U.S. patent application number 14/846114 was filed with the patent office on 2016-09-01 for cryopreservation, hibernation and room temperature storage of encapulated pancreatic endoderm cell aggregates.
This patent application is currently assigned to ViaCyte, Inc.. The applicant listed for this patent is ViaCyte, Inc.. Invention is credited to Alan Agulnick, Chad Green, Evert Kroon, Laura Martinson, Michael Scott.
Application Number | 20160250262 14/846114 |
Document ID | / |
Family ID | 50513424 |
Filed Date | 2016-09-01 |
United States Patent
Application |
20160250262 |
Kind Code |
A1 |
Agulnick; Alan ; et
al. |
September 1, 2016 |
CRYOPRESERVATION, HIBERNATION AND ROOM TEMPERATURE STORAGE OF
ENCAPULATED PANCREATIC ENDODERM CELL AGGREGATES
Abstract
Disclosed herein are methods for cryopreserving, hibernation and
room temperature storage of PEC aggregates, implantable
semipermeable devices and the VC combination product.
Inventors: |
Agulnick; Alan; (San Diego,
CA) ; Martinson; Laura; (San Diego, CA) ;
Kroon; Evert; (San Diego, CA) ; Scott; Michael;
(San Diego, CA) ; Green; Chad; (San Diego,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ViaCyte, Inc. |
San Diego |
CA |
US |
|
|
Assignee: |
ViaCyte, Inc.
San Diego
CA
|
Family ID: |
50513424 |
Appl. No.: |
14/846114 |
Filed: |
September 4, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/US2014/022065 |
Mar 7, 2014 |
|
|
|
14846114 |
|
|
|
|
61775480 |
Mar 8, 2013 |
|
|
|
Current U.S.
Class: |
424/93.7 |
Current CPC
Class: |
A61K 35/39 20130101;
C12N 5/0678 20130101; A61K 38/28 20130101; A01N 1/021 20130101;
A01N 1/0284 20130101; A01N 1/0278 20130101 |
International
Class: |
A61K 35/39 20060101
A61K035/39; C12N 5/071 20060101 C12N005/071; A01N 1/02 20060101
A01N001/02 |
Claims
1. A method for cryopreserving an encapsulated cell population,
said method comprising: a. obtaining a cell population to be
cryopreserved; b. loading the cell population into an implantable
semi-permeable encapsulation device thereby making an encapsulated
cell population; c. contacting the encapsulated cell population
with a cryopreservative thereby cryopreserving the encapsulated
cell population.
2. A method for producing insulin in vivo in a mammal, said method
comprising: a. obtaining an in vitro human pancreatic cell
aggregate population; b. loading the pancreatic cell aggregate
population into an implantable semi-permeable encapsulation device
thereby making an encapsulated pancreatic cell population; c.
contacting the pancreatic cell population with cryopreservative
thereby cryopreserving the encapsulated pancreatic cell population;
d. thawing the encapsulated pancreatic cell population; e.
implanting the encapsulated pancreatic cell population into a
mammalian host; and f. maturing the encapsulated pancreatic cell
population in vivo to form a mature cell population comprising of
endocrine and acinar cells, wherein at least some of the endocrine
cells are insulin secreting cells that produce insulin in response
to glucose stimulation in vivo, thereby producing insulin in vivo
to the mammal.
3. The method of claim 1, wherein the cell population to be
cryopreserved is PDX1 positive pancreatic endoderm cells.
4. The method of claim 3, wherein the PDX1 positive pancreatic
endoderm cells are pancreatic endoderm cells.
5. The method of claim 1, wherein the cell population to be
cryopreserved is contacted with a cryopreservative prior to loading
into the device.
6. The method of claim 1, wherein the encapsulated cell population
is shipped to the implantation site in a cryopreserved state.
7. The method of claim 1, wherein the encapsulated cell population
is at a temperature range of negative 90 to negative 260 degrees
Celsius.
8. (canceled)
9. (canceled)
10. The method of claim 1, further comprising thawing the
encapsulated cell population, wherein the survival rate for the
thawed encapsulated cell population is greater than about 5%, about
10%, about 15%, about 20%, about 25%, about 30%, about 35%, about
40%, about 45%, about 50%, about 55%, about 60%, about 65%, about
70%, about 75%, about 80%, about 85%, about 90%, about 95%, or
greater than about 95%.
11. (canceled)
12. (canceled)
13. (canceled)
14. The method of claim 1, wherein the device comprises at least
one loading port.
15. (canceled)
16. (canceled)
17. (canceled)
18. (canceled)
19. A cryopreserved PDX1 positive pancreatic endoderm
population.
20. (canceled)
21. (canceled)
22. (canceled)
23. (canceled)
24. (canceled)
25. (canceled)
26. (canceled)
27. (canceled)
28. The method of claim 1, wherein the encapsulated cell population
is pancreatic endoderm cell (PEC) aggregates.
29. The cryopreserved PDX1 positive pancreatic endoderm population
of claim 19 wherein the PDX1 positive pancreatic endoderm
population is in contact with cryopreservative.
30. The cryopreserved PDX1 positive pancreatic endoderm population
of claim 19 wherein the PDX1 positive pancreatic endoderm
population is PEC aggregates.
31. The method of claim 2, wherein greater than about 5%, about
10%, about 15%, about 20%, about 25%, about 30%, about 35%, about
40%, about 45%, about 50%, about 55%, about 60%, about 65%, about
70%, about 75%, about 80%, about 85%, about 90%, about 95%, or
greater than about 95% of the encapsulated pancreatic cell
population survive thawing.
32. The cryopreserved PDX1 positive pancreatic endoderm population
of claim 19 wherein greater than about 5%, about 10%, about 15%,
about 20%, about 25%, about 30%, about 35%, about 40%, about 45%,
about 50%, about 55%, about 60%, about 65%, about 70%, about 75%,
about 80%, about 85%, about 90%, about 95%, or greater than about
95% of the PDX1 positive pancreatic endoderm population survive
thawing.
33. The method of claim 2, wherein the device comprises at least
one loading port.
34. The cryopreserved PDX1 positive pancreatic endoderm population
of claim 19 wherein the PDX1 positive pancreatic endoderm
population is loaded into an implantable semi-permeable
encapsulation device.
35. The cryopreserved PDX1 positive pancreatic endoderm population
of claim 34 wherein the device comprises at least one loading
port.
36. The method of claim 2, wherein the encapsulated pancreatic cell
population is at a temperature range of negative 90 to negative 260
degrees Celsius.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of PCT Application No.
PCT/US2014/022065 filed Mar. 7, 2014, which claims the benefit of
U.S. Provisional Application No. 61/775,480 filed Mar. 8, 2013,
which are hereby incorporated in by their entirety and for all
purposes.
REFERENCE TO A "SEQUENCE LISTING," A TABLE, OR A COMPUTER PROGRAM
LISTING APPENDIX SUBMITTED AS AN ASCII FILE
[0002] The Sequence Listing written in file 48515-514N01US
ST25.TXT, created Nov. 6, 2015, 9.642 bytes, machine format IBM-PC,
MS-Windows operating system, is hereby incorporated by
reference.
FIELD OF THE INVENTION
[0003] This application relates generally to cryopreservation,
hibernation and room temperature storage of biological materials,
medical devices and combinations of the two as well as uses
thereof. More particularly, the application relates to methods for
cryopreserving, hibernating and storing at room temperature
encapsulated pancreatic endoderm cell (PEC) aggregates also
referred to as ViaCyte's (VC) combination product
BACKGROUND
[0004] Cryopreservation has been an effective method for long-term
storage of biological material. Long-term storage of cells and
tissue for use in clinical transplantation is based on the inherent
need to collect adequate cells or tissue and to have them available
at times that are suitable for transplantation into a patient. For
cell-based therapies to fully reach their clinical potential,
isolated cell types including PEC aggregates, implantable,
semipermeable devices and encapsulated PEC aggregates (VC
combination product) need to be preserved for significant periods
of time (months to preferably years) so that they can be
appropriately banked and distributed for on-demand utilization.
Cryopreservation represents one tenable option for long-term
preservation. Cell cryopreservation, the process of exposing cells
to extremely low temperatures (-80.degree. C. to -196.degree. C.),
makes possible the long term storage of living cells. Hibernation
and room temperature storage makes possible the short term storage
of living cells while maintaining in vivo function.
SUMMARY OF THE INVENTION
[0005] The application provides methods to cryopreserve or freeze
cells, an implantable, semi-permeable device or a combination
product. Specifically, the application provides methods to
cryopreserve or freeze: PEC aggregates, an implantable,
semi-permeable cell-encapsulation device and a cell-device
combination product. The embodiments disclosed herein overcome
disadvantages of the prior art by providing a cell-device
combination product that can be stored long term or transported to
the clinician as a ready to use product when needed.
[0006] One embodiment provides a method for cryopreserving an
encapsulated cell population, said method comprising: (a) obtaining
a cell population to be cryopreserved; (b) loading the cell
population into an implantable semi-permeable encapsulation device
thereby making an encapsulated cell population; and (c) contacting
the encapsulated cell population with a cryopreservative for at
least 20 minutes; thereby cryopreserving the encapsulated cell
population.
[0007] One embodiment provides a method for producing insulin in
vivo in a mammal, said method comprising: (a) obtaining an in vitro
human pancreatic cell aggregate population; (b) loading the
pancreatic cell aggregate population into an cell encapsulation
device thereby making an encapsulated pancreatic cell population;
(c) contacting the pancreatic cell population with a
cryopreservative for at least 20 minutes thereby cryopreserving the
encapsulated pancreatic cell population; (d) thawing the
encapsulated pancreatic cell population; (e) implanting the
encapsulated pancreatic cell population into a mammalian host; and
(f) maturing the encapsulated pancreatic cell population in vivo to
form a mature cell population comprising of endocrine and acinar
cells, wherein at least some of the endocrine cells are insulin
secreting cells that produce insulin in response to glucose
stimulation in vivo, thereby producing insulin in vivo to the
mammal.
[0008] One embodiment provides a method for cryopreserving an
encapsulated cell population, said method comprising: (a) obtaining
a cell population to be cryopreserved; (b) loading the cell
population into an implantable device thereby making encapsulated
cell population; (c) contacting the encapsulated cell population
with a cryopreservation solution; and (d) storing the encapsulated
cell population at room temperature thereby cryopreserving an
encapsulated cell population.
[0009] One embodiment provides a method for producing insulin in
vivo in a mammal, said method comprising: (a) obtaining an in vitro
human PDX1 positive pancreatic endoderm population; (b) loading the
PDX1 positive pancreatic endoderm population into an implantable
encapsulation device thereby making an encapsulated cell
population; (c) contacting the encapsulated cell population with a
cryopreservation solution; (d) storing the encapsulated cell
population at room temperature; (e) implanting the encapsulated
cell population into a mammalian host; and (f) maturing the
encapsulated cell population in said device in vivo to become at
least endocrine and acinar cells, wherein at least some of the
endocrine cells are insulin secreting cells that produce insulin in
response to glucose stimulation in vivo, thereby producing insulin
in vivo to the mammal.
[0010] One embodiment provides a method for cryopreserving
encapsulated cell population, said method comprising: (a) obtaining
a cell population to be cryopreserved; (b) loading the cell
population into an encapsulation device thereby making encapsulated
cell population; (c) contacting the encapsulated cell population
with a cryopreservation solution; and (d) storing the encapsulated
cells at 4.degree. C. thereby cryopreserving encapsulated cell
population.
[0011] One embodiment provides a method for producing insulin in
vivo in a mammal, said method comprising: (a) obtaining an in vitro
human PDX1 positive pancreatic endoderm population; (b) loading the
PDX1 positive pancreatic endoderm population into an encapsulation
device to create an encapsulated cell population; (c) contacting
the encapsulated cell population with a cryopreservation solution;
(d) storing the encapsulated cell population at 4.degree. C.; (e)
implanting the encapsulated cell population into a mammalian host;
and maturing the encapsulated cell population in in vivo such that
the mature cell population comprises endocrine and acinar cells,
wherein at least some of the endocrine cells are insulin secreting
cells that produce insulin in response to glucose stimulation in
vivo, thereby producing insulin in vivo to the mammal.
[0012] In one embodiment the cryopreserved cells are PDX1 positive
pancreatic endoderm cells including but not limited to PEC or
pancreatic endoderm, or pancreatic progenitor cells (stage 3 or
stage 4), definitive endoderm lineage cells (stage 2),
PDX1-negative foregut endoderm cells (stage 3), and endocrine
precursor cells (stage 5-6), and immature endocrine cells or
immature beta cells (stage 7) or any combination thereof
[0013] In one embodiment the temperature of the cryopreserved
cells, or the cell-device combination product is decreased to less
than about 0.degree. C., -10.degree. C., -20.degree. C.,
-30.degree. C., -40.degree. C., -50.degree. C., -60.degree. C.,
-70.degree. C., -80.degree. C., -90.degree. C., -100.degree. C.,
-110.degree. C., -120.degree. C., -130.degree. C., -140.degree. C.,
-150.degree. C., -160.degree. C., -170.degree. C., -180.degree. C.,
-190.degree. C., -200.degree. C., -210.degree. C., -220.degree. C.,
-230.degree. C., -240.degree. C., -250.degree. C., or -260.degree.
C., or preferably from about -90.degree. C. to -260.degree. C.
[0014] In one embodiment the temperature of the stored cells, or
cell-device combination product is room temperature, at about
0.degree. C., -1.degree. C., -2.degree. C., -3.degree. C.,
-4.degree. C., -5.degree. C., -6.degree. C., -7.degree. C.,
-8.degree. C., -9.degree. C., -10.degree. C. and preferably is
between -2.degree. C. and -6 and is more preferably -4.degree.
C.
[0015] In one embodiment the cryopreserved cells,
cell-encapsulation device or cell-device combination product are
stored for about 1 hour, 2 hours, 5 hours, 10 hours, 15 hours, 20
hours, 24 hours, 2 days, 4 days, 5 days, 1 week, 2 weeks, 3 weeks,
4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months,
8 months, 10 months, 1 year, 2 years, 4 years or more.
[0016] Another embodiment relates to a method where the
cryopreserved cells, cell-encapsulating device or cell-device
combination product are cryopreserved and thawed at least 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 20 or more times. In embodiments where the
PEC aggregates are cryopreserved and thawed multiple times, it is
desirable to have the cells of interest survive the freeze thaw
cycle. For example, in Example 1 below, there is increased cell
numbers of non-endocrine cell populations (CHGA-/PDX1+/NKX6.1+)
following cryopreservation and thaw as compared to cells that have
not been cryopreserved. In another aspect, it is desirable to have
fewer residual or endocrine cells (CHGA+) after cryopreservation
and thaw as compared to cells that have not been cryopreserved.
[0017] In one embodiment 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, 95%, 98% preferably 90%-95% of the cryopreserved
cells survive thawing following cryopreservation. In one embodiment
5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%
preferably 90%-95% of the cryopreserved cells survive thawing
following cryopreservation in DMSO. In one embodiment 5%, 10%, 15%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% preferably 90%-95%
of the cells stored at room temperature or 4.degree. C. in
preservation solution survive.
[0018] Another embodiment provides a method for enriching the
non-endocrine cells in a cell population comprising: (a) obtaining
a PDX1 positive pancreatic endoderm cell population to be
cryopreserved; (b) contacting the cell population with a
cryopreservative for at least 20 minutes thereby cryopreserving the
cell population; (c) thawing the cryopreserved cell population
wherein a non-endocrine subpopulation is higher than an endocrine
subpopulation thereby enriching for a non-endocrine cells in a cell
population. In another embodiment, the transplanted cell population
is capable of maturing into endocrine and acinar cells in the
mammalian host, preferably capable of maturing into mature
endocrine cells, and preferably into mature insulin secreting cells
or beta cells.
[0019] The cell population of claim 16, wherein the PDX1 positive
pancreatic endoderm population is capable of maturing into beta
cells which are capable of secreting insulin in response to glucose
stimulation.
[0020] Another embodiment relates to the time in post thaw culture.
Cryopreserved cell aggregates may be used for transplantation
following 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 days preferably 3 or 4 days
and most preferably 4 days post-thaw culturing.
[0021] Another embodiment relates to methods cryopreserving or
storing cells wherein a cryopreservative or storing solution is
added to the cells prior to encapsulating the cells into the
device.
[0022] Another embodiment relates to methods wherein the
encapsulated cell is shipped to the implantation site in a
cryopreserved state.
[0023] Another embodiment relates to methods wherein encapsulated
cells do not leak from the device.
[0024] Another embodiment relates to methods wherein the cell
survival rate is about 5%, about 10%, about 15%, about 20%, about
25%, about 30%, about 35%, about 40%, about 45%, about 50%, about
55%, about 60%, about 65%, about 70%, about 75%, about 80%, about
85%, about 90%, about 95%, or greater than about 95% after
cryopreservation and thawing. In one embodiment, the cell survival
rate is preferably, greater than about 40%, greater than about 50%,
greater than about 60%, and greater than about 95%.
[0025] In one embodiment, the cell encapsulation device comprises
no loading ports, one or two loading port, and preferably at least
one loading port.
[0026] In one embodiment, the cell encapsulation device comprises
at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more internal welds in
the cell chamber or lumen, wherein the welds restrict cell chamber
expansion.
[0027] These and other embodiments will be apparent from the
description that follows.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIGS. 1A-1I are perspective views of a single and dual
ported encapsulation device with embodiments and without internal
welds, with and without suture or ear tabs. FIG. 1A: single ported
encapsulation device; FIG. 1B: single ported encapsulation device;
FIG. 1C: dual ported encapsulation device; FIG. 1D: dual ported
encapsulation device; FIG. 1E: dual ported encapsulation device;
FIG. 1F: dual ported encapsulation device; FIG. 1G: dual ported
encapsulation device; FIG. 1H: dual ported encapsulation device
with ear tabs; FIG. 1I: dual ported encapsulation device with ear
tabs.
[0029] FIGS. 2A-2B are a top section view of single (FIG. 2A) and
dual (FIG. 2B) ported encapsulation device embodiments.
[0030] FIGS. 3A-3B are perspective views of a ported encapsulation
device embodiment. FIG. 3A is a side view and FIG. 3B is a cross
section taken through the center of the device along the internal
weld or seal region.
[0031] FIGS. 4A-4B are perspective (FIG. 4A) and side (FIG. 4B)
views of a large capacity encapsulating device embodiment.
[0032] FIG. 5A is a cross-section of dual ported encapsulation
device embodiment with an internal weld or seal.
[0033] FIG. 5B-5C are perspective views of an encapsulation device
embodiment without loading ports and containing periodic ultrasonic
spot-welds to compartmentalize the internal lumen. FIG. 5B: front
view; FIG. 5C: side view.
[0034] FIG. 6 is a schematic of a cryopreservation protocol.
[0035] FIG. 7 is a graph showing concentration of human c-peptide
in sera of mice implanted with a cell-device combination product.
Expression levels were analyzed at 8-9 weeks or 11-12 weeks
post-engraftment at fasting and 60 min after 3 g/kg intraperitoneal
glucose administration. N identifies the total numbers of GSIS
(glucose stimulated insulin secretion) tests performed on mice
within the indicated post-implant intervals. The box identifies the
middle 50% of the values, the median is represented by the
horizontal line within the box and the standard deviations are
represented by the vertical lines extending from the box.
[0036] FIG. 8 is a graph showing concentration of human c-peptide
in sera of mice implanted with un-encapsulated PEC aggregates (no
device) in the epididymal fat pad. Expression levels were analyzed
12 weeks post-engraftment at fasting and 60 min after 3 g/kg
intraperitoneal glucose administration. N identifies the total
numbers of GSIS (glucose stimulated insulin secretion) tests
performed on mice within the indicated post-implant intervals. The
box identifies the middle 50% of the values, the median is
represented by the horizontal line within the box and the standard
deviations are represented by the vertical lines extending from the
box.
[0037] FIG. 9 is a graph showing the aggregate pellet volume (APV)
yield for cryopreserved PEC aggregates in 30% or 60% KnockOut Serum
Replacement 3 or 4 days post thaw. The X-axis shows the percentage
of knockout serum used to culture the post thawed cells. The Y axis
shows the aggregate pellet volume (APV) yield, i.e., the percentage
of the output (pellet volume 3 or 4 days post thaw) over the input
(pellet volume immediately post thaw). The 90% confidence window is
represented by the line in the middle of the diamond and the lines
forming the diamond.
[0038] FIG. 10 is a graph showing concentration of human c-peptide
in sera of mice implanted with a VC combination product. Expression
levels were analyzed 9, 12, 16 and 24 weeks post-engraftment (data
combined) at fasting, 30 min, and 60 min after intraperitoneal
glucose administration. The controls are cell-device combination
products loaded with day 4 post thawed cells and implanted the same
day. Shipped samples are cell-device combination products loaded
like the controls but then shipped to an off-site location
(Sunnyvale), returned to San Diego, and implanted 24 hours later
than the non-shipped controls.
[0039] FIG. 11 is a graph showing concentration of human c-peptide
in sera of implanted mice. Mice implanted with a cell-device
combination product (PEC loaded in an implantable, semipermeable
encapsulation device) were analyzed post-engraftment for serum
levels of human C-peptide at fasting, 30 min, and 60 min after
intraperitoneal glucose administration.
[0040] FIGS. 12A-12B are graphs showing the Lactate Dehydrogenase
(LDH) Cytotoxicity results for PEC aggregates stored at room
temperature (FIG. 12A) or 4 degrees Celsius (FIG. 12B) for 7 or 14
days and based on data shown in Table 10.
[0041] FIGS. 13A-13B are graphs showing the LDH Cytotoxicity
results for PEC aggregates stored at room temperature (FIG. 13A) or
4 degrees Celsius (FIG. 13B) for 7 or 14 days and based on data
shown in Table 10.
[0042] FIG. 14 is a graph showing concentration of human c-peptide
in sera of mice implanted with a cell-device combination product.
Expression levels were analyzed at 8, 12 and 23 weeks
post-engraftment at fasting, 30 min and 60 min after 3 g/kg
intraperitoneal glucose administration. N identifies the total
numbers of GSIS (glucose stimulated insulin secretion) tests
performed on mice within the indicated post-implant intervals. The
box identifies the middle 50% of the values, the median is
represented by the horizontal line within the box and the standard
deviations are represented by the vertical lines extending from the
box.
DETAILED DESCRIPTION OF THE INVENTION
[0043] The present invention may be understood more readily by
reference to the following detailed description of the preferred
embodiments of the invention and the Examples included herein.
However, before the present compounds, compositions, and methods
are disclosed and described, it is to be understood that this
invention is not limited to specific cell types, specific feeder
cell layers, specific conditions, or specific methods, etc., and,
as such, may vary. Numerous modifications and variations therein
will be apparent to those skilled in the art. It is also to be
understood that the terminology used herein is for the purpose of
describing specific embodiments only and is not intended to be
limiting.
[0044] Unless otherwise noted, the terms used herein are to be
understood according to conventional usage by those of ordinary
skill in the relevant art. Throughout this application, various
patent and non-patent publications are referenced. The disclosures
of all of these publications and those references cited within
those publications in their entireties are hereby incorporated by
reference into this application in their entirety in order to more
fully describe the state of the art to which this patent
pertains.
[0045] Other suitable embodiments described herein are further
described in detail in at least U.S. Pat. No. 8,211,699, METHODS
FOR CULTURING PLURIPOTENT STEM CELLS IN SUSPENSION USING ERBB3
LIGANDS, issued Jul. 3, 2012; U.S. Pat. No. 7,958,585, PREPRIMITIVE
STREAK AND MESENDODERM CELLS, issued Jul. 26, 2011; U.S. Pat. Nos.
7,510,876 and 8,216,836 DEFINITIVE ENDODERM, issued Mar. 31, 2009
and Jul. 10, 2012, respectively; U.S. Pat. No. 7,541,185, METHODS
FOR IDENTIFYING FACTORS FOR DIFFERENTIATING DEFINITIVE ENDODERM,
issued Jun. 2, 2009; U.S. Pat. No. 7,625,753, EXPANSION OF
DEFINITIVE ENDODERM, issued Dec. 1, 2009; U.S. Pat. No. 7,695,963,
METHODS FOR INCREASING DEFINITIVE ENDODERM PRODUCTION, issued Apr.
13, 2010; U.S. Pat. No. 7,704,738, DEFINITIVE ENDODERM, issued Apr.
27, 2010; U.S. Pat. No. 7,993,916, METHODS FOR INCREASING
DEFINITIVE ENDODERM PRODUCTION, issued Aug. 9, 2011; U.S. Pat. No.
8,008,075, STEM CELL AGGREGATE SUSPENSION COMPOSITIONS AND METHODS
OF DIFFERENTIATION THEREOF, issued Aug. 30, 2011; U.S. Pat. No.
8,178,878, COMPOSITIONS AND METHODS FOR SELF-RENEWAL AND
DIFFERENTIATION IN HUMAN EMBRYONIC STEM CELLS, issued May 29, 2012;
U.S. Pat. No. 8,216,836, METHODS FOR IDENTIFYING FACTORS FOR
DIFFERENTIATING DEFINITIVE ENDODERM, issued Jul. 10, 2012; U.S.
Pat. Nos. 7,534,608, 7,695,965, and 7,993,920 issued May 19, 2009,
Apr. 13, 2010; and Aug. 9, 2011, respectively; U.S. Pat. No.
8,129,182, ENDOCRINE PRECURSOR CELLS, PANCREATIC HORMONEEXPRESSING
CELLS AND METHODS OF PRODUCTION, issued Mar. 6, 2012; U.S. Pat. No.
8,338,170 METHODS FOR PURIFYING ENDODERM AND PANCREATIC ENDODERM
CELLS DERIVED FROM HUMAN EMBRYONIC STEM CELLS, issued Dec. 25,
2012; U.S. Pat. No. 8,334,138, METHODS AND COMPOSITIONS FOR
FEEDER-FREE PLURIPOTENT STEM CELL MEDIA CONTAINING HUMAN SERUM,
issued Dec. 18, 2012; U.S. Pat. No. 8,278,106, ENCAPSULATION OF
PANCREATIC CELLS DERIVED FROM HUMAN PLURIPOTENT STEM CELLS, issued
Oct. 2, 2012; U.S. Pat. No. 8,338,170, titled METHOD FOR PURIFYING
ENDODERM AND PANCREATIC ENDODERM CELLS DERIVED FROM HUMAN EMBRYONIC
STEM CELLS (CYTHERA.063A), issued Dec. 25, 2012; U.S. application
Ser. No. 13/761,078, CELL COMPOSITIONS DERIVED FROM
DEDIFFERENTIATED REPROGRAMMED CELLS, filed Feb. 6, 2013; U.S.
application Ser. No. 13/672,688, SCALABLE PRIMATE PLURIPOTENT STEM
CELL AGGREGATE SUSPENSION CULTURE AND DIFFERENTIATION THEREOF,
filed Nov. 8, 2012; U.S. application Ser. No. 14/106,330, IN VITRO
DIFFERENTIATION OF PLURIPOTENT STEM CELLS TO PANCREATIC ENDODERM
CELLS (PEC) AND ENDOCRINE CELLS, filed Dec. 13, 2013; and Design
patent applications 29/408,366; 29/408,368 and 29/408,370 filed
Dec. 12, 2001 and 29/423,365 May 31, 2012.
DEFINITIONS
[0046] It will be appreciated that the numerical ranges expressed
herein include the endpoints set forth and describe all integers
between the endpoints of the stated numerical range.
[0047] Unless otherwise noted, the terms used herein are to be
understood according to conventional usage by those of ordinary
skill in the relevant art. Also, for the purposes of this
specification and appended claims, unless otherwise indicated, all
numbers expressing quantities of ingredients, percentages or
proportions of materials, reaction conditions, and other numerical
values used in the specification and claims, are to be understood
as being modified in all instances by the term "about."
Accordingly, unless indicated to the contrary, the numerical
parameters set forth in the following specification and attached
claims are approximations that may vary depending upon the desired
properties sought to be obtained by the present invention. At the
very least, and not as an attempt to limit the application of the
doctrine of equivalents to the scope of the claims, each numerical
parameter should at least be construed in light of the number of
reported significant digits and by applying ordinary rounding
techniques.
[0048] The practice of embodiments described herein employs, unless
otherwise indicated, conventional techniques of cell biology,
molecular biology, genetics, chemistry, microbiology, recombinant
DNA, and immunology.
[0049] It is to be understood that as used herein and in the
appended claims, the singular forms "a," "an," and "the," include
plural referents unless the context clearly indicates otherwise.
Thus, for example, reference to "a cell" includes one or more of
such different cells and reference to "the method" includes
reference to equivalent steps and methods known to those of
ordinary skill in the art that could be modified or substituted for
the methods described herein.
[0050] The term "cell" as used herein also refers to individual
cells, cell lines, or cultures derived from such cells. A "culture"
refers to a composition comprising isolated cells of the same or a
different type.
[0051] As used herein, the phrase "totipotent stem cells" refer to
cells having the ability to differentiate into all cells
constituting an organism, such as cells that are produced from the
fusion of an egg and sperm cell. Cells produced by the first few
divisions of the fertilized egg can also be totipotent. These cells
can differentiate into embryonic and extraembryonic cell types.
Pluripotent stem cells, such as ES cells for example, can give rise
to any fetal or adult cell type. However, alone they cannot develop
into a fetal or adult animal because they lack the potential to
develop extraembryonic tissue. Extraembryonic tissue is, in part,
derived from extraembryonic endoderm and can be further classified
into parietal endoderm (Reichert's membrane) and visceral endoderm
(forms part of the yolk sac). Both parietal and visceral endoderm
support developments of the embryo but do not themselves form
embryonic structures. There also exist other extraembryonic tissue
including extraembryonic mesoderm and extraembryonic ectoderm.
[0052] In some embodiments, a "pluripotent cell" is used as the
starting material for differentiation to endoderm-lineage, or more
particularly, to pancreatic endoderm type cells. As used herein,
"pluripotency" or "pluripotent cells" or equivalents thereof refers
to cells that are capable of both proliferation in cell culture and
differentiation towards a variety of lineage-restricted cell
populations that exhibit multipotent properties, for example, both
pluripotent ES cells and induced pluripotent stem (iPS) cells can
give rise to each of the three embryonic cell lineages. Pluripotent
cells, however, may not be capable of producing an entire organism.
That is, pluripotent cells are not totipotent.
[0053] In certain embodiments, the pluripotent cells used as
starting material are stem cells, including hES cells, hEG cells,
iPS cells, even parthenogenic cells and the like. As used herein,
"embryonic" refers to a range of developmental stages of an
organism beginning with a single zygote and ending with a
multicellular structure that no longer comprises pluripotent or
totipotent cells other than developed gametic cells. In addition to
embryos derived by gamete fusion, the term "embryonic" refers to
embryos derived by somatic cell nuclear transfer. Still in another
embodiment, pluripotent cells are not derived or are not
immediately derived from embryos, for example, iPS cells are
derived from a non-pluripotent cell, e.g., a multipotent cell or
terminally differentiated cell.
[0054] Human pluripotent stem cells can also be defined or
characterized by the presence of several transcription factors and
cell surface proteins including transcription factors Oct-4, Nanog,
and Sox-2, which form the core regulatory complex ensuring the
suppression of genes that lead to differentiation and the
maintenance of pluripotency; and cell surface antigens, such as the
glycolipids SSEA3, SSEA4 and the keratan sulfate antigens, Tra-1-60
and Tra-1-81.
[0055] As used herein, the phrase "induced pluripotent stem cells,"
or "iPS cells" or "iPSCs", refer to a type of pluripotent stem cell
artificially prepared from a non-pluripotent cell, typically an
adult somatic cell, or terminally differentiated cell, such as a
fibroblast, a hematopoietic cell, a myocyte, a neuron, an epidermal
cell, or the like, by inserting certain genes or gene products,
referred to as reprogramming factors. See Takahashi et al., Cell
131:861-872 (2007); Wernig et al., Nature 448:318-324 (2007); Park
et al., Nature 451:141-146 (2008), which are herein incorporated by
reference in their entireties. Induced pluripotent stem cells are
substantially similar to natural human pluripotent stem cells, such
as hES cells, in many respects including, the expression of certain
stem cell genes and proteins, chromatin methylation patterns,
doubling time, embryoid body formation, teratoma formation, viable
chimera formation, and potency and differentiability. Human iPS
cells provide a source of pluripotent stem cells without the
associated use of embryos.
[0056] Various methods can be employed to produce iPS cells, which
are well known in the art. However, all the methodologies employ
certain reprogramming factors comprising expression cassettes
encoding Sox-2, Oct-4, Nanog and optionally Lin-28, or expression
cassettes encoding Sox-2, Oct-4, Klf4 and optionally c-myc, or
expression cassettes encoding Sox-2, Oct-4, and optionally Esrrb.
Nucleic acids encoding these reprogramming factors can be in the
same expression cassette, different expression cassettes, the same
reprogramming vector, or different reprogramming vectors. Oct-3/4
and certain members of the Sox gene family (Sox-1, Sox-2, Sox-3,
and Sox-15) are crucial transcriptional regulators involved in the
induction process whose absence makes induction impossible. Oct-3/4
(Pou5f1) is one of the family of octamer ("Oct") transcription
factors, and plays an important role in maintaining pluripotency.
For example, the absence of Oct-3/4 in normally Oct-3/4+ cells,
such as blastomeres and embryonic stem cells, leads to spontaneous
trophoblast differentiation; whereas the presence of Oct-3/4 gives
rise to the pluripotency and differentiation potential of embryonic
stem cells. Also, other genes in the "Oct" family, for example,
Oct1 and Oct6, do not induce pluripotency, therefore this
pluripotency induction process can be attributed to Oct-3/4.
