U.S. patent application number 15/137955 was filed with the patent office on 2016-09-01 for stable fungal cel6 enzyme variants.
This patent application is currently assigned to California Institute of Technology. The applicant listed for this patent is California Institute of Technology. Invention is credited to Frances H. Arnold, Indira Wu.
Application Number | 20160251642 15/137955 |
Document ID | / |
Family ID | 47601727 |
Filed Date | 2016-09-01 |
United States Patent
Application |
20160251642 |
Kind Code |
A1 |
Arnold; Frances H. ; et
al. |
September 1, 2016 |
STABLE FUNGAL CEL6 ENZYME VARIANTS
Abstract
The disclosure provides variant Ce16a enzymes having increased
thermostability, methods of making and using such polypeptides.
Inventors: |
Arnold; Frances H.; (La
Canada, CA) ; Wu; Indira; (Pasadena, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
California Institute of Technology |
Pasadena |
CA |
US |
|
|
Assignee: |
California Institute of
Technology
|
Family ID: |
47601727 |
Appl. No.: |
15/137955 |
Filed: |
April 25, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13554736 |
Jul 20, 2012 |
9322007 |
|
|
15137955 |
|
|
|
|
61510914 |
Jul 22, 2011 |
|
|
|
Current U.S.
Class: |
435/209 |
Current CPC
Class: |
Y02E 50/10 20130101;
C12Y 302/01004 20130101; C12P 19/14 20130101; C12P 7/00 20130101;
Y02E 50/16 20130101; C12N 15/00 20130101; C12P 19/02 20130101; C12P
2203/00 20130101; C12Y 302/01091 20130101; C12P 7/10 20130101; C12N
9/2437 20130101 |
International
Class: |
C12N 9/42 20060101
C12N009/42 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under Grant
No. W911NF-09-D-0001 awarded by the Army Research Office. The
government has certain rights in the invention.
Claims
1. A recombinant polypeptide comprising at least 80% identity to
SEQ ID NO:4 and having one or more amino acid substitutions at
residues selected from the group consisting of N38, S54, V151,
V154, M158, C269, Q300, S316, S340, S430, and S437, and wherein the
polypeptide has cellulase activity and comprises increased
thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6,
or 8.
2. The recombinant polypeptide of claim 1, further comprising a
cellulose binding domain (CBD) operably linked to the
polypeptide.
3. The recombinant polypeptide of claim 2, wherein the CBD
comprises a sequence as set forth in SEQ ID NO:10.
4. The recombinant polypeptide of claim 1, wherein the polypeptide
comprises one or more substitutions selected from the group
consisting of N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G,
C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and
S437W.
5. The recombinant polypeptide of claim 1 comprising SEQ ID NO:4
having substitutions at a positions selected from the group
consisting of: (a) one or more residue selected from the group
consisting of N38, S54, V151, V154, C269, S316, S430 and any
combination thereof; (b) M158 and one or more additional residues
selected from the group consisting of N38, S54, V151, V154, C269,
S316, and S430; (c) Q300 and one or more additional residue
selected from the group consisting of N38, S54, V151, V154, C269,
S316, and S430; (d) S340 and one or more additional residue
selected from the group consisting of N38, S54, V151, V154, C269,
S316, and S430; and (e) S437 and one or more additional residue
selected from the group consisting of N38, S54, V151, V154, C269,
S316, and S430.
6. The recombinant polypeptide of claim 5, comprising SEQ ID NO:4
and having having substitutions selected from the group consisting
of: (a) one or more substitution selected from the group consisting
of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S,
S316R, and S430P; (b) M158L and one or more additional
substitutions selected from the group consisting of N38S, S54F,
S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P;
(c) Q300L and one or more additional substitutions selected from
the group consisting of N38S, S54F, S54M, V151A, V154E, C269A,
C269G, C269L, C269S, S316R, and S430P; (d) S340P and one or more
additional substitutions selected from the group consisting of
N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R,
and S430P; (e) S340W and one or more additional substitutions
selected from the group consisting of N38S, S54F, S54M, V151A,
V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (f) S437F and
one or more additional substitutions selected from the group
consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L,
C269S, S316R, and S430P; (g) S437P and one or more additional
substitutions selected from the group consisting of N38S, S54F,
S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P;
and (h) S437W and one or more additional substitutions selected
from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A,
C269G, C269L, C269S, S316R, and S430P.
7. A recombinant polypeptide comprising at least 80% identity to
SEQ ID NO:6 and having one or more amino acid substitutions at
residues selected from the group consisting of G37, Q53, V155,
V158, Q162, L276, I307, K323, P347, T436, and Y443, and wherein the
polypeptide has cellulase activity and comprises increased
thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6,
or 8.
8. The recombinant polypeptide of claim 7, wherein the
substitutions are selected from the group consisting of G37S, Q53F,
Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R,
P347W, T436P, Y443F, and Y443W.
9. The recombinant polypeptide of claim 7, wherein the polypeptide
comprising SEQ ID NO:6 has up to 50, 25, 10, or 5 conservative
amino acid substitutions excluding specific residues G37, Q53,
V155, V158, Q162, L276, I307, K323, P347, T436, and/or Y443,
wherein at least one or more of these specific residues have
substitutions selected form the group consisting of G37S, Q53F,
Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R,
P347W, T436P, Y443F, and Y443W.
10. The recombinant polypeptide of claim 7 comprising SEQ ID NO:6
having substitutions at a positions selected from the group
consisting of: (a) a residue selected from the group consisting of
G37, Q53, V155, V158, Q162, L276, I307, K323, P347, and T436; and
(b) Y443 and one or more additional residue selected from the group
consisting of G37, Q53, V155, V158, Q162, L276, I307, K323, P347,
and T436.
11. The recombinant polypeptide of claim 7, comprising SEQ ID NO:6
and having substitutions selected from the group consisting of: (a)
a substitution selected from the group consisting of G37S, Q53F,
Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R,
P347W, and T436P; (b) Y443F and one or more additional
substitutions selected from the group consisting of G37S, Q53F,
Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R,
P347W, T436P; and (c) Y443P and one or more additional
substitutions selected from the group consisting of G37S, Q53F,
Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R,
P347W, T436P; and (d) Y443W and one or more additional
substitutions selected from the group consisting of G37S, Q53F,
Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R,
P347W, and T436P.
12. A recombinant polypeptide comprising at least 80% identity to
SEQ ID NO:8 and having one or more amino acid substitutions at
residues selected from the group consisting of N38, L54, V155,
V158, Q162, L276, I307, R323, 5347, T436, and Y443, and wherein the
polypeptide has cellulase activity and comprises increased
thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6,
or 8.
13. The recombinant polypeptide of claim 12 comprising SEQ ID NO:8
having substitutions at a positions selected from the group
consisting of: (a) a residue selected from the group consisting of
N38, L54, V155, V158, Q162, L276, I307, R323, S347, and T436; and
(b) Y443 and one or more additional residue selected from the group
consisting N38, L54, V155, V158, Q162, L276, I307, R323, S347, and
T436.
14. The recombinant polypeptide of claim 12, comprising SEQ ID NO:8
and having having substitutions selected from the group consisting
of: (a) a residue selected from the group consisting of N38S, L54F,
L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P,
S347W, and T436P; (b) Y443F and one or more additional
substitutions selected from the group consisting N38S, L54F, L54M,
V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and
T436P; (c) Y443P and one or more additional substitutions selected
from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L,
L276A, L276G, L276S, I307L, S347P, S347W, and T436P; and (d) Y443W
and one or more additional substitutions selected from the group
consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G,
L276S, I307L, S347P, S347W, and T436P.
15. The recombinant polypeptide of claim 12, wherein the
substitutions are selected from the group consisting of N38S, L54F,
L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P,
S347W, T436P, Y443F, and Y443W.
16. The recombinant polypeptide of claim 12, wherein the
polypeptide comprising SEQ ID NO:8 has up to 50, 25, 10, or 5
conservative amino acid substitutions excluding specific residues
N38, L54, V155, V158, Q162, L276, I307, R323, S347, T436, and Y443,
wherein at least one or more of these specific residues have
substitutions selected form the group consisting of N38S, L54F,
L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P,
S347W, T436P, Y443F, and Y443W.
17. A polynucleotide encoding a polypeptide of claim 1.
18. A polynucleotide encoding a polypeptide of claim 7.
19. A polynucleotide encoding a polypeptide of claim 12.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 13/554,736, filed Jul. 20, 2012 (now U.S. Pat. No. 9,322,007),
which application claims priority under 35 U.S.C. .sctn.119 to U.S.
Provisional Application Ser. No. 61/510,914, filed, Jul. 22, 2011,
the disclosures of which are incorporated herein by reference.
TECHNICAL FIELD
[0003] The disclosure provides thermostable variants of fungal Ce16
(cellobiohydrolase II) enzymes and their use to hydrolyze
cellulose.
BACKGROUND
[0004] The performance of cellulase mixtures in biomass conversion
processes depends on many enzyme properties including stability,
product inhibition, synergy among different cellulase components,
productive binding versus nonproductive adsorption and pH
dependence, in addition to the cellulose substrate physical state
and composition. Given the multivariate nature of cellulose
hydrolysis, it is desirable to have diverse cellulases to choose
from in order to optimize enzyme formulations for different
applications and feedstocks.
SUMMARY
[0005] The disclosure provide recombinant or substantially purified
polypeptides comprising a sequence that is at least 67.7% identical
to a sequence set forth in SEQ ID NO:2, 4, 6, 8, 12, 14, 16, 18,
20, 22, 24, 26, or 28 and having cellulase activity and increased
thermostability compared to a polypeptide comprising SEQ ID NO:4,
6, or 8. In one embodiment, the recombinant or substantially
purified polypeptide comprises at least 67.7% identity (e.g., 67.7,
70, 80, 85, 90, 95, 98, 99, or 100% identity) to SEQ ID NO:2 and
having one or more amino acid substitutions at residues selected
from the group consisting of N14, S30, V128, V131, M135, C246,
Q277, S293, S317, S406, and S413, and wherein the polypeptide has
cellulase activity and comprises increased thermostability compared
to a wild-type enzyme of SEQ ID NO: 4, 6, or 8. In another
embodiment, the polypeptide comprises one or more substitutions
selected from the group consisting of N14S, S30F, S30M, V128A,
V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P,
S317W, S406P, S413F, and S413W. In yet another embodiment, the
polypeptide comprises a sequence as set forth in SEQ ID NO:4 and
wherein residues N14, S30, V128, V131, M135, C246, Q277, S293,
5317, S406, and S413 of SEQ ID NO:2 correspond to residues N38,
S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437 in
SEQ ID NO:4. In a further description, the polypeptide comprises
SEQ ID NO:4 and has one or more substitutions at a residue selected
from N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and
S437. In another embodiment, the polypeptide comprises a sequence
as set forth in SEQ ID NO:6 and wherein residues N14, S30, V128,
V131, M135, C246, Q277, S293, S317, S406, and S413 of SEQ ID NO:2
correspond to residues G37, Q53, V155, V158, Q162, L276, I307,
K323, P347, T436, and Y443 in SEQ ID NO:6. In a further
description, the polypeptide comprises SEQ ID NO:6 and has one or
more substitutions at a residue selected from G37, Q53, V155, V158,
Q162, L276, I307, K323, P347, T436, and Y443. In yet another
embodiment, the polypeptide comprises a sequence as set forth in
SEQ ID NO:8 and wherein residues N14, S30, V128, V131, M135, C246,
Q277, S293, S317, S406, and S413 of SEQ ID NO:2 correspond to
residues or N38, L54, V155, V158, Q162, L276, I307, R323, S347,
T436, and Y443 in SEQ ID NO:8. In a further description, the
polypeptide comprises SEQ ID NO:8 and has one or more substitutions
at a residue selected from N38, L54, V155, V158, Q162, L276, I307,
R323, S347, T436, and Y443. In another embodiment, the polypeptide
comprise a sequence that is at least 80%, 85%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to
the sequence as set forth in SEQ ID NO:12, 14, 16, 18, 20, 22, 24,
26, or 28. In another of the foregoing embodiments, the polypeptide
can further comprise a cellulose binding domain (CBD) operably
linked to the polypeptide. In one embodiment, the CBD comprises a
sequence as set forth in SEQ ID NO:10.
[0006] The disclosure also provides a recombinant polypeptide
comprising at least 80% identity to SEQ ID NO:6 and having one or
more substitutions at a residue selected from the group consisting
of G37, Q53, V155, V158, Q162, L276, I307, K323, P347, T436, and
Y443 and wherein the polypeptide has cellulase activity and
comprises increased thermostability compared to a wild-type enzyme
of SEQ ID NO: 4, 6, or 8. In a further embodiment, the
substitutions are selected from the group consisting of G37S, Q53F,
Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R,
P347W, T436P, Y443F, and Y443W. In yet another embodiment, the
polypeptide comprising SEQ ID NO:6 has up to 50, 25, 10, or 5
conservative amino acid substitutions excluding specific residues
G37, Q53, V155, V158, Q162, L276, I307, K323, P347, T436, and/or
Y443, wherein at least one or more of these specific residues have
substitutions selected form the group consisting of G37S, Q53F,
Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R,
P347W, T436P, Y443F, and Y443W.
[0007] The disclosure also provides a recombinant polypeptide
comprising at least 80% identity to SEQ ID NO:4 and having one or
more substitutions at a residue selected from the group consisting
of N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and
S437 and wherein the polypeptide has cellulase activity and
comprises increased thermostability compared to a wild-type enzyme
of SEQ ID NO: 4, 6, or 8. In one embodiment, the substitutions are
selected from the group consisting of N38S, S54F, S54M, V151A,
V154E, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W,
S430P, S437F, and S437W. In another embodiment, the recombinant
polypeptide comprising SEQ ID NO:6 has up to 50, 25, 10, or 5
conservative amino acid substitutions excluding specific residues
N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437,
wherein at least one or more of these specific residues have
substitutions selected form the group consisting of N38S, S54F,
S54M, V151A, V154E, C269A, C269G, C269L, C269S, Q300L, S316R,
S340P, S340W, S430P, S347F, and S427W.
[0008] The disclosure also provides a recombinant polypeptide
comprising at least 80% identity to SEQ ID NO:8 and having one or
more substitutions at a residue selected from the group consisting
of N38, L54, V155, V158, Q162, L276, I307, R323, S347, T436, and
Y443 and wherein the polypeptide has cellulase activity and
comprises increased thermostability compared to a wild-type enzyme
of SEQ ID NO: 4, 6, or 8. In one embodiment, the recombinant
polypeptide the substitutions are selected from the group
consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G,
L276S, I307L, S347P, S347W, T436P, Y443F, and Y443W. In yet another
embodiment, the polypeptide comprising SEQ ID NO:6 has up to 50,
25, 10, or 5 conservative amino acid substitutions excluding
specific residues N38, L54, V155, V158, Q162, L276, I307, R323,
S347, T436, and Y443, wherein at least one or more of these
specific residues have substitutions selected form the group
consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276G, L276A,
L276S, I307L, S347P, S347W, T436P, Y443F, and Y443W.
[0009] In certain embodiment, a recombinant polypeptide of the
disclosure comprises SEQ ID NO:2 having substitutions selected from
the group consisting of: (a) one or more substitution at a residue
selected from the group consisting of N14, S30, V128, V131, M135,
C246, Q277, S293, S317, S406 and any combination thereof; and (b) a
substitution at S413 and one or more substitutions at a residue
selected from the group consisting of N14, S30, V128, V131, M135,
C246, Q277, S293, S317, S406 and any combination thereof. In a
further embodiment, a recombinant polypeptide of the disclosure
comprises SEQ ID NO:2 having substitutions selected from the group
consisting of: (a) one or more substitutions selected from the
group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A,
C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P; (b)
S413F and one or more additional substitutions selected from the
group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A,
C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P; (c)
S413P and one or more additional substitutions selected from the
group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A,
C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P; and (d)
S413W and one or more additional substitutions selected from the
group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A,
C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P.
[0010] In certain embodiment, a recombinant polypeptide of the
disclosure comprises SEQ ID NO:4 having substitutions at a
positions selected from the group consisting of: (a) one or more
residue selected from the group consisting of N38, S54, V151, V154,
C269, S316, S430 and any combination thereof; (b) M158 and one or
more additional residues selected from the group consisting of N38,
S54, V151, V154, C269, S316, and S430; (c) Q300 and one or more
additional residue selected from the group consisting of N38, S54,
V151, V154, C269, S316, and S430; (d) S340 and one or more
additional residue selected from the group consisting of N38, S54,
V151, V154, C269, S316, and S430; and (e) S437 and one or more
additional residue selected from the group consisting of N38, S54,
V151, V154, C269, S316, and S430. In a further embodiment, a
recombinant polypeptide of the disclosure comprises SEQ ID NO:4
having substitutions selected from the group consisting of: (a) one
or more substitution selected from the group consisting of N38S,
S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and
S430P; (b) M158L and one or more additional substitutions selected
from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A,
C269G, C269L, C269S, S316R, and S430P; (c) Q300L and one or more
additional substitutions selected from the group consisting of
N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R,
and S430P; (d) S340P and one or more additional substitutions
selected from the group consisting of N38S, S54F, S54M, V151A,
V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (e) S340W and
one or more additional substitutions selected from the group
consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L,
C269S, S316R, and S430P; (f) S437F and one or more additional
substitutions selected from the group consisting of N38S, S54F,
S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P;
(g) S437P and one or more additional substitutions selected from
the group consisting of N38S, S54F, S54M, V151A, V154E, C269A,
C269G, C269L, C269S, S316R, and S430P; and (h) S437W and one or
more additional substitutions selected from the group consisting of
N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R,
and S430P.
[0011] In certain embodiment, a recombinant polypeptide of the
disclosure comprises SEQ ID NO:6 having substitutions at a
positions selected from the group consisting of: (a) a residue
selected from the group consisting of G37, Q53, V155, V158, Q162,
L276, I307, K323, P347, and T436; and (b) Y443 and one or more
additional residue selected from the group consisting of G37, Q53,
V155, V158, Q162, L276, I307, K323, P347, and T436. In a further
embodiment, a recombinant polypeptide of the disclosure comprises
SEQ ID NO:6 having substitutions selected from the group consisting
of: (a) a substitution selected from the group consisting of G37S,
Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R,
P347W, and T436P; (b) Y443F and one or more additional
substitutions selected from the group consisting of G37S, Q53F,
Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R,
P347W, T436P; and (c) Y443P and one or more additional
substitutions selected from the group consisting of G37S, Q53F,
Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R,
P347W, T436P; and (d) Y443W and one or more additional
substitutions selected from the group consisting of G37S, Q53F,
Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R,
P347W, and T436P.
[0012] In certain embodiment, a recombinant polypeptide of the
disclosure comprises SEQ ID NO:8 having substitutions at a
positions selected from the group consisting of: (a) a residue
selected from the group consisting of N38, L54, V155, V158, Q162,
L276, I307, R323, S347, and T436; and (b) Y443 and one or more
additional residue selected from the group consisting N38, L54,
V155, V158, Q162, L276, I307, R323, S347, and T436. In a further
embodiment, the recombinant polypeptide comprises SEQ ID NO:8
having substitutions selected from the group consisting of: (a) a
residue selected from the group consisting of N38S, L54F, L54M,
V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and
T436P; (b) Y443F and one or more additional substitutions selected
from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L,
L276A, L276G, L276S, I307L, S347P, S347W, and T436P; (c) Y443P and
one or more additional substitutions selected from the group
consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G,
L276S, I307L, S347P, S347W, and T436P; and (d) Y443W and one or
more additional substitutions selected from the group consisting
N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L,
S347P, S347W, and T436P.
[0013] In various embodiments of the disclosure substitutions in
SEQ ID NO:2 are as described above, but specifically exclude
substitutions at S413. In various embodiments of the disclosure
substitutions in SEQ ID NO:4 are as described above, but
specifically exclude substitutions at one or more positions
selected from the group consisting of M158, Q300, S340, S437, and
S437. In various embodiments of the disclosure substitutions in SEQ
ID NO:6 are as described above, but specifically exclude
substitutions at Y443. In various embodiments of the disclosure
substitutions in SEQ ID NO:8 are as described above, but
specifically exclude substitutions at Y443.
[0014] In any of the foregoing embodiments comprising the
substitutions above, the resulting "modified" polypeptide comprises
a polypeptide having cellulase activity and improved
thermostability compared to a wild-type enzyme comprising SEQ ID
NO:4, 6, or 8.
[0015] The disclosure also provides a polynucleotide encoding a
polypeptide of any of the foregoing embodiments.
[0016] The disclosure also provides a vector comprising a
polynucleotide described above as well as host cells comprising a
vector of the disclosure.
[0017] The disclosure also provides a host cell that expresses a
polypeptide described herein in any of the embodiments described
above.
[0018] The disclosure also provides enzymatic preparation
comprising a polypeptide of the disclosure.
[0019] The disclosure also provides a method of treating a biomass
comprising cellulose, the method comprising contacting the biomass
with a polypeptide described in any of the foregoing embodiments,
an enzymatic preparation of the disclosure, or a host cell
expressing a polypeptide of the disclosure.
BRIEF DESCRIPTION OF THE FIGURES
[0020] FIG. 1 shows alignment of Cel6a amino acid sequences from H.
insolens (SEQ ID NO:6), H. jecorina (HJ) (SEQ ID NO:4), C.
thermophilum (SEQ ID NO:8), and HJPlus (SEQ ID NO:2). Residues with
double underlining are specific residues for mutation.
[0021] FIG. 2 shows the total activity at 75.degree. C. (measured
as cellobiose equivalents released) from 3-day S. cerevisiae
culture supernatant of cultures expressing HJPlus and the top five
variants from the first generation random mutagenesis library.
[0022] FIG. 3 shows the total activity at 75.degree. C. (measured
as cellobiose equivalents released) from 3-day S. cerevisiae
culture supernatant of cultures expressing 1G6 and the top five
variants from the second generation random mutagenesis library.
[0023] FIG. 4 shows the total activity at 75.degree. C. (measured
as cellobiose equivalents released) from 3-day S. cerevisiae
culture supernatant of cultures expressing 2B3 and the top five
variants from the recombination library.
[0024] FIG. 5 shows the total activity at 75.degree. C. (measured
as cellobiose equivalents released) from 3-day S. cerevisiae
culture supernatant of cultures expressing HJPlus and the top
variant from every generation of random mutagenesis and
recombination.
[0025] FIG. 6 shows the total activity at 75.degree. C. (measured
as cellobiose equivalents released) from 3-day S. cerevisiae
culture supernatant of cultures expressing the top five variants
from the NNK libraries.
[0026] FIG. 7 shows the half-life and T.sub.50 values for HJPlus
and the best variants from each generation of random mutagenesis
and recombination.
[0027] FIG. 8 shows the residual activity of 3C6P and C246G at pH 4
(50 mM sodium citrate), pH 5 (50 mM sodium acetate), and pH 6
through 9 (50 mM sodium phosphate) after 15-minute thermal
inactivation; the data were modeled with sigmoidal functions.
[0028] FIG. 9 shows the half-lives of C246G at 90.degree. C. at
various pH values (pH 4 (50 mM sodium citrate), pH 5 (50 mM sodium
acetate), and pH 6 through 9 (50 mM sodium phosphate)).
[0029] FIG. 10 shows 2-hour activity of 3C6P and C246G at
80.degree. C. and 4-hour activity at 90.degree. C. (measured as
cellobiose equivalents released) at various pH conditions (pH 4 (50
mM sodium citrate), pH 5 (50 mM sodium acetate), and pH 6 through 9
(50 mM sodium phosphate)).
[0030] FIG. 11 shows the effects of different mutations at residue
C246 on the residual activity of the engineered Ce16s. Purified
enzymes were inactivated at 50 mM sodium phosphate, pH 7.0 for 15
minutes before assayed for activities with 30 mg/mL of Avicel. The
activity was measured as the amount of cellobiose released after
2-hour incubation at 50.degree. C.
[0031] FIG. 12 shows the residual activity of H. jecorina Ce16a and
HJ C269G at pH 4 (50 mM sodium citrate), pH 5 (50 mM sodium
acetate), and pH 6 through 9 (50 mM sodium phosphate) after
15-minute thermal inactivation; the data were modeled with
sigmoidal functions.
[0032] FIG. 13 shows the residual activity of H. insolens Ce16a and
HI L276G at pH 4 (50 mM sodium citrate), pH 5 (50 mM sodium
acetate), and pH 6 through 9 (50 mM sodium phosphate) after
15-minute thermal inactivation; the data were modeled with
sigmoidal functions.
[0033] FIG. 14 shows 2-hour activity of H. jecorina (HJ) Ce16a, HJ
with S54F mutation, HJ with S316R mutation, and HJ with S430P
mutation at 50.degree. C. and 60.degree. C. (measured as cellobiose
equivalents released) at 50 mM sodium acetate buffer, pH 5.0.
DETAILED DESCRIPTION
[0034] As used herein and in the appended claims, the singular
forms "a," "and," and "the" include plural referents unless the
context clearly dictates otherwise. Thus, for example, reference to
"a Ce16 enzyme" includes a plurality of such enzymes and reference
to "the protein" includes reference to one or more proteins, and so
forth.
[0035] Also, the use of "or" means "and/or" unless stated
otherwise. Similarly, "comprise," "comprises," "comprising"
"include," "includes," and "including" are interchangeable and not
intended to be limiting.
[0036] It is to be further understood that where descriptions of
various embodiments use the term "comprising," those skilled in the
art would understand that in some specific instances, an embodiment
can be alternatively described using language "consisting
essentially of" or "consisting of."
[0037] Although methods and materials similar or equivalent to
those described herein can be used in the practice of the disclosed
methods and compositions, the exemplary methods, devices and
materials are described herein.
[0038] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood to one of
ordinary skill in the art to which this disclosure belongs. Thus,
as used throughout the instant application, the following terms
shall have the following meanings.
[0039] Cellulose is the main structural component of most plant
cell walls, making it the most abundant biopolymer on earth.
Cellulose is a polysaccharide composed of glucosyl units linked
together by .beta.-1,4 glycosidic bonds. The .beta.-linkage ensures
that the subunits rotate 180.degree. every two glucose subunits
along the cellulose chain. The rotation makes the cellulose chains
straight and highly symmetrical. X-ray diffraction and nuclear
magnetic resonance studies have shown that cellulose chains form
extensive intramolecular and intermolecular hydrogen bonds between
the hydroxyl groups and the oxygen in the pyranose ring, producing
crystalline elementary fibrils with strong tensile strength and low
accessibility. The extensive hydrogen bonding makes cellulose a
very recalcitrant material, with a half-life of over four million
years from spontaneous hydrolysis at 25.degree. C. Despite this
recalcitrance, nature has provided several enzyme solutions capable
of hydrolyzing cellulose into a form that can be utilized by
microorganisms as a source of carbon and energy.
[0040] Recent studies have documented the superior performance of
cellulases from thermophilic fungi relative to their mesophilic
counterparts in laboratory scale biomass conversion processes,
where enhanced stability leads to retention of activity over longer
periods of time at both moderate and elevated temperatures. Fungal
cellulases are attractive because they are highly active and can be
expressed in fungal hosts such as Hypocrea jecorina (anamorph
Trichoderma reesei) at levels up to 40 g/L in the supernatant.
Unfortunately, the set of documented thermostable fungal cellulases
is small. In the case of the processive cellobiohydrolase class II
(CBH II) enzymes, fewer than 10 natural thermostable gene sequences
are annotated in the CAZy database.
[0041] Fungal cellulases are important in industrial applications,
from cotton softening in the textile industries to biofuel
production in biorefineries. Specifically, cellulases are used in
biorefineries to break down cellulosic biomass into fermentable
sugars, from which biofuels and higher-value chemicals can be
derived. For cellulosic biomass to become a feasible feedstock for
transportation fuels and chemicals, the cost of production needs to
be competitive with the current technology of producing them from
fossil fuels. Thermostable cellulases are particularly interesting
for biomass degradation for several reasons. Thermostable
cellulases tend to be more stable during production, storage and
over a range of temperatures and operating conditions. Thermostable
enzymes are more resilient towards relatively harsh industrial
treatments and conditions. They also can be used to hydrolyze
cellulose at higher temperatures, where the enzymes can access the
substrate and catalyze their reactions at a higher rate--assuming
that the reaction temperature is lower than the denaturing
temperature for the enzyme. The risk of contamination by
microorganisms is also reduced at elevated temperatures, as is the
viscosity of hydrolysis mixtures, which lowers process costs.
[0042] The mesophilic fungus Hypocrea jecorina (anamorph
Trichoderma reesei) secretes an array of cellulose enzymes that
work synergistically to degrade the cellulose to smaller oligomers
and eventually to glucose. This fungus' collection of cellulases
includes at least five endoglucanases (EGI-V), two
cellobiohydrolases (Ce16a, Ce17a), .beta.-glucosidases, and
hemicellulases. In Hypocrea jecorina, cellobiohydrolase Ce17a,
Ce16a, and EGII comprise 60.+-.5%, 20.+-.6%, and 12.+-.3% of total
cellulase protein, respectively. All three cellulases consist of a
cellulose-binding domain (CBD) and a catalytic domain connected by
a glycosylated peptide linker. Cellobiose is the primary product of
cellulose hydrolysis by cellobiohydrolases Ce16a and Ce17a.
