U.S. patent application number 14/864736 was filed with the patent office on 2016-07-21 for anti-human cd52 immunoglobulins.
The applicant listed for this patent is GENZYME CORPORATION. Invention is credited to William Harold Brondyk, Bruce L. Roberts, Srinivas Shankara, William M. Siders.
Application Number | 20160208010 14/864736 |
Document ID | / |
Family ID | 43085579 |
Filed Date | 2016-07-21 |
United States Patent
Application |
20160208010 |
Kind Code |
A1 |
Roberts; Bruce L. ; et
al. |
July 21, 2016 |
ANTI-HUMAN CD52 IMMUNOGLOBULINS
Abstract
The present invention relates to humanized immunoglobulins,
mouse monoclonal antibodies and chimeric antibodies that have
binding specificity for human CD52. The present invention further
relates to a humanized immunoglobulin light chain and a humanized
immunoglobulin heavy chain. The invention also relates to isolated
nucleic acids, recombinant vectors and host cells that comprise a
sequence which encodes a humanized immunoglobulin or immunoglobulin
light chain or heavy chain, and to a method of preparing a
humanized immunoglobulin. The humanized immunoglobulins can be used
in therapeutic applications to treat, for example, autoimmune
disease, cancer, non-Hodgkin's lymphoma, multiple sclerosis and
chronic lymphocytic leukemia.
Inventors: |
Roberts; Bruce L.;
(Southborough, MA) ; Shankara; Srinivas;
(Shrewbury, MA) ; Brondyk; William Harold;
(Mansfield, MA) ; Siders; William M.; (Franklin,
MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
GENZYME CORPORATION |
Cambridge |
MA |
US |
|
|
Family ID: |
43085579 |
Appl. No.: |
14/864736 |
Filed: |
September 24, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14091083 |
Nov 26, 2013 |
|
|
|
14864736 |
|
|
|
|
13320019 |
Nov 10, 2011 |
8617554 |
|
|
PCT/US2010/034704 |
May 13, 2010 |
|
|
|
14091083 |
|
|
|
|
61177837 |
May 13, 2009 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 2039/505 20130101;
A61P 37/02 20180101; C07K 2317/734 20130101; A61P 29/00 20180101;
C07K 2317/52 20130101; A61P 35/00 20180101; C07K 2317/76 20130101;
A61P 9/00 20180101; C07K 2317/565 20130101; C07K 2317/94 20130101;
C07K 2317/24 20130101; A61P 35/02 20180101; C07K 2317/34 20130101;
A61P 37/06 20180101; A61P 37/00 20180101; A61P 25/00 20180101; C07K
2317/732 20130101; C07K 16/2893 20130101; C07K 2317/64 20130101;
A61P 19/02 20180101; A61P 37/04 20180101 |
International
Class: |
C07K 16/28 20060101
C07K016/28 |
Claims
1. (canceled)
2. A monoclonal anti-human CD52 antibody, or an antigen-binding
portion thereof, that binds to the same epitope on human CD52 as an
anti-human CD52 antibody whose light chain and heavy chain comprise
the three complementarity determining regions (CDRs) found in a)
SEQ ID NOs: 3 and 16, respectively b) SEQ ID NOs: 4 and 17,
respectively; c) SEQ ID NOs: 5 and 18, respectively; d) SEQ ID NOs:
6 and 19, respectively; e) SEQ ID NOs: 7 and 20, respectively; f)
SEQ ID NOs: 8 and 21, respectively; g) SEQ ID NOs: 9 and 22,
respectively; h) SEQ ID NOs: 10 and 23, respectively; i) SEQ ID
NOs: 11 and 24, respectively; j) SEQ ID NOs: 12 and 25,
respectively; k) SEQ ID NOs: 12 and 137, respectively; or l) SEQ ID
NOs: 13 and 26, respectively.
3. A monoclonal anti-human CD52 antibody, or an antigen-binding
portion thereof, that competes or cross-competes with an anti-human
CD52 antibody whose light chain and heavy chain comprise the three
complementarity determining regions (CDRs) found in a) SEQ ID NOs:
3 and 16, respectively; b) SEQ ID NOs: 4 and 17, respectively; c)
SEQ ID NOs: 5 and 18, respectively; d) SEQ ID NOs: 6 and 19,
respectively; e) SEQ ID NOs: 7 and 20, respectively; f) SEQ ID NOs:
8 and 21, respectively; g) SEQ ID NOs: 9 and 22, respectively; h)
SEQ ID NOs: 10 and 23, respectively; i) SEQ ID NOs: 11 and 24,
respectively; i) SEQ ID NOs: 12 and 25, respectively; k) SEQ ID
NOs: 12 and 137, respectively; or l) SEQ ID NOs: 13 and 26,
respectively.
4-24. (canceled)
25. An isolated nucleic acid encoding the heavy chain or an
antigen-binding portion thereof, or the light chain or an
antigen-binding portion thereof, of the monoclonal antibody of
claim 2.
26-28. (canceled)
29. A recombinant vector comprising (1) a nucleic acid sequence
encoding the heavy chain or an antigen-binding portion thereof, (2)
a nucleic acid sequence encoding the light chain or an
antigen-binding portion thereof, or (3) both, of a monoclonal
antibody according to claim 2.
30. A host cell comprising a first nucleic acid sequence encoding
the heavy chain or an antigen-binding portion thereof of a
monoclonal antibody according to claim 2, said first nucleic acid
sequence operably linked to an expression control element, and a
second nucleic acid sequence encoding the light chain or an
antigen-binding portion thereof of said monoclonal antibody, said
second nucleic acid sequence operably linked to an expression
control element.
31. A method of making an anti-human CD52 antibody or an
antigen-binding portion thereof, comprising maintaining the host
cell of claim 30 under conditions appropriate for expression of the
antibody or portion.
32. (canceled)
33. A composition comprising the monoclonal antibody or
antigen-binding portion according to claim 2 and a pharmaceutically
acceptable vehicle or carrier.
34. A method for treating a patient in need thereof, comprising
administering to the patient an effective amount of the monoclonal
antibody or antigen-binding portion according to claim 2.
35-54. (canceled)
55. An isolated nucleic acid encoding the heavy chain or an
antigen-binding portion thereof, or the light chain or an
antigen-binding portion thereof, of the monoclonal antibody of
claim 3.
56. A recombinant vector comprising (1) a nucleic acid sequence
encoding the heavy chain or an antigen-binding portion thereof, (2)
a nucleic acid sequence encoding the light chain or an
antigen-binding portion thereof, or (3) both, of a monoclonal
antibody according to claim 3.
57. A host cell comprising a first nucleic acid sequence encoding
the heavy chain or an antigen-binding portion thereof of a
monoclonal antibody according to claim 3, said first nucleic acid
sequence operably linked to an expression control element, and a
second nucleic acid sequence encoding the light chain or an
antigen-binding portion thereof of said monoclonal antibody, said
second nucleic acid sequence operably linked to an expression
control element.
58. A method of making an anti-human CD52 antibody or an
antigen-binding portion thereof, comprising maintaining the host
cell of claim 57 under conditions appropriate for expression of the
antibody or portion.
59. A composition comprising the monoclonal antibody or
antigen-binding portion according to claim 3 and a pharmaceutically
acceptable vehicle or carrier.
60. A method for treating a patient in need thereof, comprising
administering to the patient an effective amount of the monoclonal
antibody or antigen-binding portion according to claim 3.
Description
[0001] This application is a continuation application of U.S.
patent application Ser. No. 14/091,083, filed Nov. 26, 2013 (now
pending), which is a continuation of U.S. patent application Ser.
No. 13/320,019, filed Nov. 10, 2011 (now issued as U.S. Pat. No.
8,617,554), which is a national stage application under 35 U.S.C.
.sctn.371 of International Application PCT/US2010/034704 (now
expired), filed May 13, 2010, which claims priority from U.S.
Provisional Application 61/177,837 (now expired), filed May 13,
2009. The contents of the foregoing priority applications are
incorporated by reference herein in their entirety.
[0002] A sequence listing associated with this application is being
submitted electronically via EFS-Web in text format, and is hereby
incorporated by reference in its entirety into the specification.
The name of the text file containing the Sequence Listing is
001662_0029_303_Sequence_Listing.txt. The text file, created on
Sep. 24, 2015, is 182,348 bytes in size.
BACKGROUND OF THE INVENTION
[0003] CD52 is a glycosylated, glycosylphosphatidylinositol
(GPI)-anchored cell surface protein found in abundance (500,000
molecules/cell) on a variety of normal and malignant lymphoid cells
(e.g., T and B cells). See, e.g., Hale et al., J Biol regul Homeost
Agents 15:386-391 (2001); Huh et al., Blood 92: Abstract 4199
(1998); Elsner et al., Blood 88:4684-4693 (1996); Gilleece et al.,
Blood 82:807-812 (1993); Rodig et al., Clin Cancer Res 12:7174-7179
(2006); Ginaldi et al., Leuk Res 22:185-191 (1998). CD52 is
expressed at lower levels on myeloid cells such as monocytes,
macrophages, and dendritic cells, with little expression found on
mature natural killer (NK) cells, neutrophils, and hematological
stem cells. Id. CD52 is also produced by epithelial cells in the
epididymis and duct deferens, and is acquired by sperm during
passage through the genital tract (Hale et al., 2001, supra;
Domagala et al., Med Sci Monit 7:325-331 (2001)). The exact
biological function of CD52 remains unclear but some evidence
suggests that it may be involved in T cell migration and
co-stimulation (Rowan et al., Int Immunol 7:69-77 (1995); Masuyama
et al., J Exp Med 189:979-989 (1999); Watanabe et al., Clin Immunol
120:247-259 (2006)).
[0004] Campath-1H.RTM. (alemtuzumab, Campath.RTM., MabCampath.RTM.)
is a humanized anti-human CD52 monoclonal antibody that exhibits
potent in vitro cytotoxic effects (antibody-dependent cell mediated
cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC)).
Campath.RTM. recognizes an epitope which consists of the carboxy
terminal four amino acids of the mature CD52 protein and a portion
of the negatively charged GPI anchor. Due to its significant
cytotoxic effects, Campath.RTM. is capable of depleting CD52
positive cells in vivo and it is approved for front line and third
line treatment of chronic lymphocytic leukemia (CLL). Campath.RTM.
has been evaluated for its utility in the treatment of several
autoimmune diseases, including rheumatoid arthritis, vasculitis,
myositis and Wegener's disease. However, the most advanced studies
of Campath.RTM. are in treating relapsing remitting multiple
sclerosis (MS). These studies showed a significant improvement in
time to relapse relative to an active comparator (Rebif.RTM. (i.e.,
interferon beta-1a)).
[0005] A need exists for additional therapeutic agents and
approaches to target CD52.
SUMMARY OF THE INVENTION
Humanized Immunoglobulins
[0006] The invention relates to humanized immunoglobulins that have
binding specificity for human CD52 (huCD52). They may comprise the
complementarity determining regions (CDRs) of mouse anti-human CD52
antibodies. The humanized immunoglobulins of the invention have
amino acid sequences that are different from other humanized
immunoglobulins, and in particular from other humanized
immunoglobulins that comprise CDRs of murine anti-human CD52
antibodies. The humanized immunoglobulins of the invention are
different from the humanized immunoglobulin Campath.RTM.. In some
embodiments, they provide advantages over humanized antibodies that
comprise the CDRs of Campath.RTM..
[0007] The humanized immunoglobulins described herein can comprise
a humanized heavy chain and a humanized light chain. In one
embodiment, the humanized immunoglobulin comprises a light chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 3
and a heavy chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 16; a light chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 4 and a heavy chain comprising
one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 17; a light
chain comprising one or more CDRs (e.g., all three CDRs) of SEQ ID
NO: 5 and a heavy chain comprising one or more CDRs (e.g., all
three CDRs) of SEQ ID NO: 18; a light chain comprising one or more
CDRs (e.g., all three CDRs) of SEQ ID NO: 6 and a heavy chain
comprising one or more CDRs of SEQ ID NO: 19; a light chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 7
and a heavy chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 20; a light chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 8 and a heavy chain comprising
one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 21; a light
chain comprising one or more CDRs (e.g., all three CDRs) of SEQ ID
NO: 9 and a heavy chain comprising one or more CDRs (e.g., all
three CDRs) of SEQ ID NO: 22; a light chain comprising one or more
CDRs (e.g., all three CDRs) of SEQ ID NO: 10 and a heavy chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO:
23; a light chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 11 and a heavy chain comprising one or more
CDRs (e.g., all three CDRs) of SEQ ID NO: 24; a light chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 12
and a heavy chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 25; a light chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 12 and a heavy chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO:
137; or a light chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 13 and a heavy chain sequence comprising one or
more CDRs (e.g., all three CDRs) of SEQ ID NO: 26. The CDRs in the
above-mentioned SEQ ID NOs are indicated by FIGS. 2 and 3 and are
referred to in Tables 1-6 as provided herein.
[0008] In another embodiment, the humanized immunoglobulin that has
binding specificity for human CD52 comprises a light chain
comprising one or more CDRs (e.g., all three) selected from the
group consisting of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29,
SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID
NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38,
SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID
NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47,
and SEQ ID NO: 48; a heavy chain comprising one or more CDRs (e.g.,
all three) selected from the group consisting of SEQ ID NO: 49, SEQ
ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO:
54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ
ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO:
63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ
ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO:
72, SEQ ID NO: 73, SEQ ID NO: 74, and SEQ ID NO: 294; or such a
light chain and such a heavy chain; wherein the humanized
immunoglobulin is not Campath.RTM..
[0009] In another embodiment, the humanized immunoglobulin that has
a binding specificity for human CD52 comprises a light chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 3,
SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO:
8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or
SEQ ID NO: 13; a heavy chain comprising one or more CDRs (e.g., all
three CDRs) of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID
NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23,
SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 137; or
such a light chain and such a heavy chain; wherein the humanized
immunoglobulin is not Campath.RTM..
[0010] In some embodiments, the framework region of the humanized
immunoglobulin has at least 50% homology to the framework region of
the immunoglobulin from which the light chain CDRs and the heavy
chain CDRs are obtained. For example, the framework region of the
humanized immunoglobulin can be at least 50%, at least 60%, at
least 70%, at least 80%, at least 90%, at least 95%, at least 98%,
at least 99%, or even 100% identical, to a germline human
immunoglobulin sequence. In one embodiment, the framework region of
the humanized immunoglobulin can be obtained or derived from an IgG
human antibody variable region. In another embodiment the CD52 is
wildtype human CD52. In yet another embodiment, the humanized
immunoglobulin can compete with alemtuzumab for binding to human
CD52, e.g., it can bind to an epitope that is identical to, or
which overlaps with, the epitope to which alemtuzumab binds.
[0011] The invention also relates to a humanized light chain of a
humanized immunoglobulin of the invention. In one embodiment, the
humanized light chain comprises one or more CDRs selected from the
group consisting of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29,
SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID
NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38,
SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID
NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47,
and SEQ ID NO: 48 or a combination thereof, wherein the humanized
light chain is not the humanized light chain of Campath.RTM..
[0012] In other embodiment, the humanized light chain comprises one
or more CDRs (e.g., all three CDRs) of SEQ ID NO: 3, SEQ ID NO: 4,
SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO:
9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13,
wherein the humanized light chain is not the humanized light chain
of Campath.RTM..
[0013] The invention also relates to a humanized heavy chain of a
humanized immunoglobulin of the invention. In one embodiment, the
humanized heavy chain comprises one or more CDRs of an Ig variable
domain selected from the group consisting of SEQ ID NO: 49, SEQ ID
NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54,
SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID
NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63,
SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID
NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72,
SEQ ID NO: 73, SEQ ID NO: 74, and SEQ ID NO: 294, or a combination
thereof, wherein the humanized heavy chain is not the humanized
heavy chain of Campath.RTM..
[0014] In other embodiments, the humanized heavy chain comprises
one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 16, SEQ ID
NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21,
SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID
NO: 26, or SEQ ID NO: 137, wherein the humanized heavy chain is not
the humanized heavy chain of Campath.RTM..
[0015] Preferably, the humanized immunoglobulins of the present
invention comprise both a humanized light chain of the invention
and a humanized heavy chain of the invention.
[0016] In other embodiments, the invention provides a humanized
immunoglobulin which binds to the same epitope on human CD52 as, or
competes or cross-competes with, a mouse monoclonal antibody
comprising a light chain variable region of SEQ ID NO: 3 and a
heavy chain variable region of SEQ ID NO: 16; a light chain
variable region of SEQ ID NO: 4 and a heavy chain variable region
of SEQ ID NO: 17; a light chain variable region of SEQ ID NO: 5 and
a heavy chain variable region of SEQ ID NO: 18; a light chain
variable region of SEQ ID NO: 6 and a heavy chain variable region
of SEQ ID NO: 19; a light chain variable region of SEQ ID NO: 7 and
a heavy chain variable region of SEQ ID NO: 20; a light chain
variable region of SEQ ID NO: 8 and a heavy chain variable region
of SEQ ID NO: 21; a light chain variable region of SEQ ID NO: 9 and
a heavy chain variable region of SEQ ID NO: 22; a light chain
variable region of SEQ ID NO: 10 and a heavy chain variable region
of SEQ ID NO: 23; a light chain variable region of SEQ ID NO: 11
and a heavy chain variable region of SEQ ID NO: 24; a light chain
variable region of SEQ ID NO: 12 and a heavy chain variable region
of SEQ ID NO: 25; or a light chain variable region of SEQ ID NO: 13
and a heavy chain variable region of SEQ ID NO: 26. In other
embodiments, the humanized immunoglobulin binds to an epitope on
human CD52 which overlaps with the epitope to which such a mouse
monoclonal antibody binds.
[0017] In other embodiments, the invention provides a humanized
immunoglobulin which binds to an epitope on human CD52 (e.g., SEQ
ID NO: 104) comprising at least residue 1 of the mature human CD52
sequence (where residue 1 is the N-terminus of the mature human
CD52 sequence, i.e., the N-terminal glycine [G] residue; see FIG.
4). The humanized immunoglobulin may bind to an epitope comprising
at least residues 1, 3, 4 and 5 of the mature human CD52 sequence
(these residues being a glycine [G], an asparagine [N], an
aspartate [D], and a threonine [T], respectively). The humanized
immunoglobulin may bind to an epitope comprising at least residues
1, 2, 3, 4 and 5 of the mature human CD52 sequence (these residues
being a glycine [G], a glutamine [Q], an asparagine [N], an
aspartate [D], and a threonine [T], respectively). In other
embodiments, the invention provides a humanized immunoglobulin
which binds to an epitope on human CD52 comprising at least
residues 7, 8 and 9 of the mature human CD52 sequence (these
residues being a glutamine [Q], a threonine [T], and a serine [S],
respectively). In some embodiments, the epitope comprises at least
residues 7 (Q), 8 (T) and 11 (P) of the mature human CD52 sequence.
In some embodiments, the epitope comprises at least residues 4 (D)
and 11 (P) of the mature human CD52 sequence.
[0018] In some embodiments, the invention provides a humanized
immunoglobulin, which binds to human CD52, and which comprises a
light chain comprising one or more CDRs selected from the group
consisting of SEQ ID NO: 115, SEQ ID NO: 118, and SEQ ID NO: 121
(e.g., all three of said CDRs), or a heavy chain comprising one or
more CDRs selected from the group consisting of SEQ ID NO: 124, SEQ
ID NO: 127, and SEQ ID NO: 130 (e.g., all three of said CDRs), or
both such light chain and such heavy chain. In other embodiments,
the invention provides a humanized immunoglobulin, which binds to
human CD52, and which comprises a light chain comprising one or
more CDRs selected from the group consisting of SEQ ID NO: 116, SEQ
ID NO: 119, and SEQ ID NO: 122 (e.g., all three of said CDRs), or a
heavy chain comprising one or more CDRs selected from the group
consisting of SEQ ID NO: 125, SEQ ID NO: 128, and SEQ ID NO: 131
(e.g., all three of said CDRs), or both such light chain and heavy
chain. In still further embodiments, the invention provides a
humanized immunoglobulin, which binds to human CD52, and which
comprises a light chain comprising one or more CDRs selected from
the group consisting of SEQ ID NO: 117, SEQ ID NO: 120, and SEQ ID
NO: 123 (e.g., all three of said CDRs), or a heavy chain comprising
one or more CDRs selected from the group consisting of SEQ ID NO:
126, SEQ ID NO: 129, and SEQ ID NO: 132 (e.g., all three of said
CDRs), or both such light chain and such heavy chains.
[0019] In certain embodiments, the humanized immunoglobulin
comprises a light chain comprising the CDRs of SEQ ID NO: 115, SEQ
ID NO: 118 and SEQ ID NO: 121 and a heavy chain comprising the CDRs
of SEQ ID NO: 124, SEQ ID NO: 127 and SEQ ID NO: 130. In other
embodiments, the humanized immunoglobulin comprises a light chain
comprising the CDRs of SEQ ID NO: 116, SEQ ID NO: 119 and SEQ ID
NO: 122 and a heavy chain comprising the CDRs of SEQ ID NO: 125,
SEQ ID NO: 128 and SEQ ID NO: 131. In other embodiments, the
humanized immunoglobulin comprises a light chain comprising the
CDRs of SEQ ID NO: 117, SEQ ID NO: 120 and SEQ ID NO: 123 and a
heavy chain comprising the CDRs of SEQ ID NO: 126, SEQ ID NO: 129
and SEQ ID NO: 132.
[0020] The humanized immunoglobulins of the present invention are
different from the humanized immunoglobulin Campath.RTM..
[0021] The amino acid sequences of the above-mentioned SEQ ID NOs:
115-132 are provided below, and are based on the amino acid
sequences that are reported in Tables 1-6 as provided elsewhere
herein. In these amino acid sequences, "X" stands for any amino
acid, and the symbol "/" indicates that either (or any) of the
amino acids depicted adjacent that symbol may be present at the
indicated position (e.g., K/R indicates that a lysine or arginine
residue is present at the indicated position and F/L/V indicates
that a phenylalanine, leucine or valine residue is present at the
indicated position).
TABLE-US-00001 Light Chain CDR-1 Sequences (SEQ ID NO: 115)
K/RSSQSLL/V/IXS/TN/DGXS/TYLX (SEQ ID NO: 116)
K/RSSQSLL/V/IHS/TNGXS/TYLH (SEQ ID NO: 117) RSSQSLVHTNGNS/TYLH
Light Chain CDR-2 Sequences (SEQ ID NO: 118) XVSXXXS (SEQ ID NO:
119) XVSXRXS (SEQ ID NO: 120) MVSXRFS Light Chain CDR-3 Sequences
(SEQ ID NO: 121) XQXXH/R/KF/L/V/IXX (SEQ ID NO: 122)
SQSXH/R/KF/L/V/IPX (SEQ ID NO: 123) SQSXHVPF/P Heavy Chain CDR-1
Sequences (SEQ ID NO: 124) GFXFXXYW/YMX (SEQ ID NO: 125)
GFTFXXYW/YMX (SEQ ID NO: 126) GFTFTDYW/YMS Heavy Chain CDR-2
Sequences (SEQ ID NO: 127) XIRXKXBXYXTXYXXSVKG (SEQ ID NO: 128)
XIRXKXNXYTTEYXXSVKG (SEQ ID NO: 129) FIRNKANGYTTEYXXSVKG Heavy
Chain CDR-3 Sequences (SEQ ID NO: 130) TXXXY/F/W (SEQ ID NO: 131)
TRYXY/F/WFDY (SEQ ID NO: 132) TRYIF/WFDY
[0022] The invention also relates to a humanized light chain
comprising one or more CDRs selected from the group consisting of
SEQ ID NO: 115, SEQ ID NO: 118, and SEQ ID NO: 121 (e.g., all three
of said CDRs); a humanized light chain comprising one or more CDRs
selected from the group consisting of SEQ ID NO: 116, SEQ ID NO:
119, and SEQ ID NO: 122 (e.g., all three of said CDRs); or a
humanized light chain comprising one or more CDRs selected from the
group consisting of SEQ ID NO: 117, SEQ ID NO: 120, and SEQ ID NO:
123 (e.g., all three of said CDRs).
[0023] The invention also relates to a humanized heavy chain
comprising one or more CDRs selected from the group consisting of
SEQ ID NO: 124, SEQ ID NO: 127, and SEQ ID NO: 130 (e.g., all three
of said CDRs); a humanized heavy chain comprising one or more CDRs
selected from the group consisting of SEQ ID NO: 125, SEQ ID NO:
128, and SEQ ID NO: 131 (e.g., all three of said CDRs); or a
humanized heavy chain comprising one or more CDRs selected from the
group consisting of SEQ ID NO: 126, SEQ ID NO: 129, and SEQ ID NO:
132 (e.g., all three of said CDRs).
[0024] The humanized light chains and humanized heavy chains of the
present invention are different from the humanized light chain and
the humanized heavy chains of the humanized immunoglobulin
Campath.RTM..
[0025] In some embodiments of the present invention, the humanized
immunoglobulins of the invention (irrespective of the manner in
which they might otherwise be defined, e.g., regardless of whether
they might also be defined in terms of the sequence of one or more
of their CDRs and/or by their cross-reactivity with a mouse
monoclonal antibody or another humanized immunoglobulin): (1)
exhibit binding to glycosylated and de-glycosylated CD52 with no
apparent preference; (2) exhibit binding specific for glycosylated
CD52; (3) exhibit binding specific for de-glycosylated CD52; or (4)
exhibit binding preferential for de-glycosylated over glycosylated
CD52. In certain embodiments, the humanized immunoglobulins of the
invention have a greater binding affinity for glycosylated human
CD52 than for non-glycosylated or de-glycosylated human CD52.
Indeed, in certain embodiments of the present invention, the
humanized immunoglobulins of the present invention exhibit binding
that is specific for glycosylated human CD52. Binding affinity for
non-glycosylated or de-glycosylated human CD52 may be determined
with the use of mature human CD52 that has been de-glycosylated
using a glycosidase, e.g., using the endoglycosidase PNGase-F. In
certain embodiments of the present invention, the humanized
immunoglobulins of the invention bind to an epitope on mature human
CD52 which comprises its N-linked carbohydrate moiety. This
carbohydrate moiety is a sialylted, polylactosamine-containing
core-fucosylated tetraantennary N-linked oligosaccharide (Treumann,
A. et al., (1995) J. Biol. Chem. 270:6088-6099). This epitope may
also comprise at least residue 1 of the mature human CD52 sequence,
at least residue 3 of the mature human CD52 sequence, at least
residues 1, 3, 4 and 5 of the mature human CD52 sequence, or at
least residues 1, 2, 3, 4 and 5 of the mature human CD52 sequence.
In some embodiments, the mouse or chimeric antibodies of the
present invention may have any of these binding features.
[0026] Isolated nucleic acid molecules that encode a humanized
immunoglobulin, humanized light chain or humanized heavy chain of
the invention, as defined elsewhere herein, are also provided. In
some embodiments, the invention is an (one or more) isolated
nucleic acid molecule encoding a humanized heavy chain and a
humanized light chain which associate together to form a humanized
immunoglobulin that has binding specificity for human CD52, wherein
the humanized light chain comprises one or more CDRs (e.g., all
three CDRs) of SEQ ID NO: 3 and a heavy chain comprising one or
more CDRs (e.g., all three CDRs) of SEQ ID NO: 16; a light chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 4
and a heavy chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 17; a light chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 5 and a heavy chain comprising
one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 18; a light
chain comprising one or more CDRs (e.g., all three CDRs) of SEQ ID
NO: 6 and a heavy chain comprising one or more CDRs (e.g., all
three CDRs) of SEQ ID NO: 19; a light chain comprising one or more
CDRs (e.g., all three CDRs) of SEQ ID NO: 7 and a heavy chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO:
20; a light chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 8 and a heavy chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 21; a light chain comprising
one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 9 and a heavy
chain comprising one or more CDRs (e.g., all three CDRs) of SEQ ID
NO: 22; a light chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 10 and a heavy chain comprising one or more
CDRs (e.g., all three CDRs) of SEQ ID NO: 23; a light chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 11
and a heavy chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 24; a light chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 12 and a heavy chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO:
25; a light chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 12 and a heavy chain comprising one or more
CDRs (e.g., all three CDRs) of SEQ ID NO: 137; or a light chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 13
and a heavy chain sequence comprising one or more CDRs (e.g., all
three CDRs) of SEQ ID NO: 26.
[0027] In some embodiments, the invention is one or more isolated
nucleic acid molecules encoding a humanized heavy chain and a
humanized light chain which associate together to form a humanized
immunoglobulin that has binding specificity for human CD52, wherein
the humanized immunoglobulin binds to the same epitope on human
CD52 as a mouse monoclonal antibody comprising a light chain
variable region of SEQ ID NO: 3 and a heavy chain variable region
of SEQ ID NO: 16; a light chain variable region of SEQ ID NO: 4 and
a heavy chain variable region of SEQ ID NO: 17; a light chain
variable region of SEQ ID NO: 5 and a heavy chain variable region
of SEQ ID NO: 18; a light chain variable region of SEQ ID NO: 6 and
a heavy chain variable region of SEQ ID NO: 19; a light chain
variable region of SEQ ID NO: 7 and a heavy chain variable region
of SEQ ID NO: 20; a light chain variable region of SEQ ID NO: 8 and
a heavy chain variable region of SEQ ID NO: 21; a light chain
variable region of SEQ ID NO: 9 and a heavy chain variable region
of SEQ ID NO: 22; a light chain variable region of SEQ ID NO: 10
and a heavy chain variable region of SEQ ID NO: 23; a light chain
variable region of SEQ ID NO: 11 and a heavy chain variable region
of SEQ ID NO: 24; a light chain variable region of SEQ ID NO: 12
and a heavy chain variable region of SEQ ID NO: 25; or a light
chain variable region of SEQ ID NO: 13 and a heavy chain variable
region of SEQ ID NO: 26. In other embodiments, the invention is one
or more isolated nucleic acid molecules encoding a humanized heavy
chain and a humanized light chain which associate together to form
a humanized immunoglobulin that has binding specificity for human
CD52, wherein the humanized immunoglobulin binds to an epitope on
human CD52 which overlaps with the epitope to which such a mouse
monoclonal antibody binds.
[0028] In other embodiments, the invention is one or more isolated
nucleic acid molecules encoding a humanized heavy chain and a
humanized light chain which associate together to form a humanized
immunoglobulin that has binding specificity for human CD52, wherein
the humanized immunoglobulin binds to an epitope comprising at
least residue 1 of mature human CD52; the humanized immunoglobulin
binds to an epitope comprising at least residues 1, 3, 4 and 5 of
mature human CD52; the humanized immunoglobulin binds to an epitope
comprising at least residues 1, 2, 3, 4 and 5 of mature human CD52;
or the humanized immunoglobulin binds to an epitope comprising at
least residues 7, 8 and 9 of mature human CD52. In some
embodiments, the epitope comprises at least residues 7, 8 and 11 of
the mature human CD52 sequence. In some embodiments, the epitope
comprises at least residues 4 and 11 of the mature human CD52
sequence.
[0029] In other embodiments, the invention is one or more isolated
nucleic acid molecules encoding a humanized heavy chain and a
humanized light chain which associate together to form a humanized
immunoglobulin that has binding specificity for human CD52, wherein
the humanized immunoglobulin comprises a light chain comprising one
or more CDRs selected from the group consisting of SEQ ID NO: 115,
SEQ ID NO: 118, and SEQ ID NO: 121 (e.g., all three of said CDRs),
and/or a heavy chain comprising one or more CDRs selected from the
group consisting of SEQ ID NO: 124, SEQ ID NO: 127, and SEQ ID NO:
130 (e.g., all three of said CDRs); a light chain comprising one or
more CDRs selected from the group consisting of SEQ ID NO: 116, SEQ
ID NO: 119, and SEQ ID NO: 122 (e.g., all three of said CDRs),
and/or a heavy chain comprising one or more CDRs selected from the
group consisting of SEQ ID NO: 125, SEQ ID NO: 128, and SEQ ID NO:
131 (e.g., all three of said CDRs); or a light chain comprising one
or more CDRs selected from the group consisting of SEQ ID NO: 117,
SEQ ID NO: 120, and SEQ ID NO: 123 (e.g., all three of said CDRs),
and/or a heavy chain comprising one or more CDRs selected from the
group consisting of SEQ ID NO: 126, SEQ ID NO: 129, and SEQ ID NO:
132 (e.g., all three of said CDRs).
[0030] In certain embodiments, the invention is one or more
isolated nucleic acid molecules encoding a humanized heavy chain
and a humanized light chain which associate together to form a
humanized immunoglobulin that has binding specificity for human
CD52, wherein the humanized immunoglobulin comprises a light chain
comprising the CDRs of SEQ ID NO: 115, SEQ ID NO: 118 and SEQ ID
NO: 121 and a heavy chain comprising the CDRs of SEQ ID NO: 124,
SEQ ID NO: 127 and SEQ ID NO: 130; a light chain comprising the
CDRs of SEQ ID NO: 116, SEQ ID NO: 119 and SEQ ID NO: 122 and a
heavy chain comprising the CDRs of SEQ ID NO: 125, SEQ ID NO: 128
and SEQ ID NO: 131; or a light chain comprising the CDRs of SEQ ID
NO: 117, SEQ ID NO: 120 and SEQ ID NO: 123 and a heavy chain
comprising the CDRs of SEQ ID NO: 126, SEQ ID NO: 129 and SEQ ID
NO: 132.
[0031] The one or more nucleic acids of the invention do not encode
the humanized immunoglobulin Campath.RTM..
[0032] In other embodiments, the invention is one or more isolated
nucleic acid molecules encoding a humanized heavy chain and a
humanized light chain which associate together to form a humanized
immunoglobulin that has binding specificity for human CD52, wherein
the humanized immunoglobulin has a greater binding affinity for
glycosylated human CD52 than for non-glycosylated or
de-glycosylated human CD52, e.g., exhibits binding that is specific
for glycosylated human CD52. The humanized immunoglobulin may bind
to an epitope on mature human CD52 which comprises its N-linked
carbohydrate moiety. This epitope may also comprise at least
residue 1 of the mature human CD52 sequence, at least residue 3 of
the mature human CD52 sequence, at least residues 1, 3, 4 and 5 of
the mature human CD52 sequence, or at least residues 1, 2, 3, 4 and
5 of the mature human CD52 sequence.
[0033] In other embodiments, the invention is an isolated nucleic
acid molecule encoding a humanized light chain comprising one or
more CDRs (e.g., all three CDRs) of SEQ ID NO: 3, SEQ ID NO: 4, SEQ
ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9,
SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13,
wherein the humanized light chain is not the humanized light chain
of Campath.RTM..
[0034] In other embodiments, the invention is an isolated nucleic
acid molecule encoding a humanized heavy chain comprising one or
more CDRs (e.g., all three CDRs) of SEQ ID NO: 16, SEQ ID NO: 17,
SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID
NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26,
or SEQ ID NO: 137, wherein the humanized heavy chain is not the
humanized heavy chain of Campath.RTM..
[0035] In other embodiments, the invention is an isolated nucleic
acid molecule encoding a humanized light chain comprising one or
more CDRs selected from the group consisting of SEQ ID NO: 27, SEQ
ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO:
32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ
ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO:
41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ
ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48, or a combination
thereof, wherein the humanized light chain is not the humanized
light chain of Campath.RTM..
[0036] In other embodiments, the invention is an isolated nucleic
acid molecule encoding a humanized heavy chain comprising one or
more CDRs selected from the group consisting of SEQ ID NO: 49, SEQ
ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO:
54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ
ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO:
63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ
ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO:
72, SEQ ID NO: 73, SEQ ID NO: 74, and SEQ ID NO: 294, or a
combination thereof, wherein the humanized heavy chain is not the
humanized heavy chain of Campath.RTM..
[0037] In other embodiments, the invention is an isolated nucleic
acid molecule encoding a humanized light chain comprising one or
more CDRs selected from the group consisting of SEQ ID NO: 115, SEQ
ID NO: 118, and SEQ ID NO: 121 (e.g., all three of said CDRs); a
humanized light chain comprising one or more CDRs selected from the
group consisting of SEQ ID NO: 116, SEQ ID NO: 119, and SEQ ID NO:
122 (e.g., all three of said CDRs); or a humanized light chain
comprising one or more CDRs selected from the group consisting of
SEQ ID NO: 117, SEQ ID NO: 120, and SEQ ID NO: 123 (e.g., all three
of said CDRs).
[0038] In other embodiments, the invention is an isolated nucleic
acid molecule encoding a humanized heavy chain comprising one or
more CDRs selected from the group consisting of SEQ ID NO: 124, SEQ
ID NO: 127, and SEQ ID NO: 130 (e.g., all three of said CDRs); a
humanized heavy chain comprising one or more CDRs selected from the
group consisting of SEQ ID NO: 125, SEQ ID NO: 128, and SEQ ID NO:
131 (e.g., all three of said CDRs); or a humanized heavy chain
comprising one or more CDRs selected from the group consisting of
SEQ ID NO: 126, SEQ ID NO: 129, and SEQ ID NO: 132 (e.g., all three
of said CDRs).
[0039] The invention also relates to recombinant vectors (e.g.,
expression vectors, including mammalian cell expression vectors)
that comprise a nucleic acid encoding a humanized immunoglobulin
(e.g., a humanized light chain and a humanized heavy chain), a
humanized light chain, or a humanized heavy chain of the invention.
In some embodiments, the invention is a recombinant vector
comprising a nucleic acid encoding a humanized immunoglobulin that
comprises a light chain comprising one or more CDRs (e.g., all
three CDRs) of SEQ ID NO: 3 and a heavy chain comprising one or
more CDRs (e.g., all three CDRs) of SEQ ID NO: 16; a light chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 4
and a heavy chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 17; a light chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 5 and a heavy chain comprising
one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 18; a light
chain comprising one or more CDRs (e.g., all three CDRs) of SEQ ID
NO: 6 and a heavy chain comprising one or more CDRs (e.g., all
three CDRs) of SEQ ID NO: 19; a light chain comprising one or more
CDRs (e.g., all three CDRs) of SEQ ID NO: 7 and a heavy chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO:
20; a light chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 8 and a heavy chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 21; a light chain comprising
one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 9 and a heavy
chain comprising one or more CDRs (e.g., all three CDRs) of SEQ ID
NO: 22; a light chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 10 and a heavy chain comprising one or more
CDRs (e.g., all three CDRs) of SEQ ID NO: 23; a light chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 11
and a heavy chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 24; a light chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 12 and a heavy chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO:
25; a light chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 12 and a heavy chain comprising one or more
CDRs (e.g., all three CDRs) of SEQ ID NO: 137; or a light chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 13
and a heavy chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 26.
[0040] In other embodiments, the recombinant vector comprises a
nucleic acid encoding a humanized light chain, wherein the
humanized light chain comprises one or more CDRs selected from the
group consisting of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29,
SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID
NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38,
SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID
NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47,
and SEQ ID NO: 48, or a combination thereof, wherein the humanized
light chain is not the humanized light chain of Campath.RTM..
[0041] In other embodiments, the recombinant vector comprises a
nucleic acid encoding a humanized heavy chain, wherein the
humanized heavy chain comprises one or more CDRs selected from the
group consisting of SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51,
SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID
NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60,
SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID
NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69,
SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID
NO: 74, and SEQ ID NO: 294, or a combination thereof, wherein the
humanized light chain is not the humanized light chain of
Campath.RTM..
[0042] In some embodiments, the invention provides a recombinant
vector comprising a nucleic acid molecule, or a pair of recombinant
vectors comprising nucleic acid molecules, encoding a humanized
heavy chain and a humanized light chain which associate together to
form a humanized immunoglobulin that has binding specificity for
human CD52, wherein the humanized immunoglobulin binds to the same
epitope on human CD52 as a mouse monoclonal antibody comprising a
light chain variable region of SEQ ID NO: 3 and a heavy chain
variable region of SEQ ID NO: 16; a light chain variable region of
SEQ ID NO: 4 and a heavy chain variable region of SEQ ID NO: 17; a
light chain variable region of SEQ ID NO: 5 and a heavy chain
variable region of SEQ ID NO: 18; a light chain variable region of
SEQ ID NO: 6 and a heavy chain variable region of SEQ ID NO: 19; a
light chain variable region of SEQ ID NO: 7 and a heavy chain
variable region of SEQ ID NO: 20; a light chain variable region of
SEQ ID NO: 8 and a heavy chain variable region of SEQ ID NO: 21; a
light chain variable region of SEQ ID NO: 9 and a heavy chain
variable region of SEQ ID NO: 22; a light chain variable region of
SEQ ID NO: 10 and a heavy chain variable region of SEQ ID NO: 23; a
light chain variable region of SEQ ID NO: 11 and a heavy chain
variable region of SEQ ID NO: 24; a light chain variable region of
SEQ ID NO: 12 and a heavy chain variable region of SEQ ID NO: 25;
or a light chain variable region of SEQ ID NO: 13 and a heavy chain
variable region of SEQ ID NO: 26. In other embodiments, the
invention provides a recombinant vector comprising a nucleic acid
molecule, or a pair of recombinant vectors comprising nucleic acid
molecules, encoding a humanized heavy chain and a humanized light
chain which associate together to form a humanized immunoglobulin
that has binding specificity for human CD52, wherein the humanized
immunoglobulin binds to an epitope on human CD52 which overlaps
with the epitope to which such a mouse monoclonal antibody
binds.
[0043] In other embodiments, the recombinant vector comprises a
nucleic acid molecule, or a pair of recombinant vectors comprise
nucleic acid molecules, encoding a humanized heavy chain and a
humanized light chain which associate together to form a humanized
immunoglobulin that has binding specificity for human CD52, wherein
the humanized immunoglobulin binds to an epitope comprising at
least residue 1 of mature human CD52; binds to an epitope
comprising at least residues 1, 3, 4 and 5 of mature human CD52;
binds to an epitope comprising at least residues 1, 2, 3, 4 and 5
of mature human CD52; or binds to an epitope comprising at least
residues 7, 8 and 9 of mature human CD52. In some embodiments, the
epitope comprises at least residues 7, 8 and 11 of the mature human
CD52 sequence. In some embodiments, the epitope comprises at least
residues 4 and 11 of the mature human CD52 sequence.
[0044] In some embodiments, the recombinant vector comprises a
nucleic acid molecule, or a pair of recombinant vectors comprise
nucleic acid molecules, encoding a humanized heavy chain and a
humanized light chain which associate together to form a humanized
immunoglobulin that has binding specificity for human CD52, wherein
the humanized immunoglobulin comprises a light chain comprising one
or more CDRs selected from the group consisting of SEQ ID NO: 115,
SEQ ID NO: 118, and SEQ ID NO: 121 (e.g., all three of said CDRs),
and/or a heavy chain comprising one or more CDRs selected from the
group consisting of SEQ ID NO: 124, SEQ ID NO: 127, and SEQ ID NO:
130 (e.g., all three of said CDRs); a light chain comprising one or
more CDRs selected from the group consisting of SEQ ID NO: 116, SEQ
ID NO: 119, and SEQ ID NO: 122 (e.g., all three of said CDRs),
and/or a heavy chain comprising one or more CDRs selected from the
group consisting of SEQ ID NO: 125, SEQ ID NO: 128, and SEQ ID NO:
131 (e.g., all three of said CDRs); or a light chain comprising one
or more CDRs selected from the group consisting of SEQ ID NO: 117,
SEQ ID NO: 120, and SEQ ID NO: 123 (e.g., all three of said CDRs),
and/or a heavy chain comprising one or more CDRs selected from the
group consisting of SEQ ID NO: 126, SEQ ID NO: 129, and SEQ ID NO:
132 (e.g., all three of said CDRs).
[0045] In certain embodiments, the recombinant vector comprises a
nucleic acid molecule, or a pair of recombinant vectors comprise
nucleic acid molecules, encoding a humanized heavy chain and a
humanized light chain which associate together to form a humanized
immunoglobulin that has binding specificity for human CD52, wherein
the humanized immunoglobulin comprises a light chain comprising the
CDRs of SEQ ID NO: 115, SEQ ID NO: 118 and SEQ ID NO: 121 and a
heavy chain comprising the CDRs of SEQ ID NO: 124, SEQ ID NO: 127
and SEQ ID NO: 130; a light chain comprising the CDRs of SEQ ID NO:
116, SEQ ID NO: 119 and SEQ ID NO: 122 and a heavy chain comprising
the CDRs of SEQ ID NO: 125, SEQ ID NO: 128 and SEQ ID NO: 131; or a
light chain comprising the CDRs of SEQ ID NO: 117, SEQ ID NO: 120
and SEQ ID NO: 123 and a heavy chain comprising the CDRs of SEQ ID
NO: 126, SEQ ID NO: 129 and SEQ ID NO: 132.
[0046] The one or more nucleic acids in the recombinant vector or
vectors of the present invention do not encode the humanized
immunoglobulin Campath.RTM..
[0047] In other embodiments, the recombinant vector comprises a
nucleic acid molecule, or a pair of recombinant vectors comprise
nucleic acid molecules, encoding a humanized heavy chain and a
humanized light chain which associate together to form a humanized
immunoglobulin that has binding specificity for human CD52, wherein
the humanized immunoglobulin has a greater binding affinity for
glycosylated human CD52 than for non-glycosylated or
de-glycosylated human CD52, e.g., exhibits binding that is specific
for glycosylated human CD52. The humanized immunoglobulin may bind
to an epitope on mature human CD52 which comprises its N-linked
carbohydrate moiety. This epitope may also comprise at least
residue 1 of the mature human CD52 sequence, at least residue 3 of
the mature human CD52 sequence, at least residues 1, 3, 4 and 5 of
the mature human CD52 sequence, or at least residues 1, 2, 3, 4 and
5 of the mature human CD52 sequence.
[0048] In other embodiments, the recombinant vector comprises a
nucleic acid molecule encoding a humanized light chain comprising
one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 3, SEQ ID NO:
4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID
NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO:
13, wherein the humanized light chain is not the humanized light
chain of Campath.RTM..
[0049] In other embodiments, the recombinant vector comprises a
nucleic acid molecule encoding a humanized heavy chain comprising
one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 16, SEQ ID
NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21,
SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID
NO: 26, or SEQ ID NO: 137, wherein the humanized heavy chain is not
the humanized heavy chain of Campath.RTM..
[0050] In other embodiments, the recombinant vector comprises a
nucleic acid molecule encoding a humanized light chain comprising
one or more CDRs selected from the group consisting of SEQ ID NO:
115, SEQ ID NO: 118, and SEQ ID NO: 121 (e.g., all three of said
CDRs); a humanized light chain comprising one or more CDRs selected
from the group consisting of SEQ ID NO: 116, SEQ ID NO: 119, and
SEQ ID NO: 122 (e.g., all three of said CDRs); or a humanized light
chain comprising one or more CDRs selected from the group
consisting of SEQ ID NO: 117, SEQ ID NO: 120, and SEQ ID NO: 123
(e.g., all three of said CDRs), wherein the humanized light chain
is not the humanized light chain of Campath.RTM..
[0051] In other embodiments, the recombinant vector comprises a
nucleic acid molecule encoding a humanized heavy chain comprising
one or more CDRs selected from the group consisting of SEQ ID NO:
124, SEQ ID NO: 127, and SEQ ID NO: 130 (e.g., all three of said
CDRs); a humanized heavy chain comprising one or more CDRs selected
from the group consisting of SEQ ID NO: 125, SEQ ID NO: 128, and
SEQ ID NO: 131 (e.g., all three of said CDRs); or a humanized heavy
chain comprising one or more CDRs selected from the group
consisting of SEQ ID NO: 126, SEQ ID NO: 129, and SEQ ID NO: 132
(e.g., all three of said CDRs), wherein the humanized heavy chain
is not the humanized heavy chain of Campath.RTM..
[0052] In particular embodiments, the recombinant vector of the
invention is an expression vector, such as a mammalian cell
expression vector. In certain embodiments, the vector is a plasmid
or a viral vector (e.g., an adenoviral or AAV vector).
[0053] The invention also relates to a host cell that comprises a
(one or more) nucleic acid (e.g., recombinant) encoding a humanized
immunoglobulin (humanized light chain and humanized heavy chain), a
humanized light chain or a humanized heavy chain of the invention.
In some embodiments, the host cell comprises a recombinant vector
(e.g., expression vector, including mammalian cell expression
vectors) of the invention.
[0054] In a particular embodiment, the host cell comprises a
nucleic acid (one or more nucleic acids) encoding a humanized light
chain and a humanized heavy chain, wherein the humanized light
chain and the humanized heavy chain associate together to form a
humanized immunoglobulin that has binding specificity for human
CD52 and wherein the humanized immunoglobulin comprises a light
chain comprising one or more CDRs (e.g., all three CDRs) of SEQ ID
NO: 3 and a heavy chain comprising one or more CDRs (e.g., all
three CDRs) of SEQ ID NO: 16; a light chain comprising one or more
CDRs (e.g., all three CDRs) of SEQ ID NO: 4 and a heavy chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO:
17; a light chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 5 and a heavy chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 18; a light chain comprising
one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 6 and a heavy
chain comprising one or more CDRs (e.g., all three CDRs) of SEQ ID
NO: 19; a light chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 7 and a heavy chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 20; a light chain comprising
one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 8 and a heavy
chain comprising one or more CDRs (e.g., all three CDRs) of SEQ ID
NO: 21; a light chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 9 and a heavy chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 22; a light chain comprising
one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 10 and a
heavy chain comprising one or more CDRs (e.g., all three CDRs) of
SEQ ID NO: 23; a light chain comprising one or more CDRs (e.g., all
three CDRs) of SEQ ID NO: 11 and a heavy chain comprising one or
more CDRs (e.g., all three CDRs) of SEQ ID NO: 24; a light chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 12
and a heavy chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 25; a light chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 12 and a heavy chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO:
137; or a light chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 13 and a heavy chain sequence comprising one or
more CDRs (e.g., all three CDRs) of SEQ ID NO: 26.
[0055] In some embodiments, the host cell comprises one or more
nucleic acid molecules encoding a humanized heavy chain and a
humanized light chain which associate together to form a humanized
immunoglobulin that has binding specificity for human CD52, wherein
the humanized immunoglobulin binds to the same epitope on human
CD52 as a mouse monoclonal antibody comprising a light chain
variable region of SEQ ID NO: 3 and a heavy chain variable region
of SEQ ID NO: 16; a light chain variable region of SEQ ID NO: 4 and
a heavy chain variable region of SEQ ID NO: 17; a light chain
variable region of SEQ ID NO: 5 and a heavy chain variable region
of SEQ ID NO: 18; a light chain variable region of SEQ ID NO: 6 and
a heavy chain variable region of SEQ ID NO: 19; a light chain
variable region of SEQ ID NO: 7 and a heavy chain variable region
of SEQ ID NO: 20; a light chain variable region of SEQ ID NO: 8 and
a heavy chain variable region of SEQ ID NO: 21; a light chain
variable region of SEQ ID NO: 9 and a heavy chain variable region
of SEQ ID NO: 22; a light chain variable region of SEQ ID NO: 10
and a heavy chain variable region of SEQ ID NO: 23; a light chain
variable region of SEQ ID NO: 11 and a heavy chain variable region
of SEQ ID NO: 24; a light chain variable region of SEQ ID NO: 12
and a heavy chain variable region of SEQ ID NO: 25; or a light
chain variable region of SEQ ID NO: 13 and a heavy chain variable
region of SEQ ID NO: 26. In other embodiments, the host cell
comprises one or more nucleic acid molecules encoding a humanized
heavy chain and a humanized light chain which associate together to
form a humanized immunoglobulin that has binding specificity for
human CD52, wherein the humanized immunoglobulin binds to an
epitope on human CD52 which overlaps with the epitope to which such
a mouse monoclonal antibody binds.
[0056] In other embodiments, the host cell comprises one or more
nucleic acid molecules encoding a humanized heavy chain and a
humanized light chain which associate together to form a humanized
immunoglobulin that has binding specificity for human CD52, wherein
the humanized immunoglobulin binds to an epitope comprising at
least residue 1 of mature human CD52; binds to an epitope
comprising at least residues 1, 3, 4 and 5 of mature human CD52;
binds to an epitope comprising at least residues 1, 2, 3, 4 and 5
of mature human CD52; or binds to an epitope comprising at least
residues 7, 8 and 9 of mature human CD52. In some embodiments, the
epitope comprises at least residues 7, 8 and 11 of the mature human
CD52 sequence. In some embodiments, the epitope comprises at least
residues 4 and 11 of the mature human CD52 sequence.
[0057] In some embodiments, the host cell comprises one or more
nucleic acid molecules encoding a humanized heavy chain and a
humanized light chain which associate together to form a humanized
immunoglobulin that has binding specificity for human CD52, wherein
the humanized immunoglobulin comprises a light chain comprising one
or more CDRs selected from the group consisting of SEQ ID NO: 115,
SEQ ID NO: 118, and SEQ ID NO: 121 (e.g., all three of said CDRs),
and/or a heavy chain comprising one or more CDRs selected from the
group consisting of SEQ ID NO: 124, SEQ ID NO: 127, and SEQ ID NO:
130 (e.g., all three of said CDRs); a light chain comprising one or
more CDRs selected from the group consisting of SEQ ID NO: 116, SEQ
ID NO: 119, and SEQ ID NO: 122 (e.g., all three of said CDRs),
and/or a heavy chain comprising one or more CDRs selected from the
group consisting of SEQ ID NO: 125, SEQ ID NO: 128, and SEQ ID NO:
131 (e.g., all three of said CDRs); or a light chain comprising one
or more CDRs selected from the group consisting of SEQ ID NO: 117,
SEQ ID NO: 120, and SEQ ID NO: 123 (e.g., all three of said CDRs),
and/or a heavy chain comprising one or more CDRs selected from the
group consisting of SEQ ID NO: 126, SEQ ID NO: 129, and SEQ ID NO:
132 (e.g., all three of said CDRs).
[0058] In some embodiments, the host cell comprises one or more
nucleic acid molecules encoding a humanized heavy chain and a
humanized light chain which associate together to form a humanized
immunoglobulin that has binding specificity for human CD52, wherein
the humanized immunoglobulin comprises a light chain comprising the
CDRs of SEQ ID NO: 115, SEQ ID NO: 118 and SEQ ID NO: 121 and a
heavy chain comprising the CDRs of SEQ ID NO: 124, SEQ ID NO: 127
and SEQ ID NO: 130; a light chain comprising the CDRs of SEQ ID NO:
116, SEQ ID NO: 119 and SEQ ID NO: 122 and a heavy chain comprising
the CDRs of SEQ ID NO: 125, SEQ ID NO: 128 and SEQ ID NO: 131; or a
light chain comprising the CDRs of SEQ ID NO: 117, SEQ ID NO: 120
and SEQ ID NO: 123 and a heavy chain comprising the CDRs of SEQ ID
NO: 126, SEQ ID NO: 129 and SEQ ID NO: 132.
[0059] In other embodiments, the host cell comprises one or more
nucleic acid molecules encoding a humanized heavy chain and a
humanized light chain which associate together to form a humanized
immunoglobulin that has binding specificity for human CD52, wherein
the humanized immunoglobulin has a greater binding affinity for
glycosylated human CD52 than for non-glycosylated or
de-glycosylated human CD52, e.g., exhibits binding that is specific
for glycosylated human CD52. The humanized immunoglobulin may bind
to an epitope on mature human CD52 which comprises its N-linked
carbohydrate moiety. This epitope may also comprise at least
residue 1 of the mature human CD52 sequence, at least residue 3 of
the mature human CD52 sequence, at least residues 1, 3, 4 and 5 of
the mature human CD52 sequence, or at least residues 1, 2, 3, 4 and
5 of the mature human CD52 sequence.
[0060] In some embodiments, the host cell comprises a nucleic acid
molecule encoding a humanized light chain comprising one or more
CDRs (e.g., all three CDRs) of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID
NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ
ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13. The
humanized light chain is not the humanized light chain of
Campath.RTM..
[0061] In other embodiments, the host cell comprises a nucleic acid
molecule encoding a humanized heavy chain comprising one or more
CDRs (e.g., all three CDRs) of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID
NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22,
SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ
ID NO: 137. The humanized heavy chain is not the humanized heavy
chain of Campath.RTM..
[0062] In some embodiments, the host cell comprises a nucleic acid
encoding a humanized light chain, wherein the humanized light chain
comprises one or more CDRs selected from the group consisting of
SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID
NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35,
SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID
NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44,
SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48 or a
combination thereof, wherein the humanized light chain is not the
humanized light chain of Campath.RTM..
[0063] In other embodiments, the host cell comprises a nucleic acid
encoding a humanized heavy chain, wherein the humanized heavy chain
comprises one or more CDRs selected from the group consisting of
SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID
NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57,
SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID
NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66,
SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID
NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, and SEQ ID NO:
294, or a combination thereof, wherein the humanized heavy chain is
not the humanized heavy chain of Campath.RTM..
[0064] The invention also relates to a method of preparing a
humanized immunoglobulin that has binding specificity for human
CD52 comprising maintaining a host cell of the invention (e.g., a
host cell that contains one or more recombinant nucleic acids that
encode a humanized immunoglobulin of the invention (e.g., a
humanized light chain and a humanized heavy chain of the
invention)) under conditions appropriate for expression of a
humanized immunoglobulin, whereby humanized immunoglobulin chains
are expressed and a humanized immunoglobulin is produced. In some
embodiments, the method further comprises purifying or isolating
the humanized immunoglobulin. In some embodiments, the method
further comprises combining the purified or isolated humanized
immunoglobulin with a physiologically acceptable vehicle or carrier
to produce a pharmaceutical composition.
[0065] The invention also relates to a method of preparing a
humanized light chain that has binding specificity for human CD52
comprising maintaining a host cell of the invention (e.g., a host
cell that contains one or more recombinant nucleic acids that
encode a humanized light chain of the invention) under conditions
appropriate for expression of a humanized light chain, whereby a
humanized light chain is expressed and a humanized light chain is
produced. In some embodiments, the method further comprises
purifying or isolating the humanized light chain.
[0066] The invention also relates to a method of preparing a
humanized heavy chain that has binding specificity for human CD52
comprising maintaining a host cell of the invention (e.g., a host
cell that contains one or more recombinant nucleic acids that
encode a humanized heavy chain of the invention) under conditions
appropriate for expression of a humanized heavy chain, whereby a
humanized heavy chain is expressed and a humanized heavy chain is
produced. In some embodiments, the method further comprises
purifying or isolating the humanized heavy chain.
[0067] The invention further relates to a pharmaceutical
composition comprising a humanized immunoglobulin of the invention
(e.g., comprising a humanized light chain of the invention and/or a
humanized heavy chain of the invention) and a physiologically
acceptable vehicle or carrier. In some embodiments, the
pharmaceutical composition comprises a unit dose composition.
[0068] The invention also relates to a method of producing a
hybridoma that secretes a monoclonal antibody that has binding
specificity for human CD52 comprising administering lymphocytes of
a mouse transgenic for human CD52 to a non-transgenic mouse of the
same, or of a similar, strain (e.g., CD1) as the human CD52
transgenic mouse, thereby producing an immunized, non-transgenic
mouse. Splenocytes of the immunized, non-transgenic mouse are fused
with immortalized cells, thereby producing a hybridoma. The
hybridoma is maintained under conditions in which it will secrete a
monoclonal antibody having binding specificity for human CD52. In
some embodiments, FACS analysis is used to detect a hybridoma that
secretes a monoclonal antibody that has binding specificity for
human CD52. In other embodiments, the strain of the transgenic
mouse and the strain of the non-transgenic mouse are identical. In
certain embodiments, the CD52 is wildtype human CD52. In some
embodiments, the CD52 transgenic mouse and the non-transgenic mouse
are CD1 mice. In some embodiments, the lymphocytes used for
immunization are obtained from the spleen of the human CD52
transgenic mouse. In some embodiments, the immortalized cells are
selected from the group consisting of SP2/0 Ag14 cells and NS1
myeloma cells. The invention also relates to a hybridoma produced
by the methods of the invention. Optionally, the monoclonal
antibody secreted by the hybridoma is collected and can be further
purified (e.g., substantially purified, isolated). In other
embodiments, the method further comprises determining the
nucleotide sequence of the monoclonal antibody secreted by the
hybridoma.
[0069] The invention also relates to a method for treating an
autoimmune disease (e.g., multiple sclerosis (MS), rheumatoid
arthritis (RA) (See e.g., Nature Reviews Drug Discovery 6: 75-92
(2007)), vasculitis (See e.g., Rheumatology 39:229-237 (2000)),
Behcet's disease (BD) (See e.g., Rheumatology 42:1539-1544 (2003)),
lupus and celiac disease (Vivas, S., et al., N. Engl. J. Med.,
354(23):2514-2515 (2006)), vasculitis, psoriasis, myositis,
scleroderma, aplastic anemia, and colitis) in a patient in need
thereof, comprising administering to the patient an effective
amount of a humanized immunoglobulin of the invention.
[0070] In another aspect, an effective amount of a humanized
immunoglobulin of the invention can be administered in conjunction
with one or more immunosuppressive agents to prepare a patient in
need thereof for a solid organ transplant (Agarwal et al.,
Transplant Immunol., 20:6-11 (2008)) or a CD34+ stem cell
transplant (Burt et al., The Lancet, published online Jan. 30,
2009).
[0071] The invention also relates to a method for treating cancer
in a patient in need thereof, comprising administering to the
patient an effective amount of a humanized immunoglobulin of the
invention.
[0072] The invention also relates to a method for treating multiple
sclerosis in a patient in need thereof, comprising administering to
the patient an effective amount of a humanized immunoglobulin of
the invention.
[0073] The invention also relates to a method for treating chronic
lymphocytic leukemia in a patient in need thereof, comprising
administering to the patient an effective amount of a humanized
immunoglobulin of the invention.
[0074] The administration of a humanized immunoglobulin of the
present invention may comprise the administration of the humanized
immunoglobulin per se (e.g., in a pharmaceutical composition), the
administration of one or more recombinant vectors encoding the
humanized immunoglobulin, or the administration of a host cell
which comprises one or more nucleic acids (e.g., one or more
recombinant vectors) encoding the humanized immunoglobulins and
expresses the humanized immunoglobulin.
[0075] The invention also relates to a method of diagnosing a
disease selected from the group consisting of autoimmune diseases
(e.g., multiple sclerosis, lupus, vasculitis), cancer (e.g.,
leukemias (e.g., chronic lymphocytic leukemia), and lymphomas
(e.g., non-Hodgkin's lymphoma)), transplant (e.g., solid organ
transplant (e.g., kidney transplant) and stem cell transplant),
'comprising assaying a patient sample in vitro with a humanized
immunoglobulin of the invention.
[0076] The invention also relates to a humanized immunoglobulin of
the invention (e.g., comprising a humanized light chain of the
invention and/or humanized heavy chain of the invention), a
recombinant vector of the invention, or a host cell of the
invention, for use in medicine, such as for use in therapy and/or
diagnosis of a disease such as for use in treating a disease or
disorder described herein such as an autoimmune disease (e.g.,
multiple sclerosis, rheumatoid arthritis, and lupus), cancer, a
lymphocyte hyper-proliferative condition (e.g., T or B cell
malignancies including leukemia such as B-cell chronic lymphocytic
leukemia and lymphomas such as non-Hodgkin's lymphoma). See, e.g.,
Lundin, J., et al., Blood, 101:4267-4272 (2003); Rodig, S J., et
al., Clinical Cancer Research, 12(23):7174-7179 (2006). The
invention also relates to the use of a humanized immunoglobulin,
humanized light chain or humanized heavy chain of the invention, a
recombinant vector of the invention, or a host cell of the
invention, for the manufacture of a medicament for treating a
disease or disorder described herein (e.g., autoimmune diseases
(e.g., multiple sclerosis, lupus, vasculitis), cancer (e.g.,
leukemias (e.g., chronic lymphocytic leukemia), and lymphomas
(e.g., non-Hodgkin's lymphoma)), and transplant (e.g., solid organ
transplant (e.g., kidney transplant) and stem cell
transplant)').
[0077] The invention further provides humanized anti-human CD52
antibodies comprising human light chain framework regions that
utilize a human Vk2-A18b gene in which residues 36 (Y) and 46 (L)
(Kabat numbering) have been substituted. In some embodiments,
residue 36 is V or L and residue 46 is R. The invention also
provides humanized anti-human CD52 antibodies comprising human
heavy chain framework regions that utilize a human VH 3-23 gene in
which residue 47 (W) (Kabat numbering) has been substituted. In
some embodiments, residues 47 (W) and 49 (S) (Kabat numbering) both
have been substituted. In some embodiments, residue 47 is L and
residue 49 is S. In other embodiments, residue 47 is L and residue
49 is A.
[0078] In some embodiments, a humanized anti-human CD52 antibody of
the invention has an EC.sub.50 value as determined in a
cell-binding assay such as the assay described in Example 29 that
is two-fold lower than the EC.sub.50 value for Campath-1H.RTM.
antibody. In various embodiments, the humanized anti-human CD52
antibody has an EC.sub.50 value of 11 nM or less.
[0079] In some embodiments, a humanized anti-human CD52 antibody of
the invention binds CD52 on cells in the presence of
anti-Campath-1H.RTM. antibodies from the serum of a human patient
who has been treated with Campath-1H.RTM.. That is, the binding of
a humanized anti-human CD52 antibody of the invention to CD52 on
cells is not reduced in the presence of such anti-Campath-1H.RTM.
antibodies compared to Campath-1H.RTM. binding to CD52 or is less
reduced in the presence of such anti-Campath-1H.RTM. antibodies
compared to Campath-1H.RTM. binding to CD52.
[0080] The invention further provides humanized anti-human CD52
antibodies with a lymphocyte depletion profile in blood and/or
spleen of a humanized anti-human CD52 antibody provided herein.
[0081] In some embodiments, a humanized anti-human CD52 antibody of
the invention increases the circulating level of one or more of
TNFalpha, IL-6 and MCP-1 in the serum of a subject.
[0082] In some embodiments, a humanized anti-human CD52 antibody of
the invention reduces lymphocyte levels in a subject for at least
30 days, at least 50 days, at least 60 days, at least 70 days, at
least 80 days or for more than 80 days.
[0083] In some embodiments, a humanized anti-human CD52 antibody of
the invention delays the onset of disease and/or decreases the
severity of disease as measured by clinical score in a mouse EAE
model.
[0084] In some embodiments, a humanized anti-human CD52 antibody of
the invention is less immunogenic than Campath-1H.RTM. in an
immunogenicity assay such as the assay described in Example 69 or
70.
Mouse Monoclonal Immunoglobulins
[0085] The invention also relates to mouse monoclonal antibodies
(mouse monoclonal immunoglobulins) that have binding specificity
for human CD52. In one embodiment, the invention relates to a mouse
monoclonal antibody that has binding specificity for human CD52,
comprising a light chain comprising SEQ ID NO: 3 and a heavy chain
comprising SEQ ID NO: 16; a light chain comprising SEQ ID NO: 4 and
a heavy chain comprising SEQ ID NO: 17; a light chain comprising
SEQ ID NO: 5 and a heavy chain comprising SEQ ID NO: 18; a light
chain comprising SEQ ID NO: 6 and a heavy chain comprising SEQ ID
NO: 19; a light chain comprising SEQ ID NO: 7 and a heavy chain
comprising SEQ ID NO: 20; a light chain comprising SEQ ID NO: 8 and
a heavy chain comprising SEQ ID NO: 21; a light chain comprising
SEQ ID NO: 9 and a heavy chain comprising SEQ ID NO: 22; a light
chain comprising SEQ ID NO: 10 and a heavy chain comprising SEQ ID
NO: 23; a light chain comprising SEQ ID NO: 11 and a heavy chain
comprising SEQ ID NO: 24; a light chain comprising SEQ ID NO: 12
and a heavy chain comprising SEQ ID NO: 25; or a light chain
comprising SEQ ID NO: 13 and a heavy chain comprising SEQ ID NO:
26.
