U.S. patent application number 14/923134 was filed with the patent office on 2016-08-25 for subgenomic replicons of the flavivirus dengue.
The applicant listed for this patent is The United States of America, as represented by the Secretary, Department of Health & Human Servic, The United States of America, as represented by the Secretary, Department of Health & Human Servic. Invention is credited to Andrew I. Dayton, Xiaowu Pang, Mingjie Zhang.
Application Number | 20160243214 14/923134 |
Document ID | / |
Family ID | 23049193 |
Filed Date | 2016-08-25 |
United States Patent
Application |
20160243214 |
Kind Code |
A1 |
Pang; Xiaowu ; et
al. |
August 25, 2016 |
SUBGENOMIC REPLICONS OF THE FLAVIVIRUS DENGUE
Abstract
The present invention discloses the construction of dengue virus
subgenomic replicons containing large deletions in the structural
region (C-preM-E) of the genome, which replicons are useful as
vaccines to protect against dengue virus infection.
Inventors: |
Pang; Xiaowu; (Rockville,
MD) ; Dayton; Andrew I.; (Bethesda, MD) ;
Zhang; Mingjie; (Bethesda, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The United States of America, as represented by the Secretary,
Department of Health & Human Servic |
Rockville |
MD |
US |
|
|
Family ID: |
23049193 |
Appl. No.: |
14/923134 |
Filed: |
October 26, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13242036 |
Sep 23, 2011 |
9169297 |
|
|
14923134 |
|
|
|
|
12394822 |
Feb 27, 2009 |
8048427 |
|
|
13242036 |
|
|
|
|
10656721 |
Sep 5, 2003 |
7524508 |
|
|
12394822 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 39/12 20130101;
C12N 2740/16122 20130101; C12N 2770/24162 20130101; Y02A 50/386
20180101; A61K 2039/5258 20130101; A61K 39/21 20130101; C12N 7/00
20130101; A61P 37/04 20180101; A61K 2039/53 20130101; C12N 15/86
20130101; A61K 2039/5256 20130101; C12N 2740/16134 20130101; C12N
2770/24123 20130101; C12N 2840/203 20130101; A61P 31/14 20180101;
C12N 2770/24161 20130101; A61K 2039/5254 20130101; C12N 2770/24143
20130101; A61P 31/12 20180101; C07K 14/005 20130101 |
International
Class: |
A61K 39/21 20060101
A61K039/21; C07K 14/005 20060101 C07K014/005; C12N 15/86 20060101
C12N015/86; A61K 39/12 20060101 A61K039/12; C12N 7/00 20060101
C12N007/00 |
Claims
1-24. (canceled)
25. A subgenomic replicon of dengue virus origin comprising a
deletion for the sequence coding for PreM structural protein
(.DELTA.M).
26. The subgenomic replicon of claim 25, wherein the dengue virus
origin is dengue virus type 1, 2, 3, or 4 origin.
27. The subgenomic replicon of claim 25, which is adapted to
receive at least a nucleotide sequence without disrupting its
replication capabilities.
28. A vaccine or therapeutic comprising the subgenomic replicon of
claim 25 or 27 and a pharmaceutically acceptable carrier.
29. A dengue virus like particle comprising a subgenomic replicon
of dengue virus origin which comprises a deletion for the sequence
coding for PreM structural protein (.DELTA.M), optionally which is
adapted to receive at least a nucleotide sequence without
disrupting its replication capabilities, and structural proteins of
the homologous dengue virus wherein said structural proteins
encapsulate said subgenomic replicon.
30. A method of immunization comprising administering to an
individual in need thereof the subgenomic replicon of claim 25.
31. A method of treatment comprising administering to an individual
in need thereof the subgenomic replicon of claim 25.
Description
RELATED APPLICATION
[0001] This application is a continuation of application Ser. No.
13/242,036, filed Sep. 23, 2011 (now U.S. Pat. No. 9,169,297),
which is a continuation of application Ser. No. 12/394,822, filed
Feb. 27, 2009 (now U.S. Pat. No. 8,048,427), which is a
continuation of application Ser. No. 10/656,721, filed Sep. 5, 2003
(now U.S. Pat. No. 7,524,508), which is a continuation of and
claims the benefit of priority of International Application No.
PCT/US02/06962 filed Feb. 21, 2002, designating the United States
of America and published in English, which claims the benefit of
priority of U.S. Provisional Application No. 60/274,684 filed Mar.
9, 2001, both of which are hereby expressly incorporated by
reference in their entireties.
FIELD OF THE INVENTION
[0002] The present invention discloses the construction of dengue
virus subgenomic replicons containing large deletions in the
structural region (C-preM-E) of the genome, which replicons are
useful as vaccines to protect against dengue virus infection.
BACKGROUND OF THE INVENTION
[0003] The mosquito-borne flaviviras, dengue, is estimated to cause
in each year 100 million cases of dengue fever (DF), 500,000 cases
of dengue hemorrhagic fever (DHF) and 25,000 deaths, with 2.5
billion people at risk (Monath, T. P. 1994 PNAS USA 91:2395-2400).
Although a successful vaccine against the prototypical flavivirus,
yellow fever (YF) virus, has been in use since the 1930s and
vaccines to two other flaviviruses, Japanese encephalitis (JE)
virus and tick-borne encephalitis (TBE) virus are currently
available, there is as yet no dengue vaccine approved for use
(Cardosa, M J. 1998 Brit Med Bull 54:395-405).
[0004] Dengue virus has a typical flavivirus genome structure, as
described in FIG. 2A. The structural proteins, C, prM (M) and E,
are involved in packaging, export and subsequent entry. The
non-structural proteins, NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5
include an RNA-directed RNA polymerase, and a protease function
involved in cleaving certain positions of the long viral
polyprotein which contains all the viral genes (Chambers, T J. et
al. 1990 Ann Rev Microbiol 44:649-88; Rice, C M. 1996 In: Fields
Virology, 3rd ed. Philadelphia, Pa. Lippincott-Raven Publishers, p.
931-996).
[0005] The four serotypes of dengue virus ("1" through "4") share
approximately 60%-74% amino acid residue identity with one another
in the E gene (Thomas, C J. et al. 1990 Ann Rev Microbiol
44:649-88) and induce cross-reacting antibodies (Heinz, F. X. 1986
Adv Vims Res 31:103-168). However, neutralizing antibodies to the
structural proteins of one serotype of dengue typically not only
fail to provide protection against other serotypes, but appear to
cause the enhanced replication of virus seen in dengue hemorrhagic
fever, which is generally seen upon reinfection by dengue virus of
a different serotype. This antibody-dependent enhancement of
infection (ADE), which is believed to be mediated by enhancement of
viral uptake by macrophages (Morens, D. M. 1994 Clin Infect Dis
19:500-512) complicates dengue vaccine development, since an
inadequate or modified immunogen may contribute to disease, rather
than prevent infection (Halstead, S. B. 1988 Science
239:476-481).
[0006] Two strategies suggest themselves for circumventing the
problems caused by cross reacting antibodies against the major
structural proteins, prM and E. One strategy is to immunize with
multiple strains of dengue virus to elicit high affinity,
neutralizing antibodies against the multiple dengue serotypes. At
least one vaccine to do this (using dengue vaccine candidates DEN-1
PDK13, DEN-2 PDK53, DEN-3 PGMK 30/F3, and DEN-4 PDK48) has been in
clinical trials (Bhamarapravati, N. and Sutee, Y. 2000 Vaccine 18
Suppl 2:4447; Kanesa-thasan, N. et al. 2001 Vaccine 19:3179-3188).
A second strategy is to induce immunity only to viral proteins
other than prM and E. Several studies have shown that the
nonstructural glycoprotein NS1 can play an important role in
protection against dengue. Mice immunized with purified dengue-2
NS1 protein injected intramuscularly and boosted after 3 days and
two weeks were protected from developing lethal dengue encephalitis
upon subsequent challenge with dengue-2 virus (Schlesinger, J J. et
al. 1987 J Gen Virol 68:853-857) Similarly, mice immunized with
recombinant vaccinia virus expressing authentic NS1 (Falgout, B. et
al. 1990 J Virol 64:4356-4363) were protected against the
development of dengue-4 virus encephalitis when challenged by
intracerebral injection. Inoculation of mice with specific
combinations of MAbs directed against dengue-2 NS1 (Henchal. E. A.
et al. 1988 J Gen Virol 69:2101-2107) also protects against lethal
virus encephalitis upon intracerebral dengue-2 challenge. Other
nonstructural proteins are also immunogenic and may participate in
eliciting protection (Brinton, M. A. et al. 1998 Clin Diagn Virol
10:129-39).
SEGUE TO SUMMARY OF THE INVENTION
[0007] Towards the goal of devising a "live" vaccine based on only
non-structural dengue proteins, we have attempted to construct
dengue virus genomes from which the pre-M and E genes have been
deleted. Upon introduction into a host's cells, these sub-genomic
fragments should replicate intracellularly and support prolonged
expression of dengue non-structural proteins without producing the
deleted structural proteins and without forming infectious virions.
Sub-genomic replicons of several positive-strand RNA animal viruses
have been reported, particularly yellow fever and Kunjin among the
flaviviruses. These replicons, when introduced into host cells,
replicate and make viral proteins for over 41 days (Khromykn, A. A.
and Westaway, E. D. 1997 J Virol 71:1497-1505), but cannot form
infectious virions because they lack critical structural proteins.
Effectively delivered to host cells in vivo, such replicons should
efficiently induce immunologic reactions against the expressed
proteins remaining in the sub-genomic construct. Herein we describe
the successful construction of two dengue virus sub-genomic
constructs which replicate in LLC-MK2 cells in tissue culture when
transfected in as full length RNA. We also report that expression
of dengue virus proteins from these replicons can be supported by
transfection of a DNA-based expression vector containing the
replicon.
SUMMARY OF THE INVENTION
[0008] The present invention discloses the construction of dengue
virus subgenomic replicons containing large deletions in the
structural region (C-preM-E) of the genome, which replicons are
useful as vaccines to protect against dengue virus infection.
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIG. 1. Representation of .DELTA.E, .DELTA.ME, and
.DELTA.CME dengue replicons compared to wildtype. (A) Wildtype
dengue replicon. (B) The .DELTA.E replicon contains a deletion of
the sequence coding for Envelope (E) protein. (C) The .DELTA.ME
replicon contains a deletion of the sequence coding for
pre-Membrane (prM) and Envelope (E) proteins. (D) The .DELTA.CME
contains a deletion of the sequence coding for Core (C),
pre-Membrane (prM), and Envelope (E) proteins.
[0010] FIG. 2. (A) Diagram of dengue virus genome and deletion
mutations in this study. (B) Sequences at the deletion points of
mutants used in this study. .DELTA.ME Replicon: (AGTTGT, SEQ ID NO:
1; CGTAACAGCACC, SEQ ID NO: 2; GGTTCT, SEQ ID NO: 3); .DELTA.CME
Replicon (AGTTGT, SEQ ID NO: 4; GAGAGAAGCACC, SEQ ID NO: 5; GGTTCT,
SEQ ID NO: 6).
[0011] FIG. 3. Expression of dengue virus as determined by
immunofluorescent staining with mouse anti-dengue virus-2. Cells
were counterstained with Evans Blue, but different filtration
systems available on the different microscopes variably blocked
visualization of the background of cells fluorescing red.
Transfection efficiencies were generally in the range of 0.01% to
1% and in the background of each photograph in this figure are
numerous non-fluorescent cells, best visualized on an Apple
Macintosh. In the experiments herein, cells were photographed
variously with either 40.times. or 60.times. objectives. 3A,
Dengue-2 wild type virus (48 hrs); 3B, .DELTA.prM-E (48 hrs); 3C,
.DELTA.C-prM-E (48 hrs); 3D, Dengue-2 wild type (8 days); 3E,
.DELTA.prM-E (8 days); 3F, .DELTA.C-prM-E (8 days).
[0012] FIG. 4. Dengue virus RNA in transfected cells as determined
by RT-PCR, normalized to total RNA: Lane 1, .lamda., Hind-Ill
molecular weight markers; Lanes 2-4, .DELTA.prM-E; 5-7, .DELTA.E; 2
and 5, 6 hrs; 3 and 6, 24 hrs; 4 and 7, 48 hrs.
[0013] FIG. 5. Expression of dengue virus proteins by
DNA-.DELTA.prM-E transfected into cells in the form of plasmid
DNA.
