U.S. patent application number 14/964429 was filed with the patent office on 2016-07-21 for fungal endophytes for improved crop yields and protection from pests.
The applicant listed for this patent is THE TEXAS A&M UNIVERSITY SYSTEM. Invention is credited to Gregory A. Sword.
Application Number | 20160205947 14/964429 |
Document ID | / |
Family ID | 53007462 |
Filed Date | 2016-07-21 |
United States Patent
Application |
20160205947 |
Kind Code |
A1 |
Sword; Gregory A. |
July 21, 2016 |
Fungal Endophytes for Improved Crop Yields and Protection from
Pests
Abstract
The invention provides a synthetic combination of a crop and at
least one fungal endophyte, wherein the crop is a host plant of the
endophyte. Provided are also methods and compositions for producing
such synthetic combinations. The endophyte reproduces and enhances
the agronomic characteristics of the crop. Methods for inoculating
the host plant with the endophyte, for propagating the
host-endophyte combination, and for detecting the presence of the
endophyte and of its metabolites within a host plant are also
described.
Inventors: |
Sword; Gregory A.; (College
Station, TX) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
THE TEXAS A&M UNIVERSITY SYSTEM |
College Station |
TX |
US |
|
|
Family ID: |
53007462 |
Appl. No.: |
14/964429 |
Filed: |
December 9, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14535292 |
Nov 6, 2014 |
9277751 |
|
|
14964429 |
|
|
|
|
61900929 |
Nov 6, 2013 |
|
|
|
61900935 |
Nov 6, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01H 5/10 20130101; A01N
63/30 20200101 |
International
Class: |
A01N 63/04 20060101
A01N063/04; A01H 5/10 20060101 A01H005/10 |
Claims
1.-20. (canceled)
21. A method for improving drought resistance in a cotton plant,
the method comprising: contacting a cotton plant or a seed of said
cotton plant with a formulation comprising purified filamentous,
spore-forming, facultative fungal endophytes of at least one
species, wherein the facultative fungal endophytes are present in
the formulation in an amount effective to improve drought
resistance of the cotton plant or a cotton plant grown from the
seed compared to a reference cotton plant or a cotton plant grown
from a reference seed.
22. The method of claim 21, wherein the formulation contains at
least 100 (10 2) spores/ml or 100,000 (10 5) spores/g dry weight of
the facultative fungal endophytes.
23. The method of claim 21, wherein the facultative fungal
endophytes are present in the formulation in an amount effective to
increase biomass.
24.-26. (canceled)
27. The method of claim 21, wherein the facultative fungal
endophytes are present in the formulation in an amount effective to
reduce yield loss.
28. The method of claim 27, wherein yield loss is reduced by at
least 5%.
29. The method of claim 27, wherein the reduction in yield loss
results in a yield increase of at least 5%.
30. The method of claim 21, wherein enhanced resistance to drought
stress is assessed by withholding water from 7-day old seedlings of
the cotton plant grown in the greenhouse, wherein the seedlings
have increased time to wilt as compared to a seedling grown from a
reference seed.
31. A synthetic combination of a cotton seed and purified
filamentous, spore-forming, facultative fungal endophytes of at
least one species, wherein the facultative fungal endophytes are
present in the formulation in an amount effective to improve
drought resistance of the cotton plant grown from the seed compared
to a plant grown from a reference seed.
32. The synthetic combination of claim 31, wherein the facultative
fungal endophytes are present at a concentration of at least 100
(10 2) spores/seed on the surface of the seed.
33. The synthetic combination of claim 31, wherein the facultative
fungal endophytes are present in the formulation in an amount
effective to increase biomass.
34.-36. (canceled)
37. The synthetic combination of claim 31, wherein the facultative
fungal endophytes are present in the formulation in an amount
effective to reduce yield loss.
38. The synthetic combination of claim 37, wherein yield loss is
reduced by at least 5%.
39. The synthetic combination of claim 37, wherein the reduction in
yield loss results in a yield increase of at least 5%.
40. The synthetic combination of claim 31, wherein enhanced
resistance to drought stress is assessed by withholding water from
7-day old seedlings of the cotton plant grown in the greenhouse,
wherein the seedlings have increased time to wilt as compared to a
seedling grown from a reference seed.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 14/535,292 filed Nov. 6, 2014, allowed, which claims priority
to U.S. Provisional Patent Application Nos. 61/900,929 and
61/900,935, both filed Nov. 6, 2013, which are herein incorporated
by reference in their entirety.
INCORPORATION OF SEQUENCE LISTING
[0002] The sequence listing that is contained in the file named
32600 US_Sequence_Listing.txt, includes 77 sequences and is 33
kilobytes as measured in Microsoft Windows operating system and was
created on Dec. 5, 2015, is filed electronically herewith and
incorporated herein by reference.
FIELD OF THE INVENTION
[0003] The present invention relates to fungal endophytes of
agricultural crops for improving yield and/or for protection from
pests.
DESCRIPTION OF RELATED ART
[0004] Fungal endophytes are fungi that internally colonize plant
tissues without causing evident damage or disease. Particular
fungal endophytes, such as mycorrhiza, survive within various host
plant tissues, often colonizing the intercellular spaces of host
leaves, stems, flowers or roots. The symbiotic endophyte-host
relationships can provide several fitness benefits to the host
plant, such as enhancement of nutrition, and/or increased drought
tolerance. Root-colonizing mycorrhizae survive on photosynthetic
carbohydrates from the plant, and in return, aid in the
solubilization and uptake of water and minerals to the host, which
can lead to the promotion of seed germination and plant growth.
Additionally, the association of a fungal endophyte with a host
plant can provide tolerance to a variety of biotic and abiotic
stresses. Host growth, fitness promotion and protection are thought
to be achieved through multiple beneficial properties of the
endophyte-host association. For instance, the endophytic organisms
may produce growth-regulating substances to induce biomass
production and alkaloids or other metabolites. Additionally, fungal
endophytes may directly suppress or compete with disease-causing
microbes, protecting the plant from potential pathogens.
SUMMARY OF THE INVENTION
[0005] In one aspect, the invention provides methods for improving
a trait in an agricultural plant comprising contacting an
agricultural seed of said plant with a formulation comprising a
purified facultative fungal endophytes of at least one species,
wherein the endophytes are capable of producing substances that are
beneficial to plants or detrimental to pests or both, and wherein
the endophytes are present in the formulation in an amount
effective to modulate the colonization frequencies of the
endophytes that are native to the agricultural plant grown from the
seed compared to a reference seed that is planted in an
agricultural environment, and to provide a benefit to the seeds or
the agricultural plants grown from the seeds.
[0006] In another aspect, the invention provides methods for
providing a benefit to an agricultural plant comprising treating
said plant, the seed of said plant, or the rhizosphere of said
plant or seed with a composition comprising purified facultative
fungal endophytes and an agriculturally-acceptable carrier, wherein
the endophyte is capable of at least one of: reducing pest
reproduction, killing pests, and deterring pests, and wherein the
endophyte is present in the composition in an amount effective to
provide a benefit to the seeds or the agricultural plants derived
from the seeds.
[0007] In yet another aspect, the invention provides methods for
providing a benefit to an agricultural plant, comprising obtaining
a synthetic combination of an agricultural plant seed and a
purified facultative fungal endophyte, wherein the endophyte is
capable of at least one of: reducing pest reproduction, killing
pests, and deterring pests, and wherein the endophyte is present in
the synthetic combination in an amount effective to provide a
benefit to the seeds or the agricultural plants derived from the
seeds.
[0008] In another embodiments, methods of producing a plant with a
non-naturally occurring ratio of endophytes is provided, where the
methods comprise contacting an agricultural seed of the plant with
a formulation comprising facultative fungal endophytes of at least
one species, wherein endophytes are present in the formulation in
an amount effective to modulate the colonization frequencies of the
endophytes that are native to the agricultural plant grown from the
seed compared to a reference seed that is planted in an
agricultural environment, wherein the plant with the non-naturally
occurring ratio of endophytes has an improved trait as compared to
a plant with a naturally-occurring ratio. In a further aspect, the
facultative fungal endophytes are capable of producing substances
that are beneficial to plants or detrimental to pests or both.
[0009] In another aspect, the invention provides methods for
altering the systemic defensive pathway in a plant comprising
contacting an agricultural seed of said plant with a formulation
comprising a purified facultative fungal endophytes of at least one
species, wherein the endophytes are capable of producing substances
that are beneficial to plants or detrimental to pests or both, and
wherein the endophyte is present in the synthetic combination in an
amount effective to modulate the level of at least one phytohormone
within an agricultural plant grown from the plant seed, and to
provide a benefit to the seeds or the agricultural plants grown
from the seeds. In a further aspect, the facultative fungal
endophytes are capable of producing substances that are beneficial
to plants or detrimental to pests or both.
[0010] In other embodiments, the invention provides methods of
modulating the colonization frequencies of endophytes that are
native to the agricultural plant grown from the seed compared to a
reference seed that is planted in an agricultural environment,
comprising contacting the seed of the agricultural plant with a
formulation comprising facultative fungal endophytes of at least
one species, and wherein endophytes are present in the formulation
in an amount effective to modulate the colonization frequencies of
native endophytes and to provide a benefit to the seeds or the
agricultural plants grown from the seeds. In certain aspects, the
native endophytes are of genus Alternaria. In a further aspect, the
facultative fungal endophytes are capable of producing substances
that are beneficial to plants or detrimental to pests or both.
[0011] In another aspect, the invention provides methods for
altering the systemic defensive pathway in a plant comprising
contacting an agricultural seed of said plant with a formulation
comprising a purified facultative fungal endophytes of at least one
species, and wherein the endophyte is present in the synthetic
combination in an amount effective to modulate the level of at
least one phytohormone within an agricultural plant grown from the
plant seed, and to provide a benefit to the seeds or the
agricultural plants grown from the seeds. In a further aspect, the
facultative fungal endophytes are capable of producing substances
that are beneficial to plants or detrimental to pests or both.
[0012] In yet another aspect, the invention provides methods of
producing a plant with a network of fungal endophytes that
comprises endophytes of the genus Alternaria, comprising (a)
contacting the seed of an agricultural plant with a formulation
comprising facultative fungal endophytes of at least one
non-Alternaria species, wherein endophytes are present in the
formulation in an amount effective to provide a benefit to the
seeds or the agricultural plants grown from the seeds, and wherein
the plant grown from the seed comprises endophytes of the genus
Alternaria. In a further aspect, the facultative fungal endophytes
are capable of producing substances that are beneficial to plants
or detrimental to pests or both.
[0013] Also provided herein are synthetic combinations of an
agricultural plant seed and a composition comprising purified
entomopathogenic fungal endophytes of at least one species, wherein
the endophytes are capable of (1) colonizing the agricultural plant
grown from the plant seed (2) and at least one of: reducing pest
reproduction, killing pests, and deterring pests, from within the
agricultural plant; wherein the endophytes are not of species
Beauveria bassiana, and wherein the endophyte is present in the
synthetic combination in an amount effective to provide a benefit
other than enhanced resistance to biotic stress to the seeds or the
agricultural plants derived from the seeds when the seeds or plants
are grown in an agricultural setting.
[0014] In yet another aspect, the invention provides synthetic
combinations of an agricultural plant seed and a composition
comprising purified facultative fungal endophytes of at least one
species, wherein the endophyte is present in the synthetic
combination in an amount effective to modulate the level of at
least one phytohormone within an agricultural plant grown from the
plant seed, and to provide a benefit to the seeds or the
agricultural plants grown from the seeds. In a further aspect, the
facultative fungal endophytes are capable of producing substances
that are beneficial to plants or detrimental to pests or both.
[0015] In another embodiment, the invention provides synthetic
combinations of an agricultural plant seed and a composition
comprising purified facultative fungal endophytes of at least one
species, wherein the facultative fungal endophytes are present in
the synthetic combination in an amount effective to modulate the
colonization frequencies of endophytes that are native to the
agricultural plant grown from the seed compared to a reference seed
that is planted in an agricultural environment, and to provide a
benefit to the seeds or the agricultural plants grown from the
seeds. In a further aspect, the facultative fungal endophytes are
capable of producing substances that are beneficial to plants or
detrimental to pests or both. In certain aspects, the facultative
fungal endophytes are present in the synthetic combination in an
amount effective to modulate the colonization frequencies of
endophytes of genus Alternaria that are native to the agricultural
plant grown from the seed compared to a reference seed that is
planted in an agricultural environment.
[0016] In a further aspect for certain of these methods and
synthetic combinations, the composition comprising purified
facultative fungal endophytes also comprises an agriculturally
acceptable carrier.
[0017] In a further aspect for certain of these methods and
synthetic combinations, the facultative fungal endophyte may be a
filamentous fungal endophyte. In other embodiments, the facultative
endophyte may be spore-forming. In yet other embodiments, the
facultative fungal endophyte may be a septate fungal endophyte. In
yet other embodiments, the facultative fungal endophyte may be a
dark septate fungal endophyte. In some embodiments, the facultative
endophyte may be an entomopathogen. In some embodiments, the
facultative fungal endophyte may belong to the phylum Ascomycota or
Basidiomycota. In a further aspect, the facultative fungal
endophyte may belong to subphylum Pezizomycotina, Agaricomycotina,
or Ustilaginomycotina. In yet another aspect, facultative fungal
endophyte may belong to class Sordariomycetes, Dothideomycetes,
Agaricomycetes, Ustilaginomycetes, Orbiliomycetes, or
Eurotiomycetes. In yet another aspect, the facultative fungal
endophyte may belong to order Hypocreales, Pleosporales,
Capnodiales, Sordariales, Polyporales, Diaporthales, Ustilaginales,
Xylariales, Orbiliales, Trichosphaeriales, or Eurotiales.
[0018] In a further aspect, the facultative fungal endophyte may be
a species from Table 1, namely Acremonium alternatum, Alternaria
alternata, Alternaria brassicae, Alternaria compacta, Alternaria
dianthi, Alternaria longipes, Alternaria mali, Alternaria sesami,
Alternaria solani, Alternaria sp., Alternaria tenuissima,
Ascomycota sp., Bipolaris spicifera, Cercospora canescens,
Cercospora capsici, Cercospora kikuchii, Cercospora zinnia,
Chaetomium globosum, Chaetomium piluliferum, Chaetomium sp.,
Cladosporium cladosporioides, Cladosporium sp., Cladosporium
uredinicola, Cochliobolus sp, Phanerochaete crassa, Phoma
americana, Phoma subherbarum, Phomopsis liquidambari, Phomopsis
sp., Pleospora sp., Pleosporaceae sp., Polyporales sp., Preussia
africana, Preussia sp., Pseudozyma sp., Pyrenophora teres,
Colletotrichumcapsici, Coniolariella gamsii, Coniothyrium
aleuritis, Coniothyrium sp., Corynespora cassiicola, Diaporthe sp.,
Diatrype sp., Drechslerella dactyloides, Embellisia indefessa,
Epicoccum nigrum, Epicoccum sp., Exserohilum rostratum, Fusarium
chlamydosporum, Fusarium sp., Gibellulopsis nigrescens,
Gnomoniopsis sp., Lewia infectoria, Mycosphaerella coffeicola,
Mycosphaerellaceae sp., Nigrospora oryzae, Nigrospora sp.,
Nigrospora sphaerica, Paecilomyces sp., Penicillium citrinum,
Retroconis sp., Rhizopycnis sp., Schizothecium inaequale,
Stagonospora sp., Stemphylium lancipes, Thielavia hyrcaniae,
Thielavia sp., Ulocladium chartarum, Verticillium sp., Beauveria
bassiana, Aspergillus parasiticus, Lecanicillium lecanii, and
Paecilomyces lilacinus.
[0019] In a further aspect, the facultative fungal endophyte
comprises a nucleic acid that is at least 97% identical, for
example, at least 98% identical, at least 99% identical, at least
99.5% identical, or 100% identical to the nucleic acids provided in
any of SEQ ID NO:7 through SEQ ID NO:77, for example those listed
in Example 16.
[0020] In another aspect for certain of these methods is an
additional step of packaging the contacted seeds in a container may
be included. In certain aspects, the packaging material may be
selected from a bag, box, bin, envelope, carton, or container, and
may comprise a dessicant.
[0021] In a further aspect for certain of these methods and
synthetic combinations, the benefit to the treated seed or plant
grown from the treated seed is measured at the level of the
population, as compared to a reference population of plants. In
certain aspects, the facultative fungal endophyte may be providing
a benefit to a crop comprising a plurality of agricultural plants
produced from the seeds treated with the endophyte. In certain
aspects, the present invention discloses a substantially uniform
population of plants produced by growing the population of seeds
described above. In one embodiment, at least 75%, at least 80%, at
least 90%, at least 95% or more of the plants comprise in one or
more tissues an effective amount of the endophyte or endophytes. In
another embodiment, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%,
75%, at least 80%, at least 90%, at least 95% or more of the plants
comprise a microbe population that is substantially similar.
[0022] In a further aspect for certain of these methods and
synthetic combinations, the plant is grown in an agricultural
setting or environment, including a greenhouse. In one embodiment,
the agricultural setting or environment comprises at least 100
plants. In another embodiment, the population occupies at least
about 100 square feet of space, wherein at least about 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% of the
population comprises an effective amount of the microbe. In another
embodiment, the population occupies at least about 100 square feet
of space, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90% or more than 90% of the population comprises the microbe
in reproductive tissue. In still another embodiment, the population
occupies at least about 100 square feet of space, wherein at least
about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90%
of the population comprises at least 10 CFUs, 100 CFUs, 1,000 CFUs,
10,000 CFUs or more of the facultative fungal endophyte of the
invention. In yet another embodiment, the population occupies at
least about 100 square feet of space, wherein at least about 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% of the
population comprises the facultative fungal endophyte of the
invention.
[0023] In one embodiment, at least 10%, at least 20%, at least 30%,
at least 40%, at least 50%, at least 60%, at least 70%, at least
75%, at least 80%, at least 90%, at least 95% or more of the seeds
in the population, contains a viable endophyte or endophytes
disposed on the surface of the seeds. In a particular embodiment,
at least 10%, at least 20%, at least 30%, at least 40%, at least
50%, at least 60%, at least 70%, at least 75%, at least 80%, at
least 90%, at least 95% or more of the seeds in the population
contains at least 10 CFU, for example, at least 30 CFU, at least
100 CFU, at least 300 CFU, at least 1,000 CFU, at least 3,000 CFU,
at least 10,000 CFU or more, of the endophyte or endophytes coated
onto the surface of the seed.
[0024] In a further aspect for certain of these methods and
synthetic combinations, the endophytes that are native to the
agricultural plant and whose colonization frequencies or ratios are
altered may belong to phylum Ascomycota or Basidiomycota. In yet
another aspect, the endophytes that are native to the agricultural
plant may be of class Leotiomycetes, Dothideomycetes,
Eurotiomycetes, Saccharomycetes, Sordariomycetes, Agaricomycetes,
Microbotryomycetes, Tremellomycetes. In yet another aspect, the
native endophytes may belong to order Capnodiales, Pleosporales,
Chaetothythyriales, Eurotiales, Saccharomyceoles, Diaporthales,
Hypocreales, Ophiostomatales, Sordariales, Trichosphaeriales,
Xylariales, Cantharellales, Corticiales, Polyporales, Russulales,
Sporidiobolales, or Tremellales. In a further aspect, the native
endophytes may belong to genus Davidiellaceae, Mycosphaerellaceae,
Pleosporaceae, Didymellaceae, Sporormiaceae, Chaetothyriaceae,
Trichocomaceae, Saccharomycetaceae, Gnomoniaceae, Cordycipitaceae,
Nectriaceae, Hypocreaceae, Plectosphaerellaceae, Ophiostomataceae,
Chaetomiaceae, Lasiosphaeriaceae, Trichosphaeriaceae,
Ceraiobasidiaceae, Corticiaceae, Coriolaceae, Peniophoraceae,
Sporidiobolaceae, or Tremellaceae. In a further aspect, the
endophytes that are native to the agricultural plant may be a
species from Table 2, namely Cladosporium sp., Cladosporium
cladosporioides, Davidiella sp., Cercospora sp., Cercospora
beticola, Alternaria sp., Alternaria alternata, Alternaria citri,
Alternaria tenuissima, Cochliobolus sp., Curvularia sp.,
Exserohilum sp., Lewia sp., Lewia infectoria, Pyrenophora sp.,
Pyrenophora tritici-repentis, Pleospora sp., Phoma americana,
Preussia africana, Penicillium sp., Thermomyces sp., Thermomyces
lanuginosus, Candida sp., Candida quercitrusa, Candida tropicalis,
Cyberlindnera sp., Cyberlindnera jadinii, Kluyveromyces sp.,
Kluyveromyces marxianus, Gnomoniopsis sp., Beauveria bassiana,
Cordyceps sp., Cordyceps bassiana, Fusarium sp., Gibellulopsis
nigrescens, Hypocrea sp., Hypocrea lixii, Hypocrea virens,
Trichoderma sp., Trichoderma tomentosum, Verticillium sp.,
Ophiostoma sp., Ophiostoma dendifundum, Chaetomium sp., Chaetomium
globosum, Thielavia hyrcaniae, Taifanglania sp., Taifanglania
inflata, Schizothecium inaequale, Nigrospora sp., Rhizoctonia sp.,
Phanerochaete sp, Trametes sp., Trametes hirsuta, Trametes villose,
Rhodotorula sp., Rhodotorula mucilaginosa, Cryptococcus sp.
