U.S. patent application number 14/828415 was filed with the patent office on 2016-07-14 for macrophage migration inhibitory factor (mif) promoter polymorphism in inflammatory disease.
The applicant listed for this patent is Baxalta GmbH, Baxalta Incorporated. Invention is credited to John A. Baugh, Richard J. Bucala, Smita Chitnis, Seamus C. Donnelly, Peter K. Gregersen, Joanita Monteiro.
Application Number | 20160201130 14/828415 |
Document ID | / |
Family ID | 23339212 |
Filed Date | 2016-07-14 |
United States Patent
Application |
20160201130 |
Kind Code |
A1 |
Baugh; John A. ; et
al. |
July 14, 2016 |
MACROPHAGE MIGRATION INHIBITORY FACTOR (MIF) PROMOTER POLYMORPHISM
IN INFLAMMATORY DISEASE
Abstract
Describe herein is a novel CATT-tetranucleotide repeat
polymorphism at position -817 of the human Mif gene that
functionally affects the activity of the Macrophage Inhibitory
Factor (MIF) promoter in gene reporter assays. Four genotypes are
described which comprise 5, 6, 7, or 8-CATT repeat units. Of these,
the 5-CATT allele has the lowest level of basal and stimulated MIF
promoter activity in vitro. The presence of the low expressing,
5-CATT repeat allele correlated with low disease severity in a
cohort of rheumatoid arthritis patients. Methods, compositions and
apparatus for detecting this CATT-tetranucleotide repeat
polymorphism at position -817 of the human Mif gene, and for using
same for assessing predisposition to severe inflammatory disease,
are also disclosed.
Inventors: |
Baugh; John A.; (Kilpedder,
IE) ; Bucala; Richard J.; (Cos Cob, CT) ;
Chitnis; Smita; (San Diego, CA) ; Donnelly; Seamus
C.; (Dublin, IE) ; Gregersen; Peter K.;
(Larchmont, NY) ; Monteiro; Joanita;
(Philadelphia, PA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Baxalta Incorporated
Baxalta GmbH |
Bannockburn
Glattpark (Opfikon) |
IL |
US
CH |
|
|
Family ID: |
23339212 |
Appl. No.: |
14/828415 |
Filed: |
August 17, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13707383 |
Dec 6, 2012 |
9139877 |
|
|
14828415 |
|
|
|
|
11599443 |
Nov 15, 2006 |
|
|
|
13707383 |
|
|
|
|
10323656 |
Dec 20, 2002 |
7205107 |
|
|
11599443 |
|
|
|
|
60341832 |
Dec 21, 2001 |
|
|
|
Current U.S.
Class: |
424/85.2 ;
424/158.1; 435/6.12; 514/16.6; 514/169; 536/24.1 |
Current CPC
Class: |
C12Q 2600/112 20130101;
C12Q 2600/156 20130101; C07K 16/241 20130101; C07K 2317/76
20130101; C07K 16/245 20130101; A61P 43/00 20180101; A61K 31/56
20130101; A61K 38/2066 20130101; A61P 29/00 20180101; A61K 38/1709
20130101; C12Q 1/6883 20130101; C07K 16/249 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; A61K 38/20 20060101 A61K038/20; A61K 31/56 20060101
A61K031/56; C07K 16/24 20060101 C07K016/24; A61K 38/17 20060101
A61K038/17 |
Claims
1. A method of diagnosis of severity of a non-infectious
inflammatory disease or of a predisposition to severity of a
non-infectious inflammatory disease, said method comprising
detecting a polymorphism in a human Mif promoter that correlates
with an increase or decrease in MIF polypeptide expression, wherein
detection of said polymorphism is indicative of the severity of
said disease or predisposition to severity of said disease.
2. The method of claim 1, wherein said non-infectious inflammatory
disease is selected from the group consisting of autoimmunity,
rheumatoid arthritis and graft versus host disease.
3. The method of claim 2, wherein said polymorphism in a human Mif
promoter is a CATT-tretranucleotide repeat polymorphism at position
-817 of the human Mif gene.
4. The method of claim 3, wherein said CATT-tretranucleotide repeat
polymorphism at position -817 of the human Mif gene is selected
from the group consisting of 5, 6, 7 and 8 repeat units, and
presence of a 5 repeat unit in at least one allele indicates
occurrence of or predisposition to low disease severity.
5. The method of claim 1, comprising amplifying said Mif promoter
using a PCR technique.
6. A PCR primer set selected to amplify a region of a human Mif
promoter, wherein said PCR primer set is selected from the group
consisting of: (i) MIF-F (-1024) and MIF-R (-421); (ii) MIF-F
(-441) and MIF-R (+4); (iii) MIFF (-13) and MIF-R (+395); and (iv)
MIF-F (+379) and MIF-R (+1043).
7. A method of detecting a polymorphism in a human Mif promoter
region comprising using a primer set of claim 6.
8. An article of manufacture comprising a PCR primer set of claim
6.
9. An isolated nucleic acid molecule comprising a human Mif
promoter.
10. An isolated nucleic acid molecule of claim 9, that is a genomic
DNA fragment.
11. An isolated nucleic acid molecule of claim 10, wherein said
genomic DNA fragment has been amplified from a DNA sample of a
human subject.
12. An isolated nucleic acid molecule of claim 9, comprising a
portion of a human Mif promoter that comprises a
CATT-tretranucleotide repeat polymorphism at position -817 of the
human Mif gene.
13. A method of inflammatory disease therapy comprising screening
an individual for severity of a non-infectious inflammatory disease
or of a predisposition to severity of a non-infectious inflammatory
disease comprising: detecting in a human subject a polymorphism in
a human Mif promoter that correlates with an increase or decrease
in MIF polypeptide expression, wherein detection of said
polymorphism is indicative of the severity of said disease or
predisposition to severity of said disease; and treating said human
subject to prevent or reduce the severity of said inflammatory
disease or to delay the onset of said inflammatory disease.
14. The method of claim 13, comprising treating said human subject
by administering an effective amount of at least one agent selected
from the group consisting of an MIF inhibitor, an anti-TNF.alpha.
antibody, an anti-IL1 antibody, and anti-IFN-.gamma. antibody,
IL-1RA, a steroid, a glucocorticoid, and IL-10.
15. The method of claim 14, wherein said inflammatory disease is
rheumatoid arthritis and said polymorphism in a human Mif promoter
is a CATT-tretranucleotide repeat polymorphism at position -817 of
the human Mif gene.