Another family of genes associated with maintaining pluripotency
similar to Oct-3/4, is the Sox family. However, the Sox family is
not exclusive to pluripotent cell types but is also associated with
multipotent and unipotent stem cells. The Sox family has been found
to work as well in the induction process. Initial studies by
Takahashi et al., 2006 supra used Sox2. Since then, Sox1, Sox3,
Sox15, and Sox18 genes have also generated iPS cells. Klf4 of the
Klf family of genes (Klf-1, Klf2, Klf4, and Klf5) was initially
identified by Yamanaka et al. 2006 supra as a factor for the
generation of mouse iPS cells. Human iPS cells from S. Yamanaka
were used herein to explore cell therapeutic applications of hIPS
cells. However, Yu et al. 2007 supra reported that Klf4 was not
required and in fact failed to produce human iPS cells. Other
members of the Klf family are capable generating iPS cells,
including Klf1, Klf2 and Klf5. Lastly, the Myc family (C-myc,
L-myc, and N-myc), proto-oncogenes implicated in cancer; c-myc was
a factor implicated in the generation of mouse and human iPS cells,
but Yu et al. (2007 supra reported that c-myc was not required for
generation of human iPS cells.
[0057] As used herein, "multipotency" or "multipotent cell" or
equivalents thereof refers to a cell type that can give rise to a
limited number of other particular cell types. That is, multipotent
cells are committed to one or more embryonic cell fates, and thus,
in contrast to pluripotent cells, cannot give rise to each of the
three embryonic cell lineages as well as to extraembryonic cells.
Multipotent somatic cells are more differentiated relative to
pluripotent cells, but are not terminally differentiated.
Pluripotent cells therefore have a higher potency than multipotent
cells. Potency-determining factors that can reprogram somatic cells
or used to generate iPS cells include, but are not limited to,
factors such as Oct-4, Sox2, FoxD3, UTF1, Stella, Rex1, ZNF206,
Sox15, Myb12, Lin28, Nanog, DPPA2, ESG1, Otx2 or combinations
thereof.
[0058] Embodiments described herein are directed to methods of
preserving cell aggregates or implantable, semipermeable devices or
encapsulated cell aggregates.
[0059] Current cell cryopreservation protocols relate generally to
single cells in suspension. The present application teaches, among
other things, cryopreserving (1) hES derived cell aggregates, (2)
implantable, semipermeable devices and (3) encapsulated hES derived
cell aggregates. Specifically, the present application teaches,
among other things, cryopreserving (1) PEC aggregates, (2)
implantable, semipermeable devices and (3) encapsulated PEC
aggregates ("VC combination product"). Cryopreserving cell
aggregates has additional challenges not present when
cryopreserving single cells. For example, the cell aggregates are
not uniform in shape, size or density. When the cell aggregates are
exposed to a cryopreservant, cells on the outside of the aggregate
are exposed to more of the toxic cryopreservant than cells on the
inside of the aggregate. If the aggregate is not exposed to enough
cryopreservant, for sufficient time, the cells in the middle of the
aggregate may not be exposed to enough cryopreservant resulting in
cell death when exposed to extreme cold. Variations in the
aggregate size and density make it difficult to utilize a single
method effective for all cell aggregates. Problems associated with
variations in cell aggregate shape, size or density could be
alleviated if cell aggregates could be made more homogenous or by
selecting aggregates of uniform shape, size or density, or by
removing aggregates of non-uniform shape, size or density.
[0060] Cells can be inserted into implantable semipermeable devices
at the point of manufacture or, alternatively, at the clinical
site. If the cells are inserted at the point of manufacture or
clinical site, the cells can be cryopreserved separately from the
device. Then, the cryopreserved cells can be thawed when ready to
be used either at the manufacturing or clinical site. Loading an
encapsulation device directly at the clinical site has several
drawbacks in both safety and cell viability. Cells can leak from
the device when the syringe is removed from the port. The syringe's
needle can also pierce the wall of the encapsulation device,
allowing cells to escape. Such contamination is a safety hazard
regulated by the U.S. Food and Drug Administration. Theoretically,
even a single contaminating cell could expand and/or biodistribute.
Thus, development of a procedure to deliver encapsulated cells to
the clinical site is needed. As taught, this problem can be solved
in several different ways: cells can be cryopreserved separate from
the encapsulation device, thawed when needed, loaded into the
encapsulation device and then shipped to the clinical site.
Alternatively, encapsulated cells can be cryopreserved and then
shipped to the clinical site when needed. The encapsulated cells
can be shipped in a cryopreserved or frozen state and thawed prior
to use by the medical professional. The encapsulated cells can also
be thawed prior to shipment. It may also be useful to cryopreserve
the implantable, semipermeable device itself for longer shelf
life.
[0061] Cryopreserving encapsulated cell aggregates has additional
challenges not present when cryopreserving single cells. For
example, there can be significant cell death during thawing of
cells subsequent to cryopreservation. Living cells have difficulty
surviving in such an environment. One of skill in the art will
recognize that if cell survival following cryopreservation is
increased to greater than 50% or greater than 60%, 70%, 80% 90%,
95%, 98% or more preferably 90-95%, cell death during thawing does
not pose as significant an issue.
[0062] Some embodiments of the methods of producing insulin
described herein can include treating an animal having diabetes, or
controlling glucose concentration in the blood of an animal, by
providing the animal with pancreatic endoderm cells that can mature
in vivo into insulin producing cells that secrete insulin in
response to glucose stimulation.
[0063] One aspect described herein includes populations of
pluripotent or precursor cells that are capable of selectively, and
in some aspects selectively reversibly, developing into different
cellular lineages when cultured under appropriate conditions. As
used herein, the term "population" refers to cell culture of more
than one cell having the same identifying characteristics. The term
"cell lineage" refers to all of the stages of the development of a
cell type, from the earliest precursor cell to a completely mature
cell (i.e. a specialized cell). A "precursor cell" or "progenitor
cell" can be any cell in a cell differentiation pathway that is
capable of differentiating into a more mature cell. As such, a
precursor cell can be a pluripotent cell, or it can be a partially
differentiated multipotent cell, or reversibly differentiated cell.
The term "precursor cell population" refers to a group of cells
capable of developing into a more mature or differentiated cell
type. A precursor cell population can comprise cells that are
pluripotent, cells that are stem cell lineage restricted (i.e.
cells capable of developing into less than all ectodermal lineages,
or into, for example, only cells of neuronal lineage), and cells
that are reversibly stem cell lineage restricted. Therefore, the
term "progenitor cell" or "precursor cell" may be a "pluripotent
cell" or "multipotent cell."
[0064] As used herein, the terms "develop from pluripotent cells",
"differentiate from pluripotent cells", "mature from pluripotent
cells" or "produced from pluripotent cells", "derived from
pluripotent cells", "differentiated from pluripotent cells" and
equivalent expressions refer to the production of a differentiated
cell type from pluripotent cells in vitro or in vivo, e.g., in the
case of endocrine cells matured from transplanted PDX1 pancreatic
endoderm cells in vivo as described in International Patent
Application No. PCT/US2007/015536, entitled METHODS OF PRODUCING
PANCREATIC HORMONES. All such terms refer to the progression of a
cell from the stage of having the potential to differentiate into
at least two different cellular lineages to becoming a specialized
and terminally differentiated cell. Such terms can be used
interchangeably for the purposes of the present application.
Embodiments described herein contemplate culture conditions that
permit such differentiation to be reversible, such that
pluripotency or at least the ability to differentiate into more
than one cellular lineage can be selectively regained.
[0065] The term "feeder cell" refers to a culture of cells that
grows in vitro and secretes at least one factor into the culture
medium, and that can be used to support the growth of another cell
of interest in culture. As used herein, a "feeder cell layer" can
be used interchangeably with the term "feeder cell." A feeder cell
can comprise a monolayer, where the feeder cells cover the surface
of the culture dish with a complete layer before growing on top of
each other, or can comprise clusters of cells. In a preferred
embodiment, the feeder cell comprises an adherent monolayer.
[0066] As used herein, the terms "cluster" and "clump" or
"aggregate" can be used interchangeably, and generally refer to a
group of cells that have not been dissociated into single cells.
The clusters may be dissociated into smaller clusters. This
dissociation is typically manual in nature (such as using a Pasteur
pipette), but other means of dissociation are contemplated.
Aggregate suspension pluripotent or multipotent cell cultures are
substantially as described in International Publications
PCT/US2007/062755, titled COMPOSITIONS AND METHODS FOR CULTURING
DIFFERENTIAL CELLS and PCT/US2008/082356, titled STEM CELL
AGGREGATE SUSPENSION COMPOSITIONS AND METHODS OF DIFFERENTIATION
THEREOF, which are herein incorporated by reference in their
entireties.
[0067] Similarly, embodiments in which pluripotent cell cultures or
aggregate pluripotent suspension cultures are grown in defined
conditions without the use of feeder cells, are "feeder-free".
Feeder--free culture methods increase scalability and
reproducibility of pluripotent cell culture and reduces the risk of
contamination, for example, by infectious agents from the feeder
cells or other animal--sourced culture components. Feeder-free
methods are also described in U.S. Pat. No. 6,800,480 to Bodnar et
al. (assigned to Geron Corporation, Menlo Park, Calif.). However,
and in contrast to U.S. Pat. No. 6,800,480 patent, embodiments
described herein, whether they be pluripotent, multipotent or
differentiated cell cultures, are feeder-free and do not further
contain an endogenous or exogenous extracellular-matrix; i.e. the
cultures described herein are extracellular-matrix-free as well as
being feeder free. For example, in the U.S. Pat. No. 6,800,480,
extracellular matrix is prepared by culturing fibroblasts, lysing
the fibroblasts in situ, and then washing what remains after lysis.
Alternatively, in U.S. Pat. No. 6,800,480 extracellular matrix can
also be prepared from an isolated matrix component or a combination
of components selected from collagen, placental matrix,
fibronectin, laminin, merosin, tenascin, heparin sulfate,
chondroitin sulfate, dermatan sulfate, aggrecan, biglycan,
thrombospondin, vitronectin, and decorin. Embodiments described
herein neither produce an extracellular-matrix by growth of a
feeder or fibroblast layer and lysing the cells to produce the
extracellular-matrix; nor does it require first coating the tissue
culture vessel with extracellular matrix component or a combination
of extracellular-matrix components selected from collagen,
placental matrix, fibronectin, laminin, merosin, tenascin, heparin
sulfate, chondroitin sulfate, dermatan sulfate, aggrecan, biglycan,
thrombospondin, vitronectin, and decorin. Hence, the aggregate
suspension cultures described herein for pluripotent, multipotent
and differentiated cells do not require a feeder layer, a lysed
feeder or fibroblast cell to produce an extracellular matrix
coating, an exogenously added extracellular matrix or matrix
component; rather use of soluble human serum component as described
in International Application PCT/US2008/080516, titled METHODS AND
COMPOSITIONS FOR FEEDER-FREE PLURIPOTENT STEM CELL MEDIA CONTAINING
HUMAN SERUM, which is herein incorporated by reference in its
entirety, overcomes the need for either a feeder-cell or feeder
monolayer, as well as overcoming the need for an endogenous
extracellular-matrix from a feeder or fibroblast cell or from
exogenously added extracellular-matrix components.
[0068] In preferred embodiments, culturing methods are free of
animal-sourced products. In another preferred embodiment, the
culturing methods are xeno-free. In even more preferred
embodiments, one or more conditions or requirements for the
commercial manufacture of human cell therapeutics met or exceeded
by the culturing methods described herein.
[0069] General methods for production of endoderm lineage cells
derived from hES cells are described in related U.S. applications
as indicated above, and D'Amour et al. 2005 Nat Biotechnol.
23:1534-41 and D'Amour et al. 2006 Nat Biotechnol. 24(11):1392-401.
D'Amour et al. describe a 5 step differentiation protocol: stage 1
(results in mostly definitive endoderm production), stage 2
(results in mostly PDX1-negative foregut endoderm production),
stage 3 (results in mostly PDX1-positive foregut endoderm
production), stage 4 (results in mostly pancreatic endoderm or
pancreatic endocrine progenitor production) and stage 5 (results in
mostly hormone expressing endocrine cell production.
[0070] The term "trophectoderm" refers to a multipotent cell having
the relative high expression of markers selected from the group
consisting of HAND1, Eomes, MASH2, ESXL1, HCG, KRT18, PSG3, SFXN5,
DLX3, PSX1, ETS2, and ERRB genes as compared to the expression
levels of HAND1, Eomes, MASH2, ESXL1, HCG, KRT18, PSG3, SFXN5,
DLX3, PSX1, ETS2, and ERRB in non-trophectoderm cells or cell
populations.
[0071] "Extraembryonic endoderm" refers to a multipotent cell
having relative high expression levels of markers selected from the
group consisting of SOX7, SOX17, THBD, SPARC, DAB1, or AFP genes as
compared to the expression levels of SOX7, SOX17, THBD, SPARC,
DAB1, or AFP in non-extraembryonic endoderm cells or cell
populations.
[0072] The term "Preprimitive streak cells" refers to a multipotent
cell having relative high expression levels of the FGF8 and/or
NODAL marker genes, as compared to BRACHURY low, FGF4 low, SNAI1
low, SOX17 low, FOXA2 low, SOX7 low and SOX1 low.
[0073] The term "Mesendoderm cell" refers to a multipotent cell
having relative high expression levels of brachyury, FGF4, SNAI1
MIXL1 and/or WNT3 marker genes, as compared to SOX17 low, CXCR4
low, FOXA2 low, SOX7 low and SOX1 low.
[0074] The term "Definitive endoderm (DE)" refers to a multipotent
endoderm lineage cell that can differentiate into cells of the gut
tube or organs derived from the gut tube. In accordance with
certain embodiments, the definitive endoderm cells are mammalian
cells, and in a preferred embodiment, the definitive endoderm cells
are human cells. In some embodiments of the present invention,
definitive endoderm cells express or fail to significantly express
certain markers. In some embodiments, one or more markers selected
from SOX17, CXCR4, MIXL1, GATA4, HNF3.beta., GSC, FGF17, VWF,
CALCR, FOXQ1, CMKOR1 and CRIP1 are expressed in definitive endoderm
cells. In other embodiments, one or more markers selected from
OCT4, alpha-fetoprotein (AFP), Thrombomodulin (TM), SPARC, SOX7 and
HNF4alpha are not expressed or significantly expressed in
definitive endoderm cells. Definitive endoderm cell populations and
methods of production thereof are also described in U.S.
application Ser. No. 11/021,618, entitled DEFINITIVE ENDODERM,
filed Dec. 23, 2004.
[0075] Still other embodiments relate to cell cultures termed
"PDX1-negative foregut endoderm cells" or "foregut endoderm cells"
or equivalents thereof. In some embodiments, the foregut endoderm
cells express SOX17, HNF1.beta. (HNF1B), HNF4alpha (HNF4A) and
FOXA1 markers but do not substantially express PDX1, AFP, SOX7, or
SOX1. PDX1-negative foregut endoderm cell populations and methods
of production thereof are also described in U.S. application Ser.
No. 11/588,693, entitled PDX1-expressing dorsal and ventral foregut
endoderm, filed Oct. 27, 2006.
[0076] Other embodiments described herein relate to cell cultures
of "PDX1-positive, dorsally-biased, foregut endoderm cells" (dorsal
PDX1-positive foregut endoderm cells) or just "PDX1-positive
endoderm." In some embodiments, the PDX1-positive endoderm cells
express one or more markers selected from Table 1 and/or one or
more markers selected from Table 2, also described in related U.S.
application Ser. No. 11/588,693 entitled PDX1 EXPRESSING DOSAL AND
VENTRAL FOREGUT ENDODERM, filed Oct. 27, 2006, and also U.S.
application Ser. No. 11/115,868, entitled PDX1-expressing endoderm,
filed Apr. 26, 2005.
[0077] The PDX1-positive foregut endoderm cells, such as those
produced according to the methods described herein, are progenitors
which can be used to produce fully differentiated pancreatic
hormone secreting or endocrine cells, e.g., insulin-producing
.beta.-cells. In some embodiments of the present invention,
PDX1-positive foregut endoderm cells are produced by
differentiating definitive endoderm cells that do not substantially
express PDX1 (PDX1-negative definitive endoderm cells; also
referred to herein as definitive endoderm) so as to form
PDX1-positive foregut endoderm cells.
[0078] As used herein, "pancreatic endoderm," "pancreatic
epithelial," "pancreatic epithelium" (all can be abbreviated "PE")
"pancreatic progenitor," "PDX-1 positive pancreatic endoderm or
equivalents thereof, such as pancreatic endoderm cells ("PEC"), are
all precursor or progenitor pancreatic cells. PEC as described
herein is a progenitor cell population after stage 4
differentiation (about day 12-14) and includes at least two major
distinct populations: i) pancreatic progenitor cells that express
NKX6.1 but do not express CHGA (or CHGA negative, CHGA-); and ii)
polyhormonal endocrine cells that express CHGA (CHGA positive,
CHGA+). Without being bound by theory, the cell population that
expresses NKX6.1 but not CHGA is hypothesized to be the more active
or therapeutic component of PEC, whereas the population of
CHGA-positive polyhormonal endocrine cells is hypothesized to
further differentiate and mature in vivo into glucagon-expressing
islet cells. See Kelly et al. (2011) Cell-surface markers for the
isolation of pancreatic cell types derived from human embryonic
stem cells, Nat Biotechnol. 29(8):750-756, published online 31 Jul.
2011 and Schulz et al. (2012), A Scalable System for Production of
Functional Pancreatic Progenitors from Human Embryonic Stem Cells,
PLosOne 7(5): 1-17, e37004.
[0079] Still, sometimes, pancreatic endoderm cells are used without
reference to PEC as described just above, but to refer to at least
stages 3 and 4 type cells in general. The use and meaning will be
clear from the context. Pancreatic endoderm derived from
pluripotent stem cells, and at least hES and hIPS cells, in this
manner are distinguished from other endodermal lineage cell types
based on differential or high levels of expression of markers
selected from PDX1, NKX6.1, PTF1A, CPA1, cMYC, NGN3, PAX4, ARX and
NKX2.2 markers, but do not substantially express genes which are
hallmark of pancreatic endocrine cells, for example, CHGA, INS,
GCG, GHRL, SST, MAFA, PCSK1 and GLUT1. Additionally, some
"endocrine progenitor cells" expressing NGN3 can differentiate into
other non-pancreatic structures (e.g., duodenum). In one
embodiment, the NGN3 expressing endocrine progenitor described
herein differentiates into mature pancreatic lineage cells, e.g.,
pancreatic endocrine cells. Pancreatic endoderm or endocrine
progenitor cell populations and methods thereof are also described
in U.S. patent application Ser. No. 11/773,944, entitled Methods of
producing pancreatic hormones, filed Jul. 5, 2007, and U.S. patent
application Ser. No. 12/107,020, entitled METHODS FOR PURIFYING
ENDODERM AND PANCREATIC ENDODERM CELLS DERIVED FORM HUMAN EMBRYONIC
STEM CELLS, filed Apr. 21, 2008.
[0080] As used herein, "endocrine precursor cell" refers to a
multipotent cell of the definitive endoderm lineage that expresses
neurogenin 3 (NEUROG3) and which can further differentiate into
cells of the endocrine system including, but not limited to,
pancreatic islet hormone-expressing cells. Endocrine precursor
cells cannot differentiate into as many different cell, tissue
and/or organ types as compared to less specifically differentiated
definitive endoderm lineage cells, such as PDX1-positive pancreatic
endoderm cell.
[0081] As used herein, "pancreatic islet hormone-expressing cell,"
"pancreatic endocrine cell," or equivalents thereof refer to a
cell, which has been derived from a pluripotent cell in vitro,
which can be polyhormonal or singly-hormonal. The endocrine cells
can therefore express one or more pancreatic hormones, which have
at least some of the functions of a human pancreatic islet cell.
Pancreatic islet hormone-expressing cells can be mature or
immature. Immature pancreatic islet hormone-expressing cells can be
distinguished from mature pancreatic islet hormone-expressing cells
based on the differential expression of certain markers, or based
on their functional capabilities, e.g., glucose responsiveness.
[0082] As used herein, "immature beta cells" or "immature endocrine
cells" or "immature beta cells" or equivalents thereof refers to
endocrine cell populations made in vitro which are capable of
functioning in vivo, i.e., when transplanted secrete insulin in
response to blood glucose. Properly specified endocrine cells or
stage 7 cultures may have additional characteristics including the
following: When transplanted, properly specified endocrine cells
may develop and mature to functional pancreatic islet cells.
Properly specified endocrine cells may be enriched for endocrine
cells (or depleted of non-endocrine cells). In a preferred
embodiment greater than about 50% of the cells in the properly
specified endocrine cell population are CHGA+. In a more preferred
embodiment greater than about 60% or 70% or 80% or 90% or 95% or
98% or 100% of the cells in the properly specified endocrine cell
population are CHGA+. In a preferred embodiment less than about 50%
of the cells in the properly specified endocrine cell population
are CHGA-. In a more preferred embodiment less than about 15% of
the cells in the properly specified endocrine cell population are
CHGA-. In a more preferred embodiment less than about 10% or 5% or
3% or 2% or 1% or 0.5% or 0% of the cells in the properly specified
endocrine cell population are CHGA-. Further, expression of certain
markers may be suppressed in properly specified endocrine cells
such as NGN3 expression during stage 3. Properly specified
endocrine cells may have increased expression of NGN3 at stage 5.
Properly specified endocrine cells may be singly-hormonal (e.g. INS
only, GCG only or SST only). Properly specified endocrine cells may
co-express other immature endocrine cell markers including NKX6.1
and PDX1. Properly specified endocrine cells may be both
singly-hormonal and co-express other immature endocrine cell
markers including NKX6.1 and PDX1. Properly specified endocrine
cells may have more singly hormone expressing INS cells as a
percentage of the total INS population. In a preferred embodiment
properly specified endocrine cells have at least 50% singly hormone
expressing INS cells as a percentage of the total INS population.
Properly specified endocrine cells may be CHGA+/INS+/NKX6.1+
(triple positive). In a preferred embodiment greater than about 25%
of the cells in the cell population are CHGA+/INS+/NKX6.1+ (triple
positive). In a preferred embodiment greater than about 30% or 40%
or 50% or 60% or 70% or 80% or 90% or 95% 100% of the cells in the
cell population are CHGA+/INS+/NKX6.1+ (triple positive).
[0083] The term "immature endocrine cell,", specifically an
"immature beta-cell," or equivalents thereof refer to a cell
derived from any other endocrine cell precursor including an
endocrine progenitor/precursor cell, a pancreatic endoderm (PE)
cell, a pancreatic foregut cell, a definitive endoderm cell, a
mesendoderm cell or any earlier derived cell later described, that
expresses at least a marker selected from the group consisting of
INS, NKX6.1, PDX1, NEUROD, MNX1, NKX2.2, MAFA, PAX4, SNAIL2, FOXA1
or FOXA2. Preferably, an immature beta-cell described herein
expresses, INS, NKX6.1 and PDX1, and more preferably it
co-expresses INS and NKX6.1. The terms "immature endocrine cell,"
"immature pancreatic hormone-expressing cell," or "immature
pancreatic islet" or equivalents thereof refer to a unipotent
immature beta cell, or pre-beta cell, and do not include other
immature cells, for example, the terms do not include an immature
alpha (glucagon) cell, or an immature delta (somatostatin) cell, or
an immature epsilon (ghrelin) cell, or an immature pancreatic
polypeptide (PP). Immature endocrine and immature beta cells are
described in more detail in Applicants U.S. application No.,
ENCAPSULATION OF PANCREATIC CELLS DERIVED FROM HUMAN PLURIPOTENT
STEM CELLS, filed Dec. 13, 2013.
[0084] The term "essentially" or "substantially" means either a de
minimus or a reduced amount of a component or cell present in any
cell aggregate suspension type, e.g., cell aggregates in suspension
described herein are "essentially or substantially homogenous",
"essentially or substantially homo-cellular" or are comprised of
"essentially hES cells", "essentially or substantially definitive
endoderm cells", "essentially or substantially foregut endoderm
cells", "essentially or substantially PDX1-negative foregut
endoderm cells", "essentially or substantially PDX1-positive
pre-pancreatic endoderm cells", "essentially or substantially
PDX1-positive pancreatic endoderm or progenitor cells",
"essentially or substantially PDX1-positive pancreatic endoderm tip
cells", "essentially or substantially pancreatic endocrine
precursor cells", "essentially or substantially pancreatic
endocrine cells" and the like.
[0085] With respect to cells in cell cultures or in cell
populations, the term "substantially free of" means that the
specified cell type of which the cell culture or cell population is
free, is present in an amount of less than about 10%, less than
about 9%, less than about 8%, less than about 7%, less than about
6%, less than about 5%, less than about 4%, less than about 3%,
less than about 2% or less than about 1% of the total number of
cells present in the cell culture or cell population.
[0086] Cell cultures can be grown in medium containing reduced
serum or substantially free of serum or no serum. Under certain
culture conditions, serum concentrations can range from about 0%
(v/v) to about 10% (v/v). For example, in some differentiation
processes, the serum concentration of the medium can be less than
about 0.05% (v/v), less than about 0.1% (v/v), less than about 0.2%
(v/v), less than about 0.3% (v/v), less than about 0.4% (v/v), less
than about 0.5% (v/v), less than about 0.6% (v/v), less than about
0.7% (v/v), less than about 0.8% (v/v), less than about 0.9% (v/v),
less than about 1% (v/v), less than about 2% (v/v), less than about
3% (v/v), less than about 4% (v/v), less than about 5% (v/v), less
than about 6% (v/v), less than about 7% (v/v), less than about 8%
(v/v), less than about 9% (v/v) or less than about 10% (v/v). In
some processes, preprimitive streak cells are grown without serum
or without serum replacement. In still other processes,
preprimitive streak cells are grown in the presence of B27. In such
processes, the concentration of B27 supplement can range from about
0.1% (v/v) to about 20% (v/v).
[0087] As used herein, "exogenously added," compounds such as
growth factors, differentiation factors, and the like, in the
context of cultures or conditioned media, refers to growth factors
that are added to the cultures or media to supplement any compounds
or growth factors that may already be present in the culture or
media. For example, in some embodiments, cells cultures and or cell
populations do not include an exogenously-added retinoid.
[0088] As used herein, "expression" refers to the production of a
material or substance as well as the level or amount of production
of a material or substance. Thus, determining the expression of a
specific marker refers to detecting either the relative or absolute
amount of the marker that is expressed or simply detecting the
presence or absence of the marker.
[0089] As used herein, "marker" refers to any molecule that can be
observed or detected. For example, a marker can include, but is not
limited to, a nucleic acid, such as a transcript of a specific
gene, a polypeptide product of a gene, a non-gene product
polypeptide, a glycoprotein, a carbohydrate, a glycolipid, a lipid,
a lipoprotein or a small molecule (for example, molecules having a
molecular weight of less than 10,000 amu).
[0090] The progression of pluripotent cells to various multipotent
and/or differentiated cells can be monitored by determining the
relative expression of genes, or gene markers, characteristic of a
specific cell, as compared to the expression of a second or control
gene, e.g., housekeeping genes. In some processes, the expression
of certain markers is determined by detecting the presence or
absence of the marker. Alternatively, the expression of certain
markers can be determined by measuring the level at which the
marker is present in the cells of the cell culture or cell
population. In such processes, the measurement of marker expression
can be qualitative or quantitative. One method of quantitating the
expression of markers that are produced by marker genes is through
the use of quantitative PCR (Q-PCR). Methods of performing Q-PCR
are well known in the art. Other methods which are known in the art
can also be used to quantitate marker gene expression. For example,
the expression of a marker gene product can be detected by using
antibodies specific for the marker gene product of interest.
[0091] The terms fibroblast growth factor 7 (FGF7) and keratinocyte
growth factor (KGF) are synonymous.
Methods for Production of Induced Pluripotent Stem (iPS) Cells
[0092] Embodiments described herein are not limited to any one type
of iPS cell or any one method of producing the iPS cell.
Embodiments are not limited or dependent on levels of efficiency of
production of the iPS cells, because various methods exist.
Embodiments described herein apply to differentiation of iPS cells
into endoderm-lineage cells and uses thereof.
[0093] Embodiments of the compositions and methods described herein
contemplate the use of various differentiable primate pluripotent
stem cells including human pluripotent stem cells such as hESC,
including but not limited to, CyT49, CyT212, CyT203, CyT25,
(commercially available at least at the time of filing of this
instant application from ViaCyte Inc. located at 3550 General
Atomics Court, San Diego Calif. 92121) BGO1, BG02 and MELT, and
induced pluripotent stem (iPS) cells such as iPSC-482c7 and
iPSC-603 (Cellular Dynamics International, Inc., Madison, Wis.) and
iPSC-G4 (hereinafter "G4") and iPSC-B7 (hereinafter, "B7") (Shinya
Yamanaka, Center for iPS Cell Research, Kyoto University); studies
using G4 and B7 are described in detail herein. Certain of these
human pluripotent stem cells are registered with national
registries such as the National Institutes of Health (NIH) and
listed in the NIH Human Stem Cell Registry (e.g., CyT49
Registration No. #0041). Information on CyT49, other available cell
lines can also be found on the worldwide web at
stemcells.nih.gov/research/registry. Still other cell lines, e.g.,
BG01 and BG01v, are sold and distributed to third parties by
WiCell.RTM., an affiliate of the Wisconsin International Stem Cell
(WISC) Bank (Catalog name, BG01) and ATCC (Catalog No. SCRC-2002),
respectively. While other cell lines described herein may not be
registered or distributed by a biological repository, such as
WiCell.RTM. or ATCC, such cell lines are available to the public
directly or indirectly from the principle investigators,
laboratories and/or institutions. Public requests for cell lines
and reagents, for example, are customary for those skilled in the
art in the life sciences. Typically, transfer of these cells or
materials is by way of a standard material transfer agreement
between the proprietor of the cell line or material and the
recipient. These types of material transfers occur frequently in a
research environment, particularly in the life sciences. In fact,
Applicant has routinely transferred cells since the time they were
derived and characterized, including CyT49 (2006), CyT203 (2005),
Cyt212 (2009), CyT25 (2002), BG01 (2001), BG02 (2001), BG03 (2001)
and BG01v (2004), through such agreements with commercial and
non-profit industry partners and collaborators. The year in
parenthesis next to each cell line in the previous list indicates
the year when the cell lines or materials became publically
available and immortal (e.g. cell banks were made) and thus
destruction of another embryo has not been performed or required
since the establishment of these cell lines in order to make the
compositions and practice the methods described herein.
[0094] In August 2006, Klimanskaya et al. demonstrated that hESC
can be derived from single blastomeres, hence keeping the embryo
intact and not causing their destruction. Biopsies were performed
from each embryo using micromanipulation techniques and nineteen
(19) ES-cell-like outgrowths and two (2) stable hESC lines were
obtained. These hESC lines were able to be maintained in an
undifferentiated state for over six (6) months, and showed normal
karyotype and expression of markers of pluripotency, including
Oct-4, SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, Nanog and Alkaline
Phosphatase. These hESC can differentiate and form derivatives of
all three (3) embryonic germ layers both in vitro and form in
teratomas in vivo. These methods to create new stem cell lines
without destruction of embryos addresses the ethical concerns of
using human embryos. See Klimanskaya et al. (2006) Nature
444:481-5, Epub 2006 Aug. 23. However, Klimanskaya et al.
co-cultured the derived hESC line with other hESC. Later, in 2008,
Chung Y. et al., were able to obtain hES cell lines again from a
single blastomere but without co-culture with hESC. See Chung Y. et
al., Cell Stem Cell 2008, 2(2), 113-117. Thus the compositions and
methods described herein, and in particular, the such compositions
and methods as related to induced pluripotent stem cells or
genetically dedifferentiated pluripotent stem cells, do not require
the destruction of a human embryo.
[0095] Tables 3 and 4 are non-exhaustive lists of certain iPSC and
hESCs, respectively, which are available worldwide for research
and/or commercial purposes, and are suitable for use in the methods
and compositions of the present invention. The information in
Tables 3 and 4 were derived from the literature and publically
available databases including, for example, the National Institutes
of Health (NIH) Human Stem Cell Registry, the Human Embryonic Stem
Cell Registry and the International Stem Cell Registry located at
the University of Massachusetts Medical School, Worcester, Mass.,
USA. These databases are periodically updated as cell lines become
available and registration obtained.
[0096] Human iPSC described herein (at least iPSC-603 and
iPSC-482-c7) were provided by Cellular Dynamics International, Inc.
(Madison, Wis., USA).
TABLE-US-00001 TABLE 3 Listing of human induced pluripotent stem
(hIPS) cell lines University of Wisconsin 1. IPS(FORESKIN)-1
(Normal; 46XY; Yu, J., et al. [Thomson] Madison (USA) Science. 2007
Induced pluripotent stem cell lines derived from human somatic
cells 318(5858): 1917-20.) 2. IPS(FORESKIN)-2 (Normal; 46XY; Yu,
J., et al. [Thomson] Science. 2007 Induced pluripotent stem cell
lines derived from human somatic cells 318(5858): 1917-20.) 3.
IPS(FORESKIN)-3 (Normal; 46XY; Yu, J., et al. [Thomson] Science.
2007 Induced pluripotent stem cell lines derived from human somatic
cells 318(5858): 1917-20.) 4. IPS(FORESKIN)-4 (Normal; 46XY; Yu,
J., et al. [Thomson] Science. 2007 Induced pluripotent stem cell
lines derived from human somatic cells 318(5858): 1917-20.) 5.
IPS(IMR90)-1 (Normal; 46XX; Yu, J., et al. [Thomson] Science. 2007
Induced pluripotent stem cell lines derived from human somatic
cells 318(5858): 1917-20.) 6. IPS(IMR90)-2 (Normal; 46XX; Yu, J.,
et al. [Thomson] Science. 2007 Induced pluripotent stem cell lines
derived from human somatic cells 318(5858): 1917-20.) 7.
IPS(IMR90)-3 (Normal; 46XX; Yu, J., et al. [Thomson] Science. 2007
Induced pluripotent stem cell lines derived from human somatic
cells 318(5858): 1917-20.) 8. IPS(IMR90)-4 (Normal; 46XX; Yu, J.,
et al. [Thomson] Science. 2007 Induced pluripotent stem cell lines
derived from human somatic cells 318(5858): 1917-20.) 9.
IPS-SMA-3.5 (Normal; 46XY; Type 1 Spinal Muscular Atrophy; Ebert,
A. D., et al. 2009. Induced pluripotent stem cells from a spinal
muscular atrophy patient Nature. 457: 277-80) 10. IPS-SMA-3.6
(Normal; 46XY; Type 1 Spinal Muscular Atrophy; Ebert, A. D., et al.
