U.S. patent application number 15/046105 was filed with the patent office on 2016-08-11 for mice that produce antigen-binding proteins with ph-dependent binding characteristics.
The applicant listed for this patent is Regeneron Pharmaceuticals, Inc.. Invention is credited to Lynn MACDONALD, John MCWHIRTER, Andrew J. MURPHY.
Application Number | 20160229906 15/046105 |
Document ID | / |
Family ID | 48014364 |
Filed Date | 2016-08-11 |
United States Patent
Application |
20160229906 |
Kind Code |
A1 |
MCWHIRTER; John ; et
al. |
August 11, 2016 |
Mice That Produce Antigen-Binding Proteins With pH-Dependent
Binding Characteristics
Abstract
Genetically modified non-human animals are provided that
comprise an immunoglobulin heavy chain locus comprising an
unrearranged human heavy chain variable region nucleotide sequence
comprising an addition of at least one histidine codon or a
substitution of at least one endogenous non-histidine codon with a
histidine codon. Compositions and methods for making the
genetically modified non-human animals as described herein are
provided. Non-human animals capable of expressing an
antigen-binding protein characterized by pH-dependent antigen
binding, enhanced recyclability and/or enhanced serum half-life are
also provided.
Inventors: |
MCWHIRTER; John; (Tarrytown,
NY) ; MACDONALD; Lynn; (Harrison, NY) ;
MURPHY; Andrew J.; (Croton-on-Hudson, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Regeneron Pharmaceuticals, Inc. |
Tarrytown |
NY |
US |
|
|
Family ID: |
48014364 |
Appl. No.: |
15/046105 |
Filed: |
February 17, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13832309 |
Mar 15, 2013 |
9301510 |
|
|
15046105 |
|
|
|
|
61611950 |
Mar 16, 2012 |
|
|
|
61613352 |
Mar 20, 2012 |
|
|
|
61736930 |
Dec 13, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01K 2267/01 20130101;
A01K 2207/15 20130101; A01K 2217/072 20130101; A01K 2217/075
20130101; A01K 67/0275 20130101; C07K 2317/21 20130101; C07K
2317/52 20130101; A01K 2227/105 20130101; C07K 2317/14 20130101;
C12N 15/8509 20130101; A01K 2217/15 20130101; A01K 67/0278
20130101; C12P 21/005 20130101; C07K 2317/56 20130101; C07K 2317/24
20130101; C12N 2800/204 20130101; C07K 16/00 20130101; C07K
2317/565 20130101 |
International
Class: |
C07K 16/00 20060101
C07K016/00; C12N 15/85 20060101 C12N015/85; C12P 21/00 20060101
C12P021/00; A01K 67/027 20060101 A01K067/027 |
Claims
1. A method of producing a nucleic acid encoding a human
immunoglobulin heavy chain variable domain with at least one
histidine, comprising: obtaining from a lymphocyte of a non-human
animal, or a hybridoma produced from the lymphocyte, a nucleic acid
comprising a rearranged human immunoglobulin heavy chain variable
region gene sequence that encodes a human immunoglobulin heavy
chain variable domain, wherein the non-human animal comprises in
its germline genome an unrearranged human immunoglobulin heavy
chain variable region nucleotide sequence that comprises an
addition of at least one histidine codon or a substitution of at
least one non-histidine codon with a histidine codon, wherein the
added or substituted histidine codon is not encoded by a
corresponding human germline heavy chain variable region gene
segment, and wherein the added or substituted histidine codon is
present in a complementary determining region 3 (CDR3) encoding
sequence.
2. The method of claim 1, further comprising immunizing the
non-human animal with an antigen of interest, and allowing the
animal to mount an immune response to the antigen before obtaining
the nucleic acid.
3. The method of claim 2, wherein the human immunoglobulin heavy
chain variable domain specifically binds the antigen of
interest.
4. The method of claim 3, wherein the obtained rearranged human
immunoglobulin heavy chain variable region gene sequence comprises
at least one somatic hypermutation.
5. The method of claim 1, wherein the unrearranged human
immunoglobulin heavy chain variable region nucleotide sequence is
operably linked to an endogenous non-human immunoglobulin heavy
chain constant region gene sequence at an endogenous non-human
immunoglobulin heavy chain locus.
6. The method of claim 1, wherein the non-human animal further
comprises in its germline genome an unrearranged human
immunoglobulin light chain variable region nucleotide sequence
comprising unrearranged human V.sub.L and unrearranged human
J.sub.L gene segments; and wherein the lymphocyte, or hybridoma
produced therefrom, expresses a human immunoglobulin light chain
variable domain that is cognate to the human immunoglobulin heavy
chain variable domain.
7. The method of claim 1, wherein the unrearranged human
immunoglobulin heavy chain variable region nucleotide sequence
further comprises an addition of at least one histidine codon or a
substitution of at least one non-histidine codon with a histidine
codon in a CDR1 encoding sequence, a CDR2 encoding sequence, an N
terminal encoding sequence or a loop encoding sequence.
8. The method of claim 1, wherein the CDR3 encoding sequence is
selected from a human germline V.sub.H gene segment sequence, a
human germline D gene segment sequence, a human germline J.sub.H
gene segment sequence, and a combination thereof.
9. The method of claim 1, wherein the non-histidine codon that is
substituted with the histidine codon encodes the amino acid
selected from the group consisting of Y, N, D, Q, S, W, and R.
10. The method of claim 1, wherein the added or substituted
histidine codon is present in at least one reading frame of a human
D gene segment.
11. The method of claim 10, wherein the reading frame is a
hydrophilic frame of the human D gene segment, and the hydrophilic
frame comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of SEQ ID NO: 46, SEQ
ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO:
56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ
ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO:
74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ
ID NO: 84, SEQ ID NO: 86, and a combination thereof.
12. The method of claim 1, wherein the non-human animal is a rodent
selected from a rat, a mouse and a hamster.
13. The method of claim 1, wherein the lymphocyte is a B cell.
14. A nucleic acid comprising the rearranged human immunoglobulin
heavy chain variable region gene sequence produced by the method of
claim 1.
15. The nucleic acid of claim 14, wherein the nucleic acid further
comprises a human constant region gene sequence operably linked to
the rearranged human immunoglobulin heavy chain variable region
gene sequence.
16. The nucleic acid of claim 15, wherein the human heavy chain
constant region gene sequence comprises a modification that
increases an affinity of a C.sub.H2-C.sub.H3 region of an IgG heavy
chain constant region amino acid sequence to neonatal Fc receptor
(FcRn) at a pH ranging from about 5.5 to about 6.0, wherein the
modification is a mutation in the IgG heavy chain constant region
amino acid sequence selected from the group consisting of M428L,
N434S, V259I, V308F, N434A, M252Y, S254T, T256E, T250Q, H433K,
N434Y, and a combination thereof.
17. A cell comprising the nucleic acid of claim 14.
18. A method of obtaining a cell that expresses a human
immunoglobulin heavy chain variable domain with at least one
histidine comprising: isolating a lymphocyte from a non-human
animal that comprises in its germline genome an unrearranged human
immunoglobulin heavy chain variable region nucleotide sequence that
comprises an addition of at least one histidine codon or a
substitution of at least one non-histidine codon with a histidine
codon, wherein the added or substituted histidine codon is not
encoded by a corresponding human germline heavy chain variable
region gene segment, and wherein the added or substituted histidine
codon is present in a complementary determining region 3 (CDR3)
encoding sequence.
19. The method of claim 18, further comprising producing a
hybridoma from the isolated lymphocyte, wherein the hybridoma
expresses a human immunoglobulin heavy chain variable domain with
at least one histidine in the CDR3.
20. The method of claim 18, wherein the non-human animal further
comprises in its germline genome an unrearranged human
immunoglobulin light chain variable region nucleotide sequence
comprising unrearranged human V.sub.L and unrearranged human
J.sub.L gene segments; and wherein the lymphocyte expresses a human
immunoglobulin light chain variable domain that is cognate to the
human immunoglobulin heavy chain variable domain.
21. The method of claim 18, wherein the unrearranged human
immunoglobulin heavy chain variable region nucleotide sequence
further comprises an addition of at least one histidine codon or a
substitution of at least one non-histidine codon with a histidine
codon in a CDR1 encoding sequence, a CDR2 encoding sequence, an N
terminal encoding sequence or a loop encoding sequence
22. The method of claim 18, wherein the CDR3 encoding sequence is
selected from a human germline V.sub.H gene segment sequence, a
human germline D gene segment sequence, a human germline J.sub.H
gene segment sequence, and a combination thereof.
23. A cell obtained according to the method of claim 18.
24. An in vitro method of making a human immunoglobulin heavy chain
variable domain comprising: expressing in a cell the nucleic acid
of claim 14.
25. The method of claim 24, wherein the nucleic acid further
comprises a human immunoglobulin heavy chain constant region gene
sequence operably linked to the rearranged human immunoglobulin
heavy chain variable region gene sequence.
26. The method of claim 25, wherein the human immunoglobulin heavy
chain constant region gene sequence comprises a modification that
increases an affinity of a C.sub.H2-C.sub.H3 region of an IgG heavy
chain constant region amino acid sequence to neonatal Fc receptor
(FcRn) at a pH ranging from about 5.5 to about 6.0, wherein the
modification is a mutation in the IgG heavy chain constant region
amino acid sequence selected from the group consisting of M428L,
N434S, V259I, V308F, N434A, M252Y, S254T, T256E, T250Q, H433K,
N434Y, and a combination thereof.
27. The method of claim 24, further comprising co-expressing in the
cell a nucleotide sequence encoding a human immunoglobulin light
chain variable domain.
28. A human immunoglobulin heavy chain variable domain made
according to the method of claim 24.
29. A genetically modified immunoglobulin heavy chain locus in a
germline of a non-human animal comprising an unrearranged human
heavy chain variable region nucleotide sequence, wherein the
unrearranged human heavy chain variable region nucleotide sequence
comprises an addition of at least one histidine codon or a
substitution of at least one endogenous non-histidine codon with a
histidine codon.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 13/832,309, filed 15, Mar. 2013, entitled
"Mice That Produce Antigen-Binding Proteins With pH-Dependent
Binding Characteristics," which claims the benefit of priority to
U.S. Provisional Application No. 61/611,950, filed 16, Mar. 2012,
U.S. Provisional Application No. 61/613,352, filed Mar. 20, 2012,
and U.S. Provisional Application No. 61/736,930, filed 13, Dec.
2012, the entire contents of each of the applications are
incorporated herein by reference.
FIELD OF THE INVENTION
[0002] Genetically modified immunoglobulin loci of non-human
animals comprising an unrearranged human heavy chain variable
region nucleotide sequence, wherein the unrearranged human heavy
chain variable region nucleotide sequence comprises an addition of
least one histidine codon or a substitution of at least one
non-histidine codon with a histidine codon. Non-human animals,
including rodents, e.g., mice and rats, comprising in their
germline an unrearranged human immunoglobulin heavy chain variable
region nucleotide sequence, wherein the unrearranged human
immunoglobulin heavy chain variable region nucleotide sequence
comprises an addition of least one histidine codon or a
substitution of at least one non-histidine codon with a histidine
codon. Genetically engineered non-human animals capable of
expressing an antigen-binding protein that is characterized by
pH-dependent antigen binding, improved recyclability, and/or
enhanced serum half-life.
BACKGROUND OF THE INVENTION
[0003] Drugs administered into the body, including therapeutic
monoclonal antibodies, can be affected via various elimination
mechanisms, including glomerular filtration (e.g., into urine),
secretion (e.g., into the bile), and catabolism by cells. While
small molecules are cleared from the body via renal filtration, the
majority of secreted antibodies (e.g., IgG, which are too big to be
filtered through glomeruli) are primarily removed from the body via
cell-mediated catabolism, e.g., fluid-phase endocytosis
(phagocytosis) or receptor-mediated endocytosis. For example,
soluble molecules with several repeated epitopes are bound by a
plurality of circulating antibodies, and the resulting large
antigen-antibody complexes are phagocytosed rapidly into cells for
degradation. On the other hand, cell surface target receptors,
which are bound by antibodies (i.e., receptor-antibody complexes),
undergo target-mediated endocytosis in a dose-dependent manner,
which leads to formation of endosomes destined for lysosomal
degradation inside cells. In some cases, the endocytosed
receptor-antibody complexes bind neonatal Fc receptors (FcRn)
inside the endosomes in a pH-dependent manner and are routed back
to the cell surface for release into plasma or interstitial fluids
upon exposure to a neutral extracellular pH (e.g., pH 7.0-7.4).
[0004] There is a need in the art for systems, e.g., non-human
animals, cells, and genomic loci that generate antigen-binding
proteins with titratable residues, e.g., genetically modified loci
that rearrange immunoglobulin gene segments to generate heavy chain
variable domains that respond to changes in pH, e.g., that donate
or accept protons and, e.g., whose binding characteristics differ
according to protonation state.
[0005] There is also a need in the art for methods and compositions
that can further increase recycling efficiency of endocytosed
antigen-binding proteins by promoting dissociation of
antigen-binding proteins from receptor-antigen-binding protein
complexes or by increasing the affinity of antigen-binding proteins
toward FcRn in an acidic endosomal compartment without compromising
the specificity and affinity of the antigen-binding protein toward
an antigen of interest.
SUMMARY OF THE INVENTION
[0006] Genetically modified immunoglobulin heavy chain loci in the
germline genome of non-human animals are provided, wherein the
immunoglobulin heavy chain loci comprise a genetically modified
unrearranged heavy chain variable region nucleotide sequence (e.g.,
one or more genetically modified human V.sub.H, D, and/or J.sub.H
gene segment), wherein the unrearranged heavy chain variable region
nucleotide sequence comprises an addition of at least one histidine
codon or a substitution of at least one endogenous non-histidine
codon with a histidine codon. In various embodiments, the
genetically modified unrearranged heavy chain variable region
nucleotide sequence comprises at least one histidine codon in at
least one reading frame that encodes an immunoglobulin heavy chain
variable domain. In various embodiments, the unrearranged heavy
chain variable region nucleotide sequence comprising the at least
one histidine codon is operably linked to a human or non-human
heavy chain constant region nucleotide sequence (e.g., a heavy
chain constant region nucleotide sequence that encodes an
immunoglobulin isotype selected from IgM, IgD, IgA, IgE, and
IgG).
[0007] Non-human animals (mammals, e.g., rodents such as mice,
rats, or hamsters) are provided that are genetically engineered to
contain immunoglobulin heavy chain genomic loci in their germline
genome, wherein the genomic loci comprise an unrearranged heavy
chain variable region nucleotide sequence (e.g., one or more
genetically modified human V.sub.H, D, and/or J.sub.H gene
segments), wherein the unrearranged heavy chain variable region
nucleotide sequence comprises an addition of at least one histidine
codon or a substitution of at least one endogenous non-histidine
codon with a histidine codon. In various embodiments, the genome of
the non-human animals comprises a modification (i) that deletes or
renders nonfunctional all, or substantially all, endogenous
immunoglobulin V.sub.H, D, and/or J.sub.H gene segments (e.g., via
insertion of a nucleotide sequence, e.g., an exogenous nucleotide
sequence, in the immunoglobulin locus or via non-functional
rearrangement or inversion of endogenous V.sub.H, D, and/or J.sub.H
gene segments); and (ii) that introduces an unrearranged human
heavy chain variable region nucleotide sequence (e.g., genetically
modified human V.sub.H, D, or J.sub.H gene segments), wherein the
unrearranged heavy chain variable region nucleotide sequence
comprises an addition of at least one histidine codon or a
substitution of at least one endogenous non-histidine codon with a
histidine codon. In various embodiments, the unrearranged heavy
chain variable region nucleotide sequence is present at an
endogenous locus (i.e., where the unrearranged heavy chain variable
region nucleotide sequence is located in a wild-type non-human
animal) or present ectopically (e.g., at a locus different from the
endogenous immunoglobulin heavy chain locus in its genome), or
within its endogenous locus (e.g., within an immunoglobulin
variable locus, wherein the endogenous locus is placed or moved to
a different location in the genome). In various embodiments, the
immunoglobulin heavy chain variable region nucleotide sequence is
operably linked to a human or non-human heavy chain constant region
nucleotide sequence (e.g., a heavy chain constant region nucleotide
sequence that encodes an immunoglobulin isotype selected from IgM,
IgD, IgA, IgE, and IgG).
[0008] Genetically modified non-human animals are provided that are
capable of expressing a genetically modified immunoglobulin heavy
variable domain comprising one or more histidines, wherein the one
or more histidines are not encoded by a germline gene segment of a
corresponding wild-type non-human animal.
[0009] Genetically modified non-human animals are provided that
comprise a B cell population that is characterized by rearranged
immunoglobulin heavy chain variable genes that encode an
immunoglobulin heavy chain variable domain with one or more
histidines that are not encoded by a germline gene segment of a
corresponding wild-type non-human animal.
[0010] Methods and compositions are provided for making non-human
animals that comprise a genetically modified immunoglobulin heavy
chain variable locus comprising an unrearranged human heavy chain
variable region nucleotide sequence containing one or more
histidine codons in at least one reading frame that encodes a heavy
chain variable domain.
[0011] Methods and compositions are provided for non-human animals
that make antigen-binding proteins that exhibit a pH-dependent
binding of an antigen. Methods and compositions are provided for
making non-human animals that have B cell populations, or antibody
populations, that are enriched (as compared with corresponding
wild-type animals) with antigen-binding proteins that are
pH-dependent, e.g., in particular, heavy chain variable domains,
and/or antigen-binding fragments thereof.
[0012] In one aspect, a genetically modified immunoglobulin locus
in a germline genome of a non-human animal is provided comprising
an unrearranged human heavy chain variable region nucleotide
sequence, wherein the unrearranged heavy chain variable region
nucleotide sequence comprises an addition of least one histidine
codon or a substitution of at least one endogenous non-histidine
codon with a histidine codon.
[0013] In one embodiment, the non-human animal is a mammal,
including a rodent, e.g., a mouse, a rat, or a hamster.
[0014] In one embodiment, the added or substituted histidine codon
is present in an immunoglobulin heavy chain gene segment selected
from a human V.sub.H gene segment, a human D gene segment, a human
J.sub.H gene segment, and a combination thereof. In one embodiment,
the immunoglobulin heavy chain gene segment is selected from a
human germline V.sub.H gene segment, a human germline D gene
segment, a human germline J.sub.H gene segment, and a combination
thereof.
[0015] In one embodiment, the human V gene segment (V.sub.H) is
selected from the group consisting of V.sub.H1-2, V.sub.H1-3,
V.sub.H1-8, V.sub.H1-18, V.sub.H1-24, V.sub.H1-45, V.sub.H1-46,
V.sub.H1-58, V.sub.H1-69, V.sub.H2-5, V.sub.H2-26, V.sub.H2-70,
V.sub.H3-7, V.sub.H3-9, V.sub.H3-11, V.sub.H3-13, V.sub.H3-15,
V.sub.H3-16, V.sub.H3-20, V.sub.H3-21, V.sub.H3-23, V.sub.H3-30,
V.sub.H3-30-3, V.sub.H 3-30-5, V.sub.H3-33, V.sub.H3-35,
V.sub.H3-38, V.sub.H3-43, V.sub.H3-48, V.sub.H3-49, V.sub.H3-53,
V.sub.H3-64, V.sub.H3-66, V.sub.H3-72, V.sub.H3-73, V.sub.H3-74,
V.sub.H4-4, V.sub.H4-28, V.sub.H4-30-1, V.sub.H4-30-2,
V.sub.H4-30-4, V.sub.H4-31, V.sub.H4-34, V.sub.H4-39, V.sub.H4-59,
V.sub.H4-61, V.sub.H5-51, V.sub.H6-1, V.sub.H7-4-1, V.sub.H7-81,
and a combination thereof.
[0016] In one embodiment, the human D gene segment is selected from
the group consisting of D1-1, D1-7, D1-14, D1-20, D1-26, D2-2,
D2-8, D2-15, D2-21, D3-3, D3-9, D3-10, D3-16, D3-22, D4-4, D4-11,
D4-17, D4-23, D5-12, D5-5, D5-18, D5-24, D6-6, D6-13, D6-19, D6-25,
D7-27, and a combination thereof.
[0017] In one embodiment, the human J gene segment is selected from
the group consisting of J.sub.H1, J.sub.H2, J.sub.H3, J.sub.H4,
J.sub.H5, J.sub.H6, and a combination thereof.
[0018] In one embodiment, the added or substituted histidine codon
is present in the unrearranged heavy chain variable region
nucleotide sequence that encodes an N-terminal region, a loop 4
region, a CDR1, a CDR2, a CDR3, or a combination thereof.
[0019] In one embodiment, the unrearranged heavy chain variable
region nucleotide sequence comprises 2 or more, 3 or more, 4 or
more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or
more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more,
16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or
more, 22 or more, 23 or more, 24 or more, or 25 or more, 26 or
more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more,
32 or more, 33 or more, 34 or more 35 or more, 36 or more, 37 or
more, 38 or more, 39 or more, 40 or more, 41 or more, 42 or more,
43 or more, 44 or more, 45 or more, 46 or more, 47 or more, 48 or
more, 49 or more, 50 or more, 51 or more, 52 or more, 53 or more,
54 or more, 55 or more, 56 or more, 57 or more, 58 or more, 59 or
more, 60 or more, or 61 or more of histidine codons.
[0020] In one embodiment, the unrearranged heavy chain variable
region nucleotide sequence is operably linked to a human or
non-human heavy chain constant region nucleotide sequence that
encodes an immunoglobulin isotype selected from IgM, IgD, IgG, IgE,
and IgA.
[0021] In one embodiment, the human unrearranged immunoglobulin
heavy chain variable region nucleotide sequence is operably linked
to a human or non-human heavy chain constant region nucleotide
sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3,
and a combination thereof. In one embodiment, the heavy chain
constant region nucleotide sequence comprises a C.sub.H1, a hinge,
a C.sub.H2, and a C.sub.H3 (i.e.,
C.sub.H1-hinge-C.sub.H2-C.sub.H3).
[0022] In one embodiment, a heavy chain constant region nucleotide
sequence is present at an endogenous locus (i.e., where the
nucleotide sequence is located in a wild-type non-human animal) or
present ectopically (e.g., at a locus different from the endogenous
immunoglobulin chain locus in its genome, or within its endogenous
locus, e.g., within an immunoglobulin variable locus, wherein the
endogenous locus is placed or moved to a different location in the
genome).
[0023] In one embodiment, the heavy chain constant region
nucleotide sequence comprises a modification in a C.sub.H2 or a
C.sub.H3, wherein the modification increases the affinity of the
heavy chain constant region amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0024] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a modification at position 250
(e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or
T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a
modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K)
and/or 434 (e.g., H/F or Y); or a modification at position 250
and/or 428; or a modification at position 307 or 308 (e.g., 308F,
V308F), and 434. In one embodiment, the modification comprises a
428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L,
259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K
(e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and
256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L
modification (e.g., T250Q and M428L); and a 307 and/or 308
modification (e.g., 308F or 308P), wherein the modification
increases the affinity of the heavy chain constant region amino
acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0025] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 252 and 257, wherein the modification increases the
affinity of the human C.sub.H2 amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0026] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 307 and 311, wherein the modification increases the
affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic
environment (e.g., in an endosome where pH ranges from about 5.5 to
about 6.0).
[0027] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H3 amino acid sequence,
wherein the C.sub.H3 amino acid sequence comprises at least one
modification between amino acid residues at positions 433 and 436,
wherein the modification increases the affinity of the C.sub.H3
amino acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0028] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, N434S, and a combination thereof.
[0029] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, V259I, V308F, and a combination thereof.
[0030] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising an N434A mutation.
[0031] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M252Y, S254T, T256E, and a combination thereof.
[0032] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of T250Q, M248L, or both.
[0033] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of H433K, N434Y, or both.
[0034] In one embodiment, the genetically modified immunoglobulin
locus comprises: (1) a first allele, wherein the unrearranged human
immunoglobulin heavy chain variable region nucleotide sequence as
described herein is operably linked to a first heavy chain constant
region nucleotide sequence encoding a first CH.sub.3 amino acid
sequence of a human IgG selected from IgG1, IgG2, IgG4, and a
combination thereof; and (2) a second allele, wherein the
unrearranged human immunoglobulin heavy chain variable region
nucleotide sequence as described herein is operably linked to a
second heavy chain constant region nucleotide sequence encoding a
second C.sub.H3 amino acid sequence of the human IgG selected from
IgG1, IgG2, IgG4, and a combination thereof, and wherein the second
CH.sub.3 amino acid sequence comprises a modification that reduces
or eliminates binding for the second CH.sub.3 amino acid sequence
to Protein A (see, for example, US 2010/0331527A1, which is
incorporated by reference herein in its entirety).
[0035] In one embodiment, the second CH.sub.3 amino acid sequence
comprises an H95R modification (by IMGT exon numbering; H435R by EU
numbering). In one embodiment the second CH.sub.3 amino acid
sequence further comprises an Y96F modification (by IMGT exon
numbering; H436F by EU). In another embodiment, the second CH.sub.3
amino acid sequence comprises both an H95R modification (by IMGT
exon numbering; H435R by EU numbering) and an Y96F modification (by
IMGT exon numbering; H436F by EU).
[0036] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG1 and further comprises a mutation
selected from the group consisting of D16E, L18M, N44S, K52N, V57M,
and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by
EU).
[0037] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG2 and further comprises a mutation
selected from the group consisting of N44S, K52N, and V82I (IMGT:
N384S, K392N, and V422I by EU).
[0038] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG4 and further comprises a mutation
selected from the group consisting of Q15R, N44S, K52N, V57M, R69K,
E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and
V422I by EU).
[0039] In one embodiment, the heavy chain constant region amino
acid sequence is a non-human constant region amino acid sequence,
and the heavy chain constant region amino acid sequence comprises
one or more of any of the types of modifications described
above.
[0040] In one embodiment, all or substantially all endogenous
V.sub.H, D, and J.sub.H gene segments are deleted from an
immunoglobulin heavy chain locus or rendered non-functional (e.g.,
via insertion of a nucleotide sequence (e.g., an exogenous
nucleotide sequence) in the immunoglobulin locus or via
non-functional rearrangement, or inversion, of the endogenous
V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80%
or more, about 85% or more, about 90% or more, about 95% or more,
about 96% or more, about 97% or more, about 98% or more, or about
99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments
are deleted or rendered non-functional. In one embodiment, e.g., at
least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or
J gene segments are deleted or rendered non-functional.
[0041] In one embodiment, the genetically modified immunoglobulin
heavy chain locus comprises a modification that deletes or renders
non-functional all, or substantially all, endogenous V.sub.H, D,
and J.sub.H gene segments; and the genetically modified locus
comprises an unrearranged heavy chain variable region nucleotide
sequence comprising one or more human V.sub.H, D, and/or J.sub.H
gene segments having one or more histidine codons, wherein the
unrearranged heavy chain variable region nucleotide sequence is
present at an endogenous location (i.e., where the nucleotide
sequence is located in a wild-type non-human animal) or present
ectopically (e.g., at a locus different from the endogenous
immunoglobulin chain locus in its genome), or within its endogenous
locus (e.g., within an immunoglobulin variable locus, wherein the
endogenous locus is placed or moved to a different location in the
genome).
[0042] In one embodiment, the genetically modified immunoglobulin
locus comprises an endogenous Adam6a gene, Adam6b gene, or both,
and the genetic modification does not affect the expression and/or
function of the endogenous Adam6a gene, Adam6b gene, or both.
[0043] In one embodiment, the genetically modified immunoglobulin
locus comprises an ectopically present Adam6a gene, Adam6b gene, or
both. In one embodiment, the Adam6a gene is a non-human Adam6a
gene. In one embodiment, the Adam6a gene is a human Adam6a gene. In
one embodiment, the Adam6b gene is a non-human Adam6b gene. In one
embodiment, the Adam6b gene is a human Adam6b gene.
[0044] In one embodiment, the genetically modified immunoglobulin
locus further comprises a humanized, unrearranged .lamda. and/or
.kappa. light chain variable gene sequence. In one embodiment, the
humanized, unrearranged .lamda. and/or .kappa. light chain variable
gene sequence is operably linked to an immunoglobulin light chain
constant region nucleotide sequence selected from a .lamda. light
chain constant region nucleotide sequence and a .kappa. light chain
constant region nucleotide sequence. In one embodiment, the
humanized, unrearranged .lamda. light chain variable region
nucleotide sequence is operably linked to a .lamda. light chain
constant region nucleotide sequence. In one embodiment, the .lamda.
light chain constant region nucleotide sequence is a mouse, rat, or
human sequence. In one embodiment, the humanized, unrearranged
.kappa. light chain variable region nucleotide sequence is operably
linked to a .kappa. light chain constant region nucleotide
sequence. In one embodiment, the .kappa. light chain constant
region nucleotide sequence is a mouse, rat, or human sequence.
[0045] In one embodiment, the genetically modified immunoglobulin
locus comprises an unrearranged light chain variable gene sequence
that contains at least one modification that introduces at least
one histidine codon in at least one reading frame encoding a light
chain variable domain. In one embodiment, the genetically modified
immunoglobulin locus comprises a rearranged (e.g., rearranged
.lamda. or .kappa. V/J sequence) sequence that comprises one, two,
three, or four codons for histidine in a light chain CDR. In one
embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a
combination thereof. In one embodiment, the unrearranged or
rearranged light chain variable region nucleotide sequence is an
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence. In one embodiment, the
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence is present at an endogenous
mouse immunoglobulin light chain locus. In one embodiment, the
mouse immunoglobulin light chain locus is a mouse .kappa. locus. In
one embodiment, the mouse immunoglobulin light chain locus is a
mouse .lamda. locus.
[0046] In one embodiment, the genetically modified immunoglobulin
locus as described herein is present in an immunoglobulin heavy
chain locus of a mouse. In one embodiment, the genetically modified
immunoglobulin locus is present in a humanized immunoglobulin heavy
chain locus in a VELOCIMMUNE.RTM. mouse.
[0047] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein exhibits a
weaker antigen binding at an acidic environment (e.g., at a pH of
about 5.5 to about 6.0) than a corresponding wild-type heavy chain
variable domain without the genetic modification.
[0048] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin locus as described herein has at least about 2-fold,
at least about 3-fold, at least about 4-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold, at least about 25-fold, or at least about 30-fold
decrease in dissociative half-life (t.sub.1/2) at an acidic pH
(e.g., pH of about 5.5 to about 6.0) as compared to the
dissociative half-life (t.sub.1/2) of the antigen-binding protein
at a neutral pH (e.g., pH of about 7.0 to about 7.4).
[0049] In one embodiment, the genetically modified immunoglobulin
locus described herein comprises a B cell population that, upon
stimulation with an antigen of interest, is capable of producing
antigen-binding proteins, e.g., antibodies, comprising a heavy
chain variable domain with one or more histidine residues. The
antigen-binding proteins as described herein, when administered
into a subject, exhibits an increased serum half-life over a
corresponding wild-type antigen-binding protein, which possesses a
similar or sufficiently similar amino acid sequence that encodes
the heavy chain variable domain but does not comprise a histidine
residue in the heavy chain variable domain. In some embodiments,
the antigen-binding protein described herein exhibits an increased
serum half-life that is at least about 2-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold higher than the corresponding wild-type
antigen-binding protein, which possesses a similar or sufficiently
similar amino acid sequence that encodes the heavy chain variable
domain but does not comprise a histidine residue in the heavy chain
variable domain.
[0050] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin locus as described herein is characterized by
improved pH-dependent recyclability, enhanced serum half-life, or
both as compared with a wild-type antigen-binding protein without
the genetic modification as described herein.
[0051] In one aspect, a genetically modified immunoglobulin locus
in a germline genome of a non-human animal is provided comprising
an unrearranged human heavy chain variable region nucleotide
sequence, wherein the human unrearranged heavy chain variable
region nucleotide sequence comprises a substitution of at least one
endogenous non-histidine codon with a histidine codon.
[0052] In one embodiment, the non-human animal is a mammal,
including a rodent, e.g., a mouse, a rat, or a hamster.
[0053] In one embodiment, 2 or more, 3 or more, 4 or more, 5 or
more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or
more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more,
17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or
more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more,
28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or
more, 34 or more, 35 or more, 36 or more, 37 or more, 38 or more,
39 or more, 40 or more, 41 or more, 42 or more, 43 or more, 44 or
more, 45 or more, 46 or more, 47 or more, 48 or more, 49 or more,
50 or more, 51 or more, 52 or more, 53 or more, 54 or more, 55 or
more, 56 or more, 57 or more, 58 or more, 59 or more, 60 or more,
or 61 or more of the endogenous non-histidine codons are replaced
with histidine codons.
[0054] In one embodiment, the endogenous non-histone codon encodes
the amino acid selected from Y, N, D, Q, S, W, and R.
[0055] In one embodiment, the substituted histidine codon is
present in an unrearranged heavy chain variable region nucleotide
sequence that encodes an immunoglobulin variable domain selected
from an N-terminal region, a loop 4 region, a CDR1, a CDR2, a CDR3,
a combination thereof.
[0056] In one embodiment, the substituted histidine codon is
present in an unrearranged heavy chain variable region nucleotide
sequence that encodes a complementary determining region (CDR)
selected from a CDR1, a CDR2, a CDR3, and a combination
thereof.
[0057] In one embodiment, the substituted histidine codon is
present in an unrearranged heavy chain variable region nucleotide
sequence that encodes a frame region (FR) selected from FR1, FR2,
FR3, FR4, and a combination thereof.
[0058] In one embodiment, the unrearranged heavy chain variable
region nucleotide sequence comprises a genetically modified human
V.sub.H gene segment, wherein one or more endogenous non-histidine
codon in at least one reading frame of the human V.sub.H gene
segment has been replaced with a histidine codon.
[0059] In one embodiment, the human unrearranged heavy chain
variable region nucleotide sequence comprises a modification that
replaces at least one endogenous non-histidine codon of a human
V.sub.H gene segment with a histidine codon, wherein the human
V.sub.H gene segment is selected from the group consisting of
V.sub.H1-2, V.sub.H1-3, V.sub.H1-8, V.sub.H1-18, V.sub.H1-24,
V.sub.H1-45, V.sub.H1-46, V.sub.H1-58, V.sub.H1-69, V.sub.H2-5,
V.sub.H2-26, V.sub.H2-70, V.sub.H3-7, V.sub.H3-9, V.sub.H3-11,
V.sub.H3-13, V.sub.H3-15, V.sub.H3-16, V.sub.H3-20, V.sub.H3-21,
V.sub.H3-23, V.sub.H3-30, V.sub.H3-30-3, V.sub.H 3-30-5,
V.sub.H3-33, V.sub.H3-35, V.sub.H3-38, V.sub.H3-43, V.sub.H3-48,
V.sub.H3-49, V.sub.H3-53, V.sub.H3-64, V.sub.H3-66, V.sub.H3-72,
V.sub.H3-73, V.sub.H3-74, V.sub.H4-4, V.sub.H4-28, V.sub.H4-30-1,
V.sub.H4-30-2, V.sub.H4-30-4, V.sub.H4-31, V.sub.H4-34,
V.sub.H4-39, V.sub.H4-59, V.sub.H4-61, V.sub.H5-51, V.sub.H6-1,
V.sub.H7-4-1, V.sub.H7-81, and a combination thereof.
[0060] In one embodiment, the human unrearranged heavy chain
variable region nucleotide sequence comprises a genetically
modified human J.sub.H gene segment, wherein one or more endogenous
non-histidine codon in at least one reading frame of the human
J.sub.H gene segment has been replaced with a histidine codon.
[0061] In one embodiment, the human unrearranged heavy chain
variable region nucleotide sequence comprises a modification that
replaces at least one endogenous non-histidine codon of a human
J.sub.H segment with a histidine codon, wherein the human J.sub.H
gene segment is selected from the group consisting of J.sub.H1,
J.sub.H2, 43, 44, J.sub.HS, J.sub.H6, and a combination
thereof.
[0062] In one embodiment, the substituted histidine codon is
present in a heavy chain variable region nucleotide sequence that
encodes part of a CDR3. In one embodiment, the part of CDR3
comprises an amino acid sequence derived from a reading frame of a
genetically modified human D gene segment comprising a modification
that replaces at least one endogenous non-histidine codon in the
reading frame with a histidine codon.
[0063] In one embodiment, the endogenous non-histidine codon that
is substituted with a histidine codon encodes the amino acid
selected from Y, N, D, Q, S, W, and R.
[0064] In one embodiment, the substituted histidine codon is
present in at least one reading frame of the human D gene segment
that is most frequently observed in VELOCIMMUNE.RTM. humanized
immunoglobulin mice.
[0065] In one embodiment, the reading frame of the genetically
modified human D gene segment that encodes part of CDR3 is selected
from a hydrophobic frame, a stop frame, and a hydrophilic
frame.
[0066] In one embodiment, the reading frame is a hydrophobic frame
of a human D gene segment.
[0067] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D1-1 (GTTGT; SEQ ID
NO: 88), D1-7 (GITGT; SEQ ID NO: 89), D1-20 (GITGT; SEQ ID NO: 89),
and D1-26 (GIVGAT; SEQ ID NO: 90), and the human D gene segment
further comprises a modification that replaces at least one
endogenous non-histidine codon in the nucleotide sequence with a
histidine codon.
[0068] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D2-2 (DIVVVPAAI; SEQ
ID NO: 92), D2-8 (DIVLMVYAI; SEQ ID NO: 94), D2-15 (DIVVVVAAT; SEQ
ID NO: 95), and D2-21 (HIVVVTAI; SEQ ID NO: 97), and the human D
gene segment further comprises a modification that replaces at
least one endogenous non-histidine codon in the nucleotide sequence
with a histidine codon.
[0069] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D3-3 (ITIFGVVII; SEQ
ID NO: 98), D3-9 (ITIF*LVII; SEQ ID NO: 99, SEQ ID NO:100), D3-10
(ITMVRGVII; SEQ ID NO:101), D3-16 (IMITFGGVIVI; SEQ ID NO:102), and
D3-22 (ITMIVVVIT; SEQ ID NO:103), and the human D gene segment
further comprises a modification that replaces at least one
endogenous codon in the nucleotide sequence with a histidine
codon.
[0070] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D4-4 (TTVT; SEQ ID
NO: 105), D4-11 (TTVT; SEQ ID NO:105), D4-17 (TTVT; SEQ ID NO:105),
D4-23 (TTVVT; SEQ ID NO: 106) and the human D gene segment further
comprises a modification that replaces at least one endogenous
non-histidine codon in the nucleotide sequence with a histidine
codon.
[0071] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D5-5 (VDTAMV; SEQ ID
NO: 107), D5-12 (VDIVATI; SEQ ID NO: 108), D5-18 (VDTAMV; SEQ ID
NO:107), and D5-24 (VEMATI; SEQ ID NO:109), and the human D gene
segment further comprises a modification that replaces at least one
endogenous non-histidine codon in the nucleotide sequence with a
histidine codon.
[0072] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D6-6 (SIAAR; SEQ ID
NO: 111), D6-13 (GIAAAG; SEQ ID NO: 113), and D6-19 (GIAVAG; SEQ ID
NO:115), and the human D gene segment further comprises a
modification that replaces at least one endogenous non-histidine
codon in the nucleotide sequence with a histidine codon.
[0073] In one embodiment, the hydrophobic frame comprises a
nucleotide sequence that encodes human D7-27 (LTG), and the human D
gene segment further comprises a modification that replaces at
least one endogenous non-histidine codon in the nucleotide sequence
with a histidine codon.
[0074] In one embodiment, the reading frame is a stop reading frame
of a human D gene segment.
[0075] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D1-1 (VQLER;
SEQ ID NO:8), D1-7(V*LEL), D1-20(V*LER), D1-26 (V*WELL; SEQ ID NO:
12), and the human D gene segment further comprises a modification
that replaces at least one endogenous non-histidine codon in the
nucleotide sequence with a histidine codon.
[0076] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D2-2
(RIL**YQLLY; SEQ ID NO:14), D2-8 (RILY*WCMLY; SEQ ID NO:16 and SEQ
ID NO: 17), D2-15 (RIL*WW*LLL), and D2-21 (SILWW*LLF; SEQ ID
NO:19), and the human D gene segment further comprises a
modification that replaces at least one endogenous non-histidine
codon in the nucleotide sequence with a histidine codon.
[0077] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D3-3
(VLRFLEWLLY; SEQ ID NO:21), D3-9 (VLRYFDWLL*; SEQ ID NO:23), D3-10
(VLLWFGELL*; SEQ ID NO:25), D3-16 (VL*LRLGELSLY; SEQ ID NO:27), and
D3-22 (VLL***WLLL; SEQ ID NO:29), and the human D gene segment
comprises a modification that replaces at least one endogenous
non-histidine codon in the nucleotide sequence with a histidine
codon.
[0078] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D4-4 (*LQ*L),
D4-11 (*LQ*L), D4-17 (*LR*L), and D4-23 (*LRW*L), and the human D
gene segment comprises a modification that replaces at least one
endogenous non-histidine codon in the nucleotide sequence with a
histidine codon.
[0079] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D5-5 (WIQLWL;
SEQ ID NO:35); D5-12 (Wl*WLRL; SEQ ID NO:37), D5-18 (WIQLWL; SEQ ID
NO:35), and D5-24 (*RWLQL; SEQ ID NO:39), and the human D gene
segment comprises a modification that replaces at least one
endogenous non-histidine codon in the nucleotide sequence with a
histidine codon.
[0080] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D6-6 (V*QLV),
D6-13 (V*QQLV; SEQ ID NO:41), and D6-19 (V*QWLV; SEQ ID NO:43), and
the human D gene segment further comprises a modification that
replaces at least one endogenous non-histidine codon in the
nucleotide sequence with a histidine codon.
[0081] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes D7-27
(*LG), and the human D gene segment further comprises a
modification that replaces at least one endogenous codon of the
human D gene segment in the nucleotide sequence with a histidine
codon.
[0082] In one embodiment, the reading frame is a hydrophilic frame
of a human D gene segment.
[0083] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D1-1 (YNWND; SEQ ID
NO: 45), D1-7 (YNWNY; SEQ ID NO: 47), D1-20 (YNWND; SEQ ID NO: 45),
and D1-26 (YSGSYY; SEQ ID NO:49), and the human D gene segment
further comprises a modification that replaces at least one
endogenous codon in the nucleotide sequence with a histidine codon.
In one embodiment, the hydrophilic frame comprises a nucleotide
sequence that encodes the amino acid sequence selected from the
group consisting of SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50,
and a combination thereof.
