U.S. patent application number 15/012804 was filed with the patent office on 2016-08-04 for miniaturized lateral flow device for rapid and sensitive detection of proteins or nucleic acids.
The applicant listed for this patent is Los Alamos National Security, LLC.. Invention is credited to Robert B. Cary.
Application Number | 20160222442 15/012804 |
Document ID | / |
Family ID | 39721714 |
Filed Date | 2016-08-04 |
United States Patent
Application |
20160222442 |
Kind Code |
A1 |
Cary; Robert B. |
August 4, 2016 |
Miniaturized Lateral Flow Device for Rapid and Sensitive Detection
of Proteins or Nucleic Acids
Abstract
The invention provides miniaturized lateral flow chromatographic
and lateral flow chromatographic microarray devices (LFM). The
miniaturization of lateral flow nucleic acid detection achieved by
the present invention offers reduced reagent use, femtomole
sensitivity, excellent linear dynamic range, and rapid detection.
Moreover, the small feature sizes of capture oligonucleotides
renders the potential information capacity of the platform
comparable to more traditional spotted fluorescence microarrays as
well as improving sensitivity. The LFM devices exemplified herein
enable analytes to be detected within 10 seconds from the time of
sample introduction to the LFM device. Sample volumes may be as low
as about 10 microliters, significantly reducing assay costs and
ameliorating reagent storage logistics. Additionally, the
miniaturization of lateral flow opens the door to highly
multiplexed assays, allowing many proteins or nucleic acids to be
detected in a single assay.
Inventors: |
Cary; Robert B.; (Santa Fe,
NM) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Los Alamos National Security, LLC. |
Los Alamos |
NM |
US |
|
|
Family ID: |
39721714 |
Appl. No.: |
15/012804 |
Filed: |
February 1, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11894910 |
Aug 22, 2007 |
|
|
|
15012804 |
|
|
|
|
60925210 |
Apr 18, 2007 |
|
|
|
60839537 |
Aug 22, 2006 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6834 20130101;
G01N 33/523 20130101; C12Q 1/6837 20130101; C12Q 1/6834 20130101;
C12Q 2565/625 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Goverment Interests
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH OR DEVELOPMENT
[0002] This invention was made with government support under
Contract No. DE-AC52-06NA25396, awarded by the United States
Department of Energy. The government has certain rights in this
invention.
Claims
1. A method for quantitatively detecting the presence of one or
more target nucleic acids in a fluid sample, the method comprising:
immobilizing first capture oligonucleotides on a first region of a
microporous membrane; immobilizing second capture oligonucleotides
on a second region of a microporous membrane; hybridizing labeled
colorimetric detection oligonucleotides to a complementary first
sequence of the target nucleic acid; directly hybridizing the first
capture oligonucleotides to a complementary second sequence of a
first group of the target nucleic acids; directly hybridizing the
second capture oligonucleotides to a complementary third sequence
of a second group of the target nucleic acids, wherein the first
capture oligonucleotides and the second capture oligonucleotides
each display signal linearity over a different concentration range
of the target nucleic acid; measuring an intensity of a first
optical or colorimetric signal produced on the first region;
measuring an intensity of a second optical or colorimetric signal
produced on the second region; determining if the intensity of the
first signal and/or the second signal is in the linear range of the
first capture oligonucleotide and second capture oligonucleotide
respectively; and calculating the concentration of the target
nucleic acid in the fluid sample using the intensity of the first
signal and/or the second signal if the intensity is in the
respective linear range.
2. The method of claim 1 wherein the microporous membrane comprises
lateral flow compatible nitrocellulose.
3. The method of claim 1 wherein the detection oligonucleotide is
labeled with a detectable particle of between 0.02 and 1 .mu.m in
diameter.
4. The method of claim 3 wherein the detectable particle is
selected from the group consisting of polystyrene microspheres,
latex particles, nano-gold particles, colloidal gold particles,
metal particles, magnetic particles, and semi-conductor
nanocrystals.
5. The method of claim 1 wherein the detection oligonucleotides
each comprise a first portion having a sequence complementary to
the first sequence and a second portion having a non-target
specific sequence of at least 9 nucleotides, which second portion
is adjacent to the label.
6. The method of claim 5 wherein the second portion has a poly (A)
or poly (T) sequence of at least 9 nucleotides.
7. The method of claim 1 wherein the first sequence and second
sequence of the target nucleic acid are adjacent within 2
bases.
8. The method of claim 1 wherein each detection oligonucleotide is
a branched nucleic acid molecule or a dendrimeric nucleic acid
molecule.
9. The method of claim 1 wherein each first capture oligonucleotide
and/or second capture oligonucleotide has a feature size of between
50 and 300 .mu.m diameter.
10. The method of claim 9 wherein each first capture
oligonucleotide and/or second capture oligonucleotide has a feature
size of between 50 and 250 .mu.m diameter.
11. The method of claim 10 wherein each of the first capture
oligonucleotides and/or second capture oligonucleotides has a
feature size of between 50 and 200 .mu.m diameter.
12. The method of claim 1 further comprising: releasing nucleic
acids from a biological sample, the nucleic acids suspected of
containing the target nucleic acid sequence; and amplifying the
target nucleic acid sequence to produce copies of the target
nucleic acid.
13. The method of claim 12 wherein the copies of the target nucleic
acid comprise DNA or RNA.
14. The method of claim 12 wherein the amplifying step comprises
reverse transcription polymerase chain reaction (RT-PCR) or nucleic
acid sequence based amplification (NASBA).
15. The method of claim 1 comprising hybridizing different labeled
colorimetric detection oligonucleotides to different target nucleic
acids.
16. The method of claim 15 wherein the different detection
oligonucleotides are coupled to differentiable detectable
labels.
17. The method of claim 16 wherein the differentiable detectable
labels comprise dyed polystyrene microspheres.
18. The method of claim 16 wherein the differentiable detectable
labels comprise semiconductor nanocrystals with different spectral
emission characteristics.
Description
RELATED APPLICATIONS
[0001] This patent application is a continuation of U.S. patent
application Ser. No. 11/894,910, entitled "Miniaturized Lateral
Flow Device for Rapid and Sensitive Detection of Proteins or
Nucleic Acids", filed Aug. 22, 2007, which claims the benefit of
the filing date of U.S. Provisional Patent Application No.
60/839,537 filed Aug. 22, 2006 and U.S. Provisional Patent
Application No. 60/925,210 filed Apr. 18, 2007 under 35 U.S.C.
119(e).
BACKGROUND OF THE INVENTION
[0003] The threat presented by biological weapons, global health
care issues and emerging diseases of natural origin lend urgency to
the development of rapid, field-deployable pathogen detection and
diagnostic tools (1,2). Ideally, to be of general field utility, a
diagnostic device must be capable of sensitive and specific
pathogen detection while retaining simplicity of use and
independence from complex laboratory instrumentation (3).
Additional challenges are presented by the need to screen samples
for multiple pathogenic or toxic agents, a characteristic highly
desirable in cases where commonalities in early symptom
presentation confound differential diagnoses.
[0004] While nucleic acid-based assays for pathogen detection and
identification offer sensitivity, specificity and resolution, they
are relatively elaborate and often costly, limiting their utility
for point-of-care diagnostics and deployment under field conditions
where a supporting laboratory infrastructure is limited or absent.
Reliance upon polymerase chain reaction (PCR) and fluorescent
detection of amplified nucleic acids has contributed significantly
to the complexity and cost of nucleic acid diagnostics (2,4-6).
Retaining assay sensitivity, while circumventing requirements for
thermocyclers and fluorescence detection hardware, remains a
significant challenge.
[0005] The recent advent of DNA microarray technology has promised
to increase the information capacity of nucleic acid diagnostics
and enable the highly multiplexed detection of genetic signatures
(7). The potential of DNA microarrays to detect, in parallel, large
panels of distinct nucleic acid sequences has proven to be a
powerful technique for many laboratory applications (for review see
(8)). Nonetheless, the reliance of this technology on costly
instrumentation for high-resolution fluorescence signal
transduction severely limits the utility of microarrays for field
applications where a laboratory infrastructure is limited or
unavailable. Additionally, the long hybridization incubations
required for microarray assays increase sample-to-answer times
beyond what would be acceptable for a rapid screening assay. Though
microarray hybridization times as short as 500 seconds have been
reported (9), such methods employ relatively elaborate microfluidic
designs that remain reliant upon fluorescent detection and do not
address the need for low cost, easily manufactured devices that can
be used without costly supporting instrumentation.
[0006] In contrast to DNA-based assays, immunoassays have found
widespread acceptance in low cost, easily used formats, perhaps the
most notable of which is the chromatographic lateral flow
immunoassay (for a review see (10)). Lateral flow assays, also
known as hand-held assays or dipstick assays, are used for a broad
range of applications where rapid antigen detection is required in
an easily used, low cost format. Expanding the domain of lateral
flow chromatography to nucleic acid detection, a number of recent
reports have described lateral flow detection of PCR products using
a variety of capture and detection schemes (11-14). Unfortunately,
the utility of lateral flow detection in the context of a PCR-based
assay is severely limited by the fact that reliance on
thermocycling hardware largely negates the potential benefit of the
otherwise highly simplified lateral flow platform. Additionally, a
PCR-based approach to lateral flow detection necessitates each PCR
reaction be subjected to post-amplification manipulations required
to generate single-stranded products for hybridization-based
detection.
[0007] Recent work has sought to alleviate reliance on PCR through
employing isothermal nucleic acid amplification schemes or direct
detection of unamplified genetic material. Enabled by the use of
up-converting phosphor reporters, unamplified Streptococcus
pneumoniae DNA sequence has been detected using a lateral flow
assay format (15). Up-converting phosphor technology, while
sensitive, remains dependent upon the hardware required to detect
phosphor emission (16). The use of simple colorimetric detection
schemes that circumvent the requirements for complex
instrumentation require an upstream amplification strategy to
attain suitable sensitivity. Isothermal nucleic acid amplification
coupled with lateral flow detection has been reported for assays
making use of cycling probe technology (CPT, (17)) and nucleic acid
sequence-based amplification (NASBA, (18-20)) (21-25). While the
work by Fong et al (21) made use of a lateral flow immuno-assay for
DNA detection, the RNA targets amplified by NASBA in the work from
Baeumner's group (22-25) were detected using a lateral flow system
enabled by the use of liposome encapsulated dye and a sandwich
hybridization assay similar to that reported by Rule et al (12).
While shown to display nanomolar sensitivity, the reported dye
encapsulating liposome-based methods require additional washing
steps and the liposomes are relatively labile, must be custom
synthesized, and stored under stabilizing hydrated conditions
(26).
SUMMARY OF THE INVENTION
[0008] The invention provides miniaturized lateral flow
chromatographic and lateral flow chromatographic microarray devices
(collectively, "LFM devices"), also termed "DNA dipstick", "nucleic
acid dipstick", LFM dipstick" and "dipstick" devices, as well as
diagnostic assay methods utilizing LFM technology and dipsticks and
related diagnostic kits comprising LFM dipsticks.
[0009] The LFM technology and LFM devices of the invention offer
many of the advantages of microarray technology yet retain the
simplicity of lateral flow-based platforms. The miniaturization of
lateral flow nucleic acid detection achieved by the present
invention offers reduced reagent use, femtomole sensitivity,
excellent linear dynamic range, and rapid detection. Moreover, the
small feature sizes of capture oligonucleotides renders the
potential information capacity of the platform comparable to more
traditional spotted fluorescence microarrays as well as improving
sensitivity. The LFM devices exemplified herein enable analytes to
be detected within 10 seconds from the time of sample introduction
to the LFM device. Sample volumes may be as low as about 10
microliters, significantly reducing assay costs and ameliorating
reagent storage logistics. Additionally, the miniaturization of
lateral flow opens the door to highly multiplexed assays, allowing
many proteins or nucleic acids to be detected in a single
assay.
[0010] Coupled with an isothermal amplification technique, LFM
provides a facile means of rapidly detecting nucleic acid targets
while circumventing hardware requirements for fluorescence
detection and PCR thermocycling.
[0011] The power of LFM is demonstrated in the Examples, infra.
More specifically, Example 8 illustrates the utility of the lateral
flow microarray (LFM) approach for sensitive detection and
discrimination of closely related microbial signatures when present
as minority sequences in complex nucleic acid mixtures, using an
assay based on the nonsense mutation in the plcR gene of B.
anthracis, that is absent in the near phylogenetic neighbors B.
thuringiensis and B. cereus (27,28). The results demonstrate that
LFMs, making use of stable detection reagents suitable for dry
storage, can be used to detect as little as 250 amol analyte within
2 minutes of sample addition. The miniaturization of lateral flow
detection decreases reagent consumption and sample-to-answer times
while increasing the potential information capacity of the platform
to enable the development of highly multiplexed nucleic acid
detection assays.
[0012] In one aspect, the invention provides a lateral flow
chromatographic device for detecting the presence of at least one
single-stranded target nucleic acid analyte in a fluid sample,
comprising a chromatographic test strip which comprises (a) a
sample receiving zone for receiving an aliquot of the sample and
for receiving a labeled detection oligonucleotide, which detection
oligonucleotide comprises a sequence which is complementary to a
first sequence of the target nucleic acid; and, (b) a capture zone
in lateral flow contact with the sample receiving zone, said
capture zone comprising a microporous membrane, onto which at least
one capture oligonucleotide is immobilized at a feature size of 500
.mu.m diameter or smaller, and which comprises a sequence which is
complementary to a second sequence of the target nucleic acid. In
some embodiments, the microporous membrane is 3 mm or less in
width. The lateral flow chromatographic device may combine the
sample receiving zone and the capture zone, such that they comprise
a contiguous microporous membrane. The microporous membrane is a
lateral flow compatible nitrocellulose membrane having a pore size
of between 0.2 and 20 .mu.m. The detection oligonucleotide is
labeled with a detectable particle of between 0.02 and 1 .mu.m in
diameter, including without limitation, polystyrene microspheres,
latex particles, nano-gold particles, colloidal gold particles,
metal particles, magnetic particles, fluorescently detectable
particles, and semi-conductor nanocrystals. In some embodiments,
the detection oligonucleotide comprises a first portion having a
sequence complementary to a part of the target sequence and a
second portion having a non-target specific sequence of at least 9
nucleotides, which second portion is adjacent to the label. The
second portion may, for example, be a poly (A) or poly (T) sequence
of at least 9 nucleotides.
