U.S. patent application number 15/019758 was filed with the patent office on 2016-08-18 for real time cleavage assay.
The applicant listed for this patent is Exact Sciences Corporation. Invention is credited to Hatim Allawi, Michael J. Domanico, Graham P. Lidgard, Rebecca Oldham-Haltom, Hongzhi Zou.
Application Number | 20160237480 15/019758 |
Document ID | / |
Family ID | 46048113 |
Filed Date | 2016-08-18 |
United States Patent
Application |
20160237480 |
Kind Code |
A1 |
Oldham-Haltom; Rebecca ; et
al. |
August 18, 2016 |
Real Time Cleavage Assay
Abstract
A cleavage-based real-time PCR assay method is provided. In
general terms, the assay method includes subjecting a reaction
mixture comprising a) PCR reagents for amplifying a nucleic acid
target, and b) flap cleavage reagents for performing a flap
cleavage assay on the amplified nucleic acid target to two sets of
thermocycling conditions. No additional reagents are added to the
reaction between said first and second sets of cycles and, in each
cycle of the second set of cycles, cleavage of a flap probe is
measured.
Inventors: |
Oldham-Haltom; Rebecca;
(Marshall, WI) ; Zou; Hongzhi; (Middleton, WI)
; Lidgard; Graham P.; (Madison, WI) ; Domanico;
Michael J.; (Middleton, WI) ; Allawi; Hatim;
(Middleton, WI) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Exact Sciences Corporation |
Madison |
WI |
US |
|
|
Family ID: |
46048113 |
Appl. No.: |
15/019758 |
Filed: |
February 9, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13720757 |
Dec 19, 2012 |
9290797 |
|
|
15019758 |
|
|
|
|
12946737 |
Nov 15, 2010 |
8361720 |
|
|
13720757 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6886 20130101;
C12Q 1/6827 20130101; C12Q 1/6818 20130101; C12Q 1/686 20130101;
C12Q 1/686 20130101; C12Q 2600/156 20130101; C12Q 2525/301
20130101; C12Q 2565/1015 20130101; C12Q 2527/101 20130101; C12Q
2600/158 20130101; C12Q 2561/109 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1-13. (canceled)
14. A method of sample analysis comprising: (a) subjecting a
reaction mixture comprising: a target nucleic acid; PCR reagents
for amplifying the target nucleic acid, and flap cleavage reagents
for performing a flap cleavage assay on the target nucleic acid, to
thermocycling conditions that include multiple cycles of: a first
temperature of at least 90.degree. C.; a second temperature; and a
third temperature in the range of 65.degree. C. to 75.degree. C.;
wherein the second temperature is at least 10.degree. C. lower than
the third temperature; and (b) measuring cleavage of a flap
oligonucleotide while the reaction mixture is at the second
temperature.
15. The method of claim 14, wherein said second temperature is in
the range 50.degree. C. to 55.degree. C.
16. The method of claim 14, wherein the measuring step (b)
comprises measuring cleavage of a 5' fluorophore from the flap
oligonucleotide.
17. The method of claim 14, wherein the multiple cycles is 20-50
cycles.
18. The method of claim 17, wherein said method further comprises
graphing the amount of cleavage that occurs in each of the 20-50
cycles, thereby providing an estimate of the abundance of the
target nucleic acid.
19. The method of claim 14, wherein the reaction mixture has a
volume that is in the range of 5 .mu.l to 200 .mu.l, and each of
said first to third temperatures is, independently, of a duration
in the range of 10 seconds to 3 minutes.
20. The method of claim 14, wherein said cleavage of the flap
oligonucleotide in (b) indicates a mutation in the target nucleic
acid.
21. The method of claim 14, wherein: the PCR reagents comprise: a
nucleic acid template; a first PCR primer, a second PCR primer, a
thermostable polymerase, and nucleotides; and the flap cleavage
reagents comprise: an invasive oligonucleotide, a flap
oligonucleotide, a thermostable flap endonuclease and a FRET
cassette, wherein i. the first PCR primer and the invasive
oligonucleotide have different nucleotide sequences or ii. the
first PCR primer and the invasive oligonucleotide have the same
nucleotide sequence and the first primer is used as the invasive
oligonucleotide
22. The method of claim 21, wherein said first PCR primer is
present in said reaction mixture at the same concentration as the
second PCR primer.
23. The method of claim 21, wherein the thermostable polymerase is
selected from Taq, Pfu, Pwo, UlTma and Vent.
24. The method of claim 14, wherein the target nucleic acid
corresponds to a mutated locus in the human genome.
25. The method of claim 24, wherein the mutated locus is
cancer-related.
26. The method of claim 25, wherein the mutated locus is an
oncogenic mutation in PIK3CA, NRAS, KRAS, JAK2, HRAS, FGFR3, FGFR1,
EGFR, CDK4, BRAF, RET, PGDFRA, KIT or ERBB2.
27. The method of claim 14, wherein no additional reagents are
added to said reaction mix between steps (a) and (b).
28. The method of claim 14, wherein said reaction mix further
comprises PCR reagents and flap reagents for amplifying and
detecting a second target nucleic acid.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S. patent
application Ser. No. 12/946,737, filed on Nov. 10, 2010, all of
which is incorporated by reference in its entirety.
BACKGROUND
[0002] Several point mutations in the human genome have a direct
association with a disease. For example, several germline KRAS
mutations have been found to be associated with Noonan syndrome
(Schubbert et al. Nat. Genet. 2006 38: 331-6) and
cardio-facio-cutaneous syndrome (Niihori et al. Nat. Genet. 2006
38: 294-6). Likewise, somatic KRAS mutations are found at high
rates in leukemias, colorectal cancer (Burmer et al. Proc. Natl.
Acad. Sci. 1989 86: 2403-7), pancreatic cancer (Almoguera et al.
Cell 1988 53: 549-54) and lung cancer (Tam et al. Clin. Cancer Res.
2006 12: 1647-53). Many point mutations in the human genome have no
apparent causative association with a disease.
[0003] Methods for the detection of point mutations may be used,
for example, to provide a diagnostic for diseases that are
associated with the point mutations.
