U.S. patent application number 15/095382 was filed with the patent office on 2016-07-28 for methods for diagnosing prostate cancer using micrornas.
This patent application is currently assigned to The Ohio State University. The applicant listed for this patent is The Ohio State University. Invention is credited to George A. Calin, Carlo M. Croce, Stefano Volinia.
Application Number | 20160215352 15/095382 |
Document ID | / |
Family ID | 38256892 |
Filed Date | 2016-07-28 |
United States Patent
Application |
20160215352 |
Kind Code |
A1 |
Croce; Carlo M. ; et
al. |
July 28, 2016 |
Methods for Diagnosing Prostate Cancer Using MicroRNAs
Abstract
Described herein are methods for treating prostate cancer using
microRNAs. Also described are methods and compositions for the
diagnosis and treatment of solid cancers. Methods of identifying
inhibitors of tumorigenesis are also provided.
Inventors: |
Croce; Carlo M.; (Columbus,
OH) ; Calin; George A.; (Pearland, TX) ;
Volinia; Stefano; (Ferrara, IT) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Ohio State University |
Columbus |
OH |
US |
|
|
Assignee: |
The Ohio State University
Columbus
OH
|
Family ID: |
38256892 |
Appl. No.: |
15/095382 |
Filed: |
April 11, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14032450 |
Sep 20, 2013 |
|
|
|
15095382 |
|
|
|
|
13406630 |
Feb 28, 2012 |
8557520 |
|
|
14032450 |
|
|
|
|
12160061 |
Jul 3, 2008 |
8148069 |
|
|
PCT/US2007/000159 |
Jan 3, 2007 |
|
|
|
13406630 |
|
|
|
|
60756585 |
Jan 5, 2006 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2320/30 20130101;
C12N 15/113 20130101; C12N 2310/141 20130101; A61K 31/7105
20130101; A61P 35/00 20180101; C12N 2320/12 20130101; C12Q 1/6886
20130101; C12Q 1/6837 20130101; C12N 15/111 20130101; C12N 2320/11
20130101; C12Q 2600/158 20130101; C12N 2330/10 20130101; C12N
2310/113 20130101; C12N 2310/14 20130101; C12Q 2600/178
20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12N 15/113 20060101 C12N015/113 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] This invention made with government support under
P01CA76259, P01CA81534, and P30CA56036, awarded by the National
Institute of Health. The Government has certain rights in this
invention.
Claims
1. A method of inhibiting tumorigenesis in a subject who has
prostate cancer, comprising: a. determining the amount of at least
one miR gene product in cancer cells from the subject, relative to
control; and b. altering the amount of miR gene product in the
cancer cells by: (i) administering to the subject an effective
amount of at least one isolated or synthetic miRNA gene product, or
an isolated variant or biologically-active fragment thereof,
wherein the miRNA gene product is selected from the group
consisting of: miR-128a prec; let-7a-2 prec; miR-218-2; miR-29a
prec; miR-149; and miR-24-1; or (ii) administering to the subject
an effective amount of at least one compound for inhibiting
expression of the at least one anti-miR gene product, wherein the
anti-miRNA gene product is selected from the group consisting of:
let-7d; miR-195; miR-203; miR-34a; miR-20a; miR-29a; miR-25;
miR-95; miR-197; miR-135-2; miR-187; miR-196-1; miR-148; miR-191;
miR-21; let-7i; miR-198; miR-199a-2; miR-30c; miR-17-5p; miR-92-2;
miR-146; miR-181b-1; miR-196-1; miR-93-1; miR-223; miR-16-1;
miR-101-1 prec; miR-124a-1; miR-26a-1; miR-214; miR-27a; miR-106a;
and miR-199a-1; c. such that tumorigenesis is inhibited in the
subject.
2. The method of claim 1, further comprising communicating the
diagnosis to at least one person.
3. The method of claim 2, further comprising communicating the
diagnosis to at least one person.
4. A pharmaceutical composition for treating a prostate cancer,
comprising at least one isolated miR gene product, or an isolated
variant or biologically-active fragment thereof, and a
pharmaceutically-acceptable carrier; wherein the miRNA gene product
is selected from the group consisting of : miR-128a prec; let-7a-2
prec; miR-218-2; miR-29a prec; miR-149; and miR-24-1.
5. A pharmaceutical composition for treating a solid cancer,
comprising at least one miR expression-inhibition compound and a
pharmaceutically-acceptable carrier; wherein the anti-miRNA gene
product is selected from the group consisting of: let-7d; miR-195;
miR-203; miR-34a; miR-20a; miR-29a; miR-25; miR-95; miR-197;
miR-135-2; miR-187; miR-196-1; miR-148; miR-191; miR-21; let-7i;
miR-198; miR-199a-2; miR-30c; miR-17-5p; miR-92-2; miR-146;
miR-181b-1; miR-196-1; miR-93-1; miR-223; miR-16-1; miR-101-1 prec;
miR-124a-1; miR-26a-1; miR-214; miR-27a; miR-106a; and miR-199a-1.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is filed under 35 U.S.C. .sctn.121 as a
continuation application claiming the benefit under 35 U.S.C.
.sctn.120 of U.S. application Ser. No. 14/032,450 filed on Sep. 20,
2013, still pending; which is a divisional application of U.S.
application Ser. No. 13/406,630 filed on Feb. 28, 2012, now U.S.
Pat. No. 8,557,520, issued Oct. 15, 2013; which is a divisional
application of U.S. application Ser. No. 12/160,061 filed July 3,
2008, now U.S. Pat. No. 8,148,069, issued on Apr. 3, 2012; which is
the national stage entry of International Application
PCT/US2007/000159 filed under the authority of the Patent
Cooperation Treaty on Jan. 3, 2007, published; which claims the
benefit of U.S. Provisional Application Ser. No. 60/756,585, filed
on Jan. 5, 2006. The disclosures of each of the aforementioned
applications are incorporated herein by reference for all
purposes.
BACKGROUND OF THE INVENTION
[0003] Cancer, the uncontrolled growth of malignant cells, is a
major health problem of the modern medical era and is one of the
leading causes of death in developed countries. In the United
States, one in four deaths is caused by cancer (Jemal, A. et al.,
CA Cancer J. Clin. 52:23-47 (2002)). Among cancers, those that
arise from organs and solid tissues, known as solid cancers (e.g.,
colon cancer, lung cancer, breast cancer, stomach cancer, prostate
cancer, pancreatic cancer) are among the most-commonly identified
human cancers.
[0004] For example, prostate cancer is the most frequently
diagnosed noncutaneous malignancy among men in industrialized
countries, and, in the United States, 1 in 8 men will develop
prostate cancer during his life (Simard, J. et al., Endocrinology
143(6):2029-40 (2002)). The incidence of prostate cancer has
dramatically increased over the last decades and prostate cancer is
now a leading cause of death in the United States and Western
Europe (Peschel, R. E. and J. W. Colberg, Lancet 4:233-41 (2003);
Nelson, W. G. et al., N. Engl. J. Med. 349(4):366-81 (2003)). An
average 40% reduction in life expectancy affects males with
prostate cancer. If detected early, prior to metastasis and local
spread beyond the capsule, prostate cancer can often times be cured
(e.g., using surgery). However, if diagnosed after spread and
metastasis from the prostate, prostate cancer is typically a fatal
disease with low cure rates. While prostate-specific antigen
(PSA)-based screening has aided early diagnosis of prostate cancer,
it is neither highly sensitive nor specific (Punglia et al., N.
Engl. J. Med. 349(4):335-42 (2003)). This means that a high
percentage of false negative and false positive diagnoses are
associated with the test. The consequences are both many instances
of missed cancers and unnecessary follow-up biopsies for those
without cancer.
[0005] Breast cancer remains the second leading cause of
cancer-related deaths in women, affecting more than 180,000 women
in the United States each year. For women in North America, the
life-time odds of getting breast cancer are now one in eight.
Although the discovery of BRCA1 and BRCA2 were important steps in
identifying key genetic factors involved in breast cancer, it has
become clear that mutations in BRCA1 and BRCA2 account for only a
fraction of inherited susceptibility to breast cancer (Nathanson,
K. L., et al., Human Mol. Gen. 10(7):715-720 (2001); Anglican
Breast Cancer Study Group. Br. J. Cancer 83(10):1301-08 (2000); and
Syrjakoski, K., et al., J. Natl. Cancer Inst. 92:1529-31 (2000)).
Despite considerable research into therapies for breast cancer,
breast cancer remains difficult to diagnose and treat effectively,
and the high mortality observed in breast cancer patients indicates
that improvements are needed in the diagnosis, treatment and
prevention of the disease.
[0006] Excluding skin cancer, colorectal cancer is the third most
frequently diagnosed cancer in the United States and Canada (after
lung and breast in women, and lung and prostate in men). The
American Cancer Society estimates that there will be approximately
145,000 new cases of colorectal cancer diagnosed in the U.S. in
2005 (Cancer Facts and FIGS. 2005. Atlanta, GA: American Cancer
Society, 2005). Colorectal cancer is the second leading cause of
cancer death among men and women in the United States and Canada
(after lung cancer).
[0007] The annual incidence of pancreatic cancer is nearly
equivalent to the annual mortality, estimated to be 31,860 and
31,270, respectively, in the U.S. in 2004 (Cancer Facts and Figures
2004. Atlanta, Ga.: American Cancer Society, 2004). Patients with
locally advanced and metastatic pancreatic cancer have poor
prognoses, and diagnosis generally occurs too late for surgery or
radiotherapy to be curative (Burr, H. A., et al., The Oncologist
10(3): 183-190, (2005)). Chemotherapy can provide relief of
symptoms for some patients with advanced pancreatic cancer, but its
impact on survival has been modest to date.
[0008] In the United States, more than 20,000 individuals are
diagnosed with stomach (gastric) cancer each year. The American
Cancer Society estimates that there will be 22,710 new cases of
colorectal cancer diagnosed in the U.S. in 2004 (Cancer Facts and
Figures 2004. Atlanta, Ga.: American Cancer Society, 2004.).
Because stomach cancer may occur without symptoms, it may be in
advanced stages by the time the diagnosis is made. Treatment is
then directed at making the patient more comfortable and improving
quality of life.
[0009] Lung cancer causes more deaths worldwide than any other form
of cancer (Goodman, G. E., Thorax 57:994-999 (2002)). In the United
States, lung cancer is the primary cause of cancer death among both
men and women. In 2002, the death rate from lung cancer was an
estimated 134,900 deaths, exceeding the combined total for breast,
prostate and colon cancer. Id. Lung cancer is also the leading
cause of cancer death in all European countries, and numbers of
lung cancer-related deaths are rapidly increasing in developing
countries as well.
[0010] The five-year survival rate among all lung cancer patients,
regardless of the stage of disease at diagnosis, is only about 13%.
This contrasts with a five-year survival rate of 46% among cases
detected while the disease is still localized. However, only 16% of
lung cancers are discovered before the disease has spread. Early
detection is difficult as clinical symptoms are often not observed
until the disease has reached an advanced stage. Despite research
into therapies for this and other cancers, lung cancer remains
difficult to diagnose and treat effectively.
[0011] Clearly, the identification of markers and genes that are
responsible for susceptibility to particular forms of solid cancer
(e.g., prostate cancer, breast cancer, lung cancer, stomach cancer,
colon cancer, pancreatic cancer) is one of the major challenges
facing oncology today. There is a need to identify means for the
early detection of individuals that have a genetic susceptibility
to cancer so that more aggressive screening and intervention
regimens may be instituted for the early detection and treatment of
cancer. Cancer genes may also reveal key molecular pathways that
may be manipulated (e.g., using small or large molecule weight
drugs) and may lead to more effective treatments regardless of the
cancer stage when a particular cancer is first diagnosed.
[0012] MicroRNAs are a class of small, non-coding RNAs that control
gene expression by hybridizing to and triggering either
translational repression or, less frequently, degradation of a
messenger RNA (mRNA) target. The discovery and study of miRNAs has
revealed miRNA-mediated gene regulatory mechanisms that play
important roles in organismal development and various cellular
processes, such as cell differentiation, cell growth and cell death
(Cheng, A.M., et al., Nucleic Acids Res. 33:1290-1297 (2005)).
Recent studies suggest that aberrant expression of particular
miRNAs may be involved in human diseases, such as neurological
disorders (Ishizuka, A., et al., Genes Dev. 16:2497-2508 (2002))
and cancer. In particular, misexpression of miR-16-1 and/or miR-15a
has been found in human chronic lymphocytic leukemias (Calin, G.
A., et al., Proc. Natl. Acad. Sci. U.S.A. 99:15524-15529
(2002)).
[0013] Clearly, there is a great need in the art for improved
methods for detecting and treating solid cancers (e.g., prostate
cancer, breast cancer, lung cancer, stomach cancer, colon cancer,
pancreatic cancer). The present invention provides novel methods
and compositions for the diagnosis and treatment of solid
cancers.
SUMMARY OF THE INVENTION
[0014] The present invention is based, in part, on the
identification of specific miRNAs that have altered expression
levels in particular solid cancers.
[0015] Accordingly, the invention encompasses methods of diagnosing
whether a subject has, or is at risk for developing, a solid
cancer. According to the methods of the invention, the level of at
least one miR gene product in a test sample from the subject is
compared to the level of a corresponding miR gene product in a
control sample. An alteration (e.g., an increase, a decrease) in
the level of the miR gene product in the test sample, relative to
the level of a corresponding miR gene product in a control sample,
is indicative of the subject either having, or being at risk for
developing, a solid cancer. The solid cancer can be any cancer that
arises from organs and solid tissues. In certain embodiments, the
solid cancer is stomach cancer, breast cancer, pancreatic cancer,
colon cancer, lung cancer or prostate cancer. In particular
embodiments, the solid cancer is not breast cancer, lung cancer,
prostate cancer, pancreatic cancer or gastrointestinal cancer.
[0016] In one embodiment, the at least one miR gene product
measured in the test sample is selected from the group consisting
of miR-21, miR-191, miR-17-5p and combinations thereof. In another
embodiment, the at least one miR gene product measured in the test
sample is selected from the group consisting of miR-21, miR-17-5p,
miR-191, miR-29b-2, miR-223, miR-128b, miR-199a-1, miR-24-1,
miR-24-2, miR-146, miR-155, miR-181b-1, miR-20a, miR-107, miR-32,
miR-92-2, miR-214, miR-30c, miR-25, miR-221, miR-106a and
combinations thereof.
[0017] In one embodiment, the solid cancer is breast cancer or lung
cancer and the at least one miR gene product measured in the test
sample is selected from the group consisting of miR-210, miR-213
and a combination thereof.
[0018] In another embodiment, the solid cancer is colon cancer,
stomach cancer, prostate cancer or pancreas cancer and the at least
one miR gene product measured in the test sample is miR-218-2.
[0019] In a certain embodiment, the solid cancer is breast cancer
and the at least one miR gene product measured in the test sample
is selected from the group consisting of miR-125b-1, miR-125b-2,
miR-145, miR-21 and combinations thereof. In a related embodiment,
the solid cancer is breast cancer and the at least one miR gene
product in the test sample is selected from the group consisting of
miR-21, miR-29b-2, miR-146, miR-125b-2, miR-125b-1, miR-10b,
miR-145, miR-181a, miR-140, miR-213, miR-29a prec, miR-181b-1,
miR-199b, miR-29b-1, miR-130a, miR-155, let-7a-2, miR-205, miR-29c,
miR-224, miR-100, miR-31, miR-30c, miR-17-5p, miR-210, miR-122a,
miR-16-2 and combinations thereof.
[0020] In another embodiment, the solid cancer is colon cancer and
the at least one miR gene product in the test sample is selected
from the group consisting of miR-24-1, miR-29b-2, miR-20a, miR-10a,
miR-32, miR-203, miR-106a, miR-17-5p, miR-30c, miR-223, miR-126*,
miR-128b, miR-21, miR-24-2, miR-99b prec, miR-155, miR-213,
miR-150, miR-107, miR-191, miR-221, miR-9-3 and combinations
thereof.
[0021] In yet another embodiment, the solid cancer is lung cancer
and the miR gene product in the test sample is selected from the
group consisting of miR-21, miR-205, miR-200b, miR-9-1, miR-210,
miR-148, miR-141, miR-132, miR-215, miR-128b, let-7g, miR-16-2,
miR-129-1/2prec, miR-126*, miR-142-as, miR-30d, miR-30a-5p,
miR-7-2, miR-199a-1, miR-127, miR-34a prec, miR-34a, miR-136,
miR-202, miR-196-2, miR-199a-2, let-7a-2, miR-124a-1, miR-149,
miR-17-5p, miR-196-1 prec, miR-10a, miR-99b prec, miR-196-1,
miR-199b, miR-191, miR-195, miR-155 and combinations thereof.
[0022] In an additional embodiment, the solid cancer is pancreatic
cancer and the at least one miR gene product measured in the test
sample is selected from the group consisting of miR-103-1,
miR-103-2, miR-155, miR-204 and combinations thereof. In a related
embodiment, the solid cancer is pancreatic cancer and the miR gene
product in the test sample is selected from the group consisting of
miR-103-2, miR-103-1, miR-24-2, miR-107, miR-100, miR-125b-2,
miR-125b-1, miR-24-1, miR-191, miR-23a, miR-26a-1, miR-125a,
miR-130a, miR-26b, miR-145, miR-221, miR-126*, miR-16-2, miR-146,
miR-214, miR-99b, miR-128b, miR-155, miR-29b-2, miR-29a, miR-25,
miR-16-1, miR-99a, miR-224, miR-30d, miR-92-2, miR-199a-1, miR-223,
miR-29c, miR-30b, miR-129-1/2, miR-197, miR-17-5p, miR-30c,
miR-7-1, miR-93-1, miR-140, miR-30a-5p, miR-132, miR-181b-1,
miR-152 prec, miR-23b, miR-20a, miR-222, miR-27a, miR-92-1, miR-21,
miR-129-1/2 prec, miR-150, miR-32, miR-106a, miR-29b-1 and
combinations thereof.
[0023] In another embodiment, the solid cancer is prostate cancer
and the miR gene product in the test sample is selected from the
group consisting of let-7d, miR-128a prec, miR-195, miR-203,
let-7a-2 prec, miR-34a, miR-20a, miR-218-2, miR-29a, miR-25,
miR-95, miR-197, miR-135-2, miR-187, miR-196-1, miR-148, miR-191,
miR-21, let-7i, miR-198, miR-199a-2, miR-30c, miR-17-5p, miR-92-2,
miR-146, miR-181b-1 prec, miR-32, miR-206, miR-184 prec, miR-29a
prec, miR-29b-2, miR-149, miR-181b-1, miR-196-1 prec, miR-93-1,
miR-223, miR-16-1, miR-101-1, miR-124a-1, miR-26a-1, miR-214,
miR-27a, miR-24-1, miR-106a, miR-199a-1 and combinations
thereof.
[0024] In yet another embodiment, the solid cancer is stomach
cancer and the miR gene product in the test sample is selected from
the group consisting of miR-223, miR-21, miR-218-2, miR-103-2,
miR-92-2, miR-25, miR-136, miR-191, miR-221, miR-125b-2, miR-103-1,
miR-214, miR-222, miR-212 prec, miR-125b-1, miR-100, miR-107,
miR-92-1, miR-96, miR-192, miR-23a, miR-215, miR-7-2, miR-138-2,
miR-24-1, miR-99b, miR-33b, miR-24-2 and combinations thereof.
[0025] The level of the at least one miR gene product can be
measured using a variety of techniques that are well known to those
of skill in the art (e.g., quantitative or semi-quantitative
RT-PCR, Northern blot analysis, solution hybridization detection).
In a particular embodiment, the level of at least one miR gene
product is measured by reverse transcribing RNA from a test sample
obtained from the subject to provide a set of target
oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides
to one or more miRNA-specific probe oligonucleotides (e.g.,
hybridzing to a microarray that comprises several miRNA-specific
probe oligonucleotides) to provide a hybridization profile for the
test sample, and comparing the test sample hybridization profile to
a hybridization profile from a control sample. An alteration in the
signal of at least one miRNA in the test sample relative to the
control sample is indicative of the subject either having, or being
at risk for developing, a solid cancer. In a particular embodiment,
target oligonucleotides are hybridized to a microarray comprising
miRNA-specific probe oligonucleotides for one or more miRNAs
selected from the group consisting of miR-21, miR-17-5p, miR-191,
miR-29b-2, miR-223, miR-128b, miR-199a-1, miR-24-1, miR-24-2,
miR-146, miR-155, miR-181b-1, miR-20a, miR-107, miR-32, miR-92-2,
miR-214, miR-30c, miR-25, miR-221, miR-106a and combinations
thereof.
[0026] The invention also encompasses methods of inhibiting
tumorigenesis in a subject who has, or is suspected of having, a
solid cancer (e.g., prostate cancer, stomach cancer, pancreatic
cancer, lung cancer, breast cancer, colon cancer), wherein at least
one miR gene product is deregulated (e.g., down-regulated,
up-regulated) in the cancer cells of the subject. When the at least
one isolated miR gene product is down-regulated in the cancer
cells, the method comprises administering an effective amount of an
isolated miR gene product, an isolated variant or a
biologically-active fragment of the miR gene product or variant,
such that proliferation of cancer cells in the subject is
inhibited. In a further embodiment, the at least one isolated miR
gene product is selected from the group consisting of miR-145,
miR-155, miR-218-2 and combinations thereof. In a particular
embodiment, the miR gene product is not miR-15a or miR-16-1. When
the at least one isolated miR gene product is up-regulated in the
cancer cells, the method comprises administering to the subject an
effective amount of at least one compound for inhibiting expression
of the at least one miR gene product (referred to herein as a "miR
expression-inhibition compound"), such that proliferation of cancer
cells in the subject is inhibited. In a particular embodiment, the
at least one miR expression-inhibition compound is specific for a
miR gene product selected from the group consisting of miR-21,
miR-17-5p, miR-191, miR-29b-2, miR-223, miR-128b, miR-199a-1,
miR-24-1, miR-24-2, miR-146, miR-155, miR-181b-1, miR-20a, miR-107,
miR-32, miR-92-2, miR-214, miR-30c, miR-25, miR-221, miR-106a and
combinations thereof.
[0027] In a related embodiment, the methods of inhibiting
tumorigenesis in a subject additionally comprise the step of
determining the amount of at least one miR gene product in cancer
cells from the subject, and comparing that level of the miR gene
product in the cells to the level of a corresponding miR gene
product in control cells. If expression of the miR gene product is
deregulated (e.g., down-regulated, up-regulated) in cancer cells,
the methods further comprise altering the amount of the at least
one miR gene product expressed in the cancer cells. In one
embodiment, the amount of the miR gene product expressed in the
cancer cells is less than the amount of the miR gene product
expressed in a control cell (e.g., control cells), and an effective
amount of the down-regulated miR gene product, isolated variant or
biologically-active fragment of the miR gene product or variant, is
administered to the subject. Suitable miR gene products for this
embodiment include miR-145, miR-155, miR-218-2 and combinations
thereof, among others. In a particular embodiment, the miR gene
product is not miR-15a or miR-16-1. In another embodiment, the
amount of the miR gene product expressed in the cancer cells is
greater than the amount of the miR gene product expressed in the
control cell (e.g., control cells), and an effective amount of at
least one compound for inhibiting expression of the at least one
up-regulated miR gene product is administered to the subject.
Suitable compounds for inhibiting expression of the at least one
miR gene product include, but are not limited to, compounds that
inhibit the expression of miR-21, miR-17-5p, miR-191, miR-29b-2,
miR-223, miR-128b, miR-199a-1, miR-24-1, miR-24-2, miR-146,
miR-155, miR-181b-1, miR-20a, miR-107, miR-32, miR-92-2, miR-214,
miR-30c, miR-25, miR-221, miR-106a and combinations thereof.
[0028] The invention further provides pharmaceutical compositions
for treating solid cancers (e.g., prostate cancer, stomach cancer,
pancreatic cancer, lung cancer, breast cancer, colon cancer). In
one embodiment, the pharmaceutical compositions comprise at least
one isolated miR gene product and a pharmaceutically-acceptable
carrier. In a particular embodiment, the at least one miR gene
product corresponds to a miR gene product that has a decreased
level of expression in cancer cells relative to control cells. In
certain embodiments the isolated miR gene product is selected from
the group consisting of miR-145, miR-155, miR-218-2 and
combinations thereof.
[0029] In another embodiment, the pharmaceutical compositions of
the invention comprise at least one miR expression-inhibition
compound and a pharmaceutically-acceptable carrier. In a particular
embodiment, the at least one miR expression-inhibition compound is
specific for a miR gene product whose expression is greater in
cancer cells than in control cells. In certain embodiments, the miR
expression-inhibition compound is specific for one or more miR gene
products selected from the group consisting of miR-21, miR-17-5p,
miR-191, miR-29b-2, miR-223, miR-128b, miR-199a-1, miR-24-1,
miR-24-2, miR-146, miR-155, miR-181b-1, miR-20a, miR-107, miR-32,
miR-92-2, miR-214, miR-30c, miR-25, miR-221, miR-106a and
combinations thereof.
[0030] The invention also encompasses methods of identifying an
inhibitor of tumorigenesis, comprising providing a test agent to a
cell and measuring the level of at least one miR gene product in
the cell. In one embodiment, the method comprises providing a test
agent to a cell and measuring the level of at least one miR gene
product associated with decreased expression levels in solid
cancers (e.g., prostate cancer, stomach cancer, pancreatic cancer,
lung cancer, breast cancer, colon cancer). An increase in the level
of the miR gene product in the cell, relative to a suitable control
cell, is indicative of the test agent being an inhibitor of
tumorigenesis. In a particular embodiment, the at least one miR
gene product associated with decreased expression levels in solid
cancer cells is selected from the group consisting of miR-145,
miR-155, miR-218-2 and combinations thereof.
[0031] In other embodiments, the method comprises providing a test
agent to a cell and measuring the level of at least one miR gene
product associated with increased expression levels in solid
cancers. A decrease in the level of the miR gene product in the
cell, relative to a suitable control cell, is indicative of the
test agent being an inhibitor of tumorigenesis. In a particular
embodiment, the at least one miR gene product associated with
increased expression levels in solid cancer cells is selected from
the group consisting of miR-21, miR-17-5p, miR-191, miR-29b-2,
miR-223, miR-128b, miR-199a-1, miR-24-1, miR-24-2, miR-146,
miR-155, miR-181b-1, miR-20a, miR-107, miR-32, miR-92-2, miR-214,
miR-30c, miR-25, miR-221, miR-106a and combinations thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
[0032] The patent or application file contains at least one drawing
executed in color. Copies of this patent or patent application
publication with color drawings will be provided by the Office upon
request and payment of the necessary fee.
[0033] FIG. 1 depicts a clustering analysis of 540 samples,
representing 6 solid cancers (top) and the respective normal
tissues. miRNAs included in the tree (n=137) represent those whose
expression level (background-subtracted intensity) was higher than
the threshold value (256) in at least 50% of the samples analyzed.
Arrays were median-centered and normalized using Gene Cluster 2.0.
Average linkage clustering was performed by using uncentered
correlation metric. The colors indicate the difference in
expression level from the median for the microRNAs in each
sample.
[0034] FIG. 2 depicts unsupervised analysis of microRNA expression
data. MicroRNA profiling of 540 samples (indicated at top of panel)
covering breast, colon, lung, pancreas, prostate and stomach
(normal tissues and tumors) were filtered, centered and normalized
for each feature. The data were subject to hierarchical clustering
on both the samples (horizontally-oriented) and the features
(vertically-oriented with average linkage and Pearson correlation
as a similarity measure. Sample names are indicated at the top of
the figure and miRNA names on the left. The probe ID is indicated
in parentheses, as the same microRNA can be measured by different
oligonucleotides. The colors indicate the difference in expression
level from the median for the microRNAs in each sample.
[0035] FIG. 3 depicts the expression of differentially-regulated
miRNAs across solid cancers (top). Sixty-one microRNAs, which are
present in at least 90% of the tissues solid cancers, are
represented (right of panel). The tree displays the average
absolute expression values for each of the listed microRNAs after
log.sub.2 transformation. The mean was computed over all samples
from the same tissue or tumor histotype. Genes were mean-centered
and normalized using Gene Cluster 2.0. Average linkage clustering
was performed using Euclidean distance.
[0036] FIG. 4 depicts fold changes in the expression of miRNAs
present in at least 75% of the solid tumors with at least 1 tumor
absolute value higher than 2 in different cancer samples (top),
relative to normal samples. The tree displays the log.sub.2
transformation of average fold changes (cancer vs. normal). The
mean was computed over all samples from the same tissue or tumor
histotype. Arrays were mean-centered and normalized using Gene
Cluster 2.0. Average linkage clustering was performed using
uncentered correlation metric.
[0037] FIG. 5 depicts fold changes in the expression of miRNAs
present in the signatures of at least 50% of the solid tumors in
cancer vs. normal samples. The tree displays the log.sub.2
transformation of the average fold changes (cancer over normal).
The mean was computed over all samples from the same tissue or
tumor histotype. Arrays were mean centered and normalized using
Gene Cluster 2.0. Average linkage clustering was performed using
uncentered correlation metric.
[0038] FIG. 6A depicts bar graphs indicating that the 3'UTR of
different genes encoding cancer protein enables cancer regulation
by microRNA. The relative repression of firefly luciferase
expression (Fold Change) standardized to a renilla luciferase
control. PLAG1, pleiomorphic adenoma gene 1; TGFBR2, transforming
growth factor beta receptor II; Rb, retinoblastoma gene. pGL-3
(Promega) was used as the empty vector. miR-20a, miR-26a-1 and
miR-106 oligoRNAs (sense and scrambled) were used for
transfections. A second experiment using mutated versions of each
target mRNA, which lack the 5' miRNA-end complementarity site
(MUT), as controls is shown in the bottom panel. All the
experiments were performed twice in triplicate (n=6).
[0039] FIG. 6B depicts Western blots indicating that, in certain
cancers (e.g., lung, breast, colon, gastric), the levels of RB1
(Rb) protein displays an inverse correlation with the level of
miR-106a expression. .beta.-Actin was used as a control for
normalization. N1, normal sample; T1 and T2, tumor sample.
[0040] FIG. 7 depicts Northern blots showing down-regulation of
miR-145 (top) and up-regulation of miR-21 (bottom) expression in
breast cancer samples (P series and numbered series) relative to
normal samples. Normalization was performed with a U6-specific
probe.
[0041] FIG. 8 depicts Northern blots showing up-regulation of
miR-103 and down-regulation miR-155 (top) expression in different
endocrine pancreatic cancer samples (WDET, well differentiated
pancreatic endocrine tumors, WDEC, well differentiated pancreatic
endocrine carcinomas and ACC, pancreatic acinar cell carcinomas)
relative to normal samples (K series), as well as up-regulation of
miR-204 (bottom) expression in insulinomas (F series) relative to
normal samples (K series) and non secreting/non functioning
(NF-series) samples. Normalization was performed with a probe
specific to 5S RNA.
DETAILED DESCRIPTION OF THE INVENTION
[0042] The present invention is based, in part, on the
identification of particular microRNAs whose expression is altered
in cancer cells associated with different solid cancers, such as
colon, stomach, pancreatic, lung, breast and prostate cancer,
relative to normal control cells.
[0043] As used herein interchangeably, a "miR gene product,"
"microRNA," "miR," or "miRNA" refers to the unprocessed (e.g.,
precursor) or processed (e.g., mature) RNA transcript from a miR
gene. As the miR gene products are not translated into protein, the
term "miR gene products" does not include proteins. The unprocessed
miR gene transcript is also called a "miR precursor" or "miR prec"
and typically comprises an RNA transcript of about 70-100
nucleotides in length. The miR precursor can be processed by
digestion with an RNAse (for example, Dicer, Argonaut, or RNAse III
(e.g., E. coli RNAse III)) into an active 19-25 nucleotide RNA
molecule. This active 19-25 nucleotide RNA molecule is also called
the "processed" miR gene transcript or "mature" miRNA.
[0044] The active 19-25 nucleotide RNA molecule can be obtained
from the miR precursor through natural processing routes (e.g.,
using intact cells or cell lysates) or by synthetic processing
routes (e.g., using isolated processing enzymes, such as isolated
Dicer, Argonaut, or RNAse III). It is understood that the active
19-25 nucleotide RNA molecule can also be produced directly by
biological or chemical synthesis, without having been processed
from the miR precursor. When a microRNA is referred to herein by
name, the name corresponds to both the precursor and mature forms,
unless otherwise indicated.
[0045] Tables 1a and 1b depict the nucleotide sequences of
particular precursor and mature human microRNAs.