[0013] In some embodiments, the first sequence and second sequence
of the target nucleic acid are adjacent within 2 bases, in order to
take advantage of "base stacking" hybridization stability.
[0014] In another aspect, the invention provides a lateral flow
chromatographic device for detecting the presence of at least one
single-stranded target nucleic acid analyte in a fluid sample,
comprising a lateral flow matrix which defines a flow path and
which comprises in series: (a) a sample receiving zone for
receiving an aliquot of a fluid sample; (b) a labeling zone in
lateral flow contact with said sample receiving zone, wherein the
labeling zone comprises a porous material containing at least one
detection oligonucleotide reversibly bound thereto, which detection
oligonucleotide is complementary to a first sequence of the target
nucleic acid and is coupled to a detectable label; and, (c) a
capture zone in lateral flow contact with said labeling zone, said
capture zone comprising a microporous membrane, onto which at least
one capture oligonucleotide is immobilized at a feature size of 500
.mu.m diameter or smaller. In some embodiments, the microporous
membrane is 3 mm or less in width. The lateral flow chromatographic
device may combine the sample receiving zone and the capture zone,
such that they comprise a contiguous microporous membrane. The
microporous membrane is a lateral flow compatible nitrocellulose
membrane having a pore size of between 0.2 and 20 .mu.m. The
detection oligonucleotide is labeled with a detectable particle of
between 0.02 and 1 .mu.m in diameter, including without limitation,
polystyrene microspheres, latex particles, nano-gold particles,
colloidal gold particles, metal particles, magnetic particles,
fluorescently detectable particles, and semi-conductor
nanocrystals. In some embodiments, the detection oligonucleotide
comprises a first portion having a sequence complementary to a part
of the target sequence and a second portion having a non-target
specific sequence of at least 9 nucleotides, which second portion
is adjacent to the label. The second portion may, for example, be a
poly (A) or poly (T) sequence of at least 9 nucleotides.
[0015] In some embodiments, the first sequence and second sequence
of the target nucleic acid are adjacent within 2 bases, in order to
take advantage of "base stacking" hybridization stability.
[0016] In another aspect, the invention provides an assay method of
testing for the presence of a target nucleic acid in a liquid
sample, comprising applying or contacting the liquid sample to the
sample receiving zone of the lateral flow chromatographic device of
the invention, allowing the sample to transport by capillary action
through the capture zone, and detecting the presence or absence of
the target nucleic acid by detecting the presence of the label at
the relevant capture zone feature.
[0017] In another aspect, the invention provides a method for
detecting the presence of a target nucleic acid in a biological
sample, comprising: (a) providing a biological sample suspected of
containing the target nucleic acid sequence; (b) releasing nucleic
acid from the biological sample; (c) amplifying the target nucleic
acid using nucleic acid sequence based amplification (NASBA) to
generate a solution containing amplified single-stranded RNA
complementary to the target nucleic acid, if present in the
extracted DNA and/or RNA from the biological sample; and, (d)
assaying for the presence of the complementary RNA target nucleic
acid using the assay method above.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1. Detection of DNA hybridization over range of capture
oligonucleotide deposition concentrations on DNA dipstick. See
Example 1.
[0019] FIG. 2. See Example 2. (A) Dipstick exposed to 100 .mu.l of
sample containing 5 nM cya target sequence (i.e. 500 fmol target
sequence) (5'-AAGCTTCAGGTTTAGTACCAGAACATGCAGATGCTTTTAA-3') [SEQ ID
NO: 1]. Signal is detectable as a blue dot only at the cya capture
feature. (B) Dipstick exposed to 100 .mu.l of sample containing 5
nM capB target sequence
(5'-TTATCTGGGAAGACCATGTAATCAAATTTTCGTAAGAATTC-3') [SEQ ID NO: 2].
Specific signal is generated at the cognate capB capture feature of
the dipstick. (C) Dipstick exposed to 100 .mu.l of sample
containing 5 nM pagA target sequence
(5'-TTCGAATTACTAAATCCTGCAGATACACTCCCACCAATAT-3') [SEQ ID NO: 3].
Signal is detected only at the pagA capture site. In this
particular dipstick, the negative results at the cya and capB
capture sites can be visualized as faint white areas of microsphere
exclusion at their respective capture positions. (D) Triplex
dipstick detection of all three target sequences each present at a
concentration of 5 nM in a 100 .mu.l sample volume. For all panels,
signal was visually discernible within 10 minutes.
[0020] FIG. 3. Sensitivity and detection times for DNA dipstick and
DNA dipstick microarrays. See Example 3.
[0021] FIG. 4. Sensitivity and detection times for DNA dipstick
microarrays, see Example 3.
[0022] FIG. 5. (A) NASBA primer binding sites are shown in the
relevant region of the predicted B. anthracis plcR mRNA sequence
based on GenBank accession number AY265698 [SEQ ID NO: 4]. The
terminal 3' base of plc-P1 is complementary to the U of the ochre
stop codon, indicated with an arrowhead, diagnostic for B.
anthracis. (B) The predicted nucleotide sequence plcR mRNA in the
region represented by synthetic target dnaR89 [SEQ ID NO: 5]. The
binding sites of detection probe R-57-76-3TN, as well as capture
probes R-77-96, R36-55 and R-24-43 are indicated.
[0023] FIG. 6. (A) A compact plastic housing was designed to a
carry conjugate release pad and a LFM membrane. A small port is
used to introduce the 10 .mu.l sample volume and a rectangular
window allows direct visualization of the microarray capture
features. The device is 39.times.5 mm. (B) A schematic
representation of the hybridization sandwich assay used for
LFM-based nucleic acid detection. Carboxyl-polystyrene dyed
microspheres are linked to amine modified detection oligonucleotide
R-57-76-3TN. The microsphere/analyte complex forms by hybridization
as sample solution liberates dried microspheres from the conjugate
release pad. This complex is captured from solution by
hybridization to immobilized capture probes as capillary flow
transports the sample/bead solution through the large pore
nitrocellulose matrix. The resulting increase in local microsphere
concentration, at capture features complementary to the target
analyte, rapidly produces a colorimetric signal visible to the
naked eye and easily detected at low concentrations using widely
available flatbed scanners. The hybridization based nature of the
assay render it well suited for multiplexed detection.
[0024] FIG. 7. (A) LFM substrates patterned with different
concentrations of capture oligonucleotides R-77-96, R-36-55, and
R-24-43 were used to detect dnaR89 with R-57-76-3TN microspheres.
Signals generated at microarray capture features printed at 200,
400 and 800 .mu.M were quantified following lateral flow of samples
containing 5, 10 and 20 fmol dnaR89. Signals were normalized for
each capture probe and target concentration. Average signal
intensities were calculated and presented in this bar graph. 400
.mu.M printing concentrations consistently provided the strongest
signal independent of capture sequence or dnaR89 concentration. (B)
Scatter plot of normalized signal intensity versus SSC
concentration. LFM running buffer was optimized for SSC
concentration using R-57-76-3TN to detect dnaR89 (circles) or
plcRivt (squares). (C) Line plot of normalized signal intensity
versus formamide concentration. Formamide concentrations between 0
and 20% in LFM running buffer based on 4.times.SSC were evaluated
for dnaR89 (circles) and plcRivt (squares). 5% formamide provided
near optimal detection of both dnaR89 and plcRivt. (D) Line plot of
normalized signal intensity versus the R-57-76-3TN to microsphere
ratio. 2.2.times.10.sup.4 oligonucleotides/bead in coupling
reactions provided the best performing conjugated microsphere
populations as judged by hybridization sandwich assay signal
intensity.
[0025] FIG. 8. Representative LFMs are shown following detection of
the indicated amounts of dnaR89. The microarray physical layout is
provided in the color legend. The panel labeled "Ponceau S" is an
LFM prior to sample addition. Ponceau S allows visualization of
successful oligonucleotide deposition but migrates away from the
capture zone during sample transport across the substrate. Contrast
was adjusted using the Auto Contrast function in Photoshop CS2 to
increase reproduction contrast. Auto Contrast adjustment was not
used for images subjected to quantification. The bar is 600 .mu.m
for all LFM panels.
[0026] FIG. 9. (A) The relative performance of three different
capture oligonucleotides (R-77-96, circle/solid line; R-36-55,
square/solid line; R-24-43, diamond/dashed line) was determined
using varying amounts of dnaR89 from 0 to 200 fmol. The capture
probe R-77-96 provides significantly more sensitive detection than
the other capture sequences evaluated using R-57-76-3TN coupled
microspheres. (B) R-77-96 signal intensity versus amol dnaR89 from
0 to 2500 amol is plotted with a linear regression line
(R.sup.2=0.989). (C) R-24-43 signal intensity versus fmol dnaR89
from 2.5 fmol to 100 fmol plotted with a linear regression line
(R.sup.2=0.968). For all parts error bars are the 95% confidence
interval (one tailed, n=6).
[0027] FIG. 10. Time course of LFM detection: 10 .mu.l samples
containing either 1000 fmol (circle), 100 fmol (square) or 10 fmol
(diamond) dnaR89 were run on appropriately patterned LFMs. Video
data were collected and colorimetric signal intensity measured from
video frames at R-77-96 capture features. Capillary transport of
the 10 .mu.l sample was complete by 120 seconds. Lines represent
logarithmic curve fits to the data.
[0028] FIG. 11. (A) Indicated amounts of total cellular RNA from B.
anthracis Sterne strain 7702 or, as a negative control, 2 ng B.
thuringiensis strain HD 621 RNA (0 fg) were introduced to 1 .mu.g
of total human cellular RNA isolated from HeLa S3 cells. RNA
mixtures were subjected to NASBA amplification for 60 min after
which 2 .mu.l aliquots of the NASBA reactions were mixed with 8
.mu.l of LFM running buffer and introduced to LFMs. Enlarged LFM
sub-regions are shown following Auto Contrast adjustment in
Photoshop. The legend indicates microarray element identities: (+)
dnaR89 as a positive hybridization control, (-)R-57-76 as negative
hybridization control, (24-43) capture probe R-24-43, (36-55)
capture probe R-36-55, (77-96) capture probe R-77-96. (B) Graph of
quantified signals from B. anthracis and B. thuringiensis
challenged LFMs with linear regression line (R.sup.2=0.970). 0 fg
B. anthracis total cellular RNA data point contains 2 ng B.
thuringiensis total cellular RNA in addition to 1 .mu.g human total
cellular RNA. Error bars depict measurement standard deviation
(three determinations).
[0029] FIG. 12. Dual reporter LFM. Snapshots of a single LFM
visualized under ambient lighting (A) revealing dyed microsphere
colorimetric signal and under UV-LED flashlight illumination (B)
revealing signal generated by fluorescent semi-conductor
nanocrystals (biotin conjugated Quantum Dots). The LFM membrane was
challenged with dnaR89 detected using biotinylated detection
oligonucleotide R-57-76-3TBIO. The detection oligonucleotide
sequence is: 5'-AGGTGAGACATAATCATGCA
TTTTTTTTTU-biotinTTTTU-biotinTTTTU-biotin3' [SEQ ID NO: 6].
[0030] FIG. 13. Linearity of semi-conductor nanocrystal-based LFM
detection. Varying quantities of dnaR89 were detected by LFM using
R-57-76-3TBIO and streptavidin conjugated semi-conductor
nanocrystals. The resulting LFMs were quantified on an Axon GenePix
4200 Pro microarray scanner using GenePix Pro 6.0 software.
Background corrected mean signal values are shown plotted versus
fmols of dnaR89. The assay exhibits excellent linearity
(R.sup.2=0.991) over a 1000-fold range of target.
DETAILED DESCRIPTION OF THE INVENTION
[0031] Unless otherwise defined, all terms of art, notations and
other scientific terminology used herein are intended to have the
meanings commonly understood by those of skill in the art to which
this invention pertains, unless otherwise defined. In some cases,
terms with commonly understood meanings are defined herein for
clarity and/or for ready reference, and the inclusion of such
definitions herein should not be construed to represent a
substantial difference over what is generally understood in the
art. The techniques and procedures described or referenced herein
are generally well understood and commonly employed using
conventional methodologies by those skilled in the art, such as,
for example, the widely utilized molecular cloning methodologies
described in Sambrook et al., Molecular Cloning: A Laboratory
Manual 3rd. edition (2001) Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. and Current Protocols in Molecular Biology
(Ausbel et al., eds., John Wiley & Sons, Inc. 2001. As
appropriate, procedures involving the use of commercially available
kits and reagents are generally carried out in accordance with
manufacturer defined protocols and/or parameters unless otherwise
noted.
[0032] Overview of LFM System
[0033] The invention relates to miniaturized lateral flow
chromatographic methods and devices useful for the sensitive and
specific detection of nucleic acid and protein analytes. As the
invention realizes many of the benefits of microarray technology,
incorporated into a lateral flow technology platform, the term
"lateral flow microarray" or "LFM" is used herein. Principal
features of LFM include small feature sizes (spot sizes) compared
to traditional lateral flow devices (i.e., typically less than 600
.mu.m diameter, more typically less than 300 .mu.m diameter, and in
some embodiments, smaller, i.e., 50 .mu.m diameter or less),
reduced width of the microporous detection membrane, high feature
density potential, and multiplex capability. These features, in
turn, result in lower sample volume requirements (i.e., 10 .mu.L),
faster assay run times, lower reagent costs, and surprising levels
of sensitivity (i.e., attomolar) and linear dynamic range (i.e., 3
orders of magnitude signal linearity).