Description
[0001] This application is a continuation of U.S. application Ser.
No. 13/707,383, filed Dec. 6, 2012, which is a continuation of U.S.
application Ser. No. 11/599,443 filed Nov. 15, 2006, which is a
continuation of U.S. application Ser. No. 10/323,656 filed Dec. 20,
2002 (now U.S. Pat. No. 7,205,107), which claims priority from U.S.
Provisional Application Ser. No. 60/341,832 filed Dec. 21, 2001.
The entirety of these applications are incorporated herein by
reference.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] This invention relates to diagnostic method and apparatus
based upon a functional polymorphism in the promoter of a gene
encoding macrophage migration inhibitory factor (MIF). More
specifically, this invention relates to a method for diagnosis of
pre-disposition to certain disease states, by screening for the
presence of this promoter polymorphism. The invention also relates
to apparatus for screening for the polymorphism, MIF genes
containing the polymorphism and to a probe therefor.
[0004] 2. Background of the Technology
[0005] A number of experimental studies have led to the concept
that macrophage migration inhibitory factor (MIF) functions as a
physiological counter-regulator of glucocorticoid action within the
immune system. In this role, MIF's position within the cytokine
cascade is to act in concert with endogenous glucocorticoids to
control the set point and the magnitude of the inflammatory
response (1). MIF also has several direct, pro-inflammatory roles
in inflammatory diseases such as rheumatoid arthritis (2), sepsis
(3, 4), acute respiratory distress syndrome (5), and
glomerulonephritis (6).
[0006] MIF was originally described over 30 years ago as a
T-lymphocyte-derived factor that inhibited the migration of
peritoneal macrophages (7), but it is now known that several other
cell types, including macrophages themselves, are important sources
of MIF (8). MIF levels are elevated in the serum and synovial fluid
of patients with rheumatoid arthritis (2, 9), and within the
synovial joint MIF immunostaining can be localized to the synovial
lining CD14+ macrophages and fibroblast-like synoviocytes (2). Upon
release MIF is directly pro-inflammatory by activating or promoting
cytokine expression (TNF.alpha. (8, 10), IL-1.beta., IL-2 (11),
IL-6 (8,12), IL-8 (13) and IFN.gamma., (11, 14)), nitric oxide
release (15), matrix metalloproteinase (MMP) expression (16, 17),
and induction of the cyclooxygenase-2 (Cox-2) pathway (18). MIF's
capacity to induce to sustained activation of the p44/p42 (ERK-1/2)
MAP kinase pathway (18) and to inhibit p53-dependent apoptosis (19,
20) also suggest that this mediator may play a key role in
initiation of rheumatoid pannus.
[0007] U.S. Pat. No. 6,030,615 to Bucala, et al. discloses a
combination method for treating diseases caused by
cytokine-mediated toxicity, comprising administering an effective
amount of (a) an MIF inhibitor, such as an antibody that binds to
an MIF polypeptide, wherein the MIF polypeptide has a molecular
weight of about 12.5 kDa in combination with (b) anti-TNF.alpha.,
anti-IL1, anti-IFN-.gamma., IL-IRA, a steroid, a glucocorticoid, or
IL-10.
[0008] The concept that polymorphisms in immune response genes
contribute to the pathogenesis of certain human
autoimmune/inflammatory diseases has received increasing interest
over the last several years. At present, very few gene
polymorphisms have been shown to be functionally significant and to
be of prognostic value in specific disease states. Previously
defined examples include polymorphisms in TNF.alpha. and IL-1ra
that have been shown to have certain prognostic significance in
malaria and ischaemic heart disease respectively (24,25).
Similarly, a number, of polymorphisms in TNF.alpha. and IL-.beta.
have been reported to be associated with rheumatoid arthritis
severity (26-28).
SUMMARY OF THE INVENTION
[0009] The present invention is based in part upon identification
of a novel polymorphism in the human Mif gene that consists of a
tetra-nucleotide CATT repeat located at position -817 of the Mif
promoter. As disclosed herein, this promoter polymorphism is
functionally significant in vitro, and analysis of a cohort of
patients with rheumatoid arthritis indicates that this CATT repeat
is associated with disease severity.
[0010] One object of this invention, therefore, is to provide a
method of diagnosis comprising determining the genotype of a human
Mif promoter.
[0011] Another object of this invention is to provide diagnostic
means, comprising a means for determining the genotype of a human
Mif promoter.
[0012] Accordingly, the invention relates to a method of diagnosis
of severity of a non-infectious inflammatory disease or of a
predisposition to severity of a non-infectious inflammatory disease
comprising detecting a polymorphism in a human Mif promoter that
correlates with an increase or decrease in MIF polypeptide
expression. In this method the non-infectious inflammatory disease
is, for instance, autoimmunity, graft versus host disease, or
preferably rheumatoid arthritis, and preferably detection of the
polymorphism is indicative of the severity of the disease or
predisposition to severity of the disease. Preferably, this
polymorphism in a human Mif promoter that correlates with an
increase or decrease in MIF polypeptide expression is a
CATT-tretranucleotide repeat polymorphism at position -817 of the
human Mif gene, selected from the group consisting of 5, 6, 7 and 8
repeat units, where presence of the 5 repeat unit indicates
occurrence of or predisposition to low disease severity.
[0013] The diagnostic method of the invention preferably comprises
a step of amplifying the Mif promoter using a PCR technique. For
this purpose, the invention provides a PCR primer set selected to
amplify a region of a human Mif promoter. For instance, the PCR
primer set may be selected from the group consisting of: (i) MIF-F
(-1024) and MIF-R (-421); (ii) MIF-F (-441) and MIF-R (+4); (iii)
MIF-F (-13) and MIF-R (+395); and (iv) MIF-F (+379) and MIF-R
(+1043), as shown in Table 1, infra. The invention also relates to
a method of using a primer set of the invention to detect a
polymorphism in a human Mif promoter region, and an article of
manufacture (such as a diagnostic kit) comprising a PCR primer set
of the invention.
[0014] The invention further relates to nucleic acid molecule
comprising a human Mif promoter sequence in which the
CATT-tetranucleotide at position -817 is repeated 5, 6, 7 or 8
times. Preferably, the nucleic acid molecule is an isolated DNA
molecule, particularly an isolated genomic DNA fragment that has
been amplified from a DNA sample of a human subject. In preferred
embodiments, the isolated nucleic acid molecule of the invention
comprises a portion of a human Mif promoter that comprises a
CATT-tretranucleotide repeat polymorphism at position -817 of the
human Mif gene.
