U.S. patent application number 15/082621 was filed with the patent office on 2016-07-14 for rna aptamers for therapeutic and diagnostic delivery to pancreatic cancer cells.
The applicant listed for this patent is CITY OF HOPE. Invention is credited to John J. ROSSI, Sorah YOON.
Application Number | 20160201059 15/082621 |
Document ID | / |
Family ID | 49328023 |
Filed Date | 2016-07-14 |
United States Patent
Application |
20160201059 |
Kind Code |
A1 |
ROSSI; John J. ; et
al. |
July 14, 2016 |
RNA APTAMERS FOR THERAPEUTIC AND DIAGNOSTIC DELIVERY TO PANCREATIC
CANCER CELLS
Abstract
In some embodiments, aptamers that specifically bind pancreatic
cancer cells are provided. Such aptamers may include an RNA
molecule that specifically binds a pancreatic cancer cell surface
protein. In certain embodiments, the RNA molecule that is used as
an aptamer may include a nucleotide sequence of GAAUGCCC (SEQ ID
NO: 8). In other embodiments, the RNA molecule may include a
nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ
ID NO:4, SEQ ID NO:5, or SEQ ID NO:6. In certain embodiments, the
aptamer may be conjugated to one or more therapeutic agents (e.g.,
an shRNA molecule, an siRNA molecule, an mRNA molecule, or an miRNA
molecule), one or more diagnostic agents, or a combination thereof.
The aptamers and their conjugates may be used to deliver
therapeutic agents to a pancreatic cancer cell, and/or in methods
for treating or diagnosing pancreatic cancer.
Inventors: |
ROSSI; John J.; (Azusa,
CA) ; YOON; Sorah; (Pasadena, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
CITY OF HOPE |
DUARTE |
CA |
US |
|
|
Family ID: |
49328023 |
Appl. No.: |
15/082621 |
Filed: |
March 28, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14391997 |
Oct 10, 2014 |
|
|
|
PCT/US2013/031074 |
Mar 13, 2013 |
|
|
|
15082621 |
|
|
|
|
61622375 |
Apr 10, 2012 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/188; 435/375; 514/44R; 536/23.1; 536/23.5 |
Current CPC
Class: |
C12N 15/115 20130101;
C12N 2310/351 20130101; A61K 31/7105 20130101; A61P 1/18 20180101;
A61K 31/7088 20130101; A61P 35/00 20180101; A61K 47/549 20170801;
C12N 2310/16 20130101; C07H 21/02 20130101; C12N 15/111 20130101;
C12N 2320/32 20130101; C12N 2310/3519 20130101; C12N 2310/322
20130101 |
International
Class: |
C12N 15/115 20060101
C12N015/115; A61K 31/7088 20060101 A61K031/7088; A61K 47/48
20060101 A61K047/48 |
Claims
1. An aptamer comprising an RNA molecule, wherein the RNA molecule
comprises a nucleotide sequence of GAAUGCCC (SEQ ID NO: 8).
2. The aptamer of claim 1, wherein the aptamer comprises one or
more modified nucleosides.
3. The aptamer of claim 1, wherein the aptamer comprises one or
more 2-fluoropyrimidine nucleosides.
4. The aptamer of claim 1, wherein the aptamer has a length of 87
nucleotides or less.
5. The aptamer of claim 1, wherein the aptamer has a length of 40
nucleotides or less.
6. The aptamer of claim 1, wherein the aptamer is conjugated to one
or more therapeutic agents.
7. The aptamer of claim 1, wherein the aptamer is conjugated to an
agent selected from the group consisting of an shRNA molecule,
siRNA molecule, mRNA molecule or an miRNA molecule.
8. The aptamer of claim 1, wherein the aptamer is conjugated to a
chemotherapeutic agent selected from the group consisting of
13-cis-Retinoic Acid, 2-Chlorodeoxyadenosine, 5-Azacitidine,
5-Fluorouracil, 6-Mercaptopurine, 6-Thioguanine, actinomycin-D,
adriamycin, aldesleukin, alemtuzumab, alitretinoin,
all-transretinoic acid, alpha interferon, altretamine,
amethopterin, am ifostine, anagrelide, anastrozole,
arabinosylcytosine, arsenic trioxide, amsacrine, am
inocamptothecin, aminoglutethimide, asparaginase, azacytidine,
bacillus calmette-guerin (BCG), bendamustine, bevacizumab,
bexarotene, bicalutamide, bortezomib, bleomycin, busulfan, calcium
leucovorin, citrovorum factor, capecitabine, canertinib,
carboplatin, carmustine, cetuximab, chlorambucil, cisplatin,
cladribine, cortisone, cyclophosphamide, cytarabine, darbepoetin
alfa, dasatinib, daunomycin, decitabine, denileukin diftitox,
dexamethasone, dexasone, dexrazoxane, dactinomycin, daunorubicin,
decarbazine, docetaxel, doxorubicin, doxifluridine, eniluracil,
epirubicin, epoetin alfa, erlotinib, everolimus, exemestane,
estramustine, etoposide, filgrastim, fluoxymesterone, fulvestrant,
flavopiridol, floxuridine, fludarabine, fluorouracil, flutamide,
gefitinib, gemcitabine, gemtuzumab ozogamicin, goserelin,
granulocyte-colony stimulating factor, granulocyte
macrophage-colony stimulating factor, hexamethylmelamine,
hydrocortisone hydroxyurea, ibritumomab, interferon alpha,
interleukin-2, interleukin-11, isotretinoin, ixabepilone,
idarubicin, imatinib mesylate, ifosfamide, irinotecan, lapatinib,
lenalidomide, letrozole, leucovorin, leuprolide, liposomal Ara-C,
lomustine, mechlorethamine, megestrol, melphalan, mercaptopurine,
mesna, methotrexate, methylprednisolone, mitomycin C, mitotane,
mitoxantrone, nelarabine, nilutamide, octreotide, oprelvekin,
oxaliplatin, paclitaxel, pamidronate, pemetrexed, panitumumab, PEG
Interferon, pegaspargase, pegfilgrastim, PEG-L-asparag inase,
pentostatin, plicamycin, prednisolone, prednisone, procarbazine,
raloxifene, rituximab, romiplostim, ralitrexed, sapacitabine,
sargramostim, satraplatin, sorafenib, sunitinib, semustine,
streptozocin, tamoxifen, tegafur, tegafur-uracil, temsirolimus,
temozolamide, teniposide, thalidomide, thioguanine, thiotepa,
topotecan, toremifene, tositumomab, trastuzumab, tretinoin,
trimitrexate, alrubicin, vincristine, vinblastine, vindestine,
vinorelbine, vorinostat, and zoledronic acid.
9. The aptamer of claim 1, wherein the aptamer is conjugated to a
chemotherapeutic agent selected from the group consisting of
5-Azacitidine, 5-Fluorouracil, adriamycin and gemcitabine.
10. The aptamer of claim 1, wherein the aptamer is conjugated to
one or more diagnostic agents.
11. The aptamer of claim 1, wherein the aptamer is conjugated to a
nanoparticle, a radioactive substance, a dye, a contrast agent, a
fluorescent molecule, a bioluminescent molecule, an enzyme, or an
enhancing agent.
12. A pharmaceutical composition comprising the aptamer of claim 1
and a pharmaceutically acceptable carrier.
13. A method of delivering a therapeutic agent to a pancreatic
cancer cell comprising contacting the pancreatic cancer cell with
an aptamer conjugate, wherein the aptamer conjugate comprises an
aptamer component and a therapeutic agent component; and wherein
the aptamer component is an RNA molecule that specifically binds a
pancreatic cancer cell surface protein, resulting in
internalization of the pancreatic cell aptamer conjugate.
14. The method of claim 13, wherein the therapeutic agent component
comprises an shRNA molecule, an siRNA molecule, an mRNA molecule,
or an miRNA molecule.
15. The method of claim 13, wherein the RNA molecule comprises a
nucleotide sequence of GAAUGCCC (SEQ ID NO: 8).
16. A method for treating pancreatic cancer comprising
administering a therapeutically effective amount of an aptamer,
wherein the aptamer comprises an RNA molecule that specifically
binds a pancreatic cancer cell surface protein.
17. The method of claim 16, wherein the RNA molecule comprises a
nucleotide sequence of GAAUGCCC (SEQ ID NO: 8).
18. The method of claim 16, wherein the aptamer is conjugated to
one or more therapeutic agents.
19. The method of claim 18, wherein the therapeutic agent is a
nucleic acid molecule.
20. The method of claim 16, wherein the wherein the aptamer is
conjugated to an agent selected from the group consisting of an
shRNA molecule, siRNA molecule, mRNA molecule or an miRNA molecule.
Description
PRIORITY CLAIM
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/391,997, filed Oct. 10, 2014, which is a
U.S. national phase application of International Application No.
PCT/US2013/031074, filed Mar. 13, 2013, which claims priority to
U.S. Provisional Patent Application No. 61/622,375, filed Apr. 10,
2012, the subject matter of which is hereby incorporated by
reference as if fully set forth herein.
BACKGROUND
[0002] Pancreatic ductal adenocarcinoma (PDAC) is the fourth most
common cause of cancer death in the United States, accounting for
30,000 deaths yearly in the United States (Jemal et al. 2009).
Pancreatic cancer is characterized by a rapid disease progression
and absence of specific symptoms, largely precluding an early
diagnosis and meaningful treatment (Stathis & Moore, 2010;
Schneider et al. 2005).