[0086] In one embodiment, the mouse monoclonal antibody that has
binding specificity for human CD52 comprises a light chain variable
region selected from the group consisting of SEQ ID NO: 3, SEQ ID
NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ
ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID
NO: 13, or a heavy chain variable region selected from the group
consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID
NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23,
SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26, or both such light
chain variable region and such heavy chain variable region.
[0087] The invention also relates to a mouse immunoglobulin light
chain comprising the variable region of SEQ ID NO: 3, SEQ ID NO: 4,
SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO:
9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO:
13.
[0088] The invention also relates to a mouse immunoglobulin heavy
chain comprising the variable region of SEQ ID NO: 16, SEQ ID NO:
17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ
ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID
NO: 26.
[0089] Preferably, the mouse monoclonal antibodies of the present
invention comprise both a mouse antibody light chain of the
invention and a mouse antibody heavy chain of the invention. In
some embodiments, the invention provides a mouse monoclonal
immunoglobulin which binds to the same epitope on human CD52 as a
mouse monoclonal antibody comprising a light chain variable region
of SEQ ID NO: 3 and a heavy chain variable region of SEQ ID NO: 16;
a light chain variable region of SEQ ID NO: 4 and a heavy chain
variable region of SEQ ID NO: 17; a light chain variable region of
SEQ ID NO: 5 and a heavy chain variable region of SEQ ID NO: 18; a
light chain variable region of SEQ ID NO: 6 and a heavy chain
variable region of SEQ ID NO: 19; a light chain variable region of
SEQ ID NO: 7 and a heavy chain variable region of SEQ ID NO: 20; a
light chain variable region of SEQ ID NO: 8 and a heavy chain
variable region of SEQ ID NO: 21; a light chain variable region of
SEQ ID NO: 9 and a heavy chain variable region of SEQ ID NO: 22; a
light chain variable region of SEQ ID NO: 10 and a heavy chain
variable region of SEQ ID NO: 23; a light chain variable region of
SEQ ID NO: 11 and a heavy chain variable region of SEQ ID NO: 24; a
light chain variable region of SEQ ID NO: 12 and a heavy chain
variable region of SEQ ID NO: 25; or a light chain variable region
of SEQ ID NO: 13 and a heavy chain variable region of SEQ ID NO:
26. In other embodiments, the invention provides a mouse monoclonal
immunoglobulin which binds to an epitope on human CD52 which
overlaps with the epitope to which such a mouse monoclonal antibody
binds.
[0090] In other embodiments, the invention provides a mouse
monoclonal immunoglobulin which binds to an epitope on human CD52
comprising at least residue 1 of the mature human CD52 sequence.
The mouse monoclonal immunoglobulin may bind to an epitope
comprising at least residues 1, 3, 4 and 5 of the mature human CD52
sequence, may bind to an epitope comprising at least residues 1, 2,
3, 4 and 5 of the mature human CD52 sequence, or may bind to an
epitope comprising at least residues 7, 8 and 9 of the mature human
CD52 sequence. In some embodiments, the epitope comprises at least
residues 7, 8 and 11 of the mature human CD52 sequence. In some
embodiments, the epitope comprises at least residues 4 and 11 of
the mature human CD52 sequence.
[0091] The invention also relates to isolated nucleic acid
molecules that encode the mouse monoclonal immunoglobulins, mouse
immunoglobulin light chains or mouse immunoglobulin heavy chains of
the invention. In some embodiments, the invention is an isolated
nucleic acid molecule encoding a mouse immunoglobulin heavy chain
and a mouse immunoglobulin light chain which associate together to
form a mouse monoclonal immunoglobulin that has binding specificity
for human CD52, wherein the mouse immunoglobulin light chain
comprises a variable region selected from the group consisting of
SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO:
7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID
NO: 12 and SEQ ID NO: 13, or the mouse immunoglobulin heavy chain
comprises a variable region selected from the group consisting of
SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID
NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24,
SEQ ID NO: 25 and SEQ ID NO: 26, or both such light chain and such
heavy chain.
[0092] In some embodiments, the isolated nucleic acid encodes a
mouse immunoglobulin light chain which comprises a variable region
selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4,
SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO:
9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO:
13.
[0093] In other embodiments, the isolated nucleic acid encodes a
mouse immunoglobulin heavy chain which comprises a variable region
selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17,
SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID
NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO:
26.
[0094] The invention also relates to recombinant vectors (e.g.,
expression vectors, including mammalian cell expression vectors)
that comprise a nucleic acid encoding the mouse monoclonal
immunoglobulin (e.g., a mouse immunoglobulin light chain and a
mouse immunoglobulin heavy chain), the mouse immunoglobulin light
chain, or the mouse immunoglobulin heavy chain of the invention. In
some embodiments, the invention is a recombinant vector comprising
a nucleic acid, or a pair of recombinant vectors comprising nucleic
acids encoding a mouse monoclonal immunoglobulin that comprises a
light chain variable region selected from the group consisting of
SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO:
7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID
NO: 12 and SEQ ID NO: 13, or a heavy chain variable region selected
from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID
NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22,
SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26, or
both such light chain variable region and heavy chain variable
region.
[0095] In other embodiments, the recombinant vector comprises a
nucleic acid encoding a mouse immunoglobulin light chain, wherein
the mouse immunoglobulin light chain comprises SEQ ID NO: 3, SEQ ID
NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ
ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO:
13.
[0096] In other embodiments, the recombinant vector comprises a
nucleic acid encoding a mouse immunoglobulin heavy chain, wherein
the mouse immunoglobulin heavy chain comprises SEQ ID NO: 16, SEQ
ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO:
21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 or
SEQ ID NO: 26.
[0097] In other embodiments, the recombinant vector comprises a
nucleic acid encoding a mouse immunoglobulin light chain and a
mouse immunoglobulin heavy chain, wherein the mouse immunoglobulin
light chain and mouse immunoglobulin heavy chain associate together
to form a mouse monoclonal immunoglobulin that has binding
specificity for human CD52. In one embodiment, the mouse
immunoglobulin light chain comprises a variable region selected
from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO:
5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID
NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13, and the
mouse immunoglobulin heavy chain comprises a variable region
selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17,
SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID
NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO:
26.
[0098] In particular embodiments, the recombinant vector of the
invention is an expression vector, such as a mammalian cell
expression vector. In certain embodiments, the vector is a plasmid
or a viral vector (e.g., an adenoviral or AAV vector).
[0099] The invention also relates to a host cell that comprises one
or more nucleic acids encoding the mouse monoclonal immunoglobulin
(mouse immunoglobulin light chain and mouse immunoglobulin heavy
chain), the mouse immunoglobulin light chain or the mouse
immunoglobulin heavy chain of the invention. For example, in some
embodiments, the host cell comprises a recombinant vector (e.g.,
expression vector, mammalian cell expression vector) of the
invention.
[0100] In some embodiments, the host cell comprises nucleic acid
encoding a mouse immunoglobulin light chain and a mouse
immunoglobulin heavy chain, wherein the mouse immunoglobulin light
chain and the mouse immunoglobulin heavy chain associate together
to form a mouse monoclonal immunoglobulin that has binding
specificity for human CD52 and wherein the mouse immunoglobulin
light chain comprises a variable region selected from the group
consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO:
6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID
NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13, and/or the mouse
immunoglobulin heavy chain comprises a variable region selected
from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID
NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22,
SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26, or
both.
[0101] In some embodiments, the host cell comprises nucleic acid
encoding a mouse immunoglobulin light chain, wherein the mouse
immunoglobulin light chain comprises a light chain variable region
selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4,
SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO:
9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO:
13.
[0102] In some embodiments, the host cell comprises a nucleic acid
encoding a mouse immunoglobulin heavy chain, wherein the mouse
immunoglobulin heavy chain comprises a heavy chain variable region
selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17,
SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID
NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO:
26.
[0103] The invention also relates to a method of preparing a mouse
monoclonal immunoglobulin comprising maintaining a host cell of the
invention (e.g., a host cell that contains one or more recombinant
nucleic acids (e.g., recombinant vectors) that encode a mouse
monoclonal immunoglobulin (e.g., a mouse immunoglobulin light chain
and a mouse immunoglobulin heavy chain) of the invention) under
conditions appropriate for expression of a mouse monoclonal
immunoglobulin, whereby mouse monoclonal immunoglobulin chains are
expressed and a mouse monoclonal immunoglobulin is produced. In
some embodiments, the method further comprises purifying or
isolating the mouse monoclonal immunoglobulin.
[0104] The invention also relates to a method of preparing a light
chain of a mouse monoclonal immunoglobulin, comprising maintaining
a host cell of the invention containing a nucleic acid encoding a
mouse immunoglobulin light chain of the invention under conditions
appropriate for expression of said mouse immunoglobulin light
chain, whereby a light chain is expressed. In some embodiments, the
method further comprises purifying or isolating the light
chain.
[0105] The invention also relates to a method of preparing a heavy
chain of a mouse monoclonal immunoglobulin, comprising maintaining
a host cell of the invention containing a nucleic acid encoding a
mouse immunoglobulin heavy chain of the invention under conditions
appropriate for expression of said mouse immunoglobulin heavy
chain, whereby a mouse immunoglobulin heavy chain is expressed. In
some embodiments, the method further comprises purifying or
isolating the mouse immunoglobulin heavy chain.
[0106] The invention also relates to a method of diagnosing a
disease (e.g., autoimmune diseases (e.g., multiple sclerosis,
lupus, vasculitis), cancer (e.g., leukemias (e.g., chronic
lymphocytic leukemia), and lymphomas (e.g., non-Hodgkin's
lymphoma)), and transplant (e.g., solid organ transplant (e.g.,
kidney transplant) and stem cell transplant)') comprising assaying
a patient sample in vitro, with the mouse monoclonal immunoglobulin
of the invention (e.g., Lundin, J., et al., Blood, 101:4267-4272
(2003); Rodig, S J, et al., Clin. Cancer res., 12(23); 7174-717179
(2006)).
Chimeric Immunoglobulins
[0107] The invention also relates to chimeric immunoglobulins that
have binding specificity for human CD52. Such chimeric
immunoglobulins may include the variable regions of any of the
mouse monoclonal immunoglobulin of the present invention. In one
embodiment, the chimeric immunoglobulin of the invention comprises
the light chain variable region of SEQ ID NO: 3 and the heavy chain
variable region of SEQ ID NO: 16; the light chain variable region
of SEQ ID NO: 4 and the heavy chain variable region of SEQ ID NO:
17; the light chain variable region of SEQ ID NO: 5 and the heavy
chain variable region of SEQ ID NO: 18; the light chain variable
region of SEQ ID NO: 6 and the heavy chain variable region of SEQ
ID NO: 19; the light chain variable region of SEQ ID NO: 7 and the
heavy chain variable region of SEQ ID NO: 20; the light chain
variable region of SEQ ID NO: 8 and the heavy chain variable region
of SEQ ID NO: 21; the light chain variable region of SEQ ID NO: 9
and the heavy chain variable region of SEQ ID NO: 22; the light
chain variable region of SEQ ID NO: 10 and the heavy chain variable
region of SEQ ID NO: 23; the light chain variable region of SEQ ID
NO: 11 and the heavy chain variable region of SEQ ID NO: 24; the
light chain variable region of SEQ ID NO: 12 and the heavy chain
variable region of SEQ ID NO: 25; or the light chain variable
region of SEQ ID NO: 13 and the heavy chain variable region of SEQ
ID NO: 26.
[0108] The invention also relates to a chimeric antibody that has
binding specificity for human CD52, comprising a light chain
variable region sequence selected from the group consisting of: the
light chain variable region of SEQ ID NO: 3, the light chain
variable region of SEQ ID NO: 4, the light chain variable region of
SEQ ID NO: 5, the light chain variable region of SEQ ID NO: 6, the
light chain variable region of SEQ ID NO: 7, the light chain
variable region of SEQ ID NO: 8, the light chain variable region of
SEQ ID NO: 9, the light chain variable region of SEQ ID NO: 10, the
light chain variable region of SEQ ID NO: 11, the light chain
variable region of SEQ ID NO: 12 and the light chain variable
region of SEQ ID NO: 13, and/or a heavy chain variable region
sequence selected from the group consisting of: the heavy chain
variable region of SEQ ID NO: 16, the heavy chain variable region
of SEQ ID NO: 17, the heavy chain variable region of SEQ ID NO: 18,
the heavy chain variable region of SEQ ID NO: 19, the heavy chain
variable region of SEQ ID NO: 20, the heavy chain variable region
of SEQ ID NO: 21, the heavy chain variable region of SEQ ID NO: 22,
the heavy chain variable region of SEQ ID NO: 23, the heavy chain
variable region of SEQ ID NO: 24, the heavy chain variable region
of SEQ ID NO: 25 and the heavy chain variable region of SEQ ID NO:
26.
[0109] The invention also relates to a chimeric light chain
comprising a variable region selected from the group consisting of
SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO:
7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID
NO: 12, and SEQ ID NO: 13.
[0110] The invention also relates to a chimeric heavy chain
comprising a variable region selected from the group consisting of
SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID
NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24,
SEQ ID NO: 25, and SEQ ID NO: 26.
[0111] Preferably, the chimeric immunoglobulins of the present
invention comprise both a chimeric light chain of the invention and
a chimeric heavy chain of the invention.
[0112] In some embodiments, the invention provides a chimeric
immunoglobulin which binds to the same epitope on human CD52 as a
mouse monoclonal antibody comprising a light chain variable region
of SEQ ID NO: 3 and a heavy chain variable region of SEQ ID NO: 16;
a light chain variable region of SEQ ID NO: 4 and a heavy chain
variable region of SEQ ID NO: 17; a light chain variable region of
SEQ ID NO: 5 and a heavy chain variable region of SEQ ID NO: 18; a
light chain variable region of SEQ ID NO: 6 and a heavy chain
variable region of SEQ ID NO: 19; a light chain variable region of
SEQ ID NO: 7 and a heavy chain variable region of SEQ ID NO: 20; a
light chain variable region of SEQ ID NO: 8 and a heavy chain
variable region of SEQ ID NO: 21; a light chain variable region of
SEQ ID NO: 9 and a heavy chain variable region of SEQ ID NO: 22; a
light chain variable region of SEQ ID NO: 10 and a heavy chain
variable region of SEQ ID NO: 23; a light chain variable region of
SEQ ID NO: 11 and a heavy chain variable region of SEQ ID NO: 24; a
light chain variable region of SEQ ID NO: 12 and a heavy chain
variable region of SEQ ID NO: 25; or a light chain variable region
of SEQ ID NO: 13 and a heavy chain variable region of SEQ ID NO:
26. In other embodiments, the chimeric immunoglobulin binds to an
epitope on human CD52 which overlaps with the epitope to which such
a mouse monoclonal antibody binds.
[0113] In other embodiments, the invention provides a chimeric
immunoglobulin which binds to an epitope on human CD52 comprising
at least residue 1 of the mature human CD52 sequence. The chimeric
immunoglobulin may bind to an epitope comprising at least residues
1, 3, 4 and 5 of the mature human CD52 sequence, may bind to an
epitope comprising at least residues 1, 2, 3, 4 and 5 of the mature
human CD52 sequence, or may bind to an epitope on human CD52
comprising at least residues 7, 8 and 9 of the mature human CD52
sequence. In some embodiments, the epitope comprises at least
residues 7, 8 and 11 of the mature human CD52 sequence. In some
embodiments, the epitope comprises at least residues 4 and 11 of
the mature human CD52 sequence.
[0114] The invention also relates to isolated nucleic acid
molecules that encode the chimeric immunoglobulins, chimeric light
chains or chimeric heavy chains of the invention. In some
embodiments, the invention is an isolated nucleic acid molecule
(one or more nucleic acid molecules) encoding a chimeric heavy
chain and a chimeric light chain which associate together to form a
chimeric immunoglobulin that has binding specificity for human
CD52, wherein the chimeric light chain comprises a variable region
selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4,
SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO:
9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13;
and/or the chimeric heavy chain comprises a variable region
selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17,
SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID
NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO:
26.
[0115] In some embodiments, the invention is an isolated nucleic
acid molecule encoding a chimeric light chain that comprises the
variable region of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID
NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ
ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.
[0116] In some embodiments, the invention is an isolated nucleic
acid molecule encoding a chimeric heavy chain that comprises the
variable region of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ
ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO:
23, SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO: 26.
[0117] The invention also relates to recombinant vectors (e.g.,
expression vectors, mammalian cell expression vectors) that
comprise a nucleic acid encoding the chimeric immunoglobulin
(chimeric light chain and chimeric heavy chain), the chimeric light
chain, or the chimeric heavy chain of the invention. In some
embodiments, the invention is a recombinant vector comprising a
nucleic acid (or a pair of recombinant vectors comprising nucleic
acids) encoding a chimeric immunoglobulin that comprises a light
chain variable region selected from the group consisting of SEQ ID
NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ
ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12
and SEQ ID NO: 13; or a heavy chain variable region selected from
the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO:
18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ
ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26; or both
such light chain and heavy chain.
[0118] In other embodiments, the recombinant vector comprises a
nucleic acid encoding a chimeric light chain, wherein the chimeric
light chain comprises the variable region of SEQ ID NO: 3, SEQ ID
NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ
ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO:
13.
[0119] In other embodiments, the recombinant vector comprises a
nucleic acid encoding a chimeric heavy chain, wherein the chimeric
heavy chain comprises the variable region of SEQ ID NO: 16, SEQ ID
NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21,
SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 or SEQ
ID NO: 26.
[0120] In particular embodiments, the recombinant vector of the
invention is an expression vector, such as a mammalian cell
expression vector. In certain embodiments, the vector is a plasmid
or a viral vector (e.g., an adenoviral or AAV vector).
[0121] The invention also relates to a host cell that comprises one
or more nucleic acids (e.g., one or more recombinant vectors)
encoding the chimeric immunoglobulin (chimeric light chain and
chimeric heavy chain), the chimeric light chain or the chimeric
heavy chain of the invention. For example, in some embodiments, the
host cell comprises a recombinant vector (e.g., expression vector,
mammalian cell expression vector) of the invention.
[0122] In some embodiments, the host cell comprises a recombinant
nucleic acid (or a pair of recombinant nucleic acids) encoding a
chimeric light chain and a chimeric heavy chain, wherein the
chimeric light chain and the chimeric heavy chain associate
together to form a chimeric immunoglobulin that has binding
specificity for human CD52 and wherein the chimeric light chain
comprises a variable region selected from the group consisting of
SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO:
7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID
NO: 12 and SEQ ID NO: 13; and/or the chimeric heavy chain comprises
a variable region selected from the group consisting of the
variable region of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ
ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO:
23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26.
[0123] In some embodiments, the host cell comprises a recombinant
nucleic acid encoding a chimeric light chain, wherein the chimeric
light chain comprises a light chain variable region selected from
the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5,
SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO:
10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13.
[0124] In some embodiments, the host cell comprises a recombinant
nucleic acid encoding a chimeric heavy chain, wherein the chimeric
heavy chain comprises a heavy chain variable region selected from
the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO:
18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ
ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26.
[0125] The invention also relates to a method of preparing a
chimeric immunoglobulin comprising maintaining a host cell of the
invention (e.g., a host cell that contains one or more isolated
nucleic acids that encode a chimeric immunoglobulin (e.g., a
chimeric light chain and a chimeric heavy chain) of the invention)
under conditions appropriate for expression of a chimeric
immunoglobulin, whereby chimeric immunoglobulin chains are
expressed and a chimeric immunoglobulin is produced. In some
embodiments, the method further comprises purifying or isolating
the chimeric immunoglobulin.
[0126] The invention also relates to a method of preparing a
chimeric light chain comprising maintaining a host cell of the
invention (e.g., a host cell that contains a nucleic acid encoding
a chimeric light chain of the invention) under conditions
appropriate for expression of said chimeric light chain, whereby a
chimeric light chain is expressed and a chimeric light chain is
produced. In some embodiments, the method further comprises
purifying or isolating the chimeric light chain.
[0127] The invention also relates to a method of preparing a
chimeric heavy chain comprising maintaining a host cell of the
invention (e.g., a host cell that contains a nucleic acid encoding
a chimeric heavy chain of the invention) under conditions
appropriate for expression of said chimeric heavy chain, whereby a
chimeric heavy chain is expressed and a chimeric heavy chain is
produced. In some embodiments, the method further comprises
purifying or isolating the chimeric heavy chain.
[0128] The invention also relates to a method of diagnosing a
disease selected from the group consisting of autoimmune diseases
(e.g., multiple sclerosis, lupus, vasculitis), cancer (e.g.,
leukemias (e.g., chronic lymphocytic leukemia), and lymphomas
(e.g., non-Hodgkin's lymphoma)), and transplant (e.g., solid organ
transplant (e.g., kidney transplant) and stem cell transplant',
comprising assaying a patient sample in vitro, with the chimeric
immunoglobulin of the invention.
[0129] Further embodiments of this invention are described as
follows. In one aspect, the invention relates to a monoclonal
anti-human CD52 antibody or an antigen-binding portion thereof,
wherein the light chain and heavy chain of said antibody comprise
the three complementarity determining regions (CDRs) found in: SEQ
ID NOs: 3 and 16, respectively; SEQ ID NOs: 4 and 17, respectively;
SEQ ID NOs: 5 and 18, respectively; SEQ ID NOs: 6 and 19,
respectively; SEQ ID NOs: 7 and 20, respectively; SEQ ID NOs: 8 and
21, respectively; SEQ ID NOs: 9 and 22, respectively; SEQ ID NOs:
10 and 23, respectively; SEQ ID NOs: 11 and 24, respectively; SEQ
ID NOs: 12 and 25, respectively; SEQ ID NOs: 12 and 137,
respectively; or SEQ ID NOs: 13 and 26, respectively. In some
embodiments, the invention relates to an antibody that binds to the
same epitope on human CD52 as the above monoclonal antibody or
antigen-binding portion. In some embodiments, the invention relates
to an antibody that competes with the above monoclonal antibody or
antigen-binding portion. In some embodiments, the invention relates
to an antibody that cross-competes with the above monoclonal
antibody or antigen-binding portion.
[0130] In some embodiments, any of the above antibodies or
antigen-binding portions binds to an amino acid sequence comprising
SEQ ID NO: 104. In some related embodiments, the binding of said
antibody or portion to SEQ ID NO: 104 may be reduced by an alanine
substitution at one or more of residues 4, 7, 8, or 11 of SEQ ID
NO: 104.
[0131] In some embodiments, the antibody is a humanized antibody, a
mouse antibody, or a chimeric antibody. In certain embodiments, the
framework regions of the heavy chain of said antibody utilize a
VH3-72 or VH3-23 human germline sequence, and the framework regions
of the light chain of said antibody utilize a VK2 A18b human
germline sequence.
[0132] In some embodiments, the invention relates to a monoclonal
anti-human CD52 antibody or an antigen-binding portion thereof,
wherein said antibody comprises heavy chain (H)-CDR1, H-CDR2,
H-CDR3, and light chain (L)-CDR1, L-CDR2, and L-CDR3 whose amino
acid sequences are SEQ ID NOs: 51, 59, 69, 29, 36, and 43,
respectively; SEQ ID NOs: 50, 60, 69, 29, 37, and 43, respectively;
SEQ ID NOs: 50, 61, 68, 29, 38, and 43, respectively; SEQ ID NOs:
50, 61, 69, 29, 36, and 43, respectively; SEQ ID NOs: 50, 62, 69,
29, 39, and 43, respectively; SEQ ID NOs: 52, 61, 70, 30, 40, and
43, respectively; SEQ ID NOs: 53, 63, 71, 31, 36, and 44,
respectively; SEQ ID NOs: 54, 64, 71, 31, 36, and 45, respectively;
SEQ ID NOs: 55, 63, 72, 31, 36, and 46, respectively; SEQ ID NOs:
56, 65, 73, 32, 41, and 47, respectively; SEQ ID NOs: 56, 65, 294,
32, 41, and 47, respectively; or SEQ ID NOs: 56, 66, 74, 33, 41,
and 48, respectively.
[0133] In some embodiments, the invention relates to a monoclonal
anti-human CD52 antibody or an antigen-binding portion thereof,
wherein the light chain and heavy chain of said antibody comprise
the amino acid sequences of SEQ ID NOs: 3 and 16, respectively; SEQ
ID NOs: 4 and 17, respectively; SEQ ID NOs: 5 and 18, respectively;
SEQ ID NOs: 6 and 19, respectively; SEQ ID NOs: 7 and 20,
respectively; SEQ ID NOs: 8 and 21, respectively; SEQ ID NOs: 9 and
22, respectively; SEQ ID NOs: 10 and 23, respectively; SEQ ID NOs:
11 and 24, respectively; SEQ ID NOs: 12 and 25, respectively; or
SEQ ID NOs: 13 and 26, respectively.
[0134] In some embodiments, the invention relates to a monoclonal
antibody or antigen-binding portion thereof, wherein the heavy
chain and light chain of said antibody comprise the amino acid
sequences of SEQ ID NOs: 103 and 102, respectively; SEQ ID NOs: 136
and 138, respectively; SEQ ID NOs: 137 and 138, respectively; SEQ
ID NOs: 139 and 147, respectively; SEQ ID NOs: 149 and 155,
respectively; SEQ ID NOs: 149 and 156, respectively; SEQ ID NOs:
158 and 165, respectively; SEQ ID NOs: 158 and 166, respectively;
SEQ ID NOs: 159 and 165, respectively; SEQ ID NOs: 159 and 166,
respectively; SEQ ID NOs: 161 and 166, respectively; or SEQ ID NOs:
163 and 166, respectively. In some embodiments, the invention
relates to an antibody that binds to the same epitope on human CD52
as the above monoclonal antibody or antigen-binding portion. In
some embodiments, the invention relates to an antibody that
competes with the above monoclonal antibody or antigen-binding
portion. In some embodiments, the invention relates to an antibody
that cross-competes with the above monoclonal antibody or
antigen-binding portion.
[0135] In certain embodiments, the invention relates to a
monoclonal humanized anti-human CD52 antibody or an antigen-binding
portion thereof, wherein the heavy chain and the light chain of
said antibody comprise the amino acid sequences of SEQ ID NOs: 272
and 273, respectively, without the signal sequences. In certain
embodiments, the invention relates to a monoclonal anti-human CD52
antibody or an antigen-binding portion thereof, wherein the heavy
chain and the light chain of said antibody comprise the amino acid
sequences of SEQ ID NOs: 274 and 275, respectively, without the
signal sequences. In certain embodiments, the invention relates to
a monoclonal anti-human CD52 antibody or an antigen-binding portion
thereof, wherein the heavy chain and the light chain of said
antibody comprise the amino acid sequences of SEQ ID NOs: 276 and
278, respectively, without the signal sequences. In certain
embodiments, the invention relates to a monoclonal anti-human CD52
antibody or an antigen-binding portion thereof, wherein the heavy
chain and the light chain of said antibody comprise the amino acid
sequences of SEQ ID NOs: 277 and 278, respectively, without the
signal sequences. In certain embodiments, the invention relates to
a monoclonal anti-human CD52 antibody or an antigen-binding portion
thereof, wherein the heavy chain and the light chain of said
antibody comprise the amino acid sequences of SEQ ID NOs: 279 and
280, respectively, without the signal sequences. In certain
embodiments, the invention relates to a monoclonal anti-human CD52
antibody or an antigen-binding portion thereof, wherein the heavy
chain and the light chain of said antibody comprise the amino acid
sequences of SEQ ID NOs: 281 and 282, respectively, without the
signal sequences. The invention also provides antibodies that bind
to the same epitope on CD52 as one of these humanized antibodies
and antibodies that compete or cross-compete with one of these
humanized antibodies. In related embodiments, the invention
provides compositions comprising one such humanized antibody and a
pharmaceutically acceptable carrier.
[0136] In some embodiments, the invention relates to a monoclonal
anti-human CD52 antibody or an antigen-binding portion thereof,
wherein the light chain of said antibody comprises an amino acid
sequence selected from the group consisting of SEQ ID NOs: 102,
138, 145-148, 153-157, and 164-168. In certain embodiments, the
invention relates to a monoclonal anti-human CD52 antibody or an
antigen-binding portion thereof, wherein the light chain of said
antibody comprises an amino acid sequence selected from the group
consisting of SEQ ID NOs: 273, 275, 278, 280, and 282, without the
signal sequences. In certain embodiments, the invention relates to
an antibody light chain or a portion thereof, comprising an amino
acid sequence selected from the group consisting of SEQ ID NOs:
102, 138, 145-148, 153-157, 164-168, 273, 275, 278, 280, and 282,
without the signal sequences if present.
[0137] In some embodiments, the invention relates to a monoclonal
anti-human CD52 antibody or an antigen-binding portion thereof,
wherein the heavy chain of said antibody comprises an amino acid
sequence selected from the group consisting of SEQ ID NOs: 103,
136, 137, 139-144, 149-152, and 158-163. In certain embodiments,
the invention relates to a monoclonal anti-human CD52 antibody or
an antigen-binding portion thereof, wherein the heavy chain of said
antibody comprises an amino acid sequence selected from the group
consisting of SEQ ID NOs: 272, 274, 276, 277, 279, and 281, without
the signal sequences. In certain embodiments, the invention relates
to an antibody heavy chain or a portion thereof, comprising an
amino acid sequence selected from the group consisting of SEQ ID
NOs: 103, 136, 137, 139-144, 149-152, 158-163, 272, 274, 276, 277,
279, and 281, without the signal sequences if present.
[0138] In some embodiments, any of the above antibodies may be an
IgG, IgM, IgA, IgD or IgE molecule. In certain embodiments, said
IgG is IgG1, IgG2, IgG3, or IgG4.
[0139] In some embodiments, any of the above antigen-binding
portions may be a single chain antibody, Fv, Fab, Fab', F(ab')2,
Fd, single chain Fv molecule (scFv), bispecific single chain Fv
dimer, diabody, domain-deleted antibody or single domain antibody
(dAb).
[0140] The invention also relates to any of the above antibodies or
antigen-binding portions, wherein said antibody or antigen-binding
portion depletes T or B lymphocytes, or both; preferentially
depletes T lymphocytes as compared to B lymphocytes; increases
circulating serum levels of TNF-alpha, IL-6, or MCP-1 (e.g., by at
least 5%, at least 10%, at least 50%, at least 100% or at least
200%); mediates antibody-dependent cell mediated cytotoxicity
(ADCC) of CD52-expressing cells; mediates complement-dependent
cytotoxicity (CDC) of CD52-expressing cells; binds to human CD52 in
spite of the presence of neutralizing antibodies to alemtuzumab in
a human patient; and/or promotes intracellular signaling in human T
and/or B cells (see, e.g., Hederer et al., International Immunology
12:505-616 (2000); Watanabe et al., Clinical Immunology 120:
247-259 (2006)).
[0141] The invention further relates to an isolated nucleic acid
encoding the heavy chain or an antigen-binding portion thereof, or
the light chain or an antigen-binding portion thereof, of any of
the above antibodies. In some embodiments, said isolated nucleic
acid comprises a heavy chain nucleotide sequence selected from the
group consisting of SEQ ID NOs: 283, 285, 287, 288, 290, and 292,
or said nucleotide sequence without the sequence encoding a signal
peptide; a light chain nucleotide sequence selected from the group
consisting of SEQ ID NOs: 284, 286, 289, 291, and 293, or said
nucleotide sequence without the sequence encoding a signal peptide;
or both said heavy chain nucleotide sequence and said light chain
nucleotide sequence. In certain embodiments, said isolated nucleic
acid comprises a heavy chain nucleotide sequence and a light chain
nucleotide sequence selected from the group consisting of SEQ ID
NO: 283 and SEQ ID NO: 284, respectively, both without sequences
encoding signal peptides; SEQ ID NO: 285 and SEQ ID NO: 286,
respectively, both without sequences encoding signal peptides; SEQ
ID NO: 287 and SEQ ID NO: 289, respectively, both without sequences
encoding signal peptides; SEQ ID NO: 288 and SEQ ID NO: 289,
respectively, both without sequences encoding signal peptides; SEQ
ID NO: 290 and SEQ ID NO: 291, respectively, both without sequences
encoding signal peptides; and SEQ ID NO: 292 and SEQ ID NO: 293,
respectively, both without sequences encoding signal peptides.
[0142] The invention also relates to the use of an isolated nucleic
acid comprising a heavy chain nucleotide sequence and an isolated
nucleic acid comprising a light chain nucleotide sequence for the
manufacture of a medicament for treating a patient in need thereof,
wherein said heavy chain nucleotide sequence and light chain
nucleotide sequence are selected from the group consisting of SEQ
ID NO: 283 and SEQ ID NO: 284, respectively, both without sequences
encoding signal peptides; SEQ ID NO: 285 and SEQ ID NO: 286,
respectively, both without sequences encoding signal peptides; SEQ
ID NO: 287 and SEQ ID NO: 289, respectively, both without sequences
encoding signal peptides; SEQ ID NO: 288 and SEQ ID NO: 289,
respectively, both without sequences encoding signal peptides; SEQ
ID NO: 290 and SEQ ID NO: 291, both respectively, without sequences
encoding signal peptides; and SEQ ID NO: 292 and SEQ ID NO: 293,
both respectively, without sequences encoding signal peptides.
[0143] The invention also relates to a recombinant vector
comprising (1) a nucleic acid sequence encoding the heavy chain or
an antigen-binding portion thereof, (2) a nucleic acid sequence
encoding the light chain or an antigen-binding portion thereof, or
(3) both, of any of the above antibodies. The invention further
relates to a host cell comprising a first nucleic acid sequence
encoding the heavy chain or an antigen-binding portion thereof of
any of the above antibodies, said first nucleic acid sequence
operably linked to an expression control element, and a second
nucleic acid sequence encoding the light chain or an
antigen-binding portion thereof of said antibody, said second
nucleic acid sequence operably linked to an expression control
element. The invention relates to a method of making an anti-human
CD52 antibody or an antigen-binding portion thereof, comprising
maintaining said host cell under conditions appropriate for
expression of the antibody or portion, and also relates to said
method further comprising the step of isolating the antibody or
portion.
[0144] The invention relates to a composition comprising the
monoclonal antibody or antigen-binding portion according to any one
of claims 1-24 and a pharmaceutically acceptable vehicle or
carrier.
[0145] In some embodiments, the invention relates to a method for
treating a patient in need thereof, comprising administering to the
patient an effective amount of any of the above antibodies or
antigen-binding portions, or the above composition. In certain
embodiments, said patient is receiving a transplantation.
[0146] In some embodiments, the invention relates to a method for
treating an autoimmune disease in a patient in need thereof,
comprising administering to the patient an effective amount of any
of the above antibodies or antigen-binding portions, or the above
composition. In certain embodiments, the autoimmune disease is,
e.g., multiple sclerosis, rheumatoid arthritis, or systemic lupus
erythematosus.
[0147] In some embodiments, the invention relates to a method for
treating cancer in a patient in need thereof, comprising
administering to the patient an effective amount of any of the
above antibodies or antigen-binding portions, or the above
composition. In certain embodiments, the cancer is, e.g., a
lymphoma such as non-Hodgkin's lymphoma; a leukemia such as B-cell
chronic lymphocytic leukemia; T cell malignancy, wherein the
antibody or portion preferentially depletes T cells as compared to
B cells; or a solid tumor.
[0148] In some embodiments, any of the above methods of treatment
further comprising administering to the patient a neutrophil or NK
cell stimulatory agent. In certain embodiments, said agent is G-CSF
or GM-CSF. In some embodiments, any of the above methods of
treatment further comprises administering to the patient a T
regulatory cell stimulatory agent. In certain embodiments, said
agent is rapamycin.
[0149] In some embodiments, the invention relates to a method for
inhibiting angiogenesis in a patient in need thereof, comprising
administering an effective amount of any of the above antibodies or
antigen-binding portions to the patient. In certain embodiments,
the patient has a solid tumor. In certain embodiments, the patient
has neovascularization. In certain embodiments, said
neovascularization is in the eye.
[0150] The invention also relates to the use of any of the above
antibodies or antigen-binding portions for the manufacture of a
medicament for treating an autoimmune disease in a patient in need
thereof. Further, the invention relates to the use of any of the
above antibodies or antigen-binding portions for the manufacture of
a medicament for treating cancer in a patient in need thereof. The
invention relates to the use of any of the above antibodies or
antigen-binding portions for the manufacture of a medicament for
treating a patient in need of a transplantation. The invention
relates to the use of any of the above antibodies or
antigen-binding portions for the manufacture of a medicament for
treating neovascularization in a patient in need thereof.
[0151] The invention also relates to the use of any of the above
antibodies or antigen-binding portions as a medicament.
BRIEF DESCRIPTION OF THE DRAWINGS
[0152] FIGS. 1A-1B is a schematic representation of the development
of new anti-CD52 monoclonal antibodies. The general scheme is
depicted in FIG. 1A and the names of the mouse anti-human CD52
antibody clones as well as their isotypes in shown in FIG. 1B.
[0153] FIG. 2 is an alignment of the amino acid sequences of
several mouse anti-human CD52 kappa light chain sequences (SEQ ID
NOS:1-13). Campath-1G.RTM. is the rat monoclonal antibody from
which the humanized Campath-1H.RTM. antibody is derived.
[0154] FIG. 3 is an alignment of the amino acid sequences of
several mouse anti-human CD52 heavy chain sequences (SEQ ID
NOS:14-26).
[0155] FIG. 4 is an alignment of wildtype CD52 and 10 mutant CD52
proteins (SEQ ID NOS: 104-114, from top to bottom).
[0156] FIG. 5A illustrates the FACS-based N-terminal binding
profile of antibodies 4B10 and 7F11 on cells expressing CD52
alanine scanning mutants.
[0157] FIG. 5B illustrates the FACS-based middle region binding
profile of antibodies CF1D12, 3G7, 9D9, 5F7, 4G7, and 11C11 on
cells expressing CD52 alanine scanning mutants.
[0158] FIG. 5C illustrates the FACS-based binding profile of
antibodies Campath-1H.RTM. ("Campath 1H"), 2C3, 12G6, and 23E6 on
cells expressing CD52 alanine scanning mutants.
[0159] FIG. 5D depicts immunoblots of CD52+/-N-linked glycosylation
probed with the panel of chimeric monoclonal antibodies. "C1H"
stands for Campath-1H.RTM..
[0160] FIG. 6 is a graph showing the results of a 1.5 hour CDC
assay on various chimeric anti-CD52 antibodies screened on CHO-K1
CD52 #67 cells. The results show that chimeric antibodies 4B10 and
7F11 are comparable to or better than Campath-1H.RTM. ("Campath
1H").
[0161] FIG. 7 is a graph showing the results of a 14 hour ADCC
assay on various chimeric IgG1 antibodies to CD52 screened on
CHO-K1 CD52 #67 cells. The results show that chimeric antibodies
2C3 and 12G6 are comparable to or better than Campath-1H.RTM.
("Campath 1-H").
[0162] FIGS. 8A-8C illustrate the comparative binding of various
anti-CD52 antibodies and the Campath-1H.RTM. ("C-1H") antibody to
defined human lymphocyte populations. These figures show the
hierarchy of the binding ability of the chimeric antibodies
screened by FACS assay. Curves to the far right demonstrate the
highest binding ability, whereas curves to the left bind with lower
affinity.
[0163] FIGS. 9A-9C are graphs illustrating the level of CD4 T cells
(FIG. 9A), CD8 T cells (FIG. 9B) and CD19 B cells (FIG. 9C) in the
blood 72 hours after dosing with chimeric antibodies 7F11, 8G3,
23E6, 12G6, 4B10, or 5F7, or Campath-1H.RTM. ("Cam").
[0164] FIGS. 10A-10C are graphs illustrating the level of CD4 T
cells (FIG. 10A), CD8 T cells (FIG. 10B) and CD19 B cells (FIG.
10C) in the spleen 72 hours after dosing with chimeric antibodies
7F11, 8G3, 23E6, 12G6, 4B10, or 5F7, or Campath-1H.RTM.
("Cam").
[0165] FIGS. 11A-11C are graphs showing the level of CD4 T cells
(FIG. 11A), CD8 T cells (FIG. 11B) and CD19 B cells (FIG. 11C) in
the blood 72 hours after dosing with chimeric antibodies 2C3, 9D9,
4B10, 3G7, or 11C11, or Campath-1H.RTM. ("Cam").
[0166] FIG. 12 is a Kaplan Meier Survival graph illustrating the
percent of surviving mice after treatment with 7F11, 4B10, or 12G6
chimeric monoclonal antibodies, or Campath-1H.RTM. ("Campath").
[0167] FIG. 13 is a Kaplan Meier Survival graph illustrating the
percent of surviving mice after treatment with 2C3, 8G3, or 23E6
chimeric monoclonal antibodies, or Campath-1H.RTM. ("Campath").
[0168] FIG. 14 is a Kaplan Meier Survival graph illustrating the
percent of surviving mice after treatment with 9D9 or 4B10 chimeric
monoclonal antibodies, or Campath-1H.RTM. ("Campath").
[0169] FIG. 15 is a Kaplan Meier Survival graph illustrating the
percent of surviving mice after treatment with 2C3 or 11C11
chimeric monoclonal antibodies, or Campath-1H.RTM. ("Campath").
[0170] FIG. 16 is an alignment of the mouse anti-human CD52
antibody 4B10 heavy chain variable region (SEQ ID NO: 96) sequence
with the closest matched human germline sequence (SEQ ID NO: 97)
and the humanized heavy chain variable region sequence (SEQ ID NO:
98). Also shown is an alignment of the mouse anti-human CD52
antibody 4B10 light chain variable region (SEQ ID NO: 99) sequence
with the closest matched human germline sequence (SEQ ID NO: 100)
and the humanized light chain variable region sequence (SEQ ID NO:
101).
[0171] FIG. 17 shows the humanized 4B10 heavy chain (SEQ ID NO:
103) and light chain (SEQ ID NO: 102) variable region
sequences.
[0172] FIG. 18 is a graph showing that humanized antibody
4B10-H1/K1 ("4B10-Humanized") and chimeric antibody 4B10 bind
equivalently to cells expressing CD52.
[0173] FIG. 19 is a graph showing that humanized antibody
4B10-H1/K1 ("4B10 Humanized") and chimeric antibody 4B10 mediate
equivalent ADCC activity on cells expressing CD52.
[0174] FIG. 20 is a graph showing that humanized antibody
4B10-H1/K1 ("4B10-Humanized") and chimeric antibody 4B10 mediate
equivalent CDC activity on cells expressing CD52.
[0175] FIG. 21 is a graph illustrating the pharmacokinetic profile
of chimeric anti-CD52 antibodies (12G6, 7F11 and 4B10),
Campath-1H.RTM. ("Campath"), and humanized anti-CD52 antibody
4B10-H1/K1 ("4B10 humanized (H1/K1)") in heterozygous huCD52
transgenic mice.
[0176] FIGS. 22A-22C are graphs showing the level of CD4 T cells
(FIG. 22A), CD8 T cells (FIG. 22B) and CD19 B cells (FIG. 22C) in
the blood 72 hours after dosing with chimeric antibody 4B10 or
humanized antibody 4B10-H1/K1 ("4B10-Hu") or Campath-1H.RTM.
("Campath").
[0177] FIG. 23 is a graph showing the summary of the relative
binding affinities of the anti-CD52 monoclonal antibodies.
[0178] FIG. 24 shows the humanized 7F11 heavy and light (kappa)
chain variable region sequences Amino acid residues that are back
mutated to mouse residues are underlined and the CDRs are shown in
boldface.
[0179] FIG. 25 is a histogram showing that chimeric and humanized
7F11 antibodies bind equivalently to cells expressing CD52. The X
axis represents the fluorescence emitted by the bound anti-CD52
antibody, while the area of each peak represents the total cell
population.
[0180] FIG. 26A shows the humanized 2C3 heavy chain variable region
sequences Amino acid residues that are back mutated to mouse
residues are underlined and the CDRs are shown in boldface. FIG.
26B shows the humanized 2C3 light (kappa) chain variable region
sequences. Amino acid residues that are back mutated to mouse
residues are underlined and the CDRs are shown in boldface.
[0181] FIG. 27A is a histogram showing binding of humanized and
chimeric 2C3 antibodies to cells expressing CD52. The X axis
represents the fluorescence emitted by the bound anti-CD52
antibody, while the area of each peak represents the total cell
population. FIG. 27B is a histogram showing that chimeric and a
subset of the humanized 2C3 antibodies bind equivalently to cells
expressing CD52. The X axis represents the fluorescence emitted by
the bound anti-CD52 antibody, while the area of each peak
represents the total cell population.
[0182] FIG. 28A shows the humanized 12G6 heavy chain variable
region sequences. Amino acid residues that are back mutated to
mouse residues are underlined and the CDRs are shown in boldface.
FIG. 28B shows the humanized 12G6 light (kappa) chain variable
region sequences. Amino acid residues that are back mutated to
mouse residues are underlined and the CDRs are shown in
boldface.
[0183] FIG. 29 is a histogram showing that chimeric and a subset of
the humanized 12G6 antibodies bind equivalently to cells expressing
CD52. The X axis represents the fluorescence emitted by the bound
anti-CD52 antibody, while the area of each peak represents the
total cell population.
[0184] FIG. 30A shows the humanized 9D9 heavy chain variable region
sequences Amino acid residues that are back mutated to mouse
residues are underlined and the CDRs are shown in boldface. FIG.
30B shows the humanized 9D9 light (kappa) chain variable region
sequences. Amino acid residues that are back mutated to mouse
residues are underlined and the CDRs are shown in boldface.
[0185] FIG. 31 is a histogram showing that chimeric and a subset of
the humanized 9D9 antibodies bind equivalently to cells expressing
CD52. The X axis represents the fluorescence emitted by the bound
anti-CD52 antibody, while the area of each peak represents the
total cell population.
[0186] FIG. 32A shows the binding curves of Campath-1H.RTM.
("C1H"), a chimeric 2C3 antibody, and a humanized 2C3-SFD1/K12
antibody to primary human T cells and huCD52 transgenic mouse T
cells. FIG. 32B shows the binding curves of Campath-1H.RTM.
("C1H"), a chimeric 9D9 antibody, and humanized 9D9 antibodies to
primary human T cells and huCD52 transgenic mouse T cells. FIG. 32C
shows the binding curves of Campath-1H.RTM. ("C1H"), a chimeric
12G6 antibody, and humanized 12G6 antibodies to primary human T
cells and huCD52 transgenic mouse T cells.
[0187] FIG. 33 is a table showing the relative binding efficiency
of Campath-1H.RTM., chimeric 2C3 and 12G6 antibodies, and humanized
2C3 and 12G6 antibodies to huCD52 expressing human and transgenic
mouse T cells.
[0188] FIG. 34 illustrates the comparative binding patterns of
humanized anti-CD52 Campath-1H.RTM., 2C3, 12G6, and 9D9 antibodies
to defined subsets of human peripheral blood mononuclear cell
populations by flow cytometry. These histograms show that the
humanized anti-CD52 antibody binding is equivalent to that of
Campath-1H.RTM. for various CD52 expressing human PBMC subsets. The
X axis represents the fluorescence emitted by the bound anti-CD52
antibody, while the area of each peak represents the total cell
population.
[0189] FIG. 35 is a graph showing that chimeric and humanized 7F11
antibodies mediate equivalent ADCC activity on cells expressing
CD52.
[0190] FIG. 36 is a graph showing that chimeric and humanized 7F11
antibodies mediate CDC activity on cells expressing CD52.
[0191] FIG. 37 is a graph showing that chimeric and humanized 2C3
antibodies mediate ADCC activity on cells expressing CD52.
[0192] FIG. 38 is a graph showing that chimeric and humanized 2C3
antibodies mediate CDC activity on cells expressing CD52.
[0193] FIG. 39 is a graph showing that chimeric and humanized 12G6
antibodies mediate ADCC activity on cells expressing CD52.
[0194] FIG. 40 is a graph showing that chimeric and humanized 12G6
antibodies mediate CDC activity on cells expressing CD52.
[0195] FIG. 41 is a graph showing that chimeric and humanized 9D9
antibodies mediate ADCC activity on cells expressing CD52.
[0196] FIG. 42 is a graph showing that chimeric and humanized 9D9
antibodies mediate CDC activity on cells expressing CD52.
[0197] FIG. 43 is a graph showing the ADCC activity of humanized
anti-CD52 antibodies on primary T cells.
[0198] FIG. 44 is a graph showing the CDC activity of humanized
anti-CD52 antibodies on primary T cells.
[0199] FIG. 45 is a graph showing neutralization of Campath-1H.RTM.
but not other anti-CD52 antibodies with CAMMS223 study human serum
samples that contain anti-Campath-1H.RTM. neutralizing antibodies.
Serum samples were taken from a representative patient (MS-1) at
month 12 (M12) and month 13 (M13).
[0200] FIGS. 46A-46E show the level of CD4+ T cells, CD8+ T cells,
B220+ B cells, NK cells, myeloid cells, and neutrophils in the
blood 72 hours after dosing with Campath-1H.RTM. ("Campath") and
humanized 4B10-H1/K1 ("4B10") antibodies.
[0201] FIGS. 47A-47E show the level of CD4+ T cells, CD8+ T cells,
B220+ B cells, NK cells, myeloid cells, neutrophils, and
macrophages in the spleen 72 hours after dosing with
Campath-1H.RTM. ("Campath") and humanized 4B10-H1/K1 ("4B10")
antibodies.
[0202] FIGS. 48A-48E show the levels of circulating cytokines 2
hours after dosing with Campath-1H.RTM. ("Campath") and humanized
4B10-H1/K1 ("4B10") antibodies.
[0203] FIGS. 49A and 49B show the repopulation of circulating
lymphocytes over a time course after dosing with Campath-1H.RTM.
("Campath") and humanized 4B10-H1/K1 ("4B10") antibodies,
(mg/kg).
[0204] FIGS. 50A-50E show the level of CD4+ T cells, CD8+ T cells,
B220+ B cells, NK cells, myeloid cells, and neutrophils in the
blood 72 hours after dosing with the humanized 7F11-SFD1/K2 ("7F11
SFD1") and 7F11-SFD2/K2 ("7F11 SFD2") antibodies.
[0205] FIGS. 51A-51E show the level of CD4+ T cells, CD8+ T cells,
B220+ B cells, NK cells, myeloid cells, and neutrophils in the
spleen 72 hours after dosing with the humanized 7F11-SFD1/K2 ("7F11
SFD1") and 7F11-SFD2/K2 ("7F11 SFD2") antibodies.
[0206] FIGS. 52A-52F show the levels of circulating cytokines 2
hours after dosing with the humanized 7F11-SFD1/K2 ("7F11 SFD1")
and 7F11-SFD2/K2 ("7F11 SFD2") antibodies.
[0207] FIGS. 53A and 53B show the repopulation of circulating
lymphocytes over a timecourse after dosing with the humanized
7F11-SFD1/K2 ("7F11 SFD1") and 7F11-SFD2/K2 ("7F11 SFD2")
antibodies, (mg/kg).
[0208] FIGS. 54A and 54B show the level of CD4+ T cells, CD8+ T
cells and B220+ B cells in the blood 72 hours after dosing with
Campath-1H.RTM. ("Campath"), 7F11-chimeric antibodies, and
humanized 7F11-SFD1/K2 and 7F11-SFD2/K2 antibodies.
[0209] FIG. 55 shows the level of Campath-1H.RTM. ("Campath"),
7F11-chimeric antibody and humanized 7F11-SFD1/K2 and 7F11-SFD2/K2
antibodies in the blood over a timecourse after dosing.
[0210] FIGS. 56A-56E show the level of CD4+ T cells, CD8+ T cells,
B220+ B cells, NK cells, and neutrophils in the blood 72 hours
after dosing with 2C3-SFD1/K12 antibodies.
[0211] FIGS. 57A-57E show the level of CD4+ T cells, CD8+ T cells,
B220+ B cells, NK cells, and neutrophils in the spleen 72 hours
after dosing with 2C3-SFD1/K12 antibodies.
[0212] FIGS. 58A-58F show the levels of circulating cytokines 2
hours after dosing with 2C3-SFD1/K12 ("2C3") antibodies.
[0213] FIG. 59 shows the repopulation of circulating lymphocytes
over a timecourse after dosing with 2C3-SFD1/K12 antibodies,
(mg/kg).
[0214] FIGS. 60A-60E show the level of CD4+ T cells, CD8+ T cells,
B220+ B cells, NK cells, myeloid cells, macrophages, and
neutrophils in the blood 72 hours after dosing with 12G6-SFD1/K11
antibodies.
[0215] FIGS. 61A-61E show the level of CD4+ T cells, CD8+ T cells,
B220+ B cells, NK cells, macrophages, neutrophils, and myeloid
cells in the spleen 72 hours after dosing with 12G6-SFD1/K11
antibodies.
[0216] FIGS. 62A-62F show the levels of circulating cytokines 2
hours after dosing with 12G6-SFD1/K11 ("12G6 hu") antibodies.
[0217] FIG. 63 shows the repopulation of circulating lymphocytes
over a timecourse after dosing with 12G6-SFD1/K11 antibodies,
(mg/kg).
[0218] FIGS. 64A-64C show the level of 2C3-chimeric, 2C3-SFD1/K12,
12G6-chimeric, 12G6-SFD1/K11, 9D9-chimeric, and 9D9-H10/K12
antibodies in the blood over a timecourse after dosing.
[0219] FIGS. 65A-65E show the level of CD4+ T cells, CD8+ T cells,
B220+ B cells, NK cells, myeloid cells, macrophages, and
neutrophils in the blood 72 hours after dosing with 9D9-H10/K12
("9D9") antibodies.
[0220] FIGS. 66A-66E show the level of CD4+ T cells, CD8+ T cells,
B220+ B cells, NK cells, myeloid cells, neutrophils, and
macrophages in the spleen 72 hours after dosing with 9D9-H10/K12
("9D9") antibodies.
[0221] FIGS. 67A-67F show the levels of circulating cytokines 2
hours after dosing with 9D9-H10/K12 ("9D9") antibodies.
[0222] FIG. 68 shows the repopulation of circulating lymphocytes
over a timecourse after dosing with 9D9-H10/K12 ("9D9") antibodies,
(mg/kg).
[0223] FIGS. 69A-69D show the level of bulk lymphocyte populations
(CD4+ T cells, CD8+ T cells, and B cells) and CD4+ T cell, CD8+ T
cell, B220+ B cell and NK cell subtypes in the blood 72 hours after
dosing with Campath-1H.RTM. ("Campath"), 2C3-SFD1/K12 ("2C3"),
12G6-SFD1/K11 ("12G6"), and 9D9-H10/K12 ("9D9") antibodies.
[0224] FIGS. 70A-70D show the level of bulk lymphocyte populations
(CD4+ T cells, CD8+ T cells, and B cells) and CD4+ T cell, CD8+ T
cell, B220+ B cell and NK cell subtypes in the spleen 72 hours
after dosing with Campath-1H.RTM. ("Campath"), 2C3-SFD1/K12
("2C3"), 12G6-SFD1/K11 ("12G6"), and 9D9-H10/K12 ("9D9")
antibodies.
[0225] FIGS. 71A-71F show the levels of circulating cytokines 2
hours after dosing with Campath-1H.RTM., 2C3-SFD1/K12,
12G6-SFD1/K11, and 9D9-H10/K12 antibodies.
[0226] FIG. 72 shows the level of CD4+ T cells, CD8+ T cells, B220+
B cells, and NK cells in the blood 72 hours after dosing with
9D9-H10/K12 and 9D9-H11/K12 antibodies.
[0227] FIG. 73 shows the level of CD4+ T cells, CD8+ T cells, B220+
B cells, and NK cells in the spleen 72 hours after dosing with
9D9-H10/K12 and 9D9-H11/K12 antibodies.
[0228] FIGS. 74A-74D show the level of CD4+ T cells, CD8+ T cells,
B220+ B cells, NK cells, and myeloid cells in the blood 72 hours
after dosing with 12G6-SFD1/K11 ("12G6 K11") and 12G6-SFD1/K12
("12G6 K12") antibodies.
[0229] FIGS. 75A-75D show the level of CD4+ T cells, CD8+ T cells,
B220+ B cells, NK cells and myeloid cells in the spleen 72 hours
after dosing with 12G6-SFD1/K11 ("12G6 K11") and 12G6-SFD1/K12
("12G6 K12") antibodies.
[0230] FIG. 76 shows the level of bulk lymphocyte populations (CD4+
T cells, CD8+ T cells, and B220+ B cells) in the blood 72 hours
after dosing with 9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13
antibodies.
[0231] FIGS. 77A-77D show the level of CD4+ T cell, CD8+ T cell,
B220+ B cell, NK cell, and myeloid cell subtypes in the blood 72
hours after dosing with 9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13
antibodies.
[0232] FIG. 78 shows the level of bulk lymphocyte populations (CD4+
T cells, CD8+ T cells, and B220+ B cells) in the spleen 72 hours
after dosing with 9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13
antibodies.
[0233] FIGS. 79A-79D show the level of CD4+ T cell, CD8+ T cell,
B220+ B cell, NK cell, and myeloid cell subtypes in the spleen 72
hours after dosing with 9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13
antibodies.
[0234] FIGS. 80A-80F show the levels of circulating cytokines 2
hours after dosing with 9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13
antibodies.
[0235] FIGS. 81A and 81B show the level of 2C3-SFD1/K12,
12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13 and 9D9-H18/K13
antibodies in the blood over a timecourse after dosing.
[0236] FIGS. 82A-82F show the level of cytokines in the blood over
a 48-hour timecourse following dosing with Campath-1H.RTM.
("Campath"), 2C3-SFD1/K11, 12G6-SFD1/K11, 12G6-SFD1/K12,
9D9-H16/K13 or 9D9-H18/K13 antibodies.
[0237] FIGS. 83A-83E show the level of bulk lymphocytes, CD4+ T
cells, CD8+ T cells, B220+ B cells, NK cells, and myeloid cells in
the spleen 72 hours after dosing with Campath-1H.RTM. ("Campath"),
2C3-SFD1/K11, 12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13 or
9D9-H18/K13 antibodies.
[0238] FIGS. 84A-84G show the repopulation of circulating CD4+ and
CD8+ T cells, regulatory T cells, B cells, NK cells, neutrophils
and macrophages over a timecourse after dosing with Campath-1H.RTM.
("Campath"), 2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12
antibodies.
[0239] FIG. 85 shows the ability of FITC-labeled Campath-1H.RTM.
("Campath"), 2C3-SFD1/K12 ("2C3 K12"), 12G6-SFD1/K11 ("12G6 K11"),
12G6-SFD1/K12 ("12G6 K12"), 9D9-H16/K13 ("9D9 H16"), and
9D9-H18/K13 ("9D9 H18") antibodies to specifically bind huCD52
lymphocyte cell populations in the spleen.
[0240] FIGS. 86A-86E show the level of bulk lymphocyte populations
(CD4+ T cells, CD8+ T cells, and B220+ B cells) and CD4+ T cell,
CD8+ T cell, B220+ B cell, NK cell, and myeloid cell subtypes in
the blood 72 hours after dosing with Campath-1H.RTM. ("Campath"),
2C3-SFD1/K12, 12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13, and
9D9-H18/K13 antibodies.
[0241] FIGS. 87A-87E show the level of bulk lymphocyte populations
(CD4+ T cells, CD8+ T cells, and B220+ B cells) and CD4+ T cell,
CD8+ T cell, B220+ B cell, NK cell, and myeloid cell subtypes in
the spleen 72 hours after dosing with Campath-1H.RTM. ("Campath"),
2C3-SFD1/K12, 12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13, and
9D9-H18/K13 antibodies.
[0242] FIGS. 88A-88F show the levels of circulating cytokines 2
hours after dosing with Campath-1H.RTM. ("Campath"), 2C3-SFD1/K12,
12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13, and 9D9-H18/K13
antibodies.
[0243] FIGS. 89A-89D show the level of CD4+ T cell, CD8+ T cell,
B220+ B cell, and NK/myeloid cell subtypes in the blood 72 hours
after dosing with Campath-1H.RTM. ("Campath"), 2C3-SFD1/K12,
9D9-H16/K13 and 12G6-SFD1/K12 antibodies.
[0244] FIGS. 90A-90D show the level of CD4+ T cell, CD8+ T cell,
B220+ B cell, and NK/myeloid cell subtypes in the spleen 72 hours
after dosing with Campath-1H.RTM. ("Campath"), 2C3-SFD1/K12,
9D9-H16/K13 and 12G6-SFD1/K12 antibodies.
[0245] FIGS. 91A-91D show the level of CD4+ T cell, CD8+ T cell,
B220+ B cell, and NK/myeloid cell subtypes in the lymph node 72
hours after dosing with Campath-1H.RTM. ("Campath"), 2C3-SFD1/K12,
9D9-H16/K13 and 12G6-SFD1/K12 antibodies.
[0246] FIG. 92A shows the huCD52 expression level on CD4+ T cell,
CD8+ T cell, B220+ B cell, and NK/myeloid cell subtypes in
huCD52-KI/O and non-transgenic control mice. FIG. 92B shows the
huCD52 expression level on CD4+ T cells, CD8+ T cells, and B cells
in huCD52-KI/O and huCD52 CD1 transgenic mice.
[0247] FIG. 93 shows the binding to huCD52 of 12G6-SFD1/K12 and
2C3-SFD1/K12 antibodies from various production sources ("small
scale" and "large scale") as compared to a Campath-1H.RTM.
control.
[0248] FIG. 94 shows the level of bulk lymphocyte populations (CD4+
T cells, CD8+ T cells, B220+ B cells and NK cells) in the blood 72
hours after dosing with 12G6-SFD1/K12 and 2C3-SFD1/K12 antibodies
from various production sources ("small scale" and "large
scale").
[0249] FIG. 95 shows the levels of 2C3-SFD1/K12, 9D9-H16/K13 and
12G6-SFD1/K12 antibodies in the blood over a timecourse after
dosing.
[0250] FIG. 96 demonstrates the EAE clinical score of 2C3-SFD1/K12
and 12G6-SFD1/K12 over a timecourse of disease progression.
[0251] FIGS. 97A and 97B demonstrate the ability of Campath1H.RTM.
("Campath"), 2C3-SFD1/K12 ("2C3"), His435Ala 2C3-SFD1/K12 ("H435A
2C3") and His310Ala/His435Gln 2C3-SFD1/K12 ("H310A/H435Q 2C3") to
bind to mouse and human FcRn molecules.
[0252] FIG. 98 shows the in vivo clearance of 2C3-SFD1/K12 ("2C3
unmodified"), 2C3-SFD1/K12-Modified 1 ("2C3-Fc mutant 1") and
2C3-SFD1/K12-Modified 2 ("2C3-Fc mutant 2") in nontransgenic
mice.
[0253] FIG. 99 shows the in vivo clearance of 2C3-SFD1/K12 ("2C3"),
2C3-SFD1/K12-Modified 1 ("2C3-Fc mutant 1") and
2C3-SFD1/K12-Modified 2 ("2C3-Fc mutant 2") in huCD52 transgenic
mice.
[0254] FIGS. 100A and 100B show the level of bulk lymphocyte
populations (CD4+ T cells, CD8+ T cells, B220+ B cells, and NK
cells) in the blood and spleen 72 hours after dosing with
2C3-SFD1/K12 ("2C3"), 2C3-SFD1/K12-Modified 1 ("2C3 Fc mutant-1"),
and 2C3-SFD1/K12-Modified 2 ("2C3 Fc mutant-2") antibodies.
[0255] FIGS. 101A and 101B are representative sensorgrams of
Biacore T100 assays to determine the epitope specificity of the
humanized 12G6-SFD1/K12 antibody and mutant peptides generated by
alanine scanning. FIG. 101A shows no binding between 12G6-SFD1/K12
and the MUT 8 peptide, while FIG. 101B shows binding between
12G6-SFD1/K12 and the MUT 9 peptide.
[0256] FIG. 102 shows the TCR V beta analysis for donor BMS486.
CD4+ T cells educated with Campath-1H.RTM. peptide group 986-989
exhibited preferential expansion of a single V beta (V.beta.3).
[0257] FIG. 103 shows the TCR V beta analysis for donor BMS928.
CD4+ T cells educated with 12G6-SFD1/K12 peptide groups 1066-67-68
and 1083-84-85 exhibited preferential expansion of a single V beta
(V.beta.20).
[0258] FIGS. 104A-104J show the Campath-1H.RTM. immunogenicity
assessment. Proliferative responses are shown in CPM for individual
donors A-J. The X axis depicts the groups of peptides used to
stimulate autologous CD4+ T cells three times. Each group of T
cells was assayed in triplicate with autologous DCs pulsed with the
educating antigen/peptide group (specific response, left bar,
white), irrelevant DR binding peptide (middle bar, striped), or
media (right bar, black).
[0259] FIGS. 105A-105J show the 12G6-SFD1/K12 immunogenicity
assessment. Proliferative responses are shown in CPM for individual
donors A-J. The X axis depicts the groups of peptides used to
stimulate autologous CD4+ T cells three times. Each group of T
cells was assayed in triplicate with autologous DCs pulsed with the
educating peptide group (specific response, left bar, white),
irrelevant DR binding peptide (middle bar, striped), or media
(right bar, black). In groups assayed without the media control,
the left bar (white) represents DCs pulsed with the educating
peptide, and the right bar (striped) represents DCs pulsed with the
irrelevant peptide.
[0260] FIG. 106 shows the full-length humanized heavy chain amino
acid sequence of 2C3-SFD1 (SEQ ID NO: 272) and the full-length
humanized light chain amino acid sequence of 2C3-K12 (SEQ ID NO:
273). The signal sequences are boldfaced and italicized and the
CDRs are underlined.
[0261] FIG. 107 shows the full-length humanized heavy chain amino
acid sequence of 7F11-SFD1 (SEQ ID NO: 274) and the full-length
humanized light chain amino acid sequence of 7F11-K2 (SEQ ID NO:
275). The signal sequences are boldfaced and italicized and the
CDRs are underlined.
[0262] FIG. 108 shows the full-length humanized heavy chain amino
acid sequences of 9D9-H16 (SEQ ID NO: 276) and 9D9-H18 (SEQ ID NO:
277), and the full-length humanized light chain amino acid sequence
of 9D9-K13 (SEQ ID NO: 278). The signal sequences are boldfaced and
italicized and the CDRs are underlined.
[0263] FIG. 109 shows the full-length humanized heavy chain amino
acid sequence of 12G6-SFD1 (SEQ ID NO: 279) and the full-length
humanized light chain amino acid sequence of 12G6-K12 (SEQ ID NO:
280). The signal sequences are boldfaced and italicized and the
CDRs are underlined.
[0264] FIG. 110 shows the full-length humanized heavy chain amino
acid sequence of 4B10-H1 (SEQ ID NO: 281) and the full-length
humanized light chain amino acid sequence of 4B10-K1 (SEQ ID NO:
282). The signal sequences are boldfaced and italicized and the
CDRs are underlined.
[0265] FIG. 111 shows the full-length humanized heavy chain nucleic
acid sequence of 2C3-SFD1 (SEQ ID NO: 283) and the full-length
humanized light chain nucleic acid sequence of 2C3-K12 (SEQ ID NO:
284). The signal sequences are underlined, the variable domains are
in boldface, and the constant regions are italicized.
[0266] FIG. 112 shows the full-length humanized heavy chain nucleic
acid sequence of 7F11-SFD1 (SEQ ID NO: 285) and the full-length
humanized light chain nucleic acid sequence of 7F11-K2 (SEQ ID NO:
286). The signal sequences are underlined, the variable domains are
in boldface, and the constant regions are italicized.
