U.S. patent application number 15/094624 was filed with the patent office on 2016-07-21 for methods, cells & organisms.
This patent application is currently assigned to Kymab Limited. The applicant listed for this patent is Kymab Limited. Invention is credited to Hanif Ali, Allan Bradley, E-Chiang Lee.
Application Number | 20160207983 15/094624 |
Document ID | / |
Family ID | 51610392 |
Filed Date | 2016-07-21 |
United States Patent
Application |
20160207983 |
Kind Code |
A1 |
Bradley; Allan ; et
al. |
July 21, 2016 |
Methods, Cells & Organisms
Abstract
The invention relates to an approach for introducing one or more
desired insertions and/or deletions of known sizes into one or more
predefined locations in a nucleic acid (eg, in a cell or organism
genome). They developed techniques to do this either in a
sequential fashion or by inserting a discrete DNA fragment of
defined size into the genome precisely in a predefined location or
carrying out a discrete deletion of a defined size at a precise
location. The technique is based on the observation that DNA
single-stranded breaks are preferentially repaired through the HDR
pathway, and this reduces the chances of indels (eg, produced by
NHEJ) in the present invention and thus is more efficient than
prior art techniques. The invention also provides sequential
insertion and/or deletions using single- or double-stranded DNA
cutting.
Inventors: |
Bradley; Allan; (Cambridge,
GB) ; Ali; Hanif; (Cambridge, GB) ; Lee;
E-Chiang; (Cambridge, GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Kymab Limited |
Cambridge |
|
GB |
|
|
Assignee: |
Kymab Limited
Cambridge
GB
|
Family ID: |
51610392 |
Appl. No.: |
15/094624 |
Filed: |
April 8, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14490549 |
Sep 18, 2014 |
|
|
|
15094624 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01K 2207/15 20130101;
C12N 2510/04 20130101; C07K 2317/14 20130101; A01K 67/0278
20130101; C12N 2800/80 20130101; A01K 2217/052 20130101; C07K
2317/52 20130101; A01K 2217/072 20130101; C07K 2317/56 20130101;
C12N 5/0635 20130101; C07K 2317/20 20130101; C07K 2317/24 20130101;
C12N 15/102 20130101; A01K 2227/105 20130101; C07K 16/00 20130101;
C12N 15/907 20130101; A01K 2267/01 20130101 |
International
Class: |
C07K 16/00 20060101
C07K016/00; A01K 67/027 20060101 A01K067/027; C12N 5/0781 20060101
C12N005/0781 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 18, 2013 |
GB |
1316560.0 |
Dec 2, 2013 |
GB |
1321210.5 |
Claims
1. A method for antibody production, comprising the steps of: (a)
providing a mouse or progeny thereof developed from the modified
mouse ES cell, wherein the modified mouse ES cell has been produced
by contacting a mouse ES cell with: a Cas9 protein; a CRISPR RNA
that hybridizes to a CRISPR target sequence at the genomic locus of
interest; a tracrRNA; and an incoming nucleic acid sequence that is
flanked by: (i) a 5' homology arm that is homologous to a 5' target
sequence at the genomic locus of interest; and (ii) a 3' homolog
arm that is homologous to a 3' target sequence at the genomic locus
of interest; wherein following the contacting step, the genome of
the mouse ES cell is modified to comprise a targeted genetic
modification comprising a disruption of a target protein or domain
thereof thereby producing a modified mouse ES cell and developing
the mouse from the modified mouse ES cell; (b) immunizing the mouse
with a predetermined antigen; (c) removing B lymphocytes from the
mouse and selecting one or more B lymphocytes expressing antibodies
that bind to the antigen; and (d) isolating an antibody expressed
by the B lymphocytes.
2. The method of claim 1, further comprising a step of producing
the modified mouse ES cell wherein the step comprises contacting a
mouse ES cell with: a Cas9 protein; a CRISPR RNA that hybridizes to
a CRISPR target sequence at the genomic locus of interest; a
tracrRNA; and an incoming nucleic acid sequence that is flanked by:
(i) a 5' homology arm that is homologous to a 5' target sequence at
the genomic locus of interest; and (ii) a 3' homolog arm that is
homologous to a 3' target sequence at the genomic locus of
interest, wherein following the contacting step, the genome of the
mouse ES cell is modified to comprise a targeted genetic
modification comprising a disruption of a target protein or domain
thereof thereby producing a modified mouse ES cell;
3. The method of claim 1, wherein the incoming nucleic acid is at
least 10 kb in size.
4. The method of claim 1, wherein the targeted genomic modification
comprises: deletion of a region of the genomic locus of interest
wherein the deletion is at least 20 kb; and/or insertion of the
insert nucleic acid at the genomic locus of interest wherein the
insertion is at least 20 kb.
5. The method of claim 2, wherein prior to performing step (a), the
mouse ES cell comprises a deletion of one or more mouse antibody
gene segments, antibody variable regions, or antibody constant
regions
6. The method of claim 2, wherein prior to performing step (a), the
mouse ES cell comprises an insertion of one or more human antibody
gene segments, antibody variable regions, or antibody constant
regions.
7. The method of claim 2, wherein prior to performing step (a), the
mouse ES cell comprises a deletion of one or more mouse antibody
gene segments, antibody variable regions, or antibody constant
regions and an insertion of one or more human antibody gene
segments, antibody variable regions, or antibody constant
regions.
8. The method of claim 1, further comprising isolating from the B
lymphocytes a nucleic acid encoding the antibody.
9. The method of claim 1, further comprising: (e) isolating from
the B lymphocytes a nucleic acid encoding the antibody.
10. The method of claim 9, further comprising: (f) exchanging the
heavy chain constant region nucleotide sequence of the nucleic acid
encoding the antibody with a nucleotide sequence encoding a human
heavy chain constant region; humanised heavy chain constant region;
or a non-naturally occurring human constant region.
11. The method of claim 9, further comprising a step of affinity
maturing the variable region of the antibody.
12. The method of claim 9, further comprising a step of inserting
the isolated nucleic acid into an expression vector or host.
13. The method of claim 1, wherein the antibody expressed by the B
lymphocytes is a IgG-type antibody.
14. The method of claim 1, wherein the method further comprises a
step of immortalizing the selected B lymphocytes of progeny thereof
after step (d).
15. The method of claim 1, wherein the method further comprises a
step of producing hybridomas from the selected B lymphocytes of
progeny thereof after step (d).
16. The method of claim 4, wherein the targeted genomic
modification comprises insertion of one or more of: a. one or more
human antibody heavy chain variable domains; b. one or more human
antibody kappa light chain variable domains; c. one or more human
antibody lambda light chain variable domains; and d. one or more
human Fc receptor protein or subunit or domain thereof.
17. The method of claim 4, wherein the targeted genomic
modification comprises deletion of one or more mouse antibody heavy
chain variable domains and insertion of one or more human antibody
heavy chain variable domains.
18. The method of claim 4, wherein the targeted genomic
modification comprises deletion of one or more mouse antibody kappa
light chain variable domains and insertion of one or more human
antibody kappa light chain variable domains.
19. The method of claim 4, wherein the targeted genomic
modification comprises deletion of one or more mouse antibody
lambda light chain variable domains and insertion of one or more
human antibody lambda light chain variable domains.
20. The method of claim 4, wherein the targeted genomic
modification comprises deletion of one or more mouse Fc receptor
protein or subunit or domain thereof and insertion of one or more
human Fc receptor protein or subunit or domain thereof.
21. The method of claim 4, wherein the targeted genomic
modification comprises insertion of one or more human antibody gene
segments, antibody variable regions, or antibody constant
regions.
22. The method of claim 4, wherein the targeted genomic
modification comprises deletion of one or more mouse antibody gene
segments, antibody variable regions, or antibody constant regions
and insertion of one or more human antibody gene segments, antibody
variable regions, or antibody constant regions.
23. The method of claim 1, wherein the targeted genomic
modification comprises a knock-out of a target protein or domain
thereof.
24. The method of claim 1, wherein step (a) comprises the use of at
least two CRISPR RNAs; each of which hybridizes to a CRISPR target
sequence at the same genomic locus of interest.
25. The method of claim 24, wherein an indel is created at the
genomic locus, wherein the indel results in a knock-out or
disruption of a target protein.
26. A pharmaceutical composition comprising an isolated antibody
produced by the method method of claim 1.
27. A nucleic acid produced by the method of claim 9.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application under 35
U.S.C. .sctn.120 of co-pending U.S. application Ser. No.
14/490,549, filed Sep. 18, 2014, which claims the benefit of Great
Britain application number 1321210.5, filed Dec. 2, 2013, and Great
Britain application number 1316560.0, filed Sep. 18, 2013, the
disclosures of which are herein incorporated by reference in their
entireties.
SEQUENCE LISTING
[0002] The content of the following submission on ASCII text file
is incorporated herein by reference in its entirety: a computer
readable form (CRF) of the Sequence Listing (file name:
Sequence_Listing_14490549. txt, created on Apr. 8, 2016, size:
27,892 bytes).
FIELD OF THE INVENTION
[0003] The inventors have devised an approach for introducing one
or more desired insertions and/or deletions of known sizes into one
or more predefined locations in a nucleic acid (eg, in a cell or
organism genome). They developed techniques to do this either in a
sequential fashion or by inserting a discrete DNA fragment of
defined size into the genome precisely in a predefined location or
carrying out a discrete deletion of a defined size at a precise
location. The technique is based on the observation that DNA
single-stranded breaks are preferentially repaired through the HDR
pathway, and this reduces the chances of indels (eg, produced by
NHEJ) in the present invention and thus is more efficient than
prior art techniques.
[0004] The inventors have also devised new techniques termed
sequential endonuclease-mediated homology directed recombination
(sEHDR) and sequential Cas-mediated homology directed recombination
(sCHDR).
BACKGROUND
[0005] Certain bacterial and archaea strains have been shown to
contain highly evolved adaptive immune defense systems, CRISPR/Cas
systems, which continually undergo reprogramming to direct
degradation of complementary sequences present within invading
viral or plasmid DNA. Short segments of foreign DNA, called
spacers, are incorporated into the genome between CRISPR repeats,
and serve as a `memory` of past exposures. CRISPR spacers are then
used to recognize and silence exogenous genetic elements in a
manner analogous to RNAi in eukaryotic organisms. The clustered
regularly interspaced short palindromic repeats (CRISPR) system
including the CRISPR associated (Cas) protein has been
reconstituted in vitro by a number of research groups allowing for
the DNA cleavage of almost any DNA template without the caveat of
searching for the right restriction enzyme cutter. The CRISPR/Cas
system also offers a blunt end cleavage creating a dsDNA or, using
mutated Cas versions, a selective single strand-specific cleavage
(see Cong et al, Wang et al & Mali et al cited below).
[0006] Through in vitro studies using Streptococcus pyogenes type
II CRISPR/Cas system it has been shown that the only components
required for efficient CRISPR/Cas-mediated target DNA or genome
modification are a Cas nuclease (eg, a Cas9 nuclease), CRISPR RNA
(crRNA) and trans-activating crRNA (tracrRNA). The wild-type
mechanism of CRISPR/Cas-mediated DNA cleavage occurs via several
steps. Transcription of the CRISPR array, containing small
fragments (20-30 base-pairs) of the encountered (or target) DNA,
into pre-crRNA, which undergoes maturation through the
hybridisation with tracrRNA via direct repeats of pre-crRNA. The
hybridisation of the pre-crRNA and tracrRNA, known as guide RNA
(gRNA or sgRNA), associates with the Cas nuclease forming a
ribonucleoprotein complex, which mediates conversion of pre-crRNA
into mature crRNA. Mature crRNA:tracrRNA duplex directs Cas9 to the
DNA target consisting of the protospacer and the requisite
protospacer adjacent motif (CRISPR/cas protospacer-adjacent motif;
PAM) via heteroduplex formation between the spacer region of the
crRNA and the protospacer DNA on the host genome. The Cas9 nuclease
mediates cleavage of the target DNA upstream of PAM to create a
double-stranded break within the protospacer or a strand-specific
nick using mutated Cas9 nuclease whereby one DNA strand-specific
cleavage motif is mutated (For example, Cas9 nickase contains a
D10A substitution) (Cong et al).
[0007] It is worth noting that different strains of Streptococcus
have been isolated which use PAM sequences that are different from
that used by Streptococcus pyogenes Cas9. The latter requires a NGG
PAM sequence. CRISPR/Cas systems (for example the Csy4
endoribonulcease in Pseudomonas aeroginosa (see Shah et al)) have
been described in other prokaryotic species, which recognise a
different PAM sequence (eg, CCN, TCN, TTC, AWG, CC, NNAGNN, NGG,
NGGNG). It is noteworthy that the Csy4 (also known as Cas6f) has no
sequence homology to Cas9 but the DNA cleavage occurs through a
similar mechanism involving the assembly of a Cas-protein-crRNA
complex that facilitates target DNA recognition leading to specific
DNA cleavage (Haurwitz et al).
[0008] In vitro-reconstituted type II CRISPR/Cas system has been
adapted and applied in a number of different settings. These
include creating selective gene disruption in single or multiple
genes in ES cells and also single or multiple gene disruption using
a one-step approach using zygotes to generate biallelic mutations
in mice. The speed, accuracy and the efficiency at which this
system could be applied to genome editing in addition to its
multiplexing capability makes this system vastly superior to its
predecessor genome editing technologies namely zinc finger
nucleases (ZFNs), transcription activator-like effector nucleases
(TALENs) and engineered homing meganucleases (Gaj et al &
Perez-Pinera et al). These have been successfully used in various
eukaryotic hosts but they all suffer from important limitations
notably off-target mutagenesis leading to nuclease-related toxicity
and also the time and cost of developing such engineered proteins.
The CRISPR/Cas system on the other hand is a superior genome
editing system by which mutations can be introduced with relative
ease simply by designing a single guided RNA complementary to the
protospacer sequence on the target DNA.
[0009] The dsDNA break induced by an endonuclease, such as Cas9, is
subsequently repaired through non-homologous end joining mechanism
(NHEJ) whereby the subsequent DNA repair at the breakpoint junction
is stitched together with different and unpredictable inserted or
deletions (indels) of varying size. This is highly undesirable when
precise nucleic acid or genome editing is required. However a
predefined precise mutation can be generated using homology
directed repair (HDR), eg, with the inclusion of a donor oligo or
donor DNA fragment. This approach with Cas9 nuclease has been shown
to generate precise predefined mutations but the efficiency at
which this occurs in both alleles is low and mutation is seen in
one of the strands of the dsDNA target (Wang et al).
[0010] The CRISPR/Cas system does therefore have some limitations
in its current form. While it may be possible to modify a desired
sequence in one strand of dsDNA, the sequence in the other strand
is often mutated through undesirable NHEJ.
SUMMARY OF THE INVENTION
[0011] A first configuration of the present invention
provides:--
[0012] A method of nucleic acid recombination, the method
comprising providing dsDNA comprising first and second strands and
[0013] (a) using nucleic acid cleavage to create 5' and 3' cut ends
in the first strand; [0014] (b) using homologous recombination to
insert a nucleotide sequence between the ends, thereby producing a
modified first strand; thereby producing DNA wherein the first
strand has been modified by said recombination but the second
strand has not been modified; and [0015] (c) optionally replicating
the modified first strand to produce a progeny dsDNA wherein each
strand thereof comprises a copy of the inserted nucleotide
sequence; and isolating the progeny dsDNA. A second configuration
of the present invention provides:-- [0016] A method of nucleic
acid recombination, the method comprising [0017] (a) using nucleic
acid cleavage to create 5' and 3' cut ends in a single nucleic acid
strand; [0018] (b) using homologous recombination to insert a
nucleotide sequence between the ends, wherein the insert sequence
comprises a regulatory element or encodes all or part of a protein;
and [0019] (c) optionally obtaining the nucleic acid strand
modified in step (b) or a progeny nucleic strand comprising the
inserted nucleotide sequence. A third configuration of the present
invention provides:--
[0020] A method of nucleic acid recombination, the method
comprising [0021] (a) using nucleic acid cleavage to create first
and second breaks in a nucleic acid strand, thereby creating 5' and
3' cut ends and a nucleotide sequence between the ends; [0022] (b)
using homologous recombination to delete the nucleotide sequence;
and [0023] (c) optionally obtaining the nucleic acid strand
modified in step (b) or a progeny nucleic strand comprising the
deletion.
[0024] In aspects of the configurations of the invention there is
provided a method of sequential endonuclease-mediated homology
directed recombination (sEHDR) comprising carrying out the method
of any preceding configuration a first time and carrying out the
method of any preceding configuration a second time. In this way,
the invention enables serial nucleic acid modifications, e.g.,
genome modifications, to be carried out, which may comprise precise
sequence deletions, insertions or combinations of these two or more
times. For example, it is possible to use this aspect of the
invention to "walk along" nucleic acids (e.g., chromosomes in
cells) to make relatively large and precise nucleotide sequence
deletions or insertions. In an embodiment, one or more Cas
endonucleases (e.g., a Cas9 and/or Cys4) are used in a method of
sequential Cas-mediated homology directed recombination
(sCHDR).
[0025] In another aspect, the invention can be described according
to the numbered sentences below:
1. A method of nucleic acid recombination, the method comprising
providing dsDNA comprising first and second strands and (a) using
nucleic acid cleavage to create 5' and 3' cut ends in the first
strand; (b) using homologous recombination to insert a nucleotide
sequence between the ends, thereby producing a modified first
strand; thereby producing DNA wherein the first strand has been
modified by said recombination but the second strand has not been
modified; and (c) optionally replicating the modified first strand
to produce a progeny dsDNA wherein each strand thereof comprises a
copy of the inserted nucleotide sequence; and isolating the progeny
dsDNA. 2. A method of nucleic acid recombination, the method
comprising (a) using nucleic acid cleavage to create 5' and 3' cut
ends in a single nucleic acid strand; (b) using homologous
recombination to insert a nucleotide sequence between the ends,
wherein the insert sequence comprises a regulatory element or
encodes all or part of a protein; and (c) optionally obtaining the
nucleic acid strand modified in step (b) or a progeny nucleic
strand comprising the inserted nucleotide sequence. 3. The method
of any preceding sentence, wherein the insert sequence replaces an
orthologous or homologous sequence of the strand. 4. The method of
any preceding sentence, wherein the insert nucleotide sequence is
at least 10 nucleotides long. 5. The method of any preceding
sentence, wherein the insert sequence comprises a site specific
recombination site. 6. A method of nucleic acid recombination, the
method comprising (a) using nucleic acid cleavage to create first
and second breaks in a nucleic acid strand, thereby creating 5' and
3' cut ends and a nucleotide sequence between the ends; (b) using
homologous recombination to delete the nucleotide sequence; and (c)
optionally obtaining the nucleic acid strand modified in step (b)
or a progeny nucleic strand comprising the deletion. 7. The method
of sentence 6, wherein the deleted sequence comprises a regulatory
element or encodes all or part of a protein. 8. The method of any
preceding sentence, wherein step (c) is performed by isolating a
cell comprising the modified first strand, or by obtaining a
non-human vertebrate in which the method has been performed or a
progeny thereof. 9. The method of any preceding sentence, wherein
the nucleic acid strand or the first strand is a DNA strand. 10.
The method of any preceding sentence wherein the product of the
method comprises a nucleic acid strand comprising a PAM motif 3' of
the insertion or deletion. 11. The method of any preceding
sentence, wherein step (b) is performed by carrying out homologous
recombination between an incoming nucleic acid comprising first and
second homology arms, wherein the homology arms are substantially
homologous respectively to a sequence extending 5' from the 5' end
and a sequence extending 3' from the 3' end. 12. The method of
sentence 11, wherein step (b) is performed by carrying out
homologous recombination between an incoming nucleic acid
comprising an insert nucleotide sequence flanked by the first and
second homology arms, wherein the insert nucleotide sequence is
inserted between the 5' and 3' ends. 13. The method of sentence 12,
wherein the insert is as recited in any one of sentences 3 to 5 and
there is no further sequence between the homology arms. 14. The
method of any one of sentences 11 to 13, wherein each homology arm
is at least 20 contiguous nucleotides long. 15. The method of any
one of sentences 11 to 14, wherein the first and/or second homology
arm comprises a PAM motif. 16. The method of any preceding
sentence, wherein Cas endonuclease-mediated cleavage is used in
step (a); optionally by recognition of a GG or NGG PAM motif. 17.
The method of sentence 16, wherein a nickase is used to cut in step
(a). 18. The method of any preceding sentence, wherein the method
is carried out in a cell, e.g., a eukaryotic cell. 19. The method
of sentence 19, wherein the method is carried out in a mammalian
cell. 20. The method of sentence 19, wherein the cell is a rodent
(e.g., mouse) ES cell or zygote. 21. The method of any preceding
sentence, wherein the method is carried out in a non-human mammal,
e.g., a mouse or rat or rabbit. 22. The method of any preceding
sentence, wherein each cleavage site is flanked by PAM motif (e.g.,
a NGG or NGGNG sequence, wherein N is any base and G is a guanine).
23. The method of any preceding sentence, wherein the 3' end is
flanked 3' by a PAM motif. 24. The method of any preceding
sentence, wherein step (a) is carried out by cleavage in one single
strand of dsDNA. 25. The method of any preceding sentence, wherein
step (a) is carried out by combining in a cell the nucleic acid
strand, a Cas endonuclease, a crRNA and a tracrRNA (e.g., provided
by one or more gRNAs) for targeting the endonuclease to carry out
the cleavage, and optionally an insert sequence for homologous
recombination with the nucleic acid strand. 26. The method of any
preceding sentence, wherein step (b) is performed by carrying out
homologous recombination with an incoming nucleic acid comprising
first and second homology arms, wherein the homology arms are
substantially homologous respectively to a sequence extending 5'
from the 5' end and a sequence extending 3' from the 3' end,
wherein the second homology arm comprises a PAM sequence such that
homologous recombination between the second homology arm and the
sequence extending 3' from the 3' end produces a sequence
comprising a PAM motif in the product of the method. 27. A method
of sequential endonuclease-mediated homology directed recombination
(sEHDR) comprising carrying out the method of any preceding
sentence (e.g., when according to sentence 1 using a nickase to cut
a single strand of dsDNA; or when dependent from sentence 2 or 5
using a nuclease to cut both strands of dsDNA) a first time and a
second time, wherein endonuclease-mediated cleavage is used in each
step (a); wherein the product of the first time is used for
endonuclease-mediated cleavage the second time, whereby either (i)
first and second nucleotide sequences are deleted the first time
and the second times respectively; (ii) a first nucleotide sequence
is deleted the first time and a second nucleotide sequence is
inserted the second time; (iii) a first nucleotide sequence is
inserted the first time and a second nucleotide sequence is deleted
the second time; or (iv) first and second nucleotide sequences are
inserted the first and second times respectively; optionally
wherein the nucleic acid strand modification the second time is
within 20 or less nucleotides of the nucleic acid strand
modification the first time. 28. The method of sentence 27, wherein
the first time is carried out according to sentence 6, wherein the
incoming nucleic acid comprises no sequence between the first and
second homology arms, wherein sequence between the 5' and 3' ends
is deleted by homologous recombination; and/or the second time is
carried out according to sentence 6, wherein step (b) is performed
by carrying out homologous recombination between an incoming
nucleic acid comprising first and second homology arms, wherein the
homology arms are substantially homologous respectively to a
sequence extending 5' from the 5' end and a sequence extending 3'
from the 3' end, wherein the incoming nucleic acid comprises no
sequence between the first and second homology arms such that
sequence between the 5' and 3' ends is deleted by homologous
recombination; optionally wherein the second arm comprises a PAM
motif such that the product of the second time comprises a PAM
motif for use in a subsequent Cas endonuclease-mediated method
according to any one of sentences 1 to 26. 29. The method of
sentence 27, wherein the first time is carried out according to
sentence 1 or 2, wherein the incoming nucleic acid comprises the
insert sequence between the first and second homology arms, wherein
the insert sequence is inserted between the 5' and 3' ends by
homologous recombination; and/or the second time is carried out
according to sentence 1 or 2, wherein step (b) is performed by
carrying out homologous recombination between an incoming nucleic
acid comprising first and second homology arms, wherein the
homology arms are substantially homologous respectively to a
sequence extending 5' from the 5' end and a sequence extending 3'
from the 3' end, wherein the insert sequence is inserted between
the 5' and 3' ends by homologous recombination; optionally wherein
the second arm comprises a PAM motif such that the product of the
second time comprises a PAM motif for use in a subsequent Cas
endonuclease-mediated method according to any one of sentences 1 to
26. 30. The method of sentence 27, wherein one of said first and
second times is carried out as specified in sentence 28 and the
other time is carried out as specified in sentence 29, wherein at
least one sequence deletion and at least one sequence insertion is
performed. 31. The method of any preceding sentence, wherein step
(a) is carried out using Cas endonuclease-mediated cleavage and a
gRNA comprising a crRNA and a tracrRNA. 32. The method of sentence
25 or 31, wherein the crRNA has the structure 5'-X-Y-3', wherein X
is an RNA nucleotide sequence (optionally at least 5 nucleotides
long) and Y is a crRNA sequence comprising a nucleotide motif that
hybridises with a motif comprised by the tracrRNA, wherein X is
capable of hybridising with a nucleotide sequence extending 5' from
the desired site of the 5' cut end. 33. The method of sentence 25,
31 or 32, wherein Y is 5'-N1UUUUAN2N3GCUA-3' (SEQ ID NO: 3),
wherein each of N1-3 is a A, U, C or G and/or the tracrRNA
comprises the sequence (in 5' to 3' orientation) UAGCM1UUAAAAM2
(SEQ ID NO: 4), wherein M1 is spacer nucleotide sequence and M2 is
a nucleotide. 34. A method of producing a cell or a transgenic
non-human organism, the method comprising (a) carrying out the
method of any preceding sentence to (i) knock out a target
nucleotide sequence in the genome of a first cell and/or (ii) knock
in an insert nucleotide sequence into the genome of a first cell,
optionally wherein the insert sequence replaces a target sequence
in whole or in part at the endogenous location of the target
sequence in the genome; wherein the cell or a progeny thereof can
develop into a non-human organism or cell; and (b) developing the
cell or progeny into a non-human organism or a non-human cell. 35.