[0003] Despite aggressive efforts to improve treatment for patients
with pancreatic cancer, limited progress has been made (Stathis
& Moore 2010; Pancreatic Cancer UK 2011). Although improvement
is being made through the development of improved targeted and
systemic therapies, the prognosis and treatment of pancreatic
cancer is still inadequate. This is due both to the late
presentation and the lack of an effective treatment strategy (Li et
al. 2004). As a result, gemcitabine as a single agent given
postoperatively remains the current standard of care. Combinations
with other chemotherapeutic drugs or biological agents given as a
palliative setting for unresectable pancreatic cancer or adjuvant
setting following resection have resulted in limited improvement
(Klinkenbijl et al. 1999; Neoptolemus et al. 2004; Oettle et al.
2007). The 5 yr survival of patients with pancreatic cancer,
despite numerous phase 3 trials, remains less than 5% after
resection (Vincent et al. 2011; Alexakis 2004; Ghaneh 2007, BSG
2005). The majority of patients will present with either local or
systemic recurrence within 2 years following resection and
postoperative adjuvant chemotherapy (Vincent et al. 2011; Alexakis
2004; Ghaneh 2007). Currently, the most effective single agent
gemcitabine achieves an improved 1-year survival rate from 16 to
19%. Treatment with conventional treatments such as gemcitabine or
5-flurouracil (5-FU) results in a median survival of just a few
months (Saif 2009; Rivera et al. 2009). The addition of
Tarceva.RTM. (erlotinib) in a randomized study added a median of 11
days to overall survival (Cunningham 2009; Heinemann 2012).
[0004] This limitation of conventional treatment is due to the
profound resistance of PDAC cells towards anti-cancer drugs
emerging from the efficient protection against chemotherapeutic
drugs (Wong & Lemoine 2009; Fulda 2009). Therefore, it is
important to develop new therapeutic strategies for this
devastating disease.
SUMMARY
[0005] In some embodiments, aptamers that specifically bind
pancreatic cancer cells are provided. Such pancreatic cancer cell
aptamers may include an RNA molecule that specifically binds a
pancreatic cancer cell surface protein. The RNA molecule that is
used as an aptamer in accordance with the embodiments described
herein may include a nucleotide sequence of GAAUGCCC (SEQ ID NO:
8). In certain embodiments, the RNA molecule may include a
nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ
ID NO:4, SEQ ID NO:5, or SEQ ID NO:6. In certain embodiments, the
aptamer may be conjugated to one or more therapeutic agents, one or
more diagnostic agents, or a combination thereof. In some aspects
the one or more therapeutic agents may be selected from an shRNA
molecule, an siRNA molecule, an mRNA molecule, or an miRNA
molecule.
[0006] In some embodiments, methods for delivering a therapeutic
agent to a pancreatic cancer cell are provided. Such methods may
include a step of contacting the pancreatic cancer cell with a
pancreatic cancer cell aptamer conjugate. The pancreatic cancer
cell aptamer conjugate may include a pancreatic cell aptamer
component and a therapeutic agent component. In some aspects the
pancreatic cell aptamer component includes an RNA molecule that
specifically binds a pancreatic cancer cell surface protein,
resulting in internalization of the pancreatic cell aptamer
conjugate--such as those described herein. The therapeutic agent
component may include any suitable therapeutic agent that can be
conjugated to an mRNA molecule including, but not limited to, an
shRNA molecule, an siRNA molecule, an mRNA molecule, or an miRNA
molecule.
[0007] In other embodiments, methods for treating pancreatic cancer
are provided. Such a method may include a step of administering a
therapeutically effective amount of a pancreatic cell aptamer,
wherein the pancreatic cell aptamer comprises an RNA molecule that
specifically binds a pancreatic cancer cell surface protein, and
wherein the pancreatic cell aptamer prevents binding of a
pancreatic cell ligand. The RNA molecule that is used as an aptamer
in accordance with the embodiments described herein may include a
nucleotide sequence of GAAUGCCC (SEQ ID NO: 8). In certain
embodiments, the RNA molecule may include a nucleotide sequence of
SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or
SEQ ID NO:6. In certain embodiments, the aptamer may be conjugated
to one or more therapeutic agents, one or more diagnostic agents,
or a combination thereof. In some embodiments, the aptamers may be
part of a pharmaceutical composition for use in the methods of
treating pancreatic cancer. Said pharmaceutical compositions may
further comprise one or more additional therapeutic agents (e.g.,
chemotherapeutics).
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] This application contains at least one drawing executed in
color. Copies of this application with color drawing(s) will be
provided by the Office upon request and payment of the necessary
fees.
[0009] FIG. 1 is a schematic diagram illustrating a
selection/counterselection SELEX process for selecting pancreatic
cancer cell-specific aptamers according to some embodiments.
Briefly, a population of 2'F-Py RNAs was incubated with a
non-pancreatic cancer cell line (Huh7 hepatocarcinoma cell line) or
a healthy pancreatic cell line for the counterselection step.
Unbound oligonucleotides sequences were recovered and incubated
with a pancreatic cancer cell line (Panc-1) for the selection step.
Unbound sequences were discarded and bound sequences were recovered
by total RNA extraction. Sequences enriched by the selection step
are then amplified before the subsequent cycle of selection. (SELEX
method based on an adapted version of Esposito et al. 2011).
[0010] FIGS. 2A-2F show the secondary structure of six RNA aptamers
selected from randomized N40 RNA libraries according to some
embodiments. The secondary structures of the six aptamers, (2A) SEQ
ID NO:1; (2B) SEQ ID NO:2; (2C) SEQ ID NO:3; (2D) SEQ ID NO:4; (2E)
SEQ ID NO:5; and (2F) SEQ ID NO:6; were predicted using the Mfold
program.
[0011] FIG. 3 illustrates cell-type specific binding and uptake by
flow cytometry. Cy3-labeled RNAs were tested for binding to Panc-1
and Huh7 as control cells. The selected aptamers showed cell-type
specific binding affinity. The results are reported as mean
.+-.S.D. Asterisks indicate that the value is significantly
different from the value for the initial RNA library control in the
corresponding assay, with P values of P=0.001(**) to 0.01(*). P
values were calculated using a two-tailed, paired t-test with 95%
confidence intervals. Data shown are the means of three replicates,
and error bars represent the standard errors of the means. Data
represent the average of three replicated. Initial RNA library pool
is shown as Lib. PC; Panc-1, NC; Huh7.
[0012] FIGS. 4A and 4B illustrate cell-internalization of target
cells by confocal microscopy. Cells were grown in 35 mm dishes and
incubated with 100 nM of Cy3-labeled RNA. After one hour
incubation, cells were washed and took images using 40.times.
magnification. (4A) Initial RNA library pool was incubated in
Panc-1 and Huh7. (4B) Each aptamer clones were incubated in Panc-1.
Red; Cy3-labeled RNA, Blue: Hoechest 33342 (Nuclear dye for living
cells).
[0013] FIGS. 5A-E illustrate cell-internalization in other types of
pancreatic cancer cells by confocal microscopy. Each RNA aptamer
clones labeled with Cy3 were applied to different type of
pancreatic cancer cells. Cells were grown in 35 mm dishes and
incubated with 100 nM of RNA. After one hour incubation, cells were
washed and took images using 40.times. magnification. (5A) AsPC-1.
(5B) CFPAC-1. (5C) BxPC-1. (5D) Capan-1. (5E) MIA PaCa-2. Red;
Cy3-labeled RNA, Blue: Hoechest 33342 (Nuclear dye for living
cells). Aptamers were internalized by every type of pancreatic
cancer cells.
[0014] FIGS. 6A and 6B illustrate cell-internalization in normal
primary pancreatic cells by confocal microscopy. Each of the RNA
aptamer clones labeled with Cy3 was applied to different type of
normal pancreatic cells. Cells were grown in 35 mm dishes and
incubated with 100 nM of RNA. After one hour incubation, cells were
washed and took images using 40.times. magnification. Red:
Cy3-labeled RNA (none shown), Blue: Hoechest 33342 (Nuclear dye for
living cells). None of the normal pancreatic cancer cells
internalized the RNA aptamers.
[0015] FIG. 7 shows the binding affinity of P19, P15 and P1
aptamers. The measurement of dissociation constant (K.sub.D) was
done by physiology function of Zeiss LSM using various
concentrations (15.6-500 nM) of Cy3 labeled aptamers. The affinity
of P19, P15, and P1 were 64.76 nM, 70.72 nM, and 112.2 nM,
respectively.
[0016] FIG. 8 illustrates cell internalization competition assays
by confocal microscopy. Panc-1 cells were incubated with
fluorescently labeled P19 RNA (200 nM) and increasing amounts (1
.mu.M) of unlabeled each clone aptamers as competitors against the
labeled RNA. The fluorescence intensity was quantified in the
presence of increasing amounts of competitors using confocal
microscopy and analyzed statistically.
[0017] FIG. 9 shows cell proliferation assays for cells treated
with P1 and P19 aptamers. Cell proliferation was quantified by
WST-1 reagent following the manufacturer's guidelines. Panc-1
(2.5.times.10.sup.5 cells) was treated with four times of P1 and
P19 at 9 ug per treatment in Panc-1. WST-1 reagent was used at a
1:100 dilution to plates and incubated for one hour. The enzymatic
reaction was measured at 450 .eta.m using Bio-Tek ELISA reader
[0018] FIG. 10 illustrates results of in vivo experiments. Panc-1
pancreatic cancer cells were injected subcutaneously (s.c.) on the
flank in five NOD/SCID mice. After 2 weeks, mice were divided into
two groups. One group served as untreated controls and the others
injected 10 ug with P1 combined with P19. Aptamers were injected
via tail vein. A total of 4 times was injected per animal. Student
t-test was used for statistical analysis. * TTEST: P value
<0.05.
