Mice That Produce Antigen-Binding Proteins With pH-Dependent Binding Characteristics

Abstract

Genetically modified non-human animals are provided that comprise an immunoglobulin heavy chain locus comprising an unrearranged human heavy chain variable region nucleotide sequence comprising an addition of at least one histidine codon or a substitution of at least one endogenous non-histidine codon with a histidine codon. Compositions and methods for making the genetically modified non-human animals as described herein are provided. Non-human animals capable of expressing an antigen-binding protein characterized by pH-dependent antigen binding, enhanced recyclability and/or enhanced serum half-life are also provided.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is a continuation of U.S. patent application Ser. No. 13/832,309, filed 15, Mar. 2013, entitled "Mice That Produce Antigen-Binding Proteins With pH-Dependent Binding Characteristics," which claims the benefit of priority to U.S. Provisional Application No. 61/611,950, filed 16, Mar. 2012, U.S. Provisional Application No. 61/613,352, filed Mar. 20, 2012, and U.S. Provisional Application No. 61/736,930, filed 13, Dec. 2012, the entire contents of each of the applications are incorporated herein by reference.

FIELD OF THE INVENTION

[0002] Genetically modified immunoglobulin loci of non-human animals comprising an unrearranged human heavy chain variable region nucleotide sequence, wherein the unrearranged human heavy chain variable region nucleotide sequence comprises an addition of least one histidine codon or a substitution of at least one non-histidine codon with a histidine codon. Non-human animals, including rodents, e.g., mice and rats, comprising in their germline an unrearranged human immunoglobulin heavy chain variable region nucleotide sequence, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence comprises an addition of least one histidine codon or a substitution of at least one non-histidine codon with a histidine codon. Genetically engineered non-human animals capable of expressing an antigen-binding protein that is characterized by pH-dependent antigen binding, improved recyclability, and/or enhanced serum half-life.

BACKGROUND OF THE INVENTION

[0003] Drugs administered into the body, including therapeutic monoclonal antibodies, can be affected via various elimination mechanisms, including glomerular filtration (e.g., into urine), secretion (e.g., into the bile), and catabolism by cells. While small molecules are cleared from the body via renal filtration, the majority of secreted antibodies (e.g., IgG, which are too big to be filtered through glomeruli) are primarily removed from the body via cell-mediated catabolism, e.g., fluid-phase endocytosis (phagocytosis) or receptor-mediated endocytosis. For example, soluble molecules with several repeated epitopes are bound by a plurality of circulating antibodies, and the resulting large antigen-antibody complexes are phagocytosed rapidly into cells for degradation. On the other hand, cell surface target receptors, which are bound by antibodies (i.e., receptor-antibody complexes), undergo target-mediated endocytosis in a dose-dependent manner, which leads to formation of endosomes destined for lysosomal degradation inside cells. In some cases, the endocytosed receptor-antibody complexes bind neonatal Fc receptors (FcRn) inside the endosomes in a pH-dependent manner and are routed back to the cell surface for release into plasma or interstitial fluids upon exposure to a neutral extracellular pH (e.g., pH 7.0-7.4).

[0004] There is a need in the art for systems, e.g., non-human animals, cells, and genomic loci that generate antigen-binding proteins with titratable residues, e.g., genetically modified loci that rearrange immunoglobulin gene segments to generate heavy chain variable domains that respond to changes in pH, e.g., that donate or accept protons and, e.g., whose binding characteristics differ according to protonation state.

[0005] There is also a need in the art for methods and compositions that can further increase recycling efficiency of endocytosed antigen-binding proteins by promoting dissociation of antigen-binding proteins from receptor-antigen-binding protein complexes or by increasing the affinity of antigen-binding proteins toward FcRn in an acidic endosomal compartment without compromising the specificity and affinity of the antigen-binding protein toward an antigen of interest.

SUMMARY OF THE INVENTION

[0006] Genetically modified immunoglobulin heavy chain loci in the germline genome of non-human animals are provided, wherein the immunoglobulin heavy chain loci comprise a genetically modified unrearranged heavy chain variable region nucleotide sequence (e.g., one or more genetically modified human V.sub.H, D, and/or J.sub.H gene segment), wherein the unrearranged heavy chain variable region nucleotide sequence comprises an addition of at least one histidine codon or a substitution of at least one endogenous non-histidine codon with a histidine codon. In various embodiments, the genetically modified unrearranged heavy chain variable region nucleotide sequence comprises at least one histidine codon in at least one reading frame that encodes an immunoglobulin heavy chain variable domain. In various embodiments, the unrearranged heavy chain variable region nucleotide sequence comprising the at least one histidine codon is operably linked to a human or non-human heavy chain constant region nucleotide sequence (e.g., a heavy chain constant region nucleotide sequence that encodes an immunoglobulin isotype selected from IgM, IgD, IgA, IgE, and IgG).

[0007] Non-human animals (mammals, e.g., rodents such as mice, rats, or hamsters) are provided that are genetically engineered to contain immunoglobulin heavy chain genomic loci in their germline genome, wherein the genomic loci comprise an unrearranged heavy chain variable region nucleotide sequence (e.g., one or more genetically modified human V.sub.H, D, and/or J.sub.H gene segments), wherein the unrearranged heavy chain variable region nucleotide sequence comprises an addition of at least one histidine codon or a substitution of at least one endogenous non-histidine codon with a histidine codon. In various embodiments, the genome of the non-human animals comprises a modification (i) that deletes or renders nonfunctional all, or substantially all, endogenous immunoglobulin V.sub.H, D, and/or J.sub.H gene segments (e.g., via insertion of a nucleotide sequence, e.g., an exogenous nucleotide sequence, in the immunoglobulin locus or via non-functional rearrangement or inversion of endogenous V.sub.H, D, and/or J.sub.H gene segments); and (ii) that introduces an unrearranged human heavy chain variable region nucleotide sequence (e.g., genetically modified human V.sub.H, D, or J.sub.H gene segments), wherein the unrearranged heavy chain variable region nucleotide sequence comprises an addition of at least one histidine codon or a substitution of at least one endogenous non-histidine codon with a histidine codon. In various embodiments, the unrearranged heavy chain variable region nucleotide sequence is present at an endogenous locus (i.e., where the unrearranged heavy chain variable region nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin heavy chain locus in its genome), or within its endogenous locus (e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome). In various embodiments, the immunoglobulin heavy chain variable region nucleotide sequence is operably linked to a human or non-human heavy chain constant region nucleotide sequence (e.g., a heavy chain constant region nucleotide sequence that encodes an immunoglobulin isotype selected from IgM, IgD, IgA, IgE, and IgG).

[0008] Genetically modified non-human animals are provided that are capable of expressing a genetically modified immunoglobulin heavy variable domain comprising one or more histidines, wherein the one or more histidines are not encoded by a germline gene segment of a corresponding wild-type non-human animal.

[0009] Genetically modified non-human animals are provided that comprise a B cell population that is characterized by rearranged immunoglobulin heavy chain variable genes that encode an immunoglobulin heavy chain variable domain with one or more histidines that are not encoded by a germline gene segment of a corresponding wild-type non-human animal.

[0010] Methods and compositions are provided for making non-human animals that comprise a genetically modified immunoglobulin heavy chain variable locus comprising an unrearranged human heavy chain variable region nucleotide sequence containing one or more histidine codons in at least one reading frame that encodes a heavy chain variable domain.

[0011] Methods and compositions are provided for non-human animals that make antigen-binding proteins that exhibit a pH-dependent binding of an antigen. Methods and compositions are provided for making non-human animals that have B cell populations, or antibody populations, that are enriched (as compared with corresponding wild-type animals) with antigen-binding proteins that are pH-dependent, e.g., in particular, heavy chain variable domains, and/or antigen-binding fragments thereof.

[0012] In one aspect, a genetically modified immunoglobulin locus in a germline genome of a non-human animal is provided comprising an unrearranged human heavy chain variable region nucleotide sequence, wherein the unrearranged heavy chain variable region nucleotide sequence comprises an addition of least one histidine codon or a substitution of at least one endogenous non-histidine codon with a histidine codon.

[0013] In one embodiment, the non-human animal is a mammal, including a rodent, e.g., a mouse, a rat, or a hamster.

[0014] In one embodiment, the added or substituted histidine codon is present in an immunoglobulin heavy chain gene segment selected from a human V.sub.H gene segment, a human D gene segment, a human J.sub.H gene segment, and a combination thereof. In one embodiment, the immunoglobulin heavy chain gene segment is selected from a human germline V.sub.H gene segment, a human germline D gene segment, a human germline J.sub.H gene segment, and a combination thereof.

[0015] In one embodiment, the human V gene segment (V.sub.H) is selected from the group consisting of V.sub.H1-2, V.sub.H1-3, V.sub.H1-8, V.sub.H1-18, V.sub.H1-24, V.sub.H1-45, V.sub.H1-46, V.sub.H1-58, V.sub.H1-69, V.sub.H2-5, V.sub.H2-26, V.sub.H2-70, V.sub.H3-7, V.sub.H3-9, V.sub.H3-11, V.sub.H3-13, V.sub.H3-15, V.sub.H3-16, V.sub.H3-20, V.sub.H3-21, V.sub.H3-23, V.sub.H3-30, V.sub.H3-30-3, V.sub.H 3-30-5, V.sub.H3-33, V.sub.H3-35, V.sub.H3-38, V.sub.H3-43, V.sub.H3-48, V.sub.H3-49, V.sub.H3-53, V.sub.H3-64, V.sub.H3-66, V.sub.H3-72, V.sub.H3-73, V.sub.H3-74, V.sub.H4-4, V.sub.H4-28, V.sub.H4-30-1, V.sub.H4-30-2, V.sub.H4-30-4, V.sub.H4-31, V.sub.H4-34, V.sub.H4-39, V.sub.H4-59, V.sub.H4-61, V.sub.H5-51, V.sub.H6-1, V.sub.H7-4-1, V.sub.H7-81, and a combination thereof.

[0016] In one embodiment, the human D gene segment is selected from the group consisting of D1-1, D1-7, D1-14, D1-20, D1-26, D2-2, D2-8, D2-15, D2-21, D3-3, D3-9, D3-10, D3-16, D3-22, D4-4, D4-11, D4-17, D4-23, D5-12, D5-5, D5-18, D5-24, D6-6, D6-13, D6-19, D6-25, D7-27, and a combination thereof.

[0017] In one embodiment, the human J gene segment is selected from the group consisting of J.sub.H1, J.sub.H2, J.sub.H3, J.sub.H4, J.sub.H5, J.sub.H6, and a combination thereof.

[0018] In one embodiment, the added or substituted histidine codon is present in the unrearranged heavy chain variable region nucleotide sequence that encodes an N-terminal region, a loop 4 region, a CDR1, a CDR2, a CDR3, or a combination thereof.

[0019] In one embodiment, the unrearranged heavy chain variable region nucleotide sequence comprises 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, or 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or more, 34 or more 35 or more, 36 or more, 37 or more, 38 or more, 39 or more, 40 or more, 41 or more, 42 or more, 43 or more, 44 or more, 45 or more, 46 or more, 47 or more, 48 or more, 49 or more, 50 or more, 51 or more, 52 or more, 53 or more, 54 or more, 55 or more, 56 or more, 57 or more, 58 or more, 59 or more, 60 or more, or 61 or more of histidine codons.

[0020] In one embodiment, the unrearranged heavy chain variable region nucleotide sequence is operably linked to a human or non-human heavy chain constant region nucleotide sequence that encodes an immunoglobulin isotype selected from IgM, IgD, IgG, IgE, and IgA.

[0021] In one embodiment, the human unrearranged immunoglobulin heavy chain variable region nucleotide sequence is operably linked to a human or non-human heavy chain constant region nucleotide sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3, and a combination thereof. In one embodiment, the heavy chain constant region nucleotide sequence comprises a C.sub.H1, a hinge, a C.sub.H2, and a C.sub.H3 (i.e., C.sub.H1-hinge-C.sub.H2-C.sub.H3).

[0022] In one embodiment, a heavy chain constant region nucleotide sequence is present at an endogenous locus (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome, or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome).

[0023] In one embodiment, the heavy chain constant region nucleotide sequence comprises a modification in a C.sub.H2 or a C.sub.H3, wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0024] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a modification at position 250 (e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K) and/or 434 (e.g., H/F or Y); or a modification at position 250 and/or 428; or a modification at position 307 or 308 (e.g., 308F, V308F), and 434. In one embodiment, the modification comprises a 428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L, 259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K (e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and 256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L modification (e.g., T250Q and M428L); and a 307 and/or 308 modification (e.g., 308F or 308P), wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0025] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 252 and 257, wherein the modification increases the affinity of the human C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0026] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 307 and 311, wherein the modification increases the affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0027] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H3 amino acid sequence, wherein the C.sub.H3 amino acid sequence comprises at least one modification between amino acid residues at positions 433 and 436, wherein the modification increases the affinity of the C.sub.H3 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0028] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, N434S, and a combination thereof.

[0029] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, V259I, V308F, and a combination thereof.

[0030] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising an N434A mutation.

[0031] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M252Y, S254T, T256E, and a combination thereof.

[0032] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of T250Q, M248L, or both.

[0033] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of H433K, N434Y, or both.

[0034] In one embodiment, the genetically modified immunoglobulin locus comprises: (1) a first allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a first heavy chain constant region nucleotide sequence encoding a first CH.sub.3 amino acid sequence of a human IgG selected from IgG1, IgG2, IgG4, and a combination thereof; and (2) a second allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a second heavy chain constant region nucleotide sequence encoding a second C.sub.H3 amino acid sequence of the human IgG selected from IgG1, IgG2, IgG4, and a combination thereof, and wherein the second CH.sub.3 amino acid sequence comprises a modification that reduces or eliminates binding for the second CH.sub.3 amino acid sequence to Protein A (see, for example, US 2010/0331527A1, which is incorporated by reference herein in its entirety).

[0035] In one embodiment, the second CH.sub.3 amino acid sequence comprises an H95R modification (by IMGT exon numbering; H435R by EU numbering). In one embodiment the second CH.sub.3 amino acid sequence further comprises an Y96F modification (by IMGT exon numbering; H436F by EU). In another embodiment, the second CH.sub.3 amino acid sequence comprises both an H95R modification (by IMGT exon numbering; H435R by EU numbering) and an Y96F modification (by IMGT exon numbering; H436F by EU).

[0036] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG1 and further comprises a mutation selected from the group consisting of D16E, L18M, N44S, K52N, V57M, and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by EU).

[0037] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG2 and further comprises a mutation selected from the group consisting of N44S, K52N, and V82I (IMGT: N384S, K392N, and V422I by EU).

[0038] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG4 and further comprises a mutation selected from the group consisting of Q15R, N44S, K52N, V57M, R69K, E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and V422I by EU).

[0039] In one embodiment, the heavy chain constant region amino acid sequence is a non-human constant region amino acid sequence, and the heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0040] In one embodiment, all or substantially all endogenous V.sub.H, D, and J.sub.H gene segments are deleted from an immunoglobulin heavy chain locus or rendered non-functional (e.g., via insertion of a nucleotide sequence (e.g., an exogenous nucleotide sequence) in the immunoglobulin locus or via non-functional rearrangement, or inversion, of the endogenous V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments are deleted or rendered non-functional. In one embodiment, e.g., at least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or J gene segments are deleted or rendered non-functional.

[0041] In one embodiment, the genetically modified immunoglobulin heavy chain locus comprises a modification that deletes or renders non-functional all, or substantially all, endogenous V.sub.H, D, and J.sub.H gene segments; and the genetically modified locus comprises an unrearranged heavy chain variable region nucleotide sequence comprising one or more human V.sub.H, D, and/or J.sub.H gene segments having one or more histidine codons, wherein the unrearranged heavy chain variable region nucleotide sequence is present at an endogenous location (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome), or within its endogenous locus (e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome).

[0042] In one embodiment, the genetically modified immunoglobulin locus comprises an endogenous Adam6a gene, Adam6b gene, or both, and the genetic modification does not affect the expression and/or function of the endogenous Adam6a gene, Adam6b gene, or both.

[0043] In one embodiment, the genetically modified immunoglobulin locus comprises an ectopically present Adam6a gene, Adam6b gene, or both. In one embodiment, the Adam6a gene is a non-human Adam6a gene. In one embodiment, the Adam6a gene is a human Adam6a gene. In one embodiment, the Adam6b gene is a non-human Adam6b gene. In one embodiment, the Adam6b gene is a human Adam6b gene.

[0044] In one embodiment, the genetically modified immunoglobulin locus further comprises a humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence. In one embodiment, the humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence is operably linked to an immunoglobulin light chain constant region nucleotide sequence selected from a .lamda. light chain constant region nucleotide sequence and a .kappa. light chain constant region nucleotide sequence. In one embodiment, the humanized, unrearranged .lamda. light chain variable region nucleotide sequence is operably linked to a .lamda. light chain constant region nucleotide sequence. In one embodiment, the .lamda. light chain constant region nucleotide sequence is a mouse, rat, or human sequence. In one embodiment, the humanized, unrearranged .kappa. light chain variable region nucleotide sequence is operably linked to a .kappa. light chain constant region nucleotide sequence. In one embodiment, the .kappa. light chain constant region nucleotide sequence is a mouse, rat, or human sequence.

[0045] In one embodiment, the genetically modified immunoglobulin locus comprises an unrearranged light chain variable gene sequence that contains at least one modification that introduces at least one histidine codon in at least one reading frame encoding a light chain variable domain. In one embodiment, the genetically modified immunoglobulin locus comprises a rearranged (e.g., rearranged .lamda. or .kappa. V/J sequence) sequence that comprises one, two, three, or four codons for histidine in a light chain CDR. In one embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a combination thereof. In one embodiment, the unrearranged or rearranged light chain variable region nucleotide sequence is an unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence. In one embodiment, the unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence is present at an endogenous mouse immunoglobulin light chain locus. In one embodiment, the mouse immunoglobulin light chain locus is a mouse .kappa. locus. In one embodiment, the mouse immunoglobulin light chain locus is a mouse .lamda. locus.

[0046] In one embodiment, the genetically modified immunoglobulin locus as described herein is present in an immunoglobulin heavy chain locus of a mouse. In one embodiment, the genetically modified immunoglobulin locus is present in a humanized immunoglobulin heavy chain locus in a VELOCIMMUNE.RTM. mouse.

[0047] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein exhibits a weaker antigen binding at an acidic environment (e.g., at a pH of about 5.5 to about 6.0) than a corresponding wild-type heavy chain variable domain without the genetic modification.

[0048] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein has at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, or at least about 30-fold decrease in dissociative half-life (t.sub.1/2) at an acidic pH (e.g., pH of about 5.5 to about 6.0) as compared to the dissociative half-life (t.sub.1/2) of the antigen-binding protein at a neutral pH (e.g., pH of about 7.0 to about 7.4).

[0049] In one embodiment, the genetically modified immunoglobulin locus described herein comprises a B cell population that, upon stimulation with an antigen of interest, is capable of producing antigen-binding proteins, e.g., antibodies, comprising a heavy chain variable domain with one or more histidine residues. The antigen-binding proteins as described herein, when administered into a subject, exhibits an increased serum half-life over a corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain. In some embodiments, the antigen-binding protein described herein exhibits an increased serum half-life that is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold higher than the corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain.

[0050] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein is characterized by improved pH-dependent recyclability, enhanced serum half-life, or both as compared with a wild-type antigen-binding protein without the genetic modification as described herein.

[0051] In one aspect, a genetically modified immunoglobulin locus in a germline genome of a non-human animal is provided comprising an unrearranged human heavy chain variable region nucleotide sequence, wherein the human unrearranged heavy chain variable region nucleotide sequence comprises a substitution of at least one endogenous non-histidine codon with a histidine codon.

[0052] In one embodiment, the non-human animal is a mammal, including a rodent, e.g., a mouse, a rat, or a hamster.

[0053] In one embodiment, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or more, 34 or more, 35 or more, 36 or more, 37 or more, 38 or more, 39 or more, 40 or more, 41 or more, 42 or more, 43 or more, 44 or more, 45 or more, 46 or more, 47 or more, 48 or more, 49 or more, 50 or more, 51 or more, 52 or more, 53 or more, 54 or more, 55 or more, 56 or more, 57 or more, 58 or more, 59 or more, 60 or more, or 61 or more of the endogenous non-histidine codons are replaced with histidine codons.

[0054] In one embodiment, the endogenous non-histone codon encodes the amino acid selected from Y, N, D, Q, S, W, and R.

[0055] In one embodiment, the substituted histidine codon is present in an unrearranged heavy chain variable region nucleotide sequence that encodes an immunoglobulin variable domain selected from an N-terminal region, a loop 4 region, a CDR1, a CDR2, a CDR3, a combination thereof.

[0056] In one embodiment, the substituted histidine codon is present in an unrearranged heavy chain variable region nucleotide sequence that encodes a complementary determining region (CDR) selected from a CDR1, a CDR2, a CDR3, and a combination thereof.

[0057] In one embodiment, the substituted histidine codon is present in an unrearranged heavy chain variable region nucleotide sequence that encodes a frame region (FR) selected from FR1, FR2, FR3, FR4, and a combination thereof.

[0058] In one embodiment, the unrearranged heavy chain variable region nucleotide sequence comprises a genetically modified human V.sub.H gene segment, wherein one or more endogenous non-histidine codon in at least one reading frame of the human V.sub.H gene segment has been replaced with a histidine codon.

[0059] In one embodiment, the human unrearranged heavy chain variable region nucleotide sequence comprises a modification that replaces at least one endogenous non-histidine codon of a human V.sub.H gene segment with a histidine codon, wherein the human V.sub.H gene segment is selected from the group consisting of V.sub.H1-2, V.sub.H1-3, V.sub.H1-8, V.sub.H1-18, V.sub.H1-24, V.sub.H1-45, V.sub.H1-46, V.sub.H1-58, V.sub.H1-69, V.sub.H2-5, V.sub.H2-26, V.sub.H2-70, V.sub.H3-7, V.sub.H3-9, V.sub.H3-11, V.sub.H3-13, V.sub.H3-15, V.sub.H3-16, V.sub.H3-20, V.sub.H3-21, V.sub.H3-23, V.sub.H3-30, V.sub.H3-30-3, V.sub.H 3-30-5, V.sub.H3-33, V.sub.H3-35, V.sub.H3-38, V.sub.H3-43, V.sub.H3-48, V.sub.H3-49, V.sub.H3-53, V.sub.H3-64, V.sub.H3-66, V.sub.H3-72, V.sub.H3-73, V.sub.H3-74, V.sub.H4-4, V.sub.H4-28, V.sub.H4-30-1, V.sub.H4-30-2, V.sub.H4-30-4, V.sub.H4-31, V.sub.H4-34, V.sub.H4-39, V.sub.H4-59, V.sub.H4-61, V.sub.H5-51, V.sub.H6-1, V.sub.H7-4-1, V.sub.H7-81, and a combination thereof.

[0060] In one embodiment, the human unrearranged heavy chain variable region nucleotide sequence comprises a genetically modified human J.sub.H gene segment, wherein one or more endogenous non-histidine codon in at least one reading frame of the human J.sub.H gene segment has been replaced with a histidine codon.

[0061] In one embodiment, the human unrearranged heavy chain variable region nucleotide sequence comprises a modification that replaces at least one endogenous non-histidine codon of a human J.sub.H segment with a histidine codon, wherein the human J.sub.H gene segment is selected from the group consisting of J.sub.H1, J.sub.H2, 43, 44, J.sub.HS, J.sub.H6, and a combination thereof.

[0062] In one embodiment, the substituted histidine codon is present in a heavy chain variable region nucleotide sequence that encodes part of a CDR3. In one embodiment, the part of CDR3 comprises an amino acid sequence derived from a reading frame of a genetically modified human D gene segment comprising a modification that replaces at least one endogenous non-histidine codon in the reading frame with a histidine codon.

[0063] In one embodiment, the endogenous non-histidine codon that is substituted with a histidine codon encodes the amino acid selected from Y, N, D, Q, S, W, and R.

[0064] In one embodiment, the substituted histidine codon is present in at least one reading frame of the human D gene segment that is most frequently observed in VELOCIMMUNE.RTM. humanized immunoglobulin mice.

[0065] In one embodiment, the reading frame of the genetically modified human D gene segment that encodes part of CDR3 is selected from a hydrophobic frame, a stop frame, and a hydrophilic frame.

[0066] In one embodiment, the reading frame is a hydrophobic frame of a human D gene segment.

[0067] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D1-1 (GTTGT; SEQ ID NO: 88), D1-7 (GITGT; SEQ ID NO: 89), D1-20 (GITGT; SEQ ID NO: 89), and D1-26 (GIVGAT; SEQ ID NO: 90), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0068] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D2-2 (DIVVVPAAI; SEQ ID NO: 92), D2-8 (DIVLMVYAI; SEQ ID NO: 94), D2-15 (DIVVVVAAT; SEQ ID NO: 95), and D2-21 (HIVVVTAI; SEQ ID NO: 97), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0069] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D3-3 (ITIFGVVII; SEQ ID NO: 98), D3-9 (ITIF*LVII; SEQ ID NO: 99, SEQ ID NO:100), D3-10 (ITMVRGVII; SEQ ID NO:101), D3-16 (IMITFGGVIVI; SEQ ID NO:102), and D3-22 (ITMIVVVIT; SEQ ID NO:103), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon.

[0070] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D4-4 (TTVT; SEQ ID NO: 105), D4-11 (TTVT; SEQ ID NO:105), D4-17 (TTVT; SEQ ID NO:105), D4-23 (TTVVT; SEQ ID NO: 106) and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0071] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D5-5 (VDTAMV; SEQ ID NO: 107), D5-12 (VDIVATI; SEQ ID NO: 108), D5-18 (VDTAMV; SEQ ID NO:107), and D5-24 (VEMATI; SEQ ID NO:109), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0072] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D6-6 (SIAAR; SEQ ID NO: 111), D6-13 (GIAAAG; SEQ ID NO: 113), and D6-19 (GIAVAG; SEQ ID NO:115), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0073] In one embodiment, the hydrophobic frame comprises a nucleotide sequence that encodes human D7-27 (LTG), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0074] In one embodiment, the reading frame is a stop reading frame of a human D gene segment.

[0075] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D1-1 (VQLER; SEQ ID NO:8), D1-7(V*LEL), D1-20(V*LER), D1-26 (V*WELL; SEQ ID NO: 12), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0076] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D2-2 (RIL**YQLLY; SEQ ID NO:14), D2-8 (RILY*WCMLY; SEQ ID NO:16 and SEQ ID NO: 17), D2-15 (RIL*WW*LLL), and D2-21 (SILWW*LLF; SEQ ID NO:19), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0077] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D3-3 (VLRFLEWLLY; SEQ ID NO:21), D3-9 (VLRYFDWLL*; SEQ ID NO:23), D3-10 (VLLWFGELL*; SEQ ID NO:25), D3-16 (VL*LRLGELSLY; SEQ ID NO:27), and D3-22 (VLL***WLLL; SEQ ID NO:29), and the human D gene segment comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0078] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D4-4 (*LQ*L), D4-11 (*LQ*L), D4-17 (*LR*L), and D4-23 (*LRW*L), and the human D gene segment comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0079] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D5-5 (WIQLWL; SEQ ID NO:35); D5-12 (Wl*WLRL; SEQ ID NO:37), D5-18 (WIQLWL; SEQ ID NO:35), and D5-24 (*RWLQL; SEQ ID NO:39), and the human D gene segment comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0080] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D6-6 (V*QLV), D6-13 (V*QQLV; SEQ ID NO:41), and D6-19 (V*QWLV; SEQ ID NO:43), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0081] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes D7-27 (*LG), and the human D gene segment further comprises a modification that replaces at least one endogenous codon of the human D gene segment in the nucleotide sequence with a histidine codon.

[0082] In one embodiment, the reading frame is a hydrophilic frame of a human D gene segment.

[0083] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D1-1 (YNWND; SEQ ID NO: 45), D1-7 (YNWNY; SEQ ID NO: 47), D1-20 (YNWND; SEQ ID NO: 45), and D1-26 (YSGSYY; SEQ ID NO:49), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, and a combination thereof.

[0084] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D2-2 (GYCSSTSCYT; SEQ ID NO:51), D2-8 (GYCTNGVCYT; SEQ ID NO: 53), D2-15 (GYCSGGSCYS; SEQ ID NO:55), and D2-21 (AYCGGDCYS; SEQ ID NO:57), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, and a combination thereof.

[0085] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D3-3 (YYDFWSGYYT; SEQ ID NO:59), D3-9 (YYDILTGYYN; SEQ ID NO:61), D3-10 (YYYGSGSYYN; SEQ ID NO:63), D3-16 (YYDYVWGSYRYT; SEQ ID NO:65), and D3-22 (YYYDSSGYYY; SEQ ID NO:67), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and a combination thereof.

[0086] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D4-4 (DYSNY; SEQ ID NO:69), D4-11 (DYSNY; SEQ ID NO:69), D4-17 (DYGDY; SEQ ID NO:71), and D4-23 (DYGGNS; SEQ ID NO:73), and the human D gene segment comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, and a combination thereof.

[0087] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D5-5 (GYSYGY; SEQ ID NO:75), D5-12 (GYSGYDY; SEQ ID NO:77), D5-18 (GYSYGY; SEQ ID NO:75), and D5-24 (RDGYNY; SEQ ID NO:79), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, and a combination thereof.

[0088] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D6-6 (EYSSSS; SEQ ID NO: 81), D6-13 (GYSSSWY; SEQ ID NO:83), and D6-19 (GYSSGWY; SEQ ID NO:85), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 76, and a combination thereof.

[0089] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes D7-27 (NWG), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence a histidine codon.

[0090] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, and a combination thereof.

[0091] In one embodiment, the human unrearranged immunoglobulin heavy chain variable region nucleotide sequence is operably linked to a human or non-human heavy chain constant region nucleotide sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3, and a combination thereof. In one embodiment, the heavy chain constant region nucleotide sequence comprises a C.sub.H1, a hinge, a C.sub.H2, and a C.sub.H3 (i.e., C.sub.H1-hinge-C.sub.H2-C.sub.H3).

[0092] In one embodiment, a heavy chain constant region nucleotide sequence is present at an endogenous locus (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome), or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome.

[0093] In one embodiment, the heavy chain constant region nucleotide sequence comprises a modification in a C.sub.H2 or a C.sub.H3, wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0094] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a modification at position 250 (e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K) and/or 434 (e.g., H/F or Y); or a modification at position 250 and/or 428; or a modification at position 307 or 308 (e.g., 308F, V308F), and 434. In one embodiment, the modification comprises a 428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L, 259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K (e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and 256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L modification (e.g., T250Q and M428L); and a 307 and/or 308 modification (e.g., 308F or 308P), wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0095] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 252 and 257, wherein the modification increases the affinity of the human C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0096] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 307 and 311, wherein the modification increases the affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0097] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H3 amino acid sequence, wherein the C.sub.H3 amino acid sequence comprises at least one modification between amino acid residues at positions 433 and 436, wherein the modification increases the affinity of the C.sub.H3 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0098] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, N434S, and a combination thereof.

[0099] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, V259I, V308F, and a combination thereof.

[0100] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising an N434A mutation.

[0101] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M252Y, S254T, T256E, and a combination thereof.

[0102] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of T250Q, M248L, or both.

[0103] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of H433K, N434Y, or both.

[0104] In one embodiment, the genetically modified immunoglobulin locus comprises: (1) a first allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a first heavy chain constant region nucleotide sequence encoding a first CH.sub.3 amino acid sequence of a human IgG selected from IgG1, IgG2, IgG4, and a combination thereof; and (2) a second allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a second heavy chain constant region nucleotide sequence encoding a second C.sub.H3 amino acid sequence of the human IgG selected from IgG1, IgG2, IgG4, and a combination thereof, and wherein the second CH.sub.3 amino acid sequence comprises a modification that reduces or eliminates binding for the second CH.sub.3 amino acid sequence to Protein A (see, for example, US 2010/0331527A1, which is incorporated by reference herein in its entirety).

[0105] In one embodiment, the second CH.sub.3 amino acid sequence comprises an H95R modification (by IMGT exon numbering; H435R by EU numbering). In one embodiment the second CH.sub.3 amino acid sequence further comprises an Y96F modification (by IMGT exon numbering; H436F by EU). In another embodiment, the second CH.sub.3 amino acid sequence comprises both an H95R modification (by IMGT exon numbering; H435R by EU numbering) and an Y96F modification (by IMGT exon numbering; H436F by EU).

[0106] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG1 and further comprises a mutation selected from the group consisting of D16E, L18M, N44S, K52N, V57M, and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by EU).

[0107] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG2 and further comprises a mutation selected from the group consisting of N44S, K52N, and V82I(IMGT: N384S, K392N, and V422I by EU).

[0108] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG4 and further comprises a mutation selected from the group consisting of Q15R, N44S, K52N, V57M, R69K, E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and V422I by EU).

[0109] In one embodiment, the heavy chain constant region amino acid sequence is a non-human constant region amino acid sequence, and the heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0110] In one embodiment, the heavy chain constant region nucleotide sequence is a human heavy chain constant region amino acid sequence, and the human heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0111] In one embodiment, all or substantially all endogenous V.sub.H, D, and J.sub.H gene segments are deleted from an immunoglobulin heavy chain locus or rendered non-functional (e.g., via insertion of a nucleotide sequence, e.g., an exogenous nucleotide sequence, in the immunoglobulin locus or via non-functional rearrangement, or inversion, of the endogenous V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments are deleted or rendered non-functional. In one embodiment, e.g., at least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or J gene segments are deleted or rendered non-functional.

[0112] In one embodiment, the genetically modified locus comprises a modification that deletes or renders non-functional all or substantially all endogenous V.sub.H, D, and J.sub.H gene segments; and the genomic locus comprises a genetically modified, unrearranged human heavy chain variable region nucleotide sequence comprising a substitution of at least one endogenous non-histidine codon with a histidine codon in at least one reading frame. In one embodiment, the genetically modified, unrearranged immunoglobulin heavy chain variable gene sequence is present at an endogenous location (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome), or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome.

[0113] In one embodiment, the genetically modified locus comprises an endogenous Adam6a gene, Adam6b gene, or both, and the genetic modification does not affect the expression and/or function of the endogenous Adam6a gene, Adam6b gene, or both.

[0114] In one embodiment, the genetically modified locus comprises an ectopically present Adam6a gene, Adam6b gene, or both. In one embodiment, the Adam6a gene is a non-human Adam6a gene. In one embodiment, the Adam6a gene is a mouse Adam6a gene. In one embodiment, the Adam6a gene is a human Adam6a gene. In one embodiment, the Adam6b gene is a non-human Adam6b gene. In one embodiment, the Adam6b gene is a mouse Adam6b gene. In one embodiment, the Adam6b gene is a human Adam6b gene.

[0115] In one embodiment, the genetically modified immunoglobulin locus further comprises a humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence. In one embodiment, the humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence is operably linked to an immunoglobulin light chain constant region nucleotide sequence selected from a .lamda. light chain constant region nucleotide sequence and a .kappa. light chain constant region nucleotide sequence. In one embodiment, the humanized, unrearranged .lamda. light chain variable region nucleotide sequence is operably linked to a .lamda. light chain constant region nucleotide sequence. In one embodiment, the .lamda. light chain constant region nucleotide sequence is a mouse, rat, or human sequence. In one embodiment, the humanized, unrearranged .kappa. light chain variable region nucleotide sequence is operably linked to a .kappa. light chain constant region nucleotide sequence. In one embodiment, the .kappa. light chain constant region nucleotide sequence is a mouse, rat, or human sequence.

[0116] In one embodiment, the genetically modified immunoglobulin locus comprises an unrearranged light chain variable gene sequence that contains at least one modification that introduces at least one histidine codon in at least one reading frame encoding a light chain variable domain. In one embodiment, the genetically modified immunoglobulin locus comprises a rearranged (e.g., a rearranged .lamda. or .kappa. V/J sequence) sequence that comprises one, two, three, or four codons for histidine in a light chain CDR. In one embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a combination thereof. In one embodiment, the unrearranged or rearranged light chain variable region nucleotide sequence is an unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence. In one embodiment, the unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence is present at an endogenous mouse immunoglobulin light chain locus. In one embodiment, the mouse immunoglobulin light chain locus is a mouse .kappa. locus. In one embodiment the mouse immunoglobulin light chain locus is a mouse .lamda. locus.

[0117] In one embodiment, the genetically modified immunoglobulin locus as described herein is present in an immunoglobulin heavy chain locus of a mouse. In one embodiment, the genetically modified immunoglobulin locus is present in a humanized immunoglobulin heavy chain locus in a VELOCIMMUNE.RTM. mouse.

[0118] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein exhibits a weaker antigen binding at an acidic environment (e.g., at a pH of about 5.5 to about 6.0) than a corresponding wild-type heavy chain variable domain without the genetic modification described herein.

[0119] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein has at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, or at least about 30-fold decrease in dissociative half-life (t.sub.1/2) at an acidic pH (e.g., pH of about 5.5 to about 6.0) as compared to the dissociative half-life (t.sub.1/2) of the antigen-binding protein at a neutral pH (e.g., pH of about 7.0 to about 7.4).

[0120] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein is characterized by improved pH-dependent recyclability, enhanced serum half-life, or both as compared with a wild-type antigen-binding protein without the genetic modification.

