U.S. patent application number 14/992412 was filed with the patent office on 2016-07-14 for stabilized recombinant expression plasmid vector in hafnia alvei and applications thereof.
The applicant listed for this patent is CATHAY INDUSTRIAL BIOTECH LTD., CATHAY R&D CENTER CO., LTD.. Invention is credited to Naiqiang Li, Charlie Liu, Xiucai Liu, Zhenhua Pang.
Application Number | 20160201048 14/992412 |
Document ID | / |
Family ID | 49581613 |
Filed Date | 2016-07-14 |
United States Patent
Application |
20160201048 |
Kind Code |
A1 |
Pang; Zhenhua ; et
al. |
July 14, 2016 |
STABILIZED RECOMBINANT EXPRESSION PLASMID VECTOR IN HAFNIA ALVEI
AND APPLICATIONS THEREOF
Abstract
One aspect of the present disclosure relates to a stabilized
recombinant expression plasmid vector comprising a polynucleotide
encoding an antitoxin gene which expresses a polypeptide that
neutralizes a polypeptide toxic to a host cell, the toxic
polypeptide being expressed by a toxin gene in the host cell, and a
polynucleotide encoding a polypeptide expression product, and the
stabilized recombinant expression plasmid vector is derived from a
Hafnia alvei autonomously replicable backbone plasmid. Other
aspects of the present disclosure relate to a transformant
transformed with the stabilized recombinant expression plasmid
vector disclosed herein, a method of producing biobased cadaverine
using the transformant disclosed herein, and biobased cadaverine
prepared by the method disclosed herein. Another aspect of the
present disclosure relates to a polyamide formed using biobased
cadaverine disclosed herein, and a composition thereof. Another
aspect of the present disclosure relates to a method of preparing
1,5-diisocyanatopentane comprising preparing biobased cadaverine
using the method disclosed herein and converting the biobased
cadaverine to 1,5-diisocyanatopentane.
Inventors: |
Pang; Zhenhua; (Shanghai,
CN) ; Li; Naiqiang; (Shanghai, CN) ; Liu;
Charlie; (Shanghai, CN) ; Liu; Xiucai;
(Shanghai, CN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
CATHAY INDUSTRIAL BIOTECH LTD.
CATHAY R&D CENTER CO., LTD. |
Shanghai
Shanghai |
|
CN
CN |
|
|
Family ID: |
49581613 |
Appl. No.: |
14/992412 |
Filed: |
January 11, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13795949 |
Mar 12, 2013 |
9234203 |
|
|
14992412 |
|
|
|
|
61649719 |
May 21, 2012 |
|
|
|
Current U.S.
Class: |
435/128 ;
435/252.3; 435/320.1; 528/335; 564/511 |
Current CPC
Class: |
C12P 13/00 20130101;
C12N 15/74 20130101; C12P 13/001 20130101; C12N 9/88 20130101; C07C
211/09 20130101; C12Y 401/01018 20130101; C08G 69/26 20130101 |
International
Class: |
C12N 9/88 20060101
C12N009/88; C07C 211/09 20060101 C07C211/09; C08G 69/26 20060101
C08G069/26; C12P 13/00 20060101 C12P013/00 |
Claims
1. A stabilized recombinant expression plasmid vector comprising: a
polynucleotide encoding an antitoxin gene which expresses a
polypeptide that counteracts a polypeptide toxic to a host cell,
the toxic polypeptide being expressed by a toxin gene in the host
cell, and a polynucleotide encoding a polypeptide expression
product, wherein: the stabilized recombinant expression plasmid
vector is derived from a Hafnia alvei autonomously replicable
backbone plasmid.
2. The recombinant expression plasmid vector of claim 1, further
comprising a polynucleotide encoding the toxin gene.
3-5. (canceled)
6. The recombinant expression plasmid vector of claim 1, wherein
the backbone plasmid is selected from the group consisting of pUC
(pUC18/19), pBR322, pACYC and any derived plasmids thereof.
7. The recombinant expression plasmid vector of claim 1, wherein
the polypeptide expression product is an enzyme selected from the
group consisting of decarboxylase, hydrolases and
phosphorylase.
8. The recombinant expression plasmid vector of claim 7, wherein
the decarboxylase is an amino acid decarboxylase selected from the
group consisting of lysine decarboxylase, tyrosine decarboxylase,
arginine decarboxylase, ornithine decarboxylase, and glutamate
decarboxylase.
9. The recombinant expression plasmid vector of claim 8, wherein
the polynucleotide encoding lysine decarboxylase comprises a
polynucleotide selected from the group consisting of haldc gene,
cadA gene, and fragments thereof.
10-12. (canceled)
13. The recombinant expression plasmid vector of claim 2, wherein
the backbone plasmid is selected from the group consisting of pUC
(pUC18/19), pBR322, pACYC and any derived plasmids thereof.
14. The recombinant expression plasmid vector of claim 2, wherein
the polypeptide expression product is an enzyme selected from the
group consisting of decarboxylase, hydrolases and
phosphorylase.
15. The recombinant expression plasmid vector of claim 14, wherein
the decarboxylase is an amino acid decarboxylase selected from the
group consisting of lysine decarboxylase, tyrosine decarboxylase,
arginine decarboxylase, ornithine decarboxylase, and glutamate
decarboxylase.
16. The recombinant expression plasmid vector of claim 15, wherein
the polynucleotide encoding lysine decarboxylase comprises a
polynucleotide selected from the group consisting of haldc gene,
cadA gene, and fragments thereof.
17. (canceled)
18. A transformant obtained by transforming a recombinant
expression plasmid vector of claim 1 into a host cell, wherein the
host cell is a Hafnia alvei strain free of endogenous plasmids.
19. The transformant of claim 18, wherein the Hafnia alvei strain
is an industrial Hafnia alvei strain.
20. A method of producing cadaverine (1,5-pentanediamine)
comprising: 1a) cultivating the transformant of one of claim 13;
1b) producing cadaverine using the culture obtained from step 1a to
decarboxylate lysine; and 1c) extracting and purifying cadaverine
from the reaction obtained from step 1b.
21. A biobased cadaverine prepared according to the method of claim
20.
22. A polyamide having a structure of Structure 1: ##STR00002##
including stereoisomers thereof, wherein: m=4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22; n=4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22; j=about
100.about.about 1,000,000; and the polyamide is prepared from one
or more diamines having carbon numbers of m and one or more
dicarboxylic acids having carbon numbers of n, at least one of the
diamines and dicarboxylic acids comprises biobased carbon under
Standard ASTM D6866, and the m or n of each diamine or dicarboxylic
acid can be the same or different.
23. A polyamide according to claim 22, wherein the diamine is
biobased cadaverine prepared according to the method of claim
15.
24. The polyamide according to claim 22, wherein the dicarboxylic
acids comprise biobased carbon under Standard ASTM D6866.
25. A composition comprising a polyamide of claim 22.
26. A method of preparing 1,5-diisocyanatopentane comprising: 2a)
preparing biobased cadaverine according to the method of claim 20;
and 2b) converting biobased cadaverine obtained from step 2a to
1,5-diisocyanatopentane.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 13/795,949, filed Mar. 12, 2013, which claims the benefit
of U.S. Provisional Patent Application No. 61/649,719, filed May
21, 2012, which is incorporated by reference as if fully set forth
herein.
BACKGROUND
[0002] Cadaverine is a platform chemical involved in the production
of various products. Bio-based production of cadaverine has gained
research interest since the 1980s. Cadaverine can be synthesized
via decarboxylation of lysine in microorganisms. Currently,
biosynthesis of cadaverine is performed using two strategies:
fermentative production or in vitro enzyme catalysis.
[0003] In a fermentative production of L-lysine approach, a lysine
decarboxylase gene is added to a lysine producing bacteria strain
(e.g. Corynebacterium glutamicum and Escherichia coli (E. coli)) to
extend the lysine biosynthesis pathway to a cadaverine biosynthesis
pathway. However, the reported cadaverine yield is lower than the
lysine yield for other Corynebacterium glutamicum strains lacking
the lysine decarboxylase gene. Such low yield may be due to the
toxicity of the cadaverine product to the producing bacterial
strain.
[0004] Alternatively, bacteria can be engineered or induced to
produce lysine decarboxylase for the in vitro enzyme catalysis. One
strategy involves inducing expression of a chromosomally encoded
lysine decarboxylase gene in an un-engineered Hafnia alvei (H.
alvei) strain. However, the reported yield of the enzyme is low.
Another strategy involves engineering recombinant strains. For
example, Japanese companies (JP2009028045, U.S. Pat. No. 7,189,543,
CN102056889) have reported the construction of E. coli recombinant
strains that over-express lysine decarboxylase and utilize either
whole cell or cell lysate for catalysis. However, expression of
large amounts of polypeptides that are toxic to the host cell
causes expression plasmid instability over serial passage.
Antibiotics are required in the medium to ensure plasmid stability
during the culture.
[0005] Use of antibiotics may cause development of antibiotic
resistant bacteria, and maintains high levels of antibiotic
resistant microorganisms in the environment. See, e.g. Martinez,
"Environmental pollution by antibiotics and by antibiotic
resistance determinants," Environmental Pollution (2009), Vol. 157,
Issue 11, 2893-2902. However, antibiotic resistant bacteria
potentially pose health and/or environmental hazards. Thus, there
remains a need for a more effective recombinant plasmid vector that
can remain stable through multiple rounds of serial passage without
antibiotic selection.
