U.S. patent application number 14/911911 was filed with the patent office on 2016-07-14 for endo-xylanase and coding gene and use thereof.
The applicant listed for this patent is SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES CHINESE ACADEMY OF SCIENCES. Invention is credited to Yongping HUANG, Ning LIU, Changli QIAN, Qian WANG, Qianfu WANG, Wei WEI, Lei XIE, Xing YAN, Zhihua ZHOU.
Application Number | 20160201045 14/911911 |
Document ID | / |
Family ID | 52468069 |
Filed Date | 2016-07-14 |
United States Patent
Application |
20160201045 |
Kind Code |
A1 |
ZHOU; Zhihua ; et
al. |
July 14, 2016 |
Endo-xylanase and Coding Gene and Use Thereof
Abstract
Provided are an endo-xylanase and a coding gene and the use
thereof. Also provided are an expression vector and a host cell
containing the coding gene, a method for forming a simple sugar by
using the xylanase, a xylanase mutant with an improved thermal
stability and a method for improving the thermal stability of the
xylanase.
Inventors: |
ZHOU; Zhihua; (Shanghai,
CN) ; WANG; Qianfu; (Shanghai, CN) ; WEI;
Wei; (Shanghai, CN) ; QIAN; Changli;
(Shanghai, CN) ; WANG; Qian; (Shanghai, CN)
; LIU; Ning; (Shanghai, CN) ; XIE; Lei;
(Shanghai, CN) ; YAN; Xing; (Shanghai, CN)
; HUANG; Yongping; (Shanghai, CN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES CHINESE ACADEMY OF
SCIENCES |
Shanghai |
|
CN |
|
|
Family ID: |
52468069 |
Appl. No.: |
14/911911 |
Filed: |
August 14, 2014 |
PCT Filed: |
August 14, 2014 |
PCT NO: |
PCT/CN2014/084349 |
371 Date: |
February 12, 2016 |
Current U.S.
Class: |
506/11 |
Current CPC
Class: |
A23K 50/75 20160501;
C12N 9/2482 20130101; C12P 19/14 20130101; A23K 20/189 20160501;
C12P 19/02 20130101; A23L 29/06 20160801; A23K 50/30 20160501; C12Y
302/01008 20130101 |
International
Class: |
C12N 9/24 20060101
C12N009/24 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 15, 2013 |
CN |
201310357541.5 |
Claims
1. An isolated polypeptide selected from the group consisting of:
(a) a polypeptide the amino acid of which is set forth in SEQ ID
NO:2; (b) a polypeptide fragment consisting of amino acid residues
19-272 of SEQ ID NO:2; (c) a polypeptide fragment consisting of
amino acid residues 19-267 of SEQ ID NO:2; (d) a polypeptide
comprising amino acids 19-267 of SEQ ID NO:2; (e) a polypeptide
formed by substitution, deletion or addition of one or several
amino acids in the amino acid sequence of (a), (b), (c) or (d) and
having the function of the polypeptide of (a); (f) a polypeptide
formed by adding a tag sequence or a signal peptide sequence at the
N or C terminus of the polypeptide of (a), (b), (c), (d) or (e);
and (g) a fusion protein containing the polypeptide of (a), (b),
(c), (d) or (e).
2. The polypeptide of claim 1, wherein the polypeptide is selected
from the group consisting of polypeptides containing amino acid
substitution(s) at the site(s) corresponding to at least one of
K32, N37, S42, M80, K205, E219, A221, M222, K223, T228 and A386 of
SEQ ID NO:2.
3. The polypeptide of claim 1, wherein the polypeptide is selected
from the group consisting of: (1) the polypeptide in which a
substitution mutation, K32T, is present at position corresponding
to amino acid residue 32 of SEQ ID NO:2; (2) the polypeptide in
which a substitution mutation, N37D, is present at position
corresponding to amino acid residue 37 of SEQ ID NO:2; (3) the
polypeptide in which a substitution mutation, S42N, is present at
position corresponding to amino acid residue 42 of SEQ ID NO:2; (4)
the polypeptide in which a substitution mutation, M80I, is present
at position corresponding to amino acid residue 80 of SEQ ID NO:2;
(5) the polypeptide in which a substitution mutation, K205E, is
present at position corresponding to amino acid residue 205 of SEQ
ID NO:2; (6) the polypeptide in which a substitution mutation,
E219D, is present at position corresponding to amino acid residue
219 of SEQ ID NO:2; (7) the polypeptide in which a substitution
mutation, A221T, is present at position corresponding to amino acid
residue 221 of SEQ ID NO:2; (8) the polypeptide in which a
substitution mutation, M222L, is present at position corresponding
to amino acid residue 222 of SEQ ID NO:2; (9) the polypeptide in
which a substitution mutation, K223M, is present at position
corresponding to amino acid residue 223 of SEQ ID NO:2; (10) the
polypeptide in which a substitution mutation, K223T, is present at
position corresponding to amino acid residue 223 of SEQ ID NO:2;
(11) the polypeptide in which a substitution mutation, K223C, is
present at position corresponding to amino acid residue 223 of SEQ
ID NO:2; (12) the polypeptide in which a substitution mutation,
K223S, is present at position corresponding to amino acid residue
223 of SEQ ID NO:2; (13) the polypeptide in which a substitution
mutation, K223G, is present at position corresponding to amino acid
residue 223 of SEQ ID NO:2; (14) the polypeptide in which a
substitution mutation, K223L, is present at position corresponding
to amino acid residue 223 of SEQ ID NO:2; (15) the polypeptide in
which a substitution mutation, T228S, is present at position
corresponding to amino acid residue 228 of SEQ ID NO:2; (16) the
polypeptide in which a substitution mutation, A386S, is present at
position corresponding to amino acid residue 386 of SEQ ID NO:2;
(17) the polypeptide in which substitution mutations, K205E, K223T
and A386S, are present at positions corresponding to amino acid
residues 205, 223 and 386 of SEQ ID NO:2; (18) the polypeptide in
which substitution mutations, K32T and K223T, are present at
positions corresponding to amino acid residues 32 and 223 of SEQ ID
NO:2; (19) the polypeptide in which substitution mutations, K205E
and K223T, are present at positions corresponding to amino acid
residues 205 and 223 of SEQ ID NO:2; (20) the polypeptide in which
a substitution mutation, K223E, K223T, K223C, K223S, K223G or
K223L, is present at position corresponding to amino acid residue
223 of SEQ ID NO:2; (21) the polypeptide in which substitution
mutations, K32T and K223C, are present at positions corresponding
to amino acid residues 32 and 223 of SEQ ID NO:2; and (22) the
polypeptide in which substitution mutations, K32T and K223S, are
present at positions corresponding to amino acid residues 32 and
223 of SEQ ID NO:2.
4. An isolated polynucleotide, which is selected from the group
consisting of: (1) the polynucleotide encoding the polypeptide of
claim 1; and (2) the polynucleotide complementary to the
polynucleotide of (1).
5. A vector comprising the polynucleotide of claim 4.
6. A genetically engineering host cell comprising the vector of
claim 5.
7. A method for producing a polypeptide selected from the group
consisting of: (a) a polypeptide the amino acid of which is set
forth in SEQ ID NO:2; (b) a polypeptide fragment consisting of
amino acid residues 19-272 of SEQ ID NO:2; (c) a polypeptide
fragment consisting of amino acid residues 19-267 of SEQ ID NO:2;
(d) a polypeptide comprising amino acids 19-267 of SEQ ID NO:2; (e)
a polypeptide formed by substitution, deletion or addition of one
or several amino acids in the amino acid sequence of (a), (b), (c)
or (d) and having the function of the polypeptide of (a); (f) a
polypeptide formed by adding a tag sequence or a signal peptide
sequence at the N or C terminus of the polypeptide of (a), (b),
(c), (d) or (e); (g) a fusion protein containing the polypeptide of
(a), (b), (c), (d) or (e), comprising: (a) culturing the host cell
of claim 6 under the conditions suitable for the host cell to
express the polypeptide; and (b) isolating the polypeptide from the
culture.
8. (canceled)
9. A method for degrading xylan, comprising mixing the polypeptide
of claim 1 with xylan or a material containing xylan to allow the
polypeptide to degrade the xylan or the xylan contained in a
material containing xylan under suitable reaction conditions to
oligoxylan or xylo-oligosaccharide or xylose.
10. The method of claim 9, wherein the xylan is selected from the
group consisting of birch xylan and beech xylan.
11. The method of claim 9, wherein the material containing xylan is
selected from the group consisting of pulp, feed and straw.
12. The method of claim 9, wherein the suitable reaction condition
includes a pH of 3-12, preferably 5.5-10, more preferably about
7.0, and a temperature of 15-90.degree. C., preferably
30-60.degree. C., more preferably 50-55.degree. C.
13. The method of claim 9, wherein the method further comprises
adding an additive that regulating the enzymatic activity of the
polypeptide to the mixture of the polypeptide and the xylan or the
material containing xylan, wherein the additive is selected from
the group consisting of K.sup.+, Mn.sup.2+, Cu.sup.2+ or Co.sup.2+,
or substance that can be hydrolyzed to form K.sup.+, Mn.sup.2+,
Cu.sup.2+ or Co.sup.2+ after adding to the substrate.
14. A composition comprising a safe and effective amount of the
polypeptide of claim 1 and a bromatologically acceptable or
industrially acceptable carrier.
15. A method for increasing the thermal stability of xylanase,
comprising mutating the amino acid residue(s) of the xylanase
polypeptide at position(s) corresponding to position 32 and/or 223
of SEQ ID NO:2, thereby obtaining a mutated xylanase having an
improved thermal stability as compared the xylanase before
mutation.
16. A method for screening a xylanase having an improved thermal
stability, comprising: (1) constructing a library comprising
mutants of SEQ ID NO:2 or fragments of SEQ ID NO:2 comprising amino
acids 19-267 based on SEQ ID NO:2 or fragments of SEQ ID NO:2
comprising amino acids 19-267; and (2) testing the thermal
stability of the mutants in the library; wherein, after testing
under the same test conditions, the mutant having a reduction
degree of activity lower than that of the control by at least 5% is
the mutant having an improved thermal stability.
17. The method according to claim 16, wherein the step of testing
the thermal stability includes testing the enzymatic activity of
the mutants and control at a pH of 3-12, preferably 5.5-10, more
preferably about 7.0, and a temperature of 15-90.degree. C.,
preferably 30-60.degree. C., more preferably 50-55.degree. C., and
wherein the substrate for testing is selected from birch xylan and
beech xylan.
18. The isolated polynucleotide of claim 4, wherein the polypeptide
is selected from the group consisting of polypeptides containing
amino acid substitution(s) at the site(s) corresponding to at least
one of K32, N37, S42, M80, K205, E219, A221, M222, K223, T228 and
A386 of SEQ ID NO:2; or wherein the polypeptide is selected from
the group consisting of: (1) the polypeptide in which a
substitution mutation, K32T, is present at position corresponding
to amino acid residue 32 of SEQ ID NO:2; (2) the polypeptide in
which a substitution mutation, N37D, is present at position
corresponding to amino acid residue 37 of SEQ ID NO:2; (3) the
polypeptide in which a substitution mutation, S42N, is present at
position corresponding to amino acid residue 42 of SEQ ID NO:2; (4)
the polypeptide in which a substitution mutation, M801, is present
at position corresponding to amino acid residue 80 of SEQ ID NO:2;
(5) the polypeptide in which a substitution mutation, K205E, is
present at position corresponding to amino acid residue 205 of SEQ
ID NO:2; (6) the polypeptide in which a substitution mutation,
E219D, is present at position corresponding to amino acid residue
219 of SEQ ID NO:2; (7) the polypeptide in which a substitution
mutation, A221T, is present at position corresponding to amino acid
residue 221 of SEQ ID NO:2; (8) the polypeptide in which a
substitution mutation, M222L, is present at position corresponding
to amino acid residue 222 of SEQ ID NO:2; (9) the polypeptide in
which a substitution mutation, K223M, is present at position
corresponding to amino acid residue 223 of SEQ ID NO:2; (10) the
polypeptide in which a substitution mutation, K223T, is present at
position corresponding to amino acid residue 223 of SEQ ID NO:2;
(11) the polypeptide in which a substitution mutation, K223C, is
present at position corresponding to amino acid residue 223 of SEQ
ID NO:2; (12) the polypeptide in which a substitution mutation,
K223S, is present at position corresponding to amino acid residue
223 of SEQ ID NO:2; (13) the polypeptide in which a substitution
mutation, K223G, is present at position corresponding to amino acid
residue 223 of SEQ ID NO:2; (14) the polypeptide in which a
substitution mutation, K223L, is present at position corresponding
to amino acid residue 223 of SEQ ID NO:2; (15) the polypeptide in
which a substitution mutation, T228S, is present at position
corresponding to amino acid residue 228 of SEQ ID NO:2; (16) the
polypeptide in which a substitution mutation, A386S, is present at
position corresponding to amino acid residue 386 of SEQ ID NO:2;
(17) the polypeptide in which substitution mutations, K205E, K223T
and A386S, are present at positions corresponding to amino acid
residues 205, 223 and 386 of SEQ ID NO:2; (18) the polypeptide in
which substitution mutations, K32T and K223T, are present at
positions corresponding to amino acid residues 32 and 223 of SEQ ID
NO:2; (19) the polypeptide in which substitution mutations, K205E
and K223T, are present at positions corresponding to amino acid
residues 205 and 223 of SEQ ID NO:2; (20) the polypeptide in which
a substitution mutation, K223E, K223T, K223C, K223S, K223G or
K223L, is present at position corresponding to amino acid residue
223 of SEQ ID NO:2; (21) the polypeptide in which substitution
mutations, K32T and K223C, are present at positions corresponding
to amino acid residues 32 and 223 of SEQ ID NO:2; and (22) the
polypeptide in which substitution mutations, K32T and K223S, are
present at positions corresponding to amino acid residues 32 and
223 of SEQ ID NO:2.
19. A vector comprising the polynucleotide of claim 18.
20. A genetically engineering host cell comprising an integrated
polynucleotide including the polynucleotide of claim 4.
21. The method of claim 11, wherein the polypeptide is selected
from the group consisting of polypeptides containing amino acid
substitution(s) at the site(s) corresponding to at least one of
K32, N37, S42, M80, K205, E219, A221, M222, K223, T228 and A386 of
SEQ ID NO:2; or wherein the polypeptide is selected from the group
consisting of: (1) the polypeptide in which a substitution
mutation, K32T, is present at position corresponding to amino acid
residue 32 of SEQ ID NO:2; (2) the polypeptide in which a
substitution mutation, N37D, is present at position corresponding
to amino acid residue 37 of SEQ ID NO:2; (3) the polypeptide in
which a substitution mutation, S42N, is present at position
corresponding to amino acid residue 42 of SEQ ID NO:2; (4) the
polypeptide in which a substitution mutation, M80I, is present at
position corresponding to amino acid residue 80 of SEQ ID NO:2; (5)
the polypeptide in which a substitution mutation, K205E, is present
at position corresponding to amino acid residue 205 of SEQ ID NO:2;
(6) the polypeptide in which a substitution mutation, E219D, is
present at position corresponding to amino acid residue 219 of SEQ
ID NO:2; (7) the polypeptide in which a substitution mutation,
A221T, is present at position corresponding to amino acid residue
221 of SEQ ID NO:2; (8) the polypeptide in which a substitution
mutation, M222L, is present at position corresponding to amino acid
residue 222 of SEQ ID NO:2; (9) the polypeptide in which a
substitution mutation, K223M, is present at position corresponding
to amino acid residue 223 of SEQ ID NO:2; (10) the polypeptide in
which a substitution mutation, K223T, is present at position
corresponding to amino acid residue 223 of SEQ ID NO:2; (11) the
polypeptide in which a substitution mutation, K223C, is present at
position corresponding to amino acid residue 223 of SEQ ID NO:2;
(12) the polypeptide in which a substitution mutation, K223S, is
present at position corresponding to amino acid residue 223 of SEQ
ID NO:2; (13) the polypeptide in which a substitution mutation,
K223G, is present at position corresponding to amino acid residue
223 of SEQ ID NO:2; (14) the polypeptide in which a substitution
mutation, K223L, is present at position corresponding to amino acid
residue 223 of SEQ ID NO:2; (15) the polypeptide in which a
substitution mutation, T228S, is present at position corresponding
to amino acid residue 228 of SEQ ID NO:2; (16) the polypeptide in
which a substitution mutation, A386S, is present at position
corresponding to amino acid residue 386 of SEQ ID NO:2; (17) the
polypeptide in which substitution mutations, K205E, K223T and
A386S, are present at positions corresponding to amino acid
residues 205, 223 and 386 of SEQ ID NO:2; (18) the polypeptide in
which substitution mutations, K32T and K223T, are present at
positions corresponding to amino acid residues 32 and 223 of SEQ ID
NO:2; (19) the polypeptide in which substitution mutations, K205E
and K223T, are present at positions corresponding to amino acid
residues 205 and 223 of SEQ ID NO:2; (20) the polypeptide in which
a substitution mutation, K223E, K223T, K223C, K223S, K223G or
K223L, is present at position corresponding to amino acid residue
223 of SEQ ID NO:2; (21) the polypeptide in which substitution
mutations, K32T and K223C, are present at positions corresponding
to amino acid residues 32 and 223 of SEQ ID NO:2; and (22) the
polypeptide in which substitution mutations, K32T and K223S, are
present at positions corresponding to amino acid residues 32 and
223 of SEQ ID NO:2.
Description
TECHNICAL FIELD
[0001] The present disclosure belongs to the biotechnical field,
relating to a novel endo-xylanase, its coding gene and use
thereof.
TECHNICAL BACKGROUND
[0002] Brief Introduction of Xylan. The backbone of xylan is formed
by xylose molecules (D xylose) linked through .beta.-1,4-glycosidic
linkage and the branched chains are formed by arabinofuranosidic
group, glucuronyl or acetyl, etc. Xylan is the major component of
the hemicellulose in the plant cell wall. Besides cellulose,
hemicellulose is the second important component of the plant
polysaccharide and is the second abundant reproducible plant
polysaccharide in the nature.
[0003] Source of Xylan. Materials rich in xylan could be obtained
from various sources, including agricultural, forestry and
industrial wastes, such as hardwood, cork, stalk, straw, bran,
etc., and municipal solid wastes, etc. Different plants contain
different amounts of xylan. Hardwood contains more xylan than cork.
The amount of xylan may be accounted for 15.about.30% of the dry
weight of hardwood and 7.about.12% of the dry weight of cork
commonly. The amount of xylan may be up to 30% or more in some
annual plants, such as wheat, sugarcane, and cotton seed hull.
[0004] Brief Introduction of Xylanase. Xylanase is a collective
term of a series of glycosyl hydrolases that can specifically
degrade xylan. Many enzymes are required to thoroughly degrade
xylan due to differences in monosaccharide units that consist of
the xylan, in types of bonds, and in branched chains of xylan
having different substituents. The enzymes include
endo-.beta.-1,4-xylanase (EC 3.2.1.8), .beta.-xylosidase (EC
3.2.1.37), .alpha.-L-arabinofuranosidase (E.C. 3.2.1.39),
.beta.-D-glucuronidase (EC 3.2.1.39), acetyl xylan esterases (E.C.
3.1.1.72), and ferulic or p-coumaric acid esterase (E.C. 3.2.1.73)
that degrades the ester bond formed by residue of the side chain of
arabinose and phenolic acid (such as ferulic acid or coumaric
acid), etc. Among the above enzymes, the endo-.beta.-1,4-xylanase
is the major enzyme for degrading xylan, which acts on the internal
.beta.-1,4-xylosidic linkage within the backbone of xylan through
an endo-cleavage manner to hydrolyze the large polyxylan to
oligoxylan and small-amount xyloses, thereby initiating the gradual
degradation of polysaccharide (Bernier R, Driguez H, Desrochers M
Gene 26:59-65, 1983).
[0005] Application of Xylanase in Traditional Industry. Xylanase is
widely used and plays an important role in various industrial
sectors, including food, feed, paper manufacture, and spinning,
etc. Firstly, in the food industry, xylanase is used in processing
of fruit, vegetable and plant to promote the dipping procedure, to
make the juice clear and to increase the output and filter
efficiency. Xylanase is also used in the preparation and brewage of
grape wine to promote dipping of grape skin and to reduce turbidity
of the finished product. Xylanase is also used in the baking,
grinding, and processing of cookie and candy to increase the
elasticity and strength of flour dough and to improve the texture
of the bread. It is also used in the coffee processing to reduce
the viscosity of the coffee extract and improve the
drying/freeze-drying procedure. Secondly, in the industry of paper
manufacture, xylanase is used to promote the pulping treatment and
to replace the mechanical pulping, which can not only effectively
reduce energy consumption but also increase formation of fibril of
pulp and water permeability, thereby increasing processing
efficiency and paper strength. Thirdly, in the spinning industry,
xylanase is used in the enzymolysis of textiles, such as flax,
jute, ramie, hemp, etc., to reduce or replace the chemical blending
method. Fourthly, in the agriculture and animal husbandry, xylanase
is widely used in the feed for monogastric animals, such as pig and
poultry, and ruminants, to assist the animal to effectively degrade
xylan, reduce the content of the non-starch polysaccharide in the
feed, increase the digestibility and nutritive value of the feed,
and reduce environmental pollution.