TABLE-US-00001 TABLE 1a Human microRNA Precursor Sequences SEQ ID
Precursor Name Sequence (5' To 3')* NO. let-7a-1
CACUGUGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACA 1
CCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUAA CGUG let-7a-2
AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGG 2
GAGAUAACUGUACAGCCUCCUAGCUUUCCU let-7a-3
GGGUGAGGUAGUAGGUUGUAUAGUUUGGGGCUCUGCCCUGCUA 3
UGGGAUAACUAUACAAUCUACUGUCUUUCCU let-7a-4
GUGACUGCAUGCUCCCAGGUUGAGGUAGUAGGUUGUAUAGUUU 4
AGAAUUACACAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCC UUGGGUCUUGCACUAAACAAC
let-7b GGCGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAU 5
GUUGCCCCUCGGAAGAUAACUAUACAACCUACUGCCUUCCCUG let-7c
GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACAC 6
CCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGC let-7d
CCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGGGAUU 7
UUGCCCACAAGGAGGUAACUAUACGACCUGCUGCCUUUCUUAG G let-7d-v1
CUAGGAAGAGGUAGUAGUUUGCAUAGUUUUAGGGCAAAGAUU 8
UUGCCCACAAGUAGUUAGCUAUACGACCUGCAGCCUUUUGUAG let-7d-v2
CUGGCUGAGGUAGUAGUUUGUGCUGUUGGUCGGGUUGUGACAU 9
UGCCCGCUGUGGAGAUAACUGCGCAAGCUACUGCCUUGCUAG let-7e
CCCGGGCUGAGGUAGGAGGUUGUAUAGUUGAGGAGGACACCCA 10
AGGAGAUCACUAUACGGCCUCCUAGCUUUCCCCAGG let-7f-1
UCAGAGUGAGGUAGUAGAUUGUAUAGUUGUGGGGUAGUGAUU 11
UUACCCUGUUCAGGAGAUAACUAUACAAUCUAUUGCCUUCCCU GA let-7f-2-1
CUGUGGGAUGAGGUAGUAGAUUGUAUAGUUGUGGGGUAGUGA 12
UUUUACCCUGUUCAGGAGAUAACUAUACAAUCUAUUGCCUUCC CUGA let-7f-2-2
CUGUGGGAUGAGGUAGUAGAUUGUAUAGUUUUAGGGUCAUACC
CCAUCUUGGAGAUAACUAUACAGUCUACUGUCUUUCCCACGG 13 let-7g
UUGCCUGAUUCCAGGCUGAGGUAGUAGUUUGUACAGUUUGAGG
GUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCAC 14
UGCCUUGCCAGGAACAGCGCGC let-7i
CUGGCUGAGGUAGUAGUUUGUGCUGUUGGUCGGGUUGUGACAU 15
UGCCCGCUGUGGAGAUAACUGCGCAAGCUACUGCCUUGCUAG miR-lb-1-1
ACCUACUCAGAGUACAUACUUCUUUAUGUACCCAUAUGAACAU 16
ACAAUGCUAUGGAAUGUAAAGAAGUAUGUAUUUUUGGUAGGC miR-1b-1-2
CAGCUAACAACUUAGUAAUACCUACUCAGAGUACAUACUUCUU 17
UAUGUACCCAUAUGAACAUACAAUGCUAUGGAAUGUAAAGAAG UAUGUAUUUUUGGUAGGCAAUA
miR-1b-2 GCCUGCUUGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCU 18
GCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCAGGCCGGG miR-1b
UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGC 19
UAUGGAAUGUAAAGAAGUAUGUAUCUCA miR-1d
ACCUACUCAGAGUACAUACUUCUUUAUGUACCCAUAUGAACAU 20
ACAAUGCUAUGGAAUGUAAAGAAGUAUGUAUUUUUGGUAGGC miR-7-1a
UGGAUGUUGGCCUAGUUCUGUGUGGAAGACUAGUGAUUUUGUU 21
GUUUUUAGAUAACUAAAUCGACAACAAAUCACAGUCUGCCAUA UGGCACAGGCCAUGCCUCUACA
miR-7-1b UUGGAUGUUGGCCUAGUUCUGUGUGGAAGACUAGUGAUUUUGU 22
UGUUUUUAGAUAACUAAAUCGACAACAAAUCACAGUCUGCCAU
AUGGCACAGGCCAUGCCUCUACAG miR-7-2
CUGGAUACAGAGUGGACCGGCUGGCCCCAUCUGGAAGACUAGU 23
GAUUUUGUUGUUGUCUUACUGCGCUCAACAACAAAUCCCAGUC
UACCUAAUGGUGCCAGCCAUCGCA miR-7-3
AGAUUAGAGUGGCUGUGGUCUAGUGCUGUGUGGAAGACUAGUG 24
AUUUUGUUGUUCUGAUGUACUACGACAACAAGUCACAGCCGGC
CUCAUAGCGCAGACUCCCUUCGAC miR-9-1
CGGGGUUGGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGGU 25
GUGGAGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAAUAACC CCA miR-9-2
GGAAGCGAGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGUA 26
UUGGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAACUCCUUC A miR-9-3
GGAGGCCCGUUUCUCUCUUUGGUUAUCUAGCUGUAUGAGUGCC 27
ACAGAGCCGUCAUAAAGCUAGAUAACCGAAAGUAGAAAUGAUU CUCA miR-10a
GAUCUGUCUGUCUUCUGUAUAUACCCUGUAGAUCCGAAUUUGU 28
GUAAGGAAUUUUGUGGUCACAAAUUCGUAUCUAGGGGAAUAUG
UAGUUGACAUAAACACUCCGCUCU miR-10b
CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAA 29
UUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAA
UAUAUGGUCGAUGCAAAAACUUCA miR-15a-2
GCGCGAAUGUGUGUUUAAAAAAAAUAAAACCUUGGAGUAAAGU 30
AGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCA UAUUGUGCUGCCUCAAAAAUAC
miR-15a CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGA 31
AAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG miR-15b-1
CUGUAGCAGCACAUCAUGGUUUACAUGCUACAGUCAAGAUGCG 32
AAUCAUUAUUUGCUGCUCUAG miR-15b-2
UUGAGGCCUUAAAGUACUGUAGCAGCACAUCAUGGUUUACAUG 33
CUACAGUCAAGAUGCGAAUCAUUAUUUGCUGCUCUAGAAAUUU AAGGAAAUUCAU miR-16-1
GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUU 34
CUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUU GAC miR-16-2
GUUCCACUCUAGCAGCACGUAAAUAUUGGCGUAGUGAAAUAUA 35
UAUUAAACACCAAUAUUACUGUGCUGCUUUAGUGUGAC miR-16-13
GCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAA 36
AAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGU miR-17
GUCAGAAUAAUGUCAAAGUGCUUACAGUGCAGGUAGUGAUAUG 37
UGCAUCUACUGCAGUGAAGGCACUUGUAGCAUUAUGGUGAC miR-18
UGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCA 38
UCUACUGCCCUAAGUGCUCCUUCUGGCA miR-18-13
UUUUUGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUU 39
AGCAUCUACUGCCCUAAGUGCUCCUUCUGGCAUAAGAA miR-19a
GCAGUCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAU 40
GUAGUUGUGCAAAUCUAUGCAAAACUGAUGGUGGCCUGC miR-19a-13
CAGUCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUG 41
UAGUUGUGCAAAUCUAUGCAAAACUGAUGGUGGCCUG miR-19b-1
CACUGUUCUAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUGU 42
GAUAUUCUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGUAGU G miR-19b-2
ACAUUGCUACUUACAAUUAGUUUUGCAGGUUUGCAUUUCAGCG 43
UAUAUAUGUAUAUGUGGCUGUGCAAAUCCAUGCAAAACUGAUU GUGAUAAUGU miR-19b-13
UUCUAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUGUGAUAU 44
UCUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGUAG miR-19b-X
UUACAAUUAGUUUUGCAGGUUUGCAUUUCAGCGUAUAUAUGUA 45
UAUGUGGCUGUGCAAAUCCAUGCAAAACUGAUUGUGAU miR-20
GUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUUAGUUAUCU 46 (miR-20a)
ACUGCAUUAUGAGCACUUAAAGUACUGC miR-21
UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAU 47
GGCAACACCAGUCGAUGGGCUGUCUGACA miR-21-17
ACCUUGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUC 48
UCAUGGCAACACCAGUCGAUGGGCUGUCUGACAUUUUG miR-22
GGCUGAGCCGCAGUAGUUCUUCAGUGGCAAGCUUUAUGUCCUG 49
ACCCAGCUAAAGCUGCCAGUUGAAGAACUGUUGCCCUCUGCC miR-23a
GGCCGGCUGGGGUUCCUGGGGAUGGGAUUUGCUUCCUGUCACA 50
AAUCACAUUGCCAGGGAUUUCCAACCGACC miR-23b
CUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGU 51
GACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACC ACGACCUUGGC miR-23-19
CCACGGCCGGCUGGGGUUCCUGGGGAUGGGAUUUGCUUCCUGU 52
CACAAAUCACAUUGCCAGGGAUUUCCAACCGACCCUGA miR-24-1
CUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUUACACAC 53
UGGCUCAGUUCAGCAGGAACAGGAG miR-24-2
CUCUGCCUCCCGUGCCUACUGAGCUGAAACACAGUUGGUUUGU 54
GUACACUGGCUCAGUUCAGCAGGAACAGGG miR-24-19
CCCUGGGCUCUGCCUCCCGUGCCUACUGAGCUGAAACACAGUU 55
GGUUUGUGUACACUGGCUCAGUUCAGCAGGAACAGGGG miR-24-9
CCCUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUUACAC 56
ACUGGCUCAGUUCAGCAGGAACAGCAUC miR-25
GGCCAGUGUUGAGAGGCGGAGACUUGGGCAAUUGCUGGACGCU 57
GCCCUGGGCAUUGCACUUGUCUCGGUCUGACAGUGCCGGCC miR-26a
AGGCCGUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGG 58
UCCCAAUGGCCUAUCUUGGUUACUUGCACGGGGACGCGGGCCU miR-26a-1
GUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCA 59
AUGGGCCUAUUCUUGGUUACUUGCACGGGGACGC miR-26a-2
GGCUGUGGCUGGAUUCAAGUAAUCCAGGAUAGGCUGUUUCCAU 60
CUGUGAGGCCUAUUCUUGAUUACUUGUUUCUGGAGGCAGCU miR-26b
CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUC 61
CAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG miR-27a
CUGAGGAGCAGGGCUUAGCUGCUUGUGAGCAGGGUCCACACCA 62
AGUCGUGUUCACAGUGGCUAAGUUCCGCCCCCCAG miR-27b-1
AGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUUUCCG 63
CUUUGUUCACAGUGGCUAAGUUCUGCACCU miR-27b-2
ACCUCUCUAACAAGGUGCAGAGCUUAGCUGAUUGGUGAACAGU 64
GAUUGGUUUCCGCUUUGUUCACAGUGGCUAAGUUCUGCACCUG AAGAGAAGGUG miR-27-19
CCUGAGGAGCAGGGCUUAGCUGCUUGUGAGCAGGGUCCACACC 65
AAGUCGUGUUCACAGUGGCUAAGUUCCGCCCCCCAGG miR-28
GGUCCUUGCCCUCAAGGAGCUCACAGUCUAUUGAGUUACCUUU 66
CUGACUUUCCCACUAGAUUGUGAGCUCCUGGAGGGCAGGCACU miR-29a-2
CCUUCUGUGACCCCUUAGAGGAUGACUGAUUUCUUUUGGUGUU 67
CAGAGUCAAUAUAAUUUUCUAGCACCAUCUGAAAUCGGUUAUA AUGAUUGGGGAAGAGCACCAUG
miR-29a AUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUA 68
GCACCAUCUGAAAUCGGUUAU miR-29b-1
CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGU 69
GAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG miR-29b-2
CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUC 70
UUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG miR-29c
ACCACUGGCCCAUCUCUUACACAGGCUGACCGAUUUCUCCUGG 71
UGUUCAGAGUCUGUUUUUGUCUAGCACCAUUUGAAAUCGGUUA
UGAUGUAGGGGGAAAAGCAGCAGC miR-30a
GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAGAU 72
GGGCUUUCAGUCGGAUGUUUGCAGCUGC miR-30b-1
AUGUAAACAUCCUACACUCAGCUGUAAUACAUGGAUUGGCUGG 73
GAGGUGGAUGUUUACGU
miR-30b-2 ACCAAGUUUCAGUUCAUGUAAACAUCCUACACUCAGCUGUAAU 74
ACAUGGAUUGGCUGGGAGGUGGAUGUUUACUUCAGCUGACUUG GA miR-30c
AGAUACUGUAAACAUCCUACACUCUCAGCUGUGGAAAGUAAGA 75
AAGCUGGGAGAAGGCUGUUUACUCUUUCU miR-30d
GUUGUUGUAAACAUCCCCGACUGGAAGCUGUAAGACACAGCUA 76
AGCUUUCAGUCAGAUGUUUGCUGCUAC miR-30e
CUGUAAACAUCCUUGACUGGAAGCUGUAAGGUGUUCAGAGGAG 77
CUUUCAGUCGGAUGUUUACAG miR-31
GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACC 78
UGCUAUGCCAACAUAUUGCCAUCUUUCC miR-32
GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCA 79
AUGCAAUUUAGUGUGUGUGAUAUUUUC miR-33b
GGGGGCCGAGAGAGGCGGGCGGCCCCGCGGUGCAUUGCUGUUG 80
CAUUGCACGUGUGUGAGGCGGGUGCAGUGCCUCGGCAGUGCAG
CCCGGAGCCGGCCCCUGGCACCAC miR-33b-2
ACCAAGUUUCAGUUCAUGUAAACAUCCUACACUCAGCUGUAAU 81
ACAUGGAUUGGCUGGGAGGUGGAUGUUUACUUCAGCUGACUUG GA miR-33
CUGUGGUGCAUUGUAGUUGCAUUGCAUGUUCUGGUGGUACCCA 82
UGCAAUGUUUCCACAGUGCAUCACAG miR-34-a
GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGU 83
UGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUA
GAAGUGCUGCACGUUGUGGGGCCC miR-34-b
GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGG 84
UGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC miR-34-c
AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUA 85
CCAAUCACUAACCACACGGCCAGGUAAAAAGAUU miR-91-13
UCAGAAUAAUGUCAAAGUGCUUACAGUGCAGGUAGUGAUAUGU 86
GCAUCUACUGCAGUGAAGGCACUUGUAGCAUUAUGGUGA miR-92-1
CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGU 87
AUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG miR-92-2
UCAUCCCUGGGUGGGGAUUUGUUGCAUUACUUGUGUUCUAUAU 88
AAAGUAUUGCACUUGUCCCGGCCUGUGGAAGA miR-93-1
CUGGGGGCUCCAAAGUGCUGUUCGUGCAGGUAGUGUGAUUACC 89 (miR-93-2)
CAACCUACUGCUGAGCUAGCACUUCCCGAGCCCCCGG miR-95-4
AACACAGUGGGCACUCAAUAAAUGUCUGUUGAAUUGAAAUGCG 90
UUACAUUCAACGGGUAUUUAUUGAGCACCCACUCUGUG miR-96-7
UGGCCGAUUUUGGCACUAGCACAUUUUUGCUUGUGUCUCUCCG 91
CUCUGAGCAAUCAUGUGCAGUGCCAAUAUGGGAAA miR-97-6
GUGAGCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCAC 92 (miR-30*)
AGAUGGGCUUUCAGUCGGAUGUUUGCAGCUGCCUACU miR-98
GUGAGGUAGUAAGUUGUAUUGUUGUGGGGUAGGGAUAUUAGG 93
CCCCAAUUAGAAGAUAACUAUACAACUUACUACUUUCC miR-99b
GGCACCCACCCGUAGAACCGACCUUGCGGGGCCUUCGCCGCACA 94
CAAGCUCGUGUCUGUGGGUCCGUGUC miR-99a
CCCAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGGUGAAGUGG 95
ACCGCACAAGCUCGCUUCUAUGGGUCUGUGUCAGUGUG miR-100-1/2
AAGAGAGAAGAUAUUGAGGCCUGUUGCCACAAACCCGUAGAUC 96
CGAACUUGUGGUAUUAGUCCGCACAAGCUUGUAUCUAUAGGUA UGUGUCUGUUAGGCAAUCUCAC
miR-100-11 CCUGUUGCCACAAACCCGUAGAUCCGAACUUGUGGUAUUAGUC 97
CGCACAAGCUUGUAUCUAUAGGUAUGUGUCUGUUAGG miR-101-1/2
AGGCUGCCCUGGCUCAGUUAUCACAGUGCUGAUGCUGUCUAUU 98
CUAAAGGUACAGUACUGUGAUAACUGAAGGAUGGCAGCCAUCU
UACCUUCCAUCAGAGGAGCCUCAC miR-101
UCAGUUAUCACAGUGCUGAUGCUGUCCAUUCUAAAGGUACAGU 99 ACUGUGAUAACUGA
miR-101-1 UGCCCUGGCUCAGUUAUCACAGUGCUGAUGCUGUCUAUUCUAA 100
AGGUACAGUACUGUGAUAACUGAAGGAUGGCA miR-101-2
ACUGUCCUUUUUCGGUUAUCAUGGUACCGAUGCUGUAUAUCUG 101
AAAGGUACAGUACUGUGAUAACUGAAGAAUGGUGGU miR-101-9
UGUCCUUUUUCGGUUAUCAUGGUACCGAUGCUGUAUAUCUGAA 102
AGGUACAGUACUGUGAUAACUGAAGAAUGGUG miR-102-1
CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUC 103
UUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG miR-102-7.1
CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGU 104 (miR-102-7.2)
GAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG miR-103-2
UUGUGCUUUCAGCUUCUUUACAGUGCUGCCUUGUAGCAUUCAG 105
GUCAAGCAACAUUGUACAGGGCUAUGAAAGAACCA miR-103-1
UACUGCCCUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGG 106
AUCAAGCAGCAUUGUACAGGGCUAUGAAGGCAUUG miR-104-17
AAAUGUCAGACAGCCCAUCGACUGGUGUUGCCAUGAGAUUCAA 107
CAGUCAACAUCAGUCUGAUAAGCUACCCGACAAGG miR-105-1
UGUGCAUCGUGGUCAAAUGCUCAGACUCCUGUGGUGGCUGCUC 108
AUGCACCACGGAUGUUUGAGCAUGUGCUACGGUGUCUA miR-105-2
UGUGCAUCGUGGUCAAAUGCUCAGACUCCUGUGGUGGCUGCUU 109
AUGCACCACGGAUGUUUGAGCAUGUGCUAUGGUGUCUA miR-106-a
CCUUGGCCAUGUAAAAGUGCUUACAGUGCAGGUAGCUUUUUGA 110
GAUCUACUGCAAUGUAAGCACUUCUUACAUUACCAUGG miR-106-b
CCUGCCGGGGCUAAAGUGCUGACAGUGCAGAUAGUGGUCCUCU 111
CCGUGCUACCGCACUGUGGGUACUUGCUGCUCCAGCAGG miR-107
CUCUCUGCUUUCAGCUUCUUUACAGUGUUGCCUUGUGGCAUGG 112
AGUUCAAGCAGCAUUGUACAGGGCUAUCAAAGCACAGA miR-108-1-A
CACUGCAAGAACAAUAAGGAUUUUUAGGGGCAUUAUGACUGA 113 small
GUCAGAAAACACAGCUGCCCCUGAAAGUCCCUCAUUUUUCUUG CUGU miR-108-2-A
CUGCAAGAGCAAUAAGGAUUUUUAGGGGCAUUAUGAUAGUGG 114 small
AAUGGAAACACAUCUGCCCCCAAAAGUCCCUCAUUUU miR-122a-1
CCUUAGCAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCUAA 115
ACUAUCAAACGCCAUUAUCACACUAAAUAGCUACUGCUAGGC miR-122a-2
AGCUGUGGAGUGUGACAAUGGUGUUUGUGUCCAAACUAUCAAA 116
CGCCAUUAUCACACUAAAUAGCU miR-123
ACAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUA 117 CCGUGAGUAAUAAUGCGC
miR-124a-1 AGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGU 118
CCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAAUGGGGCUG miR-124a-2
AUCAAGAUUAGAGGCUCUGCUCUCCGUGUUCACAGCGGACCUU 119
GAUUUAAUGUCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAG
CGGAGCCUACGGCUGCACUUGAAG miR-124a-3
UGAGGGCCCCUCUGCGUGUUCACAGCGGACCUUGAUUUAAUGU 120
CUAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGAGGCGCCUC C miR-124a
CUCUGCGUGUUCACAGCGGACCUUGAUUUAAUGUCUAUACAAU 121
UAAGGCACGCGGUGAAUGCCAAGAG miR-124b
CUCUCCGUGUUCACAGCGGACCUUGAUUUAAUGUCAUACAAUU 122
AAGGCACGCGGUGAAUGCCAAGAG miR-125a-1
UGCCAGUCUCUAGGUCCCUGAGACCCUUUAACCUGUGAGGACA 123
UCCAGGGUCACAGGUGAGGUUCUUGGGAGCCUGGCGUCUGGCC miR-125a-2
GGUCCCUGAGACCCUUUAACCUGUGAGGACAUCCAGGGUCACA 124
GGUGAGGUUCUUGGGAGCCUGG miR-125b-1
UGCGCUCCUCUCAGUCCCUGAGACCCUAACUUGUGAUGUUUAC 125
CGUUUAAAUCCACGGGUUAGGCUCUUGGGAGCUGCGAGUCGUG CU miR-125b-2
ACCAGACUUUUCCUAGUCCCUGAGACCCUAACUUGUGAGGUAU 126
UUUAGUAACAUCACAAGUCAGGCUCUUGGGACCUAGGCGGAGG GGA miR-126-1
CGCUGGCGACGGGACAUUAUUACUUUUGGUACGCGCUGUGACA 127
CUUCAAACUCGUACCGUGAGUAAUAAUGCGCCGUCCACGGCA miR-126-2
ACAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUA 128 CCGUGAGUAAUAAUGCGC
miR-127-1 UGUGAUCACUGUCUCCAGCCUGCUGAAGCUCAGAGGGCUCUGA 129
UUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGGAA GUCUCAUCAUC miR-127-2
CCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAU 130
CGGAUCCGUCUGAGCUUGGCUGGUCGG miR-128a
UGAGCUGUUGGAUUCGGGGCCGUAGCACUGUCUGAGAGGUUUA 131
CAUUUCUCACAGUGAACCGGUCUCUUUUUCAGCUGCUUC miR-128b
GCCCGGCAGCCACUGUGCAGUGGGAAGGGGGGCCGAUACACUG 132
UACGAGAGUGAGUAGCAGGUCUCACAGUGAACCGGUCUCUUUC
CCUACUGUGUCACACUCCUAAUGG miR-128
GUUGGAUUCGGGGCCGUAGCACUGUCUGAGAGGUUUACAUUUC 133
UCACAGUGAACCGGUCUCUUUUUCAGC miR-129-1
UGGAUCUUUUUGCGGUCUGGGCUUGCUGUUCCUCUCAACAGUA 134
GUCAGGAAGCCCUUACCCCAAAAAGUAUCUA miR-129-2
UGCCCUUCGCGAAUCUUUUUGCGGUCUGGGCUUGCUGUACAUA 135
ACUCAAUAGCCGGAAGCCCUUACCCCAAAAAGCAUUUGCGGAG GGCG miR-130a
UGCUGCUGGCCAGAGCUCUUUUCACAUUGUGCUACUGUCUGCA 136
CCUGUCACUAGCAGUGCAAUGUUAAAAGGGCAUUGGCCGUGUA GUG miR-131-1
GCCAGGAGGCGGGGUUGGUUGUUAUCUUUGGUUAUCUAGCUGU 137
AUGAGUGGUGUGGAGUCUUCAUAAAGCUAGAUAACCGAAAGUA
AAAAUAACCCCAUACACUGCGCAG miR-131-3
CACGGCGCGGCAGCGGCACUGGCUAAGGGAGGCCCGUUUCUCU 138
CUUUGGUUAUCUAGCUGUAUGAGUGCCACAGAGCCGUCAUAAA
GCUAGAUAACCGAAAGUAGAAAUG miR-131
GUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGUAUUGGUCUU 139
CAUAAAGCUAGAUAACCGAAAGUAAAAAC miR-132-1
CCGCCCCCGCGUCUCCAGGGCAACCGUGGCUUUCGAUUGUUACU 140
GUGGGAACUGGAGGUAACAGUCUACAGCCAUGGUCGCCCCGCA GCACGCCCACGCGC
miR-132-2 GGGCAACCGUGGCUUUCGAUUGUUACUGUGGGAACUGGAGGUA 141
ACAGUCUACAGCCAUGGUCGCCC miR-133a-1
ACAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGCCUC 142
UUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAUU GA miR-133a-2
GGGAGCCAAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAU 143
CGACUGUCCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUG UGCAUUGAUGGCGCCG
miR-133 GCUAGAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAU 144
UUGGUCCCCUUCAACCAGCUGUAGC miR-133b
CCUCAGAAGAAAGAUGCCCCCUGCUCUGGCUGGUCAAACGGAA 145
CCAAGUCCGUCUUCCUGAGAGGUUUGGUCCCCUUCAACCAGCU
ACAGCAGGGCUGGCAAUGCCCAGUCCUUGGAGA miR-133b-small
GCCCCCUGCUCUGGCUGGUCAAACGGAACCAAGUCCGUCUUCCU 146
GAGAGGUUUGGUCCCCUUCAACCAGCUACAGCAGGG miR-134-1
CAGGGUGUGUGACUGGUUGACCAGAGGGGCAUGCACUGUGUUC 147
ACCCUGUGGGCCACCUAGUCACCAACCCUC miR-134-2
AGGGUGUGUGACUGGUUGACCAGAGGGGCAUGCACUGUGUUCA 148
CCCUGUGGGCCACCUAGUCACCAACCCU miR-135a-1
AGGCCUCGCUGUUCUCUAUGGCUUUUUAUUCCUAUGUGAUUCU 149
ACUGCUCACUCAUAUAGGGAUUGGAGCCGUGGCGCACGGCGGG GACA miR-135a-2
AGAUAAAUUCACUCUAGUGCUUUAUGGCUUUUUAUUCCUAUGU 150
(miR-135-2) GAUAGUAAUAAAGUCUCAUGUAGGGAUGGAAGCCAUGAAAUAC
AUUGUGAAAAAUCA miR-135 CUAUGGCUUUUUAUUCCUAUGUGAUUCUACUGCUCACUCAUAU
151 AGGGAUUGGAGCCGUGG miR-135b
CACUCUGCUGUGGCCUAUGGCUUUUCAUUCCUAUGUGAUUGCU 152
GUCCCAAACUCAUGUAGGGCUAAAAGCCAUGGGCUACAGUGAG GGGCGAGCUCC miR-136-1
UGAGCCCUCGGAGGACUCCAUUUGUUUUGAUGAUGGAUUCUUA 153
UGCUCCAUCAUCGUCUCAAAUGAGUCUUCAGAGGGUUCU miR-136-2
GAGGACUCCAUUUGUUUUGAUGAUGGAUUCUUAUGCUCCAUCA 154 UCGUCUCAAAUGAGUCUUC
miR-137 CUUCGGUGACGGGUAUUCUUGGGUGGAUAAUACGGAUUACGUU 155
GUUAUUGCUUAAGAAUACGCGUAGUCGAGG miR-138-1
CCCUGGCAUGGUGUGGUGGGGCAGCUGGUGUUGUGAAUCAGGC 156
CGUUGCCAAUCAGAGAACGGCUACUUCACAACACCAGGGCCAC ACCACACUACAGG miR-138-2
CGUUGCUGCAGCUGGUGUUGUGAAUCAGGCCGACGAGCAGCGC 157
AUCCUCUUACCCGGCUAUUUCACGACACCAGGGUUGCAUCA miR-138
CAGCUGGUGUUGUGAAUCAGGCCGACGAGCAGCGCAUCCUCUU 158
ACCCGGCUAUUUCACGACACCAGGGUUG miR-139
GUGUAUUCUACAGUGCACGUGUCUCCAGUGUGGCUCGGAGGCU 159
GGAGACGCGGCCCUGUUGGAGUAAC miR-140
UGUGUCUCUCUCUGUGUCCUGCCAGUGGUUUUACCCUAUGGUA 160
GGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACAG GAUACCGGGGCACC
miR-140as UCCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGU 161
UCUACCACAGGGUAGAACCACGGACAGGA miR-140s
CCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUU 162
CUACCACAGGGUAGAACCACGGACAGG miR-141-1
CGGCCGGCCCUGGGUCCAUCUUCCAGUACAGUGUUGGAUGGUC 163
UAAUUGUGAAGCUCCUAACACUGUCUGGUAAAGAUGGCUCCCG GGUGGGUUC miR-141-2
GGGUCCAUCUUCCAGUACAGUGUUGGAUGGUCUAAUUGUGAAG 164
CUCCUAACACUGUCUGGUAAAGAUGGCCC miR-142
ACCCAUAAAGUAGAAAGCACUACUAACAGCACUGGAGGGUGUA 165
GUGUUUCCUACUUUAUGGAUG miR-143-1
GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUC 166
UGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAG AGAGAAGUUGUUCUGCAGC
miR-143-2 CCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAG 167
AUGAAGCACUGUAGCUCAGG miR-144-1
UGGGGCCCUGGCUGGGAUAUCAUCAUAUACUGUAAGUUUGCGA 168
UGAGACACUACAGUAUAGAUGAUGUACUAGUCCGGGCACCCCC miR-144-2
GGCUGGGAUAUCAUCAUAUACUGUAAGUUUGCGAUGAGACACU 169
ACAGUAUAGAUGAUGUACUAGUC miR-145-1
CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAU 170
GCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGG UU miR-145-2
CUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUG 171
GGGAUUCCUGGAAAUACUGUUCUUGAG miR-146-1
CCGAUGUGUAUCCUCAGCUUUGAGAACUGAAUUCCAUGGGUUG 172
UGUCAGUGUCAGACCUCUGAAAUUCAGUUCUUCAGCUGGGAUA UCUCUGUCAUCGU miR-146-2
AGCUUUGAGAACUGAAUUCCAUGGGUUGUGUCAGUGUCAGACC 173
UGUGAAAUUCAGUUCUUCAGCU miR-147
AAUCUAAAGACAACAUUUCUGCACACACACCAGACUAUGGAAG 174
CCAGUGUGUGGAAAUGCUUCUGCUAGAUU miR-148a
GAGGCAAAGUUCUGAGACACUCCGACUCUGAGUAUGAUAGAAG 175 (miR-148)
UCAGUGCACUACAGAACUUUGUCUC miR-148b
CAAGCACGAUUAGCAUUUGAGGUGAAGUUCUGUUAUACACUCA 176
GGCUGUGGCUCUCUGAAAGUCAGUGCAUCACAGAACUUUGUCU CGAAAGCUUUCUA
miR-148b-small AAGCACGAUUAGCAUUUGAGGUGAAGUUCUGUUAUACACUCAG 177
GCUGUGGCUCUCUGAAAGUCAGUGCAU miR-149-1
GCCGGCGCCCGAGCUCUGGCUCCGUGUCUUCACUCCCGUGCUUG 178
UCCGAGGAGGGAGGGAGGGACGGGGGCUGUGCUGGGGCAGCUG GA miR-149-2
GCUCUGGCUCCGUGUCUUCACUCCCGUGCUUGUCCGAGGAGGG 179 AGGGAGGGAC
miR-150-1 CUCCCCAUGGCCCUGUCUCCCAACCCUUGUACCAGUGCUGGGCU 180
CAGACCCUGGUACAGGCCUGGGGGACAGGGACCUGGGGAC miR-150-2
CCCUGUCUCCCAACCCUUGUACCAGUGCUGGGCUCAGACCCUGG 181
UACAGGCCUGGGGGACAGGG miR-151
UUUCCUGCCCUCGAGGAGCUCACAGUCUAGUAUGUCUCAUCCC 182
CUACUAGACUGAAGCUCCUUGAGGACAGG miR-151-2
CCUGUCCUCAAGGAGCUUCAGUCUAGUAGGGGAUGAGACAUAC 183
UAGACUGUGAGCUCCUCGAGGGCAGG miR-152-1
UGUCCCCCCCGGCCCAGGUUCUGUGAUACACUCCGACUCGGGCU 184
CUGGAGCAGUCAGUGCAUGACAGAACUUGGGCCCGGAAGGACC miR-152-2
GGCCCAGGUUCUGUGAUACACUCCGACUCGGGCUCUGGAGCAG 185
UCAGUGCAUGACAGAACUUGGGCCCCGG miR-153-1-1
CUCACAGCUGCCAGUGUCAUUUUUGUGAUCUGCAGCUAGUAUU 186
CUCACUCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGCAGGUG UGGC miR-153-1-2
UCUCUCUCUCCCUCACAGCUGCCAGUGUCAUUGUCACAAAAGU 187
GAUCAUUGGCAGGUGUGGCUGCUGCAUG miR-153-2-1
AGCGGUGGCCAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUA 188
UGAGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGAAACUGU G miR-153-2-2
CAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUAUGAGCCCAG 189
UUGCAUAGUCACAAAAGUGAUCAUUG miR-154-1
GUGGUACUUGAAGAUAGGUUAUCCGUGUUGCCUUCGCUUUAUU 190
UGUGACGAAUCAUACACGGUUGACCUAUUUUUCAGUACCAA miR-154-2
GAAGAUAGGUUAUCCGUGUUGCCUUCGCUUUAUUUGUGACGAA 191
UCAUACACGGUUGACCUAUUUUU miR-155
CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGAC 192
UCCUACAUAUUAGCAUUAACAG miR-156 = miR-
CCUAACACUGUCUGGUAAAGAUGGCUCCCGGGUGGGUUCUCUC 193 157 = overlap
GGCAGUAACCUUCAGGGAGCCCUGAAGACCAUGGAGGAC miR-141 miR-158-small =
GCCGAGACCGAGUGCACAGGGCUCUGACCUAUGAAUUGACAGC 194 miR-192
CAGUGCUCUCGUCUCCCCUCUGGCUGCCAAUUCCAUAGGUCACA
GGUAUGUUCGCCUCAAUGCCAGC miR-159-1-
UCCCGCCCCCUGUAACAGCAACUCCAUGUGGAAGUGCCCACUGG 195 small
UUCCAGUGGGGCUGCUGUUAUCUGGGGCGAGGGCCA miR-161-small
AAAGCUGGGUUGAGAGGGCGAAAAAGGAUGAGGUGACUGGUCU 196
GGGCUACGCUAUGCUGCGGCGCUCGGG miR-163-1b-
CAUUGGCCUCCUAAGCCAGGGAUUGUGGGUUCGAGUCCCACCC 197 small
GGGGUAAAGAAAGGCCGAAUU miR-163-3-
CCUAAGCCAGGGAUUGUGGGUUCGAGUCCCACCUGGGGUAGAG 198 small
GUGAAAGUUCCUUUUACGGAAUUUUUU miR-162
CAAUGUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAA 199
GAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAA GGUUGACCAUACUCUACAGUUG
miR-175- GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUG 200 small =
miR-224 CAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC miR-177-small
ACGCAAGUGUCCUAAGGUGAGCUCAGGGAGCACAGAAACCUCC 201
AGUGGAACAGAAGGGCAAAAGCUCAUU miR-180-small
CAUGUGUCACUUUCAGGUGGAGUUUCAAGAGUCCCUUCCUGGU 202
UCACCGUCUCCUUUGCUCUUCCACAAC miR-181a
AGAAGGGCUAUCAGGCCAGCCUUCAGAGGACUCCAAGGAACAU 203
UCAACGCUGUCGGUGAGUUUGGGAUUUGAAAAAACCACUGACC
GUUGACUGUACCUUGGGGUCCUUA miR-181b-1
CCUGUGCAGAGAUUAUUUUUUAAAAGGUCACAAUCAACAUUCA 204
UUGCUGUCGGUGGGUUGAACUGUGUGGACAAGCUCACUGAACA
AUGAAUGCAACUGUGGCCCCGCUU miR-181b-2
CUGAUGGCUGCACUCAACAUUCAUUGCUGUCGGUGGGUUUGAG 205
UCUGAAUCAACUCACUGAUCAAUGAAUGCAAACUGCGGACCAA ACA miR-181c
CGGAAAAUUUGCCAAGGGUUUGGGGGAACAUUCAACCUGUCGG 206
UGAGUUUGGGCAGCUCAGGCAAACCAUCGACCGUUGAGUGGAC
CCUGAGGCCUGGAAUUGCCAUCCU miR-182-as
GAGCUGCUUGCCUCCCCCCGUUUUUGGCAAUGGUAGAACUCAC 207
ACUGGUGAGGUAACAGGAUCCGGUGGUUCUAGACUUGCCAACU
AUGGGGCGAGGACUCAGCCGGCAC miR-182
UUUUUGGCAAUGGUAGAACUCACACUGGUGAGGUAACAGGAUC 208
CGGUGGUUCUAGACUUGCCAACUAUGG miR-183
CCGCAGAGUGUGACUCCUGUUCUGUGUAUGGCACUGGUAGAAU 209
UCACUGUGAACAGUCUCAGUCAGUGAAUUACCGAAGGGCCAUA
AACAGAGCAGAGACAGAUCCACGA miR-184-1
CCAGUCACGUCCCCUUAUCACUUUUCCAGCCCAGCUUUGUGACU 210
GUAAGUGUUGGACGGAGAACUGAUAAGGGUAGGUGAUUGA miR-184-2
CCUUAUCACUUUUCCAGCCCAGCUUUGUGACUGUAAGUGUUGG 211
ACGGAGAACUGAUAAGGGUAGG miR-185-1
AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCC 212
CUCCCCAGGGGCUGGCUUUCCUCUGGUCCUUCCCUCCCA miR-185-2
AGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAG 213
GGGCUGGCUUUCCUCUGGUCCUU miR-186-1
UGCUUGUAACUUUCCAAAGAAUUCUCCUUUUGGGCUUUCUGGU 214
UUUAUUUUAAGCCCAAAGGUGAAUUUUUUGGGAAGUUUGAGCU miR-186-2
ACUUUCCAAAGAAUUCUCCUUUUGGGCUUUCUGGUUUUAUUUU 215
AAGCCCAAAGGUGAAUUUUUUGGGAAGU miR-187
GGUCGGGCUCACCAUGACACAGUGUGAGACUCGGGCUACAACA 216
CAGGACCCGGGGCGCUGCUCUGACCCCUCGUGUCUUGUGUUGC AGCCGGAGGGACGCAGGUCCGCA
miR-188-1 UGCUCCCUCUCUCACAUCCCUUGCAUGGUGGAGGGUGAGCUUU 217
CUGAAAACCCCUCCCACAUGCAGGGUUUGCAGGAUGGCGAGCC miR-188-2
UCUCACAUCCCUUGCAUGGUGGAGGGUGAGCUUUCUGAAAACC 218
CCUCCCACAUGCAGGGUUUGCAGGA miR-189-1
CUGUCGAUUGGACCCGCCCUCCGGUGCCUACUGAGCUGAUAUC 219
AGUUCUCAUUUUACACACUGGCUCAGUUCAGCAGGAACAGGAG UCGAGCCCUUGAGCAA
miR-189-2 CUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUUACACAC 220
UGGCUCAGUUCAGCAGGAACAGGAG miR-190-1
UGCAGGCCUCUGUGUGAUAUGUUUGAUAUAUUAGGUUGUUAUU 221
UAAUCCAACUAUAUAUCAAACAUAUUCCUACAGUGUCUUGCC miR-190-2
CUGUGUGAUAUGUUUGAUAUAUUAGGUUGUUAUUUAAUCCAAC 222
UAUAUAUCAAACAUAUUCCUACAG miR-191-1
CGGCUGGACAGCGGGCAACGGAAUCCCAAAAGCAGCUGUUGUC 223
UCCAGAGCAUUCCAGCUGCGCUUGGAUUUCGUCCCCUGCUCUCC UGCCU miR-191-2
AGCGGGCAACGGAAUCCCAAAAGCAGCUGUUGUCUCCAGAGCA 224
UUCCAGCUGCGCUUGGAUUUCGUCCCCUGCU miR-192-2/3
CCGAGACCGAGUGCACAGGGCUCUGACCUAUGAAUUGACAGCC 225
AGUGCUCUCGUCUCCCCUCUGGCUGCCAAUUCCAUAGGUCACA
GGUAUGUUCGCCUCAAUGCCAG
miR-192 GCCGAGACCGAGUGCACAGGGCUCUGACCUAUGAAUUGACAGC 226
CAGUGCUCUCGUCUCCCCUCUGGCUGCCAAUUCCAUAGGUCACA
GGUAUGUUCGCCUCAAUGCCAGC miR-193-1
CGAGGAUGGGAGCUGAGGGCUGGGUCUUUGCGGGCGAGAUGAG 227
GGUGUCGGAUCAACUGGCCUACAAAGUCCCAGUUCUCGGCCCC CG miR-193-2
GCUGGGUCUUUGCGGGCGAGAUGAGGGUGUCGGAUCAACUGGC 228 CUACAAAGUCCCAGU
miR-194-1 AUGGUGUUAUCAAGUGUAACAGCAACUCCAUGUGGACUGUGUA 229
CCAAUUUCCAGUGGAGAUGCUGUUACUUUUGAUGGUUACCAA miR-194-2
GUGUAACAGCAACUCCAUGUGGACUGUGUACCAAUUUCCAGUG 230
GAGAUGCUGUUACUUUUGAU miR-195-1
AGCUUCCCUGGCUCUAGCAGCACAGAAAUAUUGGCACAGGGAA 231
GCGAGUCUGCCAAUAUUGGCUGUGCUGCUCCAGGCAGGGUGGU G miR-195-2
UAGCAGCACAGAAAUAUUGGCACAGGGAAGCGAGUCUGCCAAU 232 AUUGGCUGUGCUGCU
miR-196-1 CUAGAGCUUGAAUUGGAACUGCUGAGUGAAUUAGGUAGUUUCA 233
UGUUGUUGGGCCUGGGUUUCUGAACACAACAACAUUAAACCAC
CCGAUUCACGGCAGUUACUGCUCC miR-196a-1
GUGAAUUAGGUAGUUUCAUGUUGUUGGGCCUGGGUUUCUGAAC 234
ACAACAACAUUAAACCACCCGAUUCAC miR-196a-2
UGCUCGCUCAGCUGAUCUGUGGCUUAGGUAGUUUCAUGUUGUU 235 (miR-196-2)
GGGAUUGAGUUUUGAACUCGGCAACAAGAAACUGCCUGAGUUA
CAUCAGUCGGUUUUCGUCGAGGGC miR-196
GUGAAUUAGGUAGUUUCAUGUUGUUGGGCCUGGGUUUCUGAAC 236
ACAACAACAUUAAACCACCCGAUUCAC miR-196b
ACUGGUCGGUGAUUUAGGUAGUUUCCUGUUGUUGGGAUCCACC 237
UUUCUCUCGACAGCACGACACUGCCUUCAUUACUUCAGUUG miR-197