[0014] FIG. 6. Construction of wild type dengue virus and dengue
virus replicon vectors used in these studies. (A) The diagram at
the top represents the wild type dengue virus genome. (B)
.DELTA.prM-E/GFP replicon. (C) .DELTA.prM-E/gp120 replicon. (D)
.DELTA.prM-E/gp160 replicon.
[0015] FIG. 7. Expression of green fluorescent protein (GFP) by
.DELTA.pre-M/E-GFP 48 hours post transfection.
[0016] FIG. 8. Expression of proteins by .DELTA.pre-M/E-gpl20 50
hours post transfection. Left and right frames are two independent
fields. Anti-dengue serum was used in these experiments.
[0017] FIG. 9. Expression of proteins by .DELTA.pre-M/E-gpl20 48
hours post transfection. Left and right frames are two independent
fields. Anti-HIV serum was used in these experiments.
[0018] FIG. 10. Expression of gpl60 by .DELTA.pre-M/E-gpl60 48
hours post transfection. Left and right frames are independent
fields. Anti-HIV serum was used in these experiments.
[0019] FIG. 11. Expression of gpl60 by .DELTA.pre-M/E-gpl60 36
hours post transfection. Anti-dengue serum was used in these
experiments. Left and right panels are independent fields.
[0020] FIG. 12. Expression of proteins by .DELTA.pre-M/E-gpl20 9
days post transfection. Cells were trypsinized and replated on day
7 post transfection and harvested for immunofluorescence two days
later. Left and right frames are two independent fields.
Anti-dengue serum was used in these experiments
[0021] FIG. 13. Simultaneous expression of HIV and dengue proteins
by .DELTA.pre-M/E-gp120-transfected cells 4 days post transfection.
Left frame: FITC detection of HIV proteins. Right frame: Rhodamine
detection of dengue proteins.
[0022] FIG. 14. Simultaneous expression of HIV and dengue proteins
by .DELTA.pre-M/E-gp120-transfected cells 7 days post transfection.
Left frame: FITC detection of HIV proteins. Right frame: Rhodamine
detection of dengue proteins.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
[0023] The invention relates to a subgenomic replicon of dengue
virus origin comprising a deletion for the sequence coding for C,
PreM, and E structural proteins (.DELTA.CME).
[0024] The invention also relates to a subgenomic replicon of
dengue virus origin comprising a deletion for the sequence coding
for PreM and E structural proteins (.DELTA.ME).
[0025] The invention also relates to a subgenomic replicon of
dengue virus origin comprising a deletion for the sequence coding
for E structural protein (.DELTA.E).
[0026] The invention also relates to a subgenomic replicon of
dengue virus type 1 origin comprising a deletion for the sequence
coding for C, PreM, and E structural proteins (.DELTA.CME).
[0027] The invention also relates to a subgenomic replicon of
dengue virus type 1 origin comprising a deletion for the sequence
coding for PreM and E structural proteins (.DELTA.ME).
[0028] The invention also relates to a subgenomic replicon of
dengue virus type 1 origin comprising a deletion for the sequence
coding for E structural protein (.DELTA.E).
[0029] The invention also relates to a subgenomic replicon of
dengue virus type 2 origin comprising a deletion for the sequence
coding for C, PreM, and E structural proteins (.DELTA.CME).
[0030] The invention also relates to a subgenomic replicon of
dengue virus type 2 origin comprising a deletion for the sequence
coding for PreM and E structural proteins (.DELTA.ME).
[0031] The invention also relates to a subgenomic replicon of
dengue virus type 2 origin comprising a deletion for the sequence
coding for E structural protein (.DELTA.E).
[0032] The invention also relates to a subgenomic replicon of
dengue virus type 3 origin comprising a deletion for the sequence
coding for C, PreM, and E structural proteins (.DELTA.CME).
[0033] The invention also relates to a subgenomic replicon of
dengue virus type 3 origin comprising a deletion for the sequence
coding for PreM and E structural proteins (.DELTA.ME).
[0034] The invention also relates to a subgenomic replicon of
dengue virus type 3 origin comprising a deletion for the sequence
coding for E structural protein (.DELTA.E).
[0035] The invention also relates to a subgenomic replicon of
dengue virus type 4 origin comprising a deletion for the sequence
coding for C, PreM, and E structural proteins (.DELTA.CME).
[0036] The invention also relates to a subgenomic replicon of
dengue virus type 4 origin comprising a deletion for the sequence
coding for PreM and E structural proteins (.DELTA.ME).
[0037] The invention also relates to a subgenomic replicon of
dengue virus type 4 origin comprising a deletion for the sequence
coding for E structural protein (.DELTA.E).
[0038] The invention also relates to a subgenomic replicon of
dengue virus origin comprising a deletion for the sequence coding
for C, PreM, and E structural proteins (.DELTA.CME), for PreM and E
structural proteins (.DELTA.ME), or for E structural protein
(.DELTA.E); and further comprising part or all of the 5'UTR; at
least about the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64,
65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81,
82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98,
99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111,
112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124,
125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137,
138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150,
151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163,
164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, or 175
nucleotides of C protein; at least about the last 1, 2, 3, 4, 5, 6,
7, 8, 9. 10, 11, 12, 13, 14, 15, 16, 17, 18. 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57,
58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74,
75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91,
92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106,
107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119,
120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132,
133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145,
146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158,
159. 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171,
172, 173, 174, or 175 nucleotides of E protein; substantially all
of the nonstructural region; and part or all of the 3'UTR.
[0039] The invention also relates to a subgenomic replicon of
dengue virus origin comprising a deletion for the sequence coding
for C, PreM, and E structural proteins (.DELTA.CME), for PreM and E
structural proteins (.DELTA.ME), or for E structural protein
(.DELTA.E), which is adapted to receive at least a nucleotide
sequence without disrupting its replication capabilities.
[0040] The invention also relates to a vaccine comprising a
subgenomic replicon of dengue virus origin which comprises a
deletion for the sequence coding for C, PreM, and E structural
proteins (.DELTA.CME), for PreM and E structural proteins
(.DELTA.ME), or for E structural protein (.DELTA.E), optionally
which is adapted to receive at least a nucleotide sequence without
disrupting its replication capabilities, and a pharmaceutically
acceptable carrier.
[0041] The invention also relates to a therapeutic comprising a
subgenomic replicon of dengue virus origin which comprises a
deletion for the sequence coding for C, PreM, and E structural
proteins (.DELTA.CME), for PreM and E structural proteins
(.DELTA.ME), or for E structural protein (.DELTA.E), optionally
which is adapted to receive at least a nucleotide sequence without
disrupting its replication capabilities, and a pharmaceutically
acceptable carrier.
[0042] The invention also relates to a dengue virus like particle
comprising a subgenomic replicon of dengue virus origin which
comprises a deletion for the sequence coding for C, PreM, and E
structural proteins (.DELTA.CME), for PreM and E structural
proteins (.DELTA.ME), or for E structural protein (.DELTA.E),
optionally which is adapted to receive at least a nucleotide
sequence without disrupting its replication capabilities, and
structural proteins of the homologous dengue virus wherein said
structural proteins encapsulate said subgenomic replicon.
[0043] The invention also relates to a method of immunization
comprising administering to an individual in need thereof a
subgenomic replicon of dengue virus origin which comprises a
deletion for the sequence coding for C, PreM, and E structural
proteins (.DELTA.CME), for PreM and E structural proteins
(.DELTA.ME), or for E structural protein (.DELTA.E), optionally
which is adapted to receive at least a nucleotide sequence without
disrupting its replication capabilities.
[0044] The invention also relates to a method of immunization
comprising administering to an individual in need thereof a dengue
virus like particle which comprises a subgenomic replicon of dengue
virus origin comprising a deletion for the sequence coding for C,
PreM, and E structural proteins (.DELTA.CME), for PreM and E
structural proteins (.DELTA.ME), or for E structural protein
(.DELTA.E), optionally which is adapted to receive at least a
nucleotide sequence without disrupting its replication
capabilities, and structural proteins of the homologous dengue
virus wherein said structural proteins encapsulate said subgenomic
replicon.
[0045] The invention also relates to a method of treatment
comprising administering to an individual in need thereof a
subgenomic replicon of dengue virus origin which comprises a
deletion for the sequence coding for C, PreM, and E structural
proteins (.DELTA.CME), for PreM and E structural proteins
(.DELTA.ME), or for E structural protein (.DELTA.E), optionally
which is adapted to receive at least a nucleotide sequence without
disrupting its replication capabilities.
[0046] The invention also relates to a method of treatment
comprising administering to an individual in need thereof a dengue
virus like particle which comprises a subgenomic replicon of dengue
virus origin comprising a deletion for the sequence coding for C,
PreM, and E structural proteins (.DELTA.CME), for PreM and E
structural proteins (.DELTA.ME), or for E structural protein
(.DELTA.E), optionally which is adapted to receive at least a
nucleotide sequence without disrupting its replication
capabilities, and structural proteins of the homologous dengue
virus wherein said structural proteins encapsulate said subgenomic
replicon.
Dengue Genome
[0047] Dengue viruses are part of the Flavivirus genus in the
Flaviviridae family. Flaviviruses are single stranded RNA (ssRNA)
positive strand viruses which do not have a DNA stage. The
flavivirus genome is approximately 11 kb and consists of a long
Open Reading Frame (ORF) flanked by a 5' Untranslated Region (UTR)
(95-132 nt) and a 3'UTR (114-624 nt). The UTRs contain conserved
RNA elements and play a role in viral RNA replication. The ORF
contains three structural proteins, Core (C), pre-Membrane (prM),
Envelope (E), and seven non-structural proteins, NS1, NS2A, NS2B,
NS3, NS4A, NS4B, and NS5.
Subgenomic Replicons
[0048] Although the present invention describes a means for
producing proteins, the term "protein" should be understood to
include within its scope parts of proteins such as peptide and
polypeptide sequences.
[0049] In use, the replicon is introduced into a host cell where
gene expression and hence protein production take place. Because
the vector is capable of self-replication, multiple copies of the
replicon will also be generated. This leads to an exponential
increase in the number of replicons in the host cell as well as an
exponential increase in the amount of protein that is produced.
[0050] Optionally, upon introduction of a second vector, containing
the structural genes necessary to produce virus particles,
structural proteins are produced. These proteins encapsulate the
replicon therein forming a "pseudo" recombinant virus that is
capable of producing heterologous protein inside another cell. The
pseudo-virus cannot, however, replicate to produce new viral
particles because the genes necessary for the production of the
structural proteins are not provided in the replicon. Pseudo-virus
stock will only be produced when co-transfection of the replicon
and the vector bearing the structural genes occurs.
[0051] It will be appreciated that any replicon derived from a
dengue RNA, which is lacking at least a structural gene, and,
optionally, which is adapted to receive at least a nucleotide
sequence may be employed in the present invention. Preferably, the
replicon is derived from dengue types 1, 2, 3, or 4 and is adapted
to comprise (open language) or consist of (closed language) the
following: part or all of the 5'UTR; at least about the first 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37,
38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54,
55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71,
72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88,
89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103,
104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116,
117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129,
130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142,
143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155,
156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168,
169, 170, 171, 172, 173, 174, or 175 nucleotides of C protein
(preferably the first 20 to 60 nucleotides); at least about the
last 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,
36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52,
53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69,
70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86,
87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102,
103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115,
116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128,
129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141,
142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154,
155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167,
168, 169, 170, 171, 172, 173, 174, or 175 nucleotides of E protein
(preferably the last 72 nucleotides); substantially all of the
nonstructural region; and part or all of the 3'UTR. Replication of
a flavivirus genome is dependent on the genes in the nonstructural
region of the genome being present during transcription and
translation. Preferably any modification made to the nonstructural
region should not interfere with the functional activity of the
genes within the nonstructural region of the genome.
[0052] Optimal dengue replicon design for transfection into
eukaryotic cells might also include such sequences as: sequences to
promote expression of the heterologous gene of interest, including
appropriate transcription initiation, termination, and enhancer
sequences; as well as sequences that enhance translation
efficiency, such as the Kozak consensus sequence; and an internal
ribosomal entry site (IRES) of picornaviruses.