[0084] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D2-2 (GYCSSTSCYT;
SEQ ID NO:51), D2-8 (GYCTNGVCYT; SEQ ID NO: 53), D2-15 (GYCSGGSCYS;
SEQ ID NO:55), and D2-21 (AYCGGDCYS; SEQ ID NO:57), and the human D
gene segment further comprises a modification that replaces at
least one endogenous codon in the nucleotide sequence with a
histidine codon. In one embodiment, the hydrophilic frame comprises
a nucleotide sequence that encodes the amino acid sequence selected
from the group consisting of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID
NO: 56, SEQ ID NO: 58, and a combination thereof.
[0085] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D3-3 (YYDFWSGYYT;
SEQ ID NO:59), D3-9 (YYDILTGYYN; SEQ ID NO:61), D3-10 (YYYGSGSYYN;
SEQ ID NO:63), D3-16 (YYDYVWGSYRYT; SEQ ID NO:65), and D3-22
(YYYDSSGYYY; SEQ ID NO:67), and the human D gene segment further
comprises a modification that replaces at least one endogenous
codon in the nucleotide sequence with a histidine codon. In one
embodiment, the hydrophilic frame comprises a nucleotide sequence
encodes the amino acid sequence selected from the group consisting
of SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ
ID NO: 68, and a combination thereof.
[0086] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D4-4 (DYSNY; SEQ ID
NO:69), D4-11 (DYSNY; SEQ ID NO:69), D4-17 (DYGDY; SEQ ID NO:71),
and D4-23 (DYGGNS; SEQ ID NO:73), and the human D gene segment
comprises a modification that replaces at least one endogenous
codon in the nucleotide sequence with a histidine codon. In one
embodiment, the hydrophilic frame comprises a nucleotide sequence
that encodes the amino acid sequence selected from the group
consisting of SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, and a
combination thereof.
[0087] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D5-5 (GYSYGY; SEQ ID
NO:75), D5-12 (GYSGYDY; SEQ ID NO:77), D5-18 (GYSYGY; SEQ ID
NO:75), and D5-24 (RDGYNY; SEQ ID NO:79), and the human D gene
segment further comprises a modification that replaces at least one
endogenous codon in the nucleotide sequence with a histidine codon.
In one embodiment, the hydrophilic frame comprises a nucleotide
sequence that encodes the amino acid sequence selected from the
group consisting of SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80,
and a combination thereof.
[0088] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D6-6 (EYSSSS; SEQ ID
NO: 81), D6-13 (GYSSSWY; SEQ ID NO:83), and D6-19 (GYSSGWY; SEQ ID
NO:85), and the human D gene segment further comprises a
modification that replaces at least one endogenous codon in the
nucleotide sequence with a histidine codon. In one embodiment, the
hydrophilic frame comprises a nucleotide sequence that encodes the
amino acid sequence selected from the group consisting of SEQ ID
NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 76, and a
combination thereof.
[0089] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes D7-27 (NWG),
and the human D gene segment further comprises a modification that
replaces at least one endogenous codon in the nucleotide sequence a
histidine codon.
[0090] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of SEQ ID NO: 46, SEQ
ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO:
56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ
ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO:
74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ
ID NO: 84, SEQ ID NO: 86, and a combination thereof.
[0091] In one embodiment, the human unrearranged immunoglobulin
heavy chain variable region nucleotide sequence is operably linked
to a human or non-human heavy chain constant region nucleotide
sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3,
and a combination thereof. In one embodiment, the heavy chain
constant region nucleotide sequence comprises a C.sub.H1, a hinge,
a C.sub.H2, and a C.sub.H3 (i.e.,
C.sub.H1-hinge-C.sub.H2-C.sub.H3).
[0092] In one embodiment, a heavy chain constant region nucleotide
sequence is present at an endogenous locus (i.e., where the
nucleotide sequence is located in a wild-type non-human animal) or
present ectopically (e.g., at a locus different from the endogenous
immunoglobulin chain locus in its genome), or within its endogenous
locus, e.g., within an immunoglobulin variable locus, wherein the
endogenous locus is placed or moved to a different location in the
genome.
[0093] In one embodiment, the heavy chain constant region
nucleotide sequence comprises a modification in a C.sub.H2 or a
C.sub.H3, wherein the modification increases the affinity of the
heavy chain constant region amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0094] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a modification at position 250
(e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or
T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a
modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K)
and/or 434 (e.g., H/F or Y); or a modification at position 250
and/or 428; or a modification at position 307 or 308 (e.g., 308F,
V308F), and 434. In one embodiment, the modification comprises a
428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L,
259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K
(e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and
256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L
modification (e.g., T250Q and M428L); and a 307 and/or 308
modification (e.g., 308F or 308P), wherein the modification
increases the affinity of the heavy chain constant region amino
acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0095] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 252 and 257, wherein the modification increases the
affinity of the human C.sub.H2 amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0096] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 307 and 311, wherein the modification increases the
affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic
environment (e.g., in an endosome where pH ranges from about 5.5 to
about 6.0).
[0097] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H3 amino acid sequence,
wherein the C.sub.H3 amino acid sequence comprises at least one
modification between amino acid residues at positions 433 and 436,
wherein the modification increases the affinity of the C.sub.H3
amino acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0098] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, N434S, and a combination thereof.
[0099] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, V259I, V308F, and a combination thereof.
[0100] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising an N434A mutation.
[0101] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M252Y, S254T, T256E, and a combination thereof.
[0102] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of T250Q, M248L, or both.
[0103] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of H433K, N434Y, or both.
[0104] In one embodiment, the genetically modified immunoglobulin
locus comprises: (1) a first allele, wherein the unrearranged human
immunoglobulin heavy chain variable region nucleotide sequence as
described herein is operably linked to a first heavy chain constant
region nucleotide sequence encoding a first CH.sub.3 amino acid
sequence of a human IgG selected from IgG1, IgG2, IgG4, and a
combination thereof; and (2) a second allele, wherein the
unrearranged human immunoglobulin heavy chain variable region
nucleotide sequence as described herein is operably linked to a
second heavy chain constant region nucleotide sequence encoding a
second C.sub.H3 amino acid sequence of the human IgG selected from
IgG1, IgG2, IgG4, and a combination thereof, and wherein the second
CH.sub.3 amino acid sequence comprises a modification that reduces
or eliminates binding for the second CH.sub.3 amino acid sequence
to Protein A (see, for example, US 2010/0331527A1, which is
incorporated by reference herein in its entirety).
[0105] In one embodiment, the second CH.sub.3 amino acid sequence
comprises an H95R modification (by IMGT exon numbering; H435R by EU
numbering). In one embodiment the second CH.sub.3 amino acid
sequence further comprises an Y96F modification (by IMGT exon
numbering; H436F by EU). In another embodiment, the second CH.sub.3
amino acid sequence comprises both an H95R modification (by IMGT
exon numbering; H435R by EU numbering) and an Y96F modification (by
IMGT exon numbering; H436F by EU).
[0106] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG1 and further comprises a mutation
selected from the group consisting of D16E, L18M, N44S, K52N, V57M,
and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by
EU).
[0107] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG2 and further comprises a mutation
selected from the group consisting of N44S, K52N, and V82I(IMGT:
N384S, K392N, and V422I by EU).
[0108] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG4 and further comprises a mutation
selected from the group consisting of Q15R, N44S, K52N, V57M, R69K,
E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and
V422I by EU).
[0109] In one embodiment, the heavy chain constant region amino
acid sequence is a non-human constant region amino acid sequence,
and the heavy chain constant region amino acid sequence comprises
one or more of any of the types of modifications described
above.
[0110] In one embodiment, the heavy chain constant region
nucleotide sequence is a human heavy chain constant region amino
acid sequence, and the human heavy chain constant region amino acid
sequence comprises one or more of any of the types of modifications
described above.
[0111] In one embodiment, all or substantially all endogenous
V.sub.H, D, and J.sub.H gene segments are deleted from an
immunoglobulin heavy chain locus or rendered non-functional (e.g.,
via insertion of a nucleotide sequence, e.g., an exogenous
nucleotide sequence, in the immunoglobulin locus or via
non-functional rearrangement, or inversion, of the endogenous
V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80%
or more, about 85% or more, about 90% or more, about 95% or more,
about 96% or more, about 97% or more, about 98% or more, or about
99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments
are deleted or rendered non-functional. In one embodiment, e.g., at
least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or
J gene segments are deleted or rendered non-functional.
[0112] In one embodiment, the genetically modified locus comprises
a modification that deletes or renders non-functional all or
substantially all endogenous V.sub.H, D, and J.sub.H gene segments;
and the genomic locus comprises a genetically modified,
unrearranged human heavy chain variable region nucleotide sequence
comprising a substitution of at least one endogenous non-histidine
codon with a histidine codon in at least one reading frame. In one
embodiment, the genetically modified, unrearranged immunoglobulin
heavy chain variable gene sequence is present at an endogenous
location (i.e., where the nucleotide sequence is located in a
wild-type non-human animal) or present ectopically (e.g., at a
locus different from the endogenous immunoglobulin chain locus in
its genome), or within its endogenous locus, e.g., within an
immunoglobulin variable locus, wherein the endogenous locus is
placed or moved to a different location in the genome.
[0113] In one embodiment, the genetically modified locus comprises
an endogenous Adam6a gene, Adam6b gene, or both, and the genetic
modification does not affect the expression and/or function of the
endogenous Adam6a gene, Adam6b gene, or both.
[0114] In one embodiment, the genetically modified locus comprises
an ectopically present Adam6a gene, Adam6b gene, or both. In one
embodiment, the Adam6a gene is a non-human Adam6a gene. In one
embodiment, the Adam6a gene is a mouse Adam6a gene. In one
embodiment, the Adam6a gene is a human Adam6a gene. In one
embodiment, the Adam6b gene is a non-human Adam6b gene. In one
embodiment, the Adam6b gene is a mouse Adam6b gene. In one
embodiment, the Adam6b gene is a human Adam6b gene.
[0115] In one embodiment, the genetically modified immunoglobulin
locus further comprises a humanized, unrearranged .lamda. and/or
.kappa. light chain variable gene sequence. In one embodiment, the
humanized, unrearranged .lamda. and/or .kappa. light chain variable
gene sequence is operably linked to an immunoglobulin light chain
constant region nucleotide sequence selected from a .lamda. light
chain constant region nucleotide sequence and a .kappa. light chain
constant region nucleotide sequence. In one embodiment, the
humanized, unrearranged .lamda. light chain variable region
nucleotide sequence is operably linked to a .lamda. light chain
constant region nucleotide sequence. In one embodiment, the .lamda.
light chain constant region nucleotide sequence is a mouse, rat, or
human sequence. In one embodiment, the humanized, unrearranged
.kappa. light chain variable region nucleotide sequence is operably
linked to a .kappa. light chain constant region nucleotide
sequence. In one embodiment, the .kappa. light chain constant
region nucleotide sequence is a mouse, rat, or human sequence.
[0116] In one embodiment, the genetically modified immunoglobulin
locus comprises an unrearranged light chain variable gene sequence
that contains at least one modification that introduces at least
one histidine codon in at least one reading frame encoding a light
chain variable domain. In one embodiment, the genetically modified
immunoglobulin locus comprises a rearranged (e.g., a rearranged
.lamda. or .kappa. V/J sequence) sequence that comprises one, two,
three, or four codons for histidine in a light chain CDR. In one
embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a
combination thereof. In one embodiment, the unrearranged or
rearranged light chain variable region nucleotide sequence is an
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence. In one embodiment, the
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence is present at an endogenous
mouse immunoglobulin light chain locus. In one embodiment, the
mouse immunoglobulin light chain locus is a mouse .kappa. locus. In
one embodiment the mouse immunoglobulin light chain locus is a
mouse .lamda. locus.
[0117] In one embodiment, the genetically modified immunoglobulin
locus as described herein is present in an immunoglobulin heavy
chain locus of a mouse. In one embodiment, the genetically modified
immunoglobulin locus is present in a humanized immunoglobulin heavy
chain locus in a VELOCIMMUNE.RTM. mouse.
[0118] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein exhibits a
weaker antigen binding at an acidic environment (e.g., at a pH of
about 5.5 to about 6.0) than a corresponding wild-type heavy chain
variable domain without the genetic modification described
herein.
[0119] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin locus as described herein has at least about 2-fold,
at least about 3-fold, at least about 4-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold, at least about 25-fold, or at least about 30-fold
decrease in dissociative half-life (t.sub.1/2) at an acidic pH
(e.g., pH of about 5.5 to about 6.0) as compared to the
dissociative half-life (t.sub.1/2) of the antigen-binding protein
at a neutral pH (e.g., pH of about 7.0 to about 7.4).
[0120] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin locus as described herein is characterized by
improved pH-dependent recyclability, enhanced serum half-life, or
both as compared with a wild-type antigen-binding protein without
the genetic modification.
[0121] In one embodiment, the genetically modified immunoglobulin
locus described herein comprises a B cell population that, upon
stimulation with an antigen of interest, is capable of producing
antigen-binding proteins, e.g., antibodies, comprising a heavy
chain variable domain comprising one or more histidine residues.
The antigen-binding proteins, which are produced by the genetically
modified immunoglobulin locus described herein, when administered
into a subject, exhibits an increased serum half-life over a
corresponding wild-type antigen-binding protein, which possesses a
similar or sufficiently similar amino acid sequence that encodes
the heavy chain variable domain but does not comprise a histidine
residue in the heavy chain variable domain. In some embodiments,
the antigen-binding protein described herein exhibits an increased
serum half-life that is at least about 2-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold higher than the corresponding wild-type
antigen-binding protein, which possesses a similar or sufficiently
similar amino acid sequence that encodes the heavy chain variable
domain but does not comprise a histidine residue in the heavy chain
variable domain.
[0122] In one aspect, a genetically modified immunoglobulin locus
of a non-human animal comprising a human V.sub.H, D, and J.sub.H
gene segment is provided, wherein at least one human D gene segment
has been inverted 5' to 3' with respect to a corresponding
wild-type sequence, and wherein at least one reading frame of the
inverted human D gene segment comprises one ore more histidine
codon.
[0123] In one embodiment, the non-human animal is a mammal,
including a rodent, e.g., a mouse, a rat, or a hamster
[0124] In one embodiment, the genetically modified immunoglobulin
locus is present in a germline genome.
[0125] In one embodiment, the genetically modified immunoglobulin
locus encodes an immunoglobulin heavy chain variable domain
comprising one or more, 2 or more, 3 or more, 4 or more, 5 or more,
6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more,
12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or
more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more,
23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or
more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or more,
or 34 or more of histidine residues.
[0126] In one embodiment, at least two, at least three, at least
four, at least five, at least six, at least seven, at least eight,
at least nine, at least ten, at least eleven, at least twelve, at
least thirteen, at least fourteen, at least fifteen, at least
sixteen, at least seventeen, at least eighteen, at least nineteen,
at least twenty, at least twenty one, at least twenty two, at least
twenty three, at least twenty four, or all or substantially all of
functional human D gene segments have inverted orientation with
respect to corresponding wild type sequences.
[0127] In one embodiment, all or substantially all of endogenous
immunoglobulin V.sub.H, D, J.sub.H gene segments are deleted from
the immunoglobulin heavy chain locus or rendered non-functional
(e.g., via insertion of a nucleotide sequence, e.g., exogenous
nucleotide sequence, in the immunoglobulin locus or via
non-functional rearrangement or inversion of all, or substantially
all, endogenous immunoglobulin V.sub.H, D, J.sub.H segments), and
the genetically modified immunoglobulin locus comprises a human
V.sub.H, D, and J.sub.H gene segments, wherein at least one human D
gene segment is present in an inverted orientation with respect to
a corresponding wild type sequence, and wherein at least one
reading frame in the inverted human D gene segment comprises at
least one histidine codon.
[0128] In one embodiment, the inverted human D gene segment is
operably linked to a human V.sub.H gene segment, and/or human
J.sub.H gene segment
[0129] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is selected from the group consisting of D1-1, D1-7,
D1-20, D1-26, D2-2, D2-8, D2-15, D2-21, D3-3, D3-9, D3-10, D3-16,
D3-22, D4-4, D4-11, D4-17, D4-23, D5-5, D5-12, D5-18, D5-24, D6-6,
D6-13, D6-19, D7-27, and a combination thereof.
[0130] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D1 gene segment selected from the group consisting of
D1-1, D1-7, D1-20, D1-26, and a combination thereof.
[0131] In one embodiment, the human D gene segment that is present
in the inverted orientation relative a corresponding wild type
sequence is a D2 gene segment selected from the group consisting of
D2-2, D2-8, D2-15, D2-21, and a combination thereof.
[0132] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D3 gene segment selected from the group consisting of
D3-3, D3-9, D3-10, D3-16, D3-22, and a combination thereof.
[0133] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D4 gene segment selected from the group consisting of
D4-4, D4-11, D4-17, D4-23, and a combination thereof.
[0134] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D5 gene segment selected from the group consisting of
D5-5, D5-12, D5-18, D5-24, and a combination thereof.
[0135] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D6 gene segment selected from the group consisting of
D6-6, D6-13, D6-19, and a combination thereof.
[0136] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is D7-27.
[0137] In one embodiment, the reading frame of the human D gene
segment is selected from a stop reading frame, a hydrophilic
reading frame, and a hydrophobic reading frame, and at least one
reading frame of the inverted human D gene segment comprises one or
more histidine codon.
[0138] In one embodiment, the unrearranged heavy chain variable
region nucleotide sequence comprising the inverted human D gene
segment is operably linked to a human or non-human heavy chain
constant region nucleotide sequence that encodes an immunoglobulin
isotype selected from IgM, IgD, IgG, IgE, and IgA.
[0139] In one embodiment, the unrearranged heavy chain variable
region nucleotide sequence comprising the inverted human D gene
segment is operably linked to a human or non-human heavy chain
constant region nucleotide sequence that encodes an immunoglobulin
isotype selected from IgM, IgD, IgG, IgE, and IgA.
[0140] In one embodiment, the human unrearranged immunoglobulin
heavy chain variable region nucleotide sequence is operably linked
to a human or non-human heavy chain constant region nucleotide
sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3,
and a combination thereof. In one embodiment, the heavy chain
constant region nucleotide sequence comprises a C.sub.H1, a hinge,
a C.sub.H2, and a C.sub.H3 (i.e.,
C.sub.H1-hinge-C.sub.H2-C.sub.H3).
[0141] In one embodiment, a heavy chain constant region nucleotide
sequence is present at an endogenous locus (i.e., where the
nucleotide sequence is located in a wild-type non-human animal) or
present ectopically (e.g., at a locus different from the endogenous
immunoglobulin chain locus in its genome), or within its endogenous
locus, e.g., within an immunoglobulin variable locus, wherein the
endogenous locus is placed or moved to a different location in the
genome.
[0142] In one embodiment, the heavy chain constant region
nucleotide sequence comprises a modification in a C.sub.H2 or a
C.sub.H3, wherein the modification increases the affinity of the
heavy chain constant region amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0143] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a modification at position 250
(e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or
T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a
modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K)
and/or 434 (e.g., H/F or Y); or a modification at position 250
and/or 428; or a modification at position 307 or 308 (e.g., 308F,
V308F), and 434. In one embodiment, the modification comprises a
428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L,
259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K
(e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and
256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L
modification (e.g., T250Q and M428L); and a 307 and/or 308
modification (e.g., 308F or 308P), wherein the modification
increases the affinity of the heavy chain constant region amino
acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0144] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 252 and 257, wherein the modification increases the
affinity of the human C.sub.H2 amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0145] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 307 and 311, wherein the modification increases the
affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic
environment (e.g., in an endosome where pH ranges from about 5.5 to
about 6.0).
[0146] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H3 amino acid sequence,
wherein the C.sub.H3 amino acid sequence comprises at least one
modification between amino acid residues at positions 433 and 436,
wherein the modification increases the affinity of the C.sub.H3
amino acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0147] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, N434S, and a combination thereof.
[0148] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, V259I, V308F, and a combination thereof.
[0149] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising an N434A mutation.
[0150] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M252Y, S254T, T256E, and a combination thereof.
[0151] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of T250Q, M248L, or both.
[0152] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of H433K, N434Y, or both.
[0153] In one embodiment, the genetically modified immunoglobulin
locus comprises: (1) a first allele, wherein the unrearranged human
immunoglobulin heavy chain variable region nucleotide sequence as
described herein is operably linked to a first heavy chain constant
region nucleotide sequence encoding a first CH.sub.3 amino acid
sequence of a human IgG selected from IgG1, IgG2, IgG4, and a
combination thereof; and (2) a second allele, wherein the
unrearranged human immunoglobulin heavy chain variable region
nucleotide sequence as described herein is operably linked to a
second heavy chain constant region nucleotide sequence encoding a
second C.sub.H3 amino acid sequence of the human IgG selected from
IgG1, IgG2, IgG4, and a combination thereof, and wherein the second
CH.sub.3 amino acid sequence comprises a modification that reduces
or eliminates binding for the second CH.sub.3 amino acid sequence
to Protein A (see, for example, US 2010/0331527A1, incorporated by
reference herein in its entirety).
[0154] In one embodiment, the second CH.sub.3 amino acid sequence
comprises an H95R modification (by IMGT exon numbering; H435R by EU
numbering). In one embodiment the second CH.sub.3 amino acid
sequence further comprises an Y96F modification (by IMGT exon
numbering; H436F by EU). In another embodiment, the second CH.sub.3
amino acid sequence comprises both an H95R modification (by IMGT
exon numbering; H435R by EU numbering) and an Y96F modification (by
IMGT exon numbering; H436F by EU).
[0155] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG1 and further comprises a mutation
selected from the group consisting of D16E, L18M, N44S, K52N, V57M,
and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by
EU).
[0156] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG2 and further comprises a mutation
selected from the group consisting of N44S, K52N, and V82I (IMGT:
N384S, K392N, and V422I by EU).
[0157] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG4 and further comprises a mutation
selected from the group consisting of Q15R, N44S, K52N, V57M, R69K,
E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and
V422I by EU).
[0158] In one embodiment, the heavy chain constant region amino
acid sequence is a non-human constant region amino acid sequence,
and the heavy chain constant region amino acid sequence comprises
one or more of any of the types of modifications described
above.
[0159] In one embodiment, the heavy chain constant region
nucleotide sequence is a human heavy chain constant region amino
acid sequence, and the human heavy chain constant region amino acid
sequence comprises one or more of any of the types of modifications
described above.
[0160] In one embodiment, all, or substantially all, endogenous
V.sub.H, D, and J.sub.H gene segments are deleted from an
immunoglobulin heavy chain locus or rendered non-functional (e.g.,
via insertion of a nucleotide sequence (e.g., an exogenous
nucleotide sequence) in the immunoglobulin locus or via
non-functional rearrangement, or inversion, of the endogenous
V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80%
or more, about 85% or more, about 90% or more, about 95% or more,
about 96% or more, about 97% or more, about 98% or more, or about
99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments
are deleted or rendered non-functional. In one embodiment, e.g., at
least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or
J gene segments are deleted or rendered non-functional.
[0161] In one embodiment, the genetically modified immunoglobulin
heavy chain locus comprises a modification that deletes or renders
non-functional, all or substantially all, endogenous V.sub.H, D,
and J.sub.H gene segments; and the genetically modified locus
comprises an unrearranged heavy chain variable region nucleotide
sequence comprising at least one inverted human D gene segment as
described herein wherein the unrearranged heavy chain variable
region nucleotide sequence is present at an endogenous location
(i.e., where the nucleotide sequence is located in a wild-type
non-human animal) or present ectopically (e.g., at a locus
different from the endogenous immunoglobulin chain locus in its
genome, or within its endogenous locus, e.g., within an
immunoglobulin variable locus, wherein the endogenous locus is
placed or moved to a different location in the genome).
[0162] In one embodiment, the genetically modified immunoglobulin
locus comprises an endogenous Adam6a gene, Adam6b gene, or both,
and the genetic modification does not affect the expression and/or
function of the endogenous Adam6a gene, Adam6b gene, or both.
[0163] [000163] In one embodiment, the genetically modified
immunoglobulin locus comprises an ectopically present Adam6a gene,
Adam6b gene, or both. In one embodiment, the Adam6a gene is a
non-human Adam6a gene. In one embodiment, the Adam6a gene is a
mouse Adam6a gene. In one embodiment, the Adam6a gene is a human
Adam6a gene. In one embodiment, the Adam6b gene is a non-human
Adam6b gene. In one embodiment, the Adam6b gene is a mouse Adam6b
gene. In one embodiment, the Adam6b gene is a human Adam6b
gene.
[0164] In one embodiment, the genetically modified immunoglobulin
locus further comprises a humanized, unrearranged .lamda. and/or
.kappa. light chain variable gene sequence. In one embodiment, the
humanized, unrearranged .lamda. and/or .kappa. light chain variable
gene sequence is operably linked to an immunoglobulin light chain
constant region nucleotide sequence selected from a .lamda. light
chain constant region nucleotide sequence and a .kappa. light chain
constant region nucleotide sequence. In one embodiment, the
humanized, unrearranged .lamda. light chain variable region
nucleotide sequence is operably linked to a .lamda. light chain
constant region nucleotide sequence. In one embodiment, the .lamda.
light chain constant region nucleotide sequence is a mouse, rat, or
human sequence. In one embodiment, the humanized, unrearranged
.kappa. light chain variable region nucleotide sequence is operably
linked to a .kappa. light chain constant region nucleotide
sequence. In one embodiment, the .kappa. light chain constant
region nucleotide sequence is a mouse, rat, or human sequence.
[0165] In one embodiment, the genetically modified immunoglobulin
locus comprises an unrearranged light chain variable gene sequence
that contains at least one modification that introduces at least
one histidine codon in at least one reading frame encoding a light
chain variable domain. In one embodiment, the genetically modified
immunoglobulin locus comprises a rearranged (e.g., a rearranged
.lamda. or .kappa. V/J sequence) sequence that comprises one, two,
three, or four codons for histidine in a light chain CDR. In one
embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a
combination thereof. In one embodiment, the unrearranged or
rearranged light chain variable region nucleotide sequence is an
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence. In one embodiment, the
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence is present at an endogenous
mouse immunoglobulin light chain locus. In one embodiment, the
mouse immunoglobulin light chain locus is a mouse .kappa. locus. In
one embodiment, the mouse immunoglobulin light chain locus is a
mouse immunoglobulin light chain locus is a mouse .lamda.
locus.
[0166] In one embodiment, the genetically modified immunoglobulin
locus as described herein is present in an immunoglobulin heavy
chain locus of a mouse. In one embodiment, the genetically modified
immunoglobulin locus is present in a humanized immunoglobulin heavy
chain locus in a VELOCIMMUNE.RTM. mouse.
[0167] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein exhibits a
weaker antigen binding at an acidic environment (e.g., at a pH of
about 5.5 to about 6.0) than a corresponding wild-type heavy chain
variable domain without the genetic modification.
[0168] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin locus as described herein has at least about 2-fold,
at least about 3-fold, at least about 4-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold, at least about 25-fold, or at least about 30-fold
decrease in dissociative half-life (t.sub.1/2) at an acidic pH
(e.g., pH of about 5.5 to about 6.0) as compared to the
dissociative half-life (t.sub.1/2) of the antigen-binding protein
at a neutral pH (e.g., pH of about 7.0 to about 7.4).
[0169] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin locus as described herein is characterized by
improved pH-dependent recyclability, enhanced serum half-life, or
both as compared with a wild-type antigen-binding protein without
the genetic modification.
[0170] In one embodiment, the genetically modified immunoglobulin
locus described herein comprises a B cell population that, upon
stimulation with an antigen of interest, is capable of producing
antigen-binding proteins, e.g., antibodies, comprising a heavy
chain variable domain comprising one or more histidine residues.
The antigen-binding proteins as described herein when administered
into a subject, exhibits an increased serum half-life over a
corresponding wild-type antigen-binding protein, which possesses a
similar or sufficiently similar amino acid sequence that encodes
the heavy chain variable domain but does not comprise a histidine
residue in the heavy chain variable domain. In some embodiments,
the antigen-binding protein described herein exhibits an increased
serum half-life that is at least about 2-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold higher than the corresponding wild-type
antigen-binding protein, which possesses a similar or sufficiently
similar amino acid sequence that encodes the heavy chain variable
domain but does not comprise a histidine residue in the heavy chain
variable domain.
[0171] In one aspect, a non-human animal is provided comprising in
its germline genome a genetically modified immunoglobulin locus
comprising an unrearranged human heavy chain variable region
nucleotide sequence, wherein the unrearranged heavy chain variable
region nucleotide sequence comprises an addition of least one
histidine codon or a substitution of at least one endogenous
non-histidine codon with a histidine codon.
[0172] In one embodiment, the non-human animal is a mammal,
including a rodent, e.g., a mouse, a rat, or a hamster.
[0173] In one embodiment, the added or substituted histidine codon
is present in an immunoglobulin heavy chain gene segment selected
from a human V.sub.H gene segment, a human D gene segment, a human
J.sub.H gene segment, and a combination thereof. In one embodiment,
the immunoglobulin heavy chain gene segment is selected from a
human germline V.sub.H gene segment, a human germline D gene
segment, a human germline J.sub.H gene segment, and a combination
thereof.
[0174] In one embodiment, the human V.sub.H gene segment is
selected from the group consisting of V.sub.H1-2, V.sub.H1-3,
V.sub.H1-8, V.sub.H1-18, V.sub.H1-24, V.sub.H1-45, V.sub.H1-46,
V.sub.H1-58, V.sub.H1-69, V.sub.H2-5, V.sub.H2-26, V.sub.H2-70,
V.sub.H3-7, V.sub.H3-9, V.sub.H3-11, V.sub.H3-13, V.sub.H3-15,
V.sub.H3-16, V.sub.H3-20, V.sub.H3-21, V.sub.H3-23, V.sub.H3-30,
V.sub.H3-30-3, V.sub.H 3-30-5, V.sub.H3-33, V.sub.H3-35,
V.sub.H3-38, V.sub.H3-43, V.sub.H3-48, V.sub.H3-49, V.sub.H3-53,
V.sub.H3-64, V.sub.H3-66, V.sub.H3-72, V.sub.H3-73, V.sub.H3-74,
V.sub.H4-4, V.sub.H4-28, V.sub.H4-30-1, V.sub.H4-30-2,
V.sub.H4-30-4, V.sub.H4-31, V.sub.H4-34, V.sub.H4-39, V.sub.H4-59,
V.sub.H4-61, V.sub.H5-51, V.sub.H6-1, V.sub.H7-4-1, V.sub.H7-81,
and a combination thereof.
[0175] In one embodiment, the human D gene segment is selected from
the group consisting of D1-1, D1-7, D1-14, D1-20, D1-26, D2-2,
D2-8, D2-15, D2-21, D3-3, D3-9, D3-10, D3-16, D3-22, D4-4, D4-11,
D4-17, D4-23, D5-12, D5-5, D5-18, D5-24, D6-6, D6-13, D6-19, D6-25,
D7-27, and a combination thereof.
[0176] In one embodiment, the human J.sub.H gene segment is
selected from the group consisting of J.sub.H1, J.sub.H2, J.sub.H3,
J.sub.H4, J.sub.H5, J.sub.H6, and a combination thereof.
[0177] In one embodiment, the added or substituted histidine codon
is present in the unrearranged heavy chain variable region
nucleotide sequence encoding an N-terminal region, a loop 4 region,
a CDR1, a CDR2, a CDR3, or a combination thereof.
[0178] In one embodiment, the unrearranged heavy chain variable
region nucleotide sequence comprises 2 or more, 3 or more, 4 or
more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or
more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more,
16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or
more, 22 or more, 23 or more, 24 or more, or 25 or more, 26 or
more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more,
32 or more, 33 or more, 34 or more 35 or more, 36 or more, 37 or
more, 38 or more, 39 or more, 40 or more, 41 or more, 42 or more,
43 or more, 44 or more, 45 or more, 46 or more, 47 or more, 48 or
more, 49 or more, 50 or more, 51 or more, 52 or more, 53 or more,
54 or more, 55 or more, 56 or more, 57 or more, 58 or more, 59 or
more, 60 or more, or 61 or more of histidine codons.
[0179] In one embodiment, the unrearranged heavy chain variable
region nucleotide sequence comprising the inverted human D gene
segment is operably linked to a human or non-human heavy chain
constant region nucleotide sequence that encodes an immunoglobulin
isotype selected from IgM, IgD, IgG, IgE, and IgA.
[0180] In one embodiment, the human unrearranged immunoglobulin
heavy chain variable region nucleotide sequence is operably linked
to a human or non-human heavy chain constant region nucleotide
sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3,
and a combination thereof. In one embodiment, the heavy chain
constant region nucleotide sequence comprises a C.sub.H1, a hinge,
a C.sub.H2, and a C.sub.H3 (i.e.,
C.sub.H1-hinge-C.sub.H2-C.sub.H3).
[0181] In one embodiment, a heavy chain constant region nucleotide
sequence is present at an endogenous locus (i.e., where the
nucleotide sequence is located in a wild-type non-human animal) or
present ectopically (e.g., at a locus different from the endogenous
immunoglobulin chain locus in its genome), or within its endogenous
locus, e.g., within an immunoglobulin variable locus, wherein the
endogenous locus is placed or moved to a different location in the
genome.
[0182] In one embodiment, the heavy chain constant region
nucleotide sequence comprises a modification in a C.sub.H2 or a
C.sub.H3, wherein the modification increases the affinity of the
heavy chain constant region amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0183] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a modification at position 250
(e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or
T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a
modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K)
and/or 434 (e.g., H/F or Y); or a modification at position 250
and/or 428; or a modification at position 307 or 308 (e.g., 308F,
V308F), and 434. In one embodiment, the modification comprises a
428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L,
259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K
(e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and
256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L
modification (e.g., T250Q and M428L); and a 307 and/or 308
modification (e.g., 308F or 308P), wherein the modification
increases the affinity of the heavy chain constant region amino
acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0184] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 252 and 257, wherein the modification increases the
affinity of the human C.sub.H2 amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0185] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 307 and 311, wherein the modification increases the
affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic
environment (e.g., in an endosome where pH ranges from about 5.5 to
about 6.0).
[0186] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H3 amino acid sequence,
wherein the C.sub.H3 amino acid sequence comprises at least one
modification between amino acid residues at positions 433 and 436,
wherein the modification increases the affinity of the C.sub.H3
amino acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0187] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, N434S, and a combination thereof.
[0188] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, V259I, V308F, and a combination thereof.
[0189] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising an N434A mutation.
[0190] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M252Y, S254T, T256E, and a combination thereof.
[0191] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of T250Q, M248L, or both.
[0192] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of H433K, N434Y, or both.
[0193] In one embodiment, the genetically modified immunoglobulin
locus comprises: (1) a first allele, wherein the unrearranged human
immunoglobulin heavy chain variable region nucleotide sequence as
described herein is operably linked to a first heavy chain constant
region nucleotide sequence encoding a first CH.sub.3 amino acid
sequence of a human IgG selected from IgG1, IgG2, IgG4, and a
combination thereof; and (2) a second allele, wherein the
unrearranged human immunoglobulin heavy chain variable region
nucleotide sequence as described herein is operably linked to a
second heavy chain constant region nucleotide sequence encoding a
second C.sub.H3 amino acid sequence of the human IgG selected from
IgG1, IgG2, IgG4, and a combination thereof, and wherein the second
CH.sub.3 amino acid sequence comprises a modification that reduces
or eliminates binding for the second CH.sub.3 amino acid sequence
to Protein A (see, for example, US 2010/0331527A1, which is
incorporated by reference herein in its entirety).
[0194] In one embodiment, the second CH.sub.3 amino acid sequence
comprises an H95R modification (by IMGT exon numbering; H435R by EU
numbering). In one embodiment the second CH.sub.3 amino acid
sequence further comprises an Y96F modification (by IMGT exon
numbering; H436F by EU). In another embodiment, the second CH.sub.3
amino acid sequence comprises both an H95R modification (by IMGT
exon numbering; H435R by EU numbering) and an Y96F modification (by
IMGT exon numbering; H436F by EU).
[0195] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG1 and further comprises a mutation
selected from the group consisting of D16E, L18M, N44S, K52N, V57M,
and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by
EU).
[0196] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG2 and further comprises a mutation
selected from the group consisting of N44S, K52N, and V82I (IMGT:
N384S, K392N, and V422I by EU).
[0197] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG4 and further comprises a mutation
selected from the group consisting of Q15R, N44S, K52N, V57M, R69K,
E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and
V422I by EU).
[0198] In one embodiment, the heavy chain constant region amino
acid sequence is a non-human constant region amino acid sequence,
and the heavy chain constant region amino acid sequence comprises
one or more of any of the types of modifications described
above.
[0199] In one embodiment, the heavy chain constant region
nucleotide sequence is a human heavy chain constant region amino
acid sequence, and the human heavy chain constant region amino acid
sequence comprises one or more of any of the types of modifications
described above.
[0200] In one embodiment, all or substantially all endogenous
V.sub.H, D, and J.sub.H gene segments are deleted from an
immunoglobulin heavy chain locus or rendered non-functional (e.g.,
via insertion of a nucleotide sequence (e.g., an exogenous
nucleotide sequence) in the immunoglobulin locus or via
non-functional rearrangement, or inversion, of the endogenous
V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80%
or more, about 85% or more, about 90% or more, about 95% or more,
about 96% or more, about 97% or more, about 98% or more, or about
99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments
are deleted or rendered non-functional. In one embodiment, e.g., at
least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or
J gene segments are deleted or rendered non-functional.
[0201] In one embodiment, the genetically modified immunoglobulin
heavy chain locus comprises a modification that deletes or renders,
all or substantially all, non-functional endogenous V.sub.H, D, and
J.sub.H gene segments; and the genetically modified locus comprises
an unrearranged heavy chain variable region nucleotide sequence
comprising one or more human V.sub.H, D, and/or J.sub.H gene
segments having one or more histidine codons, wherein the
unrearranged heavy chain variable region nucleotide sequence is
present at an endogenous location (i.e., where the nucleotide
sequence is located in a wild-type non-human animal) or present
ectopically (e.g., at a locus different from the endogenous
immunoglobulin chain locus in its genome, or within its endogenous
locus, e.g., within an immunoglobulin variable locus, wherein the
endogenous locus is placed or moved to a different location in the
genome).
[0202] In one embodiment, the genetically modified immunoglobulin
locus comprises an endogenous Adam6a gene, Adam6b gene, or both,
and the genetic modification does not affect the expression and/or
function of the endogenous Adam6a gene, Adam6b gene, or both.
[0203] In one embodiment, the genetically modified immunoglobulin
locus comprises an ectopically present Adam6a gene, Adam6b gene, or
both. In one embodiment, the Adam6a gene is a non-human Adam6a
gene. In one embodiment, the Adam6a gene is a human Adam6a gene. In
one embodiment, the Adam6b gene is a non-human Adam6b gene. In one
embodiment, the Adam6b gene is a human Adam6b gene.
[0204] In one embodiment, the genetically modified immunoglobulin
locus further comprises a humanized, unrearranged .lamda. and/or
.kappa. light chain variable gene sequence. In one embodiment, the
humanized, unrearranged .lamda. and/or .kappa. light chain variable
gene sequence is operably linked to an immunoglobulin light chain
constant region nucleotide sequence selected from a .lamda. light
chain constant region nucleotide sequence and a .kappa. light chain
constant region nucleotide sequence. In one embodiment, the
humanized, unrearranged .lamda. light chain variable region
nucleotide sequence is operably linked to a .lamda. light chain
constant region nucleotide sequence. In one embodiment, the .lamda.
light chain constant region nucleotide sequence is a mouse, rat, or
human sequence. In one embodiment, the humanized, unrearranged
.kappa. light chain variable region nucleotide sequence is operably
linked to a .kappa. light chain constant region nucleotide
sequence. In one embodiment, the .kappa. light chain constant
region nucleotide sequence is a mouse, rat, or human sequence.
[0205] In one embodiment, the genetically modified immunoglobulin
locus comprises an unrearranged light chain variable gene sequence
that contains at least one modification that introduces at least
one histidine codon in at least one reading frame encoding a light
chain variable domain. In one embodiment, the genetically modified
immunoglobulin locus comprises a rearranged (e.g., a rearranged
.lamda. or .kappa. V/J sequence) sequence that comprises one, two,
three, or four codons for histidine in a light chain CDR. In one
embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a
combination thereof. In one embodiment, the unrearranged or
rearranged light chain variable region nucleotide sequence is an
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence. In one embodiment, the
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence is present at an endogenous
mouse immunoglobulin light chain locus. In one embodiment, the
mouse immunoglobulin light chain locus is a mouse .kappa. locus. In
one embodiment, the mouse immunoglobulin light chain locus is a
mouse .lamda. locus.
[0206] In one embodiment, the genetically modified immunoglobulin
locus as described herein is present in an immunoglobulin heavy
chain locus of a mouse. In one embodiment, the genetically modified
immunoglobulin locus is present in a humanized immunoglobulin heavy
chain locus in a VELOCIMMUNE.RTM. mouse.
[0207] In one embodiment, the non-human animal is heterozygous for
the genetically modified immunoglobulin heavy chain locus, and the
non-human animal is capable of expressing a human immunoglobulin
heavy chain variable domain comprising at least one histidine
residue derived predominantly from the genetically modified
immunoglobulin heavy chain locus as described herein.
[0208] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein exhibits a
weaker antigen binding at an acidic environment (e.g., at a pH of
about 5.5 to about 6.0) than a corresponding wild-type heavy chain
variable domain without the genetic modification.
[0209] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin locus as described herein has at least about 2-fold,
at least about 3-fold, at least about 4-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold, at least about 25-fold, or at least about 30-fold
decrease in dissociative half-life (t.sub.1/2) at an acidic pH
(e.g., pH of about 5.5 to about 6.0) as compared to the
dissociative half-life (t.sub.1/2) of the antigen-binding protein
at a neutral pH (e.g., pH of about 7.0 to about 7.4).
[0210] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin locus as described herein is characterized by
improved pH-dependent recyclability, enhanced serum half-life, or
both as compared with a wild-type antigen-binding protein without
the genetic modification.
[0211] In one embodiment, the genetically modified immunoglobulin
locus described herein comprises a B cell population that, upon
stimulation with an antigen of interest, is capable of producing
antigen-binding proteins, e.g., antibodies, comprising a heavy
chain variable domain comprising one or more histidine residues.
The antigen-binding proteins as described herein when administered
into a subject, exhibits an increased serum half-life over a
corresponding wild-type antigen-binding protein, which possesses a
similar or sufficiently similar amino acid sequence that encodes
the heavy chain variable domain but does not comprise a histidine
residue in the heavy chain variable domain. In some embodiments,
the antigen-binding protein described herein exhibits an increased
serum half-life that is at least about 2-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold higher than the corresponding wild-type
antigen-binding protein, which possesses a similar or sufficiently
similar amino acid sequence that encodes the heavy chain variable
domain but does not comprise a histidine residue in the heavy chain
variable domain.