[0019] FIG. 11 illustrates results of gemcitabine-resistant tumor
animal experiments. Gemcitabine-resistant ASPC-1
(2.8.times.10.sup.6) cells were injected subcutaneously (s.c.) on
the flank in twelve 5-weeks-old female NOD/SCID mice. After 3
weeks, mice were divided into four groups. One group served as
untreated controls and the others injected with P1, P19, and P1
combined with P19 (P1+P19). Aptamers were injected via tail vein. A
total of 4 times was injected per animal every two days and
sacrificed at day 9. When compared to the control, all three
treatment groups showed a significant anti-tumor effect
(*P<0.05)
DETAILED DESCRIPTION
[0020] Pancreatic cancer cell aptamers, systems for cell specific
delivery and methods for their use are provided herein. According
to the embodiments described herein, the pancreatic cancer cell
aptamers may be used alone or in combination with therapeutic or
diagnostic agents and molecules for treatment, diagnosis and
monitoring of pancreatic cancer.
[0021] Aptamers
[0022] In one embodiment, aptamers for targeting pancreatic cancer
cells are provided. Said aptamers may be used for treating
pancreatic cell cancer, malignancies or for any other disease or
condition related to pancreatic cells. An "aptamer" is any suitable
small molecule, such as a nucleic acid or a peptide molecule that
binds specifically to a target, such as a small molecule, protein,
nucleic acid, cell, tissue or organism. Aptamers that target
specific cell surface proteins can be employed as delivery
molecules to target a distinct cell type, thereby reducing
off-target effects or other unwanted side effects. Further, by
binding a specific cell surface protein, the aptamers may also be
used as a therapeutic agent on their own.
[0023] In some embodiments, the aptamer (or aptamer component) is a
nucleic acid aptamer. Such aptamers with binding affinities in
nanomolar range have been utilized for flexible applications
ranging from diagnostic to therapeutic assay formats (Zhou &
Rossi 2009). Moreover, aptamers that target specific cell surface
proteins may be employed as delivery molecules to target a distinct
cell type, hence reducing off-target effects or other unwanted side
effects (Zhou et al. 2008). In certain embodiments, the nucleic
acid aptamer is an RNA aptamer. An RNA aptamer may be any suitable
RNA molecule that can be used on its own as a stand-alone molecule,
or may be integrated as part of a larger RNA molecule having
multiple functions, such as an RNA interference molecule in
accordance with some embodiments. For example, the pancreatic cell
aptamer may be located in an exposed region of an shRNA molecule
(e.g., the loop region of the shRNA molecule) to allow the shRNA or
miRNA molecule to bind a surface receptor on the target cell, then
after it is internalized, is processed by the target cell's RNA
interference pathways.
[0024] The nucleic acid that forms the nucleic acid aptamer may
comprise naturally occurring nucleosides, modified nucleosides,
naturally occurring nucleosides with hydrocarbon linkers (e.g., an
alkylene) or a polyether linker (e.g., a PEG linker) inserted
between one or more nucleosides, modified nucleosides with
hydrocarbon or PEG linkers inserted between one or more
nucleosides, or a combination of thereof. In some embodiments,
nucleotides or modified nucleotides of the nucleic acid aptamer can
be replaced with a hydrocarbon linker or a polyether linker
provided that the binding affinity and selectivity of the nucleic
acid aptamer is not substantially reduced by the substitution.
[0025] According to the embodiments described herein, aptamers that
target and selectively bind pancreatic cancer cells are generated
and selected. Selection of aptamers may be accomplished by any
suitable method known in the art, including an optimized protocol
for in vitro selection, known as SELEX (Systemic Evolution of
Ligands by Exponential enrichment). Although the SELEX process has
been established as a general technique for aptamer selection, it
is not predictable nor is it standardized for use with any target.
Instead, the SELEX process must be optimized and customized for
each particular target molecule. Each SELEX experiment includes its
own challenges and is not guaranteed to work for all targets.
[0026] Many factors are important for successful aptamer selection.
For example, the target molecule should be stable and easily
reproduced for each round of SELEX, because the SELEX process
involves multiple rounds of binding, selection, and amplification
to enrich the nucleic acid molecules. In addition, the nucleic
acids that exhibit specific binding to the target molecule have to
be present in the initial library. Thus, it is advantageous to
produce a highly diverse nucleic acid pool. Because the starting
library is not guaranteed to contain aptamers to the target
molecule, the SELEX process for a single target may need to be
repeated with different starting libraries. Aptamer selection using
SELEX is unpredictable. Even when all of the factors are optimized
for successful aptamer selection, the SELEX process does not always
yield viable aptamers for every target molecule.
[0027] In some embodiments, selection of an aptamer may be
accomplished by applying a SELEX process against whole
living/intact cells in culture to obtain aptamers that selectively
target an antigen that is specifically expressed on a target cell.
A whole cell SELEX process may include an approach that includes
both counterselection and selection, which is specifically designed
for enrichment of aptamers against cell surface tumor-specific
targets (FIG. 1). As described in detail in the Examples below, a
SELEX process was used to generate a panel of RNA aptamers that are
able to bind pancreatic cancer cells, but do not bind unrelated
cancer cell or healthy cell types. In certain embodiments, the
pancreatic cancer cell aptamers have a sequence that may include
SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or
SEQ ID NO:6, which are described in detail in the Example below and
in FIGS. 2A-2F.
[0028] As described in the Examples below, at least two aptamers
have been determined to be effective in reducing tumor size. These
aptamers share a common nucleotide motif GAAUGCCC (SEQ ID NO: 8).
As such, a pancreatic cell aptamer used in accordance with the
embodiments described herein may include a nucleotide sequence of
GAAUGCCC (SEQ ID NO: 8).
[0029] The aptamers described herein target a cell surface molecule
or an endocytotic membrane associated protein (e.g., a membrane
receptor or a glycoprotein) that is overexpressed on pancreatic
cancer cells or is specifically expressed only on pancreatic cancer
cells. As such, the aptamer selection process described above may
be used to develop aptamers that bind known cell surface molecules
and endocytotic membrane associated proteins, or may also be used
to discover new cell surface molecules that act as pancreatic cell
biomarkers and are specific to pancreatic cells.
[0030] According to the embodiments described herein, the
pancreatic cancer cell aptamers can act as a cell-specific delivery
vehicle, a therapeutic agent, or both. Further, these aptamers are
likely able to inhibit or suppress proliferation of pancreatic
cancer cells or otherwise interfere with a cancerous pathway by
blocking a receptor or other membrane associated protein,
preventing a ligand from binding. Therefore, the pancreatic cancer
cell aptamers may be used for at least two functions: inhibition of
proliferation and survival of pancreatic cancer cells and as a
delivery vehicle for therapeutic and/or diagnostic agents. As
described below, the pancreatic cancer cell aptamers can deliver
therapeutic or diagnostic agents efficiently to pancreatic cancer
cell lines.
[0031] Aptamer conjugates
[0032] According to some embodiments, the aptamers described herein
may be conjugated to a therapeutic agent, forming a therapeutic
aptamer conjugate. As used herein, the term "conjugated to," or
"conjugate" refers to two or more entities or the state of two or
more entities which are linked by a direct or indirect covalent or
non-covalent interaction. In some embodiments, an association is
covalent. In some embodiments, a covalent association is mediated
by a linker moiety. In some embodiments, an association is
non-covalent (e.g. charge interactions, affinity interactions,
metal coordination, physical adsorption, host-guest interactions,
hydrophobic interactions, stacking interactions, hydrogen bonding
interactions such as with "sticky sequences," van der Waals
interactions, magnetic interactions, electrostatic interactions,
dipole-dipole interactions, etc.). In this case, the pancreatic
cancer cell aptamers described herein may be used as a
cell-specific delivery vehicle to deliver a therapeutic or
diagnostic payload to pancreatic cancer cells.
[0033] According to some embodiments, the pancreatic cancer cell
aptamers described herein may be conjugated to one or more
therapeutic agents to form a therapeutic aptamer conjugate. A
"therapeutic agent" as used herein is an atom, molecule, or
compound that is useful in the treatment of cancer or other
conditions described herein. Examples of therapeutic agents that
may be conjugated to a pancreatic cell aptamer include, but are not
limited to, drugs, chemotherapeutic agents, therapeutic antibodies
and fragments thereof, toxins, radioisotopes, enzymes (e.g.,
enzymes to cleave prodrugs to a cytotoxic agent at the site of the
tumor), nucleases, hormones, immunomodulators, antisense
oligonucleotides, nucleic acid molecules (e.g., mRNA molecules,
cDNA molecules or RNAi molecules such as siRNA or shRNA),
chelators, boron compounds, photoactive agents and dyes. The
therapeutic agent may also include a metal, metal alloy,
intermetallic or core-shell nanoparticle bound to a chelator that
acts as a radiosensitizer to render the targeted cells more
sensitive to radiation therapy as compared to healthy cells.
Further, the therapeutic agent may include paramagnetic
nanoparticles for MRI contrast agents (e.g., magnetite or
Fe.sub.3O.sub.4) and may be used with other types of therapies
(e.g., photodynamic and hyperthermal therapies) and imaging (e.g.,
fluorescent imaging (Au and CdSe)).
[0034] In certain embodiments, the pancreatic cell aptamer is
conjugated to a nucleic acid molecule which acts as the therapeutic
agent. In some embodiments, the nucleic acid molecule that is
conjugated to the aptamer is an RNA molecule. RNA molecules that
may be conjugated to the aptamer in accordance with the embodiments
described herein may include, but are not limited to, ribosomal RNA
(rRNA), messenger RNA (mRNA), transfer RNA (tRNA), small nuclear
RNA (snRNA), small nucleolar RNA (snoRNA), small cytoplasmic RNA
(scRNA), micro RNA (miRNA), small interfering RNA (siRNA), and
short hairpin RNA (shRNA).