BRIEF DESCRIPTION OF THE DRAWINGS
[0006] FIG. 1 shows the construction of the pPlac-cadA-abtabi
recombinant expression plasmid vector as discussed in Example 1. a)
cadA PCR product produced using the E. coli BL21 chromosome as a
template; b) plasmid pMD18-T-cadA produced by ligation of the cadA
PCR product to the pMD18-T vector, wherein the short lacZ fragment
was located 5' to the cadA gene; c) pPlac-cadA plasmid after
deletion of the lacZ fragment; d) abt/abi PCR product with HindIII
sites amplified using H. alvei pAlvB as a template, the PCR product
was then ligated to a pMD18-T vector containing a HindIII
restriction site; and e) pPlac-cadA-abtabi recombinant expression
plasmid produced by HindIII digestion and subsequent ligation of
fragments from pPlac-cadA and the pMD18-T vector containing the
abt/abi fragment.
[0007] FIG. 2 shows the two possible constructions of
pPlac-cadA-abtabi recombinant expression plasmid (Type I and Type
II) produced according to the methods disclosed herein.
[0008] FIG. 3 shows recombinant strain JM109/pPlac-cadA colony
growth on LB and LB/Amp plates after serial subculturing and serial
dilution as discussed in Example 3.
[0009] FIG. 4 shows recombinant strain Ha/pPlac-cadA colony growth
on LB and LB/Amp plates after serial subculturing and serial
dilution as discussed in Example 3.
[0010] FIG. 5 shows recombinant strain Ha.sup.c/pPlac-cadA-abtabi
colony growth on LB and LB/Amp plates after serial subculturing and
serial dilution as discussed in Example 3.
[0011] FIG. 6 shows stability of plasmid pPlac-cadA in cured H.
alvei.
[0012] FIG. 7 shows stability of type I pPlac-cadA-abtabi plasmid
in cured H. alvei.
DETAILED DESCRIPTION
[0013] The following description provides specific details for a
thorough understanding of, and enabling description for,
embodiments of the disclosure. However, one skilled in the art will
understand that the disclosure may be practiced without these
details. In other instances, well-known structures and functions
have not been shown or described in detail to avoid unnecessarily
obscuring the description of the embodiments of the disclosure.
[0014] The abbreviations used for the amino acids, peptides, base
sequences, and nucleic acids in the present disclosure are based on
the abbreviations specified in the IUPAC-IUB Communication on
Biochemical Nomenclature, Eur. J. Biochem., 138: 9 (1984),
"Guideline for Preparing Specifications Including Base Sequences
and Amino Acid Sequences" (United States Patent and Trademark
Office), and those commonly used in this technical field.
[0015] A "nucleotide sequence," "polynucleotide" or "DNA molecule"
as contemplated by the current disclosure, may include double
strand DNA or single strand DNA (i.e., a sense chain and an
antisense chain constituting the double strand DNA), and a fragment
thereof. As used herein, "a fragment thereof" means a part of the
nucleotide sequence that encodes a peptide which provides
substantially the same function as the peptide encoded by the whole
nucleotide sequence. For example, a polynucleotide encoding an
antitoxin gene expresses a polypeptide that neutralizes a toxin
polypeptide. A fragment of the polynucleotide encoding the
antitoxin gene expresses a polypeptide that can neutralize the
toxin polypeptide, which provides substantially the same function
as the polypeptide encoded by the whole sequence of the
polynucleotide encoding the antitoxin gene. Similarly, a fragment
of a polynucleotide encoding a toxin gene expresses a polypeptide
that is toxic to a cell substantially the same as the toxin
polypeptide expressed by the whole sequence of the polynucleotide
encoding the toxin gene.
[0016] Nucleotide sequences, polynucleotides or DNA molecules as
used herein are not limited to the functional region, and may
include at least one of an expression suppression region, a coding
region, a leader sequence, an exon, an intron and an expression
cassette (see, e.g. Papadakis et al., "Promoters and Control
Elements: Designing Expression Cassettes for Gene Therapy," Current
Gene Therapy (2004), 4, 89-113). Further, examples of nucleotide
sequences or polynucleotides may include RNA or DNA. A polypeptide
containing a specific amino acid sequence and a polynucleotide
containing a specific DNA sequence may include fragments, homologs,
derivatives, and mutants of the polynucleotide. Examples of mutants
of a nucleotide sequence or polynucleotide (such as mutant DNA),
include naturally occurring allelic mutants; artificial mutants;
and mutants having deletion, substitution, addition, and/or
insertion. It should be understood that such mutants encode
polypeptides having substantially the same function as the
polypeptide encoded by the original non-mutated polynucleotide.
[0017] One aspect of the invention relates to a stabilized
recombinant expression plasmid vector comprising:
[0018] a polynucleotide encoding an antitoxin gene which expresses
a polypeptide that neutralizes a polypeptide toxic to a host cell,
the toxic polypeptide being expressed by a polynucleotide encoding
a toxin gene in the host cell,
[0019] a polynucleotide encoding a polypeptide expression product,
wherein
[0020] the stabilized recombinant expression plasmid vector is
derived from an autonomously replicable backbone plasmid of a host
cell.
[0021] In certain embodiments, the toxin gene is chromosomally
encoded in the genome of the host cell.
[0022] In certain embodiments, the stabilized recombinant
expression plasmid vector further comprises the polynucleotide
encoding the toxin gene.
[0023] In certain embodiments, the polynucleotide encoding the
toxin gene and/or the polynucleotide encoding the antitoxin gene is
recombinant.
[0024] In certain embodiments, one or more genes of the toxin gene,
antitoxin gene and polypeptide expression product gene are further
optimized using codon optimization technology to provide better
expression of the corresponding polypeptides in the host cell. For
example, an optimized toxin gene may comprise a DNA sequence
optimized to provide a better expression of the toxin polypeptide
compared to SEQ ID NO:1 or SEQ ID NO:3. In certain embodiments, the
antitoxin gene comprises a DNA sequence further optimized to
provide a better expression of the antitoxin polypeptide compared
to SEQ ID NO:2 or SEQ ID NO:4. In certain embodiments, the
polypeptide expression product gene comprises a DNA sequence
further optimized to provide a better expression of the polypeptide
expression product compared to SEQ ID NO:5 or SEQ ID NO:6.
[0025] Codon optimization is a technique to maximize the protein
expression in a host cell by increasing the translational
efficiency of gene of interest. DNA sequence of nucleotides of one
species is optimized into DNA sequence of nucleotides of another
species. A DNA sequence is broken into triplets (codons). The
codons of low frequency of an amino acid are replaced with codons
for the same amino acid but of high frequency in the host cell.
Accordingly, the expression of the optimized DNA sequence is
improved in the host cell. See, e.g.
http://www.guptalab.org/shubhg/pdf/shubhra_codon.pdf for an
overview of codon optimization technology, which is incorporated
herein by reference in its entirety.
[0026] As used herein, a toxin/antitoxin gene pair has two genes,
one is a toxin gene which expresses a polypeptide toxic to a host
cell, and the other is an antitoxin gene which expresses a
polypeptide that neutralizes the toxic polypeptide in the host
cell.
[0027] Certain prokaryotes have one or more chromosomally encoded
toxin genes. Certain prokaryotes contain endogenous plasmids that
encode specific toxin/antitoxin gene pairs that play a role in
maintenance of the genetic information and response to stress.
(See, Wertz et al. "Chimeric nature of two plasmids of Hafnia alvei
encoding the bacteriocins alveicins A and B." Journal of
Bacteriology, (2004) 186: 1598-1605.) In either case, as long as
the cell has one or more plasmids comprising antitoxin gene, the
toxin is neutralized by the antitoxin that is continuously
expressed by one or more plasmids to keep the cells alive. In
certain prokaryotes, the antitoxin protein degrades faster than the
toxin protein. If the plasmid comprising the antitoxin gene is lost
from the cell, the toxin protein will exist longer than the
antitoxin protein in the cell and kill or inhibit the growth of the
cell. Therefore, plasmid comprising the antitoxin or the
toxin/antitoxin gene is preferably maintained to keep the host cell
alive.
[0028] Examples of the toxin/antitoxin gene pair include, without
limitation, abt/abi gene pair and aat/aai gene pair, and fragments
thereof. In certain embodiments, the toxin gene comprises a DNA
sequence of SEQ ID NO:1, or SEQ ID NO:3. In certain embodiments,
the antitoxin gene comprises a DNA sequence of SEQ ID NO:2, or SEQ
ID NO:4.
[0029] As used herein, the term "host cell" means a microorganism
cell that can be transformed with a stabilized recombinant express
plasmid vector. An example of a host cell includes, without
limitation, Hafnia alvei (H. alvei).
[0030] In certain embodiments, the host cell is free of endogenous
plasmid either in its native form or by removing any endogenous
plasmid. The term "cure" as used herein means to remove endogenous
plasmid from the host cell. The resulting endogenous plasmid-free
host cell is referred to as a "cured" host cell.