SUMMARY
[0004] A cleavage-based real-time PCR assay method is provided. In
certain embodiments, the assay method includes subjecting a
reaction mixture comprising a) PCR reagents for amplifying a
nucleic acid target, and b) flap cleavage reagents for performing a
flap cleavage assay on the amplified nucleic acid target to two
sets of thermocycling conditions. The first set of thermocycling
conditions includes a set of 5-15 cycles of: i. a first temperature
of at least 90.degree. C.; ii. a second temperature in the range of
60.degree. C. to 75.degree. C.; iii. a third temperature in the
range of 65.degree. C. to 75.degree. C. The second and third
temperatures may be the same. The second set of thermocycling
conditions includes a set of 20-50 cycles of: i. a fourth
temperature of at least 90.degree. C.; ii. a fifth temperature that
is at least 10.degree. C. lower than the second temperature; iii. a
sixth temperature in the range of 65.degree. C. to 75.degree. C. In
certain cases, no additional reagents are added to the reaction
between the first and second sets of cycles and, in each cycle of
the second set of cycles, cleavage of a flap probe is measured.
BRIEF DESCRIPTION OF THE FIGURES
[0005] FIG. 1 schematically illustrates some of the general
principles of a flap assay.
[0006] FIG. 2 shows results of an assay done using single stage
thermocycling. Detection and quantitation of the KRAS G35T mutation
in the presence of the wild type sequence at levels, as indicated.
Kinetic curves show all ratios of mutant to wild type other than
1:10 and 1:100 are indistinguishable.
[0007] FIG. 3 shows results of an assay done using two stage
thermocycling. Detection and quantitation of the KRAS G35T mutation
in the presence of the wild type sequence at levels, as indicated.
Kinetic curves show resolution of ratios from 1:10 to 1:10,000.
DEFINITIONS
[0008] The term "sample" as used herein relates to a material or
mixture of materials, typically, although not necessarily, in
liquid form, containing one or more analytes of interest.
[0009] The term "nucleotide" is intended to include those moieties
that contain not only the known purine and pyrimidine bases, but
also other heterocyclic bases that have been modified. Such
modifications include methylated purines or pyrimidines, acylated
purines or pyrimidines, alkylated riboses or other heterocycles. In
addition, the term "nucleotide" includes those moieties that
contain hapten or fluorescent labels and may contain not only
conventional ribose and deoxyribose sugars, but other sugars as
well. Modified nucleosides or nucleotides also include
modifications on the sugar moiety, e.g., wherein one or more of the
hydroxyl groups are replaced with halogen atoms or aliphatic
groups, are functionalized as ethers, amines, or the likes.
[0010] The term "nucleic acid" and "polynucleotide" are used
interchangeably herein to describe a polymer of any length, e.g.,
greater than about 2 bases, greater than about 10 bases, greater
than about 100 bases, greater than about 500 bases, greater than
1000 bases, up to about 10,000 or more bases composed of
nucleotides, e.g., deoxyribonucleotides or ribonucleotides, and may
be produced enzymatically or synthetically (e.g., PNA as described
in U.S. Pat. No. 5,948,902 and the references cited therein) which
can hybridize with naturally occurring nucleic acids in a sequence
specific manner analogous to that of two naturally occurring
nucleic acids, e.g., can participate in Watson-Crick base pairing
interactions. Naturally-occurring nucleotides include guanine,
cytosine, adenine and thymine (G, C, A and T, respectively).
[0011] The term "nucleic acid sample," as used herein denotes a
sample containing nucleic acid.
[0012] The term "target polynucleotide," as used herein, refers to
a polynucleotide of interest under study. In certain embodiments, a
target polynucleotide contains one or more target sites that are of
interest under study.
[0013] The term "oligonucleotide" as used herein denotes a single
stranded multimer of nucleotides of about 2 to 200 nucleotides.
Oligonucleotides may be synthetic or may be made enzymatically,
and, in some embodiments, are 10 to 50 nucleotides in length.
Oligonucleotides may contain ribonucleotide monomers (i.e., may be
oligoribonucleotides) or deoxyribonucleotide monomers. An
oligonucleotide may be 10 to 20, 11 to 30, 31 to 40, 41 to 50, 51
to 60, 61 to 70, 71 to 80, 80 to 100, 100 to 150 or 150 to 200
nucleotides in length, for example.
[0014] The term "duplex," or "duplexed," as used herein, describes
two complementary polynucleotides that are base-paired, i.e.,
hybridized together.
[0015] The term "primer" as used herein refers to an
oligonucleotide that has a nucleotide sequence that is
complementary to a region of a target polynucleotide. A primer
binds to the complementary region and is extended, using the target
nucleic acid as the template, under primer extension conditions. A
primer may be in the range of about 15 to about 50 nucleotides
although primers outside of this length may be used. A primer can
be extended from its 3' end by the action of a polymerase. An
oligonucleotide that cannot be extended from it 3' end by the
action of a polymerase is not a primer.
[0016] The term "extending" as used herein refers to any addition
of one or more nucleotides to the end of a nucleic acid, e.g. by
ligation of an oligonucleotide or by using a polymerase.
[0017] The term "amplifying" as used herein refers to generating
one or more copies of a target nucleic acid, using the target
nucleic acid as a template.
[0018] The term "denaturing," as used herein, refers to the
separation of a nucleic acid duplex into two single strands.
[0019] The terms "determining", "measuring", "evaluating",
"assessing," "assaying," "detecting," and "analyzing" are used
interchangeably herein to refer to any form of measurement, and
include determining if an element is present or not. These terms
include both quantitative and/or qualitative determinations.
Assessing may be relative or absolute. "Assessing the presence of"
includes determining the amount of something present, as well as
determining whether it is present or absent.
[0020] The term "using" has its conventional meaning, and, as such,
means employing, e.g., putting into service, a method or
composition to attain an end.
[0021] As used herein, the term "T.sub.m" refers to the melting
temperature of an oligonucleotide duplex at which half of the
duplexes remain hybridized and half of the duplexes dissociate into
single strands. The T.sub.m of an oligonucleotide duplex may be
experimentally determined or predicted using the following formula
T.sub.m=81.5+16.6(log.sub.10[Na.sup.+])+0.41 (fraction G+C)-(60/N),
where N is the chain length and [Na.sup.+] is less than 1 M. See
Sambrook and Russell (2001; Molecular Cloning: A Laboratory Manual,
3.sup.rd ed., Cold Spring Harbor Press, Cold Spring Harbor N.Y.,
ch. 10). Other formulas for predicting T.sub.m of oligonucleotide
duplexes exist and one formula may be more or less appropriate for
a given condition or set of conditions.