[0035] In one aspect, the nucleic acid molecule is an RNA
interference molecule (e.g., an siRNA or shRNA molecule) that, when
delivered to a target cell by the aptamer, is internalized by the
cell and acts to suppress or silence the expression of one or more
oncogenes or of any protein or peptide that is associated with
cancer by targeting an mRNA molecule. In one embodiment, the RNA
interference molecule is (i) an siRNA, shRNA, miRNA or other RNA
molecule which targets an mRNA molecule which encodes K-ras
(V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog) and/or SHH
(Sonic Hedgehog), (ii) an mRNA molecule which encodes an
anti-apoptotic protein (e.g., Bcl-xL, Bcl-2, survivin, Hax-1, AKT2,
Mcl-1), or (iii) any other RNA molecule that inhibits or enhances
expression of a protein that is associated with cancer.
[0036] In another embodiment, the nucleic acid molecule is an mRNA
molecule that is expressed intracellularly as part of a therapeutic
or diagnostic payload. Alternatively, the mRNA component may
include a cDNA molecule. Further, the mRNA component may express a
full wild type protein or peptide in a target cell, or may express
at least the biologically active portion of the protein or peptide.
When expressed within the target cell, the mRNA molecule acts as a
therapeutic agent by expressing a protein or peptide that is
missing or altered in the target cell, a cytotoxic protein or
peptide to kill the target cell, an apoptotic triggering protein or
peptide, or any other anti-cancer protein or peptide.
[0037] Chemotherapeutic agents that may be used in accordance with
the embodiments described herein are often cytotoxic or cytostatic
in nature and may include, but are not limited to, alkylating
agents, antimetabolites, anti-tumor antibiotics, topoisomerase
inhibitors, mitotic inhibitors hormone therapy, targeted
therapeutics and immunotherapeutics. In some embodiments the
chemotherapeutic agents that may be used as therapeutic agents in
accordance with the embodiments of the disclosure include, but are
not limited to,13-cis-Retinoic Acid, 2-Chlorodeoxyadenosine,
5-Azacitidine, 5-Fluorouracil, 6-Mercaptopurine, 6-Thioguanine,
actinomycin-D, adriamycin, aldesleukin, alemtuzumab, alitretinoin,
all-transretinoic acid, alpha interferon, altretamine,
amethopterin, amifostine, anagrelide, anastrozole,
arabinosylcytosine, arsenic trioxide, amsacrine, aminocamptothecin,
am inoglutethimide, asparaginase, azacytidine, bacillus
calmette-guerin (BCG), bendamustine, bevacizumab, bexarotene,
bicalutamide, bortezomib, bleomycin, busulfan, calcium leucovorin,
citrovorum factor, capecitabine, canertinib, carboplatin,
carmustine, cetuximab, chlorambucil, cisplatin, cladribine,
cortisone, cyclophosphamide, cytarabine, darbepoetin alfa,
dasatinib, daunomycin, decitabine, denileukin diftitox,
dexamethasone, dexasone, dexrazoxane, dactinomycin, daunorubicin,
decarbazine, docetaxel, doxorubicin, doxifluridine, eniluracil,
epirubicin, epoetin alfa, erlotinib, everolimus, exemestane,
estramustine, etoposide, filgrastim, fluoxymesterone, fulvestrant,
flavopiridol, floxuridine, fludarabine, fluorouracil, flutamide,
gefitinib, gemcitabine, gemtuzumab ozogamicin, goserelin,
granulocyte - colony stimulating factor, granulocyte
macrophage-colony stimulating factor, hexamethylmelamine,
hydrocortisone hydroxyurea, ibritumomab, interferon alpha,
interleukin-2, interleukin-11, isotretinoin, ixabepilone,
idarubicin, imatinib mesylate, ifosfamide, irinotecan, lapatinib,
lenalidomide, letrozole, leucovorin, leuprolide, liposomal Ara-C,
lomustine, mechlorethamine, megestrol, melphalan, mercaptopurine,
mesna, methotrexate, methylprednisolone, mitomycin C, mitotane,
mitoxantrone, nelarabine, nilutamide, octreotide, oprelvekin,
oxaliplatin, paclitaxel, pamidronate, pemetrexed, panitumumab, PEG
Interferon, pegaspargase, pegfilgrastim, PEG-L-asparaginase,
pentostatin, plicamycin, prednisolone, prednisone, procarbazine,
raloxifene, rituximab, romiplostim, ralitrexed, sapacitabine,
sargramostim, satraplatin, sorafenib, sunitinib, semustine,
streptozocin, tamoxifen, tegafur, tegafur-uracil, temsirolimus,
temozolamide, teniposide, thalidomide, thioguanine, thiotepa,
topotecan, toremifene, tositumomab, trastuzumab, tretinoin,
trimitrexate, alrubicin, vincristine, vinblastine, vindestine,
vinorelbine, vorinostat, or zoledronic acid.
[0038] Therapeutic antibodies and functional fragments thereof,
that may be used as therapeutic agents in accordance with the
embodiments of the disclosure include, but are not limited to,
alemtuzumab, bevacizumab, cetuximab, edrecolomab, gemtuzumab,
ibritumomab tiuxetan, panitumumab, rituximab, tositumomab, and
trastuzumab and other antibodies associated with specific diseases
listed herein.
[0039] Toxins that may be used as therapeutic agents in accordance
with the embodiments of the disclosure include, but are not limited
to, ricin, abrin, ribonuclease (RNase), DNase I, Staphylococcal
enterotoxin-A, pokeweed antiviral protein, gelonin, diphtheria
toxin, Pseudomonas exotoxin, and Pseudomonas endotoxin.
[0040] Radioisotopes that may be used as therapeutic agents in
accordance with the embodiments of the disclosure include, but are
not limited to, .sup.32P, .sup.89Sr, .sup.90Y, .sup.99mTc,
.sup.99MO, .sup.131I, .sup.153Sm, .sup.177Lu, .sup.186Re,
.sup.213Bi, .sup.223Ra and .sup.225Ac.
[0041] According to other embodiments, the pancreatic cell aptamers
described herein may be conjugated to one or more diagnostic agents
(or "imaging agents"), forming a diagnostic aptamer conjugate. The
diagnostic aptamer conjugate may to target and visualize pancreatic
cells in vivo via an imaging method (e.g., positron emission
tomography (PET), computer assisted tomography (CAT), single photon
emission computerized tomography, x-ray, fluoroscopy, and magnetic
resonance imaging (MRI)). As such, the diagnostic aptamer conjugate
may be used in methods for diagnosing, monitoring and/or
visualizing a disease related to the pancreas.
[0042] In some embodiments, a diagnostic or imaging agent may
include, but is not limited to a fluorescent, luminescent, or
magnetic protein, peptide or derivatives thereof (e.g., genetically
engineered variants). Fluorescent proteins that may be used
include, but are not limited to, green fluorescent protein (GFP),
enhanced GFP (EGFP), red, blue, yellow, cyan, and sapphire
fluorescent proteins, and reef coral fluorescent protein.
Luminescent proteins that may be used include, but are not limited
to, luciferase, aequorin and derivatives thereof. Numerous
fluorescent and luminescent dyes and proteins are known in the art
(see, e.g., U.S. Patent Application Publication 2004/0067503;
Valeur, B., "Molecular Fluorescence: Principles and Applications,"
John Wiley and Sons, 2002; Handbook of Fluorescent Probes and
Research Products, Molecular Probes, 9.sup.th edition, 2002; and
The Handbook--A Guide to Fluorescent Probes and Labeling
Technologies, Invitrogen, 10th edition, available at the Invitrogen
web site; both of which are hereby incorporated by reference as if
fully set forth herein.)
[0043] In other aspects, a pancreatic cell aptamer may be further
conjugated to or otherwise associated with a non-protein diagnostic
agent or a delivery vehicle such as a nanoparticle, radioactive
substances (e.g., radioisotopes, radionuclides, radiolabels or
radiotracers), dyes, contrast agents, fluorescent compounds or
molecules, bioluminescent compounds or molecules, enzymes and
enhancing agents (e.g., paramagnetic ions). In addition, it should
be noted that some nanoparticles, for example quantum dots and
metal nanoparticles (described below) may also be suitable for use
as a diagnostic agent or a therapeutic agent (e.g., using
hyperthermal and photodynamic therapies as well as diagnostic
agents through fluorescence and or MRI contrast).
[0044] Fluorescent and luminescent substances that may be used as
an additional diagnostic agent in accordance with the embodiments
of the disclosure include, but are not limited to, a variety of
organic or inorganic small molecules commonly referred to as
"dyes," "labels," or "indicators." Examples include fluorescein,
rhodamine, acridine dyes, Alexa dyes, and cyanine dyes.
[0045] Enzymes that may be used as an additional diagnostic agent
in accordance with the embodiments of the disclosure include, but
are not limited to, horseradish peroxidase, alkaline phosphatase,
acid phosphatase, glucose oxidase, .beta.-galactosidase,
.beta.-glucoronidase or .beta.-lactamase. Such enzymes may be used
in combination with a chromogen, a fluorogenic compound or a
luminogenic compound to generate a detectable signal.