[0053] Therefore, while the nucleotide sequence may be placed under
the control of dengue regulatory machinery in the replicon, it may
alternatively be controlled by one or more alternate regulatory
elements capable of promoting expression. Such elements will be
well known to those of ordinary skill in this field. In one
embodiment of the invention the replicon contains a eucaryotic
promoter sequence (such as a CMV promoter) upstream of the 5'UTR
and a ribozyme sequence (such as a delta virus ribozyme) followed
by a transcription terminator sequence downstream of the 3'UTR.
Transfection of the resulting plasmid DNA in cells will ensure
production of a dengue replicon RNA transcript with the authentic
5'-end by cellular RNA polymerase II and with the authentic 3'-end
cleaved by delta virus ribozyme, which is preferred for its
efficient replication.
[0054] It will be appreciated that the nucleotide sequence inserted
into the replicon may encode part or all of any natural or
recombinant protein except for the structural protein sequence into
which or in place of which the nucleotide sequence is inserted. For
example, the nucleotide sequence may encode a single polypeptide
sequence or a plurality of sequences linked together in such a way
that each of the sequences retains its identity when expressed as
an amino acid sequence. Where the nucleotide sequence encodes a
plurality of peptides, the peptides should be linked together in
such a way that each retains its identity when expressed. Such
polypeptides may be produced as a fusion protein or engineered in
such a manner to result in separate polypeptide or peptide
sequences.
[0055] Where the vector is used to deliver nucleotide sequences to
a host cell to enable host cell expression of immunogenic
polypeptides, the nucleotide sequence may encode one or more
immunogenic polypeptides in association with a range of epitopes
which contribute to T-cell activity. In such circumstances the
heterologous nucleotide sequence preferably encodes epitopes
capable of eliciting either a helper T-cell response or a cytotoxic
T-cell (CTL) response or both.
[0056] The replicon described herein may also be engineered to
express multiple nucleotide sequences allowing co-expression of
several proteins such as a plurality of antigens together with
cytokines or other immunomodulators to enhance the generation of an
immune response. Such a replicon might be particularly useful for
example in the production of various proteins at the same time or
in gene therapy applications.
[0057] By way of example only the nucleotide sequence may encode
the DNA sequence of one or more of the following: malarial surface
antigens; betagalactosidase; green fluorescence protein; any major
antigenic viral antigen, e.g., Haemagglutinin from influenza virus
or a human immunodeficiency virus (HIV) protein such as HIV gp 120
(or gp 160) and HIV gag protein or part thereof; any eukaryotic
polypeptide such as, for example, a mammalian polypeptide such as
an enzyme, e.g., chymosin or gastric lipase; an enzyme inhibitor,
e.g., tissue inhibitor of metalloproteinase (T1MP); a hormone,
e.g., growth hormone; a lymphokine, e.g., an interferon; a
cytokine, e.g., an interleukin (e.g., IL-2, IL-4, IL-6 etc); a
chemokine, e.g., macrophage inflammatory protein-2; a plasminogen
activator, e.g., tissue plasminogen activator (tPA) or
prourokinase; or a natural, modified or chimeric immunoglobulin or
a fragment thereof including chimeric immunoglobulins having dual
activity such as antibody enzyme or antibody-toxin chimeras.
[0058] To optimize expression of desired foreign proteins, an
autocatalytic peptide cleavage site is added to the replicon. This
construct will allow one to place an autocatalytic peptide cleavage
site between two protein coding sequences. When the protein is
expressed from the nucleic acid construct, the autocatalytic
peptide cleavage site will automatically cleave the desired foreign
protein.
[0059] The table below compares known autocatalytic peptide
cleavage sites:
TABLE-US-00001 -16 -1 1 7 Mengo virus, GYESDLLERDVEINPG PFTFKERQ
strain M (SEQ ID NO: 7) (SEQ ID NO: 8) Encephalo- GYPADLLIHDIETNPG
PFMAKEKK myocarditis (SEQ ID NO: 9) (SEQ ID NO: 10) virus, strain B
Encephalo- GYEADEITHDIETNPG PFMFRPRK myocarditis (SEQ ID NO: 11)
(SEQ ID NO: 12) virus, strain Rueckert Theilers murine
DYYRQRLIHDVETNPG EVQSVPQP encephalo- (SEQ ID NO: 13) (SEQ ID NO:
14) myelitis virus, strain Bean Theilers murine DYYKQRLIHDVEMNPG
PVQSVFQP encephalo- (SEQ ID NO: 15) (SEQ ID NO: 16) myelitis virus,
strain GDVII Foot-and-mouth NFDLLKLAGDVESNPG PFFFSDVR disease
virus, (SEQ ID NO: 17) (SEQ ID NO: 18) strain 01 Kaufbeuren Bovine
QIDRILISGDIELNGP PNALVKLN rotavirus (SEQ ID NO: 19) (SEQ ID NO: 20)
type C Porcine QIDRILISGDVELNPG PDPLIRLN rotavirus (SEQ ID NO: 21)
(SEQ ID NO: 22) type C
[0060] Preferably, the autocatalytic peptide cleavage site is at
least 17 amino acids in length with 16 amino acids extending in the
minus direction (NH2 direction) and one residue in the plus
direction (COOH direction) relative to the cleavage site. Ryan and
Drew, EMBO J 13: 928 (1994) added 3 amino acids (QLL) extending in
the minus direction corresponding to the three C-terminal residues
of capsid protein ID apropos foot-and-mouth disease virus 2A
oligopeptide to mediate cleavage of an artificial polyprotein.
Other peptide cleavage sites, autocatalytic or otherwise, are
contemplated that act as a protease.
[0061] The second vector that contains the dengue structural
gene(s) should be engineered to prevent recombination with the
self-replicating expression vector. One means for achieving this
end is to prepare the second vector from genetic material that is
heterologous in origin to the origin of the self-replicating
expression vector. For example, the second vector might be prepared
from Semliki Forest virus (SFV) as the replicon is prepared from
dengue virus.
[0062] To optimize expression of the dengue structural genes, the
second vector might include such sequences as: sequences to promote
expression of the genes of interest, including appropriate
transcription initiation, termination, and enhancer sequences; as
well as sequences that enhance translation efficiency, such as the
Kozak consensus sequence. Preferably, the second vector contains
separate regulatory elements associated with each of the different
structural genes expressed by the vector. Most preferably, the
dengue C gene and the prME genes are placed under the control of
separate regulatory elements in the vector.
[0063] The present invention also provides stable cell lines
capable of persistently producing replicon RNAs. To prepare such
cell lines, the described vectors are constructed in selectable
form by inserting an IRES-Neo (neomycin transferase) or such
cassette into the 3'UTR, the 5'UTR, in place of a structural gene,
or other.
[0064] Host cell lines contemplated to be useful in the method of
the invention include any eukaryotic cell lines that can be
immortalized, i.e., are viable for multiple passages, (e.g.,
greater than 50 generations), without significant reduction in
growth rate or protein production. Useful cell lines should also be
easy to transfect, be capable of stably maintaining foreign RNA
with an unarranged sequence, and have the necessary cellular
components for efficient transcription, translation,
post-translation modification, and secretion of the protein.
Currently preferred cells are those having simple media component
requirements, and which can be adapted for suspension culturing.
Most preferred are mammalian cell lines that can be adapted to
growth in low serum or serum-free medium. Representative host cell
lines include BHK (baby hamster kidney), VERO, C6-36, COS, CHO
(Chinese hamster ovary), myeloma, HeLa, fibroblast, embryonic and
various tissue cells, e.g., kidney, liver, lung and the like.
Desirably a cell line is selected from one of the following: BHK21
(hamster), SK6 (swine), VERO (monkey), L292 (mouse), HeLa (human),
HEK (human), 2fTGH cells, HepG2 (human). Useful cells can be
obtained from the American Type Culture Collection (ATCC),
Manassas, Va.
[0065] With respect to the transfection process used in the
practice of the invention, all means for introducing nucleic acids
into a cell are contemplated including, without limitation,
CaPO.sub.4 co-precipitation, electroporation, DEAE-dextran mediated
uptake, protoplast fusion, microinjection and lipofusion. Moreover,
the invention contemplates either simultaneous or sequential
transfection of the host cell with vectors containing the gene
sequences. In one preferred embodiment, host cells are sequentially
transfected with at least two unlinked vectors, one of which
contains dengue replicon expressing heterologous gene, and the
other of which contains the structural genes.
[0066] The present invention also provides virus like particles
containing dengue replicons and a method for producing such
particles. It will be appreciated by those skilled in the art that
virus like particles that contain dengue derived replicons can be
used to deliver any nucleotide sequence to a cell. Further, the
replicons may be of either DNA or RNA in structure. One particular
use for such particles is to deliver nucleotide sequences coding
for polypeptides that stimulate an immune response. Such particles
may be employed as a therapeutic or in circumstances where the
nucleotide sequence encodes peptides that are capable of eliciting
a protective immune response so that they may be used as a vaccine.
Another use for such particles is to introduce into a subject a
nucleotide sequence coding for a protein that is either deficient
or is being produced in insufficient amounts in a cell.
[0067] The replicon containing dengue virus like particles that
contain nucleotide coding sequence for immunogenic polypeptide(s)
as active ingredients may be prepared as injectables, either as
liquid solutions or suspensions; solid forms suitable for solution
in, or suspension in, liquid prior to injection may also be
prepared. The dengue replicon therapeutic(s) may also be mixed with
excipients that are pharmaceutically acceptable and compatible with
the replicon encapsulated viral particle. Suitable excipients are,
for example, water, saline, dextrose, glycerol, ethanol, or the
like and combinations thereof. In addition, if desired, the
therapeutic may contain minor amounts of auxiliary substances such
as wetting or emulsifying agents, pH buffering agents, and/or
adjuvant which enhance the effectiveness of the therapeutic.
[0068] The replicon containing dengue virus like particles may be
conventionally administered parenterally, by injection, for
example, either subcutaneously or intramuscularly. Additional
formulations which are suitable for other modes of administration
include suppositories and, in some cases, oral formulations. For
suppositories, traditional binders and carriers may include, for
example, polyalkylene glycols or triglycerides; such suppositories
may be formed from mixtures containing the active ingredient in the
range of 0.5% to 10%, preferably 1%-2%.
[0069] Oral formulations include such normally employed excipients
as, for example, pharmaceutical grades of mannitol, lactose,
starch, magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate and the like. These compositions take the form of
solutions, suspensions, tablets, pills, capsules, sustained release
formulations or powders and contain 10%-95% of virus like
particles, preferably 25-70%.
[0070] The dengue virus like particles may be formulated into the
vaccine as neutral or salt forms. Pharmaceutically acceptable salts
include the acid addition salts (formed with free amino groups of
the peptide) and which are formed with inorganic acids such as, for
example, hydrochloric or phosphoric acids, or such organic acids
such as acetic, oxalic, tartaric, maleic, and the like. Salts
formed with the free carboxyl groups may also be derived from
inorganic bases such as, for example, sodium, potassium, ammonium,
calcium, or ferric hydroxides, and such organic bases as
isopropylamins, trimethylamine, 2-ethylamino ethanol, histidino,
procaine, and the like.
[0071] The dengue virus like particles may be administered in a
manner compatible with the dosage formulation and in such amount as
will be prophylactically and/or therapeutically effective. The dose
of viral particles to be administered depends on the subject to be
treated, the type of nucleotide sequence that is being administered
and the type of expression efficiency of that sequence and in the
case where the nucleotide sequence encodes immunogenic
peptide/polypeptides the degree of protection desired. Precise
amounts of active ingredient required to be administered may depend
on the judgment of the practitioner and may be peculiar to each
subject.
[0072] The dengue virus like particles may be given to a subject in
a single delivery schedule, or preferably in a multiple delivery
schedule. A multiple delivery schedule is one in which a primary
course of delivery may be with 1-10 separate doses, followed by
other doses given at subsequent time intervals required to maintain
and or re-enforce the effect sought and if needed, a subsequent
dose(s) after several months. The delivery regimen will also, at
least in part, be determined by the need of the individual and be
dependent upon the judgment of the practitioner.
Genetic Immunization and Gene Therapy
[0073] In some embodiments, the present invention relates to
genetic methods of eliciting immune responses in an individual
which can protect an individual from dengue infection or combat
dengue diseases. According to the present invention, genetic
material that encodes a subgenomic replicon is directly
administered to an individual either in vivo or to the cells of an
individual ex vivo. The genetic material encodes a peptide or
protein that shares at least an epitope with a dengue nonstructural
protein to be targeted. The genetic material is expressed by the
individual's cells to form immunogenic target proteins that elicit
an immune response. The resulting immune response is broad based:
in addition to a humoral immune response, both arms of the cellular
immune response are elicited. Thus, the immune responses elicited
by vaccination methods of the present invention are particularly
effective to protect against dengue infection or combat diseases
associated with dengue.