[0121] In one embodiment, the genetically modified immunoglobulin locus described herein comprises a B cell population that, upon stimulation with an antigen of interest, is capable of producing antigen-binding proteins, e.g., antibodies, comprising a heavy chain variable domain comprising one or more histidine residues. The antigen-binding proteins, which are produced by the genetically modified immunoglobulin locus described herein, when administered into a subject, exhibits an increased serum half-life over a corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain. In some embodiments, the antigen-binding protein described herein exhibits an increased serum half-life that is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold higher than the corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain.

[0122] In one aspect, a genetically modified immunoglobulin locus of a non-human animal comprising a human V.sub.H, D, and J.sub.H gene segment is provided, wherein at least one human D gene segment has been inverted 5' to 3' with respect to a corresponding wild-type sequence, and wherein at least one reading frame of the inverted human D gene segment comprises one ore more histidine codon.

[0123] In one embodiment, the non-human animal is a mammal, including a rodent, e.g., a mouse, a rat, or a hamster

[0124] In one embodiment, the genetically modified immunoglobulin locus is present in a germline genome.

[0125] In one embodiment, the genetically modified immunoglobulin locus encodes an immunoglobulin heavy chain variable domain comprising one or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or more, or 34 or more of histidine residues.

[0126] In one embodiment, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, at least twenty one, at least twenty two, at least twenty three, at least twenty four, or all or substantially all of functional human D gene segments have inverted orientation with respect to corresponding wild type sequences.

[0127] In one embodiment, all or substantially all of endogenous immunoglobulin V.sub.H, D, J.sub.H gene segments are deleted from the immunoglobulin heavy chain locus or rendered non-functional (e.g., via insertion of a nucleotide sequence, e.g., exogenous nucleotide sequence, in the immunoglobulin locus or via non-functional rearrangement or inversion of all, or substantially all, endogenous immunoglobulin V.sub.H, D, J.sub.H segments), and the genetically modified immunoglobulin locus comprises a human V.sub.H, D, and J.sub.H gene segments, wherein at least one human D gene segment is present in an inverted orientation with respect to a corresponding wild type sequence, and wherein at least one reading frame in the inverted human D gene segment comprises at least one histidine codon.

[0128] In one embodiment, the inverted human D gene segment is operably linked to a human V.sub.H gene segment, and/or human J.sub.H gene segment

[0129] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is selected from the group consisting of D1-1, D1-7, D1-20, D1-26, D2-2, D2-8, D2-15, D2-21, D3-3, D3-9, D3-10, D3-16, D3-22, D4-4, D4-11, D4-17, D4-23, D5-5, D5-12, D5-18, D5-24, D6-6, D6-13, D6-19, D7-27, and a combination thereof.

[0130] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D1 gene segment selected from the group consisting of D1-1, D1-7, D1-20, D1-26, and a combination thereof.

[0131] In one embodiment, the human D gene segment that is present in the inverted orientation relative a corresponding wild type sequence is a D2 gene segment selected from the group consisting of D2-2, D2-8, D2-15, D2-21, and a combination thereof.

[0132] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D3 gene segment selected from the group consisting of D3-3, D3-9, D3-10, D3-16, D3-22, and a combination thereof.

[0133] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D4 gene segment selected from the group consisting of D4-4, D4-11, D4-17, D4-23, and a combination thereof.

[0134] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D5 gene segment selected from the group consisting of D5-5, D5-12, D5-18, D5-24, and a combination thereof.

[0135] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D6 gene segment selected from the group consisting of D6-6, D6-13, D6-19, and a combination thereof.

[0136] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is D7-27.

[0137] In one embodiment, the reading frame of the human D gene segment is selected from a stop reading frame, a hydrophilic reading frame, and a hydrophobic reading frame, and at least one reading frame of the inverted human D gene segment comprises one or more histidine codon.

[0138] In one embodiment, the unrearranged heavy chain variable region nucleotide sequence comprising the inverted human D gene segment is operably linked to a human or non-human heavy chain constant region nucleotide sequence that encodes an immunoglobulin isotype selected from IgM, IgD, IgG, IgE, and IgA.

[0139] In one embodiment, the unrearranged heavy chain variable region nucleotide sequence comprising the inverted human D gene segment is operably linked to a human or non-human heavy chain constant region nucleotide sequence that encodes an immunoglobulin isotype selected from IgM, IgD, IgG, IgE, and IgA.

[0140] In one embodiment, the human unrearranged immunoglobulin heavy chain variable region nucleotide sequence is operably linked to a human or non-human heavy chain constant region nucleotide sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3, and a combination thereof. In one embodiment, the heavy chain constant region nucleotide sequence comprises a C.sub.H1, a hinge, a C.sub.H2, and a C.sub.H3 (i.e., C.sub.H1-hinge-C.sub.H2-C.sub.H3).

[0141] In one embodiment, a heavy chain constant region nucleotide sequence is present at an endogenous locus (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome), or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome.

[0142] In one embodiment, the heavy chain constant region nucleotide sequence comprises a modification in a C.sub.H2 or a C.sub.H3, wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0143] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a modification at position 250 (e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K) and/or 434 (e.g., H/F or Y); or a modification at position 250 and/or 428; or a modification at position 307 or 308 (e.g., 308F, V308F), and 434. In one embodiment, the modification comprises a 428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L, 259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K (e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and 256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L modification (e.g., T250Q and M428L); and a 307 and/or 308 modification (e.g., 308F or 308P), wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0144] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 252 and 257, wherein the modification increases the affinity of the human C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0145] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 307 and 311, wherein the modification increases the affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0146] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H3 amino acid sequence, wherein the C.sub.H3 amino acid sequence comprises at least one modification between amino acid residues at positions 433 and 436, wherein the modification increases the affinity of the C.sub.H3 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0147] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, N434S, and a combination thereof.

[0148] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, V259I, V308F, and a combination thereof.

[0149] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising an N434A mutation.

[0150] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M252Y, S254T, T256E, and a combination thereof.

[0151] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of T250Q, M248L, or both.

[0152] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of H433K, N434Y, or both.

[0153] In one embodiment, the genetically modified immunoglobulin locus comprises: (1) a first allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a first heavy chain constant region nucleotide sequence encoding a first CH.sub.3 amino acid sequence of a human IgG selected from IgG1, IgG2, IgG4, and a combination thereof; and (2) a second allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a second heavy chain constant region nucleotide sequence encoding a second C.sub.H3 amino acid sequence of the human IgG selected from IgG1, IgG2, IgG4, and a combination thereof, and wherein the second CH.sub.3 amino acid sequence comprises a modification that reduces or eliminates binding for the second CH.sub.3 amino acid sequence to Protein A (see, for example, US 2010/0331527A1, incorporated by reference herein in its entirety).

[0154] In one embodiment, the second CH.sub.3 amino acid sequence comprises an H95R modification (by IMGT exon numbering; H435R by EU numbering). In one embodiment the second CH.sub.3 amino acid sequence further comprises an Y96F modification (by IMGT exon numbering; H436F by EU). In another embodiment, the second CH.sub.3 amino acid sequence comprises both an H95R modification (by IMGT exon numbering; H435R by EU numbering) and an Y96F modification (by IMGT exon numbering; H436F by EU).

[0155] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG1 and further comprises a mutation selected from the group consisting of D16E, L18M, N44S, K52N, V57M, and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by EU).

[0156] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG2 and further comprises a mutation selected from the group consisting of N44S, K52N, and V82I (IMGT: N384S, K392N, and V422I by EU).

[0157] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG4 and further comprises a mutation selected from the group consisting of Q15R, N44S, K52N, V57M, R69K, E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and V422I by EU).

[0158] In one embodiment, the heavy chain constant region amino acid sequence is a non-human constant region amino acid sequence, and the heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0159] In one embodiment, the heavy chain constant region nucleotide sequence is a human heavy chain constant region amino acid sequence, and the human heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0160] In one embodiment, all, or substantially all, endogenous V.sub.H, D, and J.sub.H gene segments are deleted from an immunoglobulin heavy chain locus or rendered non-functional (e.g., via insertion of a nucleotide sequence (e.g., an exogenous nucleotide sequence) in the immunoglobulin locus or via non-functional rearrangement, or inversion, of the endogenous V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments are deleted or rendered non-functional. In one embodiment, e.g., at least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or J gene segments are deleted or rendered non-functional.

[0161] In one embodiment, the genetically modified immunoglobulin heavy chain locus comprises a modification that deletes or renders non-functional, all or substantially all, endogenous V.sub.H, D, and J.sub.H gene segments; and the genetically modified locus comprises an unrearranged heavy chain variable region nucleotide sequence comprising at least one inverted human D gene segment as described herein wherein the unrearranged heavy chain variable region nucleotide sequence is present at an endogenous location (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome, or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome).

[0162] In one embodiment, the genetically modified immunoglobulin locus comprises an endogenous Adam6a gene, Adam6b gene, or both, and the genetic modification does not affect the expression and/or function of the endogenous Adam6a gene, Adam6b gene, or both.

[0163] [000163] In one embodiment, the genetically modified immunoglobulin locus comprises an ectopically present Adam6a gene, Adam6b gene, or both. In one embodiment, the Adam6a gene is a non-human Adam6a gene. In one embodiment, the Adam6a gene is a mouse Adam6a gene. In one embodiment, the Adam6a gene is a human Adam6a gene. In one embodiment, the Adam6b gene is a non-human Adam6b gene. In one embodiment, the Adam6b gene is a mouse Adam6b gene. In one embodiment, the Adam6b gene is a human Adam6b gene.

[0164] In one embodiment, the genetically modified immunoglobulin locus further comprises a humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence. In one embodiment, the humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence is operably linked to an immunoglobulin light chain constant region nucleotide sequence selected from a .lamda. light chain constant region nucleotide sequence and a .kappa. light chain constant region nucleotide sequence. In one embodiment, the humanized, unrearranged .lamda. light chain variable region nucleotide sequence is operably linked to a .lamda. light chain constant region nucleotide sequence. In one embodiment, the .lamda. light chain constant region nucleotide sequence is a mouse, rat, or human sequence. In one embodiment, the humanized, unrearranged .kappa. light chain variable region nucleotide sequence is operably linked to a .kappa. light chain constant region nucleotide sequence. In one embodiment, the .kappa. light chain constant region nucleotide sequence is a mouse, rat, or human sequence.

[0165] In one embodiment, the genetically modified immunoglobulin locus comprises an unrearranged light chain variable gene sequence that contains at least one modification that introduces at least one histidine codon in at least one reading frame encoding a light chain variable domain. In one embodiment, the genetically modified immunoglobulin locus comprises a rearranged (e.g., a rearranged .lamda. or .kappa. V/J sequence) sequence that comprises one, two, three, or four codons for histidine in a light chain CDR. In one embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a combination thereof. In one embodiment, the unrearranged or rearranged light chain variable region nucleotide sequence is an unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence. In one embodiment, the unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence is present at an endogenous mouse immunoglobulin light chain locus. In one embodiment, the mouse immunoglobulin light chain locus is a mouse .kappa. locus. In one embodiment, the mouse immunoglobulin light chain locus is a mouse immunoglobulin light chain locus is a mouse .lamda. locus.

[0166] In one embodiment, the genetically modified immunoglobulin locus as described herein is present in an immunoglobulin heavy chain locus of a mouse. In one embodiment, the genetically modified immunoglobulin locus is present in a humanized immunoglobulin heavy chain locus in a VELOCIMMUNE.RTM. mouse.

[0167] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein exhibits a weaker antigen binding at an acidic environment (e.g., at a pH of about 5.5 to about 6.0) than a corresponding wild-type heavy chain variable domain without the genetic modification.

[0168] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein has at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, or at least about 30-fold decrease in dissociative half-life (t.sub.1/2) at an acidic pH (e.g., pH of about 5.5 to about 6.0) as compared to the dissociative half-life (t.sub.1/2) of the antigen-binding protein at a neutral pH (e.g., pH of about 7.0 to about 7.4).

[0169] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein is characterized by improved pH-dependent recyclability, enhanced serum half-life, or both as compared with a wild-type antigen-binding protein without the genetic modification.

[0170] In one embodiment, the genetically modified immunoglobulin locus described herein comprises a B cell population that, upon stimulation with an antigen of interest, is capable of producing antigen-binding proteins, e.g., antibodies, comprising a heavy chain variable domain comprising one or more histidine residues. The antigen-binding proteins as described herein when administered into a subject, exhibits an increased serum half-life over a corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain. In some embodiments, the antigen-binding protein described herein exhibits an increased serum half-life that is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold higher than the corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain.

[0171] In one aspect, a non-human animal is provided comprising in its germline genome a genetically modified immunoglobulin locus comprising an unrearranged human heavy chain variable region nucleotide sequence, wherein the unrearranged heavy chain variable region nucleotide sequence comprises an addition of least one histidine codon or a substitution of at least one endogenous non-histidine codon with a histidine codon.

[0172] In one embodiment, the non-human animal is a mammal, including a rodent, e.g., a mouse, a rat, or a hamster.

[0173] In one embodiment, the added or substituted histidine codon is present in an immunoglobulin heavy chain gene segment selected from a human V.sub.H gene segment, a human D gene segment, a human J.sub.H gene segment, and a combination thereof. In one embodiment, the immunoglobulin heavy chain gene segment is selected from a human germline V.sub.H gene segment, a human germline D gene segment, a human germline J.sub.H gene segment, and a combination thereof.

[0174] In one embodiment, the human V.sub.H gene segment is selected from the group consisting of V.sub.H1-2, V.sub.H1-3, V.sub.H1-8, V.sub.H1-18, V.sub.H1-24, V.sub.H1-45, V.sub.H1-46, V.sub.H1-58, V.sub.H1-69, V.sub.H2-5, V.sub.H2-26, V.sub.H2-70, V.sub.H3-7, V.sub.H3-9, V.sub.H3-11, V.sub.H3-13, V.sub.H3-15, V.sub.H3-16, V.sub.H3-20, V.sub.H3-21, V.sub.H3-23, V.sub.H3-30, V.sub.H3-30-3, V.sub.H 3-30-5, V.sub.H3-33, V.sub.H3-35, V.sub.H3-38, V.sub.H3-43, V.sub.H3-48, V.sub.H3-49, V.sub.H3-53, V.sub.H3-64, V.sub.H3-66, V.sub.H3-72, V.sub.H3-73, V.sub.H3-74, V.sub.H4-4, V.sub.H4-28, V.sub.H4-30-1, V.sub.H4-30-2, V.sub.H4-30-4, V.sub.H4-31, V.sub.H4-34, V.sub.H4-39, V.sub.H4-59, V.sub.H4-61, V.sub.H5-51, V.sub.H6-1, V.sub.H7-4-1, V.sub.H7-81, and a combination thereof.

[0175] In one embodiment, the human D gene segment is selected from the group consisting of D1-1, D1-7, D1-14, D1-20, D1-26, D2-2, D2-8, D2-15, D2-21, D3-3, D3-9, D3-10, D3-16, D3-22, D4-4, D4-11, D4-17, D4-23, D5-12, D5-5, D5-18, D5-24, D6-6, D6-13, D6-19, D6-25, D7-27, and a combination thereof.

[0176] In one embodiment, the human J.sub.H gene segment is selected from the group consisting of J.sub.H1, J.sub.H2, J.sub.H3, J.sub.H4, J.sub.H5, J.sub.H6, and a combination thereof.

[0177] In one embodiment, the added or substituted histidine codon is present in the unrearranged heavy chain variable region nucleotide sequence encoding an N-terminal region, a loop 4 region, a CDR1, a CDR2, a CDR3, or a combination thereof.

[0178] In one embodiment, the unrearranged heavy chain variable region nucleotide sequence comprises 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, or 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or more, 34 or more 35 or more, 36 or more, 37 or more, 38 or more, 39 or more, 40 or more, 41 or more, 42 or more, 43 or more, 44 or more, 45 or more, 46 or more, 47 or more, 48 or more, 49 or more, 50 or more, 51 or more, 52 or more, 53 or more, 54 or more, 55 or more, 56 or more, 57 or more, 58 or more, 59 or more, 60 or more, or 61 or more of histidine codons.

[0179] In one embodiment, the unrearranged heavy chain variable region nucleotide sequence comprising the inverted human D gene segment is operably linked to a human or non-human heavy chain constant region nucleotide sequence that encodes an immunoglobulin isotype selected from IgM, IgD, IgG, IgE, and IgA.

[0180] In one embodiment, the human unrearranged immunoglobulin heavy chain variable region nucleotide sequence is operably linked to a human or non-human heavy chain constant region nucleotide sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3, and a combination thereof. In one embodiment, the heavy chain constant region nucleotide sequence comprises a C.sub.H1, a hinge, a C.sub.H2, and a C.sub.H3 (i.e., C.sub.H1-hinge-C.sub.H2-C.sub.H3).

[0181] In one embodiment, a heavy chain constant region nucleotide sequence is present at an endogenous locus (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome), or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome.

[0182] In one embodiment, the heavy chain constant region nucleotide sequence comprises a modification in a C.sub.H2 or a C.sub.H3, wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0183] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a modification at position 250 (e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K) and/or 434 (e.g., H/F or Y); or a modification at position 250 and/or 428; or a modification at position 307 or 308 (e.g., 308F, V308F), and 434. In one embodiment, the modification comprises a 428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L, 259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K (e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and 256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L modification (e.g., T250Q and M428L); and a 307 and/or 308 modification (e.g., 308F or 308P), wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0184] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 252 and 257, wherein the modification increases the affinity of the human C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0185] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 307 and 311, wherein the modification increases the affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0186] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H3 amino acid sequence, wherein the C.sub.H3 amino acid sequence comprises at least one modification between amino acid residues at positions 433 and 436, wherein the modification increases the affinity of the C.sub.H3 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0187] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, N434S, and a combination thereof.

[0188] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, V259I, V308F, and a combination thereof.

[0189] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising an N434A mutation.

[0190] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M252Y, S254T, T256E, and a combination thereof.

[0191] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of T250Q, M248L, or both.

[0192] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of H433K, N434Y, or both.

[0193] In one embodiment, the genetically modified immunoglobulin locus comprises: (1) a first allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a first heavy chain constant region nucleotide sequence encoding a first CH.sub.3 amino acid sequence of a human IgG selected from IgG1, IgG2, IgG4, and a combination thereof; and (2) a second allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a second heavy chain constant region nucleotide sequence encoding a second C.sub.H3 amino acid sequence of the human IgG selected from IgG1, IgG2, IgG4, and a combination thereof, and wherein the second CH.sub.3 amino acid sequence comprises a modification that reduces or eliminates binding for the second CH.sub.3 amino acid sequence to Protein A (see, for example, US 2010/0331527A1, which is incorporated by reference herein in its entirety).

[0194] In one embodiment, the second CH.sub.3 amino acid sequence comprises an H95R modification (by IMGT exon numbering; H435R by EU numbering). In one embodiment the second CH.sub.3 amino acid sequence further comprises an Y96F modification (by IMGT exon numbering; H436F by EU). In another embodiment, the second CH.sub.3 amino acid sequence comprises both an H95R modification (by IMGT exon numbering; H435R by EU numbering) and an Y96F modification (by IMGT exon numbering; H436F by EU).

[0195] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG1 and further comprises a mutation selected from the group consisting of D16E, L18M, N44S, K52N, V57M, and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by EU).

[0196] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG2 and further comprises a mutation selected from the group consisting of N44S, K52N, and V82I (IMGT: N384S, K392N, and V422I by EU).

[0197] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG4 and further comprises a mutation selected from the group consisting of Q15R, N44S, K52N, V57M, R69K, E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and V422I by EU).

[0198] In one embodiment, the heavy chain constant region amino acid sequence is a non-human constant region amino acid sequence, and the heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0199] In one embodiment, the heavy chain constant region nucleotide sequence is a human heavy chain constant region amino acid sequence, and the human heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0200] In one embodiment, all or substantially all endogenous V.sub.H, D, and J.sub.H gene segments are deleted from an immunoglobulin heavy chain locus or rendered non-functional (e.g., via insertion of a nucleotide sequence (e.g., an exogenous nucleotide sequence) in the immunoglobulin locus or via non-functional rearrangement, or inversion, of the endogenous V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments are deleted or rendered non-functional. In one embodiment, e.g., at least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or J gene segments are deleted or rendered non-functional.

[0201] In one embodiment, the genetically modified immunoglobulin heavy chain locus comprises a modification that deletes or renders, all or substantially all, non-functional endogenous V.sub.H, D, and J.sub.H gene segments; and the genetically modified locus comprises an unrearranged heavy chain variable region nucleotide sequence comprising one or more human V.sub.H, D, and/or J.sub.H gene segments having one or more histidine codons, wherein the unrearranged heavy chain variable region nucleotide sequence is present at an endogenous location (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome, or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome).

[0202] In one embodiment, the genetically modified immunoglobulin locus comprises an endogenous Adam6a gene, Adam6b gene, or both, and the genetic modification does not affect the expression and/or function of the endogenous Adam6a gene, Adam6b gene, or both.

[0203] In one embodiment, the genetically modified immunoglobulin locus comprises an ectopically present Adam6a gene, Adam6b gene, or both. In one embodiment, the Adam6a gene is a non-human Adam6a gene. In one embodiment, the Adam6a gene is a human Adam6a gene. In one embodiment, the Adam6b gene is a non-human Adam6b gene. In one embodiment, the Adam6b gene is a human Adam6b gene.

[0204] In one embodiment, the genetically modified immunoglobulin locus further comprises a humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence. In one embodiment, the humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence is operably linked to an immunoglobulin light chain constant region nucleotide sequence selected from a .lamda. light chain constant region nucleotide sequence and a .kappa. light chain constant region nucleotide sequence. In one embodiment, the humanized, unrearranged .lamda. light chain variable region nucleotide sequence is operably linked to a .lamda. light chain constant region nucleotide sequence. In one embodiment, the .lamda. light chain constant region nucleotide sequence is a mouse, rat, or human sequence. In one embodiment, the humanized, unrearranged .kappa. light chain variable region nucleotide sequence is operably linked to a .kappa. light chain constant region nucleotide sequence. In one embodiment, the .kappa. light chain constant region nucleotide sequence is a mouse, rat, or human sequence.

[0205] In one embodiment, the genetically modified immunoglobulin locus comprises an unrearranged light chain variable gene sequence that contains at least one modification that introduces at least one histidine codon in at least one reading frame encoding a light chain variable domain. In one embodiment, the genetically modified immunoglobulin locus comprises a rearranged (e.g., a rearranged .lamda. or .kappa. V/J sequence) sequence that comprises one, two, three, or four codons for histidine in a light chain CDR. In one embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a combination thereof. In one embodiment, the unrearranged or rearranged light chain variable region nucleotide sequence is an unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence. In one embodiment, the unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence is present at an endogenous mouse immunoglobulin light chain locus. In one embodiment, the mouse immunoglobulin light chain locus is a mouse .kappa. locus. In one embodiment, the mouse immunoglobulin light chain locus is a mouse .lamda. locus.

[0206] In one embodiment, the genetically modified immunoglobulin locus as described herein is present in an immunoglobulin heavy chain locus of a mouse. In one embodiment, the genetically modified immunoglobulin locus is present in a humanized immunoglobulin heavy chain locus in a VELOCIMMUNE.RTM. mouse.

[0207] In one embodiment, the non-human animal is heterozygous for the genetically modified immunoglobulin heavy chain locus, and the non-human animal is capable of expressing a human immunoglobulin heavy chain variable domain comprising at least one histidine residue derived predominantly from the genetically modified immunoglobulin heavy chain locus as described herein.

[0208] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein exhibits a weaker antigen binding at an acidic environment (e.g., at a pH of about 5.5 to about 6.0) than a corresponding wild-type heavy chain variable domain without the genetic modification.

[0209] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein has at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, or at least about 30-fold decrease in dissociative half-life (t.sub.1/2) at an acidic pH (e.g., pH of about 5.5 to about 6.0) as compared to the dissociative half-life (t.sub.1/2) of the antigen-binding protein at a neutral pH (e.g., pH of about 7.0 to about 7.4).

[0210] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein is characterized by improved pH-dependent recyclability, enhanced serum half-life, or both as compared with a wild-type antigen-binding protein without the genetic modification.

[0211] In one embodiment, the genetically modified immunoglobulin locus described herein comprises a B cell population that, upon stimulation with an antigen of interest, is capable of producing antigen-binding proteins, e.g., antibodies, comprising a heavy chain variable domain comprising one or more histidine residues. The antigen-binding proteins as described herein when administered into a subject, exhibits an increased serum half-life over a corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain. In some embodiments, the antigen-binding protein described herein exhibits an increased serum half-life that is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold higher than the corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain.

[0212] In one aspect, a non-human animal comprising a genetically modified immunoglobulin locus is provided, wherein the genetically modified immunoglobulin locus comprises an unrearranged human heavy chain variable region nucleotide sequence, and wherein the human unrearranged heavy chain variable region nucleotide sequence comprises a substitution of at least one endogenous non-histidine codon with a histidine codon.

[0213] In one embodiment, the non-human animal is a mammal, including a rodent, e.g., a mouse, a rat, or a hamster.

[0214] In one embodiment, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or more, 34 or more, 35 or more, 36 or more, 37 or more, 38 or more, 39 or more, 40 or more, 41 or more, 42 or more, 43 or more, 44 or more, 45 or more, 46 or more, 47 or more, 48 or more, 49 or more, 50 or more, 51 or more, 52 or more, 53 or more, 54 or more, 55 or more, 56 or more, 57 or more, 58 or more, 59 or more, 60 or more, or 61 or more of the endogenous non-histidine codons are replaced with histidine codons.

[0215] In one embodiment, the endogenous non-histone codon encodes the amino acid selected from Y, N, D, Q, S, W, and R.

[0216] In one embodiment, the substituted histidine codon is present in an unrearranged heavy chain variable region nucleotide sequence that encodes an immunoglobulin variable domain selected from an N-terminal region, a loop 4 region, a CDR1, a CDR2, a CDR3, a combination thereof.

[0217] In one embodiment, the substituted histidine codon is present in an unrearranged heavy chain variable region nucleotide sequence that encodes a complementary determining region (CDR) selected from a CDR1, a CDR2, a CDR3, and a combination thereof.

[0218] In one embodiment, the substituted histidine codon is present in an unrearranged heavy chain variable region nucleotide sequence that encodes a frame region (FR) selected from FR1, FR2, FR3, FR4, and a combination thereof.

[0219] In one embodiment, the unrearranged heavy chain variable region nucleotide sequence comprises a genetically modified human V.sub.H gene segment, wherein one or more endogenous non-histidine codon in at least one reading frame of the human V.sub.H gene segment has been replaced with a histidine codon.

[0220] In one embodiment, the human unrearranged heavy chain variable region nucleotide sequence comprises a modification that replaces at least one endogenous non-histidine codon of a human V.sub.H gene segment with a histidine codon, wherein the human V.sub.H gene segment is selected from the group consisting of V.sub.H1-2, V.sub.H1-3, V.sub.H1-8, V.sub.H1-18, V.sub.H1-24, V.sub.H1-45, V.sub.H1-46, V.sub.H1-58, V.sub.H1-69, V.sub.H2-5, V.sub.H2-26, V.sub.H2-70, V.sub.H3-7, V.sub.H3-9, V.sub.H3-11, V.sub.H3-13, V.sub.H3-15, V.sub.H3-16, V.sub.H3-20, V.sub.H3-21, V.sub.H3-23, V.sub.H3-30, V.sub.H3-30-3, V.sub.H 3-30-5, V.sub.H3-33, V.sub.H3-35, V.sub.H3-38, V.sub.H3-43, V.sub.H3-48, V.sub.H3-49, V.sub.H3-53, V.sub.H3-64, V.sub.H3-66, V.sub.H3-72, V.sub.H3-73, V.sub.H3-74, V.sub.H4-4, V.sub.H4-28, V.sub.H4-30-1, V.sub.H4-30-2, V.sub.H4-30-4, V.sub.H4-31, V.sub.H4-34, V.sub.H4-39, V.sub.H4-59, V.sub.H4-61, V.sub.H5-51, V.sub.H6-1, V.sub.H7-4-1, V.sub.H7-81, and a combination thereof.

[0221] In one embodiment, the human unrearranged heavy chain variable region nucleotide sequence comprises a genetically modified human J.sub.H gene segment, wherein one or more endogenous non-histidine codon in at least one reading frame of the human J.sub.H gene segment has been replaced with a histidine codon.

[0222] In one embodiment, the human unrearranged heavy chain variable region nucleotide sequence comprises a modification that replaces at least one endogenous non-histidine codon of a human J.sub.H segment with a histidine codon, wherein the human J.sub.H gene segment is selected from the group consisting of J.sub.H1, J.sub.H2, J.sub.H3, J.sub.H4, J.sub.H5, J.sub.H6, and a combination thereof.

[0223] In one embodiment, the substituted histidine codon is present in a heavy chain variable region nucleotide sequence that encodes part of a CDR3. In one embodiment, the part of CDR3 comprises an amino acid sequence derived from a reading frame of a genetically modified human D gene segment comprising a modification that replaces at least one endogenous non-histidine codon in the reading frame with a histidine codon.

[0224] In one embodiment, the endogenous non-histidine codon that is substituted with a histidine codon encodes the amino acid selected from Y, N, D, Q, S, W, and R.

[0225] In one embodiment, the substituted histidine codon is present in at least one reading frame of the human D gene segment that is most frequently observed in VELOCIMMUNE.RTM. humanized immunoglobulin mice.

[0226] In one embodiment, the reading frame of the genetically modified human D gene segment that encodes part of CDR3 is selected from a hydrophobic frame, a stop frame, and a hydrophilic frame.

[0227] In one embodiment, the reading frame is a hydrophobic frame of a human D gene segment.

[0228] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D1-1 (GTTGT; SEQ ID NO: 88), D1-7 (GITGT; SEQ ID NO: 89), D1-20 (GITGT; SEQ ID NO: 89), and D1-26 (GIVGAT; SEQ ID NO:90), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0229] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D2-2 (DIVVVPAAI; SEQ ID NO:92), D2-8 (DIVLMVYAI; SEQ ID NO: 94), D2-15 (DIVVVVAAT; SEQ ID NO:95), and D2-21 (HIVVVTAI; SEQ ID NO: 97), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0230] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D3-3 (ITIFGVVII; SEQ ID NO:98), D3-9 (ITIF*LVII; SEQ ID NO:99, SEQ ID NO:100), D3-10 (ITMVRGVII; SEQ ID NO:101), D3-16 (IMITFGGVIVI; SEQ ID NO:102), and D3-22 (ITMIVVVIT; SEQ ID NO:103), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon.

[0231] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D4-4 (TTVT; SEQ ID NO:105), D4-11 (TTVT; SEQ ID NO:105), D4-17 (TTVT; SEQ ID NO:105), D4-23 (TTVVT; SEQ ID NO: 106) and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0232] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D5-5 (VDTAMV; SEQ ID NO: 107), D5-12 (VDIVATI; SEQ ID NO:108), D5-18 (VDTAMV; SEQ ID NO:107), and D5-24 (VEMATI; SEQ ID NO:109), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0233] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D6-6 (SIAAR; SEQ ID NO:111), D6-13 (GIAAAG; SEQ ID NO:113), and D6-19 (GIAVAG; SEQ ID NO:115), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0234] In one embodiment, the hydrophobic frame comprises a nucleotide sequence that encodes human D7-27 (LTG), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0235] In one embodiment, the reading frame is a stop reading frame of a human D gene segment.

[0236] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D1-1 (VQLER; SEQ ID NO:8), D1-7(V*LEL), D1-20(V*LER), D1-26 (V*WELL; SEQ ID NO:12), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0237] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D2-2 (RIL**YQLLY; SEQ ID NO:14), D2-8 (RILY*WCMLY; SEQ ID NO:16 and SEQ ID NO: 17), D2-15 (RIL*WW*LLL), and D2-21 (SILWW*LLF; SEQ ID NO:19), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0238] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D3-3 (VLRFLEWLLY; SEQ ID NO:21), D3-9 (VLRYFDWLL*; SEQ ID NO:23), D3-10 (VLLWFGELL*; SEQ ID NO:25), D3-16 (VL*LRLGELSLY; SEQ ID NO:27), and D3-22 (VLL***WLLL; SEQ ID NO:29), and the human D gene segment comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0239] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D4-4 (*LQ*L), D4-11 (*LQ*L), D4-17 (*LR*L), and D4-23 (*LRW*L), and the human D gene segment comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0240] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D5-5 (WIQLWL; SEQ ID NO:35); D5-12 (Wl*WLRL; SEQ ID NO:37), D5-18 (WIQLWL; SEQ ID NO:35), and D5-24 (*RWLQL; SEQ ID NO:39), and the human D gene segment comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0241] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D6-6 (V*QLV), D6-13 (V*QQLV; SEQ ID NO:41), and D6-19 (V*QWLV; SEQ ID NO:43), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0242] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes D7-27 (*LG), and the human D gene segment further comprises a modification that replaces at least one endogenous codon of the human D gene segment in the nucleotide sequence with a histidine codon.

[0243] In one embodiment, the reading frame is a hydrophilic frame of a human D gene segment.

[0244] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D1-1 (YNWND; SEQ ID NO: 45), D1-7 (YNWNY; SEQ ID NO: 47), D1-20 (YNWND; SEQ ID NO: 45), and D1-26 (YSGSYY; SEQ ID NO:49), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, and a combination thereof.

[0245] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D2-2 (GYCSSTSCYT; SEQ ID NO:51), D2-8 (GYCTNGVCYT; SEQ ID NO: 53), D2-15 (GYCSGGSCYS; SEQ ID NO:55), and D2-21 (AYCGGDCYS; SEQ ID NO:57), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, and a combination thereof.

[0246] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D3-3 (YYDFWSGYYT; SEQ ID NO:59), D3-9 (YYDILTGYYN; SEQ ID NO:61), D3-10 (YYYGSGSYYN; SEQ ID NO:63), D3-16 (YYDYVWGSYRYT; SEQ ID NO:65), and D3-22 (YYYDSSGYYY; SEQ ID NO:67), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and a combination thereof.

[0247] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D4-4 (DYSNY; SEQ ID NO:69), D4-11 (DYSNY; SEQ ID NO:69), D4-17 (DYGDY; SEQ ID NO:71), and D4-23 (DYGGNS; SEQ ID NO:73), and the human D gene segment comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, and a combination thereof.

[0248] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D5-5 (GYSYGY; SEQ ID NO:75), D5-12 (GYSGYDY; SEQ ID NO:77), D5-18 (GYSYGY; SEQ ID NO:75), and D5-24 (RDGYNY; SEQ ID NO:79), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, and a combination thereof.

[0249] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D6-6 (EYSSSS; SEQ ID NO: 81), D6-13 (GYSSSWY; SEQ ID NO:83), and D6-19 (GYSSGWY; SEQ ID NO:85), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 76, and a combination thereof.

[0250] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes D7-27 (NWG), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence a histidine codon.

[0251] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, and a combination thereof.

[0252] In one embodiment, the unrearranged heavy chain variable region nucleotide sequence comprising the inverted human D gene segment is operably linked to a human or non-human heavy chain constant region nucleotide sequence that encodes an immunoglobulin isotype selected from IgM, IgD, IgG, IgE, and IgA.

[0253] In one embodiment, the human unrearranged immunoglobulin heavy chain variable region nucleotide sequence is operably linked to a human or non-human heavy chain constant region nucleotide sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3, and a combination thereof. In one embodiment, the heavy chain constant region nucleotide sequence comprises a C.sub.H1, a hinge, a C.sub.H2, and a C.sub.H3 (i.e., C.sub.H1-hinge-C.sub.H2-C.sub.H3).

[0254] In one embodiment, a heavy chain constant region nucleotide sequence is present at an endogenous locus (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome, or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome).

[0255] In one embodiment, the heavy chain constant region nucleotide sequence comprises a modification in a C.sub.H2 or a C.sub.H3, wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0256] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a modification at position 250 (e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K) and/or 434 (e.g., H/F or Y); or a modification at position 250 and/or 428; or a modification at position 307 or 308 (e.g., 308F, V308F), and 434. In one embodiment, the modification comprises a 428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L, 259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K (e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and 256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L modification (e.g., T250Q and M428L); and a 307 and/or 308 modification (e.g., 308F or 308P), wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0257] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 252 and 257, wherein the modification increases the affinity of the human C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0258] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 307 and 311, wherein the modification increases the affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0259] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H3 amino acid sequence, wherein the C.sub.H3 amino acid sequence comprises at least one modification between amino acid residues at positions 433 and 436, wherein the modification increases the affinity of the C.sub.H3 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0260] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, N434S, and a combination thereof.

[0261] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, V259I, V308F, and a combination thereof.

[0262] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising an N434A mutation.

[0263] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M252Y, S254T, T256E, and a combination thereof.

[0264] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of T250Q, M248L, or both.

[0265] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of H433K, N434Y, or both.