[0043] Recently, the creation of a collection of thermostable
Family 6 fungal cellobiohydrolases (Ce16) using structure-guided
SCHEMA recombination was reported. The genes encoding the Ce16a
from Humicola insolens, Hypocrea jecorina, and Chaetomium
thermophilum were divided into eight blocks and recombined to
create new, chimeric Ce16a enzymes. The block boundaries were
identified using computational tools that allowed the number of
disrupted side-chain contacts to be minimized, relative to the
average number of mutations in the resulting chimeric proteins.
Based on activity and stability data obtained from the enzymes
encoded by the 48 genes that were sampled (from the 6,561 possible
chimeric sequences), linear regression models were built to
determine how each sequence block contributes to the
thermostability of a chimeric Ce16a enzyme. The four stabilizing
blocks were introduced in the cellobiohydrolase of H. jecorina to
create the "HJPlus" chimera 12222332 (described in US Patent
Publication No. 2010/0304464-A1, incorporated herein by reference),
which is stable for more than 12 hours at 63.degree. C. and is also
secreted at relatively high levels in S. cerevisiae. In this
disclosure, HJPlus was used as the platform for further protein
engineering efforts to improve the enzyme properties relevant to
optimizing cellulose hydrolysis, most notably thermostability,
substrate binding, and cellulose activity. Further improving the
thermostability of HJPlus not only pushes the limit of enzyme
stability but also allows the discovery of mutations that might not
have appeared at lower temperatures because they are not beneficial
at lower temperatures. The disclosure also provides a method that
allows high throughput screening on microcrystalline cellulose,
Avicel, to identify useful mutations.
[0044] The disclosure provides modified Family 6 cellulases (Ce16a)
that exhibit enhanced activity, thermostability, substrate binding,
and/or expression in S. cerevisiae. The disclosure also provides
genetic constructs that encode the modified Ce16a enzymes and the
methods for mutating, deriving, and producing the modified Ce16a
enzymes from yeast and fungal expression strains. The disclosure
also provides use of the modified Ce16a enzymes in the hydrolysis
of cellulose or cellulosic biomass and the production of biofuels
from fermentable sugars and alcohols, as well as other industrial
applications of cellulases.
[0045] As will be described in more detail below, the disclosure is
based, at least in part, on the generation and expression of novel
enzymes that catalyze the degradation of cellulose. In one
embodiment, novel polypeptides that have been engineered/modified
to degrade cellulose are provided. Such polypeptides include Ce16a
variants that have been altered to include amino acid substitutions
at specified residues as well as properties that include increased
thermostability compared to wild-type Ce16a enzymes.
[0046] While these variants will be described in more detail below,
it is understood that polypeptides of the disclosure contain one or
more modified amino acids. The presence of modified amino acids are
advantageous in, for example, (a) increasing polypeptide in vivo
half-life, activity or thermostability, (b) reducing or increasing
polypeptide antigenicity, and (c) increasing polypeptide storage
stability. Amino acid(s) are modified, for example,
co-translationally or post-translationally during recombinant
production (e.g., N-linked glycosylation at N-X-S/T motifs during
expression in mammalian cells) or modified by synthetic means.
Accordingly, A "mutant", "variant" or "modified" protein,
polypeptide, enzyme, polynucleotide, gene, or cell, means a
protein, polypeptide, enzyme, polynucleotide, gene, or cell, that
has been altered or derived, or is in some way different or
changed, from a parent protein, polypeptide, enzyme,
polynucleotide, gene, or cell. A mutant or modified protein or
enzyme is usually, although not necessarily, expressed from a
mutant polynucleotide or gene.
[0047] "Conservative amino acid substitution" or, simply,
"conservative variations" of a particular sequence refers to the
replacement of one amino acid, or series of amino acids, with
essentially identical amino acid sequences. One of skill will
recognize that individual substitutions, deletions or additions
which alter, add or delete a single amino acid or a percentage of
amino acids in an encoded sequence result in "conservative
variations" where the alterations result in the deletion of an
amino acid, addition of an amino acid, or substitution of an amino
acid with a chemically similar amino acid.
[0048] Conservative substitution tables providing functionally
similar amino acids are well known in the art. For example, one
conservative substitution group includes Alanine (A), Serine (S),
and Threonine (T). Another conservative substitution group includes
Aspartic acid (D) and Glutamic acid (E). Another conservative
substitution group includes Asparagine (N) and Glutamine (Q). Yet
another conservative substitution group includes Arginine (R) and
Lysine (K). Another conservative substitution group includes
Isoleucine, (I) Leucine (L), Methionine (M), and Valine (V).
Another conservative substitution group includes Phenylalanine (F),
Tyrosine (Y), and Tryptophan (W).
[0049] Thus, "conservative amino acid substitutions" of a listed
polypeptide sequence of the disclosure include substitutions of a
percentage, typically less than 10%, of the amino acids of the
polypeptide sequence, with a conservatively selected amino acid of
the same conservative substitution group. Accordingly, a
conservatively substituted variation of a polypeptide of the
invention can contain 100, 75, 50, 25, or 10 substitutions with a
conservatively substituted variation of the same conservative
substitution group.
[0050] It is understood that the addition of sequences which do not
alter the encoded activity of a nucleic acid molecule, such as the
addition of a non-functional or non-coding sequence, is a
conservative variation of the basic nucleic acid. The "activity" of
an enzyme is a measure of its ability to catalyze a reaction, i.e.,
to "function", and may be expressed as the rate at which the
product of the reaction is produced. For example, enzyme activity
can be represented as the amount of product produced per unit of
time or per unit of enzyme (e.g., concentration or weight), or in
terms of affinity or dissociation constants. As used
interchangeably herein a "Ce16a activity", "biological activity of
Ce16a" or "functional activity of Ce16a", refers to an activity
exerted by a Ce16a, Ce16a polypeptide, or a polypeptide having
Ce16a activity on a Ce16a polypeptide substrate, as determined in
vitro, according to standard techniques (as described below). Such
Ce16a activity can be characterized as the rate of breakdown of
cellulose or other organic polymeric sugar composition.
[0051] "Conservative variants" are proteins or enzymes in which a
given amino acid residue has been changed without altering overall
conformation and function of the protein or enzyme, including, but
not limited to, replacement of an amino acid with one having
similar properties, including polar or non-polar character, size,
shape and charge. Amino acids other than those indicated as
conserved may differ in a protein or enzyme so that the percent
protein or amino acid sequence similarity between any two proteins
of similar function may vary and can be, for example, at least 30%,
at least 50%, at least 70%, at least 80%, at least 90%, at least
95%, at least 98% or at least 99%, as determined according to an
alignment scheme. As referred to herein, "sequence similarity"
means the extent to which nucleotide or protein sequences are
related. The extent of similarity between two sequences can be
based on percent sequence identity and/or conservation. "Sequence
identity" herein means the extent to which two nucleotide or amino
acid sequences are invariant. "Sequence alignment" means the
process of lining up two or more sequences to achieve maximal
levels of identity (and, in the case of amino acid sequences,
conservation) for the purpose of assessing the degree of
similarity. Numerous methods for aligning sequences and assessing
similarity/identity are known in the art such as, for example, the
Cluster Method, wherein similarity is based on the MEGALIGN
algorithm, as well as BLASTN, BLASTP, and FASTA (Lipman and
Pearson, 1985; Pearson and Lipman, 1988). When using all of these
programs, the preferred settings are those that results in the
highest sequence similarity. For example, an commonly used on-line
algorithm can be found at http:(//)web.expasy.org/sim/ and the
default parameters used (e.g., gap open penalty of 12, gap
extension penalty of 4 and the comparison Matrix being BLOSUM62).
Using the immediately foregoing algorithm "SIM" (Huang et al.,
Advances in Applied Mathematics, vol. 12 (1991), pp. 337-357), the
percent identity between SEQ ID NO:2 and SEQ ID NO:6 is 67.7%.
[0052] Non-conservative modifications of a particular polypeptide
are those which substitute any amino acid not characterized as a
conservative substitution. For example, any substitution which
crosses the bounds of the six groups set forth above. These include
substitutions of basic or acidic amino acids for neutral amino
acids, (e.g., Asp, Glu, Asn, or Gln for Val, Ile, Leu or Met),
aromatic amino acid for basic or acidic amino acids (e.g., Phe, Tyr
or Trp for Asp, Asn, Glu or Gln) or any other substitution not
replacing an amino acid with a like amino acid. Basic side chains
include lysine (K), arginine (R), histidine (H); acidic side chains
include aspartic acid (D), glutamic acid (E); uncharged polar side
chains include glycine (G), asparagine(N), glutamine (Q), serine
(S), threonine (T), tyrosine (Y), cysteine (C); nonpolar side
chains include alanine (A), valine (V), leucine (L), isoleucine
(I), proline (P), phenylalanine (F), methionine (M), tryptophan
(W); beta-branched side chains include threonine (T), valine (V),
isoleucine (I); aromatic side chains include tyrosine (Y),
phenylalanine (F), tryptophan (W), histidine (H).
[0053] Accordingly, some amino acid residues at specific positions
in a polypeptide are "excluded" from conservative amino acid
substitutions. Instead, these restricted or "specific" amino acids
are generally chosen from a particular group of amino acids or a
specific amino acid to be substituted at that position. These amino
acid residues can be substituted at a designated position to obtain
a modified or variant polypeptide. While some overlap may occur,
the members substituted at these specific positions are not
"conservative amino acid substitutions" as defined above. In
general, these mutations represent non-conservative substitutions
at the indicated position in the designated sequence. For example,
as described more fully below the substitution at position 14 of,
e.g., SEQ ID NO:2 (see FIG. 1), replaces Asn or Gly with Ser. This
substitution is generally not considered a "conservative"
substitution. Similar substitutions are made throughout the various
sequences at the indicated positions in order to modify the
activity of the polypeptide.
[0054] A "mutation" means any process or mechanism resulting in a
mutant protein, enzyme, polynucleotide, gene, or cell. This
includes any mutation in which a protein, enzyme, polynucleotide,
or gene sequence is altered, and any detectable change in a cell
arising from such a mutation. Typically, a mutation occurs in a
polynucleotide or gene sequence, by point mutations, deletions, or
insertions of single or multiple nucleotide residues. A mutation
includes polynucleotide alterations arising within a
protein-encoding region of a gene as well as alterations in regions
outside of a protein-encoding sequence, such as, but not limited
to, regulatory or promoter sequences. A mutation in a gene can be
"silent", i.e., not reflected in an amino acid alteration upon
expression, leading to a "sequence-conservative" variant of the
gene. This generally arises when one amino acid corresponds to more
than one codon.
[0055] A "parent" protein, enzyme, polynucleotide, gene, or cell,
is any protein, enzyme, polynucleotide, gene, or cell, from which
any other protein, enzyme, polynucleotide, gene, or cell, is
derived or made, using any methods, tools or techniques, and
whether or not the parent is itself native or mutant. A parent
polynucleotide or gene encodes for a parent protein or enzyme.
Exemplary parent polynucleotides and polypeptides include, for
example, SEQ ID NO:3, 5, and 7 and SEQ ID NO: 4, 6, and 8,
respectively.
[0056] A "protein" or "polypeptide", which terms are used
interchangeably herein, comprises one or more chains of chemical
building blocks called amino acids that are linked together by
chemical bonds called peptide bonds. An "enzyme" means any
substance, composed wholly or largely of protein, that catalyzes or
promotes, more or less specifically, one or more chemical or
biochemical reactions. A "native" or "wild-type" protein, enzyme,
polynucleotide, gene, or cell, means a protein, enzyme,
polynucleotide, gene, or cell that occurs in nature. In some
embodiments of the disclosure proteins or protein sequences are
presented that are not fully "native". For example, in certain
aspect of the disclosure the catalytic domains of the respective
enzymes are native, but they further comprise a cellulose binding
domain and linker from H. jecorina, which results in a protein that
is not native to, for example, H. insolens and C. thermophilum.
[0057] A polynucleotide, polypeptide, or other component is
"isolated" when it is partially or completely separated from
components with which it is normally associated (other proteins,
nucleic acids, cells, synthetic reagents, etc.). A nucleic acid or
polypeptide is "recombinant" when it is artificial or engineered,
or derived from an artificial or engineered protein or nucleic
acid. For example, a polynucleotide that is inserted into a vector
or any other heterologous location, e.g., in a genome of a
recombinant organism, such that it is not associated with
nucleotide sequences that normally flank the polynucleotide as it
is found in nature is a recombinant polynucleotide. A protein
expressed in vitro or in vivo from a recombinant polynucleotide is
an example of a recombinant polypeptide. Likewise, a polynucleotide
sequence that does not appear in nature, for example a variant of a
naturally occurring gene, is recombinant. For example, an
"isolated" nucleic acid molecule is one which is separated from
other nucleic acid molecules which are present in the natural
source of the nucleic acid. For example, with regards to genomic
DNA, the term "isolated" includes nucleic acid molecules which are
separated from the chromosome with which the genomic DNA is
naturally associated. Typically, an "isolated" nucleic acid is free
of sequences which naturally flank the nucleic acid (i.e.,
sequences located at the 5' and 3' ends of the nucleic acid) in the
genomic DNA of the organism from which the nucleic acid is derived.
For example, in various embodiments, the isolated nucleic acid
molecule can contain less than about 5 kb, 4kb, 3kb, 2kb, 1 kb, 0.5
kb or 0.1 kb of nucleotide sequences which naturally flank the
nucleic acid molecule in genomic DNA of the cell from which the
nucleic acid is derived. Moreover, an "isolated" nucleic acid
molecule, such as a cDNA molecule, can be substantially free of
other cellular material, or culture medium when produced by
recombinant techniques, or substantially free of chemical
precursors or other chemicals when chemically synthesized.
[0058] "Sequence identity" herein means the extent to which two
nucleotide or amino acid sequences are invariant. "Sequence
alignment" means the process of lining up two or more sequences to
achieve maximal levels of identity (and, in the case of amino acid
sequences, conservation) for the purpose of assessing the degree of
similarity. Numerous methods for aligning sequences and assessing
similarity/identity are known in the art such as, for example, the
Cluster Method, wherein similarity is based on the MEGALIGN
algorithm, as well as BLASTN, BLASTP, and FASTA (Lipman and
Pearson, 1985; Pearson and Lipman, 1988). When using all of these
programs, the preferred settings are those that results in the
highest sequence similarity. For example, the "identity" or
"percent identity" with respect to a particular pair of aligned
amino acid sequences can refer to the percent amino acid sequence
identity that is obtained by ClustalW analysis (version W 1.8
available from European Bioinformatics Institute, Cambridge, UK),
counting the number of identical matches in the alignment and
dividing such number of identical matches by the greater of (i) the
length of the aligned sequences, and (ii) 96, and using the
following default ClustalW parameters to achieve slow/accurate
pairwise alignments--Gap Open Penalty: 10; Gap Extension Penalty:
0.10; Protein weight matrix: Gonnet series; DNA weight matrix: IUB;
Toggle Slow/Fast pairwise alignments=SLOW or FULL Alignment.
[0059] Two sequences are "optimally aligned" when they are aligned
for similarity scoring using a defined amino acid substitution
matrix (e.g., BLOSUM62), gap existence penalty and gap extension
penalty so as to arrive at the highest score possible for that pair
of sequences. Amino acid substitution matrices and their use in
quantifying the similarity between two sequences are well-known in
the art and described, e.g., in Dayhoff et al. (1978) "A model of
evolutionary change in proteins" in "Atlas of Protein Sequence and
Structure," Vol. 5, Suppl. 3 (ed. M. 0. Dayhoff), pp. 345-352.
Natl. Biomed. Res. Found., Washington, D.C. and Henikoffet al.
(1992) Proc. Nat'l. Acad. Sci. USA 89: 10915-10919 (each of which
is incorporated by reference). The BLOSUM62 matrix (FIG. 10) is
often used as a default scoring substitution matrix in sequence
alignment protocols such as Gapped BLAST 2.0. The gap existence
penalty is imposed for the introduction of a single amino acid gap
in one of the aligned sequences, and the gap extension penalty is
imposed for each additional empty amino acid position inserted into
an already opened gap. The alignment is defined by the amino acids
positions of each sequence at which the alignment begins and ends,
and optionally by the insertion of a gap or multiple gaps in one or
both sequences so as to arrive at the highest possible score. While
optimal alignment and scoring can be accomplished manually, the
process is facilitated by the use of a computer-implemented
alignment algorithm, e.g., gapped BLAST 2.0, described in Altschul
et al. (1997) Nucl. Acids Res. 25: 3389-3402 (incorporated by
reference herein), and made available to the public at the National
Center for Biotechnology Information (NCBI) Website
(www.ncbi.nlm.nih.gov). Optimal alignments, including multiple
alignments, can be prepared using, e.g., PSI-BLAST, available
through the NCB1 website and described by Altschul et al. (1997)
Nucl. Acids Res. 25:3389-3402 (incorporated by reference
herein).
[0060] With respect to an amino acid sequence that is optimally
aligned with a reference sequence, an amino acid residue
"corresponds to" the position in the reference sequence with which
the residue is paired in the alignment. The "position" is denoted
by a number that sequentially identifies each amino acid in the
reference sequence based on its position relative to the
N-terminus. For example, in SEQ ID NO:2, position 14 is N, position
15 is W, position 16 is S, etc. When a test sequence is optimally
aligned with SEQ ID NO:2, a residue in the test sequence that
aligns with the W at position 16 is said to "correspond to position
16" of SEQ ID NO:2. Owing to deletions, insertion, truncations,
fusions, etc., that must be taken into account when determining an
optimal alignment, in general the amino acid residue number in a
test sequence as determined by simply counting from the N-terminal
will not necessarily be the same as the number of its corresponding
position in the reference sequence. For example, in a case where
there is a deletion in an aligned test sequence, there will be no
amino acid that corresponds to a position in the reference sequence
at the site of deletion. Where there is an insertion in an aligned
reference sequence, that insertion will not correspond to any amino
acid position in the reference sequence. In the case of truncations
or fusions there can be stretches of amino acids in either the
reference or aligned sequence that do not correspond to any amino
acid in the corresponding sequence.
[0061] By "cellulase activity" means an enzyme that is capable of
hydrolyzing cellulose. Cellulase refers to a class of enzymes
produced by fungi, bacteria, and protozoans that catalyze the
hydrolysis of cellulose. However, there are also cellulases
produced by other types of organisms such as plants and animals.
The EC number for this group of enzymes is EC 3.2.1.4. There are
five general types of cellulases based on the type of reaction
catalyzed: endo-cellulase; exo-cellulase, within this category
there are two main types of exo-cellulases (or cellobiohydrolases,
abbreviate CBH)--one type working processively from the reducing
end, and one type working processively from the non-reducing end of
cellulose; cellobiase or beta-glucosidase hydrolyses; oxidative
cellulases; and cellulose phosphorylases that depolymerize
cellulose using phosphates instead of water. Most fungal cellulases
have two-domains: a catalytic domain and a cellulose binding domain
that are connected by a flexible linker. In specific embodiments of
the disclosure the cellulase activity is a Ce16a activity. The
sequences described herein include, in some instances, both the
cellulose binding domain and the catalytic domain or just the
catalytic domain. In such instances where only the catalytic domain
sequence is provided it will be recognized that a cellulose binding
domain (CBD) such as that provided in SEQ ID NO:10, may be
functional linked (either as part of the coding sequence or fused
later) to the catalytic domain either directly or through a
linker.
[0062] As used herein a "modified" or "thermostable" Ce16a variant
refers to a polypeptide as described in more detail below that
comprises at least 67.7% identity (e.g., 67.7, 70, 80, 90, 95, 98,
99% identity) to SEQ ID NO:2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24,
26 or 28 and which has at least one specific mutation as set forth
below. A specific mutation refers to a one or more substitutions at
N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and/or
S413 in HJPlus (SEQ ID NO:2); N38, S54, V151, V154, M158, C269,
Q300, S316, S340, S430, and/or S437 in Ce16a enzyme from Hypocrea
jecorina (SEQ ID NO:4); G37, Q53, V155, V158, Q162, L276, I307,
K323, P347, T436, and/or Y443 in Ce16a enzyme from Humicola
insolens (SEQ ID NO:6); or N38, L54, V155, V158, Q162, L276, I307,
R323, S347, T436, and/or Y443 in Ce16a enzyme from Chaetomium
thermophilum (SEQ ID NO:8), and wherein the modified or
thermostable variant comprises increased thermostability or
activity compared to a wild-type protein of SEQ ID NO:4, 6, or
8.
[0063] Referring to the sequence comparison of various Cel6a
polypeptides in FIG. 1, SEQ ID NO:2 includes the amino acid
sequence HJplus. SEQ ID NO:4 provides the amino acid sequence of
wild-type Ce16a from Hypocrea jecorina (including a signal domain
residues 1-24) and shares amino acid sequence identity to HJPlus
(SEQ ID NO:2). SEQ ID NO:6 includes the amino acid sequence of
Ce16a (including a signal domain residues 1-23) from Humicola
insolens. This wild-type Cel6a shares % amino acid sequence
identity to the Cel6a of Hypocrea jecorina (SEQ ID NO:4) as well as
the HJplus polypeptide of SEQ ID NO:2. SEQ ID NO:8 includes the
amino acid sequence of wild-type Cel6a (including a signal domain
residues 1-24) from Chaetomium thermophilum and shares amino acid
sequence identity to SEQ ID NO:2, 4, and 6.
[0064] The polypeptides of FIG. 1 (SEQ ID Nos:2, 4, 6, and 8) are
closely related to one another and show a high degree of sequence
identity. The sequences can be aligned based on the sequence
homology. The alignment provided in FIG. 1 identifies "equivalent
positions" in the sequences. An equivalent position denotes a
position which, on the basis of the alignment of the sequence of
the parent polypeptides in question with the "reference" Ce16a
amino acid sequence in question (e.g. SEQ ID NO:2) so as to achieve
juxtapositioning of amino acid residues which are common to both,
corresponds most closely to a particular position in the reference
sequence in question. This process can cause gaps or insertions to
appear in the sequences. In the alignment of FIGS. 1, equivalent
positions are shown lined up vertically with one another. For
example, position 14 in SEQ ID NO: 2 is equivalent to position 38,
37, and 38 in SEQ ID NO: 4, 6, and 8, respectively.
[0065] In one embodiment, the disclosure provides a modified Ce16a
enzyme comprising amino acid substitution(s) at one or more
residues selected from N14, S30, V128, V131, M135, C246, Q277,
S293, S317, S406, and/or S413 in HJPlus (SEQ ID NO:2), wherein the
modified Ce16a comprises increased thermostability and cellulase
activity. In one specific embodiment, the disclosure encompasses a
variant Ce16a enzyme, wherein said enzyme comprises specific amino
acid substitution(s) at one or more of the residues N14S, S30F,
S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L,
S293R, S317P, S317W, S406P, S413F, and/or S413W in HJPlus (SEQ ID
NO:2). Accordingly, in various embodiments, isolated or recombinant
polypeptides comprising the amino acid sequence set forth in SEQ ID
NO:2 having up to 50, 25, 10, or 5 conservative amino acid
substitutions excluding specific residues N14, S30, V128, V131,
M135, C246, Q277, S293, S317, S406, and/or S413, wherein at least
one or more of these specific residues have substitutions selected
form the group consisting of N14S, S30F, S30M, V128A, V131E, M135L,
C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, S406P,
S413F, and/or S413W. In another embodiment, the disclosure provides
polypeptides that have at least 80%, 85%, 90%, 95%, 98%, 99% or
100% sequence identity to SEQ ID NO:12, 14, 16, 18, 20, 22, 24, 26,
or 28, wherein the polypeptide comprises cellulase activity and has
increased thermostability compared to SEQ ID NO:2, 4, 6, or 8.
[0066] In one embodiment, the disclosure provides modified Ce16a
enzymes derived from amino acid substitution(s) at one or more
residues G37, Q53, V155, V158, Q162, L276, I307, K323, P347, T436,
and/or Y443 in Ce16a enzyme from Humicola insolens (SEQ ID NO:6),
from which HJPlus is derived), wherein the modified Ce16a comprises
increased thermostability and cellulase activity. The residue
position(s) can further be identified by reference to the residues
of SEQ ID NO:2 and FIG. 1. In one specific embodiment, the
disclosure encompasses a variant Ce16a enzyme, wherein said enzyme
comprises amino acid substitution(s) at one or more of the residues
G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L,
K323R, P347W, T436P, Y443F, and/or Y443W in in Ce16a enzyme from
Humicola insolens (SEQ ID NO:6), from which HJPlus is derived.
Accordingly, in various embodiments, isolated or recombinant
polypeptides comprising the amino acid sequence set forth in SEQ ID
NO:6 having up to 50, 25, 10, or 5 conservative amino acid
substitutions excluding specific residues G37, Q53, V155, V158,
Q162, L276, I307, K323, P347, T436, and/or Y443, wherein at least
one or more of these specific residues have substitutions selected
form the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L,
L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and/or
Y443W. In any of the foregoing embodiments, the polypeptide of SEQ
ID NO:6 can lack the leader sequence and comprises amino acid
24-476 of SEQ ID NO:6 and having the foregoing substitutions.
[0067] In one embodiment, the disclosure provides a modified Cel6a
enzymes derived from amino acid substitution(s) at one or more
residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430,
and/or S437 in Ce16a enzyme from Hypocrea jecorina (SEQ ID NO:4),
from which HJPlus is derived), wherein the modified Ce16a comprises
increased thermostability and cellulase activity. The residue
position(s) can further be identified by reference to the residues
of SEQ ID NO:2 and FIG. 1. In one specific embodiment, the
invention encompasses a variant Ce16a enzyme, wherein said enzyme
comprises amino acid substitution(s) at one or more of the residues
N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, Q300L,
S316R, S340P, S340W, S430P, S437F, and/or S437W in in Ce16a enzyme
from Hypocrea jecorina (SEQ ID NO:4), from which HJPlus is derived.
Accordingly, in various embodiments, isolated or recombinant
polypeptides comprising the amino acid sequence set forth in SEQ ID
NO:4 having up to 50, 25, 10, or 5 conservative amino acid
substitutions excluding specific residues N38, S54, V151, V154,
M158, C269, Q300, S316, S340, S430, and/or S437, wherein at least
one or more of these specific residues have substitutions selected
form the group consisting of N38S, S54F, S54M, V151A, V154E, M158L,
C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P,
S437F, and/or S437W. In any of the foregoing embodiments, the
polypeptide of SEQ ID NO:4 can lack the leader sequence and
comprises amino acid 25-471 of SEQ ID NO:4 and having the foregoing
substitutions.
[0068] In one embodiment, the disclosure provides a modified Ce16a
enzymes derived from amino acid substitution(s) at one or more
residues N38, L54, V155, V158, Q162, L276, I307, R323, S347, T436,
and/or Y443 in Ce16a enzyme from Chaetomium thermophilum (SEQ ID
NO:8), from which HJPlus is derived), wherein the modified Ce16a
comprises increased thermostability and cellulase activity. The
residue position(s) can further be identified by reference to the
residues of SEQ ID NO:2 and FIG. 1. In one specific embodiment, the
disclosure encompasses a variant Ce16a enzyme, wherein said enzyme
comprises amino acid substitution(s) at one or more of the residues
N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L,
S347P, S347W, T436P, Y443F, and/or Y443W in in Ce16a enzyme from
Chaetomium thermophilum (SEQ ID NO:8), from which HJPlus is
derived. Accordingly, in various embodiments, isolated or
recombinant polypeptides comprising the amino acid sequence set
forth in SEQ ID NO:8 having up to 50, 25, 10, or 5 conservative
amino acid substitutions excluding specific residues N38, L54,
V155, V158, Q162, L276, I307, R323, S347, T436, and/or Y443,
wherein at least one or more of these specific residues have
substitutions selected form the group consisting of N38S, L54F,
L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P,
S347W, T436P, Y443F, and/or Y443W. In any of the foregoing
embodiments, the polypeptide of SEQ ID NO:8 can lack the leader
sequence and comprises amino acid 25-476 of SEQ ID NO:8 and having
the foregoing substitutions.
[0069] In one embodiment, the disclosure provides modified Family 6
cellulases derived from amino acid substitution at one or more
residues corresponding to N14, S30, V128, V131, M135, C246, Q277,
S293, S317, S406, and/or S413 of SEQ ID NO:2. The residue
position(s) in related Ce16a's can be identified by reference to
FIG. 1. In one specific embodiment, the disclosure encompasses a
variant Family 6 cellulase, wherein said enzyme comprises amino
acid substitution at one or more of the residues corresponding to
N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S,
Q277L, S293R, S317P, S317W, S406P, S413F, and/or S413W of SEQ ID
NO:2 (see, e.g., FIG. 1). Examples of Family 6 cellulases include,
but are limited to, Humicola insolens Ce16a, Hypocrea jecorina
Ce16a, Chaetomium thermophilum Ce16a, Phanerochaete chrysosporium
Ce16a, Thermobifida fusca Ce16a and Ce16b, Cellulomonas fimi Ce16a
and Ce16b, Talaromyces emersonii CBHII, Penicillium decumbens
Ce16a, or variants derived from wild-type Family 6 cellulases
mentioned above.
[0070] In other embodiments of the disclosure polypeptides
comprising at least 67.7% or more (e.g., 80%, 85%, 90%, 95%, 98%,
or 99%) identity to SEQ ID NO:2 and having any combination of the
following amino acids S14, F30, M30, A128, E131, L135, A246, G246,
L246, S246, L277, R293, P317, W317, P406, F413, and/or W413 and
having Ce16a activity is provided.