Cryptococcus skinneri, or Tremella sp.
[0025] In a further aspect for certain of these methods and
synthetic combinations, the benefit provided by the facultative
fungal endophyte to the agricultural plant is an improved agronomic
property selected from the group consisting of increased biomass,
increased tillering, increased root mass, increased flowering,
increased yield, increased water use efficiency, reduction of yield
loss, altered plant height, decreased time to emergence, increased
seedling height, increased root length, increased chlorophyll
levels, retention of developing flowers, retention of developing
fruits, altered phytohormone levels, and enhanced resistance to
environmental stress relative to a reference plant. In some
aspects, the benefit provided is the alteration of levels of at
least two phytohormones. In some aspects, the environmental stress
is selected from the group consisting of drought stress, cold
stress, heat stress, nutrient deficiency, salt toxicity, aluminum
toxicity, grazing by herbivores, insect infestation, nematode
infection, and fungal infection, bacterial infection and viral
infection. In some aspects, the benefit to agricultural plants
derived from the seed is increased yield in a population of said
plants by about 5%, 10%, 15%, 20%, 30%, 40%, or 45% relative to a
reference population of plants. In other aspects, the benefit to
agricultural plants derived from the seed is a reduction of yield
loss in a population of said plants by more than 40%, 30%, 20%,
10%, 5%, or 1% relative to a reference population of plants. In
some aspects, treatment of seeds with facultative fungal endophytes
may decrease thrip damage, decrease fleahopper damage, increase
canopy temperature, increase drought tolerance, increase above
ground biomass, and increase below ground biomass in the plants
grown from the treated seeds.
[0026] In a further aspect for certain of these methods and
synthetic combinations, the facultative fungal endophyte is present
in the synthetic combination in an amount effective to obtain at
least 50% colonization of the leaves, stems or roots of an
agricultural plant grown from the seed.
[0027] In a further aspect for certain of these methods and
synthetic combinations, the facultative fungal endophytes are
capable of producing substances that are detrimental to pests. In
certain aspects, the pest may be a nematode and/or an insect, for
example, a root knot nematode, a aphid, a lygus bug, a stink bug,
or combinations thereof.
[0028] In a further aspect for certain of these methods and
synthetic combinations, the synthetic combination may comprise at
least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, or 20 facultative fungal endophytes. In one aspect, the
invention provides a synthetic combination of a cotton plant or
seed and a fungal endophyte comprising at least 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 endophytes
selected from those in Table 1, wherein the cotton or seed is a
host of the endophyte.
[0029] In another aspect, a seed coating is provided comprising a
fungal endophyte comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 endophytes from Table 1;
and at least one sticker, wherein the fungal endophyte is in
contact with the sticker. In certain aspects, the sticker may
comprise, for example, alginic acid, carrageenan, dextrin, dextran,
pelgel, polyethelene glycol, polyvinyl pyrrolidone, methyl
cellulose, polyvinyl alcohol, gelatin, or combinations thereof. In
certain aspects, the sticker may have a weight ratio between fungal
endophyte and sticker of 1:1-10, 1:10-50, 1:50-100, 1:100-500,
1:500-1000, or 1:1000-5000. The seed coating may be a solid or
fluid. In certain aspects, the seed coating is a powder. In certain
aspects, the fungal endophyte may comprise fungal spores. In
various aspects, the seed coating may comprise about 1, 2, 5, 10,
50, 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7,
10.sup.8, or 10.sup.9 or more colony forming units per gram or
spores per gram.
[0030] In certain embodiments, compositions for foliar or soil
application may comprise a fungal endophyte comprising at least 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or
20 endophytes from Table 1, and at least one carrier, surfactant or
diluent. In certain aspects, the compositions may comprise may
comprise about 1, 2, 5, 10, 50, 10.sup.2, 10.sup.3, 10.sup.4,
10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, or 10.sup.9 or more colony
forming units per gram or spores per gram. In various aspects, the
composition may comprise water, a detergent, Triton X,
insecticides, fungicides, or combinations thereof, for example. In
further embodiments, seed compositions comprise a plant seed and
the above-described seed coating. In certain aspects, the plant
seed comprises a cotton seed, a seed of an agronomically elite
plant, a dicot plant seed, and/or a monocot plant seed. In certain
aspects, the seed composition may be resistant to a pest comprising
an insect and/or a nematode.
[0031] In yet another aspect, the invention provides methods for
preventing pest infestation or increasing yield, which may comprise
treating a plant, plant seed, or the rhizosphere of said plant or
seed with the endophyte containing compositions described herein.
In certain aspects, the method may also comprise identifying a
plant or seed as in need of endophyte treatment. The pest may
comprise, for example, a nematode and/or insect. In certain
aspects, the pest may comprise a root knot nematode, a aphid, a
lygus bug, a stink bug, or combinations thereof.
[0032] In still yet another aspect, methods for preventing pest
infestation are provided comprising obtaining a seed described
herein and planting the seed. The method may further comprise
identifying a need of preventing pest infestation. In certain
aspects, the pest may comprise a nematode and/or a insect; and/or
the pest may comprise a root knot nematode, a aphid, a lygus bug, a
stink bug, or combinations thereof.
[0033] In a further embodiment, a method for treating a pest
infestation comprises identifying a plant suspected of being
infected with a pest, applying an above-described composition to
the plant, whereby an endophyte-treated plant is generated. In
certain aspects, the pest may comprise a nematode and/or an insect;
and/or the pest may comprise a root knot nematode, a aphid, a lygus
bug, a stink bug, or combinations thereof
[0034] In still yet another aspect, a method of manufacturing
pest-resistant seeds is provided comprising providing a fungal
endophyte composition comprising at least 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 endophytes from
Table 1, providing seeds; and combining the seeds with the
endophyte composition, whereby pest-resistant seeds are generated.
In certain aspects, the method increases the percentage of
colonization with the endophyte of the plant developing from the
seed.
[0035] In still yet another aspect, methods of increasing a yield
of a crop or a reduction of loss are disclosed comprising providing
a fungal endophyte composition comprising at least 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20
endophytes from Table 1; and applying the endophyte composition to
a seed, plant or part thereof, whereby the yield of the crop
increases. In certain aspects, the crop may be cotton, and the
increase of yield may be at least about 2%, 3% 5%, 15%, 20%, or 25%
relative to a crop to which no endophyte composition has been
applied. In certain aspects, the increase of yield is about 2%-5%,
3%-5%, 5%-10%, 10%-15%, or greater than about 20%, 30%, or more
relative to a crop to which no endophyte composition has been
applied. In certain aspects, the crop is cotton and the increase of
yield comprises reduced boll damage. In certain aspects, the
reduction of loss comprises reduction of loss due to insect
infestation or drought, and the loss is less than 50%, 40%, 30%,
20%, 10%, 5%, or 5% relative to a crop to which no endophyte
composition has been applied.
[0036] Also described herein are commodity plant products
comprising a plant or part of a plant (including a seed) and
further comprising the facultative fungal endophyte described above
that is present in a detectable level, for example, as detected by
the presence of its nucleic acid by PCR. In another aspect,
disclosed is a method of producing a commodity plant product,
comprising obtaining a plant or plant tissue from the synthetic
combination described above, and producing the commodity plant
product therefrom. The commodity plant product can be produced from
the seed, or the plant (or a part of the plant) grown from the
seed. The commodity plant product can also be produced from the
progeny of such plant or plant part. The commodity plant product
can be is selected from the group consisting of grain, flour,
starch, seed oil, syrup, meal, flour, oil, film, packaging,
nutraceutical product, an animal feed, a fish fodder, a cereal
product, a processed human-food product, a sugar or an alcohol and
protein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0037] FIG. 1: The colonization efficiencies demonstrate that
endophytes can be manipulated in the field. Depicted are the
mean+/-SE endophytic colonization frequencies of cotton seedlings
under field conditions inoculated by seed treatments with different
spore concentrations of either (left) Paecilomyces lilacinus or
(right) Beauveria bassiana.
[0038] FIG. 2: The endophytic fungus Paecilomyces lilacinus
negatively affects root knot nematode (Meloidogyne incognita)
reproduction when present as an endophyte in cotton. At high
nematode inoculum levels (10,000 eggs), the endophyte reduced egg
production in plants following treatment of seeds with solutions
containing either 10.sup.6 or 10.sup.7 spores/ml when compared to
untreated control seeds. At field inoculum levels (2000 eggs), the
presence of the endophyte significantly reduced both galls and egg
production at both seed treatment concentrations.
[0039] FIG. 3: Endophytic Chaetomium globosum negatively affects
root-knot nematode reproduction. Negative effects of endophytic
Chaetomium globosum on root-knot nematode gall formation and egg
production following cotton seed soaking treatments in solutions of
0 (untreated controls), 10.sup.6 and 10.sup.8 spores/ml. Seedlings
were inoculated with 1000 nematode eggs and grown in the
greenhouse. Egg production by hatching nematodes that successfully
infected the seedlings was quantified 60 days later.
[0040] FIG. 4A and FIG. 4B: The effect of endophytic fungi on
cotton aphids (Aphis gossypii) reproduction. FIG. 4A demonstrates
that the presence of Beauveria bassiana in cotton negatively
affects the reproduction of cotton aphids. FIG. 4B demonstrates
that the presence of Paecilomyces lilacinus in cotton negatively
affects the reproduction of cotton aphids.
[0041] FIG. 5: Effects of Chaetomium globosum on cotton aphids.
Endophytic Chaetomium globosum in cotton negatively affects cotton
aphid population growth rates as evidenced by reduced reproduction
after 14 days on endophyte-colonized versus control plants. Cotton
plants were grown from seeds treated by soaking in spore solutions
of 0 (control), 10.sup.6 (low) and 108 (high) spores/ml.
[0042] FIG. 6A and FIG. 6B: The effect of the endophytic fungi
Beauveria bassiana and Paecilomyces lilacinus on western tarnished
plant bugs Lygus hesperus (Miridae). FIG. 6A demonstrates that
Beauveria bassiana and Paecilomyces lilacinus negatively affect
host plant selection of western tarnished plant bugs when present
as an endophyte in cotton. FIG. 6B demonstrates that Beauveria
bassiana and Paecilomyces lilacinus negatively affect host plant
selection behavior of western tarnished plant bugs when present as
an endophyte in cotton.
[0043] FIG. 7A and FIG. 7B: The effect of the endophytic fungi
Beauveria bassiana and Paecilomyces lilacinus on southern green
stink bugs (Nezara viridula (Pentatomidae). FIG. 7A demonstrates
that Beauveria bassiana and Paecilomyces lilacinus negatively
affect host plant selection of southern green stink bugs when
present as an endophyte in cotton. FIG. 7B demonstrates that
Beauveria bassiana and Paecilomyces lilacinus negatively affect
host plant selection behavior of southern green stink bugs when
present as an endophyte in cotton.
[0044] FIG. 8: A reduction in cotton boll damage was observed
during field trials. Relative to control plants, levels of
insect-related boll damage were lower among plants that were
treated by soaking seeds in spore solutions of Beauveria bassiana
and Paecilomyces lilacinus at concentrations of 10.sup.6 and
10.sup.8 spore/ml.
[0045] FIG. 9: Foliar application of cotton in the field with
spores of endophytic entomopathogenic fungi improves plant
performance. Cotton (variety FM1740B2F) seeds treated with a
variety of typical fungicide (Metalaxyl, Triadimenol,
Trifloxystrobin, 2-(Thiocyanome-thylthio) benzothioazole) and
insecticide (Thiodicarb, Imidacloprid, Chloropyrifos) seed
treatments were planted and grown under field conditions. The
plants were sprayed at the 5th true leaf stage with aqueous
solutions of Beauveria bassiana and Paecilomyces fumosoroseus.
Sucrose was included (1% wt/vol) as an additional nutritional
resource for the fungi. Significantly higher first position boll
(developing fruit) retention was observed in plants sprayed with
Beauveria bassiana without sucrose and Paecilomyces fumosoroseus
plus sucrose.
[0046] FIG. 10A and FIG. 10B: Positive effects of fungal endophytes
on cotton plant performance under field conditions. FIG. 10A
demonstrates an early season trend for higher square retention in
the treated versus untreated plants. FIG. 10B demonstrates that
significantly more bolls were retained in the endophyte treatment
groups later in the season, relative to control. This is
demonstrated with both endophyte species used and with both seed
treatment concentration employed (Repeated measures ANOVA: Time,
P<0.001; Time*Endophyte, P=0.045, Endophyte, P=0.003).
[0047] FIG. 11: Positive effects of fungal endophytes on cotton
yields under field conditions. The data demonstrate that endophyte
treatments achieved 25% higher yields in treated cotton plants.
[0048] FIG. 12A and FIG. 12B: Positive effects of fungal endophytes
on sorghum (FIG. 12A) plant height and (FIG. 12B) total fresh
biomass under growth chamber seedling assays. Data shown is average
plant height (cm) and total fresh biomass (g) of n=10 independent
replicates. Error bars represent .+-.1 standard error. All three
fungal endophytes improve both traits relative to the untreated
control.
[0049] FIG. 13: The in-field modulation of the colonization of
endogenous cotton endophytes in (panels A, B) stems and (panels C,
D) roots when treated with fungal endophytes Paecilomyces lilacinus
(panels A, C) and Beauveria bassiana (panels B, D). Data shown is a
percentage change in colonization relative to the corresponding
untreated control and plant tissue.
[0050] FIG. 14: Average percent difference in yield between
endophyte treated and control cotton plants (n=6 replicate plots in
a dryland field, College Station, Tex.) for 15 facultative fungal
endophytes in the Phytogen (PHY 499WRF) cultivar.
[0051] FIG. 15: Aggregated average percent difference in yield
between endophyte treated and control cotton plants (n=6 replicate
plots in a dryland field, College Station, Tex.) for 15 facultative
fungal endophytes and two cotton cultivars; Delta Pine (DP
0912B2RF) and Phytogen (PHY 499WRF). Bars represent a 95%
confidence interval around the mean.
[0052] FIG. 16A and FIG. 16B: Average percent difference in thrip
damage (FIG. 16A) and fleahopper damage (FIG. 16B) between
endophyte treated and control cotton plants. The thrip damage was
assessed in the Delta Pine (DP 0912B2RF) cultivar (n=6 replicate
plots in a dryland field, College Station, Tex.) for 15 facultative
fungal endophytes. 12 out of the 15 facultative fungal endophytes
tested showed a decrease in thrip damage relative to the untreated
cotton plants. The fleahopper damage was assessed in cotton plants
of the Phytogen (PHY 499WRF) cultivar (n=6 replicate plots in a
dryland field, College Station, Tex.) for 15 facultative fungal
endophytes. 6 out of the 15 facultative fungal endophytes tested
showed an average decrease in fleahopper damage as compared to
untreated cotton plants.
[0053] FIG. 17A and FIG. 17B: Mid-season field-trait measured in
June at the dryland trial of (FIG. 17A) root length and (FIG. 17B)
belowground weight. Data presented is the average of n=10
independent replicates and error bars represent .+-.one standard
error.
[0054] FIG. 18: Mid-season field-trait measured in July at the
dryland trial of canopy temperature (Celsius) for the (open bars)
Delta Pine and (hatched bars) Phyton cultivars. Data presented is
the block-controlled average of n=10 independent replicates,
relative to the control plot and error bars represent .+-.one
standard error.
[0055] FIG. 19: Mid-season field-trait measured in August at the
dryland trial of NDVI for the (open bars) Delta Pine and (hatched
bars) Phyton cultivars. Data presented is the block-controlled
average of n=10 independent replicates, relative to the control
plot and error bars represent .+-.one standard error.
[0056] FIG. 20: Mid-season field-trait measured in August at the
dryland trial of first position square retention for the (open
bars) Delta Pine and (hatched bars) Phyton cultivars. Data
presented is the block-controlled average of n=10 independent
replicates, relative to the control plot and error bars represent
.+-.one standard error.
[0057] FIG. 21: Mid-season field-trait measured in August at the
dryland trial of plant height (cm) for the (open bars) Delta Pine
and (hatched bars) Phyton cultivars. Data presented is the
block-controlled average of n=10 independent replicates, relative
to the control plot and error bars represent .+-.one standard
error.
[0058] FIG. 22: Mid-season field-trait measured in July at the
dryland trial of plant height (cm) for the (open bars) Delta Pine
and (hatched bars) Phyton cultivars. Data presented is the
block-controlled average of n=10 independent replicates, relative
to the control plot and error bars represent .+-.one standard
error.
[0059] FIG. 23: Picture showing increased biomass in the plants
treated with endophytes (right half of the image) compared to
untreated control (left half of the image).
[0060] FIG. 24: Table showing the time to wilt following drought
stress in days for plants grown from seeds treated with fungal
endophytes and control.
[0061] FIG. 25: Table showing the time to death following drought
stress in days for plants grown from seeds treated with fungal
endophytes and control.
DETAILED DESCRIPTION OF THE INVENTION
[0062] Endophytic fungi are ubiquitous in nature, infecting
virtually all plants in both natural and agronomic ecosystems.
Plants commonly harbor a diversity of fungi living within their
tissues as asymptomatic endophytes that can provide protection from
a range of biotic and abiotic stressors. The present disclosure
describes certain fungal endophytes that can be pathogens,
parasites or antagonists to plant pathogens, insects, and nematode
pests, thereby providing health and performance benefits to crop
plants. The symbiotic endophyte-host relationships can provide
several general health and fitness benefits to the host plant, such
as enhancement of nutrition, increased drought tolerance and/or
chemical defense from potential herbivores and often enhanced
biomass production. Root-colonizing mycorrhizae survive on
photosynthetic carbohydrates from the plant, and in return, aid in
the solubilization and uptake of water and minerals to the host,
which can lead to the promotion of seed germination and plant
growth. Additionally, the association of a fungal endophyte with a
host plant often provides protection from pathogens or tolerance to
a variety of biotic and abiotic stresses, such as insect
infestation, grazing, water or nutrient deficiency, heat stress,
salt or aluminum toxicity, and freezing temperatures. Host growth
and fitness promotion and protection are thought to be achieved
through multiple beneficial properties of the endophyte-host
association.
[0063] These fungal endophytes provided in Table 1 were originally
collected as fungal endophytes of cotton. These endophytic fungi
can be inoculated to live within cotton using either seed, soil or
foliar applications and exhibited surprisingly beneficial effects
by providing protection from pest infestation. Pests can be
nematode and/or insect pests. In addition, these endophytic fungi
have an unexpected beneficial effect on cotton yield.