GGCUGUGCCGGGUAGAGAGGGCAGUGGGAGGUAAGAGCUCUUC 238
ACCCUUCACCACCUUCUCCACCCAGCAUGGCC miR-197-2
GUGCAUGUGUAUGUAUGUGUGCAUGUGCAUGUGUAUGUGUAU 239 GAGUGCAUGCGUGUGUGC
miR-198 UCAUUGGUCCAGAGGGGAGAUAGGUUCCUGUGAUUUUUCCUUC 240
UUCUCUAUAGAAUAAAUGA miR-199a-1
GCCAACCCAGUGUUCAGACUACCUGUUCAGGAGGCUCUCAAUG 241
UGUACAGUAGUCUGCACAUUGGUUAGGC miR-199a-2
AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGA 242
CUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUU
GGUUAGACUGGGCAAGGGAGAGCA miR-199b
CCAGAGGACACCUCCACUCCGUCUACCCAGUGUUUAGACUAUC 243
UGUUCAGGACUCCCAAAUUGUACAGUAGUCUGCACAUUGGUUA
GGCUGGGCUGGGUUAGACCCUCGG miR-199s
GCCAACCCAGUGUUCAGACUACCUGUUCAGGAGGCUCUCAAUG 244
UGUACAGUAGUCUGCACAUUGGUUAGGC miR-200a
GCCGUGGCCAUCUUACUGGGCAGCAUUGGAUGGAGUCAGGUCU 245
CUAAUACUGCCUGGUAAUGAUGACGGC miR-200b
CCAGCUCGGGCAGCCGUGGCCAUCUUACUGGGCAGCAUUGGAU 246
GGAGUCAGGUCUCUAAUACUGCCUGGUAAUGAUGACGGCGGAG CCCUGCACG miR-200c
CCCUCGUCUUACCCAGCAGUGUUUGGGUGCGGUUGGGAGUCUC 247
UAAUACUGCCGGGUAAUGAUGGAGG miR-202
GUUCCUUUUUCCUAUGCAUAUACUUCUUUGAGGAUCUGGCCUA 248
AAGAGGUAUAGGGCAUGGGAAGAUGGAGC miR-203
GUGUUGGGGACUCGCGCGCUGGGUCCAGUGGUUCUUAACAGUU 249
CAACAGUUCUGUAGCGCAAUUGUGAAAUGUUUAGGACCACUAG
ACCCGGCGGGCGCGGCGACAGCGA miR-204
GGCUACAGUCUUUCUUCAUGUGACUCGUGGACUUCCCUUUGUC 250
AUCCUAUGCCUGAGAAUAUAUGAAGGAGGCUGGGAAGGCAAAG
GGACGUUCAAUUGUCAUCACUGGC miR-205
AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUC 251
CACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGA
AGUUCAGGAGGCAUGGAGCUGACA miR-206-1
UGCUUCCCGAGGCCACAUGCUUCUUUAUAUCCCCAUAUGGAUU 252
ACUUUGCUAUGGAAUGUAAGGAAGUGUGUGGUUUCGGCAAGUG miR-206-2
AGGCCACAUGCUUCUUUAUAUCCCCAUAUGGAUUACUUUGCUA 253
UGGAAUGUAAGGAAGUGUGUGGUUUU miR-208
UGACGGGCGAGCUUUUGGCCCGGGUUAUACCUGAUGCUCACGU 254
AUAAGACGAGCAAAAAGCUUGUUGGUCA miR-210
ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCA 255
CACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGA UCUGUGCCUGGGCAGCGCGACCC
miR-211 UCACCUGGCCAUGUGACUUGUGGGCUUCCCUUUGUCAUCCUUC 256
GCCUAGGGCUCUGAGCAGGGCAGGGACAGCAAAGGGGUGCUCA
GUUGUCACUUCCCACAGCACGGAG miR-212
CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGA 257
CUGCUUACUGCCCGGGCCGCCCUCAGUAACAGUCUCCAGUCACG GCCACCGACGCCUGGCCCCGCC
miR-213-2 CCUGUGCAGAGAUUAUUUUUUAAAAGGUCACAAUCAACAUUCA 258
UUGCUGUCGGUGGGUUGAACUGUGUGGACAAGCUCACUGAACA
AUGAAUGCAACUGUGGCCCCGCUU miR-213
GAGUUUUGAGGUUGCUUCAGUGAACAUUCAACGCUGUCGGUGA 259
GUUUGGAAUUAAAAUCAAAACCAUCGACCGUUGAUUGUACCCU AUGGCUAACCAUCAUCUACUCC
miR-214 GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACU 260
UGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACA
GGCAGUCACAUGACAACCCAGCCU miR-215
AUCAUUCAGAAAUGGUAUACAGGAAAAUGACCUAUGAAUUGAC 261
AGACAAUAUAGCUGAGUUUGUCUGUCAUUUCUUUAGGCCAAUA
UUCUGUAUGACUGUGCUACUUCAA miR-216
GAUGGCUGUGAGUUGGCUUAAUCUCAGCUGGCAACUGUGAGAU 262
GUUCAUACAAUCCCUCACAGUGGUCUCUGGGAUUAUGCUAAAC
AGAGCAAUUUCCUAGCCCUCACGA miR-217
AGUAUAAUUAUUACAUAGUUUUUGAUGUCGCAGAUACUGCAUC 263
AGGAACUGAUUGGAUAAGAAUCAGUCACCAUCAGUUCCUAAUG
CAUUGCCUUCAGCAUCUAAACAAG miR-218-1
GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAU 264
GUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCA
UGGAACGUCACGCAGCUUUCUACA miR-218-2
GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAU 265
GUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCG
CGGAAAGCACCGUGCUCUCCUGCA miR-219
CCGCCCCGGGCCGCGGCUCCUGAUUGUCCAAACGCAAUUCUCGA 266
GUCUAUGGCUCCGGCCGAGAGUUGAGUCUGGACGUCCCGAGCC GCCGCCCCCAAACCUCGAGCGGG
miR-219-1 CCGCCCCGGGCCGCGGCUCCUGAUUGUCCAAACGCAAUUCUCGA 267
GUCUAUGGCUCCGGCCGAGAGUUGAGUCUGGACGUCCCGAGCC GCCGCCCCCAAACCUCGAGCGGG
miR-219-2 ACUCAGGGGCUUCGCCACUGAUUGUCCAAACGCAAUUCUUGUA 268
CGAGUCUGCGGCCAACCGAGAAUUGUGGCUGGACAUCUGUGGC UGAGCUCCGGG miR-220
GACAGUGUGGCAUUGUAGGGCUCCACACCGUAUCUGACACUUU 269
GGGCGAGGGCACCAUGCUGAAGGUGUUCAUGAUGCGGUCUGGG
AACUCCUCACGGAUCUUACUGAUG miR-221
UGAACAUCCAGGUCUGGGGCAUGAACCUGGCAUACAAUGUAGA 270
UUUCUGUGUUCGUUAGGCAACAGCUACAUUGUCUGCUGGGUUU
CAGGCUACCUGGAAACAUGUUCUC miR-222
GCUGCUGGAAGGUGUAGGUACCCUCAAUGGCUCAGUAGCCAGU 271
GUAGAUCCUGUCUUUCGUAAUCAGCAGCUACAUCUGGCUACUG
GGUCUCUGAUGGCAUCUUCUAGCU miR-223
CCUGGCCUCCUGCAGUGCCACGCUCCGUGUAUUUGACAAGCUG 272
AGUUGGACACUCCAUGUGGUAGAGUGUCAGUUUGUCAAAUACC
CCAAGUGCGGCACAUGCUUACCAG miR-224
GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUG 273
CAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC miR-294-1
CAAUCUUCCUUUAUCAUGGUAUUGAUUUUUCAGUGCUUCCCUUU 274 (chr16)
UGUGUGAGAGAAGAUA miR-296
AGGACCCUUCCAGAGGGCCCCCCCUCAAUCCUGUUGUGCCUAAU 275
UCAGAGGGUUGGGUGGAGGCUCUCCUGAAGGGCUCU miR-299
AAGAAAUGGUUUACCGUCCCACAUACAUUUUGAAUAUGUAUGU 276
GGGAUGGUAAACCGCUUCUU miR-301
ACUGCUAACGAAUGCUCUGACUUUAUUGCACUACUGUACUUUAC 277
AGCUAGCAGUGCAAUAGUAUUGUCAAAGCAUCUGAAAGCAGG miR-302a
CCACCACUUAAACGUGGAUGUACUUGCUUUGAAACUAAAGAAGU 278
AAGUGCUUCCAUGUUUUGGUGAUGG miR-302b
GCUCCCUUCAACUUUAACAUGGAAGUGCUUUCUGUGACUUUAAA 279
AGUAAGUGCUUCCAUGUUUUAGUAGGAGU miR-302c
CCUUUGCUUUAACAUGGGGGUACCUGCUGUGUGAAACAAAAGU 280
AAGUGCUUCCAUGUUUCAGUGGAGG miR-302d
CCUCUACUUUAACAUGGAGGCACUUGCUGUGACAUGACAAAAAU 281
AAGUGCUUCCAUGUUUGAGUGUGG miR-320
GCUUCGCUCCCCUCCGCCUUCUCUUCCCGGUUCUUCCCGGAGUC 282
GGGAAAAGCUGGGUUGAGAGGGCGAAAAAGGAUGAGGU miR-321
UUGGCCUCCUAAGCCAGGGAUUGUGGGUUCGAGUCCCACCCGGG 283 GUAAAGAAAGGCCGA
miR-323 UUGGUACUUGGAGAGAGGUGGUCCGUGGCGCGUUCGCUUUAUU 284
UAUGGCGCACAUUACACGGUCGACCUCUUUGCAGUAUCUAAUC miR-324
CUGACUAUGCCUCCCCGCAUCCCCUAGGGCAUUGGUGUAAAGCU 285
GGAGACCCACUGCCCCAGGUGCUGCUGGGGGUUGUAGUC miR-325
AUACAGUGCUUGGUUCCUAGUAGGUGUCCAGUAAGUGUUUGUG 286
ACAUAAUUUGUUUAUUGAGGACCUCCUAUCAAUCAAGCACUGUG CUAGGCUCUGG miR-326
CUCAUCUGUCUGUUGGGCUGGAGGCAGGGCCUUUGUGAAGGCGG 287
GUGGUGCUCAGAUCGCCUCUGGGCCCUUCCUCCAGCCCCGAGGC GGAUUCA miR-328
UGGAGUGGGGGGGCAGGAGGGGCUCAGGGAGAAAGUGCAUACA 288
GCCCCUGGCCCUCUCUGCCCUUCCGUCCCCUG miR-330
CUUUGGCGAUCACUGCCUCUCUGGGCCUGUGUCUUAGGCUCUGC 289
AAGAUCAACCGAGCAAAGCACACGGCCUGCAGAGAGGCAGCGCU CUGCCC miR-331
GAGUUUGGUUUUGUUUGGGUUUGUUCUAGGUAUGGUCCCAGGG 290
AUCCCAGAUCAAACCAGGCCCCUGGGCCUAUCCUAGAACCAACC UAAGCUC miR-335
UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUC 291
AUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCU AUAUUCA miR-337
GUAGUCAGUAGUUGGGGGGUGGGAACGGCUUCAUACAGGAGUU 292
GAUGCACAGUUAUCCAGCUCCUAUAUGAUGCCUUUCUUCAUCCC CUUCAA miR-338
UCUCCAACAAUAUCCUGGUGCUGAGUGAUGACUCAGGCGACUCC 293
AGCAUCAGUGAUUUUGUUGAAGA miR-339
CGGGGCGGCCGCUCUCCCUGUCCUCCAGGAGCUCACGUGUGCCU 294
GCCUGUGAGCGCCUCGACGACAGAGCCGGCGCCUGCCCCAGUGU CUGCGC miR-340
UUGUACCUGGUGUGAUUAUAAAGCAAUGAGACUGAUUGUCAUA 295
UGUCGUUUGUGGGAUCCGUCUCAGUUACUUUAUAGCCAUACCUG GUAUCUUA miR-342
GAAACUGGGCUCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGA 296
CAUGGUUAAUGGAAUUGUCUCACACAGAAAUCGCACCCGUCACC UUGGCCUACUUA
miR-345 ACCCAAACCCUAGGUCUGCUGACUCCUAGUCCAGGGCUCGUGAU 297
GGCUGGUGGGCCCUGAACGAGGGGUCUGGAGGCCUGGGUUUGA AUAUCGACAGC miR-346
GUCUGUCUGCCCGCAUGCCUGCCUCUCUGUUGCUCUGAAGGAGG 298
CAGGGGCUGGGCCUGCAGCUGCCUGGGCAGAGCGGCUCCUGC miR-367
CCAUUACUGUUGCUAAUAUGCAACUCUGUUGAAUAUAAAUUGG 299
AAUUGCACUUUAGCAAUGGUGAUGG miR-368
AAAAGGUGGAUAUUCCUUCUAUGUUUAUGUUAUUUAUGGUUAA 300
ACAUAGAGGAAAUUCCACGUUUU miR-369
UUGAAGGGAGAUCGACCGUGUUAUAUUCGCUUUAUUGACUUCG 301
AAUAAUACAUGGUUGAUCUUUUCUCAG miR-370
AGACAGAGAAGCCAGGUCACGUCUCUGCAGUUACACAGCUCACG 302
AGUGCCUGCUGGGGUGGAACCUGGUCUGUCU miR-371
GUGGCACUCAAACUGUGGGGGCACUUUCUGCUCUCUGGUGAAAG 303
UGCCGCCAUCUUUUGAGUGUUAC miR-372
GUGGGCCUCAAAUGUGGAGCACUAUUCUGAUGUCCAAGUGGAA 304
AGUGCUGCGACAUUUGAGCGUCAC miR-373
GGGAUACUCAAAAUGGGGGCGCUUUCCUUUUUGUCUGUACUGG 305
GAAGUGCUUCGAUUUUGGGGUGUCCC miR-374
UACAUCGGCCAUUAUAAUACAACCUGAUAAGUGUUAUAGCACUU 306
AUCAGAUUGUAUUGUAAUUGUCUGUGUA miR-hes1
AUGGAGCUGCUCACCCUGUGGGCCUCAAAUGUGGAGGAACUAUU 307
CUGAUGUCCAAGUGGAAAGUGCUGCGACAUUUGAGCGUCACCGG UGACGCCCAUAUCA
miR-hes2 GCAUCCCCUCAGCCUGUGGCACUCAAACUGUGGGGGCACUUUCU 308
GCUCUCUGGUGAAAGUGCCGCCAUCUUUUGAGUGUUACCGCUUG AGAAGACUCAACC miR-hes3
CGAGGAGCUCAUACUGGGAUACUCAAAAUGGGGGCGCUUUCCUU 309
UUUGUCUGUUACUGGGAAGUGCUUCGAUUUUGGGGUGUCCCUG UUUGAGUAGGGCAUC *An
underlined sequence within a precursor sequence corresponds to a
mature processed miR transcript (see Table 1b). Some precursor
sequences have two underlined sequences denoting two different
mature miRs that are derived from the same precursor. All sequences
are human.
TABLE-US-00002 TABLE 1b Human Mature microRNA Sequences. Mature
miRNA Mature miRNA Sequence Corresponding precursor Name (5' to 3')
SEQ ID NO. microRNA(s); see Table 1a let-7a ugagguaguagguuguauaguu
310 let-7a-1; let-7a-2; let-7a-3; let- 7a-4 let-7b
ugagguaguagguugugugguu 311 let-7b let-7c ugagguaguagguuguaugguu 312
let-7c let-7d agagguaguagguugcauagu 313 let-7d; let-7d-v1 let-7e
ugagguaggagguuguauagu 314 let-7e let-7f ugagguaguagauugauaguu 315
let-7f-1; let-7f-2-1; let-7f-2-2 let-7g ugagguaguaguuuguacagu 316
let-7g let-7i ugagguaguaguuugugcu 317 let-7i miR-1
uggaauguaaagaaguaugua 318 miR-1b; miR-1b-1; miR-1b-2 miR-7
uggaagacuagugauuuuguu 319 miR-7-1; miR-7-1a; miR-7-2; miR-7-3 miR-9
ucuuugguuaucuagcuguauga 320 miR-9-1; miR-9-2; miR-9-3 miR-9*
uaaagcuagauaaccgaaagu 321 miRr-9-1; miR-9-2; miR-9-3 miR-10a
uacccuguagauccgaauuugug 322 miR-10a miR-10b uacccuguagaaccgaauuugu
323 miR-10b miR-15a uagcagcacauaaugguuugug 324 miR-15a; miR-15a-2
miR-15b uagcagcacaucaugguuuaca 325 miR-15b miR-16
uagcagcacguaaauauuggcg 326 miR-16-1; miR-16-2; miR-16-13 miR-l7-5p
caaagugcuuacagugcagguagu 327 miR-17 miR-17-3p acugcagugaaggcacuugu
328 miR-17 miR-18 uaaggugcaucuagugcagaua 329 miR-18; miR-18-13
miR-19a ugugcaaaucuaugcaaaacuga 330 miR-19a; miR-19a-13 miR-19b
ugugcaaauccaugcaaaacuga 331 miR-19b-1; miR-19b-2 miR-20
uaaagugcuuauagugcaggua 332 miR-20 (miR-20a) miR-21
uagcuuaucagacugauguuga 333 miR-21; miR-21-17 miR-22
aagcugccaguugaagaacugu 334 miR-22 miR-23a aucacauugccagggauuucc 335
miR-23a miR-23b aucacauugccagggauuaccac 336 miR-23b miR-24
uggcucaguucagcaggaacag 337 miR-24-1; miR-24-2; miR-24-19; miR-24-9
miR-25 cauugcacuugucucggucuga 338 miR-25 miR-26a
uucaaguaauccaggauaggcu 339 miR-26a; miR-26a-1; miR-26a-2 miR-26b
uucaaguaauucaggauaggu 340 miR-26b miR-27a uucacaguggcuaaguuccgcc
341 miR-27a miR-27b uucacaguggcuaaguucug 342 miR-27b-1; miR-27b-2
miR-28 aaggagcucacagucuauugag 343 miR-28 miR-29a
cuagcaccaucugaaaucgguu 344 miR-29a-2; miR-29a miR-29b
uagcaccauuugaaaucagu 345 miR-29b-1; miR-29b-2 miR-29c
uagcaccauuugaaaucgguua 346 miR-29c miR-30a-5p
uguaaacauccucgacuggaagc 347 miR-30a miR-30a-3p
cuuucagucggauguuugcagc 348 miR-30a miR-30b uguaaacauccuacacucagc
349 miR-30b-1; miR-30b-2 miR-30c uguaaacauccuacacucucagc 350
miR-30c miR-30d uguaaacauccccgacuggaag 351 miR-30d miR-30e
uguaaacauccuugacugga 352 miR-30e miR-31 ggcaagaugcuggcauagcug 353
miR-31 miR-32 uauugcacauuacuaaguugc 354 miR-32 miR-33
gugcauuguaguugcauug 355 miR-33; miR-33b miR-34a
uggcagugucuuagcugguugu 356 miR-34a miR-34b aggcagugucauuagcugauug
357 miR-34b miR-34c aggcaguguaguuagcugauug 358 miR-34c miR-92
uauugcacuugucccggccugu 359 miR-92-2; miR-92-1 miR-93
aaagugcuguucgugcagguag 360 miR-93-1; miR-93-2 miR-95
uucaacggguauuuauugagca 361 miR-95 miR-96 uuuggcacuagcacauuuuugc 362
miR-96 miR-98 ugagguaguaaguuguauuguu 363 miR-98 miR-99a
aacccguagauccgaucuugug 364 miR-99a miR-99b cacccguagaaccgaccuugcg
365 miR-99b miR-100 uacaguacugugauaacugaag 366 miR-100 miR-101
uacaguacugugauaacugaag 367 miR-101-1; miR-101-2 miR-103
agcagcauuguacagggcuauga 368 miR-103-1 miR-105 ucaaaugcucagacuccugu
369 miR-105 miR-106-a aaaagugcuuacagugcagguagc 370 miR-106-a
miR-106-b uaaagugcugacagugcagau 371 miR-106-b miR-107
agcagcauuguacagggcuauca 372 miR-107 miR-122a
uggagugugacaaugguguuugu 373 miR-122a-1; miR-122a-2 miR-124a
uuaaggcacgcggugaaugcca 374 miR-124a-1; miR-124a-2; miR- 124a-3
miR-125a ucccugagacccuuuaaccugug 375 miR-125a-1; miR-125a-2
miR-125b ucccugagacccuaacuuguga 376 miR-125b-1; miR-125b-2 miR-126*
cauuauuacuuuugguacgcg 377 miR-126-1; miR-126-2 miR-126
ucguaccgugaguaauaaugc 378 miR-126-1; miR-126-2 miR-127
ucggauccgucugagcuuggcu 379 miR-12-1; miR-127-2 miR-128a
ucacagugaaccggucucuuuu 380 miR-128; miR-128a miR-128b
ucacagugaaccggucucuuuc 381 miR-128b miR-129 cuuuuugcggucugggcuugc
382 miR-129-1; miR-129-2 miR-130a cagugcaauguuaaaagggc 383 miR-130a
miR-130b cagugcaaugaugaaagggcau 384 miR-130b miR-132
uaacagucuacagccauggucg 385 miR-132-1 miR-133a
uugguccccuucaaccagcugu 386 miR-133a-1; miR-133a-2 miR-133b
uugguccccuucaaccagcua 387 miR-133b miR-134 ugugacugguugaccagaggg
388 miR-134-1; miR-134-2 miR-135a uauggcuuuuuauuccuauguga 389
miR-135a; miR-135a-2 (miR- 135-2) miR-135b uauggcuuuucauuccuaugug
390 miR-135b miR-136 acuccauuuguuuugaugaugga 391 miR-136-1;
miR-136-2 miR-137 uauugcuuaagaauacgcguag 392 miR-137 miR-138
agcugguguugugaauc 393 miR-138-1; miR-138-2 miR-139
ucuacagugcacgugucu 394 miR-139 miR-140 agugguuuuacccuaugguag 395
miR-140; miR-140as; miR-140s miR-141 aacacugucugguaaagaugg 396
miR-141-1; miR-141-2 miR-142-3p uguaguguuuccuacuuuaugga 397 miR-142
miR-142-5p cauaaaguagaaagcacuac 398 miR-142 miR-143
ugagaugaagcacuguagcuca 399 miR-143-1 miR-144 uacaguauagaugauguacuag
400 miR-144-1; miR-144-2 miR-145 guccaguuuucccaggaaucccuu 401
miR-145-1; miR-145-2 miR-146 ugagaacugaauuccauggguu 402 miR-146-1;
miR-146-2 miR-147 guguguggaaaugcuucugc 403 miR-147 miR-148a
ucagugcacuacagaacuuugu 404 miR-148a (miR-148) miR-148b
ucagugcaucacagaacuuugu 405 miR-148b miR-149 ucuggcuccgugucuucacucc
406 miR-149 miR-150 ucucccaacccuuguaccagug 407 miR-150-1; miR-150-2
miR-151 acuagacugaagcuccuugagg 408 miR-151 miR-152
ucagugcaugacagaacuugg 409 miR-152-1; miR-152-2 miR-153
uugcauagucacaaaaguga 410 miR-153-1-1; miR-153-1-2; miR-153-2-1;
miR-153-2-2 miR-154 uagguuauccguguugccuucg 411 miR-154-1; miR-154-2
miR-154* aaucauacacgguugaccuauu 412 miR-154-1; miR-154-2 miR-155
uuaaugcuaaucgugauagggg 413 miR-155 miR-181a aacauucaacgcugucggugagu
414 miR-181a miR-181b aacauucauugcugucgguggguu 415 miR-181b-1;
miR-181b-2 miR-181c aacauucaaccugucggugagu 416 miR-181c miR-182
uuuggcaaugguagaacucaca 417 miR-182; miR-182as miR-182*
ugguucuagacuugccaacua 418 miR-182; miR-182as miR-183
uauggcacugguagaauucacug 419 miR-183 miR-184 uggacggagaacugauaagggu
420 miR-184-1; miR-184-2 miR-185 uggagagaaaggcaguuc 421 miR-185-1;
miR-185-2 miR-186 caaagaauucuccuuuugggcuu 422 miR-186-1; miR-186-2
miR-187 ucgugucuuguguugcagccg 423 miR-187 miR-188
caucccuugcaugguggagggu 424 miR-188
miR-189 gugccuacugagcugauaucagu 425 miR-189-1; miR-189-2 miR-190
ugauauguuugauauauuaggu 426 miR-190-1; miR-190-2 miR-191
caacggaaucccaaaagcagcu 427 miR-191-1; miR-191-2 miR-192
cugaccuaugaauugacagcc 428 miR-192 miR-193 aacuggccuacaaagucccag 429
miR-193-1; miR-193-2 miR-194 uguaacagcaacuccaugugga 430 miR-194-1;
miR-194-2 miR-195 uagcagcacagaaauauuggc 431 miR-195-1; miR-195-2
miR-196a uagguaguuucauguuguugg 432 miR-196a; miR-196a-2 (miR196
miR-196b uagguaguuuccuguuguugg 433 miR-196b miR-197
uucaccaccuucuccacccagc 434 miR-197 miR-198 gguccagaggggagauagg 435
miR-198 miR-199a cccaguguucagacuaccuguuc 436 miR-199a-1; miR-199a-2
miR-199a* uacaguagucugcacauugguu 437 miR-199a-1; miR-199a-2; miR-
199s; miR-199b miR-199b cccaguguuuagacuaucuguuc 438 miR-199b
miR-200a uaacacugucugguaacgaugu 439 miR-200a miR-200b
cucuaauacugccugguaaugaug 440 miR-200b miR-200c
aauacugccggguaaugaugga 441 miR-200c miR-202 agagguauagggcaugggaaga
442 miR-202 miR-203 gugaaauguuuaggaccacuag 443 miR-203 miR-204
uucccuuugucauccuaugccu 444 miR-204 miR-205 uccuucauuccaccggagucug
445 miR-205 miR-206 uggaauguaaggaagugugugg 446 miR-206-1; miR-206-2
miR-208 auaagacgagcaaaaagcuugu 447 miR-208 miR-210
cugugcgugugacagcggcug 448 miR-210 miR-211 uucccuuugucauccuucgccu
449 miR-211 miR-212 uaacagucuccagucacggcc 450 miR-212 miR-213
accaucgaccguugauuguacc 451 miR-213 miR-214 acagcaggcacagacaggcag
452 miR-214 miR-215 augaccuaugaauugacagac 453 miR-215 miR-216
uaaucucagcuggcaacugug 454 miR-216 miR-217 uacugcaucaggaacugauuggau
455 miR-217 miR-218 uugugcuugaucuaaccaugu 456 miR-218-1; miR-218-2
miR-219 ugauuguccaaacgcaauucu 457 miR-219; miR-219-1; miR-219-2
miR-220 ccacaccguaucugacacuuu 458 miR-220 miR-221
agcuacauugucugcuggguuuc 459 miR-221 miR-222
agcuacaucuggcuacugggucuc 460 miR-222 miR-223 ugucaguuugucaaauacccc
461 miR-223 miR-224 caagucacuagugguuccguuua 462 miR-224 miR-296
agggcccccccucaauccugu 463 miR-296 miR-299 ugguuuaccgucccacauacau
464 miR-299 miR-301 cagugcaauaguauugucaaagc 465 miR-301 miR-302a
uaagugcuuccauguuuugguga 466 miR-302a miR-302b*
acuuuaacauggaagugcuuucu 467 miR-302b miR-302b
uaagugcuuccauguuuuaguag 468 miR-302b miR-302c*
uuuaacauggggguaccugcug 469 miR-302c miR-302c
uaagugcuuccauguuucagugg 470 miR-302c miR-302d
uaagugcuuccauguuugagugu 471 miR-302d miR-320
aaaagcuggguugagagggcgaa 472 miR-320 miR-321 uaagccagggauuguggguuc
473 miR-321 miR-323 gcacauuacacggucgaccucu 474 miR-323 miR-324-5p
cgcauccccuagggcauuggugu 475 miR-324 miR-324-3p
ccacugccccaggugcugcugg 476 miR-324 miR-325 ccuaguagguguccaguaagu
477 miR-325 miR-326 ccucugggcccuuccuccag 478 miR-326 miR-328
cuggcccucucugcccuuccgu 479 miR-328 miR-330 gcaaagcacacggccugcagaga
480 miR-330 miR-331 gccccugggccuauccuagaa 481 miR-331 miR-335
ucaagagcaauaacgaaaaaugu 482 miR-335 miR-337 uccagcuccuauaugaugccuuu
483 miR-337 miR-338 uccagcaucagugauuuuguuga 484 miR-338 miR-339
ucccuguccuccaggagcuca 485 miR-339 miR-340 uccgucucaguuacuuuauagcc
486 miR-340 miR-342 ucucacacagaaaucgcacccguc 487 miR-342 miR-345
ugcugacuccuaguccagggc 488 miR-345 miR-346 ugucugcccgcaugccugccucu
489 miR-346 miR-367 aauugcacuuuagcaaugguga 490 miR-367 miR-368
acauagaggaaauuccacguuu 491 miR-368 miR-369 aauaauacaugguugaucuuu
492 miR-369 miR-370 gccugcugggguggaaccugg 493 miR-370 miR-371
gugccgccaucuuuugagugu 494 miR-371 miR-372 aaagugcugcgacauuugagcgu
495 miR-372 miR-373* acucaaaaugggggcgcuuucc 496 miR-373 miR-373
gaagugcuucgauuuuggggugu 497 miR-373 miR-374 uuauaauacaaccugauaagug
498 miR-374
[0046] The present invention encompasses methods of diagnosing
whether a subject has, or is at risk for developing, a solid
cancer, comprising measuring the level of at least one miR gene
product in a test sample from the subject and comparing the level
of the miR gene product in the test sample to the level of a
corresponding miR gene product in a control sample. As used herein,
a "subject" can be any mammal that has, or is suspected of having,
a solid cancer. In a preferred embodiment, the subject is a human
who has, or is suspected of having, a solid cancer.
[0047] In one embodiment, the at least one miR gene product
measured in the test sample is selected from the group consisting
of miR-21, miR-17-5p, miR-191, miR-29b-2, miR-223, miR-128b,
miR-199a-1, miR-24-1, miR-24-2, miR-146, miR-155, miR-181b-1,
miR-20a, miR-107, miR-32, miR-92-2, miR-214, miR-30c, miR-25,
miR-221, miR-106a and combinations thereof. In a particular
embodiment, the miR gene product is miR-21, miR-191 or miR-17-5p.
In another embodiment, the miR gene product is not miR-15a or
miR-16-1. In an additional embodiment, the miR gene product is not
miR 159-1 or miR-192. In an additional embodiment, the miR gene
product is not miR-186, miR-101-1, miR-194, miR-215, miR-106b,
miR-25, miR-93, miR-29b, miR-29a, miR-96, miR-182s, miR-182as,
miR-183, miR-129-1, let-7a-1, let-7d, let-7f-1, miR-23b, miR-24-1,
miR-27b, miR-32, miR-159-1, miR-192, miR-125b-1, let-7a-2, miR-100,
miR-196-2, miR-148b, miR-190, miR-21, miR-301, miR-142s, miR-142as,
miR-105-1, or miR-175. In a further embodiment, the miR gene
product is not miR-21, miR-301, miR-142as, miR-142s, miR-194,
miR-215, or miR-32. In another embodiment, the miR gene product is
not miR-148, miR-10a, miR-196-1, miR-152, miR-196-2, miR-148b,
miR-10b, miR-129-1, miR-153-2, miR-202, miR-139, let-7a, let-7f, or
let-7d. In yet another embodiment, the miR gene product is not
miR-15a, miR-16-1, miR-182, miR-181, miR-30, miR-15a, miR-16-1,
miR-15b, miR-16-2, miR-195, miR-34, miR-153, miR-21, miR-217,
miR-205, miR-204, miR-211, miR-143, miR-96, miR-103, miR-107,
miR-129, miR-9, miR-137, miR-217, miR-186.
[0048] The solid cancer can be any cancer that arises from organs
and solid tissues. Such cancers are typically associated with the
formation and/or presence of tumor masses and can be carcinomas,
sarcomas and lymphomas. Specific examples of solid cancers to be
diagnosed by the methods of the invention include, but are not
limited to, colon cancer, rectal cancer, stomach (gastric) cancer,
pancreatic cancer, breast cancer, lung cancer, prostate cancer,
bronchial cancer, testicular cancer, ovarian cancer, uterine
cancer, penile cancer, melanoma and other skin cancers, liver
cancer, esophogeal cancer, cancers of the oral cavity and pharynx
(e.g., tongue cancer, mouth cancer), cancers of the digestive
system (e.g., intestinal cancer, gall bladder cancer), bone and
joint cancers, cancers of the endocrine system (e.g., thyroid
cancer), brain cancer, eye cancer, cancers of the urinary system
(e.g., kidney cancer, urinary bladder cancer), Hodgkin disease and
non-Hodgkin lymphoma. In particular embodiments, the solid cancer
is not one or more of breast cancer, lung cancer, prostate cancer,
pancreatic cancer or gastrointestinal cancer.
[0049] In one embodiment, the solid cancer is breast cancer or lung
cancer and the at least one miR gene product measured in the test
sample is selected from the group consisting of miR-210, miR-213
and a combination thereof.
[0050] In a further embodiment, the solid cancer is colon cancer,
stomach cancer, prostate cancer or pancreas cancer and the at least
one miR gene product measured in the test sample is miR-218-2.
[0051] In a certain embodiment of the invention, the solid cancer
is breast cancer and the at least one miR gene product measured in
the test sample is selected from the group consisting of
miR-125b-1, miR-125b-2, miR-145, miR-21 and combinations thereof.
In a related embodiment, the solid cancer is breast cancer and the
at least one miR gene product in the test sample is selected from
the group consisting of miR-21, miR-29b-2, miR-146, miR-125b-2,
miR-125b-1, miR-10b, miR-145, miR-181a, miR-140, miR-213, miR-29a
prec, miR-181b-1, miR-199b, miR-29b-1, miR-130a, miR-155, let-7a-2,
miR-205, miR-29c, miR-224, miR-100, miR-31, miR-30c, miR-17-5p,
miR-210, miR-122a, miR-16-2 and combinations thereof. In a related
embodiment, the solid cancer is breast cancer and the at least one
miR gene product is not miR-15a or miR-16-1. In a further
embodiment, the solid cancer is breast cancer and the at least one
miR gene product is not miR-145, miR-21, miR-155, miR-10b,
miR-125b-1, miR-125b-2, let7a-2, let7a-3, let-7d, miR-122a,
miR-191, miR-206, miR-210, let-7i, miR-009-1 (miR131-1), miR-34
(miR-170), miR-102 (miR-29b), miR-123 (miR-126), miR-140-as,
miR-125a, miR-194, miR-204, miR-213, let-7f-2, miR-101, miR-128b,
miR-136, miR-143, miR-149, miR-191, miR-196-1, miR-196-2, miR-202,
miR-103-1, or miR-30c. In another embodiment, the solid cancer is
breast cancer and the miR gene product is not miR-21, miR-125b-1,
let-7a-2, let-7i, miR-100, let-7g, miR-31, miR-32a-1, miR-33b,
miR-34a-2, miR-101-1, miR-135-1, miR-142as, miR-142s, miR-144,
miR-301, miR-29c, miR-30c, miR-106a, or miR-29b-1. In yet another
embodiment, the solid cancer is breast cancer and the miR gene
product is not miR-159-1 or miR-192. In an additional embodiment,
the solid cancer is breast cancer and the miR gene product is not
miR-186, miR-101-1, miR-194, miR-215, miR-106b, miR-25, miR-93,
miR-29b, miR-29a, miR-96, miR-182s, miR-182as, miR-183, miR-129-1,
let-7a-1, let-7d, let-7f-1, miR-23b, miR-24-1, miR-27b, miR-32,
miR-159-1, miR-192, miR-125b-1, let-7a-2, miR-100, miR-196-2,
miR-148b, miR-190, miR-21, miR-301, miR-142s, miR-142as, miR-105-1,
or miR-175. In a further embodiment, the solid cancer is breast
cancer and the miR gene product is not miR-21, miR-301, miR-142as,
miR-142s, miR-194, miR-215, or miR-32. In another embodiment, the
solid cancer is breast cancer and the miR gene product is not
miR-148, miR-10a, miR-196-1, miR-152, miR-196-2, miR-148b, miR-10b,
miR-129-1, miR-153-2, miR-202, miR-139, let-7a, let-7f, or let-7d.
In yet another embodiment, the solid cancer is breast cancer and
the miR gene product is not miR-181b, miR-181c, miR-181d, miR-30,
miR-15b, miR-16-2, miR-153-1, miR-217, miR-205, miR-204, miR-103,
miR-107, miR-129-2, miR-9 or miR-137.
[0052] In another embodiment, the solid cancer is colon cancer and
the at least one miR gene product in the test sample is selected
from the group consisting of miR-24-1, miR-29b-2, miR-20a, miR-10a,
miR-32, miR-203, miR-106a, miR-17-5p, miR-30c, miR-223, miR-126*,
miR-128b, miR-21, miR-24-2, miR-99b prec, miR-155, miR-213,
miR-150, miR-107, miR-191, miR-221, miR-9-3 and combinations
thereof. In another embodiment, the solid cancer is colon cancer
and the miR gene product is not miR 159-1 or miR-192. In an
additional embodiment, the solid cancer is colon cancer and the miR
gene product is not miR-186, miR-101-1, miR-194, miR-215, miR-106b,
miR-25, miR-93, miR-29b, miR-29a, miR-96, miR-182s, miR-182as,
miR-183, miR-129-1, let-7a-1, let-7d, let-7f-1, miR-23b, miR-24-1,
miR-27b, miR-32, miR-159-1, miR-192, miR-125b-1, let-7a-2, miR-100,
miR-196-2, miR-148b, miR-190, miR-21, miR-301, miR-142s, miR-142as,
miR-105-1, or miR-175. In a further embodiment, the solid cancer is
colon cancer and the miR gene product is not miR-21, miR-301,
miR-142as, miR-142s, miR-194, miR-215, or miR-32. In another
embodiment, the solid cancer is colon cancer and the miR gene
product is not miR-148, miR-10a, miR-196-1, miR-152, miR-196-2,
miR-148b, miR-10b, miR-129-1, miR-153-2, miR-202, miR-139, let-7a,
let-7f, or let-7d. In yet another embodiment, the solid cancer is
colon cancer and the miR gene product is not miR-181b, miR-181c,
miR-181d, miR-30, miR-15b, miR-16-2, miR-153-1, miR-217, miR-205,
miR-204, miR-103, miR-107, miR-129-2, miR-9 or miR-137.