[0015] Another aspect of the present invention relates to a method
of inflammatory disease therapy comprising screening an individual
for severity of a non-infectious inflammatory disease or of a
predisposition to severity of a non-infectious inflammatory
disease. This method comprises: detecting in a human subject a
polymorphism in a human Mif promoter that correlates with an
increase or decrease in MIF polypeptide expression, where detection
of the polymorphism is indicative of the severity of the disease or
predisposition to severity of the disease. This method of
inflammatory disease therapy further comprises treating the human
subject to prevent or reduce the severity of the inflammatory
disease or to delay the onset of the inflammatory disease. For
instance, the therapy may comprise treating the human subject by
administering an effective amount of at least one agent selected
from the group consisting of an MIF inhibitor, an anti-TNF.alpha.
antibody, an anti-IL1 antibody, and anti-IFN-.gamma. antibody,
IL-IRA, a steroid, a glucocorticoid, and IL-10.
[0016] In a preferred embodiment of the invention method of
inflammatory disease therapy the inflammatory disease is rheumatoid
arthritis and the polymorphism in a human Mif promoter is a
CATT-tretranucleotide repeat polymorphism at position -817 of the
human Mif gene.
BRIEF DESCRIPTION OF THE FIGURES
[0017] FIG. 1 shows a schematic representation of the human Mif
promoter region. Putative transcription factor binding sites and
areas of interest are boxed. The polymorphic CATT repeat region
(-817 to -797/-785) is indicated by a lack of shading.
[0018] FIG. 2 shows the basal transcriptional activity of human Mif
promoter polymorphic variants in Cos-7 cells. MIF promoter activity
was determined by dual luciferase assays with results expressed as
relative light units (RLU). Cos-7 cells were transiently
co-transfected with 800 ng of test DNA vector: pGL3-basic (negative
control), pMIF-5, pMIF-6, pMIF-7, or pMIF-8 (5, 6, 7, or 8-CATT
repeat polymorphism specific MIF promoter-luciferase constructs)
and 200 ng of control pRLTK vector. After 48 hours, the cells were
lysed and luciferase activity was determined in relation to renilla
activity using a dual luciferase kit (Promega) and a TD 20/20
luminometer. The data represent the mean of four individual
experiments each carried out in duplicate .+-.STDEV. * indicates
P<0.03 vs. activity of pMIF-5 construct.
[0019] FIG. 3 shows the effect of CATT-repeat polymorphic variation
on Mif promoter responses to serum and forskolin stimulation in
Cos-7 cells. MIF promoter activity was determined by dual
luciferase assays with results expressed as relative light units
(RLU). Cos-7 cells were transiently co-transfected with 800 ng of
test DNA vector: pGL3-basic (negative control), pMIF-5, pMIF-6,
pMIF-7, or pMIF-8 (5, 6, 7, or 8-CATT repeat polymorphism specific
MIF promoter-luciferase constructs) and 200 ng of control pRLTK
vector. After 24 hours of transfection, the cells were washed in
PBS and then cultured in serum free media overnight. The cells were
then either left unstimulated (serum starved) or treated with 2%
fetal calf serum (FCS) or 1 .mu.M forskolin ("1 .mu.M FSK"). After
a further twelve hour incubation luciferase activity was determined
as in FIG. 2. The data represent the mean of four individual
experiments each carried out in duplicate .+-.STDEV. * indicates
P<0.03 vs. activity of pMIF-5 construct.
[0020] FIGS. 4A and 4B depict the nucleic acid sequence for human
MIF (SEQ ID NO: 12). The nucleotide position designated as -817 in
the figure is position 259 of SEQ ID NO: 12.
DETAILED DESCRIPTION OF THE INVENTION
[0021] The novel Mif gene polymorphism identified herein is
associated with reduced MIF promoter activity, and the presence of
this genotype in the homozygous state appears to be associated with
a reduced risk of severe rheumatoid arthritis.
[0022] MIF has been shown to promote TNF.alpha. secretion and to
enhance 1FN.gamma. induced nitric oxide secretion from macrophages
(8). In addition, MIF is an important autocrine regulator of
macrophage (8), T-cell (11) and fibroblast activation (18). These
data have led to numerous investigations of the potential role for
MIF in chronic inflammatory conditions such as rheumatoid
arthritis.
[0023] MIF protein levels circulate in higher levels in serum of
rheumatoid arthritis patients and cellular MIF expression is
enhanced within the synovium (2, 9). Cultured synovial fibroblasts
obtained from patients with rheumatoid arthritis secrete
significant quantities of MIF spontaneously in culture, and
secretion increases further following pro-inflammatory stimulation
(2). MIF stimulation of rheumatoid synovial fibroblasts results in
increased expression of matrix metalloproteinases (16), as well as
the induction of phospholipase A.sub.2 (PLA.sub.2) and COX-2
expression (29) Immunoneutralization of MIF activity in synoviocyte
cultures also has been shown to inhibit IL-I.beta. induced
expression of COX-2 and PLA.sub.2 mRNA (29). The administration of
a neutralizing anti-MIF antibody also delays the onset and
decreases the severity of type-II collagen induced arthritis in
mice (30) and profoundly inhibits the development of
adjuvant-induced arthritis in rats (31). Thus, there is
considerable evidence implicating MIF in the pathogenesis of
inflammatory arthritis.
[0024] Disclosed herein is a significant association between
patients that are homozygous for the low expressing, 5-CATT allele
and less aggressive rheumatoid disease. Only 1/79 (1.2%) patients
with severe rheumatoid arthritis inherited this genotype, compared
with 101105 (9.5%) of patients with milder, non-progressive
disease. This suggests that a genetic predisposition to low
expression of MIF protects against persistent inflammation and/or
joint destruction. It is unknown at present which transcription
factors may be involved in modulating the transcriptional effects
of the polymorphic region, but the 5-CATT allele shows reduced
responses in vitro to both serum and forskolin stimulation as well
as reduced basal activity. A CATT repeated element also exists in
the promoter of human granulocyte-macrophage colony-stimulating
factor (GM-CSF), and is required for promoter activity (32, 33). It
has been shown that the nuclear factor YY1.sup.34, and more
recently the factors AP-1 and SP-1, can form complexes with this
region of the GM-CSF promoter (35). Whether any of these same
factors also influence the activity of the MIF CATT repeat remains
to be determined.