[0022] As used herein, the term "T.sub.m-matched" refers to a
plurality of nucleic acid duplexes having T.sub.ms that are within
a defined range, e.g., within 5.degree. C. or 10.degree. C. of each
other.
[0023] As used herein, the term "reaction mixture" refers to a
mixture of reagents that are capable of reacting together to
produce a product in appropriate external conditions over a period
of time. A reaction mixture may contain PCR reagents and flap
cleavage reagents, for example, the recipes for which are
independently known in the art.
[0024] The term "mixture", as used herein, refers to a combination
of elements, that are interspersed and not in any particular order.
A mixture is heterogeneous and not spatially separable into its
different constituents. Examples of mixtures of elements include a
number of different elements that are dissolved in the same aqueous
solution, or a number of different elements attached to a solid
support at random or in no particular order in which the different
elements are not specially distinct. A mixture is not addressable.
To illustrate by example, an array of spatially separated
surface-bound polynucleotides, as is commonly known in the art, is
not a mixture of surface-bound polynucleotides because the species
of surface-bound polynucleotides are spatially distinct and the
array is addressable.
[0025] As used herein, the term "PCR reagents" refers to all
reagents that are required for performing a polymerase chain
reaction (PCR) on a template. As is known in the art, PCR reagents
essentially include a first primer, a second primer, a thermostable
polymerase, and nucleotides. Depending on the polymerase used, ions
(e.g., Mg.sup.2+) may also be present. PCR reagents may optionally
contain a template from which a target sequence can be
amplified.
[0026] As used herein, the term "flap assay" refers to an assay in
which a flap oligonucleotide is cleaved in an overlap-dependent
manner by a flap endonuclease to release a flap that is then
detected. The principles of flap assays are well known and
described in, e.g., Lyamichev et al. (Nat. Biotechnol. 1999
17:292-296), Ryan et al (Mol. Diagn. 1999 4:135-44) and Allawi et
al (J Clin Microbiol. 2006 44: 3443-3447). For the sake of clarity,
certain reagents that are employed in a flap assay are described
below. The principles of a flap assay are illustrated in FIG. 1. In
the flap assay shown in FIG. 1, an invasive oligonucleotide 2 and
flap oligonucleotide 4 are hybridized to target 6 to produce a
first complex 8 that contains a nucleotide overlap at position 10.
First complex 8 is a substrate for flap endonuclease. Flap
endonuclease 12 cleaves flap oligonucleotide 4 to release a flap 14
that hybridizes with FRET cassette 16 that contains a quencher "Q"
and a nearby quenched flourophore "R" that is quenched by the
quencher Q. Hybridization of flap 14 to FRET cassette 16 results in
a second complex 18 that contains a nucleotide overlap at position
20. The second complex is also a substrate for flap endonuclease.
Cleavage of FRET cassette 16 by flap endonuclease 12 results in
release of the fluorophore 22, which produces a fluorescent signal.
These components are described in greater detail below.
[0027] As used herein, the term "invasive oligonucleotide" refers
to an oligonucleotide that is complementary to a region in a target
nucleic acid. The 3' terminal nucleotide of the invasive
oligonucleotide may or may not base pair a nucleotide in the target
(e.g., which may be the site of a SNP or a mutation, for
example).
[0028] As used herein, the term "flap oligonucleotide" refers to an
oligonucleotide that contains a flap region and a region that is
complementary to a region in the target nucleic acid. The target
complementary regions on the invasive oligonucleotide and the flap
oligonucleotide overlap by a single nucleotide. As is known, if the
3' terminal nucleotide of the invasive nucleotide and the
nucleotide that overlaps that nucleotide in the flap
oligonucleotide both base pair with a nucleotide in the target
nucleic acid, then a particular structure is formed. This structure
is a substrate for an enzyme, defined below as a flap endonuclease,
that cleaves the flap from the target complementary region of the
flap oligonucleotide. If the 3' terminal nucleotide of the invasive
oligonucleotide does not base pair with a nucleotide in the target
nucleic acid, or if the overlap nucleotide in the flap
oligononucleotide does not base pair with a nucleotide in the
target nucleic acid, the complex is not a substrate for the enzyme
and there is little or no cleavage.
[0029] The term "flap endonuclease" or "FEN" for short, as used
herein, refers to a class of nucleolytic enzymes that act as
structure specific endonucleases on DNA structures with a duplex
containing a single stranded 5' overhang, or flap, on one of the
strands that is displaced by another strand of nucleic acid, i.e.,
such that there are overlapping nucleotides at the junction between
the single and double-stranded DNA. FENs catalyze hydrolytic
cleavage of the phosphodiester bond at the junction of single and
double stranded DNA, releasing the overhang, or the flap. Flap
endonucleases are reviewed by Ceska and Savers (Trends Biochem.
Sci. 1998 23:331-336) and Liu et al (Annu. Rev. Biochem. 2004 73:
589-615). FENs may be individual enzymes, multi-subunit enzymes, or
may exist as an activity of another enzyme or protein complex,
e.g., a DNA polymerase. A flap endonuclease may be
thermostable.
[0030] As used herein, the term "cleaved flap" refers to a
single-stranded oligonucleotide that is a cleavage product of a
flap assay.
[0031] As used herein, the term "FRET cassette" refers to a hairpin
oligonucleotide that contains a fluorophore moiety and a nearby
quencher moiety that quenches the fluorophore. Hybridization of a
cleaved flap with a FRET cassette produces a secondary substrate
for the flap endonuclease. Once this substrate is formed, the 5'
fluorophore-containing base is cleaved from the cassette, thereby
generating a fluorescence signal.
[0032] As used herein, the term "flap assay reagents" refers to all
reagents that are required for performing a flap assay on a
substrate. As is known in the art, flap assays include an invasive
oligonucleotide, a flap oligonucleotide, a flap endonuclease and a
FRET cassette, as described above. Flap assay reagents may
optionally contain a target to which the invasive oligonucleotide
and flap oligonucleotide bind.
DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0033] Before the present invention is described in greater detail,
it is to be understood that this invention is not limited to
particular embodiments described, as such may, of course, vary. It
is also to be understood that the terminology used herein is for
the purpose of describing particular embodiments only, and is not
intended to be limiting, since the scope of the present invention
will be limited only by the appended claims.