[0266] In one embodiment, the genetically modified immunoglobulin locus comprises: (1) a first allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a first heavy chain constant region nucleotide sequence encoding a first CH.sub.3 amino acid sequence of a human IgG selected from IgG1, IgG2, IgG4, and a combination thereof; and (2) a second allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a second heavy chain constant region nucleotide sequence encoding a second C.sub.H3 amino acid sequence of the human IgG selected from IgG1, IgG2, IgG4, and a combination thereof, and wherein the second CH.sub.3 amino acid sequence comprises a modification that reduces or eliminates binding for the second CH.sub.3 amino acid sequence to Protein A (see, for example, US 2010/0331527A1, which is incorporated by reference herein in its entirety).

[0267] In one embodiment, the second CH.sub.3 amino acid sequence comprises an H95R modification (by IMGT exon numbering; H435R by EU numbering). In one embodiment the second CH.sub.3 amino acid sequence further comprises an Y96F modification (by IMGT exon numbering; H436F by EU). In another embodiment, the second CH.sub.3 amino acid sequence comprises both an H95R modification (by IMGT exon numbering; H435R by EU numbering) and an Y96F modification (by IMGT exon numbering; H436F by EU).

[0268] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG1 and further comprises a mutation selected from the group consisting of D16E, L18M, N44S, K52N, V57M, and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by EU).

[0269] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG2 and further comprises a mutation selected from the group consisting of N44S, K52N, and V82I (IMGT: N384S, K392N, and V422I by EU).

[0270] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG4 and further comprises a mutation selected from the group consisting of Q15R, N44S, K52N, V57M, R69K, E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and V422I by EU).

[0271] In one embodiment, the heavy chain constant region amino acid sequence is a non-human constant region amino acid sequence, and the heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0272] In one embodiment, the heavy chain constant region nucleotide sequence is a human heavy chain constant region amino acid sequence, and the human heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0273] In one embodiment, all, or substantially all, endogenous V.sub.H, D, and J.sub.H gene segments are deleted from an immunoglobulin heavy chain locus or rendered non-functional (e.g., via insertion of a nucleotide sequence (e.g., an exogenous nucleotide sequence) in the immunoglobulin locus or via non-functional rearrangement, or inversion, of the endogenous V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments are deleted or rendered non-functional. In one embodiment, e.g., at least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or J gene segments are deleted or rendered non-functional.

[0274] In one embodiment, the genetically modified locus comprises a modification that deletes or renders non-functional all or substantially all endogenous V.sub.H, D, and J.sub.H gene segments; and the genomic locus comprises the genetically modified, unrearranged human heavy chain variable region nucleotide sequence comprising a substitution of at least one endogenous non-histidine codon with a histidine codon in at least one reading frame. In one embodiment, the genetically modified, unrearranged immunoglobulin heavy chain variable gene sequence is present at an endogenous location (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome), or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome.

[0275] In one embodiment, the genetically modified locus comprises an endogenous Adam6a gene, Adam6b gene, or both, and the genetic modification does not affect the expression and/or function of the endogenous Adam6a gene, Adam6b gene, or both.

[0276] In one embodiment, the genetically modified locus comprises an ectopically present Adam6a gene, Adam6b gene, or both. In one embodiment, the Adam6a gene is a non-human Adam6a gene. In one embodiment, the Adam6a gene is a mouse Adam6a gene. In one embodiment, the Adam6a gene is a human Adam6a gene. In one embodiment, the Adam6b gene is a non-human Adam6b gene. In one embodiment, the Adam6b gene is a mouse Adam6b gene. In one embodiment, the Adam6b gene is a human Adam6b gene.

[0277] In one embodiment, the genetically modified immunoglobulin locus further comprises a humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence. In one embodiment, the humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence is operably linked to an immunoglobulin light chain constant region nucleotide sequence selected from a .lamda. light chain constant region nucleotide sequence and a .kappa. light chain constant region nucleotide sequence. In one embodiment, the humanized, unrearranged .lamda. light chain variable region nucleotide sequence is operably linked to a .lamda. light chain constant region nucleotide sequence. In one embodiment, the .lamda. light chain constant region nucleotide sequence is a mouse, rat, or human sequence. In one embodiment, the humanized, unrearranged .kappa. light chain variable region nucleotide sequence is operably linked to a .kappa. light chain constant region nucleotide sequence. In one embodiment, the .kappa. light chain constant region nucleotide sequence is a mouse, rat, or human sequence.

[0278] In one embodiment, the genetically modified immunoglobulin locus comprises an unrearranged light chain variable gene sequence that contains at least one modification that introduces at least one histidine codon in at least one reading frame encoding a light chain variable domain. In one embodiment, the genetically modified immunoglobulin locus comprises a rearranged (e.g., rearranged .lamda. or .kappa. V/J sequence) sequence that comprises one, two, three, or four codons for histidine in a light chain CDR. In one embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a combination thereof. In one embodiment, the unrearranged or rearranged light chain variable region nucleotide sequence is an unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence. In one embodiment, the unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence is present at an endogenous mouse immunoglobulin light chain locus. In one embodiment, the mouse immunoglobulin light chain locus is a mouse .kappa. locus. In one embodiment the mouse immunoglobulin light chain locus is a mouse .lamda. locus.

[0279] In one embodiment, the genetically modified immunoglobulin locus as described herein is present in an immunoglobulin heavy chain locus of a mouse. In one embodiment, the genetically modified immunoglobulin locus is present in a humanized immunoglobulin heavy chain locus in a VELOCIMMUNE.RTM. mouse.

[0280] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein exhibits a weaker antigen binding at an acidic environment (e.g., at a pH of about 5.5 to about 6.0) than a corresponding wild-type heavy chain variable domain without the genetic modification.

[0281] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein has at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, or at least about 30-fold decrease in dissociative half-life (t.sub.1/2) at an acidic pH (e.g., pH of about 5.5 to about 6.0) as compared to the dissociative half-life (t.sub.1/2) of the antigen-binding protein at a neutral pH (e.g., pH of about 7.0 to about 7.4).

[0282] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein is characterized by improved pH-dependent recyclability, enhanced serum half-life, or both as compared with a wild-type antigen-binding protein without the genetic modification.

[0283] In one embodiment, the genetically modified immunoglobulin locus as described herein comprises a B cell population that, upon stimulation with an antigen of interest, is capable of producing antigen-binding proteins, e.g., antibodies, comprising a heavy chain variable domain comprising one or more histidine residues. The antigen-binding proteins as described herein, when administered into a subject, exhibits an increased serum half-life over a corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain. In some embodiments, the antigen-binding protein described herein exhibits an increased serum half-life that is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold higher than the corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain.

[0284] In one embodiment, the non-human animal is heterozygous for the genetically modified immunoglobulin heavy chain locus, and the non-human animal is capable of expressing the human immunoglobulin heavy chain variable domain comprising at least one histidine residue derived predominantly from the genetically modified immunoglobulin heavy chain locus as described herein.

[0285] In one aspect, a non-human animal comprising a genetically modified immunoglobulin locus comprising a human V.sub.H, D, and J.sub.H gene segment is provided, wherein at least one of the human D gene segment has been inverted 5' to 3' with respect to a corresponding wild-type sequence, and wherein at least one reading frame of the inverted human D gene segment comprises a histidine codon.

[0286] In one embodiment, the non-human animal is a mammal, including a rodent, e.g., a mouse, a rat, or a hamster

[0287] In one embodiment, the genetically modified immunoglobulin locus is present in a germline genome.

[0288] In one embodiment, wherein the reading frame of the inverted human D gene segment comprises one or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or more, or 34 or more of histidine codons.

[0289] In one embodiment, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, at least twenty one, at least twenty two, at least twenty three, at least twenty four, or all or substantially all of functional human D gene segments have inverted orientation with respect to corresponding wild type sequences.

[0290] In one embodiment, all or substantially all of endogenous immunoglobulin V.sub.H, D, J.sub.H gene segments are deleted from the immunoglobulin heavy chain locus or rendered non-functional (e.g., via insertion of a nucleotide sequence, e.g., exogenous nucleotide sequence, in the immunoglobulin locus or via non-functional rearrangement or inversion of all, or substantially all, endogenous immunoglobulin V.sub.H, D, J.sub.H segments), and the genetically modified immunoglobulin locus comprises a human V.sub.H, D, and J.sub.H gene segments, wherein at least one of the human D gene segment is present in an inverted orientation with respect to corresponding wild type sequences, and wherein at least one reading frame of the inverted human D gene segment comprises at least one histidine codon.

[0291] In one embodiment, the inverted human D gene segment is operably linked to a human V.sub.H gene segment, and/or human J.sub.H gene segment

[0292] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is selected from the group consisting of D1-1, D1-7, D1-20, D1-26, D2-2, D2-8, D2-15, D2-21, D3-3, D3-9, D3-10, D3-16, D3-22, D4-4, D4-11, D4-17, D4-23, D5-5, D5-12, D5-18, D5-24, D6-6, D6-13, D6-19, D7-27, and a combination thereof.

[0293] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D1 gene segment selected from the group consisting of D1-1, D1-7, D1-20, D1-26, and a combination thereof.

[0294] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequences is a D2 gene segment selected from the group consisting of D2-2, D2-8, D2-15, D2-21, and a combination thereof.

[0295] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D3 gene segment selected from the group consisting of D3-3, D3-9, D3-10, D3-16, D3-22, and a combination thereof.

[0296] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D4 gene segment selected from the group consisting of D4-4, D4-11, D4-17, D4-23, and a combination thereof.

[0297] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D5 gene segment selected from the group consisting of D5-5, D5-12, D5-18, D5-24, and a combination thereof.

[0298] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D6 gene segment selected from the group consisting of D6-6, D6-13, D6-19, and a combination thereof.

[0299] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is D7-27.

[0300] In one embodiment, the reading frame of the human D gene segment is selected from a stop reading frame, a hydrophilic reading frame, a hydrophobic reading frame, and a combination thereof, wherein at least one reading frame of the inverted human D gene segment comprises a histidine codon.

[0301] In one embodiment, the unrearranged heavy chain variable region nucleotide sequence comprising the inverted human D gene segment is operably linked to a human or non-human heavy chain constant region nucleotide sequence that encodes an immunoglobulin isotype selected from IgM, IgD, IgG, IgE, and IgA.

[0302] In one embodiment, the human unrearranged immunoglobulin heavy chain variable region nucleotide sequence is operably linked to a human or non-human heavy chain constant region nucleotide sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3, and a combination thereof. In one embodiment, the heavy chain constant region nucleotide sequence comprises a C.sub.H1, a hinge, a C.sub.H2, and a C.sub.H3 (i.e., C.sub.H1-hinge-C.sub.H2-C.sub.H3).

[0303] In one embodiment, a heavy chain constant region nucleotide sequence is present at an endogenous locus (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome, or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome).

[0304] In one embodiment, the heavy chain constant region nucleotide sequence comprises a modification in a C.sub.H2 or a C.sub.H3, wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0305] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a modification at position 250 (e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K) and/or 434 (e.g., H/F or Y); or a modification at position 250 and/or 428; or a modification at position 307 or 308 (e.g., 308F, V308F), and 434. In one embodiment, the modification comprises a 428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L, 259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K (e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and 256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L modification (e.g., T250Q and M428L); and a 307 and/or 308 modification (e.g., 308F or 308P), wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0306] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 252 and 257, wherein the modification increases the affinity of the human C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0307] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 307 and 311, wherein the modification increases the affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0308] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H3 amino acid sequence, wherein the C.sub.H3 amino acid sequence comprises at least one modification between amino acid residues at positions 433 and 436, wherein the modification increases the affinity of the C.sub.H3 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0309] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, N434S, and a combination thereof.

[0310] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, V259I, V308F, and a combination thereof.

[0311] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising an N434A mutation.

[0312] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M252Y, S254T, T256E, and a combination thereof.

[0313] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of T250Q, M248L, or both.

[0314] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of H433K, N434Y, or both.

[0315] In one embodiment, the genetically modified immunoglobulin locus comprises: (1) a first allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a first heavy chain constant region nucleotide sequence encoding a first CH.sub.3 amino acid sequence of a human IgG selected from IgG1, IgG2, IgG4, and a combination thereof; and (2) a second allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a second heavy chain constant region nucleotide sequence encoding a second C.sub.H3 amino acid sequence of the human IgG selected from IgG1, IgG2, IgG4, and a combination thereof, and wherein the second CH.sub.3 amino acid sequence comprises a modification that reduces or eliminates binding for the second CH.sub.3 amino acid sequence to Protein A (see, for example, US 2010/0331527A1, incorporated by reference herein in its entirety).

[0316] In one embodiment, the second CH.sub.3 amino acid sequence comprises an H95R modification (by IMGT exon numbering; H435R by EU numbering). In one embodiment the second CH.sub.3 amino acid sequence further comprises an Y96F modification (by IMGT exon numbering; H436F by EU). In another embodiment, the second CH.sub.3 amino acid sequence comprises both an H95R modification (by IMGT exon numbering; H435R by EU numbering) and an Y96F modification (by IMGT exon numbering; H436F by EU).

[0317] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG1 and further comprises a mutation selected from the group consisting of D16E, L18M, N44S, K52N, V57M, and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by EU).

[0318] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG2 and further comprises a mutation selected from the group consisting of N44S, K52N, and V82I (IMGT: N384S, K392N, and V422I by EU).

[0319] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG4 and further comprises a mutation selected from the group consisting of Q15R, N44S, K52N, V57M, R69K, E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and V422I by EU).

[0320] In one embodiment, the heavy chain constant region amino acid sequence is a non-human constant region amino acid sequence, and the heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0321] In one embodiment, the heavy chain constant region nucleotide sequence is a human heavy chain constant region amino acid sequence, and the human heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0322] In one embodiment, all or substantially all endogenous V.sub.H, D, and J.sub.H gene segments are deleted from an immunoglobulin heavy chain locus or rendered non-functional (e.g., via insertion of a nucleotide sequence (e.g., an exogenous nucleotide sequence) in the immunoglobulin locus or via non-functional rearrangement, or inversion, of the endogenous V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments are deleted or rendered non-functional. In one embodiment, e.g., at least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or J gene segments are deleted or rendered non-functional.

[0323] In one embodiment, the genetically modified immunoglobulin heavy chain locus comprises a modification that deletes or renders, all or substantially all, non-functional endogenous V.sub.H, D, and J.sub.H gene segments; and the genetically modified locus comprises an unrearranged heavy chain variable region nucleotide sequence comprising at least one inverted human D gene segment as described herein wherein the unrearranged heavy chain variable region nucleotide sequence is present at an endogenous location (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome, or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome).

[0324] In one embodiment, the genetically modified immunoglobulin locus comprises an endogenous Adam6a gene, Adam6b gene, or both, and the genetic modification does not affect the expression and/or function of the endogenous Adam6a gene, Adam6b gene, or both.

[0325] In one embodiment, the genetically modified immunoglobulin locus comprises an ectopically present Adam6a gene, Adam6b gene, or both. In one embodiment, the Adam6a gene is a non-human Adam6a gene. In one embodiment, the Adam6a gene is a mouse Adam6a gene. In one embodiment, the Adam6a gene is a human Adam6a gene. In one embodiment, the Adam6b gene is a non-human Adam6b gene. In one embodiment, the Adam6b gene is a mouse Adam6b gene. In one embodiment, the Adam6b gene is a human Adam6b gene.

[0326] In one embodiment, the genetically modified immunoglobulin locus further comprises a humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence. In one embodiment, the humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence is operably linked to an immunoglobulin light chain constant region nucleotide sequence selected from a .lamda. light chain constant region nucleotide sequence and a .kappa. light chain constant region nucleotide sequence. In one embodiment, the humanized, unrearranged .lamda. light chain variable region nucleotide sequence is operably linked to a .lamda. light chain constant region nucleotide sequence. In one embodiment, the .lamda. light chain constant region nucleotide sequence is a mouse, rat, or human sequence. In one embodiment, the humanized, unrearranged .kappa. light chain variable region nucleotide sequence is operably linked to a .kappa. light chain constant region nucleotide sequence. In one embodiment, the .kappa. light chain constant region nucleotide sequence is a mouse, rat, or human sequence.

[0327] In one embodiment, the genetically modified immunoglobulin locus comprises an unrearranged light chain variable gene sequence that contains at least one modification that introduces at least one histidine codon in at least one reading frame encoding a light chain variable domain. In one embodiment, the genetically modified immunoglobulin locus comprises a rearranged (e.g., a rearranged .lamda. or .kappa. V/J sequence) sequence that comprises one, two, three, or four codons for histidine in a light chain CDR. In one embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a combination thereof. In one embodiment, the unrearranged or rearranged light chain variable region nucleotide sequence is an unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence. In one embodiment, the unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence is present at an endogenous mouse immunoglobulin light chain locus. In one embodiment, the mouse immunoglobulin light chain locus is a mouse .kappa. locus. In one embodiment, the mouse immunoglobulin light chain locus is a mouse immunoglobulin light chain locus is a mouse .lamda. locus.

[0328] In one embodiment, the genetically modified immunoglobulin locus as described herein is present in an immunoglobulin heavy chain locus of a mouse. In one embodiment, the genetically modified immunoglobulin locus is present in a humanized immunoglobulin heavy chain locus in a VELOCIMMUNE.RTM. mouse.

[0329] In one embodiment, the non-human animal is heterozygous for the genetically modified immunoglobulin heavy chain locus, and the non-human animal is capable of expressing the human immunoglobulin heavy chain variable domain comprising at least one histidine residue derived predominantly from the genetically modified immunoglobulin heavy chain locus as described herein.

[0330] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein exhibits a weaker antigen binding at an acidic environment (e.g., at a pH of about 5.5 to about 6.0) than a corresponding wild-type heavy chain variable domain without the genetic modification.

[0331] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein has at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, or at least about 30-fold decrease in dissociative half-life (t.sub.1/2) at an acidic pH (e.g., pH of about 5.5 to about 6.0) as compared to the dissociative half-life (t.sub.1/2) of the antigen-binding protein at a neutral pH (e.g., pH of about 7.0 to about 7.4).

[0332] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein is characterized by improved pH-dependent recyclability, enhanced serum half-life, or both as compared with a wild-type antigen-binding protein without the genetic modification.

[0333] In one embodiment, the genetically modified immunoglobulin locus described herein comprises a B cell population that, upon stimulation with an antigen of interest, is capable of producing antigen-binding proteins, e.g., antibodies, comprising a heavy chain variable domain comprising one or more histidine residues. The antigen-binding proteins as described herein when administered into a subject, exhibits an increased serum half-life over a corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain. In some embodiments, the antigen-binding protein described herein exhibits an increased serum half-life that is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold higher than the corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain.

[0334] In one aspect, a non-human animal that is capable of expressing an antigen-binding protein with enhanced pH-dependent recyclability and/or enhanced serum half-life are provided, wherein the non-human animal comprises in its germline genome an unrearranged human immunoglobulin heavy chain variable region nucleotide sequence, wherein the unrearranged heavy chain variable region nucleotide sequence comprises an addition of least one histidine codon or a substitution of at least one endogenous non-histidine codon with a histidine codon as described herein.

[0335] In one embodiment, the antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein exhibits a weaker antigen binding at an acidic environment (e.g., at a pH of about 5.5 to about 6.0) than a corresponding wild-type heavy chain variable domain without the genetic modification.

[0336] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein has at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, or at least about 30-fold decrease in dissociative half-life (t.sub.1/2) at an acidic pH (e.g., pH of about 5.5 to about 6.0) as compared to the dissociative half-life (t.sub.1/2) of the antigen-binding protein at a neutral pH (e.g., pH of about 7.0 to about 7.4).

[0337] In one embodiment, the antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein is characterized by improved pH-dependent recyclability, enhanced serum half-life, or both as compared with a wild-type antigen-binding protein without the genetic modification.

[0338] In one embodiment, the genetically modified immunoglobulin locus described herein comprises a B cell population that, upon stimulation with an antigen of interest, is capable of producing antigen-binding proteins, e.g., antibodies, comprising a heavy chain variable domain comprising one or more histidine residues. The antigen-binding proteins as described herein when administered into a subject, exhibits an increased serum half-life over a corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain. In some embodiments, the antigen-binding protein described herein exhibits an increased serum half-life that is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold higher than the corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain.

[0339] In one aspect, a targeting construct is provided, comprising 5' and 3' targeting arms homologous to a genomic D region or genomic V and J region of a non-human animal, wherein at least one V.sub.H, D, or J.sub.H gene segment comprises any of the modifications as described herein, e.g., an addition of at least one histidine codon, a substitution of at least one endogenous non-histidine codon into a histidine codon, and/or inversion of at least one functional D gene segment with respect to a corresponding wild type sequence.

[0340] In one aspect, a hybridoma or quadroma is provided that is derived from a cell of any of the non-human animal as described herein. In one embodiment, the non-human animal is a rodent, e.g., a mouse, a rat, or a hamster.

[0341] In one aspect, pluripotent, induced pluripotent, or totipotent stem cells derived form a non-human animal comprising the various genomic modifications of the described invention are provided. In a specific embodiment, the pluripotent, induced pluripotent, or totipotent stem cells are mouse or rat embryonic stem (ES) cells. In one embodiment, the pluripotent, induced pluripotent, or totipotent stem cells have an XX karyotype or an XY karyotype. In one embodiment, the pluripotent or induced pluripotent stem cells are hematopoietic stem cells.

[0342] In one aspect, cells that comprise a nucleus containing a genetic modification as described herein are also provided, e.g., a modification introduced into a cell by pronuclear injection. In one embodiment, the pluripotent, induced pluripotent, or totipotent stem cells comprise a genetically modified immunoglobulin genomic locus, wherein the genomic locus comprises, from 5' to 3', (1) an FRT recombination site, (2) human V.sub.H gene segments, (3) a mouse adam6 gene, (4) a loxP recombination site, (5) histidine-substituted human D gene segments, (6) human J.sub.H gene segments, followed by (7) a mouse E.sub.i (intronic enhancer), and (8) a mouse IgM constant region nucleotide sequence.

[0343] In one aspect, a lymphocyte isolated from a genetically modified non-human animal as described herein is provided. In one embodiment, the lymphocyte is a B cell, wherein the B cell comprises an immunoglobulin genomic locus comprising an unrearranged heavy chain variable region nucleotide sequence wherein the unrearranged heavy chain variable gene sequence comprises an addition of least one histidine codon or a substitution of at least one endogenous non-histidine codon with a histidine codon.

[0344] In one aspect, a lymphocyte isolated from a genetically modified non-human animal as described herein is provided. In one embodiment, the lymphocyte is a B cell, wherein the B cell comprises an immunoglobulin locus that comprises a human V, D, and J gene segment, wherein at least one of the human D gene segment has been inverted 5' to 3' with respect to wild-type sequences, and wherein at least one reading frame of the inverted human D gene segment encodes at least one histidine residue. In one embodiment, the B cell is capable of producing an antigen-binding protein comprising the genetically modified heavy chain variable domain as described herein. In one embodiment, the genetically modified heavy chain variable domain as described herein is operably linked to a heavy chain constant region amino acid sequence.

[0345] In one aspect, a B cell population is provided that are capable of expressing an antigen-binding protein comprising at least one histidine residue in a heavy chain variable domain, wherein the B cell population comprises any genetic modifications as described herein. In one embodiment, the at least one histidine residue is present in a heavy chain CDR. In one embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a combination thereof. In one embodiment, the at least one histidine residue is present in CDR3.

[0346] In one aspect, a B cell population is provided that are capable of expressing an antigen-binding protein with enhanced serum half-life and/or enhanced pH-dependent recyclability, wherein the B cell population comprises any genetic modifications as described herein.

[0347] In one aspect, a method for making a non-human animal comprising a genetically modified immunoglobulin heavy chain variable locus is provided, comprising:

[0348] (a) modifying a genome of a non-human animal to delete or render non-functional endogenous immunoglobulin heavy chain V, D, and J gene segments (e.g., via insertion of a nucleotide sequence, e.g., an exogenous nucleotide sequence, in the immunoglobulin locus or via non-functional rearrangement or inversion of endogenous V.sub.H, D, J.sub.H segments); and

[0349] (b) placing in the genome an unrearranged heavy chain variable region nucleotide sequence, wherein the unrearranged heavy chain variable region nucleotide sequence comprises an addition of least one histidine codon or a substitution of at least one endogenous non-histidine codon with a histidine codon as described herein.

[0350] In one embodiment, the non-human animal is a mammal, including a rodent, e.g., a mouse, a rat, or a hamster.

[0351] In one embodiment, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or more, 34 or more, 35 or more, 36 or more, 37 or more, 38 or more, 39 or more, 40 or more, 41 or more, 42 or more, 43 or more, 44 or more, 45 or more, 46 or more, 47 or more, 48 or more, 49 or more, 50 or more, 51 or more, 52 or more, 53 or more, 54 or more, 55 or more, 56 or more, 57 or more, 58 or more, 59 or more, 60 or more, or 61 or more of the endogenous non-histidine codons are replaced with histidine codons.

[0352] In one embodiment, the endogenous non-histone codon encodes the amino acid selected from Y, N, D, Q, S, W, and R.

[0353] In one embodiment, the added or substituted histidine codon is present in an unrearranged heavy chain variable region nucleotide sequence that encodes an immunoglobulin variable domain selected from an N-terminal region, a loop 4 region, a CDR1, a CDR2, a CDR3, a combination thereof.

[0354] In one embodiment, the added substituted histidine codon histidine codon is present in an unrearranged heavy chain variable region nucleotide sequence that encodes a complementary determining region (CDR) selected from a CDR1, a CDR2, a CDR3, and a combination thereof.

[0355] In one embodiment, the added or substituted histidine codon is present in an unrearranged heavy chain variable region nucleotide sequence that encodes a frame region (FR) selected from FR1, FR2, FR3, FR4, and a combination thereof.

[0356] In one embodiment, the unrearranged heavy chain variable region nucleotide sequence comprises a genetically modified human V.sub.H gene segment, wherein one or more endogenous non-histidine codon in at least one reading frame of the human V.sub.H gene segment has been replaced with a histidine codon.

[0357] In one embodiment, the human unrearranged heavy chain variable region nucleotide sequence comprises a modification that replaces at least one endogenous non-histidine codon of a human V.sub.H gene segment with a histidine codon, wherein the human V.sub.H gene segment is selected from the group consisting of V.sub.H1-2, V.sub.H1-3, V.sub.H1-8, V.sub.H1-18, V.sub.H1-24, V.sub.H1-45, V.sub.H1-46, V.sub.H1-58, V.sub.H1-69, V.sub.H2-5, V.sub.H2-26, V.sub.H2-70, V.sub.H3-7, V.sub.H3-9, V.sub.H3-11, V.sub.H3-13, V.sub.H3-15, V.sub.H3-16, V.sub.H3-20, V.sub.H3-21, V.sub.H3-23, V.sub.H3-30, V.sub.H3-30-3, V.sub.H 3-30-5, V.sub.H3-33, V.sub.H3-35, V.sub.H3-38, V.sub.H3-43, V.sub.H3-48, V.sub.H3-49, V.sub.H3-53, V.sub.H3-64, V.sub.H3-66, V.sub.H3-72, V.sub.H3-73, V.sub.H3-74, V.sub.H4-4, V.sub.H4-28, V.sub.H4-30-1, V.sub.H4-30-2, V.sub.H4-30-4, V.sub.H4-31, V.sub.H4-34, V.sub.H4-39, V.sub.H4-59, V.sub.H4-61, V.sub.H5-51, V.sub.H6-1, V.sub.H7-4-1, V.sub.H7-81, and a combination thereof.

[0358] In one embodiment, the human unrearranged heavy chain variable region nucleotide sequence comprises a genetically modified human J.sub.H gene segment, wherein one or more endogenous non-histidine codon in at least one reading frame of the human J.sub.H gene segment has been replaced with a histidine codon.

[0359] In one embodiment, the human unrearranged heavy chain variable region nucleotide sequence comprises a modification that replaces at least one endogenous non-histidine codon of a human J.sub.H segment with a histidine codon, wherein the human J.sub.H gene segment is selected from the group consisting of J.sub.H1, J.sub.H2, 43, 44, 45, J.sub.H6, and a combination thereof.

[0360] In one embodiment, the added or substituted histidine codon is present in a heavy chain variable region nucleotide sequence that encodes part of a CDR3. In one embodiment, the part of CDR3 comprises an amino acid sequence derived from a reading frame of a genetically modified human D gene segment comprising a modification that replaces at least one endogenous non-histidine codon in the reading frame with a histidine codon.

[0361] In one embodiment, the endogenous non-histidine codon that is substituted with a histidine codon encodes the amino acid selected from Y, N, D, Q, S, W, and R.

[0362] In one embodiment, the added or substituted histidine codon is present in at least one reading frame of the human D gene segment that is most frequently observed in VELOCIMMUNE.RTM. humanized immunoglobulin mice.

[0363] In one embodiment, the reading frame of the genetically modified human D gene segment that encodes part of CDR3 is selected from a hydrophobic frame, a stop frame, and a hydrophilic frame.

[0364] In one embodiment, the reading frame is a hydrophobic frame of a human D gene segment.

[0365] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D1-1 (GTTGT; SEQ ID NO: 88), D1-7 (GITGT; SEQ ID NO: 89), D1-20 (GITGT; SEQ ID NO: 89), and D1-26 (GIVGAT; SEQ ID NO:90), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0366] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D2-2 (DIVVVPAAI; SEQ ID NO:92), D2-8 (DIVLMVYAI; SEQ ID NO: 94), D2-15 (DIVVVVAAT; SEQ ID NO:95), and D2-21 (HIVVVTAI; SEQ ID NO: 97), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0367] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D3-3 (ITIFGVVII; SEQ ID NO:98), D3-9 (ITIF*LVII; SEQ ID NO:99, SEQ ID NO:100), D3-10 (ITMVRGVII; SEQ ID NO:101), D3-16 (IMITFGGVIVI; SEQ ID NO:102), and D3-22 (ITMIVVVIT; SEQ ID NO:103), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon.

[0368] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D4-4 (TTVT; SEQ ID NO:105), D4-11 (TTVT; SEQ ID NO:105), D4-17 (TTVT; SEQ ID NO:105), D4-23 (TTVVT; SEQ ID NO: 106) and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0369] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D5-5 (VDTAMV; SEQ ID NO: 107), D5-12 (VDIVATI; SEQ ID NO:108), D5-18 (VDTAMV; SEQ ID NO:107), and D5-24 (VEMATI; SEQ ID NO:109), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0370] In one embodiment, the hydrophobic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D6-6 (SIAAR; SEQ ID NO:111), D6-13 (GIAAAG; SEQ ID NO:113), and D6-19 (GIAVAG; SEQ ID NO:115), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0371] In one embodiment, the hydrophobic frame comprises a nucleotide sequence that encodes human D7-27 (LTG), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0372] In one embodiment, the reading frame is a stop reading frame of a human D gene segment.

[0373] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D1-1 (VQLER; SEQ ID NO:8), D1-7(V*LEL), D1-20(V*LER), D1-26 (V*WELL; SEQ ID NO:12), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0374] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D2-2 (RIL**YQLLY; SEQ ID NO:14), D2-8 (RILY*WCMLY; SEQ ID NO:16 and SEQ ID NO: 17), D2-15 (RIL*WW*LLL), and D2-21 (SILWW*LLF; SEQ ID NO:19), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0375] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D3-3 (VLRFLEWLLY; SEQ ID NO:21), D3-9 (VLRYFDWLL*; SEQ ID NO:23), D3-10 (VLLWFGELL*; SEQ ID NO:25), D3-16 (VL*LRLGELSLY; SEQ ID NO:27), and D3-22 (VLL***WLLL; SEQ ID NO:29), and the human D gene segment comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0376] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D4-4 (*LQ*L), D4-11 (*LQ*L), D4-17 (*LR*L), and D4-23 (*LRW*L), and the human D gene segment comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0377] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D5-5 (WIQLWL; SEQ ID NO:35); D5-12 (Wl*WLRL; SEQ ID NO:37), D5-18 (WIQLWL; SEQ ID NO:35), and D5-24 (*RWLQL; SEQ ID NO:39), and the human D gene segment comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0378] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D6-6 (V*QLV), D6-13 (V*QQLV; SEQ ID NO:41), and D6-19 (V*QWLV; SEQ ID NO:43), and the human D gene segment further comprises a modification that replaces at least one endogenous non-histidine codon in the nucleotide sequence with a histidine codon.

[0379] In one embodiment, the stop reading frame of the human D gene segment comprises a nucleotide sequence that encodes D7-27 (*LG), and the human D gene segment further comprises a modification that replaces at least one endogenous codon of the human D gene segment in the nucleotide sequence with a histidine codon.

[0380] In one embodiment, the reading frame is a hydrophilic frame of a human D gene segment.

[0381] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D1-1 (YNWND; SEQ ID NO: 45), D1-7 (YNWNY; SEQ ID NO: 47), D1-20 (YNWND; SEQ ID NO: 45), and D1-26 (YSGSYY; SEQ ID NO:49), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, and a combination thereof.

[0382] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D2-2 (GYCSSTSCYT; SEQ ID NO:51), D2-8 (GYCTNGVCYT; SEQ ID NO: 53), D2-15 (GYCSGGSCYS; SEQ ID NO:55), and D2-21 (AYCGGDCYS; SEQ ID NO:57), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, and a combination thereof.

[0383] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D3-3 (YYDFWSGYYT; SEQ ID NO:59), D3-9 (YYDILTGYYN; SEQ ID NO:61), D3-10 (YYYGSGSYYN; SEQ ID NO:63), D3-16 (YYDYVWGSYRYT; SEQ ID NO:65), and D3-22 (YYYDSSGYYY; SEQ ID NO:67), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, and a combination thereof.

[0384] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D4-4 (DYSNY; SEQ ID NO:69), D4-11 (DYSNY; SEQ ID NO:69), D4-17 (DYGDY; SEQ ID NO:71), and D4-23 (DYGGNS; SEQ ID NO:73), and the human D gene segment comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, and a combination thereof.

[0385] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D5-5 (GYSYGY; SEQ ID NO:75), D5-12 (GYSGYDY; SEQ ID NO:77), D5-18 (GYSYGY; SEQ ID NO:75), and D5-24 (RDGYNY; SEQ ID NO:79), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, and a combination thereof.

[0386] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of D6-6 (EYSSSS; SEQ ID NO: 81), D6-13 (GYSSSWY; SEQ ID NO:83), and D6-19 (GYSSGWY; SEQ ID NO:85), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence with a histidine codon. In one embodiment, the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 76, and a combination thereof.

[0387] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes D7-27 (NWG), and the human D gene segment further comprises a modification that replaces at least one endogenous codon in the nucleotide sequence a histidine codon.

[0388] In one embodiment, the hydrophilic frame of the human D gene segment comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, and a combination thereof.

[0389] In one embodiment, the unrearranged heavy chain variable region nucleotide sequence comprising the inverted human D gene segment is operably linked to a human or non-human heavy chain constant region nucleotide sequence that encodes an immunoglobulin isotype selected from IgM, IgD, IgG, IgE, and IgA.

[0390] In one embodiment, the human unrearranged immunoglobulin heavy chain variable region nucleotide sequence is operably linked to a human or non-human heavy chain constant region nucleotide sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3, and a combination thereof. In one embodiment, the heavy chain constant region nucleotide sequence comprises a C.sub.H1, a hinge, a C.sub.H2, and a C.sub.H3 (i.e., C.sub.H1-hinge-C.sub.H2-C.sub.H3).

[0391] In one embodiment, a heavy chain constant region nucleotide sequence is present at an endogenous locus (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome, or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome).

[0392] In one embodiment, the heavy chain constant region nucleotide sequence comprises a modification in a C.sub.H2 or a C.sub.H3, wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0393] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a modification at position 250 (e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K) and/or 434 (e.g., H/F or Y); or a modification at position 250 and/or 428; or a modification at position 307 or 308 (e.g., 308F, V308F), and 434. In one embodiment, the modification comprises a 428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L, 259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K (e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and 256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L modification (e.g., T250Q and M428L); and a 307 and/or 308 modification (e.g., 308F or 308P), wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0394] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 252 and 257, wherein the modification increases the affinity of the human C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0395] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 307 and 311, wherein the modification increases the affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0396] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H3 amino acid sequence, wherein the C.sub.H3 amino acid sequence comprises at least one modification between amino acid residues at positions 433 and 436, wherein the modification increases the affinity of the C.sub.H3 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0397] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, N434S, and a combination thereof.

[0398] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, V259I, V308F, and a combination thereof.

[0399] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising an N434A mutation.

[0400] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M252Y, S254T, T256E, and a combination thereof.

[0401] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of T250Q, M248L, or both.

[0402] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of H433K, N434Y, or both.

[0403] In one embodiment, the genetically modified immunoglobulin locus comprises: (1) a first allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a first heavy chain constant region nucleotide sequence encoding a first CH.sub.3 amino acid sequence of a human IgG selected from IgG1, IgG2, IgG4, and a combination thereof; and (2) a second allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a second heavy chain constant region nucleotide sequence encoding a second C.sub.H3 amino acid sequence of the human IgG selected from IgG1, IgG2, IgG4, and a combination thereof, and wherein the second CH.sub.3 amino acid sequence comprises a modification that reduces or eliminates binding for the second CH.sub.3 amino acid sequence to Protein A (see, for example, US 2010/0331527A1, which is incorporated by reference herein in its entirety).