[0064] Described is the application of beneficial fungi to
establish endophytically within crop plants to improve plant
performance and yield while conferring protection against insect
and nematode pests. In this regard, the present invention overcomes
the limitations of the prior art such as the susceptibility of the
fungi to degradation by UV light, desiccation or heat after
exposure to the environment following application as an inundative
soil or foliar biopesticide. Inoculation and endophytic
establishment of the fungi within the plant protects the fungi from
UV light, desiccation, and unfavorable temperatures, while
harboring the fungi in the very plant tissues they are intended to
protect. Introducing fungi to live endophytically within plants
requires no genetic modification of the plant or microorganisms,
and the fungi themselves can be a source for natural products. In
various embodiments, the fungal inoculant can be formulated and
applied, for example, as treatment of seeds, in furrow
applications, before or during planting, or as foliar application
after plant germination, and after inoculation, the fungal
endophytes provide season-long protective effects and higher crop
yields (approximately 25% higher). In certain embodiments, the
increase of yield is about 5%, 10%, 15%, 20%, 30%, 40%, 45%, 50%,
or greater than 50% relative to a crop to which no endophyte
composition has been applied. In further embodiments, the increase
of yield is the result of reduction of loss that comprises
reduction of loss due to insect infestation or drought and the loss
is less than 50%, 40%, 30%, 20%, 10%, 5%, or 5% relative to a crop
to which no endophyte composition has been applied. In certain
embodiments, the crop is cotton and the reduction of loss comprises
reduced boll damage.
[0065] Thus, in one aspect, the invention provides a combination
(also termed a "symbiotum") of a host plant and an endophyte that
allows for improved agronomic properties of host plants. The
combination may be achieved by artificial inoculation, application,
or other infection of a host plant or seeds thereof, such as a
cotton plant or seed thereof, or host plant tissues, with a fungal
endophyte strain of the present invention. Thus, a combination
achieved by such an inoculation is termed a "synthetic"
combination, synthetic composition, synthetic seed coating, and/or
synthetic pest-resistant seed composition. The fungal endophyte may
be present in intercellular spaces within plant tissue, such as the
root. Its presence may also occur or may also be maintained within
a plant or plant population by means of grafting or other
inoculation methods such as treating seeds, plants or parts thereof
with endophyte mycelia, or endophyte spores. In certain
embodiments, the plant, part of the plant, roots, seed, or leaves
are sterilized to remove microorganisms before applying the
endophyte. In particular embodiments, seeds are sterilized to
remove native endophytes before adding the endophyte compositions
herein described. In certain aspects, the ability of the seed to
germinate is not affected by the sterilization.
[0066] The invention also provides methods for detecting the
presence of the fungal endophyte of the present invention within a
host plant. This may be accomplished, for instance, by isolation of
total DNA from tissues of a potential plant-endophyte combination,
followed by PCR, or alternatively, Southern blotting, western
blotting, or other methods known in the art, to detect the presence
of specific nucleic or amino acid sequences associated with the
presence of a fungal endophyte strain of the present invention.
Alternatively, biochemical methods such as ELISA, HPLC, TLC, or
fungal metabolite assays may be utilized to determine the presence
of an endophyte strain of the present invention in a given sample
of crop tissue. Additionally, methods for identification may
include microscopic analysis, such as root staining, or culturing
methods, such as grow out tests or other methods known in the art
(Deshmukh et al. 2006). In particular embodiments, the roots of a
potential grass plant-endophyte combination may be stained with
fungal specific stains, such as WGA-Alexa 488, and microscopically
assayed to determine fungal root associates.
[0067] In certain embodiments, the agronomic qualities may be
selected from the group consisting of: increased biomass, increased
tillering, increased root mass, increased flowering, increased seed
yield, and enhanced resistance to biotic and/or abiotic stresses,
each of these qualities being rated in comparison to otherwise
identical plants grown under the same conditions, and differing
only with respect to the presence or absence of a fungal endophyte.
The synthetic combinations and methods of the present invention may
be applied to respond to actual or anticipated stresses. Such
stresses may include, for instance, drought (water deficit), cold,
heat stress, nutrient deficiency, salt toxicity, aluminum toxicity,
grazing by herbivores, insect infestation, nematode infection, and
fungal, bacteria or viral infection, among others.
[0068] The present disclosure provides, in one embodiment, fungal
endophytes selected from those in Table 1 that negatively affect
the reproduction of insect herbivores feeding on leaves above
ground (cotton aphids, Aphis gossypii) and plant parasitic
nematodes attacking roots below ground (root knot nematodes,
Meloidogyne incognita). In addition, improved plant performance and
yields in colonized versus uncolonized control plants may be
observed in field trials employing seed treatment with such
endophytes. Plant growth enhancement and increased resistance to
root knot nematodes was demonstrated in cotton, for example,
employing Chaetomium globosum as an endophyte in greenhouse trials.
In addition and as a further non-limiting illustrative example,
using Beauveria bassiana as an endophyte in cotton, reductions in
insect (cotton aphid) reproduction was demonstrated in both
greenhouse and field trials. The endophytic presence of
Paecilomyces lilacinus and Beauveria bassiana also had negative
effects on the host selection behavior of key sucking bug pests
(Lygus hesperus and Nezara viridula) that attack developing flowers
and fruits in cotton. Furthermore, in field trials using Beauveria
bassiana as an endophyte in cotton positive effects on plant
performance and higher yields in endophyte colonized versus
uncolonized control plants was demonstrated.
[0069] Metabolomic differences between the plants can be detected
using methods known in the art. For example, a biological sample
(whole tissue, exudate, phloem sap, xylem sap, root exudate, etc.)
from the endophyte-associated and reference agricultural plants can
be analyzed essentially as described in Fiehn et al., (2000) Nature
Biotechnol., 18, 1157-1161, or Roessner et al., (2001) Plant Cell,
13, 11-29. Such metabolomic methods can be used to detect
differences in levels in hormones, nutrients, secondary
metabolites, root exudates, phloem sap content, xylem sap content,
heavy metal content, and the like.
[0070] In another embodiment, the present invention contemplates
methods of coating the seed of a plant with a plurality of
endophytes, as well as seed compositions comprising a plurality of
endophytes on and/or in the seed. The methods according to this
embodiment can be performed in a manner similar to those described
herein for single endophyte coating. In one example, multiple
endophytes can be prepared in a single preparation that is coated
onto the seed. The endophytes can be from a common origin (i.e., a
same plant). Alternatively, the endophytes can be from different
plants.
[0071] Where multiple endophytes are coated onto the seed, any or
all of the endophytes may be capable of conferring a beneficial
trait onto the host plant. In some cases, all of the endophytes are
capable of conferring a beneficial trait onto the host plant. The
trait conferred by each of the endophytes may be the same (e.g.,
both improve the host plant's tolerance to a particular biotic
stress), or may be distinct (e.g., one improves the host plant's
tolerance to drought, while another improves phosphate
utilization). In other cases the conferred trait may be the result
of interactions between the endophytes.
DEFINITIONS
[0072] In the description and tables herein, a number of terms are
used. In order to provide a clear and consistent understanding of
the specification and claims, the following definitions are
provided. Unless otherwise noted, terms are to be understood
according to conventional usage by those of ordinary skill in the
relevant art.
[0073] When a term is provided in the singular, the inventors also
contemplate aspects of the invention described by the plural of
that term. The singular form "a," "an," and "the" include plural
references unless the context clearly dictates otherwise. For
example, the term "a cell" includes one or more cells, including
mixtures thereof.
[0074] The term "comprising" is intended to mean that the
compositions and methods include the recited elements, but not
excluding others. "Consisting essentially of" when used to define
compositions and methods, shall mean excluding other elements of
any essential significance to the combination. Thus, a composition
consisting essentially of the elements as defined herein would not
exclude trace contaminants from the isolation and purification
method and agriculturally acceptable carriers. "Consisting of"
shall mean excluding more than trace elements of other ingredients
and substantial method steps for applying the compositions of this
invention. Embodiments defined by each of these transition terms
are within the scope of this invention.
[0075] Biological control: the term "biological control" and its
abbreviated form "biocontrol," as used herein, is defined as
control of a pest, pathogen, or insect or any other undesirable
organism by the use of at least one endophyte.
[0076] A "composition" is intended to mean a combination of active
agent and at least another compound, carrier or composition, inert
(for example, a detectable agent or label or liquid carrier) or
active, such as a pesticide.
[0077] As used herein, an "agricultural seed" is a seed used to
grow plants in agriculture (an "agricultural plant"). The seed may
be of a monocot or dicot plant, and is planted for the production
of an agricultural product, for example grain, food, fiber, etc. As
used herein, an agricultural seed is a seed that is prepared for
planting, for example, in farms for growing. Agricultural seeds are
distinguished from commodity seeds in that the former is not used
to generate products, for example commodity plant products.
[0078] As used herein, a "commodity plant product" refers to any
composition or product that is comprised of material derived from a
plant, seed, plant cell, or plant part of the present invention.
Commodity plant products may be sold to consumers and can be viable
or nonviable. Nonviable commodity products include but are not
limited to nonviable seeds and grains; processed seeds, seed parts,
and plant parts; dehydrated plant tissue, frozen plant tissue, and
processed plant tissue; seeds and plant parts processed for animal
feed for terrestrial and/or aquatic animal consumption, oil, meal,
flour, flakes, bran, fiber, and any other food for human or animal
consumption; and biomasses and fuel products. Any such commodity
plant product that is derived from the plants of the present
invention may contain at least a detectable amount of the specific
and unique DNA corresponding to the endophytes described herein.
Any standard method of detection for polynucleotide molecules may
be used, including methods of detection disclosed herein.
[0079] As used herein, the phrase "agronomically elite plants"
refers to a genotype or cultivar with a phenotype adapted for
commercial cultivation. Traits comprised by an agronomically elite
plant may include biomass, carbohydrate, and/or seed yield; biotic
or abiotic stress resistance, including drought resistance, insect
resistance, fungus resistance, virus resistance, bacteria
resistance, cold tolerance, and salt tolerance; improved
standability, enhanced nutrient use efficiency, and reduced lignin
content.
[0080] In certain embodiments, cotton agronomically elite plants
include, for example, known cotton varieties AM 1550 B2RF, NG 1511
B2RF, NG 1511 B2RF, FM 1845LLB2, FM 1944GLB2, FM 1740B2F, PHY 499
WRF, PHY 375 WRF, PHY 367 WRF, PHY 339 WRF, PHY 575 WRF, DP 1252
B2RF, DP 1050 B2RF, DP 1137 B2RF, DP 1048 B2RF, and/or DP 1137
B2RF.
[0081] As used herein, the phrase "culture filtrate" refers to
broth or media obtained from cultures inoculated with a strain of
fungi and allowed to grow. The media is typically filtered to
remove any suspended cells, leaving the nutrients, hormones, or
other chemicals.
[0082] As used herein, the term "endophyte" refers to an organism
capable of living within a plant or plant tissue. An endophyte may
comprise a fungal organism that may confer an increase in yield,
biomass, resistance, or fitness in its host plant. Fungal
endophytes may occupy the intracellular or extracellular spaces of
plant tissue, including the leaves, stems, flowers, or roots.
[0083] The phrase "pest resistance" refers to inhibiting or
reducing attack from pests. Pest resistance provides at least some
increase in pest resistance over that which is already possessed by
the plant.
[0084] As used herein, the term "genotypes" refers to the genetic
constitution of a cell or organism.
[0085] As used herein, the term "phenotype" refers to the
detectable characteristics of a cell or organism, which
characteristics are either the direct or indirect manifestation of
gene expression.
[0086] As used herein, the phrase "host plant" refers to any plant
that an endophytic fungi colonizes. In certain embodiments, the
host plant comprises progeny of colonized plant.
[0087] As used herein, the phrase "increased yield" refers to an
increase in biomass or seed weight, seed or fruit size, seed number
per plant, seed number per unit area, bushels per acre, tons per
acre, kilo per hectare, carbohydrate yield, or cotton yield. Such
increased yield is relative to a plant or crop that has not been
inoculated with the endophyte. In certain embodiments, the increase
yield is relative to other commonly used pest treatments or other
methods of addressing the biotic or abiotic stress.
[0088] As used herein, the phrase "biomass" means the total mass or
weight (fresh or dry), at a given time, of a plant tissue, plant
tissues, an entire plant, or population of plants, usually given as
weight per unit area. The term may also refer to all the plants or
species in the community (community biomass).
[0089] As used herein, "sticker" refers to compounds to enhance
binding of spores to the seed surface. Non-limiting examples of
such compounds are alginic acid, carrageenan, dextrin, dextran,
pelgel, polyethelene glycol, polyvinyl pyrrolidone, methyl
cellulose, polyvinyl alcohol, or gelatin.
[0090] As used herein, an "agriculturally acceptable" excipient or
carrier is one that is suitable for use in agriculture without
undue adverse side effects to the plants, the environment, or to
humans or animals who consume the resulting agricultural products
derived therefrom commensurate with a reasonable benefit/risk
ratio.
[0091] As used herein, the term "synthetic" or the phrase
"synthetic combination" refers to an artificial combination that
includes mycelia and/or spores of a endophyte that is or leads to
an endophytic fungal-host relationship (also termed a "symbiotum")
of a host plant and an endophyte. The synthetic combination may be
achieved, for example, by artificial inoculation, application, or
other infection of a host plant, host plant seeds, or host plant
tissues with the endophyte. In addition, the combination of host
plant and an endophyte may be achieved by inoculating the soil or
growth media of the plant.
[0092] The present invention contemplates the use of "isolated"
microbe. As used herein, an isolated microbe is a microbe that is
isolated from its native environment, and carries with it an
inference that the isolation was carried out by the hand of man. An
isolated microbe is one that has been separated from at least some
of the components with which it was previously associated (whether
in nature or in an experimental setting) or occurs at a higher
concentration, viability, or other functional aspect than occurring
in its native environment. Therefore, an "isolated" microbe is
partially or completely separated from any other substance(s) as it
is found in nature or as it is cultured, propagated, stored or
subsisted in naturally or non-naturally occurring environments.
Specific examples of isolated microbes include partially pure
microbes, substantially pure microbes and microbes cultured in a
medium that is non-naturally occurring.
[0093] As used herein, a microbe is considered to be "native" to a
plant or a portion of the plant, and is said to be "natively"
present in the plant or a portion of plant, if that plant or
portion of the plant contains the microbe, for example, in the
absence of any contacting with the microbe preparation, or contains
the microbe at much lower concentrations than the contacting with
the microbe preparation would provide.
[0094] Some of the methods described herein allow the colonization
of plant seeds by microbes. As used herein, a microbe is said to
"colonize" a plant or seed when it can exist in a symbiotic or
non-detrimental relationship with the plant in the plant
environment, for example on, in close proximity to or inside a
plant, including the seed.
[0095] A "population" of plants, as used herein, refers to a
plurality of plants that were either grown from the seeds treated
with the endophytes as described herein, or are progeny of a plant
or group of plants that were subjected to the inoculation methods.
The plants within a population are typically of the same species,
and/or typically share a common genetic derivation.
EXAMPLES
Example 1
Creating Spore Suspensions and Treatment of Seeds
[0096] Cultivation of plants and endophytic fungi strains: The
cotton seed variety used in particular embodiments was variety
LA122 (available from All-Tex Seed, Inc., Levelland, Tex. 79336).
Paecilomyces lilacinus and Chaetomium globosum were obtained from
cotton plants as described (Ek-Ramos et al. 2013, PLoS ONE 8(6):
e66049. doi:10.1371/journal.pone.0066049). Persons of ordinary
skill in the art can obtain endophytes suitable for performing the
various embodiments of the present invention by performing the
procedures described therein. In short, plant samples were rinsed
in tap water and surface sterilized by immersion in 70% ethanol for
5 min, 10% bleach solution for 3 min, and rinsed twice with
autoclaved distilled water. Samples were blotted dry using
autoclaved paper towels. Five individual surface sterilized leaves,
squares and bolls (N=15 total samples) were randomly selected and
imprinted onto fresh potato dextrose agar (PDA) and V8 media as a
way to monitor surface sterilization efficiency. For endophyte
isolation, leaves were cut in small fragments of approximately 1
cm.sup.2. Squares and bolls were cut in six pieces. Any fiber
present was removed and cut into six smaller pieces. Leaf fragments
were placed upside down on PDA and V8 medium plates in triplicate.
Each plate contained 3 leaf fragments for a total of 9 fragments
assayed per plant. For squares collected early in the season, 3
slices per square were plated on PDA and V8 media as with the leaf
fragments. Because of similarity in size and location within a
plant, when collected later in the season, squares and bolls from a
given plant were plated together on petri dishes containing two
square slices, two boll slices and two pieces of fiber. Antibiotics
Penicillin G (100 Units/mL) and Streptomycin (100 .mu.g/mL) (Sigma,
St Louis, Mo., USA) were added to the media to suppress bacterial
growth. All plates were incubated in the dark at room temperature
for, in average, two weeks until growth of fungal endophyte hyphae
from plant tissues was detected.
[0097] An inclusive combination of morphological and molecular
fungal endophyte identification was employed for identification.
Once fungal hyphae were detected growing from the plant material,
samples were taken to obtain pure fungal isolates. For
identification by PCR, genomic DNA was extracted from mycelium of
each isolated fungal strain, following a chloroform:isoamyl alcohol
24:1 protocol and fungal specific primers were used to amplify the
ITS (Internal Transcribed Spacer) region of nuclear ribosomal DNA.
This region is the primary barcoding marker for fungi and includes
the ITS1 and ITS2 regions, separated by the 5.8S ribosomal gene. In
order to avoid introducing biases during PCR (taxonomy bias and
introduction of mismatches), it has been suggested to amplify the
ITS1 region only, therefore the primers ITS1 (5' TCC GTA GGT GAA
CCT GCG G 3') (SEQ ID NO:5) and ITS2 (5' GCT GCG TTC TTC ATC GAT GC
3') (SEQ ID NO:6) were used to amplify and sequence the .about.240
by ITS1 region of each one of the isolated fungal strains. The
resulting sequences were aligned as query sequences with the
publicly available databases GenBank nucleotide, UNITE and PlutoF.
The last two are specifically compiled and used for fungi
identification. Table 1 provides a list of endophytes identified
and useful in the present invention. All of these endophytes belong
to phylum Ascomycota, subphylum Pezizomycotina, except for
Phanerochaete crassa, which belongs to phylum Basidiomycota,
subphylum Agaricomycotina, and Pseudozyma sp, which belongs to
phylum Basidiomycota, subphylum Ustilaginomycotina. Table 1 shows
the species/genus, family, order, subclass, class, and the SEQ ID
NO corresponding to the .about.240 bp ITS1 region for each one of
the isolated fungal strains, except for Beauveria bassiana,
Aspergillus parasiticus, Lecanicillium lecanii, and Paecilomyces
lilacinus, where the sequences shown includes the ITS1, ITS2, 5.8S,
18S, and 28S sequences and were obtained from the UNITE database
for GenBank numbers JF837090, JX857815, FJ643076, and EU553283,
respectively.
