U.S. patent application number 15/147885 was filed with the patent office on 2016-08-25 for microorganism and method for the fermentative production of an organic-chemical compound.
This patent application is currently assigned to Evonik Degussa GmbH. The applicant listed for this patent is Evonik Degussa GmbH. Invention is credited to Brigitte Bathe, Wilfried Claes, Stephan Hans, Alexander Henrich, Reinhard Kramer, Alexander Reth, Gerd Seibold.
Application Number | 20160244490 15/147885 |
Document ID | / |
Family ID | 45876803 |
Filed Date | 2016-08-25 |
United States Patent
Application |
20160244490 |
Kind Code |
A1 |
Hans; Stephan ; et
al. |
August 25, 2016 |
Microorganism and Method for the Fermentative Production of an
Organic-Chemical Compound
Abstract
The invention relates to a microorganism which produces and/or
secretes an organic-chemical compound, wherein the microorganism
has increased expression, compared to the particular starting
strain, of one or more protein subunits of the ABC transporter
having the activity of a trehalose importer, said microorganism
being capable of taking up trehalose from the medium; and to a
method for the production of an organic-chemical compound, using
the microorganism according to the invention, wherein accumulation
of trehalose in the fermentation broth is reduced or avoided.
Inventors: |
Hans; Stephan; (Osnabruck,
DE) ; Bathe; Brigitte; (Salzkotten, DE) ;
Reth; Alexander; (Bielefeld, DE) ; Claes;
Wilfried; (Bielefeld, DE) ; Kramer; Reinhard;
(Julich, DE) ; Seibold; Gerd; (Koln, DE) ;
Henrich; Alexander; (Koln, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Evonik Degussa GmbH |
Essen |
|
DE |
|
|
Assignee: |
Evonik Degussa GmbH
Essen
DE
|
Family ID: |
45876803 |
Appl. No.: |
15/147885 |
Filed: |
May 5, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13438665 |
Apr 3, 2012 |
9359413 |
|
|
15147885 |
|
|
|
|
61533783 |
Sep 12, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 14/34 20130101;
C12P 13/08 20130101 |
International
Class: |
C07K 14/34 20060101
C07K014/34; C12P 13/08 20060101 C12P013/08 |
Foreign Application Data
Date |
Code |
Application Number |
Apr 4, 2011 |
DE |
10 2011 006 716.7 |
Claims
1. An isolated Corynebacterium glutamicum bacterium that has been
modified from a starting strain and which produces an L-amino acid
during fermentation, wherein: a) compared to the starting strain,
the bacterium comprises increased expression of a polynucleotide
coding for a polypeptide with an amino acid sequence that is at
least 70% identical to the amino acid sequence of SEQ ID NO:8 or
20, wherein: i) said polypeptide comprises a subunit of a protein
complex having the activity of a trehalose importer; ii) said
polypeptide has permease activity; b) said bacterium is capable of
taking up trehalose from the medium.
2. The Corynebacterium glutamicum bacterium of claim 1, wherein,
compared to the starting strain, said bacterium further comprises
increased expression of at least one additional polynucleotide
selected from the group consisting of a), b), c), d) and e),
wherein said additional polynucleotides are as follows: a) a
polynucleotide coding for a polypeptide with an amino acid sequence
that is at least 70% identical to the amino acid sequence of SEQ ID
NO:2 or 14; b) a polynucleotide coding for a polypeptide with an
amino acid sequence that is at least 70% identical to the amino
acid sequence of SEQ ID NO:4 or 16; c) a polynucleotide coding for
a polypeptide with an amino acid sequence that is at least 70%
identical to the amino acid sequence of SEQ ID NO:6 or 18; d) a
polynucleotide coding for a polypeptide with an amino acid sequence
that is at least 70% identical to the amino acid sequence of SEQ ID
NO:10 or 22; and e) a polynucleotide coding for a polypeptide with
an amino acid sequence that is at least 70% identical to the amino
acid sequence of SEQ ID NO:12 or 24.
3. The Corynebacterium glutamicum bacterium of claim 2, wherein,
compared to the starting strain, said bacterium further comprises
increased expression of at least one additional polynucleotide
selected from the group consisting of polynucleotides a), b) and
d).
4. The Corynebacterium glutamicum bacterium of claim 2, wherein,
compared to the starting strain, said bacterium further comprises
increased expression of at least one additional polynucleotide
selected from the group consisting of polynucleotides b) and
d).
5. The Corynebacterium glutamicum bacterium of claim 2, wherein,
compared to the starting strain, said bacterium further comprises
increased expression of additional polynucleotide d).
6. The Corynebacterium glutamicum bacterium of claim 2, wherein,
compared to the starting strain, said bacterium further comprises,
increased expression of all of the the additional polynucleotides
a), b) and d).
7. The Corynebacterium glutamicum bacterium of claim 2, wherein,
compared to the starting strain, said bacterium further comprises
increased expression of all of the additional polynucleotides a),
b), c), d) and e).
8. The Corynebacterium glutamicum bacterium of claim 1, wherein the
L-amino acid is selected from the group consisting of: a
proteinogenic L-amino acid; L-ornithine; and L-homoserine.
9. The Corynebacterium glutamicum bacterium of claim 1, wherein the
L-amino acid is selected from the group consisting of:
L-methionine; L-valine; L-proline; L-glutamate; and
L-isoleucine.
10. The Corynebacterium glutamicum bacterium of claim 1, wherein
the L-amino acid is L-lysine.
11. The Corynebacterium glutamicum bacterium of claim 1, wherein
expression of said polynucleotide coding for an amino acid sequence
that is at least 70% identical to the amino acid sequence of SEQ ID
NO:8 or 20 is increased by one or more measures selected from the
following group consisting of: a) using a promoter to express the
sequence at least 70% identical to the amino acid sequence of SEQ
ID NO:8 or 20, wherein said promoter stronger in said bacterium
than in said starting strain; b) increasing the copy number of said
polynucleotide by inserting the polynucleotide into a plasmid with
increased copy number in said bacterium and/or by integrating at
least one copy of said polynucleotide into the chromosome of said
bacterium; c) expressing the sequence coding for said polypeptide
with a ribosome binding site which is stronger in the bacterium
than in the starting strain; d) optimizing the codon usage of said
polynucleotide in said bacterium compared to the starting strain;
e) using a sequence that results in a reduction of secondary
structures in the mRNA transcribed; f) using a sequence that
results in an elimination of RNA polymerase terminator sequences in
transcribed mRNA; g) using mRNA-stabilizing sequences in the mRNA
transcribed from said polynucleotide.
12. A method for the fermentative production of an L-amino acid,
comprising the steps: a) culturing the bacterium of claim 1 in a
medium to produce a fermentation broth; and b) accumulating the
L-amino acid in the fermentation broth of a).
13. The method of claim 12, wherein the accumulation of trehalose
in the fermentation broth is reduced.
14. The method of claim 12, wherein, compared to said starting
strain, the bacterium used for culturing comprises increased
expression of at least one additional polynucleotide selected from
the group consisting of a), b), c), d) and e), wherein said
additional polynucleotides are as follows: a) a polynucleotide
coding for a polypeptide with an amino acid sequence that is at
least 70% identical to the amino acid sequence of SEQ ID NO:2 or
14; b) a polynucleotide coding for a polypeptide with an amino acid
sequence that is at least 70% identical to the amino acid sequence
of SEQ ID NO:4 or 16; c) a polynucleotide coding for a polypeptide
with an amino acid sequence that is at least 70% identical to the
amino acid sequence of SEQ ID NO:6 or 18; d) a polynucleotide
coding for a polypeptide with an amino acid sequence that is at
least 70% identical to the amino acid sequence of SEQ ID NO:10 or
22; and e) a polynucleotide coding for a polypeptide with an amino
acid sequence that is at least 70% identical to the amino acid
sequence of SEQ ID NO:12 or 24.
15. The method of claim 14, wherein, compared to the starting
strain, said bacterium further comprises increased expression of at
least one additional polynucleotide selected from the group
consisting of polynucleotides a), b) and d).
16. The method of claim 14, wherein, compared to the starting
strain, said bacterium further comprises increased expression of at
least one additional polynucleotide selected from the group
consisting of of polynucleotides b) and d).
17. The method of claim 14, wherein, compared to the starting
strain, said bacterium further comprises increased expression of
additional polynucleotide d).
18. The method of claim 14, wherein, compared to the starting
strain, said bacterium further comprises, increased expression of
all of the the additional polynucleotides a), b) and d).
19. The method of claim 14, wherein, compared to the starting
strain, said bacterium further comprises, increased expression of
all of the the additional polynucleotides a), b), d) and e).
20. The method of claim 14, wherein, compared to the starting
strain, said bacterium further comprises, increased expression of
all of the additional polynucleotides a), b), c), d) and e).
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S. Ser. No.
13/438,665, filed on Apr. 3, 2012, which claims the benefit of U.S.
provisional application 61/533,783 filed on Sep. 12, 2011 and
priority to German Application, DE 10 2011 006 716.7 filed on Apr.
4, 2011.
FIELD OF THE INVENTION
[0002] The invention relates to a microorganism which produces
and/or secretes an organic-chemical compound, said microorganism
having increased expression of a trehalose importer, and to a
method of producing an organic-chemical compound by using the
microorganism according to the invention.
BACKGROUND OF THE INVENTION
[0003] L-Amino acids are used in human medicine, in the
pharmaceutical industry, in the food industry and very particularly
in animal nutrition. It is known that L-amino acids such as, for
example, L-lysine, are produced by fermentation of strains of
coryneform bacteria, in particular Corynebacterium glutamicum, or
of strains of the Enterobacteriaceae family, in particular
Escherichia coli. Because of the great economic importance, work is
continually being done on improving the production methods. Method
improvements may relate to fermentation technology measures such
as, for example, stirring and supplying oxygen, or to the
composition of the nutrient media, for example the sugar
concentration during fermentation, or to the working-up to product
form by, for example, ion exchange chromatography or to the
intrinsic performance properties of the microorganism itself.
[0004] The methods used for improving the performance properties of
these microorganisms are those of mutagenesis, selection and choice
of mutants. The strains obtained in this way are resistant to
anti-metabolites or are auxotrophic for metabolites of regulatory
importance, and produce L-amino acids. A known anti-metabolite is
the lysine analogue S-(2-aminoethyl)-L-cysteine (AEC).
[0005] Methods of recombinant DNA technology have likewise been
used for some years for strain improvement of L-amino
acid-producing strains of the genus Corynebacterium, in particular
Corynebacterium glutamicum, or of the genus Escherichia, in
particular Escherichia coli, by modifying, i.e. enhancing or
attenuating, individual amino acid biosynthesis genes and
investigating the effect on amino acid production.
[0006] The nucleotide sequences of the chromosomes of numerous
bacteria have been disclosed. The nucleotide sequence of the
Corynebacterium glutamicum ATCC13032 genome is described in Ikeda
and Nakagawa (Applied Microbiology and Biotechnology 62:99-109
(2003)), in EP 1 108 790 and in Kalinowski et al. (J. Biotechnol.
104(1-3), (2003)). The nucleotide sequence of the Corynebacterium
glutamicum R genome is described in Yukawa et al. (Microbiology
153(4)1042-1058 (2007)). The nucleotide sequence of the
Corynebacterium efficiens genome is described in Nishio et al.
(Genome Research 13(7):1572-1579 (2003)). The nucleotide sequence
of the Corynebacterium diphteriae NCTC 13129 genome has been
described by Cerdeno-Tarraga et al. (Nucl. Ac. Res. 31
(22):6516-6523 (2003)). The nucleotide sequence of the
Corynebacterium jeikeum genome has been described by Tauch et al.
(J. Bacteriol. 187(13):4671-4682 (2005)).
[0007] A review of various aspects of the fermentative production
of L-amino acids can be found in R. Faurie and J. Thommel in
Advances in Biochemical Engineering Biotechnology, volume 79
(Springer-Verlag, Berlin, Heidelberg Germany (2003)).
[0008] Significant amounts of secreted trehalose are found in the
supernatant of industrial fermentations of C. glutamicum. This
externally accumulated trehalose is not metabolically recycled by
the cells. Said externally accumulated trehalose therefore
represents a significant loss in industrial fermentations, both in
respect of maximally achievable product formation and with regard
to the biomass concentration reached in the fermenter.
[0009] Making use of the externally accumulated trehalose is the
main goal desired. Achieving this goal would have a plurality of
possible positive consequences: (1) utilization of substrate carbon
which otherwise remains unused at the end of the fermentation, (2)
increase in the biomass achievable in the fermentation, (3)
increased product yield in biotechnological production processes,
e.g. in amino acid production, (4) avoidance of unwanted
contamination in the product supernatant at the end of the
fermentation.
SUMMARY OF THE INVENTION
[0010] The present invention provides a microorganism which
produces and/or secretes an organic-chemical compound. The
microorganism has increased expression, compared to the particular
starting strain, of one or more protein subunits of the ABC
transporter having the activity of a trehalose importer, and is
capable of taking up trehalose from the medium.
[0011] The invention furthermore provides a method for the
fermentative production of an organic-chemical compound, comprising
the steps: [0012] a) culturing the above-described microorganism
according to the present invention in a suitable medium, resulting
in a fermentation broth, and [0013] b) accumulating the
organic-chemical compound in the fermentation broth of a);
[0014] wherein accumulation of trehalose in the fermentation broth
is reduced or avoided.
[0015] Preference is given to reducing the accumulation of
trehalose in the fermentation broth by 50% or more, by 70% or more,
by 80% or more, by 90% or more, by 95% or more, by 98% or more, by
99% or more, and most preferably by 99.5% or more, compared to the
particular starting strain of the microorganism.
[0016] The present invention is advantageous in that (1) substrate
carbon in the form of trehalose which otherwise remains unused in
the fermentation broth at the end of the fermentation is utilized;
(2) the biomass achievable in the fermentation is increased; (3)
the product yield in biotechnological production processes, e.g.
amino acid production, is increased and (4) unwanted contamination
in the product supernatant at the end of the fermentation is
avoided.
[0017] Surprisingly, a trehalose uptake system has been identified
for C. glutamicum. Enhanced expression of all genes of the operon
encoding the trehalose import system result in an increase in the
target product (the organic-chemical compound) with the use of a
corresponding producer strain. Surprisingly, a corresponding
trehalose uptake has also been found when only one of the subunits
(e.g. permease subunit) is expressed. The present invention thus
provides microorganisms (producer strains) whose cells take up the
externally accumulated trehalose through an active transport system
in the plasma membrane. The fact that C. glutamicum has the
metabolic capacity of metabolizing trehalose in the cytoplasm gives
rise to the above advantages of the present invention. Preferably,
the microorganism is capable of reducing, compared to the
particular starting strain of the microorganism, or, in particular,
of avoiding, accumulation of trehalose in the medium (culturing
medium).
[0018] In a preferred embodiment of the microorganism, the ABC
transporter having the activity of a trehalose importer is derived
from Corynebacterium glutamicum. The protein subunits of the ABC
transporter having the activity of a trehalose importer are as
follows: integral membrane protein (permease), ATP-binding and
-hydrolyzing (ATPase) protein and periplasmic (or lipoprotein)
substrate-binding protein. The composition of an ABC transporter is
as follows: two permeases, two ATPases and one periplasmic (or
lipoprotein) substrate-binding protein. The two permeases and the
ATPases may in each case have different amino acid sequences.
[0019] A preferred embodiment of the microorganism according to the
present invention has increased expression, compared to the
particular starting strain, of all protein subunits of the ABC
transporter having the activity of a trehalose importer. This means
that preferentially the permease, the ATPase and the periplasmic
subunit of the ABC transporter having the activity of a trehalose
importer have increased expression, i.e. are overexpressed.
[0020] In an alternative embodiment, the microorganism according to
the present invention has increased expression, compared to the
particular starting strain, of one or more protein subunits of the
ABC transporter having the activity of a trehalose importer.
Moreover, a gene of the operon coding for the subunits of the ABC
transporter having the activity of a trehalose importer, which
(gene) does not necessarily code for a subunit of the ABC
transporter itself, may have increased expression.
[0021] Preference is furthermore given to a microorganism having,
compared to the particular starting strain, increased expression of
at least one polynucleotide selected from the group consisting of
a) to 0: [0022] a) a polynucleotide coding for a polypeptide with
an amino acid sequence that is at least 70% identical to the amino
acid sequence depicted in SEQ ID NO:2 or 14; [0023] b) a
polynucleotide coding for a polypeptide with an amino acid sequence
that is at least 70% identical to the amino acid sequence depicted
in SEQ ID NO:4 or 16; [0024] c) a polynucleotide coding for a
polypeptide with an amino acid sequence that is at least 70%
identical to the amino acid sequence depicted in SEQ ID NO:6 or 18;
[0025] d) a polynucleotide coding for a polypeptide with an amino
acid sequence that is at least 70% identical to the amino acid
sequence depicted in SEQ ID NO:8 or 20; [0026] e) a polynucleotide
coding for a polypeptide with an amino acid sequence that is at
least 70% identical to the amino acid sequence depicted in SEQ ID
NO:10 or 22; [0027] f) a polynucleotide coding for a polypeptide
with an amino acid sequence that is at least 70% identical to the
amino acid sequence depicted in SEQ ID NO:12 or 24.
[0028] Preference is furthermore given to the microorganism having,
compared to the particular starting strain, increased expression of
at least one polynucleotide selected from the group consisting of
a), b), d), e): [0029] a) a polynucleotide coding for a polypeptide
with an amino acid sequence that is at least 70% identical to the
amino acid sequence depicted in SEQ ID NO:2 or 14; [0030] b) a
polynucleotide coding for a polypeptide with an amino acid sequence
that is at least 70% identical to the amino acid sequence depicted
in SEQ ID NO:4 or 16; [0031] d) a polynucleotide coding for a
polypeptide with an amino acid sequence that is at least 70%
identical to the amino acid sequence depicted in SEQ ID NO:8 or 20;
[0032] e) a polynucleotide coding for a polypeptide with an amino
acid sequence that is at least 70% identical to the amino acid
sequence depicted in SEQ ID NO:10 or 22.
[0033] In a further preferred embodiment, the microorganism has,
compared to the particular starting strain, increased expression of
at least one polynucleotide selected from the group consisting of
b), d) and e): [0034] b) a polynucleotide coding for a polypeptide
with an amino acid sequence that is at least 70% identical to the
amino acid sequence depicted in SEQ ID NO:4 or 16; [0035] d) a
polynucleotide coding for a polypeptide with an amino acid sequence
that is at least 70% identical to the amino acid sequence depicted
in SEQ ID NO:8 or 20; [0036] e) a polynucleotide coding for a
polypeptide with an amino acid sequence that is at least 70%
identical to the amino acid sequence depicted in SEQ ID NO:10 or
22.
[0037] Particularly preferably, the microorganism has, compared to
the particular starting strain, increased expression of the
following polynucleotides: [0038] d) a polynucleotide coding for a
polypeptide with an amino acid sequence that is at least 70%
identical to the amino acid sequence depicted in SEQ ID NO:8 or 20;
and/or [0039] e) a polynucleotide coding for a polypeptide with an
amino acid sequence that is at least 70% identical to the amino
acid sequence depicted in SEQ ID NO:10 or 22.
[0040] A further, preferred embodiment of the microorganism has,
compared to the particular starting strain, increased expression of
the polynucleotides a) and b): [0041] a) a polynucleotide coding
for a polypeptide with an amino acid sequence that is at least 70%
identical to the amino acid sequence depicted in SEQ ID NO:2 or 14;
[0042] b) a polynucleotide coding for a polypeptide with an amino
acid sequence that is at least 70% identical to the amino acid
sequence depicted in SEQ ID NO:4 or 16;
[0043] and of the polynucleotide d) and/or e) [0044] d) a
polynucleotide coding for a polypeptide with an amino acid sequence
that is at least 70% identical to the amino acid sequence depicted
in SEQ ID NO:8 or 20; [0045] e) a polynucleotide coding for a
polypeptide with an amino acid sequence that is at least 70%
identical to the amino acid sequence depicted in SEQ ID NO:10 or
22.
[0046] Preference is furthermore given to a microorganism having,
compared to the particular starting strain, increased expression of
the polynucleotides a), b) c), d) and e), and, where appropriate,
f).
[0047] An organic-chemical compound means for the purposes of the
invention a vitamin such as, for example, thiamine (vitamin B1),
riboflavin (vitamin B2), cyanocobalamin (vitamin B12), folic acid
(vitamin M), tocopherol (vitamin E) or nicotinic acid/nicotinamide,
a nucleoside or nucleotide such as, for example,
S-adenosyl-methionine, inosine 5'-monophosphoric acid and guanosine
5'-monophosphoric acid, L-amino acids, or else an amine such as
cadaverin, for example. Preference is given to producing L-amino
acids and products containing them.
[0048] The organic-chemical compound produced and/or secreted by
the microorganism according to the invention is preferably selected
from the group consisting of vitamin, nucleoside or nucleotide,
L-amino acids and amine.
[0049] The term "L-amino acid" includes the proteinogenic amino
acids and also L-ornithine and L-homoserine. Proteinogenic L-amino
acids are to be understood to mean the L-amino acids present in
natural proteins, that is in proteins of microorganisms, plants,
animals and humans. Proteinogenic amino acids comprise L-aspartic
acid, L-asparagine, L-threonine, L-serine, L-glutamic acid,
L-glutamine, L-glycine, L-alanine, L-cysteine, L-valine,
L-methionine, L-isoleucine, L-leucine, L-tyrosine, L-phenylalanine,
L-histidine, L-lysine, L-tryptophan, L-arginine, L-proline and in
some cases L-selenocysteine and L-pyrrolysine.
[0050] The organic-chemical compound is particularly preferably
selected from the group consisting of proteinogenic L-amino acid,
L-ornithine and L-homoserine. Particular preference is given to the
proteinogenic L-amino acid being selected from the group consisting
of L-lysine, L-methionine, L-valine, L-proline, L-glutamate and
L-isoleucine, in particular L-lysine.
[0051] The term amino acids or L-amino acids, where mentioned
herein, also comprises their salts, for example lysine
monohydrochloride or lysine sulphate in the case of the amino acid
L-lysine.
[0052] The microorganism is preferably selected from the group
consisting of bacteria, yeast and fungi, particularly preferably
among the bacteria from the group consisting of the genus
Corynebacterium and the bacteria of the Enterobacteriaceae family,
with very particular preference being given to the species
Corynebacterium glutamicum.
[0053] In a further, preferred embodiment, expression of the
polynucleotide coding for a protein subunit of the ABC transporter
having the activity of a trehalose importer is increased by one or
more measures selected from the following group: [0054] a)
expression of the gene is under the control of a promoter which is
stronger in the microorganism used for the method than the original
promoter of said gene; [0055] b) increasing the copy number of the
gene coding for a polypeptide having the activity of a trehalose
importer; preferably by inserting said gene into plasmids with
increased copy number and/or by integrating at least one copy of
said gene into the chromosome of said microorganism; [0056] c) the
gene is expressed using a ribosome binding site which is stronger
in the microorganism used for the method than the original ribosome
binding site of said gene; [0057] d) the gene is expressed with
optimization of the codon usage of the microorganism used for the
method; [0058] e) the gene is expressed with reduction of mRNA
secondary structures in the mRNA transcribed from said gene; [0059]
f) the gene is expressed with elimination of RNA polymerase
terminator sequences in the mRNA transcribed from said gene; [0060]
g) the gene is expressed with use of mRNA-stabilizing sequences in
the mRNA transcribed from said gene.
[0061] The above measures for increasing expression may be combined
in a suitable manner. Preference is given to increasing expression
of the polynucleotide coding for a protein subunit of the ABC
transporter having the activity of a trehalose importer by
combining at least two of the measures selected from the group
consisting of a), b) and c), particularly preferably by combining
measures a) and b).
[0062] As mentioned above, the present invention also relates to a
method for the fermentative production of an organic-chemical
compound, comprising the steps: [0063] a) culturing the
above-described microorganism according to the present invention in
a suitable medium, resulting in a fermentation broth, and [0064] b)
accumulating the organic-chemical compound in the fermentation
broth of a);
[0065] wherein accumulation of trehalose in the fermentation broth
is reduced or avoided.
[0066] Preference is given to reducing the accumulation of
trehalose in the fermentation broth by 50% or more, by 70% or more,
by 80% or more, by 90% or more, by 95% or more, by 98% or more, by
99% or more, and most preferably by 99.5% or more, compared to the
particular starting strain of the microorganism.