The method of sentence 34, wherein the organism or cell is
homozygous for the modification (i) and/or (ii). 36. The method of
sentence 34 or 35, wherein the cell is an ES cell, iPS cell,
totipotent cell or pluripotent cell. 37. The method of any one of
sentences 34 to 36, wherein the cell is a rodent (e.g., a mouse or
rat) cell. 38. The method of any one of sentences 34 to 37, wherein
the target sequence is an endogenous sequence comprising all or
part of a regulatory element or encoding all or part of a protein.
39. The method of any one of sentences 34 to 38, wherein the insert
sequence is a synthetic sequence; or comprises a sequence encoding
all or part of a protein from a species other than the species from
which the first cell is derived; or comprises a regulatory element
from said first species. 40. The method of sentence 39, wherein the
insert sequence encodes all or part of a human protein or a human
protein subunit or domain. 41. A cell or a non-human organism whose
genome comprises a modification comprising a non-endogenous
nucleotide sequence flanked by endogenous nucleotide sequences,
wherein the cell or organism is obtainable by the method of any one
of sentences 24 to 40 and wherein the non-endogenous sequence is
flanked 3' by a Cas PAM motif; wherein the cell is not comprised by
a human; and one, more or all of (a) to (d) applies (a) the genome
is homozygous for the modification; or comprises the modification
at one allele and is unmodified by Cas-mediated homologous
recombination at the other allele; (b) the non-endogenous sequence
comprises all or part of a regulatory element or encodes all or
part of a protein; (c) the non-endogenous sequence is at least 20
nucleotides long; (d) the non-endogenous sequence replaces an
orthologous or homologous sequence in the genome. 42. The cell or
organism of sentence 41, wherein the non-endogenous sequence is a
human sequence. 43. The cell or organism of sentence 41 or 42,
wherein the PAM motif comprises a sequence selected from CCN, TCN,
TTC, AWG, CC, NNAGNN, NGGNG GG, NGG, WGG, CWT, CTT and GAA. 44. The
cell or organism of any one of sentences 41 to 43, wherein there is
a PAM motif no more than 10 nucleotides (e.g., 3 nucleotides) 3' of
the non-endogenous sequence. 45. The cell or organism of any one of
sentences 41 to 44, wherein the PAM motif is recognised by a
Streptococcus Cas9. 46. The cell or organism of any one of claims
41 to 45, which is a non-human vertebrate cell or a non-human
vertebrate that expresses one or more human antibody heavy chain
variable domains (and optionally no heavy chain variable domains of
a non-human vertebrate species). 47. The cell or organism of any
one of sentences 41 to 46, which is a non-human vertebrate cell or
a non-human vertebrate that expresses one or more human antibody
kappa light chain variable domains (and optionally no kappa light
chain variable domains of a non-human vertebrate species). 48. The
cell or organism of any one of sentences 41 to 47, which is a
non-human vertebrate cell or a non-human vertebrate that expresses
one or more human antibody lambda light chain variable domains (and
optionally no kappa light chain variable domains of a non-human
vertebrate species). 49. The cell or organism of any one of
sentences 46 to 48, wherein the non-endogenous sequence encodes a
human Fc receptor protein or subunit or domain thereof (e.g., a
human FcRn or FcY receptor protein, subunit or domain). 50. The
cell or organism of any one of sentences 41 to 48, wherein the
non-endogenous sequence comprises one or more human antibody gene
segments, an antibody variable region or an antibody constant
region. 51. The cell or organism of any one of sentences 41 to 50,
wherein the insert sequence is a human sequence that replaces or
supplements an orthologous non-human sequence. 52. A monoclonal or
polyclonal antibody prepared by immunisation of a vertebrate (e.g.,
mouse or rat) according to any one of sentences 41 to 51 with an
antigen. 53. A method of isolating an antibody that binds a
predetermined antigen, the method comprising (a) providing a
vertebrate (optionally a mouse or rat) according to any one of
sentences 41 to 51; (b) immunising said vertebrate with said
antigen; (c) removing B lymphocytes from the vertebrate and
selecting one or more B lymphocytes expressing antibodies that bind
to the antigen; (d) optionally immortalising said selected B
lymphocytes or progeny thereof, optionally by producing hybridomas
therefrom; and (e) isolating an antibody (e.g., and IgG-type
antibody) expressed by the B lymphocytes. 54. The method of
sentence 53, comprising the step of isolating from said B
lymphocytes nucleic acid encoding said antibody that binds said
antigen; optionally exchanging the heavy chain constant region
nucleotide sequence of the antibody with a nucleotide sequence
encoding a human or humanised heavy chain constant region and
optionally affinity maturing the variable region of said antibody;
and optionally inserting said nucleic acid into an expression
vector and optionally a host. 55. The method of sentence 53 or 54,
further comprising making a mutant or derivative of the antibody
produced by the method of sentence 53 or 54. 56. The use of an
isolated, monoclonal or polyclonal antibody according to sentence
52, or a mutant or derivative antibody thereof that binds said
antigen, in the manufacture of a composition for use as a
medicament. 57. The use of an isolated, monoclonal or polyclonal
antibody according to sentence 52, or a mutant or derivative
antibody thereof that binds said antigen for use in medicine. 58. A
nucleotide sequence encoding an antibody of sentence 52, optionally
wherein the nucleotide sequence is part of a vector. 59. A
pharmaceutical composition comprising the antibody or antibodies of
sentence 52 and a diluent, excipient or carrier. 60. An ES cell, a
eukaryotic cell, a mammalian cell, a non-human animal or a
non-human blastocyst comprising an expressible
genomically-integrated nucleotide sequence encoding a Cas
endonuclease. 61. The cell, animal or blastocyst of sentence 60,
wherein the endonuclease sequence is constitutively expressible.
62. The cell, animal or blastocyst of sentence 60, wherein the
endonuclease sequence is inducibly expressible. 63. The cell,
animal or blastocyst of sentence 60, 61 or 62, wherein the
endonuclease sequence is expressible in a tissue-specific or
stage-specific manner in the animal or a progeny thereof, or in a
non-human animal that is a progeny of the cell or blastocyst. 64.
The cell or animal of sentence 63, wherein the cell is a non-human
embryo cell or the animal is a non-human embryo, wherein the
endonuclease sequence is expressible or expressed in the cell or
embryo. 65. The cell of animal sentence 64, wherein the
endonuclease is operatively linked to a promoter selected from the
group consisting of an embryo-specific promoter (e.g., a Nanog
promoter, a Pou5fl promoter or a SoxB promoter). 66. The cell,
animal or blastocyst of any one of sentences 60 to 65, wherein the
Cas endonuclease is at a Rosa 26 locus. 67. The cell, animal or
blastocyst of any one of sentences 60 to 65, wherein the Cas
endonuclease is operably linked to a Rosa 26 promoter. 68. The
cell, animal or blastocyst of any one of sentences 60 to 63,
wherein the Cas endonuclease sequence is flanked 5' and 3' by
transposon elements (e.g., inverted piggyBac terminal elements) or
site-specific recombination sites (e.g., loxP and/or a mutant lox,
e.g., lox2272 or lox511; or frt). 69. The cell, animal or
blastocyst of sentence 68, comprising one or more restriction
endonuclease sites between the Cas endonuclease sequence and a
transposon element. 70. The cell, animal or blastocyst of any one
of sentences 60 to 69 comprising one or more gRNAs. 71. The cell,
animal or blastocyst of sentence 68, 69 or 70, wherein the gRNA(s)
are flanked 5' and 3' by transposon elements (e.g., inverted
piggyBac terminal elements) or site-specific recombination sites
(e.g., loxP and/or a mutant lox, e.g., lox2272 or lox511; or frt).
72. Use of the cell, animal or blastocyst of any one of sentences
60 to 71 in a method according to any one of sentences 1 to 51.
BRIEF DESCRIPTION OF THE FIGURES
[0026] FIG. 1 depicts a schematic of precise DNA Insertion in a
Predefined Location (KI). gRNA designed against a predefined
location can induce DNA nick using Cas9 D10A nickase 5' of the PAM
sequence (shown as solid black box). Alternatively, gRNA can be
used together with Cas9 wild-type nuclease to induce
double-stranded DNA breaks 5' of the PAM sequence. The addition of
a donor oligo or a donor DNA fragment (single or double stranded)
with homology around the breakpoint region containing any form of
DNA alterations including addition of endogenous or exogenous DNA
can be precisely inserted at the breakpoint junction where the DNA
is repaired through HDR.
[0027] FIG. 2 depicts a schematic of precise DNA Deletion (KO).
gRNAs targeting flanking region of interest can induce two DNA
nicks using Cas9 D10A nickase in predefine locations containing the
desired PAM sequences (shown as solid black box). Alternatively,
gRNAs can be used with Cas9 wild-type nuclease to induce two DSB
flanking the region of interest. Addition of a donor oligo or a
donor DNA fragment (single or double stranded) with homology to
region 5' of PAM 1 and 3' of PAM 2 sequence will guide DNA repair
in a precise manner via HDR. DNA repair via HDR will reduce the
risk of indel formation at the breakpoint junctions and avoid DNA
repair through NHEJ and in doing so, it will delete out the region
flanked by the PAM sequence and carry out DNA repair in a
pre-determined and pre-defined manner.
[0028] FIG. 3 depicts precise DNA Deletion and Insertion
(KO.fwdarw.KI). gRNAs targeting flanking region of interest can
induce two DNA nicks using Cas9 D10A nickase in predefine locations
containing the desired PAM sequences (shown as solid black box).
Alternatively, gRNAs can be used with Cas9 wild-type nuclease to
induce two DSB flanking the region of interest. Addition of a donor
oligo or a donor DNA fragment (single or double stranded) with
homology to region 5' of PAM 1 and 3' to PAM 2 with inclusion of
additional endogenous or exogenous DNA, will guide DNA repair in a
precise manner via HDR with the concomitant deletion of the region
flanked by DSB or nick and the insertion of DNA of interest.
[0029] FIG. 4 depicts a sechematic of recycling PAM For Sequential
Genome Editing (Deletions). gRNAs targeting flanking region of
interest can induce two DNA nicks using Cas9 D10A nickase in
predefine locations containing the desired PAM sequences (shown as
solid black box). Alternatively, gRNAs can be used with Cas9
wild-type nuclease to induce two DSB flanking the region of
interest. Addition of a donor oligo or a donor DNA fragment (single
or double stranded) with homology to region 5' of PAM 2 and 3' of
PAM 3 will guide DNA repair in a precise manner via HDR and in
doing so, it will delete out the region between PAM 2 and PAM 3.
This deletion will retain PAM 3 and thus acts as a site for
carrying out another round of CRISPR/Cas mediated genome editing.
Another PAM site (e.g., PAM 1) can be used in conjunction with PAM
3 sequence to carry out another round of deletion as described
above. Using this PAM recycling approach, many rounds of deletions
can be performed in a stepwise deletion fashion, where PAM 3 is
recycled after each round. This approach can be used also for the
stepwise addition of endogenous or exogenous DNA.
[0030] FIG. 5 depicts CRISPR/Cas mediated Lox Insertion to
facilitate RMCE. gRNAs targeting flanking region of interest can
induce two DNA nicks using Cas9 D10A nickase in predefine locations
containing the desired PAM sequences (shown as solid black box).
Alternatively, gRNAs can be used with Cas9 wild-type nuclease to
induce two DSB flanking the region of interest. Addition of two
donor oligos or donor DNA fragments (single or double stranded)
with homology to regions 5' and 3' of each PAM sequence where the
donor DNA contains recombinase recognition sequence (RRS) such as
loxP and lox5171 will guide DNA repair in a precise manner via HDR
with the inclusion of these RRS. The introduced RRS can be used as
a landing pad for inserting any DNA of interest with high
efficiency and precisely using recombinase mediated cassette
exchange (RMCE). The retained PAM 2 site can be recycled for
another round of CRISPR/Cas mediated genome editing for deleting or
inserting DNA of interest. Note, the inserted DNA of interest could
contain selection marker such as PGK-Puro flanked by PiggyBac LTR
to allow for the initial selection and upon successful integration
into DNA of interest, the selection marker can be removed
conveniently by expressing hyperPbase transposase.
[0031] FIG. 6 depicts a schematic of genome modification to produce
transposon-excisable Cas9 and gRNA.
[0032] FIG. 7 depicts a schematic of genome modification to produce
transposon-excisable Cas9 and gRNA
DETAILED DESCRIPTION OF THE INVENTION
[0033] The inventors addressed the need for improved nucleic acid
modification techniques. An example of a technique for nucleic acid
modification is the application of the CRISPR/Cas system. This
system has been shown thus far to be the most advanced genome
editing system available due, inter alia, to its broad application,
the relative speed at which genomes can be edited to create
mutations and its ease of use. The inventors, however, believed
that this technology can be advanced for even broader applications
than are apparent from the state of the art.
[0034] The inventors realised that an important aspect to achieve
this would be to find a way of improving the fidelity of nucleic
acid modifications beyond that contemplated by the CRISPR/Cas
methods known in the art.
[0035] Additionally, the inventors realised that only modest
nucleic acid modifications had been reported to date. It would be
desirable to effect relatively large predefined and precise DNA
deletions or insertions using the CRISPR/Cas system.
[0036] The inventors have devised an approach for introducing one
or more desired insertions and/or deletions of known sizes into one
or more predefined locations in a nucleic acid (eg, in a cell or
organism genome). They developed techniques to do this either in a
sequential fashion or by inserting a discrete DNA fragment of
defined size into the genome precisely in a predefined location or
carrying out a discrete deletion of a defined size at a precise
location. The technique is based on the observation that DNA
single-stranded breaks are preferentially repaired through the HDR
pathway, and this reduces the chances of indels (eg, produced by
NHEJ) in the present invention and thus is more efficient than
prior art techniques.
[0037] To this end, the invention provides:--
[0038] A method of nucleic acid recombination, the method
comprising providing double stranded DNA (dsDNA) comprising first
and second strands and
(a) using nucleic acid cleavage to create 5' and 3' cut ends in the
first strand; and (b) using homologous recombination to insert a
nucleotide sequence between the ends, thereby producing a modified
first strand; thereby producing DNA wherein the first strand has
been modified by said recombination but the second strand has not
been modified.
[0039] Optionally the method further comprises replicating the
modified first strand to produce a progeny dsDNA wherein each
strand thereof comprises a copy of the insert nucleotide sequence.
Optionally the method comprises (c) isolating the progeny dsDNA,
eg, by obtaining a cell containing said progeny dsDNA. Replication
can be effected, for example in a cell. For example, steps (a) and
(b) are carried out in a cell and the cell is replicated, wherein
the machinery of the cell replicates the modified first strand, eg,
to produce a dsDNA progeny in which each strand comprises the
modification.
[0040] Optionally, in any configuration, aspect, example or
embodiment of the invention, the modified DNA strand resulting from
step (b) is isolated.
[0041] Optionally, in any configuration, aspect, example or
embodiment of the invention, the method is carried out in vitro.
For example, the method is carried out in a cell or cell population
in vitro.
[0042] Alternatively, optionally, in any configuration, aspect,
example or embodiment of the invention, the method is carried out
to modify the genome of a virus.
[0043] Alternatively, optionally, in any configuration, aspect,
example or embodiment of the invention, the method is carried out
in vivo in an organism. In an example, the organism is a non-human
organism. In an example it is a plant or an animal or an insect or
a bacterium or a yeast. For example, the method is practised on a
vertebrate (eg, a human patient or a non-human vertebrate (e.g., a
bird, e.g., a chicken) or non-human mammal such as a mouse, a rat
or a rabbit). Optionally, in any configuration, aspect, example or
embodiment of the invention, the method is a method of cosmetic
treatment of a human or a non-therapeutic, non-surgical,
non-diagnostic method, e.g, practised on a human or a non-human
vertebrate or mammal (e.g., a mouse or a rat).
[0044] The invention also provides:
[0045] A method of nucleic acid recombination, the method
comprising
(a) using nucleic acid cleavage to create 5' and 3' cut ends in a
single nucleic acid strand; (b) using homologous recombination to
insert a nucleotide sequence between the ends, wherein the insert
sequence comprises a regulatory element or encodes all or part of a
protein; and (c) Optionally obtaining the nucleic acid strand
modified in step (b) or a progeny nucleic strand comprising the
inserted nucleotide sequence, eg, by obtaining a cell containing
said progeny nucleic acid strand.
[0046] In an example the progeny strand is a product of the
replication of the strand produced by step (b). The progeny strand
is, for example, produced by nucleic acid replication in a cell.
For example, steps (a) and (b) are carried out in a cell and the
cell is replicated, wherein the machinery of the cell replicates
the modified strand produced in step (b), e.g, to produce a dsDNA
progeny in which each strand comprises the modification.
[0047] In an example, the single nucleic acid strand is a DNA or
RNA strand.
[0048] In an example, the regulatory element is a promoter or
enhancer.
[0049] Optionally, in any configuration, aspect, example or
embodiment of the invention, the inserted nucleotide sequence is a
plant, animal, vertebrate or mammalian sequence, e.g., a human
sequence. For example, the sequence encodes a complete protein,
polypeptide, peptide, domain or a plurality of any one of these. In
an example, the inserted sequence confers a resistance property to
a cell comprising the modified nucleic acid produced by the method
of the invention (e.g., herbicide, viral or bacterial resistance).
In an example, the inserted sequence encodes an interleukin,
receptor (e.g., a cell surface receptor), growth factor, hormone,
antibody (or variable domain or binding site thereof), antagonist,
agonist; eg, a human version of any of these. In an example, the
inserted sequence is an exon.
[0050] Optionally, in any configuration, aspect, example or
embodiment of the invention, the inserted nucleotide sequence
replaces an orthologous or homologous sequence of the strand (e.g,
the insert is a human sequence that replaces a plant, human or
mouse sequence). For example, the method is carried out in a mouse
or mouse cell and the insert replaces an orthologous or homologous
mouse sequence (e.g., a mouse biological target protein implicated
in disease). For example, the method is carried out (e.g., in
vitro) in a human cell and the insert replaces an orthologous or
homologous human sequence (e.g., a human biological target protein
implicated in disease, e.g., a mutated form of a sequence is
replaced with a different (e.g., wild-type) human sequence, which
may be useful for correcting a gene defect in the cell. In this
embodiment, the cell may be a human ES or iPS or totipotent or
pluripotent stem cell and may be subsequently introduced into a
human patient in a method of gene therapy to treat and/or prevent a
medical disease or condition in the patient).
[0051] Optionally, in any configuration, aspect, example or
embodiment of the invention, the inserted nucleotide sequence is at
least 10 nucleotides long, eg, at least 20, 30, 40, 50, 60, 70, 80,
90, 100, 150, 200, 300, 400, 500, 600, 700, 800 or 900 nucleotides,
or at least 1, 2, 3, 5, 10, 20, 50 or 100 kb long.
[0052] Optionally, in any configuration, aspect, example or
embodiment of the invention, the insert sequence comprises a site
specific recombination site, eg, a lox, frt or rox site. For
example, the site can be a loxP, lox511 or lox2272 site.
[0053] The invention also provides:--
[0054] A method of nucleic acid recombination, the method
comprising
(a) using nucleic acid cleavage to create first and second breaks
in a nucleic acid strand, thereby creating 5' and 3' cut ends and a
nucleotide sequence between the ends; (b) using homologous
recombination to delete the nucleotide sequence; and (c) optionally
obtaining the nucleic acid strand modified in step (b) or a progeny
nucleic strand comprising the deletion.
[0055] In an example the progeny strand is a product of the
replication of the strand produced by step (b). The progeny strand
is, for example, produced by nucleic acid replication in a cell.
For example, steps (a) and (b) are carried out in a cell and the
cell is replicated, wherein the machinery of the cell replicates
the modified strand produced in step (b), eg, to produce a dsDNA
progeny in which each strand comprises the modification.
[0056] In an example, the single nucleic acid strand is a DNA or
RNA strand.
[0057] In an example, the deleted sequence comprises a regulatory
element or encodes all or part of a protein. In an embodiment, the
deleted regulatory element is a promoter or enhancer.
[0058] Optionally, in any configuration, aspect, example or
embodiment of the invention, the deleted nucleotide sequence is a
plant, animal, vertebrate or mammalian sequence, e.g., a human
sequence. For example, the sequence encodes a complete protein,
polypeptide, peptide, domain or a plurality of any one of these. In
an example, the deleted sequence encodes an interleukin, receptor
(e.g., a cell surface receptor), growth factor, hormone, antibody
(or variable domain or binding site thereof), antagonist, agonist;
e.g., a non-human version of any of these. In an example, the
deleted sequence is an exon.
[0059] Optionally, in any configuration, aspect, example or
embodiment of the invention, the deleted nucleotide sequence is
replaced by an orthologous or homologous sequence of a different
species or strain (e.g., a human sequence replaces an orthologous
or homologous plant, human or mouse sequence). For example, the
method is carried out in a mouse or mouse cell and the insert
replaces an orthologous or homologous mouse sequence (e.g., a mouse
biological target protein implicated in disease). For example, the
method is carried out (e.g., in vitro) in a human cell and the
insert replaces an orthologous or homologous human sequence (e.g.,
a human biological target protein implicated in disease, e.g., a
mutated form of a sequence is replaced with a different (e.g.,
wild-type) human sequence, which may be useful for correcting a
gene defect in the cell. In this embodiment, the cell may be a
human ES or iPS or totipotent or pluripotent stem cell and may be
subsequently introduced into a human patient in a method of gene
therapy to treat and/or prevent a medical disease or condition in
the patient).
[0060] Optionally, in any configuration, aspect, example or
embodiment of the invention, the deleted nucleotide sequence is at
least 10 nucleotides long, eg, at least 20, 30, 40, 50, 60, 70, 80,
90, 100, 150, 200, 300, 400, 500, 600, 700, 800 or 900 nucleotides,
or at least 1, 2, 3, 5, 10, 20, 50 or 100 kb long.
[0061] Optionally, in any configuration, aspect, example or
embodiment of the invention, step (c) is performed by isolating a
cell comprising the modified first strand, or by obtaining a
non-human vertebrate in which the method has been performed or a
progeny thereof.
[0062] Optionally, in any configuration, aspect, example or
embodiment of the invention, the product of the method comprises a
nucleic acid strand comprising a PAM motif 3' of the insertion or
deletion. In an example, the PAM motif is within 10, 9, 8, 7 6, 5,
4 or 3 nucleotides of the insertion or deletion. This is useful to
enable serial insertions and/or deletions according to the method
as explained further below.
[0063] Optionally, in any configuration, aspect, example or
embodiment of the invention, the product of the method comprises a
nucleic acid strand comprising a PAM motif 5' of the insertion or
deletion. In an example, the PAM motif is within 10, 9, 8, 7 6, 5,
4 or 3 nucleotides of the insertion or deletion. This is useful to
enable serial insertions and/or deletions according to the method
as explained further below.
[0064] Optionally, in any configuration, aspect, example or
embodiment of the invention, step (b) is performed by carrying out
homologous recombination between an incoming nucleic acid
comprising first and second homology arms, wherein the homology
arms are substantially homologous respectively to a sequence
extending 5' from the 5' end and a sequence extending 3' from the
3' end. The skilled person will be familiar with constructing
vectors and DNA molecules for use in homologous recombination,
including considerations such as homology arm size and sequence and
the inclusion of selection markers between the arms. For example,
the incoming nucleic acid comprises first and second homology arms,
and the insert sequence and an optional selection marker sequence
(e.g., neo nucleotide sequence). The arms may be at least 20, 30,
40, 50, 100 or 150 nucleotides in length, for example. Where
deletion is required, the insert is omitted (although an optional
selection marker sequence may or may not be included between the
arms).
[0065] Thus, in an embodiment of the invention, step (b) is
performed by carrying out homologous recombination between an
incoming nucleic acid comprising an insert nucleotide sequence
flanked by the first and second homology arms, wherein the insert
nucleotide sequence is inserted between the 5' and 3' ends.
[0066] In another embodiment of the invention, the insert is
between the homology arms and there is no further sequence between
the arms.
[0067] In an example, each homology arm is at least 20, 30, 40, 50,
100 or 150 nucleotides long.
[0068] Optionally, in any configuration, aspect, example or
embodiment of the invention, step (a) is carried out using an
endonuclease, eg, a nickase. Nickases cut in a single strand of
dsDNA only. For example, the endonuclease is an endonuclease of a
CRISPR/Cas system, eg, a Cas9 or Cys4 endnonuclease (e.g., a Cas9
or Cys4 nickase). In an example, the endounuclease recognises a PAM
listed in Table 1 below, for example, the endonuclease is a Cas
endonuclease that recognises a PAM selected from CCN, TCN, TTC,
AWG, CC, NNAGNN, NGGNG GG, NGG, WGG, CWT, CTT and GAA. In an
example, the Cas endonuclease is a S pyogenes endonuclease, e.g., a
S pyogenes Cas9 endonuclease. In an example, a S. pyogenes PAM
sequence or Streptococcus thermophilus LMD-9 PAM sequence is
used.
[0069] In an example, the endonuclease is a Group 1 Cas
endonuclease. In an example, the endonuclease is a Group 2 Cas
endonuclease. In an example, the endonuclease is a Group 3 Cas
endonuclease. In an example, the endonuclease is a Group 4 Cas
endonuclease. In an example, the endonuclease is a Group 7 Cas
endonuclease. In an example, the endonuclease is a Group 10 Cas
endonuclease.