[0267] FIG. 113 shows the full-length humanized heavy chain nucleic
acid sequences of 9D9-H16 (SEQ ID NO: 287) and 9D9-H18 (SEQ ID NO:
288). The signal sequences are underlined, the variable domains are
in boldface, and the constant regions are italicized.
[0268] FIG. 114 shows the full-length humanized light chain nucleic
acid sequence of 9D9-K13 (SEQ ID NO: 289). The signal sequence is
underlined, the variable domain is in boldface, and the constant
region is italicized.
[0269] FIG. 115 shows the full-length humanized heavy chain nucleic
acid sequence of 12G6-SFD1 (SEQ ID NO: 290) and the full-length
humanized light chain nucleic acid sequence of 12G6-K12 (SEQ ID NO:
291). The signal sequences are underlined, the variable domains are
in boldface, and the constant regions are italicized.
[0270] FIG. 116 shows the full-length humanized heavy chain nucleic
acid sequence of 4B10-H1 (SEQ ID NO: 292) and the full-length
humanized light chain nucleic acid sequence of 4B10-K1 (SEQ ID NO:
293). The signal sequences are underlined, the variable domains are
in boldface, and the constant regions are italicized.
DETAILED DESCRIPTION OF THE INVENTION
[0271] CD52 is a glycosylated, GPI anchored cell surface abundant
protein (approximately 5.times.10.sup.5 antibody binding sites per
cell) present on at least 95% of all human peripheral blood
lymphocytes and monocytes/macrophages (Hale G, et al., "The
CAMPATH-1 antigen (CD52)," Tissue Antigens, 35:178-327 (1990)), but
is absent from hematopoietic stem cells. This invention is directed
to immunoglobulins (anti-CD52) which have binding specificity
(e.g., epitopic specificity) for, or are selective for binding to,
human CD52 or a portion thereof. These immunoglobulins bind
specifically to a CD52, and do not bind specifically to non-CD52
molecules. Specific binding between an anti-CD52 immunoglobulin and
CD52 can be determined, for example, by measuring EC.sub.50 of the
immunoglobulin's binding to CD52+ cells by flow cytometry. Specific
binding can be indicated by an EC.sub.50 range of, e.g., 0.5-10
.mu.g/ml. The immunoglobulins described herein can have binding
specificity for all or a portion of a human CD52 wherein the human
CD52 is an isolated and/or recombinant human CD52, or on the
surface of a cell which expresses human CD52. In addition, the
immunoglobulins can have binding specificity for one or more forms
of human CD52 (e.g., glycosylated human CD52; de-glycosylated human
CD52; non-glycosylated human CD52; and allelic variants). In one
embodiment, the immunoglobulins have binding specificity for a
naturally occurring, endogenous or wildtype human CD52. The amino
acid sequence of a wildtype human CD52 is set out in FIG. 4 (SEQ ID
NO: 104).
[0272] The immunoglobulins described herein can be purified or
isolated using known techniques Immunoglobulins that are "purified"
or "isolated" have been separated away from molecules (e.g.,
peptides) of their source of origin (e.g., the supernatant of
cells; in a mixture such as in a mixture of immunoglobulins in a
library), and include immunoglobulins obtained by methods described
herein or other suitable methods. Isolated immunoglobulins include
substantially pure (essentially pure) immunoglobulins, and
immunoglobulins produced by chemical synthesis, recombinant
techniques and a combination thereof.
[0273] More specifically, the invention relates to anti-human CD52
immunoglobulins, antigen-binding fragments (i.e., portions) of the
immunoglobulins, the light chains of the immunoglobulins, the heavy
chains of the immunoglobulins, and fragments of these light chains
or heavy chains. The invention also relates to mature
immunoglobulins or chains thereof, such as glycosylated
immunoglobulins. The invention also relates to immature or
precursor immunoglobulin (protein). The invention also relates to
nucleic acid molecules (e.g., vectors) that encode both these
immature or mature proteins, to vectors and host cells that
comprise such nucleic acid, to methods of producing immature and
mature proteins and to methods of using the immunoglobulins.
[0274] The immunoglobulins of this invention can be used to treat a
subject in need thereof (e.g., a human patient) to deplete the
subject's lymphocytes and other CD52+ cells (e.g., CD52+ cancerous
cells) as needed. As used herein, "lymphocyte depletion" is a type
of immunosuppression by reducing the population of circulating
lymphocytes, e.g., T cells and/or B cells, resulting in
lymphopenia. The immunoglobulins of this invention can also be used
to inhibit angiogenesis as further described below. The
immunoglobulins of this invention also can be used to enrich
hematopoietic stem cells, for example, in ex vivo applications
(see, e.g., Lim et al., J. Hematology & Oncology 1:19
(2008)).
[0275] Naturally occurring immunoglobulins have a common core
structure in which two identical light chains (about 24 kD) and two
identical heavy chains (about 55 or 70 kD) form a tetramer. The
amino-terminal portion of each chain is known as the variable (V)
region and can be distinguished from the more conserved constant
(C) regions of the remainder of each chain. Within the variable
region of the light chain (also called the V.sub.L domain) is a
C-terminal portion known as the J region. Within the variable
region of the heavy chain (also called the V.sub.H domain), there
is a D region in addition to the J region. Most of the amino acid
sequence variation in immunoglobulins is confined to three separate
locations in the V regions known as hypervariable regions or
complementarity determining regions (CDRs) which are directly
involved in antigen binding. Proceeding from the amino-terminus,
these regions are designated CDR1, CDR2 and CDR3, respectively. The
CDRs are held in place by more conserved framework regions (FRs).
Proceeding from the amino-terminus, these regions are designated
FR1, FR2, FR3 and FR4, respectively. The locations of CDR and FR
regions and a numbering system have been defined by Kabat et al.
(Kabat, E. A., et al., Sequences of Proteins of Immunological
Interest, Fifth Edition, U.S. Department of Health and Human
Services, U.S. Government Printing Office (1991), Chothia &
Lesk, Canonical Structures for the Hypervariable Regions of
Immunoglobulins, J. Mol. Biol., 196, 901-917 (1987), and the
IMGT.RTM. numbering system (The International ImMunoGeneTics
Information System.RTM., Lefranc, M.-P., The Immunologist 7,
132-136 (1999). Visual inspection and sequence analysis can be
carried out to identify the CDR boundaries. For this invention, the
CDR sequences are defined by using both the Kabat system and the
IMGT system; that is, when the CDRs defined by the two systems do
not entirely overlap, we include all the residues from the
sequences defined by both systems.
[0276] Human immunoglobulins can be divided into classes and
subclasses, depending on the isotype of the heavy chain. The
classes include IgG, IgM, IgA, IgD and IgE, in which the heavy
chains are of the gamma (.gamma.), mu (.mu.), alpha (.alpha.),
delta (.delta.) or epsilon (.epsilon.) type, respectively.
Subclasses include IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2, in which
the heavy chains are of the .gamma.1, .gamma.2, .gamma.3, .gamma.4,
.alpha.1 and .alpha.2 type, respectively. Human immunoglobulin
molecules of a selected class or subclass may contain either a
kappa (.kappa.) or lambda (.lamda.) light chain. See e.g., Cellular
and Molecular Immunology, Wonsiewicz, M. J., Ed., Chapter 45, pp.
41-50, W. B. Saunders Co., Philadelphia, Pa. 91991); Nisonoff, A.,
Introduction to Molecular Immunology, 2.sup.nd Ed., Chapter 4, pp.
45-65, Sinauer Associates, Inc., Sunderland, Mass. (1984).
[0277] As used herein, the terms "immunoglobulin" and "antibody,"
which are used interchangeably, refer to whole antibodies and
antigen-binding fragments (i.e., "antigen-binding portions"--the
two terms are used interchangeably herein unless otherwise
indicated). Antigen-binding fragments of antibodies can be in the
format of, for example, single chain antibodies, Fv fragments, Fab
fragments, Fab' fragments, F(ab').sub.2 fragments, Fd fragments,
single chain Fv molecules (scFv), bispecific single chain Fv dimers
(PCT/US92/09665), diabodies, domain-deleted antibodies and single
domain antibodies (dAbs). See e.g., Nature Biotechnology
22(9):1161-1165 (2004)). Also within the invention are
antigen-binding molecules comprising a VH and/or a VL. In the case
of a VH, the molecule may also comprise one or more of a CH1 hinge,
CH2 and CH3 region. Such single chain antibodies are also intended
to be encompassed within the term "antigen-binding portion" of an
antibody.
[0278] Antibody portion or fragments can be produced by enzymatic
cleavage or by recombinant techniques. For instance, papain or
pepsin cleavage can be used to generate Fab or F(ab').sub.2
fragments, respectively. Antibodies can also be produced in a
variety of truncated forms using antibody genes in which one or
more stop codons have been introduced upstream of the natural stop
site. For example, a recombinant construct encoding the heavy chain
of an F(ab').sub.2 fragment can be designed to include DNA
sequences encoding the CH.sub.1 domain and hinge region of the
heavy chain. Preferred antigen-binding fragments have binding
specificity for a wildtype human CD52.
[0279] In another aspect, the invention provides a variant of an
antibody or portion thereof as described herein, wherein said
variant binds to human CD52 specifically but differs from the
reference antibody or portion thereof by 1, 2, 3, 4, 5, 6, 7, 8, 9
or 10 amino acid substitutions (for example, in a CDR region, a FR
region, or a constant domain). For example, the variant antibody is
at least 90%, at least 91%, at least 93%, at least 95%, at least
97% or at least 99% identical to the reference antibody in the
heavy chain, the heavy chain variable domain, the light chain, or
the light chain variable domain.
[0280] Sequence similarity or identity for polypeptides, which is
also referred to as sequence identity, is typically measured using
sequence analysis software. Protein analysis software matches
similar sequences using measures of similarity assigned to various
substitutions, deletions and other modifications, including
conservative amino acid substitutions. For instance, GCG contains
programs such as "Gap" and "Bestfit" which can be used with default
parameters to determine sequence homology or sequence identity
between closely related polypeptides, such as homologous
polypeptides from different species of organisms or between a wild
type protein and a mutein thereof. See, e.g., GCG Version 6.1.
Polypeptide sequences also can be compared using FASTA using
default or recommended parameters, a program in GCG Version 6.1.
FASTA (e.g., FASTA2 and FASTA3) provides alignments and percent
sequence identity of the regions of the best overlap between the
query and search sequences (Pearson, Methods Enzymol. 183:63-98
(1990); Pearson, Methods Mol. Biol. 132:185-219 (2000)). Another
preferred algorithm when comparing a sequence of the invention to a
database containing a large number of sequences from different
organisms is the computer program BLAST, especially blastp or
tblastn, using default parameters. See, e.g., Altschul et al., J.
Mol. Biol. 215:403-410 (1990); Altschul et al., Nucleic Acids Res.
25:3389-402 (1997); herein incorporated by reference.
[0281] According to the invention, one type of amino acid
substitution that may be made is to change one or more cysteines in
the antibody, which may be chemically reactive, to another residue,
such as, without limitation, alanine or serine. In one embodiment,
there is a substitution of a non-canonical cysteine. The
substitution can be made in a CDR or framework region of a variable
domain or in the constant domain of an antibody. In some
embodiments, the cysteine is canonical. Another type of amino acid
substitution that may be made is to remove potential proteolytic
sites in the antibody. Such sites may occur in a CDR or framework
region of a variable domain or in the constant domain of an
antibody. Substitution of cysteine residues and removal of
proteolytic sites may decrease the risk of heterogeneity in the
antibody product and thus increase its homogeneity. Another type of
amino acid substitution is to eliminate asparagine-glycine pairs,
which form potential deamidation sites, by altering one or both of
the residues. In another aspect of the invention, the antibody may
be deimmunized to reduce its immunogenicity using the techniques
described in, e.g., PCT Publication WO98/52976 and WO00/34317.
[0282] Another type of amino acid substitution that may be made in
one of the variants according to the invention is a conservative
amino acid substitution. A "conservative amino acid substitution"
is one in which an amino acid residue is substituted by another
amino acid residue having a side chain R group) with similar
chemical properties (e.g., charge or hydrophobicity). In general, a
conservative amino acid substitution will not substantially change
the functional properties of a protein. In cases where two or more
amino acid sequences differ from each other by conservative
substitutions, the percent sequence identity or degree of
similarity may be adjusted upwards to correct for the conservative
nature of the substitution. Means for making this adjustment are
well-known to those of skill in the art. See e.g., Pearson, Methods
Mol. Biol. 243:307-31 (1994).
[0283] Examples of groups of amino acids that have side chains with
similar chemical properties include 1) aliphatic side chains:
glycine, alanine, valine, leucine, and isoleucine; 2)
aliphatic-hydroxyl side chains: serine and threonine; 3)
amide-containing side chains: asparagine and glutamine; 4) aromatic
side chains: phenylalanine, tyrosine, and tryptophan; 5) basic side
chains: lysine, arginine, and histidine; 6) acidic side chains:
aspartic acid and glutamic acid; and 7) sulfur-containing side
chains: cysteine and methionine. Preferred conservative amino acids
substitution groups are: valine-leucine-isoleucine,
phenylalanine-tyrosine, lysine-arginine, alanine-valine,
glutamate-aspartate, and asparagine-glutamine. Alternatively, a
conservative replacement is any change having a positive value in
the PAM250 log-likelihood matrix disclosed in Gonnet et al.,
Science 256:1443-45 (1992). A "moderately conservative" replacement
is any change having a nonnegative value in the PAM250
log-likelihood matrix.
[0284] In certain embodiments, amino acid substitutions to an
antibody or antigen-binding portion of the invention are those
which: (1) reduce susceptibility to proteolysis, (2) reduce
susceptibility to oxidation, (3) alter binding affinity for forming
protein complexes, for example, to enhance ADCC and CDC activity of
the antibody, (4) confer or modify other physicochemical or
functional properties of such analogs, but still retain specific
binding to human CD52, (5) remove C-terminal lysine, and (6) add or
remove glycosylation sites.
[0285] In an aspect, the invention provides a new and novel
polypeptide that is the heavy or light chain of an antibody of this
invention, or that is a variable domain-containing portion of the
heavy or light chain. Such a polypeptide is useful because it can
partner with an opposite (light or heavy) antibody chain to form a
CD52-binding molecule.
Humanized Immunoglobulins
[0286] Described herein are humanized immunoglobulins comprising
the CDRs of novel mouse anti-human CD52 antibodies. In one
embodiment, the humanized immunoglobulin comprises a humanized
light chain and a humanized heavy chain that have CDR amino acid
sequences which differ from the amino acid sequence of other
humanized versions of anti-CD52 antibodies (e.g.,
Campath.RTM.).
[0287] The term "humanized immunoglobulin" as used herein refers to
an immunoglobulin comprising chains that comprise one or more light
chain CDRs (CDR1, CDR2 and CDR3) and one or more heavy chain CDRs
(CDR1, CDR2 and CDR3) of an anti-CD52 antibody of nonhuman origin,
also referred to herein as the donor antibody (e.g., a murine
anti-CD52 antibody), and at least a portion of an immunoglobulin of
human origin (e.g., framework regions, or framework and constant
regions, derived from a light and/or heavy chain of human origin,
such as CDR-grafted antibodies with or without framework changes).
The humanized immunoglobulin of the invention comprises at least
one CDR that differs from at least one CDR (e.g., from the
corresponding CDR) present in Campath.RTM.. See, e.g., Cabilly et
al., U.S. Pat. No. 4,816,567; Cabilly et al., European Patent No.
0,125,023 B1; Boss et al., U.S. Pat. No. 4,816,397; Boss et al.,
European Patent No. 0,120,694 B1; Neuberger, M. S. et al., WO
86/01533; Neuberger, M. S. et al., European Patent No. 0,194,276
B1; Winter, U.S. Pat. No. 5,225,539; Winter, European Patent No.
0,239,400 B1; Padlan, E. A. et al., European Patent Application No.
0,519,596 A1. See also, Ladner et al., U.S. Pat. No. 4,946,778;
Huston, U.S. Pat. No. 5,476,786; and Bird, R. E. et al., Science,
242: 423-426 (1988)), regarding single chain antibodies. In some
embodiments, humanized immunoglobulins are de-immunized antibodies.
See, e.g., Carr et al., U.S. Pat. No. 7,264,806, regarding
de-immunized immunoglobulins that have been modified to reduce the
number of potential T-cell epitopes, thereby reducing the
propensity for the immunoglobulin to elicit an immune response upon
administration to a human.
[0288] In particular embodiments, the humanized immunoglobulin
comprises one or more light chain CDRs and one or more heavy chain
CDRs of one or more of the following murine monoclonal antibodies:
mouse 8G3.25.3.5, mouse 4G7.F3, mouse 9D9.A2, mouse 11C11.C5, mouse
3G7.E9, mouse 5F7.1.1.4, mouse 12G6.15.1.2, mouse 23E6.2.2.1, mouse
2C3.3.8.1, mouse 7F11.1.9.7, and mouse 4B10.1.2.4.
[0289] In another embodiment, the humanized immunoglobulins bind
human CD52 with an affinity similar to or better than that of
Campath.RTM.. In a particular embodiment, the humanized
immunoglobulin of the present invention has the binding specificity
of a murine anti-human CD52 antibody of the invention (e.g., having
specificity for human CD52, having the same or similar epitopic
specificity) and/or it has the same inhibitory function. The
humanized immunoglobulins can have the binding specificity and/or
inhibitory activity of a murine anti-human CD52 antibody or
humanized anti-human CD52 antibody described herein, and/or the
epitopic specificity of a murine anti-human CD52 antibody or
humanized anti-human CD52 antibody described herein (e.g., it can
compete with the murine anti-human CD52 antibody, or another
humanized anti-CD52 antibody (e.g., Campath.RTM.) for binding to
CD52, and/or it can have the inhibitory function of the murine or
humanized anti-human CD52 antibody). In a particular embodiment,
the humanized immunoglobulin has the binding specificity, epitopic
specificity and/or inhibitory activity of any one of mouse
antibodies 8G3, 4G7, 9D9, 11C11, 3G7, 5F7, 12G6, 23E6, 2C3, 7F11,
and 4B10.
[0290] The portion of the humanized immunoglobulin or
immunoglobulin chain which is of human origin (e.g., framework
region; constant region) can be derived from any suitable human
immunoglobulin or immunoglobulin chain. For example, a human
constant region or portion thereof in a humanized or chimeric
antibody can be derived from a human .kappa. or .lamda. light chain
gene, and/or from a human .gamma. (e.g., .gamma.1, .gamma.2,
.gamma.3, .gamma.4), .mu., .alpha. (e.g., .alpha.1, .alpha.2),
.delta. or .epsilon. heavy chain gene, including allelic variants.
A particular constant region (e.g., IgG1), variant or portion
thereof can be selected in order to tailor effector function. For
example, a mutated constant region (variant) can be incorporated
into the immunoglobulin or immunoglobulin chain so as to minimize
binding to Fc receptors and/or ability to fix complement. (See
e.g., Winter et al., GB 2,209,757 B; Morrison et al., WO 89/07142;
Morgan et al., WO 94/29351, Dec. 22, 1994). In one embodiment, the
human framework has no variation or mutation in its structure or
sequence. In a particular embodiment, the framework is a germline
framework sequence that has no mutations or variations in its
sequence.
[0291] As used herein, the term "germline" refers to the nucleotide
sequences and amino acid sequences of the antibody genes and gene
segments as they are passed from parents to offspring via the germ
cells. This germline sequence is distinguished from the nucleotide
sequences encoding antibodies in mature B cells which have been
altered by recombination and hypermutation events during the course
of B cell maturation. An antibody that "utilizes" a particular
germline has a nucleotide or amino acid sequence that most closely
aligns with that germline nucleotide sequence or with the amino
acid sequence that it specifies. Such antibodies frequently are
mutated compared with the germline sequence.
[0292] In other embodiments, the human framework has minimal
variation or mutation from germline sequence in its structure or
sequence (e.g., less than 3, 4, 5, 6, 7, 8, 9, or 10 acceptor
framework residues have been replaced with donor framework residues
to improve binding affinity, see Queen et al., U.S. Pat. No.
5,530,101). In a particular embodiment, a limited number of amino
acids in the framework of a humanized immunoglobulin chain (e.g.,
1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids) are chosen to be the
same as the amino acids at those positions in the donor sequence
(i.e., "back-mutated"), rather than in the acceptor sequence, to
increase the affinity of an antibody comprising the humanized
immunoglobulin chain for human CD52.
[0293] Human framework regions (e.g., of the heavy and/or light
chain variable regions) are preferably obtained or derived from a
human antibody variable region having sequence similarity to the
analogous or equivalent region (e.g., heavy or light chain variable
regions) of the antigen-binding region of the donor immunoglobulin
(murine anti-CD52 antibody). Other sources of framework regions for
portions of human origin of a humanized immunoglobulin include
human variable region consensus sequences (See e.g., Kettleborough,
C. A. et al., Protein Engineering 4:773-783 (1991); Carter et al.,
WO 94/04679; Carter U.S. Pat. No. 6,407,213)). For example, the
region of the donor sequence of the antibody (e.g., the sequence of
the variable region) used to obtain the nonhuman portion can be
compared to human sequences as described in Kabat, E. A. et al.
Sequences of Proteins of Immunological Interest, Fifth Edition,
U.S. Department of Health and Human Services, U.S. Government
Printing Office (1991) to select a particular source of the human
portions of the humanized immunoglobulin, e.g., a source of the
framework regions.
[0294] In one embodiment, the framework regions of the humanized
immunoglobulin chains are obtained, or derived, from a human Ig
variable region having at least about 50%, at least about 55%, at
least about 60%, at least about 65%, at least about 70%, at least
about 75%, at least about 80%, at least about 85%, at least about
90% or at least about 95% overall sequence identity, with the
variable region of the nonhuman donor. In a particular embodiment,
the framework regions of the humanized immunoglobulin chains are
obtained or derived from human variable region framework regions
having at least about 50%, at least about 55%, at least about 60%,
at least about 65%, at least about 70%, at least about 75%, at
least about 80%, at least about 85%, at least about 90%, or at
least about 95% overall sequence identity, with the framework
regions of the variable region of the nonhuman donor
immunoglobulin.
[0295] In one embodiment, at least one of the framework regions
(FR) of the humanized immunoglobulin is obtained or derived from
one or more chains of an antibody of human origin. Thus, the FR can
include a FR1 and/or FR2 and/or FR3 and/or FR4 obtained or derived
from one or more antibodies of human origin (e.g., from a human
immunoglobulin chain, from a human consensus sequence).
[0296] The immunoglobulin portions for use in the present invention
have sequences identical, or similar, to immunoglobulins from which
they are derived or to variants thereof. Such variants include
mutants differing by the addition, deletion or substitution (e.g.,
conservative substitution) of one or more residues, e.g., differing
by up to 3, 4, 5, 6, 7, 8, 9, or 10 residues from the parental
sequence by one or more additions, deletions or substitutions. As
indicated above, the humanized immunoglobulin of the invention
comprises one or more CDRs from one or more of the murine anti-CD52
antibodies (donor antibodies) described herein. Changes in the
framework region, such as those which substitute a residue of the
framework region of human origin with a residue from the
corresponding position of the donor antibody, can be made. One or
more mutations, including deletions, insertions and substitutions
of one or more amino acids in the framework region, can be made. If
desired, framework mutations can be included in a humanized
antibody or chain, and sites for mutation can be selected using any
suitable method, for example as described in WO 98/06248, the
entire teachings of which are incorporated by reference.
[0297] It will be appreciated by one of skill in the art that in
some cases residues flanking the one or more CDRs of the murine
anti-CD52 antibody(ies) may contribute, and in some cases, may be
essential, either directly or indirectly, to function (e.g.,
binding). Thus, in some embodiments, one or more amino acids
flanking one or more CDRs (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10
flanking amino acids) of the murine framework are also included in
the humanized immunoglobulin.
[0298] In some embodiments, the human heavy chain framework regions
of the humanized antibodies of this invention utilize the human
VH3-72 or VH3-23 germline sequence. In some embodiments, the human
light chain framework regions of the humanized antibodies of this
invention utilize the human Vk2-A18b germline sequence. Back
mutations may optionally be made in these FR regions at one or more
of the residues as described in the Working Examples below to
improve CD52-binding affinity of the humanized antibody.
[0299] "Affinity" is a term of art that describes the strength of a
binding interaction and typically refers to the overall strength of
binding of the immunoglobulin to human CD52.
[0300] In a particular embodiment, the immunoglobulin has a binding
activity measured as an EC.sub.50 value of less than 10 .mu.g/ml
(e.g., as determined by flow cytometry). In another embodiment, the
immunoglobulin has a binding activity measured as an EC.sub.50
value of less than 5.0 .mu.g/ml, or less than 1.0 .mu.g/ml (e.g.,
as determined by flow cytometry).
[0301] In some embodiments, the immunoglobulin binds to human CD52
with an affinity (K.sub.D; K.sub.D=K.sub.off (kd)/Kon (ka)) of 300
nM to 1 pM (i.e., 3.times.10.sup.-7 to 1.times.10.sup.-12M),
preferably 50 nM to 1 pM, more preferably 5 nM to 1 pM and most
preferably 1 nM to 1 pM, for example, a K.sub.D of
1.times.10.sup.-7 M or less, preferably 1.times.10.sup.-8 M or
less, more preferably 1.times.10.sup.-9 M or less, advantageously
1.times.10.sup.-10 M or less and most preferably 1.times.10.sup.-11
M or 1.times.10.sup.-12 or less; and/or a K.sub.off rate constant
of 5.times.10.sup.-1 s-1 to 1.times.10.sup.-7 s-1, preferably
1.times.10.sup.-2 s-1 to 1.times.10.sup.-6 s-1, more preferably
5.times.10.sup.-3 s-1 to 1.times.10.sup.-5 s-1, for example
5.times.10.sup.-1 s-1 or less, preferably 1.times.10.sup.-2 s-1 or
less, advantageously 1.times.10.sup.-3 s-1 or less, more preferably
1.times.10.sup.-4 s-1 or less, still more preferably
1.times.10.sup.-5 s-1 or less, and most preferably
1.times.10.sup.-6 s-1 or less as determined by surface plasmon
resonance.
[0302] As is apparent to one of skill in the art, a variety of
methods can be used to confirm that immunoglobulins produced
according to methods provided herein and known in the art have the
requisite specificity (e.g., binding specificity, epitopic
specificity). For example, the binding function of a humanized
anti-CD52 immunoglobulin of the invention having binding
specificity for human CD52 can be detected using any suitable
method, e.g., assays which monitor formation of a complex between
humanized immunoglobulin and human CD52 (e.g., a membrane fraction
comprising human CD52; a cell bearing human CD52, such as a human T
cell, a human B cell; a CHO cell or a recombinant host cell
comprising and expressing a nucleic acid encoding human CD52; a
peptide (e.g., a synthetic peptide) having an amino acid sequence
of CD52; a solid support comprising human CD52).
[0303] The ability of an immunoglobulin of the invention (e.g., a
humanized immunoglobulin of the invention) to bind to the same
epitope on human CD52 as a particular murine, chimeric, or
humanized monoclonal antibody, or to bind to an epitope on human
CD52 which overlaps with the epitope on human CD52 to which a
particular murine, chimeric, or humanized monoclonal antibody
binds, can be readily determined using a variety of techniques
known to those of skill in the art, including e.g., competitive
binding assays. These may involve the use of a labeled form of said
particular antibody, and a measurement of the binding of that
labeled antibody to human CD52 in the presence and in the absence
of an immunoglobulin of the invention.
[0304] An "epitope" as used herein includes any protein determinant
capable of specific binding to an immunoglobulin. Epitopic
determinants generally consist of chemically active surface
groupings of molecules such as amino acids or carbohydrate or sugar
side chains and generally have specific three dimensional
structural characteristics, as well as specific charge
characteristics. An epitope may be "linear" or "conformational." In
a linear epitope, all of the points of interaction between the
protein and the interacting molecule (such as an antibody) occur
linearly along the primary amino acid sequence of the protein. In a
conformational epitope, the points of interaction occur across
amino acid residues on the protein that are separated from one
another. Once a desired epitope on an antigen is determined, it is
possible to generate antibodies to that epitope, e.g., using the
techniques described in the present invention. Alternatively,
during the discovery process, the generation and characterization
of antibodies may elucidate information about desirable epitopes.
From this information, it is then possible to competitively screen
antibodies for binding to the same epitope. An approach to achieve
this is to conduct competition studies to find antibodies that
competitively bind with one another, i.e., the antibodies compete
for binding to the antigen.
[0305] In one embodiment, to determine if a test antibody binds to
the same or overlapping epitope of a humanized antibody of this
invention, one allows the anti-CD52 antibody of the invention to
bind to CD52 under saturating conditions and then measures the
ability of the test antibody to bind to CD52. If the test antibody
is able to bind to CD52 at the same time as the reference anti-CD52
antibody, then the test antibody binds to a different epitope than
the reference anti-CD52 antibody. However, if the test antibody is
not able to bind to CD52 at the same time, then the test antibody
binds to the same epitope, an overlapping epitope, or an epitope
that is in close proximity to the epitope bound by the anti-CD52
antibody of the invention. This experiment can be performed using
ELISA, RIA, BIACORE.TM., or flow cytometry. To test whether an
anti-CD52 antibody cross-competes with another anti-CD52 antibody,
one may use the competition method described above in two
directions, i.e., determining if the reference antibody blocks the
test antibody and vice versa. In a some embodiment, the experiment
is performed using BIACORE.TM..
[0306] Epitope binning can also be useful to characterize the
antibodies of this invention. The term "binning" refers to a method
to group antibodies based on their antigen binding characteristics.
A high throughput process for "binning" antibodies based upon their
cross-competition is described in International Patent Application
No. WO 03/48731. The "epitope binning" can be investigated by
allowing an unlabeled form of an anti-CD52 antibody "A" to bind to
a synthetic peptide corresponding to the sequence of CD52 or to
CD52 positive cells. Subsequently a labeled second anti-CD52
antibody "B" is added and one can assess the amount of labeled
antibody that can bind relative to a control sample where the cells
or synthetic peptide have not been exposed previously to anti-CD52
antibody "A." Alternatively, anti-CD52 antibodies "A" and "B" can
both be labeled with different flourochromes or chemicals enabling
detection, and one can measure the quantities of both labeled
antibodies that can engage the CD52 peptide at the same time using
a device capable of detecting the label or measure the amounts of
both antibodies that simultaneously engage CD52 positive cells by
flow cytometry. Biacore and Octet technologies enable one to
investigate the competitive binding of unlabelled forms of
antibodies. This use of unlabelled forms of antibodies is desired
as the chemical modification of some antibodies can compromise the
binding activity. See also the technology described in See also Jia
et al., J. Immunol. Methods 288:91-98 (2004), which is useful in
performing epitope binning as well.
[0307] Also provided herein are portions of the humanized
immunoglobulins such as light chains, heavy chains and portions of
light and heavy chains. These immunoglobulin portions can be
obtained or derived from immunoglobulins (e.g., by reduction and/or
cleavage), or produced or expressed by nucleic acids encoding a
portion of an immunoglobulin or chain thereof having the desired
property (e.g., binds human CD52, sequence similarity). They can be
prepared by e.g., de novo synthesis of the relevant portion.
Humanized immunoglobulins comprising the desired portions (e.g.,
antigen-binding region, CDR, FR, C region) of human and nonhuman
origin can be produced using synthetic and/or recombinant nucleic
acids to prepare constructs (e.g., cDNA) encoding the desired
humanized chain. For example, to prepare a portion of an
immunoglobulin (e.g., a portion of a chain), one or more stop
codons can be introduced at the desired position. Nucleic acid
(e.g., DNA) sequences coding for humanized variable regions can be
constructed using PCR mutagenesis methods to alter existing DNA
sequences (see e.g., Kamman, M., et al., Nucl. Acids Res. 17:5404
(1989)). PCR primers coding for the new CDRs can be hybridized to a
DNA template of a previously humanized variable region which is
based on the same, or a very similar, human variable region (Sato,
K., et al., Cancer Research 53:851-856 (1993)). If a similar DNA
sequence is not available for use as a template, a nucleic acid
comprising a sequence encoding a variable region sequence can be
constructed from synthetic oligonucleotides (see e.g., Kolbinger,
F., Protein Engineering 8:971-980 (1993)). A sequence encoding a
signal peptide can also be incorporated into the nucleic acid
(e.g., on synthesis, upon insertion into a vector). If a signal
peptide sequence is unavailable (e.g., not typically present), a
signal peptide sequence from another antibody can be used (see,
e.g., Kettleborough, C. A., Protein Engineering 4:773-783 (1991)).
Using these methods, methods described herein or other suitable
methods, variants can readily be produced.
[0308] The invention relates to a humanized immunoglobulin that has
binding specificity for human CD52 and comprises a humanized light
chain and a humanized heavy chain and/or portions thereof. In one
embodiment, the humanized immunoglobulin comprises a light chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 3
and a heavy chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 16; a light chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 4 and a heavy chain comprising
one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 17; a light
chain comprising one or more CDRs (e.g., all three CDRs) of SEQ ID
NO: 5 and a heavy chain comprising one or more CDRs (e.g., all
three CDRs) of SEQ ID NO: 18; a light chain comprising one or more
CDRs (e.g., all three CDRs) of SEQ ID NO: 6 and a heavy chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO:
19; a light chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 7 and a heavy chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 20; a light chain comprising
one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 8 and a heavy
chain comprising one or more CDRs (e.g., all three CDRs) of SEQ ID
NO: 21; a light chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 9 and a heavy chain comprising one or more CDRs
(e.g., all three CDRs) of SEQ ID NO: 22; a light chain comprising
one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 10 and a
heavy chain comprising one or more CDRs (e.g., all three CDRs) of
SEQ ID NO: 23; a light chain comprising one or more CDRs (e.g., all
three CDRs) of SEQ ID NO: 11 and a heavy chain comprising one or
more CDRs (e.g., all three CDRs) of SEQ ID NO: 24; a light chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 12
and a heavy chain comprising one or more CDRs (e.g., all three
CDRs) of SEQ ID NO: 25; or a light chain comprising one or more
CDRs (e.g., all three CDRs) of SEQ ID NO: 13 and a heavy chain
sequence comprising one or more CDRs (e.g., all three CDRs) of SEQ
ID NO: 26.
[0309] In one embodiment, a humanized immunoglobulin of the
invention comprises heavy chain (H)-CDR1, H-CDR2, H-CDR3, light
chain (L)-CDR1, L-CDR2, and L-CDR3 whose amino acid sequences are:
a) SEQ ID NOs: 51, 59, 69, 29, 36, and 43, respectively; b) SEQ ID
NOs: 50, 60, 69, 29, 37, and 43, respectively; c) SEQ ID NOs: 50,
61, 68, 29, 38, and 43, respectively; d) SEQ ID NOs: 50, 61, 69,
29, 36, and 43, respectively; e) SEQ ID NOs: 50, 62, 69, 29, 39,
and 43, respectively; f) SEQ ID NOs: 52, 61, 70, 30, 40, and 43,
respectively; g) SEQ ID NOs: 53, 63, 71, 31, 36, and 44,
respectively; h) SEQ ID NOs: 54, 64, 71, 31, 36, and 45,
respectively; i) SEQ ID NOs: 55, 63, 72, 31, 36, and 46,
respectively; j) SEQ ID NOs: 56, 65, 73, 32, 41, and 47,
respectively; k) SEQ ID NOs: 56, 65, 294, 32, 41, and 47; or l) SEQ
ID NOs: 56, 66, 74, 33, 41, and 48, respectively.
[0310] In another embodiment, a humanized immunoglobulin of this
invention comprises H-CDR3 and L-CDR3 whose sequences are a) SEQ ID
NOs: 69 and 43, respectively; b) SEQ ID NOs: 68 and 43,
respectively; c) SEQ ID NOs: 70 and 43, respectively; d) SEQ ID
NOs: 71 and 44, respectively; e) SEQ ID NOs: 71 and 45,
respectively; f) SEQ ID NOs: 72 and 46, respectively; g) SEQ ID
NOs: 73 and 47, respectively; h) SEQ ID NOs: 294 and 47,
respectively; or i) SEQ ID NOs: 74 and 48, respectively.
[0311] In another embodiment, the humanized immunoglobulin has
binding specificity for human CD52 and comprises a light chain
comprising one or more CDRs selected from the group consisting of
SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID
NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35,
SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID
NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44,
SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48, or
a combination thereof; and a heavy chain comprising one or more
CDRs selected from the group consisting of SEQ ID NO: 49, SEQ ID
NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54,
SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID
NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63,
SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID
NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72,
SEQ ID NO: 73, SEQ ID NO: 74, and SEQ ID NO: 294, or a combination
thereof, wherein the humanized immunoglobulin is not
Campath.RTM..
[0312] In another embodiment, the humanized immunoglobulin that has
a binding specificity for human CD52 comprises a light chain
comprising one or more CDRs (e.g., all three CDRs) of SEQ ID NO: 3,
SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO:
8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ
ID NO: 13, and a heavy chain comprising one or more CDRs (e.g., all
three CDRs) of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID
NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23,
SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 137,
wherein the humanized immunoglobulin is not Campath.RTM..
[0313] The invention also relates to a humanized immunoglobulin
light chain of the humanized immunoglobulin described herein. In
one embodiment, the humanized immunoglobulin light chain comprises
one or more CDRs selected from the group consisting of SEQ ID NO:
27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ
ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO:
36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ
ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO:
45, SEQ ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48, and a
combination thereof, wherein the humanized immunoglobulin light
chain is not the light chain of Campath.RTM.. For example, the
humanized antibody has L-CDR1, L-CDR2, and L-CDR3 whose amino acid
sequences are: a) SEQ ID NOs: 29, 36, and 43, respectively; b) SEQ
ID NOs: 29, 37, and 43, respectively; c) SEQ ID NOs: 29, 38, and
43, respectively; d) SEQ ID NOs: 29, 36, and 43, respectively; e)
SEQ ID NOs: 29, 39, and 43, respectively; f) SEQ ID NOs: 30, 40,
and 43, respectively; g) SEQ ID NOs: 31, 36, and 44, respectively;
h) SEQ ID NOs: 31, 36, and 45, respectively; i) SEQ ID NOs: 31, 36,
and 46, respectively; j) SEQ ID NOs: 32, 41, and 47, respectively;
or k) SEQ ID NOs: 33, 41, and 48, respectively.
[0314] The invention also relates to humanized heavy chain
comprising one or more CDRs selected from the group consisting of
SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID
NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57,
SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID
NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66,
SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID
NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, and SEQ ID NO:
294, or a combination thereof, wherein the humanized immunoglobulin
heavy chain is not the heavy chain of Campath.RTM.. For example,
the humanized antibody has H-CDR1, H-CDR2, and H-CDR3 whose amino
acid sequences are: a) SEQ ID NOs: 51, 59, and 69, respectively; b)
SEQ ID NOs: 50, 60, and 69, respectively; c) SEQ ID NOs: 50, 61,
and 68, respectively; d) SEQ ID NOs: 50, 61, and 69, respectively;
e) SEQ ID NOs: 50, 62, and 69, respectively; f) SEQ ID NOs: 52, 61,
and 70, respectively; g) SEQ ID NOs: 53, 63, and 71, respectively;
h) SEQ ID NOs: 54, 64, and 71, respectively; i) SEQ ID NOs: 55, 63,
and 72, respectively; j) SEQ ID NOs: 56, 65, and 73, respectively;
k) SEQ ID NOs: 56, 65, and 294; or 1) SEQ ID NOs: 56, 66, and 74,
respectively.
[0315] In one embodiment, a humanized antibody of this invention
comprises a light chain comprising a variable domain (V.sub.L)
sequence of one of SEQ ID NOs: 102, 138, 145-148, 153-157, and
164-168. In a related embodiment, the humanized antibody comprises
a light chain whose amino acid sequence comprises or consists of
one of SEQ ID NOs: 273, 275, 278, 280, and 282.
[0316] In one embodiment, a humanized antibody of this invention
comprises a heavy chain comprising a variable domain (V.sub.H)
sequence of one of SEQ ID NOs: 103, 136, 137, 139-144, 149-152, and
158-163. In a related embodiment, the humanized antibody comprises
a heavy chain whose amino acid sequence comprises or consists of
one of SEQ ID NOs: 272, 274, 276, 277, 279, and 281.
[0317] In some embodiments, a humanized antibody of this invention
comprises a V.sub.H and a V.sub.L whose amino acid sequences
comprise or consist of [0318] a) SEQ ID NOs: 103 and 102,
respectively (4B10-H1/K1); [0319] b) SEQ ID NOs: 136 and 138,
respectively (7F11-SFD1/K2); [0320] c) SEQ ID NOs: 137 and 138,
respectively (7F11-SFD2/K2) [0321] d) SEQ ID NO: 139 and one of SEQ
ID NOs: 145-148, respectively (e.g., SEQ ID NOs: 139 and 146,
respectively (2C3-SFD1/K11); and SEQ ID NOs: 139 and 147,
respectively (2C3-SFD1/K12)); [0322] e) SEQ ID NO: 140 and one of
SEQ ID NOs: 145-148, respectively; [0323] f) SEQ ID NO: 141 and one
of SEQ ID NOs: 145-148, respectively; [0324] g) SEQ ID NO: 142 and
one of SEQ ID NOs: 145-148, respectively; [0325] h) SEQ ID NO: 143
and one of SEQ ID NOs: 145-148, respectively; [0326] i) SEQ ID NO:
144 and one of SEQ ID NOs: 145-148, respectively; [0327] j) SEQ ID
NO: 149 and one of SEQ ID NOs: 153-157, respectively (e.g., SEQ ID
NOs: 149 and 155, respectively (12G6-SFD1/K11); SEQ ID NOs: 149 and
156, respectively (12G6-SFD1/K12); and SEQ ID NOs: 149 and 157,
respectively (12G6-SFD1/K13)); [0328] k) SEQ ID NO: 150 and one of
SEQ ID NOs: 153-157, respectively; [0329] l) SEQ ID NO: 151 and one
of SEQ ID NOs: 153-157, respectively; [0330] m) SEQ ID NO: 152 and
one of SEQ ID NOs: 153-157, respectively; [0331] n) SEQ ID NO: 158
and one of SEQ ID NOs: 164-168, respectively (e.g., SEQ ID NOs: 158
and 165, respectively (9D9-H10/K12); and SEQ ID NOs: 158 and 166,
respectively (9D9-H10/K13)); [0332] o) SEQ ID NO: 159 and one of
SEQ ID NOs: 164-168, respectively (e.g., SEQ ID NOs: 159 and 165,
respectively (9D9-H11/K12); and SEQ ID NOs: 159 and 166,
respectively (9D9-H11/K13)); [0333] p) SEQ ID NO: 160 and one of
SEQ ID NOs: 164-168, respectively; [0334] q) SEQ ID NO: 161 and one
of SEQ ID NOs: 164-168, respectively (e.g., SEQ ID NOs: 161 and
166, respectively (9D9-H16/K13)); [0335] r) SEQ ID NO: 162 and one
of SEQ ID NOs: 164-168, respectively; or [0336] s) SEQ ID NO: 163
and one of SEQ ID NOs: 164-168, respectively (e.g., SEQ ID NOs: 163
and 166, respectively (9D9-H18/K13)). The antibodies included in
the parentheses are further described below in the working
examples.
[0337] In one embodiment, a humanized antibody of this invention
comprises a light chain (LC) and a heavy chain (HC) whose amino
acid sequences comprise or consist of a) SEQ ID NOs: 273 and 272,
respectively; b) SEQ ID NOs: 275 and 274, respectively; c) SEQ ID
NOs: 278 and 276, respectively; d) SEQ ID NOs: 278 and 277,
respectively; e) SEQ ID NOs: 280 and 279, respectively; or f) SEQ
ID NOs: 282 and 281, respectively.
[0338] This invention also provides anti-human CD52 antibodies
(except those, in any, known in the prior art) that binds to the
same epitope as, or competes or cross-competes with, an antibody
exemplified herein. These antibodies can be, for example,
humanized, chimeric, or mouse antibodies. For example, the
invention provides anti-human CD52 antibodies that bind to the same
epitope as, or competes or cross-competes with, one of mouse
antibodies 8G3, 4F7, 9D9, 11C11, 3G7, 5F7, 12G6, 23E6, 2C3, 7F11,
and 4B10, and humanized and chimeric versions of these mouse
antibodies. The ability of an antibody to bind to the same epitope
as, or competes or cross-competes with a reference antibody can be
determined as described above. For example, we have found that the
CD52 epitope bound by the humanized antibodies 2C3-SFD1/K12 and
12G6-SFD1/K12 includes residues 7, 8, and 11 in SEQ ID NO: 104, and
that the epitope bound by the humanized antibody 9D9-H16/K13
includes residues 4 and 11 in SEQ ID NO: 104. Thus, in some
embodiments, this invention provides anti-CD52 antibodies that bind
to the same epitope as, or competes or cross-competes with, those
humanized antibodies.
[0339] If desired, for example, for diagnostic or assay purposes
(e.g., imaging to allow, for example, monitoring of therapies), the
humanized immunoglobulin (e.g., antigen-binding fragment thereof)
can comprise a detectable label. Suitable detectable labels and
methods for labeling a humanized immunoglobulin or antigen-binding
fragment thereof are well known in the art. Suitable detectable
labels include, for example, a radioisotope (e.g., as Indium-111,
Technnetium-99m or Iodine-131), positron emitting labels (e.g.,
Fluorine-19), paramagnetic ions (e.g., Gadolinium (III), Manganese
(II)), an epitope label (tag), an affinity label (e.g., biotin,
avidin), a spin label, an enzyme, a fluorescent group or a
chemiluminescent group. When labels are not employed, complex
formation (e.g., between humanized immunoglobulin and human CD52)
can be determined by surface plasmon resonance, ELISA, FACS, or
other suitable methods.
[0340] Anti-CD52 antibodies used in the invention also may be
conjugated, via, for example, chemical reactions or genetic
modifications, to other moieties (e.g., pegylation moieties) that
improve the antibodies' pharmacokinetics such as half-life. In some
embodiments, the anti-CD52 antibodies used in this invention can be
linked to a suitable cytokine via, e.g., chemical conjugation or
genetic modifications (e.g., appending the coding sequence of the
cytokine in frame to an antibody coding sequence, thereby creating
an antibody:cytokine fusion protein).
[0341] The invention also relates to immunoconjugates in which the
humanized immunoglobulin (e.g., antigen-binding fragment thereof)
of the invention is coupled to another therapeutic agent, such as a
bioactive compound (e.g., cytokines, superantigens, cytotoxic
agents and toxins). For example, the humanized immunoglobulin that
has binding specificity for human CD52 (e.g., antigen binding
fragment thereof) can be coupled to a biological protein, a
molecule of plant or bacterial origin (or derivative thereof), an
interleukin-2 antibody or diphtheria toxin antibodies.
Mouse Monoclonal Immunoglobulins
[0342] As described herein, mouse monoclonal immunoglobulins having
binding specificity for human CD52 have been produced. Humanized
and chimeric antibodies of this invention can be derived from the
mouse monoclonal antibodies of this invention. That is, in some
embodiments, humanized and chimeric anti-CD52 antibodies of the
invention comprise sequences taken from a mouse monoclonal antibody
of the invention, such as one or more CDR sequences. A mouse
monoclonal immunoglobulin of this invention comprises a light chain
and a heavy chain that have CDR amino acid sequences which differ
from the CDR amino acid sequences of known mouse anti-CD52
monoclonal antibodies (e.g., from CF1D12).
[0343] As used herein, the term "mouse monoclonal immunoglobulin"
refers to an immunoglobulin containing light chain CDRs (L-CDR1,
L-CDR2 and L-CDR3) and heavy chain CDRs (H-CDR1, H-CDR2 and H-CDR3)
of a murine anti-human CD52 antibody, and framework and constant
regions of murine origin. Mouse monoclonal immunoglobulins are
homogeneous antibodies of a single specificity prepared, for
example, by the use of hybridoma technology or recombinant
methods.
[0344] The invention relates to the mouse monoclonal
immunoglobulins described herein, including antigen-binding
fragments (i.e., portions) of the mouse monoclonal immunoglobulins,
the light chains of the mouse monoclonal immunoglobulins, the heavy
chains of the mouse monoclonal immunoglobulins, and fragments of
these heavy and light chains. In a particular embodiment, the mouse
monoclonal antibody is the mouse 8G3.25.3.5 (also called GENZ
8G3.25.3.5 or 8G3), mouse GMA 4G7.F3 (also called 4G7.F3 or 4G7),
mouse GMA 9D9.A2 (also called 9D9.A2 or 9D9), mouse GMA 11C11.C5
(also called 11C11.C5 or 11C11), mouse GMA 3G7.E9 (also called
3G7.E9 or 3G7), mouse 5F7.1.1.4 (also called GENZ 5F7.1.1.4 or
5F7), mouse 12G6.15.1.2 (also called GENZ 12G6.15.1.2 or 2G6),
mouse 23E6.2.2.1 (also called GENZ 23E6.2.2.1 or 23E6), mouse
2C3.3.8.1 (also called GENZ 2C3.3.8.1 or 2C3), mouse 7F11.1.9.7
(also called GENZ 7F11.1.9.7 or 7F11), or mouse 4B10.1.2.4 (also
called GENZ 4B10.1.2.4 or 4B10). The invention relates to mature
mouse monoclonal immunoglobulin, such as the mouse monoclonal
immunoglobulin following processing to remove the heavy and light
chain signal peptides and/or to the glycosylated immunoglobulin.
The invention also relates to immature or precursor protein, such
as a mouse immunoglobulin light chain or a mouse immunoglobulin
heavy chain comprising a signal peptide. The invention also relates
to nucleic acid molecules (e.g., vectors) that encode these
immature or mature proteins, to host cells that comprise such
nucleic acids and to methods of producing these immature and mature
proteins.
[0345] The binding function of a mouse monoclonal immunoglobulin
having binding specificity for human CD52 can be detected using any
suitable method, for example using assays which monitor formation
of a complex between mouse monoclonal immunoglobulin and human CD52
(e.g., a membrane fraction comprising human CD52, or a cell bearing
human CD52, such as a human T cell, a human B cell, CHO cell or a
recombinant host cell comprising a nucleic acid encoding human
CD52; a peptide (e.g., a synthetic peptide) having an amino acid
sequence of CD52).
[0346] Also provided herein are portions of the murine
immunoglobulins which include light chains, heavy chains and
portions of light and heavy chains. These immunoglobulin portions
can be obtained or derived from immunoglobulins (e.g., by reduction
and/or cleavage), or nucleic acids encoding a portion of an
immunoglobulin or chain thereof having the desired property (e.g.,
binds human CD52, sequence similarity) can be produced and
expressed. They can be prepared by e.g., de novo synthesis of a
portion of mouse monoclonal immunoglobulins comprising the desired
portions (e.g., antigen-binding region, CDR, FR, and/or C region)
of murine origin can be produced using synthetic and/or recombinant
nucleic acids to prepare constructs (e.g., cDNA) encoding the
desired monoclonal immunoglobulin chain. To prepare a portion of a
chain, one or more stop codons can be introduced at the desired
position. A sequence encoding a signal peptide can also be
incorporated into the nucleic acid (e.g., on synthesis, upon
insertion into a vector). If the natural signal peptide sequence is
unavailable, a signal peptide sequence from another antibody can be
used (see, e.g., Kettleborough, C. A., Protein Engineering
4:773-783 (1991)). Using these methods, methods described herein or
other suitable methods, variants can be readily produced.
[0347] In one embodiment, a mouse monoclonal immunoglobulin of this
invention comprises a light chain comprising SEQ ID NO: 3 and a
heavy chain comprising SEQ ID NO: 16; a light chain comprising SEQ
ID NO: 4 and a heavy chain comprising SEQ ID NO: 17; a light chain
comprising SEQ ID NO: 5 and a heavy chain comprising SEQ ID NO: 18;
a light chain comprising SEQ ID NO: 6 and a heavy chain comprising
SEQ ID NO: 19; a light chain comprising SEQ ID NO: 7 and a heavy
chain comprising SEQ ID NO: 20; a light chain comprising SEQ ID NO:
8 and a heavy chain comprising SEQ ID NO: 21; a light chain
comprising SEQ ID NO: 9 and a heavy chain comprising SEQ ID NO: 22;
a light chain comprising SEQ ID NO: 10 and a heavy chain comprising
SEQ ID NO: 23; a light chain comprising SEQ ID NO: 11 and a heavy
chain comprising SEQ ID NO: 24; a light chain comprising SEQ ID NO:
12 and a heavy chain comprising SEQ ID NO: 25; or a light chain
comprising SEQ ID NO: 13 and a heavy chain comprising SEQ ID NO:
26.
[0348] In another embodiment, the invention also relates to a mouse
monoclonal antibody that has binding specificity for human CD52,
comprising a light chain variable region selected from the group
consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO:
6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID
NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13; and a heavy chain
variable region selected from the group consisting of SEQ ID NO:
16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ
ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23; SEQ ID NO: 24, SEQ ID NO:
25 and SEQ ID NO: 26.
[0349] If desired, for example, for diagnostic or assay purposes
(e.g., imaging), the mouse monoclonal immunoglobulin (e.g., antigen
binding fragment thereof) can comprise a detectable label. Suitable
detectable labels and methods for labeling a mouse monoclonal
immunoglobulin are well known in the art. Suitable detectable
labels include, for example, a radioisotope (e.g., as Indium-111,
Technnetium-99m or Iodine-131), positron emitting labels (e.g.,
Fluorine-19), paramagnetic ions (e.g., Gadlinium (III), Manganese
(II)), an epitope label (tag), an affinity label (e.g., biotin,
avidin), a spin label, an enzyme, a fluorescent group or a
chemiluminescent group. When labels are not employed, complex
formation (e.g., between mouse monoclonal immunoglobulin and CD52)
can be determined by surface plasmon resonance or other suitable
methods. All suitable methods and techniques described above for
humanized antibodies of this invention can also be used herein.
Chimeric Immunoglobulins
[0350] As described herein, chimeric immunoglobulins having binding
specificity for human CD52 have been produced. The chimeric
immunoglobulin comprises a chimeric light chain and/or a chimeric
heavy chain that have amino acid sequences which differ from the
amino acid sequence of known chimeric antibodies having binding
specificity for human CD52.
[0351] As used herein, the term "chimeric immunoglobulin" refers to
a recombinant protein that contains the variable domains including
the complementarity determining regions (CDRs) of an antibody
derived from one species, preferably a murine anti-human CD52
monoclonal antibody, while the constant domains of the antibody
molecule are derived from those of a different species, e.g., from
a human antibody.
[0352] The invention relates to the chimeric immunoglobulins
described herein, including antigen-binding fragments (i.e.,
portions) of the chimeric immunoglobulins, the chimeric light
chains and chimeric heavy chains of the chimeric immunoglobulins
and fragments of these chimeric light and heavy chains. The
invention relates to mature chimeric immunoglobulin, such as the
chimeric immunoglobulin following processing to remove the heavy
and light signal peptides and/or to the glycosylated
immunoglobulin. The invention also relates to immature or precursor
protein, such as a chimeric heavy chain comprising a signal
peptide. The invention also relates to nucleic acid molecules
(e.g., vectors) that encode these immature or mature proteins, to
host cells that comprise such nucleic acids and to methods of
producing these immature and mature proteins.
[0353] The binding function of a chimeric immunoglobulin having
binding specificity for human CD52 can be detected using any
suitable method, for example using assays which monitor formation
of a complex between chimeric immunoglobulin and human CD52 (e.g.,
a membrane fraction comprising human CD52, on a cell bearing human
CD52, such as a human T cell, a human B cell, CHO cell or a
recombinant host cell comprising a nucleic acid encoding human
CD52, a peptide (e.g., synthetic peptide) having an amino acid
sequence of CD52).
[0354] Also provided herein are portions of the chimeric
immunoglobulins which include light chains, heavy chains and
portions of light and heavy chains. These immunoglobulin portions
can be obtained or derived from immunoglobulins (e.g., by reduction
and/or cleavage), or nucleic acids encoding a portion of an
immunoglobulin or chain thereof having the desired property (e.g.,
binds human CD52, sequence similarity) can be produced and
expressed. They may be prepared by e.g., de novo synthesis of a
portion. Chimeric immunoglobulins comprising the desired portions
(e.g., antigen-binding region, CDR, FR, and/or C region) of human
and nonhuman origin can be produced using synthetic and/or
recombinant nucleic acids to prepare constructs (e.g., cDNA)
encoding the desired chimeric chain. To prepare a portion of a
chain, one or more stop codons can be introduced at the desired
position. A sequence encoding a signal peptide can also be
incorporated into the nucleic acid (e.g., on synthesis, upon
insertion into a vector). If the natural signal peptide sequence is
unavailable (e.g., typically not present), a signal peptide
sequence from another antibody can be used (see, e.g.,
Kettleborough, C. A., Protein Engineering 4:773-783 (1991)). Using
these methods, methods described herein or other suitable methods,
variants can be readily produced.
[0355] In one embodiment, a chimeric immunoglobulin of this
invention comprises the light chain variable region of SEQ ID NO: 3
and the heavy chain variable region of SEQ ID NO: 16; the light
chain variable region of SEQ ID NO: 4 and the heavy chain variable
region of SEQ ID NO: 17; the light chain variable region of SEQ ID
NO: 5 and the heavy chain variable region of SEQ ID NO: 18; the
light chain variable region of SEQ ID NO: 6 and the heavy chain
variable region of SEQ ID NO: 19; the light chain variable region
of SEQ ID NO: 7 and the heavy chain variable region of SEQ ID NO:
20; the light chain variable region of SEQ ID NO: 8 and the heavy
chain variable region of SEQ ID NO: 21; the light chain variable
region of SEQ ID NO: 9 and the heavy chain variable region of SEQ
ID NO: 22; the light chain variable region of SEQ ID NO: 10 and the
heavy chain variable region of SEQ ID NO: 23; the light chain
variable region of SEQ ID NO: 11 and the heavy chain variable
region of SEQ ID NO: 24; the light chain variable region of SEQ ID
NO: 12 and the heavy chain variable region of SEQ ID NO: 25; or the
light chain variable region of SEQ ID NO: 13 and the heavy chain
variable region of SEQ ID NO: 26.
[0356] The invention also relates to a chimeric antibody that has
binding specificity for human CD52, comprising a light chain
variable region sequence selected from the group consisting of: the
light chain variable region of SEQ ID NO: 3, the light chain
variable region of SEQ ID NO: 4, the light chain variable region of
SEQ ID NO: 5, the light chain variable region of SEQ ID NO: 6, the
light chain variable region of SEQ ID NO: 7, the light chain
variable region of SEQ ID NO: 8, the light chain variable region of
SEQ ID NO: 9, the light chain variable region of SEQ ID NO: 10, the
light chain variable region of SEQ ID NO: 11, the light chain
variable region of SEQ ID NO: 12 and the light chain variable
region of SEQ ID NO: 13, and a heavy chain variable region sequence
selected from the group consisting of: the heavy chain variable
region of SEQ ID NO: 16, the heavy chain variable region of SEQ ID
NO: 17, the heavy chain variable region of SEQ ID NO: 18, the heavy
chain variable region of SEQ ID NO: 19, the heavy chain variable
region of SEQ ID NO: 20, the heavy chain variable region of SEQ ID
NO: 21, the heavy chain variable region of SEQ ID NO: 22, the heavy
chain variable region of SEQ ID NO: 23, the heavy chain variable
region of SEQ ID NO: 24, the heavy chain variable region of SEQ ID
NO: 25 and the heavy chain variable region of SEQ ID NO: 26.
[0357] The invention also relates to a chimeric light chain
comprising the variable region of SEQ ID NO: 3, SEQ ID NO: 4, SEQ
ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9,
SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.
[0358] The invention also relates to a chimeric heavy chain
comprising the variable region of SEQ ID NO: 16, SEQ ID NO: 17, SEQ
ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO:
22, SEQ ID NO: 23; SEQ ID NO: 24, SEQ ID NO: 25 or SEQ ID NO:
26
[0359] If desired, for example, for diagnostic or assay purposes
(e.g., imaging), the chimeric immunoglobulin (e.g., antigen-binding
fragment thereof) can comprise a detectable label. Suitable
detectable labels and methods for labeling a chimeric
immunoglobulin are well known in the art. Suitable detectable
labels include, for example, a radioisotope (e.g., as Indium-111,
Technnetium-99m or Iodine-131), positron emitting labels (e.g.,
Fluorine-19), paramagnetic ions (e.g., Gadlinium (III), Manganese
(II)), an epitope label (tag), an affinity label (e.g., biotin,
avidin), a spin label, an enzyme, a fluorescent group or a
chemiluminescent group. When labels are not employed, complex
formation (e.g., between chimeric immunoglobulin and human CD52)
can be determined by surface plasmon resonance or other suitable
methods. All suitable methods and techniques described above for
humanized antibodies of this invention can also be used herein.
Nucleic Acids and Recombinant Vectors
[0360] The present invention also relates to isolated and/or
recombinant (including, e.g., essentially pure) nucleic acids
comprising sequences which encode a humanized immunoglobulin,
humanized light chain, humanized heavy chain, mouse monoclonal
immunoglobulin, mouse immunoglobulin light chain, mouse
immunoglobulin heavy chain, chimeric immunoglobulin, chimeric light
chain or chimeric heavy chain of the present invention.
[0361] Nucleic acids referred to herein as "isolated" or "purified"
are nucleic acids which have been separated away from the nucleic
acids of the genomic DNA or cellular RNA of their source of origin
(e.g., as they exist in cells or in a mixture of nucleic acids such
as a library), and include nucleic acids obtained by methods
described herein or other suitable methods, including essentially
pure nucleic acids, nucleic acids produced by chemical synthesis,
by combinations of biological and chemical methods, and recombinant
nucleic acids which are isolated (see e.g., Daugherty, B. L. et
al., Nucleic Acids Res., 19(9): 2471-2476 (1991); Lewis, A. P. and
J. S. Crowe, Gene, 101: 297-302 (1991)).
[0362] Nucleic acids referred to herein as "recombinant" are
nucleic acids which have been produced by recombinant DNA
methodology, including those nucleic acids that are generated by
procedures which rely upon a method of artificial recombination,
such as the polymerase chain reaction (PCR) and/or cloning into a
vector using restriction enzymes. "Recombinant" nucleic acids are
also those that result from recombination events that occur through
the natural mechanisms of cells, but are selected for after the
introduction to the cells of nucleic acids designed to allow and
make probable a desired recombination event.
[0363] The present invention also relates more specifically to
isolated and/or recombinant nucleic acids comprising a nucleotide
sequence which encodes a humanized immunoglobulin, mouse
immunoglobulin or chimeric immunoglobulin that has binding
specificity for human CD52 (e.g., a humanized immunoglobulin of the
present invention in which the nonhuman portion (e.g., the CDRs) is
derived from a murine anti-CD52 monoclonal antibody; a mouse
immunoglobulin of the present invention; or a chimeric
immunoglobulin of the present invention in which the nonhuman
portion (e.g., the V.sub.H and V.sub.L) is derived from a murine
anti-CD52 monoclonal antibody) or portion (e.g., antigen-binding
portion) thereof (e.g., heavy or light chain thereof).
[0364] Nucleic acids of the present invention can be used to
produce humanized immunoglobulins having binding specificity for
human CD52, mouse immunoglobulins having binding specificity for
human CD52 and chimeric immunoglobulins having binding specificity
for human CD52. For example, a nucleic acid (e.g., DNA (such as
cDNA), or RNA) or one or more nucleic acids encoding a humanized
immunoglobulin, mouse immunoglobulin or chimeric immunoglobulin of
the present invention can be incorporated into a suitable construct
(e.g., a recombinant vector) for further manipulation of sequences
or for production of the encoded immunoglobulins in suitable host
cells.
[0365] Constructs or vectors (e.g., expression vectors) suitable
for the expression of a humanized immunoglobulin having binding
specificity for human CD52, mouse immunoglobulin having binding
specificity for human CD52 or chimeric immunoglobulin having
binding specificity for human CD52 are also provided. A variety of
vectors are available, including vectors which are maintained in
single copy or multiple copies in a host cell, or which become
integrated into the host cell's chromosome(s). The constructs or
vectors can be introduced into a suitable host cell, and cells
which express a humanized immunoglobulin, mouse immunoglobulin or
chimeric immunoglobulin of the present invention, can be produced
and maintained in culture. A single vector or multiple vectors can
be used for the expression of a humanized immunoglobulin, mouse
immunoglobulin or chimeric immunoglobulin having binding
specificity for human CD52.
[0366] Suitable expression vectors, for example mammalian cell
expression vectors, can also contain a number of components,
including, but not limited to one or more of the following: an
origin of replication; a selectable marker gene; one or more
expression control elements, such as a transcriptional control
element (e.g., a promoter, an enhancer, a terminator), and/or one
or more translation signals; a signal sequence or leader sequence
for membrane targeting or secretion. In a construct or vector, a
signal peptide sequence can be provided by the construct or vector
or other source. For example, the transcriptional and/or
translational signals of an immunoglobulin can be used to direct
expression.
[0367] A promoter can be provided for expression in a suitable host
cell. Promoters can be constitutive or inducible. For example, a
promoter can be operably linked to a nucleic acid encoding a
humanized immunoglobulin or immunoglobulin chain, such that it
directs expression of the encoded polypeptide. A variety of
suitable promoters for prokaryotic (e.g., lac, tac, T3, T7
promoters for E. coli) and eukaryotic (e.g., yeast alcohol
dehydrogenase (ADH1), SV40, CMV) hosts are available. Those of
skill in the art will be able to select the appropriate promoter
for expressing an anti-CD52 antibody or portion thereof of the
invention.
[0368] In addition, the vectors (e.g., expression vectors)
typically comprise a selectable marker for selection of host cells
carrying the vector, and, in the case of a replicable vector, an
origin of replication. Genes encoding products which confer
antibiotic or drug resistance are common selectable markers and may
be used in prokaryotic (e.g., .beta.-lactamase gene (ampicillin
resistance), Tet gene (tetracycline resistance) and eukaryotic
cells (e.g., neomycin (G418 or geneticin), gpt (mycophenolic acid),
ampicillin, or hygromycin resistance genes). Dihydrofolate
reductase marker genes permit selection with methotrexate in a
variety of hosts. Genes encoding the gene product of auxotrophic
markers of the host (e.g., LEU2, URA3, HIS3) are often used as
selectable markers in yeast. Use of viral (e.g., baculovirus) or
phage vectors, and vectors which are capable of integrating into
the genome of the host cell, such as retroviral vectors, are also
contemplated.
[0369] The invention thus relates to isolated nucleic acid
molecules that encode the humanized immunoglobulin, humanized light
chain, humanized heavy chain, mouse immunoglobulin, mouse
immunoglobulin light chain, mouse immunoglobulin heavy chain,
chimeric immunoglobulin, chimeric light chain, or chimeric heavy
chain of this invention. The invention also relates to isolated
nucleic acid molecules that encode an antigen-binding portion of
the immunoglobulins and their chains. Polypeptide sequences encoded
by the nucleic acids of this invention are described above and in
the following Examples.
[0370] In some embodiments, a nucleic acid and vector of this
invention encodes a heavy chain (or an antigen-binding portion
thereof) or a light chain (or an antigen-binding portion thereof)
of this invention. A host cell containing both the heavy
chain-encoding nucleic acid and the light chain-encoding nucleic
acid can be used to make an antibody comprising the heavy and light
chain (or an antigen-binding portion of the antibody). The heavy
chain-encoding nucleic acid and the light chain-encoding nucleic
acid can be placed on separate expression vectors. They can also be
placed on a single expression vector under the same or different
expression control. See, e.g., Cabilly U.S. Pat. No. 6,331,415;
Fang U.S. Pat. No. 7,662,623.