[0404] In one embodiment, the second CH.sub.3 amino acid sequence comprises an H95R modification (by IMGT exon numbering; H435R by EU numbering). In one embodiment the second CH.sub.3 amino acid sequence further comprises an Y96F modification (by IMGT exon numbering; H436F by EU). In another embodiment, the second CH.sub.3 amino acid sequence comprises both an H95R modification (by IMGT exon numbering; H435R by EU numbering) and an Y96F modification (by IMGT exon numbering; H436F by EU).

[0405] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG1 and further comprises a mutation selected from the group consisting of D16E, L18M, N44S, K52N, V57M, and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by EU).

[0406] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG2 and further comprises a mutation selected from the group consisting of N44S, K52N, and V82I (IMGT: N384S, K392N, and V422I by EU).

[0407] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG4 and further comprises a mutation selected from the group consisting of Q15R, N44S, K52N, V57M, R69K, E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and V422I by EU).

[0408] In one embodiment, the heavy chain constant region amino acid sequence is a non-human constant region amino acid sequence, and the heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0409] In one embodiment, the heavy chain constant region nucleotide sequence is a human heavy chain constant region amino acid sequence, and the human heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0410] In one embodiment, all or substantially all endogenous V.sub.H, D, and J.sub.H gene segments are deleted from an immunoglobulin heavy chain locus or rendered non-functional (e.g., via insertion of a nucleotide sequence (e.g., an exogenous nucleotide sequence) in the immunoglobulin locus or via non-functional rearrangement, or inversion, of the endogenous V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments are deleted or rendered non-functional. In one embodiment, e.g., at least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or J gene segments are deleted or rendered non-functional.

[0411] In one embodiment, the genetically modified locus comprises a modification that deletes or renders non-functional all or substantially all endogenous V.sub.H, D, and J.sub.H gene segments; and the genomic locus comprises the genetically modified, unrearranged human heavy chain variable region nucleotide sequence comprising a substitution of at least one endogenous non-histidine codon with a histidine codon in at least one reading frame. In one embodiment, the genetically modified, unrearranged immunoglobulin heavy chain variable gene sequence is present at an endogenous location (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome), or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome.

[0412] In one embodiment, the genetically modified locus comprises an endogenous Adam6a gene, Adam6b gene, or both, and the genetic modification does not affect the expression and/or function of the endogenous Adam6a gene, Adam6b gene, or both.

[0413] In one embodiment, the genetically modified locus comprises an ectopically present Adam6a gene, Adam6b gene, or both. In one embodiment, the Adam6a gene is a non-human Adam6a gene. In one embodiment, the Adam6a gene is a mouse Adam6a gene. In one embodiment, the Adam6a gene is a human Adam6a gene. In one embodiment, the Adam6b gene is a non-human Adam6b gene. In one embodiment, the Adam6b gene is a mouse Adam6b gene. In one embodiment, the Adam6b gene is a human Adam6b gene.

[0414] In one embodiment, the genetically modified immunoglobulin locus further comprises a humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence. In one embodiment, the humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence is operably linked to an immunoglobulin light chain constant region nucleotide sequence selected from a .lamda. light chain constant region nucleotide sequence and a .kappa. light chain constant region nucleotide sequence. In one embodiment, the humanized, unrearranged .lamda. light chain variable region nucleotide sequence is operably linked to a .lamda. light chain constant region nucleotide sequence. In one embodiment, the .lamda. light chain constant region nucleotide sequence is a mouse, rat, or human sequence. In one embodiment, the humanized, unrearranged .kappa. light chain variable region nucleotide sequence is operably linked to a .kappa. light chain constant region nucleotide sequence. In one embodiment, the .kappa. light chain constant region nucleotide sequence is a mouse, rat, or human sequence.

[0415] In one embodiment, the genetically modified immunoglobulin locus comprises an unrearranged light chain variable gene sequence that contains at least one modification that introduces at least one histidine codon in at least one reading frame encoding a light chain variable domain. In one embodiment, the genetically modified immunoglobulin locus comprises a rearranged (e.g., a rearranged .lamda. or .kappa. V/J sequence) sequence that comprises one, two, three, or four codons for histidine in a light chain CDR. In one embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a combination thereof. In one embodiment, the unrearranged or rearranged light chain variable region nucleotide sequence is an unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence. In one embodiment, the unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence is present at an endogenous mouse immunoglobulin light chain locus. In one embodiment, the mouse immunoglobulin light chain locus is a mouse .kappa. locus. In one embodiment the mouse immunoglobulin light chain locus is a mouse .lamda. locus.

[0416] In one embodiment, the genetically modified immunoglobulin locus as described herein is present in an immunoglobulin heavy chain locus of a mouse. In one embodiment, the genetically modified immunoglobulin locus is present in a humanized immunoglobulin heavy chain locus in a VELOCIMMUNE.RTM. mouse.

[0417] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein exhibits a weaker antigen binding at an acidic environment (e.g., at a pH of about 5.5 to about 6.0) than a corresponding wild-type heavy chain variable domain without the genetic modification.

[0418] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein has at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, or at least about 30-fold decrease in dissociative half-life (t.sub.1/2) at an acidic pH (e.g., pH of about 5.5 to about 6.0) as compared to the dissociative half-life (t.sub.1/2) of the antigen-binding protein at a neutral pH (e.g., pH of about 7.0 to about 7.4).

[0419] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein is characterized by improved pH-dependent recyclability, enhanced serum half-life, or both as compared with a wild-type antigen-binding protein without the genetic modification.

[0420] In one embodiment, the genetically modified immunoglobulin locus described herein comprises a B cell population that, upon stimulation with an antigen of interest, is capable of producing antigen-binding proteins, e.g., antibodies, comprising a heavy chain variable domain comprising one or more histidine residues. The antigen-binding proteins as described herein when administered into a subject, exhibits an increased serum half-life over a corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain. In some embodiments, the antigen-binding protein described herein exhibits an increased serum half-life that is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold higher than the corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain.

[0421] In one aspect, a method for making a non-human animal comprising a genetically modified immunoglobulin heavy chain variable locus is provided, comprising:

[0422] (a) modifying a genome of a non-human animal to delete or render non-functional endogenous immunoglobulin heavy chain V, D, and J gene segments (e.g., via insertion of a nucleotide sequence (e.g., an exogenous nucleotide sequence) in the immunoglobulin locus or via non-functional rearrangement or inversion of endogenous V.sub.H, D, J.sub.H segments); and

[0423] (b) placing in the genome a human V.sub.H, D, and J.sub.H gene segment, wherein at least one of the human D gene segment has been inverted 5' to 3' with respect to a corresponding wild-type sequence, and wherein at least one reading frame of the inverted human D gene segment comprises a histidine codon.

[0424] In one embodiment, the non-human animal is a mammal, including a rodent, e.g., a mouse, a rat, or a hamster

[0425] In one embodiment, the genetically modified immunoglobulin locus is present in a germline genome.

[0426] In one embodiment, the genetically modified immunoglobulin locus encodes an immunoglobulin heavy chain variable domain comprising one or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or more, or 34 or more of histidine residues.

[0427] In one embodiment, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, at least twenty one, at least twenty two, at least twenty three, at least twenty four, or all or substantially all of functional human D gene segments have inverted orientation with respect to corresponding wild type sequences.

[0428] In one embodiment, all or substantially all of endogenous immunoglobulin V.sub.H, D, J.sub.H gene segments are deleted from the immunoglobulin heavy chain locus or rendered non-functional (e.g., via insertion of a nucleotide sequence, e.g., exogenous nucleotide sequence, in the immunoglobulin locus or via non-functional rearrangement or inversion of all, or substantially all, endogenous immunoglobulin V.sub.H, D, J.sub.H segments), and the genetically modified immunoglobulin locus comprises a human V.sub.H, D, and J.sub.H gene segments, wherein at least one of the human D gene segment is present in an inverted orientation with respect to a corresponding wild type sequence, and wherein at least one reading frame in the inverted human D gene segment comprises at least one histidine codon.

[0429] In one embodiment, the inverted human D gene segment is operably linked to a human V.sub.H gene segment, and/or human J.sub.H gene segment

[0430] In one embodiment, the human D gene segment that is present in the inverted orientation relative to wild type sequences is selected from the group consisting of D1-1, D1-7, D1-20, D1-26, D2-2, D2-8, D2-15, D2-21, D3-3, D3-9, D3-10, D3-16, D3-22, D4-4, D4-11, D4-17, D4-23, D5-5, D5-12, D5-18, D5-24, D6-6, D6-13, D6-19, D7-27, and a combination thereof.

[0431] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D1 gene segment selected from the group consisting of D1-1, D1-7, D1-20, D1-26, and a combination thereof.

[0432] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D2 gene segment selected from the group consisting of D2-2, D2-8, D2-15, D2-21, and a combination thereof.

[0433] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D3 gene segment selected from the group consisting of D3-3, D3-9, D3-10, D3-16, D3-22, and a combination thereof.

[0434] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D4 gene segment selected from the group consisting of D4-4, D4-11, D4-17, D4-23, and a combination thereof.

[0435] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D5 gene segment selected from the group consisting of D5-5, D5-12, D5-18, D5-24, and a combination thereof.

[0436] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is a D6 gene segment selected from the group consisting of D6-6, D6-13, D6-19, and a combination thereof.

[0437] In one embodiment, the human D gene segment that is present in the inverted orientation relative to a corresponding wild type sequence is D7-27.

[0438] In one embodiment, the reading frame of the human D gene segment is selected from a stop reading frame, a hydrophilic reading frame, a hydrophobic reading frame, and a combination thereof.

[0439] In one embodiment, the unrearranged heavy chain variable region nucleotide sequence comprising the inverted human D gene segment is operably linked to a human or non-human heavy chain constant region nucleotide sequence that encodes an immunoglobulin isotype selected from IgM, IgD, IgG, IgE, and IgA.

[0440] In one embodiment, the human unrearranged immunoglobulin heavy chain variable region nucleotide sequence is operably linked to a human or non-human heavy chain constant region nucleotide sequence selected from a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3, and a combination thereof. In one embodiment, the heavy chain constant region nucleotide sequence comprises a C.sub.H1, a hinge, a C.sub.H2, and a C.sub.H3 (i.e., C.sub.H1-hinge-C.sub.H2-CH3).

[0441] In one embodiment, a heavy chain constant region nucleotide sequence is present at an endogenous locus (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome, or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome).

[0442] In one embodiment, the heavy chain constant region nucleotide sequence comprises a modification in a C.sub.H2 or a C.sub.H3, wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0443] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a modification at position 250 (e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K) and/or 434 (e.g., H/F or Y); or a modification at position 250 and/or 428; or a modification at position 307 or 308 (e.g., 308F, V308F), and 434. In one embodiment, the modification comprises a 428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L, 259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K (e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and 256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L modification (e.g., T250Q and M428L); and a 307 and/or 308 modification (e.g., 308F or 308P), wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0444] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 252 and 257, wherein the modification increases the affinity of the human C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0445] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 307 and 311, wherein the modification increases the affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0446] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H3 amino acid sequence, wherein the C.sub.H3 amino acid sequence comprises at least one modification between amino acid residues at positions 433 and 436, wherein the modification increases the affinity of the C.sub.H3 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0447] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, N434S, and a combination thereof.

[0448] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M428L, V259I, V308F, and a combination thereof.

[0449] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising an N434A mutation.

[0450] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of M252Y, S254T, T256E, and a combination thereof.

[0451] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of T250Q, M248L, or both.

[0452] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human heavy chain constant region amino acid sequence comprising a mutation selected from the group consisting of H433K, N434Y, or both.

[0453] In one embodiment, the genetically modified immunoglobulin locus comprises: (1) a first allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a first heavy chain constant region nucleotide sequence encoding a first CH.sub.3 amino acid sequence of a human IgG selected from IgG1, IgG2, IgG4, and a combination thereof; and (2) a second allele, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a second heavy chain constant region nucleotide sequence encoding a second C.sub.H3 amino acid sequence of the human IgG selected from IgG1, IgG2, IgG4, and a combination thereof, and wherein the second CH.sub.3 amino acid sequence comprises a modification that reduces or eliminates binding for the second CH.sub.3 amino acid sequence to Protein A (see, for example, US 2010/0331527A1, which is incorporated by reference herein in its entirety).

[0454] In one embodiment, the second CH.sub.3 amino acid sequence comprises an H95R modification (by IMGT exon numbering; H435R by EU numbering). In one embodiment the second CH.sub.3 amino acid sequence further comprises an Y96F modification (by IMGT exon numbering; H436F by EU). In another embodiment, the second CH.sub.3 amino acid sequence comprises both an H95R modification (by IMGT exon numbering; H435R by EU numbering) and an Y96F modification (by IMGT exon numbering; H436F by EU).

[0455] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG1 and further comprises a mutation selected from the group consisting of D16E, L18M, N44S, K52N, V57M, and V82I (IMGT; D356E, L38M, N384S, K392N, V397M, and V422I by EU).

[0456] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG2 and further comprises a mutation selected from the group consisting of N44S, K52N, and V82I (IMGT: N384S, K392N, and V422I by EU).

[0457] In one embodiment, the second CH.sub.3 amino acid sequence is from a modified human IgG4 and further comprises a mutation selected from the group consisting of Q15R, N44S, K52N, V57M, R69K, E79Q, and V82I (IMGT: Q355R, N384S, K392N, V397M, R409K, E419Q, and V422I by EU).

[0458] In one embodiment, the heavy chain constant region amino acid sequence is a non-human constant region amino acid sequence, and the heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0459] In one embodiment, the heavy chain constant region nucleotide sequence is a human heavy chain constant region amino acid sequence, and the human heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0460] In one embodiment, all or substantially all endogenous V.sub.H, D, and J.sub.H gene segments are deleted from an immunoglobulin heavy chain locus or rendered non-functional (e.g., via insertion of a nucleotide sequence (e.g., an exogenous nucleotide sequence) in the immunoglobulin locus or via non-functional rearrangement, or inversion, of the endogenous V.sub.H, D, J.sub.H segments). In one embodiment, e.g., about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more of all endogenous V.sub.H, D, or J.sub.H gene segments are deleted or rendered non-functional. In one embodiment, e.g., at least 95%, 96%, 97%, 98%, or 99% of endogenous functional V, D, or J gene segments are deleted or rendered non-functional.

[0461] In one embodiment, the genetically modified immunoglobulin heavy chain locus comprises a modification that deletes or renders, all or substantially all, non-functional endogenous V.sub.H, D, and J.sub.H gene segments; and the genetically modified locus comprises an unrearranged heavy chain variable region nucleotide sequence comprising at least one inverted human D gene segment as described herein wherein the unrearranged heavy chain variable region nucleotide sequence is present at an endogenous location (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome, or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome).

[0462] In one embodiment, the genetically modified immunoglobulin locus comprises an endogenous Adam6a gene, Adam6b gene, or both, and the genetic modification does not affect the expression and/or function of the endogenous Adam6a gene, Adam6b gene, or both.

[0463] In one embodiment, the genetically modified immunoglobulin locus comprises an ectopically present Adam6a gene, Adam6b gene, or both. In one embodiment, the Adam6a gene is a non-human Adam6a gene. In one embodiment, the Adam6a gene is a mouse Adam6a gene. In one embodiment, the Adam6a gene is a human Adam6a gene. In one embodiment, the Adam6b gene is a non-human Adam6b gene. In one embodiment, the Adam6b gene is a mouse Adam6b gene. In one embodiment, the Adam6b gene is a human Adam6b gene.

[0464] In one embodiment, the genetically modified immunoglobulin locus further comprises a humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence. In one embodiment, the humanized, unrearranged .lamda. and/or .kappa. light chain variable gene sequence is operably linked to an immunoglobulin light chain constant region nucleotide sequence selected from a .lamda. light chain constant region nucleotide sequence and a .kappa. light chain constant region nucleotide sequence. In one embodiment, the humanized, unrearranged .lamda. light chain variable region nucleotide sequence is operably linked to a .lamda. light chain constant region nucleotide sequence. In one embodiment, the .lamda. light chain constant region nucleotide sequence is a mouse, rat, or human sequence. In one embodiment, the humanized, unrearranged .kappa. light chain variable region nucleotide sequence is operably linked to a .kappa. light chain constant region nucleotide sequence. In one embodiment, the .kappa. light chain constant region nucleotide sequence is a mouse, rat, or human sequence.

[0465] In one embodiment, the genetically modified immunoglobulin locus comprises an unrearranged light chain variable gene sequence that contains at least one modification that introduces at least one histidine codon in at least one reading frame encoding a light chain variable domain. In one embodiment, the genetically modified immunoglobulin locus comprises a rearranged (e.g., a rearranged .lamda. or .kappa. V/J sequence) sequence that comprises one, two, three, or four codons for histidine in a light chain CDR. In one embodiment, the CDR is a selected from a CDR1, CDR2, CDR3, and a combination thereof. In one embodiment, the unrearranged or rearranged light chain variable region nucleotide sequence is an unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence. In one embodiment, the unrearranged or rearranged human .lamda. or .kappa. light chain variable region nucleotide sequence is present at an endogenous mouse immunoglobulin light chain locus. In one embodiment, the mouse immunoglobulin light chain locus is a mouse .kappa. locus. In one embodiment, the mouse immunoglobulin light chain locus is a mouse immunoglobulin light chain locus is a mouse .lamda. locus.

[0466] In one embodiment, the genetically modified immunoglobulin locus as described herein is present in an immunoglobulin heavy chain locus of a mouse. In one embodiment, the genetically modified immunoglobulin locus is present in a humanized immunoglobulin heavy chain locus in a VELOCIMMUNE.RTM. mouse.

[0467] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein exhibits a weaker antigen binding at an acidic environment (e.g., at a pH of about 5.5 to about 6.0) than a corresponding wild-type heavy chain variable domain without the genetic modification.

[0468] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein has at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, or at least about 30-fold decrease in dissociative half-life (t.sub.1/2) at an acidic pH (e.g., pH of about 5.5 to about 6.0) as compared to the dissociative half-life (t.sub.1/2) of the antigen-binding protein at a neutral pH (e.g., pH of about 7.0 to about 7.4).

[0469] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein is characterized by improved pH-dependent recyclability, enhanced serum half-life, or both as compared with a wild-type antigen-binding protein without the genetic modification.

[0470] In one embodiment, the genetically modified immunoglobulin locus described herein comprises an enriched B cell population that, upon stimulation with an antigen of interest, is capable of producing antigen-binding proteins, e.g., antibodies, comprising a heavy chain variable domain comprising one or more histidine residues. The antigen-binding proteins as described herein, when administered into a subject, exhibits an increased serum half-life over a corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain. In some embodiments, the antigen-binding protein described herein exhibits an increased serum half-life that is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold higher than the corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain.

[0471] In one aspect, a method for making a non-human animal that is capable of producing an immunoglobulin heavy chain variable domain with enhanced serum half-life and/or enhanced pH-dependent recyclability is provided, comprising

[0472] (a) modifying a genome of a non-human animal to delete or render non-functional endogenous immunoglobulin heavy chain V, D, and J gene segments (e.g., via insertion of a nucleotide sequence (e.g., an exogenous nucleotide sequence) in the immunoglobulin locus or via non-functional rearrangement or inversion of endogenous V.sub.H, D, J.sub.H segments); and

[0473] (b) placing in the genome an unrearranged human heavy chain variable region nucleotide sequence, wherein the unrearranged heavy chain variable region nucleotide sequence comprises an addition of least one histidine codon or a substitution of at least one endogenous non-histidine codon with a histidine codon, and wherein an antigen-binding protein comprising the immunoglobulin heavy chain variable domain produced by the non-human animal exhibits enhanced serum half-life and/or enhanced pH-dependent recyclability as compared to a wild-type immunoglobulin heavy chain domain.

[0474] In one embodiment, the non-human animal, upon contact with an antigen, can produce an enriched population of B cell repertoire that expresses an antigen-binding protein with enhanced serum half-life and/or enhanced pH-dependent recyclability, wherein the enriched B cell population comprises any genetic modifications as described herein.

[0475] In one embodiment, an antigen-binding protein produced by the genetically modified non-human animal is characterized by sufficient affinity to an antigen of interest at a neutral pH (e.g., pH of about 7.0 to about 7.4) and enhanced dissociation of the antibody from an antigen-antigen-binding protein complex at a pH less than the neutral pH (e.g., at an endosomal pH, e.g. pH of about 5.5 to 6.0).

[0476] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein has at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, or at least about 30-fold decrease in dissociative half-life (t.sub.1/2) at an acidic pH (e.g., pH of about 5.5 to about 6.0) as compared to the dissociative half-life (t.sub.1/2) of the antigen-binding protein at a neutral pH (e.g., pH of about 7.0 to about 7.4).

[0477] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein is characterized by improved pH-dependent recyclability, enhanced serum half-life, or both as compared with a wild-type antigen-binding protein without the genetic modification.

[0478] In one embodiment, the genetically modified immunoglobulin locus described herein comprises a an enriched B cell population that, upon stimulation with an antigen of interest, is capable of producing antigen-binding proteins, e.g., antibodies, comprising a heavy chain variable domain comprising one or more histidine residues. The antigen-binding proteins as described herein when administered into a subject, exhibits an increased serum half-life over a corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain. In some embodiments, the antigen-binding protein described herein exhibits an increased serum half-life that is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold higher than the corresponding wild-type antigen-binding protein, which possesses a similar or sufficiently similar amino acid sequence that encodes the heavy chain variable domain but does not comprise a histidine residue in the heavy chain variable domain.

[0479] In one embodiment, the antigen-binding protein comprises an immunoglobulin heavy chain variable domain that is capable of specifically binding an antigen of interest with an affinity (K.sub.D) lower than 10.sup.-6, 10.sup.-7, 10.sup.-8, 10.sup.-9, 10.sup.-10, 10.sup.-11, and 10.sup.-12 at a neutral pH (e.g., pH of about 7.0 to about 7.4).

[0480] In one aspect, a method for obtaining an antigen-binding protein with enhanced recyclability and/or improved serum half-life is provided, comprising:

[0481] (a) immunizing a non-human animal having a genetically modified immunoglobulin locus as described herein wherein the non-human animal comprises an unrearranged human heavy chain variable region nucleotide sequence comprising an addition of least one histidine codon or a substitution of at least one endogenous non-histidine codon with a histidine codon;

[0482] (b) allowing the non-human animal to mount an immune response;

[0483] (c) harvesting a lymphocyte (e.g., a B cell) from the immunized non-human animal;

[0484] (d) fusing the lymphocyte with a myeloma cell to form a hybridoma cell, and

[0485] (e) obtaining an antigen-binding protein produced by the hybridoma cell, wherein the antigen-binding protein exhibits enhanced recyclability and/or serum stability.

[0486] In one aspect, a genetically modified immunoglobulin heavy chain locus obtainable by any of the methods as described herein is provided.

[0487] In one aspect, a genetically modified non-human animal obtainable by any of the methods as described herein is provided.

[0488] In various embodiments, the non-human animal is a mammal. In one embodiment, the mammal is a rodent, e.g., a mouse, a rat, or a hamster.

[0489] In various embodiments, the genetically modified immunoglobulin loci as described herein are present in the germline genome of a non-human animal, e.g., a mammal, e.g., a rodent, e.g., a mouse, a rat, or a hamster.

BRIEF DESCRIPTION OF THE DRAWINGS

[0490] FIGS. 1A and 1B illustrate the amino acid sequences encoded by the three reading frames (i.e., stop, hydrophilic, and hydrophobic reading frames) of human D gene segments (D) and the amino acid sequences encoded by the three reading frames of histidine-substituted human D gene segments (HD). Introduction of histidine codons (typed in bold) in the hydrophilic reading frame also changed many stop codons in the stop reading frame to Ser codons (typed in bold) but introduced few changes in the hydrophobic reading frame. The "*" symbol represents a stop codon, and the comma between the two SEQ ID NOs indicates that there are two amino acid sequences separated by the stop codon.

[0491] FIG. 2 illustrates schemes for targeting pLMa0174 containing a spectinomycin selection cassette into the 5' end of MAID 1116 (Step 1. BHR (Spec)). In Step 1, a chloramphenicol selection cassette, a neomycin selection cassette, a loxP site, two V.sub.H gene segments (hV.sub.H1-3 and hV.sub.H1-2), the human Adam6 gene, all of which are located upstream of hV.sub.H6-1, were deleted from the clone and replaced by a spectinomycin cassette to yield the VI433 clone. In Step 2 (BHR (Hyg +Spec)), pNTu0002 containing a hygromycin cassette flanked by FRT sites was targeted into a region comprising human immunoglobulin D gene segments. Via Step 2, all human D gene segments were deleted from VI433 and replaced with the hygromycin cassette to yield MAID6011 VI 434 (clone 1).

[0492] FIG. 3 illustrates schemes for assembling histidine-substituted human D gene segments via sequential ligation.

[0493] FIG. 4 illustrates the introduction of pre-assembled, histidine-substituted human D gene segments containing a neomycin cassette into a region between the most D-proximal V.sub.H gene segment (V.sub.H 6-1) and the most D-proximal J.sub.H gene segment (J.sub.H1) via enzyme-mediated digestion (PI-SceI and I-CeuI) and ligation. This process removes the hygromycin cassette from MAID 6011 VI434 and introduces pre-assembled human histidine-substituted D gene segments into the clone. Bacterial cells comprising a successfully targeted clone are selected based on both neomycin and spectinomycin resistance. The resulting clone (MAID6012 VI469) comprises, from 5' to 3', (1) a spectinomycin selection cassette, (2) a 50 kb arm comprising a human V.sub.H gene segment (V.sub.H 6-1), (3) a neomycin cassette flanked by loxP sites, (4) human D gene segments containing histidine substitutions (HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD 1.7-6.13 (9268 bp; SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO: 3), and HD 1.20-6.25, 1.26 (11592 bp; SEQ ID NO: 4)), (5) about 25 kb of a genomic region containing human J.sub.H gene segments, (6) a mouse E.sub.i sequence (SEQ ID NO: 5; an intronic enhancer that promotes V.sub.H to DJ.sub.H rearrangement in developing B cells), and (7) a mouse IgM constant region nucleotide sequence (mlgM exon 1; SEQ ID NO: 7).

[0494] FIG. 5 illustrates schemes for deleting the human immunoglobulin heavy chain D gene region from the MAID 1460 heterozygous ES cells by targeting the 129 strain-derived chromosome of MAID 1460 het with the hygromycin selection cassette in MAID 6011 VI434.

[0495] FIG. 6 shows a list of primers and probes used to confirm a loss of allele (LOA), a gain of allele (GOA), or a parental allele (Parental) in the screening assays for identifying MAID 6011.

[0496] FIG. 7 illustrates schemes for constructing MAID 6012 het by targeting MAID 6011 heterozygous ES cells with MAID 6012 VI469. Electroporation of the MAID 6012 VI469 construct into the MAID 6011 heterozygous ES cells yielded MAID 6012 heterozygous ES cells in which the 129 strain-derived chromosome is modified to contain, from 5' to 3' direction, an FRT site, human V.sub.H gene segments, a mouse genomic region comprising adam6 genes, a floxed neomycin selection cassette, human D gene segments comprising histidine substitutions (HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD 1.7-6.13 (9268 bp; SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO: 3), and HD 1.20-6.25, 1.26 (11592 bp; SEQ ID NO: 4)), human J.sub.H gene segments, a mouse E.sub.i sequence (SEQ ID NO: 5; an intronic enhancer that promotes V.sub.H to DJ.sub.H rearrangement in developing B cells), and a mouse IgM constant region nucleotide sequence (mlgM exon 1; SEQ ID NO: 7).

[0497] FIG. 8 shows a list of primers and probes used to confirm a loss of allele (LOA), a gain of allele (GOA), or a parental allele (Parental) in the screening assay for identifying MAID 6012.

[0498] FIG. 9 illustrates schemes for removing a neomycin cassette from MAID 6012 heterozygous ES cells. Electroporation of a Cre-expressing plasmid into the MAID 6012 ES cells lead to recombination and deletion of the floxed neomycin cassette, yielding MAID 6013 heterozygous ES cells.

[0499] FIGS. 10A-10E illustrate human D gene segment nucleotide sequences with translations for each of the six reading frames, i.e., three reading frames for direct 5' to 3' orientation and three reading frames for inverted orientation (3' to 5' orientation). The "*" symbol represents a stop codon, and the comma between two SEQ ID NOs indicates that there are two amino acid sequences separated by the stop codon.

[0500] FIGS. 11-13 illustrate mRNA sequences and their encoded protein sequences expressed by 6013 FO heterozygous mice, which comprise histidine-substituted human D gene segments (HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD 1.7-6.13 (9268 bp; SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO: 3), and HD 1.20-6.25, 1.26 (11592bp; SEQ ID NO: 4)) in the immunoglobulin heavy chain locus in their 129 strain-derived chromosome. The boxed sequences in each figure indicate the presence of histidine codons in the CDR3 sequences derived from the genetically modified immunoglobulin heavy chain locus comprising the histidine-substituted human D gene segments. FWR represents frame region and CDR represents complementarity determining region. In the alignment, the dot "." indicates a sequence identical to the query sequence, and the dash "-" indicates a gap in the sequence.

[0501] FIG. 14 illustrates histidine incorporation frequency in immunoglobulin heavy chain CDR3 sequences. The X-axis represents the number of histidine codons appeared in each CDR3 sequence, and the Y-axis represents the corresponding proportion of reads. The "6013 F0 het" indicates CDR3 sequences expressed by the 6013 heterozygous mice comprising histidine-substituted D gene segments. The "VI3-Adam6" indicates CDR3 sequences obtained from control mice comprising human V.sub.H, D, and J.sub.H gene segments without the histidine modification as described herein. The "ASAP" indicates CDR3 sequences obtained from the Regeneron antibody database, which was used as another control.

DETAILED DESCRIPTION OF THE INVENTION

[0502] This invention is not limited to particular methods, and experimental conditions described, as such methods and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention is defined by the claims.

[0503] Unless defined otherwise, all terms and phrases used herein include the meanings that the terms and phrases have attained in the art, unless the contrary is clearly indicated or clearly apparent from the context in which the term or phrase is used. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, particular methods and materials are now described. All publications mentioned are hereby incorporated by reference

Definitions

[0504] The term "complementary determining region" or "CDR," as used herein, includes an amino acid sequence encoded by a nucleic acid sequence of an organism's immunoglobulin genes that normally (i.e., in a wild type animal) appears between two framework regions in a variable region of a light or a heavy chain of an immunoglobulin molecule (e.g., an antibody or a T cell receptor). A CDR can be encoded by, for example, a germline sequence or a rearranged sequence, and, for example, by a naive or a mature B cell or a T cell. A CDR can be somatically mutated (e.g., vary from a sequence encoded in an animal's germline), humanized, and/or modified with amino acid substitutions, additions, or deletions. In some circumstances (e.g., for a CDR3), CDRs can be encoded by two or more sequences (e.g., germline sequences) that are not contiguous (e.g., in an unrearranged nucleic acid sequence) but are contiguous in a B cell nucleic acid sequence, e.g., as a result of splicing or connecting the sequences (e.g., V-D-J recombination to form a heavy chain CDR3).

[0505] The term "dissociative half-life" or 1.sub.12'' as used herein refers to the value calculated by the following formula: t.sub.1/2 (min)=(In2/k.sub.d)/60, wherein k.sub.d represents a dissociation rate constant.

[0506] The term "germline" in reference to an immunoglobulin nucleic acid sequence includes a nucleic acid sequence that can be passed to progeny.

[0507] The phrase "heavy chain," or "immunoglobulin heavy chain" includes an immunoglobulin heavy chain sequence, including immunoglobulin heavy chain constant region sequence, from any organism. Heavy chain variable domains include three heavy chain CDRs and four FR regions, unless otherwise specified. Fragments of heavy chains include CDRs, CDRs and FRs, and combinations thereof. A typical heavy chain has, following the variable domain (from N-terminal to C-terminal), a C.sub.H1 domain, a hinge, a C.sub.H2 domain, and a C.sub.H3 domain. A functional fragment of a heavy chain includes a fragment that is capable of specifically recognizing an epitope (e.g., recognizing the epitope with a K.sub.D in the micromolar, nanomolar, or picomolar range), that is capable of expressing and secreting from a cell, and that comprises at least one CDR. Heavy chain variable domains are encoded by variable region nucleotide sequence, which generally comprises V.sub.H, D.sub.H, and J.sub.H segments derived from a repertoire of V.sub.H, D.sub.H, and J.sub.H segments present in the germline. Sequences, locations and nomenclature for V, D, and J heavy chain segments for various organisms can be found in IMGT database, which is accessible via the internet on the world wide web (www) at the URL "imgt.org."

[0508] The phrase "light chain" includes an immunoglobulin light chain sequence from any organism, and unless otherwise specified includes human kappa (K) and lambda (A) light chains and a VpreB, as well as surrogate light chains. Light chain variable domains typically include three light chain CDRs and four framework (FR) regions, unless otherwise specified. Generally, a full-length light chain includes, from amino terminus to carboxyl terminus, a variable domain that includes FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, and a light chain constant region amino acid sequence. Light chain variable domains are encoded by the light chain variable region nucleotide sequence, which generally comprises light chain Wand light chain J.sub.L gene segments, derived from a repertoire of light chain V and J gene segments present in the germline. Sequences, locations and nomenclature for light chain V and J gene segments for various organisms can be found in IMGT database, which is accessible via the internet on the world wide web (www) at the URL "imgt.org." Light chains include those, e.g., that do not selectively bind either a first or a second epitope selectively bound by the epitope-binding protein in which they appear. Light chains also include those that bind and recognize, or assist the heavy chain with binding and recognizing, one or more epitopes selectively bound by the epitope-binding protein in which they appear.

[0509] The phrase "operably linked" refers to a relationship wherein the components operably linked function in their intended manner. In one instance, a nucleic acid sequence encoding a protein may be operably linked to regulatory sequences (e.g., promoter, enhancer, silencer sequence, etc.) so as to retain proper transcriptional regulation. In one instance, a nucleic acid sequence of an immunoglobulin variable region (or V(D)J segments) may be operably linked to a nucleic acid sequence of an immunoglobulin constant region so as to allow proper recombination between the sequences into an immunoglobulin heavy or light chain sequence.

[0510] The phrase "somatically mutated," as used herein, includes reference to a nucleic acid sequence from a B cell that has undergone class-switching, wherein the nucleic acid sequence of an immunoglobulin variable region, e.g., a heavy chain variable region (e.g., a heavy chain variable domain or including a heavy chain CDR or FR sequence) in the class-switched B cell is not identical to the nucleic acid sequence in the B cell prior to class-switching, such as, for example a difference in a CDR or a framework nucleic acid sequence between a B cell that has not undergone class-switching and a B cell that has undergone class-switching. The phrase "somatically mutated" includes reference to nucleic acid sequences from affinity-matured B cells that are not identical to corresponding immunoglobulin variable region nucleotide sequences in B cells that are not affinity-matured (i.e., sequences in the genome of germline cells). The phrase "somatically matured" also includes reference to an immunoglobulin variable region nucleic acid sequence from a B cell after exposure of the B cell to an epitope of interest, wherein the nucleic acid sequence differs from the corresponding nucleic acid sequence prior to exposure of the B cell to the epitope of interest. The term "somatically mutated" also refers to sequences from antibodies that have been generated in an animal, e.g., a mouse having human immunoglobulin variable region nucleic acid sequences, in response to an immunogen challenge, and that result from the selection processes inherently operative in such an animal.

Non-Human Animals That Express Immunoglobulin Heavy Chain Variable Domain Comprising Histidine Residues

[0511] The described invention provides genetically modified non-human animals that can produce antigen-binding proteins with pH-dependent antigen binding characteristics. In various embodiments, the antigen-binding proteins produced by the genetically modified non-human animals as described herein exhibit increased pH-dependent recycling efficiency and/or enhanced serum half-life. In particular, the described invention employs genetic modifications in the immunoglobulin heavy chain locus to introduce histidine codons into a human heavy chain variable region nucleotide sequence and, optionally, to introduce a mutation(s) in a constant region nucleotide sequence that encodes C.sub.H2 and/or C.sub.H3 domains that increases the binding of the antibody constant region to an FcRn receptor, which facilitates recycling of the antigen-binding protein. Antigen-binding proteins comprising the modification may more loosely bind its target in an acidic intracellular compartment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0) than in an extracellular environment or at the surface of a cell (i.e., at a physiological pH, e.g., a pH ranging from about 7.0 to about 7.4) due to protonated histidine residues located in the antigen binding sites. Therefore, the antigen-biding proteins comprising the genetic modifications as described herein would be able to be recycled more rapidly or efficiently than wild-type antigen-binding proteins that do not comprise such genetic modifications following target-mediated endocytosis. Furthermore, since the modified histidine residues are protonated only in an acidic environment, but not at a neutral pH, it is expected that such modification would not affect binding affinity and/or specificity of the antigen-binding protein toward an antigen of interest at a physiological pH.

[0512] In various aspects, non-human animals are provided comprising immunoglobulin heavy chain loci that comprise an unrearranged human heavy chain variable region nucleotide sequence, wherein the unrearranged human heavy chain variable region nucleotide sequence comprises an addition of least one histidine codon or a substitution of at least one endogenous non-histidine codon with a histidine codon.