[0067] In a preferred method, the microorganism used for culturing
has, compared to the particular starting strain, increased
expression of one or more polynucleotides according to one of the
following definitions I to VIII: [0068] I: increased expression,
compared to the particular starting strain, of a polynucleotide
selected from the group consisting of a) to 0: [0069] a) a
polynucleotide coding for a polypeptide with an amino acid sequence
that is at least 70% identical to the amino acid sequence depicted
in SEQ ID NO:2 or 14; [0070] b) a polynucleotide coding for a
polypeptide with an amino acid sequence that is at least 70%
identical to the amino acid sequence depicted in SEQ ID NO:4 or 16;
[0071] c) a polynucleotide coding for a polypeptide with an amino
acid sequence that is at least 70% identical to the amino acid
sequence depicted in SEQ ID NO:6 or 18; [0072] d) a polynucleotide
coding for a polypeptide with an amino acid sequence that is at
least 70% identical to the amino acid sequence depicted in SEQ ID
NO:8 or 20; [0073] e) a polynucleotide coding for a polypeptide
with an amino acid sequence that is at least 70% identical to the
amino acid sequence depicted in SEQ ID NO:10 or 22; [0074] f) a
polynucleotide coding for a polypeptide with an amino acid sequence
that is at least 70% identical to the amino acid sequence depicted
in SEQ ID NO:12 or 24; [0075] II: increased expression, compared to
the particular starting strain, of a polynucleotide selected from
the group consisting of a), b), d) and e); [0076] III: increased
expression, compared to the particular starting strain, of a
polynucleotide selected from the group consisting of b), d) and e);
[0077] IV: increased expression, compared to the particular
starting strain, of the polynucleotide d) and/or e); [0078] V:
increased expression, compared to the particular starting strain,
of any polynucleotides a), b), d) and e); [0079] VI: increased
expression, compared to the particular starting strain, of any
polynucleotides a), b), d); [0080] VII: increased expression,
compared to the particular starting strain, of any polynucleotides
a), b), e); [0081] VIII: increased expression, compared to the
particular starting strain, of any polynucleotides a) to e) and,
where appropriate, f).
[0082] Preference is given to producing from the fermentation broth
a product in liquid or solid form.
BRIEF DESCRIPTION OF THE DRAWINGS
[0083] FIG. 1 depicts the arrangement of open reading frames cg0835
to cg0830. The reading frames code for the following putative
proteins: cg0835: ATPase; cg0834 periplasmic substrate-binding
protein; cg0832: permease subunit; cg0831 permease subunit.
[0084] FIG. 2 is a schematic representation of expression construct
pXMJ19-cg0831. Table 2 below summarizes the abbreviations and names
used and also the meaning thereof. The base pair numbers indicated
are approximations obtained within the limits of reproducibility of
measurements.
TABLE-US-00001 TABLE 2 cat chloramphenicol resistance gene lacI
coding for Lac repressor Ptac tac promoter oriCg origin of
Corynebacterium glutamicum plasmid pBL1 ori pUC origin of
Escherichia coli plasmid pUC TrrnB rrnB terminator cg0831 coding
for permease subunit cg0832 coding for permease subunit cg0833
coding for unknown protein cg0834 coding for periplasmic
substrate-binding protein cg0835 coding for ATPase
[0085] FIG. 3 is a schematic representation of plasmid
pK18mobsacB_Pgap_cg0832 used for functionally linking ORF cg0832 to
the Pgap promoter. Table 3 below summarizes the abbreviations and
names used and also the meaning thereof. The abbreviations and
names used have the following meanings. The base pair numbers
indicated are approximations obtained within the limits of
reproducibility of measurements.
TABLE-US-00002 [0086] TABLE 3 Kan: kanamycin resistance gene NruI
cleavage site of restriction enzyme NruI HindIII cleavage site of
restriction enzyme HindIII ScaI cleavage site of restriction enzyme
ScaI XbaI cleavage site of restriction enzyme XbaI Pgap_cg0832 DNA
cassette for establishing functional linkage of ORF cg0832 and the
Pgap promoter sacB: sacB-gene RP4-mob: mob region containing the
origin of replication for transfer (oriT) oriV: origin of
replication V
DETAILED DESCRIPTION OF THE INVENTION
[0087] As mentioned above, the term microorganism comprises
bacteria, yeasts and fungi. Among the bacteria, mention may be made
in particular of the genus Corynebacterium and of bacteria of the
Enterobacteriaceae family.
[0088] Within the genus Corynebacterium, preference is given to
strains based on the following species: [0089] Corynebacterium
efficiens such as, for example, type strain DSM44549; [0090]
Corynebacterium glutamicum such as, for example, type strain
ATCC13032 or strain R; and [0091] Corynebacterium ammoniagenes such
as, for example, strain ATCC6871;
[0092] with the species Corynebacterium glutamicum being very
particularly preferred.
[0093] Some representatives of the species Corynebacterium
glutamicum are known in the prior art also by different names.
These include, for example:
[0094] strain ATCC13870, referred to as Corynebacterium
acetoacidophilum;
[0095] strain DSM20137, referred to as Corynebacterium ilium;
[0096] strain ATCC17965, referred to as Corynebacterium
melassecola;
[0097] strain ATCC14067, referred to as Brevibacterium flavum;
[0098] strain ATCC13869, referred to as Brevibacterium
lactofermentum; and
[0099] strain ATCC14020, referred to as Brevibacterium
divaricatum.
[0100] The term "Micrococcus glutamicus" has likewise been in use
for Corynebacterium glutamicum. Some representatives of the species
Corynebacterium efficiens have also been referred to as
Corynebacterium thermoaminogenes in the prior art, for example the
strain FERM BP-1539.
[0101] The microorganisms or strains employed for the measures of
overexpressing the trehalose importer (starting strains) preferably
already have the ability to concentrate the desired L-amino acids
in the cell or to secrete them into the surrounding nutrient medium
and accumulate them there. The expression "to produce" is also used
for this hereinbelow.
[0102] More specifically, the strains employed for the measures of
overexpression have the ability to concentrate in the cell or
accumulate in the nutrient medium .gtoreq.(at least) .gtoreq.0.10
g/l, 0.25 g/l, .gtoreq.0.5 g/l, .gtoreq.1.0 g/l, .gtoreq.1.5 g/l,
.gtoreq.2.0 g/l, .gtoreq.4 g/l or .gtoreq.10 g/l of the desired
compound within .ltoreq.(no more than) 120 hours, .ltoreq.96 hours,
.ltoreq.48 hours, .ltoreq.36 hours, .ltoreq.24 hours or .ltoreq.12
hours. The starting strains are preferably strains produced by
mutagenesis and selection, by recombinant DNA technology or by a
combination of both methods.
[0103] A person skilled in the art understands that a microorganism
suitable for the measures of the invention can also be obtained by
firstly overexpressing a trehalose importer in a wild strain, for
example in the Corynebacterium glutamicum type strain ATCC 13032 or
in the strain ATCC 14067, and then, by means of further genetic
measures described in the prior art, causing the microorganism to
produce the desired L-amino acid(s). Transforming the wild type
only with the polynucleotide mentioned does not constitute an
inventive measure.
[0104] Examples of strains of the species Corynebacterium
glutamicum which secrete or produce L-lysine are: [0105]
Corynebacterium glutamicum MH20-22B (=DSM16835) described in
Menkel, et al. (Applied and Environmental
Microbiology:55(3):684-688 (1989)) and deposited as DSM16835;
[0106] Corynebacterium glutamicum DM1729 described in Georgi, et
al. (Metabolic Engineering 7:291-301 (2005)) and in EP 1 717 616 A2
and deposited as DSM17576; [0107] Corynebacterium glutamicum
DSM13994 described in U.S. Pat. No. 6,783,967; and [0108]
Corynebacterium glutamicum DM1933 described in Blombach, et al.
(Appl. Environ. Microbiol. 75(2):419-27 (January 2009).
[0109] An example of a strain of the species Corynebacterium
efficiens which secretes or produces L-lysine is: Corynebacterium
thermoaminogenes AJ12521 (=FERM BP-3304) described in U.S. Pat. No.
5,250,423.
[0110] L-Lysine-producing microorganisms typically have a
feedback-resistant or desensitized aspartate kinase.
Feedback-resistant aspartate kinases mean aspartate kinases (LysC)
which, by comparison with the wild form (wild type), show less
sensitivity to inhibition by mixtures of lysine and threonine or
mixtures of AEC (aminoethylcysteine) and threonine or lysine alone
or AEC alone. The genes or alleles coding for these aspartate
kinases which are desensitized by comparison with the wild type are
also referred to as lysC.sup.FBR alleles. The suitable wild type in
the case of aspartate kinases of the species Corynebacterium
glutamicum is the strain ATCC13032. Numerous lysC.sup.FBR alleles
coding for aspartate kinase variants which have amino acid
substitutions by comparison with the wild-type protein are
described in the prior art. The lysC gene in bacteria of the genus
Corynebacterium is also referred to as ask gene. The aspartate
kinase encoded by the lysC gene in Enterobacteriaceae is also
referred to as aspartokinase III.
[0111] An extensive list containing information about the amino
acid substitutions in the Corynebacterium glutamicum aspartate
kinase protein that result in desensitization is included inter
alia in WO2009141330. Preference is given to aspartate kinase
variants carrying amino acid substitutions selected from the group
consisting of: L-isoleucine for L-threonine at position 380 of the
amino acid sequence and optionally L-phenylalanine for L-serine at
position 381, L-isoleucine for L-threonine at position 311 and
L-threonine for L-alanine at position 279.
[0112] An extensive list containing information about the amino
acid substitutions in the Escherichia coli aspartate kinase III
protein that result in desensitization to inhibition by L-lysine is
included inter alia in EP 0 834 559 A1 on page 3 (lines 29 to 41).
Preference is given to an aspartate kinase variant containing
L-aspartic acid instead of glycine at position 323 of the amino
acid sequence and/or L-isoleucine instead of L-methionine at
position 318.
[0113] An example of a strain of the species Corynebacterium
glutamicum which secretes or produces L-methionine is
Corynebacterium glutamicum DSM 17322 described in WO
2007/011939.
[0114] Examples of known representatives of coryneform bacterial
strains that produce or secrete L-tryptophan are: [0115]
Corynebacterium glutamicum K76 (=Ferm BP-1847) described in U.S.
Pat. No. 5,563,052; [0116] Corynebacterium glutamicum BPS13 (=Ferm
BP-1777) described in U.S. Pat. No. 5,605,818; and [0117]
Corynebacterium glutamicum Ferm BP-3055 described in U.S. Pat. No.
5,235,940.
[0118] Examples of known representatives of coryneform bacterial
strains that produce or secrete L-valine are: [0119] Brevibacterium
lactofermentum FERM BP-1763 described in U.S. Pat. No. 5,188,948;
[0120] Brevibacterium lactofermentum FERM BP-3007 described in U.S.
Pat. No. 5,521,074; [0121] Corynebacterium glutamicum FERM BP-3006
described in U.S. Pat. No. 5,521,074; and [0122] Corynebacterium
glutamicum FERM BP-1764 described in U.S. Pat. No. 5,188,948.
[0123] Examples of known representatives of coryneform bacterial
strains that produce or secrete L-isoleucine are: [0124]
Brevibacterium flavum FERM BP-760 described in U.S. Pat. No.
4,656,135; [0125] Brevibacterium flavum FERM BP-2215 described in
U.S. Pat. No. 5,294,547; and [0126] Corynebacterium glutamicum FERM
BP-758 described in U.S. Pat. No. 4,656,135.
[0127] Examples of known representatives of coryneform bacterial
strains that produce or secrete L-homoserine are: [0128]
Micrococcus glutamicus ATCC 14296 described in U.S. Pat. No.
3,189,526; and [0129] Micrococcus glutamicus ATCC 14297 described
in U.S. Pat. No. 3,189,526.
[0130] Cadaverine-producing or -secreting microorganisms are
described, for example, in WO 2007/113127.
[0131] An ABC transporter having the activity of a trehalose
importer means a protein or a protein complex with multiple
subunits which catalyzes the transport of trehalose from the
surrounding area into the cell of the microorganism in
question.
[0132] ABC transporters constitute one of the largest families of
membrane proteins, a common structural element of which is an
ATP-binding cassette and which actively transport specific
substrates across a cellular membrane. The energy needed for
transporting the substrates of ABC transporters against a
concentration gradient is produced by binding and hydrolysis of ATP
on the ATPase unit.
[0133] The structure of a prokaryotic ABC transporter normally
consists of three parts: two integral membrane proteins (permease),
each one having from five to seven transmembrane segments, two
additional proteins which bind and hydrolyse ATP (ATPase), and a
periplasmic substrate-binding protein (or membrane-anchored
lipoprotein). Many of the genes for said three parts form operons.
ABC transporters thus belong firstly to the primarily active
transporters and secondly to the membrane-bound ATPases.
[0134] Public databases such as, for example, the UniProtKB
(Universal Protein Resource Knowledgebase) database contain
descriptions of ABC transporters of very different organisms. The
UniProtKB database is maintained by the UniProt consortium which
includes the European Bioinformatics Institute (EBI, Wellcome
Trust, Hinxton Cambridge, United Kingdom), the Swiss Institute of
Bioinformatics (SIB, Centre Medical Universitaire, Geneva,
Switzerland) and the Protein Information Resource (PIR, Georgetown
University, Washington, D.C., US).
[0135] The genes for a trehalose importer may be isolated from the
organisms with the aid of the polymerase chain reaction (PCR) using
suitable primers. Instructions can be found inter alia in the
laboratory manual "PCR" by Newton and Graham (Spektrum Akademischer
Verlag, Heidelberg, Germany, 1994) and in WO 2006/100211, pages 14
to 17.
[0136] The measures of the invention may make use of the genes of
the trehalose importer from corynebacteria. Preference is given to
using genes coding for polypeptides which have trehalose importer
activity and whose amino acid sequence is .gtoreq.(at least)
.gtoreq.50% .gtoreq.60% .gtoreq.70% .gtoreq.80% .gtoreq.90%
.gtoreq.92% .gtoreq.94% .gtoreq.96% .gtoreq.97% .gtoreq.98%
.gtoreq.99%, identical to the amino acid sequence selected from SEQ
ID NO: 2, 4, 6, 8, 10 and, where appropriate, 12, or 14, 16, 18,
20, 22, 24. In the course of the studies resulting in the present
invention, the operon coding for the trehalose importer of
Corynebacterium glutamicum was identified. The operon encoding the
trehalose importer in Corynebacterium glutamicum has multiple
reading frames or genes.
[0137] Table 1 summarizes the information regarding the reading
frames of the operon coding for the Corynebacterium glutamicum
trehalose importer.
TABLE-US-00003 TABLE 1 The genes/reading frames of the operon
coding for the Corynebacterium glutamicum trehalose importer Name
of the Length (number reading frame of amino acid SEQ in the operon
coding for residues) ID NO: cg0835 ATPase 332 2 (msik2) cg0834
periplasmic substrate- 424 4 binding protein cg0833 unknown 151 6
cg0832 permease 344 8 cg0831 permease 278 10 cg0830 hypothetical
reading 74 12 frame
[0138] The genomic arrangement of the reading frames is depicted in
FIG. 1, and the sequence of the region is listed under SEQ ID
NO:25.
[0139] From a chemical point of view, a gene is a polynucleotide. A
polynucleotide encoding a protein/polypeptide is used herein
synonymously with the term "gene".
[0140] A preferred embodiment of the microorganism overexpresses
one or more gene(s) coding for one or more polypeptide(s) selected
from a) to 0 below:
[0141] a) [0142] i) a polypeptide consisting of or comprising the
amino acid sequence depicted in SEQ ID NO: 2; [0143] ii) a
polypeptide with an amino acid sequence that is at least 70%
identical to the amino acid sequence of i), said polypeptide being
a subunit of a protein complex having the activity of a trehalose
importer; [0144] iii) a polypeptide having an amino acid sequence
containing a deletion, substitution, insertion and/or addition of
from 1 to 66, 1 to 33, 1 to 17, 1 to 7, amino acid residues with
respect to the amino acid sequence depicted in SEQ ID NO: 2, said
polypeptide being a subunit of a protein complex having the
activity of a trehalose importer;
[0145] b) [0146] i) a polypeptide consisting of or comprising the
amino acid sequence depicted in SEQ ID NO: 4; [0147] ii) a
polypeptide with an amino acid sequence that is at least 70%
identical to the amino acid sequence of i), said polypeptide being
a subunit of a protein complex having the activity of a trehalose
importer; [0148] iii) a polypeptide having an amino acid sequence
containing a deletion, substitution, insertion and/or addition of
from 1 to 85, 1 to 42, 1 to 21, 1 to 9, amino acid residues with
respect to the amino acid sequence depicted in SEQ ID NO: 4, said
polypeptide being a subunit of a protein complex having the
activity of a trehalose importer;
[0149] c) [0150] i) a polypeptide consisting of or comprising the
amino acid sequence depicted in SEQ ID NO: 6; [0151] ii) a
polypeptide with an amino acid sequence that is at least 70%
identical to the amino acid sequence of i), said polypeptide being
a subunit of a protein complex having the activity of a trehalose
importer; [0152] iii) a polypeptide having an amino acid sequence
containing a deletion, substitution, insertion and/or addition of
from 1 to 30, 1 to 15, 1 to 6, 1 to 3, amino acid residues with
respect to the amino acid sequence depicted in SEQ ID NO: 6, said
polypeptide being a subunit of a protein complex having the
activity of a trehalose importer;
[0153] d) [0154] i) a polypeptide consisting of or comprising the
amino acid sequence depicted in SEQ ID NO: 8; [0155] ii) a
polypeptide with an amino acid sequence that is at least 70%
identical to the amino acid sequence of i), said polypeptide being
a subunit of a protein complex having the activity of a trehalose
importer; [0156] iii) a polypeptide having an amino acid sequence
containing a deletion, substitution, insertion and/or addition of
from 1 to 69, 1 to 34, 1 to 17, 1 to 7, amino acid residues with
respect to the amino acid sequence depicted in SEQ ID NO: 8, said
polypeptide being a subunit of a protein complex having the
activity of a trehalose importer;
[0157] e) [0158] i) a polypeptide consisting of or comprising the
amino acid sequence depicted in SEQ ID NO: 10; [0159] ii) a
polypeptide with an amino acid sequence that is at least 70%
identical to the amino acid sequence of i), said polypeptide being
a subunit of a protein complex having the activity of a trehalose
importer; [0160] iii) a polypeptide having an amino acid sequence
containing a deletion, substitution, insertion and/or addition of
from 1 to 56, 1 to 28, 1 to 14, 1 to 6, amino acid residues with
respect to the amino acid sequence depicted in SEQ ID NO: 10, said
polypeptide being a subunit of a protein complex having the
activity of a trehalose importer;
[0161] f) [0162] i) a polypeptide consisting of or comprising the
amino acid sequence depicted in SEQ ID NO: 12; [0163] ii) a
polypeptide with an amino acid sequence that is at least 70%
identical to the amino acid sequence of i), said polypeptide being
a subunit of a protein complex having the activity of a trehalose
importer; [0164] iii) a polypeptide having an amino acid sequence
containing a deletion, substitution, insertion and/or addition of
from 1 to 15, 1 to 8, 1 to 4, 1 to 2, amino acid residues with
respect to the amino acid sequence depicted in SEQ ID NO: 12, said
polypeptide being a subunit of a protein complex having the
activity of a trehalose importer.
[0165] Preferred embodiments comprise variants which are at least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 98% or at least 99%, identical to the above-described amino
acid sequences, i.e. with at least 75%, at least 80%, at least 85%,
at least 90%, at least 95%, at least 98% or at least 99%, of the
amino acid positions being identical to those of the
above-described amino acid sequences. Percentage identity is
preferably calculated over the entire length of the amino acid or
nucleic acid region. A person skilled in the art has a number of
programs, based on a multiplicity of algorithms, available for
sequence comparison. In this context, the algorithms of Needleman
and Wunsch or Smith and Waterman produce particularly reliable
results. The program PileUp (J. Mol. Evolution. 25:351-360 (1987);
Higgins, et al., CABIOS 5:151-153 (1989)) or the programs Gap and
BestFit (Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970) and
Smith and Waterman, Adv. Appl. Math. 2:482-489 (1981)), which are
part of the GCG software package (Genetics Computer Group, 575
Science Drive, Madison, Wis., USA 53711 (1991)), are available for
the alignment of sequences. The sequence identity percentages
listed above are preferably calculated over the entire sequence
region using the GAP program.
[0166] Where appropriate, preference is given to conservative amino
acid substitutions. In the case of aromatic amino acids,
conservative substitutions are those in which phenylalanine,
tryptophan and tyrosine are substituted for each other. In the case
of hydrophobic amino acids, conservative substitutions are those in
which leucine, isoleucine and valine are substituted for one
another. In the case of polar amino acids, conservative
substitutions are those in which glutamine and asparagine are
substituted for one another. In the case of basic amino acids,
conservative substitutions are those in which arginine, lysine and
histidine are substituted for one another. In the case of acidic
amino acids, conservative substitutions are those in which aspartic
acid and glutamic acid are substituted for one another. In the case
of the amino acids containing hydroxyl groups, conservative
substitutions are those in which serine and threonine are
substituted for one another.
[0167] It is furthermore possible to use polynucleotides which
hybridize under stringent conditions with the nucleotide sequence
complementary to SEQ ID NO: 1, 3, 5, 7, 9, 11, preferably to the
coding region of SEQ ID NO: 1, 3, 5, 7, 9, 11, and code for a
polypeptide which is part of a trehalose importer.
[0168] Instructions regarding the hybridization of nucleic acids or
polynucleotides can be found by the skilled worker inter alia in
the manual "The DIG System Users Guide for Filter Hybridization"
from Boehringer Mannheim GmbH (Mannheim, Germany, 1993) and in
Liebl et al. (International Journal of Systematic Bacteriology
41:255-260 (1991)). Hybridization takes place under stringent
conditions, that is to say only hybrids in which the probe (i.e. a
polynucleotide comprising the nucleotide sequence complementary to
SEQ ID NO: 1, 3, 5, 7, 9, 11, preferably the coding region of SEQ
ID NO: 1, 3, 5, 7, 9, 11) and the target sequence (i.e. the
polynucleotides treated with or identified by said probe) are at
least 70% identical are formed. The stringency of the
hybridization, including the washing steps, is known to be
influenced or determined by varying the buffer composition,
temperature and salt concentration. The hybridization reaction is
generally carried out with relatively low stringency compared with
the washing steps (Hybaid Hybridisation Guide, Hybaid Limited,
Teddington, U K, 1996).
[0169] For example, a 5.times.SSC buffer at a temperature of
approx. 50.degree. C.-68.degree. C. may be employed for the
hybridization reaction. Here, probes may also hybridize with
polynucleotides which are less than 70% identical to the nucleotide
sequence of the probe employed. Such hybrids are less stable and
are removed by washing under stringent conditions. This may be
achieved, for example, by lowering the salt concentration to
2.times.SSC or 1.times.SSC and, where appropriate, subsequently
0.5.times.SSC (The DIG System User's Guide for Filter
Hybridisation, Boehringer Mannheim, Mannheim, Germany, 1995), with
a temperature of approx. 50.degree. C.-68.degree. C., approx.
52.degree. C.-68.degree. C., approx. 54.degree. C.-68.degree. C.,
approx. 56.degree. C.-68.degree. C., approx. 58.degree.
C.-68.degree. C., approx. 60.degree. C.-68.degree. C., approx.
62.degree. C.-68.degree. C., approx. 64.degree. C.-68.degree. C.,
approx. 66.degree. C.-68.degree. C. being set. Preference is given
to temperature ranges of approx. 64.degree. C.-68.degree. C. or
approx. 66.degree. C.-68.degree. C. It is optionally possible to
lower the salt concentration to a concentration corresponding to
0.2.times.SSC or 0.1.times.SSC. The SSC buffer optionally contains
sodium dodecylsulphate (SDS) at a concentration of 0.1%. By
gradually increasing the hybridization temperature in steps of
approx. 1-2.degree. C. from 50.degree. C. to 68.degree. C., it is
possible to isolate polynucleotide fragments which are at least
70%, at least 80%, at least 90%, at least 92%, at least 94%, at
least 96%, at least 97%, at least 98%, or at least 99%, where
appropriate 100%, identical to the sequence or complementary
sequence of the probe employed and which code for a polypeptide
which is part of a trehalose importer. Further instructions
regarding hybridization are obtainable on the market in the form of
"kits" (e.g. DIG Easy Hyb from Roche Diagnostics GmbH, Mannheim,
Germany, Catalogue No. 1603558).
[0170] For the measures of the invention, a gene coding for a part
of a trehalose importer is overexpressed in a microorganism or
starting or parent strain producing the desired amino acid(s).
Overexpression generally means an increase in the intracellular
concentration or activity of a ribonucleic acid, of a protein
(polypeptide) or of an enzyme by comparison with the starting
strain (parent strain) or wild-type strain, if the latter is the
starting strain. A starting strain (parent strain) means the strain
on which the measure leading to overexpression has been carried
out.
[0171] For overexpression, preference is given to the methods of
recombinant overexpression. These include all methods in which a
microorganism is prepared using a DNA molecule provided in vitro.
Examples of such DNA molecules include promoters, expression
cassettes, genes, alleles, coding regions, etc. They are
transferred by methods of transformation, conjugation, transduction
or similar methods into the desired microorganism.
[0172] The measures of overexpression increase the activity or
concentration of the corresponding polypeptides generally by at
least 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% or 500%,
preferably at most by 1000%, 2000%, 4000%, 10000% or 20000%, based
on the activity or concentration of said polypeptide in the strain
prior to the measure resulting in overexpression.