[0071] In other embodiments of the disclosure polypeptides
comprising at least 80%, 85%, 90%, 95%, 98%, or 99% identity to SEQ
ID NO:4 and having any combination of the following amino acids
S38, F54, M54, A151, E154, L158, A269, G269, L269, S269, L300,
R316, P340, W340, P430, F437, and/or W437 and having Ce16a activity
is provided.
[0072] In other embodiments of the disclosure polypeptides
comprising at least 80%, 85%, 90%, 95%, 98%, or 99% identity to SEQ
ID NO:6 and having any combination of the following amino acids
S37, F53, M53, A155, E158, L162, A276, G276, S276, L307, R323,
P347, W347, P436, F443, and/or W443 and having Ce16a activity is
provided.
[0073] In other embodiments of the disclosure polypeptides
comprising at least 80%, 85%, 90%, 95%, 98%, or 99% identity to SEQ
ID NO:8 and having any combination of the following amino acids
S38, F54, M54, A155, E158, L162, A276, G276, S276, L307, P347,
W347, P436, F443, and/or W443 and having Ce16a activity is
provided.
[0074] In one embodiment, the disclosure relates to a variant
derived from an amino acid substitution at residue C246G in a
thermostable cellulase of SEQ ID NO:2, or C269G of SEQ ID NO:4, or
L276G of SEQ ID NO:6, or L276G of SEQ ID NO:8. The residue position
corresponds to the position found in HJPlus of SEQ ID NO:2.
[0075] For the purposes of the disclosure, a polypeptide of the
disclosure exhibits improved thermostability with respect to a
corresponding parent polypeptide if it has a T.sub.50 which is at
least about 5.degree. C., or at least about 9.degree. C. higher
than that of the parent cellulase, or for example a
cellobiohydrolase having a T.sub.50 from about 5.degree. C. to
about 30.degree. C. higher, or any amount there between, or a
T.sub.50 from about 9.degree. C. to about 30.degree. C. higher, or
any amount there between, when compared to that of the parent
cellobiohydrolase. The T.sub.50 is the temperature at which the
modified or the natural enzyme retains 50% of its residual activity
after a pre-incubation for 15 minutes and is determined by the
assay detailed in Examples below or as known in the art.
[0076] A thermostable Ce16a variant of the disclosure comprises an
enzyme that has a thermostability higher than the wild-type enzyme
of SEQ ID NO:4, 6, or 8 by at least 5.degree. C. In one embodiment,
the wild-type enzyme has a T.sub.50 of 70.degree. C. and a
thermostabilized variant has an increase in T.sub.50 of 5.degree.
C. or above. In various embodiments described herein, the modified
Ce16a enzymes may exhibit enhanced thermostabilities, characterized
by a 20-fold increase in half-life at 75.degree. C. and an increase
of 7.9 .degree. C. in T.sub.50 value as compared to HJPlus Ce16a of
SEQ ID NO:2, or wild-type enzymes comprising SEQ ID NO:4, 6, or
8.
[0077] The modified cellobiohydrolases or cellulases of the
disclosure may have T.sub.50 which is about 5.degree. C. to about
30.degree. C. higher than that of a corresponding parent
cellobiohydrolase (e.g., SEQ ID NO:2, 4, 6 or 8), or any range
there between, about 5.degree. C. to about 20.degree. C. higher, or
any range there between, about 8.degree. C. to about 15.degree. C.
higher, or any range there between, or from about 9.degree. C. to
about 15.degree. C. higher, or any range there between. For
example, the modified cellulase may have a T.sub.50 that is at
least about 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26,
28, or 30.degree. C. higher than that of the corresponding parent
cellobiohydrolase.
[0078] The disclosure provides Ce16a variants, mutants and chimeras
having increased thermostability compared to a wild-type protein
consisting of SEQ ID NO:4, 6 or 8. In one embodiment, the
thermostable enzyme is derived from amino acid substitution(s) at
one or more residues G37, Q53, V155, V158, Q162, L276, I307, K323,
P347, T436, and/or Y443 in Ce16a enzyme from Humicola insolens (SEQ
ID NO:6). In another embodiment, the disclosure encompasses a
variant Ce16a enzyme, wherein said thermostable enzyme comprises
amino acid substitution(s) at one or more of the residues G37S,
Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R,
P347W, T436P, Y443F, and/or Y443W in Ce16a enzyme from Humicola
insolens (SEQ ID NO:6). In various embodiments, isolated or
recombinant polypeptides are provided comprising the amino acid
sequence set forth in SEQ ID NO:6 having up to 50, 25, 10, or 5
conservative amino acid substitutions excluding specific residues
G37, Q53, V155, V158, Q162, L276, I307, K323, P347, T436, and/or
Y443, wherein at least one or more of these specific residues have
substitutions selected form the group consisting of G37S, Q53F,
Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R,
P347W, T436P, Y443F, and/or Y443W are provided. In any of the
foregoing embodiments, the polypeptide of SEQ ID NO:6 can lack the
leader sequence and comprises amino acid 24-476 of SEQ ID NO:6 and
having the foregoing substitutions. In one embodiment, the
disclosure provides a thermostable enzyme derived from amino acid
substitution(s) at one or more residues N38, S54, V151, V154, M158,
C269, Q300, S316, S340, S430, and/or S437 in a Ce16a enzyme from
Hypocrea jecorina (SEQ ID NO:4). In one specific embodiment, the
disclosure encompasses a thermostable variant enzyme, wherein said
enzyme comprises amino acid substitution(s) at one or more of the
residues N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G,
C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and/or
S437W in in Ce16a enzyme from Hypocrea jecorina (SEQ ID NO:4).
Accordingly, in various embodiments, isolated or recombinant
thermostable enzymes are provided comprising the amino acid
sequence set forth in SEQ ID NO:4 having up to 50, 25, 10, or 5
conservative amino acid substitutions excluding specific residues
N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and/or
S437, wherein at least one or more of these specific residues have
substitutions selected form the group consisting of N38S, S54F,
S54M, V151A, V154E, M158L, C269A, C269G, C269L, C269S, Q300L,
S316R, S340P, S340W, S430P, S437F, and/or S437W. In any of the
foregoing embodiments, the polypeptide of SEQ ID NO:4 can lack the
leader sequence and comprises amino acid 25-471 of SEQ ID NO:4 and
having the foregoing substitutions. In one embodiment, the
disclosure provides a thermostable enzyme derived from amino acid
substitution(s) at one or more residues N38, L54, V155, V158, Q162,
L276, I307, R323, S347, T436, and/or Y443 in Ce16a enzyme from
Chaetomium thermophilum (SEQ ID NO:8). In one embodiment, the
disclosure encompasses a thermostable variant enzyme, wherein said
enzyme comprises amino acid substitution(s) at one or more of the
residues N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G,
L276S, I307L, S347P, S347W, T436P, Y443F, and/or Y443W in a Ce16a
enzyme from Chaetomium thermophilum (SEQ ID NO:8). Accordingly, in
various embodiments, isolated or recombinant thermostable
polypeptides are provided comprising the amino acid sequence set
forth in SEQ ID NO:8 having up to 50, 25, 10, or 5 conservative
amino acid substitutions excluding specific residues N38, L54,
V155, V158, Q162, L276, I307, R323, S347, T436, and/or Y443,
wherein at least one or more of these specific residues have
substitutions selected form the group consisting of N38S, L54F,
L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P,
S347W, T436P, Y443F, and/or Y443W. In any of the foregoing
embodiments, the polypeptide of SEQ ID NO:8 can lack the leader
sequence and comprises amino acid 25-476 of SEQ ID NO:8 and having
the foregoing substitutions.
[0079] Additional Ce16a family members can be identified by
sequence alignment using any of the sequences of SEQ ID NO:2, 4, 6,
or 8. These family members can then be modified at corresponding
amino acid positions as set forth above. The modified polypeptide
may then be assayed for activity as described below at various
temperatures and conditions to identify those modifications that
introduce a favorable activity.
[0080] The variants identified herein can also be used to generate
chimeric cellobiohydrolases. For example, SCHEMA has been used
previously to create families of hundreds of active
.beta.-lactamase and cytochrome P450 enzyme chimeras. SCHEMA uses
protein structure data to define boundaries of contiguous amino
acid "blocks" which minimize <E>, the library average number
of amino acid sidechain contacts that are broken when the blocks
are swapped among different parents. It has been shown that the
probability that a .beta.-lactamase chimera was folded and active
was inversely related to the value of E for that sequence. The
RASPP (Recombination as Shortest Path Problem) algorithm was used
to identify the block boundaries that minimized <E> relative
to the library average number of mutations, <m>. More than
20% of the .about.500 unique chimeras characterized from a
.beta.-lactamase collection comprised of 8 blocks from 3 parents
(3.sup.8=6,561 possible sequences) were catalytically active. A
similar approach produced a 3-parent, 8-block cytochrome P450
chimera family containing more than 2,300 novel, catalytically
active enzymes. Chimeras from these two collections were
characterized by high numbers of mutations, 66 and 72 amino acids
on average from the closest parent, respectively. SCHEMA/RASPP thus
enabled design of chimera families having significant sequence
diversity and an appreciable fraction of functional members.
[0081] It has also been shown that the thermostabilities of SCHEMA
chimeras can be predicted based on sequence-stability data from a
small sample of the sequences. Linear regression modeling of
thermal inactivation data for 184 cytochrome P450 chimeras showed
that SCHEMA blocks made additive contributions to thermostability.
More than 300 chimeras were predicted to be thermostable by this
model, and all 44 that were tested were more stable than the most
stable parent. It was estimated that as few as 35 thermostability
measurements could be used to predict the most thermostable
chimeras. Furthermore, the thermostable P450 chimeras displayed
unique activity and specificity profiles, demonstrating that
chimeragenesis can lead to additional useful enzyme properties.
Here SCHEMA recombination of CBH II enzymes can generate chimeric
cellulases that are active on phosphoric acid swollen cellulose
(PASC) at high temperatures, over extended periods of time, and
broad ranges of pH.
[0082] Descriptions of SCHEMA directed recombination and synthesis
of chimeric polypeptides are described in the examples herein, as
well as in Otey et al., (2006), PLoS Biol. 4(5):e112; Meyer et al.,
(2003) Protein Sci., 12:1686-1693; U.S. patent application Ser. No.
12/024,515, filed Feb. 1, 2008; and U.S. patent application Ser.
No. 12/027,885, filed Feb. 7, 2008; such references incorporated
herein by reference in their entirety.
[0083] In other embodiments, the thermostable enzymes described
above can be operably linked to a cellulose binding domain (CBD)
such as the CBD-linker polypeptide set forth in SEQ ID NO:10.
"Fused," "operably linked," and "operably associated" are used
interchangeably herein to broadly refer to a chemical or physical
coupling of two otherwise distinct domains or peptide segments,
wherein each domain or peptide segment when operably linked can
provide a functional polypeptide having a desired activity. Domains
or peptide segments can be connected through peptide linkers such
that they are functional or can be fused through other
intermediates or chemical bonds. For example, two domains can be
part of the same coding sequence, wherein the polynucleotides are
in frame such that the polynucleotide when transcribed encodes a
single mRNA that when translated comprises both domains as a single
polypeptide. Alternatively, both domains can be separately
expressed as individual polypeptides and fused to one another using
chemical methods. Typically, the coding domains will be linked
"in-frame" either directly of separated by a peptide linker and
encoded by a single polynucleotide. Various coding sequences for
peptide linkers and peptide are known in the art.
[0084] In some embodiments, a polypeptide of the disclosure
comprise a substantially pure polypeptide. A "substantially pure
polypeptide" refers to a composition in which the polypeptide
species is the predominant species present (i.e., on a molar or
weight basis it is more abundant than any other individual
macromolecular species in the composition), and is generally a
substantially purified composition when the object species
comprises at least about 50 percent of the macromolecular species
present by mole or % weight. Generally, a substantially pure
polypeptide composition will comprise about 60% or more, about 70%
or more, about 80% or more, about 90% or more, about 95% or more,
and about 98% or more of all macromolecular species by mole or %
weight present in the composition. In some embodiments, the object
species is purified to essential homogeneity (i.e., contaminant
species cannot be detected in the composition by conventional
detection methods) wherein the composition consists essentially of
a single macromolecular species. Solvent species, small molecules
(<500 Daltons), and elemental ion species are not considered
macromolecular species.
[0085] The disclosure also provides polynucleotide and nucleic
acids encoding the polypeptides described herein. "Polynucleotide"
or "nucleic acid sequence" refers to a polymeric form of
nucleotides. In some instances a polynucleotide refers to a
sequence that is not immediately contiguous with either of the
coding sequences with which it is immediately contiguous (one on
the 5' end and one on the 3' end) in the naturally occurring genome
of the organism from which it is derived. The term therefore
includes, for example, a recombinant DNA which is incorporated into
a vector; into an autonomously replicating plasmid or virus; or
into the genomic DNA of a prokaryote or eukaryote, or which exists
as a separate molecule (e.g., a cDNA) independent of other
sequences. The nucleotides of the disclosure can be
ribonucleotides, deoxyribonucleotides, or modified forms of either
nucleotide. A polynucleotides as used herein refers to, among
others, single-and double-stranded DNA, DNA that is a mixture of
single- and double-stranded regions, single- and double-stranded
RNA, and RNA that is mixture of single- and double-stranded
regions, hybrid molecules comprising DNA and RNA that may be
single-stranded or, more typically, double-stranded or a mixture of
single- and double-stranded regions. The term polynucleotide
encompasses genomic DNA or RNA (depending upon the organism, i.e.,
RNA genome of viruses), as well as mRNA encoded by the genomic DNA,
and cDNA.
[0086] The polynucleotides may be operatively linked to one or more
heterologous regulatory or control sequences that control gene
expression to create a recombinant polynucleotide capable of
expressing the polypeptide. Expression constructs containing a
heterologous polynucleotide encoding the Ce16a variant can be
introduced into appropriate host cells to express the
polypeptide.
[0087] Given the knowledge of specific sequences of the Ce16a
enzymes (see, e.g., SEQ ID NOs:1, 3, 5, and 7), the polynucleotide
sequences will be apparent form the amino acid sequence of the
disclosure to one of skill in the art. The knowledge of the codons
corresponding to various amino acids coupled with the knowledge of
the amino acid sequence of the polypeptides allows those skilled in
the art to make different polynucleotides encoding the polypeptides
of the disclosure. Thus, the disclosure contemplates each and every
possible variation of the polynucleotides that could be made by
selecting combinations based on possible codon choices, and all
such variations are to be considered specifically disclosed for any
of the polypeptides described herein.
[0088] In some embodiments, the polynucleotides encode the
polypeptides described herein but have about 80% or more sequence
identity, about 85% or more sequence identity, about 90% or more
sequence identity, about 91% or more sequence identity, about 92%
or more sequence identity, about 93% or more sequence identity,
about 94% or more sequence identity, about 95% or more sequence
identity, about 96% or more sequence identity, about 97% or more
sequence identity, about 98% or more sequence identity, or about
99% or more sequence identity at the nucleotide level to a
reference polynucleotide encoding the Ce16a polypeptides of SEQ ID
NO:2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24, 26, or 28 and encode a
polypeptide having cellulase activity and thermostability that is
greater than a wild-type Ce16a of SEQ ID NO:4, 6, or 8.
[0089] In one embodiment, an isolated polynucleotide of the
disclosure comprises at least 80% identity (e.g., 80, 85, 90, 95,
98, 99% identity) to SEQ ID NO:1, 3, 5, 7, 11, 13, 15, 17, 19, 21,
23, 25, or 27 and which encodes a polypeptide of SEQ ID NO:2, 4, 6,
8, 12, 14, 16, 18, 20, 22, 24, 26, or 28 and wherein the
polypeptide comprises cellulase activity and has improved
thermostability compared to a polypeptide comprising SEQ ID NO:4,
6, or 8. In another embodiment, the disclosure provides a
polynucleotide comprising a sequence selected from the group
consisting of SEQ ID NO: 11, 13, 15, 17, 19, 21, 23, 25, and 27. In
yet another embodiment, the disclosure provides a polynucleotide
comprising a sequence that encodes a polypeptide of SEQ ID NO:6 and
having one or more substitutions selected from the group consisting
of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S,
I307L, K323R, P347W, T436P, Y443F, and Y443W. In yet another
embodiment, the disclosure provides a polynucleotide comprising a
sequence that encodes a polypeptide of SEQ ID NO:4 and having one
or more substitutions selected from the group consisting of N38S,
S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269S, Q300L, S316R,
S340P, S340W, S430P, S437F, and S437W. In yet another embodiment,
the disclosure provides a polynucleotide comprising a sequence that
encodes a polypeptide of SEQ ID NO:8 and having one or more
substitutions selected from the group consisting of N38S, L54F,
L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P,
S347W, T436P, Y443F, and Y443W.
[0090] In some embodiments, the isolated polynucleotides encoding
the polypeptides may be manipulated in a variety of ways to provide
for expression of the polypeptide. Manipulation of the isolated
polynucleotide prior to its insertion into a vector may be
desirable or necessary depending on the expression vector. The
techniques for modifying polynucleotides and nucleic acid sequences
utilizing recombinant DNA methods are well known in the art.
Guidance is provided in Sambrook et al., 2001, Molecular Cloning: A
Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press;
and Current Protocols in Molecular Biology, Ausubel. F. ed., Greene
Pub. Associates, 1998, updates to 2007.
[0091] In some embodiments, the polynucleotides are operatively
linked to control sequences for the expression of the
polynucleotides and/or polypeptides. In some embodiments, the
control sequence may be an appropriate promoter sequence, which can
be obtained from genes encoding extracellular or intracellular
polypeptides, either homologous or heterologous to the host cell.
For bacterial host cells, suitable promoters for directing
transcription of the nucleic acid constructs of the present
disclosure, include the promoters obtained from the E. coli lac
operon, Bacillus subtilis xy1A and xy1B genes, Bacillus megatarium
xylose utilization genes (e.g., Rygus et al., (1991) Appl.
Microbiol. Biotechnol. 35:594-599; Meinhardt et al., (1989) Appl.
Microbiol. Biotechnol. 30:343-350), prokaryotic beta-lactamase gene
(Villa-Kamaroff et al., (1978) Proc. Natl Acad. Sci. USA 75:
3727-3731), as well as the tac promoter (DeBoer et al., (1983)
Proc. Natl Acad. Sci. USA 80: 21-25). Various suitable promoters
are described in "Useful proteins from recombinant bacteria" in
Scientific American, 1980, 242:74-94; and in Sambrook et al.,
supra.
[0092] In some embodiments, the control sequence may also be a
suitable transcription terminator sequence, a sequence recognized
by a host cell to terminate transcription. The terminator sequence
is operably linked to the 3' terminus of the nucleic acid sequence
encoding the polypeptide. Any terminator which is functional in the
host cell of choice may be used.
[0093] In some embodiments, the control sequence may also be a
suitable leader sequence, a nontranslated region of an mRNA that is
important for translation by the host cell. The leader sequence is
operably linked to the 5' terminus of the nucleic acid sequence
encoding the polypeptide. Any leader sequence that is functional in
the host cell of choice may be used.
[0094] In some embodiments, the control sequence may also be a
signal peptide coding region that codes for an amino acid sequence
linked to the amino terminus of a polypeptide and directs the
encoded polypeptide into the cell's secretory pathway. The 5' end
of the coding sequence of the nucleic acid sequence may inherently
contain a signal peptide coding region naturally linked in
translation reading frame with the segment of the coding region
that encodes the secreted polypeptide. Alternatively, the 5' end of
the coding sequence may contain a signal peptide coding region that
is foreign to the coding sequence. The foreign signal peptide
coding region may be required where the coding sequence does not
naturally contain a signal peptide coding region. Effective signal
peptide coding regions for bacterial host cells can be the signal
peptide coding regions obtained from the genes for Bacillus NC1B
11837 maltogenic amylase, Bacillus stearothermophilus
alpha-amylase, Bacillus licheniformis subtilisin, Bacillus
licheniformis beta-lactamase, Bacillus stearothermophilus neutral
proteases (nprT, nprS, nprM), and Bacillus subtilis prsA. Further
signal peptides are described by Simonen and Palva, (1993)
Microbiol Rev 57: 109-137.
[0095] The disclosure is further directed to a recombinant
expression vector comprising a polynucleotide encoding the
engineered Cel6a polypeptides, and one or more expression
regulating regions such as a promoter and a terminator, a
replication origin, etc., depending on the type of hosts into which
they are to be introduced. In creating the expression vector, the
coding sequence is located in the vector so that the coding
sequence is operably linked with the appropriate control sequences
for expression.
[0096] The recombinant expression vector may be any vector (e.g., a
plasmid or virus), which can be conveniently subjected to
recombinant DNA procedures and can bring about the expression of
the polynucleotide sequence. The choice of the vector will
typically depend on the compatibility of the vector with the host
cell into which the vector is to be introduced. The vectors may be
linear or closed circular plasmids.
[0097] The expression vector may be an autonomously replicating
vector, i.e., a vector that exists as an extrachromosomal entity,
the replication of which is independent of chromosomal replication,
e.g., a plasmid, an extrachromosomal element, a minichromosome, or
an artificial chromosome. The vector may contain any means for
assuring self-replication. Alternatively, the vector may be one
which, when introduced into the host cell, is integrated into the
genome and replicated together with the chromosome(s) into which it
has been integrated. Furthermore, a single vector or plasmid or two
or more vectors or plasmids which together contain the total DNA to
be introduced into the genome of the host cell, or a transposon,
may be used.
[0098] In some embodiments, the expression vector of the disclosure
contains one or more selectable markers, which permit easy
selection of transformed cells. A selectable marker is a gene the
product of which provides for biocide or viral resistance,
resistance to heavy metals, prototrophy to auxotrophs, and the
like. Examples of bacterial selectable markers are the dal genes
from Bacillus subtilis or Bacillus licheniformis, or markers, which
confer antibiotic resistance such as ampicillin, kanamycin,
chloramphenicol or tetracycline resistance. Other useful markers
will be apparent to the skilled artisan.
[0099] In another embodiment, the disclosure provides a host cell
comprising a polynucleotide encoding a Ce16a polypeptide, the
polynucleotide being operatively linked to one or more control
sequences for expression of the polypeptide in the host cell. Host
cells for use in expressing the polypeptides encoded by the
expression vectors of the disclosure are well known in the art and
include, but are not limited to, bacterial cells, such as E. coli
and Bacillus megaterium; eukaryotic cells, such as yeast cells, CHO
cells and the like, insect cells such as Drosophila S2 and
Spodoptera Sf9 cells; animal cells such as CHO, COS, BHK, 293, and
Bowes melanoma cells; and plant cells. Other suitable host cells
will be apparent to the skilled artisan. Appropriate culture
mediums and growth conditions for the above-described host cells
are well known in the art.
[0100] The Ce16a polypeptides of the disclosure can be made by
using methods well known in the art. Polynucleotides can be
synthesized by recombinant techniques, such as that provided in
Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, 3rd
Ed., Cold Spring Harbor Laboratory Press; and Current Protocols in
Molecular Biology, Ausubel. F. ed., Greene Pub. Associates, 1998,
updates to 2007. Polynucleotides encoding the enzymes, or the
primers for amplification can also be prepared by standard
solid-phase methods, according to known synthetic methods, for
example using phosphoramidite method described by Beaucage et al.,
(1981) Tet Lett 22:1859-69, or the method described by Matthes et
al., (1984) EMBO J. 3:801-05, e.g., as it is typically practiced in
automated synthetic methods. In addition, essentially any nucleic
acid can be obtained from any of a variety of commercial sources,
such as The Midland Certified Reagent Company, Midland, Tex., The
Great American Gene Company, Ramona, Calif., ExpressGen Inc.
Chicago, Ill., Operon Technologies Inc., Alameda, Calif., and many
others.
[0101] Engineered enzymes expressed in a host cell can be recovered
from the cells and or the culture medium using any one or more of
the well-known techniques for protein purification, including,
among others, lysozyme treatment, sonication, filtration,
desalting, ultra-centrifugation, chromatography, and affinity
separation (e.g., substrate bound antibodies). Suitable solutions
for lysing and the high efficiency extraction of proteins from
bacteria, such as E. coli, are commercially available under the
trade name CelLytic BTM from Sigma-Aldrich of St. Louis Mo.
[0102] Chromatographic techniques for isolation of the polypeptides
include, among others, reverse phase chromatography high
performance liquid chromatography, ion exchange chromatography, gel
electrophoresis, and affinity chromatography. Conditions for
purifying a particular enzyme will depend, in part, on factors such
as net charge, hydrophobicity, hydrophilicity, molecular weight,
molecular shape, etc., and will be apparent to those having skill
in the art.
[0103] As discussed above, the polypeptide can be used in a variety
of applications, such as, among others, biofuel generation,
cellulose breakdown and the like.
[0104] The disclosure also provides a recombinant yeast expressing
a Ce16a polypeptide variant as described above. The recombinant
organisms of the disclosure are useful for bioethanol production.
The engineered strains can be evaluated for cellulose hydrolysis
and ethanol production under different conditions such as resting
and growth conditions in SDC medium. Both small and large-scale
(shaker flask/one liter bioreactor) studies can be performed. In
resting cell experiments, cells are grown aerobically using glucose
as the carbon source. Cells are then washed and used in cellulose
anaerobic hydrolysis. Enzyme activity, hydrolysis products,
glucose, and ethanol will be monitored using methods described
herein. In studies carried out in a fermentor, a mild agitation can
be used to promote mixing of solid cellulose material with cells.
Once optimized industrial yeast fermentation process may be used.
Different cellulose concentrations can also be used. The rate of
glucose generation will be estimated from the experiments and
compared to those without the modified Ce16a polypeptides. In
studies under growing conditions, the cells will be provided
cellulose as the sole carbon source, and other nutrients necessary
for growth. Anaerobic conditions are maintained. Cell biomass,
enzyme activities, glucose and ethanol are measured.
[0105] The disclosure provides yeast strains for direct
fermentation of cellulose to ethanol, eliminating the need for use
of purified cellulases. The methods and compositions of the
disclosure provide abundant, low-cost, agriculture residue to be
used as raw material for ethanol production. The increased
production of ethanol not only reduces pollution to the environment
but also the need for imported petroleum as transportation fuel.
Collectively, the benefits from the invention include at least
efficient, economical, and environmentally friendly conversion of
biomass.
[0106] The disclosure also provides purified enzymes (i.e., Ce16a
thermostable variants) that can be used for industrial
applications. Under such conditions, the enzymes are purified from
a yeast or other microorganism engineered to express the
thermostable enzyme and the enzymes are then added to a reactor
comprising cellulose to be degraded. Other cellulase enzymes (e.g.,
Ce17a) can be added to the reactor.
[0107] The following examples are meant to further explain, but not
limited the foregoing disclosure or the appended claims.
EXAMPLES
[0108] Strains, plasmids, and oligonucleotides. Strains, plasmid,
oligonucleotide, nucleotide and amino acid sequences described
herein listed in Tables 1, 2, 3, and 4 below.