[0074] The immune response elicited by the target protein that is
produced by vaccinated cells in an individual is a broad-based
immune response which involves B cell and T cell responses
including cytotoxic T cell (CTL) responses. The target antigens
produced within the cells of the host are processed
intracellularly: broken down into small peptides, bound by Class I
MHC molecules, and expressed on the cell surface. The Class I
MHC-target antigen complexes are capable of stimulating CD8+
T-cells, which are phenotypically the killer/suppressor cells.
Genetic immunization according to the present invention is thus
capable of eliciting cytotoxic T-cell (CTL) responses (killer cell
responses). It has been observed that genetic immunization
according to the present invention is more likely to elicit CTL
responses than other methods of immunization.
[0075] Genetic immunization according to the present invention
elicits an effective immune response without the use of infective
agents or infective vectors. Vaccination techniques which usually
do produce a CTL response do so through the use of an infective
agent. A complete, broad based immune response is not generally
exhibited in individuals immunized with killed, inactivated or
subunit vaccines. The present invention achieves the full
complement of immune responses in a safe manner without the risks
and problems associated with vaccinations that use infectious
agents.
[0076] According to some embodiments of the present invention,
cells are treated with compounds that facilitate uptake of genetic
constructs by the cells. According to some embodiments of the
present invention, cells are treated with compounds that stimulate
cell division and facilitate uptake of genetic constructs.
Administration of compounds that facilitate uptake of genetic
constructs by the cells including cell stimulating compounds
results in a more effective immune response against the target
protein encoded by the genetic construct.
[0077] According to some embodiments of the present invention, the
genetic construct is administered to an individual using a
needleless injection device. According to some embodiments of the
present invention, the genetic construct is simultaneously
administered to an individual intradermally, subcutaneously and
intramuscularly using a needleless injection device. Administration
of genetic constructs using needleless injection devices is
disclosed in the art.
[0078] According to the present invention, DNA or RNA that encodes
a target protein is introduced into the cells of an individual
where it is expressed, thus producing the target protein. The DNA
or RNA is linked to regulatory elements necessary for expression in
the cells of the individual. Regulatory elements for DNA include a
promoter and a polyadenylation signal. In addition, other elements,
such as a Kozak region, may also be included in the genetic
construct.
[0079] The genetic construct of a genetic vaccine comprises a
nucleotide sequence that encodes a target protein operably linked
to regulatory elements needed for gene expression. Accordingly,
incorporation of the DNA or RNA molecule into a living cell results
in the expression of the DNA or RNA encoding the target protein and
thus, production of the target protein.
[0080] When taken up by a cell, the genetic construct which
includes the nucleotide sequence encoding the target protein
operably linked to the regulatory elements may remain present in
the cell as a functioning extrachromosomal molecule or it may
integrate into the cell's chromosomal DNA. DNA may be introduced
into cells where it remains as separate genetic material in the
form of a plasmid. Alternatively, linear DNA which can integrate
into the chromosome may be introduced into the cell. When
introducing DNA into the cell, reagents which promote DNA
integration into chromosomes may be added. DNA sequences which are
useful to promote integration may also be included in the DNA
molecule. Since integration into the chromosomal DNA necessarily
requires manipulation of the chromosome, it is preferred to
maintain the DNA construct as a replicating or non-replicating
extrachromosomal molecule. This reduces the risk of damaging the
cell by splicing into the chromosome without affecting the
effectiveness of the vaccine. Alternatively, RNA may be
administered to the cell. It is also contemplated to provide the
genetic construct as a linear minichromosome including a
centromere, telomeres and an origin of replication.
[0081] The necessary elements of a genetic construct of a genetic
vaccine include a nucleotide sequence that encodes a target protein
and the regulatory elements necessary for expression of that
sequence in the cells of the vaccinated individual. The regulatory
elements are operably linked to the DNA sequence that encodes the
target protein to enable expression.
[0082] The molecule that encodes a target protein is a
protein-encoding molecule which is translated into protein. Such
molecules include DNA or RNA which comprise a nucleotide sequence
that encodes the target protein. These molecules may be cDNA,
genomic DNA, synthesized DNA or a hybrid thereof or an RNA molecule
such as mRNA. Accordingly, as used herein, the terms "genetic
construct" and "nucleotide sequence" are meant to refer to both DNA
and RNA molecules.
[0083] The regulatory elements necessary for gene expression of a
DNA molecule include: a promoter, an initiation codon, a stop
codon, and a polyadenylation signal. In addition, enhancers are
often required for gene expression. It is necessary that these
elements be operable in the vaccinated individual. Moreover, it is
necessary that these elements be operably linked to the nucleotide
sequence that encodes the target protein such that the nucleotide
sequence can be expressed in the cells of a vaccinated individual
and thus the target protein can be produced.
[0084] Initiation codons and stop codon are generally considered to
be part of a nucleotide sequence that encodes the target protein.
However, it is necessary that these elements are functional in the
vaccinated individual.
[0085] Similarly, promoters and polyadenylation signals used must
be functional within the cells of the vaccinated individual.
[0086] In order to be a functional genetic construct, the
regulatory elements must be operably linked to the nucleotide
sequence that encodes the target protein. Accordingly, it is
necessary for the initiation and termination codons to be in frame
with the coding sequence.
[0087] In order to maximize protein production, regulatory
sequences may be selected which are well suited for gene expression
in the vaccinated cells. Moreover, codons may be selected which are
most efficiently transcribed in the vaccinated cell. One having
ordinary skill in the art can produce DNA constructs which are
functional in vaccinated cells.
[0088] In order to test expression, genetic constructs can be
tested for expression levels in vitro using tissue culture of cells
of the same type as those to be vaccinated. For example, if the
genetic vaccine is to be administered into human muscle cells,
muscle cells grown in culture such as solid muscle tumors cells of
rhabdomyosarcoma may be used as an in vitro model to measure
expression level.
[0089] According to the invention, the genetic vaccine may be
administered directly into the individual to be immunized or ex
vivo into removed cells of the individual which are reimplanted
after administration. By either route, the genetic material is
introduced into cells which are present in the body of the
individual. Routes of administration include, but are not limited
to, intramuscular, intraperitoneal, intradermal, subcutaneous,
intravenous, intraarterially, mtraoccularly and oral as well as
transdermally or by inhalation or suppository. Preferred routes of
administration include intramuscular, intraperitoneal, intradermal
and subcutaneous injection. Genetic constructs may be administered
by means including, but not limited to, traditional syringes,
needleless injection devices, or "microprojectile bombardment gene
guns". Alternatively, the genetic vaccine may be introduced by
various means into cells that are removed from the individual. Such
means include, for example, ex vivo transfection, electroporation,
microinjection and microprojectile bombardment. After the genetic
construct is taken up by the cells, they are reimplanted into the
individual. It is contemplated that otherwise non-immunogenic cells
that have genetic constructs incorporated therein can be implanted
into the individual even if the vaccinated cells were originally
taken from another individual.
[0090] The genetic vaccines according to the present invention
comprise about 1 nanogram to about 1000 micrograms of DNA. In some
preferred embodiments, the vaccines contain about 10 nanograms to
about 800 micrograms of DNA. In some preferred embodiments, the
vaccines contain about 0.1 to about 500 micrograms of DNA. In some
preferred embodiments, the vaccines contain about 1 to about 350
micrograms of DNA. In some preferred embodiments, the vaccines
contain about 25 to about 250 micrograms of DNA. In some preferred
embodiments, the vaccines contain about 100 micrograms DNA.
[0091] The genetic vaccines according to the present invention are
formulated according to the mode of administration to be used. One
having ordinary skill in the art can readily formulate a genetic
vaccine that comprises a genetic construct. In cases where
intramuscular injection is the chosen mode of administration, an
isotonic formulation is preferably used. Generally, additives for
isotonicity can include sodium chloride, dextrose, mannitol,
sorbitol and lactose. In some cases, isotonic solutions such as
phosphate buffered saline are preferred. Stabilizers include
gelatin and albumin. In some embodiments, a vasoconstriction agent
is added to the formulation. The pharmaceutical preparations
according to the present invention are provided sterile and pyrogen
free.
[0092] Genetic constructs may optionally be formulated with one or
more response enhancing agents such as: compounds which enhance
transfection, i.e., transfecting agents; compounds which stimulate
cell division, i.e., replication agents; compounds which stimulate
immune cell migration to the site of administration, i.e.,
inflammatory agents; compounds which enhance an immune response,
i.e., adjuvants or compounds having two or more of these
activities.
[0093] In a preferred embodiment, bupivacaine, a well-known and
commercially available pharmaceutical compound, is administered
prior to, simultaneously with or subsequent to the genetic
construct. Bupivacaine and the genetic construct may be formulated
in the same composition. Bupivacaine is particularly useful as a
cell stimulating agent in view of its many properties and
activities when administered to tissue. Bupivacaine promotes and
facilitates the uptake of genetic material by the cell. As such, it
is a transfecting agent. Administration of genetic constructs in
conjunction with bupivacaine facilitates entry of the genetic
constructs into cells. Bupivacaine is believed to disrupt or
otherwise render the cell membrane more permeable. Cell division
and replication is stimulated by bupivacaine. Accordingly,
bupivacaine acts as a replicating agent. Administration of
bupivacaine also irritates and damages the tissue. As such, it acts
as an inflammatory agent which elicits migration and chemotaxis of
immune cells to the site of administration. In addition to the
cells normally present at the site of administration, the cells of
the immune system which migrate to the site in response to the
inflammatory agent can come into contact with the administered
genetic material and the bupivacaine. Bupivacaine, acting as a
transfection agent, is available to promote uptake of genetic
material by such cells of the immune system as well.
[0094] Bupivacaine is related chemically and pharmacologically to
the aminoacyl local anesthetics. It is a homologue of mepivacaine
and related to lidocaine. Bupivacaine renders muscle tissue voltage
sensitive to sodium challenge and effects ion concentration within
the cells. A complete description of bupivacaine's pharmacological
activities can be found in Ritchie, J. M. and N. M. Greene, The
Pharmacological Basis of Therapeutics, Eds.: Gilman, A. G. et al,
8th Edition, Chapter 15:3111. Bupivacaine and compounds that
display a functional similarity to bupivacaine are preferred in the
method of the present invention.
[0095] Bupivacaine-HCl is chemically designated as
2-piperidinecarboxamide,
1-butyl-N-(2,6-dimethylphenyl)monohydrochloride, monohydrate and is
widely available commercially for pharmaceutical uses from many
sources including from Astra Pharmaceutical Products Inc.
(Westboro, Mass.) and Sanofi Winthrop Pharmaceuticals (New York,
N.Y.), Eastman Kodak (Rochester, N.Y.). Bupivacaine is commercially
formulated with and without methylparaben and with or without
epinephrine. Any such formulation may be used. It is commercially
available for pharmaceutical use in concentration of 0.25%, 0.5%
and 0.75% which may be used on the invention. Alternative
concentrations which elicit desirable effects may be prepared if
desired.
[0096] Other contemplated response enhancing agents which may
function transfecting agents and/or replicating agents and or
inflammatory agents and which may be co-adminstered with
bupivacaine and similar acting compounds include lectins, growth
factors, cytokines and lymphokines such as alpha-interferon,
gamma-interferon, platelet derived growth factor (PDGF), gCSF,
gMCSF, TNF, epidermal growth factor (EGF), IL-1, IL-2, IL-4, IL-6,
IL-8, IL-10 and IL-12 as well as collagenase, fibroblast growth
factor, estrogen, dexamethasone, saponins, surface active agents
such as immune-stimulating complexes (ISCOMS), Freund's incomplete
adjuvant, LPS analog including monophosphoryl Lipid A (MPL),
muramyl peptides, quinone analogs and vesicles such as squalene and
squalane, hyaluronic acid and hyaluronidase may also be used
administered in conjunction with the genetic construct. In some
embodiments, combinations of these agents are administered in
conjunction with bupivicaine and the genetic construct. For
example, bupivacaine and either hyaluronic acid or hyaluronidase
are co-administered with a genetic construct.