[0513] In various aspects, methods of making and using the non-human animals are also provided. When immunized with an antigen of interest, the genetically modified non-human animals are capable of generating B cell populations that produce antigen-binding proteins comprising heavy chain variable domains with histidine residues, wherein the antigen-binding proteins exhibit enhanced pH-dependent recycling and/or increased serum half-life. In various embodiments, the non-human animals generate B cell populations that express human heavy chain variable domains along with cognate human light chain variable domains. In various embodiments, the genetically modified immunoglobulin heavy chain loci are present in a germline genome of the non-human animal.

[0514] In various embodiments, the genetically modified immunoglobulin heavy chain locus comprises a modification that deletes or renders, all or substantially all, non-functional endogenous V.sub.H, D, and J.sub.H gene segments; and the genetically modified locus comprises an unrearranged heavy chain variable region nucleotide sequence comprising one or more human V.sub.H, D, and/or J.sub.H gene segments having one or more histidine codons, wherein the unrearranged heavy chain variable region nucleotide sequence is present at an endogenous location (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome, or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome). In one embodiment, e.g., about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more of all endogenous heavy chain V, D, or J gene segments are deleted or rendered non-functional. In one embodiment, e.g., at least 95%, 96%, 97%, 98%, or 99% of endogenous functional heavy chain V, D, or J gene segments are deleted or rendered non-functional.

[0515] In one embodiment, the non-human animal is a mammal. Although embodiments directed to introducing histidine codons into an unrearranged human heavy chain variable gene sequence in a mouse are extensively discussed herein, other non-human animals are also provided that comprise a genetically modified immunoglobulin locus containing an unrearranged human heavy chain variable region nucleotide sequence comprising an addition of least one histidine codon or a substitution of at least one endogenous non-histidine codon with a histidine codon. Such non-human animals include any of those which can be genetically modified to express the histidine-containing heavy chain variable domain as disclosed herein, including, e.g., mouse, rat, rabbit, pig, bovine (e.g., cow, bull, buffalo), deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey), etc. For example, for those non-human animals for which suitable genetically modifiable ES cells are not readily available, other methods are employed to make a non-human animal comprising the genetic modification. Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing somatic cell nuclear transfer (SCNT) to transfer the genetically modified genome to a suitable cell, e.g., an enucleated oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo. Methods for modifying a non-human animal genome (e.g., a pig, cow, rodent, chicken, etc. genome) include, e.g., employing a zinc finger nuclease (ZFN) or a transcription activator-like effector nuclease (TALEN) to modify a genome to include a nucleotides sequence that encodes

[0516] In one embodiment, the non-human animal is a small mammal, e.g., of the superfamily Dipodoidea or Muroidea. In one embodiment, the genetically modified animal is a rodent. In one embodiment, the rodent is selected from a mouse, a rat, and a hamster. In one embodiment, the rodent is selected from the superfamily Muroidea. In one embodiment, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamster, New World rats and mice, voles), Muridae (true mice and rats, gerbils, spiny mice, crested rats), Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice), Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole rates, bamboo rats, and zokors). In a specific embodiment, the genetically modified rodent is selected from a true mouse or rat (family Muridae), a gerbil, a spiny mouse, and a crested rat. In one embodiment, the genetically modified mouse is from a member of the family Muridae. In one embodiment, the animal is a rodent. In a specific embodiment, the rodent is selected from a mouse and a rat. In one embodiment, the non-human animal is a mouse.

[0517] In one embodiment, the non-human animal is a rodent that is a mouse of a C57BL strain selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6N, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, and C57BL/OIa. In another embodiment, the mouse is a 129 strain. In one embodiment, the 129 strain is selected from the group consisting of 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/Svlm), 129S2, 129S4, 129S5, 129S9/SvEvH, 129S6 (129/SvEvTac), 129S7, 129S8, 129T1, 129T2 (see, e.g., Festing et al. (1999) Revised nomenclature for strain 129 mice, Mammalian Genome 10:836, see also, Auerbach et al. (2000) Establishment and Chimera Analysis of 129/SvEv- and C57BL/6-Derived Mouse Embryonic Stem Cell Lines). In one embodiment, the genetically modified mouse is a mix of an aforementioned 129 strain and an aforementioned C57BL strain (e.g., a C57BL/6 strain). In another embodiment, the mouse is a mix of aforementioned 129 strains, or a mix of aforementioned C57BL/6 strains. In one embodiment, the 129 strain of the mix is a 129S6 (129/SvEvTac) strain. In another embodiment, the mouse is a mix of a 129/SvEv- and a C57BL/6-derived strain. In a specific embodiment, the mouse is a mix of a 129/SvEv- and a C57BL/6-derived strain as described in Auerbach et al. 2000 Bio Techniques 29:1024-1032. In another embodiment, the mouse is a BALB strain, e.g., BALB/c strain. In another embodiment, the mouse is a mix of a BALB strain (e.g., BALB/c strain) and another aforementioned strain.

[0518] In one embodiment, the non-human animal is a rat. In one embodiment, the rat is selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In one embodiment, the rat strain is a mix of two or more of a strain selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.

[0519] In one embodiment, the non-human animal is a mouse. In one embodiment, the mouse is a VELOCIMMUNE.RTM. humanized mouse.

[0520] VELOCIMMUNE.RTM. humanized mice (see, e.g., U.S. Pat. No. 6,596,541, U.S. Pat. No. 7,105,348, and

[0521] US20120322108A1, which are incorporated herein by reference in their entireties), which contain a precise replacement of mouse immunoglobulin variable regions with human immunoglobulin variable regions at the endogenous mouse loci, display a surprising and remarkable similarity to wild-type mice with respect to B cell development. VELOCIMMUNE.RTM. humanized mice display an essentially normal, wild-type response to immunization that differed only in one significant respect from wild-type mice--the variable regions generated in response to immunization are fully human.

[0522] VELOCIMMUNE.RTM. humanized mice contain a precise, large-scale replacement of germline variable region nucleotide sequences of mouse immunoglobulin heavy chain (IgH) and immunoglobulin light chain (e.g., .kappa. light chain, Ig.kappa.) with corresponding human immunoglobulin variable region nucleotide sequences, at the endogenous loci (see, e.g., U.S. Pat. No. 6,596,541, U.S. Pat. No. 7,105,348, US 20120322108A1, which are incorporated herein by reference in their entireties). In total, about six megabases of mouse loci are replaced with about 1.5 megabases of human genomic sequence. This precise replacement results in a mouse with hybrid immunoglobulin loci that make heavy and light chains that have a human variable regions and a mouse constant region. The precise replacement of mouse V.sub.H-D-J.sub.H and V.kappa.-J.kappa. segments leave flanking mouse sequences intact and functional at the hybrid immunoglobulin loci. The humoral immune system of the mouse functions like that of a wild-type mouse. B cell development is unhindered in any significant respect and a rich diversity of human variable regions is generated in the mouse upon antigen challenge.

[0523] VELOCIMMUNE.RTM. humanized mice are possible because immunoglobulin gene segments for heavy and .kappa. light chains rearrange similarly in humans and mice, which is not to say that their loci are the same or even nearly so--clearly they are not. However, the loci are similar enough that humanization of the heavy chain variable gene locus can be accomplished by replacing about three million base pairs of contiguous mouse sequence that contains all the V.sub.H, D, and J.sub.H gene segments with about one million bases of contiguous human genomic sequence covering basically the equivalent sequence from a human immunoglobulin locus.

[0524] In some embodiments, further replacement of certain mouse constant region nucleotide sequences with human constant region nucleotide sequences (e.g., replacement of mouse heavy chain C.sub.H1 nucleotide sequence with human heavy chain C.sub.H1 nucleotide sequence, and replacement of mouse light chain constant region nucleotide sequence with human light chain constant region nucleotide sequence) results in mice with hybrid immunoglobulin loci that make antibodies that have human variable regions and partly human constant regions, suitable for, e.g., making fully human antibody fragments, e.g., fully human Fab's. Mice with hybrid immunoglobulin loci exhibit normal variable gene segment rearrangement, normal somatic hypermutation frequencies, and normal class switching. These mice exhibit a humoral immune system that is indistinguishable from wild type mice, and display normal cell populations at all stages of B cell development and normal lymphoid organ structures--even where the mice lack a full repertoire of human variable region nucleotide segments. Immunizing these mice results in robust humoral responses that display a wide diversity of variable gene segment usage.

[0525] The precise replacement of the mouse germline variable region nucleotide sequence allows for making mice that have partly human immunoglobulin loci. Because the partly human immunoglobulin loci rearrange, hypermutate, and class switch normally, the partly human immunoglobulin loci generate antibodies in a mouse that comprise human variable regions. Nucleotide sequences that encode the variable regions can be identified and cloned, then fused (e.g., in an in vitro system) with any sequences of choice, e.g., any immunoglobulin isotype suitable for a particular use, resulting in an antibody or antigen-binding protein derived wholly from human sequences.

[0526] In various embodiments, at least one histidine codon is present in an unrearranged heavy chain variable region nucleotide sequence that encodes an N-terminal region, a loop 4 region, a CDR1, a CDR2, a CDR3, or a combination thereof.

[0527] In various embodiments, at least one histidine codon is present in an unrearranged heavy chain variable region nucleotide sequence that encodes a framework region (FR) selected from the group consisting of FR1, FR2, FR3, and FR4.

[0528] In various aspects, the genetically modified immunoglobulin locus comprises a nucleotide sequence wherein at least one codon has been replaced with a histidine codon.

[0529] In various aspects, the genetically modified immunoglobulin locus comprises an unrearranged human heavy chain variable region nucleotide sequence comprising a substitution of at least one endogenous non-histidine codon with a histidine codon.

[0530] In one embodiment, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or more, 34 or more, 35 or more, 36 or more, 37 or more, 38 or more, 39 or more, 40 or more, 41 or more, 42 or more, 43 or more, 44 or more, 45 or more, 46 or more, 47 or more, 48 or more, 49 or more, 50 or more, 51 or more, 52 or more, 53 or more, 54 or more, 55 or more, 56 or more, 57 or more, 58 or more, 59 or more, 60 or more, or 61 or more of the endogenous non-histidine codons are replaced with histidine codons.

[0531] Previous studies on reading frame usage of human immunoglobulin D gene segments have shown that, of the three reading frames (i.e., stop, hydrophobic, and hydrophilic), the stop frame is used very infrequently. Apparently, some stop frames are chewed back and result in expression. However, stop reading frames are used at such a low frequency that for the purposes of engineering histidine codons, it is more efficient not to use the stop reading frame. As between hydrophilic and hydrophobic reading frames, the hydrophilic reading frame appears to be preferred. Thus, in one embodiment, the hydrophilic reading frame of human D gene segments is engineered to contain one or more histidine codons (as compared with the stop frame or with the hydrophobic frame).

[0532] Methods of introducing a mutation in vitro, e.g., site-directed mutagenesis, are well known in the art. In some embodiments of the described invention, histidine codons are enriched by designing histidine-substituted human D gene segments in silico (e.g., mutation of Y, D, and N codons to H codons, e.g., CAT, CAC), which are synthesized (e.g., chemical synthesis) with (unique) restriction enzyme sites for ligating them back together. The synthesized D gene segments are made with the appropriate recombination signal sequences (RSS) upstream and downstream. In one embodiment, when ligated to one another, the synthesized histidine-substituted D gene segments include the intergenic sequences observed in a human between each D gene segment.

[0533] It is understood that the codons that encode the one or more histidines, upon rearrangement and/or somatic hypermutation, may change such that one or more of the histidines will be changed to another amino acid. However, this may not occur for each and every codon encoding histidine, in each and every rearrangement in the non-human animal. If such changes occur, the changes may occur in some but not all B cells or in some but not all heavy chain variable sequences.

[0534] In various aspects, the genetically modified immunoglobulin locus comprises a human heavy chain V, D, and J gene segment, wherein at least one of the human D gene segment has been inverted 5' to 3' with respect to a corresponding wild-type sequence, and wherein at least one reading frame of the inverted human D gene segment comprises a histidine codon.

[0535] In various embodiments, the nucleotide sequence comprises one or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, or 25 or more of histidine codons.

[0536] There are 25 functional human D gene segments in 6 families of 3-5 members each (one family--the D7 family--has a single member). Direct recombination of human D gene segments is much more frequent than inversion, although inverted reading frames exhibit more histidine codons. Certain D gene segments and reading frames are used more frequently than others. All three direct reading frames and all three inverted orientation reading frames for all the functional D gene segments are presented in FIGS. 10A-10E. As shown in FIGS. 10A-10E, there are many more histidine codons in inverted reading frames than in direct reading frames. More specifically, there are 34 histidines in inverted reading frames and only four in direct reading frames. In addition, of the four in direct reading frames, three histidines are encoded by pseudogenes or present in alternate alleles. Therefore, there is only a single direct reading frame of a germline human D gene segment that contains a histidine codon, with further histidine codons possibly encountered in alternate alleles (presumably in subsets of the human population).

[0537] Inverted D rearrangements are extremely rare. Tuaillon et al. (J. Immunol., 154(12): 5453-6465, incorporated by reference herein in its entirety) showed that usage of inverted reading frames (as measured by limiting dilution PCT) is very rare, i.e., that the ratio of direct to indirect rearrangements are, in most cases, 100 to 1000. To the extent that the ratio of direct to indirect rearrangement was low, it was only observed in those D segments that exhibit very low usage. It was also shown that D gene segment family 7, which is located adjacent to J1 (far down from other D family members) is mostly used in fetuses, but exhibits a low usage in adults (Schroeder et al., Immunology 30, 2006, 119-135, incorporated by reference herein in its entirety). Therefore, in one embodiment, D family 7 sequences are not inverted 5' to 3'.

[0538] In one embodiment, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, at least twenty one, at least twenty two, at least twenty three, at least twenty four, or all or substantially all of the human functional D gene segments are inverted 5' to 3' with respect to corresponding wild type sequences.

[0539] In one embodiment, the human immunoglobulin heavy chain variable domain comprising at least one non-naturally occurring histidine residue exhibits pH-dependent antigen binding characteristics. For example, an antibody comprising the modified immunoglobulin heavy chain variable domain binds a target with sufficient affinity at around a neutral pH (e.g., pH of about 7.0 to about 7.4), but either does not bind or binds weaker to the same target at an acidic pH (e.g., pH of about 5.5 to about 6.0). In one embodiment, the acidic pH is selected from about 5.5, about 5.6, about 5.7, about 5.8, about 5.9, and about 6.0. In one embodiment, the neutral pH is selected from about 7.0, about 7.1, about 7.2, about 7.3, and about 7.4.

[0540] In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 2 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 25.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin heavy chain locus as described herein has a dissociative half-life (t.sub.1/2) of less than 1 min at an acidic pH (e.g., pH of about 5.5 to about 6.0) at 37.degree. C. In one embodiment, an antigen-binding protein comprising a heavy chain variable domain expressed by the genetically modified immunoglobulin locus as described herein has at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, or at least about 30-fold decrease in dissociative half-life (t.sub.1/2) at an acidic pH (e.g., pH of about 5.5 to about 6.0) as compared to the dissociative half-life (t.sub.1/2) of the antigen-binding protein at a neutral pH (e.g., pH of about 7.0 to about 7.4).

[0541] In one embodiment, antigen binding proteins comprising the genetically modified human immunoglobulin heavy chain variable domain is capable of specifically binding an antigen of interest with an affinity (K.sub.D) lower than 10.sup.-6, 10.sup.-7, 10.sup.-8, 10.sup.-9 or 10.sup.-10, 10.sup.-11, 10.sup.-12 at a neutral or physiological pH (pH of about 7.0 to about 7.4).

[0542] The altered binding property of the immunoglobulin heavy chain variable domain at an acidic pH (e.g., pH of about 5.5 to about 6.0) would, in some circumstances, allow faster turnover of the antibody because the therapeutic antibody will bind a target on a cell's surface, be internalized into an endosome, and more readily or more rapidly dissociate from the target in the endosome, so that the therapeutic can be recycled to bind yet another molecule of target present in another cell. This would allow one to administer a therapeutic antibody at a lower dose, or administer the therapeutic antibody less frequently. This is particularly useful in a situation where it is not desirable to administer a therapeutic antibody frequently, or administer at a level above a certain dosage for safety or toxicity reasons.

[0543] In various embodiments, the human immunoglobulin heavy chain variable region nucleotide sequence as described herein is operably linked to a human or non-human heavy chain constant region nucleotide sequence (e.g., a heavy chain constant region nucleotide sequence that encodes an immunoglobulin isotype selected from IgM, IgD, IgG, IgE, and IgA). In various embodiments, the human or non-human heavy chain constant region nucleotide sequence is selected from the group consisting of a C.sub.H1, a hinge, a C.sub.H2, a C.sub.H3, and a combination thereof. In one embodiment, the constant region nucleotide sequence comprises a C.sub.H1, a hinge, a C.sub.H2, and a C.sub.H3 (e.g., C.sub.H1-hinge-a C.sub.H2-C.sub.H3).

[0544] In various embodiments, the heavy chain constant region nucleotide sequence is present at an endogenous locus (i.e., where the nucleotide sequence is located in a wild-type non-human animal) or present ectopically (e.g., at a locus different from the endogenous immunoglobulin chain locus in its genome, or within its endogenous locus, e.g., within an immunoglobulin variable locus, wherein the endogenous locus is placed or moved to a different location in the genome).

[0545] In one embodiment, the heavy chain constant region nucleotide sequence comprises a modification in a C.sub.H2 or a C.sub.H3, wherein the modification increases the affinity of the heavy chain constant region amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0546] The neonatal Fc receptor for IgG (FcRn) has been well characterized in the transfer of passive humoral immunity from a mother to her fetus across the placenta and proximal small intestine (Roopenian, D. and Akilesh, S., Nat. Rev. Immun., 2007, 7:715-725, which is incorporated by reference herein in its entirety). FcRn binds to the Fc portion of IgG at a site that is distinct from the binding sites of the classical FcyRs or the C1q component of complement, which initiates the classical pathway of complement activation. More specifically, it was shown that FcRn binds the C.sub.H2-C.sub.H3 hinge region of IgG antibodies--a versatile region of Fc that also binds Staphylococcal protein A, Streptococcal protein G, and the rheumatoid factor. In contrast to other Fc-binding proteins, however, FcRn binds the Fc region of IgG in a strictly pH-dependent manner; at physiological pH 7.4, FcRn does not bind IgG, whereas at the acidic pH of the endosome (e.g., where the pH ranges from about 5.5 to about 6.0), FcRn exhibits a low micromolar to nanomolar affinity for the Fc region of IgG. This pH-dependent interaction has been shown to be mediated by the titration of histidine residues in the C.sub.H2-C.sub.H3 region of IgG and their subsequent interaction with acidic residue on the surface of FcRn (Roopenian, D. and Akilesh, S., Nat. Rev. Immun., 2007, 7:715-725, incorporated by reference in its entirety).

[0547] Various mutations in the C.sub.H2-C.sub.H3 region of IgG that can increase the affinity of Fc region to FcRn at an acidic pH are known in the art. These include, but are not limited to, modification at position 250 (e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a modification at 428 and/or 433 (e.g., L/R/S/P/Q or K) and/or 434 (e.g., H/F or Y); or a modification at 250 and/or 428; or a modification at 307 or 308 (e.g., 308F, V308F), and 434. In another example, the modification can comprise a 428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L, 259I (e.g., V259I), and 308F (e.g., V308F) modification; a 433K (e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and 256 (e.g., 52Y, 254T, and 256E) modification; a 250Q and 428L modification, or a combination thereof.

[0548] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 252 and 257, wherein the modification increases the affinity of the human C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0549] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H2 amino acid sequence comprising at least one modification between amino acid residues at positions 307 and 311, wherein the modification increases the affinity of the C.sub.H2 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0550] In one embodiment, the heavy chain constant region nucleotide sequence encodes a human C.sub.H3 amino acid sequence, wherein the C.sub.H3 amino acid sequence comprises at least one modification between amino acid residues at positions 433 and 436, wherein the modification increases the affinity of the C.sub.H3 amino acid sequence to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).

[0551] In one embodiment, the human constant region amino acid sequence encoded by the heavy chain constant region nucleotide sequence described herein comprises a mutation selected from the group consisting of M428L, N434S, and a combination thereof. In one embodiment, the human constant region amino acid sequence comprises a mutation selected from the group consisting of M428L, V259I, V308F, and a combination thereof. In one embodiment, the human constant region amino acid sequence comprises an N434A mutation. In one embodiment, the human constant region amino acid sequence comprises a mutation selected from the group consisting of M252Y, S254T, T256E, and a combination thereof. In one embodiment, the human constant region amino acid sequence comprises a mutation selected from the group consisting of T250Q, M248L, or both. In one embodiment, the human constant region amino acid sequence comprises a mutation selected from the group consisting of H433K, N434Y, or both.

[0552] In one embodiment, the heavy chain constant region amino acid sequence is a non-human constant region amino acid sequence, and the heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

[0553] In one embodiment, the heavy chain constant region nucleotide sequence is a human heavy chain constant region amino acid sequence, and the human heavy chain constant region amino acid sequence comprises one or more of any of the types of modifications described above.

EXAMPLES

[0554] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.

p Example 1

Construction of Humanized Immunoglobulin Heavy Chain Loci Comprising Histidine-Substituted D Gene Segments

[0555] Construction of immunoglobulin heavy chain loci comprising histidine-substituted human D gene segments was carried out by series of homologous recombination reactions in bacterial cells (BHR) using Bacterial Artificial Chromosome (BAC) DNA. Several targeting constructs for creation of a genetically engineered mouse that expresses a heavy chain variable domain comprising one or more histidine residues were generated using VELOCIGENE.RTM. genetic engineering technology (see, e.g., U.S. Pat. No. 6,586,251 and Valenzuela, D. M. et al. (2003), High-throughput engineering of the mouse genome coupled with high-resolution expression analysis, Nature Biotechnology 21(6):652-659, which is incorporated herein by reference in their entireties).

[0556] Initially, human D gene segments were synthesized in silico as four pieces (4 repeats) in which the codons encoding tyrosine (Y), asparagine (N), serine (S), glycine (G), and aspartate (D) in the hydrophilic frame were substituted with histidine codons (hereinafter "histidine-substituted human D gene segments", i.e., HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD 1.7-6.13 (9268 bp; SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO: 3), and HD 1.20-6.25, 1.26 (11592 bp; SEQ ID NO: 4) (FIG. 3). The four repeats also contained unique restriction enzyme sites at the ends for ligating them back together. The specific location of the histidine substitutions (labeled in bold type) in each human D gene segment is shown in FIGS. 1A and 1B in the column labeled "Hydrophilic." As shown in FIG. 1, while the modification introduced histidine codons in the hydrophilic reading frame, it also changed some stop codons to serine codons in the "Stop" reading frame. The modification, however, made few changes in the "Hydrophobic" reading frame. The detailed procedure for ligating the four synthesized D segment repeats is illustrated in FIG. 3 (sequential ligation). The resulting clone contained, from 5' to 3', a 5' mouse homology arm, a floxed neomycin cassette, human D gene segments comprising histidine substitutions (i.e., HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD 1.7-6.13 (9268 bp; SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO: 3), and HD 1.20-6.25, 1.26 (11592 bp; SEQ ID NO: 4)), a chloramphenicol selection cassette, and a 3' homology arm.

[0557] The following six genetic modifications were carried out in order to replace the endogenous human D gene segments in the VELOCIMMUNE.RTM. humanized mouse with the histidine-substituted human D gene segments described above.

[0558] First, pLMa0174, containing a spectinomycin selection cassette and an AsiSI restriction site, was targeted into the 5' end of the MAID 1116 clone (Step 1. BHR (Spec); FIG. 2). During Step 1, a chloramphenicol selection cassette, a neomycin selection cassette, a loxP site, two V.sub.H gene segments (hV.sub.H1-3 and hV.sub.H1-2), and the human Adam6p gene, all of which are located 5' upstream of hV.sub.H6-1, were deleted from the MAID 1116 clone and replaced by a spectinomycin cassette to yield the VI433 clone.

[0559] Second, in Step 2 (BHR (Hyg+Spec); FIG. 2), pNTu0002 containing a hygromycin cassette flanked by FRT sites was targeted into a region comprising human immunoglobulin D.sub.H gene segments. During Step 2, all human heavy chain D gene segments were deleted from VI433 and replaced with the hygromycin cassette to yield MAID6011 VI434 (clone 1). The modification also introduced the PI-SceI and the I-CeuI restriction sites at the 5' and 3' end of the hygromycin cassette.

[0560] Third, the genomic region comprising histidine-substituted human D gene segments (HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD 1.7-6.13 (9268 bp; SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO: 3), and HD 1.20-6.25, 1.26 (11592 bp; SEQ ID NO: 4)) were introduced into a region between the PI-SceI and the I-CeuI sites of MAID 6011 VI434 via restriction digestion and ligation (PI-SceI/I-CeuI Ligation modified 1116 (Kan+Spec); FIG. 4). This yielded MAID6012 VI469 containing, from 5' to 3', a spectinomycin cassette, about 50 kb of a genomic region comprising V.sub.H6-1, a floxed neomycin cassette, about 40 kb of the histidine-substituted human D gene segments (HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD 1.7-6.13 (9268 bp; SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO: 3), and HD 1.20-6.25, 1.26 (11592 bp; SEQ ID NO: 4)), and about 25 kb of a genomic region containing human J.sub.H gene segments, followed by a mouse E.sub.i (mIgH intronic enhancer; SEQ ID NO: 5), a mouse switch region (SEQ ID NO: 6), and a mouse IgM constant region nucleotide sequence (mIgM exon 1; SEQ ID NO: 7). Bacterial cells containing the modification were selected based on Kanamycin and Spectinomycin selection.

[0561] Fourth, MAID 1460 heterozygous mouse ES cells were targeted with MAID 6011 VI434 via electroporation in order to remove all endogenous human D gene segments from the MAID 1460 clone as illustrated in FIG. 5. This yielded MAID 6011 heterozygous mouse ES cells comprising in its immunoglobulin heavy chain locus (at the 129 strain-derived chromosome), from 5' to 3', an FRT site, human V.sub.H gene segments, a mouse genomic region encompassing adam6a/b genes, a hygromycin cassette flanked by FRT sites, and human J.sub.H segments, followed by a mouse E.sub.i sequence and an IgM constant region nucleotide sequence. The genetic modification of MAID 6011 (a loss of alleles, a gain of alleles, and presence of parental alleles) was confirmed by using the probes and primers as shown in FIG. 6.

[0562] Fifth, MAID 6011 heterozygous mouse ES cells were electroporated with MAID 6012 VI469 in order to introduce histidine-substituted human D gene segments (i.e., HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD 1.7-6.13 (9268 bp; SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO: 3), and HD 1.20-6.25, 1.26 (11592 bp; SEQ ID NO: 4)) into MAID 6011. The targeting step removed the floxed hygromycin selection cassette from MAID 6011 and replaced the sequence with the histidine-substituted human D gene segments. This lead to MAID 6012 hetrozygous ES cells comprising a wild-type C57BL/6 strain-derived chromosome and a genetically modified 129 strain-derived chromosome comprising human wild-type V.sub.H and J.sub.H gene segments and the histidine-substituted human D gene segments described herein. In addition, the ES cells contained a mouse genomic region encompassing adam6a/b genes and a floxed neomycin cassette between the V.sub.H and D segments (FIG. 7). The genetic modification of MAID 6012 (a loss of alleles, a gain of alleles, and presence of parental alleles) was confirmed by using the probes and primers as shown in FIG. 8.

[0563] Lastly, MAID 6012 ES cells were electroporated with a plasmid that expresses a Cre recombinase in order to remove the neomycin selection cassette from the MAID 6012 ES cells, resulting in MAID 6013 heterozygous ES cells (FIG. 9). The final MAID 6013 heterozygous ("MAID 6013 het") ES cell contains a wild-type C57BL/6 strain-derived chromosome and a genetically modified, 129 strain-derived chromosome comprising in its immunoglobulin heavy chain locus, from 5' to 3', (1) an FRT site; (2) human V.sub.H gene segments; (3) a mouse genomic region encompassing adam6a/b genes; (4) a floxed neomycin selection cassette; (5) histidine-substituted human D gene segments (HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD 1.7-6.13 (9268 bp; SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO: 3), and HD 1.20-6.25, 1.26 (11592 bp; SEQ ID NO: 4)); (6) human J.sub.H gene segments; followed by (7) a mouse E.sub.i sequence (mIgH intronic enhancer; SEQ ID NO: 5), (8) a switch region (SEQ ID NO: 6); and (9) a mouse IgM constant region nucleotide sequence (mIgM exon 1; SEQ ID NO: 7) as illustrated in FIG. 9.

[0564] The targeted ES cells (MAID 6013) described above were used as donor ES cells and introduced into an 8-cell stage mouse embryo by the VELOCIMOUSE.RTM. method (see, e.g., U.S. Pat. No. 7,576,259, U.S. Pat. No. 7,659,442, U.S. Pat. No. 7,294,754, US 2008-0078000 A1, all of which are incorporated by reference herein in their entireties). Mice bearing the genetically modified immunoglobulin heavy chain locus comprising the histidine-substituted human heavy chain D gene segments described herein were identified by genotyping using the primers and probes set forth in FIG. 8. The resulting genetically modified FO mouse was crossed to a wild-type mouse to obtain F1 offspring. F1 pups were genotyped, and the F1 pups that are heterozygous for the genetically modified immunoglobulin locus comprising histidine-substituted human heavy chain D gene segments were selected for further characterization.

Example 2

Analysis of Rearranged Heavy Chain Variable Region Nucleotide Sequences

[0565] Next, it was examined whether the genetically modified mouse comprising histidine-substituted human D gene segments described herein, i.e., 6013 F0 heterozygous mouse, which comprises in its germline a 129 strain-derived chromosome comprising human V.sub.H, J.sub.H gene segments, and histidine-substituted human D gene segments (HD 1.1-6.6 (9586 bp; SEQ ID NO: 1), HD 1.7-6.13 (9268 bp; SEQ ID NO: 2), HD 1.14-6.19 (9441 bp; SEQ ID NO: 3), and HD 1.20-6.25, 1.26 (11592 bp; SEQ ID NO: 4), can express rearranged heavy chain V(D)J sequences comprising one or more histidine codons derived from the genetically modified immunoglobulin heavy chain locus.

[0566] To this end, mRNA sequences encoding IgM heavy chain variable region were analyzed for the presence of IgM CDR3 sequences derived from the histidine-substituted human D gene segments via high throughput sequencing. Briefly, spleens were harvested and homogenized in 1.times.PBS (Gibco) using glass slides. Cells were pelleted in a centrifuge (500.times.g for 5 minutes), and red blood cells were lysed in ACK Lysis buffer (Gibco) for 3 minutes. Cells were washed with 1.times.PBS and filtered using a 0.7 .mu.m cell strainer. B-cells were isolated from spleen cells using MACS magnetic positive selection for CD19 (Miltenyi Biotec). Total RNA was isolated from pelleted B-cells using the RNeasy Plus kit(Qiagen). PolyA+mRNA was isolated from total RNA using the Oligotex.RTM. Direct mRNA mini kit (Qiagen).

[0567] Double-stranded cDNA was prepared from splenic B cell mRNA by 5' RACE using the SMARTer.TM. Pico cDNA Synthesis Kit (Clontech). The Clontech reverse transcriptase and dNTPs were substituted with Superscript II and dNTPs from Invitrogen. Heavy chain variable region (V.sub.H) antibody repertoires were amplified from the cDNA using primers specific for IgM constant regions and the SMARTer.TM. 5' RACE primer (Table 1). PCR products were cleaned up using a QIAquick.RTM. PCR Purification Kit (Qiagen). A second round of PCR was done using the same 5' RACE primer and a nested 3' primer specific for the IgM constant regions (Table 2). The second round PCR products were purified using a SizeSelect.TM. E-gel.RTM. system (Invitrogen). A third PCR was performed with primers that added 454 adapters and barcodes. The third round PCR products were purified using Agencourt.RTM. AMPure.RTM. XP Beads. Purified PCR products were quantified by SYBR.RTM.-qPCR using a KAPA Library Quantification Kit (KAPA Biosystems). Pooled libraries were subjected to emulsion PCR (emPCR) using the 454 GS Junior Titanium Series Lib-A emPCR Kit (Roche Diagnostics) and bidirectional sequencing using Roche 454 GS Junior instrument according to the manufacturer's protocols.

TABLE-US-00001 TABLE 1 NAME SEQUENCE 3' mIgM CH1 outer TCTTATCAGACAGGGGGCTCTC (SEQ ID NO: 321)

TABLE-US-00002 TABLE 2 NAME 3' mIgM GGAAGACATTTGGGAAGGACTG (SEQID NO: 322) CH1 inner

[0568] Bioinfomatic Analysis

[0569] The 454 sequences were sorted based on the sample barcode perfect match and trimmed for quality. Custom D database was created using histidine-substituted human D-gene segments. Sequences were annotated based on alignment of rearranged Ig sequences to human germline V and J gene segments database using local installation of igblast (NCBI, v2.2.25+). Sequences derived from the endogenous mouse immunoglobulin heavy chain locus were filtered out using similarity threshold of 90%. A sequence was marked as ambiguous and removed from analysis when multiple best hits with identical score were detected. A set of perl scripts was developed to analyze results and store data in mysql database. The CDR3 region was defined between conserved C codon and FGXG motif (SEQ ID NO: 323) for light chains and WGXG motif (SEQ ID NO: 324) for heavy chains. CDR3 length was determined using only productive antibodies. Number of histidine codons was calculated for each CDR3 region.

[0570] As shown in FIGS. 11-13, the 6013 F0 heterozygous mice expressed a diverse repertoire of rearranged heavy chain variable region mRNA sequences (rearranged V-D-J sequences) encoding one or more histidine codons in CDR3. The sequencing and alignment data suggested that the histidine codons appeared in CDR3 sequences were derived from various histidine-substituted human D gene segments present in the genetically modified immunoglobulin heavy chain locus of the 6013 mice described herein. In addition, as compared with control mice comprising human V.sub.H, D.sub.H, J.sub.H gene segments and mouse adam6 genes (VI3-Adam6, US Publication No. 2012/0322108A1, which is incorporated by reference in its entirety), the genetically modified 6013 F0 heterozygous mice exhibited a higher frequency of histidine occurrence in the heavy chain CDR3 sequences (FIG. 14).

[0571] While the described invention has been described with reference to the specific embodiments thereof it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adopt a particular situation, material, composition of matter, process, process step or steps, to the objective spirit and scope of the described invention. All such modifications are intended to be within the scope of the claims appended hereto.