TABLE-US-00001 TABLE 1 endophytes identified and useful in the
present invention Genus/Species Family Order Subclass Class SEQ ID
NO. Acremonium Incertaesedis Hypocreales Hypocreomycetidae
Sordariomycetes 7 alternatum Alternaria Pleosporaceae Pleosporales
Pleosporomycetidae Dothideomycetes 8 alternata Alternaria
Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 9
brassicae Alternaria Pleosporaceae Pleosporales Pleosporomycetidae
Dothideomycetes 10 compacta Alternaria dianthi Pleosporaceae
Pleosporales Pleosporomycetidae Dothideomycetes 11 Alternaria
Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 12
longipes Alternaria mali Pleosporaceae Pleosporales
Pleosporomycetidae Dothideomycetes 13 Alternaria sesami
Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 14
Alternaria solani Pleosporaceae Pleosporales Pleosporomycetidae
Dothideomycetes 15 Alternaria sp. Pleosporaceae Pleosporales
Pleosporomycetidae Dothideomycetes 16 Alternaria Pleosporaceae
Pleosporales Pleosporomycetidae Dothideomycetes 17 tenuissima
Bipolaris Pleosporaceae Pleosporales Pleosporomycetidae
Dothideomycetes 18 spicifera Cercospora Mycosphaerellaceae
Capnodiales Dothideomycetidae Dothideomycetes 19 canescens
Cercospora Mycosphaerellaceae Capnodiales Dothideomycetidae
Dothideomycetes 20 capsici Cercospora Mycosphaerellaceae
Capnodiales Dothideomycetidae Dothideomycetes 21 kikuchii
Cercospora Mycosphaerellaceae Capnodiales Dothideomycetidae
Dothideomycetes 22 zinnia Chaetomium Chaetomiaceae Sordariales
Sordariomycetidae Sordariomycetes 23 globosum Chaetomium
Chaetomiaceae Sordariales Sordariomycetidae Sordariomycetes 24
piluliferum Chaetomium sp. Chaetomiaceae Sordariales
Sordariomycetidae Sordariomycetes 25 Cladosporium Cladosporiaceae
Capnodiales Dothideomycetidae Dothideomycetes 26 cladosporioides
Cladosporium sp. Cladosporiaceae Capnodiales Dothideomycetidae
Dothideomycetes 27 Cladosporium Cladosporiaceae Capnodiales
Dothideomycetidae Dothideomycetes 28 uredinicola Cochliobolus sp
Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 29
Phanerochaete Phanerochaetaceae Polyporales Incertae sedis
Agaricomycetes 30 crassa Phoma Incertae sedis Pleosporales
Pleosporomycetidae Dothideomycetes 31 americana Phoma Incertae
sedis Pleosporales Pleosporomycetidae Dothideomycetes 32
subherbarum Phomopsis Diaporthaceae Diaporthales Sordariomycetidae
Sordariomycetes 33 liquidambari Phomopsis sp. Diaporthaceae
Diaporthales Sordariomycetidae Sordariomycetes 34 Pleospora sp.
Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 35
Pleosporaceae sp. Pleosporaceae Pleosporales Pleosporomycetidae
Dothideomycetes 36 Preussia africana Sporormiaceae Pleosporales
Pleosporomycetidae Dothideomycetes 37 Preussia sp. Sporormiaceae
Pleosporales Pleosporomycetidae Dothideomycetes 38 Pseudozyma sp.
Ustilaginaceae Ustilaginales Ustilaginomycetidae Ustilaginomycetes
39 Pyrenophora Pleosporaceae Pleosporales Pleosporomycetidae
Dothideomycetes 40 teres Colletotrichum Glomerellaceae Incertae
sedis Sordariomycetidae Sordariomycetes 41 capsici Coniolariella
Incertae sedis Xylariales Xylariomycetidae Sordariomycetes 42
gamsii Coniothyrium Coniothyriaceae Pleosporales Pleosporomycetidae
Dothideomycetes 43 aleuritis Coniothyrium sp. Coniothyriaceae
Pleosporales Pleosporomycetidae Dothideomycetes 44 Corynespora
Corynesporascaceae Pleosporales Pleosporomycetidae Dothideomycetes
45 cassiicola Diaporthe sp. Diaporthaceae Diaporthales
Sordariomycetidae Sordariomycetes 46 Diatrype sp. Diatrypaceae
Xylariales Xylariomycetidae Sordariomycetes 47 Drechslerella
Orbiliaceae Orbiliales Orbiliomycetidae Orbiliomycetes 48
dactyloides Embellisia Pleosporaceae Pleosporales
Pleosporomycetidae Dothideomycetes 49 indefessa Epicoccum
Pleosporaceae Pleosporales Pleosporomycetidae Dothideomycetes 50
nigrum Epicoccum sp. Pleosporaceae Pleosporales Pleosporomycetidae
Dothideomycetes 51 Exserohilum Pleosporaceae Pleosporales
Pleosporomycetidae Dothideomycetes 52 rostratum Fusarium
Nectriaceae Hypocreales Hypocreomycetidae Sordariomycetes 53
chlamydosporum Fusarium sp. Nectriaceae Hypocreales
Hypocreomycetidae Sordariomycetes 54 Gibellulopsis
Plectosphaerellaceae Incertae sedis Hypocreomycetidae
Sordariomycetes 55 nigrescens Gnomoniopsis sp. Glomerellaceae
Incertae sedis Hypocreomycetidae Sordariomycetes 56 Lewia
infectoria Pleosporaceae Pleosporales Pleosporomycetidae
Dothideomycetes 57 Mycosphaerella Mycosphaerellaceae Capnodiales
Dothideomycetidae Dothideomycetes 58 coffeicola Mycosphaerellaceae
Mycosphaerellaceae Capnodiales Dothideomycetidae Dothideomycetes 59
sp. Nigrospora Incertae sedis Trichosphaeriales Incertae sedis
Sordariomycetes 60 oryzae Nigrospora sp. Incertae sedis
Trichosphaeriales Incertae sedis Sordariomycetes 61 Nigrospora
Incertae sedis Trichosphaeriales Incertae sedis Sordariomycetes 62
sphaerica Paecilomyces sp. Trichocomaceae Eurotiales
Eurotiomycetidae Eurotiomycetes 63 Penicillium Trichocomaceae
Eurotiales Eurotiomycetidae Eurotiomycetes 64 citrinum Retroconis
sp. Incertae sedis Incertae sedis Incertae sedis Incertae sedis 65
Rhizopycnis sp. Incertae sedis Incertae sedis Incertae sedis
Dothideomycetes 66 Schizothecium Lasiosphaeriaceae Sordariales
Sordariomycetidae Sordariomycetes 67 inaequale Stagonospora sp.
Phaeosphaeriaceae Pleosporales Pleosporomycetidae Dothideomycetes
68 Stemphylium Pleosporaceae Pleosporales Pleosporomycetidae
Dothideomycetes 69 lancipes Thielavia Chaetomiaceae Sordariales
Sordariomycetidae Sordariomycetes 70 hyrcaniae Thielavia sp.
Chaetomiaceae Sordariales Sordariomycetidae Sordariomycetes 71
Ulocladium Pleosporaceae Pleosporales Pleosporomycetidae
Dothideomycetes 72 chartarum Verticillium sp. Plectosphaerellaceae
Incertae sedis Hypocreomycetidae Sordariomycetes 73 Beauveria
Cordycipitaceae Hypocreales Hypocreomycetidae Sordariomycetes 74
bassiana Aspergillus Trichocomaceae Eurotiales Eurotiomycetidae
Eurotiomycetes 75 parasiticus Lecanicillium Cordycipitaceae
Hypocreales Hypocreomycetidae Sordariomycetes 76 lecanii
Paecilomyces Trichocomaceae Eurotiales Eurotiomycetidae
Eurotiomycetes 77 lilacinus
[0098] TABLE 1 List of endophytes:
[0099] Acremonium alternatum, Alternaria alternata, Alternaria
brassicae, Alternaria compacta, Alternaria dianthi, Alternaria
longipes, Alternaria mali, Alternaria sesami, Alternaria solani,
Alternaria sp., Alternaria tenuissima, Ascomycota sp., Bipolaris
spicifera, Cercospora canescens, Cercospora capsici, Cercospora
kikuchii, Cercospora zinnia, Chaetomium globosum, Chaetomium
piluliferum, Chaetomium sp., Cladosporium cladosporioides,
Cladosporium sp., Cladosporium uredinicola, Cochliobolus sp,
Phanerochaete crassa, Phoma americana, Phoma subherbarum, Phomopsis
liquidambari, Phomopsis sp., Pleospora sp., Pleosporaceae sp.,
Polyporales sp., Preussia africana, Preussia sp., Pseudozyma sp.,
Pyrenophora teres, Colletotrichumcapsici, Coniolariella gamsii,
Coniothyrium aleuritis, Coniothyrium sp., Corynespora cassiicola,
Diaporthe sp., Diatrype sp., Drechslerella dactyloides, Embellisia
indefessa, Epicoccum nigrum, Epicoccum sp., Exserohilum rostratum,
Fusarium chlamydosporum, Fusarium sp., Gibellulopsis nigrescens,
Gnomoniopsis sp., Lewia infectoria, Mycosphaerella coffeicola,
Mycosphaerellaceae sp., Nigrospora oryzae, Nigrospora sp.,
Nigrospora sphaerica, Paecilomyces sp., Penicillium citrinum,
Retroconis sp., Rhizopycnis sp., Schizothecium inaequale,
Stagonospora sp., Stemphylium lancipes, Thielavia hyrcaniae,
Thielavia sp., Ulocladium chartarum, Verticillium sp., Beauveria
bassiana, Aspergillus parasiticus, Lecanicillium lecanii,
Paecilomyces lilacinus.
[0100] Beauveria bassiana was cultured from a commercially obtained
strain (available from Botanigard). Beauveria bassiana,
Paecilomyces lilacinus, and Chaetomium globosum were cultured on
potato dextrose agar media (PDA). Stock spore concentration
solutions of each fungi were made by adding 10 ml of sterile water
to the fungi plates and scraping them free of the agar with a
sterile scalpel. The resulting mycelia and spores obtained were
then filtered into a sterile beaker utilizing a cheese cloth to
filter out the mycelia, thereby creating stock solutions. A
haemocytometer was used to measure and calculate spore
concentrations of the stock solutions. The desired concentrations
were created by dilution, and seeds were placed into spore
suspensions with the desired spore concentrations. In various
embodiments, the final treatment concentrations can be about
10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7,
10.sup.8, or 10.sup.9 spores/ml which can be reached by serial
dilutions in sterile water or in an appropriate solution or
buffer.
[0101] For seed inoculation, the seeds were surface sterilized
prior to soaking them in spore suspensions with the desired
concentration by immersion the seeds in 70% ethanol for 3 minutes
with constant shaking followed by incubation in 2% NaOCl for 3
minutes; followed by three washes in sterile water. The third
sterile water wash was plated onto potato dextrose agar media (PDA)
to confirm that surface sterilization was effective. Seeds were
then soaked for 24 hours in beakers containing spore suspensions
with two different concentrations of fungi. Control group seeds
were treated with sterile water only. Spore concentrations for
Beauveria bassiana were zero (control), 1.times.10.sup.6 (treatment
1) and 1.times.10.sup.9 (treatment 2) and for Paecilomyces
lilacinus or Chaetomium globosum were zero (control),
1.times.10.sup.6 (treatment 1) and 1.times.10.sup.7 (treatment 2).
These beakers were incubated for 24 hours at 32.degree. C. in a
culture chamber until next day for planting (24 hr).
[0102] Soaked seeds were planted in L22 mix soil (Borlaug
Institute, Texas A&M). All plants were grown in a laboratory
greenhouse at .about.28.degree. C. with a natural light
photoperiod. There was no fertilization of the plants, and watering
was done consistently across all treatments as needed.
[0103] Direct seed inoculation: In particular embodiments,
individual seeds and the surrounding soil can be directly
inoculated with the spore solution (10.sup.2-10.sup.3,
10.sup.3-10.sup.4, 10.sup.4-10.sup.5, 10.sup.6-10.sup.7, or
10.sup.7-10.sup.8 spores/ml) at planting before covering the seed
with soil.
[0104] In various embodiments, any seed or plant treatments that
are suitable for application of biological agents to seeds or
plants and known to persons having ordinary skill in the art can be
employed.
Example 2
Application of Endophyte Spores as a Dry Powder Composition
[0105] In addition to application of a spore solution for seed
treatment, the endophytes or endophyte spores can also be applied
as dry powder or using a sicker such as methyl cellulose for seed
treatment. In certain embodiments, the concentration may be at
least 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, or higher
colony forming units or spores/g dry weight.
[0106] In certain embodiments, endophytes can be grown in fungi
cultivation media in a fermenter. Endophytic mycelial fragments or
spores can be collected, dried and ground. A sticker such as
carboxymethyl cellulose may also be added to the ground endophytic
material.
[0107] In certain embodiments the weight ratio between endophytic
material and sticker may be between 1:10-50, 1:50-100, 1:100-500,
or 1:500-1000 to obtain the seed coating or seed inoculation
material. This seed inoculation material can be applied to seeds.
In various embodiments, the weight ratio between seed inoculation
material and seed may be 1:10-50, 1:50-100, 1:100-500, 1:500-1000,
or 1:1000-5000.
Example 3
Soil (in Furrow) Endophyte Treatments
[0108] Soil drench (in furrow) application may be performed by
applying an endophyte composition to the surface of the soil and/or
seed during planting. In particular embodiments, the endophyte
composition may comprise an endophyte suspension or an endophyte
dry powder formulation. In various embodiments the endophyte may
comprise mycelia and/or spores. In particular embodiments, the soil
drench application may comprise applying the endophyte composition
to the surface of the soil directly above each seed. In certain
embodiments, the endophyte composition may comprise 0.01-0.1,
0.1-1, or 1-10 ml endophyte suspension, which may be a endophyte
spore suspension.
[0109] Soil inoculation: In certain embodiments, seeds can be
planted into inoculated soil. The inoculum can be obtained by
multiplying the endophyte on fungal growth media. The fungal growth
media can be potato dextrose agar media (PDA). In other embodiments
the fungal growth media can be as wheat grain. In a non-limiting
example, 100 g of wheat grain can be washed and soaked overnight in
sterile water. Excess water can be drained, seeds dried on paper
towel, packed in a 500 ml conical flask and autoclaved at 15 psi
for 1 h. One milliliter of the endophytic fungal spore suspension
(10.sup.7 spores/ml) can be inoculated to the flask, and the
cultures can be incubated at 25.degree. C. for 2 weeks. To avoid
clumping, the flasks can be shaken vigorously to separate the grain
and break the mycelial mat. Approximately 5 g of inoculum can be
placed in soil at planting. In certain embodiments, the inoculum
can be placed in the soil at the same time or within 1 month of
planting the seeds. In certain embodiments, the seeds may comprise
sterilized seeds.
Example 4
Foliar Endophyte Treatments
[0110] Plants were inoculated via foliar application at the third
true leaf stage by spraying the surface of fully expanded leaves to
run-off with a spore suspension (10.sup.8 spores/ml) using a
hand-held plastic sprayer (1 L). In certain embodiments, endophyte
spore suspensions were made in water. In certain embodiments, the
water was supplemented with a detergent. In a particular
non-limiting example, the spore suspension contained 0.02% Triton X
100 as a detergent.
[0111] Foliar endophyte treatment may be performed using any
suitable method known to a person having ordinary skill in the art.
In particular, foliar endophyte treatment may be performed using a
sprayer by directly spraying leaves with an endophyte suspension,
which may be a endophyte spore suspension.
[0112] FIG. 9 demonstrates that foliar application of cotton in the
field with spores of endophytic entomopathogenic fungi improved
plant performance. Cotton (variety FM1740B2F) seeds were treated
with a variety of typical fungicide (Metalaxyl, Triadimenol,
Trifloxystrobin, 2-(Thiocyanome-thylthio) benzothioazole) and
insecticide (Thiodicarb, Imidacloprid, Chloropyrifos), and seed
treatments were planted and grown under field conditions. The
plants were sprayed at the 5th true leaf stage with aqueous
solutions of Beauveria bassiana and Paecilomyces fumosoroseus.
Sucrose was included (1% wt/vol) as an additional nutritional
resource for the fungi. Significantly higher first position boll
(developing fruit) retention was observed in plants sprayed with
Beauveria bassiana without sucrose and P. fumosoroseus plus
sucrose.
Example 5
Confirmation of Plant Colonization by Endophytic Fungi
[0113] Plants were individually placed in plastic bags, which were
labeled with plant number, treatment, and final aphid number, and
stored in 4.degree. C. until the next day for endophyte
confirmation. Half of each plant was utilized for plating on PDA
agar and the other half was freeze-dried for to conduct diagnostic
PCR assays for endophyte confirmation. The surface sterilization
protocol and plating of third sterile water wash on PDA to test for
surface contamination was conducted as described above. For
diagnostic PCR assays, plant tissue was freeze-dried and DNA was
extracted utilizing the CTAB protocol (Doyle & Doyle, 1987,
Phytochemistry Bulletin 19:11-15). The oligonucleotide primer
sequences synthesized were based upon a NCBI BLAST search
corresponding to the laboratory culture sequence results isolated
(Ek-Ramos et al., 2013). Sense and antisense oligonucleotide
sequences for Beauveria bassiana were: 5'-CGGCGGACTCGCCCCAGCCCG-3'
(SEQ ID NO:1) and 5'-CCGCGTCGGGGTTCCGGTGCG-3' (SEQ ID NO:2)
respectively. The oligonucleotides used to amplify Paecelomyces
lilacinus were: 5' CTCAGTTGCCTCGGCGGGAA 3' (SEQ ID NO:3) and 5'
GTGCAACTCAGAGAAGAAATTCCG 3' (SEQ ID NO:4).
[0114] The PCR protocol consisted of a denaturation step at
95.degree. C. for 5 min, followed by alignment of oligonucleotides
at 56.degree. C. for 2 min and an extension step of 7 min at
72.degree. C. with a total of 35 cycles. The PCR products were
visualized in a 2% agarose gel containing 1% ethidium bromide.
Electrophoresis was performed at 70 volts for 30 min.
Example 6
Endophytic Fungi can be Manipulated in the Field
[0115] A field trial using isolates of Paecilomyces lilacinus and
Beauveria bassiana was conducted during the summer. A randomized
block design with five replicate plots that were planted with seeds
that were inoculated by soaking for 9 hr in three different aqueous
spore concentrations (0, 10.sup.6, or 10.sup.8 spores/ml) of the
candidate endophyte (such as Paecilomyces lilacinus or Beauveria
bassiana). Each plot consisted of four 15.24 m (40 ft) rows, each
separated by 101.6 cm (40 in).
[0116] Colonization efficiency: At the first true leaf stage, four
plants from each plot for a total of 20 plants per treatment were
randomly sampled and tested for colonization by each of the
candidate endophytes. Colonization frequencies were determined by
incubating surface sterilized root, stem and leaf fragments on PDA
media and observing for fungal growth. Colonization frequencies are
reported as the number of plants per treatment group with at least
one positively colonized plant fragment.
[0117] The high endophytic colonization frequency of seedlings by
Paecilomyces lilacinus or Beauveria bassiana demonstrates that the
presence of specific endophytes can be manipulated under field
planting conditions (FIG. 1).
Example 7
Cotton Aphid Reproduction Test
[0118] A colony of A. gossypii was reared on cotton in cages in a
greenhouse kept at approximately 28.degree. C. with natural light
photoperiod. Second instar nymphs were placed directly onto
endophyte-treated cotton plants and control plants. Ten plants were
utilized per treatment group and ten aphids were placed per plant.
After plants were inoculated with the aphids, the plants were
placed in individual plastic 45.times.20 cm cups and sealed with
no-see-um mesh (Eastex products, NJ) to avoid aphid movement from
plant to plant. In one embodiment, the plants used were 13 days
old, approximately in the first true leaf stage, and aphids were
left to reproduce for seven days under greenhouse conditions. In
another embodiment, aphids were left to reproduce for 14 days on
plants initially 20 days old at the beginning of the experiment,
approximately in the third true leaf stage. At the end of each
embodiment, aphid numbers were counted and recorded per individual
plant. The presence of Beauveria bassiana or Paecilomyces lilacinus
as an endophyte in cotton significantly reduced the reproduction of
cotton aphids on endophyte treated plants versus untreated control
plants (FIG. 4A, 4B, and FIG. 5)
Example 8
Fungal Endophytes Reduce Nematode Reproduction
[0119] Plants were germinated from treated and untreated control
seeds in an environment chamber and then transplanted to soil in
pots 11 days after planting. Two replicate seedlings per treatment
were sampled to examine the endophyte colonization efficiency by
surface sterilization and plating on PDA agar. Nematode treatment
group seedlings were treated with either 2,000 or 10,000 eggs/plant
at day six after transplanting. Plants were harvested and processed
6 weeks after nematode inoculation. The numbers of galls per gram
of root tissue and total egg numbers in the population for each
plant were quantified to compare nematode performance between
endophyte-treated and untreated (control) plants.