[0053] In yet another embodiment, the solid cancer is lung cancer
and the miR gene product in the test sample is selected from the
group consisting of miR-21, miR-205, miR-200b, miR-9-1, miR-210,
miR-148, miR-141, miR-132, miR-215, miR-128b, let-7g, miR-16-2,
miR-129-1/2 prec, miR-126*, miR-142-as, miR-30d, miR-30a-5p,
miR-7-2, miR-199a-1, miR-127, miR-34a prec, miR-34a, miR-136,
miR-202, miR-196-2, miR-199a-2, let-7a-2, miR-124a-1, miR-149,
miR-17-5p, miR-196-1 prec, miR-10a, miR-99b prec, miR-196-1,
miR-199b, miR-191, miR-195, miR-155 and combinations thereof. In a
related embodiment, the solid cancer is lung cancer and the at
least one miR gene product is not miR-15a or miR-16-1. In a further
embodiment, the solid cancer is lung cancer and the at least one
miR gene product is not miR-21, miR-191, miR-126*, miR-210,
miR-155, miR-143, miR-205, miR-126, miR-30a-5p, miR-140, miR-214,
miR-218-2, miR-145, miR-106a, miR-192, miR-203, miR-150, miR-220,
miR-192, miR-224, miR-24-2, miR-212, miR-9, miR-17, miR-124a-1,
miR-95, miR-198, miR-216, miR-219-1, miR-197, miR-125a, miR-26a-1,
miR-146, miR-199b, let7a-2, miR-27b, miR-32, miR-29b-2, miR-33,
miR-181c, miR-101-1, miR-124a-3, miR-125b-1 or let7f-1. In another
embodiment, the solid cancer is lung cancer and the at least one
miR gene product is not miR-21, miR-182, miR-181, miR-30, miR-15a,
miR-143, miR-205, miR-96, miR-103, miR-107, miR-129, miR-137,
miR-186, miR-15b, miR-16-2, miR-195, miR-34, miR-153, miR-217,
miR-204, miR-211, miR-9, miR-217, let-7a-2 or miR-32. In a further
embodiment, the solid cancer is lung cancer and the miR gene
product is not let-7c, let-7g, miR-7-3, miR-210, miR-31, miR-34a-1,
miR-a-2, miR-99a, miR-100, miR-125b-2, miR-132, miR-135-1, miR-195,
miR-34, miR-123, miR-203. In another embodiment, the solid cancer
is lung cancer and the miR gene product is not miR 159-1 or
miR-192. In an additional embodiment, the solid cancer is lung
cancer and the miR gene product is not miR-186, miR-101-1, miR-194,
miR-215, miR-106b, miR-25, miR-93, miR-29b, miR-29a, miR-96,
miR-182s, miR-182as, miR-183, miR-129-1, let-7a-1, let-7d,
let-7f-1, miR-23b, miR-24-1, miR-27b, miR-32, miR-159-1, miR-192,
miR-125b-1, let-7a-2, miR-100, miR-196-2, miR-148b, miR-190,
miR-21, miR-301, miR-142s, miR-142as, miR-105-1, or miR-175. In a
further embodiment, the solid cancer is lung cancer and the miR
gene product is not miR-21, miR-301, miR-142as, miR-142s, miR-194,
miR-215, or miR-32. In another embodiment, the solid cancer is lung
cancer and the miR gene product is not miR-148, miR-10a, miR-196-1,
miR-152, miR-196-2, miR-148b, miR-10b, miR-129-1, miR-153-2,
miR-202, miR-139, let-7a, let-7f, or let-7d. In yet another
embodiment, the solid cancer is lung cancer and the miR gene
product is not miR-181b, miR-181c, miR-181d, miR-30, miR-15b,
miR-16-2, miR-153-1, miR-217, miR-205, miR-204, miR-103, miR-107,
miR-129-2, miR-9 or miR-137.
[0054] In a further embodiment, the solid cancer is pancreatic
cancer and the at least one miR gene product measured in the test
sample is selected from the group consisting of miR-103-1,
miR-103-2, miR-155, miR-204 and combinations thereof. In a related
embodiment, the solid cancer is pancreatic cancer and the miR gene
product in the test sample is selected from the group consisting of
miR-103-2, miR-103-1, miR-24-2, miR-107, miR-100, miR-125b-2,
miR-125b-1, miR-24-1, miR-191, miR-23a, miR-26a-1, miR-125a,
miR-130a, miR-26b, miR-145, miR-221, miR-126*, miR-16-2, miR-146,
miR-214, miR-99b, miR-128b, miR-155, miR-29b-2, miR-29a, miR-25,
miR-16-1, miR-99a, miR-224, miR-30d, miR-92-2, miR-199a-1, miR-223,
miR-29c, miR-30b, miR-129-1/2, miR-197, miR-17-5p, miR-30c,
miR-7-1, miR-93-1, miR-140, miR-30a-5p, miR-132, miR-181b-1,
miR-152 prec, miR-23b, miR-20a, miR-222, miR-27a, miR-92-1, miR-21,
miR-129-1/2 prec, miR-150, miR-32, miR-106a, miR-29b-1 and
combinations thereof. In one embodiment, the solid cancer is
pancreatic cancer and the miR gene product is not miR-15a or
miR-16-1. In another embodiment, the solid cancer is pancreatic
cancer and the miR gene product is not miR 159-1 or miR-192. In an
additional embodiment, the solid cancer is pancreatic cancer and
the miR gene product is not miR-186, miR-101-1, miR-194, miR-215,
miR-106b, miR-25, miR-93, miR-29b, miR-29a, miR-96, miR-182s,
miR-182as, miR-183, miR-129-1, let-7a-1, let-7d, let-7f-1, miR-23b,
miR-24-1, miR-27b, miR-32, miR-159-1, miR-192, miR-125b-1,
let-7a-2, miR-100, miR-196-2, miR-148b, miR-190, miR-21, miR-301,
miR-142s, miR-142as, miR-105-1, or miR-175. In a further
embodiment, the solid cancer is pancreatic cancer and the miR gene
product is not miR-21, miR-301, miR-142as, miR-142s, miR-194,
miR-215, or miR-32. In another embodiment, the solid cancer is
pancreatic cancer and the miR gene product is not miR-148, miR-10a,
miR-196-1, miR-152, miR-196-2, miR-148b, miR-10b, miR-129-1,
miR-153-2, miR-202, miR-139, let-7a, let-7f, or let-7d. In yet
another embodiment, the solid cancer is pancreatic cancer and the
miR gene product is not miR-181b, miR-181c, miR-181d, miR-30,
miR-15b, miR-16-2, miR-153-1, miR-217, miR-205, miR-204, miR-103,
miR-107, miR-129-2, miR-9 or miR-137.
[0055] In another embodiment, the solid cancer is prostate cancer
and the miR gene product in the test sample is selected from the
group consisting of let-7d, miR-128a prec, miR-195, miR-203,
let-7a-2 prec, miR-34a, miR-20a, miR-218-2, miR-29a, miR-25,
miR-95, miR-197, miR-135-2, miR-187, miR-196-1, miR-148, miR-191,
miR-21, let-7i, miR-198, miR-199a-2, miR-30c, miR-17-5p, miR-92-2,
miR-146, miR-181b-1 prec, miR-32, miR-206, miR-184 prec, miR-29a
prec, miR-29b-2, miR-149, miR-181b-1, miR-196-1 prec, miR-93-1,
miR-223, miR-16-1, miR-101-1, miR-124a-1, miR-26a-1, miR-214,
miR-27a, miR-24-1, miR-106a, miR-199a-1 and combinations thereof.
In a related embodiment, the solid cancer is prostate cancer and
the miR gene product is not miR-15a or miR-16-1. In another
embodiment, the solid cancer is prostate cancer and the miR gene
product is not miR 159-1 or miR-192. In an additional embodiment,
the solid cancer is prostate cancer and the miR gene product is not
miR-186, miR-101-1, miR-194, miR-215, miR-106b, miR-25, miR-93,
miR-29b, miR-29a, miR-96, miR-182s, miR-182as, miR-183, miR-129-1,
let-7a-1, let-7d, let-7f-1, miR-23b, miR-24-1, miR-27b, miR-32,
miR-159-1, miR-192, miR-125b-1, let-7a-2, miR-100, miR-196-2,
miR-148b, miR-190, miR-21, miR-301, miR-142s, miR-142as, miR-105-1,
or miR-175. In a further embodiment, the solid cancer is prostate
cancer and the miR gene product is not miR-21, miR-301, miR-142as,
miR-142s, miR-194, miR-215, or miR-32. In another embodiment, the
solid cancer is prostate cancer and the miR gene product is not
miR-148, miR-10a, miR-196-1, miR-152, miR-196-2, miR-148b, miR-10b,
miR-129-1, miR-153-2, miR-202, miR-139, let-7a, let-7f, or let-7d.
In yet another embodiment, the solid cancer is prostate cancer and
the miR gene product is not miR-181b, miR-181c, miR-181d, miR-30,
miR-15b, miR-16-2, miR-153-1, miR-217, miR-205, miR-204, miR-103,
miR-107, miR-129-2, miR-9 or miR-137.
[0056] In yet another embodiment, the solid cancer is stomach
cancer and the miR gene product in the test sample is selected from
the group consisting of miR-223, miR-21, miR-218-2, miR-103-2,
miR-92-2, miR-25, miR-136, miR-191, miR-221, miR-125b-2, miR-103-1,
miR-214, miR-222, miR-212 prec, miR-125b-1, miR-100, miR-107,
miR-92-1, miR-96, miR-192, miR-23a, miR-215, miR-7-2, miR-138-2,
miR-24-1, miR-99b, miR-33b, miR-24-2 and combinations thereof. In a
related embodiment, the solid cancer is stomach cancer and the miR
gene product is not miR-15a or miR-16-1. In another embodiment, the
solid cancer is stomach cancer and the miR gene product is not miR
159-1 or miR-192. hi an additional embodiment, the solid cancer is
stomach cancer and the miR gene product is not miR-186, miR-101-1,
miR-194, miR-215, miR-106b, miR-25, miR-93, miR-29b, miR-29a,
miR-96, miR-182s, miR-182as, miR-183, miR-129-1, let-7a-1, let-7d,
let-7f-1, miR-23b, miR-24-1, miR-27b, miR-32, miR-159-1, miR-192,
miR-125b-1, let-7a-2, miR-100, miR-196-2, miR-148b, miR-190,
miR-21, miR-301, miR-142s, miR-142as, miR-105-1, or miR-175. In a
further embodiment, the solid cancer is stomach cancer and the miR
gene product is not miR-21, miR-301, miR-142as, miR-142s, miR-194,
miR-215, or miR-32. In another embodiment, the solid cancer is
stomach cancer and the miR gene product is not miR-148, miR-10a,
miR-196-1, miR-152, miR-196-2, miR-148b, miR-10b, miR-129-1,
miR-153-2, miR-202, miR-139, let-7a, let-7f, or let-7d. In yet
another embodiment, the solid cancer is stomach cancer and the miR
gene product is not miR-181b, miR-181c, miR-181d, miR-30, miR-15b,
miR-16-2, miR-153-1, miR-217, miR-205, miR-204, miR-103, miR-107,
miR-129-2, miR-9 or miR-137.
[0057] The level of at least one miR gene product can be measured
in a biological sample (e.g., cells, tissues) obtained from the
subject. For example, a tissue sample (e.g., from a tumor) can be
removed from a subject suspected of having a solid cancer by
conventional biopsy techniques. In another embodiment, a blood
sample can be removed from the subject, and blood cells (e.g.,
white blood cells) can be isolated for DNA extraction by standard
techniques. The blood or tissue sample is preferably obtained from
the subject prior to initiation of radiotherapy, chemotherapy or
other therapeutic treatment. A corresponding control tissue or
blood sample can be obtained from unaffected tissues of the
subject, from a normal human individual or population of normal
individuals, or from cultured cells corresponding to the majority
of cells in the subject's sample. The control tissue or blood
sample is then processed along with the sample from the subject, so
that the levels of miR gene product produced from a given miR gene
in cells from the subject's sample can be compared to the
corresponding miR gene product levels from cells of the control
sample. A reference miR expression standard for the biological
sample can also be used as a control.
[0058] An alteration (e.g., an increase or decrease) in the level
of a miR gene product in the sample obtained from the subject,
relative to the level of a corresponding miR gene product in a
control sample, is indicative of the presence of a solid cancer in
the subject. In one embodiment, the level of the at least one miR
gene product in the test sample is greater than the level of the
corresponding miR gene product in the control sample (i.e.,
expression of the miR gene product is "up-regulated"). As used
herein, expression of a miR gene product is "up-regulated" when the
amount of miR gene product in a cell or tissue sample from a
subject is greater than the amount of the same gene product in a
control cell or tissue sample. In another embodiment, the level of
the at least one miR gene product in the test sample is less than
the level of the corresponding miR gene product in the control
sample (i.e., expression of the miR gene product is
"down-regulated"). As used herein, expression of a miR gene is
"down-regulated" when the amount of miR gene product produced from
that gene in a cell or tissue sample from a subject is less than
the amount produced from the same gene in a control cell or tissue
sample. The relative miR gene expression in the control and normal
samples can be determined with respect to one or more RNA
expression standards. The standards can comprise, for example, a
zero miR gene expression level, the miR gene expression level in a
standard cell line, the miR gene expression level in unaffected
tissues of the subject, or the average level of miR gene expression
previously obtained for a population of normal human controls.
[0059] The level of a miR gene product in a sample can be measured
using any technique that is suitable for detecting RNA expression
levels in a biological sample. Suitable techniques (e.g., Northern
blot analysis, RT-PCR, in situ hybridization) for determining RNA
expression levels in a biological sample (e.g., cells, tissues) are
well known to those of skill in the art. In a particular
embodiment, the level of at least one miR gene product is detected
using Northern blot analysis. For example, total cellular RNA can
be purified from cells by homogenization in the presence of nucleic
acid extraction buffer, followed by centrifugation. Nucleic acids
are precipitated, and DNA is removed by treatment with DNase and
precipitation. The RNA molecules are then separated by gel
electrophoresis on agarose gels according to standard techniques,
and transferred to nitrocellulose filters. The RNA is then
immobilized on the filters by heating. Detection and quantification
of specific RNA is accomplished using appropriately labeled DNA or
RNA probes complementary to the RNA in question. See, for example,
Molecular Cloning: A Laboratory Manual, J. Sambrook et al., eds.,
2nd edition, Cold Spring Harbor Laboratory Press, 1989, Chapter 7,
the entire disclosure of which is incorporated by reference.
[0060] Suitable probes for Northern blot hybridization of a given
miR gene product can be produced from the nucleic acid sequences
provided in Table 1a and Table 1b and include, but are not limited
to, probes having at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%,
99% or complete complementarity to a miR gene product of interest.
Methods for preparation of labeled DNA and RNA probes, and the
conditions for hybridization thereof to target nucleotide
sequences, are described in Molecular Cloning: A Laboratory Manual,
J. Sambrook et al., eds., 2nd edition, Cold Spring Harbor
Laboratory Press, 1989, Chapters 10 and 11, the disclosures of
which are incorporated herein by reference.
[0061] For example, the nucleic acid probe can be labeled with,
e.g., a radionuclide, such as .sup.3H, 32P, .sup.33P, .sup.14C, or
.sup.35S; a heavy metal; a ligand capable of functioning as a
specific binding pair member for a labeled ligand (e.g., biotin,
avidin or an antibody); a fluorescent molecule; a chemiluminescent
molecule; an enzyme or the like.
[0062] Probes can be labeled to high specific activity by either
the nick translation method of Rigby et al. (1977), J. Mol. Biol.
113:237-251 or by the random priming method of Fienberg et al.
(1983), Anal. Biochem. 132:6-13, the entire disclosures of which
are incorporated herein by reference. The latter is the method of
choice for synthesizing .sup.32P-labeled probes of high specific
activity from single-stranded DNA or from RNA templates. For
example, by replacing preexisting nucleotides with highly
radioactive nucleotides according to the nick translation method,
it is possible to prepare .sup.32P-labeled nucleic acid probes with
a specific activity well in excess of 10.sup.8 cpm/microgram.
Autoradiographic detection of hybridization can then be performed
by exposing hybridized filters to photographic film. Densitometric
scanning of the photographic films exposed by the hybridized
filters provides an accurate measurement of miR gene transcript
levels. Using another approach, miR gene transcript levels can be
quantified by computerized imaging systems, such as the Molecular
Dynamics 400-B 2D Phosphorimager available from Amersham
Biosciences, Piscataway, N.J.
[0063] Where radionuclide labeling of DNA or RNA probes is not
practical, the random-primer method can be used to incorporate an
analogue, for example, the dTTP analogue
5-(N-(N-biotinyl-epsilon-aminocaproyl)-3-aminoallyl)deoxyuridine
triphosphate, into the probe molecule. The biotinylated probe
oligonucleotide can be detected by reaction with biotin-binding
proteins, such as avidin, streptavidin, and antibodies (e.g.,
anti-biotin antibodies) coupled to fluorescent dyes or enzymes that
produce color reactions.
[0064] In addition to Northern and other RNA hybridization
techniques, determining the levels of RNA transcripts can be
accomplished using the technique of in situ hybridization. This
technique requires fewer cells than the Northern blotting
technique, and involves depositing whole cells onto a microscope
cover slip and probing the nucleic acid content of the cell with a
solution containing radioactive or otherwise labeled nucleic acid
(e.g., cDNA or RNA) probes. This technique is particularly
well-suited for analyzing tissue biopsy samples from subjects. The
practice of the in situ hybridization technique is described in
more detail in U.S. Pat. No. 5,427,916, the entire disclosure of
which is incorporated herein by reference. Suitable probes for in
situ hybridization of a given miR gene product can be produced from
the nucleic acid sequences provided in Table 1a and Table 1b, and
include, but are not limited to, probes having at least about 70%,
75%, 80%, 85%, 90%, 95%, 98%, 99% or complete complementarity to a
miR gene product of interest, as described above.
[0065] The relative number of miR gene transcripts in cells can
also be determined by reverse transcription of miR gene
transcripts, followed by amplification of the reverse-transcribed
transcripts by polymerase chain reaction (RT-PCR). The levels of
miR gene transcripts can be quantified in comparison with an
internal standard, for example, the level of mRNA from a
"housekeeping" gene present in the same sample. A suitable
"housekeeping" gene for use as an internal standard includes, e.g.,
myosin or glyceraldehyde-3-phosphate dehydrogenase (G3PDH). Methods
for performing quantitative and semi-quantitative RT-PCR, and
variations thereof, are well known to those of skill in the
art.
[0066] In some instances, it may be desirable to simultaneously
determine the expression level of a plurality of different miR gene
products in a sample. In other instances, it may be desirable to
determine the expression level of the transcripts of all known miR
genes correlated with a cancer. Assessing cancer-specific
expression levels for hundreds of miR genes or gene products is
time consuming and requires a large amount of total RNA (e.g., at
least 20 .mu.g for each Northern blot) and autoradiographic
techniques that require radioactive isotopes.
[0067] To overcome these limitations, an oligolibrary, in microchip
format (i.e., a microarray), may be constructed containing a set of
oligonucleotide (e.g., oligodeoxynucleotides) probes that are
specific for a set of miR genes. Using such a microarray, the
expression level of multiple microRNAs in a biological sample can
be determined by reverse transcribing the RNAs to generate a set of
target oligodeoxynucleotides, and hybridizing them to probe the
oligonucleotides on the microarray to generate a hybridization, or
expression, profile. The hybridization profile of the test sample
can then be compared to that of a control sample to determine which
microRNAs have an altered expression level in solid cancer cells.
As used herein, "probe oligonucleotide" or "probe
oligodeoxynucleotide" refers to an oligonucleotide that is capable
of hybridizing to a target oligonucleotide. "Target
oligonucleotide" or "target oligodeoxynucleotide" refers to a
molecule to be detected (e.g., via hybridization). By "miR-specific
probe oligonucleotide" or "probe oligonucleotide specific for a
miR" is meant a probe oligonucleotide that has a sequence selected
to hybridize to a specific miR gene product, or to a reverse
transcript of the specific miR gene product.
[0068] An "expression profile" or "hybridization profile" of a
particular sample is essentially a fingerprint of the state of the
sample; while two states may have any particular gene similarly
expressed, the evaluation of a number of genes simultaneously
allows the generation of a gene expression profile that is unique
to the state of the cell. That is, normal tissue may be
distinguished from cancerous (e.g., tumor) tissue, and within
cancerous tissue, different prognosis states (for example, good or
poor long term survival prospects) may be determined. By comparing
expression profiles of solid cancer tissue in different states,
information regarding which genes are important (including both up-
and down-regulation of genes) in each of these states is obtained.
The identification of sequences that are differentially expressed
in solid cancer tissue, as well as differential expression
resulting in different prognostic outcomes, allows the use of this
information in a number of ways. For example, a particular
treatment regime may be evaluated (e.g., to determine whether a
chemotherapeutic drug acts to improve the long-term prognosis in a
particular patient). Similarly, diagnosis may be done or confirmed
by comparing patient samples with known expression profiles.
Furthermore, these gene expression profiles (or individual genes)
allow screening of drug candidates that suppress the solid cancer
expression profile or convert a poor prognosis profile to a better
prognosis profile.
[0069] Accordingly, the invention provides methods of diagnosing
whether a subject has, or is at risk for developing, a solid
cancer, comprising reverse transcribing RNA from a test sample
obtained from the subject to provide a set of target
oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides
to a microarray comprising miRNA-specific probe oligonucleotides to
provide a hybridization profile for the test sample, and comparing
the test sample hybridization profile to a hybridization profile
generated from a control sample or reference standard, wherein an
alteration in the signal of at least one miRNA is indicative of the
subject either having, or being at risk for developing, a solid
cancer. In one embodiment, the microarray comprises miRNA-specific
probe oligonucleotides for a substantial portion of all known human
miRNAs. In a particular embodiment, the microarray comprises
miRNA-specific probe oligonucleotides for one or more miRNAs
selected from the group consisting of miR-21, miR-17-5p, miR-191,
miR-29b-2, miR-223, miR-128b, miR-199a-1, miR-24-1, miR-24-2,
miR-146, miR-155, miR-181b-1, miR-20a, miR-107, miR-32, miR-92-2,
miR-214, miR-30c, miR-25, miR-221, miR-106a and combinations
thereof.
[0070] The microarray can be prepared from gene-specific
oligonucleotide probes generated from known miRNA sequences. The
array may contain two different oligonucleotide probes for each
miRNA, one containing the active, mature sequence and the other
being specific for the precursor of the miRNA. The array may also
contain controls, such as one or more mouse sequences differing
from human orthologs by only a few bases, which can serve as
controls for hybridization stringency conditions. tRNAs or other
RNAs (e.g., rRNAs, mRNAs) from both species may also be printed on
the microchip, providing an internal, relatively stable, positive
control for specific hybridization. One or more appropriate
controls for non-specific hybridization may also be included on the
microchip. For this purpose, sequences are selected based upon the
absence of any homology with any known miRNAs.
[0071] The microarray may be fabricated using techniques known in
the art. For example, probe oligonucleotides of an appropriate
length, e.g., 40 nucleotides, are 5'-amine modified at position C6
and printed using commercially available microarray systems, e.g.,
the GeneMachine OmniGrid.TM. 100 Microarrayer and Amersham
CodeLink.TM. activated slides. Labeled cDNA oligomer corresponding
to the target RNAs is prepared by reverse transcribing the target
RNA with labeled primer. Following first strand synthesis, the
RNA/DNA hybrids are denatured to degrade the RNA templates. The
labeled target cDNAs thus prepared are then hybridized to the
microarray chip under hybridizing conditions, e.g.,
6.times.SSPE/30% formamide at 25.degree. C. for 18 hours, followed
by washing in 0.75.times.TNT (Tris HCl/NaCl/Tween 20) at 37.degree.
C. for 40 minutes. At positions on the array where the immobilized
probe DNA recognizes a complementary target cDNA in the sample,
hybridization occurs. The labeled target cDNA marks the exact
position on the array where binding occurs, allowing automatic
detection and quantification. The output consists of a list of
hybridization events, indicating the relative abundance of specific
cDNA sequences, and therefore the relative abundance of the
corresponding complementary miRs, in the patient sample. According
to one embodiment, the labeled cDNA oligomer is a biotin-labeled
cDNA, prepared from a biotin-labeled primer. The microarray is then
processed by direct detection of the biotin-containing transcripts
using, e.g., Streptavidin-A1exa647 conjugate, and scanned utilizing
conventional scanning methods. Image intensities of each spot on
the array are proportional to the abundance of the corresponding
miR in the patient sample.
[0072] The use of the array has several advantages for miRNA
expression detection. First, the global expression of several
hundred genes can be identified in the same sample at one time
point. Second, through careful design of the oligonucleotide
probes, expression of both mature and precursor molecules can be
identified. Third, in comparison with Northern blot analysis, the
chip requires a small amount of RNA, and provides reproducible
results using 2.5 .mu.g of total RNA. The relatively limited number
of miRNAs (a few hundred per species) allows the construction of a
common microarray for several species, with distinct
oligonucleotide probes for each. Such a tool would allow for
analysis of trans-species expression for each known miR under
various conditions.
[0073] In addition to use for quantitative expression level assays
of specific miRs, a microchip containing miRNA-specific probe
oligonucleotides corresponding to a substantial portion of the
miRNome, preferably the entire miRNome, may be employed to carry
out miR gene expression profiling, for analysis of miR expression
patterns. Distinct miR signatures can be associated with
established disease markers, or directly with a disease state.
[0074] According to the expression profiling methods described
herein, total RNA from a sample from a subject suspected of having
a cancer (e.g., a solid cancer) is quantitatively reverse
transcribed to provide a set of labeled target
oligodeoxynucleotides complementary to the RNA in the sample. The
target oligodeoxynucleotides are then hybridized to a microarray
comprising miRNA-specific probe oligonucleotides to provide a
hybridization profile for the sample. The result is a hybridization
profile for the sample representing the expression pattern of miRNA
in the sample. The hybridization profile comprises the signal from
the binding of the target oligodeoxynucleotides from the sample to
the miRNA-specific probe oligonucleotides in the microarray. The
profile may be recorded as the presence or absence of binding
(signal vs. zero signal). More preferably, the profile recorded
includes the intensity of the signal from each hybridization. The
profile is compared to the hybridization profile generated from a
normal, i.e., noncancerous, control sample. An alteration in the
signal is indicative of the presence of, or propensity to develop,
cancer in the subject.
[0075] Other techniques for measuring miR gene expression are also
within the skill in the art, and include various techniques for
measuring rates of RNA transcription and degradation.
[0076] The invention also provides methods of determining the
prognosis of a subject with a solid cancer, comprising measuring
the level of at least one miR gene product, which is associated
with a particular prognosis in a solid cancer (e.g., a good or
positive prognosis, a poor or adverse prognosis), in a test sample
from the subject. According to these methods, an alteration in the
level of a miR gene product that is associated with a particular
prognosis in the test sample, as compared to the level of a
corresponding miR gene product in a control sample, is indicative
of the subject having a solid cancer with a particular prognosis.
In one embodiment, the miR gene product is associated with an
adverse (i.e., poor) prognosis. Examples of an adverse prognosis
include, but are not limited to, low survival rate and rapid
disease progression. In certain embodiments, the level of the at
least one miR gene product is measured by reverse transcribing RNA
from a test sample obtained from the subject to provide a set of
target oligodeoxynucleotides, hybridizing the target
oligodeoxynucleotides to a microarray that comprises miRNA-specific
probe oligonucleotides to provide a hybridization profile for the
test sample, and comparing the test sample hybridization profile to
a hybridization profile generated from a control sample.
[0077] Without wishing to be bound by any one theory, it is
believed that alterations in the level of one or more miR gene
products in cells can result in the deregulation of one or more
intended targets for these miRs, which can lead to the formation of
solid cancers. Therefore, altering the level of the miR gene
product (e.g., by decreasing the level of a miR gene product that
is up-regulated in solid cancer cells, by increasing the level of a
miR gene product that is down-regulated in solid cancer cells) may
successfully treat the solid cancer.
[0078] Accordingly, the present invention encompasses methods of
inhibiting tumorigenesis in a subject who has, or is suspected of
having, a solid cancer wherein at least one miR gene product is
deregulated (e.g., down-regulated, up-regulated) in the cancer
cells of the subject. When the at least one isolated miR gene
product is down-regulated in the cancer cells (e.g., miR-145,
miR-155, miR-218-2), the method comprises administering an
effective amount of the at least one isolated miR gene product, or
an isolated variant or biologically-active fragment thereof, such
that proliferation of cancer cells in the subject is inhibited. In
one embodiment, the isolated miR gene product that is administered
is not miR-15a or miR-16-1. In another embodiment, the miR gene
product is not miR 159-1 or miR-192. In an additional embodiment,
the miR gene product is not miR-186, miR-101-1, miR-194, miR-215,
miR-106b, miR-25, miR-93, miR-29b, miR-29a, miR-96, miR-182s,
miR-182as, miR-183, miR-129-1, let-7a-1, let-7d, let-7f-1, miR-23b,
miR-24-1, miR-27b, miR-32, miR-159-1, miR-192, miR-125b-1,
let-7a-2, miR-100, miR-196-2, miR-148b, miR-190, miR-21, miR-301,
miR-142s, miR-142as, miR-105-1, or miR-175. In a further
embodiment, the miR gene product is not miR-21, miR-301, miR-142as,
miR-142s, miR-194, miR-215, or miR-32. In another embodiment, the
miR gene product is not miR-148, miR-10a, miR-196-1, miR-152,
miR-196-2, miR-148b, miR-10b, miR-129-1, miR-153-2, miR-202,
miR-139, let-7a, let-7f, or let-7d. In yet another embodiment, the
miR gene product is not miR-30, miR-15b, miR-16-2, miR-217,
miR-205, miR-204, miR-103, miR-107, miR-9, and miR-137. In a
further embodiment, the miR gene product is not miR-145, miR-21,
miR-155, miR-10b, miR-125b-1, miR-125b-2, let7a-2, let7a-3, let-7d,
miR-122a, miR-191, miR-206, miR-210, let-7i, miR-009-1 (miR131-1),
miR-34 (miR-170), miR-102 (miR-29b), miR-123 (miR-126), miR-140-as,
miR-125a, miR-194, miR-204, miR-213, let-7f-2, miR-101, miR-128b,
miR-136, miR-143, miR-149, miR-191, miR-196-1, miR-196-2, miR-202,
miR-103-1, or miR-30c. In another embodiment, the miR gene product
is not miR-21, miR-125b-1, let-7a-2, let-7i, miR-100, let-7g,
miR-31, miR-32a-1, miR-33b, miR-34a-2, miR-101-1, miR-135-1,
miR-142as, miR-142s, miR-144, miR-301, miR-29c, miR-30c, miR-106a,
or miR-29b-1.
[0079] For example, when a miR gene product is down-regulated in a
cancer cell in a subject, administering an effective amount of an
isolated miR gene product to the subject can inhibit proliferation
of the cancer cell. The isolated miR gene product that is
administered to the subject can be identical to the endogenous
wild-type miR gene product (e.g., a miR gene product shown in Table
1a or Table 1b) that is down-regulated in the cancer cell or it can
be a variant or biologically-active fragment thereof. As defined
herein, a "variant" of a miR gene product refers to a miRNA that
has less than 100% identity to a corresponding wild-type miR gene
product and possesses one or more biological activities of the
corresponding wild-type miR gene product. Examples of such
biological activities include, but are not limited to, inhibition
of expression of a target RNA molecule (e.g., inhibiting
translation of a target RNA molecule, modulating the stability of a
target RNA molecule, inhibiting processing of a target RNA
molecule) and inhibition of a cellular process associated with
solid cancer (e.g., cell differentiation, cell growth, cell death).
These variants include species variants and variants that are the
consequence of one or more mutations (e.g., a substitution, a
deletion, an insertion) in a miR gene. In certain embodiments, the
variant is at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%
identical to a corresponding wild-type miR gene product.
[0080] As defined herein, a "biologically-active fragment" of a miR
gene product refers to an RNA fragment of a miR gene product that
possesses one or more biological activities of a corresponding
wild-type miR gene product. As described above, examples of such
biological activities include, but are not limited to, inhibition
of expression of a target RNA molecule and inhibition of a cellular
process associated with solid cancer. In certain embodiments, the
biologically-active fragment is at least about 5, 7, 10, 12, 15, or
17 nucleotides in length. In a particular embodiment, an isolated
miR gene product can be administered to a subject in combination
with one or more additional anti-cancer treatments. Suitable
anti-cancer treatments include, but are not limited to,
chemotherapy, radiation therapy and combinations thereof (e.g.,
chemoradiation).
[0081] When the at least one isolated miR gene product is
up-regulated in the cancer cells, the method comprises
administering to the subject an effective amount of at least one
compound for inhibiting expression of the at least one miR gene
product, referred to herein as miR gene expression-inhibition
compounds, such that proliferation of solid cancer cells is
inhibited. In a particular embodiment, the at least one miR
expression-inhibition compound is specific for a miR gene product
selected from the group consisting of miR-21, miR-17-5p, miR-191,
miR-29b-2, miR-223, miR-128b, miR-199a-1, miR-24-1, miR-24-2,
miR-146, miR-155, miR-181b-1, miR-20a, miR-107, miR-32, miR-92-2,
miR-214, miR-30c, miR-25, miR-221, miR-106a and combinations
thereof. A miR gene expression-inhibiting compound can be
administered to a subject in combination with one or more
additional anti-cancer treatments. Suitable anti-cancer treatments
include, but are not limited to, chemotherapy, radiation therapy
and combinations thereof (e.g., chemoradiation).
[0082] The terms "treat", "treating" and "treatment", as used
herein, refer to ameliorating symptoms associated with a disease or
condition, for example, a solid cancer, including preventing or
delaying the onset of the disease symptoms, and/or lessening the
severity or frequency of symptoms of the disease or condition. The
terms "subject", "patient" and "individual" are defined herein to
include animals, such as mammals, including, but not limited to,
primates, cows, sheep, goats, horses, dogs, cats, rabbits, guinea
pigs, rats, mice or other bovine, ovine, equine, canine, feline,
rodent, or murine species. In a preferred embodiment, the animal is
a human.
[0083] As used herein, an "effective amount" of an isolated miR
gene product is an amount sufficient to inhibit proliferation of a
cancer cell in a subject suffering from a solid cancer. One skilled
in the art can readily determine an effective amount of a miR gene
product to be administered to a given subject, by taking into
account factors, such as the size and weight of the subject; the
extent of disease penetration; the age, health and sex of the
subject; the route of administration; and whether the
administration is regional or systemic.
[0084] For example, an effective amount of an isolated miR gene
product can be based on the approximate weight of a tumor mass to
be treated. The approximate weight of a tumor mass can be
determined by calculating the approximate volume of the mass,
wherein one cubic centimeter of volume is roughly equivalent to one
gram. An effective amount of the isolated miR gene product based on
the weight of a tumor mass can be in the range of about 10-500
micrograms/gram of tumor mass. In certain embodiments, the tumor
mass can be at least about 10 micrograms/gram of tumor mass, at
least about 60 micrograms/gram of tumor mass or at least about 100
micrograms/gram of tumor mass.
[0085] An effective amount of an isolated miR gene product can also
be based on the approximate or estimated body weight of a subject
to be treated. Preferably, such effective amounts are administered
parenterally or enterally, as described herein. For example, an
effective amount of the isolated miR gene product is administered
to a subject can range from about 5-3000 micrograms/kg of body
weight, from about 700-1000 micrograms/kg of body weight, or
greater than about 1000 micrograms/kg of body weight.
[0086] One skilled in the art can also readily determine an
appropriate dosage regimen for the administration of an isolated
miR gene product to a given subject. For example, a miR gene
product can be administered to the subject once (e.g., as a single
injection or deposition). Alternatively, a miR gene product can be
administered once or twice daily to a subject for a period of from
about three to about twenty-eight days, more particularly from
about seven to about ten days. In a particular dosage regimen, a
miR gene product is administered once a day for seven days. Where a
dosage regimen comprises multiple administrations, it is understood
that the effective amount of the miR gene product administered to
the subject can comprise the total amount of gene product
administered over the entire dosage regimen.
[0087] As used herein, an "isolated" miR gene product is one that
is synthesized, or altered or removed from the natural state
through human intervention. For example, a synthetic miR gene
product, or a miR gene product partially or completely separated
from the coexisting materials of its natural state, is considered
to be "isolated." An isolated miR gene product can exist in
substantially-purified form, or can exist in a cell into which the
miR gene product has been delivered. Thus, a miR gene product that
is deliberately delivered to, or expressed in, a cell is considered
an "isolated" miR gene product. A miR gene product produced inside
a cell from a miR precursor molecule is also considered to be an
"isolated" molecule. According to the invention, the isolated miR
gene products described herein can be used for the manufacture of a
medicament for treating a solid cancer in a subject (e.g., a
human).
[0088] Isolated miR gene products can be obtained using a number of
standard techniques. For example, the miR gene products can be
chemically synthesized or recombinantly produced using methods
known in the art. In one embodiment, miR gene products are
chemically synthesized using appropriately protected ribonucleoside
phosphoramidites and a conventional DNA/RNA synthesizer. Commercial
suppliers of synthetic RNA molecules or synthesis reagents include,
e.g., Proligo (Hamburg, Germany), Dharmacon Research (Lafayette,
Colo., U.S.A.), Pierce Chemical (part of Perbio Science, Rockford,
Ill., U.S.A.), Glen Research (Sterling, Va., U.S.A.), ChemGenes
(Ashland, Mass., U.S.A.) and Cruachem (Glasgow, UK).
[0089] Alternatively, the miR gene products can be expressed from
recombinant circular or linear DNA plasmids using any suitable
promoter. Suitable promoters for expressing RNA from a plasmid
include, e.g., the U6 or H1 RNA pol III promoter sequences, or the
cytomegalovirus promoters. Selection of other suitable promoters is
within the skill in the art. The recombinant plasmids of the
invention can also comprise inducible or regulatable promoters for
expression of the miR gene products in cancer cells.
[0090] The miR gene products that are expressed from recombinant
plasmids can be isolated from cultured cell expression systems by
standard techniques. The miR gene products that are expressed from
recombinant plasmids can also be delivered to, and expressed
directly in, the cancer cells. The use of recombinant plasmids to
deliver the miR gene products to cancer cells is discussed in more
detail below.
[0091] The miR gene products can be expressed from a separate
recombinant plasmid, or they can be expressed from the same
recombinant plasmid. In one embodiment, the miR gene products are
expressed as RNA precursor molecules from a single plasmid, and the
precursor molecules are processed into the functional miR gene
product by a suitable processing system, including, but not limited
to, processing systems extant within a cancer cell. Other suitable
processing systems include, e.g., the in vitro Drosophila cell
lysate system (e.g., as described in U.S. Published Patent
Application No. 2002/0086356 to Tuschl et al., the entire
disclosure of which is incorporated herein by reference) and the E.
coli RNAse III system (e.g., as described in U.S. Published Patent
Application No. 2004/0014113 to Yang et al., the entire disclosure
of which is incorporated herein by reference).
[0092] Selection of plasmids suitable for expressing the miR gene
products, methods for inserting nucleic acid sequences into the
plasmid to express the gene products, and methods of delivering the
recombinant plasmid to the cells of interest are within the skill
in the art. See, for example, Zeng et al. (2002), Molecular Cell
9:1327-1333; Tuschl (2002), Nat. Biotechnol, 20:446-448;
Brummelkamp et al. (2002), Science 296:550-553; Miyagishi et al.
(2002), Nat. Biotechnol. 20:497-500; Paddison et al. (2002), Genes
Dev. 16:948-958; Lee et al. (2002), Nat. Biotechnol. 20:500-505;
and Paul et al. (2002), Nat. Biotechnol. 20:505-508, the entire
disclosures of which are incorporated herein by reference.