Sequence CWU 1

1

32419586DNAHomo sapiensmisc_feature(1)..(9586)HD 1.1-6.6 1tccccgttga agctgacctg cccagagggg cctgggccca ccccacacac cggggcggaa 60tgtgtacagg ccccggtctc tgtgggtgtt ccgctaactg gggctcccag tgctcacccc 120acaactaaag cgagccccag cctccagagc ccccgaagga gatgccgccc acaagcccag 180cccccatcca ggaggcccca gagctcaggg cgccggggca gattctgaac agccccgagt 240cacggtgggt accactggca cgaccaccgt gagaaaaact gtgtccaaaa ctgtctcctg 300gcccctgctg gaggccgcgc cagagagggg agcagccgcc ccgaacctag gtcctgctca 360gctcacacga cccccagcac ccagagcaca acggagtccc cattgaatgg tgaggacggg 420gaccagggct ccagggggtc atggaagggg ctggacccca tcctactgct atggtcccag 480tgctcctggc cagaactgac cctaccaccg acaagagtcc ctcagggaaa cgggggtcac 540tggcacctcc cagcatcaac cccaggcagc acaggcataa accccacatc cagagccgac 600tccaggagca gagacacccc agtaccctgg gggacaccga ccctgatgac tccccactgg 660aatccacccc agagtccacc aggaccaaag accccgcccc tgtctctgtc cctcactcag 720gacctgctgc ggggcgggcc atgagaccag actcgggctt agggaacacc actgtggccc 780caacctcgac caggccacag gcccttcctt cctgccctgc ggcagcacag actttggggt 840ctgtgcagag aggaatcaca gaggccccag gctgaggtgg tgggggtgga agacccccag 900gaggtggccc acttcccttc ctcccagctg gaacccacca tgaccttctt aagatagggg 960tgtcatccga ggcaggtcct ccatggagct cccttcaggc tcctccccgg tcctcactag 1020gcctcagtcc cggctgcggg aatgcagcca ccacaggcac accaggcagc ccagacccag 1080ccagcctgca gtgcccaagc ccacattctg gagcagagca ggctgtgtct gggagagtct 1140gggctcccca ccgccccccc gcacacccca cccacccctg tccaggccct atgcaggagg 1200gtcagagccc cccatggggt atggacttag ggtctcactc acgtggctcc cctcctgggt 1260gaaggggtct catgcccaga tccccacagc agagctggtc aaaggtggag gcagtggccc 1320cagggccacc ctgacctgga ccctcaggct cctctagccc tggctgccct gctgtccctg 1380ggaggcctgg actccaccag accacaggtc cagggcaccg cccataggtg ctgcccacac 1440tcagttcaca ggaagaagat aagctccaga cccccaagac tgggacctgc cttcctgcca 1500ccgcttgtag ctccagacct ccgtgcctcc cccgaccact tacacacggg ccagggagct 1560gttccacaaa gatcaacccc aaaccgggac cgcctggcac tcgggccgct gccacttccc 1620tctccatttg ttcccagcac ctctgtgctc cctccctcct ccctccttca ggggaacagc 1680ctgtgcagcc cctccctgca ccccacaccc tggggaggcc caaccctgcc tccagccctt 1740tctcccccgc tgctcttcct gcccatccag acaaccctgg ggtcccatcc ctgcagccta 1800caccctggtc tccacccaga cccctgtctc tccctccaga cacccctccc aggccaaccc 1860tgcacatgca ggccctcccc ttttctgctg ccagagcctc agtttctacc ctctgtgcct 1920accccctgcc tcctcctgcc cacaactcga gctcttcctc tcctggggcc cctgagccat 1980ggcactgacc gtgcactccc acccccacac tgcccatgcc ctcaccttcc tcctggacac 2040tctgaccccg ctcccctctt ggacccagcc ctggtatttc caggacaaag gctcacccaa 2100gtcttcccca tgcaggccct tgccctcact gcccggttac acggcagcct cctgtgcaca 2160gaagcaggga gctcagccct tccacaggca gaaggcactg aaagaaatcg gcctccagca 2220ccctgatgca cgtccgcctg tgtctctcac tgcccgcacc tgcagggagg ctcggcactc 2280cctgtaaaga cgagggatcc aggcagcaac atcatgggag aatgcagggc tcccagacag 2340cccagccctc tcgcaggcct ctcctgggaa gagacctgca gccaccactg aacagccacg 2400gagcccgctg gatagtaact gagtcagtga ccgacctgga gggcagggga gcagtgaacc 2460ggagcccaga ccatagggac agagaccagc cgctgacatc ccgagcccct cactggcggc 2520cccagaacac cgcgtggaaa cagaacagac ccacattccc acctggaaca gggcagacac 2580tgctgagccc ccagcaccag ccctgagaaa caccaggcaa cggcatcaga gggggctcct 2640gagaaagaaa ggaggggagg tctccttcac cagcaagtac ttcccttgac caaaaacagg 2700gtccacgcaa ctcccccagg acaaaggagg agccccctgt acagcactgg gctcagagtc 2760ctctcccaca caccctgagt ttcagacaaa aaccccctgg aaatcatagt atcagcagga 2820gaactagcca gagacagcaa gaggggactc agtgactccc gcggggacag gaggattttg 2880tgggggctcg tgtcactgtg aggacattgt agtcatacca gctgccatac ccacagtgac 2940acagccccat tcccaaagcc ctgctgtaaa cgcttccact tctggagctg aggggctggg 3000gggagcgtct gggaagtagg gcctaggggt ggccatcaat gcccaaaacg caccagactc 3060ccccccagac atcaccccac tggccagtga gcagagtaaa cagaaaatga gaagcagctg 3120ggaagcttgc acaggcccca aggaaagagc tttggcgggt gtgcaagagg ggatgcgggc 3180agagcctgag cagggccttt tgctgtttct gctttcctgt gcagatagtt ccataaactg 3240gtgttcaaga tcgatggctg ggagtgagcc caggaggaca gtgtgggaag ggcacaggga 3300aggagaagca gccgctatcc tacactgtca tctttcaaga gtttgccctg tgcccacaat 3360gctgcatcat gggatgctta acagctgatg tagacacagc taaagagaga atcagtgaaa 3420tggatttgca gcacagatct gaataaattc tccagaatgt ggagccacac agaagcaagc 3480acaaggaaag tgcctgatgc aagggcaaag tacagtgtgt accttcaggc tgggcacaga 3540cactctgaaa agccttggca ggaactccct gcaacaaagc agagccctgc aggcaatgcc 3600agctccagag ccctccctga gagcctcatg ggcaaagatg tgcacaacag gtgtttctca 3660tagccccaaa ctgagaatga agcaaacagc catctgaagg aaaacaggca aataaacgat 3720ggcaggttca tgaaatgcaa acccagacag ccagaaggac aacagtgagg gttacaggtg 3780actctgtggt tgagttcatg acaatgctga gtaattggag taacaaagga aagtccaaaa 3840aatactttca atgtgatttc ttctaaataa aatttacagc cggcaaaatg aactatcttc 3900ttaagggata aactttccac taggaaaact ataaggaaaa tcaagaaaag gatgatcaca 3960taaacacagt ggtcgttact tctactgggg aaggaagagg gtatgaactg agacacacag 4020ggttggcaag tctcctaaca agaacagaac aaatacatta cagtaccttg aaaacagcag 4080ttaaaattct aaattgcaag aagaggaaaa tgcacacagc tgtgtttaga aaattctcag 4140tccagcactg ttcataatag caaagacatt aacccaggtt ggataaataa acgatgacac 4200aggcaattgc acaatgatac agacatacat tcagtatatg agacattgat gatgtatccc 4260caaagaaatg actttaaaga gaaaaggcct gatatgtggt ggcactcacc tccctgggca 4320tccccggaca ggctgcaggc acactgtgtg gcagggcagg ctggtacctg ctggcagctc 4380ctggggcctg atgtggagca ggcacagagc cgtatccccc cgaggacata tacccccaag 4440gacggcacag ttggtacatt ccggagacaa gcaactcagc cacactccca ggccagagcc 4500cgagagggac gcccatgcac agggaggcag agcccagctc ctccacagcc agcagcaccc 4560gtgcaggggc cgccatctgg caggcacaga gcatgggctg ggaggagggg cagggacacc 4620aggcagggtt ggcaccaact gaaaattaca gaagtctcat acatctacct cagccttgcc 4680tgacctgggc ctcacctgac ctggacctca cctggcctgg acctcacctg gcctagacct 4740cacctctggg cttcacctga gctcggcctc acctgacttg gaccttgcct gtcctgagct 4800cacatgatct gggcctcacc tgacctgggt ttcacctgac ctgggcttca cctgacctgg 4860gcctcatctg acctgggcct cactggcctg gacctcacct ggcctgggct tcacctggcc 4920tcaggcctca tctgcacctg ctccaggtct tgctggaacc tcagtagcac tgaggctgca 4980ggggctcatc cagggttgca gaatgactct agaacctccc acatctcagc tttctgggtg 5040gaggcacctg gtggcccagg gaatataaaa agcctgaatg atgcctgcgt gatttggggg 5100caatttataa acccaaaagg acatggccat gcagcgggta gggacaatac agacagatat 5160cagcctgaaa tggagcctca gggcacaggt gggcacggac actgtccacc taagccaggg 5220gcagacccga gtgtccccgc agtagacctg agagcgctgg gcccacagcc tcccctcggt 5280gccctgctac ctcctcaggt cagccctgga catcccgggt ttccccaggc ctggcggtag 5340gtttggggtg aggtctgtgt cactgtggta tcaccatttt tggagtggtc attataccca 5400cagtgtcaca gagtccatca aaaacccatc cctgggaacc ttctgccaca gccctccctg 5460tggggcaccg ccgcgtgcca tgttaggatt ttgactgagg acacagcacc atgggtatgg 5520tggctaccgc agcagtgcag cccgtgaccc aaacacacag ggcagcaggc acaacagaca 5580agcccacaag tgaccaccct gagctcctgc ctgccagccc tggagaccat gaaacagatg 5640gccaggatta tcccataggt cagccagacc tcagtccaac aggtctgcat cgctgctgcc 5700ctccaatacc agtccggatg gggacagggc tggcccacat taccatttgc tgccatccgg 5760ccaacagtcc cagaagcccc tccctcaagg ctgggccaca tgtgtggacc ctgagagccc 5820cccatgtctg agtaggggca ccaggaaggt ggggctggcc ctgtgcactg tccctgcccc 5880tgtggtccct ggcctgcctg gccctgacac ctgggcctct cctgggtcat ttccaagaca 5940gaagacattc ccaggacagc tggagctggg agtccatcat cctgcctggc cgtcctgagt 6000cctgcgcctt tccaaacctc acccgggaag ccaacagagg aatcacctcc cacaggcaga 6060gacaaagacc ttccagaaat ctctgtctct ctccccagtg ggcaccctct tccagggcag 6120tcctcagtga tatcacagtg ggaacccaca tctggatcgg gactgccccc agaacacaag 6180atggcccaca gggacagccc cacagcccag cccttcccag acccctaaaa ggcgtcccac 6240cccctgcatc tgccccaggg ctcaaactcc aggaggactg actcctgcac accctcctgc 6300cagacatcac ctcagcccct cctggaaggg acaggagcgc gcaagggtga gtcagaccct 6360cctgccctcg atggcaggcg gagaagattc agaaaggtct gagatcccca ggacgcagca 6420ccactgtcaa tgggggcccc agacgcctgg accagggcct gcgtgggaaa ggcctctggg 6480cacactcagg ggctttttgt gaagggtcct cctactgtgt gaccacagtc actaccacag 6540tgatgaaccc agcagcaaaa actgaccgga ctcccaaggt ttatgcacac ttctccgctc 6600agagctctcc aggatcagaa gagccgggcc caagggtttc tgcccagacc ctcggcctct 6660agggacatct tggccatgac agcccatggg ctggtgcccc acacatcgtc tgccttcaaa 6720caagggcttc agagggctct gaggtgacct cactgatgac cacaggtgcc ctggcccctt 6780ccccaccagc tgcaccagac cccgtcatga cagatgcccc gattccaaca gccaattcct 6840ggggccagga atcgctgtag acaccagcct ccttccaaca cctcctgcca attgcctgga 6900ttcccatccc ggttggaatc aagaggacag catcccccag gctcccaaca ggcaggactc 6960ccacaccctc ctctgagagg ccgctgtgtt ccgtagggcc aggctgcaga cagtccccct 7020cacctgccac tagacaaatg cctgctgtag atgtccccac ctggaaaata ccactcatgg 7080agcccccagc cccaggtaca gctgtagaga gagtctctga ggcccctaag aagtagccat 7140gcccagttct gccgggaccc tcggccaggc tgacaggagt ggacgctgga gctgggccca 7200tactgggcca cataggagct caccagtgag ggcaggagag cacatgccgg ggagcaccca 7260gcctcctgct gaccagaggc ccgtcccaga gcccaggagg ctgcagaggc ctctccaggg 7320ggacactgtg catgtctggt ccctgagcag ccccccacgt ccccagtcct gggggcccct 7380ggcacagctg tctggaccct ctctattccc tgggaagctc ctcctgacag ccccgcctcc 7440agttccaggt gtggttattg tcagggggtg tcagactgtg gtggacacag ccatggttac 7500cacagtggtg ctgcccatag cagcaaccag gccaagtaga caggcccctg ctgtgcagcc 7560ccaggcctcc agctcacctg cttctcctgg ggctctcaag gctgctgttt tctgcactct 7620cccctctgtg gggagggttc cctcagtggg agatctgttc tcaacatccc acggcctcat 7680tcctgcaagg aaggccaatg gatgggcaac ctcacatgcc gcggctaaga tagggtgggc 7740agcctggcgg ggacaggaca tcctgctggg gtatctgtca ctgtgcctag tggggcactg 7800gctcccaaac aacgcagtcc ttgccaaaat ccccacggcc tcccccgcta ggggctggcc 7860tgatctcctg cagtcctagg aggctgctga cctccagaat ggctccgtcc ccagttccag 7920ggcgagagca gatcccaggc cggctgcaga ctgggaggcc accccctcct tcccagggtt 7980cactgcaggt gaccagggca ggaaatggcc tgaacacagg gataaccggg ccatccccca 8040acagagtcca ccccctcctg ctctgtaccc cgcacccccc aggccagccc atgacatccg 8100acaaccccac accagagtca ctgcccggtg ctgccctagg gaggacccct cagcccccac 8160cctgtctaga ggactgggga ggacaggaca cgccctctcc ttatggttcc cccacctggc 8220tctggctggg acccttgggg tgtggacaga aaggacgctt gcctgattgg cccccaggag 8280cccagaactt ctctccaggg accccagccc gagcaccccc ttacccagga cccagccctg 8340cccctcctcc cctctgctct cctctcatca ccccatggga atccagaatc cccaggaagc 8400catcaggaag ggctgaggga ggaagtgggg ccactgcacc accaggcagg aggctctgtc 8460tttgtgaacc cagggaggtg ccagcctcct agagggtatg gtccaccctg cctatggctc 8520ccacagtggc aggctgcagg gaaggaccag ggacggtgtg ggggagggct cagggccccg 8580cgggtgctcc atcttggatg agcctatctc tctcacccac ggactcgccc acctcctctt 8640caccctggcc acacgtcgtc cacaccatcc taagtcccac ctacaccaga gccggcacag 8700ccagtgcaga cagaggctgg ggtgcagggg ggccgactgg gcagcttcgg ggagggagga 8760atggaggaag gggagttcag tgaagaggcc cccctcccct gggtccagga tcctcctctg 8820ggacccccgg atcccatccc ctccaggctc tgggaggaga agcaggatgg gagaatctgt 8880gcgggaccct ctcacagtgg aatacctcca cagcggctca ggccagatac aaaagcccct 8940cagtgagccc tccactgcag tgctgggcct gggggcagcc gctcccacac aggatgaacc 9000cagcaccccg aggatgtcct gccaggggga gctcagagcc atgaaggagc aggatatggg 9060acccccgata caggcacaga cctcagctcc attcaggact gccacgtcct gccctgggag 9120gaaccccttt ctctagtccc tgcaggccag gaggcagctg actcctgact tggacgccta 9180ttccagacac cagacagagg ggcaggcccc ccagaaccag ggatgaggac gccccgtcaa 9240ggccagaaaa gaccaagttg cgctgagccc agcaagggaa ggtccccaaa caaaccagga 9300agtttctgaa ggtgtctgtg tcacagtgga gcatagccac tcgtcccaca gtgacactcg 9360ccaggccaga aaccccatcc caagtcagcg gaatgcagag agagcaggga ggacatgttt 9420aggatctgag gccgcacctg acacccaggc cagcagacgt ctcctgtcca cggcaccctg 9480ccatgtcctg catttctgga agaacaaggg caggctgaag ggggtccagg accaggagat 9540gggtccgctc tacccagaga aggagccagg caggacacaa gccccc 958629268DNAHomo sapiensmisc_feature(1)..(9268)HD 1.7-6.13 2tccccattga ggctgacctg cccagagggt cctgggccca cccaacacac cggggcggaa 60tgtgtgcagg cctcggtctc tgtgggtgtt ccgctagctg gggctcacag tgctcacccc 120acacctaaaa cgagccacag cctccggagc ccctgaagga gaccccgccc acaagcccag 180cccccaccca ggaggcccca gagcacaggg cgccccgtcg gattctgaac agccccgagt 240cacagtgggt atcactggca ctaccactgt gagaaaagct tcgtccaaaa cggtctcctg 300gccacagtcg gaggccccgc cagagagggg agcagccacc ccaaacccat gttctgccgg 360ctcccatgac cccgtgcacc tggagcccca cggtgtcccc actggatggg aggacaaggg 420ccgggggctc cggcgggtcg gggcaggggc ttgatggctt ccttctgccg tggccccatt 480gcccctggct ggagttgacc cttctgacaa gtgtcctcag agagtcaggg atcagtggca 540cctcccaaca tcaaccccac gcagcccagg cacaaacccc acatccaggg ccaactccag 600gaacagagac accccaatac cctgggggac cccgaccctg atgactcccg tcccatctct 660gtccctcact tggggcctgc tgcggggcga gcacttggga gcaaactcag gcttagggga 720caccactgtg ggcctgacct cgagcaggcc acagaccctt ccctcctgcc ctggtgcagc 780acagactttg gggtctgggc agggaggaac ttctggcagg tcaccaagca cagagccccc 840aggctgaggt ggccccaggg ggaaccccag caggtggccc actacccttc ctcccagctg 900gaccccatgt cttccccaag ataggggtgc catccaaggc aggtcctcca tggagccccc 960ttcaggctcc tctccagacc ccactgggcc tcagtcccca ctctaggaat gcagccacca 1020cgggcacacc aggcagccca ggcccagcca ccctgcagtg cccaagccca caccctggag 1080gagagcaggg tgcgtctggg aggggctggg ctccccaccc ccacccccac ctgcacaccc 1140cacccaccct tgcccgggcc ccctgcagga gggtcagagc ccccatggga tatggactta 1200gggtctcact cacgcacctc ccctcctggg agaaggggtc tcatgcccag atccccccag 1260cagcgctggt cacaggtaga ggcagtggcc ccagggccac cctgacctgg cccctcaggc 1320tcctctagcc ctggctgccc tgctgtccct gggaggcctg ggctccacca gaccacaggt 1380ctagggcacc gcccacactg gggccgccca cacacagctc acaggaagaa gataagctcc 1440agacccccag gcccgggacc tgccttgctg ctacgacttc ctgccccaga cctcgttgcc 1500ctcccccgtc cacttacaca caggccagga agctgttccc acacagacca accccagacg 1560gggaccacct ggcactcagg tcactgccat ttccttctcc attcacttcc aatgcctctg 1620tgcttcctcc ctcctccttc cttcggggga gcaccctgtg cagctcctcc ctgcagtcca 1680caccctgggg agacccgacc ctgcagccca caccctgggg agacctgacc ctcctccagc 1740cctttctccc ccgctgctct tgccacccac caagacagcc ctggggtcct gtccctacag 1800cccccaccca gttctctacc tagacccgtc ttcctccctc taaacacctc tcccaggcca 1860accctacacc tgcaggccct cccctccact gccaaagacc ctcagtttct cctgcctgtg 1920cccacccccg tgctcctcct gcccacagct cgagctcttc ctctcctagg gcccctgagg 1980gatggcattg accgtgccct cgcacccaca cactgcccat gccctcacat tcctcctggc 2040cactccagcc ccactcccct ctcaggcctg gctctggtat ttctgggaca aagccttacc 2100caagtctttc ccatgcaggc ctgggccctt accctcactg cccggttaca gggcagcctc 2160ctgtgcacag aagcagggag ctcagccctt ccacaggcag aaggcactga aagaaatcgg 2220cctccagcgc cttgacacac gtctgcctgt gtctctcact gcccgcacct gcagggaggc 2280tcggcactcc ctctaaagac gagggatcca ggcagcagca tcacaggaga atgcagggct 2340accagacatc ccagtcctct cacaggcctc tcctgggaag agacctgaag acgcccagtc 2400aacggagtct aacaccaaac ctccctggag gccgatgggt agtaacggag tcattgccag 2460acctggaggc aggggagcag tgagcccgag cccacaccat agggccagag gacagccact 2520gacatcccaa gccactcact ggtggtccca caacacccca tggaaagagg acagacccac 2580agtcccacct ggaccagggc agagactgct gagacccagc accagaacca accaagaaac 2640accaggcaac agcatcagag ggggctctgg cagaacagag gaggggaggt ctccttcacc 2700agcaggcgct tcccttgacc gaagacagga tccatgcaac tcccccagga caaaggagga 2760gccccttgtt cagcactggg ctcagagtcc tctccaagac acccagagtt tcagacaaaa 2820accccctgga atgcacagtc tcagcaggag agccagccag agccagcaag atggggctca 2880gtgacacccg cagggacagg aggattttgt gggggctcgt gtcactgtga ggacattgta 2940ctcatggtgt atgccatacc cacagtgaca cagccccatt cccaaagccc tactgcaaac 3000gcattccact tctggggctg aggggctggg ggagcgtctg ggaaataggg ctcaggggtg 3060tccatcaatg cccaaaacgc accagactcc cctccataca tcacacccac cagccagcga 3120gcagagtaaa cagaaaatga gaagcaagct ggggaagctt gcacaggccc caaggaaaga 3180gctttggcgg gtgtgtaaga ggggatgcgg gcagagcctg agcagggcct tttgctgttt 3240ctgctttcct gtgcagagag ttccataaac tggtgttcga gatcaatggc tgggagtgag 3300cccaggagga cagcgtggga agagcacagg gaaggaggag cagccgctat cctacactgt 3360catctttcga aagtttgcct tgtgcccaca ctgctgcatc atgggatgct taacagctga 3420tgtagacaca gctaaagaga gaatcagtga gatggatttg cagcacagat ctgaataaat 3480tctccagaat gtggagcagc acagaagcaa gcacacagaa agtgcctgat gcaaggacaa 3540agttcagtgg gcaccttcag gcattgctgc tgggcacaga cactctgaaa agccctggca 3600ggaactccct gtgacaaagc agaaccctca ggcaatgcca gccccagagc cctccctgag 3660agcctcatgg gcaaagatgt gcacaacagg tgtttctcat agccccaaac tgagagcaaa 3720gcaaacgtcc atctgaagga gaacaggcaa ataaacgatg gcaggttcat gaaatgcaaa 3780cccagacagc cacaagcaca aaagtacagg gttataagcg actctggttg agttcatgac 3840aatgctgagt aattggagta acaaagtaaa ctccaaaaaa tactttcaat gtgatttctt 3900ctaaataaaa tttacaccct gcaaaatgaa ctgtcttctt aagggataca tttcccagtt 3960agaaaaccat aaagaaaacc aagaaaagga tgatcacata aacacagtgg tggttacttc 4020tgctggggaa ggaagagggt atgaactgag atacacaggg tgggcaagtc tcctaacaag 4080aacagaacga atacattaca gtaccttgaa aacagcagtt aaacttctaa attgcaagaa 4140gaggaaaatg cacacagttg tgtttagaaa attctcagtc cagcactgtt cataatagca 4200aagacattaa cccaggtcgg ataaataagc gatgacacag gcaattgcac aatgatacag 4260acatatattt agtatatgag acatcgatga tgtatcccca aataaacgac tttaaagaga 4320taaagggctg atgtgtggtg gcattcacct ccctgggatc cccggacagg ttgcaggctc 4380actgtgcagc agggcaggcg ggtacctgct ggcagttcct ggggcctgat gtggagcaag 4440cgcagggcca tatatcccgg aggacggcac agtcagtgaa ttccagagag aagcaactca 4500gccacactcc ccaggcagag cccgagaggg acgcccacgc acagggaggc agagcccagc 4560acctccgcag ccagcaccac ctgcgcacgg gccaccacct tgcaggcaca gagtgggtgc 4620tgagaggagg ggcagggaca ccaggcaggg tgagcaccca gagaaaactg cagacgcctc 4680acacatccac ctcagcctcc cctgacctgg acctcactgg cctgggcctc acttaacctg 4740ggcttcacct gaccttggcc tcacctgact tggacctcgc ctgtcccaag ctttacctga 4800cctgggcctc aactcacctg aacgtctcct gacctgggtt taacctgtcc tggaactcac 4860ctggccttgg cttcccctga cctggacctc atctggcctg ggcttcacct ggcctgggcc 4920tcacctgacc tggacctcat ctggcctgga cctcacctgg cctggacttc acctggcctg 4980ggcttcacct gacctggacc tcacctggcc tcgggcctca cctgcacctg ctccaggtct 5040tgctggagcc tgagtagcac tgagggtgca gaagctcatc cagggttggg gaatgactct 5100agaagtctcc cacatctgac ctttctgggt ggaggcagct ggtggccctg ggaatataaa 5160aatctccaga atgatgactc tgtgatttgt gggcaactta tgaacccgaa aggacatggc 5220catggggtgg gtagggacat agggacagat gccagcctga ggtggagcct caggacacag 5280gtgggcacgg acactatcca cataagcgag ggatagaccc gagtgtcccc acagcagacc 5340tgagagcgct gggcccacag

cctcccctca gagccctgct gcctcctccg gtcagccctg 5400gacatcccag gtttccccag gcctggcggt aggtttagaa tgaggtctgt gtcactgtgg 5460tatcaccata ttttgactgg tcattataac cacagtgtca cagagtccat caaaaaccca 5520tgcctggaag cttcccgcca cagccctccc catggggccc tgctgcctcc tcaggtcagc 5580cccggacatc ccgggtttcc ccaggctggg cggtaggttt ggggtgaggt ctgtgtcact 5640gtggtatcac catggttcgg ggagtcatta taaccacagt gtcacagagt ccatcaaaaa 5700cccatccctg ggagcctccc gccacagccc tccctgcagg ggaccggtac gtgccatgtt 5760aggattttga tcgaggagac agcaccatgg gtatggtggc taccacagca gtgcagcctg 5820tgacccaaac ccgcagggca gcaggcacga tggacaggcc cgtgactgac cacgctgggc 5880tccagcctgc cagccctgga gatcatgaaa cagatggcca aggtcaccct acaggtcatc 5940cagatctggc tccgaggggt ctgcatcgct gctgccctcc caacgccagt ccaaatggga 6000cagggacggc ctcacagcac catctgctgc catcaggcca gcgatcccag aagcccctcc 6060ctcaaggctg ggcacatgtg tggacactga gagccctcat atctgagtag gggcaccagg 6120agggaggggc tggccctgtg cactgtccct gcccctgtgg tccctggcct gcctggccct 6180gacacctgag cctctcctgg gtcatttcca agacagaaga cattcctggg gacagccgga 6240gctgggcgtc gctcatcctg cccggccgtc ctgagtcctg ctcatttcca gacctcaccg 6300gggaagccaa cagaggactc gcctcccaca ttcagagaca aagaaccttc cagaaatccc 6360tgcctctctc cccagtggac accctcttcc aggacagtcc tcagtggcat cacagcggcc 6420tgagatcccc aggacgcagc accgctgtca ataggggccc caaatgcctg gaccagggcc 6480tgcgtgggaa aggcctctgg ccacactcgg gctttttgtg aagggccctc ctgctgtgtg 6540accacagtca ctaccatagt gatgaaccca gtggcaaaaa ctggctggaa acccaggggc 6600tgtgtgcacg cctcagcttg gagctctcca ggagcacaag agccgggccc aaggatttgt 6660gcccagaccc tcagcctcta gggacacctg ggtcatctca gcctgggctg gtgccctgca 6720caccatcttc ctccaaatag gggcttcaga gggctctgag gtgacctcac tcatgaccac 6780aggtgacctg gcccttccct gccagctata ccagaccctg tcttgacaga tgccccgatt 6840ccaacagcca attcctggga ccctgaatag ctgtagacac cagcctcatt ccagtacctc 6900ctgccaattg cctggattcc catcctggct ggaatcaaga aggcagcatc cgccaggctc 6960ccaacaggca ggactcccgc acaccctcct ctgagaggcc gctgtgttcc gcagggccag 7020gccctggaca gttcccctca cctgccacta gagaaacacc tgccattgtc gtccccacct 7080ggaaaagacc actcgtggag cccccagccc caggtacagc tgtagagaca gtcctcgagg 7140cccctaagaa ggagccatgc ccagttctgc cgggaccctc ggccaggccg acaggagtgg 7200acgctggagc tgggcccaca ctgggccaca taggagctca ccagtgaggg caggagagca 7260catgccgggg agcacccagc ctcctgctga ccagaggccc gtcccagagc ccaggaggct 7320gcagaggcct ctccagggag acactgtgca tgtctggtac ctaagcagcc ccccacgtcc 7380ccagtcctgg gggcccctgg ctcagctgtc tgggccctcc ctgctccctg ggaagctcct 7440cctgacagcc ccgcctccag ttccaggtgt ggttattgtc aggcgatgtc agactgtggt 7500ggacatagtg gccaccatta ccacagtggt gccgcccata gcagcaacca ggccaagtag 7560acaggcccct gctgcgcagc cccaggcatc cacttcacct gcttctcctg gggctctcaa 7620ggctgctgtc tgtcctctgg ccctctgtgg ggagggttcc ctcagtggga ggtctgtgct 7680ccagggcagg gatgattgag atagaaatca aaggctggca gggaaaggca gcttcccgcc 7740ctgagaggtg caggcagcac cacggagcca cggagtcaca gagccacgga gcccccattg 7800tgggcatttg agagtgctgt gcccccggca ggcccagccc tgatggggaa gcctgtccca 7860tcccacagcc cgggtcccac gggcagcggg cacagaagct gccaggttgt cctctatgat 7920cctcatccct ccagcagcat cccctccaca gtggggaaac tgaggcttgg agcaccaccc 7980ggccccctgg aaatgaggct gtgagcccag acagtgggcc cagagcactg tgagtacccc 8040ggcagtacct ggctgcaggg atcagccaga gatgccaaac cctgagtgac cagcctacag 8100gaggatccgg ccccacccag gccactcgat taatgctcaa ccccctgccc tggagacctc 8160ttccagtacc accagcagct cagcttctca gggcctcatc cctgcaagga aggtcaaggg 8220ctgggcctgc cagaaacaca gcaccctccc tagccctggc taagacaggg tgggcagacg 8280gctgtggacg ggacatattg ctggggcatt tctcactgtc acttctgggt ggtagctctg 8340acaaaaacgc agaccctgcc aaaatcccca ctgcctcccg ctaggggctg gcctggaatc 8400ctgctgtcct aggaggctgc tgacctccag gatggctccg tccccagttc cagggcgaga 8460gcagatccca ggcaggctgt aggctgggag gccacccctg cccttgccgg ggttgaatgc 8520aggtgcccaa ggcaggaaat ggcatgagca cagggatgac cgggacatgc cccaccagag 8580tgcgcccctt cctgctctgc accctgcacc ccccaggcca gcccacgacg tccaacaact 8640gggcctgggt ggcagcccca cccagacagg acagacccag caccctgagg aggtcctgcc 8700agggggagct aagagccatg aaggagcaag atatggggcc cccgatacag gcacagatgt 8760cagctccatc caggaccacc cagcccacac cctgagagga acgtctgtct ccagcctctg 8820caggtcggga ggcagctgac ccctgacttg gacccctatt ccagacacca gacagaggcg 8880caggcccccc agaaccaggg ttgagggacg ccccgtcaaa gccagacaaa accaaggggt 8940gttgagccca gcaagggaag gcccccaaac agaccaggag gtttctgaag gtgtctgtgt 9000cacagtgggg catagccaca gctggtacca cagtgacact cacccagcca gaaaccccat 9060tccaagtcag cggaagcaga gagagcaggg aggacacgtt taggatctga gactgcacct 9120gacacccagg ccagcagacg tctcccctcc agggcacccc accctgtcct gcatttctgc 9180aagatcaggg gcggcctgag ggggggtcta gggtgaggag atgggtcccc tgtacaccaa 9240ggaggagtta ggcaggtccc gagcactc 926839441DNAHomo sapiensmisc_feature(1)..(9441)HD 1.14-6.19 3tccccattga ggctgacctg cccagagagt cctgggccca ccccacacac cggggcggaa 60tgtgtgcagg cctcggtctc tgtgggtgtt ccgctagctg gggctcacag tgctcacccc 120acacctaaaa tgagccacag cctccggagc ccccgcagga gaccccgccc acaagcccag 180cccccaccca ggaggcccca gagctcaggg cgccccgtcg gattccgaac agccccgagt 240cacagcgggt ataaccggaa ccaccactgt cagaatagct acgtcaaaaa ctgtccagtg 300gccactgccg gaggccccgc cagagagggc agcagccact ctgatcccat gtcctgccgg 360ctcccatgac ccccagcacg cggagcccca cagtgtcccc actggatggg aggacaagag 420ctggggattc cggcgggtcg gggcaggggc ttgatcgcat ccttctgccg tggctccagt 480gcccctggct ggagttgacc cttctgacaa gtgtcctcag agagacaggc atcaccggcg 540cctcccaaca tcaaccccag gcagcacagg cacaaacccc acatccagag ccaactccag 600gagcagagac accccaatac cctgggggac cccgaccctg atgacttccc actggaattc 660gccgtagagt ccaccaggac caaagaccct gcctctgcct ctgtccctca ctcaggacct 720gctgccgggc gaggccttgg gagcagactt gggcttaggg gacaccagtg tgaccccgac 780cttgaccagg acgcagacct ttccttcctt tcctggggca gcacagactt tggggtctgg 840gccaggagga acttctggca ggtcgccaag cacagaggcc acaggctgag gtggccctgg 900aaagacctcc aggaggtggc cactcccctt cctcccagct ggaccccatg tcctccccaa 960gataagggtg ccatccaagg caggtgctcc ttggagcccc attcagactc ctccctggac 1020cccactgggc ctcagtccca gctctgggga tgaagccacc acaagcacac caggcagccc 1080aggcccagcc accctgcagt gcccaagcac acactctgga gcagagcagg gtgcctctgg 1140gaggggctga gctccccacc ccacccccac ctgcacaccc cacccacccc tgcccagcgg 1200ctctgcagga gggtcagagc cccacatggg gtatggactt agggtctcac tcacgtggct 1260cccatcatga gtgaaggggc ctcaagccca ggttcccaca gcagcgcctg tcgcaagtgg 1320aggcagaggc ccgagggcca ccctgacctg gtccctgagg ttcctgcagc ccaggctgcc 1380ctgctgtccc tgggaggcct gggctccacc agaccacagg tccagggcac cgggtgcagg 1440agccacccac acacagctca caggaagaag ataagctcca gacccccagg gccagaacct 1500gccttcctgc tactgcttcc tgccccagac ctgggcgccc tcccccgtcc acttacacac 1560aggccaggaa gctgttccca cacagaacaa ccccaaacca ggaccgcctg gcactcaggt 1620ggctgccatt tccttctcca tttgctccca gcgcctctgt cctccctggt tcctccttcg 1680ggggaacagc ctgtgcagcc agtccctgca gcccacaccc tggggagacc caaccctgcc 1740tggggccctt ccaaccctgc tgctcttact gcccacccag aaaactctgg ggtcctgtcc 1800ctgcagtccc taccctggtc tccacccaga cccctgtgta tcactccaga cacccctccc 1860aggcaaaccc tgcacctgca ggccctgtcc tcttctgtcg ctagagcctc agtttctccc 1920ccctgtgccc acaccctacc tcctcctgcc cacaactcta actcttcttc tcctggagcc 1980cctgagccat ggcattgacc ctgccctccc accacccaca gcccatgccc tcaccttcct 2040cctggccact ccgaccccgc cccctctcag gccaagccct ggtatttcca ggacaaaggc 2100tcacccaagt ctttcccagg caggcctggg ctcttgccct cacttcccgg ttacacggga 2160gcctcctgtg cacagaagca gggagctcag cccttccaca ggcagaaggc actgaaagaa 2220atcggcctcc agcaccttga cacacgtccg cccgtgtctc tcactgcccg cacctgcagg 2280gaggctccgc actccctcta aagacaaggg atccaggcag cagcatcacg ggagaatgca 2340gggctcccag acatcccagt cctctcacag gcctctcctg ggaagagacc tgcagccacc 2400accaaacagc cacagaggct gctggatagt aactgagtca atgaccgacc tggagggcag 2460gggagcagtg agccggagcc cataccatag ggacagagac cagccgctga catcccgagc 2520tcctcaatgg tggccccata acacacctag gaaacataac acacccacag ccccacctgg 2580aacagggcag agactgctga gcccccagca ccagccccaa gaaacaccag gcaacagtat 2640cagagggggc tcccgagaaa gagaggaggg gagatctcct tcaccatcaa atgcttccct 2700tgaccaaaaa cagggtccac gcaactcccc caggacaaag gaggagcccc ctatacagca 2760ctgggctcag agtcctctct gagacaccct gagtttcaga caacaacccg ctggaatgca 2820cagtctcagc aggagaacag accaaagcca gcaaaaggga cctcggtgac accagtaggg 2880acaggaggat tttgtggggg ctcgtgtcac tgtgaggaca ttgtagtcat ggtagctgcc 2940actcccacag tgacacagac ccattcccaa agccctactg caaacacacc cactcctggg 3000gctgaggggc tgggggagcg tctgggaagt agggtccagg ggtgtctatc aatgtccaaa 3060atgcaccaga ctccccgcca aacaccaccc caccagccag cgagcagggt aaacagaaaa 3120tgagaggctc tgggaagctt gcacaggccc caaggaaaga gctttggcgg gtgtgcaaga 3180ggggatgcag gcagagcctg agcagggcct tttgctgttt ctgctttcct gtgcagagag 3240ttccataaac tggtgttcaa gatcagtggc tgggaatgag cccaggaggg cagtctgtgg 3300gaagagcaca gggaaggagg agcagccgct atcctacact gtcatctttc aaaagtttgc 3360cttgtgacca cactattgca tcatgggatg cttaagagct gatgtagaca cagctaaaga 3420gagaatcagt gagatgaatt tgcagcatag atctgaataa actctccaga atgtggagca 3480gtacagaagc aaacacacag aaagtgcctg atgcaaggac aaagttcagt gggcaccttc 3540aggcattgct gctgggcaca gacactctga aaagccttgg caggatctcc ctgcgacaaa 3600gcagaaccct caggcaatgc cagccccaga gccctccctg agagcgtcat ggggaaagat 3660gtgcagaaca gctgattatc atagactcaa actgagaaca gagcaaacgt ccatctgaag 3720aacagtcaaa taagcaatgg taggttcatg caatgcaaac ccagacagcc aggggacaac 3780agtagagggc tacaggcggc tttgcggttg agttcatgac aatgctgagt aattggagta 3840acagaggaaa gcccaaaaaa tacttttaat gtgatttctt ctaaataaaa tttacaccag 3900gcaaaatgaa ctgtcttctt aagggataaa ctttcccctg gaaaaactac aaggaaaatt 3960aagaaaacga tgatcacata aacacagttg tggttacttc tactggggaa ggaagagggt 4020atgagctgag acacacagag tcggcaagtc tccaagcaag cacagaacga atacattaca 4080gtaccttgaa tacagcagtt aaacttctaa atcgcaagaa caggaaaatg cacacagctg 4140tgtttagaaa attctcagtc cagcactatt cataatagca aagacattaa cccaggttgg 4200ataaataaat gatgacacag gcaattgcac aatgatacag acatacattt agtacatgag 4260acatcgatga tgtatcccca aagaaatgac tttaaagaga aaaggcctga tgtgtggtgg 4320cactcacctc cctgggatcc ccggacaggt tgcaggcaca ctgtgtggca gggcaggctg 4380gtacatgctg gcagctcctg gggcctgatg tggagcaagc gcagggctgt atacccccaa 4440ggatggcaca gtcagtgaat tccagagaga agcagctcag ccacactgcc caggcagagc 4500ccgagaggga cgcccacgta cagggaggca gagcccagct cctccacagc caccaccacc 4560tgtgcacggg ccaccacctt gcaggcacag agtgggtgct gagaggaggg gcagggacac 4620caggcagggt gagcacccag agaaaactgc agaagcctca cacatccacc tcagcctccc 4680ctgacctgga cctcacctgg tctggacctc acctggcctg ggcctcacct gacctggacc 4740tcacctggcc tgggcttcac ctgacctgga cctcacctgg cctccggcct cacctgcacc 4800tgctccaggt cttgctggaa cctgagtagc actgaggctg cagaagctca tccagggttg 4860gggaatgact ctggaactct cccacatctg acctttctgg gtggaggcat ctggtggccc 4920tgggaatata aaaagcccca gaatggtgcc tgcgtgattt gggggcaatt tatgaacccg 4980aaaggacatg gccatggggt gggtagggac atagggacag atgccagcct gaggtggagc 5040ctcaggacac agttggacgc ggacactatc cacataagcg agggacagac ccgagtgttc 5100ctgcagtaga cctgagagcg ctgggcccac agcctcccct cggtgccctg ctgcctcctc 5160aggtcagccc tggacatccc gggtttcccc aggccagatg gtaggtttga agtgaggtct 5220gtgtcactgt ggtatcatga tcacgtttgg gggagtcatc gttataccca cagcatcaca 5280cggtccatca gaaacccatg ccacagccct ccccgcaggg gaccgccgcg tgccatgtta 5340cgattttgat cgaggacaca gcgccatggg tatggtggct accacagcag tgcagcccat 5400gacccaaaca cacagggcag caggcacaat ggacaggcct gtgagtgacc atgctgggct 5460ccagcccgcc agccccggag accatgaaac agatggccaa ggtcacccca cagttcagcc 5520agacatggct ccgtggggtc tgcatcgctg ctgccctcta acaccagccc agatggggac 5580aaggccaacc ccacattacc atctcctgct gtccacccag tggtcccaga agcccctccc 5640tcatggctga gccacatgtg tgaaccctga gagcacccca tgtcagagta ggggcagcag 5700aagggcgggg ctggccctgt gcactgtccc tgcacccatg gtccctcgcc tgcctggccc 5760tgacacctga gcctcttctg agtcatttct aagatagaag acattcccgg ggacagccgg 5820agctgggcgt cgctcatccc gcccggccgt cctgagtcct gcttgtttcc agacctcacc 5880agggaagcca acagaggact cacctcacac agtcagagac aaagaacctt ccagaaatcc 5940ctgtctcact ccccagtggg caccttcttc caggacattc ctcggtcgca tcacagcagg 6000cacccacatc tggatcagga cggcccccag aacacaagat ggcccatggg gacagcccca 6060caacccaggc cttcccagac ccctaaaagg cgtcccaccc cctgcacctg ccccagggct 6120aaaaatccag gaggcttgac tcccgcatac cctccagcca gacatcacct cagccccctc 6180ctggagggga caggagcccg ggagggtgag tcagacccac ctgccctcga tggcaggcgg 6240ggaagattca gaaaggcctg agatccccag gacgcagcac cactgtcaat gggggcccca 6300gacgcctgga ccagggcctg cgtgggaaag gccgctgggc acactcaggg gctttttgtg 6360aaggcccctc ctactgtgtg accacggtca ctaccacagt gatgaaacta gcagcaaaaa 6420ctggccggac acccagggac catgcacact tctcagcttg gagctctcca ggaccagaag 6480agtcaggtct gagggtttgt agccagaccc tcggcctcta gggacaccct ggccatcaca 6540gcggatgggc tggtgcccca catgccatct gctccaaaca ggggcttcag agggctctga 6600ggtgacttca ctcatgacca caggtgccct ggccccttcc ccgccagcta caccgaaccc 6660tgtcccaaca gctgccccag ttccaacagc caattcctgg ggcccagaat tgctgtagac 6720accagcctcg ttccagcacc tcctgccaat tgcctggatt cacatcctgg ctggaatcaa 6780gagggcagca tccgccaggc tcccaacagg caggactccc gcacaccctc ctctgagagg 6840ccgctgtgtt ccgcagggcc aggccctgga cagttcccct cacctgccac tagagaaaca 6900cctgccattg tcgtccccac ctggaaaaga ccactcgtgg agcccccagc cccaggtaca 6960gctgtagaga gactccccga gggatctaag aaggagccat gcgcagttct gccgggaccc 7020tcggccaggc cgacaggagt ggacactgga gctgggccca cactgggcca cataggagct 7080caccagtgag ggcaggagag cacatgccgg ggagcaccca gcctcctgct gaccagaggc 7140ccgtcccaga gcccaggagg ctgcagaggc ctctccaggg ggacactgtg catgtctggt 7200ccctgagcag ccccccacgt ccccagtcct gggggcccct ggcacagctg tctggaccct 7260ccctgttccc tgggaagctc ctcctgacag ccccgcctcc agttccaggt gtggttattg 7320tcagggggtg tcagactgtg gtggacacag ccatggttac cacagtggtg ctgcccatag 7380cagcaaccag gccaagtaga caggcccctg ctgtgcagcc ccaggcctcc acttcacctg 7440cttctcctgg ggctctcaag gtcactgttg tctgtactct gccctctgtg gggagggttc 7500cctcagtggg aggtctgttc tcaacatccc agggcctcat gtctgcacgg aaggccaatg 7560gatgggcaac ctcacatgcc gcggctaaga tagggtgggc agcctggcgg gggacagtac 7620atactgctgg ggtgtctgtc actgtgccta gtggggcact ggctcccaaa caacgcagtc 7680ctcgccaaaa tccccacagc ctcccctgct aggggctggc ctgatctcct gcagtcctag 7740gaggctgctg acctccagaa tgtctccgtc cccagttcca gggcgagagc agatcccagg 7800ccggctgcag actgggaggc caccccctcc ttcccagggt tcactggagg tgaccaaggt 7860aggaaatggc cttaacacag ggatgactgc gccatccccc aacagagtca gccccctcct 7920gctctgtacc ccgcaccccc caggccagtc cacgaaaacc agggccccac atcagagtca 7980ctgcctggcc cggccctggg gcggacccct cagcccccac cctgtctaga ggacttgggg 8040ggacaggaca caggccctct ccttatggtt cccccacctg cctccggccg ggacccttgg 8100ggtgtggaca gaaaggacac ctgcctaatt ggcccccagg aacccagaac ttctctccag 8160ggaccccagc ccgagcaccc ccttacccag gacccagccc tgcccctcct cccctctgct 8220ctcctctcat caccccatgg gaatccggta tccccaggaa gccatcagga agggctgaag 8280gaggaagcgg ggccgtgcac caccgggcag gaggctccgt cttcgtgaac ccagggaagt 8340gccagcctcc tagagggtat ggtccaccct gcctggggct cccaccgtgg caggctgcgg 8400ggaaggacca gggacggtgt gggggagggc tcagggccct gcgggtgctc ctccatcttc 8460ggtgagcctc ccccttcacc caccgtcccg cccacctcct ctccaccctg gctgcacgtc 8520ttccacacca tcctgagtcc tacctacacc agagccagca aagccagtgc agacaaaggc 8580tggggtgcag gggggctgcc agggcagctt cggggaggga aggatggagg gaggggaggt 8640cagtgaagag gcccccttcc cctgggtcca ggatcctcct ctgggacccc cggatcccat 8700cccctcctgg ctctgggagg agaagcagga tgggagaatc tgtgcgggac cctctcacag 8760tggaatatcc ccacagcggc tcaggccaga cccaaaagcc cctcagtgag ccctccactg 8820cagtcctggg cctgggtagc agcccctccc acagaggaca gacccagcac cccgaagaag 8880tcctgccagg gggagctcag agccatgaaa gagcaggata tggggtcccc gatacaggca 8940cagacctcag ctccatccag gcccaccggg acccaccatg ggaggaacac ctgtctccgg 9000gttgtgaggt agctggcctc tgtctcggac cccactccag acaccagaca gaggggcagg 9060ccccccaaaa ccagggttga gggatgatcc gtcaaggcag acaagaccaa ggggcactga 9120ccccagcaag ggaaggctcc caaacagacg aggaggtttc tgaagctgtc tgtatcacag 9180tggggcatag ccatggctgg taccacagtg acactcgcca ggccagaaac cccgtcccaa 9240gtcagcggaa gcagagagag cagggaggac acgtttagga tctgaggccg cacctgacac 9300ccagggcagc agacgtctcc cctccagggc accctccacc gtcctgcgtt tcttcaagaa 9360taggggcggc ctgagggggt ccagggccag gcgataggtc ccctctaccc caaggaggag 9420ccaggcagga cccgagcacc g 9441411592DNAHomo sapiensmisc_feature(1)..(11592)HD 1.20-6.25, 1.26 4tccccattga ggctgacctg cccagacggg cctgggccca ccccacacac cggggcggaa 60tgtgtgcagg ccccagtctc tgtgggtgtt ccgctagctg gggcccccag tgctcacccc 120acacctaaag cgagccccag cctccagagc cccctaagca ttccccgccc agcagcccag 180cccctgcccc cacccaggag gccccagagc tcagggcgcc tggtcggatt ctgaacagcc 240ccgagtcaca gtgggtatca ctggcacgac caccgtgaga aaaactgtgt ccaaaactga 300ctcctggcag cagtcggagg ccccgccaga gaggggagca gccggcctga acccatgtcc 360tgccggttcc catgaccccc agcacccaga gccccacggt gtccccgttg gataatgagg 420acaagggctg ggggctccgg tggtttgcgg cagggacttg atcacatcct tctgctgtgg 480ccccattgcc tctggctgga gttgaccctt ctgacaagtg tcctcagaaa gacagggatc 540accggcacct cccaatatca accccaggca gcacagacac aaaccccaca tccagagcca 600actccaggag cagagacacc ccaacactct gggggacccc aaccgtgata actccccact 660ggaatccgcc ccagagtcta ccaggaccaa aggccctgcc ctgtctctgt ccctcactca 720gggcctcctg cagggcgagc gcttgggagc agactcggtc ttaggggaca ccactgtggg 780ccccaacttt gatgaggcca ctgacccttc cttcctttcc tggggcagca cagactttgg 840ggtctgggca gggaagaact actggctggt ggccaatcac agagccccca ggccgaggtg 900gccccaagaa ggccctcagg aggtggccac tccacttcct cccagctgga ccccaggtcc 960tccccaagat aggggtgcca tccaaggcag gtcctccatg gagccccctt cagactcctc 1020ccgggacccc actggacctc agtccctgct ctgggaatgc agccaccaca agcacaccag 1080gaagcccagg cccagccacc ctgcagtggg caagcccaca ctctggagca gagcagggtg 1140cgtctgggag gggctaacct ccccaccccc caccccccat ctgcacacag ccacctacca 1200ctgcccagac cctctgcagg agggccaagc caccatgggg tatggactta gggtctcact 1260cacgtgcctc ccctcctggg agaaggggcc tcatgcccag atccctgcag cactagacac 1320agctggaggc agtggcccca gggccaccct gacctggcat ctaaggctgc tccagcccag 1380acagcactgc cgttcctggg aagcctgggc tccaccagac cacaggtcca gggcacagcc 1440cacaggagcc acccacacac agctcacagg aagaagataa gctccagacc ccagggcggg 1500acctgccttc ctgccaccac