[0046] Radioactive substances that may be used as an additional
diagnostic agent in accordance with the embodiments of the
disclosure include, but are not limited to, .sup.18F, .sup.32P,
.sup.33P, .sup.45Ti, .sup.47Sc, .sup.52Fe, .sup.59Fe, .sup.62Cu,
.sup.64Cu, .sup.67Cu, .sup.67Ga, .sup.68Ga, .sup.77As, .sup.86Y,
.sup.90Y, .sup.89Sr, .sup.89Zr, .sup.94Tc, .sup.94Tc, .sup.99mTc,
.sup.99Mo, .sup.105Pd, .sup.105Rh, .sup.111Ag, .sup.111In,
.sup.123I, .sup.124I, .sup.125I, .sup.131I, .sup.142Pr, .sup.143Pr,
.sup.149Pm, .sup.153Sm, .sup.154-1581Gd, .sup.161Tb, .sup.166Dy,
.sup.166Ho, .sup.169Er, .sup.175Lu, .sup.177Lu, .sup.186Re,
.sup.188Re, .sup.189Re, .sup.194Ir, .sup.198Au, .sup.199Au,
.sup.211At, .sup.211Pb, .sup.212Bi, .sup.212Pb, .sup.213Bi,
.sup.223Ra and .sup.225Ac. Paramagnetic ions that may be used as an
additional diagnostic agent in accordance with the embodiments of
the disclosure include, but are not limited to, ions of transition
and lanthanide metals (e.g., metals having atomic numbers of 21-29,
42, 43, 44, or 57-71). These metals include ions of Cr, V, Mn, Fe,
Co, Ni, Cu, La, Ce, Pr, Nd, Pm, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb
and Lu.
[0047] When the diagnostic agent is a radioactive metal or
paramagnetic ion, the agent may be reacted with another long-tailed
reagent having a long tail with one or more chelating groups
attached to the long tail for binding these ions. The long tail may
be a polymer such as a polylysine, polysaccharide, or other
derivatized or derivatizable chain having pendant groups to which
may be added for binding to the metals or ions. Examples of
chelating groups that may be used according to the disclosure
include, but are not limited to, ethylenediaminetetraacetic acid
(EDTA), diethylenetriaminepentaacetic acid (DTPA), DOTA, NOTA,
NETA, porphyrins, polyamines, crown ethers, bis-thiosemicarbazones,
polyoximes, and like groups. The chelate is normally linked to the
PSMA antibody or functional antibody fragment by a group which
enables the formation of a bond to the molecule with minimal loss
of immunoreactivity and minimal aggregation and/or internal
cross-linking. The same chelates, when complexed with
non-radioactive metals, such as manganese, iron and gadolinium are
useful for MRI, when used along with the antibodies and carriers
described herein. Macrocyclic chelates such as NOTA, DOTA, and TETA
are of use with a variety of metals and radiometals including, but
not limited to, radionuclides of gallium, yttrium and copper,
respectively. Other ring-type chelates such as macrocyclic
polyethers, which are of interest for stably binding nuclides, such
as .sup.223Ra for RAIT may be used. In certain embodiments,
chelating moieties may be used to attach a PET diagnostic agent,
such as an Al-.sup.18F complex, to a targeting molecule for use in
PET analysis.
[0048] In other embodiments, the aptamers may be conjugated to both
a therapeutic and a diagnostic agent. Therefore, any of the above
diagnostic and therapeutic agents may be used in combination to
form an aptamer conjugate that targets pancreatic cells to deliver
both a diagnostic and a therapeutic payload with a single dose.
[0049] Therapeutic Uses of Pancreatic Cancer Cell Aptamers
[0050] The aptamers and the aptamer-therapeutic agent conjugates
described herein have at least a dual function that provides a
basis for treating pancreatic cancer. First, according to some
embodiments, the pancreatic cell aptamers may be used on their own
to inhibit or suppress proliferation and survival of pancreatic
cancer cells, and may also be used to eradicate existing primary or
metastatic tumors.
[0051] Therefore, methods for suppressing pancreatic cancer cell
proliferation, eradicating pancreatic cancer cell tumors and
treating a pancreatic cancer or a pancreatic cancer cell
malignancy, are provided according to the embodiments described
herein. Pancreatic cancers and tumors that may be treated using the
methods described herein include, but are not limited to acinar
cell carcinoma, adenocarcinoma, adenosquamous carcinoma, giant cell
tumor, intraductal papillary-mucinous neoplasm (IPMN), musinous
cystadenocarcinoma, pancreatoblastoma, serous cystadenocarcinoma,
solid and pseudopapillary tumors, gastrinoma (Zollinger-Ellison
Syndrome), glucagonoma, insulinoma, nonfunctional islet cell
tumors, somatostatinoma, secondary tumors derived from multiple
endocrine neoplasia Type-1, or vasoactive intestinal
peptide-releasing tumor (VIPoma or Verner-Morrison Syndrome).
[0052] "Treat i n g" or "treatment" of a condition may refer to
preventing the condition, slowing the onset or rate of development
of the condition, reducing the risk of developing the condition,
preventing or delaying the development of symptoms associated with
the condition, reducing or ending symptoms associated with the
condition, generating a complete or partial regression of the
condition, or some combination thereof. For example, an aptamer or
an aptamer conjugate such as those described herein may be used to
treat pancreatic cancer, wherein the treatment refers to
suppression of pancreatic cancer cell proliferation rate, an
increase in pancreatic cancer cell death, or a decreased tumor size
resulting in regression or eradication of a tumor. The treatments
described herein may be used in any suitable subject, including a
human subject or any mammalian or avian subject that needs
treatment in accordance with the methods described herein (e.g.,
dogs, cats, horses, rabbits, mice, rats, pigs, cows).
[0053] The methods for treating the pancreatic cancer include
administering a therapeutically effective amount of a therapeutic
composition. An "effective amount," "therapeutically effective
amount" or "effective dose" is an amount of a composition (e.g., a
therapeutic composition or agent) that produces a desired
therapeutic effect in a subject, such as preventing or treating a
target condition or alleviating symptoms associated with the
condition. The precise therapeutically effective amount is an
amount of the composition that will yield the most effective
results in terms of efficacy of treatment in a given subject. This
amount will vary depending upon a variety of factors, including but
not limited to the characteristics of the therapeutic compound
(including activity, pharmacokinetics, pharmacodynamics, and
bioavailability), the physiological condition of the subject
(including age, sex, disease type and stage, general physical
condition, responsiveness to a given dosage, and type of
medication), the nature of the pharmaceutically acceptable carrier
or carriers in the formulation, and the route of administration.
One skilled in the clinical and pharmacological arts will be able
to determine a therapeutically effective amount through routine
experimentation, namely by monitoring a subject's response to
administration of a compound and adjusting the dosage accordingly.
For additional guidance, see Remington: The Science and Practice of
Pharmacy 21.sup.st Edition, Univ. of Sciences in Philadelphia
(USIP), Lippincott Williams & Wilkins, Philadelphia, Pa.,
2005.
[0054] The therapeutic composition may include, among other things,
an aptamer, a therapeutic agent, an aptamer-therapeutic agent or a
combination thereof. Aptamers, therapeutic agents, and
aptamer-therapeutic agents suitable for use according to the
embodiments described herein may include, but are not limited to,
those described above and in the Examples below. For example, in
some embodiments, an RNA aptamer that may be used as part of the
therapeutic composition may include a sequence of SEQ ID NO:8. In
other embodiments, the RNA aptamer may include a sequence of SEQ ID
NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID
NO:6 (FIGS. 2A-2F).
[0055] The therapeutic composition may also include one or more
pharmaceutically acceptable carriers. A "pharmaceutically
acceptable carrier" refers to a pharmaceutically acceptable
material, composition, or vehicle that is involved in carrying or
transporting a compound of interest from one tissue, organ, or
portion of the body to another tissue, organ, or portion of the
body. For example, the carrier may be a liquid or solid filler,
diluent, excipient, solvent, or encapsulating material, or some
combination thereof. Each component of the carrier must be
"pharmaceutically acceptable" in that it must be compatible with
the other ingredients of the formulation. It also must be suitable
for contact with any tissue, organ, or portion of the body that it
may encounter, meaning that it must not carry a risk of toxicity,
irritation, allergic response, immunogenicity, or any other
complication that excessively outweighs its therapeutic
benefits.
[0056] The therapeutic compositions described herein may be
administered by any suitable route of administration. A route of
administration may refer to any administration pathway known in the
art, including but not limited to aerosol, enteral, nasal,
ophthalmic, oral, parenteral, rectal, transdermal (e.g., topical
cream or ointment, patch), or vaginal. "Transdermal" administration
may be accomplished using a topical cream or ointment or by means
of a transdermal patch. "Parenteral" refers to a route of
administration that is generally associated with injection,
including infraorbital, infusion, intraarterial, intracapsular,
intracardiac, intradermal, intramuscular, intraperitoneal,
intrapulmonary, intraspinal, intrasternal, intrathecal,
intrauterine, intravenous, subarachnoid, subcapsular, subcutaneous,
transmucosal, or transtracheal.
[0057] According to the embodiments described herein, the
pharmaceutical composition may optionally include, in addition to
the one or more aptamer or aptamer conjugates, one or more
additional therapeutic agents, such as an anti-cancer agent,
antibiotic, anti-viral agent, anti-HIV agent, anti-parasite agent,
anti-protozoal agent, anesthetic, anticoagulant, inhibitor of an
enzyme, steroidal agent, steroidal or non-steroidal
anti-inflammatory agent, antihistamine, immunosuppressant agent,
anti-neoplastic agent, antigen, vaccine, antibody, decongestant,
sedative, opioid, analgesic, anti-pyretic, birth control agent,
hormone, prostaglandin, progestational agent, anti-glaucoma agent,
ophthalmic agent, anti-cholinergic, analgesic, anti-depressant,
anti-psychotic, neurotoxin, hypnotic, tranquilizer,
anti-convulsant, muscle relaxant, anti-Parkinson agent,
anti-spasmodic, muscle contractant, channel blocker, miotic agent,
anti-secretory agent, anti-thrombotic agent, anticoagulant,
anti-cholinergic, .beta.-adrenergic blocking agent, diuretic,
cardiovascular active agent, vasoactive agent, vasodilating agent,
anti-hypertensive agent, angiogenic agent, modulators of
cell-extracellular matrix interactions (e.g. cell growth inhibitors
and anti-adhesion molecules), inhibitors of DNA, RNA, or protein
synthesis.