[0070] In an example, the endonuclease recognises a CRISPR/Cas
Group 1 PAM. In an example, the endonuclease recognises a
CRISPR/Cas Group 2 PAM. In an example, the endonuclease recognises
a CRISPR/Cas Group 3 PAM. In an example, the endonuclease
recognises a CRISPR/Cas Group 4 PAM. In an example, the
endonuclease recognises a CRISPR/Cas Group 7 PAM. In an example,
the endonuclease recognises a CRISPR/Cas Group 10 PAM.
[0071] In an example, Cas endonuclease-mediated cleavage is used in
step (a); optionally by recognition of a GG or NGG PAM motif.
[0072] In an example, the first and/or second homology arm
comprises a PAM motif. This is useful to enable serial insertions
and/or deletions according to the method as explained further
below.
[0073] An example of a suitable nickase is S pyogenes Cas9 D10A
nickase (see Cong et al and the Examples section below).
[0074] Optionally, in any configuration, aspect, example or
embodiment of the invention, steps (a) and (b) of the method is
carried out in a cell, eg a bacterial, yeast, eukaryotic cell,
plant, animal, mammal, vertebrate, non-human animal, rodent, rat,
mouse, rabbit, fish, bird or chicken cell. For example, the cell is
an E. coli cell or CHO or HEK293 or Picchia or Saccharomyces cell.
In an example, the cell is a human cell in vitro. In one
embodiment, the cell is an embryonic stem cell (ES cell, e.g., a
human or non-human ES cell) or an induced pluripotent stem cell
(iPS cell; e.g., a human, rodent, rat or mouse iPS cell) or a
pluripotent or totipotent cell. Optionally the cell is not an
embryonic cell, e.g., wherein the cell is not a human embryonic
cell. Optionally the cell is not a pluripotent or totipotent cell.
In an example, the method is used to produce a human stem cell for
human therapy (e.g., an iPS cell generated from a cell of a patient
for reintroduction into the patient after the method of the
invention has been performed on the cell), wherein the stem cell
comprises a nucleotide sequence or gene sequence inserted by the
method of the invention. The features of the examples in this
paragraph can be combined.
[0075] In an example, the method is carried out in a mammalian
cell. For example, the cell is a human cell in vitro or a non-human
mammalian cell. For example, a non-human (e.g., rodent, rat or
mouse) zygote. For example, a single-cell non-human zygote.
[0076] In an example, the method is carried out in a plant or
non-human mammal, e.g. a rodent, mouse or rat or rabbit, or a
tissue or organ thereof (eg, in vitro).
[0077] In an example, the 3' or each cleavage site is flanked 3' by
PAM motif (eg, a motif disclosed herein, such as NGG or NGGNG
sequence, wherein N is any base and G is a guanine). For example,
one or more or all cleavage sites are flanked 3' by the sequence
5'-TGGTG-3'. Unlike dsDNA, the PAM is not absolutely required for
ssDNA binding and cleavage: A single-stranded oligodeoxynucleotide
containing a protospacer with or without a PAM sequence is bound
nearly as well as dsDNA and may be used in the invention wherein a
single strand of DNA is modified. Moreover, in the presence of
Mg.sup.2+ ions, Cas9 cuts ssDNA bound to the crRNA using its HNH
active site independently of PAM.
[0078] Optionally, in any configuration, aspect, example or
embodiment of the invention, step (a) is carried out by cleavage in
one single strand of dsDNA or in ssDNA.
[0079] Optionally, in any configuration, aspect, example or
embodiment of the invention, step (a) is carried out by combining
in a cell the nucleic acid strand, a Cas endonuclease, a crRNA and
a tracrRNA (e.g., provided by one or more gRNAs) for targeting the
endonuclease to carry out the cleavage, and optionally an insert
sequence for homologous recombination with the nucleic acid strand.
Instead of an insert sequence, one can use an incoming sequence
containing homology arms but no insert sequence, to effect deletion
as described above. In an example, the Cas endonuclease is encoded
by a nucleotide sequence that has been introduced into the cell. In
an example, the gRNA is encoded by a DNA sequence that has been
introduced into the cell.
[0080] In an example, the method is carried out in the presence of
Mg.sup.2+.
[0081] Optionally, in any configuration, aspect, example or
embodiment of the invention, step (b) is performed by carrying out
homologous recombination with an incoming nucleic acid comprising
first and second homology arms, wherein the homology arms are
substantially homologous respectively to a sequence extending 5'
from the 5' end and a sequence extending 3' from the 3' end,
wherein the second homology arm comprises a PAM sequence such that
homologous recombination between the second homology arm and the
sequence extending 3' from the 3' end produces a sequence
comprising a PAM motif in the product of the method. The PAM can be
any PAM sequence disclosed herein, for example. Thus, the method
produces a modified nucleic acid strand comprising a PAM that can
be used for a subsequent nucleic acid modification according to any
configuration, aspect, example or embodiment of the invention,
wherein a Cas endonuclease is used to cut the nucleic acid. This is
useful, for example, for performing sequential
endonuclease-mediated homology directed recombination (sEHDR)
according to the invention, more particularly sCHDR described
below.
Sequential Endonuclease-Mediated Homology Directed Recombination
(sEHDR)
[0082] The invention further provides:--
[0083] A method of sequential endonuclease-mediated homology
directed recombination (sEHDR) comprising carrying out the method
of any preceding configuration, aspect, example or embodiment of
the invention a first time and a second time, wherein
endonuclease-mediated cleavage is used in each step (a); wherein
the product of the first time is used for endonuclease-mediated
cleavage the second time, whereby either (i) first and second
nucleotide sequences are deleted the first time and the second
times respectively; (ii) a first nucleotide sequence is deleted the
first time and a second nucleotide sequence is inserted the second
time; (iii) a first nucleotide sequence is inserted the first time
and a second nucleotide sequence is deleted the second time; or
(iv) first and second nucleotide sequences are inserted the first
and second times respectively; optionally wherein the nucleic acid
strand modification the second time is within 20, 10, 5, 4, 3, 2 or
1 or less nucleotides of the nucleic acid strand modification the
first time or directly adjacent to the nucleic acid strand
modification the first time.
[0084] For example, the first and second nucleotide sequences are
inserted so that they are contiguous after the insertion the second
time. Alternatively, the first and second deletions are such that a
contiguous sequence has been deleted after the first and second
deletions have been performed.
[0085] In an embodiment of sEHDR, the invention uses a Cas
endonuclease. Thus, there is provided:
[0086] A method of sequential Cas-mediated homology directed
recombination (sCHDR) comprising carrying out the method of any
preceding claim a first time and a second time, wherein Cas
endonuclease-mediated cleavage is used in each step (a); wherein
step (b) of the first time is carried out performing homologous
recombination with an incoming nucleic acid comprising first and
second homology arms, wherein the homology arms are substantially
homologous respectively to a sequence extending 5' from the 5' end
and a sequence extending 3' from the 3' end, wherein the second
homology arm comprises a PAM sequence such that homologous
recombination between the second homology arm and the sequence
extending 3' from the 3' end produces a sequence comprising a PAM
motif in the product of the method; wherein the PAM motif of the
product of the first time is used for Cas endonuclease-mediated
cleavage the second time, whereby either (i) first and second
nucleotide sequences are deleted the first time and the second
times respectively; (ii) a first nucleotide sequence is deleted the
first time and a second nucleotide sequence is inserted the second
time; (iii) a first nucleotide sequence is inserted the first time
and a second nucleotide sequence is deleted the second time; or
(iv) first and second nucleotide sequences are inserted the first
and second times respectively; optionally wherein the nucleic acid
strand modification the second time is within 20, 10, 5, 4, 3, 2 or
1 or less nucleotides of the nucleic acid strand modification the
first time or directly adjacent to the nucleic acid strand
modification the first time.
[0087] For example, the first and second nucleotide sequences are
inserted so that they are contiguous after the insertion the second
time. Alternatively, the first and second deletions are such that a
contiguous sequence has been deleted after the first and second
deletions have been performed.
[0088] In an embodiment (First Embodiment), the first time is
carried out according to the third configuration of the invention,
wherein the incoming nucleic acid comprises no sequence between the
first and second homology arms, wherein sequence between the 5' and
3' ends is deleted by homologous recombination; and/or the second
time is carried out according to the third configuration of the
invention, wherein step (b) is performed by carrying out homologous
recombination between an incoming nucleic acid comprising first and
second homology arms, wherein the homology arms are substantially
homologous respectively to a sequence extending 5' from the 5' end
and a sequence extending 3' from the 3' end, wherein the incoming
nucleic acid comprises no sequence between the first and second
homology arms such that sequence between the 5' and 3' ends is
deleted by homologous recombination; optionally wherein the second
arm comprises a PAM motif such that the product of the second time
comprises a PAM motif for use in a subsequent Cas
endonuclease-mediated method according to any configuration,
aspect, example or embodiment of the invention.
[0089] In an embodiment (Second Embodiment), the first time is
carried out according to the first or second configuration of the
invention, wherein the incoming nucleic acid comprises the insert
sequence between the first and second homology arms, wherein the
insert sequence is inserted between the 5' and 3' ends by
homologous recombination; and/or the second time is carried out
according to the first or second configuration of the invention,
wherein step (b) is performed by carrying out homologous
recombination between an incoming nucleic acid comprising first and
second homology arms, wherein the homology arms are substantially
homologous respectively to a sequence extending 5' from the 5' end
and a sequence extending 3' from the 3' end, wherein the insert
sequence is inserted between the 5' and 3' ends by homologous
recombination; optionally wherein the second arm comprises a PAM
motif such that the product of the second time comprises a PAM
motif for use in a subsequent Cas endonuclease-mediated method
according to any configuration, aspect, example or embodiment of
the invention.
[0090] In an example, one of said first and second times is carried
out as specified in the First Embodiment and the other time is
carried out as specified in the Second Embodiment, wherein at least
one sequence deletion and at least one sequence insertion is
performed.
[0091] Optionally, in any configuration, aspect, example or
embodiment of the invention, step (a) is carried out by Cas
endonuclease-mediated cleavage using a Cas endonuclease, one or
more crRNAs and a tracrRNA. For example, the method is carried out
in a cell and the crRNA and tracrRNA is introduced into the cell as
RNA molecules. For example, the method is carried out in a zygote
(e.g., a non-human zygote, e.g., a rodent, rat or mouse zygote) and
the crRNA and tracrRNA is injected into zygote. In another
embodiment, the crRNA and tracrRNA are encoded by DNA within a cell
or organism and are transcribed inside the cell (e.g., an ES cell,
e.g., a non-human ES cell, e.g., a rodent, rat or mouse ES cell) or
organism to produce the crRNA and tracrRNA. The organism is, for
example, a non-human animal or plant or bacterium or yeast or
insect. In an embodiment, the tracrRNA is in this way encoded by
DNA but one or more crRNAs are introduced as RNA nucleic acid into
the cell or organism to effect the method of the invention.
[0092] Additionally or alternatively to these examples, the
endonuclease may be introduced as a protein or a vector encoding
the endonuclease may be introduced into the cell or organism to
effect the method of the invention. In another example, the
endonuclease is encoded by DNA that is genomically integrated into
the cell or organism and is transcribed and translated inside the
cell or organism.
[0093] In an example, the method of the invention is carried out in
an ES cell (e.g., a non-human ES cell, e.g., a rodent, rat or mouse
ES cell) that has been pre-engineered to comprise an expressible
genomically-integrated Cas endonuclease sequence (or a vector
carrying this has been include in the cell). It would be possible
to introduce (or encode) a tracrRNA. By introducing a crRNA with a
guiding oligo sequence to target the desired area of the cell
genome, one can then carry out modifications in the cell genome as
per the invention. In an example, a gRNA as described herein is
introduced into the ES cell. The genomically-integrated expressible
Cas endonuclease sequence can, for example, be constitutively
expressed or inducibly expressible. Alternatively or additionally,
the sequence may be expressible in a tissue-specific manner in a
progeny organism (e.g., a rodent) developed using the ES cell.
[0094] The initial ES cell comprising a genomically-integrated
expressible Cas endonuclease sequence can be used, via standard
techniques, to produce a progeny non-human animal that contains the
expressible Cas endonuclease sequence. Thus, the invention
provides:
[0095] A non-human animal (e.g., a vertebrate, mammal, fish or
bird), animal cell, insect, insect cell, plant or plant cell
comprising a genomically-integrated expressible Cas endonuclease
nucleotide sequence and optionally a tracrRNA and/or a nucleotide
sequence encoding a tracrRNA. The Cas endonuclease is, for example,
Cas9 or Cys4. In an example, the animal, insect or plant genome
comprises a chromosomal DNA sequence flanked by site-specific
recombination sites and/or transposon elements (e.g., piggyBac
transposon repeat elements), wherein the sequence encodes the
endonuclease and optionally one or more gRNAs. As described in the
Examples below, recombinase-mediated cassette exchange (RMCE) can
be used to insert such a sequence. The transposon elements can be
used to excise the sequence from the genome once the endonuclease
has been used to perform recombination. The RMCE and/or
transposon-mediated excision can be performed in a cell (e.g., an
ES cell) that later is used to derive a progeny animal or plant
comprising the desired genomic modification.
[0096] The invention also provides an ES cell derived or derivable
from such an animal, wherein the ES cell comprises a
genomically-integrated expressible Cas endonuclease nucleotide
sequence. In an example, the ES cell is a rodent, e.g., a mouse or
rat ES cell, or is a rabbit, dog, pig, cat, cow, non-human primate,
fish, amphibian or bird ES cell.
[0097] The invention also provides a method of isolating an ES
cell, the method comprising deriving an ES cell from an animal
(e.g., a non-human animal, e.g., a rodent, e.g., a rat or a mouse),
wherein the animal comprises a genomically-integrated expressible
Cas endonuclease nucleotide sequence, as described herein.
[0098] In any of these aspects, instead of an ES cell, the cell may
be an iPS cell or a totipotent or pluripotent cell. Thus, an iPS or
stem cell can be derived from (e.g., a somatic cell of) a human,
engineered in vitro to comprise a genomically-integrated
expressible Cas endonuclease nucleotide sequence and optionally one
or more DNA sequences encoding a tracrRNA or gRNA. The invention,
thus, also relates to such a method and to a human iPS or stem cell
comprising a genomically-integrated expressible Cas endonuclease
nucleotide sequence and optionally one or more DNA sequences
encoding a tracrRNA or gRNA. This cell can be used in a method of
the invention to carry out genome modification (e.g., to correct a
genetic defect, e.g., by replacement of defective sequence with a
desired sequence, optionally with subsequent transposon-mediated
excision of the endonuclease-encoding sequence). After optional
excision of the Cas endonuclease sequence, the iPS cell or stem
cell can be introduced into the donor human (or a different human,
e.g., a genetic relative thereof) to carry out genetic therapy or
prophylaxis. In the alternative, a totipotent or pluripotent human
cell is used and then subsequently developed into human tissue or
an organ or part thereof. This is useful for providing material for
human therapy or prophylaxis or for producing assay materials (eg,
for implantation into model non-human animals) or for use in in
vitro testing (e.g., of drugs).
[0099] In an example the method uses a single guided RNA (gRNA)
comprising a crRNA and a tracrRNA. The crRNA comprises an
oligonucleotide sequence ("X" in the structure 5'-X-Y-3' mentioned
below) that is chosen to target a desired part of the nucleic acid
or genome to be modified. The skilled person will be able readily
to select appropriate oligo sequence. In an example, the sequence
is from 3 to 100 nucleotides long, eg, from 3 to 50, 40, 30, 25,
20, 15 or 10 nucleotides long, eg, from or 5, 10, 15 or 20 to 100
nuclueotides long, eg, from 5, 10, 15 or 20 to 50 nucleotides
long.
[0100] For example, the gRNA is a single nucleic acid comprising
both the crRNA and the tracrRNA. An example of a gRNA comprises the
sequence 5'-[oligo]-[UUUUAGAGCUA] (SEQ ID NO:
1)-[LINKER]-[UAGCAAGUUAAAA] (SEQ ID NO: 2)-3', wherein the LINKER
comprises a plurality (e.g., 4 or more, e.g., 4, 5 or 6)
nucleotides (e.g., 5'-GAAA-3').
[0101] For example, the crRNA has the structure 5'-X-Y-3', wherein
X is an RNA nucleotide sequence (optionally at least 5 nucleotides
long) and Y is a crRNA sequence comprising a nucleotide motif that
hybridises with a motif comprised by the tracrRNA, wherein X is
capable of hybridising with a nucleotide sequence 5' of the desired
site of the 5' cut end, e.g., extending 5' from the desired site of
the 5' cut.
[0102] In an example, Y is 5'-N1UUUUAN2N3GCUA-3' (SEQ ID NO: 3),
wherein each of N1-3 is a A, U, C or G and/or the tracrRNA
comprises the sequence (in 5' to 3' orientation) UAGCM1UUAAAAM2
(SEQ ID NO: 4, when M1 is, e.g., 5 nucleotides), wherein M1 is
spacer nucleotide sequence and M2 is a nucleotide; e.g., N1-G, N2=G
and N3=A. The spacer sequence is, e.g., 5, 4, 3, 2 or 1 RNA
nucleotides in length (e.g., AAG in 5' to 3' orientation). M2 is,
for example, a A, U, C or G (e.g., M2 is a G). In an embodiment, a
chimaeric gRNA is used which comprises a sequence 5'-X-Y-Z-3',
wherein X and Y are as defined above and Z is a tracrRNA comprising
the sequence (in 5' to 3' orientation) UAGCM1UUAAAAM2 (SEQ ID NO:
4), wherein M1 is spacer nucleotide sequence and M2 is a
nucleotide. In an example, Z comprises the sequence
5'-UAGCAAGUUAAAA-3' (SEQ ID NO: 2), e.g., Z is
5'-UAGCAAGUUAAAAUAAGGCUAGUCCG-3' (SEQ ID NO: 5). In an example, the
gRNA has the sequence:
TABLE-US-00001 (SEQ ID NO: 5)
5'-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUC
AACUUGAAAAAGUGGCACCGAGUCGGUGC-3'.
[0103] When it is desired to use the present invention to insert an
exogenous sequence into the nucleic acid to be modified, the
exogenous sequence can be provided on linear or circular nucleic
acid (e.g., DNA). Typically, the exogenous sequence is flanked by
homology arms that can undergo homologous recombination with
sequences 5' and 3' respectively of the site where the exogenous
sequence is to be inserted. The skilled person is familiar with
choosing homology arms for homologous recombination.
[0104] The invention can be used in a method of producing a
transgenic organism, e.g., any organism recited herein. For
example, the organism can be a non-human organism used as an assay
model to test a pharmaceutical drug or to express an exogenous
protein or a part thereof (e.g., a human protein target knocked-in
into a non-human animal assay organism). In another example, the
invention has been used to knock-out an endogenous sequence (e.g.,
a target protein) in an organism, such as a non-human organism.
This can be useful to assess the effect (phenotype) of the
knock-out and thus to assess potential drug targets or proteins
implicated in disease. In one example, the organism is a non-human
animal (e.g., a vertebrate, mammal, bird, fish, rodent, mouse, rat
or rabbit) in which a human target protein has been knocked-in
using the invention. Optionally, the invention has been used to
knock out an orthologous or homologous endogenous target of the
organism (eg, an endogenous target sequence has been replaced at
the endogenous position by an orthologous or homologous human
target sequence). In this way, an assay model can be produced for
testing pharmaceutical drugs that act via the human target.
[0105] In an embodiment, the organism is a non-human vertebrate
that expresses human antibody variable regions whose genome
comprises a replacement of an endogenous target with an orthologous
or homologous human sequence. In an example, the method of the
invention is used to produce an Antibody-Generating Vertebrate or
Assay Vertebrate as disclosed in WO2013061078, the disclosure of
which, and specifically including the disclosure of such
Vertebrates, their composition, manufacture and use, is included
specifically herein by reference as though herein reproduced in its
entirety and for providing basis for claims herein.
[0106] In an example, an exogenous regulatory element is knocked-in
using the method. For example, it is knocked-in to replace an
endogenous regulatory element.
[0107] In one aspect, the invention provides a method of producing
a cell or a transgenic non-human organism (e.g., any non-human
organism recited herein), the method comprising
(a) carrying out the method of any in any configuration, aspect,
example or embodiment of the invention to (i) knock out a target
nucleotide sequence in the genome of a first cell and/or (ii) knock
in an insert nucleotide sequence into the genome of a first cell,
optionally wherein the insert sequence replaces a target sequence
in whole or in part at the endogenous location of the target
sequence in the genome; wherein the cell or a progeny thereof can
develop into a non-human organism or cell; and (b) developing the
cell or progeny into a non-human organism or a non-human cell.
[0108] In an example, the organism or cell is homozygous for the
modification (i) and/or (ii).
[0109] In an example, the cell is an ES cell, iPS cell, totipotent
cell or pluripotent cell. In an example, the cell is a non-human
vertebrate cell or a human cell in vitro. In an example, the cell
is a plant, yeast, insect or bacterial cell.
[0110] In an example, the cell or organism is a rodent (e.g., a
mouse or rat) cell or a rabbit, bird, fish, chicken, non-human
primate, monkey, pig, dog, Camelid, shark, sheep, cow or cat
cell.
[0111] In an example, the target sequence is an endogenous sequence
comprising all or part of a regulatory element or encoding all or
part of a protein. In an example, the insert sequence is a
synthetic sequence; or comprises a sequence encoding all or part of
a protein from a species other than the species from which the
first cell is derived; or comprises a regulatory element from said
first species. This is useful to combine genes with new regulatory
elements.
[0112] In an example, the insert sequence encodes all or part of a
human protein or a human protein subunit or domain. For example,
the insert sequence encodes a cell membrane protein, secreted
protein, intracellular protein, cytokine, receptor protein (e.g.,
Fc receptor protein, such as FcRn or a FcY receptor protein),
protein of the human immune system or domain thereof (e.g., an Ig
protein or domain, such as an antibody or TCR protein or domain, or
a MHC protein), a hormone or growth factor.
[0113] The invention also provides:
[0114] A cell (e.g., an isolated or purified cell, eg, a cell in
vitro, or any cell disclosed herein) or a non-human organism (e.g.,
any organism disclosed herein) whose genome comprises a
modification comprising a non-endogenous nucleotide sequence
flanked by endogenous nucleotide sequences, wherein the cell or
organism is obtainable by the method of any configuration, aspect,
example or embodiment of the invention, and wherein the
non-endogenous sequence is flanked 3' and/or 5' by (e.g., within
20, 10, 5, 4, 3, 2 or 1 or less nucleotides of, or directly
adjacent to) a Cas PAM motif; wherein the cell is not comprised by
a human; and one, more or all of (a) to (d) applies
(a) the genome is homozygous for the modification; or comprises the
modification at one allele and is unmodified by Cas-mediated
homologous recombination at the other allele; (b) the
non-endogenous sequence comprises all or part of a regulatory
element or encodes all or part of a protein; (c) the non-endogenous
sequence is at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200,
300, 400, 500, 600, 700, 800 or 900 nucleotides, or at least 1, 2,
3, 5, 10, 20, 50 or 100 kb long; (d) the non-endogenous sequence
replaces an orthologous or homologous sequence in the genome.
[0115] The cell can be a human cell, or included in human tissue
but not part of a human being. For example, the cell is a human
cell in vitro.
[0116] In an example, the non-endogenous sequence is a human
sequence.
[0117] In an example, the PAM motif is any PAM disclosed herein or
comprises a sequence selected from CCN, TCN, TTC, AWG, CC, NNAGNN,
NGGNG GG, NGG, WGG, CWT, CTT and GAA. For example, the motif is a
Cas9 PAM motif. For example, the PAM is NGG. In another example,
the PAM is GG.
[0118] In an example, there is a PAM motif no more than 10
nucleotides (e.g., 3 nucleotides) 3' and/or 5' of the
non-endogenous sequence.
[0119] In an example, the PAM motif is recognised by a
Streptococcus Cas9.
[0120] In an example, the cell or organism is a non-human
vertebrate cell or a non-human vertebrate that expresses one or
more human antibody heavy chain variable domains (and optionally no
heavy chain variable domains of a non-human vertebrate species).
For example, the organism is an Antibody-Generating Vertebrate or
Assay Vertebrate disclosed in WO2013061078.
[0121] In an example, the cell or organism is a non-human
vertebrate cell or a non-human vertebrate that expresses one or
more human antibody kappa light chain variable domains (and
optionally no kappa light chain variable domains of a non-human
vertebrate species).
[0122] In an example, the cell or organism is a non-human
vertebrate cell or a non-human vertebrate that expresses one or
more human antibody lambda light chain variable domains (and
optionally no kappa light chain variable domains of a non-human
vertebrate species).
[0123] In an example, the non-endogenous sequence encodes a human
Fc receptor protein or subunit or domain thereof (e.g., a human
FcRn or FcY receptor protein, subunit or domain).
[0124] In an example, the non-endogenous sequence comprises one or
more human antibody gene segments, an antibody variable region or
an antibody constant region.
[0125] In an example, the insert sequence is a human sequence that
replaces or supplements an orthologous non-human sequence.
[0126] The invention also provides:
[0127] A monoclonal or polyclonal antibody prepared by immunisation
of a vertebrate (e.g., mouse or rat) of the invention (or produced
by a method of the invention) with an antigen.
[0128] The invention also provides:
A method of isolating an antibody that binds a predetermined
antigen, the method comprising (a) providing a vertebrate
(optionally a mouse or rat) of the invention (or produced by a
method of the invention); (b) immunising said vertebrate with said
antigen; (c) removing B lymphocytes from the vertebrate and
selecting one or more B lymphocytes expressing antibodies that bind
to the antigen; (d) optionally immortalising said selected B
lymphocytes or progeny thereof, optionally by producing hybridomas
therefrom; and (e) isolating an antibody (eg, and IgG-type
antibody) expressed by the B lymphocytes.