[0097] In some embodiments of the invention, the genetic construct
is injected with a needleless injection device. The needleless
injection devices are particularly useful for simultaneous
administration of the material intramuscularly, intradermally and
subcutaneously.
[0098] In some embodiments of the invention, the genetic construct
is administered with a response enhancing agent by means of a
microprojectile particle bombardment procedure as taught by Sanford
et al. in U.S. Pat. No. 4,945,050 issued Jul. 31, 1990.
[0099] In some embodiments of the invention, the genetic construct
is administered as part of a liposome complex with a response
enhancing agent.
[0100] In some embodiments of the invention, the individual is
subject to a single vaccination to produce a full, broad immune
response. In some embodiments of the invention, the individual is
subject to a series of vaccinations to produce a full, broad immune
response. According to some embodiments of the invention, at least
two and preferably four to five injections are given over a period
of time. The period of time between injections may include from 24
hours apart to two weeks or longer between injections, preferably
one week apart. Alternatively, at least two and up to four separate
injections are given simultaneously at different sites.
[0101] While this disclosure generally discusses immunization in
the context of prophylactic methods of protection, the term
"immunizing" is meant to refer to both prophylactic and therapeutic
methods. Thus, a method of immunizing includes both methods of
protecting an individual from dengue challenge as well as methods
of treating an individual suffering from dengue disease.
Accordingly, the present invention may be used as a vaccine for
prophylactic protection or in a therapeutic manner; that is, as
immunotherapeutic methods and preparations.
[0102] Other aspects of the invention include the use of genetic
constructs in methods of introducing therapeutic genes into cells
of an individual. Thus, one aspect of the present invention relates
to gene therapy; that is, to methods of introducing nucleic acid
molecules that encode therapeutic proteins into the cells of an
individual. The administration protocols and genetic constructs
useful in gene therapy applications are the same as those described
above for genetic immunization except the genetic constructs
include nucleotide sequences that encode proteins whose presence in
the individual will eliminate a deficiency in the individual and or
whose presence will provide a therapeutic effect on the
individual.
Construction of Dengue Replicons and Optional Encapsidation
[0103] Nucleotide sequences encoding the structural and
nonstructural proteins of all four dengue types have been reported.
Type I: Fu et al. 1992 Virology 188:953; Type II: Gualano et al.
1998 J Gen Virology 79:437; Type HI: Osatomi et al. 1990 Virology
176:643; Type IV: Zhao et al. 1986 Virology 155:77; Mackow et al.
1987 Virology 159:217.
[0104] Several dengue subgenomic replicons containing large
deletions in the structural region (C-prM-E) can be constructed.
Referring to FIG. 1, representative are .DELTA.E, .DELTA.ME, and
.DELTA.CME dengue replicons. The .DELTA.E replicon contains a
deletion of the sequence coding for Envelope (E) protein. The
.DELTA.ME replicon contains a deletion of the sequence coding for
pre-Membrane (prM) and Envelope (E) proteins. The .DELTA.CME
contains a deletion of the sequence coding for Core (C),
pre-Membrane (prM), and Envelope (E) proteins.
[0105] All deletion constructs may be prepared from cDNA clones
used in the construction of plasmid dengue for generation of
infectious dengue RNA by PCR-directed technology, using appropriate
primers and conventional cloning. .DELTA.C, .DELTA.ME, and
.DELTA.CME, and derivatives, are prepared to comprise (open
language) or consist of (closed language) the following: part or
all of the 5'UTR; at least about the first 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,
43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59,
60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76,
77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93,
94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107,
108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120,
121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133,
134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146,
147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159,
160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172,
173, 174, or 175 nucleotides of C protein; at least about the last
1, 2, 3, 4, 5, 6, 7, 8, 9. 10, 11, 12, 13, 14, 15, 16, 17, 18. 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53,
54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70,
71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87,
88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103,
104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116,
117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129,
130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142,
143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155,
156, 157, 158, 159. 160, 161, 162, 163, 164, 165, 166, 167, 168,
169, 170, 171, 172, 173, 174, or 175 nucleotides of E protein;
substantially all of the nonstructural region; and part or all of
the 3'UTR.
[0106] Evidence of replication of these RNAs after introduction
into host cells is sought by immunofluorescence analysis of cells
with antibodies to dengue proteins or by radioimmunoprecipitation
analysis of lysates with antibodies to dengue proteins. No apparent
cytopathic effect is observed in the great majority of the antibody
positive cells at any time posttransfection. Reverse transcription
PCR and Northern blot analysis confirm accumulation of
dengue-specific RNA in cells transfected with .DELTA.C, .DELTA.ME,
and .DELTA.CME, and derivatives.
[0107] A minimal sequence in core protein, or envelope protein,
required for RNA replication is defined. Replicon constructs
containing sequences coding for only the first amino acids of core
protein, or only the last amino acids of envelope protein, are
prepared. Deletions in the C coding sequence, or E coding sequence,
are monitored for translation efficiency and replication activity.
Translation efficiency may be unaffected. Replication activity is
compared. Immunofluorescence results and Northern blot analysis may
identify the minimal sequence required for RNA replication.
[0108] The effect of deletions in the 5'UTR and 3'UTR on RNA
replication is determined. Replicon constructs with deletions in
the 5'UTR or 3'UTR are prepared. Immunofluorescence results and
Northern blot analysis may identify the 5 'UTR and 3 'UTR
sequence(s) that may be removed without deleterious effect on RNA
replication
[0109] Multi-cistronic dengue replicon RNAs expressing heterologous
genes are prepared. As a first step, an expression cassette is
prepared for insertion into the 3'UTR, the 5'UTR, in place of a
structural gene, or other. Initially, the IRES from EMCV is linked
to a reporter gene to create an IRES-reporter gene cassette. The
IRES from EMCV ensures cap-independent internal initiation of
translation of the reporter gene to which it is linked. For
example, an IRES-CAT gene cassette is cloned. The expression
cassette is inserted in the plus orientation. Synthesis of plus
strands of replicon RNA during replication is monitored via
expression of the CAT gene.
[0110] To select for cells persistently expressing dengue
replicons, the CAT gene is replaced by the Neo gene. The low
percentage of replicon-expressing cells is strikingly enriched by
selection during growth in the presence of the antibiotic G418. No
apparent changes in the morphology of surviving positive cells is
observed.
[0111] Dengue virus replicon RNA is encapsidated by a procedure
involving two simultaneous or consecutive introductions into host
cells, first with dengue virus replicon .DELTA.C, .DELTA.ME, or
.DELTA.CME RNA, and about 24 hours later with a recombinant Semliki
Forest virus (SFV) replicon RNA(s) expressing dengue virus
structural proteins. The presence of dengue virus replicon RNA in
encapsidated particles is demonstrated by its amplification and
expression in host cells, detected by Northern blotting with
dengue-specific probes and by immunofluorescence analysis with
antibodies to dengue proteins. Infectious particles are pelleted by
ultracentrifugation of the culture fluid from cells into which are
introduced dengue virus replicon .DELTA.C, .DELTA.ME, or .DELTA.CME
RNA, and recombinant Semliki Forest virus (SFV) replicon RNA(s)
expressing dengue virus structural proteins. The particles are
neutralized by preincubation with antibodies to dengue E protein.
Radioimmunoprecipitation analysis with anti-E antibodies of the
culture fluid of the doubly transfected cells shows the presence of
C, preM, and E proteins in the immunoprecipitated particles.
Reverse transcription PCR shows that the immunoprecipitated
particles also contain dengue specific RNA. The encapsidated
replicon particles sediment about the same as dengue virions in a 5
to 25% sucrose density gradient and are uniformly spherical, with a
diameter that compares favorably with an approximately 50 nm
diameter for dengue virions.
Example 1
[0112] As part of a program to develop a dengue virus vaccine which
avoids the deleterious effects of antibody dependent enhancement
(ADE) of infection mediated by antibodies to dengue virus
structural proteins, we investigated the possibility of designing
dengue vaccines based on non-structural proteins.
[0113] Our results indicate that dengue constructs which lack major
structural proteins replicate intracellularly in tissue culture.
These replicons are capable of prolonged expression of dengue virus
non-structural proteins for at least seven days in culture.
[0114] Our conclusions indicate that dengue virus genomes lacking
major structural proteins can, like other flaviviruses, replicate
intracellularly and express virus non-structural proteins with
minimal toxicity to host cells. These findings pave the way for the
development of dengue virus replicons as a form of live, attenuated
virus vaccine.
Development of Dengue Virus Type 2 Replicons Capable of Prolonged
Expression in Host Cells
[0115] Immunofluorescent analysis of cell cultures 48 hrs post
transfection demonstrates efficient expression of dengue virus
proteins from wild type dengue virus as well as from both the
.DELTA.prM-E and .DELTA.C-prM-E mutants (see FIG. 2 and FIGS. 3A,
3B and 3C). By this time point, the wild type virus has had a
limited opportunity to be transmitted in secondary rounds of
infection. Interestingly, pairs of fluorescent cells were often
seen, suggesting cells continued to replicate after being
successfully transfected by replication competent dengue replicons.
This is particularly evident in FIGS. 3B and 3C.
[0116] By 8 days post transfection, wild type dengue virus
expression is more widespread throughout the culture than it was 48
hrs post transfection, presumably because it was able to undergo
multiple rounds of replication and transmission (FIG. 3D). Cell
cultures transfected with .DELTA.prM-E (FIG. 3E) or .DELTA.C-prM-E
(FIG. 3F) still have cells efficiently expressing dengue proteins
at 8 days, but they are more rare than they were at 48 hrs post
transfection. This is consistent with the inability of these
mutants to make infectious virions and suggests that the viral
proteins remaining in the dengue replicons may moderately retard
cell growth and replication. However, in the experiments presented
herein, cells were trypsinized and replated on day 7 post
transfection, so they may not have had sufficient time to recover
and replicate prior to harvest for immunofluorescence on day 8.
[0117] No fluorescent cells were ever seen at either 48 hrs or 8
days post transfection with dengue deletion mutant .DELTA.E, from
which most of the E gene has been deleted. However, negative
results are hard to interpret in this system.
[0118] The prolonged expression of dengue virus proteins by the
.DELTA.prM-E and .DELTA.C-prM-E replicons presumably is dependent
on the ability of these sub-genomic fragments to replicate.
Consistent with this presumption, .DELTA.prM-E RNA was seen to
sequentially increase in cultures over at least the first 48 hrs
post transfection (FIG. 4), whereas no dengue virus RNA was seen
over this time period after transfection with .DELTA.E RNA. RNA
from both of these constructs is undetectable at 6 hrs post
transfection, suggesting that most of the transfecting RNA is
rapidly degraded.
[0119] When the .DELTA.-prM-E replicon is placed under the control
of a cytomegalovirus (CMVB) promoter, it is still capable of active
dengue virus protein expression when transfected into cells in the
form of plasmid DNA (see FIG. 5).
[0120] The expression of dengue virus RNA and proteins in cultures
transfected with the .DELTA.-prM-E and .DELTA.C-prM-E mutants is
consistent with replication of the viral sub-genomes in these host
cells. This is consistent with similar replicons constructed from
Kunjin virus (Khromykn, A. A. and Westaway, E. D. 1997 J Virol
71:1497-1505). Most encouraging, however, is the finding of viral
protein expression at long time points (8 days) subsequent to
transfection with the .DELTA.prM-E and .DELTA.C-prM-E replicons in
the absence of selection. Previous experiments with other
flavivirus replicons have demonstrated expression for as long as 41
days post transfection (Khromykn, A. A. and Westaway, E. D. 1997 J
Virol 71:1497-1505), but these replicons expressed neomycin and
were grown under selective pressure. The longest, previously
reported time for pure replicon expression in the absence of
selection was just 72 hours (Khromykn, A. A. and Westaway, E. D.
1997 J Virol 71:1497-1505). We have not yet searched for continued
expression beyond 8 days post transfection, but we have no reason
to believe that is not readily achievable.