[0034] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limit of that range and any other stated or intervening
value in that stated range, is encompassed within the invention.
The upper and lower limits of these smaller ranges may
independently be included in the smaller ranges and are also
encompassed within the invention, subject to any specifically
excluded limit in the stated range. Where the stated range includes
one or both of the limits, ranges excluding either or both of those
included limits are also included in the invention.
[0035] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can also be used in the practice or testing of the present
invention, the preferred methods and materials are now
described.
[0036] All publications and patents cited in this specification are
herein incorporated by reference as if each individual publication
or patent were specifically and individually indicated to be
incorporated by reference and are incorporated herein by reference
to disclose and describe the methods and/or materials in connection
with which the publications are cited. The citation of any
publication is for its disclosure prior to the filing date and
should not be construed as an admission that the present invention
is not entitled to antedate such publication by virtue of prior
invention. Further, the dates of publication provided may be
different from the actual publication dates which may need to be
independently confirmed.
[0037] It must be noted that as used herein and in the appended
claims, the singular forms "a", "an", and "the" include plural
referents unless the context clearly dictates otherwise. It is
further noted that the claims may be drafted to exclude any
optional element. As such, this statement is intended to serve as
antecedent basis for use of such exclusive terminology as "solely,"
"only" and the like in connection with the recitation of claim
elements, or use of a "negative" limitation.
[0038] As will be apparent to those of skill in the art upon
reading this disclosure, each of the individual embodiments
described and illustrated herein has discrete components and
features which may be readily separated from or combined with the
features of any of the other several embodiments without departing
from the scope or spirit of the present invention. Any recited
method can be carried out in the order of events recited or in any
other order which is logically possible.
[0039] Described herein is a cleavage-based real-time PCR assay
method. In general terms, the assay method includes subjecting a
reaction mixture comprising a) PCR reagents for amplifying a
nucleic acid target, and b) flap cleavage reagents for performing a
flap cleavage assay on the amplified nucleic acid target to two
sets of thermocycling conditions. In certain cases, no additional
reagents are added to the reaction between the first and second
sets of cycles and, in each cycle of the second set of cycles,
cleavage of a flap probe is measured. In further describing the
method, the reagent mixture used in the method will be described
first, followed by a description of the thermocycling conditions
used in the method.
[0040] In the following description, the skilled artisan will
understand that any of a number of polymerases and flap
endonucleases could be used in the methods, including without
limitation, those isolated from thermostable or hyperthermostable
prokaryotic, eukaryotic, or archaeal organisms. The skilled artisan
will also understand that the enzymes that are used in the method,
e.g., polymerase and flap endonuclease, include not only naturally
occurring enzymes, but also recombinant enzymes that include
enzymatically active fragments, cleavage products, mutants, and
variants of wild type enzymes.
[0041] Reaction Mixture
[0042] As noted above, the reaction mixture used in the method
contains at least PCR reagents for amplifying a nucleic acid target
and flap cleavage reagents for performing a flap cleavage assay on
the amplified nucleic acid. The reaction mixture employed in the
method may therefore contain a pair of primers as well a reaction
buffer (which can be pH buffered and may include salt, e.g.,
MgCl.sub.2 and other components necessary for PCR), nucleotides,
e.g., dGTP, dATP, dTTP and dCTP and a thermostable DNA polymerase,
as well as a flap oligonucleotide, a flap endonuclease and a FRET
cassette, as defined above. Depending on how the assay is performed
(i.e., depending on whether one of the PCR primers is used as an
invasive oligonucleotide in the flap assay) the reaction mix may
additionally contain an invasive oligonucleotide that is distinct
from the PCR primers. The reaction mixture may further contain a
nucleic acid target.
[0043] The exact identities and concentrations of the reagents
present in the reaction mixture may be similar to or the same as
those independently employed in PCR and flap cleavage assays, with
the exception that the reaction mixture contains Mg.sup.2+ at a
concentration that is higher then employed in conventional PCR
reaction mixtures (which contain Mg.sup.2+ at a concentration of
between about 1.8 mM and 3 mM). In certain embodiments, the
reaction mixture described herein contains Mg.sup.2+ at a
concentration in the range of 4 mM to 10 mM, e.g., 6 mM to 9 mM.
Exemplary reaction buffers and DNA polymerases that may be employed
in the subject reaction mixture include those described in various
publications (e.g., Ausubel, et al., Short Protocols in Molecular
Biology, 3rd ed., Wiley & Sons 1995 and Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Third Edition, 2001 Cold
Spring Harbor, N.Y.). Reaction buffers and DNA polymerases suitable
for PCR may be purchased from a variety of suppliers, e.g.,
Invitrogen (Carlsbad, Calif.), Qiagen (Valencia, Calif.) and
Stratagene (La Jolla, Calif.). Exemplary polymerases include Taq,
Pfu, Pwo, UlTma and Vent, although many other polymerases may be
employed in certain embodiments. Guidance for the reaction
components suitable for use with a polymerase as well as suitable
conditions for their use, is found in the literature supplied with
the polymerase. Primer design is described in a variety of
publications, e.g., Diffenbach and Dveksler (PCR Primer, A
Laboratory Manual, Cold Spring Harbor Press 1995); R. Rapley, (The
Nucleic Acid Protocols Handbook (2000), Humana Press, Totowa,
N.J.); Schena and Kwok et al., Nucl. Acid Res. 1990 18:999-1005).
Primer and probe design software programs are also commercially
available, including without limitation, Primer Detective
(ClonTech, Palo Alto, Calif.), Lasergene, (DNASTAR, Inc., Madison,
Wis.); and Oligo software (National Biosciences, Inc., Plymouth,
Minn.) and iOligo (Caesar Software, Portsmouth, N.H).
[0044] Exemplary flap cleavage assay reagents are found in
Lyamichev et al. (Nat. Biotechnol. 1999 17:292-296), Ryan et al
(Mol. Diagn. 1999 4:135-44) and Allawi et al (J Clin Microbiol.
2006 44: 3443-3447). Appropriate conditions for flap endonuclease
reactions are either known or can be readily determined using
methods known in the art (see, e.g., Kaiser et al., J. Biol. Chem.