[0212] In one aspect, a non-human animal comprising a genetically
modified immunoglobulin locus is provided, wherein the genetically
modified immunoglobulin locus comprises an unrearranged human heavy
chain variable region nucleotide sequence, and wherein the human
unrearranged heavy chain variable region nucleotide sequence
comprises a substitution of at least one endogenous non-histidine
codon with a histidine codon.
[0213] In one embodiment, the non-human animal is a mammal,
including a rodent, e.g., a mouse, a rat, or a hamster.
[0214] In one embodiment, 2 or more, 3 or more, 4 or more, 5 or
more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or
more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more,
17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or
more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more,
28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or
more, 34 or more, 35 or more, 36 or more, 37 or more, 38 or more,
39 or more, 40 or more, 41 or more, 42 or more, 43 or more, 44 or
more, 45 or more, 46 or more, 47 or more, 48 or more, 49 or more,
50 or more, 51 or more, 52 or more, 53 or more, 54 or more, 55 or
more, 56 or more, 57 or more, 58 or more, 59 or more, 60 or more,
or 61 or more of the endogenous non-histidine codons are replaced
with histidine codons.
[0215] In one embodiment, the endogenous non-histone codon encodes
the amino acid selected from Y, N, D, Q, S, W, and R.
[0216] In one embodiment, the substituted histidine codon is
present in an unrearranged heavy chain variable region nucleotide
sequence that encodes an immunoglobulin variable domain selected
from an N-terminal region, a loop 4 region, a CDR1, a CDR2, a CDR3,
a combination thereof.
[0217] In one embodiment, the substituted histidine codon is
present in an unrearranged heavy chain variable region nucleotide
sequence that encodes a complementary determining region (CDR)
selected from a CDR1, a CDR2, a CDR3, and a combination
thereof.
[0218] In one embodiment, the substituted histidine codon is
present in an unrearranged heavy chain variable region nucleotide
sequence that encodes a frame region (FR) selected from FR1, FR2,
FR3, FR4, and a combination thereof.
[0219] In one embodiment, the unrearranged heavy chain variable
region nucleotide sequence comprises a genetically modified human
V.sub.H gene segment, wherein one or more endogenous non-histidine
codon in at least one reading frame of the human V.sub.H gene
segment has been replaced with a histidine codon.
[0220] In one embodiment, the human unrearranged heavy chain
variable region nucleotide sequence comprises a modification that
replaces at least one endogenous non-histidine codon of a human
V.sub.H gene segment with a histidine codon, wherein the human
V.sub.H gene segment is selected from the group consisting of
V.sub.H1-2, V.sub.H1-3, V.sub.H1-8, V.sub.H1-18, V.sub.H1-24,
V.sub.H1-45, V.sub.H1-46, V.sub.H1-58, V.sub.H1-69, V.sub.H2-5,
V.sub.H2-26, V.sub.H2-70, V.sub.H3-7, V.sub.H3-9, V.sub.H3-11,
V.sub.H3-13, V.sub.H3-15, V.sub.H3-16, V.sub.H3-20, V.sub.H3-21,
V.sub.H3-23, V.sub.H3-30, V.sub.H3-30-3, V.sub.H 3-30-5,
V.sub.H3-33, V.sub.H3-35, V.sub.H3-38, V.sub.H3-43, V.sub.H3-48,
V.sub.H3-49, V.sub.H3-53, V.sub.H3-64, V.sub.H3-66, V.sub.H3-72,
V.sub.H3-73, V.sub.H3-74, V.sub.H4-4, V.sub.H4-28, V.sub.H4-30-1,
V.sub.H4-30-2, V.sub.H4-30-4, V.sub.H4-31, V.sub.H4-34,
V.sub.H4-39, V.sub.H4-59, V.sub.H4-61, V.sub.H5-51, V.sub.H6-1,
V.sub.H7-4-1, V.sub.H7-81, and a combination thereof.
[0221] In one embodiment, the human unrearranged heavy chain
variable region nucleotide sequence comprises a genetically
modified human J.sub.H gene segment, wherein one or more endogenous
non-histidine codon in at least one reading frame of the human
J.sub.H gene segment has been replaced with a histidine codon.
[0222] In one embodiment, the human unrearranged heavy chain
variable region nucleotide sequence comprises a modification that
replaces at least one endogenous non-histidine codon of a human
J.sub.H segment with a histidine codon, wherein the human J.sub.H
gene segment is selected from the group consisting of J.sub.H1,
J.sub.H2, J.sub.H3, J.sub.H4, J.sub.H5, J.sub.H6, and a combination
thereof.
[0223] In one embodiment, the substituted histidine codon is
present in a heavy chain variable region nucleotide sequence that
encodes part of a CDR3. In one embodiment, the part of CDR3
comprises an amino acid sequence derived from a reading frame of a
genetically modified human D gene segment comprising a modification
that replaces at least one endogenous non-histidine codon in the
reading frame with a histidine codon.
[0224] In one embodiment, the endogenous non-histidine codon that
is substituted with a histidine codon encodes the amino acid
selected from Y, N, D, Q, S, W, and R.
[0225] In one embodiment, the substituted histidine codon is
present in at least one reading frame of the human D gene segment
that is most frequently observed in VELOCIMMUNE.RTM. humanized
immunoglobulin mice.
[0226] In one embodiment, the reading frame of the genetically
modified human D gene segment that encodes part of CDR3 is selected
from a hydrophobic frame, a stop frame, and a hydrophilic
frame.
[0227] In one embodiment, the reading frame is a hydrophobic frame
of a human D gene segment.
[0228] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D1-1 (GTTGT; SEQ ID
NO: 88), D1-7 (GITGT; SEQ ID NO: 89), D1-20 (GITGT; SEQ ID NO: 89),
and D1-26 (GIVGAT; SEQ ID NO:90), and the human D gene segment
further comprises a modification that replaces at least one
endogenous non-histidine codon in the nucleotide sequence with a
histidine codon.
[0229] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D2-2 (DIVVVPAAI; SEQ
ID NO:92), D2-8 (DIVLMVYAI; SEQ ID NO: 94), D2-15 (DIVVVVAAT; SEQ
ID NO:95), and D2-21 (HIVVVTAI; SEQ ID NO: 97), and the human D
gene segment further comprises a modification that replaces at
least one endogenous non-histidine codon in the nucleotide sequence
with a histidine codon.
[0230] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D3-3 (ITIFGVVII; SEQ
ID NO:98), D3-9 (ITIF*LVII; SEQ ID NO:99, SEQ ID NO:100), D3-10
(ITMVRGVII; SEQ ID NO:101), D3-16 (IMITFGGVIVI; SEQ ID NO:102), and
D3-22 (ITMIVVVIT; SEQ ID NO:103), and the human D gene segment
further comprises a modification that replaces at least one
endogenous codon in the nucleotide sequence with a histidine
codon.
[0231] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D4-4 (TTVT; SEQ ID
NO:105), D4-11 (TTVT; SEQ ID NO:105), D4-17 (TTVT; SEQ ID NO:105),
D4-23 (TTVVT; SEQ ID NO: 106) and the human D gene segment further
comprises a modification that replaces at least one endogenous
non-histidine codon in the nucleotide sequence with a histidine
codon.
[0232] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D5-5 (VDTAMV; SEQ ID
NO: 107), D5-12 (VDIVATI; SEQ ID NO:108), D5-18 (VDTAMV; SEQ ID
NO:107), and D5-24 (VEMATI; SEQ ID NO:109), and the human D gene
segment further comprises a modification that replaces at least one
endogenous non-histidine codon in the nucleotide sequence with a
histidine codon.
[0233] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D6-6 (SIAAR; SEQ ID
NO:111), D6-13 (GIAAAG; SEQ ID NO:113), and D6-19 (GIAVAG; SEQ ID
NO:115), and the human D gene segment further comprises a
modification that replaces at least one endogenous non-histidine
codon in the nucleotide sequence with a histidine codon.
[0234] In one embodiment, the hydrophobic frame comprises a
nucleotide sequence that encodes human D7-27 (LTG), and the human D
gene segment further comprises a modification that replaces at
least one endogenous non-histidine codon in the nucleotide sequence
with a histidine codon.
[0235] In one embodiment, the reading frame is a stop reading frame
of a human D gene segment.
[0236] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D1-1 (VQLER;
SEQ ID NO:8), D1-7(V*LEL), D1-20(V*LER), D1-26 (V*WELL; SEQ ID
NO:12), and the human D gene segment further comprises a
modification that replaces at least one endogenous non-histidine
codon in the nucleotide sequence with a histidine codon.
[0237] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D2-2
(RIL**YQLLY; SEQ ID NO:14), D2-8 (RILY*WCMLY; SEQ ID NO:16 and SEQ
ID NO: 17), D2-15 (RIL*WW*LLL), and D2-21 (SILWW*LLF; SEQ ID
NO:19), and the human D gene segment further comprises a
modification that replaces at least one endogenous non-histidine
codon in the nucleotide sequence with a histidine codon.
[0238] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D3-3
(VLRFLEWLLY; SEQ ID NO:21), D3-9 (VLRYFDWLL*; SEQ ID NO:23), D3-10
(VLLWFGELL*; SEQ ID NO:25), D3-16 (VL*LRLGELSLY; SEQ ID NO:27), and
D3-22 (VLL***WLLL; SEQ ID NO:29), and the human D gene segment
comprises a modification that replaces at least one endogenous
non-histidine codon in the nucleotide sequence with a histidine
codon.
[0239] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D4-4 (*LQ*L),
D4-11 (*LQ*L), D4-17 (*LR*L), and D4-23 (*LRW*L), and the human D
gene segment comprises a modification that replaces at least one
endogenous non-histidine codon in the nucleotide sequence with a
histidine codon.
[0240] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D5-5 (WIQLWL;
SEQ ID NO:35); D5-12 (Wl*WLRL; SEQ ID NO:37), D5-18 (WIQLWL; SEQ ID
NO:35), and D5-24 (*RWLQL; SEQ ID NO:39), and the human D gene
segment comprises a modification that replaces at least one
endogenous non-histidine codon in the nucleotide sequence with a
histidine codon.
[0241] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D6-6 (V*QLV),
D6-13 (V*QQLV; SEQ ID NO:41), and D6-19 (V*QWLV; SEQ ID NO:43), and
the human D gene segment further comprises a modification that
replaces at least one endogenous non-histidine codon in the
nucleotide sequence with a histidine codon.
[0242] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes D7-27
(*LG), and the human D gene segment further comprises a
modification that replaces at least one endogenous codon of the
human D gene segment in the nucleotide sequence with a histidine
codon.
[0243] In one embodiment, the reading frame is a hydrophilic frame
of a human D gene segment.
[0244] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D1-1 (YNWND; SEQ ID
NO: 45), D1-7 (YNWNY; SEQ ID NO: 47), D1-20 (YNWND; SEQ ID NO: 45),
and D1-26 (YSGSYY; SEQ ID NO:49), and the human D gene segment
further comprises a modification that replaces at least one
endogenous codon in the nucleotide sequence with a histidine codon.
In one embodiment, the hydrophilic frame comprises a nucleotide
sequence that encodes the amino acid sequence selected from the
group consisting of SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50,
and a combination thereof.
[0245] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D2-2 (GYCSSTSCYT;
SEQ ID NO:51), D2-8 (GYCTNGVCYT; SEQ ID NO: 53), D2-15 (GYCSGGSCYS;
SEQ ID NO:55), and D2-21 (AYCGGDCYS; SEQ ID NO:57), and the human D
gene segment further comprises a modification that replaces at
least one endogenous codon in the nucleotide sequence with a
histidine codon. In one embodiment, the hydrophilic frame comprises
a nucleotide sequence that encodes the amino acid sequence selected
from the group consisting of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID
NO: 56, SEQ ID NO: 58, and a combination thereof.
[0246] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D3-3 (YYDFWSGYYT;
SEQ ID NO:59), D3-9 (YYDILTGYYN; SEQ ID NO:61), D3-10 (YYYGSGSYYN;
SEQ ID NO:63), D3-16 (YYDYVWGSYRYT; SEQ ID NO:65), and D3-22
(YYYDSSGYYY; SEQ ID NO:67), and the human D gene segment further
comprises a modification that replaces at least one endogenous
codon in the nucleotide sequence with a histidine codon. In one
embodiment, the hydrophilic frame comprises a nucleotide sequence
encodes the amino acid sequence selected from the group consisting
of SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ
ID NO: 68, and a combination thereof.
[0247] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D4-4 (DYSNY; SEQ ID
NO:69), D4-11 (DYSNY; SEQ ID NO:69), D4-17 (DYGDY; SEQ ID NO:71),
and D4-23 (DYGGNS; SEQ ID NO:73), and the human D gene segment
comprises a modification that replaces at least one endogenous
codon in the nucleotide sequence with a histidine codon. In one
embodiment, the hydrophilic frame comprises a nucleotide sequence
that encodes the amino acid sequence selected from the group
consisting of SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, and a
combination thereof.
[0248] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D5-5 (GYSYGY; SEQ ID
NO:75), D5-12 (GYSGYDY; SEQ ID NO:77), D5-18 (GYSYGY; SEQ ID
NO:75), and D5-24 (RDGYNY; SEQ ID NO:79), and the human D gene
segment further comprises a modification that replaces at least one
endogenous codon in the nucleotide sequence with a histidine codon.
In one embodiment, the hydrophilic frame comprises a nucleotide
sequence that encodes the amino acid sequence selected from the
group consisting of SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80,
and a combination thereof.
[0249] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D6-6 (EYSSSS; SEQ ID
NO: 81), D6-13 (GYSSSWY; SEQ ID NO:83), and D6-19 (GYSSGWY; SEQ ID
NO:85), and the human D gene segment further comprises a
modification that replaces at least one endogenous codon in the
nucleotide sequence with a histidine codon. In one embodiment, the
hydrophilic frame comprises a nucleotide sequence that encodes the
amino acid sequence selected from the group consisting of SEQ ID
NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 76, and a
combination thereof.
[0250] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes D7-27 (NWG),
and the human D gene segment further comprises a modification that
replaces at least one endogenous codon in the nucleotide sequence a
histidine codon.
[0251] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of SEQ ID NO: 46, SEQ
ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO:
56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ
ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO:
74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ
ID NO: 84, SEQ ID NO: 86, and a combination thereof.
[0252] In one embodiment, the unrearranged heavy chain variable
region nucleotide sequence comprising the inverted human D gene
segment is operably linked to a human or non-human heavy chain
constant region nucleotide sequence that encodes an immunoglobulin
isotype selected from IgM, IgD, IgG, IgE, and IgA.
[0253] In one embodiment, the human unrearranged immunoglobulin
heavy chain variable region nucleotide sequence is operably linked
to a human or non-human heavy chain constant region nucleotide
sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3,
and a combination thereof. In one embodiment, the heavy chain
constant region nucleotide sequence comprises a C.sub.H1, a hinge,
a C.sub.H2, and a C.sub.H3 (i.e.,
C.sub.H1-hinge-C.sub.H2-C.sub.H3).
[0254] In one embodiment, a heavy chain constant region nucleotide
sequence is present at an endogenous locus (i.e., where the
nucleotide sequence is located in a wild-type non-human animal) or
present ectopically (e.g., at a locus different from the endogenous
immunoglobulin chain locus in its genome, or within its endogenous
locus, e.g., within an immunoglobulin variable locus, wherein the
endogenous locus is placed or moved to a different location in the
genome).
[0255] In one embodiment, the heavy chain constant region
nucleotide sequence comprises a modification in a C.sub.H2 or a
C.sub.H3, wherein the modification increases the affinity of the
heavy chain constant region amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0256] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a modification at position 250
(e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or
T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a
modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K)
and/or 434 (e.g., H/F or Y); or a modification at position 250
and/or 428; or a modification at position 307 or 308 (e.g., 308F,
V308F), and 434. In one embodiment, the modification comprises a
428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L,
259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K
(e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and
256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L
modification (e.g., T250Q and M428L); and a 307 and/or 308
modification (e.g., 308F or 308P), wherein the modification
increases the affinity of the heavy chain constant region amino
acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0257] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 252 and 257, wherein the modification increases the
affinity of the human C.sub.H2 amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0258] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 307 and 311, wherein the modification increases the
affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic
environment (e.g., in an endosome where pH ranges from about 5.5 to
about 6.0).
[0259] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H3 amino acid sequence,
wherein the C.sub.H3 amino acid sequence comprises at least one
modification between amino acid residues at positions 433 and 436,
wherein the modification increases the affinity of the C.sub.H3
amino acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0260] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, N434S, and a combination thereof.
[0261] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, V259I, V308F, and a combination thereof.
[0262] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising an N434A mutation.
[0263] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M252Y, S254T, T256E, and a combination thereof.
[0264] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of T250Q, M248L, or both.
[0265] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of H433K, N434Y, or both.
[0266] In one embodiment, the genetically modified immunoglobulin
locus comprises: (1) a first allele, wherein the unrearranged human
immunoglobulin heavy chain variable region nucleotide sequence as
described herein is operably linked to a first heavy chain constant
region nucleotide sequence encoding a first CH.sub.3 amino acid
sequence of a human IgG selected from IgG1, IgG2, IgG4, and a
combination thereof; and (2) a second allele, wherein the
unrearranged human immunoglobulin heavy chain variable region
nucleotide sequence as described herein is operably linked to a
second heavy chain constant region nucleotide sequence encoding a
second C.sub.H3 amino acid sequence of the human IgG selected from
IgG1, IgG2, IgG4, and a combination thereof, and wherein the second
CH.sub.3 amino acid sequence comprises a modification that reduces
or eliminates binding for the second CH.sub.3 amino acid sequence
to Protein A (see, for example, US 2010/0331527A1, which is
incorporated by reference herein in its entirety).
[0267] In one embodiment, the second CH.sub.3 amino acid sequence
comprises an H95R modification (by IMGT exon numbering; H435R by EU
numbering). In one embodiment the second CH.sub.3 amino acid
sequence further comprises an Y96F modification (by IMGT exon
numbering; H436F by EU). In another embodiment, the second CH.sub.3
amino acid sequence comprises both an H95R modification (by IMGT
exon numbering; H435R by EU numbering) and an Y96F modification (by
IMGT exon numbering; H436F by EU).
[0268] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG1 and further comprises a mutation
selected from the group consisting of D16E, L18M, N44S, K52N, V57M,
and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by
EU).
[0269] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG2 and further comprises a mutation
selected from the group consisting of N44S, K52N, and V82I (IMGT:
N384S, K392N, and V422I by EU).
[0270] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG4 and further comprises a mutation
selected from the group consisting of Q15R, N44S, K52N, V57M, R69K,
E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and
V422I by EU).
[0271] In one embodiment, the heavy chain constant region amino
acid sequence is a non-human constant region amino acid sequence,
and the heavy chain constant region amino acid sequence comprises
one or more of any of the types of modifications described
above.
[0272] In one embodiment, the heavy chain constant region
nucleotide sequence is a human heavy chain constant region amino
acid sequence, and the human heavy chain constant region amino acid
sequence comprises one or more of any of the types of modifications
described above.
[0273] In one embodiment, all, or substantially all, endogenous
V.sub.H, D, and J.sub.H gene segments are deleted from an
immunoglobulin heavy chain locus or rendered non-functional (e.g.,
via insertion of a nucleotide sequence (e.g., an exogenous
nucleotide sequence) in the immunoglobulin locus or via
non-functional rearrangement, or inversion, of the endogenous
V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80%
or more, about 85% or more, about 90% or more, about 95% or more,
about 96% or more, about 97% or more, about 98% or more, or about
99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments
are deleted or rendered non-functional. In one embodiment, e.g., at
least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or
J gene segments are deleted or rendered non-functional.
[0274] In one embodiment, the genetically modified locus comprises
a modification that deletes or renders non-functional all or
substantially all endogenous V.sub.H, D, and J.sub.H gene segments;
and the genomic locus comprises the genetically modified,
unrearranged human heavy chain variable region nucleotide sequence
comprising a substitution of at least one endogenous non-histidine
codon with a histidine codon in at least one reading frame. In one
embodiment, the genetically modified, unrearranged immunoglobulin
heavy chain variable gene sequence is present at an endogenous
location (i.e., where the nucleotide sequence is located in a
wild-type non-human animal) or present ectopically (e.g., at a
locus different from the endogenous immunoglobulin chain locus in
its genome), or within its endogenous locus, e.g., within an
immunoglobulin variable locus, wherein the endogenous locus is
placed or moved to a different location in the genome.
[0275] In one embodiment, the genetically modified locus comprises
an endogenous Adam6a gene, Adam6b gene, or both, and the genetic
modification does not affect the expression and/or function of the
endogenous Adam6a gene, Adam6b gene, or both.
[0276] In one embodiment, the genetically modified locus comprises
an ectopically present Adam6a gene, Adam6b gene, or both. In one
embodiment, the Adam6a gene is a non-human Adam6a gene. In one
embodiment, the Adam6a gene is a mouse Adam6a gene. In one
embodiment, the Adam6a gene is a human Adam6a gene. In one
embodiment, the Adam6b gene is a non-human Adam6b gene. In one
embodiment, the Adam6b gene is a mouse Adam6b gene. In one
embodiment, the Adam6b gene is a human Adam6b gene.
[0277] In one embodiment, the genetically modified immunoglobulin
locus further comprises a humanized, unrearranged .lamda. and/or
.kappa. light chain variable gene sequence. In one embodiment, the
humanized, unrearranged .lamda. and/or .kappa. light chain variable
gene sequence is operably linked to an immunoglobulin light chain
constant region nucleotide sequence selected from a .lamda. light
chain constant region nucleotide sequence and a .kappa. light chain
constant region nucleotide sequence. In one embodiment, the
humanized, unrearranged .lamda. light chain variable region
nucleotide sequence is operably linked to a .lamda. light chain
constant region nucleotide sequence. In one embodiment, the .lamda.
light chain constant region nucleotide sequence is a mouse, rat, or
human sequence. In one embodiment, the humanized, unrearranged
.kappa. light chain variable region nucleotide sequence is operably
linked to a .kappa. light chain constant region nucleotide
sequence. In one embodiment, the .kappa. light chain constant
region nucleotide sequence is a mouse, rat, or human sequence.
[0278] In one embodiment, the genetically modified immunoglobulin
locus comprises an unrearranged light chain variable gene sequence
that contains at least one modification that introduces at least
one histidine codon in at least one reading frame encoding a light
chain variable domain. In one embodiment, the genetically modified
immunoglobulin locus comprises a rearranged (e.g., rearranged
.lamda. or .kappa. V/J sequence) sequence that comprises one, two,
three, or four codons for histidine in a light chain CDR. In one
embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a
combination thereof. In one embodiment, the unrearranged or
rearranged light chain variable region nucleotide sequence is an
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence. In one embodiment, the
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence is present at an endogenous
mouse immunoglobulin light chain locus. In one embodiment, the
mouse immunoglobulin light chain locus is a mouse .kappa. locus. In
one embodiment the mouse immunoglobulin light chain locus is a
mouse .lamda. locus.
[0279] In one embodiment, the genetically modified immunoglobulin
locus as described herein is present in an immunoglobulin heavy
chain locus of a mouse. In one embodiment, the genetically modified
immunoglobulin locus is present in a humanized immunoglobulin heavy
chain locus in a VELOCIMMUNE.RTM. mouse.
[0280] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein exhibits a
weaker antigen binding at an acidic environment (e.g., at a pH of
about 5.5 to about 6.0) than a corresponding wild-type heavy chain
variable domain without the genetic modification.
[0281] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin locus as described herein has at least about 2-fold,
at least about 3-fold, at least about 4-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold, at least about 25-fold, or at least about 30-fold
decrease in dissociative half-life (t.sub.1/2) at an acidic pH
(e.g., pH of about 5.5 to about 6.0) as compared to the
dissociative half-life (t.sub.1/2) of the antigen-binding protein
at a neutral pH (e.g., pH of about 7.0 to about 7.4).
[0282] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin locus as described herein is characterized by
improved pH-dependent recyclability, enhanced serum half-life, or
both as compared with a wild-type antigen-binding protein without
the genetic modification.
[0283] In one embodiment, the genetically modified immunoglobulin
locus as described herein comprises a B cell population that, upon
stimulation with an antigen of interest, is capable of producing
antigen-binding proteins, e.g., antibodies, comprising a heavy
chain variable domain comprising one or more histidine residues.
The antigen-binding proteins as described herein, when administered
into a subject, exhibits an increased serum half-life over a
corresponding wild-type antigen-binding protein, which possesses a
similar or sufficiently similar amino acid sequence that encodes
the heavy chain variable domain but does not comprise a histidine
residue in the heavy chain variable domain. In some embodiments,
the antigen-binding protein described herein exhibits an increased
serum half-life that is at least about 2-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold higher than the corresponding wild-type
antigen-binding protein, which possesses a similar or sufficiently
similar amino acid sequence that encodes the heavy chain variable
domain but does not comprise a histidine residue in the heavy chain
variable domain.
[0284] In one embodiment, the non-human animal is heterozygous for
the genetically modified immunoglobulin heavy chain locus, and the
non-human animal is capable of expressing the human immunoglobulin
heavy chain variable domain comprising at least one histidine
residue derived predominantly from the genetically modified
immunoglobulin heavy chain locus as described herein.
[0285] In one aspect, a non-human animal comprising a genetically
modified immunoglobulin locus comprising a human V.sub.H, D, and
J.sub.H gene segment is provided, wherein at least one of the human
D gene segment has been inverted 5' to 3' with respect to a
corresponding wild-type sequence, and wherein at least one reading
frame of the inverted human D gene segment comprises a histidine
codon.
[0286] In one embodiment, the non-human animal is a mammal,
including a rodent, e.g., a mouse, a rat, or a hamster
[0287] In one embodiment, the genetically modified immunoglobulin
locus is present in a germline genome.
[0288] In one embodiment, wherein the reading frame of the inverted
human D gene segment comprises one or more, 2 or more, 3 or more, 4
or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10
or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or
more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more,
21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or
more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more,
32 or more, 33 or more, or 34 or more of histidine codons.
[0289] In one embodiment, at least two, at least three, at least
four, at least five, at least six, at least seven, at least eight,
at least nine, at least ten, at least eleven, at least twelve, at
least thirteen, at least fourteen, at least fifteen, at least
sixteen, at least seventeen, at least eighteen, at least nineteen,
at least twenty, at least twenty one, at least twenty two, at least
twenty three, at least twenty four, or all or substantially all of
functional human D gene segments have inverted orientation with
respect to corresponding wild type sequences.
[0290] In one embodiment, all or substantially all of endogenous
immunoglobulin V.sub.H, D, J.sub.H gene segments are deleted from
the immunoglobulin heavy chain locus or rendered non-functional
(e.g., via insertion of a nucleotide sequence, e.g., exogenous
nucleotide sequence, in the immunoglobulin locus or via
non-functional rearrangement or inversion of all, or substantially
all, endogenous immunoglobulin V.sub.H, D, J.sub.H segments), and
the genetically modified immunoglobulin locus comprises a human
V.sub.H, D, and J.sub.H gene segments, wherein at least one of the
human D gene segment is present in an inverted orientation with
respect to corresponding wild type sequences, and wherein at least
one reading frame of the inverted human D gene segment comprises at
least one histidine codon.
[0291] In one embodiment, the inverted human D gene segment is
operably linked to a human V.sub.H gene segment, and/or human
J.sub.H gene segment
[0292] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is selected from the group consisting of D1-1, D1-7,
D1-20, D1-26, D2-2, D2-8, D2-15, D2-21, D3-3, D3-9, D3-10, D3-16,
D3-22, D4-4, D4-11, D4-17, D4-23, D5-5, D5-12, D5-18, D5-24, D6-6,
D6-13, D6-19, D7-27, and a combination thereof.
[0293] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D1 gene segment selected from the group consisting of
D1-1, D1-7, D1-20, D1-26, and a combination thereof.
[0294] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequences is a D2 gene segment selected from the group consisting
of D2-2, D2-8, D2-15, D2-21, and a combination thereof.
[0295] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D3 gene segment selected from the group consisting of
D3-3, D3-9, D3-10, D3-16, D3-22, and a combination thereof.
[0296] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D4 gene segment selected from the group consisting of
D4-4, D4-11, D4-17, D4-23, and a combination thereof.
[0297] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D5 gene segment selected from the group consisting of
D5-5, D5-12, D5-18, D5-24, and a combination thereof.
[0298] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D6 gene segment selected from the group consisting of
D6-6, D6-13, D6-19, and a combination thereof.
[0299] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is D7-27.
[0300] In one embodiment, the reading frame of the human D gene
segment is selected from a stop reading frame, a hydrophilic
reading frame, a hydrophobic reading frame, and a combination
thereof, wherein at least one reading frame of the inverted human D
gene segment comprises a histidine codon.
[0301] In one embodiment, the unrearranged heavy chain variable
region nucleotide sequence comprising the inverted human D gene
segment is operably linked to a human or non-human heavy chain
constant region nucleotide sequence that encodes an immunoglobulin
isotype selected from IgM, IgD, IgG, IgE, and IgA.
[0302] In one embodiment, the human unrearranged immunoglobulin
heavy chain variable region nucleotide sequence is operably linked
to a human or non-human heavy chain constant region nucleotide
sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3,
and a combination thereof. In one embodiment, the heavy chain
constant region nucleotide sequence comprises a C.sub.H1, a hinge,
a C.sub.H2, and a C.sub.H3 (i.e.,
C.sub.H1-hinge-C.sub.H2-C.sub.H3).
[0303] In one embodiment, a heavy chain constant region nucleotide
sequence is present at an endogenous locus (i.e., where the
nucleotide sequence is located in a wild-type non-human animal) or
present ectopically (e.g., at a locus different from the endogenous
immunoglobulin chain locus in its genome, or within its endogenous
locus, e.g., within an immunoglobulin variable locus, wherein the
endogenous locus is placed or moved to a different location in the
genome).
[0304] In one embodiment, the heavy chain constant region
nucleotide sequence comprises a modification in a C.sub.H2 or a
C.sub.H3, wherein the modification increases the affinity of the
heavy chain constant region amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0305] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a modification at position 250
(e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or
T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a
modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K)
and/or 434 (e.g., H/F or Y); or a modification at position 250
and/or 428; or a modification at position 307 or 308 (e.g., 308F,
V308F), and 434. In one embodiment, the modification comprises a
428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L,
259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K
(e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and
256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L
modification (e.g., T250Q and M428L); and a 307 and/or 308
modification (e.g., 308F or 308P), wherein the modification
increases the affinity of the heavy chain constant region amino
acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0306] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 252 and 257, wherein the modification increases the
affinity of the human C.sub.H2 amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0307] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 307 and 311, wherein the modification increases the
affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic
environment (e.g., in an endosome where pH ranges from about 5.5 to
about 6.0).
[0308] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H3 amino acid sequence,
wherein the C.sub.H3 amino acid sequence comprises at least one
modification between amino acid residues at positions 433 and 436,
wherein the modification increases the affinity of the C.sub.H3
amino acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0309] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, N434S, and a combination thereof.
[0310] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, V259I, V308F, and a combination thereof.
[0311] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising an N434A mutation.
[0312] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M252Y, S254T, T256E, and a combination thereof.
[0313] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of T250Q, M248L, or both.
[0314] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of H433K, N434Y, or both.
[0315] In one embodiment, the genetically modified immunoglobulin
locus comprises: (1) a first allele, wherein the unrearranged human
immunoglobulin heavy chain variable region nucleotide sequence as
described herein is operably linked to a first heavy chain constant
region nucleotide sequence encoding a first CH.sub.3 amino acid
sequence of a human IgG selected from IgG1, IgG2, IgG4, and a
combination thereof; and (2) a second allele, wherein the
unrearranged human immunoglobulin heavy chain variable region
nucleotide sequence as described herein is operably linked to a
second heavy chain constant region nucleotide sequence encoding a
second C.sub.H3 amino acid sequence of the human IgG selected from
IgG1, IgG2, IgG4, and a combination thereof, and wherein the second
CH.sub.3 amino acid sequence comprises a modification that reduces
or eliminates binding for the second CH.sub.3 amino acid sequence
to Protein A (see, for example, US 2010/0331527A1, incorporated by
reference herein in its entirety).
[0316] In one embodiment, the second CH.sub.3 amino acid sequence
comprises an H95R modification (by IMGT exon numbering; H435R by EU
numbering). In one embodiment the second CH.sub.3 amino acid
sequence further comprises an Y96F modification (by IMGT exon
numbering; H436F by EU). In another embodiment, the second CH.sub.3
amino acid sequence comprises both an H95R modification (by IMGT
exon numbering; H435R by EU numbering) and an Y96F modification (by
IMGT exon numbering; H436F by EU).
[0317] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG1 and further comprises a mutation
selected from the group consisting of D16E, L18M, N44S, K52N, V57M,
and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by
EU).
[0318] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG2 and further comprises a mutation
selected from the group consisting of N44S, K52N, and V82I (IMGT:
N384S, K392N, and V422I by EU).
[0319] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG4 and further comprises a mutation
selected from the group consisting of Q15R, N44S, K52N, V57M, R69K,
E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and
V422I by EU).
[0320] In one embodiment, the heavy chain constant region amino
acid sequence is a non-human constant region amino acid sequence,
and the heavy chain constant region amino acid sequence comprises
one or more of any of the types of modifications described
above.
[0321] In one embodiment, the heavy chain constant region
nucleotide sequence is a human heavy chain constant region amino
acid sequence, and the human heavy chain constant region amino acid
sequence comprises one or more of any of the types of modifications
described above.
[0322] In one embodiment, all or substantially all endogenous
V.sub.H, D, and J.sub.H gene segments are deleted from an
immunoglobulin heavy chain locus or rendered non-functional (e.g.,
via insertion of a nucleotide sequence (e.g., an exogenous
nucleotide sequence) in the immunoglobulin locus or via
non-functional rearrangement, or inversion, of the endogenous
V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80%
or more, about 85% or more, about 90% or more, about 95% or more,
about 96% or more, about 97% or more, about 98% or more, or about
99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments
are deleted or rendered non-functional. In one embodiment, e.g., at
least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or
J gene segments are deleted or rendered non-functional.
[0323] In one embodiment, the genetically modified immunoglobulin
heavy chain locus comprises a modification that deletes or renders,
all or substantially all, non-functional endogenous V.sub.H, D, and
J.sub.H gene segments; and the genetically modified locus comprises
an unrearranged heavy chain variable region nucleotide sequence
comprising at least one inverted human D gene segment as described
herein wherein the unrearranged heavy chain variable region
nucleotide sequence is present at an endogenous location (i.e.,
where the nucleotide sequence is located in a wild-type non-human
animal) or present ectopically (e.g., at a locus different from the
endogenous immunoglobulin chain locus in its genome, or within its
endogenous locus, e.g., within an immunoglobulin variable locus,
wherein the endogenous locus is placed or moved to a different
location in the genome).
[0324] In one embodiment, the genetically modified immunoglobulin
locus comprises an endogenous Adam6a gene, Adam6b gene, or both,
and the genetic modification does not affect the expression and/or
function of the endogenous Adam6a gene, Adam6b gene, or both.
[0325] In one embodiment, the genetically modified immunoglobulin
locus comprises an ectopically present Adam6a gene, Adam6b gene, or
both. In one embodiment, the Adam6a gene is a non-human Adam6a
gene. In one embodiment, the Adam6a gene is a mouse Adam6a gene. In
one embodiment, the Adam6a gene is a human Adam6a gene. In one
embodiment, the Adam6b gene is a non-human Adam6b gene. In one
embodiment, the Adam6b gene is a mouse Adam6b gene. In one
embodiment, the Adam6b gene is a human Adam6b gene.
[0326] In one embodiment, the genetically modified immunoglobulin
locus further comprises a humanized, unrearranged .lamda. and/or
.kappa. light chain variable gene sequence. In one embodiment, the
humanized, unrearranged .lamda. and/or .kappa. light chain variable
gene sequence is operably linked to an immunoglobulin light chain
constant region nucleotide sequence selected from a .lamda. light
chain constant region nucleotide sequence and a .kappa. light chain
constant region nucleotide sequence. In one embodiment, the
humanized, unrearranged .lamda. light chain variable region
nucleotide sequence is operably linked to a .lamda. light chain
constant region nucleotide sequence. In one embodiment, the .lamda.
light chain constant region nucleotide sequence is a mouse, rat, or
human sequence. In one embodiment, the humanized, unrearranged
.kappa. light chain variable region nucleotide sequence is operably
linked to a .kappa. light chain constant region nucleotide
sequence. In one embodiment, the .kappa. light chain constant
region nucleotide sequence is a mouse, rat, or human sequence.
[0327] In one embodiment, the genetically modified immunoglobulin
locus comprises an unrearranged light chain variable gene sequence
that contains at least one modification that introduces at least
one histidine codon in at least one reading frame encoding a light
chain variable domain. In one embodiment, the genetically modified
immunoglobulin locus comprises a rearranged (e.g., a rearranged
.lamda. or .kappa. V/J sequence) sequence that comprises one, two,
three, or four codons for histidine in a light chain CDR. In one
embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a
combination thereof. In one embodiment, the unrearranged or
rearranged light chain variable region nucleotide sequence is an
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence. In one embodiment, the
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence is present at an endogenous
mouse immunoglobulin light chain locus. In one embodiment, the
mouse immunoglobulin light chain locus is a mouse .kappa. locus. In
one embodiment, the mouse immunoglobulin light chain locus is a
mouse immunoglobulin light chain locus is a mouse .lamda.
locus.
[0328] In one embodiment, the genetically modified immunoglobulin
locus as described herein is present in an immunoglobulin heavy
chain locus of a mouse. In one embodiment, the genetically modified
immunoglobulin locus is present in a humanized immunoglobulin heavy
chain locus in a VELOCIMMUNE.RTM. mouse.
[0329] In one embodiment, the non-human animal is heterozygous for
the genetically modified immunoglobulin heavy chain locus, and the
non-human animal is capable of expressing the human immunoglobulin
heavy chain variable domain comprising at least one histidine
residue derived predominantly from the genetically modified
immunoglobulin heavy chain locus as described herein.
[0330] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein exhibits a
weaker antigen binding at an acidic environment (e.g., at a pH of
about 5.5 to about 6.0) than a corresponding wild-type heavy chain
variable domain without the genetic modification.
[0331] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin locus as described herein has at least about 2-fold,
at least about 3-fold, at least about 4-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold, at least about 25-fold, or at least about 30-fold
decrease in dissociative half-life (t.sub.1/2) at an acidic pH
(e.g., pH of about 5.5 to about 6.0) as compared to the
dissociative half-life (t.sub.1/2) of the antigen-binding protein
at a neutral pH (e.g., pH of about 7.0 to about 7.4).
[0332] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin locus as described herein is characterized by
improved pH-dependent recyclability, enhanced serum half-life, or
both as compared with a wild-type antigen-binding protein without
the genetic modification.
[0333] In one embodiment, the genetically modified immunoglobulin
locus described herein comprises a B cell population that, upon
stimulation with an antigen of interest, is capable of producing
antigen-binding proteins, e.g., antibodies, comprising a heavy
chain variable domain comprising one or more histidine residues.
The antigen-binding proteins as described herein when administered
into a subject, exhibits an increased serum half-life over a
corresponding wild-type antigen-binding protein, which possesses a
similar or sufficiently similar amino acid sequence that encodes
the heavy chain variable domain but does not comprise a histidine
residue in the heavy chain variable domain. In some embodiments,
the antigen-binding protein described herein exhibits an increased
serum half-life that is at least about 2-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold higher than the corresponding wild-type
antigen-binding protein, which possesses a similar or sufficiently
similar amino acid sequence that encodes the heavy chain variable
domain but does not comprise a histidine residue in the heavy chain
variable domain.
[0334] In one aspect, a non-human animal that is capable of
expressing an antigen-binding protein with enhanced pH-dependent
recyclability and/or enhanced serum half-life are provided, wherein
the non-human animal comprises in its germline genome an
unrearranged human immunoglobulin heavy chain variable region
nucleotide sequence, wherein the unrearranged heavy chain variable
region nucleotide sequence comprises an addition of least one
histidine codon or a substitution of at least one endogenous
non-histidine codon with a histidine codon as described herein.
[0335] In one embodiment, the antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein exhibits a
weaker antigen binding at an acidic environment (e.g., at a pH of
about 5.5 to about 6.0) than a corresponding wild-type heavy chain
variable domain without the genetic modification.
[0336] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin locus as described herein has at least about 2-fold,
at least about 3-fold, at least about 4-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold, at least about 25-fold, or at least about 30-fold
decrease in dissociative half-life (t.sub.1/2) at an acidic pH
(e.g., pH of about 5.5 to about 6.0) as compared to the
dissociative half-life (t.sub.1/2) of the antigen-binding protein
at a neutral pH (e.g., pH of about 7.0 to about 7.4).
[0337] In one embodiment, the antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin locus as described herein is characterized by
improved pH-dependent recyclability, enhanced serum half-life, or
both as compared with a wild-type antigen-binding protein without
the genetic modification.
[0338] In one embodiment, the genetically modified immunoglobulin
locus described herein comprises a B cell population that, upon
stimulation with an antigen of interest, is capable of producing
antigen-binding proteins, e.g., antibodies, comprising a heavy
chain variable domain comprising one or more histidine residues.
The antigen-binding proteins as described herein when administered
into a subject, exhibits an increased serum half-life over a
corresponding wild-type antigen-binding protein, which possesses a
similar or sufficiently similar amino acid sequence that encodes
the heavy chain variable domain but does not comprise a histidine
residue in the heavy chain variable domain. In some embodiments,
the antigen-binding protein described herein exhibits an increased
serum half-life that is at least about 2-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold higher than the corresponding wild-type
antigen-binding protein, which possesses a similar or sufficiently
similar amino acid sequence that encodes the heavy chain variable
domain but does not comprise a histidine residue in the heavy chain
variable domain.
[0339] In one aspect, a targeting construct is provided, comprising
5' and 3' targeting arms homologous to a genomic D region or
genomic V and J region of a non-human animal, wherein at least one
V.sub.H, D, or J.sub.H gene segment comprises any of the
modifications as described herein, e.g., an addition of at least
one histidine codon, a substitution of at least one endogenous
non-histidine codon into a histidine codon, and/or inversion of at
least one functional D gene segment with respect to a corresponding
wild type sequence.
[0340] In one aspect, a hybridoma or quadroma is provided that is
derived from a cell of any of the non-human animal as described
herein. In one embodiment, the non-human animal is a rodent, e.g.,
a mouse, a rat, or a hamster.
[0341] In one aspect, pluripotent, induced pluripotent, or
totipotent stem cells derived form a non-human animal comprising
the various genomic modifications of the described invention are
provided. In a specific embodiment, the pluripotent, induced
pluripotent, or totipotent stem cells are mouse or rat embryonic
stem (ES) cells. In one embodiment, the pluripotent, induced
pluripotent, or totipotent stem cells have an XX karyotype or an XY
karyotype. In one embodiment, the pluripotent or induced
pluripotent stem cells are hematopoietic stem cells.