[0120] FIGS. 2 and 3 demonstrate that the endophytic fungi
Paecilomyces lilacinus and Chaetomium globosum negatively affected
root knot nematode (Meloidogyne incognita) reproduction when
present as an endophyte in cotton. At high nematode inoculum levels
(10,000 eggs), Paecilomyces lilacinus reduced egg production in
plants following treatment of seeds with solutions containing
either 10.sup.6 or 10.sup.7 spores/ml when compared to untreated
control seeds. At field inoculum levels (2000 eggs), the presence
of Paecilomyces lilacinus significantly reduced both galls and egg
production at both seed treatment concentrations. Endophytic
Chaetomium globosum negatively affects root-knot nematode
reproduction. Negative effects of endophytic Chaetomium globosum on
root-knot nematode gall formation and egg production were
demonstrated following cotton seed soaking treatments in solutions
of 0 (untreated controls), 10.sup.6 and 10.sup.8 spores/ml.
Example 9
Effect of Fungal Endophytes on Insects
[0121] Endophyte-treated and control plants were grown from
non-transgenic cotton seeds (Gossypium hirsutum) (variety LA122,
AllTex Seed Co.). Seeds were soaked for 24 hours in beakers
containing 10.sup.8 spores/ml solutions of the fungi utilized plus
sterile water-only as a control. The beakers were placed in a
32.degree. C. culture chamber overnight (approx. 9 h) until
planting the next day. The plants were grown under both greenhouse
and field conditions. Greenhouse plants were first germinated in
seedling trays and then transferred to 30 cm pots. Field grown
plants were concurrently planted and grown.
[0122] Behavioral assays: No-choice and choice behavioral assays
were conducted to compare the response of western tarnished plant
bugs (L. hesperus) and green stink bugs (N. viridula) to squares
and bolls from endophyte-treated and untreated plants. The assays
were conducted at 30.degree. C. in 10 cm diameter petri dishes with
a thin layer of 2% agar on the bottom to provide moisture for the
squares (L. hesperus assays) and bolls (N. viridula assays) from
experimental plants offered to the insects during the observations.
For no-choice assays, a single square or boll was inserted by the
base into the agar in the center of the dish. A single young adult
(1-7 days post molt) insect was placed in each dish and covered
with the top. A total of 30 insects were observed in each trial
with N=10 insects each in the Beauveria bassiana, Paecilomyces
lilacinus and control treatment groups. The L. hesperus no-choice
trials were replicated four times (N=40 per treatment) with squares
from greenhouse grown plants used in all but one trial. The N.
viridula no-choice trials were replicated three times (N=20 per
treatment) with bolls from greenhouse grown plants used in one
trial.
[0123] Choice tests were conducted under the similar conditions
using the same arenas, but with two equal sized squares (L.
hesperus) or bolls (N. viridula) placed 4 cm apart in the center of
the petri dish. The two squares or bolls per arena were from an
untreated control plant and either a Beauveria bassiana or
Paecilomyces lilacinus treated plant. A total of 20 insects were
observed in each trial, with N=10 each in the Beauveria bassiana
vs. control and Paecilomyces lilacinus vs. control treatment
groups. The L. hesperus and N. viridula choice trials were both
replicated twice (N=20 per treatment) with squares from field-grown
plants in all trials.
[0124] Insects were observed for 6 hours per trial using a point
sampling procedure for both the no-choice and choice assays.
Preliminary observations indicated that the insects of both species
were more active at the beginning of the assay, thus staged
sampling schedule was adopted with observations recorded at 5
minute intervals early in the assay (0-60 min), 15 minute intervals
in the middle (61-180 min) and 30 minute intervals late (181-360
min) in the assay. At each sampling interval, the insects were
recorded as either off the square/boll or feeding or roosting upon
the square/boll.
[0125] Data analysis: In the no-choice assays, the proportion of
insects observed either feeding or resting upon cotton squares (L.
hesperus) or bolls (N. viridula) was compared between treatment
groups at each observation point across the duration of the assay
using the Wilcoxon Signed Ranks Test. To test for variation in
responses over time, for each individual the proportion of
observations either feeding or upon the plant sample was calculated
for early (0-60 min), middle (61-180 min) and late (181-360 min)
periods of the assay and compared across treatment groups using a
repeated measures analysis of variance (ANOVA) with the endophyte
treatment group as the main factor and time as the repeat effect.
The observed frequency of individuals failing to make contact with
squares or bolls from endophyte-treated plants was compared to the
expected frequency of individuals failing to do so based on the
control group using a X2 test. Among the insects that did make
contact with either a square or boll, the time to first contact
(latency) was compared among treatment groups using a one-way
ANOVA. All analyses including tests of normality and homogeneity of
variances were conducted in SPSS 21 (SPSS Inc.).
[0126] Results of the L. hesperus no-choice assays: Over the
duration of the assay, a significantly higher proportion of L.
hesperus individuals over time was observed in contact with and
feeding upon squares from untreated control plants relative to
those from either of the Beauveria bassiana or Paecilomyces
lilacinus endophyte treatment groups (Wilcoxon Signed Ranks test,
P<0.0001 for both comparisons) (FIG. 6A). Repeated measures
ANOVA indicated a significant effect of time (F.sub.1,116=86.175;
P<0.001) with a higher proportion of insects contacting the
square as the assay progressed (FIG. 6B). There was also a
significant effect of endophyte treatment (F.sub.2,116=4.929;
P=0.009) with no significant time X endophyte treatment interaction
(F.sub.2,116=1.015; P=0.366). Of the 40 insects in each treatment
group, 12.5% of the control group failed to make contact with the
square over the course of the assay, while a significantly higher
35% and 32.5% the Beauveria bassiana and Paecilomyces lilacinus
treatment group insect respectively failed to make contact (X2
test, P<0.0001). Among the insects that did make contact with a
square, there was significant difference in the latency to first
contact among the treatment groups (F.sub.2.85=7.225; P<0.0001)
with the control group exhibiting a shorter latency to contact than
either the Beauveria bassiana (posthoc LSD test; P=0.001) or
Paecilomyces lilacinus endophyte treatment groups (posthoc LSD
test; P=0.006 (FIG. 6A).
[0127] Results of the L. hesperus choice assays: In simultaneous
choice tests, L. hesperus individuals selected squares from
untreated control plants more often than those from
endophyte-treated plants. Response ratios were significantly
greater than 0.5 over the duration of the assays, indicating that
the insects non-randomly selected bolls from control plants over
bolls from plants endophytically colonized by either (A) Beauveria
bassiana (P<0.0001; Wilcoxon Signed Ranks test) or (B)
Paecilomyces lilacinus (P<0.0001; Wilcoxon Signed Ranks
test)(FIG. 6B).
[0128] Results of the N. viridula no-choice assays: Over the
duration of the assay, a significantly higher proportion of N.
viridula individuals over time was observed in contact with and
feeding upon bolls from untreated control plants relative to those
from either of the Beauveria bassiana or Paecilomyces lilacinus
endophyte treatment groups (Wilcoxon Signed Ranks test, P<0.0001
for both comparisons)(FIG. 7A). Repeated measures ANOVA indicated a
significant effect of time (F.sub.1,116=86.175; P<0.001) with a
higher proportion of insects contacting the square as the assay
progressed (FIG. 1), There was also a significant effect of
endophyte treatment (F.sub.2,116=4.929; P=0.009) with no
significant time X endophyte treatment interaction
(F.sub.2,116=1.015; P=0.366). Of the 40 insects in each treatment
group, 12.5% of the control group failed to make contact with the
square over the course of the assay, while a significantly higher
35% and 32.5% the Beauveria bassiana and Paecilomyces lilacinus
treatment group insect respectively failed to make contact (X2
test, P<0.0001). Among the insects that did make contact with a
square, there was significant difference in the latency to first
contact among the treatment groups (F.sub.2.85=7.225; P<0.0001)
with the control group exhibiting a shorter latency to contact than
either the Beauveria bassiana (posthoc LSD test; P=0.001) or
Paecilomyces lilacinus endophyte treatment groups (posthoc LSD
test; P=0.006 (FIG. 7B).
Example 10
More Bolls are Retained after Endophyte Treatment
[0129] During the field trial, cotton phenology and development was
quantified using a plant mapping and information system developed
specifically for cotton to track fruit development and retention by
the plant as a means of monitoring plant development and stress
(COTMAN.TM., Cotton Inc.). One measure of cotton stress is the
retention of developing flowers (squares) and fruits (bolls) in the
first fruiting position on branches. First position squares and
bolls were measured on 5 plants per row in two rows in each of the
five replicate plots (N=10 plants per plot) for each treatment
group.
[0130] FIG. 10 demonstrates that early in the growing season as
flowers begin to develop, a trend for higher square retention in
the endophyte-treated plants relative to controls was observed.
This trend continued later in the season as evidenced by
significantly higher boll retention among the endophyte treatment
groups relative to the untreated control plants.
[0131] FIG. 8 demonstrates reduction in cotton boll damage during
field trials. Relative to control plants, levels of insect-related
boll damage were lower among plants that were treated by soaking
seeds in spore solutions of Beauveria bassiana and Paecilomyces
lilacinus at concentrations of 10.sup.6 and 10.sup.8 spore/ml.
Positive effects of fungal endophytes on cotton plant performance
under field conditions.
Example 11
Endophyte Treatment Increases Yield
[0132] At the end of the field trial employing endophyte treatment
and treatment plants, plots were machine harvested with a 1-row
picker. Surprisingly, the final yields at harvest were
significantly higher than expected (25% higher than the untreated
controls). Unexpectedly, treatment with Paecilomyces lilacinus or
Beauveria bassiana resulted in higher yields than untreated control
plants with regardless of the initial seed treatment concentration.
(FIG. 11)
Example 12
Endophyte Treatment of Sorghum Increased Growth in the
Greenhouse
[0133] The effect of the described microbial compositions on
sorghum was tested in a seedling assay. Sorghum bicolor seeds were
surface sterilized using ethanol and bleach as described in Example
1 for cotton. Three strains (B. bassiana, P. fumosoroseus, and P.
lilacinus) were prepared as conidia suspensions at 10.sup.7
conidia/ml, and coated on the sorghum seeds as described in Example
1. Control seeds were soaked in sterile water instead of a conidia
suspension. Planted seeds were held in constant growth chamber
conditions for two weeks at a replication of 10. At the end of two
weeks, the plants were removed from the growth chamber and the
plant height and biomass were measured. FIG. 12A shows the increase
in plant height when applied with the described microbial
composition relative to the control (p<0.05). FIG. 12B shows the
increase in plant biomass in plants grown from seed that were
treated with the described microbial composition relative to the
control (p<0.05).
Example 13
Treatment with Fungal Endophytes Modulates the Colonization
Frequencies of Native Endophytes
[0134] To determine whether endophyte seed treatments could alter
the microbiome of the plant grown from the seed, cotton seeds were
treated with spore suspensions of Paecilomyces lilacinus or
Beauveria bassiana. Plants were grown in the field as part of a
field trial planted and maintained under standard agricultural
practices. Endophytic fungi were isolated on PDA media separately
from surface-sterilized above-ground stem/leaf and below-ground
root tissue to assess changes in the microbial community. The
comparison shown in FIG. 13 is relative to the fungal endophyte
communities in untreated control plants. The results show that
these treatments can alter the colonization rates of native fungal
endophytes.
[0135] Fungal endophyte treatments may alter the colonization
frequencies of any of the fungal endophytes naturally present in
plants. To determine what other native endophytes may be affected
by seed treatments with fungal endophytes, the identity of cotton
fungal endophytes isolated from plants of two commercial cotton
varieties, CG3787B2RF and PHY499WRF, were assessed. The samples
were obtained during a variety trial near Lubbock, Tex., USA
identified as Lubbock-RACE. One single healthy leaf was collected
from each of nine individual plants sampled per variety across
multiple replicate plots arranged in a randomized block design to
control for spatial variation in the field. To identify the fungal
endophyte species, whole genomic DNA was extracted and the
ribosomal DNA internal transcribed spacer (ITS) region was
amplified as a barcode for 454 pyrosequencing using ITS1F forward
and ITS2 reverse universal fusion primers. The fungal endophytes
identified in this experiment, along with those shown in FIG. 13,
are listed in Table 2.
TABLE-US-00002 TABLE 2 Native fungal endophytes that may be altered
by seed treatments with other fungal endophytes Phylum Class Order
Family Genus species Ascomycota Leotiomycetes Leotiomycetes
Geomyces auratus Dothideomycetes Botryosphaeriales
Botryosphaeriaceae Macrophomina sp. Dothideomycetes Capnodiales
Davidiellaceae Dothideomycetes Capnodiales Davidiellaceae
Cladosporium sp. Dothideomycetes Capnodiales Davidiellaceae
Cladosporium cladosporioides Dothideomycetes Capnodiales
Davidiellaceae Davidiella sp. Dothideomycetes Capnodiales
Mycosphaerellaceae Cercospora sp. Dothideomycetes Capnodiales
Mycosphaerellaceae Cercospora beticola Dothideomycetes Pleosporales
Dothideomycetes Pleosporales Pleosporaceae Dothideomycetes
Pleosporales Pleosporaceae Alternaria sp. Dothideomycetes
Pleosporales Pleosporaceae Alternaria alternata Dothideomycetes
Pleosporales Pleosporaceae Alternaria citri Dothideomycetes
Pleosporales Pleosporaceae Alternaria porri Dothideomycetes
Pleosporales Pleosporaceae Alternaria tenuissima Dothideomycetes
Pleosporales Pleosporaceae Cochliobolus sp. Dothideomycetes
Pleosporales Pleosporaceae Curvularia sp. Dothideomycetes
Pleosporales Pleosporaceae Epicoccum sp. Dothideomycetes
Pleosporales Pleosporaceae Exserohilum sp. Dothideomycetes
Pleosporales Pleosporaceae Lewia sp. Dothideomycetes Pleosporales
Pleosporaceae Lewia infectoria Dothideomycetes Pleosporales
Pleosporaceae Pyrenophora sp. Dothideomycetes Pleosporales
Pleosporaceae Pyrenophora triticirepentis Dothideomycetes
Pleosporales Pleosporaceae Pleospora sp. Dothideomycetes
Pleosporales Didymellaceae Phoma americana Dothideomycetes
Pleosporales Sporormiaceae Preussia africana Eurotiomycetes
Chaetothyriales Eurotiomycetes Chaetothyriales Chaetothyriaceae
Eurotiomycetes Eurotiales Trichocomaceae Eurotiomycetes Eurotiales
Trichocomaceae Aspergillus sp. Eurotiomycetes Eurotiales
Trichocomaceae Penicillium sp. Eurotiomycetes Eurotiales
Trichocomaceae Thermomyces sp. Eurotiomycetes Eurotiales
Trichocomaceae Thermomyces lanuginosus Saccharomycetes
Saccharomycetales Saccharomycetes Saccharomycetales
Saccharomycetaceae Saccharomycetes Saccharomycetales
Saccharomycetaceae Candida sp. Saccharomycetes Saccharomycetales
Saccharomycetaceae Candida quercitrusa Saccharomycetes
Saccharomycetales Saccharomycetaceae Candida tropicalis
Saccharomycetes Saccharomycetales Saccharomycetaceae Cyberlindnera
sp. Saccharomycetes Saccharomycetales Saccharomycetaceae
Cyberlindnera jadinii Saccharomycetes Saccharomycetales
Saccharomycetaceae Kluyveromyces sp. Saccharomycetes
Saccharomycetales Saccharomycetaceae Kluyveromyces marxianus
Sordariomycetes Sordariomycetes Diaporthales Gnomoniaceae
Gnomoniopsis sp. Sordariomycetes Hypocreales Cordycipitaceae
Beauveria bassiana Sordariomycetes Hypocreales Cordycipitaceae
Cordyceps sp. Sordariomycetes Hypocreales Cordycipitaceae Cordyceps
bassiana Sordariomycetes Hypocreales Nectriaceae Sordariomycetes
Hypocreales Nectriaceae Fusarium sp. Sordariomycetes Hypocreales
Hypocreaceae Sordariomycetes Hypocreales Hypocreaceae Gibellulopsis
nigrescens Sordariomycetes Hypocreales Hypocreaceae Hypocrea sp.
Sordariomycetes Hypocreales Hypocreaceae Hypocrea lixii
Sordariomycetes Hypocreales Hypocreaceae Hypocrea virens
Sordariomycetes Hypocreales Hypocreaceae Trichoderma sp.
Sordariomycetes Hypocreales Hypocreaceae Trichoderma tomentosum
Sordariomycetes Hypocreales Plectosphaerellaceae Verticillium sp.
Sordariomycetes Ophiostomatales Ophiostomataceae Sordariomycetes
Ophiostomatales Ophiostomataceae Ophiostoma sp. Sordariomycetes
Ophiostomatales Ophiostomataceae Ophiostoma dendifundum
Sordariomycetes Sordariales Chaetomiaceae Chaetomium sp.
Sordariomycetes Sordariales Chaetomiaceae Chaetomium globosum
Sordariomycetes Sordariales Chaetomiaceae Thielavia hyrcaniae
Sordariomycetes Sordariales Chaetomiaceae Taifanglania sp.
Sordariomycetes Sordariales Chaetomiaceae Taifanglania inflata
Sordariomycetes Sordariales Lasiosphaeriaceae Schizothecium
inaequale Sordariomycetes Trichosphaeriales Trichosphaeriaceae
Nigrospora sp. Sordariomycetes Xylariales Amphisphaeriaceae
Truncatella angustata Basidiomycota Agaricomycetes Cantharellales
Ceratobasidiaceae Rhizoctonia sp. Agaricomycetes Corticiales
Corticiaceae Agaricomycetes Corticiales Corticiaceae Phanerochaete
sp Agaricomycetes Polyporales Coriolaceae Agaricomycetes
Polyporales Coriolaceae Trametes sp. Agaricomycetes Polyporales
Coriolaceae Trametes hirsuta Agaricomycetes Polyporales Coriolaceae
Trametes villosa Agaricomycetes Russulales Peniophoraceae
Microbotryomycetes Sporidiobolales Microbotryomycetes
Sporidiobolales Sporidiobolaceae Rhodotorula sp. Microbotryomycetes
Sporidiobolales Sporidiobolaceae Rhodotorula mucilaginosa
Tremellomycetes Tremellomycetes Tremellales Tremellomycetes
Tremellales Tremellaceae Cryptococcus sp Tremellomycetes
Tremellales Tremellaceae Cryptococcus skinneri Tremellomycetes
Tremellales Tremellaceae Tremella sp.
Example 14
Fungal Endophyte Seed Treatment Leads to Modulation of Phytohormone
Levels in Plants Grown from the Seed
[0136] To determine whether fungal endophyte seed treatment affects
phytohormone levels in plants grown from the seed, tissue was
harvested from the root or third true leaf of cotton plants
inoculated with either endophytic Beauveria bassiana or
Paecilomyces lilacinus. The experiment was done with three
endophyte treatments (uncolonized control, B. bassiana or P.
lilacinus) and, for Beauveria bassiana, two herbivory treatments
(no aphids, or aphid herbivory for either 1, 4, 8, 24 or 48 hours).
Phytohormone levels for abscisic acid (ABA), tuberonic acid
(12-OH-JA, an oxidation product of JA-Ile) (TA), ascorbic acid
(AA), 12-Oxophytodienoic acid (a JA precursor) (OPDA), JA
isoleucine (JA-Ile), and salicylic acid (SA) were assessed by LC-MS
in leaf and root tissues separately. All phytohormone level
comparisons were made versus plants in the uncolonized control
group with significance at P<0.05. Phytohormone levels in plants
grown from seed treated with Beauveria bassiana are shown in Table
3, and phytohormone levels in plants grown from seed treated with
Paecilomyces lilacinus are shown in Table 4.
