U.S. patent application number 14/913177 was filed with the patent office on 2016-07-14 for genome modification using guide polynucleotide/cas endonuclease systems and methods of use.
The applicant listed for this patent is PIONEER HI-BRED INTERNATIONAL, INC.. Invention is credited to Andrew Cigan, Phillip A. Patten, Joshua K. Young.
Application Number | 20160201072 14/913177 |
Document ID | / |
Family ID | 51493053 |
Filed Date | 2016-07-14 |
United States Patent
Application |
20160201072 |
Kind Code |
A1 |
Cigan; Andrew ; et
al. |
July 14, 2016 |
GENOME MODIFICATION USING GUIDE POLYNUCLEOTIDE/CAS ENDONUCLEASE
SYSTEMS AND METHODS OF USE
Abstract
Compositions and methods are provided for genome modification of
a target sequence in the genome of a cell. The methods and
compositions employ a guide polynucleotide/Cas endonuclease system
to provide an effective system for modifying or altering target
sites within the genome of a cell or organism. Once a genomic
target site is identified, a variety of methods can be employed to
further modify the target sites such that they contain a variety of
polynucleotides of interest. Compositions and methods are also
provided for editing a nucleotide sequence in the genome of a cell.
Breeding methods and methods for selecting plants utilizing a two
component RNA polynucleotide and Cas endonuclease system are also
disclosed.
Inventors: |
Cigan; Andrew; (Johnston,
IA) ; Patten; Phillip A.; (Menlo Park, CA) ;
Young; Joshua K.; (Johnston, IA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
PIONEER HI-BRED INTERNATIONAL, INC. |
Johnston |
IA |
US |
|
|
Family ID: |
51493053 |
Appl. No.: |
14/913177 |
Filed: |
August 20, 2014 |
PCT Filed: |
August 20, 2014 |
PCT NO: |
PCT/US2014/051780 |
371 Date: |
February 19, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61868706 |
Aug 22, 2013 |
|
|
|
61882532 |
Sep 25, 2013 |
|
|
|
61937045 |
Feb 7, 2014 |
|
|
|
61953090 |
Mar 14, 2014 |
|
|
|
62023239 |
Jul 11, 2014 |
|
|
|
Current U.S.
Class: |
800/306 ;
435/468; 435/469; 435/470; 435/6.11; 536/23.1; 800/295; 800/298;
800/312; 800/313; 800/314; 800/317.2; 800/317.3; 800/320;
800/320.1; 800/320.2; 800/320.3; 800/322 |
Current CPC
Class: |
C12N 2310/3231 20130101;
C12N 2310/10 20130101; C12N 15/8241 20130101; A01H 1/00 20130101;
C12N 15/8216 20130101; C12N 15/113 20130101; C12N 2310/20 20170501;
C12N 15/8213 20130101; C12N 2310/3341 20130101; C12N 2310/315
20130101; C12N 2310/321 20130101; C12N 2310/3521 20130101; C12N
2310/322 20130101; C12N 2310/3533 20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82; A01H 1/04 20060101 A01H001/04; C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A guide polynucleotide comprising: (i) a first nucleotide
sequence domain that is complementary to a nucleotide sequence in a
target DNA; and, (ii) a second nucleotide sequence domain that
interacts with a Cas endonuclease, wherein the first nucleotide
sequence domain and the second nucleotide sequence domain are
composed of deoxyribonucleic acids (DNA), ribonucleic acids (RNA),
or a combination thereof, wherein the guide polynucleotide does not
solely comprise ribonucleic acids.
2. The guide polynucleotide of claim 1, wherein the first
nucleotide sequence domain and the second nucleotide sequence
domain are located on a single molecule.
3. The guide polynucleotide of claim 1, wherein the second
nucleotide sequence domain comprises two separate molecules that
are capable of hybridizing along a region of complementarity.
4. The guide polynucleotide of claim 1, wherein the first
nucleotide sequence domain is a DNA sequence and the second
nucleotide sequence domain is selected from the group consisting of
a DNA sequence, a RNA sequence, and a combination thereof.
5. The guide polynucleotide of claim 1, wherein the first
nucleotide sequence domain and the second nucleotide sequence
domain are DNA sequences.
6. The guide polynucleotide of claim 1, wherein the first
nucleotide sequence domain and/or the second nucleotide sequence
domain comprises at least one modification, wherein said at least
one modification is selected from the group consisting of a 5' cap,
a 3' polyadenylated tail, a riboswitch sequence, a stability
control sequence, a sequence that forms a dsRNA duplex, a
modification or sequence that targets the guide poly nucleotide to
a subcellular location, a modification or sequence that provides
for tracking, a modification or sequence that provides a binding
site for proteins, a Locked Nucleic Acid (LNA), a 5-methyl dC
nucleotide, a 2,6-Diaminopurine nucleotide, a 2'-Fluoro A
nucleotide, a 2'-Fluoro U nucleotide; a 2'-O-Methyl RNA nucleotide,
a phosphorothioate bond, linkage to a cholesterol molecule, linkage
to a polyethylene glycol molecule, linkage to a spacer 18 molecule,
a 5' to 3' covalent linkage, and any combination thereof.
7-8. (canceled)
9. A plant or seed comprising the guide polynucleotide of claim
1.
10. A guide polynucleotide/Cas endonuclease complex wherein the
guide polynucleotide comprises: (i) a first nucleotide sequence
domain that is complementary to a nucleotide sequence in a target
DNA; and, (ii) a second nucleotide sequence domain that interacts
with a Cas endonuclease, wherein said guide polynucleotide does not
solely comprise ribonucleic acids, wherein said guide
polynucleotide and Cas endonuclease are capable of forming a
complex that enables the Cas endonuclease to introduce a double
strand break at said target site.
11. The guide polynucleotide/Cas endonuclease complex of claim 10,
wherein the first nucleotide sequence domain and the second
nucleotide sequence domain of the guide polynucleotide are composed
of deoxyribonucleic acids (DNA), ribonucleic acids (RNA), or a
combination thereof, wherein the guide polynucleotide does not
solely comprise ribonucleic acids.
12. The guide polynucleotide/Cas endonuclease complex of claim 10,
wherein the first nucleotide sequence domain and/or the second
nucleotide sequence domain of said guide polynucleotide comprises
at least one modification that provides for an additional
beneficial feature, wherein said at least one modification is
selected from the group consisting of a 5' cap, a 3' polyadenylated
tail, a riboswitch sequence, a stability control sequence; a
sequence that forms a dsRNA duplex, a modification or sequence that
targets the guide poly nucleotide to a subcellular location, a
modification or sequence that provides for tracking, a modification
or sequence that provides a binding site for proteins, a Locked
Nucleic Acid (LNA), a 5-methyl dC nucleotide, a 2,6-Diaminopurine
nucleotide, a 2'-Fluoro A nucleotide, a 2'-Fluoro U nucleotide; a
2'-O-Methyl RNA nucleotide, a phosphorothioate bond, linkage to a
cholesterol molecule, linkage to a polyethylene glycol molecule,
linkage to a spacer 18 molecule, a 5' to 3' covalent linkage, and
any combination thereof.
13. The guide polynucleotide/Cas endonuclease complex of claim 10,
wherein the Cas endonuclease is a Cas9 endonuclease.
14. A plant or seed comprising the guide polynucleotide/Cas
endonuclease complex of claim 10.
15. (canceled)
16. A method for modifying a target site in the genome of a cell,
the method comprising providing a guide polynucleotide and a Cas
endonuclease to a cell, wherein said guide polynucleotide does not
solely comprise ribonucleic acids, wherein said guide
polynucleotide and Cas endonuclease are capable of forming a
complex that enables the Cas endonuclease to introduce a double
strand break at said target site.
17. The method of claim 16, further comprising providing a donor
DNA to said cell, wherein said donor DNA comprises a polynucleotide
of interest.
18. The method of any one of claim 16, further comprising
identifying at least one cell that has a modification at said
target, wherein the modification at said target site is selected
from the group consisting of (i) a replacement of at least one
nucleotide, (ii) a deletion of at least one nucleotide, (iii) an
insertion of at least one nucleotide, and (iv) any combination of
(i)-(iii).
19-24. (canceled)
25. A method for modifying a target site in the genome of a cell,
the method comprising: a) providing to a cell a crNucleotide, a
first recombinant DNA construct capable of expressing a tracrRNA,
and a second recombinant DNA capable of expressing a Cas
endonuclease, wherein said crNucleotide is a deoxyribonucleotide
sequence or a combination of a deoxyribonucleotide and
ribonucleotide sequence, wherein said crNucleotide, said tracrRNA
and said Cas endonuclease are capable of forming a complex that
enables the Cas endonuclease to introduce a double strand break at
said target site; and, b) identifying at least one cell that has a
modification at said target site, wherein the modification is
selected from the group consisting of (i) a replacement of at least
one nucleotide, (ii) a deletion of at least one nucleotide, (iii)
an insertion of at least one nucleotide, and (iv) any combination
of (i)-(iii).
26. A method for modifying a target site in the genome of a cell,
the method comprising: a) providing to a cell a tracrNucleotide, a
first recombinant DNA construct capable of expressing a crRNA and a
second recombinant DNA capable of expressing a Cas endonuclease,
wherein said tracrNucleotide is selected a deoxyribonucleotide
sequence or a combination of a deoxyribonucleotide and
ribonucleotide sequence, wherein said tracrNucleotide, said crRNA
and said Cas endonuclease are capable of forming a complex that
enables the Cas endonuclease to introduce a double strand break at
said target site; and, b) identifying at least one cell that has a
modification at said target site, wherein the modification is
selected from the group consisting of (i) a replacement of at least
one nucleotide, (ii) a deletion of at least one nucleotide, (iii)
an insertion of at least one nucleotide, and (iv) any combination
of (i)-(iii).
27. (canceled)
28. A method for editing a nucleotide sequence in the genome of a
cell, the method comprising introducing a guide polynucleotide, a
polynucleotide modification template and at least one Cas
endonuclease into a cell, wherein said guide polynucleotide does
not solely comprise ribonucleic acids, wherein the Cas endonuclease
introduces a double-strand break at a target site in the genome of
said cell, wherein said polynucleotide modification template
comprises at least one nucleotide modification of said nucleotide
sequence.
29-31. (canceled)
32. A plant or seed comprising a guide polynucleotide and a Cas9
endonuclease, wherein said guide polynucleotide does not solely
comprise ribonucleic acids, wherein said Cas9 endonuclease and
guide polynucleotide are capable of forming a complex and creating
a double strand break in a genomic target site of said plant.
33-43. (canceled)
Description
[0001] This application claims the benefit of U.S. Provisional
Application No. 61/868,706, filed Aug. 22, 2013, U.S. Provisional
Application No. 61/882,532, filed Sep. 25, 2013, U.S. Provisional
Application No. 61/937,045, filed Feb. 7, 2014, U.S. Provisional
Application No. 61/953,090, filed Mar. 14, 2014, and U.S.
Provisional Application No. 62/023,239, filed Jul. 11, 2014; all of
which are hereby incorporated herein in their entirety by
reference.
FIELD
[0002] The disclosure relates to the field of molecular biology, in
particular, to methods for altering the genome of a cell.
REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY
[0003] The official copy of the sequence listing is submitted
electronically via EFS-Web as an ASCII formatted sequence listing
with a file named 20140815_BB2344PCT_ST25_SequenceListing created
on Aug. 15, 2014 and having a size of 82 kilobytes and is filed
concurrently with the specification. The sequence listing contained
in this ASCII formatted document is part of the specification and
is herein incorporated by reference in its entirety.
BACKGROUND
[0004] Recombinant DNA technology has made it possible to insert
foreign DNA sequences into the genome of an organism, thus,
altering the organism's phenotype.
[0005] One method for inserting or modifying a DNA sequence
involves homologous DNA recombination by introducing a transgenic
DNA sequence flanked by sequences homologous to the genomic target.
U.S. Pat. No. 5,527,695 describes transforming eukaryotic cells
with DNA sequences that are targeted to a predetermined sequence of
the eukaryote's DNA. Specifically, the use of site-specific
recombination is discussed. Transformed cells are identified
through use of a selectable marker included as a part of the
introduced DNA sequences.
[0006] It was shown that artificially induced site-specific genomic
double-stranded breaks in plant cells were repaired by homologous
recombination with exogenously supplied DNA using two different
pathways. (Puchta et al., (1996) Proc. Natl. Acad. Sci. USA
93:5055-5060; U.S. Patent Application Publication No.
2005/0172365A1 published Aug. 4, 2005; U.S. Patent Application
Publication No. 2006/0282914 published Dec. 14, 2006; WO
2005/028942 published Jun. 2, 2005).
[0007] Since the isolation, cloning, transfer and recombination of
DNA segments, including coding sequences and non-coding sequences,
is most conveniently carried out using restriction endonuclease
enzymes. Much research has focused on studying and designing
endonucleases such as WO 2004/067736 published Aug. 12, 2004; U.S.
Pat. No. 5,792,632 issued to Dujon et al., Aug. 11, 1998; U.S. Pat.
No. 6,610,545 B2 issued to Dujon et al., Aug. 26, 2003; Chevalier
et al., (2002) Mol Cell 10:895-905; Chevalier et al., (2001)
Nucleic Acids Res 29:3757-3774; Seligman et al., (2002) Nucleic
Acids Res 30:3870-3879.
[0008] Although several approaches have been developed to target a
specific site for modification in the genome of a cell, there still
remains a need for more efficient and effective methods for
producing an organism, such as but not limited to yeast and fertile
plants, having an altered genome comprising specific modifications
in a defined region of the genome of the cell.
BRIEF SUMMARY
[0009] Compositions and methods are provided employing a guide
polynucleotide/Cas endonuclease system for genome modification of a
target sequence in the genome of a cell or organism, for gene
editing, and for inserting a polynucleotide of interest into the
genome of a cell or organism. The methods and compositions employ a
guide polynucleotide/Cas endonuclease system to provide for an
effective system for modifying or altering target sites and editing
nucleotide sequences of interest within the genome of cell, wherein
the guide polynucleotide is comprised of a DNA, RNA or a DNA-RNA
combination sequence. Cells include, but are not limited to
non-human, animal, bacterial, fungal, insect, yeast, and plant
cells. Once a genomic target site is identified, a variety of
methods can be employed to further modify the target sites such
that they contain a variety of polynucleotides of interest.
Breeding methods and methods for selecting plants utilizing a guide
polynucleotide and Cas endonuclease system are also disclosed. Also
provided are nucleic acid constructs, cells, yeast, plants, plant
cells, explants, seeds and grain having the guide
polynucleotide/Cas endonuclease system. Compositions and methods
are also provided for editing a nucleotide sequence in the genome
of a cell. The nucleotide sequence to be edited (the nucleotide
sequence of interest) can be located within or outside a target
site that is recognized by a Cas endonuclease.
[0010] Thus in a first embodiment of the disclosure, the
composition comprises a guide polynucleotide comprising: (i) a
first nucleotide sequence domain that is complementary to a
nucleotide sequence in a target DNA; and, (ii) a second nucleotide
sequence domain that interacts with a Cas endonuclease, wherein the
first nucleotide sequence domain and the second nucleotide sequence
domain are composed of deoxyribonucleic acids (DNA), ribonucleic
acids (RNA), or a combination thereof, wherein the guide
polynucleotide does not solely comprise ribonucleic acids. The %
complementation between the first nucleotide sequence domain
(Variable Targeting domain) and the target sequence can be at least
50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%,
79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. The first
nucleotide sequence domain (VT domain) comprises a contiguous
stretch of 12 to 30 nucleotides.
[0011] In one embodiment, the first nucleotide sequence domain (VT
domain) and the second nucleotide sequence domain of the guide
polynucleotide are located on a single molecule. In another
embodiment, the second nucleotide sequence domain (Cas Endonuclease
Recognition domain) comprises two separate molecules that are
capable of hybridizing along a region of complementarity.
[0012] In another embodiment, the composition comprises a guide
polynucleotide, wherein the first nucleotide sequence domain is a
DNA sequence and the second nucleotide sequence domain is selected
from the group consisting of a DNA sequence, a RNA sequence, and a
combination thereof.
[0013] In another embodiment, the composition comprises a guide
polynucleotide, wherein the first nucleotide sequence domain and/or
the second nucleotide sequence domain comprises at least one
modification that optionally provides for an additional beneficial
feature, wherein said at least one modification is selected from
the group consisting of a 5' cap, a 3' polyadenylated tail, a
riboswitch sequence, a stability control sequence; a sequence that
forms a dsRNA duplex, a modification or sequence that targets the
guide poly nucleotide to a subcellular location, a modification or
sequence that provides for tracking, a modification or sequence
that provides a binding site for proteins, a Locked Nucleic Acid
(LNA), a 5-methyl dC nucleotide, a 2,6-Diaminopurine nucleotide, a
2'-Fluoro A nucleotide, a 2'-Fluoro U nucleotide; a 2'-O-Methyl RNA
nucleotide, a phosphorothioate bond, linkage to a cholesterol
molecule, linkage to a polyethylene glycol molecule, linkage to a
spacer 18 molecule, a 5' to 3' covalent linkage, or any combination
thereof. The additional beneficial can be a modified or regulated
stability, a subcellular targeting, tracking, a fluorescent label,
a binding site for a protein or protein complex, modified binding
affinity to complementary target sequence, modified resistance to
cellular degradation, or an increased cellular permeability.
[0014] In another embodiment, the composition comprises a guide
polynucleotide/Cas endonuclease complex wherein the guide
polynucleotide comprises (i) a first nucleotide sequence domain
that is complementary to a nucleotide sequence in a target DNA; and
(ii) a second nucleotide sequence domain that interacts with a Cas
endonuclease, wherein said guide polynucleotide does not solely
comprise ribonucleic acids, wherein said guide polynucleotide and
Cas endonuclease are capable of forming a complex that enables the
Cas endonuclease to introduce a double strand break at said target
site.
[0015] In another embodiment, the composition comprises a guide
polynucleotide/Cas endonuclease complex, wherein the first
nucleotide sequence domain and/or the second nucleotide sequence
domain of said guide polynucleotide comprises at least one
modification that optionally provides for an additional beneficial
feature, wherein said at least one modification is selected from
the group consisting of a 5' cap, a 3' polyadenylated tail, a
riboswitch sequence, a stability control sequence; a sequence that
forms a dsRNA duplex, a modification or sequence that targets the
guide poly nucleotide to a subcellular location, a modification or
sequence that provides for tracking, a modification or sequence
that provides a binding site for proteins, a Locked Nucleic Acid
(LNA), a 5-methyl dC nucleotide, a 2,6-Diaminopurine nucleotide, a
2'-Fluoro A nucleotide, a 2'-Fluoro U nucleotide; a 2'-O-Methyl RNA
nucleotide, a phosphorothioate bond, linkage to a cholesterol
molecule, linkage to a polyethylene glycol molecule, linkage to a
spacer 18 molecule, a 5' to 3' covalent linkage, or any combination
thereof.
[0016] In another embodiment, the composition comprises plant or
seed comprising the guide polynucleotide or the guide
polynucleotide/Cas endonuclease complex of the disclosure.
[0017] In another embodiment, the method comprises a method for
modifying a target site in the genome of a cell, the method
comprising introducing a guide polynucleotide into a cell having a
Cas endonuclease, wherein said guide polynucleotide does not solely
comprise ribonucleic acids, wherein said guide polynucleotide and
Cas endonuclease are capable of forming a complex that enables the
Cas endonuclease to introduce a double strand break at said target
site.
[0018] In another embodiment, the method comprises a method for
modifying a target site in the genome of a cell, the method
comprising introducing a guide polynucleotide and a Cas
endonuclease into a cell, wherein said guide polynucleotide does
not solely comprise ribonucleic acids, wherein said guide
polynucleotide and Cas endonuclease are capable of forming a
complex that enables the Cas endonuclease to introduce a double
strand break at said target site.
[0019] In another embodiment, the method comprises a method for
introducing a polynucleotide of interest into a target site in the
genome of a cell, the method comprising: a) providing a guide
polynucleotide, a donor DNA and a Cas endonuclease to a cell,
wherein said guide polynucleotide does not solely comprise
ribonucleic acids, wherein said guide polynucleotide and Cas
endonuclease are capable of forming a complex that enables the Cas
endonuclease to introduce a double strand break at said target
site; b) contacting the cell of (a) with a donor DNA comprising a
polynucleotide of interest; and,
c) identifying at least one cell from (b) comprising in its genome
the polynucleotide of interest integrated at said target site.
[0020] In another embodiment, the method comprises a method for
modifying a target site in the genome of a cell, the method
comprising: a) providing to a cell a crNucleotide, a first
recombinant DNA construct capable of expressing a tracrRNA, and a
second recombinant DNA capable of expressing a Cas endonuclease,
wherein said crNucleotide is a deoxyribonucleotide sequence or a
combination of a deoxyribonucleotide and ribonucleotide sequence,
wherein said crNucleotide, said tracrRNA and said Cas endonuclease
are capable of forming a complex that enables the Cas endonuclease
to introduce a double strand break at said target site; and, b)
identifying at least one cell that has a modification at said
target site, wherein the modification is selected from the group
consisting of (i) a replacement of at least one nucleotide, (ii) a
deletion of at least one nucleotide, (iii) an insertion of at least
one nucleotide, and (iv) any combination of (i)-(iii).
[0021] In another embodiment, the method comprises a method for
modifying a target site in the genome of a cell, the method
comprising: a) providing to a cell a tracrNucleotide, a first
recombinant DNA construct capable of expressing a crRNA and a
second recombinant DNA capable of expressing a Cas endonuclease,
wherein said tracrNucleotide is selected a deoxyribonucleotide
sequence or a combination of a deoxyribonucleotide and
ribonucleotide sequence, wherein said tracrNucleotide, said crRNA
and said Cas endonuclease are capable of forming a complex that
enables the Cas endonuclease to introduce a double strand break at
said target site; and, b) identifying at least one cell that has a
modification at said target site, wherein the modification is
selected from the group consisting of (i) a replacement of at least
one nucleotide, (ii) a deletion of at least one nucleotide, (iii)
an insertion of at least one nucleotide, and (iv) any combination
of (i)-(iii).
[0022] In another embodiment, the method comprises a method for
introducing a polynucleotide of interest into a target site in the
genome of a cell, the method comprising: a) introducing into a cell
a first recombinant DNA construct capable of expressing a guide
polynucleotide, and a second recombinant DNA construct capable of
expressing a Cas endonuclease, wherein said guide polynucleotide
does not solely comprise ribonucleic acids, wherein said guide
polynucleotide and Cas endonuclease are capable of forming a
complex that enables the Cas endonuclease to introduce a double
strand break at said target site; b) contacting the cell of (a)
with a donor DNA comprising a polynucleotide of interest; and, c)
identifying at least one cell from (b) comprising in its genome the
polynucleotide of interest integrated at said target site.
[0023] In another embodiment, the method comprises a method for
editing a nucleotide sequence in the genome of a cell, the method
comprising introducing a guide polynucleotide, a polynucleotide
modification template and at least one Cas endonuclease into a
cell, wherein said guide polynucleotide does not solely comprise
ribonucleic acids, wherein the Cas endonuclease introduces a
double-strand break at a target site in the genome of said cell,
wherein said polynucleotide modification template comprises at
least one nucleotide modification of said nucleotide sequence.
[0024] In another embodiment, the composition comprises a plant or
seed comprising a guide polynucleotide and a Cas endonuclease,
wherein said guide polynucleotide does not solely comprise
ribonucleic acids, wherein said Cas endonuclease and guide
polynucleotide are capable of forming a complex and creating a
double strand break in a genomic target site of said plant.
[0025] In another embodiment, the composition comprises a plant or
seed comprising a recombinant DNA construct and a guide
polynucleotide, wherein said guide polynucleotide does not solely
comprise ribonucleic acids, wherein said recombinant DNA construct
comprises a promoter operably linked to a nucleotide sequence
encoding a plant optimized Cas endonuclease, wherein said plant
optimized Cas endonuclease and guide polynucleotide are capable of
forming a complex and creating a double strand break in a genomic
target site of said plant.
[0026] In another embodiment, the method comprises a method for
selecting a plant comprising an altered target site in its plant
genome, the method comprising: a) obtaining a first plant
comprising at least one Cas endonuclease capable of introducing a
double strand break at a target site in the plant genome; b)
obtaining a second plant comprising a guide polynucleotide that is
capable of forming a complex with the Cas endonuclease of (a),
wherein the guide polynucleotide does not solely comprise
ribonucleic acids, c) crossing the first plant of (a) with the
second plant of (b); d) evaluating the progeny of (c) for an
alteration in the target site and e) selecting a progeny plant that
possesses the desired alteration of said target site.
[0027] Additional embodiments of the methods and compositions of
the present disclosure are disclosed below.
BRIEF DESCRIPTION OF THE DRAWINGS AND THE SEQUENCE LISTING
[0028] The disclosure can be more fully understood from the
following detailed description and the accompanying drawings and
Sequence Listing, which form a part of this application. The
sequence descriptions and sequence listing attached hereto comply
with the rules governing nucleotide and amino acid sequence
disclosures in patent applications as set forth in 37 C.F.R.
.sctn..sctn.1.821-1.825. The sequence descriptions contain the
three letter codes for amino acids as defined in 37 C.F.R.
.sctn..sctn.1.821-1.825, which are incorporated herein by
reference.
FIGURES
[0029] FIG. 1 A shows a duplex guide polynucleotide containing a
double molecule comprising a first nucleotide sequence domain
(referred to as Variable Targeting domain or VT domain) that is
complementary to a nucleotide sequence in a target DNA and a second
nucleotide sequence domain (referred to as Cas endonuclease
recognition domain or CER domain) that interacts with a Cas
endonuclease polypeptide. The CER domain of the duplex guide
polynucleotide comprises two separate molecules that are hybridized
along a region of complementarity. The two separate molecules can
be RNA, DNA, and/or RNA-DNA-combination sequences. The first
molecule of the duplex guide polynucleotide comprising a VT domain
linked to a CER domain (shown as crNucleotide) is referred to as
"crDNA" (when composed of a contiguous stretch of DNA nucleotides)
or "crRNA" (when composed of a contiguous stretch of RNA
nucleotides), or "crDNA-RNA" (when composed of a combination of DNA
and RNA nucleotides). The second molecule of the duplex guide
polynucleotide comprising a CER domain (shown as tracrNucleotide)
is referred to as "tracrRNA" (when composed of a contiguous stretch
of RNA nucleotides) or "tracrDNA" (when composed of a contiguous
stretch of DNA nucleotides) or "tracrDNA-RNA" (when composed of a
combination of DNA and RNA nucleotides).
[0030] FIG. 1B shows a single guide polynucleotide comprising a
first nucleotide sequence domain (referred to as Variable Targeting
domain or VT domain) that is complementary to a nucleotide sequence
in a target DNA and a second nucleotide domain (referred to as Cas
endonuclease recognition domain or CER domain) that interacts with
a Cas endonuclease polypeptide. By "domain" it is meant a
contiguous stretch of nucleotides that can be RNA, DNA, and/or
RNA-DNA-combination sequences. The single guide polynucleotide
comprises a crNucleotide (comprising a VT domain linked to a CER
domain) linked to a tracrNucleotide (comprising a CER domain) with
a linker nucleotide sequence (shown as a loop). The single guide
polynucleotide being comprised of sequences from the crNucleotide
and tracrNucleotide may be referred to as "single guide RNA" (when
composed of a contiguous stretch of RNA nucleotides) or "single
guide DNA" (when composed of a contiguous stretch of DNA
nucleotides) or "single guide RNA-DNA" (when composed of a
combination of RNA and DNA nucleotides).
[0031] FIG. 2A-2C show expression cassettes for Cas9, crRNA and
tracrRNA expression. FIG. 2A shows a maize codon optimized Cas9
gene (encoding a Cas9 endonuclease) containing a potato ST-LS1
intron, a SV40 amino terminal nuclear localization sequence (SV40
NLS), and a VirD2 carboxyl terminal NLS (VirD2 NLS), operably
linked to a plant ubiquitin promoter (UBI Pro) (SEQ ID NO: 5). The
maize optimized Cas9 gene (just Cas9 coding sequence, no NLSs)
corresponds to nucleotide positions 2037-2411 and 2601-6329 of SEQ
ID NO: 5 with the potato intron residing at positions 2412-2600 of
SEQ ID NO: 5.SV40 NLS is at positions 2010-2036 of SEQ ID NO: 5.
VirD2 NLS is at positions 6330-6386 of SEQ ID NO: 5. FIG. 2 B shows
a maize U6 polymerase III promoter operably linked to a nucleotide
sequence encoding a crRNA molecule operably linked to a maize U6
terminator. The resulting maize optimized crRNA expression cassette
is listed in SEQ ID NO: 8. FIG. 2 C shows a maize U6 polymerase III
promoter operably linked to a nucleotide sequence encoding a
tracrRNA molecule operably linked to a maize U6 PoIIII terminator.
The resulting maize optimized tracrRNA expression cassette is
listed in SEQ ID NO: 9.
[0032] FIG. 3A shows a duplex guide RNA/Cas9 endonuclease system
and target DNA complex relative to the appropriately oriented PAM
sequence (AGG) at the maize LIGCas-3 target sequence (SEQ ID NO:
14, Table 1). The duplex guide RNA (lighter gray backgrounds)
comprises a crRNA molecule (SEQ ID NO: 10) containing a variable
targeting domain (VT domain) base-pairing to the complementary
strand of the LIGCas-3 target sequence, and a tracrRNA molecule
(SEQ ID NO:11) comprising part of the CER domain. The Cas9
endonuclease is depicted in dark gray. Triangles point towards the
expected site of DNA cleavage on both sense and anti-sense DNA
strands.
[0033] FIG. 3B shows a single guide RNA/Cas9 endonuclease complex
interacting with the genomic LIGCas-3 target site relative to the
appropriately oriented PAM sequence (AGG) at the maize genomic
LIGCas-3 target site (SEQ ID NO: 14, Table 1). The single guide RNA
(light gray background, SEQ ID NO: 96) is a fusion between a crRNA
and tracrRNA and comprises a variable targeting domain that is
complementary to one DNA strand of the double strand DNA genomic
target site. The Cas9 endonuclease is shown in dark gray. Triangles
point towards the expected site of DNA cleavage on both sense and
anti-sense DNA strands.
[0034] FIGS. 4A-4C show an alignment and count of the top 10 most
frequent NHEJ mutations induced by the maize optimized guide
RNA/Cas endonuclease system described herein at the maize genomic
Liguleless 1 locus. The mutations were identified by deep
sequencing. The PAM sequence and expected site of cleavage are also
indicated. Deletions or insertions as a result of imperfect NHEJ
are shown by a "-" or an italicized underlined nucleotide,
respectively. In FIG. 4A, the reference sequence (SEQ ID NO: 23)
represents the unmodified LIGCas-1 locus with the target site
underlined. The sequences comprising the mutations 1-10 of the
LIGCas-1 target site correspond to SEQ ID NOs: 24-33, respectively.
In FIG. 4B, the reference sequence (SEQ ID NO: 23) represents the
unmodified LIGCas-2 locus with the target site underlined. The
sequences comprising the mutations 1-10 of the LIGCas-2 target site
correspond to SEQ ID NOs: 34-43, respectively. In FIG. 4C, the
reference sequence (SEQ ID NO: 44) represents the unmodified
LIGCas-3 locus with the target site underlined. The sequences
comprising the mutations 1-10 of the LIGCas-3 target site
correspond to SEQ ID NOs: 45-54, respectively.
[0035] FIG. 5 shows a duplex guide polynucleotide/Cas9 endonuclease
system and target DNA complex relative to the appropriately
oriented PAM sequence at the maize LIGCas-3 target sequence (SEQ ID
NO: 14, Table 1). The duplex guide RNA (lighter gray backgrounds)
comprises a crDNA molecule (SEQ ID NO: 55) containing a variable
targeting domain (VT domain) base-pairing to the complementary
strand of the LIGCas-3 target sequence and a tracrRNA molecule (SEQ
ID NO: 11) comprising part of the CER domain. The Cas9 endonuclease
is shown in dark gray. Triangles point towards the expected site of
DNA cleavage on both sense and anti-sense DNA strands.
[0036] FIGS. 6A-6B show alignments and counts of the top 3 most
frequent NHEJ mutations induced by either a maize optimized duplex
guide RNA/Cas endonuclease system (FIG. 6A) or a maize optimized
duplex guide polynucleotide/Cas endonuclease system (FIG. 6B)
described herein at the maize genomic Liguleless 1 locus. The
mutations were identified by deep sequencing. The PAM sequence and
expected site of cleavage are also indicated. Deletions or
insertions as a result of imperfect NHEJ are shown by a "-" or an
italicized underlined nucleotide, respectively. In FIG. 6A, the
NHEJ mutations originated from synthetic crRNA plus tracrRNA and
Cas9 expression cassettes. The reference sequence (SEQ ID NO: 44)
represents the unmodified LIGCas-3 locus with the target site
underlined. The sequences comprising the mutations 1-3 of the
LIGCas-3 target site correspond to SEQ ID NOs: 56-58, respectively.
In FIG. 6B, the NHEJ mutations originated from synthetic crDNA plus
tracrRNA and Cas9 expression cassettes. The reference sequence (SEQ
ID NO: 44) represents the unmodified LIGCas-3 locus with the target
site underlined. The sequences comprising the mutations 1-3 of the
LIGCas-3 target site correspond to SEQ ID NOs: 59-61,
respectively.
[0037] FIG. 7 illustrates the disruption of the yeast ADE2 gene on
chromosome 15 with URA3 coding sequence and 305 bp of duplicated
ADE2 gene sequence resulting in the ADE:URA3:DE2 yeast screening
strain.
[0038] FIG. 8 illustrates the scheme by which cleavage activity may
be monitored in the yeast ADE:URA3:DE2 screening strain. If the
URA3 target site is cleaved, the ADE2 sequence duplications
flanking the URA3 coding sequence may be used as template for
homologous recombination repair of the DNA double strand break. As
depicted by dashed lines leading from the regions of ADE2 sequence
duplication in the ADE:URA3:DE2 configuration to the ADE2
configuration, homologous recombination mediated repair of the
double strand break results in the loss of the URA3 gene coding
sequence and the gain of a functional ADE2 gene.
[0039] FIG. 9 shows the numerical scale and corresponding red/white
sectoring of yeast colonies used to quantify cleavage activity.
Since the sectoring phenotype is a qualitative measure of cleavage
activity, a 0-4 numerical scoring system was implemented. A score
of 0 indicates that no white sectors (no cutting) were observed; a
score of 4 indicates completely white colonies (complete cutting of
the recognition site); scores of 1-3 indicate intermediate white
sectoring phenotypes (and intermediate degrees of recognition site
cutting).
SEQUENCES
[0040] SEQ ID NO: 1 is the nucleotide sequence of the Cas9 gene
from Streptococcus pyogenes M1 GAS (SF370).
[0041] SEQ ID NO: 2 is the nucleotide sequence of the potato ST-LS1
intron.
[0042] SEQ ID NO: 3 is the amino acid sequence of SV40 amino
N-terminal.
[0043] SEQ ID NO: 4 is the amino acid sequence of Agrobacterium
tumefaciens bipartite VirD2 T-DNA border endonuclease carboxyl
terminal.
[0044] SEQ ID NO: 5 is the nucleotide sequence of an expression
cassette expressing the maize optimized Cas9.
[0045] SEQ ID NO: 6 is the nucleotide sequence of the maize U6
polymerase III promoter.
[0046] SEQ ID NO: 7 is the amino acid sequence a SV40 nuclear
localization signal.
[0047] SEQ ID NO: 8 is the nucleotide sequence of a maize optimized
crRNA expression cassette containing the variable targeting domain
targeting the LIGCas-3 target sequence.
[0048] SEQ ID NO: 9 is the nucleotide sequence of a maize optimized
tracrRNA expression cassette.
[0049] SEQ ID NO: 10 is the nucleotide sequence of a crRNA
containing a variable targeting domain targeting the LIGCas-3
target sequence.
[0050] SEQ ID NO: 11 is the nucleotide sequence of the tracrRNA
from Streptococcus pyogenes M1 GAS (SF370)>
[0051] SEQ ID NO: 12 is the nucleotide sequence of the maize
genomic target site LIGCas-1 plus PAM sequence.
[0052] SEQ ID NO: 13 is the nucleotide sequence of the maize
genomic target site LIGCas-2 plus PAM sequence.
[0053] SEQ ID NO: 14 is the nucleotide sequence of the maize
genomic target site LIGCas-3 plus PAM sequence.
[0054] SEQ ID NOs: 15-22 are nucleotide sequences of PCR
primers.
[0055] SEQ ID NO: 23 is the nucleotide sequence of the unmodified
reference sequence for LIGCas-1 and LIGCas-2 locus (FIG. 4A-4B)
[0056] SEQ ID NOs: 24-33 are the nucleotide sequences of mutations
1-10 for the LIGCas-1 locus (FIG. 4A).
[0057] SEQ ID NOs: 34-43 are the nucleotide sequences of mutations
1-10 for the LIGCas-2 locus (FIG. 4B).
[0058] SEQ ID NO: 44 is the nucleotide sequence of the unmodified
reference sequence for LIGCas-3 (FIG. 4C)
[0059] SEQ ID NOs: 45-54 are the nucleotide sequences of mutations
1-10 for the LIGCas-3 locus (FIG. 4C).
[0060] SEQ ID NO: 55 is the nucleotide sequence of a crDNA
(comprised of deoxyribonucleic acids) containing a variable
targeting domain targeting the LIGCas-3 target sequence
[0061] SEQ ID NOs: 56-58 are the nucleotide sequences of mutations
1-3 for the LIGCas-3 locus (originating from synthetic crRNA plus
tracrRNA and Cas9 expression cassettes) (FIG. 6A).
[0062] SEQ ID NOs: 59-61 are the nucleotide sequences of mutations
1-3 for the LIGCas-3 locus (originating from synthetic crDNA plus
tracrRNA and Cas9 expression cassettes) (FIG. 6B).
[0063] SEQ ID NO: 62 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crRNA) that does not include
any modification to its ribonucleotide sequence.
[0064] SEQ ID NO: 63 is the nucleotide sequence of a CER domain of
a crNucleotide (crRNA) that does not include any modification to
its ribonucleotide sequence.
[0065] SEQ ID NO: 64 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crRNA), that includes
phosphorothioate bonds at the 5' end of its nucleotide sequence
(G*C*G*). In the sequence listing, the first N at the 5' end
represents a G ribonucleotide with a phosphorothioate bond, the
second N represents a C ribonucleotide with a phosphorothioate bond
and third N represents a G ribonucleotide with a Phosphorothioate
bond.
[0066] SEQ ID NO: 65 is the nucleotide sequence of a CER domain of
a crNucleotide (crRNA) that includes phosphorothioate bonds near
the 3' end of its nucleotide sequence (U*U*U*). In the sequence
listing, the Ns at the nineteenth, twentieth and twenty-first
positions represent U ribonucleotides with phosphorothioate
bonds.
[0067] SEQ ID NO: 66 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crRNA) that includes
2'-O-methyl RNA nucleotides at it 5' end (mGmCmG). In the sequence
listing, the first N at the 5' end represents a G 2'-O-methyl
ribonucleotide, the second N represents a C 2'-O-methyl
ribonucleotide and the third N represents a G 2'-O-Methyl
ribonucleotide.
[0068] SEQ ID NO: 67 is the nucleotide sequence of a CER domain of
a crNucleotide (crRNA) that includes 2'-O-methyl RNA nucleotides
near the 3' end of its nucleotide sequence (mUmUmG). In the
sequence listing, the N at the twentieth position represents a U
2'-O-Methyl ribonucleotide, the N at the twenty-first position
represents a U 2'-O-Methyl ribonucleotide and the N at the
twenty-second position represents a G 2'-O-Methyl
ribonucleotide.
[0069] SEQ ID NO: 68 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crRNA) that includes
2'-O-Methyl RNA nucleotides for each nucleotide. In the sequence
listing, the first N at the 5' end represents a G 2'-O-Methyl
ribonucleotide, a N at the second position represents a C
2'-O-Methyl ribonucleotide, a N at the third position represents a
G 2'-O-Methyl ribonucleotide, a N at the fourth position represents
an U 2'-O-Methyl ribonucleotide, a N at the fifth position
represents an A 2'-O-Methyl ribonucleotide, a N at the sixth
position represents a C 2'-O-Methyl ribonucleotide, a N at the
seventh position represents a G 2'-O-Methyl ribonucleotide, a N at
the eighth position represents a C 2'-O-Methyl ribonucleotide, a N
at the ninth position represents a G 2'-O-Methyl ribonucleotide, a
N at the tenth position represents an U 2'-O-Methyl ribonucleotide,
a N at the eleventh position represents an A 2'-O-Methyl
ribonucleotide, a N at the twelfth position represents C
2'-O-Methyl ribonucleotide, a N at the thirteenth position
represents a G 2'-O-Methyl ribonucleotide, a N at the fourteenth
position represents an U 2'-O-Methyl ribonucleotide, a N at the
fifteenth position represents a G 2'-O-Methyl ribonucleotide, a N
at the sixteenth position represents an U 2'-O-Methyl
ribonucleotide and a N seventeenth position represents a G
2'-O-Methyl ribonucleotide.
[0070] SEQ ID NO: 69 is the nucleotide sequence of a CER domain of
a crNucleotide (crRNA) that include 2'-O-Methyl RNA nucleotides for
each nucleotide. In the sequence listing, the first N at the 5' end
represents a G 2'-O-Methyl ribonucleotide, a N at the second
position represents an U 2'-O-Methyl ribonucleotide, a N at the
third position represents an U 2'-O-Methyl ribonucleotide, a N at
the fourth position represents an U 2'-O-Methyl ribonucleotide, a N
at the fifth position represents an U 2'-O-Methyl ribonucleotide, a
N at the sixth position represents an A 2'-O-Methyl ribonucleotide,
a N at the seventh position represents a G 2'-O-Methyl
ribonucleotide, a N at the eighth position represents an A
2'-O-Methyl ribonucleotide, a N at the ninth position represents a
G 2'-O-Methyl ribonucleotide, a N at the tenth position represents
a C 2'-O-Methyl ribonucleotide, a N at the eleventh position
represents an U 2'-O-Methyl ribonucleotide, a N at the twelfth
position represents an A 2'-O-Methyl ribonucleotide, a N at the
thirteenth position represents an U 2'-O-Methyl ribonucleotide, a N
at the fourteenth position represents a G 2'-O-Methyl
ribonucleotide, a N at the fifteenth position represents a C
2'-O-Methyl ribonucleotide, a N at the sixteenth position
represents an U 2'-O-Methyl ribonucleotide, a N at the seventeenth
position represents a G 2'-O-Methyl ribonucleotide, a N at the
eighteen position represents an U 2'-O-Methyl ribonucleotide, a N
at the nineteenth position represents an U 2'-O-Methyl
ribonucleotide, a N at the twentieth position represents an U
2'-O-Methyl ribonucleotide, a N at the twenty-first position
represents an U 2'-O-Methyl ribonucleotide and a N at the
twenty-second position represents a G 2'-O-Methyl
ribonucleotide.
[0071] SEQ ID NO: 70 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crDNA) that does not include
any modification to its deoxyribonucleotide sequence.
[0072] SEQ ID NO: 71 is the nucleotide sequence of a CER domain of
a crNucleotide (crDNA) that does not include any modification to
its deoxyribonucleotide sequence.
[0073] SEQ ID NO: 72 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crDNA), which includes one
Locked Nucleic Acid nucleotide (+T) in its nucleotide sequence. In
the sequence listing, an N at the sixteenth position represents a T
Locked Nucleic Acid base.
[0074] SEQ ID NO: 73 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crDNA), which includes three
Locked Nucleic Acid nucleotide (+C, +T, +T) in its nucleotide
sequence. In the sequence listing, an N at the twelfth position
represents a C Locked Nucleic Acid base, a N at the fourteenth
position represents a T Locked Nucleic Acid base and a N at the
sixteenth position represents a T Locked Nucleic Acid base.
[0075] SEQ ID NO: 74 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crDNA), that includes six
Locked Nucleic Acid nucleotide (+C, +C, +T, +C, +T, +T) in its
nucleotide sequence. In the sequence listing, a N at the sixth
position represents a C Locked Nucleic Acid base, a N at the eighth
position represents a C Locked Nucleic Acid base, a N at the tenth
position represents a T Locked Nucleic Acid base, a N at the
twelfth position represents a C Locked Nucleic Acid base, a N at
the fourteenth position represents a T Locked Nucleic Acid base and
a N at the sixteenth position represents a T Locked Nucleic Acid
base.