[0342] In one aspect, cells that comprise a nucleus containing a
genetic modification as described herein are also provided, e.g., a
modification introduced into a cell by pronuclear injection. In one
embodiment, the pluripotent, induced pluripotent, or totipotent
stem cells comprise a genetically modified immunoglobulin genomic
locus, wherein the genomic locus comprises, from 5' to 3', (1) an
FRT recombination site, (2) human V.sub.H gene segments, (3) a
mouse adam6 gene, (4) a loxP recombination site, (5)
histidine-substituted human D gene segments, (6) human J.sub.H gene
segments, followed by (7) a mouse E.sub.i (intronic enhancer), and
(8) a mouse IgM constant region nucleotide sequence.
[0343] In one aspect, a lymphocyte isolated from a genetically
modified non-human animal as described herein is provided. In one
embodiment, the lymphocyte is a B cell, wherein the B cell
comprises an immunoglobulin genomic locus comprising an
unrearranged heavy chain variable region nucleotide sequence
wherein the unrearranged heavy chain variable gene sequence
comprises an addition of least one histidine codon or a
substitution of at least one endogenous non-histidine codon with a
histidine codon.
[0344] In one aspect, a lymphocyte isolated from a genetically
modified non-human animal as described herein is provided. In one
embodiment, the lymphocyte is a B cell, wherein the B cell
comprises an immunoglobulin locus that comprises a human V, D, and
J gene segment, wherein at least one of the human D gene segment
has been inverted 5' to 3' with respect to wild-type sequences, and
wherein at least one reading frame of the inverted human D gene
segment encodes at least one histidine residue. In one embodiment,
the B cell is capable of producing an antigen-binding protein
comprising the genetically modified heavy chain variable domain as
described herein. In one embodiment, the genetically modified heavy
chain variable domain as described herein is operably linked to a
heavy chain constant region amino acid sequence.
[0345] In one aspect, a B cell population is provided that are
capable of expressing an antigen-binding protein comprising at
least one histidine residue in a heavy chain variable domain,
wherein the B cell population comprises any genetic modifications
as described herein. In one embodiment, the at least one histidine
residue is present in a heavy chain CDR. In one embodiment, the CDR
is a selected from a CDR1, CDR2, CDR3, and a combination thereof.
In one embodiment, the at least one histidine residue is present in
CDR3.
[0346] In one aspect, a B cell population is provided that are
capable of expressing an antigen-binding protein with enhanced
serum half-life and/or enhanced pH-dependent recyclability, wherein
the B cell population comprises any genetic modifications as
described herein.
[0347] In one aspect, a method for making a non-human animal
comprising a genetically modified immunoglobulin heavy chain
variable locus is provided, comprising:
[0348] (a) modifying a genome of a non-human animal to delete or
render non-functional endogenous immunoglobulin heavy chain V, D,
and J gene segments (e.g., via insertion of a nucleotide sequence,
e.g., an exogenous nucleotide sequence, in the immunoglobulin locus
or via non-functional rearrangement or inversion of endogenous
V.sub.H, D, J.sub.H segments); and
[0349] (b) placing in the genome an unrearranged heavy chain
variable region nucleotide sequence, wherein the unrearranged heavy
chain variable region nucleotide sequence comprises an addition of
least one histidine codon or a substitution of at least one
endogenous non-histidine codon with a histidine codon as described
herein.
[0350] In one embodiment, the non-human animal is a mammal,
including a rodent, e.g., a mouse, a rat, or a hamster.
[0351] In one embodiment, 2 or more, 3 or more, 4 or more, 5 or
more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or
more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more,
17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or
more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more,
28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or
more, 34 or more, 35 or more, 36 or more, 37 or more, 38 or more,
39 or more, 40 or more, 41 or more, 42 or more, 43 or more, 44 or
more, 45 or more, 46 or more, 47 or more, 48 or more, 49 or more,
50 or more, 51 or more, 52 or more, 53 or more, 54 or more, 55 or
more, 56 or more, 57 or more, 58 or more, 59 or more, 60 or more,
or 61 or more of the endogenous non-histidine codons are replaced
with histidine codons.
[0352] In one embodiment, the endogenous non-histone codon encodes
the amino acid selected from Y, N, D, Q, S, W, and R.
[0353] In one embodiment, the added or substituted histidine codon
is present in an unrearranged heavy chain variable region
nucleotide sequence that encodes an immunoglobulin variable domain
selected from an N-terminal region, a loop 4 region, a CDR1, a
CDR2, a CDR3, a combination thereof.
[0354] In one embodiment, the added substituted histidine codon
histidine codon is present in an unrearranged heavy chain variable
region nucleotide sequence that encodes a complementary determining
region (CDR) selected from a CDR1, a CDR2, a CDR3, and a
combination thereof.
[0355] In one embodiment, the added or substituted histidine codon
is present in an unrearranged heavy chain variable region
nucleotide sequence that encodes a frame region (FR) selected from
FR1, FR2, FR3, FR4, and a combination thereof.
[0356] In one embodiment, the unrearranged heavy chain variable
region nucleotide sequence comprises a genetically modified human
V.sub.H gene segment, wherein one or more endogenous non-histidine
codon in at least one reading frame of the human V.sub.H gene
segment has been replaced with a histidine codon.
[0357] In one embodiment, the human unrearranged heavy chain
variable region nucleotide sequence comprises a modification that
replaces at least one endogenous non-histidine codon of a human
V.sub.H gene segment with a histidine codon, wherein the human
V.sub.H gene segment is selected from the group consisting of
V.sub.H1-2, V.sub.H1-3, V.sub.H1-8, V.sub.H1-18, V.sub.H1-24,
V.sub.H1-45, V.sub.H1-46, V.sub.H1-58, V.sub.H1-69, V.sub.H2-5,
V.sub.H2-26, V.sub.H2-70, V.sub.H3-7, V.sub.H3-9, V.sub.H3-11,
V.sub.H3-13, V.sub.H3-15, V.sub.H3-16, V.sub.H3-20, V.sub.H3-21,
V.sub.H3-23, V.sub.H3-30, V.sub.H3-30-3, V.sub.H 3-30-5,
V.sub.H3-33, V.sub.H3-35, V.sub.H3-38, V.sub.H3-43, V.sub.H3-48,
V.sub.H3-49, V.sub.H3-53, V.sub.H3-64, V.sub.H3-66, V.sub.H3-72,
V.sub.H3-73, V.sub.H3-74, V.sub.H4-4, V.sub.H4-28, V.sub.H4-30-1,
V.sub.H4-30-2, V.sub.H4-30-4, V.sub.H4-31, V.sub.H4-34,
V.sub.H4-39, V.sub.H4-59, V.sub.H4-61, V.sub.H5-51, V.sub.H6-1,
V.sub.H7-4-1, V.sub.H7-81, and a combination thereof.
[0358] In one embodiment, the human unrearranged heavy chain
variable region nucleotide sequence comprises a genetically
modified human J.sub.H gene segment, wherein one or more endogenous
non-histidine codon in at least one reading frame of the human
J.sub.H gene segment has been replaced with a histidine codon.
[0359] In one embodiment, the human unrearranged heavy chain
variable region nucleotide sequence comprises a modification that
replaces at least one endogenous non-histidine codon of a human
J.sub.H segment with a histidine codon, wherein the human J.sub.H
gene segment is selected from the group consisting of J.sub.H1,
J.sub.H2, 43, 44, 45, J.sub.H6, and a combination thereof.
[0360] In one embodiment, the added or substituted histidine codon
is present in a heavy chain variable region nucleotide sequence
that encodes part of a CDR3. In one embodiment, the part of CDR3
comprises an amino acid sequence derived from a reading frame of a
genetically modified human D gene segment comprising a modification
that replaces at least one endogenous non-histidine codon in the
reading frame with a histidine codon.
[0361] In one embodiment, the endogenous non-histidine codon that
is substituted with a histidine codon encodes the amino acid
selected from Y, N, D, Q, S, W, and R.
[0362] In one embodiment, the added or substituted histidine codon
is present in at least one reading frame of the human D gene
segment that is most frequently observed in VELOCIMMUNE.RTM.
humanized immunoglobulin mice.
[0363] In one embodiment, the reading frame of the genetically
modified human D gene segment that encodes part of CDR3 is selected
from a hydrophobic frame, a stop frame, and a hydrophilic
frame.
[0364] In one embodiment, the reading frame is a hydrophobic frame
of a human D gene segment.
[0365] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D1-1 (GTTGT; SEQ ID
NO: 88), D1-7 (GITGT; SEQ ID NO: 89), D1-20 (GITGT; SEQ ID NO: 89),
and D1-26 (GIVGAT; SEQ ID NO:90), and the human D gene segment
further comprises a modification that replaces at least one
endogenous non-histidine codon in the nucleotide sequence with a
histidine codon.
[0366] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D2-2 (DIVVVPAAI; SEQ
ID NO:92), D2-8 (DIVLMVYAI; SEQ ID NO: 94), D2-15 (DIVVVVAAT; SEQ
ID NO:95), and D2-21 (HIVVVTAI; SEQ ID NO: 97), and the human D
gene segment further comprises a modification that replaces at
least one endogenous non-histidine codon in the nucleotide sequence
with a histidine codon.
[0367] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D3-3 (ITIFGVVII; SEQ
ID NO:98), D3-9 (ITIF*LVII; SEQ ID NO:99, SEQ ID NO:100), D3-10
(ITMVRGVII; SEQ ID NO:101), D3-16 (IMITFGGVIVI; SEQ ID NO:102), and
D3-22 (ITMIVVVIT; SEQ ID NO:103), and the human D gene segment
further comprises a modification that replaces at least one
endogenous codon in the nucleotide sequence with a histidine
codon.
[0368] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D4-4 (TTVT; SEQ ID
NO:105), D4-11 (TTVT; SEQ ID NO:105), D4-17 (TTVT; SEQ ID NO:105),
D4-23 (TTVVT; SEQ ID NO: 106) and the human D gene segment further
comprises a modification that replaces at least one endogenous
non-histidine codon in the nucleotide sequence with a histidine
codon.
[0369] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D5-5 (VDTAMV; SEQ ID
NO: 107), D5-12 (VDIVATI; SEQ ID NO:108), D5-18 (VDTAMV; SEQ ID
NO:107), and D5-24 (VEMATI; SEQ ID NO:109), and the human D gene
segment further comprises a modification that replaces at least one
endogenous non-histidine codon in the nucleotide sequence with a
histidine codon.
[0370] In one embodiment, the hydrophobic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D6-6 (SIAAR; SEQ ID
NO:111), D6-13 (GIAAAG; SEQ ID NO:113), and D6-19 (GIAVAG; SEQ ID
NO:115), and the human D gene segment further comprises a
modification that replaces at least one endogenous non-histidine
codon in the nucleotide sequence with a histidine codon.
[0371] In one embodiment, the hydrophobic frame comprises a
nucleotide sequence that encodes human D7-27 (LTG), and the human D
gene segment further comprises a modification that replaces at
least one endogenous non-histidine codon in the nucleotide sequence
with a histidine codon.
[0372] In one embodiment, the reading frame is a stop reading frame
of a human D gene segment.
[0373] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D1-1 (VQLER;
SEQ ID NO:8), D1-7(V*LEL), D1-20(V*LER), D1-26 (V*WELL; SEQ ID
NO:12), and the human D gene segment further comprises a
modification that replaces at least one endogenous non-histidine
codon in the nucleotide sequence with a histidine codon.
[0374] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D2-2
(RIL**YQLLY; SEQ ID NO:14), D2-8 (RILY*WCMLY; SEQ ID NO:16 and SEQ
ID NO: 17), D2-15 (RIL*WW*LLL), and D2-21 (SILWW*LLF; SEQ ID
NO:19), and the human D gene segment further comprises a
modification that replaces at least one endogenous non-histidine
codon in the nucleotide sequence with a histidine codon.
[0375] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D3-3
(VLRFLEWLLY; SEQ ID NO:21), D3-9 (VLRYFDWLL*; SEQ ID NO:23), D3-10
(VLLWFGELL*; SEQ ID NO:25), D3-16 (VL*LRLGELSLY; SEQ ID NO:27), and
D3-22 (VLL***WLLL; SEQ ID NO:29), and the human D gene segment
comprises a modification that replaces at least one endogenous
non-histidine codon in the nucleotide sequence with a histidine
codon.
[0376] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D4-4 (*LQ*L),
D4-11 (*LQ*L), D4-17 (*LR*L), and D4-23 (*LRW*L), and the human D
gene segment comprises a modification that replaces at least one
endogenous non-histidine codon in the nucleotide sequence with a
histidine codon.
[0377] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D5-5 (WIQLWL;
SEQ ID NO:35); D5-12 (Wl*WLRL; SEQ ID NO:37), D5-18 (WIQLWL; SEQ ID
NO:35), and D5-24 (*RWLQL; SEQ ID NO:39), and the human D gene
segment comprises a modification that replaces at least one
endogenous non-histidine codon in the nucleotide sequence with a
histidine codon.
[0378] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes the amino
acid sequence selected from the group consisting of D6-6 (V*QLV),
D6-13 (V*QQLV; SEQ ID NO:41), and D6-19 (V*QWLV; SEQ ID NO:43), and
the human D gene segment further comprises a modification that
replaces at least one endogenous non-histidine codon in the
nucleotide sequence with a histidine codon.
[0379] In one embodiment, the stop reading frame of the human D
gene segment comprises a nucleotide sequence that encodes D7-27
(*LG), and the human D gene segment further comprises a
modification that replaces at least one endogenous codon of the
human D gene segment in the nucleotide sequence with a histidine
codon.
[0380] In one embodiment, the reading frame is a hydrophilic frame
of a human D gene segment.
[0381] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D1-1 (YNWND; SEQ ID
NO: 45), D1-7 (YNWNY; SEQ ID NO: 47), D1-20 (YNWND; SEQ ID NO: 45),
and D1-26 (YSGSYY; SEQ ID NO:49), and the human D gene segment
further comprises a modification that replaces at least one
endogenous codon in the nucleotide sequence with a histidine codon.
In one embodiment, the hydrophilic frame comprises a nucleotide
sequence that encodes the amino acid sequence selected from the
group consisting of SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50,
and a combination thereof.
[0382] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D2-2 (GYCSSTSCYT;
SEQ ID NO:51), D2-8 (GYCTNGVCYT; SEQ ID NO: 53), D2-15 (GYCSGGSCYS;
SEQ ID NO:55), and D2-21 (AYCGGDCYS; SEQ ID NO:57), and the human D
gene segment further comprises a modification that replaces at
least one endogenous codon in the nucleotide sequence with a
histidine codon. In one embodiment, the hydrophilic frame comprises
a nucleotide sequence that encodes the amino acid sequence selected
from the group consisting of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID
NO: 56, SEQ ID NO: 58, and a combination thereof.
[0383] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D3-3 (YYDFWSGYYT;
SEQ ID NO:59), D3-9 (YYDILTGYYN; SEQ ID NO:61), D3-10 (YYYGSGSYYN;
SEQ ID NO:63), D3-16 (YYDYVWGSYRYT; SEQ ID NO:65), and D3-22
(YYYDSSGYYY; SEQ ID NO:67), and the human D gene segment further
comprises a modification that replaces at least one endogenous
codon in the nucleotide sequence with a histidine codon. In one
embodiment, the hydrophilic frame comprises a nucleotide sequence
encodes the amino acid sequence selected from the group consisting
of SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ
ID NO: 68, and a combination thereof.
[0384] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D4-4 (DYSNY; SEQ ID
NO:69), D4-11 (DYSNY; SEQ ID NO:69), D4-17 (DYGDY; SEQ ID NO:71),
and D4-23 (DYGGNS; SEQ ID NO:73), and the human D gene segment
comprises a modification that replaces at least one endogenous
codon in the nucleotide sequence with a histidine codon. In one
embodiment, the hydrophilic frame comprises a nucleotide sequence
that encodes the amino acid sequence selected from the group
consisting of SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, and a
combination thereof.
[0385] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D5-5 (GYSYGY; SEQ ID
NO:75), D5-12 (GYSGYDY; SEQ ID NO:77), D5-18 (GYSYGY; SEQ ID
NO:75), and D5-24 (RDGYNY; SEQ ID NO:79), and the human D gene
segment further comprises a modification that replaces at least one
endogenous codon in the nucleotide sequence with a histidine codon.
In one embodiment, the hydrophilic frame comprises a nucleotide
sequence that encodes the amino acid sequence selected from the
group consisting of SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80,
and a combination thereof.
[0386] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of D6-6 (EYSSSS; SEQ ID
NO: 81), D6-13 (GYSSSWY; SEQ ID NO:83), and D6-19 (GYSSGWY; SEQ ID
NO:85), and the human D gene segment further comprises a
modification that replaces at least one endogenous codon in the
nucleotide sequence with a histidine codon. In one embodiment, the
hydrophilic frame comprises a nucleotide sequence that encodes the
amino acid sequence selected from the group consisting of SEQ ID
NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 76, and a
combination thereof.
[0387] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes D7-27 (NWG),
and the human D gene segment further comprises a modification that
replaces at least one endogenous codon in the nucleotide sequence a
histidine codon.
[0388] In one embodiment, the hydrophilic frame of the human D gene
segment comprises a nucleotide sequence that encodes the amino acid
sequence selected from the group consisting of SEQ ID NO: 46, SEQ
ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO:
56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ
ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO:
74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ
ID NO: 84, SEQ ID NO: 86, and a combination thereof.
[0389] In one embodiment, the unrearranged heavy chain variable
region nucleotide sequence comprising the inverted human D gene
segment is operably linked to a human or non-human heavy chain
constant region nucleotide sequence that encodes an immunoglobulin
isotype selected from IgM, IgD, IgG, IgE, and IgA.
[0390] In one embodiment, the human unrearranged immunoglobulin
heavy chain variable region nucleotide sequence is operably linked
to a human or non-human heavy chain constant region nucleotide
sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3,
and a combination thereof. In one embodiment, the heavy chain
constant region nucleotide sequence comprises a C.sub.H1, a hinge,
a C.sub.H2, and a C.sub.H3 (i.e.,
C.sub.H1-hinge-C.sub.H2-C.sub.H3).
[0391] In one embodiment, a heavy chain constant region nucleotide
sequence is present at an endogenous locus (i.e., where the
nucleotide sequence is located in a wild-type non-human animal) or
present ectopically (e.g., at a locus different from the endogenous
immunoglobulin chain locus in its genome, or within its endogenous
locus, e.g., within an immunoglobulin variable locus, wherein the
endogenous locus is placed or moved to a different location in the
genome).
[0392] In one embodiment, the heavy chain constant region
nucleotide sequence comprises a modification in a C.sub.H2 or a
C.sub.H3, wherein the modification increases the affinity of the
heavy chain constant region amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0393] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a modification at position 250
(e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or
T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a
modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K)
and/or 434 (e.g., H/F or Y); or a modification at position 250
and/or 428; or a modification at position 307 or 308 (e.g., 308F,
V308F), and 434. In one embodiment, the modification comprises a
428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L,
259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K
(e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and
256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L
modification (e.g., T250Q and M428L); and a 307 and/or 308
modification (e.g., 308F or 308P), wherein the modification
increases the affinity of the heavy chain constant region amino
acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0394] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 252 and 257, wherein the modification increases the
affinity of the human C.sub.H2 amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0395] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 307 and 311, wherein the modification increases the
affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic
environment (e.g., in an endosome where pH ranges from about 5.5 to
about 6.0).
[0396] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H3 amino acid sequence,
wherein the C.sub.H3 amino acid sequence comprises at least one
modification between amino acid residues at positions 433 and 436,
wherein the modification increases the affinity of the C.sub.H3
amino acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0397] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, N434S, and a combination thereof.
[0398] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, V259I, V308F, and a combination thereof.
[0399] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising an N434A mutation.
[0400] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M252Y, S254T, T256E, and a combination thereof.
[0401] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of T250Q, M248L, or both.
[0402] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of H433K, N434Y, or both.
[0403] In one embodiment, the genetically modified immunoglobulin
locus comprises: (1) a first allele, wherein the unrearranged human
immunoglobulin heavy chain variable region nucleotide sequence as
described herein is operably linked to a first heavy chain constant
region nucleotide sequence encoding a first CH.sub.3 amino acid
sequence of a human IgG selected from IgG1, IgG2, IgG4, and a
combination thereof; and (2) a second allele, wherein the
unrearranged human immunoglobulin heavy chain variable region
nucleotide sequence as described herein is operably linked to a
second heavy chain constant region nucleotide sequence encoding a
second C.sub.H3 amino acid sequence of the human IgG selected from
IgG1, IgG2, IgG4, and a combination thereof, and wherein the second
CH.sub.3 amino acid sequence comprises a modification that reduces
or eliminates binding for the second CH.sub.3 amino acid sequence
to Protein A (see, for example, US 2010/0331527A1, which is
incorporated by reference herein in its entirety).
[0404] In one embodiment, the second CH.sub.3 amino acid sequence
comprises an H95R modification (by IMGT exon numbering; H435R by EU
numbering). In one embodiment the second CH.sub.3 amino acid
sequence further comprises an Y96F modification (by IMGT exon
numbering; H436F by EU). In another embodiment, the second CH.sub.3
amino acid sequence comprises both an H95R modification (by IMGT
exon numbering; H435R by EU numbering) and an Y96F modification (by
IMGT exon numbering; H436F by EU).
[0405] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG1 and further comprises a mutation
selected from the group consisting of D16E, L18M, N44S, K52N, V57M,
and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by
EU).
[0406] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG2 and further comprises a mutation
selected from the group consisting of N44S, K52N, and V82I (IMGT:
N384S, K392N, and V422I by EU).
[0407] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG4 and further comprises a mutation
selected from the group consisting of Q15R, N44S, K52N, V57M, R69K,
E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and
V422I by EU).
[0408] In one embodiment, the heavy chain constant region amino
acid sequence is a non-human constant region amino acid sequence,
and the heavy chain constant region amino acid sequence comprises
one or more of any of the types of modifications described
above.
[0409] In one embodiment, the heavy chain constant region
nucleotide sequence is a human heavy chain constant region amino
acid sequence, and the human heavy chain constant region amino acid
sequence comprises one or more of any of the types of modifications
described above.
[0410] In one embodiment, all or substantially all endogenous
V.sub.H, D, and J.sub.H gene segments are deleted from an
immunoglobulin heavy chain locus or rendered non-functional (e.g.,
via insertion of a nucleotide sequence (e.g., an exogenous
nucleotide sequence) in the immunoglobulin locus or via
non-functional rearrangement, or inversion, of the endogenous
V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80%
or more, about 85% or more, about 90% or more, about 95% or more,
about 96% or more, about 97% or more, about 98% or more, or about
99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments
are deleted or rendered non-functional. In one embodiment, e.g., at
least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or
J gene segments are deleted or rendered non-functional.
[0411] In one embodiment, the genetically modified locus comprises
a modification that deletes or renders non-functional all or
substantially all endogenous V.sub.H, D, and J.sub.H gene segments;
and the genomic locus comprises the genetically modified,
unrearranged human heavy chain variable region nucleotide sequence
comprising a substitution of at least one endogenous non-histidine
codon with a histidine codon in at least one reading frame. In one
embodiment, the genetically modified, unrearranged immunoglobulin
heavy chain variable gene sequence is present at an endogenous
location (i.e., where the nucleotide sequence is located in a
wild-type non-human animal) or present ectopically (e.g., at a
locus different from the endogenous immunoglobulin chain locus in
its genome), or within its endogenous locus, e.g., within an
immunoglobulin variable locus, wherein the endogenous locus is
placed or moved to a different location in the genome.
[0412] In one embodiment, the genetically modified locus comprises
an endogenous Adam6a gene, Adam6b gene, or both, and the genetic
modification does not affect the expression and/or function of the
endogenous Adam6a gene, Adam6b gene, or both.
[0413] In one embodiment, the genetically modified locus comprises
an ectopically present Adam6a gene, Adam6b gene, or both. In one
embodiment, the Adam6a gene is a non-human Adam6a gene. In one
embodiment, the Adam6a gene is a mouse Adam6a gene. In one
embodiment, the Adam6a gene is a human Adam6a gene. In one
embodiment, the Adam6b gene is a non-human Adam6b gene. In one
embodiment, the Adam6b gene is a mouse Adam6b gene. In one
embodiment, the Adam6b gene is a human Adam6b gene.
[0414] In one embodiment, the genetically modified immunoglobulin
locus further comprises a humanized, unrearranged .lamda. and/or
.kappa. light chain variable gene sequence. In one embodiment, the
humanized, unrearranged .lamda. and/or .kappa. light chain variable
gene sequence is operably linked to an immunoglobulin light chain
constant region nucleotide sequence selected from a .lamda. light
chain constant region nucleotide sequence and a .kappa. light chain
constant region nucleotide sequence. In one embodiment, the
humanized, unrearranged .lamda. light chain variable region
nucleotide sequence is operably linked to a .lamda. light chain
constant region nucleotide sequence. In one embodiment, the .lamda.
light chain constant region nucleotide sequence is a mouse, rat, or
human sequence. In one embodiment, the humanized, unrearranged
.kappa. light chain variable region nucleotide sequence is operably
linked to a .kappa. light chain constant region nucleotide
sequence. In one embodiment, the .kappa. light chain constant
region nucleotide sequence is a mouse, rat, or human sequence.
[0415] In one embodiment, the genetically modified immunoglobulin
locus comprises an unrearranged light chain variable gene sequence
that contains at least one modification that introduces at least
one histidine codon in at least one reading frame encoding a light
chain variable domain. In one embodiment, the genetically modified
immunoglobulin locus comprises a rearranged (e.g., a rearranged
.lamda. or .kappa. V/J sequence) sequence that comprises one, two,
three, or four codons for histidine in a light chain CDR. In one
embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a
combination thereof. In one embodiment, the unrearranged or
rearranged light chain variable region nucleotide sequence is an
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence. In one embodiment, the
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence is present at an endogenous
mouse immunoglobulin light chain locus. In one embodiment, the
mouse immunoglobulin light chain locus is a mouse .kappa. locus. In
one embodiment the mouse immunoglobulin light chain locus is a
mouse .lamda. locus.
[0416] In one embodiment, the genetically modified immunoglobulin
locus as described herein is present in an immunoglobulin heavy
chain locus of a mouse. In one embodiment, the genetically modified
immunoglobulin locus is present in a humanized immunoglobulin heavy
chain locus in a VELOCIMMUNE.RTM. mouse.
[0417] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein exhibits a
weaker antigen binding at an acidic environment (e.g., at a pH of
about 5.5 to about 6.0) than a corresponding wild-type heavy chain
variable domain without the genetic modification.
[0418] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin locus as described herein has at least about 2-fold,
at least about 3-fold, at least about 4-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold, at least about 25-fold, or at least about 30-fold
decrease in dissociative half-life (t.sub.1/2) at an acidic pH
(e.g., pH of about 5.5 to about 6.0) as compared to the
dissociative half-life (t.sub.1/2) of the antigen-binding protein
at a neutral pH (e.g., pH of about 7.0 to about 7.4).
[0419] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin locus as described herein is characterized by
improved pH-dependent recyclability, enhanced serum half-life, or
both as compared with a wild-type antigen-binding protein without
the genetic modification.
[0420] In one embodiment, the genetically modified immunoglobulin
locus described herein comprises a B cell population that, upon
stimulation with an antigen of interest, is capable of producing
antigen-binding proteins, e.g., antibodies, comprising a heavy
chain variable domain comprising one or more histidine residues.
The antigen-binding proteins as described herein when administered
into a subject, exhibits an increased serum half-life over a
corresponding wild-type antigen-binding protein, which possesses a
similar or sufficiently similar amino acid sequence that encodes
the heavy chain variable domain but does not comprise a histidine
residue in the heavy chain variable domain. In some embodiments,
the antigen-binding protein described herein exhibits an increased
serum half-life that is at least about 2-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold higher than the corresponding wild-type
antigen-binding protein, which possesses a similar or sufficiently
similar amino acid sequence that encodes the heavy chain variable
domain but does not comprise a histidine residue in the heavy chain
variable domain.
[0421] In one aspect, a method for making a non-human animal
comprising a genetically modified immunoglobulin heavy chain
variable locus is provided, comprising:
[0422] (a) modifying a genome of a non-human animal to delete or
render non-functional endogenous immunoglobulin heavy chain V, D,
and J gene segments (e.g., via insertion of a nucleotide sequence
(e.g., an exogenous nucleotide sequence) in the immunoglobulin
locus or via non-functional rearrangement or inversion of
endogenous V.sub.H, D, J.sub.H segments); and
[0423] (b) placing in the genome a human V.sub.H, D, and J.sub.H
gene segment, wherein at least one of the human D gene segment has
been inverted 5' to 3' with respect to a corresponding wild-type
sequence, and wherein at least one reading frame of the inverted
human D gene segment comprises a histidine codon.
[0424] In one embodiment, the non-human animal is a mammal,
including a rodent, e.g., a mouse, a rat, or a hamster
[0425] In one embodiment, the genetically modified immunoglobulin
locus is present in a germline genome.
[0426] In one embodiment, the genetically modified immunoglobulin
locus encodes an immunoglobulin heavy chain variable domain
comprising one or more, 2 or more, 3 or more, 4 or more, 5 or more,
6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more,
12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or
more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more,
23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or
more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or more,
or 34 or more of histidine residues.
[0427] In one embodiment, at least two, at least three, at least
four, at least five, at least six, at least seven, at least eight,
at least nine, at least ten, at least eleven, at least twelve, at
least thirteen, at least fourteen, at least fifteen, at least
sixteen, at least seventeen, at least eighteen, at least nineteen,
at least twenty, at least twenty one, at least twenty two, at least
twenty three, at least twenty four, or all or substantially all of
functional human D gene segments have inverted orientation with
respect to corresponding wild type sequences.
[0428] In one embodiment, all or substantially all of endogenous
immunoglobulin V.sub.H, D, J.sub.H gene segments are deleted from
the immunoglobulin heavy chain locus or rendered non-functional
(e.g., via insertion of a nucleotide sequence, e.g., exogenous
nucleotide sequence, in the immunoglobulin locus or via
non-functional rearrangement or inversion of all, or substantially
all, endogenous immunoglobulin V.sub.H, D, J.sub.H segments), and
the genetically modified immunoglobulin locus comprises a human
V.sub.H, D, and J.sub.H gene segments, wherein at least one of the
human D gene segment is present in an inverted orientation with
respect to a corresponding wild type sequence, and wherein at least
one reading frame in the inverted human D gene segment comprises at
least one histidine codon.
[0429] In one embodiment, the inverted human D gene segment is
operably linked to a human V.sub.H gene segment, and/or human
J.sub.H gene segment
[0430] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to wild type sequences is
selected from the group consisting of D1-1, D1-7, D1-20, D1-26,
D2-2, D2-8, D2-15, D2-21, D3-3, D3-9, D3-10, D3-16, D3-22, D4-4,
D4-11, D4-17, D4-23, D5-5, D5-12, D5-18, D5-24, D6-6, D6-13, D6-19,
D7-27, and a combination thereof.
[0431] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D1 gene segment selected from the group consisting of
D1-1, D1-7, D1-20, D1-26, and a combination thereof.
[0432] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D2 gene segment selected from the group consisting of
D2-2, D2-8, D2-15, D2-21, and a combination thereof.
[0433] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D3 gene segment selected from the group consisting of
D3-3, D3-9, D3-10, D3-16, D3-22, and a combination thereof.
[0434] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D4 gene segment selected from the group consisting of
D4-4, D4-11, D4-17, D4-23, and a combination thereof.
[0435] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D5 gene segment selected from the group consisting of
D5-5, D5-12, D5-18, D5-24, and a combination thereof.
[0436] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is a D6 gene segment selected from the group consisting of
D6-6, D6-13, D6-19, and a combination thereof.
[0437] In one embodiment, the human D gene segment that is present
in the inverted orientation relative to a corresponding wild type
sequence is D7-27.
[0438] In one embodiment, the reading frame of the human D gene
segment is selected from a stop reading frame, a hydrophilic
reading frame, a hydrophobic reading frame, and a combination
thereof.
[0439] In one embodiment, the unrearranged heavy chain variable
region nucleotide sequence comprising the inverted human D gene
segment is operably linked to a human or non-human heavy chain
constant region nucleotide sequence that encodes an immunoglobulin
isotype selected from IgM, IgD, IgG, IgE, and IgA.
[0440] In one embodiment, the human unrearranged immunoglobulin
heavy chain variable region nucleotide sequence is operably linked
to a human or non-human heavy chain constant region nucleotide
sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3,
and a combination thereof. In one embodiment, the heavy chain
constant region nucleotide sequence comprises a C.sub.H1, a hinge,
a C.sub.H2, and a C.sub.H3 (i.e., C.sub.H1-hinge-C.sub.H2-CH3).
[0441] In one embodiment, a heavy chain constant region nucleotide
sequence is present at an endogenous locus (i.e., where the
nucleotide sequence is located in a wild-type non-human animal) or
present ectopically (e.g., at a locus different from the endogenous
immunoglobulin chain locus in its genome, or within its endogenous
locus, e.g., within an immunoglobulin variable locus, wherein the
endogenous locus is placed or moved to a different location in the
genome).
[0442] In one embodiment, the heavy chain constant region
nucleotide sequence comprises a modification in a C.sub.H2 or a
C.sub.H3, wherein the modification increases the affinity of the
heavy chain constant region amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0443] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a modification at position 250
(e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or
T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a
modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K)
and/or 434 (e.g., H/F or Y); or a modification at position 250
and/or 428; or a modification at position 307 or 308 (e.g., 308F,
V308F), and 434. In one embodiment, the modification comprises a
428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L,
259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K
(e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and
256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L
modification (e.g., T250Q and M428L); and a 307 and/or 308
modification (e.g., 308F or 308P), wherein the modification
increases the affinity of the heavy chain constant region amino
acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0444] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 252 and 257, wherein the modification increases the
affinity of the human C.sub.H2 amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0445] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 307 and 311, wherein the modification increases the
affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic
environment (e.g., in an endosome where pH ranges from about 5.5 to
about 6.0).
[0446] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H3 amino acid sequence,
wherein the C.sub.H3 amino acid sequence comprises at least one
modification between amino acid residues at positions 433 and 436,
wherein the modification increases the affinity of the C.sub.H3
amino acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0447] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, N434S, and a combination thereof.
[0448] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M428L, V259I, V308F, and a combination thereof.
[0449] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising an N434A mutation.
[0450] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of M252Y, S254T, T256E, and a combination thereof.
[0451] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of T250Q, M248L, or both.
[0452] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human heavy chain constant region
amino acid sequence comprising a mutation selected from the group
consisting of H433K, N434Y, or both.
[0453] In one embodiment, the genetically modified immunoglobulin
locus comprises: (1) a first allele, wherein the unrearranged human
immunoglobulin heavy chain variable region nucleotide sequence as
described herein is operably linked to a first heavy chain constant
region nucleotide sequence encoding a first CH.sub.3 amino acid
sequence of a human IgG selected from IgG1, IgG2, IgG4, and a
combination thereof; and (2) a second allele, wherein the
unrearranged human immunoglobulin heavy chain variable region
nucleotide sequence as described herein is operably linked to a
second heavy chain constant region nucleotide sequence encoding a
second C.sub.H3 amino acid sequence of the human IgG selected from
IgG1, IgG2, IgG4, and a combination thereof, and wherein the second
CH.sub.3 amino acid sequence comprises a modification that reduces
or eliminates binding for the second CH.sub.3 amino acid sequence
to Protein A (see, for example, US 2010/0331527A1, which is
incorporated by reference herein in its entirety).
[0454] In one embodiment, the second CH.sub.3 amino acid sequence
comprises an H95R modification (by IMGT exon numbering; H435R by EU
numbering). In one embodiment the second CH.sub.3 amino acid
sequence further comprises an Y96F modification (by IMGT exon
numbering; H436F by EU). In another embodiment, the second CH.sub.3
amino acid sequence comprises both an H95R modification (by IMGT
exon numbering; H435R by EU numbering) and an Y96F modification (by
IMGT exon numbering; H436F by EU).
[0455] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG1 and further comprises a mutation
selected from the group consisting of D16E, L18M, N44S, K52N, V57M,
and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by
EU).
[0456] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG2 and further comprises a mutation
selected from the group consisting of N44S, K52N, and V82I (IMGT:
N384S, K392N, and V422I by EU).
[0457] In one embodiment, the second CH.sub.3 amino acid sequence
is from a modified human IgG4 and further comprises a mutation
selected from the group consisting of Q15R, N44S, K52N, V57M, R69K,
E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and
V422I by EU).
[0458] In one embodiment, the heavy chain constant region amino
acid sequence is a non-human constant region amino acid sequence,
and the heavy chain constant region amino acid sequence comprises
one or more of any of the types of modifications described
above.
[0459] In one embodiment, the heavy chain constant region
nucleotide sequence is a human heavy chain constant region amino
acid sequence, and the human heavy chain constant region amino acid
sequence comprises one or more of any of the types of modifications
described above.
[0460] In one embodiment, all or substantially all endogenous
V.sub.H, D, and J.sub.H gene segments are deleted from an
immunoglobulin heavy chain locus or rendered non-functional (e.g.,
via insertion of a nucleotide sequence (e.g., an exogenous
nucleotide sequence) in the immunoglobulin locus or via
non-functional rearrangement, or inversion, of the endogenous
V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80%
or more, about 85% or more, about 90% or more, about 95% or more,
about 96% or more, about 97% or more, about 98% or more, or about
99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments
are deleted or rendered non-functional. In one embodiment, e.g., at
least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or
J gene segments are deleted or rendered non-functional.
[0461] In one embodiment, the genetically modified immunoglobulin
heavy chain locus comprises a modification that deletes or renders,
all or substantially all, non-functional endogenous V.sub.H, D, and
J.sub.H gene segments; and the genetically modified locus comprises
an unrearranged heavy chain variable region nucleotide sequence
comprising at least one inverted human D gene segment as described
herein wherein the unrearranged heavy chain variable region
nucleotide sequence is present at an endogenous location (i.e.,
where the nucleotide sequence is located in a wild-type non-human
animal) or present ectopically (e.g., at a locus different from the
endogenous immunoglobulin chain locus in its genome, or within its
endogenous locus, e.g., within an immunoglobulin variable locus,
wherein the endogenous locus is placed or moved to a different
location in the genome).
[0462] In one embodiment, the genetically modified immunoglobulin
locus comprises an endogenous Adam6a gene, Adam6b gene, or both,
and the genetic modification does not affect the expression and/or
function of the endogenous Adam6a gene, Adam6b gene, or both.
[0463] In one embodiment, the genetically modified immunoglobulin
locus comprises an ectopically present Adam6a gene, Adam6b gene, or
both. In one embodiment, the Adam6a gene is a non-human Adam6a
gene. In one embodiment, the Adam6a gene is a mouse Adam6a gene. In
one embodiment, the Adam6a gene is a human Adam6a gene. In one
embodiment, the Adam6b gene is a non-human Adam6b gene. In one
embodiment, the Adam6b gene is a mouse Adam6b gene. In one
embodiment, the Adam6b gene is a human Adam6b gene.
[0464] In one embodiment, the genetically modified immunoglobulin
locus further comprises a humanized, unrearranged .lamda. and/or
.kappa. light chain variable gene sequence. In one embodiment, the
humanized, unrearranged .lamda. and/or .kappa. light chain variable
gene sequence is operably linked to an immunoglobulin light chain
constant region nucleotide sequence selected from a .lamda. light
chain constant region nucleotide sequence and a .kappa. light chain
constant region nucleotide sequence. In one embodiment, the
humanized, unrearranged .lamda. light chain variable region
nucleotide sequence is operably linked to a .lamda. light chain
constant region nucleotide sequence. In one embodiment, the .lamda.
light chain constant region nucleotide sequence is a mouse, rat, or
human sequence. In one embodiment, the humanized, unrearranged
.kappa. light chain variable region nucleotide sequence is operably
linked to a .kappa. light chain constant region nucleotide
sequence. In one embodiment, the .kappa. light chain constant
region nucleotide sequence is a mouse, rat, or human sequence.
[0465] In one embodiment, the genetically modified immunoglobulin
locus comprises an unrearranged light chain variable gene sequence
that contains at least one modification that introduces at least
one histidine codon in at least one reading frame encoding a light
chain variable domain. In one embodiment, the genetically modified
immunoglobulin locus comprises a rearranged (e.g., a rearranged
.lamda. or .kappa. V/J sequence) sequence that comprises one, two,
three, or four codons for histidine in a light chain CDR. In one
embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a
combination thereof. In one embodiment, the unrearranged or
rearranged light chain variable region nucleotide sequence is an
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence. In one embodiment, the
unrearranged or rearranged human .lamda. or .kappa. light chain
variable region nucleotide sequence is present at an endogenous
mouse immunoglobulin light chain locus. In one embodiment, the
mouse immunoglobulin light chain locus is a mouse .kappa. locus. In
one embodiment, the mouse immunoglobulin light chain locus is a
mouse immunoglobulin light chain locus is a mouse .lamda.
locus.
[0466] In one embodiment, the genetically modified immunoglobulin
locus as described herein is present in an immunoglobulin heavy
chain locus of a mouse. In one embodiment, the genetically modified
immunoglobulin locus is present in a humanized immunoglobulin heavy
chain locus in a VELOCIMMUNE.RTM. mouse.
[0467] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein exhibits a
weaker antigen binding at an acidic environment (e.g., at a pH of
about 5.5 to about 6.0) than a corresponding wild-type heavy chain
variable domain without the genetic modification.
[0468] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin locus as described herein has at least about 2-fold,
at least about 3-fold, at least about 4-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold, at least about 25-fold, or at least about 30-fold
decrease in dissociative half-life (t.sub.1/2) at an acidic pH
(e.g., pH of about 5.5 to about 6.0) as compared to the
dissociative half-life (t.sub.1/2) of the antigen-binding protein
at a neutral pH (e.g., pH of about 7.0 to about 7.4).
[0469] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin locus as described herein is characterized by
improved pH-dependent recyclability, enhanced serum half-life, or
both as compared with a wild-type antigen-binding protein without
the genetic modification.