[0025] The CATT-repeat region within the Mif gene contains several
putative Pit-1 transcription factor binding sites. Pit-1 is a
pituitary-specific transcription factor that is critical for the
expression of pituitary hormones such as prolactin and growth
hormone (36). The anterior pituitary gland is an important source
of MIF in rodents (3) and secretes MIF in response to physiological
or infective stress (37). Corticotrophin-releasing factor (CRF)
also has been shown to be a potent inducer of MIF expression in
cultured pituitary cells. A recent fimctional analysis of the
murine MIF gene-promoter using rat pituitary cells and the
pituitary cell line AtT-20 demonstrated that CRF-induced gene
expression is dependent upon a cAMP responsive element binding
protein (38). Interestingly, reports of linkage of the CRF locus to
rheumatoid arthritis have recently appeared in the literature, and
there is some evidence that the hypothalamic pituitary-adrenal
(HPA) axis may play a role in the pathogenesis of rheumatoid
arthritis in certain patients. Patients with active rheumatoid
arthritis have been shown to have abnormally low diurnal cortisol
levels in the face of normal pituitary and adrenal function,
suggesting a defect at the hypothalamic level (40). Given MIF's
capacity to counter-regulate glucocorticoid action within the
immune system (reviewed by Bucala (1)), the expression of MIF by
the anterior pituitary gland may be important to the development of
inflammatory diseases such as rheumatoid arthritis.
[0026] Since the initiation of these studies, a -173*G/C single
nucleotide polymorphism (SNP) in the Mif gene promoter has been
reported by Donn, et al. (41) and was shown to be associated with
systemic-onset juvenile idiopathic arthritis (systemic-onset JIA).
The possession of at least one 173*C allele was seen in 36.8% of
patients with systemic-onset JIA compared to 20.3% of the normal
population (41). However, there is no information concerning the
effect of this SNP on gene expression. A preliminary analysis by
the present inventors indicates that the 173*C allele cannot
explain the present association data or results of promoter assays;
indeed, there is no evidence of positive linkage disequilibrium
between the 173*C allele and the 5-CAAT allele (data not
shown).
[0027] TNF.alpha. is considered to be a critical effector cytokine
in rheumatoid arthritis, and anti-TNF.alpha. therapy has emerged to
have high efficacy in the treatment of this disease (42). Of note,
there is a close relationship between MIF and TNF.alpha.. MIF
appears to act as an important upstream regulator of TNF.alpha.
expression. MIF promotes secretion of TNF.alpha. from macrophages
and overrides the ability of glucocorticoids to suppress macrophage
TNF.alpha. production (43). Immunoneutralization of MIF also
reduces circulating levels of TNF.alpha.a (3). In a clinical
setting, the analysis of MIF polymorphisms provides a
prognosticator of disease severity, particularly in inflammatory
diseases and more particularly in rheumatoid disease, and can
assist in the selection of interventional therapy. The data herein
also reaffirm the potential importance of MIF as a therapeutic
target in rheumatoid arthritis and possibly other inflammatory
diseases.
Experimental
Materials and Methods
[0028] Patients:
[0029] DNA samples were obtained from the Wichita Rheumatic Disease
Data Bank and were representative of Caucasian patients followed in
a rheumatology practice since 1974. The rheumatoid arthritis
patients were divided into 2 groups using the following criteria:
A) Severe (n=79); mean age at onset 55 years, mean disease duration
of 13 years, mean Larsen score rate of 4.0, mean RF titer of 339.24
and a mean HAQ score of 1.36. B) Mild (n=105); mean age at onset 45
years, mean disease duration of 15 years, mean Larsen score of 1.0,
mean RF titer of 362.84 and a mean HAQ score of 0.93. Healthy
Caucasian volunteers provided genomic DNA that was used as the
normal control group (n=159).
[0030] DNA Extraction:
[0031] DNA was extracted from whole blood using the G Nome kit (Bio
101 Inc., CA, USA) and from the buccal brushes using the Pure Gene
Kit.RTM. (Gentra Systems Inc., MN, USA).
[0032] Mif Gene Sequencing and Polymorphism Analysis:
[0033] The Mif gene (GenBank Accession number: L19686, hereby
incorporated in its entirety herein by reference) is located on
chromosome 22q11.2 (44). The gene is 2167 bp long and has 3 exons
separated by 2 introns of 189 bp and 95 bp. Four sets of primers
were used to span the entire gene (Table 1, below).
TABLE-US-00001 TABLE 1 Primer sequences and conditions for PCR of
the Mif Gene Annealing PCR PCR Primer Primer Sequences Temp Special
Product Set Locations (5'-3') (.degree. C.) Conditions Size SET 1
MIF-F (-1074) TGCAGGAACCAATACCCATAGG 58.1 654 BP (SEQ. ID NO: 1)
MIF-R (-421) TGCGTGAGCTTGTGTGTTTGAG (SEQ. ID NO: 2) SET 2 MIF-F
(-441) TCAAACACACAAGCTCACGCA 60.8 10% DMSO 445 BP (SEQ. ID NO: 3)
MIF-R (+4) TGGTCCCGCCTTTTGTG (SEQ. ID NO: 4) SET 3 MIF-F (-13
CACAAAAGGCGGGACCACA 62.3 25% 7-Deaza 408 BP (SEQ. ID NO: 5) GTP in
1.25 MIF-R (+395) ACTGCGAGGAAAGGGCG mM dNTP (SEQ. ID NO: 6) SET 4
MIF-F (+379) CGCCCTTTCCTCGCAGT 10% DMSO 665 BP (SEQ. ID NO: 7)
MIF-R (+1043) TAGAATGGAAAGACACTGGG (SEQ. ID NO: 8)
The PCR reaction consisted of 1.times.PCR buffer II (Perkin Elmer,
CA, USA), 20 ng DNA, 1.5 mM MgCl.sub.2, 20 pmoles each of forward
and reverse primers and 0.5 units of Amplitaq Gold.RTM. polymerase
(Perkin Elmer-Applied Biosystems, CA, USA). The dNTP were used at a
concentration of 0.2 mM except for set 3, where the 0.2 mM dNTP had
0.05 mM of 7-Deaza GTP in a 20 .mu.l PCR reaction. The PCR
conditions were as follows: 95.degree. C./12 min, followed by 40
cycles of 95.degree. C./30 sec, annealing temp (Table 1)/30 sec,
72.degree. C./60 sec and 72.degree. C./10 min. The PCR products
were resolved using a 1% agarose gel stained with ethidium
bromide.