274:21387-94, 1999). Exemplary flap endonucleases that may be used
the method include, without limitation, Thermus aquaticus DNA
polymerase I, Thermus thermophilus DNA polymerase I, mammalian
FEN-1, Archaeoglobus fulgidus FEN-1, Methanococcus jannaschii
FEN-1, Pyrococcus furiosus FEN-1, Methanobacterium
thermoautotrophicum FEN-1, Thermus thermophilus FEN-1, CLEAVASE.TM.
(Third Wave, Inc., Madison, Wis.), S. cerevisiae RTH1, S.
cerevisiae RAD27, Schizosaccharomyces pombe rad2, bacteriophage T5
5'-3' exonuclease, Pyroccus horikoshii FEN-1, human exonuclease 1,
calf thymus 5'-3' exonuclease, including homologs thereof in
eubacteria, eukaryotes, and archaea, such as members of the class
II family of structure-specific enzymes, as well as enzymatically
active mutants or variants thereof. Descriptions of cleaving
enzymes can be found in, among other places, Lyamichev et al.,
Science 260:778-83, 1993; Eis et al., Nat. Biotechnol. 19:673-76,
2001; Shen et al., Trends in Bio. Sci. 23:171-73, 1998; Kaiser et
al. J. Biol. Chem. 274:21387-94, 1999; Ma et al., J. Biol. Chem.
275:24693-700, 2000; Allawi et al., J. Mol. Biol. 328:537-54, 2003;
Sharma et al., J. Biol. Chem. 278:23487-96, 2003; and Feng et al.,
Nat. Struct. Mol. Biol. 11:450-56, 2004.
[0045] In particular embodiments, the reaction mix may contain
reagents for assaying multiple (e.g., at least 2, 3, 4 or more)
different targets sequences in parallel. In these cases, the
reaction mix may contain multiple pairs of PCR primers, multiple
different flap oligonucleotides having different flaps, and
multiple different FRET cassettes for detecting the different
flaps, once they are cleaved. In one embodiment, oligonucleotides
in a mixture may have common flaps but different binding sequences
to allow for, for example, a set of mutations to cleave a common
FRET cassette and report a signal where a single fluorophore is
indicative of the presence of a mutation. In this embodiment, which
mutation is present in the sample may be determined after the
presence of a mutation has identified. Optionally, the reaction may
contain multiple invasive oligonucleotides if one of the PCR
primers is not used as an invasive oligonucleotide. Upon cleavage
of the FRET cassettes, multiple distinguishable fluorescent signals
may be observed. The fluorophore may be selected from, e.g.,
6-carboxyfluorescein (FAM), which has excitation and emission
wavelengths of 485 nm and 520 nm respectively, Redmond Red, which
has excitation and emission wavelengths of 578 nm and 650 nm
respectively and Yakima Yellow, which has excitation and emission
wavelengths of 532 nm and 569 nm respectively, and Quasor670 which
has excitation and emission wavelengths of 644 nm and 670 nm
respectively, although many others could be employed. In certain
cases, at least one of the PCR primer pairs, flap oligonucleotides
and FRET cassettes may be for the detection of an internal
control.
[0046] As would be apparent, the various oligonucleotides used in
the method are designed so as to not interfere with each other. For
example, in particular embodiments, the flap oligonucleotide may be
capped at its 3' end, thereby preventing its extension. Likewise,
in certain embodiments, the invasive oligonucleotide may also be
capped at its 3' end if it is not used as one of the PCR primers.
In particular embodiment, if the invasive oligonucleotide is not
used as one of the PCR primers, then the invasive oligonucleotide
may be present at a concentration that is in the range of 5% to
50%, e.g., 10% to 40% of the concentration of the PCR primers.
Further, in certain cases, the T.sub.ms of the flap portion and the
target complementary regions of the flap oligonucleotide may
independently be at least 10.degree. C. lower (e.g., 10-20.degree.
C. lower) than the T.sub.ms of the PCR primers, which results in a)
less hybridization of the flap oligonucleotide to the target
nucleic acid at higher temperatures (60.degree. C. to 75.degree.
C.) and b) less hybridization of any cleaved clap to the FRET
cassette at higher temperatures (60.degree. C. to 75.degree. C.).
The lower fifth temperature is favorable for hybridization of the
oligonucleotides used in the flap assay, and for the activity of
the flap endonuclease.
[0047] In a multiplex reaction, the primers may be designed to have
similar thermodynamic properties, e.g., similar T.sub.ms, G/C
content, hairpin stability, and in certain embodiments may all be
of a similar length, e.g., from 18 to 30 nt, e.g., 20 to 25 nt in
length. The other reagents used in the reaction mixture may also be
T.sub.m matched.
[0048] The assay mixture may be present in a vessel, including
without limitation, a tube; a multi-well plate, such as a 96-well,
a 384-well, a 1536-well plate; and a microfluidic device. In
certain embodiments, multiple multiplex reactions are performed in
the same reaction vessel. Depending on how the reaction is
performed, the reaction mixture may be of a volume of 5 .mu.l to
200 .mu.l, e.g., 10 .mu.l to 100 .mu.l, although volumes outside of
this range are envisioned.
[0049] In certain embodiments, a subject reaction mix may further
contain a nucleic acid sample. In particular embodiments, the
sample may contain genomic DNA or an amplified version thereof
(e.g., genomic DNA amplified using the methods of Lage et al,
Genome Res. 2003 13: 294-307 or published patent application
US20040241658, for example). In exemplary embodiments, the genomic
sample may contain genomic DNA from a mammalian cell such a human,
mouse, rat or monkey cell. The sample may be made from cultured
cells or cells of a clinical sample, e.g., a tissue biopsy, scrape
or lavage or cells of a forensic sample (i.e., cells of a sample
collected at a crime scene). In particular embodiments, the genomic
sample may be from a formalin fixed paraffin embedded (FFPE)
sample.
[0050] In particular embodiments, the nucleic acid sample may be
obtained from a biological sample such as cells, tissues, bodily
fluids, and stool. Bodily fluids of interest include but are not
limited to, blood, serum, plasma, saliva, mucous, phlegm, cerebral
spinal fluid, pleural fluid, tears, lactal duct fluid, lymph,
sputum, cerebrospinal fluid, synovial fluid, urine, amniotic fluid,
and semen. In particular embodiments, a sample may be obtained from
a subject, e.g., a human, and it may be processed prior to use in
the subject assay. For example, the nucleic acid may be extracted
from the sample prior to use, methods for which are known.