[0058] In addition to their independent function for treating
pancreatic cancer, the pancreatic cell aptamers may also serve as a
pancreatic cell specific targeting delivery vehicle to deliver a
therapeutic or diagnostic payload to a particular cell. Therefore,
according to some embodiments, methods for delivering a therapeutic
payload (or a therapeutic agent) to a pancreatic cancer cell are
provided. Such methods may include a step of contacting the
pancreatic cancer cell with a pancreatic cancer cell aptamer
conjugate, wherein the pancreatic cell aptamer conjugate comprises
a pancreatic cell aptamer component and a therapeutic agent
component (i.e., the therapeutic payload). As described above, the
pancreatic cell aptamer component may be any suitable aptamer, for
example, a nucleic acid aptamer. In one embodiment, the nucleic
acid aptamer is an RNA molecule that specifically binds a
pancreatic cancer cell surface protein or other molecule, resulting
in internalization of the pancreatic cell aptamer conjugate by the
pancreatic cancer cell.
[0059] In one embodiment, the therapeutic agent component (or the
therapeutic payload) may be an siRNA molecule, an miRNA molecule,
an shRNA molecule, or an mRNA molecule as described with respect to
aptamer-RNA chimeras described herein.
[0060] In another aspect, the pancreatic cell aptamer or aptamer
conjugates may be used to deliver a diagnostic payload to
pancreatic cancer cells or a pancreatic tumor cell. In such
aspects, the pancreatic cell aptamer or aptamer conjugate may be
used in methods of diagnosing pancreatic cancer. The methods for
diagnosing a pancreatic cancer or pancreatic malignancy may include
a step of administering to a subject suspected of having a
pancreatic cancer or a pancreatic cancer malignancy, an effective
amount of a pancreatic cancer cell aptamer that is conjugated to a
diagnostic agent. The diagnostic agent may include one or more
diagnostic agents, such as those described above. The method may
further include a step of subjecting the subject to a diagnostic
imaging technique (e.g., MRI, PET, CT, SPECT, PET/CT, PET/MRI, or
other suitable imaging method) to visualize any diagnostic agent
that is delivered to pancreatic cancer cells. Visualization of a
diagnostic agent localized to an organ that is susceptible to
pancreatic cancer (primary or metastatic cancer) such as the
pancreas or liver, by the diagnostic imaging technique indicate
that the subject has or likely has a form of pancreatic cancer such
as those described above.
[0061] The following examples are intended to illustrate various
embodiments of the invention. As such, the specific embodiments
discussed are not to be construed as limitations on the scope of
the invention. It will be apparent to one skilled in the art that
various equivalents, changes, and modifications may be made without
departing from the scope of invention, and it is understood that
such equivalent embodiments are to be included herein. Further, all
references cited in the disclosure are hereby incorporated by
reference in their entirety, as if fully set forth herein.
EXAMPLES
[0062] Aptamers that are identified using systematic evolution of
ligands by exponential enrichment (SELEX) as an in vitro selection
strategy can adopt complex structures to bind target proteins with
high affinities and specificities (Ellington & Szostak 1990;
Tuerk 1997). As described above, aptamers may be selected to
recognize a wide variety of targets from small molecules to
proteins and nucleic acids in cultured cells and whole organisms
(Ulrich et al. 2002; Wang et al. 2000; Blank et al. 2001; Daniels
et al. 2003; Hicke et al. 2001; Wilson & Szostak 1999). The
Example below describes a cell-based SELEX assay for the
identification of pancreatic cancer cell surface biomarkers and the
therapeutic delivery of siRNAs into pancreatic cancer cells.
[0063] In the Examples described below, a 2'-fluropyrimidine-RNA
(2'F-RNA) combinatorial library was used to isolate 2'F RNA
aptamers against a Panc-1 cell line, which is an aggressive
pancreatic cancer cell type. We observed that the aptamers
selectively internalized into pancreatic cancer cells and the
selected aptamers are candidates for targeted delivery of
therapeutic siRNAs and other agents into these cells.
Example 1
Generation of Pancreatic Cell Aptamers for Use in Therapeutic
Methods
[0064] Materials and Methods
[0065] Cell lines. To use intact cells as target, Panc-1
(CRL-1469), Capan-1 (HTB-79), CFPAC-1 (CRL-1918), MIA PaCa-2
(CRL-1420), BxPC-3 (CRL-1687) and AsPC-1 (CRL-1682) were purchased
from ATCC for use as target intact cells and Huh7 cells were
purchased from JCRB. Primary human pancreatic epithelial cells were
purchased in cell systems. The cells were cultured in a humidified
5% CO.sub.2 incubator at 37.degree. C. according to cell bank's
instructions.
[0066] Whole-Cell SELEX (systemic evolution of ligands by
exponential enrichment). The SELEX cycle was performed as described
by Tuerk and Gold (11). In vitro selection was carried out as
described (Hwang et al. 2009), with a few modifications in this
study. The 2'F-RNA aptamers were selected from randomized
sequences. A random library of RNA oligonucleotides which have a
sequence of 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N.sub.40-CAUAA
CCCAGAGGUGAUGGAUCCCCC-3' (SEQ ID NO:7) was constructed by in vitro
transcription of synthetic DNA templates with NTPs (2'F UTP, 2'F
CTP, GTP, ATP, Epicentre Biotechnologies, Madision, WI) and T7 RNA
polymerase. N.sub.40 represents 40 nucleotide (nt) sequences formed
by equimolar incorporation of A, G, C, and U at each position. To
increase the nuclease resistance, 2'F-Py RNAs were used. For the
first round, 5.87 nmol of the RNA library was incubated with target
cells (Panc-1) in 1 ml binding buffer (PBS W/O Ca.sup.2+ and
Mg.sup.2+, 5 mM MgCl.sub.2, 0.01% BSA) for 1 hour at room
temperature with shaking. RNA molecules that bound to target cells
were recovered, amplified by RT-PCR and in vitro transcription, and
used in the following selection rounds. In subsequent rounds, the
RNA concentration was reduced by 10-fold and incubation time was
reduced to create a more stringent condition. To remove RNAs that
non-specifically bind the target cells, the counter-selection was
carried out at every 3rd round using Huh7 cells. After 14 rounds of
SELEX, the resulting cDNAs were amplified. The amplified DNA was
cloned and individual clones were identified by DNA sequencing.
Structures of aptamers were predicted using MFOLD (Zuker 2003),
available at http://www.bioinfo.rpi.edu/applications/mfold/using a
salt correction algorithm and temperature correction for 25.degree.
C.
[0067] Results and Discussion
[0068] In vitro selection of RNA aptamers to the intact target
cells. The human pancreatic carcinoma cells (Panc-1) were used as
target cells for the aptamer selection and the human hepatoma cell
line (Huh7) was used for the counter-selection steps to remove
non-pancreatic cancer cell specific aptamers. A library of 2'
Fluroro pyrimidines RNAs (2'F RNA) were used to increase
nuclease-resistance and enhance aptamer folding. To isolate 2'F RNA
aptamers binding to intact cells, a library of approximately
4.sup.40 different 2'F RNA molecules, containing a 40-nt-long
random sequence flanked by defined sequences, was screened by
SELEX. After 14 cycles of selection, the highly enriched aptamer
pools were cloned. The nucleotide sequences of 47 clones were
determined.
[0069] Comparison of individual sequences and structures. Six
different groups of aptamers (or "clones") (Groups I-VI) were
selected. Each group represents a set of repeated sequences. After
14 rounds of selection, the sequences of 47 clones were identified
and the frequencies of each of the six aptamer clones were shown as
number, as shown in Table 1 below.
TABLE-US-00001 TABLE 1 Alignment and identification of RNA aptamers
Fre- quency Group Name Sequences (Random sequence) (%) I P15
GGGAGACAAGAAUAAACGCUCAAAGUU 19(9/47) GCGGCCCAACCGUUUAAUUCAGAAUAG
UGUGAUGCCUUCGACAGGAGGCUCACA ACAGGC (SEQ ID NO: 1) II P19
GGGAGACAAGAAUAAACGCUCAAUGGC 13(6/47) GAAUGCCCGCCUAAUAGGGCGUUAUGA
CUUGUUGAGUUCGACAGGAGGCUCACA ACAGGC (SEQ ID NO: 2) III P1
GGGAGACAAGAAUAAACGCUCAAUGCG 13(6/47) CUGAAUGCCCAGCCGUGAAAGCGUCGA
UUUCCAUCCUUCGACAGGAGGCUCACA ACAGGC (SEQ ID NO: 3) IV P11
GGGAGACAAGAAUAAACGCUCAAAUGA 9(4/47) UUGCCCAUUCGGUUAUGCUUGCGCUUC
CUAAAGAGCUUCGACAGGAGGCUCACA ACAGGC (SEQ ID NO: 4 V P7
GGGAGACAAGAAUAAACGCUCAAGGCC 6(3/47) AUGUUGAAUGCCCAACUAAGCUUUGAG
CUUUGGAGCUUCGACAGGAGGCUCACA ACAGGC (SEQ ID NO: 5) VI P6
GGGAGACAAGAAUAAACGCUCAACAAU 4(2/47) GGAGCGUUAAACGUGAGCCAUUCGACA
GGAGGCUCACAACAGGC (SEQ ID NO: 6)
[0070] The six groups of aptamers had very different sequences,
however, sequences P19, P1 and P7 contained a common motif,
GAAUGCCC (SEQ ID NO: 8). Sequence P15 was found nine times and the
length of the random region was 40 nucleotides (nt). Sequences P19
and P1 were found six times and the length of the random regions
was 40 nt. Sequence P11 was found four times and P7 was found three
times. Both also have 40 nt in the randomized region. Sequence P6
was found two times and the length of the randomized region length
is 24 nt. Minimum energy structural analyses of the selected
aptamers were carried out using Mfold (Zuker, 2003) (FIGS. 2A, 2B,
2C, 2D, 2E and 2F). As shown in FIGS. 2A-2F, the calculated
secondary structures of the RNA aptamers contained several
stem-loop regions.