TABLE-US-00003 TABLE 3 Phytohormone levels in plants grown from
seed treated with Beauveria bassiana Herbivory Phytohormone Tissue
Upregulated/downregulated Tissue Upregulated/downregulated Yes ABA
Leaves Down at 8 hours of feeding Roots Upregulated at 48 hrs of
feeding No Not significant Upregulated Yes TA Leaves Not
significant Roots Upreguated at 48 hrs of feeding No Not
significant Not significant Yes AA Leaves Down at 4 hrs up at 24
hrs Roots Up at 8 hrs down at 48 hrs No Not significant Upregulated
Yes OPDA Leaves Not significant Roots Up at 4 hrs and 8 hrs No Not
significant Upregulated Yes JA-Ile Leaves Up at 48 hrs Roots Up at
48 hrs No Not significant Upregulated Yes SA Leaves Up at 1 hr, 8
hr, 24 and 48 hr Roots Down at 4 hr the rest n.s No Not significant
Not significant
TABLE-US-00004 TABLE 4 Phytohormone levels in plants grown from
seed treated with Paecilomyces lilacinus Yes ABA Leaves Down at 48
hrs Roots Up at 1 hr and 8 hrs Yes TA Leaves down at 4 and 8 hrs
Roots up at 4 hrs Yes AA Leaves down at 4 and 8 hrs Roots up at 4
hrs Yes OPDA Leaves down at 4 and 8 hrs Roots Up at 4 and 48 hrs,
down at 24 hrs Yes JA-Ile Leaves Down at 8 and 48 hrs Roots Up at 4
and 24 hrs Yes SA Leaves Up at 1 and 4 hr, down at 8 hrs Roots Up
at 1, down at 8 hrs
Example 15
Fungal Endophyte Seed Treatments Alter Traits in Certain Cotton
Cultivars in Field Trials
[0137] The 2014 field trials were executed in a similar fashion as
described in Example 6. A field trial using isolates of listed
below was conducted during the summer. Each plot consisted of four
15.24 m (40 ft) rows, each separated by 101.6 cm (40 in), and there
were 6 replicate plots per treatment. Yield from plots treated with
the described microbial compositions was compared relative to the
untreated control plots. For thrips, this damage assessment was on
a scale of 0-5; 0=no damage, 1=noticeable feeding scars, but no
stunting, 2=noticeable feeding and 25% stunting, 3=feeding with
blackened leaf terminals and 50% stunting, 4=severe feeding and 75%
stunting, and 5=severe feeding and 90% stunting. For fleahoppers,
the number of insects per plant were quantified and reported as an
average for each plot. FIG. 14 shows the yield improvement of crops
when treated with the described microbial compositions, for Delta
Pine and Phytogen cultivars, respectively. FIG. 15 shows the
aggregated yield improvement of the microbes across the two
cultivars. Bars represent 95% confidence intervals. FIG. 16A shows
the beneficial effect of 12 out of 15 microbial compositions tested
on thrip damage in the Delta Pine cultivar. In the Phytogen
cultivar, only 2 out of the 15 microbial compositions tested showed
a benefit by reducing thrip damage. FIG. 16B shows the beneficial
effect of reducing fleahopper damage in the Phytogen cultivar,
where 6 out of the 15 facultative fungal endophytes tested showed
an average decrease in fleahopper damage as compared to untreated
cotton plants. In the Delta Pine cultivar, only one microbial
composition showed a beneficial effect on fleahopper damage.
[0138] A number of other mid-season plant traits were also assessed
in the field to determine the effect of the described fungal
endophyte compositions. FIG. 17A shows the beneficial increase of
the described microbial compositions on mid-season mean root
length. FIG. 17B shows the beneficial increase of the described
fungal endophyte compositions on mid-season belowground weight.
FIG. 18 shows the beneficial increase of the described fungal
endophyte compositions on mid-season canopy temperature for both
Delta Pine and Phyton cultivars. FIG. 19 shows the beneficial
increase of the described fungal endophyte compositions on
mid-season NDVI (Normalized Difference Vegetation Index) for both
Delta Pine and Phytogen cultivars. NDVI is a measure of chlorophyll
content. FIG. 20 shows the beneficial increase of the described
fungal endophyte compositions on mid-season first-position square
retention for both Delta Pine and Phytogen cultivars. FIG. 21 and
FIG. 22 show the modulation (up in July and down in August) of
mid-season plant height when treated with the described fungal
endophyte compositions for both Delta Pine and Phytogen cultivars.
FIG. 23 shows increased biomass in the plants treated with
endophytes (right half of the image) compared to untreated control
(left half of the image).
[0139] In FIGS. 15 through 22, TAM505 is Acremonium sp., TAM32 is
Epicoccum nigrum, TAM534 is Cladosporium urdinicola, TAM244 is
Cladosporium sp., TAM514 is Cladosporium urdinicola, TAM474 is
Cladosporium cladosporoides, TAM554 is Chaetomium globosum, TAM15
is Exserohilum sp., TAM488 is Epicoccum nigrum, TAM452 is
Cladosporium urdinicola, TAM490 is Paecilomyces lilacinus, TAMBB is
Beauveria bassiana, TAM105 is Cochliobolus sp., TAM189 is Bipolaris
sp., and TAM47 is Epicoccum nigrum.
Example 16
Fungal Endophyte Seed Treatments Provide Drought Tolerance in
Cotton Cultivars in Greenhouse Trials
[0140] Cotton plants were germinated from endophyte-treated and
untreated control seeds in the greenhouse. All seeds watered for 7
days or until cotyledon stage using pre-determined soil saturation
volume of water per plant. At 7 DAP, water was withheld from water
stressed plants while controls continued to be watered. Time to
wilt and time to death were measured at a max of 21 DAP. The data
in FIG. 24 shows the mean time to wilt, and the data in FIG. 25
shows the mean time to death. Endophyte treatment increased the
survival of plants subjected to drought stress in both the Delta
Pine (DTP) and the Phytogen (PHY) cultivars. In FIGS. 24 and 25,
endophyte number 194 is Epicoccum nigrum, 249 is Cladosporium
cladosporioides, 355 is Chaetomium globusum, 46 is Epicoccum sp.,
463 is Cladosporium sp., 534 is Cladosporium uredinicola, 554 is
Chaetomium globosum, 58 is Epicoccum nigrum, and control is no
endophyte treatment.
Example 17
Identification of Fungal Endophytes with at Least 97% Identity to
Those in Table 1
[0141] All known fungal endophytes with 97% identity to SEQ ID NO:7
through SEQ ID NO:77 were identified and are listed here by
accession number: FJ425672, AY526296, JQ760047, UDB014465,
KC662098, HQ649874, JQ764783, EU881906, KF251285, JQ862870,
AB019364, AB594796, JF773666, JN034678, KC343142, EU707899,
AB627855, GU138704, JN695549, DQ279491, HM776417, AB361643,
DQ782839, AF222826, EU682199, DQ782833, EU054429, FJ025275,
AY354239, AF222828, GU721921, GU721920, DQ093715, AJ309335,
FR774125, JQ747741, EF042603, KC968942, HE584924, AY740158,
FJ645268, HQ692590, GQ203786, AY233867, HE579398, AB777497,
KF435523, DQ420778, JQ649365, AJ271430, GQ996183, EF070423,
FJ172277, AF483612, JX675127, EF070420, EF070421, AB741597,
JN225408, DQ019364, KF251279, EF194151, EU977196, JX981477,
EU686115, JX021531, FJ527863, AJ302451, AJ302455, JN975370,
EU754952, AF284388, KF296855, AF502785, JX317207, AF502781,
DQ278915, EU686867, KC179120, HM991270, AF284384, DQ632670,
JQ759806, JQ747685, EU885302, GU721781, EF434047, EF505854,
JQ666587, JQ619887, GQ919270, KF531831, AB627854, DQ914679,
DQ914681, Q599592, DQ279490, DQ660336, JX069862, AB607957,
HE820869, FJ859345, JX966567, GU910230, AB627850, JX144030,
DQ914723, HM595556, KC771473, DQ849310, EU179868, KF312152,
JN890447, JX042854, EU554174, JN198518, HM992813, JQ845947,
KF251310, JQ758707, AM930536, KF296912, JN865204, JN943512,
GQ921743, EU245000, EU977304, EU144787, HE579322, HE579402,
GU910171, HE792919, KC960885, DQ485941, JN604449, HQ607913,
AF502620, DQ468027, JX944132, JN207338, JQ922240, JN207336,
JX559559, JN207330, JN207333, HE820882, JX969625, HQ339994,
JF744950, HE584937, JN120351, JX298885, DQ872671, AJ877102,
JQ081564, DQ019391, AF071342, EF104180, JQ759755, GU827492,
JN418769, GU324757, JX984750, JX256420, KF436271, JX205162,
JN712450, KF435911, GU367905, JX416919, KC315933, JQ736648,
AY904051, AF404126, J466722, HE584965, JN890282, HE584966,
HQ166312, KC305124, HE977536, KC305128, AY907040, JF710504,
AF483609, AJ302460, AJ302461, AJ302462, AY969615, EU685981, 75615,
AJ302468, FJ210503, GU237860, JX960591, JX143632, HM044649,
EU164404, HE584824, HQ116406, DQ156342, JX416911, U75617, GU721359,
KC427041, EU254839, JX262800, KC179307, HQ107993, KF361474,
GU721420, HM053659, EF619702, EU686156, HE820839, HQ634617,
GU721810, AB277211, AJ302417, KC315945, JQ002571, AM237457,
AF009805, JX489795, EU680554, KC507199, FJ236723, HQ692618,
JN846717, JX944160, JQ585672, KF435573, EU520590, HM581946,
DQ250382, JX243908, KC343184, KC485454, GQ479695, GU237760,
KF147147, EF619849, GU237767, GU237766, AB818997, AF502847,
EU683672, KF225801, KC965743, AJ488254, DQ825983, JNO31007,
DQ825985, KF028765, AB818999, HQ238268, EU685984, KC966180,
HE998711, HQ533007, AM113729, KF251637, FN394692, KF435172,
JN207307, JQ814305, HM770988, KC145175, AB511813, EU552102,
AJ309344, EU645686, JQ936328, JNO38492, DQ875349, EU977228,
JQ814357, KF040480, JX317350, DQ401548, DQ318195, DQ318194,
GU721776, KF193449, AF178544, AM262354, AB540567, AY627787,
HE792907, HE579333, EU445372, AF362069, GU973687, HM053663,
AB374284, DQ062977, GU237797, JQ760783, EF029240, HM751829,
FM200445, AY953383, AY233922, JF742784, HM626650, FN610871,
JX155902, JX006065, AB566289, AF163078, AY344976, AB566287,
AF282089, AY251441, AF395693, JQ761899, AJ315835, HQ187633,
KC287233, AJ315831, HE820745, JN418779, M13906, JQ761896, AJ315838,
AY536373, HQ328035, JX838793, JQ758986, HQ166357, JN163855,
KC965595, JN545789, JN545788, GU944558, HE579247, KF296900,
EF377335, KC965954, GU269703, AB095511, EF419913, DQ993641,
AB325678, HQ223035, AY513945, FJ197013, FR799277, HM071900,
JN207293, FJ025268, JQ758966, GU138733, GU138730, DQ267595,
GQ919269, JF770450, GU138734, DQ279488, DQ279486, DQ242472,
EU164804, EF104177, GU366726, KF212243, DQ923534, GU079598,
JX987761, JX984765, AY585343, JQ769260, GU721919, DQ923538,
EU686756, EU040222, U75626, GU004264, EU686753, JQ765651, JX270629,
JN943408, EF042604, AJ271588, HE579386, GQ479556, JQ759962,
JX317413, EU516867, DQ780361, JQ905644, HQ649792, JQ247355,
FN386296, AY004778, DQ102374, KF251383, GU237835, DQ383642,
FN868479, GU237814, KC343032, JN943394, HQ450001, KC800573,
AB217793, GQ851883, EU330630, JF309198, AY489281, GU325687,
JX399008, AB164703, EF159407, AJ302429, UDB008141, UDB008140,
FM200496, AJ302426, AJ302422, AJ302423, JQ683725, KF193481,
JQ683727, HE792931, AB220252, FJ013057, DQ286207, JQ759811,
JF414842, JX088707, JN415754, AY787715, JX559577, KC776206,
GU166440, KC460867, FJ515595, KF056850, DQ118964, KC806227,
KC631802, EU823315, AY528970, HQ116401, JX317516, KF251313,
KC800565, AF502705, AF502810, M747697, AY527407, EU680518,
AJ621773, AB374285, HQ832827, GU174316, DQ974750, JN198507,
JF749806, JQ782739, HQ023202, AY616234, KC965315, AB743781,
EU554161, KC507201, HM036624, EF464164, JX391942, AB743995,
FJ415474, AY647237, KC965503, AB540553, HQ377280, JX898571,
JN969419, DQ166962, HM123519, GU237881, AB683953, AY681487,
EU498738, EU687037, AB540550, EF394866, AY853245, EU680532,
HQ450006, AM292674, KF435452, AF502638, JN890354, JX256427,
JF773646, KC916704, FJ347031, JN572154, AF443850, AY273300,
JQ247392, JQ247393, HQ316569, GU324760, AB120858, JF440978,
HQ115719, JF440976, DQ124120, HQ022342, AF333138, AB255293,
GQ999456, DQ286209, HE820785, AF451751, JNO38479, JQ044421,
JQ044422, KC968911, KC492447, FM172902, AF437754, HM030631,
HM595545, AY510424, JX414184, HQ184179, AB588822, JQ813816,
JQ813817, FJ025255, AY745019, EU668292, HM216214, AF427105,
EU479799, JQ769257, HM484866, EU301059, EU564808, AY265329,
HQ701737, KC677889, AY907030, GU721349, AY304513, GU062277,
AY907037, HM484859, AB576865, JX090109, UDB004179, JN692542,
JQ327868, AY756490, JN890185, JX042994, FJ613832, AF009815,
HQ332534, AF009816, EU686781, DQ520639, KC247154, HE820841,
HE820847, JN717228, JX944174, GU721348, AB444657, KF435560,
JQ585546, JQ775577, UDB004443, JF744968, KF192823, JN102440,
AM504058, JX164074, GU907781, HQ889707, FJ612980, KF251355,
AF502854, AF350291, HQ649989, GU966521, FJ481149, AY916491,
AB444663, FR799197, KC691458, HE820786, JN802324, AF149926,
AY372686, AY233908, HQ631033, UDB004677, KF251596, EU479757,
GU079602, KC691456, DQ420883, DQ914680, DQ914683, KC305134,
JN207313, AB512307, JN807326, GQ395365, JN207256, FJ425678,
AB000932, JN207252, KF293814, GU138728, AY160210, UDB015006,
KC565735, FJ524302, AF404127, EU272486, JF796251, JF439458,
AY304511, KC592278, JX143583, JF440977, EU686925, JX982370,
EU687082, JX966607, GU222370, JN687988, JN006771, JX436806,
JQ936201, KF481950, AF178551, KC181937, JX144778, DQ790541,
JF796076, JX898576, JX418352, AF097902, FJ411320, AF309617,
FR863589, HM469970, AF163069, KF582795, AB566293, HE820790,
GQ267191, JX130356, JN049828, HM060596, KF436001, GQ919283,
HQ832834, JN049822, EU041786, AB594789, HE579259, HE584944,
GU004268, GU237770, GQ921765, HE579253, KC305158, AF043599,
GQ267190, AY344968, JN601031, JN969420, GU328624, AB540507,
AM691002, JN102384, EU480019, JN545815, DQ993651, JX130360,
JX398990, AY969704, KF251559, AF395695, HQ449993, U94714, KF435968,
JX966550, AB859762, JF749808, U94713, GU981750, AF177152, FJ430599,
JB647433, GU981756, GU981757, EF104164, JN802311, GQ266146,
HQ445083, JX155909, KF436256, DQ318204, GU078649, JN890115,
DQ386141, GQ999487, EU686744, FJ426983, UDB013022, FN435799,
EF600976, HM596012, JF825143, AM711381, EU816668, AJ972833,
JQ905735, AF004686, EU266103, EU266107, HQ166334, EF679384,
UDB004580, AM691001, JX399012, KC460880, JX982437, AB482221,
AM292048, KF251253, AF350308, JF502446, JQ905803, KC179320,
KF251393, GU053815, DQ323686, DQ323681, KC343119, HE820747,
KF251529, DQ676536, U17215, DQ278919, EU489950, FR668016, GU903287,
AJ302439, AJ302438, AJ302435, AJ302434, JN807325, AB741584,
KC790941, DQ394387, FJ403513, GQ461566, KF193491, KC305164,
AF502895, GU237707, EU977520, AB247177, AB482220, AY929321,
GU004278, AB247171, GU461294, GU461295, JX123570, AY684241,
EU686968, JX944143, JN871718, JQ796813, HQ829122, KF435590,
KC806231, JX414183, GU944858, AF502733, JN662314, HQ022970,
AY510418, KC623569, KC216145, KF129059, DQ279515, KF251526,
JN192379, JN192376, HM140630, DQ006928, AF011289, EU089663,
FJ825373, DQ307292, JN890424, KF155521, AB670714, GQ927271,
AB670717, B670711, AB670713, KF435279, GU053814, KF435375,
JX414188, AF033422, GU225946, EU520610, JF773645, KC595884,
KC965570, DQ812921, EU885299, DQ078757, FJ612618, KF018920,
JX077035, EU686911, JX270567, HE579352, EU885297, FJ418185,
DQ914724, HQ608112, HQ450016, GU174399, JN890327, HM999913,
GU079580, HE584936, JQ765675, GU726947, JQ765670, HM588120,
AY969986, JN120335, JQ247384, HQ891112, JQ769297, JN207242,
EU002888, EU479803, AY365468, AF163083, DQ534482, KC146356,
KF436052, AF416460, JX537970, JX156018, AY907035, GQ241278,
AF409972, JQ388941, FR668022, EU687151, DQ468026, AY251418,
AB508842, AB508840, DQ233665, GU721949, AJ302444, JF927155,
AJ302442, GU721976, AJ302440, KC790931, UDB004433, GU328539,
EU479791, HQ649905, KC797566, JQ753968, GU721449, HQ701742,
AY613410, GU062246, AY907045, HM991267, DQ979608, JQ781840,
GU721442, EU426553, DQ980024, HQ634638, AF222836, GU222372,
AY969338, EF104158, AY431101, JQ081415, FJ649318, AY152583,
JN943058, EU885294, HQ231255, FJ179477, EU304350, KC005785,
FR799224, EF070422, HQ533789, AJ289870, KF025952, HQ611347,
DQ485934, KC989106, JQ081921, HE820871, AF404125, JN603182,
KF436170, HQ832964, DQ185074, KC216108, JN102460, GU553324,
DQ318207, HQ589260, AB819001, AY699669, EU812501, AB819004,
HQ436065, KC013976, KF251204, KF435307, AF249905, EF029217,
EF029216, FJ708614, EF029198, JQ517314, GU199416, HM180398,
EU479748, GU721599, DQ185081, EF104175, JX021528, KF251430,
AY611071, AY329221, JN207241, HM235963, JN890375, JF506092,
KF193461, KF453551, HM123501, HM051074, AB255269, HQ904082,
KF193500, FN562038, GU721911, EF417805, KF193504, KF028766,
HE579312, EF433991, KF144910, KF144911, FM200450, AF163090,
AB444665, AB444664, HQ649964, AB444666, AB444661, AY528998,
DQ525492, KC870889, EF543844, GU073125, AY684240, JN163853,
EU680538, AF395694, KC179102, KC778197, JN102425, DQ520638,
EU244997, GU994552, DQ279527, KC179418, EF495164, AY999117,
JX860441, JQ793663, DQ836775, EU479964, AY772736, AJ875343,
KC013972, AJ875346, AY208785, HE614864, HF570009, KF435344,
KC148376, EF641857, JX625368, AB512308, KC305146, AY266384,
KC662096, HE579269, GU004277, GU004276, EF504668, EU687114,
GU004272, GU004271, EU516731, KC213751, JN102394, HQ654776,
JQ862729, EU687052, JX868653, FJ172294, JX130355, HE584891,
FJ427063, GQ996174, FN252438, AJ633598, JX398987, EU245009,
HM069466, FJ859344, JN942165, FJ785433, EF504592, HQ449989,
HQ449988, JN120346, JX868648, EF600969, HQ529711, JN383815,
KF003112, JN890192, GU981748, EU715654, EF535663, GU328634,
UDB004320, GQ999475, FR731421, GU322457, EF550969, GU322450,
FJ477838, KC305130, AJ247519, JQ026214, AJ972825, KC305135,
EU520614, EU338415, JQ747670, EU040241, HE584979, KF477240,
HM162095, AB746179, KC963934, AY906949, JN975339, EU520120,
HM071902, JX399005, EU828350, JX399006, EF070418, FJ025231,
EF070415, JN859327, JQ517292, JX399009, KF297004, JN618372,
AY233888, EU784271, AM292673, EU514295, GQ921804, GU595027,
HM008727, GU174426, JN673038, AF442801, EU686126, JF440982,
EU754960, GQ154505, GU055711, FJ175159, KC354573, DQ993639,
JQ621881, JN102454, AY177233, FJ013071, AY566992, GQ120971,
EF408555, JX317505, AF524905, FJ887922, AF264905, AF264906,
HM997113, EF619857, KC537805, KC537804, FJ887928, AB255303,
HQ671302, FJ210537, FN386267, HQ649813, GU083033, KF251334,
GU721297, KC181926, DQ832329, JQ781696, KF251233, KF251234,
GQ505688, AJ437294, AJ437295, EF679363, HE820831, FN868450,
GU174305, AY428866, AY956759, JQ759940, DQ489291, AJ271418,
AY157952, EU784408, FJ427055, EF419900, FN813731, FJ427059,
KF435462, JQ860113, KF209290, JF439437, KC565714, FJ228189,
AF377282, JQ814364, HM991266, EF458676, AY762046, JN048884,
HQ896484, HE579345, AB444659, EU076958, HQ402674, AF540504,
AM922204, EU479758, JN943840, JN943841, FJ427025, KC584194,
AF502754, FJ418192, KC343004, AB524806, AJ877224, DQ394377,
FJ427028, AF282090, GQ927270, EU178738, DQ059579, EF535699,
KF040479, AF163085, JX256429, AY999125, KF477238, KC513506,
GQ999534, GU237837, EU002898, HM164732, AF443193, AJ315828,
AJ315829, AY586560, JX868722, EU686847, DQ875350, DQ421277,
AM176740, JX280875, AM691003, KF302463, GQ921786, KC965801,
AM691004, EF452446, EU040235, KC662103, KC662102, AY251073,
DQ993637, AY489282, FJ151434, JQ936199, EF505495, JN163856,
JN659510, EF452449, EF504607.1, GQ516009.1, GQ508761.1,
KC8008470.1, JX187590.1, GQ508832.1, KC800841.1, KC800840.1,
EF504876.1, HQ540685.1, EF505180.1, AY842353.1, GU014821.1,
FJ761203.1, GQ510033.1, EF504642.1, GU014822.1, AY998786.1,
AB581046.1, EF452470.1, FJ907534.1, EF504721.1, Y08744.2,
FJ757587.1, GU014820.1, AF400896.1, KC800831.1, EF505804.1,
EF505121.1, JX187587.1, KC800858.1, GQ866210.1, GQ522120.1,
Y10748.1, EF504853.1, EF452471.1, KJ834329.1, AB581446.1,
JX187588.1, AF163061.1, AB632670.1, Y08746.1, EF505082.1,
JX187589.1, EF504723.1, AF400889.1, KC800835.1, and EF505282.1.