[0051] For example, DNA can be extracted from stool from any number
of different methods, including those described in, e.g, Coll et al
(J. of Clinical Microbiology 1989 27: 2245-2248), Sidransky et al
(Science 1992 256: 102-105), Villa (Gastroenterology 1996 110:
1346-1353) and Nollau (BioTechniques 1996 20: 784-788), and U.S.
Pat. Nos. 5,463,782, 7,005,266, 6,303,304 and 5,741,650. Commercial
DNA extraction kits for the extraction of DNA from stool include
the QIAamp stool mini kit (QIAGEN, Hilden, Germany), Instagene
Matrix (Bio-Rad, Hercules, Calif.), and RapidPrep Micro Genomic DNA
isolation kit (Pharmacia Biotech Inc. Piscataway, N.J.), among
others.
[0052] Method for Sample Analysis
[0053] In performing the subject method, the reaction mixture is
generally subjected to the following thermocycling conditions: a
first set of 5 to 15 (e.g., 8 to 12) cycles of: i. a first
temperature of at least 90.degree. C.; ii. a second temperature in
the range of 60.degree. C. to 75.degree. C. (e.g., 65.degree. C. to
75.degree. C.); iii. a third temperature in the range of 65.degree.
C. to 75.degree. C.; followed by: a second set of 20-50 cycles of:
i. a fourth temperature of at least 90.degree. C.; ii. a fifth
temperature that is at least 10.degree. C. lower than the second
temperature (e.g., in the range of 50.degree. C. to 55.degree. C.;
and iii. a sixth temperature in the range of 65.degree. C. to
75.degree. C. No additional reagents need to be added to the
reaction mixture during the thermocycling, e.g., between the first
and second sets of cycles. In particular embodiments, the
thermostable polymerase is not inactivated between the first and
second sets of conditions, thereby allowing the target to be
amplified during each cycle of the second set of cycles. In
particular embodiments, the second and third temperatures are the
same temperature such that "two step" theremocycling conditions are
performed. Each of the cycles may be independently of a duration in
the range of 10 seconds to 3 minutes, although durations outside of
this range are readily employed.
[0054] In each cycle of the second set of cycles (e.g., while the
reaction is in the fifth temperature), a signal generated by
cleavage of the flap probe may be measured to provide a real-time
measurement of the amount of target nucleic acid in the sample
(where the term "real-time" is intended to refer to a measurement
that is taken as the reaction progresses and products accumulate).
The measurement may be expressed as an absolute number of copies or
a relative amount when normalized to a control nucleic acid in the
sample.
[0055] Without being bound to any specific theory, it is believed
that the higher reaction temperatures in the first set of cycles
may allow the target nucleic acid to be efficiently amplified by
the pair of PCR primers without significant interference by any of
the flap assay reagents or their reaction products. The lower
reaction temperature used in the second set of cycles (i.e., the
fifth temperature) is not optimum for the polymerase used for PCR,
but allows the flap oligonucleotide to efficiently hybridize to the
target nucleic acid and is closer to the optimum temperature of the
flap endonuclease. The lower reaction temperature used in the
second set of cycles also facilitates subsequent hybridization of
the cleaved flap to the FRET cassette. Thus, at a lower
temperature, the target nucleic acid may be detected without
significant interference from the PCR reagents.
[0056] In certain cases, fluorescence indicating the amount of
cleaved flap can be detected by an automated fluorometer designed
to perform real-time PCR having the following features: a light
source for exciting the fluorophore of the FRET cassette, a system
for heating and cooling reaction mixtures and a fluorometer for
measuring fluorescence by the FRET cassette. This combination of
features, allows real-time measurement of the cleaved flap, thereby
allowing the amount of target nucleic acid in the sample to be
quantified. Automated fluorometers for performing real-time PCR
reactions are known in the art and can be adapted for use in this
specific assay, for example, the ICYCLER.TM. from Bio-Rad
Laboratories (Hercules, Calif.), the Mx3000P.TM., the MX3005P.TM.
and the MX4000.TM. from Stratagene (La Jolla, Calif.), the ABI
PRISM.TM. 7300, 7500, 7700, and 7900 Taq Man (Applied Biosystems,
Foster City, Calif.), the SMARTCYCLER.TM., ROTORGENE 2000.TM.
(Corbett Research, Sydney, Australia) and the GENE XPERT.TM. System
(Cepheid, Sunnyvale, Calif.) and the LIGHTCYCLER.TM. (Roche
Diagnostics Corp., Indianapolis, Ind.). The speed of ramping
between the different reaction temperatures is not critical and, in
certain embodiments, the default ramping speeds that are preset on
thermocyclers may be employed.
[0057] In certain cases, the method may further involve graphing
the amount of cleavage that occurs at each of the second set of
cycles, thereby providing an estimate of the abundance of the
nucleic acid target. The estimate may be calculated by determining
the threshold cycle (i.e., the cycle at which this fluorescence
increases above a predetermined threshold; the "Ct" value or "Cp"
value). This estimate can be compared to a control (which control
may be assayed in the same reaction mix as the genomic locus of
interest) to provide a normalized estimate. The thermocycler may
also contain a software application for determining the threshold
cycle for each of the samples. An exemplary method for determining
the threshold cycle is set forth in, e.g., Luu-The et al
(Biotechniques 2005 38: 287-293).
[0058] A device for performing sample analysis is also provided. In
certain embodiments, the device comprises: a) a thermocycler
programmed to perform the above-described and b) a vessel
comprising: PCR reagents for amplifying a nucleic acid target, and
flap cleavage reagents for performing a flap cleavage assay on the
nucleic acid target.
[0059] Utility
[0060] The method described finds use in a variety of applications,
where such applications generally include sample analysis
applications in which the presence of a target nucleic acid
sequence in a given sample is detected.
[0061] In particular, the above-described methods may be employed
to diagnose, to predict a response to treatment, or to investigate
a cancerous condition or another mammalian disease, including but
not limited to, leukemia, breast carcinoma, prostate cancer,
Alzheimer's disease, Parkinsons's disease, epilepsy, amylotrophic
lateral schlerosis, multiple sclerosis, stroke, autism, mental
retardation, and developmental disorders. Many nucleotide
polymorphisms are associated with and are thought to be a factor in
producing these disorders. Knowing the type and the location of the
nucleotide polymorphism may greatly aid the diagnosis, prognosis,
and understanding of various mammalian diseases. In addition, the
assay conditions described herein can be employed in other nucleic
acid detection applications including, for example, for the
detection of infectious diseases, viral load monitoring, viral
genotyping, environmental testing, food testing, forensics,
epidemiology, and other areas where specific nucleic acid sequence
detection is of use.