[0470] In one embodiment, the genetically modified immunoglobulin
locus described herein comprises an enriched B cell population
that, upon stimulation with an antigen of interest, is capable of
producing antigen-binding proteins, e.g., antibodies, comprising a
heavy chain variable domain comprising one or more histidine
residues. The antigen-binding proteins as described herein, when
administered into a subject, exhibits an increased serum half-life
over a corresponding wild-type antigen-binding protein, which
possesses a similar or sufficiently similar amino acid sequence
that encodes the heavy chain variable domain but does not comprise
a histidine residue in the heavy chain variable domain. In some
embodiments, the antigen-binding protein described herein exhibits
an increased serum half-life that is at least about 2-fold, at
least about 5-fold, at least about 10-fold, at least about 15-fold,
at least about 20-fold higher than the corresponding wild-type
antigen-binding protein, which possesses a similar or sufficiently
similar amino acid sequence that encodes the heavy chain variable
domain but does not comprise a histidine residue in the heavy chain
variable domain.
[0471] In one aspect, a method for making a non-human animal that
is capable of producing an immunoglobulin heavy chain variable
domain with enhanced serum half-life and/or enhanced pH-dependent
recyclability is provided, comprising
[0472] (a) modifying a genome of a non-human animal to delete or
render non-functional endogenous immunoglobulin heavy chain V, D,
and J gene segments (e.g., via insertion of a nucleotide sequence
(e.g., an exogenous nucleotide sequence) in the immunoglobulin
locus or via non-functional rearrangement or inversion of
endogenous V.sub.H, D, J.sub.H segments); and
[0473] (b) placing in the genome an unrearranged human heavy chain
variable region nucleotide sequence, wherein the unrearranged heavy
chain variable region nucleotide sequence comprises an addition of
least one histidine codon or a substitution of at least one
endogenous non-histidine codon with a histidine codon, and wherein
an antigen-binding protein comprising the immunoglobulin heavy
chain variable domain produced by the non-human animal exhibits
enhanced serum half-life and/or enhanced pH-dependent recyclability
as compared to a wild-type immunoglobulin heavy chain domain.
[0474] In one embodiment, the non-human animal, upon contact with
an antigen, can produce an enriched population of B cell repertoire
that expresses an antigen-binding protein with enhanced serum
half-life and/or enhanced pH-dependent recyclability, wherein the
enriched B cell population comprises any genetic modifications as
described herein.
[0475] In one embodiment, an antigen-binding protein produced by
the genetically modified non-human animal is characterized by
sufficient affinity to an antigen of interest at a neutral pH
(e.g., pH of about 7.0 to about 7.4) and enhanced dissociation of
the antibody from an antigen-antigen-binding protein complex at a
pH less than the neutral pH (e.g., at an endosomal pH, e.g. pH of
about 5.5 to 6.0).
[0476] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin locus as described herein has at least about 2-fold,
at least about 3-fold, at least about 4-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold, at least about 25-fold, or at least about 30-fold
decrease in dissociative half-life (t.sub.1/2) at an acidic pH
(e.g., pH of about 5.5 to about 6.0) as compared to the
dissociative half-life (t.sub.1/2) of the antigen-binding protein
at a neutral pH (e.g., pH of about 7.0 to about 7.4).
[0477] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin locus as described herein is characterized by
improved pH-dependent recyclability, enhanced serum half-life, or
both as compared with a wild-type antigen-binding protein without
the genetic modification.
[0478] In one embodiment, the genetically modified immunoglobulin
locus described herein comprises a an enriched B cell population
that, upon stimulation with an antigen of interest, is capable of
producing antigen-binding proteins, e.g., antibodies, comprising a
heavy chain variable domain comprising one or more histidine
residues. The antigen-binding proteins as described herein when
administered into a subject, exhibits an increased serum half-life
over a corresponding wild-type antigen-binding protein, which
possesses a similar or sufficiently similar amino acid sequence
that encodes the heavy chain variable domain but does not comprise
a histidine residue in the heavy chain variable domain. In some
embodiments, the antigen-binding protein described herein exhibits
an increased serum half-life that is at least about 2-fold, at
least about 5-fold, at least about 10-fold, at least about 15-fold,
at least about 20-fold higher than the corresponding wild-type
antigen-binding protein, which possesses a similar or sufficiently
similar amino acid sequence that encodes the heavy chain variable
domain but does not comprise a histidine residue in the heavy chain
variable domain.
[0479] In one embodiment, the antigen-binding protein comprises an
immunoglobulin heavy chain variable domain that is capable of
specifically binding an antigen of interest with an affinity
(K.sub.D) lower than 10.sup.-6, 10.sup.-7, 10.sup.-8, 10.sup.-9,
10.sup.-10, 10.sup.-11, and 10.sup.-12 at a neutral pH (e.g., pH of
about 7.0 to about 7.4).
[0480] In one aspect, a method for obtaining an antigen-binding
protein with enhanced recyclability and/or improved serum half-life
is provided, comprising:
[0481] (a) immunizing a non-human animal having a genetically
modified immunoglobulin locus as described herein wherein the
non-human animal comprises an unrearranged human heavy chain
variable region nucleotide sequence comprising an addition of least
one histidine codon or a substitution of at least one endogenous
non-histidine codon with a histidine codon;
[0482] (b) allowing the non-human animal to mount an immune
response;
[0483] (c) harvesting a lymphocyte (e.g., a B cell) from the
immunized non-human animal;
[0484] (d) fusing the lymphocyte with a myeloma cell to form a
hybridoma cell, and
[0485] (e) obtaining an antigen-binding protein produced by the
hybridoma cell, wherein the antigen-binding protein exhibits
enhanced recyclability and/or serum stability.
[0486] In one aspect, a genetically modified immunoglobulin heavy
chain locus obtainable by any of the methods as described herein is
provided.
[0487] In one aspect, a genetically modified non-human animal
obtainable by any of the methods as described herein is
provided.
[0488] In various embodiments, the non-human animal is a mammal. In
one embodiment, the mammal is a rodent, e.g., a mouse, a rat, or a
hamster.
[0489] In various embodiments, the genetically modified
immunoglobulin loci as described herein are present in the germline
genome of a non-human animal, e.g., a mammal, e.g., a rodent, e.g.,
a mouse, a rat, or a hamster.
BRIEF DESCRIPTION OF THE DRAWINGS
[0490] FIGS. 1A and 1B illustrate the amino acid sequences encoded
by the three reading frames (i.e., stop, hydrophilic, and
hydrophobic reading frames) of human D gene segments (D) and the
amino acid sequences encoded by the three reading frames of
histidine-substituted human D gene segments (HD). Introduction of
histidine codons (typed in bold) in the hydrophilic reading frame
also changed many stop codons in the stop reading frame to Ser
codons (typed in bold) but introduced few changes in the
hydrophobic reading frame. The "*" symbol represents a stop codon,
and the comma between the two SEQ ID NOs indicates that there are
two amino acid sequences separated by the stop codon.
[0491] FIG. 2 illustrates schemes for targeting pLMa0174 containing
a spectinomycin selection cassette into the 5' end of MAID 1116
(Step 1. BHR (Spec)). In Step 1, a chloramphenicol selection
cassette, a neomycin selection cassette, a loxP site, two V.sub.H
gene segments (hV.sub.H1-3 and hV.sub.H1-2), the human Adam6 gene,
all of which are located upstream of hV.sub.H6-1, were deleted from
the clone and replaced by a spectinomycin cassette to yield the
VI433 clone. In Step 2 (BHR (Hyg +Spec)), pNTu0002 containing a
hygromycin cassette flanked by FRT sites was targeted into a region
comprising human immunoglobulin D gene segments. Via Step 2, all
human D gene segments were deleted from VI433 and replaced with the
hygromycin cassette to yield MAID6011 VI 434 (clone 1).
[0492] FIG. 3 illustrates schemes for assembling
histidine-substituted human D gene segments via sequential
ligation.
[0493] FIG. 4 illustrates the introduction of pre-assembled,
histidine-substituted human D gene segments containing a neomycin
cassette into a region between the most D-proximal V.sub.H gene
segment (V.sub.H 6-1) and the most D-proximal J.sub.H gene segment
(J.sub.H1) via enzyme-mediated digestion (PI-SceI and I-CeuI) and
ligation. This process removes the hygromycin cassette from MAID
6011 VI434 and introduces pre-assembled human histidine-substituted
D gene segments into the clone. Bacterial cells comprising a
successfully targeted clone are selected based on both neomycin and
spectinomycin resistance. The resulting clone (MAID6012 VI469)
comprises, from 5' to 3', (1) a spectinomycin selection cassette,
(2) a 50 kb arm comprising a human V.sub.H gene segment (V.sub.H
6-1), (3) a neomycin cassette flanked by loxP sites, (4) human D
gene segments containing histidine substitutions (HD 1.1-6.6 (9586
bp; SEQ ID NO: 1), HD 1.7-6.13 (9268 bp; SEQ ID NO: 2), HD
1.14-6.19 (9441 bp; SEQ ID NO: 3), and HD 1.20-6.25, 1.26 (11592
bp; SEQ ID NO: 4)), (5) about 25 kb of a genomic region containing
human J.sub.H gene segments, (6) a mouse E.sub.i sequence (SEQ ID
NO: 5; an intronic enhancer that promotes V.sub.H to DJ.sub.H
rearrangement in developing B cells), and (7) a mouse IgM constant
region nucleotide sequence (mlgM exon 1; SEQ ID NO: 7).
[0494] FIG. 5 illustrates schemes for deleting the human
immunoglobulin heavy chain D gene region from the MAID 1460
heterozygous ES cells by targeting the 129 strain-derived
chromosome of MAID 1460 het with the hygromycin selection cassette
in MAID 6011 VI434.
[0495] FIG. 6 shows a list of primers and probes used to confirm a
loss of allele (LOA), a gain of allele (GOA), or a parental allele
(Parental) in the screening assays for identifying MAID 6011.
[0496] FIG. 7 illustrates schemes for constructing MAID 6012 het by
targeting MAID 6011 heterozygous ES cells with MAID 6012 VI469.
Electroporation of the MAID 6012 VI469 construct into the MAID 6011
heterozygous ES cells yielded MAID 6012 heterozygous ES cells in
which the 129 strain-derived chromosome is modified to contain,
from 5' to 3' direction, an FRT site, human V.sub.H gene segments,
a mouse genomic region comprising adam6 genes, a floxed neomycin
selection cassette, human D gene segments comprising histidine
substitutions (HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD 1.7-6.13
(9268 bp; SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO: 3), and
HD 1.20-6.25, 1.26 (11592 bp; SEQ ID NO: 4)), human J.sub.H gene
segments, a mouse E.sub.i sequence (SEQ ID NO: 5; an intronic
enhancer that promotes V.sub.H to DJ.sub.H rearrangement in
developing B cells), and a mouse IgM constant region nucleotide
sequence (mlgM exon 1; SEQ ID NO: 7).
[0497] FIG. 8 shows a list of primers and probes used to confirm a
loss of allele (LOA), a gain of allele (GOA), or a parental allele
(Parental) in the screening assay for identifying MAID 6012.
[0498] FIG. 9 illustrates schemes for removing a neomycin cassette
from MAID 6012 heterozygous ES cells. Electroporation of a
Cre-expressing plasmid into the MAID 6012 ES cells lead to
recombination and deletion of the floxed neomycin cassette,
yielding MAID 6013 heterozygous ES cells.
[0499] FIGS. 10A-10E illustrate human D gene segment nucleotide
sequences with translations for each of the six reading frames,
i.e., three reading frames for direct 5' to 3' orientation and
three reading frames for inverted orientation (3' to 5'
orientation). The "*" symbol represents a stop codon, and the comma
between two SEQ ID NOs indicates that there are two amino acid
sequences separated by the stop codon.
[0500] FIGS. 11-13 illustrate mRNA sequences and their encoded
protein sequences expressed by 6013 FO heterozygous mice, which
comprise histidine-substituted human D gene segments (HD 1.1-6.6
(9586 bp; SEQ ID NO: 1), HD 1.7-6.13 (9268 bp; SEQ ID NO: 2), HD
1.14-6.19 (9441 bp; SEQ ID NO: 3), and HD 1.20-6.25, 1.26 (11592bp;
SEQ ID NO: 4)) in the immunoglobulin heavy chain locus in their 129
strain-derived chromosome. The boxed sequences in each figure
indicate the presence of histidine codons in the CDR3 sequences
derived from the genetically modified immunoglobulin heavy chain
locus comprising the histidine-substituted human D gene segments.
FWR represents frame region and CDR represents complementarity
determining region. In the alignment, the dot "." indicates a
sequence identical to the query sequence, and the dash "-"
indicates a gap in the sequence.
[0501] FIG. 14 illustrates histidine incorporation frequency in
immunoglobulin heavy chain CDR3 sequences. The X-axis represents
the number of histidine codons appeared in each CDR3 sequence, and
the Y-axis represents the corresponding proportion of reads. The
"6013 F0 het" indicates CDR3 sequences expressed by the 6013
heterozygous mice comprising histidine-substituted D gene segments.
The "VI3-Adam6" indicates CDR3 sequences obtained from control mice
comprising human V.sub.H, D, and J.sub.H gene segments without the
histidine modification as described herein. The "ASAP" indicates
CDR3 sequences obtained from the Regeneron antibody database, which
was used as another control.
DETAILED DESCRIPTION OF THE INVENTION
[0502] This invention is not limited to particular methods, and
experimental conditions described, as such methods and conditions
may vary. It is also to be understood that the terminology used
herein is for the purpose of describing particular embodiments
only, and is not intended to be limiting, since the scope of the
present invention is defined by the claims.
[0503] Unless defined otherwise, all terms and phrases used herein
include the meanings that the terms and phrases have attained in
the art, unless the contrary is clearly indicated or clearly
apparent from the context in which the term or phrase is used.
Although any methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present invention, particular methods and materials are now
described. All publications mentioned are hereby incorporated by
reference
Definitions
[0504] The term "complementary determining region" or "CDR," as
used herein, includes an amino acid sequence encoded by a nucleic
acid sequence of an organism's immunoglobulin genes that normally
(i.e., in a wild type animal) appears between two framework regions
in a variable region of a light or a heavy chain of an
immunoglobulin molecule (e.g., an antibody or a T cell receptor). A
CDR can be encoded by, for example, a germline sequence or a
rearranged sequence, and, for example, by a naive or a mature B
cell or a T cell. A CDR can be somatically mutated (e.g., vary from
a sequence encoded in an animal's germline), humanized, and/or
modified with amino acid substitutions, additions, or deletions. In
some circumstances (e.g., for a CDR3), CDRs can be encoded by two
or more sequences (e.g., germline sequences) that are not
contiguous (e.g., in an unrearranged nucleic acid sequence) but are
contiguous in a B cell nucleic acid sequence, e.g., as a result of
splicing or connecting the sequences (e.g., V-D-J recombination to
form a heavy chain CDR3).
[0505] The term "dissociative half-life" or 1.sub.12'' as used
herein refers to the value calculated by the following formula:
t.sub.1/2 (min)=(In2/k.sub.d)/60, wherein k.sub.d represents a
dissociation rate constant.
[0506] The term "germline" in reference to an immunoglobulin
nucleic acid sequence includes a nucleic acid sequence that can be
passed to progeny.
[0507] The phrase "heavy chain," or "immunoglobulin heavy chain"
includes an immunoglobulin heavy chain sequence, including
immunoglobulin heavy chain constant region sequence, from any
organism. Heavy chain variable domains include three heavy chain
CDRs and four FR regions, unless otherwise specified. Fragments of
heavy chains include CDRs, CDRs and FRs, and combinations thereof.
A typical heavy chain has, following the variable domain (from
N-terminal to C-terminal), a C.sub.H1 domain, a hinge, a C.sub.H2
domain, and a C.sub.H3 domain. A functional fragment of a heavy
chain includes a fragment that is capable of specifically
recognizing an epitope (e.g., recognizing the epitope with a
K.sub.D in the micromolar, nanomolar, or picomolar range), that is
capable of expressing and secreting from a cell, and that comprises
at least one CDR. Heavy chain variable domains are encoded by
variable region nucleotide sequence, which generally comprises
V.sub.H, D.sub.H, and J.sub.H segments derived from a repertoire of
V.sub.H, D.sub.H, and J.sub.H segments present in the germline.
Sequences, locations and nomenclature for V, D, and J heavy chain
segments for various organisms can be found in IMGT database, which
is accessible via the internet on the world wide web (www) at the
URL "imgt.org."
[0508] The phrase "light chain" includes an immunoglobulin light
chain sequence from any organism, and unless otherwise specified
includes human kappa (K) and lambda (A) light chains and a VpreB,
as well as surrogate light chains. Light chain variable domains
typically include three light chain CDRs and four framework (FR)
regions, unless otherwise specified. Generally, a full-length light
chain includes, from amino terminus to carboxyl terminus, a
variable domain that includes FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, and a
light chain constant region amino acid sequence. Light chain
variable domains are encoded by the light chain variable region
nucleotide sequence, which generally comprises light chain Wand
light chain J.sub.L gene segments, derived from a repertoire of
light chain V and J gene segments present in the germline.
Sequences, locations and nomenclature for light chain V and J gene
segments for various organisms can be found in IMGT database, which
is accessible via the internet on the world wide web (www) at the
URL "imgt.org." Light chains include those, e.g., that do not
selectively bind either a first or a second epitope selectively
bound by the epitope-binding protein in which they appear. Light
chains also include those that bind and recognize, or assist the
heavy chain with binding and recognizing, one or more epitopes
selectively bound by the epitope-binding protein in which they
appear.
[0509] The phrase "operably linked" refers to a relationship
wherein the components operably linked function in their intended
manner. In one instance, a nucleic acid sequence encoding a protein
may be operably linked to regulatory sequences (e.g., promoter,
enhancer, silencer sequence, etc.) so as to retain proper
transcriptional regulation. In one instance, a nucleic acid
sequence of an immunoglobulin variable region (or V(D)J segments)
may be operably linked to a nucleic acid sequence of an
immunoglobulin constant region so as to allow proper recombination
between the sequences into an immunoglobulin heavy or light chain
sequence.
[0510] The phrase "somatically mutated," as used herein, includes
reference to a nucleic acid sequence from a B cell that has
undergone class-switching, wherein the nucleic acid sequence of an
immunoglobulin variable region, e.g., a heavy chain variable region
(e.g., a heavy chain variable domain or including a heavy chain CDR
or FR sequence) in the class-switched B cell is not identical to
the nucleic acid sequence in the B cell prior to class-switching,
such as, for example a difference in a CDR or a framework nucleic
acid sequence between a B cell that has not undergone
class-switching and a B cell that has undergone class-switching.
The phrase "somatically mutated" includes reference to nucleic acid
sequences from affinity-matured B cells that are not identical to
corresponding immunoglobulin variable region nucleotide sequences
in B cells that are not affinity-matured (i.e., sequences in the
genome of germline cells). The phrase "somatically matured" also
includes reference to an immunoglobulin variable region nucleic
acid sequence from a B cell after exposure of the B cell to an
epitope of interest, wherein the nucleic acid sequence differs from
the corresponding nucleic acid sequence prior to exposure of the B
cell to the epitope of interest. The term "somatically mutated"
also refers to sequences from antibodies that have been generated
in an animal, e.g., a mouse having human immunoglobulin variable
region nucleic acid sequences, in response to an immunogen
challenge, and that result from the selection processes inherently
operative in such an animal.
Non-Human Animals That Express Immunoglobulin Heavy Chain Variable
Domain Comprising Histidine Residues
[0511] The described invention provides genetically modified
non-human animals that can produce antigen-binding proteins with
pH-dependent antigen binding characteristics. In various
embodiments, the antigen-binding proteins produced by the
genetically modified non-human animals as described herein exhibit
increased pH-dependent recycling efficiency and/or enhanced serum
half-life. In particular, the described invention employs genetic
modifications in the immunoglobulin heavy chain locus to introduce
histidine codons into a human heavy chain variable region
nucleotide sequence and, optionally, to introduce a mutation(s) in
a constant region nucleotide sequence that encodes C.sub.H2 and/or
C.sub.H3 domains that increases the binding of the antibody
constant region to an FcRn receptor, which facilitates recycling of
the antigen-binding protein. Antigen-binding proteins comprising
the modification may more loosely bind its target in an acidic
intracellular compartment (e.g., in an endosome where pH ranges
from about 5.5 to about 6.0) than in an extracellular environment
or at the surface of a cell (i.e., at a physiological pH, e.g., a
pH ranging from about 7.0 to about 7.4) due to protonated histidine
residues located in the antigen binding sites. Therefore, the
antigen-biding proteins comprising the genetic modifications as
described herein would be able to be recycled more rapidly or
efficiently than wild-type antigen-binding proteins that do not
comprise such genetic modifications following target-mediated
endocytosis. Furthermore, since the modified histidine residues are
protonated only in an acidic environment, but not at a neutral pH,
it is expected that such modification would not affect binding
affinity and/or specificity of the antigen-binding protein toward
an antigen of interest at a physiological pH.
[0512] In various aspects, non-human animals are provided
comprising immunoglobulin heavy chain loci that comprise an
unrearranged human heavy chain variable region nucleotide sequence,
wherein the unrearranged human heavy chain variable region
nucleotide sequence comprises an addition of least one histidine
codon or a substitution of at least one endogenous non-histidine
codon with a histidine codon.
[0513] In various aspects, methods of making and using the
non-human animals are also provided. When immunized with an antigen
of interest, the genetically modified non-human animals are capable
of generating B cell populations that produce antigen-binding
proteins comprising heavy chain variable domains with histidine
residues, wherein the antigen-binding proteins exhibit enhanced
pH-dependent recycling and/or increased serum half-life. In various
embodiments, the non-human animals generate B cell populations that
express human heavy chain variable domains along with cognate human
light chain variable domains. In various embodiments, the
genetically modified immunoglobulin heavy chain loci are present in
a germline genome of the non-human animal.
[0514] In various embodiments, the genetically modified
immunoglobulin heavy chain locus comprises a modification that
deletes or renders, all or substantially all, non-functional
endogenous V.sub.H, D, and J.sub.H gene segments; and the
genetically modified locus comprises an unrearranged heavy chain
variable region nucleotide sequence comprising one or more human
V.sub.H, D, and/or J.sub.H gene segments having one or more
histidine codons, wherein the unrearranged heavy chain variable
region nucleotide sequence is present at an endogenous location
(i.e., where the nucleotide sequence is located in a wild-type
non-human animal) or present ectopically (e.g., at a locus
different from the endogenous immunoglobulin chain locus in its
genome, or within its endogenous locus, e.g., within an
immunoglobulin variable locus, wherein the endogenous locus is
placed or moved to a different location in the genome). In one
embodiment, e.g., about 80% or more, about 85% or more, about 90%
or more, about 95% or more, about 96% or more, about 97% or more,
about 98% or more, or about 99% or more of all endogenous heavy
chain V, D, or J gene segments are deleted or rendered
non-functional. In one embodiment, e.g., at least 95%, 96%, 97%,
98%, or 99% of endogenous functional heavy chain V, D, or J gene
segments are deleted or rendered non-functional.
[0515] In one embodiment, the non-human animal is a mammal.
Although embodiments directed to introducing histidine codons into
an unrearranged human heavy chain variable gene sequence in a mouse
are extensively discussed herein, other non-human animals are also
provided that comprise a genetically modified immunoglobulin locus
containing an unrearranged human heavy chain variable region
nucleotide sequence comprising an addition of least one histidine
codon or a substitution of at least one endogenous non-histidine
codon with a histidine codon. Such non-human animals include any of
those which can be genetically modified to express the
histidine-containing heavy chain variable domain as disclosed
herein, including, e.g., mouse, rat, rabbit, pig, bovine (e.g.,
cow, bull, buffalo), deer, sheep, goat, chicken, cat, dog, ferret,
primate (e.g., marmoset, rhesus monkey), etc. For example, for
those non-human animals for which suitable genetically modifiable
ES cells are not readily available, other methods are employed to
make a non-human animal comprising the genetic modification. Such
methods include, e.g., modifying a non-ES cell genome (e.g., a
fibroblast or an induced pluripotent cell) and employing somatic
cell nuclear transfer (SCNT) to transfer the genetically modified
genome to a suitable cell, e.g., an enucleated oocyte, and
gestating the modified cell (e.g., the modified oocyte) in a
non-human animal under suitable conditions to form an embryo.
Methods for modifying a non-human animal genome (e.g., a pig, cow,
rodent, chicken, etc. genome) include, e.g., employing a zinc
finger nuclease (ZFN) or a transcription activator-like effector
nuclease (TALEN) to modify a genome to include a nucleotides
sequence that encodes
[0516] In one embodiment, the non-human animal is a small mammal,
e.g., of the superfamily Dipodoidea or Muroidea. In one embodiment,
the genetically modified animal is a rodent. In one embodiment, the
rodent is selected from a mouse, a rat, and a hamster. In one
embodiment, the rodent is selected from the superfamily Muroidea.
In one embodiment, the genetically modified animal is from a family
selected from Calomyscidae (e.g., mouse-like hamsters), Cricetidae
(e.g., hamster, New World rats and mice, voles), Muridae (true mice
and rats, gerbils, spiny mice, crested rats), Nesomyidae (climbing
mice, rock mice, with-tailed rats, Malagasy rats and mice),
Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole
rates, bamboo rats, and zokors). In a specific embodiment, the
genetically modified rodent is selected from a true mouse or rat
(family Muridae), a gerbil, a spiny mouse, and a crested rat. In
one embodiment, the genetically modified mouse is from a member of
the family Muridae. In one embodiment, the animal is a rodent. In a
specific embodiment, the rodent is selected from a mouse and a rat.
In one embodiment, the non-human animal is a mouse.
[0517] In one embodiment, the non-human animal is a rodent that is
a mouse of a C57BL strain selected from C57BL/A, C57BL/An,
C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6N,
C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, and C57BL/OIa. In
another embodiment, the mouse is a 129 strain. In one embodiment,
the 129 strain is selected from the group consisting of 129P1,
129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/Svlm), 129S2,
129S4, 129S5, 129S9/SvEvH, 129S6 (129/SvEvTac), 129S7, 129S8,
129T1, 129T2 (see, e.g., Festing et al. (1999) Revised nomenclature
for strain 129 mice, Mammalian Genome 10:836, see also, Auerbach et
al. (2000) Establishment and Chimera Analysis of 129/SvEv- and
C57BL/6-Derived Mouse Embryonic Stem Cell Lines). In one
embodiment, the genetically modified mouse is a mix of an
aforementioned 129 strain and an aforementioned C57BL strain (e.g.,
a C57BL/6 strain). In another embodiment, the mouse is a mix of
aforementioned 129 strains, or a mix of aforementioned C57BL/6
strains. In one embodiment, the 129 strain of the mix is a 129S6
(129/SvEvTac) strain. In another embodiment, the mouse is a mix of
a 129/SvEv- and a C57BL/6-derived strain. In a specific embodiment,
the mouse is a mix of a 129/SvEv- and a C57BL/6-derived strain as
described in Auerbach et al. 2000 Bio Techniques 29:1024-1032. In
another embodiment, the mouse is a BALB strain, e.g., BALB/c
strain. In another embodiment, the mouse is a mix of a BALB strain
(e.g., BALB/c strain) and another aforementioned strain.
[0518] In one embodiment, the non-human animal is a rat. In one
embodiment, the rat is selected from a Wistar rat, an LEA strain, a
Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti.
In one embodiment, the rat strain is a mix of two or more of a
strain selected from the group consisting of Wistar, LEA, Sprague
Dawley, Fischer, F344, F6, and Dark Agouti.
[0519] In one embodiment, the non-human animal is a mouse. In one
embodiment, the mouse is a VELOCIMMUNE.RTM. humanized mouse.
[0520] VELOCIMMUNE.RTM. humanized mice (see, e.g., U.S. Pat. No.
6,596,541, U.S. Pat. No. 7,105,348, and
[0521] US20120322108A1, which are incorporated herein by reference
in their entireties), which contain a precise replacement of mouse
immunoglobulin variable regions with human immunoglobulin variable
regions at the endogenous mouse loci, display a surprising and
remarkable similarity to wild-type mice with respect to B cell
development. VELOCIMMUNE.RTM. humanized mice display an essentially
normal, wild-type response to immunization that differed only in
one significant respect from wild-type mice--the variable regions
generated in response to immunization are fully human.
[0522] VELOCIMMUNE.RTM. humanized mice contain a precise,
large-scale replacement of germline variable region nucleotide
sequences of mouse immunoglobulin heavy chain (IgH) and
immunoglobulin light chain (e.g., .kappa. light chain, Ig.kappa.)
with corresponding human immunoglobulin variable region nucleotide
sequences, at the endogenous loci (see, e.g., U.S. Pat. No.
6,596,541, U.S. Pat. No. 7,105,348, US 20120322108A1, which are
incorporated herein by reference in their entireties). In total,
about six megabases of mouse loci are replaced with about 1.5
megabases of human genomic sequence. This precise replacement
results in a mouse with hybrid immunoglobulin loci that make heavy
and light chains that have a human variable regions and a mouse
constant region. The precise replacement of mouse V.sub.H-D-J.sub.H
and V.kappa.-J.kappa. segments leave flanking mouse sequences
intact and functional at the hybrid immunoglobulin loci. The
humoral immune system of the mouse functions like that of a
wild-type mouse. B cell development is unhindered in any
significant respect and a rich diversity of human variable regions
is generated in the mouse upon antigen challenge.
[0523] VELOCIMMUNE.RTM. humanized mice are possible because
immunoglobulin gene segments for heavy and .kappa. light chains
rearrange similarly in humans and mice, which is not to say that
their loci are the same or even nearly so--clearly they are not.
However, the loci are similar enough that humanization of the heavy
chain variable gene locus can be accomplished by replacing about
three million base pairs of contiguous mouse sequence that contains
all the V.sub.H, D, and J.sub.H gene segments with about one
million bases of contiguous human genomic sequence covering
basically the equivalent sequence from a human immunoglobulin
locus.
[0524] In some embodiments, further replacement of certain mouse
constant region nucleotide sequences with human constant region
nucleotide sequences (e.g., replacement of mouse heavy chain
C.sub.H1 nucleotide sequence with human heavy chain C.sub.H1
nucleotide sequence, and replacement of mouse light chain constant
region nucleotide sequence with human light chain constant region
nucleotide sequence) results in mice with hybrid immunoglobulin
loci that make antibodies that have human variable regions and
partly human constant regions, suitable for, e.g., making fully
human antibody fragments, e.g., fully human Fab's. Mice with hybrid
immunoglobulin loci exhibit normal variable gene segment
rearrangement, normal somatic hypermutation frequencies, and normal
class switching. These mice exhibit a humoral immune system that is
indistinguishable from wild type mice, and display normal cell
populations at all stages of B cell development and normal lymphoid
organ structures--even where the mice lack a full repertoire of
human variable region nucleotide segments. Immunizing these mice
results in robust humoral responses that display a wide diversity
of variable gene segment usage.
[0525] The precise replacement of the mouse germline variable
region nucleotide sequence allows for making mice that have partly
human immunoglobulin loci. Because the partly human immunoglobulin
loci rearrange, hypermutate, and class switch normally, the partly
human immunoglobulin loci generate antibodies in a mouse that
comprise human variable regions. Nucleotide sequences that encode
the variable regions can be identified and cloned, then fused
(e.g., in an in vitro system) with any sequences of choice, e.g.,
any immunoglobulin isotype suitable for a particular use, resulting
in an antibody or antigen-binding protein derived wholly from human
sequences.
[0526] In various embodiments, at least one histidine codon is
present in an unrearranged heavy chain variable region nucleotide
sequence that encodes an N-terminal region, a loop 4 region, a
CDR1, a CDR2, a CDR3, or a combination thereof.
[0527] In various embodiments, at least one histidine codon is
present in an unrearranged heavy chain variable region nucleotide
sequence that encodes a framework region (FR) selected from the
group consisting of FR1, FR2, FR3, and FR4.
[0528] In various aspects, the genetically modified immunoglobulin
locus comprises a nucleotide sequence wherein at least one codon
has been replaced with a histidine codon.
[0529] In various aspects, the genetically modified immunoglobulin
locus comprises an unrearranged human heavy chain variable region
nucleotide sequence comprising a substitution of at least one
endogenous non-histidine codon with a histidine codon.
[0530] In one embodiment, 2 or more, 3 or more, 4 or more, 5 or
more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or
more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more,
17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or
more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more,
28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or
more, 34 or more, 35 or more, 36 or more, 37 or more, 38 or more,
39 or more, 40 or more, 41 or more, 42 or more, 43 or more, 44 or
more, 45 or more, 46 or more, 47 or more, 48 or more, 49 or more,
50 or more, 51 or more, 52 or more, 53 or more, 54 or more, 55 or
more, 56 or more, 57 or more, 58 or more, 59 or more, 60 or more,
or 61 or more of the endogenous non-histidine codons are replaced
with histidine codons.
[0531] Previous studies on reading frame usage of human
immunoglobulin D gene segments have shown that, of the three
reading frames (i.e., stop, hydrophobic, and hydrophilic), the stop
frame is used very infrequently. Apparently, some stop frames are
chewed back and result in expression. However, stop reading frames
are used at such a low frequency that for the purposes of
engineering histidine codons, it is more efficient not to use the
stop reading frame. As between hydrophilic and hydrophobic reading
frames, the hydrophilic reading frame appears to be preferred.
Thus, in one embodiment, the hydrophilic reading frame of human D
gene segments is engineered to contain one or more histidine codons
(as compared with the stop frame or with the hydrophobic
frame).
[0532] Methods of introducing a mutation in vitro, e.g.,
site-directed mutagenesis, are well known in the art. In some
embodiments of the described invention, histidine codons are
enriched by designing histidine-substituted human D gene segments
in silico (e.g., mutation of Y, D, and N codons to H codons, e.g.,
CAT, CAC), which are synthesized (e.g., chemical synthesis) with
(unique) restriction enzyme sites for ligating them back together.
The synthesized D gene segments are made with the appropriate
recombination signal sequences (RSS) upstream and downstream. In
one embodiment, when ligated to one another, the synthesized
histidine-substituted D gene segments include the intergenic
sequences observed in a human between each D gene segment.
[0533] It is understood that the codons that encode the one or more
histidines, upon rearrangement and/or somatic hypermutation, may
change such that one or more of the histidines will be changed to
another amino acid. However, this may not occur for each and every
codon encoding histidine, in each and every rearrangement in the
non-human animal. If such changes occur, the changes may occur in
some but not all B cells or in some but not all heavy chain
variable sequences.
[0534] In various aspects, the genetically modified immunoglobulin
locus comprises a human heavy chain V, D, and J gene segment,
wherein at least one of the human D gene segment has been inverted
5' to 3' with respect to a corresponding wild-type sequence, and
wherein at least one reading frame of the inverted human D gene
segment comprises a histidine codon.
[0535] In various embodiments, the nucleotide sequence comprises
one or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more,
7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or
more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more,
18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or
more, 24 or more, or 25 or more of histidine codons.
[0536] There are 25 functional human D gene segments in 6 families
of 3-5 members each (one family--the D7 family--has a single
member). Direct recombination of human D gene segments is much more
frequent than inversion, although inverted reading frames exhibit
more histidine codons. Certain D gene segments and reading frames
are used more frequently than others. All three direct reading
frames and all three inverted orientation reading frames for all
the functional D gene segments are presented in FIGS. 10A-10E. As
shown in FIGS. 10A-10E, there are many more histidine codons in
inverted reading frames than in direct reading frames. More
specifically, there are 34 histidines in inverted reading frames
and only four in direct reading frames. In addition, of the four in
direct reading frames, three histidines are encoded by pseudogenes
or present in alternate alleles. Therefore, there is only a single
direct reading frame of a germline human D gene segment that
contains a histidine codon, with further histidine codons possibly
encountered in alternate alleles (presumably in subsets of the
human population).
[0537] Inverted D rearrangements are extremely rare. Tuaillon et
al. (J. Immunol., 154(12): 5453-6465, incorporated by reference
herein in its entirety) showed that usage of inverted reading
frames (as measured by limiting dilution PCT) is very rare, i.e.,
that the ratio of direct to indirect rearrangements are, in most
cases, 100 to 1000. To the extent that the ratio of direct to
indirect rearrangement was low, it was only observed in those D
segments that exhibit very low usage. It was also shown that D gene
segment family 7, which is located adjacent to J1 (far down from
other D family members) is mostly used in fetuses, but exhibits a
low usage in adults (Schroeder et al., Immunology 30, 2006,
119-135, incorporated by reference herein in its entirety).
Therefore, in one embodiment, D family 7 sequences are not inverted
5' to 3'.
[0538] In one embodiment, at least two, at least three, at least
four, at least five, at least six, at least seven, at least eight,
at least nine, at least ten, at least eleven, at least twelve, at
least thirteen, at least fourteen, at least fifteen, at least
sixteen, at least seventeen, at least eighteen, at least nineteen,
at least twenty, at least twenty one, at least twenty two, at least
twenty three, at least twenty four, or all or substantially all of
the human functional D gene segments are inverted 5' to 3' with
respect to corresponding wild type sequences.
[0539] In one embodiment, the human immunoglobulin heavy chain
variable domain comprising at least one non-naturally occurring
histidine residue exhibits pH-dependent antigen binding
characteristics. For example, an antibody comprising the modified
immunoglobulin heavy chain variable domain binds a target with
sufficient affinity at around a neutral pH (e.g., pH of about 7.0
to about 7.4), but either does not bind or binds weaker to the same
target at an acidic pH (e.g., pH of about 5.5 to about 6.0). In one
embodiment, the acidic pH is selected from about 5.5, about 5.6,
about 5.7, about 5.8, about 5.9, and about 6.0. In one embodiment,
the neutral pH is selected from about 7.0, about 7.1, about 7.2,
about 7.3, and about 7.4.
[0540] In one embodiment, an antigen-binding protein comprising a
heavy chain variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 2 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin heavy chain locus as described herein has a
dissociative half-life (t.sub.1/2) of less than 1 min at an acidic
pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one
embodiment, an antigen-binding protein comprising a heavy chain
variable domain expressed by the genetically modified
immunoglobulin locus as described herein has at least about 2-fold,
at least about 3-fold, at least about 4-fold, at least about
5-fold, at least about 10-fold, at least about 15-fold, at least
about 20-fold, at least about 25-fold, or at least about 30-fold
decrease in dissociative half-life (t.sub.1/2) at an acidic pH
(e.g., pH of about 5.5 to about 6.0) as compared to the
dissociative half-life (t.sub.1/2) of the antigen-binding protein
at a neutral pH (e.g., pH of about 7.0 to about 7.4).
[0541] In one embodiment, antigen binding proteins comprising the
genetically modified human immunoglobulin heavy chain variable
domain is capable of specifically binding an antigen of interest
with an affinity (K.sub.D) lower than 10.sup.-6, 10.sup.-7,
10.sup.-8, 10.sup.-9 or 10.sup.-10, 10.sup.-11, 10.sup.-12 at a
neutral or physiological pH (pH of about 7.0 to about 7.4).
[0542] The altered binding property of the immunoglobulin heavy
chain variable domain at an acidic pH (e.g., pH of about 5.5 to
about 6.0) would, in some circumstances, allow faster turnover of
the antibody because the therapeutic antibody will bind a target on
a cell's surface, be internalized into an endosome, and more
readily or more rapidly dissociate from the target in the endosome,
so that the therapeutic can be recycled to bind yet another
molecule of target present in another cell. This would allow one to
administer a therapeutic antibody at a lower dose, or administer
the therapeutic antibody less frequently. This is particularly
useful in a situation where it is not desirable to administer a
therapeutic antibody frequently, or administer at a level above a
certain dosage for safety or toxicity reasons.
[0543] In various embodiments, the human immunoglobulin heavy chain
variable region nucleotide sequence as described herein is operably
linked to a human or non-human heavy chain constant region
nucleotide sequence (e.g., a heavy chain constant region nucleotide
sequence that encodes an immunoglobulin isotype selected from IgM,
IgD, IgG, IgE, and IgA). In various embodiments, the human or
non-human heavy chain constant region nucleotide sequence is
selected from the group consisting of a C.sub.H1, a hinge, a
C.sub.H2, a C.sub.H3, and a combination thereof. In one embodiment,
the constant region nucleotide sequence comprises a C.sub.H1, a
hinge, a C.sub.H2, and a C.sub.H3 (e.g., C.sub.H1-hinge-a
C.sub.H2-C.sub.H3).
[0544] In various embodiments, the heavy chain constant region
nucleotide sequence is present at an endogenous locus (i.e., where
the nucleotide sequence is located in a wild-type non-human animal)
or present ectopically (e.g., at a locus different from the
endogenous immunoglobulin chain locus in its genome, or within its
endogenous locus, e.g., within an immunoglobulin variable locus,
wherein the endogenous locus is placed or moved to a different
location in the genome).
[0545] In one embodiment, the heavy chain constant region
nucleotide sequence comprises a modification in a C.sub.H2 or a
C.sub.H3, wherein the modification increases the affinity of the
heavy chain constant region amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0546] The neonatal Fc receptor for IgG (FcRn) has been well
characterized in the transfer of passive humoral immunity from a
mother to her fetus across the placenta and proximal small
intestine (Roopenian, D. and Akilesh, S., Nat. Rev. Immun., 2007,
7:715-725, which is incorporated by reference herein in its
entirety). FcRn binds to the Fc portion of IgG at a site that is
distinct from the binding sites of the classical FcyRs or the C1q
component of complement, which initiates the classical pathway of
complement activation. More specifically, it was shown that FcRn
binds the C.sub.H2-C.sub.H3 hinge region of IgG antibodies--a
versatile region of Fc that also binds Staphylococcal protein A,
Streptococcal protein G, and the rheumatoid factor. In contrast to
other Fc-binding proteins, however, FcRn binds the Fc region of IgG
in a strictly pH-dependent manner; at physiological pH 7.4, FcRn
does not bind IgG, whereas at the acidic pH of the endosome (e.g.,
where the pH ranges from about 5.5 to about 6.0), FcRn exhibits a
low micromolar to nanomolar affinity for the Fc region of IgG. This
pH-dependent interaction has been shown to be mediated by the
titration of histidine residues in the C.sub.H2-C.sub.H3 region of
IgG and their subsequent interaction with acidic residue on the
surface of FcRn (Roopenian, D. and Akilesh, S., Nat. Rev. Immun.,
2007, 7:715-725, incorporated by reference in its entirety).
[0547] Various mutations in the C.sub.H2-C.sub.H3 region of IgG
that can increase the affinity of Fc region to FcRn at an acidic pH
are known in the art. These include, but are not limited to,
modification at position 250 (e.g., E or Q); 250 and 428 (e.g., L
or F); 252 (e.g., L/Y/F/W or T), 254 (e.g., S or T), and 256 (e.g.,
S/R/Q/E/D or T); or a modification at 428 and/or 433 (e.g.,
L/R/S/P/Q or K) and/or 434 (e.g., H/F or Y); or a modification at
250 and/or 428; or a modification at 307 or 308 (e.g., 308F,
V308F), and 434. In another example, the modification can comprise
a 428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L,
259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K
(e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and
256 (e.g., 52Y, 254T, and 256E) modification; a 250Q and 428L
modification, or a combination thereof.