Method of Producing Immunoglobulins Having Specificity for Human
CD52
[0371] Another aspect of the invention relates to a method of
making an anti-human CD52 antibody of this invention. The antibody
of this invention can be produced, for example, by the expression
of one or more recombinant nucleic acids encoding the antibody in a
suitable host cell. The host cell can be produced using any
suitable method. For example, the expression constructs (e.g., the
one or more vectors, e.g., a mammalian cell expression vector)
described herein can be introduced into a suitable host cell, and
the resulting cell can be maintained (e.g., in culture, in an
animal, in a plant) under conditions suitable for expression of the
construct(s) or vector(s). Suitable host cells can be prokaryotic,
including bacterial cells such as E. coli (e.g., strain
DHS.alpha..TM. (Invitrogen, Carlsbad, Calif.)), B. subtilis and/or
other suitable bacteria; eukaryotic cells, such as fungal or yeast
cells (e.g., Pichia pastoris, Aspergillus sp., Saccharomyces
cerevisiae, Schizosaccharomyces pombe, Neurospora crassa), or other
lower eukaryotic cells, and cells of higher eukaryotes such as
those from insects (e.g., Drosophila Schnieder S2 cells, Sf9 insect
cells (WO 94/26087 (O'Connor), TN5B1-4 (HIGH 5) insect cells
(Invitrogen), mammals (e.g., COS cells, such as COS-1 (ATCC
Accession No. CRL-1650) and COS-7 (ATCC Accession No. CRL-1651),
CHO (e.g., ATCC Accession No. CRL-9096), CHO DG44 (Urlaub, G. and
Chasin, L A., Proc. Natl. Acad. Sci. USA, 77(7):4216-4220 (1980)),
293 (ATCC Accession No. CRL-1573), HeLa (ATCC Accession No. CCL-2),
CV1 (ATCC Accession No. CCL-70), WOP (Dailey, L., et al., J.
Virol., 54:739-749 (1985)), 3T3, 293T (Pear, W. S., et al., Proc.
Natl. Acad. Sci. U.S.A., 90:8392-8396 (1993)), NSO cells, SP2/0
cells, HuT 78 cells and the like)), or plants (e.g., tobacco, lemna
(duckweed), and algae). (See, for example, Ausubel, F. M. et al.,
eds. Current Protocols in Molecular Biology, Greene Publishing
Associates and John Wiley & Sons Inc. (1993)). In some
embodiments, the host cell is not part of a multicellular organism
(e.g., plant or animal), e.g., it is an isolated host cell or is
part of a cell culture.
[0372] The present invention also relates to cells comprising a
nucleic acid, e.g., a vector, of the invention (e.g., an expression
vector). For example, a nucleic acid (i.e., one or more nucleic
acids) encoding the heavy and light chains of a humanized
immunoglobulin, the heavy and light chains of mouse immunoglobulin,
or the heavy and light chains of a chimeric immunoglobulin, said
immunoglobulin having binding specificity for human CD52, or a
construct (i.e., one or more constructs, e.g., one or more vectors)
comprising such nucleic acid(s), can be introduced into a suitable
host cell by a method appropriate to the host cell selected (e.g.,
transformation, transfection, electroporation, infection), with the
nucleic acid(s) being, or becoming, operably linked to one or more
expression control elements (e.g., in a vector, in a construct
created by processes in the cell, integrated into the host cell
genome). Host cells can be maintained under conditions suitable for
expression (e.g., in the presence of inducer, suitable media
supplemented with appropriate salts, growth factors, antibiotic,
nutritional supplements, etc.), whereby the encoded polypeptide(s)
are produced. If desired, the encoded protein (e.g., humanized
immunoglobulin, mouse immunoglobulin, chimeric immunoglobulin) can
be isolated, for example, from the host cells, culture medium, or
milk. This process encompasses expression in a host cell (e.g., a
mammary gland cell) of a transgenic animal or plant (e.g., tobacco)
(see e.g., WO 92/03918).
[0373] Fusion proteins can be produced in which an immunoglobulin
portion (e.g., a humanized immunoglobulin; immunoglobulin chain) is
linked to a non-immunoglobulin moiety (i.e., a moiety which does
not occur in immunoglobulins as found in nature) in an N-terminal
location, C-terminal location or internal to the fusion protein.
For example, some embodiments can be produced by the insertion of a
nucleic acid encoding an immunoglobulin sequence(s) into a suitable
expression vector, such as a pET vector (e.g., pET-15b, Novagen), a
phage vector (e.g., pCANTAB 5 E, Pharmacia), or other vector (e.g.,
pRIT2T Protein A fusion vector, Pharmacia). The resulting construct
can be introduced into a suitable host cell for expression. Upon
expression, some fusion proteins can be isolated or purified from a
cell lysate by means of a suitable affinity matrix (see, e.g.,
Current Protocols in Molecular Biology (Ausubel, F. M. et al.,
Eds., Vol. 2, Suppl. 26, pp. 16.4.1-16.7.8 (1991)).
[0374] The invention relates to a host cell that comprises
recombinant nucleic acid(s) encoding an immunoglobulin provided
herein (e.g., a humanized immunoglobulin, a humanized light chain
or a humanized heavy chain, a mouse immunoglobulin, a mouse light
chain or a mouse heavy chain, a chimeric immunoglobulin, a chimeric
heavy chain, or a chimeric light chain of the invention). The
invention also relates to a host cell that comprises recombinant
nucleic acid(s) encoding an antigen-binding portion of the
immunoglobulin or their chains. In some embodiments, the host cell
comprises a recombinant vector (e.g., expression vector, mammalian
cell expression vector) of the invention as referred to herein.
[0375] The invention also relates to a method of preparing an
immunoglobulin or an immunoglobulin polypeptide chain of this
invention. In one embodiment, the method comprises maintaining a
host cell of the invention as described herein (e.g., a host cell
that contains one or more isolated nucleic acids that encode the
immunoglobulin or polypeptide chain (e.g., a light chain and a
heavy chain, a light chain only, or a heavy chain only, of the
invention) under conditions appropriate for expression of the
immunoglobulin or polypeptide chain. For example a host cell can be
cultured on a substrate or in suspension. In some embodiments, the
method further comprises the step of purifying or isolating the
immunoglobulin or polypeptide chain.
[0376] The invention further relates to a method of preparing
immunoglobulins through phage display. For example, a naive
antibody phage display library on CD52 antigen can be panned.
Alternatively, a method of preparing immunoglobulins through guided
selection can be used (U.S. Patent Application Publication US
2006-0251658 A1.) A custom library built around, for example, a
fixed heavy chain (and/or light chain) CDR3 region of a known
anti-CD52 antibody can be created. The CDR1 and CDR2 regions of the
heavy and light chains can be derived from a naive repertoire
(Osburn et al., Methods, 36:61-68 (2005)). In one embodiment,
anti-CD52 ScFvs can be generated from ScFv naive antibody libraries
which are used to obtain mouse-human chimeric antibodies with the
desired binding properties. These libraries may be screened for
antibodies with the desired binding properties. ScFv phage
libraries may be used. For example, ScFvs which recognize human
CD52 can be isolated from scFv guided selection libraries following
a series of repeated selection cycles on recombinant human CD52
essentially as described in Vaughan et al. (1996). In brief,
following incubation with the library, the immobilized antigen,
which is pre-coupled to paramagnetic beads, and bound phage can be
recovered by magnetic separation while unbound phage is washed
away. Bound phage can then be rescued as described by Vaughan et
al. (1996) and the selection process repeated.
[0377] In a particular embodiment, a library is constructed
consisting of the entire variable domain of the heavy chain of a
mouse anti-CD52 antibody fused in a single chain format to a
repertoire of naive human light chain variable regions. After
selection the pool of human light chain variable regions that
complement the mouse heavy chain variable region are identified. A
library is then constructed consisting of the repertoire of human
light chain variable regions selected above fused in a single chain
format to a chimeric heavy chain variable region consisting of
naive human CDR1 and CDR2 regions and a fixed CDR3 region from the
mouse anti-CD52 antibody heavy chain variable domain. After
selection for CD52 binders, the best binding clones are selected.
Five of the 6 CDR regions can be human in origin while the CDR-3 of
the heavy chain variable region can be identical to the original
CDR3 of the mouse heavy chain variable domain.
[0378] Selections can be performed using CD52 coupled to DYNABEADS
M-270 amine (Dynal) according to the manufacturer's
recommendations. Alternatively, selections using biotinylated CD52
can be prepared using the primary amine specific reagent
succinimidyl-6-(biotinamido) hexanoate following the manufacturer's
instructions (EZ link NHS LC Biotin, Pierce).
[0379] Outputs from selections can be tested as periplasmic
preparations in high throughput screens based on competition assays
which measure the ability of the scFvs present in the periplasmic
preparation to compete for binding to CD52.
[0380] Samples that are able to compete in the high throughput
screens may be subjected to DNA sequencing as described in Vaughan
et al. (1996) and Osburn et al. (1996). Clones would then be
expressed and purified as scFvs or IgGs and assessed for their
ability to bind CD52, neutralize CD52 or a combination thereof,
e.g., using assays such as antibody-dependent cell mediated
cytotoxicity (ADCC) assay and complement dependent cytotoxicity
(CDC) assay. Purified scFv preparations can then be prepared as
described in Example 3 of WO 01/66754. Protein concentrations of
purified scFv preparations were determined using the BCA method
(Pierce). Similar approaches can be used to screen for an optimal
partner (the opposite chain) of a fixed immunoglobulin heavy or
light chain (or V.sub.H or V.sub.L).
[0381] In a particular embodiment, the invention is directed to a
method of producing a hybridoma that secretes a monoclonal antibody
that has binding specificity for human CD52 comprising
administering lymphocytes of a CD52 transgenic mouse to a
non-transgenic mouse having the same strain (e.g., CD1) as the
human CD52 transgenic mouse, thereby producing an immunized,
non-transgenic mouse. Splenocytes of the immunized, non-transgenic
mouse are contacted with immortalized cells, thereby producing
fused cells, and the fused cells are maintained under conditions in
which hybridomas that secrete a monoclonal antibody having binding
specificity for human CD52 are produced, thereby producing a
hybridoma that secretes a monoclonal antibody that has binding
specificity for human CD52.
Immunoglobulins Containing a Toxin Moiety or Toxin
[0382] The invention also relates to immunoglobulins that comprise
a toxin moiety or toxin. Suitable toxin moieties comprise a toxin
(e.g., surface active toxin, cytotoxin). The toxin moiety or toxin
can be linked or conjugated to the immunoglobulin using any
suitable method. For example, the toxin moiety or toxin can be
covalently bonded to the immunoglobulin directly or through a
suitable linker. Suitable linkers can include noncleavable or
cleavable linkers, for example, pH cleavable linkers or linkers
that comprise a cleavage site for a cellular enzyme (e.g., cellular
esterases, cellular proteases such as cathepsin B). Such cleavable
linkers can be used to prepare an immunoglobulin that can release a
toxin moiety or toxin after the immunoglobulin is internalized.
[0383] A variety of methods for linking or conjugating a toxin
moiety or toxin to an immunoglobulin can be used. The particular
method selected will depend on the toxin moiety or toxin and
immunoglobulin to be linked or conjugated. If desired, linkers that
contain terminal functional groups can be used to link the
immunoglobulin and toxin moiety or toxin. Generally, conjugation is
accomplished by reacting toxin moiety or toxin that contains a
reactive functional group (or is modified to contain a reactive
functional group) with a linker or directly with an immunoglobulin.
Covalent bonds are formed by reacting a toxin moiety or toxin that
contains (or is modified to contain) a chemical moiety or
functional group that can, under appropriate conditions, react with
a second chemical group thereby forming a covalent bond. If
desired, a suitable reactive chemical group can be added to an
immunoglobulin or to a linker using any suitable method. (See,
e.g., Hermanson, G. T., Bioconjugate Techniques, Academic Press:
San Diego, Calif. (1996).) Many suitable reactive chemical group
combinations are known in the art, for example an amine group can
react with an electrophilic group such as tosylate, mesylate, halo
(chloro, bromo, fluoro, iodo), N-hydroxysuccinimidyl ester (NHS),
and the like. Thiols can react with maleimide, iodoacetyl,
acrylolyl, pyridyl disulfides, 5-thiol-2-nitrobenzoic acid thiol
(TNB-thiol), and the like. An aldehyde functional group can be
coupled to amine- or hydrazide-containing molecules, and an azide
group can react with a trivalent phosphorous group to form
phosphoramidate or phosphoramide linkages. Suitable methods to
introduce activating groups into molecules are known in the art
(see for example, Hermanson, G. T., Bioconjugate Techniques,
Academic Press: San Diego, Calif. (1996)).
[0384] Suitable toxin moieties and toxins include, for example, a
maytansinoid (e.g., maytansinol, e.g., DM1, DM4), a taxane, a
calicheamicin, a duocarmycin, or derivatives thereof. The
maytansinoid can be, for example, maytansinol or a maytansinol
analogue. Examples of maytansinol analogs include those having a
modified aromatic ring (e.g., C-19-decloro, C-20-demethoxy,
C-20-acyloxy) and those having modifications at other positions
(e.g., C-9-CH, C-14-alkoxymethyl, C-14-hydroxymethyl or
aceloxymethyl, C-15-hydroxy/acyloxy, C-15-methoxy, C-18-N-demethyl,
4,5-deoxy). Maytansinol and maytansinol analogs are described, for
example, in U.S. Pat. Nos. 5,208,020 and 6,333,410, the contents of
which are incorporated herein by reference. Maytansinol can be
coupled to antibodies and antibody fragments using, e.g., an
N-succinimidyl 3-(2-pyridyldithio)proprionate (also known as
N-succinimidyl 4-(2-pyridyldithio)pentanoate (or SPP)),
4-succinimidyl-oxycarbonyl-a-(2-pyridyldithio)-toluene (SMPT),
N-succinimidyl-3-(2-pyridyldithio)butyrate (SDPB), 2 iminothiolane,
or S-acetylsuccinic anhydride. The taxane can be, for example, a
taxol, taxotere, or novel taxane (see, e.g., WO 01/38318). The
calicheamicin can be, for example, a bromo-complex calicheamicin
(e.g., an alpha, beta or gamma bromo-complex), an iodo-complex
calicheamicin (e.g., an alpha, beta or gamma iodo-complex), or
analogs and mimics thereof. Bromo-complex calicheamicin include
I1-BR, I2-BR, I3-BR, I4-BR, J1-BR, J2-BR and K1-BR. Iodo-complex
calicheamicins include I1-I, I2-I, I3-I, J1-I, J2-I, L1-I and
K1-BR. Calicheamicin and mutants, analogs and mimics thereof are
described, for example, in U.S. Pat. Nos. 4,970,198; 5,264,586;
5,550,246; 5,712,374, and 5,714,586, the contents of each of which
are incorporated herein by reference. Duocarmycin analogs (e.g.,
KW-2189, DC88, DC89 CBI-TMI, and derivatives thereof) are
described, for example, in U.S. Pat. No. 5,070,092, U.S. Pat. No.
5,187,186, U.S. Pat. No. 5,641,780, U.S. Pat. No. 5,641,780, U.S.
Pat. No. 4,923,990, and U.S. Pat. No. 5,101,038, the contents of
each of which are incorporated herein by reference.
[0385] Examples of other toxins include, but are not limited to
antimetabolites (e.g., methotrexate, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating
agents (e.g., mechlorethamine, thioepa chlorambucil, CC-1065 (see
U.S. Pat. Nos. 5,475,092, 5,585,499, 5,846,545), melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclophosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and
cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, mitomycin, puromycin anthramycin (AMC)), duocarmycin
and analogs or derivatives thereof, and anti-mitotic agents (e.g.,
vincristine, vinblastine, taxol, auristatins (e.g., auristatin E)
and maytansinoids, and analogs or homologs thereof).
[0386] The toxin can also be a surface active toxin, such as a
toxin that is a free radical generator (e.g., selenium containing
toxin moieties), or radionuclide containing moiety. Suitable
radionuclide containing moieties, include for example, moieties
that contain radioactive iodine (131I or 125I), yttrium (90Y),
lutetium (177Lu), actinium (225Ac), praseodymium, astatine (211At),
rhenium (186Re), bismuth (212Bi or 213Bi), indium (111In),
technetium (99mTc), phosphorus (32P), rhodium (188Rh), sulfur
(35S), carbon (14C), tritium (3H), chromium (51Cr), chlorine
(36C1), cobalt (57Co or 58Co), iron (59Fe), selenium (75Se), or
gallium (67Ga).
[0387] The toxin can be a protein, polypeptide or peptide, from
bacterial sources, e.g., diphtheria toxin, pseudomonas exotoxin
(PE) and plant proteins, e.g., the A chain of ricin (RTA), the
ribosome inactivating proteins (RIPs) gelonin, pokeweed antiviral
protein, saporin, and dodecandron are contemplated for use as
toxins.
[0388] Antisense compounds of nucleic acids designed to bind,
disable, promote degradation or prevent the production of the mRNA
responsible for generating a particular target protein can also be
used as a toxin. Antisense compounds include antisense RNA or DNA,
single or double stranded, oligonucleotides, or their analogs,
which can hybridize specifically to individual mRNA species and
prevent transcription and/or RNA processing of the mRNA species
and/or translation of the encoded polypeptide and thereby effect a
reduction in the amount of the respective encoded polypeptide.
Ching, et al., Proc. Natl. Acad. Sci. U.S.A. 86: 10006-10010
(1989); Broder, et al., Ann. Int. Med. 113: 604-618 (1990); Loreau,
et al., FEBS Letters 274: 53-56 (1990). Useful antisense
therapeutics include for example: Veglin.TM. (VasGene) and OGX-011
(Oncogenix).
[0389] Toxins can also be photoactive agents. Suitable photoactive
agents include porphyrin-based materials such as porfimer sodium,
the green porphyrins, chlorin E6, hematoporphyrin derivative
itself, phthalocyanines, etiopurpurins, texaphrin, and the
like.
[0390] The toxin can be an antibody or antibody fragment that binds
an intracellular target. Such antibodies or antibody fragments can
be directed to defined subcellular compartments or targets. For
example, the antibodies or antibody fragments can bind an
intracellular target selected from erbB2, EGFR, BCR-ABL, p21Ras,
Caspase3, Caspase7, Bcl-2, p53, Cyclin E, ATF-1/CREB, HPV16 E7,
HP1, Type IV collagenases, cathepsin L as well as others described
in Kontermann, R. E., Methods, 34:163-170 (2004), incorporated
herein by reference in its entirety.
Therapeutic Methods and Compositions
[0391] The antibodies of this invention are useful in
immuno-suppression and immuno-ablation. The antibodies target
CD52-expressing cells (e.g., T and B cells) and reduce (or
"deplete" as used herein) their population in a subject in need
thereof. Lymphocyte depletion may be useful in treating a variety
of diseases and conditions such as inflammation, autoimmune
diseases and cancer (e.g., lymphocyte (either B or T cell)
malignancy). See, e.g., Reiff, A., Hematology, 10(2):79-93 (2005).
Examples of diseases and conditions that can be treated with the
antibodies or antigen-binding portions of this invention include,
without limitation, multiple sclerosis, lupus, rheumatoid
arthritis, graft versus host disease (GVHD), inflammatory bowl
disease, vasculitis, Behcet's disease, Wegener's granulomatosis,
Sjogren's syndrome, uveitis, psoriasis, scleroderma, polymyositis,
type I (autoimmune-based) diabetes, autoimmune cytopenias (e.g.,
autoimmune neutropenia, transfusion-dependent refractory PRCA,
leukemia and lymphoma such as non-Hodgkin's lymphoma with bulky
disease and B-cell chronic lymphocytic leukemia.
[0392] Accordingly, aspects of this invention are methods for
lymphocyte depletion, and for treating inflammation, an autoimmune
disease or cancer by administering an effective amount of an
antibody of the invention to a subject in need thereof (e.g., a
human patient having an autoimmune disease, a blood cancer, or a
patient who is to receive a transplantation). The antibody also can
be administered prophylactically to prevent onset of inflammation
or relapse of an autoimmune disease or cancer. For example, the
antibody of this invention can be administered as part of a
conditioning regimen to prepare a patient for a transplantation
(e.g., a stem cell transplant, an infusion of autologous of
allogeneic T cells, or a solid organ transplant).
[0393] Some anti-CD52 antibodies of this invention preferentially
target certain populations of CD52+ cells. One possible explanation
is that epitopes to which these antibodies bind include one or more
carbohydrate groups on the CD52 protein, and such carbohydrate
groups may be more prevalent on CD52 expressed on one cell type
versus another. For example, we have found that antibody 7F11, 5F7,
3G7, and 11C11 deplete T cells to a greater extent than B cells.
Thus, the humanized and chimeric versions of these antibodies may
be used to treat T cell malignancy with milder immunosuppressing
side effects.
[0394] Because antibodies of this invention target CD52-expressing
cells, the antibodies also can be used to deplete CD52+ cell types
other than T cells and B cells. For example, studies have shown
that vascular leukocytes (VLC) and Tie2+ monocytes-myeloid cells
expressing high levels of CD52--promote tumor angiogenesis and
contribute to tumor resistance to anti-VEGF therapy. Pulaski et
al., J. Translational Med. 7:49 (2009). Anti-CD52 antibodies of
this invention thus can be used to inhibit tumor angiogenesis by
targeting VLC and Tie2+ monocytes. For this purpose, the anti-CD52
antibodies can be administered systemically, or locally at a site
of neovascularization, such as a tumor site. Anti-CD52 antibody
therapy can be used in conjunction with standard-of-care cancer
treatment such as chemotherapy, surgery, or radiation, or with
another targeted therapy such as anti-VEGF antibody therapy.
Anti-CD52 antibody therapy can be used to treat, for example,
breast cancer, lung cancer, glioma, colorectal cancer, and any
other indications of anti-VEGF antibodies. Anti-CD52 antibody
therapy also can be used in other neovascularization conditions
including non-oncological neovascular conditions.
[0395] Antibodies of this invention can be administered to an
individual (e.g., a human) alone or in conjunction with another
agent (e.g., an immunosuppressant) in a combination therapy. The
antibody can be administered before, along with or subsequent to
administration of the additional agent. In some embodiments, the
additional agent is, for example, an anti-inflammatory compound
such as sulfasalazine, another non-steroidal anti-inflammatory
compound, or a steroidal anti-inflammatory compound. In some
embodiments, the additional agent is another lympho-depleting
antibody such as another anti-CD52 antibody, an anti-CD20 antibody,
an anti-BAFF antibody, an anti-BAFF-R antibody, and the like. In
some embodiments, the additional agent is, e.g., a cytokine (e.g.,
IL-7), anti-cytokine receptor antibody, or a soluble receptor, that
skews, manipulates, and/or augments the reconstitution process that
occurs following lymphodepletion mediated by an anti-CD52 antibody
(see, e.g., Sportes et al., " "Cytokine Therapies: Ann. N.Y. Acad.
Sci. 1182:28-38 (2009)). In another embodiment, a synthetic peptide
mimetic can be administered in conjunction with an immunoglobulin
of the present invention.
[0396] Studies have shown that lymphocyte depletion by alemtuzumab
is mediated by neutrophils and NK cells (Hu et al., Immunology
128:260-270 (2009). Thus, in an embodiment of combination therapy,
an agent that stimulates neutrophils and NK cells can be
administered to a patient, before, during or after anti-CD52
antibody therapy, to augment the antibody therapy. Stimulating
neutrophils and/or NK cells include, without limitation, (1)
increasing their rates of division, (2) increasing their cell
surface expression of the Fc receptors corresponding to the isotype
of the anti-CD52 antibody (e.g., Fc.gamma.RIIIa and Fc.gamma.RIIIb,
Fc.gamma.RII, Fc.gamma.RI, and Fc.alpha.RI), (3) mobilizing and
increasing the number of circulating cells, (4) recruiting the
cells to target sites (e.g., sites of tumors, inflammation, or
tissue damage), (5) and increasing their cytotoxic activity.
Examples of agents that stimulate neutrophils and/or NK cells
include, for example, granulocyte monocyte colony stimulating
factor (GM-CSF) (e.g., LEUKINE.RTM. or sargramostim and
molgramostim); granulocyte colony stimulating factor (G-CSF) (e.g.,
NEUPOGEN.RTM. or filgrastim, pegylated filgrastim, and
lenograstim); interferon gamma (e.g., ACTIMMUNE.RTM.); CXC
chemokine receptor 4 (CXCR4) antagonists (e.g., MOZOBIL.TM. or
plerixafor); and CXC chemokine receptor 2 (CXCR2) agonists. The
neutrophil count of the patient may be monitored periodically to
ensure optimal treatment efficacy. The neutrophil count of the
patient also can be measured prior to the start of the anti-CD52
antibody treatment. The stimulator's amount can be adjusted based
on the patient's neutrophil count. A higher dose of the stimulator
may be used if the patient has a lower than normal neutrophil
count. During periods of neutropenia, which may be caused by
treatment with the anti-CD52 antibody, a higher dose of the
neutrophil stimulator may also be administered to maximize the
effect of the anti-CD52 antibody.
[0397] Because neutrophil and/or NK stimulation improves the
efficacy of anti-CD52 antibody therapy, this embodiment of
combination therapy allows one to use less antibody in a patient
while maintaining similar treatment efficacy. Using less anti-CD52
antibody while maintaining treatment efficacy may help reduce side
effects of the anti-CD52 antibody, which include immune response in
the patient against the administered antibody as well as
development of secondary autoimmunity (autoimmunity that arises
during or after anti-CD52 antibody treatment). This embodiment of
combination of therapy is also useful in an oncology setting, e.g.,
when the patient has neutropenia.
[0398] In another embodiment of combination therapy, one can use a
stimulator of regulatory T cells to augment anti-CD52 antibody
therapy. Our data show that anti-CD52 antibodies deplete
CD4.sup.+CD25.sup.+FoxP3.sup.+ regulatory T cells to a much lesser
extent as compared to other CD4.sup.+ T cells. Regulatory T cells
(also known as "Treg" or suppressor T cells) are cells that are
capable of inhibiting the proliferation and/or function of other
lymphoid cells via contact-dependent or contact-independent (e.g.,
cytokine production) mechanisms. Several types of regulatory T
cells have been described, including .gamma..delta. T cells,
natural killer T (NKT) cells, CD8.sup.+T cells, CD4.sup.+T cells,
and double negative CD4.sup.-CD8.sup.-T cells. See, e.g., Bach et
al., Immunol. 3:189-98 (2003). CD4.sup.+CD25.sup.+FoxP3.sup.+
regulatory T cells have been referred as "naturally occurring"
regulatory T cells; they express CD4, CD25 and forkhead family
transcription factor FoxP3 (forkhead box p3). Thus, in this
embodiment of combination therapy, one can administer an agent that
stimulates CD4.sup.+CD25.sup.+FoxP3.sup.+ regulatory T cells
before, during or after the anti-CD52 antibody therapy, to skew the
composition of the immune system following lympho-depletion. The
agent may, for example, activate those T cells, stabilize and/or
expand the population of the cells, mobilize and increase
circulation of the cells, and/or recruit the cells to target sites.
Examples of such agents are rapamycin, active or latent TGF-.beta.
(e.g., TGF-.beta.1, TGF-.beta.2, TGF-.beta.3, TGF-.beta.4, and
TGF-.gamma.5), IL-10, IL-4, IFN-.alpha., vitamin D3, dexamethasone,
and mycophenolate mofetil (see, e.g., Barrat et al., J. Exp. Med.
195:603-616 (2002); Gregori et al., J Immunol. 167: 1945-1953
(2001); Battaglia et al., Blood 105: 4743-4748 (2005); Battaglia et
al., J. Immunol. 177:8338-8347 (2006)).
[0399] In this invention, an effective amount of anti-CD52 antibody
for treating a disease is an amount that helps the treated subject
to reach one or more desired clinical end points. For example, for
lupus (whose manifestations include systemic lupus erythematosus,
lupus nephritis, cutaneous lupus erythematosus, CNS lupus,
cardiovascular manifestations, pulmonary manifestations, hepatic
manifestations, haematological manifestations, gastrointestinal
manifestations, musculoskeletal manifestations, neonatal lupus
erythematosus, childhood systemic lupus erythematosus, drug-induced
lupus erythematosus, anti-phospholipid syndrome, and complement
deficiency syndromes resulting in lupus manifestations; see, e.g.,
Robert G. Lahita, Editor, Systemic Lupus Erythematosus, 4th Ed.,
Elsevier Academic Press, 2004), clinical endpoints can be measured
by monitoring of an affected organ system (e.g., hematuria and/or
proteinuria for lupus nephritis) and/or using a disease activity
index that provides a composite score of disease severity across
several organ systems (e.g., BILAG, SLAM, SLEDAI, ECLAM). See,
e.g., Mandl et al., "Monitoring patients with systemic lupus
erythematosus" in Systemic Lupus Erythematosus, 4.sup.th edition,
pp. 619-631, R. G. Lahita, Editor, Elsevier Academic Press,
(2004).
[0400] In another example of autoimmune disease, multiple sclerosis
(including relapsing-remitting, secondary progressive, primary
progressive, and progressive relapsing multiple sclerosis ((Lublin
et al., Neurology 46 (4), 907-11 (1996)), diagnosed is made by, for
example, the history of symptoms and neurological examination with
the help of tests such as magnetic resonance imaging (MRI), spinal
taps, evoked potential tests, and laboratory analysis of blood
samples. In MS, the goal of treatment is to reduce the frequency
and severity of relapses, prevent disability arising from disease
progression, and promote tissue repair (Compston and Coles, 2008).
Thus, an amount of anti-CD52 antibody that helps achieve a clinical
endpoint consistent with that goal is an effective amount of
antibody for the treatment.
[0401] To minimize immunogenicity, it is preferred that a humanized
antibody be used to treat a human patient in therapeutic methods
and compositions of this invention. In cases where repeated
administration is not necessary, it may also be appropriate to
administer a mouse:human chimeric antibody of this invention to a
human patient.
[0402] The antibodies of the invention can be used to treat an
individual who has previously been treated with Campath-1H.RTM. who
has developed neutralizing antibodies to Campath-1H.RTM. (e.g., a
Campath-1H.RTM.-refractory individual). For example, one could
treat an individual having an autoimmune disease (e.g., multiple
sclerosis, lupus, vasculitis) and/or a cancer (e.g., a leukemia
(e.g., chronic lymphocytic leukemia), a lymphoma (e.g.,
non-Hodgkin's lymphoma)) who has previously been treated with
Campath-1H.RTM. (e.g., with one or more courses of Campath-1H.RTM.
treatment) and who has developed neutralizing antibodies to
Campath-1H.RTM. that reduce the efficacy of further Campath-1H.RTM.
treatment. We have shown that the humanized antibodies of this
invention (e.g., humanized 2C3, 12G6, and 9D9) can bind to human
CD52 despite the presence of neutralizing antibodies to
alemtuzumab. In another embodiment, one could treat an individual
who had become refractory to treatment with a particular humanized
antibody described herein with one of the other humanized
antibodies described herein.
[0403] The antibody of this invention can be administered in a
single unit dose or multiple doses at any time point deemed
appropriate by a health care provider. The dosage can be determined
by methods known in the art and can be dependent, for example, upon
the individual's age, sensitivity, tolerance and overall
well-being. A variety of routes of administration can be used,
including, but not necessarily limited to, parenteral (e.g.,
intravenous, intraarterial, intramuscular, intrathecal,
intraperitoneal, subcutaneous injection), oral (e.g., dietary),
locally, topical, inhalation (e.g., intrabronchial, intranasal or
oral inhalation, intranasal drops), or rectal, depending on the
disease or condition to be treated. Parenteral administration may
be one preferred mode of administration.
[0404] In one embodiment, the antibodies of the invention are
administered to a patient using the same dosing regimen as
Campath-1H.RTM. (e.g., the dosing regimen of Campath-1H.RTM. for
chronic lymphocytic leukemia). In another embodiment, an antibody
of the invention is administered to a patient having an autoimmune
disease (e.g., multiple sclerosis (MS)) in a regimen comprising
administration of a first cycle of the antibody followed by at
least one further cycle of the antibody, in which each treatment
cycle comprises 1-5 doses that are applied on consecutive days, and
wherein each treatment cycle is separated from the next cycle by at
least 1-24 months (e.g., 12 months). For example, in one
embodiment, a patient having multiple sclerosis is treated with a
first cycle of the antibody comprising 5 daily doses of the
antibody followed by at least one further cycle of antibody
treatment, in which the treatment occurs 12 months after the first
cycle and comprises 3 doses of the antibody applied on consecutive
days. In another embodiment, a patients having MS is only
re-treated once evidence of renewed MS activity has been observed
(see, e.g., WO 2008/031626; the teachings of which are incorporated
herein by reference in their entirety). In some embodiments, it may
be necessary to administer more frequent courses of treatment
(e.g., every four months, every six months) if patients with more
advanced forms of MS or more progressive forms of other autoimmune
diseases (such as vasculitis; see, e.g., Walsh et al., Ann Rheum
Dis 67:1322-1327 (2008)) experience a relapse early on after their
last course of treatment. Evidence of renewed MS activity may be
determined based on the professional judgment of the treating
clinician, using any means that may be available to such clinician.
A variety of techniques are currently available to clinicians to
diagnose renewed MS activity including, without limitation, by
clinical means (relapse or progression of neurological disability)
or by magnetic resonance imaging (MRI) of the brain or spinal cord.
As is well understood by medical practitioners, disease activity
detected via MRI may be indicated by the occurrence of new cerebral
or spinal lesions on T1 (enhanced or non-enhanced)- or T2-weighted
images or by the increase of the volume of such lesions. As
diagnostic methods for MS are continually evolving, it is
anticipated there may be additional methods in the future that will
detect renewed MS activity (e.g., magnetization transfer ratio or
MR-spectroscopy). The particular diagnostic method used to detect
renewed MS activity is not a limitation of the claimed invention.
In certain embodiments, repeated MRIs are performed in fixed
intervals after a treatment cycle in order to determine whether
re-treatment of any given patient is necessary and the optimal time
point for re-treatment of such patient. In general, it is desirable
for re-treatment to occur before the disease re-manifests
clinically.
[0405] Formulation will vary according to the route of
administration selected (e.g., solution, emulsion). An appropriate
composition comprising the antibody to be administered can be
prepared in a physiologically acceptable vehicle or carrier. The
composition can comprise multiple doses or be a single unit dose
composition. For solutions or emulsions, suitable carriers include,
for example, aqueous or alcoholic/aqueous solutions, emulsions or
suspensions, including saline and buffered media. Parenteral
vehicles can include sodium chloride solution, Ringer's dextrose,
dextrose and sodium chloride, lactated Ringer's or fixed oils.
Intravenous vehicles can include various additives, preservatives,
or fluid, nutrient or electrolyte replenishers (See, generally,
Remington's Pharmaceutical Sciences, 17th Edition, Mack Publishing
Co., PA, 1985). For inhalation, the compound can be solubilized and
loaded into a suitable dispenser for administration (e.g., an
atomizer, nebulizer or pressurized aerosol dispenser).
Diagnostic Methods and Compositions
[0406] The immunoglobulins of the present invention also are useful
in a variety of processes with applications in research and
diagnosis. For instance, they can be used to detect, isolate,
and/or purify human CD52 or variants thereof (e.g., by affinity
purification or other suitable methods such as flow cytometry,
e.g., for cells, such as lymphocytes, in suspension), and to study
human CD52 structure (e.g., conformation) and function. For in
vitro applications, wherein immunogenicity of the antibody is not a
concern, the mouse and chimeric antibodies of this invention will
be useful in addition to humanized antibodies.
[0407] The immunoglobulins of the present invention can be used in
diagnostic applications (e.g., in vitro, ex vivo). For example, the
humanized immunoglobulins of the present invention can be used to
detect and/or measure the level of human CD52 in a sample (e.g., on
cells expressing human CD52 in tissues or body fluids, such as an
inflammatory exudate, blood, serum, bowel fluid, tissues bearing
human CD52). A sample (e.g., tissue and/or body fluid) can be
obtained from an individual and an immunoglobulin described herein
can be used in a suitable immunological method to detect and/or
measure human CD52 expression, including methods such as flow
cytometry (e.g., for cells in suspension such as lymphocytes),
enzyme-linked immunosorbent assays (ELISA), including
chemiluminescence assays, radioimmunoassay, and
immunohistology.
[0408] In one embodiment, a method of detecting human CD52 in a
sample is provided, comprising contacting a sample with an
immunoglobulin of the present invention under conditions suitable
for specific binding of the immunoglobulin to human CD52 and
detecting antibody-CD52 complexes which are formed. In an
application of the method, the immunoglobulins described herein can
be used to analyze normal versus inflamed tissues (e.g., from a
human) for human CD52 reactivity and/or expression (e.g.,
immunohistologically) to detect associations between e.g.,
inflammatory bowel disease (IBD), autoimmune diseases (such as
multiple sclerosis and lupus), cancer (such as non-Hodgkin's
lymphoma and chronic lymphocytic leukemia), or other conditions and
increased expression of human CD52 (e.g., in affected tissues).
Thus, the immunoglobulins of the present invention permit
immunological methods of assessment of the presence of human CD52
in normal and inflamed tissues, through which the presence of
disease, disease progress and/or the efficacy of anti-human CD52
therapy in the treatment of disease, e.g., inflammatory disease can
be assessed.
[0409] In addition, the immunoglobulins can be used to examine
tissues after treatment with a depleting anti-CD52 therapeutic
antibody to gauge how effective the depletion has been as well as
to determine whether there has been any downregulation in the
expression of CD52 (Rawstrom et al., Br. J. Heam., 107:148-153
(1999)).
[0410] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
Exemplary methods and materials are described below, although
methods and materials similar or equivalent to those described
herein can also be used in the practice or testing of the present
invention. All publications and other references mentioned herein
are incorporated by reference in their entirety. In case of
conflict, the present specification, including definitions, will
control. Although a number of documents are cited herein, this
citation does not constitute an admission that any of these
documents forms part of the common general knowledge in the art.
Throughout this specification and claims, the word "comprise," or
variations such as "comprises" or "comprising" will be understood
to imply the inclusion of a stated integer or group of integers but
not the exclusion of any other integer or group of integers. The
materials, methods, and examples are illustrative only and not
intended to be limiting.
EXEMPLIFICATION
Example 1
Generation of Mouse Anti-Human CD52 Antibodies
[0411] The mouse anti-human CD52 antibodies in the following
working examples were generated by immunizing CD1 strain mice with
splenocytes from human CD52 transgenic mice with a CD1 background
(FIG. 1A), where display of human CD52 on the surface of mouse B
and T cells of the transgenic mice was verified by flow cytometry.
Because the transgenic mice had the same background (CD1) as the
immunized mice, splenocytes from the transgenic mice presented
human CD52 at the cell surface as a unique, non-self antigen in a
native format, and the immunized nontransgenic mice mounted an
antibody response primarily towards the human CD52.
[0412] To collect splenocytes from the human CD52 transgenic mice,
the mice were euthanized, spleens were harvested and single cell
suspensions were prepared by passing through a syringe. CD1 mice
were then immunized with the collected human CD52 positive spleen
cells at 5.times.10.sup.6 in 100 .mu.l per mouse with or without
Freund's Complete Adjuvant by intraperitoneal (i.p.) injection.
Mice were given two booster doses every two weeks after first
immunization with transgenic mouse human CD52 positive spleen cells
at 5.times.10.sup.6 in 100 .mu.l per mouse with Freund's Incomplete
Adjuvant, ip.
[0413] Eye bleeds were collected 100-200 .mu.l per mouse in
yellow-capped serum separator tubes from all mice before
immunization to determine base level reactivity, and a week after
every round of immunization to determine base level reactivity, and
a week after every round of immunization to determine anti-human
CD52 specific immune response. Mice that mounted high levels of
anti-human CD52 reactivity as measured by FACS on CHO K1 cells
engineered to express human CD52 protein, but not on parental CHO
K1 cells were sacrificed, blood was harvested and spleens were
collected under sterile conditions to generate hybridomas.
Hybridomas were generated by using a non-secreting mouse myeloma
cell-line SP2/0 Ag14 or NS1 myeloma cells as fusion partners 3-4
days post immunization. Fused cells were placed in complete growth
medium containing hypoxanthine, aminopterin and thymidine to
generate hybridomas. After screening many hybridoma supernatants,
several clones were selected that produced specific anti-human CD52
antibodies and were further subcloned to derive a clonal
population. Hybridoma clones that produced anti-human CD52
antibodies were scaled up for further development.
Example 2
PCR Analysis of Heavy and Light Chains of Mouse Anti-Human CD52
Antibodies
[0414] A number of mouse anti-human CD52 monoclonal antibodies
(FIG. 1B) were identified by testing hybridoma supernatants for the
presence of anti-human CD52 reactivity. Individual clones were
selected and the mouse heavy and light chain variable sequences
were identified by PCR cloning and sequencing. The sequences of the
light chains are shown in FIG. 2 as compared to YTH 34.5 HL (i.e.,
Campath-1G.RTM. Kappa (rat) and a reagent antibody CF1D12 (CF1D12
Kappa) (Invitrogen Life Science Technologies). Similarly, the
sequences of the heavy chains are shown in FIG. 3 as compared to
YTH 34.5 HL and a reagent antibody CF1D12.
[0415] A total of 10 unique light chain variable sequences and 11
unique heavy chain variable sequences were identified. If one
includes Campath.RTM. and CF1D12, 7 unique CDR-1 regions (Table 1),
8 unique CDR-2 regions (Table 2) and 7 unique CDR-3 regions (Table
3) were identified within the light chains of anti-human CD52
antibodies.
TABLE-US-00002 TABLE 1 Light Chain CDR-1 Sequences Light Chain
CDR-1 Sequence A KASQNIDKYLN (SEQ ID NO: 27) B KSSQSLLESDGRTYLN
(SEQ ID NO: 28) C KSSQSLLDSDGKTYLN (SEQ ID NO: 29) D
KSSQSLLDSDGRTYLN (SEQ ID NO: 30) E KSSQSLLYSNGKTYLN (SEQ ID NO: 31)
F RSSQSLVHTNGNSYLH (SEQ ID NO: 32) G RSSQSLVHTNGNTYLH (SEQ ID NO:
33)
TABLE-US-00003 TABLE 2 Light Chain CDR-2 Sequences Light Chain
CDR-2 Sequence A NTNNLQT (SEQ ID NO: 34) B LVSNLDS (SEQ ID NO: 35)
C LVSKLDS (SEQ ID NO: 36) D LVSNLGS (SEQ ID NO: 37) E LVSALDS (SEQ
ID NO: 38) F LVSNLNS (SEQ ID NO: 39) G LVSHLDS (SEQ ID NO: 40) H
MVSNRFS (SEQ ID NO: 41)
TABLE-US-00004 TABLE 3 Light Chain CDR-3 Sequences Light Chain
CDR-3 Sequence A LQHISRPRT (SEQ ID NO: 42) B WQGTHFPWT (SEQ ID NO:
43) C VQGSHFHT (SEQ ID NO: 44) D VQGTRFHT (SEQ ID NO: 45) E
VQGTHLHT (SEQ ID NO: 46) F SQSTHVPFT (SEQ ID NO: 47) G SQSAHVPPLT
(SEQ ID NO: 48)
[0416] If one includes Campath.RTM. and CF1D12, a total of 8 unique
CDR-1 regions (Table 4), 10 unique CDR-2 regions (Table 5) and 8
unique CDR-3 regions (Table 6) have been identified within the
heavy chains of anti-human CD52 antibodies.
TABLE-US-00005 TABLE 4 Heavy Chain CDR-1 Sequences Heavy Chain
CDR-1 Sequence A GFTFTDFYMN (SEQ ID NO: 49) B GFTFSDAWMD (SEQ ID
NO: 50) C RFTFSDAWMD (SEQ ID NO: 51) D GLTFSDAWMD (SEQ ID NO: 52) E
GFPFSNYWMN (SEQ ID NO: 53) F GFTFNKYWMN (SEQ ID NO: 54) G
GFTFNTYWMN (SEQ ID NO: 55) H GFTFTDYYMS (SEQ ID NO: 56)
TABLE-US-00006 TABLE 5 Heavy Chain CDR-2 Sequences Heavy Chain
CDR-2 Sequence A FIRDKAKGYTTEYNPSVKG (SEQ ID NO: 57) B
EIRNKAKNHVAYYAESVKG (SEQ ID NO: 58) C EIRNKANNHATYYAESVKG (SEQ ID
NO: 59) D EIRNKAKNHVKYYAESVKG (SEQ ID NO: 60) E EIRNKAKNHATYYAESVKG
(SEQ ID NO: 61) F EIRKKVNNHATYYAESVKG (SEQ ID NO: 62) G
QIRLKSNNYATHYAESVKG (SEQ ID NO: 63) H QIRLKSDNYATHYAESVKG (SEQ ID
NO: 64) I FIRNKANGYTTEYNASVKG (SEQ ID NO: 65) J FIRNKANGYTTEYSASVKG
(SEQ ID NO: 66)
TABLE-US-00007 TABLE 6 Heavy Chain CDR-3 Sequences Heavy Chain
CDR-3 Sequence A AREGHTAAPFDY (SEQ ID NO: 67) B TTLDS (SEQ ID NO:
68) C TSLDY (SEQ ID NO: 69) D TGLDY (SEQ ID NO; 70) E TPIDY (SEQ ID
NO: 71) F TPVDF (SEQ ID NO: 72) G TRYIFFDY (SEQ ID NO: 73) H
TRYIWFDY (SEQ ID NO: 74)
[0417] The association of specific light and heavy chain CDR
regions within 13 different anti-human CD52 antibodies is depicted
in Table 7.
TABLE-US-00008 TABLE 7 Classification of Anti-Human CD52 Antibodies
on the Basis of CDR Composition Clone Heavy Chain CDR-1 Light Chain
Name CDR-1 CDR-2 CDR-3 CDR-1 CDR-2 CDR-3 Campath .RTM. A A A A A A
CF1D12 B B B B B B 8G3.25.3.5 C C C C C B GMA 4G7.F3 B D C C D B
GMA 9D9.A2 B E B C E B GMA B E C C C B 11C11.C5 GMA 3G7.E9 B F C C
F B 5F7.1.1.4 D E D D G B 12G6.15.1.2 E G E E C C 23E6.2.2.1 F H E
E C D 2C3.3.8.1 G G F E C E 7F11.1.9.7 H I G F H F 4B10.1.2.4 H J H
G H G Clones 8G3.25.3.5, 4G7.F3, 9D9.A2, 11C11.C5, 3G7.E9,
5F7.1.1.4, 12G6.15.1.2, 23E6.2.2.1, 2C3.3.8.1, 7F11.1.9.7 and
4B10.1.2.4 are hereafter referred to as 8G3, 4G7, 9D9, 11C11, 3G7,
5F7, 12G6, 23E6, 2C3, 7F11 and 4B10, respectively.
TABLE-US-00009 TABLE 7.1 SEQ ID NOs of the CDRs of the Anti-Human
CD52 Antibodies Clone Heavy Chain Light Chain Name CDR-1 CDR-2
CDR-3 CDR-1 CDR-2 CDR-3 Campath .RTM. 49 57 67 27 34 42 CF1D12 50
58 68 28 35 43 8G3 51 59 69 29 36 43 4G7 50 60 69 29 37 43 9D9 50
61 68 29 38 43 11C11 50 61 69 29 36 43 3G7 50 62 69 29 39 43 5F7 52
61 70 30 40 43 12G6 53 63 71 31 36 44 23E6 54 64 71 31 36 45 2C3 55
63 72 31 36 46 7F11 56 65 73 32 41 47 4B10 56 66 74 33 41 48
Example 3
Cloning of Mouse IgG Variable Region Genes from Mouse Hybridoma
Cells to Generate a Mouse/Human Chimeric IgG1 Antibody
[0418] Actively proliferating and antibody secreting hybridoma
cells were used to isolate RNA using Trizol.RTM. reagent
(Gibco/BRL) following the manufacturer's suggested protocol. RNA
was quantified by measuring OD using Nanodrop, and the integrity of
the RNA was determined by running it on a gel or by using a
bioanalyzer. Total RNA was reverse transcribed to cDNA and the
variable regions for the heavy and light chains were amplified by
polymerase chain reaction (PCR). The cDNA was generated using BD
Sprint PowerScript Reverse Transcriptase.TM. (Clontech) and
Oligo(dT) primer at 0.5 .mu.g/.mu.l (Invitrogen Cat# Y01212) and
reverse primers (located in the constant region of the heavy and
light chains) listed numerically below at 10 .mu.M following the
manufacturer's protocol. Specifically, primers numbered 3 (SEQ ID
NO: 77), 11 (SEQ ID NO: 85), 19 (SEQ ID NO: 93), 20 (SEQ ID NO: 94)
and 21 (SEQ ID NO: 95) were employed. PCR amplification of the
heavy and light chain variable regions was carried out using cDNA
generated as described above. 1 .mu.l of cDNA was mixed with
forward primer and reverse primers at 10 .mu.M each for both heavy
and light chains and mixed with PCR super mix (Invitrogen) in the
presence of 2 .mu.l of MgCl.sub.2 at 25 mM. The PCR program was run
in the following steps: 1) 95.degree. C. for 2 minutes; 2)
95.degree. C. for 30 seconds; 3) 56.degree. C. for 30 seconds; 4)
68.degree. C. for 45 seconds; 5) Repeat steps 2 to 4 25 times; 6)
68.degree. C. for 10 minutes and hold at 16.degree. C. The PCR
product was analyzed on a 2% gel for the presence of variable
region sequence product of about 300-400 by in size and the
appropriate bands were cloned into pCR2.1-TOPO TA cloning Kit
(Invitrogen) following the manufacturer's instructions and the
cloned and sequence confirmed using M13 primers. Primers used for
reverse transcribing and for PCR amplification of light chain and
heavy chain sequences are provided:
Light Chain Primers
[0419] 1) Lead-ML kappa=5' ATGGGCWTCAARATGRARWCWCAT 3' (Forward
primer in leader sequence) (SEQ ID NO: 75) [0420] 2) FR1-ML
kappa=5' GAYATTGTGMTRACMCARKMTCAA 3' (Forward primer in the frame
work 1) (SEQ ID NO: 76) [0421] 3) ML kappa const=5'
ACTGGATGGTGGGAAGATGGA 3'(Reverse primer in constant region) (SEQ ID
NO: 77) [0422] 4) VK-MK=5' GAYATTGTGMTSACMCARWCTMCA 3' (Forward
primer in the frame work 1) (SEQ ID NO: 78) [0423] 5) MKC-Const=5'
GGATACAGTTGGTGCAGCATC 3' (Reverse primer in constant region) (SEQ
ID NO: 79)
Heavy Chain Primers
[0423] [0424] 6) MH-SP-ALT1=5' ATGRASTTSKGGYTMARCTKGRTT 3' (Forward
primer in leader sequence) (SEQ ID NO: 80) [0425] 7) MH-SP-ALT2=5'
ATGRAATGSASCTGGGTYWTYCTCT 3' (Forward primer in leader sequence)
(SEQ ID NO: 81) [0426] 8) MH-FR1=5' SAGGTSMARCTGCAGSAGTCT 3'
(Forward primer in the frame work 1) (SEQ ID NO: 82) [0427] 9)
MH-FR1-1=5' SAGGTGMAGCTCSWRSARYCSGGG 3' (Forward primer in the
frame work 1) (SEQ ID NO: 83) [0428] 10) MH-J2=5'
TGAGGAGACTGTGAGAGTGGTGCC 3' (Reverse primer in J region) (SEQ ID
NO: 84) [0429] 11) MH-gamma-const=5' AYCTCCACACACAGGRRCCAGTGGATAGAC
3' (Reverse primer in constant region) (SEQ ID NO: 85) [0430] 12)
VH MH1=5' SARGTNMAGCTGSAGSAGTC 3' (Forward primer in the frame work
1) (SEQ ID NO: 86) [0431] 13) VH MH2=5' SARGTNMAGCTGSAGSAGTCWGG 3'
(Forward primer in the frame work 1) (SEQ ID NO: 87) [0432] 14) VH
MH3=5' CAGGTTACTCTGAAAGWGTSTG 3' (Forward primer in the frame work
1) (SEQ ID NO: 88) [0433] 15) VH MH4=5' GAGGTCCARCTGCAACARTC
3'(Forward primer in the frame work 1) (SEQ ID NO: 89) [0434] 16)
VH MH5=5' CAGGTCCAACTVCAGCARCC 3'(Forward primer in the frame work
1) (SEQ ID NO: 90) [0435] 17) VH MH6=5' GAGGTGAASSTGGTGGAATC
3'(Forward primer in the frame work 1) (SEQ ID NO: 91) [0436] 18)
VH MH7=5' GATGTGAACTTGGAAGTGTC 3'(Forward primer in the frame work
1) (SEQ ID NO: 92) [0437] 19) IgG1=5' ATAGACAGATGGGGGTGTCGTTTTGGC
3' (Reverse primer in mouse IgG1 CH1 constant region) (SEQ ID NO:
93) [0438] 20) IgG2A=5' CTTGACCAGGCATCCTAGAGTCA 3' (Reverse primer
in mouse IgG2A CH1 constant region) (SEQ ID NO: 94) [0439] 21)
IgG2B=5' AGGGGCCAGTGGATAGAGTGATGG 3' (Reverse primer in mouse IgG2B
CH1 constant region) (SEQ ID NO: 95)
[0440] Degenerate primers led to some degeneracy in the 5' end of
the frame work 1 region of both heavy and light chains. The
consensus DNA sequence from several independent heavy chain
variable region clones and from light chain variable region clones
was used to derive the amino acid sequence.
[0441] Functional chimeric anti-CD52 antibodies were produced by
joining the heavy chain and light chain variable regions to the DNA
encoding human IgG1 heavy chain (identical sequence to that found
in Campath-1H.RTM.) and human kappa light chain constant region
(identical sequence to that found in Campath-1H.RTM.),
respectively. To generate pCEP4 (Invitrogen) light chain vector
encoding CD52 antibody light chain, the light chain variable
sequence was PCR amplified and engineered by ligase independent
cloning into the pCEP4 LIC light chain vector to have the human
kappa signal sequence in the 5' end and the light chain constant
region in the 3'end. Similarly, to generate pCEP4 heavy chain
vector, the variable region of the heavy chain sequence was
engineered by ligase independent cloning into the pCEP4 LIC heavy
chain vector to have the human kappa chain signal sequence in the
5' end and the heavy chain constant region encompassing CH1, hinge,
CH2 and CH3 regions in the 3'end. The constant region amino acid
sequences for both heavy and light chains are identical to that of
the constant regions present in Campath-1H.RTM. antibody.
[0442] Briefly, pCEP4 LIC vector was digested with BfuA1 (New
England Biolabs-NEB) in appropriate buffer following the
manufacturer's recommendations and after complete digestion, the
vector was purified using PureLink.RTM. PCR Purification Kit
(Invitrogen). The linearized plasmid was then treated with T4 DNA
polymerase (New England Biolabs) to generate single-stranded ends
and was used to clone the variable region fragment. Heavy chain
specific pCEP4 LIC vector was used for cloning heavy chain variable
region and light chain specific pCEP4 LIC vector was used for
cloning light chain variable region. Variable region insert was
generated by PCR using pCR2.1-TOPO heavy chain variable region
containing plasmid or pCR2.1-TOPO light chain variable region
containing plasmid as template and primers that contain variable
chain specific sequence and vector overhangs. VENT DNA polymerase
(New England Biolabs) was used for PCR amplification of the insert.
PCR-amplified insert was gel purified and treated with T4 DNA
polymerase to generate single-stranded ends. Prepared vectors for
heavy chain and light chain and respective variable region insert
fragments were combined and incubated at room temperature for 10
minutes and used to transform TOPO10 cells (Invitrogen), ampicillin
resistant colonies were picked and sequence verified. pCEP4 heavy
chain and pCEP4 light chain clones that had the correct heavy chain
and light chain sequences inserted in-frame were amplified and used
for protein production. The heavy chain construct was
co-transfected with the corresponding light chain construct in a
1:1 ratio into HEK293 cells (Invitrogen) using the cationic lipid
Lipofectamine.TM. 2000 (Invitrogen). The conditioned medium was
harvested three days after the transfection and the chimeric
antibody was purified using protein A chromatography. For this
chromatography method, the medium was added to protein A and washed
with 50 column volumes of PBS. The chimeric antibody was eluted
with 5 column volumes of 12.5 mM citric acid, pH 3.0. The pH of the
eluted antibody was neutralized by addition of 0.5 M HEPES. The
buffer was exchanged into PBS by using a PD-10 gel filtration
column.
Example 4
Analysis of the Epitope Specificities of Chimeric Anti-Human CD52
Monoclonal Antibodies
[0443] The epitope specificities of the clones were determined by
assessing the ability of the chimeric antibodies to bind to a panel
of cell lines engineered to express mutants of human CD52 (FIG. 4)
generated by alanine scanning mutagenesis. Antibody substitution of
the first 10 amino acids of the 12 amino acid extracellular region
of CD52 was conducted on human CD52 cDNA in pcDNA3.1 expression
vector (Invitrogen) using the STRATAGENE QUIKCHANGE II XL
site-directed mutagenesis kit. pcDNA3.1 vector encoding wild type
or mutant CD52 sequence was sequence-verified and transfected into
CHO cells using Lipofectamine.TM. and by selecting in media
containing G418 to generate CHO cell lines that expressed wild type
or alanine mutant CD52. Epitope specific binding of anti-human CD52
chimeric antibodies was determined by measuring the binding of the
antibodies against the wild type and mutant CD52 expressing cells
by FACS. FACS analysis was carried out by detecting the binding of
chimeric anti-CD52 antibodies using PE-conjugated goat anti-human
secondary antibody (Jackson ImmunoResearch Labs). FIGS. 5A-5C show
the Mean Fluorescence Intensity (MFI) of anti-CD52 monoclonal
antibodies to wild type and mutant CD52 expressing cell lines. Even
though CD52 is a very short, 12 amino acid, GPI anchored protein,
the FACS results clearly define that there are three sets of
antibodies: (1) N-terminal binding group (such as 4B10); (2) middle
binding group (such as 4G7, 9D9 and 11C1) and (3) C-terminal
binding group (such as 23E6, 12G6, and 2C3). The epitope
specificities of the anti-human CD52 monoclonal antibodies
(identified by the abbreviated names described at the end of
Example 2) are summarized in Table 8.
TABLE-US-00010 TABLE 8 Characteristics of 11 Mouse Anti- Human CD52
Monoclonal Antibodies Epitope Clone Isotype Specificity Rat
YTH34.5HL IgG2a 9-10-11-12 Mouse CF1D12 IgG3 3-4-5-6-7 8G3.25.3.5
IgG3 Not confirmed 4G7.F3 IgG3 3-4-5-6-7 9D9.A2 IgG3 3-4-5-6-7
11C11.C5 IgG3 1-3-4-5-6-7 3G7.E9 IgG2b 1-3-4-5-6-7 5F7.1.1.4 IgG3
1-3-4-5-6-7-10 12G6.15.1.2 IgG3 7-8-9 23E6.2.2.1 IgG3 7-8-9
2C3.3.8.1 IgG3 7-8-9-10 7F11.1.9.7 IgG1 1-2-3-4-5 4B10.1.2.4 IgG2a
1-2-3-4-5
[0444] CD52 is an extremely small antigen but possesses a
relatively large, hydrophilic N-linked glycan moiety as well as a
hydrophobic GPI-anchor. To explore the possibility that the sugars
might constitute all or part of an epitope recognized by the
anti-CD52 antibodies, samples of affinity purified CD52 from
CHO-CD52 cells were treated with the endoglycosidase, PNGase-F, to
completely remove N-linked sugars from the antigen. Treated and
mock-treated control samples were then resolved by SDS-PAGE,
blotted to polyvinylidene fluoride (PVDF) membrane (Invitrogen),
probed with 3 .mu.g/ml final of each of the anti-CD52 chimeric
monoclonal antibodies indicated, and subsequently developed
according to standard western blotting procedures using enhanced
chemiluminescent detection. Blots with Campath-1H.RTM. (C1H) and
with secondary antibody alone (2.degree. Alone) were run as
positive and negative controls, respectively, and probed with each
of the monoclonal antibodies (FIG. 5D). The results revealed
different binding preferences amongst the antibodies for
glycosylated versus de-glycosylated CD52. This characterization
allowed for the categorization of the eleven antibodies into four
types of binding groups: [0445] 1. Antibodies exhibiting binding
with no apparent preference for glycosylated versus de-glycosylated
CD52 (4G7, 9D9) [0446] 2. Antibodies exhibiting binding specific
for glycosylated CD52 (7F11, 4B10) [0447] 3. Antibodies exhibiting
binding specific for de-glycosylated CD52 (8G3) [0448] 4.
Antibodies exhibiting binding preferential for de-glycosylated over
glycosylated CD52 (12G6, 5F7, 23E6, 2C3, 11C11, 3G7)
Example 5
CDC Activity of Chimeric Anti-CD52 Antibodies
[0449] A complement-dependent cytotoxicity (CDC) assay was
performed as described .mu.below. Briefly, CHO K1 cells engineered
to express CD52 protein (CHO-CD52) were used as target cells and
labeled with Na.sub.2.sup.51CrO.sub.4 (New England Nuclear, Boston,
Mass.) at 37.degree. C. for 1-2 hrs. The cells were washed,
resuspended with X-Vivo media, and mixed with anti-human CD52
antibodies to final concentration of 2.2 .mu.g/ml. Human complement
(Sigma) was added to the experimental wells to a final
concentration of 10%. After a 1-5-hour incubation, 25 .mu.l of
cell-free supernatant was collected from each well and counted in a
MicroBeta.RTM. Trilux Scintillation Counter (Wallac, Gaithersburg,
Md.). The amount of .sup.51Cr spontaneously released was obtained
by incubating target cells in medium alone. Spontaneous release
from target cells was typically less than 20%. The total amount of
.sup.51Cr incorporated was determined by adding 1% Triton X-100 in
distilled water, and the percentage lysis was calculated as
follows: [(sample counts per minute (c.p.m.)-spontaneous
c.p.m.)/(total c.p.m.-spontaneous c.p.m.)].times.100.
[0450] Twelve different chimeric anti-CD52 antibodies (mouse
variable region and human IgG1 constant region) were tested in CDC
assay with human complement on CHO-CD52 cells. Campath-1H.RTM.
humanized antibody was used as a positive control. A negative
control was Campath-1H.RTM. null (a non-cell-binding minimal mutant
of Campath-1H.RTM.--two point mutations in H2 loop-heavy chain CDR2
region (K52bD and K53D; Gilliland L K et al., Journal of
Immunology, 162:3663-3671 (1999)). The results indicate that the
chimeric antibodies are capable of mediating CDC killing on
CD52-expressing cells. Some of the chimeric antibodies mediated
robust killing equivalent or better than Campath.RTM. (FIG. 6).
Example 6
ADCC Activity of Chimeric Anti-CD52 Antibodies
[0451] An antibody-dependent cytotoxicity (ADCC) assay was
performed as described below. Briefly, CHO K1 cells engineered to
express CD52 protein (CHO-CD52) were used as target cells and
labeled with Na.sub.2.sup.51CrO.sub.4 (New England Nuclear, Boston,
Mass.) at 37.degree. C. for 1-2 hrs. The cells were washed,
resuspended with X-Vivo media, and mixed with anti-human CD52
antibodies to final concentration of 1.1 .mu.g/ml. Human PBMC were
used as effectors cells and were added at a 1:100
target-to-effector cell ratio. After a 6 hr-overnight incubation,
25 .mu.l of cell-free supernatant was collected from each well and
counted in a MicroBeta.RTM. Trilux Scintillation Counter (Wallac,
Gaithersburg, Md.). The amount of .sup.51Cr spontaneously released
was obtained by incubating target cells in medium alone.
Spontaneous release from target cells was typically less than 20%.
The total amount of .sup.51Cr incorporated was determined by adding
1% Triton X-100 in distilled water, and the percentage lysis was
calculated as follows: [(sample c.p.m.-spontaneous c.p.m.)/(total
c.p.m.-spontaneous c.p.m.)].times.100.
[0452] Twelve different chimeric anti-CD52 antibodies (mouse
variable region and human IgG1 constant region) were tested in ADCC
assay using human PBMC as effector cells. Campath-1H.RTM. humanized
antibody was used as a positive control. Used as a negative control
was Campath-1H.RTM. null (a non-cell-binding minimal mutant of
Campath-1H.RTM.--two point mutations in H2 loop-heavy chain CDR2
region (K52bD and K53D; Gilliland, 1999, supra). The results
indicate that the chimeric antibodies are capable of mediating ADCC
killing on CD52-expressing cells. Some of the chimeric antibodies
mediated robust killing equivalent or better than Campath-1H.RTM.
(FIG. 7).
Example 7
Evaluation of the Binding of Chimeric Anti-CD52 Antibodies to
Defined Lymphocyte Population
[0453] The following fluorochrome conjugated antibodies were used
for flow cytometric analysis: anti-CD3-FITC, anti-CD27-PE,
anti-CD62L-PE CyS, anti-CD56-PE C.gamma.7, anti-CD16-APC C.gamma.7
(BD Biosciences, San Diego, Calif.), anti-CD45RA-ECD (Beckman
Coulter), anti-CD19-Pacific Blue, anti-CD4-APC C.gamma.5.5 and
anti-CD8 pacific orange (Invitrogen, CA). All the mouse chimeric
anti-human CD52 antibodies as well as the humanized Campath-1H.RTM.
were conjugated to Alexa fluor 647 (BD Pharmingen). Healthy human
peripheral blood mononuclear cells were obtained either from
cryopreserved buffy coats or from mononuclear cells separated from
blood of normal donors obtained from commercial vendors
(Bioreclamation, NY, USA). For enrichment of mononuclear cells,
human peripheral blood was diluted 1:1 with sterile phosphate
buffered saline (PBS) and carefully layered over Ficoll-hypaque (GE
Healthcare Bio-Sciences, Uppsala, Sweden) and centrifuged for 30
min at room temperature. The interphase layer of mononuclear cells
was drawn out and washed in PBS containing 5% fetal bovine serum
(FACS buffer). Contaminating red blood cells (RBCs) were lysed with
RBC lysing solution (Sigma, St. Louis, Mo., USA). Cells were
resuspended in cold FACS buffer and the debris was removed using a
40 micron filter. Ten color flow cytometry was performed to
evaluate the binding ability of 9 chimeric anti-human CD52
antibodies (4B10, 7F11, 9D9, 5F7, 2C3, 4G7, 23E6, 8G3, 3G7) as
compared to Campath-1H.RTM..
[0454] Briefly, replicates of 1.times.10.sup.6 PBMC's in FACS
buffer were incubated with a cocktail of pre-titrated dilutions of
antibodies against CD3, CD27, CD45RA, CD62L, CD56, CD19, CD8, CD4,
CD16 along with one of 9 chimeric anti-human CD52 antibodies (4B10,
7F11, 9D9, 5F7, 2C3, 4G7, 23E6, 8G3, 3G7) for 30 min at 4.degree.