[0062] In some embodiments, a biological sample may be obtained
from a patient, and the sample may be analyzed using the method. In
particular embodiments, the method may be employed to identify
and/or estimate the amount of mutant copies of a genomic locus that
are in a biological sample that contains both wild type copies of a
genomic locus and mutant copies of the genomic locus that have a
point mutation relative to the wild type copies of the genomic
locus. In this example, the sample may contain at least 100 times
(e.g., at least 1,000 times, at least 5,000 times, at least 10,000
times, at least 50,000 times or at least 100,000 times) more wild
type copies of the genomic locus than mutant copies said genomic
locus.
[0063] In these embodiments, the method may be employed to detect
an oncogenic mutation (which may be a somatic mutation) in, e.g.,
PIK3CA, NRAS, KRAS, JAK2, HRAS, FGFR3, FGFR1, EGFR, CDK4, BRAF,
RET, PGDFRA, KIT or ERBB2, which mutation may be associated with
breast cancer, melanoma, renal cancer, endometrial cancer, ovarian
cancer, pancreatic cancer, leukemia, colorectal cancer, prostate
cancer, mesothelioma, glioma, meullobastoma, polythemia, lymphoma,
sarcoma or multiple myeloma (see, e.g., Chial 2008 Proto-oncogenes
to oncogenes to cancer. Nature Education 1:1).
[0064] In these embodiments, the reaction mixture may contain a
first primer and a second primer wherein the first primer comprises
a 3' terminal nucleotide that base pairs with the point mutation.
The first primer may be employed as the invasive oligonucleotide in
the second set of cycles or, in certain cases, there may be a
separate invasive oligonucleotide present in the reaction mixture
that also has a 3' terminal nucleotide that base pairs with the
point mutation. Since the point mutation in the genomic locus may
have a direct association with cancer, e.g., colorectal cancer, the
subject method may be employed to diagnose patients with cancer,
alone, or in combination with other clinical techniques (e.g., a
physical examination such as a colonoscopy or immunohistochemical
analysis) or molecular techniques. For example, results obtained
from the subject assay may be combined with other information,
e.g., information regarding the methylation status of other loci,
information regarding in the same locus or at a different locus,
cytogenetic information, information regarding rearrangements, gene
expression information or information about the length of
telemerers, to provide an overall diagnosis of cancer or other
diseases.
[0065] In one embodiment, a sample may be collected from a patient
at a first location, e.g., in a clinical setting such as in a
hospital or at a doctor's office, and the sample may forwarded to a
second location, e.g., a laboratory where it is processed and the
above-described method is performed to generate a report. A
"report" as described herein, is an electronic or tangible document
which includes report elements that provide test results that may
include a Ct or Cp value or the like that indicates the presence of
mutant copies of the genomic locus in the sample. Once generated,
the report may be forwarded to another location (which may the same
location as the first location), where it may be interpreted by a
health professional (e.g., a clinician, a laboratory technician, or
a physician such as an oncologist, surgeon, pathologist), as part
of a clinical diagnosis.
[0066] Kits
[0067] Also provided are kits for practicing the subject method, as
described above. The components of the kit may be present in
separate containers, or multiple components may be present in a
single container.
[0068] In addition to above-mentioned components, the kit may
further include instructions for using the components of the kit to
practice the subject methods. The instructions for practicing the
subject methods are generally recorded on a suitable recording
medium. For example, the instructions may be printed on a
substrate, such as paper or plastic, etc. As such, the instructions
may be present in the kits as a package insert, in the labeling of
the container of the kit or components thereof (i.e., associated
with the packaging or subpackaging) etc. In other embodiments, the
instructions are present as an electronic storage data file present
on a suitable computer readable storage medium, e.g. CD-ROM,
diskette, etc. In yet other embodiments, the actual instructions
are not present in the kit, but means for obtaining the
instructions from a remote source, e.g. via the internet, are
provided. An example of this embodiment is a kit that includes a
web address where the instructions can be viewed and/or from which
the instructions can be downloaded. As with the instructions, this
means for obtaining the instructions is recorded on a suitable
substrate.
[0069] In addition to the instructions, the kits may also include
one or more control samples, e.g., positive or negative controls
analytes for use in testing the kit.
[0070] All publications and patent applications cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference. The
citation of any publication is for its disclosure prior to the
filing date and should not be construed as an admission that the
present invention is not entitled to antedate such publication by
virtue of prior invention.
[0071] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it is readily apparent to those of ordinary skill
in the art in light of the teachings of this invention that certain
changes and modifications may be made thereto without departing
from the spirit or scope of the appended claims.
Example 1
KRAS G35T Assay
[0072] The assay described below is designed to detect nucleic acid
sequences containing the KRAS G35T mutation in a background of wild
type sequences. For reference, partial nucleotide sequences for the
wild type and G35T mutant alleles of KRAS are shown below.
[0073] Partial sequence of amplification region for KRAS, wild type
(position 35 underlined):
TABLE-US-00001 (SEQ ID NO: 1)
ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAG
TGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATC
CAACAATAGAGGTAAATCTTGTTTTAATATGCATATTACTGG
[0074] Partial sequence of amplification region for KRAS, mutant
G35T (position 35 underlined):
TABLE-US-00002 (SEQ ID NO: 2)
ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGTTGGCGTAGGCAAGAG
TGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATC
CAACAATAGAGGTAAATCTTGTTTTAATATGCATATTACTGG
[0075] The ability to detect the KRAS mutation T at position 35 in
a background of wild type G at position 35 was tested using two
different thermocycling protocols, one of which uses single stage
cycling and the other uses two stage cycling (see Table 1). In both
protocols, at all dilutions, approximately 100,000 copies (i.e.,
100,000 double stranded plasmids) of the wild type sequence were
present. To the 100,000 copies of wild type, approximately 10,000,
1,000, 100, and 10 copies of the mutant target gene were added. A
sample containing 100,000 copies of the mutant sequence was used as
a control.