[0121] In order for the dengue replicons reported herein to be of
immunologic value, they need to be expressible in a convenient form
and (we anticipate) they need to produce NS1 protein. Formally, the
data presented herein do not directly prove NS1 production, because
the antisera used detect multiple viral structural and
nonstructural proteins. Attempts to visulize dengue replicon
protein synthesis by Western blotting were unsuccessful in our
hands, presumably because of the comparatively low transfection
efficiencies achieved. However, the previously demonstrated
dependence of dengue virus replication on NS1 production
(Lindenbach, B. D. and Rice, C M. 1997 J Virol 71:9608-9617) and
the fact that dengue virus RNA levels increase with time after
transfection in the cultures used herein (implying active dengue
RNA replication) together strongly imply the production of
significant quantities of NS1 protein by these replicons. As for a
suitable form of delivery, the ability of pDNA-.DELTA.prM-E to make
high levels of dengue proteins after transfection into cells in the
form of DNA suggests the possibility of using DNA transfection to
achieve immunization (Beard, C et al. 1999 J Biot 73:243-249).
[0122] In conclusion, we have demonstrated the prolonged expression
of dengue virus proteins from sub-genomic dengue RNA fragments,
lacking major structural genes, transfected into tissue culture
cells. This prolonged expression is associated with detectable
increases in dengue RNA in the transfected tissue cultures,
implying that the sub-genomic fragments are replicating, and
implying the synthesis of NS1 protein and other viral
non-structural proteins known to be required for viral genomic
replication. The ability to express these sub-genomic dengue
replicons from transfected DNA offers the possibility of using
DNA-based, dengue replicon vaccines. Other delivery methods are
contemplated, including the development of packaging cell
lines.
Culturing of Dengue Virus
[0123] Dengue virus strains DEN1/WP and DEN2/NGC, kindly provided
by Dr. Lewis Markoff (Polo, S. et al. 1997 J Virol 71:536-674; Pur,
B. et al. 2000 Virus Genes 20:57-63), were passaged in monkey
LLC-MK2 cells at 37.degree. C. in a humidified incubator under 5%
CO.sub.2, using Medium 199 plus 10% fetal bovine serum (FBS) and 50
.mu.g of Gentamicin per ml. The cells were trypsinized a day before
virus infection and plated to reach approximately 80% confluence on
the day of infection. Infections were typically at an MOI of 0.01
PFU/cell in Medium 199 plus 2% FBS.
In Vitro Mutagenesis
[0124] DNA fragments used for spanning the desired deletions (see
FIG. 2) were synthesized by polymerase chain reaction (PCR) from
two short overlapping primers. For the .DELTA.CME replicon, the 5'
primer was 5'ATCATTATGCTGATTCCAACAGTGATGGCG
TTCCATTTAACCACACGTAACAGCACCTCACTGTCTGTG3' (SEQ ID NO:23). For the
.DELTA.prME replicon, the 5' primer was
5'ACAGCTGTCGCTCCTTCAATGACAATGC
GTTGCATAGGAATATCAAATAGAAGCACCTCACTGTCTGTG3' (SEQ ID NO: 24). For
both mutants, the 3' primer was 5'ATACAGCGTCACGACTCCCACCAATACTAGTGA
CACAGACAGTGAGGTGCT3' (SEQ ID NO: 25).
[0125] PDNA-.DELTA.prM-E was constructed by placing the
.DELTA.prM-E replicon RNA under the transcriptional control of a
CMV promoter and placing it upstream of a Hepatitis Delta Virus
(HDV) self cleaving ribozyme.
[0126] Dengue-2 virus cDNA cloned in the yeast shuttle vector
pBR424, linearized by excision of a short BamHl fragment was
transfected into competent (Spencer, F. et al. 1993 Methods
Companion Methods Enzymol 5:161-175) S. cerevisiae YPH857, kindly
provided by Barry Falgout (CBER/FDA), along with the appropriate
PCR fragment spanning the desired deletion. Yeast colonies which
grew on tryptophan minus plates represented vectors which had
recircularized by homologous recombination with these PCR fragments
(Spencer, F. et al. 1993 Methods Companion Methods Enzymol
5:161-175). DNA from these colonies was transformed into E. coli
Stbl 2 cells (Life Technologies, Inc.) to make sufficient
quantities of dengue recombinant, genomic-length DNAs for
characterization and analysis.
Expression of Virus and Replicons in Cells
[0127] The full length virus and replicon cDNA plasmids isolated
from Stbl 2 cells were linearized with SacI, purified by Qiagen
chromatography, and eluted by RNase-free water in preparation for
transcription. The transcription reaction mixtures contained 1
.mu.g of linearized DNA; 0.5 mM (each) ATP, CTP, and UTP; 0.1 mM
GTP; 0.5 mM cap analog (NEBL); 10 mM DTT; 40 U of RNasin (Promega);
30 U of SP6 RNA polymerase; and 1.times.SP6 RNA polymerase buffer
(Promega) in a volume of 30 .mu.l. The reaction mixtures were
incubated at 40.degree. C. for 2 hrs. Aliquots (12.5 .mu.l) of the
reaction mixtures, containing full length viral RNA, were used to
transfect approximately 2.times.10.sup.6 monkey LLC-MK2 cells in
phosphate-buffered saline (PBS) by electroporation in a 0.4 cm gap
electroporation cuvette. Each cuvette was pulsed at 200 V, 950
.mu.F using a BioRad Genepuls electroporator. The cells were then
resuspended in growth medium and plated on the appropriate tissue
culture dish. Plasmid DNA-.DELTA.prM-E was transfected into cells
by electroporation using identical conditions.
[0128] After electroporation, cells were either plated directly on
multiwell plates for harvest at short time periods (typically 48
hrs or less) or on tissue culture dishes for trypsinization and
seeding onto multiwell plates on the day before final harvest for
longer time periods (typically 8 days post transfection).
Immuno-Histochemical Methods
[0129] Cells growing on chamber slides were rinsed in
room-temperature PBS and then fixed in cold acetone for 10 min at
-20.degree. C. After being air dried, each chamber was covered with
50 .mu.l of a 1:50 dilution of DEN2-specific hyperimmune mouse
ascitic fluid (HMAF, American Type Culture Collection) in PBS plus
2% normal goat serum. Samples were incubated at room temperature
for 1 h in a humidified atmosphere and then rinsed twice in PBS.
Samples were similarly incubated with a 1:100 dilution of
fluorescein isothiocyanate-labeled goat anti-mouse antibodies (Life
Technologies) and rinsed twice in PBS. Cells in some experiments
were counterstained with 0.02% Evans Blue.
Example 2
[0130] Despite tremendous progress in developing anti-retroviral
drugs to combat HIV, there remains a need for an effective HIV
vaccine. This need is particularly pressing in third world
countries, where demographics and economics make drug therapy
difficult to deliver. Although HIV infection elicits neutralizing
antibodies and a cellular immune response against the virus
(reviewed in Nathanson, N. and Matieson, B J. 2000 J Infect Dis
182:579-589; and Cho, M. W. 2000 Adv Pharmacol 49:263-314) and
there exist "exposed uninfected" (EU) individuals that appear to
have acquired resistance to infection by HIV (Clerici, M. et al.
1992 J Infect Dis 165:1012-1019; Kaul, R. et al. In: Program and
abstracts of the 7th Conference on Retro viruses and Opportunistic
Infections (San Francisco) San Francisco: Foundation for
Retrovirology and Human Health, 2000, 168), the hallmark of HIV
infection is the almost universal inability of humans to mount an
immune response that can prevent the eventual development of
AIDS.
[0131] An effective vaccine will require not only the design of
effective immunogens, but also the design of optimized protocols of
immunogen delivery. As a live, attenuated vaccine for HIV is
considered difficult to test and dangerous to implement (Nathanson,
N. and Mathieson, B. 2000 J Infect Dis 182:579-589; Cho, M. W. 2000
Adv Pharmacol 49:263-314; Baba, T. W. et al. 1999 Nat Med
5:194-203; Baba, T. W. et al. 1995 Science 267:1820-1825; Bogers,
W. M. et al. 1995 AIDS 9:F13-F18; Greenough, T. C. et al. 1999 N
Engl J Med 340:236-237; Berkhout, B. et al. 1999 J Virol
73:1138-1145), various alternatives to HIV could be considered as
potential "live" vectors for HIV immunogens, including enteric
bacteria, poxviruses (vaccinia and canarypox), small RNA viruses
(e.g. poliovirus and Semliki Forest virus), Rhabdoviruses (e.g.
vesicular stomatitis virus), DNA viruses (e.g. adenovirus and
adeno-associated viruses) and even naked DNA to achieve expression
in living host cells (Cho, M. W. 2000 Adv Pharmacol 49:263-314;
Rose, N. F. et al. 2001 Cell 106:539-549).
[0132] Dengue possesses several advantages which favor its choice
as a vector for HIV immunogens. As a flavivirus, it replicates
entirely in the cytoplasm through RNA directed RNA polymerization
and is incapable of integrating into the host genome. Flavivirus
replicons can replicate inside cells and achieve prolonged
expression of high levels of virally encoded proteins with minimal
toxicity (Khromykn, A. A. and Westaway, E. D. 1997 J Virol
71(2):1497-1505) and are unable to recombine or mutate to produce
infectious HIV particles. Finally, by eliciting an immune reaction
against the dengue non-structural proteins remaining in replicons,
dengue virus replicons may induce a protective immunity against
dengue which would not predispose vaccinated individuals to DHF.
Properly administered, dengue virus replicons expressing HIV
epitopes might thus serve as dual vaccines, conferring protection
against dengue virus as well as HIV.
[0133] The challenges in developing a safe and effective HIV
vaccine are many and varied. Choice of immunogen is clearly
problematic. Critical epitopes may be masked by glycosyl groups
and/or tertiary structure (Reitter, J. et al. 1998 Nat Med
4:679-684; Chan, D. C and Kim, P. S. 1998 Cell 93:681-684; LaCasse,
R. A. et al. 1999 Science 283:357-362) and (Cooney, E. L. et al.
1991 Lancet 337:567-572). The extensive genetic variability of HIV
complicates immunogen choice and the high rate of mutation
increases the likelihood of the rapid development of resistance.
Furthermore, the method of immunogen delivery (e.g. purified
subunits or inactivated virus vs. various forms of "live"
expression) can determine the relative nature and extent of humoral
and cell mediated immunologic responses. Priming with various types
of "live" expression followed by boosting with purified subunits is
currently favored as a method to obtain stronger immunologic
responses than either method alone (reviewed in Nathanson, N. and
Mathieson, B J. 2000 J Infect Dis 182:579-589; and Cho, M. W. 2000
Adv Pharmacol 49:263-314). Previously acquired immunity to a viral
vector such as vaccinia may influence its efficacy in inducing
immunity against heterologous proteins being delivered (Cooney, E.
L. et al. 1991 Lancet 337:567-572; Cooney, E. L. et al. 1993 PNAS
USA 90:1882-1886; Graham, B. S. et al. 1992 J Infect Dis
166:244-52; McElrath, M J. et al. 1994 J Infect Dis 169:41-47) and
it may be wise to provide physicians with HIV vaccines based on a
variety of vectors to handle a variety of clinical situations.
[0134] The use of live dengue as a vaccine or as a vector for
heterologous immunogens has historically been considered
problematic because of the pathologies associated with dengue
infection. Although dengue fever (DF) is usually self limited,
dengue hemorrhagic fever (DHF) is considerably debilitating and
frequently fatal (Monath, T. P. 1994 PNAS USA 91:2395-2400).
However, DHF is unlikely to result from or be promoted by the
vectors reported herein. The enhanced replication of virus seen in
dengue hemorrhagic fever is generally seen upon reinfection by
dengue virus of a serotype different from previous infections and
is believed to be mediated by antibodies against viral structural
proteins: so called antibody dependent enhancement of infection, or
ADE. These cross reacting antibodies actually promote viral uptake
by macrophages (Morens, D. M. 1994 Clin Infect Dis 19:500-512;
Halstead, S. B. 1988 Science 239:476-481). The main challenge in
using live dengue in humans is thus avoiding the development of
antibody dependent enhancement (ADE) of infection by antibodies
against the pre-M and E proteins of one dengue strain which weakly
cross react with the pre-M and E of a second infecting dengue
strain. Since the replicons reported herein lack the major viral
structural protein genes, they are not only incapable of sustaining
a spreading infection but also are incapable of eliciting
antibodies against the missing structural proteins. They should
neither induce DF nor promote DHF.