C. Cells were washed and fixed in PBS containing 1%
paraformaldehyde. 100,000 events of the stained cells were acquired
on BD LSR-II (BD Biosciences, San Jose, Calif.) and the data was
analyzed using FlowJo 7.2 version Software (Tree Star, Inc, Oregan,
USA). Multiple subsets with distinct phenotypic characteristics
have been defined among B and T lymphocytes and CD52 has been shown
to be expressed on all human lymphocytes. Ten color flow cytometry
analysis was performed to identify the lymphocyte subsets, and to
assess similarities and the differences in the binding
characteristics of anti-CD52 antibodies to cell surface CD52 on
defined subsets. Using a combination of markers, 11 phenotypically
distinct cell populations corresponding to B, T and NK cell
lineages were first defined from the lymphocyte gate. The intensity
of staining which corresponds to the ability of anti-CD52
antibodies to detect CD52 expression was then assessed. The
histograms (FIGS. 8A-8C) show a comparison of the level of
detection of CD52 with each antibody on individual lymphocyte
populations. The data shows that the antibodies exhibit significant
differences in binding to CD52. The level of detection with 4B10,
9D9, 7F11 and Campath-1H.RTM. are comparable, although 4B10
consistently shows the highest level of detection than other
antibodies including Campath-1H.RTM., on almost all the cell
subsets examined. On the other hand, the detection level of CD52
with 3G7, 4G7, 8G3 and 23E6 antibodies is significantly lower. The
results indicate a hierarchy within the antibodies with respect to
their ability to recognize CD52 on different cell populations with
4B10 being highest and 3G7 being the lowest. Interestingly, these
differences are less obvious on CD4 effector and more so on NK cell
subsets on which CD52 appears to be expressed at relatively lower
levels. The variations in the binding characteristics indicate that
the properties of the chimeric antibodies not only differ
significantly from Campath-1H.RTM. but also reflect differences in
properties among the antibodies.
Example 8
Analysis of Chimeric Anti-CD52 Antibodies in Human CD52 Transgenic
Mice (7F11, 8G3, 23E6, 12G6, 4B10 and 5F7)
[0455] Human CD52 transgenic mice were administered either
Campath.RTM. or chimeric anti-CD52 antibodies (7F11, 8G3, 23E6,
12G6, 4B10 and 5F7) to examine the level of lymphocyte depletion.
Mice were injected intra-peritoneally with either Campath.RTM. or
the chimeric anti-CD52 antibodies in a 100 .mu.l volume at a dose
of 1 mg/kg. Three days later mice were sacrificed and blood and
spleens were collected to determine the level of B and T-cell
depletion. Flow cytometry was utilized to evaluate the absolute
numbers of total T helper cells, cytotoxic T cells, and B cells
present in the circulating peripheral blood or spleens of huCD52
transgenic mice. These lymphocyte populations were defined by their
surface expression of the following protein antigens: CD4
expression identifies the T helper cell population, CD8 expression
identifies the cytotoxic T cell population and CD19 expression
identifies all mature B cell populations. A significant level of T
and B-cell depletion was observed for both the 12G6 and 4B10
antibodies, which was comparable to the depletion observed with
Campath.RTM.. Treatment with either Campath.RTM., the chimeric 12G6
or the chimeric 4B10 antibody significantly reduced T and B cells
in both the blood and spleens of treated mice at this dose level.
The 7F11 and 5F7 chimeric antibodies resulted in significant levels
of T cell depletion level in the blood and spleen but were less
effective at depleting B cells in both compartments. Treatment with
the 23E6 antibody resulted in a moderate level of depletion at this
dose while little to no depletion was observed with the lower
affinity 8G3 antibody.
[0456] FIGS. 9A-9C show the level of CD4 T cells, CD8 T cells and
CD19 B cells in the blood 72 hours after dosing with the chimeric
antibodies. FIGS. 10A-10C show the level of CD4 T cells, CD8 T
cells and CD19 B cells in the spleen 72 hours after dosing.
Example 9
Analysis of Chimeric Anti-CD52 Antibodies in Human CD52 Transgenic
Mice (2C3, 3G7, 4B10, 9D9, and 11C11)
[0457] Human CD52 transgenic mice were administered either
Campath.RTM. or chimeric anti-CD52 antibodies (2C3, 3G7, 4B10, 9D9
and 11C11) to examine the level of lymphocyte depletion. Mice were
injected intravenously with either Campath.RTM. or the chimeric
anti-CD52 antibodies in a 100 .mu.l volume at a dose of 1 mg/kg.
Three days later mice were sacrificed and blood and spleens were
collected to determine the level of B and T-cell depletion. Flow
cytometry was utilized to evaluate the absolute numbers of total T
helper cells, cytotoxic T cells, and B cells present in the
circulating peripheral blood of huCD52 transgenic mice. These
lymphocyte populations were defined by their surface expression of
the following protein antigens: CD4 expression identifies the T
helper cell population, CD8 expression identifies the cytotoxic T
cell population and CD19 expression identifies all mature B cell
populations. A significant level of T and B cell depletion was
observed for several antibodies in both the blood and spleen. The
depleting activity for 2C3 and 9D9 was comparable to that observed
with Campath.RTM. with significant levels of CD4 and CD8 T cells
and CD19 B cells being depleted. Treatment with chimeric 4B10 also
resulted in a significant decrease in the numbers of lymphocytes in
the blood of transgenic mice. While treatment with either the
chimeric antibody 3G7 or 11C11 antibody significantly depleted T
cells in the blood, the level of B cells present were not
significantly affected at this dose.
[0458] FIGS. 11A-11C show the level of CD4 T cells, CD8 T cells and
CD19 B cells in the blood 72 hours after dosing with the chimeric
antibodies.
Example 10
Analysis of the Efficacy of Anti-CD52 Antibodies (7F11, 4B10 and
12G6)
[0459] Forty SCID mice (n=8 per group) were injected with
1.times.10.sup.6 B104 tumor cells in 100 .mu.l volume on the right
flank. On day 11 post tumor cell injection, treatment began with
Campath.RTM., 7F11, 4B10 or 12G6 chimeric antibodies. Antibodies
were administered once weekly at 10 mg/kg by intraperitoneal
injection throughout the remainder of the experiment. All mice in
the untreated group developed progressively growing tumors
requiring sacrifice with a median survival of 29 days. Treatment
with Campath.RTM. resulted in a statistically significant increase
in survival compared to the untreated group (median survival (MS)
of 50 days and p<0.0001). Treatment with the chimeric anti-CD52
antibodies also resulted in a statistically significant increase in
survival compared to untreated mice (p<0.0001 for 7F11 and 4B10
and p=0.0020 for 12G6). Based on survival rates, the activity of
both 7F11 and 4B10 antibodies appears to be greater than
Campath.RTM. (63% survival for 7F11 and 75% survival for 4B10
compared to 50% survival for Campath.RTM.). FIG. 12 shows the
percent survival of the mice after treatment.
Example 11
Analysis of the Efficacy of Anti-CD52 Antibodies (2C3, 8G3 and
23E6)
[0460] Forty SCID mice (n=8 per group) were injected with
1.times.10.sup.6 B104 tumor cells in a 100 .mu.l volume on the
right flank. On day 11 post tumor cell injection, treatment began
with either Campath.RTM., 2C3, 8G3 or 23E6 chimeric antibodies.
Antibodies were administered once weekly at 10 mg/kg by
intraperitoneal injection throughout the remainder of the
experiment. All mice in the untreated group developed progressively
growing tumors requiring sacrifice with a median survival of 26
days. Treatment with Campath.RTM., 23E6, and the 2C3 antibody
resulted in statistically significant increases in survival
(p=0.0025, p=0.0007, and p=0.0002 respectively). FIG. 13 shows the
percent survival of the mice after treatment.
Example 12
Analysis of the Efficacy of Chimeric Anti-CD52 Antibodies in a
Xenograft Tumor Model (9D9 and 4B10)
[0461] Forty SCID mice (n=8 per group) were injected with
1.times.10.sup.6 B104 tumor cells in a 100 .mu.l volume on the
right flank. On day 11 post tumor cell injection, treatment began
with either Campath.RTM., 9D9 or 4B10 chimeric antibody. Antibodies
were administered once weekly at 10 mg/kg by intraperitoneal
injection throughout the remainder of the experiment. All mice in
the untreated group developed progressively growing tumors
requiring sacrifice with a median survival of 27 days. Treatment
with Campath.RTM. resulted in a statistically significant increase
in survival compared to the untreated group (median survival not
achieved and p<0.0001). Treatment with the chimeric anti-CD52
antibodies also resulted in a statistically significant increase in
survival compared to untreated mice (p<0.0001 for 9D9 and 4B10).
Statistical analysis of the survival curves reveals that the 9D9
chimeric antibody displayed activity comparable to Campath.RTM.
(p=0.0675) in this experiment. FIG. 14 shows the percent survival
of the mice after treatment.
Example 13
Analysis of the Efficacy of Chimeric Anti-CD52 Antibodies in a
Xenograft Tumor Model (2C3 and 11C11)
[0462] Forty SCID mice (n=8 per group) were injected with
1.times.10.sup.6 B104 tumor cells in a 100 .mu.l volume on the
right flank. On day 11 post tumor cell injection, treatment began
with either Campath.RTM., 2C3 or 11C11 chimeric antibody.
Antibodies were administered once weekly at 10 mg/kg by
intraperitoneal injection throughout the remainder of the
experiment. All mice in the untreated group developed progressively
growing tumors requiring sacrifice with a median survival of 32
days. Treatment with Campath.RTM. resulted in a statistically
significant increase in survival compared to the untreated group
(median survival not achieved and p<0.0001). Treatment with the
chimeric anti-CD52 antibodies also resulted in a statistically
significant increase in survival compared to untreated mice
(p<0.0001 for 2C3 and p=0.0004 for 11C11). Statistical analysis
of the survival curves reveals that both the 2C3 and 11C11 chimeric
antibodies displayed activity comparable to Campath.RTM. (p=0.3173
for 2C3 and p=0.9703 for 11C11). FIG. 15 shows the percent survival
of the mice after treatment with Campath.RTM., 2C3 chimeric
antibody or 11C11 chimeric antibody.
Example 14
Generation and Analysis of Humanized Anti-CD52 Antibody 4B10
[0463] Humanized anti-human CD52 antibody 4B10 was generated by
grafting the CDR regions from the mouse 4B10 antibody into a human
antibody variable region framework. Mouse 4B10 heavy chain and
light chain sequences were evaluated by a web-based sequence
alignment in order to identify a human germline heavy chain and
light chain framework sequence that would serve as a suitable
acceptor for the CDR graft (FIG. 16). The residues defining the CDR
regions by Kabat and IMGT.RTM. were superimposed into human
framework regions that have high sequence identity to generate
humanized heavy chain and light chain sequences. Visual inspection
and sequence analysis of the superimposed 4B10 heavy and light
chain sequences was carried out to identify the most suitable
acceptor sequence. Of all the germline sequences that have high
similarity, the VH3-72 germline sequence for heavy chain and the
VK2-A18b for light chain (human germ line sequences can be found at
the website described in the publication by Tomlinson, I M, et al.,
EMBO J., 14(18):4628-4638 (1995); Cook, G P., et al., Nature
Genetics, 7:162-168 (1994)) were selected from their high degree of
homology, sequence similarity to mouse framework regions and for
minimal disruption of CDR loop structure as CDR acceptor sequence.
CDR1, 2, and 3 sequences of heavy chain and light chain for 4B10
were grafted into VH3-72 and VK2-A18b human framework regions
respectively to generate humanized heavy chain and light chain
sequences for 4B10 (illustrated in FIG. 17; FIG. 110).
Example 15
Assessment of the Binding Activities of Chimeric and Humanized 4B10
Monoclonal Antibodies
[0464] Chimeric and humanized 4B10 antibodies were produced and
purified as described in Example 3 and analyzed for their ability
to bind to the B cell line B104, which endogenously expresses CD52,
by FACS. Briefly, 2.times.10.sup.5 B104 cells were incubated with
antibody (0.02 .mu.g/ml to 16.7 .mu.g/ml) in PBS containing 5%
fetal bovine serum and 5% goat serum. The bound antibody was
detected with FITC labeled goat anti-human secondary antibody which
detected chimeric or humanized anti-CD52 antibodies. Labeled cells
were analyzed using a FACSCalibur.TM. system (Becton Dickinson).
FIG. 18 shows the fold increase in Geometric mean fluorescence
intensity of each sample normalized (divided) to that of
2.degree.-only sample. The 11 different concentrations (12.sup.th
point on X axis is secondary alone) of the humanized and chimeric
antibody used in the assay is shown on the X axis and the Geo Mean
fold increase in the mean fluorescence is on the Y axis. The
results indicate that the humanized 4B10 antibody bound as well or
slightly better than chimeric 4B10 antibody to CD52 expressing
cells.
Example 16
Assessment of the ADCC Activities of Chimeric and Humanized 4B10
Monoclonal Antibodies
[0465] Humanized and chimeric 4B10 antibodies were evaluated for
their ability to mediate ADCC killing of CD52-expressing cells. An
ADCC assay was carried out as described above in Example 6.
Briefly, CHO K1 cells engineered to express CD52 protein (CHO-CD52)
were used as target cells and labeled with Na.sub.2.sup.51CrO.sub.4
(New England Nuclear, Boston, Mass.) at 37.degree. C. for 1-2 hrs.
The cells were washed, resuspended in RPMI 1640 media with 10% FCS,
and mixed with chimeric or humanized 4B10 antibodies at various
concentrations ranging from 10 .mu.g/ml to 0.01 .mu.g/ml. Human
PBMC were used as effectors cells and were added at 1:50
target-to-effector cell ratio. After a 6 hr-overnight incubation,
25 .mu.l of cell-free supernatant was collected from each well and
counted in a MicroBeta.RTM. Trilux Scintillation Counter (Wallac,
Gaithersburg, Md.). The amount of .sup.51Cr spontaneously released
was obtained by incubating target cells in medium alone.
Spontaneous release from target cells was typically less than 20%.
The total amount of .sup.51Cr incorporated was determined by adding
1% Triton X-100 in distilled water, and the percentage lysis was
calculated as follows: [(sample c.p.m.-spontaneous c.p.m.)/(total
c.p.m.-spontaneous c.p.m.)].times.100.
[0466] FIG. 19 illustrates the concentrations of control, chimeric
and humanized 4B10 antibodies used in the assay (X axis) and the Y
axis shows % specific killing. The results indicate that humanized
4B10 antibody mediated equivalent or slightly better ADCC killing
than chimeric 4B10 antibody. The control IgG1 isotype control
showed only low levels of background killing at the concentrations
tested.
Example 17
Assessment of the CDC Activities of Chimeric and Humanized 4B10
Monoclonal Antibodies
[0467] Humanized and chimeric 4B10 antibodies were evaluated for
their ability to mediate cytotoxic effect on B104 cells that
endogenously express CD52 in the presence of human complement.
CellTiter-Glo.RTM. kit (Promega) was used to determine the live
cells remaining in the assay. Briefly, B104 cells (target cells)
were plated at 2.5.times.10.sup.4 cells/well in a 96 well plate and
were mixed with chimeric or humanized 4B10 antibody at various
concentrations ranging from 1 .mu.g/ml to 25 .mu.g/ml and human
complement to a final concentration of 10%. Complement alone
without the antibody and antibody alone without complement were
used as controls to determine the background. After three hours of
incubation at 37.degree. C., plates were centrifuged for 3 min at
1500 rpm and the live cells present in the pellet were determined
using CellTiter-Glo.RTM. assay. Plates were read on Envision
machine. FIG. 20 shows the live cells present in the assay as
measured using CellTiter-Glo.RTM. assay. Again, with the increasing
concentrations of the humanized and chimeric 4B10 antibody there is
a decrease in the number of live cells. These results suggest that
the humanized antibody performed as well as or slightly better than
chimeric 4B10 antibody in CDC mediated killing of B104 cells.
Example 18
Analysis of Pharmacokinetic Profile of Chimeric And Humanized
Anti-CD52 Antibodies in CD52 Transgenic Mice (12G6, 7F11, Chimeric
And Humanized 4B10)
[0468] Human CD52 transgenic mice were administered one of
Campath.RTM., 12G6, 7F11, and chimeric and humanized 4B10 anti-CD52
antibodies to examine the level of lymphocyte depletion. Mice were
injected intravenously with one of those antibodies in a 100 .mu.l
volume at a dose of 1 mg/kg. For analysis of anti-antibody
responses, 100 .mu.l of blood was collected into serum separator
tubes via puncture of the retro-orbital plexus at 2 hours, 1, 2, 4,
7, and 10 days post antibody injection. ELISA analysis was used to
determine the level of circulating human IgG1 in each serum sample.
Based on circulating levels of antibody, there appears to be little
to no difference between Campath.RTM., 7F11, and the chimeric and
humanized forms of 4B10. The 12G6 antibody displayed lower cmax
values following injection, suggesting that this antibody may be
degraded more quickly. FIG. 21 shows the pharmacokinetic profile of
Campath.RTM., 12G6 (chimeric), 7F11 (chimeric), 4B10 (chimeric) and
4B10 (humanized) antibodies.
Example 19
Analysis of the Depleting Activity of Chimeric and Humanized
Anti-CD52 Antibodies in CD52 Transgenic Mice (Chimeric and
Humanized 4B10)
[0469] Human CD52 transgenic mice were administered either
Campath.RTM. or chimeric or humanized 4B10 anti-human CD52 antibody
to examine the level of lymphocyte depletion. Mice were injected
intravenously with either Campath.RTM. or the chimeric or humanized
4B10 anti-human CD52 antibody in a 100 .mu.l volume at a dose of
0.1 mg/kg. Three days later mice were sacrificed and blood and
spleens were collected to determine the level of B and T-cell
depletion. Flow cytometry was utilized to evaluate the absolute
numbers of total T helper cells, cytotoxic T cells, and B cells
present in the circulating peripheral blood of the huCD52
transgenic mice. These lymphocyte populations were defined by their
surface expression of the following protein antigens: CD4
expression identifies the T helper cell population, CD8 expression
identifies the cytotoxic T cell population and CD19 expression
identifies all mature B cell populations. Comparison of the
depleting activity in the spleen revealed that there was no
difference in the level of T cells depleted following
administration of either Campath.RTM. or the chimeric or humanized
forms of 4B10. Due to the low dose used, only a modest level of
depletion of B cells was observed in the spleen. On a per animal
basis it appears that the humanized 4B10 antibody is as good or
slightly better than Campath.RTM. at mediating lymphocyte
depletion. FIGS. 22A-22C show the level of CD4 T cells, CD8 T cells
and CD19 B cells in the blood 72 hours after dosing with the
chimeric and humanized antibodies.
Example 20
Relative Binding Efficiency of Anti-human CD52 Antibodies
[0470] The EC50 values of selected anti-CD52 antibodies were
estimated using CHO cells engineered to express CD52. CHO-CD52
cells were trypsinized in 0.25% trypsin, collected, and rinsed with
PBS/5% FBS. Cells were then deposited into round-bottom 96 well
plates at 1E5 cells per well. Primary antibody staining was done
with a 12 point serial dilution (1:2) of each anti-CD52 chimeric
antibody starting at 50 .mu.g/mL. FITC-conjugated goat FAB2
fragment of anti-human Fc gamma at 10 .mu.g/mL (Jackson
109-096-098) secondary was used. Cells were washed 3 times in
ice-cold PBS/5% FBS before and after each incubation. Cells were
fixed with PBS containing 2% methanol-free paraformaldehyde and
evaluated by flow cytometry. The flow cytometry data was analyzed
using Graph pad Prizm software to determine EC50 value with 95%
confidence interval.
[0471] Binding data (FIG. 23) indicates that the new CD52
antibodies not only have different epitope specificities as
mentioned earlier, but also have different binding characteristics
as shown in the table given below. Campath-1H.RTM., 7F11, 4B10, 2C3
and 12G6 chimeric antibodies showed relatively similar EC 50 values
between 0.5 to 2.5 .mu.g/ml/. 9D9 chimeric antibody showed slightly
different binding characteristics with EC50 value around 5 to 7
.mu.g/ml. 4B10 humanized antibody showed similar binding
characteristics as that of chimeric 4B10 antibody, indicating that
the humanized antibody retained the binding characteristics as that
of chimeric 4B10 antibody.
TABLE-US-00011 TABLE 9 EC50 (.mu.g/mL) Clone ID Mean STDEV C1H*
1.36 0.46 2C3-Chi 1.32 0.33 4B10-Chi 2.18 0.33 4B10-H1/K1 2.23 0.50
7F11-Chi 2.22 0.29 9D9-Chi 6.05 1.18 12G6-Chi 0.95 0.21 *C1H refers
to Campath-1H .RTM..
Example 21
Humanization of Anti-CD52 Antibody Clone 7F11
[0472] Humanization of anti-human CD52 antibody clone 7F11 was
performed by grafting the CDR regions from the mouse 7F11 antibody
into a human antibody variable region framework as described in
Example 14 for 4B10 antibody humanization. CDR-1, CDR-2, and CDR-3
sequences of the heavy chain and light chain of 7F11 were grafted
into VH3-72 and VK2 A18b human framework regions, respectively. The
human JH6 (WGQGTTVTVSS: SEQ ID NO: 133) and JK2 (FGQGTKLEIK: SEQ ID
NO: 134) sequences were selected as the C-terminal peptides for the
humanized heavy and light chains, respectively, to generate
humanized heavy chain (7F11-SFD1 and 7F11-SFD2) and humanized light
chain (7F11-VK2) variable region sequences for 7F11 (FIG. 24). The
two humanized heavy chain variable region sequences (7F11-SFD1 and
7F11-SFD2) differ by one amino acid residue in the CDR-3 region.
The 7F11-SFD1 version has a threonine at position 93 (denoted by
the Kabat numbering system), while the 7F11-SFD2 version has an
alanine at this position. Position 93 is underlined for both
7F11-SFD1 and 7F11-SFD2 in FIG. 24.
[0473] The full-length heavy chain amino acid sequence of 7F11-SFD1
(SEQ ID NO: 274) and the full-length light chain amino acid
sequence of 7F11-K2 (SEQ ID NO: 275) are shown in FIG. 107.
Example 22
Assessment of the Binding Activities of Chimeric and Humanized 7F11
Monoclonal Antibodies
[0474] Chimeric and humanized 7F11 antibodies (7F11-SFD1/K2 and
7F11-SFD2/K2) were produced and purified using the methods
described in Example 3, and analyzed for their ability to bind to
CD52 expressed on the surface of CHO-CD52 cells (CHO cells
engineered to express human CD52) by flow cytometry. Briefly,
2.times.10.sup.5 CHO-CD52 cells were incubated with an antibody at
10 .mu.g/ml in PBS containing 5% fetal bovine serum and 5% goat
serum. Bound antibody was detected with a FITC-labeled goat
anti-human secondary antibody which detected chimeric or humanized
anti-CD52 antibodies. Labeled cells were analyzed using a
FACSCalibur.TM. system (Becton Dickinson) and the data was analyzed
using FlowJo version 7.2 software (Tree Star, Inc, Oregon, USA).
The histogram in FIG. 25 compares the levels of CD52 detected with
chimeric and humanized 7F11 antibodies. The results indicate that
the humanized 7F11 antibodies bound as well or slightly better than
the chimeric 7F11 antibody to CD52 expressing cells.
Example 23
Humanization of Anti-CD52 Antibody Clone 2C3
[0475] Humanization of anti-human CD52 antibody clone 2C3 was
performed by grafting the CDR regions from the mouse 2C3 antibody
into a human antibody variable region framework as described in
Example 14 for clone 4B10 antibody humanization. CDR-1, CDR-2, and
CDR-3 sequences of the heavy chain and light chain of 2C3 were
grafted into VH3-72 and VK2 A18b human framework regions,
respectively. The human JH6 (WGQGTTVTVSS: SEQ ID NO: 133) and JK5
(FGQGTRLEIK: SEQ ID NO: 135) sequences were selected as the
C-terminal peptides for the humanized heavy and light chains,
respectively, to generate humanized heavy chain (2C3-SFD1) and
light chain (2C3-VK1) variable region sequences for 2C3 (FIGS. 26A
and B). Unlike humanized clones 4B10 and 7F11, the binding affinity
for the CDR-grafted humanized 2C3 antibody was greatly reduced.
Binding affinity was restored by introducing back mutations to the
CDR-grafted structure, with the aim of limiting the number of back
mutations to a minimum to keep the reshaped antibody as "human" as
possible, thus reducing the possibility of immunogenicity. Single
or multiple back mutations were incorporated into both the
humanized heavy and light chain variable region sequences. The
positions of the back mutations (as denoted by the Kabat numbering
system) are depicted in Table 10 and Table 11 below. Antibodies
generated with these back mutations were evaluated for restored
binding affinity. Three light chain variants (2C3-VK1(L46R), also
referred to as 2C3-VK11; 2C3-VK1(Y36L-L46R), also referred to as
2C3-VK12; and 2C3-VK1(M4I-A19V-Y36L-Q45K-L46R), also referred to as
2C3-VK13) and 5 heavy chain variants (2C3-SFD1(L78V), also referred
to as 2C3-VH12; 2C3-SFD1(G49A), also referred to as 2C3-VH15;
2C3-SFD1(G49A-L78V), also referred to as 2C3-VH16;
2C3-SFD1(L18M-G49A-L78V), also referred to as 2C3-VH17; and
2C3-SFD1(L18M-G42E-G49A-L78V), also referred to as 2C3-VH19) were
generated using standard molecular biology techniques. The amino
acid sequences for CDR-grafted heavy chain variable region sequence
2C3-SFD1 and back mutants 2C3-VH12, 2C3-VH15, 2C3-VH16, 2C3-VH17,
and 2C3-VH19 are shown in FIG. 26A with the back mutated amino
acids underlined and the CDRs boldfaced. Similarly, for the light
chain sequences, CDR-grafted variable region sequence 2C3-VK1 and
back mutants 2C3-VK11, 2C3-VK12, and 2C3-VK13 are shown in FIG. 26B
with the back mutated amino acids underlined and the CDRs
boldfaced.
[0476] The full-length heavy chain amino acid sequence of 2C3-SFD1
(SEQ ID NO: 272) and the full-length light chain amino acid
sequence of 2C3-K12 (SEQ ID NO: 273) are shown in FIG. 106.
TABLE-US-00012 TABLE 10 2C3 clone heavy chain back mutants Clone ID
Mutation (Kabat numbering position) 2C3-VH12 L to V (78) 2C3-VH15 G
to A (49) 2C3-VH16 G to A (49), L to V (78) 2C3-VH17 L to M (18), G
to A (49), L to V (78) 2C3-VH19 L to M (18), G to E (42), G to A
(49), L to V (78)
TABLE-US-00013 TABLE 11 2C3 clone light (kappa) chain back mutants
Clone ID Mutation (Kabat numbering position) 2C3-VK11 L to R (46)
2C3-VK12 Y to L (36) and L to R (46) 2C3-VK13 M to I (4), A to V
(19), Y to L (36), QL to KR (45, 46)
Example 24
Assessment of the Binding Activities of Chimeric and Humanized 2C3
Monoclonal Antibodies
[0477] Chimeric and humanized 2C3 antibodies were produced and
purified using the methods described in Example 3. A number of the
humanized antibodies produced by pairing heavy chain variants with
light chain variants, and a corresponding chimeric antibody, were
analyzed by flow cytometry for their ability to bind to CD52
expressed on the surface of CHO-CD52 cells, using the methods
described in Example 22. The binding data suggest that clones
generated by pairing heavy chain variants with light chain variants
2C3-VK1 or 2C3-VK11 had reduced binding ability, while clones
generated by pairing heavy chain variants with 2C3-VK12 or 2C3-VK13
showed binding equivalent to or better than that of a chimeric 2C3
antibody. A representative histogram of selected clones (FIG. 27A)
compares the level of CD52 detected by chimeric and humanized 2C3
antibodies. Binding of 2C3-SFD1/K1 is reduced significantly
compared to that of the corresponding chimeric antibody.
Incorporating a single mouse residue at position 46 (leucine to
arginine) in the light chain (resulting in 2C3-VK11) did not
restore the binding when paired with heavy chain 2C3-SFD1 to make
antibody 2C3-SFD1/K11. Further, binding was not restored by
incorporating three back mutations in the heavy chain (resulting in
2C3-VH17) to make antibody 2C3-H17/K11. However, binding was
completely restored when the 2C3-SFD1 heavy chain was paired with
2C3-VK12, which has two back mutations, to make antibody
2C3-SFD1/K12, suggesting that specific back mutations need to be
incorporated to restore binding avidity. FIG. 27B shows a histogram
of selected humanized clones that demonstrate binding equivalent to
that of a chimeric 2C3 antibody. These results indicate that the
back mutation of two amino acid residues in the 2C3-VK12 light
chain was sufficient to completely restore antibody avidity. The
changes at residues 36 (Y to L) and 46 (L to R) were able to
restore binding when paired with almost any heavy chain variant. As
such, the humanized 2C3 clone showing restored binding with minimal
framework residues derived from the original mouse antibody is
2C3-SFD1/K12.
Example 25
Humanization of Anti-CD52 Antibody Clone 12G6
[0478] Humanization of anti-human CD52 antibody clone 12G6 was
performed by grafting the CDR regions from the mouse 12G6 antibody
into a human antibody variable region framework as described in
Example 14 for clone 4B10 antibody humanization. CDR-1, CDR-2, and
CDR-3 sequences of the heavy chain and light chain of 12G6 were
grafted into VH3-72 and VK2 A18b human framework regions,
respectively. The human JH6 (WGQGTTVTVSS: SEQ ID NO: 133) and JK2
(FGQGTKLEIK: SEQ ID NO: 134) sequences were selected as the
C-terminal peptides for the humanized heavy and light chains,
respectively, to generate humanized heavy chain (12G6-SFD1) and
light chain (12G6-VK1) variable region sequences for 12G6 (FIGS.
28A and 28B). When the 12G6-SFD1 heavy chain variable region and
12G6-VK1 light chain variable region were combined in the humanized
12G6-SFD1/K1 antibody, the binding affinity for CD52 was greatly
reduced. Binding affinity was restored by introducing back
mutations to the CDR grafted structure. Single or multiple back
mutations were incorporated into both the humanized heavy and light
chain variable region sequences. The positions of these back
mutations (as denoted by the Kabat numbering system) are depicted
in Table 12 and Table 13 below. Antibodies generated with these
back mutations were evaluated for restored binding affinity. Four
light chain variants (12G6-VK1(Y36V), also referred to as
12G6-VK10; 12G6-VK1(Y36V-Q45K-L46R), also referred to as 12G6-VK11;
12G6-VK1(Y36V-L46R), also referred to as 12G6-VK12; and
12G6-VK1(L46R), also referred to as 12G6-VK13) and three heavy
chain variants (12G6-SFD1(L78V), also referred to as 12G6-VH10;
12G6-SFD1(G49A), also referred to as 12G6-VH11; and
12G6-SFD1(G49A-L78V), also referred to as 12G6-VH12) were generated
using standard molecular biology techniques. The amino acid
sequences for the CDR grafted heavy chain variable region sequence
12G6-SFD1 and back mutants 12G6-VH10, 12G6-VH11, and 12G6-VH12 are
shown in FIG. 28A with the back mutated amino acids underlined and
the CDRs boldfaced. Similarly, for the light chain sequences, CDR
grafted variable region sequence 12G6-VK1 and back mutants
12G6-VK10, 12G6-VK11, 12G6-VK12, and 12G6-VK13 are shown in FIG.
28B with the back mutated amino acids underlined and the CDRs
boldfaced.
[0479] The full-length heavy chain amino acid sequence of 12G6-SFD1
(SEQ ID NO: 279) and the full-length light chain amino acid
sequence of 12G6-K12 (SEQ ID NO: 280) are shown in FIG. 109.
TABLE-US-00014 TABLE 12 12G6 clone heavy chain back mutants Clone
ID Mutation (Kabat numbering position) 12G6-VH10 L to V (78)
12G6-VH11 G to A (49) 12G6-VH12 G to A (49) and L to V (78)
TABLE-US-00015 TABLE 13 12G6 clone light (kappa) chain back mutants
Clone ID Mutation (Kabat numbering position) 12G6-VK10 Y to V (36)
12G6-VK11 Y to V (36), QL to KR (45, 46) 12G6-VK12 Y to V (36), L
to R (46) 12G6-VK13 L to R (46)
Example 26
Assessment of the Binding Activities of Chimeric and Humanized 12G6
Monoclonal Antibodies
[0480] Chimeric and humanized 12G6 antibodies were produced and
purified using the methods described in Example 3. A number of the
humanized antibodies produced by pairing heavy chain variants with
light chain variants, and a corresponding chimeric antibody, were
analyzed by flow cytometry for their ability to bind to CD52
expressed on the surface of CHO-CD52 cells, using the methods
described in Example 22. The binding data suggest that clones
generated by pairing heavy chain variants with light chain variants
12G6-VK1, 12G6-VK10, or 12G6-VK13 had reduced binding ability,
while clones generated by pairing heavy chain variants with
12G6-VK11 or 12G6-VK12 showed binding equivalent to or better than
that of the corresponding chimeric 12G6 antibody. A representative
histogram of selected clones (FIG. 29) compares the level of CD52
detected by chimeric and humanized 12G6 antibodies. These results
indicate that the back mutation of two amino acid residues in the
12G6 light chain variable region (clone 12G6-VK12) was sufficient
to completely restore antibody specificity. The changes at Kabat
numbering residues 36 (Y to V) and 46 (L to R) were able to restore
binding when paired with almost any heavy chain variant. As such,
the humanized 12G6 clone showing restored binding with minimal
framework residues derived from the original mouse antibody is
12G6-SFD1/K12.
Example 27
Humanization of Anti-CD52 Antibody Clone 9D9
[0481] Humanization of anti-human CD52 antibody clone 9D9 was
performed by grafting the CDR regions from the mouse 9D9 antibody
into a human antibody variable region framework as described in
Example 14 for clone 4B10 antibody humanization. CDR-1, CDR-2, and
CDR-3 sequences of the heavy chain and light chain of 9D9 were
grafted into VH3-23 and VK2 A18b human framework regions,
respectively. The human JH6 (WGQGTTVTVSS: SEQ ID NO: 133) and JK2
(FGQGTKLEIK: SEQ ID NO: 134) sequences were selected as the
C-terminal peptides for the humanized heavy and light chains,
respectively, to generate humanized heavy chain (9D9-VH10) and
light chain (9D9-VK2) variable region sequences (FIGS. 30A and
30B). When the 9D9-VH10 heavy chain and 9D9-VK2 light chain were
combined in the humanized 9D9-H10/K2 antibody, the binding affinity
for CD52 was greatly reduced. Binding affinity was restored by
introducing back mutations to the CDR grafted structure. Single or
multiple back mutations were incorporated into both the humanized
heavy and light chain variable region sequences. The positions of
the back mutations (as denoted by the Kabat numbering system) are
depicted in Table 14 and Table 15 below. Antibodies generated with
these back mutations were evaluated for restored binding affinity.
Four light chain variants (9D9-VK2(Y36L-Q45K-L46R), also referred
to as 9D9-VK12; 9D9-VK2(Y36L-L46R), also referred to as 9D9-VK13;
9D9-VK2(L46R), also referred to as 9D9-VK14; and
9D9-VK2(Q45K-L46R), also referred to as 9D9-VK15) and five heavy
chain variants (9D9-VH10(W47L-V48T-S49A-N76S-L78V), also referred
to as 9D9-VH11; 9D9-VH10(W47L-V48T-S49A), also referred to as
9D9-VH15; 9D9-VH10(W47L), also referred to as 9D9-VH16;
9D9-VH10(W47L-V48T), also referred to as 9D9-VH17; and
9D9-VH10(W47L-S49A), also referred to as 9D9-VH18) were generated
using standard molecular biology techniques. The amino acid
sequences for CDR-grafted heavy chain variable region sequence
9D9-VH10 and back mutants 9D9-VH11, 9D9-VH15, 9D9-VH16, 9D9-VH17,
and 9D9-VH18 are shown in FIG. 30A with the back mutated amino
acids underlined and the CDRs boldfaced. Similarly, for the light
chain sequences, CDR-grafted variable region sequence 9D9-VK2 and
back mutants 9D9-VK12, 9D9-VK13, 9D9-VK14, and 9D9-VK15 are shown
in FIG. 30B with the back mutated amino acids underlined and the
CDRs boldfaced.
[0482] The full-length heavy chain amino acid sequences of 9D9-H16
(SEQ ID NO: 276) and 9D9-H18 (SEQ ID NO: 277), and the full-length
light chain amino acid sequence of 9D9-K13 (SEQ ID NO: 278) are
shown in FIG. 108.
TABLE-US-00016 TABLE 14 9D9 heavy chain back mutants Clone ID
Mutation (Kabat numbering position) 9D9-VH11 WVS to LTA (47-49), N
to S (76), L to V (78) 9D9-VH15 WVS to LTA (47-49) 9D9-VH16 W to L
(47) 9D9-VH17 WV to LT (47, 48) 9D9-VH18 W to L (47) and S to A
(49)
TABLE-US-00017 TABLE 15 9D9 light (kappa) chain back mutants Clone
ID Mutation (Kabat numbering position) 9D9-VK12 Y to L (36) and QL
to KR (45, 46) 9D9-VK13 Y to L (36) and L to R (46) 9D9-VK14 L to R
(46) 9D9-VK15 QL to KR (45, 46)
Example 28
Assessment of the Binding Activities of Chimeric and Humanized 9D9
Monoclonal Antibodies
[0483] Chimeric and humanized 9D9 antibodies were produced and
purified using the methods described in Example 3. A number of the
humanized antibodies produced by pairing heavy chain variants with
light chain variants, and a corresponding chimeric antibody, were
analyzed by flow cytometry for their ability to bind to CD52
expressed on the surface of CHO-CD52 cells (CHO cells engineered to
express human CD52), using the methods described in Example 22. The
binding data suggest that clones generated by pairing heavy chain
variants with light chain variants 9D9-VK2, 9D9-VK14, or 9D9-VK15
had reduced binding ability, while clones generated by pairing
9D9-VK12 or 9D9-VK13 light chain variants with back mutated heavy
chain variants 9D9-VH11, 9D9-VH15, 9D9-VH16, and 9D9-VH18 showed
binding equivalent to or better than that of the corresponding
chimeric 9D9 antibody. When light chain variants 9D9-VK12 and
9D9-VK13 were paired with the parental CDR grafted heavy chain
9D9-VH10 or the back mutated 9D9-VH17 sequence, binding was
significantly reduced, suggesting that for humanized 9D9 clones,
both heavy chain and light chain sequences have to be engineered
with back mutations to restore binding ability. A representative
histogram of selected clones (FIG. 31) compares the level of CD52
detected by chimeric and humanized 9D9 antibodies. These results
indicate that the back mutation of two amino acid residues (e.g., Y
to L at position 36, and L to R at position 46) in the 9D9 light
chain variable region (clone 9D9-VK13) was necessary to restore
antibody specificity when paired with heavy chains that were
mutated at one position (e.g., W to L, at position 47) or at two
positions (e.g., W to L at position 47 and S to A at position 49).
As such, the humanized 9D9 clones showing restored binding with
minimal framework residues derived from the original mouse antibody
are 9D9-H16/K13 and 9D9-H18/K13.
Example 29
Determination of Relative Binding Efficiency of Humanized
Anti-Human CD52 Antibodies
[0484] The EC.sub.50 values of chimeric and humanized anti-CD52
antibodies were estimated using CD4+ T cells isolated from healthy
donor PBMCs obtained from commercial sources (Bioreclamation, NY,
USA). CD4+ T cells were isolated by negative selection using an
EasySep.TM. kit (Stem Cell Technologies). CD4+ T cells isolated
from huCD52 transgenic CD1 mouse spleen tissue were also used (Stem
Cell Technologies) according to the methods described above in
Example 20 for CHO-CD52 cells. Briefly, human CD4+ T cells were
isolated from 50 ml of peripheral blood from healthy volunteers
(Bioreclamation), and huCD52 transgenic mouse CD4+ T cells were
isolated from spleen tissue. Cells were rinsed with PBS/5% FBS and
deposited into round-bottom 96 well plates at 1.times.10.sup.5
cells per well. Primary antibody staining was done with an 8 point
serial dilution (1:3) of each anti-CD52 chimeric and humanized
antibody starting at 100 .mu.g/mL. A FITC-conjugated goat
F(ab').sub.2 fragment of anti-human Fc gamma at 10 .mu.g/mL
(Jackson 109-096-098) secondary antibody was used. Cells were
washed 3 times in ice-cold PBS/5% FBS before and after each
incubation. Cells were fixed with PBS containing 2% methanol-free
paraformaldehyde and evaluated by flow cytometry. The flow
cytometry data was analyzed using GraphPad Prism software to
determine an EC.sub.50 value with 95% confidence interval. Based on
the binding of anti-CD52 antibodies to CD4+ T cells isolated from
human PBMCs and to CD4+ T cells isolated from spleen tissue of
human CD52 transgenic mice, binding curves (FIGS. 32A, 32B, 32C)
were generated and EC.sub.50 values estimated and shown in FIG. 33.
All of the antibodies showed similar binding characteristics to
both human CD4+ T cells and to CD4+ T cells isolated from human
CD52 transgenic mice. Binding data indicate that the humanized
antibodies have equivalent or better binding affinities compared to
their parental chimeric antibodies, suggesting that binding
affinity is retained or improved upon humanization. Humanized 2C3
and 12G6 antibodies have at least two fold lower EC.sub.50 values
than a Campath-1H.RTM. antibody as determined by this cell binding
assay.
Example 30
Evaluation of the Binding of Humanized Anti-CD52 Antibodies to a
Defined Lymphocyte Population
[0485] Campath-1H.RTM. (C1H) and humanized 2C3 (2C3-SFD1/K12), 9D9
(9D9-H16/K13 and 9D9-H18/K13), and 12G6 (12G6-SFD1/K11,
12G6-SFD1/K12) antibodies were evaluated for their binding to
various PBMC subsets in normal donor PBMCs using the methods
described above in Example 7 for chimeric anti-CD52 antibodies. A
number of fluorochrome conjugated antibodies were used for flow
cytometric analysis. Anti-CD27-PE, anti-CD19 and anti-CD11c-PE
C.gamma.5, anti-CD56 and anti-CD123-PE C.gamma.7, anti-CD16-APC
C.gamma.7, and CD4-APC were obtained from BD Biosciences (San
Diego, Calif.), while anti-CD54RA-ECD and anti-HLA-DR-ECD were
obtained from Beckman Coulter. Anti-CD3-Pacific Blue, anti-CD8 and
anti-CD14-Pacific Orange, and anti-CD4-APC cy5.5 were obtained from
Invitrogen (CA). All of the humanized anti-human CD52 antibodies
(9D9-H18/K13, 9D9-H16/K13, 12G6-SFD1/K11, 12G6-SFD1/K12, and
2C3-SFD1/K12) as well as the Campath-1H.RTM. were conjugated to
FITC. Healthy human peripheral blood mononuclear cells were
obtained either from cryopreserved buffy coats or from mononuclear
cells separated from the blood of normal donors obtained from
commercial vendors (Bioreclamation, NY, USA) as described above in
Example 7. For enrichment of mononuclear cells, human peripheral
blood was diluted 1:1 with sterile phosphate buffered saline (PBS)
and carefully layered over Ficoll-Hypaque.TM. (GE Healthcare
Bio-Sciences, Uppsala, Sweden) and centrifuged for 30 min at room
temperature. The interphase layer of mononuclear cells was drawn
out and washed in PBS containing 5% fetal bovine serum (FACS
buffer). Contaminating red blood cells (RBCs) were lysed with RBC
lysing solution (Sigma, St. Louis, Mo., USA). Cells were
resuspended in cold FACS buffer and the debris was removed using a
40 .mu.m filter. Multi color flow cytometry was performed to
evaluate the binding ability of humanized anti-human CD52
antibodies 2C3 (2C3-SFD1/K12), 9D9 (9D9-H16/K13 and 9D9-H18/K13)
and 12G6 (12G6-SFD1/K11 and 12G6-SFD1/K12) as compared to
Campath-1H.RTM..
[0486] Briefly, replicates of 1.times.10.sup.6 PBMCs in FACS buffer
were incubated with cocktails of pre-titrated dilutions of
antibodies to examine either lymphocyte or myeloid derived cells.
The lymphocyte cocktail comprised antibodies against CD3, CD27,
CD45RA, CD56, CD19, CD8, CD4, and CD16. The antibody cocktail to
define myeloid populations included antibodies against HLA-DR,
CD11c, CD123, CD4, and CD14. In each of the cocktails, one of the
anti-CD52 antibodies was included at 10 .mu.g/ml concentration. The
cells were stained for 30 min at 4.degree. C. and were washed and
fixed in PBS containing 1% paraformaldehyde. 100,000 events of the
stained cells were acquired on a BD LSR II flow cytometer (BD
Biosciences, San Jose, Calif.), and the data was analyzed using
FlowJo version 7.2 software (Tree Star, Inc., Oregon, USA).
Multiple subsets with distinct phenotypic characteristics have been
defined among B and T lymphocytes, and CD52 has been shown to be
expressed on all human lymphocytes. Multi color flow cytometry
analysis was performed to identify the lymphocyte subsets, and to
assess similarities and differences in the binding characteristics
of the humanized anti-CD52 antibodies to cell surface CD52 on
defined subsets. Using a combination of markers, phenotypically
distinct cell populations corresponding to B, T, NK and antigen
presenting cell lineages were first defined. The intensity of
staining, which corresponds to the ability of humanized anti-CD52
antibodies to detect CD52 expression on each of the defined cell
populations, was assessed and compared to that of Campath-1H.RTM..
The histograms (FIG. 34) compare the level of CD52 detected by each
antibody on individual populations. The results indicate that all
of the humanized anti-CD52 antibodies bind to cell surface CD52 to
a similar extent. Further, no differences were observed between
Campath-1H.RTM. and humanized anti-CD52 antibodies with respect to
the level of detection of cell surface CD52. Analysis was performed
on six different donors. Representative data generated using cells
derived from one donor is shown in FIG. 34. A similar binding
pattern was observed with cells from other donors.
Example 31
Assessment of the ADCC Activities of Chimeric and Humanized 7F11
Monoclonal Antibodies
[0487] Humanized and chimeric 7F11 antibodies were evaluated for
their ability to mediate ADCC killing of CD52 expressing cells. An
ADCC assay was carried out using the methods described above in
Example 6. Briefly, CHO K1 cells engineered to express CD52 protein
(CHO-CD52) were used as target cells. The target cells were labeled
with Na.sub.2.sup.51CrO.sub.4 (New England Nuclear, Boston, Mass.)
at 37.degree. C. for 2-3 hrs. The cells were washed, re-suspended
in RPMI 1640 media with 10% FCS, and mixed with an IgG control
antibody, a chimeric 7F11 antibody, or a humanized 7F11 antibody
(7F11-SFD1/K2 or 7F11-SFD2/K2) at various concentrations ranging
from 5 .mu.g/ml to 0.01 .mu.g/ml. Human NK cells isolated from
PBMCs using an NK cell isolation kit (Stem Cell Technologies) were
used as effector cells and were added at a 1:5 target to effector
cell ratio. After 2-6 hrs incubation, 25 .mu.l of cell-free
supernatant were collected from each well and counted in a
MicroBeta.RTM. Trilux Scintillation Counter (Wallac, Gaithersburg,
Md.). The amount of .sup.51Cr spontaneously released was obtained
by incubating target cells in medium alone. Spontaneous release
from target cells was typically less than 20%. The total amount of
.sup.51Cr incorporated was determined by adding 1% Triton X-100 in
distilled water, and the percentage lysis was calculated as
follows: [(sample c.p.m.-spontaneous c.p.m.)/(total
c.p.m.-spontaneous c.p.m.)].times.100. FIG. 35 illustrates the
concentrations of control IgG, chimeric 7F11 antibody, and
humanized 7F11 antibodies used in the assay (X axis) vs. % specific
lysis (Y axis). The results indicate that humanized 7F11 antibodies
(7F11-SFD1/K2 and 7F11-SFD2/K2) mediated equivalent or slightly
better ADCC killing as compared to a chimeric 7F11 antibody. The
control IgG1 isotype showed only low levels of background killing
at the concentrations tested.
Example 32
Assessment of the CDC Activities of Chimeric and Humanized 7F11
Monoclonal Antibodies
[0488] Humanized and chimeric 7F11 antibodies were evaluated for
their ability to mediate complement dependent cytotoxicity (CDC) of
CD52 expressing cells. A CDC assay was carried out using the
methods described above in Example 5 for chimeric anti-CD52
antibodies. Briefly, CHO K1 cells engineered to express CD52
protein (CHO-CD52) were used as target cells and labeled with
Na.sub.2.sup.51CrO.sub.4 (New England Nuclear, Boston, Mass.) at
37.degree. C. for 2-3 hrs. The cells were washed, resuspended in
RPMI 1640 media, and mixed with an IgG control antibody, a chimeric
7F11 antibody, or a humanized 7F11 antibody (7F11-SFD1/K2 or
7F11-SFD2/K2) at various concentrations ranging from 20 .mu.g/ml to
500 .mu.g/ml. Human complement (Sigma) was added to the
experimental wells to a final concentration of 10%. After a
1-5-hour incubation, 25 .mu.l of cell-free supernatant were
collected from each well and counted in a MicroBeta.RTM. Trilux
Scintillation Counter (Wallac, Gaithersburg, Md.). The amount of
.sup.51Cr spontaneously released was obtained by incubating target
cells in medium alone. Spontaneous release from target cells was
typically less than 20%. The total amount of .sup.51Cr incorporated
was determined by adding 1% Triton X-100 in distilled water, and
the percentage lysis was calculated as follows: [(sample counts per
minute (c.p.m.)-spontaneous c.p.m.)/(total c.p.m.-spontaneous
c.p.m.)].times.100. FIG. 36 illustrates the concentrations of
control IgG, chimeric 7F11 antibody, and humanized 7F11 antibodies
(7F11-SFD1/K2 and 7F11-SFD2/K2) used in the assay (X axis) vs. %
specific lysis (Y axis). The results indicate that the chimeric
7F11 antibody and humanized antibody 7F11-SFD1/K2 mediated
equivalent killing, while humanized antibody 7F11-SFD2/K2 mediated
significantly better CDC killing than the chimeric 7F11 antibody.
The control IgG1 isotype antibody showed only low levels of
background killing at the concentrations tested.
Example 33
Assessment of the ADCC Activities of Chimeric and Humanized 2C3
Monoclonal Antibodies
[0489] Humanized and chimeric 2C3 antibodies were evaluated for
their ability to mediate ADCC killing of CD52 expressing cells. An
ADCC assay was carried out using the methods described above in
Example 6, with slight modifications. Briefly, T cells isolated
from healthy donor PBMCs using a CD4+ T cell isolation kit (Stem
Cell Technologies) were used as target cells. The target cells were
labeled overnight with Na.sub.2.sup.51CrO.sub.4 (New England
Nuclear, Boston, Mass.) at 37.degree. C. The cells were washed,
re-suspended in RPMI 1640 media with 10% FCS, and mixed with an IgG
control antibody, a chimeric 2C3 antibody, or a humanized 2C3
antibody (2C3-SFD1/K12) at various concentrations ranging from 10
.mu.g/ml to 100 pg/ml. Human NK cells isolated from PBMCs (using an
NK cell isolation kit from Stem Cell Technologies) were used as
effector cells and were added at a 1:5 target to effector cell
ratio. After 2-6 hrs of incubation, 25 .mu.l of cell-free
supernatant were collected from each well and counted in a
MicroBeta.RTM. Trilux Scintillation Counter (Wallac, Gaithersburg,
Md.). The amount of .sup.51Cr spontaneously released was obtained
by incubating target cells in medium alone. Spontaneous release
from target cells was typically less than 20%. The total amount of
.sup.51Cr incorporated was determined by adding 1% Triton X-100 in
distilled water, and the percentage lysis was calculated as
follows: [(sample c.p.m.-spontaneous c.p.m.)/(total
c.p.m.-spontaneous c.p.m.)].times.100. FIG. 37 illustrates the
concentrations of control IgG, chimeric 2C3 antibody, and humanized
2C3 antibody (2C3-SFD1/K12) used in the assay (X axis) vs. %
specific lysis (Y axis). The results indicate that the humanized
2C3 antibody 2C3-SFD1/K12 mediated ADCC killing equivalent to that
of the 2C3 chimeric antibody. The IgG1 isotype control showed only
low levels of background killing at the concentrations tested.
Example 34
Assessment of the CDC Activities of Chimeric and Humanized 2C3
Monoclonal Antibodies
[0490] Humanized and chimeric 2C3 antibodies were evaluated for
their ability to mediate complement dependent cytotoxicity (CDC) of
CD52 expressing cells. A CDC assay was carried out using the
methods described above in Example 5, with slight modifications.
Briefly, T cells isolated from healthy donor PBMCs were used as
target cells and labeled overnight with Na.sub.2.sup.51CrO.sub.4
(New England Nuclear, Boston, Mass.) at 37.degree. C. After
overnight labeling, the cells were washed, re-suspended in RPMI
1640 media with 10% FCS, and mixed with an IgG control antibody, a
chimeric 2C3 antibody, or a humanized 2C3 antibody (2C3-SFD1/K12)
at various concentrations ranging from 10 .mu.g/ml to 10 .mu.g/ml.
Human complement (Sigma) was added to the experimental wells to a
final concentration of 10%. After a 1-5 hour incubation, 25 .mu.l
of cell-free supernatant were collected from each well and counted
in a MicroBeta.RTM. Trilux
[0491] Scintillation Counter (Wallac, Gaithersburg, Md.). The
amount of .sup.51Cr spontaneously released was obtained by
incubating target cells in medium alone. Spontaneous release from
target cells was typically less than 20%. The total amount of
.sup.51Cr incorporated was determined by adding 1% Triton X-100 in
distilled water, and the percentage lysis was calculated as
follows: [(sample counts per minute (c.p.m.)-spontaneous
c.p.m.)/(total c.p.m.-spontaneous c.p.m.)].times.100. FIG. 38
illustrates the concentrations of control IgG, chimeric 2C3
antibody, and humanized 2C3 antibody (2C3-SFD1/K12) used in the
assay (X axis) vs. % specific lysis (Y axis). The results indicate
that the chimeric 2C3 antibody and the humanized 2C3 antibody
(2C3-SFD1/K12) mediated equivalent lysis. The control IgG1 isotype
antibody showed only low levels of background killing at the
concentrations tested.
Example 35
Assessment of the ADCC Activities of Chimeric and Humanized 12G6
Monoclonal Antibodies
[0492] Humanized and chimeric 12G6 antibodies were evaluated for
their ability to mediate ADCC killing of CD52 expressing cells. An
ADCC assay was carried out by chromium release assays using T cells
isolated from healthy donor PBMCs as target cells, as described
above in Example 31. FIG. 39 illustrates the concentrations of
control IgG, chimeric 12G6 antibody, and humanized 12G6 antibodies
(12G6-SFD1/K11 or 12G6-SFD1/K12) used in the assay (X axis) vs. %
specific lysis (Y axis). The results indicate that humanized 12G6
antibodies 12G6-SFD1/K11 and 12G6-SFD1/K12 mediated equivalent ADCC
killing as compared to the 12G6 chimeric antibody. The IgG1 isotype
control showed only low levels of background killing at the
concentrations tested.
Example 36
Assessment of the CDC Activities of Chimeric and Humanized 12G6
Monoclonal Antibodies
[0493] Humanized and chimeric 12G6 antibodies were evaluated for
their ability to mediate complement dependent cytotoxicity (CDC) of
CD52 expressing cells. A CDC assay was carried out by chromium
release assays using T cells isolated from healthy donor PBMCs as
target cells, as described above in Example 32. FIG. 40 illustrates
the concentrations of control IgG, chimeric 12G6 antibody, and
humanized 12G6 antibodies (12G6-SFD1/K11 and 12G6-SFD1/K12) used in
the assay (X axis) vs. % specific lysis (Y axis). The results
indicate that the chimeric 12G6 antibody mediated equivalent lysis
as compared to humanized 12G6 antibodies (12G6-SFD1/K11 and
12G6-SFD1/K12). The control IgG1 isotype antibody showed only low
levels of background killing at the concentrations tested.
Example 37
Assessment of the ADCC Activities of Chimeric and Humanized 9D9
Monoclonal Antibodies
[0494] Humanized and chimeric 9D9 antibodies were evaluated for
their ability to mediate ADCC killing of CD52 expressing cells. An
ADCC assay was carried out by chromium release assays using T cells
isolated from healthy donor PBMCs as target cells, as described
above in Example 31. FIG. 41 illustrates the concentrations of
control IgG, chimeric 9D9 antibody, and humanized 9D9 antibodies
(9D9-H10/K13, 9D9-H11/K13, 9D9-H16/K13, and 9D9-H18/K13) used in
the assay (X axis) vs. % specific lysis (Y axis). The results
indicate that the chimeric and humanized 9D9 antibodies (with the
exception of 9D9-H10/K13) mediated equivalent ADCC killing. The
IgG1 isotype control showed only low levels of background killing
at the concentrations tested.
Example 38
Assessment of the CDC Activities of Chimeric and Humanized 9D9
Monoclonal Antibodies
[0495] Humanized and chimeric 9D9 antibodies were evaluated for
their ability to mediate complement dependent cytotoxicity (CDC) of
CD52 expressing cells. A CDC assay was carried out by chromium
release assays using T cells isolated from healthy donor PBMCs as
target cells, as described above in Example 32. FIG. 42 illustrates
the concentrations of control IgG, chimeric 9D9 antibody, and
humanized 9D9 antibodies (9D9-H10/K13, 9D9-H11/K13, 9D9-H16/K13,
and 9D9-H18/K13) used in the assay (X axis) vs. % specific lysis (Y
axis). The results indicate that a chimeric 9D9 antibody mediated
equivalent lysis as compared to humanized 9D9 antibodies (with the
exception of 9D9-H10/K13). The control IgG1 isotype antibody showed
only low levels of background killing at the concentrations
tested.
Example 39
Assessment of the ADCC Activities of Campath-1H.RTM. and Humanized
Anti-CD52 Antibodies on Primary T Cells
[0496] Campath-1H.RTM. and humanized anti-CD52 antibodies were
evaluated for their ability to mediate ADCC killing of CD52
expressing cells. An ADCC assay was carried out by chromium release
assays using T cells isolated from healthy donor PBMCs as target
cells, as described above in Example 31. FIG. 43 illustrates the
concentrations of control IgG, Campath-1H.RTM., and humanized
2C3-SFD1/K12, 9D9-H16/K13, 9D9-H18/K13, 12G6-SFD1/K11, and
12G6-SFD1/K12 antibodies used in the assay (X axis) vs. % specific
lysis (Y axis). The results indicate that the above humanized 2C3,
9D9, and 12G6 antibodies mediated ADCC killing equivalent to that
of Campath-1H.RTM. at concentrations in excess of 10 .mu.g/ml. The
IgG1 isotype control showed only low levels of background killing
at the concentrations tested.
Example 40
Assessment of the CDC Activities of Campath-1H.RTM. and Humanized
Anti-CD52 Antibodies on Primary T Cells
[0497] Campath-1H.RTM. and humanized anti-CD52 antibodies were
evaluated for their ability to mediate complement dependent
cytotoxicity (CDC) of CD52 expressing cells. A CDC assay was
carried out by chromium release assays using T cells isolated from
healthy donor PBMCs as target cells, as described above in Example
32. FIG. 44 illustrates the concentrations of control IgG,
Campath-1H.RTM., and humanized 2C3-SFD1/K12, 9D9-H16/K13,
9D9-H18/K13, 12G6-SFD1/K11, and 12G6-SFD1/K12 antibodies used in
the assay (X axis) vs. % specific lysis (Y axis). The results
indicate that humanized 2C3 and 12G6 antibodies mediated CDC
killing equivalent to Campath-1H.RTM., while humanized 9D9
antibodies demonstrated significantly reduced CDC activity, similar
to their corresponding chimeric antibody. The IgG1 isotype control
showed only low levels of background killing at the concentrations
tested.
Example 41
Assessment of Neutralizing Ability of Serum Samples Containing
Anti-Campath-1H.RTM. Neutralizing Antibodies to Block Humanized
2C3, 12G6, and 9D9 Anti-CD52 Antibody Activity
[0498] To assess the ability of humanized antibodies to bind to
CD52 expressing cells in the presence of neutralizing antibodies
against Campath-1H.RTM., anti-CD52 antibodies (Campath-1H.RTM.,
2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12) were reacted with
human serum containing anti-Campath-1H.RTM. antibody reactivity and
evaluated for binding to CD52 expressing Raji cells. Serum samples
obtained from relapsing remitting multiple sclerosis patients who
were enrolled in the CAMMS223 study (The CAMMS223 Trial
Investigators, "Alemtuzumab vs. interferon Beta-1a in early
multiple sclerosis," N Engl J Med 359:1786-1801 (2008)) were used
in the assay. Repeated administration of the Campath-1H.RTM.
antibody resulted in generation of anti-Campath-1H.RTM. antibody
responses in most patients. The anti-Campath-1H.RTM. antibody titer
is very low at month 12 in most patients, and increased
significantly upon administration of a second cycle of
Campath-1H.RTM. resulting in a high titer anti-Campath-1H.RTM.
response in the sera at month 13. Anti-CD52 antibody neutralization
assays were carried out using month 12 and month 13 serum samples
obtained from five different MS patients (MS-1 to MS-5) who had
been treated with Campath-1H.RTM. under the CAMMS223 protocol.
FITC-conjugated anti-CD52 antibodies Campath-1H.RTM., 2C3-SFD1/K12,
12G6-SFD1/K12, and 9D9-H16/K13 (used in Example 30 and shown to
bind to CD52 expressing cells) were used to stain Raji cells that
express human CD52 in the absence or presence of a range of
dilutions of serum obtained from patients who have been treated
with Campath-1H.RTM.. Briefly, MS patient serum samples (month 12
and month 13) were made into 6 fold serial dilutions and incubated
with 10 .mu.g/ml of FITC-conjugated anti-CD52 antibodies
(Campath-1H.RTM., 2C3-SFD1/K12, 12G6-SFD1/K12, and 9D9-H16/K13) for
1 hr at 37.degree. C. Raji cells were rinsed with a staining buffer
containing HBSS, 5% FBS, and 0.1% azide, and then deposited into
round-bottom 96 well plates at 1.times.10.sup.5 cells per well.
Cells were blocked with 10 .mu.g/ml of human IgG Fc fragment for 30
min on ice in staining buffer. The cells were then washed with
staining buffer and re-suspended in 100 .mu.l of the antibody-serum
mix as described above. After 30 minutes on ice, cells were washed
and fixed with BD Cytofix.TM. and the FITC-labeled antibody coated
cells were analyzed using a FACSCalibur.TM. system (Becton
Dickinson), after which the data was analyzed using FlowJo version
7.2 software (Tree Star, Inc., Oregon, USA). Binding of
FITC-conjugated anti-CD52 antibodies in the presence of
anti-Campath-1H.RTM. neutralizing antibodies in the serum was
assessed by flow cytometry and % binding relative to control, as a
measure of inhibition was calculated as (MFI with serum/MFI control
(no serum)).times.100. Representative data from one of the donors
(MS-1) is shown in FIG. 45. The X axis denotes the serum dilution
factor and the Y axis denotes the % control binding as a measure of
antibody neutralizing activity. The data clearly demonstrate that
month 12 serum samples have no inhibitory effect on Campath-1H.RTM.
or other anti-CD52 antibodies, suggesting that there are low or no
anti-Campath-1H.RTM. blocking antibodies in the serum. Month 13
serum samples mediated complete inhibition of Campath-1H.RTM.
binding even at a 1:1000 dilution of serum, but did not mediate
inhibition of 2C3, 12G6, and 9D9 humanized anti-CD52 antibodies
even at the highest concentration (1:24 dilution) tested. Two of
the five patients developed anti-Campath-1H.RTM. neutralizing
antibody titers of >1:1000, whereas three other patients had
about 1:100 Campath-1H.RTM. neutralizing antibody titers. Even
though two of the patients' month 13 sera had relatively high
neutralizing antibody titers of >1:1000 against Campath-1H.RTM.,
these sera did not inhibit binding of humanized 2C3-SFD1/K12,
12G6-SFD1/K12, and 9D9-H16/K13 antibodies, suggesting that the
anti-Campath-1H.RTM. antibody reactivity in patients treated with
Campath-1H.RTM. did not block binding of these humanized antibodies
to CD52 as presented on cells.
Example 42
Analysis of Depletion and Repopulation of Anti-CD52 Antibodies in
huCD52 Transgenic Mice (4B10-H1/K1)
[0499] The depleting activities of Campath-1H.RTM. and the
humanized anti-CD52 antibody (4B10-H1/K1) at different dose levels
were examined in the huCD52 transgenic mouse. Mice were injected
intravenously with 0.1, 0.5, 1.0 or 5.0 mg/kg of each antibody. Two
hours post dosing, serum was collected to examine the level of
circulating cytokines. Three days post dosing, mice were
sacrificed, and blood and spleens were collected from each mouse
(N=5) to determine the level of cell depletion using flow cytometry
analysis. Samples were evaluated to determine the relative numbers
of total T helper cell (CD4+), cytotoxic T cell (CD8+), B cell
(B220+) and myeloid cell subpopulations present in the circulating
peripheral blood or spleen of huCD52 transgenic mice. In addition,
T and B cell subset analysis was performed to determine the overall
depleting effect. A subset of mice (N=5) were kept alive to monitor
the repopulation kinetics. Depletion was greatest in the T cell
compartment with CD4+ T cells being depleted most followed by CD8+
T cells, B cells, NK cells, and other myeloid cells. Within the
CD4+ T cell compartment, naive CD4+ T cells were depleted the most
followed by CD4+ central memory (CM), CD4+ effector memory (EM),
and CD4+ regulatory T cells (Treg). A similar pattern was observed
for CD8+ T cells (Naive>CM>EM). Conversely, mature B cells
were depleted to a greater extent than immature B cells. Comparison
of Campath-1H.RTM. treated mice to 4B10-H1/K1 treated mice
demonstrated similar patterns of cells in both the blood and spleen
at each of the doses examined.
[0500] Serum cytokine analysis demonstrated dose dependent
increases for TNF.alpha., IL-6 and MCP-1. The circulating level of
these cytokines remained elevated compared to untreated mice at the
0.5 and 0.1 mg/kg doses as well. Slight increases were also
observed for IL-10 in the Campath-1H.RTM. treated group at the
three highest doses but only for the highest dose of the humanized
4B10-H1/K1 treated group. No significant increases in the level of
circulating IL-12 or IFNg (not shown) were noted.
[0501] By 50-60 days post dosing, with the exception of the 1.0
mg/kg group, lymphocyte levels in all of the Campath-1H.RTM. dosed
groups had rebounded to the levels of untreated mice. In the 1.0
mg/kg group, lymphocytes had returned to normal levels by 80 days
post dosing. Similar repopulation kinetics were also observed for
the humanized 4B10-H1/K1 antibody treated mice. Lymphocytes had
rebounded to control levels by 50 days post dosing in all
4B10-H1/K1 treated groups with the exception of the 0.5 mg/kg
level. Levels of circulating lymphocytes in the 0.5 mg/kg group
remained decreased throughout the course of the monitoring period.
Total lymphocytes were monitored for repopulation in the blood.
[0502] FIGS. 46A-46E show the level of CD4+ T cells, CD8+ T cells
and B220+ B cells in the blood 72 hours after dosing with
Campath-1H.RTM. ("Campath") and humanized 4B10-H1/K1 ("4B10")
antibodies. FIGS. 47A-47E show the level of CD4+ T cells, CD8+ T
cells and B220+ B cells in the spleen 72 hours after dosing with
Campath-1H.RTM. ("Campath") and humanized 4B10-H1/K1 ("4B10")
antibodies. FIGS. 48A-48E show the levels of circulating cytokines
2 hours after dosing with Campath-1H.RTM. ("Campath") and humanized
4B10-H1/K1 ("4B10") antibodies. FIGS. 49A-49B show the repopulation
of circulating lymphocytes over a timecourse after dosing with
Campath-1H.RTM. ("Campath") and humanized 4B10-H1/K1 ("4B10")
antibodies.