[0034] The sensitivity of lateral flow nucleic acid detection
methods previously reported in the literature has been on the order
of 1 fmol (e.g., (25)). In embodiments of LFM which utilize dyed
polystyrene microspheres as the detection particle (i.e.,
colorimetric detection), the LFM platform provides rapid detection
of as little as 250 amol of target using a low cost and widely
available flatbed scanner, a standard personal computer system and
a commercially available microarray data extraction suit or free
image analysis software. This detection limit is similar to the
sensitivity reported for fluorescence and chemiluminescence
microarray detection strategies (9,46). Furthermore, it is likely
that the sensitivity of LFM may be improved by using semi-conductor
nanocrystal as the detection particle. Importantly, utilizing
nanocrystals in LFM assays results in improved linear dynamic range
(see Examples, infra).
[0035] LFM demonstrates excellent linear dynamic range utilizing
dyed microspheres as the detection particle. Indeed, with reference
to the studies described in Example 6, infra, the effective linear
range of the LFM assay extends over a 400-fold range of target from
250 amol to 100 fmol (see FIGS. 9B and 9C). As the information
density of the LFM offers the capacity for additional capture
probes of varying hybridization potential to be included, it is
expected that this dynamic range may be extended. The uniformity of
sample flow exhibited by the LFM suggests that larger capture probe
sets can be accommodated without complications arising from
physical factors. For example, concentrations of analyte 40-fold
above the linear range of R-77-96 did not adversely impact the
linearity of R-24-43 signal at LFM elements situated directly
downstream (with respect to sample flow) of R-77-96 capture
features (FIGS. 9B and 9C). Only at artificially high microsphere
capture densities, such as those produced by the positive control
hybridizations in FIG. 8, are signal gradients observed as a
function of physical location on the LFM, presumably due to
physical occlusion of membrane pores by high local accumulations of
microspheres.
[0036] Studies utilizing semi-conductor nanocrystals as the
detection particle indicate that the linear dynamic range of LFM
may be improved to at least three orders of magnitude. As shown in
Example 8, remarkable signal linearity over the 1 fmol to 1000 fmol
range of dnaR89 analyte was achieved using LFM devices containing
nanocrystal-conjugated detection oligonucleotides
(R.sup.2=0.991).
[0037] LFMs offer several advantages arising directly from the
miniaturization of the system without sacrificing detection
sensitivity. While traditional lateral flow assays make use of
sample volumes on the order of hundreds of microliters to
milliliters, the miniaturization approach embodied in the invention
reduces sample volume to about 10 .mu.l. This reduced sample volume
significantly decreases the consumption of reagents required for
amplification, and thus assay cost. In the Examples disclosed
herein, the LFM device enabled a reduction in the standard NASBA
reaction volumes from 20 .mu.l to 2 .mu.l, thereby achieving a one
order of magnitude reduction in enzyme consumption. Similarly,
other amplification schemes, such as those that make use of
microfluidic systems or lab-on-a-chip technologies, may be
integrated with LFM-based detection systems to provide a rapid and
cost effective means of detecting analytes.
[0038] A further benefit of LFM is the time required to detect
analyte following introduction of amplified sample material. While
the procedures used in Example 8 employed NASBA amplification and
traditional RNA isolation protocols requiring approximately 90
minutes to complete, more recent advances in nucleic acid
preparation and amplification have reported significant reduction
in sample processing times (for a recent review see (47)). As
amplification protocols become more rapid, the speed with which
amplicons can be detected, without reliance on complex optical
systems and fluorescent detection methods, will be critical to
realizing the potential of these technologies. The LFM methods of
the invention are able to achieve detection of nucleic acid
analytes in less than 2 minutes. Given that 250 amol is equivalent
to 1.5.times.10.sup.8 molecules, efficient amplification methods
that offer 10.sup.9 fold amplification, widely cited amplification
levels for PCR- and NASBA-based techniques (22,48), would
theoretically enable the detection of single copy targets by LFM
following amplification. Future systems that couple advanced
amplification technologies and compatible streamlined nucleic acid
preparation modalities with rapid LFM detection will allow
significant decreases in sample-to-answer times without costly or
complex instrumentation.
[0039] LFM devices of the invention utilize sandwich-type
hybridization, either employing sets of target-complementary
oligonucleotides (or other nucleic acid molecules, such as
dendrimers) to detect nucleic acid analytes, or binding ligands
such as antibodies to detect protein analytes. In respect of
nucleic acid detection methods using LFM, nucleic acid target is
detected redundantly using (a) detectably labeled detection
oligonucleotides complementary to one of two signature sequences on
the target nucleic acid (i.e., oligonucleotides conjugated to a
detectable label, such as dyed microspheres, semi-conductor
nanocrystals, etc.), and (b) membrane-immobilized capture
oligonucleotides complementary to the other signature sequence on
the target. In the practice of a nucleic acid detection assay
utilizing the LFM system of the invention, the capture of amplified
target nucleic acids by the membrane-immobilized capture
oligonucleotides and labeled detection oligonucleotides brings the
label into contact with the membrane, displaying a visual or
machine-readable optical signal. Thus, the assay requires positive
hybridization to two distinct sequences on the target nucleic acid
in order to produce a localized signal, resulting in very high
assay specificity.
[0040] Physical Components of LFM Devices
[0041] The lateral flow chromatographic devices of the invention
comprise a series of absorbent substrates which are used to
transport analyte in a lateral manner to components containing
certain reagents or materials required for the detection of the
analyte.
[0042] In one aspect, a lateral flow chromatographic device of the
invention comprises a chromatographic test strip which comprises
(a) a sample receiving zone for receiving an aliquot of the sample
and for receiving a labeled detection oligonucleotide, which
detection oligonucleotide comprises a sequence which is
complementary to a first sequence of the target nucleic acid; and,
(b) a capture zone in lateral flow contact with the sample
receiving zone, said capture zone comprising a microporous
membrane, onto which at least one capture oligonucleotide is
immobilized and which comprises a sequence which is complementary
to a second sequence of the target nucleic acid. In an alternative
embodiment, a labeling zone in lateral flow contact with said
sample receiving zone is inserted up-stream of the capture zone and
is lateral flow contact with the capture zone. A labeling zone
comprises a porous material containing at least one detection
oligonucleotide reversibly bound thereto, which detection
oligonucleotide is complementary to a first sequence of the target
nucleic acid and is coupled to a detectable label, thereby enabling
the label step to take place on the device.
[0043] In a simplified illustration, one embodiment of the LFM
device is structurally organized into at least 3 zones, comprising
in linear orientation: (a) a sample pad constructed from absorbent
material onto which a liquid, nucleic acid-containing sample is
deposited, (b) a conjugate release pad containing a least one
oligonucleotide-fitted detection particle (e.g., microsphere, bead,
quantum dot), and (c) a detection zone comprising a nitrocellulose
or nylon membrane containing at least one immobilized capture
oligonucleotide. In some embodiments, a fourth element comprises an
absorbent material which is capable of facilitating the lateral
flow of the liquid sample from the sample pad end of the device to
and through the detection zone. In some embodiments, the sample pad
(a) and the conjugate release pad (b) are combined. In alternative
embodiments, the conjugate release pad element is eliminated, and
the sample to be assayed for the presence of a target nucleic acid
is mixed with the oligonucleotide-fitted detection particle prior
to placing the sample onto the sample pad.
[0044] The first substrate, or sample pad or sample receiving zone,
comprises an absorbent material preferably composed of a matrix,
with minimal nucleic acid binding properties, that will permit
unobstructed migration of the nucleic acid analyte to subsequent
stages of the apparatus without depletion. In a specific
embodiment, the sample pad is composed of a cellulose fiber pad
such as Millipore cellulose fiber sample pad material (Cat
#CFSP223000).
[0045] In embodiments where separate sample and conjugate release
pads are employed in the LFM device, the sample pad is situated
within the device such that it is in physical contact with the
conjugate release pad.
[0046] The substrate which contains the labeled detection
oligonucleotide conjugate is termed the conjugate release pad or
labeling zone. In some embodiments, the labeling zone is also used
to receive sample directly. The conjugate release pad comprises a
matrix composed of a material with minimal nucleic acid binding
capacity and of a physical composition which allows dried detection
particles to be liberated into solution with minimal residual
binding to the matrix. Examples of materials suitable for conjugate
pads include glass fiber and polyester materials (e.g., rayon).
These materials are commonly available from various commercial
sources (e.g., Millipore, Schleicher & Schuell).
[0047] The detection membrane of the capture zone may be any
microporous membrane material which is lateral flow compatible,
typically microporous cellulose or cellulose-derived materials such
as nitrocellulose (e.g., HiFlow 135, Millipore) or nylon. In some
embodiments, the sample receiving zone and the capture zone
comprise a contiguous microporous membrane.
[0048] Typically, the microporous membrane defines a relatively
narrow flow path. This may be achieved, for example, by utilizing
narrow strips of microporous membrane material. Excellent results
are obtained with membrane strips of 5 mm or less in width, with
the best results being obtained with strips of 3 mm or less. As
will be appreciated, other means for retaining a narrow flow path
of less than 5 mm or less than mm may be used, and may include
without limitation the use of barriers which define borders which
limit the flow path to a channel.
[0049] The microporous membrane of the capture zone is a lateral
flow compatible membrane such as cellulose, nitrocellulose,
polyethersulfone, polyvinylidine fluoride, nylon, charge-modified
nylon, and polytetrafluoroethylene. Typically, the membrane is
nitrocellulose. The detection membrane is typically provided with a
backing material for support, such as mylar or similar plastic
materials. The membrane may be treated with agents that inhibit
non-specific binding of analyte or other reagents used in an LFM
assay.
[0050] In embodiments utilizing nitrocellulose, pore sizes
typically range between 0.2 and 20 .mu.m, and more typically
between 0.2 and 12 .mu.m. In preferred embodiments utilizing
particle labels, the pore size of the microporous membrane should
be on the order to about 10 times the diameter of the particle.
[0051] In one embodiment, the detection membrane is composed of a
supported nitrocellulose membrane of sufficiently large pore
structure to allow the unimpeded transport of detection reagent
through the membrane matrix. Examples of suitable nitrocellulose
materials for dyed microsphere mediated detection are Millipore
HiFlow Plus HF09004, HF13504, Schleicher & Schuell Prima 60,
Schleicher & Schuell Prima 85. The Millipore HF13504
nitrocellulose membrane has been demonstrated to provide rapid,
specific and sensitive detection when patterned with appropriate
capture oligonucleotides (see Examples, infra). The microporous
membrane is placed in lateral flow contact with the labeling zone
(conjugate release pad).
[0052] In some embodiments, an absorbent material is placed in
lateral flow contact with the distal end of the detection membrane
in order to facilitate lateral flow through the entire LFM device.
Materials suitable for use as an absorbent pad include any
absorbent material, including, but not limited to, nitrocellulose,
cellulose esters, glass (e.g., borosilicate glass fiber),
polyethersulfone, cotton, dehydrated polyacrylamide, silica gel,
and polyethylene glycols. The rate of capillary flow can be
controlled by choosing the appropriate absorbent zone material.
[0053] LFM devices may be encased in a housing as described in,
e.g., U.S. Pat. No. 5,451,504. Materials for use in the housing
include, but are not limited to, transparent tape, plastic film,
plastic, glass, metal and the like. Such housings preferably
contain an opening or sample port for introducing sample, as well
as a window(s) permitting the visualization of the detection
zone(s) of the detection membrane.
[0054] Microarray Fabrication:
[0055] In the fabrication of an LFM device, the microporous
membrane of the capture zone is used for patterning capture
oligonucleotides and or protein capture ligands (i.e.,
antibodies).
[0056] In preferred nucleic acid detection LFM fabrications,
capture oligonucleotides are patterned onto the detection membrane
or substrate (i.e., nitrocellulose) with spot diameter sizes
("feature sizes") of about 1 mm or less, preferably 600 .mu.m or
less, more preferably less than about 300 .mu.m diameter, and in
some embodiments, smaller (i.e., 50 to 200 .mu.m, 50 to 250 .mu.m,
50 to 300 .mu.m). Oligonucleotide concentrations for spotting are
generally in the range of 200 .mu.M-800 .mu.M. In embodiments in
which PNAs or LNAs are used to synthesize oligonucleotides, lower
densities may suffice.
[0057] Detection membranes may be patterned to suit the desired
design of the detection element of the device. Methods for
depositing nucleic acids and proteins onto microporous membranes
such as nitrocellulose are well know, and negative and positive
control reagents as well as capture reagents may be patterned on to
the detection membrane using any of a number of deposition
techniques. These techniques can be selected based on the density
of information to be represented on the detection membrane. Manual
deposition by pipette, automated deposition by robotics through
contact mediated processes (stainless steel pins on a contact
microarray printing robot) or noncontact mediated processes such as
piezo responsive micropipettes, may all be used successfully to
fabricate the nucleic acid detection device described here.
[0058] Preferably, when using nitrocellulose and similar membranes,
non-contact printing techniques are used to deposit capture
oligonucleotides or proteins onto the detection membrane, in order
to retain the structural integrity of the detection membrane
material. See. For example, the non-contact printing methods
utilized in the Examples which follow.
[0059] Additionally, more convention means may be employed,
including various techniques commonly used to fabricate hand held
assay devices for the immunological detection of proteinaceous
analytes in the context of a lateral flow immunochromatographic
device.
[0060] For example, immobilization of capture oligonucleotides
directly on the detection membrane may be accomplished by using
high salt to adsorb the nucleic acid molecules to the surface of
the membrane, combined with baking at about 80.degree. C. to
permanently fix the adsorbed oligonucleotides. Additionally,
oligonucleotides may be deposited onto the membrane (i.e.,
nitrocellulose), air dried, and subjected to UV radiation (see
Examples herein). Capture oligonucleotides may also be fixed
directly to detection membrane by vacuum transfer in the presence
of an equimolar concentration of sodium chloride and sodium
citrate, or by the use of ultraviolet irradiation. The capture
oligonucleotides may also be covalently linked to charge-modified
nylon. In other embodiments, capture oligonucleotides may
incorporate a reactive ligand (e.g., biotin) and may be immobilized
indirectly on the detection membrane as a result of the interaction
between the ligand and an immobilized member of a binding pair
(e.g., streptavidin).