Example 18
Endophytes and Combination Thereof
[0142] The protocols as described in Examples 1-16 are used in
connection with the endophytes of Table 1 to confirm beneficial
properties on plant health, such as yield and/or past resistance,
for example. In particular, endophytes from Table 1 are employed in
a synthetic combination with a plant as described herein with crop
plants, such as cotton. Any single or combination of endophytes
listed in Table 1 can also be used in this manner, employing for
example seed coatings or foliar, soil, or rhizosphere applications.
A seed composition may comprise seeds and any combination of
endophytes listed in Table 1. Endophytes listed in Table 1 or
combinations thereof are thus employed in methods for preventing
pest infestation, increased yield, treating a pest infestation,
manufacturing pest-resistant seeds; or increasing a yield or
reducing loss of a crop according to the methods of Examples 1-15.
Sequence CWU 1
1
77121DNAArtificial sequenceSynthetic oligonucleotide 1cggcggactc
gccccagccc g 21221DNAArtificial sequenceSynthetic oligonucleotide
2ccgcgtcggg gttccggtgc g 21320DNAArtificial sequenceSynthetic
oligonucleotide 3ctcagttgcc tcggcgggaa 20424DNAArtificial
sequenceSynthetic oligonucleotide 4gtgcaactca gagaagaaat tccg
24518DNAArtificial sequenceSynthetic oligonucleotide 5tccgtaggtg
aacctgcg 18620DNAArtificial sequenceSynthetic oligonucleotide
6gctgcgttct tcatcgatgc 207225DNAAcremonium alternatum 7gggtacataa
actcccaaac cattgtgaac ttaccactgt tgcttcggcg gcctcgcccc 60gggcgcgttc
gcgcggcccg gacccaggcg tccgccggag gctccaaact cttgtctttt
120agtgtatttc tgagtggcat aagcaaataa atcaaaactt tcagcaacgg
atctcttggt 180tctggcatcg atgaagaacg cagcaggact aacgtgtgtc gacgg
2258225DNAAlternaria alternata 8gccaatgaac acctgcggag ggatcattac
acaaatatga aggcgggctg gacctctcgg 60ggttacagcc ttgctgaata atcccccttg
tcttttgcgt acttcttgtt tccttggtgg 120gttcgcccac cactaggaca
aacataaacc ttttgtaatt gcaatcagcg tcagtaacaa 180attaataatt
acaactttca acaacggatc tcttggttct ggcat 2259240DNAAlternaria
brassicae 9gactttcata gtaggaggag cgggctggaa tcaccctctc ggggggtaca
gccttgctga 60attatttcac ccttgtcttt tgcgtacttc ttgtttcctt ggtgggttcg
cccaccacta 120ggacaaacat aaaccttttg taattgcaat cagcgtcagt
aacaaattaa taattacaac 180tttcaacaac ggatctcttg gttctggcat
cgatgaagaa cgcacagtca gtgtgaaatc 24010224DNAAlternaria compacta
10tgcgtatgtc cgacatatca ggcgggctgg acctctcggg gttacagcct tgctgaatta
60ttcacccctt gtcttttgcg tacttcttgt ttccttggtg ggttcgccca ccactaggac
120aaacataaac cttttgtaat tgcaatcagc gtcagtaaca aattaataat
tacaactttc 180aacaacggat ctcttggttc tggcatcgat gaaaaacgca tcaa
22411297DNAAlternaria dianthi 11cctccggact ggctcgagga ggttggcaac
gaccacctca agccggaaag ttggtcaaac 60tcggtcattt agaggaagta aaagtcgtaa
caatttctcc gtaggtgaac ctgcggaggg 120atcattacac aggtatgaag
gcgggctgga atctctcggg gttacagcct tgctgaatta 180ttcacccgtg
tcttttgcgt acttcttgtt tcctgggtgg gttcgcccac caccaggacc
240aaccataaac cttttgtaat tgcaatcagc gtcagtaaca aaataataat tacaact
29712249DNAAlternaria longipes 12tggtaattac aaaatgaagc gggctggacc
tctcggggtt acagcctgct gaattattca 60cccttgtctt ttgcgtactt cttgtttcct
tggtgggttc gcccaccact aggacaaaca 120taaacctttt gtaattgcaa
tcagcgtcag taacaaatta ataattacaa ctttcaacaa 180cggatctctt
ggttctggca tcgatgaaga acgcagcaaa ttaatgccgg ctggaacgcc 240tctgggata
24913227DNAAlternaria mali 13atcgtggagg tcaggactat tacacatatg
aaggcgggct ggaacctctc ggggttacag 60ccttgctgaa ttattcaccc ttgtcttttg
cgtacttctt gtttccttgg tgggttcgcc 120caccactagg acaaacataa
accttttgta attgcaatca gcgtcagtaa caaattaata 180attacaactt
tccacaacgg gatctcttgg gttctggcat cgctagc 22714210DNAAlternaria
sesami 14aggcgggctg gcacctctcg gggtggccag ccttgctgaa ttattccacc
cgtgtctttt 60gcgtacttct tgtttccttg gtgggctcgc ccaccacaag gaccaaccca
taaacctttt 120tgtaatggca atcagcgtca gtaacaatgt aataattaca
actttcaaca acggatctct 180tggttctggc atcgatgaag aacgcagcaa
21015256DNAAlternaria solani 15atgtgtcatg gtatgaggcg ggctggacct
ctcggggtta cagccttgct gaattattca 60cccttgtctt ttgcgtactt cttgtttcct
tggtgggttc gcccaccact aggacaaaca 120taaacctttt gtaattgcaa
tcagcgtcag taacaaatta ataattacaa ctttcaacaa 180cggatctctt
ggttctggca tcgatgaaga acgcagcgaa atgcgataag tagtgtgaat
240tgcagaattc agtaat 25616263DNAAlternaria sp. 16aggcgggctg
gacctctcgg ggttacagcc ttgctgaatt attcaccctt gtcttttgcg 60tacttcttgt
ttccttggtg ggttcgccca ccactaggac aaacataaac cttttgtaat
120tgcaatcagc gtcagtaaca aattaataat tacaactttc aacaacggat
ctcttggttc 180tggcatcgat gaagaacgca gctaaataca tatgaaggcg
ggctggaacg tcccgcggtt 240gcagacttgc tgacttattc acc
26317204DNAAlternaria tenuissima 17tgaggcgggc tggacctctc ggggttacag
ccttgctgaa ttattcaccc ttgtcttttg 60cgtacttctt gtttccttgg tgggttcgcc
caccactagg acaaacataa accttttgta 120attgcaatca gcgtcagtaa
caaattaata attacaactt tcaacaacgg atctcttggt 180tctggcatcg
atgaagaacg cagc 20418244DNABipolaris spicifera 18acgaaggccg
ttcgcggctg gactatttat tacccttgtc ttttgcgcac ttgttgtttc 60ctgggcgggt
tcgctcgcca ccaggaccac aatataaacc ttttttatgc agttgcaatc
120agcgtcagta taacaaatgt aaatcattta caactttcaa caacggatct
cttggttctg 180gcatcgatga agaacgcagc aatacacact caataaaaaa
cgaaggccgt tcgcggacgg 240acta 24419246DNACercospora canescens
19cttcggtgcg cttccccttt gggggacttt gggagggatc attactgagt gagggccttc
60gggctcgacc tccaaccctt tgtgaacaca acttgttgct tcgggggcga ccctgccgtt
120tcgacggcga gcgcccccgg aggccttcaa acactgcatc tttgcgtcgg
agtttaagta 180aattaaacaa aactttcaac aacggatctc ttggttctgg
catcgatgaa gaacgcagcg 240aaatgc 24620280DNACercospora capsici
20gactagctac ataggcttcg ggctcgacct ccaccctttg tgaacacaac ttgttgcttc
60gggggcgacc ctgccgtttc gacggcgagc gcccccggag gccttcaaac actgcatctt
120tgcgtcggag tttaagtaaa ttaaacaaaa ctttcaacaa cggatctctt
ggttctggca 180tcgatgaaga acgcagcaga aatgcgataa gtaatgtgaa
ttgcagaatt cagtgaatca 240tcgaatcttt gaacgcacat tgcgcccctt
ggtattccga 28021220DNACercospora kikuchii 21cgtagggtga acctgcggag
ggatcattac tgagtgaggg ccttcgggct cgacctccaa 60ccctttgtga acacaacttg
ttgcttcggg ggcgaccctg ccgtttcgac ggcgagcgcc 120cccggaggcc
ttcaaacact gcatctttgc gtcggagttt aagtaaatta aacaaaactt
180tcaacaacgg atctcttggt tctggcatcg atgaagaacg
22022243DNACercospora zinnia 22tcgattgaat ggctcagtga ggccttcgga
ctggcccagg gaggtcggca acgaccaccc 60agggccggaa agttggtcaa actcggtcat
ttagaggaag taaaagtcgt aacaaggtct 120ccgtaggtga acctgcggag
ggatcattac tgagtgaggg ccttcgggct cgacctccaa 180ccctttgtga
acacaacttg ttgcttcggg ggcgaccctg ccgtttcgac ggcgatcact 240tgt
24323291DNAChaetomium globosum 23aaactcccta accattgtga acgttaccta
taccgttgct tcggcgggcg gccccggggt 60ttaccccccg ggcgcccctg ggccccaccg
cgggcgcccg ccggaggtca ccaaactctt 120gataatttat ggcctctctg
agtcttctgt actgaataag tcaaaacttt caacaacgga 180tctcttggtt
ctggcatcga tgaagaacgc agccatcatt agagagttgc aaactcccta
240aacccttgtg aacgtaacct ataccgttgc gttcggcggg cggcccccgg g
29124263DNAChaetomium piluliferum 24cattacagag ttgcaaaact
ccctaaacca ttgtgaacgt taccttcaaa ccgttgcttc 60ggcgggcggc cccgctccgc
ccggtgcccc ctggccccct agcggggcgc ccgccggagg 120aaaacccaac
tcttgattat aatggcctct ctgtctcttc tgtactgaat aagtcaaaac
180tttcaacaac ggatctcttg gttctggcat cgatgaagaa cgcagcgaaa
tgcgataagt 240aatgtgaatt gcagaattca gtg 26325210DNAChaetomium sp.
25ctccctaacc attgtgaacg ttacctaaac cgttgcttcg gcgggcggcc ccggggttta
60ccccccgggc gcccctgggc cccaccgcgg gcgcccgccg gaggtcacca aactcttgat
120aatttatggc ctctctgagt cttctgtact gaataagtca aaactttcaa
caacggatct 180cttggttctg gcatcgatga aaaacgcagc
21026255DNACladosporium cladosporioides 26tctaccaccg ggatgttcat
aaccctttgt tgtccgactc tgttgcctcc ggggcgaccc 60tgccttcggg cgggggctcc
gggtggacac ttcaaactct tgcgtaactt tgcagtctga 120gtaaatttaa
ttaataaatt aaaactttta acaacggatc tcttggttct ggcatcgatg
180aagaacgcag ccaaaccagc aaacccggtc taacccccgg gatgttcatg
accctttgtt 240gtccgactct gaggc 25527240DNACladosporium sp.
27actgcttcat tacaacaacg cccgggcttc ggcctggtta ttcaaaaccc tttgttgtcc
60gactctgttg cctccgcggc gaccctgcct tcgggcgggg gctccgggtg gacacttcaa
120actcttgcgt aactttgcag tctgagtaaa cttaattaat aaattaaaac
ttttaacaac 180ggatctcttg gttctggcat cgatgaagaa cggagcgaaa
tgcgataagt aatgaattgc 24028226DNACladosporium uredinicola
28ggtctaccac cgggatgttc ataacccttt gttgtccgac tctgttgcct ccggggcgac
60cctgccttcg ggcgggggct ccgggtggac acttcaaact cttgcgtaac tttgcagtct
120gagtaaactt aattaataaa ttaaaacttt taacaacgga tctcttggtt
ctggcatcga 180tgaagaacgc agcgaaaatc aagtgggtct gcccccgcga tgggat
22629250DNACochliobolus sp 29gctaattaac caataaccta tgaaggctgt
acgccgctgc gcccccggcc agttggctga 60ggctggatta tttattaccc cttgtctttt
gcgcacttgt tgtttcctgg gcgggttcgc 120ccgcctccag gaccacacca
taaacctttt ttatgcagtt gcaatcagcg tcagtacaac 180aaatgtaaat
catttacaac tttcaacaac ggatctcttg gttctggcat cgatgaagaa
240ccgcaacagc 25030249DNAPhanerochaete crassa 30ggttgtagct
ggcctcatac tgggcatgtg cacacctggc tcatccactc cttaacctct 60gtgcactttt
tgtaggctct ggttgaaagg cgttgcttca cttcggtgtg gtaatcgctg
120gaagacctgg tctatgtttt attacaaacg cttcagttat acaatgttta
tctgcgtata 180acgcatttat atacaacttt cagcaacgga tctcttggct
ctcgcatcga tgaagaacgc 240agctcgagt 24931267DNAPhoma americana
31cgtacgctac atggaagtaa aagtagtaac aaggtttccg taggtgaacc tgcggaagga
60tcattaccta gagttgtagg ctttgcctgc tatctcttac ccatgtcttt tgagtacctt
120cgtttcctcg gcgggtccgc ccgccgattg gacaatttaa accatttgca
gttgcaatca 180gcgtctgaaa aaacttaata gttacaactt tcaacaacgg
atctcttggt tctggcatca 240atgaaaaacg cagcaacaca aaattac
26732205DNAPhoma subherbarum 32tacgtgcagc gctttgcctg ctatctctta
cccatgtctt ttgagtacct tcgtttcctc 60ggcgggtccg cccgccgatt ggacaattta
aaccatttgc agttgcaatc agcgtctgaa 120aaaaacttaa tagttacaac
tttcaacaac ggatctcttg gttctggcat cgatgaagaa 180cgcagcttac
ctagagaatg cgtgt 20533264DNAPhomopsis liquidambari 33aggcgcaccc
agaaaccctt tgtgaactta taccttactg ttgcctcggc gcatgctggc 60cccctcgggg
tcccctggag acagggagca ggcacgccgg cggccaagtt aactcttgtt
120tttacactga aactctgaga aaaaaacaca aatgaatcaa aactttcaac
aacggatctc 180ttggttctgg catcgatgaa gaacgcacaa gtggagggcc
ccaggcgccc ccccaaaacc 240ttttttgagt tattacttac tgtt
26434222DNAPhomopsis sp. 34ccggcgcacc cagaaaccct ttgtgaactt
atacctactg ttgcctcggc gcaggccggc 60cttttgtcaa aaaaggcccc ctggagacag
ggagcagccc gccggcggcc aaccaaactc 120ttgtttctac agtgaatctc
tgaggaaaaa acataaatga atcaaaactt tcaacaacgg 180atctcttggt
tctggcatcg atgaagaacg cagcatgctg gc 22235255DNAPleospora sp.