TABLE-US-00001 TABLE 1 Genotypes of strains disclosed herein
Species Strain Genotype E. coli XL1-blue recA1 endA1 gyrA96 thi-1
hsdR17 supE44 relA1 lac [F' proAB lacIqZ.DELTA.M15 Tn10 (Tetr)] S.
cerevisiae YDR483W Mata his3D1 leu2D0 lys2D0 ura3D0 BY4742 Dkre2,
ATCC No. 4014317
TABLE-US-00002 TABLE 2 Plasmids disclosed herein Name Source or
reference pBack YEp352/PGK91-1-.alpha.ss pHJPlus HJPlus gene cloned
into the pBack plasmid; it is described in U.S. patent application
12/723,597 p1G6 1G6 gene cloned into the pBack plasmid p2B3 2B3
gene cloned into the pBack plasmid p3C6P 3C6P gene cloned into the
pBack plasmid
TABLE-US-00003 TABLE 3 Oligonucleotide sequences (shown from 5' to
3') disclosed herein. Seq Name Sequence ID alpha_HomeRe_Lt
CGGGTTATTGTTTATAAATACTACTATTGCCAG 29 His_HomRe_Rt
GACATGGGAGATCGAATTCAACTCC 30 S30F_top
GCACATGCGTCTACTTCAACGACTATTACTCC 31 S30F_bottom
GGAGTAATAGTCGTTGAAGTAGACGCATGTGC 32 WT30_top
GCACATGCGTCTACTCCAACGACTATTACTCC 33 WT30_bottom
GGAGTAATAGTCGTTGGAGTAGACGCATGTGC 34 V128A_top
GCAGCTAGTGCTGCGGCTGAGGTGCCAAGTTTTATGTGGCTGGATAC 35 V128A_bottom
GTATCCAGCCACATAAAACTTGGCACCTCAGCCGCAGCACTAGCTGC 36 V131E_top
GCAGCTAGTGCTGTGGCTGAGGAGCCAAGTTTTATGTGGCTGGATAC 37 V131E_bottom
GTATCCAGCCACATAAAACTTGGCTCCTCAGCCACAGCACTAGCTGC 38 M135L_top
GCAGCTAGTGCTGTGGCTGAGGTGCCAAGTTTTTTGTGGCTGGATAC 39 M135L_bottom
GTATCCAGCCACAAAAAACTTGGCACCTCAGCCACAGCACTAGCTGC 40 V128A/V131E_top
GCAGCTAGTGCTGCGGCTGAGGAGCCAAGTTTTATGTGGCTGGATAC 41
V128A/V131E_bottom GTATCCAGCCACATAAAACTTGGCTCCTCAGCCGCAGCACTAGCTGC
42 V128A/M135L_top GCAGCTAGTGCTGCGGCTGAGGTGCCAAGTTTTTTGTGGCTGGATAC
43 V128A/M135L_bottom
GTATCCAGCCACAAAAAACTTGGCACCTCAGCCGCAGCACTAGCTGC 44 V131E/M135L_top
GCAGCTAGTGCTGTGGCTGAGGAGCCAAGTTTTTTGTGGCTGGATAC 45
V131E/M135L_bottom GTATCCAGCCACAAAAAACTTGGCTCCTCAGCCACAGCACTAGCTGC
46 128/131/135_top GCAGCTAGTGCTGCGGCTGAGGAGCCAAGTTTTTTGTGGCTGGATAC
47 128/131/135_bottom
GTATCCAGCCACAAAAAACTTGGCTCCTCAGCCGCAGCACTAGCTGC 48
WT128/131/135_top GCAGCTAGTGCTGTGGCTGAGGTGCCAAGTTTTATGTGGCTGGATAC
49 WT128/131/135_bottom
GTATCCAGCCACATAAAACTTGGCACCTCAGCCACAGCACTAGCTGC 50 S293R_top
CAAAAATGCCTCAAGACCTAGAGCGCTG 51 S293R_bottom
CAGCGCTCTAGGTCTTGAGGCATTTTTG 52 WT293_top
CAAAAATGCCTCAAGTCCTAGAGCGCTG 53 WT293_bottom
CAGCGCTCTAGGACTTGAGGCATTTTTG 54 S40613_top
GATGGAACGAGTGATCCTTCTGCTCCAAG 55 S406P_bottom
CTTGGAGCAGAAGGATCACTCGTTCCATC 56 WT406_top
GATGGAACGAGTGATTCTTCTGCTCCAAG 57 WT406_bottom
CTTGGAGCAGAAGAATCACTCGTTCCATC 58 N14NNKLt
GGCCAATGTGGTGGCCAGNNKTGGTCGGGTCCGAC 59 N14 Rt CTGGCCACCACATTGGCC 60
S30NNK Lt CCGGAAGCACATGCGTCTACNNKAACGACTATTACTCCCAGTG 61 S30 Rt
GTAGACGCATGTGCTTCCGG 62 V128NNK Lt
CGTGCCGCAGCTAGTGCTNNKGCTGAGGTGCCAAG 63 V128 Rt AGCACTAGCTGCGGCACG
64 V131NNK Lt GCAGCTAGTGCTGTGGCTGAGNNKCCAAGTTTTATGTGGCTG 65 V131 Rt
CTCAGCCACAGCACTAGCTGC 66 M135NNK Lt
GTGGCTGAGGTGCCAAGTTTTNNKTGGCTGGATACTTTGG 67 M135 Rt
AAAACTTGGCACCTCAGCCAC 68 Q277NNK Lt
GTTGGGTTGGCCAGCAAATNNKGATCCCGCTGCGCAG 69 Q277 Rt
ATTTGCTGGCCAACCCAAC 70 S293NNK Lt
GCAAATGTTTACAAAAATGCCTCANNKCCTAGAGCGCTGAGG 71 S293 Rt
TGAGGCATTTTTGTAAACATTTGC 72 S317NNK Lt
CTTGGTCAATAGCGAGTCCTCCANNKTACACAAGCCCTAACCC 73 S317 Rt
GGAGGACTCGCTATTGACCAAG 74 S406NNK Lt
GGAGAGTCAGATGGAACGAGTGATNNKTCTGCTCCAAGGTTCG 75 S406 Rt
ATCACTCGTTCCATCTGACTCTCC 76 S413NNK Lt
GATTCTTCTGCTCCAAGGTTCGATNNKCATTGCGCATTACCAG 77 S413 Rt
ATCGAACCTTGGAGCAGAAGAATC 78 W99Y Lt
CTTTGAAGGTGTTCAGCTGTATGCTAATAACTATTATAGATCTGAG 79 W99Y Rt
CTCAGATCTATAATAGTTATTAGCATACAGCTGAACACCTTCAAAG 80 N102P Lt
CAGCTGTGGGCTAATCCATATTATAGATCTGAGGTACATAC 81 N102P Rt
GTATGTACCTCAGATCTATAATATGGATTAGCCCACAGCTG 82 R122A Lt
GACCCCGCGTTGGCTGCCGCAGCTAGTG 83 R122A Rt
CACTAGCTGCGGCAGCCAACGCGGGGTC 84 A124K Lt
GCGTTGCGTGCCAAAGCTAGTGCTGCGG 85 A124K Rt
CCGCAGCACTAGCTTTGGCACGCAACGC 86 M146L Lt
GACAAAACCCCCTTATTGGAACAAACGTTGGC 87 M146L Rt
GCCAACGTTTGTTCCAATAAGGGGGTTTTGTC 88 I153A Lt
CAAACGTTGGCTGATGCTCGTACTGCGAATAAAAAC 89 I153A Rt
GTTTTTATTCGCAGTACGAGCATCAGCCAACGTTTG 90 Y186L Lt
GAGCAACGGGGAGTTGAGCATTGCGGATG 91 Y186L Rt
CATCCGCAATGCTCAACTCCCCGTTGCTC 92 C246G Lt
CAGAGTGCTTATCTTGAGGGTATCAATTATGCAGTCAC 93 C246G Rt
GTGACTGCATAATTGATACCCTCAAGATAAGCACTCTG 94 V251L Lt
GTGCATCAATTATGCATTGACCCAGTTGAATTTG 95 V251L Rt
CAAATTCAACTGGGTCAATGCATAATTGATGCAC 96 S292G Lt
GTTTACAAAAATGCCGGTAGTCCTAGAGCGCTG 97 S292G Rt
CAGCGCTCTAGGACTACCGGCATTTTTGTAAAC 98 L297V Lt
CTCAAGTCCTAGAGCGGTTAGGGGTCTTGCAAC 99 L297V Rt
GTTGCAAGACCCCTAACCGCTCTAGGACTTGAG 100 P321W Lt
CCACCGTACACAAGCTGGAACCCAAACTACGATG 101 P321W Rt
CATCGTAGTTTGGGTTCCAGCTTGTGTACGGTGG 102 F334L Lt
GCATTACATAGAAGCATTGGCTCCTTTGCTTCG 103 F334L Rt
CGAAGCAAAGGAGCCAATGCTTCTATGTAATGC 104 P358G Lt
GAAACGGCAAGCAGGGTACAGGGCAGCTAGAATG 105 G358G Rt
CATTCTAGCTGCCCTGTACCCTGCTTGCCGTTTC 106 G360R Lt
CAAGCAGCCGACAAGACAGCTAGAATGGGG 107 G360R Rt
CCCCATTCTAGCTGTCTTGTCGGCTGCTTG 108 Q361R Lt
CAGCCGACAGGGAGACTAGAATGGGGGC 109 Q361R Rt
GCCCCCATTCTAGTCTCCCTGTCGGCTG 110 T373A Lt
GCAATGTCAAGGGTGCTGGTTTCGGTGTTAGAC 111 T373A Rt
GTCTAACACCGAAACCAGCACCCTTGACATTGC 112
[0109] Media, buffers, and reagents. SD-Ura media: commercially
available from MP Biomedicals, contains 20 g/L D-glucose, 1.7 g/L
yeast nitrogen base, 5 g/L ammonium sulfate, and 0.8 g/L casamino
acids without uracil. YPD media: 10 g/L Bacto yeast extract, 20 g/L
Bacto peptone, and 20 g/L D-glucose. Tris-DTT buffer: 390 g/L
1,4-dithiothreitol and 121.1 g/L of Tris base, pH 8.0. Buffer E:
1.2 g/L Tris base, 92.4 g/L sucrose, and 0.2 g/L magnesium
chloride, pH 7.4. Buffer A: 20 mM Tris, 100 mM sodium chloride, and
10 mM imidazole, pH 8.0. Buffer B: 20 mM Tris, 100 mM sodium
chloride, and 300 mM imidazole, pH 8.0. Somogyi reagent 1: 180 g/L
Na.sub.2SO.sub.4, 15 g/L Rochelle salt, 30 g/L Na.sub.2CO.sub.3,
and 20 g/L NaHCO.sub.3. Somogyi reagent 2: 180 g/L Na.sub.2SO.sub.4
and 12.8 g of anhydrous CuSO.sub.4. Nelson reagent: 50 g/L
(NH.sub.4).sub.2MoO.sub.4, 1.5 N H.sub.2SO.sub.4, and 6 g/L
NaH.sub.2AsO.sub.4; incubate at 37.degree. C. for 16-24 hours for
the formation of the chromogenic compound.
[0110] High-efficiency S. cerevisiae transformation. The
transformation protocol published by Chao et al. (Nat Protoc,
1(2):755-768, 2006) was adapted and scaled down to generate
libraries with 10.sup.4 colonies. A colony was used to start a 5 mL
YPD culture and grown overnight at 30.degree. C. and 250 rpm. In
the morning, the overnight culture was used to inoculate 10 mL of
YPD media per transformation to an OD.sub.600 of 0.1. The YPD
culture was grown at 30.degree. C. and 250 rpm until an OD.sub.600
of 1.5. Once the cells reached the desired absorbance, 100 .mu.L of
Tris-DTT buffer per 10 mL of YPD culture was added and incubated at
30.degree. C. and 250 rpm for 15 minutes. The cells were pelleted
at 2,500 g for 3 minutes at 4.degree. C., washed with 10 mL of
ice-cold buffer E per 10 mL of culture, and again washed with 1 mL
of ice-cold buffer E. The cell pellet was resuspended in 50 .mu.L
of ice-cold buffer E per transformation. For each transformation,
50 .mu.L competent cells were mixed with 1 .mu.g of DNA in less
than 5 .mu.L volume and transferred to an ice-cold 0.2-cm
electroporation cuvette. The cells were electroporated at 0.54 kV
and 25 .mu.F without a pulse controller and immediately rescued by
adding 1 mL of warm (30.degree. C.) YPD media. The cells were
incubated at 30.degree. C. and 250 rpm for 1 hour before plating on
SD-Ura agar plates and grown at 30.degree. C. for three days.
[0111] Heterologous expression in S. cerevisiae in 96-well plates.
To express random mutagenesis libraries in S. cerevisiae, the
high-efficiency competent cells were used. The competent cells were
transformed with 0.5 .mu.g of the linearized vector and 0.5 .mu.g
of the error-prone ce16a PCR insert via electroporation and plated
on SD-Ura agar plates. The linearized vector and the PCR insert
shared regions of homology upstream and downstream of the ce16a
gene and were expected to be joined together by homology
recombination in S. cerevisiae. Colonies containing mutant Ce16a
were randomly selected and inoculated in 50 .mu.L/well of SD-Ura
media in 96-well plates. The culture was grown overnight at
30.degree. C., 250 rpm with 80% humidity in orbital shakers. Once
the culture in SD-Ura media reached saturation, it was expanded
with 350 .mu.L/well of YPD media and grown at 30.degree. C., 250
rpm with 80% humidity for an additional of 48 hours. Both the
SD-Ura media and the YPD media in 96-well plates were supplemented
with 25 .mu.g/mL of kanamycin to prevent bacterial contamination.
The culture was harvested by centrifugation at 5,000.times.g,
4.degree. C. for 10 minutes, and the supernatant was used for
activity assays without further treatment.
[0112] High-throughput Ce16a activity assay on Avicel. Ce16a
enzymes in the culture supernatants were purified by binding to the
substrate and washing with 50 mM sodium acetate, pH 5.0, to remove
the media. Substrate plates were prepared by pipetting 60 .mu.L of
well-agitated 50 mg/mL Avicel solution into 96-well PCR plates. 100
.mu.L of 3-day culture supernatant were added to the substrate
plates and incubated at 4.degree. C. for 1.5 hours. Avicel and the
bound enzymes were pelleted via centrifugation at 1,000.times.g,
4.degree. C. and washed three times with 180 .mu.L of 50 mM sodium
acetate, pH 5.0. After the wash step, Avicel and the bound enzymes
were resuspended in 75 .mu.L of 50 mM sodium acetate, pH 5.0 and
incubated at 75.degree. C. for two hours. After the 2-hour
incubation, the mixture was cooled immediately to 4.degree. C. and
centrifuged at 1,000 g for 10 minutes at 4.degree. C. 50 .mu.L of
the supernatant was transferred for determination of the reducing
end concentrations using the Nelson-Somogyi microtiter assay
described below. 0.1 mM to 2 mM of cellobiose were used as
standards.
[0113] Detection of reducing sugars. For reducing sugar in the
range of 0.15 mM to 2 mM, the Nelson-Somogyi assay was used.
[0114] Typically, 50 .mu.L of sugar solution was mixed with 40
.mu.L of Somogyi reagent 1 and 10 .mu.L of Somogyi reagent 2 and
boiled at 95.degree. C. for 15 minutes. The reaction was
subsequently cooled to 4.degree. C. and mixed with 50 .mu.L of
Nelson reagent. The reagents were mixed thoroughly to ensure the
evolution of CO.sub.2 was completed and the maximum color
development was achieved. After centrifuging the reagents briefly
to remove the CO.sub.2 in the solution, the absorbance of the sugar
solution at 520 nm was obtained using a SpectraMax microplate
reader with or without cellobiose solution as standard.
[0115] Plasmid DNA recovery from S. cerevisiae. The plasmid DNA was
recovered from S. cerevisiae using the Zymoprep.TM. II Yeast
Plasmid Miniprep kit (Zymo Research). An aliquot of 200 .mu.L of
yeast cells from the library screen were pelleted at 2500 g for 2
minutes. The cell pellet was resuspended in 200 .mu.L of Solution 1
and 5 .mu.L of Zymolase.TM. provided by the kit and incubated at
37.degree. C. for 1 hour. 200 .mu.L of Solution 2 and 400 .mu.L of
Solution 3 provided by the kit were added sequentially and
thoroughly mixed. The mixture was centrifuged at 14,000 rpm for 10
minutes in a table-top microcentrifuge. The following purification
steps using the Zymo columns were according to the manufacturer's
instructions. The plasmid DNA was eluted with 6 .mu.L of Buffer EB
provided by the kit. The plasmid DNA was amplified using E. coli
XL1-blue cells and minipreped using QIAprep Spin Miniprep Kit
(Qiagen). The sequence of the plasmid DNA was determined using
external sequencing facilities.
[0116] Low-efficiency S. cerevisiae transformation. S. cerevisiae
cells were made competent using the Frozen-EZ Yeast Transformation
II.TM. Kit (Zymo Research) for plasmid DNA transformation. A colony
was used to start a 5 mL YPD culture and grown overnight at
30.degree. C. and 250 rpm. In the morning, the overnight culture
was used to inoculate a new YPD culture to an OD.sub.600 of 0.1.
The YPD culture was grown until the OD.sub.600 of 1. The cells were
pelleted, washed once with EZ 1 solution provided by the kit, and
resuspended in EZ 2 solution provided by the kit. The cells were
either transformed immediately or stored at -80.degree. C. for
future use. 50 .mu.L of the competent cells were diluted with 500
.mu.L of EZ 3 solution provided by the kit. 0.5 .mu.g of plasmid
DNA (in less than 5 .mu.L volume) was mixed with 75-500 .mu.L of
diluted cells and incubated at 30.degree. C. for 45 minutes,
vortexed every 15 minutes. 50-100 .mu.L of transformed cells were
spread per SD-Ura agar plate and incubated at 30.degree. C. for
three days.
[0117] Heterologous expression in S. cerevisiae for enzyme
purification. Fresh colonies on SD-Ura plates expressing the
desired enzymes were inoculated into 5-10 mL SD-Ura medium and
grown overnight at 30.degree. C., 250 rpm. The overnight culture
was diluted 1:10 with YPD medium in 300-mL Tunair flasks (Shelton
Scientific) and grown at 30.degree. C., 250 rpm for 48 hours.
Cultures were centrifuged and sterile-filtered using 0.2 .mu.m
polyethersulfone membranes, and PMSF (phenylmethylsulfonylfluoride)
and sodium azide were supplemented to a final concentration of 100
.mu.M and 0.02%, respectively. Ce16a enzymes in the culture
supernatants were purified using HP Ni-NTA Columns (GE Healthcare)
in an AKTApurifier.TM. FPLC system (GE Healthcare), and eluant
fractions having elevated absorbance at 280 nm from the baseline
were pooled. The enzyme solutions were washed three times using 50
mM sodium acetate, pH 5.0 to remove the imidazole from the elution
buffer and concentrated to 500 .mu.L using 20 mL spin columns with
10-kDa PES membranes (Sartorius Stedim Biotech). PMSF and sodium
azide were again supplemented to a final concentration of 100 .mu.M
and 0.02%, respectively. Purified protein concentrations were
determined using the absorbance at 280 nm and the extinction
coefficient of the respective protein.
[0118] Half-life measurement. The half-life is defined as the time
at which an enzyme loses 50% of its activity upon incubation at a
specified temperature and other conditions (pH, buffer, etc.). More
thermostable enzymes exhibit longer half-lives upon incubation. 40
.mu.L of 50 ng/.mu.L Ce16a enzyme in 50 mM sodium acetate buffer,
pH 5.0 were aliquoted into eppendorf tubes and incubated at the
specified temperature for a range of times in the tabletop thermal
mixer. At each time point, an aliquot/tube of the enzyme was
removed and cooled to 4.degree. C. on ice. The range of incubation
time was selected such that the half-life would fall approximately
in the middle. After the heat inactivation period and cooling, 60
.mu.L of well-agitated 50 mg/mL Avicel solution was added to the
enzymes. The solution was subsequently incubated at 50.degree. C.
for 2 hours, to obtain a measure the enzyme's residual activity.
After the hydrolysis reaction, the solution was cooled to 4.degree.
C. and 50 .mu.L of the supernatant was removed for reducing sugar
determination along with cellobiose standards using the
Nelson-Somogyi assay as described above. The reducing sugar
concentrations over the range of heat inactivation periods were
determined using the cellobiose standards, and the natural log of
the residual activity at each time point was plotted as a function
of time using Excel (Microsoft). The data points were fitted using
a 1-parameter linear equation with the y-intercept set to zero, and
the half-life of the enzyme was determined using the slope of the
fitted equation.
[0119] T.sub.50 value measurement. T.sub.50 is defined as the
temperature at which an enzyme loses 50% of its activity during a
15-min heat inactivation period. 40 .mu.L of 50 ng/.mu.L Ce16a
enzymes in 50 mM sodium acetate buffer, pH 5.0 were aliquoted into
the wells of a 96-well plate and incubated at an elevated
temperature gradient in a PCR machine for 15-minutes. The
temperature gradient was selected such that the T.sub.50 value
would fall in the middle. After the heat inactivation period, the
enzymes were cooled to 4.degree. C. and 60 .mu.L of well-agitated
50 mg/mL Avicel solution were added. The plate was subsequently
incubated at 50.degree. C. for 2 hours to measure the residual
activity. After the hydrolysis reaction, the solution was cooled to
4.degree. C. and 50 .mu.L of the supernatant was removed for
reducing sugar determination along with cellobiose standards using
Nelson-Somogyi assay as described above. The reducing sugar
concentrations across the temperature gradient were determined
using the cellobiose standards and plotted against temperature
using SigmaPlot (Systat Software Inc). The data points were fitted
using 4-parameter sigmoidal curves, and the T.sub.50 value was
determined as the temperature where 50% activity was lost.
Example 1
Thermostabilizing Mutations Discovered by Random Mutagenesis and
Screening
[0120] The following example illustrates a method for discovering
mutations that improve the total activity of Ce16 enzymes at
elevated temperatures and also describes the biochemical properties
of such improved enzymes.
[0121] Random mutagenesis. Plasmid pHJPlus carrying the
HJPlus.sup.his6 gene served as the template for error-prone PCR
using forward primer alpha_HomeRe_Lt and reverse primer
His_HomRe_Rt. The gene was flanked by the NheI site and the KpnI
site in the plasmid pHJPlus. The primers were designed to have
regions of homology 85 base-pairs upstream of the NheI site and 65
base-pair downstream of the KpnI site to allow homologous
recombination to occur in yeast. The error rates of the libraries
were adjusted using different concentrations of manganese chloride
in the PCR reaction. Once the error-prone PCR libraries were
expressed in yeast, five colonies were randomly selected for
sequencing to determine the error-rates. Once the library with the
desired mutation rate was identified, roughly 3000 colonies were
randomly selected for total secreted cellobiohydrolase activity
evaluation at an elevated temperature in the high-throughput assay.
The top 1% of the colonies having higher total activities at
75.degree. C. than HJPlus were selected for regrowth and
re-evaluation with the activity assay. The total activities from
culture supernatants of the top five variants from the rescreen are
shown in FIG. 2. The plasmid DNA of the top five variants was
recovered, and the region of the Ce16a genes was sequenced. Clone
1G6 was identified as the best-performing variant, with a mutation
that encodes for amino acid substitution S317P. Other amino acid
substitutions discovered among the top five variants are S30F,
V128A, V131E, S293R, and S413F.
[0122] Plasmid p1G6 carrying the 1G6.sup.his6 gene served as the
template for error-prone PCR for the second generation of mutants.
The error-prone PCR libraries were made and characterized as
described for the first generation of mutants. Again, roughly 3000
colonies were randomly selected for the total activity evaluation
at an elevated temperature in the high-throughput assay. The top 1%
of the colonies with higher total activities at 75.degree. C. than
1G6 were selected for regrowth and re-evaluation with the activity
assay. The total activities from culture supernatant of the top
five variants from the rescreen are shown in FIG. 3. Plasmid DNA
from the top five variants was recovered, and the region of Ce16a
gene was sequenced. The mutations of the top five clones are listed
in Table 4. Clone 2B3 was identified as the best performing
variant. It has a mutation that encodes the amino acid
substitution. Other mutations discovered among the top five
variants are N14S, M135L, S406P, S413P, and S413F.
TABLE-US-00004 TABLE 4 List of amino acid substitutions the top
five most active variants from generations one and two. AA
Generation Variant substitution 1 1E6 S30F, V128A 1 1E7 S293R 1 1F4
S413F 1 1F8 V131E 1 1G6 S317P 2 2B3 Q277L 2 2C5 N14S, S413P 2 2F4
M135L 2 2F11 S413F 2 2G6 S406P
Example 2
Enhanced Stability by Recombination of Stabilizing Mutations
[0123] The following example illustrates a method for improving the
total activity at elevated temperatures of a cellobiohydrolase by
recombining potentially beneficial mutations and screening the
resulting variants for higher stability. It also describes the
biochemical properties of such improved cellobiohydrolase
enzymes.
[0124] Plasmid p2B3 carrying the 2B3.sup.his6 gene served as the
template for the recombination of the mutations found in the first
two generations of random mutagenesis. The amino acid substitutions
included in the recombination library can be found in Table 5. Five
PCR fragments were generated using the primers listed in Table 6.
The fragments were isolated on 1% TAE agarose gels and purified
using the QIAquick Gel Extraction Kit (Qiagen). Fragments 1 and 2
were joined together via overlap extension PCR, while fragment 4
and 5 were joined together also via overlap extension PCR. The
recombinant library PCR insert was subsequently made using fragment
1+2, 3, and 4+5 using overlap extension PCR.
TABLE-US-00005 TABLE 5 List of amino acid mutations included in the
recombination library Amino Amino acid Acid substitution included
Position in 2B3 Mutation in the library 30 Ser Phe Ser, Phe 128 Val
Ala Val, Ala 131 Val Glu Val, Glu 135 Met Leu Met, Leu 293 Ser Arg
Ser, Arg 406 Ser Pro Ser, Pro 413 Ser -- Ser
TABLE-US-00006 TABLE 6 List of primers used to generate the
recombination library Fragment Primers used to clone the amino acid
in 2B3 Primers used to clone the library mutation 1 alpha_HomeRe_Lt
WT30_bottom alpha_HomeRe_Lt S30F_bottom 2 WT30_top
WT128/131/135_bottom S30F_top V128A_bottom, V131E_bottom,
M135L_bottom, V128A/V131E_bottom, V128A/M135L_bottom,
V131E/M135L_bottom, 128/131/135_bottom 3 WT128/131/135_top
WT293_bottom V128A_top, S293R_bottom V131E_top, M135L_top,
V128A/V131E_top, V128A/M135L_top, V131E/M135L_top, 128/131/135_top
4 WT293_top WT406_bottom S293R_top S406P_bottom 5 WT406_top
His_HomRe_Rt S406P_top His_HomRe_Rt
[0125] The recombinant library was expressed in yeast, and roughly
600 colonies were randomly selected for total activity evaluation
at an elevated temperature in the high-throughput assay. The top 6%
of the colonies with higher total activities at 75.degree. C. than
2B3 were selected for regrowth and re-evaluation with the activity
assay. The total activities of 3-day culture supernatants of the
top five variants from the rescreen are shown in FIG. 4. Plasmid
DNA was recovered from the top five variants, and the region of
Ce16a gene was sequenced. The mutations in the top five variants
are listed in Table 7. Variant 3C6 was identified as the best
performing variant from the high-throughput screen. Mutation S413F
and S413P identified in the previous libraries as beneficial were
combined in variant 3C6. The total activities of the variants, as
well as that of HJPlus and the best variants from each generation,
are shown in FIG. 5. Variant 3C6P was identified to be superior to
3C6F. The best variant 3C6P from the recombinant library contains
the mutation S30F, V128A, M135L, Q277L, S317P, S406P, and S413P in
the background of HJPlus Ce16a (see, e.g., US Patent Publication
No. 2010/0304464-A1, which is incorporated herein by
reference).
TABLE-US-00007 TABLE 7 The mutations of the top five variants from
the recombination library with respect to 2B3 Variants Mutation(s)
with respect to 2B3 3C6 S30F, V128A, M135L, S406P 3D6 M135L, S406P
3D8 S30F, V131E 3E5 V131E, M135L, S293R, S406P 3E8 S30F, M135L,
S406P
Example 3
Identifying Stabilizing Mutations by Site-Saturation Mutagenesis at
Key Positions
[0126] The following example illustrates a method for improving the
total activity at elevated temperatures of a cellobiohydrolase and
also describes the biochemical properties of such improved
cellobiohydrolase enzymes.
[0127] The random mutagenesis libraries described above identified
10 amino acid positions as important for improving the total
activity of the cellobiohydrolase at elevated temperatures. The
amino acid positions are N14, S30, V128, V131, M135, Q277, S293,
S317, S406, and S413 based on the sequence of HJPlus. Plasmid
pHJPlus carrying the HJPlus.sup.his6 gene served as the template
for the NNK libraries at the beneficial positions described above.
The primers used to construct the NNK libraries can be found in
Table 8. The NNK libraries were expressed in yeast, and roughly 90
colonies per NNK library were randomly selected for total activity
evaluation at an elevated temperature in the high-throughput assay.
Colonies showing an increase of 10% or higher in total activity at
75.degree. C. than HJPlus were selected for regrowth and
re-evaluation with the activity assay. The plasmid DNA of the top
variants at each amino acid position from the rescreen were
recovered, and the region of Ce16a gene was sequenced. The
beneficial mutations identified from the random mutagenesis
libraries were also found as the top variants in the NNK libraries.
In other words, the top variants in the NNK libraries identified
the same mutations as beneficial as the random mutagenesis
libraries. The total activity from 3-day culture supernatant of the
top five variants is shown in FIG. 6, with the variants identified
by the mutations they contain. Among the top five variants, two new
beneficial substitutions were discovered: S317W (SEQ ID NO:11 and
12, polynucleotide and polypeptide, respectively) and S413W (SEQ ID
NO:13 and 14, polynucleotide and polypeptide, respectively).
TABLE-US-00008 TABLE 8 The primers used to construct the NNK
libraries at the ten beneficial positions identified in the random
mutagenesis libraries Position Left primer Right primer N14 N14NNK
Lt N14 Rt S30 S30NNK Lt S30 Rt V128 V128NNK Lt V128 Rt V131 V131NNK
Lt V131 Rt M135 M135NNK Lt M135 Rt Q277 Q277NNK Lt Q277 Rt S293
S293NNK Lt S293 Rt S317 S317NNK Lt S317 Rt S406 S406NNK Lt S406 Rt
S413 S413NNK Lt S413 Rt
Example 4
Biochemical Analysis of the Top Variants
[0128] The following example describes the biochemical properties
of the improved cellobiohydrolase enzymes discovered above.
[0129] HJPlus, the top variants from the NNK libraries (S317W and
S413W), and the best variant from each generation of the
mutagenesis libraries (1F4, 1G6, 2B3, 3C6, and 3C6P), as well as
other top variants from the mutagenesis libraries (2F4, and 2G6)
were expressed in yeast and purified using the AKTApurifier.TM.
FPLC system as described in the methods section. The half-lives of
the purified enzymes were determined at 75.degree. C. in 50 mM
sodium acetate buffer, pH 5.0, and the thermal deactivation in 50
mM sodium acetate buffer, pH 5.0 over time was observed to follow a
first-order rate equation. As shown in FIG. 7, after three rounds
of directed evolution, the half-life of the best variant, 3C6P, at
75.degree. C. increased approximately twenty-fold compared to
HJPlus, from 9.5 minutes to 190 minutes.