[0034] The PCR products from 6 normal controls and 6 rheumatoid
arthritis patients were sequenced using the Big Dye Terminator.RTM.
cycle sequencing ready reaction kit (Perkin Elmer-Applied
Biosystems). The sequences from all four primer sets were compiled
to represent the entire Mif gene and were compared to analyze
differences between the rheumatoid arthritis group and the normal
controls.
[0035] Rapid Screening for CATT Repeat Polymorphism:
[0036] The forward primer from Set 1 (SEQ. ID. NO: 1) was used with
the reverse primer MIF-R -728 (5'-AATGGTAAACTCGGGGAC-3'; SEQ. ID
NO: 9). The reverse primer was fluorescently labeled with TET to
allow detection of the PCR products using capillary electrophoresis
(45).
[0037] The PCR conditions were 1.times.PCR Buffer II, 1.5 mM
MgCl.sub.2, 0.2 mM dNTP, 0.75 pmoles of each primer, 1 ng DNA, 0.05
.mu.l AmpliTaq Gold.RTM. polymerase in a 10 .mu.l PCR reaction. The
PCR cycling conditions used were the same as described above except
for annealing conditions of 53.8.degree. C./30 sec. 1 .mu.l of
diluted PCR product was added to 12 .mu.l of deionized formamide
containing 0.5 .mu.l GS-500 TAMRA size standard (Perkin
Elmer-Applied Biosystems). Samples were denatured before being
resolved using an ABI 310 Genetic Analyzer (Perkin Elmer-Applied
Biosystems). DNA samples from homozygous individuals that
previously had been fully sequenced were used as controls for the
repeat sizes obtained by capillary electrophoresis.
[0038] MIF Promoter Cloning and Reporter Assays:
[0039] Genomic DNA obtained from the primary screening that
contained the 5, 6, 7, or 8-CATT tetranucleotide repeat
polymorphism was used as a PCR template for initial cloning into
the pCR2.1-TOPO vector (Invitrogen, CA, USA). The following primers
were used to generate a 1173-1189 bp PCR product representing
1071-1087 bp of the upstream flanking region of the MIF coding
sequence plus the first 102 bp of exon I (see FIG. 1):
TABLE-US-00002 Forward primer: (SEQ. ID NO: 10)
5'-CTCGAGCTGCAGGAACCAATACCCAT-3'; Reverse primer: (SEQ. ID NO: 11)
5'-AAGCTTGGCATGATGGCAGAAGGACC-3'.
[0040] After complete sequencing, the promoter region was excised
from the pCR2.1 vector and cloned into the Xhol/HindIII sites of
the pGL3-Basic luciferase vector (Promega, WI, USA). This vector
contains the CDNA encoding a modified version of firefly luciferase
in the absence of eukaryotic enhancer or promoter elements.
Luciferase constructs directly regulated by the MIF promoter,
containing the 5, 6, 7, or 8-CATT polymorphism, were generated.
Transient transfections were carried out using 3 .mu.l Fugene 6
(Roche, NJ, USA) and 1 .mu.g of DNA per well of a six well plate as
per manufacturers directions. Cell lines used included Cos-7
(monkey kidney fibroblast), A549 (human lung epithelium) and
CCD-19LU (primary human lung fibroblast). Data were normalized in
relation to an internal control of Renilla luciferase that was
regulated by the Herpes simplex virus thymidine kinase promoter
(PRL-TK vector--Promega, WI, USA). Subsequently, each transfection
consisted of 800 ng of test DNA (MIF-promoter regulated Luciferase
gene) combined with 200 ng of PRL-TK control vector DNA. Luciferase
assays were measured using a TD-20/20 luminometer (Turner Designs,
CA, USA) and the Dual Luciferase Reporter System (Promega, WI,
USA). Basal promoter activity was determined by measuring
luciferase activity 36 hours after transfection. In some cases,
cells were stimulated for the last 20 hours of culture prior to
measurement of promoter activity.
[0041] Genotype and Statistical Analysis:
[0042] The data were analyzed using Genotyper.RTM. 2.1 software
(Perkin Elmer-Applied Biosystems, CA, USA). The relationship
between the genotypes and disease status (normal, mild or severe)
was examined using the chi-square test and Fishers' exact test.
Gene reporter assays were repeated 3 to 10 times in duplicate. Data
are presented as mean.+-.STDEV and compared by non-parametric
Mann-Whitney U tests. Significance was defined as P<0.05.
Results
[0043] Identification of a Microsatellite Repeat in the Mif
Promoter.
[0044] Genomic DNA from six normal volunteers and six rheumatoid
patients was utilized for full sequencing of the Mif gene. Due to
the high GC content of this gene, the analysis was carried out in
four sections. Alignment of all twelve sequences identified a
tetra-nucleotide CATT repeat polymorphism in the upstream promoter
region at position -817 (FIG. 1). Individuals having 5, 6, 7 or
8-CATT repeat alleles in their sequences were found. Individuals
were either heterozygous or homozygous for these alleles, although
no 7-CATT homozygotes were found in the normal population and no
8-CATT homozygotes were found in either population studied.
[0045] For rapid screening of the promoter polymorphism, a
fluorescently labeled reverse primer that was proximal to the
tetranucleotide repeat units was designed in order to amplify a
smaller PCR fragment (340-352 bp). This fragment then was analyzed
using capillary electrophoresis on an ABI310 Genetic analyzer. The
DNA of individuals previously sequenced was used as a template to
generate control DNA fragments in order to correlate the fragment
size observed on the ABI310 analyzer with the number of CATT
repeats in the test samples. Accordingly, the 4 PCR product sizes
were 340, 344, 348, and 352 bp in length, and these corresponded to
five, six, seven, and eight-CATT repeats, respectively. The
genotypes observed were: 5,5; 5,6; 5,7; 6,6; 6,7; 7,7; 5,8; and
6,8. The 8,8 genotype was not seen in either the normal (n=159) or
patient (n=184) populations; and the 7,7 genotype was not seen in
the normal population, but was observed in one patient within the
rheumatoid arthritis group.