[0173] Overexpression is achieved by a multiplicity of methods
available in the prior art. These include increasing the copy
number and modifying the nucleotide sequences directing or
controlling expression of the gene. The transcription of a gene is
controlled inter alia by the promoter and optionally by proteins
which suppress (repressor proteins) or promote (activator proteins)
transcription. The translation of the RNA formed is controlled
inter alia by the ribosome binding site and the start codon.
Polynucleotides or DNA molecules which include a promoter and a
ribosome binding site and optionally a start codon are also
referred to as expression cassette.
[0174] The copy number may be increased by means of plasmids which
replicate in the cytoplasm of the microorganism. To this end, an
abundance of plasmids are described in the prior art for very
different groups of microorganisms, which plasmids can be used for
setting the desired increase in the copy number of the gene.
Plasmids suitable for the genus Escherichia are described, for
example, in the manual Molecular Biology, Labfax (ed.: T. A. Brown,
Bios Scientific, Oxford, U K, 1991). Plasmids suitable for the
genus Corynebacterium are described, for example, in Tauch, et al.
(J. Biotechnology 104(1-3):27-40, (2003)), or in Stansen, et al.
(Applied and Environmental Microbiology 71:5920-5928 (2005)).
[0175] The copy number may furthermore be increased by at least one
(1) copy by introducing further copies into the chromosome of the
microorganism. Methods suitable for the genus Corynebacterium are
described, for example, in the patents WO 03/014330, WO 03/040373
and WO 04/069996. Examples of methods suitable for the genus
Escherichia are insertion of a gene copy into the att site of the
phage (Yu, et al., Gene 223:77-81 (1998)), chromosomal
amplification with the aid of the phage Mu, as described in EP 0
332 448, or the methods of gene replacement with the aid of
conditionally replicating plasmids, as described by Hamilton, et
al. (J. Bacteriol. 174:4617-4622 (1989)) or Link, et al. (J.
Bacteriol. 179:6228-6237 (1997)).
[0176] Gene expression may furthermore be increased by using a
strong promoter which is functionally linked to the gene to be
expressed. Preference is given to using a promoter which is
stronger than the natural promoter, i.e., the one present in the
wild type or parent strain. To this end, the prior art has an
abundance of methods available. "Functionallinkage" in this context
means the sequential arrangement of a promoter with a gene,
resulting in expression of said gene and control thereof.
[0177] Promoters suitable for the genus Corynebacterium can be
found inter alia in Morinaga, et al. (J. Biotechnol. 5:305-312,
(1987)), in the patent documents EP 0 629 699 A2, US 2007/0259408
A1, WO 2006/069711, EP 1 881 076 A1 and EP 1 918 378 A1 and in
reviews such as the "Handbook of Corynebacterium glutamicum" (eds.:
Lothar Eggeling and Michael Bott, CRC Press, Boca Raton, US (2005))
or the book "Corynebacteria, Genomics and Molecular Biology" (Ed.:
Andreas Burkovski, Caister Academic Press, Norfolk, UK (2008)).
Examples of promoters which allow controlled, i.e., inducible or
repressible, expression are described, for example, in Tsuchiya, et
al. (Bio/Technology 6{428-430 (1988)). Such promoters or expression
cassettes are typically employed at a distance of from 1 to 1000,
preferably 1 to 500, nucleotides upstream of the first nucleotide
of the start codon of the coding region of the gene. It is likewise
possible to place a plurality of promoters upstream of the desired
gene or functionally link them to the gene to be expressed and in
this way achieve increased expression. Examples of this are
described in the patent WO 2006/069711.
[0178] The structure of Escherichia coli promoters is well known.
It is therefore possible to increase the strength of a promoter by
modifying its sequence by means of one or more substitution(s)
and/or one or more insertion(s) and/or one or more deletion(s) of
nucleotides. Examples of this can be found inter alia in "Herder
Lexikon der Biologie" (Spektrum Akademischer Verlag, Heidelberg,
Germany (1994)). Examples of the modification of promoters for
increasing expression in coryneform bacteria can be found in U.S.
Pat. No. 6,962,805 B2 and in a publication by Vasicova et al.
(Bacteriol. 1999 October; 181(19):6188-91.). Enhancing a target
gene by substituting a homologous promoter is described, for
example, in EP 1 697 526 B1.
[0179] The structure of the Corynebacterium glutamicum ribosome
binding site is likewise well known and is described, for example,
in Amador (Microbiology 145, 915-924 (1999)), and in manuals and
textbooks of genetics, for example "Gene and Klone" (Winnacker,
Verlag Chemie, Weinheim, Germany (1990)) or "Molecular Genetics of
Bacteria" (Dale and Park, Wiley and Sons Ltd., Chichester, UK
(2004)).
[0180] Overexpression can likewise be achieved by increasing the
expression of activator proteins or reducing or switching off the
expression of repressor proteins.
[0181] The overexpression measures mentioned may be combined with
one another in a suitable manner. Thus it is possible, for example,
to combine the use of a suitable expression cassette with
increasing the copy number or, preferably, the use of a suitable
promoter with increasing the copy number.
[0182] Instructions regarding the handling of DNA, digestion and
ligation of DNA, transformation and selection of transformants can
be found inter alia in the known manual by Sambrook, et al.
"Molecular Cloning: A Laboratory Manual, Second Edition" (Cold
Spring Harbor Laboratory Press, 1989).
[0183] The extent of expression or overexpression can be determined
by measuring the amount of the mRNA transcribed from the gene, by
determining the amount of the polypeptide and by determining the
enzyme activity. The amount of mRNA may be determined inter alia by
using the methods of "Northern blotting" and of quantitative
RT-PCR. Quantitative RT-PCR involves reverse transcription
preceding the polymerase chain reaction. For this, the
LightCycler.TM. system from Roche Diagnostics (Boehringer Mannheim
GmbH, Roche Molecular Biochemicals, Mannheim, Germany) may be used,
as described, for example, in Jungwirth, et al. (FEMS Microbiology
Letters 281:190-197 (2008)).
[0184] The concentration of the protein may be determined via 1-
and 2-dimensional protein gel fractionation and subsequent optical
identification of the protein concentration by appropriate
evaluation software in the gel. A customary method of preparing
protein gels for coryneform bacteria and of identifying said
proteins is the procedure described by Hermann, et al.
(Electrophoresis 22:1712-23 (2001)). The protein concentration may
likewise be determined by Western blot hybridization using an
antibody specific for the protein to be detected (Sambrook et al.,
Molecular cloning: a laboratory manual. 2.sup.nd Ed. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) and
subsequent optical evaluation using corresponding software for
concentration determination (Lohaus, et al., Biospektrum 5:32-39
(1998); Lottspeich, Angewandte Chemie 321:2630-2647 (1999)).
[0185] The microorganisms produced may be cultured continuously--as
described, for example, in WO 05/021772--or discontinuously in a
batch process (batch cultivation) or in a fed batch or repeated fed
batch process for the purpose of producing the desired
organic-chemical compound. A summary of a general nature about
known cultivation methods is available in the textbook by Chmiel
(Bioprozesstechnik 1. Einfuhrung in die Bioverfahrenstechnik
(Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by
Storhas (Bioreaktoren and periphere Einrichtungen (Vieweg Verlag,
Brunswick/Wiesbaden, 1994)).
[0186] The culture medium or fermentation medium to be used must in
a suitable manner satisfy the demands of the respective strains.
Descriptions of culture media for various microorganisms are
present in the "Manual of Methods for General Bacteriology" of the
American Society for Bacteriology (Washington D.C., USA, 1981). The
terms culture medium and fermentation medium or medium are
interchangeable.
[0187] It is possible to use, as carbon source, sugars and
carbohydrates such as, for example, glucose, sucrose, lactose,
fructose, maltose, molasses, sucrose-containing solutions from
sugar beet or sugar cane processing, starch, starch hydrolysate and
cellulose, oils and fats such as, for example, soybean oil,
sunflower oil, groundnut oil and coconut fat, fatty acids such as,
for example, palmitic acid, stearic acid and linoleic acid,
alcohols such as, for example, glycerol, methanol and ethanol, and
organic acids such as, for example, acetic acid or lactic acid.
[0188] It is possible to use, as nitrogen source, organic
nitrogen-containing compounds such as peptones, yeast extract, meat
extract, malt extract, corn steep liquor, soybean flour and urea,
or inorganic compounds such as ammonium sulphate, ammonium
chloride, ammonium phosphate, ammonium carbonate and ammonium
nitrate. The nitrogen sources can be used individually or as
mixture.
[0189] It is possible to use, as phosphorus source, phosphoric
acid, potassium dihydrogen phosphate or dipotassium hydrogen
phosphate or the corresponding sodium-containing salts.
[0190] The culture medium must additionally comprise salts, for
example in the form of chlorides or sulphates of metals such as,
for example, sodium, potassium, magnesium, calcium and iron, such
as, for example, magnesium sulphate or iron sulphate, which are
necessary for growth. Finally, essential growth factors such as
amino acids, for example homoserine and vitamins, for example
thiamine, biotin or pantothenic acid, may be employed in addition
to the above-mentioned substances.
[0191] The starting materials may be added to the culture in the
form of a single batch or be fed in during the cultivation in a
suitable manner.
[0192] The pH of the culture can be controlled by employing basic
compounds such as sodium hydroxide, potassium hydroxide, ammonia or
aqueous ammonia, or acidic compounds such as phosphoric acid or
sulphuric acid in a suitable manner. The pH is generally adjusted
to a value of from 6.0 to 8.5, preferably 6.5 to 8. To control
foaming, it is possible to employ antifoams such as, for example,
fatty acid polyglycol esters. To maintain the stability of
plasmids, it is possible to add to the medium suitable selective
substances such as, for example, antibiotics. The fermentation is
preferably carried out under aerobic conditions. In order to
maintain these conditions, oxygen or oxygen-containing gas mixtures
such as, for example, air are introduced into the culture. It is
likewise possible to use liquids enriched with hydrogen peroxide.
The fermentation is carried out, where appropriate, at elevated
pressure, for example at an elevated pressure of from 0.03 to 0.2
MPa. The temperature of the culture is normally from 20.degree. C.
to 45.degree. C. and preferably from 25.degree. C. to 40.degree.
C., particularly preferably from 30.degree. C. to 37.degree. C. In
batch processes, the cultivation is preferably continued until an
amount of the desired organic-chemical compound sufficient for
being recovered has formed. This aim is normally achieved within 10
hours to 160 hours. In continuous processes, longer cultivation
times are possible. The activity of the microorganisms results in a
concentration (accumulation) of the organic-chemical compound in
the fermentation medium and/or in the cells of said
microorganisms.
[0193] Examples of suitable fermentation media can be found inter
alia in the U.S. Pat. No. 5,770,409, U.S. Pat. No. 5,990,350, U.S.
Pat. No. 5,275,940, WO 2007/012078, U.S. Pat. No. 5,827,698, WO
2009/043803, U.S. Pat. No. 5,756,345 and U.S. Pat. No.
7,138,266.
[0194] Analysis of L-amino acids to determine the concentration at
one or more time(s) during the fermentation can take place by
separating the L-amino acids by means of ion exchange
chromatography, preferably cation exchange chromatography, with
subsequent post-column derivatization using ninhydrin, as described
in Spackman et al. (Analytical Chemistry 30: 1190-1206 (1958)). It
is also possible to employ ortho-phthalaldehyde rather than
ninhydrin for post-column derivatization. An overview article on
ion exchange chromatography can be found in Pickering (LC.cndot.GC
(Magazine of Chromatographic Science 7(6):484-487 (1989)).
[0195] It is likewise possible to carry out a pre-column
derivatization, for example using ortho-phthalaldehyde or phenyl
isothiocyanate, and to fractionate the resulting amino acid
derivates by reversed-phase chromatography (RP), preferably in the
form of high-performance liquid chromatography (HPLC). A method of
this type is described, for example, in Lindroth, et al.
(Analytical Chemistry 51:1167-1174 (1979)). Detection is carried
out photometrically (absorption, fluorescence). A review regarding
amino acid analysis can be found inter alia in the textbook
"Bioanalytik" by Lottspeich and Zorbas (Spektrum Akademischer
Verlag, Heidelberg, Germany 1998).
[0196] The performance of the methods or fermentation processes
according to the invention, in terms of one or more of the
parameters selected from the group of concentration (compound
formed per unit volume), yield (compound formed per unit carbon
source consumed), formation (compound formed per unit volume and
time) and specific formation (compound formed per unit dry cell
matter or dry biomass and time or compound formed per unit cellular
protein and time) or else other process parameters and combinations
thereof, is increased by at least 0.5%, at least 1%, at least 1.5%
or at least 2%, based on methods or fermentation processes using
microorganisms containing an increased trehalose importer
activity.
[0197] The fermentation measures result in a fermentation broth
which contains the desired organic-chemical compound, preferably
L-amino acid. A product containing the organic-chemical compound is
then provided or produced or recovered in liquid or solid form.
[0198] A "fermentation broth" means a fermentation medium or
nutrient medium in which a microorganism has been cultivated for a
certain time and at a certain temperature. The fermentation medium
or the media employed during fermentation comprise(s) all the
substances or components which ensure production of the desired
compound and typically propagation and viability.
[0199] When the fermentation is complete, the resulting
fermentation broth accordingly comprises: [0200] a) the biomass
(cell mass) of the microorganism, said biomass having been produced
due to propagation of the cells of said microorganism, [0201] b)
the desired organic-chemical compound formed during the
fermentation, [0202] c) the organic by-products formed during the
fermentation, and [0203] d) the constituents of the fermentation
medium employed or of the starting materials, such as, for example,
vitamins such as biotin or salts such as magnesium sulphate, which
have not been consumed in the fermentation.
[0204] The organic by-products include substances which are
produced and optionally secreted by the microorganisms employed in
the fermentation in addition to the particular desired compound.
These also include sugars such as, for example, trehalose.
[0205] The fermentation broth is removed from the culture vessel or
fermentation tank, collected where appropriate, and used for
providing a product containing the organic-chemical compound,
preferably an L-amino acid-containing product, in liquid or solid
form. The expression "recovering the L-amino acid-containing
product" is also used for this. In the simplest case, the L-amino
acid-containing fermentation broth itself, which has been removed
from the fermentation tank, constitutes the recovered product.
[0206] One or more of the measures selected from the group
consisting of: [0207] a) partial (>0% to <80%) to complete
(100%) or virtually complete (.gtoreq.80%, .gtoreq.90%,
.gtoreq.95%, .gtoreq.96%, .gtoreq.97%, .gtoreq.98%, .gtoreq.99%)
removal of the water, [0208] b) partial (>0% to <80%) to
complete (100%) or virtually complete (.gtoreq.80%, .gtoreq.90%,
.gtoreq.95%, .gtoreq.96%, .gtoreq.97%, .gtoreq.98%, .gtoreq.99%)
removal of the biomass, the latter being optionally inactivated
before removal, [0209] c) partial (>0% to <80%) to complete
(100%) or virtually complete (.gtoreq.80%, .gtoreq.90%,
.gtoreq.95%, .gtoreq.96%, .gtoreq.97%, .gtoreq.98%, .gtoreq.99%,
.gtoreq.99.3%, .gtoreq.99.7%) removal of the organic by-products
formed during fermentation, and [0210] d) partial (>0%) to
complete (100%) or virtually complete (.gtoreq.80%, .gtoreq.90%,
.gtoreq.95%, .gtoreq.96%, .gtoreq.97%, .gtoreq.98%, .gtoreq.99%,
.gtoreq.99.3%, .gtoreq.99.7%) removal of the constituents of the
fermentation medium employed or of the starting materials, which
have not been consumed in the fermentation, from the fermentation
broth achieves concentration or purification of the desired
organic-chemical compound. Products having a desired content of
said compound are isolated in this way.
[0211] The partial (>0% to <80%) to complete (100%) or
virtually complete (.gtoreq.80% to <100%) removal of the water
(measure a)) is also referred to as drying. In one variant of the
method, complete or virtually complete removal of the water, of the
biomass, of the organic by-products and of the unconsumed
constituents of the fermentation medium employed results in pure
(.gtoreq.80% by weight, .gtoreq.90% by weight) or high-purity
(.gtoreq.95% by weight, .gtoreq.97% by weight, .gtoreq.99% by
weight) product forms of the desired organic-chemical compound,
preferably L-amino acids. An abundance of technical instructions
for measures a), b), c) and d) are available in the prior art.
[0212] In the case of the amino acid L-lysine, essentially four
different product forms are known in the prior art. One group of
L-lysine-containing products includes concentrated aqueous alkaline
solutions of purified L-lysine (EP-B-0534865). A further group, as
described for example in U.S. Pat. No. 6,340,486 and U.S. Pat. No.
6,465,025, includes aqueous acidic biomass-containing concentrates
of L-lysine-containing fermentation broths. The best-known group of
solid products includes pulverulent or crystalline forms of
purified or pure L-lysine, which is typically in the form of a salt
such as, for example, L-lysine monohydrochloride. A further group
of solid product forms is described for example in EP-B-0533039.
The product form described therein comprises besides L-lysine most
of the starting materials used during the fermentative production
and not consumed and, where appropriate, the biomass of the
microorganism employed with a proportion of >0%-100%.
[0213] A wide variety of processes appropriate for the various
product forms are known for producing the L-lysine-containing
product or the purified L-lysine from the fermentation broth. The
methods essentially used to produce pure solid L-lysine are those
of ion exchange chromatography, where appropriate with use of
activated carbon, and methods of crystallization. The corresponding
base or a corresponding salt such as, for example, the
monohydrochloride (Lys-HCl) or lysine sulphate
(Lys.sub.2-H.sub.2SO.sub.4) is obtained in this way.
[0214] EP-B-0534865 describes a process for producing aqueous basic
L-lysine-containing solutions from fermentation broths. In the
process described therein, the biomass is separated from the
fermentation broth and discarded. A base such as, for example,
sodium hydroxide, potassium hydroxide or ammonium hydroxide is used
to set a pH of between 9 and 11. The mineral constituents
(inorganic salts) are removed from the broth by crystallization
after concentration and cooling and are either used as fertilizer
or discarded.
[0215] In processes for producing lysine by using bacteria of the
genus Corynebacterium, preferred processes are those resulting in
products which comprise constituents of the fermentation broth.
These are used in particular as animal feed additives.
[0216] Depending on requirements, the biomass can be removed wholly
or partly from the fermentation broth by separation methods such
as, for example, centrifugation, filtration, decantation or a
combination thereof, or be left completely therein. Where
appropriate, the biomass or the biomass-containing fermentation
broth is inactivated during a suitable process step, for example by
thermal treatment (heating) or by addition of acid.
[0217] In one procedure, the biomass is completely or virtually
completely removed so that no (0%) or at most 30%, at most 20%, at
most 10%, at most 5%, at most 1% or at most 0.1% biomass remains in
the prepared product. In a further procedure, the biomass is not
removed, or is removed only in small proportions, so that all
(100%) or more than 70%, 80%, 90%, 95%, 99% or 99.9% biomass
remains in the product prepared. In one method according to the
invention, accordingly, the biomass is removed in proportions of
from .gtoreq.0% to .ltoreq.100%.
[0218] Finally, the fermentation broth obtained after the
fermentation can be adjusted, before or after the complete or
partial removal of the biomass, to an acidic pH with an inorganic
acid such as, for example, hydrochloric acid, sulphuric acid or
phosphoric acid, or organic acids such as, for example, propionic
acid (GB 1,439,728 or EP 1 331 220). It is likewise possible to
acidify the fermentation broth with the complete content of
biomass. Finally, the broth can also be stabilized by adding sodium
bisulphite (NaHSO3, GB 1,439,728) or another salt, for example
ammonium, alkali metal or alkaline earth metal salt of sulphurous
acid.
[0219] During the removal of the biomass, any organic or inorganic
solids present in the fermentation broth are partially or
completely removed. The organic by-products dissolved in the
fermentation broth, and the dissolved unconsumed constituents of
the fermentation medium (starting materials), remain at least
partly (>0%), preferably to an extent of at least 25%,
particularly preferably to an extent of at least 50% and very
particularly preferably to an extent of at least 75%, in the
product. Where appropriate, they also remain completely (100%) or
virtually completely, meaning >95% or >98% or greater than
99%, in the product. If a product in this sense comprises at least
part of the constituents of the fermentation broth, this is also
described by the term "product based on fermentation broth."
[0220] Subsequently, water is removed from the broth, or it is
thickened or concentrated, by known methods such as, for example,
using a rotary evaporator, thin-film evaporator, falling-film
evaporator, by reverse osmosis or by nanofiltration. This
concentrated fermentation broth can then be worked up to
free-flowing products, in particular to a fine powder or preferably
coarse granules, by methods of freeze drying, spray drying, spray
granulation or by other processes as described for example in the
circulating fluidized bed according to PCT/EP2004/006655. A desired
product is isolated where appropriate from the resulting granules
by screening or dust removal. It is likewise possible to dry the
fermentation broth directly, i.e., without previous concentration
by spray drying or spray granulation. "Free-flowing" means powders
which, from of a series of glass orifice vessels with orifices of
different sizes, flow unimpeded at least out of the vessel with a 5
mm (millimetre) orifice (Klein: Seifen, Ole, Fette, Wachse 94, 12
(1968)). "Fine" means a powder predominantly (>50%) having a
particle size of diameter from 20 to 200 .mu.m. "Coarse" means a
product predominantly (>50%) having a particle size of diameter
from 200 to 2000 .mu.m.
[0221] The particle size determination can be carried out by
methods of laser diffraction spectrometry. Corresponding methods
are described in the textbook on "Teilchengro.beta.enmessung in der
Laborpraxis" (particle size measurement in laboratory practice) by
R. H. Muller and R. Schuhmann, Wissenschaftliche
Verlagsgesellschaft Stuttgart (1996) or in the textbook
"Introduction to Particle Technology" by M. Rhodes, published by
Wiley & Sons (1998).
[0222] The free-flowing, fine powder can in turn be converted by
suitable compaction or granulation processes into a coarse, very
free-flowing, storable and substantially dust-free product. The
term "dust-free" means that the product comprises only small
proportions (<5%) of particle sizes below 100 .mu.m in diameter.
"Storable" in the sense of this invention means a product which can
be stored for at least one (1) year or longer, preferably at least
1.5 years or longer, particularly preferably two (2) years or
longer, in a dry and cool environment without any substantial loss
(at most 5%) of the respective amino acid occurring.
[0223] The invention further relates to a method described in
principle in WO 2007/042363 A1. To this end, a method is carried
out which uses the fermentation broth obtained according to the
invention, from which the biomass has been removed completely or
partially, where appropriate, and which method comprises the
following steps: [0224] a) the pH is reduced to 4.0 to 5.2, in
particular 4.9 to 5.1, by adding sulphuric acid and a molar
sulphate/L-lysine ratio of from 0.85 to 1.2, preferably 0.9 to 1.0,
particularly preferably >0.9 to <0.95, is established in the
broth, where appropriate by adding one or more further
sulphate-containing compound(s), and [0225] b) the mixture obtained
in this way is concentrated by removal of water, and granulated
where appropriate, where one or both of the following measures
is/are carried out where appropriate before step a): [0226] c)
measurement of the molar sulphate/L-lysine ratio to ascertain the
required amount of sulphate-containing compound(s) [0227] d)
addition of a sulphate-containing compound selected from the group
of ammonium sulphate, ammonium bisulphate and sulphuric acid in
appropriate ratios.
[0228] Where appropriate, furthermore, before step b), a salt of
sulphurous acid, preferably alkali metal bisulphite, particularly
preferably sodium bisulphite, is added in a concentration of from
0.01 to 0.5% by weight, preferably 0.1 to 0.3% by weight,
particularly preferably 0.1 to 0.2% by weight, based on the
fermentation broth.
[0229] Preferred sulphate-containing compounds which should be
mentioned in the context of the abovementioned process steps are in
particular ammonium sulphate and/or ammonium bisulphate or
appropriate mixtures of ammonia and sulphuric acid and sulphuric
acid itself.
[0230] The molar sulphate/L-lysine ratio V is calculated by the
formula: V=2.times.[SO.sub.4.sup.2-]/[L-lysine]. This formula takes
account of the fact that the SO.sub.4.sup.2- anion is doubly
charged, or sulphuric acid is dibasic. A ratio of V=1 means that a
stoichiometric composition Lys.sub.2-(H.sub.2SO.sub.4) is present,
whereas the finding with a ratio of V=0.9 is a 10% sulphate deficit
and with a ratio of V=1.1 is a 10% sulphate excess.
[0231] It is advantageous to employ during the granulation or
compaction the usual organic or inorganic auxiliaries or carriers
such as starch, gelatine, cellulose derivatives or similar
substances, as normally used in the processing of food products or
feeds as binders, gelling agents or thickeners, or further
substances such as, for example, silicas, silicates (EP0743016A) or
stearates.
[0232] It is further advantageous to treat the surface of the
resulting granules with oils or fats as described in WO 04/054381.