[0031] In certain embodiments, the host cell may be selected from
any of the H. alvei strains, for example, endogenous plasmid-free
H. alvei strains, H. alvei strains having pAlvA plasmids and the
cured strains thereof (pAlvA.sup.- strains), and H. alvei strains
having pAlvB plasmids and the cured strains thereof (pAlvB.sup.-
strains).
[0032] In certain embodiments, the host cell is an industrial
strain suitable to be used in industrial-scale or large-scale
production. For example, industrial strains may be cultivated in a
fermenter. The scale of culture may range from hundreds of liters
to millions of liters. On the contrary, a laboratory strain usually
is cultivated in a few liters or less. In certain embodiments, an
industrial strain may grow in a simpler or more economical medium
than laboratory strains.
[0033] A polypeptide expression product is a polypeptide produced
by a host cell. Examples of polypeptide expression products
include, without limitation, any polypeptide expression product
that can be produced by E. coli., e.g. enzymes such as
decarboxylases, hydrolases, and phosphorylase. In one embodiment,
the decarboxylase is amino acid decarboxylase, e.g. lysine
decarboxylase, tyrosine decarboxylase, arginine decarboxylase,
ornithine decarboxylase, and glutamate decarboxylase. In another
embodiment, a polynucleotide encoding a lysine decarboxylase
comprises a haldc gene, a cadA gene, or a fragment thereof. In
another embodiment, the polynucleotide encoding a lysine
decarboxylase comprises a DNA sequence of SEQ ID NO:5, or SEQ ID
NO:6. In another embodiment, the hydrolase is a N-glycosidase or a
O-glycosidase, examples include, without limitation, glucosidase,
.alpha.-glucosidase, .beta.-glucosidase, mannosidase,
.alpha.-mannosidase, .beta.-mannosidase, fructosidase,
.beta.-fructosidase, xylosidase, .alpha.-xylosidase,
.beta.-xylosidase, galactosidase, .alpha.-galactosidase,
.beta.-galactosidase, lactase, amylase, .alpha.-amylase,
.beta.-amylase, myrosinase, chitinase, sucrase, maltase, invertase,
hyaluronidase, and neuraminidase. In another embodiment, a
polynucleotide encoding a .beta.-galactosidase comprises lacZ gene
or a fragment thereof.
[0034] An autonomously replicable backbone plasmid of a host cell
may be any plasmid that can replicate in the host cell. In one
embodiment, the stabilized recombinant plasmid is derived from a
backbone plasmid that can replicate in H. alvei. Examples of the
backbone plasmids include, without limitation, backbone plasmids
that can replicate in E. coli. strains, e.g. pUC (e.g. pUC18 and
pUC19 plasmids), pBR322 and pACYC plasmids, and plasmids derived
therefrom.
[0035] As used herein, a recombinant plasmid "derived from an
autonomously replicable backbone plasmid of a host cell" means the
recombinant plasmid is constructed by inserting one or more
polynucleotides encoding an antitoxin gene, one or more
polynucleotides encoding a toxin gene, and/or one or more
polynucleotides encoding a polypeptide expression product described
herein, and any combination thereof, into the autonomously
replicable backbone plasmid of the host cell.
[0036] Another aspect of the present disclosure relates to a
transformant obtained by transforming one or more stabilized
recombinant plasmid vector disclosed herein into a host cell.
[0037] As used herein, a transformant is a host cell that has been
altered by introducing one or more recombinant plasmid vectors in
the host cell. In certain embodiments, the transformant is obtained
by introducing a recombinant plasmid vector through transformation
into a host cell displaying competence to the plasmid vector.
[0038] An antitoxin gene transformant or toxin/antitoxin gene pair
transformant shows improved plasmid stability compared to the same
host cell transformed by a recombinant plasmid vector that does not
contain an antitoxin gene or a toxin/antitoxin gene pair.
[0039] In one embodiment, the host cell is an endogenous
plasmid-free H. alvei strain. The endogenous plasmid-free H. alvei
strain in its native form may be plasmid-free. Alternatively, the
endogenous plasmid-free H. alvei strain is a cured H. alvei strain
as described supra. The stabilized recombinant plasmid vector
comprises one or more antitoxin genes selected from the group
consisting of abi gene, aai gene and fragments thereof, and/or one
or more toxin/antitoxin gene pairs selected from the group
consisting of abt/abi gene pair and aat/aai gene pair, and
fragments thereof.
[0040] Another aspect of the present disclosure relates to a method
of producing cadaverine comprising:
[0041] 1a) cultivating a transformant comprising a stabilized
recombinant expression plasmid vector disclosed herein;
[0042] 1b) producing cadaverine using the culture obtained from
step 1a to decarboxylate lysine; and
[0043] 1c) recovering cadaverine from the reaction obtained from
step 1b.
[0044] As used herein, "using the culture obtained from step 1a"
may comprise further processes of the culture obtained from step
1a. For example, using a buffer solution to dilute the culture;
centrifuging the culture to collect the cells; resuspending the
cells in a buffer solution; or lysing the cells into cell lysate;
or/and purifying lysine decarboxylase from the cell lysate.
[0045] The transformant may be cultured using a medium containing
carbon sources and non-carbon nutrient sources. Examples of carbon
sources include, without limitation, sugar (e.g. carbohydrates such
as glucose and fructose), oil and/or fat, fatty acid, and/or
derivatives thereof. The oil and fat may contain saturated and/or
unsaturated fatty acids having 10 or more carbon atoms, e.g.
coconut oil, palm oil, palm kernel oil, and the like. The fatty
acid may be a saturated and/or unsaturated fatty acid, e.g.
hexanoic acid, octanoic acid, decanoic acid, lauric acid, oleic
acid, palmitic acid, linoleic acid, linolenic acid, myristic acid,
and the like. Examples of derivatives of a fatty acid include,
without limitation, esters and salts thereof. Examples of
non-carbon sources include, without limitation, nitrogen sources,
inorganic salts, and other organic nutrient sources.
[0046] For example, a medium may contain a carbon source
assimilable by the transformant, optionally with one or more other
source selected from the group consisting of a nitrogen source, an
inorganic salt and another organic nutrient source. In certain
embodiments, the weight percentage of the nitrogen source is about
0.01 to 0.1% of the medium. Examples of the nitrogen source may
comprise ammonia, ammonium salts (e.g. ammonium chloride, ammonium
sulfate and ammonium phosphate), peptone, meat extract, yeast
extract, and the like. Examples of the inorganic salts include,
without limitation, potassium dihydrogen phosphate, dipotassium
hydrogen phosphate, magnesium phosphate, magnesium sulfate, sodium
chloride, and the like. Examples of the other organic nutrient
source include, without limitation, amino acids (e.g. glycine,
alanine, serine, threonine and proline), vitamins (e.g. vitamin B1,
vitamin B12 and vitamin C), and the like.
[0047] The culture may be carried out at any temperature as long as
the cells can grow, and preferably at about 20 to about 40.degree.
C., or about 35.degree. C. The culture period may be about 1, about
2, about 3, about 4, about 5, about 6, about 7, about 8, about 9,
or about 10 days.
[0048] In one embodiment, the transformant is cultured in a medium
containing peptides, peptones, vitamins (e.g. B vitamins), trace
elements (e.g. nitrogen, sulfur, magnesium), and minerals. Examples
of such medium include, without limitation, commonly known Lysogeny
broth (LB) mediums comprising tryptone, yeast extract and NaCl
suspended in water (e.g. distilled or deionized).
[0049] In another embodiment, step 1c of the method further
comprises the following steps:
[0050] 1d) separating the solid and liquid components of the
reaction obtained from step 1b;
[0051] 1e) adjusting the pH of the liquid component obtained from
step 1d to about 14 or higher;
[0052] 1f) removing water from the liquid component obtained from
step 1e; and
[0053] 1g) recovering cadaverine.
[0054] In step 1d, the separation of the solid and liquid
components of the reaction of step 1b may be accomplished by
conventional centrifugation and/or filtration.
[0055] In step 1e, the pH of the liquid component of step 1d may be
adjusted by adding a base, e.g. NaOH. NaOH may be added as a solid
and/or a solution (e.g. an aqueous solution).
[0056] In step 1f, the water may be removed by distillation at
ambient pressure or under vacuum.
[0057] In step 1g, cadaverine may be recovered by distillation at
ambient pressure or under vacuum.
[0058] Another aspect of the present disclosure relates to biobased
cadaverine prepared according to the method disclosed herein.
[0059] As used herein, a "biobased" compound means the compound is
considered biobased under Standard ASTM D6866.
[0060] Another aspect of the present disclosure relates to a
polyamide having a structure of Structure 1:
##STR00001## [0061] including stereoisomers thereof, wherein:
[0062] m=4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, or 22; [0063] n=4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, or 22; [0064] j=about 100.about.about
1,000,000; and [0065] the polyamide is prepared from one or more
diamines having carbon numbers of m and one or more dicarboxylic
acids having carbon numbers of n, at least one of the diamines and
dicarboxylic acids comprises biobased carbon under Standard ASTM
D6866, and the m or n of each diamine or dicarboxylic acid can be
the same or different.