[0046] Distribution of Mif Alleles in Normal Controls and
Rheumatoid Arthritis Patients.
[0047] The distribution of the different Mif alleles in normal
controls, mild rheumatoid arthritis and severe rheumatoid arthritis
patients are shown in Table 2, below.
TABLE-US-00003 TABLE 2 Distribution of MIF genotypes and the
frequency of 5-CATT allele in normal and rheumatoid arthritis (RA)
populations Frequency of 5-CATT allele MIF-Genotype 5,5 or 5,X X,X
Population 5,5 6,6 7,7 5,6 5,7 6,7 5,8 6,8 alleles alleles Normal 8
53 0 61 10 25 1 1 80 79 (u-159) (5.03%) 33.33% (38.36%) (6.3%)
(15.72%) (0.63%) (0.63%) (50.31%) (49.69%) Wichita 10 49 1 23 8 14
0 0 41 64 Mild RA (9.52%) (46.67%) (0.95%) (21.91%) (7.62%) 13.33%)
(39.05%) (60.95%) (u-105) Wichita 1 40 0 20 4 13 0 1 25 54 Severe
RA (1.27%) (50.63%) (25.31%) (5.06%) (16.46%) (1.27%) (31.65%)
(68.35%) u = 79
There was no deviation from Hardy-Weinberg equilibrium in normal
controls (p=0.69). The frequencies of the 5, 6, 7 and 8 alleles
were found to be 0.277, 0.607, 0.11 and 0.006 respectively.
[0048] The number of individuals carrying at least one 5-CATT
allele decreases from 50.31% in the normal population to 31.65% in
the severe rheumatoid arthritis population (Table 2). The
difference between the severe rheumatoid arthritis patients and
controls is statistically significant (p<0.02). The cases and
controls analyzed in this study were not closely matched for
geographic and ethnic origin, hence the data must be interpreted
with some caution. A comparison of specific genotypes between the
mild and severe rheumatoid arthritis populations was therefore
carried out, as shown in Table 2. The 5,5 genotype is observed in
9.5% of the patients with mild rheumatoid arthritis, but is
significantly decreased to 1.3% in the patients with severe disease
(p=0.0252 by Fisher's exact test). These data indicate that a
homozygous 5-CATT allele is protective for the development of
severe disease.
[0049] Effect of the CATT Repeat Polymorphism on MIF Promoter
Activity.
[0050] To investigate whether the CATT repeat polymorphism was
associated with functional regulation of MIF expression, a gene
reporter assay was developed and studied under defined conditions
in vitro. Gene reporter assays have been widely employed to study
transcriptional regulation, or as readouts to monitor transcription
factor (21,22).
[0051] Transfection of the Mif promoter-regulated luciferase
constructs into Cos-7 cells, A549 cells, and CCD-19Lu cells was
associated with strong basal promoter activity, as indicated by
high luciferase production, when compared to control vector
(pGL3-Basic) (FIG. 2 and data not shown). Promoter activity was
increased by forskolin (an inducer of CAMP synthesis 23) and serum
stimulation (FIG. 3), as well as phorbol ester stimulation (data
not shown). In general, basal promoter activity was high in each of
the cell lines tested when compared to negative (empty pGL3 vector)
and positive (pRL-TK) controls, and these data appeared to
correlate with the high level of endogenous MIF protein expression
that was observed in these cell lines (data not shown). Of note, in
each of the cell lines tested, the 5-CATT repeat MIF promoter
construct showed significantly lower transcriptional activity when
compared to the 6, 7, or 8-CATT repeat promoter constructs.
REFERENCE LIST
[0052] The following documents are cited parenthetically by number
in the specification above. [0053] 1. Bucala, "MIF
Rediscovered:Cytokine, Pituitary Hormone, and
Glucocorticoid-Induced Regulator of the Immune Response", FASEB
Journal, 10, 1607-1613 (1996). [0054] 2. Leech, et al. "Macrophage
Migration Inhibitory Factor in Rheumatoid Arthritis: Evidence of
Proinflanunatory Function and Regulation by Glucocorticoids",
Arthritis Rheum., 42, 1601-1608 (1999). [0055] 3. Bernhagen. et
al., "MIF is a Pituitary-Derived Cytokine that Potentiates Lethal
Endotoxemia", Nature, 365, 756-759 (1993). [0056] 4. Bemhagen, et
al., "The Emerging Role of MIF in Septic Shock and Infection",
Biotherapy, 1995; 8, 123-127 (1995). [0057] 5. Donnelly, et al.,
"Macrophage Migration Inhibitory Factor and Acute Lung Injury",
Chest, 1999; 116, 111S (1999). [0058] 6. Yang, et al., "Reversal of
Established Rat Crescentic Glomerulonephritis by Blockade of
Macrophage Migration Inhibitory Factor (MIF): Potential Role of MIF
in Regulating Glucocorticold Production", Molecular Medicine, 4,
413-424 (1998). [0059] 7. David, "Delayed Hypersensitivity in
vitro: Its Mediation by Cell-Free Substances Formed by Lymphoid
Cell-Antigen Interaction", Proc Natl Acad Sci USA, 56, 72-77
(1996). [0060] 8. Calandra, et al., "Macrophage is an Important and
Previously Unrecognized Source of Macrophage-Migration Inhibitory
Factor", J. Exp. Med., 179, 1895-1902 (1994). [0061] 9. Onodera, et
al., "High Expression of Macrophage Migration Inhibitory Factor in
the Synovial Tissues of Rheumatoid Joints", Cytokine, 11, 163-167
(1999). [0062] 10. Calandra, et al., "Protection from Septic Shock
by Neutralization of Macrophage Migration Inhibitory Factor", Nat.
Med.; 6, 164-170 (2000). [0063] 11. Bacher, et al., "An Essential
Regulatory Role for Macrophage Migration Inhibitory Factor in
T-cell Activation", Proc. Natl. Acad. Sci. USA, 93, 7849-7854
(1996). [0064] 12. Satoskar, et al, "Migration-Inhibitory Factor
Gene-Deficient Mice are Susceptible to Cutaneous Leishmania Major
Infection", Infect. Immun.; 69, 906-911 (2001). [0065] 13. Benigni,
et al., "The Proinflammatory Mediator Macrophage Migration
Inhibitory Factor Induces Glucose Catabolism in Muscle", J. Clin.