Example 43
Analysis of Depletion and Repopulation of Anti-CD52 Antibodies in
huCD52 Transgenic Mice (7F11-SFD1/K2 and 7F11-SFD2/K2)
[0503] The depleting activity of humanized antibodies (7F11-SFD1/K2
and 7F11-SFD2/K2) at different dose levels was examined in huCD52
transgenic mice. Mice were injected intravenously with 0.1, 0.5,
1.0 or 5.0 mg/kg of each antibody. Two hours post dosing, serum was
collected to examine the level of circulating cytokines. Three days
post dosing, mice were sacrificed, and blood and spleens were
collected from each mouse (N=5) to determine the level of cell
depletion using flow cytometry analysis. Samples were evaluated to
determine the relative numbers of total T helper cell (CD4+),
cytotoxic T cell (CD8+), B cell (B220+) and myeloid cell
subpopulations present in the circulating peripheral blood or
spleen of huCD52 transgenic mice. In addition, T and B cell subset
analysis was performed to determine the overall depleting effect. A
subset of mice (N=5) were kept alive to monitor the repopulation
kinetics. Administration of each humanized 7F11 antibody
(7F11-SFD1/K2 and 7F11-SFD2/K2) at all doses resulted in depletion
of a significant number of both T cells and B cells in the blood.
These data also demonstrated that various T and B cell subsets are
depleted to differing degrees depending on the dose of antibody
used. Naive T cells (both CD4 and CD8) demonstrated the most
depletion with other cell populations (including memory and T reg
cells) being depleted to a lesser degree. In the B cell
compartment, mature B cells were depleted more readily than
immature B cells. In the spleen, dose dependent depletion was
observed with significant depletion of lymphocytes being observed
at the 5 and 1 mg/kg dose levels. Similar to the case with blood,
naive T cells were more readily depleted than memory cells. B cells
were depleted to a lesser extent than T cells with each of the
humanized 7F11 clones (7F11-SFD1/K2 and 7F11-SFD2/K2). Depletion
was not observed for NK cells or neutrophils in the blood or the
spleen at any of the doses injected. Serum cytokine analysis
demonstrated dose dependent increases for both TNF.alpha. and IL-6.
Levels of these cytokines remained elevated compared to untreated
mice at the 0.5 and 0.1 mg/kg doses as well. Dose dependent
increases in the level of circulating MCP-1 were also noted.
[0504] By 30 days post dosing, lymphocyte levels in the 0.5 and 0.1
mg/kg dosed groups had rebounded to the levels of untreated mice.
In the 1.0 and 5.0 mg/kg groups, lymphocytes had returned to normal
levels by 50 and 80 days, respectively, for clone 7F11-SFD1/K2 and
by 80 days post dosing for both the 1.0 and 5.0 mg/kg groups of
clone 7F11-SFD2/K2. Total lymphocytes were monitored for
repopulation in the blood.
[0505] FIGS. 50A-50E show the level of CD4+ T cells, CD8+ T cells
and B220+ B cells in the blood 72 hours after dosing with the
humanized 7F11-SFD1/K2 ("7F11 SFD1") and 7F11-SFD2/K2 ("7F11 SFD2")
antibodies. FIGS. 51A-51E show the level of CD4+ T cells, CD8+ T
cells and B220+ B cells in the spleen 72 hours after dosing with
the humanized 7F11-SFD1/K2 ("7F11 SFD1") and 7F11-SFD2/K2 ("7F11
SFD2") antibodies. FIGS. 52A-52F show the levels of circulating
cytokines 2 hours after dosing with the humanized 7F11-SFD1/K2
("7F11 SFD1") and 7F11-SFD2/K2 ("7F11 SFD2") antibodies. FIGS.
53A-53B show the repopulation of circulating lymphocytes over a
timecourse after dosing with the humanized 7F11-SFD1/K2 ("7F11
SFD1") and 7F11-SFD2/K2 ("7F11 SFD2") antibodies.
Example 44
Analysis of 7F11 Humanized Anti-CD52 Antibodies in CD52 Transgenic
Mice (7F11-SFD1/K2 and 7F11-SFD2/K2)
[0506] The depleting activity of the chimeric 7F11 antibodies and
humanized 7F11-SFD1/K2 and 7F11-SFD2/K2 antibodies in comparison to
Campath-1H.RTM. was examined in the huCD52 transgenic mouse. Mice
were injected intravenously with 1.0 mg/kg of each antibody. Three
days post dosing, mice were sacrificed, and blood and spleens were
collected from each mouse (N=5) to determine the level of cell
depletion using flow cytometry analysis. Samples were evaluated to
determine the relative numbers of total T helper cell (CD4+),
cytotoxic T cell (CD8+), B cell (B220+) and myeloid cell
subpopulations present in the circulating peripheral blood or
spleen of huCD.OMEGA. transgenic mice. Administration of
Campath-1H.RTM. resulted in depletion of a significant number of
both T cells and B cells in the blood and spleen. Although a
comparable level of T cell depletion was observed in the blood for
both the chimeric and humanized 7F11 antibodies (7F11-SFD1/K2 and
7F11-SFD2/K2), B cells were depleted to a lesser extent. This
observation was also apparent in the spleen, where significant T
cell depletion was noted, but only a modest level of B cell
depletion was achieved with the 7F11 antibodies (7F11-SFD1/K2 and
7F11-SFD2/K2).
[0507] FIGS. 54A-54B show the level of CD4+ T cells, CD8+ T cells
and B220+ B cells in the blood 72 hours after dosing with
Campath-1H.RTM. ("Campath"), 7F11-chimeric antibodies, and
humanized 7F11-SFD1/K2 and 7F11-SFD2/K2 antibodies.
Example 45
Analysis of PK Profiles of Anti-CD52 Antibodies in CD52 Transgenic
Mice (7F11-SFD1/K2 and 7F11-SFD2/K2)
[0508] To ensure that the humanization process did not alter the
clearance rate of the antibody, the pharmacokinetic profile of the
chimeric 7F11 anti-CD52 antibody and humanized 7F11-SFD1/K2 and
7F11-SFD2/K2 anti-CD52 antibodies was determined in huCD52
transgenic mice. Mice were injected intravenously with antibodies
at 5 mg/kg and blood was collected at various timepoints beginning
two hours post dosing. The circulating levels of each antibody were
evaluated using an anti-human IgG ELISA. For each of the humanized
clones, there was a slight difference in the Cmax noted at 2 hours
post dosing. Clearance rates for the chimeric 7F11 antibody and
humanized 7F11-SFD1/K2 and 7F11-SFD2/K2 antibodies were similar to
each other as well as to Campath-1H.RTM. over the course of the
experiment, indicating that the humanization process did not
significantly alter the pharmacokinetic profile of the
antibodies.
[0509] FIG. 55 shows the level of Campath-1H.RTM. ("Campath"),
7F11-chimeric antibody and humanized 7F11-SFD1/K2 and 7F11-SFD2/K2
antibodies in the blood over a timecourse after dosing.
Example 46
Analysis of Depletion and Repopulation of Anti-CD52 Antibodies in
huCD52 Transgenic Mice (2C3-SFD1/K12)
[0510] The depleting activity of the 2C3-SFD1/K12 clone at
different dose levels was examined in the huCD52 transgenic mouse.
Mice were injected intravenously with 0.1, 0.5, 1.0 or 5.0 mg/kg of
antibody. Two hours post dosing, serum was collected to potentially
examine the level of circulating cytokines. Three days post dosing,
mice were sacrificed, and blood and spleens were collected from
each mouse (N=5) to determine the level of cell depletion using
flow cytometry analysis. Samples were evaluated to determine the
relative numbers of total T helper cell (CD4+), cytotoxic T cell
(CD8+), B cell (B220+) and myeloid cell subpopulations present in
the circulating peripheral blood or spleen of huCD52 transgenic
mice. In addition, T and B cell subset analysis was performed to
determine the overall depleting effect. A subset of mice (N=5) were
kept alive to monitor the repopulation kinetics. Administration of
2C3-SFD1/K12 at the 5, 1, and 0.5 mg/kg doses resulted in depletion
of a significant number of both T cells and B cells in the blood. A
variable level of lymphocyte depletion was observed in the blood at
the 0.1 mg/kg dose with CD4+ T cells and B cells being depleted to
a greater extent than CD8+ T cells. These data also demonstrated
that various T and B cell subsets are depleted to differing degrees
depending on the dose of antibody used. Naive T cells (both CD4 and
CD8) demonstrated the most depletion compared to other cell
populations (including memory and T reg cells), which were depleted
to a lesser degree. In the B cell compartment, mature B cells were
depleted more readily than immature B cells. In the spleen, dose
dependent depletion was observed with significant depletion of
lymphocytes being observed at the 5 and 1 mg/kg dose levels.
Similar to Campath-1H.RTM., naive T cells were more readily
depleted than memory cells. Depletion was observed for NK cells and
neutrophils in the blood, but little to no depletion was observed
in the spleen at any of the doses injected. Serum cytokine analysis
demonstrated dose dependent increases for both TNF.alpha. and IL-6
with the 5 mg/kg dose inducing the highest level of each cytokine.
Levels comparable to untreated mice were observed in the 0.5 and
0.1 mg/kg dose levels for TNF.alpha. and the 0.1 mg/kg dose level
for IL-6. Dose dependent increases in the level of circulating
MCP-1 were also noted.
[0511] By 30 days post dosing, lymphocyte levels for the 0.1 and
0.5 mg/kg groups had rebounded to the levels of untreated mice. In
the 1.0 and 5.0 mg/kg groups, lymphocytes had returned to normal
levels by 80 days post dosing. Total lymphocytes were monitored for
repopulation in the blood.
[0512] FIGS. 56A-56E show the level of CD4+ T cells, CD8+ T cells
and B220 B cells in the blood 72 hours after dosing with
2C3-SFD1/K12 antibodies. FIGS. 57A-57E show the level of CD4+ T
cells, CD8+ T cells and B220+ B cells in the spleen 72 hours after
dosing with 2C3-SFD1/K12 antibodies. FIGS. 58A-58F show the levels
of circulating cytokines 2 hours after dosing with 2C3-SFD1/K12
antibodies. FIG. 59 shows the repopulation of circulating
lymphocytes over a timecourse after dosing with 2C3-SFD1/K12
antibodies.
Example 47
Analysis of Depletion and Repopulation of Anti-CD52 Antibodies in
huCD52 Transgenic Mice (12G6-SFD1/K11)
[0513] The depleting activity of the 12G6-SFD1/K11 clone at
different dose levels was examined in the huCD52 transgenic mouse.
Mice were injected intravenously with 0.1, 0.5, 1.0 or 5.0 mg/kg of
antibody. Two hours post dosing, serum was collected to potentially
examine the level of circulating cytokines. Three days post dosing,
mice were sacrificed, and blood and spleens were collected from
each mouse (N=5) to determine the level of cell depletion using
flow cytometry analysis. Samples were evaluated to determine the
relative numbers of total T helper cell (CD4+), cytotoxic T cell
(CD8+), B cell (B220+) and myeloid cell subpopulations present in
the circulating peripheral blood or spleen of huCD52 transgenic
mice. In addition, T and B cell subset analysis was performed to
determine the overall depleting effect. A subset of mice (N=5) were
kept alive to monitor the repopulation kinetics. Administration of
12G6-SFD1/K11 at the 5, 1, and 0.5 mg/kg doses resulted in
depletion of a significant number of both T cells and B cells in
the blood. A variable level of lymphocyte depletion was observed in
the blood at the 0.1 mg/kg dose with CD4+ T cells and B cells being
depleted to a greater extent than CD8+ T cells. These data also
demonstrated that various T and B cell subsets are depleted to
differing degrees depending on the dose of antibody used. Naive T
cells (both CD4 and CD8) demonstrated the most depletion compared
to other cell populations (including memory and T reg cells), which
were depleted to a lesser degree. In the B cell compartment, mature
B cells were depleted more readily than immature B cells. In the
spleen, dose dependent depletion was observed with significant
depletion of lymphocytes being observed at the 5 and 1 mg/kg dose
levels. Similar to Campath-1H.RTM., naive T cells were more readily
depleted than memory cells. Depletion was observed for NK cells and
neutrophils in the blood but little to no depletion was observed in
the spleen at any of the doses injected. Serum cytokine analysis
demonstrated dose dependent increases for both TNF.alpha. and IL-6
with the 5 mg/kg dose inducing the highest level of each cytokine.
Levels comparable to untreated mice were observed in the 0.5 and
0.1 mg/kg dose levels for TNF.alpha. and the 0.1 mg/kg dose level
for IL-6. Dose dependent increases in the level of circulating
MCP-1 were also noted.
[0514] By 30 days post dosing, lymphocyte levels had rebounded to
the levels of untreated mice. In the 1.0 and 5.0 mg/kg groups,
lymphocytes had returned to normal levels by 80 days post dosing.
Total lymphocytes were monitored for repopulation in the blood.
[0515] FIGS. 60A-60E show the level of CD4+ T cells, CD8+ T cells
and B220+ B cells in the blood 72 hours after dosing with
12G6-SFD1/K11 antibodies. FIGS. 61A-61E show the level of CD4+ T
cells, CD8+ T cells and B220+ B cells in the spleen 72 hours after
dosing with 12G6-SFD1/K11 antibodies. FIGS. 62A-62F show the levels
of circulating cytokines 2 hours after dosing with 12G6-SFD1/K11
("12G6 hu") antibodies. FIG. 63 shows the repopulation of
circulating lymphocytes over a timecourse after dosing with
12G6-SFD1/K11 antibodies.
Example 48
Analysis of PK Profile of Anti-CD52 Antibodies in CD52 Transgenic
Mice (2C3-SFD1/K12, 12G6-SFD1/K11 and 9D9-H10/K12)
[0516] The pharmacokinetic profiles of anti-CD52 antibodies were
determined in huCD52 transgenic mice. This experiment compared the
humanized and chimeric forms of the antibodies to ensure that the
humanization process did not alter the clearance rate of the
antibodies. Comparisons included chimeric 2C3, 12G6, and 9D9
antibodies and humanized 2C3-SFD1/K12, 12G6-SFD1/K11, and
9D9-H10/K12 antibodies. Mice were injected i.v. with antibodies at
5 mg/kg and blood was collected at various timepoints beginning two
hours post dosing. The circulating levels of each antibody were
evaluated using an anti-human IgG ELISA. For each of the
chimeric/humanized antibody pairs analyzed, there was a slight
difference in the Cmax noted at 2 hours post dosing. For the 2C3
and 12G6 antibodies, the Cmax of the humanized version (i.e.,
2C3-SFD1/K12 and 12G6-SFD1/K11) was slightly higher while the
chimeric version was slightly higher for the 9D9 pair. Clearance
rates for the antibody pairs were similar over the course of the
experiment indicating that the humanization process did not
significantly alter the pharmacokinetic profile of the
antibodies.
[0517] FIGS. 64A-64C show the level of 2C3-chimeric, 2C3-SFD1/K12,
12G6-chimeric, 12G6-SFD1/K11, 9D9-chimeric, and 9D9-H10/K12
antibodies in the blood over a timecourse after dosing.
Example 49
Analysis of Depletion and Repopulation of Anti-CD52 Antibodies in
huCD52 Transgenic Mice (9D9-H10/K12)
[0518] The depleting activity of the 9D9-H10/K12 clone at different
dose levels was examined in the huCD52 transgenic mouse. Mice were
injected intravenously with 0.1, 0.5, 1.0 or 5.0 mg/kg of antibody.
Two hours post dosing, serum was collected to potentially examine
the level of circulating cytokines. Three days post dosing, mice
were sacrificed, and blood and spleens were collected from each
mouse (N=5) to determine the level of cell depletion using flow
cytometry analysis. Samples were evaluated to determine the
relative numbers of total T helper cell (CD4+), cytotoxic T cell
(CD8+), B cell (B220+) and myeloid cell subpopulations present in
the circulating peripheral blood or spleen of huCD52 transgenic
mice. In addition, T and B cell subset analysis was performed to
determine the overall depleting effect. A subset of mice (N=5) were
kept alive to monitor the repopulation kinetics. Administration of
9D9-H10/K12 at the 5, 1, and 0.5 mg/kg doses resulted in depletion
of a significant number of both T cells and B cells in the blood.
Only a modest level of lymphocyte depletion was observed in the
blood at the 0.1 mg/kg dose. These data also demonstrated that
various T and B cell subsets are depleted to differing degrees
depending on the dose of antibody used. Naive T cells (both CD4 and
CD8) demonstrated the most depletion compared to other cell
populations (including memory and T reg cells), which were depleted
to a lesser degree. In the B cell compartment, mature B cells were
depleted more readily than immature B cells. In the spleen,
significant depletion of these cells was only observed at the 5 and
1 mg/kg dose levels. Similar to Campath-1H.RTM., naive T cells were
more readily depleted than memory cells. Depletion was observed for
NK cells and neutrophils in the blood but little to no depletion
was observed in the spleen at any of the doses injected. Serum
cytokine analysis demonstrated no significant increases for either
TNF.alpha. or IL-6 at any of the dose levels analyzed. Dose
dependent increases in the level of circulating MCP-1, however,
were noted.
[0519] The repopulation portion of this experiment was terminated
early when lymphocytes were 50-80% repopulated (depending on the
dose). Lymphocyte repopulation was monitored based on total
lymphocyte counts and not on a T and B cell basis.
[0520] FIGS. 65A-65E show the level of CD4+ T cells, CD8+ T cells
and B220+ B cells in the blood 72 hours after dosing with
9D9-H10/K12 ("9D9") antibodies. FIGS. 66A-66E show the level of
CD4+ T cells, CD8+ T cells and B220+ B cells in the spleen 72 hours
after dosing with 9D9-H10/K12 ("9D9") antibodies. FIGS. 67A-67F
show the levels of circulating cytokines 2 hours after dosing with
9D9-H10/K12 ("9D9") antibodies. FIG. 68 shows the repopulation of
circulating lymphocytes over a timecourse after dosing with
9D9-H10/K12 ("9D9") antibodies.
Example 50
Analysis of Depletion and Repopulation of Anti-CD52 Antibodies in
huCD52 Transgenic Mice (2C3-SFD1/K12, 12G6-SFD1/K11 and
9D9-H10/K12)
[0521] The depleting activity of Campath-1H.RTM. and the humanized
2C3-SFD1/K12, 12G6-SFD1/K11 and 9D9-H10/K12 clones at different
dose levels was examined in the huCD52 transgenic mouse. Mice were
injected intravenously with either 0.1 or 1.0 mg/kg of antibody.
Two hours post dosing, serum was collected to potentially examine
the level of circulating cytokines. Three days post dosing, mice
were sacrificed, and blood and spleens were collected from each
mouse to determine the level of cell depletion using flow cytometry
analysis. Samples were evaluated to determine the relative numbers
of total T helper cell (CD4+), cytotoxic T cell (CD8+), B cell
(B220+) and myeloid cell subpopulations present in the circulating
peripheral blood or spleen of huCD52 transgenic mice. In addition,
T and B cell subset analysis was performed to determine the overall
depleting effect. All of the humanized antibodies (2C3-SFD1/K12,
12G6-SFD1/K11 and 9D9-H10/K12) mediated depletion of lymphocytes
within the spleen and blood when compared with PBS treated animals.
Depletion was more robust in the blood than the spleen for all
antibodies, and the depletion was dose-dependent in both tissues.
Depletion was most dramatic for CD4 and CD8+ T cells with less
depletion in the B cell compartment. Various T and B cell subsets
were depleted to differing degrees. Naive T cells (both CD4 and
CD8) demonstrated the most depletion compared to other cell
populations (including memory and T reg cells), which were depleted
to a lesser degree. In the B cell compartment, mature B cells were
depleted more readily than immature B cells. Serum cytokine
analysis revealed significant increases in the level of IL-6, MCP-1
and TNF.alpha. 2 hours post dosing. Increases were noted for all
antibodies, including Campath-1H.RTM., and were dose dependent
(i.e. higher cytokine levels were noted for the 1.0 mg/kg dose
level than the 0.1 mg/kg dose). In comparison to Campath-1H.RTM.,
2C3-SFD1/K12 and 12G6-SFD1/K11 induced similar levels of IL-6 while
9D9-H10/K12 induced IL-6 to a significantly lower degree. For
MCP-1, the 12G6-SFD1/K11 antibody induced lower levels, and both
12G6-SFD1/K11 and 9D9-H10/K12 decreased TNF.alpha. levels compared
to Campath-1H.RTM..
[0522] FIGS. 69A-69D show the level of bulk lymphocyte populations
(CD4+ T cells, CD8+ T cells, and B cells) and CD4+ T cell, CD8+ T
cell and B220+ B/NK cell subtypes in the blood 72 hours after
dosing with Campath-1H.RTM. ("Campath"), 2C3-SFD1/K12 ("2C3"),
12G6-SFD1/K11 ("12G6"), and 9D9-H10/K12 ("9D9") antibodies. FIGS.
70A-70D show the level of bulk lymphocyte populations (CD4+ T
cells, CD8+ T cells, and B cells) and CD4+ T cell, CD8+ T cell and
B220+ B/NK cell subtypes in the spleen 72 hours after dosing with
Campath-1H.RTM. ("Campath"), 2C3-SFD1/K12 ("2C3"), 12G6-SFD1/K11
("12G6"), and 9D9-H10/K12 ("9D9") antibodies. FIGS. 71A-71F show
the levels of circulating cytokines 2 hours after dosing with
Campath-1H.RTM., 2C3-SFD1/K12, 12G6-SFD1/K11, and 9D9-H10/K12
antibodies.
Example 51
Direct Comparison of Anti-huCD52 Humanized 9D9 Clones in huCD52
Transgenic Mice (9D9 H10/K12 and 9D9 H11/K12)
[0523] The depleting activity of two humanized anti-CD52 9D9 clones
(9D9-H10/K12 and 9D9-H11/K12) was examined in huCD52 transgenic
mice. Mice were injected intravenously with either 0.1 or 1.0 mg/kg
of antibody. Three days post dosing, mice were sacrificed, and
blood and spleens were collected from each mouse to determine the
level of cell depletion using flow cytometry analysis. Samples were
evaluated to determine the relative numbers of total T helper cell
(CD4+), cytotoxic T cell (CD8+), B cell (B2200+) and NK cell
subpopulations present in the circulating peripheral blood or
spleen of huCD52 transgenic mice. Treatment with either antibody
resulted in similar lymphocyte depletion within the blood and
spleen, with lymphocyte depletion in the blood being more robust.
Further, CD4 and CD8+ T cells were more strongly depleted than B
cells and NK cells in both tissues. While the depletion with the
9D9-H10/K12 clone appears less robust than the depletion with the
9D9-H11/K12 clone, the difference is not statistically
significant.
[0524] FIG. 72 shows the level of CD4+ T cells, CD8+ T cells, B220+
B cells, and NK cells in the blood 72 hours after dosing with
9D9-H10/K12 and 9D9-H11/K12 antibodies. FIG. 73 shows the level of
CD4+ T cells, CD8+ T cells, B220+ B cells, and NK cells in the
spleen 72 hours after dosing with 9D9-H10/K12 and 9D9-H11/K12
antibodies.
Example 52
Direct Comparison of Anti-huCD52 Humanized 12G6 Clones in huCD52
Transgenic Mice (12G6-SFD1/K11 and 12G6-SFD1-K12)
[0525] The depleting activity of two humanized anti-CD52 12G6
clones (12G6-SFD1/K11 and 12G6-SFD1/K12) was examined in the huCD52
transgenic mouse. Mice were injected intravenously with either 0.1
or 1.0 mg/kg of antibody. Two hours post dosing, serum was
collected to potentially examine the level of circulating
cytokines. Three days post dosing, mice were sacrificed, and blood
and spleens were collected from each mouse to determine the level
of cell depletion using flow cytometry analysis. Samples were
evaluated to determine the relative numbers of total T helper cell
(CD4+), cytotoxic T cell (CD8+), B cell (B220+) and myeloid cell
subpopulations present in the circulating peripheral blood or
spleen of huCD52 transgenic mice. In addition, T and B cell subset
analysis was performed to determine the overall depleting effect.
Administration of either the 12G6-SFD1/K11 antibody or the
12G6-SFD1/K12 antibody resulted in a significant level of
lymphocyte depletion within the blood. There appeared to be little
to no difference in the lymphocyte depleting activity of the two
clones. The pattern of lymphocyte depletion was s such that naive
CD4 and CD8+ T cells were depleted to a higher degree than memory T
cells or Treg cells. Myeloid cell populations were depleted to a
lesser degree regardless of the clone (12G6-SFD1/K11 or
12G6-SFD1/K12) or dose. Serum cytokine analysis was not performed
for this experiment.
[0526] FIGS. 74A-74D show the level of CD4+ T cells, CD8+ T cells,
B220+ B/NK cells, and myeloid cells in the blood 72 hours after
dosing with 12G6-SFD1/K11 ("12G6 K11") and 12G6-SFD1/K12 ("12G6
K12") antibodies. FIGS. 75A-75D show the level of CD4+ T cells,
CD8+ T cells, B220+ B/NK cells, and myeloid cells in the spleen 72
hours after dosing with 12G6-SFD1/K11 ("12G6 K11") and
12G6-SFD1/K12 ("12G6 K12") antibodies.
Example 53
Direct Comparison of Anti-huCD52 Humanized 9D9 Clones in huCD52
Transgenic Mice (9D9 H11/K12, 9D9 H16/K13, and 9D9 H18/K13)
[0527] The depleting activity of three humanized 9D9 antibodies
(9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13) was compared in the
huCD52 transgenic mouse. Human CD52 transgenic mice were treated
with PBS as a vehicle control or injected with either 1 mg/kg or
0.1 mg/kg of each antibody. At two hours post dosing, serum was
collected to determine the level of circulating cytokines. Three
days later, mice were sacrificed, and peripheral blood and spleens
were collected and processed for flow cytometry analysis. Samples
were evaluated to determine the relative numbers of total T helper
cell (CD4+), cytotoxic T cell (CD8+), B cell (B220+) and myeloid
cell subpopulations present in the circulating peripheral blood or
spleen of huCD52 transgenic mice. In addition, T and B cell subset
analysis was performed to determine the overall depleting effect.
All 9D9 (9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13) antibodies
mediated cellular depletion of lymphocyte and myeloid cell
populations in the blood and spleen to a similar extent. More
robust lymphocyte and myeloid cell depletion was observed in the
blood than the spleen. Comparison of the depleting activity of the
9D9 clones (9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13) demonstrated
that 9D9-H16/K13 resulted in the most robust depletion, followed by
9D9-H18/K13 and 9D9-H11/K12. This was most apparent for lymphocytes
in the spleen at the 1 mg/kg dose in which 9D9-H16/K13 treatment
resulted in a higher degree of depletion than either of the other
clones (9D9-H18/K13 and 9D9-H11/K12). Further, the pattern of
depletion was such that naive CD4 and CD8+ T cells were depleted to
a higher degree than memory T cells or Treg cells, and B cell
populations were depleted to a higher level with 9D9-H16/K13.
Myeloid cell populations were less impacted by anti-CD52 treatment
regardless of the clone of antibody (9D9-H11/K12, 9D9-H16/K13, or
9D9-H18/K13) or dose. Of the cytokines analyzed, increases were
noted in IL-6, TNF.alpha. and MCP-1. Following injection, similar
circulating level of IL6 and MCP-1 were observed for all of the 9D9
clones (9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13) at both the 0.1
and 1.0 mg/kg dose levels. Slight differences were observed with
circulating TNF.alpha. levels in which injection of the 9D9-H16/K13
clone resulted in a modest increase at the 1.0 mg/kg dose.
[0528] FIG. 76 shows the level of bulk lymphocyte populations (CD4+
T cells, CD8+ T cells, and B220+ B cells) in the blood 72 hours
after dosing with 9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13
antibodies. FIGS. 77A-77D show the level of CD4+ T cell, CD8+ T
cell, B220+B/NK cell, and myeloid cell subtypes in the blood 72
hours after dosing with 9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13
antibodies. FIG. 78 shows the level of bulk lymphocyte populations
(CD4+ T cells, CD8+ T cells, and B220+ B cells) in the spleen 72
hours after dosing with 9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13
antibodies. FIGS. 79A-79D show the level of CD4+ T cell, CD8+ T
cell, B220+ B/NK cell, and myeloid cell subtypes in the spleen 72
hours after dosing with 9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13
antibodies. FIGS. 80A-80F show the levels of circulating cytokines
2 hours after dosing with 9D9-H11/K12, 9D9-H16/K13, and 9D9-H18/K13
antibodies.
Example 54
Analysis of PK Profile of Anti-CD52 Antibodies from the 2C3, 12G6,
and 9D9 Families in CD52 Transgenic Mice
[0529] The pharmacokinetic profiles of humanized 2C3-SFD1/K12,
12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13 and 9D9-H18/K13 were
determined in huCD52 transgenic mice. Mice were injected i.v. with
antibodies at 1 mg/kg and blood was collected at various timepoints
beginning two hours post dosing. The circulating levels of each
antibody were evaluated using an anti-human Ig ELISA. The
calculated half-lives were: 2C3-SFD1/K12 79.0.+-.23.9 hours,
12G6-SFD1/K11 49.0.+-.14.4 hours, 12G6-SFD1/K12 75.1.+-.28.5,
9D9-H16/K13 59.8+26.6 hours and 9D9-H18/K13 42.2+15.7 hours.
[0530] Overall, there was significant inter-animal variability for
exposure in these studies. The terminal elimination half-lives for
2C3-SFD1/K12 and 12G6-SFD1/K12 were similar while the half-life of
12G6-SFD1/K11 was shorter but not significantly different.
Clearance was fastest with 2C3-SFD1/K12 followed by 12G6-SFD1/K11
and 12G6-SFD1/K12. The two 12G6 treatments mirrored each other for
most of the time points measured, while 2C3-SFD1/K12 showed less
exposure and faster clearance. 9D9-H16/K13 and 9D9-H18/K13 were
quite similar for all PK parameters measured.
[0531] FIGS. 81A-81B show the level of 2C3-SFD1/K12, 12G6-SFD1/K11,
12G6-SFD1/K12, 9D9-H16/K13 and 9D9-H18/K13 antibodies in the blood
over a timecourse after dosing.
TABLE-US-00018 TABLE 16 PK Parameters 2C3-SFD1/K12 12G6-SFD1/K11
12G6-SFD1/K12 9D9-H16/K13 9D9-H18/K13 t.sub.1/2 (hr) 79.0 .+-. 23.9
49.0 .+-. 14.4 75.1 .+-. 28.5 59.8 .+-. 26.6 42.2 .+-. 15.7 Cl
(ml/hr/kg) 20.3 .+-. 2.9 10.6 .+-. 1.69 7.08 .+-. 1.80 5.64 .+-.
1.73 6.65 .+-. 3.02 Vz (ml/kg) 2251 .+-. 539 770 .+-. 294 721 .+-.
224 445 .+-. 133 366 .+-. 100 AUC (ug*hr/ml) 251 .+-. 37.2 485 .+-.
104 747 .+-. 188 196 .+-. 70.2 174 .+-. 65.2 Cmax (ug/ml) 4.22 .+-.
0.54 7.12 .+-. 1.97 8.96 .+-. 2.33 3.58 .+-. 2.16 4.35 .+-.
1.54
Example 55
Evaluation of Cytokine Storm in Response to Treatment with
Anti-CD52 Antibodies
[0532] The release of serum cytokine following treatment with
anti-CD52 antibodies was evaluated in huCD52 transgenic mice.
Animals were treated with 1 mg/kg of Campath-1H.RTM.,
12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13 or 9D9-H18/K13. One group
of animals was treated with 5 mg/kg of 2C3-SFD1/K12 in view of
previous results indicating that injection with 2C3-SFD1/K12 may
result in lower levels of depletion compared to the other
antibodies, thereby normalizing the groups based on the dose needed
to achieve similar levels of depletion. All groups were bled 1, 2,
4, 24, and 48 hours post treatment and CBA analysis for
inflammatory cytokines was conducted. All groups were also
sacrificed 3 days post treatment and the spleens were evaluated for
depletion of lymphocytes in the spleen by flow cytometry. Treatment
with each of the antibodies resulted in depletion of various
targets similar to that observed for Campath-1H.RTM.. This was also
true for 2C3-SFD1/K12, in which a 5 mg/kg dose was used to elicit
similar depletion. Some variability in depletion was observed with
12G6-SFD1/K12 and 9D9-H16/K13, most likely due to the repeated
bleeding of the animals to acquire serum for cytokine analysis.
Cytokine expression, however, was reduced for antibodies from the
12G6 (12G6-SFD1/K11 and 12G6-SFD1/K12) and 9D9 (9D9-H16/K13 and
9D9-H18/K13) family members. This was most noticeable for release
of IL-6, MCP-1 and TNF.alpha. at the early 1 and 2 hour time
points.
[0533] FIGS. 82A-82F show the level of cytokines in the blood over
a 48-hour timecourse following dosing with Campath-1H.RTM.
("Campath"), 12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13 or
9D9-H18/K13 antibodies. FIGS. 83A-83E show the level of bulk
lymphocytes, CD4+ T cells, CD8+ T cells, B220+ B/NK cells, and
myeloid cells in the spleen 72 hours after dosing with
Campath-1H.RTM. ("Campath"), 12G6-SFD1/K11, 12G6-SFD1/K12,
9D9-H16/K13 or 9D9-H18/K13 antibodies.
Example 56
Evaluation of the Repopulation Kinetics in the Blood of CD52
Transgenic Mice Following Treatment with Anti-CD52 Antibodies
[0534] The repopulation kinetics of several cell types in the blood
were assessed following administration of humanized anti-CD52
2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12 antibodies. Mice were
injected i.v. with each antibody at 2 mg/kg to ensure a robust
level of depletion. At various timepoints post injection, blood was
collected for flow cytometry analysis to determine the level of
circulating lymphocytes in the blood, including CD4+ and CD8+ T
cells, regulatory T cells, B cells, NK cells, neutrophils and
macrophages. No differences were observed in the initial depleting
activity for each antibody, which was confirmed on day 3 post
injection. Mice were bled weekly for the first month and biweekly
thereafter to monitor the kinetics of repopulation. The kinetics of
lymphocyte repopulation were similar for any of the anti-CD52
(2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12) antibodies compared
to Campath-1H.RTM.. By day 57, the B cells returned to baseline in
the blood while T cells approached baseline levels by day 84. By
day 116, CD8+ T cells had not returned to control levels, but
similar repopulation kinetics for all other cell types monitored
were observed with each of the anti-CD52 (2C3-SFD1/K12, 9D9-H16/K13
and 12G6-SFD1/K12) antibodies and Campath-1H.RTM..
[0535] FIGS. 84A-84G show the repopulation of circulating CD4+ and
CD8+ T cells, regulatory T cells, B cells, NK cells, neutrophils
and macrophages over a timecourse after dosing with Campath-1H.RTM.
("Campath"), 2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12
antibodies.
Example 57
Evaluation of CD52 Expression in CD52 Transgenic Mice Using the
Anti-CD52 Antibodies
[0536] Expression of huCD52 was evaluated using the humanized
anti-CD52 antibodies to determine whether similar staining patterns
could be observed on mature and developing cell populations in
huCD52 transgenic mice. 2C3-SFD1/K12, 12G6-SFD1/K11, 12G6-SFD1/K12,
9D9-H16/K13, and 9D9-H18/K13 antibodies were conjugated with FITC
to use in flow cytometry staining. Tissues from huCD52 transgenic
mice were collected and processed for staining. 2C3-SFD1/K12,
12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13, and 9D9-H18/K13
antibodies stained lymphocytes expressing huCD52 from the spleen of
transgenic mice similar to Campath-1H.RTM.. The staining patterns
were representative of the lymphocyte populations and subsets found
in other lymphoid organs such as the thymus and bone marrow.
[0537] FIG. 85 shows the ability of FITC-labeled Campath-1H.RTM.,
2C3-SFD1/K12, 12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13, and
9D9-H18/K13 antibodies to specifically bind huCD52 lymphocyte cell
populations in the spleen.
Example 58
Direct Comparison of Single Dose Treatment with Anti-huCD52 in
huCD52 Transgenic Mice
[0538] The depleting activity of several humanized anti-CD52
antibodies (2C3-SFD1/K12, 12G6-SFD1/K11, 12G6-SFD1/K12,
9D9-H16/K13, and 9D9-H18/K13) was compared in the huCD52 transgenic
mouse. Mice were injected with antibodies i.v. at 1 mg/kg. At
2-hours post dosing, serum was collected for cytokine analysis.
Three days later mice were sacrificed and blood and spleen
collected to compare the level of lymphocyte depletion. Significant
levels of B and T cell depletion were observed for all of the
anti-CD52 antibodies (2C3-SFD1/K12, 12G6-SFD1/K11, 12G6-SFD1/K12,
9D9-H16/K13, and 9D9-H18/K13) and were comparable to those observed
following Campath-1H.RTM. administration. Subset analysis also
revealed no significant differences in the level of depletion for
each antibody (2C3-SFD1/K12, 12G6-SFD1/K11, 12G6-SFD1/K12,
9D9-H16/K13, and 9D9-H18/K13) in either blood or spleen. Following
injection of Campath-1H.RTM., there was a marked increase in the
circulating levels of both IL-6 and TNF.alpha.. Although injection
of each of the anti-CD52 antibodies (2C3-SFD1/K12, 12G6-SFD1/K11,
12G6-SFD1/K12, 9D9-H16/K13, and 9D9-H18/K13) resulted in a
significant decrease in the level of TNF.alpha. compared to
Campath-1H.RTM., the levels of IL-6 were similar.
[0539] FIGS. 86A-86E show the level of bulk lymphocyte populations
(CD4+ T cells, CD8+ T cells, and B220+ B cells) and CD4+ T cell,
CD8+ T cell, B220+ B/NK cell, and myeloid cell subtypes in the
blood 72 hours after dosing with Campath-1H.RTM. ("Campath"),
2C3-SFD1/K12, 12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13, and
9D9-H18/K13 antibodies. FIGS. 87A-87E show the level of bulk
lymphocyte populations (CD4+ T cells, CD8+ T cells, and B220+ B
cells) and CD4+ T cell, CD8+ T cell, B220+ B/NK cell, and myeloid
cell subtypes in the spleen 72 hours after dosing with
Campath-1H.RTM. ("Campath"), 2C3-SFD1/K12, 12G6-SFD1/K11,
12G6-SFD1/K12, 9D9-H16/K13, and 9D9-H18/K13 antibodies. FIGS.
88A-88C show the levels of circulating cytokines 2 hours after
dosing with Campath-1H.RTM. ("Campath"), 2C3-SFD1/K12,
12G6-SFD1/K11, 12G6-SFD1/K12, 9D9-H16/K13, and 9D9-H18/K13
antibodies.
Example 59
In Depth Depletion of Lymphocytes in huCD52 Transgenic Mice
Following Single Dose Treatment With Anti-huCD52 Antibodies
[0540] Extensive depletion analysis was performed in the huCD52
transgenic mouse using anti-CD52 2C3-SFD1/K12, 9D9-H16/K13 and
12G6-SFD1/K12 antibodies. Mice (N=4) were injected i.v. with a
single dose of each antibody at 1 mg/kg. Three days later, the mice
were sacrificed, and blood, spleen, lymph nodes, and thymus were
collected to compare the level of lymphocyte depletion using
multi-color flow cytometry analysis. Significant levels of B and T
cell depletion were observed for all of the anti-CD52 2C3-SFD1/K12,
9D9-H16/K13 and 12G6-SFD1/K12 antibodies and were comparable to
those observed following Campath1H.RTM. administration in each
tissue examined. Subset analysis also revealed no significant
differences in the level of depletion for each antibody in either
blood or spleen. Significant levels of lymphocyte depletion were
also observed in the lymph nodes of mice. There did, however,
appear to be some variability in the activity of the antibody,
especially when looking at the central and effector memory T cell
subset. Due to technical issues regarding the LSR-II and the CD8
stain, the thymus could not be evaluated.
[0541] FIGS. 89A-89D show the level of CD4+ T cell, CD8+ T cell,
B220+ B cell, and NK/myeloid cell subtypes in the blood 72 hours
after dosing with Campath-1H.RTM. ("Campath"), 2C3-SFD1/K12,
9D9-H16/K13 and 12G6-SFD1/K12 antibodies. FIGS. 90A-90D show the
level of CD4+ T cell, CD8+ T cell, B220+ B cell, and NK/myeloid
cell subtypes in the spleen 72 hours after dosing with
Campath-1H.RTM. ("Campath"), 2C3-SFD1/K12, 9D9-H16/K13 and
12G6-SFD1/K12 antibodies. FIGS. 91A-91D show the level of CD4+ T
cell, CD8+ T cell, B220+ B cell, and NK/myeloid cell subtypes in
the lymph node 72 hours after dosing with Campath-1H.RTM.
("Campath"), 2C3-SFD1/K12, 9D9-H16/K13 and 12G6-SFD1/K12
antibodies.
Example 60
Creation and Evaluation of the huCD52 Knock-in/Knock-Out (KI/KO)
Transgenic Mouse on the C57BL/6 Background
[0542] A new human CD52 knock-in/knock-out mouse model was created
on the C57Bl/6 background. To create this mouse, the mouse CD52
gene sequence was replaced by the human CD52 gene sequence. The
targeting strategy allowed for the replacement of the mouse
sequence with the human sequence while maintaining the exon-intron
structure. A selection marker was used to identify progeny
containing the new gene sequence. The final allele was created by
removal of the selection marker leaving only the human CD52 gene
sequence.
[0543] Basic characterization of the huCD52 KI/KO mouse model
involved determining the level of human CD52 expression on
lymphocytes. Blood from huCD52-KI/KO transgenic mice (N=4) and
C57BL/6 mice (N=2) were stained for hCD52 expression and the number
of CD52 molecules/cell was enumerated using the Bang's labs Simply
Cellular anti-human antibody assay. Staining of peripheral blood
cells from huCD52-KI/KO transgenic mice demonstrated that
expression of huCD52 is very high on the majority of lymphocytes
from these animals. Expression levels were similar to those
observed in human CD4, CD8, and B cell populations. Expression
levels on NK cells and macrophages were lower than those observed
for T cells and B cells. An increased level of huCD52 expression
was detected on neutrophils in these mice, contrary to the
decreased expression level in human neutrophils or similar cells
from the original transgenic mouse line on the CD-1 background.
Similar levels of CD52 expression were observed on T and B cells
from the original huCD52 CD1 transgenic mouse and the huCD52 KI/KI
mouse.
[0544] FIG. 92A shows the huCD52 expression level on CD4+ T cell,
CD8+ T cell, B220+ B cell, and NK/myeloid cell subtypes in
huCD52-KI/KO and non-transgenic control mice. FIG. 92B shows the
huCD52 expression level on CD4+ T cells, CD8+ T cells, and B cells
in huCD52-KI/KO and huCD52 CD1 transgenic mice.
Example 61
Direct Comparison of Depletion Characteristics Between Small and
Large Scale Lots of 12G6 and 2C3
[0545] huCD52 KI/KO transgenic mice were dosed with 12G6-SFD1/K12
or 2C3-SFD1/K12 to determine the depleting activity. In addition,
activity was examined using antibodies generated from two different
sources (small scale and large scale lots) at Genzyme. Mice were
injected i.v. with each antibody at 1 mg/kg. Three days post
injection, mice were sacrificed, and blood was collected for flow
cytometry analysis to determine the levels of circulating CD4+ and
CD8+ T cells, B cells, NK cells, neutrophils and macrophages. No
significant differences in depletion of CD4 T cells, CD8+ T cells,
B cells, and NK cells were observed between the small scale and
large scale lot derived antibodies.
[0546] The various lots of 12G6-SFD1/K12 and 2C3-SFD1/K12
antibodies were also evaluated by flow cytometry to compare the
intensity of staining on splenocytes from huCD52-KI/KO transgenic
mice. Both 12G6-SFD1/K12 and 2C3-SFD1/K12 antibodies appear to
recognize human CD52 to the same extent as Campath-1H.RTM. on
isolated splenocytes. In addition, there was no difference in the
level of recognition between the two sources (small scale and large
scale lots) of antibody.
[0547] FIGS. 93A-93B show binding to huCD52 of 12G6-SFD1/K12 and
2C3-SFD1/K12 antibodies (from various production sources) as
compared to a Campath-1H.RTM. control. FIG. 94 shows the level of
bulk lymphocyte populations (CD4+ T cells, CD8+ T cells, and B220+
B cells) in the blood 72 hours after dosing with 12G6-SFD1/K12 and
2C3-SFD1/K12 antibodies from various production sources.
Example 62
Analysis of PK Profile for Anti-CD52 Antibodies in huCD52-KI/KO
Transgenic Mice
[0548] The pharmacokinetic profiles of humanized 2C3-SFD1/K12,
9D9-H16/K13 and 12G6-SFD1/K12 antibodies were determined in huCD52
KI/KO transgenic mice. Mice were injected i.v. with antibodies at 1
mg/kg, and blood was collected at various timepoints beginning two
hours post dosing. The circulating levels of each antibody were
evaluated using an anti-human Ig ELISA. The overall clearance rate
was similar for each of the humanized anti-CD52 2C3-SFD1/K12,
9D9-H16/K13 and 12G6-SFD1/K12 antibodies with 2C3-SFD1/K12
exhibiting potentially faster kinetics, while 12G6-SFD1/K12 was
present in the serum for the longest period of time.
[0549] FIGS. 95A-95B show the levels of 2C3-SFD1/K12, 9D9-H16/K13
and 12G6-SFD1/K12 antibodies in the blood over a timecourse after
dosing.
Example 63
Evaluation of 12G6 and 2C3 Pretreatment on EAE in huCD52-KI/KO
Transgenic Mice
[0550] The efficacy of anti-CD52 antibody treatment on reducing the
overall disease incidence and severity of Experimental Autoimmune
Encephalomyelitis (EAE) was evaluated in huCD52 KI/KO mice.
huCD52-KI/KO mice were treated with a course of either 2C3-SFD1/K12
or 12G6-SFD1/K12 on days -5 thru -1. EAE (a model of multiple
sclerosis) was induced by immunization with MOG35-55 peptide
emulsified in CFA, and treatment with pertussis toxin, on days 0
and 2. Vehicle treated mice began to display signs of paralysis by
day 10 post injection, which developed into severe progressive
disease. In contrast, pretreatment of mice with either the
2C3-SFD1/K12 or 12G6-SFD1/K12 antibody delayed the onset of disease
and decreased the overall disease severity.
[0551] FIG. 96 demonstrates the EAE clinical score of 2C3-SFD1/K12
and 12G6-SFD1/K12 over a timecourse of disease progression.
Example 64
Fc Modification of Antibodies to Alter the Pharmacokinetic Profile
of Anti-CD52 Antibodies
[0552] Alterations in the Fc region of antibodies 1) affect the
biological activity of the antibody by altering interactions with
Fc receptors and/or 2) alter the pharmacokinetic profile of the
antibody by altering interactions with the FcRn neonatal receptor.
The FcRn molecule is expressed on vascular endothelium and is
believed to be the main site of IgG recycling. The FcRn binds to
the antibody Fc portion which then becomes internalized within a
cell. Antibodies that have high affinity interactions with the FcRn
will be recycled back to the surface of the cell and will be
released back into circulation. Antibodies that have lower affinity
interactions dissociate within the cell and ultimately degrade.
Site directed mutagenesis to increase the interaction with FcRn
generates an antibody that can be maintained in circulation for
longer periods of time compared to an unmodified antibody.
Conversely, mutations within the Fc region of an antibody that
decrease FcRn binding shorten the circulating half-life of the
antibody. Mutations that have been described to decrease binding to
FcRn resulting in shorter circulating half-lives include the
His435Ala single mutation and the His310Ala/His435Gln double
mutation (see, e.g., Kim et al., "Mapping the site on human IgG for
binding of the MHC class I-related receptor, FcRn," Eur. J.
Immunol., 29:2819-2825 (1999) and Kenanova et al., "Tailoring the
Pharmacokinetics and Positron Emission Tomography Imaging
Properties of Anti-Carcinoembryonic Antigen Single-Chain Fv-Fc
Antibody Fragments," Cancer. Res. 65(2):622-631 (2005)).
[0553] The 2C3-SFD1/K12 antibody was mutated to generate His435Ala
2C3-SFD1/K12 ("2C3-SFD1/K12-Modified 1") and His310Ala/His435Gln
2C3-SFD1/K12 ("2C3-SFD1/K12-Modified 2") antibodies that have
altered PK profiles. Biacore analysis was conducted to confirm
decreased binding to both mouse and human FcRn molecules. Both
Campath-1H.RTM. and 2C3-SFD1/K12 antibodies bound to each of the
mouse and human FcRn molecules with similar kinetics. In contrast,
His435Ala 2C3-SFD1/K12 antibodies bound at low levels to the mouse
FcRn but not to human FcRn. His310Ala/His435Gln 2C3-SFD1/K12
antibodies did not bind to either mouse or human FcRn molecule,
indicating that the incorporation of either the single or double
mutation into the 2C3-SFD1/K12 Fc region significantly affects
binding to mouse and human FcRn.
[0554] FIGS. 97A-97B demonstrate the ability of Campath1H.RTM.
("Campath"), 2C3-SFD1/K12 ("2C3"), His435Ala 2C3-SFD1/K12 ("H435A
2C3") and His310Ala/His435Gln 2C3-SFD1/K12 ("H310A/H435Q 2C3") to
bind to mouse and human FcRn molecules.
Example 65
Evaluation of the Half-Life of Fc Modified Anti-CD52 Antibodies
Following I.V. Administration in C57Bl/6 Mice
[0555] Fc modifications were incorporated into the 2C3-SFD1/K12
backbone to generate 2C3-SFD1/K12-Modified 1 and
2C3-SFD1/K12-Modified 2 antibodies that exhibited decreased binding
to the FcRn receptor responsible for maintaining antibodies in
circulation. The pharmacokinetic profile was determined for the
2C3-SFD1/K12 antibody and the 2C3-SFD1/K12-Modified 1 and
2C3-SFD1/K12-Modified 2 antibodies with reduced FcRn binding.
C57BL/6 mice were used to evaluate the PK profile in the absence of
target antigen (2C3-SFD1/K12 binds to human CD52 but does not
cross-react with mouse CD52). Mice were injected i.v. with
antibodies at 1 mg/kg. At various timepoints, blood was collected
to analyze the level of circulating human IgG1 in the mouse serum
by ELISA. Both 2C3-SFD1/K12-Modified 1 and 2C3-SFD1/K12-Modified 2
antibodies were cleared from the blood faster than the 2C3-SFD1/K12
antibody. 2C3-SFD1/K12 had a half-life of 403 hrs, while
2C3-SFD1/K12-Modified 1 had a half-life of 51 hours and
2C3-SFD1/K12-Modified 2 had a half-life of 8 hours. PK profiles for
2C3-SFD1/K12 and 2C3-SFD1/K12-Modified-1 were consistent with a
1-compartment model with only a single phase of elimination. In
contrast, profiles for 2C3-SFD1/K12-Modified-2 were consistent with
a 2 compartment model, with 2 distinct phases of elimination
(specified as alpha and beta in the table). The first phase lasted
until 48 hr post dose (alpha) and the second phase (beta, also
called the terminal elimination phase) started 48 hr post dose.
[0556] FIG. 98 shows the in vivo clearance of 2C3-SFD1/K12 ("2C3
unmodified"), 2C3-SFD1/K12-Modified 1 ("2C3-Fc mutant 1") and
2C3-SFD1/K12-Modified 2 ("2C3-Fc mutant 2") in nontransgenic
mice.
TABLE-US-00019 TABLE 17 Summary of Pharmacokinetic Data Across
Groups 2C3-SFD1/K12- 2C3-SFD1/K12- 2C3-SFD1/K12 Modified 1 Modified
2 t.sub.1/2 (hr) 403 .+-. 140 51.0 .+-. 12.3 8.05 .+-. 0.74 (Alpha)
282 .+-. 385 (Beta) Cl (ml/hr/kg) 0.29 .+-. 0.09 1.35 .+-. 0.36
5.90 .+-. 4.67 Vz (ml/kg) 156 .+-. 40.7 94.8 .+-. 14.3 1932 .+-.
1341 AUC (ug*hr/ml) 3748 .+-. 937 781 .+-. 171 230 .+-. 105 Cmax
(ug/ml) 9.65 .+-. 1.72 11.9 .+-. 0.83 9.64 .+-. 3.70
TABLE-US-00020 TABLE 18 Individual Animal Data HL_Lambda_z Cmax
AUCINF_obs Vz_obs Cl_obs Group.sup.# Animal (hr) (ug/ml) (hr*ug/ml)
(ml/kg) (ml/hr/kg) 2C3 2.1 197.26 11.56 2967.86 95.89 0.34 2C3 2.2
494.01 10.54 4635.96 153.73 0.22 2C3 2.3 324.61 10.06 3783.76
123.77 0.26 2C3 2.4 283.68 10.57 3130.92 130.72 0.32 2C3 2.5 330.89
6.15 2025.29 235.71 0.49 2C3 2.6 547.78 10.56 4469.73 176.81 0.22
2C3 2.7 597.92 10.57 4764.75 181.04 0.21 2C3 2.8 320.65 7.61
3415.82 135.43 0.29 2C3 2.9 527.01 9.27 4533.82 167.70 0.22 AVG
402.65 9.65 3747.55 155.64 0.29 SD 140.22 1.72 937.38 40.73 0.09
2C3-M1 3.1 35.20 12.84 513.50 98.89 1.95 2C3-M1 3.2 42.74 11.68
842.55 73.17 1.19 2C3-M1 3.3 50.55 11.39 902.62 80.80 1.11 2C3-M1
3.4 46.61 12.49 717.95 93.67 1.39 2C3-M1 3.5 56.38 12.94 911.32
89.26 1.10 2C3-M1 3.6 63.40 12.41 995.22 91.91 1.00 2C3-M1 3.7
33.86 12.02 513.17 95.19 1.95 2C3-M1 3.8 63.14 10.56 842.79 108.08
1.19 2C3-M1 3.9 66.75 11.02 788.59 122.12 1.27 AVG 50.96 11.93
780.86 94.79 1.35 SD 12.30 0.83 170.51 14.33 0.36 Alpha Beta
HL_Lambda HL_Lambda Cmax AUCINF_obs Vz_obs Cl_obs Group.sup.#
Animal (hr) (hr) (ug/ml) (hr*ug/ml) (ml/kg) (ml/hr/kg) 2C3-M2 4.1*
8.31 Missing 10.62 177.07 67.74 5.65 2C3-M2 4.2 7.42 994.71 11.35
390.03 3679.37 2.56 2C3-M2 4.3 7.37 703.09 10.48 315.82 3211.80
3.17 2C3-M2 4.4 7.72 227.03 11.78 247.96 1320.92 4.03 2C3-M2 4.5**
Missing Missing Missing Missing Missing Missing 2C3-M2 4.6**
Missing Missing Missing Missing Missing Missing 2C3-M2 4.7*** 77.89
77.89 1.32 61.71 1820.87 16.20 2C3-M2 4.8 8.18 150.98 11.41 221.89
981.64 4.51 2C3-M2 4.9 9.33 77.61 10.49 194.31 576.21 5.15 AVG 8.05
281.98 9.64 229.83 1931.80 5.90 SD 0.74 384.82 3.70 104.69 1341.43
4.67 .sup.#The tested groups were 2C3-SFD1/K12 ("2C3"),
2C3-SFD1/K12-Modified 1 ("2C3-M1") and 2C3-SFD1/K12-Modified 2
("2C3-M2") *Animal 4.1 no beta t1/2, Vz outlier. **Animals 4.5
& 4.6, not enough data for PK analysis. ***Animal 4.7
incomplete injection
Example 66
Evaluation of the Half-Life of Fc Modified Anti-CD52 Antibodies
Following I.V. Administration in Heterozygous huCD52 Transgenic
Mice
[0557] The pharmacokinetic profile was determined for the
2C3-SFD1/K12 antibody and the 2C3-SFD1/K12-Modified 1 and
2C3-SFD1/K12-Modified 2 antibodies with reduced FcRn binding in
vitro. huCD52 transgenic mice were used to evaluate the PK profile
in the presence of the 2C3-SFD1/K12 antibody target antigen. Mice
were injected i.v. with antibodies at 1 mg/kg. At various
timepoints, blood was collected to determine the level of
circulating human IgG1 in the mouse serum by ELISA. Both
2C3-SFD1/K12-Modified 1 and 2C3-SFD1/K12-Modified 2 antibodies were
cleared from the blood faster than the 2C3-SFD1/K12 antibody.
2C3-SFD1/K12 had a half-life of 64 hrs, while 2C3-SFD1/K12-Modified
1 had a half-life of 32 hours, and 2C3-SFD1/K12-Modified 2 had a
half-life of 6.5 hours.
[0558] FIG. 99 shows the in vivo clearance of 2C3-SFD1/K12 ("2C3"),
2C3-SFD1/K12 modified 1 ("2C3-Fc mutant 1") and 2C3-SFD1/K12
modified 2 ("2C3-Fc mutant 2") in huCD52 transgenic mice.
TABLE-US-00021 TABLE 19 Summary of Pharmacokinetic Data Across
Groups 2C3-SFD1/K12- 2C3-SFD1/K12- 2C3-SFD1/K12 Modified 1 Modified
2 t.sub.1/2 (hr) 64.2 .+-. 12.1 32.3 .+-. 3.25 6.58 .+-. 2.03 Cl
(ml/hr/kg) 2.15 .+-. 0.31 2.51 .+-. 0.28 5.41 .+-. 0.83 Vz (ml/kg)
198 .+-. 42.8 117 .+-. 21.1 49.7 .+-. 11.1 AUC (ug*hr/ml) 475 .+-.
73.4 403 .+-. 44.5 188 .+-. 27.2 Cmax (ug/ml) 8.88 .+-. 1.69 12.4
.+-. 1.67 12.9 .+-. 1.91
TABLE-US-00022 TABLE 20 Individual Animal Data HL_Lambda_z Cmax
AUCINF_obs Vz_obs Cl_obs Group# Animal (hr) (ug/ml) (hr*ug/ml)
(ml/kg) (ml/hr/kg) 2C3 2.1 77.32 8.19 421.87 264.42 2.37 2C3 2.11
61.47 10.38 483.25 183.51 2.07 2C3 2.2 78.28 9.28 496.58 227.42
2.01 2C3 2.3 82.38 6.99 441.98 268.91 2.26 2C3 2.4 53.60 9.08
465.09 166.28 2.15 2C3 2.5 58.02 9.09 526.59 158.95 1.90 2C3 2.6
44.97 6.03 371.17 174.78 2.69 2C3 2.7 56.52 9.38 476.41 171.16 2.10
2C3 2.8 67.99 12.13 641.28 152.97 1.56 2C3 2.9 61.46 8.30 421.65
210.29 2.37 Mean 64.20 8.88 474.59 197.87 2.15 SD 12.06 1.69 73.40
42.80 0.31 2C3-M1 3.1 28.48 15.19 412.41 99.64 2.42 2C3-M1 3.11
34.64 12.60 468.36 106.69 2.14 2C3-M1 3.2 27.57 14.17 411.82 96.60
2.43 2C3-M1 3.3 34.27 11.96 401.38 123.20 2.49 2C3-M1 3.4 29.10
12.51 400.36 104.85 2.50 2C3-M1 3.5 29.63 11.11 470.98 90.77 2.12
2C3-M1 3.6 32.76 9.75 348.72 135.53 2.87 2C3-M1 3.7 35.68 10.41
328.71 156.61 3.04 2C3-M1 3.8 36.41 13.52 390.24 134.61 2.56 2C3-M1
3.9 34.06 12.39 392.53 125.19 2.55 Mean 32.26 12.36 402.55 117.37
2.51 SD 3.25 1.67 44.48 21.05 0.28 2C3-M2 4.1 7.64 13.45 197.24
55.85 5.07 2C3-M2 4.11 Missing 9.00 Missing Missing Missing 2C3-M2
4.2 7.79 14.92 217.80 51.61 4.59 2C3-M2 4.3 7.35 12.79 183.44 57.78
5.45 2C3-M2 4.4 3.54 10.34 152.92 33.44 6.54 2C3-M2 4.5 Missing
Missing Missing Missing Missing 2C3-M2 4.6 Missing Missing Missing
Missing Missing 2C3-M2 4.7 Missing Missing Missing Missing Missing
2C3-M2 4.8 Missing Missing Missing Missing Missing 2C3-M2 4.9
Missing Missing Missing Missing Missing Mean 6.58 12.10 187.85
49.67 5.41 SD 2.03 2.40 27.23 11.12 0.83 PK parameters not
available for 4.11, 4.5, 4.6, 4.7, 4.8, and 4.9 due to insufficient
data. #The tested groups were 2C3-SFD1/K12 ("2C3"),
2C3-SFD1/K12-Modified 1 ("2C3-M1") and 2C3-SFD1/K12-Modified 2
("2C3-M2")
Example 67
Evaluation of In Vivo Depletion Following I.V. Administration of Fc
Modified Anti-CD52 Antibodies in Heterozygous huCD52 Transgenic
Mice
[0559] The depletion activity was determined for the 2C3-SFD1/K12,
2C3-SFD1/K12-Modified 1, and 2C3-SFD1/K12-Modified 2 antibodies in
huCD52 transgenic mice. Mice were treated with 1 mg/kg of
2C3-SFD1/K12, 2C3-SFD1/K12-Modified 1, or 2C3-SFD1/K12-Modified 2
antibodies and evaluated for the presence of CD4 T cells, CD8+ T
cells, B cells, and NK cells 72 hours later. Administration of
2C3-SFD1/K12-Modified 1 or 2C3-SFD1/K12-Modified 2 antibodies
resulted in decreased levels of depletion in the blood and spleen
compared administration of 2C3-SFD1/K12 antibodies. Further,
2C3-SFD1/K12-Modified 1 elicited greater depletion than
2C3-SFD1/K12-Modified 2 in both the blood and spleen
[0560] FIGS. 100A-100B show the level of bulk lymphocyte
populations (CD4+ T cells, CD8+ T cells, B220+ B cells, and NK
cells) in the blood and spleen 72 hours after dosing with
2C3-SFD1/K12 ("2C3"), 2C3-SFD1/K12 modified 1 ("2C3 Fc mutant-1"),
and 2C3-SFD1/K12 modified 2 ("2C3 Fc mutant-2") antibodies.
Example 68
Detailed Epitope Specificities of Humanized Anti-CD52
Antibodies
[0561] Detailed epitope specificities of the humanized
12G6-SFD1/K12, 2C3-SFD1/K12, and 9D9-H16/K13 antibodies were
determined using a Biacore T100 instrument. As a control, the
epitope specificity of clone 097 (purified anti-human CD52
antibody, Biolegend) was evaluated using the same methodologies.
The epitope specificity of clone 097 had previously been
characterized using a peptide ELISA method (Hale G, "Synthetic
peptide mimotype of the CAMPATH-1 (CD52) antigen, a small
glycosylphosphatidylinositol-anchored glycoprotein,"
Immunotechnology, 1:175-187 (1995)). In this Biacore T100 assay,
the antibodies were directly immobilized on Biacore CMS Series S
carboxymethyl dextran sensor chips (GE #BR-1006-68) using amine
coupling. The carboxymethyl dextran surface was activated using a
1:1 mixture of 0.1M N-hydroxysuccinimide (NHS) and 0.4M
N-ethyl-N'-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC),
allowing the surface to bind reactive amine groups on the
antibodies. Because IgM antibodies tend to have a higher level of
non-specific binding compared to IgGs, the binding of a mouse
IgM.kappa. (mIgM.kappa.) isotype control (Biolegend clone #MM-30)
was also investigated. Following antibody immobilization, the
reactive sensor chip surface was quenched using 1M ethanolamine
hydrochloride/NaOH pH 8.5. One flow cell on each chip was a blank
reference surface, and subsequent flow cells were immobilized with
10,000 RU of antibody.
[0562] A series of alanine-scanning mutant peptides comprising the
human CD52 sequence (MUT 1-MUT 12 (SEQ ID NOS: 169-180,
respectively), Table 21) (see, e.g., Hale G, "Synthetic peptide
mimotype of the CAMPATH-1 (CD52) antigen, a small
glycosylphosphatidylinositol-anchored glycoprotein,"
Immunotechnology, 1:175-187 (1995)) were synthesized. Antibody
binding to these mutant CD52 peptides and to wildtype human CD52
peptides was tested at concentrations of 500 nM, 100 nM, 50 nM, and
0 nM. Peptides were diluted into the assay running buffer, HBS-EP+
(10 mM HEPES, 150 mM NaCl, 0.05% P20 surfactant, 3 mM EDTA, pH
7.4). Duplicates of 100 nM samples were included. The light (kappa)
chain specific rat anti-mouse IgM antibody (Southern Biotech Clone
#1B4B1) was also included as an IgM control. The T100 instrument
sample chamber and assay temperatures were set to 4.degree. C. and
25.degree. C., respectively. The human CD52 peptide samples were
injected for five minutes at a 50 .mu.l/min flow rate to measure
association, and washed in HBS-EP+ for five minutes at a 50
.mu.l/min flow rate to measure dissociation. The antibody surface
was stripped of any remaining bound peptide using a sixty second
injection of 10 mM glycine-HCl pH 2.0 at a 50 .mu.l/min flow rate.
Analysis was performed using Biacore T100 Kinetics Evaluation
software v2.0 (GE Healthcare). Data was fit to a 1:1 model with
reference flow cell and 0 nM concentration subtraction
(double-reference subtraction). Representative sensorgrams of
12G6-SFD1/K12 antibody negative ((-), MUT 8) and positive ((+), MUT
9) peptide epitope recognition are shown in FIG. 101A and FIG.
101B, respectively. The compiled peptide binding data is summarized
in Table 21.
[0563] The previously characterized binding specificity of clone
097 (Hale G, "Synthetic peptide mimotype of the CAMPATH-1 (CD52)
antigen, a small glycosylphosphatidylinositol-anchored
glycoprotein," Immunotechnology, 1:175-187 (1995)) was determined
by coating ELISA plates with peptides containing the six residues
of the C-terminal portion of human CD52 and then measuring the
binding of the antibody to the fixed peptide. Each of the residues
was substituted by all 20 amino acids. Because the peptides were
attached to a solid surface in this ELISA, the assay may have been
more influenced by avidity effects than the Biacore T100 assay
described herein, which uses an antibody fixed to the surface over
which the peptides are flowed. In the ELISA study, alanine
substitutions at positions 11 and 12 (wildtype residues proline and
serine, respectively) of the mature form of human CD52 were found
to reduce strong binding of clone 097 to the peptide. In the
present Biacore T100 study, alanine substitutions at positions 11
and 12 (as well as positions 7, 8, 9, and 10) were found to
abrogate binding of clone 097. The hypothesized avidity effects of
the ELISA assay are likely the reason why the mapped epitope of
clone 097 is smaller as determined by the ELISA method than as
determined by the described Biacore T100 assay.
[0564] The binding of both the 2C3-SFD1/K12 and 12G6-SFD1/K12
humanized antibodies to the human CD52 peptide sequence is
sensitive to alanine substitutions at positions 7, 8, and 11 and
the binding of humanized 9D9-H16/K13 is sensitive to alanine
substitutions at positions 4 and 11. These defined epitope
specificities overlap with the results observed in Example 4
(summarized in Table 8). Slight variations between the results are
not unexpected given that the Biacore T100 method used to measure
binding in the present case was significantly different from the
method used in Example 4. In contrast to the present case, in
Example 4, engineered CHO cells were used to express wildtype or
alanine-substituted mutants of human CD52. Human CD52 expressed in
such mammalian cells can be glycosylated, affecting binding. This
is not the case for the human CD52 used in the Biacore T100
assay.