2009. Induced pluripotent stem cells from a spinal muscular atrophy
patient Nature. 457: 277-80) 11. IPS-WT (Normal; 46XX; Type 1
Spinal Muscular Atrophy; Ebert, A. D., et al. 2009. Induced
pluripotent stem cells from a spinal muscular atrophy patient
Nature. 457: 277-80) University of California, Los 1. IPS-1
(Karumbayaram, S. et al. 2009. Directed Differentiation of Angeles
(USA) Human-Induced Pluripotent Stem Cells Generates Active Motor
NeuronsStem Cells. 27: 806-811; Lowry, W. E., et al. 2008.
Generation of human induced pluripotent stem cells from dermal
fibroblasts Proc Natl Acad Sci USA. 105: 2883-8) 2. IPS-2
(Karumbayaram, S. et al. 2009. Directed Differentiation of
Human-Induced Pluripotent Stem Cells Generates Active Motor
NeuronsStem Cells. 27: 806-811; Lowry, W. E., et al. 2008.
Generation of human induced pluripotent stem cells from dermal
fibroblastsProc Natl Acad Sci USA. 105: 2883-8) 3. IPS-5 (Lowry, W.
E., et al. 2008. Generation of human induced pluripotent stem cells
from dermal fibroblasts Proc Natl Acad Sci USA. 105: 2883-8) 4.
IPS-7 (Lowry, W. E., et al. 2008. Generation of human induced
pluripotent stem cells from dermal fibroblasts Proc Natl Acad Sci
USA. 105: 2883-8) 5. IPS-18 (Karumbayaram, S. et al. 2009. Directed
Differentiation of Human-Induced Pluripotent Stem Cells Generates
Active Motor NeuronsStem Cells. 27: 806-811; Lowry, W. E., et al.
2008. Generation of human induced pluripotent stem cells from
dermal fibroblastsProc Natl Acad Sci USA. 105: 2883-8) 6. IPS-24
(Lowry, W. E., et al. 2008. Generation of human induced pluripotent
stem cells from dermal fibroblasts Proc Natl Acad Sci USA. 105:
2883-8) 7. IPS-29 (Lowry, W. E., et al. 2008. Generation of human
induced pluripotent stem cells from dermal fibroblasts Proc Natl
Acad Sci USA. 105: 2883-8) Mt. Sinai Hospital (Samuel 1. 60
(Woltjen, K. et al. 2009. PiggyBac transposition reprograms
Lunenfeld Research fibroblasts to induced pluripotent stem cells
Nature. Institute; USA) 458(7239): 766-70) 2. 61 (Woltjen, K. et
al. 2009. PiggyBac transposition reprograms fibroblasts to induced
pluripotent stem cells Nature. 458(7239): 766-70) 3. 66 (Woltjen,
K. et al. 2009. PiggyBac transposition reprograms fibroblasts to
induced pluripotent stem cells Nature 458(7239): 766-70) 4. 67
(Woltjen, K. et al. 2009. PiggyBac transposition reprograms
fibroblasts to induced pluripotent stem cells Nature 458(7239):
766-70) 5. HIPSC117 (Kaji K, et al. 2009 Virus-free induction of
pluripotency and subsequent excision of reprogramming factors
Nature 458(7239): 771-5) 6. HIPSC121 (Kaji K, et al. 2009
Virus-free induction of pluripotency and subsequent excision of
reprogramming factors Nature 458(7239): 771-5) 7. HIPSC122 (Kaji K,
et al. 2009 Virus-free induction of pluripotency and subsequent
excision of reprogramming factors Nature 458(7239): 771-5)
Children's Hospital - Boston 1. 551-IPS8 (Park IH, et al. 2008.
Reprogramming of human (USA) somatic cells to pluripotency with
defined factors Nature 451: 141-6). 2. ADA-IPS2 ((ADA-SCID)
Adenosine Deaminase Deficiency- related Severe Combined
Immunodeficiency (GGG>AGG, exon 7, ADA gene); Park, I. H. et al.
2008. Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):
877-86) 3. ADA-IPS3 ((ADA-SCID) Adenosine Deaminase Deficiency-
related Severe Combined Immunodeficiency (GGG>AGG, exon 7, ADA
gene); Park, I. H. et al. 2008. Disease-Specific Induced
Pluripotent Stem Cells Cel 1134(5): 877-86) 4. BJ1-IPS1 (Park, I.
H. et al. 2008. Disease-Specific Induced Pluripotent Stem Cells
Cell 134(5): 877-86) 5. BMD-IPS1 (Male; (BMD) Becker Muscular
Dystrophy (Unidentified mutation in dystrophin); Park, I. H. et al.
2008. Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):
877-86) 6. BMD-IPS4 (Normal; 46XY; (BMD) Becker Muscular Dystrophy
(Unidentified mutation in dystrophin); Park, I. H. et al. 2008.
Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):
877-86) 7. DH1CF16-IPS1 (Normal; 46XY; Park, I. H. et al. 2008.
Disease- Specific Induced Pluripotent Stem Cells Cell 134(5):
877-86) 8. DH1CF32-IPS2 (Male; Park, I. H. et al. 2008.
Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):
877-86) 9. DH1F-IPS3-3(Normal; 46XY; Park, I. H. et al. 2008.
Disease- Specific Induced Pluripotent Stem Cells Cell 134(5):
877-86) 10. DMD-IPS1 ((Normal; 46XY; DMD) Duchenne Muscular
Dystrophy (Deletion of exon 45-52, dystrophin gene; Park, I. H. et
al. 2008. Disease-Specific Induced Pluripotent Stem Cells Cell
134(5): 877-86) 11. DMD-IPS2 (Male; (DMD) Duchenne Muscular
Dystrophy (Deletion of exon 45-52, dystrophin gene; Park, I. H. et
al. 2008. Disease-Specific Induced Pluripotent Stem Cells Cell
134(5): 877-86) 12. DS1-IPS4 (Male; Down syndrome (Trisomy 21);
Park, I. H. et al. 2008. Disease-Specific Induced Pluripotent Stem
Cells Cell 134(5): 877-86) 13. DS2-IPS1 (Male; Down syndrome
(Trisomy 21); Park, I. H. et al. 2008. Disease-Specific Induced
Pluripotent Stem Cells Cell 134(5): 877-86) 14. DS2-IPS10 (Male;
Down syndrome (Trisomy 21); Park, I. H. et al. 2008.
Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):
877-86) 15. GD-IPS1(Male; (GD) Gaucher Disease type III (AAC >
AGC, exon 9, G-insertion, nucleotide 84 of cDNA, GBA gene; Park, I.
H. et al. 2008. Disease-Specific Induced Pluripotent Stem Cells
Cell 134(5): 877-86) 16. GD-IPS3 (Male; (GD) Gaucher Disease type
III (AAC > AGC, exon 9, G-insertion, nucleotide 84 of cDNA, GBA
gene; Park, I. H. et al. 2008. Disease-Specific Induced Pluripotent
Stem Cells Cell 134(5): 877-86) 17. HFIB2-IPS2 (Park, I. H., et al.
2008. Generation of human- induced pluripotent stem cells Nat
Protoc. 3: 1180-6; Park, I. H. et al. 2008. Reprogramming of human
somatic cells to pluripotency with defined factors Nature 451:
141-6) 18. HFIB2-IPS4 (Park, I. H., et al. 2008. Generation of
human- induced pluripotent stem cells Nat Protoc. 3: 1180-6; Park,
I. H. et al. 2008. Reprogramming of human somatic cells to
pluripotency with defined factors Nature 451: 141-6) 19. HFIB2-IPS5
(Park, I. H., et al. 2008. Generation of human- induced pluripotent
stem cells Nat Protoc. 3: 1180-6; Park, I. H. et al. 2008.
Reprogramming of human somatic cells to pluripotency with defined
factors Nature 451: 141-6) 20. JDM-IPS1 (Normal, 46XX; Juvenile
diabetes mellitus (multifactorial); Park, I. H. et al. 2008.
Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):
877-86) 21. JDM-IPS1 (Normal, 46XX; Juvenile diabetes mellitus
(multifactorial); Park, I. H. et al. 2008. Disease-Specific Induced
Pluripotent Stem Cells Cell 134(5): 877-86) 22. JDM-IPS2 (Female;
Juvenile diabetes mellitus (multifactorial); Park, I. H. et al.
2008. Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):
877-86) 23. JDM-IPS3 (Female; Juvenile diabetes mellitus
(multifactorial); Park, I. H. et al. 2008. Disease-Specific Induced
Pluripotent Stem Cells Cell 134(5): 877-86) 24. LNSC-IPS2 (Female;
Lesch-Nyhan syndrome (carrier, heterozygosity of HPRT1; Park, I. H.
et al. 2008. Disease- Specific Induced Pluripotent Stem Cells Cell
134(5): 877-86) 25. MRC5-IPS7 (Male; Park, I. H. et al. 2008.
Disease-Specific Induced Pluripotent Stem Cells Cell134(5): 877-86)
26. MRCS-IPS12 (Normal; 46XY; Park, I. H. et al. 2008. Disease-
Specific Induced Pluripotent Stem Cells Cell 134(5): 877-86) 27.
MRC5-IPS1 (Male; Park, I. H. et al. 2008. Disease-Specific Induced
Pluripotent Stem Cells Cell 134(5): 877-86) 28. PD-IPS1 (Male;
Parkinson disease (multifactorial); Park, I. H. et al. 2008.
Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):
877-86) 29. SBDS-IPS1 (Male; Swachman-Bodian-Diamond syndrome (IV2
+ 2T > C and IV3 - 1G > A, SBDS gene; Park, I. H. et al.
2008. Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):
877-86) 30. SBDS-IPS2 31. SBDS-IPS3 (Normal; 46XY;
Swachman-Bodian-Diamond syndrome (IV2 + 2T > C and IV3 - 1G >
A, SBDS gene; Park, I. H. et al. 2008. Disease-Specific Induced
Pluripotent Stem Cells Cell 134(5): 877-86) Harvard University
(USA) 1. A29a (46XX; (ALS) Amyotrophic Lateral Sclerosis (L144F
[Leu144 > Phe] dominant allele of the superoxide dismutase
(SOD1) gene; Caucasian; Dimos, J. T., et al. 2008. Induced
pluripotent stem cells generated from patients with ALS can be
differentiated into motor neurons Science. 321: 1218-21) 2. A29b
(46XX; (ALS) Amyotrophic Lateral Sclerosis (L144F [Leu144 > Phe]
dominant allele of the superoxide dismutase (SOD1) gene; Caucasian;
Dimos, J. T., et al. 2008. Induced pluripotent stem cells generated
from patients with ALS can be differentiated into motor neurons
Science. 321: 1218-21) 3. A29c (46XX; (ALS) Amyotrophic Lateral
Sclerosis (L144F [Leu144 > Phe] dominant allele of the
superoxide dismutase (SOD1) gene; Caucasian; Dimos, J. T., et al.
2008. Induced pluripotent stem cells generated from patients with
ALS can be differentiated into motor neurons Science 321: 1218-21)
Salk Institute (USA) 1. HAIR-IPS1 (Aasen, T., et al [Belmonte, J.
C.] 2008. Efficient and rapid generation of induced pluripotent
stem cells from human keratinocytes Nat Biotechnol 26: 1276-84) 2.
HAIR-IPS2 (Aasen, T., et al [Belmonte, J. C.] 2008. Efficient and
rapid generation of induced pluripotent stem cells from human
keratinocytes Nat Biotechnol 26: 1276-84) Royan Institute (Iran) 1.
R.1.H.iPSC.1(OCT4, Sox2, KLF4, c-Myc; Human fibroblasts) 2.
BOM.1.H.iPSC.1 (OCT4, Sox2, KLF4, c-Myc; Human fibroblasts) 3.
FHC.1.H.iPSC.3 (OCT4, Sox2, KLF4, c-Myc; Human fibroblasts) 4.
GSD.1.H.iPSC.7 (OCT4, Sox2, KLF4, c-Myc; Human fibroblasts) 5.
TYR.1.H.iPSC.1 (OCT4, Sox2, KLF4, c-Myc; Human fibroblasts) 6.
HER.1.H.iPSC.1 (OCT4, Sox2, KLF4, c-Myc; Human fibroblasts) 7.
R.1.H.iPSC.4 (OCT4, Sox2, KLF4, c-Myc; Human fibroblasts) 8.
R.1.H.iPSC.9 (OCT4, Sox2, KLF4, c-Myc; Human fibroblasts) 9.
RP2.H.iPSC.3 (OCT4, Sox2, KLF4, c-Myc; iPS cells) 10.
LCA.1.H.iPSC.1 (OCT4, Sox2, KLF4, c-Myc; iPS cells) 11.
USH.1.H.iPSC.6 (OCT4, Sox2, KLF4, c-Myc; Human fibroblasts) 12.
RP.1.H.iPSC.2 (OCT4, Sox2, KLF4, c-Myc; Human fibroblasts) 13.
ARMD.1.H.iPSC.2 (OCT4, Sox2, KLF4, c-Myc; Human fibroblasts) 14.
LHON.1.H.iPSC.5 (OCT4, Sox2, KLF4, c-Myc; iPS cells) 15.
CNS.1.H.iPSC.10 (OCT4, Sox2, KLF4, c-Myc; iPS cells) 16.
CNS.2.H.iPSC.7 (OCT4, Sox2, KLF4, c-Myc; iPS cells) Centre of
Regenerative 1. KiPS4F-1 (OCT4, Sox2, KLF4, c-Myc; human foreskin
Medicine in Barcelona keratinocytes; 46XY) (Spain) 2. KiPS3F-7
(OCT4, Sox2, KLF4); human foreskin keratinocytes) 3. KiPS4F-8
(OCT4, Sox2, KLF4, c-Myc human foreskin keratinocytes; 46XY) 4.
cFA404-KiPS4F-1 (OCT4, Sox2, KLF4, c-Myc; Epidermal keratinocytes;
46XY) 5. cFA404-KiPS4F-3 (OCT4, Sox2, KLF4, c-Myc; Epidermal
keratinocytes; 46XY) Universite Paris-Sud 11 1. PB03 (Oct4, Sox2,
Lin28, Nanog; Primary Amniocytes; 46XX; (France) Lentivirus) 2.
PB04 (Oct4, Sox2, Lin28, Nanog; Primary Amniocytes; B- Thalassemia
affected; 46XY; Lentivirus) 3. PB05-1 (Oct4, Sox2, Lin28, Nanog;
Primary Amniocytes; B- Thalassemia affected; 46XY; Lentivirus) 4.
PB05 (Oct4, Sox2, Lin28, Nanog; Primary Amniocytes; B-
Thalassemia affected; 46XY; Lentivirus) 5. PB06 (Oct4, Sox2, Lin28,
Nanog; Primary Amniocytes; Down Syndrome; 47XY, +21; Lentivirus) 6.
PB06-1 (Oct4, Sox2, Lin28, Nanog; Primary Amniocytes; Down
Syndrome; 47XY, +21; Lentivirus) 7. PB07 (OCT4, Sox2, KLF4, c-Myc;
Primary Amniocytes; 46XY; Retrotivirus) 8. PB08 (OCT4, Sox2, KLF4,
c-Myc; Primary Amniocytes; 46XY; Retrotivirus) 9. PB09 (Oct4, Sox2,
Lin28, Nanog; Primary Amniocytes; 46XY; Lentivirus) 10. PB10 (Oct4,
Sox2; Primary Amniocytes46XY, Lentivirus) Kyoto University (Japan)
1. 201B1 (human fibroblast; 46XX) 2. 201B2 (human fibroblast; 46XX)
3. 201B3 (human fibroblast; 46XX) 4. 201B6 (human fibroblast; 46XX)
5. 201B7 (human fibroblast; 46XX) 6. 243H1 (human fibroblast) 7.
243H7 (human fibroblast) 8. 246B1 (Normal, 46XX) 9. 246B2 (Normal,
46XX) 10. 246B3 (Normal, 46XX) 11. 246B4 (Normal, 46XX) 12. 246B5
(Normal, 46XX) 13. 246B6 (Normal, 46XX) 14. 246G1 (human
fibroblast; Takahashi, K., et al. 2007. Induction of pluripotent
stem cells from adult human fibroblasts by defined factors Cell.
131: 861-72) 15. 246G3 (human fibroblast; Takahashi, K., et al.
2007. Induction of pluripotent stem cells from adult human
fibroblasts by defined factors Cell. 131: 861-72) 16. 246G4 (human
fibroblast; Takahashi, K., et al. 2007. Induction of pluripotent
stem cells from adult human fibroblasts by defined factors Cell.
131: 861-72) 17. 246G5 (human fibroblast; Takahashi, K., et al.
2007. Induction of pluripotent stem cells from adult human
fibroblasts by defined factors Cell. 131: 861-72) 18. 246G6 (human
fibroblast; Takahashi, K., et al. 2007. Induction of pluripotent
stem cells from adult human fibroblasts by defined factors Cell.
131: 861-72) 19. 253F1 (Normal, 46XX; Takahashi, K., et al. 2007.
Induction of pluripotent stem cells from adult human fibroblasts by
defined factors Cell. 131: 861-72) 20. 253F2 (Normal, 46XX;
Takahashi, K., et al. 2007. Induction of pluripotent stem cells
from adult human fibroblasts by defined factors Cell. 131: 861-72)
21. 253F3 (Normal, 46XX; Takahashi, K., et al. 2007. Induction of
pluripotent stem cells from adult human fibroblasts by defined
factors Cell. 131: 861-72) 22. 253F4 (Normal, 46XX; Takahashi, K.,
et al. 2007. Induction of pluripotent stem cells from adult human
fibroblasts by defined factors Cell. 131: 861-72) 23. 253F5
(Normal, 46XX; Takahashi, K., et al. 2007. Induction of pluripotent
stem cells from adult human fibroblasts by defined factors Cell.
131: 861-72) Shanghai Institutes for 1. HAFDC-IPS-6 (Li C., et al.
2009 Pluripotency can be rapidly and Biological Sciences (China)
efficiently induced in human amniotic fluid-derived cells Hum Mol
Genet. 2009 Nov 15; 18(22): 4340-9) 2. IPS-S (Liao, J., et al. 2008
Enhanced efficiency of generating induced pluripotent stem (iPS)
cells from human somatic cells by a combination of six
transcription factors Cell Res. 18: 600-3)
[0097] Another advantage is that such hIPS cells would be an
immunologically matched autologous cell population; and
patient-specific cells would allow for studying origin and
progression of the disease. Thus, it is possible to understand the
root causes of a disease, which can provide insights leading to
development of prophylactic and therapeutic treatments for the
disease.
Pluripotent Human Embryonic Stem (hES) Cells
[0098] The invention described herein is useful with all hES cell
lines, and at least those listed in Table 4. This information was
derived from the literature and publically available databases
including for example the National Institutes of Health (NIH) Stem
Cell Registry, the Human Embryonic Stem Cell Registry and the
International Stem Cell Registry located at the University of
Massachusetts Medical School, Worcester, Mass., USA. These
databases are periodically updated as cell lines become available
and registration obtained. As of the filing date of this
application there were 254 iPSC lines listed with the International
Stem Cell Registry and 1211 hESC lines. Table 4 below is not
inclusive of all hESC and iPSC that are listed, but rather, are
examples of the pluripotent stem cells potentially available.
TABLE-US-00002 TABLE 4 Listing of human embryonic stem (hES) cell
lines Institution (Country) U.S.A. BresaGen, Inc., Athens, Georgia
(USA) BG01, BG02, BG03; BG04; BG01v Invitrogen (USA) BG01v/hOG
CyThera, Inc., San Diego, California (USA) CyT49, CyT203, CyT25
Geron Corporation, Menlo Park, California (USA) GE01, GE07, GE09,
GE13, GE14, GE91, GE92 (H1, H7, H9, H13, H14, H9.1, H9.2)
University of California, San Francisco, California UC01, UC06
(HSF-1, HSF-6); UCSFB1, (USA) UCSFB2, UCSFB3, UCSFB4, UCSFB5,
UCSFB6, UCSFB7, UCSFB8, UCSFB9 & UCSFB10 Wisconsin Alumni
Research Foundation, Madison, WA01, WA07, WA09, WA13, WA14 (H1, H7,
Wisconsin (USA) H9, H13, H14) Children's Hospital Corporation (USA)
CHB-1, CHB-2 CHB-3 CHB-4, CHB-5, CHB- 6, CHB-8, CHB-9, CHB-10,
CHB-11 & CHB- 12 The Rockefeller University (USA) RUES1, RUES2
& RUES3 Harvard University (USA) HUES1, HUES2, HUES3, HUES4,
HUES5, HUES6, HUES7, HUES8, HUES9, HUES10, HUES11, HUES12, HUES13,
HUES14, HUES15, HUES16, HUES17, HUES18, HUES19, HUES20, HUES21,
HUES22, HUES23, HUES24, HUES25, HUES26, HUES27; HUES28; HUES48;
HUES49; HUES53; HUES55 & HUES56 Mt Sinai Hospital-Samuel
Lunenfeld Research CA1 & CA2 Institute (USA) Children's
Memorial Hospital (USA) CM-1, CM-2, CM-5, CM-6, CM-7, CM-8, CM- 11,
CM-12, CM-13, CM-14, CM-16 The University of Texas Health Science
Center at CR1 & CR2 Houston (USA) California Stem Cell, Inc.
(USA) CSC14 University of Connecticut School of CSC14, CT1, CT2,
CT3, & CT4 Medicine/Dentistry (USA) The Third Affiliated
Hospital of Guangzhou Medical FY-3PN; FY-hES-1; FY-hES-3; FY-hES-5;
College (USA) FY-hES-7 & FY-hES-8 Advanced Cell Technology,
Inc. (USA) MA 01; MA 09; MA 42; MA 50; MA135; NED 1; NED 2; NED 3
& NED 4 Stanford University (USA) MFS5 New York University
School of Medicine (USA) NYUES1; NYUES2; NYUES3; NYUES4; NYUES5;
NYUES6 & NYUES7 Reprogenetics, LLC (USA) RNJ7 University of
California, Los Angeles (USA) UCLA1; UCLA2 & UCLA3 Eastern
Virginia Medical School (USA) ES-76; ES-78-1; ES-78-2 Reproductive
Genetics Institute (USA) RG-222; RG-230; RG-249; RG-308; RG-313;
RG-148; DYSTROPHIA MYOTONICA 1 (DM1), affected, 46, XY; RG-153;
DYSTROPHIA MYOTONICA 1 (DM1), affected, 46, XX; RG-170; MUSCULAR
DYSTROPHY, BECKER TYPE (BMD), affected, 46, XY; RG-186; HUNTINGTON
DISEASE (HD), affected, 46, XX; RG-194; HUNTINGTON DISEASE (HD),
affected, 46, XY; RG-233; HEMOGLOBIN B LOCUS (HBB), affected
(HbS/HbS - sickle cell anemia), 46, XX; RG-245; EMERY-DREIFUSS
MUSCULAR DYSTROPHY, X-LINKED (EDMD), carrier, 47, XXY; RG-246;
EMERY-DREIFUSS MUSCULAR DYSTROPHY, X-LINKED (EDMD), affected, 46,
XY; RG-271; TORSION DYSTONIA 1 (DYT1), AUTOSOMAL DOMINANT, affected
(N/GAG del), 46, XY; RG-283; MUSCULAR DYSTROPHY, DUCHENNE TYPE
(DMD), affected, 46, XY; RG-288; CYSTIC FIBROSIS (CF), affected
(deltaF508/deltaF508), 46, XY; RG-289; CYSTIC FIBROSIS (CF),
affected (deltaF508/deltaF508), 46, XX; RG-301; MUSCULAR DYSTROPHY,
DUCHENNE TYPE(DMD) affected, 46, XY; RG-302; MUSCULAR DYSTROPHY,
DUCHENNE TYPE (DMD), carrier, 46, XX; RG-315; NEUROFIBROMATOSIS,
TYPE I (NF1), affected (R19 47X/N), 46, XY; RG-316; TUBEROUS
SCLEROSIS, TYPE 1(TSC1), affected (N/IVS7 + 1 G-A); RG-316;
TUBEROUS SCLEROSIS, TYPE 1(TSC1), affected (N/IVS7 + 1 G-A);
RG-320; TUBEROUS SCLEROSIS, TYPE 1(TSC1), affected (N/IVS7 + 1
G-A); RG-326; POPLITEAL PTERYGIUM SYNDROME (PPS), affected
(R84H/N), 46, XY; RG-328; FACIOSCAPULOHUMERAL MUSCULAR DYSTROPHY
1A(FSHD), affected, 46, XY; RG-330; FACIOSCAPULOHUMERAL MUSCULAR
DYSTROPHY 1A (FSHD), affected, 46, XY; RG-333; FACIOSCAPULOHUMERAL
MUSCULAR DYSTROPHY 1A (FSHD), affected, 46, XX; RG-356; HEMOGLOBIN
ALPHA LOCUS (HBA), affected (-alpha /--), 46, XX; RG-357;
EMERY-DREIFUSS MUSCULAR DYSTROPHY, X-LINKED (EDMD), affected, 46,
XY; RG-358; EMERY-DREIFUSS MUSCULAR DYSTROPHY, X-LINKED (EDMD),
affected, 46, XY; RG-399; FACIOSCAPULOHUMERAL MUSCULAR DYSTROPHY 1A
(FSHD), affected, 46, XX; RG-401; FACIOSCAPULOHUMERAL MUSCULAR
DYSTROPHY 1A (FSHD), affected, 46, XX; RG-402; FACIOSCAPULOHUMERAL
MUSCULAR DYSTROPHY 1A (FSHD), affected, 46, XX; RG-403;
FACIOSCAPULOHUMERAL MUSCULAR DYSTROPHY 1A (FSHD), affected; RG-404;
SPINAL MUSCULAR ATROPHY, TYPE I (SMA1), affected, 46, XY; RG-406;
TORSION DYSTONIA 1, AUTOSOMAL DOMINANT (DYT1), affected (N/GAG
del); RG-413; BREAST CANCER, FAMILIAL (BRCA2), affected (N/IVS7 GT
del) & MULTIPLE ENDOCRINE NEOPLASIA, TYPE I (MEN1), affected
(N/3036 4bp del); RG-414; MULTIPLE ENDOCRINE NEOPLASIA, TYPE I
(MEN1), affected (N/3036 4bp del); RG-415; HUNTINGTON DISEASE (HD),
affected; RG-416; CYSTIC FIBROSIS (CF), affected (deltaF508/1717-1
G-A); RG-417; CYSTIC FIBROSIS (CF), affected (deltaF508/1717-1
G-A); RG-418; HEMOGLOBIN B LOCUS (HBB), affected (cd8 + G/619del);
RG-420; HEMOGLOBIN B LOCUS (HBB), affected (cd8 + G/619del);
RG-422; CYSTIC FIBROSIS (CF), affected (N1303K/deltaF508); RG-423;
CYSTIC FIBROSIS (CF), carrier (N/deltaF508); RG-424; MULTIPLE
ENDOCRINE NEOPLASIA, TYPE 2 (MEN2B), affected (M918T/N); RG-426;
PELIZAEUS-MERZBACHER DISEASE (PMLD), affected; RG-428; TUBEROUS
SCLEROSIS, TYPE 1 (TSC1), affected (N/IVS7 + 1 G-A); South American
Instituto de Biociencias, Sao Paulo (Brazil) BR-1 Middle East
Technion-Israel Institute of Technology, Haifa TE03, TE04 TE06 (I
3, I 4 I 6) (Israel) Hadassah University Hospital (Israel) HAD 1;
HAD 2; HAD 3; HAD 4; HAD 5; HAD 6 Hebrew University of Jerusalem
HEFX1 Technion - Israel Institute of Technology I3; I3.2; I3.3; 14;
16; 16.2; J3; J3.2 Royan Institute (Iran) ARMD.1.H.iPSC.2;
BOM.1.H.iPSC.1; CNS.1.H.iPSC.10; CNS.2.H.iPSC.7; FHC.1.H.iPSC.3;
GSD.1.H.iPSC.7; HER.1.H.iPSC.1; LCA.1.H.iPSC.1; LHON.1.H.iPSC.5;
R.1.H.iPSC.1; R.1.H.iPSC.4; R.1.H.iPSC.9; Royan H1; Royan H10;
Royan H2; Royan H3; Royan H4; Royan H5; Royan H6; Royan H7; Royan
H8; Royan H9; RP.1.H.iPSC.2; RP2.H.iPSC.3; TYR.1.H.iPSC.1;
USH.1.H.iPSC.6 Europe Cellartis AB, Gotenberg (Sweden) SA001, SA002
(Sahlgrenska 1, Sahlgrenska 2); SA002.2; SA003; AS034.1; AS034.1.1;
AS034.2; AS038; AS046; FC018; ASo85; AS094; SA111; SA121; SA142;
SA167; SA181; SA191; SA196; SA202; SA203; SA211; SA218; SA240;
SA279; SA348; SA352; SA399; SA461; SA502; SA506; SA521; SA540;
SA611 Karolinska Institutet (Sweden) HS181; HS207; HS235; HS237;
HS293; HS306; HS346; HS351; HS356; HS360; HS361; HS362; HS363;
HS364; HS366; HS368; HD380; HS382; HS400; HS401; HS402; HS415;
HS420; HS422; HS426; HS429; HS429A; HS429B; HS429C; HS429D; HS475;
HS480; HS481; HS539 Goteborg University, Goteborg (Sweden)
SA04-SA19 (Sahlgrenska 4-Sahlgrenska 19) Karolinska Institute,
Stockholm (Sweden) KA08, KA09, KA40, KA41, KA42, KA43 (hICM8,
hICM9, hICM40, hICM41, hICM42, hICM43) Geneva University
(Switzerland) CH-ES1 University of Basel (Switzerland) CH-ES3;
CH-ES3; CH-ES5 Roslin Cells Ltd (UK) RC2; RC3; RC4; RC5 University
of Newcastle upon Tyne (UK) NCL-1; NCL-2; NCL-3; NCL-4; NCL-5; NCL-
6; NCL-7; NCL-8; NCL-9 Roslin Institute (Edinburgh) & Geron
Corporation RH1; RH2; RH3; RH4; RH5; RH6; RH7; RH9; (UK) University
of Manchester (UK) Man 2 King's College London (UK) KCL-001
(formerly WT3) The University of Sheffield, Sheffield (UK) SHEF-1;
SHEF-2; SHEF-3; SHEF-4; SHEF-5; SHEF-6; SHEF-7; SHEF-8 Universities
of Edinburgh & Oxford; University of Edi-1; Edi-2; Edi-3; Edi-4
Cambridge (UK) Roslin Cells Ltd, Roslin Institute, Universities of
RCM-1; RC-1; RC-2; RC-3; RC-4; RC-5; RC-6; Edinburgh &
Manchester, Central Manchester & RC-7; RC-8; RC-9; RC-10
Manchester Children's University Hospitals NHS Trust (UK) King's
College London & Guy's Hospital Trust/ KCL-003-CF1 (formerly
CF1); KCL-005-HD1; Charitable Foundation of Guy's & St Thomas
(UK) KCL008-HD-2; KCL009-trans-1; KCL-001 (WT-3); KCL-001 (WT-4)
Stem Cell Sciences Ltd, Australia (SCS) & MEL-1; MEL-2; MEL-3;
MEL-4 Australian Stem Cell Centre (ASCC) University of Edinburgh
(UK) CB660 Axordia Ltd. (UK) Shef-1; Shef-2; Shef-3; Shef-4;
Shef-5; Shef-6; Shef-7 University of Nottingham (UK) Nott-1; Nott-2
Centre of Regenerative Medicine in Barcelona ES-2; ES-3; ES-4;
ES-5; ES-6; ES-7; ES-8; ES- (Spain) 9; ES-10; ES-11EM;
cFA404-KiPS4F-1; cFA404-KiPS4F-3; KiPS3F-7; KiPS4F-1; KiPS4F-8
Principe Felipe Centro de Investigacion (Spain) VAL-3; VAL-4;
VAL-5; VAL-6M; VAL-7; VAL-8; VAL-9; VAL-10B Universite Libre de
Bruxelles (Belgium) ERA-1; ERA2; ERA-3; ERAMUC-1; ERAMUC-1 Vrije
Universiteit Brussel (Belgium) VUB01; VUB02; VUB06; VUB07;
VUB03_DM1; VUB04_CF; VUB05_HD; VUB08_MFS; VUB09_FSHD; VUB10_SCA7;
VUB11_FXS; VUB13_FXS; VUB14; VUB19_DM1; VUB20_CMT1A; VUB22_CF;
VUB23_OI; VUB24_DM1; VUB26; VUB27; VUB28_HD_MFS Central Manchester
and Manchester Children's Man 1; Man 2 University Hospitals NHS
(UK) Universite Paris-Sud 11 (France) CL01; CL02; CL03; PB04; PB05;
PB05-1; PB06; PB06-1; PB07; PB08; PB09; PB10 INSERM (France) OSCAR;
STR-I-155-HD; STR-I-171-GLA; STR-I-189-FRAXA; STR-I-203-CFTR;
STR-I- 209-MEN2a; STR-I-211-MEN2a; STR-I-221- Sca2; STR-I-229-MTMX;
STR-I-231-MTMX; STR-I-233-FRAXA; STR-I-251-CFTR; STR-I- 301-MFS;
STR-I-305-APC; STR-I-315-CMT1a; STR-I-347-FRAXA; STR-I-355-APC;
STR-I- 359-APC Masaryk University (Czech Republic) CCTL 6; CCTL 8;
CCTL 9; CCTL 10; CCTL 12; CCTL 13; CCRL 14 Aalborg University
(Denmark) CLS1; CLS2; CLS3; CLS4 University of Copenhagen (Denmark)
LRB001; LRB002; LRB003; LRB004; LRB005; LRB006; LRB007; LRB008;
LRB009; LRB010; LRB011; LRB013; LRB014; LRB016; LRB017; LRB018;
University of Southern Denmark KMEB1; KMEB2; KMEB3; KMEB4; KMEB
University of Helsinki (Finland) FES21; FES22; FES29; FES30; FES61;
FES75 University of Tampere (Finland) Regea 06/015; Regea 06/040;
Regea 07/027; Regea 07/046; Regea 08/013; Regea 08/017; Regea
08/023; Regea 08/056 Leiden University Medical Center (Netherlands)
HESC-NL1; HESC-NL2; HESC-NL3; HESC- NL4 Russian Academy of Sciences
(Russia) ESM01; ESM02; ESM03; Instanbul Memorial Hospital (Turkey)
MINE: NS-2; NS-3; NS-4; NS-5; NS-6; NS-7; NS-8; NS-9; NS-10; OZ-1;
OZ-2; OZ-3; OZ-4; OZ-5; OZ-6; OZ-7; OZ-8 Australia Monash
University (Australia) Envy Prince of Wales Hospital, Sydney
(Australia) E1C1; E1C2; E1C3; E1C4; Endeavour 1; Endeavour 2;
hES3.1; hES3.2; hES3.3 Sydney IVF Limited (Australia) SIVF01;
SIVF03; SIVF05; SIVF06; SIVF07; SIVF08; SIVF09; SIVF10; SIVF11;
SIVF12; SIVF13 Asia Kyoto University (Japan) 201B1; 201B2; 201B3;
201B6; 201B7; 243H1; 243H7; 246G1; 246G3; 246G4; 246G5; 246G6;
khES-1; khES-2; khES-3; Singapore Stem Cell Consortium ESI-013;
ESI-014; ESI-017; ESI-027; ESI-035; ESI-049; ESI-051; ESI-053 ES
Cell International Pte Ld (Singapore) ES01, ES02, ES03, ES04, ES05,
ES06 (HES-1, HES-2, HES-3, HES-4, HES-5, HES-6 Maria Biotech Co.