[0066] In one embodiment, the diamine is biobased cadaverine, more
preferably biobased cadaverine prepared according to the method
disclosed herein. Examples of the dicarboxylic acids include,
without limitation, C.sub.10dicarboxylic acid, C.sub.11dicarboxylic
acid, C.sub.12dicarboxylic acid, C.sub.13dicarboxylic acid,
C.sub.14dicarboxylic acid, C.sub.16dicarboxylic acid,
C.sub.18dicarboxylic acid, and any combinations thereof. In certain
embodiments, all or part of the C.sub.ndicarboxylic acids are
biobased.
[0067] In another embodiments, the polyamide has a structure
described above, wherein: [0068] the polyamide is formed by
reacting biobased cadaverine with one or more dicarboxylic acids,
more preferably the biobased cadaverine is prepared according to
the method disclosed herein. [0069] n=4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, or 22; [0070] j=about
100.about.about 1,000,000, about 1000.about.about 100,000, or about
1000.about.about 10,000; and [0071] the dicarboxylic acids comprise
biobased carbon under Standard ASTM D6866.
[0072] Another aspect of the present disclosure relates to a method
of making the polyamides disclosed herein comprising [0073]
preparing biobased cadaverine as the C.sub.mdiamine according to
the method disclosed herein.
[0074] In one embodiment, the method further comprises preparing
one or more biobased C.sub.ndicarboxylic acids.
[0075] In another embodiment, the method further comprises
preparing the polyamide by reacting biobased cadaverine with one or
more biobased C.sub.ndicarboxylic acids.
[0076] Another aspect of the present disclosure relates to a
composition comprising one or more polyamides disclosed herein.
[0077] In one embodiment, the diamine is biobased cadaverine, more
preferably biobased cadaverine prepared according to the method
disclosed herein. Examples of the dicarboxylic acids include,
without limitation, C.sub.10dicarboxylic acid, C.sub.11dicarboxylic
acid, C.sub.12dicarboxylic acid, C.sub.13dicarboxylic acid,
C.sub.14dicarboxylic acid, C.sub.16dicarboxylic acid,
C.sub.18dicarboxylic acid, and any combinations thereof. In certain
embodiments, all or part of the C.sub.ndicarboxylic acids are
biobased.
[0078] In another embodiments, the polyamide has a structure
described above, wherein: [0079] the polyamide is formed by
reacting biobased cadaverine with one or more dicarboxylic acids,
more preferably the biobased cadaverine is prepared according to
the method disclosed herein. [0080] n=4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, or 22; [0081] j=about
100.about.about 1,000,000, about 1000.about.about 100,000, or about
1000.about.about 10,000; and [0082] the dicarboxylic acids comprise
biobased carbon under Standard ASTM D6866.
[0083] Another aspect of the present disclosure relates to a method
of preparing 1,5-diisocyanatopentane comprising:
[0084] 2a) preparing biobased cadaverine as disclosed herein;
and
[0085] 2b) converting biobased cadaverine obtained from step 2a to
1,5-diisocyanatopentane.
[0086] Step 2b may comprise using any known method to convert
diamine into isocyanate. An example of said method is the
traditional phosgene method, which includes one-step high
temperature phosgene method (i.e. mixing phosgene with diamine at
high temperature to obtain isocyanate), the improved two-step
phosgene method, and the triphosgene method in which triphosgene is
used instead of phosgene. There are also other methods that do not
use phosgene as a raw material. An example of said method is
hexanediamine carbonylation which uses CO.sub.2 instead of
phosgene: CO.sub.2 is added into a solution of a primary amine and
an organic base, then a proper amount of phosphorus electrophilic
reagents is added into the reaction solution to start an exothermic
dehydration reaction to obtain isocyanate. Another example is
carbamate thermal decomposition method wherein a primary amine is
converted to a carbamate, and then the carbamate is heated to
decompose and generate isocyanate.
[0087] The following examples are intended to illustrate various
embodiments of the invention. As such, the specific embodiments
discussed are not to be construed as limitations on the scope of
the invention. It will be apparent to one skilled in the art that
various equivalents, changes, and modifications may be made without
departing from the scope of invention, and it is understood that
such equivalent embodiments are to be included herein. Further, all
references cited in the disclosure are hereby incorporated by
reference in their entireties, as if fully set forth herein.
EXAMPLES
Example 1
Construction of cadA Recombinant Expression Plasmid Vector
[0088] cadA gene was amplified with primers 1 and 2 (primer 1, SEQ
ID:NO 7: ATGAACGTTATTGCAATATT, SEQ ID:NO 8: primer 2:
ACTGAAAGCTTCCACTTCCCTTGTACGAGCT), using E. coli BL21 (purchased
from Biomed) chromosomal DNA as template (FIG. 1a). The PCR product
was ligated to a pUC18-derived T vector, pMD18-T (TaKaRa). The
ligation product that was selected contained the cadA gene and lac
promoter (Plac) positioned in the same orientation. The resulting
plasmid is named pMD18-T-cadA (FIG. 1b).
[0089] pMD18-T-cadA contained a cadA gene in frame with a short
lacZ fragment located at the 5' end. Subsequently, this plasmid was
subjected to nucleotide deletion via site-specific mutagenesis PCR.
The PCR reaction contained: 50 ng plasmid DNA, 10 pmole primer 3
(SEQ ID:NO 9: ATTCAATATTGCAATAACGTTCATAGCTGTTTCCTGTGTG), dNTPs
(0.25 mM each), 1 .mu.L Pfu DNA polymerase (Biomed), 1 .mu.L Taq
DNA ligase (NEB), 4 .mu.L Pfu DNA polymerase 10.times. buffer, 5
.mu.L Taq DNA ligase 10.times. buffer and deionized water added to
a total volume of 50 .mu.L. The thermal condition was set as
regular PCR. At the end of the PCR reaction, 1 .mu.L DpnI (NEB) was
added and the reaction was incubated at 37.degree. C. for 1 hour.
100 .mu.L of E. coli BL21 competent cells were transformed with 10
.mu.L of the PCR reaction. Plasmids from the transformant colonies
were extracted and sequenced using primer 4 (SEQ ID:NO 10:
AGGAAACAGCTATGAACGTT). The expected plasmid contained a deletion of
the lacZ fragment. The resulting plasmid was named pPlac-cadA,
wherein the lacZ fragment to the 5' end of cadA gene was removed
(FIG. 1c).
[0090] The H. alvei strain used herein contained endogenous pAlvB
plasmid.
[0091] The toxin/antitoxin gene pair of the endogenous pAlvB
plasmid was abt/abi gene pair. Primers 5 and 6 were designed
according to the published pAlvB sequence (GenBank: AY271829) to
amplify a fragment containing the abt/abi genes. The primers
introduced HindIII digestion sites on both ends of the fragment
(primer 5: ACTGAAAGCTTTACTTTCATCACAAGCCTCT (SEQ ID:NO 11), primer
6: ACTGAAAGCTTAGATTCAGCGCGAGAGTGAT (SEQ ID:NO 12)) (FIG. 1d). PCR
was conducted with primers 5 and 6 using pAlvB as a template. The
PCR product was ligated to the pMD18-T vector. The ligation product
was digested with HindIII to release a fragment of about 1.8 kb
containing the abt/abi genes. The pPlac-cadA plasmid was also
digested with HindIII to release a fragment of about 4.8 kb.
Finally, the pPlac-cadA fragment and the abt/abi fragment were
ligated together to form the recombinant expression plasmid vector,
pPlac-cadA-abtabi (FIG. 1e).
[0092] FIG. 1e shows one structure of the plasmid product for
illustration purpose. One person having ordinary skill in the art
would recognize, ligation of the pPlac-cadA and abt/abi fragments
resulted in two types of plasmids with opposite abt/abi
orientations relative to the rest of the plasmid (FIG. 2). The two
orientations were identified by PCR reactions using isolated
pPlac-cadA-abtabi plasmids templates. PCR reactions were conducted
with either primers 1 and 5, or primers 1 and 6. The plasmid was
type I plasmid (FIG. 2) when a 4 kb PCR product was produced with
primers 1 and 5. The plasmid was type II plasmid (FIG. 2) when a 4
kb PCR product was produced with primers 1 and 6.
[0093] Because the H. alvei strain used herein contained endogenous
pAlvB plasmid, the H. alvei strain was cured first to provide
endogenous plasmid-free H. alvei strain (H. alvei.sup.c). H.
alvei.sup.c strain was then transformed with the new expression
plasmid (pPlac-cadA-abtabi). This new recombinant expression
plasmid vector showed stability after 5 or more rounds of serial
subculturing without antibiotic selection.
Example 2
Curation of the Hafnia alvei Endogenous Plasmid
[0094] A H. alvei strain having endogenous pAlvB plasmid was cured
to remove the endogenous plasmid. The dependence of host survival
on pAlvB was relieved by expressing recombinant antitoxin using a
pUC plasmid. The pUC-derived plasmid was used as a backbone plasmid
because it can replicate in H. alvei and has the ability to
increase copy number upon an increase in temperature. Thus, upon
antibiotic selection and temperature increase, the pUC plasmid was
favorably selected and the pAlvB plasmid was lost from the cell and
the recombinant Abi, overexpressed by pUC, neutralized the existing
endogenous Abt toxin. As a result, the H. alvei strain survived
after loss of the endogenous pAlvB rather than being killed by the
endogenous Abt toxin.