Oils which can be used are mineral oils, vegetable oils or mixtures
of vegetable oils. Examples of such oils are soybean oil, olive
oil, soybean oil/lecithin mixtures. In the same way, silicone oils,
polyethylene glycols or hydroxyethylcellulose are also suitable.
Treatment of the surfaces with said oils achieves an increased
abrasion resistance of the product and a reduction in the dust
content. The oil content in the product is 0.02 to 2.0% by weight,
preferably 0.02 to 1.0% by weight, and very particularly preferably
0.2 to 1.0% by weight, based on the total amount of the feed
additive.
[0233] Preferred products have a proportion of .gtoreq.97% by
weight with a particle size of from 100 to 1800 .mu.m, or a
proportion of .gtoreq.95% by weight with a particle size of 300 to
1800 .mu.m, in diameter. The proportion of dust, i.e. particles
with a particle size <100 .mu.m, is preferably >0 to 1% by
weight, particularly preferably not exceeding 0.5% by weight.
[0234] However, alternatively, the product may also be absorbed on
an organic or inorganic carrier known and customary in the
processing of feeds, such as, for example, silicas, silicates,
meals, brans, flours, starches, sugars or others, and/or be mixed
and stabilized with customary thickeners or binders. Examples of
use and processes therefor are described in the literature (Die
Muhle+Mischfuttertechnik 132 (1995) 49, page 817).
[0235] Finally, the product can also be brought, by coating
processes with film-formers such as, for example, metal carbonates,
silicas, silicates, alginates, stearates, starches, gums and
cellulose ethers, as described in DE-C-4100920, into a state which
is stable to digestion by animal stomachs, especially the stomach
of ruminants.
[0236] To establish a desired L-lysine concentration in the
product, it is possible, depending on requirements, to add the
L-lysine during the process in the form of a concentrate or, where
appropriate, of a substantially pure substance or its salt in
liquid or solid form. These can be added singly or as mixtures to
the resulting or concentrated fermentation broth, or else during
the drying or granulation process.
[0237] The invention further relates to a method for preparing a
solid lysine-containing product, which method is described in
principle in US 20050220933. This involves carrying out a method
which uses the fermentation broth obtained according to the
invention and which comprises the following steps: [0238] a)
filtration of the fermentation broth, preferably with a membrane
filter, to result in a biomass-containing slurry and a filtrate;
[0239] b) concentration of the filtrate, preferably so as to result
in a solids content of from 48 to 52% by weight; [0240] c)
granulation of the concentrate obtained in step b), preferably at a
temperature of from 50.degree. C. to 62.degree. C.; and [0241] d)
coating of the granules obtained in c) with one or more of the
coating agent(s).
[0242] The concentration of the filtrate in step b) can also be
carried out in such a way that a solids content of >52 to
.ltoreq.55% by weight, of >55 to .ltoreq.58% by weight or of
>58 to .ltoreq.61% by weight is obtained.
[0243] The coating agents preferably used for the coating in step
d) are selected from the group consisting of: [0244] d1) the
biomass obtained in step a); [0245] d2) an L-lysine-containing
compound, preferably selected from the group of L-lysine
hydrochloride or L-lysine sulphate; [0246] d3) an essentially
L-lysine-free substance with an L-lysine content of <1% by
weight, preferably <0.5% by weight, preferably selected from the
group of starch, carrageenan, agar, silicas, silicates, meals,
brans and flours; and [0247] d4) a water-repellent substance,
preferably selected from the group of oils, polyethylene glycols
and liquid paraffins.
[0248] The L-lysine content is adjusted to a desired value by the
measures corresponding to steps d1) to d4), in particular d1) to
d3).
[0249] In the production of L-lysine-containing products, the ratio
of the ions is preferably adjusted so that the molar ion ratio
corresponding to the following formula:
2x[SO.sub.4.sup.2-]+[Cl.sup.-]-[NH.sub.4.sup.+]-[Na.sup.+]-[K.sup.+]-2x[-
Mg.sup.2+]-2x[Ca.sup.2+]/[L-Lys]
gives 0.68 to 0.95, preferably 0.68 to 0.90, particularly
preferably 0.68 to 0.86, as described by Kushiki, et al., in US
20030152633.
[0250] In the case of L-lysine, the solid product produced in this
way has, based on the fermentation broth, a lysine content (as
lysine base) of from 10% by weight to 70% by weight or 20% by
weight to 70% by weight, preferably 30% by weight to 70% by weight
and very particularly preferably from 40% by weight to 70% by
weight, based on the dry matter of the product. Maximum lysine base
contents of 71% by weight, 72% by weight, 73% by weight are
likewise possible.
[0251] The water content of the L-lysine-containing solid product
is up to 5% by weight, preferably up to 4% by weight, and
particularly preferably less than 3% by weight.
[0252] The strain DM1729 was deposited with the German collection
of microorganisms and cell cultures under accession number DSM17576
on 16 Sep. 2005.
EXAMPLES
Example 1
Identification of a Trehalose Uptake System
[0253] For bacteria of the order Actinomycetales, which also
includes C. glutamicum, trehalose metabolization has hitherto been
described only for bacteria of the Streptomycetaceae family:
Streptomyces coelicolor and Streptomyces reticuli utilize trehalose
as carbon source. Gene expression analyses indicated an involvement
in trehalose uptake of the components of an ABC transport system,
encoded by agl3E, agl3F and agl3G, in S. coelicolor and of the
ATPase subunit MsiK in S. reticuli. A Blast analysis of the C.
glutamicum genomic sequence identified two open reading frames
(cg2708 and cg0835) with high homology to S. reticuli msiK (GenBank
accession no. CAA70125): the C. glutamicum protein encoded by
cg2708 is 59% identical to S. reticuli MsiK (e-value 7e-125), but
is the ATP-binding protein MusE of the MusEFGK.sub.2 maltose
transporter, the deletion of which does not affect trehalose
utilization. The second protein, encoded by cg0835, is, at 58%,
likewise highly identical to S. reticuli MsiK (e-value 8e-112).
Sequence comparisons of S. coelicolor agl3E, agl3F and agl3G
(accession no. NP_631226, NP_631225, NP_631224) with the C.
glutamicum genomic sequence did not yield any further meaningful
hits (e.g. 25% to 32% identity to genes of the ABC uptake system
UgpAEBC which catalyses the uptake of glycerol 3-phosphate, and
genes of the maltose uptake system Mu5EFGK2).
[0254] Comparative sequence analysis therefore yields, as a
possible trehalose uptake system in C. glutamicum, the open reading
frame cg0835 and the open reading frames cg0834, cg0832 and cg0831
which are located in the immediate vicinity in the genomic sequence
and which code for a substrate-binding protein and two permease
components of an as yet uncharacterized ABC transporter (see FIG. 1
for arrangement).
Example 2
Construction of Vector pXMJ19_cg0831
[0255] The expression construct containing the reading frames
cg0832, cg0834, cg0833, cg0832 and cg0831 was prepared by
amplifying the corresponding gene region by means of a
proof-reading polymerase (PRECISOR High-Fidelity DNA Polymerase,
Biocat, Heidelberg, Germany) and ligating it into the pJet cloning
vector (Fermentas, St. Leon-Roth, Germany). To this end, the
following synthetic oligonucleotides (primers) were used:
TABLE-US-00004 primer cg0831for (SEQ ID No: 30): 5'
GCTCTAGATGCGTTCTGCTCCTGACCTT 3' primer cg0831rev (SEQ ID No: 31):
5' CGGGATCCTTTGCGTTGCGATTCGGATT 3'
[0256] The primers shown were synthesized by MWG Biotech
(Ebersberg, Germany). In each case, the recognition sequence for
the restriction enzymes XbaI and BamHI, respectively, is
underlined.
[0257] The fragment obtained was then excised by the restriction
enzymes XbaI and BamHI (New England Biolabs, Schwalbach, Germany)
from the pJet vector and ligated into the pXMJ19 expression vector
(Jakoby et al., 1999), which had previously been linearized with
XbaI and BamHI and then dephosphorylated using Antarctic
Phosphatase (New England Biolabs, Schwalbach, Germany). This was
followed by transforming competent E. coli DH5.alpha.mcr cells with
5 .mu.l of the ligation mixture. The clones obtained were screened
by restriction of the prepared plasmids for those containing the
desired insert. The plasmid has been named pXMJ19_cg0831 (see FIG.
2).
Example 3
Preparation of C. glutamicum Strains DM1933/pXMJ19 and
DM1933/pXMJ19_cg0831
[0258] The plasmids described in Example 2, pXMJ19 and
pXMJ19_cg0831, were electroporated into Corynebacterium glutamicum
DM1933, using the electroporation method of Liebl, et al. (FEMS
Microbiological Letters 53:299-303 (1989)).
[0259] The DM1933 strain is an aminoethylcystein-resistant mutant
of Corynebacterium glutamicum ATCC13032 and has been described in a
publication (Blombach, et al., Appl. and Env. Microbiol. 419-427
(2009)).
[0260] Plasmid-harbouring cells were selected by plating the
electroporation mixture onto LB agar (Sambrook et al., Molecular
cloning: a laboratory manual. 2.sup.nd Ed. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1989) supplemented with
7.5 mg/l chloramphenicol. Plasmid DNA was isolated from in each
case one transformant by the usual methods (Peters-Wendisch et al.,
Microbiology 144:915-927 (1998)) and checked by restriction
cleavage with subsequent agarose gel electrophoresis.
[0261] The strains obtained were named DM1933/pXMJ19 and
DM1933/pXMJ19_cg0831. The pXMJ19_cg0831 construct contains the
reading frames cg0832, cg0834, cg0833, cg0832 and cg0831.
Example 4
Production of L-Lysine
[0262] The C. glutamicum strains obtained in Example 3,
DM1933/pXMJ19 and DM1933/pXMJ19 cg0831, were cultured in a nutrient
medium suitable for lysine production, and the lysine content in
the culture supernatant was determined.
[0263] For this purpose, the strains were first incubated on an
agar plate containing the appropriate antibiotic (brain-heart agar
with chloramphenicol (7.5 mg/1)) at 33.degree. C. for 24 hours.
Starting from this agar plate culture, a preculture was inoculated
(10 ml of medium in a 100 ml conical flask). The medium used for
the preculture and the main culture was MM medium to which
chloramphenicol (7.5 mg/l) was added. Table 4 gives an overview of
the composition of the culturing medium used.
TABLE-US-00005 TABLE 4 MM medium CSL (corn steep liquor) 5 g/l MOPS
(morpholinopropanesulfonic acid) 20 g/l Glucose (autoclaved
separately) 50 g/l Salts: (NH.sub.4).sub.2SO.sub.4 25 g/l
KH.sub.2PO.sub.4 0.1 g/l MgSO.sub.4 * 7 H.sub.2O 1.0 g/l CaCl.sub.2
* 2 H.sub.2O 10 mg/l FeSO.sub.4 * 7 H.sub.2O 10 mg/l MnSO.sub.4 *
H.sub.2O 5.0 mg/l Biotin (sterile-filtered) 0.3 mg/l Thiamine * HCl
(sterile-filtered) 0.2 mg/l CaCO.sub.3 25 g/l
[0264] CSL, MOPS and the salt solution were adjusted to pH 7 with
aqueous ammonia and autoclaved. The sterile substrate and vitamin
solutions and the dry-autoclaved CaCO.sub.3 were then added.
[0265] The preculture was incubated on a shaker at 250 rpm and
33.degree. C. for 24 hours. A main culture was inoculated from this
preculture such that the starting OD (660 nm) of the main culture
was 0.1 OD.
[0266] Culturing was carried out in 10 ml volumes in a 100 ml
conical flask with baffles at a temperature of 33.degree. C. and
80% humidity.
[0267] After 20 and 40 hours (h) the OD at a measurement wavelength
of 660 nm was determined using a Biomek 1000 (Beckmann Instruments
GmbH, Munich). The amount of lysine produced was determined by ion
exchange chromatography and post-column derivatization with
ninhydrin detection, using an amino acid analyzer from
Eppendorf-BioTronik (Hamburg, Germany). The trehalose concentration
was determined by means of HPLC, using an analyzer from Dionex GmbH
(65510 Idstein, Germany). Table 5 depicts the result of the
experiment.
TABLE-US-00006 TABLE 5 Production of L-lysine and trehalose
concentration measurement. All values are averages of 3 independent
experiments with the strains listed; n.d. = not determined.
L-Lysine OD Trehalose HCl (g/l) (660 nm) (g/l) Strain 20 h 40 h 20
h 40 h 20 h 40 h DM1933/pXMJ19 11.84 13.65 14.04 13.12 n.d. 3.13
DM1933/pXMJ19_cg0831 11.82 14.89 14.62 13.7 n.d. 0
[0268] The result indicates that trehalose is no longer produced as
a by-product when lysine is produced from trehalose using a
trehalose importer-expressing strain. It is furthermore evident
that the yield of the desired product (L-lysine) is increased.
Example 5
Construction of vector pK18mobsacB_Pgap_cg0832
[0269] A 1701 bp DNA fragment corresponding to the nucleotide
sequence (SEQ ID No: 26) for overexpressing the genes cg0831 and
cg0832 was prepared by de novo gene synthesis at GENEART AG
(Regensburg, Germany).
[0270] The positions of nucleotides 613 to 1095 describe a promoter
fragment from the application US20080050786 (SEQ ID NO:20), wherein
a cleavage site for the NruI restriction enzyme was generated by
mutating the nucleobase thymine in position 1079 to the nucleobase
guanine, the nucleobase thymine in position 1080 to the nucleobase
cytosine and the nucleobase thymine in position 1081 to the
nucleobase guanine. In addition, a cleavage site for the Sca
restriction enzyme was generated by adding a linker sequence (SEQ
ID NO:28) to the 5' end of the promoter sequence and is located in
positions 607 to 612. The 489 bp promoter fragment obtained from
this was functionally linked to the start codon of the gene
cg0832.
[0271] The construct has a 600 bp flanking sequence in the
downstream region (positions 1096 to 1695) and a 600 bp flanking
sequence in the upstream (positions 7 to 606) region of the
promoter, for integration of the promoter by means of homologous
recombination.
[0272] Sequences containing cleavage sites for the restriction
enzymes XbaI (positions 1 to 6) and HindIII (positions 1696 to
1701) were added to the flanking regions, thereby enabling the
construct to be cloned into the exchange vector pK18mobsacB.
[0273] The 1701 bp fragment was digested with the XbaI and HindIII
restriction enzymes and then subcloned into the mobilizable vector
pK18mobsacB described by Schafer, et al. (Gene 145:69-73 (1994)),
in order to enable the promoter to integrate upstream of the gene
cg0832. To this end, pK18mobsacB was digested with the XbaI and
HindIII restriction enzymes. The vector prepared in this way was
mixed with the fragment, and the mixture was treated with the
Ready-To-Go T4 DNA ligase kit (Amersham-Pharmacia, Freiburg,
Germany).
[0274] Subsequently, the E. coli strain S17-1 (Simon, et al.,
Bio/Technologie 1:784-791, (1993)) was transformed with the
ligation mixture (Hanahan, In. DNA cloning. A practical approach.
Vol. I. ILR-Press, Cold Spring Harbor, N.Y., 1989).
Plasmid-harbouring cells were selected by plating the
transformation mixture onto LB agar (Sambrock, et al., Molecular
Cloning: a laboratory manual. 2.sup.nd Ed. Cold Spring Habor, N.Y.,
1989) supplemented with 50 mg/l kanamycin.
[0275] Plasmid DNA was isolated from a transformant with the aid of
the QIAprep Spin Miniprep kit from Qiagen and checked by
restriction cleavage with the XbaI and HindIII enzymes and
subsequent agarose gel electrophoresis. The plasmid is referred to
as pK18mobsacB_Pgap_cg0832 and is depicted in FIG. 3.
Example 6
Preparation of C. glutamicum Strain DM1933_Pgap_cg0832
[0276] The aim was to introduce the mutation Pgap_cg0832 into the
strain Corynebacterium glutamicum DM1933. The DM1933 strain is an
aminoethylcysteine-resistant mutant of Corynebacterium glutamicum
ATCC13032 and has been described in a publication (Blombach et al.,
Appl. and Env. Microbiol. 419-427 (2009)).
[0277] The vector pK18mobsacB_Pgap_cg0832 described in Example 5
was transferred by conjugation according to the protocol of
Schafer, et al. (J. Microbiol. 172:1663-1666 (1990)) into the C.
glutamicum strain DM1933. Said vector cannot self-replicate in
DM1933 and is retained in the cell only if it has integrated into
the chromosome as a result of a recombination event.
Transconjugants, i.e. clones with integrated
pK18mobsacB_Pgap_cg0832, were selected by plating the conjugation
mixture onto LB agar supplemented with 25 mg/l kanamycin and 50
mg/l nalidixic acid. Kanamycin-resistant transconjugants were then
streaked out on LB-agar plates supplemented with kanamycin (25
mg/1) and incubated at 33.degree. C. for 24 hours. Mutants in which
the plasmid had been excised as a result of a second recombination
event were selected by culturing the clones non-selectively in
liquid LB medium for 30 hours, then streaking them out on LB agar
supplemented with 10% sucrose and incubating at 33.degree. C. for
24 hours.
[0278] Plasmid pK18mobsacB_Pgap_cg0832, like the starting plasmid
pK18mobsacB, contains a copy of the sacB gene coding for Bacillus
subtilis levansucrase, in addition to the kanamycin resistance
gene. Sucrose-inducible expression of the sacB gene leads to the
formation of levansucrase which catalyses the synthesis of the
product levan which is toxic to C. glutamicum. Consequently, only
those clones in which the integrated pK18mobsacB_Pgap_cg0832 has
been excised as a result of a second recombination event grow on
sucrose-supplemented LB agar. Depending on the location of the
second recombination event in relation to the site of mutation, the
mutation is incorporated during excision or the host chromosome
remains in the original state.
[0279] Subsequently, a clone was identified in which the desired
exchange, i.e. incorporation of the Pgap_cg0832 cassette into the
chromosome, had occurred. To this end, 50 clones with the phenotype
"growth in the presence of sucrose" and "no growth in the presence
of kanamycin" were checked for integration of the Pgap_cg0832
cassette using the polymerase chain reaction (PCR). For this, the
following synthetic oligonucleotides (primers) were used:
TABLE-US-00007 primer cg0832_1.p (SEQ ID NO: 28): 5'
GCTGGAATACGGAGTGAACC 3' primer cg0832_2.p (SEQ ID NO: 29): 5'
GGGATTGCCCAAGGGATAAG 3'
[0280] The primers shown were synthesized by MWG Biotech
(Ebersberg, Germany). The primers cg0832_1.p and cg0832_2.p enable
a 570 bp DNA fragment to be amplified in the case of the wild-type
arrangement. The size of the amplicon is 1059 bp in the case of
integration of the Pgap_cg0832 construct into the chromosome.
[0281] The PCR reactions were carried out using the Taq PCR core
kit from Quiagen (Hilden, Germany), comprising Therms aquaticus Taq
DNA polymerase, in an Eppendorf Mastercycler (Hamburg, Germany).
The conditions in the reaction mixture were adjusted according to
the manufacturer's instructions. The PCR mixture was first
subjected to an initial denaturation at 94.degree. C. for 2
minutes. This was followed by 35 repeats of a denaturing step at
94.degree. C. for 30 seconds, a step of binding the primers to the
DNA at 57.degree. C. for 30 seconds, and the extension step for
extending the primers at 72.degree. C. for 60 s. After the final
extension step at 72.degree. C. for 5 min, the products amplified
in this way were checked by electrophoresis in an agarose gel.
[0282] In this way mutants were identified which contain the
Pgap_cg0832 cassette in an integrated form, with one of the strains
obtained being named C. glutamicum DM1933_Pgap_cg0832.
Example 7
Production of L-Lysine
[0283] The C. glutamicum strain DM1933 Pgap_cg0832 obtained in
Example 6 and the starting strain DM1933 were cultured in a
nutrient medium suitable for lysine production, and the lysine
content in the culture supernatant was determined.
[0284] For this purpose, the strains were first incubated on an
agar plate (brain-heart agar) at 33.degree. C. for 24 hours.
Starting from this agar plate culture, a preculture was inoculated
(10 ml of medium in a 100 ml conical flask). The medium used for
the preculture and the main culture was MM medium (see Table 4).
CSL, MOPS and the salt solution were adjusted to pH 7 with aqueous
ammonia and autoclaved. The sterile substrate and vitamin solutions
and the dry-autoclaved CaCO3 were then added.
[0285] The preculture was incubated on a shaker at 250 rpm and
33.degree. C. for 24 hours. A main culture was inoculated from this
preculture such that the starting OD (660 nm) of the main culture
was 0.1 OD. Culturing was carried out in 10 ml volumes in a 100 ml
conical flask with baffles at a temperature of 33.degree. C. and
80% humidity.
[0286] After 20 and 40 hours (h) the OD at a measurement wavelength
of 660 nm was determined using a Biomek 1000 (Beckmann Instruments
GmbH, Munich). The amount of lysine produced was determined by ion
exchange chromatography and post-column derivatization with
ninhydrin detection, using an amino acid analyzer from
Eppendorf-BioTronik (Hamburg, Germany). The trehalose concentration
was determined by means of HPLC, using an analyzer from Dionex GmbH
(65510 Idstein, Germany). Table 6 depicts the result of the
experiment.
TABLE-US-00008 TABLE 6 Production of L-lysine and trehalose
concentration measurement. All values are averages of 3 independent
experiments with the strains listed; n.d. = not determined.
L-Lysine OD Trehalose HCl (g/l) (660 nm) (g/l) Strain 20 h 40 h 20
h 40 h 20 h 40 h DM1933 12.83 13.65 14.75 12.19 n.d. 3.03
DM1933_Pgap_cg0832 12.91 14.15 15.11 12.34 n.d. 0
[0287] The result indicates that trehalose is no longer produced as
a by-product when lysine is produced from trehalose using a strain
in which only expression of the trehalose importer subunits encoded
by cg0832 and cg0831 (in both cases a permease subunit) is
enhanced. It is furthermore evident that the yield of the desired
product (L-lysine) is increased.