[0093] In one embodiment, a plasmid expressing the miR gene
products comprises a sequence encoding a miR precursor RNA under
the control of the CMV intermediate-early promoter. As used herein,
"under the control" of a promoter means that the nucleic acid
sequences encoding the miR gene product are located 3' of the
promoter, so that the promoter can initiate transcription of the
miR gene product coding sequences.
[0094] The miR gene products can also be expressed from recombinant
viral vectors. It is contemplated that the miR gene products can be
expressed from two separate recombinant viral vectors, or from the
same viral vector. The RNA expressed from the recombinant viral
vectors can either be isolated from cultured cell expression
systems by standard techniques, or can be expressed directly in
cancer cells. The use of recombinant viral vectors to deliver the
miR gene products to cancer cells is discussed in more detail
below.
[0095] The recombinant viral vectors of the invention comprise
sequences encoding the miR gene products and any suitable promoter
for expressing the RNA sequences. Suitable promoters include, but
are not limited to, the U6 or H1 RNA pol III promoter sequences, or
the cytomegalovirus promoters. Selection of other suitable
promoters is within the skill in the art. The recombinant viral
vectors of the invention can also comprise inducible or regulatable
promoters for expression of the miR gene products in a cancer
cell.
[0096] Any viral vector capable of accepting the coding sequences
for the miR gene products can be used; for example, vectors derived
from adenovirus (AV); adeno-associated virus (AAV); retroviruses
(e.g., lentiviruses (LV), Rhabdoviruses, murine leukemia virus);
herpes virus, and the like. The tropism of the viral vectors can be
modified by pseudotyping the vectors with envelope proteins or
other surface antigens from other viruses, or by substituting
different viral capsid proteins, as appropriate.
[0097] For example, lentiviral vectors of the invention can be
pseudotyped with surface proteins from vesicular stomatitis virus
(VSV), rabies, Ebola, Mokola, and the like. AAV vectors of the
invention can be made to target different cells by engineering the
vectors to express different capsid protein serotypes. For example,
an AAV vector expressing a serotype 2 capsid on a serotype 2 genome
is called AAV 2/2. This serotype 2 capsid gene in the AAV 2/2
vector can be replaced by a serotype 5 capsid gene to produce an
AAV 2/5 vector. Techniques for constructing AAV vectors that
express different capsid protein serotypes are within the skill in
the art; see, e.g., Rabinowitz, J. E., et al. (2002), J. Virol.
76:791-801, the entire disclosure of which is incorporated herein
by reference.
[0098] Selection of recombinant viral vectors suitable for use in
the invention, methods for inserting nucleic acid sequences for
expressing RNA into the vector, methods of delivering the viral
vector to the cells of interest, and recovery of the expressed RNA
products are within the skill in the art. See, for example,
Dornburg (1995), Gene Therapy 2:301-310; Eglitis (1988),
Biotechniques 6:608-614; Miller (1990), Hum. Gene Therapy 1:5-14;
and Anderson (1998), Nature 392:25-30, the entire disclosures of
which are incorporated herein by reference.
[0099] Particularly suitable viral vectors are those derived from
AV and AAV. A suitable AV vector for expressing the miR gene
products, a method for constructing the recombinant AV vector, and
a method for delivering the vector into target cells, are described
in Xia et al. (2002), Nat. Biotech. 20:1006-1010, the entire
disclosure of which is incorporated herein by reference. Suitable
AAV vectors for expressing the miR gene products, methods for
constructing the recombinant AAV vector, and methods for delivering
the vectors into target cells are described in Samulski et al.
(1987), J. Virol. 61 :3096-3101; Fisher et al. (1996), J. Virol.,
70:520-532; Samulski et al. (1989), J. Virol. 63:3822-3826; U.S.
Pat. No. 5,252,479; U.S. Pat. No. 5,139,941; International Patent
Application No. WO 94/13788; and International Patent Application
No. WO 93/24641, the entire disclosures of which are incorporated
herein by reference. In one embodiment, the miR gene products are
expressed from a single recombinant AAV vector comprising the CMV
intermediate early promoter.
[0100] In a certain embodiment, a recombinant AAV viral vector of
the invention comprises a nucleic acid sequence encoding a miR
precursor RNA in operable connection with a polyT termination
sequence under the control of a human U6 RNA promoter. As used
herein, "in operable connection with a polyT termination sequence"
means that the nucleic acid sequences encoding the sense or
antisense strands are immediately adjacent to the polyT termination
signal in the 5' direction. During transcription of the miR
sequences from the vector, the polyT termination signals act to
terminate transcription.
[0101] In other embodiments of the treatment methods of the
invention, an effective amount of at least one compound that
inhibits miR expression can be administered to the subject. As used
herein, "inhibiting miR expression" means that the production of
the precursor and/or active, mature form of miR gene product after
treatment is less than the amount produced prior to treatment. One
skilled in the art can readily determine whether miR expression has
been inhibited in a cancer cell, using, for example, the techniques
for determining miR transcript level discussed above for the
diagnostic method. Inhibition can occur at the level of gene
expression (i.e., by inhibiting transcription of a miR gene
encoding the miR gene product) or at the level of processing (e.g.,
by inhibiting processing of a miR precursor into a mature, active
miR).
[0102] As used herein, an "effective amount" of a compound that
inhibits miR expression is an amount sufficient to inhibit
proliferation of a cancer cell in a subject suffering from a cancer
(e.g., a solid cancer). One skilled in the art can readily
determine an effective amount of a miR expression-inhibition
compound to be administered to a given subject, by taking into
account factors, such as the size and weight of the subject; the
extent of disease penetration; the age, health and sex of the
subject; the route of administration; and whether the
administration is regional or systemic.
[0103] For example, an effective amount of the
expression-inhibition compound can be based on the approximate
weight of a tumor mass to be treated, as described herein. An
effective amount of a compound that inhibits miR expression can
also be based on the approximate or estimated body weight of a
subject to be treated, as described herein.
[0104] One skilled in the art can also readily determine an
appropriate dosage regimen for administering a compound that
inhibits miR expression to a given subject.
[0105] Suitable compounds for inhibiting miR gene expression
include double-stranded RNA (such as short- or small-interfering
RNA or "siRNA"), antisense nucleic acids, and enzymatic RNA
molecules, such as ribozymes. Each of these compounds can be
targeted to a given miR gene product and interfere with the
expression of (e.g., inhibit translation of, induce cleavage or
destruction of) the target miR gene product.
[0106] For example, expression of a given miR gene can be inhibited
by inducing RNA interference of the miR gene with an isolated
double-stranded RNA ("dsRNA") molecule which has at least 90%, for
example at least 95%, at least 98%, at least 99%, or 100%, sequence
homology with at least a portion of the miR gene product. In a
particular embodiment, the dsRNA molecule is a "short or small
interfering RNA" or "siRNA."
[0107] siRNA useful in the present methods comprise short
double-stranded RNA from about 17 nucleotides to about 29
nucleotides in length, preferably from about 19 to about 25
nucleotides in length. The siRNA comprise a sense RNA strand and a
complementary antisense RNA strand annealed together by standard
Watson-Crick base-pairing interactions (hereinafter "base-paired").
The sense strand comprises a nucleic acid sequence that is
substantially identical to a nucleic acid sequence contained within
the target miR gene product.
[0108] As used herein, a nucleic acid sequence in an siRNA which is
"substantially identical" to a target sequence contained within the
target mRNA is a nucleic acid sequence that is identical to the
target sequence, or that differs from the target sequence by one or
two nucleotides. The sense and antisense strands of the siRNA can
comprise two complementary, single-stranded RNA molecules, or can
comprise a single molecule in which two complementary portions are
base-paired and are covalently linked by a single-stranded
"hairpin" area.
[0109] The siRNA can also be altered RNA that differs from
naturally-occurring RNA by the addition, deletion, substitution
and/or alteration of one or more nucleotides. Such alterations can
include addition of non-nucleotide material, such as to the end(s)
of the siRNA or to one or more internal nucleotides of the siRNA,
or modifications that make the siRNA resistant to nuclease
digestion, or the substitution of one or more nucleotides in the
siRNA with deoxyribonucleotides.
[0110] One or both strands of the siRNA can also comprise a 3'
overhang. As used herein, a "3' overhang" refers to at least one
unpaired nucleotide extending from the 3'-end of a duplexed RNA
strand. Thus, in certain embodiments, the siRNA comprises at least
one 3' overhang of from 1 to about 6 nucleotides (which includes
ribonucleotides or deoxyribonucleotides) in length, from 1 to about
5 nucleotides in length, from 1 to about 4 nucleotides in length,
or from about 2 to about 4 nucleotides in length. In a particular
embodiment, the 3' overhang is present on both strands of the
siRNA, and is 2 nucleotides in length. For example, each strand of
the siRNA can comprise 3' overhangs of dithymidylic acid ("TT") or
diuridylic acid ("uu").
[0111] The siRNA can be produced chemically or biologically, or can
be expressed from a recombinant plasmid or viral vector, as
described above for the isolated miR gene products. Exemplary
methods for producing and testing dsRNA or siRNA molecules are
described in U.S. Published Patent Application No. 2002/0173478 to
Gewirtz and in U.S. Published Patent Application No. 2004/0018176
to Reich et al., the entire disclosures of both of which are
incorporated herein by reference.
[0112] Expression of a given miR gene can also be inhibited by an
antisense nucleic acid. As used herein, an "antisense nucleic acid"
refers to a nucleic acid molecule that binds to target RNA by means
of RNA-RNA, RNA-DNA or RNA-peptide nucleic acid interactions, which
alters the activity of the target RNA. Antisense nucleic acids
suitable for use in the present methods are single-stranded nucleic
acids (e.g., RNA, DNA, RNA-DNA chimeras, peptide nucleic acid
(PNA)) that generally comprise a nucleic acid sequence
complementary to a contiguous nucleic acid sequence in a miR gene
product. The antisense nucleic acid can comprise a nucleic acid
sequence that is 50-100% complementary, 75-100% complementary, or
95-100% complementary to a contiguous nucleic acid sequence in a
miR gene product. Nucleic acid sequences for the miR gene products
are provided in Tables la and lb. Without wishing to be bound by
any theory, it is believed that the antisense nucleic acids
activate RNase H or another cellular nuclease that digests the miR
gene product/antisense nucleic acid duplex.
[0113] Antisense nucleic acids can also contain modifications to
the nucleic acid backbone or to the sugar and base moieties (or
their equivalent) to enhance target specificity, nuclease
resistance, delivery or other properties related to efficacy of the
molecule. Such modifications include cholesterol moieties, duplex
intercalators, such as acridine, or one or more nuclease-resistant
groups.
[0114] Antisense nucleic acids can be produced chemically or
biologically, or can be expressed from a recombinant plasmid or
viral vector, as described above for the isolated miR gene
products. Exemplary methods for producing and testing are within
the skill in the art; see, e.g., Stein and Cheng (1993), Science
261:1004 and U.S. Pat. No. 5,849,902 to Woolf et al., the entire
disclosures of which are incorporated herein by reference.
[0115] Expression of a given miR gene can also be inhibited by an
enzymatic nucleic acid. As used herein, an "enzymatic nucleic acid"
refers to a nucleic acid comprising a substrate binding region that
has complementarity to a contiguous nucleic acid sequence of a miR
gene product, and which is able to specifically cleave the miR gene
product. The enzymatic nucleic acid substrate binding region can
be, for example, 50-100% complementary, 75-100% complementary, or
95-100%o complementary to a contiguous nucleic acid sequence in a
miR gene product. The enzymatic nucleic acids can also comprise
modifications at the base, sugar, and/or phosphate groups. An
exemplary enzymatic nucleic acid for use in the present methods is
a ribozyme.
[0116] The enzymatic nucleic acids can be produced chemically or
biologically, or can be expressed from a recombinant plasmid or
viral vector, as described above for the isolated miR gene
products. Exemplary methods for producing and testing dsRNA or
siRNA molecules are described in Werner and Uhlenbeck (1995), Nucl.
Acids Res. 23:2092-96; Hammann et al. (1999), Antisense and Nucleic
Acid Drug Dev. 9:25-31; and U.S. Pat. No. 4,987,071 to Cech et al,
the entire disclosures of which are incorporated herein by
reference.
[0117] Administration of at least one miR gene product, or at least
one compound for inhibiting miR expression, will inhibit the
proliferation of cancer cells in a subject who has a solid cancer.
As used herein, to "inhibit the proliferation of a cancer cell"
means to kill the cell, or permanently or temporarily arrest or
slow the growth of the cell Inhibition of cancer cell proliferation
can be inferred if the number of such cells in the subject remains
constant or decreases after administration of the miR gene products
or miR gene expression-inhibition compounds. An inhibition of
cancer cell proliferation can also be inferred if the absolute
number of such cells increases, but the rate of tumor growth
decreases.
[0118] The number of cancer cells in the body of a subject can be
determined by direct measurement, or by estimation from the size of
primary or metastatic tumor masses. For example, the number of
cancer cells in a subject can be measured by immunohistological
methods, flow cytometry, or other techniques designed to detect
characteristic surface markers of cancer cells.
[0119] The size of a tumor mass can be ascertained by direct visual
observation, or by diagnostic imaging methods, such as X-ray,
magnetic resonance imaging, ultrasound, and scintigraphy.
Diagnostic imaging methods used to ascertain size of the tumor mass
can be employed with or without contrast agents, as is known in the
art. The size of a tumor mass can also be ascertained by physical
means, such as palpation of the tissue mass or measurement of the
tissue mass with a measuring instrument, such as a caliper.
[0120] The miR gene products or miR gene expression-inhibition
compounds can be administered to a subject by any means suitable
for delivering these compounds to cancer cells of the subject. For
example, the miR gene products or miR expression-inhibition
compounds can be administered by methods suitable to transfect
cells of the subject with these compounds, or with nucleic acids
comprising sequences encoding these compounds. In one embodiment,
the cells are transfected with a plasmid or viral vector comprising
sequences encoding at least one miR gene product or miR gene
expression-inhibition compound.
[0121] Transfection methods for eukaryotic cells are well known in
the art, and include, e.g., direct injection of the nucleic acid
into the nucleus or pronucleus of a cell; electroporation; liposome
transfer or transfer mediated by lipophilic materials;
receptor-mediated nucleic acid delivery, bioballistic or particle
acceleration; calcium phosphate precipitation, and transfection
mediated by viral vectors.
[0122] For example, cells can be transfected with a liposomal
transfer compound, e.g., DOTAP
(N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium
methylsulfate, Boehringer-Mannheim) or an equivalent, such as
LIPOFECTIN. The amount of nucleic acid used is not critical to the
practice of the invention; acceptable results may be achieved with
0.1-100 micrograms of nucleic acid/10.sup.5 cells. For example, a
ratio of about 0.5 micrograms of plasmid vector in 3 micrograms of
DOTAP per 10.sup.5 cells can be used.
[0123] A miR gene product or miR gene expression-inhibition
compound can also be administered to a subject by any suitable
enteral or parenteral administration route. Suitable enteral
administration routes for the present methods include, e.g., oral,
rectal, or intranasal delivery. Suitable parenteral administration
routes include, e.g., intravascular administration (e.g.,
intravenous bolus injection, intravenous infusion, intra-arterial
bolus injection, intra-arterial infusion and catheter instillation
into the vasculature); peri- and intra-tissue injection (e.g.,
peri-tumoral and intra-tumoral injection, intra-retinal injection,
or subretinal injection); subcutaneous injection or deposition,
including subcutaneous infusion (such as by osmotic pumps); direct
application to the tissue of interest, for example by a catheter or
other placement device (e.g., a retinal pellet or a suppository or
an implant comprising a porous, non-porous, or gelatinous
material); and inhalation. Particularly suitable administration
routes are injection, infusion and direct injection into the
tumor.
[0124] In the present methods, a miR gene product or miR gene
product expression-inhibition compound can be administered to the
subject either as naked RNA, in combination with a delivery
reagent, or as a nucleic acid (e.g., a recombinant plasmid or viral
vector) comprising sequences that express the miR gene product or
miR gene product expression-inhibition compound. Suitable delivery
reagents include, e.g., the Mirus Transit TKO lipophilic reagent;
lipofectin; lipofectamine; cellfectin; polycations (e.g.,
polylysine), and liposomes.
[0125] Recombinant plasmids and viral vectors comprising sequences
that express the miR gene products or miR gene
expression-inhibition compounds, and techniques for delivering such
plasmids and vectors to cancer cells, are discussed herein and/or
are well known in the art.
[0126] In a particular embodiment, liposomes are used to deliver a
miR gene product or miR gene expression-inhibition compound (or
nucleic acids comprising sequences encoding them) to a subject.
Liposomes can also increase the blood half-life of the gene
products or nucleic acids. Suitable liposomes for use in the
invention can be formed from standard vesicle-forming lipids, which
generally include neutral or negatively charged phospholipids and a
sterol, such as cholesterol. The selection of lipids is generally
guided by consideration of factors, such as the desired liposome
size and half-life of the liposomes in the blood stream. A variety
of methods are known for preparing liposomes, for example, as
described in Szoka et al. (1980), Ann. Rev. Biophys. Bioeng. 9:467;
and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369,
the entire disclosures of which are incorporated herein by
reference.
[0127] The liposomes for use in the present methods can comprise a
ligand molecule that targets the liposome to cancer cells. Ligands
that bind to receptors prevalent in cancer cells, such as
monoclonal antibodies that bind to tumor cell antigens, are
preferred.
[0128] The liposomes for use in the present methods can also be
modified so as to avoid clearance by the mononuclear macrophage
system ("MMS") and reticuloendothelial system ("RES"). Such
modified liposomes have opsonization-inhibition moieties on the
surface or incorporated into the liposome structure. In a
particularly preferred embodiment, a liposome of the invention can
comprise both an opsonization-inhibition moiety and a ligand.
[0129] Opsonization-inhibiting moieties for use in preparing the
liposomes of the invention are typically large hydrophilic polymers
that are bound to the liposome membrane. As used herein, an
opsonization-inhibiting moiety is "bound" to a liposome membrane
when it is chemically or physically attached to the membrane, e.g.,
by the intercalation of a lipid-soluble anchor into the membrane
itself, or by binding directly to active groups of membrane lipids.
These opsonization-inhibiting hydrophilic polymers form a
protective surface layer that significantly decreases the uptake of
the liposomes by the MMS and RES; e.g., as described in U.S. Pat.
No. 4,920,016, the entire disclosure of which is incorporated
herein by reference.
[0130] Opsonization-inhibiting moieties suitable for modifying
liposomes are preferably water-soluble polymers with a
number-average molecular weight from about 500 to about 40,000
daltons, and more preferably from about 2,000 to about 20,000
daltons. Such polymers include polyethylene glycol (PEG) or
polypropylene glycol (PPG) derivatives; e.g., methoxy PEG or PPG,
and PEG or PPG stearate; synthetic polymers, such as polyacrylamide
or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric
polyamidoamines; polyacrylic acids; polyalcohols, e.g.,
polyvinylalcohol and polyxylitol to which carboxylic or amino
groups are chemically linked, as well as gangliosides, such as
ganglioside GM1. Copolymers of PEG, methoxy PEG, or methoxy PPG, or
derivatives thereof, are also suitable. In addition, the
opsonization-inhibiting polymer can be a block copolymer of PEG and
either a polyamino acid, polysaccharide, polyamidoamine,
polyethyleneamine, or polynucleotide. The opsonization-inhibiting
polymers can also be natural polysaccharides containing amino acids
or carboxylic acids, e.g., galacturonic acid, glucuronic acid,
mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid,
alginic acid, carrageenan; aminated polysaccharides or
oligosaccharides (linear or branched); or carboxylated
polysaccharides or oligosaccharides, e.g., reacted with derivatives
of carbonic acids with resultant linking of carboxylic groups.
Preferably, the opsonization-inhibiting moiety is a PEG, PPG, or a
derivative thereof. Liposomes modified with PEG or PEG-derivatives
are sometimes called "PEGylated liposomes."
[0131] The opsonization-inhibiting moiety can be bound to the
liposome membrane by any one of numerous well-known techniques. For
example, an N-hydroxysuccinimide ester of PEG can be bound to a
phosphatidyl-ethanolamine lipid-soluble anchor, and then bound to a
membrane. Similarly, a dextran polymer can be derivatized with a
stearylamine lipid-soluble anchor via reductive amination using
Na(CN)BH.sub.3 and a solvent mixture, such as tetrahydrofuran and
water in a 30:12 ratio at 60.degree. C.
[0132] Liposomes modified with opsonization-inhibition moieties
remain in the circulation much longer than unmodified liposomes.
For this reason, such liposomes are sometimes called "stealth"
liposomes. Stealth liposomes are known to accumulate in tissues fed
by porous or "leaky" microvasculature. Thus, tissue characterized
by such microvasculature defects, for example, solid tumors, will
efficiently accumulate these liposomes; see Gabizon, et al. (1988),
Proc. Natl. Acad. Sci., U.S.A., 18:6949-53. In addition, the
reduced uptake by the RES lowers the toxicity of stealth liposomes
by preventing significant accumulation of the liposomes in the
liver and spleen. Thus, liposomes that are modified with
opsonization-inhibition moieties are particularly suited to deliver
the miR gene products or miR gene expression-inhibition compounds
(or nucleic acids comprising sequences encoding them) to tumor
cells.
[0133] The miR gene products or miR gene expression-inhibition
compounds can be formulated as pharmaceutical compositions,
sometimes called "medicaments," prior to administering them to a
subject, according to techniques known in the art. Accordingly, the
invention encompasses pharmaceutical compositions for treating a
solid cancer. In one embodiment, the pharmaceutical composition
comprises at least one isolated miR gene product, or an isolated
variant or biologically-active fragment thereof, and a
pharmaceutically-acceptable carrier. In a particular embodiment,
the at least one miR gene product corresponds to a miR gene product
that has a decreased level of expression in solid cancer cells
relative to suitable control cells. In certain embodiments the
isolated miR gene product is selected from the group consisting of
miR-145, miR-155, miR-218-2 combinations thereof.
[0134] In other embodiments, the pharmaceutical compositions of the
invention comprise at least one miR expression-inhibition compound.
In a particular embodiment, the at least one miR gene
expression-inhibition compound is specific for a miR gene whose
expression is greater in solid cancer cells than control cells. In
certain embodiments, the miR gene expression-inhibition compound is
specific for one or more miR gene products selected from the group
consisting of miR-21, miR-17-5p, miR-191, miR-29b-2, miR-223,
miR-128b, miR-199a-1, miR-24-1, miR-24-2, miR-146, miR-155,
miR-181b-1, miR-20a, miR-107, miR-32, miR-92-2, miR-214, miR-30c,
miR-25, miR-221, miR-106a and combinations thereof.
[0135] Pharmaceutical compositions of the present invention are
characterized as being at least sterile and pyrogen-free. As used
herein, "pharmaceutical compositions" include formulations for
human and veterinary use. Methods for preparing pharmaceutical
compositions of the invention are within the skill in the art, for
example as described in Remington's Pharmaceutical Science, 17th
ed., Mack Publishing Company, Easton, Pa. (1985), the entire
disclosure of which is incorporated herein by reference.
[0136] The present pharmaceutical compositions comprise at least
one miR gene product or miR gene expression-inhibition compound (or
at least one nucleic acid comprising sequences encoding them)
(e.g., 0.1 to 90% by weight), or a physiologically-acceptable salt
thereof, mixed with a pharmaceutically-acceptable carrier. In
certain embodiments, the pharmaceutical compositions of the
invention additionally comprise one or more anti-cancer agents
(e.g., chemotherapeutic agents).The pharmaceutical formulations of
the invention can also comprise at least one miR gene product or
miR gene expression-inhibition compound (or at least one nucleic
acid comprising sequences encoding them), which are encapsulated by
liposomes and a pharmaceutically-acceptable carrier. In one
embodiment, the pharmaceutical composition comprises a miR gene or
gene product that is not miR-15 and/or miR-16.
[0137] Especially suitable pharmaceutically-acceptable carriers are
water, buffered water, normal saline, 0.4% saline, 0.3% glycine,
hyaluronic acid and the like.
[0138] In a particular embodiment, the pharmaceutical compositions
of the invention comprise at least one miR gene product or miR gene
expression-inhibition compound (or at least one nucleic acid
comprising sequences encoding them) that is resistant to
degradation by nucleases. One skilled in the art can readily
synthesize nucleic acids that are nuclease resistant, for example,
by incorporating one or more ribonucleotides that is modified at
the 2'-position into the miR gene product. Suitable 2'-modified
ribonucleotides include those modified at the 2'-position with
fluoro, amino, alkyl, alkoxy, and O-allyl.
[0139] Pharmaceutical compositions of the invention can also
comprise conventional pharmaceutical excipients and/or additives.
Suitable pharmaceutical excipients include stabilizers,
antioxidants, osmolality adjusting agents, buffers, and pH
adjusting agents. Suitable additives include, e.g., physiologically
biocompatible buffers (e.g., tromethamine hydrochloride), additions
of chelants (such as, for example, DTPA or DTPA-bisamide) or
calcium chelate complexes (such as, for example, calcium DTPA,
CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium
salts (for example, calcium chloride, calcium ascorbate, calcium
gluconate or calcium lactate). Pharmaceutical compositions of the
invention can be packaged for use in liquid form, or can be
lyophilized.
[0140] For solid pharmaceutical compositions of the invention,
conventional nontoxic solid pharmaceutically-acceptable carriers
can be used; for example, pharmaceutical grades of mannitol,
lactose, starch, magnesium stearate, sodium saccharin, talcum,
cellulose, glucose, sucrose, magnesium carbonate, and the like.
[0141] For example, a solid pharmaceutical composition for oral
administration can comprise any of the carriers and excipients
listed above and 10-95%, preferably 25%-75%, of the at least one
miR gene product or miR gene expression-inhibition compound (or at
least one nucleic acid comprising sequences encoding them). A
pharmaceutical composition for aerosol (inhalational)
administration can comprise 0.01-20% by weight, preferably 1%-10%
by weight, of the at least one miR gene product or miR gene
expression-inhibition compound (or at least one nucleic acid
comprising sequences encoding them) encapsulated in a liposome as
described above, and a propellant. A carrier can also be included
as desired; e.g., lecithin for intranasal delivery.
[0142] The pharmaceutical compositions of the invention can further
comprise one or more anti-cancer agents. In a particular
embodiment, the compositions comprise at least one miR gene product
or miR gene expression-inhibition compound (or at least one nucleic
acid comprising sequences encoding them) and at least one
chemotherapeutic agent. Chemotherapeutic agents that are suitable
for the methods of the invention include, but are not limited to,
DNA-alkylating agents, anti-tumor antibiotic agents, anti-metabolic
agents, tubulin stabilizing agents, tubulin destabilizing agents,
hormone antagonist agents, topoisomerase inhibitors, protein kinase
inhibitors, HMG-CoA inhibitors, CDK inhibitors, cyclin inhibitors,
caspase inhibitors, metalloproteinase inhibitors, antisense nucleic
acids, triple-helix DNAs, nucleic acids aptamers, and
molecularly-modified viral, bacterial and exotoxic agents. Examples
of suitable agents for the compositions of the present invention
include, but are not limited to, cytidine arabinoside,
methotrexate, vincristine, etoposide (VP-16), doxorubicin
(adriamycin), cisplatin (CDDP), dexamethasone, arglabin,
cyclophosphamide, sarcolysin, methylnitrosourea, fluorouracil,
5-fluorouracil (5FU), vinblastine, camptothecin, actinomycin-D,
mitomycin C, hydrogen peroxide, oxaliplatin, irinotecan, topotecan,
leucovorin, carmustine, streptozocin, CPT-11, taxol, tamoxifen,
dacarbazine, rituximab, daunorubicin,
1-.beta.-D-arabinofuranosylcytosine, imatinib, fludarabine,
docetaxel, FOLFOX4.
[0143] The invention also encompasses methods of identifying an
inhibitor of tumorigenesis, comprising providing a test agent to a
cell and measuring the level of at least one miR gene product in
the cell. In one embodiment, the method comprises providing a test
agent to a cell and measuring the level of at least one miR gene
product associated with decreased expression levels in cancer
cells. An increase in the level of the miR gene product in the cell
after the agent is provided, relative to a suitable control cell
(e.g., agent is not provided), is indicative of the test agent
being an inhibitor of tumorigenesis. In a particular embodiment, at
least one miR gene product associated with decreased expression
levels in cancer cells is selected from the group consisting of
miR-145, miR-155, miR-218-2 and combinations thereof.
[0144] In other embodiments the method comprises providing a test
agent to a cell and measuring the level of at least one miR gene
product associated with increased expression levels in cancer
cells. A decrease in the level of the miR gene product in the cell
after the agent is provided, relative to a suitable control
cell(e.g., agent is not provided), is indicative of the test agent
being an inhibitor of tumorigenesis. In a particular embodiment, at
least one miR gene product associated with increased expression
levels in cancer cells is selected from the group consisting of
miR-21, miR-17-5p, miR-191, miR-29b-2, miR-223, miR-128b,
miR-199a-1, miR-24-1, miR-24-2, miR-146, miR-155, miR-181b-1,
miR-20a, miR-107, miR-32, miR-92-2, miR-214, miR-30c, miR-25,
miR-221, miR-106a.
[0145] Suitable agents include, but are not limited to drugs (e.g.,
small molecules, peptides), and biological macromolecules (e.g.,
proteins, nucleic acids). The agent can be produced recombinantly,
synthetically, or it may be isolated (i.e., purified) from a
natural source. Various methods for providing such agents to a cell
(e.g., transfection) are well known in the art, and several of such
methods are described hereinabove. Methods for detecting the
expression of at least one miR gene product (e.g., Northern
blotting, in situ hybridization, RT-PCR, expression profiling) are
also well known in the art. Several of these methods are also
described hereinabove.
[0146] The invention will now be illustrated by the following
non-limiting examples.
EXEMPLIFICATION
[0147] The following Materials and Methods were used in the
Examples:
[0148] Samples
[0149] A total of 540 samples, including 363 primary tumor samples
and 177 normal tissues, were used in this study (Table 2). The
following solid cancers were represented: lung carcinoma, breast
carcinoma, prostate carcinoma, stomach carcinoma, colon carcinoma
and pancreatic endocrine tumors. All samples were obtained with
informed consent from each patient and were confirmed
histologically. Normal samples were paired with samples from
individuals affected with lung and stomach carcinoma, and from
normal individuals for the remaining tissues. All normal breast
samples were obtained by pooling 5 unrelated normal tissues. Total
RNA was isolated from tissues using TRIzol.TM. reagent
(Invitrogen), according to manufacturer's instructions.
[0150] MicroRNA Microarrays.
[0151] Microarray analysis was performed as previously described
(Liu, C.-G., et al., Proc. Natl. Acad. Sci. USA 101: 11755-11760
(2004)). Briefly, 5 .mu.g of total RNA was used for hybridization
on miRNA microarray chips. These chips contain gene-specific 40-mer
oligonucleotide probes, spotted by contacting technologies and
covalently attached to a polymeric matrix. The microarrays were
hybridized in 6.times.SSPE (0.9 M NaCl/60 mM
NaH.sub.2PO.sub.4.H.sub.2O/8 mM EDTA, pH 7.4)/30% formamide at
25.degree. C. for 18 hr, washed in 0.75.times.TNT
(Tris-HCl/NaCl/Tween 20) at 37.degree. C. for 40 min, and processed
using direct detection of the biotin-labeled transcripts by
streptavidin-Alexa647 (Molecular Probes) conjugate. Processed
slides were scanned using a microarray scanner (GenePix Pro, Axon),
with the laser set to 635 nm, at fixed PMT setting and a scan
resolution of 10 mm The data were confirmed by Northern blotting as
described (Calin, G. A., et al., Proc. Natl. Acad. Sci. USA
101:11755-11760 (2004); Iorio, M. V., et al., Cancer Res. 65:
7065-7070 (2005)).
TABLE-US-00003 TABLE 2 Samples used in the study (tumors and
corresponding normals). Tumour type Cancer Samples Normal Samples
Lung carcinoma 123 123 Breast carcinoma 79 6* Colon carcinoma 46 8
Gastric carcinoma 20 21 Endocrine pancreatic tumours 39 12 Prostate
cancer 56 7 All tissues (527) 363 177 *Pools of 5 unrelated normal
breast tissues per sample (for a total of 30 unrelated
individuals).
[0152] Computational Analysis.
[0153] Microarray images were analyzed using GenePix Pro (Axon).
Average values of the replicate spots of each miRNA were
background-subtracted, normalized and subjected to further
analysis. Normalization was performed by using a per chip median
normalization method, using the median array as a reference.
Finally, miRNAs measured as present in at least the smallest of the
two classes in a dataset were selected. Absent calls were
thresholded to 4.5 prior to statistical analysis. This level is the
average minimum intensity level detected in the experiments.
MicroRNA nomenclature was according to the Genome Browser and the
microRNA database at Sanger Center (Griffiths-Jones, S., Nucleic
Acids Res 32: D109-11(2004)); in case of discrepancies we followed
the microRNA database. Differentially-expressed microRNAs were
identified by using the t test procedure within significance
analysis of microarrays (SAM)(Tusher, V. G., et al., Proc Natl Acad
Sci USA 98: 5116-21 (2001). SAM calculates a score for each gene on
the basis of the change in expression relative to the standard
deviation of all measurements. Within SAM, t test was used. The
microRNA signatures were determined by applying nearest shrunken
centroids method. This method identifies a subgroup of genes that
best characterizes each solid cancer from its respective normal
counterpart. The prediction error was calculated by means of
10-fold cross validation, and for each cancer, we obtained the miR
signature that resulted in the minimal prediction error. A
resampling test was performed by random permutation analysis to
compute the p-value of the shared signature.
EXAMPLE 1
Identification of a MicroRNA Expression Signature in Human Solid
Cancers Statistics
[0154] The combined cancers/normal tissue comparison was conducted
using a reduced number of lung samples (80 cancer and 40 normal
samples), in order to balance the different tissues numerically,
yielding a total of 404 samples. For statistical analysis, 137
miRs, whose expression values were above 256 (threshold value) in
at least 50% of the samples, were retained from the 228 that were
measured. A T test was used to identify differentially-expressed
microRNAs (Table 3). The p-values of the T test were corrected for
multiple testing procedures and to control Type I error rates.
Adjusted p-values were obtained by performing resampling with
500,000 permutations (Jung, S. H., et al. Biostatistics 6: 157-69
(2005)). This analysis was performed in order to evaluate the
results by using the same method as Lu and co-workers (Lu, J., et
al., Nature 435: 834-8(2005)).
[0155] As an alternative to T test, significance analysis of
microarrays (SAM) was used to identify differentially-expressed
microRNAs. This procedure allows for the control of false detection
rate (FDR). The delta was chosen to result in an FDR less than or
equal to 0.01. microRNA subsets which result in the best tumor
classification, i.e., which best predict the two classes (cancer
and normal), were then identified using the method of the nearest
shrunken centroids, as implemented in PAM (prediction analysis of
microarray). The prediction error was calculated by means of
10-fold cross validation. The microRNAs were selected yielding the
minimum misclassification error after cross-validation.
[0156] Results
[0157] By T-test, 43 differentially-expressed miRs with an adjusted
p-value below 0.05 were obtained (Table 3). Twenty six miRs were
overexpressed and 17 were under-expressed relative to corresponding
normal tissues when the six solid cancers are grouped together
(breast, colon, lung, pancreas, prostate, stomach). These results
indicated that the spectrum of expressed miRNAs in solid cancers is
very different from that of normal cells (43 out of 137 miRNAs,
31%). Using SAM, 49 miRNAs were identified as
differentially-expressed, of which 34 were up-regulated (Table 4).
Using PAM, 36 over-expressed miRNAs in cancer (indicated by
positive cancer scores) and 21 down-regulated miRs (indicated by
negative cancer scores) were identified as differentially-expressed
(Table 5). However, these analyses are not tailored to identify
alterations in miR expression that consistently result in
transformation, because miR expression is heavily tissue-specific
(He, L., et al. Nature 435: 828-833 (2005); also see FIG. 1 and
FIG. 2).
[0158] The clustering of miRs based on expression profiles derived
from 363 solid cancer and 177 normal samples using 228 miRs is
shown in FIG. 1. The tree, which shows a very good separation
between the different tissues, was constructed using 137 different
miRNAs that were expressed in at least 50% of the samples used in
the study.
TABLE-US-00004 TABLE 3 Differentially regulated miRs in 6 solid
cancer types vs. normal tissues (T test stats.)*. Cancer Normal miR
ID Mean Mean Test stat Raw p Adj p miR-21 #47 11.538663 9.648338
7.861136 2.00E-06 2.00E-06 miR-141 #137 9.024091 7.905398 6.238014
2.00E-06 2.00E-06 miR-212 #208 13.540651 14.33617 -6.57942 2.00E-06
2.00E-06 miR-128a prec #113 12.32588 13.522675 -6.76388 2.00E-06
2.00E-06 miR-138-2 #133 11.739557 13.144746 -7.01204 2.00E-06
2.00E-06 miR-218-2 #221 11.279787 12.539366 -7.40557 2.00E-06
2.00E-06 miR-23b #51 14.169748 15.949736 -8.37744 2.00E-06 2.00E-06
miR-195 #184 10.343991 9.172985 5.763262 2.00E-06 1.00E-05 miR-212
prec #209 12.686966 13.661763 -5.83132 4.00E-06 1.00E-05 miR-29b-2
#95 11.27556 9.940731 5.660854 2.00E-06 1.40E-05 miR-199a-1 #191
10.032008 8.920183 5.528849 2.00E-06 3.00E-05 miR-9-3 #28 11.461922
12.570412 -5.43006 2.00E-06 4.60E-05 miR-128a #114 13.024235
13.856624 -5.35102 6.00E-06 7.20E-05 let-7a-1 #1 12.616569
13.455246 -5.35346 2.00E-06 7.20E-05 let-7b #5 13.42636 14.068521
-5.17701 1.00E-05 0.000146 miR-16-2 #39 10.460707 9.305895 5.048375
4.00E-06 0.000224 miR-199a-2 #192 9.714225 8.759237 4.862553
1.00E-05 0.000494 miR-152 prec #151 11.388676 12.357529 -4.83716
2.00E-06 0.00053 miR-16-1 #38 10.443169 9.338182 4.755258 1.00E-05
0.00071 miR-30d #72 13.982017 14.775206 -4.5707 1.20E-05 0.001476
miR-34a #78 10.675566 9.63769 4.467301 2.60E-05 0.00217 miR-17-5p
#41 11.567244 10.281468 4.341834 3.80E-05 0.0034 miR-128b #115
10.930395 9.947746 4.304764 3.80E-05 0.003912 miR-20a #46 11.409852
10.19284 4.304678 3.20E-05 0.003912 miR-181b-1 prec #211 9.577504
8.804294 4.285968 4.80E-05 0.004126 miR-132 #121 9.599947 8.775966
4.284737 5.60E-05 0.004126 miR-200b #195 9.475221 8.527243 4.221511
4.00E-05 0.0052 let-7a-3 #4 10.436089 9.511546 4.08952 0.000104
0.008242 miR-138-1 #132 8.299613 9.200253 -4.05204 5.60E-05 0.00931
miR-29c #65 11.291005 10.326912 4.019385 0.000144 0.010312 miR-29a
#62 11.381359 10.461075 4.013697 0.00015 0.010398 miR-96 #86
11.37218 12.136636 -3.94825 0.000138 0.012962 miR-191 #177
13.498207 12.729872 3.817228 0.000158 0.02015 miR-27a #59 10.399338
9.548582 3.715048 0.000344 0.028096 let-7g #15 10.819688 10.01157
3.653239 0.000426 0.033874 miR-9-1 #24 10.102819 9.212988 3.651886
0.000388 0.033874 miR-125a #107 10.960998 10.005312 3.651356
0.000452 0.033874 miR-95 #84 9.435733 8.751331 3.59406 0.000478
0.039594 miR-155 #157 12.505359 13.231221 -3.58369 0.000614
0.040394 miR-199b #194 9.755066 9.082751 3.55934 0.000588 0.04314
miR-24-2 #54 12.611696 11.612557 3.518774 0.00087 0.048278 let-7e
#11 12.497795 13.055093 -3.51589 0.00054 0.048354 miR-92-1 #81
16.081074 16.592426 -3.50446 0.000928 0.049828 *Forty-three miRs
have an adjusted p-value lower than 0.05. Twenty-six miRs are
overexpressed and 17 down-regulated in breast, colon, lung,
pancreas, prostate, stomach carcinomas.