[0076] SEQ ID NO: 75 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crDNA), that includes three
Locked Nucleic Acid nucleotide (+C, +T, +T) in its nucleotide
sequence and phosphorothioate bonds near the 5' end of its
nucleotide sequence (G*C*G*). In the sequence listing, a first N at
the 5' end represents a G deoxyribonucleotide with a
phosphorothioate bond, a N at the second position represents a C
deoxyribonucleotide with a phosphorothioate bond, a N at the third
position represents a G deoxyribonucleotide with a phosphorothioate
bond, a N at the twelfth position represents a C Locked Nucleic
Acid base, a N at the fourteenth position represents a T Locked
Nucleic Acid base and a N at the sixteenth position represents a T
Locked Nucleic Acid base.
[0077] SEQ ID NO: 76 is the nucleotide sequence of a CER domain of
a crNucleotide (crDNA) that includes three Locked Nucleic Acid
nucleotide (T*T*T) near the 3' end of the nucleotide sequence. In
the sequence listing, the Ns at the nineteenth, twentieth and
twenty-first positions represent T deoxyribonucleotides with
Phosphorothioate bonds.
[0078] SEQ ID NO: 77 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crDNA) that includes one
5-Methyl dC nucleotide in its nucleotide sequence. In the sequence
listing, a N at the twelfth position represents a 5-Methyl dC
deoxyribonucleotide.
[0079] SEQ ID NO: 78 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crDNA) that includes three
5-Methyl dC nucleotide in its nucleotide sequence. In the sequence
listing, Ns at the sixth, eighth and twelfth positions represent
5-Methyl dC deoxyribonucleotides.
[0080] SEQ ID NO: 79 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crDNA) that includes one
2,6-diaminopurine nucleotide in its nucleotide sequence. In the
sequence listing, a N at the eleventh position represents a
2,6-Diaminopurine deoxyribonucleotide.
[0081] SEQ ID NO: 80 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crDNA) that includes two
2,6-diaminopurine nucleotides in its nucleotide sequence. In the
sequence listing, a Ns at the fifth and eleventh positions
represent 2,6-diaminopurine deoxyribonucleotides.
[0082] SEQ ID NO: 81 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crDNA) that includes Locked
Nucleic Acid nucleotides near the 5' end of its nucleotide
sequence. In the sequence listing, the first N at the 5' end
represent a G Locked Nucleic Acid base, second N represents a C
Locked Nucleic Acid base and third N represents a G Locked Nucleic
Acid base.
[0083] SEQ ID NO: 82 is the nucleotide sequence of a CER domain of
a crNucleotide (crDNA) that includes Locked Nucleic Acid
nucleotides near the 3' end of the nucleotide sequence. In the
sequence listing, a N at the twentieth position represents a T
Locked Nucleic Acid base, a N at the twenty-first position
represents a T Locked Nucleic Acid base and a N at the
twenty-second position represents a G Locked Nucleic Acid base.
[0084] SEQ ID NO: 83 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crDNA) that includes
phosphorothioate bonds near the 5' end of its nucleotide sequence.
In the sequence listing, a first N at the 5' end represents a G
deoxyribonucleotide with a phosphorothioate bond, second N
represents a C deoxyribonucleotide with a phosphorothioate bond and
third N represents a G deoxyribonucleotide with a phosphorothioate
bond.
[0085] SEQ ID NO: 84 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crDNA) that includes
2'-O-Methyl RNA nucleotides near the 5' end of its nucleotide
sequence. In the sequence listing, a first N at the 5' end
represents a G 2'-O-Methyl ribonucleotide, second N represents a C
2'-O-Methyl ribonucleotide and third N represents a G 2'-O-Methyl
ribonucleotide.
[0086] SEQ ID NO: 85 is the nucleotide sequence of a CER domain of
a crNucleotide (crDNA) that includes 2'-O-Methyl RNA nucleotides
near the 3' end of the nucleotide sequence. In the sequence
listing, a N at the twentieth position represents a U 2'-O-Methyl
ribonucleotide, a N at the twenty-first position represents a U
2'-O-Methyl ribonucleotide and a N at the twenty-second position
represent G 2'-O-Methyl ribonucleotide.
[0087] SEQ ID NO: 86 is the nucleotide sequence of a variable
targeting domain of a crNucleotide (crDNA) that includes
2'-O-Methyl RNA nucleotides at each nucleotide except T of its
nucleotide sequence. In the sequence listing, a first N at the 5'
end represents a G 2'-O-Methyl ribonucleotide, a N at the second
position represents a C 2'-O-Methyl ribonucleotide, a N at the
third position represents a G 2'-O-Methyl ribonucleotide, a N at
the fifth position represents an A 2'-O-Methyl ribonucleotide, a N
at the sixth position represents a C 2'-O-Methyl ribonucleotide, a
N at the seventh position represents a G 2'-O-Methyl
ribonucleotide, a N at the eighth position represents a C
2'-O-Methyl ribonucleotide, a N at the ninth position represents a
G 2'-O-Methyl ribonucleotide, a N at the eleventh position
represents an A 2'-O-Methyl ribonucleotide, a N at the twelfth
position represents C 2'-O-Methyl ribonucleotide, a N at the
thirteenth position represents a G 2'-O-Methyl ribonucleotide, a N
at the fifteenth position represents a G 2'-O-Methyl ribonucleotide
and a N at the seventeenth position represents a G 2'-O-Methyl
ribonucleotide.
[0088] SEQ ID NO: 87 is the nucleotide sequence of a CER domain of
a crNucleotide (crDNA) that includes 2'-O-Methyl RNA nucleotides at
each nucleotide except T the nucleotide sequence. In the sequence
listing, a first N at the 5' end represents a G 2'-O-Methyl
ribonucleotide, a N at the sixth position represents an A
2'-O-Methyl ribonucleotide, a N at the seventh position represents
a G 2'-O-Methyl ribonucleotide, a N at the eighth position
represents an A 2'-O-Methyl ribonucleotide, a N at the ninth
position represents a G 2'-O-Methyl ribonucleotide, a N at the
tenth position represents a C 2'-O-Methyl ribonucleotide, a N at
the twelfth position represents an A 2'-O-Methyl ribonucleotide, a
N at the fourteenth position represents a G 2'-O-Methyl
ribonucleotide, a N at the fifteenth position represents a C
2'-O-Methyl ribonucleotide, a N at the seventeenth position
represents a G 2'-O-Methyl ribonucleotide and a N at the
twenty-second position represents a G 2'-O-Methyl
ribonucleotide.
[0089] SEQ ID NO: 88 is the nucleotide sequence of the
Saccharomyces cerevisiae codon optimized Cas9.
[0090] SEQ ID NO: 89 is the nucleotide sequence of the T7 promoter
from bacteriophage T7.
[0091] SEQ ID NO: 90 is the nucleotide sequence of the ADE:URA3:DE2
target sequence (PAM sequence not included)
[0092] SEQ ID NO: 91-95 are the nucleotide sequences of Cas9
endonucleases.
[0093] SEQ ID NO: 96 is the nucleotide sequence of a single guide
RNA targeting the LIGCas-3 target sequence (FIG. 3B).
DETAILED DESCRIPTION
[0094] The present disclosure includes compositions and methods for
genome modification of a target sequence in the genome of a cell.
The methods and compositions employ a guide polynucleotide/Cas
endonuclease system to provide an effective system for modifying
target sites within the genome of a cell. Cells include, but are
not limited to, animal, bacterial, fungal, insect, yeast, and plant
cells as well as plants and seeds produced by the methods described
herein. Once a genomic target site is identified, a variety of
methods can be employed to further modify the target sites such
that they contain a variety of polynucleotides of interest.
Breeding methods utilizing a guide polynucleotide/Cas endonuclease
system are also disclosed. Compositions and methods are also
provided for editing a nucleotide sequence in the genome of a cell.
The nucleotide sequence to be edited (the nucleotide sequence of
interest) can be located within or outside a target site that is
recognized by a Cas endonuclease.
[0095] CRISPR loci (Clustered Regularly Interspaced Short
Palindromic Repeats) (also known as SPIDRs--SPacer Interspersed
Direct Repeats) constitute a family of recently described DNA loci.
CRISPR loci consist of short and highly conserved DNA repeats
(typically 24 to 40 bp, repeated from 1 to 140 times-also referred
to as CRISPR-repeats) which are partially palindromic. The repeated
sequences (usually specific to a species) are interspaced by
variable sequences of constant length (typically 20 to 58 by
depending on the CRISPR locus (WO2007/025097 published Mar. 1,
2007).
[0096] CRISPR loci were first recognized in E. coli (Ishino et al.
(1987) J. Bacterial. 169:5429-5433; Nakata et al. (1989) J.
Bacterial. 171:3553-3556). Similar interspersed short sequence
repeats have been identified in Haloferax mediterranei,
Streptococcus pyogenes, Anabaena, and Mycobacterium tuberculosis
(Groenen et al. (1993) Mol. Microbiol. 10:1057-1065; Hoe et al.
(1999) Emerg. Infect. Dis. 5:254-263; Masepohl et al. (1996)
Biochim. Biophys. Acta 1307:26-30; Mojica et al. (1995) Mol.
Microbiol. 17:85-93). The CRISPR loci differ from other SSRs by the
structure of the repeats, which have been termed short regularly
spaced repeats (SRSRs) (Janssen et al. (2002) OMICS J. Integ. Biol.
6:23-33; Mojica et al. (2000) Mol. Microbiol. 36:244-246). The
repeats are short elements that occur in clusters, that are always
regularly spaced by variable sequences of constant length (Mojica
et al. (2000) Mol. Microbiol. 36:244-246).
[0097] Cas gene includes a gene that is generally coupled,
associated or close to or in the vicinity of flanking CRISPR loci.
The terms "Cas gene", "CRISPR-associated (Cas) gene" are used
interchangeably herein. A comprehensive review of the Cas protein
family is presented in Haft et al. (2005) Computational Biology,
PLoS Comput Biol 1(6): e60. doi:10.1371/journal.pcbi.0010060. As
described therein, 41 CRISPR-associated (Cas) gene families are
described, in addition to the four previously known gene families.
It shows that CRISPR systems belong to different classes, with
different repeat patterns, sets of genes, and species ranges. The
number of Cas genes at a given CRISPR locus can vary between
species.
[0098] Cas endonuclease relates to a Cas protein encoded by a Cas
gene, wherein said Cas protein is capable of introducing a double
strand break into a DNA target sequence. The Cas endonuclease
unwinds the DNA duplex in close proximity of the genomic target
site and cleaves both DNA strands upon recognition of a target
sequence by a guide polynucleotide, but only if the correct
protospacer-adjacent motif (PAM) is approximately oriented at the
3' end of the target sequence (FIG. 3A, FIG. 3B).
[0099] In one embodiment, the Cas endonuclease is a Cas9
endonuclease that is capable of introducing a double strand break
at a DNA target site, wherein the DNA cleavage at a specific
location is enabled by a) base-pairing complementary between the
DNA target site and the variable targeting domain of the guide
polynucleotide, and b) the presence of a short protospacer adjacent
motif (PAM) immediately adjacent to the DNA target site.
[0100] In one embodiment, the Cas endonuclease gene is a Cas9
endonuclease, such as but not limited to, Cas9 genes listed in SEQ
ID NOs: 462, 474, 489, 494, 499, 505, and 518 of WO2007/025097
published Mar. 1, 2007, and incorporated herein by reference. In
another embodiment, the Cas endonuclease gene is plant, maize or
soybean optimized Cas9 endonuclease (FIG. 1 A). In another
embodiment, the Cas endonuclease gene is operably linked to a SV40
nuclear targeting signal upstream of the Cas codon region and a
bipartite VirD2 nuclear localization signal (Tinland et al. (1992)
Proc. Natl. Acad. Sci. USA 89:7442-6) downstream of the Cas codon
region.
[0101] In one embodiment, the Cas endonuclease gene is a Cas9
endonuclease gene of SEQ ID NO: 1, 91, 92, 93, 94, 95 or
nucleotides 2037-6329 of SEQ ID N0:5, or any functional fragment or
variant thereof.
[0102] The terms "functional fragment", "fragment that is
functionally equivalent" and "functionally equivalent fragment" are
used interchangeably herein. These terms refer to a portion or
subsequence of a Cas endonuclease sequence in which the ability to
create a double-strand break is retained.
[0103] The terms "functional variant", "Variant that is
functionally equivalent" and "functionally equivalent variant" are
used interchangeably herein. These terms refer to a variant of the
Cas endonuclease in which the ability create a double-strand break
is retained. Fragments and variants can be obtained via methods
such as site-directed mutagenesis and synthetic construction.
[0104] In one embodiment, the Cas endonuclease gene is a plant
codon optimized streptococcus pyogenes Cas9 gene that can recognize
any genomic sequence of the form N(12-30)NGG can in principle be
targeted.
[0105] Endonucleases are enzymes that cleave the phosphodiester
bond within a polynucleotide chain, and include restriction
endonucleases that cleave DNA at specific sites without damaging
the bases. Restriction endonucleases include Type I, Type II, Type
III, and Type IV endonucleases, which further include subtypes. In
the Type I and Type III systems, both the methylase and restriction
activities are contained in a single complex. Endonucleases also
include meganucleases, also known as homing endonucleases (HEases),
which like restriction endonucleases, bind and cut at a specific
recognition site, however the recognition sites for meganucleases
are typically longer, about 18 bp or more. (patent application
WO-PCT PCT/US12/30061 filed on Mar. 22, 2012) Meganucleases have
been classified into four families based on conserved sequence
motifs (Belfort M, and Perlman P S J. Biol. Chem. 1995;
270:30237-30240). These motifs participate in the coordination of
metal ions and hydrolysis of phosphodiester bonds. HEases are
notable for their long recognition sites, and for tolerating some
sequence polymorphisms in their DNA substrates. The naming
convention for meganuclease is similar to the convention for other
restriction endonuclease. Meganucleases are also characterized by
prefix F-, I-, or PI- for enzymes encoded by free-standing ORFs,
introns, and inteins, respectively. One step in the recombination
process involves polynucleotide cleavage at or near the recognition
site. This cleaving activity can be used to produce a double-strand
break. For reviews of site-specific recombinases and their
recognition sites, see, Sauer (1994) Curr Op Biotechnol 5:521-7;
and Sadowski (1993) FASEB 7:760-7. In some examples the recombinase
is from the Integrase or Resolvase families.
[0106] TAL effector nucleases are a new class of sequence-specific
nucleases that can be used to make double-strand breaks at specific
target sequences in the genome of a plant or other organism.
(Miller et al. (2011) Nature Biotechnology 29:143-148). Zinc finger
nucleases (ZFNs) include engineered double-strand break inducing
agents comprised of a zinc finger DNA binding domain and a
double-strand-break-inducing agent domain. Recognition site
specificity is conferred by the zinc finger domain, which typically
comprising two, three, or four zinc fingers, for example having a
C2H2 structure, however other zinc finger structures are known and
have been engineered. Zinc finger domains are amenable for
designing polypeptides which specifically bind a selected
polynucleotide recognition sequence. ZFNs consist of an engineered
DNA-binding zinc finger domain linked to a non-specific
endonuclease domain, for example nuclease domain from a Type IIs
endonuclease such as FokI. Additional functionalities can be fused
to the zinc-finger binding domain, including transcriptional
activator domains, transcription repressor domains, and methylases.
In some examples, dimerization of nuclease domain is required for
cleavage activity. Each zinc finger recognizes three consecutive
base pairs in the target DNA. For example, a 3 finger domain
recognized a sequence of 9 contiguous nucleotides, with a
dimerization requirement of the nuclease, two sets of zinc finger
triplets are used to bind a 18 nucleotide recognition sequence.
[0107] In one embodiment of the disclosure, the composition
comprises a plant or seed comprising a guide polynucleotide and a
Cas9 endonuclease, wherein said guide polynucleotide does not
solely comprise ribonucleic acids, wherein said Cas9 endonuclease
and guide polynucleotide are capable of forming a complex and
creating a double strand break in a genomic target site of said
plant.
[0108] Bacteria and archaea have evolved adaptive immune defenses
termed Clustered Regularly Interspaced Short Palindromic Repeats
(CRISPR)/CRISPR-associated (Cas) systems that use short RNA to
direct degradation of foreign nucleic acids (WO2007/025097
published Mar. 1, 2007, and incorporated herein by reference.) The
type II CRISPR/Cas system from bacteria employs a crRNA and
tracrRNA to guide the Cas endonuclease to its DNA target. The crRNA
(CRISPR RNA) contains the region complementary to one strand of the
double strand DNA target and base pairs with the tracrRNA
(trans-activating CRISPR RNA) forming a RNA duplex that directs the
Cas endonuclease to cleave the DNA target.
[0109] As used herein, the term "guide polynucleotide", relates to
a polynucleotide sequence that can form a complex with a Cas
endonuclease and enables the Cas endonuclease to recognize and
optionally cleave a DNA target site. The guide polynucleotide can
be a single molecule or a double molecule. The guide polynucleotide
sequence can be a RNA sequence, a DNA sequence, or a combination
thereof (a RNA-DNA combination sequence). Optionally, the guide
polynucleotide can comprise at least one nucleotide, phosphodiester
bond or linkage modification such as, but not limited, to Locked
Nucleic Acid (LNA), 5-methyl dC, 2,6-Diaminopurine, 2'-Fluoro A,
2'-Fluoro U, 2'-O-Methyl RNA, Phosphorothioate bond, linkage to a
cholesterol molecule, linkage to a polyethylene glycol molecule,
linkage to a spacer 18 (hexaethylene glycol chain) molecule, or 5'
to 3' covalent linkage resulting in circularization. In some
embodiment of this disclosure, the guide polynucleotide does not
solely comprise ribonucleic acids (RNAs). A guide polynucleotide
that solely comprises ribonucleic acids is also referred to as a
"guide RNA".
[0110] The guide polynucleotide can be a double molecule (also
referred to as duplex guide polynucleotide) comprising a first
nucleotide sequence domain (referred to as Variable Targeting
domain or VT domain) that is complementary to a nucleotide sequence
in a target DNA and a second nucleotide sequence domain (referred
to as Cas endonuclease recognition domain or CER domain) that
interacts with a Cas endonuclease polypeptide (FIG. 1A). The CER
domain of the double molecule guide polynucleotide comprises two
separate molecules that are hybridized along a region of
complementarity (FIG. 1A). The two separate molecules can be RNA,
DNA, and/or RNA-DNA-combination sequences. In one embodiment of
this disclosure, the duplex guide polynucleotide does not solely
comprise ribonucleic acids (RNAs) as show in, for example, but not
limiting to, FIG. 3A). In some embodiments, the first molecule of
the duplex guide polynucleotide comprising a VT domain linked to a
CER domain (shown as "crNucleotide" in FIG. 1A) is referred to as
"crDNA" (when composed of a contiguous stretch of DNA nucleotides)
or "crRNA" (when composed of a contiguous stretch of RNA
nucleotides), or "crDNA-RNA" (when composed of a combination of DNA
and RNA nucleotides). In some embodiments the second molecule of
the duplex guide polynucleotide comprising a CER domain (shown as
tracrNucleotide in FIG. 1A) is referred to as "tracrRNA" (when
composed of a contiguous stretch of RNA nucleotides) or "tracrDNA"
(when composed of a contiguous stretch of DNA nucleotides) or
"tracrDNA-RNA" (when composed of a combination of DNA and RNA
nucleotides).
[0111] The guide polynucleotide can also be a single molecule
comprising a first nucleotide sequence domain (referred to as
Variable Targeting domain or VT domain) that is complementary to a
nucleotide sequence in a target DNA and a second nucleotide domain
(referred to as Cas endonuclease recognition domain or CER domain)
that interacts with a Cas endonuclease polypeptide (FIG. 1 B). By
"domain" it is meant a contiguous stretch of nucleotides that can
be RNA, DNA, and/or RNA-DNA-combination sequence. The VT domain
and/or the CER domain of a single guide polynucleotide can comprise
a RNA sequence, a DNA sequence, or a RNA-DNA-combination sequence.
In some embodiments the single guide polynucleotide comprises a
crNucleotide (comprising a VT domain linked to a CER domain) linked
to a tracrNucleotide (comprising a CER domain), wherein the linkage
is a nucleotide sequence comprising a RNA sequence, a DNA sequence,
or a RNA-DNA combination sequence (FIG. 1B). The single guide
polynucleotide being comprised of sequences from the crNucleotide
and tracrNucleotide may be referred to as "single guide RNA" (when
composed of a contiguous stretch of RNA nucleotides) or "single
guide DNA" (when composed of a contiguous stretch of DNA
nucleotides) or "single guide RNA-DNA" (when composed of a
combination of RNA and DNA nucleotides).
[0112] One advantage of using a single guide polynucleotide versus
a duplex guide polynucleotide is that only one expression cassette
needs to be made to express the single guide polynucleotide.
[0113] The term "variable targeting domain" or "VT domain" is used
interchangeably herein and refers to a nucleotide sequence that is
complementary to one strand (nucleotide sequence) of a double
strand DNA target site. The % complementation between the first
nucleotide sequence domain (VT domain) and the target sequence can
be at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%,
61%, 62%, 63%, 63%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%,
74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or
100%. The variable target domain can be at least 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30
nucleotides in length. In some embodiments, the variable targeting
domain comprises a contiguous stretch of 12 to 30 nucleotides. The
variable targeting domain can be composed of a DNA sequence, a RNA
sequence, a modified DNA sequence, a modified RNA sequence (see for
example modifications described herein), or any combination
thereof.
[0114] The term "Cas endonuclease recognition domain" or "CER
domain" of a guide polynucleotide is used interchangeably herein
and relates to a nucleotide sequence (such as a second nucleotide
sequence domain of a guide polynucleotide), that interacts with a
Cas endonuclease polypeptide. The CER domain can be composed of a
DNA sequence, a RNA sequence, a modified DNA sequence, a modified
RNA sequence (see for example modifications described herein), or
any combination thereof.
[0115] The nucleotide sequence linking the crNucleotide and the
tracrNucleotide of a single guide polynucleotide can comprise a RNA
sequence, a DNA sequence, or a RNA-DNA combination sequence. In one
embodiment, the nucleotide sequence linking the crNucleotide and
the tracrNucleotide of a single guide polynucleotide can be at
least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53,
54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70,
71, 72, 73, 74, 75, 76, 77, 78, 78, 79, 80, 81, 82, 83, 84, 85, 86,
87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100
nucleotides in length. In another embodiment, the nucleotide
sequence linking the crNucleotide and the tracrNucleotide of a
single guide polynucleotide can comprise a tetraloop sequence, such
as, but not limiting to a GAAA tetraloop sequence.
[0116] Nucleotide sequence modification of the guide
polynucleotide, VT domain and/or CER domain can be selected from,
but not limited to, the group consisting of a 5' cap, a 3'
polyadenylated tail, a riboswitch sequence, a stability control
sequence, a sequence that forms a dsRNA duplex, a modification or
sequence that targets the guide poly nucleotide to a subcellular
location, a modification or sequence that provides for tracking, a
modification or sequence that provides a binding site for proteins,
a Locked Nucleic Acid (LNA), a 5-methyl dC nucleotide, a
2,6-Diaminopurine nucleotide, a 2'-Fluoro A nucleotide, a 2'-Fluoro
U nucleotide; a 2'-O-Methyl RNA nucleotide, a phosphorothioate
bond, linkage to a cholesterol molecule, linkage to a polyethylene
glycol molecule, linkage to a spacer 18 molecule, a 5' to 3'
covalent linkage, or any combination thereof. These modifications
can result in at least one additional beneficial feature, wherein
the additional beneficial feature is selected from the group of a
modified or regulated stability, a subcellular targeting, tracking,
a fluorescent label, a binding site for a protein or protein
complex, modified binding affinity to complementary target
sequence, modified resistance to cellular degradation, and
increased cellular permeability.
[0117] In one embodiment of the disclosure, the composition
comprises a guide polynucleotide comprising: (i) a first nucleotide
sequence domain (VT domain) that is complementary to a nucleotide
sequence in a target DNA; and, (ii) a second nucleotide sequence
domain (CER domain) that interacts with a Cas endonuclease, wherein
the first nucleotide sequence domain and the second nucleotide
sequence domain are composed of deoxyribonucleic acids (DNA),
ribonucleic acids (RNA), or a combination thereof, wherein the
guide polynucleotide does not solely comprise ribonucleic acids.
The % complementation between the first nucleotide sequence domain
(Variable Targeting domain) and the target sequence can be at least
50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%,
63%, 63%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%,
76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%,
89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
[0118] In one embodiment of the disclosure, the first nucleotide
sequence domain (VT domain) and the second nucleotide sequence
domain (CER domain) of the guide polynucleotide are located on a
single molecule. In another embodiment, the second nucleotide
sequence domain (Cas Endonuclease Recognition domain) comprises two
separate molecules that are capable of hybridizing along a region
of complementarity.
[0119] In another embodiment, the composition comprises a guide
polynucleotide, wherein the first nucleotide sequence domain is a
DNA sequence and the second nucleotide sequence domain is selected
from the group consisting of a DNA sequence, a RNA sequence, and a
combination thereof.
[0120] In one embodiment, the composition comprises a guide
polynucleotide, wherein the first nucleotide sequence domain (VT
domain) is a DNA sequence and the second nucleotide sequence domain
(CER domain) is selected from the group consisting of a DNA
sequence, a RNA sequence, and a combination thereof.
[0121] The guide polynucleotide and Cas endonuclease are capable of
forming a complex, referred to as the "guide polynucleotide/Cas
endonuclease complex", that enables the Cas endonuclease to
introduce a double strand break at a DNA target site.
[0122] In one embodiment, the composition comprises a guide
polynucleotide/Cas endonuclease complex wherein the guide
polynucleotide comprises (i) a first nucleotide sequence domain
that is complementary to a nucleotide sequence in a target DNA; and
(ii) a second nucleotide sequence domain that interacts with a Cas
endonuclease, wherein said guide polynucleotide does not solely
comprise ribonucleic acids, wherein said guide polynucleotide and
Cas endonuclease are capable of forming a complex that enables the
Cas endonuclease to introduce a double strand break at said target
site.
[0123] In another embodiment, the composition comprises a guide
polynucleotide/Cas endonuclease complex, wherein the first
nucleotide sequence domain (VT domain) and the second nucleotide
sequence domain (CER domain) of the guide polynucleotide are
composed of deoxyribonucleic acids (DNA), ribonucleic acids (RNA),
or a combination thereof, wherein the guide polynucleotide does not
solely comprise ribonucleic acids.
[0124] In one embodiment the guide polynucleotide can be introduce
into the plant cell directly using particle bombardment.
[0125] When the guide polynucleotide comprises solely of RNA
sequences (also referred to as "guide RNA") it can be introduced
indirectly by introducing a recombinant DNA molecule comprising the
corresponding guide DNA sequence operably linked to a plant
specific promoter that is capable of transcribing the guide
polynucleotide in said plant cell. The term "corresponding guide
DNA" refers to a DNA molecule that is identical to the RNA molecule
but has a "T" substituted for each "U" of the RNA molecule.
[0126] In some embodiments, the guide polynucleotide is introduced
via particle bombardment or Agrobacterium transformation of a
recombinant DNA construct comprising the corresponding guide DNA
operably linked to a plant U6 polymerase III promoter.
[0127] The terms "target site", "target sequence", "target DNA",
"target locus", "genomic target site", "genomic target sequence",
and "genomic target locus" are used interchangeably herein and
refer to a polynucleotide sequence in the genome (including
choloroplastic and mitochondrial DNA) of a cell at which a
double-strand break is induced in the cell genome by a Cas
endonuclease. The target site can be an endogenous site in the
genome of an cell or organism, or alternatively, the target site
can be heterologous to the cell or organism and thereby not be
naturally occurring in the genome, or the target site can be found
in a heterologous genomic location compared to where it occurs in
nature. As used herein, terms "endogenous target sequence" and
"native target sequence" are used interchangeable herein to refer
to a target sequence that is endogenous or native to the genome of
a cell or organism and is at the endogenous or native position of
that target sequence in the genome of a cell or organism. Cells
include, but are not limited to animal, bacterial, fungal, insect,
yeast, and plant cells as well as plants and seeds produced by the
methods described herein.
[0128] In one embodiments, the target site can be similar to a DNA
recognition site or target site that that is specifically
recognized and/or bound by a double-strand break inducing agent
such as a LIG3-4 endonuclease (US patent publication 2009-0133152
A1 (published May 21, 2009) or a MS26++ meganuclease (U.S. patent
application Ser. No. 13/526,912 filed Jun. 19, 2012).
[0129] An "artificial target site" or "artificial target sequence"
are used interchangeably herein and refer to a target sequence that
has been introduced into the genome of a cell or organism, such as
but not limiting to a plant or yeast. Such an artificial target
sequence can be identical in sequence to an endogenous or native
target sequence in the genome of a cell but be located in a
different position (i.e., a non-endogenous or non-native position)
in the genome of a cell or organism.
[0130] An "altered target site", "altered target sequence",
"modified target site", "modified target sequence" are used
interchangeably herein and refer to a target sequence as disclosed
herein that comprises at least one alteration when compared to
non-altered target sequence. Such "alterations" include, for
example: (i) replacement of at least one nucleotide, (ii) a
deletion of at least one nucleotide, (iii) an insertion of at least
one nucleotide, or (iv) any combination of (i)-(iii).
[0131] Methods for modifying a genomic target site of an organism
such as but not limiting to a plant or yeast are disclosed
herein.
[0132] In one embodiment, a method for modifying a target site in
the genome of a plant cell comprises introducing a guide
polynucleotide into a cell having a Cas endonuclease, wherein said
guide polynucleotide does not solely comprise ribonucleic acids,
wherein said guide polynucleotide and Cas endonuclease are capable
of forming a complex that enables the Cas endonuclease to introduce
a double strand break at said target site. This method can further
comprise further comprising identifying at least one cell that has
a modification at said target, wherein the modification at said
target site is selected from the group consisting of (i) a
replacement of at least one nucleotide, (ii) a deletion of at least
one nucleotide, (iii) an insertion of at least one nucleotide, and
(iv) any combination of (i)-(iii). This method can also further
comprise introducing a donor DNA to said cell, wherein said donor
DNA comprises a polynucleotide of interest.
[0133] Further provided is a method for method for modifying a
target site in the genome of a cell, the method comprising
introducing a guide polynucleotide and a Cas endonuclease into a
cell, wherein said guide polynucleotide does not solely comprise
ribonucleic acids, wherein said guide polynucleotide and Cas
endonuclease are capable of forming a complex that enables the Cas
endonuclease to introduce a double strand break at said target
site. This method can further comprise further comprising
identifying at least one cell that has a modification at said
target, wherein the modification at said target site is selected
from the group consisting of (i) a replacement of at least one
nucleotide, (ii) a deletion of at least one nucleotide, (iii) an
insertion of at least one nucleotide, and (iv) any combination of
(i)-(iii). This method can also further comprise introducing a
donor DNA to said cell, wherein said donor DNA comprises a
polynucleotide of interest.
[0134] Further provided is a method for modifying a target site in
the genome of a cell, the method comprising: a) introducing into a
cell a crNucleotide, a first recombinant DNA construct capable of
expressing a tracrRNA, and a second recombinant DNA capable of
expressing a Cas endonuclease, wherein said crNucleotide is a
deoxyribonucleotide sequence or a combination of a
deoxyribonucleotide and ribonucleotide sequence, wherein said
crNucleotide, said tracrRNA and said Cas endonuclease are capable
of forming a complex that enables the Cas endonuclease to introduce
a double strand break at said target site; and, b) identifying at
least one cell that has a modification at said target site, wherein
the modification is selected from the group consisting of (i) a
replacement of at least one nucleotide, (ii) a deletion of at least
one nucleotide, (iii) an insertion of at least one nucleotide, and
(iv) any combination of (i)-(iii).
[0135] Further provided is a method for method for modifying a
target site in the genome of a cell, the method comprising: a)
introducing into a cell a tracrNucleotide, a first recombinant DNA
construct capable of expressing a crRNA and a second recombinant
DNA capable of expressing a Cas endonuclease, wherein said
tracrNucleotide is selected a deoxyribonucleotide sequence or a
combination of a deoxyribonucleotide and ribonucleotide sequence,
wherein said tracrNucleotide, said crRNA and said Cas endonuclease
are capable of forming a complex that enables the Cas endonuclease
to introduce a double strand break at said target site; and, b)
identifying at least one cell that has a modification at said
target site, wherein the modification is selected from the group
consisting of (i) a replacement of at least one nucleotide, (ii) a
deletion of at least one nucleotide, (iii) an insertion of at least
one nucleotide, and (iv) any combination of (i)-(iii).
[0136] The length of the target site can vary, and includes, for
example, target sites that are at least 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides
in length. It is further possible that the target site can be
palindromic, that is, the sequence on one strand reads the same in
the opposite direction on the complementary strand. The
nick/cleavage site can be within the target sequence or the
nick/cleavage site could be outside of the target sequence. In
another variation, the cleavage could occur at nucleotide positions
immediately opposite each other to produce a blunt end cut or, in
other cases, the incisions could be staggered to produce
single-stranded overhangs, also called "sticky ends", which can be
either 5' overhangs, or 3' overhangs.
[0137] Active variants of genomic target sites can also be used.
Such active variants can comprise at least 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or
more sequence identity to the given target site, wherein the active
variants retain biological activity and hence are capable of being
recognized and cleaved by a Cas endonuclease. Assays to measure the
double-strand break of a target site by an endonuclease are known
in the art and generally measure the overall activity and
specificity of the agent on DNA substrates containing recognition
sites.
[0138] Various methods and compositions can be employed to obtain a
cell or organism having a polynucleotide of interest inserted in a
target site for a Cas endonuclease. Such methods can employ
homologous recombination to provide integration of the
polynucleotide of Interest at the target site. In one method
provided, a polynucleotide of interest is provided to the cell in a
donor DNA construct. As used herein, "donor DNA" is a DNA construct
that comprises a polynucleotide of Interest to be inserted into the
target site of a cas endonuclease. Optionally, the donor DNA
construct can further comprise a first and a second region of
homology that flank the polynucleotide of Interest. The first and
second regions of homology of the donor DNA share homology to a
first and a second genomic region, respectively, present in or
flanking the target site of the plant genome. By "homology" is
meant DNA sequences that are similar. For example, a "region of
homology to a genomic region" that is found on the donor DNA is a
region of DNA that has a similar sequence to a given "genomic
region" in the plant genome. A region of homology can be of any
length that is sufficient to promote homologous recombination at
the cleaved target site. For example, the region of homology can
comprise at least 5-10, 5-15, 5-20, 5-25, 5-30, 5-35, 5-40, 5-45,
5-50, 5-55, 5-60, 5-65, 5-70, 5-75, 5-80, 5-85, 5-90, 5-95, 5-100,
5-200, 5-300, 5-400, 5-500, 5-600, 5-700, 5-800, 5-900, 5-1000,
5-1100, 5-1200, 5-1300, 5-1400, 5-1500, 5-1600, 5-1700, 5-1800,
5-1900, 5-2000, 5-2100, 5-2200, 5-2300, 5-2400, 5-2500, 5-2600,
5-2700, 5-2800, 5-2900, 5-3000, 5-3100 or more bases in length such
that the region of homology has sufficient homology to undergo
homologous recombination with the corresponding genomic region.
"Sufficient homology" indicates that two polynucleotide sequences
have sufficient structural similarity to act as substrates for a
homologous recombination reaction. The structural similarity
includes overall length of each polynucleotide fragment, as well as
the sequence similarity of the polynucleotides. Sequence similarity
can be described by the percent sequence identity over the whole
length of the sequences, and/or by conserved regions comprising
localized similarities such as contiguous nucleotides having 100%
sequence identity, and percent sequence identity over a portion of
the length of the sequences.
[0139] The amount of homology or sequence identity shared by a
target and a donor polynucleotide can vary and includes total
lengths and/or regions having unit integral values in the ranges of
about 1-20 bp, 20-50 bp, 50-100 bp, 75-150 bp, 100-250 bp, 150-300
bp, 200-400 bp, 250-500 bp, 300-600 bp, 350-750 bp, 400-800 bp,
450-900 bp, 500-1000 bp, 600-1250 bp, 700-1500 bp, 800-1750 bp,
900-2000 bp, 1-2.5 kb, 1.5-3 kb, 2-4 kb, 2.5-5 kb, 3-6 kb, 3.5-7
kb, 4-8 kb, 5-10 kb, or up to and including the total length of the
target site. These ranges include every integer within the range,
for example, the range of 1-20 bp includes 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 bp. The amount of
homology can also described by percent sequence identity over the
full aligned length of the two polynucleotides which includes
percent sequence identity of about at least 50%, 55%, 60%, 65%,
70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%,
83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%,
96%, 97%, 98%, 99% or 100%. Sufficient homology includes any
combination of polynucleotide length, global percent sequence
identity, and optionally conserved regions of contiguous
nucleotides or local percent sequence identity, for example
sufficient homology can be described as a region of 75-150 bp
having at least 80% sequence identity to a region of the target
locus. Sufficient homology can also be described by the predicted
ability of two polynucleotides to specifically hybridize under high
stringency conditions, see, for example, Sambrook et al., (1989)
Molecular Cloning: A Laboratory Manual, (Cold Spring Harbor
Laboratory Press, NY); Current Protocols in Molecular Biology,
Ausubel et al., Eds (1994) Current Protocols, (Greene Publishing
Associates, Inc. and John Wiley & Sons, Inc); and, Tijssen
(1993) Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes, (Elsevier, New
York).
[0140] As used herein, a "genomic region" is a segment of a
chromosome in the genome of a plant cell that is present on either
side of the target site or, alternatively, also comprises a portion
of the target site. The genomic region can comprise at least 5-10,
5-15, 5-20, 5-25, 5-30, 5-35, 5-40, 5-45, 5-50, 5-55, 5-60, 5-65,
5-70, 5-75, 5-80, 5-85, 5-90, 5-95, 5-100, 5-200, 5-300, 5-400,
5-500, 5-600, 5-700, 5-800, 5-900, 5-1000, 5-1100, 5-1200, 5-1300,
5-1400, 5-1500, 5-1600, 5-1700, 5-1800, 5-1900, 5-2000, 5-2100,
5-2200, 5-2300, 5-2400, 5-2500, 5-2600, 5-2700, 5-2800, 5-2900,
5-3000, 5-3100 or more bases such that the genomic region has
sufficient homology to undergo homologous recombination with the
corresponding region of homology.
[0141] The region of homology on the donor DNA can have homology to
any sequence flanking the target site. While in some embodiments
the regions of homology share significant sequence homology to the
genomic sequence immediately flanking the target site, it is
recognized that the regions of homology can be designed to have
sufficient homology to regions that may be further 5' or 3' to the
target site. In still other embodiments, the regions of homology
can also have homology with a fragment of the target site along
with downstream genomic regions. In one embodiment, the first
region of homology further comprises a first fragment of the target
site and the second region of homology comprises a second fragment
of the target site, wherein the first and second fragments are
dissimilar.
[0142] As used herein, "homologous recombination" refers to the
exchange of DNA fragments between two DNA molecules at the sites of
homology. The frequency of homologous recombination is influenced
by a number of factors. Different organisms vary with respect to
the amount of homologous recombination and the relative proportion
of homologous to non-homologous recombination. Generally, the
length of the region of homology affects the frequency of
homologous recombination events: the longer the region of homology,
the greater the frequency. The length of the homology region needed
to observe homologous recombination is also species-variable. In
many cases, at least 5 kb of homology has been utilized, but
homologous recombination has been observed with as little as 25-50
bp of homology. See, for example, Singer et al., (1982) Cell
31:25-33; Shen and Huang, (1986) Genetics 112:441-57; Watt et al.,
(1985) Proc. Natl. Acad. Sci. USA 82:4768-72, Sugawara and Haber,
(1992) Mol Cell Biol 12:563-75, Rubnitz and Subramani, (1984) Mol
Cell Biol 4:2253-8; Ayares et al., (1986) Proc. Natl. Acad. Sci.
USA 83:5199-203; Liskay et al., (1987) Genetics 115:161-7.
[0143] Alteration of the genome of a plant cell, for example,
through homologous recombination (HR), is a powerful tool for
genetic engineering. Despite the low frequency of homologous
recombination in higher plants, there are a few examples of
successful homologous recombination of plant endogenous genes. The
parameters for homologous recombination in plants have primarily
been investigated by rescuing introduced truncated selectable
marker genes. In these experiments, the homologous DNA fragments
were typically between 0.3 kb to 2 kb. Observed frequencies for
homologous recombination were on the order of 10.sup.-4 to
10.sup.-5. See, for example, Halfter et al., (1992) Mol Gen Genet
231:186-93; Offringa et al., (1990) EMBO J 9:3077-84; Offringa et
al., (1993) Proc. Natl. Acad. Sci. USA 90:7346-50; Paszkowski et
al., (1988) EMBO J 7:4021-6; Hourda and Paszkowski, (1994) Mol Gen
Genet 243:106-11; and Risseeuw et al., (1995) Plant J 7:109-19.
[0144] Homologous recombination has been demonstrated in insects.
In Drosophila, Dray and Gloor found that as little as 3 kb of total
template:target homology sufficed to copy a large non-homologous
segment of DNA into the target with reasonable efficiency (Dray and
Gloor, (1997) Genetics 147:689-99). Using FLP-mediated DNA
integration at a target FRT in Drosophila, Golic et al., showed
integration was approximately 10-fold more efficient when the donor
and target shared 4.1 kb of homology as compared to 1.1 kb of
homology (Golic et al., (1997) Nucleic Acids Res 25:3665). Data
from Drosophila indicates that 2-4 kb of homology is sufficient for
efficient targeting, but there is some evidence that much less
homology may suffice, on the order of about 30 bp to about 100 bp
(Nassif and Engels, (1993) Proc. Natl. Acad. Sci. USA 90:1262-6;
Keeler and Gloor, (1997) Mol Cell Biol 17:627-34).
[0145] Homologous recombination has also been accomplished in other
organisms. For example, at least 150-200 bp of homology was
required for homologous recombination in the parasitic protozoan
Leishmania (Papadopoulou and Dumas, (1997) Nucleic Acids Res
25:4278-86). In the filamentous fungus Aspergillus nidulans, gene
replacement has been accomplished with as little as 50 bp flanking
homology (Chaveroche et al., (2000) Nucleic Acids Res 28:e97).
Targeted gene replacement has also been demonstrated in the ciliate
Tetrahymena thermophila (Gaertig et al., (1994) Nucleic Acids Res
22:5391-8). In mammals, homologous recombination has been most
successful in the mouse using pluripotent embryonic stem cell lines
(ES) that can be grown in culture, transformed, selected and
introduced into a mouse embryo. Embryos bearing inserted transgenic
ES cells develop as genetically offspring. By interbreeding
siblings, homozygous mice carrying the selected genes can be
obtained. An overview of the process is provided in Watson et al.,
(1992) Recombinant DNA, 2nd Ed., (Scientific American Books
distributed by WH Freeman & Co.); Capecchi, (1989) Trends Genet
5:70-6; and Bronson, (1994) J Biol Chem 269:27155-8. Homologous
recombination in mammals other than mouse has been limited by the
lack of stem cells capable of being transplanted to oocytes or
developing embryos. However, McCreath et al., Nature 405:1066-9
(2000) reported successful homologous recombination in sheep by
transformation and selection in primary embryo fibroblast
cells.
[0146] Once a double-strand break is induced in the DNA, the cell's
DNA repair mechanism is activated to repair the break. Error-prone
DNA repair mechanisms can produce mutations at double-strand break
sites. The most common repair mechanism to bring the broken ends
together is the nonhomologous end-joining (NHEJ) pathway (Bleuyard
et al., (2006) DNA Repair 5:1-12). The structural integrity of
chromosomes is typically preserved by the repair, but deletions,
insertions, or other rearrangements are possible (Siebert and
Puchta, (2002) Plant Cell 14:1121-31; Pacher et al., (2007)
Genetics 175:21-9). The two ends of one double-strand break are the
most prevalent substrates of NHEJ (Kirik et al., (2000) EMBO J
19:5562-6), however if two different double-strand breaks occur,
the free ends from different breaks can be ligated and result in
chromosomal deletions (Siebert and Puchta, (2002) Plant Cell
14:1121-31), or chromosomal translocations between different
chromosomes (Pacher et al., (2007) Genetics 175:21-9).
[0147] Episomal DNA molecules can also be ligated into the
double-strand break, for example, integration of T-DNAs into
chromosomal double-strand breaks (Chilton and Que, (2003) Plant
Physiol 133:956-65; Salomon and Puchta, (1998) EMBO J 17:6086-95).
Once the sequence around the double-strand breaks is altered, for
example, by exonuclease activities involved in the maturation of
double-strand breaks, gene conversion pathways can restore the
original structure if a homologous sequence is available, such as a
homologous chromosome in non-dividing somatic cells, or a sister
chromatid after DNA replication (Molinier et al., (2004) Plant Cell
16:342-52). Ectopic and/or epigenic DNA sequences may also serve as
a DNA repair template for homologous recombination (Puchta, (1999)
Genetics 152:1173-81).