[0095] The abi antitoxin gene from pAlvB was amplified using
primers 6 and 7 (primer 7: ACTGAAAGCTTTTTAATTGTGTGACCACTAT (SEQ
ID:NO 13)). The resulting PCR product was ligated to the pMD18-T
vector (containing an ampicillin resistance gene) and was named
pMD18-T-abi. The ligation product was transformed into H. alvei
competent cells prepared with CaCl.sub.2. The H. alvei competent
cells were prepared the same way as E. coli. competent cells.
[0096] The transformant contained two plasmids in the cell: pAlvB
and pMD18-T-abi. The transformant was streaked onto an LB/Amp plate
and incubated at 40.degree. C. overnight. Colony PCR was performed
for the out-grown colonies with primers 5 and 6. Loss of pAlvB was
confirmed by the lack of PCR product.
[0097] The next step was removal of the pUC plasmid from the
pAlvB-cured H. alvei strain. The strain was streaked onto an LB
plate with no ampicillin and incubated overnight at 40.degree. C.
An out-grown colony was restreaked on an LB plate and incubated at
40.degree. C. overnight. Colony PCR was performed for the out-grown
colonies with primers 6 and 7. Loss of pMD18-T-abi was confirmed by
lack of PCR product as well as by lack of plasmid DNA after DNA
extraction using a plasmid extraction kit (AxyPrep from
Axygen).
[0098] The cured strain was named H. alvei.sup.c (Ha.sup.c).
Example 3
Toxin/Antitoxin Gene Pair Stabilizes cadA Expression Plasmid in H.
alvei
[0099] The stability of different plasmid vectors was assayed by
serially subculturing recombinant strains to non-selective medium
and plating the cultures on non-selective and selective plates to
estimate the total cell number and the number of plasmid-containing
cells.
[0100] Single colonies of three recombinant strains:
JM109/pPlac-cadA, Ha/pPlac-cadA, and Ha.sup.c/pPlac-cadA-abtabi
(Type II), were used to inoculate LB medium containing ampicillin
(JM109 is an E. coli strain; Ha denotes unmodified H. alvei
containing the endogenous pAlvB plasmid; Ha.sup.c denotes cured H.
alvei lacking the pAlvB plasmid). The cultures were grown for 1 day
at 35.degree. C. (seed culture), and were then used to inoculate
fresh LB medium without ampicillin at a rate of 0.1%. The
subcultures were grown for 1 day (1.sup.st subculture).
Sub-culturing was continued with the same inoculation rate and the
same growth conditions (2.sup.nd to 5.sup.th subculture). On each
day, samples were taken from cultures and serially diluted with
sterile 0.85% NaCl. 5 .mu.L of diluted samples were spotted onto LB
plates and LB/Amp plates. The plates were incubated for 1 day at
35.degree. C. The total cell number and the number of cells that
harbor the ampicillin resistant plasmid can be estimated from the
number of colonies on LB and LB/Amp plates, respectively (FIG. 3
(JM109/pPlac-cadA), FIG. 4 (Ha/pPlac-cadA), FIG. 5
(Ha.sup.c/pPlac-cadA-abtabi)).
[0101] The percentage of plasmid-bearing cells decreased to
approximately 1.degree. A after 2 or 3 subcultures for the
JM109/pPlac-cadA and Ha/pPlac-cadA strains (FIGS. 3 and 4,
respectively). However, 100% of plasmid-bearing cells remained
after 5 consecutive subcultures for strain
Ha.sup.c/pPlac-cadA-abtabi (FIG. 5). Thus, the toxin/antitoxin
genes stabilized the recombinant expression plasmid vector in H.
alvei with no need of antibiotic selection.
Example 4
Stability of Plasmid pPlac-cadA in Cured H. alvei
[0102] The stability of plasmid pPlac-cadA was assayed by culturing
the recombinant strain in non-selective medium and plating the
culture on non-selective and selective plates to estimate the total
cell number and the number of plasmid-bearing cells.
[0103] A single colony of strain Ha.sup.c/pPlac-cadA was used to
inoculate LB medium containing ampicillin (Ha.sup.c denotes cured
H. alvei lacking the pAlvB plasmid). The culture was grown for 1
day at 35.degree. C. (seed culture), and was then used to inoculate
fresh LB medium without ampicillin at a rate of 0.1%. The
subculture was grown for 1 day. Samples were taken from the seed
culture and the subculture and serially diluted with sterile 0.85%
NaCl. 5 .mu.L of diluted samples were spotted onto LB plates and
LB/Amp plates. The plates were incubated for 1 day at 35.degree. C.
The total cell number and the number of cells that harbor the
ampicillin resistant plasmid can be estimated from the number of
colonies on LB and LB/Amp plates, respectively (FIG. 6).
[0104] The plasmid was very unstable in cured H. alvei. About 0.1%
of the cells retained the plasmid in the seed culture. And no
plasmid-bearing cells were observed in the subculture.
Example 5
Stability of type I pPlac-cadA-abtabi plasmid in cured H. alvei
[0105] The stability of type I pPlac-cadA-abtabi plasmid was
assayed by serially subculturing the recombinant strain in
non-selective medium and plating the culture on non-selective and
selective plates to estimate the total cell number and the number
of plasmid-bearing cells.
[0106] A single colony of strain Ha.sup.c/pPlac-cadA-abtabi (type
I) was used to inoculate LB medium containing ampicillin. The
culture was grown for 1 day at 35.degree. C. (seed culture), and
was then used to inoculate fresh LB medium without ampicillin at a
rate of 0.1% (1.sup.st subculture). Sub-culturing was continued
with the same inoculation rate and the same growth conditions
(2.sup.nd subculture). Both subcultures were grown for 1 day.
Samples were taken from the seed culture and the subcultures and
serially diluted with sterile 0.85% NaCl. 5 .mu.L of diluted
samples were spotted onto LB plates and LB/Amp plates. The plates
were incubated for 1 day at 35.degree. C. The percentage of cells
that harbor the ampicillin resistant plasmid was estimated from the
number of colonies on LB and LB/Amp plates (FIG. 7).
[0107] There was a significant increase in plasmid stability when
abt/abi was present on the plasmid in cured H. alvei. Although
there was a significant loss of plasmid in the seed culture, the
plasmid was not completely lost in the subcultures like pPlac-cadA
was. About 1% of the cells still had the plasmid in the second
subculture.