[0288] All references cited herein are fully incorporated by
reference. Having now fully described the invention, it will be
understood by one of skill in the art that the invention may be
performed within a wide and equivalent range of conditions,
parameters, and the like, without affecting the spirit or scope of
the invention or any embodiment thereof
Sequence CWU 1
1
3111299DNACorynebacterium glutamicumCDS(151)..(1149)ATP-binding and
-hydrolyzing (ATPase) protein of the ABC transporter having the
activity of a trehalose importer 1ctttgagctt gatgccgccc caaaagagtt
gttgccaccg atcgcgaact ttggcagtag 60ccatgcgttc tgctcctgac cttgaacagc
ggtcccaatt tagacccgct aaacccacaa 120tgtgtactgg tgctggtaat
ttagtagaac atg gca acg gtc aca ttc gac aag 174 Met Ala Thr Val Thr
Phe Asp Lys 1 5 gtc aca atc cgg tac ccc ggc gcg gag cgc gca aca gtt
cat gag ctt 222Val Thr Ile Arg Tyr Pro Gly Ala Glu Arg Ala Thr Val
His Glu Leu 10 15 20 gat tta gat atc gct gat ggc gag ttt ttg gtg
ctc gtc ggc cct tcg 270Asp Leu Asp Ile Ala Asp Gly Glu Phe Leu Val
Leu Val Gly Pro Ser 25 30 35 40 ggt tgt ggt aaa tcc act acg ctg cgt
gct ttg gcg ggg ctt gag ggc 318Gly Cys Gly Lys Ser Thr Thr Leu Arg
Ala Leu Ala Gly Leu Glu Gly 45 50 55 gtg gag tcg ggt gtg atc aaa
att gat ggc aag gat gtc act ggt cag 366Val Glu Ser Gly Val Ile Lys
Ile Asp Gly Lys Asp Val Thr Gly Gln 60 65 70 gag ccg gcg gat cgc
gat atc gcg atg gtg ttc cag aat tat gct ctg 414Glu Pro Ala Asp Arg
Asp Ile Ala Met Val Phe Gln Asn Tyr Ala Leu 75 80 85 tac cct cac
atg acg gtg gcg aag aat atg ggt ttt gcg ctg aag ttg 462Tyr Pro His
Met Thr Val Ala Lys Asn Met Gly Phe Ala Leu Lys Leu 90 95 100 gct
aag ctg ccg cag gcg cag atc gat gcg aag gtc aat gag gct gcg 510Ala
Lys Leu Pro Gln Ala Gln Ile Asp Ala Lys Val Asn Glu Ala Ala 105 110
115 120 gaa att ctt ggg ttg acg gag ttt ttg gat cgc aag cct aag gat
tta 558Glu Ile Leu Gly Leu Thr Glu Phe Leu Asp Arg Lys Pro Lys Asp
Leu 125 130 135 tcg ggt ggt cag cgt cag cgt gtg gcg atg ggt cgc gcg
ttg gtg cgt 606Ser Gly Gly Gln Arg Gln Arg Val Ala Met Gly Arg Ala
Leu Val Arg 140 145 150 gat ccg aag gtg ttc ctc atg gat gag ccg ctg
tcc aac ctg gat gcg 654Asp Pro Lys Val Phe Leu Met Asp Glu Pro Leu
Ser Asn Leu Asp Ala 155 160 165 aaa ttg cgc gtg caa acc cgc gcg gag
gtc gct gct ttg cag cgt cgc 702Lys Leu Arg Val Gln Thr Arg Ala Glu
Val Ala Ala Leu Gln Arg Arg 170 175 180 ctg ggc acc acc acg gtg tat
gtc acc cac gat cag gtt gag gca atg 750Leu Gly Thr Thr Thr Val Tyr
Val Thr His Asp Gln Val Glu Ala Met 185 190 195 200 acg atg ggc gat
cgg gtt gcg gtg ctc aag gac ggg ttg ctg cag cag 798Thr Met Gly Asp
Arg Val Ala Val Leu Lys Asp Gly Leu Leu Gln Gln 205 210 215 gtc gca
ccg ccc agg gag ctt tac gac gcc ccg gtc aac gaa ttc gtt 846Val Ala
Pro Pro Arg Glu Leu Tyr Asp Ala Pro Val Asn Glu Phe Val 220 225 230
gcg ggc ttc atc ggc tcg ccg tcc atg aac ctc ttc cct gcc aac ggg
894Ala Gly Phe Ile Gly Ser Pro Ser Met Asn Leu Phe Pro Ala Asn Gly
235 240 245 cac aag atg ggt gtg cgc ccg gag aag atg ctg gtc aat gag
acc cct 942His Lys Met Gly Val Arg Pro Glu Lys Met Leu Val Asn Glu
Thr Pro 250 255 260 gag ggt ttc aca agc att gat gct gtg gtg gat atc
gtc gag gag ctt 990Glu Gly Phe Thr Ser Ile Asp Ala Val Val Asp Ile
Val Glu Glu Leu 265 270 275 280 ggc tcc gaa tcg tat gtt tat gcc act
tgg gag ggc cac cgc ctg gtg 1038Gly Ser Glu Ser Tyr Val Tyr Ala Thr
Trp Glu Gly His Arg Leu Val 285 290 295 gcc cgt tgg gtg gaa ggc ccc
gtg cca gcc cct ggc acg cct gtg act 1086Ala Arg Trp Val Glu Gly Pro
Val Pro Ala Pro Gly Thr Pro Val Thr 300 305 310 ttt tcc tat gat gcg
gcg cag gcg cat cat ttc gat ctg gag tcg ggc 1134Phe Ser Tyr Asp Ala
Ala Gln Ala His His Phe Asp Leu Glu Ser Gly 315 320 325 gag cgt atc
gct tag tttcggacgt ggggaggcgt cgaaaagcat ctttattttt 1189Glu Arg Ile
Ala 330 gaccctccgg gggtgattta acctaaaatt ccacacaaac gtgttcgagg
tcattagatt 1249gataagcatc tgttgttaag aaaggtgact tcctatgtcc
tcgatttccc 12992332PRTCorynebacterium glutamicum 2Met Ala Thr Val
Thr Phe Asp Lys Val Thr Ile Arg Tyr Pro Gly Ala 1 5 10 15 Glu Arg
Ala Thr Val His Glu Leu Asp Leu Asp Ile Ala Asp Gly Glu 20 25 30
Phe Leu Val Leu Val Gly Pro Ser Gly Cys Gly Lys Ser Thr Thr Leu 35
40 45 Arg Ala Leu Ala Gly Leu Glu Gly Val Glu Ser Gly Val Ile Lys
Ile 50 55 60 Asp Gly Lys Asp Val Thr Gly Gln Glu Pro Ala Asp Arg
Asp Ile Ala 65 70 75 80 Met Val Phe Gln Asn Tyr Ala Leu Tyr Pro His
Met Thr Val Ala Lys 85 90 95 Asn Met Gly Phe Ala Leu Lys Leu Ala
Lys Leu Pro Gln Ala Gln Ile 100 105 110 Asp Ala Lys Val Asn Glu Ala
Ala Glu Ile Leu Gly Leu Thr Glu Phe 115 120 125 Leu Asp Arg Lys Pro
Lys Asp Leu Ser Gly Gly Gln Arg Gln Arg Val 130 135 140 Ala Met Gly
Arg Ala Leu Val Arg Asp Pro Lys Val Phe Leu Met Asp 145 150 155 160
Glu Pro Leu Ser Asn Leu Asp Ala Lys Leu Arg Val Gln Thr Arg Ala 165
170 175 Glu Val Ala Ala Leu Gln Arg Arg Leu Gly Thr Thr Thr Val Tyr
Val 180 185 190 Thr His Asp Gln Val Glu Ala Met Thr Met Gly Asp Arg
Val Ala Val 195 200 205 Leu Lys Asp Gly Leu Leu Gln Gln Val Ala Pro
Pro Arg Glu Leu Tyr 210 215 220 Asp Ala Pro Val Asn Glu Phe Val Ala
Gly Phe Ile Gly Ser Pro Ser 225 230 235 240 Met Asn Leu Phe Pro Ala
Asn Gly His Lys Met Gly Val Arg Pro Glu 245 250 255 Lys Met Leu Val
Asn Glu Thr Pro Glu Gly Phe Thr Ser Ile Asp Ala 260 265 270 Val Val
Asp Ile Val Glu Glu Leu Gly Ser Glu Ser Tyr Val Tyr Ala 275 280 285
Thr Trp Glu Gly His Arg Leu Val Ala Arg Trp Val Glu Gly Pro Val 290
295 300 Pro Ala Pro Gly Thr Pro Val Thr Phe Ser Tyr Asp Ala Ala Gln
Ala 305 310 315 320 His His Phe Asp Leu Glu Ser Gly Glu Arg Ile Ala
325 330 31575DNACorynebacterium
glutamicumCDS(151)..(1425)periplasmic (or lipoprotein)
substrate-binding protein of the ABC transporter having the
activity of a trehalose importer 3cgagcgtatc gcttagtttc ggacgtgggg
aggcgtcgaa aagcatcttt atttttgacc 60ctccgggggt gatttaacct aaaattccac
acaaacgtgt tcgaggtcat tagattgata 120agcatctgtt gttaagaaag
gtgacttcct atg tcc tcg att tcc cgc aag acc 174 Met Ser Ser Ile Ser
Arg Lys Thr 1 5 ggc gcg tca ctt gca gcc acc aca ctg ttg gca gcg atc
gca ctg gcc 222Gly Ala Ser Leu Ala Ala Thr Thr Leu Leu Ala Ala Ile
Ala Leu Ala 10 15 20 ggt tgt agt tca gac tca agc tcc gac tcc aca
gat tcc acc gct agc 270Gly Cys Ser Ser Asp Ser Ser Ser Asp Ser Thr
Asp Ser Thr Ala Ser 25 30 35 40 gaa ggc gca gac agc cgc ggc ccc atc
acc ttt gcg atg ggc aaa aac 318Glu Gly Ala Asp Ser Arg Gly Pro Ile
Thr Phe Ala Met Gly Lys Asn 45 50 55 gac acc gac aaa gtc att ccg
atc atc gac cgc tgg aac gaa gcc cac 366Asp Thr Asp Lys Val Ile Pro
Ile Ile Asp Arg Trp Asn Glu Ala His 60 65 70 ccc gat gag cag gta
acg ctc aac gaa ctc gcc ggt gaa gcc gac gcg 414Pro Asp Glu Gln Val
Thr Leu Asn Glu Leu Ala Gly Glu Ala Asp Ala 75 80 85 cag cgc gaa
acc ctc gtg caa tcc ctg cag gcc ggc aac tct gac tac 462Gln Arg Glu
Thr Leu Val Gln Ser Leu Gln Ala Gly Asn Ser Asp Tyr 90 95 100 gac
gtc atg gcg ctc gac gtc atc tgg acc gca gac ttc gcg gca aac 510Asp
Val Met Ala Leu Asp Val Ile Trp Thr Ala Asp Phe Ala Ala Asn 105 110
115 120 caa tgg ctc gca cca ctt gaa ggc gac ctc gag gta gac acc tcc
gga 558Gln Trp Leu Ala Pro Leu Glu Gly Asp Leu Glu Val Asp Thr Ser
Gly 125 130 135 ctg ctg caa tcc acc gtg gat tcc gca acc tac aac ggc
acc ctc tac 606Leu Leu Gln Ser Thr Val Asp Ser Ala Thr Tyr Asn Gly
Thr Leu Tyr 140 145 150 gca ctg cca cag aac acc aac ggc cag cta ctg
ttc cgc aac acc gaa 654Ala Leu Pro Gln Asn Thr Asn Gly Gln Leu Leu
Phe Arg Asn Thr Glu 155 160 165 atc atc cca gaa gca cca gca aac tgg
gct gac ctc gtg gaa tcc tgc 702Ile Ile Pro Glu Ala Pro Ala Asn Trp
Ala Asp Leu Val Glu Ser Cys 170 175 180 acg ctt gct gaa gaa gca ggc
gtt gat tgc ctg acc act cag ctc aag 750Thr Leu Ala Glu Glu Ala Gly
Val Asp Cys Leu Thr Thr Gln Leu Lys 185 190 195 200 cag tac gaa ggc
ctt tca gtg aac acc atc ggc ttc atc gaa ggt tgg 798Gln Tyr Glu Gly
Leu Ser Val Asn Thr Ile Gly Phe Ile Glu Gly Trp 205 210 215 gga ggc
agc gtc cta gac gat gac ggc aac gtc acc gta gac agc gac 846Gly Gly
Ser Val Leu Asp Asp Asp Gly Asn Val Thr Val Asp Ser Asp 220 225 230
gac gcc aag gca ggc ctt caa gcg ctt gtc gac ggc ttc gac gac ggc
894Asp Ala Lys Ala Gly Leu Gln Ala Leu Val Asp Gly Phe Asp Asp Gly
235 240 245 acc atc tcc aag gca tcc ctt gca gcg acc gaa gaa gaa acc
aac ctc 942Thr Ile Ser Lys Ala Ser Leu Ala Ala Thr Glu Glu Glu Thr
Asn Leu 250 255 260 gca ttc acc gaa ggc caa acc gcc tac gcc att aac
tgg cca tac atg 990Ala Phe Thr Glu Gly Gln Thr Ala Tyr Ala Ile Asn
Trp Pro Tyr Met 265 270 275 280 tac acc aac tcc gaa gaa gcc gaa gca
acc gca ggc aaa ttc gaa gta 1038Tyr Thr Asn Ser Glu Glu Ala Glu Ala
Thr Ala Gly Lys Phe Glu Val 285 290 295 cag ccc ctc gta ggt aaa gac
ggc gtc ggc gta tcc acc ctt ggt ggc 1086Gln Pro Leu Val Gly Lys Asp
Gly Val Gly Val Ser Thr Leu Gly Gly 300 305 310 tac aac aac ggc atc
aac gtc aac tcc gaa aac aag gca acc gcc cgc 1134Tyr Asn Asn Gly Ile
Asn Val Asn Ser Glu Asn Lys Ala Thr Ala Arg 315 320 325 gac ttc atc
gaa ttc atc atc aac gaa gag aac caa acc tgg ttc gcg 1182Asp Phe Ile
Glu Phe Ile Ile Asn Glu Glu Asn Gln Thr Trp Phe Ala 330 335 340 gac
aac tcc ttc cca cca gtt ctg gca tcc atc tac gat gat gag tcc 1230Asp
Asn Ser Phe Pro Pro Val Leu Ala Ser Ile Tyr Asp Asp Glu Ser 345 350
355 360 ctt gtt gag cag tac cca tac ctg cca gca ctg aag gaa tcc ctg
gaa 1278Leu Val Glu Gln Tyr Pro Tyr Leu Pro Ala Leu Lys Glu Ser Leu
Glu 365 370 375 aac gca gca cca cgc cca gtg tct cct ttc tac cca gcc
atc tcc aag 1326Asn Ala Ala Pro Arg Pro Val Ser Pro Phe Tyr Pro Ala
Ile Ser Lys 380 385 390 gca atc cag gac aac gcc tac gca gcg ctt aac
ggc aac gtc gac gtt 1374Ala Ile Gln Asp Asn Ala Tyr Ala Ala Leu Asn
Gly Asn Val Asp Val 395 400 405 gac cag gca acc acc gat atg aag gca
gcg atc gaa aac gct tcc agc 1422Asp Gln Ala Thr Thr Asp Met Lys Ala
Ala Ile Glu Asn Ala Ser Ser 410 415 420 tag ttcggtaatt tagttcattc
tccggccacc ttccctgaaa tccttagcgg 1475atttccacaa aggtggccgg
agttttgtcc tattgttggg tgtaattgaa cttgtgtgaa 1535aggagtccgg
atggcttccg gcaaagatct tcaagtttcc 15754424PRTCorynebacterium
glutamicum 4Met Ser Ser Ile Ser Arg Lys Thr Gly Ala Ser Leu Ala Ala
Thr Thr 1 5 10 15 Leu Leu Ala Ala Ile Ala Leu Ala Gly Cys Ser Ser
Asp Ser Ser Ser 20 25 30 Asp Ser Thr Asp Ser Thr Ala Ser Glu Gly
Ala Asp Ser Arg Gly Pro 35 40 45 Ile Thr Phe Ala Met Gly Lys Asn
Asp Thr Asp Lys Val Ile Pro Ile 50 55 60 Ile Asp Arg Trp Asn Glu
Ala His Pro Asp Glu Gln Val Thr Leu Asn 65 70 75 80 Glu Leu Ala Gly
Glu Ala Asp Ala Gln Arg Glu Thr Leu Val Gln Ser 85 90 95 Leu Gln
Ala Gly Asn Ser Asp Tyr Asp Val Met Ala Leu Asp Val Ile 100 105 110
Trp Thr Ala Asp Phe Ala Ala Asn Gln Trp Leu Ala Pro Leu Glu Gly 115
120 125 Asp Leu Glu Val Asp Thr Ser Gly Leu Leu Gln Ser Thr Val Asp
Ser 130 135 140 Ala Thr Tyr Asn Gly Thr Leu Tyr Ala Leu Pro Gln Asn
Thr Asn Gly 145 150 155 160 Gln Leu Leu Phe Arg Asn Thr Glu Ile Ile
Pro Glu Ala Pro Ala Asn 165 170 175 Trp Ala Asp Leu Val Glu Ser Cys
Thr Leu Ala Glu Glu Ala Gly Val 180 185 190 Asp Cys Leu Thr Thr Gln
Leu Lys Gln Tyr Glu Gly Leu Ser Val Asn 195 200 205 Thr Ile Gly Phe
Ile Glu Gly Trp Gly Gly Ser Val Leu Asp Asp Asp 210 215 220 Gly Asn
Val Thr Val Asp Ser Asp Asp Ala Lys Ala Gly Leu Gln Ala 225 230 235
240 Leu Val Asp Gly Phe Asp Asp Gly Thr Ile Ser Lys Ala Ser Leu Ala
245 250 255 Ala Thr Glu Glu Glu Thr Asn Leu Ala Phe Thr Glu Gly Gln
Thr Ala 260 265 270 Tyr Ala Ile Asn Trp Pro Tyr Met Tyr Thr Asn Ser
Glu Glu Ala Glu 275 280 285 Ala Thr Ala Gly Lys Phe Glu Val Gln Pro
Leu Val Gly Lys Asp Gly 290 295 300 Val Gly Val Ser Thr Leu Gly Gly
Tyr Asn Asn Gly Ile Asn Val Asn 305 310 315 320 Ser Glu Asn Lys Ala
Thr Ala Arg Asp Phe Ile Glu Phe Ile Ile Asn 325 330 335 Glu Glu Asn
Gln Thr Trp Phe Ala Asp Asn Ser Phe Pro Pro Val Leu 340 345 350 Ala
Ser Ile Tyr Asp Asp Glu Ser Leu Val Glu Gln Tyr Pro Tyr Leu 355 360
365 Pro Ala Leu Lys Glu Ser Leu Glu Asn Ala Ala Pro Arg Pro Val Ser
370 375 380 Pro Phe Tyr Pro Ala Ile Ser Lys Ala Ile Gln Asp Asn Ala
Tyr Ala 385 390 395 400 Ala Leu Asn Gly Asn Val Asp Val Asp Gln Ala
Thr Thr Asp Met Lys 405 410 415 Ala Ala Ile Glu Asn Ala Ser Ser 420
5756DNACorynebacterium glutamicumCDS(151)..(606)function unknown
5aaggcagcga tcgaaaacgc ttccagctag ttcggtaatt tagttcattc tccggccacc
60ttccctgaaa tccttagcgg atttccacaa aggtggccgg agttttgtcc tattgttggg
120tgtaattgaa cttgtgtgaa aggagtccgg atg gct tcc ggc aaa gat ctt caa
174 Met Ala Ser Gly Lys Asp Leu Gln 1 5 gtt tcc aca ttt ggc tac atc
tcc cgc tgc ccc gtg cag gtc tac gaa
222Val Ser Thr Phe Gly Tyr Ile Ser Arg Cys Pro Val Gln Val Tyr Glu
10 15 20 gca atc gca gat ccc aga caa cta gaa cgc tac ttc gcc acc
ggc gga 270Ala Ile Ala Asp Pro Arg Gln Leu Glu Arg Tyr Phe Ala Thr
Gly Gly 25 30 35 40 gta tct ggc cgc ctc gaa acc gga tcg act gtc tat
tgg gac ttc gtt 318Val Ser Gly Arg Leu Glu Thr Gly Ser Thr Val Tyr
Trp Asp Phe Val 45 50 55 gat ttt ccc ggt gcg ttt ccg gtc caa gtt
gtc tca gct aca cag gct 366Asp Phe Pro Gly Ala Phe Pro Val Gln Val
Val Ser Ala Thr Gln Ala 60 65 70 gaa cac att gaa ctc cgc tgg gga
caa gca aat gag ctg cgt tcc gtc 414Glu His Ile Glu Leu Arg Trp Gly
Gln Ala Asn Glu Leu Arg Ser Val 75 80 85 aac ttc gag ttc gaa cct
ttt aga aat ttc acc cgc acg aaa ctc acc 462Asn Phe Glu Phe Glu Pro
Phe Arg Asn Phe Thr Arg Thr Lys Leu Thr 90 95 100 atc acc gaa ggc
agt tgg ccg ctc act ccc gca gga gcc caa gag gct 510Ile Thr Glu Gly
Ser Trp Pro Leu Thr Pro Ala Gly Ala Gln Glu Ala 105 110 115 120 ctg
ggc agc cag atg gga tgg act ggc atg ctg tcc gca cta aaa gcg 558Leu
Gly Ser Gln Met Gly Trp Thr Gly Met Leu Ser Ala Leu Lys Ala 125 130
135 tgg ctg gaa tac gga gtg aac ctc cgc gac ggg ttt tat aag caa tag
606Trp Leu Glu Tyr Gly Val Asn Leu Arg Asp Gly Phe Tyr Lys Gln 140
145 150 gcaatgtgtc catcacgatg tgtggcggat tatgatccat gtaacaagaa
tgtgcagttt 666cacagaactg acaatcaact tattttgacc tgacaaaagg
agcgacgaca catggccaca 726ttcaaacagg ccagaagcgc tgcctggctg
7566151PRTCorynebacterium glutamicum 6Met Ala Ser Gly Lys Asp Leu
Gln Val Ser Thr Phe Gly Tyr Ile Ser 1 5 10 15 Arg Cys Pro Val Gln
Val Tyr Glu Ala Ile Ala Asp Pro Arg Gln Leu 20 25 30 Glu Arg Tyr
Phe Ala Thr Gly Gly Val Ser Gly Arg Leu Glu Thr Gly 35 40 45 Ser
Thr Val Tyr Trp Asp Phe Val Asp Phe Pro Gly Ala Phe Pro Val 50 55
60 Gln Val Val Ser Ala Thr Gln Ala Glu His Ile Glu Leu Arg Trp Gly
65 70 75 80 Gln Ala Asn Glu Leu Arg Ser Val Asn Phe Glu Phe Glu Pro
Phe Arg 85 90 95 Asn Phe Thr Arg Thr Lys Leu Thr Ile Thr Glu Gly
Ser Trp Pro Leu 100 105 110 Thr Pro Ala Gly Ala Gln Glu Ala Leu Gly
Ser Gln Met Gly Trp Thr 115 120 125 Gly Met Leu Ser Ala Leu Lys Ala
Trp Leu Glu Tyr Gly Val Asn Leu 130 135 140 Arg Asp Gly Phe Tyr Lys
Gln 145 150 71335DNACorynebacterium
glutamicumCDS(151)..(1185)integral membrane protein (permease) of
the ABC transporter having the activity of a trehalose importer
7tacggagtga acctccgcga cgggttttat aagcaatagg caatgtgtcc atcacgatgt
60gtggcggatt atgatccatg taacaagaat gtgcagtttc acagaactga caatcaactt
120attttgacct gacaaaagga gcgacgacac atg gcc aca ttc aaa cag gcc aga
174 Met Ala Thr Phe Lys Gln Ala Arg 1 5 agc gct gcc tgg ctg atc gcc
ccc gcc ctc gtg gtc ctt gca gtg gtg 222Ser Ala Ala Trp Leu Ile Ala
Pro Ala Leu Val Val Leu Ala Val Val 10 15 20 atc gga tat ccc atc
gtc cga gca att tgg cta tcc ttc cag gcc gac 270Ile Gly Tyr Pro Ile
Val Arg Ala Ile Trp Leu Ser Phe Gln Ala Asp 25 30 35 40 aaa ggc ctc
gac ccc acc acc gga ctc ttc acc gac ggt ggc ttc gca 318Lys Gly Leu
Asp Pro Thr Thr Gly Leu Phe Thr Asp Gly Gly Phe Ala 45 50 55 gga
cta gac aat tac ctc tac tgg ctc acc caa cga tgc atg ggt tca 366Gly
Leu Asp Asn Tyr Leu Tyr Trp Leu Thr Gln Arg Cys Met Gly Ser 60 65
70 gac ggc acc atc cgt acc tgc cca ccc ggc aca cta gcc acc gac ttc
414Asp Gly Thr Ile Arg Thr Cys Pro Pro Gly Thr Leu Ala Thr Asp Phe
75 80 85 tgg cca gca cta cgc atc acg ttg ttc ttc acc gtg gtt acc
gtc ggc 462Trp Pro Ala Leu Arg Ile Thr Leu Phe Phe Thr Val Val Thr
Val Gly 90 95 100 ttg gaa act atc ctc ggc acc gcc atg gca ctg atc