[0129] In an example, the method comprises the step of isolating
from said B lymphocytes nucleic acid encoding said antibody that
binds said antigen; optionally exchanging the heavy chain constant
region nucleotide sequence of the antibody with a nucleotide
sequence encoding a human or humanised heavy chain constant region
and optionally affinity maturing the variable region of said
antibody; and optionally inserting said nucleic acid into an
expression vector and optionally a host.
[0130] In an example, the method comprises making a mutant or
derivative of the antibody produced by the method.
[0131] The invention provides the use of an isolated, monoclonal or
polyclonal antibody described herein, or a mutant or derivative
antibody thereof that binds said antigen, in the manufacture of a
composition for use as a medicament.
[0132] The invention provides the use of an isolated, monoclonal or
polyclonal antibody described herein, or a mutant or derivative
antibody thereof that binds said antigen for use in medicine.
[0133] The invention provides a nucleotide sequence encoding an
antibody described herein, optionally wherein the nucleotide
sequence is part of a vector.
[0134] The invention provides a pharmaceutical composition
comprising the antibody or antibodies described herein and a
diluent, excipient or carrier.
[0135] The invention provides an ES cell, a non-human animal or a
non-human blastocyst comprising an expressible
genomically-integrated nucleotide sequence encoding a Cas
endonuclease (e.g., a Cas9 or Cys4) and optionally an expressible
genomically-integrated nucleotide sequence encoding a tracrRNA or a
gRNA. For example, the ES cell is any ES cell type described
herein.
[0136] In an example of the cell, animal or blastocyst, the
endonuclease sequence is constitutively expressible.
[0137] In an example of the cell, animal or blastocyst, the
endonuclease sequence is inducibly expressible.
[0138] In an example of the cell, animal or blastocyst, the
endonuclease sequence is expressible in a tissue-specific manner in
the animal or a progeny thereof, or in a non-human animal that is a
progeny of the cell or blastocyst.
[0139] In an example, the cell, animal or blastocyst comprises one
or more gRNAs or an expressible nucleotide sequence encoding a gRNA
or a plurality of expressible nucleotide sequences each encoding a
different gRNA.
[0140] The invention provides the use of the cell, animal or
blastocyst in a method according to any configuration, aspect,
embodiment or example of the invention.
[0141] An aspect provides an antibody produced by the method of the
invention, optionally for use in medicine, eg, for treating and/or
preventing a medical condition or disease in a patient, e.g., a
human.
[0142] An aspect provides a nucleotide sequence encoding the
antibody of the invention, optionally wherein the nucleotide
sequence is part of a vector. Suitable vectors will be readily
apparent to the skilled person, eg, a conventional antibody
expression vector comprising the nucleotide sequence together in
operable linkage with one or more expression control elements.
[0143] An aspect provides a pharmaceutical composition comprising
the antibody of the invention and a diluent, excipient or carrier,
optionally wherein the composition is contained in an IV container
(e.g., and IV bag) or a container connected to an IV syringe.
[0144] An aspect provides the use of the antibody of the invention
in the manufacture of a medicament for the treatment and/or
prophylaxis of a disease or condition in a patient, e.g., a
human.
[0145] In a further aspect the invention relates to humanised
antibodies and antibody chains produced according to the present
invention, both in chimaeric and fully humanised form, and use of
said antibodies in medicine. The invention also relates to a
pharmaceutical composition comprising such an antibody and a
pharmaceutically acceptable carrier or other excipient.
[0146] Antibody chains containing human sequences, such as
chimaeric human--non human antibody chains, are considered
humanised herein by virtue of the presence of the human protein
coding regions region. Fully human antibodies may be produced
starting from DNA encoding a chimaeric antibody chain of the
invention using standard techniques.
[0147] Methods for the generation of both monoclonal and polyclonal
antibodies are well known in the art, and the present invention
relates to both polyclonal and monoclonal antibodies of chimaeric
or fully humanised antibodies produced in response to antigen
challenge in non human-vertebrates of the present invention.
[0148] In a yet further aspect, chimaeric antibodies or antibody
chains generated in the present invention may be manipulated,
suitably at the DNA level, to generate molecules with antibody-like
properties or structure, such as a human variable region from a
heavy or light chain absent a constant region, for example a domain
antibody; or a human variable region with any constant region from
either heavy or light chain from the same or different species; or
a human variable region with a non-naturally occurring constant
region; or human variable region together with any other fusion
partner. The invention relates to all such chimaeric antibody
derivatives derived from chimaeric antibodies identified according
to the present invention.
[0149] In a further aspect, the invention relates to use of animals
of the present invention in the analysis of the likely effects of
drugs and vaccines in the context of a quasi-human antibody
repertoire.
[0150] The invention also relates to a method for identification or
validation of a drug or vaccine, the method comprising delivering
the vaccine or drug to a mammal of the invention and monitoring one
or more of: the immune response, the safety profile; the effect on
disease.
[0151] The invention also relates to a kit comprising an antibody
or antibody derivative as disclosed herein and either instructions
for use of such antibody or a suitable laboratory reagent, such as
a buffer, antibody detection reagent.
[0152] It will be understood that particular embodiments described
herein are shown by way of illustration and not as limitations of
the invention. The principal features of this invention can be
employed in various embodiments without departing from the scope of
the invention. Those skilled in the art will recognize, or be able
to ascertain using no more than routine study, numerous equivalents
to the specific procedures described herein. Such equivalents are
considered to be within the scope of this invention and are covered
by the claims. All publications and patent applications mentioned
in the specification are indicative of the level of skill of those
skilled in the art to which this invention pertains. All
publications and patent applications are herein incorporated by
reference to the same extent as if each individual publication or
patent application was specifically and individually indicated to
be incorporated by reference. The use of the word "a" or an when
used in conjunction with the term "comprising" in the claims and/or
the specification may mean "one," but it is also consistent with
the meaning of "one or more," "at least one," and "one or more than
one." The use of the term or in the claims is used to mean "and/or"
unless explicitly indicated to refer to alternatives only or the
alternatives are mutually exclusive, although the disclosure
supports a definition that refers to only alternatives and
"and/or." Throughout this application, the term "about" is used to
indicate that a value includes the inherent variation of error for
the device, the method being employed to determine the value, or
the variation that exists among the study subjects.
[0153] As used in this specification and claim(s), the words
"comprising" (and any form of comprising, such as "comprise" and
"comprises"), "having" (and any form of having, such as "have" and
"has"), "including" (and any form of including, such as "includes"
and "include") or "containing" (and any form of containing, such as
"contains" and "contain") are inclusive or open-ended and do not
exclude additional, unrecited elements or method steps.
[0154] The term "or combinations thereof" as used herein refers to
all permutations and combinations of the listed items preceding the
term. For example, "A, B, C, or combinations thereof is intended to
include at least one of: A, B, C, AB, AC, BC, or ABC, and if order
is important in a particular context, also BA, CA, CB, CBA, BCA,
ACB, BAC, or CAB. Continuing with this example, expressly included
are combinations that contain repeats of one or more item or term,
such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth.
The skilled artisan will understand that typically there is no
limit on the number of items or terms in any combination, unless
otherwise apparent from the context.
[0155] Any part of this disclosure may be read in combination with
any other part of the disclosure, unless otherwise apparent from
the context.
[0156] All of the compositions and/or methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the compositions and/or methods and in
the steps or in the sequence of steps of the method described
herein without departing from the concept, spirit and scope of the
invention. All such similar substitutes and modifications apparent
to those skilled in the art are deemed to be within the spirit,
scope and concept of the invention as defined by the appended
claims.
REFERENCES
[0157] 1. Cong L, Ran F A, Cox D, Lin S, Barretto R, Habib N, Hsu P
D, Wu X, Jiang W, Marraffini L A et al: Multiplex genome
engineering using CRISPR/Cas systems. Science 2013,
339(6121):819-823. [0158] 2. Wang H, Yang H, Shivalila C S, Dawlaty
M M, Cheng A W, Zhang F, Jaenisch R: One-step generation of mice
carrying mutations in multiple genes by CRISPR/Cas-mediated genome
engineering. Cell 2013, 153(4):910-918. [0159] 3. Mali P, Yang L,
Esvelt K M, Aach J, Guell M, DiCarlo J E, Norville J E, Church G M:
RNA-guided human genome engineering via Cas9. Science 2013,
339(6121):823-826. [0160] 4. Gaj T, Gersbach C A, Barbas C F, 3rd:
ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering.
Trends Biotechnol 2013, 31(7):397-405. [0161] 5. Perez-Pinera P,
Ousterout D G, Gersbach C A: Advances in targeted genome editing.
Curr Opin Chem Biol 2012, 16(3-4):268-277. [0162] 6. Shah S A,
Erdmann S, Mojica F J, Garrett R A: Protospacer recognition motifs:
Mixed identities and functional diversity. RNA Biol 2013, 10(5).
[0163] 7. Haurwitz R E, Sternberg S H, Doudna J A: Csy4 relies on
an unusual catalytic dyad to position and cleave CRISPR RNA. EMBO J
2012, 31(12):2824-2832. [0164] 8. Yusa K, Zhou L, Li M A, Bradley
A, Craig N L: A hyperactive piggyBac transposase for mammalian
applications. Proc Nod Acad Sci USA 2011, 108(4):1531-1536. [0165]
9. Qiao J, Oumard A, Wegloehner W, Bode J: Novel tag-and-exchange
(RMCE) strategies generate master cell clones with predictable and
stable transgene expression properties. J Mol Biol 2009,
390(4):579-594. [0166] 10. Oumard A, Qiao J, Jostock T, Li J, Bode
J: Recommended Method for Chromosome Exploitation: RMCE-based
Cassette-exchange Systems in Animal Cell Biotechnology.
Cytotechnology 2006, 50(1-3):93-108. The present invention is
described in more detail in the following non limiting
exemplification.
EXAMPLES
Example 1
Precise DNA Modifications
[0167] (a) Use of Nickase for HDR
[0168] It has been reported that the Cas9 nuclease can be converted
into a nickase through the substitution of an aspartate to alanine
(D10A) in the RuvCl domain of SpCas9 (Cong et al). It is noteworthy
that DNA single-stranded breaks are preferentially repaired through
the HDR pathway. The Cas9 D10A nickase, when in a complex with
mature crRNA:tracrRNA, can specifically induce DNA nicking at a
precise location. With this in mind, we propose extending the
application of the CRISPR/Cas system by creating a nick in a given
location in a genome using Cas9 D10A nickase and then exploiting
the HDR pathway for inserting a single-stranded DNA fragment
(endogenous or exogenous) which will contain DNA homology flanking
the nick. Typically for recombineering 50 bp is enough for
efficient recombination) flanking the nicked DNA junction to bring
in and insert a given DNA in a precision location; similar size
homology will be used with the present example (FIG. 1). Guide RNA
(gRNA) will be design individually per target protospacer sequence
or incorporated into a single CRISPR array encoding for 2 or more
spacer sequences allowing multiplex genome editing from a single
CRSPR array.
[0169] In a separate setting, two gRNA or a single CRISPR array
encoding multiple spacer sequence can be designed flanking a gene
or a region of interest and with the association of Cas9 D10A
nickase, two separate single-stranded breaks can be induced. This
in association with a single-stranded DNA fragment containing DNA
homology to the 5' breakpoint junction of the first DNA nick and
DNA homology to the 3' breakpoint junction of the second nick the
region in between the two single stranded DNA nick can be precisely
deleted (FIG. 2). In an another setting, two separate gRNA or a
multiplex single CRISPR array can be designed flanking a gene or a
region of interest and with the association of Cas9 D10A nickase
two separate single-stranded breaks can be induced. In this case
the intruding single stranded DNA fragment can contain DNA sequence
from either endogenous or exogenous source containing sequence for
a known gene, regulatory element promoter etc. This single-stranded
DNA fragment (or double stranded DNA) can be brought together to
replace the DNA region of interest flanked by DNA nick by arming it
with DNA homology from the 5' region of the first nick and 3'
region from the second nick (FIG. 3). Due to the high efficiency of
the CRISPR/Cas system to cleave DNA, the above proposed strategy
will not require introduction of any selection marker thus creating
exact seamless genome editing in a precise and defined manner. As
an option, a selection marker can be included flanked by PiggyBac
LTRs to allow for the direct selection of correctly modified
clones. Once the correct clones have been identified, the selection
marker can be removed conveniently through the expression of
hyperactive piggyBac transposase (Yusa K, Zhou L, Li M A, Bradley
A, Craig N L: A hyperactive piggyBac transposase for mammalian
applications. Proc Natl Acad Sci USA 2011, 108(4):1531-1536).
Furthermore, the above approaches can be applied to ES cells,
mammalian cells, yeast cells, bacterial cells, plant cells as well
as directly performing in zygotes to expedite the process of
homozygeous genome engineering in record time. It would be also
possible to multiplex this system to generate multiple simultaneous
DNA insertions (KI), deletions (KO) and the sequential deletion and
insertion (KO.fwdarw.KI).
Example 2
Recycling PAM for Sequential Insertions or Deletions
[0170] In certain settings it may be useful to edit a genome by
chromosome walking. Using any of the three examples outlined above,
it could be possible to carry out sequential genome editing in a
stepwise fashion whereby the PAM sequence used in a previous round
of CRISPR/Cas mediated genome editing, can be re-used to carry out
multiple rounds of genome editing such as deletions, insertions or
the simultaneous deletion and insertion. An example of sequential
deletion whereby the PAM sequence from the previous genome editing
step is recycled is shown in FIG. 4. Using the PAM recycling
approach, it is possible to carry out sequential insertions as well
as sequential simultaneous deletion and insertion.
Example 3
Rapid Insertion of Lox Sites Using CRISPR/Cas System
[0171] Targeting efficiency using conventional homologous
recombination methods in ES cells is low. In a different setting,
the CRISPR/Cas system can be used to rapidly and efficiently
introduce lox sites or other recombinase recognition sequence such
as Frt in a defined location to act as a landing pad for genome
editing using recombinase mediated cassette exchange (RMCE) (Qiao
J, Oumard A, Wegloehner W, Bode J: Novel tag-and-exchange (RMCE)
strategies generate master cell clones with predictable and stable
transgene expression properties. J Mol Biol 2009, 390(4):579-594;
and Oumard A, Qiao J, Jostock T, Li J, Bode J: Recommended Method
for Chromosome Exploitation: RMCE-based Cassette-exchange Systems
in Animal Cell Biotechnology. Cytotechnology 2006, 50(1-3):93-108).
Once the lox sites are introduced into the genome, inversion,
deletion or cassette exchange to delete and introduce DNA fragment
varying in size at this site can be efficiently conducted via
expression of Cre recombinase. An example of CRISPR/Cas mediated
lox insertion followed by RMCE is shown in FIG. 5. The RMCE step
can be used to invert the region flanked by lox site or to delete
this region as well as to simultaneously delete and insert DNA of
interest in this region. Furthermore, the RMCE step can be adapted
for carrying out multiple sequential rounds of RMCE (sRMCE).
Example 4
[0172] Reference is made to FIG. 6. A piggyBac transposon
harbouring a PGK promoter-driven loxP/mutant lox-flanked neo.sup.R
gene is targeted into an ES cell genome by standard homologous
recombination. The targeted clones can be selected by G418. This
provides a landing pad for the following recombinase-mediated
cassette exchange (RMCE). Such an ES clone can be used a parental
cells for any modification further. A cassette containing the
loxP/mutant lox-flanked promoterless Puro.DELTA.TK-T2A-Cas9 and U6
polymerase Ill promoter-driven guide RNA (gRNA) genes are inserted
into the landing pad through transient cre expression. The gRNA
genes can be one or more than one which target to the same gene or
different genes. The inserted clones can be selected with puromycin
and confirmed by junction PCRs. During the selection, the
expression of Cas9 and gRNAs from the inserted cassette results in
more efficient gene targeting or modification than transient
expression of the Cas9 and gRNA can achieve. Following 4-6 day
selection, the whole modified cassette is excised by the transient
expression of piggyBac transposase (Pease). The final ES cell
clones would not contain any Cas9 or gRNA sequence. The clones with
homozygous modified genes would be confirmed by PCR and
sequence.
[0173] The main feature of this invention is to control the Cas9
and gRNA expression in certain time to be sufficient to generate
efficient targeting rates.
Example 5
Methodology
Reconstructing CRISPR/Cas Vector System (Nuclease)
[0174] The CRISPR/Cas genome editing system has been reconstructed
in vitro and exemplified in mouse embryonic stem cells using vector
pX330 containing humanised S. pyogenes (hSpCsn1) (Cong et al). The
CRISPR/Cas system can be reconstructed as described in Cong et of
using synthetic DNA strings and DNA assembly. In the present
example, the entire DNA assembly would constitute a 6006 bp
fragment containing 45 bp homology to pBlueScript KS+ vector 5' to
the EcoRV cutting site, Human U6 promoter, two Bbsl restriction
sites for cloning in the spacer sequence which fuses to a chimeric
guided RNA sequence, chicken beta-actin promoter with 3 FLAG,
nuclear localisation signal (NLS) followed by hSpCsn1 sequence and
another NLS, bGH polyA, inverted terminal repeat sequence and
finally another 45 bp homology to pBlueScript KS+ 3' to the EcoRV
cutting site. This 6006 bp stretch of DNA will be synthetized as 7
individual DNA fragments where each fragment will have a 45 bp
overlap to the adjacent DNA fragment to allow DNA assembly. The DNA
sequence of these fragments is shown below in the order of
assembly.
TABLE-US-00002 Fragment 1A (1340 bp) (SEQ ID NO: 7)
GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATGAGGG
CCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTA
GAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAA
AATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAA
ATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATT
TCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGGTCT
TCGAGAAGACCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG
TCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGTTTTA
GAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTTTAGCGCGTGC
GCCAATTCTGCAGACAAATGGCTCTAGAGGTACCCGTTACATAACTTACG
GTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTC
AATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATT
TACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGT
ACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTGTGC
CCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTAT
TAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACT
CTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTT
TTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGC
CAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGT
GCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGC
GAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGG
GAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTC
GCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCG
GGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCTGAGCAAGAGGTAA
GGGTTTAAGGGATGGTTGGTTGGTGGGGTATTAATGTTTAATTACCTGGA
GCACCTGCCTGAAATCACTTTTTTTCAGGTTGGACCGGTGCCACCATGGA
CTATAAGGACCACGACGGAGACTACAAGGATCATGATATT. Fragment 2 (852 bp) (SEQ
ID NO: 8) ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTA
CAAAGACGATGACGATAAGATGGCCCCAAAGAAGAAGCGGAAGGTCGGTA
TCCACGGAGTCCCAGCAGCCGACAAGAAGTACAGCATCGGCCTGGACATC
GGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCC
CAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATCAAGA
AGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACAGCCGAGGCC
ACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCG
GATCTGCTATCTGCAAGAGATCTTCAGCAACGAGATGGCCAAGGTGGACG
ACAGCTTCTTCCACAGACTGGAAGAGTCCTTCCTGGTGGAAGAGGATAAG
AAGCACGAGCGGCACCCCATCTTCGGCAACATCGTGGACGAGGTGGCCTA
CCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGAAACTGGTGGACA
GCACCGACAAGGCCGACCTGCGGCTGATCTATCTGGCCCTGGCCCACATG
ATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGACAA
CAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGC
TGTTCGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATC
CTGTCTGCCAGACTGAGCAAGAGCAGACGGCTGGAAAATCTGATCGCCCA
GCTGCCCGGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCCTGA GC. Fragment 3
(920 bp) (SEQ ID NO: 9)
GGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCCTGAGCCTGGG
CCTGACCCCCAACTTCAAGAGCAACTTCGACCTGGCCGAGGATGCCAAAC
TGCAGCTGAGCAAGGACACCTACGACGACGACCTGGACAACCTGCTGGCC
CAGATCGGCGACCAGTACGCCGACCTGTTTCTGGCCGCCAAGAACCTGTC
CGACGCCATCCTGCTGAGCGACATCCTGAGAGTGAACACCGAGATCACCA
AGGCCCCCCTGAGCGCCTCTATGATCAAGAGATACGACGAGCACCACCAG
GACCTGACCCTGCTGAAAGCTCTCGTGCGGCAGCAGCTGCCTGAGAAGTA
CAAAGAGATTTTCTTCGACCAGAGCAAGAACGGCTACGCCGGCTACATTG
ACGGCGGAGCCAGCCAGGAAGAGTTCTACAAGTTCATCAAGCCCATCCTG
GAAAAGATGGACGGCACCGAGGAACTGCTCGTGAAGCTGAACAGAGAGGA
CCTGCTGCGGAAGCAGCGGACCTTCGACAACGGCAGCATCCCCCACCAGA
TCCACCTGGGAGAGCTGCACGCCATTCTGCGGCGGCAGGAAGATTTTTAC
CCATTCCTGAAGGACAACCGGGAAAAGATCGAGAAGATCCTGACCTTCCG
CATCCCCTACTACGTGGGCCCTCTGGCCAGGGGAAACAGCAGATTCGCCT
GGATGACCAGAAAGAGCGAGGAAACCATCACCCCCTGGAACTTCGAGGAA
GTGGTGGACAAGGGCGCTTCCGCCCAGAGCTTCATCGAGCGGATGACCAA
CTTCGATAAGAACCTGCCCAACGAGAAGGTGCTGCCCAAGCACAGCCTGC
TGTACGAGTACTTCACCGTGTATAACGAGCTGACCAAAGTGAAATACGTG
ACCGAGGGAATGAGAAAGCC. Fragment 4 (920 bp) (SEQ ID NO: 10)
CGAGCTGACCAAAGTGAAATACGTGACCGAGGGAATGAGAAAGCCCGCCT
TCCTGAGCGGCGAGCAGAAAAAGGCCATCGTGGACCTGCTGTTCAAGACC
AACCGGAAAGTGACCGTGAAGCAGCTGAAAGAGGACTACTTCAAGAAAAT
CGAGTGCTTCGACTCCGTGGAAATCTCCGGCGTGGAAGATCGGTTCAACG
CCTCCCTGGGCACATACCACGATCTGCTGAAAATTATCAAGGACAAGGAC
TTCCTGGACAATGAGGAAAACGAGGACATTCTGGAAGATATCGTGCTGAC
CCTGACACTGTTTGAGGACAGAGAGATGATCGAGGAACGGCTGAAAACCT
ATGCCCACCTGTTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCGGAGA
TACACCGGCTGGGGCAGGCTGAGCCGGAAGCTGATCAACGGCATCCGGGA
CAAGCAGTCCGGCAAGACAATCCTGGATTTCCTGAAGTCCGACGGCTTCG
CCAACAGAAACTTCATGCAGCTGATCCACGACGACAGCCTGACCTTTAAA
GAGGACATCCAGAAAGCCCAGGTGTCCGGCCAGGGCGATAGCCTGCACGA
GCACATTGCCAATCTGGCCGGCAGCCCCGCCATTAAGAAGGGCATCCTGC
AGACAGTGAAGGTGGTGGACGAGCTCGTGAAAGTGATGGGCCGGCACAAG
CCCGAGAACATCGTGATCGAAATGGCCAGAGAGAACCAGACCACCCAGAA
GGGACAGAAGAACAGCCGCGAGAGAATGAAGCGGATCGAAGAGGGCATCA
AAGAGCTGGGCAGCCAGATCCTGAAAGAACACCCCGTGGAAAACACCCAG
CTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAATGGGCGGGATAT
GTACGTGGACCAGGAACTGG. Fragment 5 (920 bp) (SEQ ID NO: 11)
ACTACCTGCAGAATGGGCGGGATATGTACGTGGACCAGGAACTGGACATC
AACCGGCTGTCCGACTACGATGTGGACCATATCGTGCCTCAGAGCTTTCT
GAAGGACGACTCCATCGACAACAAGGTGCTGACCAGAAGCGACAAGAACC
GGGGCAAGAGCGACAACGTGCCCTCCGAAGAGGTCGTGAAGAAGATGAAG
AACTACTGGCGGCAGCTGCTGAACGCCAAGCTGATTACCCAGAGAAAGTT
CGACAATCTGACCAAGGCCGAGAGAGGCGGCCTGAGCGAACTGGATAAGG
CCGGCTTCATCAAGAGACAGCTGGTGGAAACCCGGCAGATCACAAAGCAC
GTGGCACAGATCCTGGACTCCCGGATGAACACTAAGTACGACGAGAATGA
CAAGCTGATCCGGGAAGTGAAAGTGATCACCCTGAAGTCCAAGCTGGTGT
CCGATTTCCGGAAGGATTTCCAGTTTTACAAAGTGCGCGAGATCAACAAC
TACCACCACGCCCACGACGCCTACCTGAACGCCGTCGTGGGAACCGCCCT
GATCAAAAAGTACCCTAAGCTGGAAAGCGAGTTCGTGTACGGCGACTACA
AGGTGTACGACGTGCGGAAGATGATCGCCAAGAGCGAGCAGGAAATCGGC
AAGGCTACCGCCAAGTACTTCTTCTACAGCAACATCATGAACTTTTTCAA
GACCGAGATTACCCTGGCCAACGGCGAGATCCGGAAGCGGCCTCTGATCG
AGACAAACGGCGAAACCGGGGAGATCGTGTGGGATAAGGGCCGGGATTTT
GCCACCGTGCGGAAAGTGCTGAGCATGCCCCAAGTGAATATCGTGAAAAA
GACCGAGGTGCAGACAGGCGGCTTCAGCAAAGAGTCTATCCTGCCCAAGA
GGAACAGCGATAAGCTGATC. Fragment 6 (789 bp) (SEQ ID NO: 12)
AGCAAAGAGTCTATCCTGCCCAAGAGGAACAGCGATAAGCTGATCGCCAG
AAAGAAGGACTGGGACCCTAAGAAGTACGGCGGCTTCGACAGCCCCACCG
TGGCCTATTCTGTGCTGGTGGTGGCCAAAGTGGAAAAGGGCAAGTCCAAG
AAACTGAAGAGTGTGAAAGAGCTGCTGGGGATCACCATCATGGAAAGAAG
CAGCTTCGAGAAGAATCCCATCGACTTTCTGGAAGCCAAGGGCTACAAAG
AAGTGAAAAAGGACCTGATCATCAAGCTGCCTAAGTACTCCCTGTTCGAG
CTGGAAAACGGCCGGAAGAGAATGCTGGCCTCTGCCGGCGAACTGCAGAA
GGGAAACGAACTGGCCCTGCCCTCCAAATATGTGAACTTCCTGTACCTGG
CCAGCCACTATGAGAAGCTGAAGGGCTCCCCCGAGGATAATGAGCAGAAA
CAGCTGTTTGTGGAACAGCACAAGCACTACCTGGACGAGATCATCGAGCA
GATCAGCGAGTTCTCCAAGAGAGTGATCCTGGCCGACGCTAATCTGGACA
AAGTGCTGTCCGCCTACAACAAGCACCGGGATAAGCCCATCAGAGAGCAG
GCCGAGAATATCATCCACCTGTTTACCCTGACCAATCTGGGAGCCCCTGC
CGCCTTCAAGTACTTTGACACCACCATCGACCGGAAGAGGTACACCAGCA
CCAAAGAGGTGCTGGACGCCACCCTGATCCACCAGAGCATCACCGGCCTG
TACGAGACACGGATCGACCTGTCTCAGCTGGGAGGCGAC. Fragment 7 (535 bp) (SEQ
ID NO: 13)
GGCCTGTACGAGACACGGATCGACCTGTCTCAGCTGGGAGGCGACAAAAG
GCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGTAAGAAT
TCCTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCAT
CTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACT
CCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAG
TAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGG
AGGATTGGGAAGAGAATAGCAGGCATGCTGGGGAGCGGCCGCAGGAACCC
CTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGA
GGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCT
CAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGGGCGCCTATCGAATTCC
TGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCC.