[0148] Alternatively, the double-strand break can be repaired by
homologous recombination between homologous DNA sequences. Once the
sequence around the double-strand break is altered, for example, by
exonuclease activities involved in the maturation of double-strand
breaks, gene conversion pathways can restore the original structure
if a homologous sequence is available, such as a homologous
chromosome in non-dividing somatic cells, or a sister chromatid
after DNA replication (Molinier et al., (2004) Plant Cell
16:342-52). Ectopic and/or epigenic DNA sequences may also serve as
a DNA repair template for homologous recombination (Puchta, (1999)
Genetics 152:1173-81).
[0149] DNA double-strand breaks appear to be an effective factor to
stimulate homologous recombination pathways (Puchta et al., (1995)
Plant Mol Biol 28:281-92; Tzfira and White, (2005) Trends
Biotechnol 23:567-9; Puchta, (2005) J Exp Bot 56:1-14). Using
DNA-breaking agents, a two- to nine-fold increase of homologous
recombination was observed between artificially constructed
homologous DNA repeats in plants (Puchta et al., (1995) Plant Mol
Biol 28:281-92). In maize protoplasts, experiments with linear DNA
molecules demonstrated enhanced homologous recombination between
plasmids (Lyznik et al., (1991) Mol Gen Genet 230:209-18).
[0150] In some embodiments, the methods provided herein comprise
contacting a cell with a donor DNA and a Cas endonuclease. Once a
double-strand break is introduced in the target site by the Cas
endonuclease, the first and second regions of homology of the donor
DNA can undergo homologous recombination with their corresponding
genomic regions of homology resulting in exchange of DNA between
the donor and the genome.
[0151] As such, the provided methods result in the integration of
the polynucleotide of interest of the donor DNA into the
double-strand break in the target site in the genome of a cell or
organism, thereby altering the original target site and producing
an altered genomic target site.
[0152] In one embodiment of the disclosure, the method comprises a
method for introducing a polynucleotide of interest into a target
site in the genome of a cell, the method comprising: a) introducing
a guide polynucleotide, a donor DNA and a Cas endonuclease into a
cell, wherein said guide polynucleotide does not solely comprise
ribonucleic acids, wherein said guide polynucleotide and Cas
endonuclease are capable of forming a complex that enables the Cas
endonuclease to introduce a double strand break at said target
site; b) contacting the cell of (a) with a donor DNA comprising a
polynucleotide of interest; and, c) identifying at least one cell
from (b) comprising in its genome the polynucleotide of interest
integrated at said target. The guide polynucleotide, Cas
endonuclease and donor DNA can be introduced by any means known in
the art. These means include, but are not limited to direct
delivery of each component via particle bombardment, delivery
through one or more recombinant DNA expression cassettes, or any
combination thereof.
[0153] In some embodiment of the disclosure, the method comprises a
method for introducing a polynucleotide of interest into a target
site in the genome of a cell, wherein the donor DNA and Cas
endonuclease are introduced into said cell using at least one
recombinant DNA construct capable of expressing the donor DNA
and/or the Cas endonuclease; and/or, wherein the guide
polynucleotide is introduced directly by particle bombardment.
[0154] In another embodiment of the disclosure, the method
comprises method for introducing a polynucleotide of interest into
a target site in the genome of a cell, the method comprising: a)
introducing into a cell a first recombinant DNA construct capable
of expressing a guide polynucleotide, and a second recombinant DNA
construct capable of expressing a Cas endonuclease, wherein said
guide polynucleotide does not solely comprise ribonucleic acids,
wherein said guide polynucleotide and Cas endonuclease are capable
of forming a complex that enables the Cas endonuclease to introduce
a double strand break at said target site; b) contacting the cell
of (a) with a donor DNA comprising a polynucleotide of interest;
and, c) identifying at least one cell from (b) comprising in its
genome the polynucleotide of interest integrated at said target
site.
[0155] The donor DNA may be introduced by any means known in the
art. For example, a cell or organism, such as but not limiting to a
plant or yeast having a target site is provided. The donor DNA may
be provided by any transformation method known in the art
including, for example, Agrobacterium-mediated transformation or
biolistic particle bombardment. The donor DNA may be present
transiently in the cell or it could be introduced via a viral
replicon. In the presence of the Cas endonuclease and the target
site, the donor DNA is inserted into the transformed genome.
[0156] Another approach uses protein engineering of existing homing
endonucleases to alter their target specificities. Homing
endonucleases, such as I-SceI or I-CreI, bind to and cleave
relatively long DNA recognition sequences (18 bp and 22 bp,
respectively). These sequences are predicted to naturally occur
infrequently in a genome, typically only 1 or 2 sites/genome. The
cleavage specificity of a homing endonuclease can be changed by
rational design of amino acid substitutions at the DNA binding
domain and/or combinatorial assembly and selection of mutated
monomers (see, for example, Arnould et al., (2006) J Mol Biol
355:443-58; Ashworth et al., (2006) Nature 441:656-9; Doyon et al.,
(2006) J Am Chem Soc 128:2477-84; Rosen et al., (2006) Nucleic
Acids Res 34:4791-800; and Smith et al., (2006) Nucleic Acids Res
34:e149; Lyznik et al., (2009) U.S. Patent Application Publication
No. 20090133152A1; Smith et al., (2007) U.S. Patent Application
Publication No. 20070117128A1). Engineered meganucleases have been
demonstrated that can cleave cognate mutant sites without
broadening their specificity. An artificial recognition site
specific to the wild type yeast I-SceI homing nuclease was
introduced in maize genome and mutations of the recognition
sequence were detected in 1% of analyzed F1 plants when a
transgenic I-SceI was introduced by crossing and activated by gene
excision (Yang et al., (2009) Plant Mol Biol 70:669-79). More
practically, the maize liguleless locus was targeted using an
engineered single-chain endonuclease designed based on the I-CreI
meganuclease sequence. Mutations of the selected liguleless locus
recognition sequence were detected in 3% of the T0 transgenic
plants when the designed homing nuclease was introduced by
Agrobacterium-mediated transformation of immature embryos (Gao et
al., (2010) Plant J 61:176-87).
[0157] Polynucleotides of interest are further described herein and
are reflective of the commercial markets and interests of those
involved in the development of the crop. Crops and markets of
interest change, and as developing nations open up world markets,
new crops and technologies will emerge also. In addition, as our
understanding of agronomic traits and characteristics such as yield
and heterosis increase, the choice of genetic engineering will
change accordingly.
Genome Editing Using the Guide Polynucleotide/Cas Endonuclease
System.
[0158] As described herein, the guide polynucleotide/Cas
endonuclease system can be used in combination with a co-delivered
polynucleotide modification template to allow for editing of a
genomic nucleotide sequence of interest. While numerous
double-strand break-making systems exist, their practical
applications for gene editing may be restricted due to the
relatively low frequency of induced double-strand breaks (DSBs). To
date, many genome modification methods rely on the homologous
recombination system. Homologous recombination (HR) can provide
molecular means for finding genomic DNA sequences of interest and
modifying them according to the experimental specifications.
Homologous recombination takes place in plant somatic cells at low
frequency. The process can be enhanced to a practical level for
genome engineering by introducing double-strand breaks (DSBs) at
selected endonuclease target sites. The challenge has been to
efficiently make DSBs at genomic sites of interest since there is a
bias in the directionality of information transfer between two
interacting DNA molecules (the broken one acts as an acceptor of
genetic information). Described herein is the use of a guide
polynucleotide/Cas system which provides flexible genome cleavage
specificity and results in a high frequency of double-strand breaks
at a DNA target site, thereby enabling efficient gene editing in a
nucleotide sequence of interest, wherein the nucleotide sequence of
interest to be edited can be located within or outside the target
site recognized and cleaved by a Cas endonuclease.
[0159] A "modified nucleotide" or "edited nucleotide" refers to a
nucleotide sequence of interest that comprises at least one
alteration when compared to its non-modified nucleotide sequence.
Such "alterations" include, for example: (i) replacement of at
least one nucleotide, (ii) a deletion of at least one nucleotide,
(iii) an insertion of at least one nucleotide, or (iv) any
combination of (i)-(iii).
[0160] The term "polynucleotide modification template" refers to a
polynucleotide that comprises at least one nucleotide modification
when compared to the nucleotide sequence to be edited. A nucleotide
modification can be at least one nucleotide substitution, addition
or deletion. Optionally, the polynucleotide modification template
can further comprise homologous nucleotide sequences flanking the
at least one nucleotide modification, wherein the flanking
homologous nucleotide sequences provide sufficient homology to the
desired nucleotide sequence to be edited.
[0161] In one embodiment, the disclosure describes a method for
editing a nucleotide sequence in the genome of a cell, the method
comprising introducing a guide polynucleotide, a polynucleotide
modification template and at least one Cas endonuclease into a
cell, wherein said guide polynucleotide does not solely comprise
ribonucleic acids, wherein the Cas endonuclease introduces a
double-strand break at a target site in the genome of said cell,
wherein said polynucleotide modification template comprises at
least one nucleotide modification of said nucleotide sequence.
Cells include, but are not limited to, animal, bacterial, fungal,
insect, yeast, and plant cells as well as plants and seeds produced
by the methods described herein. The nucleotide to be edited can be
located within or outside a target site recognized and cleaved by a
Cas endonuclease. In one embodiment, the at least one nucleotide
modification is not a modification at a target site recognized and
cleaved by a Cas endonuclease. In another embodiment, there are at
least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 40, 50, 100, 200, 300,
400, 500, 600, 700, 900 or 1000 nucleotides between the at least
one nucleotide to be edited and the genomic target site.
[0162] The nucleotide sequence to be edited can be a sequence that
is endogenous, artificial, pre-existing, or transgenic to the cell
that is being edited. For example, the nucleotide sequence in the
genome of a cell can be a transgene that is stably incorporated
into the genome of a cell. Editing of such transgene may result in
a further desired phenotype or genotype. The nucleotide sequence in
the genome of a cell can also be a mutated or pre-existing sequence
that was either endogenous or artificial from origin such as an
endogenous gene or a mutated gene of interest.
[0163] In one embodiment the nucleotide sequence can be a promoter
wherein the editing of the promoter results in any one of the
following or any one combination of the following: an increased
promoter activity, an increased promoter tissue specificity, a
decreased promoter activity, a decreased promoter tissue
specificity, a mutation of DNA binding elements and/or a deletion
or addition of DNA binding elements.
[0164] In one embodiment the nucleotide sequence can be a
regulatory sequence in the genome of a cell. A regulatory sequence
is a segment of a nucleic acid molecule which is capable of
increasing or decreasing the expression of specific genes within an
organism. Examples of regulatory sequences include, but are not
limited to, transcription activators, transcriptions repressors,
and translational repressors, splicing factors, miRNAs, siRNA,
artificial miRNAs, a CAAT box, a CCAAT box, a Pribnow box, a TATA
box, SECIS elements and polyadenylation signals. In some
embodiments the editing of a regulatory element results in altered
protein translation, RNA cleavage, RNA splicing or transcriptional
termination.
Regulatory Sequence Modifications Using the Guide
Polynucleotide/Cas Endonuclease System
[0165] In one embodiment the nucleotide sequence to be modified can
be a regulatory sequence such as a promoter wherein the editing of
the promoter comprises replacing the promoter (also referred to as
a "promoter swap" or "promoter replacement") or promoter fragment
with a different promoter (also referred to as replacement
promoter) or promoter fragment (also referred to as replacement
promoter fragment), wherein the promoter replacement results in any
one of the following or any one combination of the following: an
increased promoter activity, an increased promoter tissue
specificity, a decreased promoter activity, a decreased promoter
tissue specificity, a new promoter activity, an inducible promoter
activity, an extended window of gene expression, a modification of
the timing or developmental progress of gene expression in the same
cell layer or other cell layer (such as but not limiting to
extending the timing of gene expression in the tapetum of maize
anthers (U.S. Pat. No. 5,837,850 issued Nov. 17, 1998), a mutation
of DNA binding elements and/or a deletion or addition of DNA
binding elements. The promoter (or promoter fragment) to be
modified can be a promoter (or promoter fragment) that is
endogenous, artificial, pre-existing, or transgenic to the cell
that is being edited. The replacement promoter (or replacement
promoter fragment) can be a promoter (or promoter fragment) that is
endogenous, artificial, pre-existing, or transgenic to the cell
that is being edited.
[0166] In one embodiment the nucleotide sequence can be a promoter
wherein the editing of the promoter comprises replacing an ARGOS 8
promoter with a Zea mays GOS2 PRO:GOS2-intron promoter.
[0167] In one embodiment the nucleotide sequence can be a promoter
wherein the editing of the promoter comprises replacing a native
EPSPS1 promoter from with a plant ubiquitin promoter.
[0168] In one embodiment the nucleotide sequence can be a promoter
wherein the editing of the promoter comprises replacing an
endogenous maize NPK1 promoter with a stress inducible maize RAB17
promoter.
[0169] In one embodiment the nucleotide sequence can be a promoter
wherein the promoter to be edited is selected from the group
comprising Zea mays-PEPC1 promoter (Kausch et al, Plant Molecular
Biology, 45: 1-15, 2001), Zea mays Ubiquitin promoter (UBI1ZM PRO,
Christensen et al, plant Molecular Biology 18: 675-689, 1992), Zea
mays-Rootmet2 promoter (U.S. Pat. No. 7,214,855), Rice actin
promoter (OS-ACTIN PRO, U.S. Pat. No. 5,641,876; McElroy et al, The
Plant Cell, Vol 2, 163-171, February 1990), Sorghum RCC3 promoter
(US 2012/0210463 filed on 13 Feb. 2012), Zea mays-GOS2 promoter
(U.S. Pat. No. 6,504,083), Zea mays-ACO2 promoter (U.S. application
Ser. No. 14/210,711 filed 14 Mar. 2014) or Zea mays-oleosin
promoter (U.S. Pat. No. 8,466,341 B2).
[0170] In another embodiment, the guide polynucleotide/Cas
endonuclease system can be used in combination with a co-delivered
polynucleotide modification template or donor DNA sequence to allow
for the insertion of a promoter or promoter element into a genomic
nucleotide sequence of interest, wherein the promoter insertion (or
promoter element insertion) results in any one of the following or
any one combination of the following: an increased promoter
activity (increased promoter strength), an increased promoter
tissue specificity, a decreased promoter activity, a decreased
promoter tissue specificity, a new promoter activity, an inducible
promoter activity, an extended window of gene expression, a
modification of the timing or developmental progress of gene
expression a mutation of DNA binding elements and/or an addition of
DNA binding elements. Promoter elements to be inserted can be, but
are not limited to, promoter core elements (such as, but not
limited to, a CAAT box, a CCAAT box, a Pribnow box, a and/or TATA
box, translational regulation sequences and/or a repressor system
for inducible expression (such as TET operator
repressor/operator/inducer elements, or Sulphonylurea (Su)
repressor/operator/inducer elements. The dehydration-responsive
element (DRE) was first identified as a cis-acting promoter element
in the promoter of the drought-responsive gene rd29A, which
contains a 9 bp conserved core sequence, TACCGACAT
(Yamaguchi-Shinozaki, K., and Shinozaki, K. (1994) Plant Cell 6,
251-264). Insertion of DRE into an endogenous promoter may confer a
drought inducible expression of the downstream gene. Another
example is ABA-responsive elements (ABREs) that contain a
(C/T)ACGTGGC consensus sequence found to be present in numerous ABA
and/or stress-regulated genes (Busk P. K., Pages M. (1998) Plant
Mol. Biol. 37:425-435). Insertion of 35S enhancer or MMV enhancer
into an endogenous promoter region will increase gene expression
(U.S. Pat. No. 5,196,525). The promoter (or promoter element) to be
inserted can be a promoter (or promoter element) that is
endogenous, artificial, pre-existing, or transgenic to the cell
that is being edited.
[0171] In one embodiment, the guide polynucleotide/Cas endonuclease
system can be used to insert an enhancer element, such as but not
limited to a Cauliflower Mosaic Virus 35 S enhancer, in front of an
endogenous FMT1 promoter to enhance expression of the FTM1.
[0172] In one embodiment, the guide polynucleotide/Cas endonuclease
system can be used to insert a component of the TET operator
repressor/operator/inducer system, or a component of the
sulphonylurea (Su) repressor/operator/inducer system into plant
genomes to generate or control inducible expression systems.
[0173] In another embodiment, the guide polynucleotide/Cas
endonuclease system can be used to allow for the deletion of a
promoter or promoter element, wherein the promoter deletion (or
promoter element deletion) results in any one of the following or
any one combination of the following: a permanently inactivated
gene locus, an increased promoter activity (increased promoter
strength), an increased promoter tissue specificity, a decreased
promoter activity, a decreased promoter tissue specificity, a new
promoter activity, an inducible promoter activity, an extended
window of gene expression, a modification of the timing or
developmental progress of gene expression, a mutation of DNA
binding elements and/or an addition of DNA binding elements.
Promoter elements to be deleted can be, but are not limited to,
promoter core elements, promoter enhancer elements or 35 S enhancer
elements (as described in Example 32) The promoter or promoter
fragment to be deleted can be endogenous, artificial, pre-existing,
or transgenic to the cell that is being edited.
[0174] In one embodiment, the guide polynucleotide/Cas endonuclease
system can be used to delete the ARGOS 8 promoter present in a
maize genome as described herein.
[0175] In one embodiment, the guide polynucleotide/Cas endonuclease
system can be used to delete a 35S enhancer element present in a
plant genome as described herein.
Terminator Modifications Using the Guide Polynucleotide/Cas
Endonuclease System
[0176] In one embodiment the nucleotide sequence to be modified can
be a terminator wherein the editing of the terminator comprises
replacing the terminator (also referred to as a "terminator swap"
or "terminator replacement") or terminator fragment with a
different terminator (also referred to as replacement terminator)
or terminator fragment (also referred to as replacement terminator
fragment), wherein the terminator replacement results in any one of
the following or any one combination of the following: an increased
terminator activity, an increased terminator tissue specificity, a
decreased terminator activity, a decreased terminator tissue
specificity, a mutation of DNA binding elements and/or a deletion
or addition of DNA binding elements." The terminator (or terminator
fragment) to be modified can be a terminator (or terminator
fragment) that is endogenous, artificial, pre-existing, or
transgenic to the cell that is being edited. The replacement
terminator (or replacement terminator fragment) can be a terminator
(or terminator fragment) that is endogenous, artificial,
pre-existing, or transgenic to the cell that is being edited.
[0177] In one embodiment the nucleotide sequence to be modified can
be a terminator wherein the terminator to be edited is selected
from the group comprising terminators from maize Argos 8 or SRTF18
genes, or other terminators, such as potato PinII terminator,
sorghum actin terminator (SB-ACTIN TERM, WO 2013/184537 A1
published December 2013), sorghum SB-GKAF TERM (WO2013019461), rice
T28 terminator (OS-T28 TERM, WO 2013/012729 A2), AT-T9 TERM (WO
2013/012729 A2) or GZ-W64A TERM (U.S. Pat. No. 7,053,282).
[0178] In one embodiment, the guide polynucleotide/Cas endonuclease
system can be used in combination with a co-delivered
polynucleotide modification template or donor DNA sequence to allow
for the insertion of a terminator or terminator element into a
genomic nucleotide sequence of interest, wherein the terminator
insertion (or terminator element insertion) results in any one of
the following or any one combination of the following: an increased
terminator activity (increased terminator strength), an increased
terminator tissue specificity, a decreased terminator activity, a
decreased terminator tissue specificity, a mutation of DNA binding
elements and/or an addition of DNA binding elements.
[0179] The terminator (or terminator element) to be inserted can be
a terminator (or terminator element) that is endogenous,
artificial, pre-existing, or transgenic to the cell that is being
edited.
[0180] In another embodiment, the guide polynucleotide/Cas
endonuclease system can be used to allow for the deletion of a
terminator or terminator element, wherein the terminator deletion
(or terminator element deletion) results in any one of the
following or any one combination of the following: an increased
terminator activity (increased terminator strength), an increased
terminator tissue specificity, a decreased terminator activity, a
decreased terminator tissue specificity, a mutation of DNA binding
elements and/or an addition of DNA binding elements. The terminator
or terminator fragment to be deleted can be endogenous, artificial,
pre-existing, or transgenic to the cell that is being edited.
Additional Regulatory Sequence Modifications Using the Guide
Polynucleotide/Cas Endonuclease System
[0181] In one embodiment, the guide polynucleotide/Cas endonuclease
system can be used to modify or replace a regulatory sequence in
the genome of a cell. A regulatory sequence is a segment of a
nucleic acid molecule which is capable of increasing or decreasing
the expression of specific genes within an organism and/or is
capable of altering tissue specific expression of genes within an
organism. Examples of regulatory sequences include, but are not
limited to, 3' UTR (untranslated region) region, 5' UTR region,
transcription activators, transcriptional enhancers transcriptions
repressors, translational repressors, splicing factors, miRNAs,
siRNA, artificial miRNAs, promoter elements, CAMV 35 S enhancer,
MMV enhancer elements (PCT/US14/23451 filed Mar. 11, 2013), SECIS
elements, polyadenylation signals, and polyubiquitination sites. In
some embodiments the editing (modification) or replacement of a
regulatory element results in altered protein translation, RNA
cleavage, RNA splicing, transcriptional termination or post
translational modification. In one embodiment, regulatory elements
can be identified within a promoter and these regulatory elements
can be edited or modified do to optimize these regulatory elements
for up or down regulation of the promoter.
[0182] In one embodiment, the genomic sequence of interest to be
modified is a polyubiquitination site, wherein the modification of
the polyubiquitination sites results in a modified rate of protein
degradation. The ubiquitin tag condemns proteins to be degraded by
proteasomes or autophagy. Proteasome inhibitors are known to cause
a protein overproduction. Modifications made to a DNA sequence
encoding a protein of interest can result in at least one amino
acid modification of the protein of interest, wherein said
modification allows for the polyubiquitination of the protein (a
post translational modification) resulting in a modification of the
protein degradation
[0183] In one embodiment, the genomic sequence of interest to be
modified is a polyubiquitination site on a maize EPSPS gene,
wherein the polyubiquitination site modified resulting in an
increased protein content due to a slower rate of EPSPS protein
degradation.
[0184] In one embodiment, the genomic sequence of interest to be
modified is a an intron site, wherein the modification consist of
inserting an intron enhancing motif into the intron which results
in modulation of the transcriptional activity of the gene
comprising said intron.
[0185] In one embodiment, the genomic sequence of interest to be
modified is a an intron site, wherein the modification consist of
replacing a soybean EPSP1 intron with a soybean ubiquitin intron 1
as described herein (Example 25)
[0186] In one embodiment, the genomic sequence of interest to be
modified is a an intron or UTR site, wherein the modification
consist of inserting at least one microRNA into said intron or UTR
site, wherein expression of the gene comprising the intron or UTR
site also results in expression of said microRNA, which in turn can
silence any gene targeted by the microRNA without disrupting the
gene expression of the native/transgene comprising said intron.
[0187] In one embodiment, the guide polynucleotide/Cas endonuclease
system can be used to allow for the deletion or mutation of a Zinc
Finger transcription factor, wherein the deletion or mutation of
the Zinc Finger transcription factor results in or allows for the
creation of a dominant negative Zinc Finger transcription factor
mutant (Li et al 2013 Rice zinc finger protein DST enhances grain
production through controlling Gn1a/OsCKX2 expression PNAS
110:3167-3172). Insertion of a single base pair downstream zinc
finger domain will result in a frame shift and produces a new
protein which still can bind to DNA without transcription activity.
The mutant protein will compete to bind to cytokinin oxidase gene
promoters and block the expression of cytokinin oxidase gene.
Reduction of cytokinin oxidase gene expression will increase
cytokinin level and promote panicle growth in rice and ear growth
in maize, and increase yield under normal and stress
conditions.
Modifications of Splicing Sites and/or Introducing Alternate
Splicing Sites Using the Guide Polynucleotide/Cas Endonuclease
System
[0188] Protein synthesis utilizes mRNA molecules that emerge from
pre-mRNA molecules subjected to the maturation process. The
pre-mRNA molecules are capped, spliced and stabilized by addition
of polyA tails. Eukaryotic cells developed a complex process of
splicing that result in alternative variants of the original
pre-mRNA molecules. Some of them may not produce functional
templates for protein synthesis. In maize cells, the splicing
process is affected by splicing sites at the exon-intron junction
sites. An example of a canonical splice site is AGGT. Gene coding
sequences can contains a number of alternate splicing sites that
may affect the overall efficiency of the pre-mRNA maturation
process and as such may limit the protein accumulation in cells.
The guide polynucleotide/Cas endonuclease system can be used in
combination with a co-delivered polynucleotide modification
template to edit a gene of interest to introduce a canonical splice
site at a described junction or any variant of a splicing site that
changes the splicing pattern of pre-mRNA molecules.
[0189] In one embodiment, the nucleotide sequence of interest to be
modified is a maize EPSPS gene, wherein the modification of the
gene consists of modifying alternative splicing sites resulting in
enhanced production of the functional gene transcripts and gene
products (proteins).
[0190] In one embodiment, the nucleotide sequence of interest to be
modified is a gene, wherein the modification of the gene consists
of editing the intron borders of alternatively spliced genes to
alter the accumulation of splice variants.
Modifications of Nucleotide Sequences Encoding a Protein of
Interest Using the Guide Polynucleotide/Cas Endonuclease System
[0191] In one embodiment, the guide polynucleotide/Cas endonuclease
system can be used to modify or replace a coding sequence in the
genome of a cell, wherein the modification or replacement results
in any one of the following, or any one combination of the
following: an increased protein (enzyme) activity, an increased
protein functionality, a decreased protein activity, a decreased
protein functionality, a site specific mutation, a protein domain
swap, a protein knock-out, a new protein functionality, a modified
protein functionality.
[0192] In one embodiment the protein knockout is due to the
introduction of a stop codon into the coding sequence of
interest.
[0193] In one embodiment the protein knockout is due to the
deletion of a start codon into the coding sequence of interest.
Amino Acid and/or Protein Fusions Using the Guide
Polynucleotide/Cas Endonuclease System
[0194] In one embodiment, the guide polynucleotide/Cas endonuclease
system can be used with or without a co-delivered polynucleotide
sequence to fuse a first coding sequence encoding a first protein
to a second coding sequence encoding a second protein in the genome
of a cell, wherein the protein fusion results in any one of the
following or any one combination of the following: an increased
protein (enzyme) activity, an increased protein functionality, a
decreased protein activity, a decreased protein functionality, a
new protein functionality, a modified protein functionality, a new
protein localization, a new timing of protein expression, a
modified protein expression pattern, a chimeric protein, or a
modified protein with dominant phenotype functionality.
[0195] In one embodiment, the guide polynucleotide/Cas endonuclease
system can be used with or without a co-delivered polynucleotide
sequence to fuse a first coding sequence encoding a chloroplast
localization signal to a second coding sequence encoding a protein
of interest, wherein the protein fusion results in targeting the
protein of interest to the chloroplast.
[0196] In one embodiment, the guide polynucleotide/Cas endonuclease
system can be used with or without a co-delivered polynucleotide
sequence to fuse a first coding sequence encoding a chloroplast
localization signal to a second coding sequence encoding a protein
of interest, wherein the protein fusion results in targeting the
protein of interest to the chloroplast.
[0197] In one embodiment, the guide polynucleotide/Cas endonuclease
system can be used with or without a co-delivered polynucleotide
sequence to fuse a first coding sequence encoding a chloroplast
localization signal (e.g., a chloroplast transit peptide) to a
second coding sequence, wherein the protein fusion results in a
modified protein with dominant phenotype functionality
Gene Silencing by Expressing an Inverted Repeat into a Gene of
Interest Using the Guide Polynucleotide/Cas Endonuclease System
[0198] In one embodiment, the guide polynucleotide/Cas endonuclease
system can be used in combination with a co-delivered
polynucleotide sequence to insert an inverted gene fragment into a
gene of interest in the genome of an organism, wherein the
insertion of the inverted gene fragment can allow for an in-vivo
creation of an inverted repeat (hairpin) and results in the
silencing of said endogenous gene.
[0199] In one embodiment the insertion of the inverted gene
fragment can result in the formation of an in-vivo created inverted
repeat (hairpin) in a native (or modified) promoter of a gene
and/or in a native 5' end of the native gene. The inverted gene
fragment can further comprise an intron which can result in an
enhanced silencing of the targeted gene.
Genome Deletion for Trait Locus Characterization
[0200] Trait mapping in plant breeding often results in the
detection of chromosomal regions housing one or more genes
controlling expression of a trait of interest. For a qualitative
trait, the guide polynucleotide/Cas endonuclease system can be used
to eliminate candidate genes in the identified chromosomal regions
to determine if deletion of the gene affects expression of the
trait. For quantitative traits, expression of a trait of interest
is governed by multiple quantitative trait loci (QTL) of varying
effect-size, complexity, and statistical significance across one or
more chromosomes. In cases of negative effect or deleterious QTL
regions affecting a complex trait, the guide polynucleotide/Cas
endonuclease system can be used to eliminate whole regions
delimited by marker-assisted fine mapping, and to target specific
regions for their selective elimination or rearrangement.
Similarly, presence/absence variation (PAV) or copy number
variation (CNV) can be manipulated with selective genome deletion
using the guide polynucleotide/Cas endonuclease system.
[0201] In one embodiment, the region of interest can be flanked by
two independent guide polynucleotide/CAS endonuclease target
sequences. Cutting would be done concurrently. The deletion event
would be the repair of the two chromosomal ends without the region
of interest. Alternative results would include inversions of the
region of interest, mutations at the cut sites and duplication of
the region of interest
[0202] Methods for Identifying at Least One Plant Cell Comprising
in its Genome a Polynucleotide of Interest Integrated at the Target
Site.
[0203] Further provided, are methods for identifying at least one
plant cell comprising in its genome a polynucleotide of Interest
integrated at the target site. A variety of methods are available
for identifying those plant cells with insertion into the genome at
or near to the target site without using a screenable marker
phenotype. Such methods can be viewed as directly analyzing a
target sequence to detect any change in the target sequence,
including but not limited to PCR methods, sequencing methods,
nuclease digestion, Southern blots, and any combination thereof.
See, for example, U.S. patent application Ser. No. 12/147,834,
herein incorporated to the extent necessary for the methods
described herein.
[0204] The method also comprises recovering a plant from the plant
cell comprising a polynucleotide of Interest integrated into its
genome. The plant may be sterile or fertile. It is recognized that
any polynucleotide of interest can be provided, integrated into the
plant genome at the target site, and expressed in a plant.
[0205] Polynucleotides/polypeptides of interest include, but are
not limited to, herbicide-tolerance coding sequences, insecticidal
coding sequences, nematicidal coding sequences, antimicrobial
coding sequences, antifungal coding sequences, antiviral coding
sequences, abiotic and biotic stress tolerance coding sequences, or
sequences modifying plant traits such as yield, grain quality,
nutrient content, starch quality and quantity, nitrogen fixation
and/or utilization, fatty acids, and oil content and/or
composition. More specific polynucleotides of interest include, but
are not limited to, genes that improve crop yield, polypeptides
that improve desirability of crops, genes encoding proteins
conferring resistance to abiotic stress, such as drought, nitrogen,
temperature, salinity, toxic metals or trace elements, or those
conferring resistance to toxins such as pesticides and herbicides,
or to biotic stress, such as attacks by fungi, viruses, bacteria,
insects, and nematodes, and development of diseases associated with
these organisms. General categories of genes of interest include,
for example, those genes involved in information, such as zinc
fingers, those involved in communication, such as kinases, and
those involved in housekeeping, such as heat shock proteins. More
specific categories of transgenes, for example, include genes
encoding important traits for agronomics, insect resistance,
disease resistance, herbicide resistance, fertility or sterility,
grain characteristics, and commercial products. Genes of interest
include, generally, those involved in oil, starch, carbohydrate, or
nutrient metabolism as well as those affecting kernel size, sucrose
loading, and the like that can be stacked or used in combination
with other traits, such as but not limited to herbicide resistance,
described herein.
[0206] Agronomically important traits such as oil, starch, and
protein content can be genetically altered in addition to using
traditional breeding methods. Modifications include increasing
content of oleic acid, saturated and unsaturated oils, increasing
levels of lysine and sulfur, providing essential amino acids, and
also modification of starch. Hordothionin protein modifications are
described in U.S. Pat. Nos. 5,703,049, 5,885,801, 5,885,802, and
5,990,389, herein incorporated by reference. Another example is
lysine and/or sulfur rich seed protein encoded by the soybean 2S
albumin described in U.S. Pat. No. 5,850,016, and the chymotrypsin
inhibitor from barley, described in Williamson et al. (1987) Eur.
J. Biochem. 165:99-106, the disclosures of which are herein
incorporated by reference.
[0207] Commercial traits can also be encoded on a polynucleotide of
interest that could increase for example, starch for ethanol
production, or provide expression of proteins. Another important
commercial use of transformed plants is the production of polymers
and bioplastics such as described in U.S. Pat. No. 5,602,321. Genes
such as .beta.-Ketothiolase, PHBase (polyhydroxybutyrate synthase),
and acetoacetyl-CoA reductase (see Schubert et al. (1988) J.
Bacteriol. 170:5837-5847) facilitate expression of
polyhydroxyalkanoates (PHAs).
[0208] Derivatives of the coding sequences can be made by
site-directed mutagenesis to increase the level of preselected
amino acids in the encoded polypeptide. For example, the gene
encoding the barley high lysine polypeptide (BHL) is derived from
barley chymotrypsin inhibitor, U.S. application Ser. No.
08/740,682, filed Nov. 1, 1996, and WO 98/20133, the disclosures of
which are herein incorporated by reference. Other proteins include
methionine-rich plant proteins such as from sunflower seed (Lilley
et al. (1989) Proceedings of the World Congress on Vegetable
Protein Utilization in Human Foods and Animal Feedstuffs, ed.
Applewhite (American Oil Chemists Society, Champaign, Ill.), pp.
497-502; herein incorporated by reference); corn (Pedersen et al.
(1986) J. Biol. Chem. 261:6279; Kirihara et al. (1988) Gene 71:359;
both of which are herein incorporated by reference); and rice
(Musumura et al. (1989) Plant Mol. Biol. 12:123, herein
incorporated by reference). Other agronomically important genes
encode latex, Floury 2, growth factors, seed storage factors, and
transcription factors.
[0209] Polynucleotides that improve crop yield include dwarfing
genes, such as Rht1 and Rht2 (Peng et al. (1999) Nature
400:256-261), and those that increase plant growth, such as
ammonium-inducible glutamate dehydrogenase. Polynucleotides that
improve desirability of crops include, for example, those that
allow plants to have reduced saturated fat content, those that
boost the nutritional value of plants, and those that increase
grain protein. Polynucleotides that improve salt tolerance are
those that increase or allow plant growth in an environment of
higher salinity than the native environment of the plant into which
the salt-tolerant gene(s) has been introduced.
[0210] Polynucleotides/polypeptides that influence amino acid
biosynthesis include, for example, anthranilate synthase (AS; EC
4.1.3.27) which catalyzes the first reaction branching from the
aromatic amino acid pathway to the biosynthesis of tryptophan in
plants, fungi, and bacteria. In plants, the chemical processes for
the biosynthesis of tryptophan are compartmentalized in the
chloroplast. See, for example, US Pub. 20080050506, herein
incorporated by reference. Additional sequences of interest include
Chorismate Pyruvate Lyase (CPL) which refers to a gene encoding an
enzyme which catalyzes the conversion of chorismate to pyruvate and
pHBA. The most well characterized CPL gene has been isolated from
E. coli and bears the GenBank accession number M96268. See, U.S.
Pat. No. 7,361,811, herein incorporated by reference.
[0211] These polynucleotide sequences of interest may encode
proteins involved in providing disease or pest resistance. By
"disease resistance" or "pest resistance" is intended that the
plants avoid the harmful symptoms that are the outcome of the
plant-pathogen interactions. Pest resistance genes may encode
resistance to pests that have great yield drag such as rootworm,
cutworm, European Corn Borer, and the like. Disease resistance and
insect resistance genes such as lysozymes or cecropins for
antibacterial protection, or proteins such as defensins, glucanases
or chitinases for antifungal protection, or Bacillus thuringiensis
endotoxins, protease inhibitors, collagenases, lectins, or
glycosidases for controlling nematodes or insects are all examples
of useful gene products. Genes encoding disease resistance traits
include detoxification genes, such as against fumonisin (U.S. Pat.
No. 5,792,931); avirulence (avr) and disease resistance (R) genes
(Jones et al. (1994) Science 266:789; Martin et al. (1993) Science
262:1432; and Mindrinos et al. (1994) Cell 78:1089); and the like.
Insect resistance genes may encode resistance to pests that have
great yield drag such as rootworm, cutworm, European Corn Borer,
and the like. Such genes include, for example, Bacillus
thuringiensis toxic protein genes (U.S. Pat. Nos. 5,366,892;
5,747,450; 5,736,514; 5,723,756; 5,593,881; and Geiser et al.
(1986) Gene 48:109); and the like.
[0212] An "herbicide resistance protein" or a protein resulting
from expression of an "herbicide resistance-encoding nucleic acid
molecule" includes proteins that confer upon a cell the ability to
tolerate a higher concentration of an herbicide than cells that do
not express the protein, or to tolerate a certain concentration of
an herbicide for a longer period of time than cells that do not
express the protein. Herbicide resistance traits may be introduced
into plants by genes coding for resistance to herbicides that act
to inhibit the action of acetolactate synthase (ALS), in particular
the sulfonylurea-type herbicides, genes coding for resistance to
herbicides that act to inhibit the action of glutamine synthase,
such as phosphinothricin or basta (e.g., the bar gene), glyphosate
(e.g., the EPSP synthase gene and the GAT gene), HPPD inhibitors
(e.g, the HPPD gene) or other such genes known in the art. See, for
example, U.S. Pat. Nos. 7,626,077, 5,310,667, 5,866,775, 6,225,114,
6,248,876, 7,169,970, 6,867,293, and U.S. Provisional Application
No. 61/401,456, each of which is herein incorporated by reference.
The bar gene encodes resistance to the herbicide basta, the nptII
gene encodes resistance to the antibiotics kanamycin and geneticin,
and the ALS-gene mutants encode resistance to the herbicide
chlorsulfuron.
[0213] Sterility genes can also be encoded in an expression
cassette and provide an alternative to physical detasseling.
Examples of genes used in such ways include male fertility genes
such as MS26 (see for example U.S. Pat. Nos. 7,098,388, 7,517,975,
7,612,251), MS45 (see for example U.S. Pat. Nos. 5,478,369,
6,265,640) or MSCA1 (see for example U.S. Pat. No. 7,919,676).
Maize plants (Zea mays L.) can be bred by both self-pollination and
cross-pollination techniques. Maize has male flowers, located on
the tassel, and female flowers, located on the ear, on the same
plant. It can self-pollinate ("selfing") or cross pollinate.
Natural pollination occurs in maize when wind blows pollen from the
tassels to the silks that protrude from the tops of the incipient
ears. Pollination may be readily controlled by techniques known to
those of skill in the art. The development of maize hybrids
requires the development of homozygous inbred lines, the crossing
of these lines, and the evaluation of the crosses. Pedigree
breeding and recurrent selection are two of the breeding methods
used to develop inbred lines from populations. Breeding programs
combine desirable traits from two or more inbred lines or various
broad-based sources into breeding pools from which new inbred lines
are developed by selfing and selection of desired phenotypes. A
hybrid maize variety is the cross of two such inbred lines, each of
which may have one or more desirable characteristics lacked by the
other or which complement the other. The new inbreds are crossed
with other inbred lines and the hybrids from these crosses are
evaluated to determine which have commercial potential. The hybrid
progeny of the first generation is designated F1. The F1 hybrid is
more vigorous than its inbred parents. This hybrid vigor, or
heterosis, can be manifested in many ways, including increased
vegetative growth and increased yield.
[0214] Hybrid maize seed can be produced by a male sterility system
incorporating manual detasseling. To produce hybrid seed, the male
tassel is removed from the growing female inbred parent, which can
be planted in various alternating row patterns with the male inbred
parent. Consequently, providing that there is sufficient isolation
from sources of foreign maize pollen, the ears of the female inbred
will be fertilized only with pollen from the male inbred. The
resulting seed is therefore hybrid (F1) and will form hybrid
plants.
[0215] Field variation impacting plant development can result in
plants tasseling after manual detasseling of the female parent is
completed. Or, a female inbred plant tassel may not be completely
removed during the detasseling process. In any event, the result is
that the female plant will successfully shed pollen and some female
plants will be self-pollinated. This will result in seed of the
female inbred being harvested along with the hybrid seed which is
normally produced. Female inbred seed does not exhibit heterosis
and therefore is not as productive as F1 seed. In addition, the
presence of female inbred seed can represent a germplasm security
risk for the company producing the hybrid.
[0216] Alternatively, the female inbred can be mechanically
detasseled by machine. Mechanical detasseling is approximately as
reliable as hand detasseling, but is faster and less costly.
However, most detasseling machines produce more damage to the
plants than hand detasseling. Thus, no form of detasseling is
presently entirely satisfactory, and a need continues to exist for
alternatives which further reduce production costs and to eliminate
self-pollination of the female parent in the production of hybrid
seed.
[0217] Mutations that cause male sterility in plants have the
potential to be useful in methods for hybrid seed production for
crop plants such as maize and can lower production costs by
eliminating the need for the labor-intensive removal of male
flowers (also known as de-tasseling) from the maternal parent
plants used as a hybrid parent. Mutations that cause male sterility
in maize have been produced by a variety of methods such as X-rays
or UV-irradiations, chemical treatments, or transposable element
insertions (ms23, ms25, ms26, ms32) (Chaubal et al. (2000) Am J Bot
87:1193-1201). Conditional regulation of fertility genes through
fertility/sterility "molecular switches" could enhance the options
for designing new male-sterility systems for crop improvement
(Unger et al. (2002) Transgenic Res 11:455-465).
[0218] Besides identification of novel genes impacting male
fertility, there remains a need to provide a reliable system of
producing genetic male sterility.
[0219] In U.S. Pat. No. 5,478,369, a method is described by which
the Ms45 male fertility gene was tagged and cloned on maize
chromosome 9. Previously, there had been described a male fertility
gene on chromosome 9, ms2, which had never been cloned and
sequenced. It is not allelic to the gene referred to in the '369
patent. See Albertsen, M. and Phillips, R. L., "Developmental
Cytology of 13 Genetic Male Sterile Loci in Maize" Canadian Journal
of Genetics & Cytology 23:195-208 (January 1981). The only
fertility gene cloned before that had been the Arabidopsis gene
described at Aarts, et al., supra.
[0220] Examples of genes that have been discovered subsequently
that are important to male fertility are numerous and include the
Arabidopsis ABORTED MICROSPORES (AMS) gene, Sorensen et al., The
Plant Journal (2003) 33(2):413-423); the Arabidopsis MS1 gene
(Wilson et al., The Plant Journal (2001) 39(2):170-181); the NEF1
gene (Ariizumi et al., The Plant Journal (2004) 39(2):170-181);
Arabidopsis AtGPAT1 gene (Zheng et al., The Plant Cell (2003)
15:1872-1887); the Arabidopsis dde2-2 mutation was shown to be
defective in the allene oxide syntase gene (Malek et al., Planta
(2002) 216:187-192); the Arabidopsis faceless pollen-1 gene (flp1)
(Ariizumi et al, Plant Mol. Biol. (2003) 53:107-116); the
Arabidopsis MALE MEIOCYTE DEATH1 gene (Yang et al., The Plant Cell
(2003) 15: 1281-1295); the tapetum-specific zinc finger gene, TAZ1
(Kapoor et al., The Plant Cell (2002) 14:2353-2367); and the
TAPETUM DETERMINANT1 gene (Lan et al, The Plant Cell (2003)
15:2792-2804).
[0221] Other known male fertility mutants or genes from Zea mays
are listed in U.S. Pat. No. 7,919,676 incorporated herein by
reference.
[0222] Other genes include kinases and those encoding compounds
toxic to either male or female gametophytic development.
[0223] Furthermore, it is recognized that the polynucleotide of
interest may also comprise antisense sequences complementary to at
least a portion of the messenger RNA (mRNA) for a targeted gene
sequence of interest. Antisense nucleotides are constructed to
hybridize with the corresponding mRNA. Modifications of the
antisense sequences may be made as long as the sequences hybridize
to and interfere with expression of the corresponding mRNA. In this
manner, antisense constructions having 70%, 80%, or 85% sequence
identity to the corresponding antisense sequences may be used.
Furthermore, portions of the antisense nucleotides may be used to
disrupt the expression of the target gene. Generally, sequences of
at least 50 nucleotides, 100 nucleotides, 200 nucleotides, or
greater may be used.