[0130] The T.sub.50 values of the purified enzymes in 50 mM sodium
acetate buffer, pH 5.0 were also determined. The T.sub.50 values of
HJPlus, the top two variants from the NNK libraries (S317W and
S413W), and the top variants from the mutagenesis libraries (1F4,
1G6, 2B3, 2F4, 2G6, 3C6, and 3C6P) were measured and summarized in
Table 9. The top mutations contributed up to 2.4.degree. C. in the
T.sub.50 values. The T.sub.50 value of 3C6P increased by
7.9.degree. C., from 71.9 .degree. C. to 79.8 .degree. C., from
HJPlus. The improvements in total activities observed during the
high throughput assay at 75.degree. C. can be attributed to a
significant increase in the thermostability of the variants.
TABLE-US-00009 TABLE 9 The T.sub.50 values for HJPlus and the top
variants from the NNK libraries, the random mutagenesis libraries,
and the recombination library Variants T50 (.degree. C.)
Mutation(s) with respect to HJPlus HJPlus 71.9 .+-. 0.6 -- S317W
73.6 .+-. 0.5 S317W S413W 74.3 .+-. 0.3 S413W 1F4 73.0 .+-. 0.3
S413F 1G6 73.2 .+-. 0.3 S317P 2B3 75.7 .+-. 0.3 Q277L, S317P 2F4
75.0 .+-. 0.2 M135L, S317P 2G6 75.3 .+-. 0.1 S317P, S406P 3C6 76.9
.+-. 0.2 S30F, V128A, M135L, Q277L, S317P, 406P 3C6P 79.8 .+-. 0.3
S30F, V128A, M135L, Q277L, S317P, 406P, S413P
Example 5
Investigating the pH Dependency of the Top Variants
[0131] The following example illustrates a method of identifying
residue site(s) for improvements and investigating the pH
dependency of the variants at elevated temperatures.
[0132] At high temperatures, certain amino residues such as
cysteine or asparagine are prone to chemical modification or
destruction that can lead to irreversible thermal inactivation of
the enzyme. To examine the effect of cysteine on the thermal
inactivation of Family 6 cellulase, the mutation C246G was
introduced into the top variant 3C6P, expressed it in yeast, and
purified the Ce16 variant using the AKTApurifier.TM. FPLC system as
described in the methods section. The residual activities of the
purified C246G Ce16a enzyme after 15-minute inactivation at
70.degree. C. through 90.degree. C. was examined in 50 mM sodium
acetate buffer, pH 5.0, and compared to that of 3C6P.
Interestingly, C246G retained a baseline activity after 15-minute
incubation at 90.degree. C., where 3C6P was completely inactivated
in the same reaction condition. Further examination showed that the
effect was pH-dependent. The baseline activity at 90.degree. C. was
the most pronounced at pH 6 and pH 7, followed by pH 5 and pH 8,
while 3C6P completely deactivated in the same conditions. At pH 7,
the C246G variant retained 73% of the activity after 15-minute
inactivation at 90.degree. C. (0.29 mM) compared to the residual
activity at 70.degree. C. (0.40 mM). At pH 6 where C246G is the
most active, the variant retained 51% of the activity after
15-minute inactivation at 90.degree. C. (0.26 mM) compared to the
residual activity at 70.degree. C. (0.50 mM). The residual
activities of 3C6P and C246G between pH 4 and 9 after 15-minute
inactivation at 70.degree. C. through 90.degree. C. are shown in
FIG. 8.
[0133] The half-life of C246G was determined as well, and the
thermal deactivation was observed to follow a first-order rate
equation. The half-life of C246G is the longest at pH 6, followed
by pH 7, 8, 5, 9, and 4, demonstrating thermostability as well as
stability at alkaline conditions. The half-life of C246G was up to
83 minutes at pH 6, while the half-life of 3C6P at 90.degree. C. is
less than 5 minutes at various pH. The half-lives of C246G at
90.degree. C. at various pH are summarized in FIG. 9.
[0134] In addition to measuring the residual activity of C246G
after thermal inactivation in the form of T.sub.50 values and
half-lives at 90.degree. C., the total activities of C246G at
various temperatures were measured as well. Specifically, the total
activities of 3C6P and C246G after 2 hours of incubation at
80.degree. C. and after 4 hours of incubation at 90.degree. C. were
measured and compared across different pHs. As shown in FIG. 10,
3C6P and C246G released the same concentration of cellobiose
equivalent across different pHs and at both 80.degree. C. and
90.degree. C. The only exception is the activity of C246G at pH 4
where C246G exhibited slightly lower activity than 3C6P. Combining
our observation on the stability of the C246G variant, this shows
that the mutation C246G can greatly enhances the stability of a
thermostable Family 6 cellulase, without compromising on the
activity of the enzyme.
[0135] To investigate the mechanism behind the stabilizing effect
of the C246G mutation, other amino acid substitution at residue 246
were tested. Three other variants having mutations at residue C246
in the background of 3C6P were constructed and purified: C246S,
C246A, and C246L. The activities of the new variants were
determined after inactivating them across a temperature gradient
between 70.degree. C. and 90.degree. C. for 15 minutes at pH 7.0.
As shown in FIG. 11, at pH 7.0 all four variants with mutations at
residue C246 exhibited a similar residual activity profile as that
of C246G; all four variants retained roughly 35% to 69% activity
after heat inactivation.
Example 6
Effect of the pH-Dependent Mutation in the Background of H.
jecorina and H. insolens Ce16a
[0136] The following example described the biochemical properties
of the pH-dependent mutation in the background of H. jecorina Ce16a
and of H. insolens.
[0137] Mutation glycine at position 246 (the numbering based on
HJPlus) is introduced into the Cel6a enzyme from H. jecorina, which
has a cysteine at position 269, and into the Cel6a enzyme from H.
insolens, which has a leucine at position 276. The variants HJ
C269G and HI L276G were expressed in yeast and purified using the
AKTApurifier.TM. FPLC system as described in the methods section.
The residual activities of the purified HJ C269G and HI L276G after
15-minute inactivation was measured at pH 4 to 9 to examine whether
the same retention of baseline activity is observed in other Family
6 cellulases. As shown in FIGS. 12 and 13, the mutation glycine at
position 269 and 276 does not stabilize the Ce16a from H. jecorina
and H. insolens as it did in HJPlus, as measured by the residual
activities after 15-minute thermal inactivation. This is in stark
contrast to the C246G variant (in the background of 3C6P), where
the variant retained a high fraction of its residual activity, even
as the temperature of thermal inactivation increased to 90.degree.
C. As demonstrated here, this is believed to be due to the fact
that both HJ C269G and HI L276G contained another free cysteine
that is preventing the enzymes from being thermostabilized by the
new mutation as it did in C246G.
Example 7
Effect of the Beneficial Mutations in the Background of H. jecorina
Ce16a
[0138] The following example describes the biochemical properties
of the beneficial mutations in the background of H. jecorina
Ce16a.
[0139] Mutations S54F, S316R, and S430P were introduced into the
Ce16a enzyme from H. jecorina and expressed in yeast. 4-day yeast
culture supernatants were purified using the AKTApurifier.TM. FPLC
system as described in the methods section. The T.sub.50 values of
the purified enzymes in 50 mM sodium acetate buffer, pH 5.0 were
determined and summarized in Table 10. The mutations contributed up
to 1.7.degree. C. in the T.sub.50 values, from 60.degree. C. to
61.7.degree. C. This shows that the mutations not only stabilize
the HJPlus Ce16a enzyme but also the Ce16a enzyme from its closest
parent, H. jecorina. The total activities of the enzymes after 2
hours of incubation at 50.degree. C. and 60.degree. C. were
measured in 50 mM NaOAc buffer, pH 5.0. As shown in FIG. 14, the
improvements in the T.sub.50 value translated to increases in total
activity of the enzyme after 2 hours. The mutants demonstrated an
increase up to 13% in total activity at 50.degree. C., from 0.23 mM
of cellobiose equivalents to 0.26 mM, and an increase up to 19% in
total activity at 60.degree. C., from 0.26 mM to 0.31 mM. As
demonstrated here, it is believed that the beneficial mutations
discovered in the background of HJPlus are applicable to other
cellulases that share high sequence and/or structural homology with
HJPlus, including H. jecoria, H. insolens, C. thermophilum, from
which HJPlus is derived, as well as other Family 6 cellulases not
listed here. Sequence homology is defined as high when it is 50% or
more compared to the sequence of HJPlus. In addition, structural
homology is defined as the ones that share the same structural
topologies as HJPlus.
TABLE-US-00010 TABLE 10 The T.sub.50 values for H. jecorina (HJ)
Cel6a and the beneficial mutations in the background of H. jecorina
Cel6a Mutation with respect Variants T50 (.degree. C.) to H.
jecorina H. jecorina 60.0 .+-. 0.3 -- HJ S54F 60.4 .+-. 0.3 S54F HJ
S316R 60.1 .+-. 0.3 S316R HJ S430P 61.7 .+-. 0.1 S430P
[0140] The foregoing examples are provided to further explain but
not limit the disclosure.
Sequence CWU 1
1
11211362DNAArtificial SequenceHJPlus Cel6a variant 1gct agc tgc tca
agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser Cys Ser
Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5 10 15 ggt ccg
act tgc tgt gct tcc gga agc aca tgc gtc tac tcc aac gac 96Gly Pro
Thr Cys Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp 20 25 30
tat tac tcc cag tgt ctt ccc ggc gct gca agc tca agc tcg tcc acg
144Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr
35 40 45 cgc gcc gcg tcg acg act tct cga gta tcc ccc aca aca tcc
cgg tcg 192Arg Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser
Arg Ser 50 55 60 agc tcc gcg acg cct cca cct ggt tct act act acc
aga gta cct cca 240Ser Ser Ala Thr Pro Pro Pro Gly Ser Thr Thr Thr
Arg Val Pro Pro 65 70 75 80 gtc gga tcg gga acc gct acg tat tca ggt
aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly
Asn Pro Phe Glu Gly Val 85 90 95 cag ctg tgg gct aat aac tat tat
aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn Tyr Tyr
Arg Ser Glu Val His Thr Leu Ala 100 105 110 att ccg caa att aca gac
ccc gcg ttg cgt gcc gca gct agt gct gtg 384Ile Pro Gln Ile Thr Asp
Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115 120 125 gct gag gtg cca
agt ttt atg tgg ctg gat act ttg gac aaa acc ccc 432Ala Glu Val Pro
Ser Phe Met Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135 140 tta atg
gaa caa acg ttg gct gat ata cgt act gcg aat aaa aac ggc 480Leu Met
Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala Asn Lys Asn Gly 145 150 155
160 ggc aat tat gct gga caa ttt gtg gtt tat gac ctg ccg gat aga gat
528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp
165 170 175 tgt gct gca cta gcg agc aac ggg gag tac agc att gcg gat
ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp
Gly Gly 180 185 190 gtc gca aag tac aaa aac tat ata gat act atc agg
caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg
Gln Ile Val Val 195 200 205 gaa tac agt gat att cgt acg ctg ctt gta
atc gaa ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val
Ile Glu Pro Asp Ser Leu 210 215 220 gcg aac ttg gta aca aat cta ggt
act ccg aag tgt gcg aac gcg cag 720Ala Asn Leu Val Thr Asn Leu Gly
Thr Pro Lys Cys Ala Asn Ala Gln 225 230 235 240 agt gct tat ctt gag
tgc atc aat tat gca gtc acc cag ttg aat ttg 768Ser Ala Tyr Leu Glu
Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245 250 255 cca aac gtt
gca atg tat ctt gat gct ggt cat gcc ggg tgg ttg ggt 816Pro Asn Val
Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp Leu Gly 260 265 270 tgg
cca gca aat cag gat ccc gct gcg cag ctg ttt gca aat gtt tac 864Trp
Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn Val Tyr 275 280
285 aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt gca aca aat gtt
912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val
290 295 300 gct aat tac aac gct tgg tca ata gcg agt cct cca tcg tac
aca agc 960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Ser Tyr
Thr Ser 305 310 315 320 cct aac cca aac tac gat gag aag cat tac ata
gaa gca ttt gct cct 1008Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile
Glu Ala Phe Ala Pro 325 330 335 ttg ctt cgt aac caa ggt ttt gat gca
aag ttt atc gtc gat acc gga 1056Leu Leu Arg Asn Gln Gly Phe Asp Ala
Lys Phe Ile Val Asp Thr Gly 340 345 350 aga aac ggc aag cag ccg aca
ggg cag cta gaa tgg ggg cac tgg tgc 1104Arg Asn Gly Lys Gln Pro Thr
Gly Gln Leu Glu Trp Gly His Trp Cys 355 360 365 aat gtc aag ggt acg
ggt ttc ggt gtt aga ccc acg gct aac act ggg 1152Asn Val Lys Gly Thr
Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375 380 cat gag ttg
gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca 1200His Glu Leu
Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser 385 390 395 400
gat gga acg agt gat tct tct gct cca agg ttc gat tct cat tgc gca
1248Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415 tta cca gat gct ttg cag cca gca cct caa gca gga gct tgg
ttc caa 1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp
Phe Gln 420 425 430 gct tat ttt gta caa tta ctg act aac gcc aat cct
agt ttt cta cat 1344Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro
Ser Phe Leu His 435 440 445 cac cat cac cac cat tag 1362His His His
His His 450 2453PRTArtificial SequenceSynthetic Construct 2Ala Ser
Cys Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5 10 15
Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp 20
25 30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser
Thr 35 40 45 Arg Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr
Ser Arg Ser 50 55 60 Ser Ser Ala Thr Pro Pro Pro Gly Ser Thr Thr
Thr Arg Val Pro Pro 65 70 75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser
Gly Asn Pro Phe Glu Gly Val 85 90 95 Gln Leu Trp Ala Asn Asn Tyr
Tyr Arg Ser Glu Val His Thr Leu Ala 100 105 110 Ile Pro Gln Ile Thr
Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115 120 125 Ala Glu Val
Pro Ser Phe Met Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135 140 Leu
Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala Asn Lys Asn Gly 145 150
155 160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg
Asp 165 170 175 Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala
Asp Gly Gly 180 185 190 Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile
Arg Gln Ile Val Val 195 200 205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu
Val Ile Glu Pro Asp Ser Leu 210 215 220 Ala Asn Leu Val Thr Asn Leu
Gly Thr Pro Lys Cys Ala Asn Ala Gln 225 230 235 240 Ser Ala Tyr Leu
Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245 250 255 Pro Asn
Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp Leu Gly 260 265 270
Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn Val Tyr 275
280 285 Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn
Val 290 295 300 Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Ser
Tyr Thr Ser 305 310 315 320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr
Ile Glu Ala Phe Ala Pro 325 330 335 Leu Leu Arg Asn Gln Gly Phe Asp
Ala Lys Phe Ile Val Asp Thr Gly 340 345 350 Arg Asn Gly Lys Gln Pro
Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355 360 365 Asn Val Lys Gly
Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375 380 His Glu
Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser 385 390 395
400 Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415 Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp
Phe Gln 420 425 430 Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro
Ser Phe Leu His 435 440 445 His His His His His 450
31416DNAHypocrea jecorinaCDS(1)..(1416) 3atg att gtc ggc att ctc
acc acg ctg gct acg ctg gcc aca ctc gca 48Met Ile Val Gly Ile Leu
Thr Thr Leu Ala Thr Leu Ala Thr Leu Ala 1 5 10 15 gct agt gtg cct
cta gag gag cgg caa gct tgc tca agc gtc tgg ggc 96Ala Ser Val Pro
Leu Glu Glu Arg Gln Ala Cys Ser Ser Val Trp Gly 20 25 30 caa tgt
ggt ggc cag aat tgg tcg ggt ccg act tgc tgt gct tcc gga 144Gln Cys
Gly Gly Gln Asn Trp Ser Gly Pro Thr Cys Cys Ala Ser Gly 35 40 45
agc aca tgc gtc tac tcc aac gac tat tac tcc cag tgt ctt ccc ggc
192Ser Thr Cys Val Tyr Ser Asn Asp Tyr Tyr Ser Gln Cys Leu Pro Gly
50 55 60 gct gca agc tca agc tcg tcc acg cgc gcc gcg tcg acg act
tct cga 240Ala Ala Ser Ser Ser Ser Ser Thr Arg Ala Ala Ser Thr Thr
Ser Arg 65 70 75 80 gta tcc ccc aca aca tcc cgg tcg agc tcc gcg acg
cct cca cct ggt 288Val Ser Pro Thr Thr Ser Arg Ser Ser Ser Ala Thr
Pro Pro Pro Gly 85 90 95 tct act act acc aga gta cct cca gtc gga
tcg gga acc gct acg tat 336Ser Thr Thr Thr Arg Val Pro Pro Val Gly
Ser Gly Thr Ala Thr Tyr 100 105 110 tca ggc aac cct ttt gtt ggg gtc
act cct tgg gcc aat gca tat tac 384Ser Gly Asn Pro Phe Val Gly Val
Thr Pro Trp Ala Asn Ala Tyr Tyr 115 120 125 gcc tct gaa gtt agc agc
ctc gct att cct agc ttg act gga gcc atg 432Ala Ser Glu Val Ser Ser
Leu Ala Ile Pro Ser Leu Thr Gly Ala Met 130 135 140 gcc act gct gca
gca gct gtc gca aag gtt ccc tct ttt atg tgg cta 480Ala Thr Ala Ala
Ala Ala Val Ala Lys Val Pro Ser Phe Met Trp Leu 145 150 155 160 gat
act ctt gac aag acc cct ctc atg gag caa acc ttg gcc gac atc 528Asp
Thr Leu Asp Lys Thr Pro Leu Met Glu Gln Thr Leu Ala Asp Ile 165 170
175 cgc acc gcc aac aag aat ggc ggt aac tat gcc gga cag ttt gtg gtg
576Arg Thr Ala Asn Lys Asn Gly Gly Asn Tyr Ala Gly Gln Phe Val Val
180 185 190 tat gac ttg ccg gat cgc gat tgc gct gcc ctt gcc tcg aat
ggc gaa 624Tyr Asp Leu Pro Asp Arg Asp Cys Ala Ala Leu Ala Ser Asn
Gly Glu 195 200 205 tac tct att gcc gat ggt ggc gtc gcc aaa tat aag
aac tat atc gac 672Tyr Ser Ile Ala Asp Gly Gly Val Ala Lys Tyr Lys
Asn Tyr Ile Asp 210 215 220 acc att cgt caa att gtc gtg gaa tat tcc
gat atc cgg acc ctc ctg 720Thr Ile Arg Gln Ile Val Val Glu Tyr Ser
Asp Ile Arg Thr Leu Leu 225 230 235 240 gtt att gag cct gac tct ctt
gcc aac ctg gtg acc aac ctc ggt act 768Val Ile Glu Pro Asp Ser Leu
Ala Asn Leu Val Thr Asn Leu Gly Thr 245 250 255 cca aag tgt gcc aat
gct cag tca gcc tac ctt gag tgc atc aac tac 816Pro Lys Cys Ala Asn
Ala Gln Ser Ala Tyr Leu Glu Cys Ile Asn Tyr 260 265 270 gcc gtc aca
cag ctg aac ctt cca aat gtt gcg atg tat ttg gac gct 864Ala Val Thr
Gln Leu Asn Leu Pro Asn Val Ala Met Tyr Leu Asp Ala 275 280 285 ggc
cat gca gga tgg ctt ggc tgg ccg gca aac caa gac ccg gcc gct 912Gly
His Ala Gly Trp Leu Gly Trp Pro Ala Asn Gln Asp Pro Ala Ala 290 295
300 cag cta ttt gca aat gtt tac aag aat gca tcg tct ccg aga gct ctt
960Gln Leu Phe Ala Asn Val Tyr Lys Asn Ala Ser Ser Pro Arg Ala Leu
305 310 315 320 cgc gga ttg gca acc aat gtc gcc aac tac aac ggg tgg
aac att acc 1008Arg Gly Leu Ala Thr Asn Val Ala Asn Tyr Asn Gly Trp
Asn Ile Thr 325 330 335 agc ccc cca tcg tac acg caa ggc aac gct gtc
tac aac gag aag ctg 1056Ser Pro Pro Ser Tyr Thr Gln Gly Asn Ala Val
Tyr Asn Glu Lys Leu 340 345 350 tac atc cac gct att gga cct ctt ctt
gcc aat cac ggc tgg tcc aac 1104Tyr Ile His Ala Ile Gly Pro Leu Leu
Ala Asn His Gly Trp Ser Asn 355 360 365 gcc ttc ttc atc act gat caa
ggt cga tcg gga aag cag cct acc gga 1152Ala Phe Phe Ile Thr Asp Gln
Gly Arg Ser Gly Lys Gln Pro Thr Gly 370 375 380 cag caa cag tgg gga
gac tgg tgc aat gtg acc ggc acc gga ttt ggt 1200Gln Gln Gln Trp Gly
Asp Trp Cys Asn Val Thr Gly Thr Gly Phe Gly 385 390 395 400 att cgc
cca tcc gca aac act ggg gac tcg ttg ctg gat tcg ttt gtc 1248Ile Arg
Pro Ser Ala Asn Thr Gly Asp Ser Leu Leu Asp Ser Phe Val 405 410 415
tgg gtc aag cca ggc ggc gag tgt gac ggc acc agc gac agc agt gcg
1296Trp Val Lys Pro Gly Gly Glu Cys Asp Gly Thr Ser Asp Ser Ser Ala
420 425 430 cca cga ttt gac tcc cac tgt gcg ctc cca gat gcc ttg caa
ccg gcg 1344Pro Arg Phe Asp Ser His Cys Ala Leu Pro Asp Ala Leu Gln
Pro Ala 435 440 445 cct caa gct ggt gct tgg ttc caa gcc tac ttt gtg
cag ctt ctc aca 1392Pro Gln Ala Gly Ala Trp Phe Gln Ala Tyr Phe Val
Gln Leu Leu Thr 450 455 460 aac gca aac cca tcg ttc ctg taa 1416Asn
Ala Asn Pro Ser Phe Leu 465 470 4471PRTHypocrea jecorina 4Met Ile
Val Gly Ile Leu Thr Thr Leu Ala Thr Leu Ala Thr Leu Ala 1 5 10 15
Ala Ser Val Pro Leu Glu Glu Arg Gln Ala Cys Ser Ser Val Trp Gly 20
25 30 Gln Cys Gly Gly Gln Asn Trp Ser Gly Pro Thr Cys Cys Ala Ser
Gly 35 40 45 Ser Thr Cys Val Tyr Ser Asn Asp Tyr Tyr Ser Gln Cys
Leu Pro Gly 50 55 60 Ala Ala Ser Ser Ser Ser Ser Thr Arg Ala Ala
Ser Thr Thr Ser Arg 65 70 75 80 Val Ser Pro Thr Thr Ser Arg Ser Ser
Ser Ala Thr Pro Pro Pro Gly 85 90 95 Ser Thr Thr Thr Arg Val Pro
Pro Val Gly Ser Gly Thr Ala Thr Tyr 100 105 110 Ser Gly Asn Pro Phe
Val Gly Val Thr Pro Trp Ala Asn Ala Tyr Tyr 115 120 125 Ala Ser Glu
Val Ser Ser Leu Ala Ile Pro Ser Leu Thr Gly Ala Met 130 135 140 Ala
Thr Ala Ala Ala Ala Val Ala Lys Val Pro Ser Phe Met Trp Leu 145 150
155 160 Asp Thr Leu Asp Lys Thr Pro Leu Met Glu Gln Thr Leu Ala Asp
Ile 165 170 175 Arg Thr Ala Asn Lys Asn Gly Gly Asn Tyr Ala Gly Gln
Phe Val Val 180 185 190 Tyr Asp Leu Pro Asp Arg Asp Cys Ala Ala Leu
Ala Ser Asn Gly Glu 195 200 205 Tyr Ser Ile Ala Asp Gly Gly Val Ala
Lys Tyr Lys Asn Tyr Ile Asp 210
215 220 Thr Ile Arg Gln Ile Val Val Glu Tyr Ser Asp Ile Arg Thr Leu
Leu 225 230 235 240 Val Ile Glu Pro Asp Ser Leu Ala Asn Leu Val Thr
Asn Leu Gly Thr 245 250 255 Pro Lys Cys Ala Asn Ala Gln Ser Ala Tyr
Leu Glu Cys Ile Asn Tyr 260 265 270 Ala Val Thr Gln Leu Asn Leu Pro
Asn Val Ala Met Tyr Leu Asp Ala 275 280 285 Gly His Ala Gly Trp Leu
Gly Trp Pro Ala Asn Gln Asp Pro Ala Ala 290 295 300 Gln Leu Phe Ala
Asn Val Tyr Lys Asn Ala Ser Ser Pro Arg Ala Leu 305 310 315 320 Arg
Gly Leu Ala Thr Asn Val Ala Asn Tyr Asn Gly Trp Asn Ile Thr 325 330
335 Ser Pro Pro Ser Tyr Thr Gln Gly Asn Ala Val Tyr Asn Glu Lys Leu
340 345 350 Tyr Ile His Ala Ile Gly Pro Leu Leu Ala Asn His Gly Trp
Ser Asn 355 360 365 Ala Phe Phe Ile Thr Asp Gln Gly Arg Ser Gly Lys
Gln Pro Thr Gly 370 375 380 Gln Gln Gln Trp Gly Asp Trp Cys Asn Val
Thr Gly Thr Gly Phe Gly 385 390 395 400 Ile Arg Pro Ser Ala Asn Thr
Gly Asp Ser Leu Leu Asp Ser Phe Val 405 410 415 Trp Val Lys Pro Gly
Gly Glu Cys Asp Gly Thr Ser Asp Ser Ser Ala 420 425 430 Pro Arg Phe
Asp Ser His Cys Ala Leu Pro Asp Ala Leu Gln Pro Ala 435 440 445 Pro
Gln Ala Gly Ala Trp Phe Gln Ala Tyr Phe Val Gln Leu Leu Thr 450 455
460 Asn Ala Asn Pro Ser Phe Leu 465 470 51431DNAHumicola
insolensCDS(1)..(1431) 5atg gcc aag ttc ttc ctt act gct gcc ttt gcg
gct gcc gct ctc gcc 48Met Ala Lys Phe Phe Leu Thr Ala Ala Phe Ala
Ala Ala Ala Leu Ala 1 5 10 15 gct ccc gtt gtt gag gag cgc cag aac
tgt gcc ccg act tgg ggc cag 96Ala Pro Val Val Glu Glu Arg Gln Asn
Cys Ala Pro Thr Trp Gly Gln 20 25 30 tgc ggt ggc atc ggc ttc aat
ggc ccg act tgc tgc cag tct ggt agc 144Cys Gly Gly Ile Gly Phe Asn
Gly Pro Thr Cys Cys Gln Ser Gly Ser 35 40 45 acc tgc gtg aag cag
aac gac tgg tac tcc cag tgc ttg ccc ggt agc 192Thr Cys Val Lys Gln
Asn Asp Trp Tyr Ser Gln Cys Leu Pro Gly Ser 50 55 60 cag gtc acc
acg acc tcg act acg tcg act tcg agc tcg tcg acc acc 240Gln Val Thr
Thr Thr Ser Thr Thr Ser Thr Ser Ser Ser Ser Thr Thr 65 70 75 80 tcc
cgg gcc acc tcg acc acc agg acc ggt ggt gtg acc tcg atc acc 288Ser
Arg Ala Thr Ser Thr Thr Arg Thr Gly Gly Val Thr Ser Ile Thr 85 90
95 act gct ccc acc cgc acc gtc acc atc cct ggc ggt gcc acc acc acg
336Thr Ala Pro Thr Arg Thr Val Thr Ile Pro Gly Gly Ala Thr Thr Thr
100 105 110 gcc agc tac aac ggc aac ccc ttc gag ggt gtc cag ctc tgg
gcc aac 384Ala Ser Tyr Asn Gly Asn Pro Phe Glu Gly Val Gln Leu Trp
Ala Asn 115 120 125 aac tac tac cgc tct gag gtc cac acc ctc gcc att
cct cag atc acc 432Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala Ile
Pro Gln Ile Thr 130 135 140 gac cct gcc ttg agg gct gcg gcc tcg gcc
gtc gct gag gtc ccg agc 480Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala
Val Ala Glu Val Pro Ser 145 150 155 160 ttc cag tgg ctc gac cgc aac
gtc acg gtc gac acc ctg ctc gtc gag 528Phe Gln Trp Leu Asp Arg Asn
Val Thr Val Asp Thr Leu Leu Val Glu 165 170 175 acc ctc tct gag atc
cgc gcc gcg aac cag gcg ggc gcg aac ccc ccg 576Thr Leu Ser Glu Ile
Arg Ala Ala Asn Gln Ala Gly Ala Asn Pro Pro 180 185 190 tat gcc gcc
cag atc gtc gtt tac gac ctt cct gac cgc gac tgc gct 624Tyr Ala Ala
Gln Ile Val Val Tyr Asp Leu Pro Asp Arg Asp Cys Ala 195 200 205 gcc
gcg gct tcg aac ggc gag tgg gcg atc gcc aac aac ggc gcc aac 672Ala
Ala Ala Ser Asn Gly Glu Trp Ala Ile Ala Asn Asn Gly Ala Asn 210 215
220 aac tac aag gga tac atc aac cgg atc cgc gag att ctc att tcg ttc
720Asn Tyr Lys Gly Tyr Ile Asn Arg Ile Arg Glu Ile Leu Ile Ser Phe
225 230 235 240 tcg gat gtc cgc acg att ctg gtt atc gag ccc gac tcg
ctg gcc aac 768Ser Asp Val Arg Thr Ile Leu Val Ile Glu Pro Asp Ser
Leu Ala Asn 245 250 255 atg gtc acc aac atg aac gtc gcc aag tgc agc
ggt gcc gcc tcg acc 816Met Val Thr Asn Met Asn Val Ala Lys Cys Ser
Gly Ala Ala Ser Thr 260 265 270 tac cgc gag ttg acc atc tat gcc ctc
aag cag ctc gac ctc ccg cac 864Tyr Arg Glu Leu Thr Ile Tyr Ala Leu
Lys Gln Leu Asp Leu Pro His 275 280 285 gtc gcc atg tac atg gac gcc
ggc cac gct ggc tgg ctt ggc tgg ccc 912Val Ala Met Tyr Met Asp Ala
Gly His Ala Gly Trp Leu Gly Trp Pro 290 295 300 gcc aac atc cag ccc
gct gct gag ctc ttc gcc aag atc tac gag gat 960Ala Asn Ile Gln Pro
Ala Ala Glu Leu Phe Ala Lys Ile Tyr Glu Asp 305 310 315 320 gcc ggc
aag ccc cgc gcc gtc cgc ggt ctc gcc acc aac gtc gcc aac 1008Ala Gly
Lys Pro Arg Ala Val Arg Gly Leu Ala Thr Asn Val Ala Asn 325 330 335
tac aac gcc tgg agc atc tcg agc ccg ccg ccg tac acc agc ccc aac
1056Tyr Asn Ala Trp Ser Ile Ser Ser Pro Pro Pro Tyr Thr Ser Pro Asn
340 345 350 ccc aac tac gac gag aag cac tac atc gag gcc ttc cgc cct
ctc ctc 1104Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Arg Pro
Leu Leu 355 360 365 gag gcc cgc ggc ttc ccc gcc cag ttc atc gtc gac
cag ggc cgc agc 1152Glu Ala Arg Gly Phe Pro Ala Gln Phe Ile Val Asp
Gln Gly Arg Ser 370 375 380 ggc aag cag ccc acc ggc cag aag gaa tgg
ggc cac tgg tgc aat gcc 1200Gly Lys Gln Pro Thr Gly Gln Lys Glu Trp