[0061] Detection membranes may be patterned with positive and
negative control reagents and capture reagents in an array such
that the physical position of each reagent is known. Positive
control reagents can be composed of oligonucleotides complementary
to detection oligonucleotides immobilized on detection reagents
(i.e. dyed microspheres linked to oligonucleotides through a
covalent bond or through an affinity interaction such as that
mediated by streptavidin/biotin interactions). Alternatively, in
embodiments where the streptavidin/biotin interaction is used to
couple dyed microspheres to oligonucleotides the positive control
array element can be composed of biotin in any of a number of forms
suitable for immobilization on nitrocellulose (for example, a
biotin labeled nucleic acid). Following binding to detection
oligonucleotides, free biotin binding sites on
streptavidin-conjugated dyed microspheres remain available for
interaction with immobilized biotin on the detection membrane, thus
providing one form of positive control.
[0062] Another positive control may be achieved by the
immobilization of oligonucleotide on the detection membrane. The
use of an oligonucleotide complementary to the dyed
microsphere-conjugated detection oligonucleotide as a positive
control allows direct hybridization of the detection
oligonucleotide/dyed microsphere complex following lateral flow
chromatography over the positive control. Negative controls for
hybridization specificity can be incorporated into the device by
patterning the detection membrane with detection oligonucleotide or
other nucleic acid sequences predicted, by means known to those
skilled in the art, to not hybridize to the detection
oligonucleotide sequence.
[0063] For nucleic acid analytes, capture reagents are composed of
oligonucleotides synthesized such that the sequence is
complementary to a region of the analyte target nucleic acid not
overlapping with the region complementary to the detection
oligonucleotide. Ideally, the predicted secondary structure of the
analyte target nucleic acid is examined to identify those regions
exhibiting reduced likelihood of participating in intramolecular
hydrogen bonds. Such regions are preferable sites for detection and
capture oligonucleotide binding.
[0064] Array elements may take the form of lines, stripes, dots or
human readable icons, letters or other forms or shapes deemed
useful to the interpretation of device read-out. In the case of
spots or dots deposited by robotic or manual means, individual
feature sizes from 50 microns to 5 mm have been shown to provide
accurate and interpretable hybridization mediated detection of 20
fmol analyte DNA molecules.
[0065] Capture and Detection Oligonucleotides:
[0066] For nucleic acid analytes, LFM devices incorporate two
classes of oligonucleotide referred to here as capture and
detection oligonucleotides. The detection oligonucleotide is linked
by any of a number of means to a detection reagent or label that,
when concentrated by capture through hybridization, renders the
capture zone distinguishable (i.e., opically) from the surrounding
substrate and from additional capture zones where the detection
reagent has not been sequestered. Examples of detection reagents
include polystyrene microspheres, latex particles, nano-gold
particles, colloidal gold particles, metal particles, magnetic
particles, fluorescently detectable particles, and semi-conductor
nanocrystals and the like.
[0067] Alternatively, a nucleic acid complex, such as a DNA
dendrimer or branched-DNA molecule, carrying multiple detectable
moieties, such as fluorescent molecules or biotin, can be used to
amplify lateral flow microarray signal intensity. By generating DNA
dendrimers carrying a detection sequence complementary to a region
of the target (detection sequence) each hybridization event at the
LFM capture zone results in the localization of multiple detectable
labels. Using a highly biotinylated dendrimer and a streptavidin
conjugated detection particle such as a dyed microspheres or
semi-conductor nanocrystals, both colorimetric and fluorescent
signal amplification can be realized. For example, the large number
of streptavidin binding sites on biotinylated dendrimers will
increase the number of streptavidin bound particles captured by
each hybridization event and generate a correspondingly amplified
signal. Several potential advantages, especially with respect to
multiplexed detection, may be realized using this approach.
Specifically, the use of a generic biotin/streptavidin interaction
allows the simultaneous use of multiple detection probe sequences
without requiring the preparation of multiple quantum dot-detection
probe conjugates. Together with the use of generic tag sequences
added to amplicons through the use of specially designed NASBA
primers, this approach is compatible with the development of
generic tag-based LFMs suitable for the detection of differing
panels of pathogens without redesign of the LFM layout.
[0068] The detection oligonucleotide is designed such that the
melting temperature of the resulting oligonucleotide allows
hybridization to its cognate sequence on the analyte under ambient
conditions with sufficient rapidity to allow duplex formation to
occur during lateral flow. Detection oligonucleotides with Tm of
50-70.degree. C. have been shown to provide effective reagents for
the detection of relevant analytes (using approximately 20-mer
oligonucleotides).
[0069] Detection oligonucleotides are synthesized with suitable
modifications to allow the efficient linkage to appropriate
detection reagent. In some embodiments it is advantageous to
include a spacer sequence consisting of 9 to 20 T residues proximal
to the modified end of the oligonucleotide that will be coupled to
the detection reagent. Chemistries of known suitability for use in
the device include biotin/streptavidin through a biotin
incorporated onto either the 5' or 3' end of the detection
oligonucleotide and covalent cross-linking through a primary amine
incorporated into either the 3' of 5' end of the detection
oligonucleotide. In one preferred process, detection
oligonucleotides are covalently linked to polystyrene microspheres
using the coupling agent 1-etyl-3-(3-dimethylaminopropyl-diimide
HCl (EDAC). Other methods that mediate the formation of a stable
complex between the detection reagent and the detection
oligonucleotide under assay conditions should also be suitable for
use in the fabrication of the device.
[0070] The second class of oligonucleotide used in the device is
the capture oligonucleotide. This reagent is immobilized on the
microporous detection membrane through the use of standard methods
for coupling nucleic acids to nitrocellulose or nylon, including
without limitation drying followed by ultraviolet light
cross-linking using 0.5 Joules UV. The capture oligonucleotide is
designed such that the sequence is complementary to the analyte
target nucleic acid at a region predicted to have little or no
secondary structure. The length of the capture oligonucleotide is
typically approximately 20 bases in length or of a length, to
generate a predicted melting temperature of approximately
50-70.degree. C.
[0071] In some embodiments it may be advantageous to add a spacer
sequence consisting of 9 to 20 T residues.
[0072] Detection and capture oligonucleotides can be synthesized
using well known DNA synthesis chemistries. The incorporation of
modified nucleic acids such as PNA (peptide nucleic acid) or LNA
(locked nucleic acid) may be useful for the enhanced hybridization
properties of these DNA derivatives. The use of PNA or LNA moieties
in the preparation of detection and/or capture oligonucleotides
will be useful in manipulating the desired melting temperature, and
so may allow shorter oligonucleotides to be employed for detection
and/or capture where sequence constraints preclude longer DNA
oligonucleotides.
[0073] In some embodiments, detection and capture oligonucleotides
are designed to hybridize to target nucleic acid within 0, 1 or 2
bases of each other, in order to increase the stability of
hybridization via the "base stacking" phenomenon. Base stacking has
been reported to stabilize hybridization and allow efficient
capture of dilute nucleic acids by hybridization (38-42). The data
generated in Example 6, infra, demonstrates that detection and
capture oligonucleotides which bind in tandem result in
significantly higher hybridization signals.
[0074] Detection Modalities:
[0075] The detection zone (detection membrane) of the lateral flow
device may comprise one or more capture oligonucleotides which are
complementary to one or more target sequences. The capture
oligonucleotides are stably affixed to the sample-exposed
surface(s) of the microporous detection membrane using standard
methodologies. Protein capture reagents may also be patterned onto
the detection membrane using standard methods.
[0076] The LFM devices of the invention can make use of diverse
detection modalities, including visual detection signals resulting
from the capture and increased local concentration of an
appropriate detection particle. The resulting colorimetric signal
can be visualized by eye. Alternatively, for more quantitative and
sensitive detection of signal, an electronic instrument capable of
detecting colorimetric signals may be employed. Such instruments
include standard flatbed scanners, dedicated lateral flow
chromatographic strip readers (e.g. QuadScan, KGW Enterprises,
Inc), or a simple CCD based devices fabricated for the detection of
colorimetric signals such as those employed by commercially
available immunochromatographic test strips (e.g. Clearblue Easy
Digital Pregnancy Test).
[0077] Visualization by eye can be aided by the fabrication of the
device in a manner that generates an easily recognized or
interpreted shape on the dipstick surface. One example would be the
patterning of an LFM with elements in a physical configuration that
results in the appearance of a letter or symbol indicative of a
positive or negative result (e.g. a "+" or "-" symbol).
[0078] Embodiments that employ fluorescent detection reagents such
as fluorescent nanoparticles (e.g. Qdots, QuantumDots, Inc.) offer
the potential increased sensitivity that results from the
application of fluorescence detection technology. Such embodiments
can be read using any of a number of ultraviolet light sources
including hand held UV lamps, UV emitting LEDs, and light sources
with sufficient emission in the UV to excite the nanoparticles. A
simple filter can be used to enhance the visualization of
nanoparticle fluorescence emissions. For example, a long pass
filter with a cut off below the emission wavelength of the
nanoparticle may be employed. In the case of excitation with a
white light source, an additional filter to limit excitation to UVA
and shorter wavelengths can be used (e.g., a 380 nm short pass
filter).
[0079] The microporous detection membrane may contain capture
oligonucleotides printed monolithically in order to produce
virtually any colorimetric pattern that can be visualized by the
unaided human eye, such as bands, letters, numbers, symbols, and
the like. If the sample contains both the first and second target
sequences, colored beads with hybridized detection
oligonucleotide-target nucleic acid will then hybridize to the
immobilized capture oligonucleotide, and thereafter remain stably
immobilized to the membrane at that physical location. Such "low
density" components of the detection zone may be used to provide a
rapid indication of the presence of a target sequence or sequences
in the sample, visualized only be the unaided eye.
[0080] In addition, the capture zone may contain one or more "high
density" components, capable of providing high resolution detail of
the signatures of the sequences present in the sample nucleic acid.
For example, an array of a number of distinct second detection
oligonucleotides may be deposited in distinct physical locations on
the membrane (i.e., an array of spots), each of which detection
oligonucleotide is specifically complementary to a distinct target
sequence. Such high-density arrays may be used to interrogate the
sample for genotype signature sequences and the like. These array
components may be read by methods well known in the art, including
by scanning and computer assisted densitometry, the use of CCD
cameras, etc.
[0081] Assay devices of the invention comprising such low and high
density detection zones are termed "dual-density" systems, assays
and devices. The principal design element of such dual-density
devices is the provision of two levels of information obtained from
a single sample. The low density component provides instantaneous
visual information indicative of the presence or absence of a first
level target sequence, and may be used to provide fundamental
diagnostic information, such as the presence of a nucleic acid
sequence indicative of a virus or bacteria in the sample. Because
this information is provided by a colored band or other shape or
symbol, the user is able to identify the presence of a target
immediately and without the use of any instrumentation
whatsoever.
[0082] The high density components may be assayed using standard
instrumentation at any time following the assay. For example, the
device may be stored or shipped for high density array analysis
using appropriate instrumentation and/or expertise. Thus, as an
example, such dual-density devices may be used by a consumer
patient for determining whether a body fluid sample contains an
influenza virus. A positive result indicates the need for having
the high density component of the device analyzed by specialized
personnel, in order to determine the influenza strain, subtype, or
genotype, for example. The consumer patient is able to use the
device to determine the need for profession medical attention. The
medical professional is able to analyze the same device for more
specific diagnostic information.
[0083] LFM Nucleic Acid Assays:
[0084] In one aspect of the invention, an LFM assay is provided.
LFM assays of the invention are useful for the specific detection
of a target analyte, typically from a complex sample of interest,
and generally comprise the steps of extracting analyte material
(i.e., DNA, RNA, protein) from sample of interest, enriching for
the analyte, and detecting the presence of the analyte using an LFM
device populated with target-specific capture elements.
[0085] In one aspect, the invention provides a method of testing
for the presence of a target nucleic acid in a liquid sample,
comprising applying or contacting the liquid sample to the sample
receiving zone a lateral flow chromatographic device of the
invention, allowing the sample to transport by capillary action
through the capture zone, and detecting the presence or absence of
the target nucleic acid by detecting the presence of the label at
the relevant capture zone feature.
[0086] Various DNA and RNA extraction methodologies are routine and
well known in the art. Various kits for the efficient extraction of
total nucleic acid, RNA or DNA are widely available from a number
of commercial entities. Any of these methodologies and kits may be
used to extract nucleic acid from a sample to assessed using the
LFM assay.
[0087] Single-stranded RNA or DNA targets may be amplified
directly, while double-stranded DNA targets generally are rendered
single-stranded before amplification. Methods for rendering
single-stranded DNA templates from a double-stranded DNA targets
include without limitation heat penetration (i.e., 95.degree. C.
for 5 minutes) and chemical denaturation (i.e., sodium hydroxide,
followed by neutralization). Another method for rendering
amplifiable single-stranded DNA from double-stranded DNA involves
enzymatic unwinding of the double-stranded DNA, using for example a
DNA helicase, which can open-up portions of the DNA, permitting
primer and polymerase access and binding (see Kornberg and Baker,
1992, DNA Replication, 2nd edn, New York: WH Freeman and Company;
Caruthers and McKay, 2002, Helicase structure and mechanism. Curr
Opin Struct Biol 12: 123-133).
[0088] As used herein, a "target sequence" is a nucleotide sequence
within a target nucleic acid molecule which is to be amplified.
Within the target sequence is a primer binding portion, to which
primers are designed to hybridize in order to initiate DNA
polymerization.
[0089] The selection of a particular target sequence for
amplification will relate to the LFM assay objectives. For example,
where amplification is aimed at identifying a particular strain of
an organism, the target sequence should be one of the unique
genetic signatures which differentiates that strain from others to
which it may be related. In some cases, this may be a single
defining sequence. In other cases, a combination of target
sequences may be required to reliably identify and differentiate
the organism. The selection of target sequences which impart
specificity to assays utilizing amplified genetic material involves
considerations well known in the art, including for example, unique
pathogen-specific sequences, toxins genes, virulence factors or
specific signature sequence combinations.