[0006] Application of Xylanase in Bioenergy Field. Importantly,
xylanase can be used together with other cellulases and
hemicellulases in the industrial production of converting
lignocellulose to fuel ethanol, under the background that global
fossil resources are increasingly depleted and development of new
bioenergy is imminent. In one aspect, xylanase could greatly
increase frequency and efficiency of cellulase in contacting and
acting on cellulose chain by degrading the hemicellulose chain
closely crosslinked with lignin and cellulose backbone in
lignocellulose, thereby indirectly increasing the degradation
efficiency of cellulose. In another aspect, with research and
development of pentose fermentation pathway and strains in recently
years, the process of producing the fuel ethanol by utilizing
bacteria, yeast and filamentous fungi to ferment the hydrolyzed
product, xylose, of xylan is mature gradually. With the above two
aspects, the conversion efficiency of lignocellulose is greatly
improved and thus the cost for producing fuel ethanol is
effectively reduced.
[0007] Study History of Xylanase. Since xylanase could be widely
used, research on xylanase began early at 1960'. A lot of xylanases
with different types and functions were isolated from different
sources of microbes. Xylanases from Trichoderma reesei, Aspergillus
niger, Streptomyces lividans, Cellulomonas fimi, Clostridium
thermocellum, and Penicillium simplicissimum, etc., have been
clearly investigated. What should be noted is that most of these
xylanase genes were isolated from the pure culture of microbes.
However, species of microbes in the nature that can be cultured are
less than 1% and the resultant xylanases are far from enough to
meet the needs of modern industrial production in their physical
and chemical properties, catalytic efficiency and yield, etc.
[0008] Considering that most of the xylanases known in the prior
art exhibit a relatively low activity, and their physical and
chemical properties, catalytic efficiency and yield, etc., are far
from enough to meet the needs of modern industrial production,
there is a need to further broaden the objects to be screened and
to screen out novel xylanases having a high enzymatic activity for
industrial production to increase the production efficiency.
SUMMARY
[0009] The purpose of the present disclosure is to provide a novel
endo-xylanase, its coding gene and use thereof.
[0010] The purpose of the present disclosure is to provide an
expression vector and a host cell comprising the endo-xylanase
gene, methods for expressing the gene and purifying the protein,
and the zymological characteristics and functional features of the
recombinant protein.
[0011] In one aspect of the present disclosure, an isolated
polypeptide is provided, which is selected from the group
consisting of:
[0012] (a) a polypeptide set forth in SEQ ID NO:2;
[0013] (b) a polypeptide fragment consisting of amino acid residues
19-272 of SEQ ID NO:2;
[0014] (c) a polypeptide fragment consisting of amino acid residues
19-267 of SEQ ID NO:2;
[0015] (d) a polypeptide comprising amino acids 19-267 of SEQ ID
NO:2;
[0016] (e) a polypeptide formed by substitution, deletion or
insertion of one or several, such as 1-20, preferably 1-10, more
preferably 1-5, and more preferably 1-3, amino acids in the amino
acid sequence of (a), (b), (c) or (d) and having the function of
the polypeptide of (a);
[0017] (f) a polypeptide formed by adding a tag sequence or a
signal peptide sequence at the N or C terminus of the polypeptide
of (a), (b), (c), (d) or (e);
[0018] (g) a fusion protein containing the polypeptide of (a), (b),
(c), (d) or (e).
[0019] In a preferred embodiment, the polypeptide is derived from
an intestinal metagenomics library of Globitermes sulphureus, which
is one of the high termite species.
[0020] In a specific embodiment, the function of the polypeptide in
(a) includes but is not limited to the function of being used as an
endo-xylanase.
[0021] In a preferred embodiment, the polypeptide of (e) exhibits
an improved thermal stability as compared to the wild type
sequence, in addition to the function of being used as an
endo-xylanase.
[0022] In a specific embodiment, the polypeptide is selected from
the group consisting of:
[0023] (i) SEQ ID NO:2; and
[0024] (ii) a fragment of SEQ ID NO:2 which contains at least amino
acids 19-267 of SEQ ID NO:2.
[0025] In a specific embodiment, the fragment consists of amino
acid residues 19-272 of SEQ ID NO:2.
[0026] In a specific embodiment, the polypeptide of (e) is selected
from the group consisting of polypeptides containing amino acid
substitution(s) at the site(s) corresponding to at least one of
K32, N37, S42, M80, K205, E219, A221, M222, K223, T228 and A386 of
SEQ ID NO:2.
[0027] In a specific embodiment, the polypeptide of (e) contains
substitutions at least at K32 and K223 of SEQ ID NO:2. In some
specific embodiments, the substitution mutation is a combination of
K32T with any of K223M, K223E, K223T, K223C, K223S, K223G and
K223L.
[0028] In a specific embodiment, the polypeptide of (e) contains
substitution at least at position 223, which is selected from the
group consisting of K223M, K223E, K223T, K223C, K223S, K223G and
K223L.
[0029] In a specific embodiment, the mutation in the polypeptide of
(e) is a substitution selected from one or more of K32T, N37D,
S42N, M80I, K205E, E219D, A221T, M222L, K223M, K223E, K223T, K223C,
K223S, K223G, K223L, T228S, and A386S.
[0030] In a specific embodiment, the polypeptide of (e) is selected
from the group consisting of (1) the polypeptide in which a
substitution mutation, N37D, is present at position corresponding
to amino acid residue 37 of SEQ ID NO:2; (2) the polypeptide in
which a substitution mutation, S42N, is present at position
corresponding to amino acid residue 42 of SEQ ID NO:2; (3) the
polypeptide in which a substitution mutation, M80I, is present at
position corresponding to amino acid residue 80 of SEQ ID NO:2; (4)
the polypeptide in which a substitution mutation, E219D, is present
at position corresponding to amino acid residue 219 of SEQ ID NO:2;
(5) the polypeptide in which a substitution mutation, A221T, is
present at position corresponding to amino acid residue 221 of SEQ
ID NO:2; (6) the polypeptide in which a substitution mutation,
M222L, is present at position corresponding to amino acid residue
222 of SEQ ID NO:2; (7) the polypeptide in which a substitution
mutation, K223M, is present at position corresponding to amino acid
residue 223 of SEQ ID NO:2; (8) the polypeptide in which a
substitution mutation, T228S, is present at position corresponding
to amino acid residue 228 of SEQ ID NO:2; (9) the polypeptide in
which substitution mutations, K205E, K223T and A386S, are present
at positions corresponding to amino acid residues 205, 223 and 386
of SEQ ID NO:2; (10) the polypeptide in which substitution
mutations, K32T and K223T, are present at positions corresponding
to amino acid residues 32 and 223 of SEQ ID NO:2; (11) the
polypeptide in which substitution mutations, K205E and K223T, are
present at positions corresponding to amino acid residues 205 and
223 of SEQ ID NO:2; (12) the polypeptide in which a substitution
mutation, K223E, K223T, K223C, K223S, K223G or K223L, is present at
position corresponding to amino acid residue 223 of SEQ ID NO:2;
(13) the polypeptide in which substitution mutations, K21T and
K223C, are present at positions corresponding to amino acid
residues 21 and 223 of SEQ ID NO:2; and (14) the polypeptide in
which substitution mutations, K32T and K223S, are present at
positions corresponding to amino acid residues 32 and 223 of SEQ ID
NO:2.
[0031] In another aspect of the present disclosure, an isolated
polynucleotide is provided, which contains a nucleotide sequence
selected from the group consisting of:
[0032] (1) a polynucleotide encoding the polypeptide;
[0033] (2) a polynucleotide complementary to the polynucleotide of
(1).
[0034] In another preferred embodiment, the polynucleotide encodes
the polypeptide set for in SEQ ID NO:2.
[0035] In another preferred embodiment, the nucleotide sequence of
the polynucleotide is set forth in SEQ ID NO:1.
[0036] In another aspect of the present disclosure, a vector is
provided, which contains the polynucleotide.
[0037] In another aspect of the present disclosure, a genetically
engineering host cell is provided, which contains the vector, or in
which the polynucleotide is integrated into its genome.
[0038] In another aspect of the present disclosure, a method for
preparing the polypeptide is provided, which comprises:
[0039] (a) culturing the host cell;
[0040] (b) isolating the polypeptide from the culture.
[0041] In another aspect of the present invention, a method is
provided for degrading xylan or materials containing xylan to
xylo-oligosaccharide or monosaccharide by utilizing the
polypeptide.
[0042] In another preferred embodiment, the xylo-oligosaccharide is
xylobiose, xylotriose or xylotetraose.
[0043] In another preferred embodiment, the polypeptide degrades
the substrate through an endo-cleavage manner, and the substrate is
xylan, or materials containing xylan, such as hemicellulose.
[0044] In another preferred embodiment, the xylan is birch xylan or
beech xylan.
[0045] In another aspect of the present disclosure, a composition
is provided, which comprises a safe and effective amount of the
polypeptide and a bromatologically acceptable or industrially
acceptable carrier.
[0046] In another preferred embodiment, the composition further
comprises additives for regulating enzymatic activity.
[0047] In another preferred embodiment, the additives for
regulating enzymatic activity are additives that improve enzymatic
activity, preferably selected from the group consisting of K.sup.+,
Mn.sup.2+, or materials that could be hydrolyzed to form K.sup.+ or
Mn.sup.2+ after adding to the substrate; or the additives for
regulating enzymatic activity are additives that inhibit enzymatic
activity, preferably selected from the group consisting of
Ni.sup.2+, Zn.sup.2+, Fe.sup.3+ and EDTA, or materials that could
be hydrolyzed to form Ni.sup.2+, Zn.sup.2+ or Fe.sup.3+ after
adding to the substrate.
[0048] In a preferred embodiment, the xylan is birch xylan or beech
xylan.
[0049] In another preferred embodiment, the substrate to be
hydrolyzed is treated by the polypeptide at pH 3-12, such as
3.5-9.5, 5-10, 4-9.5, 5.5-9.5, preferably 6.0-9.5, more preferably
6.0-8.0, most preferably 7.0.
[0050] In another preferred embodiment, the substrate to be
hydrolyzed is treated by the polypeptide under 15-90.quadrature.,
such as 25-80.quadrature., preferably 30-60.quadrature., more
preferably 45-55.quadrature., further more preferably
50-55.quadrature..
[0051] In another preferred embodiment, additives for regulating
enzymatic activity are added during treatment with the
polypeptide.
[0052] In another preferred embodiment, the additives for
regulating enzymatic activity are additives that improve enzymatic
activity, preferably selected from the group consisting of K.sup.+,
Mn.sup.2+, or materials that could be hydrolyzed to form K.sup.+ or
Mn.sup.2+ after adding to the substrate; or
[0053] the additives for regulating enzymatic activity are
additives that inhibit enzymatic activity, preferably selected from
the group consisting of Ni.sup.2+, Zn.sup.2+, Fe.sup.3+ and EDTA,
or materials that could be hydrolyzed to form Ni.sup.2+, Zn.sup.2+
or Fe.sup.3+ after adding to the substrate.
[0054] The present disclosure also provides a method for improving
the thermal stability of xylanase, comprising mutating the amino
acid residue(s) of the xylanase polypeptide at position(s)
corresponding to amino acid residue 32 and/or 223 of SEQ ID NO:2,
thereby obtaining xylanase having an improved thermal
stability.
[0055] In a specific embodiment, the xylanase polypeptide is the
xylanase polypeptide known in the art.
[0056] In other embodiments, the xylanase polypeptide is SEQ ID
NO:2 of the present disclosure or active fragment(s) thereof
[0057] In other embodiments, the mutation further comprises
mutations at other positions of xylanase. In preferred embodiments,
the other positions include one or more of positions 37, 42, 80,
205, 219, 221, 222, 228 and 386, numbered according to the amino
acid positions in SEQ ID NO:2.
[0058] The present disclosure further provides a method for
screening a xylanase having an improved thermal stability,
comprising:
[0059] (1) constructing a library comprising mutants of SEQ ID NO:2
or its active fragments; and
[0060] (2) testing the thermal stability of the mutants in the
library;
[0061] wherein, after testing under the same conditions, the mutant
having a reduction degree of activity lower than that of the
control by at least 5%, preferably at least 10%, at least 20%, at
least 30% or more is the mutant having an improved thermal
stability.
[0062] In the above method, the control may be the starting
polypeptide used for constructing the mutant library, such as SEQ
ID NO:2 or its fragment(s) that contain amino acids 19-267 or
19-272, or some mutants ascertained to have the endo-xylanase
activity of SEQ ID NO:2 and the same or improved thermal stability
as compared to SEQ ID NO:2 or its fragment(s) that contain amino
acids 19-267 or 19-272.
[0063] In a specific embodiment, the constructed mutants at least
contain substitution mutation(s) at one or more positions selected
from the group consisting of K32, N37, S42, M80, K205, E219, A221,
M222, K223, T228 and A386, numbered according to the amino acid
positions in SEQ ID NO:2.
[0064] In a specific embodiment, the constructed mutants at least
include mutation(s) at K32 and/or K223. In other embodiments, the
constructed mutants can further comprise mutation(s), preferably
substitution, at one or more positions selected from the group
consisting of N37, S42, M80, K205, E219, A221, M222, T228 and A386.
The above positions are numbered according to SEQ ID NO:2.
[0065] In a specific embodiment, the thermal stability test
includes testing the enzymatic activity of the mutants and control
at pH 3-12, preferably 5.5-10, more preferably about 7.0, and
15-90.degree. C., preferably 30-60.degree. C., more preferably
50-55.degree. C., and wherein the substrate for testing is selected
from birch xylan and beech xylan.
[0066] Other aspects of the present disclosure will be apparent to
the skilled artisan in view of the contents disclosed in the
present disclosure.
BRIEF DESCRIPTION OF DRAWINGS
[0067] FIG. 1 shows the electrophoretogram obtained after PCR of
recombinant E. coli BL21(DE3)/pET28a-xyl7 colonies. Lane M shows
the electrophoretic result of DNA marker, respectively
corresponding to 23.1 kb, 9.4 kb, 6.6 kp, 4.4 kp, 2.3 kb, 2.0 kb,
564 bp bands, from top to bottom. Lanes 1-5 indicate the
electrophoretogram of five monoclonal colonies of E. coli
BL21(DE3)/pET28a(+)-xyl7 obtained after PCR.
[0068] FIG. 2 shows the SDS-PAGE diagram obtained after expression
of the endo-1,4-.beta.-xylanase gene xyl7 and purification of the
expressed product. Lane 1: proteins from the supernatant of cell
lysate; lane 2: 20 mM imidazole eluent; lane 3: 40 mM imidazole
eluent; lane 4: 60 mM imidazole eluent; lane 5: 100 mM imidazole
eluent; lane 6: 200 mM imidazole eluent; lane 7: 500 mM imidazole
eluent; lane M: protein Marker, with a molecular weight of 200,
116, 97.2, 66.4, 44.3, 29, 20.1 and 14.3 kDa, respectively, from
top to bottom.
[0069] FIG. 3 shows the enzymatic activity curve at different pH
values. .diamond-solid. indicates enzymatic activity in NaAc
buffer; .box-solid. indicates enzymatic activity in
NaH.sub.2PO.sub.4 buffer; .tangle-solidup. indicates enzymatic
activity in Tris-HCl buffer.
[0070] FIG. 4 indicates pH tolerance of Xyl7. .diamond-solid.
indicates enzymatic activity in NaH.sub.2PO.sub.4 buffer, pH 6.5;
.tangle-solidup. indicates enzymatic activity in NaH.sub.2PO.sub.4
buffer, pH 7.0; * indicates enzymatic activity in NaH.sub.2PO.sub.4
buffer supplemented with 70 mM mercaptoethanol, pH 7.0; x indicates
enzymatic activity in NaH.sub.2PO.sub.4 buffer, pH 7.5.
[0071] FIG. 5 shows the enzymatic activity curve of Xyl7 under
different temperatures.
[0072] FIG. 6 shows the tolerance of Xyl7 under different
temperature. .diamond-solid. indicates enzymatic activity under
45.degree. C.; .box-solid. indicates enzymatic activity under
50.degree. C.; .tangle-solidup. indicates enzymatic activity under
55.degree. C.; x indicates enzymatic activity in NaH.sub.2PO.sub.4
buffer supplemented with 70 mM mercaptoethanol under 50.degree.
C.
[0073] FIG. 7 shows TLC analysis on the hydrolyzed substrates
obtained by hydrolyzing birch xylan by Xyl7 under different
conditions. 1: standard, wherein X1 is xylose, X2 is xylobiose, and
X3 is xylotriose; 2: control (1% birch xylan that was not treated
by the enzyme); 3: hydrolyzed product obtained after treatment for
10 minutes; 4: hydrolyzed product obtained after treatment for 1
hour; 5: hydrolyzed product obtained after treatment for 4 hours;
6: xylan was finally hydrolyzed to xylo-oligosaccharide after
treating for 12 hours, which mainly includes xylobiose, xylotriose
and xylotetraose.
[0074] FIG. 8 shows the residual enzymatic activity of Xyl7 tested
after being placed for two hours under pH8 and pH9 at 55.degree.
C., 60.degree. C. and 70.degree. C., respectively.
[0075] FIG. 9 shows the relative residual activity of Xyl7 tested
after being incubated under pH4 and pH5 at 37.degree. C. for 15,
30, 45 and 60 minutes.
[0076] FIG. 10 shows the result obtained by the first round of
screening on the random mutation library from directed evolution of
Xyl7.
[0077] FIG. 11 shows the test result on the thermal stability of
the mutants obtained from the first round of screening in the
directed evolution.
[0078] FIG. 12 shows the result obtained from the second round of
screening on the random mutation library and the screening result
from saturation mutation at position 223.
[0079] FIG. 13 shows the test result on thermal stability of the
mutants having combined mutation at position 223 at 55.degree. C.
(the upper panel) and 60.degree. C. (the lower panel).
[0080] FIG. 14 shows the SDS-PAGE diagram obtained after expression
of the fragment of Xyl7 consisting of residues 19-272 and
purification of the expressed product. Lane 1: total proteins
obtained after cell lysing; lane 2: precipitate from cell lysate;
lane 3: supernatant of cell lysate; lane 4: 60 mM imidazole eluent;
lane 5: 100 mM imidazole eluent; lane 6: 200 mM imidazole eluent;
lane 7: 500 mM imidazole eluent; lane M: protein Marker, with a
molecular weight of 200, 116, 97.2, 66.4, 44.3, 29, 20.1 and 14.3
kDa, respectively, from top to bottom.
[0081] FIG. 15 shows the test result on thermal stability of the
mutants of the fragment of Xyl7 consisting of residues 19-272,
which have mutation at position 223, at 55.quadrature. (the upper
panel) and 60.quadrature. (the lower panel).
[0082] FIG. 16 shows the protein expression result of residue
19-267 of Xyl7, named Xyl7R2. Lane 1: total proteins obtained after
cell lysing; lane 2: precipitate from cell lysate; lane 3:
supernatant of cell lysate; lane 4: 60 mM imidazole eluent; lane 5:
100 mM imidazole eluent; lane 6: 200 mM imidazole eluent; lane 7:
500 mM imidazole eluent; lane M: protein Marker.
SPECIFIC MODE FOR CARRYING OUT THE INVENTION
[0083] After a large scale of screening, the present inventors
firstly isolated a novel xylanase, preferably,
endo-1,4-.beta.-xylanase, from the intestinal tract metagenome of
termite, which exhibited high enzymatic activity, could be used in
a wide range of temperature and pH, and had good application in
industrial production. The amino acid sequence of the xylanase
shows a highest similarity of 69% to the known amino acid
sequences, demonstrating that it is a new protein. The xylanase of
the present disclosure exhibits a very high enzymatic activity,
with a specific activity of higher than 6340 U/mg at pH7.0 and
50.quadrature..
[0084] Aiming to overcome the defects present in the gene screening
in traditional microbiology, metagenomics was developed. By
directly extracting microbial nucleic acid from the environment and
constructing metagenomic library (BAC, fosmid or plasmid library),
defects caused by isolation and culture technology of microbe could
be effectively overcome, thereby obtaining genetic information of
all populations in the biocoenosis. The genetic information
includes genes participating in bioconversion in the biocoenosis.
Expression of the enzymes encoded by these genes in a clonal host
could be used to screen various enzymes associated with
bioconversion, thereby possibly obtaining a lot of new genes.
[0085] It is well known that xylanases of different natures are
required in different applications, and xylanases of different
natures may possibly be present in microbial genome in different
ecological environments in the nature. Termite is an important
organism which degrades lignocellulose in the natural ecosystem.
Its symbiotic microbial biocoenosis in gut plays a key role in
substance conversion of cellulose. Considering the high efficiency,
uniqueness and complexity of the gut ecosystem of termite, termite
was used as the system for screening xylanase by metagenomic
technology in the present disclosure. By investigating the genes
and enzymes from termite, we finally found the xylanase of the
present disclosure.
[0086] The xylanase of the present disclosure can act on the
interior of the long chain of xylan molecule, acting on the
.beta.-1,4-xylosidic linkage within the backbone of xylan to
hydrolyze the large polyxylan to simple sugar, such as
xylo-oligosaccharide.
[0087] As used herein, the term "the polypeptide of the present
disclosure", "the protein of the present disclosure", "the xylanase
of the present disclosure", "Xyl7 protein", "Xyl7 polypeptide" or
"xylanase Xyl7" may be used interchangeable, all referring to the
protein or polypeptide having the amino acid sequence (SEQ ID NO:2,
its fragments or mutated forms or derivatives) of xylanase Xyl7.
They include the xylanase Xyl7 containing or not containing the
starting methionine.
[0088] As used herein, the terms "the gene of the present
disclosure", "xyl7 gene" and "xyl7" refer to the polynucleotide
having the gene sequence encoding xylanase (SEQ ID NO:1, its
mutated forms or derivatives).