Invest., 2000; 106, 1291-1300 (2000). [0066] 14. Abe, et al.,
"Regulation of the CTL Response by Macrophage Migration Inhibitory
Factor", J. Immunol.; 166, 747-753 (2001). [0067] 15. Benihagen, et
al., "Purification and Characterization of the Cytokine
Macrophage-Migration Inhibitory Factor (MIF)", FASEB Journal, 8,
A1417 (1994). [0068] 16. Onodera, et al., "Macrophage Migration
Inhibitory Factor Up-Regulates Expression of Matrix
Metalloproteinases in Synovial Fibroblasts of Rheumatoid
Arthritis", J. Biol. Chem., 275, 444-450 (2000). [0069] 17.
Meyer-Siegler, et al., "Macrophage Migration Inhibitory Factor
Increases MMP-2 Activity in DU-145 Prostate Cells", Cytokine, 12,
914-921 (2000). [0070] 18. Mitchell, et al., "Sustained
Mitogen-Activated Protein Kinase (MAPK) and Cytoplasmic
Phospholipase A2 Activation by Macrophage Migration Inhibitory
Factor (MIF). Regulatory Role in Cell Proliferation and
Glucocorticoid Action", J. Biol. Chem.; 274, 18100-18106 (1999).
[0071] 19. Hudson, et al., "A Proinflammatory Cytokine Inhibits p53
Tumor Suppressor Activity", J. Exp. Med., 190: 1375-1382 (1999).
[0072] 20. Mitchel, et al., "Macrophage Migration Inhibitory Factor
(MIF) Sustains Macrophage Proinflammatory Function by Inhibiting
p53: Regulatory Role in the Innate Immune Response", Proc. Natl.
Acad. Sci. USA, (In press). [0073] 21. Alam, et al., "Reporter
Genes: Application to the Study of Mammalian Gene Transcription",
Anal. Biochem., 188, 245-254 (1990). [0074] 22. Naylor, et al.,
"Reporter Gene Technology: the Future Looks Bright, Biochem.
Pharmacol., 58, 749-757 (1999). [0075] 23. Seamon, et al.,
"Forskolin: A Unique Diterpene Activator of Cyclic AMP-Generating
Systems", J. Cyclic Nucleotide Res., 7, 201-224 (1981). [0076] 24.
McGuire, et al., "Variation in the TNF-.alpha. Promoter Region
Associated with Susceptibility to Cerebral Malaria", Nature, 371,
508-510 (1994). [0077] 25. Francis, et al. "Interleukin-I Receptor
Antagonist Gene Polymorphism and Coronary Artery Disease",
Circulation, 99, 861-866 (1999). [0078] 26. Buchs, et al.,
"IL-I.beta. and IL-I Ra Gene Polymorphisms and Disease Severity in
Rheumatoid Arthritis: Interaction with Their Plasma Levels", Genes
Immun., 2, 222-228 (2001). [0079] 27. Mu, et al., "Tumor Necrosis
Factor .alpha. Microsatellite Polymorphism is Associated with
Rheumatoid Arthritis Severity Through an Interaction with the
HLA-DRB1 Shared Epitope", Arthritis Rheum., 42, 43 8-442 (1999).
[0080] 28. van Krugten, et al., "Association of the TNF +489
Polymorphism with Susceptibility and Radiographic Damage in
Rheumatoid Arthritis", Genes Immun., 1, 91-96 (1999). [0081] 29.
Sampey, et al., "Regulation of Synoviocyte Phospholipase A2 and
Cyclooxygenase 2 by Macrophage Migration Inhibitory Factor",
Arthritis Rheum., 44, 1273-1280 (2001). [0082] 30. Mikulowska, et
al., "Macrophage Migration Inhibitory Factor is Involved in the
Pathogenesis of Coliagen Type 11-Induced Arthritis in Mice", J.
Immunol., 158, 5514-5517 (1997). [0083] 31. Leech, et al.,
"Regulation of Macrophage Migration Inhibitory Factor by Endogenous
Glucocorticoids in Rat Adjuvant-Induced Arthritis", Arthritis
Rheum., 43, 827-833 (2000). [0084] 32. Nimer, et al., "The Repeated
Sequence CATT(A/T) is Required for Granulocyte-Macrophage
Colony-Stimulating Factor Promoter Activity", Mol. Cell. Biol., 10,
6084-6088 (1990). [0085] 33. Nimer, et al., "Adjacent, Cooperative
Elements Form a Strong, Constitutive Enhancer in the Human
Granulocyte-Macrophage Colony-Stimulating Factor Gene", Blood, 87,
3694-3703 (1996). [0086] 34. Ye, et al., "Identification of a DNA
Binding Site for the Nuclear Factor YYI in the Human GM-CSF Core
Promoter", Nucleic Acids Res., 22, 5672-5678 (1994). [0087] 35. Ye,
et al., "Characterization of the Human Granulocyte-Macrophage
Colony-Stimulating Factor Gene Ppromoter: An AP I Complex and an
Spl-Related Complex Transactivate the Promoter Activity that is
Suppressed by a YYI Complex", Mol. Cell Biol., 16, 157-167 (1996),
[0088] 36. Cohen, et al., "Role of Pit-I in the Gene Expression of
Growth Hormone, Prolactin, and Thyrotropin", Endocrinol, Metab.
Clin. North Am., 25, 523-540 (1996). [0089] 37. Calandra, et al.,
"MIF as a Glucocorticoid-Induced Modulator of Cytokine Production",
Nature, 377, 68-71 (1995). [0090] 38. Waeber, et al,
"Transcriptional Activation of the Macrophage Migration-Inhibitory
Factor Gene by the Corticotropin-Releasing Factor is Mediated by
the Cyclic Adenosine 3',5'-Monophosphate Responsive Element-Binding
Protein CREB in Pituitary Cells", Mol. Endocrinol, 12, 698-705
(1998). [0091] 39. Baerwald, et al., "Corticotropin Releasing
Hormone (CRH) Promoter Polymorphisms in Various Ethnic Groups of
Patients with Rheumatoid Arthritis", Z. Rheumatol., 59, 29-34
(2000). [0092] 40. Chikanza, et al., "Defective Hypothalamic
Response to Immune and Inflammatory Stimuli in Patients with
Rheumatoid Arthritis", Arthritis Rheum., 35, 1281-1288 (1992).