[0224] In addition, the polynucleotide of interest may also be used
in the sense orientation to suppress the expression of endogenous
genes in plants. Methods for suppressing gene expression in plants
using polynucleotides in the sense orientation are known in the
art. The methods generally involve transforming plants with a DNA
construct comprising a promoter that drives expression in a plant
operably linked to at least a portion of a nucleotide sequence that
corresponds to the transcript of the endogenous gene. Typically,
such a nucleotide sequence has substantial sequence identity to the
sequence of the transcript of the endogenous gene, generally
greater than about 65% sequence identity, about 85% sequence
identity, or greater than about 95% sequence identity. See, U.S.
Pat. Nos. 5,283,184 and 5,034,323; herein incorporated by
reference.
[0225] The polynucleotide of interest can also be a phenotypic
marker. A phenotypic marker is screenable or a selectable marker
that includes visual markers and selectable markers whether it is a
positive or negative selectable marker. Any phenotypic marker can
be used. Specifically, a selectable or screenable marker comprises
a DNA segment that allows one to identify, or select for or against
a molecule or a cell that contains it, often under particular
conditions. These markers can encode an activity, such as, but not
limited to, production of RNA, peptide, or protein, or can provide
a binding site for RNA, peptides, proteins, inorganic and organic
compounds or compositions and the like.
[0226] Examples of selectable markers include, but are not limited
to, DNA segments that comprise restriction enzyme sites; DNA
segments that encode products which provide resistance against
otherwise toxic compounds including antibiotics, such as,
spectinomycin, ampicillin, kanamycin, tetracycline, Basta, neomycin
phosphotransferase II (NEO) and hygromycin phosphotransferase
(HPT)); DNA segments that encode products which are otherwise
lacking in the recipient cell (e.g., tRNA genes, auxotrophic
markers); DNA segments that encode products which can be readily
identified (e.g., phenotypic markers such as .beta.-galactosidase,
GUS; fluorescent proteins such as green fluorescent protein (GFP),
cyan (CFP), yellow (YFP), red (RFP), and cell surface proteins);
the generation of new primer sites for PCR (e.g., the juxtaposition
of two DNA sequence not previously juxtaposed), the inclusion of
DNA sequences not acted upon or acted upon by a restriction
endonuclease or other DNA modifying enzyme, chemical, etc.; and,
the inclusion of a DNA sequences required for a specific
modification (e.g., methylation) that allows its
identification.
[0227] Additional selectable markers include genes that confer
resistance to herbicidal compounds, such as glufosinate ammonium,
bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D).
See for example, Yarranton, (1992) Curr Opin Biotech 3:506-11;
Christopherson et al., (1992) Proc. Natl. Acad. Sci. USA 89:6314-8;
Yao et al., (1992) Cell 71:63-72; Reznikoff, (1992) Mol Microbiol
6:2419-22; Hu et al., (1987) Cell 48:555-66; Brown et al., (1987)
Cell 49:603-12; Figge et al., (1988) Cell 52:713-22; Deuschle et
al., (1989) Proc. Natl. Acad. Sci. USA 86:5400-4; Fuerst et al.,
(1989) Proc. Natl. Acad. Sci. USA 86:2549-53; Deuschle et al.,
(1990) Science 248:480-3; Gossen, (1993) Ph.D. Thesis, University
of Heidelberg; Reines et al., (1993) Proc. Natl. Acad. Sci. USA
90:1917-21; Labow et al., (1990) Mol Cell Biol 10:3343-56;
Zambretti et al., (1992) Proc. Natl. Acad. Sci. USA 89:3952-6; Baim
et al., (1991) Proc. Natl. Acad. Sci. USA 88:5072-6; Wyborski et
al., (1991) Nucleic Acids Res 19:4647-53; Hillen and Wissman,
(1989) Topics Mol Struc Biol 10:143-62; Degenkolb et al., (1991)
Antimicrob Agents Chemother 35:1591-5; Kleinschnidt et al., (1988)
Biochemistry 27:1094-104; Bonin, (1993) Ph.D. Thesis, University of
Heidelberg; Gossen et al., (1992) Proc. Natl. Acad. Sci. USA
89:5547-51; Oliva et al., (1992) Antimicrob Agents Chemother
36:913-9; Hlavka et al., (1985) Handbook of Experimental
Pharmacology, Vol. 78 (Springer-Verlag, Berlin); Gill et al.,
(1988) Nature 334:721-4. Commercial traits can also be encoded on a
gene or genes that could increase for example, starch for ethanol
production, or provide expression of proteins. Another important
commercial use of transformed plants is the production of polymers
and bioplastics such as described in U.S. Pat. No. 5,602,321. Genes
such as .beta.-Ketothiolase, PHBase (polyhydroxyburyrate synthase),
and acetoacetyl-CoA reductase (see Schubert et al. (1988) J.
Bacteriol. 170:5837-5847) facilitate expression of
polyhyroxyalkanoates (PHAs).
[0228] Exogenous products include plant enzymes and products as
well as those from other sources including prokaryotes and other
eukaryotes. Such products include enzymes, cofactors, hormones, and
the like. The level of proteins, particularly modified proteins
having improved amino acid distribution to improve the nutrient
value of the plant, can be increased. This is achieved by the
expression of such proteins having enhanced amino acid content.
[0229] The transgenes, recombinant DNA molecules, DNA sequences of
interest, and polynucleotides of interest can be comprise one or
more DNA sequences for gene silencing. Methods for gene silencing
involving the expression of DNA sequences in plant are known in the
art include, but are not limited to, cosuppression, antisense
suppression, double-stranded RNA (dsRNA) interference, hairpin RNA
(hpRNA) interference, intron-containing hairpin RNA (ihpRNA)
interference, transcriptional gene silencing, and micro RNA (miRNA)
interference
[0230] As used herein, "nucleic acid" means a polynucleotide and
includes a single or a double-stranded polymer of
deoxyribonucleotide or ribonucleotide bases. Nucleic acids may also
include fragments and modified nucleotides. Thus, the terms
"polynucleotide", "nucleic acid sequence", "nucleotide sequence"
and "nucleic acid fragment" are used interchangeably to denote a
polymer of RNA and/or DNA that is single- or double-stranded,
optionally containing synthetic, non-natural, or altered nucleotide
bases. Nucleotides (usually found in their 5'-monophosphate form)
are referred to by their single letter designation as follows: "A"
for adenosine or deoxyadenosine (for RNA or DNA, respectively), "C"
for cytosine or deoxycytosine, "G" for guanosine or deoxyguanosine,
"U" for uridine, "T" for deoxythymidine, "R" for purines (A or G),
"Y" for pyrimidines (C or T), "K" for G or T, "H" for A or C or T,
"I" for inosine, and "N" for any nucleotide.
[0231] "Open reading frame" is abbreviated ORF.
[0232] The terms "subfragment that is functionally equivalent" and
"functionally equivalent subfragment" are used interchangeably
herein. These terms refer to a portion or subsequence of an
isolated nucleic acid fragment in which the ability to alter gene
expression or produce a certain phenotype is retained whether or
not the fragment or subfragment encodes an active enzyme. For
example, the fragment or subfragment can be used in the design of
genes to produce the desired phenotype in a transformed plant.
Genes can be designed for use in suppression by linking a nucleic
acid fragment or subfragment thereof, whether or not it encodes an
active enzyme, in the sense or antisense orientation relative to a
plant promoter sequence.
[0233] The term "conserved domain" or "motif" means a set of amino
acids conserved at specific positions along an aligned sequence of
evolutionarily related proteins. While amino acids at other
positions can vary between homologous proteins, amino acids that
are highly conserved at specific positions indicate amino acids
that are essential to the structure, the stability, or the activity
of a protein. Because they are identified by their high degree of
conservation in aligned sequences of a family of protein
homologues, they can be used as identifiers, or "signatures", to
determine if a protein with a newly determined sequence belongs to
a previously identified protein family.
[0234] Polynucleotide and polypeptide sequences, variants thereof,
and the structural relationships of these sequences can be
described by the terms "homology", "homologous", "substantially
identical", "substantially similar" and "corresponding
substantially" which are used interchangeably herein. These refer
to polypeptide or nucleic acid fragments wherein changes in one or
more amino acids or nucleotide bases do not affect the function of
the molecule, such as the ability to mediate gene expression or to
produce a certain phenotype. These terms also refer to
modification(s) of nucleic acid fragments that do not substantially
alter the functional properties of the resulting nucleic acid
fragment relative to the initial, unmodified fragment. These
modifications include deletion, substitution, and/or insertion of
one or more nucleotides in the nucleic acid fragment.
[0235] Substantially similar nucleic acid sequences encompassed may
be defined by their ability to hybridize (under moderately
stringent conditions, e.g., 0.5.times.SSC, 0.1% SDS, 60.degree. C.)
with the sequences exemplified herein, or to any portion of the
nucleotide sequences disclosed herein and which are functionally
equivalent to any of the nucleic acid sequences disclosed herein.
Stringency conditions can be adjusted to screen for moderately
similar fragments, such as homologous sequences from distantly
related organisms, to highly similar fragments, such as genes that
duplicate functional enzymes from closely related organisms.
Post-hybridization washes determine stringency conditions.
[0236] The term "selectively hybridizes" includes reference to
hybridization, under stringent hybridization conditions, of a
nucleic acid sequence to a specified nucleic acid target sequence
to a detectably greater degree (e.g., at least 2-fold over
background) than its hybridization to non-target nucleic acid
sequences and to the substantial exclusion of non-target nucleic
acids. Selectively hybridizing sequences typically have about at
least 80% sequence identity, or 90% sequence identity, up to and
including 100% sequence identity (i.e., fully complementary) with
each other.
[0237] The term "stringent conditions" or "stringent hybridization
conditions" includes reference to conditions under which a probe
will selectively hybridize to its target sequence in an in vitro
hybridization assay. Stringent conditions are sequence-dependent
and will be different in different circumstances. By controlling
the stringency of the hybridization and/or washing conditions,
target sequences can be identified which are 100% complementary to
the probe (homologous probing). Alternatively, stringency
conditions can be adjusted to allow some mismatching in sequences
so that lower degrees of similarity are detected (heterologous
probing). Generally, a probe is less than about 1000 nucleotides in
length, optionally less than 500 nucleotides in length.
[0238] Typically, stringent conditions will be those in which the
salt concentration is less than about 1.5 M Na ion, typically about
0.01 to 1.0 M Na ion concentration (or other salt(s)) at pH 7.0 to
8.3, and at least about 30.degree. C. for short probes (e.g., 10 to
50 nucleotides) and at least about 60.degree. C. for long probes
(e.g., greater than 50 nucleotides). Stringent conditions may also
be achieved with the addition of destabilizing agents such as
formamide. Exemplary low stringency conditions include
hybridization with a buffer solution of 30 to 35% formamide, 1 M
NaCl, SDS (sodium dodecyl sulphate) at 37.degree. C., and a wash in
1.times. to 2.times.SSC (20.times.SSC=3.0 M NaCl/0.3 M trisodium
citrate) at 50 to 55.degree. C. Exemplary moderate stringency
conditions include hybridization in 40 to 45% formamide, 1 M NaCl,
1% SDS at 37.degree. C., and a wash in 0.5.times. to 1.times.SSC at
55 to 60.degree. C. Exemplary high stringency conditions include
hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37.degree. C.,
and a wash in 0.1.times.SSC at 60 to 65.degree. C.
[0239] "Sequence identity" or "identity" in the context of nucleic
acid or polypeptide sequences refers to the nucleic acid bases or
amino acid residues in two sequences that are the same when aligned
for maximum correspondence over a specified comparison window.
[0240] The term "percentage of sequence identity" refers to the
value determined by comparing two optimally aligned sequences over
a comparison window, wherein the portion of the polynucleotide or
polypeptide sequence in the comparison window may comprise
additions or deletions (i.e., gaps) as compared to the reference
sequence (which does not comprise additions or deletions) for
optimal alignment of the two sequences. The percentage is
calculated by determining the number of positions at which the
identical nucleic acid base or amino acid residue occurs in both
sequences to yield the number of matched positions, dividing the
number of matched positions by the total number of positions in the
window of comparison and multiplying the results by 100 to yield
the percentage of sequence identity. Useful examples of percent
sequence identities include, but are not limited to, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90% or 95%, or any integer percentage from
50% to 100%. These identities can be determined using any of the
programs described herein.
[0241] Sequence alignments and percent identity or similarity
calculations may be determined using a variety of comparison
methods designed to detect homologous sequences including, but not
limited to, the MegAlign.TM. program of the LASERGENE
bioinformatics computing suite (DNASTAR Inc., Madison, Wis.).
Within the context of this application it will be understood that
where sequence analysis software is used for analysis, that the
results of the analysis will be based on the "default values" of
the program referenced, unless otherwise specified. As used herein
"default values" will mean any set of values or parameters that
originally load with the software when first initialized.
[0242] The "Clustal V method of alignment" corresponds to the
alignment method labeled Clustal V (described by Higgins and Sharp,
(1989) CABIOS 5:151-153; Higgins et al., (1992) Comput Appl Biosci
8:189-191) and found in the MegAlign.TM. program of the LASERGENE
bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). For
multiple alignments, the default values correspond to GAP
PENALTY=10 and GAP LENGTH PENALTY=10. Default parameters for
pairwise alignments and calculation of percent identity of protein
sequences using the Clustal method are KTUPLE=1, GAP PENALTY=3,
WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters
are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. After
alignment of the sequences using the Clustal V program, it is
possible to obtain a "percent identity" by viewing the "sequence
distances" table in the same program.
[0243] The "Clustal W method of alignment" corresponds to the
alignment method labeled Clustal W (described by Higgins and Sharp,
(1989) CABIOS 5:151-153; Higgins et al., (1992) Comput Appl Biosci
8:189-191) and found in the MegAlign.TM. v6.1 program of the
LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison,
Wis.). Default parameters for multiple alignment (GAP PENALTY=10,
GAP LENGTH PENALTY=0.2, Delay Divergen Seqs (%)=30, DNA Transition
Weight=0.5, Protein Weight Matrix=Gonnet Series, DNA Weight
Matrix=IUB). After alignment of the sequences using the Clustal W
program, it is possible to obtain a "percent identity" by viewing
the "sequence distances" table in the same program.
[0244] Unless otherwise stated, sequence identity/similarity values
provided herein refer to the value obtained using GAP Version 10
(GCG, Accelrys, San Diego, Calif.) using the following parameters:
% identity and % similarity for a nucleotide sequence using a gap
creation penalty weight of 50 and a gap length extension penalty
weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and %
similarity for an amino acid sequence using a GAP creation penalty
weight of 8 and a gap length extension penalty of 2, and the
BLOSUM62 scoring matrix (Henikoff and Henikoff, (1989) Proc. Natl.
Acad. Sci. USA 89:10915). GAP uses the algorithm of Needleman and
Wunsch, (1970) J Mol Biol 48:443-53, to find an alignment of two
complete sequences that maximizes the number of matches and
minimizes the number of gaps. GAP considers all possible alignments
and gap positions and creates the alignment with the largest number
of matched bases and the fewest gaps, using a gap creation penalty
and a gap extension penalty in units of matched bases.
[0245] "BLAST" is a searching algorithm provided by the National
Center for Biotechnology Information (NCBI) used to find regions of
similarity between biological sequences. The program compares
nucleotide or protein sequences to sequence databases and
calculates the statistical significance of matches to identify
sequences having sufficient similarity to a query sequence such
that the similarity would not be predicted to have occurred
randomly. BLAST reports the identified sequences and their local
alignment to the query sequence.
[0246] It is well understood by one skilled in the art that many
levels of sequence identity are useful in identifying polypeptides
from other species or modified naturally or synthetically wherein
such polypeptides have the same or similar function or activity.
Useful examples of percent identities include, but are not limited
to, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, or any
integer percentage from 50% to 100%. Indeed, any integer amino acid
identity from 50% to 100% may be useful in describing the present
disclosure, such as 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%,
60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%,
73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%,
86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or
99%.
[0247] "Gene" includes a nucleic acid fragment that expresses a
functional molecule such as, but not limited to, a specific
protein, including regulatory sequences preceding (5' non-coding
sequences) and following (3' non-coding sequences) the coding
sequence. "Native gene" refers to a gene as found in nature with
its own regulatory sequences.
[0248] A "mutated gene" is a gene that has been altered through
human intervention. Such a "mutated gene" has a sequence that
differs from the sequence of the corresponding non-mutated gene by
at least one nucleotide addition, deletion, or substitution. In
certain embodiments of the disclosure, the mutated gene comprises
an alteration that results from a guide polynucleotide/Cas
endonuclease system as disclosed herein. A mutated plant is a plant
comprising a mutated gene.
[0249] As used herein, a "targeted mutation" is a mutation in a
native gene that was made by altering a target sequence within the
native gene using a method involving a double-strand-break-inducing
agent that is capable of inducing a double-strand break in the DNA
of the target sequence as disclosed herein or known in the art.
[0250] In one embodiment, the targeted mutation is the result of a
guide polynucleotide/Cas endonuclease induced gene editing as
described herein. The guide polynucleotide/Cas endonuclease induced
targeted mutation can occur in a nucleotide sequence that is
located within or outside a genomic target site that is recognized
and cleaved by a Cas endonuclease.
[0251] The term "genome" as it applies to a plant cells encompasses
not only chromosomal DNA found within the nucleus, but organelle
DNA found within subcellular components (e.g., mitochondria, or
plastid) of the cell.
[0252] A "codon-modified gene" or "codon-preferred gene" or
"codon-optimized gene" is a gene having its frequency of codon
usage designed to mimic the frequency of preferred codon usage of
the host cell.
[0253] An "allele" is one of several alternative forms of a gene
occupying a given locus on a chromosome. When all the alleles
present at a given locus on a chromosome are the same, that plant
is homozygous at that locus. If the alleles present at a given
locus on a chromosome differ, that plant is heterozygous at that
locus.
[0254] "Coding sequence" refers to a polynucleotide sequence which
codes for a specific amino acid sequence. "Regulatory sequences"
refer to nucleotide sequences located upstream (5' non-coding
sequences), within, or downstream (3' non-coding sequences) of a
coding sequence, and which influence the transcription, RNA
processing or stability, or translation of the associated coding
sequence. Regulatory sequences may include, but are not limited to:
promoters, translation leader sequences, 5' untranslated sequences,
3' untranslated sequences, introns, polyadenylation target
sequences, RNA processing sites, effector binding sites, and
stem-loop structures.
[0255] "A plant-optimized nucleotide sequence" is nucleotide
sequence that has been optimized for increased expression in
plants, particularly for increased expression in plants or in one
or more plants of interest. For example, a plant-optimized
nucleotide sequence can be synthesized by modifying a nucleotide
sequence encoding a protein such as, for example,
double-strand-break-inducing agent (e.g., an endonuclease) as
disclosed herein, using one or more plant-preferred codons for
improved expression. See, for example, Campbell and Gowri (1990)
Plant Physiol. 92:1-11 for a discussion of host-preferred codon
usage.
[0256] Methods are available in the art for synthesizing
plant-preferred genes. See, for example, U.S. Pat. Nos. 5,380,831,
and 5,436,391, and Murray et al. (1989) Nucleic Acids Res.
17:477-498, herein incorporated by reference. Additional sequence
modifications are known to enhance gene expression in a plant host.
These include, for example, elimination of: one or more sequences
encoding spurious polyadenylation signals, one or more exon-intron
splice site signals, one or more transposon-like repeats, and other
such well-characterized sequences that may be deleterious to gene
expression. The G-C content of the sequence may be adjusted to
levels average for a given plant host, as calculated by reference
to known genes expressed in the host plant cell. When possible, the
sequence is modified to avoid one or more predicted hairpin
secondary mRNA structures. Thus, "a plant-optimized nucleotide
sequence" of the present disclosure comprises one or more of such
sequence modifications.
[0257] "Promoter" refers to a DNA sequence capable of controlling
the expression of a coding sequence or functional RNA. The promoter
sequence consists of proximal and more distal upstream elements,
the latter elements often referred to as enhancers. An "enhancer"
is a DNA sequence that can stimulate promoter activity, and may be
an innate element of the promoter or a heterologous element
inserted to enhance the level or tissue-specificity of a promoter.
Promoters may be derived in their entirety from a native gene, or
be composed of different elements derived from different promoters
found in nature, and/or comprise synthetic DNA segments. It is
understood by those skilled in the art that different promoters may
direct the expression of a gene in different tissues or cell types,
or at different stages of development, or in response to different
environmental conditions. It is further recognized that since in
most cases the exact boundaries of regulatory sequences have not
been completely defined, DNA fragments of some variation may have
identical promoter activity. Promoters that cause a gene to be
expressed in most cell types at most times are commonly referred to
as "constitutive promoters".
[0258] It has been shown that certain promoters are able to direct
RNA synthesis at a higher rate than others. These are called
"strong promoters". Certain other promoters have been shown to
direct RNA synthesis at higher levels only in particular types of
cells or tissues and are often referred to as "tissue specific
promoters", or "tissue-preferred promoters" if the promoters direct
RNA synthesis preferably in certain tissues but also in other
tissues at reduced levels. Since patterns of expression of a
chimeric gene (or genes) introduced into a plant are controlled
using promoters, there is an ongoing interest in the isolation of
novel promoters which are capable of controlling the expression of
a chimeric gene or (genes) at certain levels in specific tissue
types or at specific plant developmental stages.
[0259] New promoters of various types useful in plant cells are
constantly being discovered; numerous examples may be found in the
compilation by Okamuro and Goldberg, (1989) In The Biochemistry of
Plants, Vol. 115, Stumpf and Conn, eds (New York, N.Y.: Academic
Press), pp. 1-82.
[0260] "Translation leader sequence" refers to a polynucleotide
sequence located between the promoter sequence of a gene and the
coding sequence. The translation leader sequence is present in the
fully processed mRNA upstream of the translation start sequence.
The translation leader sequence may affect processing of the
primary transcript to mRNA, mRNA stability or translation
efficiency. Examples of translation leader sequences have been
described (e.g., Turner and Foster, (1995) Mol Biotechnol
3:225-236).
[0261] "3' non-coding sequences", "transcription terminator" or
"termination sequences" refer to DNA sequences located downstream
of a coding sequence and include polyadenylation recognition
sequences and other sequences encoding regulatory signals capable
of affecting mRNA processing or gene expression. The
polyadenylation signal is usually characterized by affecting the
addition of polyadenylic acid tracts to the 3' end of the mRNA
precursor. The use of different 3' non-coding sequences is
exemplified by Ingelbrecht et al., (1989) Plant Cell 1:671-680.
[0262] "RNA transcript" refers to the product resulting from RNA
polymerase-catalyzed transcription of a DNA sequence. When the RNA
transcript is a perfect complimentary copy of the DNA sequence, it
is referred to as the primary transcript. A RNA transcript is
referred to as the mature RNA when it is a RNA sequence derived
from post-transcriptional processing of the primary transcript.
"Messenger RNA" or "mRNA" refers to the RNA that is without introns
and that can be translated into protein by the cell. "cDNA" refers
to a DNA that is complementary to, and synthesized from, a mRNA
template using the enzyme reverse transcriptase. The cDNA can be
single-stranded or converted into double-stranded form using the
Klenow fragment of DNA polymerase I. "Sense" RNA refers to RNA
transcript that includes the mRNA and can be translated into
protein within a cell or in vitro. "Antisense RNA" refers to an RNA
transcript that is complementary to all or part of a target primary
transcript or mRNA, and that blocks the expression of a target gene
(see, e.g., U.S. Pat. No. 5,107,065). The complementarity of an
antisense RNA may be with any part of the specific gene transcript,
i.e., at the 5' non-coding sequence, 3' non-coding sequence,
introns, or the coding sequence. "Functional RNA" refers to
antisense RNA, ribozyme RNA, or other RNA that may not be
translated but yet has an effect on cellular processes. The terms
"complement" and "reverse complement" are used interchangeably
herein with respect to mRNA transcripts, and are meant to define
the antisense RNA of the message.
[0263] The term "operably linked" refers to the association of
nucleic acid sequences on a single nucleic acid fragment so that
the function of one is regulated by the other. For example, a
promoter is operably linked with a coding sequence when it is
capable of regulating the expression of that coding sequence (i.e.,
the coding sequence is under the transcriptional control of the
promoter). Coding sequences can be operably linked to regulatory
sequences in a sense or antisense orientation. In another example,
the complementary RNA regions can be operably linked, either
directly or indirectly, 5' to the target mRNA, or 3' to the target
mRNA, or within the target mRNA, or a first complementary region is
5' and its complement is 3' to the target m RNA.
[0264] Standard recombinant DNA and molecular cloning techniques
used herein are well known in the art and are described more fully
in Sambrook et al., Molecular Cloning: A Laboratory Manual; Cold
Spring Harbor Laboratory: Cold Spring Harbor, NY (1989).
Transformation methods are well known to those skilled in the art
and are described infra.
[0265] "PCR" or "polymerase chain reaction" is a technique for the
synthesis of specific DNA segments and consists of a series of
repetitive denaturation, annealing, and extension cycles.
Typically, a double-stranded DNA is heat denatured, and two primers
complementary to the 3' boundaries of the target segment are
annealed to the DNA at low temperature, and then extended at an
intermediate temperature. One set of these three consecutive steps
is referred to as a "cycle".
[0266] The term "recombinant" refers to an artificial combination
of two otherwise separated segments of sequence, e.g., by chemical
synthesis, or manipulation of isolated segments of nucleic acids by
genetic engineering techniques.
[0267] The terms "plasmid", "vector" and "cassette" refer to an
extra chromosomal element often carrying genes that are not part of
the central metabolism of the cell, and usually in the form of
double-stranded DNA. Such elements may be autonomously replicating
sequences, genome integrating sequences, phage, or nucleotide
sequences, in linear or circular form, of a single- or
double-stranded DNA or RNA, derived from any source, in which a
number of nucleotide sequences have been joined or recombined into
a unique construction which is capable of introducing a
polynucleotide of interest into a cell. "Transformation cassette"
refers to a specific vector containing a foreign gene and having
elements in addition to the foreign gene that facilitates
transformation of a particular host cell. "Expression cassette"
refers to a specific vector containing a foreign gene and having
elements in addition to the foreign gene that allow for expression
of that gene in a foreign host.
[0268] The terms "recombinant DNA molecule", "recombinant
construct", "expression construct", "construct", "construct", and
"recombinant DNA construct" are used interchangeably herein. A
recombinant construct comprises an artificial combination of
nucleic acid fragments, e.g., regulatory and coding sequences that
are not all found together in nature. For example, a construct may
comprise regulatory sequences and coding sequences that are derived
from different sources, or regulatory sequences and coding
sequences derived from the same source, but arranged in a manner
different than that found in nature. Such a construct may be used
by itself or may be used in conjunction with a vector. If a vector
is used, then the choice of vector is dependent upon the method
that will be used to transform host cells as is well known to those
skilled in the art. For example, a plasmid vector can be used. The
skilled artisan is well aware of the genetic elements that must be
present on the vector in order to successfully transform, select
and propagate host cells. The skilled artisan will also recognize
that different independent transformation events may result in
different levels and patterns of expression (Jones et al., (1985)
EMBO J 4:2411-2418; De Almeida et al., (1989) Mol Gen Genetics
218:78-86), and thus that multiple events are typically screened in
order to obtain lines displaying the desired expression level and
pattern. Such screening may be accomplished standard molecular
biological, biochemical, and other assays including Southern
analysis of DNA, Northern analysis of mRNA expression, PCR, real
time quantitative PCR (qPCR), reverse transcription PCR (RT-PCR),
immunoblotting analysis of protein expression, enzyme or activity
assays, and/or phenotypic analysis.
[0269] The term "expression", as used herein, refers to the
production of a functional end-product (e.g., an mRNA, guide
polynucleotide, or a protein) in either precursor or mature
form.
[0270] The term "introduced" means providing a nucleic acid (e.g.,
expression construct) or protein into a cell. Introduced includes
reference to the incorporation of a nucleic acid into a eukaryotic
or prokaryotic cell where the nucleic acid may be incorporated into
the genome of the cell, and includes reference to the transient
provision of a nucleic acid or protein to the cell. Introduced
includes reference to stable or transient transformation methods,
as well as sexually crossing. Thus, "introduced" in the context of
inserting a nucleic acid fragment (e.g., a recombinant DNA
construct/expression construct) into a cell, means "transfection"
or "transformation" or "transduction" and includes reference to the
incorporation of a nucleic acid fragment into a eukaryotic or
prokaryotic cell where the nucleic acid fragment may be
incorporated into the genome of the cell (e.g., chromosome,
plasmid, plastid, or mitochondrial DNA), converted into an
autonomous replicon, or transiently expressed (e.g., transfected
mRNA).
[0271] "Mature" protein refers to a post-translationally processed
polypeptide (i.e., one from which any pre- or propeptides present
in the primary translation product have been removed). "Precursor"
protein refers to the primary product of translation of mRNA (i.e.,
with pre- and propeptides still present). Pre- and propeptides may
be but are not limited to intracellular localization signals.
[0272] "Stable transformation" refers to the transfer of a nucleic
acid fragment into a genome of a host organism, including both
nuclear and organellar genomes, resulting in genetically stable
inheritance. In contrast, "transient transformation" refers to the
transfer of a nucleic acid fragment into the nucleus, or other
DNA-containing organelle, of a host organism resulting in gene
expression without integration or stable inheritance. Host
organisms containing the transformed nucleic acid fragments are
referred to as "transgenic" organisms.
[0273] The commercial development of genetically improved germplasm
has also advanced to the stage of introducing multiple traits into
crop plants, often referred to as a gene stacking approach. In this
approach, multiple genes conferring different characteristics of
interest can be introduced into a plant. Gene stacking can be
accomplished by many means including but not limited to
co-transformation, retransformation, and crossing lines with
different genes of interest.
[0274] The term "plant" refers to whole plants, plant organs, plant
tissues, seeds, plant cells, seeds and progeny of the same. Plant
cells include, without limitation, cells from seeds, suspension
cultures, embryos, meristematic regions, callus tissue, leaves,
roots, shoots, gametophytes, sporophytes, pollen and microspores.
Plant parts include differentiated and undifferentiated tissues
including, but not limited to roots, stems, shoots, leaves,
pollens, seeds, tumor tissue and various forms of cells and culture
(e.g., single cells, protoplasts, embryos, and callus tissue). The
plant tissue may be in plant or in a plant organ, tissue or cell
culture. The term "plant organ" refers to plant tissue or a group
of tissues that constitute a morphologically and functionally
distinct part of a plant. The term "genome" refers to the entire
complement of genetic material (genes and non-coding sequences)
that is present in each cell of an organism, or virus or organelle;
and/or a complete set of chromosomes inherited as a (haploid) unit
from one parent. "Progeny" comprises any subsequent generation of a
plant.
[0275] A transgenic plant includes, for example, a plant which
comprises within its genome a heterologous polynucleotide
introduced by a transformation step. The heterologous
polynucleotide can be stably integrated within the genome such that
the polynucleotide is passed on to successive generations. The
heterologous polynucleotide may be integrated into the genome alone
or as part of a recombinant DNA construct. A transgenic plant can
also comprise more than one heterologous polynucleotide within its
genome. Each heterologous polynucleotide may confer a different
trait to the transgenic plant. A heterologous polynucleotide can
include a sequence that originates from a foreign species, or, if
from the same species, can be substantially modified from its
native form. Transgenic can include any cell, cell line, callus,
tissue, plant part or plant, the genotype of which has been altered
by the presence of heterologous nucleic acid including those
transgenics initially so altered as well as those created by sexual
crosses or asexual propagation from the initial transgenic. The
alterations of the genome (chromosomal or extra-chromosomal) by
conventional plant breeding methods, by the genome editing
procedure described herein that does not result in an insertion of
a foreign polynucleotide, or by naturally occurring events such as
random cross-fertilization, non-recombinant viral infection,
non-recombinant bacterial transformation, non-recombinant
transposition, or spontaneous mutation are not intended to be
regarded as transgenic.
[0276] In one embodiment of the disclosure, the composition
comprises a plant or seed comprising a recombinant DNA construct
and a guide polynucleotide, wherein said guide polynucleotide does
not solely comprise ribonucleic acids, wherein said recombinant DNA
construct comprises a promoter operably linked to a nucleotide
sequence encoding a plant optimized Cas endonuclease, wherein said
plant optimized Cas endonuclease and guide polynucleotide are
capable of forming a complex and creating a double strand break in
a genomic target site of said plant.
[0277] In another embodiment of the disclosure, the composition
further comprising a polynucleotide of interest integrated into a
genomic target site of said plant.
[0278] In another embodiment of the disclosure, the composition
further comprising a modification at a genomic target site, wherein
the modification is selected from the group consisting of (i) a
replacement of at least one nucleotide, (ii) a deletion of at least
one nucleotide, (iii) an insertion of at least one nucleotide, and
(iv) any combination of (i)-(iii).
[0279] In another embodiment of the disclosure, the composition
comprises a plant or seed comprising at least one altered target
sequence, wherein the at least one altered target sequence
originated from a corresponding target sequence that was recognized
and cleaved by a guide polynucleotide/Cas endonuclease complex,
wherein the Cas endonuclease is capable of introducing a
double-strand break at said target site in the plant genome,
wherein said guide polynucleotide does not solely comprise
ribonucleic acids.
[0280] In another embodiment of the disclosure, the composition
comprises a plant or seed comprising a modified nucleotide
sequence, wherein the modified nucleotide sequence was produced by
providing a guide polynucleotide, a polynucleotide modification
template and at least one Cas endonuclease to a cell, wherein said
guide polynucleotide does not solely comprise ribonucleic acids,
wherein the Cas endonuclease is capable of introducing a
double-strand break at a target site in the plant genome, wherein
said polynucleotide modification template comprises at least one
nucleotide modification of said nucleotide sequence.
[0281] In certain embodiments of the disclosure, a fertile plant is
a plant that produces viable male and female gametes and is
self-fertile. Such a self-fertile plant can produce a progeny plant
without the contribution from any other plant of a gamete and the
genetic material contained therein. Other embodiments of the
disclosure can involve the use of a plant that is not self-fertile
because the plant does not produce male gametes, or female gametes,
or both, that are viable or otherwise capable of fertilization. As
used herein, a "male sterile plant" is a plant that does not
produce male gametes that are viable or otherwise capable of
fertilization. As used herein, a "female sterile plant" is a plant
that does not produce female gametes that are viable or otherwise
capable of fertilization. It is recognized that male-sterile and
female-sterile plants can be female-fertile and male-fertile,
respectively. It is further recognized that a male fertile (but
female sterile) plant can produce viable progeny when crossed with
a female fertile plant and that a female fertile (but male sterile)
plant can produce viable progeny when crossed with a male fertile
plant.
[0282] A "centimorgan" (cM) or "map unit" is the distance between
two linked genes, markers, target sites, loci, or any pair thereof,
wherein 1% of the products of meiosis are recombinant. Thus, a
centimorgan is equivalent to a distance equal to a 1% average
recombination frequency between the two linked genes, markers,
target sites, loci, or any pair thereof.
[0283] Breeding Methods and Methods for Selecting Plants Utilizing
a Two Component RNA Guide and Cas Endonuclease System.
[0284] The present disclosure finds use in the breeding of plants
comprising one or more transgenic traits. Most commonly, transgenic
traits are randomly inserted throughout the plant genome as a
consequence of transformation systems based on Agrobacterium,
biolistics, or other commonly used procedures. More recently, gene
targeting protocols have been developed that enable directed
transgene insertion. One important technology, site-specific
integration (SSI) enables the targeting of a transgene to the same
chromosomal location as a previously inserted transgene.
Custom-designed meganucleases and custom-designed zinc finger
meganucleases allow researchers to design nucleases to target
specific chromosomal locations, and these reagents allow the
targeting of transgenes at the chromosomal site cleaved by these
nucleases.
[0285] The currently used systems for precision genetic engineering
of eukaryotic genomes, e.g. plant genomes, rely upon homing
endonucleases, meganucleases, zinc finger nucleases, and
transcription activator-like effector nucleases (TALENs), which
require de novo protein engineering for every new target locus.
[0286] The highly specific, guide polynucleotide/Cas9 endonuclease
system described herein, is more easily customizable and therefore
more useful when modification of many different target sequences is
the goal. In one embodiment, the disclosure takes further advantage
of the multiple component nature of the guide polynucleotide/Cas
system, with its constant protein component, the Cas endonuclease,
and its variable and easily reprogrammable targeting component, the
guide polynucleotide. As described herein, the guide polynucleotide
can comprise a DNA, RNA or DNA-RNA combination sequence making it
very customizable and therefore more useful for when modification
of one or many different target sequences is the goal.
[0287] The guide polynucleotide/Cas system described herein is
especially useful for genome engineering, especially plant genome
engineering, in circumstances where nuclease off-target cutting can
be toxic to the targeted cells. In one embodiment of the guide
polynucleotide/Cas system described herein, the constant component,
in the form of an expression-optimized Cas9 gene, is stably
integrated into the target genome, e.g. plant genome. Expression of
the Cas9 gene is under control of a promoter, e.g. plant promoter,
which can be a constitutive promoter, tissue-specific promoter or
inducible promoter, e.g. temperature-inducible, stress-inducible,
developmental stage inducible, or chemically inducible promoter. In
the absence of the variable targeting domain, of the guide
polynucleotide, the Cas protein is not able to recognize and cut
DNA and therefore its presence in the plant cell should have little
or no consequence. Hence a key advantage of the guide
polynucleotide/Cas system described herein is the ability to create
and maintain a cell line or transgenic organism capable of
efficient expression of the Cas protein with little or no
consequence to cell viability. In order to induce cutting at
desired genomic sites to achieve targeted genetic modifications,
guide polynucleotides can be introduced by a variety of methods
into cells containing the stably-integrated and expressed Cas gene.
For example, guide polynucleotides can be chemically or
enzymatically synthesized, and introduced into the Cas expressing
cells via direct delivery methods such a particle bombardment or
electroporation.
[0288] Alternatively, genes capable of efficiently expressing guide
polynucleotides in the target cells can be synthesized chemically,
enzymatically or in a biological system, and these genes can be
introduced into the Cas expressing cells via direct delivery
methods such a particle bombardment, electroporation or biological
delivery methods such as Agrobacterium mediated DNA delivery.
[0289] One embodiment of the disclosure is a method for selecting a
plant comprising an altered target site in its plant genome, the
method comprising: a) obtaining a first plant comprising at least
one Cas endonuclease capable of introducing a double strand break
at a target site in the plant genome; b) obtaining a second plant
comprising a guide polynucleotide that is capable of forming a
complex with the Cas endonuclease of (a), wherein the guide
polynucleotide does not solely comprise ribonucleic acids, c)
crossing the first plant of (a) with the second plant of (b); d)
evaluating the progeny of (c) for an alteration in the target site
and e) selecting a progeny plant that possesses the desired
alteration of said target site.
[0290] Another embodiment of the disclosure is a method for
selecting a plant comprising an altered target site in its plant
genome, the method comprising: a) obtaining a first plant
comprising at least one Cas endonuclease capable of introducing a
double strand break at a target site in the plant genome; b)
obtaining a second plant comprising a guide polynucleotide and a
donor DNA, wherein the guide polynucleotide does not solely
comprise ribonucleic acids, wherein said guide polynucleotide is
capable of forming a complex with the Cas endonuclease of (a),
wherein said donor DNA comprises a polynucleotide of interest; c)
crossing the first plant of (a) with the second plant of (b); d)
evaluating the progeny of (c) for an alteration in the target site
and e) selecting a progeny plant that comprises the polynucleotide
of interest inserted at said target site.
[0291] Another embodiment of the disclosure is a method for
selecting a plant comprising an altered target site in its plant
genome, the method comprising selecting at least one progeny plant
that comprises an alteration at a target site in its plant genome,
wherein said progeny plant was obtained by crossing a first plant
expressing at least one Cas endonuclease to a second plant
comprising a guide polynucleotide and a donor DNA, wherein the
guide polynucleotide does not solely comprise ribonucleic acids,
wherein said Cas endonuclease is capable of introducing a double
strand break at said target site, wherein said donor DNA comprises
a polynucleotide of interest.
[0292] As disclosed herein, a guide polynucleotide/Cas system
mediating gene targeting can be used in methods for directing
transgene insertion and/or for producing complex transgenic trait
loci comprising multiple transgenes in a fashion similar as
disclosed in WO2013/0198888 (published Aug. 1, 2013) where instead
of using a double strand break inducing agent to introduce a gene
of interest, a guide polynucleotide/Cas system as disclosed herein
is used. In one embodiment, a complex transgenic trait locus is a
genomic locus that has multiple transgenes genetically linked to
each other. By inserting independent transgenes within 0.1, 0.2,
0.3, 04, 0.5, 1, 2, or even 5 centimorgans (cM) from each other,
the transgenes can be bred as a single genetic locus (see, for
example, U.S. patent application Ser. No. 13/427,138) or PCT
application PCT/US2012/030061. After selecting a plant comprising a
transgene, plants containing (at least) one transgenes can be
crossed to form an F1 that contains both transgenes. In progeny
from these F1 (F2 or BC1) 1/500 progeny would have the two
different transgenes recombined onto the same chromosome. The
complex locus can then be bred as single genetic locus with both
transgene traits. This process can be repeated to stack as many
traits as desired.
[0293] Proteins may be altered in various ways including amino acid
substitutions, deletions, truncations, and insertions. Methods for
such manipulations are generally known. For example, amino acid
sequence variants of the protein(s) can be prepared by mutations in
the DNA. Methods for mutagenesis and nucleotide sequence
alterations include, for example, Kunkel, (1985) Proc. Natl. Acad.
Sci. USA 82:488-92; Kunkel et al., (1987) Meth Enzymol 154:367-82;
U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques
in Molecular Biology (MacMillan Publishing Company, New York) and
the references cited therein. Guidance regarding amino acid
substitutions not likely to affect biological activity of the
protein is found, for example, in the model of Dayhoff et al.,
(1978) Atlas of Protein Sequence and Structure (Natl Biomed Res
Found, Washington, D.C.). Conservative substitutions, such as
exchanging one amino acid with another having similar properties,
may be preferable. Conservative deletions, insertions, and amino
acid substitutions are not expected to produce radical changes in
the characteristics of the protein, and the effect of any
substitution, deletion, insertion, or combination thereof can be
evaluated by routine screening assays. Assays for
double-strand-break-inducing activity are known and generally
measure the overall activity and specificity of the agent on DNA
substrates containing target sites.
[0294] A variety of methods are known for the introduction of
nucleotide sequences and polypeptides into an organism, including,
for example, transformation, sexual crossing, and the introduction
of the polypeptide, DNA, or mRNA into the cell.
[0295] Methods for contacting, providing, and/or introducing a
composition into various organisms are known and include but are
not limited to, stable transformation methods, transient
transformation methods, virus-mediated methods, and sexual
breeding. Stable transformation indicates that the introduced
polynucleotide integrates into the genome of the organism and is
capable of being inherited by progeny thereof. Transient
transformation indicates that the introduced composition is only
temporarily expressed or present in the organism.
[0296] Protocols for introducing polynucleotides and polypeptides
into plants may vary depending on the type of plant or plant cell
targeted for transformation, such as monocot or dicot. Suitable
methods of introducing polynucleotides and polypeptides into plant
cells and subsequent insertion into the plant genome include
microinjection (Crossway et al., (1986) Biotechniques 4:320-34 and
U.S. Pat. No. 6,300,543), meristem transformation (U.S. Pat. No.
5,736,369), electroporation (Riggs et al., (1986) Proc. Natl. Acad.
Sci. USA 83:5602-6, Agrobacterium-mediated transformation (U.S.
Pat. Nos. 5,563,055 and 5,981,840), direct gene transfer
(Paszkowski et al., (1984) EMBO J 3:2717-22), and ballistic
particle acceleration (U.S. Pat. Nos. 4,945,050; 5,879,918;
5,886,244; 5,932,782; Tomes et al., (1995) "Direct DNA Transfer
into Intact Plant Cells via Microprojectile Bombardment" in Plant
Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg
& Phillips (Springer-Verlag, Berlin); McCabe et al., (1988)
Biotechnology 6:923-6; Weissinger et al., (1988) Ann Rev Genet
22:421-77; Sanford et al., (1987) Particulate Science and
Technology 5:27-37 (onion); Christou et al., (1988) Plant Physiol
87:671-4 (soybean); Finer and McMullen, (1991) In Vitro Cell Dev
Biol 27P:175-82 (soybean); Singh et al., (1998) Theor Appl Genet
96:319-24 (soybean); Datta et al., (1990) Biotechnology 8:736-40
(rice); Klein et al., (1988) Proc. Natl. Acad. Sci. USA 85:4305-9
(maize); Klein et al., (1988) Biotechnology 6:559-63 (maize); U.S.