[0089] As used herein, the "simple sugar" is generally a collective
term of a kind of sugars formed after cleaving the xylan chain,
which have a chain length less than that before cleavage. For
example, the simple sugar contains 1-50 xyloses, preferably, 1-30
xyloses, more preferably, 1-15 xyloses, more preferably, 1-10
xyloses, such as 2, 3, 4, 5, 6, 7, 8, 9 xyloses. The simple sugar
includes xylo-oligosaccharide, xylobiose, xylotriose, xylotetraose,
etc. In the present disclosure, the simple sugar also refers to
xylo-oligosaccharide or small-amount xyloses.
[0090] As used herein, the "xylose" refers to a monosaccharide
containing 5 carbon atoms, with a molecular formula of
C.sub.4H.sub.9O.sub.4CHO. The "xylan" is a polymer of "xylose".
[0091] As used herein, "isolated" refers to that a substance is
isolated from its original environment (if it is a natural
substance, the original environment is the natural environment).
For example, the polynucleotide and polypeptide in a natural state
within a living cell are not isolated or purified. However, if the
polynucleotide or polypeptide is separated from other substances
simultaneously present in the natural state, it is isolated and
purified.
[0092] As used herein, the "isolated Xyl7 protein or polypeptide"
refers to that the Xyl7 polypeptide is essentially free of other
proteins, lipids, sugars or other substances that are naturally
associated with the polypeptide. The skilled artisan can use the
standard protein purification technology to purify Xyl7 protein.
The substantially pure polypeptide could produce a single main band
on the non-reduced polyacrylamide gel. The purity of Xyl7
polypeptide can be used for analysis of amino acid sequence.
[0093] The polypeptide of the present disclosure may be a
recombinant polypeptide, a natural polypeptide, or a synthetic
polypeptide, preferably a recombinant polypeptide. The polypeptide
of the present disclosure may be a natural, purified product, or
may be chemically synthesized product, or may be produced from
prokaryotic host or eukaryotic host, such as bacterium, yeast,
higher plant, insect and mammal cell, by recombinant technology.
According to the host used in the recombinant production protocol,
the polypeptide of the present disclosure may be glycosylated, or
non-glycosylated. The polypeptide of the present disclosure may
also include or not include the starting methionine residue.
[0094] The present disclosure also includes the fragments,
derivatives and analogs of the Xyl7 protein. As used herein, the
terms "fragment", "derivative" and "analog" refer to the
polypeptide substantially retaining the same biological function or
activity as that of the native Xyl7 protein. The fragment,
derivative or analog of the polypeptide of the present disclosure
may be (i) a polypeptide with one or more conservative or
non-conservative amino acid residue(s), preferably conservative
amino acid residue, being substituted, wherein the substituted
amino acid residue may or may not be encoded by genetic codes; or
(ii) a polypeptide with one or more amino acid residue(s) being
substituted by a substituent group, or (iii) a polypeptide formed
by fusing the mature polypeptide with another compound, such as the
compound for extending the half life of the polypeptide, such as
polyethylene glycol, or (iv) a polypeptide formed by fusing an
additional amino acid sequence, such as a leader sequence, a
secretion sequence, a sequence for purifying the present
polypeptide, or proteinogen sequence, or an IgG fragment of an
antigen, with the present polypeptide. According to the present
disclosure, these fragments, derivatives and analogs fall within
the scope known to the skilled in the art.
[0095] In the present disclosure, the term "Xyl7 polypeptide"
refers to the polypeptide set for in SEQ ID NO:2, or active
fragments and active derivatives thereof, which have Xyl7 protein
activity. In a preferred embodiment, the active fragment may be a
fragment containing the conservative domain of SEQ ID NO:2 (amino
acids 32-256). For example, the fragment may be a fragment
containing amino acid residues 19-267 of SEQ ID NO:2. In other
embodiments, the active fragment may be a fragment containing amino
acid residues 19-272 of SEQ ID NO:2. For example, the fragment may
be amino acids 19-450, 19-300, etc., of SEQ ID NO:2, preferably
amino acids 19-267 and 19-272 of SEQ ID NO:2. Additionally, for
example, mutation can be present outside the conservative domain of
SEQ ID NO:2 (amino acids 32-256). In a preferred embodiment,
mutation is taken place outside, such as, amino acid residue 19 to
amino acid residue 267 or 272 of SEQ ID NO:2. Mutation can be 1-20,
such as 1-10, preferably 1-5 or 1-3 deletion, substitution and
insertion of amino acid. The term also includes the mutated forms
of SEQ ID NO: 2 or amino acids 19-272 or 19-267 of SEQ ID NO:2,
which have the same function as Xyl7 protein. These mutated forms
include, but is not limited to, deletion, insertion and/or
substitution of one or more (generally 1-50, preferably 1-30, more
preferably 1-20, more preferably 1-10, most preferably 1-5) amino
acids, and addition or deletion of one or more (generally less than
20, preferably less than 10, more preferably less than 5) amino
acids at the C terminus and/or N terminus. For example, in the
field of the art, substitution with amino acid having close or
similar property generally will not change the function of protein.
For example, addition or deletion of one or more amino acids at the
C terminus and/or N terminus generally will not change the function
of protein. Additionally, for example, the same catalytic function
as that of the intact protein can also be obtained even only the
catalytic domain of the protein is expressed while the carbohydrate
binding domain is not expressed. The mutated forms of the
polypeptide include homologous sequence, conservative mutant,
allelic variant, native variant, induced variant, protein encoded
by a DNA that can hybridize to xyl7 DNA under high or low stringent
condition, and polypeptide or protein obtained by utilizing an
antibody against the Xyl7 polypeptide. The present disclosure also
provides other polypeptides, such as a fusion protein comprising
the Xyl7 polypeptide or its fragment. In additional to the almost
full length polypeptide, the present disclosure also includes the
soluble fragments of the Xyl7 polypeptide. Generally, the fragment
contains at least about 10 continuous amino acids, generally at
least 30 continuous amino acids, preferably at least 50 continuous
amino acids, more preferably at least 80 continuous amino acids,
most preferably at least 100 continuous amino acids, of the Xyl7
polypeptide sequence.
[0096] The mutated forms of SEQ ID NO:2 or amino acids 19-272 or
19-267 of SEQ ID NO:2 of the present disclosure include, but is not
limited to, substitution mutation occurred at one or more positions
selected from the group consisting of 32, 37, 42, 80, 205, 219,
221, 222, 223, 228 and 386 of SEQ ID NO:2, or at one or more
positions corresponding to the following amino acid residues of SEQ
ID NO:2: 32, 37, 42, 80, 205, 219, 221, 222, 223, 228 and 386.
Amino acid used for substitution is not specially limited. In some
embodiments, the mutated sequence of the present disclosure may
contain one or more substitutions selected from the group
consisting of K32T, N37D, S42N, M80I, K205E, E219D, A221T, M222L,
K223M, K223E, K223T, K223C, K223S, K223G, K223L, T228S, and
A386S.
[0097] In some embodiments, the mutated forms of the present
disclosure include, but are not limited to, the sequences set for
in SEQ ID NO: 13, 15, 17, 19, 21, 23, 25, 27 and 29. The present
disclosure also includes the coding sequences of these mutated
polypeptides, which, for example, are the sequences set forth in
SEQ ID NO:12, 14, 16, 18, 20, 22, 24, 26 and 28.
[0098] Also provided in the present disclosure are analogs of the
Xyl7 protein or polypeptide. The difference between these analogs
and the native Xyl7 polypeptide may be the difference in amino acid
sequence or in modification that does not affect the sequence, or
both. These polypeptides include native or induced genetic
variants. Induced variants may be obtained via various
technologies, such as via radiation or exposure to mutagen to
produce random mutation or via site-directed mutagenesis or other
known molecular biological technique. Analogs further include those
having a residue different from the native L-amino acid, such as a
D-amino acid, and an amino acid that is not naturally occurring or
that is synthetic, such as .beta., .gamma.-amino acid. It should be
understood that the polypeptide of the present disclosure is not
limited to the above representative polypeptides listed above.
Modification that generally does not change the primary structure
includes in vivo or in vitro chemical derivative forms of the
polypeptide, such as acetylation or carboxylation. Modification
further includes glycosylation, such as the polypeptides produced
by glycosylation modification during its synthesis or processing or
further processing. This kind of modification can be accomplished
by exposing the polypeptide to the enzyme used for glycosylation,
such as the mammal glycosylase or deglycosylase. Modified forms
further comprise sequences with phosphorylated amino acid residue,
such as phosphotyrosine, phosphoserine and phosphothreonine. Also
included are polypeptides that are modified to increase its
anti-proteolytic property or to optimize solubility.
[0099] In the present disclosure, the "conservative variant
polypeptides of Xyl7 protein" refers to polypeptides with at most
20, preferably at most 10, more preferably at most 5, most
preferably at most 3 amino acids being replaced by amino acids
having close or similar amino acids, as compared to SEQ ID NO:2 or
amino acids 19-267 or 19-272 of SEQ ID NO:2. These conservative
variant polypeptides preferably are produced according to the amino
acid replacement indicated in Table 1.
TABLE-US-00001 TABLE 1 Initial Residue Representative Substitution
Preferred Substitution Ala (A) Val; Leu; Ile Val Arg (R) Lys; Gln;
Asn Lys Asn (N) Gln; His; Lys; Arg Gln Asp (D) Glu Glu Cys (C) Ser
Ser Gln (Q) Asn Asn Glu (E) Asp Asp Gly (G) Pro; Ala Ala His (H)
Asn; Gln; Lys; Arg Arg Ile (I) Leu; Val; Met; Ala; Phe Leu Leu (L)
Ile; Val; Met; Ala; Phe Ile Lys (K) Arg; Gln; Asn Arg Met (M) Leu;
Phe; Ile Leu Phe (F) Leu; Val; Ile; Ala; Tyr Leu Pro (P) Ala Ala
Ser (S) Thr Thr Thr (T) Ser Ser Trp (W) Tyr; Phe Tyr Tyr (Y) Trp;
Phe; Thr; Ser Phe Val (V) Ile; Leu; Met; Phe; Ala Leu
[0100] The amino terminus or carboxyl terminus of the present Xyl7
protein may contain one or more polypeptide fragment(s) as a
protein tag. Any suitable tag can be used in the present
disclosure. For example, the tag may be FLAG, HA, HAL c-Myc,
Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, E, B, gE and
Ty1. These tags may be used in protein purification. Some tags and
their sequences are listed in Table 2.
TABLE-US-00002 TABLE 2 Tag Number of Residue Sequence SEQ ID NO:
Poly-Arg 5-6, generally 5 RRRRR 5 Poly-His 2-10, generally 6 HHHHHH
6 FLAG 8 DYKDDDDK 7 Strep-TagII 8 WSHPQFEK 8 C-myc 10 WQKLISEEDL
9
[0101] To allow the translated protein to be secretorily expressed,
such as secreted outside the cell, a signal peptide sequence, such
as the pelB signal peptide, etc., may be added at the terminus of
the Xyl7. The signal peptide may be cleaved during secretion of the
polypeptide from the cell.
[0102] The polynucleotide of the present disclosure may be in a DNA
or RNA form. The DNA form includes cDNA, genomic DNA or
artificially synthetic DNA. DNA may be single-stranded or
double-stranded. DNA may be a coding strand or a non-coding strand.
The coding sequence that encodes the mature polypeptide may be
identical to the coding sequence set forth in SEQ ID NO:1 or its
degenerate variant. As used herein, the "degenerate variant" in the
present disclosure refers to the nucleic acid sequence encoding the
protein of SEQ ID NO:2 but having differences in coding sequence
from the coding sequence shown in SEQ ID NO:1.
[0103] Polynucleotide encoding the mature polypeptide of SEQ ID
NO:2 includes the coding sequence that only encodes the mature
polypeptide; the coding sequence of the mature polypeptide and
various additional coding sequences; the coding sequence of the
mature polypeptide (and optionally additional coding sequences) and
non-coding sequence.
[0104] The term "polynucleotide encoding polypeptide" may be a
polynucleotide comprising a polynucleotide encoding the present
polypeptide, or further comprising additional coding sequence
and/or non-coding sequence.
[0105] Also contemplated in the present disclosure are variants of
the above polynucleotide, which encode polypeptides having the same
amino acid sequence as that of the present disclosure, or
fragments, analogs and derivatives thereof. The variants of the
polynucleotide may be a naturally occurring allelic variant or
non-naturally occurring variant. These nucleotide variants include
substitution variant, deletion variant and insertion variant. As
known in the art, the allelic variant is an alternative of
polynucleotide, which may contain substitution, deletion or
insertion of one or more nucleotide(s) but the function of the
encoded polypeptide will not be substantively changed.
[0106] The present disclosure also relates to the polynucleotides
hybridized to the above sequence and having at least 50%,
preferably at least 70%, more preferably at least 80% sequence
identity between two sequences. Specifically, the present
disclosure relates to the polynucleotides hybridizable to the
polynucleotide of the present disclosure under stringent condition.
In the present disclosure, the "stringent condition" refers to (1)
hybridizing and eluting at a relatively low ionic strength and a
relatively high temperature, such as 0.2.times.SSC, 0.1% SDS,
60.degree. C.; or (2) hybridizing in the presence of a denaturant,
such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll,
42.degree. C., etc.; or (3) hybridizing only when two sequences
having an identity of at least 90%, preferably 95% or more.
Additionally, the polypeptide encoded by the hybridizable
polynucleotide exhibit the same biological function and activity as
the mature polypeptide set forth in SEQ ID NO:2 or amino acids
19-267 of SEQ ID NO:2.
[0107] The present disclosure also relates to nucleic acid fragment
that hybridizes to the above sequence. As used herein, the "nucleic
acid fragment" contains at least 15 nucleotides, preferably at
least 30, more preferably at least 50, most preferably at least 100
nucleotides. The nucleic acid fragment may be used for amplifying
nucleic acid, such as PCR, to determine and/or isolate the
polynucleotide encoding Xyl7 protein.
[0108] Preferably, the present polypeptide and polynucleotide are
provided in an isolated form, more preferably, purified to a
homogeneous state.
[0109] The full length xyl7 nucleotide sequence or its fragment may
be obtained by PCR amplification, recombinant method or artificial
synthesis. For the PCR amplification, sequences of interest can be
obtained by amplification by using primers designed according to
the related nucleotide sequence disclosed in the present
disclosure, especially the sequence of the open reading frame, and
the commercially available cDNA library or a cDNA library prepared
according to the conventional method known in the art as template.
When the sequence is too long, two or multiple PCR amplification
should be done and then the fragments obtained from each
amplification can be linked together in proper order.
[0110] Once a sequence of interest is obtained, a large amount of
the sequences can be produced through a recombinant method.
Generally, the sequence is cloned into a vector and then the vector
is transferred into a cell. Sequence of interest could then be
isolated from the proliferative host cell via a conventional
method.
[0111] Additionally, the sequence of interest can be artificially
synthesized, especially when it is a short fragment. Generally,
many small fragments are firstly synthesized and then they are
linked together to obtain a long fragment.
[0112] Currently, the DNA sequences encoding the present proteins,
or their fragments or derivatives could be completely obtained
through chemical synthesis. The DNA sequence can then be introduced
into various existing DNA molecules, such as vectors, and cells
known in the art. Additionally, mutation can be introduced into the
protein sequence of the present disclosure via chemical
synthesis.
[0113] Preferably, method for amplification of DNA/RNA by PCR
technique is used to obtain the genes of the present disclosure.
Especially in the case that it is difficult to obtain the full
length cDNA from a library, RACE (RACE-cDNA, rapid amplification of
cDNA ends) is preferred. Primers used in PCR may be suitably
selected according to the sequence information disclosed in the
present disclosure and synthesized by the conventional method. The
amplified DNA/RNA fragment could be isolated and purified by a
conventional method, such as gel electrophoresis.
[0114] The present disclosure also relates to vectors containing
the present polynucleotide, host cells genetically engineered by
the vector or coding sequence of Xyl7 protein of the present
disclosure, and methods for producing the polypeptide of the
present disclosure via a recombinant technique.
[0115] The recombinant Xyl7 polypeptide may be expressed or
produced by utilizing the polynucleotide sequence of the present
disclosure via a conventional recombinant DNA technique. Generally,
the following steps are included:
[0116] (1) Transforming or transfecting suitable host cells with
the present polynucleotide (or variants thereof) encoding the Xyl7
polypeptide or the recombinant expression vector containing the
polynucleotide;
[0117] (2) Culturing the host cells in a suitable culture
medium;
[0118] (3) Isolating and purifying proteins from the culture medium
or cells.
[0119] In the present disclosure, the xyl7 polynucleotide sequence
may be inserted into a recombinant expression vector. The term
"recombinant expression vector" refers to the bacterial plasmid,
bacteriophage, yeast plasmid, plant cell virus, mammalian cell
virus such as adenovirus, retrovirus, or other vectors known in the
art. Any plasmid and vector can be used as long as they can
replicate and stabilize in the host. One important feature of an
expression vector is that it generally contains a replication
origin, a promoter, a marker gene and a translation control
element.
[0120] Methods well known by the skilled in the art can be used to
construct an expression vector that contains DNA sequence encoding
Xyl7 and suitable transcription/translation control signal. These
methods include in vitro recombinant DNA technique, DNA synthesis
technique, in vivo recombinant technique, etc. The DNA sequence may
be effectively linked to a suitable promoter in the expression
vector to direct mRNA synthesis. Representative examples of
promoter include lac or trp promoter from E. coli, PL promoter from
bacteriophage .lamda.; eukaryotic promoter, including CMV immediate
early promoter, HSV thymidine kinase promoter, early and late SV40
promoter, LTRs of retrovirus, and some other promoters known to be
able to control expression of a gene in prokaryotic or eukaryotic
cell or its virus. The expression vector further comprises ribosome
bind site for initiating translation and transcription
terminator.
[0121] Additionally, the expression vector preferably contains one
or more selectable marker gene(s) for providing phenotypic
characteristics for the transformed host cell, such as
dihydrofolate reductase, neomycin resistance gene and green
fluorescent protein (GFP) used in culture of eukaryotic cell, or
tetracycline or ampicillin resistance gene used for E. coli.
[0122] Vector containing the above suitable DNA sequence and
suitable promoter or control sequence can be used to transform a
suitable host cell to allow it to express the protein.
[0123] Host cell may be prokaryotic cell, such as bacterial cell;
or lower eukaryotic cell, such as yeast cell; or a higher
eukaryotic cell, such as mammal cell. Representative examples
include E. coli, Streptomyces; cells from Salmonella typhimurium;
fungal cell, such as yeast; plant cell; insect cell, such as
Drosophila melanogaster S2, or Sf9; animal cell, such as CHO, COS,
293 cell, or Bowes melanoma cells.
[0124] When expressing the polynucleotide of the present disclosure
in a higher eukaryotic cell, insertion of an enhancer sequence in
the vector will improve the transcription. Enhancer may be a
cis-acting factor of DNA, generally containing 10 to 300 bps, which
acts on the promoter to improve the gene transcription. Examples of
enhancer include SV40 enhancer, which contain 100 to 270 bps and
locate at the later side of the replication origin; polyoma virus
enhancer and adenovirus enhancer, which locate at the later side of
the replication origin, etc.
[0125] It is well known for the skilled in the art to select
suitable vector, promoter, enhancer and host cell.
[0126] Transformation of host cell with recombinant DNA can be
performed through the conventional technique known in the art. When
the host is a prokaryotic organism, such as E. coli, competent
cells that can adsorb DNA can be harvested after exponential phase
and then treated by CaCl.sub.2 method. All steps are known in the
art. MgCl.sub.2 may be used in another method. When necessary,
transformation can be performed by electroporation. When the host
is a eukaryotic organism, the following DNA transfection methods
can be used: calcium phosphate coprecipitation method and
conventional mechanical method, such as microinjection,
electroporation, and liposome packaging, etc.
[0127] The resultant transformant may be cultured by a conventional
method to express the polypeptide encoded by the present gene.
According to the used host cell, the culture medium used for
culture may be selected from various conventional culture mediums.
Cultivation is performed under conditions suitable for growth of
host cell. When the host cells grow and reach to a suitable cell
density, the selected promoter is induced by a suitable method,
such as temperature conversion or chemical induction, and the cells
are further cultured for a period of time.
[0128] In the above-mentioned methods, the recombinant polypeptide
may be expressed within the cell, on the cell membrane, or secreted
outside the cell. When necessary, the recombinant protein may be
isolated and purified via various isolation methods by utilizing
its physical, chemical or other properties. These methods are known
to the skilled artisan. Examples of these methods include, but are
not limited to, conventional renaturation treatment, treatment by
protein precipitant (salting out), centrifugation, breakage of
bacterium through osmosis, super processing, super centrifugation,
molecular screen chromatography (gel filtration), adsorption
chromatography, ion exchange chromatography, high-performance
liquid chromatography (HPLC) and other liquid chromatography
techniques, and combination thereof.
[0129] The use of the recombinant Xyl7 includes, but is not limited
to, hydrolyzing xylan, cleaving the long xylan chain into a short
chain, or forming simple sugar. Most known xylanases exhibit an
activity lower than the activity of the present Xyl7 enzyme. It is
expected that the enzymatic activity of Xyl7, or its applicable pH
range, temperature range and thermal stability may be further
improved by modification of its protein molecule. Thus, Xyl7 has a
promising application prospect. Some techniques for modifying
protein are well known to the skilled in the art. Thus, xylanases
formed by modifying Xyl7 by these techniques are also contemplated
in the present disclosure.
[0130] The expressed recombinant Xyl7 protein is used to screen a
library of polypeptide, which may find out polypeptide molecules
that may have therapeutic value and can inhibit or stimulate the
function of the Xyl7 protein.