[0175] To reconstruct the CRISPR/Cas system described in Cong er al
the above DNA fragments in addition to EcoRV linearised pBlueScript
KS+ vector will be assembled using Gibson Assembly kit (NEB Cat No.
E5510S). As an alternative approach, the 6006 bp fragment can be
assembled by assembly PCR by mixing molar ratio of the individual
DNA fragments together and using the DNA mixture as PCR template.
The assembled PCR product can then be cloned directly into
pBlueScript vector or a standard cloning vector system such as a
TOPO TA cloning kit (Invitrogen).
Reconstructing CRISPR/Cas Vector System (D10A Nickase)
[0176] The D10A nickase version of the CRISPR/Cas system can be
conveniently reconstructed by assembling the above fragments where
fragment 2 is replaced with fragment 2A which contains the D10A
substitution (See sequence below).
TABLE-US-00003 Fragment 2A (852 bp) (SEQ ID NO: 14)
ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTA
CAAAGACGATGACGATAAGATGGCCCCAAAGAAGAAGCGGAAGGTCGGTA
TCCACGGAGTCCCAGCAGCCGACAAGAAGTACAGCATCGGCCTGgccATC
GGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCC
CAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATCAAGA
AGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACAGCCGAGGCC
ACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCG
GATCTGCTATCTGCAAGAGATCTTCAGCAACGAGATGGCCAAGGTGGACG
ACAGCTTCTTCCACAGACTGGAAGAGTCCTTCCTGGTGGAAGAGGATAAG
AAGCACGAGCGGCACCCCATCTTCGGCAACATCGTGGACGAGGTGGCCTA
CCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGAAACTGGTGGACA
GCACCGACAAGGCCGACCTGCGGCTGATCTATCTGGCCCTGGCCCACATG
ATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGACAA
CAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGC
TGTTCGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATC
CTGTCTGCCAGACTGAGCAAGAGCAGACGGCTGGAAAATCTGATCGCCCA
GCTGCCCGGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCCTGA GC.
[0177] The substituted aspartate to alanine is highlighted in bold
and underlined.
Target (Spacer) Sequence Cloning
[0178] The target spacer sequence can be cloned into the above
CRISPR/Cas vector system via the Bbsl restriction sites located
upstream of the chimeric guided RNA sequence. The spacer sequence
can be ordered as oligo pairs and annealed together with overhangs
as shown below to allow direct cloning into Bbsl linearised
CRISPR/Cas vector using standard molecular biology protocols.
[0179] Sequence of an example oligo pair with spacer sequence:
TABLE-US-00004 (SEQ ID NO: 15) 5' - CACCGNNNNNNNNNNNNNNNNNNN - 3'.
(SEQ ID NO: 16) 3' - CNNNNNNNNNNNNNNNNNNNCAAA - 5'.
The 4 bp overhang sequence underlined is required to be included in
the spacer oligos to facilitate cloning into the Bbsl restriction
site in the CRISPR/Cas vector. Using this approach, any spacer
sequence can be conveniently cloned into the CRISPR/Cas vector.
Reconstructing CRISPR/Cas System for One-step Generation of
Transgenic Animals
[0180] In order to reconstitute a CRISPR/Cas system for one-step
generation of transgenic animal as described in Wang et al (Wang H,
Yang H, Shivalila C S, Dawlaty M M, Cheng A W, Zhang F, Jaenisch R:
One-step generation of mice carrying mutations in multiple genes by
CRISPR/Cas-mediated genome engineering. Cell 2013, 153(4):910-918)
where direct embryo injection is used, the above detailed
CRISPR/Cas vector system needs to be modified to incorporate a T7
polymerase promoter to the Cas9 coding sequence. In addition, the
gRNA needs to be removed and synthetised separately by annealing
oligos or produced synthetically (See below for an example
T7-spacer sequence fused to chimeric guided RNA sequence--T7-gRNA).
Note, ideally the spacer sequence will be designed in a unique
region of a given chromosome to minimise off-target effect and also
the respective protospacer genomic sequence needs to have a PAM at
the 3'-end.
Example T7-gRNA Sequence
TABLE-US-00005 [0181] (SEQ ID NO: 17)
TTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGC
TAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT
GGCACCGAGTCGGTGCTTTTTT.
[0182] The underlined 20 by of N's depicts the spacer sequence for
a given target DNA.
[0183] To reconstruct the one-step CRISPR/Cas system, the above
detailed DNA fragments (Fragments 2, 3, 4, 5, 6 & 7) can be
assembled together where fragment 1A (containing 45 bp homology to
pBlueScript KS+ vector 5' to the EcoRV restriction site, human U6
promoter, Bbsl restriction sites, chimeric guided RNA sequence and
chicken b-actin promoter) is replaced with fragment 1, which only
contains 45 bp homology to pBlueScript KS+ vector and the DNA
sequence for T7 polymerase promoter with 45 bp homology to fragment
2. This will create the nuclease version of the CRISPR/Cas system
for one-step generation of transgenic animals. To create the
nickase version, fragment 2 can be replaced with fragment 2A as
detailed above and then fragments 1, 2A, 3, 4, 5, 6 and 7 can be
assembled together either by Gibson assembly or by assembly
PCR.
Fragment 1 (111 bp)
TABLE-US-00006 [0184] (SEQ ID NO: 18)
GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATAATAC
GACTCACTATAGGGAGAATGGACTATAAGGACCACGACGGAGACTACAAG
GATCATGATATT.
Preparation of Oligo/DNA Fragments for HDR-Mediated Repair
[0185] DNA oligos ranging from 15 bp and upwards in excess of
>125 bp will be synthetised through Sigma Custom Oligo synthesis
Service. The oligos can contain any sequence such as a defined
mutation, introduced restriction sites or a sequence of interest
including recombination recognition sequence such as loxP or
derivatives thereof, Frt and derivatives thereof or PiggyBac LTR or
any other transposon elements or regulatory elements including
enhancers, promoter sequence, reporter gene, selection markets and
tags. The oligo design will incorporate DNA homology to the region
where Cas9 mediates double-stranded DNA break or DNA nick. The size
of the homology will range from a few base pairs (2-5 bp) to
upwards and in excess of 80 bp. Larger DNA fragments (>100 bp
ranging up to several kilobases) will be prepared either
synthetically (GeneArt) or by PCR. The DNA fragment will be
synthetised either with or without flanked NLS or only with a
single NLS and either with or without a promoter (e.g., T7
polymerase promoter). The DNA can be prepared as a single stranded
DNA fragment using either the capture biotinylated target DNA
sequence method (Invitrogen: DYNABEADS M-270 Streptavidin) or any
other standard and established single stranded DNA preparation
methodology. The single stranded DNA can be prepared for
microinjection by IVT as described above and the mRNA co-injected
with Cas9 mRNA and gRNA. The DNA fragment can also be co-injected
as a double stranded DNA fragment. The DNA fragment will be flanked
by DNA homology to the site where Cas9 mediates double-stranded DNA
break or DNA nick. The DNA homology can range from a few base pairs
(2-5 bp) and up to or in excess of several kilobases. The DNA
fragment can be used to introduce any endogenous or exogenous
DNA.
[0186] HDR-mediated repair can also be done in ES cells following
CRISPR/Cas-mediated DNA cleavage. The above mentioned donor oligo
or DNA fragment can be co-transfected into ES cells along with the
CRISPR/Cas expression vector.
Production of Cas9 mRNA and gRNA
[0187] Vector containing the T7 polymerase promoter with the coding
region of humanised Cas9 will be PCR amplified using oligos Cas9-F
and Cas9-R. The T7-Cas9 PCR product can be gel extracted and the
DNA purified using Qiagen gel extraction kit. The purified T7-Cas9
DNA will be used for in vitro transcription (IVT) using mMESSAGE
mMACHINE T7 Ultra Kit (Life Technologies Cat No. AM1345). The
vector containing the T7-gRNA can be PCR amplified using oligos
gRNA-F and gRNA-R and once again the PCR products gel purified. IVT
of the T7-gRNA will be carried out using MEGAshortscript T7 Kit
(Life Technologies Cat No. AM1354) and the gRNA purified using
MEGAclear Kit (Life Technologies Cat No. AM1908) and eluted in
RNase-free water.
TABLE-US-00007 (SEQ ID NO: 19) Cas9-F: TTAATACGACTCACTATAGG (SEQ ID
NO: 20) Cas9-R: GCGAGCTCTAGGAATTCTTAC (SEQ ID NO: 21) gRNA-F:
TTAATACGACTCACTATAGG (SEQ ID NO: 22) gRNA-R:
AAAAAAGCACCGACTCGGTGCCAC
ES Cell Transfection Procedure
[0188] Mouse embryonic stem cells AB2.1 and derivatives of this
line will be used for transfecting the mammalian codon optimised
Cas9 and sgRNA from a single expression vector or from separate
vectors if desired. AB2.1 ES cells will be cultured on a PSNL76/7/4
MEF feeder layer in M-15: Knockout DMEM (Gibco, no pyruvate, high
glucose, 15% FBS, 1.times.GPS, 1.times.BME) with standard ES cell
culturing techniques. Transfection of CRISPR/Cas expression vector
along with the optional addition of a donor oligo or DNA fragment
will be done by electroporation using the Amaxa
4D-Nucleofector.RTM. Protocol (Lonza). A plasmid expressing
PGK-Puro will also be optionally co-transfected to promote
transfection efficiency. After transfection ES cells will be plated
back onto feeder plates and Puromycin (2 .mu.g/ml) will be added 72
hours post transfection for 7 days after which colonies will be
picked and genotyped by PCR. Positive colonies will be further
cultured and expanded on feeder layer and selection markers where
necessary will be excised using a PiggyBac transposon system. This
will be done by electroporation of ES cells with a plasmid
containing HyPbase using the Amaxa 4D-Nucleofector.RTM. Protocol
(Lonza). The ES cell will be plated back onto feeder plates. ES
cells will be passaged 2-3 days post transfection and after a
further 2-3 days the ES cells will be plated out at different cells
densities (1:10, 1:20, 1:100 and 1:300) and FIAU (2 .mu.g/ml)
selection will be added 24 hours after replating. Colonies will be
picked and analysed by PCR genotyping after 7-10 days on selection
media. Positive clones will be further cultured and expanded on
feeder layer and sent for zygote (blastocyst) microinjection.
Microiniection of Mouse Zygotes
Materials and Reagents:
[0189] M2 (Sigma M7167)
[0190] Embryo Max KSOM (Speciality media MR-020P-F)
[0191] Hyaluronidase (Sigma H4272)
[0192] Mineral Oil (Sigma, M-8410)
Possible Donor Strains:
[0193] S3F/S3F;KF3/KF3
[0194] S3F/S3F;K4/K4
[0195] S7F/S7F
[0196] K5F/K5F
Preparation of Zygotes and Microinjection:
[0197] The protocol is as described in: A. Nagy Et al. Manipulating
the Mouse Embryo 3.sup.rd Edition. Chapter 7, Protocols 7-1, 7-6,
7-10, 7-11. Cold Spring Harbor Laboratory Press.
In brief: [0198] 1. Zygotes are harvested from E0.5 dpc (day
post-coitum) superovulated female mice. [0199] 2. The zygotes are
incubated in hyaluronidase to disperse cumulus cells. [0200] 3.
Zygotes are collected and transferred to several drops of M2 medium
to rinse off the hyaluronidase solution and debris. Zygotes are
placed into KSOM Media and incubated at 37.degree. C., 5% CO.sub.2
until required. [0201] 4. Zygote quality is assessed and zygotes
with normal morphology are selected for injection, these are placed
in KSOM media and incubated at 37.degree. C., 5% CO.sub.2 until
required.
Microiniection Set Up:
[0202] Injection procedures are performed on a Nikon Eclipse Ti
inverted microscope with Eppendorf micromanipulators and an
Eppendorf femtojet injection system. A slide is prepared by adding
a large drop .about.200 microlitres of M2 into the centre.
Microinjection:
[0203] Place an appropriate number of zygotes onto the slide.
Examine the zygotes and select only those with normal morphology (2
distinct pronuclei are visible). Whilst holding a zygote with a
male pronucleus closest to the injection pipette, carefully push
the injection pipette through the zona pellucida into the
pronucleus, apply injection pressure, the pronucleus should visibly
swell, remove the injection pipette quickly. The injected zygote
can be placed down while the rest are injected.
[0204] At the end of the injection session all viable injected
zygotes should be placed into prepared dishes containing drops of
KSOM and incubated until ready to surgically implant. They are
incubated for 2-3 hours before surgically implanting into pseudo
pregnant females. Pups will be born 21 days later.
Example 6
Single Copy Cas9 Expression in ES Cells
[0205] Reference is made to FIG. 7. [0206] 1. A landing pad
consisting of a PiggyBac transposon element with the following
features will be targeted into mouse ES cells (e.g., 129-derived ES
cells, such as AB2.1 ES cells; Baylor College of Medicine, Texas,
USA) and selected for on G418. The PiggyBac transposon element will
contain neomycin resistance gene flanked by loxP and lox2272. It
will also have a geneless PGK promoter. In this example, the
landing pad will be targeted into the introgenic region of Rosa26
gene located on chromosome 6, but it could be targeted elsewhere.
Targeting this landing pad in the Rosa26 gene will provide a
universal ES cell line for precisely inserting any desired DNA
fragment including DNA fragments containing Cas9, mutant Cas9 or
any other gene of interest via RMCE with high efficiency. Targeting
Rosa26 is beneficial since the targeted construct will be inserted
as a single copy (unlike random integration elsewhere) and is
unlikely to produce an unwanted phenotypic effect. [0207] Note.
This landing pad can be inserted into any gene in any chromosome or
indeed in any eukaryotic or mammalian cell line, e.g., a human,
insect, plant, yeast, mouse, rat, rabbit, rodent, pig, dog, cat,
fish, chicken or bird cell line, followed by generation of the
respective transgenic organism expressing Cas9.
[0208] Rosa 26 Locus
[0209] Ubiquitous expression of transgene in mouse embryonic stem
cell can be achieved by gene targeting to the ROSA26 locus (also
known as: gene trap ROSA 26 or Gt(ROSA)26) by homologous
recombination (Ref. (a) and (b) below). The genomic coordinates for
mouse C57BL/6J Rosa26 gene based on Ensemble release 73--September
2013 is: Chromosome 6: 113,067,428-113,077,333; reverse strand.
[0210] The Rosa26 locus can also be used to as a recipient location
to knock-in a transgene. In our example we have use the Rosa26
locus to knock-in the landing pad vector by targeting through
homologous recombination into the intronic region located between
exons 2 and 3 of mouse strain 129-derived embryonic stem cells
using approx. 3.1 kb homology arms. The homology arms were
retrieved by recombineering from a BAC Clone generated from mouse
strain 129. The sequence of the Rosa26 homology arms used for
targeting is given below.
TABLE-US-00008 Sequence of Rosa26 5' homology arm (SEQ ID NO: 23)
CACATTTGGTCCTGCTTGAACATTGCCATGGCTCTTAAAGTCTTAATTAA
GAATATTAATTGTGTAATTATTGTTTTTCCTCCTTTAGATCATTCCTTGA
GGACAGGACAGTGCTTGTTTAAGGCTATATTTCTGCTGTCTGAGCAGCAA
CAGGTCTTCGAGATCAACATGATGTTCATAATCCCAAGATGTTGCCATTT
ATGTTCTCAGAAGCAAGCAGAGGCATGATGGTCAGTGACAGTAATGTCAC
TGTGTTAAATGTTGCTATGCAGTTTGGATTTTTCTAATGTAGTGTAGGTA
GAACATATGTGTTCTGTATGAATTAAACTCTTAAGTTACACCTTGTATAA
TCCATGCAATGTGTTATGCAATTACCATTTTAAGTATTGTAGCTTTCTTT
GTATGTGAGGATAAAGGTGTTTGTCATAAAATGTTTTGAACATTTCCCCA
AAGTTCCAAATTATAAAACCACAACGTTAGAACTTATTTATGAACAATGG
TTGTAGTTTCATGCTTTTAAAATGCTTAATTATTCAATTAACACCGTTTG
TGTTATAATATATATAAAACTGACATGTAGAAGTGTTTGTCCAGAACATT
TCTTAAATGTATACTGTCTTTAGAGAGTTTAATATAGCATGTCTTTTGCA
ACATACTAACTTTTGTGTTGGTGCGAGCAATATTGTGTAGTCATTTTGAA
AGGAGTCATTTCAATGAGTGTCAGATTGTTTTGAATGTTATTGAACATTT
TAAATGCAGACTTGTTCGTGTTTTAGAAAGCAAAACTGTCAGAAGCTTTG
AACTAGAAATTAAAAAGCTGAAGTATTTCAGAAGGGAAATAAGCTACTTG
CTGTATTAGTTGAAGGAAAGTGTAATAGCTTAGAAAATTTAAAACCATAT
AGTTGTCATTGCTGAATATCTGGCAGATGAAAAGAAATACTCAGTGGTTC
TTTTGAGCAATATAACAGCTTGTTATATTAAAAATTTTCCCCACAGATAT
AAACTCTAATCTATAACTCATAAATGTTACAAATGGATGAAGCTTACAAA
TGTGGCTTGACTTGTCACTGTGCTTGTTTTAGTTATGTGAAAGTTTGGCA
ATAAACCTATGTCCTAAATAGTCAAACTGTGGAATGACTTTTTAATCTAT
TGGTTTGTCTAGAACAGTTATGTTGCCATTTGCCCTAATGGTGAAAGAAA
AAGTGGGGAGTGCCTTGGCACTGTTCATTTGTGGTGTGAACCAAAGAGGG
GGGCATGCACTTACACTTCAAACATCCTTTTGAAAGACTGACAAGTTTGG
GTCTTCACAGTTGGAATTGGGCATCCCTTTTGTCAGGGAGGGAGGGAGGG
AGGGAGGCTGGCTTGTTATGCTGACAAGTGTGATTAAATTCAAACTTTGA
GGTAAGTTGGAGGAACTTGTACATTGTTAGGAGTGTGACAATTTGGACTC
TTAATGATTTGGTCATACAAAATGAACCTAGACCAACTTCTGGAAGATGT
ATATAATAACTCCATGTTACATTGATTTCACCTGACTAATACTTATCCCT
TATCAATTAAATACAGAAGATGCCAGCCATCTGGGCCTTTTAACCCAGAA
ATTTAGTTTCAAACTCCTAGGTTAGTGTTCTCACTGAGCTACATCCTGAT
CTAGTCCTGAAAATAGGACCACCATCACCCCCAAAAAAATCTCAAATAAG
ATTTATGCTAGTGTTTCAAAATTTTAGGAATAGGTAAGATTAGAAAGTTT
TAAATTTTGAGAAATGGCTTCTCTAGAAAGATGTACATAGTGAACACTGA
ATGGCTCCTAAAGAGCCTAGAAAACTGGTACTGAGCACACAGGACTGAGA
GGTCTTTCTTGAAAAGCATGTATTGCTTTACGTGGGTCACAGAAGGCAGG
CAGGAAGAACTTGGGCTGAAACTGGTGTCTTAAGTGGCTAACATCTTCAC
AACTGATGAGCAAGAACTTTATCCTGATGCAAAAACCATCCAAACAAACT
AAGTGAAAGGTGGCAATGGATCCCAGGCTGCTCTAGAGGAGGACTTGACT
TCTCATCCCATCACCCACACCAGATAGCTCATAGACTGCCAATTAACACC
AGCTTCTAGCCTCCACAGGCACCTGCACTGGTACACATAATTTCACACAA
ACACAGTAAGAAGCCTTCCACCTGGCATGGTATTGCTTATCTTTAGTTCC
CAACACTTGGGAGGCAGAGGCCAGCCAGGGCTATGTGACAAAAACCTTGT
CTAGAGGAGAAACTTCATAGCTTATTTCCTATTCACGTAACCAGGTTAGC
AAAATTTACCAGCCAGAGATGAAGCTAACAGTGTCCACTATATTTGTAGT
GTTTTAAGTCAATTTTTTAAATATACTTAATAGAATTAAAGCTATGGTGA
ACCAAGTACAAACCTGGTGTATTAACTTGAGAACTTAGCATAAAAAGTAG
TTCATTTGTTCAGTAAATATTAAATGCTTACTGGCAAAGATTATGTCAGG
AACTTGGTAAATGGTGATGAAACAATCATAGTTGTACATCTTGGTTCTGT
GATCACCTTGGTTTGAGGTAAAAGTGGTTCCTTTGATCAAGGATGGAATT
TTAAGTTTATATTCAATCAATAATGTATTATTTTGTGATTGCAAAATTGC
CTATCTAGGGTATAAAACCTTTAAAAATTTCATAATACCAGTTCATTCTC
CAGTTACTAATTCCAAAAAGCCACTGACTATGGTGCCAATGTGGATTCTG
TTCTCAAAGGAAGGATTGTCTGTGCCCTTTATTCTAATAGAAACATCACA
CTGAAAATCTAAGCTGAAAGAAGCCAGACTTTCCTAAATAAATAACTTTC
CATAAAGCTCAAACAAGGATTACTTTTAGGAGGCACTGTTAAGGAACTGA
TAAGTAATGAGGTTACTTATATAATGATAGTCCCACAAGACTATCTGAGG
AAAAATCAGTACAACTCGAAAACAGAACAACCAGCTAGGCAGGAATAACA
GGGCTCCCAAGTCAGGAGGTCTATCCAACACCCTTTTCTGTTGAGGGCCC
CAGACCTACATATTGTATACAAACAGGGAGGTGGGTGATTTTAACTCTCC TGAGGTAC
Sequence of Rosa26 3' homology arm (SEQ ID NO: 14)
CTTGGTAAATCTTTGTCCTGAGTAAGCAGTACAGTGTACAGTTTACATTT
TCATTTAAAGATACATTAGCTCCCTCTACCCCCTAAGACTGACAGGCACT
TTGGGGGTGGGGAGGGCTTTGGAAAATAACGCTTCCATACACTAAAAGAG
AAATTTCTTTAATTAGGCTTGTTGGTTCCATACATCTACTGGTGTTTCTA
CTACTTAGTAATATTATAATAGTCACACAAGCATCTTTGCTCTGTTTAGG
TTGTATATTTATTTTAAGGCAGATGATAAAACTGTAGATCTTAAGGGATG
CTTCTGCTTCTGAGATGATACAAAGAATTTAGACCATAAAACAGTAGGTT
GCACAAGCAATAGAATATGGCCTAAAGTGTTCTGACACTTAGAAGCCAAG
CAGTGTAGGCTTCTTAAGAAATACCATTACAATCACCTTGCTAGAAATCA
AGCATTCTGGAGTGGTCAAGCAGTGTAACCTGTACTGTAAGTTACTTTTC
TGCTATTTTTCTCCCAAAGCAAGTTCTTTATGCTGATATTTCCAGTGTTA
GGAACTACAAATATTAATAAGTTGTCTTCACTCTTTTCTTTACCAAGGAG
GGTCTCTTCCTTCATCTTGATCTGAAGGATGAACAAAGGCTTGAGCAGTG
CGCTTTAGAAGATAAACTGCAGCATGAAGGCCCCCGATGTTCACCCAGAC
TACATGGACCTTTCGCCACACATGTCCCATTCCAGATAAGGCCTGGCACA
CACAAAAAACATAAGTCATTAGGCTACCAGTCTGATTCTAAAACAACCTA
AAATCTTCCCACTTAAATGCTATGGGTGGTGGGTTGGAAAGTTGACTCAG
AAAATCACTTGCTGTTTTTAGAGAGGATCTGGGTTCAGTTTCTGATACAT
TGTGGCTTACAACTATAACTCCAGTTCTAGGGGGTCCATCCAACATCCTC
TTCTGTTGAGGGCACCAAATAAATGTATTGTGTACAAACAGGGAGGTGAG
TGATTTAACTCTCGTGTATAGTACCTTGGTAAAACATTTCTTGTCCTGAG
TAAGCAGTACAGCTCTGCCTGTCCCTGGTCTACAGACACGGCTCATTTCC
CGAAGGCAAGCTGGATAGAGATTCCAATTTCTCTTCTTGGATCCCATCCT
ATAAAAGAAGGTCAAGTTTAATCTATTGCAAAAGGTAAATAGGTAGTTTC
TTACATGAGACAAGAACAAATCTTAGGTGTGAAGCAGTCATCTTTTACAG
GCCAGAGCCTCTATTCTATGCCAATGAAGGAAACTGTTAGTCCAGTGTTA
TAGAGTTAGTCCAGTGTATAGTTTTCTATCAGAACACTTTTTTTTTAAAC
AACTGCAACTTAGCTTATTGAAGACAAACCACGAGTAGAAATCTGTCCAA
GAAGCAAGTGCTTCTCAGCCTACAATGTGGAATAGGACCATGTAATGGTA
CAGTGAGTGAAATGAATTATGGCATGTTTTTCTGACTGAGAAGACAGTAC
AATAAAAGGTAAACTCATGGTATTTATTTAAAAAGAATCCAATTTCTACC
TTTTTCCAAATGGCATATCTGTTACAATAATATCCACAGAAGCAGTTCTC
AGTGGGAGGTTGCAGATATCCCACTGAACAGCATCAATGGGCAAACCCCA
GGTTGTTTTTCTGTGGAGACAAAGGTAAGATATTTCAATATATTTTCCCA
AGCTAATGAGATGGCTCAGCAAATAATGGTACTGGCCATTAAGTCTCATG
ACCTGAGCTTGATCCTCAGGGACCATGTGGTACAAGGAGAGACCTAAATC
CTTCAGTTGGACTTCAATCTTCTACCCTCATGTCCACACACAAATAAATA
CAATAAAAAACATTCTGCAGTCTGAATTTCTAAAGGTTGTTTTTCTAAAA
AGAAATGTTAAAGTAACATAGGAAGAAATATGTCCATAACTGAAATACAA
GTTTTTTAAATGGTTAAGACTGGTTTTCAAAGGATGTATGGTTAAGAAAA
TACCAGGGAAAATGAGCTTACATGTAAAAAAGTGTCTAAAAGGCCAGAGA
AATGACCCAGCTGGCAAAGGTGTCTGCCCTAAGCCAGACAAAAGGAATTT
GATTCACAGGAAGAAGAGACCCAACTCTCACTAGTTATCCTCTGACTTCC
ACACCATGACACAGCTCCATGGCACTCTCAGGCCCCCACACATATACAGA
TATAAACAGAAACCTAATCCACCAGCCTTCAGAAGCAAAGCAATTGGAGG
ATTTAAACAGGCCATGGCTACTAATAGAGATAACTGGTAGTTTAAAAGTT
ATGGTAATGACTTTCATGCTTCTTTCAACTCATATTGTTCTAAATAATTA
ATTTGGTTTTTCAAGGCAGGGTTTCTCTGTGTAGTTCTGGCTGTCCTGGA
ACTCACTCTGTAGACCAGGCTGGCCTTGAACTCAGATCCATCTGCCTCTG
GAATAAGGGCACGTGCGTGCCTTTTCTACATAACAAAACCTATACTATAA
CAAAACCTATACCATACTGTACCGTTTTGGGAAAAGACAAAAAATAATGA
ACAAAAAAGGAGAAATAACATTCCAATAAAGTATGGAAATGGTAGTTAAA
TTAATTACAAATGTTTTTCAGTAAATTAGATGTGACTTCTCATACTGTTC
ATTTGGCTATAATGATACCACAAAGCACTGGGGGTGAATAATAATTCCAA
GTCAGTAGGGAGAGAGACTTGAAAAGATGCAATGCAATCATTGAAGTTAA
ACTTACCCATCTTTAATCTGGCTCTTAGTCAATAGAGATGAGATGTTATT
TGCTGCTCTGTTCACTGCCAGTGGGTTATTGTCCCCAGCAATATGGTAAC
AGTGAGACCACTCAGTAGCCCCCTATGAGACAGGAGTGTTGGTTAAACAT
GCCACAAGAGAAAAGGGAAAAGTCACTATGGCCAACTCTCAGTAACATGG
CAATCCGTGCCATTCATTTCCTTGCCAGAAATGTCTTCCCTGTTCTTCTG
CCTACTGAACTTTCACCCACTAGAAATGTGGCTCCAATGTCATCCACTAT
GACATCAATGTCAGCGCTAGAAGCACTTTGCACACCTCTGTTGCTGACTT AG
REFERENCE
[0211] a) Pablo Perez-Pinera, David G. Ousterout, Matthew T. Brown
and Charles A. Gersbach (2012) Gene targeting to the ROSA26 locus
directed by engineered zinc finger nucleases. Nucleic Acids
Research, 2012, Vol. 40, No. 8 3741-3752 [0212] b) Peter
Hohenstein, Joan Slight, Derya Deniz Ozdemir, Sally F Burn, Rachel
Berry and Nicholas D Hastie (2008) High-efficiency Rosa26 knock-in
vector construction for Cre-regulated overexpression and RNAi.