[0090] In the practice of the invention, single or multiple target
sequences may be amplified in a single reaction using suitable,
specific primer oligonucleotides. When multiple target sequences
are to be amplified, primers must be designed to avoid possible
nonspecific interactions as is well known.
[0091] Extracted nucleic acids may be purified prior to
amplification. A number of column type DNA and RNA purification
devices are commercially available and may be employed for this
purpose. Various other techniques for purifying DNA and RNA may be
employed, including without limitation, electrophoresis, gradient
separation, affinity purification, etc.
[0092] LFM assays are useful for the detection of single stranded
amplification products derived from samples of interest (i.e.,
clinical samples, environmental specimens, etc.). LFM is compatible
for use with virtually any nucleic acid amplification method. In
the context of the rapid, simplified and highly sensitive LFM
assays of the invention, LFMs are particularly intended for use
with isothermal amplification technologies. In one embodiment,
extensively characterized herein by way of the several Examples
which follow, the isothermal amplification NASBA is utilized.
NASBA-amplified target nucleic acids are detected at very high
specificity in a matter of seconds.
[0093] NASBA is an RNA amplification methodology that offers
several advantages over other RNA amplification methods, including
the absence of a reverse transcriptase step. NASBA is an isothermal
reaction performed at 41.degree. C., which obviates the need for a
thermocycler and may facilitate the production of point-of-test
devices. A single-stranded antisense RNA product is produced during
NASBA, which can be directly hybridized by a probe sequence to
accelerate post-amplification interrogation of the product.
Additionally, selection criteria for NASBA primers are less
stringent than with other amplification methods, allowing easier
primer design in selected less-conserved regions of the gene.
Furthermore, the amplification power of NASBA has been reported to
be comparable to, or sometimes even higher than that of PCR.
[0094] In this connection, the invention provides a method for
detecting the presence of a target nucleic acid in a biological
sample, comprising: (a) providing a biological sample suspected of
containing the target nucleic acid sequence; (b) releasing nucleic
acid from the biological sample; (c) amplifying the target nucleic
acid using nucleic acid sequence based amplification (NASBA) to
generate a solution containing amplified single-stranded RNA
complementary to the target nucleic acid, if present in the
extracted DNA and/or RNA from the biological sample; and, (d)
assaying for the presence of the complementary RNA target nucleic
acid using the method according to claim 27.
[0095] In the LFM assay progression, initially, and typically
following extraction and amplification of target nucleic acid, a
solution containing one or more target sequences to be detected by
the device is introduced to the sample pad. This may be achieved by
dipping the lateral flow device sample pad/sample receiving zone
into the solution, or by dropping a quantity of the solution onto
the sample pad/sample receiving zone of the lateral flow device.
The device is sufficiently robust that the composition of the
buffer solution carrying the target sequence(s) is not critical,
however, several practical considerations are taken into account to
assure compatibility of the buffer with the device. Most
significantly, the ionic strength of the sample buffer must be such
that precipitation or aggregation of the detection particles does
not occur. Similarly, sufficient ionic strength of the buffer is
required to support hybridization during lateral flow. Impregnation
of the sample pad and/or conjugate release pad with Triton-X100,
SDS, BSA, ficol, and/or polyvinyl pyrolidone, or introduction of
these components to the sample buffer itself, can stabilize the
detection particles and block non-specific interactions between the
detection particles and the detection membrane. While a range of
concentrations of these reagents can be used successfully, buffers
of proven efficacy include 0.1% ficol, 0.1% BSA, 1% Triton X-100,
and 150 mM NaCl. This particular buffer supports mono-disperse
detection particle suspensions.
[0096] Additionally, buffers containing higher concentrations of
Triton X-100 and SDS have been found to support higher ionic
strength environments without detection particle aggregation and
may be used to facilitate hybridization. For example, 3% Triton
X-100, 0.1% SDS, 600 mM NaCl has been shown to support subnanomolar
hybridization-based detection on the device.
[0097] Optimized buffer, reagent parameters and coupling protocols
for LFM devices utilizing nitrocellulose detection membranes are
presented in Example 5.
[0098] Once on the sample pad/sample receiving zone, the analyte
solution flows from the proximal (sample) end towards the distal
(detection) end of the device. In one embodiment, detection
oligonucleotide-functionalized dyed microbeads are embedded into
the conjugate release pad component of the device, preferably in
lyophilized form, ready to be re-hydrated as the analyte solution
travels into this area of the device. As the analyte solution moves
across the conjugate release pad, the microbeads are rehydrated and
are available for detection oligonucleotide hybridization to target
sequences within the sample. Target sequences, when present, will
become hybridized to the detection oligonucleotide and thus to the
beads. This complex continues lateral flow migration to the
detection membrane, where immobilized capture oligonucleotides
hybridize to the target sequence, thus capturing the target
sequence-bead complex.
[0099] The invention also provides lateral flow chromatographic
microarray devices. In one aspect, for example, the invention
provides a lateral flow microarray chromatographic device for
detecting the presence or absence of a plurality of single-stranded
target nucleic acids in one or more fluid samples, comprising a
lateral flow matrix which defines a flow path and which comprises
in series: (a) a sample receiving zone for receiving the fluid
sample(s); (b) a labeling zone in lateral flow contact with said
sample receiving zone, wherein the labeling zone comprises a porous
material containing a plurality of different detection
oligonucleotides reversibly bound thereto, which detection
oligonucleotides are complementary to first sequences of a
plurality of respective target nucleic acids and are coupled to
detectable labels; and, (c) a capture zone in lateral flow contact
with said labeling zone, said capture zone comprising a microporous
membrane, at least a portion of which contains a plurality of
different capture oligonucleotides immobilized thereto, which
capture oligonucleotides are complementary to second sequences of a
plurality of respective target nucleic acids, and wherein the
different capture oligonucleotides are immobilized to the
microporous membrane at a feature size of 300 .mu.m or less in
diameter.
[0100] Another aspect is drawn to lateral flow chromatographic
microarray devices which eliminate the labeling zone. For example,
the invention provides A lateral flow microarray chromatographic
device for detecting the presence or absence of a plurality of
target nucleic acids in one or more fluid samples, comprising a
lateral flow matrix which defines a flow path and which comprises
in series: (a) a sample receiving zone for receiving the fluid
sample(s) and for receiving a plurality of different detection
oligonucleotides, each of which detection oligonucleotides
comprises a sequence which is complementary to a first sequence of
a specific target nucleic acid and is labeled; and, (b) a capture
zone in lateral flow contact with said labeling zone, said capture
zone comprising a microporous membrane, at least a portion of which
contains a plurality of different capture oligonucleotides
immobilized thereto, each of which capture oligonucleotides
comprises a sequence which is complementary to second sequence of
the specific target nucleic acid, and wherein the different capture
oligonucleotides are immobilized to the microporous membrane at a
feature size of 300 .mu.m or less in diameter.
[0101] Kits are also provided. In aspects in which the labeling
zone is eliminated, thereby requiring the addition of a labeled
detection oligonucleotide, the invention provides a kit for testing
the presence of a target nucleic acid in a sample, comprising: (a)
a lateral flow chromatographic device or lateral flow
chromatographic microarray device of the invention, and (b) a
labeled detection oligonucleotide complementary to a second
sequence in the target nucleic acid.
[0102] LFM, LFM assays and LFM devices of the invention are further
described by way of the following examples, none of which are
intended to be limiting.
EXAMPLES
Example 1
Detection of DNA Hybridization Over Broad Range of Capture
Oligonucleotide Deposition Concentrations on DNA Dipstick
[0103] DNA dipstick microarrays were fabricated at a density of 36
features per mm.sup.2 using varying concentrations of capture
oligonucleotide, as indicated In FIG. 1. Printing solutions of
capture oligonucleotide at 200 .mu.M, 100 .mu.M, 50 .mu.M, 25
.mu.M, 12.5 .mu.M, 6.25 .mu.M, and 3.125 .mu.M were prepared and
patterned on to lateral flow membranes. The resulting DNA dipstick
microarrays were introduced to 100 .mu.l of synthetic target DNA at
the indicated concentration of 1 .mu.M, 100 nM, 10 nM, 1 nM, and 0
nM corresponding to 100 pmol, 10 pmol, 1 pmol, 100 fmol, and 0 fmol
target molecules respectively. Capture of 100 fmol target molecule
was apparent at capture oligonucleotide printing concentrations as
low as 12.5 .mu.M (FIG. 1). However, the most sensitive detection
was obtained at higher capture oligonucleotide printing
concentrations of 200 .mu.M. Subsequent DNA dipsticks and DNA
dipstick microarrays were fabricated using 200 .mu.M solutions of
capture oligonucleotide. These data demonstrate that DNA dipstick
microarrays provide robust hybridization based detection over an
order of magnitude range of capture oligonucleotide deposition
concentrations. This further suggests that fabrication of DNA
dipstick microarrays will be relatively insensitive to variations
in capture oligonucleotide concentration resulting from varying
synthesis efficiencies.
Example 2
Detection of Single and Multiple SS-DNA Species
[0104] The following example demonstrates sensitive detection of
single-stranded DNAs using hybridization-based capture and
dyed-microsphere colorimetric detection.
[0105] Sequences derived from the B. anthracis pagA, capB and cya
genes were used to demonstrate multiplexed detection. DNA Dipsticks
were patterned with capture sequences for the detection of
fragments of three key virulence factors of B. anthracis.
[0106] The capture sequences used were:
TABLE-US-00001 pagD: [SEQ ID NO: 7]
5'-GCAGGATTTAGTAATTCGAATTTTTTTTTTTTTTT-3'; cyaD908: [SEQ ID NO: 8]
5' TGGTACTAAACCTGAAGCTTTTTTTTTTTTTTTTT 3'; and capD: [SEQ ID NO: 9]
5'-TACATGGTCTTCCCAGATAATTTTTTTTTTTTTTT-3'. 0.35 .mu.m dyed COOH
microspheres (Spherotech, Inc.) were coupled using EDAC and
standard protocols to: for capB detection [SEQ ID NO: 10] 5'
amine-C12-TTTTTTTTTTTTTTTTTTCAGAAGAATTCTTACGAAA ATTTGAT 3', for
pagA detection [SEQ ID NO: 11] 5'
amine-C12-TTTTTTTTTTTTTTTTTCTTTGATATTGGTGGGAGTG TATC; and for cya
detection [SEQ ID NO: 12] 5'
amine-C12-TTTTTTTTTTTTTTTTTAAAAGCATCTGCATGTTC.
[0107] Populations of beads coupled independently to these
detection sequences were pooled for use as colorimetric labels in
hybridization-based lateral flow detection assays. The results are
shown in FIG. 2, and described in the description of FIG. 2. These
data demonstrate rapid, specific and sensitive multiplexed
hybridization-based detection in a lateral flow device.
Example 3
Sensitivity and Detection Time for DNA Dipstick and DNA Dipstick
Microarray
[0108] The sensitivity and time required to detect nucleic acids on
DNA dipsticks and DNA dipstick microarrays were evaluated using
synthetic target molecules for which exact concentrations could be
determined.
[0109] Dipsticks were fabricated by manual deposition of capture
oligonucleotides onto membrane strips of approximately 160 to 275
mm.sup.2 surface area, features sizes were .about.2-3 mm in
diameter. Dipstick microarrays were printed using microarray
fabrication robotics to pattern membrane strips of approximately 60
mm.sup.2 surface area such that feature sizes were 300-600 .mu.m in
diameter. DNA dipsticks were challenged with 400 .mu.l of synthetic
target molecule in the presence of appropriate detection
microspheres. Typical lateral flow time for these strips was
approximately 45 minutes from sample introduction to complete
transport of the sample through the dipstick matrix. Dilution
series experiments revealed the sensitivity of detection to be 25
fmol (i.e. 400 .mu.l of 62.5 pM target) (see FIG. 3).
[0110] To determine the effect of strip surface area and feature
diameter on the speed and sensitivity of detection, lateral flow
microarray strips were introduced to 10 .mu.l of sample solution
containing 20 nM, 2 nM and 0 mM target concentration (FIG. 4).
Specific detection of the target was obtained within 1 minute. The
sensitivity was found to be 20 fmol of target (i.e. detection of 2
nM target in 10 .mu.l sample volume). The reduced surface area and
sample volume result in more rapid detection than observed with
dipsticks of more tradition size. Moreover, the sensitivity of the
dipstick microarray was similar to that of the larger dipstick in
terms of fmol detected. Thus, the DNA dipstick microarrays offer a
more rapid detection platform with similar detection thresholds to
those of larger strips while offering the increased information
capacity inherent to high density microarray technology.
Example 4
Construction of Exemplary LFM Device
[0111] Materials and Methods:
[0112] LFM Fabrication: Lateral flow microarrays (LFMs) were
printed using a NanoPlotter 2.0 (GeSim, mbH, Dresden, Germany)
non-contact picoliter deposition system equipped with NanoTips
(GeSim). Unless otherwise indicated, LFMs were patterned with 400
.mu.M solutions of oligonucleotide in H.sub.2O containing a 1:50
dilution of Ponceau S (P7767, Sigma) as a tracking dye. A lateral
flow compatible nitrocellulose membrane (HiFlow 135, Millipore) was
used as the LFM substrate. Following oligonucleotide deposition,
nitrocellulose membranes were air dried and exposed to 5000 .mu.J
UV in a StrataLinker (Stratagene). The resulting membrane sheets
were cut into 3 mm wide, 30 mm long strips which were either used
directly with buffer suspended dyed microspheres or assembled with
conjugate release pads into a custom plastic housing. Housings were
fabricated from polycarbonate sheet cut using a CO.sub.2 laser
(VersaLaser VL-300, Universal Laser Systems, Inc., Scottsdale,
Ariz., USA). Conjugate release pads were made by impregnating glass
fibre conjugate pad (GFCP203000, Millipore) with dyed microspheres
covalently conjugated to R-57-76-3TN (see below) in 1% SDS.