[0131] In another aspect, the present disclosure also comprises
polyclonal and monoclonal antibodies, especially monoclonal
antibodies, specifically against the polypeptide encoded by Xyl7
DNA or its fragment. As used herein, "specificity" refers to that
antibody can bind to the product of Xyl7 gene or its fragment.
Preferably, it refers to that the antibody can bind to the product
of xyl7 gene or its fragment but does not recognize or bind to the
other irrelevant antigen molecules. In the present disclosure,
antibody comprises the molecules which can bind to and inhibit the
Xyl7 protein and those not affecting the function of the Xyl7
protein. The present disclosure also comprises the antibodies which
can bind to the modified or un-modified product of the Xyl7
gene.
[0132] The antibody of the present disclosure may be prepared by
various techniques known to the skilled artisan. For example, the
purified product of the Xyl7 gene or its antigenic fragment may be
administered to animal to induce production of polyclonal antibody.
Similarly, cell expressing the Xyl7 protein or its antigenic
fragment may be used to immunize animal to produce the antibody.
The antibody of the present disclosure may be a monoclonal
antibody. Such monoclonal antibody may be prepared by hybridoma
technique (see Kohler et al., Nature 256; 495, 1975; Kohler et al.,
Eur. J. Immunol. 6: 511, 1976; Kohler et al., Eur. J. Immunol. 6:
292, 1976; Hammerling et al., In Monoclonal Antibodies and T Cell
Hybridomas, Elsevier, N. Y., 1981). Antibody against the Xyl7
protein may be used to detect the Xyl7 protein in a sample.
[0133] Substances that interact with Xyl7 protein, such as
inhibitor, agonist or antagonist, etc., may be screened via various
conventional screening methods by utilizing the present
protein.
[0134] The present disclosure may also provide a composition,
comprising an effective amount of the present Xyl7 polypeptide and
a bromatologically acceptable or industrially acceptable carrier.
Such carrier includes, but is not limited to, water, buffer,
glucose, water, glycerol, ethanol, and combination thereof. The
skilled in the art can determine the effective amount of the Xyl7
polypeptide in the composition according to the actual use of the
composition.
[0135] Substances for regulating the activity of the present Xyl7
enzyme may be added into the composition. Any substances capable of
improving the enzymatic activity can be used. Preferably, substance
which improves the activity of the present Xyl7 enzyme is selected
from the group consisting of K.sup.+, Mn.sup.2+, or materials that
could be hydrolyzed to form K.sup.+ or Mn.sup.2+ after adding to
the substrate, such as KCl and manganese sulfate. Additionally,
some substances may decrease the enzymatic activity, which is
selected from the group consisting of Ni.sup.2+, Zn.sup.2+,
Fe.sup.3+ and EDTA, or materials that could be hydrolyzed to form
Ni.sup.2+, Zn.sup.2+ or Fe.sup.3+ after adding to the
substrate.
[0136] After obtaining the present Xyl7 enzyme, the skilled artisan
can conveniently use the enzyme to hydrolyze substrate, especially
xylan, according to the teaching of the present disclosure. As a
preferred embodiment of the present disclosure, a method for
forming simple sugar are provided, which comprises treating the
substrate to be hydrolyzed with the present Xyl7 enzyme, wherein
the substrate includes birch xylan and beech xylan, etc. Generally,
the substrate to be hydrolyzed is treated by the Xyl7 enzyme under
pH 3.5-10. Generally, the substrate to be hydrolyzed is treated by
the Xyl7 enzyme under 30-80.degree. C. Preferably, K.sup.+,
Mn.sup.2+, or materials that could be hydrolyzed to form K.sup.+ or
Mn.sup.2+ after adding to the substrate is added during treating
with the Xyl7 enzyme.
[0137] In one embodiment of the present disclosure, an isolated
polynucleotide is provided, which encodes a polypeptide having an
amino acid sequence of SEQ ID NO:2. The polynucleotide of the
present disclosure is isolated from the Fosmid library constructed
from the gut system of termite. Its sequence is set forth in SEQ ID
NO:1, with a full length of 1518 bases. It encodes the Xyl7 protein
(SEQ ID NO:2) with a full length of 505 amino acids. In the
sequence of Xyl7 protein (SEQ ID NO:2), amino acids 32-256, from
the amino terminus, is the conservative domain of the Glycosyl
Hydrolase Family 11. The Xyl7 protein has a similarity of 69% to
the known amino acid sequences, demonstrating that it is a new
endo-1,4-.beta.-xylanase.
[0138] As demonstrated by experiments, the present
endo-1,4-.beta.-xylanase exhibit a very high xylanase activity, a
wide applicable pH range and wide applicable temperature range.
Thus, it has a promising application prospect.
[0139] The present disclosure also provides a polypeptide having an
improved thermal stability, which is derived from the original
polypeptide and exhibits xylanase activity and significantly
improved thermal stability. The original polypeptide is preferably
the polypeptide the amino acid sequence of which is set forth in
SEQ ID NO:2 or its fragment that comprising amino acids 19-267 or
19-272. Preferably, the polypeptide having an improved thermal
stability at least contains a substitution mutation at the position
corresponding to amino acid residue 32 or 223 of SEQ ID NO:2.
Preferred mutations include K32T, K223E, K223C, K223S, or
combination thereof. More preferably, the mutation is a combination
of K32T with K223C, or a combination of K32T with K223S.
[0140] Also provided in the present disclosure is a method for
increasing the thermal stability of a polypeptide, comprising
mutating the amino acid of the xylanase polypeptide at the position
corresponding to amino acid residue 32 and/or 223 of SEQ ID NO:2 to
obtain a xylanase having an improved thermal stability. The
xylanase may be other xylanases known in the art. In some
embodiments, the xylanase is the xylanase disclosed in the subject
application. Specifically, the method comprises mutating the amino
acid at amino acid residue 32 or 223 of SEQ ID NO:2 or its active
fragments.
[0141] As used herein, improvement of thermal stability is intended
to mean that the reduction degree of activity of a polypeptide is
lower than that of the wild type polypeptide (the starting
polypeptide) after treating at a temperature, such as 15-90.degree.
C., preferably 30-60.degree. C., more preferably 50-55.degree. C.,
such as 50.degree. C. or 55.degree. C. a period of time, as
compared to the activity before treating at that temperature. In
other words, the activity retained by the polypeptide after
treatment is relatively high. Substrate used in the treatment for
thermal stability may be the specific substrate of the xylanase. In
the present disclosure, the substrate may be, for example, birch
xylan and beech xylan. The pH value used in the treatment is
generally in a range of 3-12, preferably 5.5-10, more preferably
about 7.0.
[0142] Additionally, it should be understood that the above
polypeptides having an improved thermal stability and the method
for increasing the thermal stability of a polypeptide may be
modified by the skilled artisan within a certain range.
Modifications, such as addition, reduction or deletion of amino
acid in addition to mutation at amino acid residue 32 or 223 of SEQ
ID NO:2, or addition of a signal peptide, do not affect the claims
of the present disclosure. If the modifications relate to amino
acid at position corresponding to amino acid residue 32 or 223 of
SEQ ID NO:2, then the modifications shall fall within the scope of
the subject description and claims.
[0143] The invention will be further illustrated by making
reference to the following specific examples. It should be
understood that these examples are only for illustrating the
invention, but not for limiting the scope of the invention. For the
experiments the specific conditions of which are not specifically
indicated, they generally were performed according to the
conditions described in Sambrook, et al., Molecular Cloning: A
Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,
1989), or according to the conditions recommended by the
manufacturer. Unless otherwise indicated, the percentage and part
are calculated by weight.
[0144] Unless otherwise defined, all professional and scientific
terms used herein have the same meanings well known to the skilled
artisan. Additionally, any method and material similar to or
equivalent to the contents disclosed herein can be used in the
present disclosure. The preferred embodiments and materials
described herein are merely for exemplary purpose.
Example 1
Isolation of Endo-1,4-.beta.-Xylanase and its Coding Gene
[0145] The positive clone of xylanase was screened from the
metagenomics library of the microorganisms in termite gut by
utilizing metagenomic technique through a conventional method. The
plasmid DNA of the clone was extracted and subjected to 454
high-throughput sequencing. The sequences were ligated to obtain a
complete Fosmid sequence. ORF was found by DNAStar software.
GenBank database was searched by BlastP of NCBI
(http://www.ncbi.nlm.nih.gov) to obtain a new gene encoding
endo-1,4-.beta.-xylanase, which had the nucleotide sequence set
forth in SEQ ID NO:1, named Xyl7. Nucleotides 1-1518 from the 5'
end of SEQ ID NO:1 is the open reading frame (ORF) of Xyl7.
Nucleotides 1-3 from the 5' end of SEQ ID NO:1 is the starting
codon ATG of the Xyl7 gene, and nucleotides 1516-1518 from the 5'
end of SEQ ID NO:1 is the termination codon TAA of the Xyl7
gene.
[0146] The Xyl7 gene of endo-1,4-.beta.-xylanase encodes a protein
Xyl7 containing 505 amino acids, which contains the amino acid
sequence set forth in SEQ ID NO:2. The theoretical molecular weight
of the protein, as predicted by software, is 51.9 kDa and the
isoelectric point (pI) is 8.87. Amino acids 32-256 from the amino
terminus of SEQ ID NO:2 is the conservative domain of the Glycosyl
Hydrolase Family 11(GH 11).
[0147] After identification, Xyl7 could act on the internal
.beta.-1,4-xylosidic linkage of the backbone of birch xylan or
beech xylan in an endo-cleavage and highly efficient manner. When
the action time was relatively short (10 minutes), the large
polyxylan was preliminarily hydrolyzed to oligoxylan and when the
action time was relatively long (12 hours), the polyxylan was
finally hydrolyzed to xylo-oligosaccharide, mainly including
xylobiose, xylotriose and xylotetraose.
[0148] Xyl7 showed a highest homology of 69% to the endo-xylanase
having known sequence after comparison, demonstrating that it was a
new endo-1,4-.beta.-xylanase.
Example 2
Expression of Xyl7 in E. coli
[0149] 1. Construction of Recombinant Expression Vector
[0150] The predicted ORF coding gene of endo-1,4-.beta.-xylanase
was amplified by PCR from the screened xylanase positive clone. The
forward primer was 5' GAGACTCCATATGCAAGGTCCCACATGGACT 3' (SEQ ID
NO: 3), with Nde I recognition site (CATATG) added at its 5' end.
The reverse primer was 5' CGGAATTCTTACCTCACCATAACCCT 3' (SEQ ID NO:
4), with EcoR I recognition site (GAATTC) added at its 5' end.
[0151] The PCR product was purified and digested by Nde I and EcoR
I enzymes. The DNA fragment obtained after enzyme digestion was
recovered by Axgen PCR Product Column Recovery Kit and ligated with
pET-28a vector (Novagen) recovered after digested overnight by the
same two enzymes by T4 DNA ligase at 16.quadrature. to produce the
recombinant expression vector pET 28a-Xyl7. The N terminus of the
expressed product had a His tag (6.times.His-Tag) provided by the
expression vector, which facilitated the subsequent
purification.
[0152] 2. Expression of the Xyl7 Gene in E. coli BL21(DE3) and
Purification of the Expressed Product
[0153] (1) Expression of Xyl7
[0154] The above-constructed plasmid pET 28a Xyl7 was transformed
into E. coli BL21(DE3). Five monoclones were picked up from the
resultant BL21(DE3)/pET28a-Xyl7 transformants and inoculated into
LB culture liquid containing ampicillin. After culturing in a
shaker for a short period, the positive clones were identified by
PCR by directly using the bacterial liquid as template and by using
the T7 promoter primer (cat. no. 69348-3) and T7 terminator primer
(cat. no. 69337-3) for amplifying the vector. Results were shown in
FIG. 1, in which target fragments were amplified from all five
monoclones.
[0155] E. coli BL21 (DE3)/pET28a-Xyl7 was inoculated in LB culture
liquid containing 100 .mu.g/ml ampicillin and cultured overnight at
37.degree. C., 200 rpm. One milliliter of culture liquid was
inoculated to 100 ml LB culture liquid and cultured at 37.degree.
C., 200 rpm until (Moo reached 0.6-0.8. After cooling, 80 .mu.M
IPTG were added and cultivation was continued at 24.degree. C., 200
rpm for 16 hours. Thallus was recovered by centrifugation. The
recovered thallus was suspended by a lysis buffer
(NaH.sub.2PO.sub.4 50 mmol/L, NaCl 300 mmol/L, pH7.4). After
breaking the cell by ultrasonic wave, the supernatant was collected
by centrifugation, which was a crude enzyme solution.
[0156] Ni-NTA Column (Qiagen) was used to purify the crude enzyme
solution. The wash buffer used during purification contained
NaH.sub.2PO.sub.4 50 mmol/L, NaCl 300 mmol/L, pH7.0. The elution
buffer containing different concentrations of imidazole (20, 40,
60, 100, 200 and 500) contained NaH.sub.2PO.sub.4 50 mmol/L, NaCl
300 mmol/L, imidazole 20-500 mmol/L, pH 7.0. The protein SDS-PAGE
electrophoresis was performed by using 5 .mu.l elution solutions.
Results were shown in FIG. 2, in which lane 1 indicated the
supernatant of cell lysate; lane 2 indicated 20 mM imidazole
eluent; lane 3 indicated 40 mM imidazole eluent; lane 4 indicated
60 mM imidazole eluent; lane 5 indicated 100 mM imidazole eluent;
lane 6 indicated 200 mM imidazole eluent; and lane 7 indicated 500
mM imidazole eluent. From FIG. 2, the target protein was eluted in
a great amount when eluted by 200 mM imidazole and a single bank
was observed after electrophoresis, indicating that target protein
of high purity was obtained. All eluents containing the target
protein were pooled and subjected to concentration and dialysis by
vivaspin 6 ultrafiltration tube from GE (10 Kd interception value)
and at the same time a replacement buffer containing 20 mM
NaH.sub.2PO.sub.4, pH 7.4 was used to remove imidazole.
Example 3
Analysis on the Zymological Property of the Recombinant Xyl7
Protein
[0157] Enzymatic activity of the endo-1,4-.beta.-xylanase was
tested by a DNS method as follows:
[0158] (1) Preparation of DNS
[0159] 10 g NaOH were weighed and dissolved in about 400 ml
ddH.sub.2O. 10 g dinitrosalicylic acid, 2 g phenol, 0.5 g anhydrous
sodium sulfite and 200 g potassium sodium tartrate tetrahydrate
were weighed and dissolved in about 300 ml ddH.sub.2O. The two
solutions were mixed, diluted to 1 liter and preserved in dark.
[0160] (2) Preparation of Standard Curve
[0161] Nine thin-wall centrifuge tubes were loaded with the xylose
standard sample prepared according to the xylose stock volume and
pure water volume described in Table 3. The concentration of the
xylose stock was 10 mg/ml.
TABLE-US-00003 TABLE 3 Number of standard sample 1 2 3 4 5 6 7 8 9
Content of xylose 0 10 20 30 40 70 80 120 150 (.mu.g) Volume of
xylose 0 1 2 3 4 7 8 12 15 stock (.mu.l) Volume of pure 100 99 98
97 96 93 92 88 85 water (.mu.l)
[0162] 100 .mu.l DNS were added into each of the above standard
samples. The mixtures were subjected to boiled water bath for 5
minutes for developing color. Absorbance value at 540 nm was
detected by a microplate reader. Standard sample 1 was a blank
control. The absorbance value of the blank control was subtracted
from that of each sample and then the standard curve was
plotted.
[0163] (3) Detection of Standard Enzymatic Activity
[0164] In a 100 .mu.l reaction system, birch xylan was added to a
final concentration of 1% (w/w), and
Na.sub.2HPO.sub.4/NaH.sub.2PO.sub.4 buffer (pH7.0) was added to a
final concentration of 100 mM. A suitable amount of enzyme solution
diluted by the abovementioned buffer was added to the reaction
system for reaction at 50.quadrature. for 10 minutes. 100 .mu.l DNS
were added to stop the reaction. For the control, 100 .mu.l DNS
were firstly added to the above reaction system before adding the
enzyme solution. The reaction mixtures were subjected to a boiled
water bath for 5 minutes to develop color. Absorbance value at 540
nm was detected by a microplate reader. After subtracting the
absorbance value of the control from that of the sample, the
enzymatic activity unit (U) was calculated based on the standard
curve.
[0165] Definition of enzymatic activity unit (U): 1U refers to the
amount of enzyme required for catalytically hydrolyzing xylan to
produce 1 .mu.mol xylose.
[0166] Definition of specific activity unit: enzymatic activity of
1 mg protein (U/mg).
[0167] Results showed that the specific activity of Xyl7 on beech
xylan was 6340 U/mg at pH7.0, 50.degree. C.
[0168] (4) Detection of the Optimum pH of Xyl7
[0169] Buffers having different pH values in the range of 3.5-10 in
a gradient of 0.5 unit were prepared, wherein NaAc with a final
concentration of 100 mM was used to prepare the buffers having a pH
in the range of 3.5-6.0, Na.sub.2HPO.sub.4/NaH.sub.2PO.sub.4 with a
final concentration of 100 mM was used to prepare the buffers
having a pH in the range of 6.0-8.0, and Tris-HCl with a final
concentration of 100 mM was used to prepare the buffers having a pH
in the range of 8.0-10.0. The enzyme solution was added into each
pH buffer system and the enzymatic activity was tested according to
the above standard enzymatic activity detection steps. Xyl7
exhibited a highest specific activity in the
Na.sub.2HPO.sub.4/NaH.sub.2PO.sub.4 buffer (pH7.0) at
50.quadrature.. This specific activity value was used as a
reference value and its relative activity was defined as 100%. The
relative activity of the enzyme obtained at each pH value was a
ratio between the specific activity of the enzyme at each pH value
and the reference value.
[0170] Results were shown in FIG. 3. The optimum pH of Xyl7 was
7.0. Xyl7 exhibited a relative activity of 50% or more in the pH
range of from 5.5 to 10, indicating that Xyl7 exhibited a
relatively broad reaction pH range and could be applicable in a
wide range of pH value.
[0171] (5) Detection on pH Tolerance of Xyl7
[0172] The enzyme solution was kept in buffers of different pH
values (6.5, 7.0 and 7.5) or at pH 7.0 with addition of 70 mM
mercaptoethanol at 50.degree. C. for different times (15 min, 30
min, 45 min, 60 min, 75 min). Enzymatic activity was tested
according to the above standard enzymatic activity detection steps
(enzymatic activity was tested after reacting at pH7.0, 50.degree.
C. for 10 minutes). The specific activity value of Xyl7 obtained
after storing at pH7.0, 50.degree. C. for 0 minute and reacting at
50.degree. C. for 10 minutes was used as a reference value, and its
relative activity was defined as 100%. The relative activity of the
enzyme obtained after storing in each buffer having different pH
values for different times was a ratio between the specific
activity value of the enzyme subjected to above treatment and the
reference value.
[0173] Results were shown in FIG. 4. Xyl7 could tolerate a wide
range of pH values. After storing in buffer having a pH of 6.5, 7.0
or 7.5 for 45 min, the enzyme, in all cases, retained 50% or more
of the highest activity.
[0174] (6) Detection on the Optimum Temperature of Xyl7
[0175] Enzymatic activity was detected according the above standard
enzymatic activity detection steps at pH 7.0 and a temperature in
the range of 25-80.degree. C. Results were shown in FIG. 5. The
optimum temperature of Xyl7 was in the range of 50-55.degree. C.,
with an activity at 50.quadrature. slightly higher than that at
55.quadrature.. Thus, the specific activity value of the enzyme at
50.quadrature. was used as a reference value and its relative
activity was defined as 100%. The relative activity of the enzyme
at each temperature was a ratio between the specific activity value
of the enzyme at each temperature and the reference value. Xyl7
could retain 50% or more of the highest activity in the range of
30-60.degree. C., indicating that it had a wide range of reaction
temperature.
[0176] (7) Detection on Temperature Tolerance of Xyl7
[0177] The Xyl7 enzyme solution was stored in a buffer having an
optimum pH 7.0 at different temperatures (55.degree. C., 50.degree.
C., 45.degree. C.) or at 50.degree. C. with addition of 70 mM
mercaptoethan for different times (15 min, 30 min, 45 min, 60 min,
75 min). Enzymatic activity was tested according to the above
standard enzymatic activity detection steps (enzymatic activity was
tested after reacting at pH7.0, 50.degree. C. for 10 minutes). The
enzyme solution which was not subjected to heat treatment was used
as a control. Its specific activity tested under pH 7.0, 50.degree.
C. was used as a reference value and its relative activity was
defined as 100%. The relative activity of the treatment group was a
ratio between the relative activity value obtained after storing at
different temperatures for different times (treatment conditions)
and the reference value. Results were shown in FIG. 6. The activity
of Xyl7 rapidly decreased to be less than 50% of the maximum
activity after storing at 55.degree. C. for 15 min, but slowly
decreased when storing at 50.degree. C. and 45.degree. C. After
storing at these temperatures for 45 min, the enzymatic activity
decreased to be less than 50% of the maximum activity. When 70 mM
mercaptoethan were added, the decrease rate of the enzymatic
activity was further reduced.
[0178] (8) Effect of Different Chemical Agents and Metal Ions on
the Enzymatic Activity of Xyl7
[0179] Various compounds were added into the reaction system to a
final concentration of 10 mmol/L. Enzymatic activity was tested
according to the above standard enzymatic activity detection steps.