Pat. Nos. 5,240,855; 5,322,783 and 5,324,646; Klein et al., (1988)
Plant Physiol 91:440-4 (maize); Fromm et al., (1990) Biotechnology
8:833-9 (maize); Hooykaas-Van Slogteren et al., (1984) Nature
311:763-4; U.S. Pat. No. 5,736,369 (cereals); Bytebier et al.,
(1987) Proc. Natl. Acad. Sci. USA 84:5345-9 (Liliaceae); De Wet et
al., (1985) in The Experimental Manipulation of Ovule Tissues, ed.
Chapman et al., (Longman, N.Y.), pp. 197-209 (pollen); Kaeppler et
al., (1990) Plant Cell Rep 9:415-8) and Kaeppler et al., (1992)
Theor Appl Genet 84:560-6 (whisker-mediated transformation);
D'Halluin et al., (1992) Plant Cell 4:1495-505 (electroporation);
Li et al., (1993) Plant Cell Rep 12:250-5; Christou and Ford (1995)
Annals Botany 75:407-13 (rice) and Osjoda et al., (1996) Nat
Biotechnol 14:745-50 (maize via Agrobacterium tumefaciens).
[0297] Alternatively, polynucleotides may be introduced into plants
by contacting plants with a virus or viral nucleic acids.
Generally, such methods involve incorporating a polynucleotide
within a viral DNA or RNA molecule. In some examples a polypeptide
of interest may be initially synthesized as part of a viral
polyprotein, which is later processed by proteolysis in vivo or in
vitro to produce the desired recombinant protein. Methods for
introducing polynucleotides into plants and expressing a protein
encoded therein, involving viral DNA or RNA molecules, are known,
see, for example, U.S. Pat. Nos. 5,889,191, 5,889,190, 5,866,785,
5,589,367 and 5,316,931. Transient transformation methods include,
but are not limited to, the introduction of polypeptides, such as a
double-strand break inducing agent, directly into the organism, the
introduction of polynucleotides such as DNA and/or RNA
polynucleotides, and the introduction of the RNA transcript, such
as an mRNA encoding a double-strand break inducing agent, into the
organism. Such methods include, for example, microinjection or
particle bombardment. See, for example Crossway et al., (1986) Mol
Gen Genet 202:179-85; Nomura et al., (1986) Plant Sci 44:53-8;
Hepler et al., (1994) Proc. Natl. Acad. Sci. USA 91:2176-80; and,
Hush et al., (1994) J Cell Sci 107:775-84.
[0298] The term "dicot" refers to the subclass of angiosperm plants
also knows as "dicotyledoneae" and includes reference to whole
plants, plant organs (e.g., leaves, stems, roots, etc.), seeds,
plant cells, and progeny of the same. Plant cell, as used herein
includes, without limitation, seeds, suspension cultures, embryos,
meristematic regions, callus tissue, leaves, roots, shoots,
gametophytes, sporophytes, pollen, and microspores.
[0299] The term "crossed" or "cross" or "crossing" in the context
of this disclosure means the fusion of gametes via pollination to
produce progeny (i.e., cells, seeds, or plants). The term
encompasses both sexual crosses (the pollination of one plant by
another) and selfing (self-pollination, i.e., when the pollen and
ovule are from the same plant or genetically identical plants).
[0300] The term "introgression" refers to the transmission of a
desired allele of a genetic locus from one genetic background to
another. For example, introgression of a desired allele at a
specified locus can be transmitted to at least one progeny plant
via a sexual cross between two parent plants, where at least one of
the parent plants has the desired allele within its genome.
Alternatively, for example, transmission of an allele can occur by
recombination between two donor genomes, e.g., in a fused
protoplast, where at least one of the donor protoplasts has the
desired allele in its genome. The desired allele can be, e.g., a
transgene or a selected allele of a marker or QTL.
[0301] Standard DNA isolation, purification, molecular cloning,
vector construction, and verification/characterization methods are
well established, see, for example Sambrook et al., (1989)
Molecular Cloning: A Laboratory Manual, (Cold Spring Harbor
Laboratory Press, NY). Vectors and constructs include circular
plasmids, and linear polynucleotides, comprising a polynucleotide
of interest and optionally other components including linkers,
adapters, regulatory regions, introns, restriction sites,
enhancers, insulators, selectable markers, nucleotide sequences of
interest, promoters, and/or other sites that aid in vector
construction or analysis. In some examples a recognition site
and/or target site can be contained within an intron, coding
sequence, 5' UTRs, 3' UTRs, and/or regulatory regions.
[0302] The present disclosure further provides expression
constructs for expressing in a yeast or plant, plant cell, or plant
part a guide polynucleotide/Cas system that is capable of binding
to and creating a double strand break in a target site. In one
embodiment, the expression constructs of the disclosure comprise a
promoter operably linked to a nucleotide sequence encoding a Cas
gene and a promoter operably linked to a guide polynucleotide of
the present disclosure. The promoter is capable of driving
expression of an operably linked nucleotide sequence in a plant
cell.
[0303] A promoter is a region of DNA involved in recognition and
binding of RNA polymerase and other proteins to initiate
transcription. A plant promoter is a promoter capable of initiating
transcription in a plant cell, for a review of plant promoters,
see, Potenza et al., (2004) In Vitro Cell Dev Biol 40:1-22.
Constitutive promoters include, for example, the core promoter of
the Rsyn7 promoter and other constitutive promoters disclosed in
WO99/43838 and U.S. Pat. No. 6,072,050; the core CaMV 35S promoter
(Odell et al., (1985) Nature 313:810-2); rice actin (McElroy et
al., (1990) Plant Cell 2:163-71); ubiquitin (Christensen et al.,
(1989) Plant Mol Biol 12:619-32; Christensen et al., (1992) Plant
Mol Biol 18:675-89); pEMU (Last et al., (1991) Theor Appl Genet
81:581-8); MAS (Velten et al., (1984) EMBO J 3:2723-30); ALS
promoter (U.S. Pat. No. 5,659,026), and the like. Other
constitutive promoters are described in, for example, U.S. Pat.
Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785;
5,399,680; 5,268,463; 5,608,142 and 6,177,611. In some examples an
inducible promoter may be used. Pathogen-inducible promoters
induced following infection by a pathogen include, but are not
limited to those regulating expression of PR proteins, SAR
proteins, beta-1,3-glucanase, chitinase, etc.
[0304] Chemical-regulated promoters can be used to modulate the
expression of a gene in a plant through the application of an
exogenous chemical regulator. The promoter may be a
chemical-inducible promoter, where application of the chemical
induces gene expression, or a chemical-repressible promoter, where
application of the chemical represses gene expression.
Chemical-inducible promoters include, but are not limited to, the
maize In2-2 promoter, activated by benzene sulfonamide herbicide
safeners (De Veylder et al., (1997) Plant Cell Physiol 38:568-77),
the maize GST promoter (GST-II-27, WO93/01294), activated by
hydrophobic electrophilic compounds used as pre-emergent
herbicides, and the tobacco PR-1a promoter (Ono et al., (2004)
Biosci Biotechnol Biochem 68:803-7) activated by salicylic acid.
Other chemical-regulated promoters include steroid-responsive
promoters (see, for example, the glucocorticoid-inducible promoter
(Schena et al., (1991) Proc. Natl. Acad. Sci. USA 88:10421-5;
McNellis et al., (1998) Plant J 14:247-257); tetracycline-inducible
and tetracycline-repressible promoters (Gatz et al., (1991) Mol Gen
Genet 227:229-37; U.S. Pat. Nos. 5,814,618 and 5,789,156).
[0305] Tissue-preferred promoters can be utilized to target
enhanced expression within a particular plant tissue.
Tissue-preferred promoters include, for example, Kawamata et al.,
(1997) Plant Cell Physiol 38:792-803; Hansen et al., (1997) Mol Gen
Genet 254:337-43; Russell et al., (1997) Transgenic Res 6:157-68;
Rinehart et al., (1996) Plant Physiol 112:1331-41; Van Camp et al.,
(1996) Plant Physiol 112:525-35; Canevascini et al., (1996) Plant
Physiol 112:513-524; Lam, (1994) Results Probl Cell Differ
20:181-96; and Guevara-Garcia et al., (1993) Plant J 4:495-505.
Leaf-preferred promoters include, for example, Yamamoto et al.,
(1997) Plant J 12:255-65; Kwon et al., (1994) Plant Physiol
105:357-67; Yamamoto et al., (1994) Plant Cell Physiol 35:773-8;
Gotor et al., (1993) Plant J 3:509-18; Orozco et al., (1993) Plant
Mol Biol 23:1129-38; Matsuoka et al., (1993) Proc. Natl. Acad. Sci.
USA 90:9586-90; Simpson et al., (1958) EMBO J 4:2723-9; Timko et
al., (1988) Nature 318:57-8. Root-preferred promoters include, for
example, Hire et al., (1992) Plant Mol Biol 20:207-18 (soybean
root-specific glutamine synthase gene); Miao et al., (1991) Plant
Cell 3:11-22 (cytosolic glutamine synthase (GS)); Keller and
Baumgartner, (1991) Plant Cell 3:1051-61 (root-specific control
element in the GRP 1.8 gene of French bean); Sanger et al., (1990)
Plant Mol Biol 14:433-43 (root-specific promoter of A. tumefaciens
mannopine synthase (MAS)); Bogusz et al., (1990) Plant Cell
2:633-41 (root-specific promoters isolated from Parasponia
andersonii and Trema tomentosa); Leach and Aoyagi, (1991) Plant Sci
79:69-76 (A. rhizogenes roIC and roID root-inducing genes); Teeri
et al., (1989) EMBO J 8:343-50 (Agrobacterium wound-induced TR1'
and TR2' genes); VfENOD-GRP3 gene promoter (Kuster et al., (1995)
Plant Mol Biol 29:759-72); and roIB promoter (Capana et al., (1994)
Plant Mol Biol 25:681-91; phaseolin gene (Murai et al., (1983)
Science 23:476-82; Sengopta-Gopalen et al., (1988) Proc. Natl.
Acad. Sci. USA 82:3320-4). See also, U.S. Pat. Nos. 5,837,876;
5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732 and
5,023,179.
[0306] Seed-preferred promoters include both seed-specific
promoters active during seed development, as well as
seed-germinating promoters active during seed germination. See,
Thompson et al., (1989) BioEssays 10:108. Seed-preferred promoters
include, but are not limited to, Cim1 (cytokinin-induced message);
cZ19B1 (maize 19 kDa zein); and milps (myo-inositol-1-phosphate
synthase); (WO00/11177; and U.S. Pat. No. 6,225,529). For dicots,
seed-preferred promoters include, but are not limited to, bean
.beta.-phaseolin, napin, .beta.-conglycinin, soybean lectin,
cruciferin, and the like. For monocots, seed-preferred promoters
include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27
kDa gamma zein, waxy, shrunken 1, shrunken 2, globulin 1, oleosin,
and nuc1. See also, WO00/12733, where seed-preferred promoters from
END1 and END2 genes are disclosed.
[0307] A phenotypic marker is a screenable or selectable marker
that includes visual markers and selectable markers whether it is a
positive or negative selectable marker. Any phenotypic marker can
be used. Specifically, a selectable or screenable marker comprises
a DNA segment that allows one to identify, or select for or against
a molecule or a cell that contains it, often under particular
conditions. These markers can encode an activity, such as, but not
limited to, production of RNA, peptide, or protein, or can provide
a binding site for RNA, peptides, proteins, inorganic and organic
compounds or compositions and the like.
[0308] Examples of selectable markers include, but are not limited
to, DNA segments that comprise restriction enzyme sites; DNA
segments that encode products which provide resistance against
otherwise toxic compounds including antibiotics, such as,
spectinomycin, ampicillin, kanamycin, tetracycline, Basta, neomycin
phosphotransferase II (NEO) and hygromycin phosphotransferase
(HPT)); DNA segments that encode products which are otherwise
lacking in the recipient cell (e.g., tRNA genes, auxotrophic
markers); DNA segments that encode products which can be readily
identified (e.g., phenotypic markers such as .beta.-galactosidase,
GUS; fluorescent proteins such as green fluorescent protein (GFP),
cyan (CFP), yellow (YFP), red (RFP), and cell surface proteins);
the generation of new primer sites for PCR (e.g., the juxtaposition
of two DNA sequence not previously juxtaposed), the inclusion of
DNA sequences not acted upon or acted upon by a restriction
endonuclease or other DNA modifying enzyme, chemical, etc.; and,
the inclusion of a DNA sequences required for a specific
modification (e.g., methylation) that allows its
identification.
[0309] Additional selectable markers include genes that confer
resistance to herbicidal compounds, such as glufosinate ammonium,
bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D).
See for example, Yarranton, (1992) Curr Opin Biotech 3:506-11;
Christopherson et al., (1992) Proc. Natl. Acad. Sci. USA 89:6314-8;
Yao et al., (1992) Cell 71:63-72; Reznikoff, (1992) Mol Microbiol
6:2419-22; Hu et al., (1987) Cell 48:555-66; Brown et al., (1987)
Cell 49:603-12; Figge et al., (1988) Cell 52:713-22; Deuschle et
al., (1989) Proc. Natl. Acad. Sci. USA 86:5400-4; Fuerst et al.,
(1989) Proc. Natl. Acad. Sci. USA 86:2549-53; Deuschle et al.,
(1990) Science 248:480-3; Gossen, (1993) Ph.D. Thesis, University
of Heidelberg; Reines et al., (1993) Proc. Natl. Acad. Sci. USA
90:1917-21; Labow et al., (1990) Mol Cell Biol 10:3343-56;
Zambretti et al., (1992) Proc. Natl. Acad. Sci. USA 89:3952-6; Baim
et al., (1991) Proc. Natl. Acad. Sci. USA 88:5072-6; Wyborski et
al., (1991) Nucleic Acids Res 19:4647-53; Hillen and Wissman,
(1989) Topics Mol Struc Biol 10:143-62; Degenkolb et al., (1991)
Antimicrob Agents Chemother 35:1591-5; Kleinschnidt et al., (1988)
Biochemistry 27:1094-104; Bonin, (1993) Ph.D. Thesis, University of
Heidelberg; Gossen et al., (1992) Proc. Natl. Acad. Sci. USA
89:5547-51; Oliva et al., (1992) Antimicrob Agents Chemother
36:913-9; Hlavka et al., (1985) Handbook of Experimental
Pharmacology, Vol. 78 (Springer-Verlag, Berlin); Gill et al.,
(1988) Nature 334:721-4.
[0310] The cells having the introduced sequence may be grown or
regenerated into plants using conventional conditions, see for
example, McCormick et al., (1986) Plant Cell Rep 5:81-4. These
plants may then be grown, and either pollinated with the same
transformed strain or with a different transformed or untransformed
strain, and the resulting progeny having the desired characteristic
and/or comprising the introduced polynucleotide or polypeptide
identified. Two or more generations may be grown to ensure that the
polynucleotide is stably maintained and inherited, and seeds
harvested.
[0311] Any plant can be used, including monocot and dicot plants.
Examples of monocot plants that can be used include, but are not
limited to, corn (Zea mays), rice (Oryza sativa), rye (Secale
cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g.,
pearl millet (Pennisetum glaucum), proso millet (Panicum
miliaceum), foxtail millet (Setaria italica), finger millet
(Eleusine coracana)), wheat (Triticum aestivum), sugarcane
(Saccharum spp.), oats (Avena), barley (Hordeum), switchgrass
(Panicum virgatum), pineapple (Ananas comosus), banana (Musa spp.),
palm, ornamentals, turfgrasses, and other grasses. Examples of
dicot plants that can be used include, but are not limited to,
soybean (Glycine max), canola (Brassica napus and B. campestris),
alfalfa (Medicago sativa), tobacco (Nicotiana tabacum), Arabidopsis
(Arabidopsis thaliana), sunflower (Helianthus annuus), cotton
(Gossypium arboreum), and peanut (Arachis hypogaea), tomato
(Solanum lycopersicum), potato (Solanum tuberosum) etc.
[0312] The transgenes, recombinant DNA molecules, DNA sequences of
interest, and polynucleotides of interest can comprise one or more
genes of interest. Such genes of interest can encode, for example,
a protein that provides agronomic advantage to the plant.
[0313] Marker Assisted Selection and Breeding of Plants
[0314] A primary motivation for development of molecular markers in
crop species is the potential for increased efficiency in plant
breeding through marker assisted selection (MAS). Genetic marker
alleles, or alternatively, quantitative trait loci (QTL alleles,
are used to identify plants that contain a desired genotype at one
or more loci, and that are expected to transfer the desired
genotype, along with a desired phenotype to their progeny. Genetic
marker alleles (or QTL alleles) can be used to identify plants that
contain a desired genotype at one locus, or at several unlinked or
linked loci (e.g., a haplotype), and that would be expected to
transfer the desired genotype, along with a desired phenotype to
their progeny. It will be appreciated that for the purposes of MAS,
the term marker can encompass both marker and QTL loci.
[0315] After a desired phenotype and a polymorphic chromosomal
locus, e.g., a marker locus or QTL, are determined to segregate
together, it is possible to use those polymorphic loci to select
for alleles corresponding to the desired phenotype--a process
called marker-assisted selection (MAS). In brief, a nucleic acid
corresponding to the marker nucleic acid is detected in a
biological sample from a plant to be selected. This detection can
take the form of hybridization of a probe nucleic acid to a marker,
e.g., using allele-specific hybridization, southern blot analysis,
northern blot analysis, in situ hybridization, hybridization of
primers followed by PCR amplification of a region of the marker or
the like. A variety of procedures for detecting markers are well
known in the art. After the presence (or absence) of a particular
marker in the biological sample is verified, the plant is selected,
i.e., used to make progeny plants by selective breeding.
[0316] Plant breeders need to combine traits of interest with genes
for high yield and other desirable traits to develop improved plant
varieties. Screening for large numbers of samples can be expensive,
time consuming, and unreliable. Use of markers, and/or
genetically-linked nucleic acids is an effective method for
selecting plant having the desired traits in breeding programs. For
example, one advantage of marker-assisted selection over field
evaluations is that MAS can be done at any time of year regardless
of the growing season. Moreover, environmental effects are
irrelevant to marker-assisted selection.
[0317] When a population is segregating for multiple loci affecting
one or multiple traits, the efficiency of MAS compared to
phenotypic screening becomes even greater because all the loci can
be processed in the lab together from a single sample of DNA.
[0318] The DNA repair mechanisms of cells are the basis to
introduce extraneous DNA or induce mutations on endogenous genes.
DNA homologous recombination is a specialized way of DNA repair
that the cells repair DNA damages using a homologous sequence. In
plants, DNA homologous recombination happens at frequencies too low
to be routinely used in gene targeting or gene editing until it has
been found that the process can be stimulated by DNA double-strand
breaks (Bibikova et al., (2001) Mol. Cell Biol. 21:289-297; Puchta
and Baltimore, (2003) Science 300:763; Wright et al., (2005) Plant
J. 44:693-705).
[0319] The meaning of abbreviations is as follows: "sec" means
second(s), "min" means minute(s), "h" means hour(s), "d" means
day(s), ".mu.L" means microliter(s), "mL" means milliliter(s), "L"
means liter(s), ".mu.M" means micromolar, "mM" means millimolar,
"M" means molar, "mmol" means millimole(s), ".mu.mole" mean
micromole(s), "g" means gram(s), ".mu.g" means microgram(s), "ng"
means nanogram(s), "U" means unit(s), "bp" means base pair(s) and
"kb" means kilobase(s).
[0320] Non-limiting examples of compositions and methods disclosed
herein are as follows: [0321] 1. A guide polynucleotide comprising:
[0322] (i) a first nucleotide sequence domain that is complementary
to a nucleotide sequence in a target DNA; and, [0323] (ii) a second
nucleotide sequence domain that interacts with a Cas endonuclease,
wherein the first nucleotide sequence domain and the second
nucleotide sequence domain are composed of deoxyribonucleic acids
(DNA), ribonucleic acids (RNA), or a combination thereof, wherein
the guide polynucleotide does not solely comprise ribonucleic
acids. [0324] 2. The guide polynucleotide of embodiment 1 wherein
the first nucleotide sequence domain and the second nucleotide
sequence domain are located on a single molecule. [0325] 3. The
guide polynucleotide of embodiment 1 wherein the second nucleotide
sequence domain comprises two separate molecules that are capable
of hybridizing along a region of complementarity. [0326] 4. The
guide polynucleotide of any one of embodiments 1-3, wherein the
first nucleotide sequence domain is a DNA sequence and the second
nucleotide sequence domain is selected from the group consisting of
a DNA sequence, a RNA sequence, and a combination thereof. [0327]
5. The guide polynucleotide of embodiment 1 wherein the first
nucleotide sequence domain and the second nucleotide sequence
domain are DNA sequences. [0328] 6. The guide polynucleotide of
embodiment 1, wherein the first nucleotide sequence domain and/or
the second nucleotide sequence domain comprises at least one
modification, wherein said at least one modification is selected
from the group consisting of a 5' cap, a 3' polyadenylated tail, a
riboswitch sequence, a stability control sequence; a sequence that
forms a dsRNA duplex, a modification or sequence that targets the
guide poly nucleotide to a subcellular location, a modification or
sequence that provides for tracking, a modification or sequence
that provides a binding site for proteins, a Locked Nucleic Acid
(LNA), a 5-methyl dC nucleotide, a 2,6-Diaminopurine nucleotide, a
2'-Fluoro A nucleotide, a 2'-Fluoro U nucleotide; a 2'-O-Methyl RNA
nucleotide, a phosphorothioate bond, linkage to a cholesterol
molecule, linkage to a polyethylene glycol molecule, linkage to a
spacer 18 molecule, a 5' to 3' covalent linkage, or any combination
thereof. [0329] 7. The guide polynucleotide of embodiment 1,
wherein the first nucleotide sequence domain and/or the second
nucleotide sequence domain comprises at least one modification that
provides for an additional beneficial feature, wherein said at
least one modification is selected from the group consisting of a
5' cap, a 3' polyadenylated tail, a riboswitch sequence, a
stability control sequence; a sequence that forms a dsRNA duplex, a
modification or sequence that targets the guide poly nucleotide to
a subcellular location, a modification or sequence that provides
for tracking, a modification or sequence that provides a binding
site for proteins, a Locked Nucleic Acid (LNA), a 5-methyl dC
nucleotide, a 2,6-Diaminopurine nucleotide, a 2'-Fluoro A
nucleotide, a 2'-Fluoro U nucleotide; a 2'-O-Methyl RNA nucleotide,
a phosphorothioate bond, linkage to a cholesterol molecule, linkage
to a polyethylene glycol molecule, linkage to a spacer 18 molecule,
a 5' to 3' covalent linkage, or any combination thereof. [0330] 8.
The guide polynucleotide of embodiment 7, wherein the additional
beneficial feature is selected from the group of a modified or
regulated stability, a subcellular targeting, tracking, a
fluorescent label, a binding site for a protein or protein complex,
modified binding affinity to complementary target sequence,
modified resistance to cellular degradation, and increased cellular
permeability. [0331] 9. A plant or seed comprising the guide
polynucleotide of any one of embodiments 1-8 [0332] 10. A guide
polynucleotide/Cas endonuclease complex wherein the guide
polynucleotide comprises (i) a first nucleotide sequence domain
that is complementary to a nucleotide sequence in a target DNA; and
(ii) a second nucleotide sequence domain that interacts with a Cas
endonuclease, wherein said guide polynucleotide does not solely
comprise ribonucleic acids, wherein said guide polynucleotide and
Cas endonuclease are capable of forming a complex that enables the
Cas endonuclease to introduce a double strand break at said target
site. [0333] 11. The guide polynucleotide/Cas endonuclease complex
of embodiment 10, wherein the first nucleotide sequence domain and
the second nucleotide sequence domain of the guide polynucleotide
are composed of deoxyribonucleic acids (DNA), ribonucleic acids
(RNA), or a combination thereof, wherein the guide polynucleotide
does not solely comprise ribonucleic acids. [0334] 12. The guide
polynucleotide/Cas endonuclease complex of embodiment 10, wherein
the first nucleotide sequence domain and/or the second nucleotide
sequence domain of said guide polynucleotide comprises at least one
modification that provides for an additional beneficial feature,
wherein said at least one modification is selected from the group
consisting of a 5' cap, a 3' polyadenylated tail, a riboswitch
sequence, a stability control sequence; a sequence that forms a
dsRNA duplex, a modification or sequence that targets the guide
poly nucleotide to a subcellular location, a modification or
sequence that provides for tracking, a modification or sequence
that provides a binding site for proteins, a Locked Nucleic Acid
(LNA), a 5-methyl dC nucleotide, a 2,6-Diaminopurine nucleotide, a
2'-Fluoro A nucleotide, a 2'-Fluoro U nucleotide; a 2'-O-Methyl RNA
nucleotide, a phosphorothioate bond, linkage to a cholesterol
molecule, linkage to a polyethylene glycol molecule, linkage to a
spacer 18 molecule, a 5' to 3' covalent linkage, or any combination
thereof. [0335] 13. The guide polynucleotide/Cas endonuclease
complex of any one of embodiments 10-12, wherein the Cas
endonuclease is a Cas9 endonuclease. [0336] 14. A plant or seed
comprising the guide polynucleotide/Cas endonuclease complex of any
of one of embodiments 10-13. [0337] 15. A method for modifying a
target site in the genome of a cell, the method comprising
introducing a guide polynucleotide into a cell having a Cas
endonuclease, wherein said guide polynucleotide does not solely
comprise ribonucleic acids, wherein said guide polynucleotide and
Cas endonuclease are capable of forming a complex that enables the
Cas endonuclease to introduce a double strand break at said target
site. [0338] 16. A method for modifying a target site in the genome
of a cell, the method comprising introducing a guide polynucleotide
and a Cas endonuclease into a cell, wherein said guide
polynucleotide does not solely comprise ribonucleic acids, wherein
said guide polynucleotide and Cas endonuclease are capable of
forming a complex that enables the Cas endonuclease to introduce a
double strand break at said target site. [0339] 17. The method of
any one of embodiments 15-16, further comprising introducing a
donor DNA to said cell, wherein said donor DNA comprises a
polynucleotide of interest. [0340] 18. The method of any one of
embodiments 15-17, further comprising identifying at least one cell
that has a modification at said target, wherein the modification at
said target site is selected from the group consisting of (i) a
replacement of at least one nucleotide, (ii) a deletion of at least
one nucleotide, (iii) an insertion of at least one nucleotide, and
(iv) any combination of (i)-(iii). [0341] 19. A method for
introducing a polynucleotide of interest into a target site in the
genome of a cell, the method comprising: [0342] a) introducing a
guide polynucleotide, a donor DNA and a Cas endonuclease into a
cell, wherein said guide polynucleotide does not solely comprise
ribonucleic acids, wherein said guide polynucleotide and Cas
endonuclease are capable of forming a complex that enables the Cas
endonuclease to introduce a double strand break at said target
site; [0343] b) contacting the cell of (a) with a donor DNA
comprising a polynucleotide of interest; and, [0344] c) identifying
at least one cell from (b) comprising in its genome the
polynucleotide of interest integrated at said target site. [0345]
20. The method of embodiment 19, wherein the donor DNA and Cas
endonuclease are introduced into said cell using at least one
recombinant DNA construct capable of expressing the donor DNA
and/or the Cas endonuclease. [0346] 21. The method of any one of
embodiments 15-20, wherein the guide polynucleotide is introduced
directly by particle bombardment. [0347] 22. The method of any one
of embodiments 15-20, wherein the guide polynucleotide is
introduced via particle bombardment or Agrobacterium transformation
of a recombinant DNA construct comprising a U6 polymerase III
[0348] 23. The method of any one of embodiments 15-20, wherein the
guide polynucleotide is a single guide polynucleotide comprising a
variable targeting domain and a cas endonuclease recognition
domain. [0349] 24. The method of any one of embodiments 15-20,
wherein the guide polynucleotide is a duplex guide polynucleotide
comprising a crNucleotide molecule and a tracrNucleotide molecule.
[0350] 25. A method for modifying a target site in the genome of a
cell, the method comprising: [0351] a) introducing into a cell a
crNucleotide, a first recombinant DNA construct capable of
expressing a tracrRNA, and a second recombinant DNA capable of
expressing a Cas endonuclease, wherein said crNucleotide is a
deoxyribonucleotide sequence or a combination of a
deoxyribonucleotide and ribonucleotide sequence, wherein said
crNucleotide, said tracrRNA and said Cas endonuclease are capable
of forming a complex that enables the Cas endonuclease to introduce
a double strand break at said target site; and, [0352] b)
identifying at least one cell that has a modification at said
target site, wherein the modification is selected from the group
consisting of (i) a replacement of at least one nucleotide, (ii) a
deletion of at least one nucleotide, (iii) an insertion of at least
one nucleotide, and (iv) any combination of (i)-(iii). [0353] 26. A
method for modifying a target site in the genome of a cell, the
method comprising: [0354] a) introducing into a cell a
tracrNucleotide, a first recombinant DNA construct capable of
expressing a crRNA and a second recombinant DNA capable of
expressing a Cas endonuclease, wherein said tracrNucleotide is
selected a deoxyribonucleotide sequence or a combination of a
deoxyribonucleotide and ribonucleotide sequence, wherein said
tracrNucleotide, said crRNA and said Cas endonuclease are capable
of forming a complex that enables the Cas endonuclease to introduce
a double strand break at said target site; and, [0355] b)
identifying at least one cell that has a modification at said
target site, wherein the modification is selected from the group
consisting of (i) a replacement of at least one nucleotide, (ii) a
deletion of at least one nucleotide, (iii) an insertion of at least
one nucleotide, and (iv) any combination of (i)-(iii). [0356] 27. A
method for introducing a polynucleotide of interest into a target
site in the genome of a cell, the method comprising: [0357] a)
introducing into a cell a first recombinant DNA construct capable
of expressing a guide polynucleotide, and a second recombinant DNA
construct capable of expressing a Cas endonuclease, wherein said
guide polynucleotide does not solely comprise ribonucleic acids,
wherein said guide polynucleotide and Cas endonuclease are capable
of forming a complex that enables the Cas endonuclease to introduce
a double strand break at said target site; [0358] b) contacting the
cell of (a) with a donor DNA comprising a polynucleotide of
interest; and, [0359] c) identifying at least one cell from (b)
comprising in its genome the polynucleotide of interest integrated
at said target site. [0360] 28. A method for editing a nucleotide
sequence in the genome of a cell, the method comprising introducing
a guide polynucleotide, a polynucleotide modification template and
at least one Cas endonuclease into a cell, wherein said guide
polynucleotide does not solely comprise ribonucleic acids, wherein
the Cas endonuclease introduces a double-strand break at a target
site in the genome of said cell, wherein said polynucleotide
modification template comprises at least one nucleotide
modification of said nucleotide sequence. [0361] 29. The method of
any one of embodiments 15-28, wherein the cell is selected from the
group consisting of a non-human animal, bacterial, fungal, insect,
yeast, and a plant cell. [0362] 30. The method of embodiment 29,
wherein the plant cell is selected from the group consisting of a
monocot and dicot cell. [0363] 31. The method of embodiment 29,
wherein the plant cell is selected from the group consisting of
maize, rice, sorghum, rye, barley, wheat, millet, oats, sugarcane,
turfgrass, or switchgrass, soybean, canola, alfalfa, sunflower,
cotton, tobacco, peanut, potato, tobacco, Arabidopsis, and
safflower cell. [0364] 32. A plant or seed comprising a guide
polynucleotide and a Cas9 endonuclease, wherein said guide
polynucleotide does not solely comprise ribonucleic acids, wherein
said Cas9 endonuclease and guide polynucleotide are capable of
forming a complex and creating a double strand break in a genomic
target site of said plant. [0365] 33. A plant or seed comprising a
recombinant DNA construct and a guide polynucleotide, wherein said
guide polynucleotide does not solely comprise ribonucleic acids,
wherein said recombinant DNA construct comprises a promoter
operably linked to a nucleotide sequence encoding a plant optimized
Cas endonuclease, wherein said plant optimized Cas endonuclease and
guide polynucleotide are capable of forming a complex and creating
a double strand break in a genomic target site of said plant.
[0366] 34. The plant of any one of embodiments 32-33, further
comprising a polynucleotide of interest integrated into said
genomic target site of said plant. [0367] 35. The plant or seed of
any one of embodiments 32-33 further comprising a modification at
said genomic target site, wherein the modification is selected from
the group consisting of (i) a replacement of at least one
nucleotide, (ii) a deletion of at least one nucleotide, (iii) an
insertion of at least one nucleotide, and (iv) any combination of
(i)-(iii). [0368] 36. A plant or seed comprising at least one
altered target sequence, wherein the at least one altered target
sequence originated from a corresponding target sequence that was
recognized and cleaved by a guide polynucleotide/Cas endonuclease
complex, wherein the Cas endonuclease is capable of introducing a
double-strand break at said target site in the plant genome,
wherein said guide polynucleotide does not solely comprise
ribonucleic acids. [0369] 37. A plant or seed comprising a modified
nucleotide sequence, wherein the modified nucleotide sequence was
produced by providing a guide polynucleotide, a polynucleotide
modification template and at least one Cas endonuclease to a cell,
wherein said guide polynucleotide does not solely comprise
ribonucleic acids, wherein the Cas endonuclease is capable of
introducing a double-strand break at a target site in the plant
genome, wherein said polynucleotide modification template comprises
at least one nucleotide modification of said nucleotide
sequence.
[0370] 38. The plant or plant cell of embodiment 29 wherein the at
least one nucleotide modification is not a modification at said
target site. [0371] 39. The plant of any one of embodiments 32-38,
wherein the plant is a monocot or a dicot. [0372] 40. The plant of
embodiment 39, wherein the monocot is selected from the group
consisting of maize, rice, sorghum, rye, barley, wheat, millet,
oats, sugarcane, turfgrass, or switchgrass. [0373] 41. The plant of
embodiment 39, wherein the dicot is selected from the group
consisting of soybean, canola, alfalfa, sunflower, cotton, tobacco,
peanut, potato, tobacco, Arabidopsis, or safflower. [0374] 42. A
method for selecting a plant comprising an altered target site in
its plant genome, the method comprising: a) obtaining a first plant
comprising at least one Cas endonuclease capable of introducing a
double strand break at a target site in the plant genome; b)
obtaining a second plant comprising a guide polynucleotide that is
capable of forming a complex with the Cas endonuclease of (a),
wherein the guide polynucleotide does not solely comprise
ribonucleic acids, c) crossing the first plant of (a) with the
second plant of (b); d) evaluating the progeny of (c) for an
alteration in the target site and e) selecting a progeny plant that
possesses the desired alteration of said target site. [0375] A
method for selecting a plant comprising an altered target site in
its plant genome, the method comprising: a) obtaining a first plant
comprising at least one Cas endonuclease capable of introducing a
double strand break at a target site in the plant genome; b)
obtaining a second plant comprising a guide polynucleotide and a
donor DNA, wherein the guide polynucleotide does not solely
comprise ribonucleic acids, wherein said guide polynucleotide is
capable of forming a complex with the Cas endonuclease of (a),
wherein said donor DNA comprises a polynucleotide of interest; c)
crossing the first plant of (a) with the second plant of (b); d)
evaluating the progeny of (c) for an alteration in the target site
and e) selecting a progeny plant that comprises the polynucleotide
of interest inserted at said target site.
EXAMPLES
[0376] The present disclosure is further defined in the following
Examples, in which parts and percentages are by weight and degrees
are Celsius, unless otherwise stated. It should be understood that
these Examples, while indicating embodiments of the disclosure, are
given by way of illustration only. From the above discussion and
these Examples, one skilled in the art can ascertain the essential
characteristics of this disclosure, and without departing from the
spirit and scope thereof, can make various changes and
modifications of the disclosure to adapt it to various usages and
conditions. Such modifications are also intended to fall within the
scope of the appended embodiments.
Example 1
Maize Optimized Expression Cassettes for a Duplex Guide
Polynucleotide/Cas Endonuclease System for Genome Modification in
Maize Plants
[0377] In this example, expression cassettes for the Cas9
endonuclease and the mature fully processed naturally occurring
CRISPR-RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA)
belonging to the type II adaptive viral immune system from S.
pyogenes as described in Deltcheva et al. (2011) Nature 471:602-7
and Jinek et al. (2012) Science 337:816-21 are maize optimized to
examine their use as genome engineering tools in maize.
[0378] As shown in FIG. 1A, the crNucleotide and tracrNucleotide
molecules composed entirely of RNA nucleotides in this example,
form a duplex comprised of a first nucleotide sequence domain
referred to as the "variable targeting" (VT) domain, and a second
nucleotide sequence domain, referred to as the "Cas endonuclease
recognition" (CER) domain. The CER domain of a crRNA and tracrRNA
polynucleotide duplex comprises two separate molecules (a
nucleotide sequence 3' of the VT domain located on the crNucleotide
and a tracrNucleotide) that are hybridized along a region of
complementarity (FIG. 1A). The VT domain helps facilitate DNA
target site recognition while the CER domain promotes recognition
by the Cas9 protein. Along with the required protospacer adjacent
motif (PAM) sequence, both domains of the crRNA/tracrRNA
polynucleotide duplex function to guide Cas endonuclease DNA target
site cleavage and will herein be referred to as a "duplex guide
polynucleotide", "duplex guide RNA" or "crRNA/tracrRNA duplex" as
described in Example 1 of U.S. provisional application 61/868,706,
filed Aug. 22, 2013.
[0379] To test a duplex guide polynucleotide/Cas endonuclease
system in maize, the Cas9 gene from Streptococcus pyogenes M1 GAS
(SF370) (SEQ ID NO: 1) was maize codon optimized per standard
techniques known in the art and the potato ST-LS1 intron (SEQ ID
NO: 2) was introduced in order to eliminate its expression in E.
coli and Agrobacterium (FIG. 2A). To facilitate nuclear
localization of the Cas9 protein in maize cells, Simian virus 40
(SV40) monopartite (MAPKKKRKV, SEQ ID NO: 3) and Agrobacterium
tumefaciens bipartite VirD2 T-DNA border endonuclease
(KRPRDRHDGELGGRKRAR, SEQ ID NO: 4) nuclear localization signals
were incorporated at the amino and carboxyl-termini of the Cas9
open reading frame, respectively (FIG. 2A). The maize optimized
Cas9 gene was operably linked to a maize constitutive or regulated
promoter by standard molecular biological techniques. An example of
the maize optimized Cas9 expression cassette (SEQ ID NO: 5) is
illustrated in FIG. 2A containing a maize optimized Cas9 gene with
a ST-LS1 intron, SV40 amino terminal nuclear localization signal
(NLS) and VirD2 carboxyl terminal NLS driven by a plant Ubiquitin
promoter.
[0380] To confer efficient crRNA and tracrRNA expression in maize
cells so that crRNA/tracrRNA polynucleotide duplexes may guide the
Cas9 protein to cleave DNA target sites in vivo, the maize U6
polymerase III promoter (SEQ ID NO: 6) and maize U6 polymerase III
terminator (TTTTTTTT) residing on chromosome 8 were isolated and
operably fused as 5' and 3' terminal fusions, respectively, to both
the crRNA and tracrRNA DNA coding sequences using standard
molecular biology techniques generating expression cassettes as
illustrated in FIG. 2B and FIG. 2C. Sequences of the resulting
maize optimized crRNA and tracrRNA expression cassettes may be
found in SEQ ID NO: 8 (crRNA expression cassette with a VT domain
targeting the LIGCas-3 target site (Table 1) and SEQ ID NO: 9
(tracrRNA expression cassette).
[0381] As shown in FIG. 3A, the crRNA molecule requires a region of
complementarity to the DNA target (VT domain) that is approximately
12-30 nucleotides in length and upstream of a PAM sequence for
target site recognition and cleavage (Gasiunas et al. (2012) Proc.
Natl. Acad. Sci. USA 109:E2579-86, Jinek et al. (2012) Science
337:816-21, Mali et al. (2013) Science 339:823-26, and Cong et al.
(2013) Science 339:819-23). To facilitate the rapid introduction of
maize genomic DNA target sequences into the crRNA expression
construct, two Type IIS BbsI restriction endonuclease target sites
were introduced in an inverted tandem orientation with cleavage
orientated in an outward direction as described in Cong et al.
(2013) Science 339:819-23. Upon cleavage, the Type IIS restriction
endonuclease excises its target sites from the crRNA expression
plasmid, generating overhangs allowing for the in-frame directional
cloning of duplexed oligos containing the desired maize genomic DNA
target site into the VT domain. In the example shown, only target
sequences starting with a G nucleotide were used to promote
favorable polymerase III expression of the crRNA.
[0382] Expression of both the Cas endonuclease gene and the crRNA
and tracrRNA molecules then allows for the formation of the duplex
guide RNA/Cas endonuclease system (also referred to as
crRNA/tracrRNA/Cas endonuclease complex) depicted in FIG. 3A (SEQ
ID NOs: 10-11).
Example 2
The Duplex Guide RNA/Cas Endonuclease System Cleaves Chromosomal
DNA in Maize and Introduces Mutations by Imperfect Non-Homologous
End-Joining
[0383] To test whether the maize optimized duplex guide RNA/Cas
endonuclease system described in Example 1 could recognize, cleave,
and mutate maize chromosomal DNA through imprecise non-homologous
end-joining (NHEJ) repair pathways, three different genomic target
sequences were targeted for cleavage (see Table 1) and examined by
deep sequencing for the presence of NHEJ mutations.
TABLE-US-00001 TABLE 1 Maize genomic target sequences introduced
into the crRNA expression cassette. Cas RNA System Target Site
Maize Genomic Target PAM SEQ ID Locus Location Used Designation
Site Sequence Sequence NO: LIG Chr. 2: crRNA/ LIGCas-1
GTACCGTACGTGCCCCGGCG AGG 12 28.45cM tracrRNA G crRNA/ LIGCas-2
GGAATTGTACCGTACGTGCCC CGG 13 tracrRNA crRNA/ LIGCas-3
GCGTACGCGTACGTGTG AGG 14 tracrRNA LIG = approximately 600 bp
upstream of the Liguleless 1 gene start codon
[0384] The maize optimized Cas9 endonuclease expression cassette,
crRNA expression cassettes containing the specific maize VT domains
complementary to the antisense strand of the maize genomic target
sequences listed in Table 1 and tracrRNA expression cassette were
co-delivered to 60-90 Hi-II immature maize embryos by
particle-mediated delivery (see Example 7) in the presence of BBM
and WUS2 genes (see Example 8). Hi-II maize embryos transformed
with the Cas9 and long guide RNA expression cassettes (as described
in U.S. provisional patent application 61/868,706, filed on Aug.
22, 2013) targeting the LIGCas-3 genomic target site for cleavage
served as a positive control and embryos transformed with only the
Cas9 expression cassette served as a negative control. After 7
days, the 20-30 most uniformly transformed embryos from each
treatment were pooled and total genomic DNA was extracted. The
region surrounding the intended target site was PCR amplified with
Phusion.RTM. HighFidelity PCR Master Mix (New England Biolabs,
M0531 L) adding on the sequences necessary for amplicon-specific
barcodes and Illumnia sequencing using "tailed" primers through two
rounds of PCR. The primers used in the primary PCR reaction are
shown in Table 2 and the primers used in the secondary PCR reaction
were AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACG (forward, SEQ ID
NO: 21) and CAAGCAGAAGACGGCATA (reverse, SEQ ID NO: 22).
TABLE-US-00002 TABLE 2 PCR primer sequences Cas RNA SEQ Target
System Primer ID Site Used Orientation Primary PCR Primer Sequence
NO: LIGCas-1 crRNA/ Forward CTACACTCTTTCCCTACACGACGCTCTTCCGAT 15
tracrRNA CTTCCTCTGTAACGATTTACGCACCTGCTG LIGCas-1 crRNA/ Reverse
CAAGCAGAAGACGGCATACGAGCTCTTCCGATC 16 tracrRNA
TGCAAATGAGTAGCAGCGCACGTAT LIGCas-2 crRNA/ Forward
CTACACTCTTTCCCTACACGACGCTCTTCCGAT 17 tracrRNA
CTGAAGCTGTAACGATTTACGCACCTGCTG LIGCas-2 crRNA/ Reverse
CAAGCAGAAGACGGCATACGAGCTCTTCCGATC 16 tracrRNA
TGCAAATGAGTAGCAGCGCACGTAT LIGCas-3 crRNA/ Forward
CTACACTCTTTCCCTACACGACGCTCTTCCGAT 18 tracrRNA
CTAAGGCGCAAATGAGTAGCAGCGCAC LIGCas-3 crRNA/ Reverse
CAAGCAGAAGACGGCATACGAGCTCTTCCGATC 19 tracrRNA
TCACCTGCTGGGAATTGTACCGTA LIGCas-3 Long Forward
CTACACTCTTTCCCTACACGACGCTCTTCCGAT 20 guide
CTTTCCCGCAAATGAGTAGCAGCGCAC RNA LIGCas-3 Long Reverse
CAAGCAGAAGACGGCATACGAGCTCTTCCGATC 19 guide TCACCTGCTGGGAATTGTACCGTA
RNA
[0385] The resulting PCR amplifications were purified with a Qiagen
PCR purification spin column, concentration measured with a Hoechst
dye-based fluorometric assay, combined in an equimolar ratio, and
single read 100 nucleotide-length deep sequencing was performed on
IIlumina's MiSeq Personal Sequencer with a 30-40% (v/v) spike of
PhiX control v3 (Illumina, FC-110-3001) to off-set sequence bias.