Ltd. - Maria Infertility Hospital MB01, MB02, MB03; MB04; MB05;
MB06; Medical Institute, Seoul (Korea) MB07; MB08; MB09 MizMedi
Hospital - Seoul National University, MI01 (Miz-hES1); Miz-hES2;
Miz-hES3; Miz- Seoul (Korea) hES4; Miz-hES5; Miz-hES6; Miz-hES7;
Miz- hES8; Miz-hES9; Miz-hES10; Miz-hES11; Miz- hES12; Miz-hES13;
Miz-hES14; Miz-hES15; Pochon CHA University College of Medicine
CHA-hES3; CHA-hES4 (Korea) Seoul National University (Korea)
SNUhES1; SNUhES2; SNUhES3; SNUhES4; SNUhES11; SNUhES16 National
Centre for Biological Sciences/Tata NC01, NC02, NC03 (FCNCBS1,
FCNCBS2, Institute of Fundamental Research, Bangalore (India)
FCNCBS3); BJN-hem19; BJN-hem20 Reliance Life Sciences, Mumbai
(India) RL05, RL07, RL10, RL13, RL15, RL20, RL21 (RLS ES 05, RLS ES
07, RLS ES 10, National Institute for Research in Reproductive
KIND-1; KIND-2 Health (India) Tata Institute of Fundamental
Research (India) FCNCBS1; FCNCBS2; FCNCBS3 Kaohsiung Medical
University (Taiwan) T1; T2; T3; T4; T5 Central South University
(China) chESC-3 (H3); chESC-8; chESC-20; chESC-22; EBNA1 + H9
Graduate University of Chinese Academy of hPES-1; hPES-2 Sciences
(China) Huazhong University of Science and Technology hES-8; hES18
(China) Peking University Third Hospital (China) B4; B7; PKU1; PKU2
Shanghai Jiao Tong University School of Medicine SHhES1 (China)
Shanghei Second Medical University (China) SH1; SH2; SH4; SH7;
SH28; SH35; SH35a; SH38; SH39; SH42 Sun Yat-sen University (China)
CHES-1; SYSU-1; SYSU-2 Sun Yat-sen University Second Affiliated
Hospital CHE-1; CHE-2; CHE-3 (China) The Third Affiliated Hospital
of Guangzhou Medical FY-hES-5; FY-hES-9; FY-hES-10;; FY-hES-11
College (China)
Aggregate Suspension of Pluripotent Stem Cells
[0099] In contrast to previously known methods of tissue
engineering which are based on seeding individual cells into
polymer scaffolds, matrices and/or gels, embodiments described
herein can use cell aggregate suspensions formed from pluripotent
stem cell, single cell suspensions or differentiated single cell
suspensions derived therefrom.
[0100] Embodiments described herein relate to methods for
generating a pluripotent cell aggregate in suspension from a
pluripotent adherent culture, by culturing a pluripotent cell in an
adherent growth culture condition which allows for expansion in an
undifferentiated state; disassociating the adherent pluripotent
cell culture into a single cell suspension culture; contacting the
single cell suspension culture with a first differentiating culture
condition which allows for formation of hES-derived cell aggregates
in suspension by agitating the single cell suspension culture until
such a period of time when the single cell suspension culture forms
a pluripotent-derived cell aggregate in suspension, and thereby
generating a pluripotent-derived cell aggregate in suspension. In
preferred embodiments, agitation of the single cell suspension
culture is performed by rotation at about 80 rpm to 160 rpm. In
certain other embodiments described herein, a rho-kinase inhibitor
is used to facilitate pluripotent stem cell aggregation, growth,
proliferation, expansion and/or cell mass.
[0101] Methods of processing and/or manufacturing of stem cell
aggregate suspension and differentiation of cells thereof is
described in in at least Applicants U.S. Pat. Nos. 8,153,429;
8,211,699; 8,145,158; and 8,658,352.
[0102] Although the exact number of cells per aggregate is not
critical, it will be recognized by those skilled in the art that
the size of each aggregate (and thus the number of cells per
aggregate) is limited by the capacity of oxygen and nutrients to
diffuse to the central cells, and that this number may also vary
depending on cell type and the nutritive requirements of that cell
type. Cell aggregates may comprise a minimal number of cells (e.g.,
two or three cells) per aggregate, or may comprise many hundreds or
thousands of cells per aggregate. Typically, cell aggregates
comprise hundreds to thousands of cells per aggregate. For purposes
of the present invention, the cell aggregates are typically from
about 50 microns to about 600 microns in size, although, depending
on cell type, the size may be less or greater than this range. In
one embodiment, the cell aggregates are from about 50 microns to
about 250 microns in size, or about 75 to 200 microns in size, and
preferably they are about 100 to 150 microns in size.
[0103] Still other methods describe making embryoid bodies (EBs).
As used herein, the term "embryoid bodies", "aggregate bodies" or
equivalents thereof, refer to aggregates of differentiated and
undifferentiated cells that appear when ES cells overgrow in
monolayer cultures, or are maintained in suspension cultures in
undefined media or are differentiated via non-directed protocols
towards multiple germ layer tissues. That is, EBs are not formed
from a single cell suspension of pluripotent stem cells as
described herein; nor are EBs formed from adherent cultures of
pluripotent-derived multipotent cells. These features alone make
the present invention clearly distinguished from an embryoid
body.
[0104] In contrast to embryoid bodies, which are a mixture of
differentiated and undifferentiated cells and typically consist of
cells from several germ layers and go through random
differentiation, the cell aggregates described herein are
essentially or substantially homo-cellular, existing as aggregates
of pluripotent, multipotent, bipotent, or unipotent type cells,
e.g., embryonic cells, definitive endoderm, foregut endoderm, PDX1
positive pancreatic endoderm, pancreatic endocrine cells and the
like.
[0105] Embodiments described herein address the above problems by
providing a cost efficient manufacturing process or methods capable
of reproducibly producing cell aggregates that are substantially
uniform in size and shape using a process that can easily be
applied to large-scale manufacturing. In one particular embodiment,
the differentiable cells are expanded in a suspension culture,
using the cell media of the present invention. In another
particular embodiment, the differentiable cells can be maintained
and expanded in suspension, i.e., they remain undifferentiated or
are prevented from further differentiating. The term "expand" in
the context of cell culture is used as it is in the art, and refers
to cellular proliferation and increase the number of cells,
preferably increase in number of viable cells. In a specific
embodiment, the cells are expanded in a culture suspension by
culturing for more than about one day, i.e., about 24 hours. In a
more specific embodiment, the cells are expanded in a suspension
culture by culturing for at least 1, 2, 3, 4, 5, 6, 7 days, or at
least 2, 3, 4, 5, 6, 7, 8 weeks.
[0106] Still other embodiments of the invention provide for methods
of producing cell aggregate suspensions formed from differentiated
pluripotent stem cell cultures e.g., cells produced from the
pluripotent cells described herein, and including cells from stages
1, 2, 3, 4, and 5 as described in d'Amour 2005 and 2006, supra.
Hence, methods for making the cell aggregates described herein are
not limited to any one pluripotent or multipotent cell or cell
stage, rather the manner of use and need for cell type optimization
will dictate which methods are preferred.
[0107] The methods described herein for producing aggregate
suspension cultures of pluripotent cells, e.g., hES or iPS cells,
and cells derived from other pluripotent cell sources, for example,
embryonic germ or parthenote cells, are substantially as described
in PCT/US2007/062755, filed Feb. 23, 2007, and titled Compositions
and methods for culturing differential cells and PCT/US2008/080516,
filed Oct. 20, 2008, and titled Methods and compositions for
feeder-free pluripotent stem cell media containing human serum,
which are herein incorporated by reference in their entireties.
[0108] The methods described herein in no way require first coating
the culturing vessels with an extracellular matrix, e.g., as
described in U.S. Pat. No. 6,800,480 to Bodnar et al. and assigned
to Geron Corporation. In some embodiments described herein, iPS
cells can be cultured in the same way that other pluripotent stem
cells, e.g., hES and iPS cells, are cultured using soluble human
serum as substantially described in U.S. application,
PCT/US2008/080516, filed Oct. 20, 2008, and titled Methods and
compositions for feeder-free pluripotent stem cell media containing
human serum, which is herein incorporated by reference in its
entirety.
[0109] The methods described herein in no way require exogenously
added fibroblast growth factor (FGF) supplied from a source other
than just a fibroblast feeder layer as described in U.S. Pat. No.
7,005,252 to Thomson, J. and assigned to the Wisconsin Alumni
Research Foundation (WARF), which is herein incorporated by
reference in its entirety.
Multipotent and Differentiated Cell Compositions
[0110] Cell compositions produced by the methods described herein
include cell cultures comprising pluripotent stem cells,
preprimitive streak, mesendoderm, definitive endoderm, foregut
endoderm, PDX1-positive foregut endoderm, PDX1-positive pancreatic
endoderm or PDX1/NKX6.1 co-positive pancreatic endoderm, endocrine
precursor or NGN3/NKX2.2 co-positive endocrine precursor, and
hormone secreting endocrine cells or INS, GCG, GHRL, SST, PP
singly-positive endocrine cells, wherein at least about 5-90% of
the cells in culture are the preprimitive streak, mesendoderm,
definitive endoderm, foregut endoderm, PDX1-positive foregut
endoderm, PDX1-positive pancreatic endoderm or PDX1/NKX6.1
co-positive pancreatic endoderm, endocrine precursor or NGN3/NKX2.2
co-positive endocrine precursor, and hormone secreting endocrine
cells or INS, GCG, GHRL, SST, PP singly-positive endocrine cells
produced.
[0111] Some embodiments described herein relate to compositions,
such as cell populations and cell cultures that comprise both
pluripotent cells, such as stem cells and iPS cells, and
multipotent cells, such as preprimitive streak, mesendoderm or
definitive endoderm, as well as more differentiated, but still
potentially multipotent, cells, such as PDX1-positive foregut
endoderm, PDX1-positive pancreatic endoderm or PDX1/NKX6.1
co-positive pancreatic endoderm, endocrine precursor or NGN3/NKX2.2
co-positive endocrine precursor, and hormone secreting endocrine
cells or INS, GCG, GHRL, SST, PP singly-positive endocrine cells.
For example, using the methods described herein, compositions
comprising mixtures of pluripotent stem cells and other multipotent
or differentiated cells can be produced. In some embodiments,
compositions comprising at least about 5 multipotent or
differentiated cells for about every 95 pluripotent cells are
produced. In other embodiments, compositions comprising at least
about 95 multipotent or differentiated cells for about every 5
pluripotent cells are produced. Additionally, compositions
comprising other ratios of multipotent or differentiated cells to
pluripotent cells are contemplated. For example, compositions
comprising at least about 1 multipotent or differentiated cell for
about every 1,000,000 pluripotent cells, at least about 1
multipotent or differentiated cell for about every 100,000
pluripotent cells, at least about 1 multipotent or differentiated
cell for about every 10,000 pluripotent cells, at least about 1
multipotent or differentiated cell for about every 1000 pluripotent
cells, at least about 1 multipotent or differentiated cell for
about every 500 pluripotent cells, at least about 1 multipotent or
differentiated cell for about every 100 pluripotent cells, at least
about 1 multipotent or differentiated cell for about every 10
pluripotent cells, at least about 1 multipotent or differentiated
cell for about every 5 pluripotent cells, and up to about every 1
pluripotent cell and at least about 1,000,000 multipotent or
differentiated cell for about every 1 pluripotent cell are
contemplated.
[0112] Some embodiments described herein relate to cell cultures or
cell populations comprising from at least about 5% multipotent or
differentiated cell to at least about 99% multipotent or
differentiated cells. In some embodiments the cell cultures or cell
populations comprise mammalian cells. In preferred embodiments, the
cell cultures or cell populations comprise human cells. For
example, certain specific embodiments relate to cell cultures
comprising human cells, wherein from at least about 5% to at least
about 99% of the human cells are multipotent or differentiated
cell. Other embodiments relate to cell cultures comprising human
cells, wherein at least about 5%, at least about 10%, at least
about 15%, at least about 20%, at least about 25%, at least about
30%, at least about 35%, at least about 40%, at least about 45%, at
least about 50%, at least about 55%, at least about 60%, at least
about 65%, at least about 70%, at least about 75%, at least about
80%, at least about 85%, at least about 90%, at least about 95%, at
least about 98%, at least about 99%, or greater than 99% of the
human cells are multipotent or differentiated cells. In embodiments
where the cell cultures or cell populations comprise human feeder
cells, the above percentages are calculated without respect to the
human feeder cells in the cell cultures.
Monitoring the Production of Multipotent or Differentiated
Cells
[0113] The progression of pluripotent cells to multipotent cells to
further multipotent cells or differentiated cells, such as
pancreatic progenitors or hormone endocrine secreting cells, can be
monitored by determining the expression of markers characteristic
of the specific cells, including genetic markers and phenotypic
markers such as, the expression of islet hormones and the
processing of proinsulin into insulin and C peptide in endocrine
cells. In some processes, the expression of certain markers is
determined by detecting the presence or absence of the marker.
Alternatively, the expression of certain markers can be determined
by measuring the level at which the marker is present in the cells
of the cell culture or cell population. For example, in certain
processes, the expression of markers characteristic of immature
pancreatic islet hormone-expressing cells as well as the lack of
significant expression of markers characteristic of pluripotent
cells, definitive endoderm, foregut endoderm, PDX1-positive foregut
endoderm, endocrine precursor, extraembryonic endoderm, mesoderm,
ectoderm, mature pancreatic islet hormone-expressing cells and/or
other cell types is determined.
[0114] As described in connection with monitoring the production of
other less differentiated cell types of the definitive endoderm
lineage, qualitative or semi-quantitative techniques, such as blot
transfer methods and immunocytochemistry, can be used to measure
marker expression. Alternatively, marker expression can be
accurately quantitated through the use of technique such as Q-PCR.
Additionally, it will be appreciated that at the polypeptide level,
many of the markers of pancreatic islet hormone-expressing cells
are secreted proteins. As such, techniques for measuring
extracellular marker content, such as ELISA, may be utilized.
[0115] For example, in one embodiment, PDX1 is a marker gene that
is associated with PDX1-positive foregut endoderm. As such, in some
embodiments of the present invention, the expression of PDX1 is
determined. In other embodiments, the expression of other markers,
which are expressed in PDX1-positive foregut endoderm, including,
but not limited to, SOX17, HNF6, SOX9 and PROX1 is also determined.
Since PDX1 can also be expressed by certain other cell types (that
is, visceral endoderm and certain neural ectoderm), some
embodiments of the present invention relate to demonstrating the
absence or substantial absence of marker gene expression that is
associated with visceral endoderm and/or neural ectoderm. For
example, in some embodiments, the expression of markers, which are
expressed in visceral endoderm and/or neural cells, including, but
not limited to, SOX7, AFP, SOX1, ZIC1 and/or NFM is determined.
[0116] In some embodiments, PDX1-positive foregut endoderm cell
cultures produced by the methods described herein are substantially
free of cells expressing the SOX7, AFP, SOX1, ZIC1 or NFM marker
genes. In certain embodiments, the PDX1-positive foregut endoderm
cell cultures produced by the processes described herein are
substantially free of visceral endoderm, parietal endoderm and/or
neural cells.
[0117] The developmental progression of the pluripotent cells
described herein (e.g., cells produced as a result of Stages or
Steps 1-5 as described in D'Amour et al. 2006, supra) can be
monitored by determining the expression of markers characteristic
of each hES-derived or iPS-derived cell type along the
developmental pathway. In some processes, the identification and
characterization of a hES-derived or iPS-derived cell type is by
expression of a certain marker or different expression levels and
patterns of more than one marker. That is, the presence or absence,
the high or low expression, of one or more the marker(s) typifies
and identifies a cell-type. Also, certain markers can have
transient expression, whereby the marker is highly expressed during
one stage of development and poorly expressed in another stage of
development. The expression of certain markers can be determined by
measuring the level at which the marker is present in the cells of
the cell culture or cell population as compared to a standardized
or normalized control marker. In such processes, the measurement of
marker expression can be qualitative or quantitative. One method of
quantitating the expression of markers that are produced by marker
genes is through the use of quantitative PCR (Q-PCR). Methods of
performing Q-PCR are well known in the art.
[0118] In some embodiments of the present invention, the presence,
absence and/or level of expression of a marker is determined by
quantitative PCR (Q-PCR). For example, the amount of transcript
produced by certain genetic markers, such as SOX17, CXCR4, OCT4,
AFP, TM, SPARC, SOX7, CDX2, MIXL1, GATA4, HNF3.beta., HNF4alpha,
GSC, FGF17, VWF, CALCR, FOXQ1, CMKOR1, CRIP1 and other markers
described herein is determined by quantitative Q-PCR.
[0119] In other embodiments, immunohistochemistry is used to detect
the proteins expressed by the above-mentioned genes. In still other
embodiments, Q-PCR can be used in conjunction with
immunohistochemical techniques or flow cytometry techniques to
effectively and accurately characterize and identify cell types and
determine both the amount and relative proportions of such markers
in a subject cell type. In one embodiment, Q-PCR can quantify
levels of RNA expression in a cell culture containing a mixed
population of cells. However, Q-PCR cannot provide or qualify
whether the subject markers or proteins are co-expressed on the
same cell. In another embodiment, Q-PCR is used in conjunction with
flow cytometry methods to characterize and identify cell types.
Thus, by using a combination of the methods described herein, and
such as those described above, complete characterization and
identification of various cell types, including endoderm lineage
type cells, can be accomplished and demonstrated.
[0120] For example, in one preferred embodiment, pancreatic
progenitors or pancreatic endoderm or PDX-1 positive pancreatic
endoderm, expresses at least PDX1, Nkx6.1, PTF1A, CPA and/or cMYC
as demonstrated by Q-PCR and/or ICC, but such a cell at least
co-expresses PDX1 and Nkx6.1 as demonstrated by ICC and does not
express other markers including SOX17 CXCR4, or CER, to be
identified as a PDX1-positive expressing cell. Similarly, for
proper identification of a mature hormone secreting pancreatic
cell, in vitro or in vivo, for example, there is demonstrated that
C-peptide (a product of proper processing of pro-insulin in a
mature and functioning .beta. cell) and insulin are co-expressed by
ICC in the insulin secreting cell.
[0121] Still, other methods which are known in the art can also be
used to quantitate marker gene expression. For example, the
expression of a marker gene product can be detected by using
antibodies specific for the marker gene product of interest (e.g.,
e.g. Western blot, flow cytometry analysis, and the like). In
certain processes, the expression of marker genes characteristic of
hES-derived cells as well as the lack of significant expression of
marker genes characteristic of hES-derived cells. Still further
methods for characterizing and identifying hES-derived cells types
are described in related applications as indicated above, which are
herein incorporated by reference in their entirety.
[0122] Amplification probe/primer combinations suitable for use in
amplification assays include the following: Insulin (INS) (GenBank
NM_000207): primers AAGAGGCCATCAAGCAGATCA (SEQ ID NO: 1);
CAGGAGGCGCATCCACA (SEQ ID NO: 2); Nkx6.1 (NM_006168): primers
CTGGCCTGTACCCCTCATCA (SEQ ID NO: 3); CTTCCCGTCTTTGTCCAACAA (SEQ ID
NO: 4); Pdx1 (NM_000209): primers AAGTCTACCAAAGCTCACGCG (SEQ ID NO:
5); GTAGGCGCCGCCTGC (SEQ ID NO: 6); Ngn3 (NM_020999): primers
GCTCATCGCTCTCTATTCTTTTGC (SEQ ID NO: 7); GGTTGAGGCGTCATCCTTTCT (SEQ
ID NO: 8); FOXA2 (HNF3B) (NM_021784): primers GGGAGCGGTGAAGATGGA
(SEQ ID NO: 9); TCATGTTGCTCACGGAGGAGTA (SEQ ID NO: 10); Glucagon
(GCG) (NM_002054): primers AAGCATTTACTTTGTGGCTGGATT (SEQ ID NO:
11); TGATCTGGATTTCTCCTCTGTGTCT (SEQ ID NO: 12); HNF6 (NM_030712):
primers CGCTCCGCTTAGCAGCAT (SEQ ID NO: 13); GTGTTGCCTCTATCCTTCCCAT
(SEQ ID NO: 14); HNF4Alpha (NM_000457): primers
GAAGAAGGAAGCCGTCCAGA (SEQ ID NO: 15); GACCTTCGAGTGCTGATCCG (SEQ ID
NO: 16); Sox17 (NM_022454): primers GGCGCAGCAGAATCCAGA (SEQ ID NO:
17); NNNNNNNNNNNNNNN NNNNN (SEQ ID NO: 18); HLxB9 (NM_005515):
primers CACCGCGGGCATGATC (SEQ ID NO: 19); ACTTCCCCAGGAGGTTCGA (SEQ
ID NO: 20); Nkx2.2 (NM_002509): primers GGCCTTCAGTACTCCCTGCA (SEQ
ID NO: 21); GGGACTTGGAGCTTGAGTCCT (SEQ ID NO: 22); PTF1a
(NM_178161): primers GAAGGTCATCATCTGCCATCG (SEQ ID NO: 23)
GGCCATAATCAGGGTCGCT (SEQ ID NO: 24); SST (NM_001048): primers
CCCCAGACTCCGTCAGTTTC (SEQ ID NO: 25); TCCGTCTGGTTGGGTTCAG (SEQ ID
NO: 26); PAX6 (NM_000280): primers CCAGAAAGGATGCCTCATAAAGG (SEQ ID
NO: 27); TCTGCGCGCCCCTAGTTA (SEQ ID NO: 28); Oct4 primers:
TGGGCTCGAGAAGGATGTG (SEQ ID NO: 29) GCATAGTCGCTGCTTGATCG (SEQ ID
NO: 30); MIXL1 primers CCGAGTCCAGGATCCAGGTA (SEQ ID NO: 31)
CTCTGACGCCGAGACTTGG (SEQ ID NO: 32); GATA4 primers
CCTCTTGCAATGCGGAAAG (SEQ ID NO: 33) CGGGAGGAAGGCTCTCACT (SEQ ID NO:
34); GSC primers GAGGAGAAAGTGGAGGTCTGGTT (SEQ ID NO: 35)
CTCTGATGAGGACCGCTTCTG (SEQ ID NO: 36); CER primers
ACAGTGCCCTTCAGCCAGACT (SEQ ID NO: 37) ACAACTACTTTTTCACAGCCTTCGT
(SEQ ID NO: 38); AFP primers GAGAAACCCACTGGAGATGAACA (SEQ ID NO:
39) CTCATGGCAAAGTTCTTCCAGAA (SEQ ID NO: 40); SOX1 primers
ATGCACCGCTACGACATGG (SEQ ID NO: 41) CTCATGTAGCCCTGCGAGTTG (SEQ ID
NO: 42); ZIC1 primers CTGGCTGTGGCAAGGTCTTC (SEQ ID NO: 43)
CAGCCCTCAAACTCGCACTT (SEQ ID NO: 44); NFM primers
ATCGAGGAGCGCCACAAC (SEQ ID NO: 45) TGCTGGATGGTGTCCTGGT (SEQ ID NO:
46). Other primers are available through ABI Taqman including FGF17
(Hs00182599_m1), VWF (Hs00169795_m1), CMKOR1 (Hs00604567_m1), CRIP1
(Hs00832816_g1), FOXQ1 (Hs00536425_s1), CALCR (Hs00156229_m1) and
CHGA (Hs00154441_m1).
Summary of the Production of PDX1-Positive Pancreatic Endoderm
(Stages 1 to 4) and Insulin Production In Vivo
[0123] The methods for production of certain endoderm-lineage and
pancreatic endoderm-lineage cells are provided herein, and
discussed elsewhere in related applications such as U.S.
application Ser. No. 11/773,944, entitled METHODS OF PRODUCING
PANCREATIC HORMONES, filed Jul. 5, 2007, which is a
continuation-in-part of U.S. patent application Ser. No.
11/681,687, entitled ENDOCRINE PRECURSOR CELLS, PANCREATIC
HORMONE-EXPRESSING CELLS AND METHODS OF PRODUCTION, filed Mar. 2,
2007.
[0124] Briefly, the directed differentiation methods herein for
pluripotent stem cells, for example, hES and iPS cells, can be
described into at least four or five stages. Stage 1 is the
production of definitive endoderm from pluripotent stem cells and
takes about 2 to 5 days, preferably 2 or 3 days. Pluripotent stem
cells are suspended in media comprising RPMI, a TGF.beta.
superfamily member growth factor, such as Activin A, Activin B,
GDF-8 or GDF-11 (100 ng/mL), a Wnt family member or Wnt pathway
activator, such as Wnt3a (25 ng/mL), and alternatively a rho-kinase
or ROCK inhibitor, such as Y-27632 (10 .mu.M) to enhance growth,
survival and proliferation as well as promoting cell-cell adhesion.
After about 24 hours, the media is exchanged for media comprising
RPMI with serum, such as 0.2% FBS, and a TGF.beta. superfamily
member growth factor, such as Activin A, Activin B, GDF-8 or GDF-11
(100 ng/mL), and alternatively a rho-kinase or ROCK inhibitor for
another 24 (day 1) to 48 hours (day 2). Alternatively, after about
24 hours in a medium comprising Activin/Wnt3a, the cells are
cultured during the subsequent 24 hours in a medium comprising
Activin alone (i.e., the medium does not include Wnt3a).
Importantly, production of definitive endoderm requires cell
culture conditions low in serum content and thereby low in insulin
or insulin-like growth factor content. See McLean et al. (2007)
Stem Cells 25: 29-38, which is herein incorporated in its entirety.
McLean et al. also show that contacting hES cells with insulin in
concentrations as little as 0.2 .mu.g/mL at Stage 1 can be
detrimental to the production of definitive endoderm. Still others
skilled in the art have modified the Stage 1 differentiation of
pluripotent cells to definitive endoderm substantially as described
here and in D'Amour et al. (2005), for example, at least, Agarwal
et al., Efficient Differentiation of Functional Hepatocytes from
Human Embryonic Stem Cells, Stem Cells (2008) 26:1117-1127;
Borowiak et al., Small Molecules Efficiently Direct Endodermal
Differentiation of Mouse and Human Embryonic Stem Cells, (2009)
Cell Stem Cell 4:348-358; and Brunner et al., Distinct DNA
methylation patterns characterize differentiated human embryonic
stem cells and developing human fetal liver, (2009) Genome Res.
19:1044-1056. Proper differentiation, specification,
characterization and identification of definitive are necessary in
order to derive other endoderm-lineage cells. Definitive endoderm
cells at this stage co-express SOX17 and HNF3.beta. (FOXA2) and do
not appreciably express at least HNF4alpha, HNF6, PDX1, SOX6,
PROX1, PTF1A, CPA, cMYC, NKX6.1, NGN3, PAX3, ARX, NKX2.2, INS, GSC,
GHRL, SST, or PP.
[0125] Stage 2 takes the definitive endoderm cell culture from
Stage 1 and produces foregut endoderm or PDX1-negative foregut
endoderm by incubating the suspension cultures with RPMI with low
serum levels, such as 0.2% FBS, in a 1:1000 dilution of ITS, 25 ng
KGF (or FGF7), and alternatively a ROCK inhibitor for 24 hours (day
2 to day 3) to enhance growth, survival, proliferation and promote
cell-cell adhesion. After 24 hours (day 3 to day 4), the media is
exchanged for the same media minus a TGF.beta. inhibitor, but
alternatively still a ROCK inhibitor to enhance growth, survival
and proliferation of the cells, for another 24 (day 4 to day 5) to
48 hours (day 6). A critical step for proper specification of
foregut endoderm is removal of TGF.beta. family growth factors.
Hence, a TGF.beta. inhibitor can be added to Stage 2 cell cultures,
such as 2.5 .mu.M TGF.beta. inhibitor no. 4 or 5 .mu.M SB431542, a
specific inhibitor of activin receptor-like kinase (ALK), which is
a TGF.beta. type I receptor. Foregut endoderm or PDX1-negative
foregut endoderm cells produced from Stage 2 co-express SOX17,
HNF1.beta. and HNF4alpha and do not appreciably co-express at least
SOX17 and HNF3.beta. (FOXA2), nor HNF6, PDX1, SOX6, PROX1, PTF1A,
CPA, cMYC, NKX6.1, NGN3, PAX3, ARX, NKX2.2, INS, GSC, GHRL, SST, or
PP, which are hallmark of definitive endoderm, PDX1-positive
pancreatic endoderm or pancreatic progenitor cells or endocrine
precursors as well as singly or poly hormonal type cells.
[0126] Stage 3 (days 5-8) takes the foregut endoderm cell culture
from Stage 2 and produces a PDX1-positive foregut endoderm cell by
DMEM or RPMI in 1% B27, 0.25 .mu.M KAAD cyclopamine, a retinoid,
such as 0.2 .mu.M retinoic acid (RA) or a retinoic acid analog such
as 3 nM of TTNPB, and 50 ng/mL of Noggin for about 24 (day 7) to 48
hours (day 8). Specifically, Applicants have used DMEM-high glucose
since about 2003 and all patent and non-patent disclosures as of
that time employed DMEM-high glucose, even if not mentioned as
"DMEM-high glucose" and the like. This is, in part, because
manufacturers such as Gibco did not name their DMEM as such, e.g.
DMEM (Cat. No 11960) and Knockout DMEM (Cat. No 10829). It is
noteworthy, that as of the filing date of this application, Gibco
offers more DMEM products but still does not put "high glucose" in
certain of their DMEM products that contain high glucose e.g.
Knockout DMEM (Cat. No. 10829-018). Thus, it can be assumed that in
each instance DMEM is described, it is meant DMEM with high glucose
and this was apparent by others doing research and development in
this field. Again, a ROCK inhibitor or rho-kinase inhibitor such as
Y-27632 can be used to enhance growth, survival, proliferation and
promote cell-cell adhesion. PDX1-positive foregut cells produced
from Stage 3 co-express PDX1 and HNF6 as well as SOX9 and PROX, and
do not appreciably co-express markers indicative of definitive
endoderm or foregut endoderm (PDX1-negative foregut endoderm) cells
or PDX1-positive foregut endoderm cells as described above in
Stages 1 and 2.
[0127] Stage 4 (days 8-14) takes the media from Stage 3 and
exchanges it for media containing DMEM in 1% vol/vol B27
supplement, plus 50 ng/mL KGF and 50 ng/mL of EGF and sometimes
also 50 ng/mL Noggin. Again, a ROCK inhibitor such as Y-27632 can
be used to enhance growth, survival, proliferation and promote
cell-cell adhesion. PDX1-positive pancreatic endoderm cells
produced from Stage 4 co-express at least PDX1 and Nkx6.1 as well
as PTF1A, and do not appreciably express markers indicative of
definitive endoderm or foregut endoderm (PDX1-negative foregut
endoderm) cells as described above in Stages 1, 2 and 3.
[0128] Alternatively, the cells from Stage 4 can be further
differentiated in Stage 5 to produce endocrine precursor or
progenitor type cells and/or singly and poly-hormonal pancreatic
endocrine type cells from Stage 4 cells in a medium containing DMEM
in 1% vol/vol B27 supplement for about 1 to 6 days (days 15-20).
Endocrine precursors produced from Stage 5 co-express at least NGN3
and PAX4 as well as Nkx2.2, and do not appreciably express markers
indicative of definitive endoderm or foregut endoderm
(PDX1-negative foregut endoderm) or PDX1-positive pancreatic
endoderm or progenitor cells as described above in Stages 1, 2, 3
and 4.
[0129] PDX1-positive pancreatic endoderm produced from Stage 4 are
loaded and wholly contained in a macro-encapsulation device and
transplanted in a patient, and the PDX1-positive pancreatic
endoderm cells mature into pancreatic hormone secreting cells,
e.g., insulin secreting cells, in vivo. Encapsulation of the
PDX1-positive pancreatic endoderm cells and production of insulin
in vivo is described in detail in U.S. application Ser. No.
12/618,659 (the '659 application"), entitled ENCAPSULATION OF
PANCREATIC LINEAGE CELLS DERIVED FROM HUMAN PLURIPOTENT STEM CELLS,
filed Nov. 13, 2009. The '659 application claims the benefit of
priority to Provisional Patent Application No. 61/114,857, entitled
ENCAPSULATION OF PANCREATIC PROGENITORS DERIVED FROM HES CELLS,
filed Nov. 14, 2008; and U.S. Provisional Patent Application No.
61/121,084, entitled ENCAPSULATION OF PANCREATIC ENDODERM CELLS,
filed Dec. 9, 2008.