The specific activity value of the enzyme without treated by any
chemical agent or metal ion was used as a reference value and its
relative activity was defined as 100%. Effect of different chemical
agents or metal ions on the activity of Xyl7 enzyme was exhibited
by relative activity, which was a ratio between the specific
activity value of the enzyme in an environment of the chemical
agent or metal ion and the reference value. The results were shown
in Table 4. K.sup.+, Mn.sup.2+, Cu.sup.2+ and Co.sup.2+ could
activate the Xyl7, with K.sup.+ and Mn.sup.2+ producing an increase
of about 20% for the activity of the enzyme. Ni.sup.2+, Zn.sup.2+,
Fe.sup.2+ and EDTA obviously inhibited Xyl7, all of which could
produce 70% or more of activity loss for the enzyme. Mg.sup.2+
showed no obvious action on Xyl7.
TABLE-US-00004 TABLE 4 Metal Ion or Chemical Agent (10 mM) Relative
Activity (%) PC 100 .+-. 1.29 K.sup.+ 125.6 .+-. 11.98 Mg.sup.2+
101.53 .+-. 3.02 Ca.sup.2+ 90.1 .+-. 12.82 Fe.sup.2+ 25.33 .+-.
0.46 Cu.sup.2+ 108.69 .+-. 2.99 Zn.sup.2+ 64.88 .+-. 1.36 Co.sup.2+
109.14 .+-. 3.45 Ni.sup.2+ 44.25 .+-. 4.98 Mn.sup.2+ 125.73 .+-.
7.8 Ba.sup.2+ 90.71 .+-. 1.94 Al.sup.3+ 77.68 .+-. 2.32 Fe.sup.3+
90.41 .+-. 3.36 EDTA 88.65 .+-. 1.62
[0180] (9) Hydrolysis of Xyl7 on Different Substrates
[0181] Various substrates with a final concentration of 2% (w/w)
were treated by a suitable amount of enzymes at pH7.0 and
50.quadrature. for 10 minutes. Enzymatic activity was tested
according to the above standard enzymatic activity detection steps.
Results were shown in Table 5. Xyl7 showed a strong specificity to
substrate and only exerted an obvious enzymatic activity on birch
xylan and beech xylan. No detectable enzymatic activity was found
for the other test substrates. This was consistent to the high
substrate specificity of xylanase of the GH11 Family.
TABLE-US-00005 TABLE 5 Substrate Specific Activity (U/mg) Beech
xylan 6340 .+-. 48 Birch xylan 4700 .+-. 57 Microcrystalline
cellulose powder 0 Carboxymethyl cellulose sodium 0 Laminarin 0
Barley dextran 0 Locust bean gum 0
[0182] (10) TLC Analysis on Hydrolyzed Products of Birch Xylan by
Xyl7
[0183] 1% (w/w) Birch xylan was treated by 15 U Xyl7 at pH7.0 and
50.quadrature. for 10 min, 1 h, 4 h, and 12 h, respectively, to
obtain the hydrolyzed products. Two products, each 5 .mu.l, were
subjected to TLC for identification. The standard samples were
xylose, xylobiose, and xylotriose. The developing agent comprised
ethyl acetate, acetic acid and water in a ratio of 2:1:1(V/V/V).
The chromogenic agent was a solution of 1 mL aniline, 1 g
diphenylamine and 5 mL 85% phosphoric acid dissolved in 50 mL
acetone.
[0184] Results were shown in FIG. 7. When the action time was
relatively short, the large polyxylan was preliminarily hydrolyzed
by Xyl7 to oligoxylan and when the action time was relatively long,
the polyxylan was hydrolyzed to xylo-oligosaccharide, mainly
including xylobiose, xylotriose and xylotetraose. If the enzyme was
excessive, the final hydrolyzed product was xylose. Xyl7 was
demonstrated to act on the internal .beta.-1,4-xylosidic linkage of
the backbone of xylan in an endo-cleavage manner.
[0185] (11) Use of Xyl7 in Pulp Bleaching
[0186] For pulp bleaching, the xylanase is required to have no
cellulase activity and to retain enzymatic activity at an
intermediate or high temperature (such as 50-70.degree. C. and in
an alkaline environment (such as pH8-9) for one to two hours.
Therefore, Xyl7 was treated at pH8 and pH9 and a temperature of
55.degree. C., 60.degree. C. and 70.degree. C., respectively for
two hours and its enzymatic activity was tested according to the
above standard enzymatic activity detection steps (enzymatic
activity was tested after reacting at pH7.0, 50.quadrature. for 10
minutes). The control was the un-treated enzyme solution. Its
specific activity value was tested under pH7.0 and 50.quadrature.
and used as a reference value and its relative activity was defined
as 100%. The residual enzymatic activity was calculated as a ratio
of the specific activity value of the enzyme obtained after various
treatments and the reference value.
[0187] Results were shown in FIG. 8. It was found that Xyl7 could
still retain a sufficiently high enzymatic activity for one to two
hours even at a high temperature of from 50-70.quadrature. and in
an alkaline environment of pH8-9. Thus, it could be used for pulp
bleaching.
[0188] (12) Use of Xyl7 as a Feed Additive
[0189] As a feed additive, xylanase is required to retain its
enzymatic activity in a pH environment of about 4 due to the acidic
environment in the stomach of livestock, such as pig, and retain
its enzymatic activity in a pH environment of about 6 due to the
weak acidic environment in the digestive tract of chicken.
Therefore, Xyl7 was tested for its residual enzymatic activity
after treated in pH4 or pH5 at a 37.degree. C. bath for 15, 30, 45
and 60 minutes. The residual enzymatic activity was a ratio between
the specific activity of the enzyme obtained after various
treatments and that of the un-treated enzyme.
[0190] Results were shown in FIG. 9. It was found that Xyl7 could
retain a sufficiently high enzymatic activity even in an acidic
environment of pH 4-5. Thus, it could be used as a feed
additive.
Example 4
Study on Property of Amino Acids 19-272 of Xyl7
[0191] A fragment of bases 58-801 (corresponding to amino acids
19-272 of the endo-1,4-.beta.-xylanase) was amplified by the same
method as described in Example 2 by using a forward primer (5'
TGAGACTCCATATGCAAGGTCCCACATGGACT 3', SEQ ID NO: 10, with a Nde I
recognition site CATATG added at its 5' end) and a reverse primer
(5' GCGGAATTCTTATGGCGTAGGCGTGGTGCC 3', SEQ ID NO: 11, with a EcoR I
recognition site GAATTC added at its 5' end). The fragment was
cloned into a recombinant expression vector pET 28a and the vector
was expressed in E. coli BL21(DE3). The expressed product, named
Xyl7R3 hereinafter, was purified and its enzymatic activity was
tested according to the same method as described in Example 3.
[0192] As shown in FIG. 14, the expression amount of amino acids
19-272 of Xyl7 (Xyl7R3) was obviously higher than that of Xyl7, and
target protein of high purity could be obtained. Additionally, the
specific activity of Xyl7R3 as detected by the standard enzymatic
activity detection steps described in Example 3 was 8775 U/mg,
demonstrating that it exhibited a comparable activity to the full
length protein. The optimum temperature and tolerance on
temperature of Xyl7R3 were almost identical to those of Xyl7.
Example 5
Directed Evolution of Xyl7
[0193] 1. Construction of Xyl7 Random Mutation Library
[0194] A random mutation library was constructed by error-prone
PCR. Error-prone PCR was conducted by using GeneMorph II Random
Mutagenesis Kit and according to the methods provided in the kit.
According to the method provided in the kit, 500 ng template DNA
was added when performing the error-prone PCR and the mutation rate
was adjusted to 1 mutation site per kb. The mutation library was
constructed by performing two cycles of error-prone PCR with a
library capacity of 40,000 for each cycle. The mutants obtained
from each screening were re-screened and some resultant mutation
sites were subjected to saturation mutation for each site.
[0195] 2. Screen and Thermal Stability Test of Mutants of Xyl7
Having Improve Thermal Stability
[0196] Transformants were picked up by sterile toothpick to a LB
liquid culture containing antibiotic and IPTG (in a final
concentration of 1 mM) contained within the wells of a 96-well
plate and cultured overnight at 37.degree. C. and 200 rpm. Thallus
was collected by centrifugation. 100 ul buffers having the optimum
reaction pH were added to re-suspend the thallus. Clone from each
well was divided into a control group and a treatment group, with
50 ul for each well. The control group was stored at 4.degree. C.
The treatment group was treated in a water bath having a suitable
temperature for 2 hours. After adding 2% xylan to each well, the
mixture was allowed to react under 37.degree. C. for 1 hour.
Enzymatic activity was detected according to the DNS method. After
treatment, the treatment group of the wild type clone retained an
enzymatic activity which was about 10.about.20% of its control
group. At this time the other clones could be screened to obtain
the mutants having an improved thermal stability as compared to the
wild type clone. The thermal stability of finally obtained mutants
was tested according to the method described in Example 3. The
overnight thallus was re-suspended and divided into two groups,
which were the control and treatment groups, respectively. The
control group was stored in 4.degree. C. refrigerator and the
treatment group was treated under specific temperatures for 2
hours. Then the enzymatic activity was detected. The residual
enzymatic activity of the treatment group was calculated as a
percentage of the enzymatic activity of the treatment group in
relative to that of the control group.
[0197] After testing the thermal stability of the wild type
sequence, it was found that, for the wild type sample, the
enzymatic activity of the treatment group obtained after treating
in a 52.5.degree. C. water bath for two hours was 10.about.20% of
that of the control group, which complied with the requirement on
screening. Thus, about 10,000 clones in the library were screened
under this condition and 17 transformants were obtained, the
treatment groups of which still retained 80% or more of the
enzymatic activity of their respective control groups after heat
treatment. To further verify the stability capacity of these
positive transformants to temperature, two experiments for
re-screening these clones were done. In the first experiment, the
heat treatment temperature was kept at 52.5.degree. C. but the
treatment time was prolonged from 2 hours to 8 hours. In the second
experiments, the heat treatment time was kept for 2 hours, but the
treatment temperature was increased from 52.5.degree. C. to
55.degree. C.. The results after treatment were shown in FIG. 10.
Two clones, numbered as 1-6D7 and 1-8B10, were further screened
from the preliminarily screened 17 positive clones. Under the
re-screening conditions, these two clones exhibited an obvious
advantage on temperature stability as compared to the wild type and
other positive clones. Mutant 1-6D7 contained a mutation K223E at
amino acid 223, while mutant 1-8B10 contained mutations at three
positions, which were K205E, K223T and A386S.
[0198] To study effect of each of these mutation sites on the
temperature stability of the enzyme, totally 4 clones, each of
which contained a single mutation for each site, were constructed,
expressed and purified to obtain the protein. Each mutant was
tested for its thermal stability. As shown in FIG. 11, mutants
1-6D7 (K223E) and 1-8D10 and the single-mutation K223T clone of the
xylanase gene xyl7 exhibited an obvious improvement in thermal
stability than the wild type and the other two single-mutation
clones when kept at 55.degree. C. The same trend was also observed
when kept at 60.degree. C. (results were not shown). It was found
that the three mutants having an improved stability all contained a
mutation at amino acid 223, with the mutant K223T having a most
obvious improvement in stability, indicating that amino acid 223
was important to the enzymatic activity stability of the xylanase
xly7. Saturation mutation was done at site 223. The single-mutation
clone K223T was used a parent sequence to perform the second round
of error-prone PCR to construct a random mutation library.
Screening conditions were set up for the random mutation library
for the xylanase gene xyl7 constructed from the second round of
error-prone PCR, and mutants constructed from saturation mutation
at site 223. More than 10,000 clones in the random mutation library
were screened under 58.degree. C. of heat treatment for 2 hours.
About 20 mutants were obtained which exhibited obviously improved
stability as compared to the starting strain (K223T). The enzymatic
activity of the treatment group of these mutants was still 80% or
more of that of the control group which was not undergone heat
treatment. The saturation mutation clones at amino acid 223 of Xyl7
were screened and several mutants having an improved thermal
stability as compared to the wild type K223T was obtained. Similar
to the first round of re-screening, these mutants were re-screened
under 58.degree. C. for 8 hours or under 60.degree. C. for 2 hours.
Results showed that two mutants having an obviously improved
thermal stability as compared to the starting strain xyl7-K223T
were obtained from the random mutation library, which designated as
2-8F12 and 2-6B2. Mutants xyl7-K223C and xyl7-K223S were screened
from the xyl7-223K saturation mutation library, which exhibited an
obviously improved thermal stability than xyl7-K223T (FIG. 12). For
the data described above, the residual relative activity of the
mutant after high-temperature treatment was calculated by
subtracting the relative activity of mutants without temperature
treatment from that of the treatment group after high-temperature
treatment. When screening mutants from the saturation mutation
mutants, the starting strain used for constructing the mutant
library was used as control. After the same treatment, mutants were
considered to have an obviously improved enzymatic activity or
thermal stability as compared to the wild type strain if its
relative activity retained after treatment was obviously higher
than the starting strain (wild type) undergone the same
treatment.
[0199] After sequencing mutants 2-8F12 and 2-6B2, it was found that
2-8F12 contained a K32T mutation at amino acid 32 and 2-6B2
contained an E219D mutation at amino acid 219, in addition to K223T
mutation in the parent. Mutant clones containing two or three
mutations were constructed by combining the positive sites, K32T,
E219D, K223C and K223S, of the resultant mutants. The clones were
induced to express proteins and the proteins were purified. Thermal
stability of the wild type xylanase xyl7 and each mutant protein at
55.degree. C. and 60.degree. C. were detected. Two mutants,
xyl7-K32T/K223C and xyl7-K32T/K223S, which had an obviously
improved stability than the wild type and other mutation clones,
were obtained. It could be found from the data that the half life
at 55.degree. C. of the xylanase proteins from the two mutants were
greatly increased from about 15 minutes of the wild type to 42
hours or above, which was totally increased about 250 folds. The
half life at 60.degree. C. was also increased from less than 10
minutes to 150 minutes or above.
[0200] Additionally, a directed evolution library of wild type Xyl7
was constructed based on the amino acid sequence of Xyl7R3. From
this library several site-directed mutations that could obviously
enhance the stability of the enzyme were obtained, the mutants of
which were named R3-TC(K32T/K223C) and R3-TS(K32T/K223S). As shown
in FIG. 15, the half life at 55.degree. C. of these two mutants
were increased from about 10 minutes of the wild type to about 60
hours, which were increased about 360 folds. The half life at
60.degree. C. was also increased from less than 10 minutes to 120
minutes.
[0201] Substitution mutations were made to the site of the fragment
of amino acids 19-272 of Xyl7 corresponding to amino acid residue
37, 42, 80, 205, 219, 221, 222, 223, 228, 386 of SEQ ID NO:2,
numbered according to amino acid position of SEQ ID NO:2. Mutations
included one or more of N37D, S42N, M801, K205E, E219D, A221T,
M22L, K223M or K223T, T228S and A386S. Results showed that these
mutations retained the activity of the enzyme.
[0202] Substitution mutations were made to the site of the fragment
of amino acids 19-272 of Xyl7 corresponding to amino acid residue
32 or 223 of SEQ ID NO:2, including single mutations K32T, K223E,
K223C, K223S, and K223T, and double mutations K32T+K223C and
K32T+K223S. Results showed that, similar to SEQ ID NO:2, the
fragment of amino acid 19-272 of Xyl7 still showed an improved
thermal stability after introducing the above mutations.
Example 6
Study on Property of the Truncated Amino Acid Fragments of Xyl7
[0203] A sequence shorter than amino acids 19-272 of SEQ ID NO:2
was designed based on the amino acid sequence of Xyl7 (SEQ ID NO:2)
and expressed. The expressed sequence was amino acids 19-267 of SEQ
ID NO:2, named Xyl7R2. According to item (3) "Detection of standard
enzymatic activity" described in Example 3, the enzymatic activity
of Xyl7R2 was 8560 U/mg. The results showed that R2 were active and
had a high expression amount (FIG. 16).
[0204] All references mentioned in the present disclosure are
incorporated by reference herein, as each of them is individually
incorporated by reference. Additionally, it should be understood
that various modifications or amendments could be made by the
skilled in the art after reading the contents disclosed in the
present disclosure. All these equivalences also fall within the
scope defined in the attached claims of the subject application.