TABLE-US-00001 SEQUENCE LISTINGS (aat gene) >gb|AY271828.1|:
385-1717 Hafnia alvei plasm id pAlvA, complete sequence SEQ ID: NO
1 1 ttgactttgt taaaagtcag gcataagatc aaaatactgt atatataaca
atgtatttat 61 atacagtatt ttatactttt tatctaacgt cagagagggc
aatattatga gtggtggaga 121 tggcaagggt cacaatagtg gagcacatga
ttccggtggc agcattaatg gaacttctgg 181 gaaaggtggg ccatcaagcg
gaggagcatc agataattct gggtggagtt cggaaaataa 241 cccgtggggc
ggtggtaact cgggaatgat tggtggcagt caaggaggta acggagctaa 301
tcatggtggc gaaaatacat cttctaacta tgggaaagat gtatcacgcc aaatcggtga
361 tgcgatagcc agaaaggaag gcatcaatcc gaaaatattc actgggtact
ttatccgttc 421 agatggatat ttgatcggaa taacgccact tgtcagtggt
gatgcctttg gcgttaatct 481 tggcctgttc aataacaatc aaaatagtag
tagtgaaaat aagggatgga atggaaggaa 541 tggagatggc attaaaaata
gtagccaagg tggatggaag attaaaacta atgaacttac 601 ttcaaaccaa
gtagctgctg ctaaatccgt tccagaacct aaaaatagta aatattataa 661
gtccatgaga gaagctagcg atgaggttat taattctaat ttaaaccaag ggcatggagt
721 tggtgaggca gctagagctg aaagagatta cagagaaaaa gtaaagaacg
caatcaatga 781 taatagtccc aatgtgctac aggatgctat taaatttaca
gcagattttt ataaggaagt 841 ttttaacgct tacggagaaa aagccgaaaa
actagccaag ttattagctg atcaagctaa 901 aggtaaaaag atccgcaatg
tagaagatgc attgaaatct tatgaaaaac acaaggctaa 961 cattaacaaa
aaaatcaatg cgaaagatcg cgaagctatc gccaaggctt tggagtctat 1021
ggatgtagaa aaagccgcaa aaaatatatc caagttcagc aaaggactag gttgggttgg
1081 cccagctatc gatataactg attggtttac agaattatac aaagcagtga
aaactgataa 1141 ttggagatct ctttatgtta aaactgaaac tattgcagta
gggctagctg caacccatgt 1201 caccgcctta gcattcagtg ctgtcttggg
tgggcctata ggtattttag gttatggttt 1261 gattatggct ggggttgggg
cgttagttaa cgagacaata gttgacgagg caaataaggt 1321 cattgggatt taa
(aai gene) >gb|AY271828.1|: 1734-2069 Hafnia alvei plasm id
pAlvA, complete sequence SEQ ID: NO 2 1 ctatatttta gcggtcacat
tttttatttc aaaacaaaca gaaagaacac caataggaat 61 tgatgtcata
aaaataaaaa taaaatacaa agtcattaaa tatgtttttg gcacaccatc 121
cttaaaaaaa cctgttttcc aaaattcttt tttcgtatat ctaagcgctg ctttctctat
181 tagaaaccga gagaaaggaa atagaatagc gctagccaaa ccaaagattc
tgagcgcaat 241 tattttaggt tcgtcatcac cataactggc gtaaagaata
caagcagcca taaagtatcc 301 ccaaaacata ttatgtatgt aatatttcct tgtcat
(abt gene) >gb|AY271829.1|: 384-1566 Hafnia alvei plasm id
pAlvB, complete sequence SEQ ID: NO 3 1 atgagtggtg gagacggtaa
aggtcacaat agtggagcac atgattccgg tggcagcatt 61 aatggaactt
cggggaaagg tggacctgat tctggtggcg gatattggga caaccatcca 121
catattacaa tcaccggtgg acgggaagta ggtcaagggg gagctggtat caactggggt
181 ggtggttctg gtcatggtaa cggcgggggc tcagttgcca tccaagaata
taacacgagt 241 aaatatccta acacgggagg atttcctcct cttggagacg
ctagctggct gttaaatcct 301 ccaaaatggt cggttattga agtaaaatca
gaaaactcag catggcgctc ttatattact 361 catgttcaag gtcatgttta
caaattgact tttgatggta cgggtaagct cattgatacc 421 gcgtatgtta
attatgaacc cagtgatgat actcgttgga gcccgcttaa aagttttaaa 481
tataataaag gaaccgctga aaaacaggtt agggatgcca ttaacaatga aaaagaagca
541 gttaaggacg ctgttaaatt tactgcagac ttctataaag aggtttttaa
ggtttacgga 601 gaaaaagccg agaagctcgc taagttatta gcagatcaag
ctaaaggcaa aaaggttcgc 661 aacgtagaag atgccttgaa atcttatgaa
aaatataaga ctaacattaa caaaaaaatc 721 aatgcgaaag atcgcgaagc
tattgctaaa gccttggagt ctatggatgt aggaaaagcc 781 gcaaaaaata
tagccaagtt cagtaaagga ctaggttggg ttggccctgc tatcgatata 841
actgattggt ttacagaatt atacaaggca gtggaaactg ataattggag atctttttat
901 gttaaaactg aaactattgc agtagggcta gctgcaaccc atgttgccgc
cttggcattc 961 agcgctgtct tgggtgggcc tgtaggtatt ttgggttatg
gtttgattat ggctggggtt 1021 ggggcgttag ttaatgagac aatagttgac
gaggcaaata aggttattgg gctttaa (abi gene) >gb|AY271829.1|:
1583-1918 Hafnia alvei plasm id pAlvB, complete sequence SEQ ID: NO
4 1 ctataattta gcggtcacat tttttatttc aaaaaaaaca gaaataacac
ctataggaat 61 tgatgtcata aaaataaaaa ttaaatacaa agtcattaaa
tatgtttttg gcacgccatc 121 cttaaaaaaa ccagtttccc aaaattcttt
tttcgtatat ctaagcgcgg ttttctctat 181 taaaaaccga gagaaaggga
ataggatagc actagccaaa ccaaagattc tgagcgcaat 241 tattttaggt
tcgttatccc cataactggc gtaaagaata caaacagcca taaagtaccc 301
ccaaaacata ttatgtatat aatatttcct tgtcat (E. coli gene for lysine
decarboxylase (cadA)) >gb|M76411.1|ECOCADABC: 1913-4060 E.coli
cadA gene, 5' cds and cadB and cadC genes, complete cds SEQ ID: NO
5 1 atgaacgtta ttgcaatatt gaatcacatg ggggtttatt ttaaagaaga
acccatccgt 61 gaacttcatc gcgcgcttga acgtctgaac ttccagattg
tttacccgaa cgaccgtgac 121 gacttattaa aactgatcga aaacaatgcg
cgtctgtgcg gcgttatttt tgactgggat 181 aaatataatc tcgagctgtg
cgaagaaatt agcaaaatga acgagaacct gccgttgtac 241 gcgttcgcta
atacgtattc cactctcgat gtaagcctga atgacctgcg tttacagatt 301
agcttctttg aatatgcgct gggtgctgct gaagatattg ctaataagat caagcagacc
361 actgacgaat atatcaacac tattctgcct ccgctgacta aagcactgtt
taaatatgtt 421 cgtgaaggta aatatacttt ctgtactcct ggtcacatgg
gcggtactgc attccagaaa 481 agcccggtag gtagcctgtt ctatgatttc
tttggtccga ataccatgaa atctgatatt 541 tccatttcag tatctgaact
gggttctctg ctggatcaca gtggtccaca caaagaagca 601 gaacagtata
tcgctcgcgt ctttaacgca gaccgcagct acatggtgac caacggtact 661
tccactgcga acaaaattgt tggtatgtac tctgctccag caggcagcac cattctgatt
721 gaccgtaact gccacaaatc gctgacccac ctgatgatga tgagcgatgt
tacgccaatc 781 tatttccgcc cgacccgtaa cgcttacggt attcttggtg
gtatcccaca gagtgaattc 841 cagcacgcta ccattgctaa gcgcgtgaaa
gaaacaccaa acgcaacctg gccggtacat 901 gctgtaatta ccaactctac
ctatgatggt ctgctgtaca acaccgactt catcaagaaa 961 acactggatg
tgaaatccat ccactttgac tccgcgtggg tgccttacac caacttctca 1021
ccgatttacg aaggtaaatg cggtatgagc ggtggccgtg tagaagggaa agtgatttac
1081 gaaacccagt ccactcacaa actgctggcg gcgttctctc aggcttccat
gatccacgtt 1141 aaaggtgacg taaacgaaga aacctttaac gaagcctaca
tgatgcacac caccacttct 1201 ccgcactacg gtatcgtggc gtccactgaa
accgctgcgg cgatgatgaa aggcaatgca 1261 ggtaagcgtc tgatcaacgg
ttctattgaa cgtgcgatca aattccgtaa agagatcaaa 1321 cgtctgagaa
cggaatctga tggctggttc tttgatgtat ggcagccgga tcatatcgat 1381
acgactgaat gctggccgct gcgttctgac agcacctggc acggcttcaa aaacatcgat
1441 aacgagcaca tgtatcttga cccgatcaaa gtcaccctgc tgactccggg
gatggaaaaa 1501 gacggcacca tgagcgactt tggtattccg gccagcatcg
tggcgaaata cctcgacgaa 1561 catggcatcg ttgttgagaa aaccggtccg
tataacctgc tgttcctgtt cagcatcggt 1621 atcgataaga ccaaagcact
gagcctgctg cgtgctctga ctgactttaa acgtgcgttc 1681 gacctgaacc
tgcgtgtgaa aaacatgctg ccgtctctgt atcgtgaaga tcctgaattc 1741
tatgaaaaca tgcgtattca ggaactggct cagaatatcc acaaactgat tgttcaccac
1801 aatctgccgg atctgatgta tcgcgcattt gaagtgctgc cgacgatggt