atg aac aaa gaa 510Leu Glu Thr Ile Leu Gly Thr Ala Met Ala Leu Ile
Met Asn Lys Glu 105 110 115 120 ttc cgt ggc cgc gca ctt gtt cgc gca
gcg att ctt atc cct tgg gca 558Phe Arg Gly Arg Ala Leu Val Arg Ala
Ala Ile Leu Ile Pro Trp Ala 125 130 135 atc ccc acc gcc gtc acc gca
aaa ctg tgg cag ttc atc ttc gca cca 606Ile Pro Thr Ala Val Thr Ala
Lys Leu Trp Gln Phe Ile Phe Ala Pro 140 145 150 caa ggc atc atc aac
tcc atg ttt gga ctt agt gtc agt tgg acc acc 654Gln Gly Ile Ile Asn
Ser Met Phe Gly Leu Ser Val Ser Trp Thr Thr 155 160 165 gat ccg tgg
gca gct aga gcc gcc gtc att ctt gcc gac gtc tgg aaa 702Asp Pro Trp
Ala Ala Arg Ala Ala Val Ile Leu Ala Asp Val Trp Lys 170 175 180 acc
aca cca ttc atg gca ctg ctg atc ctc gcc ggt ctg caa atg atc 750Thr
Thr Pro Phe Met Ala Leu Leu Ile Leu Ala Gly Leu Gln Met Ile 185 190
195 200 ccg aag gaa acc tac gaa gca gcc cgc gtc gat ggc gca acc gcg
tgg 798Pro Lys Glu Thr Tyr Glu Ala Ala Arg Val Asp Gly Ala Thr Ala
Trp 205 210 215 cag caa ttc acc aag atc acc ctc ccg ctg gtg cgc cca
gct ttg atg 846Gln Gln Phe Thr Lys Ile Thr Leu Pro Leu Val Arg Pro
Ala Leu Met 220 225 230 gtg gca gta ctc ttc cgc acc ctc gat gcg cta
cgc atg tat gac ctc 894Val Ala Val Leu Phe Arg Thr Leu Asp Ala Leu
Arg Met Tyr Asp Leu 235 240 245 ccc gtc atc atg atc tcc agc tcc tcc
aac tcc ccc acc gct gtt atc 942Pro Val Ile Met Ile Ser Ser Ser Ser
Asn Ser Pro Thr Ala Val Ile 250 255 260 tcc cag ctg gtt gtg gaa gac
atg cgc caa aac aac ttc aac tcc gct 990Ser Gln Leu Val Val Glu Asp
Met Arg Gln Asn Asn Phe Asn Ser Ala 265 270 275 280 tcc gcc ctt tcc
aca ctg atc ttc ctg ctg atc ttc ttc gtg gcg ttc 1038Ser Ala Leu Ser
Thr Leu Ile Phe Leu Leu Ile Phe Phe Val Ala Phe 285 290 295 atc atg
atc cga ttc ctc ggc gca gat gtt tcg ggc caa cgc gga ata 1086Ile Met
Ile Arg Phe Leu Gly Ala Asp Val Ser Gly Gln Arg Gly Ile 300 305 310
aag aaa aag aaa ctg ggc gga acc aag gat gag aaa ccc acc gct aag
1134Lys Lys Lys Lys Leu Gly Gly Thr Lys Asp Glu Lys Pro Thr Ala Lys
315 320 325 gat gct gtt gta aag gcc gat tct gct gtg aag gaa gcc gct
aag cca 1182Asp Ala Val Val Lys Ala Asp Ser Ala Val Lys Glu Ala Ala
Lys Pro 330 335 340 tga ctaaacgaac aaaaggactc atcctcaact acgccggagt
ggtgttcatc 1235ctcttctggg gactagctcc cttctactgg atggttatca
ccgcactgcg cgattccaag 1295cacacctttg acaccacccc atggccaacg
cacgtcacct 13358344PRTCorynebacterium glutamicum 8Met Ala Thr Phe
Lys Gln Ala Arg Ser Ala Ala Trp Leu Ile Ala Pro 1 5 10 15 Ala Leu
Val Val Leu Ala Val Val Ile Gly Tyr Pro Ile Val Arg Ala 20 25 30
Ile Trp Leu Ser Phe Gln Ala Asp Lys Gly Leu Asp Pro Thr Thr Gly 35
40 45 Leu Phe Thr Asp Gly Gly Phe Ala Gly Leu Asp Asn Tyr Leu Tyr
Trp 50 55 60 Leu Thr Gln Arg Cys Met Gly Ser Asp Gly Thr Ile Arg
Thr Cys Pro 65 70 75 80 Pro Gly Thr Leu Ala Thr Asp Phe Trp Pro Ala
Leu Arg Ile Thr Leu 85 90 95 Phe Phe Thr Val Val Thr Val Gly Leu
Glu Thr Ile Leu Gly Thr Ala 100 105 110 Met Ala Leu Ile Met Asn Lys
Glu Phe Arg Gly Arg Ala Leu Val Arg 115 120 125 Ala Ala Ile Leu Ile
Pro Trp Ala Ile Pro Thr Ala Val Thr Ala Lys 130 135 140 Leu Trp Gln
Phe Ile Phe Ala Pro Gln Gly Ile Ile Asn Ser Met Phe 145 150 155 160
Gly Leu Ser Val Ser Trp Thr Thr Asp Pro Trp Ala Ala Arg Ala Ala 165
170 175 Val Ile Leu Ala Asp Val Trp Lys Thr Thr Pro Phe Met Ala Leu
Leu 180 185 190 Ile Leu Ala Gly Leu Gln Met Ile Pro Lys Glu Thr Tyr
Glu Ala Ala 195 200 205 Arg Val Asp Gly Ala Thr Ala Trp Gln Gln Phe
Thr Lys Ile Thr Leu 210 215 220 Pro Leu Val Arg Pro Ala Leu Met Val
Ala Val Leu Phe Arg Thr Leu 225 230 235 240 Asp Ala Leu Arg Met Tyr
Asp Leu Pro Val Ile Met Ile Ser Ser Ser 245 250 255 Ser Asn Ser Pro
Thr Ala Val Ile Ser Gln Leu Val Val Glu Asp Met 260 265 270 Arg Gln
Asn Asn Phe Asn Ser Ala Ser Ala Leu Ser Thr Leu Ile Phe 275 280 285
Leu Leu Ile Phe Phe Val Ala Phe Ile Met Ile Arg Phe Leu Gly Ala 290
295 300 Asp Val Ser Gly Gln Arg Gly Ile Lys Lys Lys Lys Leu Gly Gly
Thr 305 310 315 320 Lys Asp Glu Lys Pro Thr Ala Lys Asp Ala Val Val
Lys Ala Asp Ser 325 330 335 Ala Val Lys Glu Ala Ala Lys Pro 340
91137DNACorynebacterium glutamicumCDS(151)..(987)integral membrane
protein (permease) of the ABC transporter having the activity of a
trehalose importer 9ggcgttcatc atgatccgat tcctcggcgc agatgtttcg
ggccaacgcg gaataaagaa 60aaagaaactg ggcggaacca aggatgagaa acccaccgct
aaggatgctg ttgtaaaggc 120cgattctgct gtgaaggaag ccgctaagcc atg act
aaa cga aca aaa gga ctc 174 Met Thr Lys Arg Thr Lys Gly Leu 1 5 atc
ctc aac tac gcc gga gtg gtg ttc atc ctc ttc tgg gga cta gct 222Ile
Leu Asn Tyr Ala Gly Val Val Phe Ile Leu Phe Trp Gly Leu Ala 10 15
20 ccc ttc tac tgg atg gtt atc acc gca ctg cgc gat tcc aag cac acc
270Pro Phe Tyr Trp Met Val Ile Thr Ala Leu Arg Asp Ser Lys His Thr
25 30 35 40 ttt gac acc acc cca tgg cca acg cac gtc acc ttg gat aac
ttc cgg 318Phe Asp Thr Thr Pro Trp Pro Thr His Val Thr Leu Asp Asn
Phe Arg 45 50 55 gac gca ctg gcc acc gac aaa ggc aac aac ttc ctc
gca gcc att ggc 366Asp Ala Leu Ala Thr Asp Lys Gly Asn Asn Phe Leu
Ala Ala Ile Gly 60 65 70 aac tca ctg gtc atc agc gtc acc aca aca
gcg atc gct gtt ctc gtg 414Asn Ser Leu Val Ile Ser Val Thr Thr Thr
Ala Ile Ala Val Leu Val 75 80 85 gga gtg ttc acc gcc tac gct cta
gcc cga ctg gaa ttc ccg ggc aaa 462Gly Val Phe Thr Ala Tyr Ala Leu
Ala Arg Leu Glu Phe Pro Gly Lys 90 95 100 ggc att gtc acc ggc atc
atc ttg gca gcc tcc atg ttc ccc ggc atc 510Gly Ile Val Thr Gly Ile
Ile Leu Ala Ala Ser Met Phe Pro Gly Ile 105 110 115 120 gcc ctg gtc
act ccg ctg ttc cag ctc ttc ggt gac ctc aac tgg atc 558Ala Leu Val
Thr Pro Leu Phe Gln Leu Phe Gly Asp Leu Asn Trp Ile 125 130 135 ggc
acc tac caa gcg ctg att atc ccg aac att tcc ttc gcg cta cct 606Gly
Thr Tyr Gln Ala Leu Ile Ile Pro Asn Ile Ser Phe Ala Leu Pro 140 145
150 ctg acg atc tac acg ctc gta tcc ttc ttc agg caa ctg ccc tgg gaa
654Leu Thr Ile Tyr Thr Leu Val Ser Phe Phe Arg Gln Leu Pro Trp Glu
155 160 165 ctc gaa gaa tca gca cgt gtc gac ggc gcc aca cgt ggc caa
gcc ttc 702Leu Glu Glu Ser Ala Arg Val Asp Gly Ala Thr Arg Gly Gln
Ala Phe 170 175 180 cgc atg atc ctg ctt cct cta gca gcg ccc gca cta
ttt acc acc gcg 750Arg Met Ile Leu Leu Pro Leu Ala Ala Pro Ala Leu
Phe Thr Thr Ala 185 190 195 200 atc ctc gca ttc att gca acg tgg aac
gaa ttc atg ctg gcc cgc caa 798Ile Leu Ala Phe Ile Ala Thr Trp Asn
Glu Phe Met Leu Ala Arg Gln 205 210 215 cta tcc aac acc tcc aca gag
cca gtg acc gtt gcg atc gca agg ttc 846Leu Ser Asn Thr Ser Thr Glu
Pro Val Thr Val Ala Ile Ala Arg Phe 220 225 230 acc gga cca agc tcc
ttc gaa tac ccc tac gcc tct gtc atg gca gcg 894Thr Gly Pro Ser Ser
Phe Glu Tyr Pro Tyr Ala Ser Val Met Ala Ala 235 240 245 gga gct ttg
gtg acc atc cca ctg atc atc atg gtt ctc atc ttc caa 942Gly Ala Leu
Val Thr Ile Pro Leu Ile Ile Met Val Leu Ile Phe Gln 250 255 260 cgc
cgc atc gtc tcc gga ctc acc gca ggt ggc gtg aaa gcc tag 987Arg Arg
Ile Val Ser Gly Leu Thr Ala Gly Gly Val Lys Ala 265 270 275
actagatact catgagtgct gataaatccc aggaccaatc cgaatcgcaa cgcaaagggc
1047ttcaacccga agcgctgctt ggattcctgg gatttttctc attcctcgcc
gtcatccagg 1107cagtcatcaa cgtgttacgc cccgaacctg
113710278PRTCorynebacterium glutamicum 10Met Thr Lys Arg Thr Lys
Gly Leu Ile Leu Asn Tyr Ala Gly Val Val 1 5 10 15 Phe Ile Leu Phe
Trp Gly Leu Ala Pro Phe Tyr Trp Met Val Ile Thr 20 25 30 Ala Leu
Arg Asp Ser Lys His Thr Phe Asp Thr Thr Pro Trp Pro Thr 35 40 45
His Val Thr Leu Asp Asn Phe Arg Asp Ala Leu Ala Thr Asp Lys Gly 50
55 60 Asn Asn Phe Leu Ala Ala Ile Gly Asn Ser Leu Val Ile Ser Val
Thr 65 70 75 80 Thr Thr Ala Ile Ala Val Leu Val Gly Val Phe Thr Ala
Tyr Ala Leu 85 90 95 Ala Arg Leu Glu Phe Pro Gly Lys Gly Ile Val
Thr Gly Ile Ile Leu 100 105 110 Ala Ala Ser Met Phe Pro Gly Ile Ala
Leu Val Thr Pro Leu Phe Gln 115 120 125 Leu Phe Gly Asp Leu Asn Trp
Ile Gly Thr Tyr Gln Ala Leu Ile Ile 130 135 140 Pro Asn Ile Ser Phe
Ala Leu Pro Leu Thr Ile Tyr Thr Leu Val Ser 145 150 155 160 Phe Phe
Arg Gln Leu Pro Trp Glu Leu Glu Glu Ser Ala Arg Val Asp 165 170 175
Gly Ala Thr Arg Gly Gln Ala Phe Arg Met Ile Leu Leu Pro Leu Ala 180
185 190 Ala Pro Ala Leu Phe Thr Thr Ala Ile Leu Ala Phe Ile Ala Thr
Trp 195 200 205 Asn Glu Phe Met Leu Ala Arg Gln Leu Ser Asn Thr Ser
Thr Glu Pro 210 215 220 Val Thr Val Ala Ile Ala Arg Phe Thr Gly Pro
Ser Ser Phe Glu Tyr 225 230 235 240 Pro Tyr Ala Ser Val Met Ala Ala
Gly Ala Leu Val Thr Ile Pro Leu 245 250 255 Ile Ile Met Val Leu Ile
Phe Gln Arg Arg Ile Val Ser Gly Leu Thr 260 265 270 Ala Gly Gly Val
Lys Ala 275 11525DNACorynebacterium
glutamicumCDS(151)..(375)hypothetical protein 11cggaccaagc
tccttcgaat acccctacgc ctctgtcatg gcagcgggag ctttggtgac
60catcccactg atcatcatgg ttctcatctt ccaacgccgc atcgtctccg gactcaccgc
120aggtggcgtg aaagcctaga ctagatactc atg agt gct gat aaa tcc cag gac
174 Met Ser Ala Asp Lys Ser Gln Asp 1 5 caa tcc gaa tcg caa cgc aaa
ggg ctt caa ccc gaa gcg ctg ctt gga 222Gln Ser Glu Ser Gln Arg Lys
Gly Leu Gln Pro Glu Ala Leu Leu Gly 10 15 20 ttc ctg gga ttt ttc
tca ttc ctc gcc gtc atc cag gca gtc atc aac 270Phe Leu Gly Phe Phe
Ser Phe Leu Ala Val Ile Gln Ala Val Ile Asn 25 30 35 40 gtg tta cgc
ccc gaa cct gcc gtg tgg cca gct ctt ctc gcg ctc gtt 318Val Leu Arg
Pro Glu Pro Ala Val Trp Pro Ala Leu Leu Ala Leu Val 45 50 55 tta
gta atc gcc aca gtg tca gta tgg agg gct tgg cga aag cgc cgc 366Leu
Val Ile Ala Thr Val Ser Val Trp Arg Ala Trp Arg Lys Arg Arg 60 65
70 cct aat taa agttcctgcg ccaacgccac gataattcca gatggcccgc 415Pro
Asn gcagataaca caatcggtag gtgtcctcgt aatttgcgat cccatctagt
ggttccgcac 475cgatatgttc gatcgtttcc tcaatatcat ccaccgcaaa
catcaaacgg 5251274PRTCorynebacterium glutamicum 12Met Ser Ala Asp
Lys Ser Gln Asp Gln Ser Glu Ser Gln Arg Lys Gly 1 5 10 15 Leu Gln
Pro Glu Ala Leu Leu Gly Phe Leu Gly Phe Phe Ser Phe Leu 20 25 30
Ala Val Ile Gln Ala Val Ile Asn Val Leu Arg Pro Glu Pro Ala Val 35
40 45 Trp Pro Ala Leu Leu Ala Leu Val Leu Val Ile Ala Thr Val Ser
Val 50 55 60 Trp Arg Ala Trp Arg Lys Arg Arg Pro Asn 65 70
131305DNACorynebacterium efficiensCDS(151)..(1152)ATP-binding and
-hydrolyzing (ATPase) protein of the ABC transporter having the
activity of a trehalose importer 13atggggggtt ccgcggtggt ggttgccggg
atggtggata cccagcgtct ggatcagatc 60gcgaccgcgg agaaggtcac cgcacgggtc
tgagaatgtg gccggcccac aggtacacaa 120ctgggtgtga cactgctaac
ttcataggtt atg gcc act gtt tcc ttt gac aaa 174 Met Ala Thr Val Ser
Phe Asp Lys 1 5 gtc tcc atc cgg tac ccc ggt gcg gag cgc ccc acc gtc
cat gag ctc 222Val Ser Ile Arg Tyr Pro Gly Ala Glu Arg Pro Thr Val
His Glu Leu 10 15 20 gac ctc gag ata gcc gac ggt gaa ttc ctc gta
ctc gtc ggc ccg tcg 270Asp Leu Glu Ile Ala Asp Gly Glu Phe Leu Val
Leu Val Gly Pro Ser 25 30 35 40 ggg tgt gga aaa tca acc acg ctg cga
gcg ctc gcc ggg ctc gag gag 318Gly Cys Gly Lys Ser Thr Thr Leu Arg
Ala Leu Ala Gly Leu Glu Glu 45 50 55 gtc gaa tcc ggt gtg atc cgc
atc gac ggg cag gat gtc acc agt cag 366Val Glu Ser Gly Val Ile Arg
Ile Asp Gly Gln Asp Val Thr Ser Gln 60 65 70 gaa cct gcg gag cgt
gac atc gcg atg gtg ttc cag aac tac gcc ctc 414Glu Pro Ala Glu Arg
Asp Ile Ala Met Val Phe Gln Asn Tyr Ala Leu 75 80 85 tac ccc cac
atg tcc gtg gcg cgg aat atg ggt ttc gcc ctc aaa ctg 462Tyr Pro His
Met Ser Val Ala Arg Asn Met Gly Phe Ala Leu Lys Leu 90 95 100 gcc
aaa ctg ccc cag gcg gag atc gac gcc aag gtc cgg gag gcc gcc 510Ala
Lys Leu Pro Gln Ala Glu Ile Asp Ala Lys Val Arg Glu Ala Ala 105 110
115 120 gag atc ctc ggc ctc acc gac tac ctg gac cgc aaa ccg aag gac
ctc 558Glu Ile Leu Gly Leu Thr Asp Tyr Leu Asp Arg Lys Pro Lys Asp
Leu 125 130 135 tcc ggt ggt cag cgc cag cgt gtg gcc atg ggc cgg gcc
ctg gtg cgc 606Ser Gly Gly Gln Arg Gln Arg Val Ala Met Gly Arg Ala
Leu Val Arg 140 145 150 aac ccg aag gtc ttc ctc atg gat gag ccc ctg
tcc aac ctc gat gcc 654Asn Pro Lys Val Phe Leu Met Asp Glu Pro Leu
Ser Asn Leu Asp Ala 155 160 165 aaa ctg cgt gtg cag acg cgc gcg gaa
gtt gcc gca ctg cag cgt cgc 702Lys Leu Arg Val Gln Thr Arg Ala Glu
Val Ala Ala Leu Gln Arg Arg 170 175 180 ctg ggt acc acc acc gtc tat
gtc acc cat gat cag gtg gag gcc atg 750Leu Gly Thr Thr Thr Val Tyr
Val Thr His Asp Gln Val Glu Ala Met 185 190 195 200 acg atg ggc gac
cgc gtc gcg gtg ctc aag gac gga ctg ctc cag cag 798Thr Met Gly Asp
Arg Val Ala Val Leu Lys Asp Gly Leu Leu Gln Gln 205 210 215 gtg gcc
cca ccc cgg gag ctc tac gac acc ccg gtc aat gcg ttc gtc 846Val Ala
Pro Pro Arg Glu Leu Tyr Asp Thr Pro Val Asn Ala Phe Val 220 225 230
gcc ggt ttc atc ggc tcc cca tcg atg aat ctc ttc ccc tac gac ggt
894Ala Gly Phe Ile Gly Ser Pro Ser Met Asn Leu Phe Pro Tyr Asp Gly
235 240 245 gtg acc ctg ggt gtg cgt ccg gaa tcc atg ctg gtg gtc acc
ggc gag 942Val Thr Leu Gly Val Arg Pro Glu Ser Met Leu Val Val Thr
Gly Glu 250 255 260 gcc ccg gcc ggt tac acc gtg gtg gac ggg acg gtg
gac atc gtc gag 990Ala Pro Ala Gly Tyr Thr Val Val Asp Gly Thr Val
Asp Ile Val Glu 265 270 275 280 gag ctc ggt tcc gag tcc tat gtt tac
gcc acc tgc gac ggc aac cgc 1038Glu Leu Gly Ser Glu Ser Tyr Val Tyr
Ala Thr Cys Asp Gly Asn Arg 285 290 295 ctg gtg gcg cgc tgg gag gac
gcc gtg gtg ccc gcg ccg ggt gac cgg 1086Leu Val Ala Arg Trp Glu Asp
Ala Val Val Pro Ala Pro Gly Asp Arg 300 305 310 gtg cgg ttc gcc ttc
gac ccg gcg ggt tca cac cgt ttc gac ccg acc 1134Val Arg Phe Ala Phe
Asp Pro Ala Gly Ser His Arg Phe Asp Pro Thr 315 320 325 agc ggt tac
cgg ctc agc tgagggtgac cacggtgggg gtcgcggcgt 1182Ser Gly Tyr Arg
Leu Ser 330 cgtcaagcac tgcccccggc acgggggtga tttgaggtaa accggtgcgg
gaaagtggcg 1242aaagtcatta gattgaagtc acctgttgca gagaaaggtg
acccaccatg tccaagtttt 1302ccc 130514334PRTCorynebacterium efficiens
14Met Ala Thr Val Ser Phe Asp Lys Val Ser Ile Arg Tyr Pro Gly Ala 1
5 10 15 Glu Arg Pro Thr Val His Glu Leu Asp Leu Glu Ile Ala Asp Gly
Glu 20 25 30 Phe Leu Val Leu Val Gly Pro Ser Gly Cys Gly Lys Ser
Thr Thr Leu 35 40 45 Arg Ala Leu Ala Gly Leu Glu Glu Val Glu Ser
Gly Val Ile Arg Ile 50 55 60 Asp Gly Gln Asp Val Thr Ser Gln Glu
Pro Ala Glu Arg Asp Ile Ala 65 70 75 80 Met Val Phe Gln Asn Tyr Ala
Leu Tyr Pro His Met Ser Val Ala Arg 85 90 95 Asn Met Gly Phe Ala
Leu Lys Leu Ala Lys Leu Pro Gln Ala Glu Ile 100 105 110 Asp Ala Lys
Val Arg Glu Ala Ala Glu Ile Leu Gly Leu Thr Asp Tyr 115 120 125 Leu
Asp Arg Lys Pro Lys Asp Leu Ser Gly Gly Gln Arg Gln Arg Val 130 135
140 Ala Met Gly Arg Ala Leu Val Arg Asn Pro Lys Val Phe Leu Met Asp
145 150 155 160 Glu Pro Leu Ser Asn Leu Asp Ala Lys Leu Arg Val Gln
Thr Arg Ala 165 170 175 Glu Val Ala Ala Leu Gln Arg Arg Leu Gly Thr
Thr Thr Val Tyr Val 180 185 190 Thr His Asp Gln Val Glu Ala Met Thr
Met Gly Asp Arg Val Ala Val 195 200 205 Leu Lys Asp Gly Leu Leu Gln
Gln Val Ala Pro Pro Arg Glu Leu Tyr 210 215 220 Asp Thr Pro Val Asn
Ala Phe Val Ala Gly Phe Ile Gly Ser Pro Ser 225 230 235 240 Met Asn
Leu Phe Pro Tyr Asp Gly Val Thr Leu Gly Val Arg Pro Glu 245 250 255
Ser Met Leu Val Val Thr Gly Glu Ala Pro Ala Gly Tyr Thr Val Val 260
265 270 Asp Gly Thr Val Asp Ile Val Glu Glu Leu Gly Ser Glu Ser Tyr
Val 275 280 285 Tyr Ala Thr Cys Asp Gly Asn Arg Leu Val Ala Arg Trp
Glu Asp Ala 290 295 300 Val Val Pro Ala Pro Gly Asp Arg Val Arg Phe
Ala Phe Asp Pro Ala 305 310 315 320 Gly Ser His Arg Phe Asp Pro Thr
Ser Gly Tyr Arg Leu Ser 325 330 151605DNACorynebacterium
efficiensCDS(151)..(1455)periplasmic (or lipoprotein)
substrate-binding protein of the ABC transporter having the
activity of a trehalose importer 15ttaccggctc agctgagggt gaccacggtg
ggggtcgcgg cgtcgtcaag cactgccccc 60ggcacggggg tgatttgagg taaaccggtg
cgggaaagtg gcgaaagtca ttagattgaa 120gtcacctgtt gcagagaaag
gtgacccacc atg tcc aag ttt tcc cgc aag acc 174 Met Ser Lys Phe Ser
Arg Lys Thr 1 5 ggc gta tcg ctg gcc gca acc agc ctg atc gcc gcc atc
gcc ctg gcc 222Gly Val Ser Leu Ala Ala Thr Ser Leu Ile Ala Ala Ile
Ala Leu Ala 10 15 20 ggt tgt ggc aat gac acc gcc gac gat gcc ggc
acg acc gac acc agc 270Gly Cys Gly Asn Asp Thr Ala Asp Asp Ala Gly
Thr Thr Asp Thr Ser 25 30 35 40 acc aat gac acc gaa gcc acc acc gcc