Only those reads with a .gtoreq.1 nucleotide indel arising within
the 10 nucleotide window centered over the expected site of
cleavage and not found in a similar level in the negative control
were classified as NHEJ mutations. NHEJ mutant reads with the same
mutation were counted and collapsed into a single read and the top
10 most prevalent mutations were visually confirmed as arising
within the expected site of cleavage. The total numbers of visually
confirmed NHEJ mutations were then used to calculate the % mutant
reads based on the total number of reads of an appropriate length
containing a perfect match to the barcode and forward primer.
[0386] The frequency of NHEJ mutations recovered by deep sequencing
for the duplex guide RNA/Cas endonuclease system targeting the
three LIGCas targets (SEQ ID NOs: 12-14) compared to the single
long guide RNA/Cas endonuclease system targeting the same locus is
shown in Table 3. The ten most prevalent types of NHEJ mutations
recovered based on the duplex guide RNA/Cas endonuclease system are
shown in FIG. 4A (corresponding to SEQ ID NOs: 24-33 wherein SEQ ID
NO: 23 is the reference maize sequence comprising the LIGCas-1
target site), FIG. 4B (corresponding to SEQ ID NOs: 34-43 wherein
SEQ ID NO: 23 is the reference maize sequence comprising the
LIGCas-2 target site) and FIG. 4C (corresponding to SEQ ID NOs:
45-54, wherein SEQ ID NO: 44 is the reference maize sequence
comprising the LIGCas-3 target site).
[0387] Taken together, this data indicates that the maize optimized
duplex guide RNA/Cas endonuclease system described herein cleaves
maize chromosomal DNA and generates imperfect NHEJ mutations.
TABLE-US-00003 TABLE 3 Percent (%) mutant reads at maize Liguleless
1 target locus produced by duplex guide RNA/Cas endonuclease system
compared to the long guide RNA/Cas endonuclease system Total Number
Number of % Mutant System of Reads Mutant Reads Reads Cas9 Only
Control 1,744,427 0 0.00% LIGCas-3 long 1,596,955 35,300 2.21%
guide RNA LIGCas-1 1,803,163 4,331 0.24% crRNA/tracrRNA LIGCas-2
1,648,743 3,290 0.20% crRNA/tracrRNA LIGCas-3 1,681,130 2,409 0.14%
crRNA/tracrRNA
Example 3
Deoxyribonucleic Acid (DNA) can be Used to Guide the Cas9 Protein
to Cleave Maize Chromosomal DNA and Introduce Mutations by
Imperfect Non-Homologous End-Joining
[0388] As previously described in Gasiunas et al. (2012) Proc.
Natl. Acad. Sci. USA 109:E2579-86, Jinek et al. (2012) Science
337:816-21, Mali et al. (2013) Science 339:823-26 and Cong et al.
(2013) Science 339:819-23, ribonucleic acids or RNA have been the
only molecules described to guide a Cas9 endonuclease to recognize
and cleave a specific DNA target site. In this example, we provide
evidence that a new class of molecules, deoxyribonucleic acids
(DNA), can also be used to guide a Cas endonuclease to recognize
and cleave chromosomal DNA target sites resulting in the recovery
of imperfect NHEJ mutations.
[0389] In this example, we used a duplex guide polynucleotide
comprising of a first nucleotide sequence domain, referred to as
the "variable targeting" (VT) domain, and a second nucleotide
sequence domain, referred to as the "Cas endonuclease recognition"
(CER) domain, wherein the variable targeting domain is a contiguous
stretch of deoxyribonucleic acids (DNA). The CER domain of the
duplex guide polynucleotide comprised two separate molecules, one
DNA molecule that was linked to the VT domain of the crNucleotide
molecule (FIG. 1B) and hybridized along a region of complementarity
to a second molecule (the tracrNucleotide, FIG. 1A) consisting of a
contiguous stretch of ribonucleic acids (RNA) nucleotides (referred
to as tracrRNA). In this example the crNucleotide of the duplex
guide polynucleotide (FIG. 1A) consisted solely of DNA nucleotides
and is herein referred to as crDNA.
[0390] The crDNA sequence containing VT domain targeting the
LIGCas-3 target site (Table 1)(SEQ ID No: 55) was synthesized at
Integrated DNA Technologies, Inc. with a 5' phosphate group and
purified by PAGE and then used to test if a duplex guide
crDNA-tracrRNA polynucleotide/Cas endonuclease complex as
illustrated in FIG. 5 may recognize and cleave maize chromosomal
DNA target sites resulting in the recovery of NHEJ mutations.
[0391] To determine the optimal delivery concentration for the
synthetic crDNA molecules, different concentrations of crDNA (20
ng, 50 ng, 100 ng, 1 .mu.g and 5 .mu.g) were co-delivered along
with a maize optimized tracrRNA and Cas9 expression cassettes to
60-90 Hi-II immature maize embryos and assayed for the presence of
NHEJ mutations as described in Example 2. Embryos transformed with
only the Cas9 and tracrRNA expression cassettes served as a
negative control. As shown in Table 4, NHEJ mutations were detected
with an optimal crDNA delivery concentration near 50 ng.
[0392] To compare the NHEJ mutational activity of the duplex guide
crDNA-tracrRNA polynucleotide/Cas endonuclease complex (FIG. 5)
with a duplex guide RNA (crRNA-tracrRNA)/Cas endonuclease complex
(FIG. 3A), a crRNA comprising a VT domain targeting the LIGCas-3
target site (Table 1) was synthesized at Bio-Synthesis, Inc. with a
5' phosphate group and purified by PAGE (SEQ ID NO: 10). 50 ng of
both the synthetic crDNA and crRNA were then independently
co-delivered along with the maize optimized tracrRNA and Cas9 DNA
expression cassettes and assayed for NHEJ mutations as described
previously. The transformation experiment was performed twice to
demonstrate reproducibility. Negative controls consisted of Hi-II
maize embryos transformed with 50 ng of crDNA, the Cas9 expression
cassette or 50 ng of crDNA plus the tracrRNA expression
cassette.
[0393] As shown in Tables 4 and 5, NHEJ mutations resulting from
the duplex guide crDNA-tracRNA polynucleotide/Cas endonuclease
system were identified when the crDNA was delivered in combination
with a tracrRNA and Cas9 DNA expression cassettes compared to the
absence of NHEJ mutations in the Cas9 only, crDNA only, crDNA plus
tracrRNA only and tracrRNA plus Cas9 only controls. The top 3 most
abundant crRNA NHEJ mutations are shown in FIG. 6 A (SEQ ID NO:56,
57, 58, wherein SEQ ID NO:44 is the unmodified reference sequence
for LIGCas-3 locus) and the top 3 most abundant crDNA NHEJ
mutations are shown in FIG. 6 B (SEQ ID NO: 59, 60, 61, wherein SEQ
ID NO:44 is the unmodified reference sequence for LIGCas-3 locus)
identified are compared and shown in FIG. 6 (SEQ ID NOs: 44,
56-61).
[0394] Taken together, this data indicates that deoxyribonucleic
acids (DNA) may also be used to guide Cas endonucleases in a duplex
guide crDNA-tracRNA polynucleotide/Cas endonuclease complex (FIG.
4) to cleave maize chromosomal DNA resulting in imprecise NHEJ
mutations.
TABLE-US-00004 TABLE 4 Percent (%) mutant reads at maize Liguleless
1 target locus produced by different concentrations of transiently
delivered crDNA molecules co-delivered with tracrRNA and Cas9 DNA
expression cassettes Amount of DNA Expression Total Number of crDNA
Cassettes Number Mutant Delivered Delivered of Reads Reads 0 Cas9,
tracrRNA 1,046,553 0 20 ng Cas9, tracrRNA 926,915 0 50 ng Cas9,
tracrRNA 1,032,080 18 100 ng Cas9, tracrRNA 860,565 8 1 .mu.g Cas9,
tracrRNA 398,996 0 5 .mu.g Cas9, tracrRNA 394,959 0
TABLE-US-00005 TABLE 5 Comparison of percent (%) mutant reads at
maize Liguleless 1 target locus produced by transiently delivered
crDNA or crRNA molecules co-delivered with tracrRNA and Cas9 DNA
expression cassettes Synthetic crDNA Trans- DNA Expression Total
Number of or crRNA formation Cassettes Number Mutant Delivered
Replicate Delivered of Reads Reads -- 1 Cas9 1,151,532 0 crDNA 1 --
1,234,489 0 crDNA 1 tracrRNA 666,151 0 crDNA 1 tracrRNA, Cas9
1,046,189 40 crDNA 2 tracrRNA, Cas9 913,430 39 crRNA 1 tracrRNA,
Cas9 1,217,740 136 crRNA 2 tracrRNA, Cas9 1,028,995 281
Example 4
Modifying Nucleic Acid Component(s) of the Guide Polynucleotide/Cas
Endonuclease System to Increase Cleavage Activity and
Specificity
[0395] In this example, modifying the nucleotide base,
phosphodiester bond linkage or molecular topography of the guiding
nucleic acid component(s) of the guide polynucleotide/Cas
endonuclease system is described for increasing cleavage activity
and specificity.
[0396] As shown in FIG. 1A and FIG. 1B, the nucleic acid
component(s) of the guide polynucleotide include a variable
targeting (VT) domain and a Cas endonuclease recognition (CER)
domain. The VT domain is responsible for interacting with the DNA
target site through direct nucleotide-nucleotide base pairings
while the CER domain is required for proper Cas endonuclease
recognition (FIG. 3A and FIG. 3B). Along with the required PAM
sequence, both domains of the nucleic acid component(s) of the
guide polynucleotide/Cas endonuclease system function to link DNA
target site recognition with Cas endonuclease target site cleavage
(FIG. 3A and FIG. 3B).
[0397] Given the direct interaction of the VT domain with the DNA
target site, nucleotide base modifications within the VT domain can
be utilized to alter the nucleotide-nucleotide base pairing
relationships facilitating Cas endonuclease target site
recognition. Such modifications can be used to strengthen the
binding affinity to the complementary DNA target sequence enhancing
guide polynucleotide/Cas endonuclease target site recognition
and/or specificity. Non-limiting examples of nucleotide base
modifications that can enhance target site binding affinity and/or
specificity when introduced into the VT domain of a guide
polynucleotide are listed in Table 6. These modifications can be
used individually or in combination within the VT domain.
TABLE-US-00006 TABLE 6 Nucleotide base modifications to enhance
nucleotide base pairing with complementary DNA target sequence
Modification Effect Deoxyribonucleic Acid More specific
hybridization to complementary DNA target sequence.sup.1 Locked
Nucleic Acid Increased binding affinity and more specific
hybridization to complementary DNA target sequence.sup.2 5-methyl
dC Increase binding affinity to complementary DNA target
sequence.sup.3 2,6-Diaminopurine Increase binding affinity to
complementary DNA target sequence.sup.4 2'-Fluoro A or U Increase
binding affinity to complementary DNA target sequence.sup.5
[0398] Nucleotide modifications similar to those shown in Table 6
can also be made in the CER domain of the single or duplex guide
polynucleotide (FIG. 1A and FIG. 1B). These modifications may act
to strengthen or stabilize inter-molecular interactions in the CER
domain of a duplexed crNucleotide molecule (for example, but not
limiting to crRNA, crDNA or a combination thereof) and
tracrNucleotide molecule (for example tracrRNA, tracrDNA, or a
combination thereof)(FIG. 3A). These modifications can also help
recapitulate crNucleotide and tracrNucleotide (such as for example
but not limiting to crRNA/tracrRNA; crDNA/tracrNA; crRNA/tracrDNA,
crDNA/tracrDNA) structures required for proper Cas endonuclease
recognition in the secondary structure of guide polynucleotides
being comprised of a single molecule (FIG. 3A and FIG. 3B).
[0399] Nucleic acids expressed or delivered transiently to cells
are subject to turnover or degradation. To increase the effective
lifespan or stability of the nucleic acid component(s) of the guide
polynucleotide/Cas endonuclease system in vivo, nucleotide and/or
phosphodiester bond modifications may be introduced to reduce
unwanted degradation. Examples of nuclease resistant nucleotide and
phosphodiester bond modifications are shown in Table 7 and may be
introduced in any one of the VT and/or CER domains of the guide
polynucleotide. Modifications may be introduced at the 5' and 3'
ends of any one of the nucleic acid residues comprising the VT or
CER domains to inhibit exonuclease cleavage activity, can be
introduced in the middle of the nucleic acid sequence comprising
the VT or CER domains to slow endonuclease cleavage activity or can
be introduced throughout the nucleic acid sequences comprising the
VT or CER domains to provide protection from both exo- and
endo-nucleases.
TABLE-US-00007 TABLE 7 Nucleotide base and phosphodiester bond
modifications to decrease unwanted nuclease degradation.
Modification Effect Deoxyribonucleic Acid Less susceptible to
nuclease degradation than RNA.sup.1 Locked Nucleic Acid Very
resistant to nuclease cleavage.sup.2 2'-Fluoro A or U Increased
resistance to nuclease cleavage.sup.3 2'-O-Methyl RNA Bases
Resistant to ribonucleases and 5-10 fold more resistant to DNases
than DNA.sup.4 Phosphorothioate bond Very resistant to nuclease
cleavage.sup.5
[0400] To provide resistance against turnover or degradation in
cells, the nucleic acid component(s) of the guide polynucleotide
may also be circularized where the 5' and 3' ends are covalently
joined together. Circular RNA can be more resistant to nuclease
degradation than linear RNA and can persist in cells long after
corresponding linear transcripts (Jeck et al. (2013) RNA
19:141-157).
[0401] Modifications to any one of the guide polynucleotide nucleic
acid components may also be introduced to increase their
permeability or delivery into cells. Such modifications would
include, but not be limited to, linkage to cholesterol,
polyethylene glycol and spacer 18 (hexaethylene glycol chain).
[0402] Many of the above mentioned modified guide polynucleotides
can be synthesized and delivered transiently by biolistic
particle-mediated transformation, transfection or electroporation.
The remaining components of the guide polynucleotide/Cas
endonuclease system needed to form a functional complex capable of
binding and/or cleaving a chromosomal DNA target site may be
co-delivered as any combination of DNA expression cassettes, RNA,
mRNA (5'-capped and polyadenylated) or protein. Cell lines or
transformants may also be established stably expressing all but one
or two of the components needed to form a functional guide
polynucleotide/Cas endonuclease complex so that upon transient
delivery of the above mentioned modified nucleic acid guide(s) a
functional guide polynucleotide/Cas endonuclease complex may form.
Modified guide polynucleotides described above may also be
delivered simultaneously in multiplex to target multiple
chromosomal DNA sequences for cleavage or nicking.
[0403] The above mentioned modified guide polynucleotides may be
used in plants, animals, yeast and bacteria or in any organism
subject to genome modification with the guide polynucleotide/Cas
endonuclease system and be used to introduce imprecise NHEJ
mutations into chromosomal DNA, excise chromosomal DNA fragments
comprised of either transgenic or endogenous DNA, edit codon
composition of native or transgenic genes by homologous
recombination repair with a donor DNA repair template(s) and
site-specifically insert transgenic or endogenous DNA sequences by
homologous recombination repair with a donor DNA repair
template(s).
Example 5
Examining the Effect of Nucleotide Base and Phosphodiester Bond
Modifications to the Guide Polynucleotide Component of the Guide
Polynucleotide/Cas Endonuclease System in Maize
[0404] In this example, some of the nucleotide base and
phosphodiester bond modifications described in Example 4 are
introduced into the VT domain and/or CER domain of a crNucleotide
and methods for evaluating the impact of these modifications on the
ability of a duplexed guide polynucleotide/Cas endonuclease system
to cleave maize chromosomal DNA will be discussed.
[0405] As illustrated in Table 8, nucleotide base and
phosphodiester linkage modifications were introduced individually
or in combination into the VT domain and the CER domain of the
crNucleotide (crRNA or crDNA) component of the duplexed guide
polynucleotide/Cas endonuclease system targeting the LIGCas-3 site
(see Table 1) for cleavage. Although a number of different
nucleotide base and phosphodiester linkage modifications are
examined in combination here, other possible combinations may be
envisioned.
[0406] Locked Nucleic Acid (+), 5-Methyl dC (iMe-dC) and
2,6-Diaminopurine (i6diPr) nucleotide base modifications made in
the VT domain are introduced to increase the binding affinity to
the complementary DNA target sequence and in the case of the Locked
Nucleic Acid modifications to also increase resistance to in vivo
nucleases. All other modifications designed in both the VT and CER
domains at the 5' and 3' ends or throughout the crRNA or crDNA
sequence are introduced to decrease the effect of in vivo nucleases
and increase the effective lifespan of the crRNA or crDNA
component.
[0407] To examine the effect that the modified crRNA or crDNA
components described in Table 8 have on the ability of their
associated modified guide polynucleotide/Cas endonuclease complex
to recognize and cleave the LIGCas-3 site (see Table 1), the
modified crRNA and crDNA molecules are co-delivered to Hill
immature maize embryos with tracrRNA and Cas9 expression cassettes
as described in Example 3. Unmodified crRNA or crDNA molecules
co-delivered with tracrRNA and Cas9 expression cassettes serve as
comparators. Negative controls consist of immature maize embryos
transformed with only the corresponding modified crRNA or crDNA or
Cas9 expression cassette. Frequencies of imperfect NHEJ mutations,
assayed as described in Example 2, are used to evaluate the effect
of each crRNA or crDNA modification on Cas endonuclease cleavage
activity relative to the comparable unmodified crRNA or crDNA
experiments.
TABLE-US-00008 TABLE 8 crRNA and crDNA nucleotide base and
phosphodiester linkage modifications. Nucleic Acid crRNA or crDNA
Sequence and Corresponding Modification.sup.1 Type Modification VT
Domain CER Domain crRNA None GCGUACGCGUACGUGUG
GUUUUAGAGCUAUGCUGUUUU (SEQ ID NO: 62) G (SEQ ID NO: 63) crRNA
Phosphorothioate G*C*G*UACGCGUACGUGUG GUUUUAGAGCUAUGCUGUU*U* bonds
near ends (SEQ ID NO: 64) U*G (SEQ ID NO: 65) crRNA 2'-O-Methyl RNA
mGmCmGUACGCGUACGUGU GUUUUAGAGCUAUGCUGUUmU nucleotides at ends G
(SEQ ID NO: 66) mUmG (SEQ ID NO: 67) crRNA 2'-O-Methyl RNA
mGmCmGmUmAmCmGmCmG mGmUmUmUmUmAmGmAmGmC nucleotides for each
mUmAmCmGmUmGmUmG mUmAmUmGmCmUmGmUmUmU nucleotide (SEQ ID NO: 68)
mUmG (SEQ ID NO: 69) crDNA None GCGTACGCGTACGTGTG
GTTTTAGAGCTATGCTGTTTTG (SEQ ID NO: 70) (SEQ ID NO: 71) crDNA 1
Locked Nucleic GCGTACGCGTACGTG + TG GTTTTAGAGCTATGCTGTTTTG Acid
nucleotide in the (SEQ ID NO: 72) (SEQ ID NO: 71) variable
targeting domain crDNA 3 Locked Nucleic GCGTACGCGTA + CG + TG + TG
GTTTTAGAGCTATGCTGTTTTG Acid nucleotides in (SEQ ID NO: 73) (SEQ ID
NO: 71) the variable targeting domain crDNA 6 Locked Nucleic GCGTA
+ CG + CG + TA + CG + GTTTTAGAGCTATGCTGTTTTG Acid nucleotides in TG
+ TG (SEQ ID NO: 74) (SEQ ID NO: 71) the variable targeting domain
crDNA 3 Locked Nucleic *G C*G*TACGCGTA + CG + TG +
GTTTTAGAGCTATGCTGTT*T*T*G Acid nucleotides in TG (SEQ ID NO: 75)
(SEQ ID NO: 76) the variable targeting domain plus Phosphorothioate
bonds near ends crDNA One 5-Methyl dC GCGTACGCGTA/iMe-dC/GTGTG
GTTTTAGAGCTATGCTGTTTTG nucleotide in variable (SEQ ID NO: 77) (SEQ
ID NO: 71) targeting domain crDNA Three 5-Methyl dC
GCGTA/iMe-dC/G/iMe- GTTTTAGAGCTATGCTGTTTTG nucleotides in the
dC/GTA/iMe-dC/GTGTG (SEQ ID NO: 71) variable targeting (SEQ ID NO:
78) domain crDNA One 2,6- GCGTACGCGT/i6diPr/CGTGTG
GTTTTAGAGCTATGCTGTTTTG Diaminopurine (SEQ ID NO: 79) (SEQ ID NO:
71) nucleotide in the variable targeting domain crDNA Two 2,6-
Diaminopurine GCGT/i6diPr/CGCGT/i6diPr/ GTTTTAGAGCTATGCTGTTTTG
nucleotides in the CGTGTG (SEQ ID NO: 71) variable targeting (SEQ
ID NO: 80) domain crDNA Locked Nucleic Acid +G + C +
GTACGCGTACGTGTG GTTTTAGAGCTATGCTGTT + T + nucleotides at ends (SEQ
ID NO: 81) T + G (SEQ ID NO: 82) crDNA Phosphorothioate
G*C*G*TACGCGTACGTGTG GTTTTAGAGCTATGCTGTT*T*T*G bonds near ends (SEQ
ID NO: 83) (SEQ ID NO: 76) crDNA 2'-O-Methyl RNA
mGmCmGTACGCGTACGTGTG GTTTTAGAGCTATGCTGTTmUmU nucleotides at ends
(SEQ ID NO: 84) mG (SEQ ID NO: 85) crDNA 2'-O-Methyl RNA
mGmCmGTmAmCmGmCmGTm mGTTTTmAmGmAmGmCTmATm nucleotides at each
AmCmGTmGTmG GmCTmGTTTTmG nucleotide except T (SEQ ID NO: 86) (SEQ
ID NO: 87) .sup.1:''+'' before nucleotide denotes lock nucleic acid
base modification, ''*'' after nucleotide denotes Phosphorothioate
bond backbone modification, ''m'' before nucleotide denotes
2'-O-Methyl RNA base modification, ''iMe-dC'' denotes 5-Methyl dC
base modification and ''i6diPr'' denotes 2,6-Diaminopurine base
modification
Example 6
Methods to Examine the Effect of Modifications to the Nucleic Acid
Component(s) of the Guide Polynucleotide/Cas Endonuclease System in
Yeast
[0408] In this example, yeast screening methods are devised to
identify optimal modifications to the nucleic acid component(s) of
the guide polynucleotide/Cas endonuclease system that result in
enhanced cleavage activity.
A. ADE:URA3:DE2 Yeast Screening Strain
[0409] To identify optimal modification(s) or combinations thereof
to the nucleic acid component(s) of the guide polynucleotide/Cas
endonuclease system outlined in Example 4, a Saccharomyces
cerevisiae strain is developed to carefully monitor the cleavage
activity of the guide polynucleotide/Cas endonuclease system. This
is accomplished by replacing the native ADE2 gene on chromosome 15
of yeast strain BY4247 with a non-functional partially duplicated
ADE2 gene disrupted by the yeast URA3 gene (ADE:URA3:DE2) as shown
in FIG. 7. A guide polynucleotide/Cas endonuclease target site
adjacent to the appropriate PAM sequence is then designed against
the implanted URA3 gene so that upon cleavage the disrupted ADE2
gene containing 305 bp of duplicated overlapping sequence can be
repaired by intramolecular homologous recombination pathways
resulting in the loss of the URA3 gene and the gain of a functional
ADE2 gene as shown in FIG. 8. Media containing 5-Fluoroorotic Acid
(5-FOA) or media deficient in adenine can then be used to select
for cells where cleavage has occurred. The frequency of yeast cells
recovered after selection can then be used to quantify the cleavage
efficiency of the guide polynucleotide/Cas endonuclease system when
examining different modifications to the nucleic acid component(s)
of the guide polynucleotide/Cas endonuclease system.
[0410] Yeast cells containing a functional ADE2 gene as a result of
cleavage and repair of the ADE:URA3:DE2 locus can also be subject
to a visual phenotypic screen for cleavage activity. In the absence
of 5-FOA or adenine minus selection, functional ADE2 gene products
result in a white phenotype while non-functional products result in
a red phenotype (Ugolini et al. (1996) Curr. Genet. 30:485-492). To
visualize the white or red phenotype, individual yeast cell
transformants can be plated on solid media and allowed to grow into
a colony large enough to inspect visually. The amount of white to
red sectoring provides an indication as to the amount of cleavage
activity. Since the sectoring phenotype is a qualitative measure, a
0-4 numerical scoring system can be implemented. As shown in FIG.
9, a score of 0 indicates that no white sectors (no target site
cleavage) were observed; a score of 4 indicates completely white
colonies (complete cutting of the recognition site); scores of 1-3
indicate intermediate white sectoring phenotypes (and intermediate
degrees of target site cleavage).
B. Cas9 Component of the Guide Polynucleotide/Cas Endonuclease
System
[0411] To stably express the Cas endonuclease for pairing with the
transiently delivered modified nucleic acid component(s) described
in Example 4, the Cas9 gene from Streptococcus pyogenes M1 GAS
(SF370) can be S. cerevisiae codon optimized per standard
techniques known in the art (SEQ ID NO: 88) and a SV40 (Simian
virus 40) nuclear localization signal (SRADPKKKRKV, SEQ ID NO: 7)
can be incorporated at the carboxyl terminal to facilitate nuclear
localization. The resulting Cas9 open reading frame will then be
operably fused to the yeast inducible GAL1 promoter and CYC1
terminator. The resulting Cas9 expression cassette will then be
placed into a CEN6 autonomously replicating yeast vector containing
a LEU2 selectable marker.
[0412] To be able to test transient delivery of both the Cas9
component and the modified nucleic acid component(s) described in
Example 4, the Cas9 gene can also be delivered as mRNA. To generate
S. cerevisiae optimized Cas9 mRNA, PCR can be used to amplify the
S. cerevisiae optimized Cas9 open reading frame and associated
nuclear localization signal tailing on the required T7 promoter
sequence (TAATACGACTCACTATAGGG, SEQ ID NO: 89) just 5' of the
translation ATG start site. The resulting linear template
containing the T7 promoter can then be used to transcribe uncapped
or capped Cas9 mRNA with or without polyadenylation in vitro.
[0413] The Cas9 component can also be delivered transiently as
protein and paired with the modified nucleic acid component(s).
Cas9 protein with associated carboxyl-terminal nuclear localization
signal can be expressed and purified per standard techniques
similar to that described by Fonfara et al. (2013) Nucl. Acids Res.
doi:10.1093/nar/gkt1074 or by other methods.
C. Nucleic Acid Component(s) of the Guide Polynucleotide/Cas
Endonuclease System
[0414] It can be advantageous to pair the transient delivery of
modified crRNA or tracrRNA components with the corresponding stably
expressed unmodified crRNA or tracrRNA. To facilitate stable
expression of crRNA and tracrRNA in yeast, S. cerevisiae optimized
crRNA and tracrRNA expression cassettes can be generated. The yeast
RNA polymerase III SNR52 promoter and SUP4 terminator can be
operably fused to the ends of DNA fragments encoding the
appropriate crRNA and tracrRNA sequences required for recognition
by the S. pyogenes Cas9 protein. All crRNA expression cassettes
will contain the ADE:URA3:DE2 target sequence
(GCAGACATTACGAATGCACA, SEQ ID NO: 90) in the VT domain and target
the ADE:URA3:DE2 locus for cleavage. The resulting expression
cassettes will then be placed into a CEN6 autonomously replicating
yeast vector containing a HIS3 selectable marker.
[0415] To deliver unmodified crRNA, tracrRNA or guide RNA
transiently, PCR can be used to amplify the corresponding crRNA,
tracrRNA or guide RNA sequence tailing on the required T7 promoter
sequence (TAATACGACTCACTATAGGG, SEQ ID NO: 89) just 5' of the
transcriptional start site. The resulting linear template
containing the T7 promoter can then be used to transcribe the
corresponding crRNA, tracrRNA or long guide RNA.
[0416] Modified nucleic acid components(s) of the guide
polynucleotide/Cas endonuclease system as outlined in Example 4
will also be transiently delivered. Nucleotide base and/or
phosphodiester bond modifications similar to those illustrated in
Example 5 Table 8 can be introduced individually or in combination
into the crRNA, crDNA, tracrRNA, tracrDNA, long guide RNA or long
guide DNA nucleic acid components of the guide polynucleotide/Cas
endonuclease system and synthesized per standard techniques.
[0417] Circular RNAs, also discussed in Example 4, containing the
necessary VT and CER domains capable of forming a functional
complex with the Cas endonuclease can be generated in vitro as
described by Diegleman et al. (1998) Nucl. Acids Res. 26:3235-3241
and delivered transiently to yeast cells.
D. Transformation of Guide Polynucleotide/Cas Endonuclease
Components into the ADE:URA3:DE2 Yeast Strain
[0418] Components of the guide polynucleotide/Cas endonuclease
system can be delivered to ADE:URA3:DE2 yeast cells using standard
lithium acetate, polyethylene glycol (PEG), electroporation or
biolistic transformation methods and monitored for their ability to
cleave the ADE:URA3:DE2 target. The yeast optimized guide
polynucleotide/Cas endonuclease components discussed in Example 6
sections B and C can be delivered as expression cassettes on low
copy autonomously replicating plasmid DNA vectors, as
non-replicating transient molecules (such as mRNA, protein, RNA or
modified guide nucleic acids) or in any combination of plasmid DNA
vector expression cassette(s) and transient molecule(s).
Example 7
Transformation of Maize Immature Embryos
[0419] Transformation can be accomplished by various methods known
to be effective in plants, including particle-mediated delivery,
Agrobacterium-mediated transformation, PEG-mediated delivery, and
electroporation.
[0420] a. Particle-Mediated Delivery
[0421] Transformation of maize immature embryos using particle
delivery is performed as follows. Media recipes follow below.
[0422] The ears are husked and surface sterilized in 30% Clorox
bleach plus 0.5% Micro detergent for 20 minutes, and rinsed two
times with sterile water. The immature embryos are isolated and
placed embryo axis side down (scutellum side up), 25 embryos per
plate, on 560Y medium for 4 hours and then aligned within the
2.5-cm target zone in preparation for bombardment. Alternatively,
isolated embryos are placed on 560L (Initiation medium) and placed
in the dark at temperatures ranging from 26.degree. C. to
37.degree. C. for 8 to 24 hours prior to placing on 560Y for 4
hours at 26.degree. C. prior to bombardment as described above.
[0423] Plasmids containing the double strand brake inducing agent
and donor DNA are constructed using standard molecular biology
techniques and co-bombarded with plasmids containing the
developmental genes ODP2 (AP2 domain transcription factor ODP2
(Ovule development protein 2); US20090328252 A1) and Wushel
(US2011/0167516).
[0424] The plasmids and DNA of interest are precipitated onto 0.6
.mu.m (average diameter) gold pellets using a water-soluble
cationic lipid transfection reagent as follows. DNA solution is
prepared on ice using 1 .mu.g of plasmid DNA and optionally other
constructs for co-bombardment such as 50 ng (0.5 .mu.l) of each
plasmid containing the developmental genes ODP2 (AP2 domain
transcription factor ODP2 (Ovule development protein 2);
US20090328252 A1) and Wushel. To the pre-mixed DNA, 20 .mu.l of
prepared gold particles (15 mg/ml) and 5 .mu.l of the a
water-soluble cationic lipid transfection reagent is added in water
and mixed carefully. Gold particles are pelleted in a microfuge at
10,000 rpm for 1 min and supernatant is removed. The resulting
pellet is carefully rinsed with 100 ml of 100% EtOH without
resuspending the pellet and the EtOH rinse is carefully removed.
105 .mu.l of 100% EtOH is added and the particles are resuspended
by brief sonication. Then, 10 .mu.l is spotted onto the center of
each macrocarrier and allowed to dry about 2 minutes before
bombardment.
[0425] Alternatively, the plasmids and DNA of interest are
precipitated onto 1.1 .mu.m (average diameter) tungsten pellets
using a calcium chloride (CaCl.sub.2) precipitation procedure by
mixing 100 .mu.l prepared tungsten particles in water, 10 .mu.l (1
.mu.g) DNA in Tris EDTA buffer (1 .mu.g total DNA), 100 .mu.l 2.5 M
CaC12, and 10 .mu.l 0.1 M spermidine. Each reagent is added
sequentially to the tungsten particle suspension, with mixing. The
final mixture is sonicated briefly and allowed to incubate under
constant vortexing for 10 minutes. After the precipitation period,
the tubes are centrifuged briefly, liquid is removed, and the
particles are washed with 500 ml 100% ethanol, followed by a 30
second centrifugation. Again, the liquid is removed, and 105 .mu.l
100% ethanol is added to the final tungsten particle pellet. For
particle gun bombardment, the tungsten/DNA particles are briefly
sonicated. 10 .mu.l of the tungsten/DNA particles is spotted onto
the center of each macrocarrier, after which the spotted particles
are allowed to dry about 2 minutes before bombardment.
[0426] The sample plates are bombarded at level #4 with a Biorad
Helium Gun. All samples receive a single shot at 450 PSI, with a
total of ten aliquots taken from each tube of prepared
particles/DNA.
[0427] Following bombardment, the embryos are incubated on 560P
(maintenance medium) for 12 to 48 hours at temperatures ranging
from 26 C to 37 C, and then placed at 26 C. After 5 to 7 days the
embryos are transferred to 560R selection medium containing 3
mg/liter Bialaphos, and subcultured every 2 weeks at 26 C. After
approximately 10 weeks of selection, selection-resistant callus
clones are transferred to 288J medium to initiate plant
regeneration. Following somatic embryo maturation (2-4 weeks),
well-developed somatic embryos are transferred to medium for
germination and transferred to a lighted culture room.
Approximately 7-10 days later, developing plantlets are transferred
to 272V hormone-free medium in tubes for 7-10 days until plantlets
are well established. Plants are then transferred to inserts in
flats (equivalent to a 2.5'' pot) containing potting soil and grown
for 1 week in a growth chamber, subsequently grown an additional
1-2 weeks in the greenhouse, then transferred to Classic 600 pots
(1.6 gallon) and grown to maturity. Plants are monitored and scored
for transformation efficiency, and/or modification of regenerative
capabilities.
[0428] Initiation medium (560L) comprises 4.0 g/l N6 basal salts
(SIGMA C-1416), 1.0 ml/l Eriksson's Vitamin Mix (1000.times.
SIGMA-1511), 0.5 mg/l thiamine HCl, 20.0 g/l sucrose, 1.0 mg/l
2,4-D, and 2.88 g/l L-proline (brought to volume with D-I H.sub.2O
following adjustment to pH 5.8 with KOH); 2.0 g/l Gelrite (added
after bringing to volume with D-I H2O); and 8.5 mg/l silver nitrate
(added after sterilizing the medium and cooling to room
temperature).
[0429] Maintenance medium (560P) comprises 4.0 g/l N6 basal salts
(SIGMA C-1416), 1.0 ml/l Eriksson's Vitamin Mix (1000.times.
SIGMA-1511), 0.5 mg/l thiamine HCl, 30.0 g/l sucrose, 2.0 mg/l
2,4-D, and 0.69 g/l L-proline (brought to volume with D-I H.sub.2O
following adjustment to pH 5.8 with KOH); 3.0 g/l Gelrite (added
after bringing to volume with D-I H2O); and 0.85 mg/l silver
nitrate (added after sterilizing the medium and cooling to room
temperature).
[0430] Bombardment medium (560Y) comprises 4.0 g/l N6 basal salts
(SIGMA C-1416), 1.0 ml/l Eriksson's Vitamin Mix (1000.times.
SIGMA-1511), 0.5 mg/l thiamine HCl, 120.0 g/l sucrose, 1.0 mg/l
2,4-D, and 2.88 g/l L-proline (brought to volume with D-I H.sub.2O
following adjustment to pH 5.8 with KOH); 2.0 g/l Gelrite (added
after bringing to volume with D-I H2O); and 8.5 mg/l silver nitrate
(added after sterilizing the medium and cooling to room
temperature).
[0431] Selection medium (560R) comprises 4.0 g/l N6 basal salts
(SIGMA C-1416), 1.0 ml/l Eriksson's Vitamin Mix (1000.times.
SIGMA-1511), 0.5 mg/l thiamine HCl, 30.0 g/l sucrose, and 2.0 mg/l
2,4-D (brought to volume with D-I H.sub.2O following adjustment to
pH 5.8 with KOH); 3.0 g/l Gelrite (added after bringing to volume
with D-I H2O); and 0.85 mg/l silver nitrate and 3.0 mg/l bialaphos
(both added after sterilizing the medium and cooling to room
temperature).
[0432] Plant regeneration medium (288J) comprises 4.3 g/l MS salts
(GIBCO 11117-074), 5.0 ml/l MS vitamins stock solution (0.100 g
nicotinic acid, 0.02 g/l thiamine HCL, 0.10 g/l pyridoxine HCL, and
0.40 g/l glycine brought to volume with polished D-I H.sub.2O)
(Murashige and Skoog (1962) Physiol. Plant. 15:473), 100 mg/l
myo-inositol, 0.5 mg/l zeatin, 60 g/l sucrose, and 1.0 ml/l of 0.1
mM abscisic acid (brought to volume with polished D-I H.sub.2O
after adjusting to pH 5.6); 3.0 g/l Gelrite (added after bringing
to volume with D-I H2O); and 1.0 mg/l indoleacetic acid and 3.0
mg/l bialaphos (added after sterilizing the medium and cooling to
60.degree. C.). Hormone-free medium (272V) comprises 4.3 g/l MS
salts (GIBCO 11117-074), 5.0 ml/l MS vitamins stock solution (0.100
g/l nicotinic acid, 0.02 g/l thiamine HCL, 0.10 g/l pyridoxine HCL,
and 0.40 g/l glycine brought to volume with polished D-I H2O), 0.1
g/l myo-inositol, and 40.0 g/l sucrose (brought to volume with
polished D-I H.sub.2O after adjusting pH to 5.6); and 6 g/l
bacto-agar (added after bringing to volume with polished D-I H2O),
sterilized and cooled to 60.degree. C.
[0433] b. Agrobacterium-Mediated Transformation
[0434] Agrobacterium-mediated transformation was performed
essentially as described in Djukanovic et al. (2006) Plant Biotech
J 4:345-57. Briefly, 10-12 day old immature embryos (0.8-2.5 mm in
size) were dissected from sterilized kernels and placed into liquid
medium (4.0 g/L N6 Basal Salts (Sigma C-1416), 1.0 ml/L Eriksson's
Vitamin Mix (Sigma E-1511), 1.0 mg/L thiamine HCl, 1.5 mg/L 2, 4-D,
0.690 g/L L-proline, 68.5 g/L sucrose, 36.0 g/L glucose, pH 5.2).
After embryo collection, the medium was replaced with 1 ml
Agrobacterium at a concentration of 0.35-0.45 OD550. Maize embryos
were incubated with Agrobacterium for 5 min at room temperature,
then the mixture was poured onto a media plate containing 4.0 g/L
N6 Basal Salts (Sigma C-1416), 1.0 ml/L Eriksson's Vitamin Mix
(Sigma E-1511), 1.0 mg/L thiamine HCl, 1.5 mg/L 2, 4-D, 0.690 g/L
L-proline, 30.0 g/L sucrose, 0.85 mg/L silver nitrate, 0.1 nM
acetosyringone, and 3.0 g/L Gelrite, pH 5.8. Embryos were incubated
axis down, in the dark for 3 days at 20.degree. C., then incubated
4 days in the dark at 28.degree. C., then transferred onto new
media plates containing 4.0 g/L N6 Basal Salts (Sigma C-1416), 1.0
ml/L Eriksson's Vitamin Mix (Sigma E-1511), 1.0 mg/L thiamine HCl,
1.5 mg/L 2, 4-D, 0.69 g/L L-proline, 30.0 g/L sucrose, 0.5 g/L MES
buffer, 0.85 mg/L silver nitrate, 3.0 mg/L Bialaphos, 100 mg/L
carbenicillin, and 6.0 g/L agar, pH 5.8. Embryos were subcultured
every three weeks until transgenic events were identified. Somatic
embryogenesis was induced by transferring a small amount of tissue
onto regeneration medium (4.3 g/L MS salts (Gibco 11117), 5.0 ml/L
MS Vitamins Stock Solution, 100 mg/L myo-inositol, 0.1 .mu.M ABA, 1
mg/L IAA, 0.5 mg/L zeatin, 60.0 g/L sucrose, 1.5 mg/L Bialaphos,
100 mg/L carbenicillin, 3.0 g/L Gelrite, pH 5.6) and incubation in
the dark for two weeks at 28.degree. C. All material with visible
shoots and roots were transferred onto media containing 4.3 g/L MS
salts (Gibco 11117), 5.0 ml/L MS Vitamins Stock Solution, 100 mg/L
myo-inositol, 40.0 g/L sucrose, 1.5 g/L Gelrite, pH 5.6, and
incubated under artificial light at 28.degree. C. One week later,
plantlets were moved into glass tubes containing the same medium
and grown until they were sampled and/or transplanted into
soil.
Example 8
Transient Expression of BBM Enhances Transformation
[0435] Parameters of the transformation protocol can be modified to
ensure that the BBM activity is transient. One such method involves
precipitating the BBM-containing plasm id in a manner that allows
for transcription and expression, but precludes subsequent release
of the DNA, for example, by using the chemical PEI. In one example,
the BBM plasmid is precipitated onto gold particles with PEI, while
the transgenic expression cassette (UBLmoPAT.about.GFPm::PinII;
moPAT is the maize optimized PAT gene) to be integrated is
precipitated onto gold particles using the standard calcium
chloride method.
[0436] Briefly, gold particles were coated with PEI as follows.
First, the gold particles were washed. Thirty-five mg of gold
particles, 1.0 in average diameter (A.S.I. #162-0010), were weighed
out in a microcentrifuge tube, and 1.2 ml absolute EtOH was added
and vortexed for one minute. The tube was incubated for 15 minutes
at room temperature and then centrifuged at high speed using a
microfuge for 15 minutes at 4.degree. C. The supernatant was
discarded and a fresh 1.2 ml aliquot of ethanol (EtOH) was added,
vortexed for one minute, centrifuged for one minute, and the
supernatant again discarded (this is repeated twice). A fresh 1.2
ml aliquot of EtOH was added, and this suspension (gold particles
in EtOH) was stored at -20.degree. C. for weeks. To coat particles
with polyethylimine (PEI; Sigma #P3143), 250 .mu.l of the washed
gold particle/EtOH mix was centrifuged and the EtOH discarded. The
particles were washed once in 100 .mu.l ddH2O to remove residual
ethanol, 250 .mu.l of 0.25 mM PEI was added, followed by a
pulse-sonication to suspend the particles and then the tube was
plunged into a dry ice/EtOH bath to flash-freeze the suspension,
which was then lyophilized overnight. At this point, dry, coated
particles could be stored at -80.degree. C. for at least 3 weeks.
Before use, the particles were rinsed 3 times with 250 .mu.l
aliquots of 2.5 mM HEPES buffer, pH 7.1, with 1.times.
pulse-sonication, and then a quick vortex before each
centrifugation. The particles were then suspended in a final volume
of 250 .mu.l HEPES buffer. A 25 .mu.l aliquot of the particles was
added to fresh tubes before attaching DNA. To attach uncoated DNA,
the particles were pulse-sonicated, then 1 .mu.g of DNA (in 5 .mu.l
water) was added, followed by mixing by pipetting up and down a few
times with a Pipetteman and incubated for 10 minutes. The particles
were spun briefly (i.e. 10 seconds), the supernatant removed, and
60 .mu.l EtOH added. The particles with PEI-precipitated DNA-1 were
washed twice in 60 .mu.l of EtOH. The particles were centrifuged,
the supernatant discarded, and the particles were resuspended in 45
.mu.l water. To attach the second DNA (DNA-2), precipitation using
a water-soluble cationic lipid transfection reagent was used. The
45 .mu.l of particles/DNA-1 suspension was briefly sonicated, and
then 5 .mu.l of 100 ng/.mu.l of DNA-2 and 2.5 .mu.l of the
water-soluble cationic lipid transfection reagent were added. The
solution was placed on a rotary shaker for 10 minutes, centrifuged
at 10,000 g for 1 minute. The supernatant was removed, and the
particles resuspended in 60 .mu.l of EtOH. The solution was spotted
onto macrocarriers and the gold particles onto which DNA-1 and
DNA-2 had been sequentially attached were delivered into scutellar
cells of 10 DAP Hi-II immature embryos using a standard protocol
for the PDS-1000. For this experiment, the DNA-1 plasmid contained
a UBI::RFP::pinII expression cassette, and DNA-2 contained a
UBI::CFP::pinII expression cassette. Two days after bombardment,
transient expression of both the CFP and RFP fluorescent markers
was observed as numerous red & blue cells on the surface of the
immature embryo. The embryos were then placed on non-selective
culture medium and allowed to grow for 3 weeks before scoring for
stable colonies. After this 3-week period, 10 multicellular,
stably-expressing blue colonies were observed, in comparison to
only one red colony. This demonstrated that PEI-precipitation could
be used to effectively introduce DNA for transient expression while
dramatically reducing integration of the PEI-introduced DNA and
thus reducing the recovery of RFP-expressing transgenic events. In
this manner, PEI-precipitation can be used to deliver transient
expression of BBM and/or WUS2.