Sequence CWU 1
1
2911518DNAUnknownIntestinal tract metagenome of termite 1atgaaaaaac
tcattgctct ttcattcata gcggcatttt tcgcgccgct attcgctcaa 60ggtcccacat
ggactactag cacaatacaa gcttacaacg gctacgacta cgagctttgg
120aaccaaaaca acgcaggcac cgttagcatg aaactcacgg gagataatgg
atcaggtgcc 180agcgcggtag gcgggacgtt tacggcaaca tggagcaaca
cgcagaacgt gcttttccgc 240tccggtaaaa aatggggatc cagcagtaac
caaaaccata cgcaaatcgg caatatgagc 300attaactttg ccgctacatg
gtcttccacc gacaacgtga aaatgctcgg cgtttacggc 360tgggcgtatt
tcacatcggc aaatgtgccg acaaaacaag aaaacggtac aaacgctagt
420ttctccaacc aaatcgaata ctatattatt caagataggg gtagttataa
tccggcttcg 480ggaggcacta acgccaaaaa atacggttcg gctaccattg
acggcattgc gtatgatttc 540tatgtatgcg acagaatcaa tcagcctatg
ttaaccggca acgggaattt caaacaattc 600ttcagcgttc ctcaaagcgc
ttctgcccac agaacaagcg gtacgatttc tgtttcacag 660cactttaata
aatggcatga acttggcatg aagatggacg gtccgttata tgaggtggcg
720atgaaggttg aatcttatac cggcagtggg agtagcaacg gttcggcaac
agttacgaag 780aatcttttga ccattggagg caccacgcct acgccaagtt
ccaactcagg cggcacaaca 840agcagctcta gcagagcatc ttcttcaagc
agagcatctt cttcaagcaa tgcggcggtt 900caagcaacta cttgcaaaac
gcctttgata acatacccaa caagcacggt gccttcagat 960ccctacaccg
cctgctttaa atatacagat gacaaatgct atgtttgcaa agtggaaaat
1020gaaggcgaat ttgaaggcaa catgaacact tgcggctctg gctgggtgtg
ggacggcacg 1080cagatagaca acaatttaag ggatggctat tggtatcaag
aagtgccttg ccctgcaggt 1140tcatcttcta gccgttcaag cagctcttct
gtagcggttt catcctctag ccgttcaagc 1200agctcttccg tagcggcatc
ttcttctagc cgttcaagca gttcgtctgc atcggttagc 1260agttcatcgg
aagagactcc tatcagggtg ctccacacaa ttccttcaaa attccgcgtt
1320cgctcgctga acaacggagc tttgcagatt gaaagcaatg cggatgttgt
gctttattta 1380tacgatacca aaggaaaaat ggctcaaaaa attgaagccc
caacgggttc aagcattgta 1440aagctatctg ttcccgctgg aatctatata
gtgagaaacg ttcaaaccaa agaaaaacta 1500agggttatgg tgaggtaa
15182505PRTUnknownIntestinal tract metagenome of termite 2Met Lys
Lys Leu Ile Ala Leu Ser Phe Ile Ala Ala Phe Phe Ala Pro 1 5 10 15
Leu Phe Ala Gln Gly Pro Thr Trp Thr Thr Ser Thr Ile Gln Ala Tyr 20
25 30 Asn Gly Tyr Asp Tyr Glu Leu Trp Asn Gln Asn Asn Ala Gly Thr
Val 35 40 45 Ser Met Lys Leu Thr Gly Asp Asn Gly Ser Gly Ala Ser
Ala Val Gly 50 55 60 Gly Thr Phe Thr Ala Thr Trp Ser Asn Thr Gln
Asn Val Leu Phe Arg 65 70 75 80 Ser Gly Lys Lys Trp Gly Ser Ser Ser
Asn Gln Asn His Thr Gln Ile 85 90 95 Gly Asn Met Ser Ile Asn Phe
Ala Ala Thr Trp Ser Ser Thr Asp Asn 100 105 110 Val Lys Met Leu Gly
Val Tyr Gly Trp Ala Tyr Phe Thr Ser Ala Asn 115 120 125 Val Pro Thr
Lys Gln Glu Asn Gly Thr Asn Ala Ser Phe Ser Asn Gln 130 135 140 Ile
Glu Tyr Tyr Ile Ile Gln Asp Arg Gly Ser Tyr Asn Pro Ala Ser 145 150
155 160 Gly Gly Thr Asn Ala Lys Lys Tyr Gly Ser Ala Thr Ile Asp Gly
Ile 165 170 175 Ala Tyr Asp Phe Tyr Val Cys Asp Arg Ile Asn Gln Pro
Met Leu Thr 180 185 190 Gly Asn Gly Asn Phe Lys Gln Phe Phe Ser Val
Pro Gln Ser Ala Ser 195 200 205 Ala His Arg Thr Ser Gly Thr Ile Ser
Val Ser Gln His Phe Asn Lys 210 215 220 Trp His Glu Leu Gly Met Lys
Met Asp Gly Pro Leu Tyr Glu Val Ala 225 230 235 240 Met Lys Val Glu
Ser Tyr Thr Gly Ser Gly Ser Ser Asn Gly Ser Ala 245 250 255 Thr Val
Thr Lys Asn Leu Leu Thr Ile Gly Gly Thr Thr Pro Thr Pro 260 265 270
Ser Ser Asn Ser Gly Gly Thr Thr Ser Ser Ser Ser Arg Ala Ser Ser 275
280 285 Ser Ser Arg Ala Ser Ser Ser Ser Asn Ala Ala Val Gln Ala Thr
Thr 290 295 300 Cys Lys Thr Pro Leu Ile Thr Tyr Pro Thr Ser Thr Val
Pro Ser Asp 305 310 315 320 Pro Tyr Thr Ala Cys Phe Lys Tyr Thr Asp
Asp Lys Cys Tyr Val Cys 325 330 335 Lys Val Glu Asn Glu Gly Glu Phe
Glu Gly Asn Met Asn Thr Cys Gly 340 345 350 Ser Gly Trp Val Trp Asp
Gly Thr Gln Ile Asp Asn Asn Leu Arg Asp 355 360 365 Gly Tyr Trp Tyr
Gln Glu Val Pro Cys Pro Ala Gly Ser Ser Ser Ser 370 375 380 Arg Ser
Ser Ser Ser Ser Val Ala Val Ser Ser Ser Ser Arg Ser Ser 385 390 395
400 Ser Ser Ser Val Ala Ala Ser Ser Ser Ser Arg Ser Ser Ser Ser Ser
405 410 415 Ala Ser Val Ser Ser Ser Ser Glu Glu Thr Pro Ile Arg Val
Leu His 420 425 430 Thr Ile Pro Ser Lys Phe Arg Val Arg Ser Leu Asn
Asn Gly Ala Leu 435 440 445 Gln Ile Glu Ser Asn Ala Asp Val Val Leu
Tyr Leu Tyr Asp Thr Lys 450 455 460 Gly Lys Met Ala Gln Lys Ile Glu
Ala Pro Thr Gly Ser Ser Ile Val 465 470 475 480 Lys Leu Ser Val Pro
Ala Gly Ile Tyr Ile Val Arg Asn Val Gln Thr 485 490 495 Lys Glu Lys
Leu Arg Val Met Val Arg 500 505 331DNAArtificial sequencePrimer
3gagactccat atgcaaggtc ccacatggac t 31426DNAArtificial
sequencePrimer 4cggaattctt acctcaccat aaccct 2655PRTArtificial
sequenceTag sequence 5Arg Arg Arg Arg Arg 1 5 66PRTArtificial
sequenceTag sequence 6His His His His His His 1 5 78PRTArtificial
sequenceTag sequence 7Asp Tyr Lys Asp Asp Asp Asp Lys 1 5
88PRTArtificial sequenceTag sequence 8Trp Ser His Pro Gln Phe Glu
Lys 1 5 910PRTArtificial sequenceTag sequence 9Trp Gln Lys Leu Ile
Ser Glu Glu Asp Leu 1 5 10 1032DNAArtificial sequencePrimer
10tgagactcca tatgcaaggt cccacatgga ct 321130DNAArtificial
sequencePrimer 11gcggaattct tatggcgtag gcgtggtgcc
30121461DNAArtificial sequenceSynthesized coding sequence of N37D
mutant of Xy17 12caaggtccca catggactac tagcacaata caagcttaca
acggctacga ctacgagctt 60tggaaccaaa acaacgcagg caccgttagc atgaaactca
cgggagatga tggatcaggt 120gccagcgcgg taggcgggac gtttacggca
acatggagca acacgcagaa cgtgcttttc 180cgctccggta aaaaatgggg
atccagcagt aaccaaaacc atacgcaaat cggcaatatg 240agcattaact
ttgccgctac atggtcttcc accgacaacg tgaaaatgct cggcgtttac
300ggctgggcgt atttcacatc ggcaaatgtg ccgacaaaac aagaaaacgg
tacaaacgct 360agtttctcca accaaatcga atactatatt attcaagata
ggggtagtta taatccggct 420tcgggaggca ctaacgccaa aaaatacggt
tcggctacca ttgacggcat tgcgtatgat 480ttctatgtat gcgacagaat
caatcagcct atgttaaccg gcaacgggaa tttcaaacaa 540ttcttcagcg
ttcctcaaag cgcttctgcc cacagaacaa gcggtacgat ttctgtttca
600cagcacttta ataaatggca tgaacttggc atgaagatgg acggtccgtt
atatgaggtg 660gcgatgaagg ttgaatctta taccggcagt gggagtagca
acggttcggc aacagttacg 720aagaatcttt tgaccattgg aggcaccacg
cctacgccaa gttccaactc aggcggcaca 780acaagcagct ctagcagagc
atcttcttca agcagagcat cttcttcaag caatgcggcg 840gttcaagcaa
ctacttgcaa aacgcctttg ataacatacc caacaagcac ggtgccttca
900gatccctaca ccgcctgctt taaatataca gatgacaaat gctatgtttg
caaagtggaa 960aatgaaggcg aatttgaagg caacatgaac acttgcggct
ctggctgggt gtgggacggc 1020acgcagatag acaacaattt aagggatggc
tattggtatc aagaagtgcc ttgccctgca 1080ggttcatctt ctagccgttc
aagcagctct tctgtagcgg tttcatcctc tagccgttca 1140agcagctctt
ccgtagcggc atcttcttct agccgttcaa gcagttcgtc tgcatcggtt
1200agcagttcat cggaagagac tcctatcagg gtgctccaca caattccttc
aaaattccgc 1260gttcgctcgc tgaacaacgg agctttgcag attgaaagca
atgcggatgt tgtgctttat 1320ttatacgata ccaaaggaaa aatggctcaa
aaaattgaag ccccaacggg ttcaagcatt 1380gtaaagctat ctgttcccgc
tggaatctat atagtgagaa acgttcaaac caaagaaaaa 1440ctaagggtta
tggtgaggta a 146113486PRTArtificial sequenceSynthesized amino acid
sequence of N37D mutant of Xy17 13Gln Gly Pro Thr Trp Thr Thr Ser
Thr Ile Gln Ala Tyr Asn Gly Tyr 1 5 10 15 Asp Tyr Glu Leu Trp Asn
Gln Asn Asn Ala Gly Thr Val Ser Met Lys 20 25 30 Leu Thr Gly Asp
Asp Gly Ser Gly Ala Ser Ala Val Gly Gly Thr Phe 35 40 45 Thr Ala
Thr Trp Ser Asn Thr Gln Asn Val Leu Phe Arg Ser Gly Lys 50 55 60
Lys Trp Gly Ser Ser Ser Asn Gln Asn His Thr Gln Ile Gly Asn Met 65
70 75 80 Ser Ile Asn Phe Ala Ala Thr Trp Ser Ser Thr Asp Asn Val
Lys Met 85 90 95 Leu Gly Val Tyr Gly Trp Ala Tyr Phe Thr Ser Ala
Asn Val Pro Thr 100 105 110 Lys Gln Glu Asn Gly Thr Asn Ala Ser Phe
Ser Asn Gln Ile Glu Tyr 115 120 125 Tyr Ile Ile Gln Asp Arg Gly Ser
Tyr Asn Pro Ala Ser Gly Gly Thr 130 135 140 Asn Ala Lys Lys Tyr Gly
Ser Ala Thr Ile Asp Gly Ile Ala Tyr Asp 145 150 155 160 Phe Tyr Val
Cys Asp Arg Ile Asn Gln Pro Met Leu Thr Gly Asn Gly 165 170 175 Asn
Phe Lys Gln Phe Phe Ser Val Pro Gln Ser Ala Ser Ala His Arg 180 185
190 Thr Ser Gly Thr Ile Ser Val Ser Gln His Phe Asn Lys Trp His Glu
195 200 205 Leu Gly Met Lys Met Asp Gly Pro Leu Tyr Glu Val Ala Met
Lys Val 210 215 220 Glu Ser Tyr Thr Gly Ser Gly Ser Ser Asn Gly Ser
Ala Thr Val Thr 225 230 235 240 Lys Asn Leu Leu Thr Ile Gly Gly Thr
Thr Pro Thr Pro Ser Ser Asn 245 250 255 Ser Gly Gly Thr Thr Ser Ser
Ser Ser Arg Ala Ser Ser Ser Ser Arg 260 265 270 Ala Ser Ser Ser Ser
Asn Ala Ala Val Gln Ala Thr Thr Cys Lys Thr 275 280 285 Pro Leu Ile
Thr Tyr Pro Thr Ser Thr Val Pro Ser Asp Pro Tyr Thr 290 295 300 Ala
Cys Phe Lys Tyr Thr Asp Asp Lys Cys Tyr Val Cys Lys Val Glu 305 310
315 320 Asn Glu Gly Glu Phe Glu Gly Asn Met Asn Thr Cys Gly Ser Gly
Trp 325 330 335 Val Trp Asp Gly Thr Gln Ile Asp Asn Asn Leu Arg Asp
Gly Tyr Trp 340 345 350 Tyr Gln Glu Val Pro Cys Pro Ala Gly Ser Ser
Ser Ser Arg Ser Ser 355 360 365 Ser Ser Ser Val Ala Val Ser Ser Ser
Ser Arg Ser Ser Ser Ser Ser 370 375 380 Val Ala Ala Ser Ser Ser Ser
Arg Ser Ser Ser Ser Ser Ala Ser Val 385 390 395 400 Ser Ser Ser Ser
Glu Glu Thr Pro Ile Arg Val Leu His Thr Ile Pro 405 410 415 Ser Lys
Phe Arg Val Arg Ser Leu Asn Asn Gly Ala Leu Gln Ile Glu 420 425 430
Ser Asn Ala Asp Val Val Leu Tyr Leu Tyr Asp Thr Lys Gly Lys Met 435
440 445 Ala Gln Lys Ile Glu Ala Pro Thr Gly Ser Ser Ile Val Lys Leu
Ser 450 455 460 Val Pro Ala Gly Ile Tyr Ile Val Arg Asn Val Gln Thr
Lys Glu Lys 465 470 475 480 Leu Arg Val Met Val Arg 485
141461DNAArtificial sequenceSynthesized coding sequence of S42N
mutant of Xy17 14caaggtccca catggactac tagcacaata caagcttaca
acggctacga ctacgagctt 60tggaaccaaa acaacgcagg caccgttagc atgaaactca
cgggagataa tggatcaggt 120gccaacgcgg taggcgggac gtttacggca
acatggagca acacgcagaa cgtgcttttc 180cgctccggta aaaaatgggg
atccagcagt aaccaaaacc atacgcaaat cggcaatatg 240agcattaact
ttgccgctac atggtcttcc accgacaacg tgaaaatgct cggcgtttac
300ggctgggcgt atttcacatc ggcaaatgtg ccgacaaaac aagaaaacgg
tacaaacgct 360agtttctcca accaaatcga atactatatt attcaagata
ggggtagtta taatccggct 420tcgggaggca ctaacgccaa aaaatacggt
tcggctacca ttgacggcat tgcgtatgat 480ttctatgtat gcgacagaat
caatcagcct atgttaaccg gcaacgggaa tttcaaacaa 540ttcttcagcg
ttcctcaaag cgcttctgcc cacagaacaa gcggtacgat ttctgtttca
600cagcacttta ataaatggca tgaacttggc atgaagatgg acggtccgtt
atatgaggtg 660gcgatgaagg ttgaatctta taccggcagt gggagtagca
acggttcggc aacagttacg 720aagaatcttt tgaccattgg aggcaccacg
cctacgccaa gttccaactc aggcggcaca 780acaagcagct ctagcagagc
atcttcttca agcagagcat cttcttcaag caatgcggcg 840gttcaagcaa
ctacttgcaa aacgcctttg ataacatacc caacaagcac ggtgccttca
900gatccctaca ccgcctgctt taaatataca gatgacaaat gctatgtttg
caaagtggaa 960aatgaaggcg aatttgaagg caacatgaac acttgcggct
ctggctgggt gtgggacggc 1020acgcagatag acaacaattt aagggatggc
tattggtatc aagaagtgcc ttgccctgca 1080ggttcatctt ctagccgttc
aagcagctct tctgtagcgg tttcatcctc tagccgttca 1140agcagctctt
ccgtagcggc atcttcttct agccgttcaa gcagttcgtc tgcatcggtt
1200agcagttcat cggaagagac tcctatcagg gtgctccaca caattccttc
aaaattccgc 1260gttcgctcgc tgaacaacgg agctttgcag attgaaagca
atgcggatgt tgtgctttat 1320ttatacgata ccaaaggaaa aatggctcaa
aaaattgaag ccccaacggg ttcaagcatt 1380gtaaagctat ctgttcccgc
tggaatctat atagtgagaa acgttcaaac caaagaaaaa 1440ctaagggtta
tggtgaggta a 146115486PRTArtificial sequenceSynthesized amino acid
sequence of S42N mutant of Xy17 15Gln Gly Pro Thr Trp Thr Thr Ser
Thr Ile Gln Ala Tyr Asn Gly Tyr 1 5 10 15 Asp Tyr Glu Leu Trp Asn
Gln Asn Asn Ala Gly Thr Val Ser Met Lys 20 25 30 Leu Thr Gly Asp
Asn Gly Ser Gly Ala Asn Ala Val Gly Gly Thr Phe 35 40 45 Thr Ala
Thr Trp Ser Asn Thr Gln Asn Val Leu Phe Arg Ser Gly Lys 50 55 60
Lys Trp Gly Ser Ser Ser Asn Gln Asn His Thr Gln Ile Gly Asn Met 65
70 75 80 Ser Ile Asn Phe Ala Ala Thr Trp Ser Ser Thr Asp Asn Val
Lys Met 85 90 95 Leu Gly Val Tyr Gly Trp Ala Tyr Phe Thr Ser Ala
Asn Val Pro Thr 100 105 110 Lys Gln Glu Asn Gly Thr Asn Ala Ser Phe
Ser Asn Gln Ile Glu Tyr 115 120 125 Tyr Ile Ile Gln Asp Arg Gly Ser
Tyr Asn Pro Ala Ser Gly Gly Thr 130 135 140 Asn Ala Lys Lys Tyr Gly
Ser Ala Thr Ile Asp Gly Ile Ala Tyr Asp 145 150 155 160 Phe Tyr Val
Cys Asp Arg Ile Asn Gln Pro Met Leu Thr Gly Asn Gly 165 170 175 Asn
Phe Lys Gln Phe Phe Ser Val Pro Gln Ser Ala Ser Ala His Arg 180 185
190 Thr Ser Gly Thr Ile Ser Val Ser Gln His Phe Asn Lys Trp His Glu
195 200 205 Leu Gly Met Lys Met Asp Gly Pro Leu Tyr Glu Val Ala Met
Lys Val 210 215 220 Glu Ser Tyr Thr Gly Ser Gly Ser Ser Asn Gly Ser
Ala Thr Val Thr 225 230 235 240 Lys Asn Leu Leu Thr Ile Gly Gly Thr
Thr Pro Thr Pro Ser Ser Asn 245 250 255 Ser Gly Gly Thr Thr Ser Ser
Ser Ser Arg Ala Ser Ser Ser Ser Arg 260 265 270 Ala Ser Ser Ser Ser
Asn Ala Ala Val Gln Ala Thr Thr Cys Lys Thr 275 280 285 Pro Leu Ile
Thr Tyr Pro Thr Ser Thr Val Pro Ser Asp Pro Tyr Thr 290 295 300 Ala
Cys Phe Lys Tyr Thr Asp Asp Lys Cys Tyr Val Cys Lys Val Glu 305 310
315 320 Asn Glu Gly Glu Phe Glu Gly Asn Met Asn Thr Cys Gly Ser Gly
Trp 325 330 335 Val Trp Asp Gly Thr Gln Ile Asp Asn Asn Leu Arg Asp
Gly Tyr Trp 340 345 350 Tyr Gln Glu Val Pro Cys Pro Ala Gly Ser Ser
Ser Ser Arg Ser Ser 355 360 365 Ser Ser Ser Val Ala Val Ser Ser Ser
Ser Arg Ser Ser Ser Ser Ser 370 375 380 Val Ala Ala Ser Ser Ser Ser
Arg Ser Ser Ser Ser Ser Ala Ser Val 385 390 395 400 Ser Ser Ser Ser
Glu Glu Thr Pro Ile Arg Val Leu His Thr Ile Pro 405 410 415 Ser Lys
Phe Arg Val Arg Ser Leu Asn Asn Gly Ala Leu Gln Ile Glu 420 425 430
Ser Asn Ala Asp Val Val Leu
Tyr Leu Tyr Asp Thr Lys Gly Lys Met 435 440 445 Ala Gln Lys Ile Glu
Ala Pro Thr Gly Ser Ser Ile Val Lys Leu Ser 450 455 460 Val Pro Ala
Gly Ile Tyr Ile Val Arg Asn Val Gln Thr Lys Glu Lys 465 470 475 480
Leu Arg Val Met Val Arg 485 161461DNAArtificial sequenceSynthesized
coding sequence of M80I mutant of Xy17 16caaggtccca catggactac
tagcacaata caagcttaca acggctacga ctacgagctt 60tggaaccaaa acaacgcagg
caccgttagc atgaaactca cgggagataa tggatcaggt 120gccagcgcgg
taggcgggac gtttacggca acatggagca acacgcagaa cgtgcttttc
180cgctccggta aaaaatgggg atccagcagt aaccaaaacc atacgcaaat
cggcaatata 240agcattaact ttgccgctac atggtcttcc accgacaacg
tgaaaatgct cggcgtttac 300ggctgggcgt atttcacatc ggcaaatgtg
ccgacaaaac aagaaaacgg tacaaacgct 360agtttctcca accaaatcga
atactatatt attcaagata ggggtagtta taatccggct 420tcgggaggca
ctaacgccaa aaaatacggt tcggctacca ttgacggcat tgcgtatgat
480ttctatgtat gcgacagaat caatcagcct atgttaaccg gcaacgggaa
tttcaaacaa 540ttcttcagcg ttcctcaaag cgcttctgcc cacagaacaa
gcggtacgat ttctgtttca 600cagcacttta ataaatggca tgaacttggc
atgaagatgg acggtccgtt atatgaggtg 660gcgatgaagg ttgaatctta
taccggcagt gggagtagca acggttcggc aacagttacg 720aagaatcttt