Gly His Trp Cys Asn Ala 385 390 395 400 att ggc acc ggc ttc ggt atg
cgc ccg act gcc aac acc ggc cac cag 1248Ile Gly Thr Gly Phe Gly Met
Arg Pro Thr Ala Asn Thr Gly His Gln 405 410 415 tac gtc gac gcc ttc
gtc tgg gtc aag ccc ggc ggt gag tgc gac ggc 1296Tyr Val Asp Ala Phe
Val Trp Val Lys Pro Gly Gly Glu Cys Asp Gly 420 425 430 acc agc gac
acg acc gct gcc cgc tac gac tac cac tgc ggt ctc gag 1344Thr Ser Asp
Thr Thr Ala Ala Arg Tyr Asp Tyr His Cys Gly Leu Glu 435 440 445 gac
gcc ctc aag ccc gcc cct gag gcc ggc cag tgg ttc caa gcc tac 1392Asp
Ala Leu Lys Pro Ala Pro Glu Ala Gly Gln Trp Phe Gln Ala Tyr 450 455
460 ttt gag caa tta ctt cgt aat gcc aat ccg ccg ttc tga 1431Phe Glu
Gln Leu Leu Arg Asn Ala Asn Pro Pro Phe 465 470 475 6476PRTHumicola
insolens 6Met Ala Lys Phe Phe Leu Thr Ala Ala Phe Ala Ala Ala Ala
Leu Ala 1 5 10 15 Ala Pro Val Val Glu Glu Arg Gln Asn Cys Ala Pro
Thr Trp Gly Gln 20 25 30 Cys Gly Gly Ile Gly Phe Asn Gly Pro Thr
Cys Cys Gln Ser Gly Ser 35 40 45 Thr Cys Val Lys Gln Asn Asp Trp
Tyr Ser Gln Cys Leu Pro Gly Ser 50 55 60 Gln Val Thr Thr Thr Ser
Thr Thr Ser Thr Ser Ser Ser Ser Thr Thr 65 70 75 80 Ser Arg Ala Thr
Ser Thr Thr Arg Thr Gly Gly Val Thr Ser Ile Thr 85 90 95 Thr Ala
Pro Thr Arg Thr Val Thr Ile Pro Gly Gly Ala Thr Thr Thr 100 105 110
Ala Ser Tyr Asn Gly Asn Pro Phe Glu Gly Val Gln Leu Trp Ala Asn 115
120 125 Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala Ile Pro Gln Ile
Thr 130 135 140 Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val Ala Glu
Val Pro Ser 145 150 155 160 Phe Gln Trp Leu Asp Arg Asn Val Thr Val
Asp Thr Leu Leu Val Glu 165 170 175 Thr Leu Ser Glu Ile Arg Ala Ala
Asn Gln Ala Gly Ala Asn Pro Pro 180 185 190 Tyr Ala Ala Gln Ile Val
Val Tyr Asp Leu Pro Asp Arg Asp Cys Ala 195 200 205 Ala Ala Ala Ser
Asn Gly Glu Trp Ala Ile Ala Asn Asn Gly Ala Asn 210 215 220 Asn Tyr
Lys Gly Tyr Ile Asn Arg Ile Arg Glu Ile Leu Ile Ser Phe 225 230 235
240 Ser Asp Val Arg Thr Ile Leu Val Ile Glu Pro Asp Ser Leu Ala Asn
245 250 255 Met Val Thr Asn Met Asn Val Ala Lys Cys Ser Gly Ala Ala
Ser Thr 260 265 270 Tyr Arg Glu Leu Thr Ile Tyr Ala Leu Lys Gln Leu
Asp Leu Pro His 275 280 285 Val Ala Met Tyr Met Asp Ala Gly His Ala
Gly Trp Leu Gly Trp Pro 290 295 300 Ala Asn Ile Gln Pro Ala Ala Glu
Leu Phe Ala Lys Ile Tyr Glu Asp 305 310 315 320 Ala Gly Lys Pro Arg
Ala Val Arg Gly Leu Ala Thr Asn Val Ala Asn 325 330 335 Tyr Asn Ala
Trp Ser Ile Ser Ser Pro Pro Pro Tyr Thr Ser Pro Asn 340 345 350 Pro
Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Arg Pro Leu Leu 355 360
365 Glu Ala Arg Gly Phe Pro Ala Gln Phe Ile Val Asp Gln Gly Arg Ser
370 375 380 Gly Lys Gln Pro Thr Gly Gln Lys Glu Trp Gly His Trp Cys
Asn Ala 385 390 395 400 Ile Gly Thr Gly Phe Gly Met Arg Pro Thr Ala
Asn Thr Gly His Gln 405 410 415 Tyr Val Asp Ala Phe Val Trp Val Lys
Pro Gly Gly Glu Cys Asp Gly 420 425 430 Thr Ser Asp Thr Thr Ala Ala
Arg Tyr Asp Tyr His Cys Gly Leu Glu 435 440 445 Asp Ala Leu Lys Pro
Ala Pro Glu Ala Gly Gln Trp Phe Gln Ala Tyr 450 455 460 Phe Glu Gln
Leu Leu Arg Asn Ala Asn Pro Pro Phe 465 470 475 71431DNAChaetomium
thermophilumCDS(1)..(1431) 7atg gct aag cag ctg ctg ctc act gcc gct
ctt gcg gcc act tcg ctg 48Met Ala Lys Gln Leu Leu Leu Thr Ala Ala
Leu Ala Ala Thr Ser Leu 1 5 10 15 gct gcc cct ctc ctt gag gag cgc
cag agc tgc tcc tcc gtc tgg ggt 96Ala Ala Pro Leu Leu Glu Glu Arg
Gln Ser Cys Ser Ser Val Trp Gly 20 25 30 caa tgc ggt ggc atc aat
tac aac ggc ccg acc tgc tgc cag tcc ggc 144Gln Cys Gly Gly Ile Asn
Tyr Asn Gly Pro Thr Cys Cys Gln Ser Gly 35 40 45 agt gtt tgc act
tac ctg aat gac tgg tac agc cag tgc att ccc ggt 192Ser Val Cys Thr
Tyr Leu Asn Asp Trp Tyr Ser Gln Cys Ile Pro Gly 50 55 60 cag gct
cag ccc ggc acg act agc acc acg gct cgg acc acc agc acc 240Gln Ala
Gln Pro Gly Thr Thr Ser Thr Thr Ala Arg Thr Thr Ser Thr 65 70 75 80
agc acc acc agc act tcg tcg gtc cgc ccg acc acc tcg aat acc cct
288Ser Thr Thr Ser Thr Ser Ser Val Arg Pro Thr Thr Ser Asn Thr Pro
85 90 95 gtg acg act gct ccc ccg acg acc acc atc ccg ggc ggc gcc
tcg agc 336Val Thr Thr Ala Pro Pro Thr Thr Thr Ile Pro Gly Gly Ala
Ser Ser 100 105 110 acg gcc agc tac aac ggc aac ccg ttc tcg ggt gtc
caa ctt tgg gcc 384Thr Ala Ser Tyr Asn Gly Asn Pro Phe Ser Gly Val
Gln Leu Trp Ala 115 120 125 aac acc tac tac tcg tcc gag gtg cac act
ttg gcc atc ccc agc ttg 432Asn Thr Tyr Tyr Ser Ser Glu Val His Thr
Leu Ala Ile Pro Ser Leu 130 135 140 tct cct gag ctg gct gcc aag gcc
gcc aag gtc gct gag gtt ccc agc 480Ser Pro Glu Leu Ala Ala Lys Ala
Ala Lys Val Ala Glu Val Pro Ser 145 150 155 160 ttc cag tgg ctc gac
cgc aat gtg act gtt gac act ctc ttc tcc ggc 528Phe Gln Trp Leu Asp
Arg Asn Val Thr Val Asp Thr Leu Phe Ser Gly 165 170 175 act ctt gcc
gaa atc cgc gcc gcc aac cag cgc ggt gcc aac ccg cct 576Thr Leu Ala
Glu Ile Arg Ala Ala Asn Gln Arg Gly Ala Asn Pro Pro 180 185 190 tat
gcc ggc att ttc gtg gtt tat gac tta cca gac cgt gat tgc gcg 624Tyr
Ala Gly Ile Phe Val Val Tyr Asp Leu Pro Asp Arg Asp Cys Ala 195 200
205 gct gct gct tcg aac ggc gag tgg tct atc gcc aac aat ggt gcc aac
672Ala Ala Ala Ser Asn Gly Glu Trp Ser Ile Ala Asn Asn Gly Ala Asn
210 215 220 aac tac aag cgc tac atc gac cgg atc cgt gag ctc ctt atc
cag tac 720Asn Tyr Lys Arg Tyr Ile Asp Arg Ile Arg Glu Leu Leu Ile
Gln Tyr 225 230 235 240 tcc gat atc cgc act att ctg gtc att gaa cct
gat tcc ctg gcc aac 768Ser Asp Ile Arg Thr Ile Leu Val Ile Glu Pro
Asp Ser Leu Ala Asn 245 250 255 atg gtc acc aac atg aac gtc cag aag
tgc tcg aac gct gcc tcc act 816Met Val Thr Asn Met Asn Val Gln Lys
Cys Ser Asn Ala Ala Ser Thr 260 265 270 tac aag gag ctt act gtc tat
gcc ctc aaa cag ctc aat ctt cct cac 864Tyr Lys Glu Leu Thr Val Tyr
Ala Leu Lys Gln Leu Asn Leu Pro His 275 280 285 gtt gcc atg tac atg
gat gct ggc cac gct ggc tgg ctt ggc tgg ccc 912Val Ala Met Tyr Met
Asp Ala Gly His Ala Gly Trp Leu Gly Trp Pro 290 295 300 gcc aac atc
cag cct gct gct gag ctc ttt gct caa atc tac cgc gac 960Ala Asn Ile
Gln Pro Ala Ala Glu Leu Phe Ala Gln Ile Tyr Arg Asp 305 310 315 320
gct ggc agg ccc gct gct gtc cgc ggt ctt gcg acc aac gtt gcc aac
1008Ala Gly Arg Pro Ala Ala Val Arg Gly Leu Ala Thr Asn Val Ala Asn
325 330 335 tac aat gct tgg tcg atc gcc agc cct ccg tcc tac acc tct
cct aac 1056Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Ser Tyr Thr Ser
Pro Asn 340 345 350 ccg aac tac gac gag aag cac tat att gag gcc ttt
gct cct ctt ctc 1104Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe
Ala Pro Leu Leu 355 360 365 cgc aac cag ggc ttc gac gca aag ttc atc
gtc gac acc ggc cgt aac 1152Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile
Val Asp Thr Gly Arg Asn 370 375 380 ggc aag cag ccc act ggc cag ctt
gaa tgg ggt cac tgg tgc aat gtc 1200Gly Lys Gln Pro Thr Gly Gln Leu
Glu Trp Gly His Trp Cys Asn Val 385 390 395 400 aag gga act ggc ttc
ggt gtg cgc cct act gct aac act ggg cat gaa 1248Lys Gly Thr Gly Phe
Gly Val Arg Pro Thr Ala Asn Thr Gly His Glu 405 410 415 ctt gtt gat
gct ttc gtg tgg gtc aag ccc ggt ggc gag tcc gac ggc 1296Leu Val Asp
Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser Asp Gly 420 425 430
acc agc gac acc agc gct gct cgt tat gac tat cac tgc ggc ctt tcc
1344Thr Ser Asp Thr Ser Ala Ala Arg Tyr Asp Tyr His Cys Gly Leu Ser
435 440 445 gac gca ctg act ccg gcg cct gag gct ggc caa tgg ttc cag
gct tat 1392Asp Ala Leu Thr Pro Ala Pro Glu Ala Gly Gln Trp Phe Gln
Ala Tyr 450 455 460 ttc gaa cag ctg ctc atc aat gcc aac cct ccg ttc
tga 1431Phe Glu Gln Leu Leu Ile Asn Ala Asn Pro Pro Phe 465 470 475
8476PRTChaetomium thermophilum 8Met Ala Lys Gln Leu Leu Leu Thr Ala
Ala Leu Ala Ala Thr Ser Leu 1 5 10 15 Ala Ala Pro Leu Leu Glu Glu
Arg Gln Ser Cys Ser Ser Val Trp Gly 20 25 30 Gln Cys Gly Gly Ile
Asn Tyr Asn Gly Pro Thr Cys Cys Gln Ser Gly 35 40 45 Ser Val Cys
Thr Tyr Leu Asn Asp Trp Tyr Ser Gln Cys Ile Pro Gly 50 55 60 Gln
Ala Gln Pro Gly Thr Thr Ser Thr Thr Ala Arg Thr Thr Ser Thr 65 70
75 80 Ser Thr Thr Ser Thr Ser Ser Val Arg Pro Thr Thr Ser Asn Thr
Pro 85 90 95 Val Thr Thr Ala Pro Pro Thr Thr Thr Ile Pro Gly Gly
Ala Ser Ser 100 105 110 Thr Ala Ser Tyr Asn Gly Asn Pro Phe Ser Gly
Val Gln Leu Trp Ala 115 120 125 Asn Thr Tyr Tyr Ser Ser Glu Val His
Thr Leu Ala Ile Pro Ser Leu 130 135 140 Ser Pro Glu Leu Ala Ala Lys
Ala Ala Lys Val Ala Glu Val Pro Ser 145 150 155 160 Phe Gln Trp Leu
Asp Arg Asn Val Thr Val Asp Thr Leu Phe Ser Gly 165 170 175 Thr Leu
Ala Glu Ile Arg Ala Ala Asn Gln Arg Gly Ala Asn Pro Pro 180 185 190
Tyr Ala Gly Ile Phe Val Val Tyr Asp Leu Pro Asp Arg Asp Cys Ala 195
200 205 Ala Ala Ala Ser Asn Gly Glu Trp Ser Ile Ala Asn Asn Gly Ala
Asn 210 215 220 Asn Tyr Lys Arg Tyr Ile Asp Arg Ile Arg Glu Leu Leu
Ile Gln Tyr 225 230 235 240 Ser Asp Ile Arg Thr Ile Leu Val Ile Glu
Pro Asp Ser Leu Ala Asn 245 250 255 Met Val Thr Asn Met Asn Val Gln
Lys Cys Ser Asn Ala Ala Ser Thr 260 265 270 Tyr Lys Glu Leu Thr Val
Tyr Ala Leu Lys Gln Leu Asn Leu Pro His 275 280 285 Val Ala Met Tyr
Met Asp Ala Gly His Ala Gly Trp Leu Gly Trp Pro 290 295 300 Ala Asn
Ile Gln Pro Ala Ala Glu Leu Phe Ala Gln Ile Tyr Arg Asp 305 310 315
320 Ala Gly Arg Pro Ala Ala Val Arg Gly Leu Ala Thr Asn Val Ala Asn
325 330 335 Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Ser Tyr Thr Ser
Pro Asn 340 345 350 Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe
Ala Pro Leu Leu 355 360 365 Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile
Val Asp Thr Gly Arg Asn 370 375 380 Gly Lys Gln Pro Thr Gly Gln Leu
Glu Trp Gly His Trp Cys Asn Val 385 390 395 400 Lys Gly Thr Gly Phe
Gly Val Arg Pro Thr Ala Asn Thr Gly His Glu 405 410 415 Leu Val Asp
Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser Asp Gly 420 425 430 Thr
Ser Asp Thr Ser Ala Ala Arg Tyr Asp Tyr His Cys Gly Leu Ser 435 440
445 Asp Ala Leu Thr Pro Ala Pro Glu Ala Gly Gln Trp Phe Gln Ala Tyr
450 455 460 Phe Glu Gln Leu Leu Ile Asn Ala Asn Pro Pro Phe 465 470
475 9267DNAArtificial SequenceCBD-Linker 9gct agc tgc tca agc gtc
tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser Cys Ser Ser Val
Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5 10 15 ggt ccg act tgc
tgt gct tcc gga agc aca tgc gtc tac tcc aac gac 96Gly Pro Thr Cys
Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp 20 25 30 tat tac
tcc cag tgt ctt ccc ggc gct gca agc tca agc tcg tcc acg 144Tyr Tyr
Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35 40 45
cgc gcc gcg tcg acg act tct cga gta tcc ccc aca aca tcc cgg tcg
192Arg Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser
50 55 60 agc tcc gcg acg cct cca cct ggt tct act act acc aga gta
cct cca 240Ser Ser Ala Thr Pro Pro Pro Gly Ser Thr Thr Thr Arg Val
Pro Pro 65 70 75 80 gtc gga tcg gga acc gct acg tat tca 267Val Gly
Ser Gly Thr Ala Thr Tyr Ser 85 1089PRTArtificial SequenceSynthetic
Construct 10Ala Ser Cys Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn
Trp Ser 1 5 10 15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys Val
Tyr Ser Asn Asp 20 25 30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala
Ser Ser Ser Ser Ser Thr 35 40 45 Arg Ala Ala Ser Thr Thr Ser Arg
Val Ser Pro Thr Thr Ser Arg Ser 50 55 60 Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70 75 80 Val Gly Ser Gly
Thr Ala Thr Tyr Ser 85 111362DNAArtificial SequenceCel6A engineered
variant S317W 11gct agc tgc tca agc gtc tgg ggc caa tgt ggt ggc cag
aat tgg tcg 48Ala Ser Cys Ser Ser Val Trp Gly Gln Cys Gly Gly Gln
Asn Trp Ser 1 5 10 15 ggt ccg act tgc tgt gct tcc gga agc aca tgc
gtc tac tcc aac gac 96Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys
Val Tyr Ser Asn Asp 20 25 30 tat tac tcc cag tgt ctt ccc ggc gct
gca agc tca agc tcg tcc acg 144Tyr Tyr Ser Gln Cys Leu Pro Gly Ala
Ala Ser Ser Ser Ser Ser Thr 35 40 45 cgc gcc gcg tcg acg act tct
cga gta tcc ccc aca aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr Ser
Arg Val Ser Pro Thr Thr Ser Arg Ser 50 55 60 agc tcc gcg acg cct
cca cct ggt tct act act acc aga gta cct cca 240Ser Ser Ala Thr Pro
Pro Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70 75 80 gtc gga tcg
gga acc gct acg tat tca ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser
Gly Thr Ala Thr Tyr Ser Gly Asn Pro Phe Glu Gly Val 85 90 95 cag
ctg tgg gct aat aac tat tat aga tct gag gta cat aca ctg gcc 336Gln
Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala 100 105
110 att ccg caa att aca gac ccc gcg ttg cgt gcc gca gct agt gct gtg
384Ile Pro Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val
115 120 125 gct gag gtg cca agt ttt atg tgg ctg gat act ttg gac aaa
acc ccc 432Ala Glu Val Pro Ser Phe Met Trp Leu Asp Thr Leu Asp Lys
Thr Pro 130 135 140 tta atg gaa caa acg ttg gct gat ata cgt act gcg
aat aaa aac ggc 480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala
Asn Lys Asn Gly 145 150 155 160 ggc aat tat gct gga caa ttt gtg gtt
tat gac ctg ccg gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val
Tyr Asp Leu Pro Asp Arg Asp 165 170 175 tgt gct gca cta gcg agc aac
ggg gag tac agc att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn
Gly Glu Tyr Ser Ile Ala Asp Gly Gly 180 185 190 gtc gca aag tac aaa
aac tat ata gat act atc agg caa ata gtt gtc 624Val Ala Lys Tyr Lys
Asn Tyr Ile Asp Thr Ile Arg Gln Ile Val Val 195 200 205 gaa tac agt
gat att cgt acg ctg ctt gta atc gaa ccc gat tcc tta 672Glu Tyr Ser
Asp Ile Arg Thr Leu Leu Val Ile Glu Pro Asp Ser Leu 210 215 220 gcg
aac ttg gtg aca aat cta ggt act ccg aag tgt gcg aac gcg cag 720Ala
Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225 230
235 240 agt gct tat ctt gag tgc atc aat tat gca gtc acc cag ttg aat
ttg 768Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn
Leu 245 250 255 cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg
tgg ttg ggt 816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly
Trp Leu Gly 260 265 270 tgg cca gca aat cag gat ccc gct gcg cag ctg
ttt gca aat gtt tac 864Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu
Phe Ala Asn Val Tyr 275 280 285 aaa aat gcc tca agt cct aga gcg ctg
agg ggt ctt gca aca aat gtt 912Lys Asn Ala Ser Ser Pro Arg Ala Leu
Arg Gly Leu Ala Thr Asn Val 290 295 300 gct aat tac aac gct tgg tca
ata gcg agt cct cca tgg tac aca agc 960Ala Asn Tyr Asn Ala Trp Ser
Ile Ala Ser Pro Pro Trp Tyr Thr Ser 305 310 315 320 cct aac cca aac
tac gat gag aag cat tac ata gaa gca ttt gct cct 1008Pro Asn Pro Asn
Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro 325 330 335 ttg ctt
cgt aac caa ggt ttt gat gca aag ttt atc gtc gat acc gga 1056Leu Leu
Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly 340 345 350
aga aac ggc aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc
1104Arg Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys
355 360 365 aat gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac
act ggg 1152Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn
Thr Gly 370 375 380 cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc
gga gga gag tca 1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro
Gly Gly Glu Ser 385 390 395 400 gat gga acg agt gat tct tct gct cca
agg ttc gat tct cat tgc gca 1248Asp Gly Thr Ser Asp Ser Ser Ala Pro
Arg Phe Asp Ser His Cys Ala 405 410 415 tta cca gat gct ttg cag cca
gca cct caa gca gga gct tgg ttc caa 1296Leu Pro Asp Ala Leu Gln Pro
Ala Pro Gln Ala Gly Ala Trp Phe Gln 420 425 430 gct tat ttt gta caa
tta ctg act aac gcc aat cct agt ttt cta cat 1344Ala Tyr Phe Val Gln
Leu Leu Thr Asn Ala Asn Pro Ser Phe Leu His 435 440 445 cac cat cac
cac cat tag 1362His His His His His 450 12453PRTArtificial
SequenceSynthetic Construct 12Ala Ser Cys Ser Ser Val Trp Gly Gln
Cys Gly Gly Gln Asn Trp Ser 1 5 10 15 Gly Pro Thr Cys Cys Ala Ser
Gly Ser Thr Cys Val Tyr Ser Asn Asp 20 25 30 Tyr Tyr Ser Gln Cys
Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35 40 45 Arg Ala Ala
Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50 55 60 Ser
Ser Ala Thr Pro Pro Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn Pro Phe Glu Gly
Val 85 90 95 Gln Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His
Thr Leu Ala 100 105 110 Ile Pro Gln Ile Thr Asp Pro Ala Leu Arg Ala
Ala Ala Ser Ala Val 115 120 125 Ala Glu Val Pro Ser Phe Met Trp Leu
Asp Thr Leu Asp Lys Thr Pro 130 135 140 Leu Met Glu Gln Thr Leu Ala
Asp Ile Arg Thr Ala Asn Lys Asn Gly 145 150 155 160 Gly Asn Tyr Ala
Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp 165 170 175 Cys Ala
Ala Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp Gly Gly 180 185 190
Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg Gln Ile Val Val 195
200 205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu Pro Asp Ser
Leu 210 215 220 Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala
Asn Ala Gln 225 230 235 240 Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala
Val Thr Gln Leu Asn Leu 245 250 255 Pro Asn Val Ala Met Tyr Leu Asp
Ala Gly His Ala Gly Trp Leu Gly 260 265 270 Trp Pro Ala Asn Gln Asp
Pro Ala Ala Gln Leu Phe Ala Asn Val Tyr 275 280 285 Lys Asn Ala Ser
Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val 290 295 300 Ala Asn
Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Trp Tyr Thr Ser 305 310 315
320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro
325 330 335 Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp
Thr Gly 340 345 350 Arg Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp
Gly His Trp Cys 355 360 365 Asn Val Lys Gly Thr Gly Phe Gly Val Arg
Pro Thr Ala Asn Thr Gly 370 375 380 His Glu Leu Val Asp Ala Phe Val
Trp Val Lys Pro Gly Gly Glu Ser 385 390 395 400 Asp Gly Thr Ser Asp
Ser Ser Ala Pro Arg Phe Asp Ser His Cys Ala 405 410 415 Leu Pro Asp
Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln 420 425 430 Ala
Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro Ser Phe Leu His 435 440
445 His His His His His 450 131362DNAArtificial SequenceCel6a
engineered variant S413W 13gct agc tgc tca agc gtc tgg ggc caa tgt
ggt ggc cag aat tgg tcg 48Ala Ser Cys Ser Ser Val Trp Gly Gln Cys
Gly Gly Gln Asn Trp Ser 1 5 10 15 ggt ccg act tgc tgt gct tcc gga
agc aca tgc gtc tac tcc aac gac 96Gly Pro Thr Cys Cys Ala Ser Gly
Ser Thr Cys Val Tyr Ser Asn Asp 20 25 30 tat tac tcc cag tgt ctt
ccc ggc gct gca agc tca agc tcg tcc acg 144Tyr Tyr Ser Gln Cys Leu
Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35 40 45 cgc gcc gcg tcg
acg act tct cga gta tcc ccc aca aca tcc cgg tcg 192Arg Ala Ala Ser
Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50 55 60 agc tcc
gcg acg cct cca cct ggt tct act act acc aga gta cct cca 240Ser Ser
Ala Thr Pro Pro Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70 75 80
gtc gga tcg gga acc gct acg tat tca ggt aac ccc ttt gaa ggt gtt
288Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn Pro Phe Glu Gly Val
85 90 95 cag ctg tgg gct aat aac tat tat aga tct gag gta cat aca
ctg gcc 336Gln Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr
Leu Ala 100 105 110 att ccg caa att aca gac ccc gcg ttg cgt gcc gca
gct agt gct gtg 384Ile Pro Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala
Ala Ser Ala Val 115 120
125 gct gag gtg cca agt ttt atg tgg ctg gat act ttg gac aaa acc ccc
432Ala Glu Val Pro Ser Phe Met Trp Leu Asp Thr Leu Asp Lys Thr Pro
130 135 140 tta atg gaa caa acg ttg gct gat ata cgt act gcg aat aaa
aac ggc 480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala Asn Lys
Asn Gly 145 150 155 160 ggc aat tat gct gga caa ttt gtg gtt tat gac
ctg ccg gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp
Leu Pro Asp Arg Asp 165 170 175 tgt gct gca cta gcg agc aac ggg gag
tac agc att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu
Tyr Ser Ile Ala Asp Gly Gly 180 185 190 gtc gca aag tac aaa aac tat
ata gat act atc agg caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr
Ile Asp Thr Ile Arg Gln Ile Val Val 195 200 205 gaa tac agt gat att
cgt acg ctg ctt gta atc gaa ccc gat tcc tta 672Glu Tyr Ser Asp Ile
Arg Thr Leu Leu Val Ile Glu Pro Asp Ser Leu 210 215 220 gcg aac ttg
gtg aca aat cta ggt act ccg aag tgt gcg aac gcg cag 720Ala Asn Leu
Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225 230 235 240
agt gct tat ctt gag tgc atc aat tat gca gtc acc cag ttg aat ttg
768Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu
245 250 255 cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg tgg
ttg ggt 816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp
Leu Gly 260 265 270 tgg cca gca aat cag gat ccc gct gcg cag ctg ttt
gca aat gtt tac 864Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe
Ala Asn Val Tyr 275 280 285 aaa aat gcc tca agt cct aga gcg ctg agg
ggt ctt gca aca aat gtt 912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg
Gly Leu Ala Thr Asn Val 290 295 300 gct aat tac aac gct tgg tca ata
gcg agt cct cca tcg tac aca agc 960Ala Asn Tyr Asn Ala Trp Ser Ile
Ala Ser Pro Pro Ser Tyr Thr Ser 305 310 315 320 cct aac cca aac tac
gat gag aag cat tac ata gaa gca ttt gct cct 1008Pro Asn Pro Asn Tyr
Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro 325 330 335 ttg ctt cgt
aac caa ggt ttt gat gca aag ttt atc gtc gat acc gga 1056Leu Leu Arg
Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly 340 345 350 aga
aac ggc aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc 1104Arg
Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355 360
365 aat gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg
1152Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly
370 375 380 cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga
gag tca 1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly
Glu Ser 385 390 395 400 gat gga acg agt gat tct tct gct cca agg ttc
gat tgg cat tgc gca 1248Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe
Asp Trp His Cys Ala 405 410 415 tta cca gat gct ttg cag cca gca cct
caa gca gga gct tgg ttc caa 1296Leu Pro Asp Ala Leu Gln Pro Ala Pro
Gln Ala Gly Ala Trp Phe Gln 420 425 430 gct tat ttt gta caa tta ctg
act aac gcc aat cct agt ttt cta cat 1344Ala Tyr Phe Val Gln Leu Leu
Thr Asn Ala Asn Pro Ser Phe Leu His 435 440 445 cac cat cac cac cat
tag 1362His His His His His 450 14453PRTArtificial
SequenceSynthetic Construct 14Ala Ser Cys Ser Ser Val Trp Gly Gln
Cys Gly Gly Gln Asn Trp Ser 1 5 10 15 Gly Pro Thr Cys Cys Ala Ser
Gly Ser Thr Cys Val Tyr Ser Asn Asp 20 25 30 Tyr Tyr Ser Gln Cys
Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35 40 45 Arg Ala Ala
Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50 55 60 Ser
Ser Ala Thr Pro Pro Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn Pro Phe Glu Gly
Val 85 90 95 Gln Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His
Thr Leu Ala 100 105 110 Ile Pro Gln Ile Thr Asp Pro Ala Leu Arg Ala
Ala Ala Ser Ala Val 115 120 125 Ala Glu Val Pro Ser Phe Met Trp Leu
Asp Thr Leu Asp Lys Thr Pro 130 135 140 Leu Met Glu Gln Thr Leu Ala
Asp Ile Arg Thr Ala Asn Lys Asn Gly 145 150 155 160 Gly Asn Tyr Ala
Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp 165 170 175 Cys Ala
Ala Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp Gly Gly 180 185 190
Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg Gln Ile Val Val 195
200 205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu Pro Asp Ser
Leu 210 215 220 Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala
Asn Ala Gln 225 230 235 240 Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala
Val Thr Gln Leu Asn Leu 245 250 255 Pro Asn Val Ala Met Tyr Leu Asp
Ala Gly His Ala Gly Trp Leu Gly 260 265 270 Trp Pro Ala Asn Gln Asp
Pro Ala Ala Gln Leu Phe Ala Asn Val Tyr 275 280 285 Lys Asn Ala Ser
Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val 290 295 300 Ala Asn
Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Ser Tyr Thr Ser 305 310 315
320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro
325 330 335 Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp
Thr Gly 340 345 350 Arg Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp
Gly His Trp Cys 355 360 365 Asn Val Lys Gly Thr Gly Phe Gly Val Arg
Pro Thr Ala Asn Thr Gly 370 375 380 His Glu Leu Val Asp Ala Phe Val
Trp Val Lys Pro Gly Gly Glu Ser 385 390 395 400 Asp Gly Thr Ser Asp
Ser Ser Ala Pro Arg Phe Asp Trp His Cys Ala 405 410 415 Leu Pro Asp
Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln 420 425 430 Ala
Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro Ser Phe Leu His 435 440
445 His His His His His 450 151362DNAArtificial SequenceCel6a
engineered variant 1F4 15gct agc tgc tca agc gtc tgg ggc caa tgt
ggt ggc cag aat tgg tcg 48Ala Ser Cys Ser Ser Val Trp Gly Gln Cys
Gly Gly Gln Asn Trp Ser 1 5 10 15 ggt ccg act tgc tgt gct tcc gga
agc aca tgc gtc tac tcc aac gac 96Gly Pro Thr Cys Cys Ala Ser Gly
Ser Thr Cys Val Tyr Ser Asn Asp 20 25 30 tat tac tcc cag tgt ctt
ccc ggc gct gca agc tca agc tcg tcc acg 144Tyr Tyr Ser Gln Cys Leu
Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35 40 45 cgc gcc gcg tcg
acg act tct cga gta tcc ccc aca aca tcc cgg tcg 192Arg Ala Ala Ser
Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50 55 60 agc tcc
gcg acg cct cca cct ggt tct act act acc aga gta cct cca 240Ser Ser
Ala Thr Pro Pro Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70 75 80
gtc gga tcg gga acc gct acg tat tca ggt aac ccc ttt gaa ggt gtt
288Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn Pro Phe Glu Gly Val
85 90 95 cag ctg tgg gct aat aac tat tat aga tct gag gta cat aca
ctg gcc 336Gln Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr
Leu Ala 100 105 110 att ccg caa att aca gac ccc gcg ttg cgt gcc gca
gct agt gct gtg 384Ile Pro Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala
Ala Ser Ala Val 115 120 125 gct gag gtg cca agt ttt atg tgg ctg gat
act ttg gac aaa acc ccc 432Ala Glu Val Pro Ser Phe Met Trp Leu Asp
Thr Leu Asp Lys Thr Pro 130 135 140 tta atg gaa caa acg ttg gct gat
ata cgt act gcg aat aaa aac ggc 480Leu Met Glu Gln Thr Leu Ala Asp
Ile Arg Thr Ala Asn Lys Asn Gly 145 150 155 160 ggc aat tat gct gga
caa ttt gtg gtt tat gac ctg ccg gat aga gat 528Gly Asn Tyr Ala Gly
Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp 165 170 175 tgt gct gca
cta gcg agc aac ggg gag tac agc att gcg gat ggc ggt 576Cys Ala Ala
Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp Gly Gly 180 185 190 gtc
gca aag tac aaa aac tat ata gat act atc agg caa ata gtt gtc 624Val
Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg Gln Ile Val Val 195 200
205 gaa tac agt gat att cgt acg ctg ctt gta atc gaa ccc gat tcc tta
672Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu Pro Asp Ser Leu
210 215 220 gcg aac ttg gtg aca aat cta ggt act ccg aag tgt gcg aac
gcg cag 720Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn
Ala Gln 225 230 235 240 agt gct tat ctt gag tgc atc aat tat gca gtc
acc cag ttg aat ttg 768Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val
Thr Gln Leu Asn Leu 245 250 255 cca aac gtt gca atg tat ctt gat gct
ggt cat gcc ggg tgg ttg ggt 816Pro Asn Val Ala Met Tyr Leu Asp Ala
Gly His Ala Gly Trp Leu Gly 260 265 270 tgg cca gca aat cag gat ccc
gct gcg cag ctg ttt gca aat gtt tac 864Trp Pro Ala Asn Gln Asp Pro
Ala Ala Gln Leu Phe Ala Asn Val Tyr 275 280 285 aaa aat gcc tca agt
cct aga gcg ctg agg ggt ctt gca aca aat gtt 912Lys Asn Ala Ser Ser
Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val 290 295 300 gct aat tac
aac gct tgg tca ata gcg agt cct cca tcg tac aca agc 960Ala Asn Tyr
Asn Ala Trp Ser Ile Ala Ser Pro Pro Ser Tyr Thr Ser 305 310 315 320
cct aac cca aac tac gat gag aag cat tac ata gaa gca ttt gct cct
1008Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro
325 330 335 ttg ctt cgt aac caa ggt ttt gat gca aag ttt atc gtc gat
acc gga 1056Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp
Thr Gly 340 345 350 aga aac ggc aag cag ccg aca ggg cag cta gaa tgg
ggg cac tgg tgc 1104Arg Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp
Gly His Trp Cys 355 360 365 aat gtc aag ggt acg ggt ttc ggt gtt aga
ccc acg gct aac act ggg 1152Asn Val Lys Gly Thr Gly Phe Gly Val Arg
Pro Thr Ala Asn Thr Gly 370 375 380 cat gag ttg gtt gat gca ttc gtt
tgg gta aaa ccc gga gga gag tca 1200His Glu Leu Val Asp Ala Phe Val
Trp Val Lys Pro Gly Gly Glu Ser 385 390 395 400 gat gga acg agt gat
tct tct gct cca agg ttc gat ttt cat tgc gca 1248Asp Gly Thr Ser Asp
Ser Ser Ala Pro Arg Phe Asp Phe His Cys Ala 405 410 415 tta cca gat
gct ttg cag cca gca cct caa gca gga gct tgg ttc caa 1296Leu Pro Asp
Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln 420 425 430 gct
tat ttt gta caa tta ctg act aac gcc aat cct agt ttt cta cat 1344Ala
Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro Ser Phe Leu His 435 440
445 cac cat cac cac cat tag 1362His His His His His 450
16453PRTArtificial SequenceSynthetic Construct 16Ala Ser Cys Ser
Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5 10 15 Gly Pro
Thr Cys Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp 20 25 30
Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35
40 45 Arg Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg
Ser 50 55 60 Ser Ser Ala Thr Pro Pro Pro Gly Ser Thr Thr Thr Arg
Val Pro Pro 65 70 75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn
Pro Phe Glu Gly Val 85 90 95 Gln Leu Trp Ala Asn Asn Tyr Tyr Arg
Ser Glu Val His Thr Leu Ala 100 105 110 Ile Pro Gln Ile Thr Asp Pro
Ala Leu Arg Ala Ala Ala Ser Ala Val 115 120 125 Ala Glu Val Pro Ser
Phe Met Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135 140 Leu Met Glu
Gln Thr Leu Ala Asp Ile Arg Thr Ala Asn Lys Asn Gly 145 150 155 160
Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp 165
170 175 Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp Gly
Gly 180 185 190 Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg Gln
Ile Val Val 195 200 205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile
Glu Pro Asp Ser Leu 210 215 220 Ala Asn Leu Val Thr Asn Leu Gly Thr
Pro Lys Cys Ala Asn Ala Gln 225 230 235 240 Ser Ala Tyr Leu Glu Cys
Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245 250 255 Pro Asn Val Ala
Met Tyr Leu Asp Ala Gly His Ala Gly Trp Leu Gly 260 265 270 Trp Pro
Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn Val Tyr 275 280 285
Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val 290
295 300 Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Ser Tyr Thr
Ser 305 310 315 320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu
Ala Phe Ala Pro 325 330 335 Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys
Phe Ile Val Asp Thr Gly 340 345 350 Arg Asn Gly Lys Gln Pro Thr Gly
Gln Leu Glu Trp Gly His Trp Cys 355 360 365 Asn Val Lys Gly Thr Gly
Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375 380 His Glu Leu Val
Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser 385 390 395 400 Asp
Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Phe His Cys Ala 405 410
415 Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln
420 425 430 Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro Ser Phe
Leu His 435 440 445 His His His His His 450 171362DNAArtificial
SequenceCel6a engineered variant 1G6 17gct agc tgc
tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser Cys
Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5 10 15 ggt
ccg act tgc tgt gct tcc gga agc aca tgc gtc tac tcc aac gac 96Gly
Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp 20 25
30 tat tac tcc cag tgt ctt ccc ggc gct gca agc tca agc tcg tcc acg
144Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr
35 40 45 cgc gcc gcg tcg acg act tct cga gta tcc ccc aca aca tcc
cgg tcg 192Arg Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser
Arg Ser 50 55 60 agc tcc gcg acg cct cca cct ggt tct act act acc
aga gta cct cca 240Ser Ser Ala Thr Pro Pro Pro Gly Ser Thr Thr Thr
Arg Val Pro Pro 65 70 75 80 gtc gga tcg gga acc gct acg tat tca ggt
aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly
Asn Pro Phe Glu Gly Val 85 90 95 cag ctg tgg gct aat aac tat tat
aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn Tyr Tyr
Arg Ser Glu Val His Thr Leu Ala 100 105 110 att ccg caa att aca gac
ccc gcg ttg cgt gcc gca gct agt gct gtg 384Ile Pro Gln Ile Thr Asp
Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115 120 125 gct gag gtg cca
agt ttt atg tgg ctg gat act ttg gac aaa acc ccc 432Ala Glu Val Pro
Ser Phe Met Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135 140 tta atg
gaa caa acg ttg gct gat ata cgt act gcg aat aaa aac ggc 480Leu Met
Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala Asn Lys Asn Gly 145 150 155
160 ggc aat tat gct gga caa ttt gtg gtt tat gac ctg ccg gat aga gat
528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp
165 170 175 tgt gct gca cta gcg agc aac ggg gag tac agc att gcg gat
ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp
Gly Gly 180 185 190 gtc gca aag tac aaa aac tat ata gat act atc agg
caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg
Gln Ile Val Val 195 200 205 gaa tac agt gat att cgt acg ctg ctt gta
atc gaa ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val
Ile Glu Pro Asp Ser Leu 210 215 220 gcg aac ttg gtg aca aat cta ggt
act ccg aag tgt gcg aac gcg cag 720Ala Asn Leu Val Thr Asn Leu Gly
Thr Pro Lys Cys Ala Asn Ala Gln 225 230 235 240 agt gct tat ctt gag
tgc atc aat tat gca gtc acc cag ttg aat ttg 768Ser Ala Tyr Leu Glu
Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245 250 255 cca aac gtt
gca atg tat ctt gat gct ggt cat gcc ggg tgg ttg ggt 816Pro Asn Val
Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp Leu Gly 260 265 270 tgg
cca gca aat cag gat ccc gct gcg cag ctg ttt gca aat gtt tac 864Trp
Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn Val Tyr 275 280
285 aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt gca aca aat gtt
912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val
290 295 300 gct aat tac aac gct tgg tca ata gcg agt cct cca ccg tac
aca agc 960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Pro Tyr
Thr Ser 305 310 315 320 cct aac cca aac tac gat gag aag cat tac ata
gaa gca ttt gct cct 1008Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile
Glu Ala Phe Ala Pro 325 330 335 ttg ctt cgt aac caa ggt ttt gat gca
aag ttt atc gtc gat acc gga 1056Leu Leu Arg Asn Gln Gly Phe Asp Ala
Lys Phe Ile Val Asp Thr Gly 340 345 350 aga aac ggc aag cag ccg aca
ggg cag cta gaa tgg ggg cac tgg tgc 1104Arg Asn Gly Lys Gln Pro Thr
Gly Gln Leu Glu Trp Gly His Trp Cys 355 360 365 aat gtc aag ggt acg
ggt ttc ggt gtt aga ccc acg gct aac act ggg 1152Asn Val Lys Gly Thr
Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375 380 cat gag ttg
gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca 1200His Glu Leu
Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser 385 390 395 400
gat gga acg agt gat tct tct gct cca agg ttc gat tct cat tgc gca
1248Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415 tta cca gat gct ttg cag cca gca cct caa gca gga gct tgg
ttc caa 1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp
Phe Gln 420 425 430 gct tat ttt gta caa tta ctg act aac gcc aat cct
agt ttt cta cat 1344Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro
Ser Phe Leu His 435 440 445 cac cat cac cac cat tag 1362His His His
His His 450 18453PRTArtificial SequenceSynthetic Construct 18Ala
Ser Cys Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5 10
15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp
20 25 30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser
Ser Thr 35 40 45 Arg Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr
Thr Ser Arg Ser 50 55 60 Ser Ser Ala Thr Pro Pro Pro Gly Ser Thr
Thr Thr Arg Val Pro Pro 65 70 75 80 Val Gly Ser Gly Thr Ala Thr Tyr
Ser Gly Asn Pro Phe Glu Gly Val 85 90 95 Gln Leu Trp Ala Asn Asn
Tyr Tyr Arg Ser Glu Val His Thr Leu Ala 100 105 110 Ile Pro Gln Ile
Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115 120 125 Ala Glu
Val Pro Ser Phe Met Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135 140
Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala Asn Lys Asn Gly 145
150 155 160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp
Arg Asp 165 170 175 Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser Ile
Ala Asp Gly Gly 180 185 190 Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr
Ile Arg Gln Ile Val Val 195 200 205 Glu Tyr Ser Asp Ile Arg Thr Leu
Leu Val Ile Glu Pro Asp Ser Leu 210 215 220 Ala Asn Leu Val Thr Asn
Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225 230 235 240 Ser Ala Tyr
Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245 250 255 Pro
Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp Leu Gly 260 265
270 Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn Val Tyr
275 280 285 Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr
Asn Val 290 295 300 Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro
Pro Tyr Thr Ser 305 310 315 320 Pro Asn Pro Asn Tyr Asp Glu Lys His
Tyr Ile Glu Ala Phe Ala Pro 325 330 335 Leu Leu Arg Asn Gln Gly Phe
Asp Ala Lys Phe Ile Val Asp Thr Gly 340 345 350 Arg Asn Gly Lys Gln
Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355 360 365 Asn Val Lys
Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375 380 His
Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser 385 390
395 400 Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser His Cys
Ala 405 410 415 Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala
Trp Phe Gln 420 425 430 Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn
Pro Ser Phe Leu His 435 440 445 His His His His His 450
191362DNAArtificial SequenceCel6a engineered variant 2B3 19gct agc
tgc tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser
Cys Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5 10 15
ggt ccg acc tgc tgt gct tcc gga agc aca tgc gtc tac tcc aac gac
96Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp
20 25 30 tat tac tcc cag tgt ctt ccc ggc gct gca agc tca agc tcg
tcc acg 144Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser
Ser Thr 35 40 45 cgc gcc gcg tcg acg act tct cga gta tcc ccc aca
aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr
Thr Ser Arg Ser 50 55 60 agc tcc gcg acg cct cca cct ggt tct act
act acc aga gta cct cca 240Ser Ser Ala Thr Pro Pro Pro Gly Ser Thr
Thr Thr Arg Val Pro Pro 65 70 75 80 gtc gga tcg gga acc gct acg tat
tca ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr Tyr
Ser Gly Asn Pro Phe Glu Gly Val 85 90 95 cag ctg tgg gct aat aac
tat tat aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn
Tyr Tyr Arg Ser Glu Val His Thr Leu Ala 100 105 110 att ccg caa att
aca gac ccc gcg ttg cgt gcc gca gct agt gct gtg 384Ile Pro Gln Ile
Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115 120 125 gct gag
gtg cca agt ttt atg tgg ctg gat act ttg gac aaa acc ccc 432Ala Glu
Val Pro Ser Phe Met Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135 140
tta atg gaa caa acg ttg gct gat ata cgt act gcg aat aaa aac ggc
480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala Asn Lys Asn Gly
145 150 155 160 ggc aat tat gct gga caa ttt gtg gtt tat gac ctg ccg
gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro
Asp Arg Asp 165 170 175 tgt gct gca cta gcg agc aac ggg gag tac agc
att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser
Ile Ala Asp Gly Gly 180 185 190 gtc gca aag tac aaa aac tat ata gat
act atc agg caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp
Thr Ile Arg Gln Ile Val Val 195 200 205 gaa tac agt gat att cgt acg
ctg ctt gta atc gaa ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr
Leu Leu Val Ile Glu Pro Asp Ser Leu 210 215 220 gcg aac ttg gtg aca
aat cta ggt act ccg aag tgt gcg aac gcg cag 720Ala Asn Leu Val Thr
Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225 230 235 240 agt gct
tat ctt gag tgc atc aat tat gca gtc acc cag ttg aat ttg 768Ser Ala
Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245 250 255
cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg tgg ttg ggt
816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp Leu Gly
260 265 270 tgg cca gca aat ctg gat ccc gct gcg cag ctg ttt gca aat
gtt tac 864Trp Pro Ala Asn Leu Asp Pro Ala Ala Gln Leu Phe Ala Asn
Val Tyr 275 280 285 aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt
gca aca aat gtt 912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu
Ala Thr Asn Val 290 295 300 gct aat tac aac gct tgg tca ata gcg agt
ccc cca ccg tac aca agc 960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser
Pro Pro Pro Tyr Thr Ser 305 310 315 320 cct aac cca aac tac gat gag
aag cat tac ata gaa gca ttt gct cct 1008Pro Asn Pro Asn Tyr Asp Glu
Lys His Tyr Ile Glu Ala Phe Ala Pro 325 330 335 ttg ctt cgt aac caa
ggt ttt gat gca aag ttt atc gtc gat acc gga 1056Leu Leu Arg Asn Gln
Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly 340 345 350 aga aac ggc
aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc 1104Arg Asn Gly
Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355 360 365 aat
gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg 1152Asn
Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375
380 cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca
1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser
385 390 395 400 gat gga acg agt gat tct tct gct cca agg ttc gat tct
cat tgc gca 1248Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser
His Cys Ala 405 410 415 tta cca gat gct ttg cag cca gca cct caa gca
gga gct tgg ttc caa 1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala
Gly Ala Trp Phe Gln 420 425 430 gct tat ttt gta caa tta ctg act aac
gcc aat cct agt ttt cta cat 1344Ala Tyr Phe Val Gln Leu Leu Thr Asn
Ala Asn Pro Ser Phe Leu His 435 440 445 cac cat cac cac cat tag
1362His His His His His 450 20453PRTArtificial SequenceSynthetic
Construct 20Ala Ser Cys Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn
Trp Ser 1 5 10 15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys Val
Tyr Ser Asn Asp 20 25 30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala
Ser Ser Ser Ser Ser Thr 35 40 45 Arg Ala Ala Ser Thr Thr Ser Arg
Val Ser Pro Thr Thr Ser Arg Ser 50 55 60 Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70 75 80 Val Gly Ser Gly
Thr Ala Thr Tyr Ser Gly Asn Pro Phe Glu Gly Val 85 90 95 Gln Leu
Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala 100 105 110
Ile Pro Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115
120 125 Ala Glu Val Pro Ser Phe Met Trp Leu Asp Thr Leu Asp Lys Thr
Pro 130 135 140 Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala Asn
Lys Asn Gly 145 150 155 160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr
Asp Leu Pro Asp Arg Asp 165 170 175 Cys Ala Ala Leu Ala Ser Asn Gly
Glu Tyr Ser Ile Ala Asp Gly Gly 180 185 190 Val Ala Lys Tyr Lys Asn
Tyr Ile Asp Thr Ile Arg Gln Ile Val Val 195 200 205 Glu Tyr Ser Asp
Ile Arg Thr Leu Leu Val Ile Glu Pro Asp Ser Leu 210 215 220 Ala Asn
Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225 230 235
240 Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu
245
250 255 Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp Leu
Gly 260 265 270 Trp Pro Ala Asn Leu Asp Pro Ala Ala Gln Leu Phe Ala
Asn Val Tyr 275 280 285 Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly
Leu Ala Thr Asn Val 290 295 300 Ala Asn Tyr Asn Ala Trp Ser Ile Ala
Ser Pro Pro Pro Tyr Thr Ser 305 310 315 320 Pro Asn Pro Asn Tyr Asp
Glu Lys His Tyr Ile Glu Ala Phe Ala Pro 325 330 335 Leu Leu Arg Asn
Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly 340 345 350 Arg Asn
Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355 360 365
Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370
375 380 His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu
Ser 385 390 395 400 Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp
Ser His Cys Ala 405 410 415 Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln
Ala Gly Ala Trp Phe Gln 420 425 430 Ala Tyr Phe Val Gln Leu Leu Thr
Asn Ala Asn Pro Ser Phe Leu His 435 440 445 His His His His His 450
211362DNAArtificial SequenceCel6a engineered variant 2F4 21gct agc
tgc tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser
Cys Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5 10 15
ggt ccg act tgc tgt gct tcc gga agc aca tgc gtc tac tcc aac gac
96Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp
20 25 30 tat tac tcc cag tgt ctt ccc ggc gct gca agc tca agc tcg
tcc acg 144Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser
Ser Thr 35 40 45 cgc gcc gcg tcg acg act tct cga gta tcc ccc aca
aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr
Thr Ser Arg Ser 50 55 60 agc tcc gcg acg cct cca cct ggt tct act
act acc aga gta cct cca 240Ser Ser Ala Thr Pro Pro Pro Gly Ser Thr
Thr Thr Arg Val Pro Pro 65 70 75 80 gtc gga tcg gga acc gct acg tat
tca ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr Tyr
Ser Gly Asn Pro Phe Glu Gly Val 85 90 95 cag ctg tgg gct aat aac
tat tat aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn
Tyr Tyr Arg Ser Glu Val His Thr Leu Ala 100 105 110 att ccg caa att
aca gac ccc gcg ttg cgt gcc gca gct agt gct gtg 384Ile Pro Gln Ile
Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115 120 125 gct gag
gtg cca agt ttt ttg tgg ctg gat act ttg gac aaa acc ccc 432Ala Glu
Val Pro Ser Phe Leu Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135 140
tta atg gaa caa acg ttg gct gat ata cgt act gcg aat aaa aac ggc
480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala Asn Lys Asn Gly
145 150 155 160 ggc aat tat gct gga caa ttt gtg gtt tat gac ctg ccg
gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro
Asp Arg Asp 165 170 175 tgt gct gca cta gcg agc aac ggg gag tac agc
att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser
Ile Ala Asp Gly Gly 180 185 190 gtc gca aag tac aaa aac tat ata gat
act atc agg caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp
Thr Ile Arg Gln Ile Val Val 195 200 205 gaa tac agt gat att cgt acg
ctg ctt gta atc gaa ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr
Leu Leu Val Ile Glu Pro Asp Ser Leu 210 215 220 gcg aac ttg gtg aca
aat cta ggt act ccg aag tgt gcg aac gcg cag 720Ala Asn Leu Val Thr
Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225 230 235 240 agt gct
tat ctt gag tgc atc aat tat gca gtc acc cag ttg aat ttg 768Ser Ala
Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245 250 255
cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg tgg ttg ggt
816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp Leu Gly
260 265 270 tgg cca gca aat cag gat ccc gct gcg cag ctg ttt gca aat
gtt tac 864Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn
Val Tyr 275 280 285 aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt
gca aca aat gtt 912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu
Ala Thr Asn Val 290 295 300 gct aat tac aac gct tgg tca ata gcg agt
cct cca ccg tac aca agc 960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser
Pro Pro Pro Tyr Thr Ser 305 310 315 320 cct aac cca aac tac gat gag
aag cat tac ata gaa gca ttt gct cct 1008Pro Asn Pro Asn Tyr Asp Glu
Lys His Tyr Ile Glu Ala Phe Ala Pro 325 330 335 ttg ctt cgt aac caa
ggt ttt gat gca aag ttt atc gtc gat acc gga 1056Leu Leu Arg Asn Gln
Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly 340 345 350 aga aac ggc
aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc 1104Arg Asn Gly
Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355 360 365 aat
gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg 1152Asn
Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375
380 cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca
1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser
385 390 395 400 gat gga acg agt gat tct tct gct cca agg ttc gat tct
cat tgc gca 1248Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser
His Cys Ala 405 410 415 tta cca gat gct ttg cag cca gca cct caa gca
gga gct tgg ttc caa 1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala
Gly Ala Trp Phe Gln 420 425 430 gct tat ttt gta caa tta ctg act aac
gcc aat cct agt ttt cta cat 1344Ala Tyr Phe Val Gln Leu Leu Thr Asn
Ala Asn Pro Ser Phe Leu His 435 440 445 cac cat cac cac cat tag
1362His His His His His 450 22453PRTArtificial SequenceSynthetic
Construct 22Ala Ser Cys Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn
Trp Ser 1 5 10 15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys Val
Tyr Ser Asn Asp 20 25 30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala
Ser Ser Ser Ser Ser Thr 35 40 45 Arg Ala Ala Ser Thr Thr Ser Arg
Val Ser Pro Thr Thr Ser Arg Ser 50 55 60 Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70 75 80 Val Gly Ser Gly
Thr Ala Thr Tyr Ser Gly Asn Pro Phe Glu Gly Val 85 90 95 Gln Leu
Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala 100 105 110
Ile Pro Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115
120 125 Ala Glu Val Pro Ser Phe Leu Trp Leu Asp Thr Leu Asp Lys Thr
Pro 130 135 140 Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala Asn
Lys Asn Gly 145 150 155 160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr
Asp Leu Pro Asp Arg Asp 165 170 175 Cys Ala Ala Leu Ala Ser Asn Gly
Glu Tyr Ser Ile Ala Asp Gly Gly 180 185 190 Val Ala Lys Tyr Lys Asn
Tyr Ile Asp Thr Ile Arg Gln Ile Val Val 195 200 205 Glu Tyr Ser Asp
Ile Arg Thr Leu Leu Val Ile Glu Pro Asp Ser Leu 210 215 220 Ala Asn
Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225 230 235
240 Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu
245 250 255 Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp
Leu Gly 260 265 270 Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe
Ala Asn Val Tyr 275 280 285 Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg
Gly Leu Ala Thr Asn Val 290 295 300 Ala Asn Tyr Asn Ala Trp Ser Ile
Ala Ser Pro Pro Pro Tyr Thr Ser 305 310 315 320 Pro Asn Pro Asn Tyr
Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro 325 330 335 Leu Leu Arg
Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly 340 345 350 Arg
Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355 360
365 Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly
370 375 380 His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly
Glu Ser 385 390 395 400 Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe
Asp Ser His Cys Ala 405 410 415 Leu Pro Asp Ala Leu Gln Pro Ala Pro
Gln Ala Gly Ala Trp Phe Gln 420 425 430 Ala Tyr Phe Val Gln Leu Leu
Thr Asn Ala Asn Pro Ser Phe Leu His 435 440 445 His His His His His
450 231362DNAArtificial SequenceCel6a engineered variant 2G6 23gct
agc tgc tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala
Ser Cys Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5 10
15 ggt ccg act tgc tgt gct tcc gga agc aca tgc gtc tac tcc aac gac
96Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp
20 25 30 tat tac tcc cag tgt ctt ccc ggc gct gca agc tca agc tcg
tcc acg 144Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser
Ser Thr 35 40 45 cgc gcc gcg tcg acg act tct cga gta tcc ccc aca
aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr
Thr Ser Arg Ser 50 55 60 agc tcc gcg acg cct cca cct ggt tct act
act acc aga gta cct cca 240Ser Ser Ala Thr Pro Pro Pro Gly Ser Thr
Thr Thr Arg Val Pro Pro 65 70 75 80 gtc gga tcg gga acc gct acg tat
tca ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr Tyr
Ser Gly Asn Pro Phe Glu Gly Val 85 90 95 cag ctg tgg gct aat aac
tat tat aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn
Tyr Tyr Arg Ser Glu Val His Thr Leu Ala 100 105 110 att ccg caa att
aca gac ccc gcg ttg cgt gcc gca gct agt gct gtg 384Ile Pro Gln Ile
Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115 120 125 gct gag
gtg cca agt ttt atg tgg ctg gat act ttg gac aaa acc ccc 432Ala Glu
Val Pro Ser Phe Met Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135 140
tta atg gaa caa acg ttg gct gat ata cgt act gcg aat aaa aac ggc
480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala Asn Lys Asn Gly