Microsphere saturated release pads were allowed to air dry under
ambient conditions prior to assembly with LFM membranes.
[0113] Capture and Detection Oligonucleotides: Table 1 provides
capture and detection oligonucleotide sequences, their binding
sites within the plcR amplicon are depicted in FIG. 5B. Amine
modification and a T.sub.18 spacer sequence were included on the 3'
end of detection oligonucleotide R-57-76-3TN to allow covalent
cross-linking to dyed microspheres and to facilitate hybridization
in lateral flow sandwich assays respectively.
[0114] Conjugation of Detection Oligonucleotides to Dyed
Microspheres: SPHERO.TM. carboxyl-polystyrene 0.35 .mu.m blue
microspheres (Spherotech) were covalently conjugated to amino
modified oligonucleotide R-57-76-3TN using the coupling agent
1-etyl-3-(3-dimethylaminopropyl-diimide HCl (EDAC, Pierce) under
conditions adapted from Spiro et al (32). Briefly,
4.times.10.sup.10 microspheres were suspended in 100 mM
2-(N-morpholino)ethanesulfonic acid pH 4.5 (MES, Sigma). Indicated
amounts of oligonucleotide were introduced to MES suspended
microspheres, vortexed and incubated in the presence of 0.5 mg/ml
EDAC. Reactions were protected from light in aluminum foil wrapped
tubes and incubated at room temperature for 30 min followed by the
introduction of additional EDAC to bring the final EDAC
concentration to 1 mg/ml. Incubation was continued for an
additional 30 min after which beads were washed once with 1 ml
0.02% tween-20 (Sigma) and twice with 0.5 ml 0.1% SDS (Fisher
Scientific). Beads were resuspended in 0.5 ml DNAase/RNAase free
H2O. Bead suspensions were assessed for aggregation by
phase-contrast light microscopy using a Zeiss IM135 inverted
microscope.
[0115] Results:
[0116] Oligonucleotides for hybridization sandwich assays were
designed to detect NASBA amplified B. anthracis plcR mRNA or
synthetic targets based on relevant subregions of the plcR
sequence. Oligonucleotides immobilized on the lateral flow
substrate are referred to here as capture oligonucleotides while
those conjugated to dyed microspheres for signal generation are
referred to as detection oligonucleotides. Supported large pore
nitrocellulose membranes were patterned with varying concentrations
of capture oligonucleotides using a NanoPlotter.TM. 2.0 robotic
positioning system (GeSiM, Gro.beta.erkmannsdorf, Germany) and
NanoTip piezoelectronically actuated micropipets (GeSiM).
Oligonucleotide dnaR89 was printed on LFM substrates as a positive
hybridization control as this oligonucleotide carries sequence
complementary to bead coupled detection oligonucleotide
R-57-76-3TN. Negative hybridization controls included V24-43 (the
reverse complement of capture oligonucleotide R-24-43) and an
unrelated sequence complementary to a region of the F. tularensis
sdhA locus (FT-S18) (Pardington et al., submitted). By ejecting
droplets from the micropipet at a distance of 500 .mu.m from the
nitrocellulose substrate, microarray feature sizes of approximately
200 .mu.m could be generated. In contrast to contact microarray
printing methods, this approach preserves the fragile pore
structure of the membrane required for microsphere-based detection.
Patterned nitrocellulose sheets were cut into 3 mm wide strips and
then assembled with conjugate release pads in a custom designed
plastic housing. An example of the resulting device is shown in
FIG. 6A. Hybridization-mediated capture of analyte at the cognate
capture element of the microarray and non-overlapping hybridization
to dyed microsphere conjugated detection oligonucleotide generates
a colorimetric signal arising from an increased local concentration
of dyed microsphere particles. A schematic representation of the
hybridization sandwich assay scheme is depicted in FIG. 6B.
Example 5
LFM Sandwich Hybridization Parameter Optimization
[0117] Materials and Methods:
[0118] LFM Fabrication: LFMs were fabricated as described in
Example 4, infra.
[0119] Detection and Capture Oligonucleotides: Detection and
capture oligonucleotides were designed as indicated in Example 4,
infra. Conjugation of detection oligonucleotides to dyed,
polystyrene microspheres was as described in Example 4.
[0120] Target Nucleic Acids: A DNA oligonucleotide, dnaR89,
composed of sequence derived from a region of the plcR gene of B.
anthracis, as shown in FIG. 5B, was used to provide a readily
available and quantifiable target for LFM assay development and
optimization. The sequence of this synthetic target is provided in
Table 1. Additionally, a full-length synthetic target RNA was
generated by PCR followed by in vitro transcription. This RNA,
referred to here as plcRivt, was used to confirm that reaction
conditions established with dnaR89 were also suitable for the
detection of NASBA reaction products. Synthesis of plcRivt was
accomplished by using plc-P1 and plc-P2 primers in PCR reactions
containing 20 ng of B. anthracis Stern strain 7702 genomic DNA. PCR
reactions using Platinum PCR Supermix (Invitrogen) were conducted
for 40 cycles of 94.degree. C. for 30 s, 60.degree. C. for 30 s and
72.degree. C. for 1 min following an initial 2 min incubation at
94.degree. C. The resulting amplicon was subjected to purification
using QIAquick PCR clean-up spin-columns (QIAGEN) and subsequently
used to program an in vitro transcription reaction using the T7
AmpliScribe kit (EpiCentre). The in vitro transcription reaction
product was subjected to treatment with RNase free DNase I (Ambion)
and purified using a RNeasy column (QIAGEN). The resulting RNA was
quantified by measuring the OD.sub.260. plcRivt is predicted to be
identical in sequence to the NASBA product generated from B.
anthracis total cellular RNA using plc-P1 and plc-P2.
[0121] Detection Protocol: Following completion of sample flow, LFM
membranes were allowed to air dry prior to scanning with a standard
flatbed PC scanner (CanoScan 9950F, Canon, Inc.). Scans were
performed at 2400 dpi resolution using 48 bit color. The resulting
image files were converted to grayscale, inverted and saved as
16-bit TIFF files using Photoshop CS2 (Adobe). Image files were
then analyzed using GenePix Pro 6.0 (Molecular Devices) to quantify
microarray spot intensities for NASBA product detection and for
dnaR89 dilution series experiments.
[0122] Results:
[0123] LFMs were fabricated using varying concentrations of capture
oligonucleotide to determine optimum printing concentrations.
Following lateral flow of 25 fmol dnaR89 in 4.times.SSC, 5%
formamide, 1.4% Triton X-100, 0.1% SDS containing 0.5% R-57-76-3TN
coupled microspheres LFMs were scanned on a flatbed scanner and the
resulting images quantified. For all capture sequences examined,
400 .mu.M oligonucleotide printing concentrations provided the most
favorable signal intensity (FIG. 7A). Standard hybridization
conditions employed for these and other characterization studies
were determined through an iterative set of optimization
experiments that examined the effects of ionic strength, formamide
concentration and detection oligonucleotide to bead cross-linking
ratios.
[0124] LFM Running Buffer Optimization:
[0125] Lateral flow running buffer was based on the widely used
standard sodium citrate buffer (SSC) supplemented with 1.4% Triton
X-100 and 0.1% SDS to reduce microsphere aggregation and 5%
formamide to increase hybridization stringency and destabilize
target secondary structure. Given the profound impact ionic
strength has on the stringency of DNA hybridization (33,34), SSC
concentration was varied from 1.times. to 9.times. and assay
performance evaluated by densitometry of lateral flow microarrays
following hybridization sandwich assays conducted using 25 fmol of
the synthetic target dnaR89 or approximately 200 fmol of plcRivt.
FIG. 7B summarizes the results of SSC concentration optimization
experiments. Near optimal signal intensity was obtained for both
dnaR89 and plcRivt at SSC concentrations between 2.times. and
7.times.. 4.times.SSC was selected for use in standard LFM running
buffer as it provided sensitive hybridization-based detection of
plcR derived sequences and good capillary lateral flow
characteristics.
[0126] To determine the optimum concentration of formamide in LFM
running buffer, a series of LFM experiments were conducted at
varying formamide concentrations using both dnaR89 and plcRivt. 10
.mu.l of 4.times.SSC, 1.4% Triton X-100 and 0.1% SDS containing 25
fmol dnaR89 or approximately 200 fmol plcRivt and varying
concentrations of formamide, as indicated in FIG. 7C, were
subjected to LFM analysis and the resulting hybridization signals
quantified by densitometry. These experiments revealed a slight but
reproducible increase in signal intensity at 5% formamide. All
subsequent studies presented here were performed using 4.times.SSC,
1.4% Triton X-100, 0.1% SDS, and 5% formamide.
[0127] Optimization of Oligonucleotide-Detection Microsphere
Coupling:
[0128] Given that higher stock concentrations of synthetic
oligonucleotide dnaR89 could be obtained which allowed high
confidence quantification of this synthetic target relative to what
could be achieved with comparatively dilute solutions of the in
vitro transcription product plcRivt, subsequent LFM
characterization studies made use of dnaR89. The similarity of
buffer optima displayed dnaR89 and plcRivt synthetic targets
supported the assertion that dnaR89 could be used as an accurate
proxy for the performance of LFM assays for NASBA product
detection. Others have reported similar findings concluding that
appropriately designed DNA oligonucleotides can be used as
synthetic targets for the development of assays ultimately used for
NASBA product detection (35). Therefore, subsequent LFM assay
optimization and characterization was conducted using dnaR89.
[0129] To determine the optimum ratios for cross-linking detection
oligonucleotides to dyed polystyrene microspheres, we examined
populations of beads coupled to oligonucleotide at varying ratios.
The 3' amine modified detection oligonucleotide R-57-76-3TN was
covalently linked to polystyrene dyed microspheres using EDAC. The
resulting bead/oligonucleotide complexes were evaluated for their
ability to mediate detection of dnaR89 in a hybridization sandwich
assay. Coupling reactions using a 2.2.times.10.sup.4:1
oligonucleotide to bead ratio were found to provide optimum signal
as determined by densitometry (FIG. 7D).
Example 6
Characterization of LFM Assay Detection Sensitivity
[0130] Materials and Methods:
[0131] LMF fabrication, oligonucleotide conjugation protocols,
target nucleic acids and detection protocols were as described in
Examples 4 and 5, supra.
[0132] Variable Detection Oligonucleotides: Detection
oligonucleotide R-57-76-3TN carrying a 3' spacer region consisting
of 18 T residues was compared to detection oligonucleotide
R-57-76-3N, carrying the same analyte complementary sequence as
R-57-76-3TN but without the T.sub.18 spacer, in order to evaluate
whether the poly-T spacer influences accessibility of
microsphere-coupled detection oligonucleotides to their
hybridization targets.
[0133] Variable Capture Oligonucleotides: To determine the relative
performance of hybridization sandwich assays making use of capture
oligonucleotides with complementarity to different locations of the
target sequence, three capture oligonucleotides were synthesized
and compared using sandwich assays employing detection
oligonucleotide R-57-76-3TN coupled dyed microspheres. R-77-96 was
designed to participate in base stacking with R-57-76-3TN when
hybridized to the target. Base stacking has been reported to
stabilize hybridization and allow efficient capture of dilute
nucleic acids by hybridization (38-42). The binding sites for the
three capture oligonucleotides examined (R-77-96, R-36-55, and
R-24-43) are illustrated in FIG. 5B. Varying quantities of
synthetic target dnaR89, between 0 and 200 fmol, were used for
these studies.
[0134] Results:
[0135] Detection oligonucleotide spacer improves hybridization
efficiency: The detection oligonucleotide R-57-76-3TN carried a 3'
spacer region consisting of 18 T residues to increase the
accessibility of bead bound oligonucleotides for hybridization.
R-57-76-3N, which carried the same analyte complementary sequence
as R-57-76-3TN but without the T.sub.18 spacer, was found to
exhibit significantly reduced hybridization to dnaR89 consistent
with prior reports that a poly(dT) spacer sequence increases
hybridization efficiency to solid-phase coupled oligonucleotides
(36,37). T.sub.18 spacers were not incorporated into LFM
immobilized capture oligonucleotides as they were found to be
dispensable for hybridization.
[0136] FIG. 8 depicts LFM membranes following detection of the
indicated amounts of target oligonucleotide dnaR89. Images were
collected using a flatbed scanner at 2400 dpi optical resolution,
48-bit color. LFMs carried dnaR89, which hybridizes directly to the
microsphere conjugated detection probe, as a positive hybridization
control. Positive control features were printed as the left most
element of each LFM row to assist in feature identification.
Negative hybridization controls, F24-43 and FT-S18, were based on
the reverse complement of R-77-96 and an unrelated F. tularensis
derived sequence respectively. Additionally, to confirm that no
carryover contamination occurred during printing, H.sub.2O
containing Ponceau S was printed on LFM substrates between positive
control and capture oligonucleotide deposition. No signal was
detectable in either hybridization negative controls or H.sub.2O
negative control microarray elements.
[0137] Base stacking effect: Background corrected signal intensity
was determined from LFM images using GenePix Pro 6.0 microarray
data extraction software. The results, presented in FIG. 9A, reveal
R77-96 produces significantly higher hybridization signals than
R-36-55 or R-24-43 for all examined quantities of dnaR89,
suggesting a significant contribution of base stacking effects to
LFM hybridization sandwich assay sensitivity.
[0138] LFM Detection Sensitivity: To define the detection limit of
the LFM assay, a one-tailed t-test was used to determine quantities
of dnaR89 that generated signal intensities significantly above 0
amol negative controls. Signals generated at R-77-96 capture
features with 250 amol and greater quantities of dnaR89 were
significantly higher than 0 amol dnaR89 controls (p<0.05, n=6).