ttacacacag gccagggagc tgttcccaca cagatcaacc 1560ccaaaccggg actgcctggc actagggtca ctgccatttc cctctccatt ccctcccagt 1620gcctctgtgc tccctccttc tggggaacac cctgtgcagc ccctccctgc agcccacacg 1680ctggggagac cccaccctgc ctcgggcctt ttctacctgc tgcacttgcc gcccacccaa 1740acaaccctgg gtacgtgacc ctgcagtcct caccctgatc tgcaaccaga cccctgtccc 1800tccctctaaa cacccctccc aggccaactc tgcacctgca ggccctccgc tcttctgcca 1860caagagcctc aggttttcct acctgtgccc accccctaac ccctcctgcc cacaacttga 1920gttcttcctc tcctggagcc cttgagccat ggcactgacc ctacactccc acccacacac 1980tgcccatgcc atcaccttcc tcctggacac tctgaccccg ctcccctccc tctcagaccc 2040ggccctggta tttccaggac aaaggctcac ccaagtcttc cccatgcagg cccttgccct 2100cactgcctgg ttacacggga gcctcctgtg cgcagaagca gggagctcag ctcttccaca 2160ggcagaaggc actgaaagaa atcagcctcc agtgccttga cacacgtccg cctgtgtctc 2220tcactgcctg cacctgcagg gaggctccgc actccctcta aagatgaggg atccaggcag 2280caacatcacg ggagaatgca gggctcccag acagcccagc cctctcgcag gcctctcctg 2340ggaagagacc tgcagccacc actgaacagc cacggaggtc gctggatagt aaccgagtca 2400gtgaccgacc tggagggcag gggagcagtg aaccggagcc cataccatag ggacagagac 2460cagccgctaa catcccgagc ccctcactgg cggccccaga acaccccgtg gaaagagaac 2520agacccacag tcccacctgg aacagggcag acactgctga gcccccagca ccagccccaa 2580gaaacactag gcaacagcat cagagggggc tcctgagaaa gagaggaggg gaggtctcct 2640tcaccatcaa atgcttccct tgaccaaaaa cagggtccac gcaactcccc caggacaaag 2700gaggagcccc ctgtacagca ctgggctcag agtcctctct gagacaggct cagtttcaga 2760caacaacccg ctggaatgca cagtctcagc aggagagcca ggccagagcc agcaagagga 2820gactcggtga caccagtctc ctgtagggac aggaggattt tgtgggggtt cgtgtcactg 2880tgagcacatt gtggtggtca ctgccattcc cacagtgaca caaccccatt cctaaagccc 2940tactgcaaac gcacccactc ctgggactga ggggctgggg gagcgtctgg gaagtatggc 3000ctaggggtgt ccatcaatgc ccaaaatgca ccagactctc cccaagacat caccccacca 3060gccagtgagc agagtaaaca gaaaatgaga agcagctggg aagcttgcac aggccccaag 3120gaaagagctt tggcaggtgt gcaagagggg atgtgggcag agcctcagca gggccttttg 3180ctgtttctgc tttcctgtgc agagagttcc ataaactggt attcaagatc aatggctggg 3240agtgagccca ggaggacagt gtgggaagag cacagggaag gaggagcagc cgctatccta 3300cactgtcatc ttttgaaagt ttgccctgtg cccacaatgc tgcatcatgg gatgcttaac 3360agctgatgta gacacagcta aagagagaat cagtgaaatg gatttgcagc acagatctga 3420ataaatcctc cagaatgtgg agcagcacag aagcaagcac acagaaagtg cctgatgcca 3480aggcaaagtt cagtgggcac cttcaggcat tgctgctggg cacagacact ctgaaaagca 3540ctggcaggaa ctgcctgtga caaagcagaa ccctcaggca atgccagccc tagagccctt 3600cctgagaacc tcatgggcaa agatgtgcag aacagctgtt tgtcatagcc ccaaactatg 3660gggctggaca aagcaaacgt ccatctgaag gagaacagac aaataaacga tggcaggttc 3720atgaaatgca aactaggaca gccagaggac aacagtagag agctacaggc ggctttgcgg 3780ttgagttcat gacaatgctg agtaattgga gtaacagagg aaagcccaaa aaatactttt 3840aatgtgattt cttctaaata aaatttacac ccggcaaaat gaactatctt cttaagggat 3900aaactttccc ctggaaaaac tataaggaaa atcaagaaaa cgatgatcac ataaacacag 3960tggtggttac ttctactggg gaaggaagag ggtatgagct gagacacaca gagtcggcaa 4020gtctcctaac aagaacagaa caaatacatt acagtacctt gaaaacagca gttaaacttc 4080taaatcgcaa gaagaggaaa atgcacacac ctgtgtttag aaaattctca gtccagcact 4140gttcataata gcaaagacat taacccaggt tggataaata agcgatgaca caggcaattg 4200cacaatgata cagacataca ttcagtatat gagacatcga tgatgtatcc ccaaagaaat 4260gactttaaag agaaaaggcc tgatgtgtgg tggcaatcac ctccctgggc atccccggac 4320aggctgcagg ctcactgtgt ggcagggcag gcaggcacct gctggcagct cctggggcct 4380gatgtggagc aggcacagag ctgtatatcc ccaaggaagg tacagtcagt gcattccaga 4440gagaagcaac tcagccacac tccctggcca gaacccaaga tgcacaccca tgcacaggga 4500ggcagagccc agcacctccg cagccaccac cacctgcgca cgggccacca ccttgcaggc 4560acagagtggg tgctgagagg aggggcaggg acaccaggca gggtgagcac ccagagaaaa 4620ctgcagaagc ctcacacatc cctcacctgg cctgggcttc acctgacctg gacctcacct 4680ggcctcgggc ctcacctgca cctgctccag gtcttgctgg agcctgagta gcactgaggc 4740tgtagggact catccagggt tggggaatga ctctgcaact ctcccacatc tgacctttct 4800gggtggaggc acctggtggc ccagggaata taaaaagccc cagaatgatg cctgtgtgat 4860ttgggggcaa tttatgaacc cgaaaggaca tggccatggg gtgggtaggg acagtaggga 4920cagatgtcag cctgaggtga agcctcagga cacaggtggg catggacagt gtccacctaa 4980gcgagggaca gacccgagtg tccctgcagt agacctgaga gcgctgggcc cacagcctcc 5040cctcggggcc ctgctgcctc ctcaggtcag ccctggacat cccgggtttc cccaggcctg 5100gcggtaggtt tgaagtgagg tctgtgtcac tgtggtatca ctatcatagt agtggtcatt 5160actaccacag tgtcacagag tccatcaaaa actcatgcct gggagcctcc caccacagcc 5220ctccctgcgg gggaccgctg catgccgtgt taggattttg atcgaggaca cggcgccatg 5280ggtatggtgg ctaccacagc agtgcagccc atgacccaaa cacacggggc agcagaaaca 5340atggacaggc ccacaagtga ccatgatggg ctccagccca ccagccccag agaccatgaa 5400acagatggcc aaggtcaccc tacaggtcat ccagatctgg ctccaagggg tctgcatcgc 5460tgctgccctc ccaacgccaa accagatgga gacagggccg gccccatagc accatctgct 5520gccgtccacc cagcagtccc ggaagcccct ccctgaacgc tgggccacgt gtgtgaaccc 5580tgcgagcccc ccatgtcaga gtaggggcag caggagggcg gggctggccc tgtgcactgt 5640cactgcccct gtggtccctg gcctgcctgg ccctgacacc tgagcctctc ctgggtcatt 5700tccaagacat tcccagggac agccggagct gggagtcgct catcctgcct ggctgtcctg 5760agtcctgctc atttccagac ctcaccaggg aagccaacag aggactcacc tcacacagtc 5820agagacaacg aaccttccag aaatccctgt ttctctcccc agtgagagaa accctcttcc 5880agggtttctc ttctctccca ccctcttcca ggacagtcct cagcagcatc acagcgggaa 5940cgcacatctg gatcaggacg gcccccagaa cacgcgatgg cccatgggga cagcccagcc 6000cttcccagac ccctaaaagg tatccccacc ttgcacctgc cccagggctc aaactccagg 6060aggcctgact cctgcacacc ctcctgccag atatcacctc agccccctcc tggaggggac 6120aggagcccgg gagggtgagt cagacccacc tgccctcaat ggcaggcggg gaagattcag 6180aaaggcctga gatccccagg acgcagcacc actgtcaatg ggggccccag acgcctggac 6240cagggcctgt gtgggaaagg cctctggcca cactcagggg ctttttgtga agggccctcc 6300tgctgtgtga ccacggtggt cactcccaca gtgatgaaac cagcagcaaa aactgaccgg 6360actcgcaggg tttatgcaca cttctcggct cggagctctc caggagcaca agagccaggc 6420ccgagggttt gtgcccagac cctcggcctc tagggacacc cgggccatct tagccgatgg 6480gctgatgccc tgcacaccgt gtgctgccaa acaggggctt cagagggctc tgaggtgact 6540tcactcatga ccacaggtgc cctggtccct tcactgccag ctgcaccaga ccctgttccg 6600agagatgccc cagttccaaa agccaattcc tggggccggg aattactgta gacaccagcc 6660tcattccagt acctcctgcc aattgcctgg attcccatcc tggctggaat caagagggca 6720gcatccgcca ggctcccaac aggcaggact cccacacacc ctcctctgag aggccgctgt 6780gttccgcagg gccaggccgc agacagttcc cctcacctgc ccatgtagaa acacctgcca 6840ttgtcgtccc cacctggcaa agaccacttg tggagccccc agccccaggt acagctgtag 6900agagagtcct cgaggcccct aagaaggagc catgcccagt tctgccggga ccctcggcca 6960ggccgacagg agtggacgct ggagctgggc ccacactggg ccacatagga gctcaccagt 7020gagggcagga gagcacatgc cggggagcac ccagcctcct gctgaccaga gacccgtccc 7080agagcccagg aggctgcaga ggcctctcca gggggacaca gtgcatgtct ggtccctgag 7140cagcccccag gctctctagc actgggggcc cctggcacag ctgtctggac cctccctgtt 7200ccctgggaag ctcctcctga cagccccgcc tccagttcca ggtgtggtta ttgtcagggg 7260gtgccaggcc gtggtagaca tggccaccat taccacagtg gtgccgccca tagcagcaac 7320caggccaagt agacagaccc ctgccacgca gccccaggcc tccagctcac ctgcttctcc 7380tggggctctc aaggctgctg tctgccctct ggccctctgt ggggagggtt ccctcagtgg 7440gaggtctgtg ctccagggca gggatgactg agatagaaat caaaggctgg cagggaaagg 7500cagcttcccg ccctgagagg tgcaggcagc accacagagc catggagtca cagagccacg 7560gagcccccag tgtgggcgtg tgagggtgct gggctcccgg caggcccagc cctgatgggg 7620aagcctgccc cgtcccacag cccaggtccc caggggcagc aggcacagaa gctgccaagc 7680tgtgctctac gatcctcatc cctccagcag catccactcc acagtgggga aactgagcct 7740tggagaacca cccagccccc tggaaacaag gcggggagcc cagacagtgg gcccagagca 7800ctgtgtgtat cctggcacta ggtgcaggga ccacccggag atccccatca ctgagtggcc 7860agcctgcaga aggacccaac cccaaccagg ccgcttgatt aagctccatc cccctgtcct 7920gggaacctct tcccagcgcc accaacagct cggcttccca ggccctcatc cctccaagga 7980aggccaaagg ctgggcctgc caggggcaca gtaccctccc ttgccctggc taagacaggg 8040tgggcagacg gctgcagata ggacatattg ctggggcatc ttgctctgtg actactgggt 8100actggctctc aacgcagacc ctaccaaaat ccccactgcc tcccctgcta ggggctggcc 8160tggtctcctc ctgctgtcct aggaggctgc tgacctccag gatggcttct gtccccagtt 8220ctagggccag agcagatccc aggcaggctg taggctggga ggccacccct gtccttgccg 8280aggttcagtg caggcaccca ggacaggaaa tggcctgaac acagggatga ctgtgccatg 8340ccctacctaa gtccgcccct ttctactctg caacccccac tccccaggtc agcccatgac 8400gaccaacaac ccaacaccag agtcactgcc tggccctgcc ctggggagga cccctcagcc 8460cccaccctgt ctagaggagt tggggggaca ggacacaggc tctctcctta tggttccccc 8520acctggctcc tgccgggacc cttggggtgt ggacagaaag gacgcctgcc taattggccc 8580ccaggaaccc agaacttctc tccagggacc ccagcccgag caccccctta cccaggaccc 8640agccctgccc ctcctcccct ctgctctcct ctcatcactc catgggaatc cagaatcccc 8700aggaagccat caggaagggc tgaaggagga agcggggccg ctgcaccacc gggcaggagg 8760ctccgtcttc gtgaacccag ggaagtgcca gcctcctaga gggtatggtc caccctgcct 8820ggggctccca ccgtggcagg ctgcggggaa ggaccaggga cggtgtgggg gagggctcag 8880ggccctgcag gtgctccatc ttggatgagc ccatccctct cacccaccga cccgcccacc 8940tcctctccac cctggccaca cgtcgtccac accatcctga gtcccaccta caccagagcc 9000agcagagcca gtgcagacag aggctggggt gcaggggggc cgccagggca gctttgggga 9060gggaggaatg gaggaagggg aggtcagtga agaggccccc ctcccctggg tctaggatcc 9120acctttggga cccccggatc ccatcccctc caggctctgg gaggagaagc aggatgggag 9180attctgtgca ggaccctctc acagtggaat acctccacag cggctcaggc cagatacaaa 9240agcccctcag tgagccctcc actgcagtgc agggcctggg ggcagcccct cccacagagg 9300acagacccag caccccgaag aagtcctgcc agggggagct cagagccatg aaggagcaag 9360atatggggac cccaatactg gcacagacct cagctccatc caggcccacc aggacccacc 9420atgggtggaa cacctgtctc cggcccctgc tggctgtgag gcagctggcc tctgtctcgg 9480acccccattc cagacaccag acagagggac aggcccccca gaaccagtgt tgagggacac 9540ccctgtccag ggcagccaag tccaagaggc gcgctgagcc cagcaaggga aggcccccaa 9600acaaaccagg aggtttctga agctgtctgt gtcacagtcg ggcatagcca cggctaccac 9660aatgacactg ggcaggacag aaaccccatc ccaagtcagc cgaaggcaga gagagcaggc 9720aggacacatt taggatctga ggccacacct gacactcaag ccaacagatg tctcccctcc 9780agggcgccct gccctgttca gtgttcctga gaaaacaggg gcagcctgag gggatccagg 9840gccaggagat gggtcccctc taccccgagg aggagccagg cgggaatccc agccccctcc 9900ccattgaggc catcctgccc agaggggccc ggacccaccc cacacaccca ggcagaatgt 9960gtgcaggcct caggctctgt gggtgccgct agctggggct gccagtcctc accccacacc 10020taaggtgagc cacagccgcc agagcctcca caggagaccc cacccagcag cccagcccct 10080acccaggagg ccccagagct cagggcgcct gggtggattc tgaacagccc cgagtcacgg 10140tgggtatcat gggagccact accactgtga gaaaagctat gtccaaaact gtctcccggc 10200cactgctgga ggcccagcca gagaagggac cagccgcccg aacatacgac cttcccagac 10260ctcatgaccc ccagcacttg gagctccaca gtgtccccat tggatggtga ggatgggggc 10320cggggccatc tgcacctccc aacatcaccc ccaggcagca caggcacaaa ccccaaatcc 10380agagccgaca ccaggaacac agacacccca ataccctggg ggaccctggc cctggtgact 10440tcccactggg atccaccccc gtgtccacct ggatcaaaga ccccaccgct gtctctgtcc 10500ctcactcagg gcctgctgag gggcgggtgc tttggagcag actcaggttt aggggccacc 10560attgtggggc ccaacctcga ccaggacaca gatttttctt tcctgccctg gggcaacaca 10620gactttgggg tctgtgcagg gaggaccttc tggaaagtca ccaagcacag agccctgact 10680gaggtggtct caggaagacc cccaggaggg ggcttgtgcc ccttcctctc atgtggaccc 10740catgcccccc aagatagggg catcatgcag ggcaggtcct ccatgcagcc accactaggc 10800aactccctgg cgccggtccc cactgcgcct ccatcccggc tctggggatg cagccaccat 10860ggccacacca ggcagcccgg gtccagcaac cctgcagtgc ccaagccctt ggcaggattc 10920ccagaggctg gagcccaccc ctcctcatcc ccccacacct gcacacacac acctaccccc 10980tgcccagtcc ccctccagga gggttggagc cgcccatagg gtgggggctc caggtctcac 11040tcactcgctt cccttcctgg gcaaaggagc ctcgtgcccc ggtcccccct gacggcgctg 11100ggcacaggtg tgggtactgg gccccagggc tcctccagcc ccagctgccc tgctctccct 11160gggaggcctg ggcaccacca gaccaccagt ccagggcaca gccccaggga gccgcccact 11220gccagctcac aggaagaaga taagcttcag accctcaggg ccgggagctg ccttcctgcc 11280accccttcct gccccagacc tccatgccct cccccaacca cttacacaca agccagggag 11340ctgtttccac acagttcaac cccaaaccag gacggcctgg cactcgggtc actgccattt 11400ctgtctgcat tcgctcccag cgcccctgtg ttccctccct cctccctcct tcctttcttc 11460ctgcattggg ttcatgccgc agagtgccag gtgcaggtca gccctgagct tggggtcacc 11520tcctcactga aggcagcctc agggtgccca ggggcaggca gggtgggggt gaggcttcca 11580gctccaaccg ct 115925689DNAMus musculusmisc_feature(1)..(689)Mouse Ei (an intronic enhancer) 5tctagagagg tctggtggag cctgcaaaag tccagctttc aaaggaacac agaagtatgt 60gtatggaata ttagaagatg ttgcttttac tcttaagttg gttcctagga aaaatagtta 120aatactgtga ctttaaaatg tgagagggtt ttcaagtact cattttttta aatgtccaaa 180attcttgtca atcagtttga ggtcttgttt gtgtagaact gatattactt aaagtttaac 240cgaggaatgg gagtgaggct ctctcataac ctattcagaa ctgactttta acaataataa 300attaagtttc aaatattttt aaatgaattg agcaatgttg agttggagtc aagatggccg 360atcagaacca gaacacctgc agcagctggc aggaagcagg tcatgtggca aggctatttg 420gggaagggaa aataaaacca ctaggtaaac ttgtagctgt ggtttgaaga agtggttttg 480aaacactctg tccagcccca ccaaaccgaa agtccaggct gagcaaaaca ccacctgggt 540aatttgcatt tctaaaataa gttgaggatt cagccgaaac tggagaggtc ctcttttaac 600ttattgagtt caacctttta attttagctt gagtagttct agtttcccca aacttaagtt 660tatcgacttc taaaatgtat ttagaattc 68963518DNAMus musculusmisc_feature(1)..(3518)Mouse Switch Region 6acttatttca gttgaacatg ctggttggtg gttgagagga cactcagtca gtcagtgacg 60tgaagggctt ctaagccagt ccacatgctc tgtgtgaact ccctctggcc ctgcttattg 120ttgaatgggc caaaggtctg agaccaggct gctgctgggt aggcctggac tttgggtctc 180ccacccagac ctgggaatgt atggttgtgg cttctgccac ccatccacct ggctgctcat 240ggaccagcca gcctcggtgg ctttgaagga acaattccac acaaagactc tggacctctc 300cgaaaccagg caccgcaaat ggtaagccag aggcagccac agctgtggct gctgctctta 360aagcttgtaa actgtttctg cttaagaggg actgagtctt cagtcattgc tttaggggga 420gaaagagaca tttgtgtgtc ttttgagtac cgttgtctgg gtcactcaca tttaactttc 480cttgaaaaac tagtaaaaga aaaatgttgc ctgttaacca ataatcatag agctcatggt 540actttgagga aatcttagaa agcgtgtata caattgtctg gaattatttc agttaagtgt 600attagttgag gtactgatgc tgtctctact tcagttatac atgtgggttt gaattttgaa 660tctattctgg ctcttcttaa gcagaaaatt tagataaaat ggatacctca gtggttttta 720atggtgggtt taatatagaa ggaatttaaa ttggaagcta atttagaatc agtaaggagg 780gacccaggct aagaaggcaa tcctgggatt ctggaagaaa agatgttttt agtttttata 840gaaaacacta ctacattctt gatctacaac tcaatgtggt ttaatgaatt tgaagttgcc 900agtaaatgta cttcctggtt gttaaagaat ggtatcaaag gacagtgctt agatccgagg 960tgagtgtgag aggacagggg ctggggtatg gatacgcaga aggaaggcca cagctgtaca 1020gaattgagaa agaatagaga cctgcagttg aggccagcag gtcggctgga ctaactctcc 1080agccacagta atgacccaga cagagaaagc cagactcata aagcttgctg agcaaaatta 1140agggaacaag gttgagagcc ctagtaagcg aggctctaaa aagcacagct gagctgagat 1200gggtgggctt ctctgagtgc ttctaaaatg cgctaaactg aggtgattac tctgaggtaa 1260gcaaagctgg gcttgagcca aaatgaagta gactgtaatg aactggaatg agctgggccg 1320ctaagctaaa ctaggctggc ttaaccgaga tgagccaaac tggaatgaac ttcattaatc 1380taggttgaat agagctaaac tctactgcct acactggact gttctgagct gagatgagct 1440ggggtgagct cagctatgct acgctgtgtt ggggtgagct gatctgaaat gagatactct 1500ggagtagctg agatggggtg agatggggtg agctgagctg ggctgagcta gactgagctg 1560agctagggtg agctgagctg ggtgagctga gctaagctgg ggtgagctga gctgagcttg 1620gctgagctag ggtgagctgg gctgagctgg ggtgagctga gctgagctgg ggtaagctgg 1680gatgagctgg ggtgagctga gctgagctgg agtgagctga gctgggctga gctggggtga 1740gctgggctga gctgggctga gctgggctga gctggggtga gctgagctgg ggtgagctga 1800gctgagctgg ggtgagctga gctgagctgg ggtgagctgg ggtgagctga gctggggtga 1860gctgagctga gctggggtga gctgagctgg ggtgagctga gctgagctgg ggtgagctga 1920gctgagctga gctgagctga gctggggtga gctgagctga gctgagctgg ggtgagctgg 1980ggtgagctga gctgagctgg agtgagctga gctgggctga gctggggtga gctgggctga 2040gctggggtga gctgagctga gctgagctga gctggggtga gctgagctga gctggggtga 2100gctgagctgg ggtgagctgg gctgagctga gctgagctga gctgagctga gctgagctga 2160gctgagctga gctgagctga gctgagctga gctgagctga gctgagctgg ggtgagctga 2220gctgagctgg gctgagctgg ggtgagctgg gctgagctgg gctgagctgg gctgagctgg 2280ggtgagctga gctggggtga gctgagctga gctgggctga gctgagctga gctggggtga 2340gctgagctga gctggggtga gctgagctga gctgagctgg ggtgagctga gctgagctgg 2400gctgagcagg gctgagctgg ggtgagctga gctgagctgg ggtgagctgg gctgagctgg 2460gctgagctga gctgagctgg gctgagctgg gctgagctgg gctgagctgg gctgagctgg 2520gctgagctgg ggtgagctga gctggggtga gctggggtga gctgagctgg ggtgagctga 2580gctggggtga gctgagctga gctggggtga gctgagctgg ggtgagctga gctgagctgg 2640ggtgagctga gctgagctgg ggtgagctga gctagggtga actgggctgg gtgagctgga 2700gtgagctgag ctgaggtgaa ctggggtgag ccgggatgtt ttgagttgag ctggggtaag 2760atgagctgaa ctggggtaaa ctgggatgag ctgtggtgag cggagctgga ttgaactgag 2820ctgtgtgagc tgagctgggg tcagctgagc aagagtgagt agagctggct ggccagaacc 2880agaatcaatt aggctaagtg agccagattg tgctgggatc agctgtactc agatgagctg 2940ggatgaggta ggctgggatg agctgggcta gctgacatgg attatgtgag gctgagctag 3000catgggctgg cctagctgat gagctaagct tgaatgagcg gggctgagct ggactcagat 3060gtgctagact gagctgtact ggatgatctg gtgtagggtg atctggactc aactgggctg 3120gctgatggga tgcgccaggt tgaactaggc tcagataagt taggctgagt agggcctggt 3180tgagatggtt cgggatgagc tgggaaaaga tggactcgga ccatgaactg ggctgagctg 3240ggttgggaga ccatgaattg agctgaactg agtgcagctg ggataaactg ggttgagcta 3300agaatagact acctgaattg tgccaaactc ggctgggatc aattggaaat tatcaggatt 3360tagatgagcc ggactaaact atgctgagct ggactggttg gatgtgttga actggcctgc 3420tgctgggctg gcatagctga gttgaactta aatgaggaag gctgagcaag gctagcctgc 3480ttgcatagag ctgaacttta gcctagcctg agctggac 35187315DNAMus musculusmisc_feature(1)..(315)mouse IgM exon 1 7agagtcagtc cttcccaaat gtcttccccc tcgtctcctg cgagagcccc ctgtctgata 60agaatctggt ggccatgggc tgcctggccc gggacttcct gcccagcacc atttccttca 120cctggaacta ccagaacaac actgaagtca tccagggtat cagaaccttc ccaacactga 180ggacaggggg caagtaccta gccacctcgc aggtgttgct gtctcccaag agcatccttg 240aaggttcaga tgaatacctg gtatgcaaaa tccactacgg aggcaaaaac aaagatctgc 300atgtgcccat tccag 31585PRTHomo sapiens 8Val Gln Leu Glu Arg 1 5 95PRTUnknownMammal 9Val Pro Leu Ala Arg 1 5 105PRTUnknownMammal 10Val Ser Leu Ala Leu 1