tgaccattgg aggcaccacg cctacgccaa gttccaactc aggcggcaca
780acaagcagct ctagcagagc atcttcttca agcagagcat cttcttcaag
caatgcggcg 840gttcaagcaa ctacttgcaa aacgcctttg ataacatacc
caacaagcac ggtgccttca 900gatccctaca ccgcctgctt taaatataca
gatgacaaat gctatgtttg caaagtggaa 960aatgaaggcg aatttgaagg
caacatgaac acttgcggct ctggctgggt gtgggacggc 1020acgcagatag
acaacaattt aagggatggc tattggtatc aagaagtgcc ttgccctgca
1080ggttcatctt ctagccgttc aagcagctct tctgtagcgg tttcatcctc
tagccgttca 1140agcagctctt ccgtagcggc atcttcttct agccgttcaa
gcagttcgtc tgcatcggtt 1200agcagttcat cggaagagac tcctatcagg
gtgctccaca caattccttc aaaattccgc 1260gttcgctcgc tgaacaacgg
agctttgcag attgaaagca atgcggatgt tgtgctttat 1320ttatacgata
ccaaaggaaa aatggctcaa aaaattgaag ccccaacggg ttcaagcatt
1380gtaaagctat ctgttcccgc tggaatctat atagtgagaa acgttcaaac
caaagaaaaa 1440ctaagggtta tggtgaggta a 146117486PRTArtificial
sequenceSynthesized amino acid sequence of M80I mutant of Xy17
17Gln Gly Pro Thr Trp Thr Thr Ser Thr Ile Gln Ala Tyr Asn Gly Tyr 1
5 10 15 Asp Tyr Glu Leu Trp Asn Gln Asn Asn Ala Gly Thr Val Ser Met
Lys 20 25 30 Leu Thr Gly Asp Asn Gly Ser Gly Ala Ser Ala Val Gly
Gly Thr Phe 35 40 45 Thr Ala Thr Trp Ser Asn Thr Gln Asn Val Leu
Phe Arg Ser Gly Lys 50 55 60 Lys Trp Gly Ser Ser Ser Asn Gln Asn
His Thr Gln Ile Gly Asn Ile 65 70 75 80 Ser Ile Asn Phe Ala Ala Thr
Trp Ser Ser Thr Asp Asn Val Lys Met 85 90 95 Leu Gly Val Tyr Gly
Trp Ala Tyr Phe Thr Ser Ala Asn Val Pro Thr 100 105 110 Lys Gln Glu
Asn Gly Thr Asn Ala Ser Phe Ser Asn Gln Ile Glu Tyr 115 120 125 Tyr
Ile Ile Gln Asp Arg Gly Ser Tyr Asn Pro Ala Ser Gly Gly Thr 130 135
140 Asn Ala Lys Lys Tyr Gly Ser Ala Thr Ile Asp Gly Ile Ala Tyr Asp
145 150 155 160 Phe Tyr Val Cys Asp Arg Ile Asn Gln Pro Met Leu Thr
Gly Asn Gly 165 170 175 Asn Phe Lys Gln Phe Phe Ser Val Pro Gln Ser
Ala Ser Ala His Arg 180 185 190 Thr Ser Gly Thr Ile Ser Val Ser Gln
His Phe Asn Lys Trp His Glu 195 200 205 Leu Gly Met Lys Met Asp Gly
Pro Leu Tyr Glu Val Ala Met Lys Val 210 215 220 Glu Ser Tyr Thr Gly
Ser Gly Ser Ser Asn Gly Ser Ala Thr Val Thr 225 230 235 240 Lys Asn
Leu Leu Thr Ile Gly Gly Thr Thr Pro Thr Pro Ser Ser Asn 245 250 255
Ser Gly Gly Thr Thr Ser Ser Ser Ser Arg Ala Ser Ser Ser Ser Arg 260
265 270 Ala Ser Ser Ser Ser Asn Ala Ala Val Gln Ala Thr Thr Cys Lys
Thr 275 280 285 Pro Leu Ile Thr Tyr Pro Thr Ser Thr Val Pro Ser Asp
Pro Tyr Thr 290 295 300 Ala Cys Phe Lys Tyr Thr Asp Asp Lys Cys Tyr
Val Cys Lys Val Glu 305 310 315 320 Asn Glu Gly Glu Phe Glu Gly Asn
Met Asn Thr Cys Gly Ser Gly Trp 325 330 335 Val Trp Asp Gly Thr Gln
Ile Asp Asn Asn Leu Arg Asp Gly Tyr Trp 340 345 350 Tyr Gln Glu Val
Pro Cys Pro Ala Gly Ser Ser Ser Ser Arg Ser Ser 355 360 365 Ser Ser
Ser Val Ala Val Ser Ser Ser Ser Arg Ser Ser Ser Ser Ser 370 375 380
Val Ala Ala Ser Ser Ser Ser Arg Ser Ser Ser Ser Ser Ala Ser Val 385
390 395 400 Ser Ser Ser Ser Glu Glu Thr Pro Ile Arg Val Leu His Thr
Ile Pro 405 410 415 Ser Lys Phe Arg Val Arg Ser Leu Asn Asn Gly Ala
Leu Gln Ile Glu 420 425 430 Ser Asn Ala Asp Val Val Leu Tyr Leu Tyr
Asp Thr Lys Gly Lys Met 435 440 445 Ala Gln Lys Ile Glu Ala Pro Thr
Gly Ser Ser Ile Val Lys Leu Ser 450 455 460 Val Pro Ala Gly Ile Tyr
Ile Val Arg Asn Val Gln Thr Lys Glu Lys 465 470 475 480 Leu Arg Val
Met Val Arg 485 181461DNAArtificial sequenceSynthesized coding
sequence of E219D mutant of Xy17 18caaggtccca catggactac tagcacaata
caagcttaca acggctacga ctacgagctt 60tggaaccaaa acaacgcagg caccgttagc
atgaaactca cgggagataa tggatcaggt 120gccagcgcgg taggcgggac
gtttacggca acatggagca acacgcagaa cgtgcttttc 180cgctccggta
aaaaatgggg atccagcagt aaccaaaacc atacgcaaat cggcaatatg
240agcattaact ttgccgctac atggtcttcc accgacaacg tgaaaatgct
cggcgtttac 300ggctgggcgt atttcacatc ggcaaatgtg ccgacaaaac
aagaaaacgg tacaaacgct 360agtttctcca accaaatcga atactatatt
attcaagata ggggtagtta taatccggct 420tcgggaggca ctaacgccaa
aaaatacggt tcggctacca ttgacggcat tgcgtatgat 480ttctatgtat
gcgacagaat caatcagcct atgttaaccg gcaacgggaa tttcaaacaa
540ttcttcagcg ttcctcaaag cgcttctgcc cacagaacaa gcggtacgat
ttctgtttca 600cagcacttta ataaatggca tgaacttggc atgaagatgg
acggtccgtt atatgatgtg 660gcgatgaagg ttgaatctta taccggcagt
gggagtagca acggttcggc aacagttacg 720aagaatcttt tgaccattgg
aggcaccacg cctacgccaa gttccaactc aggcggcaca 780acaagcagct
ctagcagagc atcttcttca agcagagcat cttcttcaag caatgcggcg
840gttcaagcaa ctacttgcaa aacgcctttg ataacatacc caacaagcac
ggtgccttca 900gatccctaca ccgcctgctt taaatataca gatgacaaat
gctatgtttg caaagtggaa 960aatgaaggcg aatttgaagg caacatgaac
acttgcggct ctggctgggt gtgggacggc 1020acgcagatag acaacaattt
aagggatggc tattggtatc aagaagtgcc ttgccctgca 1080ggttcatctt
ctagccgttc aagcagctct tctgtagcgg tttcatcctc tagccgttca
1140agcagctctt ccgtagcggc atcttcttct agccgttcaa gcagttcgtc
tgcatcggtt 1200agcagttcat cggaagagac tcctatcagg gtgctccaca
caattccttc aaaattccgc 1260gttcgctcgc tgaacaacgg agctttgcag
attgaaagca atgcggatgt tgtgctttat 1320ttatacgata ccaaaggaaa
aatggctcaa aaaattgaag ccccaacggg ttcaagcatt 1380gtaaagctat
ctgttcccgc tggaatctat atagtgagaa acgttcaaac caaagaaaaa
1440ctaagggtta tggtgaggta a 146119486PRTArtificial
sequenceSynthesized amino acid sequence of E219D mutant of Xy17
19Gln Gly Pro Thr Trp Thr Thr Ser Thr Ile Gln Ala Tyr Asn Gly Tyr 1
5 10 15 Asp Tyr Glu Leu Trp Asn Gln Asn Asn Ala Gly Thr Val Ser Met
Lys 20 25 30 Leu Thr Gly Asp Asn Gly Ser Gly Ala Ser Ala Val Gly
Gly Thr Phe 35 40 45 Thr Ala Thr Trp Ser Asn Thr Gln Asn Val Leu
Phe Arg Ser Gly Lys 50 55 60 Lys Trp Gly Ser Ser Ser Asn Gln Asn
His Thr Gln Ile Gly Asn Met 65 70 75 80 Ser Ile Asn Phe Ala Ala Thr
Trp Ser Ser Thr Asp Asn Val Lys Met 85 90 95 Leu Gly Val Tyr Gly
Trp Ala Tyr Phe Thr Ser Ala Asn Val Pro Thr 100 105 110 Lys Gln Glu
Asn Gly Thr Asn Ala Ser Phe Ser Asn Gln Ile Glu Tyr 115 120 125 Tyr
Ile Ile Gln Asp Arg Gly Ser Tyr Asn Pro Ala Ser Gly Gly Thr 130 135
140 Asn Ala Lys Lys Tyr Gly Ser Ala Thr Ile Asp Gly Ile Ala Tyr Asp
145 150 155 160 Phe Tyr Val Cys Asp Arg Ile Asn Gln Pro Met Leu Thr
Gly Asn Gly 165 170 175 Asn Phe Lys Gln Phe Phe Ser Val Pro Gln Ser
Ala Ser Ala His Arg 180 185 190 Thr Ser Gly Thr Ile Ser Val Ser Gln
His Phe Asn Lys Trp His Glu 195 200 205 Leu Gly Met Lys Met Asp Gly
Pro Leu Tyr Asp Val Ala Met Lys Val 210 215 220 Glu Ser Tyr Thr Gly
Ser Gly Ser Ser Asn Gly Ser Ala Thr Val Thr 225 230 235 240 Lys Asn
Leu Leu Thr Ile Gly Gly Thr Thr Pro Thr Pro Ser Ser Asn 245 250 255
Ser Gly Gly Thr Thr Ser Ser Ser Ser Arg Ala Ser Ser Ser Ser Arg 260
265 270 Ala Ser Ser Ser Ser Asn Ala Ala Val Gln Ala Thr Thr Cys Lys
Thr 275 280 285 Pro Leu Ile Thr Tyr Pro Thr Ser Thr Val Pro Ser Asp
Pro Tyr Thr 290 295 300 Ala Cys Phe Lys Tyr Thr Asp Asp Lys Cys Tyr
Val Cys Lys Val Glu 305 310 315 320 Asn Glu Gly Glu Phe Glu Gly Asn
Met Asn Thr Cys Gly Ser Gly Trp 325 330 335 Val Trp Asp Gly Thr Gln
Ile Asp Asn Asn Leu Arg Asp Gly Tyr Trp 340 345 350 Tyr Gln Glu Val
Pro Cys Pro Ala Gly Ser Ser Ser Ser Arg Ser Ser 355 360 365 Ser Ser
Ser Val Ala Val Ser Ser Ser Ser Arg Ser Ser Ser Ser Ser 370 375 380
Val Ala Ala Ser Ser Ser Ser Arg Ser Ser Ser Ser Ser Ala Ser Val 385
390 395 400 Ser Ser Ser Ser Glu Glu Thr Pro Ile Arg Val Leu His Thr
Ile Pro 405 410 415 Ser Lys Phe Arg Val Arg Ser Leu Asn Asn Gly Ala
Leu Gln Ile Glu 420 425 430 Ser Asn Ala Asp Val Val Leu Tyr Leu Tyr
Asp Thr Lys Gly Lys Met 435 440 445 Ala Gln Lys Ile Glu Ala Pro Thr
Gly Ser Ser Ile Val Lys Leu Ser 450 455 460 Val Pro Ala Gly Ile Tyr
Ile Val Arg Asn Val Gln Thr Lys Glu Lys 465 470 475 480 Leu Arg Val
Met Val Arg 485 201461DNAArtificial sequenceSynthesized coding
sequence of A221T mutant of Xy17 20caaggtccca catggactac tagcacaata
caagcttaca acggctacga ctacgagctt 60tggaaccaaa acaacgcagg caccgttagc
atgaaactca cgggagataa tggatcaggt 120gccagcgcgg taggcgggac
gtttacggca acatggagca acacgcagaa cgtgcttttc 180cgctccggta
aaaaatgggg atccagcagt aaccaaaacc atacgcaaat cggcaatatg
240agcattaact ttgccgctac atggtcttcc accgacaacg tgaaaatgct
cggcgtttac 300ggctgggcgt atttcacatc ggcaaatgtg ccgacaaaac
aagaaaacgg tacaaacgct 360agtttctcca accaaatcga atactatatt
attcaagata ggggtagtta taatccggct 420tcgggaggca ctaacgccaa
aaaatacggt tcggctacca ttgacggcat tgcgtatgat 480ttctatgtat
gcgacagaat caatcagcct atgttaaccg gcaacgggaa tttcaaacaa
540ttcttcagcg ttcctcaaag cgcttctgcc cacagaacaa gcggtacgat
ttctgtttca 600cagcacttta ataaatggca tgaacttggc atgaagatgg
acggtccgtt atatgaggtg 660acgatgaagg ttgaatctta taccggcagt
gggagtagca acggttcggc aacagttacg 720aagaatcttt tgaccattgg
aggcaccacg cctacgccaa gttccaactc aggcggcaca 780acaagcagct
ctagcagagc atcttcttca agcagagcat cttcttcaag caatgcggcg
840gttcaagcaa ctacttgcaa aacgcctttg ataacatacc caacaagcac
ggtgccttca 900gatccctaca ccgcctgctt taaatataca gatgacaaat
gctatgtttg caaagtggaa 960aatgaaggcg aatttgaagg caacatgaac
acttgcggct ctggctgggt gtgggacggc 1020acgcagatag acaacaattt
aagggatggc tattggtatc aagaagtgcc ttgccctgca 1080ggttcatctt
ctagccgttc aagcagctct tctgtagcgg tttcatcctc tagccgttca
1140agcagctctt ccgtagcggc atcttcttct agccgttcaa gcagttcgtc
tgcatcggtt 1200agcagttcat cggaagagac tcctatcagg gtgctccaca
caattccttc aaaattccgc 1260gttcgctcgc tgaacaacgg agctttgcag
attgaaagca atgcggatgt tgtgctttat 1320ttatacgata ccaaaggaaa
aatggctcaa aaaattgaag ccccaacggg ttcaagcatt 1380gtaaagctat
ctgttcccgc tggaatctat atagtgagaa acgttcaaac caaagaaaaa
1440ctaagggtta tggtgaggta a 146121486PRTArtificial
sequenceSynthesized amino acid sequence of A221T mutant of Xy17
21Gln Gly Pro Thr Trp Thr Thr Ser Thr Ile Gln Ala Tyr Asn Gly Tyr 1
5 10 15 Asp Tyr Glu Leu Trp Asn Gln Asn Asn Ala Gly Thr Val Ser Met
Lys 20 25 30 Leu Thr Gly Asp Asn Gly Ser Gly Ala Ser Ala Val Gly
Gly Thr Phe 35 40 45 Thr Ala Thr Trp Ser Asn Thr Gln Asn Val Leu
Phe Arg Ser Gly Lys 50 55 60 Lys Trp Gly Ser Ser Ser Asn Gln Asn
His Thr Gln Ile Gly Asn Met 65 70 75 80 Ser Ile Asn Phe Ala Ala Thr
Trp Ser Ser Thr Asp Asn Val Lys Met 85 90 95 Leu Gly Val Tyr Gly
Trp Ala Tyr Phe Thr Ser Ala Asn Val Pro Thr 100 105 110 Lys Gln Glu
Asn Gly Thr Asn Ala Ser Phe Ser Asn Gln Ile Glu Tyr 115 120 125 Tyr
Ile Ile Gln Asp Arg Gly Ser Tyr Asn Pro Ala Ser Gly Gly Thr 130 135
140 Asn Ala Lys Lys Tyr Gly Ser Ala Thr Ile Asp Gly Ile Ala Tyr Asp
145 150 155 160 Phe Tyr Val Cys Asp Arg Ile Asn Gln Pro Met Leu Thr
Gly Asn Gly 165 170 175 Asn Phe Lys Gln Phe Phe Ser Val Pro Gln Ser
Ala Ser Ala His Arg 180 185 190 Thr Ser Gly Thr Ile Ser Val Ser Gln
His Phe Asn Lys Trp His Glu 195 200 205 Leu Gly Met Lys Met Asp Gly
Pro Leu Tyr Glu Val Thr Met Lys Val 210 215 220 Glu Ser Tyr Thr Gly
Ser Gly Ser Ser Asn Gly Ser Ala Thr Val Thr 225 230 235 240 Lys Asn
Leu Leu Thr Ile Gly Gly Thr Thr Pro Thr Pro Ser Ser Asn 245 250 255
Ser Gly Gly Thr Thr Ser Ser Ser Ser Arg Ala Ser Ser Ser Ser Arg 260
265 270 Ala Ser Ser Ser Ser Asn Ala Ala Val Gln Ala Thr Thr Cys Lys
Thr 275 280 285 Pro Leu Ile Thr Tyr Pro Thr Ser Thr Val Pro Ser Asp
Pro Tyr Thr 290 295 300 Ala Cys Phe Lys Tyr Thr Asp Asp Lys Cys Tyr
Val Cys Lys Val Glu 305 310 315 320 Asn Glu Gly Glu Phe Glu Gly Asn
Met Asn Thr Cys Gly Ser Gly Trp 325 330 335 Val Trp Asp Gly Thr Gln
Ile Asp Asn Asn Leu Arg Asp Gly Tyr Trp 340 345 350 Tyr Gln Glu Val
Pro Cys Pro Ala Gly Ser Ser Ser Ser Arg Ser Ser 355 360 365 Ser Ser
Ser Val Ala Val Ser Ser Ser Ser Arg Ser Ser Ser Ser Ser 370 375 380
Val Ala Ala Ser Ser Ser Ser Arg Ser Ser Ser Ser Ser Ala Ser Val 385
390 395 400 Ser Ser Ser Ser Glu Glu Thr Pro Ile Arg Val Leu His Thr
Ile Pro 405 410 415 Ser Lys Phe Arg Val Arg Ser Leu Asn Asn Gly Ala
Leu Gln Ile Glu 420 425 430 Ser Asn Ala Asp Val Val Leu Tyr Leu Tyr
Asp Thr Lys Gly Lys Met 435 440 445 Ala Gln Lys Ile Glu Ala Pro Thr
Gly Ser Ser Ile Val Lys Leu Ser 450 455 460 Val Pro Ala Gly Ile Tyr
Ile Val Arg Asn Val Gln Thr Lys Glu Lys 465 470 475 480 Leu Arg Val
Met Val Arg 485 221461DNAArtificial sequenceSynthesized coding
sequence of M222L mutant of Xy17 22caaggtccca catggactac tagcacaata
caagcttaca acggctacga ctacgagctt 60tggaaccaaa acaacgcagg caccgttagc
atgaaactca cgggagataa tggatcaggt 120gccagcgcgg taggcgggac
gtttacggca acatggagca
acacgcagaa cgtgcttttc 180cgctccggta aaaaatgggg atccagtagt
aaccaaaacc atacgcaaat cggcaatatg 240agcattaact ttgccgctac
atggtcttcc accgacaacg tgaaaatgct cggcgtttac 300ggctgggcgt
atttcacatc ggcaaatgtg ccgacaaaac aagaaaacgg tacaaacgct
360agtttctcca accaaatcga atactatatt attcaagata ggggtagtta
taatccggct 420tcgggaggca ctaacgccaa aaaatacggt tcggctacca
ttgacggcat tgcgtatgat 480ttctatgtat gcgacagaat caatcagcct
atgttaaccg gcaacgggaa tttcaaacaa 540ttcttcagcg ttcctcaaag
cgcttctgcc cacagaacaa gcggtacgat ttctgtttca 600cagcacttta
ataaatggca tgaacttggc atgaagatgg acggtccgtt atatgaggtg
660gcgttgaagg ttgaatctta taccggcagt gggagtagca acggttcggc
aacagttacg 720aagaatcttt tgaccattgg aggcaccacg cctacgccaa
gttccaactc aggcggcaca 780acaagcagct ctagcagagc atcttcttca
agcagagcat cttcttcaag caatgcggcg 840gttcaagcaa ctacttgcaa
aacgcctttg ataacatacc caacaagcac ggtgccttca 900gatccctaca
ccgcctgctt taaatataca gatgacaaat gctatgtttg caaagtggaa
960aatgaaggcg aatttgaagg caacatgaac acttgcggct ctggctgggt
gtgggacggc 1020acgcagatag acaacaattt aagggatggc tattggtatc
aagaagtgcc ttgccctgca 1080ggttcatctt ctagccgttc aagcagctct
tctgtagcgg tttcatcctc tagccgttca 1140agcagctctt ccgtagcggc
atcttcttct agccgttcaa gcagttcgtc tgcatcggtt 1200agcagttcat
cggaagagac tcctatcagg gtgctccaca caattccttc aaaattccgc
1260gttcgctcgc tgaacaacgg agctttgcag attgaaagca atgcggatgt
tgtgctttat 1320ttatacgata ccaaaggaaa aatggctcaa aaaattgaag
ccccaacggg ttcaagcatt 1380gtaaagctat ctgttcccgc tggaatctat
atagtgagaa acgttcaaac caaagaaaaa 1440ctaagggtta tggtgaggta a
146123486PRTArtificial sequenceSynthesized amino acid sequence of
M222L of Xy17 23Gln Gly Pro Thr Trp Thr Thr Ser Thr Ile Gln Ala Tyr
Asn Gly Tyr 1 5 10 15 Asp Tyr Glu Leu Trp Asn Gln Asn Asn Ala Gly
Thr Val Ser Met Lys 20 25 30 Leu Thr Gly Asp Asn Gly Ser Gly Ala
Ser Ala Val Gly Gly Thr Phe 35 40 45 Thr Ala Thr Trp Ser Asn Thr
Gln Asn Val Leu Phe Arg Ser Gly Lys 50 55 60 Lys Trp Gly Ser Ser
Ser Asn Gln Asn His Thr Gln Ile Gly Asn Met 65 70 75 80 Ser Ile Asn
Phe Ala Ala Thr Trp Ser Ser Thr Asp Asn Val Lys Met 85 90 95 Leu
Gly Val Tyr Gly Trp Ala Tyr Phe Thr Ser Ala Asn Val Pro Thr 100 105
110 Lys Gln Glu Asn Gly Thr Asn Ala Ser Phe Ser Asn Gln Ile Glu Tyr
115 120 125 Tyr Ile Ile Gln Asp Arg Gly Ser Tyr Asn Pro Ala Ser Gly
Gly Thr 130 135 140 Asn Ala Lys Lys Tyr Gly Ser Ala Thr Ile Asp Gly