[0130] In still another embodiment, methods for producing further
differentiated pancreatic-lineage cells, preferably, endocrine
precursors of stage 5, 6 and immature beta cells of stage 7 are
described herein in Table 5 and described in more detail in
Applicants U.S. application No., ENCAPSULATION OF PANCREATIC CELLS
DERIVED FROM HUMAN PLURIPOTENT STEM CELLS, filed Dec. 13, 2013. To
make endocrine precursor and immature beta cells as described
herein, stages 1-2 cells are substantially made as described in
Applicant's standard stage 1-4 protocol (Protocol No. 1 of Table
5), but during stage 3 and 4, a combination of activin, heregulin
and wnt (A, H, W) are added which suppresses NGN3 (endocrine)
expression while at the same time maintaining good cell growth and
differentiation. Proper suppression of NGN3 during stages 3 and 4,
permits for its proper induction later in stage 5 with a
gamma-secretase inhibitor (RO1), and then further differentiation
during stages 6 and 7 to immature beta cells using at least
nicotinamide (NC10), matrigel (MG0.05), Rho-kinase inhibitor and
retinoic acid (Y10). See Protocol No. 3 in Table 5.
Method of Producing Insulin In Vivo
[0131] In some embodiments, in vitro-derived pancreatic progenitor
cells or PDX-1-positive pancreatic endoderm type cells or
equivalents thereof described-above are transplanted into a
mammalian subject. These methods are described in detail in
Applicants U.S. Pat. Nos. 7,534,608; 7,695,965; and 7,993,920,
titled METHODS OF PRODUCING PANCREATIC HORMONES. In a preferred
embodiment, the mammalian subject is a human subject. Particularly
preferred subjects are those that have been identified as having a
condition which limits the ability of the subject to produce
sufficient levels of insulin in response to physiologically high
blood glucose concentrations. A range of blood glucose levels that
constitutes a physiologically high blood glucose level for any
particular mammalian species can be readily determined by those of
ordinary skill in the art. Any persistent blood glucose level that
results in a recognized disease or condition is considered to be a
physiologically high blood glucose level.
[0132] Additional embodiments of the present invention relate to an
in vivo insulin secreting cell that is derived from an in vitro
pluripotent stem cell or progeny thereof, e.g., multipotent cells,
such as PDX-1 positive foregut endoderm cell, a PDX-1 positive
pancreatic endoderm or pancreatic progenitor cell, an endocrine
precursor, such as an NGN3 positive endocrine precursor, or a
functional differentiated hormone secreting cell, such as an
insulin, glucagon, somatistatin, ghrelin, or pancreatic polypeptide
secreting cell. Any of the above-described terminally
differentiated or multipotent cells can be transplanted into the
host, or mammal, and mature into physiologically functional hormone
secreting cells, such as insulin secreting cells, in response to
host blood glucose levels. In preferred embodiments the cell does
not form a teratoma in vivo, and if so formed, remains localized to
the area of transplant and can be easily excised or removed. In
especially preferred embodiments, the cell does not contain any
karyotypic abnormality during the in vitro differentiation process,
or when transplanted into the mammal in vivo, or when maturing and
developing into functional islets in vivo.
[0133] Further, although embodiments described herein relate to an
engineered or genetically recombinant pluripotent cell, multipotent
or differentiated cell derived from the pluripotent cell, such as a
human iPS cell, based on the description provided herein, it is
anticipated that because iPS cells demonstrate similar physiology
and gene marker expression profiles to that of hES cells and
hES-derived cells, they will have similar physiological
characteristics in vivo.
Method of Encapsulating Pancreatic Progenitors
[0134] In some embodiments, the pluripotent, multipotent and
differentiated cell composition described herein can be
encapsulated in a biological and/or non-biological mechanical
device, where the encapsulated device separates and/or isolates the
cell compositions from the host.
[0135] Methods of encapsulation are described in detail in U.S.
Pat. No. 8,278,106, titled ENCAPSULATION OF PANCREATIC CELLS
DERIVED FROM HUMAN PLURIPOTENT STEM CELLS; U.S. Application No.
61/121,086 filed Dec. 12, 2008, titled ENCAPSULATION OF PANCREATIC
ENDODERM CELLS, which describes encapsulation of pancreatic
endoderm cells using a semi-permeable membrane, e.g., a
Theracyte.TM. or Gore device; Applicant's U.S. Design applications
29/408366, 29/408368, 29/408370, 29/423,365, and 29/447,944, which
describe other device embodiments.
[0136] In one embodiment, the encapsulation device contains the
pluripotent derived cells, for example, PDX-1 positive foregut
endoderm cell, a PDX-1 positive pancreatic endoderm or progenitor
cell, an endocrine precursor, such as an NGN3 positive endocrine
precursor, or a functional differentiated hormone secreting cell,
such as an insulin, glucagon, somatistatin, ghrelin, or pancreatic
polypeptide secreting cell, in a semipermeable membrane that
prevents passage of the transplanted cell population, retaining
them in the device, while at the same time permitting passage of
certain secreted polypeptides, e.g., insulin, glucagon,
somatistatin, ghrelin, pancreatic polypeptide and the like.
Alternatively, the device has a plurality of membranes, including a
vascularizing membrane.
[0137] In one embodiment, the implantable, semipermeable device is
a TheraCyte device (Irvine, Calif.). TheraCyte cell encapsulation
devices are further described in U.S. Pat. Nos. 6,773,458;
6,156,305; 6,060,640; 5,964,804; 5,964,261; 5,882,354; 5,807,406;
5,800,529; 5,782,912; 5,741,330; 5,733,336; 5,713,888; 5,653,756;
5,593,440; 5,569,462; 5,549,675; 5,545,223; 5,453,278; 5,421,923;
5,344,454; 5,314,471; 5,324,518; 5,219,361; 5,100,392; and
5,011,494, which are all herein incorporated in their entireties by
reference in their entireties.
Storing Cells for Encapsulation and Transplantation
[0138] Some embodiments relate to methods for cyropreserving cells
which have been cultured and/or differentiated in vitro. Such
storage would allow banking, quality control, and other desired
procedures and manipulations, either in connection with in vitro
analysis or implantation in vivo. Methods for cell storage prior to
transplantation include preserving the tissue by freezing cells
(cryopreservation); or by refrigerating the cells at above freezing
temperatures (hibernation) or by storing cells at room temperature
(storage). See Chanaud et al. 1987 Neurosci Lett 82: 127-133;
Collier et al. (1987) 436: 363-366; and Sauer et al. 1991 Neurology
and Neuroscience 2: 123-135; Gage et al. 1985 Neurosci Lett 60:
133-137, the disclosures of which are herein incorporated by
reference in their entireties. Although hibernation has been
reported to increase rates of graft survival and function as
compared to cryopreserved tissue, cells may not be capable of long
term maintenance under such conditions without jeopardizing cell
viability during the hibernation period.
[0139] As used herein, a "cell suspension" or equivalents thereof
refers to cell aggregates and/or clusters and/or spheres that are
contacted with a medium. Such cell suspensions are described in
detail in U.S. application Ser. No. 12/264,760, entitled Stem cell
Aggregate Suspension Compositions and Methods of Differentiation
Thereof, filed on Nov. 8, 2008, the disclosure of which is herein
incorporated by reference in its entirety.
[0140] As used herein, "adapted cell suspension" or cell suspension
cultures or equivalents thereof includes a cell suspension that has
been stored above freezing, preferably at 4.degree. C., in
hibernation medium for about 1 hour and up to about 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25 or up to 30 days.
[0141] As used herein, a cell suitable for transplantation refers
to a cell or a population of cells sufficiently viable and/or
functional for in vivo treatment of a metabolic disorder. For
example, diabetes, or one or more symptoms thereof, can be
ameliorated or reduced for a period of time following implantation
of a cell suitable for transplantation into a subject suffering
from diabetes. In one preferred embodiment, a cell or cell
population suitable for transplantation is a pancreatic progenitor
cell or population, or a PDX1-positive pancreatic progenitor cell
or population, or an endocrine precursor cell or population, or a
poly or singly-hormonal endocrine cell and/or any combination of
cell or populations of cells, or even purified or enriched cells or
populations of cells thereof. Cells suitable for the embodiments
described herein are further described in detail in U.S. Pat. No.
7,534,608 the disclosure of which is herein incorporated by
reference in its entirety.
[0142] As used herein the term "storing" or equivalents thereof
refers to holding or maintaining cells either above or below
freezing. The term is also meant to include maintaining cells prior
to use in transplantation in a subject.
[0143] As used herein the term "cryopreservation" or equivalents
thereof refers to preservation of cells at temperatures below
freezing.
[0144] As used herein the term "hibernation" or equivalents thereof
refers to preservation of cells at temperatures above freezing and
sufficiently below normal physiological temperature such that one
or more normal cellular physiological processes are decreased or
halted. In one embodiment, preferred hibernation temperatures range
between 0 and 4.degree. C., preferably about 4.degree. C.
Hibernation medium as used herein includes any medium which lacks a
cryopreservative and is physiologically compatible for storage of a
cell at above freezing temperatures, preferably about 4.degree. C.
Hibernation includes short term storage.
[0145] As used herein the term "room temperature storage" or
equivalents thereof refers to preservation of cells at normal
physiological temperature. In one embodiment, preferred storage
temperatures range between 4 and 37.degree. C., preferably about
37.degree. C. storage medium as used herein includes any medium
which lacks a cryopreservative and is physiologically compatible
for storage of a cell at normal physiological temperature,
preferably about 37.degree. C. Storage includes short term
storage.
[0146] As used herein the term "preservation solution" or
equivalents thereof refers to cryopreservation solutions,
hibernation solutions or room temperature storage solutions. These
preservation solutions are known in the art and specific examples
are described throughout this specification. For example room
temperature preservation solutions are described in Example 6 and
include as a specific example DB media. Hibernation preservation
solutions are also described in Example 6 and include as a specific
example SPS-1 media.
Hibernation Conditions
[0147] Hibernation temperatures typically range from between 0 and
5.degree. C., preferably about 4.degree. C. Numerous types of media
can be used as hibernation media in conjunction with the instant
methods. Prior art methods for freezing and hibernating cells
utilize complex media comprising buffers and added protein,
sometimes including entirely undefined components, such as serum.
However, to minimize toxicity and immunogenicity such additives are
not desirable for transplantation into humans. In preferred
embodiments, hibernation media is free of added Ca.sup.++. In
certain embodiments, medium for hibernating cells is free of added
protein and/or free of a buffer. A preferred hibernation medium
includes or consists of minimal amounts of glucose or moderate
amounts of glucose in a saline solution, e.g., either no additional
glucose or between about 0.1%-0.9% glucose in saline. In preferred
embodiments, the hibernation medium includes or consists of about
0.1-0.5% glucose. In a more preferred embodiment, the medium
includes or consists of about 0.2% glucose. In preferred
embodiments, the hibernation medium includes or consists of a very
small percentage (vol/vol) of NaCl, e.g., about 0.1-1% NaCl,
preferably about 0.5-0.9% NaCl. In certain embodiments, more
complex media can be used, e.g., Hank's balanced salt solution,
Dulbecco's minimal essential medium, or Eagle's modified minimal
essential medium. In certain embodiments it may be desirable to
supplement the chosen hibernation medium with additives, for
example, added protein (e.g., mammalian serum protein or whole
serum (preferably heat inactivated)) buffers (e.g., phosphate
buffers, HEPES, or the like) antioxidants, growth factors, KCl
(e.g., at about 30 mM), lactate (e.g., at about 20 mM), pyruvate,
MgCl.sub.2 (e.g., at about 2-3 mM), sorbitol (e.g., at about 300
mM) or other additives as are well known in the art.
[0148] In certain embodiments, the cells are hibernated at about
0-5.degree. C., preferably about 4.degree. C. In certain
embodiments, cells are maintained at about 4.degree. C. in
hibernation medium prior to freezing or use. In other embodiments,
the cells are maintained at about 4.degree. C. in hibernation
medium post freezing. In still other embodiments, the cells are
maintained at about 4.degree. C. in hibernation medium without
freezing. In certain embodiments, the cells are maintained in
hibernation medium at about 4.degree. C. for at least about 1 hour
and up to about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or up to 30 days prior to
freezing, post freezing or prior to use in transplantation. In
other embodiments, the cells are maintained in hibernation medium
at about 4.degree. C. for at least about 12-72 hours prior to
freezing, post freezing or prior to use in transplantation. In
certain embodiments the cells are maintained at 4.degree. C. in
hibernation medium for at least about 24 hours prior to freezing,
post freezing or prior to use in transplantation. In a more
preferred embodiment, the cells are maintained in hibernation
medium from at least about 36-48 hours at about 4.degree. C. prior
to freezing, post freezing or prior to use.
Cyropreservation Conditions
[0149] In some embodiments cells are cryopreserved using a
cryopreservation solution. A cryopreservation solution or medium
includes a solution which contains a cryopreservative, i.e., a
compound which protects cells against intracellular and/or cell
membrane damage as the cells are frozen or thawed. A
cryopreservative is identified by enhanced viability and/or
functionality of cells in contact with the cryopreservative when
compared with cells which are similarly frozen or thawed in the
absence of the cryopreservative. Any cryopreservative can be used
in conjunction with the instant methods and the term is meant to
encompass both intracellular and extracellular
cryopreservatives.
[0150] Any cryopreservative known in the art can be used in a
cryopreservative solution. In certain embodiments, cryopreservation
solutions include intracellular cryopreservatives including but not
limited to dimethylsulfoxide (DMSO), various diols and triols
(e.g., ethylene glycol, propylene glycol, butanediol and triol and
glycerol), as well as various amides (e.g., formamide and
acetamide); and extracellular cryopreservatives including but not
limited to phosphomono and phosphodiester catabolites of
phosphoglycerides, polyvinylpyrrolidone, or methylcellulose (e.g.,
at least 0.1%) can also be used alone or in combination with any of
the intracellular cryopreservatives.
[0151] In preferred embodiments, DMSO is used as the
cryopreservative. DMSO can be used at a wide range of
concentrations, e.g., about 1%, about 2%, about 3%, about 4%, about
5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%,
about 12%, about 13%, about 14%, about 15% or more. In more
preferred embodiments the concentration of DMSO ranges from about
6% to about 12%. In particularly preferred embodiments the
concentration of DMSO is about 10%.
[0152] In certain embodiments, the cryopreservative is added to the
cells in a stepwise manner in order to gradually increase the
concentration of the cryopreservative until the desired final
concentration of cryopreservative is achieved. In certain
embodiments, the cells are contacted with a cryopreservation
solution containing the cryopreservative at the desired final
concentration or the cryopreservative is added directly to the base
medium without a gradual increase in concentration.
[0153] The cryopreservation solution includes the cryopreservative
in an appropriate base medium. Any type of media can be used for
this purpose. In preferred embodiments, the base medium to which
the cryopreservative is added is free of added Ca.sup.++. In
certain embodiments the medium to which the cryopreservative is
added is free of added protein and/or free of a buffer. In other
embodiments, the base medium (e.g. DMEM or DMEM/F12) to which the
cryopreservative is added includes or consists of about 0.1-0.5%
glucose or no or low glucose. In some aspects of this embodiment,
the base medium (e.g. DMEM or DMEM/F12) to which the
cryopreservative is added includes or consists of about 0.5-0.9%
NaCl. In preferred embodiments, the base medium to which the
cryopreservative is added includes or consists of very low to no
glucose and about 0.5-0.9% NaCl. In another preferred embodiment,
the base medium to which the cryopreservative is added includes or
consists of about 0.1 to 0.2% glucose. In some aspects of this
embodiment, the base medium to which the cryopreservative is added
includes or consists of about 0.5-0.9% NaCl.
[0154] In certain embodiments the cryopreservation solution can
also contain added protein, for example, serum, e.g., fetal calf
serum or human serum, or a serum protein, e.g., albumin or knockout
serum replacement. In other embodiments, the cryopreservative can
also contain other additives, such as those described above for
inclusion in hibernation media, for example, antioxidants, growth
factors, KCl (e.g., at about 30 mM), lactate (e.g., at about 20
mM), pyruvate, MgCl.sub.2 (e.g., at about 2-3 mM), sorbitol (e.g.,
to an osmolarity of about 300 mM) or other additives as are well
known in the art.
[0155] Once the cells are suspended in cryopreservation solution,
the temperature of the cells is reduced in a controlled manner. In
cooling the cells to below freezing, the reduction in temperature
preferably occurs slowly to allow the cells to establish an
equilibrium between the intracellular and extracellular
concentration of cryopreservative such that intracellular ice
crystal formation is inhibited. In some embodiments, the rate of
cooling is preferably fast enough to protect the cells from excess
water loss and the toxic effects of cryopreservatives. The cells
can then be cryopreserved at a temperature of between -20.degree.
C. and about -250.degree. C. Preferably, the cells are stored below
-90.degree. C. to minimize the risk of ice recrystallization. In
particularly preferred embodiments, the cells are cryopreserved in
liquid nitrogen at about -196.degree. C. Alternatively, controlled
freezing may be accomplished with the aid of commercially available
electronically controlled freezer equipment.
Thawing Conditions
[0156] After cryopreservation, the cells can be thawed through any
available method. In a preferred embodiment, the cells are thawed
rapidly, e.g., by quick immersion in liquid at 37.degree. C. Once
the cells are thawed, dilution of the cryopreservative is
accomplished by addition of a dilution medium.
[0157] Any media can be used for diluting the cryopreservation
solution which is in contact with the thawed cells. For example,
any of the media listed above for use in hibernating cells, or for
growth and differentiation of cells, can be used for diluting the
cryopreservation solution. Other media are also appropriate, for
example, Hank's balanced salt solution (preferably without Ca++),
DMEM containing media with no glucose or minimal to low amounts of
glucose. Additives, e.g., as listed above for inclusion in
hibernation or freezing media can also be used in media for
dilution. Exemplary additives include, for example, buffers (e.g.,
phosphate buffers, HEPES, or the like) antioxidants, growth
factors, KCl (e.g., at about 30 mM), lactate (e.g., at about 20
mM), pyruvate, MgCl.sub.2 (e.g., at about 2-3 mM), sorbitol (e.g.,
to an osmolarity of about 300 mM) or others additives as are well
known in the art. Another suitable additive includes DNase (e.g.,
commercially available from Genentech, Incorporated as
PULMOZYMEOR). The medium which is used for diluting the
cryopreservation solution can, optionally, contain added protein,
e.g., added protein (e.g., mammalian serum (preferably heat
inactivated) or a serum protein such as albumin. In other
embodiments, the medium contains no added protein and/or no added
buffer.
[0158] After dilution of the cryopreservative, the cells can then
be allowed to settle or a pellet of cells can be formed under
centrifugal force in order to remove as much of the
cryopreservation solution from the cells as possible. The cells can
then be washed in medium which does not contain a cryopreservative.
It may be preferable for the cells to remain at room temperature
after the addition of the wash media and prior to letting the cells
settle or form a pellet under centrifugal force. In preferred
embodiments, the cells remain at room temperature for about 10, 15,
20, 30 minutes prior to the second centrifugation. Any medium known
in the art can be used to wash the cells, for example, any of the
hibernation or dilution media set forth above can be used.
[0159] After thawing and washing, cells are cultured at 37.degree.
C. for varying lengths of time to allow recovery prior to
transplantation. Cells can be cultured in any culture medium,
preferably in medium appropriate to their stage of differentiation.
During this time some cell may death occur.
[0160] For use in transplantation, cells should be suspended in a
final medium which is suitable for administration to a subject.
Transplantation of cells is substantially similar to that described
in U.S. Pat. No. 7,534,608, which is herein incorporated by
reference in its entirety.
[0161] In addition, the thawed cells may be maintained in
hibernation medium as described above at between 0 and 37.degree.
C., preferably about 4.degree. C. for up to 1 hour and up to about
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25 or up to 30 days prior to use in
transplantation without a significant loss in viability. In some
embodiments, no statistically significant loss in cell viability
occurs.
Determining Viability of Recovered Cells
[0162] After storage, it may be desirable to assay the viability
and/or functionality of the cells prior to transplantation to
confirm their suitability for use, e.g., in transplantation. This
can be accomplished using a variety of methods known in the art.
For example, the cells can be stained using vital stains, such as,
e.g., trypan blue or ethidium bromide or acridine orange. In
certain embodiments, a population of cells suitable for
transplantation is at least between about 50-100% viable. In
preferred embodiments, a population of cells suitable for
transplantation is at least about 50%, is at least about 55%, is at
least about 60%, is at least about 65%, is at least about 70%, is
at least about 75%, is at least about 80%, is at least about 85%,
is at least about 90%, is at least about 95%, is at least about
96%, is at least about 97%, is at least about 98%, is at least
about 99%, viable. In particularly preferred embodiments, such a
population of cells is at least about 85% viable.
[0163] In other embodiments, the morphometric characteristics of
the cells can be determined as a measure of the suitability of
cells for use in transplantation. In preferred embodiments, the
morphology of cells which have been stored using the instant
methods and are suitable for transplantation does not differ (e.g.,
statistically significant) from that of fresh cells. In preferred
embodiments, the in vivo morphology of cells which have been stored
using the instant methods and are suitable for transplantation does
not differ (e.g., statistically significant) from that of fresh
cells.
[0164] In the case of cell clusters, cell mass can be quantitated
before and after cell freeze/thaw and recovery. In one embodiment,
cell clusters cultured in suspension can be manipulated to pack in
closely. The area occupied by the clusters can then be photographed
and measured. By comparing the areas occupied by cells before and
after freeze/thaw and recovery, a value for percent recovery can be
determined.
[0165] Cells which have been stored can also be assayed for the
presence of certain hES and/or pancreatic progenitor or hormone
secreting cell markers to determine if they are suitable for use in
transplantation. This method has been described in detail in the
above in Kroon et al. 2008, supra or in U.S. Pat. No. 7,534,608,
which are herein incorporated by reference in its entireties.
[0166] Additionally, or alternatively, the cells can be tested for
their functionality, e.g. as discussed in Kroon et al. 2008, supra
or in U.S. Pat. No. 7,534,608, which are herein incorporated by
reference in its entireties.
Encapsulation Devices
[0167] One embodiment described herein relates to encapsulation
devices. Such devices can be implanted into a mammal to treat a
variety of diseases and disorders. In preferred embodiments, the
device comprises a biocompatible, immuno-isolating device that is
capable of wholly encapsulating a therapeutically biologically
active agent and/or cells therein. For example, such devices can
house therapeutically effective quantities of cells within a
semi-permeable membrane having a pore size such that oxygen and
other molecules important to cell survival and function can move
through the semi-permeable membrane but the cells of the immune
system cannot permeate or traverse through the pores. Similarly,
such devices can contain therapeutically effective quantities of a
biologically active agent, e.g., an angiogenic factor, a growth
factor, a hormone and the like.
[0168] The devices described herein can be employed for treating
pathologies requiring a continuous supply of biologically active
substances to the organism. Such devices are, for example, can also
be referred to as, bioartificial organs, which contain homogenous
or heterogenous mixtures of biologically active agents and/or
cells, or cells producing one or more biologically active
substances of interest. Ideally, the biologically active agents
and/or cells are wholly encapsulated or enclosed in at least one
internal space or are encapsulation chambers, which are bounded by
at least one or more semi-permeable membranes. Such a
semi-permeable membrane should allow the encapsulated biologically
active substance of interest to pass (e.g., insulin, glucagon,
pancreatic polypeptide and the like), making the active substance
available to the target cells outside the device and in the
patient's body. In a preferred embodiment, the semi-permeable
membrane allows nutrients naturally present in the subject to pass
through the membrane to provide essential nutrients to the
encapsulated cells. At the same time, such a semi-permeable
membrane prohibits or prevents the patient's cells, more
particularly to the immune system cells, from passing through and
into the device and harming the encapsulated cells in the device.
For example, in the case of diabetes, this approach can allow
glucose and oxygen to stimulate insulin-producing cells to release
insulin as required by the body in real time while preventing
immune system cells from recognizing and destroying the implanted
cells. In a preferred embodiment, the semi-permeable membrane
prohibits the implanted cells from escaping encapsulation.
[0169] Preferred devices may have certain characteristics which are
desirable but are not limited to one or a combination of the
following: i) comprised of a biocompatible material that functions
under physiologic conditions, including pH and temperature;
examples include, but are not limited to, anisotropic materials,
polysulfone (PSF), nano-fiber mats, polyimide,
tetrafluoroethylene/polytetrafluoroethylene (PTFE; also known as
TEFLON.RTM.), ePTFE (expanded polytetrafluoroethylene),
polyacrylonitrile, polyethersulfone, acrylic resin, cellulose
acetate, cellulose nitrate, polyamide, as well as hydroxylpropyl
methyl cellulose (HPMC) membranes; ii) releases no toxic compounds
harming the biologically active agent and/or cells encapsulated
inside the device; iii) promotes secretion or release of a
biologically active agent or macromolecule across the device; iv)
promotes rapid kinetics of macromolecule diffusion; v) promotes
long-term stability of the encapsulated cells; vi) promotes
vascularization; vii) comprised of membranes or housing structure
that is chemically inert; viii) provides stable mechanical
properties; ix) maintains structure/housing integrity (e.g.,
prevents unintended leakage of toxic or harmful agents and/or
cells); x) is refillable and/or flushable; xi) is mechanically
expandable; xii) contains no ports or at least one, two, three or
more ports; xiii) provides a means for immuno-isolating the
transplanted cells from the host tissue; xiv) is easy to fabricate
and manufacture; and xv) can be sterilized.
[0170] The embodiments of the encapsulation devices described
herein are in not intended to be limited to certain device size,
shape, design, volume capacity, and/or materials used to make the
encapsulation devices, so long as one or more of the above elements
are achieved.
Device Designs
[0171] In one embodiment, the encapsulated device is improved by
creating one or more compartments in the device, other than that
created by sealing or welding the device around the periphery or
edges to prevent leakage of the cells and/or biologically active
agents. FIGS. 1A-1I are examples of a schematic of one embodiment
of the device, but the device is not intended to be bound to just
this design. Rather, the design can include variations such as
those routine in the art. In some embodiments, device design can be
modified depending on the type of biologically active agents and/or
cells encapsulated and to meet the needs and function of the study.
A device of any size or shape reasonable can be further
compartmentalized into having at least 1, at least 2, at least 3,
at least 4, at least 5, at least 6, at least 7, at least 8, at
least 9, at least 10, at least 11, at least 12, at least 13, a
least 14, at least 15, at least 16, least 17, at least 18, at least
19, at least 20, at least 21, at least 22, at least 23, at least 24
or more chambers or compartments. One purpose for creating a
plurality of compartments is that it limits cell aggregates or
clusters or agglomerations such that cells packed in the center of
the large clusters/agglomerations are denied, or receive less,
nutrients and oxygen and therefore potentially do not survive. see
FIGS. 1A-1I, 2A-2B, 3A-3B, 4A-4B, 5A-5C, and 6-11 for example.
Devices containing a plurality of chambers or compartments
therefore are better capable to disperse the cells throughout the
chamber/compartment or chambers/compartments. In this way, there is
more opportunity for each cell to receive nutrients and oxygen,
thereby promoting cell survival and not cell death.
[0172] One embodiment relates to a substantially elliptical to
rectangular shape device; see FIGS. 1A-1I, 2A-2B and 5A-5C. These
devices are further compartmentalized or reconfigured so that
instead of a slightly flattened device there is a weld or seam
running through the center of the device, either sealing off each
half of the device, thus forming two separate reservoirs, lumens,
chambers, void spaces, containers or compartments; or the weld or
seam creates one U-shaped chamber which is separated or divided in
the middle due to the weld but such a weld in this instance does
not completely seal off the chambers; see FIGS. 1C-1F and FIG. 2B
also illustrate two ports, which provides for ease of filling and
flushing cells into and through the chambers.
[0173] Another embodiment relates to a similar elliptical or
rectangular shape device having 2, 3, 4, 5, 6, 7, 8, 9, 10 or more
welds across the plane of the device; see FIGS. 5A-5C. In some
aspects the welds are across the horizontal aspect or plane of the
device. In other aspects the welds are across the vertical aspect
or plane of the device. In still other aspects, intersecting welds
are present across both the horizontal and vertical aspects of the
plane. In some aspects the welds are parallel and equidistant to
each other. In other aspects the welds are perpendicular. In still
other aspects the welds are parallel but not equidistant. As in the
above example, such a design can effectively form up to 2, 3, 4, 5,
6, 7, 8, 9, 10 or more chambers, wholly separated if the weld runs
traverses and connects both boundaries of the device, or it can
create one continuous chamber but interdigitated. Further, although
certain exemplary devices are described in FIGS. 1A-1I, 2A-2B,
3A-3B, 4A-4B and 5A-5C with welds being parallel or parallel and
equidistant, still other devices can be customized or made with
welds in any direction or orientation, including long welds which
have regions interrupted by no welds; and with device assemblies
having one or more cell chambers. The type and number of welds and
cell chambers used can depend on the cell population or agent
employed and for what treatment or purpose. In some embodiments,
welds can be arranged to modify the look of the device.
[0174] FIGS. 1A-1I show encapsulation device embodiments described
herein, but as described above, these are preferred embodiments and
one of ordinary skill in the art can envisage that by forming
different configurations using welds or seams in any such device,
one can customize the number of compartments suitable for the
purpose. FIGS. 2A-2B, 3A-3B, 4A-4B and 5A-5C show top, side and end
cross sections of the other device embodiments. The device can be
ultrasonically welded around the entire perimeter 1 to create a
completely enclosed internal lumen; see FIGS. 1A-1C and FIGS.
2A-2B. Other means of sealing or walling off membranes to form the
pouch like device can be used. The lumen is further
compartmentalized by an internal weld 2 that is centrally located
and extends down the long axis of the device; see FIGS. 1D-1I. This
weld extends to a point 3 that effectively limits the thickness or
depth of each compartment yet does not completely segregate the
internal lumen. By this approach, the width and depth of the
compartments are controlled and can be varied as is required to
enable cell product survival and performance. Moreover, all
dimensions of the device, which include but are not limited to, the
overall length, overall width, perimeter weld thickness, perimeter
weld width, compartment length, compartment width, compartment
depth, internal weld length, internal weld width and port position
are design specifications that can be modified to optimize the
device for unique cell products and/or biologically active agents,
e.g. see modular device assembly as shown in FIGS. 2A-2B.
[0175] Referring to FIGS. 1A-1I, the compartment is loaded with a
cell product or biologically active agent through two individual
ports that are incorporated into the device during ultrasonic
welding of the perimeter. These ports extend into the lumen or
compartments and allow access to the compartment for the purpose of
evenly distributing cells and/or agents during loading. Further, as
the ports are connected via the U-shaped internal lumen as in FIGS.
1C-1F, gas is allowed to vent through each port while the adjacent
port is being loaded, thus preventing the accumulation of pressure
in the device.
[0176] Alternatively, in another embodiment, the devices provided
herein contain no ports of entry or exit, i.e. the devices are said
to be port-less. Such an embodiment is shown in FIGS. 5A-5C. FIGS.
3A-3B show side (FIG. 3A) and end cross section (FIG. 3B) views of
a device embodiments with a single (FIG. 3A) or dual (FIG. 3B) port
and both having an internal weld down the long axis of the device.
A two, three or more stage welding process may be necessary to
create a port-less device as that shown in FIGS. 5A-5C. For
example, in one aspect, the elliptical/rectangular outer perimeter
6 and the compartmentalization spot welds 7 are first created by
ultrasonic welding. The spot welds 7 in FIGS. 5A and 5C function
similarly to the internal weld 2 of FIGS. 1A-1I. The spot welds 7
of FIG. 5C are placed is a manner across the device to periodically
limit the expansion of the lumen or compartment 8 at any given
point. Again, the lumen or compartments 8 created by spot welding,
therefore interconnecting the compartments 8, and not isolating or
wholly separating any one lumen or compartment. Moreover, the total
number, diameter and distribution of the spot welds 7 are design
parameters that can be optimized to accommodate the loading
dynamics and growth rates of any cell product or agent.
[0177] Once cells are loaded into the device, the outer perimeter
is completely and aseptically sealed by a second ultrasonic weld
across the edge 9 (FIGS. 5A and 5C) of the device. The result of
the multi-step sealing process is that finished devices are totally
enclosed and have no ports extending from the perimeter. This
approach simplifies the loading process and improves the overall
integrity and safety of the device, as the ports can be an area of
the perimeter where breaches can occur as a result of suboptimal
ultrasonic welding.
[0178] Further, although the above process was described in two
sequential steps, the means for encapsulating the cells and/or
agents is not limited to the described two steps but to any number
of steps, in any order, necessary to encapsulate the cells and at
the same time prevent or reduce the level of breach of the
device.
[0179] In another embodiment, FIG. 5B shows an encapsulation device
substantially similar to the device shown in FIG. 5A, but the spot
welds 10 have been modified during the welding process to have the
centers removed. One of ordinary skill in the art can accomplish
this in various ways, e.g., by using an ultrasonic sonotrode that
has an internal sharpened edge, which can cut the material
immediately after welding. These cut-out welds 10 have an advantage
in that they are more readily integrated with the host tissue
because the cut-out welds 10 promote vascularization of the device,
thus improving the survival and performance of oxygen-dependent
cell products and/or agents. As a consequence of facilitating and
promoting new vasculature through the device, there is improved
diffusive transport of oxygen in the X-Y direction, which is
normally limited towards the center of planar sheet devices.
[0180] In other embodiments, the device design can be different
shapes, e.g. the cell encapsulation device can be in the shape of a
tube or flattened tube or any other such shape which satisfies one
of the above requirements for a device of the invention.
Device Materials
[0181] Cell permeable and impermeable membranes comprising of have
been described in the art including those patents previously
described above by Baxter or otherwise previously referred to as
TheraCyte cell encapsulation devices including, U.S. Pat. Nos.
6,773,458; 6,520,997; 6,156,305; 6,060,640; 5,964,804; 5,964,261;
5,882,354; 5,807,406; 5,800,529; 5,782,912; 5,741,330; 5,733,336;
5,713,888; 5,653,756; 5,593,440; 5,569,462; 5,549,675; 5,545,223;
5,453,278; 5,421,923; 5,344,454; 5,314,471; 5,324,518; 5,219,361;
5,100,392; and 5,011,494, which are herein incorporated by
reference in their entireties.