Example 2
Cell-Specific Aptamer Delivery to Pancreatic Cancer for Use in
Therapeutic Methods
[0071] Materials and Methods
[0072] In addition to those described in Example 1 above, the
following materials and methods were also used to determine the
ability of the aptamers to target cells
[0073] Live cell confocal imaging for cell internalization. In
order to test the internalization of the selected RNA aptamers in
the target cells and other types of pancreatic cancer cells, the
cells were grown in 35 mm glass bottom dishes (MatTek, Ashland,
Mass., USA) with seeding at 1.times.10.sup.6 cells in medium for 24
hrs. The RNAs were labeled with Cy3 using the Cy3 Silencer siRNA
labeling kit (Ambion, Tex., USA) following the manufacturer's
instructions. Cy3-labeled RNAs at 100 nM were added to the cells
and incubated for 1 hour. Following the incubation, the cells were
stained with 5 ug/ml Hoechst 33342 (Molecular Probes, Calif., USA)
for live cell nuclear staining. The images were taken using a Zeiss
LSM 510 Meta Inverted 2 photon confocal microscope system under
water immersion at 40.times. magnification.
[0074] Binding assay by flow cytometric analysis. Aptamer binding
and uptake was also assessed by flow cytometry. For the assay,
cells were detached using a non-enzymatic cell dissociation
solution, washed with PBS and suspended in binding buffer. Next,
Cy3-labeled aptamers were added and incubated for 1 hours at
37.degree. C. The binding of individual aptamers or the starting
pool as a control to pancreatic cancer cells was performed in
triplicate. Flow cytometry was performed on a Guava (Millipore,
Billerica, Mass., USA) flow cytometer and the data were analyzed
with FlowJo software.
[0075] Binding affinity and K.sub.D Determination. To determine the
binding affinity of aptamers to Panc-1, Kd function of physiology
macro provided by a Zeiss LSM 510 Meta Inverted 2 photon confocal
microscope system was used. The cells were grown in 35 mm glass
bottom dishes (MatTek, Ashland, Mass., USA) with seeding at
1.times.10.sup.6 cells in medium for 24 hrs. The RNAs were labeled
with Cy3 using the Cy3 Silencer siRNA labeling kit (Ambion, Tex.,
USA) following the manufacturer's instructions. Various
concentrations of Cy3-labeled RNAs were added to the cells and
incubated for 1 hour. After extensive washing, 20 images of each
condition of a titration curve were taken. The dissociation
constants were calculated using one site binding non-linear curve
regression with a Graph Pad Prism.
[0076] Cell internalization Competition Assays. Panc-1 cells were
prepared as detailed above for the confocal microscopy. 200 nM of
Cy3 labeled P19 aptamer was used to compete with either unlabeled
clones (1 .mu.M) in 1.times. Binding buffer prewarmed at 37.degree.
C. Cells were washed three times and took images by confocal
microscopy.
[0077] WST-1 assay. Cell proliferation was quantified following
four treatments of P1 and P19 at 9 ug per treatment in
Panc-1(2.5.times.10.sup.5 cells), using WST-1 reagent following the
manufacturer's guidelines (Roche, UK). Briefly, the WST-1 reagent
was used at a 1:100 dilution to plates and incubated for one hour.
The enzymatic reaction was measured at 450 .eta.m using Bio-Tek
ELISA reader.
[0078] Animal experiments. Five NOD/SCID mice were injected
subcutaneously (s.c.) on the flank with Panc-1 pancreatic cancer
cells in 0.05 ml PBS with 0.15 ml Matrigel. After 2 weeks, mice
were divided into two groups. One group served as untreated
controls and the others injected 10 ug with P1 combined with P19.
Aptamers were injected via tail vein (i.v.), for a total of 4 times
per animal. Animals were sacrificed before tumour disappeared.
[0079] For the gemcitabine resistant tumour test, twelve 5-week-old
female NOD/SCID mice were injected subcutaneously (S.C.) on the
flank with 2.8.times.10.sup.6ASPC-1 pancreatic cancer cells in 0.05
ml PBS with 0.15 ml Matrigel. After 3 weeks, mice were divided into
four groups. One group served as untreated controls and the others
injected with P1 (10 ug per injection), P19 (10 ug per injection)
and P1 combined with P19 (5 ug of P1 with 5 ug of P19 per
injection). Aptamers were injected through tail vein (i.v.) for a
total of 4 times per animal (at day 1, 3, 5, and 7). Animals were
sacrificed at day 9.
[0080] Results
[0081] RNA aptamers specifically bind to and are internalized in
pancreatic cancer cells. Flow cytometric analyses of the individual
clones revealed the aptamers bound to the target cells (FIG. 3). In
order to determine that the selected six different aptamers were
internalized in the pancreatic cancer cells, the live-cell confocal
microscopy with the Cy3-labeled RNA transcripts was carried out.
The RNA aptamers were internalized specifically in target cells
Panc-1(FIG. 4B), but not the Huh7 control cells (FIG. 4A).
Non-specific weak binding was observed when initial the RNA library
pool was incubated with Panc-1. FIG. 4B shows that the aptamers
aggregate within the cytoplasm, suggesting that the RNA aptamers
enter into cells via receptor-mediated endocytosis. To test that
the aptamers recognize different type of pancreatic cancer cells,
five different pancreatic cancer cell lines were tested for aptamer
uptake. All six of the tested aptamers internalized in all the
pancreatic cancer cells (FIGS. 5A, 5B, 5C, 5D, 5E).
[0082] As described above, a strategy for identifying RNA aptamers
that target pancreatic cancer cells was developed and the selected
RNA aptamers were demonstrated to internalize within the cells,
indicating that the RNA aptamers described herein may be used as
targeting agents to deliver therapeutic agents to pancreatic cancer
cells, such as siRNAs or chemotherapy agents.
[0083] In contrast to pancreatic cancer cells, the aptamers are not
internalized by normal pancreatic cells. To determine whether the
selected aptamers bind to normal pancreatic cells, primary
epithelial pancreatic cells were incubated with Cy3 labeled
aptamers as described above. As shown in FIGS. 6A and 6B, none of
the Cy3 labeled aptamers were internalized by the normal pancreatic
cells, indicating that the aptamers bind specifically to a cell
surface molecule (e.g., a cell surface protein) that is expressed
on pancreatic cancer cells, but is not expressed on normal
pancreatic cells.
[0084] RNA aptamer binding affinity of target cells. To estimate
the affinity of the RNA aptamers, Physiology function of confocal
microscopy was utilized. The measured dissociation constants
(K.sub.D) of P19, P15, and P1 were 64.76 nM, 70.72 nM, and 112.2
nM, respectively (FIG. 7). To determine whether each aptamer binds
to the pancreatic cancer cells via the same or different cell
surface proteins, Panc-1 cells were incubated with fluorescently
labeled P19 RNA (100 nM) and increasing amounts (1 .mu.M) of each
unlabeled aptamer as a competitor against the labeled chimeras
(FIG. 8). The fluorescence intensity of labeled RNAs was measured
in the presence of increasing amounts of competitors using confocal
microscopy. The intensity of P19 competed with unlabeled P19 was
significantly decreased (indicating competition for the same
target); while others showed insignificant changes, indicating that
each RNA aptamer has a different binding site on the same target or
binds different targets.
[0085] The anti-tumor effect of selected RNA aptamers. To evaluate
anti-tumor effect, three aptamer clones (P19, P15 and P1) were
injected into SCID mice intravenously (i.v.). P19 and P1 inhibited
cell proliferation in vitro (FIGS. 9). P19 and P1 also
significantly reduced the tumor size in Panc-1 engrafted mice when
administered via i.v. injection (FIG. 10), even in gemcitabine
resistant pancreatic cancer (FIG. 11). Based on these results, the
selected P19 and P1 aptamers may be used as an effective for
pancreatic cancer on their own due to their anti-cancer, tumor
regressing effects. Further, because it was shown that the P19 and
P1 aptamers effectively target and are internalized by pancreatic
cancer cells, they also have a dual function in that they can
deliver a payload (e.g., a therapeutic agent) to the pancreatic
cancer cells, resulting in an additional anti-cancer effect.
[0086] As such, the P19 and P1 aptamers may be used as delivery
agents for delivery of one or more therapeutic agents that target
K-ras (V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog) and
SHH (Sonic Hedgehog) according to some embodiments. By utilizing
both their independent anti-tumor effect as well as their ability
to deliver a therapeutic payload, the anti-tumour effects of P19
and P1 aptamers will likely be increased as compared to their
ability to deliver a therapeutic payload alone.