TABLE-US-00023 TABLE 21 Binding to alanine-scanning mutant hCD52
peptides SEQ 2C3- 9D9- 12G6- Control ID Peptide SFD1/K12 H16/K13
SFD1/K12 097 mIgM NO: Sequence Binding Binding Binding Binding
Binding Peptide MUT 1 169 AQNDTSQTSSPSADC + + + + - MUT 2 170
GANDTSQTSSPSADC + + + + - MUT 3 171 GQADTSQTSSPSADC + + + + - MUT 4
172 GQNATSQTSSPSADC + - + + - MUT 5 173 GQNDASQTSSPSADC + + + + -
MUT 6 174 GQNDTAQTSSPSADC + + + + - MUT 7 175 GQNDTSATSSPSADC - + -
- - MUT 8 176 GQNDTSQASSPSADC - + - - - MUT 9 177 GQNDTSQTASPSADC +
+ + - - MUT 10 178 GQNDTSQTSAPSADC + + + - - MUT 11 179
GQNDTSQTSSASADC - - - - - MUT 12 180 GQNDTSQTSSPAADC + + + - -
Controls WT 1 181 GQNDTSQTSSPSADK- + + + + - Biotin WT 2 182
Biotin- + - + + - GQNDTSQTSSPSAD Rat anti- N/A N/A N/A N/A N/A + +
mIgM (+) Binding detected: Maximum response (R.sub.max) > 2RUs
for 500 nM peptide injection (-) No binding detected: Maximum
response (R.sub.max) < 2RUs for 500 nM peptide injection
Example 69
Assessment of CD4+ T cell responses induced by Campath-1H.RTM. or
12G6-SFD1/K12
[0565] The CD4+ T cell proliferative response was evaluated after
repeated in vitro stimulation with autologous dendritic cells (DC)
preloaded with a set of overlapping 15-mer peptides comprising
sequences from the variable regions of either Campath-1H.RTM. or
the humanized 12G6-SFD1/K12 antibody. These experiments utilized
normal human donor T cells and DCs. Results were measured by
quantifying tritiated thymidine incorporation of the proliferating
human CD4+ T cells in response to autologous peptide pulsed antigen
presenting cells (APC).
[0566] Cell Preparation:
[0567] PBMCs were isolated from a normal human donor apheresis
product acquired from BioMed Supplies (Carlsbad, Calif.). HLA
haplotype screening of the donor blood was performed by Key
Biologics, LLC (Memphis, Tenn.) (Table 22). PBMCs were isolated
using the Ficoll-Paque.TM. PLUS density gradient (GE Healthcare)
and a series of washes with phosphate buffered saline (PBS,
Invitrogen, Carlsbad, Calif.). CD4+ T cells were isolated from PBMC
using the Dynal CD4+ bead-based positive isolation kit
(Invitrogen), following the manufacturer's recommended protocol.
Isolated CD4+ T cells were frozen in Recovery Cell Culture Freezing
Media (Invitrogen) and stored in liquid nitrogen. Dendritic Cells
(DC) were induced from PBMCs by plating adherent cells with GM-CSF
(Leukine, Bayer, Leverkusin, Germany) and IL-4 (Peprotech, Rocky
Hill, N.J.) for six days. Media supplemented with GM-CSF and IL-4
was replaced on day 4. DCs were subsequently isolated from the
flasks and frozen in the Freezing Media then transferred to liquid
nitrogen storage tanks.
TABLE-US-00024 TABLE 22 HLA haplotype of blood donors Donor HLA DR
haploytpe peptide set BMS170 DRB1_0701 DRB1_1503 Campath BMS154
DRB1_0301 DRB1_0302 Campath BMS150 DRB1_1101 DRB1_1302 Campath
BMS167 DRB1_0701 DRB1_1503 Campath BMS200 DRB1_0804 DRB1_1202
Campath BMS301 DRB1_1401 DRB1_1503 Campath BMS352 DRB1_0301
DRB1_1101 Campath BMS362 DRB1_0302 DRB1_0302 Campath BMS484
DRB1_0103 DRB1_1201 Campath/GLD52 BMS486 DRB1_1302 DRB1_1303
Campath/GLD52 BMS640 DRB1_0301 DRB1_1302 GLD52 BMS656 DRB1_301
DRB1_1101 GLD52 BMS902 DRB1_0302 DRB1_0804 GLD52 BMS928 DRB1_1001
DRB1_1503 GLD52 BMS927 DRB1_1001 DRB1_1503 GLD52 BMS963 DRB1_0302
DRB1_1401 GLD52 BMS361 DRB1_1102 DRB1_1401 GLD52 BMS165 DRB1_1102
DRB1_1501 GLD52
[0568] Peptide:
[0569] Peptides encompassing the heavy and light chain variable
regions of Campath-1H.RTM. and 12G6-SFD1/K12 were synthesized using
a Rainin Symphony automated peptide synthesizer using standard
Fmoc-chemistry on CLEAR.TM. resin (Peptides International,
Louisville, Ky.). Amino acids (EMD Biosciences, San Diego, Calif.
or Anaspec, San Jose, Calif.) were orthogonally protected with
tert-Butoxycarbonyl (BOC), tert-Butyl (tBu),
2,2,4,6,7-Pentamethyldihydro-benzofuran-5-sulfonyl (Pbf), or Trityl
(Trt) groups. Couplings were performed using an amino
acid/HCTU/HOBt/DIEA/resin with a molar ratio of 6:6:3:12:1. A
solution of 20% Piperidine and 2.5%
1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) in DMF was used to remove
Fmoc from the amino terminus during each cycle.
Deprotection/cleavage from resin was performed using a cocktail of
15 mls/0.1 mM resin of 2.5% water/2.5% TIS/5% Anisole/90% TFA v/v
ratio for 3 hours. Supernatant was precipitated in diethyl-ether
(-80.degree. C.) and pelleted at 3000 rpm for 10 minutes. Ether was
decanted and the pellet was washed again. Crude peptide was then
lyophilized. Analytical HPLC (XBridge C18 4.5.times.100 mm, Waters
Corp., Milford, Mass.) and MALDI-TOF mass spectrometry (Synapt,
Waters Corp., Milford, Mass.) were used to verify the sequences and
assess purity. All reagents were HPLC grade (EMD Biosciences, San
Diego, Ca or Sigma Aldrich, St. Louis, Mo.). Lyophilized peptides
were resuspended in 100% DMSO (Sigma). Forty three Campath-1H.RTM.
peptides were combined into 11 linear groups, each containing 3 or
4 peptides per group (Table 23: from top to bottom, light chain
peptides are denoted by SEQ ID NOs: 187-206 and heavy chain
peptides are denoted by SEQ ID NOs: 207-229). The 42 12G6-SFD1/K12
peptides were combined into 8 linear groups, each containing five
or six peptides per group (Table 24: from top to bottom, light
chain peptides are denoted by SEQ ID NOs: 230-250 and heavy chain
peptides are denoted by SEQ ID NOs: 251-271).
TABLE-US-00025 TABLE 23 43 Campath-1H .RTM. 15-mer light chain and
heavy chain peptides, overlapping by 10 amino acids each Campath-1H
.RTM. Peptides light chain heavy chain Peptide ID# Peptide ID#
DIQMTQSPSSLSASV 978 QVQLQESGPGLVRPS 998 QSPSSLSASVGDRVT 979
ESGPGLVRPSQTLSL 999 LSASVGDRVTITCKA 980 LVRPSQTLSLTCTVS 1000
GDRVTITCKASQNID 981 QTLSLTCTVSGFTFT 1001 ITCKASQNIDKYLNW 982
TCTVSGFTFTDFYMN 1002 SQNIDKYLNWYQQKP 983 GFTFTDFYMNWVRQP 1003
KYLNWYQQKPGKAPK 984 DFYMNWVRQPPGRGL 1004 YQQKPGKAPKLLIYN 985
WVRQPPGRGLEWIGF 1005 GKAPKLLIYNTNNLQ 986 PGRGLEWIGFIRDKA 1006
LLIYNTNNLQTGVPS 987 EWIGFIRDKAKGYTT 1007 TNNLQTGVPSRFSGS 988
IRDKAKGYTTEYNPS 1008 TGVPSRFSGSGSGTD 989 KGYTTEYNPSVKGRV 1009
RFSGSGSGTDFTFTI 990 EYNPSVKGRVTMLVD 1010 GSGTDFTFTISSLQP 991
VKGRVTMLVDTSKNQ 1011 FTFTISSLQPEDIAT 992 TMLVDTSKNQFSLRL 1012
SSLQPEDIATYYCLQ 993 TSKNQFSLRLSSVTA 1013 EDIATYYCLQHISRP 994
FSLRLSSVTAADTAV 1014 YYCLQHISRPRTFGQ 995 SSVTAADTAVYYCAR 1015
HISRPRTFGQGTKVE 996 ADTAVYYCAREGHTA 1016 RTFGQGTKVEIKRTV 997
YYCAREGHTAAPFDY 1017 EGHTAAPFDYWGQGS 1018 APFDYWGQGSLVTVS 1019
WGQGSLVTVSSASTK 1020
TABLE-US-00026 TABLE 24 42 12G6-SFD1/K12 15-mer light chain and
heavy chain peptides, overlapping by 10 amino acids each
12G6-SFD1/K12 Peptides light chain heavy chain Peptide ID# Peptide
ID# DIVMTQTPLSLSVTP 1027 EVQLVESGGGLVQPG 1048 QTPLSLVTPGQPAS 1028
ESGGGLVQPGGSLRL 1049 LSVTPGQPASISCKS 1029 LVQPGGSLRLSCAAS 1050
GQPASISCKSSQSLL 1030 GSLRLSCAASGFPFS 1079 ISCKSSQSLLYSNGK 1031
SCAASGFPFSNYWMN 1080 SQSLLYSNGKTYLNW 1032 GFPFSNYWMNWVRQA 1081
YSNGKTYLNWVLQKP 1072 NYWMNWVRQAPGKGL 1082 TYLNWVLQKPGQSPQ 1073
WVRQAPGKGLEWVGQ 1055 VLQKPGQSPQRLIYL 1074 PGKGLEWVGQIRLKS 1056
GQSPQRLIYLVSKLD 1036 EWVGQIRLKSNNYAT 1060 RLIYLVSKLDSGVPD 1037
IRLKSNNYATHYAES 1061 VSKLDSGVPDRFSGS 1038 NNYATHYAESVKGRF 1062
SGVPDRFSGSGSGTD 1039 HYAESVKGRFTISRD 1063 RFSGSGSGTDFTLKI 1040
VKGRFTISRDDSKNS 1064 GSGTDFTLKISRVEA 1041 TISRDDSKNSLYLQM 1065
FTLKISRVEAEDVGV 1042 DSKNSLYLQMNSLKT 1066 SRVEAEDVGVYYCVQ 1043
LYLQMNSLKTEDTAV 1067 EDVGVYYCVQGSHFH 1075 NSLKTEDTAVYYCTP 1068
YYCVQGSHFHTFGQG 1076 EDTAVYYCTPIDYWG 1083 GSHFHTFGQGTKLEI 1077
YYCTPIDYWGQGTTV 1084 TFGQGTKLEIKRTVA 1078 IDYWGQGTTVTVSSA 1085
In Vitro Stimulation
[0570] DC Antigen Pulsing and Maturation:
[0571] Before treatment with the peptides, DCs were thawed, washed
and plated in RPMI (Invitrogen, Carlsbad, Calif.) supplemented with
5% Human Serum (HS, Sigma, St. Louis, Mo.), 1%
Penicillin-Streptomycin (Invitrogen, Carlsbad, Calif.), 100
.mu.g/ml GM-CSF, and 20 .mu.g/ml IL-4. DCs were plated at
2.times.10.sup.5 cells/ml in 4 ml media in 6-well tissue culture
plates and allowed to adhere for 1 hour at 37.degree. C. Following
cell adherence, 10 .mu.g/ml (40 .mu.g total) of each peptide were
added to wells containing DCs, correlating to either 120 .mu.g or
160 .mu.g of total peptides added to each well (Campath-1H.RTM.
3-peptide or 4-peptide groups), or 200 .mu.g or 240 .mu.g of total
peptide added to each well (12G6-SFD1/K12 5-peptide or 6-peptide
groups). 40 .mu.g of the pan-DR binding epitope (PADRE) were added
to one well of DCs and served as a positive control, as it can bind
to most HLA-DR molecules (Alexander J, et al., "Development of high
potency universal DR-restricted helper epitopes by modification of
high affinity DR-blocking peptides," Immunity, 1:751-761 (1994)).
Likewise, 40 .mu.g of each of three HLA-DR binding Tetanus toxoid
peptides (DTIMMEPPYCKGLDIYYKA (SEQ ID NO: 183),
SAMLTNLIIFGPGPVLNKNEV (SEQ ID NO: 184), and NNFTVSFWLRVPKVSASHLE
(SEQ ID NO: 185)) were added to one well of DCs. Similarly, a heat
inactivated adenovirus was employed as a positive antigen source
and was added to one well of DCs at 1 pg/ml. Lastly, one group of
DCs remained unpulsed with antigen and served as a `null` educated
group. The DCs pulsed with the various antigens were incubated for
at least three hours at 37.degree. C. DCs were then treated with a
`maturating cytokine cocktail` containing 50 ng/ml TNF-.alpha., 10
ng/ml IL-6, 25 ng/ml IL-1beta (Peprotech, Rocky Hill, N.J.) and 500
ng/ml PGE-2 (Sigma Aldrich, St. Louis, Mo.). The antigen pulsed DCs
were then allowed to mature overnight at 37.degree. C.
[0572] Establishment of Co-Culture:
[0573] Following peptide loading and maturation, DCs were washed
twice with PBS and replenished with 4 ml RPMI supplemented with 10%
HS. Autologous CD4+ T cells were thawed and resuspended at
2.times.10.sup.6 cells/ml in RPMI supplemented with 10% HS,
Penicillin, and Streptomycin. The DCs were then cultured with naive
CD4+ T cells at a 10:1 T cell:DC ratio (8.times.10.sup.6 T
cells:8.times.10.sup.5 DCs) in 8 mls media. The co-culture was then
incubated at 37.degree. C. for 7 days. Approximately 72 hours after
initiation of co-culture, the cells were supplemented with 25 IU
recombinant IL-2 (Peprotech, Rocky Hill, N.J.), and further
supplemented with 25 IU recombinant IL-2 in fresh media every 3-4
days thereafter.
[0574] Restimulation of Co-Culture:
[0575] At day 7 (Stim #2) and day 14 (Stim #3), the co-cultures
were restimulated following the above procedure.
[0576] Proliferation Assay:
[0577] DCs were plated, antigen pulsed and matured as stated above
at 5.times.10.sup.5 cells/ml in 1 ml media on 24-well low binding
plates to ease the subsequent transfer of cells to U-bottom assay
plates. An irrelevant HLA_DR binding peptide, CS 378-398 (peptide
sequence DIEKKIAKMEKASSVFNVVNS (SEQ ID NO: 186)), was used as a
negative control (Alexander J, et al., "Development of high potency
universal DR-restricted helper epitopes by modification of high
affinity DR-blocking peptides," Immunity, 1:751-761 (1994)).
Following 24 hour DC maturation, the cells were detached from
plates using ice cold PBS washes. DCs were plated in U-bottom 96
well plates with the antigen stimulated T cells at a 1:1 T cell:DC
ratio (2.5.times.10.sup.4 DC/well). Each T cell group was assayed
in triplicate with DC pulsed with the educating peptide(s)
(specific response) and DC pulsed with irrelevant peptide
(nonspecific response), as well as T cell only and DC only
controls. The assay proceeded for 72 hours prior to the addition of
1 uCi tritiated thymidine per well (Perkin Elmer, Waltham, Mass.).
Cells were harvested on a 96 well plate harvester (Perkin Elmer)
and the amount of tritiated thymidine incorporated quantified by
measuring CPM on a Wallac MicroBeta.RTM. Trilux counter (Perkin
Elmer). The stimulation index was calculated by dividing the
specific CPM by the nonspecific CPM.
[0578] T Cell Receptor (TCR) V Beta Usage:
[0579] Any CD4+ T cells remaining after establishment of the
proliferation assay were frozen for eventual determination of T
cell receptor V beta chain expression. Cells were thawed and
stained with antibodies recognizing 24 conjugated Vbeta family
members for 30 minutes following manufacturer's directions in the
IOTest.RTM. Beta Mark Kit (Beckman Coulter, France). After washing
with PBS and resuspending in 1% formaldehyde, cells were analyzed
on FACScalibur.TM. (Becton Dickinson, Franklin Lakes, N.J.). The
percentage of cells expressing each of the detected V-beta chains
was calculated, as summarized in FIG. 102 and FIG. 103.
Campath-1H.RTM. Immunogenicity Assessment
[0580] Immunogenicity assessment of Campath-1H.RTM. peptides was
performed as described above using PBMCs from ten normal donors,
from BioMedSupply (BMS). The summary of the responses as indicated
by the stimulation index are depicted in Table 25A. Each donor is
listed on one column, and each row lists the group of peptides used
to stimulate CD4+ T cells. The Stimulation index (SI) is determined
by dividing the specific immune response to the educating peptide
group by an irrelevant response. SI values <2.0 are not listed.
The proliferation data for each of the ten donors summarized in
Table 25A is reported in FIG. 104A-J. Six donors exhibited a
stimulation index greater than 2.0, and as a result were termed
`Campath-1H.RTM. responders`. Educated CD4+ T cells from one of the
responders, BMS352, exhibited specific immune responses when
assayed with two different peptide groups. A seventh donor, BMS486,
was also classified as `responder`. In this donor, a stimulation
index 1.7 times background was recorded with the light chain
peptide group 986-989. When assessing the V beta upregulation in
the educated T cell cultures within this donor, it was shown that
the 986-989 educated T cells exhibited high upregulation of a
single V beta, V.beta.3 (FIG. 102). The upregulation of a single V
beta and specific proliferative response indicated that BMS486 was
a Campath-1H.RTM. responder. The three non-responding donors,
BMS200, BMS154, and BMS167, did not show proliferative data or V
beta upregulation, indicating that a peptide specific immune
response did not occur. The Campath-1H.RTM. data was quantified as
a 70% ( 7/10) responder rate. The total number of peptide groups
eliciting an immune response was eight. Three of those eight
immunogenic peptide groups elicited strong responses in the
respective donors with stimulation indices of 3.0 or above (Table
26).
[0581] Table 25: Summary of Stimulation Index Data
TABLE-US-00027 TABLE 25A Campath-1H .RTM. Stimulation Index
Campath-1H .RTM. Stimulation Index BMS200 BMS301 BMS154 BMS484
BMS362 BMS486 BMS150 BMS167 BMS170 BMS352 982, 983, 984 nd &
987 988, 989 & 990 985, 986, 991 2.6 & 992 993, 994, 995
& 996 997, 998 & 999 978, 979, 980, 981 982, 983, 984, 2.0
985 986, 987, 988, 2.1 1.7 989 990, 991, 992, 993 994, 995, 996,
2.1 997 998, 999, 1000, 1001 1002, 1003, 1004, 1005 1006, 1007, 4.2
5.4 1008, 1009 1010, 1011, 3.0 1012, 1013 1014, 1015, 1016, 1017
1018, 1019, 1020 PADRE 2.0 2.0 2.5 2.5 2.8 10.5 2.6 Tetanus 11.2
2.3 4.5 2.3 25.9 Ad-Bgal-HI 27.6 4.5 2.6 3.1 13.0 3.8 24.2 44.5
46.6 3.2 Null
TABLE-US-00028 TABLE 25B 12G6-SFD1/K12 Stimulation Index
12G6-SFD1/K12 Stimulation Index BMS484 BMS486 BMS656 BMS640 BMS361
BMS165 BMS902 BMS928 BMS927 BMS963 1027, 1028, 1029, 1030, 1031
1032, 1072, 1073, 2.1 2.5 1074, 1036 1037, 1038, 1039, 1040, 1041
1042, 1043, 1075, 1076, 1077, 1078 1048, 1049, 1050, 1079, 1080
1081, 1082, 1055, 2.1 1056, 1060 1061, 1062, 1063, 2.0 nd 1064,
1065 1066, 1067, 1068, 2.0 1083, 1084, 1085 PADRE 3.0 3.6 2.2 9.8
2.4 2.3 4.7 TT-974, 975, 976 2.9 5.2 3.2 5.7 12.9 3.7 4.3 22.4
Ad-Bgal 17.6 11.0 10.9 31.7 29.1 29.3 10.3 8.4 6.3 Null
Example 70
Assessment of CD4+ T Cell Responses Induced by 12G6-SFD1/K12
[0582] Immunogenicity assessment and V beta analysis of the
variable region of 12G6-SFD1/K12 were performed as described in
Example 69 for Campath-1H.RTM., employing cells from ten normal
donors. The proliferation data for each of the ten donors
summarized in Table 25B is reported in FIG. 105A-J. Two of these
ten donors were also used in the Campath-1H.RTM. assessment
described above (BMS486 and BMS484), while the remaining eight
donors were tested only with the 12G6-SFD1/K12 peptides. One donor,
BMS484, responded to three peptide groups and was classified as a
`12G6-SFD1/K12 responder` (Table 25B). Two donors, BMS927 and
BMS928, each responded to one group of peptides and were therefore
also classified as responders. Donor BMS928 showed a weak
stimulation index of 2.0 to the group containing heavy chain
peptides 1066, 1067, 1068, 1083, 1084, and 1085. This response was
confirmed by analyzing the proliferative T cells for V beta usage.
The responding BMS928 T cells exhibited an upregulation of a single
V beta, V.beta.20 (FIG. 103). Donor BMS927 showed a stimulation
index of 2.5 in T cells educated with one group of light chain
peptides. V beta analysis of the responding BMS927 T cells did not
indicate a single V beta upregulation over background. However,
this donor remains in the `responder` category, as the V beta kit
represents only 70% of all possible V beta usages. The
12G6-SFD1/K12 rate of immunogenicity in these 10 donors was 30% (
3/10), less than half the rate of Campath-1H.RTM. responders (70%).
A total of five peptide groups elicited a response, while none of
those five groups resulted in a stimulation index greater than 3.0
(Table 26).
TABLE-US-00029 TABLE 26 Summary of Campath-1H .RTM. and
12G6-SFD1/K12 immune responses 12G6- Campath-1H .RTM. SFD1/K12
Percentage of responders 70% (7/10) 30% (3/10) Number of peptide
groups eliciting 8 5 response Responding peptide groups with 3/8
(38%) 0/3 (0%) Stimulation Index .gtoreq. 3.0
SUMMARY
[0583] Peptides correlating to the heavy and light chain variable
regions of humanized anti-CD52 monoclonal antibody 12G6-SFD1/K12
induced fewer immune responses from ten donors (30%) than peptides
from the heavy and light chain variable regions of Campath-1H.RTM.
(70%). The CD4+ T cell based immune responses that were generated
with 12G6-SFD1/K12 were also of less magnitude than the
Campath-1H.RTM. induced responses.
[0584] The following table lists the sequence identification
numbers used herein.
TABLE-US-00030 TABLE 26 List of SEQ ID NOs SEQ ID NO TYPE
DESCRIPTION 1 light chain variable Campath-1G.RTM. 2 region (VL)
CF1D12 3 8G3 (mouse) 4 4G7 (mouse) 5 9D9 (mouse) 6 11C11 (mouse) 7
3G7 (mouse) 8 5F7 (mouse) 9 12G6 (mouse) 10 23E6 (mouse) 11 2C3
(mouse) 12 7F11 (mouse) 13 4B10 (mouse) 14 heavy chain variable
Campath-1G.RTM. 15 region (VH) CF1D12 16 8G3 (mouse) 17 4G7 (mouse)
18 9D9 (mouse) 19 11C11 (mouse) 20 3G7 (mouse) 21 5F7 (mouse) 22
12G6 (mouse) 23 23E6 (mouse) 24 2C3 (mouse) 25 7F11 (mouse) 26 4B10
(mouse) 27 light chain CDR-1 Campath-1H.RTM. 28 CF1D12 (mouse) 29
8G3, 4G7, 9D9, 11C11, 3G7 (mouse) 30 5F7 (mouse) 31 12G6, 23E6, 2C3
(mouse) 32 7F11 (mouse) 33 4B10 (mouse) 34 light chain CDR-2
Campath-1H.RTM. 35 CF1D12 (mouse) 36 8G3, 11C11, 12G6, 23E6, 2C3
(mouse) 37 4G7 (mouse) 38 9D9 (mouse) 39 3G7 (mouse) 40 5F7 (mouse)
41 7F11, 4B10 (mouse) 42 light chain CDR-3 Campath-1H.RTM. 43
CF1D12, 8G3, 4G7, 9D9, 11C11, 3G7, 5F7 (mouse) 44 12G6 (mouse) 45
23E6 (mouse) 46 2C3 (mouse) 47 7F11 (mouse) 48 4B10 (mouse) 49
heavy chain CDR-1 Campath-1H.RTM. 50 CF1D12, 4G7, 9D9, 11C11, 3G7
(mouse) 51 8G3 (mouse) 52 5F7 (mouse) 53 12G6 (mouse) 54 23E6
(mouse) 55 2C3 (mouse) 56 7F11, 4B10 (mouse) 57 heavy chain CDR-2
Campath-1H.RTM. 58 CF1D12 (mouse) 59 8G3 (mouse) 60 4G7 (mouse) 61
9D9, 11C11, 5F7 (mouse) 62 3G7( mouse) 63 12G6, 2C3 (mouse) 64 23E6
(mouse) 65 7F11 (mouse) 66 4B10 (mouse) 67 heavy chain CDR-3
Campath-1H.RTM. 68 CF1D12, 9D9 (mouse) 69 8G3, 4G7, 11C11, 3G7
(mouse) 70 5F7 (mouse) 71 12G6, 23E6 (mouse) 72 2C3 (mouse) 73 7F11
(mouse) 74 4B10 (mouse) 75 light chain primers Lead-ML kappa
(forward primer in leader sequence) 76 FR1-ML kappa (forward primer
in the framework 1) 77 ML kappa const (reverse primer in constant
region) 78 VK-MK (forward primer in the framework 1) 79 MKC-Const
(reverse primer in constant region) 80 heavy chain primers
MH-SP-ALT1 (forward primer in leader sequence) 81 MH-SP-ALT2
(forward primer in leader sequence) 82 MH-FR1 (forward primer in
the framework 1) 83 MH-FR1-1 (forward primer in the framework 1) 84
MH-J2 (reverse primer in J region) 85 MH-gamma-const (reverse
primer in constant region) 86 VH MH1 (forward primer in the
framework 1) 87 VH MH2 (forward primer in the framework 1) 88 VH
MH3 (forward primer in the framework 1) 89 VH MH4 (forward primer
in the framework 1) 90 VH MH5 (forward primer in the framework 1)
91 VH MH6 (forward primer in the framework 1) 92 VH MH7 (forward
primer in the framework 1) 93 IgG1 (reverse primer in mouse IgG1
CH1 constant region) 94 IgG2A (reverse primer in mouse IgG2A CH1
constant region) 95 IgG2B (reverse primer in mouse IgG2B CH1
constant region) 96 VH (partial) 4B10 (mouse): alignment 97 human
germline (VH) VH3-72: alignment 98 VH (partial) 4B10 (humanized):
alignment 99 mouse VL (partial) 4B10 (mouse): alignment 100 human
germline (VL) VK2-A18b: alignment 101 VL (partial) 4B10
(humanized): alignment 102 VL 4B10-VK1 (humanized) 103 VH 4B10-VH1
(humanized) 104 CD52 alanine-scanning WT 105 mutant peptides MUT 1
106 MUT 2 107 MUT 3 108 MUT 4 109 MUT 5 110 MUT 6 111 MUT 7 112 MUT
8 113 MUT 9 114 MUT 10 115 LC CDR-1 K/RSSQSLL/V/IXS/TN/DGXS/TYLX
116 K/RSSQSLL/V/IHS/TNGXS/TYLH 117 RSSQSLVHTNGNS/TYLH 118 LC CDR-2
XVSXXXS 119 XVSXRXS 120 MVSXRFS 121 LC CDR-3 XQXXH/R/KF/L/V/IXX 122
SQSXH/R/KF/L/V/IPX 123 SQSXHVPF/P 124 HC CDR-1 GFXFXXYW/YMX 125
GFTFXXYW/YMX 126 GFTFTDYW/YMS 127 HC CDR-2 XIRXKXBXYXTXYXXSVKG 128
XIRXKXNXYTTEYXXSVKG 129 FIRNKANGYTTEYXXSVKG 130 HC CDR-3 TXXXY/F/W
131 TRYXY/F/WFDY 132 TRYIF/WFDY 133 JH6 WGQGTTVTVSS 134 JK2
FGQGTKLEIK 135 JK5 FGQGTRLEIK 136 VH SFD1 7F11 137 SFD2 138 VL VK2
139 VH SFD1 2C3 140 12 141 15 142 16 143 17 144 19 145 VL VK1 146
VK11 147 VK12 148 VK13 149 VH SFD1 12G6 150 VH10 151 VH11 152 VH12
153 VL VK1 154 VK10 155 VK11 156 VK12 157 VK13 158 VH VH10 9D9 159
VH11 160 VH15 161 VH16 162 VH17 163 VH18 164 VL VK2 165 VK12 166
VK13 167 VK14 168 VK15 169 CD52 alanine-scanning MUT 1 170 peptides
MUT 2 171 MUT 3 172 MUT 4 173 MUT 5 174 MUT 6 175 MUT 7 176 MUT 8
177 MUT 9 178 MUT 10 179 MUT 11 180 MUT 12 181 WT1 182 WT2 183
Tetanus toxoid HLA DTIMMEPPYCKGLDIYYKA 184 DR-binding peptides
SAMLTNLIIFGPGPVLNKNEV 185 NNFTVSFWLRVPKVSASHLE 186 "irrelevant"
HLA-DR- CS 378-398 binding peptide 187 Campath-1H.RTM. 978 188 LC
overlapping 15-mer 979 189 peptides for 980 190 immunogenicity
study 981 191 982 192 983 193 984 194 985 195 986 196 987 197 988
198 999 199 990 200 991 201 992 202 993 203 994 204 995 205 996 206
997 207 Campath-1H.RTM. 998 208 HC overlapping 15- 999 209 mer
peptides for 1000 210 immunogenicity study 1001 211 1002 212 1003
213 1004 214 1005 215 1006 216 1007
217 1008 218 1009 219 1010 220 1011 221 1012 222 1013 223 1014 224
1015 225 1016 226 1017 227 1018 228 1019 229 1020 230 12G6-SFD1/K12
1027 231 LC 1028 232 overlapping 15-mer 1029 233 peptides for 1030
234 immunogenicity study 1031 235 1032 236 1072 237 1073 238 1074
239 1036 240 1037 241 1038 242 1039 243 1040 244 1041 245 1042 246
1043 247 1075 248 1076 249 1077 250 1078 251 12G6-SFD1/K12 1048 252
HC 1049 253 overlapping 15-mer 1050 254 peptides for 1079 255
immunogenicity study 1080 256 1081 257 1082 258 1055 259 1056 260
1060 261 1061 262 1062 263 1063 264 1064 265 1065 266 1066 267 1067
268 1068 269 1083 270 1084 271 1085 272 HC 2C3-SFD1 2C3 273 LC
2C3-K12 274 HC 7F11-SFD1 7F11 275 LC 7F11-K2 276 HC 9D9-H16 9D9 277
9D9-H18 278 LC 9D9-K13 279 HC 12G6-SFD1 12G6 280 LC 12G6-K12 281 HC
4B10-H1 4B10 282 LC 4B10-K1 283 HC (nucleic acid) 2C3-SFD1 2C3 284
LC (nucleic acid) 2C3-K12 285 HC (nucleic acid) 7F11-SFD1 7F11 286
LC (nucleic acid) 7F11-K2 287 HC (nucleic acid) 9D9-H16 9D9 288
9D9-H18 289 LC (nucleic acid) 9D9-K13 290 HC (nucleic acid)
12G6-SFD1 12G6 291 LC (nucleic acid) 12G6-K12 292 HC (nucleic acid)
4B10-H1 4B10 293 LC (nucleic acid) 4B10-K1 294 HC CDR-3 7F11-SFD2
(ARYIFFDY) 7F11
[0585] The teachings of all patents, published applications and
references cited herein are incorporated by reference in their
entirety.
[0586] While this invention has been particularly shown and
described with references to example embodiments thereof, it will
be understood by those skilled in the art that various changes in
form and details may be made therein without departing from the
scope of the invention encompassed by the appended claims.
Sequence CWU 1
1
2941107PRTRattus sp. 1Asp Ile Lys Met Thr Gln Ser Pro Ser Phe Leu
Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Leu Asn Cys Lys Ala
Ser Gln Asn Ile Asp Lys Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys
Leu Gly Glu Ser Pro Lys Leu Leu Ile 35 40 45 Tyr Asn Thr Asn Asn
Leu Gln Thr Gly Ile Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser
Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu
Asp Val Ala Thr Tyr Phe Cys Leu Gln His Ile Ser Arg Pro Arg 85 90
95 Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100 105
2112PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 2Asp Val Val Met Thr Gln Thr Pro Leu Ala Leu
Ser Val Thr Ile Gly 1 5 10 15 His Pro Ala Ser Ile Ser Cys Lys Ser
Ser Gln Ser Leu Leu Glu Ser 20 25 30 Asp Gly Arg Thr Tyr Leu Asn
Trp Leu Phe Gln Arg Pro Gly Gln Ser 35 40 45 Pro Lys Arg Leu Ile
Tyr Leu Val Ser Asn Leu Asp Ser Gly Val Pro 50 55 60 Asp Arg Phe
Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser
Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Trp Gln Gly 85 90
95 Thr His Phe Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Leu Lys
100 105 110 3112PRTMus sp. 3Asp Ile Val Leu Thr Gln Ser Thr Leu Ser
Leu Ser Val Thr Ile Gly 1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Lys
Ser Ser Gln Ser Leu Leu Asp Ser 20 25 30 Asp Gly Lys Thr Tyr Leu
Asn Trp Met Leu Gln Arg Pro Gly Gln Ser 35 40 45 Pro Lys Arg Leu
Ile Tyr Leu Val Ser Lys Leu Asp Ser Gly Val Pro 50 55 60 Asp Arg
Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80
Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Trp Gln Gly 85
90 95 Thr His Phe Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile
Lys 100 105 110 4112PRTMus sp. 4Asp Ile Val Ile Thr Gln Ser Thr Leu
Thr Leu Ser Val Thr Ile Gly 1 5 10 15 Gln Pro Ala Ser Ile Ser Cys
Lys Ser Ser Gln Ser Leu Leu Asp Ser 20 25 30 Asp Gly Lys Thr Tyr
Leu Asn Trp Leu Leu Gln Arg Pro Gly Gln Ser 35 40 45 Pro Lys Arg
Leu Met Tyr Leu Val Ser Asn Leu Gly Ser Gly Val Pro 50 55 60 Asp
Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Val 65 70
75 80 Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Trp Gln
Gly 85 90 95 Thr His Phe Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu
Glu Ile Ile 100 105 110 5112PRTMus sp. 5Asp Ile Val Met Thr Gln Thr
Pro Leu Thr Leu Ser Val Thr Ile Gly 1 5 10 15 Gln Pro Ala Ser Ile
Phe Cys Lys Ser Ser Gln Ser Leu Leu Asp Ser 20 25 30 Asp Gly Lys
Thr Tyr Leu Asn Trp Leu Leu Gln Arg Pro Gly Gln Ser 35 40 45 Pro
Lys Arg Leu Ile Tyr Leu Val Ser Ala Leu Asp Ser Gly Val Pro 50 55
60 Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80 Ser Arg Val Glu Ala Glu Asp Leu Gly Ile Tyr Tyr Cys Trp
Gln Gly 85 90 95 Thr His Phe Pro Trp Thr Phe Gly Gly Gly Thr Lys
Leu Glu Ile Lys 100 105 110 6112PRTMus sp. 6Asp Ile Val Met Thr Gln
Thr Pro Leu Thr Leu Ser Val Thr Ile Gly 1 5 10 15 Gln Pro Ala Ser
Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Asp Ser 20 25 30 Asp Gly
Lys Thr Tyr Leu Asn Trp Leu Ser Gln Arg Pro Gly Gln Ser 35 40 45
Pro Lys Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp Ser Gly Val Pro 50
55 60 Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys
Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys
Trp Gln Gly 85 90 95 Thr His Phe Pro Trp Thr Phe Gly Gly Gly Thr
Lys Leu Glu Ile Lys 100 105 110 7112PRTMus sp. 7Asp Ile Val Met Thr
Gln Ser Pro Leu Thr Leu Ser Val Thr Ile Gly 1 5 10 15 Gln Pro Ala
Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Asp Ser 20 25 30 Asp
Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln Arg Pro Gly Gln Ser 35 40
45 Pro Lys Arg Leu Ile Tyr Leu Val Ser Asn Leu Asn Ser Gly Leu Pro
50 55 60 Asp Arg Phe Ile Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr
Cys Trp Gln Gly 85 90 95 Thr His Phe Pro Trp Thr Phe Gly Gly Gly
Thr Lys Leu Glu Ile Lys 100 105 110 8112PRTMus sp. 8Asp Ile Val Leu
Thr Gln Thr Thr Leu Thr Leu Ser Val Thr Ile Gly 1 5 10 15 Gln Pro
Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Asp Ser 20 25 30
Asp Gly Arg Thr Tyr Leu Asn Trp Leu Phe Gln Arg Pro Gly Gln Ser 35
40 45 Pro Lys Arg Leu Ile Phe Leu Val Ser His Leu Asp Ser Gly Val
Pro 50 55 60 Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr
Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Leu Gly Ile Tyr
Tyr Cys Trp Gln Gly 85 90 95 Thr His Phe Pro Trp Thr Phe Gly Gly
Gly Thr Lys Leu Glu Ile Lys 100 105 110 9111PRTMus sp. 9Asp Ile Val
Met Thr Gln Thr Pro Leu Thr Leu Ser Val Thr Ile Gly 1 5 10 15 Gln
Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser 20 25
30 Asn Gly Lys Thr Tyr Leu Asn Trp Val Leu Gln Arg Pro Gly Gln Ser
35 40 45 Pro Lys Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp Ser Gly
Val Pro 50 55 60 Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe
Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Leu Gly Val
Tyr Tyr Cys Val Gln Gly 85 90 95 Ser His Phe His Thr Phe Gly Ala
Gly Thr Lys Leu Glu Leu Lys 100 105 110 10111PRTMus sp. 10Asp Ile
Val Leu Thr Gln Thr Pro Arg Thr Leu Ser Val Thr Ile Gly 1 5 10 15
Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser 20
25 30 Asn Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln Arg Pro Gly Gln
Ser 35 40 45 Pro Lys Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp Ser
Gly Val Pro 50 55 60 Asp Arg Phe Ala Gly Ser Gly Ser Gly Thr Asp
Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Leu Gly
Ile Tyr Tyr Cys Val Gln Gly 85 90 95 Thr Arg Phe His Thr Phe Gly
Ala Gly Thr Lys Leu Glu Leu Lys 100 105 110 11111PRTMus sp. 11Asp
Ile Val Ile Thr Gln Thr Pro Leu Thr Leu Ser Val Thr Ile Gly 1 5 10
15 Gln Pro Val Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser
20 25 30 Asn Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln Arg Pro Gly
Gln Ser 35 40 45 Pro Lys Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp
Ser Gly Val Pro 50 55 60 Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr
Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Leu
Gly Val Tyr Tyr Cys Val Gln Gly 85 90 95 Thr His Leu His Thr Phe
Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 110 12112PRTMus sp.
12Asp Ile Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly 1
5 10 15 Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His
Thr 20 25 30 Asn Gly Asn Ser Tyr Leu His Trp Tyr Leu Gln Lys Pro
Gly Gln Ser 35 40 45 Pro Lys Leu Leu Ile Tyr Met Val Ser Asn Arg
Phe Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ile Gly Ser Gly
Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp
Leu Gly Val Tyr Phe Cys Ser Gln Ser 85 90 95 Thr His Val Pro Phe
Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys 100 105 110 13113PRTMus
sp. 13Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Thr Val Ser Leu
Gly 1 5 10 15 Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu
Val His Thr 20 25 30 Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln
Lys Pro Gly Gln Ser 35 40 45 Pro Lys Leu Leu Ile Tyr Met Val Ser
Asn Arg Phe Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala
Glu Asp Leu Gly Ile Tyr Phe Cys Ser Gln Ser 85 90 95 Ala His Val
Pro Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu 100 105 110 Lys
14121PRTRattus sp. 14Glu Val Lys Leu Leu Glu Ser Gly Gly Gly Leu
Val Gln Pro Gly Gly 1 5 10 15 Ser Met Arg Leu Ser Cys Ala Gly Ser
Gly Phe Thr Phe Thr Asp Phe 20 25 30 Tyr Met Asn Trp Ile Arg Gln
Pro Ala Gly Lys Ala Pro Glu Trp Leu 35 40 45 Gly Phe Ile Arg Asp
Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn Pro 50 55 60 Ser Val Lys
Gly Arg Phe Thr Ile Ser Arg Asp Asn Thr Gln Asn Met 65 70 75 80 Leu
Tyr Leu Gln Met Asn Thr Leu Arg Ala Glu Asp Thr Ala Thr Tyr 85 90
95 Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp Gly
100 105 110 Gln Gly Val Met Val Thr Val Ser Ser 115 120
15114PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 15Glu Val Lys Leu Glu Glu Ser Gly Gly Gly Leu
Val Gln Pro Gly Gly 1 5 10 15 Ser Met Lys Leu Ser Cys Ala Ala Ser
Gly Phe Thr Phe Ser Asp Ala 20 25 30 Trp Met Asp Trp Val Arg Gln
Ser Pro Glu Lys Gly Leu Glu Trp Val 35 40 45 Ala Glu Ile Arg Asn
Lys Ala Lys Asn His Val Ala Tyr Tyr Ala Glu 50 55 60 Ser Val Lys
Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Ser Ser 65 70 75 80 Val
Tyr Leu Gln Met Asn Asn Leu Arg Ala Glu Asp Thr Gly Ile Tyr 85 90
95 Tyr Cys Thr Thr Leu Asp Ser Trp Gly Gln Gly Thr Ala Leu Thr Val
100 105 110 Ser Ser 16114PRTMus sp. 16Glu Val Lys Leu Glu Glu Ser
Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Met Lys Leu Ser
Cys Ala Val Ser Arg Phe Thr Phe Ser Asp Ala 20 25 30 Trp Met Asp
Trp Val Arg Gln Ser Pro Glu Lys Gly Leu Glu Trp Ile 35 40 45 Ala
Glu Ile Arg Asn Lys Ala Asn Asn His Ala Thr Tyr Tyr Ala Glu 50 55
60 Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Ser Arg
65 70 75 80 Val Phe Leu Gln Met Asn Asn Leu Arg Pro Glu Asp Thr Gly
Ile Tyr 85 90 95 Tyr Cys Thr Ser Leu Asp Tyr Trp Gly Gln Gly Thr
Thr Leu Thr Val 100 105 110 Ser Ser 17114PRTMus sp. 17Glu Val Lys
Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser
Met Lys Leu Ser Cys Ala Val Ser Gly Phe Thr Phe Ser Asp Ala 20 25
30 Trp Met Asp Trp Val Arg Gln Ser Pro Glu Lys Gly Leu Glu Trp Val
35 40 45 Ala Glu Ile Arg Asn Lys Ala Lys Asn His Val Lys Tyr Tyr
Ala Glu 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp
Ser Lys Ser Ser 65 70 75 80 Val Tyr Leu Gln Met Asn Asn Leu Arg Thr
Glu Asp Thr Gly Ile Tyr 85 90 95 Tyr Cys Thr Ser Leu Asp Tyr Trp
Gly Gln Gly Thr Ala Leu Thr Val 100 105 110 Ser Ser 18114PRTMus sp.
18Glu Val Lys Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1
5 10 15 Ser Met Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Ala 20 25 30 Trp Met Asp Trp Val Arg Gln Ser Pro Glu Lys Gly Leu
Glu Leu Thr 35 40 45 Ala Glu Ile Arg Asn Lys Ala Lys Asn His Ala
Thr Tyr Tyr Ala Glu 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ser
Arg Asp Asp Ser Lys Ser Arg 65 70 75 80 Val Tyr Leu Gln Met Asn Ser
Leu Arg Thr Glu Asp Thr Gly Ile Tyr 85 90 95 Tyr Cys Thr Thr Leu
Asp Ser Trp Gly Gln Gly Thr Ser Val Thr Val 100 105 110 Ser Ser
19114PRTMus sp. 19Glu Val Lys Leu Glu Glu Ser Gly Gly Gly Leu Val
Gln Pro Gly Gly 1 5 10 15 Ser Met Lys Leu Ser Cys Ala Val Ser Gly
Phe Thr Phe Ser Asp Ala 20 25 30 Trp Met Asp Trp Val Arg Gln Ser
Pro Glu Lys Gly Leu Glu Trp Val 35 40 45 Ala Glu Ile Arg Asn Lys
Ala Lys Asn His Ala Thr Tyr Tyr Ala Glu 50 55 60 Ser Val Lys Gly
Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Ser Ser 65 70 75 80 Val Tyr
Leu Gln Met Asn Arg Leu Arg Ala Glu Asp Thr Gly Ile Tyr 85 90 95
Tyr Cys Thr Ser Leu Asp Tyr Trp Gly Gln Gly Ser Thr Leu Thr Val 100
105 110 Ser Ser 20114PRTMus sp. 20Glu Val Lys Leu Glu Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Met Lys Leu Ser Cys
Thr Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30 Trp Met Asp Trp
Val Arg Gln Ser Pro Glu Lys Gly Leu Glu Trp Val 35 40 45 Ala Glu
Ile Arg Lys Lys Val Asn Asn His Ala Thr Tyr Tyr Ala Glu 50 55 60
Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Ser Ser 65
70 75 80 Val Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Gly
Ile Tyr 85 90
95 Tyr Cys Thr Ser Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Ser Val
100 105 110 Ser Ser 21114PRTMus sp. 21Glu Val Lys Leu Glu Glu Ser
Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Met Lys Leu Ser
Cys Ala Val Ser Gly Leu Thr Phe Ser Asp Ala 20 25 30 Trp Met Asp
Trp Val Arg Gln Ser Pro Glu Lys Gly Leu Glu Trp Ile 35 40 45 Ala
Glu Ile Arg Asn Lys Ala Lys Asn His Ala Thr Tyr Tyr Ala Glu 50 55
60 Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Ser Gly
65 70 75 80 Val Tyr Leu Gln Met Asn Asn Leu Arg Ala Glu Asp Thr Gly
Ile Tyr 85 90 95 Tyr Cys Thr Gly Leu Asp Tyr Trp Gly His Gly Thr
Ser Val Thr Val 100 105 110 Ser Ser 22114PRTMus sp. 22Glu Val Gln
Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser
Met Lys Leu Ser Cys Val Ala Ser Gly Phe Pro Phe Ser Asn Tyr 20 25
30 Trp Met Asn Trp Val Arg Gln Ser Pro Glu Lys Gly Leu Glu Trp Val
35 40 45 Ala Gln Ile Arg Leu Lys Ser Asn Asn Tyr Ala Thr His Tyr
Ala Glu 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ala Arg Asp Asp
Ser Lys Ser Ser 65 70 75 80 Val Tyr Leu Gln Met Asn Asn Leu Arg Ala
Glu Asp Thr Gly Ile Tyr 85 90 95 Tyr Cys Thr Pro Ile Asp Tyr Trp
Gly Gln Gly Thr Thr Leu Thr Val 100 105 110 Ser Ser 23114PRTMus sp.
23Glu Val Lys Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1
5 10 15 Ser Met Lys Leu Ser Cys Val Ala Ser Gly Phe Thr Phe Asn Lys
Tyr 20 25 30 Trp Met Asn Trp Val Arg Gln Ser Pro Asp Lys Gly Leu
Glu Cys Ile 35 40 45 Ala Gln Ile Arg Leu Lys Ser Asp Asn Tyr Ala
Thr His Tyr Ala Glu 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ser
Arg Asp Asp Ser Lys Ser Ser 65 70 75 80 Val Tyr Leu Gln Met Asn Asn
Leu Arg Ala Glu Asp Thr Gly Ile Tyr 85 90 95 Tyr Cys Thr Pro Ile
Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val 100 105 110 Ser Ser
24114PRTMus sp. 24Glu Val Lys Leu Glu Glu Ser Gly Gly Gly Leu Val
Gln Pro Gly Gly 1 5 10 15 Ser Met Lys Leu Ser Cys Val Ala Ser Gly
Phe Thr Phe Asn Thr Tyr 20 25 30 Trp Met Asn Trp Val Arg Gln Ser
Pro Glu Lys Gly Leu Glu Trp Val 35 40 45 Ala Gln Ile Arg Leu Lys
Ser Asn Asn Tyr Ala Thr His Tyr Ala Glu 50 55 60 Ser Val Lys Gly
Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Ser 65 70 75 80 Val Tyr
Leu Gln Met Asn Asn Leu Arg Ala Glu Asp Thr Gly Ile Tyr 85 90 95
Tyr Cys Thr Pro Val Asp Phe Trp Gly Gln Gly Thr Thr Leu Thr Val 100
105 110 Ser Ser 25117PRTMus sp. 25Glu Val Lys Leu Glu Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Ser Leu Ser Cys
Val Ala Ser Gly Phe Thr Phe Thr Asp Tyr 20 25 30 Tyr Met Ser Trp
Val Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu 35 40 45 Gly Phe
Ile Arg Asn Lys Ala Asn Gly Tyr Thr Thr Glu Tyr Asn Ala 50 55 60
Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Tyr Ser Gln Ser Ile 65
70 75 80 Leu Tyr Leu Gln Met Asn Ala Leu Arg Ala Glu Asp Ser Ala
Thr Tyr 85 90 95 Tyr Cys Thr Arg Tyr Ile Phe Phe Asp Tyr Trp Gly
Gln Gly Thr Thr 100 105 110 Leu Thr Val Ser Ser 115 26117PRTMus sp.
26Glu Val Gln Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1
5 10 15 Ala Leu Ser Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp
Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gln Pro Pro Gly Lys Ala Leu
Glu Trp Leu 35 40 45 Gly Phe Ile Arg Asn Lys Ala Asn Gly Tyr Thr
Thr Glu Tyr Ser Ala 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ser
Arg Asp Asp Ser Gln Ser Ile 65 70 75 80 Leu Tyr Leu Gln Met Asn Ala
Leu Arg Ala Glu Asp Ser Ala Thr Tyr 85 90 95 Tyr Cys Thr Arg Tyr
Ile Trp Phe Asp Tyr Trp Gly Gln Gly Thr Thr 100 105 110 Leu Thr Val
Ser Ser 115 2711PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 27Lys Ala Ser Gln Asn Ile Asp Lys Tyr
Leu Asn 1 5 10 2816PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 28Lys Ser Ser Gln Ser Leu Leu Glu Ser
Asp Gly Arg Thr Tyr Leu Asn 1 5 10 15 2916PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 29Lys
Ser Ser Gln Ser Leu Leu Asp Ser Asp Gly Lys Thr Tyr Leu Asn 1 5 10
15 3016PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 30Lys Ser Ser Gln Ser Leu Leu Asp Ser Asp Gly Arg
Thr Tyr Leu Asn 1 5 10 15 3116PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 31Lys Ser Ser Gln Ser Leu Leu
Tyr Ser Asn Gly Lys Thr Tyr Leu Asn 1 5 10 15 3216PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 32Arg
Ser Ser Gln Ser Leu Val His Thr Asn Gly Asn Ser Tyr Leu His 1 5 10
15 3316PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 33Arg Ser Ser Gln Ser Leu Val His Thr Asn Gly Asn
Thr Tyr Leu His 1 5 10 15 347PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 34Asn Thr Asn Asn Leu Gln Thr
1 5 357PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 35Leu Val Ser Asn Leu Asp Ser 1 5
367PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 36Leu Val Ser Lys Leu Asp Ser 1 5
377PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 37Leu Val Ser Asn Leu Gly Ser 1 5
387PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 38Leu Val Ser Ala Leu Asp Ser 1 5
397PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 39Leu Val Ser Asn Leu Asn Ser 1 5
407PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 40Leu Val Ser His Leu Asp Ser 1 5
417PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 41Met Val Ser Asn Arg Phe Ser 1 5
429PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 42Leu Gln His Ile Ser Arg Pro Arg Thr 1 5
439PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 43Trp Gln Gly Thr His Phe Pro Trp Thr 1 5
448PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 44Val Gln Gly Ser His Phe His Thr 1 5
458PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 45Val Gln Gly Thr Arg Phe His Thr 1 5
468PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 46Val Gln Gly Thr His Leu His Thr 1 5
479PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 47Ser Gln Ser Thr His Val Pro Phe Thr 1 5
4810PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 48Ser Gln Ser Ala His Val Pro Pro Leu Thr 1 5 10
4910PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 49Gly Phe Thr Phe Thr Asp Phe Tyr Met Asn 1 5 10
5010PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 50Gly Phe Thr Phe Ser Asp Ala Trp Met Asp 1 5 10
5110PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 51Arg Phe Thr Phe Ser Asp Ala Trp Met Asp 1 5 10
5210PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 52Gly Leu Thr Phe Ser Asp Ala Trp Met Asp 1 5 10
5310PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 53Gly Phe Pro Phe Ser Asn Tyr Trp Met Asn 1 5 10
5410PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 54Gly Phe Thr Phe Asn Lys Tyr Trp Met Asn 1 5 10
5510PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 55Gly Phe Thr Phe Asn Thr Tyr Trp Met Asn 1 5 10
5610PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 56Gly Phe Thr Phe Thr Asp Tyr Tyr Met Ser 1 5 10
5719PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 57Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr Glu
Tyr Asn Pro Ser 1 5 10 15 Val Lys Gly 5819PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 58Glu
Ile Arg Asn Lys Ala Lys Asn His Val Ala Tyr Tyr Ala Glu Ser 1 5 10
15 Val Lys Gly 5919PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 59Glu Ile Arg Asn Lys Ala Asn Asn His
Ala Thr Tyr Tyr Ala Glu Ser 1 5 10 15 Val Lys Gly 6019PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 60Glu
Ile Arg Asn Lys Ala Lys Asn His Val Lys Tyr Tyr Ala Glu Ser 1 5 10
15 Val Lys Gly 6119PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 61Glu Ile Arg Asn Lys Ala Lys Asn His
Ala Thr Tyr Tyr Ala Glu Ser 1 5 10 15 Val Lys Gly 6219PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 62Glu
Ile Arg Lys Lys Val Asn Asn His Ala Thr Tyr Tyr Ala Glu Ser 1 5 10
15 Val Lys Gly 6319PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 63Gln Ile Arg Leu Lys Ser Asn Asn Tyr
Ala Thr His Tyr Ala Glu Ser 1 5 10 15 Val Lys Gly 6419PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 64Gln
Ile Arg Leu Lys Ser Asp Asn Tyr Ala Thr His Tyr Ala Glu Ser 1 5 10
15 Val Lys Gly 6519PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 65Phe Ile Arg Asn Lys Ala Asn Gly Tyr
Thr Thr Glu Tyr Asn Ala Ser 1 5 10 15 Val Lys Gly 6619PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 66Phe
Ile Arg Asn Lys Ala Asn Gly Tyr Thr Thr Glu Tyr Ser Ala Ser 1 5 10
15 Val Lys Gly 6712PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 67Ala Arg Glu Gly His Thr Ala Ala Pro
Phe Asp Tyr 1 5 10 685PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 68Thr Thr Leu Asp Ser 1 5
695PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 69Thr Ser Leu Asp Tyr 1 5 705PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 70Thr
Gly Leu Asp Tyr 1 5 715PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 71Thr Pro Ile Asp Tyr 1 5
725PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 72Thr Pro Val Asp Phe 1 5 738PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 73Thr
Arg Tyr Ile Phe Phe Asp Tyr 1 5 748PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 74Thr
Arg Tyr Ile Trp Phe Asp Tyr 1 5 7524DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
75atgggcwtca aratgrarwc wcat 247624DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
76gayattgtgm tracmcarkm tcaa 247721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
77actggatggt gggaagatgg a 217824DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 78gayattgtgm tsacmcarwc
tmca 247921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 79ggatacagtt ggtgcagcat c 218024DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
80atgrasttsk ggytmarctk grtt 248125DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
81atgraatgsa sctgggtywt yctct 258221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
82saggtsmarc tgcagsagtc t 218324DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 83saggtgmagc tcswrsaryc
sggg 248424DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 84tgaggagact gtgagagtgg tgcc 248530DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
85ayctccacac acaggrrcca gtggatagac 308620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
86sargtnmagc tgsagsagtc 208723DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 87sargtnmagc tgsagsagtc wgg
238822DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 88caggttactc tgaaagwgts tg 228920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
89gaggtccarc tgcaacartc 209020DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 90caggtccaac tvcagcarcc
209120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 91gaggtgaass tggtggaatc 209220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
92gatgtgaact tggaagtgtc 209327DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 93atagacagat gggggtgtcg
ttttggc 279423DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 94cttgaccagg catcctagag tca
239524DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 95aggggccagt ggatagagtg atgg 2496100PRTMus sp.