[0182] In one embodiment, the encapsulating devices are comprised
of a biocompatible material including, but are not limited to,
anisotropic materials, polysulfone (PSF), nano-fiber mats,
polyimide, tetrafluoroethylene/polytetrafluoroethylene (PTFE; also
known as TEFLON.RTM.), ePTFE (expanded polytetrafluoroethylene),
polyacrylonitrile, polyethersulfone, acrylic resin, cellulose
acetate, cellulose nitrate, polyamide, as well as hydroxylpropyl
methyl cellulose (HPMC) membranes. These and substantially similar
membrane types and components are manufactured by at least
GORE.RTM., PHILLIPS SCIENTIFIC.RTM., ZEUS.RTM., PALL.RTM. and
DEWAL.RTM. to name a few.
Immobilized Device
[0183] Also provided is an implantable device, which is immobilized
at an implantation site to maintain the encapsulated cell and/or
biological active agent at the implantation site and permit
diffusion of, for example, an expressed and secreted therapeutic
polypeptide from the implantation site. In one aspect, the
implantation site is at, or close in proximity to, the tissue or
organ which is focus of the treatment. In other aspects, where
delivery of the secreted agent from the device is not location
dependent and biodistribution of the agent is dependent on the
vasculature, the device can be implanted in a remote location. For
example, in a preferred embodiment, the biocompatible device is
implanted subcutaneously under the skin on the forearm, or flank,
or back, or buttocks, or leg and the like, where it substantially
remains until such time as it is required for it to be removed.
Expandable Devices
[0184] Devices described herein have inner and outer surfaces
wherein the device contains at least one void (or reservoir, or
lumen, or container or compartment) and wherein at least one void
is open to the inner surface of the device. Conventional
implantable devices are commonly made of rigid, non-expandable
biocompatible materials. One embodiment of the device described
herein is made of an expandable material. Other embodiments are
directed to non-expandable materials. Whether the device is capable
of expanding may be an inherent part of the materials employed to
make the device, e.g., a polymer sheath which is expandable, or can
be designed such that they are expandable or have expandable
capabilities. For example, a device which expands in size to house
additional cells or to refill an existing device is provided.
[0185] In another embodiment, the implantable device is contained
in a housing or holder, which is slightly more rigid, and
non-expandable but allowing sufficient means to increase cell or
agent capacity by increasing the number of or implant devices. For
example, means for inserting an additional reservoir, lumen,
container, compartment or cassette each having pre-loaded cells or
agent. Alternatively, the housing contains a plurality of devices
only some of which are loaded with cells or have cells encapsulated
therein, while others are empty, which can be loaded and filled
with cells or agents at a later period in time or any time
subsequent the initial implantation. Such an expandable housing is
comprised of inert materials suitable for implantation in the body,
e.g., metal, titanium, titanium alloy or a stainless steel alloy,
plastic, and ceramic appropriate for implantation in the mammal,
more specifically, the human body.
[0186] Still in another embodiment, such a housing or implant
device holder includes an outer sleeve having a longitudinal axis,
at least one passage along the longitudinal axis, and a distal end
and a device engagement area adapted to cooperatively engage the
device. As an analogy, the device holder functions similarly to a
disk or cassette holder capable of housing more than one disk or
cassette at any one time or for a long period of time. In still
another embodiment, the device holder contains an expander adapted
to increase the height of the holder
Refillable Cell Encapsulation Devices
[0187] Another embodiment relates to an encapsulation device with a
refillable reservoir, lumen, container or compartment, which can be
periodically filled or flushed with appropriate therapeutic or
biologically active agents and/or cells. Such filling may be
accomplished by injecting a therapeutically effective amount of the
appropriate therapeutic or biologically active agents and/or cells
into an implanted reservoir, lumen, container or compartment, e.g.,
subdermally or subcutaneously using a syringe or other standard
means in the art for filling like reservoirs, lumens, containers or
compartments in vivo.
Large Capacity Cell Encapsulation Devices
[0188] FIGS. 4A-4B are an illustration of one embodiment, providing
for devices or assemblies containing a plurality or multiplicity of
cell chambers interconnected by cell-free zones, e.g. folds and
bends. For example, one embodiment comprises multiple porous cell
chambers that are laterally connected to each other. In one such
embodiment, the multiple porous cell chambers are formed, for
example, by ultrasonically welding the top and bottom surfaces of a
porous material along a line substantially parallel to a
longitudinal axis of the device and houses any of 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or more cell chambers.
Each cell chamber has a fixed volume capacity, e.g. 100 .mu.L, with
one or more ports and an internal matrix scaffold or foam, and, if
desirable an internal weld or welds to periodically limit the
expansion of the lumen or compartment. In one aspect, the cell
encapsulation device described herein comprises at least 2 porous
chambers or sufficient chambers to house an adequate human dosage
of islets derived from pluripotent stem cells to treat and
ameliorate a subject with diabetes once implanted. In a preferred
embodiment, each chamber has a substantially same inner diameter
and can hold about the same number of cells. The availability of
multiple chambers allows the use of any number or combination of
chambers depending on the volume of cellular preparation required,
the disease treatment regimen prescribed, which is within the
knowledge and skill of persons skilled in the art to determine.
[0189] In one embodiment of the invention, adjacent cell chambers
in a multiple chamber device or assembly may take on different
designs, volume capacity, cross-sectional dimensions and surface
areas. In one aspect, multiple porous cell chambers are formed by
ultrasonically welding the polymer mesh from a proximal end to a
distal end creating cell-free zones at each weld. The top and
bottom surfaces of cell chambers are continuous across the one or
more cell chambers except where they are interrupted by ultrasonic
weld lines or other forms of creating cell-free zones. The core or
center of each cell chamber may contain a seal or a weld in the
cell chamber interior to create a "cell free" zone in the center of
the chamber, for the purpose of partitioning the chamber and
reducing the possibility of a necrotic core of cells in the center
of the device; which can occur when the diameter of the cell
chambers becomes too big or too wide. Such cell-free zones or welds
are also described in Applicant's U.S. Pat. No. 8,278,106,
specifically FIGS. 2-7 and Applicant's device Design applications
previously mentioned. These cell-free zones or welds can be bent or
folded at an angle e.g. at 5, 10, 15, 20, 25, 30, 35, 40, 45, 50,
55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125,
130, 135, 140, 145, 150, 155, 160, 165, 170, 175, and 180 degrees,
which provides a configuration to increase cell volume by adding
more cell chambers to the device assembly while at the same time
constrains or even at times reduces or decreases the footprint of
the entire multiple chamber device assembly.
[0190] In a preferred embodiment of the invention, the devices are
laterally connected to each other and separated by cell-free zones
and/or welds. In one such embodiment, the multiple porous cell
chambers are formed by ultrasonically welding the top and bottom
surfaces of a porous material along a line substantially parallel
to a longitudinal axis of the device and houses at least 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more cell chambers.
Each chamber can house one or more ports on the same side or on
opposing sides. Further each chamber can have an internal matrix
scaffold and/or contain an internal weld.
[0191] Alternatively, individual cell chambers in any device or
assembly need not have the same configuration or design. Each
chamber can take on different characteristic designs including but
not limited to cell chambers can contain an elastomeric foam, cell
chambers with interior weld partitions as described previously in
Applicant's U.S. Pat. No. 8,278,106, cell chambers with different
outer mesh layers, cell chambers with different porous membranes,
cell chambers with additional porous membranes (e.g. vascularizing
membrane, or membrane that elutes certain factors to promote
vascularization), cell chambers of different size to customize the
cell dosage and the like. Multiple cell chamber devices or
assemblies are important for the purpose of delivering high
therapeutic effective doses to a patient while at the same time
providing flexibility in the dosing scheme and not increasing the
footprint of the device.
Encapsulated Cells
[0192] In some embodiments, the system comprises a cell density
between about 1.times.10.sup.5, 1.times.10.sup.6 cells/mL to about
1.times.10.sup.10 cells/mL or more. In some embodiments, the cell
survives under culture conditions or in vivo in the system for at
least a month, two months, three months, four months, five months,
six months, seven months, eight months, nine months, ten months,
eleven months, twelve months or a year or more with a functionality
that represents at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%,
82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, 99% or more of the function expressed at the
time the cells are/were introduced into the system or at the time
the cells fully develop and/or mature in the system, e.g.
implantation of progenitor cells which need to further develop or
mature to functional cells in vivo. In some embodiments, the cell
in the system expands in said system to increase in cell density
and/or cell function upon implantation of the system in vivo.
[0193] In one embodiment, cells encapsulated in the 3-dimensional
large capacity device assemblies include but are not limited to
mesendoderm, definitive endoderm lineage type cells including but
not limited to PDX-1 negative foregut, PDX-1 positive foregut,
pancreatic endoderm (PE or PEC), pancreatic progenitors, endocrine
precursors or progenitors, endocrine cells such as immature beta
cells and the like. In general, definitive endoderm lineage cells
may also include any cells derived from definitive endoderm and
their derivatives and progeny including but not limited to the
organs which derive from the gut tube such as the lungs, liver,
thymus, parathyroid and thyroid glands, gall bladder and pancreas.
See Grapin-Botton and Melton, 2000; Kimelman and Griffin, 2000;
Tremblay et al., 2000; Wells and Melton, 1999; Wells and Melton,
2000. These and other definitive endoderm-lineage type cells have
been described in detail by Applicant, at least in Other suitable
embodiments described herein are further described in detail in at
least U.S. Pat. No. 7,958,585, PREPRIMITIVE STREAK AND MESENDODERM
CELLS; U.S. Pat. Nos. 7,510,876, 8,216,836, 8,623,645 DEFINITIVE
ENDODERM; U.S. Pat. No. 8,129,182, ENDOCRINE PRECURSOR CELLS,
PANCREATIC HORMONEEXPRESSING CELLS AND METHODS OF PRODUCTION; U.S.
Pat. No. 8,278,106, ENCAPSULATION OF PANCREATIC CELLS DERIVED FROM
HUMAN PLURIPOTENT STEM CELLS; and U.S. application Ser. No.
14/106,330, SEMIPERMEABLE MACRO IMPLANTABLE CELLULAR ENCAPSULATION
DEVICES, filed Dec. 13, 2013.
Methods for Increasing Cell Viability
[0194] One obstacle to the field of cell and tissue
encapsulation/immuno-isolation has been the lack of sufficient
oxygen and nutrient transport across the polymer membranes used to
encapsulate cells and tissues. The result of this insufficient gas
and nutrient exchange is lowered metabolic activity and cell death.
Embodiments described herein relate to an implantable cell
encapsulation device addressing this drawback of the prior art.
[0195] Oxygen partial pressures have been measured within islets,
in their native environment, after isolation, and post-transplant
in various polymer devices as well as naked or free, for example,
under the kidney capsule. Oxygen partial pressures in pancreatic
islets are the highest of any organ in the body (37-46 mmHg).
However, upon isolation, these values fall drastically (14-19 mm
Hg). Upon transplantation of pancreatic islets into normo-glycemic
animals the values decrease slightly (9-15 mmHg) as compare to
their isolated values. See Dionne et al., Trans. Am. Soc. Artf.
Intern. Organs. 1989; 35: 739-741; and Carlsson et al., Diabetes
July 1998 47(7):1027-32, the disclosure of which is herein
expressly incorporated by reference. These studies demonstrate that
when tissues are immuno-isolated and transplanted, even in a
vascularized region such as the kidney capsule, the oxygen partial
pressures drop as compared to their native states (37-46 mmHg).
Hence, these nearly anoxic conditions can result in cell death,
particularly the nearer the cell to the core of a cell cluster or
core of an encapsulating device.
[0196] In order to achieve better oxygen availability and delivery
to the encapsulated cells or tissues and/or biologically active
agents, embodiments described herein relate to the use of, for
example, perfluorinated substances in the device design and/or
formulation, e.g., in the membranes or materials employed for
assembly of the device. In particular, perfluoro organic compounds,
e.g., perfluorocarbons (PFCs), are good solvents because they have
several fold higher solubility for oxygen than water. For example,
under normal conditions, liquid PFCs dissolve between 40 and 55% by
volume of oxygen and between 100 and 150% by volume of CO2. PFCs
are largely used as blood substitutes and tissue preservation.
Additionally, PFC derivatives are dense, chemically inert, and
water insoluble compounds that cannot be metabolized.
[0197] In another aspect of the embodiments, enhanced O.sub.2
delivery is performed by a PFC-emulsion or mixture of PFC with some
matrix. The device components or cells for example could be
suspended or soaked or incubated in the emulsion/matrix to form a
coating. Still certain PFC emulsions with higher weight/volume
concentrations have been known to have improved oxygen delivery and
retention properties. And because of the higher oxygen partial
pressure created by the O.sub.2 carrying capabilities of PFCs, an
O.sub.2 pressure gradient is created that drives diffusion of
dissolved oxygen into the tissue, thereby enhancing O.sub.2
delivery to the cells.
[0198] The PFC substance includes but is not limited to
perfluorotributylamine (FC-43), perfluorodecalin, perfluorooctyl
bromide, bis-perfluorobutyl-ethene, or other suitable PFCs.
Preferred PFCs typically contain about 60 to about 76 weight
percent carbon-bonded fluorine. The perfluorinated fluids can be
single compounds, but usually will be a mixture of such compounds.
U.S. Pat. No. 2,500,388 (Simons); U.S. Pat. No. 2,519,983 (Simons);
U.S. Pat. No. 2,594,272 (Kauck et al.); U.S. Pat. No. 2,616,927
(Kauck et al.); and U.S. Pat. No. 4,788,339 (Moore et al.), the
disclosures of which are herein incorporated by reference in their
entireties. PFCs useful in the embodiments described herein also
include those described in Encyclopedia of Chemical Technology,
Kirk-Othmer, Third Ed., Vol. 10, pages 874-81, John Wiley &
Sons (1980). For example, useful PFCs include
perfluoro-4-methylmorpholine, perfluorotriethylamine,
perfluoro-2-ethyltetrahydrofuran, perfluoro-2-butyltetrahydrofuran,
perfluoropentane, perfluoro-2-methylpentane, perfluorohexane,
perfluoro-4-isopropylmorpholine, perfluorodibutyl ether,
perfluoroheptane, perfluorooctane, and mixtures thereof. Preferred
inert fluorochemical liquids include perfluorohexane,
perfluoro-2-butyltetrahydrofuran, perfluoroheptane,
perfluorooctane, and mixtures thereof. Commercially available PFCs
useful in the embodiments described herein include FLUORINERT.TM.
fluids, e.g., FC-72, FC-75, FC-77 and FC-84, described in the 1990
product bulletin #98-0211-5347-7(101.5) NPI, FLUORINERT.TM. fluids,
(available from Minnesota Mining and Manufacturing Company, St.
Paul, Minn.), and mixtures thereof.
In Vivo Imaging Capability
[0199] In one embodiment, there is provided a means for imaging or
detecting the cells inside the encapsulating devices in vivo.
Imaging serves important roles in stem cell therapies. For example,
noninvasive forms of imaging can be used to: (1) determine the
presence, severity or phenotype of the cell and/or disease to be
treated; (2) monitor engrafted cell therapies for the appearance of
deleterious or non-target cell types and structures, such as cysts
or microcysts; (3) guide the delivery of therapy; (4) follow the
time-course of disease and evaluate the effects or efficacy of
therapy; (5) provide labels and define mechanisms of therapy; (6)
analyze and evaluate survival and function of engrafted cells; and
(7) generally facilitate the process of any cell therapy, e.g. by
determining the engraftment, survival, and local function of cell
therapy, including cell therapies described herein for treatment of
diabetes by substitution and/or implanting pancreatic progenitor
cells. In addition, although cell therapies aim to decrease
morbidity/mortality, noninvasive imaging techniques as described
herein and in more detail below can serve as a useful surrogate
endpoint, for example, in preliminary trials or preclinical
studies.
[0200] Any in vivo imaging technology is ideally: i) non-invasive;
ii) reliably repetitive; iii) capable of tissue penetration up to a
depth of at least 3 mm; iv) resolution capabilities of no greater
than 100 .mu.M and ideally no greater than 50 .mu.M; v) imaging is
not attenuated by device materials, e.g., can image through PTFE;
vi) clinically compatible and not technically cumbersome or
complicated; vii) commercially available; viii) FDA approved for
human use; ix) reasonably cost-effective; and x) can image cells in
a reasonable period of time (e.g., seconds or minutes), or any
combination of the above.
[0201] To date, current methods include but are not limited to
confocal microscopy, 2-photon microscopy, high frequency
ultrasound, optical coherence tomography (OCT), photoacoustic
tomography (PAT), computed tomography (CT), magnetic resonance
imaging (MRI), single photon emission computed tomography (SPECT)
and positron emission tomography (PET). These alone or combined can
provide useful means to monitor the transplanted cells. Also, it is
expected that such technologies will improve over time but that the
essential tenets of how each technology functions or its utility is
substantially similar. That said, in vivo imaging described herein
is not intended to be limited to technologies described below but
to technologies later discovered and described which would serve
the same utility as that described herein.
[0202] In one embodiment, the imaging technique employed would be
non-invasive and provide for a 3-dimensional tomographic data, have
high temporal and spatial resolution, allow molecular imaging, and
would be inexpensive and portable. While at present no single
modality is ideal (discussed in more detail below), each has
different attributes and these modalities together can provide
complimentary information.
[0203] Confocal microscopy is an optical imaging technique that
increases micrograph contrast and is capable of reconstructing
three-dimensional images by using a spatial pinhole to eliminate
out-of-focus light in specimens that are thicker than the focal
plane. Since only one point in the sample is illuminated at a time,
2D or 3D imaging requires scanning over a regular raster (i.e. a
rectangular pattern of parallel scanning lines) in the specimen.
Three principal scanning variations are commonly employed to
produce confocal microscope images. Fundamentally equivalent
confocal operation can be achieved by employing a laterally
translating specimen stage coupled to a stationary illuminating
light beam (stage scanning), a scanned light beam with a stationary
stage (beam scanning), or by maintaining both the stage and light
source stationary while scanning the specimen with an array of
light points transmitted through apertures in a spinning Nipkow or
Nipkov disk. Each technique has performance features that make it
advantageous for specific confocal applications, but that limits
the usefulness of that feature for other applications.
[0204] All confocal microscopes rely on the ability of the
technique to produce high-resolution images, termed optical
sections, in sequence through relatively thick sections or
whole-mount specimens. Based on the optical section as the basic
image unit, data can be collected from fixed and stained specimens
in single, double, triple, or multiple-wavelength illumination
modes, and the images collected with the various illumination and
labeling strategies will be in register with each other. Live cell
imaging and time-lapse sequences are possible, and digital image
processing methods applied to sequences of images allow z-series
and three-dimensional representation of specimens, as well as the
time-sequence presentation of 3D data as four-dimensional imaging.
The use of above confocal microscopes is not limiting as other
confocal microscopes now or later discovered are also encompassed
in the embodiments described herein.
[0205] A large number of fluorescent probes are available that,
when incorporated in relatively simple protocols, can stain certain
cellular surface markers and/or proteins and intracellular
organelles and structures, e.g., Celltracker, DiI, nuclear vital
dyes, and the like. Fluorescent markers which specifically bind
directly or indirectly to certain cell surface markers can be
especially useful for identification of for example unwanted cell
types. In one preferred embodiment, real time in vivo imaging for
the presence of encapsulated pluripotent cells provides a means to
detect, and therefore the potential to prevent, teratoma formation
caused from pluripotent stem cells, such as hES or human embryonic
gonadal cells or induced pluripotent stem (IPS) cells or parthenote
cells and the like. The same means of detection can also identify
pluripotent Stem cells which have escaped or leaked out of the
device (or become un-encapsulated). Identification of such cells
can also be performed using fluorescently labeled promoter genes
OCT4 and NANOG that are up-regulated in expression in pluripotent
stem cells. Similarly, certain intracellular fluorescent markers
that label nuclei, the Golgi apparatus, the endoplasmic reticulum,
and mitochondria, and even dyes such as fluorescently labeled
phalloidins that target polymerized actin in cells, are also
commercially available and can provide critical information about
the fate of a cell.
[0206] In another embodiment, two-photon excited fluorescence
(TPEF) microscopy is a noninvasive means to monitor differentiation
or, stated in the reverse, to identify pluripotent stem cells
(e.g., hESCs or IPS cells or parthenote cells) which did not
differentiate and were inadvertently implanted as a very small
percentage of the product cells that were encapsulated in the
device described herein. Two-photon excited fluorescence microscopy
relies substantially on endogenous sources of contrast, but can
also detect, for example, fibrillar matrix molecules via second
harmonic generation. In brief, two-photon microscopy relies on
fluorescence emission similar to that employed by confocal
microscopy. Rice et al. (2007) described that TPEF can be used to
reveal quantitative differences in the biochemical status and the
shape of differentiating and nondifferentiating stem cells in
two-dimensional (2-D). See Rice et al. (2007) J Biomed Opt. 2007
November-December; 12(6), the disclosure of which is expressly
incorporated by reference herein. In one embodiment, pluripotent
stem cells can be genetically modified to express a fluorescent
protein, e.g., enhanced green fluorescence protein, and driven by a
pluripotent stem cell promoter (e.g., OCT4 or NANOG or any other
pluripotent stem cell promoter later identified). For those
implantable devices that are deeper than subcutaneous implants,
i.e. deep below the skin surface, two-photon provides for a
non-invasive deeper imaging than confocal microscopy. Further, the
infrared light used is less harmful to living cells than visible or
ultraviolet exposure, as the photon energy required for
fluorescence excitation only occurs at the plane of focus and is
not experienced by cells or tissues in the out-of-focus planes.
[0207] In still another embodiment, ultrasound is portable,
essentially harmless, versatile, and can be done in real-time at
the time of implantation of the encapsulated cell product and/or
encapsulated biologically active agent or as a monitoring tool over
the course of implantation. In particular, conventional low and/or
corresponding high-frequency ultrasound can be used to provide
qualitative as well as quantitative spectroscopic data. Although
high-frequency ultrasound is capable of increased imaging
resolution (30-80 .mu.m over 20-50 MHz) as compared to clinical
low-frequency ultrasounds (80 .mu.m-1.5 mm over 1-20 MHz), it
suffers from limited tissue penetration depth and limiting its use
to superficial tissue sites. High-resolution imaging enables in
vivo assessment of anatomical structures and hemodynamic function
in longitudinal studies of a mammal. For example, Vevo by
VisualSonics offers: (1) ability to perform longitudinal studies of
disease progression and regression in individual subjects; (2)
image resolution of anatomical and physiological structures of down
to 30 microns; (3) ability to visualize image-guided needle
injection and extraction; (4) microcirculatory and cardiovascular
blood flow assessment; (5) high throughput via user-friendly
equipment and research-driven interface; and (6) open architecture
allowing comprehensive measurement and annotations and offline data
analysis. The ability to assess microcirculatory and cardiovascular
blood flow will assist in determining the viability of the cells,
e.g. O.sub.2 flow and delivery. In comparison, low-frequency
ultrasound (about 7-10 mHz) has been shown to detect
microstructural tissue changes that correlated with histological
cell death in acute myeloid leukemia cells exposed to chemotherapy.
See Azrif et al., Conventional low-frequency ultrasound detection
in apoptosis, Proceedings of the American Institute of Ultrasound
in Medicine, New York, N.Y. 2007 (AIUM Laura M.D., 2007) p.
S185.
[0208] In another embodiment, magnetic resonance imaging (MRI) can
be utilized to distinguish between healthy and diseased tissue
using a contrast agent. Yet, in another embodiment, computerized
tomography (CT) or CT scans can be used to create a detailed
picture of the body's tissues and structure. Again here, a contrast
agent is utilized and makes it easy to visualize abnormal tissue
due to specific absorption rates. One use of a contrast agent such
as Indium-111 (I-111) oxine is for tracking stem cells although it
does have a short half-life. Still, in another embodiment, Positron
Emission Tomography (PET) scans can be used to measure emissions
from positron-emitting molecules e.g., carbon, nitrogen, and oxygen
to name a few, and provide valuable functional information. In yet
another embodiment, optical coherence tomography (OCT) or
photoacoustic tomography (PAT) may also be used to examine cells
and tissues inside and outside the device. OCT detects differences
in the reflectivity of various tissues while PAT detects ultrasonic
waves created when tissues are heated by exposure to low energy
laser light.
[0209] Having generally described this invention, a further
understanding can be obtained by reference to certain specific
examples which are provided herein for purposes of illustration
only, and are not intended to be limiting.
EXAMPLES
[0210] It should also be understood that the foregoing relates to
preferred embodiments of the present invention and that numerous
changes may be made therein without departing from the scope of the
invention. The invention is further illustrated by the following
examples, which are not to be construed in any way as imposing
limitations upon the scope thereof. On the contrary, it is to be
clearly understood that resort may be had to various other
embodiments, modifications, and equivalents thereof, which, after
reading the description herein, may suggest themselves to those
skilled in the art without departing from the spirit of the present
invention and/or the scope of the appended claims.
[0211] It is understood that an important feature of the
cryopreservation techniques below is that all involve the
cryopreservation of PEC aggregates, not single cells.
[0212] It will be appreciated that the methods and compositions
described below cryopreservation of PEC aggregates derived from hES
cells. However, the above-described cryopreservation techniques can
be utilized with other cell types including, pluripotent stem cells
(including hES), definitive endoderm, primitive gut tube or foregut
endoderm, posterior foregut, Pdx1-positive endoderm, or endocrine
cells, or immature endocrine cells, specifically, immature beta
cells. The above described cryopreservation techniques can be
utilized with PEC derived from other cell types such as iPEC (PEC
aggregates derived from induced pluripotent stem cells), or PEC
made from other pluripotent stem cells which do not involve the
destruction of a human embryo or non-embryonic pluripotent cells
such as ICM/epiblast cells, primitive ectoderm cells, primordial
germ cells, and teratocarcinoma cells. The above-described
cryopreservation techniques can be utilized with other cell
lineages including mesoderm (bone muscle, blood), ectoderm (neural,
skin).
[0213] It is understood that the treatments described below limit
spontaneous differentiation and ideally promote survival of cell
types of interest such as non-endocrine cells compared to endocrine
and residual cell types.
Example 1
Cryopreserving and Thawing PEC Aggregates
[0214] Because cell transplantation is hindered by the lack of
available cell sources and operational and logistical problems,
there is a need to provide an unlimited pancreatic cell source for
transplantation at times convenient to the patient.
[0215] Here, Applicant explored various cryopreservation conditions
to optimize cell survival following cryopreservation.
Cryopreservation conditions analyzed include, but are not limited
to dimethyl sulfoxide (DMSO) equilibration time (e.g., 30 vs. 60
minutes), base medium composition (DMEM/XF/DMSO/Hepes vs. Cryostor
5 and cryostor 10), transition temperature to rapid cool
(-35.degree. C., -40.degree. C., -65.degree. C.), DMSO
equilibration temp (room temperature vs. 4.degree. C.),
Equilibration time and temp (4.degree. C. for 1 hr, RT for 45 min,
RT for 15 min to 4.degree. C. for 45 min), Thaw media temp (room
temperature, 4.degree. C.), slow cool rate (0.5.degree. C./min,
0.2.degree. C./min, 0.1.degree. C./min). These many iterative
experiments were tested alone, or in combination, to determine how
cell survival following cryopreservation could be optimized. Such
optimized cryopreservation and thawing protocols produce PEC
aggregates with optimized cell survival following
cryopreservation.
[0216] As a specific example, cell incubation time in the
cryopreservation solution was tested. It is well known that
extended periods of time in DMSO is detrimental to cell survival
and viability, for example, time periods greater than 20 minutes.
However, a certain time period of incubation in DMSO is necessary
for equilibration of DMSO intracellularly. Hence, Applicants
elucidated the optimal time period for DMSO incubation of PEC.
[0217] Pancreatic progenitor cells (or PEC) were differentiated to
day 13 substantially as described in U.S. Pat. Nos. 8,008,075,
8,278,106, 7,510,876, 7,534,608, 7,993,920, 7,695,965; U.S.
application Ser. Nos. 12/618,659 and 13/205,511; Schulz et al.
supra, (2012); Kroon et al. (2008) supra, D'Amour et al. (2006)
supra, and in Table 5 below. The PEC aggregates were centrifuged
and then resuspended in cryopreservation solution containing DMEM
with 30% Xeno-free Knockout Serum Replacement, 25 mM HEPES and 10%
DMSO solution. Cells were aliquoted into freezing vials and
equilibrated in cryopreservation solution for about 30 or 60
minutes at ambient temperature. Although cells were equilibrated in
cryopreservation solution for about 30 or 60 minutes, it is
expected that the cells could be equilibrated for longer for
example 90 minutes, 120 minutes, 2 hours, 3 hours, 5 hours, 8
hours, 24 hours or even longer without deleteriously affecting the
viability or later in vivo function of the cells.
TABLE-US-00003 TABLE 5 Manufacturing Method for Making Pancreatic
Endoderm Cells (PEC) and Endocrine Cell Populations Protocol #2:
Production of PEC with Higher Non- Protocol #3: Production of
Protocol #1: Standard PEC Endocrine Sub- Endocrine Cell Population
Days Stage Production Populations Days (Composite) -1 XF HA; SP XF
HA; SP -1 XF HA; SP 0 1 r0.2FBS-ITS1:5000 A100 r0.2FBS-ITS1:5000
A100 0 r0.2FBS-ITS1:5000 A100 W50 W50 W50 1 r0.2FBS-ITS1:5000 A100
r0.2FBS-ITS1:5000 A100 1 r0.2FBS-ITS1:5000 A100 2 2
r0.2FBS-ITS1:1000 K25 IV r0.2FBS-ITS1:1000 K25 IV 2
r0.2FBS-ITS1:1000 K25 IV 3 r0.2FBS-ITS1:1000 K25 r0.2FBS-ITS1:1000
K25 3 r0.2FBS-ITS1:1000 K25 4 r0.2FBS-ITS1:1000 K25
r0.2FBS-ITS1:1000 K25 4 r0.2FBS-ITS1:1000 K25 5 3 db-CTT3 N50
db-CTT3 N50 A50 H5 W50 5 db-CTT3 N50 A50 H5 W50 6 db-CTT3 N50
db-CTT3 N50 A50 H5 W50 6 db-CTT3 N50 A50 H5 W50 7 db-CTT3 N50
db-CTT3 N50 A50 H5 W50 8 4 db-N50 K50 E50 db-N50 K50 E50 A5 H5 7
db-N50 K50 E50 A5 H5 9 db-N50 K50 E50 db-N50 K50 E50 A5 H5 8 db-N50
K50 E50 A5 H5 10 db-N50 K50 E50 db-N50 K50 E50 A5 H5 9 db-N50 K50
E50 A5 H5 11 db-N50 K50 E50 db-N50 K50 E50 A5 H5 10 db-N50 K50 E50
A5 H5 12 db-N50 K50 E50 db-N50 K50 E50 11 db-N50 K50 E50 13 db-N50
K50 E50 (optional) db-N50 K50 E50 12 db-N50 K50 E50 14 5
Transplanted Transplanted 13 db-N50 K50 E50 R01 NC10 14 14 db-N50
K50 E50 R01 NC10 15 6 15 db-Y10 MG0.05 SHH100 NC10 IGF50 BMP10 16
16 db-Y10 MG0.05 SHH100 NC10 IGF50 BMP10 17 17 db-Y10 MG0.05 SHH100
NC10 IGF50 BMP10 18 18 db-Y10 MG0.05 SHH100 NC10 IGF50 BMP10 19 19
db-Y10 MG0.05 SHH100 NC10 IGF50 BMP10 20 7 20 db-MG0.05 SHH100 NC10
IGF50 BMP10 21 21 db-FBS BMP10 TTNPB1 IGF50 22 22 db-Y10 MG0.05
BMP10 TTNPB1 IGF50 23 23 db-Y10 MG0.05 BMP10 TTNPB1 IGF50 24 24
db-Y10 MG0.05 BMP10 TTNPB1 IGF50 25 25 db-Y10 MG0.05 BMP10 TTNPB1
IGF250 26 26 db-Y10 MG0.05 BMP10 TTNPB1 IGF250 27 27 db-Y10 MG0.05
BMP10 TTNPB1 IGF250 28 28 db-Y10 MG0.05 BMP10 TTNPB1 IGF250 29 29
db-Y10 MG0.05 BMP10 TTNPB1 IGF250 30 30 db-Y10 MG0.05 BMP10 TTNPB1
IGF250
[0218] hESC Agg.: hESC aggregates; XF HA: DMEM/F12 containing
GlutaMAX, supplemented with 10% v/v of Xeno-free KnockOut Serum
Replacement, 1% v/v non-essential amino acids, 0.1 mM
2-mercaptoethanol, 1% v/v penicillin/streptomycin (all from Life
Technologies), 10 ng/mL heregulin-1b (Peprotech) and 10 ng/mL
Activin A (R&D Systems); SP: StemPro.RTM. hESC SFM (Life
Technologies); r0.2FBS: RPMI 1640 (Mediatech); 0.2% FBS (HyClone),
1.times. GlutaMAX-1 (Life Technologies), 1% v/v
penicillin/streptomycin; cb: CMRL: CMRL 1066, lx Glutamax, 1% v/v
penicillin/streptomycin, 2% B-27; db: DMEM Hi Glucose (HyClone)
supplemented with 0.5.times.B-27 Supplement (Life Technologies), lx
GlutaMAX, and 1% v/v penicillin/streptomycin; A100, A50, A5: 100
ng/mL, 50 ng/mL, 5 ng/mL recombinant human Activin A (R&D
Systems); BMP20, BMP10: 20 ng/mL, 10 ng/mL BMP4 (Peprotech); CTT3:
0.25 mM KAAD-Cyclopamine (Toronto Research Chemicals) and 3 nM
TTNPB (Sigma-Aldrich); E50: 50 ng/mL recombinant human EGF (R&D
Systems); H10, H5: 10 ng/mL, 5 ng/mL Heregulin1b; IGF25: 25 ng/mL
Insulin-like Growth Factor (Peprotech); ITS:
Insulin-Transferrin-Selenium (Life Technologies) diluted 1:5000 or
1:1000; IV: 2.5 mM TGF-b RI Kinase inhibitor IV (EMD Bioscience);
K50, K25: 50 ng/mL, 25 ng/mL recombinant human KGF (R&D
Systems, or Peprotech); MG0.05: 0.05% MATRIGEL (BD Biosciences);
N50: 50 ng/mL recombinant human Noggin (R&D Systems); NC10: 10
mM Nicotinamide; PDGF10: 10 ng/mL Platelet-derived growth factor
(PDGF, R&D Systems); RO1: gamma-secretase inhibitor, R04929097,
1 mM; SHH100: 100 ng/mL sonic hedgehog; TTNPB1: 1 nM TTNPB
(Sigma-Aldrich); W50: 50 ng/mL recombinant mouse Wnt3A (R&D
Systems); Y10: 10 mM Y-27632 (Tocris Bioscience).