35cgggttggga cctcacctcg gtgagggctc cagcttgtct gaattattca cccatgtctt
60ttgcgcactt cttgtttcct gggcgggttc gcccgccacc aggaccaaac cataaacctt
120tttgtaattg caatcagcgt cagtaaacaa tgtaattatt acaactttca
acaacggatc 180tcttggttct ggcatcgatg aagaacgcag cgaaatgcga
tacgtagtgt gaattgcaga 240attcagtgat tttgc 25536349DNAPleosporaceae
sp. 36ggatcattac acaatatgaa ggcgggctgg aacctctcgg ggttacagcc
ttgctgaatt 60attcaccctt gtcttttgcg tacttcttgt ttccttggtg ggttcgccca
ccactaggac 120aaacataaac cttttgtaat tgcaatcagc gtcagtaaca
aattaataat taccactttc 180aacaacggga tctcttggtt ctgggcatcg
agcagaaaaa cgcagaattg aaggcgggct 240gggaacctct tcgggggggt
ccagggcttt ggtgaattat tcaccccttg cctttgcgta 300cgttgtttgt
tttccttggg gggggtaggc acacaaaaaa agaaaacgg 34937222DNAPreussia
africana 37aagtaccatt atcgtagggc ttcggccctg tcgagataga acccttgcct
ttttgagtac 60cttttcgttt cctcggcagg ctcgcctgcc aatggggacc ccaacaaaca
ctttgcagta 120cctgtaaaca gtctgaacaa acttttaaaa attaaaactt
tcaacaacgg atctcttggt 180tctggcatcg atgaagaacg cagcgaaatg
cgataaaacg tg 22238218DNAPreussia sp. 38ttcgagatac acccttgcct
ttttgagtac cttttcgttt cctcggcagg ctcgcctgcc 60aacggggacc cttcaaaacg
ctttgtaata cctgtaactg tctgatataa caagcaaaaa 120tcaaaacttt
caacaacgga tctcttggtt ctggcatcga tgaagaacgc agcaatcgtt
180gggcttcggc ccattagaga taacaccctt gccttttt 21839254DNAPseudozyma
sp. 39acatctcgcg gttcagcctt gttgagtatt cacccttgtt ttttgcggag
aaatgtttgg 60gtggagggag caccagcacc aagacaaatc taaacctttt gcaattgcaa
tacgggcgac 120atttacctta ataattgttg atttcataag attatatctt
ggttgaaact ccactggtaa 180tgccatcgtc taaaatctaa aaacaacttt
tggcaacgga tctcttggtt ctcgcatcga 240tgaagaacgc agcc
25440277DNAPyrenophora teres 40aggcagattg ggtagtcccc gcttttgggg
tttgcccatt ctggcgccat attcacccat 60gtcttttgcg tactacttgt ttccttggcg
ggttcgcccg ccaattggac tttattcaac 120cctttttttt ttattgcaat
cagcgtcagc aaaacaatgt aatcaattta caactttcaa 180caacggatct
cttggttctg gcatcgatga aaaacgcagc cacaatatga tggccgatgg
240ggcaggcctc ttttggggtt gccccctctg gcgccct
27741289DNAColletotrichum capsici 41gctcatcacc ctttgtgaca
taccttaact gttgcttcgg cgggtaggcg tcccctgaaa 60aggacgtctc ccggccctct
cccgtccgcg ggtggggcgc ccgccggagg ataaccaaac 120tctgatttaa
cgacgtttct tctgagtgac acaagcaaat aatcaaaact tttaacaacg
180gatctcttgg ttctggcatc gatgaagaac gcagcaatta ttggggtgtt
gctcatcatc 240ctttgtggtg aaccttaact gttgctgcgg cggggggcgg cgtcccctg
28942216DNAConiolariella gamsii 42tgacactccc aaaacccctg tgaacatacc
gtacgttgcc tcggcggggg ggcgctcccc 60ccccgccggc ggcccacgaa actctgtttt
gccctgaatc tctgaaacga caaactaaat 120cagttaaaac tttcaacaac
ggatctcttg gttctggcat cgatgaagaa cgcagcgaaa 180tatagaagtg
acccaactcc taaccactgt gaacaa 21643268DNAConiothyrium aleuritis
43tagacttcac taaagcttgt agacttcggt ctgctacctc ttacccatgt cttttgagta
60ccttcgtttc ctcggcgggt ccgcccgccg attggacaac attcaaaccc tttgcagttg
120caatcagcgt ctgaaaaaac ataatagtta caactttcaa caacggatct
cttggttctg 180gcatcgatga agaacgcagc gaaatgcgat aagtagtgtg
aattgcagaa ttcagtgaat 240catcgaatct ttgaacgcac attgcgcc
26844210DNAConiothyrium sp. 44gggctggatc tctcggggtt acagccttgc
tgaattattc acccttgtct tttgcgtact 60tcttgtttcc ttggtgggtt cgcccaccac
taggacaaac ataaaccttt tgtaattgca 120atcagcgtca gtaacaaatt
aataattaca actttcaaca acggatctct tggttctggc 180atcgatgaag
aacgcagcaa cactaatatg 21045218DNACorynespora cassiicola
45cgccccttcg agatagcacc ctttgtttat gagcacctct cgtttcctcg gcaggctcgc
60ctgccaacgg ggacccacca caaacccatt gtagtacaag aagtacacgt ctgaacaaaa
120caaaacaaac tatttacaac tttcaacaac ggatctcttg gttctggcat
cgatgaagaa 180cgcagcggat atcgtagggg ccgcgccccc ttccagat
21846204DNADiaporthe sp. 46accctttgtg aacttatacc taccgttgcc
tcggcgcagg ccggcccccc tcaccggggg 60ccccccggag acggggagca gcccgccggc
ggccaaccaa actcttgttt cttagtgaat 120ctctgagtaa aaatcataaa
tgaatcaaaa ctttcaacaa cggatctctt ggttctggca 180tcgatgaaga
acgcagcaag ttgc 20447281DNADiatrype sp. 47ccatgtgaac ttacctttgt
tgcctcggcg ggagagccta cccggtacct accctgtagt 60tacccgggag cgagctaccc
tgtagcccgc tgctggccga cccgccggtg gacagtaaaa 120ctcttgtttt
ttagtgatta tctgagtgtt tatacttaat aagttaaaac tttcaacaac
180ggatctcttg gttctggcat cgatgaagaa cgcagccaat acagagttat
cttctcccag 240cccatgtgaa cttacctttg ttgccccggc gggagagcct a
28148338DNADrechslerella dactyloides 48ggttagaaac tgttgtttcg
gcgggatctc tgccccgggg gcgtcgcagc cccggaccaa 60gggggccgcc ggaggaccaa
ccaaaactct ttttgtatac cccctcgcgg gtttttttta 120taatctgagc
cttctcggcg cctctcgtag gcgtttcgaa aatgaatcaa aacttttaaa
180aacggatctc ttggttctgg catcggatga agaacgcaga gaaatgcgat
aagtaatgtg 240aattgcagaa ttcactgaat catctaatct ttgaacggac
attgcgcccg ccagttttct 300ggcgggcatg cctgtccgag cgtcatttca accctcga
33849247DNAEmbellisia indefessa 49gcatcgatac ctgatccgag gtcaaaagtt
gaaaaaaggc tttgtggatg ctgaccttgg 60ctggaagaga gcgcgacttg tgctgcgctc
cgaaaccagt aggccggctg caatgacttt 120aaggcgagtc tccagcgaac
tggagacaag acgcccaaca ccaagcaaag cttgagggta 180caaatgacgc
tcgaacaggc atgccctttg gaataccaaa gggcgcaatg tgcgttcaaa 240aaaagca
24750207DNAEpicoccum nigrum 50ttgtagactt cggtctgcta cctcttaccc
atgtcttttg agtaccttcg tttcctcggc 60gggtccgccc gccgattgga caacattcaa
accctttgca gttgcaatca gcgtctgaaa 120aaacataata gttacaactt
tcaacaacgg atctcttggt tctggcatcg atgaaaaacg 180catcacctag
agtttgtaga cttcggt 20751234DNAEpicoccum sp. 51gtacttacct acgatttgtg
gagttcggtc tgctacctct tacccatgtc tttttaagta 60ccttcgtttc ctcggcgggt
ccgcccgccg gttggacaac attcaaaccc tttgcagttg 120caatcagcgt
ctgaaaaaac ttaatagtta caactttcaa caacggatct cttggttctg
180gcatcgaaca caaacgcagc agcttttagg gacctaccgt ctcctcctct tacc
23452237DNAExserohilum rostratum 52gctaatttcc ccaccaaact tgtagggtgt
ggtttgctgg caacagcgaa ccgccccaag 60tatttttcac ccatgtcttt tgcgcacttt
ttgtttcctg ggccagttcg ctcgccacca 120ggacccaacc ataaaccttt
ttttatgcag ttgcaatcag cgtcagtata ataattcaat 180ttattaaaac
tttcaacaac ggatctcttg gttctggcat cgatgaagaa cgcacaa
23753223DNAFusarium chlamydosporum 53tcccaacccc tgtgacatac
ctatacgttg cctcggcgga tcagcccgcg ccccgtaaaa 60cgggacggcc cgcccgagga
cccctaaact ctgtttttag tggaacttct gagtaaaaca 120aacaaataaa
tcaaaacttt caacaacgga tctcttggtt ctggcatcga tgaagaacgc
180agctcgatga agaacgcagc cccctcccca cgggtgggaa cat
22354258DNAFusarium sp. 54cactcccaac ccatgtgaac ttatctcttt
gttgcctcgg cgcaagctac ccgggacctc 60gcgccccggg cggcccgccg gcggacaaac
caaactctgt tatcttagtt gattatctga 120gtgtcttatt
taataagtca aaactttcaa caacggatct cttggttctg gcatcgatga
180agaacgcagc aaatcattac agaattatcc aactcccaaa cccatgtgaa
cttttctttt 240tgttgcctcg gcgcaagc 25855236DNAGibellulopsis
nigrescens 55atactcataa ccctttgtga ccttcatacc tgttgcttcg gcggcgcgcc
tctcggggcg 60tgcccgccgg cattatcaga atctctgttc gaacccgacg atacttctga
gtgttctaag 120cgaactgtta aaactttcaa caacggatct cttggctcca
gcatcgatga agaacgcagc 180aaatgagggg tactactctc accccccttt
ggcctcttcc cacttgttgc ttcggc 23656243DNAGnomoniopsis sp.
56cgggtgctac ccagaaaccc tttgtgaatt attctcattg ttgcctcggc attgactggc
60ctcttctgga ggtccctttt ccttcgggga aaggagcagg tcggccggtg gccctataaa
120ctctttgttt ttacagtgta tcttctgagt aaacaactat aaatgaatca
aaacttttaa 180caacggatct cttggttctg gcatcgatga agaacgcagc
aatggaacaa acgccctccg 240ggg 24357251DNALewia infectoria
57gcgggctgga cacccccagc cgggcactgc ttcacggcgt gcgcggctgg gccggccctg
60ctgaattatt cacccgtgtc ttttgcgtac ttcttgtttc ctgggtgggc tcgcccgcca
120tcaggaccaa ccacaaacct tttgcaatag caatcacggt cagtaacaac
gtaattaatt 180acaactttca acaacggatc tcttggttct ggcatcgatg
aagaacgtag cgaaatgcga 240tacgtagtgt g 25158210DNAMycosphaerella
coffeicola 58aagtcgtact ggcttcgggc tcgacctcca ccctttgtga acacaacttg
ttgcttcggg 60ggcgaccctg ccgtttcgac ggcgagcgcc cccggaggcc ttcaaacact
gcatctttgc 120gtcggagttt aagtaaatta aacaaaactt tcaacaacgg
atctcttggt tctggcatcg 180atgaagaacg cagcggtctg cacacatcag
21059213DNAMycosphaerellaceae sp. 59gaccacggcc ggccgcgcca
gcgataatcc tttgtgcccc gacattgttg cctgcctttt 60gaccctgcct tggggcgggg
gctccgggtg gacacttaaa ctcttgcgta actttgcagt 120ctgagtaaac
ttaattaata aattaaaact tttaacaccg gatctcttgg ttctggcatc
180gatgacaaaa cgcaacaaac gcagcagtta acc 21360227DNANigrospora
oryzae 60ctcccaaccc atgtgaactt atctctttgt tgcctcggcg caagctaccc
gggacctcgc 60gccccgggcg gcccgccggc ggacaaacca aactctgtta tcttcgttga
ttatctgagt 120gtcttattta ataagtcaaa actttcaaca acggatctct
tggttctggc atcgatgaag 180aacgcagcaa aaaacgcagc attatcccac
tcccaaaccc gtgggaa 22761216DNANigrospora sp. 61cccatgtgaa
catatctctt tgttgcctcg gcgcaagcta cccgggacct cgcgccccgg 60gcggcccgcc
ggcggacaaa ccaaactctg ttatcttcgt tgattatctg agtgtcttat
120ttaataagtc aaaactttca acaacggatc tcttggttct ggcatcgatg
aagaacgcag 180cagaaacgct cagccaactc ccagacccgt gtgaag
21662249DNANigrospora sphaerica 62actcccaaac ccatgtgaac atatctcttt
gttgcctcgg cgcaagctac ccgggacctc 60gcgccccggg cggcccgccg gcggacaaac
caaactctgt tatcttcgtt gattatctga 120gtgtcttatt taataagtca
aaactttcaa caacggatct cttggttctg gcatcgatga 180agaacgcagc
aaaaaaaaaa atattccact ccccaagccg ggggggaaaa tttttttttt 240tttttttgg
24963223DNAPaecilomyces sp. 63aatgcggact cccaaaccac tgtgaacata
cccgtaccgt tgcctcggcg ggcggcccca 60gggcggggcc gcagcctccc cagcggaggc
gcccgccgca ggtcgcaaaa ctataactat 120atttagtggc atctctgagt
aacttccaaa caatcaaaac tttcaacaac ggatctcttg 180gttctggcat
cgatgaagaa cgcagccaat acagaacttc gcg 22364205DNAPenicillium
citrinum 64aagtacgtga acggggcaaa cctcccaccc gtgttgcccg aacctatgtt
gcctcggcgg 60gccccgcgcc cgccgacggc ccccctgaac gctgtctgaa gttgcagtct
gagacctata 120acgaaattag ttaaaacttt caacaacgga tctcttggtt
ccggcatcga tgaagaacgc 180agcatctggc atcggctgca attcg
20565213DNARetroconis sp. 65gctatcccaa ccattgtgaa cctacctaca
accgttgctt cggcgggcgg ccccgggtct 60ccccgggcgc ccctccggcc cctcgcgggg
gcccgccgga ggtacgcaac cctctgtatt 120tgcatggcct ctctgagtct
ctgtactgaa taagtcaaaa ctttcaacaa cggatctctt 180ggttctggca
tcgatgaaga acgcagcagc tac 21366253DNARhizopycnis sp. 66gaaatattgg
gggtaagttt acgcttaacc aaaccgttcc gtaggtgaac ctgcggaagg 60atcattatcg
atttcggttt acaccgtttt ctacctttgt ctatgcgtac cacacgttcc
120ctcggggggc ttggccccca ctaggaccaa acataaacct ttggtaatgg
caatcggggt 180ctgaaataat ttaattatta caactttaaa caacggatct
ctgggttctg gcatcggtaa 240aaaaacacag gaa 25367210DNASchizothecium
inaequale 67tgcaactccc aaccattgtg aacctacctc accgttgcct cggcgggtgg
cccccacccg 60ggccgcgccg gccccaccgg gccggcaacc cgtcagagga ccgcaactct
tagtcatcat 120tggcctctct gagtaactta tacaataagt caaaactttc
aacaacggat ctcttggttc 180tggcatcgat gaagaacgca gcaagtctaa
21068237DNAStagonospora sp. 68ctagctactg gcatggggac tgttagtctg
catggtatca ctaccgatga gcagcaggtc 60ccctgtctat acccttgttt tttgcgtacc
tattgtttcc tcggcgggct tgctcgccgg 120ctggacaaaa tctataacct
ttttttaatc ttcaatcagc gtctgaaatt atacataata 180attacaactt
tcaacaacgg atctcttggt tctggcatcg atgaaaaacg cagccaa
23769223DNAStemphylium lancipes 69aaatgtggcg ccctttggta ttccaaaggg
catgcctgtt cgagcgtcat ttgtaccctc 60aagctttgct tggtgttggg cgtctttgtc
tctcacgaga ctcgccttaa aatgattggc 120agccgaccta ctggtttcgg
agcgcagcac aattcttgca ctttgaatca gccttggttg 180agcatccatc
aagaccacat ttttttaact ttttaccgta cta 22370209DNAThielavia hyrcaniae
70ctaaaccatt gtgaacctac cttctaccgt tgcttcggcg ggcgggcccc agcgcccccc
60ccggcccccc gcgggcgccc gccggaggat acccaaactc ttgacattag tggcctctct
120gagtattctt tactgaataa gtcaaaactt tcaacaacgg atctcttggt
tctggcatcg 180atgaagaacg cagcaattta cagagttgc 20971252DNAThielavia
sp. 71aaccattgtg acgttacctt caaaccgttg cttcggcggg cggcccgggt
ccgcccggtg 60ccccctggcc ccctcgcggg gcgcccgccg gaggaaaccc aactcttgat
acattatggc 120ctctctgagt cttctgtact gaataagtca aaactttcaa
caacggatct cttggttctg 180gcatcgatga agaacgcagc gaaatgcgat
aagtaatgtg aattgcagaa ttcagtgaat 240catcgaatct tt
25272217DNAUlocladium chartarum 72tgaagcgggc tggcatcctt cggggttaca
gccttgctga attattcacc cgtgtctttt 60gcgtacttct tgtttccttg gtgggttcgc
ccaccatagg acaaaccata aaccttttgt 120aattgcaatc agcgtcagta
aaaaaattaa taattacaac ttttaacaac ggatctcttg 180gttctggcat
cgatgaagaa cgcagccact tacaaaa 21773219DNAVerticillium sp.
73gtacacgata ctcataaccc tttgtgaacc ttcatacctg ttgcttcggc ggcgcgcctc
60tcggggcgtg cccgccggca ttatcagaat ctctgttcga acccgacgat acttctgagt
120gttctaagcg aactgttaaa actttcaaca acggatctct tggctccagc
atcgatgaag 180aacgcagcaa ggatcaatga atttctcacc acccaagta
21974477DNABeauveria bassiana 74ccgagttttc aactcccaaa cccttatgtg
aactcaccta tcgttgcttc ggcggactcg 60ccccagccgg acgggactgg accagcggcc
cgccggggac ctcaaactct tgtattccag 120catcttctga atacgccgca
aggcaaaaca tatgaatcaa aactttcaac aacggatctc 180ttggctctgg
catcgatgaa gaacgcagcg aaatgcgata agtaatgtga attgcagaat
240ccagtgaatc atcgaatctt tgaacgcaca ttgcgcccgc cagcattctg
gcgggcatgc 300cctttcgagc gtcatttcaa ccctcgaccc ccccttgggg
aggtcggcgt tggggacggc 360agcacaccgc cggccctgaa atggagtggc
ggcccgtccg cggcgacctc tgcgtagtaa 420tacagctcgc accgtaaccc
gacgcggcct caccgtaaaa cgacccaact tctgaac 47775506DNAAspergillus
parasiticus 75ccgagtgtag ggttcctagc gagcccaacc tcccacccgt
gtttactgta ccttagttgc 60ttcggcgggc ccgccattca tggccgccgg gggttctcag
ccccgggccc gcgcccgccg 120gagacaccac gaactctgcc tcatctaatg
aagtctgagt tgattgtatc gcaatcactt 180taaactttca acaatggatc
tcttggttcc gggatcaatg agcaacccaa caaaatgcga 240taactagtgt
gaattgcaga attccgtgaa tcatcgagtc tttgaacgca cattgcgccc
300cctggtattc ctgcggggat gcatgtccga gctgaattgc tgcccatcaa
gtacgacttg 360tgtgttgggt cgtcgtcccc tctccggggg ggacgggccc
caaacgcagc tgaggcaccg 420cggccgatcc tagagggtat gggcgctttg
tcacctgatc tataggccag gccggcgcta 480gcctaaccca aatcaatctt ttacag
50676451DNALecanicillium lecaniimisc_feature(337)..(337)n is a, c,
g, or t 76ccggcgtccg gacggcctcg cgccgcccgc ggcccggacc caggcggccg
ccggagacct 60ctaaactctg tattatcagc attttctgaa tccgccgcaa ggcaaaacaa
atgaatcaaa 120actttcaaca acggaacctc ttgggtttcg ggcatcgatg
aagaacgcag cgaaatgcga 180taagtaatgt gaattgcaga attcagtgaa
tcatcgaatc tttgaacgca cattgcgccc 240gccagcattc tggcgggcat
gcctgttcga gcgtcatttc aaccctcgac ttccctttgg 300ggaaatccgc
gttggggaaa cggcagcata cccgccnggc cccgaaatgg gagtggcggc
360ccggtcccgc ngcgaccctt ctgcgtaagt aatccaactc ggcaccggaa
ccccnacgtg 420gccaccccng taaaacaccc aacttccgaa c
45177549DNAPaecilomyces lilacinus 77ggagggatca ttaccgagtt
tacaactccc aaaccccctg tgaacttata ccattactgt 60tgcttcggcg ggttattgcc
ccggggaagg atagggtgcc gcgaggtgcc ctgcccgccc 120ccccggaaac
aggcgcccgc cggaggactc aaactctgta ttttttcttg ttttagtgta
180tactatctga gtaaaaaaca atataatgaa tcaaaacttt caacaacgga
tctcttggtt 240ctggcatcga tgaagaacgc agcgaaatgc gataagtaat
gtgaattgca gaattcagtg 300aatcatcgaa tctttgaacg cacattgcgc
ccgccagtat tctggcgggc atgcctgttc 360gagcgtcatt tcaaccctca
agcccctttg gacttggtgt tggggaccgg cgatggacaa 420actgtccttt
cgccgccccc taaatgactt ggcggcctcg tcgcggccct cctctgcgta
480gtagcacaca cctcgcaaca ggagcccggc gaatggccac tgccgtaaaa
ccccccaact 540tttttcaga 549
* * * * *