gcc tcg ggt gag gag ggc cgc 318Thr Asn Asp Thr Glu Ala Thr Thr Ala
Ala Ser Gly Glu Glu Gly Arg 45 50 55 ggc ccg att acc ttc gcc atg
ggc aag aac gac acc gac aag atc att 366Gly Pro Ile Thr Phe Ala Met
Gly Lys Asn Asp Thr Asp Lys Ile Ile 60 65 70 ccc gtg atc gag aag
tgg aac gag gag aac ccc gac cag gag gtg acc 414Pro Val Ile Glu Lys
Trp Asn Glu Glu Asn Pro Asp Gln Glu Val Thr 75 80 85 ctc aac gaa
ctc gcc ggt gag gcc gac gcc cag cgc gag acc ctc gtg 462Leu Asn Glu
Leu Ala Gly Glu Ala Asp Ala Gln Arg Glu Thr Leu Val 90 95 100 cag
tcc ctc cag gcc ggc aac tcc gat tat gac gtc atg gcc ctc gat 510Gln
Ser Leu Gln Ala Gly Asn Ser Asp Tyr Asp Val Met Ala Leu Asp 105 110
115 120 gtc atc tgg acc gcc gac ttc gcc gcc aac cag tgg ctc gcg ccg
ctt 558Val Ile Trp Thr Ala Asp Phe Ala Ala Asn Gln Trp Leu Ala Pro
Leu 125 130 135 gag ggg gaa ctc gag gtc gac acc tcc ggg ctg ctt gag
gcc acc gtg 606Glu Gly Glu Leu Glu Val Asp Thr Ser Gly Leu Leu Glu
Ala Thr Val 140 145 150 gaa tcc gcc aca tac atg gac acc ctc tac gca
ctg ccg cag aac acc 654Glu Ser Ala Thr Tyr Met Asp Thr Leu Tyr Ala
Leu Pro Gln Asn Thr 155 160 165 aac ggc cag ctg ctc tac cgc aac acc
gag atc atc ccc gag gcc ccg 702Asn Gly Gln Leu Leu Tyr Arg Asn Thr
Glu Ile Ile Pro Glu Ala Pro 170 175 180 gag aac tgg gct gac ctc gtc
gaa tcc tgc acc ctg gcg gag gag gcc 750Glu Asn Trp Ala Asp Leu Val
Glu Ser Cys Thr Leu Ala Glu Glu Ala 185 190 195 200 gag gtt gac tgc
ctg acc acc cag ctc aag cag tac gag ggc ctg acc 798Glu Val Asp Cys
Leu Thr Thr Gln Leu Lys Gln Tyr Glu Gly Leu Thr 205 210 215 gtc aac
acc atc ggc ttc atg gag ggc tgg ggc ggt tcc gtc ctg gac 846Val Asn
Thr Ile Gly Phe Met Glu Gly Trp Gly Gly Ser Val Leu Asp 220 225 230
gat gac ggc acc acc gtg gtc gtc gac tcc gac gag tcg aag gag ggc
894Asp Asp Gly Thr Thr Val Val Val Asp Ser Asp Glu Ser Lys Glu Gly
235 240 245 ctg cag gcg ctt gtc gac gcc tac gag gac ggc acc atc tcg
tcc gcg 942Leu Gln Ala Leu Val Asp Ala Tyr Glu Asp Gly Thr Ile Ser
Ser Ala 250 255 260 tcc acc gca gcc acc gag gag gag acc aac ctg gcc
ttc acc gcc ggt 990Ser Thr Ala Ala Thr Glu Glu Glu Thr Asn Leu Ala
Phe Thr Ala Gly 265 270 275 280 gag acc gcc tac gcc atc aac tgg ccg
tac atg tac acc aac gcc gag 1038Glu Thr Ala Tyr Ala Ile Asn Trp Pro
Tyr Met Tyr Thr Asn Ala Glu 285 290 295 gac tcc gag gcc acc gcc ggc
aag ttc gag gtc cag cca ctc gtg ggc 1086Asp Ser Glu Ala Thr Ala Gly
Lys Phe Glu Val Gln Pro Leu Val Gly 300 305 310 aag gac ggc gtg ggt
gtg tcc acc ctc ggt ggc tac aac aac gcc atc 1134Lys Asp Gly Val Gly
Val Ser Thr Leu Gly Gly Tyr Asn Asn Ala Ile 315 320 325 aac atc aac
tcg gag aac aag gca acc gcc cgc gac ttc atc gag ttc 1182Asn Ile Asn
Ser Glu Asn Lys Ala Thr Ala Arg Asp Phe Ile Glu Phe 330 335 340 atc
atc aac gag gag aac cag acc tgg ttc gcc gac aac tcc ttc cca 1230Ile
Ile Asn Glu Glu Asn Gln Thr Trp Phe Ala Asp Asn Ser Phe Pro 345 350
355 360 ccg gtg ctc gcc tcc atc tac gac gat gag gaa ctg atc gag cag
tac 1278Pro Val Leu Ala Ser Ile Tyr Asp Asp Glu Glu Leu Ile Glu Gln
Tyr 365 370 375 cca tac ctg ccc gcg ctg aag gaa tcc ctg gag aac gcg
gca ccg cgt 1326Pro Tyr Leu Pro Ala Leu Lys Glu Ser Leu Glu Asn Ala
Ala Pro Arg 380 385 390 ccg gtc tcc ccg ttc tac acc gcc atc tcc aag
gcc atc cag gac aac 1374Pro Val Ser Pro Phe Tyr Thr Ala Ile Ser Lys
Ala Ile Gln Asp Asn 395 400 405 gcc tac gca gcc atc aac ggc aac gtc
gac gtc gac cag gcc acc gct 1422Ala Tyr Ala Ala Ile Asn Gly Asn Val
Asp Val Asp Gln Ala Thr Ala 410 415 420 gac atg aag gca gca atc gag
aac gcc tcc tag agcgacaggg acacccccac 1475Asp Met Lys Ala Ala Ile
Glu Asn Ala Ser 425 430 cccatgacac tccggtcacc caccaggtga ccggggtttt
gtcatagtct gggcgggaac 1535aggtgttgtc acccaactgc tttcccagtg
tcggatcacg tgtctgctca agtgtcggat 1595ccaacgtccc
160516434PRTCorynebacterium efficiens 16Met Ser Lys Phe Ser Arg Lys
Thr Gly Val Ser Leu Ala Ala Thr Ser 1 5 10 15 Leu Ile Ala Ala Ile
Ala Leu Ala Gly Cys Gly Asn Asp Thr Ala Asp 20 25 30 Asp Ala Gly
Thr Thr Asp Thr Ser Thr Asn Asp Thr Glu Ala Thr Thr 35 40 45 Ala
Ala Ser Gly Glu Glu Gly Arg Gly Pro Ile Thr Phe Ala Met Gly 50 55
60 Lys Asn Asp Thr Asp Lys Ile Ile Pro Val Ile Glu Lys Trp Asn Glu
65 70 75 80 Glu Asn Pro Asp Gln Glu Val Thr Leu Asn Glu Leu Ala Gly
Glu Ala 85 90 95 Asp Ala Gln Arg Glu Thr Leu Val Gln Ser Leu Gln
Ala Gly Asn Ser 100 105 110 Asp Tyr Asp Val Met Ala Leu Asp Val Ile
Trp Thr Ala Asp Phe Ala 115 120 125 Ala Asn Gln Trp Leu Ala Pro Leu
Glu Gly Glu Leu Glu Val Asp Thr 130 135 140 Ser Gly Leu Leu Glu Ala
Thr Val Glu Ser Ala Thr Tyr Met Asp Thr 145 150 155 160 Leu Tyr Ala
Leu Pro Gln Asn Thr Asn Gly Gln Leu Leu Tyr Arg Asn 165 170 175 Thr
Glu Ile Ile Pro Glu Ala Pro Glu Asn Trp Ala Asp Leu Val Glu 180
185 190 Ser Cys Thr Leu Ala Glu Glu Ala Glu Val Asp Cys Leu Thr Thr
Gln 195 200 205 Leu Lys Gln Tyr Glu Gly Leu Thr Val Asn Thr Ile Gly
Phe Met Glu 210 215 220 Gly Trp Gly Gly Ser Val Leu Asp Asp Asp Gly
Thr Thr Val Val Val 225 230 235 240 Asp Ser Asp Glu Ser Lys Glu Gly
Leu Gln Ala Leu Val Asp Ala Tyr 245 250 255 Glu Asp Gly Thr Ile Ser
Ser Ala Ser Thr Ala Ala Thr Glu Glu Glu 260 265 270 Thr Asn Leu Ala
Phe Thr Ala Gly Glu Thr Ala Tyr Ala Ile Asn Trp 275 280 285 Pro Tyr
Met Tyr Thr Asn Ala Glu Asp Ser Glu Ala Thr Ala Gly Lys 290 295 300
Phe Glu Val Gln Pro Leu Val Gly Lys Asp Gly Val Gly Val Ser Thr 305
310 315 320 Leu Gly Gly Tyr Asn Asn Ala Ile Asn Ile Asn Ser Glu Asn
Lys Ala 325 330 335 Thr Ala Arg Asp Phe Ile Glu Phe Ile Ile Asn Glu
Glu Asn Gln Thr 340 345 350 Trp Phe Ala Asp Asn Ser Phe Pro Pro Val
Leu Ala Ser Ile Tyr Asp 355 360 365 Asp Glu Glu Leu Ile Glu Gln Tyr
Pro Tyr Leu Pro Ala Leu Lys Glu 370 375 380 Ser Leu Glu Asn Ala Ala
Pro Arg Pro Val Ser Pro Phe Tyr Thr Ala 385 390 395 400 Ile Ser Lys
Ala Ile Gln Asp Asn Ala Tyr Ala Ala Ile Asn Gly Asn 405 410 415 Val
Asp Val Asp Gln Ala Thr Ala Asp Met Lys Ala Ala Ile Glu Asn 420 425
430 Ala Ser 17786DNACorynebacterium
efficiensCDS(151)..(636)function unknown 17cccccacccc atgacactcc
ggtcacccac caggtgaccg gggttttgtc atagtctggg 60cgggaacagg tgttgtcacc
caactgcttt cccagtgtcg gatcacgtgt ctgctcaagt 120gtcggatcca
acgtccctga ggaggacccc atg tca cac cag cgc tcc ccc gag 174 Met Ser
His Gln Arg Ser Pro Glu 1 5 aca ccc gag atg ctg tcc tac acc atc tcc
gga ttc atc tcc cgg tgc 222Thr Pro Glu Met Leu Ser Tyr Thr Ile Ser
Gly Phe Ile Ser Arg Cys 10 15 20 ccc gtc cag gtc tat gag gcc atc
gtc gat cac cgt caa ctc tcc cga 270Pro Val Gln Val Tyr Glu Ala Ile
Val Asp His Arg Gln Leu Ser Arg 25 30 35 40 cat ttc gcc acc ggc ggg
gca cag ggc agg atg agc gcc ggc gcg acg 318His Phe Ala Thr Gly Gly
Ala Gln Gly Arg Met Ser Ala Gly Ala Thr 45 50 55 gtg acc tgg gac
ttc gac gat ggg tcc ggc ccc tgc acc gtc gag gtc 366Val Thr Trp Asp
Phe Asp Asp Gly Ser Gly Pro Cys Thr Val Glu Val 60 65 70 ctc cag
gcg gcg cat tcc cgg tgt ctg atc ctg gag tgg tcc agc ccc 414Leu Gln
Ala Ala His Ser Arg Cys Leu Ile Leu Glu Trp Ser Ser Pro 75 80 85
gat gcg ggt gaa ccc gcc ggg agc acc acg gtg gag ttc gcc ttc gaa
462Asp Ala Gly Glu Pro Ala Gly Ser Thr Thr Val Glu Phe Ala Phe Glu
90 95 100 ccc gcc aat gac ttc acc cgc acc aaa ctg acc atc acg gaa
tca ggg 510Pro Ala Asn Asp Phe Thr Arg Thr Lys Leu Thr Ile Thr Glu
Ser Gly 105 110 115 120 tgg cct ccc acc acc gcc ggc acc agg aaa gcg
ctg cgc gaa tgc cac 558Trp Pro Pro Thr Thr Ala Gly Thr Arg Lys Ala
Leu Arg Glu Cys His 125 130 135 cgg tgg acc acc atg ctc acc ggt ctg
aag gcc tgg ttg gaa cac ggg 606Arg Trp Thr Thr Met Leu Thr Gly Leu
Lys Ala Trp Leu Glu His Gly 140 145 150 gtg gtc ctc ggc agg gat cta
cat cgc tag ggagccttgt taaccggagg 656Val Val Leu Gly Arg Asp Leu
His Arg 155 160 tagagggtgg aacggaggtg gggttactgt tccctcactg
acaccagggt tctatgatcc 716aagtaacact tttcctgatt tctcttcttt
tcccatccat cccctctacc ccaaggagca 776ctggtgacat
78618161PRTCorynebacterium efficiens 18Met Ser His Gln Arg Ser Pro
Glu Thr Pro Glu Met Leu Ser Tyr Thr 1 5 10 15 Ile Ser Gly Phe Ile
Ser Arg Cys Pro Val Gln Val Tyr Glu Ala Ile 20 25 30 Val Asp His
Arg Gln Leu Ser Arg His Phe Ala Thr Gly Gly Ala Gln 35 40 45 Gly
Arg Met Ser Ala Gly Ala Thr Val Thr Trp Asp Phe Asp Asp Gly 50 55
60 Ser Gly Pro Cys Thr Val Glu Val Leu Gln Ala Ala His Ser Arg Cys
65 70 75 80 Leu Ile Leu Glu Trp Ser Ser Pro Asp Ala Gly Glu Pro Ala
Gly Ser 85 90 95 Thr Thr Val Glu Phe Ala Phe Glu Pro Ala Asn Asp
Phe Thr Arg Thr 100 105 110 Lys Leu Thr Ile Thr Glu Ser Gly Trp Pro
Pro Thr Thr Ala Gly Thr 115 120 125 Arg Lys Ala Leu Arg Glu Cys His
Arg Trp Thr Thr Met Leu Thr Gly 130 135 140 Leu Lys Ala Trp Leu Glu
His Gly Val Val Leu Gly Arg Asp Leu His 145 150 155 160 Arg
191347DNACorynebacterium efficiensCDS(151)..(1197)integral membrane
protein (permease) of the ABC transporter having the activity of a
trehalose importer 19agggagcctt gttaaccgga ggtagagggt ggaacggagg
tggggttact gttccctcac 60tgacaccagg gttctatgat ccaagtaaca cttttcctga
tttctcttct tttcccatcc 120atcccctcta ccccaaggag cactggtgac atg gcc
aag atg aaa cag gcg cga 174 Met Ala Lys Met Lys Gln Ala Arg 1 5 tca
gcc gca tgg ttg atc gcg cca gcc atg att gtc ctg acg gtg gtg 222Ser
Ala Ala Trp Leu Ile Ala Pro Ala Met Ile Val Leu Thr Val Val 10 15
20 atc ggc tac ccc atc gtc cgt gcc gtc tgg ttg tcc ttc cag gcg gac
270Ile Gly Tyr Pro Ile Val Arg Ala Val Trp Leu Ser Phe Gln Ala Asp
25 30 35 40 aag ggt ctc gat ccc acc acc ggg ttg ttc acc gac ggt ggt
ttc gcc 318Lys Gly Leu Asp Pro Thr Thr Gly Leu Phe Thr Asp Gly Gly
Phe Ala 45 50 55 ggt ttc gac aat tac ctg tac tgg ctc acc caa cgc
tgc atg tcc ccc 366Gly Phe Asp Asn Tyr Leu Tyr Trp Leu Thr Gln Arg
Cys Met Ser Pro 60 65 70 gac ggc acc gtg ggt acc tgt ccg ccc ggt
acc ctg gcc acc gac ttc 414Asp Gly Thr Val Gly Thr Cys Pro Pro Gly
Thr Leu Ala Thr Asp Phe 75 80 85 tgg ccg gcc ctg cgc atc acc ctg
ttc ttc acc gtg gtc acc gtc acc 462Trp Pro Ala Leu Arg Ile Thr Leu
Phe Phe Thr Val Val Thr Val Thr 90 95 100 ctg gag acc atc ctg ggt
atg gtc atg gcc ctg atc atg agc aag gag 510Leu Glu Thr Ile Leu Gly
Met Val Met Ala Leu Ile Met Ser Lys Glu 105 110 115 120 ttc cgc ggc
cgg gcc ctc gtc cgc gcc gcg gtc ctg atc ccg tgg gcg 558Phe Arg Gly
Arg Ala Leu Val Arg Ala Ala Val Leu Ile Pro Trp Ala 125 130 135 atc
ccg acg gcg gtc acc gcg aag ctg tgg cag ttc ctg ttc gcc cca 606Ile
Pro Thr Ala Val Thr Ala Lys Leu Trp Gln Phe Leu Phe Ala Pro 140 145
150 cgg ggc atc atc aat gaa ctc ttc gga ctc aat atc agc tgg acc acc
654Arg Gly Ile Ile Asn Glu Leu Phe Gly Leu Asn Ile Ser Trp Thr Thr
155 160 165 gat ccg tgg gcg gca cgc gcc gcg gtc atc ctc gcc gat gtc
tgg aag 702Asp Pro Trp Ala Ala Arg Ala Ala Val Ile Leu Ala Asp Val
Trp Lys 170 175 180 acc acc ccg ttc atg gcg ctg ctc atc ctc gcc ggg
ctg cag atg atc 750Thr Thr Pro Phe Met Ala Leu Leu Ile Leu Ala Gly
Leu Gln Met Ile 185 190 195 200 ccc aag ggc acc tat gag gcc gcc cgt
gtg gac ggg gcc agc gcc tgg 798Pro Lys Gly Thr Tyr Glu Ala Ala Arg
Val Asp Gly Ala Ser Ala Trp 205 210 215 cag cag ttc acc agg atc acc
ctc ccc ctg gtc aaa ccg gcc ctg atg 846Gln Gln Phe Thr Arg Ile Thr
Leu Pro Leu Val Lys Pro Ala Leu Met 220 225 230 gtc gcg gtg ctg ttc
cgc acc ctg gat gcc ctg cgc atg tac gac ctg 894Val Ala Val Leu Phe
Arg Thr Leu Asp Ala Leu Arg Met Tyr Asp Leu 235 240 245 ccg gtg atc
atg atc tcc gcc tcc tcg aac tcc ccc acc gcc gtg atc 942Pro Val Ile
Met Ile Ser Ala Ser Ser Asn Ser Pro Thr Ala Val Ile 250 255 260 tcc
cag ctg gtg gtc gag gac atg cgt cag aac aac ttc aac tcg gcc 990Ser
Gln Leu Val Val Glu Asp Met Arg Gln Asn Asn Phe Asn Ser Ala 265 270
275 280 tcc gcg ctg tcg acg ttg atc ttc ctg ctc atc ttc ttc gtg gcc
ttc 1038Ser Ala Leu Ser Thr Leu Ile Phe Leu Leu Ile Phe Phe Val Ala
Phe 285 290 295 gtc atg atc cgg ttc ctc ggg gcg gat gtt tcc ggg cag
cgc gga acg 1086Val Met Ile Arg Phe Leu Gly Ala Asp Val Ser Gly Gln
Arg Gly Thr 300 305 310 gag aag aac agg cgg cgg tgg cgc agg ccc ggc
cgg aag ggc gcg gct 1134Glu Lys Asn Arg Arg Arg Trp Arg Arg Pro Gly
Arg Lys Gly Ala Ala 315 320 325 gtt gcc ggg gca ggc gtc ggc atc acc
ggt gcc gcg gtg gca agt gag 1182Val Ala Gly Ala Gly Val Gly Ile Thr
Gly Ala Ala Val Ala Ser Glu 330 335 340 gtg gca tca tca tga
aacgcaagac caagaaccta atcctcaact acgcaggcgt 1237Val Ala Ser Ser 345
ggtgttcatc ctgttctggg ggctggcgcc gttctactgg atggtggtca ctgcactgcg
1297ggattcccgc cacaccttcg acaccacccc ctggcccacg cacgtgaccc
134720348PRTCorynebacterium efficiens 20Met Ala Lys Met Lys Gln Ala
Arg Ser Ala Ala Trp Leu Ile Ala Pro 1 5 10 15 Ala Met Ile Val Leu
Thr Val Val Ile Gly Tyr Pro Ile Val Arg Ala 20 25 30 Val Trp Leu
Ser Phe Gln Ala Asp Lys Gly Leu Asp Pro Thr Thr Gly 35 40 45 Leu
Phe Thr Asp Gly Gly Phe Ala Gly Phe Asp Asn Tyr Leu Tyr Trp 50 55
60 Leu Thr Gln Arg Cys Met Ser Pro Asp Gly Thr Val Gly Thr Cys Pro
65 70 75 80 Pro Gly Thr Leu Ala Thr Asp Phe Trp Pro Ala Leu Arg Ile
Thr Leu 85 90 95 Phe Phe Thr Val Val Thr Val Thr Leu Glu Thr Ile
Leu Gly Met Val 100 105 110 Met Ala Leu Ile Met Ser Lys Glu Phe Arg
Gly Arg Ala Leu Val Arg 115 120 125 Ala Ala Val Leu Ile Pro Trp Ala
Ile Pro Thr Ala Val Thr Ala Lys 130 135 140 Leu Trp Gln Phe Leu Phe
Ala Pro Arg Gly Ile Ile Asn Glu Leu Phe 145 150 155 160 Gly Leu Asn
Ile Ser Trp Thr Thr Asp Pro Trp Ala Ala Arg Ala Ala 165 170 175 Val
Ile Leu Ala Asp Val Trp Lys Thr Thr Pro Phe Met Ala Leu Leu 180 185
190 Ile Leu Ala Gly Leu Gln Met Ile Pro Lys Gly Thr Tyr Glu Ala Ala
195 200 205 Arg Val Asp Gly Ala Ser Ala Trp Gln Gln Phe Thr Arg Ile
Thr Leu 210 215 220 Pro Leu Val Lys Pro Ala Leu Met Val Ala Val Leu
Phe Arg Thr Leu 225 230 235 240 Asp Ala Leu Arg Met Tyr Asp Leu Pro
Val Ile Met Ile Ser Ala Ser 245 250 255 Ser Asn Ser Pro Thr Ala Val
Ile Ser Gln Leu Val Val Glu Asp Met 260 265 270 Arg Gln Asn Asn Phe
Asn Ser Ala Ser Ala Leu Ser Thr Leu Ile Phe 275 280 285 Leu Leu Ile
Phe Phe Val Ala Phe Val Met Ile Arg Phe Leu Gly Ala 290 295 300 Asp
Val Ser Gly Gln Arg Gly Thr Glu Lys Asn Arg Arg Arg Trp Arg 305 310
315 320 Arg Pro Gly Arg Lys Gly Ala Ala Val Ala Gly Ala Gly Val Gly
Ile 325 330 335 Thr Gly Ala Ala Val Ala Ser Glu Val Ala Ser Ser 340
345 211137DNACorynebacterium efficiensCDS(151)..(987)integral
membrane protein (permease) of the ABC transporter having the
activity of a trehalose importer 21gatccggttc ctcggggcgg atgtttccgg
gcagcgcgga acggagaaga acaggcggcg 60gtggcgcagg cccggccgga agggcgcggc
tgttgccggg gcaggcgtcg gcatcaccgg 120tgccgcggtg gcaagtgagg
tggcatcatc atg aaa cgc aag acc aag aac cta 174 Met Lys Arg Lys Thr
Lys Asn Leu 1 5 atc ctc aac tac gca ggc gtg gtg ttc atc ctg ttc tgg
ggg ctg gcg 222Ile Leu Asn Tyr Ala Gly Val Val Phe Ile Leu Phe Trp
Gly Leu Ala 10 15 20 ccg ttc tac tgg atg gtg gtc act gca ctg cgg
gat tcc cgc cac acc 270Pro Phe Tyr Trp Met Val Val Thr Ala Leu Arg
Asp Ser Arg His Thr 25 30 35 40 ttc gac acc acc ccc tgg ccc acg cac
gtg acc ctg cag aac ttc cgg 318Phe Asp Thr Thr Pro Trp Pro Thr His
Val Thr Leu Gln Asn Phe Arg 45 50 55 gat gcg ctg gcc acc gac aag
ggc aac aac ttc ctg gcg gcg atc ggc 366Asp Ala Leu Ala Thr Asp Lys
Gly Asn Asn Phe Leu Ala Ala Ile Gly 60 65 70 aac tcg ctg atc gtc
agt ctc acc acc acc gcc ctc gcg gtg atc gtg 414Asn Ser Leu Ile Val
Ser Leu Thr Thr Thr Ala Leu Ala Val Ile Val 75 80 85 ggc gtg ttc
acc gcc tat gcg ctg gca cgc ctg gac ttc ccc ggt aag 462Gly Val Phe
Thr Ala Tyr Ala Leu Ala Arg Leu Asp Phe Pro Gly Lys 90 95 100 ggg
atc atc acc ggc atc atc ctg gcg gcc tcg atg ttc ccg ggt atc 510Gly
Ile Ile Thr Gly Ile Ile Leu Ala Ala Ser Met Phe Pro Gly Ile 105 110
115 120 gcc ctg gtg acc ccg ctg ttc cag ctg ttc ggc aac atc ggc tgg
atc 558Ala Leu Val Thr Pro Leu Phe Gln Leu Phe Gly Asn Ile Gly Trp
Ile 125 130 135 ggc acc tac cag gcg ctg atc atc ccg aac atc tcc ttc
gcc ctg ccg 606Gly Thr Tyr Gln Ala Leu Ile Ile Pro Asn Ile Ser Phe
Ala Leu Pro 140 145 150 ctg acc atc tac acc ctg gtg tcc ttc ttc cgc
cag ctg ccg tgg gag 654Leu Thr Ile Tyr Thr Leu Val Ser Phe Phe Arg
Gln Leu Pro Trp Glu 155 160 165 ctc gag gag gcc gcc cgt gtg gac ggc