[0219] After four days cryopreservation, the PEC aggregates (which
were incubated in the cryopreservation solution for 30 or 60
minutes) were thawed and analyzed for cell survival. Percentage of
cell survival was quantitated by measuring cell pellet volume
(.mu.L) or calculating the area covered by cell aggregates in
tissue culture plates, e.g. 6-well tissue culture plates.
[0220] Measurements were taken at two time points, the first time
point, at thaw, before any significant cell loss occurs (i.e. 100%
cell survival); and the second time point, 1 day (or 24 hours)
post-thaw after which the majority of cell loss has occurred. The
percentage of cell survival at 1 day (24 hours) post-thaw was
calculated by comparing time point 1 to time point 2 Table 6 below
summarizes the percentage cell survival for two samples at 30 and
60 minutes.
TABLE-US-00004 TABLE 6 Percent Cell Survival Following Extended
Incubation in Cryopreservation Solution and Cryopreservation Sample
Equilibration Percent Survival 24 hrs Post-Thaw Time (min)
Replicate 1 Replicate 2 30 28% 25% 60 38% 33%
[0221] The morphology of cultured PEC aggregates (which were
incubated in the cryopreservation solution for 30 or 60 minutes)
after cryopreservation and thawing was identical to that of fresh
cells. The results in Table 6 above indicate that cell survival
following prolonged incubation in cryopreservation solution results
in better cell survival (60 min equilibration time, 38% and 33%
(avg. 35%) vs. 30 min, 28% and 25% (avg. 26%)). This result is
surprising because it was previously thought that DMSO or other
cryopreservative treatments for extended periods of time decreased
cell survival and/or function after thawing. Thus, it was
unexpected that PEC would survive well after 30 or even 60 minutes
of DMSO treatment.
[0222] In another study, prolonged incubation of PEC in the
cryopreservation solution was further optimized. At day 12 of
differentiation as substantially described in Schulz et al. (2012)
supra, the PEC aggregates were centrifuged and then resuspended in
cryopreservation solution containing DMEM with 30% Xeno-free
Knockout Serum Replacement, 25 mM HEPES and 10% DMSO solution.
Cells were aliquoted into freezing vials and equilibrated in
cryopreservation solution for about 15 minutes at ambient
temperature, for 45 minutes at 4.degree. C., then placed on ice and
put in a programmed freezer at 0.degree. C. Incubation at 4.degree.
C. is known to lessen toxicity associated with cryoprotective
agents but also slows the rate of diffusion of the cryopreservation
solution into the cells.
[0223] The freezing chamber containing the cells was brought to
-9.degree. C. at a rate of 2.degree. C./min. The chamber was held
at this temperature for about 10 minutes, and the vials were seeded
manually (formation of ice crystals). The sample was held at
-9.degree. C. for about 10 minutes and then cooled at a rate of
0.2.degree. C./minute until the vials reached -40.degree. C. The
freezing chamber was subsequently cooled at a rate of 25.degree.
C./minute until the vials reached about -150.degree. C. The vialed
cells were then moved to the vapor phase of a liquid nitrogen
storage freezer.
[0224] At desired times, the vials were rapidly thawed by
transferring the vials to a 37.degree. C. water bath. The cells
were transferred to a 15 mL sterile tube, containing DMEM with B-27
(1:100) mixed gently and spun briefly at 50.times.g. Supernatant
was removed and cells were resuspended in the same buffer plus
Noggin, KGF+EGF (each at 50 ng/mL), and DNAse at 25 .mu.g/mL
(incubation medium) and placed in rotation culture for 3 or 4
days
[0225] PEC aggregates (Stage 4--Day 12) samples were either (1)
immediately analyzed (PEC no cryo), (2) incubated for 3 days
without cryopreservation in the above described incubation medium
(PEC, 3 day incubation, no cryo) or cryopreserved, thawed and
incubated for 3 or 4 days in the above described incubation medium
(PEC, 3/4 day incubation after cryo). Cell composition of PEC
cultures was analyzed using flow cytometry as shown in Table 7
below: Column A represents CHGA(+)(Endocrine cells); Column B
represents CHGA-, NKX6-1+, PDX1+ (non-endocrine cells) and Column C
represents CHGA- cells which are a) PDX1+ and NKX6.1- b) PDX1- and
NKX6.1+ or c) PDX1- and NKX6.1- (residual cells).
TABLE-US-00005 TABLE 7 Flow Cytometry Analysis of Cryopreserved and
Non-Cryopreserved PEC PEC CHGA-, NKX6.1+, CHGA- PDX1+ NKX6.1+/-
CHGA+ (Non- PDX1+/- PEC Treatment (Endocrine) endocrine) (Residual
Cells) No cryo (n = 8) 50 27 23 No cryo, 3 days incubation 57 33 10
(n = 1) 3 days incubation after 43 50 7 cryopreservation and thaw
(n = 6) 4 days incubation after 40 51 9 cryopreservation and thaw
(n = 7) >4 days incubation after 42 50 8 cryopreservation and
thaw (n = 2)
[0226] According to Table 7, results of the flow cytometry show
that the populations of cells before and after cryopreservation are
similar, i.e., a substantial proportion of both the cryopreserved
and non-cryopreserved population consists of CHGA+ (endocrine
cells) and CHGA-/NKX6-1+/PDX1+ (non-endocrine). Thus,
cryopreservation of PEC cultures does not compromise the overall
cell population (since the percentages of CHGA+/NKX6-1-/PDX1-
(endocrine cells) and CHGA-/NKX6-1+/PDX1+ (non-endocrine cells) are
similar. Survival of the endocrine and non-endocrine cell
populations is an important feature of the above protocol.
[0227] While the cell compositions are similar overall for
cryopreserved and non-cryopreserved samples, according to Table 7,
there are some small changes in the overall cell composition. For
example, cryopreservation increases the percentage of non-endocrine
cells as compared to endocrine cells. Specifically, in Table 7, 57%
of CHGA+ and 33% CHGA-/NKX6-1+/PDX1+ in stage 4, no cryo, 3 day
incubation sample versus 43% CHGA+ and 50% CHGA-/NKX6-1+/PDX1+ in
the stage 4, cryopreserved, 3 day incubation sample. This increase
in CHGA-/NKX6-1+/PDX1+ (non-endocrine cells) as compared to CHGA+
(endocrine cells) is also seen in those cultures which had longer
post-thaw incubation periods, e.g. cryopreserved, 4 day incubation
post-thaw. An increase in the non-endocrine as compared to
endocrine cells is an important feature of the above protocol.
[0228] Additionally, it is noted that the cell aggregates are large
compared to single cells and may leave a large liquid headspace
upon cryopreservation in vials. Cell yield may increase post thaw
if this head space is reduced by using smaller vials or
cryopreserving the tubes in a horizontal vs vertical
orientation.
[0229] The above data also indicates that the incubation period
(whether cryopreserved or not) increases the total percentage of
endocrine cells plus non-endocrine cells increases whereas the
"residual" cells decrease. The above results are surprising because
previously it has been shown that cryopreservation of hESCs causes
extensive cell death, and a proportion of those that survive
differentiate spontaneously. See Reubinoff et al. (Human
Reproduction, 2001, 16, 2187-2194. Thus, increased cell survival of
PEC without substantially changing the overall cellular composition
or population is an important feature of the above protocol.
[0230] It will be appreciated that the methods and compositions
described above relate to cells cultured in vitro. However, the
above-described in vitro differentiated cell compositions may be
used for in vivo applications. Use of the compositions described
herein have been described detail in at least Applicant's U.S. Pat.
Nos. 7,534,608; 7,695,965; and U.S. Pat. No. 7,993,920; entitled
METHODS FOR PRODUCING PANCREATIC HORMONES, which issued May 19,
2009, Apr. 13, 2010 and Aug. 9, 2011, respectively; and U.S. Pat.
No. 8,278,106, entitled ENCAPSULATION OF PANCREATIC CELLS DERIVED
FROM PLURIPOTENT STEM CELLS. Use and function of the compositions
described herein have also been reported by Applicant in prior
non-patent publications including Kroon et al. 2008 supra and
Schulz et al. 2012, supra.
Example 2
Cryopreserving and Thawing Encapsulation Devices
[0231] To determine whether implantable semi-permeable
encapsulation devices as described herein can maintain their
integrity, devices were cryopreserved, thawed and subsequently
tested for quality assurance as described below.
[0232] It will be appreciated that cryopreservation of
encapsulation devices can be carried out using different techniques
and equipment including but not limited to in liquid nitrogen
(-196.degree. C.), in liquid nitrogen vapor phase, in a cryogenic
freezer, or via a slow rate freezing or vitrification.
[0233] Five empty single ported encapsulation devices with no
internal weld(s) were sterilized with ethylene oxide gas and the
port trimmed to approximately 1 cm see FIGS. 1A and 1B. The empty
encapsulation devices were then placed in 10 mL cryotubes (VWR
Product #SIMPT 310-10A) with the port facing the lid or cap.
Approximately 5.5 mL of cryopreservation solution (stock solution
comprised of 13.75 mL DMEM, 5.0 mL DMSO, 30.0 mL Xeno-free Knockout
Serum Replacement and 1.25 mL HEPES for a total volume of 50 mL)
was added to the cryotube to cover the device and port. The
cryotube with the empty encapsulation device was then centrifuged
at 1500 rpm for about 3 minutes to remove any residual air from the
lumen and port inside the device.
[0234] Because the tubes holding the encapsulation device did not
fit into the controlled rate freezer, the cyrotubes were placed in
a test tube rack fashioned from foam material. Each tube was fully
covered by the foam material and then placed in -80.degree. C.
freezer overnight. This system mimics a controlled rate freezer
because the insulation provided by the foam slows the freezing rate
as air trapped in the foam slows heat transfer. Controlled freezing
can also be achieved using a Mr. Frosty (NALGENE) vessel. The
cyrotubes were then removed from the -80.degree. C. freezer and
transferred to the vapor phase compartment of a liquid nitrogen
tank in order to bring the temperature lower. One of skill in the
art will recognize that the frozen cryotubes can be stored in
liquid nitrogen (-196.degree. C.), liquid nitrogen vapor, or in a
cryogenic freezer (-150.degree. C.). After at least 24 hours of
storage, devices were retrieved from the liquid nitrogen tank and
rapidly thawed in 37.degree. C. water bath for approximately 2
minutes. The devices were then transferred to 50 mL conical tubes
with 50 mL of PBS (phosphate buffered saline) to wash off the
cryopreservation solution. After approximately 15 minutes the PBS
was decanted off and replaced with fresh 50 mL PBS.
[0235] In order to be useful for cryopreserving the encapsulated
cells (or cell-device combination product), the device needs to
maintain its integrity. To determine whether the cryopreserved
devices maintained their integrity, pressure decay and burst
pressure testing was performed. Pressure decay is tested by
submerging the device in 100% isopropyl alcohol to saturate the
pores of the membrane. The device is then connected to a Sprint iQ
Leak Tester (USON) that fills the device with clean air until the
target pressure (about 5 psi+/-0.1 psi) is reached. Once
pressurized, the flow of air stops, the device sealed and the
amount of pressure loss over 20 seconds is recorded. A
cryopreserved device passes the pressure decay test if the amount
of pressure loss over 20 seconds is .ltoreq.0.010 psi. If the
integrity of the device was compromised by cryopreservation, the
pressure decay would be higher than 0.010 psi. Burst pressure is
tested by connecting the device to the Sprint iQ Leak Tester which
generates a pressure ramp of approximately 1 psi/sec. A
cryopreserved device passes the burst pressure test if the device
can withstand .gtoreq.5 psi without bursting. A target pressure of
5 psi is used for the burst pressure and pressure decay tests
because it is estimated that cells grown in the device for 6 months
have a pressure of 2.5 psi. Hence, by testing for 5 psi, there is a
2.5 safety threshold; and measuring 5 psi allows detection of holes
in the device down in the 1-3 .mu.M range. Ensuring the devices can
withstand 5 psi without bursting ensures the devices will be
intact. Later detection of device integrity (or device expansion)
can be imaged in vivo with standard clinical ultrasound for
example.
[0236] Table 8 shows the leak test results of 10 devices tested
substantially as described above.
TABLE-US-00006 TABLE 8 Integrity of Cell Encapsulation Devices:
Cryopreserved vs. Non- Cryopreserved Pressure Pressure Burst Burst
Sample Decay Decay Pressure Pressure No. Status (PSI) Pass/Fail
(PSI) Pass/Fail 1 Cryopreserved 0.001 Pass 18.84 Pass 2
Cryopreserved 0.000 Pass 21.29 Pass 3 Cryopreserved 0.001 Pass
21.20 Pass 4 Cryopreserved 0.001 Pass 20.35 Pass 5 Cryopreserved
0.000 Pass 17.46 Pass 6 Non-Cryopreserved 0.001 Pass 18.894 Pass 7
Non-Cryopreserved -0.001 Pass 22.612 Pass 8 Non-Cryopreserved 0
Pass 21.033 Pass 9 Non-Cryopreserved 0.001 Pass 22.156 Pass 10
Non-Cryopreserved -0.001 Pass 21.046 Pass
[0237] As indicated above in Table 8, the encapsulation devices
after cryopreservation had an average burse pressure of 19.28 psi.
The non-cryopreserved encapsulation devices had an average burse
pressure of 21.15 psi. While the non-cryopreserved encapsulation
devices had a higher average burse pressure, both cryopreserved and
non-cryopreserved encapsulation devices had burst pressures much
greater than what is expected for cell expansion in vivo (2.5 psi).
The pressure decay and burst pressure of cryopreserved devices was
comparable to devices which had not been cryopreserved. The results
of both the pressure decay and burst testing demonstrate that,
short term cryopreservation as described herein does not compromise
the general integrity of the devices. Specifically, DMSO exposure
during freeze and thaw did not impact device membrane integrity or
weld burst strength. Additionally, rapid thawing from vapor phase
Liquid nitrogen temps (-135 C to -190 C) did not stress the device
weld or materials to cause rupture or measurable change in its
integrity.
[0238] It will be appreciated by those of skill in the art that
after the devices are thawed, cells may be loaded into the
cryopreserved device and surgically implanted in a mammalian host.
PEC aggregates loaded into a previously cryopreserved device are
capable of post-engraftment function in vivo, as defined by
long-term glucose-responsive human C-peptide secretion or
protection against STZ-induced hyperglycemia. Hence,
cryopreservation of empty implantable, semipermeable devices is
expected to have little or no effect on, cell survival upon
implantation, maturation of the cells or the physiological function
of the cells once they have matured. Thus, cryopreservation proves
to be a reliable method of storing empty implantable, semipermeable
devices.
Example 3
Cryporeserved PEC Mature and Function In Vivo
[0239] To determine whether cryopreservation of PEC aggregates
affects in vivo function, PEC cell aggregates that had been
previously cryopreserved and the thawed were loaded into an
implantable, semipermeable, cell-encapsulation device,
transplanted, allowed to mature and levels of human c-peptide in
sera of implanted mice measured following intraperitoneal glucose
administration. One of skill in the art will recognize that any
appropriate implantable, semipermeable encapsulation device can
work for this study as described herein and FIGS. 1A-1I, 2A-2B,
3A-3B, 4A-4B and 5A-5C, and in Applicant's other patent and
non-patent publications, including Schulz et al. (2012) and Kroon
et al (2008), supra and U.S. Pat. Nos. 7,534,608; 7,695,965;
7,993,920 and 8,278,106, supra.
[0240] PEC aggregates cryopreserved for about 1 hour, 4 days, 6
weeks (data combined since no differences were observed for these
time periods) or 2 years were transplanted into mice substantially
as previously described herein and in Applicant's other patent and
non-patent publications, including Schulz et al. (2012) and Kroon
et al (2008), supra and U.S. Pat. Nos. 7,534,608; 7,695,965;
7,993,920 and 8,278,106, supra. Briefly, PEC populations were
wholly encapsulated with a biodegradable semi-permeable cell
encapsulation device. The devices were manufactured by Applicant
and are described in detail in U.S. Pat. No. 8,278,106, entitled
ENCAPSULATION OF PANCREATIC CELLS FROM HUMAN PLURIPOTENT STEM
CELLS, filed Nov. 13, 2009. Glucose stimulated insulin secretion
(GSIS) assays were performed starting from about 8-9 weeks and
11-13 weeks post-implant. Blood was collected prior to (fasting)
and at 60 minutes after glucose administration. Graft function was
assessed by measuring human C-peptide concentrations in the serum
in response to glucose administration.
[0241] The amount of human C-peptide released into the serum is
indicative of the amount of insulin released. C-peptide is a short
31 amino acid peptide connecting or linking A and B-chains of
proinsulin and preproinsulin, which is secreted by functioning beta
or insulin secreting cells. As discussed previously by Kroon et al.
(2008) supra and others, human C-peptide measurements are
appropriate for assessing the release of de novo-generated insulin
by the implanted cells. Hence, levels of human C-peptide in the
serum of these animals is a measure of the in vivo function of the
mature PEC grafts. Human C-peptide was detected in the serum by 8-9
weeks post-implant.
[0242] FIG. 7 is a box plot showing levels of human C-peptide in
sera of implanted mice. Mice implanted with the cell-device
combination product (PEC loaded in an implantable semipermeable
cell encapsulation device) were analyzed at 8-9 weeks or 11-13
weeks post-engraftment for serum levels of human C-peptide at
fasting and 60 min after intraperitoneal glucose administration.
The encapsulation device was loaded with fresh (not cryopreserved)
or cryopreserved PEC aggregates. The cryopreserved PEC aggregates
were either cryopreserved for 6 weeks or less or for 2 years. N
identifies the total numbers of GSIS (glucose stimulated insulin
secretion) tests performed on mice within the indicated
post-implant intervals. At 8-9 weeks and 11-13 weeks the
cryopreserved PEC for .ltoreq.6 weeks and 2 years had largely
overlapping levels of serum human C-peptide at 60 minutes following
glucose administration compared to fresh PEC samples. At 8-9 weeks
the PEC samples cryopreserved for 2 years had slightly lower serum
C-peptide levels as compared to the fresh PEC and those PEC
cryopreserved for .ltoreq.6 weeks but the values are still
overlapping. At 11-13 weeks the serum C-peptide levels are
overlapping for all three PEC samples (fresh, .ltoreq.6 weeks and 2
years cryopreservation). Additionally, graft function improves with
time in both the PEC cryopreserved for .ltoreq.6 week
cryopreservation and 2 years cryopreservation and non-cryopreserved
PEC samples, e.g., serum C-peptide levels are higher than at 11-12
weeks compared to 8-9 weeks. As such, mature PEC grafts made from
cryopreserved PEC loaded into an encapsulation device are as robust
as fresh PEC grafts; and cryopreservation did not reduce the
capacity of the PEC aggregates to mature and function in vivo,
i.e., long-term glucose-responsive human C-peptide secretion. Thus,
cryopreservation of PEC aggregates prior to implantation in an
implantable semipermeable cell-encapsulation device proves to be a
reliable method of storing PEC aggregates.
[0243] To determine what affect the device had on PEC in vivo
function, Applicants compared the in vivo function of
unencapsulated cryopreserved PEC vs. encapsulated non-cyropreserved
(or Fresh) PEC. FIG. 8 is a box plot showing levels of human
C-peptide in sera of implanted mice. Mice implanted with
un-encapsulated PEC aggregates (no device) in the epididymal fat
pad were analyzed 12 weeks post-engraftment for serum levels of
human C-peptide at fasting and 60 min after intraperitoneal glucose
administration. Devices were loaded with fresh PEC (not
cryopreserved) or 9 month cryopreserved PEC aggregates. N
identifies the total numbers of GSIS (glucose stimulated insulin
secretion) tests performed on mice within the indicated
post-implant intervals. As such, mature grafts from un-encapsulated
cryopreserved PEC implanted in the epididymal fat pad was as robust
as fresh unencapsulated PEC grafts; and cryopreservation did not
reduce the capacity of the PEC aggregates to mature and function in
vivo. Thus, cryopreservation of PEC aggregates prior to
implantation in the epididymal fat pad proves to be a reliable
method of storing PEC aggregates.
[0244] The above results are surprising because previously it has
been shown that cryopreservation of human embryonic stem cells
causes extensive cell death, and a proportion of those that survive
differentiate spontaneously. One would expect a similar outcome for
PEC. Thus, the survival, ability for the cells to mature in vivo
and demonstrate substantial post-engraftment function in vivo
demonstrates that PEC is well suited for cryopreservation
methods.
Example 4
Cell Survival Following Incubation with 30% Vs. 60% Knockout Serum
Replacement (KO-SR)
[0245] As discussed above, Applicant explored various
cryopreservation conditions to optimize cell survival following
cryopreservation. Applicant also explored various thawing and
incubation conditions to optimize cell survival following
cryopreservation. Thawing and incubation conditions analyzed
include, but are not limited to optimization of the concentrations,
time of use and duration of the thawing and incubation media, and
treatment with other factors in the thawing and incubation media
for improving cell survival. These many iterative experiments were
tested alone, or in combination, to determine how cell survival
following cryopreservation could be optimized. Such optimized
thawing and incubation protocols produce PEC aggregates with
optimized cell survival following cryopreservation.
[0246] As a specific example, PEC aggregate populations were
produced and cryopreserved substantially as described in Example 1
above. Cryopreserved PEC aggregates were then thawed and cultured
for 3 or 4 days on either 30% or 60% knockout serum replacement.
Cell viability in Example 1 was described by calculating the
percentage of cell aggregates at two time points in a cell culture
dish. Here, cell viability was measured using a similar measurement
except using aggregate pellet volume (APV or cell mass). The APV
yield is the APV post thaw divided by the APV immediately after
thaw in different levels of KO-SR, which is used to affect cell
survival. Standard thaw conditions were used to thaw cryopreseved
PEC plus 30% KOSR for 3 days post thaw, 30% KOSR for 4 days post
thaw and 60% KO-SR for 3 days post thaw. Table 9 shows the APV
yields of this study. Because the mean APV yields overlap (when
considering the standard deviation), there is no statistical
difference in APV yield when aggregates were cultured post thaw in
30% or 60% KO-SR. See also FIG. 9.
TABLE-US-00007 TABLE 9 Variability Summary for APV Yield (%) Number
of Thawed Samples Mean Std Dev Lower 95% Upper 95% Tested APV Yield
(%) 45.77496 9.051004 43.72064 47.82929 77 [all samples 30% and
60%] APV Yield Formulation 41.48125 10.12904 37.76589 45.19661 31
[30% KO-SR] APV Yield Formulation 48.66855 6.978349 46.59624
50.74087 46 [60% KO-SR] APV Yield Formulation 39.29089 8.056655
35.52026 43.06152 20 [30% KO-SR] Day Post- Thaw[3] APV Yield
Formulation 45.46373 12.54681 37.03466 53.89279 11 [30% KO-SR] Day
Post- Thaw[4] APV Yield Formulation 48.66855 6.978349 46.59624
50.74087 46 [60% KO-SR] Day Post- Thaw[3]
Example 5
Shipping Cell Loaded Encapsulation Devices
[0247] To determine the viability of the cell-device combination
product, the product was shipped and assayed as described
below.
[0248] Implantable semi-permeable devices were loaded with PEC
aggregates substantially as described above. The loaded devices
were then packed into a biological shipping container surrounded by
gel packs to keep the cells at about 37.degree. C. The container
was shipped using a private courier and transported approximately
400 miles. The shipment was unloaded at the destination center,
stored at room temperature overnight and then returned again using
gel packs to maintain constant room temperature. In total, the
shipment was in transit for approximately 24 hours.
[0249] Cells shipped approximately 400 miles at 37.degree. C.,
stored at room temperature overnight, returned approximately 400
miles at room temperature to San Diego and implanted had comparable
serum human C-peptide levels 9, 12, 16 and 24 weeks post-transplant
(data combined) as compared to implantable semi-permeable devices
loaded with day 4 post thaw cells and implanted at 4 days
post-thaw. See FIG. 10.
[0250] One of skill in the art recognizes that this protocol
represents a standard protocol which could be used to ship kits
consisting of product cells, product devices, alone or in
combination to the clinical site, e.g. doctor's office, hospital,
and the like. Additionally, one of skill in the art will recognize
that on site locations such as doctor's offices typically have
4.degree. C. cold storage units. Cells are expected to mature and
function (glucose-responsive human c-peptide secretion or
protection against STZ-induced hyperglycemia) when encapsulated
cells are shipped to facilities and stored at 4.degree. C. in an
organ/tissue preservation solution described below.
[0251] It is understood that the shipping protocol described above
limit spontaneous differentiation and ideally promote survival of
cell types of interest such as non-endocrine cells compared to
endocrine and residual cell types.
Example 6
Extending Shelf Life of PEC Aggregates
[0252] While cryopreservation is a useful long term storage
approach, there is a need for short-term storage at room
temperature or refrigerator temperature (0.degree. C.-8.degree. C.)
("hibernation"). Therefore, Applicant evaluated the viability and
yield of PEC following short-term storage at 4.degree. C. or room
temperature in three organ/tissue preservation solutions. Unlike,
cryopreservation techniques which use intracellular
cryopreservatives such as DMSO, these hibernation studies utilize
tissue preservation solutions which reduced the need for
substantial processing of the cell therapy product in order to
remove the toxic cryoprotectants prior to administration to a
patient. Specifically, these hibernation media compositions do not
include DMSO.
[0253] PEC aggregate populations were produced and cryopreserved
substantially as described in Example 1 above. Except, here,
differentiation was carried out in a bioreactor substantially as
described in U.S. Patent Publication no. 2012/0045830. After 3 days
of recovery at 37.degree. C. in rotation (about 95 rpm), all cell
aggregates were collected in a 50 mL conical tube and allowed to
settle. The supernatant was removed then the aggregates were washed
once in 40 mL DPBS (Dulbecco's phosphate buffer solution)+0.2% BSA.
With the aggregates evenly suspended, aliquots of 10 mL were
transferred into 4.times.50 mL conical tubes. After the aggregates
settled, the supernatant was removed and 24 mL of the various
test/control solutions (organ/tissue preservation solution) was
added to each of the tubes. The preservation solutions tested
(defined as both room temperature preservation solutions and
hibernation preservation solutions) include: DB-DMEM Hi Glucose
(Gibco, 11960-044), 1% B27 Supplement (Gibco, 17504-044), 1%
Penicillin/Streptomycin (Gibco, 15070-063) and 1% Glutamax (Gibco,
35050-061) or "DB", KPS-1--Kidney Perfusion Solution (Organ
Recovery Systems, KPS-1, Lot PBR-0048-006) and 1%
Penicillin/Streptomycin (Gibco, 15070-063) or "KPS", S3--Static
Preservation Solution, no additives (Organ Recovery Systems, SPS-1,
Lot PBR-0060-001) and 1% Penicillin/Streptomycin (Gibco, 15070-063)
or "S3", and Unisol-I-Base--(Cell and Tissue Systems, Inc., Lot
UHK092110) and 1% Penicillin/Streptomycin (Gibco, 15070-063) or
"Unisol". Refer also to FIGS. 12A-12B and 13A-13B.
[0254] For each of the test/control solutions (organ/tissue
preservation solution), 3 mL was added to each well in
2.times.6-well trays for a total of 12 wells. With the aggregates
evenly distributed in the conical tubes, 2 mL of aggregate
suspension was added to each well of the various 6-well trays
containing the appropriate corresponding media for a total of 5 mL
in each well. Within each group of medias, the number of aggregates
per well was adjusted such that the aggregates were evenly
distributed (based on visual assessment).
[0255] The aggregates were stored in the solutions at 4.degree. C.
and room temperature for a period of 2 weeks, with pictures taken
at 3, 5, 7, 12 and 14 days, and Live/Dead staining done at 7 and 14
days. Live/Dead staining was performed using a
Viability/Cytotoxicity Kit by Life Technologies, L3224. LDH-based
cytotoxicity was assessed at 7 and 14 days. Lactate dehydrogenase
is a soluble cytosolic enzyme that is released into the culture
medium following loss of membrane integrity resulting from either
apoptosis or necrosis. LDH activity, therefore, can be used as an
indicator of cell membrane integrity and serves as a general means
to assess cytotoxicity resulting from chemical compounds or
environmental toxic factors. Here LDH-based cytotoxicity was tested
using CytoTox 96 LDH Assay (Promega, G1780), and the results are
shown in FIGS. 12A-12B and 13A-13B.
[0256] FIGS. 12A-12B and 13A-13B and Tables 10 and 11 show that in
general cell viability in the various preservation solutions is
higher when the aggregates are stored at 4.degree. C. as compared
to room temperature storage; Compare FIGS. 12A and 12B and FIGS.
13A and 13B. Moreover, cell viability at 4.degree. C. is
significantly greater in the preservation solutions compared to the
DMEM+1% B27 (DB) control media, with no significant difference in
viability between 7 and 14 days of storage at 4.degree. C. See
FIGS. 12B and 13B.
[0257] After 7 days at 4.degree. C., cell aggregates in the control
DMEM+1% B27 (DB) media exhibited greater than .about.2-fold
increase in cytotoxicity as compared to aggregates in the
preservation solutions by LDH release. In contrast, cell aggregates
in the preservation solutions at 4.degree. C. exhibited
.about.3-fold less cytotoxicity after 7 days compared to the same
storage solutions at room temperature.
[0258] See FIGS. 12B and 13B.
TABLE-US-00008 TABLE 10 Raw Data For Cell Viability (Dead cells/mL
(.times.10.sup.6) at room temperature/ambient conditions Sample 1
Sample 2 Sample 3 Day 7 Day 14 Day 7 Day 14 Day 7 Day 14 DB 0.139
0.417 0.182 0.463 0.134 0.421 KPS-1 0.623 0.645 0.664 0.682 0.683
0.854 S3 0.857 0.550 0.553 0.566 0.564 0.649 Uni-Sol 0.622 0.535
0.603 0.559 0.748 0.597
TABLE-US-00009 TABLE 11 Raw Data For Cell Viability (Dead cells/mL
(.times.10.sup.6) at 4.degree. C. conditions: Sample 1 Sample 2
Sample 3 Day 7 Day 14 Day 7 Day 14 Day 7 Day 14 DB 0.368 1.113
0.363 1.171 0.65 1.84 KPS-1 0.112 0.187 0.127 0.195 0.123 0.246 S3
0.152 0.161 0.151 0.168 0.138 0.207 Uni-Sol 0.144 0.383 0.22 0.349
0.134 0.384
[0259] To determine whether there was a real statistical
significance between the results shown in Tables 10 and 11 and
graphed in FIGS. 12A-12B and 13A-13B, analysis of variance (ANOVA)
was used to test for significant differences between two or more
means. ANOVA on the full factorial experimental design indicates
that the media type, storage temperature and storage time are all
statistically significant factors impacting the release of LDH in
this experiment. Moreover, all secondary interactions between these
factors are significant. This means when two factors are changed
there is a significant impact on the release of LDH in this
experiment. This test showed that the results observed in Tables 10
and 11 are significant.
TABLE-US-00010 TABLE 12 ANOVA (DOE) on LDH Cytotoxicity results:
Sum of Mean F p-value Source Squares df Square Value Prob > F
Significance? Model 44.46 12 3.71 28.09 <0.0001 significant
A-Media 2.95 3 0.98 7.45 0.0006 significant B-Temp 5.41 1 5.41
41.03 <0.0001 significant C-Time 5.07 1 5.07 38.45 <0.0001
significant AB 24.73 3 8.24 62.49 <0.0001 significant AC 4.83 3
1.61 12.21 <0.0001 significant BC 1.46 1 1.46 11.09 0.0021
significant Residual 4.62 35 0.13 Lack of Fit 0.51 3 0.17 1.33
0.2818 not significant Pure Error 4.11 32 0.13 Cor Total 49.08
47
[0260] To determine whether encapsulated PEC aggregates stored
under similar above described conditions would function in vivo
after transplantation, PEC aggregates were loaded into an
implantable semi-permeable cell encapsulation device were stored
for 4 or 7 days at room temperature in DB media, or for 4, 7 or 14
days at 4.degree. C. in SPS-1 ("SPS") media and then washed in 10
mL HBSS (Hanks Balanced Salt Solution)+0.2% HSA+pen/strep. One of
skill in the art will recognize that any of the other preservation
solutions described above could be used for short term storage at
room temperature or 4.degree. C. including HEPES
(4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (Life
Technologies).
[0261] Mice were implanted with a cell-device combination product,
whereby the device was loaded with fresh (not stored) or PEC
aggregates stored for 4 or 7 days at room temperature in either DB
media ("DBRT), or stored for 4, 7 or 14 days at 4.degree. C. in
SPS-1 media ("SPS4C"). See FIG. 14. Serum C-peptide levels were
analyzed at 8, 12 and 23 weeks post-engraftment at fasting, 30
minutes and 60 min after intraperitoneal glucose administration.
FIG. 14 shows that storage of PEC cell aggregates for 4 or 7 days
at room temperature in DB media (DBRT) had largely overlapping
levels of C-peptide at 30 and 60 minutes following glucose
administration as compared to fresh PEC samples ("Control") 8, 12
and 23 weeks after transplantation. Similarly, PEC cell aggregates
stored for 4 days at 4.degree. C. in SPS-1 media (SPS4C) had
largely overlapping levels of C-peptide at 30 and 60 minutes
following glucose administration as compared to fresh PEC samples
(Control) 8, 12 and 23 weeks after transplantation. Interestingly,
PEC cell aggregates stored for longer than 4 days (or 7 or 14 days)
at 4.degree. C. in SPS-1 media (SPS4C) did not have robust levels
of C-peptide at 30 and 60 minutes following glucose administration
as compared to the Control 8 over the same period. So, although
there was increased cell death observed when PEC aggregates were
stored at room temperature as compared to 4.degree. C. (FIGS.