[0437] For example, the particles are first coated with
UBI::BBM::pinII using PEI, then coated with UBI::moPAT.about.YFP
using a water-soluble cationic lipid transfection reagent, and then
bombarded into scutellar cells on the surface of immature embryos.
PEI-mediated precipitation results in a high frequency of
transiently expressing cells on the surface of the immature embryo
and extremely low frequencies of recovery of stable transformants
Thus, it is expected that the PEI-precipitated BBM cassette
expresses transiently and stimulates a burst of embryogenic growth
on the bombarded surface of the tissue (i.e. the scutellar
surface), but this plasmid will not integrate. The PAT.about.GFP
plasmid released from the Ca++/gold particles is expected to
integrate and express the selectable marker at a frequency that
results in substantially improved recovery of transgenic events. As
a control treatment, PEI-precipitated particles containing a
UBI::GUS::pinII (instead of BBM) are mixed with the
PAT.about.GFP/Ca++ particles. Immature embryos from both treatments
are moved onto culture medium containing 3 mg/l bialaphos. After
6-8 weeks, it is expected that GFP+, bialaphos-resistant calli will
be observed in the PEI/BBM treatment at a much higher frequency
relative to the control treatment (PEI/GUS).
[0438] As an alternative method, the BBM plasmid is precipitated
onto gold particles with PEI, and then introduced into scutellar
cells on the surface of immature embryos, and subsequent transient
expression of the BBM gene elicits a rapid proliferation of
embryogenic growth. During this period of induced growth, the
explants are treated with Agrobacterium using standard methods for
maize (see Example 1), with T-DNA delivery into the cell
introducing a transgenic expression cassette such as
UBLmoPAT.about.GFPm::pinII. After co-cultivation, explants are
allowed to recover on normal culture medium, and then are moved
onto culture medium containing 3 mg/l bialaphos. After 6-8 weeks,
it is expected that GFP+, bialaphos-resistant calli will be
observed in the PEI/BBM treatment at a much higher frequency
relative to the control treatment (PEI/GUS).
[0439] It may be desirable to "kick start" callus growth by
transiently expressing the BBM and/or WUS2 polynucleotide products.
This can be done by delivering BBM and WUS2 5'-capped
polyadenylated RNA, expression cassettes containing BBM and WUS2
DNA, or BBM and/or WUS2 proteins. All of these molecules can be
delivered using a biolistics particle gun. For example 5'-capped
polyadenylated BBM and/or WUS2 RNA can easily be made in vitro
using Ambion's mMessage mMachine kit. RNA is co-delivered along
with DNA containing a polynucleotide of interest and a marker used
for selection/screening such as Ubi::moPAT.about.GFPm::PinII. It is
expected that the cells receiving the RNA will immediately begin
dividing more rapidly and a large portion of these will have
integrated the agronomic gene. These events can further be
validated as being transgenic clonal colonies because they will
also express the PAT.about.GFP fusion protein (and thus will
display green fluorescence under appropriate illumination). Plants
regenerated from these embryos can then be screened for the
presence of the polynucleotide of interest.
Sequence CWU 1
1
9614107DNAStreptococcus pyogenes M1 GAS (SF370) 1atggataaga
aatactcaat aggcttagat atcggcacaa atagcgtcgg atgggcggtg 60atcactgatg
aatataaggt tccgtctaaa aagttcaagg ttctgggaaa tacagaccgc
120cacagtatca aaaaaaatct tataggggct cttttatttg acagtggaga
gacagcggaa 180gcgactcgtc tcaaacggac agctcgtaga aggtatacac
gtcggaagaa tcgtatttgt 240tatctacagg agattttttc aaatgagatg
gcgaaagtag atgatagttt ctttcatcga 300cttgaagagt cttttttggt
ggaagaagac aagaagcatg aacgtcatcc tatttttgga 360aatatagtag
atgaagttgc ttatcatgag aaatatccaa ctatctatca tctgcgaaaa
420aaattggtag attctactga taaagcggat ttgcgcttaa tctatttggc
cttagcgcat 480atgattaagt ttcgtggtca ttttttgatt gagggagatt
taaatcctga taatagtgat 540gtggacaaac tatttatcca gttggtacaa
acctacaatc aattatttga agaaaaccct 600attaacgcaa gtggagtaga
tgctaaagcg attctttctg cacgattgag taaatcaaga 660cgattagaaa
atctcattgc tcagctcccc ggtgagaaga aaaatggctt atttgggaat
720ctcattgctt tgtcattggg tttgacccct aattttaaat caaattttga
tttggcagaa 780gatgctaaat tacagctttc aaaagatact tacgatgatg
atttagataa tttattggcg 840caaattggag atcaatatgc tgatttgttt
ttggcagcta agaatttatc agatgctatt 900ttactttcag atatcctaag
agtaaatact gaaataacta aggctcccct atcagcttca 960atgattaaac
gctacgatga acatcatcaa gacttgactc ttttaaaagc tttagttcga
1020caacaacttc cagaaaagta taaagaaatc ttttttgatc aatcaaaaaa
cggatatgca 1080ggttatattg atgggggagc tagccaagaa gaattttata
aatttatcaa accaatttta 1140gaaaaaatgg atggtactga ggaattattg
gtgaaactaa atcgtgaaga tttgctgcgc 1200aagcaacgga cctttgacaa
cggctctatt ccccatcaaa ttcacttggg tgagctgcat 1260gctattttga
gaagacaaga agacttttat ccatttttaa aagacaatcg tgagaagatt
1320gaaaaaatct tgacttttcg aattccttat tatgttggtc cattggcgcg
tggcaatagt 1380cgttttgcat ggatgactcg gaagtctgaa gaaacaatta
ccccatggaa ttttgaagaa 1440gttgtcgata aaggtgcttc agctcaatca
tttattgaac gcatgacaaa ctttgataaa 1500aatcttccaa atgaaaaagt
actaccaaaa catagtttgc tttatgagta ttttacggtt 1560tataacgaat
tgacaaaggt caaatatgtt actgaaggaa tgcgaaaacc agcatttctt
1620tcaggtgaac agaagaaagc cattgttgat ttactcttca aaacaaatcg
aaaagtaacc 1680gttaagcaat taaaagaaga ttatttcaaa aaaatagaat
gttttgatag tgttgaaatt 1740tcaggagttg aagatagatt taatgcttca
ttaggtacct accatgattt gctaaaaatt 1800attaaagata aagatttttt
ggataatgaa gaaaatgaag atatcttaga ggatattgtt 1860ttaacattga
ccttatttga agatagggag atgattgagg aaagacttaa aacatatgct
1920cacctctttg atgataaggt gatgaaacag cttaaacgtc gccgttatac
tggttgggga 1980cgtttgtctc gaaaattgat taatggtatt agggataagc
aatctggcaa aacaatatta 2040gattttttga aatcagatgg ttttgccaat
cgcaatttta tgcagctgat ccatgatgat 2100agtttgacat ttaaagaaga
cattcaaaaa gcacaagtgt ctggacaagg cgatagttta 2160catgaacata
ttgcaaattt agctggtagc cctgctatta aaaaaggtat tttacagact
2220gtaaaagttg ttgatgaatt ggtcaaagta atggggcggc ataagccaga
aaatatcgtt 2280attgaaatgg cacgtgaaaa tcagacaact caaaagggcc
agaaaaattc gcgagagcgt 2340atgaaacgaa tcgaagaagg tatcaaagaa
ttaggaagtc agattcttaa agagcatcct 2400gttgaaaata ctcaattgca
aaatgaaaag ctctatctct attatctcca aaatggaaga 2460gacatgtatg
tggaccaaga attagatatt aatcgtttaa gtgattatga tgtcgatcac
2520attgttccac aaagtttcct taaagacgat tcaatagaca ataaggtctt
aacgcgttct 2580gataaaaatc gtggtaaatc ggataacgtt ccaagtgaag
aagtagtcaa aaagatgaaa 2640aactattgga gacaacttct aaacgccaag
ttaatcactc aacgtaagtt tgataattta 2700acgaaagctg aacgtggagg
tttgagtgaa cttgataaag ctggttttat caaacgccaa 2760ttggttgaaa
ctcgccaaat cactaagcat gtggcacaaa ttttggatag tcgcatgaat
2820actaaatacg atgaaaatga taaacttatt cgagaggtta aagtgattac
cttaaaatct 2880aaattagttt ctgacttccg aaaagatttc caattctata
aagtacgtga gattaacaat 2940taccatcatg cccatgatgc gtatctaaat
gccgtcgttg gaactgcttt gattaagaaa 3000tatccaaaac ttgaatcgga
gtttgtctat ggtgattata aagtttatga tgttcgtaaa 3060atgattgcta
agtctgagca agaaataggc aaagcaaccg caaaatattt cttttactct
3120aatatcatga acttcttcaa aacagaaatt acacttgcaa atggagagat
tcgcaaacgc 3180cctctaatcg aaactaatgg ggaaactgga gaaattgtct
gggataaagg gcgagatttt 3240gccacagtgc gcaaagtatt gtccatgccc
caagtcaata ttgtcaagaa aacagaagta 3300cagacaggcg gattctccaa
ggagtcaatt ttaccaaaaa gaaattcgga caagcttatt 3360gctcgtaaaa
aagactggga tccaaaaaaa tatggtggtt ttgatagtcc aacggtagct
3420tattcagtcc tagtggttgc taaggtggaa aaagggaaat cgaagaagtt
aaaatccgtt 3480aaagagttac tagggatcac aattatggaa agaagttcct
ttgaaaaaaa tccgattgac 3540tttttagaag ctaaaggata taaggaagtt
aaaaaagact taatcattaa actacctaaa 3600tatagtcttt ttgagttaga
aaacggtcgt aaacggatgc tggctagtgc cggagaatta 3660caaaaaggaa
atgagctggc tctgccaagc aaatatgtga attttttata tttagctagt
3720cattatgaaa agttgaaggg tagtccagaa gataacgaac aaaaacaatt
gtttgtggag 3780cagcataagc attatttaga tgagattatt gagcaaatca
gtgaattttc taagcgtgtt 3840attttagcag atgccaattt agataaagtt
cttagtgcat ataacaaaca tagagacaaa 3900ccaatacgtg aacaagcaga
aaatattatt catttattta cgttgacgaa tcttggagct 3960cccgctgctt
ttaaatattt tgatacaaca attgatcgta aacgatatac gtctacaaaa
4020gaagttttag atgccactct tatccatcaa tccatcactg gtctttatga
aacacgcatt 4080gatttgagtc agctaggagg tgactga 41072189DNASolanum
tuberosum 2gtaagtttct gcttctacct ttgatatata tataataatt atcattaatt
agtagtaata 60taatatttca aatatttttt tcaaaataaa agaatgtagt atatagcaat
tgcttttctg 120tagtttataa gtgtgtatat tttaatttat aacttttcta
atatatgacc aaaacatggt 180gatgtgcag 18939PRTSimian virus 40 3Met Ala
Pro Lys Lys Lys Arg Lys Val 1 5 418PRTAgrobacterium tumefaciens
4Lys Arg Pro Arg Asp Arg His Asp Gly Glu Leu Gly Gly Arg Lys Arg 1
5 10 15 Ala Arg 56717DNAArtificial SequenceMaize optimized Cas9
expression cassette 5gtgcagcgtg acccggtcgt gcccctctct agagataatg
agcattgcat gtctaagtta 60taaaaaatta ccacatattt tttttgtcac acttgtttga
agtgcagttt atctatcttt 120atacatatat ttaaacttta ctctacgaat
aatataatct atagtactac aataatatca 180gtgttttaga gaatcatata
aatgaacagt tagacatggt ctaaaggaca attgagtatt 240ttgacaacag
gactctacag ttttatcttt ttagtgtgca tgtgttctcc tttttttttg
300caaatagctt cacctatata atacttcatc cattttatta gtacatccat
ttagggttta 360gggttaatgg tttttataga ctaatttttt tagtacatct
attttattct attttagcct 420ctaaattaag aaaactaaaa ctctatttta
gtttttttat ttaataattt agatataaaa 480tagaataaaa taaagtgact
aaaaattaaa caaataccct ttaagaaatt aaaaaaacta 540aggaaacatt
tttcttgttt cgagtagata atgccagcct gttaaacgcc gtcgacgagt
600ctaacggaca ccaaccagcg aaccagcagc gtcgcgtcgg gccaagcgaa
gcagacggca 660cggcatctct gtcgctgcct ctggacccct ctcgagagtt
ccgctccacc gttggacttg 720ctccgctgtc ggcatccaga aattgcgtgg
cggagcggca gacgtgagcc ggcacggcag 780gcggcctcct cctcctctca
cggcaccggc agctacgggg gattcctttc ccaccgctcc 840ttcgctttcc
cttcctcgcc cgccgtaata aatagacacc ccctccacac cctctttccc
900caacctcgtg ttgttcggag cgcacacaca cacaaccaga tctcccccaa
atccacccgt 960cggcacctcc gcttcaaggt acgccgctcg tcctcccccc
cccccctctc taccttctct 1020agatcggcgt tccggtccat gcatggttag
ggcccggtag ttctacttct gttcatgttt 1080gtgttagatc cgtgtttgtg
ttagatccgt gctgctagcg ttcgtacacg gatgcgacct 1140gtacgtcaga
cacgttctga ttgctaactt gccagtgttt ctctttgggg aatcctggga
1200tggctctagc cgttccgcag acgggatcga tttcatgatt ttttttgttt
cgttgcatag 1260ggtttggttt gcccttttcc tttatttcaa tatatgccgt
gcacttgttt gtcgggtcat 1320cttttcatgc ttttttttgt cttggttgtg
atgatgtggt ctggttgggc ggtcgttcta 1380gatcggagta gaattctgtt
tcaaactacc tggtggattt attaattttg gatctgtatg 1440tgtgtgccat
acatattcat agttacgaat tgaagatgat ggatggaaat atcgatctag
1500gataggtata catgttgatg cgggttttac tgatgcatat acagagatgc
tttttgttcg 1560cttggttgtg atgatgtggt gtggttgggc ggtcgttcat
tcgttctaga tcggagtaga 1620atactgtttc aaactacctg gtgtatttat
taattttgga actgtatgtg tgtgtcatac 1680atcttcatag ttacgagttt
aagatggatg gaaatatcga tctaggatag gtatacatgt 1740tgatgtgggt
tttactgatg catatacatg atggcatatg cagcatctat tcatatgctc
1800taaccttgag tacctatcta ttataataaa caagtatgtt ttataattat
tttgatcttg 1860atatacttgg atgatggcat atgcagcagc tatatgtgga
tttttttagc cctgccttca 1920tacgctattt atttgcttgg tactgtttct
tttgtcgatg ctcaccctgt tgtttggtgt 1980tacttctgca ggtcgactct
agaggatcca tggcaccgaa gaagaagcgc aaggtgatgg 2040acaagaagta
cagcatcggc ctcgacatcg gcaccaactc ggtgggctgg gccgtcatca
2100cggacgaata taaggtcccg tcgaagaagt tcaaggtcct cggcaataca
gaccgccaca 2160gcatcaagaa aaacttgatc ggcgccctcc tgttcgatag
cggcgagacc gcggaggcga 2220ccaggctcaa gaggaccgcc aggagacggt
acactaggcg caagaacagg atctgctacc 2280tgcaggagat cttcagcaac
gagatggcga aggtggacga ctccttcttc caccgcctgg 2340aggaatcatt
cctggtggag gaggacaaga agcatgagcg gcacccaatc ttcggcaaca
2400tcgtcgacga ggtaagtttc tgcttctacc tttgatatat atataataat
tatcattaat 2460tagtagtaat ataatatttc aaatattttt ttcaaaataa
aagaatgtag tatatagcaa 2520ttgcttttct gtagtttata agtgtgtata
ttttaattta taacttttct aatatatgac 2580caaaacatgg tgatgtgcag
gtggcctacc acgagaagta cccgacaatc taccacctcc 2640ggaagaaact
ggtggacagc acagacaagg cggacctccg gctcatctac cttgccctcg
2700cgcatatgat caagttccgc ggccacttcc tcatcgaggg cgacctgaac
ccggacaact 2760ccgacgtgga caagctgttc atccagctcg tgcagacgta
caatcaactg ttcgaggaga 2820accccataaa cgctagcggc gtggacgcca
aggccatcct ctcggccagg ctctcgaaat 2880caagaaggct ggagaacctt
atcgcgcagt tgccaggcga aaagaagaac ggcctcttcg 2940gcaaccttat
tgcgctcagc ctcggcctga cgccgaactt caaatcaaac ttcgacctcg
3000cggaggacgc caagctccag ctctcaaagg acacctacga cgacgacctc
gacaacctcc 3060tggcccagat aggagaccag tacgcggacc tcttcctcgc
cgccaagaac ctctccgacg 3120ctatcctgct cagcgacatc cttcgggtca
acaccgaaat taccaaggca ccgctgtccg 3180ccagcatgat taaacgctac
gacgagcacc atcaggacct cacgctgctc aaggcactcg 3240tccgccagca
gctccccgag aagtacaagg agatcttctt cgaccaatca aaaaacggct
3300acgcgggata tatcgacggc ggtgccagcc aggaagagtt ctacaagttc
atcaaaccaa 3360tcctggagaa gatggacggc accgaggagt tgctggtcaa
gctcaacagg gaggacctcc 3420tcaggaagca gaggaccttc gacaacggct
ccatcccgca tcagatccac ctgggcgaac 3480tgcatgccat cctgcggcgc
caggaggact tctacccgtt cctgaaggat aaccgggaga 3540agatcgagaa
gatcttgacg ttccgcatcc catactacgt gggcccgctg gctcgcggca
3600actcccggtt cgcctggatg acccggaagt cggaggagac catcacaccc
tggaactttg 3660aggaggtggt cgataagggc gctagcgctc agagcttcat
cgagcgcatg accaacttcg 3720ataaaaacct gcccaatgaa aaagtcctcc
ccaagcactc gctgctctac gagtacttca 3780ccgtgtacaa cgagctcacc
aaggtcaaat acgtcaccga gggcatgcgg aagccggcgt 3840tcctgagcgg
cgagcagaag aaggcgatag tggacctcct cttcaagacc aacaggaagg
3900tgaccgtgaa gcaattaaaa gaggactact tcaagaaaat agagtgcttc
gactccgtgg 3960agatctcggg cgtggaggat cggttcaacg cctcactcgg
cacgtatcac gacctcctca 4020agatcattaa agacaaggac ttcctcgaca
acgaggagaa cgaggacatc ctcgaggaca 4080tcgtcctcac cctgaccctg
ttcgaggacc gcgaaatgat cgaggagagg ctgaagacct 4140acgcgcacct
gttcgacgac aaggtcatga aacagctcaa gaggcgccgc tacactggtt
4200ggggaaggct gtcccgcaag ctcattaatg gcatcaggga caagcagagc
ggcaagacca 4260tcctggactt cctcaagtcc gacgggttcg ccaaccgcaa
cttcatgcag ctcattcacg 4320acgactcgct cacgttcaag gaagacatcc
agaaggcaca ggtgagcggg cagggtgact 4380ccctccacga acacatcgcc
aacctggccg gctcgccggc cattaaaaag ggcatcctgc 4440agacggtcaa
ggtcgtcgac gagctcgtga aggtgatggg ccggcacaag cccgaaaata
4500tcgtcataga gatggccagg gagaaccaga ccacccaaaa agggcagaag
aactcgcgcg 4560agcggatgaa acggatcgag gagggcatta aagagctcgg
gtcccagatc ctgaaggagc 4620accccgtgga aaatacccag ctccagaatg
aaaagctcta cctctactac ctgcagaacg 4680gccgcgacat gtacgtggac
caggagctgg acattaatcg gctatcggac tacgacgtcg 4740accacatcgt
gccgcagtcg ttcctcaagg acgatagcat cgacaacaag gtgctcaccc
4800ggtcggataa aaatcggggc aagagcgaca acgtgcccag cgaggaggtc
gtgaagaaga 4860tgaaaaacta ctggcgccag ctcctcaacg cgaaactgat
cacccagcgc aagttcgaca 4920acctgacgaa ggcggaacgc ggtggcttga
gcgaactcga taaggcgggc ttcataaaaa 4980ggcagctggt cgagacgcgc
cagatcacga agcatgtcgc ccagatcctg gacagccgca 5040tgaatactaa
gtacgatgaa aacgacaagc tgatccggga ggtgaaggtg atcacgctga
5100agtccaagct cgtgtcggac ttccgcaagg acttccagtt ctacaaggtc
cgcgagatca 5160acaactacca ccacgcccac gacgcctacc tgaatgcggt
ggtcgggacc gccctgatca 5220agaagtaccc gaagctggag tcggagttcg
tgtacggcga ctacaaggtc tacgacgtgc 5280gcaaaatgat cgccaagtcc
gagcaggaga tcggcaaggc cacggcaaaa tacttcttct 5340actcgaacat
catgaacttc ttcaagaccg agatcaccct cgcgaacggc gagatccgca
5400agcgcccgct catcgaaacc aacggcgaga cgggcgagat cgtctgggat
aagggccggg 5460atttcgcgac ggtccgcaag gtgctctcca tgccgcaagt
caatatcgtg aaaaagacgg 5520aggtccagac gggcgggttc agcaaggagt
ccatcctccc gaagcgcaac tccgacaagc 5580tcatcgcgag gaagaaggat
tgggacccga aaaaatatgg cggcttcgac agcccgaccg 5640tcgcatacag
cgtcctcgtc gtggcgaagg tggagaaggg caagtcaaag aagctcaagt
5700ccgtgaagga gctgctcggg atcacgatta tggagcggtc ctccttcgag
aagaacccga 5760tcgacttcct agaggccaag ggatataagg aggtcaagaa
ggacctgatt attaaactgc 5820cgaagtactc gctcttcgag ctggaaaacg
gccgcaagag gatgctcgcc tccgcaggcg 5880agttgcagaa gggcaacgag
ctcgccctcc cgagcaaata cgtcaatttc ctgtacctcg 5940ctagccacta
tgaaaagctc aagggcagcc cggaggacaa cgagcagaag cagctcttcg
6000tggagcagca caagcattac ctggacgaga tcatcgagca gatcagcgag
ttctcgaagc 6060gggtgatcct cgccgacgcg aacctggaca aggtgctgtc
ggcatataac aagcaccgcg 6120acaaaccaat acgcgagcag gccgaaaata
tcatccacct cttcaccctc accaacctcg 6180gcgctccggc agccttcaag
tacttcgaca ccacgattga ccggaagcgg tacacgagca 6240cgaaggaggt
gctcgatgcg acgctgatcc accagagcat cacagggctc tatgaaacac
6300gcatcgacct gagccagctg ggcggagaca agagaccacg ggaccgccac
gatggcgagc 6360tgggaggccg caagcgggca aggtaggtac cgttaaccta
gacttgtcca tcttctggat 6420tggccaactt aattaatgta tgaaataaaa
ggatgcacac atagtgacat gctaatcact 6480ataatgtggg catcaaagtt
gtgtgttatg tgtaattact agttatctga ataaaagaga 6540aagagatcat
ccatatttct tatcctaaat gaatgtcacg tgtctttata attctttgat
6600gaaccagatg catttcatta accaaatcca tatacatata aatattaatc
atatataatt 6660aatatcaatt gggttagcaa aacaaatcta gtctaggtgt
gttttgcgaa tgcggcc 671761000DNAZea mays 6tgagagtaca atgatgaacc
tagattaatc aatgccaaag tctgaaaaat gcaccctcag 60tctatgatcc agaaaatcaa
gattgcttga ggccctgttc ggttgttccg gattagagcc 120ccggattaat
tcctagccgg attacttctc taatttatat agattttgat gagctggaat
180gaatcctggc ttattccggt acaaccgaac aggccctgaa ggataccagt
aatcgctgag 240ctaaattggc atgctgtcag agtgtcagta ttgcagcaag
gtagtgagat aaccggcatc 300atggtgccag tttgatggca ccattagggt
tagagatggt ggccatgggc gcatgtcctg 360gccaactttg tatgatatat
ggcagggtga ataggaaagt aaaattgtat tgtaaaaagg 420gatttcttct
gtttgttagc gcatgtacaa ggaatgcaag ttttgagcga gggggcatca
480aagatctggc tgtgtttcca gctgtttttg ttagccccat cgaatccttg
acataatgat 540cccgcttaaa taagcaacct cgcttgtata gttccttgtg
ctctaacaca cgatgatgat 600aagtcgtaaa atagtggtgt ccaaagaatt
tccaggccca gttgtaaaag ctaaaatgct 660attcgaattt ctactagcag
taagtcgtgt ttagaaatta tttttttata tacctttttt 720ccttctatgt
acagtaggac acagtgtcag cgccgcgttg acggagaata tttgcaaaaa
780agtaaaagag aaagtcatag cggcgtatgt gccaaaaact tcgtcacaga
gagggccata 840agaaacatgg cccacggccc aatacgaagc accgcgacga
agcccaaaca gcagtccgta 900ggtggagcaa agcgctgggt aatacgcaaa
cgttttgtcc caccttgact aatcacaaga 960gtggagcgta ccttataaac
cgagccgcaa gcaccgaatt 1000711PRTartificial sequenceSV40 (Simian
virus 40) Nuclear localization signal 7Ser Arg Ala Asp Pro Lys Lys
Lys Arg Lys Val 1 5 10 81047DNAArtificial SequenceMaize optimized
crRNA expression cassette containing the LIGCas-3 target sequence
in the variable targeting domain 8tgagagtaca atgatgaacc tagattaatc
aatgccaaag tctgaaaaat gcaccctcag 60tctatgatcc agaaaatcaa gattgcttga
ggccctgttc ggttgttccg gattagagcc 120ccggattaat tcctagccgg
attacttctc taatttatat agattttgat gagctggaat 180gaatcctggc
ttattccggt acaaccgaac aggccctgaa ggataccagt aatcgctgag
240ctaaattggc atgctgtcag agtgtcagta ttgcagcaag gtagtgagat
aaccggcatc 300atggtgccag tttgatggca ccattagggt tagagatggt
ggccatgggc gcatgtcctg 360gccaactttg tatgatatat ggcagggtga
ataggaaagt aaaattgtat tgtaaaaagg 420gatttcttct gtttgttagc
gcatgtacaa ggaatgcaag ttttgagcga gggggcatca 480aagatctggc
tgtgtttcca gctgtttttg ttagccccat cgaatccttg acataatgat
540cccgcttaaa taagcaacct cgcttgtata gttccttgtg ctctaacaca
cgatgatgat 600aagtcgtaaa atagtggtgt ccaaagaatt tccaggccca
gttgtaaaag ctaaaatgct 660attcgaattt ctactagcag taagtcgtgt
ttagaaatta tttttttata tacctttttt 720ccttctatgt acagtaggac
acagtgtcag cgccgcgttg acggagaata tttgcaaaaa 780agtaaaagag
aaagtcatag cggcgtatgt gccaaaaact tcgtcacaga gagggccata
840agaaacatgg cccacggccc aatacgaagc accgcgacga agcccaaaca
gcagtccgta 900ggtggagcaa agcgctgggt aatacgcaaa cgttttgtcc
caccttgact aatcacaaga 960gtggagcgta ccttataaac cgagccgcaa
gcaccgaatt gcgtacgcgt acgtgtggtt 1020ttagagctat gctgttttgt ttttttt
104791087DNAArtificial SequenceMaize optimized tracrRNA expression
cassette 9tgagagtaca atgatgaacc tagattaatc aatgccaaag tctgaaaaat
gcaccctcag 60tctatgatcc agaaaatcaa gattgcttga ggccctgttc ggttgttccg
gattagagcc 120ccggattaat tcctagccgg attacttctc taatttatat
agattttgat gagctggaat 180gaatcctggc ttattccggt acaaccgaac
aggccctgaa ggataccagt aatcgctgag 240ctaaattggc atgctgtcag
agtgtcagta ttgcagcaag gtagtgagat aaccggcatc 300atggtgccag
tttgatggca ccattagggt tagagatggt ggccatgggc gcatgtcctg
360gccaactttg tatgatatat ggcagggtga ataggaaagt aaaattgtat
tgtaaaaagg 420gatttcttct gtttgttagc gcatgtacaa ggaatgcaag
ttttgagcga gggggcatca 480aagatctggc tgtgtttcca gctgtttttg
ttagccccat cgaatccttg acataatgat 540cccgcttaaa taagcaacct
cgcttgtata gttccttgtg ctctaacaca cgatgatgat 600aagtcgtaaa
atagtggtgt ccaaagaatt tccaggccca gttgtaaaag ctaaaatgct
660attcgaattt ctactagcag taagtcgtgt ttagaaatta tttttttata
tacctttttt 720ccttctatgt acagtaggac acagtgtcag cgccgcgttg
acggagaata tttgcaaaaa 780agtaaaagag aaagtcatag cggcgtatgt
gccaaaaact tcgtcacaga gagggccata 840agaaacatgg cccacggccc
aatacgaagc accgcgacga agcccaaaca gcagtccgta 900ggtggagcaa
agcgctgggt aatacgcaaa cgttttgtcc caccttgact aatcacaaga
960gtggagcgta ccttataaac cgagccgcaa gcaccgaatt ggaaccattc
aaaacagcat 1020agcaagttaa aataaggcta gtccgttatc aacttgaaaa
agtggcaccg agtcggtgct 1080ttttttt
10871039RNAArtificial SequencecrRNA containing a variable targeting
domain targeting the LIGCas-3 target sequence 10gcguacgcgu
acgugugguu uuagagcuau gcuguuuug 391186RNAStreptococcus
pyogenesmisc_feature(1)..(86)tracrRNA 11ggaaccauuc aaaacagcau
agcaaguuaa aauaaggcua guccguuauc aacuugaaaa 60aguggcaccg agucggugcu
uuuuuu 861224DNAZea maysmisc_feature(1)..(24)Maize genomic target
site LIGCas-1 plus PAM sequence 12gtaccgtacg tgccccggcg gagg
241324DNAZea maysmisc_feature(1)..(24)Maize genomic target site
LIGCas-2 plus PAM sequence 13ggaattgtac cgtacgtgcc ccgg
241420DNAZea maysmisc_feature(1)..(20)Maize genomic target site
LIGCas-3 plus PAM sequence 14gcgtacgcgt acgtgtgagg
201563DNAArtificial SequenceLIGCas-1 forward primer for primary PCR
(crRNA-tracrRNA system) 15ctacactctt tccctacacg acgctcttcc
gatcttcctc tgtaacgatt tacgcacctg 60ctg 631658DNAArtificial
SequenceLIGCas-1 and LIGCas-2 reverse primer for primary PCR
(crRNA-tracrRNA system) 16caagcagaag acggcatacg agctcttccg
atctgcaaat gagtagcagc gcacgtat 581763DNAArtificial SequenceLIGCas-2
forward primer for primary PCR (crRNA-tracrRNA system) 17ctacactctt
tccctacacg acgctcttcc gatctgaagc tgtaacgatt tacgcacctg 60ctg
631860DNAArtificial SequenceLIGCas-3 forward primer for primary PCR
(crRNA-tracrRNA system) 18ctacactctt tccctacacg acgctcttcc
gatctaaggc gcaaatgagt agcagcgcac 601957DNAArtificial
SequenceLIGCas-3 reverse primer for primary PCR (crRNA-tracrRNA and
Long guide RNA system) 19caagcagaag acggcatacg agctcttccg
atctcacctg ctgggaattg taccgta 572060DNAArtificial SequenceLIGCas-3
forward primer for primary PCR (Long guide RNA system) 20ctacactctt
tccctacacg acgctcttcc gatctttccc gcaaatgagt agcagcgcac
602143DNAArtificial SequenceForward primer for secondary PCR
21aatgatacgg cgaccaccga gatctacact ctttccctac acg
432218DNAArtificial SequenceReverse primer for secondary PCR
22caagcagaag acggcata 182393DNAZea
maysmisc_feature(1)..(93)Unmodified reference sequence for LIGCas-1
and LIGCas-2 locus 23ctgtaacgat ttacgcacct gctgggaatt gtaccgtacg
tgccccggcg gaggatatat 60atacctcaca cgtacgcgta cgcgtatata tac
932498DNAZea maysmisc_feature(1)..(98)Mutation 1 for LIGCas-1 locus
24tcctctgtaa cgatttacgc acctgctggg aattgtaccg tacgtgcccc ggtcggagga
60tatatatacc tcacacgtac gcgtacgcgt atatatac 982598DNAZea
maysmisc_feature(1)..(98)Mutation 2 for LIGCas-1 25tcctctgtaa
cgatttacgc acctgctggg aattgtaccg tacgtgcccc ggacggagga 60tatatatacc
tcacacgtac gcgtacgcgt atatatac 982698DNAZea
maysmisc_feature(1)..(98)Mutation 3 for LIGCas-1 26tcctctgtaa
cgatttacgc acctgctggg aattgtaccg tacgtgcccc gggcggagga 60tatatatacc
tcacacgtac gcgtacgcgt atatatac 982798DNAZea
maysmisc_feature(1)..(98)Mutation 4 for LIGCas-1 27tcctctgtaa
cgatttacgc acctgctggg aattgtaccg tacgtgcccc ggccggagga 60tatatatacc
tcacacgtac gcgtacgcgt atatatac 982899DNAZea
maysmisc_feature(1)..(99)Mutation 5 for LIGCas-1 28tcctctgtaa
cgatttacgc acctgctggg aattgtaccg tacgtgcccc ggatcggagg 60atatatatac
ctcacacgta cgcgtacgcg tatatatac 992994DNAZea
maysmisc_feature(1)..(94)Mutation 6 for LIGCas-1 29tcctctgtaa
cgatttacgc acctgctggg aattgtaccg tacgtgcccc ggaggatata 60tatacctcac
acgtacgcgt acgcgtatat atac 943081DNAZea
maysmisc_feature(1)..(81)Mutation 7 for LIGCas-1 30tcctctgtaa
cgatttacgc acctgctggg aattgtaccg tacgtgcccc ggttcacacg 60tacgcgtacg
cgtatatata c 813165DNAZea maysmisc_feature(1)..(65)Mutation 8 for
LIGCas-1 31tcctctgtaa cgatttacgc acctgctggg aattgtaccg tacgtacgcg
tacgcgtata 60tatac 653299DNAZea maysmisc_feature(1)..(99)Mutation 9
for LIGCas-1 32tcctctgtaa cgatttacgc acctgctggg aattgtaccg
tacgtgcccc ggttcggagg 60atatatatac ctcacacgta cgcgtacgcg tatatatac
993395DNAZea maysmisc_feature(1)..(95)Mutation 10 for LIGCas-1
33tcctctgtaa cgatttacgc acctgctggg aattgtaccg tacgtgcccc cggaggatat
60atatacctca cacgtacgcg tacgcgtata tatac 953498DNAZea
maysmisc_feature(1)..(98)Mutation 1 for LIGCas-2 34gaagctgtaa
cgatttacgc acctgctggg aattgtaccg tacgtgaccc cggcggagga 60tatatatacc
tcacacgtac gcgtacgcgt atatatac 983598DNAZea
maysmisc_feature(1)..(98)Mutation 2 for LIGCas-2 35gaagctgtaa
cgatttacgc acctgctggg aattgtaccg tacgtgtccc cggcggagga 60tatatatacc
tcacacgtac gcgtacgcgt atatatac 983696DNAZea
maysmisc_feature(1)..(96)Mutation 3 for LIGCas-2 36gaagctgtaa
cgatttacgc acctgctggg aattgtaccg tacgtccccg gcggaggata 60tatatacctc
acacgtacgc gtacgcgtat atatac 963798DNAZea
maysmisc_feature(1)..(98)Mutation 4 for LIGCas-2 37gaagctgtaa
cgatttacgc acctgctggg aattgtaccg tacgtggccc cggcggagga 60tatatatacc
tcacacgtac gcgtacgcgt atatatac 983899DNAZea
maysmisc_feature(1)..(98)Mutation 5 for LIGCas-2 38gaagctgtaa
cgatttacgc acctgctggg aattgtaccg tacgtgcacc ccggcggagg 60atatatatac
ctcacacgta cgcgtacgcg tatatatac 993987DNAZea
maysmisc_feature(1)..(87)Mutation 6 for LIGCas-2 39gaagctgtaa
cgatttacgc acctgctggg aattgtaccc ggcggaggat atatatacct 60cacacgtacg
cgtacgcgta tatatac 874092DNAZea maysmisc_feature(1)..(92)Mutation 7
for LIGCas-2 40gaagctgtaa cgatttacgc acctgctggg aattgtaccg
tccccggcgg aggatatata 60tacctcacac gtacgcgtac gcgtatatat ac
924194DNAZea maysmisc_feature(1)..(94)Mutation 8 for LIGCas-2
41gaagctgtaa cgatttacgc acctgctggg aattgtaccg tacccccggc ggaggatata
60tatacctcac acgtacgcgt acgcgtatat atac 944295DNAZea
maysmisc_feature(1)..(95)Mutation 9 for LIGCas-2 42gaagctgtaa
cgatttacgc acctgctggg aattgtaccg tacgccccgg cggaggatat 60atatacctca
cacgtacgcg tacgcgtata tatac 954388DNAZea
maysmisc_feature(1)..(88)Mutation 10 for LIGCas-2 43gaagctgtaa
cgatttacgc acctgctggg aattgtaccc cggcggagga tatatatacc 60tcacacgtac
gcgtacgcgt atatatac 884493DNAZea
maysmisc_feature(1)..(93)Unmodified reference sequence for LIGCas-3
locus 44cgcaaatgag tagcagcgca cgtatatata cgcgtacgcg tacgtgtgag
gtatatatat 60cctccgccgg ggcacgtacg gtacaattcc cag 934598DNAZea
maysmisc_feature(1)..(98)Mutation 1 for LIGCas-3 locus 45aaggcgcaaa
tgagtagcag cgcacgtata tatacgcgta cgcgtacgtt gtgaggtata 60tatatcctcc
gccggggcac gtacggtaca attcccag 984696DNAZea
maysmisc_feature(1)..(96)Mutation 2 for LIGCas-3 locus 46aaggcgcaaa
tgagtagcag cgcacgtata tatacgcgta cgcgtacggt gaggtatata 60tatcctccgc
cggggcacgt acggtacaat tcccag 964795DNAZea
maysmisc_feature(1)..(95)Mutation 3 for LIGCas-3 locus 47aaggcgcaaa
tgagtagcag cgcacgtata tatacgcgta cgcgtacgtg aggtatatat 60atcctccgcc
ggggcacgta cggtacaatt cccag 954896DNAZea
maysmisc_feature(1)..(96)Mutation 4 for LIGCas-3 locus 48aaggcgcaaa
tgagtagcag cgcacgtata tatacgcgta cgcgtactgt gaggtatata 60tatcctccgc
cggggcacgt acggtacaat tcccag 964968DNAZea
maysmisc_feature(1)..(68)Mutation 5 for LIGCas-3 locus 49aaggcgcaaa
tgagtagcag cgcacgtata tatatcctcc gccggggcac gtacggtaca 60attcccag
685093DNAZea maysmisc_feature(1)..(93)Mutation 6 for LIGCas-3 locus
50aaggcgcaaa tgagtagcag cgcacgtata tatacgcgta cgcgtgtgag gtatatatat
60cctccgccgg ggcacgtacg gtacaattcc cag 935189DNAZea
maysmisc_feature(1)..(89)Mutation 7 for LIGCas-3 locus 51aaggcgcaaa
tgagtagcag cgcacgtata tatacgcgta cgtgaggtat atatatcctc 60cgccggggca
cgtacggtac aattcccag 895289DNAZea maysmisc_feature(1)..(89)Mutation
8 for LIGCas-3 locus 52aaggcgcaaa tgagtagcag cgcacgtata tatacgcgta
cgcgtactat atatatcctc 60cgccggggca cgtacggtac aattcccag
895394DNAZea maysmisc_feature(1)..(94)Mutation 9 for LIGCas-3 locus
53aaggcgcaaa tgagtagcag cgcacgtata tatacgcgta cgcgtacgga ggtatatata
60tcctccgccg gggcacgtac ggtacaattc ccag 945496DNAZea
maysmisc_feature(1)..(96)Mutation 10 for LIGCas-3 locus
54aaggcgcaaa tgagtagcag cgcacgtata tatacgcgta cgcgtacgat gaggtatata
60tatcctccgc cggggcacgt acggtacaat tcccag 965539DNAZea
maysmisc_feature(1)..(39)crDNA sequence comprised of
deoxyribonucleic acids (crDNA) targeting 55gcgtacgcgt acgtgtggtt
ttagagctat gctgttttg 395698DNAZea maysmisc_feature(1)..(98)Mutation
1 for LIGCas-3 locus (synthetic crRNA plus tracrRNA and Cas9
56ggaacgcaaa tgagtagcag cgcacgtata tatacgcgta cgcgtacgtt gtgaggtata
60tatatcctcc gccggggcac gtacggtaca attcccag 985794DNAZea
maysmisc_feature(1)..(94)Mutation 2 for LIGCas-3 locus (synthetic
crRNA plus tracrRNA and Cas9 57ggaacgcaaa tgagtagcag cgcacgtata
tatacgcgta cgcgtagtga ggtatatata 60tcctccgccg gggcacgtac ggtacaattc
ccag 945896DNAZea maysmisc_feature(1)..(96)Mutation 3 for LIGCas-3
locus (synthetic crRNA plus tracrRNA and Cas9 58ggaacgcaaa
tgagtagcag cgcacgtata tatacgcgta cgcgtactgt gaggtatata 60tatcctccgc
cggggcacgt acggtacaat tcccag 965998DNAZea
maysmisc_feature(1)..(98)Mutation 1 for LIGCas-3 locus (synthetic
crDNA plus tracrRNA and Cas9 59ccttcgcaaa tgagtagcag cgcacgtata
tatacgcgta cgcgtacgtt gtgaggtata 60tatatcctcc gccggggcac gtacggtaca
attcccag 986066DNAZea maysmisc_feature(1)..(66)Mutation 2 for
LIGCas-3 locus (synthetic crDNA plus tracrRNA and Cas9 60ggaacgcaaa
tgagtagcag cgcacgtata tatactccgc cggggcacgt acggtacaat 60tcccag
666185DNAZea maysmisc_feature(1)..(85)Mutation 3 for LIGCas-3 locus
(synthetic crDNA plus tracrRNA and Cas9 61ggaacgcaaa tgagtagcag
cgcacgtata tatacgcgta cggtatatat atcctccgcc 60ggggcacgta cggtacaatt
cccag 856217RNAArtificial SequenceSequence of unmodified crRNA VT
domain 62gcguacgcgu acgugug 176322RNAArtificial SequenceSequence of
unmodified crRNA CER domain 63guuuuagagc uaugcuguuu ug
226417RNAArtificial SequenceSequence of crRNA VT domain modified
with Phosphorothioate bonds at 5 prime end 64nnnuacgcgu acgugug
176522RNAArtificial SequenceSequence of crRNA CER domain modified
with Phosphorothioate bonds near 3 prime end 65guuuuagagc
uaugcugunn ng 226617RNAArtificial SequenceSequence of crRNA VT
domain modified with 2-O-Methyl RNA bases at 5 prime end
66nnnuacgcgu acgugug 176722RNAArtificial SequenceSequence of crRNA
CER domain modified with 2-O-Methyl RNA bases at 3 prime end
67guuuuagagc uaugcuguun nn 226817RNAArtificial SequenceSequence of
crRNA VT domain modified with 2-O-Methyl RNA bases throughout
68nnnnnnnnnn nnnnnnn 176922RNAArtificial SequenceSequence of crRNA
CER domain modified with 2-O-Methyl RNA bases throughout
69nnnnnnnnnn nnnnnnnnnn nn 227017DNAArtificial SequenceSequence of
unmodified crDNA VT domain 70gcgtacgcgt acgtgtg 177122DNAArtificial
SequenceSequence of unmodified crDNA CER domain 71gttttagagc
tatgctgttt tg 227217DNAArtificial SequenceSequence of crDNA VT
domain modified with one Locked Nucleic Acid base 72gcgtacgcgt
acgtgng 177317DNAArtificial SequenceSequence of crDNA VT domain
modified with three Locked Nucleic Acid bases 73gcgtacgcgt angngng
177417DNAArtificial SequenceSequence of crDNA VT domain modified
with six Locked Nucleic Acid bases 74gcgtangngn angngng
177517DNAArtificial SequenceSequence of crDNA VT domain modified
with three Locked Nucleic Acid bases and three phosphorothioate
bonds 75nnntacgcgt angngng 177622DNAArtificial SequenceSequence of
crDNA CER domain modified with three phosphorothioate bonds
76gttttagagc tatgctgtnn ng 227717DNAArtificial SequenceSequence of
crDNA VT domain modified with one 5-Methyl dC base 77gcgtacgcgt
angtgtg 177817DNAArtificial SequenceSequence of crDNA VT domain
modified with three 5-Methyl dC bases 78gcgtangngt angtgtg
177917DNAArtificial SequenceSequence of crDNA VT domain modified
with one 2,6-Diaminopurine base 79gcgtacgcgt ncgtgtg
178017DNAArtificial SequenceSequence of crDNA VT domain modified
with two 2,6-Diaminopurine base 80gcgtncgcgt ncgtgtg
178117DNAArtificial SequenceSequence of crDNA VT domain with Locked
Nucleic Acid base modifications at the 5 prime end 81nnntacgcgt
acgtgtg 178222DNAArtificial SequenceSequence of crDNA CER domain
with Locked Nucleic Acid base modifications at the 3 prime end
82gttttagagc tatgctgttn nn 228317DNAArtificial SequenceSequence of
crDNA VT domain with Phosphorothioate bond modifications at the 5
prime end 83nnntacgcgt acgtgtg 178417DNAArtificial SequenceSequence
of crDNA VT domain with 2-O-Methyl RNA base modifications at the 5
prime end 84cnnntagcgt acgtgtg 178522DNAArtificial SequenceSequence
of crDNA CER domain with 2-O-Methyl RNA base modifications at the 3
prime end 85gttttagagc tatgctgttn nn 228617DNAArtificial
SequenceSequence of crDNA VT domain with 2-O-Methyl RNA base
modifications at each position except T 86nnntnnnnnt nnntntn
178722DNAArtificial SequenceSequence of crDNA CER domain with
2-O-Methyl RNA base modifications at each position except T
87nttttnnnnn tntnntnttt tn 22884104DNAartificial
sequenceSaccharomyces cerevisiae codon optimized Cas9 coding
sequence 88atggataaga agtactccat tggcctagac atcggcacca attccgtggg
ttgggccgtg 60atcaccgacg agtacaaggt tccctccaag aagttcaagg tcttaggcaa
taccgacagg 120cactctatca agaagaatct gatcggtgct ttactgtttg
actctggcga gaccgccgag 180gccaccaggt tgaaacgtac cgctagaagg
aggtacacca ggaggaagaa ccgtatctgc 240tacctacaag agatcttctc
caatgagatg gccaaggtcg acgactcctt cttccacagg 300cttgaggagt
ccttcctggt ggaggaggac aagaagcatg aaaggcaccc tatctttggc
360aacatcgtcg acgaggttgc ctaccacgag aagtacccaa ccatctacca
tctgaggaag 420aaactggtag actccaccga caaggccgac ctgcgtctga
tctacttagc cttagcccac 480atgatcaagt ttagaggcca cttcctgatc
gagggcgacc tgaatcccga taactccgac 540gtcgataagc tgttcatcca
gctggtccag acttacaatc agctgttcga ggagaacccc 600atcaacgcct
ctggcgtcga cgccaaagct atcctatcag cccgtctttc caagtctagg
660aggctagaga acttgatcgc ccagcttccc ggcgagaaga agaacggcct
gtttggcaat 720ctgatcgccc tgtccttagg cttaactccc aacttcaaat
ccaacttcga cctggccgaa 780gatgctaagt tgcagttatc caaggacact
tacgacgacg accttgataa cctgctggcc 840caaatcggcg accagtacgc
cgacctgttc ctagccgcca agaacttatc tgatgccatc 900ttactgagtg
acattctgag ggtcaacacc gagatcacca aagctccctt gagtgcctct
960atgatcaaac gttacgacga acatcaccag gaccttaccc tgctaaaggc
cctggtgagg 1020caacaactgc ccgagaagta caaggagatc ttctttgacc
agtccaagaa cggctacgcc 1080ggctacatcg atggcggcgc ctctcaggag
gagttctaca agttcatcaa gccaatctta 1140gagaagatgg acggtaccga
ggagctgctg gtaaagctga atagggagga cctgttaaga 1200aaacagagga
cctttgacaa cggctccatc cctcatcaga tccacctggg cgagctacac
1260gccatcctgc gtcgtcagga ggacttctat cccttcctga aggacaacag
agagaagatc 1320gagaagattc tgacctttcg tataccctac tacgtgggcc
ctctggccag aggcaattcc 1380aggtttgcct ggatgaccag aaagtccgag
gagaccatca caccctggaa ctttgaagag 1440gttgtggaca agggcgcttc
tgctcagtcc ttcatcgaga ggatgacaaa cttcgacaaa 1500aacctgccca
acgagaaggt cttacccaag cacagtctgc tgtacgagta cttcaccgta
1560tacaacgagc tgaccaaggt taagtacgtc accgagggca tgagaaagcc
tgccttcctg 1620tccggagagc agaagaaggc cattgtggac ttgctgttca
agaccaacag gaaagtgacc 1680gtgaagcagc tgaaagagga ctacttcaag
aagatcgagt
gcttcgactc cgtggagatc 1740agtggcgtgg aggataggtt caacgcctcc
ctaggcacat accacgatct actaaagatt 1800atcaaggaca aggacttcct
tgacaacgag gagaacgagg acatcctaga ggacatcgtc 1860ttaaccttaa
ccctattcga ggacagggag atgatcgagg agaggctgaa gacctacgcc
1920cacctgttcg acgacaaggt gatgaaacag ttgaagagga ggagatacac
cggctggggc 1980aggttatccc gtaagcttat caacggcatc cgtgacaagc
agtccggcaa gaccatctta 2040gacttcctga agtccgacgg cttcgccaac
agaaacttca tgcagctgat ccacgacgac 2100tccctgactt tcaaggagga
tatccagaag gctcaggtga gtggccaggg cgactcctta 2160catgaacaca
tcgcaaacct ggccggaagt cccgccatca agaagggcat cttgcaaact
2220gtgaaagtgg ttgacgagct ggtgaaggtg atgggcaggc ataagcccga
gaacatcgtt 2280attgagatgg cccgtgagaa ccagacaacc cagaagggcc
agaagaacag tcgtgaaagg 2340atgaagagga tcgaggaagg catcaaggag
ttaggctccc agatcctaaa ggagcacccc 2400gtcgagaaca cccaactgca
gaacgagaag ctgtacttgt actatctgca gaacggtagg 2460gacatgtacg
tcgaccagga gctggacatc aacaggctga gtgactacga cgtagaccac
2520atcgtgccac agagtttcct gaaggacgac tctatcgaca acaaggtgct
taccaggtcc 2580gacaagaacc gtggcaagag tgacaatgtg ccctccgaag
aggtggtcaa gaagatgaag 2640aactactgga ggcagctgtt gaacgccaag
ctgatcaccc agaggaagtt cgacaactta 2700accaaagctg agagaggagg
cctatctgaa ctagacaagg ccggtttcat caagaggcag 2760ctggtcgaga
ccaggcaaat caccaagcat gttgcccaga tcctagactc ccgtatgaac
2820accaagtacg acgagaacga caagctaatc agagaggtga aggtgatcac
cctgaagtcc 2880aagctggtct ccgacttccg taaggacttc cagttctaca
aggtcaggga gatcaacaac 2940taccatcatg ctcatgacgc ctaccttaac
gctgtggttg gcaccgcact gatcaagaag 3000taccctaagt tggagagtga
gttcgtatac ggcgactaca aggtctacga cgtgcgtaag 3060atgatcgcca
agtcagaaca ggaaatcggc aaggccaccg ccaagtactt cttctactct
3120aacatcatga acttcttcaa aaccgagatc accctggcca acggcgagat
ccgtaagagg 3180cctcttatcg agaccaacgg cgaaaccggt gagatagtgt
gggacaaggg cagagacttc 3240gccaccgtga gaaaggtctt atccatgcct
caagtcaaca ttgtcaagaa gaccgaggtc 3300cagaccggcg gcttctctaa
ggagagtatc ctgcccaagc gtaactctga caagctaatc 3360gccagaaaga
aggactggga ccctaagaag tatggaggct tcgactctcc cacagtagcc
3420tactccgtgc tggtggtcgc caaggtcgag aagggcaaat ccaagaagct
gaagtctgtg 3480aaggagttgc taggcatcac catcatggag aggtcctcct
tcgagaagaa tcccatcgac 3540ttcttggagg ccaaaggtta caaggaggtc
aagaaggacc tgatcatcaa gctgcccaag 3600tactccttgt tcgagttaga
gaacggcagg aagaggatgc tggcctccgc aggcgagtta 3660cagaagggta
acgagctggc cttaccctcc aagtacgtaa actttctgta cctggcttcc
3720cattacgaga agctaaaggg cagtcccgag gacaacgagc agaagcagct
gttcgtggag 3780caacacaagc attacctgga cgagatcatc gagcagatct
ccgagttcag taagcgtgtg 3840atcctggccg acgccaatct ggacaaggtc
ctgtccgcct acaacaagca tcgtgacaaa 3900ccaatccgtg agcaggctga
gaacatcatc catctattca ccctgaccaa cttaggcgcc 3960cccgccgcct
tcaagtactt tgataccact atcgacagga agaggtacac ctccaccaag
4020gaagtactag acgccaccct gatccaccaa tccatcacag gcctgtacga
gactaggatc 4080gacttatccc agctaggtgg cgat 41048920DNABacteriophage
T7T7 promoter sequence(1)..(20) 89taatacgact cactataggg
209020DNASaccharomyces cerevisiaeADE-URA3-DE2 target sequence minus
PAM sequence(1)..(20) 90gcagacatta cgaatgcaca 20913387DNAS.