96Glu Val Gln Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1
5 10 15 Ala Leu Ser Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp
Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gln Pro Pro Gly Lys Ala Leu
Glu Trp Leu 35 40 45 Gly Phe Ile Arg Asn Lys Ala Asn Gly Tyr Thr
Thr Glu Tyr Ser Ala 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ser
Arg Asp Asp
Ser Gln Ser Ile 65 70 75 80 Leu Tyr Leu Gln Met Asn Ala Leu Arg Ala
Glu Asp Ser Ala Thr Tyr 85 90 95 Tyr Cys Thr Arg 100 97100PRTHomo
sapiens 97Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro
Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr
Phe Ser Asp His 20 25 30 Tyr Met Asp Trp Val Arg Gln Ala Pro Gly
Lys Gly Leu Glu Trp Val 35 40 45 Gly Arg Thr Arg Asn Lys Ala Asn
Ser Tyr Thr Thr Glu Tyr Ala Ala 50 55 60 Ser Val Lys Gly Arg Phe
Thr Ile Ser Arg Asp Asp Ser Lys Asn Ser 65 70 75 80 Leu Tyr Leu Gln
Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr 85 90 95 Tyr Cys
Ala Arg 100 98100PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 98Glu Val Gln Leu Val Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys
Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp
Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Gly Phe
Ile Arg Asn Lys Ala Asn Gly Tyr Thr Thr Glu Tyr Ser Ala 50 55 60
Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Ser 65
70 75 80 Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala
Val Tyr 85 90 95 Tyr Cys Ala Arg 100 99100PRTMus sp. 99Asp Ile Val
Met Thr Gln Ser Pro Leu Ser Leu Thr Val Ser Leu Gly 1 5 10 15 Asp
Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Thr 20 25
30 Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45 Pro Lys Leu Leu Ile Tyr Met Val Ser Asn Arg Phe Ser Gly
Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe
Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Leu Gly Ile
Tyr Phe Cys Ser Gln Ser 85 90 95 Ala His Val Pro 100 100100PRTHomo
sapiens 100Asp Ile Val Met Thr Gln Thr Pro Leu Ser Leu Ser Val Thr
Pro Gly 1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser
Leu Leu His Ser 20 25 30 Asp Gly Lys Thr Tyr Leu Tyr Trp Tyr Leu
Gln Lys Pro Gly Gln Ser 35 40 45 Pro Gln Leu Leu Ile Tyr Glu Val
Ser Ser Arg Phe Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser
Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu
Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Gly 85 90 95 Ile His
Leu Pro 100 101100PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 101Asp Ile Val Met Thr Gln Thr Pro
Leu Ser Leu Ser Val Thr Pro Gly 1 5 10 15 Gln Pro Ala Ser Ile Ser
Cys Arg Ser Ser Gln Ser Leu Val His Thr 20 25 30 Asn Gly Asn Thr
Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45 Pro Gln
Leu Leu Ile Tyr Met Val Ser Asn Arg Phe Ser Gly Val Pro 50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 65
70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ser
Gln Ser 85 90 95 Ala His Val Pro 100 102113PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
102Asp Ile Val Met Thr Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly
1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val
His Thr 20 25 30 Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys
Pro Gly Gln Ser 35 40 45 Pro Gln Leu Leu Ile Tyr Met Val Ser Asn
Arg Phe Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser
Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu
Asp Val Gly Val Tyr Tyr Cys Ser Gln Ser 85 90 95 Ala His Val Pro
Pro Leu Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile 100 105 110 Lys
103117PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 103Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Gly Phe Ile Arg
Asn Lys Ala Asn Gly Tyr Thr Thr Glu Tyr Ser Ala 50 55 60 Ser Val
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Ser 65 70 75 80
Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr 85
90 95 Tyr Cys Ala Arg Tyr Ile Trp Phe Asp Tyr Trp Gly Gln Gly Thr
Thr 100 105 110 Val Thr Val Ser Ser 115 10412PRTHomo sapiens 104Gly
Gln Asn Asp Thr Ser Gln Thr Ser Ser Pro Ser 1 5 10
10512PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 105Ala Gln Asn Asp Thr Ser Gln Thr Ser Ser Pro
Ser 1 5 10 10612PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 106Gly Ala Asn Asp Thr Ser Gln Thr Ser
Ser Pro Ser 1 5 10 10712PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 107Gly Gln Ala Asp Thr Ser
Gln Thr Ser Ser Pro Ser 1 5 10 10812PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 108Gly
Gln Asn Ala Thr Ser Gln Thr Ser Ser Pro Ser 1 5 10
10912PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 109Gly Gln Asn Asp Ala Ser Gln Thr Ser Ser Pro
Ser 1 5 10 11012PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 110Gly Gln Asn Asp Thr Ala Gln Thr Ser
Ser Pro Ser 1 5 10 11112PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 111Gly Gln Asn Asp Thr Ser
Ala Thr Ser Ser Pro Ser 1 5 10 11212PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 112Gly
Gln Asn Asp Thr Ser Gln Ala Ser Ser Pro Ser 1 5 10
11312PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 113Gly Gln Asn Asp Thr Ser Gln Thr Ala Ser Pro
Ser 1 5 10 11412PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 114Gly Gln Asn Asp Thr Ser Gln Thr Ser
Ala Pro Ser 1 5 10 11516PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 115Xaa Ser Ser Gln Ser Leu
Xaa Xaa Xaa Xaa Gly Xaa Xaa Tyr Leu Xaa 1 5 10 15
11616PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 116Xaa Ser Ser Gln Ser Leu Xaa His Xaa Asn Gly
Xaa Xaa Tyr Leu His 1 5 10 15 11716PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 117Arg
Ser Ser Gln Ser Leu Val His Thr Asn Gly Asn Xaa Tyr Leu His 1 5 10
15 1187PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 118Xaa Val Ser Xaa Xaa Xaa Ser 1 5
1197PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 119Xaa Val Ser Xaa Arg Xaa Ser 1 5
1207PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 120Met Val Ser Xaa Arg Phe Ser 1 5
1218PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 121Xaa Gln Xaa Xaa Xaa Xaa Xaa Xaa 1 5
1228PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 122Ser Gln Ser Xaa Xaa Xaa Pro Xaa 1 5
1238PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 123Ser Gln Ser Xaa His Val Pro Xaa 1 5
12410PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 124Gly Phe Xaa Phe Xaa Xaa Tyr Xaa Met Xaa 1 5 10
12510PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 125Gly Phe Thr Phe Xaa Xaa Tyr Xaa Met Xaa 1 5 10
12610PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 126Gly Phe Thr Phe Thr Asp Tyr Xaa Met Ser 1 5 10
12719PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 127Xaa Ile Arg Xaa Lys Xaa Asx Xaa Tyr Xaa Thr
Xaa Tyr Xaa Xaa Ser 1 5 10 15 Val Lys Gly 12819PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 128Xaa
Ile Arg Xaa Lys Xaa Asn Xaa Tyr Thr Thr Glu Tyr Xaa Xaa Ser 1 5 10
15 Val Lys Gly 12919PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 129Phe Ile Arg Asn Lys Ala Asn Gly Tyr
Thr Thr Glu Tyr Xaa Xaa Ser 1 5 10 15 Val Lys Gly 1305PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 130Thr
Xaa Xaa Xaa Xaa 1 5 1318PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 131Thr Arg Tyr Xaa Xaa Phe
Asp Tyr 1 5 1328PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 132Thr Arg Tyr Ile Xaa Phe Asp Tyr 1 5
13311PRTHomo sapiens 133Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser
1 5 10 13410PRTHomo sapiens 134Phe Gly Gln Gly Thr Lys Leu Glu Ile
Lys 1 5 10 13510PRTHomo sapiens 135Phe Gly Gln Gly Thr Arg Leu Glu
Ile Lys 1 5 10 136117PRTArtificial SequenceDescription of
Artificial Sequence Synthetic polypeptide 136Glu Val Gln Leu Val
Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Asp Tyr 20 25 30 Tyr
Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45 Gly Phe Ile Arg Asn Lys Ala Asn Gly Tyr Thr Thr Glu Tyr Asn Ala
50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys
Asn Ser 65 70 75 80 Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp
Thr Ala Val Tyr 85 90 95 Tyr Cys Thr Arg Tyr Ile Phe Phe Asp Tyr
Trp Gly Gln Gly Thr Thr 100 105 110 Val Thr Val Ser Ser 115
137117PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 137Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Thr Asp Tyr 20 25 30 Tyr Met Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Gly Phe Ile Arg
Asn Lys Ala Asn Gly Tyr Thr Thr Glu Tyr Asn Ala 50 55 60 Ser Val
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Ser 65 70 75 80
Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr 85
90 95 Tyr Cys Ala Arg Tyr Ile Phe Phe Asp Tyr Trp Gly Gln Gly Thr
Thr 100 105 110 Val Thr Val Ser Ser 115 138112PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
138Asp Ile Val Met Thr Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly
1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val
His Thr 20 25 30 Asn Gly Asn Ser Tyr Leu His Trp Tyr Leu Gln Lys
Pro Gly Gln Ser 35 40 45 Pro Gln Leu Leu Ile Tyr Met Val Ser Asn
Arg Phe Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser
Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu
Asp Val Gly Val Tyr Tyr Cys Ser Gln Ser 85 90 95 Thr His Val Pro
Phe Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 110
139114PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 139Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Asn Thr Tyr 20 25 30 Trp Met Asn Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Gly Gln Ile Arg
Leu Lys Ser Asn Asn Tyr Ala Thr His Tyr Ala Glu 50 55 60 Ser Val
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Ser 65 70 75 80
Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr 85
90 95 Tyr Cys Thr Pro Val Asp Phe Trp Gly Gln Gly Thr Thr Val Thr
Val 100 105 110 Ser Ser 140114PRTArtificial SequenceDescription of
Artificial Sequence Synthetic polypeptide 140Glu Val Gln Leu Val
Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asn Thr Tyr 20 25 30 Trp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45 Gly Gln Ile Arg Leu Lys Ser Asn Asn Tyr Ala Thr His Tyr Ala Glu
50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys
Asn Ser 65 70 75 80 Val Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp
Thr Ala Val Tyr 85 90 95 Tyr Cys Thr Pro Val Asp Phe Trp Gly Gln
Gly Thr Thr Val Thr Val 100 105 110 Ser Ser 141114PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
141Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asn
Thr Tyr 20 25 30 Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45 Ala Gln Ile Arg Leu Lys Ser Asn Asn Tyr
Ala Thr His Tyr Ala Glu 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile
Ser Arg Asp Asp Ser Lys Asn Ser 65 70 75 80 Leu Tyr Leu Gln Met Asn
Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr 85 90 95 Tyr Cys Thr Pro
Val Asp Phe Trp Gly Gln Gly Thr Thr Val Thr Val 100 105 110 Ser Ser
142114PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 142Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Gln
Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe
Thr Phe Asn Thr Tyr 20 25 30 Trp Met Asn Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Gln Ile Arg Leu Lys Ser
Asn Asn Tyr Ala Thr His Tyr Ala Glu 50 55 60 Ser Val Lys Gly Arg
Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Ser 65 70 75 80 Val Tyr Leu
Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr 85 90 95 Tyr
Cys Thr Pro Val Asp Phe Trp Gly Gln Gly Thr Thr Val Thr Val 100 105
110 Ser Ser 143114PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 143Glu Val Gln Leu Val Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Met Arg Leu Ser Cys
Ala Ala Ser Gly Phe Thr Phe Asn Thr Tyr 20 25 30 Trp Met Asn Trp
Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Gln
Ile Arg Leu Lys Ser Asn Asn Tyr Ala Thr His Tyr Ala Glu 50 55 60
Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Ser 65
70 75 80 Val Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala
Val Tyr 85 90 95 Tyr Cys Thr Pro Val Asp Phe Trp Gly Gln Gly Thr
Thr Val Thr Val 100 105 110 Ser Ser 144114PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
144Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15 Ser Met Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asn
Thr Tyr 20 25 30 Trp Met Asn Trp Val Arg Gln Ala Pro Glu Lys Gly
Leu Glu Trp Val 35 40 45 Ala Gln Ile Arg Leu Lys Ser Asn Asn Tyr
Ala Thr His Tyr Ala Glu 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile
Ser Arg Asp Asp Ser Lys Asn Ser 65 70 75 80 Val Tyr Leu Gln Met Asn
Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr 85 90 95 Tyr Cys Thr Pro
Val Asp Phe Trp Gly Gln Gly Thr Thr Val Thr Val 100 105 110 Ser Ser
145111PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 145Asp Ile Val Met Thr Gln Thr Pro Leu Ser
Leu Ser Val Thr Pro Gly 1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Lys
Ser Ser Gln Ser Leu Leu Tyr Ser 20 25 30 Asn Gly Lys Thr Tyr Leu
Asn Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45 Pro Gln Leu Leu
Ile Tyr Leu Val Ser Lys Leu Asp Ser Gly Val Pro 50 55 60 Asp Arg
Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Val Gln Gly 85
90 95 Thr His Leu His Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys
100 105 110 146111PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 146Asp Ile Val Met Thr Gln Thr Pro
Leu Ser Leu Ser Val Thr Pro Gly 1 5 10 15 Gln Pro Ala Ser Ile Ser
Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser 20 25 30 Asn Gly Lys Thr
Tyr Leu Asn Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45 Pro Gln
Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp Ser Gly Val Pro 50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 65
70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Val
Gln Gly 85 90 95 Thr His Leu His Thr Phe Gly Gln Gly Thr Arg Leu
Glu Ile Lys 100 105 110 147111PRTArtificial SequenceDescription of
Artificial Sequence Synthetic polypeptide 147Asp Ile Val Met Thr
Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly 1 5 10 15 Gln Pro Ala
Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser 20 25 30 Asn
Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln Lys Pro Gly Gln Ser 35 40
45 Pro Gln Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp Ser Gly Val Pro
50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr
Cys Val Gln Gly 85 90 95 Thr His Leu His Thr Phe Gly Gln Gly Thr
Arg Leu Glu Ile Lys 100 105 110 148111PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
148Asp Ile Val Ile Thr Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly
1 5 10 15 Gln Pro Val Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu
Tyr Ser 20 25 30 Asn Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln Lys
Pro Gly Gln Ser 35 40 45 Pro Lys Arg Leu Ile Tyr Leu Val Ser Lys
Leu Asp Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser
Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu
Asp Val Gly Val Tyr Tyr Cys Val Gln Gly 85 90 95 Thr His Leu His
Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 110
149114PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 149Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Pro Phe Ser Asn Tyr 20 25 30 Trp Met Asn Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Gly Gln Ile Arg
Leu Lys Ser Asn Asn Tyr Ala Thr His Tyr Ala Glu 50 55 60 Ser Val
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Ser 65 70 75 80
Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr 85
90 95 Tyr Cys Thr Pro Ile Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr
Val 100 105 110 Ser Ser 150114PRTArtificial SequenceDescription of
Artificial Sequence Synthetic polypeptide 150Glu Val Gln Leu Val
Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Phe Pro Phe Ser Asn Tyr 20 25 30 Trp
Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45 Gly Gln Ile Arg Leu Lys Ser Asn Asn Tyr Ala Thr His Tyr Ala Glu
50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys
Asn Ser 65 70 75 80 Val Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp
Thr Ala Val Tyr 85 90 95 Tyr Cys Thr Pro Ile Asp Tyr Trp Gly Gln
Gly Thr Thr Val Thr Val 100 105 110 Ser Ser 151114PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
151Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Pro Phe Ser
Asn Tyr 20 25 30 Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45 Ala Gln Ile Arg Leu Lys Ser Asn Asn Tyr
Ala Thr His Tyr Ala Glu 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile
Ser Arg Asp Asp Ser Lys Asn Ser 65 70 75 80 Leu Tyr Leu Gln Met Asn
Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr 85 90 95 Tyr Cys Thr Pro
Ile Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr Val 100 105 110 Ser Ser
152114PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 152Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Pro Phe Ser Asn Tyr 20 25 30 Trp Met Asn Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Gln Ile Arg
Leu Lys Ser Asn Asn Tyr Ala Thr His Tyr Ala Glu 50 55 60 Ser Val
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Ser 65 70 75 80
Val Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr 85
90 95 Tyr Cys Thr Pro Ile Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr
Val 100 105 110 Ser Ser 153111PRTArtificial SequenceDescription of
Artificial Sequence Synthetic polypeptide 153Asp Ile Val Met Thr
Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly 1 5 10 15 Gln Pro Ala
Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser 20 25 30 Asn
Gly Lys Thr Tyr Leu Asn Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40
45 Pro Gln Leu Leu Ile Tyr Leu Val Ser Lys Leu Asp Ser Gly Val Pro
50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr
Cys Val Gln Gly 85 90 95 Ser His Phe His Thr Phe Gly Gln Gly Thr
Lys Leu Glu Ile Lys 100 105 110 154111PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
154Asp Ile Val Met Thr Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly
1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu
Tyr Ser 20 25 30 Asn Gly Lys Thr Tyr Leu Asn Trp Val Leu Gln Lys
Pro Gly Gln Ser 35 40 45 Pro Gln Leu Leu Ile Tyr Leu Val Ser Lys
Leu Asp Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser
Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu
Asp Val Gly Val Tyr Tyr Cys Val Gln Gly 85 90 95 Ser His Phe His
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 110
155111PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 155Asp Ile Val Met Thr Gln Thr Pro Leu Ser
Leu Ser Val Thr Pro Gly 1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Lys
Ser Ser Gln Ser Leu Leu Tyr Ser 20 25 30 Asn Gly Lys Thr Tyr Leu
Asn Trp Val Leu Gln Lys Pro Gly Gln Ser 35 40 45 Pro Lys Arg Leu
Ile Tyr Leu Val Ser Lys Leu Asp Ser Gly Val Pro 50 55 60 Asp Arg
Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Val Gln Gly 85
90 95 Ser His Phe His Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105 110 156111PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 156Asp Ile Val Met Thr Gln Thr Pro
Leu Ser Leu Ser Val Thr Pro Gly 1 5 10 15 Gln Pro Ala Ser Ile Ser
Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser 20 25 30 Asn Gly Lys Thr
Tyr Leu Asn Trp Val Leu Gln Lys Pro Gly Gln Ser 35 40 45 Pro Gln
Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp Ser Gly Val Pro 50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 65
70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Val
Gln Gly 85 90 95 Ser His Phe His Thr Phe Gly Gln Gly Thr Lys Leu
Glu Ile Lys 100 105 110 157111PRTArtificial SequenceDescription of
Artificial Sequence Synthetic polypeptide 157Asp Ile Val Met Thr
Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly 1 5 10 15 Gln Pro Ala
Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser 20 25 30 Asn
Gly Lys Thr Tyr Leu Asn Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40
45 Pro Gln Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp Ser Gly Val Pro
50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr
Cys Val Gln Gly 85 90 95 Ser His Phe His Thr Phe Gly Gln Gly Thr
Lys Leu Glu Ile Lys 100 105 110 158113PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
158Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser
Asp Ala 20 25 30 Trp Met Asp Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45 Ser Glu Ile Arg Asn Lys Ala Lys Asn His
Ala Thr Tyr Tyr Ala Glu 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile
Ser Arg Asp Asn Ser Lys Asn Thr 65 70 75 80 Leu Tyr Leu Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr 85 90 95 Tyr Cys Thr Thr
Leu Asp Ser Trp Gly Gln Thr Thr Val Thr Val Ser 100 105 110 Ser
159114PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 159Glu Val Gln Leu Leu Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30 Trp Met Asp Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Leu Thr 35 40 45 Ala Glu Ile Arg
Asn Lys Ala Lys Asn His Ala Thr Tyr Tyr Ala Glu 50 55 60 Ser Val
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Ser Thr 65 70 75 80
Val Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr 85
90 95 Tyr Cys Thr Thr Leu Asp Ser Trp Gly Gln Gly Thr Thr Val Thr
Val 100 105 110 Ser Ser 160114PRTArtificial SequenceDescription of
Artificial Sequence Synthetic polypeptide 160Glu Val Gln Leu Leu
Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30 Trp
Met Asp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Thr 35 40
45 Ala Glu Ile Arg Asn Lys Ala Lys Asn His Ala Thr Tyr Tyr Ala Glu
50 55 60 Ser Val Lys Gly Arg Phe
Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr 65 70 75 80 Leu Tyr Leu Gln
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr 85 90 95 Tyr Cys
Thr Thr Leu Asp Ser Trp Gly Gln Gly Thr Thr Val Thr Val 100 105 110
Ser Ser 161114PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 161Glu Val Gln Leu Leu Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys
Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30 Trp Met Asp Trp
Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ser Glu
Ile Arg Asn Lys Ala Lys Asn His Ala Thr Tyr Tyr Ala Glu 50 55 60
Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr 65
70 75 80 Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala
Val Tyr 85 90 95 Tyr Cys Thr Thr Leu Asp Ser Trp Gly Gln Gly Thr
Thr Val Thr Val 100 105 110 Ser Ser 162114PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
162Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser
Asp Ala 20 25 30 Trp Met Asp Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Leu Thr 35 40 45 Ser Glu Ile Arg Asn Lys Ala Lys Asn His
Ala Thr Tyr Tyr Ala Glu 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile
Ser Arg Asp Asn Ser Lys Asn Thr 65 70 75 80 Leu Tyr Leu Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr 85 90 95 Tyr Cys Thr Thr
Leu Asp Ser Trp Gly Gln Gly Thr Thr Val Thr Val 100 105 110 Ser Ser
163114PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 163Glu Val Gln Leu Leu Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30 Trp Met Asp Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Glu Ile Arg
Asn Lys Ala Lys Asn His Ala Thr Tyr Tyr Ala Glu 50 55 60 Ser Val
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr 65 70 75 80
Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr 85
90 95 Tyr Cys Thr Thr Leu Asp Ser Trp Gly Gln Gly Thr Thr Val Thr
Val 100 105 110 Ser Ser 164112PRTArtificial SequenceDescription of
Artificial Sequence Synthetic polypeptide 164Asp Ile Val Met Thr
Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly 1 5 10 15 Gln Pro Ala
Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Asp Ser 20 25 30 Asp
Gly Lys Thr Tyr Leu Asn Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40
45 Pro Gln Leu Leu Ile Tyr Leu Val Ser Ala Leu Asp Ser Gly Val Pro
50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr
Cys Trp Gln Gly 85 90 95 Thr His Phe Pro Trp Thr Phe Gly Gln Gly
Thr Lys Leu Glu Ile Lys 100 105 110 165112PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
165Asp Ile Val Met Thr Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly
1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu
Asp Ser 20 25 30 Asp Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln Lys
Pro Gly Gln Ser 35 40 45 Pro Lys Arg Leu Ile Tyr Leu Val Ser Ala
Leu Asp Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser
Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu
Asp Val Gly Val Tyr Tyr Cys Trp Gln Gly 85 90 95 Thr His Phe Pro
Trp Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 110
166112PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 166Asp Ile Val Met Thr Gln Thr Pro Leu Ser
Leu Ser Val Thr Pro Gly 1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Lys
Ser Ser Gln Ser Leu Leu Asp Ser 20 25 30 Asp Gly Lys Thr Tyr Leu
Asn Trp Leu Leu Gln Lys Pro Gly Gln Ser 35 40 45 Pro Gln Arg Leu
Ile Tyr Leu Val Ser Ala Leu Asp Ser Gly Val Pro 50 55 60 Asp Arg
Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Trp Gln Gly 85
90 95 Thr His Phe Pro Trp Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile
Lys 100 105 110 167112PRTArtificial SequenceDescription of
Artificial Sequence Synthetic polypeptide 167Asp Ile Val Met Thr
Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly 1 5 10 15 Gln Pro Ala
Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Asp Ser 20 25 30 Asp
Gly Lys Thr Tyr Leu Asn Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40
45 Pro Gln Arg Leu Ile Tyr Leu Val Ser Ala Leu Asp Ser Gly Val Pro
50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu
Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr
Cys Trp Gln Gly 85 90 95 Thr His Phe Pro Trp Thr Phe Gly Gln Gly
Thr Lys Leu Glu Ile Lys 100 105 110 168112PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
168Asp Ile Val Met Thr Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly
1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu
Asp Ser 20 25 30 Asp Gly Lys Thr Tyr Leu Asn Trp Tyr Leu Gln Lys
Pro Gly Gln Ser 35 40 45 Pro Lys Arg Leu Ile Tyr Leu Val Ser Ala
Leu Asp Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser
Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu
Asp Val Gly Val Tyr Tyr Cys Trp Gln Gly 85 90 95 Thr His Phe Pro
Trp Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 110
16915PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 169Ala Gln Asn Asp Thr Ser Gln Thr Ser Ser Pro
Ser Ala Asp Cys 1 5 10 15 17015PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 170Gly Ala Asn Asp Thr Ser
Gln Thr Ser Ser Pro Ser Ala Asp Cys 1 5 10 15 17115PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 171Gly
Gln Ala Asp Thr Ser Gln Thr Ser Ser Pro Ser Ala Asp Cys 1 5 10 15
17215PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 172Gly Gln Asn Ala Thr Ser Gln Thr Ser Ser Pro
Ser Ala Asp Cys 1 5 10 15 17315PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 173Gly Gln Asn Asp Ala Ser
Gln Thr Ser Ser Pro Ser Ala Asp Cys 1 5 10 15 17415PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 174Gly
Gln Asn Asp Thr Ala Gln Thr Ser Ser Pro Ser Ala Asp Cys 1 5 10 15
17515PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 175Gly Gln Asn Asp Thr Ser Ala Thr Ser Ser Pro
Ser Ala Asp Cys 1 5 10 15 17615PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 176Gly Gln Asn Asp Thr Ser
Gln Ala Ser Ser Pro Ser Ala Asp Cys 1 5 10 15 17715PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 177Gly
Gln Asn Asp Thr Ser Gln Thr Ala Ser Pro Ser Ala Asp Cys 1 5 10 15
17815PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 178Gly Gln Asn Asp Thr Ser Gln Thr Ser Ala Pro
Ser Ala Asp Cys 1 5 10 15 17915PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 179Gly Gln Asn Asp Thr Ser
Gln Thr Ser Ser Ala Ser Ala Asp Cys 1 5 10 15 18015PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 180Gly
Gln Asn Asp Thr Ser Gln Thr Ser Ser Pro Ala Ala Asp Cys 1 5 10 15
18115PRTHomo sapiens 181Gly Gln Asn Asp Thr Ser Gln Thr Ser Ser Ala
Ser Ala Asp Cys 1 5 10 15 18215PRTHomo sapiens 182Gly Gln Asn Asp
Thr Ser Gln Thr Ser Ser Pro Ala Ala Asp Cys 1 5 10 15
18319PRTUnknownDescription of Unknown Tetanus toxoid peptide 183Asp
Thr Ile Met Met Glu Pro Pro Tyr Cys Lys Gly Leu Asp Ile Tyr 1 5 10
15 Tyr Lys Ala 18421PRTUnknownDescription of Unknown Tetanus toxoid
peptide 184Ser Ala Met Leu Thr Asn Leu Ile Ile Phe Gly Pro Gly Pro
Val Leu 1 5 10 15 Asn Lys Asn Glu Val 20 18520PRTUnknownDescription
of Unknown Tetanus toxoid peptide 185Asn Asn Phe Thr Val Ser Phe
Trp Leu Arg Val Pro Lys Val Ser Ala 1 5 10 15 Ser His Leu Glu 20
18621PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 186Asp Ile Glu Lys Lys Ile Ala Lys Met Glu
Lys Ala Ser Ser Val Phe 1 5 10 15 Asn Val Val Asn Ser 20
18715PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 187Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu
Ser Ala Ser Val 1 5 10 15 18815PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 188Gln Ser Pro Ser Ser Leu
Ser Ala Ser Val Gly Asp Arg Val Thr 1 5 10 15 18915PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 189Leu
Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Lys Ala 1 5 10 15
19015PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 190Gly Asp Arg Val Thr Ile Thr Cys Lys Ala Ser
Gln Asn Ile Asp 1 5 10 15 19115PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 191Ile Thr Cys Lys Ala Ser
Gln Asn Ile Asp Lys Tyr Leu Asn Trp 1 5 10 15 19215PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 192Ser
Gln Asn Ile Asp Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro 1 5 10 15
19315PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 193Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly
Lys Ala Pro Lys 1 5 10 15 19415PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 194Tyr Gln Gln Lys Pro Gly
Lys Ala Pro Lys Leu Leu Ile Tyr Asn 1 5 10 15 19515PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 195Gly
Lys Ala Pro Lys Leu Leu Ile Tyr Asn Thr Asn Asn Leu Gln 1 5 10 15
19615PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 196Leu Leu Ile Tyr Asn Thr Asn Asn Leu Gln Thr
Gly Val Pro Ser 1 5 10 15 19715PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 197Thr Asn Asn Leu Gln Thr
Gly Val Pro Ser Arg Phe Ser Gly Ser 1 5 10 15 19815PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 198Thr
Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 1 5 10 15
19915PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 199Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe
Thr Phe Thr Ile 1 5 10 15 20015PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 200Gly Ser Gly Thr Asp Phe
Thr Phe Thr Ile Ser Ser Leu Gln Pro 1 5 10 15 20115PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 201Phe
Thr Phe Thr Ile Ser Ser Leu Gln Pro Glu Asp Ile Ala Thr 1 5 10 15
20215PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 202Ser Ser Leu Gln Pro Glu Asp Ile Ala Thr Tyr
Tyr Cys Leu Gln 1 5 10 15 20315PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 203Glu Asp Ile Ala Thr Tyr
Tyr Cys Leu Gln His Ile Ser Arg Pro 1 5 10 15 20415PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 204Tyr
Tyr Cys Leu Gln His Ile Ser Arg Pro Arg Thr Phe Gly Gln 1 5 10 15
20515PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 205His Ile Ser Arg Pro Arg Thr Phe Gly Gln Gly
Thr Lys Val Glu 1 5 10 15 20615PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 206Arg Thr Phe Gly Gln Gly
Thr Lys Val Glu Ile Lys Arg Thr Val 1 5 10 15 20715PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 207Gln
Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Arg Pro Ser 1 5 10 15
20815PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 208Glu Ser Gly Pro Gly Leu Val Arg Pro Ser Gln
Thr Leu Ser Leu 1 5 10 15 20915PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 209Leu Val Arg Pro Ser Gln
Thr Leu Ser Leu Thr Cys Thr Val Ser 1 5 10 15 21015PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 210Gln
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Thr Phe Thr 1 5 10 15
21115PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 211Thr Cys Thr Val Ser Gly Phe Thr Phe Thr Asp
Phe Tyr Met Asn 1 5 10 15 21215PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 212Gly Phe Thr Phe Thr Asp
Phe Tyr Met Asn Trp Val Arg Gln Pro 1 5 10 15 21315PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 213Asp
Phe Tyr Met Asn Trp Val Arg Gln Pro Pro Gly Arg Gly Leu 1 5 10 15
21415PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 214Trp Val Arg Gln Pro Pro Gly Arg Gly Leu Glu
Trp Ile Gly Phe 1 5 10 15
21515PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 215Pro Gly Arg Gly Leu Glu Trp Ile Gly Phe Ile
Arg Asp Lys Ala 1 5 10 15 21615PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 216Glu Trp Ile Gly Phe Ile
Arg Asp Lys Ala Lys Gly Tyr Thr Thr 1 5 10 15 21715PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 217Ile
Arg Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn Pro Ser 1 5 10 15
21815PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 218Lys Gly Tyr Thr Thr Glu Tyr Asn Pro Ser Val
Lys Gly Arg Val 1 5 10 15 21915PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 219Glu Tyr Asn Pro Ser Val
Lys Gly Arg Val Thr Met Leu Val Asp 1 5 10 15 22015PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 220Val
Lys Gly Arg Val Thr Met Leu Val Asp Thr Ser Lys Asn Gln 1 5 10 15
22115PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 221Thr Met Leu Val Asp Thr Ser Lys Asn Gln Phe
Ser Leu Arg Leu 1 5 10 15 22215PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 222Thr Ser Lys Asn Gln Phe
Ser Leu Arg Leu Ser Ser Val Thr Ala 1 5 10 15 22315PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 223Phe
Ser Leu Arg Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val 1 5 10 15
22415PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 224Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr
Tyr Cys Ala Arg 1 5 10 15 22515PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 225Ala Asp Thr Ala Val Tyr
Tyr Cys Ala Arg Glu Gly His Thr Ala 1 5 10 15 22615PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 226Tyr
Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr 1 5 10 15
22715PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 227Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp
Gly Gln Gly Ser 1 5 10 15 22815PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 228Ala Pro Phe Asp Tyr Trp
Gly Gln Gly Ser Leu Val Thr Val Ser 1 5 10 15 22915PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 229Trp
Gly Gln Gly Ser Leu Val Thr Val Ser Ser Ala Ser Thr Lys 1 5 10 15
23015PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 230Asp Ile Val Met Thr Gln Thr Pro Leu Ser Leu
Ser Val Thr Pro 1 5 10 15 23114PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 231Gln Thr Pro Leu Ser Leu
Val Thr Pro Gly Gln Pro Ala Ser 1 5 10 23215PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 232Leu
Ser Val Thr Pro Gly Gln Pro Ala Ser Ile Ser Cys Lys Ser 1 5 10 15
23315PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 233Gly Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser
Gln Ser Leu Leu 1 5 10 15 23415PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 234Ile Ser Cys Lys Ser Ser
Gln Ser Leu Leu Tyr Ser Asn Gly Lys 1 5 10 15 23515PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 235Ser
Gln Ser Leu Leu Tyr Ser Asn Gly Lys Thr Tyr Leu Asn Trp 1 5 10 15
23615PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 236Tyr Ser Asn Gly Lys Thr Tyr Leu Asn Trp Val
Leu Gln Lys Pro 1 5 10 15 23715PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 237Thr Tyr Leu Asn Trp Val
Leu Gln Lys Pro Gly Gln Ser Pro Gln 1 5 10 15 23815PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 238Val
Leu Gln Lys Pro Gly Gln Ser Pro Gln Arg Leu Ile Tyr Leu 1 5 10 15
23915PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 239Gly Gln Ser Pro Gln Arg Leu Ile Tyr Leu Val
Ser Lys Leu Asp 1 5 10 15 24015PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 240Arg Leu Ile Tyr Leu Val
Ser Lys Leu Asp Ser Gly Val Pro Asp 1 5 10 15 24115PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 241Val
Ser Lys Leu Asp Ser Gly Val Pro Asp Arg Phe Ser Gly Ser 1 5 10 15
24215PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 242Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly
Ser Gly Thr Asp 1 5 10 15 24315PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 243Arg Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Lys Ile 1 5 10 15 24415PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 244Gly
Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala 1 5 10 15
24515PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 245Phe Thr Leu Lys Ile Ser Arg Val Glu Ala Glu
Asp Val Gly Val 1 5 10 15 24615PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 246Ser Arg Val Glu Ala Glu
Asp Val Gly Val Tyr Tyr Cys Val Gln 1 5 10 15 24715PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 247Glu
Asp Val Gly Val Tyr Tyr Cys Val Gln Gly Ser His Phe His 1 5 10 15
24815PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 248Tyr Tyr Cys Val Gln Gly Ser His Phe His Thr
Phe Gly Gln Gly 1 5 10 15 24915PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 249Gly Ser His Phe His Thr
Phe Gly Gln Gly Thr Lys Leu Glu Ile 1 5 10 15 25015PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 250Thr
Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg Thr Val Ala 1 5 10 15
25115PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 251Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu
Val Gln Pro Gly 1 5 10 15 25215PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 252Glu Ser Gly Gly Gly Leu
Val Gln Pro Gly Gly Ser Leu Arg Leu 1 5 10 15 25315PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 253Leu
Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser 1 5 10 15
25415PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 254Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Pro Phe Ser 1 5 10 15 25515PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 255Ser Cys Ala Ala Ser Gly
Phe Pro Phe Ser Asn Tyr Trp Met Asn 1 5 10 15 25615PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 256Gly
Phe Pro Phe Ser Asn Tyr Trp Met Asn Trp Val Arg Gln Ala 1 5 10 15
25715PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 257Asn Tyr Trp Met Asn Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu 1 5 10 15 25815PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 258Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val Gly Gln 1 5 10 15 25915PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 259Pro
Gly Lys Gly Leu Glu Trp Val Gly Gln Ile Arg Leu Lys Ser 1 5 10 15
26015PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 260Glu Trp Val Gly Gln Ile Arg Leu Lys Ser Asn
Asn Tyr Ala Thr 1 5 10 15 26115PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 261Ile Arg Leu Lys Ser Asn
Asn Tyr Ala Thr His Tyr Ala Glu Ser 1 5 10 15 26215PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 262Asn
Asn Tyr Ala Thr His Tyr Ala Glu Ser Val Lys Gly Arg Phe 1 5 10 15
26315PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 263His Tyr Ala Glu Ser Val Lys Gly Arg Phe Thr
Ile Ser Arg Asp 1 5 10 15 26415PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 264Val Lys Gly Arg Phe Thr
Ile Ser Arg Asp Asp Ser Lys Asn Ser 1 5 10 15 26515PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 265Thr
Ile Ser Arg Asp Asp Ser Lys Asn Ser Leu Tyr Leu Gln Met 1 5 10 15
26615PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 266Asp Ser Lys Asn Ser Leu Tyr Leu Gln Met Asn
Ser Leu Lys Thr 1 5 10 15 26715PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 267Leu Tyr Leu Gln Met Asn
Ser Leu Lys Thr Glu Asp Thr Ala Val 1 5 10 15 26815PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 268Asn
Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr Tyr Cys Thr Pro 1 5 10 15
26915PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 269Glu Asp Thr Ala Val Tyr Tyr Cys Thr Pro Ile
Asp Tyr Trp Gly 1 5 10 15 27015PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 270Tyr Tyr Cys Thr Pro Ile
Asp Tyr Trp Gly Gln Gly Thr Thr Val 1 5 10 15 27115PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 271Ile
Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Ala 1 5 10 15
272464PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 272Met Glu Ala Pro Ala Gln Leu Leu Phe Leu
Leu Leu Leu Trp Leu Pro 1 5 10 15 Asp Thr Thr Gly Glu Val Gln Leu
Val Glu Ser Gly Gly Gly Leu Val 20 25 30 Gln Pro Gly Gly Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 35 40 45 Phe Asn Thr Tyr
Trp Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly 50 55 60 Leu Glu
Trp Val Gly Gln Ile Arg Leu Lys Ser Asn Asn Tyr Ala Thr 65 70 75 80
His Tyr Ala Glu Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp 85
90 95 Ser Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu
Asp 100 105 110 Thr Ala Val Tyr Tyr Cys Thr Pro Val Asp Phe Trp Gly
Gln Gly Thr 115 120 125 Thr Val Thr Val Ser Ser Ala Ser Thr Lys Gly
Pro Ser Val Phe Pro 130 135 140 Leu Ala Pro Ser Ser Lys Ser Thr Ser
Gly Gly Thr Ala Ala Leu Gly 145 150 155 160 Cys Leu Val Lys Asp Tyr
Phe Pro Glu Pro Val Thr Val Ser Trp Asn 165 170 175 Ser Gly Ala Leu
Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 180 185 190 Ser Ser
Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 195 200 205
Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser 210
215 220 Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp Lys
Thr 225 230 235 240 His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu
Gly Gly Pro Ser 245 250 255 Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
Thr Leu Met Ile Ser Arg 260 265 270 Thr Pro Glu Val Thr Cys Val Val
Val Asp Val Ser His Glu Asp Pro 275 280 285 Glu Val Lys Phe Asn Trp
Tyr Val Asp Gly Val Glu Val His Asn Ala 290 295 300 Lys Thr Lys Pro
Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val 305 310 315 320 Ser
Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr 325 330
335 Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr
340 345 350 Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr
Thr Leu 355 360 365 Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val
Ser Leu Thr Cys 370 375 380 Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile
Ala Val Glu Trp Glu Ser 385 390 395 400 Asn Gly Gln Pro Glu Asn Asn
Tyr Lys Thr Thr Pro Pro Val Leu Asp 405 410 415 Ser Asp Gly Ser Phe
Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser 420 425 430 Arg Trp Gln
Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala 435 440 445 Leu
His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 450 455
460 273238PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 273Met Glu Ala Pro Ala Gln Leu Leu Phe Leu
Leu Leu Leu Trp Leu Pro 1 5 10 15 Asp Thr Thr Gly Asp Ile Val Met
Thr Gln Thr Pro Leu Ser Leu Ser 20 25 30 Val Thr Pro Gly Gln Pro
Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser 35 40 45 Leu Leu Tyr Ser
Asn Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln Lys 50 55 60 Pro Gly
Gln Ser Pro Gln Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp 65 70 75 80
Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe 85
90 95 Thr Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr
Tyr 100 105 110 Cys Val Gln Gly Thr His Leu His Thr Phe Gly Gln Gly
Thr Arg Leu 115 120 125 Glu Ile Lys Arg Thr Val Ala Ala Pro Ser Val
Phe Ile Phe Pro Pro 130 135 140 Ser Asp Glu Gln Leu Lys Ser Gly Thr
Ala Ser Val Val Cys Leu Leu 145 150 155 160 Asn Asn Phe Tyr Pro Arg
Glu Ala Lys Val Gln Trp Lys Val Asp Asn 165 170 175 Ala Leu Gln Ser
Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser 180 185 190 Lys Asp
Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala 195 200 205
Asp Tyr Glu Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly 210
215 220 Leu Ser Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225
230 235 274467PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide
274Met Glu Ala Pro Ala Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro
1 5 10 15 Asp Thr Thr Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val 20 25 30 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr 35 40 45 Phe Thr Asp Tyr Tyr Met Ser Trp Val Arg
Gln Ala Pro Gly Lys Gly 50 55 60 Leu Glu Trp Val Gly Phe Ile Arg
Asn Lys Ala Asn Gly Tyr Thr Thr 65 70 75 80 Glu Tyr Asn Ala Ser Val
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp 85 90 95 Ser Lys Asn Ser
Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp 100 105 110 Thr Ala
Val Tyr Tyr Cys Thr Arg Tyr Ile Phe Phe Asp Tyr Trp Gly 115 120 125
Gln Gly Thr Thr Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser 130
135 140 Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr
Ala 145 150 155 160 Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu
Pro Val Thr Val 165 170 175 Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly
Val His Thr Phe Pro Ala 180 185 190 Val Leu Gln Ser Ser Gly Leu Tyr
Ser Leu Ser Ser Val Val Thr Val 195 200 205 Pro Ser Ser Ser Leu Gly
Thr Gln Thr Tyr Ile Cys Asn Val Asn His 210 215 220 Lys Pro Ser Asn
Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys 225 230 235 240 Asp
Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 245 250
255 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met
260 265 270 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val
Ser His 275 280 285 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp
Gly Val Glu Val 290 295 300 His Asn Ala Lys Thr Lys Pro Arg Glu Glu
Gln Tyr Asn Ser Thr Tyr 305 310 315 320 Arg Val Val Ser Val Leu Thr
Val Leu His Gln Asp Trp Leu Asn Gly 325 330 335 Lys Glu Tyr Lys Cys
Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile 340 345 350 Glu Lys Thr
Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val 355 360 365 Tyr
Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 370 375
380 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu
385 390 395 400 Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr
Thr Pro Pro 405 410 415 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr
Ser Lys Leu Thr Val 420 425 430 Asp Lys Ser Arg Trp Gln Gln Gly Asn
Val Phe Ser Cys Ser Val Met 435 440 445 His Glu Ala Leu His Asn His
Tyr Thr Gln Lys Ser Leu Ser Leu Ser 450 455 460 Pro Gly Lys 465
275239PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 275Met Glu Ala Pro Ala Gln Leu Leu Phe Leu
Leu Leu Leu Trp Leu Pro 1 5 10 15 Asp Thr Thr Gly Asp Ile Val Met
Thr Gln Thr Pro Leu Ser Leu Ser 20 25 30 Val Thr Pro Gly Gln Pro
Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser 35 40 45 Leu Val His Thr
Asn Gly Asn Ser Tyr Leu His Trp Tyr Leu Gln Lys 50 55 60 Pro Gly
Gln Ser Pro Gln Leu Leu Ile Tyr Met Val Ser Asn Arg Phe 65 70 75 80
Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe 85
90 95 Thr Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr
Tyr 100 105 110 Cys Ser Gln Ser Thr His Val Pro Phe Thr Phe Gly Gln
Gly Thr Lys 115 120 125 Leu Glu Ile Lys Arg Thr Val Ala Ala Pro Ser
Val Phe Ile Phe Pro 130 135 140 Pro Ser Asp Glu Gln Leu Lys Ser Gly
Thr Ala Ser Val Val Cys Leu 145 150 155 160 Leu Asn Asn Phe Tyr Pro
Arg Glu Ala Lys Val Gln Trp Lys Val Asp 165 170 175 Asn Ala Leu Gln
Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp 180 185 190 Ser Lys
Asp Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys 195 200 205
Ala Asp Tyr Glu Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln 210
215 220 Gly Leu Ser Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys
225 230 235 276464PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 276Met Glu Ala Pro Ala Gln Leu Leu
Phe Leu Leu Leu Leu Trp Leu Pro 1 5 10 15 Asp Thr Thr Gly Glu Val
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val 20 25 30 Gln Pro Gly Gly
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 35 40 45 Phe Ser
Asp Ala Trp Met Asp Trp Val Arg Gln Ala Pro Gly Lys Gly 50 55 60
Leu Glu Leu Val Ser Glu Ile Arg Asn Lys Ala Lys Asn His Ala Thr 65
70 75 80 Tyr Tyr Ala Glu Ser Val Lys Gly Arg Phe Thr Ile Ser Arg
Asp Asn 85 90 95 Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu
Arg Ala Glu Asp 100 105 110 Thr Ala Val Tyr Tyr Cys Thr Thr Leu Asp
Ser Trp Gly Gln Gly Thr 115 120 125 Thr Val Thr Val Ser Ser Ala Ser
Thr Lys Gly Pro Ser Val Phe Pro 130 135 140 Leu Ala Pro Ser Ser Lys
Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly 145 150 155 160 Cys Leu Val
Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 165 170 175 Ser
Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 180 185
190 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser
195 200 205 Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys
Pro Ser 210 215 220 Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser
Cys Asp Lys Thr 225 230 235 240 His Thr Cys Pro Pro Cys Pro Ala Pro
Glu Leu Leu Gly Gly Pro Ser 245 250 255 Val Phe Leu Phe Pro Pro Lys
Pro Lys Asp Thr Leu Met Ile Ser Arg 260 265 270 Thr Pro Glu Val Thr
Cys Val Val Val Asp Val Ser His Glu Asp Pro 275 280 285 Glu Val Lys
Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala 290 295 300 Lys
Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val 305 310
315 320 Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu
Tyr 325 330 335 Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile
Glu Lys Thr 340 345 350 Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro
Gln Val Tyr Thr Leu 355 360 365 Pro Pro Ser Arg Asp Glu Leu Thr Lys
Asn Gln Val Ser Leu Thr Cys 370 375 380 Leu Val Lys Gly Phe Tyr Pro
Ser Asp Ile Ala Val Glu Trp Glu Ser 385 390 395 400 Asn Gly Gln Pro
Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp 405 410 415 Ser Asp
Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser 420 425 430
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala 435
440 445 Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly
Lys 450 455 460 277464PRTArtificial SequenceDescription of
Artificial Sequence Synthetic polypeptide 277Met Glu Ala Pro Ala
Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro 1 5 10 15 Asp Thr Thr
Gly Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val 20 25 30 Gln
Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 35 40
45 Phe Ser Asp Ala Trp Met Asp Trp Val Arg Gln Ala Pro Gly Lys Gly
50 55 60 Leu Glu Leu Val Ala Glu Ile Arg Asn Lys Ala Lys Asn His
Ala Thr 65 70 75 80 Tyr Tyr Ala Glu Ser Val Lys Gly Arg Phe Thr Ile
Ser Arg Asp Asn 85 90 95 Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn
Ser Leu Arg Ala Glu Asp 100 105 110 Thr Ala Val Tyr Tyr Cys Thr Thr
Leu Asp Ser Trp Gly Gln Gly Thr 115 120 125 Thr Val Thr Val Ser Ser
Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 130 135 140 Leu Ala Pro Ser
Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly 145 150 155 160 Cys
Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 165 170
175 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln
180 185 190 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro
Ser Ser 195 200 205 Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn
His Lys Pro Ser 210 215 220 Asn Thr Lys Val Asp Lys Lys Val Glu Pro
Lys Ser Cys Asp Lys Thr 225 230 235 240 His Thr Cys Pro Pro Cys Pro
Ala Pro Glu Leu Leu Gly Gly Pro Ser 245 250 255 Val Phe Leu Phe Pro
Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg 260 265 270 Thr Pro Glu
Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro 275 280 285 Glu
Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala 290 295
300 Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val
305 310 315 320 Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly
Lys Glu Tyr 325 330 335 Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala
Pro Ile Glu Lys Thr 340 345 350 Ile Ser Lys Ala Lys Gly Gln Pro Arg
Glu Pro Gln Val Tyr Thr Leu 355 360 365 Pro Pro Ser Arg Asp Glu Leu
Thr Lys Asn Gln Val Ser Leu Thr Cys 370 375 380 Leu Val Lys Gly Phe
Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser 385 390 395 400 Asn Gly
Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp 405 410 415
Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser 420
425 430 Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu
Ala 435 440 445 Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser
Pro Gly Lys 450 455 460 278239PRTArtificial SequenceDescription of
Artificial Sequence Synthetic polypeptide 278Met Glu Ala Pro Ala
Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro 1 5 10 15 Asp Thr Thr
Gly Asp Ile Val Met Thr Gln Thr Pro Leu Ser Leu Ser 20 25 30 Val
Thr Pro Gly Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser 35 40
45 Leu Leu Asp Ser Asp Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln Lys
50 55 60 Pro Gly Gln Ser Pro Gln Arg Leu Ile Tyr Leu Val Ser Ala
Leu Asp 65 70 75 80 Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser
Gly Thr Asp Phe 85 90 95 Thr Leu Lys Ile Ser Arg Val Glu Ala Glu
Asp Val Gly Val Tyr Tyr 100 105 110 Cys Trp Gln Gly Thr His Phe Pro
Trp Thr Phe Gly Gln Gly Thr Lys 115 120 125 Leu Glu Ile Lys Arg Thr
Val Ala Ala Pro Ser Val Phe Ile Phe Pro 130 135 140 Pro Ser Asp Glu
Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu 145 150 155 160 Leu
Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp 165 170
175 Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp
180 185 190 Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu
Ser Lys 195 200 205 Ala Asp Tyr Glu Lys His Lys Val Tyr Ala Cys Glu
Val Thr His Gln 210 215 220 Gly Leu Ser Ser Pro Val Thr Lys Ser Phe
Asn Arg Gly Glu Cys 225 230 235 279464PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
279Met Glu Ala Pro Ala Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro
1 5 10 15 Asp Thr Thr Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val 20 25 30 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Pro 35 40 45 Phe Ser Asn Tyr Trp Met Asn Trp Val Arg
Gln Ala Pro Gly Lys Gly 50 55 60 Leu Glu Trp Val Gly Gln Ile Arg
Leu Lys Ser Asn Asn Tyr Ala Thr 65 70 75 80 His Tyr Ala Glu Ser Val
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp 85 90 95 Ser Lys Asn Ser
Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp 100 105 110 Thr Ala
Val Tyr Tyr Cys Thr Pro Ile Asp Tyr Trp Gly Gln Gly Thr 115 120 125
Thr Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 130
135 140 Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu
Gly 145 150 155 160 Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr
Val Ser Trp Asn 165 170 175 Ser Gly Ala Leu Thr Ser Gly Val His Thr
Phe Pro Ala Val Leu Gln 180 185 190 Ser Ser Gly Leu Tyr Ser Leu Ser
Ser Val Val Thr Val Pro Ser Ser 195 200 205 Ser Leu Gly Thr Gln Thr
Tyr Ile Cys Asn Val Asn His Lys Pro Ser 210 215 220 Asn Thr Lys Val
Asp Lys Lys Val Glu Pro Lys Ser Cys Asp Lys Thr 225 230 235 240 His
Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser 245 250
255 Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg
260 265 270 Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu
Asp Pro 275 280 285 Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu
Val His Asn Ala 290 295 300 Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn
Ser Thr Tyr Arg Val Val 305 310 315 320 Ser Val Leu Thr Val Leu His
Gln Asp Trp Leu Asn Gly Lys Glu Tyr 325 330 335 Lys Cys Lys Val Ser
Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr 340 345 350 Ile Ser Lys
Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu 355 360 365 Pro
Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys 370
375 380 Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu
Ser 385 390 395 400 Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro
Pro Val Leu Asp 405 410 415 Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys
Leu Thr Val Asp Lys Ser 420 425 430 Arg Trp Gln Gln Gly Asn Val Phe
Ser Cys Ser Val Met His Glu Ala 435 440 445 Leu His Asn His Tyr Thr
Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 450 455 460
280238PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 280Met Glu Ala Pro Ala Gln Leu Leu Phe Leu
Leu Leu Leu Trp Leu Pro 1 5 10 15 Asp Thr Thr Gly Asp Ile Val Met
Thr Gln Thr Pro Leu Ser Leu Ser 20 25 30 Val Thr Pro Gly Gln Pro
Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser 35 40 45 Leu Leu Tyr Ser
Asn Gly Lys Thr Tyr Leu Asn Trp Val Leu Gln Lys 50 55 60 Pro Gly
Gln Ser Pro Gln Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp 65 70 75 80
Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe 85
90 95 Thr Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr
Tyr 100 105 110 Cys Val Gln Gly Ser His Phe His Thr Phe Gly Gln Gly
Thr Lys Leu 115 120 125 Glu Ile Lys Arg Thr Val Ala Ala Pro Ser Val
Phe Ile Phe Pro Pro 130 135 140 Ser Asp Glu Gln Leu Lys Ser Gly Thr
Ala Ser Val Val Cys Leu Leu 145 150 155 160 Asn Asn Phe Tyr Pro Arg
Glu Ala Lys Val Gln Trp Lys Val Asp Asn 165 170 175 Ala Leu Gln Ser
Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser 180 185 190 Lys Asp
Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala 195 200 205
Asp Tyr Glu Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly 210
215 220 Leu Ser Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225
230 235 281467PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 281Met Glu Ala Pro Ala Gln Leu Leu
Phe Leu Leu Leu Leu Trp Leu Pro 1 5 10 15 Asp Thr Thr Gly Glu Val
Gln Leu Val Glu Ser Gly Gly Gly Leu Val 20 25 30 Gln Pro Gly Gly
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 35 40 45 Phe Ser
Asp Tyr Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly 50 55 60
Leu Glu Trp Val Gly Phe Ile Arg Asn Lys Ala Asn Gly Tyr Thr Thr 65
70 75 80 Glu Tyr Ser Ala Ser Val Lys Gly Arg Phe Thr Ile Ser Arg
Asp Asp 85 90 95 Ser Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu
Lys Thr Glu Asp 100 105 110 Thr Ala Val Tyr Tyr Cys Ala Arg Tyr Ile
Trp Phe Asp Tyr Trp Gly 115 120 125 Gln Gly Thr Thr Val Thr Val Ser
Ser Ala Ser Thr Lys Gly Pro Ser 130 135 140 Val Phe Pro Leu Ala Pro
Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala 145 150 155 160 Ala Leu Gly
Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val 165 170 175 Ser
Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala 180 185
190 Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val
195 200 205 Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val
Asn His 210 215 220 Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu
Pro Lys Ser Cys 225 230 235 240 Asp Lys Thr His Thr Cys Pro Pro Cys
Pro Ala Pro Glu Leu Leu Gly 245 250 255 Gly Pro Ser Val Phe Leu Phe
Pro Pro Lys Pro Lys Asp Thr Leu Met 260 265 270 Ile Ser Arg Thr Pro
Glu Val Thr Cys Val Val Val Asp Val Ser His 275 280 285 Glu Asp Pro
Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 290 295 300 His
Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 305 310
315 320 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn
Gly 325 330 335 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro
Ala Pro Ile 340 345 350 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro
Arg Glu Pro Gln Val 355 360 365 Tyr Thr Leu Pro Pro Ser Arg Asp Glu
Leu Thr Lys Asn Gln Val Ser 370 375 380 Leu Thr Cys Leu Val Lys Gly
Phe Tyr Pro Ser Asp Ile Ala Val Glu 385 390 395 400 Trp Glu Ser Asn
Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 405 410 415 Val Leu
Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 420 425 430
Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met 435
440 445 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu
Ser 450 455 460 Pro Gly Lys 465 282240PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
282Met Glu Ala Pro Ala Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro
1 5 10 15 Asp Thr Thr Gly Asp Ile Val Met Thr Gln Thr Pro Leu Ser
Leu Ser 20 25 30 Val Thr Pro Gly Gln Pro Ala Ser Ile Ser Cys Arg
Ser Ser Gln Ser 35 40 45 Leu Val His Thr Asn Gly Asn Thr Tyr Leu
His Trp Tyr Leu Gln Lys 50 55 60 Pro Gly Gln Ser Pro Gln Leu Leu
Ile Tyr Met Val Ser Asn Arg Phe 65 70 75 80 Ser Gly Val Pro Asp Arg
Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe 85 90 95 Thr Leu Lys Ile
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr 100 105 110 Cys Ser
Gln Ser Ala His Val Pro Pro Leu Thr Phe Gly Gln Gly Thr 115 120 125
Arg Leu Glu Ile Lys Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe 130
135 140 Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser Val Val
Cys 145 150 155 160 Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val
Gln Trp Lys Val 165 170 175 Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln
Glu Ser Val Thr Glu Gln 180 185 190 Asp Ser Lys Asp Ser Thr Tyr Ser
Leu Ser Ser Thr Leu Thr Leu Ser 195 200 205 Lys Ala Asp Tyr Glu Lys
His Lys Val Tyr Ala Cys Glu Val Thr His 210 215 220 Gln Gly Leu Ser
Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 240
2831395DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 283atggaagccc cagcgcagct tctcttcctc
ctgctactct ggctccctga taccaccgga 60gaggtacagc tggtggagtc gggaggaggc
ttggtacagc ctgggggttc tctgagactc 120tcctgtgcag cttctggatt
cactttcaat acctactgga tgaactgggt ccgccaggct 180ccagggaagg
gacttgagtg ggtgggtcaa attagattga aatctaataa ttatgcaaca
240cattatgcgg agtctgtgaa agggcggttc accatctcca gagatgattc
caaaaacagc 300ctctatcttc aaatgaattc cctgaaaact gaagacactg
ccgtttatta ctgtacccca 360gttgactttt ggggccaagg caccactgtc
acagtctcct cagcctccac caagggccca 420tcggtcttcc ccctggcacc
ctcctccaag agcacctctg ggggtacagc ggccctgggc 480tgcctggtca
aggactactt ccccgaaccg gtgacggtgt cgtggaactc aggcgccctg
540accagcggcg tgcacacctt cccggctgtc ctacagtcct caggactcta
ctccctcagc 600agcgtggtga ccgtgccctc cagcagcttg ggcacccaga
cctacatctg caacgtgaat 660cacaagccca gcaacaccaa ggtggacaag
aaagttgagc ccaaatcttg tgacaaaact 720cacacatgcc caccgtgccc
agcacctgaa ctcctggggg gaccgtcagt cttcctcttc 780cccccaaaac
ccaaggacac cctcatgatc tcccggaccc ctgaggtcac atgcgtggtg
840gtggacgtga gccacgaaga ccctgaggtc aagttcaact ggtacgtgga
cggcgtggag 900gtgcataatg ccaagacaaa gccgcgggag gagcagtaca
acagcacgta ccgtgtggtc 960agcgtcctca ccgtcctgca ccaggactgg
ctgaatggca aggagtacaa gtgcaaggtc 1020tccaacaaag ccctcccagc
ccccatcgag aaaaccatct ccaaagccaa agggcagccc 1080cgagaaccac
aggtgtacac cctgccccca tcccgggatg agctgaccaa gaaccaggtc
1140agcctgacat gcctggtcaa aggcttctat cccagcgaca tcgccgtgga
gtgggagagc 1200aatgggcagc cggagaacaa ctacaagacc acgcctcccg
tgctggactc cgacggctcc 1260ttcttcctct acagcaagct caccgtggac
aagtccaggt ggcagcaggg gaacgtcttc 1320tcatgctccg tgatgcatga
ggctctgcac aaccactaca cgcagaagag cctctccctg 1380tctccgggta aatga
1395284717DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 284atggaagccc cagcgcagct tctcttcctc
ctgctactct ggctccctga taccaccgga 60gacattgtga tgacccagac tccactcagt
ttgtcagtta cccctggaca accagcctca 120atctcttgca agtcaagtca
gagcctctta tatagtaatg gaaaaaccta tttgaactgg 180ttattacaga
agccaggcca gtctccacag cgcctaatct atctggtgtc taaattggac
240tctggagtcc ctgacaggtt cagtggcagt ggatcaggaa cagattttac
actgaaaatc 300agcagagtgg aggctgagga tgtgggagtt tattactgcg
tgcaaggtac acatctgcac 360acgttcggtc aagggaccag gctggagata
aaacgaactg tggcagcacc aagcgtcttc 420atcttcccgc catctgatga
gcagttgaaa tctggaactg cctctgttgt gtgcctgctg 480aataacttct
atcccagaga ggccaaagta cagtggaagg tggataacgc cctccaatcg
540ggtaactccc aggagagtgt cacagagcag gacagcaagg acagcaccta
cagcctcagc 600agcaccctga cgctgagcaa agcagactac gagaaacaca
aagtctacgc ctgcgaagtc 660acccatcagg gcctgagctc gcccgtcaca
aagagcttca acaggggaga gtgttag 7172851404DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
285atggaagccc cagcgcagct tctcttcctc ctgctactct ggctccctga
taccaccgga 60gaggtacagc tggtggagtc gggaggaggc ttggtacagc ctgggggttc
tctgagactc 120tcctgtgcag cttctggctt cacattcacc gactattaca
tgagctgggt ccgccaggct 180ccagggaagg gacttgagtg ggtgggtttc
ataaggaaca aggctaacgg ttatacaacc 240gagtacaacg cttccgttaa
aggccggttc accatctcca gagatgattc caaaaacagc 300ctctatcttc
aaatgaattc cctgaaaact gaagacactg ccgtttatta ctgtaccagg
360tatatctttt tcgattactg gggccaaggc accactgtca cagtctcctc
agcctccacc 420aagggcccat cggtcttccc cctggcaccc tcctccaaga
gcacctctgg gggtacagcg 480gccctgggct gcctggtcaa ggactacttc
cccgaaccgg tgacggtgtc gtggaactca 540ggcgccctga ccagcggcgt
gcacaccttc ccggctgtcc tacagtcctc aggactctac 600tccctcagca
gcgtggtgac cgtgccctcc agcagcttgg gcacccagac ctacatctgc
660aacgtgaatc acaagcccag caacaccaag gtggacaaga aagttgagcc
caaatcttgt 720gacaaaactc acacatgccc accgtgccca gcacctgaac
tcctgggggg accgtcagtc 780ttcctcttcc ccccaaaacc caaggacacc
ctcatgatct cccggacccc tgaggtcaca 840tgcgtggtgg tggacgtgag
ccacgaagac cctgaggtca agttcaactg gtacgtggac 900ggcgtggagg
tgcataatgc caagacaaag ccgcgggagg agcagtacaa cagcacgtac
960cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaatggcaa
ggagtacaag 1020tgcaaggtct ccaacaaagc cctcccagcc cccatcgaga
aaaccatctc caaagccaaa 1080gggcagcccc gagaaccaca ggtgtacacc
ctgcccccat cccgggatga gctgaccaag 1140aaccaggtca gcctgacatg
cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 1200tgggagagca
atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc
1260gacggctcct tcttcctcta cagcaagctc accgtggaca agtccaggtg
gcagcagggg 1320aacgtcttct catgctccgt gatgcatgag gctctgcaca
accactacac gcagaagagc 1380ctctccctgt ctccgggtaa atga
1404286720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 286atggaagccc cagcgcagct tctcttcctc
ctgctactct ggctccctga taccaccgga 60gatattgtaa tgacccaaac acccctctct
ctttcagtca cacctggaca gccagcgtcc 120atctcctgca ggtcctcaca
gagtctcgtg cacaccaatg gcaattccta cctgcattgg 180tacctgcaga
agcccgggca gagcccccag ttgctgatct atatggtgtc taatcggttc
240tccggagtcc ccgacagatt ttctggttca gggtctggaa ctgattttac
actgaagatt 300agtcgggtcg aggccgagga tgtaggcgtg tattactgct
cacaaagcac acatgtgccg 360ttcactttcg gccaaggaac aaagctcgaa
atcaagcgaa ctgtggcagc accaagcgtc 420ttcatcttcc cgccatctga
tgagcagttg aaatctggaa ctgcctctgt tgtgtgcctg 480ctgaataact
tctatcccag agaggccaaa gtacagtgga aggtggataa cgccctccaa
540tcgggtaact cccaggagag tgtcacagag caggacagca aggacagcac
ctacagcctc 600agcagcaccc tgacgctgag caaagcagac tacgagaaac
acaaagtcta cgcctgcgaa 660gtcacccatc agggcctgag ctcgcccgtc
acaaagagct tcaacagggg agagtgttag 7202871395DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
287atggaagccc cagcgcagct tctcttcctc ctgctactct ggctccctga
taccaccgga 60gaggtacagc ttcttgaaag tggaggtggc cttgtccaac ccggagggtc
attgcggttg 120agctgtgcgg caagtggctt caccttctct gacgcttgga
tggactgggt gagacaagcc 180cccggtaagg gactggagtt ggtttctgaa
atcaggaaca aggccaagaa ccatgcaaca 240tattatgccg aaagtgtgaa
gggaaggttc acaatcagta gagataacag caagaacaca 300ctgtacctcc
agatgaacag cctcagagct gaggacaccg ccgtctatta ttgtaccact
360ctcgattcat gggggcaggg taccaccgtt acagtcagca gcgcctccac
caagggccca 420tcggtcttcc ccctggcacc ctcctccaag agcacctctg
ggggtacagc ggccctgggc 480tgcctggtca aggactactt ccccgaaccg
gtgacggtgt cgtggaactc aggcgccctg 540accagcggcg tgcacacctt
cccggctgtc ctacagtcct caggactcta ctccctcagc 600agcgtggtga
ccgtgccctc cagcagcttg ggcacccaga cctacatctg caacgtgaat
660cacaagccca gcaacaccaa ggtggacaag aaagttgagc ccaaatcttg
tgacaaaact 720cacacatgcc caccgtgccc agcacctgaa ctcctggggg
gaccgtcagt cttcctcttc 780cccccaaaac ccaaggacac cctcatgatc
tcccggaccc ctgaggtcac atgcgtggtg 840gtggacgtga gccacgaaga
ccctgaggtc aagttcaact ggtacgtgga cggcgtggag 900gtgcataatg
ccaagacaaa gccgcgggag gagcagtaca acagcacgta ccgtgtggtc
960agcgtcctca ccgtcctgca ccaggactgg ctgaatggca aggagtacaa
gtgcaaggtc 1020tccaacaaag ccctcccagc ccccatcgag aaaaccatct
ccaaagccaa agggcagccc 1080cgagaaccac aggtgtacac cctgccccca
tcccgggatg agctgaccaa gaaccaggtc 1140agcctgacat gcctggtcaa
aggcttctat cccagcgaca tcgccgtgga gtgggagagc 1200aatgggcagc
cggagaacaa ctacaagacc acgcctcccg tgctggactc cgacggctcc
1260ttcttcctct acagcaagct caccgtggac aagtccaggt ggcagcaggg
gaacgtcttc 1320tcatgctccg tgatgcatga ggctctgcac aaccactaca
cgcagaagag cctctccctg 1380tctccgggta aatga 13952881395DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
288atggaagccc cagcgcagct tctcttcctc ctgctactct ggctccctga
taccaccgga 60gaggtacagc ttcttgaaag tggaggtggc cttgtccaac ccggagggtc
attgcggttg 120agctgtgcgg caagtggctt caccttctct gacgcttgga
tggactgggt gagacaagcc 180cccggtaagg gactggagtt ggttgctgaa
atcaggaaca aggccaagaa ccatgcaaca 240tattatgccg aaagtgtgaa
gggaaggttc acaatcagta gagataacag caagaacaca 300ctgtacctcc
agatgaacag cctcagagct gaggacaccg ccgtctatta ttgtaccact
360ctcgattcat gggggcaggg taccaccgtt acagtcagca gcgcctccac
caagggccca 420tcggtcttcc ccctggcacc ctcctccaag agcacctctg
ggggtacagc ggccctgggc 480tgcctggtca aggactactt ccccgaaccg
gtgacggtgt cgtggaactc aggcgccctg 540accagcggcg tgcacacctt
cccggctgtc ctacagtcct caggactcta ctccctcagc 600agcgtggtga
ccgtgccctc cagcagcttg ggcacccaga cctacatctg caacgtgaat
660cacaagccca gcaacaccaa ggtggacaag aaagttgagc ccaaatcttg
tgacaaaact 720cacacatgcc caccgtgccc agcacctgaa ctcctggggg
gaccgtcagt cttcctcttc 780cccccaaaac ccaaggacac cctcatgatc
tcccggaccc ctgaggtcac atgcgtggtg 840gtggacgtga gccacgaaga
ccctgaggtc aagttcaact ggtacgtgga cggcgtggag 900gtgcataatg
ccaagacaaa gccgcgggag gagcagtaca acagcacgta ccgtgtggtc
960agcgtcctca ccgtcctgca ccaggactgg ctgaatggca aggagtacaa
gtgcaaggtc 1020tccaacaaag ccctcccagc ccccatcgag aaaaccatct
ccaaagccaa agggcagccc 1080cgagaaccac aggtgtacac cctgccccca
tcccgggatg agctgaccaa gaaccaggtc 1140agcctgacat gcctggtcaa
aggcttctat cccagcgaca tcgccgtgga gtgggagagc 1200aatgggcagc
cggagaacaa ctacaagacc acgcctcccg tgctggactc cgacggctcc
1260ttcttcctct acagcaagct caccgtggac aagtccaggt ggcagcaggg
gaacgtcttc 1320tcatgctccg tgatgcatga ggctctgcac aaccactaca
cgcagaagag cctctccctg 1380tctccgggta aatga 1395289720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
289atggaagccc cagcgcagct tctcttcctc ctgctactct ggctccctga
taccaccgga 60gatatcgtga tgacacaaac tcccctgtct ctgtctgtaa ctccaggtca
gcccgcgagt 120atttcatgta agagcagcca atccctgctg gacagcgacg
ggaagaccta cctgaactgg 180ttactccaaa agccaggaca aagtccccaa
cgccttattt acctggtgtc agccctggac 240tctggcgtgc ccgatcgatt
tagcggcagc
gggagtggca cagatttcac cctgaaaata 300tcccgcgtcg aggccgaaga
tgtgggcgtg tactactgct ggcagggcac acatttcccc 360tggacatttg
gtcaggggac aaagctggaa attaaacgaa ctgtggcagc accaagcgtc
420ttcatcttcc cgccatctga tgagcagttg aaatctggaa ctgcctctgt
tgtgtgcctg 480ctgaataact tctatcccag agaggccaaa gtacagtgga
aggtggataa cgccctccaa 540tcgggtaact cccaggagag tgtcacagag
caggacagca aggacagcac ctacagcctc 600agcagcaccc tgacgctgag
caaagcagac tacgagaaac acaaagtcta cgcctgcgaa 660gtcacccatc
agggcctgag ctcgcccgtc acaaagagct tcaacagggg agagtgttag
7202901395DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 290atggaagccc cagcgcagct tctcttcctc
ctgctactct ggctccctga taccaccgga 60gaggtacagc tggtggagtc gggaggaggc
ttggtacagc ctgggggttc tctgagactc 120tcctgtgcag cttctggatt
cccattcagt aactactgga tgaactgggt ccgccaggct 180ccagggaagg
gacttgagtg ggtgggtcaa attagattga aatctaataa ttatgcaaca
240cattatgcgg agtctgtgaa agggcggttc accatctcca gagatgattc
caaaaacagc 300ctctatcttc aaatgaattc cctgaaaact gaagacactg
ccgtttatta ctgtacccca 360attgactatt ggggccaagg caccactgtc
acagtctcct cagcctccac caagggccca 420tcggtcttcc ccctggcacc
ctcctccaag agcacctctg ggggtacagc ggccctgggc 480tgcctggtca
aggactactt ccccgaaccg gtgacggtgt cgtggaactc aggcgccctg
540accagcggcg tgcacacctt cccggctgtc ctacagtcct caggactcta
ctccctcagc 600agcgtggtga ccgtgccctc cagcagcttg ggcacccaga
cctacatctg caacgtgaat 660cacaagccca gcaacaccaa ggtggacaag
aaagttgagc ccaaatcttg tgacaaaact 720cacacatgcc caccgtgccc
agcacctgaa ctcctggggg gaccgtcagt cttcctcttc 780cccccaaaac
ccaaggacac cctcatgatc tcccggaccc ctgaggtcac atgcgtggtg
840gtggacgtga gccacgaaga ccctgaggtc aagttcaact ggtacgtgga
cggcgtggag 900gtgcataatg ccaagacaaa gccgcgggag gagcagtaca
acagcacgta ccgtgtggtc 960agcgtcctca ccgtcctgca ccaggactgg
ctgaatggca aggagtacaa gtgcaaggtc 1020tccaacaaag ccctcccagc
ccccatcgag aaaaccatct ccaaagccaa agggcagccc 1080cgagaaccac
aggtgtacac cctgccccca tcccgggatg agctgaccaa gaaccaggtc
1140agcctgacat gcctggtcaa aggcttctat cccagcgaca tcgccgtgga
gtgggagagc 1200aatgggcagc cggagaacaa ctacaagacc acgcctcccg
tgctggactc cgacggctcc 1260ttcttcctct acagcaagct caccgtggac
aagtccaggt ggcagcaggg gaacgtcttc 1320tcatgctccg tgatgcatga
ggctctgcac aaccactaca cgcagaagag cctctccctg 1380tctccgggta aatga
1395291717DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 291atggaagccc cagcgcagct tctcttcctc
ctgctactct ggctccctga taccaccgga 60gacattgtga tgacccagac tccactcagt
ttgtcagtta cccctgggca accagcctct 120atctcttgca agtcaagtca
gagcctctta tatagtaatg gaaaaaccta tttgaactgg 180gttttacaga
agccaggcca gtctccacag cgcctaatct atctggtgtc taaactggac
240tctggagtcc ctgacaggtt ctctggcagt ggatcaggaa cagattttac
actgaaaatc 300agcagagtgg aggctgagga tgtgggagtt tattactgcg
tgcaaggttc acattttcac 360acgttcggtc aagggaccaa gctggagatt
aaacgaactg tggcagcacc aagcgtcttc 420atcttcccgc catctgatga
gcagttgaaa tctggaactg cctctgttgt gtgcctgctg 480aataacttct
atcccagaga ggccaaagta cagtggaagg tggataacgc cctccaatcg
540ggtaactccc aggagagtgt cacagagcag gacagcaagg acagcaccta
cagcctcagc 600agcaccctga cgctgagcaa agcagactac gagaaacaca
aagtctacgc ctgcgaagtc 660acccatcagg gcctgagctc gcccgtcaca
aagagcttca acaggggaga gtgttag 7172921404DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
292atggaagccc cagcgcagct tctcttcctc ctgctactct ggctccctga
taccaccgga 60gaggtacagc tggtggagtc gggaggaggc ttggtacagc ctgggggttc
tctgagactc 120tcctgtgcag cttctggatt caccttttct gattactaca
tgagctgggt ccgccaggct 180ccagggaagg gacttgagtg ggtgggtttt
attagaaaca aagctaatgg ttacacaaca 240gagtacagtg catctgtgaa
gggtcggttc accatctcca gagatgattc caaaaacagc 300ctctatcttc
aaatgaattc cctgaaaact gaagacactg ccgtttatta ctgtgcaaga
360tatatctggt ttgactactg gggccaaggc accactgtca cagtctcctc
agcctccacc 420aagggcccat cggtcttccc cctggcaccc tcctccaaga
gcacctctgg gggtacagcg 480gccctgggct gcctggtcaa ggactacttc
cccgaaccgg tgacggtgtc gtggaactca 540ggcgccctga ccagcggcgt
gcacaccttc ccggctgtcc tacagtcctc aggactctac 600tccctcagca
gcgtggtgac cgtgccctcc agcagcttgg gcacccagac ctacatctgc
660aacgtgaatc acaagcccag caacaccaag gtggacaaga aagttgagcc
caaatcttgt 720gacaaaactc acacatgccc accgtgccca gcacctgaac
tcctgggggg accgtcagtc 780ttcctcttcc ccccaaaacc caaggacacc
ctcatgatct cccggacccc tgaggtcaca 840tgcgtggtgg tggacgtgag
ccacgaagac cctgaggtca agttcaactg gtacgtggac 900ggcgtggagg
tgcataatgc caagacaaag ccgcgggagg agcagtacaa cagcacgtac
960cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaatggcaa
ggagtacaag 1020tgcaaggtct ccaacaaagc cctcccagcc cccatcgaga
aaaccatctc caaagccaaa 1080gggcagcccc gagaaccaca ggtgtacacc
ctgcccccat cccgggatga gctgaccaag 1140aaccaggtca gcctgacatg
cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 1200tgggagagca
atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc
1260gacggctcct tcttcctcta cagcaagctc accgtggaca agtccaggtg
gcagcagggg 1320aacgtcttct catgctccgt gatgcatgag gctctgcaca
accactacac gcagaagagc 1380ctctccctgt ctccgggtaa atga
1404293723DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 293atggaagccc cagcgcagct tctcttcctc
ctgctactct ggctccctga taccaccgga 60gacattgtga tgacccaaac tccactctcc
ctgtctgtca ctcctggaca accagcctcc 120atctcttgca gatctagtca
gagccttgta cacactaatg gaaacaccta tttacattgg 180tacctgcaga
agccaggcca gtctccacag ctcctgattt atatggtttc caaccgattt
240tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac
actcaagatc 300agcagagtgg aggctgagga tgtgggagtt tattactgct
ctcaaagtgc acatgttcct 360ccgctcacgt tcggtcaagg gaccaggctg
gagattaaac gaactgtggc agcaccaagc 420gtcttcatct tcccgccatc
tgatgagcag ttgaaatctg gaactgcctc tgttgtgtgc 480ctgctgaata
acttctatcc cagagaggcc aaagtacagt ggaaggtgga taacgccctc
540caatcgggta actcccagga gagtgtcaca gagcaggaca gcaaggacag
cacctacagc 600ctcagcagca ccctgacgct gagcaaagca gactacgaga
aacacaaagt ctacgcctgc 660gaagtcaccc atcagggcct gagctcgccc
gtcacaaaga gcttcaacag gggagagtgt 720tag 7232948PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 294Ala
Arg Tyr Ile Phe Phe Asp Tyr 1 5
* * * * *