5 115PRTUnknownMammal 11Val Ser Leu Ala Arg 1 5 124PRTHomo sapiens 12Trp Glu Leu Leu 1 136PRTUnknownMammal 13Val Ser Trp Glu Pro Leu 1 5 145PRTHomo sapiens 14Tyr Gln Leu Leu Tyr 1 5 156PRTUnknownMammal 15Ser Tyr Gln Leu Pro Tyr 1 5 164PRTHomo sapiens 16Arg Ile Leu Tyr 1 175PRTHomo sapiens 17Trp Cys Met Leu Tyr 1 5 1810PRTUnknownMammal 18Arg Thr Leu Tyr Ser Trp Cys Met Pro Tyr 1 5 10 195PRTHomo sapiens 19Ser Ile Leu Trp Trp 1 5 209PRTUnknownMammal 20Ser Thr Leu Trp Trp Ser Leu Pro Phe 1 5 2110PRTHomo sapiens 21Val Leu Arg Phe Leu Glu Trp Leu Leu Tyr 1 5 10 2210PRTUnknownMammal 22Val Ser Pro Phe Leu Glu Trp Ser Leu Tyr 1 5 10 239PRTHomo sapiens 23Val Leu Arg Tyr Phe Asp Trp Leu Leu 1 5 249PRTUnknownMammal 24Val Ser Pro Tyr Phe Asp Trp Ser Leu 1 5 259PRTHomo sapiens 25Val Leu Leu Trp Phe Gly Glu Leu Leu 1 5 269PRTUnknownMammal 26Val Ser Pro Trp Phe Gly Glu Ser Leu 1 5 279PRTHomo sapiens 27Leu Arg Leu Gly Glu Leu Ser Leu Tyr 1 5 289PRTUnknownMammal 28Ser Arg Leu Gly Glu Ser Ser Leu Tyr 1 5 294PRTHomo sapiens 29Trp Leu Leu Leu 1 304PRTUnknownMammal 30Val Ser Leu Ser 1 314PRTUnknownMammal 31Trp Ser Leu Leu 1 324PRTUnknownMammal 32Pro Gln Ser Leu 1 334PRTUnknownMammal 33Pro Arg Ser Leu 1 345PRTUnknownMammal 34Pro Arg Trp Ser Leu 1 5 356PRTHomo sapiens 35Trp Ile Gln Leu Trp Leu 1 5 366PRTUnknownMammal 36Trp Thr Gln Pro Trp Leu 1 5 374PRTHomo sapiens 37Trp Leu Arg Leu 1 384PRTUnknownMammal 38Trp Pro Pro Leu 1 395PRTHomo sapiens 39Arg Trp Leu Gln Leu 1 5 405PRTUnknownMammal 40Thr Trp Pro Pro Leu 1 5 414PRTHomo sapiens 41Gln Gln Leu Val 1 424PRTUnknownMammal 42Pro Gln Leu Val 1 434PRTHomo sapiens 43Gln Trp Leu Val 1 444PRTUnknownMammal 44Pro Trp Leu Val 1 455PRTHomo sapiens 45Tyr Asn Trp Asn Asp 1 5 465PRTUnknownMammal 46Tyr His Trp His Asp 1 5 475PRTHomo sapiens 47Tyr Asn Trp Asn Tyr 1 5 485PRTUnknownMammal 48Tyr His Trp His Tyr 1 5 496PRTHomo sapiens 49Tyr Ser Gly Ser Tyr Tyr 1 5 506PRTUnknownMammal 50Tyr His Gly Ser His Tyr 1 5 5110PRTHomo sapiens 51Gly Tyr Cys Ser Ser Thr Ser Cys Tyr Thr 1 5 10 5210PRTUnknownMammal 52Gly His Cys Ser His Thr Ser Cys His Thr 1 5 10 5310PRTHomo sapiens 53Gly Tyr Cys Thr Asn Gly Val Cys Tyr Thr 1 5 10 5410PRTUnknownMammal 54Gly His Cys Thr His Gly Val Cys His Thr 1 5 10 5510PRTHomo sapiens 55Gly Tyr Cys Ser Gly Gly Ser Cys Tyr Ser 1 5 10 5610PRTUnknownMammal 56Gly His Cys Ser His Gly Ser Cys His Ser 1 5 10 579PRTHomo sapiens 57Ala Tyr Cys Gly Gly Asp Cys Tyr Ser 1 5 589PRTUnknownMammal 58Ala His Cys Gly Gly His Cys His Ser 1 5 5910PRTHomo sapiens 59Tyr Tyr Asp Phe Trp Ser Gly Tyr Tyr Thr 1 5 10 6010PRTUnknownMammal 60Tyr His His Phe Trp Ser Gly His Tyr Thr 1 5 10 6110PRTHomo sapiens 61Tyr Tyr Asp Ile Leu Thr Gly Tyr Tyr Asn 1 5 10 6210PRTUnknownMammal 62Tyr His His Ile Leu Thr Gly His Tyr Asn 1 5 10 6310PRTHomo sapiens 63Tyr Tyr Tyr Gly Ser Gly Ser Tyr Tyr Asn 1 5 10 6410PRTUnknownMammal 64Tyr His His Gly Ser Gly Ser His Tyr Asn 1 5 10 6512PRTHomo sapiens 65Tyr Tyr Asp Tyr Val Trp Gly Ser Tyr Arg Tyr Thr 1 5 10 6612PRTUnknownMammal 66Tyr His Asp His Val Trp Gly Ser His Arg Tyr Thr 1 5 10 6710PRTHomo sapiens 67Tyr Tyr Tyr Asp Ser Ser Gly Tyr Tyr Tyr 1 5 10 6810PRTUnknownMammal 68Tyr His Tyr His Ser Ser Gly His Tyr Tyr 1 5 10 695PRTHomo sapiens 69Asp Tyr Ser Asn Tyr 1 5 704PRTUnknownMammal 70Pro Gln Ser Leu 1 715PRTHomo sapiens 71Asp Tyr Gly Asp Tyr 1 5 725PRTUnknownMammal 72Asp His Gly His Tyr 1 5 736PRTHomo sapiens 73Asp Tyr Gly Gly Asn Ser 1 5 746PRTUnknownMammal 74Asp His Gly Gly His Ser 1 5 756PRTHomo sapiens 75Gly Tyr Ser Tyr Gly Tyr 1 5 766PRTUnknownMammal 76Gly His Ser His Gly Tyr 1 5 777PRTHomo sapiens 77Gly Tyr Ser Gly Tyr Asp Tyr 1 5 787PRTUnknownMammal 78Gly His Ser Gly His His Tyr 1 5 796PRTHomo sapiens 79Arg Asp Gly Tyr Asn Tyr 1 5 806PRTUnknownMammal 80Arg His Gly His His Tyr 1 5 816PRTHomo sapiens 81Glu Tyr Ser Ser Ser Ser 1 5 826PRTUnknownMammal 82Glu His Ser His Ser Ser 1 5 837PRTHomo sapiens 83Gly Tyr Ser Ser Ser Trp Tyr 1 5 847PRTUnknownMammal 84Gly His Ser His Ser Trp Tyr 1 5 857PRTHomo sapiens 85Gly Tyr Ser Ser Gly Trp Tyr 1 5 867PRTUnknownMammal 86Gly His Ser His Gly Trp Tyr 1 5 876PRTHomo sapiens 87Gly Tyr Ser Ser Gly Tyr 1 5 885PRTHomo sapiens 88Gly Thr Thr Gly Thr 1 5 895PRTHomo sapiens 89Gly Ile Thr Gly Thr 1 5 906PRTHomo sapiens 90Gly Ile Val Gly Ala Thr 1 5 916PRTUnknownMammal 91Gly Ile Met Gly Ala Thr 1 5 929PRTHomo sapiens 92Asp Ile Val Val Val Pro Ala Ala Ile 1 5 939PRTUnknownMammal 93Asp Ile Val Val Ile Pro Ala Ala Ile 1 5 949PRTHomo sapiens 94Asp Ile Val Leu Met Val Tyr Ala Ile 1 5 959PRTHomo sapiens 95Asp Ile Val Val Val Val Ala Ala Thr 1 5 969PRTUnknownMammal 96Asp Ile Val Val Met Val Ala Ala Thr 1 5 978PRTHomo sapiens 97His Ile Val Val Val Thr Ala Ile 1 5 989PRTHomo sapiens 98Ile Thr Ile Phe Gly Val Val Ile Ile 1 5 994PRTHomo sapiens 99Ile Thr Ile Phe 1 1004PRTHomo sapiens 100Leu Val Ile Ile 1 1019PRTHomo sapiens 101Ile Thr Met Val Arg Gly Val Ile Ile 1 5 10211PRTHomo sapiens 102Ile Met Ile Thr Phe Gly Gly Val Ile Val Ile 1 5 10 1039PRTHomo sapiens 103Ile Thr Met Ile Val Val Val Ile Thr 1 5 1048PRTUnknownMammal 104Ile Thr Ile Val Val Val Ile Thr 1 5 1054PRTHomo sapiens 105Thr Thr Val Thr 1 1065PRTHomo sapiens 106Thr Thr Val Val Thr 1 5 1076PRTHomo sapiens 107Val Asp Thr Ala Met Val 1 5 1087PRTHomo sapiens 108Val Asp Ile Val Ala Thr Ile 1 5 1096PRTHomo sapiens 109Val Glu Met Ala Thr Ile 1 5 1106PRTUnknownMammal 110Val Asp Met Ala Thr Ile 1 5 1115PRTHomo sapiens 111Ser Ile Ala Ala Arg 1 5 1125PRTUnknownMammal 112Ser Ile Ala Thr Arg 1 5 1136PRTHomo sapiens 113Gly Ile Ala Ala Ala Gly 1 5 1146PRTUnknownMammal 114Gly Ile Ala Thr Ala Gly 1 5 1156PRTHomo sapiens 115Gly Ile Ala Val Ala Gly 1 5 1166PRTUnknownMammal 116Gly Ile Ala Met Ala Gly 1 5 1175PRTHomo sapiens 117Gly Ile Ala Ala Ala 1 5 1185PRTUnknownMammal 118Gly Ile Ala Thr Ala 1 5 11919DNAUnknownMammal 119cgggtcactg ccatttctg 1912020DNAUnknownMammal 120tctgcattcg ctcccagcgc 2012119DNAUnknownMammal 121tctgcggcat gaacccaat 1912219DNAUnknownMammal 122gtgcagggag gaccttctg 1912324DNAUnknownMammal 123agtcaccaag cacagagccc tgac 2412419DNAUnknownMammal 124gccagggagt tgcctagtg 1912519DNAUnknownMammal 125gtggcccact tcccttcct 1912622DNAUnknownMammal 126cagctggaac ccaccatgac ct 2212718DNAUnknownMammal 127gacctgcctc ggatgaca 1812819DNAUnknownMammal 128tggccagaac tgaccctac 1912920DNAUnknownMammal 129accgacaaga gtccctcagg 2013019DNAUnknownMammal 130ggagtcggct ctggatgtg 1913117DNAUnknownMammal 131tgcggccgat cttagcc 1713221DNAUnknownMammal 132acgagcgggt tcggcccatt c 2113318DNAUnknownMammal 133ttgaccgatt ccttgcgg 1813419DNAUnknownMammal 134cagtcccgtt gatccagcc 1913530DNAUnknownMammal 135cccatcaggg attttgtatc tctgtggacg 3013621DNAUnknownMammal 136ggatatgcag cactgtgcca c 2113719DNAUnknownMammal 137tcctccaacg acaggtccc 1913824DNAUnknownMammal 138tccctggaac tctgccccga caca 2413920DNAUnknownMammal 139gatgaactga cgggcacagg 2014020DNAUnknownMammal 140atcacactca tcccatcccc 2014129DNAUnknownMammal 141cccttcccta agtaccacag agtgggctc 2914220DNAUnknownMammal 142cacagggaag caggaactgc 2014318DNAUnknownMammal 143ggagccaggc aggacaca 1814419DNAUnknownMammal 144tgggctcgta gtttgacgt 1914523DNAUnknownMammal 145gggactttct tacccacact tca 2314624DNAUnknownMammal 146ggtcccgagc actcttaatt aaac 2414716DNAUnknownMammal 147cctcgaatgg aactac 1614821DNAUnknownMammal 148gggagagcaa ccattcgttg t 2114919DNAUnknownMammal 149ccgagcaccg atgcatcta 1915016DNAUnknownMammal 150cgcagtcatg taatgc 1615120DNAUnknownMammal 151gggaggcgaa ctgactgtca 2015219DNAUnknownMammal 152ggtggagagg ctattcggc 1915323DNAUnknownMammal 153tgggcacaac agacaatcgg ctg 2315417DNAUnknownMammal 154gaacacggcg gcatcag 1715517DNAHomo sapiens 155ggtacaactg gaacgac 1715617DNAHomo sapiens 156ggtataactg gaactac 1715717DNAHomo sapiens 157ggtataaccg gaaccac 171585PRTHomo sapiens 158Tyr Asn Arg Asn His 1 5 15917DNAHomo sapiens 159ggtataactg gaacgac 1716020DNAHomo sapiens 160ggtatagtgg gagctactac 2016131DNAHomo sapiens 161aggatattgt agtagtacca gctgctatgc c 311625PRTHomo sapiens 162Tyr Gln Leu Leu Cys 1 5 16310PRTHomo sapiens 163Gly Tyr Cys Ser Ser Thr Ser Cys Tyr Ala 1 5 10 1649PRTHomo sapiens 164Asp Ile Val Val Val Pro Ala Ala Met 1 5 16531DNAHomo sapiens 165aggatattgt agtagtacca gctgctatac c 3116631DNAHomo sapiens 166tggatattgt agtagtacca gctgctatgc c 311675PRTHomo sapiens 167Tyr Gln Leu Leu Cys 1 5 16810PRTHomo sapiens 168Gly Tyr Cys Ser Ser Thr Ser Cys Tyr Ala 1 5 10 1699PRTHomo sapiens 169Asp Ile Val Val Val Pro Ala Ala Met 1 5 17031DNAHomo sapiens 170aggatattgt actaatggtg tatgctatac c 3117131DNAHomo sapiens 171aagatattgt actggtggtg tatgctatac c 3117210PRTHomo sapiens 172Arg Ile Leu Tyr Trp Trp Cys Met Leu Tyr 1 5 10 17310PRTHomo sapiens 173Gly Tyr Cys Thr Gly Gly Val Cys Tyr Thr 1 5 10 1749PRTHomo sapiens 174Asp Ile Val Leu Val Val Tyr Ala Ile 1 5 17531DNAHomo sapiens 175aggatattgt agtggtggta gctgctactc c 3117628DNAHomo sapiens 176agcatattgt ggtggtgatt gctattcc 281778PRTHomo sapiens 177His Ile Val Val Val Ile Ala Ile 1 5 17828DNAHomo sapiens 178agcatattgt ggtggtgact gctattcc 2817931DNAHomo sapiens 179gtattacgat ttttggagtg gttattatac c 3118031DNAHomo sapiens 180gtattagcat ttttggagtg gttattatac c 3118110PRTUnknownMammal 181Val Leu Ala Phe Leu Glu Trp Leu Leu Tyr 1 5 10 1828PRTHomo sapiens 182His Phe Trp Ser Gly Tyr Tyr Thr 1 5 1839PRTHomo sapiens 183Ile Ser Ile Phe Gly Val Val Ile Ile 1 5 18431DNAHomo sapiens 184gtattacgat attttgactg gttattataa c 3118531DNAHomo sapiens 185gtattactat ggttcgggga gttattataa c 3118630DNAHomo sapiens 186gtattactat gttcggggag ttattataac 3018710PRTHomo sapiens 187Val Leu Leu Cys Ser Gly Ser Tyr Tyr Asn 1 5 10 1889PRTHomo sapiens 188Tyr Tyr Tyr Val Arg Gly Val Ile Ile 1 5 1898PRTHomo sapiens 189Ile Thr Met Phe Gly Arg Leu Leu 1 5 19037DNAHomo sapiens 190gtattatgat tacgtttggg ggagttatgc ttatacc 371919PRTHomo sapiens 191Leu Arg Leu Gly Glu Leu Cys Leu Tyr 1 5 19212PRTHomo sapiens 192Tyr Tyr Asp Tyr Val Trp Gly Ser Tyr Ala Tyr Thr 1 5 10 19311PRTHomo sapiens 193Ile Met Ile Thr Phe Gly Gly Val Met Leu Ile 1 5 10 19431DNAHomo sapiens 194gtattactat gatagtagtg gttattacta c 3119516DNAHomo sapiens 195tgactacagt aactac 1619616DNAHomo sapiens 196tgactacggt gactac 1619719DNAHomo sapiens 197tgactacggt ggtaactcc 1919820DNAHomo sapiens 198gtggatacag ctatggttac 2019923DNAHomo sapiens 199gtggatatag tggctacgat tac 2320020DNAHomo sapiens 200gtagagatgg ctacaattac 2020118DNAHomo sapiens 201gagtatagca gctcgtcc 1820221DNAHomo sapiens 202gggtatagca gcagctggta c 2120321DNAHomo sapiens 203gggtatagca gtggctggta c 2120418DNAHomo sapiens 204gggtatagca gcggctac 1820511DNAHomo sapiens 205ctaactgggg a 1120617DNAUnknownMammal 206gtcgttccag ttgtacc 172075PRTUnknownMammal 207Val Val Pro Val Val 1 5 2085PRTUnknownMammal 208Ser Phe Gln Leu Tyr 1 5 2095PRTUnknownMammal 209Arg Ser Ser Cys Thr 1 5 21017DNAUnknownMammal 210gtagttccag ttatacc 172115PRTUnknownMammal 211Val Val Pro Val Ile 1 5 2124PRTUnknownMammal 212Phe Gln Leu Tyr 1 2135PRTUnknownMammal 213Ser Ser Ser Tyr Thr 1 5 21417DNAUnknownMammal 214gtggttccgg ttatacc 172155PRTUnknownMammal 215Trp Phe Arg Leu Tyr 1 5 2165PRTUnknownMammal 216Gly Ser Gly Tyr Thr 1 5 21717DNAUnknownMammal 217gtcgttccag ttatacc 172185PRTUnknownMammal 218Arg Ser Ser Tyr Thr 1 5 21920DNAUnknownMammal 219gtagtagctc ccactatacc 202206PRTUnknownMammal 220Val Val Ala Pro Thr Ile 1 5 2214PRTUnknownMammal 221Leu Pro Leu Tyr 1 2226PRTUnknownMammal 222Ser Ser Ser His Tyr Thr 1 5 22331DNAUnknownMammal 223ggcatagcag ctggtactac tacaatatcc t 3122410PRTUnknownMammal

224Gly Ile Ala Ala Gly Thr Thr Thr Ile Ser 1 5 10 2258PRTUnknownMammal 225Gln Leu Val Leu Leu Gln Tyr Pro 1 5 2269PRTUnknownMammal 226His Ser Ser Trp Tyr Tyr Tyr Asn Ile 1 5 22731DNAUnknownMammal 227ggtatagcag ctggtactac tacaatatcc t 3122831DNAUnknownMammal 228ggcatagcag ctggtactac tacaatatcc a 3122931DNAUnknownMammal 229ggtatagcat acaccattag tacaatatcc t 3123010PRTUnknownMammal 230Gly Ile Ala Tyr Thr Ile Ser Thr Ile Ser 1 5 10 2318PRTUnknownMammal 231His Thr Pro Leu Val Gln Tyr Pro 1 5 2325PRTUnknownMammal 232Tyr Ser Ile His His 1 5 23331DNAUnknownMammal 233ggtatagcat acaccaccag tacaatatct t 3123410PRTUnknownMammal 234Gly Ile Ala Tyr Thr Thr Ser Thr Ile Ser 1 5 10 2358PRTUnknownMammal 235His Thr Pro Pro Val Gln Tyr Leu 1 5 2369PRTUnknownMammal 236Tyr Ser Ile His His Gln Tyr Asn Ile 1 5 23731DNAUnknownMammal 237ggagtagcag ctaccaccac tacaatatcc t 3123810PRTUnknownMammal 238Gly Val Ala Ala Thr Thr Thr Thr Ile Ser 1 5 10 2398PRTUnknownMammal 239Gln Leu Pro Pro Leu Gln Tyr Pro 1 5 2409PRTUnknownMammal 240Ser Ser Ser Tyr His His Tyr Asn Ile 1 5 24128DNAUnknownMammal 241ggaatagcaa tcaccaccac aatatgct 282429PRTUnknownMammal 242Gly Ile Ala Ile Thr Thr Thr Ile Cys 1 5 2437PRTUnknownMammal 243Gln Ser Pro Pro Gln Tyr Ala 1 5 2448PRTUnknownMammal 244Asn Ser Asn His His His Asn Met 1 5 24528DNAUnknownMammal 245ggaatagcag tcaccaccac aatatgct 282469PRTUnknownMammal 246Gly Ile Ala Val Thr Thr Thr Ile Cys 1 5 2477PRTUnknownMammal 247Gln Ser Pro Pro Gln Tyr Ala 1 5 2488PRTUnknownMammal 248Asn Ser Ser His His His Asn Met 1 5 24931DNAUnknownMammal 249ggtataataa ccactccaaa aatcgtaata c 3125010PRTUnknownMammal 250Gly Ile Ile Thr Thr Pro Lys Ile Val Ile 1 5 10 2515PRTUnknownMammal 251Pro Leu Gln Lys Ser 1 5 2529PRTUnknownMammal 252Tyr Asn Asn His Ser Lys Asn Arg Asn 1 5 25331DNAUnknownMammal 253ggtataataa ccactccaaa aatgctaata c 3125410PRTUnknownMammal 254Gly Ile Ile Thr Thr Pro Lys Met Leu Ile 1 5 10 2555PRTUnknownMammal 255Pro Leu Gln Lys Cys 1 5 2569PRTUnknownMammal 256Tyr Asn Asn His Ser Lys Asn Ala Asn 1 5 25731DNAUnknownMammal 257gttataataa ccagtcaaaa tatcgtaata c 3125810PRTUnknownMammal 258Val Ile Ile Thr Ser Gln Asn Ile Val Ile 1 5 10 2595PRTUnknownMammal 259Pro Val Lys Ile Ser 1 5 2609PRTUnknownMammal 260Tyr Asn Asn Gln Ser Lys Tyr Arg Asn 1 5 26131DNAUnknownMammal 261gttataataa ctccccgaac catagtaata c 3126210PRTUnknownMammal 262Val Ile Ile Thr Pro Arg Thr Ile Val Ile 1 5 10 2634PRTUnknownMammal 263Leu Pro Glu Pro 1 2649PRTUnknownMammal 264Tyr Asn Asn Ser Pro Asn His Ser Asn 1 5 26530DNAUnknownMammal 265gttataataa ctccccgaac atagtaatac 302667PRTUnknownMammal 266Val Ile Ile Thr Pro Arg Thr 1 5 2676PRTUnknownMammal 267Leu Pro Glu His Ser Asn 1 5 2689PRTUnknownMammal 268Tyr Asn Asn Ser Pro Asn Ile Val Ile 1 5 26937DNAUnknownMammal 269ggtataagca taactccccc aaacgtaatc ataatac 3727012PRTUnknownMammal 270Gly Ile Ser Ile Thr Pro Pro Asn Val Ile Ile Ile 1 5 10 2714PRTUnknownMammal 271Leu Pro Gln Thr 1 27211PRTUnknownMammal 272Tyr Lys His Asn Ser Pro Lys Arg Asn His Asn 1 5 10 27331DNAUnknownMammal 273gtagtaataa ccactactat catagtaata c 3127410PRTUnknownMammal 274Val Val Ile Thr Thr Thr Ile Ile Val Ile 1 5 10 2754PRTUnknownMammal 275Pro Leu Leu Ser 1 2769PRTUnknownMammal 276Ser Asn Asn His Tyr Tyr His Ser Asn 1 5 27716DNAUnknownMammal 277gtagttactg tagtca 162785PRTUnknownMammal 278Val Val Thr Val Val 1 5 2794PRTUnknownMammal 279Ser Tyr Cys Ser 1 28016DNAUnknownMammal 280gtagtcaccg tagtca 162814PRTUnknownMammal 281Ser His Arg Ser 1 28219DNAUnknownMammal 282ggagttacca ccgtagtca 192836PRTUnknownMammal 283Gly Val Thr Thr Val Val 1 5 2844PRTUnknownMammal 284Glu Leu Pro Pro 1 2855PRTUnknownMammal 285Ser Tyr His Arg Ser 1 5 28620DNAUnknownMammal 286gtaaccatag ctgtatccac 202876PRTUnknownMammal 287Val Thr Ile Ala Val Ser 1 5 2886PRTUnknownMammal 288Asn His Ser Cys Ile His 1 5 28923DNAUnknownMammal 289gtaatcgtag ccactatatc cac 232907PRTUnknownMammal 290Val Ile Val Ala Thr Ile Ser 1 5 2914PRTUnknownMammal 291Pro Leu Tyr Pro 1 2927PRTUnknownMammal 292Asn Arg Ser His Tyr Ile His 1 5 29320DNAUnknownMammal 293gtaattgtag ccatctctac 202946PRTUnknownMammal 294Val Ile Val Ala Ile Ser 1 5 2956PRTUnknownMammal 295Asn Cys Ser His Leu Tyr 1 5 29618DNAUnknownMammal 296ggacgagctg ctatactc 182976PRTUnknownMammal 297Gly Arg Ala Ala Ile Leu 1 5 2985PRTUnknownMammal 298Asp Glu Leu Leu Tyr 1 5 2995PRTUnknownMammal 299Thr Ser Cys Tyr Thr 1 5 30021DNAUnknownMammal 300gtaccagctg ctgctatacc c 213017PRTUnknownMammal 301Val Pro Ala Ala Ala Ile Pro 1 5 3026PRTUnknownMammal 302Tyr Gln Leu Leu Leu Tyr 1 5 3036PRTUnknownMammal 303Thr Ser Cys Cys Tyr Thr 1 5 30421DNAUnknownMammal 304gtaccagcca ctgctatacc c 213057PRTUnknownMammal' 305Val Pro Ala Thr Ala Ile Pro 1 5 3066PRTUnknownMammal 306Tyr Gln Pro Leu Leu Tyr 1 5 3076PRTUnknownMammal 307Thr Ser His Cys Tyr Thr 1 5 30818DNAUnknownMammal 308gtagccgctg ctataccc 183096PRTUnknownMammal 309Val Ala Ala Ala Ile Pro 1 5 3104PRTUnknownMammal 310Pro Leu Leu Tyr 1 3115PRTUnknownMammal 311Ser Arg Cys Tyr Thr 1 5 312366DNAHomo sapiens 312caggtgcagc tacagcagtg gggcgcagga ctgttgaagc cttcggatac cctgtccctc 60acctgcgctg tctatggtgg gtccttcagt ggttactact ggagctggat ccgccagccc 120ccagggaagg ggctggagtg gattggggaa atcaatcata gtggaagcac caactacaac 180ccgtccctca agagtcgagt caccatatca gtagacacgt ccaagaacca gttctccctg 240aagctgagct ctgtgaccgc cgcggacacg gctgtgtatt actgtgcggg gcatagccat 300ggctggtact actactacta cggtatggac gtctggggcc aagggaccac ggtcaccgtc 360tcctca 366313122PRTHomo sapiens 313Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Asp 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly Gly Ser Phe Ser Gly Tyr 20 25 30 Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60 Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu 65 70 75 80 Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Gly His Ser His Gly Trp Tyr Tyr Tyr Tyr Tyr Gly Met Asp Val Trp 100 105 110 Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 31496PRTHomo sapiens 314Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly Gly Ser Phe Ser Gly Tyr 20 25 30 Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60 Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu 65 70 75 80 Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 315355DNAHomo sapiens 315caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcacagac cctgtccctc 60acctgcactg tctctggtgg ctccatcagc agtggtggtt actactggag ctggatccgc 120cagcacccag ggaagggcct ggagtggatt gggtacatct attacagtgg gagcacctac 180tacaacccgt ccctcaagag tcgagttacc atatcagtag acacgtctaa gaaccagttc 240tccctgaagc tgagctctgt gactgccgcg gacacggccg tgtattactg tgcgaggggg 300gaccacggtc actacgacta ctggggccag ggaaccctgg tcaccgtctc ctcag 355316118PRTHomo sapiens 316Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Gly 20 25 30 Gly Tyr Tyr Trp Ser Trp Ile Arg Gln His Pro Gly Lys Gly Leu Glu 35 40 45 Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser 50 55 60 Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe 65 70 75 80 Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95 Cys Ala Arg Gly Asp His Gly His Tyr Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 31798PRTHomo sapiens 317Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Gly 20 25 30 Gly Tyr Tyr Trp Ser Trp Ile Arg Gln His Pro Gly Lys Gly Leu Glu 35 40 45 Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser 50 55 60 Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe 65 70 75 80 Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95 Cys Ala 318370DNAHomo sapiens 318cagctgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggagac cctgtccctc 60acctgcactg tctctggtgg ctccatcagc agtagtagtt actactgggg ctggatccgc 120cagcccccag ggaaggggct ggagtggatt gggagtatct attatagtgg gagcacctac 180tacaacccgt ccctcaagag tcgagtcacc atatccgtag acacgtccaa gaaccagttc 240tccctgaagc tgagctctgt gaccgccgca gacacggctg tgtattactg tgcgagacat 300gaagggcata gccaccttaa ctggttcgac ccctggggcc aggggggaac cctggtcacc 360gtctcctcag 370319123PRTHomo sapiens 319Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30 Ser Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu 35 40 45 Trp Ile Gly Ser Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser 50 55 60 Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe 65 70 75 80 Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95 Cys Ala Arg His Glu Gly His Ser His Leu Asn Trp Phe Asp Pro Trp 100 105 110 Gly Gln Gly Gly Thr Leu Val Thr Val Ser Ser 115 120 32099PRTHomo sapiens 320Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30 Ser Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu 35 40 45 Trp Ile Gly Ser Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser 50 55 60 Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe 65 70 75 80 Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95 Cys Ala Arg 32122DNAUnknownMammal 321tcttatcaga cagggggctc tc 2232222DNAUnknownMammal 322ggaagacatt tgggaaggac tg 223234PRTUnknownMammal 323Phe Gly Xaa Gly 1 3244PRTUnknownMammal 324Trp Gly Xaa Gly 1

Claims

1. A method of producing a nucleic acid encoding a human immunoglobulin heavy chain variable domain with at least one histidine, comprising: obtaining from a lymphocyte of a non-human animal, or a hybridoma produced from the lymphocyte, a nucleic acid comprising a rearranged human immunoglobulin heavy chain variable region gene sequence that encodes a human immunoglobulin heavy chain variable domain, wherein the non-human animal comprises in its germline genome an unrearranged human immunoglobulin heavy chain variable region nucleotide sequence that comprises an addition of at least one histidine codon or a substitution of at least one non-histidine codon with a histidine codon, wherein the added or substituted histidine codon is not encoded by a corresponding human germline heavy chain variable region gene segment, and wherein the added or substituted histidine codon is present in a complementary determining region 3 (CDR3) encoding sequence.

2. The method of claim 1, further comprising immunizing the non-human animal with an antigen of interest, and allowing the animal to mount an immune response to the antigen before obtaining the nucleic acid.

3. The method of claim 2, wherein the human immunoglobulin heavy chain variable domain specifically binds the antigen of interest.

4. The method of claim 3, wherein the obtained rearranged human immunoglobulin heavy chain variable region gene sequence comprises at least one somatic hypermutation.

5. The method of claim 1, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence is operably linked to an endogenous non-human immunoglobulin heavy chain constant region gene sequence at an endogenous non-human immunoglobulin heavy chain locus.

6. The method of claim 1, wherein the non-human animal further comprises in its germline genome an unrearranged human immunoglobulin light chain variable region nucleotide sequence comprising unrearranged human V.sub.L and unrearranged human J.sub.L gene segments; and wherein the lymphocyte, or hybridoma produced therefrom, expresses a human immunoglobulin light chain variable domain that is cognate to the human immunoglobulin heavy chain variable domain.

7. The method of claim 1, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence further comprises an addition of at least one histidine codon or a substitution of at least one non-histidine codon with a histidine codon in a CDR1 encoding sequence, a CDR2 encoding sequence, an N terminal encoding sequence or a loop encoding sequence.

8. The method of claim 1, wherein the CDR3 encoding sequence is selected from a human germline V.sub.H gene segment sequence, a human germline D gene segment sequence, a human germline J.sub.H gene segment sequence, and a combination thereof.

9. The method of claim 1, wherein the non-histidine codon that is substituted with the histidine codon encodes the amino acid selected from the group consisting of Y, N, D, Q, S, W, and R.

10. The method of claim 1, wherein the added or substituted histidine codon is present in at least one reading frame of a human D gene segment.

11. The method of claim 10, wherein the reading frame is a hydrophilic frame of the human D gene segment, and the hydrophilic frame comprises a nucleotide sequence that encodes the amino acid sequence selected from the group consisting of SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, and a combination thereof.

12. The method of claim 1, wherein the non-human animal is a rodent selected from a rat, a mouse and a hamster.

13. The method of claim 1, wherein the lymphocyte is a B cell.

14. A nucleic acid comprising the rearranged human immunoglobulin heavy chain variable region gene sequence produced by the method of claim 1.

15. The nucleic acid of claim 14, wherein the nucleic acid further comprises a human constant region gene sequence operably linked to the rearranged human immunoglobulin heavy chain variable region gene sequence.

16. The nucleic acid of claim 15, wherein the human heavy chain constant region gene sequence comprises a modification that increases an affinity of a C.sub.H2-C.sub.H3 region of an IgG heavy chain constant region amino acid sequence to neonatal Fc receptor (FcRn) at a pH ranging from about 5.5 to about 6.0, wherein the modification is a mutation in the IgG heavy chain constant region amino acid sequence selected from the group consisting of M428L, N434S, V259I, V308F, N434A, M252Y, S254T, T256E, T250Q, H433K, N434Y, and a combination thereof.

17. A cell comprising the nucleic acid of claim 14.

18. A method of obtaining a cell that expresses a human immunoglobulin heavy chain variable domain with at least one histidine comprising: isolating a lymphocyte from a non-human animal that comprises in its germline genome an unrearranged human immunoglobulin heavy chain variable region nucleotide sequence that comprises an addition of at least one histidine codon or a substitution of at least one non-histidine codon with a histidine codon, wherein the added or substituted histidine codon is not encoded by a corresponding human germline heavy chain variable region gene segment, and wherein the added or substituted histidine codon is present in a complementary determining region 3 (CDR3) encoding sequence.

19. The method of claim 18, further comprising producing a hybridoma from the isolated lymphocyte, wherein the hybridoma expresses a human immunoglobulin heavy chain variable domain with at least one histidine in the CDR3.

20. The method of claim 18, wherein the non-human animal further comprises in its germline genome an unrearranged human immunoglobulin light chain variable region nucleotide sequence comprising unrearranged human V.sub.L and unrearranged human J.sub.L gene segments; and wherein the lymphocyte expresses a human immunoglobulin light chain variable domain that is cognate to the human immunoglobulin heavy chain variable domain.

21. The method of claim 18, wherein the unrearranged human immunoglobulin heavy chain variable region nucleotide sequence further comprises an addition of at least one histidine codon or a substitution of at least one non-histidine codon with a histidine codon in a CDR1 encoding sequence, a CDR2 encoding sequence, an N terminal encoding sequence or a loop encoding sequence

22. The method of claim 18, wherein the CDR3 encoding sequence is selected from a human germline V.sub.H gene segment sequence, a human germline D gene segment sequence, a human germline J.sub.H gene segment sequence, and a combination thereof.

23. A cell obtained according to the method of claim 18.

24. An in vitro method of making a human immunoglobulin heavy chain variable domain comprising: expressing in a cell the nucleic acid of claim 14.

25. The method of claim 24, wherein the nucleic acid further comprises a human immunoglobulin heavy chain constant region gene sequence operably linked to the rearranged human immunoglobulin heavy chain variable region gene sequence.

26. The method of claim 25, wherein the human immunoglobulin heavy chain constant region gene sequence comprises a modification that increases an affinity of a C.sub.H2-C.sub.H3 region of an IgG heavy chain constant region amino acid sequence to neonatal Fc receptor (FcRn) at a pH ranging from about 5.5 to about 6.0, wherein the modification is a mutation in the IgG heavy chain constant region amino acid sequence selected from the group consisting of M428L, N434S, V259I, V308F, N434A, M252Y, S254T, T256E, T250Q, H433K, N434Y, and a combination thereof.

27. The method of claim 24, further comprising co-expressing in the cell a nucleotide sequence encoding a human immunoglobulin light chain variable domain.

28. A human immunoglobulin heavy chain variable domain made according to the method of claim 24.

29. A genetically modified immunoglobulin heavy chain locus in a germline of a non-human animal comprising an unrearranged human heavy chain variable region nucleotide sequence, wherein the unrearranged human heavy chain variable region nucleotide sequence comprises an addition of at least one histidine codon or a substitution of at least one endogenous non-histidine codon with a histidine codon.