[0548] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 252 and 257, wherein the modification increases the
affinity of the human C.sub.H2 amino acid sequence to FcRn in an
acidic environment (e.g., in an endosome where pH ranges from about
5.5 to about 6.0).
[0549] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H2 amino acid sequence
comprising at least one modification between amino acid residues at
positions 307 and 311, wherein the modification increases the
affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic
environment (e.g., in an endosome where pH ranges from about 5.5 to
about 6.0).
[0550] In one embodiment, the heavy chain constant region
nucleotide sequence encodes a human C.sub.H3 amino acid sequence,
wherein the C.sub.H3 amino acid sequence comprises at least one
modification between amino acid residues at positions 433 and 436,
wherein the modification increases the affinity of the C.sub.H3
amino acid sequence to FcRn in an acidic environment (e.g., in an
endosome where pH ranges from about 5.5 to about 6.0).
[0551] In one embodiment, the human constant region amino acid
sequence encoded by the heavy chain constant region nucleotide
sequence described herein comprises a mutation selected from the
group consisting of M428L, N434S, and a combination thereof. In one
embodiment, the human constant region amino acid sequence comprises
a mutation selected from the group consisting of M428L, V259I,
V308F, and a combination thereof. In one embodiment, the human
constant region amino acid sequence comprises an N434A mutation. In
one embodiment, the human constant region amino acid sequence
comprises a mutation selected from the group consisting of M252Y,
S254T, T256E, and a combination thereof. In one embodiment, the
human constant region amino acid sequence comprises a mutation
selected from the group consisting of T250Q, M248L, or both. In one
embodiment, the human constant region amino acid sequence comprises
a mutation selected from the group consisting of H433K, N434Y, or
both.
[0552] In one embodiment, the heavy chain constant region amino
acid sequence is a non-human constant region amino acid sequence,
and the heavy chain constant region amino acid sequence comprises
one or more of any of the types of modifications described
above.
[0553] In one embodiment, the heavy chain constant region
nucleotide sequence is a human heavy chain constant region amino
acid sequence, and the human heavy chain constant region amino acid
sequence comprises one or more of any of the types of modifications
described above.
EXAMPLES
[0554] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention nor are they intended to represent that the
experiments below are all or the only experiments performed.
Efforts have been made to ensure accuracy with respect to numbers
used (e.g. amounts, temperature, etc.) but some experimental errors
and deviations should be accounted for. Unless indicated otherwise,
parts are parts by weight, molecular weight is weight average
molecular weight, temperature is in degrees Centigrade, and
pressure is at or near atmospheric.
p Example 1
Construction of Humanized Immunoglobulin Heavy Chain Loci
Comprising Histidine-Substituted D Gene Segments
[0555] Construction of immunoglobulin heavy chain loci comprising
histidine-substituted human D gene segments was carried out by
series of homologous recombination reactions in bacterial cells
(BHR) using Bacterial Artificial Chromosome (BAC) DNA. Several
targeting constructs for creation of a genetically engineered mouse
that expresses a heavy chain variable domain comprising one or more
histidine residues were generated using VELOCIGENE.RTM. genetic
engineering technology (see, e.g., U.S. Pat. No. 6,586,251 and
Valenzuela, D. M. et al. (2003), High-throughput engineering of the
mouse genome coupled with high-resolution expression analysis,
Nature Biotechnology 21(6):652-659, which is incorporated herein by
reference in their entireties).
[0556] Initially, human D gene segments were synthesized in silico
as four pieces (4 repeats) in which the codons encoding tyrosine
(Y), asparagine (N), serine (S), glycine (G), and aspartate (D) in
the hydrophilic frame were substituted with histidine codons
(hereinafter "histidine-substituted human D gene segments", i.e.,
HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD 1.7-6.13 (9268 bp; SEQ ID
NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO: 3), and HD 1.20-6.25,
1.26 (11592 bp; SEQ ID NO: 4) (FIG. 3). The four repeats also
contained unique restriction enzyme sites at the ends for ligating
them back together. The specific location of the histidine
substitutions (labeled in bold type) in each human D gene segment
is shown in FIGS. 1A and 1B in the column labeled "Hydrophilic." As
shown in FIG. 1, while the modification introduced histidine codons
in the hydrophilic reading frame, it also changed some stop codons
to serine codons in the "Stop" reading frame. The modification,
however, made few changes in the "Hydrophobic" reading frame. The
detailed procedure for ligating the four synthesized D segment
repeats is illustrated in FIG. 3 (sequential ligation). The
resulting clone contained, from 5' to 3', a 5' mouse homology arm,
a floxed neomycin cassette, human D gene segments comprising
histidine substitutions (i.e., HD 1.1-6.6 (9586 bp; SEQ ID NO: 1),
HD 1.7-6.13 (9268 bp; SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID
NO: 3), and HD 1.20-6.25, 1.26 (11592 bp; SEQ ID NO: 4)), a
chloramphenicol selection cassette, and a 3' homology arm.
[0557] The following six genetic modifications were carried out in
order to replace the endogenous human D gene segments in the
VELOCIMMUNE.RTM. humanized mouse with the histidine-substituted
human D gene segments described above.
[0558] First, pLMa0174, containing a spectinomycin selection
cassette and an AsiSI restriction site, was targeted into the 5'
end of the MAID 1116 clone (Step 1. BHR (Spec); FIG. 2). During
Step 1, a chloramphenicol selection cassette, a neomycin selection
cassette, a loxP site, two V.sub.H gene segments (hV.sub.H1-3 and
hV.sub.H1-2), and the human Adam6p gene, all of which are located
5' upstream of hV.sub.H6-1, were deleted from the MAID 1116 clone
and replaced by a spectinomycin cassette to yield the VI433
clone.
[0559] Second, in Step 2 (BHR (Hyg+Spec); FIG. 2), pNTu0002
containing a hygromycin cassette flanked by FRT sites was targeted
into a region comprising human immunoglobulin D.sub.H gene
segments. During Step 2, all human heavy chain D gene segments were
deleted from VI433 and replaced with the hygromycin cassette to
yield MAID6011 VI434 (clone 1). The modification also introduced
the PI-SceI and the I-CeuI restriction sites at the 5' and 3' end
of the hygromycin cassette.
[0560] Third, the genomic region comprising histidine-substituted
human D gene segments (HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD
1.7-6.13 (9268 bp; SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO:
3), and HD 1.20-6.25, 1.26 (11592 bp; SEQ ID NO: 4)) were
introduced into a region between the PI-SceI and the I-CeuI sites
of MAID 6011 VI434 via restriction digestion and ligation
(PI-SceI/I-CeuI Ligation modified 1116 (Kan+Spec); FIG. 4). This
yielded MAID6012 VI469 containing, from 5' to 3', a spectinomycin
cassette, about 50 kb of a genomic region comprising V.sub.H6-1, a
floxed neomycin cassette, about 40 kb of the histidine-substituted
human D gene segments (HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD
1.7-6.13 (9268 bp; SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO:
3), and HD 1.20-6.25, 1.26 (11592 bp; SEQ ID NO: 4)), and about 25
kb of a genomic region containing human J.sub.H gene segments,
followed by a mouse E.sub.i (mIgH intronic enhancer; SEQ ID NO: 5),
a mouse switch region (SEQ ID NO: 6), and a mouse IgM constant
region nucleotide sequence (mIgM exon 1; SEQ ID NO: 7). Bacterial
cells containing the modification were selected based on Kanamycin
and Spectinomycin selection.
[0561] Fourth, MAID 1460 heterozygous mouse ES cells were targeted
with MAID 6011 VI434 via electroporation in order to remove all
endogenous human D gene segments from the MAID 1460 clone as
illustrated in FIG. 5. This yielded MAID 6011 heterozygous mouse ES
cells comprising in its immunoglobulin heavy chain locus (at the
129 strain-derived chromosome), from 5' to 3', an FRT site, human
V.sub.H gene segments, a mouse genomic region encompassing adam6a/b
genes, a hygromycin cassette flanked by FRT sites, and human
J.sub.H segments, followed by a mouse E.sub.i sequence and an IgM
constant region nucleotide sequence. The genetic modification of
MAID 6011 (a loss of alleles, a gain of alleles, and presence of
parental alleles) was confirmed by using the probes and primers as
shown in FIG. 6.
[0562] Fifth, MAID 6011 heterozygous mouse ES cells were
electroporated with MAID 6012 VI469 in order to introduce
histidine-substituted human D gene segments (i.e., HD 1.1-6.6 (9586
bp; SEQ ID NO: 1), HD 1.7-6.13 (9268 bp; SEQ ID NO: 2), HD
1.14-6.19 (9441 bp; SEQ ID NO: 3), and HD 1.20-6.25, 1.26 (11592
bp; SEQ ID NO: 4)) into MAID 6011. The targeting step removed the
floxed hygromycin selection cassette from MAID 6011 and replaced
the sequence with the histidine-substituted human D gene segments.
This lead to MAID 6012 hetrozygous ES cells comprising a wild-type
C57BL/6 strain-derived chromosome and a genetically modified 129
strain-derived chromosome comprising human wild-type V.sub.H and
J.sub.H gene segments and the histidine-substituted human D gene
segments described herein. In addition, the ES cells contained a
mouse genomic region encompassing adam6a/b genes and a floxed
neomycin cassette between the V.sub.H and D segments (FIG. 7). The
genetic modification of MAID 6012 (a loss of alleles, a gain of
alleles, and presence of parental alleles) was confirmed by using
the probes and primers as shown in FIG. 8.
[0563] Lastly, MAID 6012 ES cells were electroporated with a
plasmid that expresses a Cre recombinase in order to remove the
neomycin selection cassette from the MAID 6012 ES cells, resulting
in MAID 6013 heterozygous ES cells (FIG. 9). The final MAID 6013
heterozygous ("MAID 6013 het") ES cell contains a wild-type C57BL/6
strain-derived chromosome and a genetically modified, 129
strain-derived chromosome comprising in its immunoglobulin heavy
chain locus, from 5' to 3', (1) an FRT site; (2) human V.sub.H gene
segments; (3) a mouse genomic region encompassing adam6a/b genes;
(4) a floxed neomycin selection cassette; (5) histidine-substituted
human D gene segments (HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD
1.7-6.13 (9268 bp; SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO:
3), and HD 1.20-6.25, 1.26 (11592 bp; SEQ ID NO: 4)); (6) human
J.sub.H gene segments; followed by (7) a mouse E.sub.i sequence
(mIgH intronic enhancer; SEQ ID NO: 5), (8) a switch region (SEQ ID
NO: 6); and (9) a mouse IgM constant region nucleotide sequence
(mIgM exon 1; SEQ ID NO: 7) as illustrated in FIG. 9.
[0564] The targeted ES cells (MAID 6013) described above were used
as donor ES cells and introduced into an 8-cell stage mouse embryo
by the VELOCIMOUSE.RTM. method (see, e.g., U.S. Pat. No. 7,576,259,
U.S. Pat. No. 7,659,442, U.S. Pat. No. 7,294,754, US 2008-0078000
A1, all of which are incorporated by reference herein in their
entireties). Mice bearing the genetically modified immunoglobulin
heavy chain locus comprising the histidine-substituted human heavy
chain D gene segments described herein were identified by
genotyping using the primers and probes set forth in FIG. 8. The
resulting genetically modified FO mouse was crossed to a wild-type
mouse to obtain F1 offspring. F1 pups were genotyped, and the F1
pups that are heterozygous for the genetically modified
immunoglobulin locus comprising histidine-substituted human heavy
chain D gene segments were selected for further
characterization.
Example 2
Analysis of Rearranged Heavy Chain Variable Region Nucleotide
Sequences
[0565] Next, it was examined whether the genetically modified mouse
comprising histidine-substituted human D gene segments described
herein, i.e., 6013 F0 heterozygous mouse, which comprises in its
germline a 129 strain-derived chromosome comprising human V.sub.H,
J.sub.H gene segments, and histidine-substituted human D gene
segments (HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD 1.7-6.13 (9268 bp;
SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO: 3), and HD
1.20-6.25, 1.26 (11592 bp; SEQ ID NO: 4), can express rearranged
heavy chain V(D)J sequences comprising one or more histidine codons
derived from the genetically modified immunoglobulin heavy chain
locus.
[0566] To this end, mRNA sequences encoding IgM heavy chain
variable region were analyzed for the presence of IgM CDR3
sequences derived from the histidine-substituted human D gene
segments via high throughput sequencing. Briefly, spleens were
harvested and homogenized in 1.times.PBS (Gibco) using glass
slides. Cells were pelleted in a centrifuge (500.times.g for 5
minutes), and red blood cells were lysed in ACK Lysis buffer
(Gibco) for 3 minutes. Cells were washed with 1.times.PBS and
filtered using a 0.7 .mu.m cell strainer. B-cells were isolated
from spleen cells using MACS magnetic positive selection for CD19
(Miltenyi Biotec). Total RNA was isolated from pelleted B-cells
using the RNeasy Plus kit(Qiagen). PolyA+mRNA was isolated from
total RNA using the Oligotex.RTM. Direct mRNA mini kit
(Qiagen).
[0567] Double-stranded cDNA was prepared from splenic B cell mRNA
by 5' RACE using the SMARTer.TM. Pico cDNA Synthesis Kit
(Clontech). The Clontech reverse transcriptase and dNTPs were
substituted with Superscript II and dNTPs from Invitrogen. Heavy
chain variable region (V.sub.H) antibody repertoires were amplified
from the cDNA using primers specific for IgM constant regions and
the SMARTer.TM. 5' RACE primer (Table 1). PCR products were cleaned
up using a QIAquick.RTM. PCR Purification Kit (Qiagen). A second
round of PCR was done using the same 5' RACE primer and a nested 3'
primer specific for the IgM constant regions (Table 2). The second
round PCR products were purified using a SizeSelect.TM. E-gel.RTM.
system (Invitrogen). A third PCR was performed with primers that
added 454 adapters and barcodes. The third round PCR products were
purified using Agencourt.RTM. AMPure.RTM. XP Beads. Purified PCR
products were quantified by SYBR.RTM.-qPCR using a KAPA Library
Quantification Kit (KAPA Biosystems). Pooled libraries were
subjected to emulsion PCR (emPCR) using the 454 GS Junior Titanium
Series Lib-A emPCR Kit (Roche Diagnostics) and bidirectional
sequencing using Roche 454 GS Junior instrument according to the
manufacturer's protocols.
TABLE-US-00001 TABLE 1 NAME SEQUENCE 3' mIgM CH1 outer
TCTTATCAGACAGGGGGCTCTC (SEQ ID NO: 321)
TABLE-US-00002 TABLE 2 NAME 3' mIgM GGAAGACATTTGGGAAGGACTG (SEQID
NO: 322) CH1 inner
[0568] Bioinfomatic Analysis
[0569] The 454 sequences were sorted based on the sample barcode
perfect match and trimmed for quality. Custom D database was
created using histidine-substituted human D-gene segments.
Sequences were annotated based on alignment of rearranged Ig
sequences to human germline V and J gene segments database using
local installation of igblast (NCBI, v2.2.25+). Sequences derived
from the endogenous mouse immunoglobulin heavy chain locus were
filtered out using similarity threshold of 90%. A sequence was
marked as ambiguous and removed from analysis when multiple best
hits with identical score were detected. A set of perl scripts was
developed to analyze results and store data in mysql database. The
CDR3 region was defined between conserved C codon and FGXG motif
(SEQ ID NO: 323) for light chains and WGXG motif (SEQ ID NO: 324)
for heavy chains. CDR3 length was determined using only productive
antibodies. Number of histidine codons was calculated for each CDR3
region.
[0570] As shown in FIGS. 11-13, the 6013 F0 heterozygous mice
expressed a diverse repertoire of rearranged heavy chain variable
region mRNA sequences (rearranged V-D-J sequences) encoding one or
more histidine codons in CDR3. The sequencing and alignment data
suggested that the histidine codons appeared in CDR3 sequences were
derived from various histidine-substituted human D gene segments
present in the genetically modified immunoglobulin heavy chain
locus of the 6013 mice described herein. In addition, as compared
with control mice comprising human V.sub.H, D.sub.H, J.sub.H gene
segments and mouse adam6 genes (VI3-Adam6, US Publication No.
2012/0322108A1, which is incorporated by reference in its
entirety), the genetically modified 6013 F0 heterozygous mice
exhibited a higher frequency of histidine occurrence in the heavy
chain CDR3 sequences (FIG. 14).
[0571] While the described invention has been described with
reference to the specific embodiments thereof it should be
understood by those skilled in the art that various changes may be
made and equivalents may be substituted without departing from the
true spirit and scope of the invention. In addition, many
modifications may be made to adopt a particular situation,
material, composition of matter, process, process step or steps, to
the objective spirit and scope of the described invention. All such
modifications are intended to be within the scope of the claims
appended hereto.
Sequence CWU 1
1
32419586DNAHomo sapiensmisc_feature(1)..(9586)HD 1.1-6.6
1tccccgttga agctgacctg cccagagggg cctgggccca ccccacacac cggggcggaa
60tgtgtacagg ccccggtctc tgtgggtgtt ccgctaactg gggctcccag tgctcacccc
120acaactaaag cgagccccag cctccagagc ccccgaagga gatgccgccc
acaagcccag 180cccccatcca ggaggcccca gagctcaggg cgccggggca
gattctgaac agccccgagt 240cacggtgggt accactggca cgaccaccgt
gagaaaaact gtgtccaaaa ctgtctcctg 300gcccctgctg gaggccgcgc
cagagagggg agcagccgcc ccgaacctag gtcctgctca 360gctcacacga
cccccagcac ccagagcaca acggagtccc cattgaatgg tgaggacggg
420gaccagggct ccagggggtc atggaagggg ctggacccca tcctactgct
atggtcccag 480tgctcctggc cagaactgac cctaccaccg acaagagtcc
ctcagggaaa cgggggtcac 540tggcacctcc cagcatcaac cccaggcagc
acaggcataa accccacatc cagagccgac 600tccaggagca gagacacccc
agtaccctgg gggacaccga ccctgatgac tccccactgg 660aatccacccc
agagtccacc aggaccaaag accccgcccc tgtctctgtc cctcactcag
720gacctgctgc ggggcgggcc atgagaccag actcgggctt agggaacacc
actgtggccc 780caacctcgac caggccacag gcccttcctt cctgccctgc
ggcagcacag actttggggt 840ctgtgcagag aggaatcaca gaggccccag
gctgaggtgg tgggggtgga agacccccag 900gaggtggccc acttcccttc
ctcccagctg gaacccacca tgaccttctt aagatagggg 960tgtcatccga
ggcaggtcct ccatggagct cccttcaggc tcctccccgg tcctcactag
1020gcctcagtcc cggctgcggg aatgcagcca ccacaggcac accaggcagc
ccagacccag 1080ccagcctgca gtgcccaagc ccacattctg gagcagagca
ggctgtgtct gggagagtct 1140gggctcccca ccgccccccc gcacacccca
cccacccctg tccaggccct atgcaggagg 1200gtcagagccc cccatggggt
atggacttag ggtctcactc acgtggctcc cctcctgggt 1260gaaggggtct
catgcccaga tccccacagc agagctggtc aaaggtggag gcagtggccc
1320cagggccacc ctgacctgga ccctcaggct cctctagccc tggctgccct
gctgtccctg 1380ggaggcctgg actccaccag accacaggtc cagggcaccg
cccataggtg ctgcccacac 1440tcagttcaca ggaagaagat aagctccaga
cccccaagac tgggacctgc cttcctgcca 1500ccgcttgtag ctccagacct
ccgtgcctcc cccgaccact tacacacggg ccagggagct 1560gttccacaaa
gatcaacccc aaaccgggac cgcctggcac tcgggccgct gccacttccc
1620tctccatttg ttcccagcac ctctgtgctc cctccctcct ccctccttca
ggggaacagc 1680ctgtgcagcc cctccctgca ccccacaccc tggggaggcc
caaccctgcc tccagccctt 1740tctcccccgc tgctcttcct gcccatccag
acaaccctgg ggtcccatcc ctgcagccta 1800caccctggtc tccacccaga
cccctgtctc tccctccaga cacccctccc aggccaaccc 1860tgcacatgca
ggccctcccc ttttctgctg ccagagcctc agtttctacc ctctgtgcct
1920accccctgcc tcctcctgcc cacaactcga gctcttcctc tcctggggcc
cctgagccat 1980ggcactgacc gtgcactccc acccccacac tgcccatgcc
ctcaccttcc tcctggacac 2040tctgaccccg ctcccctctt ggacccagcc
ctggtatttc caggacaaag gctcacccaa 2100gtcttcccca tgcaggccct
tgccctcact gcccggttac acggcagcct cctgtgcaca 2160gaagcaggga
gctcagccct tccacaggca gaaggcactg aaagaaatcg gcctccagca
2220ccctgatgca cgtccgcctg tgtctctcac tgcccgcacc tgcagggagg
ctcggcactc 2280cctgtaaaga cgagggatcc aggcagcaac atcatgggag
aatgcagggc tcccagacag 2340cccagccctc tcgcaggcct ctcctgggaa
gagacctgca gccaccactg aacagccacg 2400gagcccgctg gatagtaact
gagtcagtga ccgacctgga gggcagggga gcagtgaacc 2460ggagcccaga
ccatagggac agagaccagc cgctgacatc ccgagcccct cactggcggc
2520cccagaacac cgcgtggaaa cagaacagac ccacattccc acctggaaca
gggcagacac 2580tgctgagccc ccagcaccag ccctgagaaa caccaggcaa
cggcatcaga gggggctcct 2640gagaaagaaa ggaggggagg tctccttcac
cagcaagtac ttcccttgac caaaaacagg 2700gtccacgcaa ctcccccagg
acaaaggagg agccccctgt acagcactgg gctcagagtc 2760ctctcccaca
caccctgagt ttcagacaaa aaccccctgg aaatcatagt atcagcagga
2820gaactagcca gagacagcaa gaggggactc agtgactccc gcggggacag
gaggattttg 2880tgggggctcg tgtcactgtg aggacattgt agtcatacca
gctgccatac ccacagtgac 2940acagccccat tcccaaagcc ctgctgtaaa
cgcttccact tctggagctg aggggctggg 3000gggagcgtct gggaagtagg
gcctaggggt ggccatcaat gcccaaaacg caccagactc 3060ccccccagac
atcaccccac tggccagtga gcagagtaaa cagaaaatga gaagcagctg
3120ggaagcttgc acaggcccca aggaaagagc tttggcgggt gtgcaagagg
ggatgcgggc 3180agagcctgag cagggccttt tgctgtttct gctttcctgt
gcagatagtt ccataaactg 3240gtgttcaaga tcgatggctg ggagtgagcc
caggaggaca gtgtgggaag ggcacaggga 3300aggagaagca gccgctatcc
tacactgtca tctttcaaga gtttgccctg tgcccacaat 3360gctgcatcat
gggatgctta acagctgatg tagacacagc taaagagaga atcagtgaaa
3420tggatttgca gcacagatct gaataaattc tccagaatgt ggagccacac
agaagcaagc 3480acaaggaaag tgcctgatgc aagggcaaag tacagtgtgt
accttcaggc tgggcacaga 3540cactctgaaa agccttggca ggaactccct
gcaacaaagc agagccctgc aggcaatgcc 3600agctccagag ccctccctga
gagcctcatg ggcaaagatg tgcacaacag gtgtttctca 3660tagccccaaa
ctgagaatga agcaaacagc catctgaagg aaaacaggca aataaacgat
3720ggcaggttca tgaaatgcaa acccagacag ccagaaggac aacagtgagg
gttacaggtg 3780actctgtggt tgagttcatg acaatgctga gtaattggag
taacaaagga aagtccaaaa 3840aatactttca atgtgatttc ttctaaataa
aatttacagc cggcaaaatg aactatcttc 3900ttaagggata aactttccac
taggaaaact ataaggaaaa tcaagaaaag gatgatcaca 3960taaacacagt
ggtcgttact tctactgggg aaggaagagg gtatgaactg agacacacag
4020ggttggcaag tctcctaaca agaacagaac aaatacatta cagtaccttg
aaaacagcag 4080ttaaaattct aaattgcaag aagaggaaaa tgcacacagc
tgtgtttaga aaattctcag 4140tccagcactg ttcataatag caaagacatt
aacccaggtt ggataaataa acgatgacac 4200aggcaattgc acaatgatac
agacatacat tcagtatatg agacattgat gatgtatccc 4260caaagaaatg
actttaaaga gaaaaggcct gatatgtggt ggcactcacc tccctgggca
4320tccccggaca ggctgcaggc acactgtgtg gcagggcagg ctggtacctg
ctggcagctc 4380ctggggcctg atgtggagca ggcacagagc cgtatccccc
cgaggacata tacccccaag 4440gacggcacag ttggtacatt ccggagacaa
gcaactcagc cacactccca ggccagagcc 4500cgagagggac gcccatgcac
agggaggcag agcccagctc ctccacagcc agcagcaccc 4560gtgcaggggc
cgccatctgg caggcacaga gcatgggctg ggaggagggg cagggacacc
4620aggcagggtt ggcaccaact gaaaattaca gaagtctcat acatctacct
cagccttgcc 4680tgacctgggc ctcacctgac ctggacctca cctggcctgg
acctcacctg gcctagacct 4740cacctctggg cttcacctga gctcggcctc
acctgacttg gaccttgcct gtcctgagct 4800cacatgatct gggcctcacc
tgacctgggt ttcacctgac ctgggcttca cctgacctgg 4860gcctcatctg
acctgggcct cactggcctg gacctcacct ggcctgggct tcacctggcc
4920tcaggcctca tctgcacctg ctccaggtct tgctggaacc tcagtagcac
tgaggctgca 4980ggggctcatc cagggttgca gaatgactct agaacctccc
acatctcagc tttctgggtg 5040gaggcacctg gtggcccagg gaatataaaa
agcctgaatg atgcctgcgt gatttggggg 5100caatttataa acccaaaagg
acatggccat gcagcgggta gggacaatac agacagatat 5160cagcctgaaa
tggagcctca gggcacaggt gggcacggac actgtccacc taagccaggg
5220gcagacccga gtgtccccgc agtagacctg agagcgctgg gcccacagcc
tcccctcggt 5280gccctgctac ctcctcaggt cagccctgga catcccgggt
ttccccaggc ctggcggtag 5340gtttggggtg aggtctgtgt cactgtggta
tcaccatttt tggagtggtc attataccca 5400cagtgtcaca gagtccatca
aaaacccatc cctgggaacc ttctgccaca gccctccctg 5460tggggcaccg
ccgcgtgcca tgttaggatt ttgactgagg acacagcacc atgggtatgg
5520tggctaccgc agcagtgcag cccgtgaccc aaacacacag ggcagcaggc
acaacagaca 5580agcccacaag tgaccaccct gagctcctgc ctgccagccc
tggagaccat gaaacagatg 5640gccaggatta tcccataggt cagccagacc
tcagtccaac aggtctgcat cgctgctgcc 5700ctccaatacc agtccggatg
gggacagggc tggcccacat taccatttgc tgccatccgg 5760ccaacagtcc
cagaagcccc tccctcaagg ctgggccaca tgtgtggacc ctgagagccc
5820cccatgtctg agtaggggca ccaggaaggt ggggctggcc ctgtgcactg
tccctgcccc 5880tgtggtccct ggcctgcctg gccctgacac ctgggcctct
cctgggtcat ttccaagaca 5940gaagacattc ccaggacagc tggagctggg
agtccatcat cctgcctggc cgtcctgagt 6000cctgcgcctt tccaaacctc
acccgggaag ccaacagagg aatcacctcc cacaggcaga 6060gacaaagacc
ttccagaaat ctctgtctct ctccccagtg ggcaccctct tccagggcag
6120tcctcagtga tatcacagtg ggaacccaca tctggatcgg gactgccccc
agaacacaag 6180atggcccaca gggacagccc cacagcccag cccttcccag
acccctaaaa ggcgtcccac 6240cccctgcatc tgccccaggg ctcaaactcc
aggaggactg actcctgcac accctcctgc 6300cagacatcac ctcagcccct
cctggaaggg acaggagcgc gcaagggtga gtcagaccct 6360cctgccctcg
atggcaggcg gagaagattc agaaaggtct gagatcccca ggacgcagca
6420ccactgtcaa tgggggcccc agacgcctgg accagggcct gcgtgggaaa
ggcctctggg 6480cacactcagg ggctttttgt gaagggtcct cctactgtgt
gaccacagtc actaccacag 6540tgatgaaccc agcagcaaaa actgaccgga
ctcccaaggt ttatgcacac ttctccgctc 6600agagctctcc aggatcagaa
gagccgggcc caagggtttc tgcccagacc ctcggcctct 6660agggacatct
tggccatgac agcccatggg ctggtgcccc acacatcgtc tgccttcaaa
6720caagggcttc agagggctct gaggtgacct cactgatgac cacaggtgcc
ctggcccctt 6780ccccaccagc tgcaccagac cccgtcatga cagatgcccc
gattccaaca gccaattcct 6840ggggccagga atcgctgtag acaccagcct
ccttccaaca cctcctgcca attgcctgga 6900ttcccatccc ggttggaatc
aagaggacag catcccccag gctcccaaca ggcaggactc 6960ccacaccctc
ctctgagagg ccgctgtgtt ccgtagggcc aggctgcaga cagtccccct
7020cacctgccac tagacaaatg cctgctgtag atgtccccac ctggaaaata
ccactcatgg 7080agcccccagc cccaggtaca gctgtagaga gagtctctga
ggcccctaag aagtagccat 7140gcccagttct gccgggaccc tcggccaggc
tgacaggagt ggacgctgga gctgggccca 7200tactgggcca cataggagct
caccagtgag ggcaggagag cacatgccgg ggagcaccca 7260gcctcctgct
gaccagaggc ccgtcccaga gcccaggagg ctgcagaggc ctctccaggg
7320ggacactgtg catgtctggt ccctgagcag ccccccacgt ccccagtcct
gggggcccct 7380ggcacagctg tctggaccct ctctattccc tgggaagctc
ctcctgacag ccccgcctcc 7440agttccaggt gtggttattg tcagggggtg
tcagactgtg gtggacacag ccatggttac 7500cacagtggtg ctgcccatag
cagcaaccag gccaagtaga caggcccctg ctgtgcagcc 7560ccaggcctcc
agctcacctg cttctcctgg ggctctcaag gctgctgttt tctgcactct
7620cccctctgtg gggagggttc cctcagtggg agatctgttc tcaacatccc
acggcctcat 7680tcctgcaagg aaggccaatg gatgggcaac ctcacatgcc
gcggctaaga tagggtgggc 7740agcctggcgg ggacaggaca tcctgctggg
gtatctgtca ctgtgcctag tggggcactg 7800gctcccaaac aacgcagtcc
ttgccaaaat ccccacggcc tcccccgcta ggggctggcc 7860tgatctcctg
cagtcctagg aggctgctga cctccagaat ggctccgtcc ccagttccag
7920ggcgagagca gatcccaggc cggctgcaga ctgggaggcc accccctcct
tcccagggtt 7980cactgcaggt gaccagggca ggaaatggcc tgaacacagg
gataaccggg ccatccccca 8040acagagtcca ccccctcctg ctctgtaccc
cgcacccccc aggccagccc atgacatccg 8100acaaccccac accagagtca
ctgcccggtg ctgccctagg gaggacccct cagcccccac 8160cctgtctaga
ggactgggga ggacaggaca cgccctctcc ttatggttcc cccacctggc
8220tctggctggg acccttgggg tgtggacaga aaggacgctt gcctgattgg
cccccaggag 8280cccagaactt ctctccaggg accccagccc gagcaccccc
ttacccagga cccagccctg 8340cccctcctcc cctctgctct cctctcatca
ccccatggga atccagaatc cccaggaagc 8400catcaggaag ggctgaggga
ggaagtgggg ccactgcacc accaggcagg aggctctgtc 8460tttgtgaacc
cagggaggtg ccagcctcct agagggtatg gtccaccctg cctatggctc
8520ccacagtggc aggctgcagg gaaggaccag ggacggtgtg ggggagggct
cagggccccg 8580cgggtgctcc atcttggatg agcctatctc tctcacccac
ggactcgccc acctcctctt 8640caccctggcc acacgtcgtc cacaccatcc
taagtcccac ctacaccaga gccggcacag 8700ccagtgcaga cagaggctgg
ggtgcagggg ggccgactgg gcagcttcgg ggagggagga 8760atggaggaag
gggagttcag tgaagaggcc cccctcccct gggtccagga tcctcctctg
8820ggacccccgg atcccatccc ctccaggctc tgggaggaga agcaggatgg
gagaatctgt 8880gcgggaccct ctcacagtgg aatacctcca cagcggctca
ggccagatac aaaagcccct 8940cagtgagccc tccactgcag tgctgggcct
gggggcagcc gctcccacac aggatgaacc 9000cagcaccccg aggatgtcct
gccaggggga gctcagagcc atgaaggagc aggatatggg 9060acccccgata
caggcacaga cctcagctcc attcaggact gccacgtcct gccctgggag
9120gaaccccttt ctctagtccc tgcaggccag gaggcagctg actcctgact
tggacgccta 9180ttccagacac cagacagagg ggcaggcccc ccagaaccag
ggatgaggac gccccgtcaa 9240ggccagaaaa gaccaagttg cgctgagccc
agcaagggaa ggtccccaaa caaaccagga 9300agtttctgaa ggtgtctgtg
tcacagtgga gcatagccac tcgtcccaca gtgacactcg 9360ccaggccaga
aaccccatcc caagtcagcg gaatgcagag agagcaggga ggacatgttt
9420aggatctgag gccgcacctg acacccaggc cagcagacgt ctcctgtcca
cggcaccctg 9480ccatgtcctg catttctgga agaacaaggg caggctgaag
ggggtccagg accaggagat 9540gggtccgctc tacccagaga aggagccagg
caggacacaa gccccc 958629268DNAHomo sapiensmisc_feature(1)..(9268)HD
1.7-6.13 2tccccattga ggctgacctg cccagagggt cctgggccca cccaacacac
cggggcggaa 60tgtgtgcagg cctcggtctc tgtgggtgtt ccgctagctg gggctcacag
tgctcacccc 120acacctaaaa cgagccacag cctccggagc ccctgaagga
gaccccgccc acaagcccag 180cccccaccca ggaggcccca gagcacaggg
cgccccgtcg gattctgaac agccccgagt 240cacagtgggt atcactggca
ctaccactgt gagaaaagct tcgtccaaaa cggtctcctg 300gccacagtcg
gaggccccgc cagagagggg agcagccacc ccaaacccat gttctgccgg
360ctcccatgac cccgtgcacc tggagcccca cggtgtcccc actggatggg
aggacaaggg 420ccgggggctc cggcgggtcg gggcaggggc ttgatggctt
ccttctgccg tggccccatt 480gcccctggct ggagttgacc cttctgacaa
gtgtcctcag agagtcaggg atcagtggca 540cctcccaaca tcaaccccac
gcagcccagg cacaaacccc acatccaggg ccaactccag 600gaacagagac
accccaatac cctgggggac cccgaccctg atgactcccg tcccatctct
660gtccctcact tggggcctgc tgcggggcga gcacttggga gcaaactcag
gcttagggga 720caccactgtg ggcctgacct cgagcaggcc acagaccctt
ccctcctgcc ctggtgcagc 780acagactttg gggtctgggc agggaggaac
ttctggcagg tcaccaagca cagagccccc 840aggctgaggt ggccccaggg
ggaaccccag caggtggccc actacccttc ctcccagctg 900gaccccatgt
cttccccaag ataggggtgc catccaaggc aggtcctcca tggagccccc
960ttcaggctcc tctccagacc ccactgggcc tcagtcccca ctctaggaat
gcagccacca 1020cgggcacacc aggcagccca ggcccagcca ccctgcagtg
cccaagccca caccctggag 1080gagagcaggg tgcgtctggg aggggctggg
ctccccaccc ccacccccac ctgcacaccc 1140cacccaccct tgcccgggcc
ccctgcagga gggtcagagc ccccatggga tatggactta 1200gggtctcact
cacgcacctc ccctcctggg agaaggggtc tcatgcccag atccccccag
1260cagcgctggt cacaggtaga ggcagtggcc ccagggccac cctgacctgg