TABLE-US-00005 TABLE 4 Differentially regulated miRs in 6 solid
cancer types vs. normal tissues (SAM, significance analysis of
microarrays)*. miR ID d.value stdev p.value q.value R.fold miR-21
#47 3.156 0.24 0 0 2.593 miR-23b #51 -3.117 0.212 0 0 0.443
miR-138-2 #133 -2.514 0.2 0 0 0.402 miR-218-2 #221 -2.383 0.17 0 0
0.384 miR-29b-2 #95 2.246 0.236 0 0 1.868 miR-128a prec #113 -2.235
0.177 0 0 0.368 miR-195 #184 2.085 0.203 0 0 1.695 miR-141 #137
2.08 0.179 0 0 2.459 miR-199a-1 #191 1.987 0.201 0 0 1.945 miR-9-3
#28 -1.97 0.204 0 0 0.433 miR-16-2 #39 1.966 0.229 0 0 1.788
miR-17-5p #41 1.964 0.296 0 0 0.725 miR-20a #46 1.898 0.283 0 0
0.969 miR-16-1 #38 1.87 0.232 0 0 1.447 miR-212 prec #209 -1.854
0.167 0 0 0.509 miR-34a #78 1.756 0.232 0 0 1.219 miR-152 prec #151
-1.734 0.2 0 0 0.46 miR-199a-2 #192 1.721 0.196 0 0 1.838 miR-128b
#115 1.674 0.228 0 0 1.266 miR-212 #208 -1.659 0.121 0 0 0.627
let-7a-1 #1 -1.628 0.157 0 0 0.461 miR-200b #195 1.626 0.225 0 0
1.432 miR-128a #114 -1.619 0.156 0 0 0.511 miR-29c #65 1.611 0.24 0
0 1.225 let-7a-3 #4 1.581 0.226 0 0 1.109 miR-29a #62 1.565 0.229 0
0 1.706 miR-24-2 #54 1.555 0.284 0 0 0.831 miR-138-1 #132 -1.551
0.222 0 0 0.432 miR-125a #107 1.541 0.262 0 0 1.164 miR-106a #99
1.514 0.275 0 0 0.952 miR-132 #121 1.496 0.192 0 0 2.158 miR-30d
#72 -1.491 0.174 0 0 0.424 miR-9-1 #24 1.478 0.244 0 0 0.763
miR-27a #59 1.448 0.229 0 0 1.174 miR-181b-1 prec #211 1.435 0.18 0
0 1.525 let-7g #15 1.394 0.221 0 0 1.072 miR-96 #86 -1.384 0.194 0
0 0.519 miR-191 #177 1.372 0.201 0 0 1.165 miR-93-1 #83 1.363 0.266
0 0 0.775 miR-136 #130 -1.355 0.267 0 0 0.364 miR-205 #201 1.343
0.309 0 0 1.281 miR-185 #170 1.287 0.222 0.001 0.001 0.609
miR-125b-1 #109 1.262 0.283 0.001 0.001 1.215 miR-10a #30 1.252
0.227 0.001 0.001 1.643 miR-95 #84 1.247 0.19 0.001 0.001 1.509
miR-199b #194 1.228 0.189 0.001 0.001 1.246 miR-10b #32 1.219 0.232
0.002 0.001 1.342 let-7i #10 1.216 0.203 0.002 0.001 1.026 miR-210
#205 1.213 0.237 0.002 0.001 1.088 *Thirty five miRs are
over-expressed and 14 are down-regulated in breast, colon, lung,
pancreas, prostate, stomach carcinomas (Delta = 0.9, FDR =
0.001).
TABLE-US-00006 TABLE 5 MicroRNAs selected by PAM (prediction
analysis of microarray) in 6 solid cancer types vs. normal tissues
miR ID Solid cancer score Normal tissues score miR-21 #47 0.0801
-0.2643 miR-138-2 #133 -0.055 0.1815 miR-218-2 #221 -0.0535 0.1765
miR-23b #51 -0.0516 0.17 miR-128a prec #113 -0.0498 0.1642
miR-29b-2 #95 0.0457 -0.1508 miR-195 #184 0.0404 -0.1333 miR-17-5p
#41 0.0383 -0.1263 miR-9-3 #28 -0.0357 0.1176 miR-212 prec #209
-0.0342 0.1129 miR-20a #46 0.0322 -0.1061 miR-141 #137 0.0322
-0.1061 miR-199a-1 #191 0.0319 -0.1053 miR-16-2 #39 0.0315 -0.1037
miR-152 prec #151 -0.0283 0.0933 miR-16-1 #38 0.0277 -0.0913
miR-34a #78 0.0269 -0.0886 miR-212 #208 -0.0265 0.0875 let-7a-1 #1
-0.0264 0.0872 miR-128a #114 -0.0259 0.0855 miR-128b #115 0.0254
-0.0839 miR-24-2 #54 0.0244 -0.0803 miR-29c #65 0.0224 -0.0738
miR-199a-2 #192 0.0223 -0.0736 let-7a-3 #4 0.0221 -0.073 miR-191
#177 0.0188 -0.062 miR-125a #107 0.0186 -0.0613 miR-30d #72 -0.0185
0.061 miR-29a #62 0.0184 -0.0608 miR-106a #99 0.0177 -0.0584
miR-93-1 #83 0.0163 -0.0537 miR-200b #195 0.0159 -0.0524 let-7g #15
0.0158 -0.0521 miR-27a #59 0.0157 -0.0518 miR-96 #86 -0.0156 0.0514
let-7b #5 -0.0152 0.0501 miR-138-1 #132 -0.0151 0.0499 miR-9-1 #24
0.0136 -0.0448 miR-181b-1 prec #211 0.0134 -0.0442 miR-155 #157
-0.0128 0.0423 miR-132 #121 0.0127 -0.0418 miR-136 #130 -0.0112
0.037 let-7i #10 0.0103 -0.034 miR-210 #205 0.0074 -0.0245 miR-205
#201 0.0073 -0.024 *. miR-185 #170 0.0071 -0.0234 miR-24-1 #52
0.007 -0.023 miR-199b #194 0.0064 -0.021 miR-125b-1 #109 0.006
-0.0199 miR-206 prec #203 -0.005 0.0166 miR-10a #30 0.0045 -0.015
miR-95 #84 0.0045 -0.0149 let-7e #11 -0.0039 0.013 miR-124a-3 #106
-0.0028 0.0091 miR-10b #32 0.002 -0.0066 miR-185 prec #171 -0.0014
0.0047 miR-92-1 #81 -2.00E-04 5.00E-04 *T = 1.5 and
misclassification error = 0.176. Thirty six over-expressed miRs in
cancer are indicated by positive cancer scores; 21 down-regulated
miRs are indicated by negative cancer scores.
EXAMPLE 2
Identification of MicroRNA Expression Signatures Associated with
Various Human Solid Cancers
[0159] Results
[0160] To identify microRNAs that are prognostic for cancer status
associated with solid tumors, without incurring bias due to tissue
specificity, an alternative approach was used. First, six
tissue-specific signatures, one for each cancer histotype, were
obtained by performing independent PAM tests (summarized in Tables
6 and 7) Specific signatures for each cancer are shown in Tables
8-13: e.g., breast-Table 8; colon-Table 9; lung-Table 10;
pancreas-Table 11; prostate-Table 12; stomach-Table 13. Using these
data, deregulated microRNAs that were shared among the different
histotype miRNA signatures were identified (Table 14). In order to
compute the p-values for this comparative analysis, a re-sampling
test with 1,000,000 random permutations on the miRNA identity was
performed. The p-value was defined as the relative frequency of
simulation scores exceeding the real score. Twenty-one misregulated
microRNAs that were common to at least 3 types of solid cancers
(p-value=2.5.times.10.sup.-3) were identified (Table 14).
TABLE-US-00007 TABLE 6 MicroRNAs used to classify human cancers and
normal tissues*. Up- Down- regulated regulated Misclassification
error after 10 fold Cancer miRs miRs cross validation Breast 15 12
0.08 Colon 21 1 0.09 Lung 35 3 0.31 Pancreas 55 2 0.02 Prostate 39
6 0.11 Stomach 22 6 0.19 *Median normalization was performed and
the method of the nearest shrunken centroids was used to select
predictive miRNAs.
TABLE-US-00008 TABLE 7 Deregulated microRNAs in solid common
cancers*. PAM Up- PAM Down- SAM Down- Cancer regulated SAM
Up-regulated regulated regulated Breast 15 3 (FDR = 0.33) 12 47
Colon 21 42 (FDR <= 0.06) 1 5 Lung 35 38 (FDR <= 0.01) 3 3
Pancreas 55 50 (FDR <= 0.01) 2 8 Stomach 22 22 (FDR = 0.06) 6 4
Prostate 39 49 (FDR = 0.06) 6 3 *Prediction analysis of microarrays
(PAM) identifies those genes which best characterize cancers and
normal tissues, whilst significance analysis of microarrays (SAM)
identifies all those which have differential expression in the two
classes. False detection rates (FDR) computed in SAM are indicated
in parenthesis.
TABLE-US-00009 TABLE 8 MicroRNAs selected by prediction analysis of
microarray (PAM) in breast cancer (cancer vs. normal tissues)*. miR
Cancer score Normal score miR-21 (#47) 0.0331 -0.4364 miR-29b-2
(#95) 0.0263 -0.3467 miR-146 (#144) 0.0182 -0.2391 miR-125b-2
(#111) -0.0174 0.2286 miR-125b-1 (#109) -0.0169 0.222 miR-10b (#32)
-0.0164 0.2166 miR-145 (#143) -0.0158 0.2076 miR-181a (#158) 0.0153
-0.201 miR-140 (#136) -0.0122 0.1613 miR-213 (#160) 0.0116 -0.1527
miR-29a prec (#63) 0.0109 -0.1441 miR-181b-1 (#210) 0.0098 -0.1284
miR-199b (#194) 0.0089 -0.1172 miR-29b-1 (#64) 0.0084 -0.1111
miR-130a (#120) -0.0076 0.1001 miR-155 (#157) 0.0072 -0.0951
let-7a-2 (#3) -0.0042 0.0554 miR-205 (#201) -0.004 0.0533 miR-29c
(#65) 0.0032 -0.0423 miR-224 (#228) -0.003 0.0399 miR-100 (#91)
-0.0021 0.0283 miR-31 (#73) 0.0017 -0.022 miR-30c (#70) -7.00E-04
0.009 miR-17-5p (#41) 7.00E-04 -0.0089 miR-210 (#205) 4.00E-04
-0.0057 miR-122a (#101) 4.00E-04 -0.005 miR-16-2 (#39) -1.00E-04
0.0013 *27 miRs selected, misclassification error after cross
validation of 0.008. Seventeen overexpressed miRs in cancer are
indicated by positive cancer scores; 12 down-regulated miRs are
indicated by negative cancer scores.
TABLE-US-00010 TABLE 9 MicroRNAs selected by prediction analysis of
microarray (PAM) in colon (cancer vs. normal tissues)*. miR Cancer
score Normal score miR-24-1 (#52) 0.0972 -0.5589 miR-29b-2 (#95)
0.0669 -0.3845 miR-20a (#46) 0.0596 -0.3424 miR-10a (#30) 0.0511
-0.2938 miR-32 (#75) 0.0401 -0.2306 miR-203 (#197) 0.0391 -0.2251
miR-106a (#99) 0.0364 -0.2094 miR-17-5p (#41) 0.0349 -0.2005
miR-30c (#70) 0.0328 -0.1888 miR-223 (#227) 0.0302 -0.1736 miR-126*
(#102) 0.0199 -0.1144 miR-128b (#115) 0.0177 -0.102 miR-21 (#47)
0.0162 -0.0929 miR-24-2 (#54) 0.0145 -0.0835 miR-99b prec (#88)
0.0125 -0.0721 miR-155 (#157) 0.0092 -0.0528 miR-213 (#160) 0.0091
-0.0522 miR-150 (#148) 0.0042 -0.0243 miR-107 (#100) 0.003 -0.0173
miR-191 (#177) 0.0028 -0.0159 miR-221 (#224) 0.002 -0.0116 miR-9-3
(#28) -0.0014 0.0083 *22 miRs selected, misclassification error
after cross validation of 0.09. Twenty-one over-expressed miRs in
cancer are indicated by positive cancer scores; 1 down-regulated
miR is indicated by a negative cancer score.
TABLE-US-00011 TABLE 10 MicroRNAs selected by prediction analysis
of microarray (PAM) in lung cancer (cancer vs. normal tissues)*.
miR Cancer score Normal score miR-21 (#47) 0.175 -0.175 miR-205
(#201) 0.1317 -0.1317 miR-200b (#195) 0.1127 -0.1127 miR-9-1 (#24)
0.1014 -0.1014 miR-210 (#205) 0.0994 -0.0994 miR-148 (#146) 0.0737
-0.0737 miR-141 (#137) 0.0631 -0.0631 miR-132 (#121) 0.0586 -0.0586
miR-215 (#213) 0.0575 -0.0575 miR-128b (#115) 0.0559 -0.0559 let-7g
(#15) 0.0557 -0.0557 miR-16-2 (#39) 0.0547 -0.0547 miR-129-1/2 prec
(#118) 0.0515 -0.0515 miR-126* (#102) -0.0406 0.0406 miR-142-as
(#139) 0.0366 -0.0366 miR-30d (#72) -0.0313 0.0313 miR-30a-5p (#66)
-0.0297 0.0297 miR-7-2 (#21) 0.0273 -0.0273 miR-199a-1 (#191)
0.0256 -0.0256 miR-127 (#112) 0.0254 -0.0254 miR-34a prec (#79)
0.0214 -0.0214 miR-34a (#78) 0.0188 -0.0188 miR-136 (#130) 0.0174
-0.0174 miR-202 (#196) 0.0165 -0.0165 miR-196-2 (#188) 0.0134
-0.0134 miR-199a-2 (#192) 0.0126 -0.0126 let-7a-2 (#3) 0.0109
-0.0109 miR-124a-1 (#104) 0.0081 -0.0081 miR-149 (#147) 0.0079
-0.0079 miR-17-5p (#41) 0.0061 -0.0061 miR-196-1 prec (#186) 0.0053
-0.0053 miR-10a (#30) 0.0049 -0.0049 miR-99b prec (#88) 0.0045
-0.0045 miR-196-1 (#185) 0.0044 -0.0044 miR-199b (#194) 0.0039
-0.0039 miR-191 (#177) 0.0032 -0.0032 miR-195 (#184) 7.00E-04
-7.00E-04 miR-155 (#157) 7.00E-04 -7.00E-04 *38 miRs selected,
misclassification error after cross validation of 0.31. Thirty-five
over-expressed miRs in cancer are indicated by positive cancer
scores; 3 down-regulated miRs are indicated by negative cancer
scores.
TABLE-US-00012 TABLE 11 MicroRNAs selected by prediction analysis
of microarray (PAM) in pancreatic cancer (cancer vs. normal
tissues)*. miR Cancer score Normal score miR-103-2 (#96) 0.4746
-1.582 miR-103-1 (#97) 0.4089 -1.3631 miR-24-2 (#54) 0.4059 -1.3529
miR-107 (#100) 0.3701 -1.2336 miR-100 (#91) 0.3546 -1.182
miR-125b-2 (#111) 0.3147 -1.0489 miR-125b-1 (#109) 0.3071 -1.0237
miR-24-1 (#52) 0.2846 -0.9488 miR-191 (#177) 0.2661 -0.887 miR-23a
(#50) 0.2586 -0.8619 miR-26a-1 (#56) 0.2081 -0.6937 miR-125a (#107)
0.1932 -0.644 miR-130a (#120) 0.1891 -0.6303 miR-26b (#58) 0.1861
-0.6203 miR-145 (#143) 0.1847 -0.6158 miR-221 (#224) 0.177 -0.59
miR-126* (#102) 0.1732 -0.5772 miR-16-2 (#39) 0.1698 -0.5659
miR-146 (#144) 0.1656 -0.552 miR-214 (#212) 0.1642 -0.5472 miR-99b
(#89) 0.1636 -0.5454 miR-128b (#115) 0.1536 -0.512 miR-155 (#157)
-0.1529 0.5098 miR-29b-2 (#95) 0.1487 -0.4956 miR-29a (#62) 0.1454
-0.4848 miR-25 (#55) 0.1432 -0.4775 miR-16-1 (#38) 0.1424 -0.4746
miR-99a (#90) 0.1374 -0.4581 miR-224 (#228) 0.1365 -0.4549 miR-30d
(#72) 0.1301 -0.4336 miR-92-2 (#82) 0.116 -0.3865 miR-199a-1 (#191)
0.1158 -0.3861 miR-223 (#227) 0.1141 -0.3803 miR-29c (#65) 0.113
-0.3768 miR-30b (#68) 0.1008 -0.3361 miR-129-1/2 (#117) 0.1001
-0.3337 miR-197 (#189) 0.0975 -0.325 miR-17-5p (#41) 0.0955 -0.3185
miR-30c (#70) 0.0948 -0.316 miR-7-1 (#19) 0.0933 -0.311 miR-93-1
(#83) 0.0918 -0.3061 miR-140 (#136) 0.0904 -0.3015 miR-30a-5p (#66)
0.077 -0.2568 miR-132 (#121) 0.0654 -0.2179 miR-181b-1 (#210)
0.0576 -0.1918 miR-152 prec (#151) -0.0477 0.1591 miR-23b (#51)
0.0469 -0.1562 miR-20a (#46) 0.0452 -0.1507 miR-222 (#225) 0.0416
-0.1385 miR-27a (#59) 0.0405 -0.1351 miR-92-1 (#81) 0.0332 -0.1106
miR-21 (#47) 0.0288 -0.0959 miR-129-1/2 prec 0.0282 -0.0939 (#118)
miR-150 (#148) 0.0173 -0.0578 miR-32 (#75) 0.0167 -0.0558 miR-106a
(#99) 0.0142 -0.0473 miR-29b-1 (#64) 0.0084 -0.028 *57 miRs
selected, misclassification error after cross validation of 0.02.
Fifty-seven miRs are over-expressed and 2 are down-regulated in
cancer (indicated by positive and negative scores,
respectively).
TABLE-US-00013 TABLE 12 MicroRNAs selected by prediction analysis
of microarray (PAM) in prostate cancer (cancer vs. normal
tissues)*. miR Cancer score Normal score let-7d (#8) 0.0528 -0.4227
miR-128a prec (#113) -0.0412 0.3298 miR-195 (#184) 0.04 -0.3199
miR-203 (#197) 0.0356 -0.2851 let-7a-2 prec (#2) -0.0313 0.2504
miR-34a (#78) 0.0303 -0.2428 miR-20a (#46) 0.029 -0.2319 miR-218-2
(#221) -0.0252 0.2018 miR-29a (#62) 0.0247 -0.1978 miR-25 (#55)
0.0233 -0.1861 miR-95 (#84) 0.0233 -0.1861 miR-197 (#189) 0.0198
-0.1587 miR-135-2 (#128) 0.0198 -0.1582 miR-187 (#173) 0.0192
-0.1535 miR-196-1 (#185) 0.0176 -0.1411 miR-148 (#146) 0.0175
-0.1401 miR-191 (#177) 0.017 -0.136 miR-21 (#47) 0.0169 -0.1351
let-7i (#10) 0.0163 -0.1303 miR-198 (#190) 0.0145 -0.1161
miR-199a-2 (#192) 0.0136 -0.1088 miR-30c (#70) 0.0133 -0.1062
miR-17-5p (#41) 0.0132 -0.1053 miR-92-2 (#82) 0.012 -0.0961 miR-146
(#144) 0.0113 -0.0908 miR-181b-1 prec (#211) 0.011 -0.0878 miR-32
(#75) 0.0109 -0.0873 miR-206 (#202) 0.0104 -0.083 miR-184 prec
(#169) 0.0096 -0.0764 miR-29a prec (#63) -0.0095 0.076 miR-29b-2
(#95) 0.0092 -0.0739 miR-149 (#147) -0.0084 0.0676 miR-181b-1
(#210) 0.0049 -0.0392 miR-196-1 prec (#186) 0.0042 -0.0335 miR-93-1
(#83) 0.0039 -0.0312 miR-223 (#227) 0.0038 -0.0308 miR-16-1 (#38)
0.0028 -0.0226 miR-101-1 prec (#92) 0.0015 -0.0123 miR-124a-1
(#104) 0.0015 -0.0119 miR-26a-1 (#56) 0.0015 -0.0119 miR-214 (#212)
0.0013 -0.0105 miR-27a (#59) 0.0011 -0.0091 miR-24-1 (#53)
-8.00E-04 0.0067 miR-106a (#99) 7.00E-04 -0.0057 miR-199a-1 (#191)
4.00E-04 -0.0029 *T = 1, 45 miRs selected, misclassification error
after cross validation of 0.11. Thirty-nine over-expressed miRs in
cancer are indicated by positive cancer scores; 6 downregulated
miRs are indicated by negative cancer scores.
TABLE-US-00014 TABLE 13 MicroRNAs selected by prediction analysis
of microarray (PAM) in stomach cancer (cancer vs. normal tissues)*.
miR Cancer score Normal score miR-223 (#227) 0.1896 -0.1806 miR-21
(#47) 0.1872 -0.1783 miR-218-2 (#221) -0.1552 0.1478 miR-103-2
(#96) 0.1206 -0.1148 miR-92-2 (#82) 0.1142 -0.1088 miR-25 (#55)
0.1097 -0.1045 miR-136 (#130) -0.1097 0.1045 miR-191 (#177) 0.0946
-0.0901 miR-221 (#224) 0.0919 -0.0876 miR-125b-2 (#111) 0.0913
-0.0869 miR-103-1 (#97) 0.0837 -0.0797 miR-214 (#212) 0.0749
-0.0713 miR-222 (#225) 0.0749 -0.0713 miR-212 prec (#209) -0.054
0.0514 miR-125b-1 (#109) 0.0528 -0.0503 miR-100 (#91) 0.0526
-0.0501 miR-107 (#100) 0.0388 -0.0369 miR-92-1 (#81) 0.0369 -0.0351
miR-96 (#86) -0.0306 0.0291 miR-192 (#178) 0.0236 -0.0224 miR-23a
(#50) 0.022 -0.021 miR-215 (#213) 0.0204 -0.0194 miR-7-2 (#21)
0.0189 -0.018 miR-138-2 (#133) -0.0185 0.0176 miR-24-1 (#52) 0.0151
-0.0144 miR-99b (#89) 0.0098 -0.0093 miR-33b (#76) -0.0049 0.0046
miR-24-2 (#54) 0.0041 -0.0039 *T = 1, 28 miRs selected,
misclassification error after cross validation of 0.19. Twenty-two
over-expressed miRs in cancer are indicated by positive cancer
scores; 6 down-regulated miRs are indicated by negative cancer
scores.
TABLE-US-00015 TABLE 14 The microRNAs shared by the signatures of
the 6 solid cancers*. miR N Tumor Type miR-21 6 Breast Colon Lung
Pancreas Prostate Stomach miR-17-5p 5 Breast Colon Lung Pancreas
Prostate miR-191 5 Colon Lung Pancreas Prostate Stomach miR-29b-2 4
Breast Colon Pancreas Prostate miR-223 4 Colon Pancreas Prostate
Stomach miR-128b 3 Colon Lung Pancreas miR-199a-1 3 Lung Pancreas
Prostate miR-24-1 3 Colon Pancreas Stomach miR-24-2 3 Colon
Pancreas Stomach miR-146 3 Breast Pancreas Prostate miR-155 3
Breast Colon Lung miR-181b-1 3 Breast Pancreas Prostate miR-20a 3
Colon Pancreas Prostate miR-107 3 Colon Pancreas Stomach miR-32 3
Colon Pancreas Prostate miR-92-2 3 Pancreas Prostate Stomach
miR-214 3 Pancreas Prostate Stomach miR-30c 3 Colon Pancreas
Prostate miR-25 3 Pancreas Prostate Stomach miR-221 3 Colon
Pancreas Stomach miR-106a 3 Colon Pancreas Prostate *The list
includes 21 commonly up-regulated microRNAs in 3 or more (N) types
of solid cancers (p-value = 2.5 .times. 10.sup.-3).
[0161] To maximize concision, the mean absolute expression levels
of the deregulated miRs for the 6 cancer/normal pairs were
computed. Using the expression level of miRs in the comprehensive
subset, the different tissues were correctly classified,
irrespective of the disease status (FIG. 3).
[0162] FIG. 4 shows differential expression of the common microRNAs
across the different tumor tissues, in relation to the normal
tissues. The tree displays the different cancer types according to
fold changes in the miRNA subset. Prostate, colon, stomach and
pancreatic tissues are most similar among them, while lung and
breast tissues were represented by a fairly different signature
(FIG. 4). This tree clearly shows which miRNAs are associated with
a particular cancer histotype.
[0163] Strikingly, miR-21, miR-191 and miR-17-5p are significantly
over-expressed in all, or in 5 out of 6, of the tumor types that
were considered. miR-21 was reported to be over-expressed in
glioblastoma and to have anti-apoptotic properties (Chan, J. A., et
al., Cancer Res. 65: 6029-6033 (2005)). Lung cancer shares a
portion of its signature with breast cancer and a portion with the
other solid tumors, including miR-17/20/92, all three of which are
members of the microRNA cluster that actively cooperates with c-Myc
to accelerate lymphomagenesis (He, L., et al., Nature 435: 828-833
(2005)). The identification of these microRNAs as being
over-expressed is an excellent confirmation of our approach. A
second miRNA group that is activated includes miR-210 and miR-213,
together with miR-155, which was already reported to be amplified
in large cell lymphomas (Eis, P. S., et al., Proc. Natl. Acad. Sci.
USA 102: 3627-3632 (2005)), children with Burkitt lymphoma
(Metzler, M., et al., Genes Chromosomes Cancer 39:167-169 (2004))
and various B cell lymphomas (Kluiver, J, et al., J. Pathol.,
e-published online, Jul. 22, 2005). These microRNAs are the only
ones up-regulated in breast and lung cancer. miR-218-2 is
consistently down-regulated in colon, stomach, prostate and
pancreas cancers, but not in lung and breast carcinomas.
[0164] Several observations strengthen these results. First, in
this study, the expression levels of both the precursor pre-miRNA
and the mature miRNA were determined for the majority of genes. Of
note, with the exception of miR-212 and miR-128a, in all other
instances, the abnormally-expressed region was that corresponding
to the active gene product. Second, as shown in FIG. 3, the
expression variation of the miRNAs in the comprehensive subset was
often univocal (namely, down- or up-regulation) across the
different types of cancers, suggesting a common mechanism in human
tumorigenesis. Third, the microarray data were validated by
solution hybridization for 12 breast samples (miR-125b, miR-145 and
miR-21; Iorio, M. V., et al., Cancer Res. 65: 7065-7070 (2005)) and
17 endocrine pancreatic and normal samples (miR-103, miR-155 and
miR-204; data not shown), strongly confirming the accuracy of the
microarray data.
EXAMPLE 3
Identification of Predicted Targets for MicroRNAs that are
Deregulated in Solid Tumors
[0165] Materials and Methods:
[0166] Tumor Suppressor and Oncogene Target Predictions
[0167] The most recent TargetScan predictions (April 2005) were
used to identify putative microRNA targets. These include
essentially the 3'UTR targets reported by Lewis et al. (Lewis, B.
P., et al, Cell 120: 15-20 (2005)), with a few changes arising from
updated gene boundary definitions from the April 2005 UCSC Genome
Browser mapping of RefSeq mRNAs to the hg17 human genome assembly.
Among the putative targets, known cancer genes (tumor suppressors
and oncogenes) were specified according to their identification in
the Cancer Gene Census, or as reported by OMIM.
[0168] Target in vitro Assays
[0169] For luciferase reporter experiments, 3' UTR segments of Rbl,
TGFBR2 and Plag1 that are predicted to interact with specific
cancer-associated microRNAs were amplified by PCR from human
genomic DNA and inserted into the pGL3 control vector (Promega)
using the XbaI site immediately downstream from the stop codon of
luciferase. The human megakaryocytic cell line, MEG-01, was grown
in 10% FBS in RPMI medium 1640, supplemented with 1.times.
nonessential amino acid and 1 mmol sodium pyruvate at 37.degree. C.
in a humified atmosphere of 5% CO2. The cells were co-transfected
in 12-well plates by using siPORT neoFX (Ambion, Austin, Tex.),
according to the manufacturer's protocol, with 0.4 .mu.g of the
firefly luciferase reporter vector and 0.08 .mu.g of the control
vector containing Renilla luciferase, pRL-TK (Promega). For each
well, microRNA oligonucleotides (Dharmacon Research, Lafayette,
Colo.) and anti-sense or scrambled oligonucleotides (Ambion) were
used at a concentration of 10 nM. Firefly and Renilla luciferase
activities were measured consecutively at 24 h post transfection
using dual-luciferase assays (Promega).
[0170] Western Blotting for RBI
[0171] Levels of RB1 protein were quantified using a mouse
monoclonal anti-RB1 antibody (Santa Cruz, Calif.) using standard
procedures for Western blotting. The normalization was performed
with mouse monoclonal anti-Actin antibody (Sigma).
[0172] Results
[0173] The functional significance of microRNA deregulation in
cancer needs to be understood. In solid tumors, it appears that the
most common microRNA event is gain of expression, while loss of
expression in cancer is a more limited event, and more tissue
specific. We used a three-step consequential approach in the
following order: first, "in silico" prediction of targets, then
luciferase assay for first validation of cancer relevant targets
and finally, ex vivo tumor correlation between miRNA expression (by
microarray) and target protein expression (by Western blotting) for
a specific miRNA:mRNA interactor pair. Relevant targets for cancer
miRNAs could be either recessive (e.g., tumor suppressors) or
dominant (e.g., oncogenes) cancer genes. To test the hypothesis
that microRNAs that are deregulated in solid tumors target known
oncogenes or tumor suppressors, the predicted targets for these
miRNAs were determined using TargetScan, a database of conserved 3'
UTR microRNA targets (Lewis, B. P., et al, Cell 120: 15-20 (2005)).
TargetScan contained 5,121 predictions for 18 miRNAs that are
dysregulated in solid tumors, in the total 22,402 (26.5%)
predictions. One hundred fifteen out of 263 (44%) well-known cancer
genes were predicted as targets for these 18 miRNAs (Table 15).
Because a high percentage of cancer genes are targeted by miRs that
are deregulated in solid tumors, it is unlikely that these
predictions are due to chance (P<0.0001 at Fisher
exact-test).
[0174] In silico predictions for three different cancer genes,
Retinoblastoma (Rb), TGF-beta-2 receptor (TGFBR2), and pleiomorphic
adenoma gene 1 (PLAG1), were confirmed experimentally by in vitro
assays. Using a luciferase reporter assay, three microRNAs tested
(miR-106a, miR-20a and miR-26a-1) caused a significant reduction of
protein translation relative to the scrambled control oligoRNAs in
transfected MEG-01 cells (FIG. 6). Retinoblastoma 3'UTR, for
example, was found to interact functionally with miR-106a. The
biological significance of this miRNA:mRNA interaction is
reinforced by previous reports showing that the Rb1 gene is
normally transcribed in colon cancers, whilst various fractions of
cells do not express Rb1 protein (Ali, A. A., et al., FASEB J.
7:931-937 (1993)). This finding suggests the existence of a
post-transcriptional mechanism for regulating Rb1 that could be
explained by concomitant miR-106a over-expression in colon
carcinoma (FIG. 4). Furthermore, mir-20a is down-regulated in
breast cancer (FIG. 4) and TFGBR2 protein is expressed in the
epithelium of breast cancer cells (Buck, M. B., et al., Clin.
Cancer Res. 10:491-498 (2004)). Conversely, the over-expression of
mir-20a in colon cancer may represent a novel mechanism for
down-regulating TGFBR2, in addition to mutational inactivation
(Biswas, S., et al., Cancer Res. 64:687-692 (2004)).
[0175] Finally, a set of patient samples was tested to verify
whether RB1 protein expression correlates with miR-106a expression
(FIG. 5 and FIG. 6B). As expected, in gastric, prostate and lung
tumor samples RB1 was down-regulated (in respect to the paired
normal) and miR-106a was found to be over-expressed, while in
breast tumor samples, where miR-106a is slightly down-regulated
(FIG. 5 and FIG. 6B), RB 1 is expressed at slightly higher levels
then in the paired normal control.
[0176] These experimental proofs reinforce the hypothesis that key
cancer genes are regulated by aberrant expression of miRs in solid
cancers. These data add novel examples to the list of microRNA with
important cancer gene targets, as previously shown by Johnsson et
al. (Johnson, S. M., et al., Cell 120: 635-647 (2005)) for the
let-7:Ras interaction, O'Donnell et al. (O'Donnell, K. A., et al.,
Nature 435:839-843 (2005)) for the miR-17-5p:cMyc interaction, and
Cimmino et al. (Cimmino, A., et al., Proc. Natl. Acad. Sci. USA
102:13944-13949 (2005)) for the mir-16:Bc12 interaction. Notably,
miR-17-5p and miR-16 are members of the miRNA solid cancer
signature described herein.