By the same criterion, 1 fmol dnaR89 detection limits were obtained
for both R-24-43 and R-36-55 (p<0.05, n=6). FIG. 9B depicts the
performance of LFM detection over the 0 to 2500 amol dnaR89 range
using the R-77-96/R-57-76-3TN capture/detection probes. LFM
detection exhibited excellent linearity, R.sup.2=0.989, over this
10 fold range of target molecules. While capture probe R-24-43
exhibited less sensitivity than R-77-96, this capture probe
displayed excellent signal linearity between 2.5 fmol and 100 fmol
dnaR89, R.sup.2=0.968 (FIG. 9C). These findings demonstrate that
the LFM capacity to display multiple capture sequences can be used
to simultaneously provide sensitive detection and extend assay
linearity through the use of capture probes with differing
hybridization characteristics.
Example 7
LFM Assay Time Course Evaluation
[0139] Materials and Methods:
[0140] LMF fabrication, oligonucleotide conjugation protocols,
target nucleic acids and detection protocols were as described in
Examples 4 and 5, supra.
[0141] For these time course studies, LFM assays were recorded
using a digital video recorder (DCR-PC1, Sony). Video frames were
collected for quantification using iMovie (Apple Computer). Feature
intensity was quantified for time course studies and some
optimization experiments using uncalibrated optical density in
ImageJ (http://rsb.info.nih.gov/ij/). For better reproduction
contrast, LFM images used for figures were cropped and modified by
applying the Auto Contrast function in Photoshop CS2. No other
modifications were applied.
[0142] Results:
[0143] The small sample volumes used for LFM detection and the
reduced surface area traversed during capillary lateral flow
significantly reduces detection times for the LFM relative to
traditional lateral flow devices. To quantitatively present the
speed of
[0144] LFM-mediated nucleic acid detection, we used digital video
to follow hybridization sandwich assay mediated detection of
synthetic target molecule dnaR89. These studies were conducted over
a range of target concentrations using 10 .mu.l of LFM running
buffer containing suspended R-57-76-3TN conjugated dyed
microspheres. Individual frames were isolated from video data sets
and quantified for relative signal intensity over the course of
capillary lateral flow across the LFM substrate. The resulting
signal data was plotted versus time in seconds as shown in FIG. 10.
For time measurements, t.sub.0 was defined as the time when the
sample front reached the first row of LFM features. Signal was
detectable for 1000 fmol target in 2 seconds following sample
transport across R-77-96 capture elements. 100 fmol dnaR89 was
detectable within 4 seconds while 10 fmol was clearly detectable by
30 seconds as defined by the earliest time point at which 90% of
the pixels composing the R-77-96 microarray features were greater
than one standard deviation above background. Lateral flow
transport of the 10 .mu.l sample was complete by 120 seconds.
Example 8
LFM Assay for Detection of Bacillus anthracis
[0145] Materials and Methods:
[0146] LMF fabrication, oligonucleotide conjugation protocols,
target nucleic acids and detection protocols were as described in
Examples 4 and 5, supra. Table 1 provides capture and detection
oligonucleotide sequences; binding sites within the plcR amplicon
are depicted in FIG. 5B. Amine modification and a T.sub.18 spacer
sequence were included on the 3' end of detection oligonucleotide
R-57-76-3TN to allow covalent cross-linking to dyed microspheres
and to facilitate hybridization in lateral flow sandwich assays
respectively.
[0147] RNA Isolation:
[0148] Total RNA was isolated from B. anthracis strain Sterne 7702
and B. thuringiensis strain HD 621 (29) using a previously reported
protocol (30). Purified RNA was quantified by measuring OD.sub.260
and evaluated by gel electrophoresis. 3.times.10.sup.8 cells were
used for RNA isolation typically yielding 50-75 .mu.g of total
RNA.
[0149] Amplification Primer Design
[0150] Nucleic acid sequence based amplification (NASBA, (20))
primers, plc-P1 and plc-P2, were designed to amplify a fragment of
the plcR locus from B. anthracis. Primer sequences used for NASBA
reactions are provided in Table 1, the T7 promoter sequence is
italicized in plc-P1. Plc-P1 hybridizes to the plcR transcript such
that the 3' end of the primer forms a base pair with the previously
reported polymorphism strictly associated with B. anthracis
(27,28). The NASBA P2 primer, plc-P2, is located such that the
amplified RNA resulting from NASBA is 179 bases in length, see FIG.
5A. Previously reported plcR-based B. anthracis real-time PCR
assays (27,28) have made use of an alternate upstream primer that
generates a 83 bp product but may be poorly suited for NASBA given
the optimal NASBA product size of 120-250 bases (31).
[0151] Nucleic Acid Sequence-Based Amplification (NASBA)
[0152] NASBA reactions were prepared according to the
manufacturer's instructions using the NucliSens Basic kit
(Biomerieux) and primers plc-P1 and plc-P2 at 0.4 .mu.M each.
Amounts of total cellular bacterial RNA were varied, as indicated,
between 0 and 2 ng. B. anthracis Sterne 7702 was used as a test
strain and B. thuringiensis strain HD 621 was employed as a
negative control. 1 .mu.g of human total cellular RNA isolated from
HeLa S3 cells (Stratagene) was included in all NASBA reactions to
provide a complex RNA background consistent with the composition of
human diagnostic samples. Following a 60 minute incubation at
41.degree. C., NASBA reaction products were detected by using a
lateral flow microarray (LFM).
[0153] Detection of NASBA reaction products: Detection of NASBA
products was accomplished by introducing a 2 .mu.l aliquot of a 20
.mu.l NASBA reaction into 8 .mu.l of LFM running buffer (final
buffer composition: 4.times.SSC, 0.1% SDS, 1.4% Triton X-100, 5%
deionized formamide, and 0.5% w/v R-57-76-3TN coupled 0.35 .mu.m
dyed microspheres). The final volume of solution applied to LFMs
was 10 .mu.l. Following completion of sample flow, LFM membranes
were allowed to air dry prior to scanning with a standard flatbed
PC scanner (CanoScan 9950F, Canon, Inc.). Scans were performed at
2400 dpi resolution using 48 bit color. The resulting image files
were converted to grayscale, inverted and saved as 16-bit TIFF
files using Photoshop CS2 (Adobe). Image files were then analyzed
using GenePix Pro 6.0 (Molecular Devices) to quantify microarray
spot intensities for NASBA product detection and for dnaR89
dilution series experiments.
[0154] Results:
[0155] Prior reports have described a single nucleotide
polymorphism (SNP) present in B. anthracis but not close
phylogenetic near neighbors including B. cereus and B.
thuringiensis (27,28). This SNP has been used as the basis for a
sensitive and highly discriminatory real-time PCR assay for B.
anthracis (28). To determine the utility of LFM technology for
detecting minority nucleic acids in complex samples, NASBA primers
were designed to amplify the plcR allele of B. anthracis.
[0156] Varying amounts of total cellular RNA isolated from B.
anthracis or 2 ng of B. thuringiensis HD 621 RNA as a negative
control were introduced to 1 .mu.g of total human cellular RNA
isolated from HeLa S3 cells. The resulting mixtures were subjected
to NASBA amplification using plc-P1 and plc-P2 primers. Human RNA
was included in NASBA amplification reactions to approximate the
nucleic acid complexity expected in human diagnostic specimens. 2
.mu.l of NASBA reaction mixture was removed after a 60 minute
incubation at 41.degree. C., mixed with 8 .mu.l of LFM running
buffer and assayed for plcR amplicon by LFM. Dyed microspheres
cross-linked to R-57-76-3TN were used for detection of NASBA
amplicons captured on LFMs carrying R-77-96. Data from these
studies are presented in FIG. 11. Following 60 minutes of NASBA
amplification, as little as 0.5 pg for total cellular B. anthracis
RNA could be detected in a background matrix of 1 .mu.g of human
total RNA. These studies closely approximate the conditions
expected for complex human diagnostic samples and reveal the
capacity of the LFM platform to specifically detect NASBA reaction
products generated from mixed samples where the target sequence is
a minority species. While the number of plcR mRNA copies in a B.
anthracis cell has not been determined, an estimate of LFM assay
sensitivity, in terms of B. anthracis cells, can be calculated
based on total RNA yields. Total RNA yields from vegetative B.
anthracis were in the range of approximately 167-250 fg RNA/cell.
Using this value, an estimate of LFM sensitivity corresponds to the
detection of approximately to 2-3 B. anthracis cells.
Example 9
LFMs Utilizing Semi-Conductor Nanocrystal Detection Particles
Exhibit Exceptional Linear Dynamic Range
[0157] To assess the impact of a fluorescent reporter on the linear
dynamic range of LFM mediated analyte detection, a combined
colorimetric and fluorescent detection scheme was devised. In this
detection scheme, conjugated dyed microspheres as well as
streptavidin conjugated fluorescent semi-conductor nanocrystals
(605 nm emission, Qdots, InVitrogen, Inc.) are used simultaneously
as the reporter particles. For these experiments a detection
oligonucleotide, R-57-76-3TBIO
(5'-AGGTGAGACATAATCATGCATTTTTTTTTU-biotinTTTTU-biotinTTTTU-biotin3')
[SEQ ID O: 13], carrying three biotin-modified nucleotides was
employed in hybridization sandwich assays. Following lateral flow
of 250 amol of synthetic analyte dnaR89 in 10 .mu.l of standard LFM
running buffer, LFM strips were photographed under ambient light
and under illumination with a hand-held UV-LED flashlight (FIG.
12).
[0158] As illustrated in FIG. 12, this detection scheme clearly
allows the simultaneous visualization of hybridization events using
both dyed microsphere-mediated colorimetry and semi-conductor
nanocrystal-mediated fluorescent visualization even in the absence
of optical filters. While excitation and emission filters may
further benefit the sensitivity and signal-to-noise ratio
exhibited, they are clearly not required for visualization of
nanocrystal-based LFM signals.
[0159] To quantify fluorescent nanocrystal LFM signal response
linearity, LFMs were challenged with 1, 5, 10, 50, 100, 500, 1000
fmol of dnaR89. Following lateral flow of these samples, LFM strips
were adhered to a glass microscope slide and scanned using a
standard scanning laser microarray reader (GenePix 4200 Pro, Axon
Instruments). A 488 nm laser was used as the excitation source. The
resulting data, shown in FIG. 13, illustrate remarkable signal
linearity over the 1 fmol to 1000 fmol range of dnaR89
(R.sup.2=0.991).
TABLE-US-00002 TABLE 1 Function Name Sequence Bead Conjugation/
R-57 5'-AGGTGAGACATAATCAT Detection Probe 76-3TN GCA
TTTTTTTTTTTTTTTT TT-NH2-3' [SEQ ID NO: 14] Detection Probe/ R-57-
5'-AGGTGAGACATAATCAT Negative Control 76-3N GCA-NH2-3' [SEQ ID NO:
15] LFM Immobilized R-77-96 5'-TAATAAAGAGTTTGATG Capture Probe
TGA-3' [SEQ ID NO: 16] LFM Immobilized R-36-55 5'-AAGCATTATACTTGGAC
Capture Probe AAT-3' [SEQ ID NO: 17] LFM Immobilized R-24-43
5'-TGGACAATCAATACGAA Capture Probe TAA-3' [SEQ ID NO: 18] Synthetic
target/ dnaR89 5'CAAAGCGCTTATTCGTAT Positive Hyb
TGATTGTCCAAGTATAATGC Control TTTTGCATGATTATGTCTCA
CCTTCACATCAAACTCTTTA TTATCATGTAA-3' [SEQ ID NO: 19] NASBA/In vitro
plcRivt 5'-GGGAGAUUUGCAUGACA transcription AAGCGCUUAUUCGUAUUGAU
product UGUCCAAGUAUAAUGCUUUU GCAUGAUUAUGUCUCACCUU
CACAUCAAACUCUUUAUUAU CAUGUAAUACUUCUAAUUGC UUUAAUAUAUUUUCAUAUAA
CUCAAUACUCUUCUUAAAAU GGCCAUUUUCAGCGUAAAUG UU-3' [SEQ ID NO: 20]
Negative Hyb FT-S18 5'-GCGGTCCCAAAAGGGTC Control
AGTCGTAGCACACCACTTTC A-3' [SEQ ID NO: 21] Negative Hyb F-24-43
5'-TTATTCGTATTGATTGT Control CCA-3' SEQ ID NO: 22] NASBA-P1/Allele
plc-P1 5'-TTCTAATACGACTCACT Discrimination ATAGGGAGATTTGCATGACA
AAGCGCTTA-3' [SEQ ID NO: 23] NASBA-P2 plc-P2 5'-AACATTTACGCTGAAAA
TGGCCA-3' [SEQ ID NO: 24]
CITED LITERATURE
[0160] 1. Huckle, D. (2006) Point-of-care diagnostics: will the
hurdles be overcome this time? Expert Rev Med Devices, 3, 421-426.
[0161] 2. Yang, S. and Rothman, R. E. (2004) PCR-based diagnostics
for infectious diseases: uses, limitations, and future applications
in acute-care settings. Lancet Infect Dis, 4, 337-348. [0162] 3.
Chin, C. D., Linder, V. and Sia, S. K. (2007) Lab-on-a-chip devices
for global health: past studies and future opportunities. Lab Chip,
7, 41-57. [0163] 4. Koch, W. H. (2004) Technology platforms for
pharmacogenomic diagnostic assays. Nat Rev Drug Discov, 3, 749-761.
[0164] 5. Mackay, I. M. (2004) Real-time PCR in the microbiology
laboratory. Clin Microbiol Infect, 10, 190-212. [0165] 6. Cirino,
N. M., Musser, K. A. and Egan, C. (2004) Multiplex diagnostic
platforms for detection of biothreat agents. Expert Rev Mol Diagn,
4, 841-857. [0166] 7. Petrik, J. (2006) Diagnostic applications of
microarrays. Transfus Med, 16, 233-247. [0167] 8. Heller, M. J.
(2002) DNA microarray technology: devices, systems, and
applications. Annu Rev Biomed Eng, 4, 129-153. [0168] 9. Peytavi,
R., Raymond, F. R., Gagne, D., Picard, F. J., Jia, G., Zoval, J.,
Madou, M., Boissinot, K., Boissinot, M., Bissonnette, L. et al.