gcg acc cgg ggg cag gcc ttc 702Leu Glu Glu Ala Ala Arg Val Asp Gly
Ala Thr Arg Gly Gln Ala Phe 170 175 180 cgc aag atc ctg tta ccc ctg
gcc gcc ccg gcg ctg ttc acc acc gcg 750Arg Lys Ile Leu Leu Pro Leu
Ala Ala Pro Ala Leu Phe Thr Thr Ala 185 190 195 200 atc ctg gcg ttc
atc gcc tcg tgg aat gag ttc atg ctg gcc cgt cag 798Ile Leu Ala Phe
Ile Ala Ser Trp Asn Glu Phe Met Leu Ala Arg Gln 205 210 215 ctg tcc
acc acc gcc acc gaa ccg gtc acc gtg gcc atc gcc cgc ttc 846Leu Ser
Thr Thr Ala Thr Glu Pro Val Thr Val Ala Ile Ala Arg Phe 220 225 230
tcc ggg ccg agt tcc ttc gag tac ccg tat gcc tcg gtg atg gca gcc
894Ser Gly Pro Ser Ser Phe Glu Tyr Pro Tyr Ala Ser Val Met Ala Ala
235 240 245 ggt gcc ctg gtc acc gtc cca ctg atc atc atg gtg ctc atc
ttc cag 942Gly Ala Leu Val Thr Val Pro Leu Ile Ile Met Val Leu Ile
Phe Gln 250 255 260
cga cgc atc gtc tcc ggc ctg acc gcg ggt ggt gtg aag gcc tag 987Arg
Arg Ile Val Ser Gly Leu Thr Ala Gly Gly Val Lys Ala 265 270 275
actgtcggtc atgagcacga acgaacccag ggaccagtcc gaacacaaac gccgagccct
1047ccagctcgat gcattcatcg ggttcctggg gttcttcgcc ttcctgtcgg
tgatccaggc 1107cgtgatcaat gtgctccagc ccgaaccgaa
113722278PRTCorynebacterium efficiens 22Met Lys Arg Lys Thr Lys Asn
Leu Ile Leu Asn Tyr Ala Gly Val Val 1 5 10 15 Phe Ile Leu Phe Trp
Gly Leu Ala Pro Phe Tyr Trp Met Val Val Thr 20 25 30 Ala Leu Arg
Asp Ser Arg His Thr Phe Asp Thr Thr Pro Trp Pro Thr 35 40 45 His
Val Thr Leu Gln Asn Phe Arg Asp Ala Leu Ala Thr Asp Lys Gly 50 55
60 Asn Asn Phe Leu Ala Ala Ile Gly Asn Ser Leu Ile Val Ser Leu Thr
65 70 75 80 Thr Thr Ala Leu Ala Val Ile Val Gly Val Phe Thr Ala Tyr
Ala Leu 85 90 95 Ala Arg Leu Asp Phe Pro Gly Lys Gly Ile Ile Thr
Gly Ile Ile Leu 100 105 110 Ala Ala Ser Met Phe Pro Gly Ile Ala Leu
Val Thr Pro Leu Phe Gln 115 120 125 Leu Phe Gly Asn Ile Gly Trp Ile
Gly Thr Tyr Gln Ala Leu Ile Ile 130 135 140 Pro Asn Ile Ser Phe Ala
Leu Pro Leu Thr Ile Tyr Thr Leu Val Ser 145 150 155 160 Phe Phe Arg
Gln Leu Pro Trp Glu Leu Glu Glu Ala Ala Arg Val Asp 165 170 175 Gly
Ala Thr Arg Gly Gln Ala Phe Arg Lys Ile Leu Leu Pro Leu Ala 180 185
190 Ala Pro Ala Leu Phe Thr Thr Ala Ile Leu Ala Phe Ile Ala Ser Trp
195 200 205 Asn Glu Phe Met Leu Ala Arg Gln Leu Ser Thr Thr Ala Thr
Glu Pro 210 215 220 Val Thr Val Ala Ile Ala Arg Phe Ser Gly Pro Ser
Ser Phe Glu Tyr 225 230 235 240 Pro Tyr Ala Ser Val Met Ala Ala Gly
Ala Leu Val Thr Val Pro Leu 245 250 255 Ile Ile Met Val Leu Ile Phe
Gln Arg Arg Ile Val Ser Gly Leu Thr 260 265 270 Ala Gly Gly Val Lys
Ala 275 23534DNACorynebacterium
efficiensCDS(151)..(384)hyopthetical protein 23ccgggccgag
ttccttcgag tacccgtatg cctcggtgat ggcagccggt gccctggtca 60ccgtcccact
gatcatcatg gtgctcatct tccagcgacg catcgtctcc ggcctgaccg
120cgggtggtgt gaaggcctag actgtcggtc atg agc acg aac gaa ccc agg gac
174 Met Ser Thr Asn Glu Pro Arg Asp 1 5 cag tcc gaa cac aaa cgc cga
gcc ctc cag ctc gat gca ttc atc ggg 222Gln Ser Glu His Lys Arg Arg
Ala Leu Gln Leu Asp Ala Phe Ile Gly 10 15 20 ttc ctg ggg ttc ttc
gcc ttc ctg tcg gtg atc cag gcc gtg atc aat 270Phe Leu Gly Phe Phe
Ala Phe Leu Ser Val Ile Gln Ala Val Ile Asn 25 30 35 40 gtg ctc cag
ccc gaa ccg aag gtc tgg ccg gca ctg ctg gcc ctg ctg 318Val Leu Gln
Pro Glu Pro Lys Val Trp Pro Ala Leu Leu Ala Leu Leu 45 50 55 ctg
gtg ctg gcg acg gtg agc ctg tgg cgg gcc cgg cgc gac cga tct 366Leu
Val Leu Ala Thr Val Ser Leu Trp Arg Ala Arg Arg Asp Arg Ser 60 65
70 ccc cgg acg ggg gct taa gcacccatgg ccatcgtcta caacgccgcc 414Pro
Arg Thr Gly Ala 75 accacggtca acggctttct cgcagatgac cgtgattccc
tgcagtggct cttcgacgtc 474cccggatccg ccgagacgga agcggatatc
accacattcc tcgatagcgt cggcgctgta 5342477PRTCorynebacterium
efficiens 24Met Ser Thr Asn Glu Pro Arg Asp Gln Ser Glu His Lys Arg
Arg Ala 1 5 10 15 Leu Gln Leu Asp Ala Phe Ile Gly Phe Leu Gly Phe
Phe Ala Phe Leu 20 25 30 Ser Val Ile Gln Ala Val Ile Asn Val Leu
Gln Pro Glu Pro Lys Val 35 40 45 Trp Pro Ala Leu Leu Ala Leu Leu
Leu Val Leu Ala Thr Val Ser Leu 50 55 60 Trp Arg Ala Arg Arg Asp
Arg Ser Pro Arg Thr Gly Ala 65 70 75 256199DNACorynebacterium
glutamicum 25gaaaattgtc ggcgcgatca ttccggcgct ggcgtgaagt gcgatttggt
acagctgata 60cgcgatgaaa gccagcagca atcatccacg ggtatgccca cagtttgttt
tcaggactgc 120gaccaggagt accactttcg caaggccgtg cgtcagtaga
tatctagcgc tgaacaacgt 180agcgtggctg gtgagtgatt cactgctgtg
cccaaggaac gtggcgatgc cattgtcggg 240atcttcattc agttcgtttt
gggtgagcag aacggtccag tggtgaaggc tttcgggatc 300gacaagaagg
aggagcactc cgccgatgag ctcaaataag ccgttgagtc ctttgagctt
360gatgccgccc caaaagagtt gttgccaccg atcgcgaact ttggcagtag
ccatgcgttc 420tgctcctgac cttgaacagc ggtcccaatt tagacccgct
aaacccacaa tgtgtactgg 480tgctggtaat ttagtagaac atggcaacgg
tcacattcga caaggtcaca atccggtacc 540ccggcgcgga gcgcgcaaca
gttcatgagc ttgatttaga tatcgctgat ggcgagtttt 600tggtgctcgt
cggcccttcg ggttgtggta aatccactac gctgcgtgct ttggcggggc
660ttgagggcgt ggagtcgggt gtgatcaaaa ttgatggcaa ggatgtcact
ggtcaggagc 720cggcggatcg cgatatcgcg atggtgttcc agaattatgc
tctgtaccct cacatgacgg 780tggcgaagaa tatgggtttt gcgctgaagt
tggctaagct gccgcaggcg cagatcgatg 840cgaaggtcaa tgaggctgcg
gaaattcttg ggttgacgga gtttttggat cgcaagccta 900aggatttatc
gggtggtcag cgtcagcgtg tggcgatggg tcgcgcgttg gtgcgtgatc
960cgaaggtgtt cctcatggat gagccgctgt ccaacctgga tgcgaaattg
cgcgtgcaaa 1020cccgcgcgga ggtcgctgct ttgcagcgtc gcctgggcac
caccacggtg tatgtcaccc 1080acgatcaggt tgaggcaatg acgatgggcg
atcgggttgc ggtgctcaag gacgggttgc 1140tgcagcaggt cgcaccgccc
agggagcttt acgacgcccc ggtcaacgaa ttcgttgcgg 1200gcttcatcgg
ctcgccgtcc atgaacctct tccctgccaa cgggcacaag atgggtgtgc
1260gcccggagaa gatgctggtc aatgagaccc ctgagggttt cacaagcatt
gatgctgtgg 1320tggatatcgt cgaggagctt ggctccgaat cgtatgttta
tgccacttgg gagggccacc 1380gcctggtggc ccgttgggtg gaaggccccg
tgccagcccc tggcacgcct gtgacttttt 1440cctatgatgc ggcgcaggcg
catcatttcg atctggagtc gggcgagcgt atcgcttagt 1500ttcggacgtg
gggaggcgtc gaaaagcatc tttatttttg accctccggg ggtgatttaa
1560cctaaaattc cacacaaacg tgttcgaggt cattagattg ataagcatct
gttgttaaga 1620aaggtgactt cctatgtcct cgatttcccg caagaccggc
gcgtcacttg cagccaccac 1680actgttggca gcgatcgcac tggccggttg
tagttcagac tcaagctccg actccacaga 1740ttccaccgct agcgaaggcg
cagacagccg cggccccatc acctttgcga tgggcaaaaa 1800cgacaccgac
aaagtcattc cgatcatcga ccgctggaac gaagcccacc ccgatgagca
1860ggtaacgctc aacgaactcg ccggtgaagc cgacgcgcag cgcgaaaccc
tcgtgcaatc 1920cctgcaggcc ggcaactctg actacgacgt catggcgctc
gacgtcatct ggaccgcaga 1980cttcgcggca aaccaatggc tcgcaccact
tgaaggcgac ctcgaggtag acacctccgg 2040actgctgcaa tccaccgtgg
attccgcaac ctacaacggc accctctacg cactgccaca 2100gaacaccaac
ggccagctac tgttccgcaa caccgaaatc atcccagaag caccagcaaa
2160ctgggctgac ctcgtggaat cctgcacgct tgctgaagaa gcaggcgttg
attgcctgac 2220cactcagctc aagcagtacg aaggcctttc agtgaacacc
atcggcttca tcgaaggttg 2280gggaggcagc gtcctagacg atgacggcaa
cgtcaccgta gacagcgacg acgccaaggc 2340aggccttcaa gcgcttgtcg
acggcttcga cgacggcacc atctccaagg catcccttgc 2400agcgaccgaa
gaagaaacca acctcgcatt caccgaaggc caaaccgcct acgccattaa
2460ctggccatac atgtacacca actccgaaga agccgaagca accgcaggca
aattcgaagt 2520acagcccctc gtaggtaaag acggcgtcgg cgtatccacc
cttggtggct acaacaacgg 2580catcaacgtc aactccgaaa acaaggcaac
cgcccgcgac ttcatcgaat tcatcatcaa 2640cgaagagaac caaacctggt
tcgcggacaa ctccttccca ccagttctgg catccatcta 2700cgatgatgag
tcccttgttg agcagtaccc atacctgcca gcactgaagg aatccctgga
2760aaacgcagca ccacgcccag tgtctccttt ctacccagcc atctccaagg
caatccagga 2820caacgcctac gcagcgctta acggcaacgt cgacgttgac
caggcaacca ccgatatgaa 2880ggcagcgatc gaaaacgctt ccagctagtt
cggtaattta gttcattctc cggccacctt 2940ccctgaaatc cttagcggat
ttccacaaag gtggccggag ttttgtccta ttgttgggtg 3000taattgaact
tgtgtgaaag gagtccggat ggcttccggc aaagatcttc aagtttccac
3060atttggctac atctcccgct gccccgtgca ggtctacgaa gcaatcgcag
atcccagaca 3120actagaacgc tacttcgcca ccggcggagt atctggccgc
ctcgaaaccg gatcgactgt 3180ctattgggac ttcgttgatt ttcccggtgc
gtttccggtc caagttgtct cagctacaca 3240ggctgaacac attgaactcc
gctggggaca agcaaatgag ctgcgttccg tcaacttcga 3300gttcgaacct
tttagaaatt tcacccgcac gaaactcacc atcaccgaag gcagttggcc
3360gctcactccc gcaggagccc aagaggctct gggcagccag atgggatgga
ctggcatgct 3420gtccgcacta aaagcgtggc tggaatacgg agtgaacctc
cgcgacgggt tttataagca 3480ataggcaatg tgtccatcac gatgtgtggc
ggattatgat ccatgtaaca agaatgtgca 3540gtttcacaga actgacaatc
aacttatttt gacctgacaa aaggagcgac gacacatggc 3600cacattcaaa
caggccagaa gcgctgcctg gctgatcgcc cccgccctcg tggtccttgc
3660agtggtgatc ggatatccca tcgtccgagc aatttggcta tccttccagg
ccgacaaagg 3720cctcgacccc accaccggac tcttcaccga cggtggcttc
gcaggactag acaattacct 3780ctactggctc acccaacgat gcatgggttc
agacggcacc atccgtacct gcccacccgg 3840cacactagcc accgacttct
ggccagcact acgcatcacg ttgttcttca ccgtggttac 3900cgtcggcttg
gaaactatcc tcggcaccgc catggcactg atcatgaaca aagaattccg
3960tggccgcgca cttgttcgcg cagcgattct tatcccttgg gcaatcccca
ccgccgtcac 4020cgcaaaactg tggcagttca tcttcgcacc acaaggcatc
atcaactcca tgtttggact 4080tagtgtcagt tggaccaccg atccgtgggc
agctagagcc gccgtcattc ttgccgacgt 4140ctggaaaacc acaccattca
tggcactgct gatcctcgcc ggtctgcaaa tgatcccgaa 4200ggaaacctac
gaagcagccc gcgtcgatgg cgcaaccgcg tggcagcaat tcaccaagat
4260caccctcccg ctggtgcgcc cagctttgat ggtggcagta ctcttccgca
ccctcgatgc 4320gctacgcatg tatgacctcc ccgtcatcat gatctccagc
tcctccaact cccccaccgc 4380tgttatctcc cagctggttg tggaagacat
gcgccaaaac aacttcaact ccgcttccgc 4440cctttccaca ctgatcttcc
tgctgatctt cttcgtggcg ttcatcatga tccgattcct 4500cggcgcagat
gtttcgggcc aacgcggaat aaagaaaaag aaactgggcg gaaccaagga
4560tgagaaaccc accgctaagg atgctgttgt aaaggccgat tctgctgtga
aggaagccgc 4620taagccatga ctaaacgaac aaaaggactc atcctcaact
acgccggagt ggtgttcatc 4680ctcttctggg gactagctcc cttctactgg
atggttatca ccgcactgcg cgattccaag 4740cacacctttg acaccacccc
atggccaacg cacgtcacct tggataactt ccgggacgca 4800ctggccaccg
acaaaggcaa caacttcctc gcagccattg gcaactcact ggtcatcagc
4860gtcaccacaa cagcgatcgc tgttctcgtg ggagtgttca ccgcctacgc
tctagcccga 4920ctggaattcc cgggcaaagg cattgtcacc ggcatcatct
tggcagcctc catgttcccc 4980ggcatcgccc tggtcactcc gctgttccag
ctcttcggtg acctcaactg gatcggcacc 5040taccaagcgc tgattatccc
gaacatttcc ttcgcgctac ctctgacgat ctacacgctc 5100gtatccttct
tcaggcaact gccctgggaa ctcgaagaat cagcacgtgt cgacggcgcc
5160acacgtggcc aagccttccg catgatcctg cttcctctag cagcgcccgc
actatttacc 5220accgcgatcc tcgcattcat tgcaacgtgg aacgaattca
tgctggcccg ccaactatcc 5280aacacctcca cagagccagt gaccgttgcg
atcgcaaggt tcaccggacc aagctccttc 5340gaatacccct acgcctctgt
catggcagcg ggagctttgg tgaccatccc actgatcatc 5400atggttctca
tcttccaacg ccgcatcgtc tccggactca ccgcaggtgg cgtgaaagcc
5460tagactagat actcatgagt gctgataaat cccaggacca atccgaatcg
caacgcaaag 5520ggcttcaacc cgaagcgctg cttggattcc tgggattttt
ctcattcctc gccgtcatcc 5580aggcagtcat caacgtgtta cgccccgaac
ctgccgtgtg gccagctctt ctcgcgctcg 5640ttttagtaat cgccacagtg
tcagtatgga gggcttggcg aaagcgccgc cctaattaaa 5700gttcctgcgc
caacgccacg ataattccag atggcccgcg cagataacac aatcggtagg
5760tgtcctcgta atttgcgatc ccatctagtg gttccgcacc gatatgttcg
atcgtttcct 5820caatatcatc caccgcaaac atcaaacggt gcatcccaat
ctggttaggt gcagatggag 5880cggttgcaat cggttccggt tgtagatatt
gagtaagctc cacccgagaa tgtccatccg 5940gagttttcag caccgcgatc
tcagatcgaa ttccgctgag accaacggtc cgatcagcaa 6000aatccccttg
gaccattgtt cggccatcta gggacatccc taatttctca aagaaaccga
6060ctgcttcatc caacgattcc accacaatcg ccacgttgtc caaacgttta
attcccatga 6120tccccatcgt aggtagcatc gtgtgatggc gatcatctac
aacacatcga gcacgctcaa 6180cggcttcatc gcagacaaa
6199261701DNACorynebacterium glutamicummisc_feature(1)..(6)XbaI
cleavage site 26tctagagggt gtaattgaac ttgtgtgaaa ggagtccgga
tggcttccgg caaagatctt 60caagtttcca catttggcta catctcccgc tgccccgtgc
aggtctacga agcaatcgca 120gatcccagac aactagaacg ctacttcgcc
accggcggag tatctggccg cctcgaaacc 180ggatcgactg tctattggga
cttcgttgat tttcccggtg cgtttccggt ccaagttgtc 240tcagctacac
aggctgaaca cattgaactc cgctggggac aagcaaatga gctgcgttcc
300gtcaacttcg agttcgaacc ttttagaaat ttcacccgca cgaaactcac
catcaccgaa 360ggcagttggc cgctcactcc cgcaggagcc caagaggctc
tgggcagcca gatgggatgg 420actggcatgc tgtccgcact aaaagcgtgg
ctggaatacg gagtgaacct ccgcgacggg 480ttttataagc aataggcaat
gtgtccatca cgatgtgtgg cggattatga tccatgtaac 540aagaatgtgc
agtttcacag aactgacaat caacttattt tgacctgaca aaaggagcga
600cgacacagta cttgaagcct aaaaacgacc gagcctattg ggattaccat
tgaagccagt 660gtgagttgca tcacattggc ttcaaatctg agactttaat
ttgtggattc acgggggtgt 720aatgtagttc ataattaacc ccattcgggg
gagcagatcg tagtgcgaac gatttcaggt 780tcgttccctg caaaaactat
ttagcgcaag tgttggaaat gcccccgttt ggggtcaatg 840tccatttttg
aatgtgtctg tatgattttg catctgctgc gaaatctttg tttccccgct
900aaagttgagg acaggttgac acggagttga ctcgacgaat tatccaatgt
gagtaggttt 960ggtgcgtgag ttggaaaaat tcgccatact cgcccttggg
ttctgtcagc tcaagaattc 1020ttgagtgacc gatgctctga ttgacctaac
tgcttgacac attgcatttc ctacaatcgc 1080gagaggagac acaac atg gcc aca
ttc aaa cag gcc aga agc gct gcc tgg 1131 Met Ala Thr Phe Lys Gln
Ala Arg Ser Ala Ala Trp 1 5 10 ctg atc gcc ccc gcc ctc gtg gtc ctt
gca gtg gtg atc gga tat ccc 1179Leu Ile Ala Pro Ala Leu Val Val Leu
Ala Val Val Ile Gly Tyr Pro 15 20 25 atc gtc cga gca att tgg cta
tcc ttc cag gcc gac aaa ggc ctc gac 1227Ile Val Arg Ala Ile Trp Leu
Ser Phe Gln Ala Asp Lys Gly Leu Asp 30 35 40 ccc acc acc gga ctc
ttc acc gac ggt ggc ttc gca gga cta gac aat 1275Pro Thr Thr Gly Leu
Phe Thr Asp Gly Gly Phe Ala Gly Leu Asp Asn 45 50 55 60 tac ctc tac
tgg ctc acc caa cga tgc atg ggt tca gac ggc acc atc 1323Tyr Leu Tyr
Trp Leu Thr Gln Arg Cys Met Gly Ser Asp Gly Thr Ile 65 70 75 cgt
acc tgc cca ccc ggc aca cta gcc acc gac ttc tgg cca gca cta 1371Arg
Thr Cys Pro Pro Gly Thr Leu Ala Thr Asp Phe Trp Pro Ala Leu 80 85
90 cgc atc acg ttg ttc ttc acc gtg gtt acc gtc ggc ttg gaa act atc
1419Arg Ile Thr Leu Phe Phe Thr Val Val Thr Val Gly Leu Glu Thr Ile
95 100 105 ctc ggc acc gcc atg gca ctg atc atg aac aaa gaa ttc cgt
ggc cgc 1467Leu Gly Thr Ala Met Ala Leu Ile Met Asn Lys Glu Phe Arg
Gly Arg 110 115 120 gca ctt gtt cgc gca gcg att ctt atc cct tgg gca
atc ccc acc gcc 1515Ala Leu Val Arg Ala Ala Ile Leu Ile Pro Trp Ala
Ile Pro Thr Ala 125 130 135 140 gtc acc gca aaa ctg tgg cag ttc atc
ttc gca cca caa ggc atc atc 1563Val Thr Ala Lys Leu Trp Gln Phe Ile
Phe Ala Pro Gln Gly Ile Ile 145 150 155 aac tcc atg ttt gga ctt agt
gtc agt tgg acc acc gat ccg tgg gca 1611Asn Ser Met Phe Gly Leu Ser
Val Ser Trp Thr Thr Asp Pro Trp Ala 160 165 170 gct aga gcc gcc gtc
att ctt gcc gac gtc tgg aaa acc aca cca ttc 1659Ala Arg Ala Ala Val
Ile Leu Ala Asp Val Trp Lys Thr Thr Pro Phe 175 180 185 atg gca ctg
ctg atc ctc gcc ggt ctg caa atg atc aagctt 1701Met Ala Leu Leu Ile
Leu Ala Gly Leu Gln Met Ile 190 195 200 27200PRTCorynebacterium
glutamicum 27Met Ala Thr Phe Lys Gln Ala Arg Ser Ala Ala Trp Leu
Ile Ala Pro 1 5 10 15 Ala Leu Val Val Leu Ala Val Val Ile Gly Tyr
Pro Ile Val Arg Ala 20 25 30 Ile Trp Leu Ser Phe Gln Ala Asp Lys
Gly Leu Asp Pro Thr Thr Gly 35 40 45 Leu Phe Thr Asp Gly Gly Phe
Ala Gly Leu Asp Asn Tyr Leu Tyr Trp 50 55 60 Leu Thr Gln Arg Cys
Met Gly Ser Asp Gly Thr Ile Arg Thr Cys Pro 65 70 75 80 Pro Gly Thr
Leu Ala Thr Asp Phe Trp Pro Ala Leu Arg Ile Thr Leu 85 90 95 Phe
Phe Thr Val Val Thr Val Gly Leu Glu Thr Ile Leu Gly Thr Ala 100 105
110 Met Ala Leu Ile Met Asn Lys Glu Phe Arg Gly Arg Ala Leu Val Arg
115 120 125 Ala Ala Ile Leu Ile Pro Trp Ala Ile Pro Thr Ala Val Thr
Ala Lys 130 135 140 Leu Trp Gln Phe Ile Phe Ala Pro Gln Gly Ile Ile
Asn Ser Met Phe 145 150 155 160 Gly Leu Ser Val Ser Trp Thr Thr Asp
Pro Trp Ala Ala Arg Ala Ala 165 170 175 Val Ile Leu Ala Asp Val Trp
Lys Thr Thr
Pro Phe Met Ala Leu Leu 180 185 190 Ile Leu Ala Gly Leu Gln Met Ile
195 200 2820DNAartificial sequenceprimer 28gctggaatac ggagtgaacc
202920DNAartificial sequenceprimer 29gggattgccc aagggataag
203028DNAartificialsynthetic DNA 30gctctagatg cgttctgctc ctgacctt
283128DNAartificialsynthetic DNA 31cgggatcctt tgcgttgcga ttcggatt
28
* * * * *