TABLE-US-00016 TABLE 15 Oncogenes and tumor suppressor genes
predicted by TargetScanS as targets of microRNAs from the
comprehensive cancer subset.* miRNA gene Gene Name Gene description
miR-26a, miR-146 ABL2 v-abl Abelson murine leukemia viral oncogene
homolog 2 (arg. Abelson-related gene) miR-107 AF5q31 ALL1 fused
gene from 5q31 miR-20, miR-125b AKT3 v-akl murine thymoma viral
oncogene homolog 3 miR-26a, miR-155 APC adenomatosis polyposis coli
miR-125b miR-26a, miR-218 ARHGEF12 RHO guanine nucleotide exchange
factor (GEF) 12 (LARG) miR-107, miR-221 ARNT aryl hydrocarbon
receptor nuclear translocator miR-192 ATF1 activating transcription
factor 1 miR-26a ATM Ataxia telangiectasia mutated (includes
complementation groups A, C and D) miR-24 AXL AXL receptor tyrosine
kinase miR-26a, miR-107, BCL11A B-cell CLL/lymphoma 11A miR-146,
miR-155 miR-138, miR-92 miR-20 BCL11B B-cell CLL/lymphoma 11B
(CTIP2) miR-21 BCL2 B-cell CLL/lymphoma 2 miR-26a, miR-26a BCL6
B-cell CLL/lymphoma 6 (zinc finger protein 51) miR-20, miR-92 BCL9
B-cell CLL/lymphoma 9 miR-26a, miR-223 CBFB core-binding factor,
beta subunit miR-221, miR-125b miR-218 CCDC6 coiled-coil domain
containing 6 miR-20 CCND1 cyclin D1 (PRAD1: parathyroid
adenomatosis 1) miR-26a, miR-20 CCND2 cyclin D2 miR-26a, miR-107,
miR-92 CDK6 cyclin-dependent kinase 6 miR-20 CDKN1A
cyclin-dependent kinase inhibitor 1A (p21, Cip1) miR-221, miR-92
CDKN1C cyclin-dependent kinase inhibitor 1C (p57, Kip2) miR-24 CDX2
caudal type homeo box transcription factor 2 miR-92 CEBPA
CCAAT/enhancer binding protein (C/EBP), alpha miR-26a CLTC
clathrin, heavy polypeptide (Hc) miR-218 COL1A1 collagen, type I,
alpha 1 miR-26a CREBBP CREB binding protein (CBP) miR-20 CRK v-crk
avian sarcoma virus CT10 oncogene homolog miR-20 CSF1 colony
stimulating factor 1 (macrophage) miR-221, miR-192 DDX6 DEAD/H
(Asp-Glu-Ala-Asp/His) box polypeptide 6 (RNA helicase, 54 kD)
miR-138 DEK DEK oncogene (DNA binding) miR-20 E2F1 E2F
transcription factor 1 miR-20 ELK3 ELK3, ETS-domain protein (SRF
accessory protein 2) miR-24 ELL ELL gene (11-19 lysine-rich
leukemia gene) miR-26a, miR-138 ERBB4 v-erb-a avian erythroblastic
leukemia viral oncogene homolog-like 4 miR-221, miR-155, miR- ETS1
v-ets avian erythroblastosis virus E26 oncogene 125b homolog 1
miR-20 ETV1 ets variant gene 1 miR-125b ETV6 ets variant gene 6
(TEL oncogene) miR-223 FAT FAT tumor suppressor (Drosophila)
homolog miR-223, miR-125b, miR- FGFR2 fibroblast growth factor
receptor 2 218 miR-92 FLI1 Friend leukemia virus integration 1
miR-24, miR-20 FLT1 fms-related tyrosine kinase 1 (vascular
endothelial growth factor/vascular permeability factor receptor)
miR-221 FOS v-fos FBJ murine osteosarcoma viral oncogene homolog
miR-92 FOXG1B forkhead box G1B miR-223 FOXO3A forkhead box O3A
miR-125b GOLGA5 golgi autoantigen, golgin subfamily a, 5 (PTC5)
miR-138 GPHN gephyrin (GPH) miR-107, miR-223, miR-20, HLF hepatic
leukemia factor miR-218 miR-26a, miR-107 HMGA1 high mobility group
AT-hook 1 miR-20 HOXA13 homeo box A13 miR-92 HOXA9 homeo box A9
miR-125b IRF4 interferon regulatory factor 4 miR-146, miR-20,
miR-138 JAZF1 juxtaposed with another zinc finger gene 1 miR-92 JUN
v-jun avian sarcoma virus 17 oncogene homolog miR-155 KRAS
v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog miR-218
LASP1 LIM and SH3 protein 1 miR-218 LHFP lipoma HMGIC fusion
partner miR-125b, miR-218 LIFR leukemia inhibitory factor receptor
miR-223 LMO2 LIM domain only 2 (rhombotin-like 1) (RBTN2) miR-223,
miR-155, miR- MAF v-maf musculoaponeurotic fibrosarcoma (avian)
125b, miR-92 oncogene homolog miR-92 MAP2K4 mitogen-activated
protein kinase kinase 4 miR-146, miR-20 MAP3K8 mitogen-activated
protein kinase kinase kinase 8 miR-125b MAX MAX protein miR-218 MCC
mutated in colorectal cancers miR-24 MEN1 multiple endocrine
neoplasia I miR-138 MLLT6 myeloid/lymphoid or mixed-lineage
leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)
miR-192 MSN moesin miR-24 MYB v-myb avian myeloblastosis viral
oncogene homolog miR-107, miR-223, miR-146, MYBL1 v-myb avian
myeloblastosis viral oncogene miR-221, miR-155, miR-218
homolog-like 1 miR-107, miR-20 MYCN v-myc avian myelocytomatosis
viral related oncogene, neuroblastoma derived miR-107, miR-92 MYH9
myosin, heavy polypeptide 9, non-muscle miR-24 MYST4 MYST histone
acetyltransferase (monocytic leukemia) 4 (MORF) miR-20 NBL1
neuroblastoma, suppression of tumorigenicity 1 miR-125b NIN ninein
(GSK3B interacting protein) miR-26a, miR-107 NKTR natural
killer-tumor recognition sequence miR-92 NOTCH1 Notch homolog 1,
translocation-associated (Drosophila) (TAN1) miR-24 NTRK3
neurotrophic tyrosine kinase, receptor, type 3 miR-125b PCSK7
proprotein convertase subtilisin/kexin type 7 miR-24, miR-146 PER1
period homolog 1 (Drosophila) miR-146, miR-125b, miR- PHOX2B
paired-like homeobox 2b 138 miR-155 PICALM phosphatidylinositol
binding clathrin assembly protein (CALM) miR-24, miR-26a PIM1 pim-1
oncogene miR-24, miR-26a, miR-21, PLAG1 pleiomorphic adenoma gene 1
miR-107, miR-20, miR-155 miR-218 RAB8A RAB8A, member RAS oncogene
family miR-24, miR-221 RALA v-ral simian leukemia viral oncogene
homolog A (ras related) miR-138 RARA retinoic acid receptor, alpha
miR-20, miR-192 RB1 retinoblastoma 1 (including osteosarcoma)
miR-20 RBL1 retinoblastoma-like 1 (p107) miR-20 RBL2
retinoblastoma-like 2 (p130) miR-155, miR-138 REL v-rel avian
reticuloendotheliosis viral oncogene homolog miR-20, miR-138 RHOC
ras homolog gene family, member C miR-20, miR-192 RUNX1
runt-related transcription factor 1 (AML1) miR-107, miR-223 SEPT6
septin 6 miR-146, miR-20, miR-125b SET SET translocation miR-21,
miR-20, miR-155, SKI v-ski avian sarcoma viral oncogene homolog
miR-218 miR-26a, miR-146 SMAD4 SMAD, mothers against DPP homolog 4
(Drosophila) miR-155 SPI1 spleen focus forming virus (SFFV)
proviral integration oncogene spi1 miR-125b SS18 synovial sarcoma
translocation, chromosome 18 miR-107, miR-155 SUFU suppressor of
fused homolog (Drosophila) miR-92 TAF15 TAF15 RNA polymerase II,
TATA box binding protein (TBP)-associated factor, 68 kDa miR-26a,
miR-221, miR-138 TCF12 transcription factor 12 (HTF4,
helix-loop-helix transcription factors 4) miR-21, miR-20 TGFBR2
transforming growth factor, beta receptor II (70-80 kD) miR-24,
miR-26a, miR-92 TOP1 topoisomerase (DNA) I miR-138 TPM4 tropomyosin
4 miR-20 TRIP11 thyroid hormone receptor interactor 11 miR-92 TSC1
Tuberous sclerosis 1 miR-20 TSG101 Tumor susceptibility gene 101
miR-20 TUSC2 Tumor suppressor candidate 2 miR-24 VAV1 vav 1
oncogene miR-125b VAV2 vav 2 oncogene miR-107 WHSC1 Wolf-Hirschhorn
syndrome candidate 1(MMSET) miR-138 WHSC1L1 Wolf-Hirschhorn
syndrome candidate 1-like 1 (NSD3) miR-26a WNT5A wingless-type MMTV
integration site family, member 5A miR-26a, miR-20, miR-125b YES1
v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 miR-107, miR-221
ZNF198 zinc finger protein 198 miR-218 ZNFN1A1 zinc finger protein,
subfamily 1A, 1 (Ikaros) *Known cancer genes (e.g., tumor
suppressors, oncogenes) comprise those identified in the Cancer
Gene Census or reported by OMIM.
[0177] The relevant teachings of all publications cited herein that
have not explicitly been incorporated by reference, are
incorporated herein by reference in their entirety. While this
invention has been particularly shown and described with references
to preferred embodiments thereof, it will be understood by those
skilled in the art that various changes in form and details may be
made therein without departing from the scope of the invention
encompassed by the appended claims.
Sequence CWU 1
1
498190RNAHomo sapiens 1cacuguggga ugagguagua gguuguauag uuuuaggguc
acacccacca cugggagaua 60acuauacaau cuacugucuu uccuaacgug
90272RNAHomo sapiens 2agguugaggu aguagguugu auaguuuaga auuacaucaa
gggagauaac uguacagccu 60ccuagcuuuc cu 72374RNAHomo sapiens
3gggugaggua guagguugua uaguuugggg cucugcccug cuaugggaua acuauacaau
60cuacugucuu uccu 744107RNAHomo sapiens 4gugacugcau gcucccaggu
ugagguagua gguuguauag uuuagaauua cacaagggag 60auaacuguac agccuccuag
cuuuccuugg gucuugcacu aaacaac 107585RNAHomo sapiens 5ggcgggguga
gguaguaggu ugugugguuu cagggcagug auguugcccc ucggaagaua 60acuauacaac
cuacugccuu cccug 85684RNAHomo sapiens 6gcauccgggu ugagguagua
gguuguaugg uuuagaguua cacccuggga guuaacugua 60caaccuucua gcuuuccuug
gagc 84787RNAHomo sapiens 7ccuaggaaga gguaguaggu ugcauaguuu
uagggcaggg auuuugccca caaggaggua 60acuauacgac cugcugccuu ucuuagg
87885RNAHomo sapiens 8cuaggaagag guaguaguuu gcauaguuuu agggcaaaga
uuuugcccac aaguaguuag 60cuauacgacc ugcagccuuu uguag 85985RNAHomo
sapiens 9cuggcugagg uaguaguuug ugcuguuggu cggguuguga cauugcccgc
uguggagaua 60acugcgcaag cuacugccuu gcuag 851079RNAHomo sapiens
10cccgggcuga gguaggaggu uguauaguug aggaggacac ccaaggagau cacuauacgg
60ccuccuagcu uuccccagg 791187RNAHomo sapiens 11ucagagugag
guaguagauu guauaguugu gggguaguga uuuuacccug uucaggagau 60aacuauacaa
ucuauugccu ucccuga 871289RNAHomo sapiens 12cugugggaug agguaguaga
uuguauaguu gugggguagu gauuuuaccc uguucaggag 60auaacuauac aaucuauugc
cuucccuga 891385RNAHomo sapiens 13cugugggaug agguaguaga uuguauaguu
uuagggucau accccaucuu ggagauaacu 60auacagucua cugucuuucc cacgg
8514108RNAHomo sapiens 14uugccugauu ccaggcugag guaguaguuu
guacaguuug agggucuaug auaccacccg 60guacaggaga uaacuguaca ggccacugcc
uugccaggaa cagcgcgc 1081585RNAHomo sapiens 15cuggcugagg uaguaguuug
ugcuguuggu cggguuguga cauugcccgc uguggagaua 60acugcgcaag cuacugccuu
gcuag 851685RNAHomo sapiens 16accuacucag aguacauacu ucuuuaugua
cccauaugaa cauacaaugc uauggaaugu 60aaagaaguau guauuuuugg uaggc
8517108RNAHomo sapiens 17cagcuaacaa cuuaguaaua ccuacucaga
guacauacuu cuuuauguac ccauaugaac 60auacaaugcu auggaaugua aagaaguaug
uauuuuuggu aggcaaua 1081885RNAHomo sapiens 18gccugcuugg gaaacauacu
ucuuuauaug cccauaugga ccugcuaagc uauggaaugu 60aaagaaguau guaucucagg
ccggg 851971RNAHomo sapiens 19ugggaaacau acuucuuuau augcccauau
ggaccugcua agcuauggaa uguaaagaag 60uauguaucuc a 712085RNAHomo
sapiens 20accuacucag aguacauacu ucuuuaugua cccauaugaa cauacaaugc
uauggaaugu 60aaagaaguau guauuuuugg uaggc 8521108RNAHomo sapiens
21uggauguugg ccuaguucug uguggaagac uagugauuuu guuguuuuua gauaacuaaa
60ucgacaacaa aucacagucu gccauauggc acaggccaug ccucuaca
10822110RNAHomo sapiens 22uuggauguug gccuaguucu guguggaaga
cuagugauuu uguuguuuuu agauaacuaa 60aucgacaaca aaucacaguc ugccauaugg
cacaggccau gccucuacag 11023110RNAHomo sapiens 23cuggauacag
aguggaccgg cuggccccau cuggaagacu agugauuuug uuguugucuu 60acugcgcuca
acaacaaauc ccagucuacc uaauggugcc agccaucgca 11024110RNAHomo sapiens
24agauuagagu ggcugugguc uagugcugug uggaagacua gugauuuugu uguucugaug
60uacuacgaca acaagucaca gccggccuca uagcgcagac ucccuucgac
1102589RNAHomo sapiens 25cgggguuggu uguuaucuuu gguuaucuag
cuguaugagu gguguggagu cuucauaaag 60cuagauaacc gaaaguaaaa auaacccca
892687RNAHomo sapiens 26ggaagcgagu uguuaucuuu gguuaucuag cuguaugagu
guauuggucu ucauaaagcu 60agauaaccga aaguaaaaac uccuuca 872790RNAHomo
sapiens 27ggaggcccgu uucucucuuu gguuaucuag cuguaugagu gccacagagc
cgucauaaag 60cuagauaacc gaaaguagaa augauucuca 9028110RNAHomo
sapiens 28gaucugucug ucuucuguau auacccugua gauccgaauu uguguaagga
auuuuguggu 60cacaaauucg uaucuagggg aauauguagu ugacauaaac acuccgcucu
11029110RNAHomo sapiens 29ccagagguug uaacguuguc uauauauacc
cuguagaacc gaauuugugu gguauccgua 60uagucacaga uucgauucua ggggaauaua
uggucgaugc aaaaacuuca 11030108RNAHomo sapiens 30gcgcgaaugu
guguuuaaaa aaaauaaaac cuuggaguaa aguagcagca cauaaugguu 60uguggauuuu
gaaaaggugc aggccauauu gugcugccuc aaaaauac 1083183RNAHomo sapiens
31ccuuggagua aaguagcagc acauaauggu uuguggauuu ugaaaaggug caggccauau
60ugugcugccu caaaaauaca agg 833264RNAHomo sapiens 32cuguagcagc
acaucauggu uuacaugcua cagucaagau gcgaaucauu auuugcugcu 60cuag
643398RNAHomo sapiens 33uugaggccuu aaaguacugu agcagcacau caugguuuac
augcuacagu caagaugcga 60aucauuauuu gcugcucuag aaauuuaagg aaauucau
983489RNAHomo sapiens 34gucagcagug ccuuagcagc acguaaauau uggcguuaag
auucuaaaau uaucuccagu 60auuaacugug cugcugaagu aagguugac
893581RNAHomo sapiens 35guuccacucu agcagcacgu aaauauuggc guagugaaau
auauauuaaa caccaauauu 60acugugcugc uuuaguguga c 813681RNAHomo
sapiens 36gcagugccuu agcagcacgu aaauauuggc guuaagauuc uaaaauuauc
uccaguauua 60acugugcugc ugaaguaagg u 813784RNAHomo sapiens
37gucagaauaa ugucaaagug cuuacagugc agguagugau augugcaucu acugcaguga
60aggcacuugu agcauuaugg ugac 843871RNAHomo sapiens 38uguucuaagg
ugcaucuagu gcagauagug aaguagauua gcaucuacug cccuaagugc 60uccuucuggc
a 713981RNAHomo sapiens 39uuuuuguucu aaggugcauc uagugcagau
agugaaguag auuagcaucu acugcccuaa 60gugcuccuuc uggcauaaga a
814082RNAHomo sapiens 40gcaguccucu guuaguuuug cauaguugca cuacaagaag
aauguaguug ugcaaaucua 60ugcaaaacug augguggccu gc 824180RNAHomo
sapiens 41caguccucug uuaguuuugc auaguugcac uacaagaaga auguaguugu
gcaaaucuau 60gcaaaacuga ugguggccug 804287RNAHomo sapiens
42cacuguucua ugguuaguuu ugcagguuug cauccagcug ugugauauuc ugcugugcaa
60auccaugcaa aacugacugu gguagug 874396RNAHomo sapiens 43acauugcuac
uuacaauuag uuuugcaggu uugcauuuca gcguauauau guauaugugg 60cugugcaaau
ccaugcaaaa cugauuguga uaaugu 964480RNAHomo sapiens 44uucuaugguu
aguuuugcag guuugcaucc agcuguguga uauucugcug ugcaaaucca 60ugcaaaacug
acugugguag 804581RNAHomo sapiens 45uuacaauuag uuuugcaggu uugcauuuca
gcguauauau guauaugugg cugugcaaau 60ccaugcaaaa cugauuguga u
814671RNAHomo sapiens 46guagcacuaa agugcuuaua gugcagguag uguuuaguua
ucuacugcau uaugagcacu 60uaaaguacug c 714772RNAHomo sapiens
47ugucggguag cuuaucagac ugauguugac uguugaaucu cauggcaaca ccagucgaug
60ggcugucuga ca 724881RNAHomo sapiens 48accuugucgg guagcuuauc
agacugaugu ugacuguuga aucucauggc aacaccaguc 60gaugggcugu cugacauuuu
g 814985RNAHomo sapiens 49ggcugagccg caguaguucu ucaguggcaa
gcuuuauguc cugacccagc uaaagcugcc 60aguugaagaa cuguugcccu cugcc
855073RNAHomo sapiens 50ggccggcugg gguuccuggg gaugggauuu gcuuccuguc
acaaaucaca uugccaggga 60uuuccaaccg acc 735197RNAHomo sapiens
51cucaggugcu cuggcugcuu ggguuccugg caugcugauu ugugacuuaa gauuaaaauc
60acauugccag ggauuaccac gcaaccacga ccuuggc 975281RNAHomo sapiens
52ccacggccgg cugggguucc uggggauggg auuugcuucc ugucacaaau cacauugcca
60gggauuucca accgacccug a 815368RNAHomo sapiens 53cuccggugcc
uacugagcug auaucaguuc ucauuuuaca cacuggcuca guucagcagg 60aacaggag
685473RNAHomo sapiens 54cucugccucc cgugccuacu gagcugaaac acaguugguu
uguguacacu ggcucaguuc 60agcaggaaca ggg 735581RNAHomo sapiens
55cccugggcuc ugccucccgu gccuacugag cugaaacaca guugguuugu guacacuggc
60ucaguucagc aggaacaggg g 815671RNAHomo sapiens 56cccuccggug
ccuacugagc ugauaucagu ucucauuuua cacacuggcu caguucagca 60ggaacagcau
c 715784RNAHomo sapiens 57ggccaguguu gagaggcgga gacuugggca
auugcuggac gcugcccugg gcauugcacu 60ugucucgguc ugacagugcc ggcc
845886RNAHomo sapiens 58aggccguggc cucguucaag uaauccagga uaggcugugc
aggucccaau ggccuaucuu 60gguuacuugc acggggacgc gggccu 865977RNAHomo
sapiens 59guggccucgu ucaaguaauc caggauaggc ugugcagguc ccaaugggcc
uauucuuggu 60uacuugcacg gggacgc 776084RNAHomo sapiens 60ggcuguggcu
ggauucaagu aauccaggau aggcuguuuc caucugugag gccuauucuu 60gauuacuugu
uucuggaggc agcu 846177RNAHomo sapiens 61ccgggaccca guucaaguaa
uucaggauag guugugugcu guccagccug uucuccauua 60cuuggcucgg ggaccgg
776278RNAHomo sapiens 62cugaggagca gggcuuagcu gcuugugagc aggguccaca
ccaagucgug uucacagugg 60cuaaguuccg ccccccag 786373RNAHomo sapiens
63aggugcagag cuuagcugau uggugaacag ugauugguuu ccgcuuuguu cacaguggcu
60aaguucugca ccu 736497RNAHomo sapiens 64accucucuaa caaggugcag
agcuuagcug auuggugaac agugauuggu uuccgcuuug 60uucacagugg cuaaguucug
caccugaaga gaaggug 976580RNAHomo sapiens 65ccugaggagc agggcuuagc
ugcuugugag caggguccac accaagucgu guucacagug 60gcuaaguucc gccccccagg
806686RNAHomo sapiens 66gguccuugcc cucaaggagc ucacagucua uugaguuacc
uuucugacuu ucccacuaga 60uugugagcuc cuggagggca ggcacu 8667108RNAHomo
sapiens 67ccuucuguga ccccuuagag gaugacugau uucuuuuggu guucagaguc
aauauaauuu 60ucuagcacca ucugaaaucg guuauaauga uuggggaaga gcaccaug
1086864RNAHomo sapiens 68augacugauu ucuuuuggug uucagaguca
auauaauuuu cuagcaccau cugaaaucgg 60uuau 646981RNAHomo sapiens
69cuucaggaag cugguuucau auggugguuu agauuuaaau agugauuguc uagcaccauu
60ugaaaucagu guucuugggg g 817081RNAHomo sapiens 70cuucuggaag
cugguuucac augguggcuu agauuuuucc aucuuuguau cuagcaccau 60uugaaaucag
uguuuuagga g 8171110RNAHomo sapiens 71accacuggcc caucucuuac
acaggcugac cgauuucucc ugguguucag agucuguuuu 60ugucuagcac cauuugaaau
cgguuaugau guagggggaa aagcagcagc 1107271RNAHomo sapiens
72gcgacuguaa acauccucga cuggaagcug ugaagccaca gaugggcuuu cagucggaug
60uuugcagcug c 717360RNAHomo sapiens 73auguaaacau ccuacacuca
gcuguaauac auggauuggc ugggaggugg auguuuacgu 607488RNAHomo sapiens
74accaaguuuc aguucaugua aacauccuac acucagcugu aauacaugga uuggcuggga
60gguggauguu uacuucagcu gacuugga 887572RNAHomo sapiens 75agauacugua
aacauccuac acucucagcu guggaaagua agaaagcugg gagaaggcug 60uuuacucuuu
cu 727670RNAHomo sapiens 76guuguuguaa acauccccga cuggaagcug
uaagacacag cuaagcuuuc agucagaugu 60uugcugcuac 707764RNAHomo sapiens
77cuguaaacau ccuugacugg aagcuguaag guguucagag gagcuuucag ucggauguuu
60acag 647871RNAHomo sapiens 78ggagaggagg caagaugcug gcauagcugu
ugaacuggga accugcuaug ccaacauauu 60gccaucuuuc c 717970RNAHomo
sapiens 79ggagauauug cacauuacua aguugcaugu ugucacggcc ucaaugcaau
uuagugugug 60ugauauuuuc 7080110RNAHomo sapiens 80gggggccgag
agaggcgggc ggccccgcgg ugcauugcug uugcauugca cgugugugag 60gcgggugcag
ugccucggca gugcagcccg gagccggccc cuggcaccac 1108188RNAHomo sapiens
81accaaguuuc aguucaugua aacauccuac acucagcugu aauacaugga uuggcuggga
60gguggauguu uacuucagcu gacuugga 888269RNAHomo sapiens 82cuguggugca
uuguaguugc auugcauguu cuggugguac ccaugcaaug uuuccacagu 60gcaucacag
6983110RNAHomo sapiens 83ggccagcugu gaguguuucu uuggcagugu
cuuagcuggu uguugugagc aauaguaagg 60aagcaaucag caaguauacu gcccuagaag
ugcugcacgu uguggggccc 1108484RNAHomo sapiens 84gugcucgguu
uguaggcagu gucauuagcu gauuguacug uggugguuac aaucacuaac 60uccacugcca
ucaaaacaag gcac 848577RNAHomo sapiens 85agucuaguua cuaggcagug
uaguuagcug auugcuaaua guaccaauca cuaaccacac 60ggccagguaa aaagauu
778682RNAHomo sapiens 86ucagaauaau gucaaagugc uuacagugca gguagugaua
ugugcaucua cugcagugaa 60ggcacuugua gcauuauggu ga 828778RNAHomo
sapiens 87cuuucuacac agguugggau cgguugcaau gcuguguuuc uguaugguau
ugcacuuguc 60ccggccuguu gaguuugg 788875RNAHomo sapiens 88ucaucccugg
guggggauuu guugcauuac uuguguucua uauaaaguau ugcacuuguc 60ccggccugug
gaaga 758980RNAHomo sapiens 89cugggggcuc caaagugcug uucgugcagg
uagugugauu acccaaccua cugcugagcu 60agcacuuccc gagcccccgg
809081RNAHomo sapiens 90aacacagugg gcacucaaua aaugucuguu gaauugaaau
gcguuacauu caacggguau 60uuauugagca cccacucugu g 819178RNAHomo
sapiens 91uggccgauuu uggcacuagc acauuuuugc uugugucucu ccgcucugag
caaucaugug 60cagugccaau augggaaa 789280RNAHomo sapiens 92gugagcgacu
guaaacaucc ucgacuggaa gcugugaagc cacagauggg cuuucagucg 60gauguuugca
gcugccuacu 809380RNAHomo sapiens 93gugagguagu aaguuguauu guuguggggu
agggauauua ggccccaauu agaagauaac 60uauacaacuu acuacuuucc
809470RNAHomo sapiens 94ggcacccacc cguagaaccg accuugcggg gccuucgccg
cacacaagcu cgugucugug 60gguccguguc 709581RNAHomo sapiens
95cccauuggca uaaacccgua gauccgaucu uguggugaag uggaccgcac aagcucgcuu
60cuaugggucu gugucagugu g 8196108RNAHomo sapiens 96aagagagaag
auauugaggc cuguugccac aaacccguag auccgaacuu gugguauuag 60uccgcacaag
cuuguaucua uagguaugug ucuguuaggc aaucucac 1089780RNAHomo sapiens
97ccuguugcca caaacccgua gauccgaacu ugugguauua guccgcacaa gcuuguaucu
60auagguaugu gucuguuagg 8098110RNAHomo sapiens 98aggcugcccu
ggcucaguua ucacagugcu gaugcugucu auucuaaagg uacaguacug 60ugauaacuga
aggauggcag ccaucuuacc uuccaucaga ggagccucac 1109957RNAHomo sapiens
99ucaguuauca cagugcugau gcuguccauu cuaaagguac aguacuguga uaacuga
5710075RNAHomo sapiens 100ugcccuggcu caguuaucac agugcugaug
cugucuauuc uaaagguaca guacugugau 60aacugaagga uggca 7510179RNAHomo
sapiens 101acuguccuuu uucgguuauc augguaccga ugcuguauau cugaaaggua
caguacugug 60auaacugaag aaugguggu 7910275RNAHomo sapiens
102uguccuuuuu cgguuaucau gguaccgaug cuguauaucu gaaagguaca
guacugugau 60aacugaagaa uggug 7510381RNAHomo sapiens 103cuucuggaag
cugguuucac augguggcuu agauuuuucc aucuuuguau cuagcaccau 60uugaaaucag
uguuuuagga g 8110481RNAHomo sapiens 104cuucaggaag cugguuucau
auggugguuu agauuuaaau agugauuguc uagcaccauu 60ugaaaucagu guucuugggg
g 8110578RNAHomo sapiens 105uugugcuuuc agcuucuuua cagugcugcc
uuguagcauu caggucaagc aacauuguac 60agggcuauga aagaacca
7810678RNAHomo sapiens 106uacugcccuc ggcuucuuua cagugcugcc
uuguugcaua uggaucaagc agcauuguac 60agggcuauga aggcauug
7810778RNAHomo sapiens 107aaaugucaga cagcccaucg acugguguug
ccaugagauu caacagucaa caucagucug 60auaagcuacc cgacaagg
7810881RNAHomo sapiens 108ugugcaucgu ggucaaaugc ucagacuccu
gugguggcug cucaugcacc acggauguuu 60gagcaugugc uacggugucu a
8110981RNAHomo sapiens 109ugugcaucgu ggucaaaugc ucagacuccu
gugguggcug
cuuaugcacc acggauguuu 60gagcaugugc uauggugucu a 8111081RNAHomo
sapiens 110ccuuggccau guaaaagugc uuacagugca gguagcuuuu ugagaucuac
ugcaauguaa 60gcacuucuua cauuaccaug g 8111182RNAHomo sapiens
111ccugccgggg cuaaagugcu gacagugcag auaguggucc ucuccgugcu
accgcacugu 60ggguacuugc ugcuccagca gg 8211281RNAHomo sapiens
112cucucugcuu ucagcuucuu uacaguguug ccuuguggca uggaguucaa
gcagcauugu 60acagggcuau caaagcacag a 8111390RNAHomo sapiens
113acacugcaag aacaauaagg auuuuuaggg gcauuaugac ugagucagaa
aacacagcug 60ccccugaaag ucccucauuu uucuugcugu 9011480RNAHomo
sapiens 114acugcaagag caauaaggau uuuuaggggc auuaugauag uggaauggaa
acacaucugc 60ccccaaaagu cccucauuuu 8011585RNAHomo sapiens
115ccuuagcaga gcuguggagu gugacaaugg uguuuguguc uaaacuauca
aacgccauua 60ucacacuaaa uagcuacugc uaggc 8511666RNAHomo sapiens
116agcuguggag ugugacaaug guguuugugu ccaaacuauc aaacgccauu
aucacacuaa 60auagcu 6611761RNAHomo sapiens 117acauuauuac uuuugguacg
cgcugugaca cuucaaacuc guaccgugag uaauaaugcg 60c 6111885RNAHomo
sapiens 118aggccucucu cuccguguuc acagcggacc uugauuuaaa uguccauaca
auuaaggcac 60gcggugaaug ccaagaaugg ggcug 85119110RNAHomo sapiens
119aucaagauua gaggcucugc ucuccguguu cacagcggac cuugauuuaa
ugucauacaa 60uuaaggcacg cggugaaugc caagagcgga gccuacggcu gcacuugaag
11012087RNAHomo sapiens 120ugagggcccc ucugcguguu cacagcggac
cuugauuuaa ugucuauaca auuaaggcac 60gcggugaaug ccaagagagg cgccucc
8712168RNAHomo sapiens 121cucugcgugu ucacagcgga ccuugauuua
augucuauac aauuaaggca cgcggugaau 60gccaagag 6812267RNAHomo sapiens
122cucuccgugu ucacagcgga ccuugauuua augucauaca auuaaggcac
gcggugaaug 60ccaagag 6712386RNAHomo sapiens 123ugccagucuc
uaggucccug agacccuuua accugugagg acauccaggg ucacagguga 60gguucuuggg
agccuggcgu cuggcc 8612465RNAHomo sapiens 124ggucccugag acccuuuaac
cugugaggac auccaggguc acaggugagg uucuugggag 60ccugg 6512588RNAHomo
sapiens 125ugcgcuccuc ucagucccug agacccuaac uugugauguu uaccguuuaa
auccacgggu 60uaggcucuug ggagcugcga gucgugcu 8812689RNAHomo sapiens
126accagacuuu uccuaguccc ugagacccua acuugugagg uauuuuagua
acaucacaag 60ucaggcucuu gggaccuagg cggagggga 8912785RNAHomo sapiens
127cgcuggcgac gggacauuau uacuuuuggu acgcgcugug acacuucaaa
cucguaccgu 60gaguaauaau gcgccgucca cggca 8512861RNAHomo sapiens
128acauuauuac uuuugguacg cgcugugaca cuucaaacuc guaccgugag
uaauaaugcg 60c 6112997RNAHomo sapiens 129ugugaucacu gucuccagcc
ugcugaagcu cagagggcuc ugauucagaa agaucaucgg 60auccgucuga gcuuggcugg
ucggaagucu caucauc 9713070RNAHomo sapiens 130ccagccugcu gaagcucaga
gggcucugau ucagaaagau caucggaucc gucugagcuu 60ggcuggucgg
7013182RNAHomo sapiens 131ugagcuguug gauucggggc cguagcacug
ucugagaggu uuacauuucu cacagugaac 60cggucucuuu uucagcugcu uc
82132110RNAHomo sapiens 132gcccggcagc cacugugcag ugggaagggg
ggccgauaca cuguacgaga gugaguagca 60ggucucacag ugaaccgguc ucuuucccua
cugugucaca cuccuaaugg 11013370RNAHomo sapiens 133guuggauucg
gggccguagc acugucugag agguuuacau uucucacagu gaaccggucu 60cuuuuucagc
7013474RNAHomo sapiens 134uggaucuuuu ugcggucugg gcuugcuguu
ccucucaaca guagucagga agcccuuacc 60ccaaaaagua ucua 7413590RNAHomo
sapiens 135ugcccuucgc gaaucuuuuu gcggucuggg cuugcuguac auaacucaau
agccggaagc 60ccuuacccca aaaagcauuu gcggagggcg 9013689RNAHomo
sapiens 136ugcugcuggc cagagcucuu uucacauugu gcuacugucu gcaccuguca
cuagcagugc 60aauguuaaaa gggcauuggc cguguagug 89137110RNAHomo
sapiens 137gccaggaggc gggguugguu guuaucuuug guuaucuagc uguaugagug
guguggaguc 60uucauaaagc uagauaaccg aaaguaaaaa uaaccccaua cacugcgcag
110138110RNAHomo sapiens 138cacggcgcgg cagcggcacu ggcuaaggga
ggcccguuuc ucucuuuggu uaucuagcug 60uaugagugcc acagagccgu cauaaagcua
gauaaccgaa aguagaaaug 11013972RNAHomo sapiens 139guuguuaucu
uugguuaucu agcuguauga guguauuggu cuucauaaag cuagauaacc 60gaaaguaaaa
ac 72140101RNAHomo sapiens 140ccgcccccgc gucuccaggg caaccguggc
uuucgauugu uacuguggga acuggaggua 60acagucuaca gccauggucg ccccgcagca
cgcccacgcg c 10114166RNAHomo sapiens 141gggcaaccgu ggcuuucgau
uguuacugug ggaacuggag guaacagucu acagccaugg 60ucgccc 6614288RNAHomo
sapiens 142acaaugcuuu gcuagagcug guaaaaugga accaaaucgc cucuucaaug
gauuuggucc 60ccuucaacca gcuguagcua ugcauuga 88143102RNAHomo sapiens
143gggagccaaa ugcuuugcua gagcugguaa aauggaacca aaucgacugu
ccaauggauu 60ugguccccuu caaccagcug uagcugugca uugauggcgc cg
10214468RNAHomo sapiens 144gcuagagcug guaaaaugga accaaaucgc
cucuucaaug gauuuggucc ccuucaacca 60gcuguagc 68145119RNAHomo sapiens
145ccucagaaga aagaugcccc cugcucuggc uggucaaacg gaaccaaguc
cgucuuccug 60agagguuugg uccccuucaa ccagcuacag cagggcuggc aaugcccagu
ccuuggaga 11914680RNAHomo sapiens 146gcccccugcu cuggcugguc
aaacggaacc aaguccgucu uccugagagg uuuggucccc 60uucaaccagc uacagcaggg
8014773RNAHomo sapiens 147cagggugugu gacugguuga ccagaggggc
augcacugug uucacccugu gggccaccua 60gucaccaacc cuc 7314871RNAHomo
sapiens 148agggugugug acugguugac cagaggggca ugcacugugu ucacccugug
ggccaccuag 60ucaccaaccc u 7114990RNAHomo sapiens 149aggccucgcu
guucucuaug gcuuuuuauu ccuaugugau ucuacugcuc acucauauag 60ggauuggagc
cguggcgcac ggcggggaca 90150100RNAHomo sapiens 150agauaaauuc
acucuagugc uuuauggcuu uuuauuccua ugugauagua auaaagucuc 60auguagggau
ggaagccaug aaauacauug ugaaaaauca 10015160RNAHomo sapiens
151cuauggcuuu uuauuccuau gugauucuac ugcucacuca uauagggauu
ggagccgugg 6015297RNAHomo sapiens 152cacucugcug uggccuaugg
cuuuucauuc cuaugugauu gcugucccaa acucauguag 60ggcuaaaagc caugggcuac
agugaggggc gagcucc 9715382RNAHomo sapiens 153ugagcccucg gaggacucca
uuuguuuuga ugauggauuc uuaugcucca ucaucgucuc 60aaaugagucu ucagaggguu
cu 8215462RNAHomo sapiens 154gaggacucca uuuguuuuga ugauggauuc
uuaugcucca ucaucgucuc aaaugagucu 60uc 6215573RNAHomo sapiens
155cuucggugac ggguauucuu ggguggauaa uacggauuac guuguuauug
cuuaagaaua 60cgcguagucg agg 7315699RNAHomo sapiens 156cccuggcaug
gugugguggg gcagcuggug uugugaauca ggccguugcc aaucagagaa 60cggcuacuuc
acaacaccag ggccacacca cacuacagg 9915784RNAHomo sapiens
157cguugcugca gcugguguug ugaaucaggc cgacgagcag cgcauccucu
uacccggcua 60uuucacgaca ccaggguugc auca 8415871RNAHomo sapiens
158cagcuggugu ugugaaucag gccgacgagc agcgcauccu cuuacccggc
uauuucacga 60caccaggguu g 7115968RNAHomo sapiens 159guguauucua
cagugcacgu gucuccagug uggcucggag gcuggagacg cggcccuguu 60ggaguaac
68160100RNAHomo sapiens 160ugugucucuc ucuguguccu gccagugguu
uuacccuaug guagguuacg ucaugcuguu 60cuaccacagg guagaaccac ggacaggaua
ccggggcacc 10016172RNAHomo sapiens 161uccugccagu gguuuuaccc
uaugguaggu uacgucaugc uguucuacca caggguagaa 60ccacggacag ga
7216270RNAHomo sapiens 162ccugccagug guuuuacccu augguagguu
acgucaugcu guucuaccac aggguagaac 60cacggacagg 7016395RNAHomo
sapiens 163cggccggccc uggguccauc uuccaguaca guguuggaug gucuaauugu
gaagcuccua 60acacugucug guaaagaugg cucccgggug gguuc 9516472RNAHomo
sapiens 164ggguccaucu uccaguacag uguuggaugg ucuaauugug aagcuccuaa
cacugucugg 60uaaagauggc cc 7216564RNAHomo sapiens 165acccauaaag
uagaaagcac uacuaacagc acuggagggu guaguguuuc cuacuuuaug 60gaug