thermophilusmisc_feature(1)..(3387)Cas9 endonuclease, genbank
CS571758.1 91atgagtgact tagttttagg acttgatatc ggtataggtt ctgttggtgt
aggtatcctt 60aacaaagtga caggagaaat tatccataaa aactcacgca tcttcccagc
agctcaagca 120gaaaataacc tagtacgtag aacgaatcgt caaggaagac
gcttgacacg acgtaaaaaa 180catcgtatag ttcgtttaaa tcgtctattt
gaggaaagtg gattaatcac cgattttacg 240aagatttcaa ttaatcttaa
cccatatcaa ttacgagtta agggcttgac cgatgaattg 300tctaatgaag
aactgtttat cgctcttaaa aatatggtga aacaccgtgg gattagttac
360ctcgatgatg ctagtgatga cggaaattca tcagtaggag actatgcaca
aattgttaag 420gaaaatagta aacaattaga aactaagaca ccgggacaga
tacagttgga acgctaccaa 480acatatggtc aattacgtgg tgattttact
gttgagaaag atggcaaaaa acatcgcttg 540attaatgtct ttccaacatc
agcttatcgt tcagaagcct taaggatact gcaaactcaa 600caagaattta
atccacagat tacagatgaa tttattaatc gttatctcga aattttaact
660ggaaaacgga aatattatca tggacccgga aatgaaaagt cacggactga
ttatggtcgt 720tacagaacga gtggagaaac tttagacaat atttttggaa
ttctaattgg gaaatgtaca 780ttttatccag aagagtttag agcagcaaaa
gcttcctaca cggctcaaga attcaatttg 840ctaaatgatt tgaacaatct
aacagttcct actgaaacca aaaagttgag caaagaacag 900aagaatcaaa
tcattaatta tgtcaaaaat gaaaaggcaa tggggccagc gaaacttttt
960aaatatatcg ctaagttact ttcttgtgat gttgcagata tcaagggata
ccgtatcgac 1020aaatcaggta aggctgagat tcatactttc gaagcctatc
gaaaaatgaa aacgcttgaa 1080accttagata ttgaacaaat ggatagagaa
acgcttgata aattagccta tgtcttaaca 1140ttaaacactg agagggaagg
tattcaagaa gccttagaac atgaatttgc tgatggtagc 1200tttagccaga
agcaagttga cgaattggtt caattccgca aagcaaatag ttccattttt
1260ggaaaaggat ggcataattt ttctgtcaaa ctgatgatgg agttaattcc
agaattgtat 1320gagacgtcag aagagcaaat gactatcctg acacgacttg
gaaaacaaaa acgacttcgt 1380cttcaaataa aacaaaatat ttcaaataaa
acaaaatata tagatgagaa actattaact 1440gaagaaatct ataatcctgt
tgttgctaag tctgttcgcc aggctataaa aatcgtaaat 1500gcggcgatta
aagaatacgg agactttgac aatattgtca tcgaaatggc tcgtgaaaca
1560aatgaagatg atgaaaagaa agctattcaa aagattcaaa aagccaacaa
agatgaaaaa 1620gatgcagcaa tgcttaaggc tgctaaccaa tataatggaa
aggctgaatt accacatagt 1680gttttccacg gtcataagca attagcgact
aaaatccgcc tttggcatca gcaaggagaa 1740cgttgccttt atactggtaa
gacaatctca atccatgatt tgataaataa tcctaatcag 1800tttgaagtag
atcatatttt acctctttct atcacattcg atgatagcct tgcaaataag
1860gttttggttt atgcaactgc taaccaagaa aaaggacaac gaacacctta
tcaggcttta 1920gatagtatgg atgatgcgtg gtctttccgt gaattaaaag
cttttgtacg tgagtcaaaa 1980acactttcaa acaagaaaaa agaatacctc
cttacagaag aagatatttc aaagtttgat 2040gttcgaaaga aatttattga
acgaaatctt gtagatacaa gatacgcttc aagagttgtc 2100ctcaatgccc
ttcaagaaca ctttagagct cacaagattg atacaaaagt ttccgtggtt
2160cgtggccaat ttacatctca attgagacgc cattggggaa ttgagaagac
tcgtgatact 2220tatcatcacc atgctgtcga tgcattgatt attgccgcct
caagtcagtt gaatttgtgg 2280aaaaaacaaa agaataccct tgtaagttat
tcagaagaac aactccttga tattgaaaca 2340ggtgaactta ttagtgatga
tgagtacaag gaatctgtgt tcaaagcccc ttatcaacat 2400tttgttgata
cattgaagag taaagaattt gaagacagta tcttattctc atatcaagtg
2460gattctaagt ttaatcgtaa aatatcagat gccactattt atgcgacaag
acaggctaaa 2520gtgggaaaag ataagaagga tgaaacttat gtcttaggga
aaatcaaaga tatctatact 2580caggatggtt atgatgcctt tatgaagatt
tataagaagg ataagtcaaa attcctcatg 2640tatcgtcacg acccacaaac
ctttgagaaa gttatcgagc caattttaga gaactatcct 2700aataagcaaa
tgaatgaaaa aggaaaagag gtaccatgta atcctttcct aaaatataaa
2760gaagaacatg gctatattcg taaatatagt aaaaaaggca atggtcctga
aatcaagagt 2820cttaaatact atgatagtaa gcttttaggt aatcctattg
atattactcc agagaatagt 2880aaaaataaag ttgtcttaca gtcattaaaa
ccttggagaa cagatgtcta tttcaataag 2940gctactggaa aatacgaaat
ccttggatta aaatatgctg atctacaatt tgagaaaggg 3000acaggaacat
ataagatttc ccaggaaaaa tacaatgaca ttaagaaaaa agagggtgta
3060gattctgatt cagaattcaa gtttacactt tataaaaatg atttgttact
cgttaaagat 3120acagaaacaa aagaacaaca gcttttccgt tttctttctc
gaactttacc taaacaaaag 3180cattatgttg aattaaaacc ttatgataaa
cagaaatttg aaggaggtga ggcgttaatt 3240aaagtgttgg gtaacgttgc
taatggtggt caatgcataa aaggactagc aaaatcaaat 3300atttctattt
ataaagtaag aacagatgtc ctaggaaatc agcatatcat caaaaatgag
3360ggtgataagc ctaagctaga tttttaa 3387923369DNAS.
thermophilusmisc_feature(1)..(3369)Cas9 endonuclease, genbank
CS571770.1 92atgagtgact tagttttagg acttgatatc ggtataggtt ctgttggtgt
aggtatcctt 60aacaaagtga caggagaaat tatccataaa aactcacgca tcttcccagc
agctcaagca 120gaaaataacc tagtacgtag aacgaatcgt caaggaagac
gcttgacacg acgtaaaaaa 180catcgtatag ttcgtttaaa tcgtctattt
gaggaaagtg gattaatcac cgattttacg 240aagatttcaa ttaatcttaa
cccatatcaa ttacgagtta agggcttgac cgatgaattg 300tctaatgaag
aactgtttat cgctcttaaa aatatggtga aacaccgtgg gattagttac
360ctcgatgatg ctagtgatga cggaaattca tcagtaggag actatgcaca
aattgttaag 420gaaaatagta aacaattaga aactaagaca ccgggacaga
tacagttgga acgctaccaa 480acatatggtc aattacgtgg tgattttact
gttgagaaag atggcaaaaa acatcgcttg 540attaatgtct ttccaacatc
agcttatcgt tcagaagcct taaggatact gcaaactcaa 600caagaattta
attcacagat tacagatgaa tttattaatc gttatctcga aattttaact
660ggaaaacgga aatattatca tggacccgga aatgaaaagt cacggactga
ttatggtcgt 720tacagaacga atggagaaac tttagacaat atttttggaa
ttctaattgg gaaatgtaca 780ttttatccag acgagtttag agcagcaaaa
gcttcctaca cggctcaaga attcaatttg 840ctaaatgatt tgaacaatct
aacagttcct actgaaacca aaaagttgag caaagaacag 900aagaatcaaa
tcattaatta tgtcaaaaat gaaaaggtaa tggggccagc gaaacttttt
960aaatatatcg ctaaattact ttcttgtgat gttgcagata tcaagggaca
ccgtatcgac 1020aaatcaggta aggctgagat tcatactttc gaagcctatc
gaaaaatgaa aacgcttgaa 1080accttagata ttgagcaaat ggatagagaa
acgcttgata aattagccta tgtcttaaca 1140ttaaacactg agagggaagg
tattcaagaa gctttagaac atgaatttgc tgatggtagc 1200tttagccaga
agcaagttga cgaattggtt caattccgca aagcaaatag ttccattttt
1260ggaaaaggat ggcataattt ttctgtcaaa ctgatgatgg agttaattcc
agaattgtat 1320gagacgtcag aagagcaaat gactatcctg acacgacttg
gaaaacaaaa aacaacttcg 1380tcttcaaata aaacaaaata tatagatgag
aaactattaa ctgaagaaat ctataatcct 1440gttgttgcta agtctgttcg
ccaggctata aaaatcgtaa atgcggcgat taaagaatac 1500ggagactttg
acaatattgt catcgaaatg gctcgtgaaa caaatgaaga tgatgaaaag
1560aaagctattc aaaagattca aaaagccaac aaagatgaaa aagatgcagc
aatgcttaag 1620gctgctaacc aatataatgg aaaggctgaa ttaccacata
gtgttttcca cggtcataag 1680caattagcga ctaaaatccg cctttggcat
cagcaaggag aacgttgcct ttatactggt 1740aagacaatct caatccatga
tttgataaat aatcctaatc agtttgaagt agatcatatt 1800ttacctcttt
ctatcacatt cgatgatagc cttgcaaata aggttttggt ttatgcaact
1860gctaaccaag aaaaaggaca acgaacacct tatcaggctt tagatagtat
ggatgatgcg 1920tggtctttcc gtgaattaaa agcttttgta cgtgagtcaa
aaacactttc aaacaagaaa 1980aaagaatacc tccttacaga agaagatatt
tcaaagtttg atgttcgaaa gaaatttatt 2040gaacgaaatc ttgtagatac
aagatacgct tcaagagttg tcctcaatgc ccttcaagaa 2100cactttagag
ctcacaagat tgatacaaaa gtttccgtgg ttcgtggcca atttacatct
2160caattgagac gccattgggg aattgagaag actcgtgata cttatcatca
ccatgctgtc 2220gatgcattga ttattgccgc ctcaagtcag ttgaatttgt
ggaaaaaaca aaagaatacc 2280cttgtaagtt attcagaaga acaactcctt
gatattgaaa caggtgaact tattagtgat 2340gatgagtaca aggaatctgt
gttcaaagcc ccttatcaac attttgttga tacattgaag 2400agtaaagaat
ttgaagacag tatcttattc tcatatcaag tggattctaa gtttaatcgt
2460aaaatatcag atgccactat ttatgcgaca agacaggcta aagtgggaaa
agataagaag 2520gatgaaactt atgtcttagg gaaaatcaaa gatatctata
ctcaggatgg ttatgatgcc 2580tttatgaaga tttataagaa ggataagtca
aaattcctca tgtatcgtca cgacccacaa 2640acctttgaga aagttatcga
gccaatttta gagaactatc ctaataagga aatgaatgaa 2700aaagggaaag
aagtaccatg taatcctttc ctaaaatata aagaagaaca tggctatatt
2760cgtaaatata gtaaaaaagg caatggtcct gaaatcaaga gtcttaaata
ctatgatagt 2820aagcttttag gtaatcctat tgatattact ccagagaata
gtaaaaataa agttgtctta 2880cagtcattaa aaccttggag aacagatgtc
tatttcaata aaaatactgg taaatatgaa 2940attttaggac tgaaatatgc
tgatttacaa tttgaaaaga agacaggaac atataagatt 3000tcccaggaaa
aatacaatgg cattatgaaa gaagagggtg tagattctga ttcagaattc
3060aagtttacac tttataaaaa tgatttgtta ctcgttaaag atacagaaac
aaaagaacaa 3120cagcttttcc gttttctttc tcgaactatg cctaatgtga
aatattatgt agagttaaag 3180ccttattcaa aagataaatt tgagaagaat
gagtcactta ttgaaatttt aggttctgca 3240gataagtcag gacgatgtat
aaaagggcta ggaaaatcaa atatttctat ttataaggta 3300agaacagatg
tcctaggaaa tcagcatatc atcaaaaatg agggtgataa gcctaagcta
3360gatttttaa 3369934113DNAS. agalactiaemisc_feature(1)..(4113)Cas9
endonuclease, genbank CS571785.1 93atgaataagc catattcaat aggccttgac
atcggtacta attccgtcgg atggagcatt 60attacagatg attataaagt acctgctaag
aagatgagag ttttagggaa cactgataaa 120gaatatatta agaagaatct
cataggtgct ctgctttttg atggcgggaa tactgctgca 180gatagacgct
tgaagcgaac tgctcgtcgt cgttatacac gtcgtagaaa tcgtattcta
240tatttacaag aaatttttgc agaggaaatg agtaaagttg atgatagttt
ctttcatcga 300ttagaggatt cttttctagt tgaggaagat aagagaggga
gcaagtatcc tatctttgca 360acattgcagg aagagaaaga ttatcatgaa
aaattttcga caatctatca tttgagaaaa 420gaattagctg acaagaaaga
aaaagcagac cttcgtctta tttatattgc tctagctcat 480atcattaaat
ttagagggca tttcctaatt gaggatgata gctttgatgt caggaataca
540gacatttcaa aacaatatca agatttttta gaaatcttta atacaacttt
tgaaaataat 600gatttgttat ctcaaaacgt tgacgtagag gcaatactaa
cagataagat tagcaagtct 660gcgaagaaag atcgtatttt agcgcagtat
cctaaccaaa aatctactgg catttttgca 720gaatttttga aattgattgt
cggaaatcaa gctgacttca agaaatattt caatttggag 780gataaaacgc
cgcttcaatt cgctaaggat agctacgatg aagatttaga aaatcttctt
840ggacagattg gtgatgaatt tgcagactta ttctcagcag cgaaaaagtt
atatgatagt 900gtccttttgt ctggcattct tacagtaatc gacctcagta
ccaaggcgcc actttcagct 960tctatgattc agcgttatga tgaacataga
gaggacttga aacagttaaa acaattcgta 1020aaagcttcat tgccggaaaa
atatcaagaa atatttgctg attcatcaaa agatggctac 1080gctggttata
ttgaaggtaa aactaatcaa gaagcttttt ataaatacct gtcaaaattg
1140ttgaccaagc aagaagatag cgagaatttt cttgaaaaaa tcaagaatga
agatttcttg 1200agaaaacaaa ggacctttga taatggctca attccacacc
aagtccattt gacagagctg 1260aaagctatta tccgccgtca atcagaatac
tatcccttct tgaaagagaa tcaagatagg 1320attgaaaaaa tccttacctt
tagaattcct tattatatcg ggccactagc acgtgagaag 1380agtgattttg
catggatgac tcgcaaaaca gatgacagta ttcgaccttg gaattttgaa
1440gacttggttg ataaagaaaa atctgcggaa gcttttatcc atcgtatgac
caacaatgat 1500ttttatcttc ctgaagaaaa agttttacca aagcatagtc
ttatttatga aaaatttacg 1560gtctataatg agttgactaa ggttagatat
aaaaatgagc aaggtgagac ttattttttt 1620gatagcaata ttaaacaaga
aatctttgat ggagtattca aggaacatcg taaggtatcc 1680aagaagaagt
tgctagattt tctggctaaa gaatatgagg agtttaggat agtagatgtt
1740attggtctag ataaagaaaa taaagctttc aacgcctcat tgggaactta
ccacgatctc 1800gaaaaaatac tagacaaaga ttttctagat aatccagata
atgagtctat tctggaagat 1860atcgtccaaa ctctaacatt atttgaagac
agagaaatga ttaagaagcg tcttgaaaac 1920tataaagatc tttttacaga
gtcacaacta aaaaaactct atcgtcgtca ctatactggc 1980tggggacgat
tgtctgctaa gttaatcaat ggtattcgag ataaagagag tcaaaaaaca
2040atcttggact atcttattga tgatggtaga tctaatcgca actttatgca
gttgataaat 2100gatgatggtc tatctttcaa atcaattatc agtaaggcac
aggctggtag tcattcagat 2160aatctaaaag aagttgtagg tgagcttgca
ggtagccctg ctattaaaaa gggaattcta 2220caaagtttga aaattgttga
tgagcttgtt aaagtcatgg gatacgaacc tgaacaaatt 2280gtggttgaga
tggcgcgtga gaatcaaaca acaaatcaag gtcgtcgtaa ctctcgacaa
2340cgctataaac ttcttgatga tggcgttaag aatctagcta gtgacttgaa
tggcaatatt 2400ttgaaagaat atcctacgga taatcaagcg ttgcaaaatg
aaagactttt cctttactac 2460ttacaaaacg gaagagatat gtatacaggg
gaagctctag atattgacaa tttaagtcaa 2520tatgatattg accacattat
tcctcaagct ttcataaaag atgattctat tgataatcgt 2580gttttggtat
catctgctaa aaatcgtgga aagtcagatg atgttcctag ccttgaaatt
2640gtaaaagatt gtaaagtttt ctggaaaaaa ttacttgatg ctaagttaat
gagtcagcgt 2700aagtatgata atttgactaa ggcagagcgc ggaggcctaa
cttccgatga taaggcaaga 2760tttatccaac gtcagttggt tgagacacga
caaattacca agcatgttgc ccgtatcttg 2820gatgaacgct ttaataatga
gcttgatagt aaaggtagaa ggatccgcaa agttaaaatt 2880gtaaccttga
agtcaaattt ggtttcaaat ttccgaaaag aatttggatt ctataaaatt
2940cgtgaagtta acaattatca ccatgcacat gatgcctatc ttaatgcagt
agttgctaaa 3000gctattctaa ccaaatatcc tcagttagag ccagaatttg
tctacggcga ctatccaaaa 3060tataatagtt acaaaacgcg taaatccgct
acagaaaagc tatttttcta ttcaaatatt 3120atgaacttct ttaaaactaa
ggtaacttta gcggatggaa ccgttgttgt aaaagatgat 3180attgaagtta
ataatgatac gggtgaaatt gtttgggata aaaagaaaca ctttgcgaca
3240gttagaaaag tcttgtcata ccctcagaac aatatcgtga agaagacaga
gattcagaca 3300ggtggtttct ctaaggaatc aatcttggcg catggtaact
cagataagtt gattccaaga 3360aaaacgaagg atatttattt agatcctaag
aaatatggag gttttgatag tccgatagta 3420gcttactctg ttttagttgt
agctgatatc aaaaagggta aagcacaaaa actaaaaaca 3480gttacggaac
ttttaggaat taccatcatg gagaggtcca gatttgagaa aaatccatca
3540gctttccttg aatcaaaagg ctatttaaat attagggctg ataaactaat
tattttgccc 3600aagtatagtc tgttcgaatt agaaaatggg cgtcgtcgat
tacttgctag tgctggtgaa 3660ttacaaaaag gtaatgagct agccttacca
acacaattta tgaagttctt ataccttgca 3720agtcgttata atgagtcaaa
aggtaaacca gaggagattg agaagaaaca agaatttgta 3780aatcaacatg
tctcttattt tgatgacatc cttcaattaa ttaatgattt ttcaaaacga
3840gttattctag cagatgctaa tttagagaaa atcaataagc tttaccaaga
taataaggaa 3900aatatatcag tagatgaact tgctaataat attatcaatc
tatttacttt taccagtcta 3960ggagctccag cagcttttaa attttttgat
aaaatagttg atagaaaacg ctatacatca 4020actaaagaag tacttaattc
taccctaatt catcaatcta ttactggact ttatgaaaca 4080cgtattgatt
tgggtaagtt aggagaagat tga 4113944134DNAS.
agalactiaemisc_feature(1)..(4134)Cas9 endonuclease, genbank
CS571790.1 94atgaataagc catattcaat aggccttgac atcggtacta attccgtcgg
atggagcatt 60attacagatg attataaagt acctgctaag aagatgagag ttttagggaa
cactgataaa 120gaatatatta agaagaatct cataggtgct ctgctttttg
atggcgggaa tactgctgca 180gatagacgct tgaagcgaac tgctcgtcgt
cgttatacac gtcgtagaaa tcgtattcta 240tatttacaag aaatttttgc
agaggaaatg agtaaagttg atgatagttt ctttcatcga 300ttagaggatt
cttttctagt tgaggaagat aagagaggta gcaagtatcc tatctttgca
360acaatgcagg aggagaaata ttatcatgaa aaatttccga caatctatca
tttgagaaaa 420gaattggctg acaagaaaga aaaagcagac cttcgtcttg
tttatctggc tctagctcat 480atcattaaat tcagagggca tttcctaatt
gaggatgata gatttgatgt gaggaatacc 540gatattcaaa aacaatatca
agccttttta gaaatttttg atactacctt tgaaaataat 600catttgttat
ctcaaaatgt agatgtagaa gcaattctaa cagataagat tagcaagtct
660gcgaagaagg atcgcatctt agcgcagtat cctaaccaaa aatctactgg
tatttttgca 720gaatttttga aattgattgt cggaaatcaa gctgacttca
agaaacattt caatttggag 780gataaaacac cgcttcaatt cgctaaggat
agctacgatg aagatttaga aaatcttctt 840ggacagattg gtgatgaatt
tgcagactta ttctcagtag cgaaaaagct atatgatagt 900gttcttttat
ctggcattct tacagtaact gatctcagta ccaaggcgcc actttctgcc
960tctatgattc agcgttatga tgaacatcat gaggacttaa agcatctaaa
acaattcgta 1020aaagcttcat tacctgaaaa ttatcgggaa gtatttgctg
attcatcaaa agatggctac 1080gctggctata ttgaaggcaa aactaatcaa
gaagcttttt ataaatatct gttaaaattg 1140ttgaccaaac aagaaggtag
cgagtatttt cttgagaaaa ttaagaatga agattttttg 1200agaaaacaga
gaacctttga taatggctca atcccgcatc aagtccattt gacagaattg
1260agggctatta ttcgacgtca atcagaatac tatccattct tgaaagagaa
tcaagatagg 1320attgaaaaaa tccttacctt tagaattcct tattatgtcg
ggccactagc acgtgagaag 1380agtgattttg catggatgac tcgcaaaaca
gatgacagta ttcgaccttg gaattttgaa 1440gacttggttg ataaagaaaa
atctgcggaa gcttttatcc atcgcatgac caacaatgac 1500ctctatcttc
cagaagaaaa agttttacca aagcatagtc ttatttatga aaaatttact
1560gtttacaatg aattaacgaa ggttagattt ttggcagaag gctttaaaga
ttttcaattt 1620ttaaatagga agcaaaaaga aactatcttt aacagcttgt
ttaaggaaaa acgtaaagta 1680actgaaaagg atattattag ttttttgaat
aaagttgatg gatatgaagg aattgcaatc 1740aaaggaattg agaaacagtt
taacgctagc ctttcaacct atcatgatct taaaaaaata 1800cttggcaagg
atttccttga taatacagat aacgagctta ttttggaaga tatcgtccaa
1860actctaacct tatttgaaga tagagaaatg attaagaagt gtcttgacat
ctataaagat 1920ttttttacag agtcacagct taaaaagctc tatcgccgtc
actatactgg ctggggacga 1980ttgtctgcta agctaataaa tggcatccga
aataaagaga atcaaaaaac aatcttggac 2040tatcttattg atgatggaag
tgcaaaccga aacttcatgc agttgataaa tgatgatgat 2100ctatcattta
aaccaattat tgacaaggca cgaactggta gtcattcgga taatctgaaa
2160gaagttgtag gtgaacttgc tggtagccct gctattaaaa aagggattct
acaaagtttg 2220aaaatagttg atgagctggt taaagtcatg ggctatgaac
ctgaacaaat cgtggttgaa 2280atggcacgtg agaaccaaac gacagcaaaa
ggattaagtc gttcacgaca acgcttgaca 2340accttgagag aatctcttgc
taatttgaag agtaatattt tggaagagaa aaagcctaag 2400tatgtgaaag
atcaagttga aaatcatcat ttatctgatg accgtctttt cctttactac
2460ttacaaaacg gaagagatat gtatacaaaa aaggctctgg atattgataa
tttaagtcaa 2520tatgatattg accacattat tcctcaagct ttcataaaag
atgattctat tgataatcgt 2580gttttggtat catctgctaa aaatcgtgga
aaatcagatg atgttcctag cattgaaatt 2640gtaaaagctc gcaaaatgtt
ctggaaaaat ttactggatg ctaagttaat gagtcagcgt 2700aagtatgata
atttgactaa ggcagagcgc ggaggcctaa cttccgatga taaggcaaga
2760tttatccaac gtcagttggt tgagactcga caaattacca agcatgtagc
tcgtatcttg 2820gatgaacgct tcaataatga agttgataat ggtaaaaaga
tttgcaaggt taaaattgta 2880accttgaagt caaatttggt ttcaaatttc
cgaaaagaat ttggattcta taaaattcgt 2940gaagttaatg attatcacca
tgcacacgat gcttatctta atgcagtagt tgccaaagct 3000attctaacca
aatatccaca gttagagcca gagtttgtct acggaatgta tagacagaaa
3060aaactttcga aaatcgttca tgaggataag gaagaaaaat atagtgaagc
aaccaggaaa 3120atgtttttct actccaactt gatgaatatg ttcaaaagag
ttgtgaggtt agcagatggt 3180tctattgttg taagaccagt aatagaaact
ggtagatata tgagaaaaac tgcatgggat 3240aaaaagaaac actttgcgac
agttagaaaa gtcttgtcat accctcagaa caatatcgtg 3300aagaagacag
agattcagac aggtggtttc tctaaggaat caatcttggc gcatggtaac
3360tcagataagt tgattccaag aaaaacgaag gatatttatt tagatcctaa
gaaatatgga 3420ggttttgata gtccgatagt agcttactct gttttagttg
tagctgatat caaaaaaggt 3480aaagcacaaa aactaaaaac agttacggaa
cttttaggaa ttaccatcat ggagaggtcc 3540agatttgaga aaaatccatc
agctttcctt gaatcaaaag gttatttaaa tattagggac 3600gataaattaa
tgattttacc gaagtatagt ctgttcgaat tagaaaatgg gcgtcgtcga
3660ttacttgcta gtgctggtga attacaaaaa ggtaacgagc tagccttacc
aacacaattt 3720atgaagttct tataccttgc aagtcgttat aatgagtcaa
aaggtaaacc agaggagatt 3780gagaagaaac aagaatttgt aaatcaacat
gtctcttatt ttgatgacat ccttcaatta 3840attaatgatt tttcaaaacg
agttattcta gcagatgcta atttagagaa aatcaataag 3900ctttaccagg
ataataagga aaatatacca gtagatgaac ttgctaataa tattatcaat
3960ctatttactt ttaccagtct aggagctcca gcagctttta aattttttga
taaaatagtt 4020gatagaaaac gctatacatc aactaaagaa gtacttaatt
ctactctaat ccatcaatct 4080attactggac tttatgaaac acgtattgat
ttgggtaaat taggagaaga ttga 4134954038DNAS.
mutansmisc_feature(1)..(4038)Cas9 endonuclease, genbank CS571790.1
95atgaaaaaac cttactctat tggacttgat attggaacca attctgttgg ttgggctgtt
60gtgacagatg actacaaagt tcctgctaag aagatgaagg ttctgggaaa tacagataaa
120agtcatatcg agaaaaattt gcttggcgct ttattatttg atagcgggaa
tactgcagaa 180gacagacggt taaagagaac tgctcgccgt cgttacacac
gtcgcagaaa tcgtatttta 240tatttgcaag agattttttc agaagaaatg
ggcaaggtag atgatagttt ctttcatcgt 300ttagaggatt cttttcttgt
tactgaggat aaacgaggag agcgccatcc catttttggg 360aatcttgaag
aagaagttaa gtatcatgaa aattttccaa ccatttatca tttgcggcaa
420tatcttgcgg ataatccaga aaaagttgat ttgcgtttag tttatttggc
tttggcacat 480ataattaagt ttagaggtca ttttttaatt gaaggaaagt
ttgatacacg caataatgat 540gtacaaagac tgtttcaaga atttttagca
gtctatgata atacttttga gaatagttcg 600cttcaggagc aaaatgttca
agttgaagaa attctgactg ataaaatcag taaatctgct 660aagaaagata
gagttttgaa actttttcct aatgaaaagt ctaatggccg ctttgcagaa
720tttctaaaac taattgttgg taatcaagct gattttaaaa agcattttga
attagaagag 780aaagcaccat tgcaattttc taaagatact tatgaagaag
agttagaagt actattagct 840caaattggag ataattacgc agagctcttt
ttatcagcaa agaaactgta tgatagtatc 900cttttatcag ggattttaac
agttactgat gttggtacca aagcgccttt atctgcttcg 960atgattcagc
gatataatga acatcagatg gatttagctc agcttaaaca attcattcgt
1020cagaaattat cagataaata taacgaagtt ttttctgatg tttcaaaaga
cggctatgcg 1080ggttatattg atgggaaaac aaatcaagaa gctttttata
aataccttaa aggtctatta 1140aataagattg agggaagtgg ctatttcctt
gataaaattg agcgtgaaga ttttctaaga 1200aagcaacgta cctttgacaa
tggctctatt ccacatcaga ttcatcttca agaaatgcgt 1260gctatcattc
gtagacaggc tgaattttat ccgtttttag cagacaatca agataggatt
1320gagaaattat tgactttccg tattccctac tatgttggtc cattagcgcg
cggaaaaagt 1380gattttgctt ggttaagtcg gaaatcggct gataaaatta
caccatggaa ttttgatgaa 1440atcgttgata aagaatcctc tgcagaagct
tttatcaatc gtatgacaaa ttatgatttg 1500tacttgccaa atcaaaaagt
tcttcctaaa catagtttat tatacgaaaa atttactgtt 1560tacaatgaat
taacaaaggt taaatataaa acagagcaag gaaaaacagc attttttgat
1620gccaatatga agcaagaaat ctttgatggc gtatttaagg tttatcgaaa
agtaactaaa 1680gataaattaa tggatttcct tgaaaaagaa tttgatgaat
ttcgtattgt tgatttaaca 1740ggtctggata aagaaaataa agtatttaac
gcttcttatg gaacttatca tgatttgtgt 1800aaaattttag ataaagattt
tctcgataat tcaaagaatg aaaagatttt agaagatatt 1860gtgttgacct
taacgttatt tgaagataga gaaatgatta gaaaacgtct agaaaattac
1920agtgatttat tgaccaaaga acaagtgaaa aagctggaaa gacgtcatta
tactggttgg 1980ggaagattat cagctgagtt aattcatggt attcgcaata
aagaaagcag aaaaacaatt 2040cttgattatc tcattgatga tggcaatagc
aatcggaact ttatgcaact gattaacgat 2100gatgctcttt ctttcaaaga
agagattgct aaggcacaag ttattggaga aacagacaat 2160ctaaatcaag
ttgttagtga tattgctggc agccctgcta ttaaaaaagg aattttacaa
2220agcttgaaga ttgttgatga gcttgtcaaa attatgggac atcaacctga
aaatatcgtc 2280gtggagatgg cgcgtgaaaa ccagtttacc aatcagggac
gacgaaattc acagcaacgt 2340ttgaaaggtt tgacagattc tattaaagaa
tttggaagtc aaattcttaa agaacatccg 2400gttgagaatt cacagttaca
aaatgataga ttgtttctat attatttaca aaacggcaga 2460gatatgtata
ctggagaaga attggatatt gattatctaa gccagtatga tatagaccat
2520attatcccgc aagcttttat aaaggataat tctattgata atagagtatt
gactagctca 2580aaggaaaatc gtggaaaatc ggatgatgta ccaagtaaag
atgttgttcg taaaatgaaa 2640tcctattgga gtaagctact ttcggcaaag
cttattacac aacgtaaatt tgataatttg 2700acaaaagctg aacgaggtgg
attgaccgac gatgataaag ctggattcat caagcgtcaa 2760ttagtagaaa
cacgacaaat taccaaacat gtagcacgta ttctggacga acgatttaat
2820acagaaacag atgaaaacaa caagaaaatt cgtcaagtaa aaattgtgac
cttgaaatca 2880aatcttgttt ccaatttccg taaagagttt gaactctaca
aagtgcgtga aattaatgac 2940tatcatcatg cacatgatgc ctatctcaat
gctgtaattg gaaaggcttt actaggtgtt 3000tacccacaat tggaacctga
atttgtttat ggtgattatc ctcattttca tggacataaa 3060gaaaataaag
caactgctaa gaaatttttc tattcaaata ttatgaactt ctttaaaaaa
3120gatgatgtcc gtactgataa aaatggtgaa attatctgga aaaaagatga
gcatatttct 3180aatattaaaa aagtgctttc ttatccacaa gttaatattg
ttaagaaagt agaggagcaa 3240acgggaggat tttctaaaga atctatcttg
ccgaaaggta attctgacaa gcttattcct 3300cgaaaaacga agaaatttta
ttgggatacc aagaaatatg gaggatttga tagcccgatt 3360gttgcttatt
ctattttagt tattgctgat attgaaaaag gtaaatctaa aaaattgaaa
3420acagtcaaag ccttagttgg tgtcactatt atggaaaaga tgacttttga
aagggatcca 3480gttgcttttc ttgagcgaaa aggctatcga aatgttcaag
aagaaaatat tataaagtta 3540ccaaaatata gtttatttaa actagaaaac
ggacgaaaaa ggctattggc aagtgctagg 3600gaacttcaaa agggaaatga
aatcgttttg ccaaatcatt taggaacctt gctttatcac 3660gctaaaaata
ttcataaagt tgatgaacca aagcatttgg actatgttga taaacataaa
3720gatgaattta aggagttgct agatgttgtg tcaaactttt ctaaaaaata
tactttagca 3780gaaggaaatt tagaaaaaat caaagaatta tatgcacaaa
ataatggtga agatcttaaa 3840gaattagcaa gttcatttat caacttatta
acatttactg ctataggagc accggctact 3900tttaaattct ttgataaaaa
tattgatcga aaacgatata cttcaactac tgaaattctc 3960aacgctaccc
tcatccacca atccatcacc ggtctttatg aaacgcggat tgatctcaat
4020aagttaggag gagactaa 40389694RNAArtificial Sequencesingle guide
RNA targeting the LIGCas-3 target sequence 96gcguacgcgu acgugugguu
uuagagcuag aaauagcaag uuaaaauaag gcuaguccgu 60uaucaacuug aaaaaguggc
accgagucgg ugcu 94
* * * * *