(2005) Microfluidic device for rapid (<15 min) automated
microarray hybridization. Clin Chem, 51, 1836-1844. [0169] 10. Wei,
C. W., Cheng, J. Y., Huang, C. T., Yen, M. H. and Young, T. H.
(2005) Using a microfluidic device for 1 microl DNA microarray
hybridization in 500 s. Nucleic Acids Res, 33, e78. [0170] 11. Lim,
D. V., Simpson, J. M., Kearns, E. A. and Kramer, M. F. (2005)
Current and developing technologies for monitoring agents of
bioterrorism and biowarfare. Clin Microbiol Rev, 18, 583-607.
[0171] 12. Glynou, K., loannou, P. C., Christopoulos, T. K. and
Syriopoulou, V. (2003) Oligonucleotide-functionalized gold
nanoparticles as probes in a dry-reagent strip biosensor for DNA
analysis by hybridization. Anal Chem, 75, 4155-4160. [0172] 13.
Rule, G. S., Montagna, R. A. and Durst, R. A. (1996) Rapid method
for visual identification of specific DNA sequences based on
DNA-tagged liposomes. Clin Chem, 42, 1206-1209. [0173] 14. Dineva,
M. A., Candotti, D., Fletcher-Brown, F., Allain, J. P. and Lee, H.
(2005) Simultaneous visual detection of multiple viral amplicons by
dipstick assay. J Clin Microbiol, 43, 4015-4021. [0174] 15.
Kozwich, D., Johansen, K. A., Landau, K., Roehl, C. A., Woronoff,
S. and Roehl, P. A. (2000) Development of a novel, rapid integrated
Cryptosporidium parvum detection assay. Appl Environ Microbiol, 66,
2711-2717. [0175] 16. Zuiderwijk, M., Tanke, H. J., Sam Niedbala,
R. and Corstjens, P. L. (2003) An amplification-free
hybridization-based DNA assay to detect Streptococcus pneumoniae
utilizing the up-converting phosphor technology. Clin Biochem, 36,
401-403. [0176] 17. Zijlmans, H. J., Bonnet, J., Burton, J.,
Kardos, K., Vail, T., Niedbala, R. S. and Tanke, H. J. (1999)
Detection of cell and tissue surface antigens using up-converting
phosphors: a new reporter technology. Anal Biochem, 267, 30-36.
[0177] 18. Duck, P., Alvarado-Urbina, G., Burdick, B. and Collier,
B. (1990) Probe amplifier system based on chimeric cycling
oligonucleotides. Biotechniques, 9, 142-148. [0178] 19. Piepenburg,
O., Williams, C. H., Stemple, D. L. and Armes, N. A. (2006) DNA
detection using recombination proteins. PLoS Biol, 4, e204. [0179]
20. Compton, J. (1991) Nucleic acid sequence-based amplification.
Nature, 350, 91-92. [0180] 21. Kievits, T., van Gemen, B., van
Strijp, D., Schukkink, R., Dircks, M., Adriaanse, H., Malek, L.,
Sooknanan, R. and Lens, P. (1991) NASBA isothermal enzymatic in
vitro nucleic acid amplification optimized for the diagnosis of
HIV-1 infection. J Virol Methods, 35, 273-286. [0181] 22. Malek,
L., Sooknanan, R. and Compton, J. (1994) Nucleic acid
sequence-based amplification (NASBA). Methods Mol Biol, 28,
253-260. [0182] 23. Fong, W. K., Modrusan, Z., McNevin, J. P.,
Marostenmaki, J., Zin, B. and Bekkaoui, F. (2000) Rapid solid-phase
immunoassay for detection of methicillin-resistant Staphylococcus
aureus using cycling probe technology. J Clin Microbiol, 38,
2525-2529. [0183] 24. Baeumner, A. J., Schlesinger, N. A., Slutzki,
N. S., Romano, J., Lee, E. M. and Montagna, R. A. (2002) Biosensor
for dengue virus detection: sensitive, rapid, and serotype
specific. Anal Chem, 74, 1442-1448. [0184] 25. Baeumner, A. J.,
Pretz, J. and Fang, S. (2004) A universal nucleic acid sequence
biosensor with nanomolar detection limits. Anal Chem, 76, 888-894.
[0185] 26. Hartley, H. A. and Baeumner, A. J. (2003) Biosensor for
the specific detection of a single viable B. anthracis spore. Anal
Bioanal Chem, 376, 319-327. [0186] 27. Zaytseva, N. V., Montagna,
R. A., Lee, E. M. and Baeumner, A. J. (2004) Multi-analyte
single-membrane biosensor for the serotype-specific detection of
Dengue virus. Anal Bioanal Chem, 380, 46-53. [0187] 28. Edwards, K.
A. and Baeumner, A. J. (2006) Optimization of DNA-tagged
dye-encapsulating liposomes for lateral-flow assays based on
sandwich hybridization. Anal Bioanal Chem, 386, 1335-1343. [0188]
29. Easterday, W. R., Van Ert, M. N., Simonson, T. S., Wagner, D.
M., Kenefic, L. J., Allender, C. J. and Keim, P. (2005) Use of
single nucleotide polymorphisms in the plcR gene for specific
identification of Bacillus anthracis. J Clin Microbiol, 43,
1995-1997. [0189] 30. Easterday, W. R., Van Ert, M. N., Zanecki, S.
and Keim, P. (2005) Specific detection of bacillus anthracis using
a TaqMan mismatch amplification mutation assay. Biotechniques, 38,
731-735. [0190] 31. Hill, K. K., Ticknor, L. O., Okinaka, R. T.,
Asay, M., Blair, H., Bliss, K. A., Laker, M., Pardington, P. E.,
Richardson, A. P., Tonks, M. et al. (2004) Fluorescent amplified
fragment length polymorphism analysis of Bacillus anthracis,
Bacillus cereus, and Bacillus thuringiensis isolates. Appl Environ
Microbiol, 70, 1068-1080. [0191] 32. Pannucci, J., Cai, H.,
Pardington, P. E., Williams, E., Okinaka, R. T., Kuske, C. R. and
Cary, R. B. (2004) Virulence signatures: microarray-based
approaches to discovery and analysis. Biosens Bioelectron, 20,
706-718. [0192] 33. Deiman, B., van Aarle, P. and Sillekens, P.
(2002) Characteristics and applications of nucleic acid
sequence-based amplification (NASBA). Mol Biotechnol, 20, 163-179.
[0193] 34. Spiro, A., Lowe, M. and Brown, D. (2000) A bead-based
method for multiplexed identification and quantitation of DNA
sequences using flow cytometry. Appl Environ Microbiol, 66,
4258-4265. [0194] 35. Albretsen, C., Haukanes, B. I., Aasland, R.
and Kleppe, K. (1988) Optimal conditions for hybridization with
oligonucleotides: a study with myc-oncogene DNA probes. Anal
Biochem, 170, 193-202. [0195] 36. Schildkraut, C. (1965) Dependence
of the melting temperature of DNA on salt concentration.
Biopolymers, 3, 195-208. [0196] 37. Blake, R. D. and Delcourt, S.
G. (1996) Thermodynamic effects of formamide on DNA stability.
Nucleic Acids Res, 24, 2095-2103. [0197] 38. Baeumner, A. J.,
Leonard, B., McElwee, J. and Montagna, R. A. (2004) A rapid
biosensor for viable B. anthracis spores. Anal Bioanal Chem, 380,
15-23. [0198] 39. Guo, Z., Guilfoyle, R. A., Thiel, A. J., Wang, R.
and Smith, L. M. (1994) Direct fluorescence analysis of genetic
polymorphisms by hybridization with oligonucleotide arrays on glass
supports. Nucleic Acids Res, 22, 5456-5465. [0199] 40. Day, P. J.
R., Flora, P. S., Fox, J. E. and Walker, M. R. (1991.)
Immobilization of polynucleotides on magnetic particles: Factors
Influencing hybridization efficiency. Biochem. J., 278, 735-740.
[0200] 41. O'Meara, D., Nilsson, P., Nygren, P. A., Uhlen, M. and
Lundeberg, J. (1998) Capture of single-stranded DNA assisted by
oligonucleotide modules. Anal Biochem, 255, 195-203. [0201] 42.
Lane, M. J., Paner, T., Kashin, I., Faldasz, B. D., Li, B., Gallo,
F. J. and Benight, A. S. (1997) The thermodynamic advantage of DNA
oligonucleotide `stacking hybridization` reactions: energetics of a
DNA nick. Nucleic Acids Res, 25, 611-617. [0202] 43. O'Meara, D.,
Yun, Z., Sonnerborg, A. and Lundeberg, J. (1998) Cooperative
oligonucleotides mediating direct capture of hepatitis C virus RNA
from serum. J Clin Microbiol, 36, 2454-2459. [0203] 44. Kandimalla,
E. R., Manning, A., Lathan, C., Byrn, R. A. and Agrawal, S. (1995)
Design, biochemical, biophysical and biological properties of
cooperative antisense oligonucleotides. Nucleic Acids Res, 23,
3578-3584. [0204] 45. Kieleczawa, J., Dunn, J. J. and Studier, F.
W. (1992) DNA sequencing by primer walking with strings of
contiguous hexamers. Science, 258, 1787-1791. [0205] 46. Cheek, B.
J., Steel, A. B., Torres, M. P., Yu, Y. Y. and Yang, H. (2001)
Chemiluminescence detection for hybridization assays on the
flow-thru chip, a three-dimensional microchannel biochip. Anal
Chem, 73, 5777-5783. [0206] 47. Roper, M. G., Easley, C. J. and
Landers, J. P. (2005) Advances in polymerase chain reaction on
microfluidic chips. Anal Chem, 77, 3887-3893. [0207] 48. Saiki, R.
K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn,
G. T., Mullis, K. B. and Erlich, H. A. (1988) Primer-directed
enzymatic amplification of DNA with a thermostable DNA polymerase.
Science, 239, 487-491.
[0208] All publications, patents, and patent applications cited in
this specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference.
[0209] The present invention is not to be limited in scope by the
embodiments disclosed herein, which are intended as single
illustrations of individual aspects of the invention, and any which
are functionally equivalent are within the scope of the invention.
Various modifications to the models and methods of the invention,
in addition to those described herein, will become apparent to
those skilled in the art from the foregoing description and
teachings, and are similarly intended to fall within the scope of
the invention. Such modifications or other embodiments can be
practiced without departing from the true scope and spirit of the
invention.
Sequence CWU 1
1
25140DNAArtificialsynthetic oligonucleotide 1aagcttcagg tttagtacca
gaacatgcag atgcttttaa 40241DNAArtificialsynthetic oligonucleotide
2ttatctggga agaccatgta atcaaatttt cgtaagaatt c
41340DNAArtificialsynthetic oligonucleotide 3ttcgaattac taaatcctgc
agatacactc ccaccaatat 40433RNAB.
anthracismisc_feature(1)..(33)partial plcR mRNA sequence from
GenBank accession number AY265698 4aacauuuacg cugaaaaugg ccauuuuuaa
gaa 33529RNAB. anthracismisc_feature(1)..(29)partial plcR mRNA
sequence from GenBank accession number AY265698 5caauacgaau
aagcgcuuug ucaugcaaa 29689RNAB.
anthracismisc_feature(1)..(89)partial plcR mRNA sequence from
GenBank accession number AY265698 in the region represented by
synthetic target dna R89 6caaagcgcuu auucguauug auuguccaag
uauaaugcuu uugcaugauu augucucacc 60uucacaucaa acucuuuauu aucauguaa
89740DNAArtificialsynthetic oligonucleotide 7aggtgagaca taatcatgca
tttttttttu ttttuttttu 40835DNAArtificialsynthetic oligonucleotide
8gcaggattta gtaattcgaa tttttttttt ttttt 35935DNAArtificialsynthetic
oligonucleotide 9tggtactaaa cctgaagctt tttttttttt ttttt
351035DNAArtificialsynthetic oligonucleotide 10tacatggtct
tcccagataa tttttttttt ttttt 351144DNAArtificialsynthetic
oligonucleotide 11tttttttttt ttttttttca gaagaattct tacgaaaatt tgat
441241DNAArtificialsynthetic oligonucleotide 12tttttttttt
tttttttctt tgatattggt gggagtgtat c 411335DNAArtificialsynthetic
oligonucleotide 13tttttttttt tttttttaaa agcatctgca tgttc
351440DNAArtificialsynthetic oligonucleotide 14aggtgagaca
taatcatgca tttttttttu ttttuttttu 401538DNAArtificialsynthetic
oligonucleotide 15aggtgagaca taatcatgca tttttttttt tttttttt
381620DNAArtificialsynthetic oligonucleotide 16aggtgagaca
taatcatgca 201720DNAArtificialsynthetic oligonucleotide
17taataaagag tttgatgtga 201820DNAArtificialsynthetic
oligonucleotide 18aagcattata cttggacaat
201920DNAArtificialsynthetic oligonucleotide 19tggacaatca
atacgaataa 202089DNAArtificialsynthetic oligonucleotide
20caaagcgctt attcgtattg attgtccaag tataatgctt ttgcatgatt atgtctcacc
60ttcacatcaa actctttatt atcatgtaa 8921179RNAArtificialpredicted in
vitro transcription product 21gggagauuug caugacaaag cgcuuauucg
uauugauugu ccaaguauaa ugcuuuugca 60ugauuauguc ucaccuucac aucaaacucu
uuauuaucau guaauacuuc uaauugcuuu 120aauauauuuu cauauaacuc
aauacucuuc uuaaaauggc cauuuucagc guaaauguu
1792238DNAArtificialsynthetic oligonucleotide 22gcggtcccaa
aagggtcagt cgtagcacac cactttca 382320DNAArtificial
Sequencesynthetic oligonucleotide 23ttattcgtat tgattgtcca
202446DNAArtificialsynthetic oligonucleotide 24ttctaatacg
actcactata gggagatttg catgacaaag cgctta
462523DNAArtificialsynthetic oligonucleotide 25aacatttacg
ctgaaaatgg cca 23
* * * * *
References