64166106RNAHomo sapiens 166gcgcagcgcc cugucuccca gccugaggug
cagugcugca ucucugguca guugggaguc 60ugagaugaag cacuguagcu caggaagaga
gaaguuguuc ugcagc 10616763RNAHomo sapiens 167ccugaggugc agugcugcau
cucuggucag uugggagucu gagaugaagc acuguagcuc 60agg 6316886RNAHomo
sapiens 168uggggcccug gcugggauau caucauauac uguaaguuug cgaugagaca
cuacaguaua 60gaugauguac uaguccgggc accccc 8616966RNAHomo sapiens
169ggcugggaua ucaucauaua cuguaaguuu gcgaugagac acuacaguau
agaugaugua 60cuaguc 6617088RNAHomo sapiens 170caccuugucc ucacggucca
guuuucccag gaaucccuua gaugcuaaga uggggauucc 60uggaaauacu guucuugagg
ucaugguu 8817170RNAHomo sapiens 171cucacggucc aguuuuccca ggaaucccuu
agaugcuaag auggggauuc cuggaaauac 60uguucuugag 7017299RNAHomo
sapiens 172ccgaugugua uccucagcuu ugagaacuga auuccauggg uugugucagu
gucagaccuc 60ugaaauucag uucuucagcu gggauaucuc ugucaucgu
9917365RNAHomo sapiens 173agcuuugaga acugaauucc auggguugug
ucagugucag accugugaaa uucaguucuu 60cagcu 6517472RNAHomo sapiens
174aaucuaaaga caacauuucu gcacacacac cagacuaugg aagccagugu
guggaaaugc 60uucugcuaga uu 7217568RNAHomo sapiens 175gaggcaaagu
ucugagacac uccgacucug aguaugauag aagucagugc acuacagaac 60uuugucuc
6817699RNAHomo sapiens 176caagcacgau uagcauuuga ggugaaguuc
uguuauacac ucaggcugug gcucucugaa 60agucagugca ucacagaacu uugucucgaa
agcuuucua 9917770RNAHomo sapiens 177aagcacgauu agcauuugag
gugaaguucu guuauacacu caggcugugg cucucugaaa 60gucagugcau
7017889RNAHomo sapiens 178gccggcgccc gagcucuggc uccgugucuu
cacucccgug cuuguccgag gagggaggga 60gggacggggg cugugcuggg gcagcugga
8917953RNAHomo sapiens 179gcucuggcuc cgugucuuca cucccgugcu
uguccgagga gggagggagg gac 5318084RNAHomo sapiens 180cuccccaugg
cccugucucc caacccuugu accagugcug ggcucagacc cugguacagg 60ccugggggac
agggaccugg ggac 8418164RNAHomo sapiens 181cccugucucc caacccuugu
accagugcug ggcucagacc cugguacagg ccugggggac 60aggg 6418272RNAHomo
sapiens 182uuuccugccc ucgaggagcu cacagucuag uaugucucau ccccuacuag
acugaagcuc 60cuugaggaca gg 7218369RNAHomo sapiens 183ccuguccuca
aggagcuuca gucuaguagg ggaugagaca uacuagacug ugagcuccuc 60gagggcagg
6918487RNAHomo sapiens 184uguccccccc ggcccagguu cugugauaca
cuccgacucg ggcucuggag cagucagugc 60augacagaac uugggcccgg aaggacc
8718571RNAHomo sapiens 185ggcccagguu cugugauaca cuccgacucg
ggcucuggag cagucagugc augacagaac 60uugggccccg g 7118690RNAHomo
sapiens 186cucacagcug ccagugucau uuuugugauc ugcagcuagu auucucacuc
caguugcaua 60gucacaaaag ugaucauugg cagguguggc 9018771RNAHomo
sapiens 187ucucucucuc ccucacagcu gccaguguca uugucacaaa agugaucauu
ggcaggugug 60gcugcugcau g 7118887RNAHomo sapiens 188agcgguggcc
agugucauuu uugugauguu gcagcuagua auaugagccc aguugcauag 60ucacaaaagu
gaucauugga aacugug 8718969RNAHomo sapiens 189cagugucauu uuugugaugu
ugcagcuagu aauaugagcc caguugcaua gucacaaaag 60ugaucauug
6919084RNAHomo sapiens 190gugguacuug aagauagguu auccguguug
ccuucgcuuu auuugugacg aaucauacac 60gguugaccua uuuuucagua ccaa
8419166RNAHomo sapiens 191gaagauaggu uauccguguu gccuucgcuu
uauuugugac gaaucauaca cgguugaccu 60auuuuu 6619265RNAHomo sapiens
192cuguuaaugc uaaucgugau agggguuuuu gccuccaacu gacuccuaca
uauuagcauu 60aacag 6519382RNAHomo sapiens 193ccuaacacug ucugguaaag
auggcucccg gguggguucu cucggcagua accuucaggg 60agcccugaag accauggagg
ac 82194110RNAHomo sapiens 194gccgagaccg agugcacagg gcucugaccu
augaauugac agccagugcu cucgucuccc 60cucuggcugc caauuccaua ggucacaggu
auguucgccu caaugccagc 11019580RNAHomo sapiens 195ucccgccccc
uguaacagca acuccaugug gaagugccca cugguuccag uggggcugcu 60guuaucuggg
gcgagggcca 8019670RNAHomo sapiens 196aaagcugggu ugagagggcg
aaaaaggaug aggugacugg ucugggcuac gcuaugcugc 60ggcgcucggg
7019764RNAHomo sapiens 197cauuggccuc cuaagccagg gauugugggu
ucgaguccca cccgggguaa agaaaggccg 60aauu 6419870RNAHomo sapiens
198ccuaagccag ggauuguggg uucgaguccc accuggggua gaggugaaag
uuccuuuuac 60ggaauuuuuu 70199108RNAHomo sapiens 199caaugucagc
agugccuuag cagcacguaa auauuggcgu uaagauucua aaauuaucuc 60caguauuaac
ugugcugcug aaguaagguu gaccauacuc uacaguug 10820081RNAHomo sapiens
200gggcuuucaa gucacuagug guuccguuua guagaugauu gugcauuguu
ucaaaauggu 60gcccuaguga cuacaaagcc c 8120170RNAHomo sapiens
201acgcaagugu ccuaagguga gcucagggag cacagaaacc uccaguggaa
cagaagggca 60aaagcucauu 7020270RNAHomo sapiens 202caugugucac
uuucaggugg aguuucaaga gucccuuccu gguucaccgu cuccuuugcu 60cuuccacaac
70203110RNAHomo sapiens 203agaagggcua ucaggccagc cuucagagga
cuccaaggaa cauucaacgc ugucggugag 60uuugggauuu gaaaaaacca cugaccguug
acuguaccuu gggguccuua 110204110RNAHomo sapiens 204ccugugcaga
gauuauuuuu uaaaagguca caaucaacau ucauugcugu cgguggguug 60aacugugugg
acaagcucac ugaacaauga augcaacugu ggccccgcuu 11020589RNAHomo sapiens
205cugauggcug cacucaacau ucauugcugu cgguggguuu gagucugaau
caacucacug 60aucaaugaau gcaaacugcg gaccaaaca 89206110RNAHomo
sapiens 206cggaaaauuu gccaaggguu ugggggaaca uucaaccugu cggugaguuu
gggcagcuca 60ggcaaaccau cgaccguuga guggacccug aggccuggaa uugccauccu
110207110RNAHomo sapiens 207gagcugcuug ccuccccccg uuuuuggcaa
ugguagaacu cacacuggug agguaacagg 60auccgguggu ucuagacuug ccaacuaugg
ggcgaggacu cagccggcac 11020870RNAHomo sapiens 208uuuuuggcaa
ugguagaacu cacacuggug agguaacagg auccgguggu ucuagacuug 60ccaacuaugg
70209110RNAHomo sapiens 209ccgcagagug ugacuccugu ucuguguaug
gcacugguag aauucacugu gaacagucuc 60agucagugaa uuaccgaagg gccauaaaca
gagcagagac agauccacga 11021084RNAHomo sapiens 210ccagucacgu
ccccuuauca cuuuuccagc ccagcuuugu gacuguaagu guuggacgga 60gaacugauaa
ggguagguga uuga 8421165RNAHomo sapiens 211ccuuaucacu uuuccagccc
agcuuuguga cuguaagugu uggacggaga acugauaagg 60guagg 6521282RNAHomo
sapiens 212agggggcgag ggauuggaga gaaaggcagu uccugauggu ccccucccca
ggggcuggcu 60uuccucuggu ccuucccucc ca 8221366RNAHomo sapiens
213agggauugga gagaaaggca guuccugaug guccccuccc caggggcugg
cuuuccucug 60guccuu 6621486RNAHomo sapiens 214ugcuuguaac uuuccaaaga
auucuccuuu ugggcuuucu gguuuuauuu uaagcccaaa 60ggugaauuuu uugggaaguu
ugagcu 8621571RNAHomo sapiens 215acuuuccaaa gaauucuccu uuugggcuuu
cugguuuuau uuuaagccca aaggugaauu 60uuuugggaag u 71216109RNAHomo
sapiens 216ggucgggcuc accaugacac agugugagac ucgggcuaca acacaggacc
cggggcgcug 60cucugacccc ucgugucuug uguugcagcc ggagggacgc agguccgca
10921786RNAHomo sapiens 217ugcucccucu cucacauccc uugcauggug
gagggugagc uuucugaaaa ccccucccac 60augcaggguu ugcaggaugg cgagcc
8621868RNAHomo sapiens 218ucucacaucc cuugcauggu ggagggugag
cuuucugaaa accccuccca caugcagggu 60uugcagga 68219102RNAHomo sapiens
219cugucgauug gacccgcccu ccggugccua cugagcugau aucaguucuc
auuuuacaca 60cuggcucagu ucagcaggaa caggagucga gcccuugagc aa
10222068RNAHomo sapiens 220cuccggugcc uacugagcug auaucaguuc
ucauuuuaca cacuggcuca guucagcagg 60aacaggag 6822185RNAHomo sapiens
221ugcaggccuc ugugugauau guuugauaua uuagguuguu auuuaaucca
acuauauauc 60aaacauauuc cuacaguguc uugcc 8522267RNAHomo sapiens
222cugugugaua uguuugauau auuagguugu uauuuaaucc aacuauauau
caaacauauu 60ccuacag 6722392RNAHomo sapiens 223cggcuggaca
gcgggcaacg gaaucccaaa agcagcuguu gucuccagag cauuccagcu 60gcgcuuggau
uucguccccu gcucuccugc cu 9222474RNAHomo sapiens 224agcgggcaac
ggaaucccaa aagcagcugu ugucuccaga gcauuccagc ugcgcuugga 60uuucgucccc
ugcu 74225108RNAHomo sapiens 225ccgagaccga gugcacaggg cucugaccua
ugaauugaca gccagugcuc ucgucucccc 60ucuggcugcc aauuccauag gucacaggua
uguucgccuc aaugccag 108226110RNAHomo sapiens 226gccgagaccg
agugcacagg gcucugaccu augaauugac agccagugcu cucgucuccc 60cucuggcugc
caauuccaua ggucacaggu auguucgccu caaugccagc 11022788RNAHomo sapiens
227cgaggauggg agcugagggc ugggucuuug cgggcgagau gagggugucg
gaucaacugg 60ccuacaaagu cccaguucuc ggcccccg 8822858RNAHomo sapiens
228gcugggucuu ugcgggcgag augagggugu cggaucaacu ggccuacaaa gucccagu
5822985RNAHomo sapiens 229augguguuau caaguguaac agcaacucca
uguggacugu guaccaauuu ccaguggaga 60ugcuguuacu uuugaugguu accaa
8523063RNAHomo sapiens 230guguaacagc aacuccaugu ggacugugua
ccaauuucca guggagaugc uguuacuuuu 60gau 6323187RNAHomo sapiens
231agcuucccug gcucuagcag cacagaaaua uuggcacagg gaagcgaguc
ugccaauauu 60ggcugugcug cuccaggcag gguggug 8723258RNAHomo sapiens
232uagcagcaca gaaauauugg cacagggaag cgagucugcc aauauuggcu gugcugcu
58233110RNAHomo sapiens 233cuagagcuug aauuggaacu gcugagugaa
uuagguaguu ucauguuguu gggccugggu 60uucugaacac aacaacauua aaccacccga
uucacggcag uuacugcucc 11023470RNAHomo sapiens 234gugaauuagg
uaguuucaug uuguugggcc uggguuucug aacacaacaa cauuaaacca 60cccgauucac
70235110RNAHomo sapiens 235ugcucgcuca gcugaucugu ggcuuaggua
guuucauguu guugggauug aguuuugaac 60ucggcaacaa gaaacugccu gaguuacauc
agucgguuuu cgucgagggc 11023670RNAHomo sapiens 236gugaauuagg
uaguuucaug uuguugggcc uggguuucug aacacaacaa cauuaaacca 60cccgauucac
7023784RNAHomo sapiens 237acuggucggu gauuuaggua guuuccuguu
guugggaucc accuuucucu cgacagcacg 60acacugccuu cauuacuuca guug
8423875RNAHomo sapiens 238ggcugugccg gguagagagg gcagugggag
guaagagcuc uucacccuuc accaccuucu 60ccacccagca uggcc 7523960RNAHomo
sapiens 239gugcaugugu auguaugugu gcaugugcau guguaugugu augagugcau
gcgugugugc 6024062RNAHomo sapiens 240ucauuggucc agaggggaga
uagguuccug ugauuuuucc uucuucucua uagaauaaau 60ga 6224171RNAHomo
sapiens 241gccaacccag uguucagacu accuguucag gaggcucuca auguguacag
uagucugcac 60auugguuagg c 71242110RNAHomo sapiens 242aggaagcuuc
uggagauccu gcuccgucgc cccaguguuc agacuaccug uucaggacaa 60ugccguugua
caguagucug cacauugguu agacugggca agggagagca 110243110RNAHomo
sapiens 243ccagaggaca ccuccacucc gucuacccag uguuuagacu aucuguucag
gacucccaaa 60uuguacagua gucugcacau ugguuaggcu gggcuggguu agacccucgg
11024471RNAHomo sapiens 244gccaacccag uguucagacu accuguucag
gaggcucuca auguguacag uagucugcac 60auugguuagg c 7124570RNAHomo
sapiens 245gccguggcca ucuuacuggg cagcauugga uggagucagg ucucuaauac
ugccugguaa 60ugaugacggc 7024695RNAHomo sapiens 246ccagcucggg
cagccguggc caucuuacug ggcagcauug gauggaguca ggucucuaau 60acugccuggu
aaugaugacg gcggagcccu gcacg 9524768RNAHomo sapiens 247cccucgucuu
acccagcagu guuugggugc gguugggagu cucuaauacu gccggguaau 60gauggagg
6824872RNAHomo sapiens 248guuccuuuuu ccuaugcaua uacuucuuug
aggaucuggc cuaaagaggu auagggcaug 60ggaagaugga gc 72249110RNAHomo
sapiens 249guguugggga cucgcgcgcu ggguccagug guucuuaaca guucaacagu
ucuguagcgc 60aauugugaaa uguuuaggac cacuagaccc ggcgggcgcg gcgacagcga
110250110RNAHomo sapiens 250ggcuacaguc uuucuucaug ugacucgugg
acuucccuuu gucauccuau gccugagaau 60auaugaagga ggcugggaag gcaaagggac
guucaauugu caucacuggc 110251110RNAHomo sapiens 251aaagauccuc
agacaaucca ugugcuucuc uuguccuuca uuccaccgga gucugucuca 60uacccaacca
gauuucagug gagugaaguu caggaggcau ggagcugaca 11025286RNAHomo sapiens
252ugcuucccga ggccacaugc uucuuuauau ccccauaugg auuacuuugc
uauggaaugu 60aaggaagugu gugguuucgg caagug 8625369RNAHomo sapiens
253aggccacaug cuucuuuaua uccccauaug gauuacuuug cuauggaaug
uaaggaagug 60ugugguuuu 6925471RNAHomo sapiens 254ugacgggcga
gcuuuuggcc cggguuauac cugaugcuca cguauaagac gagcaaaaag 60cuuguugguc
a 71255110RNAHomo sapiens 255acccggcagu gccuccaggc gcagggcagc
cccugcccac cgcacacugc gcugccccag 60acccacugug cgugugacag cggcugaucu
gugccugggc agcgcgaccc 110256110RNAHomo sapiens 256ucaccuggcc
augugacuug ugggcuuccc uuugucaucc uucgccuagg gcucugagca 60gggcagggac
agcaaagggg ugcucaguug ucacuuccca cagcacggag 110257110RNAHomo
sapiens 257cggggcaccc cgcccggaca gcgcgccggc accuuggcuc uagacugcuu
acugcccggg 60ccgcccucag uaacagucuc cagucacggc caccgacgcc uggccccgcc
110258110RNAHomo sapiens 258ccugugcaga gauuauuuuu uaaaagguca
caaucaacau ucauugcugu cgguggguug 60aacugugugg acaagcucac ugaacaauga
augcaacugu ggccccgcuu 110259108RNAHomo sapiens 259gaguuuugag
guugcuucag ugaacauuca acgcugucgg ugaguuugga auuaaaauca 60aaaccaucga
ccguugauug uacccuaugg cuaaccauca ucuacucc 108260110RNAHomo sapiens
260ggccuggcug gacagaguug ucaugugucu gccugucuac acuugcugug
cagaacaucc 60gcucaccugu acagcaggca cagacaggca gucacaugac aacccagccu
110261110RNAHomo sapiens 261aucauucaga aaugguauac aggaaaauga
ccuaugaauu gacagacaau auagcugagu 60uugucuguca uuucuuuagg ccaauauucu
guaugacugu gcuacuucaa 110262110RNAHomo sapiens 262gauggcugug
aguuggcuua aucucagcug gcaacuguga gauguucaua caaucccuca 60caguggucuc
ugggauuaug cuaaacagag caauuuccua gcccucacga 110263110RNAHomo
sapiens 263aguauaauua uuacauaguu uuugaugucg cagauacugc aucaggaacu
gauuggauaa 60gaaucaguca ccaucaguuc cuaaugcauu gccuucagca ucuaaacaag
110264110RNAHomo sapiens 264gugauaaugu agcgagauuu ucuguugugc
uugaucuaac caugugguug cgagguauga 60guaaaacaug guuccgucaa gcaccaugga
acgucacgca gcuuucuaca 110265110RNAHomo sapiens 265gaccagucgc
ugcggggcuu uccuuugugc uugaucuaac cauguggugg aacgauggaa 60acggaacaug
guucugucaa gcaccgcgga aagcaccgug cucuccugca 110266110RNAHomo
sapiens 266ccgccccggg ccgcggcucc ugauugucca aacgcaauuc ucgagucuau
ggcuccggcc 60gagaguugag ucuggacguc ccgagccgcc gcccccaaac cucgagcggg
110267110RNAHomo sapiens 267ccgccccggg ccgcggcucc ugauugucca
aacgcaauuc ucgagucuau ggcuccggcc 60gagaguugag ucuggacguc ccgagccgcc
gcccccaaac cucgagcggg 11026897RNAHomo sapiens 268acucaggggc
uucgccacug auuguccaaa cgcaauucuu guacgagucu gcggccaacc 60gagaauugug
gcuggacauc uguggcugag cuccggg 97269110RNAHomo sapiens 269gacagugugg
cauuguaggg cuccacaccg uaucugacac uuugggcgag ggcaccaugc 60ugaagguguu
caugaugcgg ucugggaacu ccucacggau cuuacugaug 110270110RNAHomo
sapiens 270ugaacaucca ggucuggggc augaaccugg cauacaaugu agauuucugu
guucguuagg 60caacagcuac auugucugcu ggguuucagg cuaccuggaa acauguucuc
110271110RNAHomo sapiens 271gcugcuggaa gguguaggua cccucaaugg
cucaguagcc aguguagauc cugucuuucg 60uaaucagcag cuacaucugg cuacuggguc
ucugauggca ucuucuagcu 110272110RNAHomo sapiens 272ccuggccucc
ugcagugcca cgcuccgugu auuugacaag cugaguugga cacuccaugu 60gguagagugu
caguuuguca aauaccccaa gugcggcaca ugcuuaccag 11027381RNAHomo sapiens
273gggcuuucaa gucacuagug guuccguuua guagaugauu gugcauuguu
ucaaaauggu 60gcccuaguga cuacaaagcc c 8127460RNAHomo sapiens
274caaucuuccu uuaucauggu auugauuuuu cagugcuucc cuuuugugug
agagaagaua 6027580RNAHomo sapiens 275aggacccuuc cagagggccc
ccccucaauc cuguugugcc uaauucagag gguugggugg 60aggcucuccu gaagggcucu
8027663RNAHomo sapiens 276aagaaauggu uuaccguccc acauacauuu
ugaauaugua ugugggaugg uaaaccgcuu 60cuu 6327786RNAHomo sapiens
277acugcuaacg aaugcucuga cuuuauugca cuacuguacu uuacagcuag
cagugcaaua 60guauugucaa agcaucugaa agcagg 8627869RNAHomo sapiens
278ccaccacuua aacguggaug uacuugcuuu gaaacuaaag aaguaagugc
uuccauguuu 60uggugaugg 6927973RNAHomo sapiens 279gcucccuuca
acuuuaacau ggaagugcuu ucugugacuu uaaaaguaag ugcuuccaug 60uuuuaguagg
agu 7328068RNAHomo sapiens 280ccuuugcuuu aacauggggg uaccugcugu
gugaaacaaa aguaagugcu uccauguuuc 60aguggagg 6828168RNAHomo sapiens
281ccucuacuuu aacauggagg cacuugcugu gacaugacaa aaauaagugc
uuccauguuu 60gagugugg 6828282RNAHomo sapiens 282gcuucgcucc
ccuccgccuu cucuucccgg uucuucccgg agucgggaaa agcuggguug 60agagggcgaa
aaaggaugag gu 8228359RNAHomo sapiens 283uuggccuccu aagccaggga
uuguggguuc gagucccacc cgggguaaag aaaggccga 5928486RNAHomo sapiens
284uugguacuug gagagaggug guccguggcg cguucgcuuu auuuauggcg
cacauuacac 60ggucgaccuc uuugcaguau cuaauc 8628583RNAHomo sapiens
285cugacuaugc cuccccgcau ccccuagggc auugguguaa agcuggagac
ccacugcccc 60aggugcugcu ggggguugua guc 8328698RNAHomo sapiens
286auacagugcu ugguuccuag uaggugucca guaaguguuu gugacauaau
uuguuuauug 60aggaccuccu aucaaucaag cacugugcua ggcucugg
9828795RNAHomo sapiens 287cucaucuguc uguugggcug gaggcagggc
cuuugugaag gcggguggug cucagaucgc 60cucugggccc uuccuccagc cccgaggcgg
auuca 9528875RNAHomo sapiens 288uggagugggg gggcaggagg ggcucaggga
gaaagugcau acagccccug gcccucucug 60cccuuccguc cccug 7528994RNAHomo
sapiens 289cuuuggcgau cacugccucu cugggccugu gucuuaggcu cugcaagauc
aaccgagcaa 60agcacacggc cugcagagag gcagcgcucu gccc 9429094RNAHomo
sapiens 290gaguuugguu uuguuugggu uuguucuagg uaugguccca gggaucccag
aucaaaccag 60gccccugggc cuauccuaga accaaccuaa gcuc 9429194RNAHomo
sapiens 291uguuuugagc gggggucaag agcaauaacg aaaaauguuu gucauaaacc
guuuuucauu 60auugcuccug accuccucuc auuugcuaua uuca 9429293RNAHomo
sapiens 292guagucagua guuggggggu gggaacggcu ucauacagga guugaugcac
aguuauccag 60cuccuauaug augccuuucu ucauccccuu caa 9329367RNAHomo
sapiens 293ucuccaacaa uauccuggug cugagugaug acucaggcga cuccagcauc
agugauuuug 60uugaaga 6729494RNAHomo sapiens 294cggggcggcc
gcucucccug uccuccagga gcucacgugu gccugccugu gagcgccucg 60acgacagagc
cggcgccugc cccagugucu gcgc 9429595RNAHomo sapiens 295uuguaccugg
ugugauuaua aagcaaugag acugauuguc auaugucguu ugugggaucc 60gucucaguua
cuuuauagcc auaccuggua ucuua 9529699RNAHomo sapiens 296gaaacugggc
ucaaggugag gggugcuauc ugugauugag ggacaugguu aauggaauug 60ucucacacag
aaaucgcacc cgucaccuug gccuacuua 9929798RNAHomo sapiens
297acccaaaccc uaggucugcu gacuccuagu ccagggcucg ugauggcugg
ugggcccuga 60acgagggguc uggaggccug gguuugaaua ucgacagc
9829886RNAHomo sapiens 298gucugucugc ccgcaugccu gccucucugu
ugcucugaag gaggcagggg cugggccugc 60agcugccugg gcagagcggc uccugc
8629968RNAHomo sapiens 299ccauuacugu ugcuaauaug caacucuguu
gaauauaaau uggaauugca cuuuagcaau 60ggugaugg 6830066RNAHomo sapiens
300aaaaggugga uauuccuucu auguuuaugu uauuuauggu uaaacauaga
ggaaauucca 60cguuuu 6630170RNAHomo sapiens 301uugaagggag aucgaccgug
uuauauucgc uuuauugacu ucgaauaaua caugguugau 60cuuuucucag
7030275RNAHomo sapiens 302agacagagaa gccaggucac gucucugcag
uuacacagcu cacgagugcc ugcuggggug 60gaaccugguc ugucu 7530367RNAHomo
sapiens 303guggcacuca aacugugggg gcacuuucug cucucuggug aaagugccgc
caucuuuuga 60guguuac 6730467RNAHomo sapiens 304gugggccuca
aauguggagc acuauucuga uguccaagug gaaagugcug cgacauuuga 60gcgucac
6730569RNAHomo sapiens 305gggauacuca aaaugggggc gcuuuccuuu
uugucuguac ugggaagugc uucgauuuug 60ggguguccc 6930672RNAHomo sapiens
306uacaucggcc auuauaauac aaccugauaa guguuauagc acuuaucaga
uuguauugua 60auugucugug ua 72307102RNAHomo sapiens 307auggagcugc
ucacccugug ggccucaaau guggaggaac uauucugaug uccaagugga 60aagugcugcg
acauuugagc gucaccggug acgcccauau ca 102308101RNAHomo sapiens
308gcauccccuc agccuguggc acucaaacug ugggggcacu uucugcucuc
uggugaaagu 60gccgccaucu uuugaguguu accgcuugag aagacucaac c
101309102RNAHomo sapiens 309cgaggagcuc auacugggau acucaaaaug
ggggcgcuuu ccuuuuuguc uguuacuggg 60aagugcuucg auuuuggggu gucccuguuu
gaguagggca uc 10231022RNAHomo sapiens 310ugagguagua gguuguauag uu
2231122RNAHomo sapiens 311ugagguagua gguugugugg uu 2231222RNAHomo
sapiens 312ugagguagua gguuguaugg uu 2231321RNAHomo sapiens
313agagguagua gguugcauag u 2131421RNAHomo sapiens 314ugagguagga
gguuguauag u 2131522RNAHomo sapiens 315ugagguagua gauuguauag uu
2231621RNAHomo sapiens 316ugagguagua guuuguacag u 2131719RNAHomo
sapiens 317ugagguagua guuugugcu 1931821RNAHomo sapiens
318uggaauguaa agaaguaugu a 2131921RNAHomo sapiens 319uggaagacua
gugauuuugu u 2132023RNAHomo sapiens 320ucuuugguua ucuagcugua uga
2332121RNAHomo sapiens 321uaaagcuaga uaaccgaaag u 2132223RNAHomo
sapiens 322uacccuguag auccgaauuu gug 2332322RNAHomo sapiens
323uacccuguag aaccgaauuu gu 2232422RNAHomo sapiens 324uagcagcaca
uaaugguuug ug 2232522RNAHomo sapiens 325uagcagcaca ucaugguuua ca
2232622RNAHomo sapiens 326uagcagcacg uaaauauugg cg 2232724RNAHomo
sapiens 327caaagugcuu acagugcagg uagu 2432820RNAHomo sapiens
328acugcaguga aggcacuugu 2032922RNAHomo sapiens 329uaaggugcau
cuagugcaga ua 2233023RNAHomo sapiens 330ugugcaaauc uaugcaaaac uga
2333123RNAHomo sapiens 331ugugcaaauc caugcaaaac uga 2333222RNAHomo
sapiens 332uaaagugcuu auagugcagg ua 2233322RNAHomo sapiens
333uagcuuauca gacugauguu ga 2233422RNAHomo sapiens 334aagcugccag
uugaagaacu gu 2233521RNAHomo sapiens 335aucacauugc cagggauuuc c
2133623RNAHomo sapiens 336aucacauugc cagggauuac cac 2333722RNAHomo
sapiens 337uggcucaguu cagcaggaac ag 2233822RNAHomo sapiens
338cauugcacuu gucucggucu ga
2233922RNAHomo sapiens 339uucaaguaau ccaggauagg cu 2234021RNAHomo
sapiens 340uucaaguaau ucaggauagg u 2134122RNAHomo sapiens
341uucacagugg cuaaguuccg cc 2234220RNAHomo sapiens 342uucacagugg
cuaaguucug 2034322RNAHomo sapiens 343aaggagcuca cagucuauug ag
2234422RNAHomo sapiens 344cuagcaccau cugaaaucgg uu 2234520RNAHomo
sapiens 345uagcaccauu ugaaaucagu 2034622RNAHomo sapiens
346uagcaccauu ugaaaucggu ua 2234723RNAHomo sapiens 347uguaaacauc
cucgacugga agc 2334822RNAHomo sapiens 348cuuucagucg gauguuugca gc
2234921RNAHomo sapiens 349uguaaacauc cuacacucag c 2135023RNAHomo
sapiens 350uguaaacauc cuacacucuc agc 2335122RNAHomo sapiens
351uguaaacauc cccgacugga ag 2235220RNAHomo sapiens 352uguaaacauc
cuugacugga 2035321RNAHomo sapiens 353ggcaagaugc uggcauagcu g
2135421RNAHomo sapiens 354uauugcacau uacuaaguug c 2135519RNAHomo
sapiens 355gugcauugua guugcauug 1935622RNAHomo sapiens
356uggcaguguc uuagcugguu gu 2235722RNAHomo sapiens 357aggcaguguc
auuagcugau ug 2235822RNAHomo sapiens 358aggcagugua guuagcugau ug
2235922RNAHomo sapiens 359uauugcacuu gucccggccu gu 2236022RNAHomo
sapiens 360aaagugcugu ucgugcaggu ag 2236122RNAHomo sapiens
361uucaacgggu auuuauugag ca 2236222RNAHomo sapiens 362uuuggcacua
gcacauuuuu gc 2236322RNAHomo sapiens 363ugagguagua aguuguauug uu
2236422RNAHomo sapiens 364aacccguaga uccgaucuug ug 2236522RNAHomo
sapiens 365cacccguaga accgaccuug cg 2236622RNAHomo sapiens
366uacaguacug ugauaacuga ag 2236722RNAHomo sapiens 367uacaguacug
ugauaacuga ag 2236823RNAHomo sapiens 368agcagcauug uacagggcua uga
2336920RNAHomo sapiens 369ucaaaugcuc agacuccugu 2037024RNAHomo
sapiens 370aaaagugcuu acagugcagg uagc 2437121RNAHomo sapiens
371uaaagugcug acagugcaga u 2137223RNAHomo sapiens 372agcagcauug
uacagggcua uca 2337323RNAHomo sapiens 373uggaguguga caaugguguu ugu
2337422RNAHomo sapiens 374uuaaggcacg cggugaaugc ca 2237523RNAHomo
sapiens 375ucccugagac ccuuuaaccu gug 2337622RNAHomo sapiens
376ucccugagac ccuaacuugu ga 2237721RNAHomo sapiens 377cauuauuacu
uuugguacgc g 2137821RNAHomo sapiens 378ucguaccgug aguaauaaug c
2137922RNAHomo sapiens 379ucggauccgu cugagcuugg cu 2238022RNAHomo
sapiens 380ucacagugaa ccggucucuu uu 2238122RNAHomo sapiens
381ucacagugaa ccggucucuu uc 2238221RNAHomo sapiens 382cuuuuugcgg
ucugggcuug c 2138320RNAHomo sapiens 383cagugcaaug uuaaaagggc
2038422RNAHomo sapiens 384cagugcaaug augaaagggc au 2238522RNAHomo
sapiens 385uaacagucua cagccauggu cg 2238622RNAHomo sapiens
386uugguccccu ucaaccagcu gu 2238721RNAHomo sapiens 387uugguccccu
ucaaccagcu a 2138821RNAHomo sapiens 388ugugacuggu ugaccagagg g
2138923RNAHomo sapiens 389uauggcuuuu uauuccuaug uga 2339022RNAHomo
sapiens 390uauggcuuuu cauuccuaug ug 2239123RNAHomo sapiens
391acuccauuug uuuugaugau gga 2339222RNAHomo sapiens 392uauugcuuaa
gaauacgcgu ag 2239317RNAHomo sapiens 393agcugguguu gugaauc
1739418RNAHomo sapiens 394ucuacagugc acgugucu 1839521RNAHomo
sapiens 395agugguuuua cccuauggua g 2139621RNAHomo sapiens
396aacacugucu gguaaagaug g 2139723RNAHomo sapiens 397uguaguguuu
ccuacuuuau gga 2339820RNAHomo sapiens 398cauaaaguag aaagcacuac
2039922RNAHomo sapiens 399ugagaugaag cacuguagcu ca 2240022RNAHomo
sapiens 400uacaguauag augauguacu ag 2240124RNAHomo sapiens
401guccaguuuu cccaggaauc ccuu 2440222RNAHomo sapiens 402ugagaacuga
auuccauggg uu 2240320RNAHomo sapiens 403guguguggaa augcuucugc
2040422RNAHomo sapiens 404ucagugcacu acagaacuuu gu 2240522RNAHomo
sapiens 405ucagugcauc acagaacuuu gu 2240622RNAHomo sapiens
406ucuggcuccg ugucuucacu cc 2240722RNAHomo sapiens 407ucucccaacc
cuuguaccag ug 2240822RNAHomo sapiens 408acuagacuga agcuccuuga gg
2240921RNAHomo sapiens 409ucagugcaug acagaacuug g 2141020RNAHomo
sapiens 410uugcauaguc acaaaaguga 2041122RNAHomo sapiens
411uagguuaucc guguugccuu cg 2241222RNAHomo sapiens 412aaucauacac
gguugaccua uu 2241322RNAHomo sapiens 413uuaaugcuaa ucgugauagg gg
2241423RNAHomo sapiens 414aacauucaac gcugucggug agu 2341524RNAHomo
sapiens 415aacauucauu gcugucggug gguu 2441622RNAHomo sapiens
416aacauucaac cugucgguga gu 2241722RNAHomo sapiens 417uuuggcaaug
guagaacuca ca 2241821RNAHomo sapiens 418ugguucuaga cuugccaacu a
2141923RNAHomo sapiens 419uauggcacug guagaauuca cug 2342022RNAHomo
sapiens 420uggacggaga acugauaagg gu 2242118RNAHomo sapiens
421uggagagaaa ggcaguuc 1842223RNAHomo sapiens 422caaagaauuc
uccuuuuggg cuu 2342321RNAHomo sapiens 423ucgugucuug uguugcagcc g
2142422RNAHomo sapiens 424caucccuugc augguggagg gu 2242523RNAHomo
sapiens 425gugccuacug agcugauauc agu 2342622RNAHomo sapiens
426ugauauguuu gauauauuag gu 2242722RNAHomo sapiens 427caacggaauc
ccaaaagcag cu 2242821RNAHomo sapiens 428cugaccuaug aauugacagc c
2142921RNAHomo sapiens 429aacuggccua caaaguccca g 2143022RNAHomo
sapiens 430uguaacagca acuccaugug ga 2243121RNAHomo sapiens
431uagcagcaca gaaauauugg c 2143221RNAHomo sapiens 432uagguaguuu
cauguuguug g 2143321RNAHomo sapiens 433uagguaguuu ccuguuguug g
2143422RNAHomo sapiens 434uucaccaccu ucuccaccca gc 2243519RNAHomo
sapiens 435gguccagagg ggagauagg 1943623RNAHomo sapiens
436cccaguguuc agacuaccug uuc 2343722RNAHomo sapiens 437uacaguaguc
ugcacauugg uu 2243823RNAHomo sapiens 438cccaguguuu agacuaucug uuc
2343922RNAHomo sapiens 439uaacacuguc ugguaacgau gu 2244024RNAHomo
sapiens 440cucuaauacu gccugguaau gaug 2444122RNAHomo sapiens
441aauacugccg gguaaugaug ga 2244222RNAHomo sapiens 442agagguauag
ggcaugggaa ga 2244322RNAHomo sapiens 443gugaaauguu uaggaccacu ag
2244422RNAHomo sapiens 444uucccuuugu cauccuaugc cu 2244522RNAHomo
sapiens 445uccuucauuc caccggaguc ug 2244622RNAHomo sapiens
446uggaauguaa ggaagugugu gg 2244722RNAHomo sapiens 447auaagacgag
caaaaagcuu gu 2244821RNAHomo sapiens 448cugugcgugu gacagcggcu g
2144922RNAHomo sapiens 449uucccuuugu cauccuucgc cu 2245021RNAHomo
sapiens 450uaacagucuc cagucacggc c 2145122RNAHomo sapiens
451accaucgacc guugauugua cc 2245221RNAHomo sapiens 452acagcaggca
cagacaggca g 2145321RNAHomo sapiens 453augaccuaug aauugacaga c
2145421RNAHomo sapiens 454uaaucucagc uggcaacugu g 2145524RNAHomo
sapiens 455uacugcauca ggaacugauu ggau 2445621RNAHomo sapiens
456uugugcuuga ucuaaccaug u 2145721RNAHomo sapiens 457ugauugucca
aacgcaauuc u 2145821RNAHomo sapiens 458ccacaccgua ucugacacuu u
2145923RNAHomo sapiens 459agcuacauug ucugcugggu uuc 2346024RNAHomo
sapiens 460agcuacaucu ggcuacuggg ucuc 2446121RNAHomo sapiens
461ugucaguuug ucaaauaccc c 2146223RNAHomo sapiens 462caagucacua
gugguuccgu uua 2346321RNAHomo sapiens 463agggcccccc cucaauccug u
2146422RNAHomo sapiens 464ugguuuaccg ucccacauac au 2246523RNAHomo
sapiens 465cagugcaaua guauugucaa agc 2346623RNAHomo sapiens
466uaagugcuuc cauguuuugg uga 2346723RNAHomo sapiens 467acuuuaacau
ggaagugcuu ucu 2346823RNAHomo sapiens 468uaagugcuuc cauguuuuag uag
2346922RNAHomo sapiens 469uuuaacaugg ggguaccugc ug 2247023RNAHomo
sapiens 470uaagugcuuc cauguuucag ugg 2347123RNAHomo sapiens
471uaagugcuuc cauguuugag ugu 2347223RNAHomo sapiens 472aaaagcuggg
uugagagggc gaa 2347321RNAHomo sapiens 473uaagccaggg auuguggguu c
2147422RNAHomo sapiens 474gcacauuaca cggucgaccu cu 2247523RNAHomo
sapiens 475cgcauccccu agggcauugg ugu 2347622RNAHomo sapiens
476ccacugcccc aggugcugcu gg 2247721RNAHomo sapiens 477ccuaguaggu
guccaguaag u 2147820RNAHomo sapiens 478ccucugggcc cuuccuccag
2047922RNAHomo sapiens 479cuggcccucu cugcccuucc gu 2248023RNAHomo
sapiens 480gcaaagcaca cggccugcag aga 2348121RNAHomo sapiens
481gccccugggc cuauccuaga a 2148223RNAHomo sapiens 482ucaagagcaa
uaacgaaaaa ugu 2348323RNAHomo sapiens 483uccagcuccu auaugaugcc uuu
2348423RNAHomo sapiens 484uccagcauca gugauuuugu uga 2348521RNAHomo
sapiens 485ucccuguccu ccaggagcuc a 2148623RNAHomo sapiens
486uccgucucag uuacuuuaua gcc 2348724RNAHomo sapiens 487ucucacacag
aaaucgcacc cguc 2448821RNAHomo sapiens 488ugcugacucc uaguccaggg c
2148923RNAHomo sapiens 489ugucugcccg caugccugcc ucu 2349022RNAHomo
sapiens 490aauugcacuu uagcaauggu ga 2249122RNAHomo sapiens
491acauagagga aauuccacgu uu 2249221RNAHomo sapiens 492aauaauacau
gguugaucuu u 2149321RNAHomo sapiens 493gccugcuggg guggaaccug g
2149421RNAHomo sapiens 494gugccgccau cuuuugagug u 2149523RNAHomo
sapiens 495aaagugcugc gacauuugag cgu 2349622RNAHomo sapiens
496acucaaaaug ggggcgcuuu cc 2249723RNAHomo sapiens 497gaagugcuuc
gauuuugggg ugu 2349822RNAHomo sapiens 498uuauaauaca accugauaag ug
22
* * * * *