PathoGenetics 2008, 1:3 [0213] 2. A recombinase mediated cassette
exchange (RMCE)-enabled vector containing a promoterless
puromycin-delta-tk with in-frame fusion of T2A at the C-terminus
following by either Cas9 or mutant Cas9 nucleotide sequence and a
series of unique restriction sites flanked by loxP and lox2272 will
allow for the direct targeting of this vector into the landing pad
by Cre-mediated RMCE. As is known, T2A allows ribosomal skipping
during translation. The insertion of the coding sequence of T2A
between two genes results in two products (one gene, one transcript
but two proteins expressed, in this case the Cas9 and selection
marker). ES clones containing the correctly inserted DNA fragment
can be directly selected on puromycin. This approach also
advantageously ensures single copy expression of Cas9 as suppose to
a random integration or transient expression approach. Insertion of
the RMCE enabled vector into the desired locus containing the
landing pad can be selected directly as the PGK promoter in the
landing pad will drive the transcription of the promoterless
Puro-Delta-Tk and Cas9. Since the Puro-delta-Tk is in the same
transcriptional unit as Cas9, ES clones selected on puromycin will
ensure expression of Cas9. [0214] 3. The above strategy allows for
three separate approaches to express the sgRNA designed for
disrupting (mutation through indel formation, deletion or deletion
followed by insertion) gene of interest. [0215] a. The above ES
cell line containing Cas9 can be used for generating transgenic
mice with either constitutively expressed Cas9 or modified for
inducible Cas9 expression or indeed tissue specific Cas9 expression
for example expression of Cas9 at an embryo stage using Nanog-,
Pou5f1- or SoxB promoter-specifc Cas9 expression. Such derived
mouse line expressing Cas9 can be used for genome editing in a
streamline fashion whereby in vitro transcribed sgRNA can be easily
injected into embryos obtained from such transgenic mice. This will
enhance the efficiency of generating mouse lines with the desired
homozygous genotype and thus will dramatically reduce the number of
animals required. [0216] b. sgRNA can be transfected directly into
the ES cells expressing Cas9 and thus avoids the requirement for
cloning into the RMCE enabled vector single or multiple sgRNA. This
approach will allow multiple sgRNA to be inserted into the ES cells
simultaneously very rapidly. [0217] c. Multiple sgRNA can be cloned
directly into the multiple cloning site of the RMCE enabled vector
(i.e., using a plurality of different restriction endonuclease
sites) to allow single copy expression of the guide-RNA. This
approach may be useful for limiting off-target effects particularly
relevant for those genes with high sequence homology within the
genome. [0218] 4. ES cells expressing Cas9 and sgRNA can be
selected for directly on medium containing puromycin. Selection on
puromycin for 4-6 days will allow for the desired location to be
mutated or disrupted and the advantage of manipulating ES cells is
that individual clones can be analysed by PCR followed by
sequencing for the desired mutation. Only correctly mutated ES cell
clones can be processed further whereby inserted DNA element
introduced through insertion of the landing pad and the subsequent
insertion of the RMCE vector can be completely removed leaving the
ES cell devoid of any alteration other than the intended mutation
induced by the action of Cas9 and the sgRNA. This can be done
through transiently expressing PBase transposon followed by
selection on FIAU. Removal of the constitutively expressed Cas9
with only the minimal length of time required to induce mutation in
the presence of sgRNA will reduce or eliminate the possibility of
Cas9 inducing unwanted mutations. [0219] 5. ES Clones containing
the desired mutation can be injected into blastocyst to generate
transgenic mice.
[0220] In Table 1, sequence identification numbers for sequences
from top to bottom in the column under the header "CRISPR Consensus
sequences" are SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID
NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32,
SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 and SEQ
ID NO: 37. The sequence identification numbers for sequences from
top to bottom in the column under the header "Leaders" are SEQ ID
NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42,
SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID
NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51,
SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID
NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60
and SEQ ID NO: 61.
TABLE-US-00009 TABLE 1 PAM conservation in repeats and leaders for
various CRISPR types (reproduced from Short motif sequences
determine the targets of the prokaryotic CRISPR de- fence system F.
J. M. Mojica, C. Diez-Villasenor, J. Garcia-Martinez, C. Almendros
Microbiology(2009), 155, 733-740) Genomes* PAM CRISPR
Consensus.dagger. Leaders.dagger-dbl. Group 1 Mth NGG
ATTTCAATCCCATTTTGGTCTGATTTTAAC AGGGCGGATT ATGGCCAATT Lmo WGG
ATTTACATTTTCAHAATAAGTARYTAAAAC CCACTAACTT CCGCTCTATT Group 2 Eco
CWT CGGTTTATCCCCGCTGGCGCGGGGAACWC TCTAAACATA TCTAAAAGTA Pae CTT
CGGTTCATCCCCACRCMYGTGGGGAACAC ACTTACCGTA CCTTACCGTA Group 3 Spy GAA
ATTTCAATCCACTCACCCATGAAGGGTGAGAC TGCGCCAAAT Xan GAA
GTTTCAATCCACGCGCCCGTGAGGRCGCGAC CCCCCCTTAG GCCGCCAGCA Group 4 She
GG TTTCTAAGCCGCCTGTGCGGCGGTGAAC AATAGCTTAT TGTAGAATAA Pae GG
TTTCTTAGCTGCCTATACGGCAGTGAAC TAGCTCCGAA TAGACCAAAA Ype GG
TTTCTAAGCTGCCTGTGCGGCAGTGAAC GTAAGATAAT Group 7 Sso NGG
CTTTCAATTCTATAAGAGATTATC TGAGGGTTTA Mse NGG
CTTTCAACTCTATAGGAGATTAAC TGATACCTTT TGAAACTTTT TGACACTCTT Group 10
Str NGG GTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAAC CTCGTAGACT CTCGTAGAAA
Lis NGG GTTTTAGAGCTATGTTATTTTGAATGCTAMCAAAAC CTCGCAGAAT CTCGTAGAAT
*Genomes are abbreviated according to the denominations of the
species or genera carrying the corresponding CRISPR arrays: Mth, M.
thermautotrophicus; Lmo, L. monocytogenes; Eco, E. coli, Pae, P.
aeruginosa; Spy, S. pyogenes; Xan, Xanthomonas spp.; She,
Shewanella spp.; Ype, Y. pestis; Sso, S. solfataricus; Mse, M.
sedula; Str, Streptococcus spp.; Lis, Listeria spp.
.dagger.Sequences matching the PAM are underlined.
.dagger-dbl.Representative CRISPR array proximal Leader sequences.
Nucleotides matching the PAM are underlined.
TABLE-US-00010 TABLE 2 CRISPR-Associated Endonucleases [Gene ID
numbers refer to genes in the NCBI Gene Database as at September
2013; all sequence information relating to the gene IDs below is
incorporated herein by reference for possible use in the present
invention] 1. Plav_0099 CRISPR-associated endonuclease Csn1 family
protein[Parvibaculum lavamentivorans DS-1] Other Aliases: Plav_0099
Genomic context: Chromosome Annotation: NC_009719.1 (105795 . . .
108908, complement) ID: 5454634 2. FTN_0757 membrane
protein[Francisella novicida U112] Other Aliases: FTN_0757 Genomic
context: Chromosome Annotation: NC_008601.1 (810052 . . . 814941)
ID: 4548251 3. Cj1523c CRISPR-associated protein[Campylobacter
jejuni subsp. jejuni NCTC 11168 = ATCC 700819] Other Aliases:
Cj1523c Genomic context: Chromosome Annotation: NC_002163.1
(1456880 . . . 1459834, complement) ID: 905809 4. mcrA restriction
endonuclease[Bifidobacterium longum DJO10A] Other Aliases: BLD_1902
Genomic context: Chromosome Annotation: NC_010816.1 (2257993 . . .
2261556) ID: 6362834 5. MGA_0519 Csn1 family CRISPR-associated
protein[Mycoplasma gallisepticum str. R(low)] Other Aliases:
MGA_0519 Genomic context: Chromosome Annotation: NC_004829.2
(919248 . . . 923060) ID: 1089911 6. Emin_0243 CRISPR-associated
endonuclease Csn1 family protein[Elusimicrobium minutum Pei191]
Other Aliases: Emin_0243 Genomic context: Chromosome Annotation:
NC_010644.1 (261119 . . . 264706) ID: 6263045 7. FTW_1427
CRISPR-associated large protein[Francisella tularensis subsp.
tularensis WY96-3418] Other Aliases: FTW_1427 Genomic context:
Chromosome Annotation: NC_009257.1 (1332426 . . . 1335803,
complement) ID: 4958852 8. SMA_1444 CRISPR-associated protein, Csn1
family[Streptococcus macedonicus ACA-DC 198] Other Aliases:
SMA_1444 Annotation: NC_016749.1 (1418337 . . . 1421729,
complement) ID: 11601419 9. SSUST3_1318 CRISPR-associated protein,
Csn1 family[Streptococcus suis ST3] Other Aliases: SSUST3_1318
Genomic context: Chromosome Annotation: NC_015433.1 (1323872 . . .
1327240, complement) ID: 10491484 10. cas5 CRISPR-associated
protein, Csn1 family[Streptococcus gallolyticus UCN34] Other
Aliases: GALLO_1439 Genomic context: Chromosome Annotation:
NC_013798.1 (1511433 . . . 1514825, complement) ID: 8776949 11.
GALLO_1446 CRISPR-associated protein[Streptococcus gallolyticus
UCN34] Other Aliases: GALLO_1446 Genomic context: Chromosome
Annotation: NC_013798.1 (1518984 . . . 1523110, complement) ID:
8776185 12. csn1 CRISPR-associated endonuclease
Csn1[Bifidobacterium dentium Bd1] Other Aliases: BDP_1254 Genomic
context: Chromosome Annotation: NC_013714.1 (1400576 . . . 1403992,
complement) ID: 8692053 13. NMO_0348 putative CRISPR-associated
protein[Neisseria meningitidis alpha14] Other Aliases: NMO_0348
Genomic context: Chromosome Annotation: NC_013016.1 (369547 . . .
372795, complement) ID: 8221228 14. csn1 CRISPR-Associated Protein
Csn1[Streptococcus equi subsp. zooepidemicus MGCS10565] Other
Aliases: Sez_1330 Genomic context: Chromosome Annotation:
NC_011134.1 (1369339 . . . 1373385, complement) ID: 6762114 15.
csn1 CRISPR-associated endonuclease Csn1 family
protein[Streptococcus gordonii str. Challis substr. CH1] Other
Aliases: SGO_1381 Genomic context: Chromosome Annotation:
NC_009785.1 (1426750 . . . 1430160, complement) ID: 5599802 16.
M28_Spy0748 cytoplasmic protein[Streptococcus pyogenes MGAS6180]
Other Aliases: M28_Spy0748 Genomic context: Chromosome Annotation:
NC_007296.1 (771231 . . . 775337) ID: 3573516 17. SGGBAA2069_c14690
CRISPR-associated protein[Streptococcus gallolyticus subsp.
gallolyticus ATCC BAA-2069] Other Aliases: SGGBAA2069_c14690
Genomic context: Chromosome Annotation: NC_015215.1 (1520905 . . .
1525017, complement) ID: 10295470 18. SAR116_2544 CRISPR-associated
protein, Csn1 family[Candidatus Puniceispirillum marinum IMCC1322]
Other Aliases: SAR116_2544 Genomic context: Chromosome Annotation:
NC_014010.1 (2748992 . . . 2752099) ID: 8962895 19. TDE0327
CRISPR-associated Cas5e[Treponema denticola ATCC 35405] Other
Aliases: TDE0327 Genomic context: Chromosome Annotation:
NC_002967.9 (361021 . . . 365208) ID: 2741543 20. csn1
CRISPR-associated protein[Streptococcus pasteurianus ATCC 43144]
Other Aliases: SGPB_1342 Genomic context: Chromosome Annotation:
NC_015600.1 (1400035 . . . 1403427, complement) ID: 10753339 21.
cas9 CRISPR-associated protein[Corynebacterium ulcerans BR-AD22]
Other Aliases: CULC22_00031 Genomic context: Chromosome Annotation:
NC_015683.1 (30419 . . . 33112, complement) ID: 10842578 22.
MGAS2096_Spy0843 putative cytoplasmic protein[Streptococcus
pyogenes MGAS2096] Other Aliases: MGAS2096_Spy0843 Genomic context:
Chromosome Annotation: NC_008023.1 (813084 . . . 817190) ID:
4066021 23. MGAS9429_Spy0885 cytoplasmic protein[Streptococcus
pyogenes MGAS9429] Other Aliases: MGAS9429_Spy0885 Genomic context:
Chromosome Annotation: NC_008021.1 (852508 . . . 856614) ID:
4061575 24. AZL_009000 CRISPR-associated protein, Csn1
family[Azospirillum sp. B510] Other Aliases: AZL_009000 Genomic
context: Chromosome Annotation: NC_013854.1 (1019522 . . . 1023028,
complement) ID: 8789261 25. EUBREC_1713 contains RuvC-like nuclease
and HNH-nuclease domains[Eubacterium rectale ATCC 33656] Other
Aliases: EUBREC_1713 Other Designations: CRISPR-system related
protein Genomic context: Chromosome Annotation: NC_012781.1
(1591112 . . . 1594456) ID: 7963668 26. Alide2_0194
CRISPR-associated protein, Csn1 family[Alicycliphilus denitrificans
K601] Other Aliases: Alide2_0194 Genomic context: Chromosome
Annotation: NC_015422.1 (218107 . . . 221196) ID: 10481210 27.
Alide_0205 crispr-associated protein, csn1 family[Alicycliphilus
denitrificans BC] Other Aliases: Alide_0205 Genomic context:
Chromosome Annotation: NC_014910.1 (228371 . . . 231460) ID:
10102228 28. STER_1477 CRISPR-system-like protein[Streptococcus
thermophilus LMD-9] Other Aliases: STER_1477 Genomic context:
Chromosome Annotation: NC_008532.1 (1379975 . . . 1384141,
complement) ID: 4437923 29. STER_0709 CRISPR-system-like
protein[Streptococcus thermophilus LMD-9] Other Aliases: STER_0709
Genomic context: Chromosome Annotation: NC_008532.1 (643235 . . .
646600) ID: 4437391 30. cas9 CRISPR-associated
protein[Corynebacterium diphtheriae 241] Other Aliases: CD241_2102
Genomic context: Chromosome Annotation: NC_016782.1 (2245769 . . .
2248399) ID: 11674395 31. cas3 CRISPR-associated
endonuclease[Corynebacterium diphtheriae 241] Other Aliases:
CD241_0034 Genomic context: Chromosome Annotation: NC_016782.1
(35063 . . . 38317) ID: 11672999 32. Corgl_1738 CRISPR-associated
protein, Csn1 family[Coriobacterium glomerans PW2] Other Aliases:
Corgl_1738 Genomic context: Chromosome Annotation: NC_015389.1
(2036091 . . . 2040245) ID: 10439994 33. Fluta_3147
CRISPR-associated protein, Csn1 family[Fluviicola taffensis DSM
16823] Other Aliases: Fluta_3147 Genomic context: Chromosome
Annotation: NC_015321.1 (3610221 . . . 3614597, complement) ID:
10398516 34. Acav_0267 CRISPR-associated protein, Csn1
family[Acidovorax avenae subsp. avenae ATCC 19860] Other Aliases:
Acav_0267 Genomic context: Chromosome Annotation: NC_015138.1
(295839 . . . 298976) ID: 10305168 35. NAL212_2952
CRISPR-associated protein, Csn1 family[Nitrosomonas sp. AL212]
Other Aliases: NAL212_2952 Genomic context: Chromosome Annotation:
NC_015222.1 (2941806 . . . 2944940, complement) ID: 10299493 36.
SpiBuddy_2181 CRISPR-associated protein, Csn1 family[Sphaerochaeta
globosa str. Buddy] Other Aliases: SpiBuddy_2181 Genomic context:
Chromosome Annotation: NC_015152.1 (2367952 . . . 2371491,
complement) ID: 10292274 37. Tmz1t_2411 HNH endonuclease[Thauera
sp. MZ1T] Other Aliases: Tmz1t_2411 Genomic context: Plasmid pTha01
Annotation: NC_011667.1 (75253 . . . 76200, complement) ID: 7094333
38. Gdia_0342 Csn1 family CRISPR-associated
protein[Gluconacetobacter diazotrophicus PAI 5] Other Aliases:
Gdia_0342 Genomic context: Chromosome Annotation: NC_011365.1
(382737 . . . 385748) ID: 6973736
39. JJD26997_1875 CRISPR-associated Cas5e family
protein[Cannpylobacter jejuni subsp. doylei 269.97] Other Aliases:
JJD26997_1875 Genomic context: Chromosome Annotation: NC_009707.1
(1656109 . . . 1659063, complement) ID: 5389688 40. Asuc_0376
CRISPR-associated endonuclease Csn1 family protein[Actinobacillus
succinogenes 130Z] Other Aliases: Asuc_0376 Genomic context:
Chromosome Annotation: NC_009655.1 (431928 . . . 435116) ID:
5348478 41. Veis_1230 CRISPR-associated endonuclease Csn1 family
protein[Verminephrobacter eiseniae EF01-2] Other Aliases: Veis_1230
Genomic context: Chromosome Annotation: NC_008786.1 (1365979 . . .
1369185) ID: 4695198 42. MGAS10270_Spy0886 putative cytoplasmic
protein[Streptococcus pyogenes MGAS10270] Other Aliases:
MGAS10270_Spy0886 Genomic context: Chromosome Annotation:
NC_008022.1 (844446 . . . 848552) ID: 4063984 43. gbs0911
hypothetical protein[Streptococcus agalactiae NEM316] Other
Aliases: gbs0911 Genomic context: Chromosome Annotation:
NC_004368.1 (945801 . . . 949946) ID: 1029893 44. NMA0631
hypothetical protein[Neisseria meningitidis Z2491] Other Aliases:
NMA0631 Genomic context: Chromosome Annotation: NC_003116.1 (610868
. . . 614116, complement) ID: 906626 45. Ccan_14650 hypothetical
protein[Capnocytophaga canimorsus Cc5] Other Aliases: Ccan_14650
Genomic context: Chromosome Annotation: NC_015846.1 (1579873 . . .
1584165, complement) ID: 10980451 46. Ipp0160 hypothetical
protein[Legionella pneumophila str. Paris] Other Aliases: Ipp0160
Genomic context: Chromosome Annotation: NC_006368.1 (183831 . . .
187949) ID: 3118625 47. Cbei_2080 hypothetical protein[Clostridium
beijerinckii NCIMB 8052] Other Aliases: Cbei_2080 Genomic context:
Chromosome Annotation: NC_009617.1 (2422056 . . . 2423096) ID:
5296367 48. MMOB0330 hypothetical protein[Mycoplasma mobile 163K]
Other Aliases: MMOB0330 Genomic context: Chromosome Annotation:
NC_006908.1 (45652 . . . 49362, complement) ID: 2807677 49.
MGF_5203 Csn1 family CRISPR-associated protein[Mycoplasma
gallisepticum str. F] Other Aliases: MGF_5203 Genomic context:
Chromosome Annotation: NC_017503.1 (888602 . . . 892411) ID:
12397088 50. MGAH_0519 Csn1 family CRISPR-associated
protein[Mycoplasma gallisepticum str. R(high)] Other Aliases:
MGAH_0519 Genomic context: Chromosome Annotation: NC_017502.1
(918476 . . . 922288) ID: 12395725 51. Smon_1063 CRISPR-associated
protein, Csn1 family[Streptobacillus moniliformis DSM 12112] Other
Aliases: Smon_1063 Genomic context: Chromosome Annotation:
NC_013515.1 (1159048 . . . 1162827, complement) ID: 8600791 52.
Spy49_0823 hypothetical protein[Streptococcus pyogenes NZ131] Other
Aliases: Spy49_0823 Genomic context: Chromosome Annotation:
NC_011375.1 (821210 . . . 825316) ID: 6985827 53. C8J_1425
hypothetical protein[Campylobacter jejuni subsp. jejuni 81116]
Other Aliases: C8J_1425 Genomic context: Chromosome Annotation:
NC_009839.1 (1442672 . . . 1445626, complement) ID: 5618449 54.