145 150 155 160 ggc aat tat gct gga caa ttt gtg gtt tat gac ctg ccg
gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro
Asp Arg Asp 165 170 175 tgt gct gca cta gcg agc aac ggg gag tac agc
att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser
Ile Ala Asp Gly Gly 180 185 190 gtc gca aag tac aaa aac tat ata gat
act atc agg caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp
Thr Ile Arg Gln Ile Val Val 195 200 205 gaa tac agt gat att cgt acg
ctg ctt gta atc gaa ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr
Leu Leu Val Ile Glu Pro Asp Ser Leu 210 215 220 gcg aac ttg gtg aca
aat cta ggt act ccg aag tgt gcg aac gcg cag 720Ala Asn Leu Val Thr
Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225 230 235 240 agt gct
tat ctt gag tgc atc aat tat gca gtc acc cag ttg aat ttg 768Ser Ala
Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245 250 255
cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg tgg ttg ggt
816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp Leu Gly
260 265 270 tgg cca gca aat cag gat ccc gct gcg cag ctg ttt gca aat
gtt tac 864Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn
Val Tyr 275 280 285 aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt
gca aca aat gtt 912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu
Ala Thr Asn Val 290 295 300 gct aat tac aac gct tgg tca ata gcg agt
cct cca ccg tac aca agc 960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser
Pro Pro Pro Tyr Thr Ser 305 310 315 320 cct aac cca aac tac gat gag
aag cat tac ata gaa gca ttt gct cct 1008Pro Asn Pro Asn Tyr Asp Glu
Lys His Tyr Ile Glu Ala Phe Ala Pro 325 330 335 ttg ctt cgt aac caa
ggt ttt gat gca aag ttt atc gtc gat acc gga 1056Leu Leu Arg Asn Gln
Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly 340 345 350 aga aac ggc
aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc 1104Arg Asn Gly
Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355 360 365 aat
gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg 1152Asn
Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375
380 cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca
1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser
385 390 395 400 gat gga acg agt gat cct tct gct cca agg ttc gat tct
cat tgc gca 1248Asp Gly Thr Ser Asp Pro Ser Ala Pro Arg Phe Asp Ser
His Cys Ala 405 410 415 tta cca gat gct ttg cag cca gca cct caa gca
gga gct tgg ttc caa 1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala
Gly Ala Trp Phe Gln 420 425 430 gct tat ttt gta caa tta ctg act aac
gcc aat cct agt ttt cta cat 1344Ala Tyr Phe Val Gln Leu Leu Thr Asn
Ala Asn Pro Ser Phe Leu His 435 440 445 cac cat cac cac cat tag
1362His His His His His 450 24453PRTArtificial SequenceSynthetic
Construct 24Ala Ser Cys Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn
Trp Ser 1 5 10 15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys Val
Tyr Ser Asn Asp 20 25 30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala
Ser Ser Ser Ser Ser
Thr 35 40 45 Arg Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr
Ser Arg Ser 50 55 60 Ser Ser Ala Thr Pro Pro Pro Gly Ser Thr Thr
Thr Arg Val Pro Pro 65 70 75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser
Gly Asn Pro Phe Glu Gly Val 85 90 95 Gln Leu Trp Ala Asn Asn Tyr
Tyr Arg Ser Glu Val His Thr Leu Ala 100 105 110 Ile Pro Gln Ile Thr
Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115 120 125 Ala Glu Val
Pro Ser Phe Met Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135 140 Leu
Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala Asn Lys Asn Gly 145 150
155 160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg
Asp 165 170 175 Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala
Asp Gly Gly 180 185 190 Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile
Arg Gln Ile Val Val 195 200 205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu
Val Ile Glu Pro Asp Ser Leu 210 215 220 Ala Asn Leu Val Thr Asn Leu
Gly Thr Pro Lys Cys Ala Asn Ala Gln 225 230 235 240 Ser Ala Tyr Leu
Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245 250 255 Pro Asn
Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp Leu Gly 260 265 270
Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn Val Tyr 275
280 285 Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn
Val 290 295 300 Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Pro
Tyr Thr Ser 305 310 315 320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr
Ile Glu Ala Phe Ala Pro 325 330 335 Leu Leu Arg Asn Gln Gly Phe Asp
Ala Lys Phe Ile Val Asp Thr Gly 340 345 350 Arg Asn Gly Lys Gln Pro
Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355 360 365 Asn Val Lys Gly
Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375 380 His Glu
Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser 385 390 395
400 Asp Gly Thr Ser Asp Pro Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415 Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp
Phe Gln 420 425 430 Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro
Ser Phe Leu His 435 440 445 His His His His His 450
251362DNAArtificial SequenceCel6a engineered variant 3C6 25gct agc
tgc tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser
Cys Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5 10 15
ggt ccg acc tgc tgt gct tcc gga agc aca tgc gtc tac ttc aac gac
96Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys Val Tyr Phe Asn Asp
20 25 30 tat tac tcc cag tgt ctt ccc ggc gct gca agc tca agc tcg
tcc acg 144Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser
Ser Thr 35 40 45 cgc gcc gcg tcg acg act tct cga gta tcc ccc aca
aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr
Thr Ser Arg Ser 50 55 60 agc tcc gcg acg cct cca cct ggt tct act
act acc aga gta cct cca 240Ser Ser Ala Thr Pro Pro Pro Gly Ser Thr
Thr Thr Arg Val Pro Pro 65 70 75 80 gtc gga tcg gga acc gct acg tat
tca ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr Tyr
Ser Gly Asn Pro Phe Glu Gly Val 85 90 95 cag ctg tgg gct aat aac
tat tat aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn
Tyr Tyr Arg Ser Glu Val His Thr Leu Ala 100 105 110 att ccg caa att
aca gac ccc gcg ttg cgt gcc gca gct agt gct gcg 384Ile Pro Gln Ile
Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Ala 115 120 125 gct gag
gtg cca agt ttt ttg tgg ctg gat act ttg gac aaa acc ccc 432Ala Glu
Val Pro Ser Phe Leu Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135 140
tta atg gaa caa acg ttg gct gat ata cgt act gcg aat aaa aac ggc
480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala Asn Lys Asn Gly
145 150 155 160 ggc aat tat gct gga caa ttt gtg gtt tat gac ctg ccg
gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro
Asp Arg Asp 165 170 175 tgt gct gca cta gcg agc aac ggg gag tac agc
att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser
Ile Ala Asp Gly Gly 180 185 190 gtc gca aag tac aaa aac tat ata gat
act atc agg caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp
Thr Ile Arg Gln Ile Val Val 195 200 205 gaa tac agt gat att cgt acg
ctg ctt gta atc gaa ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr
Leu Leu Val Ile Glu Pro Asp Ser Leu 210 215 220 gcg aac ttg gtg aca
aat cta ggt act ccg aag tgt gcg aac gcg cag 720Ala Asn Leu Val Thr
Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225 230 235 240 agt gct
tat ctt gag tgc atc aat tat gca gtc acc cag ttg aat ttg 768Ser Ala
Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245 250 255
cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg tgg ttg ggt
816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp Leu Gly
260 265 270 tgg cca gca aat ctg gat ccc gct gcg cag ctg ttt gca aat
gtt tac 864Trp Pro Ala Asn Leu Asp Pro Ala Ala Gln Leu Phe Ala Asn
Val Tyr 275 280 285 aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt
gca aca aat gtt 912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu
Ala Thr Asn Val 290 295 300 gct aat tac aac gct tgg tca ata gcg agt
ccc cca ccg tac aca agc 960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser
Pro Pro Pro Tyr Thr Ser 305 310 315 320 cct aac cca aac tac gat gag
aag cat tac ata gaa gca ttt gct cct 1008Pro Asn Pro Asn Tyr Asp Glu
Lys His Tyr Ile Glu Ala Phe Ala Pro 325 330 335 ttg ctt cgt aac caa
ggt ttt gat gca aag ttt atc gtc gat acc gga 1056Leu Leu Arg Asn Gln
Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly 340 345 350 aga aac ggc
aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc 1104Arg Asn Gly
Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355 360 365 aat
gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg 1152Asn
Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375
380 cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca
1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser
385 390 395 400 gat gga acg agt gat cct tct gct cca agg ttc gat tct
cat tgc gca 1248Asp Gly Thr Ser Asp Pro Ser Ala Pro Arg Phe Asp Ser
His Cys Ala 405 410 415 tta cca gat gct ttg cag cca gca cct caa gca
gga gct tgg ttc caa 1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala
Gly Ala Trp Phe Gln 420 425 430 gct tat ttt gta caa tta ctg act aac
gcc aat cct agt ttt cta cat 1344Ala Tyr Phe Val Gln Leu Leu Thr Asn
Ala Asn Pro Ser Phe Leu His 435 440 445 cac cat cac cac cat tag
1362His His His His His 450 26453PRTArtificial SequenceSynthetic
Construct 26Ala Ser Cys Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn
Trp Ser 1 5 10 15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys Val
Tyr Phe Asn Asp 20 25 30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala
Ser Ser Ser Ser Ser Thr 35 40 45 Arg Ala Ala Ser Thr Thr Ser Arg
Val Ser Pro Thr Thr Ser Arg Ser 50 55 60 Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70 75 80 Val Gly Ser Gly
Thr Ala Thr Tyr Ser Gly Asn Pro Phe Glu Gly Val 85 90 95 Gln Leu
Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala 100 105 110
Ile Pro Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Ala 115
120 125 Ala Glu Val Pro Ser Phe Leu Trp Leu Asp Thr Leu Asp Lys Thr
Pro 130 135 140 Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala Asn
Lys Asn Gly 145 150 155 160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr
Asp Leu Pro Asp Arg Asp 165 170 175 Cys Ala Ala Leu Ala Ser Asn Gly
Glu Tyr Ser Ile Ala Asp Gly Gly 180 185 190 Val Ala Lys Tyr Lys Asn
Tyr Ile Asp Thr Ile Arg Gln Ile Val Val 195 200 205 Glu Tyr Ser Asp
Ile Arg Thr Leu Leu Val Ile Glu Pro Asp Ser Leu 210 215 220 Ala Asn
Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225 230 235
240 Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu
245 250 255 Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp
Leu Gly 260 265 270 Trp Pro Ala Asn Leu Asp Pro Ala Ala Gln Leu Phe
Ala Asn Val Tyr 275 280 285 Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg
Gly Leu Ala Thr Asn Val 290 295 300 Ala Asn Tyr Asn Ala Trp Ser Ile
Ala Ser Pro Pro Pro Tyr Thr Ser 305 310 315 320 Pro Asn Pro Asn Tyr
Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro 325 330 335 Leu Leu Arg
Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly 340 345 350 Arg
Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355 360
365 Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly
370 375 380 His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly
Glu Ser 385 390 395 400 Asp Gly Thr Ser Asp Pro Ser Ala Pro Arg Phe
Asp Ser His Cys Ala 405 410 415 Leu Pro Asp Ala Leu Gln Pro Ala Pro
Gln Ala Gly Ala Trp Phe Gln 420 425 430 Ala Tyr Phe Val Gln Leu Leu
Thr Asn Ala Asn Pro Ser Phe Leu His 435 440 445 His His His His His
450 271362DNAArtificial SequenceCel6a engineered variant 3C6P 27gct
agc tgc tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala
Ser Cys Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5 10
15 ggt ccg acc tgc tgt gct tcc gga agc aca tgc gtc tac ttc aac gac
96Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys Val Tyr Phe Asn Asp
20 25 30 tat tac tcc cag tgt ctt ccc ggc gct gca agc tca agc tcg
tcc acg 144Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser
Ser Thr 35 40 45 cgc gcc gcg tcg acg act tct cga gta tcc ccc aca
aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr
Thr Ser Arg Ser 50 55 60 agc tcc gcg acg cct cca cct ggt tct act
act acc aga gta cct cca 240Ser Ser Ala Thr Pro Pro Pro Gly Ser Thr
Thr Thr Arg Val Pro Pro 65 70 75 80 gtc gga tcg gga acc gct acg tat
tca ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr Tyr
Ser Gly Asn Pro Phe Glu Gly Val 85 90 95 cag ctg tgg gct aat aac
tat tat aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn
Tyr Tyr Arg Ser Glu Val His Thr Leu Ala 100 105 110 att ccg caa att
aca gac ccc gcg ttg cgt gcc gca gct agt gct gcg 384Ile Pro Gln Ile
Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Ala 115 120 125 gct gag
gtg cca agt ttt ttg tgg ctg gat act ttg gac aaa acc ccc 432Ala Glu
Val Pro Ser Phe Leu Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135 140
tta atg gaa caa acg ttg gct gat ata cgt act gcg aat aaa aac ggc
480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala Asn Lys Asn Gly
145 150 155 160 ggc aat tat gct gga caa ttt gtg gtt tat gac ctg ccg
gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro
Asp Arg Asp 165 170 175 tgt gct gca cta gcg agc aac ggg gag tac agc
att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser
Ile Ala Asp Gly Gly 180 185 190 gtc gca aag tac aaa aac tat ata gat
act atc agg caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp
Thr Ile Arg Gln Ile Val Val 195 200 205 gaa tac agt gat att cgt acg
ctg ctt gta atc gaa ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr
Leu Leu Val Ile Glu Pro Asp Ser Leu 210 215 220 gcg aac ttg gtg aca
aat cta ggt act ccg aag tgt gcg aac gcg cag 720Ala Asn Leu Val Thr
Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225 230 235 240 agt gct
tat ctt gag tgc atc aat tat gca gtc acc cag ttg aat ttg 768Ser Ala
Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245 250 255
cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg tgg ttg ggt
816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp Leu Gly
260 265 270 tgg cca gca aat ctg gat ccc gct gcg cag ctg ttt gca aat
gtt tac 864Trp Pro Ala Asn Leu Asp Pro Ala Ala Gln Leu Phe Ala Asn
Val Tyr 275 280 285 aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt
gca aca aat gtt 912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu
Ala Thr Asn Val 290 295 300 gct aat tac aac gct tgg tca ata gcg agt
ccc cca ccg tac aca agc 960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser
Pro Pro Pro Tyr Thr Ser 305 310 315 320 cct aac cca aac tac gat gag
aag cat tac ata gaa gca ttt gct cct 1008Pro Asn Pro Asn Tyr Asp Glu
Lys His Tyr Ile Glu Ala Phe Ala Pro 325 330 335 ttg ctt cgt aac caa
ggt ttt gat gca aag ttt atc gtc gat acc gga 1056Leu Leu Arg Asn Gln
Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly 340 345 350 aga aac ggc
aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc 1104Arg Asn Gly
Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355 360 365
aat gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg
1152Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly
370 375 380 cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga
gag tca 1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly
Glu Ser 385 390 395 400 gat gga acg agt gat cct tct gct cca agg ttc
gat cct cat tgc gca 1248Asp Gly Thr Ser Asp Pro Ser Ala Pro Arg Phe
Asp Pro His Cys Ala 405 410 415 tta cca gat gct ttg cag cca gca cct
caa gca gga gct tgg ttc caa 1296Leu Pro Asp Ala Leu Gln Pro Ala Pro
Gln Ala Gly Ala Trp Phe Gln 420 425 430 gct tat ttt gta caa tta ctg
act aac gcc aat cct agt ttt cta cat 1344Ala Tyr Phe Val Gln Leu Leu
Thr Asn Ala Asn Pro Ser Phe Leu His 435 440 445 cac cat cac cac cat
tag 1362His His His His His 450 28453PRTArtificial
SequenceSynthetic Construct 28Ala Ser Cys Ser Ser Val Trp Gly Gln
Cys Gly Gly Gln Asn Trp Ser 1 5 10 15 Gly Pro Thr Cys Cys Ala Ser
Gly Ser Thr Cys Val Tyr Phe Asn Asp 20 25 30 Tyr Tyr Ser Gln Cys
Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35 40 45 Arg Ala Ala
Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50 55 60 Ser
Ser Ala Thr Pro Pro Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn Pro Phe Glu Gly
Val 85 90 95 Gln Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His
Thr Leu Ala 100 105 110 Ile Pro Gln Ile Thr Asp Pro Ala Leu Arg Ala
Ala Ala Ser Ala Ala 115 120 125 Ala Glu Val Pro Ser Phe Leu Trp Leu
Asp Thr Leu Asp Lys Thr Pro 130 135 140 Leu Met Glu Gln Thr Leu Ala
Asp Ile Arg Thr Ala Asn Lys Asn Gly 145 150 155 160 Gly Asn Tyr Ala
Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp 165 170 175 Cys Ala
Ala Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp Gly Gly 180 185 190
Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg Gln Ile Val Val 195
200 205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu Pro Asp Ser
Leu 210 215 220 Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala
Asn Ala Gln 225 230 235 240 Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala
Val Thr Gln Leu Asn Leu 245 250 255 Pro Asn Val Ala Met Tyr Leu Asp
Ala Gly His Ala Gly Trp Leu Gly 260 265 270 Trp Pro Ala Asn Leu Asp
Pro Ala Ala Gln Leu Phe Ala Asn Val Tyr 275 280 285 Lys Asn Ala Ser
Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val 290 295 300 Ala Asn
Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Pro Tyr Thr Ser 305 310 315
320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro
325 330 335 Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp
Thr Gly 340 345 350 Arg Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp
Gly His Trp Cys 355 360 365 Asn Val Lys Gly Thr Gly Phe Gly Val Arg
Pro Thr Ala Asn Thr Gly 370 375 380 His Glu Leu Val Asp Ala Phe Val
Trp Val Lys Pro Gly Gly Glu Ser 385 390 395 400 Asp Gly Thr Ser Asp
Pro Ser Ala Pro Arg Phe Asp Pro His Cys Ala 405 410 415 Leu Pro Asp
Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln 420 425 430 Ala
Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro Ser Phe Leu His 435 440
445 His His His His His 450 2933DNAArtificial
SequenceOligonucleotide Primer 29cgggttattg tttataaata ctactattgc
cag 333025DNAArtificial SequenceOligonucleotide Primer 30gacatgggag
atcgaattca actcc 253132DNAArtificial SequenceOligonucleotide Primer
31gcacatgcgt ctacttcaac gactattact cc 323232DNAArtificial
SequenceOligonucleotide Primer 32ggagtaatag tcgttgaagt agacgcatgt
gc 323332DNAArtificial SequenceOligonucleotide Primer 33gcacatgcgt
ctactccaac gactattact cc 323432DNAArtificial
SequenceOligonucleotide Primer 34ggagtaatag tcgttggagt agacgcatgt
gc 323547DNAArtificial SequenceOligonucleotide Primer 35gcagctagtg
ctgcggctga ggtgccaagt tttatgtggc tggatac 473647DNAArtificial
SequenceOligonucleotide Primer 36gtatccagcc acataaaact tggcacctca
gccgcagcac tagctgc 473747DNAArtificial SequenceOligonucleotide
Primer 37gcagctagtg ctgtggctga ggagccaagt tttatgtggc tggatac
473847DNAArtificial SequenceOligonucleotide Primer 38gtatccagcc
acataaaact tggctcctca gccacagcac tagctgc 473947DNAArtificial
SequenceOligonucleotide Primer 39gcagctagtg ctgtggctga ggtgccaagt
tttttgtggc tggatac 474047DNAArtificial SequenceOligonucleotide
Primer 40gtatccagcc acaaaaaact tggcacctca gccacagcac tagctgc
474147DNAArtificial SequenceOligonucleotide Primer 41gcagctagtg
ctgcggctga ggagccaagt tttatgtggc tggatac 474247DNAArtificial
SequenceOligonucleotide Primer 42gtatccagcc acataaaact tggctcctca
gccgcagcac tagctgc 474347DNAArtificial SequenceOligonucleotide
Primer 43gcagctagtg ctgcggctga ggtgccaagt tttttgtggc tggatac
474447DNAArtificial SequenceOligonucleotide Primer 44gtatccagcc
acaaaaaact tggcacctca gccgcagcac tagctgc 474547DNAArtificial
SequenceOligonucleotide Primer 45gcagctagtg ctgtggctga ggagccaagt
tttttgtggc tggatac 474647DNAArtificial SequenceOligonucleotide
Primer 46gtatccagcc acaaaaaact tggctcctca gccacagcac tagctgc
474747DNAArtificial SequenceOligonucleotide Primer 47gcagctagtg
ctgcggctga ggagccaagt tttttgtggc tggatac 474847DNAArtificial
SequenceOligonucleotide Primer 48gtatccagcc acaaaaaact tggctcctca
gccgcagcac tagctgc 474947DNAArtificial SequenceOligonucleotide
Primer 49gcagctagtg ctgtggctga ggtgccaagt tttatgtggc tggatac
475047DNAArtificial SequenceOligonucleotide Primer 50gtatccagcc
acataaaact tggcacctca gccacagcac tagctgc 475128DNAArtificial
SequenceOligonucleotide Primer 51caaaaatgcc tcaagaccta gagcgctg
285228DNAArtificial SequenceOligonucleotide Primer 52cagcgctcta
ggtcttgagg catttttg 285328DNAArtificial SequenceOligonucleotide
Primer 53caaaaatgcc tcaagtccta gagcgctg 285428DNAArtificial
SequenceOligonucleotide Primer 54cagcgctcta ggacttgagg catttttg
285529DNAArtificial SequenceOligonucleotide Primer 55gatggaacga
gtgatccttc tgctccaag 295629DNAArtificial SequenceOligonucleotide
Primer 56cttggagcag aaggatcact cgttccatc 295729DNAArtificial
SequenceOligonucleotide Primer 57gatggaacga gtgattcttc tgctccaag
295829DNAArtificial SequenceOligonucleotide Primer 58cttggagcag
aagaatcact cgttccatc 295935DNAArtificial SequenceOligonucleotide
Primer 59ggccaatgtg gtggccagnn ktggtcgggt ccgac 356018DNAArtificial
SequenceOligonucleotide Primer 60ctggccacca cattggcc
186143DNAArtificial SequenceOligonucleotide Primer 61ccggaagcac
atgcgtctac nnkaacgact attactccca gtg 436220DNAArtificial
SequenceOligonucleotide Primer 62gtagacgcat gtgcttccgg
206335DNAArtificial SequenceOligonucleotide Primer 63cgtgccgcag
ctagtgctnn kgctgaggtg ccaag 356418DNAArtificial
SequenceOligonucleotide Primer 64agcactagct gcggcacg
186542DNAArtificial SequenceOligonucleotide Primer 65gcagctagtg
ctgtggctga gnnkccaagt tttatgtggc tg 426621DNAArtificial
SequenceOligonucleotide Primer 66ctcagccaca gcactagctg c
216740DNAArtificial SequenceOligonucleotide Primer 67gtggctgagg
tgccaagttt tnnktggctg gatactttgg 406821DNAArtificial
SequenceOligonucleotide Primer 68aaaacttggc acctcagcca c
216937DNAArtificial SequenceOligonucleotide Primer 69gttgggttgg
ccagcaaatn nkgatcccgc tgcgcag 377019DNAArtificial
SequenceOligonucleotide Primer 70atttgctggc caacccaac
197142DNAArtificial SequenceOligonucleotide Primer 71gcaaatgttt
acaaaaatgc ctcannkcct agagcgctga gg 427224DNAArtificial
SequenceOligonucleotide Primer 72tgaggcattt ttgtaaacat ttgc
247343DNAArtificial SequenceOligonucleotide Primer 73cttggtcaat
agcgagtcct ccannktaca caagccctaa ccc 437422DNAArtificial
SequenceOligonucleotide Primer 74ggaggactcg ctattgacca ag
227543DNAArtificial SequenceOligonucleotide Primer 75ggagagtcag
atggaacgag tgatnnktct gctccaaggt tcg 437624DNAArtificial
SequenceOligonucleotide Primer 76atcactcgtt ccatctgact ctcc
247743DNAArtificial SequenceOligonucleotide Primer 77gattcttctg
ctccaaggtt cgatnnkcat tgcgcattac cag 437824DNAArtificial
SequenceOligonucleotide Primer 78atcgaacctt ggagcagaag aatc
247946DNAArtificial SequenceOligonucleotide Primer 79ctttgaaggt
gttcagctgt atgctaataa ctattataga tctgag 468046DNAArtificial
SequenceOligonucleotide Primer 80ctcagatcta taatagttat tagcatacag
ctgaacacct tcaaag 468141DNAArtificial SequenceOligonucleotide
Primer 81cagctgtggg ctaatccata ttatagatct gaggtacata c
418241DNAArtificial SequenceOligonucleotide Primer 82gtatgtacct
cagatctata atatggatta gcccacagct g 418328DNAArtificial
SequenceOligonucleotide Primer 83gaccccgcgt tggctgccgc agctagtg
288428DNAArtificial SequenceOligonucleotide Primer 84cactagctgc
ggcagccaac gcggggtc 288528DNAArtificial SequenceOligonucleotide
Primer 85gcgttgcgtg ccaaagctag tgctgcgg 288628DNAArtificial
SequenceOligonucleotide Primer 86ccgcagcact agctttggca cgcaacgc
288732DNAArtificial SequenceOligonucleotide Primer 87gacaaaaccc
ccttattgga acaaacgttg gc 328832DNAArtificial
SequenceOligonucleotide Primer 88gccaacgttt gttccaataa gggggttttg
tc 328936DNAArtificial SequenceOligonucleotide Primer 89caaacgttgg
ctgatgctcg tactgcgaat aaaaac 369036DNAArtificial
SequenceOligonucleotide Primer 90gtttttattc gcagtacgag catcagccaa
cgtttg 369129DNAArtificial SequenceOligonucleotide Primer
91gagcaacggg gagttgagca ttgcggatg 299229DNAArtificial
SequenceOligonucleotide Primer 92catccgcaat gctcaactcc ccgttgctc
299338DNAArtificial SequenceOligonucleotide Primer 93cagagtgctt
atcttgaggg tatcaattat gcagtcac 389438DNAArtificial
SequenceOligonucleotide Primer 94gtgactgcat aattgatacc ctcaagataa
gcactctg 389534DNAArtificial SequenceOligonucleotide Primer
95gtgcatcaat tatgcattga cccagttgaa tttg 349634DNAArtificial
SequenceOligonucleotide Primer 96caaattcaac tgggtcaatg cataattgat
gcac 349733DNAArtificial SequenceOligonucleotide Primer
97gtttacaaaa atgccggtag tcctagagcg ctg 339833DNAArtificial
SequenceOligonucleotide Primer 98cagcgctcta ggactaccgg catttttgta
aac 339933DNAArtificial SequenceOligonucleotide Primer 99ctcaagtcct
agagcggtta ggggtcttgc aac 3310033DNAArtificial
SequenceOligonucleotide Primer 100gttgcaagac ccctaaccgc tctaggactt
gag 3310134DNAArtificial SequenceOligonucleotide Primer
101ccaccgtaca caagctggaa cccaaactac gatg 3410234DNAArtificial
SequenceOligonucleotide Primer 102catcgtagtt tgggttccag cttgtgtacg
gtgg 3410333DNAArtificial SequenceOligonucleotide Primer
103gcattacata gaagcattgg ctcctttgct tcg 3310433DNAArtificial
SequenceOligonucleotide Primer 104cgaagcaaag gagccaatgc ttctatgtaa
tgc 3310534DNAArtificial SequenceOligonucleotide Primer
105gaaacggcaa gcagggtaca gggcagctag aatg 3410634DNAArtificial
SequenceOligonucleotide Primer 106cattctagct gccctgtacc ctgcttgccg
tttc 3410730DNAArtificial SequenceOligonucleotide Primer
107caagcagccg acaagacagc tagaatgggg 3010830DNAArtificial
SequenceOligonucleotide Primer 108ccccattcta gctgtcttgt cggctgcttg
3010928DNAArtificial SequenceOligonucleotide Primer 109cagccgacag
ggagactaga atgggggc 2811028DNAArtificial SequenceOligonucleotide
Primer 110gcccccattc tagtctccct gtcggctg 2811133DNAArtificial
SequenceOligonucleotide Primer 111gcaatgtcaa gggtgctggt ttcggtgtta
gac 3311233DNAArtificial SequenceOligonucleotide Primer
112gtctaacacc gaaaccagca cccttgacat tgc 33
* * * * *