[0087] Additionally, it has been shown that pancreatic cancer cells
may spread to the liver even at the pre-neoplastic stage (Rhim et
al. 2012). As such, intravenous administration of the aptamers for
use as a systemic therapy is particularly important in that the
vast majority of patients with pancreatic cancer, since most
likely, the patients have distant tumour spread at the time of
diagnosis. In that vein, the specific RNA aptamers against
pancreatic cancer may be used as part of a drug or a pharmaceutical
composition for systemic therapy, and may also be used for
diagnosis and staging of pancreatic cancer.
[0088] In conclusion, as illustrated in the Examples above, a
strategy for identifying RNA aptamers that target pancreatic cancer
cells has been developed, and the selected RNA aptamers were shown
to internalize within the cells. Further, RNA aptamers themselves
were shown to have anti-tumor effect on their own, and also
specifically target pancreatic cancer cells--not normal pancreatic
cells. This provides an advantage for a clinical application for
early detection of pancreatic cancer and treatment by targeting
pancreatic cancer cells. Thus, the RNA aptamers described herein
may be used as targeting agents to deliver therapeutic agents
(e.g., siRNA or chemotherapeutics) or diagnostic agents to
pancreatic cancer cells.
REFERENCES
[0089] The references, patents and published patent applications
listed below, and all references cited in the specification above
are hereby incorporated by reference in their entirety, as if fully
set forth herein. [0090] Alexakis, N., et al. Current standards of
surgery for pancreatic cancer. The British journal of surgery 91,
1410-1427 (2004). [0091] Blank, M., Weinschenk, T., Priemer, M. and
Schluesener, H. (2001) Systematic evolution of a DNA aptamer
binding to rat brain tumor microvessels. selective targeting of
endothelial regulatory protein pigpen. J Biol Chem, 276,
16464-16468. [0092] Cunningham, D., et al. Phase III randomized
comparison of gemcitabine versus gemcitabine plus capecitabine in
patients with advanced pancreatic cancer. Journal of clinical
oncology: official journal of the American Society of Clinical
Oncology 27, 5513-5518 (2009). [0093] Daniels, D. A., Chen, H.,
Hicke, B. J., Swiderek, K. M. and Gold, L. (2003) A tenascin-C
aptamer identified by tumor cell SELEX: systematic evolution of
ligands by exponential enrichment. Proc Natl Acad Sci USA, 100,
15416-15421. [0094] Ellington, A. D. and Szostak, J. W. (1990) In
vitro selection of RNA molecules that bind specific ligands.
Nature, 346, 818-822. [0095] Esposito et al. A Neutralizing RNA
Aptamer against EGFR Causes Selective Apoptotic Cell Death. PLoS
One. 2011; 6(9): e24071. [0096] Fulda, S. (2009) Apoptosis pathways
and their therapeutic exploitation in pancreatic cancer. J Cell Mol
Med, 13, 1221-1227. [0097] Ghaneh, P., Costello, E. &
Neoptolemos, J. P. Biology and management of pancreatic cancer. Gut
56, 1134-1152 (2007). [0098] Guidelines for the management of
patients with pancreatic cancer periampullary and ampullary
carcinomas. Gut 54 Suppl 5, v1-16 (2005) [0099] Heinemann, V.,
Haas, M. & Boeck, S. Systemic treatment of advanced pancreatic
cancer. Cancer treatment reviews 38, 843-853 (2012). [0100] Hicke,
B. J., Marion, C., Chang, Y. F., Gould, T., Lynott, C. K., Parma,
D., Schmidt, P. G. and Warren, S. (2001) Tenascin-C aptamers are
generated using tumor cells and purified protein. J Biol Chem, 276,
48644-48654. [0101] Hwang, B., Lim, J. H., Hahm, B., Jang, S. K.
and Lee, S. W. (2009) hnRNP L is required for the translation
mediated by HCV IRES. Biochem Biophys Res Commun, 378, 584-588.
[0102] Jemal, A., Siegel, R., Ward, E., Hao, Y., Xu, J. and Thun,
M. J. (2009) Cancer statistics, 2009. CA Cancer J Clin, 59,
225-249. [0103] Klinkenbijl, J. H., et al. Adjuvant radiotherapy
and 5-fluorouracil after curative resection of cancer of the
pancreas and periampullary region: phase III trial of the EORTC
gastrointestinal tract cancer cooperative group. Annals of surgery
230, 776-782; discussion 782-774 (1999). [0104] Li, D., Xie, K.,
Wolff, R. and Abbruzzese, J. L. (2004) Pancreatic cancer. Lancet,
363, 1049-1057. [0105] Neoptolemos, J. P., et al. A randomized
trial of chemoradiotherapy and chemotherapy after resection of
pancreatic cancer. The New England journal of medicine 350,
1200-1210 (2004). [0106] Oettle, H., et al. Adjuvant chemotherapy
with gemcitabine vs observation in patients undergoing
curative-intent resection of pancreatic cancer: a randomized
controlled trial. JAMA: the journal of the American Medical
Association 297, 267-277 (2007). [0107] Pancreatic cancer in the
UK. Lancet 378, 1050 (2011). [0108] Rhim, A. D., Mirek, E. T.,
Aiello, N. M., Maitra, A., Bailey, J. M., McAllister, F., Reichert,
M., Beatty, G. L., Rustgi, A. K., Vonderheide R. H., Leach S. D.,
Stanger B. Z. (2012) EMT and dissemination precede pancreatic tumor
Formation. Celly, 148, 349-361 [0109] Rivera, F., Lopez-Tarruella,
S., Vega-Villegas, M. E. and Salcedo, M. (2009) Treatment of
advanced pancreatic cancer: from gemcitabine single agent to
combinations and targeted therapy. Cancer Treat Rev, 35, 335-339.
[0110] Saif, M. W. (2009) Adjuvant treatment of pancreatic cancer
in 2009: where are we? Highlights from the 45th ASCO annual
meeting. Orlando, Fla., USA. May 29-Jun. 2, 2009. JOP, 10, 373-377.
[0111] Schneider, G., Siveke, J. T., Eckel, F. and Schmid, R. M.
(2005) Pancreatic cancer: basic and clinical aspects.
Gastroenterology, 128, 1606-1625. [0112] Sebolt-Leopold, J. S. and
English, J. M. (2006) Mechanisms of drug inhibition of signalling
molecules. Nature, 441, 457-462. [0113] Stathis, A. and Moore, M.
J. (2010) Advanced pancreatic carcinoma: current treatment and
future challenges. Nat Rev Clin Oncol, 7, 163-172. [0114] Tuerk, C.
(1997) Using the SELEX combinatorial chemistry process to find high
affinity nucleic acid ligands to target molecules. Methods Mol
Biol, 67, 219-230. [0115] Ulrich, H., Magdesian, M. H., Alves, M.
J. and Colli, W. (2002) In vitro selection of RNA aptamers that
bind to cell adhesion receptors of Trypanosoma cruzi and inhibit
cell invasion. J Biol Chem, 277, 20756-20762. [0116] Vincent, A.,
Herman, J., Schulick, R., Hruban, R. H. & Goggins, M.
Pancreatic cancer. Lancet 378, 607-620 (2011). [0117] Wang, J.,
Jiang, H. and Liu, F. (2000) In vitro selection of novel RNA
ligands that bind human cytomegalovirus and block viral infection.
RNA, 6, 571-583. [0118] Wilson, D. S. & Szostak, J. W. (1999)
In vitro selection of functional nucleic acids. Annu Rev Biochem,
68, 611-647. [0119] Wong, H. H. and Lemoine, N. R. (2009)
Pancreatic cancer: molecular pathogenesis and new therapeutic
targets. Nat Rev Gastroenterol Hepatol, 6, 412-422. [0120] Zuker,
M. (2003) Mfold web server for nucleic acid folding and
hybridization prediction. Nucleic Acids Res, 31, 3406-3415. [0121]
Zhou J, Li H, Li S, Zaia J, Rossi J J. Novel dual inhibitory
function aptamer-siRNA delivery system for HIV-1 therapy. Mol Ther.
2008;16(8):1481-1489. [0122] Zhou J, Rossi J J. The therapeutic
potential of cell-internalizing aptamers. Curr Top Med Chem. 2009;
9(12):1144-1157.
Sequence CWU 1
1
8187RNAArtificial SequenceSynthetic oligonucleotide 1gggagacaag
aauaaacgcu caaaguugcg gcccaaccgu uuaauucaga auagugugau 60gccuucgaca
ggaggcucac aacaggc 87287RNAArtificial SequenceSynthetic
oligonucleotide 2gggagacaag aauaaacgcu caauggcgaa ugcccgccua
auagggcguu augacuuguu 60gaguucgaca ggaggcucac aacaggc
87387RNAArtificial SequenceSynthetic oligonucleotide 3gggagacaag
aauaaacgcu caaugcgcug aaugcccagc cgugaaagcg ucgauuucca 60uccuucgaca
ggaggcucac aacaggc 87487RNAArtificial SequenceSynthetic
oligonucleotide 4gggagacaag aauaaacgcu caaaugauug cccauucggu
uaugcuugcg cuuccuaaag 60agcuucgaca ggaggcucac aacaggc
87587RNAArtificial SequenceSynthetic oligonucleotide 5gggagacaag
aauaaacgcu caaggccaug uugaaugccc aacuaagcuu ugagcuuugg 60agcuucgaca
ggaggcucac aacaggc 87671RNAArtificial SequenceSynthetic
oligonucleotide 6gggagacaag aauaaacgcu caacaaugga gcguuaaacg
ugagccauuc gacaggaggc 60ucacaacagg c 71790RNAArtificial
SequenceSynthetic oligonucleotide 7gggagagcgg aagcgugcug ggccnnnnnn
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60nnnncauaac ccagagguga uggauccccc
9088RNAArtificial SequenceSynthetic oligonucleotide 8gaaugccc 8
* * * * *
References