FTF0584 hypothetical protein[Francisella tularensis subsp.
tularensis FSC198] Other Aliases: FTF0584 Genomic context:
Chromosome Annotation: NC_008245.1 (601115 . . . 604486) ID:
4200457 55. FTT_0584 hypothetical protein[Francisella tularensis
subsp. tularensis SCHU S4] Other Aliases: FTT_0584 Genomic context:
Chromosome Annotation: NC_006570.2 (601162 . . . 604533) ID:
3191177 56. csn1 CRISPR-associated protein[Streptococcus
dysgalactiae subsp. equisimilis RE378] Other Aliases: GGS_1116
Annotation: NC_018712.1 (1169559 . . . 1173674, complement) ID:
13799322 57. SMUGS5_06270 CRISPR-associated protein
csn1[Streptococcus mutans GS-5] Other Aliases: SMUGS5_06270 Genomic
context: Chromosome Annotation: NC_018089.1 (1320641 . . . 1324678,
complement) ID: 13299050 58. Y1U_C1412 Csn1[Streptococcus
thermophilus MN-ZLW-002] Other Aliases: Y1U_C1412 Genomic context:
Chromosome Annotation: NC_017927.1 (1376653 . . . 1380819,
complement) ID: 12977193 59. Y1U_C0633 CRISPR-system-like
protein[Streptococcus thermophilus MN-ZLW-002] Other Aliases:
Y1U_C0633 Genomic context: Chromosome Annotation: NC_017927.1
(624274 . . . 627639) ID: 12975630 60. SALIVA_0715
CRISPR-associated endonuclease, Csn1 family[Streptococcus
salivarius JIM8777] Other Aliases: SALIVA_0715 Annotation:
NC_017595.1 (708034 . . . 711417) ID: 12910728 61. csn1
CRISPR-associated protein csn1[Streptococcus mutans LJ23] Other
Aliases: SMULJ23_0701 Annotation: NC_017768.1 (751695 . . . 755732)
ID: 12898085 62. RIA_1455 CRISPR-associated protein,
SAG0894[Riemerella anatipestifer RA-GD] Other Aliases: RIA_1455
Genomic context: Chromosome Annotation: NC_017569.1 (1443996 . . .
1448198) ID: 12613647 63. STND_0658 CRISPR-associated endonuclease,
Csn1 family[Streptococcus thermophilus ND03] Other Aliases:
STND_0658 Genomic context: Chromosome Annotation: NC_017563.1
(633621 . . . 636986) ID: 12590813 64. RA0C_1034 putative
BCR[Riemerella anatipestifer ATCC 11845 = DSM 15868] Other Aliases:
RA0C_1034 Genomic context: Chromosome Annotation: NC_017045.1
(1023494 . . . 1026931, complement) ID: 11996006 65. Sinf_1255
CRISPR-associated protein, SAG0894 family[Streptococcus infantarius
subsp. infantarius CJ18] Other Aliases: Sinf_1255 Genomic context:
Chromosome Annotation: NC_016826.1 (1276484 . . . 1280611,
complement) ID: 11877786 66. Nitsa_1472 CRISPR-associated protein,
csn1 family[Nitratifractor salsuginis DSM 16511] Other Aliases:
Nitsa_1472 Genomic context: Chromosome Annotation: NC_014935.1
(1477331 . . . 1480729) ID: 10148263 67. NLA_17660 hypothetical
protein[Neisseria lactamica 020-06] Other Aliases: NLA_17660
Genomic context: Chromosome Annotation: NC_014752.1 (1890078 . . .
1893326) ID: 10006697 68. SmuNN2025_0694 hypothetical
protein[Streptococcus mutans NN2025] Other Aliases: SnnuNN2025_0694
Genomic context: Chromosome Annotation: NC_013928.1 (737258 . . .
741295) ID: 8834629 69. SDEG_1231 hypothetical
protein[Streptococcus dysgalactiae subsp. equisimilis GGS_124]
Other Aliases: SDEG_1231 Chromosome: 1 Annotation: Chromosome
1NC_012891.1 (1176755 . . . 1180870, complement) ID: 8111553 70.
NMCC_0397 hypothetical protein[Neisseria meningitidis 053442] Other
Aliases: NMCC_0397 Genomic context: Chromosome Annotation:
NC_010120.1 (402733 . . . 405981, complement) ID: 5796426 71.
SAK_1017 hypothetical protein[Streptococcus agalactiae A909] Other
Aliases: SAK_1017 Genomic context: Chromosome Annotation:
NC_007432.1 (980303 . . . 984415) ID: 3686185 72. M5005_Spy_0769
hypothetical protein[Streptococcus pyogenes MGAS5005] Other
Aliases: M5005_Spy_0769 Genomic context: Chromosome Annotation:
NC_007297.1 (773340 . . . 777446) ID: 3572134 73. MS53_0582
hypothetical protein[Mycoplasma synoviae 53] Other Aliases:
MS53_0582 Genomic context: Chromosome Annotation: NC_007294.1
(684155 . . . 688099) ID: 3564051 74. DIP0036 hypothetical
protein[Corynebacterium diphtheriae NCTC 13129] Other Aliases:
DIP0036 Genomic context: Chromosome Annotation: NC_002935.2 (34478
. . . 37732) ID: 2650188 75. WS1613 hypothetical protein[Wolinella
succinogenes DSM 1740] Other Aliases: WS1613 Genomic context:
Chromosome Annotation: NC_005090.1 (1525628 . . . 1529857) ID:
2553552 76. PM1127 hypothetical protein[Pasteurella multocida
subsp. multocida str. Pm70] Other Aliases: PM1127 Genomic context:
Chromosome Annotation: NC_002663.1 (1324015 . . . 1327185,
complement) ID: 1244474 77. SPs1176 hypothetical
protein[Streptococcus pyogenes SS1-1] Other Aliases: SPs1176
Genomic context: Chromosome Annotation: NC_004606.1 (1149610 . . .
1153716, complement) ID: 1065374 78. SMU_1405c hypothetical
protein[Streptococcus mutans UA159] Other Aliases: SMU_1405c,
SMU.1405c Genomic context: Chromosome Annotation: NC_004350.2
(1330942 . . . 1334979, complement) ID: 1028661 79. lin2744
hypothetical protein[Listeria innocua Clip11262] Other Aliases:
lin2744
Genomic context: Chromosome Annotation: NC_003212.1 (2770707 . . .
2774711, complement) ID: 1131597 80. csn1B CRISPR-associated
protein[Streptococcus gallolyticus subsp. gallolyticus ATCC 43143]
Other Aliases: SGGB_1441 Annotation: NC_017576.1 (1489111 . . .
1493226, complement) ID: 12630646 81. csn1A CRISPR-associated
protein[Streptococcus gallolyticus subsp. gallolyticus ATCC 43143]
Other Aliases: SGGB_1431 Annotation: NC_017576.1 (1480439 . . .
1483831, complement) ID: 12630636 82. cas9 CRISPR-associated
protein[Corynebacterium ulcerans 809] Other Aliases: CULC809_00033
Genomic context: Chromosome Annotation: NC_017317.1 (30370 . . .
33063, complement) ID: 12286148 83. GDI_2123 hypothetical
protein[Gluconacetobacter diazotrophicus PAI 5] Other Aliases:
GDI_2123 Genomic context: Chromosome Annotation: NC_010125.1
(2177083 . . . 2180235) ID: 5792482 84. Nham_4054 hypothetical
protein[Nitrobacter hamburgensis X14] Other Aliases: Nham_4054
Genomic context: Plasmid 1 Annotation: NC_007959.1 (13284 . . .
16784, complement) ID: 4025380 85. str0657 hypothetical
protein[Streptococcus thermophilus CNRZ1066] Other Aliases: str0657
Genomic context: Chromosome Annotation: NC_006449.1 (619189 . . .
622575) ID: 3165636 86. stu0657 hypothetical protein[Streptococcus
thermophilus LMG 18311] Other Aliases: stu0657 Genomic context:
Chromosome Annotation: NC_006448.1 (624007 . . . 627375) ID:
3165000 87. SpyM3_0677 hypothetical protein[Streptococcus pyogenes
MGAS315] Other Aliases: SpyM3_0677 Genomic context: Chromosome
Annotation: NC_004070.1 (743040 . . . 747146) ID: 1008991 88.
HFMGO6CAA_5227 Csn1 family CRISPR-associated protein[Mycoplasma
gallisepticum CA06_2006.052-5-2P] Other Aliases: HFMGO6CAA_5227
Genomic context: Chromosome Annotation: NC_018412.1 (895338 . . .
899147) ID: 13464859 89. FIFMG01WIA_5025 Csn1 family
CRISPR-associated protein[Mycoplasma gallisepticum
WI01_2001.043-13-2P] Other Aliases: HFMG01WIA_5025 Genomic context:
Chromosome Annotation: NC_018410.1 (857648 . . . 861457) ID:
13463863 90. HFMG01NYA_5169 Csn1 family CRISPR-associated
protein[Mycoplasma gallisepticum NY01_2001.047-5-1P] Other Aliases:
HFMG01NYA_5169 Genomic context: Chromosome Annotation: NC_018409.1
(883511 . . . 887185) ID: 13462600 91. HFMG96NCA_5295 Csn1 family
CRISPR-associated protein[Mycoplasma gallisepticum NC96_1596-4-2P]
Other Aliases: HFMG96NCA_5295 Genomic context: Chromosome
Annotation: NC_018408.1 (904664 . . . 908473) ID: 13462279 92.
HFMG95NCA_5107 Csn1 family CRISPR-associated protein[Mycoplasma
gallisepticum NC95_13295-2-2P] Other Aliases: HFMG95NCA_5107
Genomic context: Chromosome Annotation: NC_018407.1 (871783 . . .
875592) ID: 13461469 93. MGAS10750_Spy0921 hypothetical
protein[Streptococcus pyogenes MGAS10750] Other Aliases:
MGAS10750_Spy0921 Genomic context: Chromosome Annotation:
NC_008024.1 (875719 . . . 879834) ID: 4066656 94. XAC3262
hypothetical protein[Xanthomonas axonopodis pv. citri str. 306]
Other Aliases: XAC3262 Genomic context: Chromosome Annotation:
NC_003919.1 (3842310 . . . 3842765) ID: 1157333 95. SSUST1_1305
CRISPR-system-like protein[Streptococcus suis ST1] Other Aliases:
SSUST1_1305 Genomic context: Chromosome Annotation: NC_017950.1
(1293105 . . . 1297250, complement) ID: 13017849 96. SSUD9_1467
CRISPR-associated protein, Csn1 family[Streptococcus suis D9] Other
Aliases: SSUD9_1467 Genomic context: Chromosome Annotation:
NC_017620.1 (1456318 . . . 1459686, complement) ID: 12718289 97.
BBta_3952 hypothetical protein[Bradyrhizobium sp. BTAi1] Other
Aliases: BBta_3952 Genomic context: Chromosome Annotation:
NC_009485.1 (4149455 . . . 4152649, complement) ID: 5151538 98.
CIY_03670 CRISPR-associated protein, Csn1 family[Butyrivibrio
fibrisolvens 16/4] Other Aliases: CIY_03670 Annotation: NC_021031.1
(309663 . . . 311960, complement) ID: 15213189 99. A11Q_912
CRISPR-associated protein, Csn1 family[Bdellovibrio exovorus JSS]
Other Aliases: A11Q_912 Genomic context: Chromosome Annotation:
NC_020813.1 (904781 . . . 907864, complement) ID: 14861475 100.
MCYN0850 Csn1 family CRISPR-associated protein[Mycoplasma cynos
C142] Other Aliases: MCYN_0850 Annotation: NC_019949.1 (951497 . .
. 955216, complement) ID: 14356531 101. SaSA20_0769
CRISPR-associated protein[Streptococcus agalactiae SA20-06] Other
Aliases: SaSA20_0769 Genomic context: Chromosome Annotation:
NC_019048.1 (803597 . . . 807709) ID: 13908026 102. csn1
CRISPR-associated protein, Csn1 family[Streptococcus pyogenes A20]
Other Aliases: A20_0810 Genomic context: Chromosome Annotation:
NC_018936.1 (772038 . . . 776144) ID: 13864445 103. P700755_000291
CRISPR-associated protein Cas9/Csn1, subtype II[Psychroflexus
torquis ATCC 700755] Other Aliases: P700755_000291 Genomic context:
Chromosome Annotation: NC_018721.1 (312899 . . . 317428) ID:
13804571 104. A911_07335 CRISPR-associated protein[Cannpylobacter
jejuni subsp. jejuni PT14] Other Aliases: A911_07335 Genomic
context: Chromosome Annotation: NC_018709.2 (1450217 . . . 1453180,
complement) ID: 13791138 105. ASU2_02495 CRISPR-associated
endonuclease Csn1 family protein[Actinobacillus suis H91-0380]
Other Aliases: ASU2_02495 Genomic context: Chromosome Annotation:
NC_018690.1 (552318 . . . 555482) ID: 13751600 106. csn1
CRISPR-associated protein[Listeria monocytogenes SLCC2540] Other
Aliases: LMOSLCC2540_2635 Annotation: NC_018586.1 (2700744 . . .
2704748, complement) ID: 13647248 107. csn1 CRISPR-associated
protein[Listeria monocytogenes SLCC5850] Other Aliases:
LMOSLCC5850_2605 Annotation: NC_018592.1 (2646023 . . . 2650027,
complement) ID: 13626042 108. csn1 CRISPR-associated
protein[Listeria monocytogenes serotype 7 str. SLCC2482] Other
Aliases: LMOSLCC2482_2606 Annotation: NC_018591.1 (2665393 . . .
2669397, complement) ID: 13605045 109. csn1 CRISPR-associated
protein[Listeria monocytogenes SLCC2755] Other Aliases:
LMOSLCC2755_2607 Annotation: NC_018587.1 (2694850 . . . 2698854,
complement) ID: 13599053 110. BN148_1523c CRISPR-associated
protein[Cannpylobacter jejuni subsp. jejuni NCTC 11168-BN148] Other
Aliases: BN148_1523c Annotation: NC_018521.1 (1456880 . . .
1459834, complement) ID: 13530688 111. Belba_3201 CRISPR-associated
protein Cas9/Csn1, subtype II/NMEMI[Belliella baltica DSM 15883]
Other Aliases: Belba_3201 Genomic context: Chromosome Annotation:
NC_018010.1 (3445311 . . . 3449369, complement) ID: 13056967 112.
FN3523_1121 membrane protein[Francisella cf. novicida 3523] Other
Aliases: FN3523_1121 Genomic context: Chromosome Annotation:
NC_017449.1 (1129528 . . . 1134468, complement) ID: 12924881 113.
cas9 CRISPR-associated protein Cas9/Csn1, subtype
II/NMEMI[Prevotella intermedia 17] Other Aliases: PIN17_A0201
Chromosome: II Annotation: Chromosome IINC_017861.1 (240722 . . .
244864) ID: 12849954 114. csn1 CRISPR-associated protein, Csn1
family[Streptococcus thermophilus JIM 8232] Other Aliases:
STH8232_0853 Annotation: NC_017581.1 (706443 . . . 709808) ID:
12637306 115. LMOG_01918 CRISPR-associated protein[Listeria
monocytogenes J0161] Other Aliases: LMOG_01918 Genomic context:
Chromosome Annotation: NC_017545.1 (2735374 . . . 2739378,
complement) ID: 12557915 116. LMRG_02138 CRISPR-associated
protein[Listeria monocytogenes 10403S] Other Aliases: LMRG_02138
Genomic context: Chromosome Annotation: NC_017544.1 (2641981 . . .
2645985, complement) ID: 12554876 117. CJSA_1443 putative
CRISPR-associated protein[Cannpylobacter jejuni subsp. jejuni
IA3902] Other Aliases: CJSA_1443 Genomic context: Chromosome
Annotation: NC_017279.1 (1454273 . . . 1457227, complement) ID:
12250720 118. csn1 CRISPR-associated protein Csn1[Streptococcus
pyogenes MGAS1882] Other Aliases: MGAS1882_0792 Genomic context:
Chromosome Annotation: NC_017053.1 (775696 . . . 779799) ID:
12014080 119. csn1 CRISPR-associated protein Csn1[Streptococcus
pyogenes MGAS15252] Other Aliases: MGAS15252_0796 Genomic context:
Chromosome Annotation: NC_017040.1 (778271 . . . 782374) ID:
11991096 120. cas3 CRISPR-associated endonuclease[Corynebacterium
diphtheriae HC02] Other Aliases: CDHC02_0036
Genomic context: Chromosome Annotation: NC_016802.1 (37125 . . .
40379) ID: 11739116 121. cas3 CRISPR-associated
endonuclease[Corynebacterium diphtheriae C7 (beta)] Other Aliases:
CDC7B_0035 Genomic context: Chromosome Annotation: NC_016801.1
(36309 . . . 39563) ID: 11737358 122. cas3 CRISPR-associated
endonuclease[Corynebacterium diphtheriae BH8] Other Aliases:
CDBH8_0038 Genomic context: Chromosome Annotation: NC_016800.1
(37261 . . . 40515) ID: 11735325 123. cas3 CRISPR-associated
endonuclease[Corynebacterium diphtheriae 31A] Other Aliases:
CD31A_0036 Genomic context: Chromosome Annotation: NC_016799.1
(34597 . . . 37851) ID: 11731168 124. cas3 CRISPR-associated
endonuclease[Corynebacterium diphtheriae VA01] Other Aliases:
CDVA01_0033 Genomic context: Chromosome Annotation: NC_016790.1
(34795 . . . 38049) ID: 11717708 125. cas3 CRISPR-associated
endonuclease[Corynebacterium diphtheriae HC01] Other Aliases:
CDHC01_0034 Genomic context: Chromosome Annotation: NC_016786.1
(35060 . . . 38314) ID: 11708318 126. cas9 CRISPR-associated
protein[Corynebacterium diphtheriae HC01] Other Aliases:
CDHC01_2103 Genomic context: Chromosome Annotation: NC_016786.1
(2246368 . . . 2248998) ID: 11708126 127. PARA_18570 hypothetical
protein[Haemophilus parainfluenzae T3T1] Other Aliases: PARA_18570
Genomic context: Chromosome Annotation: NC_015964.1 (1913335 . . .
1916493) ID: 11115627 128. HDN1F_34120 hypothetical protein[gamma
proteobacterium HdN1] Other Aliases: HDN1F_34120 Genomic context:
Chromosome Annotation: NC_014366.1 (4143336 . . . 4146413,
complement) ID: 9702142 129. SPy_1046 hypothetical
protein[Streptococcus pyogenes M1 GAS] Other Aliases: SPy_1046
Genomic context: Chromosome Annotation: NC_002737.1 (854757 . . .
858863) ID: 901176 130. GBS222_0765 Hypothetical
protein[Streptococcus agalactiae] Other Aliases: GBS222_0765
Annotation: NC_021195.1 (810875 . . . 814987) ID: 15484689 131.
NE061598_03330 hypothetical protein[Francisella tularensis subsp.
tularensis NE061598] Other Aliases: NE061598_03330 Genomic context:
Chromosome Annotation: NC_017453.1 (601219 . . . 604590) ID:
12437259 132. NMV_1993 hypothetical protein[Neisseria meningitidis
8013] Other Aliases: NMV_1993 Annotation: NC_017501.1 (1917073 . .
. 1920321) ID: 12393700 133. csn1 hypothetical
protein[Cannpylobacter jejuni subsp. jejuni M1] Other Aliases:
CJM1_1467 Genomic context: Chromosome Annotation: NC_017280.1
(1433667 . . . 1436252, complement) ID: 12249021 134. FTU_0629
hypothetical protein[Francisella tularensis subsp. tularensis
TIGB03] Other Aliases: FTU_0629 Genomic context: Chromosome
Annotation: NC_016933.1 (677092 . . . 680463) ID: 11890131 135.
NMAA_0315 hypothetical protein[Neisseria meningitidis WUE 2594]
Other Aliases: NMAA_0315 Annotation: NC_017512.1 (377010 . . .
380258, complement) ID: 12407849 136. WS1445 hypothetical
protein[Wolinella succinogenes DSM 1740] Other Aliases: WS1445
Genomic context: Chromosome Annotation: NC_005090.1 (1388202 . . .
1391381, complement) ID: 2554690 137. THITE_2123823 hypothetical
protein[Thielavia terrestris NRRL 8126] Other Aliases:
THITE_2123823 Chromosome: 6 Annotation: Chromosome 6NC_016462.1
(1725696 . . . 1725928) ID: 11523019 138. XAC29_16635 hypothetical
protein[Xanthomonas axonopodis Xac29-1] Other Aliases: XAC29_16635
Genomic context: Chromosome Annotation: NC_020800.1 (3849847 . . .
3850302) ID: 14853997 139. M1GAS476_0830 hypothetical
protein[Streptococcus pyogenes M1 476] Other Aliases: M1GAS476_0830
Chromosome: 1 Annotation: NC_020540.1 (792119 . . . 796225) ID:
14819166 140. Piso0_000203 Piso0_000203[Millerozynna farinosa CBS
7064] Other Aliases: GNLVRS01_PISO0A04202g Other Designations:
hypothetical protein Chromosome: A Annotation: NC_020226.1 (343553
. . . 343774, complement) ID: 14528449 141. G148_0828 hypothetical
protein[Riemerella anatipestifer RA-CH-2] Other Aliases: G148_0828
Genomic context: Chromosome Annotation: NC_020125.1 (865673 . . .
869875) ID: 14447195 142. csn1 hypothetical protein[Streptococcus
dysgalactiae subsp. equisimilis AC-2713] Other Aliases: SDSE_1207
Annotation: NC_019042.1 (1134173 . . . 1138288, complement) ID:
13901498 143. A964_0899 hypothetical protein[Streptococcus
agalactiae GD201008-001] Other Aliases: A964_0899 Genomic context:
Chromosome Annotation: NC_018646.1 (935164 . . . 939276) ID:
13681619 144. FNFX1_0762 hypothetical protein[Francisella cf.
novicida Fx1] Other Aliases: FNFX1_0762 Genomic context: Chromosome
Annotation: NC_017450.1 (781484 . . . 786373) ID: 12435564 145.
FTV_0545 hypothetical protein[Francisella tularensis subsp.