[0135] Dengue virus has a typical flavivirus genome structure, as
described in FIG. 6. The structural proteins, C, pre-M (M) and E,
are involved in packaging, export and subsequent entry. The
non-structural proteins, NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5
include an RNA-directed RNA polymerase and a protease function
involved in cleaving certain positions of the long viral
polyprotein which contains all the viral genes (Chambers, T J. et
al. 1990 Ann Rev Microbiol 44:649-88; Rice, C M In: Fields
Virology, 3rd ed. Philadelphia, Pa. Lippincott-Raven Publishers,
1996 p. 931-996). The four serotypes of dengue virus ("1" through
"4") share approximately 60%-74% amino acid residue identity with
one another in the E gene (Thomas, C J. et al. 1990 Annu Rev
Microbiol 44:649-88) and induce cross-reacting antibodies (Heinz,
F. X. 1986 Adv Virus Res 31:103-168).
[0136] Two strategies suggest themselves for circumventing the
problem of ADE from dengue vaccination. One strategy is to immunize
with multiple strains of dengue virus to elicit high affinity,
neutralizing antibodies against the multiple dengue serotypes. At
least one vaccine to do this (using dengue vaccine candidates,
DEN-1 PDK13, DEN-2 PDK53, DEN-3 PGMK 30/F3, and DEN-4 PDK48) has
been in clinical trials (Bhamarapravati, N. and Sutee, Y. 2000
Vaccine 18 Suppl 2:44-47; Kanesa-thasan, N. et al. 2001 Vaccine
19:3179-3188). A second strategy is to induce immunity only to
viral proteins other than pre-M and E. Several studies have shown
that the nonstructural glycoprotein NS1 can play an important role
in protection against dengue. Mice immunized with purified dengue-2
NS1 protein injected intramuscularly and boosted after 3 days and
two weeks were protected from developing lethal dengue encephalitis
upon subsequent challenge with dengue-2 virus (Schlesinger, J J. et
al. 1987 J Gen Virol 68:853-857). Similarly, mice immunized with
recombinant vaccinia virus expressing authentic NS1 (Falgout, B. et
al. 1990 J Virol 64:4356-4363) were protected against the
development of dengue-4 virus encephalitis when challenged by
intracerebral injection. Inoculation of mice with specific
combinations of monoclonal antibodies (Mabs) directed against
dengue-2 NS1 (Henchal, E. A. et al. 1988 J Gen Virol 69:2101-2107)
also protects against lethal virus encephalitis upon intracerebral
dengue-2 challenge. Other nonstructural proteins are also
immunogenic and may participate in eliciting protection (Brinton,
M. A. et al. 1998 Clin Diagn Virol 10:129-39).
[0137] Herein we have reported the successful construction of
several dengue virus replicons which replicate intracellularly
without the pre-M and E proteins required to form infectious
virions, including replicons which can be expressed from
transfected DNA. Towards the goal of devising a "live" dual vaccine
based on only non-structural dengue proteins and heterologous HIV
material, we report herein that these replicons can be harnessed to
express heterologous genes, including HIV gpl60 and gpl20. Upon
introduction into a host's cells, these sub-genomic fragments
should replicate intracellularly and support prolonged expression
of dengue and heterologous immunogens without producing the deleted
dengue structural proteins and without forming infectious
virions.
Development of Dengue Virus Replicons Expressing HIV-1 Gpl20 and
Other Heterologous Genes: A Tool for Dual Vaccination against
Dengue Virus and HIV (Preface)
[0138] Toward the goals of providing an additional vector to add to
the armamentarium available to HIV vaccinologists and of creating a
bivalent vaccine effective against dengue virus and HIV, we have
attempted to create vectors which express dengue virus
non-structural proteins and HIV immunogens. Herein we have reported
the successful construction of dengue virus replicons which lack
structural genes necessary for virion release and spreading
infection in culture but which can replicate intracellularly and
abundantly produce dengue non-structural proteins. Herein we have
now expressed heterologous genetic material from these
replicons.
[0139] We cloned into a .DELTA.pre-M/E dengue virus replicon genes
for either green fluorescent protein (GFP), HIV gpl60 or HIV gpl20
and tested the ability of these constructs to express dengue virus
proteins as well as the heterologous proteins in tissue culture
after transfection of replicon RNA.
[0140] Our conclusions indicate that heterologous proteins were
readily expressed from these constructs. GFP and gpl20 demonstrated
minimal or no toxicity. Gp160 expressing replicons were found to
express proteins abundantly at 36 hours post transfection, but
after 50 hrs of transfection, few replicon positive cells could be
found despite the presence of cellular debris positive for replicon
proteins. This suggested that gpl60 expressed from dengue virus
replicons is considerably more toxic than either GFP or gpl20. The
successful expression of heterologous proteins, including HIV gpl20
for long periods in culture indicates this vector system should be
useful as a vaccine vector, given appropriate delivery methods.
Development of Dengue Virus Replicons Expressing HIV-1 Gpl20 and
Other Heterologous Genes: A Tool for Dual Vaccination Against
Dengue Virus and HIV
[0141] In various previous attempts to express heterologous genes
in full length, wild type dengue virus, we experienced a very poor
success rate, despite attempts to clone heterologous material into
various positions of the genome. Our first efforts to determine
whether or not heterologous material could be readily expressed in
dengue replicons was to clone the comparatively tractable green
fluorescent protein (GFP) into the .DELTA.pre-M/E replicon, into
the position from which the pre-M and E genes had been deleted
(FIG. 6). GFP was readily visualized in cultures 48 hours post
transfection with .DELTA.pre-M/E-GFP, as seen in FIG. 7.
[0142] Encouraged by the success with GFP, we next looked at
.DELTA.pre-M/E replicons with HIV-1 env material cloned into the
position of the deleted pre-M and E genes. We analyzed two clones,
.DELTA.pre-M/E-gpl20 and .DELTA.pre-M E-g 160, expressing HIV-1
gpl20 and gpl60 respectively (FIG. 6). Expression of genes in the
.DELTA.pre-M/E-g 120 replicon was reproducibly visualized at 48-50
hours post transfection (FIGS. 8 and 9), at a level of
approximately 1% of the cells, but in many experiments, the
corresponding cultures transfected with the gpl60 replicon,
.DELTA.pre-M/E-gp160, either no fluorescence could be visualized,
or only fluorescent cells with a bizarre morphology (characterized
by debris and/or degenerative appearance) could be visualized (FIG.
10). However, when we harvested cultures earlier, at 36 hours post
transfection with .DELTA.pre-M/E-gpl60, intact, fluorescing cells
were readily found, though the morphology still appeared atypical
compared to either that of cultures transfected with wild type
dengue virus and dengue replicons or the .DELTA.pre-M/E-gpl20
replicon (see FIG. 11).
[0143] To serve as effective vaccines, it is preferable, if not
necessary, that expression systems be capable of expressing
immunogens for longer than a couple of days. Although we knew from
previous experiments that dengue replicons could survive for at
least 7 days in culture, the limited durability of cells
transfected with gpl60-expressing replicons raised the question of
whether or not cells transfected with .DELTA.pre-M/E-gpl20
replicons could survive for similarly long times in culture. When
cultures transfected with .DELTA.pre-M/E-gpl20 were trypsinized and
replated on day 7 post transfection and then analyzed on day 9 post
transfection, fluorescent cells were readily visualized (FIG. 12).
In comparison to cultures that were not trypsinized on day 7 post
transfection however, these cultures had fewer intact fluorescent
cells and more debris. Although this suggests that gpl20 expression
from a dengue replicon stresses cells, we did find fields with
adjacent, gpl20 positive cells, suggesting that at least one cell
division between day 7 and day 9 had occurred in a cell
successfully transfected with .DELTA.pre-M/E-gpl20 (FIG. VII, right
panel). At 9 days of culture post transfection with
.DELTA.pre-M/E-gpl20, only about 0.1% of the cells or less were
positive, which represents a considerable decrease from 48 hours
post transfection.
[0144] In the experiments described above and in FIGS. 8 through
12, expression of dengue replicons with heterologous material from
HIV was followed either using anti-HIV sera or anti-dengue sera,
depending on the experiment. To demonstrate that the same cells
were expressing both dengue proteins and HIV proteins, we used a
double label technique, with FITC detecting HIV proteins and
rhodamine detecting dengue proteins. FIG. 13 demonstrates the
concordance of dengue virus protein and gpl20 expression in
cultures 4 days post transfection with .DELTA.pre-M/E-gpl20 (FIG.
13). The more extensive background of auto fluorescence encountered
when visualizing the rhodamine fluorescence makes low levels of
specific rhodamine fluorescence more difficult to discern, but
clearly all intact cells positive for HIV are also positive for
dengue proteins. The rhodamine-positive spot in the lower left of
the panel is cellular debris and is also positive for dengue
proteins, but the FITC fluorescence was not well reproduced by
digital photography, though it still may be visualized on certain
monitor/computer combinations. Similar results were obtained at 7
days post transfection (FIG. 14).
[0145] Our finding that dengue virus replicons can express
heterologous genes, including HIN envelope, for prolonged periods
of time in cell culture without selection represents a significant
step in developing a new vector system potentially capable of
delivering immunogens to any host in whose cells the dengue
replicons can replicate. Flavivirus replicons have previously been
demonstrated to express heterologous genes for up to 41 days in
tissue culture in Kunjin (Khromykn, A. A. and Westaway, E. D. 1997
J Virol 71:1497-1505). However, these experiments were done in the
presence of selection for the heterologous genes cloned into the
replicons. We have demonstrated heterologous gene expression in the
absence of selection for up to at least 9 days post transfection
with chimeric dengue replicons. Although we have formally
demonstrated expression, not replication, our previous
demonstration of the replication of dengue replicons lacking
heterologous material suggests that the replicons described herein,
which contain heterologous material, are indeed replicating.
Evidence that cells continue to replicate and express replicon
proteins in both daughter cells after transfection with these
chimeric replicons further supports the implication of chimeric
replicon replication. Ideally, to serve as dual vaccines against
dengue as well as against other pathogens, the replicons should
express the dengue NS1 protein (Schlesinger, J J. et al. 1987 J Gen
Virol 68:853-857; Falgout, B. et al. 1990 J Virol 64:4356-4363;
Henchal, E. A. et al. 1988 J Gen Virol 69:2101-2107; Brinton, M. A.
et al. 1998 Clin Diagn Virol 10:129-39). So far, attempts to
visualize NS1 production by Western blots have failed, presumably
because of the low transfection efficiencies. However, we have
previously argued that the replication of dengue replicons could
not take place in the absence of the essential non-structural gene,
NS1, which implies that NS1 is being made. The frequencies and
fluorescence intensities of replicon positive cells seen in the
experiments reported herein are comparable to those seen for dengue
replicons lacking heterologous material, suggesting that
replication of the .DELTA.pre-M/E replicons containing heterologous
material is occurring as well. The finding of at least one closely
apposed pair of cells expressing high levels of replicon proteins
on day 9 post transfection, two days after trypsinization and
replating (FIG. 12, right panel), not only implies replicon
replication, but also implies the expression of NS-1 protein as
well. We contemplate the definitive demonstration of effective NS-1
production upon studies of the immune response in animals immunized
with these replicons.
[0146] Choice of immunogen remains problematic for these vectors.
Clearly, HIV-1 gp 160 is too toxic for prolonged expression. Even
the gpl20-expressing replicon seems mildly toxic in that the
frequency of gpl20 positive cells declines with time in culture
post transfection with .DELTA.pre-M E-gpl20. However, as noted
above, we have seen at least one instance of putative cellular
division at least 7 days after being successfully transfected by
.DELTA.pre-M/E-gpl20 (FIG. 12, right panel). Experiments are
contemplated to determine the feasibility of long term expression
of other HIV-1 immunogens, including gag and tat.
[0147] In conclusion, demonstration of long term protein expression
by a gp 120-expressing replicon alone, of course, does not
demonstrate that the chimeric dengue replicons constitute an
effective vaccine. However, at the very least they add to the
potential armamentarium available to the vaccinologist. It is
highly likely that a successful HIV vaccination protocol will
involve multiple immunogens and delivery protocols. For instance,
mice immunized with attenuated Friend leukemia virus (FLV) develop
an immune response whose efficacy is dependent on the additive
effects of at least three separable spleen cell populations
(Dittmer, U. et al. 1999 J Virol 73:3753-3757). By analogy, it may
be necessary to devise multiple strategies to obtain a similarly
complex and effective immune response in humans against HIV. In
animal models of HIV, different immunogens and modes of
immunization can induce different modes of protection with varying
degrees of effectiveness (Heeney, J. et al. 1999 Immunol Lett
66:189-95; Hirsch, N. et al. 1996 J Virol 70:3741-3752;
Quesada-Rolander, M. et al. 1996 AIDS Res Hum Retroviruses
12:993-999; Letvin, N. L. et al 1997 PNAS USA 94:9378-383; Miller,
C. J. et al. 1997 J Virol 71:1911-1921; Shibata, R. et al. 1997 J
Virol 71:8141-8148; Gundlach, B. et al. 1998 J Virol 72:7846-7851).