aatgactccg 1861 tatgctgcat tccagaaaga gctgcacggt atgaccgaag
aagtttacct cgacgaaatg 1921 gtaggtcgta ttaacgccaa tatgatcctt
ccgtacccgc cgggagttcc tctggtaatg 1981 ccgggtgaaa tgatcaccga
agaaagccgt ccggttctgg agttcctgca gatgctgtgt 2041 gaaatcggcg
ctcactatcc gggctttgaa accgatattc acggtgcata ccgtcaggct 2101
gatggccgct ataccgttaa ggtattgaaa gaagaaagca aaaaataa (Hafnia Alvei
gene for lysine decarboxylase (haldc) >gi|43438|emb|X03774.1|
Hafnia alvei gene for lysine decarboxylase (LDC) SEQ ID: NO 6 1
atgaatatca ttgccatcat gaacgattta agcgcttatt ttaaggaaga acccctgcgc
61 gagctgcatc aagagttaga gaaggaaggc ttccgtattg cttatcccaa
agaccgcaac 121 gatctgctga agctgattga aaacaactcc cgcctgtgtg
gcgtcatttt cgactgggat 181 aaatataacc tcgaactcag cgctgaaatc
agcgagctca acaaactgct gccaatttat 241 gccttcgcca atacctattc
gacgcttgac gtcaacatga gcgacctgcg tcttaatgtt 301 cgcttctttg
aatatgcatt aggcagcgcg caagacattg ccaccaagat ccgccaaagc 361
accgatcagt atattgatac cattctgcca ccgctgacca aggcgctgtt caaatacgtc
421 aaagaagaga aatacacagt ctgtacgccg gggcatatgg gcggaactgc
gttcgataaa 481 agccctgtcg gtagcctgtt ctatgatttc ttcggtgaaa
acaccatgcg ttcggatatc 541 tcgatctccg tatctgagct cggatcgctg
ctcgatcata gcggcccaca ccgtgacgcc 601 gaagagtata tcgcgcgcac
gttcaacgcc gatcgcagct atatcgtaac caacggaaca 661 tctacggcga
ataaaattgt cggcatgtat tcatctcctg ccggtgccac tattctgata 721
gaccgtaact gccataaatc attgacccat ttgatgatga tgagcaacgt tgtccccgtc
781 tatctgcgcc caacccgtaa cgcctacggc attttaggcg ggataccgca
aagcgagttc 841 acccgcgcca gcattgaaga gaaagtgaaa aatacgccca
atgcgacatg gccggtgcat 901 gcggtagtca ccaactctac ctatgacggc
ctgttctaca ataccgaata catcaaaaac 961 acgcttgatg ttaagtcgat
tcacttcgat tcggcatggg tgccttacac caacttccat 1021 ccgatttacc
aaggcaaagc agggatgagc ggtgaacgtg tgccggggaa aatcatctac 1081
gagactcagt ccacccacaa actgctggcg gcattctcgc aggcatcgat gatccacgtg
1141 aaaggtgaga tcaacgaaga aaccttcaat gaagcctata tgatgcatac
ctcaacatca 1201 ccgcattacg ggatcgttgc gtcgacggaa accgcggcgg
ctatgatgaa gggcaacgcc 1261 ggtaagcgtt taattaacgg ttcaattgaa
cgagcgatcc gcttccgtaa agagatccgc 1321 cgcttacgta cagaatctga
tggctggttc tttgacgtat ggcagccgga taacattgac 1381 gaggttgctt
gctggccact caatccacgt aatgaatggc atggattccc gaacatcgac 1441
aacgatcata tgtatcttga tccgatcaaa gtcactctgc tgaccccagg tttaagcccc
1501 aatggcactc tggaagagga agggataccg gcgtcgatcg tgtcgaaata
tctggatgag 1561 cacggcatca tcgtggaaaa aaccgggcca tataacctgc
tcttcctgtt tagtatcggg 1621 atcgataaaa ccaaggcgtt gagcttgttg
cgggcattaa ccgatttcaa acgcgtgtat 1681 gacctcaacc tgcgcgtgaa
aaacgtgttg ccatcgctct ataacgaggc gcctgatttc 1741 tataaagaga
tgcgaattca ggagttggct caggggattc atgctctggt gaaacaccac 1801
aatctaccag acctgatgta tcgtgcattt gaggtattac caaagctggt gatgacgccg
1861 catgatgcgt tccaagaaga agtgcgtggc aatattgagc catgtgcctt
ggatgatatg 1921 ttagggaaag ttagcgccaa catgatcttg ccgtatcctc
cgggtgttcc ggtggttatg 1981 ccgggagaaa tgctcactaa ggagagccgc
cctgttctga gcttcttgca gatgctatgt 2041 gaaattggcg cacactatcc
gggctttgaa acggatattc acggcgttca tcgtgatggt 2101 gcaacgggta
aatacatggt cgtggtgctc aaacaaggcg cagatgaacc gggtgataaa 2161
ccgagtgata cggtgaagaa agcgccgggt aaaaaaccat cagcggcgaa gaagtcataa
SEQ ID: NO 7 1 ATGAACGTTA TTGCAATATT SEQ ID: NO 8 1 ACTGAAAGCT
TCCACTTCCC TTGTACGAGC T SEQ ID: NO 9 1 ATTCAATATT GCAATAACGT
TCATAGCTGT TTCCTGTGTG SEQ ID: NO 10 1 AGGAAACAGC TATGAACGTT SEQ ID:
NO 11 1 ACTGAAAGCTT TACTTTCATC ACAAGCCTCT SEQ ID: NO 12 1
ACTGAAAGCTT AGATTCAGCG CGAGAGTGAT SEQ ID: NO 13 1 ACTGAAAGCT
TTTTAATTGT GTGACCACTA T
Sequence CWU 1
1
1311333DNAHafnia alvei 1ttgactttgt taaaagtcag gcataagatc aaaatactgt
atatataaca atgtatttat 60atacagtatt ttatactttt tatctaacgt cagagagggc
aatattatga gtggtggaga 120tggcaagggt cacaatagtg gagcacatga
ttccggtggc agcattaatg gaacttctgg 180gaaaggtggg ccatcaagcg
gaggagcatc agataattct gggtggagtt cggaaaataa 240cccgtggggc
ggtggtaact cgggaatgat tggtggcagt caaggaggta acggagctaa
300tcatggtggc gaaaatacat cttctaacta tgggaaagat gtatcacgcc
aaatcggtga 360tgcgatagcc agaaaggaag gcatcaatcc gaaaatattc
actgggtact ttatccgttc 420agatggatat ttgatcggaa taacgccact
tgtcagtggt gatgcctttg gcgttaatct 480tggcctgttc aataacaatc
aaaatagtag tagtgaaaat aagggatgga atggaaggaa 540tggagatggc
attaaaaata gtagccaagg tggatggaag attaaaacta atgaacttac
600ttcaaaccaa gtagctgctg ctaaatccgt tccagaacct aaaaatagta
aatattataa 660gtccatgaga gaagctagcg atgaggttat taattctaat
ttaaaccaag ggcatggagt 720tggtgaggca gctagagctg aaagagatta
cagagaaaaa gtaaagaacg caatcaatga 780taatagtccc aatgtgctac
aggatgctat taaatttaca gcagattttt ataaggaagt 840ttttaacgct
tacggagaaa aagccgaaaa actagccaag ttattagctg atcaagctaa
900aggtaaaaag atccgcaatg tagaagatgc attgaaatct tatgaaaaac
acaaggctaa 960cattaacaaa aaaatcaatg cgaaagatcg cgaagctatc
gccaaggctt tggagtctat 1020ggatgtagaa aaagccgcaa aaaatatatc
caagttcagc aaaggactag gttgggttgg 1080cccagctatc gatataactg
attggtttac agaattatac aaagcagtga aaactgataa 1140ttggagatct
ctttatgtta aaactgaaac tattgcagta gggctagctg caacccatgt
1200caccgcctta gcattcagtg ctgtcttggg tgggcctata ggtattttag
gttatggttt 1260gattatggct ggggttgggg cgttagttaa cgagacaata
gttgacgagg caaataaggt 1320cattgggatt taa 13332336DNAHafnia alvei
2ctatatttta gcggtcacat tttttatttc aaaacaaaca gaaagaacac caataggaat
60tgatgtcata aaaataaaaa taaaatacaa agtcattaaa tatgtttttg gcacaccatc
120cttaaaaaaa cctgttttcc aaaattcttt tttcgtatat ctaagcgctg
ctttctctat 180tagaaaccga gagaaaggaa atagaatagc gctagccaaa
ccaaagattc tgagcgcaat 240tattttaggt tcgtcatcac cataactggc
gtaaagaata caagcagcca taaagtatcc 300ccaaaacata ttatgtatgt
aatatttcct tgtcat 33631077DNAHafnia alvei 3atgagtggtg gagacggtaa
aggtcacaat agtggagcac atgattccgg tggcagcatt 60aatggaactt cggggaaagg
tggacctgat tctggtggcg gatattggga caaccatcca 120catattacaa
tcaccggtgg acgggaagta ggtcaagggg gagctggtat caactggggt
180ggtggttctg gtcatggtaa cggcgggggc tcagttgcca tccaagaata
taacacgagt 240aaatatccta acacgggagg atttcctcct cttggagacg
ctagctggct gttaaatcct 300ccaaaatggt cggttattga agtaaaatca
gaaaactcag catggcgctc ttatattact 360catgttcaag gtcatgttta
caaattgact tttgatggta cgggtaagct cattgatacc 420gcgtatgtta
attatgaacc cagtgatgat actcgttgga gcccgcttaa aagttttaaa
480tataataaag gaaccgctga aaaacaggtt agggatgcca ttaacaatga
aaaagaagca 540gttaaggacg ctgttaaatt tactgcagac ttctataaag
aggtttttaa ggtttacgga 600gaaaaagccg agaagctcgc taagttatta
gcagatcaag ctaaaggcaa aaaggttcgc 660aacgtagaag atgccttgaa
atcttatgaa aaatataaga ctaacattaa caaaaaaatc 720aatgcgaaag
atcgcgaagc tattgctaaa gccttggagt ctatggatgt aggaaaagcc