tularensis TI0902] Other Aliases: FTV_0545 Genomic context:
Chromosome Annotation: NC_016937.1 (601185 . . . 604556) ID:
11880693 146. FTL_1327 hypothetical protein[Francisella tularensis
subsp. holarctica LVS] Other Aliases: FTL_1327 Genomic context:
Chromosome Annotation: NC_007880.1 (1262508 . . . 1263689,
complement) ID: 3952607 147. FTL_1326 hypothetical
protein[Francisella tularensis subsp. holarctica LVS] Other
Aliases: FTL_1326 Genomic context: Chromosome Annotation:
NC_007880.1 (1261927 . . . 1262403, complement) ID: 3952606
Sequence CWU 1
1
61111RNAArtificial Sequencean example of part of gRNA before linker
sequence 1uuuuagagcu a 11213RNAArtificial Sequencean example of
part of gRNA following linker sequence 2uagcaaguua aaa
13312RNAArtificial Sequenceexemplary portion of gRNA (crRNA)
3nuuuuanngc ua 12416RNAArtificial Sequenceexemplary tracrRNA which
comprises a portion of a gRNA 4uagcnnnnnu uaaaan 16526RNAArtificial
Sequencean example of a tracrRNA 5uagcaaguua aaauaaggcu aguccg
26676RNAArtificial Sequencean example of a gRNA 6guuuuagagc
uagaaauagc aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu 60ggcaccgagu
cggugc 7671340DNAArtificial SequenceFragment 1A (1340 bp)
7ggtaccgggc cccccctcga ggtcgacggt atcgataagc ttgatgaggg cctatttccc
60atgattcctt catatttgca tatacgatac aaggctgtta gagagataat tggaattaat
120ttgactgtaa acacaaagat attagtacaa aatacgtgac gtagaaagta
ataatttctt 180gggtagtttg cagttttaaa attatgtttt aaaatggact
atcatatgct taccgtaact 240tgaaagtatt tcgatttctt ggctttatat
atcttgtgga aaggacgaaa caccgggtct 300tcgagaagac ctgttttaga
gctagaaata gcaagttaaa ataaggctag tccgttatca 360acttgaaaaa
gtggcaccga gtcggtgctt ttttgtttta gagctagaaa tagcaagtta
420aaataaggct agtccgtttt tagcgcgtgc gccaattctg cagacaaatg
gctctagagg 480tacccgttac ataacttacg gtaaatggcc cgcctggctg
accgcccaac gacccccgcc 540cattgacgtc aatagtaacg ccaataggga
ctttccattg acgtcaatgg gtggagtatt 600tacggtaaac tgcccacttg
gcagtacatc aagtgtatca tatgccaagt acgcccccta 660ttgacgtcaa
tgacggtaaa tggcccgcct ggcattgtgc ccagtacatg accttatggg
720actttcctac ttggcagtac atctacgtat tagtcatcgc tattaccatg
gtcgaggtga 780gccccacgtt ctgcttcact ctccccatct cccccccctc
cccaccccca attttgtatt 840tatttatttt ttaattattt tgtgcagcga
tgggggcggg gggggggggg gggcgcgcgc 900caggcggggc ggggcggggc
gaggggcggg gcggggcgag gcggagaggt gcggcggcag 960ccaatcagag
cggcgcgctc cgaaagtttc cttttatggc gaggcggcgg cggcggcggc
1020cctataaaaa gcgaagcgcg cggcgggcgg gagtcgctgc gacgctgcct
tcgccccgtg 1080ccccgctccg ccgccgcctc gcgccgcccg ccccggctct
gactgaccgc gttactccca 1140caggtgagcg ggcgggacgg cccttctcct
ccgggctgta attagctgag caagaggtaa 1200gggtttaagg gatggttggt
tggtggggta ttaatgttta attacctgga gcacctgcct 1260gaaatcactt
tttttcaggt tggaccggtg ccaccatgga ctataaggac cacgacggag
1320actacaagga tcatgatatt 13408852DNAArtificial SequenceFragment 2
(852 bp) 8atggactata aggaccacga cggagactac aaggatcatg atattgatta
caaagacgat 60gacgataaga tggccccaaa gaagaagcgg aaggtcggta tccacggagt
cccagcagcc 120gacaagaagt acagcatcgg cctggacatc ggcaccaact
ctgtgggctg ggccgtgatc 180accgacgagt acaaggtgcc cagcaagaaa
ttcaaggtgc tgggcaacac cgaccggcac 240agcatcaaga agaacctgat
cggagccctg ctgttcgaca gcggcgaaac agccgaggcc 300acccggctga
agagaaccgc cagaagaaga tacaccagac ggaagaaccg gatctgctat
360ctgcaagaga tcttcagcaa cgagatggcc aaggtggacg acagcttctt
ccacagactg 420gaagagtcct tcctggtgga agaggataag aagcacgagc
ggcaccccat cttcggcaac 480atcgtggacg aggtggccta ccacgagaag
taccccacca tctaccacct gagaaagaaa 540ctggtggaca gcaccgacaa
ggccgacctg cggctgatct atctggccct ggcccacatg 600atcaagttcc
ggggccactt cctgatcgag ggcgacctga accccgacaa cagcgacgtg
660gacaagctgt tcatccagct ggtgcagacc tacaaccagc tgttcgagga
aaaccccatc 720aacgccagcg gcgtggacgc caaggccatc ctgtctgcca
gactgagcaa gagcagacgg 780ctggaaaatc tgatcgccca gctgcccggc
gagaagaaga atggcctgtt cggaaacctg 840attgccctga gc
8529920DNAArtificial SequenceFragment 3 (920 bp) 9ggcgagaaga
agaatggcct gttcggaaac ctgattgccc tgagcctggg cctgaccccc 60aacttcaaga
gcaacttcga cctggccgag gatgccaaac tgcagctgag caaggacacc
120tacgacgacg acctggacaa cctgctggcc cagatcggcg accagtacgc
cgacctgttt 180ctggccgcca agaacctgtc cgacgccatc ctgctgagcg
acatcctgag agtgaacacc 240gagatcacca aggcccccct gagcgcctct
atgatcaaga gatacgacga gcaccaccag 300gacctgaccc tgctgaaagc
tctcgtgcgg cagcagctgc ctgagaagta caaagagatt 360ttcttcgacc
agagcaagaa cggctacgcc ggctacattg acggcggagc cagccaggaa
420gagttctaca agttcatcaa gcccatcctg gaaaagatgg acggcaccga
ggaactgctc 480gtgaagctga acagagagga cctgctgcgg aagcagcgga
ccttcgacaa cggcagcatc 540ccccaccaga tccacctggg agagctgcac
gccattctgc ggcggcagga agatttttac 600ccattcctga aggacaaccg
ggaaaagatc gagaagatcc tgaccttccg catcccctac 660tacgtgggcc
ctctggccag gggaaacagc agattcgcct ggatgaccag aaagagcgag
720gaaaccatca ccccctggaa cttcgaggaa gtggtggaca agggcgcttc
cgcccagagc 780ttcatcgagc ggatgaccaa cttcgataag aacctgccca
acgagaaggt gctgcccaag 840cacagcctgc tgtacgagta cttcaccgtg
tataacgagc tgaccaaagt gaaatacgtg 900accgagggaa tgagaaagcc
92010920DNAArtificial SequenceFragment 4 (920 bp) 10cgagctgacc
aaagtgaaat acgtgaccga gggaatgaga aagcccgcct tcctgagcgg 60cgagcagaaa
aaggccatcg tggacctgct gttcaagacc aaccggaaag tgaccgtgaa
120gcagctgaaa gaggactact tcaagaaaat cgagtgcttc gactccgtgg
aaatctccgg 180cgtggaagat cggttcaacg cctccctggg cacataccac
gatctgctga aaattatcaa 240ggacaaggac ttcctggaca atgaggaaaa
cgaggacatt ctggaagata tcgtgctgac 300cctgacactg tttgaggaca
gagagatgat cgaggaacgg ctgaaaacct atgcccacct 360gttcgacgac
aaagtgatga agcagctgaa gcggcggaga tacaccggct ggggcaggct
420gagccggaag ctgatcaacg gcatccggga caagcagtcc ggcaagacaa
tcctggattt 480cctgaagtcc gacggcttcg ccaacagaaa cttcatgcag
ctgatccacg acgacagcct 540gacctttaaa gaggacatcc agaaagccca
ggtgtccggc cagggcgata gcctgcacga 600gcacattgcc aatctggccg
gcagccccgc cattaagaag ggcatcctgc agacagtgaa 660ggtggtggac
gagctcgtga aagtgatggg ccggcacaag cccgagaaca tcgtgatcga
720aatggccaga gagaaccaga ccacccagaa gggacagaag aacagccgcg
agagaatgaa 780gcggatcgaa gagggcatca aagagctggg cagccagatc
ctgaaagaac accccgtgga 840aaacacccag ctgcagaacg agaagctgta
cctgtactac ctgcagaatg ggcgggatat 900gtacgtggac caggaactgg
92011920DNAArtificial SequenceFragment 5 (920 bp) 11actacctgca
gaatgggcgg gatatgtacg tggaccagga actggacatc aaccggctgt 60ccgactacga
tgtggaccat atcgtgcctc agagctttct gaaggacgac tccatcgaca
120acaaggtgct gaccagaagc gacaagaacc ggggcaagag cgacaacgtg
ccctccgaag 180aggtcgtgaa gaagatgaag aactactggc ggcagctgct
gaacgccaag ctgattaccc 240agagaaagtt cgacaatctg accaaggccg
agagaggcgg cctgagcgaa ctggataagg 300ccggcttcat caagagacag
ctggtggaaa cccggcagat cacaaagcac gtggcacaga 360tcctggactc
ccggatgaac actaagtacg acgagaatga caagctgatc cgggaagtga
420aagtgatcac cctgaagtcc aagctggtgt ccgatttccg gaaggatttc
cagttttaca 480aagtgcgcga gatcaacaac taccaccacg cccacgacgc
ctacctgaac gccgtcgtgg 540gaaccgccct gatcaaaaag taccctaagc
tggaaagcga gttcgtgtac ggcgactaca 600aggtgtacga cgtgcggaag
atgatcgcca agagcgagca ggaaatcggc aaggctaccg 660ccaagtactt
cttctacagc aacatcatga actttttcaa gaccgagatt accctggcca
720acggcgagat ccggaagcgg cctctgatcg agacaaacgg cgaaaccggg
gagatcgtgt 780gggataaggg ccgggatttt gccaccgtgc ggaaagtgct
gagcatgccc caagtgaata 840tcgtgaaaaa gaccgaggtg cagacaggcg
gcttcagcaa agagtctatc ctgcccaaga 900ggaacagcga taagctgatc
92012789DNAArtificial SequenceFragment 6 (789 bp) 12agcaaagagt
ctatcctgcc caagaggaac agcgataagc tgatcgccag aaagaaggac 60tgggacccta
agaagtacgg cggcttcgac agccccaccg tggcctattc tgtgctggtg
120gtggccaaag tggaaaaggg caagtccaag aaactgaaga gtgtgaaaga
gctgctgggg 180atcaccatca tggaaagaag cagcttcgag aagaatccca
tcgactttct ggaagccaag 240ggctacaaag aagtgaaaaa ggacctgatc
atcaagctgc ctaagtactc cctgttcgag 300ctggaaaacg gccggaagag
aatgctggcc tctgccggcg aactgcagaa gggaaacgaa 360ctggccctgc
cctccaaata tgtgaacttc ctgtacctgg ccagccacta tgagaagctg
420aagggctccc ccgaggataa tgagcagaaa cagctgtttg tggaacagca
caagcactac 480ctggacgaga tcatcgagca gatcagcgag ttctccaaga
gagtgatcct ggccgacgct 540aatctggaca aagtgctgtc cgcctacaac
aagcaccggg ataagcccat cagagagcag 600gccgagaata tcatccacct
gtttaccctg accaatctgg gagcccctgc cgccttcaag 660tactttgaca
ccaccatcga ccggaagagg tacaccagca ccaaagaggt gctggacgcc
720accctgatcc accagagcat caccggcctg tacgagacac ggatcgacct
gtctcagctg 780ggaggcgac 78913535DNAArtificial SequenceFragment 7
(535 bp) 13ggcctgtacg agacacggat cgacctgtct cagctgggag gcgacaaaag
gccggcggcc 60acgaaaaagg ccggccaggc aaaaaagaaa aagtaagaat tcctagagct
cgctgatcag 120cctcgactgt gccttctagt tgccagccat ctgttgtttg
cccctccccc gtgccttcct 180tgaccctgga aggtgccact cccactgtcc
tttcctaata aaatgaggaa attgcatcgc 240attgtctgag taggtgtcat
tctattctgg ggggtggggt ggggcaggac agcaaggggg 300aggattggga
agagaatagc aggcatgctg gggagcggcc gcaggaaccc ctagtgatgg
360agttggccac tccctctctg cgcgctcgct cgctcactga ggccgggcga
ccaaaggtcg 420cccgacgccc gggctttgcc cgggcggcct cagtgagcga
gcgagcgcgc agctgcctgc 480aggggcgcct atcgaattcc tgcagcccgg
gggatccact agttctagag cggcc 53514852DNAArtificial SequenceFragment
2A (852 bp) 14atggactata aggaccacga cggagactac aaggatcatg
atattgatta caaagacgat 60gacgataaga tggccccaaa gaagaagcgg aaggtcggta
tccacggagt cccagcagcc 120gacaagaagt acagcatcgg cctggccatc
ggcaccaact ctgtgggctg ggccgtgatc 180accgacgagt acaaggtgcc
cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac 240agcatcaaga
agaacctgat cggagccctg ctgttcgaca gcggcgaaac agccgaggcc
300acccggctga agagaaccgc cagaagaaga tacaccagac ggaagaaccg
gatctgctat 360ctgcaagaga tcttcagcaa cgagatggcc aaggtggacg
acagcttctt ccacagactg 420gaagagtcct tcctggtgga agaggataag
aagcacgagc ggcaccccat cttcggcaac 480atcgtggacg aggtggccta
ccacgagaag taccccacca tctaccacct gagaaagaaa 540ctggtggaca
gcaccgacaa ggccgacctg cggctgatct atctggccct ggcccacatg
600atcaagttcc ggggccactt cctgatcgag ggcgacctga accccgacaa
cagcgacgtg 660gacaagctgt tcatccagct ggtgcagacc tacaaccagc
tgttcgagga aaaccccatc 720aacgccagcg gcgtggacgc caaggccatc
ctgtctgcca gactgagcaa gagcagacgg 780ctggaaaatc tgatcgccca
gctgcccggc gagaagaaga atggcctgtt cggaaacctg 840attgccctga gc
8521524DNAArtificial Sequencean example oligo 15caccgnnnnn
nnnnnnnnnn nnnn 241624DNAArtificial Sequencean example oligo
16aaacnnnnnn nnnnnnnnnn nnnc 2417122DNAArtificial SequenceExample
T7-gRNA Sequence 17ttaatacgac tcactatagg nnnnnnnnnn nnnnnnnnnn
gttttagagc tagaaatagc 60aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt
ggcaccgagt cggtgctttt 120tt 12218112DNAArtificial SequenceFragment
1 (111 bp) 18ggtaccgggc cccccctcga ggtcgacggt atcgataagc ttgataatac
gactcactat 60agggagaatg gactataagg accacgacgg agactacaag gatcatgata
tt 1121920DNAArtificial Sequenceprimer Cas9-F 19ttaatacgac
tcactatagg 202021DNAArtificial Sequenceprimer Cas9-R used for PCR
amplification 20gcgagctcta ggaattctta c 212120DNAArtificial
Sequenceprimer CgRNA-F 21ttaatacgac tcactatagg 202224DNAArtificial
Sequenceprimer CgRNA-R 22aaaaaagcac cgactcggtg ccac
24233108DNAArtificial SequenceSequence of Rosa26 5-prime homology
arm 23cacatttggt cctgcttgaa cattgccatg gctcttaaag tcttaattaa
gaatattaat 60tgtgtaatta ttgtttttcc tcctttagat cattccttga ggacaggaca
gtgcttgttt 120aaggctatat ttctgctgtc tgagcagcaa caggtcttcg
agatcaacat gatgttcata 180atcccaagat gttgccattt atgttctcag
aagcaagcag aggcatgatg gtcagtgaca 240gtaatgtcac tgtgttaaat
gttgctatgc agtttggatt tttctaatgt agtgtaggta 300gaacatatgt
gttctgtatg aattaaactc ttaagttaca ccttgtataa tccatgcaat
360gtgttatgca attaccattt taagtattgt agctttcttt gtatgtgagg
ataaaggtgt 420ttgtcataaa atgttttgaa catttcccca aagttccaaa
ttataaaacc acaacgttag 480aacttattta tgaacaatgg ttgtagtttc
atgcttttaa aatgcttaat tattcaatta 540acaccgtttg tgttataata
tatataaaac tgacatgtag aagtgtttgt ccagaacatt 600tcttaaatgt
atactgtctt tagagagttt aatatagcat gtcttttgca acatactaac
660ttttgtgttg gtgcgagcaa tattgtgtag tcattttgaa aggagtcatt
tcaatgagtg 720tcagattgtt ttgaatgtta ttgaacattt taaatgcaga
cttgttcgtg ttttagaaag 780caaaactgtc agaagctttg aactagaaat
taaaaagctg aagtatttca gaagggaaat 840aagctacttg ctgtattagt
tgaaggaaag tgtaatagct tagaaaattt aaaaccatat 900agttgtcatt
gctgaatatc tggcagatga aaagaaatac tcagtggttc ttttgagcaa
960tataacagct tgttatatta aaaattttcc ccacagatat aaactctaat
ctataactca 1020taaatgttac aaatggatga agcttacaaa tgtggcttga
cttgtcactg tgcttgtttt 1080agttatgtga aagtttggca ataaacctat
gtcctaaata gtcaaactgt ggaatgactt 1140tttaatctat tggtttgtct
agaacagtta tgttgccatt tgccctaatg gtgaaagaaa 1200aagtggggag
tgccttggca ctgttcattt gtggtgtgaa ccaaagaggg gggcatgcac
1260ttacacttca aacatccttt tgaaagactg acaagtttgg gtcttcacag
ttggaattgg 1320gcatcccttt tgtcagggag ggagggaggg agggaggctg
gcttgttatg ctgacaagtg 1380tgattaaatt caaactttga ggtaagttgg
aggaacttgt acattgttag gagtgtgaca 1440atttggactc ttaatgattt
ggtcatacaa aatgaaccta gaccaacttc tggaagatgt 1500atataataac
tccatgttac attgatttca cctgactaat acttatccct tatcaattaa
1560atacagaaga tgccagccat ctgggccttt taacccagaa atttagtttc
aaactcctag 1620gttagtgttc tcactgagct acatcctgat ctagtcctga
aaataggacc accatcaccc 1680ccaaaaaaat ctcaaataag atttatgcta
gtgtttcaaa attttaggaa taggtaagat 1740tagaaagttt taaattttga
gaaatggctt ctctagaaag atgtacatag tgaacactga 1800atggctccta
aagagcctag aaaactggta ctgagcacac aggactgaga ggtctttctt
1860gaaaagcatg tattgcttta cgtgggtcac agaaggcagg caggaagaac
ttgggctgaa 1920actggtgtct taagtggcta acatcttcac aactgatgag
caagaacttt atcctgatgc 1980aaaaaccatc caaacaaact aagtgaaagg
tggcaatgga tcccaggctg ctctagagga 2040ggacttgact tctcatccca
tcacccacac cagatagctc atagactgcc aattaacacc 2100agcttctagc
ctccacaggc acctgcactg gtacacataa tttcacacaa acacagtaag
2160aagccttcca cctggcatgg tattgcttat ctttagttcc caacacttgg
gaggcagagg 2220ccagccaggg ctatgtgaca aaaaccttgt ctagaggaga
aacttcatag cttatttcct 2280attcacgtaa ccaggttagc aaaatttacc
agccagagat gaagctaaca gtgtccacta 2340tatttgtagt gttttaagtc
aattttttaa atatacttaa tagaattaaa gctatggtga 2400accaagtaca
aacctggtgt attaacttga gaacttagca taaaaagtag ttcatttgtt
2460cagtaaatat taaatgctta ctggcaaaga ttatgtcagg aacttggtaa
atggtgatga 2520aacaatcata gttgtacatc ttggttctgt gatcaccttg
gtttgaggta aaagtggttc 2580ctttgatcaa ggatggaatt ttaagtttat
attcaatcaa taatgtatta ttttgtgatt 2640gcaaaattgc ctatctaggg
tataaaacct ttaaaaattt cataatacca gttcattctc 2700cagttactaa
ttccaaaaag ccactgacta tggtgccaat gtggattctg ttctcaaagg
2760aaggattgtc tgtgcccttt attctaatag aaacatcaca ctgaaaatct
aagctgaaag 2820aagccagact ttcctaaata aataactttc cataaagctc
aaacaaggat tacttttagg 2880aggcactgtt aaggaactga taagtaatga
ggttacttat ataatgatag tcccacaaga 2940ctatctgagg aaaaatcagt
acaactcgaa aacagaacaa ccagctaggc aggaataaca 3000gggctcccaa
gtcaggaggt ctatccaaca cccttttctg ttgagggccc cagacctaca
3060tattgtatac aaacagggag gtgggtgatt ttaactctcc tgaggtac
3108243102DNAArtificial SequenceSequence of Rosa26 3-prime homology
arm 24cttggtaaat ctttgtcctg agtaagcagt acagtgtaca gtttacattt
tcatttaaag 60atacattagc tccctctacc ccctaagact gacaggcact ttgggggtgg
ggagggcttt 120ggaaaataac gcttccatac actaaaagag aaatttcttt
aattaggctt gttggttcca 180tacatctact ggtgtttcta ctacttagta
atattataat agtcacacaa gcatctttgc 240tctgtttagg ttgtatattt
attttaaggc agatgataaa actgtagatc ttaagggatg 300cttctgcttc
tgagatgata caaagaattt agaccataaa acagtaggtt gcacaagcaa
360tagaatatgg cctaaagtgt tctgacactt agaagccaag cagtgtaggc
ttcttaagaa 420ataccattac aatcaccttg ctagaaatca agcattctgg
agtggtcaag cagtgtaacc 480tgtactgtaa gttacttttc tgctattttt
ctcccaaagc aagttcttta tgctgatatt 540tccagtgtta ggaactacaa
atattaataa gttgtcttca ctcttttctt taccaaggag 600ggtctcttcc
ttcatcttga tctgaaggat gaacaaaggc ttgagcagtg cgctttagaa
660gataaactgc agcatgaagg cccccgatgt tcacccagac tacatggacc
tttcgccaca 720catgtcccat tccagataag gcctggcaca cacaaaaaac
ataagtcatt aggctaccag 780tctgattcta aaacaaccta aaatcttccc
acttaaatgc tatgggtggt gggttggaaa 840gttgactcag aaaatcactt
gctgttttta gagaggatct gggttcagtt tctgatacat 900tgtggcttac
aactataact ccagttctag ggggtccatc caacatcctc ttctgttgag
960ggcaccaaat aaatgtattg tgtacaaaca gggaggtgag tgatttaact
ctcgtgtata 1020gtaccttggt aaaacatttc ttgtcctgag taagcagtac
agctctgcct gtccctggtc 1080tacagacacg gctcatttcc cgaaggcaag
ctggatagag attccaattt ctcttcttgg 1140atcccatcct ataaaagaag
gtcaagttta atctattgca aaaggtaaat aggtagtttc 1200ttacatgaga
caagaacaaa tcttaggtgt gaagcagtca tcttttacag gccagagcct
1260ctattctatg ccaatgaagg aaactgttag tccagtgtta tagagttagt
ccagtgtata 1320gttttctatc agaacacttt ttttttaaac aactgcaact
tagcttattg aagacaaacc 1380acgagtagaa atctgtccaa gaagcaagtg
cttctcagcc tacaatgtgg aataggacca 1440tgtaatggta cagtgagtga
aatgaattat ggcatgtttt tctgactgag aagacagtac 1500aataaaaggt
aaactcatgg tatttattta aaaagaatcc aatttctacc tttttccaaa
1560tggcatatct gttacaataa tatccacaga agcagttctc agtgggaggt
tgcagatatc 1620ccactgaaca gcatcaatgg gcaaacccca ggttgttttt
ctgtggagac aaaggtaaga 1680tatttcaata tattttccca agctaatgag
atggctcagc aaataatggt actggccatt 1740aagtctcatg acctgagctt
gatcctcagg gaccatgtgg tacaaggaga gacctaaatc 1800cttcagttgg
acttcaatct tctaccctca tgtccacaca caaataaata caataaaaaa
1860cattctgcag tctgaatttc taaaggttgt ttttctaaaa agaaatgtta
aagtaacata 1920ggaagaaata tgtccataac tgaaatacaa gttttttaaa
tggttaagac tggttttcaa 1980aggatgtatg gttaagaaaa taccagggaa
aatgagctta catgtaaaaa agtgtctaaa 2040aggccagaga aatgacccag
ctggcaaagg tgtctgccct aagccagaca aaaggaattt 2100gattcacagg
aagaagagac ccaactctca ctagttatcc tctgacttcc acaccatgac
2160acagctccat ggcactctca ggcccccaca catatacaga tataaacaga
aacctaatcc 2220accagccttc agaagcaaag caattggagg atttaaacag
gccatggcta ctaatagaga 2280taactggtag tttaaaagtt atggtaatga
ctttcatgct tctttcaact catattgttc 2340taaataatta atttggtttt
tcaaggcagg gtttctctgt gtagttctgg ctgtcctgga 2400actcactctg
tagaccaggc tggccttgaa ctcagatcca tctgcctctg gaataagggc
2460acgtgcgtgc cttttctaca taacaaaacc tatactataa caaaacctat
accatactgt 2520accgttttgg gaaaagacaa aaaataatga acaaaaaagg
agaaataaca ttccaataaa 2580gtatggaaat ggtagttaaa ttaattacaa
atgtttttca gtaaattaga tgtgacttct 2640catactgttc atttggctat
aatgatacca caaagcactg ggggtgaata ataattccaa 2700gtcagtaggg
agagagactt gaaaagatgc aatgcaatca ttgaagttaa acttacccat
2760ctttaatctg gctcttagtc aatagagatg agatgttatt tgctgctctg
ttcactgcca 2820gtgggttatt gtccccagca atatggtaac agtgagacca
ctcagtagcc ccctatgaga 2880caggagtgtt ggttaaacat gccacaagag
aaaagggaaa agtcactatg gccaactctc 2940agtaacatgg caatccgtgc
cattcatttc cttgccagaa atgtcttccc tgttcttctg 3000cctactgaac
tttcacccac tagaaatgtg gctccaatgt catccactat gacatcaatg
3060tcagcgctag aagcactttg cacacctctg ttgctgactt ag
31022530DNAArtificial SequenceCRISPR consensus sequence of Genome
Mth and PaM NGG 25atttcaatcc cattttggtc tgattttaac
302629DNAArtificial SequenceCRISPR consensus sequence of Genome Lmo
and PaM WGG 26atttacattt cahaataagt arytaaaac 292729DNAArtificial
SequenceCRISPR consensus sequence of Genome Eco and PaM CWT
27cggtttatcc ccgctggcgc ggggaacwc 292829DNAArtificial
SequenceCRISPR consensus sequence of Genome Pae and PaM CTT
28cggttcatcc ccacrcmygt ggggaacac 292932DNAArtificial
SequenceCRISPR consensus sequence of Genome Spy and PaM GAA
29atttcaatcc actcacccat gaagggtgag ac 323031DNAArtificial
SequenceCRISPR consensus sequence of Genome Xan and PaM WGG
30gtttcaatcc acgcgcccgt gaggrcgcga c 313128DNAArtificial
SequenceCRISPR consensus sequence of Genome She and PaM GG
31tttctaagcc gcctgtgcgg cggtgaac 283228DNAArtificial SequenceCRISPR
consensus sequence of Genome Pae and PaM GG 32tttcttagct gcctatacgg
cagtgaac 283328DNAArtificial SequenceCRISPR consensus sequence of
Genome Ype and PaM GG 33tttctaagct gcctgtgcgg cagtgaac
283424DNAArtificial SequenceCRISPR consensus sequence of Genome Sso
and PaM NGG 34ctttcaattc tataagagat tatc 243524DNAArtificial
SequenceCRISPR consensus sequence of Genome Mse and PaM NGG
35ctttcaactc tataggagat taac 243636DNAArtificial SequenceCRISPR
consensus sequence of Genome Str and PaM NGG 36gttttagagc
tatgctgttt tgaatggtcc caaaac 363736DNAArtificial SequenceCRISPR
consensus sequence of Genome Lis and PaM NGG 37gttttagagc
tatgttattt tgaatgctam caaaac 363810DNAArtificial SequenceLeader
38agggcggatt 103910DNAArtificial SequenceLeader 39atggccaatt
104010DNAArtificial SequenceLeader 40ccactaactt 104110DNAArtificial
SequenceLeader 41ccgctctatt 104210DNAArtificial SequenceLeader
42tctaaacata 104310DNAArtificial SequenceLeader 43tctaaaagta
104410DNAArtificial SequenceLeader 44acttaccgta 104510DNAArtificial
SequenceLeader 45ccttaccgta 104610DNAArtificial SequenceLeader
46tgcgccaaat 104710DNAArtificial SequenceLeader 47ccccccttag
104810DNAArtificial SequenceLeader 48gccgccagca 104910DNAArtificial
SequenceLeader 49aatagcttat 105010DNAArtificial SequenceLeader
50tgtagaataa 105110DNAArtificial SequenceLeader 51tagctccgaa
105210DNAArtificial SequenceLeader 52tagaccaaaa 105310DNAArtificial
SequenceLeader 53gtaagataat 105410DNAArtificial SequenceLeader
54tgagggttta 105510DNAArtificial SequenceLeader 55tgataccttt
105610DNAArtificial SequenceLeader 56tgaaactttt 105710DNAArtificial
SequenceLeader 57tgacactctt 105810DNAArtificial SequenceLeader
58ctcgtagact 105910DNAArtificial SequenceLeader 59ctcgtagaaa
106010DNAArtificial SequenceLeader 60ctcgcagaat 106110DNAArtificial
SequenceLeader 61ctcgtagaat 10
* * * * *