Harnessing multiple immune responses may be the answer to designing
an effective HIV vaccine (Nathanson, N. and Mathieson, B J. 2000 J
Infect Dis 182:579-589) and the availability of multiple vectors
should facilitate the harnessing of multiple responses.
Culturing of Dengue Virus
[0148] Dengue virus strains DEN1/WP and DEN2/NGC, kindly provided
by Dr. Lewis Markoff, (Polo, S. et al. 1997 J Virol 71:5366-5374;
Pur, B. et al. 2000 Virus Genes 20:57-63) were passaged in monkey
LLC-MK2 cells at 37.degree. C. in a humidified incubator under 5%
CO.sub.2, using Medium 199 plus 10% fetal bovine serum (FBS) and 50
.mu.g of Gentamicin per ml. The cells were trypsinized a day before
virus infection and plated to reach approximately 80% confluence on
the day of infection. Infections were typically at an MOI of 0.01
PFU/cell in Medium 199 plus 2% FBS.
In Vitro Mutagenesis
[0149] Heterologous genes were cloned into the previously described
.DELTA.pre-M/E replicon, into the position previously occupied by
the pre-M/E genes. DNA fragments used for desired regions of
heterologous genes (see FIG. 6) were synthesized by polymerase
chain reaction (PCR) from short overlapping primers. For the Green
Fluorescent Protein (GFP) gene, the 5' primer was
5'CGAAAAAAGGCGAGAAATACGCCTTTCAATATGCTGAAACGCGA
GAGAATGGTGAGCAAGGGCGAGGAGCTG3' (SEQ ID NO: 26) and the 3' primer
was 5AAGGTCAAAATTCAACAGCTGCTTGTACAGCTCGTCCATGCC3' (SEQ ID NO: 27).
For HIV-1 gpl20 gene, the 5' primer was
5'ATCATTATGCTGAATCCAACAGTGATGGCG
TTCCATTTACCACACGTAACATGAGAGTGATGGGGATCAGGAAG3' (SEQ ID NO: 28) and
the 3' primer was 5'AAGGTCAAAATTCAACAGCTGGGTGGGTGCTAATCC
TAATGGTTC3' (SEQ ID NO: 29). GFP and HIV-1 gpl20 were fused with
FMDV/2A self cleaving protein sequence to replace natural cleavage
sites in the dengue polyprotein. These sites seem to loose their
activity when juxtaposed with heterologous material. PCR was used
to amplify DNA coding for the FMDV/2A self cleaving protein. The 5'
primer was
5'CAGCTGTTGAATTTTGACCTTCTTAAGCTTGCGGGAGACGTCGAGTCCAACCCTGG CCCC
(SEQ ID NO: 30) and the 3' primer was 5'ATACAGCGTCACGACTCCCACCAATAC
TAGTGACACAGACAGTGAGGTGCTG GGGCCAGGGTTGGACTCGAC3' (SEQ ID NO:
31).
[0150] Dengue-2 virus cDNA cloned in the yeast shuttle vector
pRS424, linearized by excision of a short Bam HI fragment was
transfected into competent (Spencer, F. et al. 1993 Methods
Companion Methods Enzymol 5:161-175) S. cerevisiae YPH857, kindly
provided by Barry Falgout (CBER FDA), along with the appropriate
PCR fragment spanning the desired deletion. Yeast colonies which
grew on tryptophan minus plates represented vectors which had
recircularized by homologous recombination with these PCR fragments
(Hirsch, V. et al. 1996 J Virol 70:3741-3752). DNA from these
colonies was transformed into E. coli STBL 2 cells (Life
Technologies, Inc.) to make sufficient quantities of dengue
recombinant, genomic-length DNAs for characterization and
analysis.
Expression of Virus and Replicons in Cells
[0151] The full length virus and replicon cDNA plasmids isolated
from STBL 2 cells were linearized with SacI, purified by Qiagen
chromatography, and eluted by RNAase-free water in preparation for
transcription. The transcription reaction mixtures contained 1
.mu.g of linearized DNA; 0.5 mM (each) ATP, CTP, and UTP; 0.1 mM
GTP; 0.5 mM cap analog (NEBL); 10 mM DTT; 40 U of Rnasin (Promega);
30 U of SP6 RNA polymerase; and lx SP6 RNA polymerase buffer
(Promega) in a volume of 30 .mu.l. The reaction mixtures were
incubated at 40.degree. C. for 2 hr. Aliquots (12.5 .mu.l) of the
reaction mixtures, containing full length viral RNA, were used to
transfect approximately 2.times.10.sup.6 Monkey LLC-MK2 cells in
phosphate-buffered saline (PBS) by electroporation in a 0.4 cm gap
electroporation cuvette. Each cuvette was pulsed at 200 V, 950
.mu.F using a BioRad Genepuls electroporator. The cells were then
resuspended in growth medium and plated on the appropriate tissue
culture dish.
[0152] After electroporation, cells were either plated directly on
multiwell plates for harvest at short time periods (typically 4
days or less) or on tissue culture dishes for trypsinization and
seeding onto multiwell plates one or two days before final harvest
for longer time periods.
Immuno-Histochemical Methods
[0153] For immunofluorescent detection of dengue-specific proteins,
cells growing on chamber slides were rinsed in room-temperature PBS
and then fixed in cold acetone for 10 min at -20.degree. C. After
being air dried, each chamber was covered with 50 .mu.l of a 1:50
dilution of DEN2-specific hyperimmune mouse ascitic fluid (HMAF,
American Type Culture Collection) in PBS plus 2% normal goat serum
and incubated at room temperature for 1 h in a humidified
atmosphere and then rinsed twice in PBS. After washing, cells were
subsequently incubated with a 1:100 dilution of fluorescein
isothiocyanate-labeled goat anti-mouse antibodies (Kirkegaard and
Perry Laboratory) and rinsed twice in PBS. For detection of
HIV-specific proteins, the same protocol was used except that cells
were initially incubated with human HIV-1 serum from Waldheim
Pharmazeutika Ges.m.b.H. Neufeld-Vienna, Austria and then
subsequently incubated with fluorescent-labeled goat anti-human
antibody. Cells in some, but not all experiments were
counterstained with 0.02% Evans Blue.
[0154] For dual labeling, the first antibodies were a 1:50 dilution
of dengue type 2 specific hyperimmune mouse ascitic fluid (HMAF,
American type culture collection) and a 1:100 dilution of human HIV
positive serum in PBS plus 2% normal goat serum. The second
antibodies were a 1:100 dilution of FITC-labeled goat anti-human
antibodies (Waldeim Pharmazeutika) and a 1:50 dilution of goat
anti-mouse IgG-L-Rhodamine (Boehringer Mannheim Biochemicals).
[0155] While the present invention has been described in some
detail for purposes of clarity and understanding, one skilled in
the art will appreciate that various changes in form and detail can
be made without departing from the true scope of the invention. All
patents, patent applications and publications referred to above are
hereby incorporated by reference.
Sequence CWU 1
1
3116DNAArtificial SequenceDelta ME Replicon 1agttgt
6212DNAArtificial SequenceDelta ME Replicon 2cgtaacagca cc
1236DNAArtificial SequenceDelta ME Replicon 3ggttct
646DNAArtificial SequenceDelta CME Replicon 4agttgt
6512DNAArtificial SequenceDelta CME Replicon 5gagagaagca cc
1266DNAArtificial SequenceDelta CME Replicon 6ggttct
6716PRTArtificial SequencePeptide from Mengo virus, strain M 7Gly
Tyr Phe Ser Asp Leu Leu Ile His Asp Val Glu Thr Asn Pro Gly1 5 10
15 88PRTArtificial SequencePeptide from Mengo virus, strain M 8Pro
Phe Thr Phe Lys Pro Arg Gln1 5 916PRTArtificial SequencePeptide
from encephalomyocarditis virus, strain B 9Gly Tyr Phe Ala Asp Leu
Leu Ile His Asp Ile Glu Thr Asn Pro Gly1 5 10 15 108PRTArtificial
SequencePeptide from encephalomyocarditis virus, strain B 10Pro Phe
Met Ala Lys Pro Lys Lys1 5 1116PRTArtificial SequencePeptide from
encephalomyocarditis virus, strain Rueckert 11Gly Tyr Phe Ala Asp
Leu Leu Ile His Asp Ile Glu Thr Asn Pro Gly1 5 10 15
128PRTArtificial SequencePeptide from encephalomyocarditis virus,
strain Rueckert 12Pro Phe Met Phe Arg Pro Arg Lys1 5
1316PRTArtificial SequencePeptide from Theilers murine
encephalomyelitis virus, bean 13Asp Tyr Tyr Arg Gln Arg Leu Ile His
Asp Val Glu Thr Asn Pro Gly1 5 10 15 148PRTArtificial
SequencePeptide from Theilers murine encephalomyelitis virus, bean
14Pro Val Gln Ser Val Phe Gln Pro1 5 1516PRTArtificial
SequencePeptide from Theilers murine encephalomyelitis virus, GDVII
15Asp Tyr Tyr Lys Gln Arg Leu Ile His Asp Val Glu Met Asn Pro Gly1
5 10 15 168PRTArtificial SequencePeptide from Theilers murine
encephalomyelitis virus, GDVII 16Pro Val Gln Ser Val Phe Gln Pro1 5
1716PRTArtificial SequencePeptide from foot-and-mouth disease
virus, strain 01 Kaufbeuren 17Asn Phe Asp Leu Leu Lys Leu Ala Gly
Asp Val Glu Ser Asn Pro Gly1 5 10 15 188PRTArtificial
SequencePeptide from foot-and-mouth disease virus, strain 01
Kaufbeuren 18Pro Phe Phe Phe Ser Asp Val Arg1 5 1916PRTArtificial
SequencePeptide from bovine rotavirus type C 19Gln Ile Asp Arg Ile
Leu Ile Ser Gly Asp Ile Glu Leu Asn Gly Pro1 5 10 15
208PRTArtificial SequencePeptide from bovine rotavirus type C 20Pro
Asn Ala Leu Val Lys Leu Asn1 5 2116PRTArtificial SequencePeptide
from porcine rotavirus type C 21Gln Ile Asp Arg Ile Leu Ile Ser Gly
Asp Val Glu Leu Asn Pro Gly1 5 10 15 228PRTArtificial
SequencePeptide from porcine rotavirus type C 22Pro Asp Pro Leu Ile
Arg Leu Asn1 5 2369DNAArtificial Sequence5' primer 23atcattatgc
tgattccaac agtgatggcg ttccatttaa ccacacgtaa cagcacctca 60ctgtctgtg
692469DNAArtificial Sequence5' primer 24acagctgtcg ctccttcaat
gacaatgcgt tgcataggaa tatcaaatag aagcacctca 60ctgtctgtg
692551DNAArtificial Sequence3' primer 25atacagcgtc acgactccca
ccaatactag tgacacagac agtgaggtgc t 512672DNAArtificial Sequence5'
primer 26cgaaaaaagg cgagaaatac gcctttcaat atgctgaaac gcgagagaat
ggtgagcaag 60ggcgaggagc tg 722742DNAArtificial Sequence3' primer
27aaggtcaaaa ttcaacagct gcttgtacag ctcgtccatg cc
422874DNAArtificial Sequence5' primer 28atcattatgc tgaatccaac
agtgatggcg ttccatttac cacacgtaac atgagagtga 60tggggatcag gaag
742945DNAArtificial Sequence3' primer 29aaggtcaaaa ttcaacagct
gggtgggtgc taatcctaat ggttc 453060DNAArtificial Sequence5' primer
30cagctgttga attttgacct tcttaagctt gcgggagacg tcgagtccaa ccctggcccc
603172DNAArtificial Sequence3' primer 31atacagcgtc acgactccca
ccaatactag tgacacagac agtgaggtgc tggggccagg 60gttggactcg ac 72
* * * * *