cccctcaggc 1320tcctctagcc ctggctgccc tgctgtccct gggaggcctg
ggctccacca gaccacaggt 1380ctagggcacc gcccacactg gggccgccca
cacacagctc acaggaagaa gataagctcc 1440agacccccag gcccgggacc
tgccttgctg ctacgacttc ctgccccaga cctcgttgcc 1500ctcccccgtc
cacttacaca caggccagga agctgttccc acacagacca accccagacg
1560gggaccacct ggcactcagg tcactgccat ttccttctcc attcacttcc
aatgcctctg 1620tgcttcctcc ctcctccttc cttcggggga gcaccctgtg
cagctcctcc ctgcagtcca 1680caccctgggg agacccgacc ctgcagccca
caccctgggg agacctgacc ctcctccagc 1740cctttctccc ccgctgctct
tgccacccac caagacagcc ctggggtcct gtccctacag 1800cccccaccca
gttctctacc tagacccgtc ttcctccctc taaacacctc tcccaggcca
1860accctacacc tgcaggccct cccctccact gccaaagacc ctcagtttct
cctgcctgtg 1920cccacccccg tgctcctcct gcccacagct cgagctcttc
ctctcctagg gcccctgagg 1980gatggcattg accgtgccct cgcacccaca
cactgcccat gccctcacat tcctcctggc 2040cactccagcc ccactcccct
ctcaggcctg gctctggtat ttctgggaca aagccttacc 2100caagtctttc
ccatgcaggc ctgggccctt accctcactg cccggttaca gggcagcctc
2160ctgtgcacag aagcagggag ctcagccctt ccacaggcag aaggcactga
aagaaatcgg 2220cctccagcgc cttgacacac gtctgcctgt gtctctcact
gcccgcacct gcagggaggc 2280tcggcactcc ctctaaagac gagggatcca
ggcagcagca tcacaggaga atgcagggct 2340accagacatc ccagtcctct
cacaggcctc tcctgggaag agacctgaag acgcccagtc 2400aacggagtct
aacaccaaac ctccctggag gccgatgggt agtaacggag tcattgccag
2460acctggaggc aggggagcag tgagcccgag cccacaccat agggccagag
gacagccact 2520gacatcccaa gccactcact ggtggtccca caacacccca
tggaaagagg acagacccac 2580agtcccacct ggaccagggc agagactgct
gagacccagc accagaacca accaagaaac 2640accaggcaac agcatcagag
ggggctctgg cagaacagag gaggggaggt ctccttcacc 2700agcaggcgct
tcccttgacc gaagacagga tccatgcaac tcccccagga caaaggagga
2760gccccttgtt cagcactggg ctcagagtcc tctccaagac acccagagtt
tcagacaaaa 2820accccctgga atgcacagtc tcagcaggag agccagccag
agccagcaag atggggctca 2880gtgacacccg cagggacagg aggattttgt
gggggctcgt gtcactgtga ggacattgta 2940ctcatggtgt atgccatacc
cacagtgaca cagccccatt cccaaagccc tactgcaaac 3000gcattccact
tctggggctg aggggctggg ggagcgtctg ggaaataggg ctcaggggtg
3060tccatcaatg cccaaaacgc accagactcc cctccataca tcacacccac
cagccagcga 3120gcagagtaaa cagaaaatga gaagcaagct ggggaagctt
gcacaggccc caaggaaaga 3180gctttggcgg gtgtgtaaga ggggatgcgg
gcagagcctg agcagggcct tttgctgttt 3240ctgctttcct gtgcagagag
ttccataaac tggtgttcga gatcaatggc tgggagtgag 3300cccaggagga
cagcgtggga agagcacagg gaaggaggag cagccgctat cctacactgt
3360catctttcga aagtttgcct tgtgcccaca ctgctgcatc atgggatgct
taacagctga 3420tgtagacaca gctaaagaga gaatcagtga gatggatttg
cagcacagat ctgaataaat 3480tctccagaat gtggagcagc acagaagcaa
gcacacagaa agtgcctgat gcaaggacaa 3540agttcagtgg gcaccttcag
gcattgctgc tgggcacaga cactctgaaa agccctggca 3600ggaactccct
gtgacaaagc agaaccctca ggcaatgcca gccccagagc cctccctgag
3660agcctcatgg gcaaagatgt gcacaacagg tgtttctcat agccccaaac
tgagagcaaa 3720gcaaacgtcc atctgaagga gaacaggcaa ataaacgatg
gcaggttcat gaaatgcaaa 3780cccagacagc cacaagcaca aaagtacagg
gttataagcg actctggttg agttcatgac 3840aatgctgagt aattggagta
acaaagtaaa ctccaaaaaa tactttcaat gtgatttctt 3900ctaaataaaa
tttacaccct gcaaaatgaa ctgtcttctt aagggataca tttcccagtt
3960agaaaaccat aaagaaaacc aagaaaagga tgatcacata aacacagtgg
tggttacttc 4020tgctggggaa ggaagagggt atgaactgag atacacaggg
tgggcaagtc tcctaacaag 4080aacagaacga atacattaca gtaccttgaa
aacagcagtt aaacttctaa attgcaagaa 4140gaggaaaatg cacacagttg
tgtttagaaa attctcagtc cagcactgtt cataatagca 4200aagacattaa
cccaggtcgg ataaataagc gatgacacag gcaattgcac aatgatacag
4260acatatattt agtatatgag acatcgatga tgtatcccca aataaacgac
tttaaagaga 4320taaagggctg atgtgtggtg gcattcacct ccctgggatc
cccggacagg ttgcaggctc 4380actgtgcagc agggcaggcg ggtacctgct
ggcagttcct ggggcctgat gtggagcaag 4440cgcagggcca tatatcccgg
aggacggcac agtcagtgaa ttccagagag aagcaactca 4500gccacactcc
ccaggcagag cccgagaggg acgcccacgc acagggaggc agagcccagc
4560acctccgcag ccagcaccac ctgcgcacgg gccaccacct tgcaggcaca
gagtgggtgc 4620tgagaggagg ggcagggaca ccaggcaggg tgagcaccca
gagaaaactg cagacgcctc 4680acacatccac ctcagcctcc cctgacctgg
acctcactgg cctgggcctc acttaacctg 4740ggcttcacct gaccttggcc
tcacctgact tggacctcgc ctgtcccaag ctttacctga 4800cctgggcctc
aactcacctg aacgtctcct gacctgggtt taacctgtcc tggaactcac
4860ctggccttgg cttcccctga cctggacctc atctggcctg ggcttcacct
ggcctgggcc 4920tcacctgacc tggacctcat ctggcctgga cctcacctgg
cctggacttc acctggcctg 4980ggcttcacct gacctggacc tcacctggcc
tcgggcctca cctgcacctg ctccaggtct 5040tgctggagcc tgagtagcac
tgagggtgca gaagctcatc cagggttggg gaatgactct 5100agaagtctcc
cacatctgac ctttctgggt ggaggcagct ggtggccctg ggaatataaa
5160aatctccaga atgatgactc tgtgatttgt gggcaactta tgaacccgaa
aggacatggc 5220catggggtgg gtagggacat agggacagat gccagcctga
ggtggagcct caggacacag 5280gtgggcacgg acactatcca cataagcgag
ggatagaccc gagtgtcccc acagcagacc 5340tgagagcgct gggcccacag
cctcccctca gagccctgct gcctcctccg gtcagccctg 5400gacatcccag
gtttccccag gcctggcggt aggtttagaa tgaggtctgt gtcactgtgg
5460tatcaccata ttttgactgg tcattataac cacagtgtca cagagtccat
caaaaaccca 5520tgcctggaag cttcccgcca cagccctccc catggggccc
tgctgcctcc tcaggtcagc 5580cccggacatc ccgggtttcc ccaggctggg
cggtaggttt ggggtgaggt ctgtgtcact 5640gtggtatcac catggttcgg
ggagtcatta taaccacagt gtcacagagt ccatcaaaaa 5700cccatccctg
ggagcctccc gccacagccc tccctgcagg ggaccggtac gtgccatgtt
5760aggattttga tcgaggagac agcaccatgg gtatggtggc taccacagca
gtgcagcctg 5820tgacccaaac ccgcagggca gcaggcacga tggacaggcc
cgtgactgac cacgctgggc 5880tccagcctgc cagccctgga gatcatgaaa
cagatggcca aggtcaccct acaggtcatc 5940cagatctggc tccgaggggt
ctgcatcgct gctgccctcc caacgccagt ccaaatggga 6000cagggacggc
ctcacagcac catctgctgc catcaggcca gcgatcccag aagcccctcc
6060ctcaaggctg ggcacatgtg tggacactga gagccctcat atctgagtag
gggcaccagg 6120agggaggggc tggccctgtg cactgtccct gcccctgtgg
tccctggcct gcctggccct 6180gacacctgag cctctcctgg gtcatttcca
agacagaaga cattcctggg gacagccgga 6240gctgggcgtc gctcatcctg
cccggccgtc ctgagtcctg ctcatttcca gacctcaccg 6300gggaagccaa
cagaggactc gcctcccaca ttcagagaca aagaaccttc cagaaatccc
6360tgcctctctc cccagtggac accctcttcc aggacagtcc tcagtggcat
cacagcggcc 6420tgagatcccc aggacgcagc accgctgtca ataggggccc
caaatgcctg gaccagggcc 6480tgcgtgggaa aggcctctgg ccacactcgg
gctttttgtg aagggccctc ctgctgtgtg 6540accacagtca ctaccatagt
gatgaaccca gtggcaaaaa ctggctggaa acccaggggc 6600tgtgtgcacg
cctcagcttg gagctctcca ggagcacaag agccgggccc aaggatttgt
6660gcccagaccc tcagcctcta gggacacctg ggtcatctca gcctgggctg
gtgccctgca 6720caccatcttc ctccaaatag gggcttcaga gggctctgag
gtgacctcac tcatgaccac 6780aggtgacctg gcccttccct gccagctata
ccagaccctg tcttgacaga tgccccgatt 6840ccaacagcca attcctggga
ccctgaatag ctgtagacac cagcctcatt ccagtacctc 6900ctgccaattg
cctggattcc catcctggct ggaatcaaga aggcagcatc cgccaggctc
6960ccaacaggca ggactcccgc acaccctcct ctgagaggcc gctgtgttcc
gcagggccag 7020gccctggaca gttcccctca cctgccacta gagaaacacc
tgccattgtc gtccccacct 7080ggaaaagacc actcgtggag cccccagccc
caggtacagc tgtagagaca gtcctcgagg 7140cccctaagaa ggagccatgc
ccagttctgc cgggaccctc ggccaggccg acaggagtgg 7200acgctggagc
tgggcccaca ctgggccaca taggagctca ccagtgaggg caggagagca
7260catgccgggg agcacccagc ctcctgctga ccagaggccc gtcccagagc
ccaggaggct 7320gcagaggcct ctccagggag acactgtgca tgtctggtac
ctaagcagcc ccccacgtcc 7380ccagtcctgg gggcccctgg ctcagctgtc
tgggccctcc ctgctccctg ggaagctcct 7440cctgacagcc ccgcctccag
ttccaggtgt ggttattgtc aggcgatgtc agactgtggt 7500ggacatagtg
gccaccatta ccacagtggt gccgcccata gcagcaacca ggccaagtag
7560acaggcccct gctgcgcagc cccaggcatc cacttcacct gcttctcctg
gggctctcaa 7620ggctgctgtc tgtcctctgg ccctctgtgg ggagggttcc
ctcagtggga ggtctgtgct 7680ccagggcagg gatgattgag atagaaatca
aaggctggca gggaaaggca gcttcccgcc 7740ctgagaggtg caggcagcac
cacggagcca cggagtcaca gagccacgga gcccccattg 7800tgggcatttg
agagtgctgt gcccccggca ggcccagccc tgatggggaa gcctgtccca
7860tcccacagcc cgggtcccac gggcagcggg cacagaagct gccaggttgt
cctctatgat 7920cctcatccct ccagcagcat cccctccaca gtggggaaac
tgaggcttgg agcaccaccc 7980ggccccctgg aaatgaggct gtgagcccag
acagtgggcc cagagcactg tgagtacccc 8040ggcagtacct ggctgcaggg
atcagccaga gatgccaaac cctgagtgac cagcctacag 8100gaggatccgg
ccccacccag gccactcgat taatgctcaa ccccctgccc tggagacctc
8160ttccagtacc accagcagct cagcttctca gggcctcatc cctgcaagga
aggtcaaggg 8220ctgggcctgc cagaaacaca gcaccctccc tagccctggc
taagacaggg tgggcagacg 8280gctgtggacg ggacatattg ctggggcatt
tctcactgtc acttctgggt ggtagctctg 8340acaaaaacgc agaccctgcc
aaaatcccca ctgcctcccg ctaggggctg gcctggaatc 8400ctgctgtcct
aggaggctgc tgacctccag gatggctccg tccccagttc cagggcgaga
8460gcagatccca ggcaggctgt aggctgggag gccacccctg cccttgccgg
ggttgaatgc 8520aggtgcccaa ggcaggaaat ggcatgagca cagggatgac
cgggacatgc cccaccagag 8580tgcgcccctt cctgctctgc accctgcacc
ccccaggcca gcccacgacg tccaacaact 8640gggcctgggt ggcagcccca
cccagacagg acagacccag caccctgagg aggtcctgcc 8700agggggagct
aagagccatg aaggagcaag atatggggcc cccgatacag gcacagatgt
8760cagctccatc caggaccacc cagcccacac cctgagagga acgtctgtct
ccagcctctg 8820caggtcggga ggcagctgac ccctgacttg gacccctatt
ccagacacca gacagaggcg 8880caggcccccc agaaccaggg ttgagggacg
ccccgtcaaa gccagacaaa accaaggggt 8940gttgagccca gcaagggaag
gcccccaaac agaccaggag gtttctgaag gtgtctgtgt 9000cacagtgggg
catagccaca gctggtacca cagtgacact cacccagcca gaaaccccat
9060tccaagtcag cggaagcaga gagagcaggg aggacacgtt taggatctga
gactgcacct 9120gacacccagg ccagcagacg tctcccctcc agggcacccc
accctgtcct gcatttctgc 9180aagatcaggg gcggcctgag ggggggtcta
gggtgaggag atgggtcccc tgtacaccaa 9240ggaggagtta ggcaggtccc gagcactc
926839441DNAHomo sapiensmisc_feature(1)..(9441)HD 1.14-6.19
3tccccattga ggctgacctg cccagagagt cctgggccca ccccacacac cggggcggaa
60tgtgtgcagg cctcggtctc tgtgggtgtt ccgctagctg gggctcacag tgctcacccc
120acacctaaaa tgagccacag cctccggagc ccccgcagga gaccccgccc
acaagcccag 180cccccaccca ggaggcccca gagctcaggg cgccccgtcg
gattccgaac agccccgagt 240cacagcgggt ataaccggaa ccaccactgt
cagaatagct acgtcaaaaa ctgtccagtg 300gccactgccg gaggccccgc
cagagagggc agcagccact ctgatcccat gtcctgccgg 360ctcccatgac
ccccagcacg cggagcccca cagtgtcccc actggatggg aggacaagag
420ctggggattc cggcgggtcg gggcaggggc ttgatcgcat ccttctgccg
tggctccagt 480gcccctggct ggagttgacc cttctgacaa gtgtcctcag
agagacaggc atcaccggcg 540cctcccaaca tcaaccccag gcagcacagg
cacaaacccc acatccagag ccaactccag 600gagcagagac accccaatac
cctgggggac cccgaccctg atgacttccc actggaattc 660gccgtagagt
ccaccaggac caaagaccct gcctctgcct ctgtccctca ctcaggacct
720gctgccgggc gaggccttgg gagcagactt gggcttaggg gacaccagtg
tgaccccgac 780cttgaccagg acgcagacct ttccttcctt tcctggggca
gcacagactt tggggtctgg 840gccaggagga acttctggca ggtcgccaag
cacagaggcc acaggctgag gtggccctgg 900aaagacctcc aggaggtggc
cactcccctt cctcccagct ggaccccatg tcctccccaa 960gataagggtg
ccatccaagg caggtgctcc ttggagcccc attcagactc ctccctggac
1020cccactgggc ctcagtccca gctctgggga tgaagccacc acaagcacac
caggcagccc 1080aggcccagcc accctgcagt gcccaagcac acactctgga
gcagagcagg gtgcctctgg 1140gaggggctga gctccccacc ccacccccac
ctgcacaccc cacccacccc tgcccagcgg 1200ctctgcagga gggtcagagc
cccacatggg gtatggactt agggtctcac tcacgtggct 1260cccatcatga
gtgaaggggc ctcaagccca ggttcccaca gcagcgcctg tcgcaagtgg
1320aggcagaggc ccgagggcca ccctgacctg gtccctgagg ttcctgcagc
ccaggctgcc 1380ctgctgtccc tgggaggcct gggctccacc agaccacagg
tccagggcac cgggtgcagg 1440agccacccac acacagctca caggaagaag
ataagctcca gacccccagg gccagaacct 1500gccttcctgc tactgcttcc
tgccccagac ctgggcgccc tcccccgtcc acttacacac 1560aggccaggaa
gctgttccca cacagaacaa ccccaaacca ggaccgcctg gcactcaggt
1620ggctgccatt tccttctcca tttgctccca gcgcctctgt cctccctggt
tcctccttcg 1680ggggaacagc ctgtgcagcc agtccctgca gcccacaccc
tggggagacc caaccctgcc 1740tggggccctt ccaaccctgc tgctcttact
gcccacccag aaaactctgg ggtcctgtcc 1800ctgcagtccc taccctggtc
tccacccaga cccctgtgta tcactccaga cacccctccc 1860aggcaaaccc
tgcacctgca ggccctgtcc tcttctgtcg ctagagcctc agtttctccc
1920ccctgtgccc acaccctacc tcctcctgcc cacaactcta actcttcttc
tcctggagcc 1980cctgagccat ggcattgacc ctgccctccc accacccaca
gcccatgccc tcaccttcct 2040cctggccact ccgaccccgc cccctctcag
gccaagccct ggtatttcca ggacaaaggc 2100tcacccaagt ctttcccagg
caggcctggg ctcttgccct cacttcccgg ttacacggga 2160gcctcctgtg
cacagaagca gggagctcag cccttccaca ggcagaaggc actgaaagaa
2220atcggcctcc agcaccttga cacacgtccg cccgtgtctc tcactgcccg
cacctgcagg 2280gaggctccgc actccctcta aagacaaggg atccaggcag
cagcatcacg ggagaatgca 2340gggctcccag acatcccagt cctctcacag
gcctctcctg ggaagagacc tgcagccacc 2400accaaacagc cacagaggct
gctggatagt aactgagtca atgaccgacc tggagggcag 2460gggagcagtg
agccggagcc cataccatag ggacagagac cagccgctga catcccgagc
2520tcctcaatgg tggccccata acacacctag gaaacataac acacccacag
ccccacctgg 2580aacagggcag agactgctga gcccccagca ccagccccaa
gaaacaccag gcaacagtat 2640cagagggggc tcccgagaaa gagaggaggg
gagatctcct tcaccatcaa atgcttccct 2700tgaccaaaaa cagggtccac
gcaactcccc caggacaaag gaggagcccc ctatacagca 2760ctgggctcag
agtcctctct gagacaccct gagtttcaga caacaacccg ctggaatgca
2820cagtctcagc aggagaacag accaaagcca gcaaaaggga cctcggtgac
accagtaggg 2880acaggaggat tttgtggggg ctcgtgtcac tgtgaggaca
ttgtagtcat ggtagctgcc 2940actcccacag tgacacagac ccattcccaa
agccctactg caaacacacc cactcctggg 3000gctgaggggc tgggggagcg
tctgggaagt agggtccagg ggtgtctatc aatgtccaaa 3060atgcaccaga
ctccccgcca aacaccaccc caccagccag cgagcagggt aaacagaaaa
3120tgagaggctc tgggaagctt gcacaggccc caaggaaaga gctttggcgg
gtgtgcaaga 3180ggggatgcag gcagagcctg agcagggcct tttgctgttt
ctgctttcct gtgcagagag 3240ttccataaac tggtgttcaa gatcagtggc
tgggaatgag cccaggaggg cagtctgtgg 3300gaagagcaca gggaaggagg
agcagccgct atcctacact gtcatctttc aaaagtttgc 3360cttgtgacca
cactattgca tcatgggatg cttaagagct gatgtagaca cagctaaaga
3420gagaatcagt gagatgaatt tgcagcatag atctgaataa actctccaga
atgtggagca 3480gtacagaagc aaacacacag aaagtgcctg atgcaaggac
aaagttcagt gggcaccttc 3540aggcattgct gctgggcaca gacactctga
aaagccttgg caggatctcc ctgcgacaaa 3600gcagaaccct caggcaatgc
cagccccaga gccctccctg agagcgtcat ggggaaagat 3660gtgcagaaca
gctgattatc atagactcaa actgagaaca gagcaaacgt ccatctgaag
3720aacagtcaaa taagcaatgg taggttcatg caatgcaaac ccagacagcc
aggggacaac 3780agtagagggc tacaggcggc tttgcggttg agttcatgac
aatgctgagt aattggagta 3840acagaggaaa gcccaaaaaa tacttttaat
gtgatttctt ctaaataaaa tttacaccag 3900gcaaaatgaa ctgtcttctt
aagggataaa ctttcccctg gaaaaactac aaggaaaatt 3960aagaaaacga
tgatcacata aacacagttg tggttacttc tactggggaa ggaagagggt
4020atgagctgag acacacagag tcggcaagtc tccaagcaag cacagaacga
atacattaca 4080gtaccttgaa tacagcagtt aaacttctaa atcgcaagaa
caggaaaatg cacacagctg 4140tgtttagaaa attctcagtc cagcactatt
cataatagca aagacattaa cccaggttgg 4200ataaataaat gatgacacag
gcaattgcac aatgatacag acatacattt agtacatgag 4260acatcgatga
tgtatcccca aagaaatgac tttaaagaga aaaggcctga tgtgtggtgg
4320cactcacctc cctgggatcc ccggacaggt tgcaggcaca ctgtgtggca
gggcaggctg 4380gtacatgctg gcagctcctg gggcctgatg tggagcaagc
gcagggctgt atacccccaa 4440ggatggcaca gtcagtgaat tccagagaga
agcagctcag ccacactgcc caggcagagc 4500ccgagaggga cgcccacgta
cagggaggca gagcccagct cctccacagc caccaccacc 4560tgtgcacggg
ccaccacctt gcaggcacag agtgggtgct gagaggaggg gcagggacac
4620caggcagggt gagcacccag agaaaactgc agaagcctca cacatccacc
tcagcctccc 4680ctgacctgga cctcacctgg tctggacctc acctggcctg
ggcctcacct gacctggacc 4740tcacctggcc tgggcttcac ctgacctgga
cctcacctgg cctccggcct cacctgcacc 4800tgctccaggt cttgctggaa
cctgagtagc actgaggctg cagaagctca tccagggttg 4860gggaatgact
ctggaactct cccacatctg acctttctgg gtggaggcat ctggtggccc
4920tgggaatata aaaagcccca gaatggtgcc tgcgtgattt gggggcaatt
tatgaacccg 4980aaaggacatg gccatggggt gggtagggac atagggacag
atgccagcct gaggtggagc 5040ctcaggacac agttggacgc ggacactatc
cacataagcg agggacagac ccgagtgttc 5100ctgcagtaga cctgagagcg
ctgggcccac agcctcccct cggtgccctg ctgcctcctc 5160aggtcagccc
tggacatccc gggtttcccc aggccagatg gtaggtttga agtgaggtct
5220gtgtcactgt ggtatcatga tcacgtttgg gggagtcatc gttataccca
cagcatcaca 5280cggtccatca gaaacccatg ccacagccct ccccgcaggg
gaccgccgcg tgccatgtta 5340cgattttgat cgaggacaca gcgccatggg
tatggtggct accacagcag tgcagcccat 5400gacccaaaca cacagggcag
caggcacaat ggacaggcct gtgagtgacc atgctgggct 5460ccagcccgcc
agccccggag accatgaaac agatggccaa ggtcacccca cagttcagcc
5520agacatggct ccgtggggtc tgcatcgctg ctgccctcta acaccagccc
agatggggac 5580aaggccaacc ccacattacc atctcctgct gtccacccag
tggtcccaga agcccctccc 5640tcatggctga gccacatgtg tgaaccctga
gagcacccca tgtcagagta ggggcagcag 5700aagggcgggg ctggccctgt
gcactgtccc tgcacccatg gtccctcgcc tgcctggccc 5760tgacacctga
gcctcttctg agtcatttct aagatagaag acattcccgg ggacagccgg
5820agctgggcgt cgctcatccc gcccggccgt cctgagtcct gcttgtttcc
agacctcacc 5880agggaagcca acagaggact cacctcacac agtcagagac
aaagaacctt ccagaaatcc 5940ctgtctcact ccccagtggg caccttcttc
caggacattc ctcggtcgca tcacagcagg 6000cacccacatc tggatcagga
cggcccccag aacacaagat ggcccatggg gacagcccca 6060caacccaggc
cttcccagac ccctaaaagg cgtcccaccc cctgcacctg ccccagggct
6120aaaaatccag gaggcttgac tcccgcatac cctccagcca gacatcacct
cagccccctc 6180ctggagggga caggagcccg ggagggtgag tcagacccac
ctgccctcga tggcaggcgg 6240ggaagattca gaaaggcctg agatccccag
gacgcagcac cactgtcaat gggggcccca 6300gacgcctgga ccagggcctg
cgtgggaaag gccgctgggc acactcaggg gctttttgtg 6360aaggcccctc
ctactgtgtg accacggtca ctaccacagt gatgaaacta gcagcaaaaa
6420ctggccggac acccagggac catgcacact tctcagcttg gagctctcca
ggaccagaag 6480agtcaggtct gagggtttgt agccagaccc tcggcctcta
gggacaccct ggccatcaca 6540gcggatgggc tggtgcccca catgccatct
gctccaaaca ggggcttcag agggctctga 6600ggtgacttca ctcatgacca
caggtgccct ggccccttcc ccgccagcta caccgaaccc 6660tgtcccaaca
gctgccccag ttccaacagc caattcctgg ggcccagaat tgctgtagac
6720accagcctcg ttccagcacc tcctgccaat tgcctggatt cacatcctgg
ctggaatcaa 6780gagggcagca tccgccaggc tcccaacagg caggactccc
gcacaccctc ctctgagagg 6840ccgctgtgtt ccgcagggcc aggccctgga
cagttcccct cacctgccac tagagaaaca 6900cctgccattg tcgtccccac
ctggaaaaga ccactcgtgg agcccccagc cccaggtaca 6960gctgtagaga
gactccccga gggatctaag aaggagccat gcgcagttct gccgggaccc
7020tcggccaggc cgacaggagt ggacactgga gctgggccca cactgggcca
cataggagct 7080caccagtgag ggcaggagag cacatgccgg ggagcaccca
gcctcctgct gaccagaggc 7140ccgtcccaga gcccaggagg ctgcagaggc
ctctccaggg ggacactgtg catgtctggt 7200ccctgagcag ccccccacgt
ccccagtcct gggggcccct ggcacagctg tctggaccct 7260ccctgttccc
tgggaagctc ctcctgacag ccccgcctcc agttccaggt gtggttattg
7320tcagggggtg tcagactgtg gtggacacag ccatggttac cacagtggtg
ctgcccatag 7380cagcaaccag gccaagtaga caggcccctg ctgtgcagcc
ccaggcctcc acttcacctg 7440cttctcctgg ggctctcaag gtcactgttg
tctgtactct gccctctgtg gggagggttc 7500cctcagtggg aggtctgttc
tcaacatccc agggcctcat gtctgcacgg aaggccaatg 7560gatgggcaac
ctcacatgcc gcggctaaga tagggtgggc agcctggcgg gggacagtac
7620atactgctgg ggtgtctgtc actgtgccta gtggggcact ggctcccaaa
caacgcagtc 7680ctcgccaaaa tccccacagc ctcccctgct aggggctggc
ctgatctcct gcagtcctag 7740gaggctgctg acctccagaa tgtctccgtc
cccagttcca gggcgagagc agatcccagg 7800ccggctgcag actgggaggc
caccccctcc ttcccagggt tcactggagg tgaccaaggt 7860aggaaatggc
cttaacacag ggatgactgc gccatccccc aacagagtca gccccctcct
7920gctctgtacc ccgcaccccc caggccagtc cacgaaaacc agggccccac
atcagagtca 7980ctgcctggcc cggccctggg gcggacccct cagcccccac
cctgtctaga ggacttgggg 8040ggacaggaca caggccctct ccttatggtt
cccccacctg cctccggccg ggacccttgg 8100ggtgtggaca gaaaggacac
ctgcctaatt ggcccccagg aacccagaac ttctctccag 8160ggaccccagc
ccgagcaccc ccttacccag gacccagccc tgcccctcct cccctctgct
8220ctcctctcat caccccatgg gaatccggta tccccaggaa gccatcagga
agggctgaag 8280gaggaagcgg ggccgtgcac caccgggcag gaggctccgt
cttcgtgaac ccagggaagt 8340gccagcctcc tagagggtat ggtccaccct
gcctggggct cccaccgtgg caggctgcgg 8400ggaaggacca gggacggtgt
gggggagggc tcagggccct gcgggtgctc ctccatcttc 8460ggtgagcctc
ccccttcacc caccgtcccg cccacctcct ctccaccctg gctgcacgtc
8520ttccacacca tcctgagtcc tacctacacc agagccagca aagccagtgc
agacaaaggc 8580tggggtgcag gggggctgcc agggcagctt cggggaggga
aggatggagg gaggggaggt 8640cagtgaagag gcccccttcc cctgggtcca
ggatcctcct ctgggacccc cggatcccat 8700cccctcctgg ctctgggagg
agaagcagga tgggagaatc tgtgcgggac cctctcacag 8760tggaatatcc
ccacagcggc tcaggccaga cccaaaagcc cctcagtgag ccctccactg
8820cagtcctggg cctgggtagc agcccctccc acagaggaca gacccagcac
cccgaagaag 8880tcctgccagg gggagctcag agccatgaaa gagcaggata
tggggtcccc gatacaggca 8940cagacctcag ctccatccag gcccaccggg
acccaccatg ggaggaacac ctgtctccgg 9000gttgtgaggt agctggcctc
tgtctcggac cccactccag acaccagaca gaggggcagg 9060ccccccaaaa
ccagggttga gggatgatcc gtcaaggcag acaagaccaa ggggcactga
9120ccccagcaag ggaaggctcc caaacagacg aggaggtttc tgaagctgtc
tgtatcacag 9180tggggcatag ccatggctgg taccacagtg acactcgcca
ggccagaaac cccgtcccaa 9240gtcagcggaa gcagagagag cagggaggac
acgtttagga tctgaggccg cacctgacac 9300ccagggcagc agacgtctcc
cctccagggc accctccacc gtcctgcgtt tcttcaagaa 9360taggggcggc
ctgagggggt ccagggccag gcgataggtc ccctctaccc caaggaggag
9420ccaggcagga cccgagcacc g 9441411592DNAHomo
sapiensmisc_feature(1)..(11592)HD 1.20-6.25, 1.26 4tccccattga
ggctgacctg cccagacggg cctgggccca ccccacacac cggggcggaa 60tgtgtgcagg
ccccagtctc tgtgggtgtt ccgctagctg gggcccccag tgctcacccc
120acacctaaag cgagccccag cctccagagc cccctaagca ttccccgccc
agcagcccag 180cccctgcccc cacccaggag gccccagagc tcagggcgcc
tggtcggatt ctgaacagcc 240ccgagtcaca gtgggtatca ctggcacgac
caccgtgaga aaaactgtgt ccaaaactga 300ctcctggcag cagtcggagg
ccccgccaga gaggggagca gccggcctga acccatgtcc 360tgccggttcc
catgaccccc agcacccaga gccccacggt gtccccgttg gataatgagg
420acaagggctg ggggctccgg tggtttgcgg cagggacttg atcacatcct
tctgctgtgg 480ccccattgcc tctggctgga gttgaccctt ctgacaagtg
tcctcagaaa gacagggatc 540accggcacct cccaatatca accccaggca
gcacagacac aaaccccaca tccagagcca 600actccaggag cagagacacc
ccaacactct gggggacccc aaccgtgata actccccact 660ggaatccgcc
ccagagtcta ccaggaccaa aggccctgcc ctgtctctgt ccctcactca
720gggcctcctg cagggcgagc gcttgggagc agactcggtc ttaggggaca
ccactgtggg 780ccccaacttt gatgaggcca ctgacccttc cttcctttcc
tggggcagca cagactttgg 840ggtctgggca gggaagaact actggctggt
ggccaatcac agagccccca ggccgaggtg 900gccccaagaa ggccctcagg
aggtggccac tccacttcct cccagctgga ccccaggtcc 960tccccaagat
aggggtgcca tccaaggcag gtcctccatg gagccccctt cagactcctc
1020ccgggacccc actggacctc agtccctgct ctgggaatgc agccaccaca
agcacaccag 1080gaagcccagg cccagccacc ctgcagtggg caagcccaca
ctctggagca gagcagggtg 1140cgtctgggag gggctaacct ccccaccccc
caccccccat ctgcacacag ccacctacca 1200ctgcccagac cctctgcagg
agggccaagc caccatgggg tatggactta gggtctcact 1260cacgtgcctc
ccctcctggg agaaggggcc tcatgcccag atccctgcag cactagacac
1320agctggaggc agtggcccca gggccaccct gacctggcat ctaaggctgc
tccagcccag 1380acagcactgc cgttcctggg aagcctgggc tccaccagac
cacaggtcca gggcacagcc 1440cacaggagcc acccacacac agctcacagg
aagaagataa gctccagacc ccagggcggg 1500acctgccttc ctgccaccac
ttacacacag gccagggagc tgttcccaca cagatcaacc 1560ccaaaccggg
actgcctggc actagggtca ctgccatttc cctctccatt ccctcccagt
1620gcctctgtgc tccctccttc tggggaacac cctgtgcagc ccctccctgc
agcccacacg 1680ctggggagac cccaccctgc ctcgggcctt ttctacctgc
tgcacttgcc gcccacccaa 1740acaaccctgg gtacgtgacc ctgcagtcct
caccctgatc tgcaaccaga cccctgtccc 1800tccctctaaa cacccctccc
aggccaactc tgcacctgca ggccctccgc tcttctgcca 1860caagagcctc
aggttttcct acctgtgccc accccctaac ccctcctgcc cacaacttga
1920gttcttcctc tcctggagcc cttgagccat ggcactgacc ctacactccc
acccacacac 1980tgcccatgcc atcaccttcc tcctggacac tctgaccccg
ctcccctccc tctcagaccc 2040ggccctggta tttccaggac aaaggctcac
ccaagtcttc cccatgcagg cccttgccct 2100cactgcctgg ttacacggga
gcctcctgtg cgcagaagca gggagctcag ctcttccaca 2160ggcagaaggc
actgaaagaa atcagcctcc agtgccttga cacacgtccg cctgtgtctc
2220tcactgcctg cacctgcagg gaggctccgc actccctcta aagatgaggg
atccaggcag 2280caacatcacg ggagaatgca gggctcccag acagcccagc
cctctcgcag gcctctcctg 2340ggaagagacc tgcagccacc actgaacagc
cacggaggtc gctggatagt aaccgagtca 2400gtgaccgacc tggagggcag
gggagcagtg aaccggagcc cataccatag ggacagagac 2460cagccgctaa
catcccgagc ccctcactgg cggccccaga acaccccgtg gaaagagaac
2520agacccacag tcccacctgg aacagggcag acactgctga gcccccagca
ccagccccaa 2580gaaacactag gcaacagcat cagagggggc tcctgagaaa
gagaggaggg gaggtctcct 2640tcaccatcaa atgcttccct tgaccaaaaa
cagggtccac gcaactcccc caggacaaag 2700gaggagcccc ctgtacagca
ctgggctcag agtcctctct gagacaggct cagtttcaga 2760caacaacccg
ctggaatgca cagtctcagc aggagagcca ggccagagcc agcaagagga
2820gactcggtga caccagtctc ctgtagggac aggaggattt tgtgggggtt
cgtgtcactg 2880tgagcacatt gtggtggtca ctgccattcc cacagtgaca
caaccccatt cctaaagccc 2940tactgcaaac gcacccactc ctgggactga
ggggctgggg gagcgtctgg gaagtatggc 3000ctaggggtgt ccatcaatgc
ccaaaatgca ccagactctc cccaagacat caccccacca 3060gccagtgagc
agagtaaaca gaaaatgaga agcagctggg aagcttgcac aggccccaag
3120gaaagagctt tggcaggtgt gcaagagggg atgtgggcag agcctcagca
gggccttttg 3180ctgtttctgc tttcctgtgc agagagttcc ataaactggt
attcaagatc aatggctggg 3240agtgagccca ggaggacagt gtgggaagag
cacagggaag gaggagcagc cgctatccta 3300cactgtcatc ttttgaaagt
ttgccctgtg cccacaatgc tgcatcatgg gatgcttaac 3360agctgatgta
gacacagcta aagagagaat cagtgaaatg gatttgcagc acagatctga
3420ataaatcctc cagaatgtgg agcagcacag aagcaagcac acagaaagtg
cctgatgcca 3480aggcaaagtt cagtgggcac cttcaggcat tgctgctggg
cacagacact ctgaaaagca 3540ctggcaggaa ctgcctgtga caaagcagaa
ccctcaggca atgccagccc tagagccctt 3600cctgagaacc tcatgggcaa
agatgtgcag aacagctgtt tgtcatagcc ccaaactatg 3660gggctggaca
aagcaaacgt ccatctgaag gagaacagac aaataaacga tggcaggttc
3720atgaaatgca aactaggaca gccagaggac aacagtagag agctacaggc
ggctttgcgg 3780ttgagttcat gacaatgctg agtaattgga gtaacagagg
aaagcccaaa aaatactttt 3840aatgtgattt cttctaaata aaatttacac
ccggcaaaat gaactatctt cttaagggat 3900aaactttccc ctggaaaaac
tataaggaaa atcaagaaaa cgatgatcac ataaacacag 3960tggtggttac
ttctactggg gaaggaagag ggtatgagct gagacacaca gagtcggcaa
4020gtctcctaac aagaacagaa caaatacatt acagtacctt gaaaacagca
gttaaacttc 4080taaatcgcaa gaagaggaaa atgcacacac ctgtgtttag
aaaattctca gtccagcact 4140gttcataata gcaaagacat taacccaggt
tggataaata agcgatgaca caggcaattg 4200cacaatgata cagacataca
ttcagtatat gagacatcga tgatgtatcc ccaaagaaat 4260gactttaaag
agaaaaggcc tgatgtgtgg tggcaatcac ctccctgggc atccccggac
4320aggctgcagg ctcactgtgt ggcagggcag gcaggcacct gctggcagct
cctggggcct 4380gatgtggagc aggcacagag ctgtatatcc ccaaggaagg
tacagtcagt gcattccaga 4440gagaagcaac tcagccacac tccctggcca
gaacccaaga tgcacaccca tgcacaggga 4500ggcagagccc agcacctccg
cagccaccac cacctgcgca cgggccacca ccttgcaggc 4560acagagtggg
tgctgagagg aggggcaggg acaccaggca gggtgagcac ccagagaaaa
4620ctgcagaagc ctcacacatc cctcacctgg cctgggcttc acctgacctg
gacctcacct 4680ggcctcgggc ctcacctgca cctgctccag gtcttgctgg
agcctgagta gcactgaggc 4740tgtagggact catccagggt tggggaatga
ctctgcaact ctcccacatc tgacctttct 4800gggtggaggc acctggtggc
ccagggaata taaaaagccc cagaatgatg cctgtgtgat 4860ttgggggcaa
tttatgaacc cgaaaggaca tggccatggg gtgggtaggg acagtaggga
4920cagatgtcag cctgaggtga agcctcagga cacaggtggg catggacagt
gtccacctaa 4980gcgagggaca gacccgagtg tccctgcagt agacctgaga
gcgctgggcc cacagcctcc 5040cctcggggcc ctgctgcctc ctcaggtcag
ccctggacat cccgggtttc cccaggcctg 5100gcggtaggtt tgaagtgagg
tctgtgtcac tgtggtatca ctatcatagt agtggtcatt 5160actaccacag
tgtcacagag tccatcaaaa actcatgcct gggagcctcc caccacagcc
5220ctccctgcgg gggaccgctg catgccgtgt taggattttg atcgaggaca
cggcgccatg 5280ggtatggtgg ctaccacagc agtgcagccc atgacccaaa
cacacggggc agcagaaaca 5340atggacaggc ccacaagtga ccatgatggg
ctccagccca ccagccccag agaccatgaa 5400acagatggcc aaggtcaccc
tacaggtcat ccagatctgg ctccaagggg tctgcatcgc 5460tgctgccctc
ccaacgccaa accagatgga gacagggccg gccccatagc accatctgct
5520gccgtccacc cagcagtccc ggaagcccct ccctgaacgc tgggccacgt
gtgtgaaccc 5580tgcgagcccc ccatgtcaga gtaggggcag caggagggcg
gggctggccc tgtgcactgt 5640cactgcccct gtggtccctg gcctgcctgg
ccctgacacc tgagcctctc ctgggtcatt 5700tccaagacat tcccagggac
agccggagct gggagtcgct catcctgcct ggctgtcctg 5760agtcctgctc
atttccagac ctcaccaggg aagccaacag aggactcacc tcacacagtc
5820agagacaacg aaccttccag aaatccctgt ttctctcccc agtgagagaa
accctcttcc 5880agggtttctc ttctctccca ccctcttcca ggacagtcct
cagcagcatc acagcgggaa 5940cgcacatctg gatcaggacg gcccccagaa
cacgcgatgg cccatgggga cagcccagcc 6000cttcccagac ccctaaaagg
tatccccacc ttgcacctgc cccagggctc aaactccagg 6060aggcctgact
cctgcacacc ctcctgccag atatcacctc agccccctcc tggaggggac
6120aggagcccgg gagggtgagt cagacccacc tgccctcaat ggcaggcggg
gaagattcag 6180aaaggcctga gatccccagg acgcagcacc actgtcaatg
ggggccccag acgcctggac 6240cagggcctgt gtgggaaagg cctctggcca
cactcagggg ctttttgtga agggccctcc 6300tgctgtgtga ccacggtggt
cactcccaca gtgatgaaac cagcagcaaa aactgaccgg 6360actcgcaggg
tttatgcaca cttctcggct cggagctctc caggagcaca agagccaggc
6420ccgagggttt gtgcccagac cctcggcctc tagggacacc cgggccatct
tagccgatgg 6480gctgatgccc tgcacaccgt gtgctgccaa acaggggctt
cagagggctc tgaggtgact 6540tcactcatga ccacaggtgc cctggtccct
tcactgccag ctgcaccaga ccctgttccg 6600agagatgccc cagttccaaa
agccaattcc tggggccggg aattactgta gacaccagcc 6660tcattccagt
acctcctgcc aattgcctgg attcccatcc tggctggaat caagagggca
6720gcatccgcca ggctcccaac aggcaggact cccacacacc ctcctctgag
aggccgctgt 6780gttccgcagg gccaggccgc agacagttcc cctcacctgc
ccatgtagaa acacctgcca 6840ttgtcgtccc cacctggcaa agaccacttg
tggagccccc agccccaggt acagctgtag 6900agagagtcct cgaggcccct
aagaaggagc catgcccagt tctgccggga ccctcggcca 6960ggccgacagg
agtggacgct ggagctgggc ccacactggg ccacatagga gctcaccagt
7020gagggcagga gagcacatgc cggggagcac ccagcctcct gctgaccaga
gacccgtccc 7080agagcccagg aggctgcaga ggcctctcca gggggacaca
gtgcatgtct ggtccctgag 7140cagcccccag gctctctagc actgggggcc
cctggcacag ctgtctggac cctccctgtt 7200ccctgggaag ctcctcctga
cagccccgcc tccagttcca ggtgtggtta ttgtcagggg 7260gtgccaggcc
gtggtagaca tggccaccat taccacagtg gtgccgccca tagcagcaac
7320caggccaagt agacagaccc ctgccacgca gccccaggcc tccagctcac
ctgcttctcc 7380tggggctctc aaggctgctg tctgccctct ggccctctgt
ggggagggtt ccctcagtgg 7440gaggtctgtg ctccagggca gggatgactg
agatagaaat caaaggctgg cagggaaagg 7500cagcttcccg ccctgagagg
tgcaggcagc accacagagc catggagtca cagagccacg 7560gagcccccag
tgtgggcgtg tgagggtgct gggctcccgg caggcccagc cctgatgggg
7620aagcctgccc cgtcccacag cccaggtccc caggggcagc aggcacagaa
gctgccaagc 7680tgtgctctac gatcctcatc cctccagcag catccactcc
acagtgggga aactgagcct 7740tggagaacca cccagccccc tggaaacaag
gcggggagcc cagacagtgg gcccagagca 7800ctgtgtgtat cctggcacta
ggtgcaggga ccacccggag atccccatca ctgagtggcc 7860agcctgcaga
aggacccaac cccaaccagg ccgcttgatt aagctccatc cccctgtcct
7920gggaacctct tcccagcgcc accaacagct cggcttccca ggccctcatc
cctccaagga 7980aggccaaagg ctgggcctgc caggggcaca gtaccctccc
ttgccctggc taagacaggg 8040tgggcagacg gctgcagata ggacatattg
ctggggcatc ttgctctgtg actactgggt 8100actggctctc aacgcagacc
ctaccaaaat ccccactgcc tcccctgcta ggggctggcc 8160tggtctcctc
ctgctgtcct aggaggctgc tgacctccag gatggcttct gtccccagtt
8220ctagggccag agcagatccc aggcaggctg taggctggga ggccacccct
gtccttgccg 8280aggttcagtg caggcaccca ggacaggaaa tggcctgaac
acagggatga ctgtgccatg 8340ccctacctaa gtccgcccct ttctactctg
caacccccac tccccaggtc agcccatgac 8400gaccaacaac ccaacaccag
agtcactgcc tggccctgcc ctggggagga cccctcagcc 8460cccaccctgt
ctagaggagt tggggggaca ggacacaggc tctctcctta tggttccccc