[0076] Table 1 summarizes the cycling conditions for the
cleavage-based assay for single stage thermocycling and two stage
thermocycling. Fluorescent signal acquisition occurs at the
53.degree. C. temperature, conducive to the cleavage reaction of
the flap probe from the target and the cleavage of the fluorophore
from the FRET cassette as mediated by the released flap.
TABLE-US-00003 TABLE 1 Single Stage Cycling Compared to 2-Stage
(Headstart) Protocol Fluo- Single 2-Stage rescent Stage:
(Headstart): Signal Temper- Number of Number of Acqui- Stage ature
Time Cycles Cycles sition Pre-incubation 95.degree. C. 2 min. 1 1
None (enzyme activation) Amplification 95.degree. C. 20 sec. NONE
10 None (Pre-Amp, 67.degree. C. 30 sec. None Headstart) 70.degree.
C. 30 sec. None Amplification 95.degree. C. 20 sec 50 45 None
53.degree. C. 1 min. Single 70.degree. C. 30 sec. None Cooling
(Hold) 40.degree. C. 30 sec. 1 1 None
[0077] Primers for the PCR amplification of the KRAS G35T mutation
were 5'-CTATTGT TGGATCATATTCGTC-3' (SEQ ID NO:3) as the reverse
primer and 5'-ACTTGTGGTAGT TGGAGCTCT-3' (SEQ ID NO:4) as the
forward primer. Note that in the forward primer, the 3'T base
(underlined) corresponds to the mutant position 35. The penultimate
C at position 34 is also a mismatch to both the mutant and wild
type sequence, and is designed to increase the discrimination of
the 3' base against the wild type target.
[0078] The homogeneous detection of the KRAS G35T mutation was
accomplished by the use of an endonuclease cleavable flap probe, a
cleavable FRET cassette, and a heat stable flap endonuclease. For
the detection of the G35T mutation, the flap probe sequence was
5'-GACGCGGAGTTGGCGTAGGCA-3'/3C6 (SEQ ID NO:5), where the mutant
base is shown underlined and the 3'-end is blocked with a
hexanediol group in order to inhibit extension. The cleaved flap
portion, which subsequently binds the FRET cassette, and in turn
releases the fluorophore away from its quencher, includes all of
the bases from the 5'-end to the mutation-specific T. Primers and
flap probes were supplied as non-catalog items by Integrated DNA
Technologies (IDT, Coralville, Iowa).
[0079] The FRET cassette used was
5'-FAM/TCT/Quencher/AGCCGGTTTTCCGGCT GAGACTCCGCGTCCGT-3'/3C6 (SEQ
ID NO:6), where FAM is fluorescein, the quencher is the
Eclipse.RTM. Dark Quencher, and the 3'-end is blocked with a
hexanediol group in order to inhibit primer extension. The FRET
cassette was supplied by Hologic (Madison, Wis.).
[0080] The PCR reactions were done in LightCycler.RTM. 480
Multiwell 96 Plates (Roche, Indianapolis) in 10 mM MOPS pH 7.5,
with 7.5 mM MgCl.sub.2, and 250 .mu.M dNTPs (Promega, Madison,
Wis.). Taq polymerase was the iTaq enzyme (BioRad, Hercules,
Calif.) and the cleavage enzyme was Cleavase 2.0 (Hologic, Madison,
Wis.). Forward primer concentration was 50 nM, reverse primer
concentration was 500 nM, flap probe was at 500 nM, and the FRET
cassette was used at a final concentration of 200 nM. All
amplification and detection was performed in the LightCycler 480
optical thermocycler (Roche, Indianapolis, Ind.).
[0081] Raw data and kinetic curves, as generated by the
LightCycler, for the two different cycling conditions, as
summarized in Table 1, are shown in FIGS. 2 and 3. The results,
showing the improved linear quantitative response of the 2-stage
cycling protocol are delineated in Table 2.
[0082] Table 2 shows the detection and quantitation of the KRAS
G35T mutation in the presence of the wild type sequence at levels,
as indicated, comparing two different cycling protocols. The point
at which the fluorescence of a sample rises above the background
fluorescence is called the "crossing point (Cp)" of the sample
(Roche LightCycler 480 Manual, Indianapolis, Ind.), and in these
assays is calculated as being the point at which fluorescence rose
to 18% of the maximum fluorescence. Cp levels above 40 cycles show
no detectable dose response.
TABLE-US-00004 TABLE 2 detection and quantitation of the KRAS G35T
mutation 2-Stage Wild Ratio of 1-Stage (Headstart) Mutant 35T Type
35G Mutant:Wild Crossing Point Crossing Point copies copies Type
(Cp) (Cp) 0 100000 N/A 44.56 40.33 0 100000 N/A 43.87 40.27 10
99990 1:10000 43.99 38.89 10 99990 1:10000 43.04 38.09 100 99900
1:1000 43.39 36.59 100 99900 1:1000 43.66 36.31 1000 99000 1:100
43.66 31.41 1000 99000 1:100 39.70 31.82 10000 90000 1:10 39.62
26.71 10000 90000 1:10 33.68 26.73 100000 0 N/A 27.72 20.62 100000
0 N/A 28.04 20.45
Sequence CWU 1
1
61142DNAArtificial Sequenceamplification region for KRAS
1atgactgaat ataaacttgt ggtagttgga gctggtggcg taggcaagag tgccttgacg
60atacagctaa ttcagaatca ttttgtggac gaatatgatc caacaataga ggtaaatctt
120gttttaatat gcatattact gg 1422142DNAArtificial
Sequenceamplification region for KRAS 2atgactgaat ataaacttgt
ggtagttgga gctgttggcg taggcaagag tgccttgacg 60atacagctaa ttcagaatca
ttttgtggac gaatatgatc caacaataga ggtaaatctt 120gttttaatat
gcatattact gg 142322DNAArtificial SequenceSynthetic reverse primer
3ctattgttgg atcatattcg tc 22421DNAArtificial SequenceSynthetic
forward primer 4acttgtggta gttggagctc t 21521DNAArtificial
SequenceSynthetic probe 5gacgcggagt tggcgtaggc a 21635DNAArtificial
SequenceSynthetic cleavable FRET cassette 6tctagccggt tttccggctg
agactccgcg tccgt 35
* * * * *