12A-12B and 13A-13B), storage at room temperature in DB media
(DBRT) for up to 7 days did not affect in vivo function as shown in
FIG. 14. In contrast, in vivo function of cell aggregates stored in
SPS-1 media in 4.degree. C. (SPS4C) was not affected up to 4 days,
however, over 7 days cell aggregates incubated under the same
conditions does appear to affect in vivo function Thus, storage of
encapsulated PEC aggregates which were held in tissue preservation
solution in at either room temperature or 4.degree. C. prior to
implantation is best when incubated in the preservation solution
for less than 7 days (but possibly more than 4 days) in SPS media
at 4.degree. C., and at least up to 7 days in DB media at room
temperature.
[0262] The above results are surprising because although there was
increased cell death observed when PEC aggregates were stored at
room temperature as compared to 4.degree. C. (FIGS. 12A-12B and
13A-13B), the viable cells were still able to mature in vivo.
[0263] It is understood that cryopreservation of the PEC aggregates
prior to treatment with the tissue preservation media is not a
requirement and that cells treated with tissue preservation media
without prior cryopreservation are expected to survive, mature and
function as described above.
[0264] The compositions described above are suitable for use in
therapy, including the treatment of insulin dependent diabetes.
Cells preserved as described above do not need to be further
processed to remove DMSO, DMEM or other toxic compounds from the
storage or preparation medium, as the product is compatible with
cell delivery devices and is not toxic by clinical
administration.
Example 7
Cryopreserving the Cell-Device Combination Product
[0265] To date, reasonably robust methods for cryopreservation of
encapsulated insulin producing cells has been limited to
microencapsulation devices. While Itkin-Ansari describes
cryopreservation of human insulin producing cells in a
macro-encapsulation device, cell yield following cryopreservation
is less than 10%. Itkin-Ansari et al., Cryopreservation of human
insulin expressing cells macro-encapsulated in a durable
therapeutic immunoisolating device theracyte, Cryo Letters. 2012
November-December; 33(6):518-31. Therefore, it is desirable to
cryopreserve the cell-device combination product described herein
with greater than 10% cell yield post-thaw. Cryopreserving the
cell-device combination product is advantageous because it allows
for sterility testing to be performed before shipping the product
to the clinical site, as well as improving storage and logistical
flexibility.
[0266] PEC aggregates will be loaded into the implantable
semipermeable device as described above and the port sealed without
first being exposed to the cryopreservation solution. The
combination product is placed inside a cryopreservation container.
Although, cryopreservation of combination product can be performed
in any type of container (e.g., vial, cryotube, bag, Daikyo Crystal
Zenith.RTM. plastic vials (Aseptic Technologies.), made of cyclic
olefin polymers,), cryopreserving the combination product in a
collapsible cryopreservation bag considerably improves cell
viability, and therefore in vivo maturation and function. This is
because using a bag to hold the combination product reduces the
total cryopreservation solution needed, and thickness of the
packaged combination product which in turn makes it easier to
control temperature changes.
[0267] In one embodiment the cryopreservation bag contains less
that 100 mL, less than 50 mL, less than 25 mL, less than 10 mL,
preferably less than 5 mL, preferably less than 3 mL
cryopreservation solution. Before sealing the bag, air and excess
cryopreservation solution is removed from the bag. Further a bag
can be a closed system which reduces the risk of loss of sterility.
In one embodiment the cryopreservation bag has 1 loading port, 2
loading ports, 3 loading ports, 4 loading ports or more. The
loading ports are made with a material that can be cryopreserved
without breaking or cracking. In one embodiment the
cryopreservation solution is loaded into the cryopreservation bag
through a loading port and is removed from the bag via a loading
port. Multiple flushing cycles with cryopreservation medium may be
performed to accelerate the diffusion of medium into the PEC cell
aggregates, and thereby minimize the exposure to such solution
prior to initiation of freezing. See FIG. 6.
[0268] In one preferred embodiment, the cryopreservation solution
contains DMEM with about 30%-60% Xeno-free KO-SR, 25 mM HEPES and
10% DMSO solution. It is understood that if the DMSO concentration
outside the device is higher, then the active time to equilibrate
the cryopreservation solution to 10% DMSO inside the device is
reduced. It is also understood that the equilibration time is
reduced if the cryopreservation solution is flowed across the
device. The combination product is equilibrated in cryopreservation
solution at ambient temperature, and then equilibrated in
cryopreservation solution at 4.degree. C., and then the
cryopreservation system (combination product and bag) is placed on
ice and put in a programmed freezer which was equilibrated to
0.degree. C. The packaged combination product is brought to
-9.degree. C. at a controlled rate. The packaged cell-device
combination product is held at this temperature for about 10
minutes, or until the internal temperature of the device reaches
-9.degree. C. and the cells packages are seeded to initiate ice
crystal formation. The packaged product is then slowly cooled at a
controlled rate until the product reaches -40.degree. C. The
packaged combination product is subsequently cooled at a controlled
rate until the sample reaches about -150.degree. C. The packaged
combination product is then moved to the vapor phase of a liquid
nitrogen storage freezer.
[0269] Once the packaged combination product has reached its target
cryopreservation temperature, it may be stored frozen for extended
periods of time and distributed to clinical centers. At desired
times the cryopreserved packaged combination product is thawed.
Rapid thawing is achieved by placing the product in a bath of warm
water, at a temperature of maximum 40.degree. C., preferably
between 10.degree. C. and 40.degree. C. and for instance about
37.degree. C. Once thawed, the cryopreservative is removed from the
cryopreservation system by flushing the system using the
cryopreservation bag port with dilution medium. For example, one
port is used to fill up the cryopreservation bag and another port
is used to draw out the dilution medium. This can be performed
simultaneously and continuously by utilizing an intravenous bag
containing dilution medium connected to the inflow port. Such a
system allows for a large dilution volume and diffusion gradient.
If flushed via discrete boluses, the packaged combination product
may be flushed more than once, optimally twice or three times or
four. The dilution medium may be any dilution medium known in the
art, for example, any of the media listed above for use in
hibernating cells such as tissue/organ preservation solutions, or
for growth and differentiation of cells. Once flushed, the
combination product is ready for implantation into a mammalian
host. Or, alternatively may be incubated in incubation medium
(described above) for up to 1 hour, 2 hours, 3 hours, 4 hours, 5
hours, 10 hours, 24 hours, 48 hours, 72 hours, 4 days, 5 days, 6
days, 7 days, 8 days, 9 days, 10 days or longer.
[0270] One drawback to the above described approach is that the
cryopreservation solution is slightly viscous and it may take some
time to equilibrate across the device membrane. Therefore, in
another embodiment, the PEC aggregates are placed in
cryopreservation solution prior to loading into the implantable,
semipermeable device. In another embodiment, the PEC aggregates are
loaded into the implantable, semipermeable device and the
cryopreservation solution is loaded into the device via the
port.
[0271] It is understood that any cryopreservative known in the art
can be used in a cryopreservative solution. Further, it is
understood that DMSO can be used at a wide range of concentrations,
e.g., about 1%, about 2%, about 3%, about 4%, about 5%, about 6%,
about 7%, about 8%, about 9%, about 10%, about 11%, about 12%,
about 13%, about 14%, about 15% or more.
[0272] In one embodiment the combination product can be
cryopreserved using a vitrification procedure. After the
combination product is equilibrated with cryopreservation solution
in either a cryotube or bag, it is immediately transferred into the
liquid phase of liquid nitrogen at -196.degree. C. to induce rapid
freezing. The product can be left in the liquid phase or moved to
the vapor phase for long term storage. The cryopreservation
solution for vitrification can include any cryopreservation
solution known in the art and may include vitrification solution
comprising a mixture of 0.5M DMSO, 0.5M propylene glycol, 0.25M
2,3-butanediol, 1.0M proline, 2.5% raffinose, 15% PVP (Ave.
M.W..apprxeq.40,000), and 15% dextran (Ave.
M.W..apprxeq.40,000-70,000); or a mixture of 0.5M DMSO, 0.5M
propylene glycol, 0.25M 2,3-butanediol, 10% raffinose, 6%
trehalose, 6% sucrose, 12% PVP (Ave. M.W..apprxeq.40,000), and 12%
dextran (Ave. M.W..apprxeq.40,000-70,000); or a mixture of 0.5M
DMSO, 0.5M propylene glycol, 0.25M 2,3-butanediol, 2.5% raffinose,
12% sucrose, 15% PVP (Ave. M.W..apprxeq.40,000), and 15% dextran
(Ave. M.W..apprxeq.40,000-70,000).
[0273] In one embodiment the combination product can be
cryopreserved using a Cells Alive System (ABI Corporation) which
uses electromagnetic fields and mechanical vibrations to prevent
ice crystal formation.
[0274] In one embodiment the combination product is pretreated
prior to cryopreservation. Prior to addition of the
cryopreservation solution the combination product is incubated in a
nutrient medium at a temperature of from 27.degree. C. to
42.degree. C. and for a period of time from five minutes to twenty
four hours. In some cases the nutrient medium contains an
antibiotic. PEC aggregates can also be pretreated by heat shock
before loading into the device as disclosed in EP0830059
incorporated by reference in its entirety. Heat shock induces
tolerance to the abruptly increasing concentration of osmotics in
cells that result from freezing by the formation of heat-shock
proteins that stabilize proteins and membranes. Heat shock is
performed by culturing the cells in a water bath at between about
31.degree. C. to about 45.degree. C., preferably between about
33.degree. C. to about 42.degree. C. and more preferably above
about 37.degree. C. Culturing is performed from a few minutes to a
few hours, preferably from about one hour to about six hours, and
more preferably from about two hours to about four hours. After
this treatment, cells are transferred to room temperature
(23.degree. C. to 25.degree. C.) for up to four hours before
cryopreservation.
[0275] In one embodiment the cells are mixed with compounds prior
to freezing, during freezing (cryopreservation solution) or during
thawing or during flushing (dilution media), or during a post thaw
incubation period (incubation media), at sufficient concentrations
to stabilize and protect cell membranes from damage post-thaw. For
example, Hank's balanced salt solution (preferably without
Ca.sup.++), DMEM containing media with no glucose or minimal to low
amounts of glucose, buffers (e.g., phosphate buffers, HEPES, or the
like) antioxidants, growth factors, KCl (e.g., at about 30 mM),
lactate (e.g., at about 20 mM), pyruvate, MgCl.sub.2 (e.g., at
about 2-3 mM), sorbitol (e.g., to an osmolarity of about 300 mM) or
others additives as are well known in the art. Another suitable
additive includes DNase (e.g., commercially available from
Genentech, Incorporated as PULMOZYME.RTM.). Added proteins such as
mammalian serum (preferably heat inactivated) or a serum protein
such as albumin. Antifreeze proteins such as glycoproteins can be
added to the cells. In one embodiment, a Rho-kinase inhibitor such
as Y27632 can be added to the cells. Additionally, large stable
molecules such as Dextran and/or D-glucose, PBS, L-glutamine, an
antibiotic, at least one mitotic inhibitor such as
fluorodeoxyuridine, cytosine arabinoside, uridine triphosphate or a
combination thereof can be added to the cells. Additionally,
anti-apoptotic agents, a composition that inhibits apoptosis and/or
necrosis triggered by cryopreservation can be added to the cells.
Cellular targets involved in the promotion of apoptosis which can
be inhibited to improve cryopreservation include but are not
limited to, Caspases (Cystine Proteases), ROCK, CAD (Caspase
Activated DNAse) ASK1, Fas, JNK (Jun Kinase Family), FADD (Fas
Activated Death Domain), TNF (Tumor Necrosis Factor), TRADD (TNF
Receptor Activated Death Domain), RIP (receptor Interacting
Protein), DAXX, Granzyme B, Bad (Mitochondrial Pro-apoptotic
protein), Bax, Bid, Cytochrome C (Mitochondrial Pro-apoptotic
protein), AIF (Apoptosis Initiation, Factor), MAPK (Mitogen
Activated Protein Kinase Family) Calpain (Serine Proteases)
Caspathin, Nitric Oxide, PARP (Poly-ADP Robose Polymerase) DFF (DNA
Fragmentation Factor). Cellular targets involved in the prevention
of apoptosis which can be activated to improve preservation
efficacy include but are not limited to Bcl-2 (Mitochondrial
Anti-apoptotic protein), Bcl-x (Mitochondrial Anti-apoptotic
protein), IAP (Inhibitor of Apoptosis Protein), RAS (Receptor
mediated pro-survival signal), AKT (Anti-apoptosis signal
Initiation), TRAF2 (TNF Receptor Associated Factor 2) or a
combination thereof can be added to the cells. Free radical
scavengers and other anti-apoptotic agents include but are not
limited to flavonoids vitamin e vitamin c vitamin d beta carotene
(vitamin a) pycnogenol super oxidedismutase n-acetyl cysteine
selenium catechins alpha lipoic acid melatonin glutathione zinc
chelators calcium chelators 1-arginine or a combination thereof can
be added to the cells. Additionally, anti-inflammatory compounds
(e.g., p38 MAP kinase inhibitors, TGF-beta inhibitors, statins,
IL-6 and IL-1 inhibitors, PEMIROLAST, TRANILAST, REMICADE,
SIROLIMUS or a combination thereof can be added to the cells. It is
understood that the addition of additional compounds does not cause
spontaneous differentiation or affect the cell population
percentages (endocrine, non-endocrine, residual) post thaw.
[0276] It is understood that the addition of any compound including
the cryopreservation solution does not negatively affect aggregate
distribution within the device.
[0277] In one embodiment, the combination product is not thawed in
a single step. A two stage method of thawing cells from a
cryopreserved state includes first warming the cells from a
cryopreservation temperature to a transition temperature of at
least -30.degree. C. in a first, slow-warming stage by exposing the
cells to a first environment having a temperature of less than
-30.degree. C., preferably -80.degree. C. as described in EP
1274301 herein incorporated by reference. Once the cells have
reached the transition temperature, they are subsequently further
warmed the cells from the transition temperature by exposing the
cells to a second environment having a temperature of at least
32.degree. C. in a second, rapid-warming stage.
[0278] In one embodiment, the combination product is not flushed
following thawing, i.e., DMSO is not removed prior to
implantation.
[0279] It is understood that the combination product may be
cryopreserved the same day or up to 1 day, 2 days, 3 days, 4 days,
5 days, 6 days, 7 days, 8 days, 9 days 10 days, 14 days, 3 weeks, 1
month, 2, months, 3, months, 4 months, 5 months, 6 months or more
post encapsulation.
[0280] It is understood that the cells cryopreserved within the
device mature and function in vivo to the same extent as cells
which had not been cryopreserved. See. FIG. 11.
[0281] It is understood that cryopreserved combination product have
comparable post-engraftment function in vivo, as defined by
long-term glucose-responsive human c-peptide secretion or
protection against STZ-induced hyperglycemia compared to
combination products which are not cryopreserved.
[0282] It is understood that histological analysis shows cell
content in both the cryopreserved and non-cryopreserved combination
product to be not statistically different 12 weeks post
engraftment.
[0283] It is understood that the methods disclosed herein for
cryopreserving the combination product provides cell viability
after thawing of preferably more than 10%, 20%, 30%, 40%, 50%
preferably more than 70%, preferably more than 80%, and for
instance 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
[0284] It will be apparent to one skilled in the art that varying
substitutions, modifications or optimization, or combinations may
be made to the embodiments disclosed herein without departing from
the scope and spirit of the invention. The methods, compositions,
and devices described herein are presently representative of
preferred embodiments and are exemplary and are not intended as
limitations on the scope of the patent. Changes, alternatives,
modifications and variations therein and other uses will occur to
those skilled in the art which are encompassed within the spirit of
the invention and are defined by the scope of the disclosure.
[0285] All publications and patents mentioned in this specification
are herein incorporated in their entireties by reference.
[0286] As used in the claims below and throughout this disclosure,
by the phrase "consisting essentially of" is meant to include any
elements listed after the phrase, and limited to other elements
that do not interfere with or contribute to the activity or action
specified in the disclosure for the listed elements. Thus, the
phrase "consisting essentially of" indicates that the listed
elements are required or mandatory, but that other elements are
optional and may or may not be present depending upon whether or
not they affect the activity or action of the listed elements.
EMBODIMENTS
Embodiment 1
[0287] A method for preserving encapsulated cell, said method
comprising: a. obtaining cells to be cryopreserved; b. loading the
cells into an implantable semi-permeable encapsulation device to
create encapsulated cells to create a combination product; c.
contacting the combination product with a cryopreservative; and d.
cryopreserving the combination product.
Embodiment 2
[0288] A method for producing insulin in vivo in a mammal, said
method comprising: a. obtaining an in vitro human PEC aggregate
population; b. loading the PEC aggregate population into an
implantable semi-permeable encapsulation device to create a
combination product; c. contacting the combination product with a
cryopreservative; d. cryopreserving the combination product; e.
thawing the cryopreserved combination product; f. implanting the
combination product into a mammalian host; and g. maturing the
encapsulated PEC aggregates in said device in vivo such that the
mature cell population comprises endocrine and acinar cells,
wherein at least some of the endocrine cells are insulin secreting
cells that produce insulin in response to glucose stimulation in
vivo, thereby producing insulin in vivo to the mammal.
Embodiment 3
[0289] The method of embodiment 1, wherein the cells are pancreatic
endoderm cell (PEC) aggregates.
Embodiment 4
[0290] The method of embodiment 1, wherein a cryopreservative is
added to the cells to be cryopreserved prior to loading into the
implantable semi-permeable device.
Embodiment 5
[0291] The method of embodiment 3, wherein a cryopreservative is
added to the PEC aggregates prior to loading into the implantable
semi-permeable device.
Embodiment 6
[0292] The method of embodiment 1, wherein the combination product
is shipped to the implantation site in a cryopreserved state.
Embodiment 7
[0293] The method of embodiment 1, wherein the combination product
is at a temperature range of negative 90 to negative 260 degrees
Celsius.
Embodiment 8
[0294] The method of embodiment 1, wherein the combination product
is at a temperature of negative 190 degrees Celsius.
Embodiment 9
[0295] The method of embodiment 1, wherein the cells to be
cryopreserved when thawed do not leak from the implantable
semi-impermeable device.
Embodiment 10
[0296] The method of embodiment 1, wherein the cell survival rate
is about 5%, about 10%, about 15%, about 20%, about 25%, about 30%,
about 35%, about 40%, about 45%, about 50%, about 55%, about 60%,
about 65%, about 70%, about 75%, about 80%, about 85%, about 90%,
about 95%, or greater than about 95%.
Embodiment 11
[0297] The method of embodiment 1, wherein the cell survival rate
is greater than about 50%.
Embodiment 12
[0298] The method of embodiment 1, wherein the cell survival rate
is greater than about 60%.
Embodiment 13
[0299] The method of embodiment 1, wherein the cell survival rate
is greater than about 95%.
Embodiment 14
[0300] The method of embodiment 1, wherein the device comprises at
least one loading port.
Embodiment 15
[0301] The method of embodiment 1, wherein the device comprises at
least two loading ports.
Embodiment 16
[0302] A cryopreserved human PEC aggregate population, wherein the
cell population is suitable for transplantation into a mammal.
Embodiment 17
[0303] The cell population of embodiment 16, wherein the PEC
aggregate population is capable of maturing into islet or acinar
cells in the mammal.
Embodiment 18
[0304] The cell population of embodiment 16, wherein the PEC
aggregate population is capable of maturing into beta cells which
are capable of secreting insulin in response to glucose
stimulation.
Embodiment 19
[0305] The cell population of embodiment 16, wherein the PEC
aggregate population comprises PDX1 positive PEC aggregates.
Embodiment 20
[0306] Cryopreserved PEC aggregates.
Embodiment 21
[0307] Cryopreserved PEC aggregates wherein greater than 50% of the
cells survive thawing.
Embodiment 22
[0308] Cryopreserved VC combination product.
Embodiment 23
[0309] Cryopreserved VC combination product wherein greater than
50% of the cells survive thawing.
Embodiment 24
[0310] Cells stored at room temperature in media comprising DMEM
Hi-Glucose.
Embodiment 25
[0311] Cells stored at 4.degree. C. in a media comprising static
preservation solution.
Embodiment 26
[0312] The media of embodiment 24 further comprising 1% B27
Supplement, 1% Penicillin/Streptomycin or 1% Glutamax.
Embodiment 27
[0313] The media of embodiment 24 or 25 wherein the cells are
PEC.
Embodiment 28
[0314] A method for preserving encapsulated cell, said method
comprising: a. obtaining cells to be preserved; b. loading the
cells into an implantable semi-permeable encapsulation device to
create encapsulated cells to create a combination product; c.
contacting the combination product with a preservation solution;
and d. storing the cells at room temperature.
Embodiment 29
[0315] A method for producing insulin in vivo in a mammal, said
method comprising: a. obtaining an in vitro human PEC aggregate
population; b. loading the PEC aggregate population into an
implantable semi-permeable encapsulation device to create a
combination product; c. contacting the combination product with a
preservation solution; d. storing the combination product at room
temperature; e. implanting the combination product into a mammalian
host; and f. maturing the encapsulated PEC aggregates in said
device in vivo such that the mature cell population comprises
endocrine and acinar cells, wherein at least some of the endocrine
cells are insulin secreting cells that produce insulin in response
to glucose stimulation in vivo, thereby producing insulin in vivo
to the mammal.
Embodiment 30
[0316] The method of embodiment 28 and 29 wherein the preservation
solution comprises DMEM Hi-Glucose.
Embodiment 31
[0317] The method of embodiment 28 and 29 wherein the preservation
solution is removed from the VC combination product prior to
implantation.
Embodiment 32
[0318] The method of embodiment 28, wherein the cells are
pancreatic endoderm cell (PEC) aggregates.
Embodiment 33
[0319] A method for preserving encapsulated cell, said method
comprising: a. obtaining cells to be preserved; b. loading the
cells into an implantable semi-permeable encapsulation device to
create encapsulated cells to create a combination product; c.
contacting the combination product with a preservation solution;
and d. storing the cells at 4.degree. C.
Embodiment 34
[0320] A method for producing insulin in vivo in a mammal, said
method comprising: a. obtaining an in vitro human PEC aggregate
population; b. loading the PEC aggregate population into an
implantable semi-permeable encapsulation device to create a
combination product; c. contacting the combination product with a
preservation solution; d. storing the combination product at
4.degree. C.; e. implanting the combination product into a
mammalian host; and maturing the encapsulated PEC aggregates in
said device in vivo such that the mature cell population comprises
endocrine and acinar cells, wherein at least some of the endocrine
cells are insulin secreting cells that produce insulin in response
to glucose stimulation in vivo, thereby producing insulin in vivo
to the mammal.
Embodiment 35
[0321] The method of embodiments 33 and 34 wherein the preservation
solution is removed from the VC combination product prior to
implantation.
Embodiment 36
[0322] The method of embodiment 33, wherein the cells are
pancreatic endoderm cell (PEC) aggregates.
Embodiment 37
[0323] A method for cryopreserving an encapsulated cell population,
said method comprising: obtaining a cell population to be
cryopreserved; loading the cell population into an implantable
semi-permeable encapsulation device thereby making an encapsulated
cell population; contacting the encapsulated cell population with a
cryopreservative for at least 20 minutes thereby cryopreserving the
encapsulated cell population.
Embodiment 38
[0324] A method for producing insulin in vivo in a mammal, said
method comprising: obtaining an in vitro human pancreatic cell
aggregate population; loading the pancreatic cell aggregate
population into an implantable semi-permeable encapsulation device
thereby making an encapsulated pancreatic cell population;
contacting the pancreatic cell population with a cryopreservative
for at least 20 minutes thereby; cryopreserving the encapsulated
pancreatic cell population; thawing the encapsulated pancreatic
cell population; implanting the encapsulated pancreatic cell
population into a mammalian host; and maturing the encapsulated
pancreatic cell population in vivo to form a mature cell population
comprising of endocrine and acinar cells, wherein at least some of
the endocrine cells are insulin secreting cells that produce
insulin in response to glucose stimulation in vivo, thereby
producing insulin in vivo to the mammal.
Embodiment 39
[0325] The method of embodiment 37, wherein the cell population to
be cryopreserved are PDX1 positive pancreatic endoderm cells.
Embodiment 40
[0326] The method of embodiment 39, wherein the PDX1 positive
pancreatic endoderm cells are pancreatic endoderm cells.
Embodiment 41
[0327] The method of embodiment 37, wherein the cell population be
cryopreserved are contacted with a cryopreservative prior to
loading into the device.
Embodiment 42
[0328] The method of embodiment 37, wherein the encapsulated cell
population is shipped to the implantation site in a cryopreserved
state.
Embodiment 43
[0329] The method of embodiment 37, wherein the encapsulated cell
population is at a temperature range of negative 90 to negative 260
degrees Celsius.
Embodiment 44
[0330] The method of embodiment 37, wherein the encapsulated cell
population is at a temperature of negative 190 degrees Celsius.
Embodiment 45
[0331] The method of embodiment 37, wherein the encapsulated cell
population does not leak from the device.
Embodiment 46
[0332] The method of embodiment 137, wherein the cell survival rate
is about 5%, about 10%, about 15%, about 20%, about 25%, about 30%,
about 35%, about 40%, about 45%, about 50%, about 55%, about 60%,
about 65%, about 70%, about 75%, about 80%, about 85%, about 90%,
about 95%, or greater than about 95%.
Embodiment 47
[0333] The method of embodiment 37, further comprising thawing the
encapsulated cell population, wherein the survival rate for the
thawed encapsulated cell population is greater than about 50%.
Embodiment 48
[0334] The method of embodiment 37, further comprising thawing the
encapsulated cell population, wherein the survival rate for the
thawed encapsulated cell population is greater than about 60%.
Embodiment 49
[0335] The method of embodiment 37, further comprising thawing the
encapsulated cell population, wherein the survival rate for the
thawed encapsulated cell population is greater than about 95%.
Embodiment 50
[0336] The method of embodiment 37, wherein the device comprises at
least one loading port.
Embodiment 51
[0337] The method of embodiment 37, wherein the device comprises at
least two loading ports.
Embodiment 52
[0338] A cryopreserved human PDX1 positive pancreatic endoderm
population.
Embodiment 53
[0339] The cell population of embodiment 52, wherein the PDX1
positive pancreatic endoderm population is capable of maturing into
endocrine and acinar cells in the mammalian host.
Embodiment 54
[0340] The cell population of embodiment 52, wherein the PDX1
positive pancreatic endoderm population is capable of maturing into
beta cells which are capable of secreting insulin in response to
glucose stimulation.
Embodiment 55
[0341] A cryopreserved PDX1 positive pancreatic endoderm
population.
Embodiment 56
[0342] A cryopreserved PDX1 positive pancreatic endoderm population
wherein greater than 50% of the cells survive thawing.
Embodiment 57
[0343] A method for cryopreserving an encapsulated cell population,
said method comprising: obtaining cells to be cryopreserved;
loading the cells into an implantable device thereby making
encapsulated cell population; contacting the encapsulated cell
population with a cryopreservation solution; and storing the
encapsulated cell population at room temperature.
Embodiment 58
[0344] A method for producing insulin in vivo in a mammal, said
method comprising: obtaining an in vitro human PDX1 positive
pancreatic endoderm population; loading the PDX1 positive
pancreatic endoderm population into an encapsulation device thereby
making an encapsulated cell population; contacting the encapsulated
cell population with a cryopreservation solution; storing the
encapsulated cell population at room temperature; implanting the
encapsulated cell population into a mammalian host; and maturing
the encapsulated cell population in said device in vivo to become
at least endocrine and acinar cells, wherein at least some of the
endocrine cells are insulin secreting cells that produce insulin in
response to glucose stimulation in vivo, thereby producing insulin
in vivo to the mammal.
Embodiment 59
[0345] A method for cryopreserving encapsulated cell, said method
comprising: obtaining cells to be cryopreserved; loading the cells
into an encapsulation device thereby making encapsulated cells;
contacting the encapsulated cells with a cryopreservation solution;
and storing the encapsulated cells at 4.degree. C.
Embodiment 60
[0346] A method for producing insulin in vivo in a mammal, said
method comprising: obtaining an in vitro human PDX1 positive
pancreatic endoderm population; loading the PDX1 positive
pancreatic endoderm population into an encapsulation device to
create an encapsulated cell population; contacting the encapsulated
cell population with a cryopreservation solution; storing the
encapsulated cell population at 4.degree. C.; implanting the
encapsulated cell population into a mammalian host; and maturing
the encapsulated cell population in vivo such that the mature cell
population comprises endocrine and acinar cells, wherein at least
some of the endocrine cells are insulin secreting cells that
produce insulin in response to glucose stimulation in vivo, thereby
producing insulin in vivo to the mammal.
Embodiment 61
[0347] A method for producing insulin in vivo in a mammal, said
method comprising: a. obtaining an in vitro human PDX1 positive
pancreatic endoderm population; b. loading the PDX1 positive
pancreatic endoderm population into an encapsulation device to
create an encapsulated cell population; c. contacting the
encapsulated cell population with a cryopreservation solution; d.
storing the encapsulated cell population at 4.degree. C.; e.
implanting the encapsulated cell population into a mammalian host;
and maturing the encapsulated cell population in vivo such that the
mature cell population comprises endocrine and acinar cells,
wherein at least some of the endocrine cells are insulin secreting
cells that produce insulin in response to glucose stimulation in
vivo, thereby producing insulin in vivo to the mammal.
Embodiment 62
[0348] The method of embodiments 60 and 61 wherein the
cryopreservation solution is removed from the encapsulated cell
population prior to implantation.
Embodiment 63
[0349] The method of embodiment 61, wherein the encapsulated cell
population are pancreatic endoderm cell (PEC) aggregates.
Sequence CWU 1
1
46121DNAArtificial SequenceSynthetic polynucleotide 1aagaggccat
caagcagatc a 21217DNAArtificial SequenceSynthetic polynucleotide
2caggaggcgc atccaca 17320DNAArtificial SequenceSynthetic
polynucleotide 3ctggcctgta cccctcatca 20421DNAArtificial
SequenceSynthetic polynucleotide 4cttcccgtct ttgtccaaca a
21521DNAArtificial SequenceSynthetic polynucleotide 5aagtctacca
aagctcacgc g 21615DNAArtificial SequenceSynthetic polynucleotide
6gtaggcgccg cctgc 15724DNAArtificial SequenceSynthetic
polynucleotide 7gctcatcgct ctctattctt ttgc 24821DNAArtificial
SequenceSynthetic polynucleotide 8ggttgaggcg tcatcctttc t
21918DNAArtificial SequenceSynthetic polynucleotide 9gggagcggtg
aagatgga 181022DNAArtificial SequenceSynthetic polynucleotide
10tcatgttgct cacggaggag ta 221124DNAArtificial SequenceSynthetic
polynucleotide 11aagcatttac tttgtggctg gatt 241225DNAArtificial
SequenceSynthetic polynucleotide 12tgatctggat ttctcctctg tgtct
251318DNAArtificial SequenceSynthetic polynucleotide 13cgctccgctt
agcagcat 181422DNAArtificial SequenceSynthetic polynucleotide
14gtgttgcctc tatccttccc at 221520DNAArtificial SequenceSynthetic
polynucleotide 15gaagaaggaa gccgtccaga 201620DNAArtificial
SequenceSynthetic polynucleotide 16gaccttcgag tgctgatccg
201718DNAArtificial SequenceSynthetic polynucleotide 17ggcgcagcag
aatccaga 181820DNAArtificial SequenceSynthetic polynucleotide
18nnnnnnnnnn nnnnnnnnnn 201916DNAArtificial SequenceSynthetic
polynucleotide 19caccgcgggc atgatc 162019DNAArtificial
SequenceSynthetic polynucleotide 20acttccccag gaggttcga
192120DNAArtificial SequenceSynthetic polynucleotide 21ggccttcagt
actccctgca 202221DNAArtificial SequenceSynthetic polynucleotide
22gggacttgga gcttgagtcc t 212321DNAArtificial SequenceSynthetic
polynucleotide 23gaaggtcatc atctgccatc g 212419DNAArtificial
SequenceSynthetic polynucleotide 24ggccataatc agggtcgct
192520DNAArtificial SequenceSynthetic polynucleotide 25ccccagactc
cgtcagtttc 202619DNAArtificial SequenceSynthetic polynucleotide
26tccgtctggt tgggttcag 192723DNAArtificial SequenceSynthetic
polynucleotide 27ccagaaagga tgcctcataa agg 232818DNAArtificial
SequenceSynthetic polynucleotide 28tctgcgcgcc cctagtta
182919DNAArtificial SequenceSynthetic polynucleotide 29tgggctcgag
aaggatgtg 193020DNAArtificial SequenceSynthetic polynucleotide
30gcatagtcgc tgcttgatcg 203120DNAArtificial SequenceSynthetic
polynucleotide 31ccgagtccag gatccaggta 203219DNAArtificial
SequenceSynthetic polynucleotide 32ctctgacgcc gagacttgg
193319DNAArtificial SequenceSynthetic polynucleotide 33cctcttgcaa
tgcggaaag 193419DNAArtificial SequenceSynthetic polynucleotide
34cgggaggaag gctctcact 193523DNAArtificial SequenceSynthetic
polynucleotide 35gaggagaaag tggaggtctg gtt 233621DNAArtificial
SequenceSynthetic polynucleotide 36ctctgatgag gaccgcttct g
213721DNAArtificial SequenceSynthetic polynucleotide 37acagtgccct
tcagccagac t 213825DNAArtificial SequenceSynthetic polynucleotide
38acaactactt tttcacagcc ttcgt 253923DNAArtificial SequenceSynthetic
polynucleotide 39gagaaaccca ctggagatga aca 234023DNAArtificial
SequenceSynthetic polynucleotide 40ctcatggcaa agttcttcca gaa
234119DNAArtificial SequenceSynthetic polynucleotide 41atgcaccgct
acgacatgg 194221DNAArtificial SequenceSynthetic polynucleotide
42ctcatgtagc cctgcgagtt g 214320DNAArtificial SequenceSynthetic
polynucleotide 43ctggctgtgg caaggtcttc 204420DNAArtificial
SequenceSynthetic polynucleotide 44cagccctcaa actcgcactt
204518DNAArtificial SequenceSynthetic polynucleotide 45atcgaggagc
gccacaac 184619DNAArtificial SequenceSynthetic polynucleotide
46tgctggatgg tgtcctggt 19
* * * * *