8520acctggctcc tgccgggacc cttggggtgt ggacagaaag gacgcctgcc
taattggccc 8580ccaggaaccc agaacttctc tccagggacc ccagcccgag
caccccctta cccaggaccc 8640agccctgccc ctcctcccct ctgctctcct
ctcatcactc catgggaatc cagaatcccc 8700aggaagccat caggaagggc
tgaaggagga agcggggccg ctgcaccacc gggcaggagg 8760ctccgtcttc
gtgaacccag ggaagtgcca gcctcctaga gggtatggtc caccctgcct
8820ggggctccca ccgtggcagg ctgcggggaa ggaccaggga cggtgtgggg
gagggctcag 8880ggccctgcag gtgctccatc ttggatgagc ccatccctct
cacccaccga cccgcccacc 8940tcctctccac cctggccaca cgtcgtccac
accatcctga gtcccaccta caccagagcc 9000agcagagcca gtgcagacag
aggctggggt gcaggggggc cgccagggca gctttgggga 9060gggaggaatg
gaggaagggg aggtcagtga agaggccccc ctcccctggg tctaggatcc
9120acctttggga cccccggatc ccatcccctc caggctctgg gaggagaagc
aggatgggag 9180attctgtgca ggaccctctc acagtggaat acctccacag
cggctcaggc cagatacaaa 9240agcccctcag tgagccctcc actgcagtgc
agggcctggg ggcagcccct cccacagagg 9300acagacccag caccccgaag
aagtcctgcc agggggagct cagagccatg aaggagcaag 9360atatggggac
cccaatactg gcacagacct cagctccatc caggcccacc aggacccacc
9420atgggtggaa cacctgtctc cggcccctgc tggctgtgag gcagctggcc
tctgtctcgg 9480acccccattc cagacaccag acagagggac aggcccccca
gaaccagtgt tgagggacac 9540ccctgtccag ggcagccaag tccaagaggc
gcgctgagcc cagcaaggga aggcccccaa 9600acaaaccagg aggtttctga
agctgtctgt gtcacagtcg ggcatagcca cggctaccac 9660aatgacactg
ggcaggacag aaaccccatc ccaagtcagc cgaaggcaga gagagcaggc
9720aggacacatt taggatctga ggccacacct gacactcaag ccaacagatg
tctcccctcc 9780agggcgccct gccctgttca gtgttcctga gaaaacaggg
gcagcctgag gggatccagg 9840gccaggagat gggtcccctc taccccgagg
aggagccagg cgggaatccc agccccctcc 9900ccattgaggc catcctgccc
agaggggccc ggacccaccc cacacaccca ggcagaatgt 9960gtgcaggcct
caggctctgt gggtgccgct agctggggct gccagtcctc accccacacc
10020taaggtgagc cacagccgcc agagcctcca caggagaccc cacccagcag
cccagcccct 10080acccaggagg ccccagagct cagggcgcct gggtggattc
tgaacagccc cgagtcacgg 10140tgggtatcat gggagccact accactgtga
gaaaagctat gtccaaaact gtctcccggc 10200cactgctgga ggcccagcca
gagaagggac cagccgcccg aacatacgac cttcccagac 10260ctcatgaccc
ccagcacttg gagctccaca gtgtccccat tggatggtga ggatgggggc
10320cggggccatc tgcacctccc aacatcaccc ccaggcagca caggcacaaa
ccccaaatcc 10380agagccgaca ccaggaacac agacacccca ataccctggg
ggaccctggc cctggtgact 10440tcccactggg atccaccccc gtgtccacct
ggatcaaaga ccccaccgct gtctctgtcc 10500ctcactcagg gcctgctgag
gggcgggtgc tttggagcag actcaggttt aggggccacc 10560attgtggggc
ccaacctcga ccaggacaca gatttttctt tcctgccctg gggcaacaca
10620gactttgggg tctgtgcagg gaggaccttc tggaaagtca ccaagcacag
agccctgact 10680gaggtggtct caggaagacc cccaggaggg ggcttgtgcc
ccttcctctc atgtggaccc 10740catgcccccc aagatagggg catcatgcag
ggcaggtcct ccatgcagcc accactaggc 10800aactccctgg cgccggtccc
cactgcgcct ccatcccggc tctggggatg cagccaccat 10860ggccacacca
ggcagcccgg gtccagcaac cctgcagtgc ccaagccctt ggcaggattc
10920ccagaggctg gagcccaccc ctcctcatcc ccccacacct gcacacacac
acctaccccc 10980tgcccagtcc ccctccagga gggttggagc cgcccatagg
gtgggggctc caggtctcac 11040tcactcgctt cccttcctgg gcaaaggagc
ctcgtgcccc ggtcccccct gacggcgctg 11100ggcacaggtg tgggtactgg
gccccagggc tcctccagcc ccagctgccc tgctctccct 11160gggaggcctg
ggcaccacca gaccaccagt ccagggcaca gccccaggga gccgcccact
11220gccagctcac aggaagaaga taagcttcag accctcaggg ccgggagctg
ccttcctgcc 11280accccttcct gccccagacc tccatgccct cccccaacca
cttacacaca agccagggag 11340ctgtttccac acagttcaac cccaaaccag
gacggcctgg cactcgggtc actgccattt 11400ctgtctgcat tcgctcccag
cgcccctgtg ttccctccct cctccctcct tcctttcttc 11460ctgcattggg
ttcatgccgc agagtgccag gtgcaggtca gccctgagct tggggtcacc
11520tcctcactga aggcagcctc agggtgccca ggggcaggca gggtgggggt
gaggcttcca 11580gctccaaccg ct 115925689DNAMus
musculusmisc_feature(1)..(689)Mouse Ei (an intronic enhancer)
5tctagagagg tctggtggag cctgcaaaag tccagctttc aaaggaacac agaagtatgt
60gtatggaata ttagaagatg ttgcttttac tcttaagttg gttcctagga aaaatagtta
120aatactgtga ctttaaaatg tgagagggtt ttcaagtact cattttttta
aatgtccaaa 180attcttgtca atcagtttga ggtcttgttt gtgtagaact
gatattactt aaagtttaac 240cgaggaatgg gagtgaggct ctctcataac
ctattcagaa ctgactttta acaataataa 300attaagtttc aaatattttt
aaatgaattg agcaatgttg agttggagtc aagatggccg 360atcagaacca
gaacacctgc agcagctggc aggaagcagg tcatgtggca aggctatttg
420gggaagggaa aataaaacca ctaggtaaac ttgtagctgt ggtttgaaga
agtggttttg 480aaacactctg tccagcccca ccaaaccgaa agtccaggct
gagcaaaaca ccacctgggt 540aatttgcatt tctaaaataa gttgaggatt
cagccgaaac tggagaggtc ctcttttaac 600ttattgagtt caacctttta
attttagctt gagtagttct agtttcccca aacttaagtt 660tatcgacttc
taaaatgtat ttagaattc 68963518DNAMus
musculusmisc_feature(1)..(3518)Mouse Switch Region 6acttatttca
gttgaacatg ctggttggtg gttgagagga cactcagtca gtcagtgacg 60tgaagggctt
ctaagccagt ccacatgctc tgtgtgaact ccctctggcc ctgcttattg
120ttgaatgggc caaaggtctg agaccaggct gctgctgggt aggcctggac
tttgggtctc 180ccacccagac ctgggaatgt atggttgtgg cttctgccac
ccatccacct ggctgctcat 240ggaccagcca gcctcggtgg ctttgaagga
acaattccac acaaagactc tggacctctc 300cgaaaccagg caccgcaaat
ggtaagccag aggcagccac agctgtggct gctgctctta 360aagcttgtaa
actgtttctg cttaagaggg actgagtctt cagtcattgc tttaggggga
420gaaagagaca tttgtgtgtc ttttgagtac cgttgtctgg gtcactcaca
tttaactttc 480cttgaaaaac tagtaaaaga aaaatgttgc ctgttaacca
ataatcatag agctcatggt 540actttgagga aatcttagaa agcgtgtata
caattgtctg gaattatttc agttaagtgt 600attagttgag gtactgatgc
tgtctctact tcagttatac atgtgggttt gaattttgaa 660tctattctgg
ctcttcttaa gcagaaaatt tagataaaat ggatacctca gtggttttta
720atggtgggtt taatatagaa ggaatttaaa ttggaagcta atttagaatc
agtaaggagg 780gacccaggct aagaaggcaa tcctgggatt ctggaagaaa
agatgttttt agtttttata 840gaaaacacta ctacattctt gatctacaac
tcaatgtggt ttaatgaatt tgaagttgcc 900agtaaatgta cttcctggtt
gttaaagaat ggtatcaaag gacagtgctt agatccgagg 960tgagtgtgag
aggacagggg ctggggtatg gatacgcaga aggaaggcca cagctgtaca
1020gaattgagaa agaatagaga cctgcagttg aggccagcag gtcggctgga
ctaactctcc 1080agccacagta atgacccaga cagagaaagc cagactcata
aagcttgctg agcaaaatta 1140agggaacaag gttgagagcc ctagtaagcg
aggctctaaa aagcacagct gagctgagat 1200gggtgggctt ctctgagtgc
ttctaaaatg cgctaaactg aggtgattac tctgaggtaa 1260gcaaagctgg
gcttgagcca aaatgaagta gactgtaatg aactggaatg agctgggccg
1320ctaagctaaa ctaggctggc ttaaccgaga tgagccaaac tggaatgaac
ttcattaatc 1380taggttgaat agagctaaac tctactgcct acactggact
gttctgagct gagatgagct 1440ggggtgagct cagctatgct acgctgtgtt
ggggtgagct gatctgaaat gagatactct 1500ggagtagctg agatggggtg
agatggggtg agctgagctg ggctgagcta gactgagctg 1560agctagggtg
agctgagctg ggtgagctga gctaagctgg ggtgagctga gctgagcttg
1620gctgagctag ggtgagctgg gctgagctgg ggtgagctga gctgagctgg
ggtaagctgg 1680gatgagctgg ggtgagctga gctgagctgg agtgagctga
gctgggctga gctggggtga 1740gctgggctga gctgggctga gctgggctga
gctggggtga gctgagctgg ggtgagctga 1800gctgagctgg ggtgagctga
gctgagctgg ggtgagctgg ggtgagctga gctggggtga 1860gctgagctga
gctggggtga gctgagctgg ggtgagctga gctgagctgg ggtgagctga
1920gctgagctga gctgagctga gctggggtga gctgagctga gctgagctgg
ggtgagctgg 1980ggtgagctga gctgagctgg agtgagctga gctgggctga
gctggggtga gctgggctga 2040gctggggtga gctgagctga gctgagctga
gctggggtga gctgagctga gctggggtga 2100gctgagctgg ggtgagctgg
gctgagctga gctgagctga gctgagctga gctgagctga 2160gctgagctga
gctgagctga gctgagctga gctgagctga gctgagctgg ggtgagctga
2220gctgagctgg gctgagctgg ggtgagctgg gctgagctgg gctgagctgg
gctgagctgg 2280ggtgagctga gctggggtga gctgagctga gctgggctga
gctgagctga gctggggtga 2340gctgagctga gctggggtga gctgagctga
gctgagctgg ggtgagctga gctgagctgg 2400gctgagcagg gctgagctgg
ggtgagctga gctgagctgg ggtgagctgg gctgagctgg 2460gctgagctga
gctgagctgg gctgagctgg gctgagctgg gctgagctgg gctgagctgg
2520gctgagctgg ggtgagctga gctggggtga gctggggtga gctgagctgg
ggtgagctga 2580gctggggtga gctgagctga gctggggtga gctgagctgg
ggtgagctga gctgagctgg 2640ggtgagctga gctgagctgg ggtgagctga
gctagggtga actgggctgg gtgagctgga 2700gtgagctgag ctgaggtgaa
ctggggtgag ccgggatgtt ttgagttgag ctggggtaag 2760atgagctgaa
ctggggtaaa ctgggatgag ctgtggtgag cggagctgga ttgaactgag
2820ctgtgtgagc tgagctgggg tcagctgagc aagagtgagt agagctggct
ggccagaacc 2880agaatcaatt aggctaagtg agccagattg tgctgggatc
agctgtactc agatgagctg 2940ggatgaggta ggctgggatg agctgggcta
gctgacatgg attatgtgag gctgagctag 3000catgggctgg cctagctgat
gagctaagct tgaatgagcg gggctgagct ggactcagat 3060gtgctagact
gagctgtact ggatgatctg gtgtagggtg atctggactc aactgggctg
3120gctgatggga tgcgccaggt tgaactaggc tcagataagt taggctgagt
agggcctggt 3180tgagatggtt cgggatgagc tgggaaaaga tggactcgga
ccatgaactg ggctgagctg 3240ggttgggaga ccatgaattg agctgaactg
agtgcagctg ggataaactg ggttgagcta 3300agaatagact acctgaattg
tgccaaactc ggctgggatc aattggaaat tatcaggatt 3360tagatgagcc
ggactaaact atgctgagct ggactggttg gatgtgttga actggcctgc
3420tgctgggctg gcatagctga gttgaactta aatgaggaag gctgagcaag
gctagcctgc 3480ttgcatagag ctgaacttta gcctagcctg agctggac
35187315DNAMus musculusmisc_feature(1)..(315)mouse IgM exon 1
7agagtcagtc cttcccaaat gtcttccccc tcgtctcctg cgagagcccc ctgtctgata
60agaatctggt ggccatgggc tgcctggccc gggacttcct gcccagcacc atttccttca
120cctggaacta ccagaacaac actgaagtca tccagggtat cagaaccttc
ccaacactga 180ggacaggggg caagtaccta gccacctcgc aggtgttgct
gtctcccaag agcatccttg 240aaggttcaga tgaatacctg gtatgcaaaa
tccactacgg aggcaaaaac aaagatctgc 300atgtgcccat tccag 31585PRTHomo
sapiens 8Val Gln Leu Glu Arg 1 5 95PRTUnknownMammal 9Val Pro Leu
Ala Arg 1 5 105PRTUnknownMammal 10Val Ser Leu Ala Leu 1
5 115PRTUnknownMammal 11Val Ser Leu Ala Arg 1 5 124PRTHomo sapiens
12Trp Glu Leu Leu 1 136PRTUnknownMammal 13Val Ser Trp Glu Pro Leu 1
5 145PRTHomo sapiens 14Tyr Gln Leu Leu Tyr 1 5 156PRTUnknownMammal
15Ser Tyr Gln Leu Pro Tyr 1 5 164PRTHomo sapiens 16Arg Ile Leu Tyr
1 175PRTHomo sapiens 17Trp Cys Met Leu Tyr 1 5 1810PRTUnknownMammal
18Arg Thr Leu Tyr Ser Trp Cys Met Pro Tyr 1 5 10 195PRTHomo sapiens
19Ser Ile Leu Trp Trp 1 5 209PRTUnknownMammal 20Ser Thr Leu Trp Trp
Ser Leu Pro Phe 1 5 2110PRTHomo sapiens 21Val Leu Arg Phe Leu Glu
Trp Leu Leu Tyr 1 5 10 2210PRTUnknownMammal 22Val Ser Pro Phe Leu
Glu Trp Ser Leu Tyr 1 5 10 239PRTHomo sapiens 23Val Leu Arg Tyr Phe
Asp Trp Leu Leu 1 5 249PRTUnknownMammal 24Val Ser Pro Tyr Phe Asp
Trp Ser Leu 1 5 259PRTHomo sapiens 25Val Leu Leu Trp Phe Gly Glu
Leu Leu 1 5 269PRTUnknownMammal 26Val Ser Pro Trp Phe Gly Glu Ser
Leu 1 5 279PRTHomo sapiens 27Leu Arg Leu Gly Glu Leu Ser Leu Tyr 1
5 289PRTUnknownMammal 28Ser Arg Leu Gly Glu Ser Ser Leu Tyr 1 5
294PRTHomo sapiens 29Trp Leu Leu Leu 1 304PRTUnknownMammal 30Val
Ser Leu Ser 1 314PRTUnknownMammal 31Trp Ser Leu Leu 1
324PRTUnknownMammal 32Pro Gln Ser Leu 1 334PRTUnknownMammal 33Pro
Arg Ser Leu 1 345PRTUnknownMammal 34Pro Arg Trp Ser Leu 1 5
356PRTHomo sapiens 35Trp Ile Gln Leu Trp Leu 1 5
366PRTUnknownMammal 36Trp Thr Gln Pro Trp Leu 1 5 374PRTHomo
sapiens 37Trp Leu Arg Leu 1 384PRTUnknownMammal 38Trp Pro Pro Leu 1
395PRTHomo sapiens 39Arg Trp Leu Gln Leu 1 5 405PRTUnknownMammal
40Thr Trp Pro Pro Leu 1 5 414PRTHomo sapiens 41Gln Gln Leu Val 1
424PRTUnknownMammal 42Pro Gln Leu Val 1 434PRTHomo sapiens 43Gln
Trp Leu Val 1 444PRTUnknownMammal 44Pro Trp Leu Val 1 455PRTHomo
sapiens 45Tyr Asn Trp Asn Asp 1 5 465PRTUnknownMammal 46Tyr His Trp
His Asp 1 5 475PRTHomo sapiens 47Tyr Asn Trp Asn Tyr 1 5
485PRTUnknownMammal 48Tyr His Trp His Tyr 1 5 496PRTHomo sapiens
49Tyr Ser Gly Ser Tyr Tyr 1 5 506PRTUnknownMammal 50Tyr His Gly Ser
His Tyr 1 5 5110PRTHomo sapiens 51Gly Tyr Cys Ser Ser Thr Ser Cys
Tyr Thr 1 5 10 5210PRTUnknownMammal 52Gly His Cys Ser His Thr Ser
Cys His Thr 1 5 10 5310PRTHomo sapiens 53Gly Tyr Cys Thr Asn Gly
Val Cys Tyr Thr 1 5 10 5410PRTUnknownMammal 54Gly His Cys Thr His
Gly Val Cys His Thr 1 5 10 5510PRTHomo sapiens 55Gly Tyr Cys Ser
Gly Gly Ser Cys Tyr Ser 1 5 10 5610PRTUnknownMammal 56Gly His Cys
Ser His Gly Ser Cys His Ser 1 5 10 579PRTHomo sapiens 57Ala Tyr Cys
Gly Gly Asp Cys Tyr Ser 1 5 589PRTUnknownMammal 58Ala His Cys Gly
Gly His Cys His Ser 1 5 5910PRTHomo sapiens 59Tyr Tyr Asp Phe Trp
Ser Gly Tyr Tyr Thr 1 5 10 6010PRTUnknownMammal 60Tyr His His Phe
Trp Ser Gly His Tyr Thr 1 5 10 6110PRTHomo sapiens 61Tyr Tyr Asp
Ile Leu Thr Gly Tyr Tyr Asn 1 5 10 6210PRTUnknownMammal 62Tyr His
His Ile Leu Thr Gly His Tyr Asn 1 5 10 6310PRTHomo sapiens 63Tyr
Tyr Tyr Gly Ser Gly Ser Tyr Tyr Asn 1 5 10 6410PRTUnknownMammal
64Tyr His His Gly Ser Gly Ser His Tyr Asn 1 5 10 6512PRTHomo
sapiens 65Tyr Tyr Asp Tyr Val Trp Gly Ser Tyr Arg Tyr Thr 1 5 10
6612PRTUnknownMammal 66Tyr His Asp His Val Trp Gly Ser His Arg Tyr
Thr 1 5 10 6710PRTHomo sapiens 67Tyr Tyr Tyr Asp Ser Ser Gly Tyr
Tyr Tyr 1 5 10 6810PRTUnknownMammal 68Tyr His Tyr His Ser Ser Gly
His Tyr Tyr 1 5 10 695PRTHomo sapiens 69Asp Tyr Ser Asn Tyr 1 5
704PRTUnknownMammal 70Pro Gln Ser Leu 1 715PRTHomo sapiens 71Asp
Tyr Gly Asp Tyr 1 5 725PRTUnknownMammal 72Asp His Gly His Tyr 1 5
736PRTHomo sapiens 73Asp Tyr Gly Gly Asn Ser 1 5
746PRTUnknownMammal 74Asp His Gly Gly His Ser 1 5 756PRTHomo
sapiens 75Gly Tyr Ser Tyr Gly Tyr 1 5 766PRTUnknownMammal 76Gly His
Ser His Gly Tyr 1 5 777PRTHomo sapiens 77Gly Tyr Ser Gly Tyr Asp
Tyr 1 5 787PRTUnknownMammal 78Gly His Ser Gly His His Tyr 1 5
796PRTHomo sapiens 79Arg Asp Gly Tyr Asn Tyr 1 5
806PRTUnknownMammal 80Arg His Gly His His Tyr 1 5 816PRTHomo
sapiens 81Glu Tyr Ser Ser Ser Ser 1 5 826PRTUnknownMammal 82Glu His
Ser His Ser Ser 1 5 837PRTHomo sapiens 83Gly Tyr Ser Ser Ser Trp
Tyr 1 5 847PRTUnknownMammal 84Gly His Ser His Ser Trp Tyr 1 5
857PRTHomo sapiens 85Gly Tyr Ser Ser Gly Trp Tyr 1 5
867PRTUnknownMammal 86Gly His Ser His Gly Trp Tyr 1 5 876PRTHomo
sapiens 87Gly Tyr Ser Ser Gly Tyr 1 5 885PRTHomo sapiens 88Gly Thr
Thr Gly Thr 1 5 895PRTHomo sapiens 89Gly Ile Thr Gly Thr 1 5
906PRTHomo sapiens 90Gly Ile Val Gly Ala Thr 1 5
916PRTUnknownMammal 91Gly Ile Met Gly Ala Thr 1 5 929PRTHomo
sapiens 92Asp Ile Val Val Val Pro Ala Ala Ile 1 5
939PRTUnknownMammal 93Asp Ile Val Val Ile Pro Ala Ala Ile 1 5
949PRTHomo sapiens 94Asp Ile Val Leu Met Val Tyr Ala Ile 1 5
959PRTHomo sapiens 95Asp Ile Val Val Val Val Ala Ala Thr 1 5
969PRTUnknownMammal 96Asp Ile Val Val Met Val Ala Ala Thr 1 5
978PRTHomo sapiens 97His Ile Val Val Val Thr Ala Ile 1 5 989PRTHomo
sapiens 98Ile Thr Ile Phe Gly Val Val Ile Ile 1 5 994PRTHomo
sapiens 99Ile Thr Ile Phe 1 1004PRTHomo sapiens 100Leu Val Ile Ile
1 1019PRTHomo sapiens 101Ile Thr Met Val Arg Gly Val Ile Ile 1 5
10211PRTHomo sapiens 102Ile Met Ile Thr Phe Gly Gly Val Ile Val Ile
1 5 10 1039PRTHomo sapiens 103Ile Thr Met Ile Val Val Val Ile Thr 1
5 1048PRTUnknownMammal 104Ile Thr Ile Val Val Val Ile Thr 1 5
1054PRTHomo sapiens 105Thr Thr Val Thr 1 1065PRTHomo sapiens 106Thr
Thr Val Val Thr 1 5 1076PRTHomo sapiens 107Val Asp Thr Ala Met Val
1 5 1087PRTHomo sapiens 108Val Asp Ile Val Ala Thr Ile 1 5
1096PRTHomo sapiens 109Val Glu Met Ala Thr Ile 1 5
1106PRTUnknownMammal 110Val Asp Met Ala Thr Ile 1 5 1115PRTHomo
sapiens 111Ser Ile Ala Ala Arg 1 5 1125PRTUnknownMammal 112Ser Ile
Ala Thr Arg 1 5 1136PRTHomo sapiens 113Gly Ile Ala Ala Ala Gly 1 5
1146PRTUnknownMammal 114Gly Ile Ala Thr Ala Gly 1 5 1156PRTHomo
sapiens 115Gly Ile Ala Val Ala Gly 1 5 1166PRTUnknownMammal 116Gly
Ile Ala Met Ala Gly 1 5 1175PRTHomo sapiens 117Gly Ile Ala Ala Ala
1 5 1185PRTUnknownMammal 118Gly Ile Ala Thr Ala 1 5
11919DNAUnknownMammal 119cgggtcactg ccatttctg
1912020DNAUnknownMammal 120tctgcattcg ctcccagcgc
2012119DNAUnknownMammal 121tctgcggcat gaacccaat
1912219DNAUnknownMammal 122gtgcagggag gaccttctg
1912324DNAUnknownMammal 123agtcaccaag cacagagccc tgac
2412419DNAUnknownMammal 124gccagggagt tgcctagtg
1912519DNAUnknownMammal 125gtggcccact tcccttcct
1912622DNAUnknownMammal 126cagctggaac ccaccatgac ct
2212718DNAUnknownMammal 127gacctgcctc ggatgaca
1812819DNAUnknownMammal 128tggccagaac tgaccctac
1912920DNAUnknownMammal 129accgacaaga gtccctcagg
2013019DNAUnknownMammal 130ggagtcggct ctggatgtg
1913117DNAUnknownMammal 131tgcggccgat cttagcc
1713221DNAUnknownMammal 132acgagcgggt tcggcccatt c
2113318DNAUnknownMammal 133ttgaccgatt ccttgcgg
1813419DNAUnknownMammal 134cagtcccgtt gatccagcc
1913530DNAUnknownMammal 135cccatcaggg attttgtatc tctgtggacg
3013621DNAUnknownMammal 136ggatatgcag cactgtgcca c
2113719DNAUnknownMammal 137tcctccaacg acaggtccc
1913824DNAUnknownMammal 138tccctggaac tctgccccga caca
2413920DNAUnknownMammal 139gatgaactga cgggcacagg
2014020DNAUnknownMammal 140atcacactca tcccatcccc
2014129DNAUnknownMammal 141cccttcccta agtaccacag agtgggctc
2914220DNAUnknownMammal 142cacagggaag caggaactgc
2014318DNAUnknownMammal 143ggagccaggc aggacaca
1814419DNAUnknownMammal 144tgggctcgta gtttgacgt
1914523DNAUnknownMammal 145gggactttct tacccacact tca
2314624DNAUnknownMammal 146ggtcccgagc actcttaatt aaac
2414716DNAUnknownMammal 147cctcgaatgg aactac
1614821DNAUnknownMammal 148gggagagcaa ccattcgttg t
2114919DNAUnknownMammal 149ccgagcaccg atgcatcta
1915016DNAUnknownMammal 150cgcagtcatg taatgc
1615120DNAUnknownMammal 151gggaggcgaa ctgactgtca
2015219DNAUnknownMammal 152ggtggagagg ctattcggc
1915323DNAUnknownMammal 153tgggcacaac agacaatcgg ctg
2315417DNAUnknownMammal 154gaacacggcg gcatcag 1715517DNAHomo
sapiens 155ggtacaactg gaacgac 1715617DNAHomo sapiens 156ggtataactg
gaactac 1715717DNAHomo sapiens 157ggtataaccg gaaccac 171585PRTHomo
sapiens 158Tyr Asn Arg Asn His 1 5 15917DNAHomo sapiens
159ggtataactg gaacgac 1716020DNAHomo sapiens 160ggtatagtgg
gagctactac 2016131DNAHomo sapiens 161aggatattgt agtagtacca
gctgctatgc c 311625PRTHomo sapiens 162Tyr Gln Leu Leu Cys 1 5
16310PRTHomo sapiens 163Gly Tyr Cys Ser Ser Thr Ser Cys Tyr Ala 1 5
10 1649PRTHomo sapiens 164Asp Ile Val Val Val Pro Ala Ala Met 1 5
16531DNAHomo sapiens 165aggatattgt agtagtacca gctgctatac c
3116631DNAHomo sapiens 166tggatattgt agtagtacca gctgctatgc c
311675PRTHomo sapiens 167Tyr Gln Leu Leu Cys 1 5 16810PRTHomo
sapiens 168Gly Tyr Cys Ser Ser Thr Ser Cys Tyr Ala 1 5 10
1699PRTHomo sapiens 169Asp Ile Val Val Val Pro Ala Ala Met 1 5
17031DNAHomo sapiens 170aggatattgt actaatggtg tatgctatac c
3117131DNAHomo sapiens 171aagatattgt actggtggtg tatgctatac c
3117210PRTHomo sapiens 172Arg Ile Leu Tyr Trp Trp Cys Met Leu Tyr 1
5 10 17310PRTHomo sapiens 173Gly Tyr Cys Thr Gly Gly Val Cys Tyr
Thr 1 5 10 1749PRTHomo sapiens 174Asp Ile Val Leu Val Val Tyr Ala
Ile 1 5 17531DNAHomo sapiens 175aggatattgt agtggtggta gctgctactc c
3117628DNAHomo sapiens 176agcatattgt ggtggtgatt gctattcc
281778PRTHomo sapiens 177His Ile Val Val Val Ile Ala Ile 1 5
17828DNAHomo sapiens 178agcatattgt ggtggtgact gctattcc
2817931DNAHomo sapiens 179gtattacgat ttttggagtg gttattatac c
3118031DNAHomo sapiens 180gtattagcat ttttggagtg gttattatac c
3118110PRTUnknownMammal 181Val Leu Ala Phe Leu Glu Trp Leu Leu Tyr
1 5 10 1828PRTHomo sapiens 182His Phe Trp Ser Gly Tyr Tyr Thr 1 5
1839PRTHomo sapiens 183Ile Ser Ile Phe Gly Val Val Ile Ile 1 5
18431DNAHomo sapiens 184gtattacgat attttgactg gttattataa c
3118531DNAHomo sapiens 185gtattactat ggttcgggga gttattataa c
3118630DNAHomo sapiens 186gtattactat gttcggggag ttattataac
3018710PRTHomo sapiens 187Val Leu Leu Cys Ser Gly Ser Tyr Tyr Asn 1
5 10 1889PRTHomo sapiens 188Tyr Tyr Tyr Val Arg Gly Val Ile Ile 1 5
1898PRTHomo sapiens 189Ile Thr Met Phe Gly Arg Leu Leu 1 5
19037DNAHomo sapiens 190gtattatgat tacgtttggg ggagttatgc ttatacc
371919PRTHomo sapiens 191Leu Arg Leu Gly Glu Leu Cys Leu Tyr 1 5
19212PRTHomo sapiens 192Tyr Tyr Asp Tyr Val Trp Gly Ser Tyr Ala Tyr
Thr 1 5 10 19311PRTHomo sapiens 193Ile Met Ile Thr Phe Gly Gly Val
Met Leu Ile 1 5 10 19431DNAHomo sapiens 194gtattactat gatagtagtg
gttattacta c 3119516DNAHomo sapiens 195tgactacagt aactac
1619616DNAHomo sapiens 196tgactacggt gactac 1619719DNAHomo sapiens
197tgactacggt ggtaactcc 1919820DNAHomo sapiens 198gtggatacag
ctatggttac 2019923DNAHomo sapiens 199gtggatatag tggctacgat tac
2320020DNAHomo sapiens 200gtagagatgg ctacaattac 2020118DNAHomo
sapiens 201gagtatagca gctcgtcc 1820221DNAHomo sapiens 202gggtatagca
gcagctggta c 2120321DNAHomo sapiens 203gggtatagca gtggctggta c
2120418DNAHomo sapiens 204gggtatagca gcggctac 1820511DNAHomo
sapiens 205ctaactgggg a 1120617DNAUnknownMammal 206gtcgttccag
ttgtacc 172075PRTUnknownMammal 207Val Val Pro Val Val 1 5
2085PRTUnknownMammal 208Ser Phe Gln Leu Tyr 1 5
2095PRTUnknownMammal 209Arg Ser Ser Cys Thr 1 5
21017DNAUnknownMammal 210gtagttccag ttatacc 172115PRTUnknownMammal
211Val Val Pro Val Ile 1 5 2124PRTUnknownMammal 212Phe Gln Leu Tyr
1 2135PRTUnknownMammal 213Ser Ser Ser Tyr Thr 1 5
21417DNAUnknownMammal 214gtggttccgg ttatacc 172155PRTUnknownMammal
215Trp Phe Arg Leu Tyr 1 5 2165PRTUnknownMammal 216Gly Ser Gly Tyr
Thr 1 5 21717DNAUnknownMammal 217gtcgttccag ttatacc
172185PRTUnknownMammal 218Arg Ser Ser Tyr Thr 1 5
21920DNAUnknownMammal 219gtagtagctc ccactatacc
202206PRTUnknownMammal 220Val Val Ala Pro Thr Ile 1 5
2214PRTUnknownMammal 221Leu Pro Leu Tyr 1 2226PRTUnknownMammal
222Ser Ser Ser His Tyr Thr 1 5 22331DNAUnknownMammal 223ggcatagcag
ctggtactac tacaatatcc t 3122410PRTUnknownMammal
224Gly Ile Ala Ala Gly Thr Thr Thr Ile Ser 1 5 10
2258PRTUnknownMammal 225Gln Leu Val Leu Leu Gln Tyr Pro 1 5
2269PRTUnknownMammal 226His Ser Ser Trp Tyr Tyr Tyr Asn Ile 1 5
22731DNAUnknownMammal 227ggtatagcag ctggtactac tacaatatcc t
3122831DNAUnknownMammal 228ggcatagcag ctggtactac tacaatatcc a
3122931DNAUnknownMammal 229ggtatagcat acaccattag tacaatatcc t
3123010PRTUnknownMammal 230Gly Ile Ala Tyr Thr Ile Ser Thr Ile Ser
1 5 10 2318PRTUnknownMammal 231His Thr Pro Leu Val Gln Tyr Pro 1 5
2325PRTUnknownMammal 232Tyr Ser Ile His His 1 5
23331DNAUnknownMammal 233ggtatagcat acaccaccag tacaatatct t
3123410PRTUnknownMammal 234Gly Ile Ala Tyr Thr Thr Ser Thr Ile Ser
1 5 10 2358PRTUnknownMammal 235His Thr Pro Pro Val Gln Tyr Leu 1 5
2369PRTUnknownMammal 236Tyr Ser Ile His His Gln Tyr Asn Ile 1 5
23731DNAUnknownMammal 237ggagtagcag ctaccaccac tacaatatcc t
3123810PRTUnknownMammal 238Gly Val Ala Ala Thr Thr Thr Thr Ile Ser
1 5 10 2398PRTUnknownMammal 239Gln Leu Pro Pro Leu Gln Tyr Pro 1 5
2409PRTUnknownMammal 240Ser Ser Ser Tyr His His Tyr Asn Ile 1 5
24128DNAUnknownMammal 241ggaatagcaa tcaccaccac aatatgct
282429PRTUnknownMammal 242Gly Ile Ala Ile Thr Thr Thr Ile Cys 1 5
2437PRTUnknownMammal 243Gln Ser Pro Pro Gln Tyr Ala 1 5
2448PRTUnknownMammal 244Asn Ser Asn His His His Asn Met 1 5
24528DNAUnknownMammal 245ggaatagcag tcaccaccac aatatgct
282469PRTUnknownMammal 246Gly Ile Ala Val Thr Thr Thr Ile Cys 1 5
2477PRTUnknownMammal 247Gln Ser Pro Pro Gln Tyr Ala 1 5
2488PRTUnknownMammal 248Asn Ser Ser His His His Asn Met 1 5
24931DNAUnknownMammal 249ggtataataa ccactccaaa aatcgtaata c
3125010PRTUnknownMammal 250Gly Ile Ile Thr Thr Pro Lys Ile Val Ile
1 5 10 2515PRTUnknownMammal 251Pro Leu Gln Lys Ser 1 5
2529PRTUnknownMammal 252Tyr Asn Asn His Ser Lys Asn Arg Asn 1 5
25331DNAUnknownMammal 253ggtataataa ccactccaaa aatgctaata c
3125410PRTUnknownMammal 254Gly Ile Ile Thr Thr Pro Lys Met Leu Ile
1 5 10 2555PRTUnknownMammal 255Pro Leu Gln Lys Cys 1 5
2569PRTUnknownMammal 256Tyr Asn Asn His Ser Lys Asn Ala Asn 1 5
25731DNAUnknownMammal 257gttataataa ccagtcaaaa tatcgtaata c
3125810PRTUnknownMammal 258Val Ile Ile Thr Ser Gln Asn Ile Val Ile
1 5 10 2595PRTUnknownMammal 259Pro Val Lys Ile Ser 1 5
2609PRTUnknownMammal 260Tyr Asn Asn Gln Ser Lys Tyr Arg Asn 1 5
26131DNAUnknownMammal 261gttataataa ctccccgaac catagtaata c
3126210PRTUnknownMammal 262Val Ile Ile Thr Pro Arg Thr Ile Val Ile
1 5 10 2634PRTUnknownMammal 263Leu Pro Glu Pro 1
2649PRTUnknownMammal 264Tyr Asn Asn Ser Pro Asn His Ser Asn 1 5
26530DNAUnknownMammal 265gttataataa ctccccgaac atagtaatac
302667PRTUnknownMammal 266Val Ile Ile Thr Pro Arg Thr 1 5
2676PRTUnknownMammal 267Leu Pro Glu His Ser Asn 1 5
2689PRTUnknownMammal 268Tyr Asn Asn Ser Pro Asn Ile Val Ile 1 5
26937DNAUnknownMammal 269ggtataagca taactccccc aaacgtaatc ataatac
3727012PRTUnknownMammal 270Gly Ile Ser Ile Thr Pro Pro Asn Val Ile
Ile Ile 1 5 10 2714PRTUnknownMammal 271Leu Pro Gln Thr 1
27211PRTUnknownMammal 272Tyr Lys His Asn Ser Pro Lys Arg Asn His
Asn 1 5 10 27331DNAUnknownMammal 273gtagtaataa ccactactat
catagtaata c 3127410PRTUnknownMammal 274Val Val Ile Thr Thr Thr Ile
Ile Val Ile 1 5 10 2754PRTUnknownMammal 275Pro Leu Leu Ser 1
2769PRTUnknownMammal 276Ser Asn Asn His Tyr Tyr His Ser Asn 1 5
27716DNAUnknownMammal 277gtagttactg tagtca 162785PRTUnknownMammal
278Val Val Thr Val Val 1 5 2794PRTUnknownMammal 279Ser Tyr Cys Ser
1 28016DNAUnknownMammal 280gtagtcaccg tagtca 162814PRTUnknownMammal
281Ser His Arg Ser 1 28219DNAUnknownMammal 282ggagttacca ccgtagtca
192836PRTUnknownMammal 283Gly Val Thr Thr Val Val 1 5
2844PRTUnknownMammal 284Glu Leu Pro Pro 1 2855PRTUnknownMammal
285Ser Tyr His Arg Ser 1 5 28620DNAUnknownMammal 286gtaaccatag
ctgtatccac 202876PRTUnknownMammal 287Val Thr Ile Ala Val Ser 1 5
2886PRTUnknownMammal 288Asn His Ser Cys Ile His 1 5
28923DNAUnknownMammal 289gtaatcgtag ccactatatc cac
232907PRTUnknownMammal 290Val Ile Val Ala Thr Ile Ser 1 5
2914PRTUnknownMammal 291Pro Leu Tyr Pro 1 2927PRTUnknownMammal
292Asn Arg Ser His Tyr Ile His 1 5 29320DNAUnknownMammal
293gtaattgtag ccatctctac 202946PRTUnknownMammal 294Val Ile Val Ala
Ile Ser 1 5 2956PRTUnknownMammal 295Asn Cys Ser His Leu Tyr 1 5
29618DNAUnknownMammal 296ggacgagctg ctatactc 182976PRTUnknownMammal
297Gly Arg Ala Ala Ile Leu 1 5 2985PRTUnknownMammal 298Asp Glu Leu
Leu Tyr 1 5 2995PRTUnknownMammal 299Thr Ser Cys Tyr Thr 1 5
30021DNAUnknownMammal 300gtaccagctg ctgctatacc c
213017PRTUnknownMammal 301Val Pro Ala Ala Ala Ile Pro 1 5
3026PRTUnknownMammal 302Tyr Gln Leu Leu Leu Tyr 1 5
3036PRTUnknownMammal 303Thr Ser Cys Cys Tyr Thr 1 5
30421DNAUnknownMammal 304gtaccagcca ctgctatacc c
213057PRTUnknownMammal' 305Val Pro Ala Thr Ala Ile Pro 1 5
3066PRTUnknownMammal 306Tyr Gln Pro Leu Leu Tyr 1 5
3076PRTUnknownMammal 307Thr Ser His Cys Tyr Thr 1 5
30818DNAUnknownMammal 308gtagccgctg ctataccc 183096PRTUnknownMammal
309Val Ala Ala Ala Ile Pro 1 5 3104PRTUnknownMammal 310Pro Leu Leu
Tyr 1 3115PRTUnknownMammal 311Ser Arg Cys Tyr Thr 1 5 312366DNAHomo
sapiens 312caggtgcagc tacagcagtg gggcgcagga ctgttgaagc cttcggatac
cctgtccctc 60acctgcgctg tctatggtgg gtccttcagt ggttactact ggagctggat
ccgccagccc 120ccagggaagg ggctggagtg gattggggaa atcaatcata
gtggaagcac caactacaac 180ccgtccctca agagtcgagt caccatatca
gtagacacgt ccaagaacca gttctccctg 240aagctgagct ctgtgaccgc
cgcggacacg gctgtgtatt actgtgcggg gcatagccat 300ggctggtact
actactacta cggtatggac gtctggggcc aagggaccac ggtcaccgtc 360tcctca
366313122PRTHomo sapiens 313Gln Val Gln Leu Gln Gln Trp Gly Ala Gly
Leu Leu Lys Pro Ser Asp 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Val
Tyr Gly Gly Ser Phe Ser Gly Tyr 20 25 30 Tyr Trp Ser Trp Ile Arg
Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn
His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60 Ser Arg
Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu 65 70 75 80
Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85
90 95 Gly His Ser His Gly Trp Tyr Tyr Tyr Tyr Tyr Gly Met Asp Val
Trp 100 105 110 Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120
31496PRTHomo sapiens 314Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu
Leu Lys Pro Ser Glu 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Val Tyr
Gly Gly Ser Phe Ser Gly Tyr 20 25 30 Tyr Trp Ser Trp Ile Arg Gln
Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn His
Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60 Ser Arg Val
Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu 65 70 75 80 Lys
Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90
95 315355DNAHomo sapiens 315caggtgcagc tgcaggagtc gggcccagga
ctggtgaagc cttcacagac cctgtccctc 60acctgcactg tctctggtgg ctccatcagc
agtggtggtt actactggag ctggatccgc 120cagcacccag ggaagggcct
ggagtggatt gggtacatct attacagtgg gagcacctac 180tacaacccgt
ccctcaagag tcgagttacc atatcagtag acacgtctaa gaaccagttc
240tccctgaagc tgagctctgt gactgccgcg gacacggccg tgtattactg
tgcgaggggg 300gaccacggtc actacgacta ctggggccag ggaaccctgg
tcaccgtctc ctcag 355316118PRTHomo sapiens 316Gln Val Gln Leu Gln
Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser
Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Gly 20 25 30 Gly
Tyr Tyr Trp Ser Trp Ile Arg Gln His Pro Gly Lys Gly Leu Glu 35 40
45 Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser
50 55 60 Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn
Gln Phe 65 70 75 80 Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr
Ala Val Tyr Tyr 85 90 95 Cys Ala Arg Gly Asp His Gly His Tyr Asp
Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115
31798PRTHomo sapiens 317Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu
Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser
Gly Gly Ser Ile Ser Ser Gly 20 25 30 Gly Tyr Tyr Trp Ser Trp Ile
Arg Gln His Pro Gly Lys Gly Leu Glu 35 40 45 Trp Ile Gly Tyr Ile
Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser 50 55 60 Leu Lys Ser
Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe 65 70 75 80 Ser
Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90
95 Cys Ala 318370DNAHomo sapiens 318cagctgcagc tgcaggagtc
gggcccagga ctggtgaagc cttcggagac cctgtccctc 60acctgcactg tctctggtgg
ctccatcagc agtagtagtt actactgggg ctggatccgc 120cagcccccag
ggaaggggct ggagtggatt gggagtatct attatagtgg gagcacctac
180tacaacccgt ccctcaagag tcgagtcacc atatccgtag acacgtccaa
gaaccagttc 240tccctgaagc tgagctctgt gaccgccgca gacacggctg
tgtattactg tgcgagacat 300gaagggcata gccaccttaa ctggttcgac
ccctggggcc aggggggaac cctggtcacc 360gtctcctcag 370319123PRTHomo
sapiens 319Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro
Ser Glu 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser
Ile Ser Ser Ser 20 25 30 Ser Tyr Tyr Trp Gly Trp Ile Arg Gln Pro
Pro Gly Lys Gly Leu Glu 35 40 45 Trp Ile Gly Ser Ile Tyr Tyr Ser
Gly Ser Thr Tyr Tyr Asn Pro Ser 50 55 60 Leu Lys Ser Arg Val Thr
Ile Ser Val Asp Thr Ser Lys Asn Gln Phe 65 70 75 80 Ser Leu Lys Leu
Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95 Cys Ala
Arg His Glu Gly His Ser His Leu Asn Trp Phe Asp Pro Trp 100 105 110
Gly Gln Gly Gly Thr Leu Val Thr Val Ser Ser 115 120 32099PRTHomo
sapiens 320Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro
Ser Glu 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser
Ile Ser Ser Ser 20 25 30 Ser Tyr Tyr Trp Gly Trp Ile Arg Gln Pro
Pro Gly Lys Gly Leu Glu 35 40 45 Trp Ile Gly Ser Ile Tyr Tyr Ser
Gly Ser Thr Tyr Tyr Asn Pro Ser 50 55 60 Leu Lys Ser Arg Val Thr
Ile Ser Val Asp Thr Ser Lys Asn Gln Phe 65 70 75 80 Ser Leu Lys Leu
Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95 Cys Ala
Arg 32122DNAUnknownMammal 321tcttatcaga cagggggctc tc
2232222DNAUnknownMammal 322ggaagacatt tgggaaggac tg
223234PRTUnknownMammal 323Phe Gly Xaa Gly 1 3244PRTUnknownMammal
324Trp Gly Xaa Gly 1
* * * * *