780gcaaaaaata tagccaagtt cagtaaagga ctaggttggg ttggccctgc
tatcgatata 840actgattggt ttacagaatt atacaaggca gtggaaactg
ataattggag atctttttat 900gttaaaactg aaactattgc agtagggcta
gctgcaaccc atgttgccgc cttggcattc 960agcgctgtct tgggtgggcc
tgtaggtatt ttgggttatg gtttgattat ggctggggtt 1020ggggcgttag
ttaatgagac aatagttgac gaggcaaata aggttattgg gctttaa
10774336DNAHafnia alvei 4ctataattta gcggtcacat tttttatttc
aaaaaaaaca gaaataacac ctataggaat 60tgatgtcata aaaataaaaa ttaaatacaa
agtcattaaa tatgtttttg gcacgccatc 120cttaaaaaaa ccagtttccc
aaaattcttt tttcgtatat ctaagcgcgg ttttctctat 180taaaaaccga
gagaaaggga ataggatagc actagccaaa ccaaagattc tgagcgcaat
240tattttaggt tcgttatccc cataactggc gtaaagaata caaacagcca
taaagtaccc 300ccaaaacata ttatgtatat aatatttcct tgtcat
33652148DNAEscherichia coli 5atgaacgtta ttgcaatatt gaatcacatg
ggggtttatt ttaaagaaga acccatccgt 60gaacttcatc gcgcgcttga acgtctgaac
ttccagattg tttacccgaa cgaccgtgac 120gacttattaa aactgatcga
aaacaatgcg cgtctgtgcg gcgttatttt tgactgggat 180aaatataatc
tcgagctgtg cgaagaaatt agcaaaatga acgagaacct gccgttgtac
240gcgttcgcta atacgtattc cactctcgat gtaagcctga atgacctgcg
tttacagatt 300agcttctttg aatatgcgct gggtgctgct gaagatattg
ctaataagat caagcagacc 360actgacgaat atatcaacac tattctgcct
ccgctgacta aagcactgtt taaatatgtt 420cgtgaaggta aatatacttt
ctgtactcct ggtcacatgg gcggtactgc attccagaaa 480agcccggtag
gtagcctgtt ctatgatttc tttggtccga ataccatgaa atctgatatt
540tccatttcag tatctgaact gggttctctg ctggatcaca gtggtccaca
caaagaagca 600gaacagtata tcgctcgcgt ctttaacgca gaccgcagct
acatggtgac caacggtact 660tccactgcga acaaaattgt tggtatgtac
tctgctccag caggcagcac cattctgatt 720gaccgtaact gccacaaatc
gctgacccac ctgatgatga tgagcgatgt tacgccaatc 780tatttccgcc
cgacccgtaa cgcttacggt attcttggtg gtatcccaca gagtgaattc
840cagcacgcta ccattgctaa gcgcgtgaaa gaaacaccaa acgcaacctg
gccggtacat 900gctgtaatta ccaactctac ctatgatggt ctgctgtaca
acaccgactt catcaagaaa 960acactggatg tgaaatccat ccactttgac
tccgcgtggg tgccttacac caacttctca 1020ccgatttacg aaggtaaatg
cggtatgagc ggtggccgtg tagaagggaa agtgatttac 1080gaaacccagt
ccactcacaa actgctggcg gcgttctctc aggcttccat gatccacgtt
1140aaaggtgacg taaacgaaga aacctttaac gaagcctaca tgatgcacac
caccacttct 1200ccgcactacg gtatcgtggc gtccactgaa accgctgcgg
cgatgatgaa aggcaatgca 1260ggtaagcgtc tgatcaacgg ttctattgaa
cgtgcgatca aattccgtaa agagatcaaa 1320cgtctgagaa cggaatctga
tggctggttc tttgatgtat ggcagccgga tcatatcgat 1380acgactgaat
gctggccgct gcgttctgac agcacctggc acggcttcaa aaacatcgat
1440aacgagcaca tgtatcttga cccgatcaaa gtcaccctgc tgactccggg
gatggaaaaa 1500gacggcacca tgagcgactt tggtattccg gccagcatcg
tggcgaaata cctcgacgaa 1560catggcatcg ttgttgagaa aaccggtccg
tataacctgc tgttcctgtt cagcatcggt 1620atcgataaga ccaaagcact
gagcctgctg cgtgctctga ctgactttaa acgtgcgttc 1680gacctgaacc
tgcgtgtgaa aaacatgctg ccgtctctgt atcgtgaaga tcctgaattc
1740tatgaaaaca tgcgtattca ggaactggct cagaatatcc acaaactgat
tgttcaccac 1800aatctgccgg atctgatgta tcgcgcattt gaagtgctgc
cgacgatggt aatgactccg 1860tatgctgcat tccagaaaga gctgcacggt
atgaccgaag aagtttacct cgacgaaatg 1920gtaggtcgta ttaacgccaa
tatgatcctt ccgtacccgc cgggagttcc tctggtaatg 1980ccgggtgaaa
tgatcaccga agaaagccgt ccggttctgg agttcctgca gatgctgtgt
2040gaaatcggcg ctcactatcc gggctttgaa accgatattc acggtgcata
ccgtcaggct 2100gatggccgct ataccgttaa ggtattgaaa gaagaaagca aaaaataa
214862220DNAHafnia alvei 6atgaatatca ttgccatcat gaacgattta
agcgcttatt ttaaggaaga acccctgcgc 60gagctgcatc aagagttaga gaaggaaggc
ttccgtattg cttatcccaa agaccgcaac 120gatctgctga agctgattga
aaacaactcc cgcctgtgtg gcgtcatttt cgactgggat 180aaatataacc
tcgaactcag cgctgaaatc agcgagctca acaaactgct gccaatttat
240gccttcgcca atacctattc gacgcttgac gtcaacatga gcgacctgcg
tcttaatgtt 300cgcttctttg aatatgcatt aggcagcgcg caagacattg
ccaccaagat ccgccaaagc 360accgatcagt atattgatac cattctgcca
ccgctgacca aggcgctgtt caaatacgtc 420aaagaagaga aatacacagt
ctgtacgccg gggcatatgg gcggaactgc gttcgataaa 480agccctgtcg
gtagcctgtt ctatgatttc ttcggtgaaa acaccatgcg ttcggatatc
540tcgatctccg tatctgagct cggatcgctg ctcgatcata gcggcccaca
ccgtgacgcc 600gaagagtata tcgcgcgcac gttcaacgcc gatcgcagct
atatcgtaac caacggaaca 660tctacggcga ataaaattgt cggcatgtat
tcatctcctg ccggtgccac tattctgata 720gaccgtaact gccataaatc
attgacccat ttgatgatga tgagcaacgt tgtccccgtc 780tatctgcgcc
caacccgtaa cgcctacggc attttaggcg ggataccgca aagcgagttc
840acccgcgcca gcattgaaga gaaagtgaaa aatacgccca atgcgacatg
gccggtgcat 900gcggtagtca ccaactctac ctatgacggc ctgttctaca
ataccgaata catcaaaaac 960acgcttgatg ttaagtcgat tcacttcgat
tcggcatggg tgccttacac caacttccat 1020ccgatttacc aaggcaaagc
agggatgagc ggtgaacgtg tgccggggaa aatcatctac 1080gagactcagt
ccacccacaa actgctggcg gcattctcgc aggcatcgat gatccacgtg
1140aaaggtgaga tcaacgaaga aaccttcaat gaagcctata tgatgcatac
ctcaacatca 1200ccgcattacg ggatcgttgc gtcgacggaa accgcggcgg
ctatgatgaa gggcaacgcc 1260ggtaagcgtt taattaacgg ttcaattgaa
cgagcgatcc gcttccgtaa agagatccgc 1320cgcttacgta cagaatctga
tggctggttc tttgacgtat ggcagccgga taacattgac 1380gaggttgctt
gctggccact caatccacgt aatgaatggc atggattccc gaacatcgac
1440aacgatcata tgtatcttga tccgatcaaa gtcactctgc tgaccccagg
tttaagcccc 1500aatggcactc tggaagagga agggataccg gcgtcgatcg
tgtcgaaata tctggatgag 1560cacggcatca tcgtggaaaa aaccgggcca
tataacctgc tcttcctgtt tagtatcggg 1620atcgataaaa ccaaggcgtt
gagcttgttg cgggcattaa ccgatttcaa acgcgtgtat 1680gacctcaacc
tgcgcgtgaa aaacgtgttg ccatcgctct ataacgaggc gcctgatttc
1740tataaagaga tgcgaattca ggagttggct caggggattc atgctctggt
gaaacaccac 1800aatctaccag acctgatgta tcgtgcattt gaggtattac
caaagctggt gatgacgccg 1860catgatgcgt tccaagaaga agtgcgtggc
aatattgagc catgtgcctt ggatgatatg 1920ttagggaaag ttagcgccaa
catgatcttg ccgtatcctc cgggtgttcc ggtggttatg 1980ccgggagaaa
tgctcactaa ggagagccgc cctgttctga gcttcttgca gatgctatgt
2040gaaattggcg cacactatcc gggctttgaa acggatattc acggcgttca
tcgtgatggt 2100gcaacgggta aatacatggt cgtggtgctc aaacaaggcg
cagatgaacc gggtgataaa 2160ccgagtgata cggtgaagaa agcgccgggt
aaaaaaccat cagcggcgaa gaagtcataa 2220720DNAArtificial
Sequenceprimer 7atgaacgtta ttgcaatatt 20831DNAArtificial
Sequenceprimer 8actgaaagct tccacttccc ttgtacgagc t
31940DNAArtificial Sequenceprimer 9attcaatatt gcaataacgt tcatagctgt
ttcctgtgtg 401020DNAArtificial Sequenceprimer 10aggaaacagc
tatgaacgtt 201131DNAArtificial Sequenceprimer 11actgaaagct
ttactttcat cacaagcctc t 311231DNAArtificial Sequenceprimer
12actgaaagct tagattcagc gcgagagtga t 311331DNAArtificial
Sequenceprimer 13actgaaagct ttttaattgt gtgaccacta t 31
* * * * *
References