Ile Ala Tyr Asp 145 150 155 160 Phe Tyr Val Cys Asp Arg Ile Asn Gln
Pro Met Leu Thr Gly Asn Gly 165 170 175 Asn Phe Lys Gln Phe Phe Ser
Val Pro Gln Ser Ala Ser Ala His Arg 180 185 190 Thr Ser Gly Thr Ile
Ser Val Ser Gln His Phe Asn Lys Trp His Glu 195 200 205 Leu Gly Met
Lys Met Asp Gly Pro Leu Tyr Glu Val Ala Leu Lys Val 210 215 220 Glu
Ser Tyr Thr Gly Ser Gly Ser Ser Asn Gly Ser Ala Thr Val Thr 225 230
235 240 Lys Asn Leu Leu Thr Ile Gly Gly Thr Thr Pro Thr Pro Ser Ser
Asn 245 250 255 Ser Gly Gly Thr Thr Ser Ser Ser Ser Arg Ala Ser Ser
Ser Ser Arg 260 265 270 Ala Ser Ser Ser Ser Asn Ala Ala Val Gln Ala
Thr Thr Cys Lys Thr 275 280 285 Pro Leu Ile Thr Tyr Pro Thr Ser Thr
Val Pro Ser Asp Pro Tyr Thr 290 295 300 Ala Cys Phe Lys Tyr Thr Asp
Asp Lys Cys Tyr Val Cys Lys Val Glu 305 310 315 320 Asn Glu Gly Glu
Phe Glu Gly Asn Met Asn Thr Cys Gly Ser Gly Trp 325 330 335 Val Trp
Asp Gly Thr Gln Ile Asp Asn Asn Leu Arg Asp Gly Tyr Trp 340 345 350
Tyr Gln Glu Val Pro Cys Pro Ala Gly Ser Ser Ser Ser Arg Ser Ser 355
360 365 Ser Ser Ser Val Ala Val Ser Ser Ser Ser Arg Ser Ser Ser Ser
Ser 370 375 380 Val Ala Ala Ser Ser Ser Ser Arg Ser Ser Ser Ser Ser
Ala Ser Val 385 390 395 400 Ser Ser Ser Ser Glu Glu Thr Pro Ile Arg
Val Leu His Thr Ile Pro 405 410 415 Ser Lys Phe Arg Val Arg Ser Leu
Asn Asn Gly Ala Leu Gln Ile Glu 420 425 430 Ser Asn Ala Asp Val Val
Leu Tyr Leu Tyr Asp Thr Lys Gly Lys Met 435 440 445 Ala Gln Lys Ile
Glu Ala Pro Thr Gly Ser Ser Ile Val Lys Leu Ser 450 455 460 Val Pro
Ala Gly Ile Tyr Ile Val Arg Asn Val Gln Thr Lys Glu Lys 465 470 475
480 Leu Arg Val Met Val Arg 485 241461DNAArtificial
sequenceSynthesized coding sequence of K223M mutant of Xy17
24caaggtccca catggactac tagcacaata caagcttaca acggctacga ctacgagctt
60tggaaccaaa acaacgcagg caccgttagc atgaaactca cgggagataa tggatcaggt
120gccagcgcgg taggcgggac gtttacggca acatggagca acacgcagaa
cgtgcttttc 180cgctccggta aaaaatgggg atccagcagt aaccaaaacc
atacgcaaat cggcaatatg 240agcattaact ttgccgctac atggtcttcc
accgacaacg tgaaaatgct cggcgtttac 300ggctgggcgt atttcacatc
ggcaaatgtg ccgacaaaac aagaaaacgg tacaaacgct 360agtttctcca
accaaatcga atactatatt attcaagata ggggtagtta taatccggct
420tcgggaggca ctaacgccaa aaaatacggt tcggctacca ttgacggcat
tgcgtatgat 480ttctatgtat gcgacagaat caatcagcct atgttaaccg
gcaacgggaa tttcaaacaa 540ttcttcagcg ttcctcaaag cgcttctgcc
cacagaacaa gcggtacgat ttctgtttca 600cagcacttta ataaatggca
tgaacttggc atgaagatgg acggtccgtt atatgaggtg 660gcgatgatgg
ttgaatctta taccggcagt gggagtagca acggttcggc aacagttacg
720aagaatcttt tgaccattgg aggcaccacg cctacgccaa gttccaactc
aggcggcaca 780acaagcagct ctagcagagc atcttcttca agcagagcat
cttcttcaag caatgcggcg 840gttcaagcaa ctacttgcaa aacgcctttg
ataacatacc caacaagcac ggtgccttca 900gatccctaca ccgcctgctt
taaatataca gatgacaaat gctatgtttg caaagtggaa 960aatgaaggcg
aatttgaagg caacatgaac acttgcggct ctggctgggt gtgggacggc
1020acgcagatag acaacaattt aagggatggc tattggtatc aagaagtgcc
ttgccctgca 1080ggttcatctt ctagccgttc aagcagctct tctgtagcgg
tttcatcctc tagccgttca 1140agcagctctt ccgtagcggc atcttcttct
agccgttcaa gcagttcgtc tgcatcggtt 1200agcagttcat cggaagagac
tcctatcagg gtgctccaca caattccttc aaaattccgc 1260gttcgctcgc
tgaacaacgg agctttgcag attgaaagca atgcggatgt tgtgctttat
1320ttatacgata ccaaaggaaa aatggctcaa aaaattgaag ccccaacggg
ttcaagcatt 1380gtaaagctat ctgttcccgc tggaatctat atagtgagaa
acgttcaaac caaagaaaaa 1440ctaagggtta tggtgaggta a
146125486PRTArtificial sequenceSynthesized amino acid sequence of
K223M mutant of Xy17 25Gln Gly Pro Thr Trp Thr Thr Ser Thr Ile Gln
Ala Tyr Asn Gly Tyr 1 5 10 15 Asp Tyr Glu Leu Trp Asn Gln Asn Asn
Ala Gly Thr Val Ser Met Lys 20 25 30 Leu Thr Gly Asp Asn Gly Ser
Gly Ala Ser Ala Val Gly Gly Thr Phe 35 40 45 Thr Ala Thr Trp Ser
Asn Thr Gln Asn Val Leu Phe Arg Ser Gly Lys 50 55 60 Lys Trp Gly
Ser Ser Ser Asn Gln Asn His Thr Gln Ile Gly Asn Met 65 70 75 80 Ser
Ile Asn Phe Ala Ala Thr Trp Ser Ser Thr Asp Asn Val Lys Met 85 90
95 Leu Gly Val Tyr Gly Trp Ala Tyr Phe Thr Ser Ala Asn Val Pro Thr
100 105 110 Lys Gln Glu Asn Gly Thr Asn Ala Ser Phe Ser Asn Gln Ile
Glu Tyr 115 120 125 Tyr Ile Ile Gln Asp Arg Gly Ser Tyr Asn Pro Ala
Ser Gly Gly Thr 130 135 140 Asn Ala Lys Lys Tyr Gly Ser Ala Thr Ile
Asp Gly Ile Ala Tyr Asp 145 150 155 160 Phe Tyr Val Cys Asp Arg Ile
Asn Gln Pro Met Leu Thr Gly Asn Gly 165 170 175 Asn Phe Lys Gln Phe
Phe Ser Val Pro Gln Ser Ala Ser Ala His Arg 180 185 190 Thr Ser Gly
Thr Ile Ser Val Ser Gln His Phe Asn Lys Trp His Glu 195 200 205 Leu
Gly Met Lys Met Asp Gly Pro Leu Tyr Glu Val Ala Met Met Val 210 215
220 Glu Ser Tyr Thr Gly Ser Gly Ser Ser Asn Gly Ser Ala Thr Val Thr
225 230 235 240 Lys Asn Leu Leu Thr Ile Gly Gly Thr Thr Pro Thr Pro
Ser Ser Asn 245 250 255 Ser Gly Gly Thr Thr Ser Ser Ser Ser Arg Ala
Ser Ser Ser Ser Arg 260 265 270 Ala Ser Ser Ser Ser Asn Ala Ala Val
Gln Ala Thr Thr Cys Lys Thr 275 280 285 Pro Leu Ile Thr Tyr Pro Thr
Ser Thr Val Pro Ser Asp Pro Tyr Thr 290 295 300 Ala Cys Phe Lys Tyr
Thr Asp Asp Lys Cys Tyr Val Cys Lys Val Glu 305 310 315 320 Asn Glu
Gly Glu Phe Glu Gly Asn Met Asn Thr Cys Gly Ser Gly Trp 325 330 335
Val Trp Asp Gly Thr Gln Ile Asp Asn Asn Leu Arg Asp Gly Tyr Trp 340
345 350 Tyr Gln Glu Val Pro Cys Pro Ala Gly Ser Ser Ser Ser Arg Ser
Ser 355 360 365 Ser Ser Ser Val Ala Val Ser Ser Ser Ser Arg Ser Ser
Ser Ser Ser 370 375 380 Val Ala Ala Ser Ser Ser Ser Arg Ser Ser Ser
Ser Ser Ala Ser Val 385 390 395 400 Ser Ser Ser Ser Glu Glu Thr Pro
Ile Arg Val Leu His Thr Ile Pro 405 410 415 Ser Lys Phe Arg Val Arg
Ser Leu Asn Asn Gly Ala Leu Gln Ile Glu 420 425 430 Ser Asn Ala Asp
Val Val Leu Tyr Leu Tyr Asp Thr Lys Gly Lys Met 435 440 445 Ala Gln
Lys Ile Glu Ala Pro Thr Gly Ser Ser Ile Val Lys Leu Ser 450 455 460
Val Pro Ala Gly Ile Tyr Ile Val Arg Asn Val Gln Thr Lys Glu Lys 465
470 475 480 Leu Arg Val Met Val Arg 485 261461DNAArtificial
sequenceSynthesized coding sequence of T228S mutant of Xy17
26caaggtccca catggactac tagcacaata caagcttaca acggctacga ctacgagctt
60tggaaccaaa acaacgcagg caccgttagc atgaaactca cgggagataa tggatcaggt
120gccagcgcgg taggcgggac gtttacggca acatggagca acacgcagaa
cgtgcttttc 180cgctccggta aaaaatgggg atccagcagt aaccaaaacc
atacgcaaat cggcaatatg 240agcattaact ttgccgctac atggtcttcc
accgacaacg tgaaaatgct cggcgtttac 300ggctgggcgt atttcacatc
ggcaaatgtg ccgacaaaac aagaaaacgg tacaaacgct 360agtttctcca
accaaatcga atactatatt attcaagata ggggtagtta taatccggct
420tcgggaggca ctaacgccaa aaaatacggt tcggctacca ttgacggcat
tgcgtatgat 480ttctatgtat gcgacagaat caatcagcct atgttaaccg
gcaacgggaa tttcaaacaa 540ttcttcagcg ttcctcaaag cgcttctgcc
cacagaacaa gcggtacgat ttctgtttca 600cagcacttta ataaatggca
tgaacttggc atgaagatgg acggtccgtt atatgaggtg 660gcgatgaagg
ttgaatctta ttccggcagt gggagtagca acggttcggc aacagttacg
720aagaatcttt tgaccattgg aggcaccacg cctacgccaa gttccaactc
aggcggcaca 780acaagcagct ctagcagagc atcttcttca agcagagcat
cttcttcaag caatgcggcg 840gttcaagcaa ctacttgcaa aacgcctttg
ataacatacc caacaagcac ggtgccttca 900gatccctaca ccgcctgctt
taaatataca gatgacaaat gctatgtttg caaagtggaa 960aatgaaggcg
aatttgaagg caacatgaac acttgcggct ctggctgggt gtgggacggc
1020acgcagatag acaacaattt aagggatggc tattggtatc aagaagtgcc
ttgccctgca 1080ggttcatctt ctagccgttc aagcagctct tctgtagcgg
tttcatcctc tagccgttca 1140agcagctctt ccgtagcggc atcttcttct
agccgttcaa gcagttcgtc tgcatcggtt 1200agcagttcat cggaagagac
tcctatcagg gtgctccaca caattccttc aaaattccgc 1260gttcgctcgc
tgaacaacgg agctttgcag attgaaagca atgcggatgt tgtgctttat
1320ttatacgata ccaaaggaaa aatggctcaa aaaattgaag ccccaacggg
ttcaagcatt 1380gtaaagctat ctgttcccgc tggaatctat atagtgagaa
acgttcaaac caaagaaaaa 1440ctaagggtta tggtgaggta a
146127486PRTArtificial sequenceSynthesized amino acid sequence of
T228S mutant of Xy17 27Gln Gly Pro Thr Trp Thr Thr Ser Thr Ile Gln
Ala Tyr Asn Gly Tyr 1 5 10 15 Asp Tyr Glu Leu Trp Asn Gln Asn Asn
Ala Gly Thr Val Ser Met Lys 20 25 30 Leu Thr Gly Asp Asn Gly Ser
Gly Ala Ser Ala Val Gly Gly Thr Phe 35 40 45 Thr Ala Thr Trp Ser
Asn Thr Gln Asn Val Leu Phe Arg Ser Gly Lys 50 55 60 Lys Trp Gly
Ser Ser Ser Asn Gln Asn His Thr Gln Ile Gly Asn Met 65 70 75 80 Ser
Ile Asn Phe Ala Ala Thr Trp Ser Ser Thr Asp Asn Val Lys Met 85 90
95 Leu Gly Val Tyr Gly Trp Ala Tyr Phe Thr Ser Ala Asn Val Pro Thr
100 105 110 Lys Gln Glu Asn Gly Thr Asn Ala Ser Phe Ser Asn Gln Ile
Glu Tyr 115 120 125 Tyr Ile Ile Gln Asp Arg Gly Ser Tyr Asn Pro Ala
Ser Gly Gly Thr 130 135 140 Asn Ala Lys Lys Tyr Gly Ser Ala Thr Ile
Asp Gly Ile Ala Tyr Asp 145 150 155 160 Phe Tyr Val Cys Asp Arg Ile
Asn Gln Pro Met Leu Thr Gly Asn Gly 165 170 175 Asn Phe Lys Gln Phe
Phe Ser Val Pro Gln Ser Ala Ser Ala His Arg 180 185 190 Thr Ser Gly
Thr Ile Ser Val Ser Gln His Phe Asn Lys Trp His Glu 195 200 205 Leu
Gly Met Lys Met Asp Gly Pro Leu Tyr Glu Val Ala Met Lys Val 210 215
220 Glu Ser Tyr Ser Gly Ser Gly Ser Ser Asn Gly Ser Ala Thr Val Thr
225 230 235 240 Lys Asn Leu Leu Thr Ile Gly Gly Thr Thr Pro Thr Pro
Ser Ser Asn 245 250 255 Ser Gly Gly Thr Thr Ser Ser Ser Ser Arg Ala
Ser Ser Ser Ser Arg 260 265 270 Ala Ser Ser Ser Ser Asn Ala Ala Val
Gln Ala Thr Thr Cys Lys Thr 275 280 285 Pro Leu Ile Thr Tyr Pro Thr
Ser Thr Val Pro Ser Asp Pro Tyr Thr 290 295 300 Ala Cys Phe Lys Tyr
Thr Asp Asp Lys Cys Tyr Val Cys Lys Val Glu 305 310 315 320 Asn Glu
Gly Glu Phe Glu Gly Asn Met Asn Thr Cys Gly Ser Gly Trp 325 330 335
Val Trp Asp Gly Thr Gln Ile Asp Asn Asn Leu Arg Asp Gly Tyr Trp 340
345 350 Tyr Gln Glu Val Pro Cys Pro Ala Gly Ser Ser Ser Ser Arg Ser
Ser 355 360 365 Ser Ser Ser Val Ala Val Ser Ser Ser Ser Arg Ser Ser
Ser Ser Ser 370 375 380 Val Ala Ala Ser Ser Ser Ser Arg Ser Ser Ser
Ser Ser Ala Ser Val 385 390 395 400 Ser Ser Ser Ser Glu Glu Thr Pro
Ile Arg Val Leu His Thr Ile Pro 405 410 415 Ser Lys Phe Arg Val Arg
Ser Leu Asn Asn Gly Ala Leu Gln Ile Glu 420 425 430 Ser Asn Ala Asp
Val Val Leu Tyr Leu Tyr Asp Thr Lys Gly Lys Met 435 440 445 Ala Gln
Lys Ile Glu Ala Pro Thr Gly Ser Ser Ile Val Lys Leu Ser 450 455 460
Val Pro Ala Gly Ile Tyr Ile Val Arg Asn Val Gln Thr Lys Glu Lys 465
470 475 480 Leu Arg Val Met Val Arg 485 281461DNAArtificial
sequenceSynthesized coding sequence of K205E,K223T, A386S mutant of
Xyl7 28caaggtccca catggactac tagcacaata caagcttaca acggctacga
ctacgagctt 60tggaaccaaa acaacgcagg caccgttagc atgaaactca cgggagataa
tggatcaggt 120gccagcgcgg taggcgggac gtttacggca acatggagca
acacgcaaaa cgtgcttttc 180cgctccggta aaaaatgggg atccagcagt
aaccaaaacc atacgcaaat cggcaatatg 240agcattaact ttgccgctac
atggtcttcc accgacaacg tgaaaatgct cggcgtttac 300ggctgggcgt
atttcacatc ggcaaatgtg ccgacaaaac aagaaaacgg tacaaacgct
360agtttctcca accaaatcga atactatatt attcaagata ggggtagtta
taatccggct 420tcgggaggca ctaacgccaa aaaatacggt tcggctacca
ttgacggcat tgcgtatgat 480ttctatgtat gcgacagaat caatcagcct
atgttaaccg gcaacgggaa tttcaaacaa 540ttcttcagcg ttcctcaaag
cgcttctgcc cacagaacaa gcggtacgat ttctgtttca 600cagcacttta
atgaatggca tgaacttggc atgaagatgg acggtccgtt atatgaggtg
660gcgatgacgg ttgaatctta taccggcagt gggagtagca acggttcggc
aacagttacg 720aagaatcttt
tgaccattgg aggcaccacg cctacgccaa gttccaactc aggcggcaca
780acaagcagct ctagcagagc atcttcttca agcagagcat cttcttcaag
caatgcggcg 840gttcaagcaa ctacttgcaa aacgcctttg ataacatacc
caacaagcac ggtgccttca 900gatccctaca ccgcctgctt taaatataca
gatgacaaat gctatgtttg caaagtggaa 960aatgaaggcg aatttgaagg
caacatgaac acttgcggct ctggctgggt gtgggacggc 1020acgcagatag
acaacaattt aagggatggc tattggtatc aagaagtgcc ttgccctgca
1080ggttcatctt ctagccgttc aagcagctct tctgtagcgg tttcatcctc
tagccgttca 1140agcagctctt ccgtatcggc atcttcttct agccgttcaa
gcagttcgtc tgcatcggtt 1200agcagttcat cggaagagac tcctatcagg
gtgctccaca caattccttc aaaattccgc 1260gttcgctcgc tgaacaacgg
agctttgcag attgaaagca atgcggatgt tgtgctttat 1320ttatacgata
ccaaaggaaa aatggctcaa aaaattgaag ccccaacggg ttcaagcatt
1380gtaaagctat ctgttcccgc tggaatctat atagtgagaa acgttcaaac
caaagaaaaa 1440ctaagggtta tggtgaggta a 146129486PRTArtificial
sequenceSynthesized amino acid sequence of K205E,K223T, A386S
mutant of Xyl7 29Gln Gly Pro Thr Trp Thr Thr Ser Thr Ile Gln Ala
Tyr Asn Gly Tyr 1 5 10 15 Asp Tyr Glu Leu Trp Asn Gln Asn Asn Ala
Gly Thr Val Ser Met Lys 20 25 30 Leu Thr Gly Asp Asn Gly Ser Gly
Ala Ser Ala Val Gly Gly Thr Phe 35 40 45 Thr Ala Thr Trp Ser Asn
Thr Gln Asn Val Leu Phe Arg Ser Gly Lys 50 55 60 Lys Trp Gly Ser
Ser Ser Asn Gln Asn His Thr Gln Ile Gly Asn Met 65 70 75 80 Ser Ile
Asn Phe Ala Ala Thr Trp Ser Ser Thr Asp Asn Val Lys Met 85 90 95
Leu Gly Val Tyr Gly Trp Ala Tyr Phe Thr Ser Ala Asn Val Pro Thr 100
105 110 Lys Gln Glu Asn Gly Thr Asn Ala Ser Phe Ser Asn Gln Ile Glu
Tyr 115 120 125 Tyr Ile Ile Gln Asp Arg Gly Ser Tyr Asn Pro Ala Ser
Gly Gly Thr 130 135 140 Asn Ala Lys Lys Tyr Gly Ser Ala Thr Ile Asp
Gly Ile Ala Tyr Asp 145 150 155 160 Phe Tyr Val Cys Asp Arg Ile Asn
Gln Pro Met Leu Thr Gly Asn Gly 165 170 175 Asn Phe Lys Gln Phe Phe
Ser Val Pro Gln Ser Ala Ser Ala His Arg 180 185 190 Thr Ser Gly Thr
Ile Ser Val Ser Gln His Phe Asn Glu Trp His Glu 195 200 205 Leu Gly
Met Lys Met Asp Gly Pro Leu Tyr Glu Val Ala Met Thr Val 210 215 220
Glu Ser Tyr Thr Gly Ser Gly Ser Ser Asn Gly Ser Ala Thr Val Thr 225
230 235 240 Lys Asn Leu Leu Thr Ile Gly Gly Thr Thr Pro Thr Pro Ser
Ser Asn 245 250 255 Ser Gly Gly Thr Thr Ser Ser Ser Ser Arg Ala Ser
Ser Ser Ser Arg 260 265 270 Ala Ser Ser Ser Ser Asn Ala Ala Val Gln
Ala Thr Thr Cys Lys Thr 275 280 285 Pro Leu Ile Thr Tyr Pro Thr Ser
Thr Val Pro Ser Asp Pro Tyr Thr 290 295 300 Ala Cys Phe Lys Tyr Thr
Asp Asp Lys Cys Tyr Val Cys Lys Val Glu 305 310 315 320 Asn Glu Gly
Glu Phe Glu Gly Asn Met Asn Thr Cys Gly Ser Gly Trp 325 330 335 Val
Trp Asp Gly Thr Gln Ile Asp Asn Asn Leu Arg Asp Gly Tyr Trp 340 345
350 Tyr Gln Glu Val Pro Cys Pro Ala Gly Ser Ser Ser Ser Arg Ser Ser
355 360 365 Ser Ser Ser Val Ala Val Ser Ser Ser Ser Arg Ser Ser Ser
Ser Ser 370 375 380 Val Ser Ala Ser Ser Ser Ser Arg Ser Ser Ser Ser
Ser Ala Ser Val 385 390 395 400 Ser Ser Ser Ser Glu Glu Thr Pro Ile
Arg Val Leu His Thr Ile Pro 405 410 415 Ser Lys Phe Arg Val Arg Ser
Leu Asn Asn Gly Ala Leu Gln Ile Glu 420 425 430 Ser Asn Ala Asp Val
Val Leu Tyr Leu Tyr Asp Thr Lys Gly Lys Met 435 440 445 Ala Gln Lys
Ile Glu Ala Pro Thr Gly Ser Ser Ile Val Lys Leu Ser 450 455 460 Val
Pro Ala Gly Ile Tyr Ile Val Arg Asn Val Gln Thr Lys Glu Lys 465 470
475 480 Leu Arg Val Met Val Arg 485
* * * * *
References