[0093] 41. Donn, et al., "A Novel 5'-Flanking Region Polymorphism
of Macrophage Migration Inhibitory Factor is Associated with
Systemic-Onset Juvenile Idiopathic Arthritis", Arthritis Rheum.,
44, 1782-1785 (2001). [0094] 42. Feldmann, et al.,
"Anti-TNF-.alpha. Alpha Therapy of Rheumatoid Arthritis: What Have
We Learned?", Ann. Rev. Immunol., 19, 163-196 (1901). [0095] 43.
Calandra, et al., "MIF, a Previously Unrecognized Macrophage
Cytokine, Induces Macrophages to Secrete TNF-.alpha. and Overcomes
Dexamethasone-Suppression of TNF Secretion", Clinical Research, 42,
A138 (1994). [0096] 44. Paralkar, et al., "Cloning the Human Gene
for Macrophage Migration Inhibitory Factor (MIF)", Genomics, 19:
48-51 (1994). [0097] 45. Tsuda, et al., "Separation of Nucleotides
by High-Voltage Capillary Electrophoresis", J. Appl. Biochem., 5,
330-336 (1983).
[0098] All patents, patent applications and publications mentioned
hereinabove are hereby incorporated by reference in their
entirety.
[0099] While the foregoing invention has been described in some
detail for purposes of clarity and understanding, it will be
appreciated by one skilled in the art from a reading of this
disclosure that various changes in form and detail can be made
without departing from the true scope of the invention and appended
claims.
Sequence CWU 1
1
12122DNAArtificial SequencePrimer 1tgcaggaacc aatacccata gg
22222DNAArtificial SequencePrimer 2tgcgtgagct tgtgtgtttg ag
22321DNAArtificial SequencePrimer 3tcaaacacac aagctcacgc a
21417DNAArtificial SequencePrimer 4tggtcccgcc ttttgtg
17519DNAArtificial SequencePrimer 5cacaaaaggc gggaccaca
19617DNAArtificial SequencePrimer 6actgcgagga aagggcg
17717DNAArtificial SequencePrimer 7cgccctttcc tcgcagt
17820DNAArtificial SequencePrimer 8tagaatggaa agacactggg
20918DNAArtificial SequencePrimer 9aatggtaaac tcggggag
181026DNAArtificial SequencePrimer 10ctcgagctgc aggaaccaat acccat
261126DNAArtificial SequencePrimer 11aagcttggca tgatggcaga aggacc
26122167DNAHomo sapiens 12ctgcaggaac caatacccat aggctatttg
tataaatggg ccatggggcc tcccagctgg 60aggctggctg gtgccacgag ggtcccacag
gcatgggtgt ccttcctata tcacatggcc 120ttcactgaga ctggtatatg
gattgcacct atcagagacc aaggacagga cctccctgga 180aatctctgag
gacctggcct gtgatccagt tgctgccttg tcctcttcct gctatgtcat
240ggcttatctt ctttcaccca ttcattcatt cattcattca ttcagcagta
ttagtcaatg 300tctcttgata tgcctggcac ctgctagatg gtccccgagt
ttaccattag tggaaaagac 360atttaagaaa ttcaccaagg gctctatgag
aggccataca cggtggacct gactagggtg 420tggcttccct gaggagctga
agttgcccag aggcccagag aaggggagct gagcacgttt 480gaaccactga
acctgctctg gacctcgcct ccttccttcg gtgcctccca gcatcctatc
540ctctttaaag agcaggggtt cagggaagtt ccctggatgg tgattcgcag
gggcagctcc 600cctctcacct gccgcatgac taccccgccc catctcaaac
acacaagctc acgcatgcgg 660gactggagcc cttgaggaca tgtggcccaa
agacaggagg tacaggggct cagtgcgtgc 720agtggaatga actgggcttc
atctctggaa gggtaagggg ccatcttccg ggttcaccgc 780cgcatcccca
cccccggcac agcgcctcct ggcgactaac atcggtgact tagtgaaagg
840actaagaaag acccgaggcg aggccggaac aggccgattt ctagccgcca
agtggagaac 900aggttggagc ggtgcgccgg gcttagcggc ggttgctgga
ggaacgggcg gagtcgccca 960gggtcctgcc ctgcgggggt cgagccgagg
caggcggtga cttccccact cggggcggag 1020ccgcagcctc gcgggggcgg
ggcctggcgc cggcggtggc gtcacaaaag gcgggaccac 1080agtggtgtcc
gagaagtcag gcacgtagct cagcggcggc cgcggcgcgt gcgtctgtgc
1140ctctgcgcgg gtctcctggt ccttctgcca tcatgccgat gttcatcgta
aacaccaacg 1200tgccccgcgc ctccgtgccg gacgggttcc tctccgagct
cacccagcag ctggcgcagg 1260ccaccggcaa gcccccccag gtttgccggg
aggggacagg aagagggggg tgcccaccgg 1320acgaggggtt ccgcgctggg
agctggggag gcgactcctg aacggagctg gggggcgggg 1380cggggggagg
acggtggctc gggcccgaag tggacgttcg gggcccgacg aggtcgctgg
1440ggcgggctga ccgcgccctt tcctcgcagt acatcgcggt gcacgtggtc
ccggaccagc 1500tcatggcctt cggcggctcc agcgagccgt gcgcgctctg
cagcctgcac agcatcggca 1560agatcggcgg cgcgcagaac cgctcctaca
gcaagctgct gtgcggcctg ctggccgagc 1620gcctgcgcat cagcccggac
aggtacgcgg agtcgcggag gggcggggga ggggcggcgg 1680cgcgcggcca
ggcccgggac tgagccaccc gctgagtccg gcctcctccc cccgcagggt
1740ctacatcaac tattacgaca tgaacgcggc caatgtgggc tggaacaact
ccaccttcgc 1800ctaagagccg cagggaccca cgctgtctgc gctggctcca
cccgggaacc cgccgcacgc 1860tgtgttctag gcccgcccac cccaaccttc
tggtggggag aaataaacgg tttagagact 1920aggagtgcct cggggttcct
tggcttgcgg gaggaattgg tgcagagccg ggacattggg 1980gagcgaggtc
gggaaacggt gttgggggcg ggggtcaggg ccgggttgct ctcctcgaac
2040ctgctgttcg ggagcccttt tgtccagcct gtccctccta cgctcctaac
agaggagccc 2100cagtgtcttt ccattctatg gcgtacgaag ggatgaggag
aagttggcac tctgccctgg 2160gctgcag 2167
* * * * *