U.S. patent application number 14/954509 was filed with the patent office on 2016-07-07 for differential gene expression in physiological and pathological angiogenesis.
This patent application is currently assigned to The United States of America, as represented by the Secretary, Department of Health and Human Serv. The applicant listed for this patent is The United States of America, as represented by the Secretary, Department of Health and Human Serv, The United States of America, as represented by the Secretary, Department of Health and Human Serv. Invention is credited to Steven Seaman, Brad St. Croix.
Application Number | 20160194720 14/954509 |
Document ID | / |
Family ID | 38722793 |
Filed Date | 2016-07-07 |
United States Patent
Application |
20160194720 |
Kind Code |
A1 |
St. Croix; Brad ; et
al. |
July 7, 2016 |
DIFFERENTIAL GENE EXPRESSION IN PHYSIOLOGICAL AND PATHOLOGICAL
ANGIOGENESIS
Abstract
Methods of inhibiting pathological angiogenesis in a subject are
disclosed. In particular examples, the method includes
administering a therapeutically effective amount of a composition
to a subject wherein the composition includes a specific binding
agent that preferentially binds to one or more pathological
angiogenesis marker proteins including Vscp, CD276, ETSvg4 (Pea3),
CD137(4-1BB), MiRP2, Ubiquitin D (Fat10), Doppel (prion-PLP),
Apelin, Plgf, Ptprn (IA-2), CD109, Ankylosis, and collagen
VIII.alpha.1. In additional examples, methods to deliver a
therapeutic agent to a brain or liver endothelial cell are also
disclosed.
Inventors: |
St. Croix; Brad; (Frederick,
MD) ; Seaman; Steven; (Martinsburg, WV) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The United States of America, as represented by the Secretary,
Department of Health and Human Serv |
Bethesda |
MD |
US |
|
|
Assignee: |
The United States of America, as
represented by the Secretary, Department of Health and Human
Serv
Bethesda
MD
|
Family ID: |
38722793 |
Appl. No.: |
14/954509 |
Filed: |
November 30, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13863674 |
Apr 16, 2013 |
|
|
|
14954509 |
|
|
|
|
13052878 |
Mar 21, 2011 |
8440411 |
|
|
13863674 |
|
|
|
|
12514297 |
May 8, 2009 |
|
|
|
PCT/US2007/072395 |
Jun 28, 2007 |
|
|
|
13052878 |
|
|
|
|
60858068 |
Nov 9, 2006 |
|
|
|
60879457 |
Jan 8, 2007 |
|
|
|
Current U.S.
Class: |
424/133.1 ;
424/178.1; 424/183.1; 506/9 |
Current CPC
Class: |
C12N 15/1072 20130101;
G01N 33/574 20130101; A61K 45/06 20130101; C12Q 2600/158 20130101;
A61K 39/39558 20130101; A61P 35/04 20180101; G01N 33/57496
20130101; A61P 35/00 20180101; G01N 33/6893 20130101; G01N 33/57492
20130101; G01N 33/57407 20130101; C12Q 2600/16 20130101; C12Q
1/6886 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; G01N 33/574 20060101 G01N033/574 |
Claims
1. A method of determining pathological angiogenesis, comprising:
a) contacting a sample obtained from a subject with a first probe,
antibody, or primer set capable of detecting at least a first
expression product selected from the group consisting of Vscp,
ETSvg4 (Pea3), CD137(4-1BB), MiRP2, Ubiquitin D (Fat10), Doppel
(prion-PLP), Apelin, Plgf, CD109, Ankylosis, and collagen VIII and
a second probe, antibody, or primer set capable of detecting at
least a second expression product selected from the group
consisting of Vscp, ETSvg4 (Pea3), CD137(4-1BB), MiRP2, Ubiquitin D
(Fat10), Doppel (prion-PLP), Apelin, Plgf, CD109, Ankylosis, and
collagen VIII, in a sample obtained from the subject; b) detecting
the at least first expression product and the at least second
expression product in the sample obtained from the subject by
performing an assay that detects both the at least first and second
expression products; and c) determining the presence of
pathological angiogenesis in the subject by comparing expression
level of the first expression product and the second expression
product in the sample obtained from the subject with the expression
level of the first expression product and second expression product
in a control sample, wherein detection of an increase in expression
of the at least first and second expression products as compared to
expression of the at least first and second expression products in
a control sample indicates pathological angiogenesis.
2. The method of claim 1, wherein detection of an increase in
expression of the at least first and second expression products
indicates the presence of a tumor.
3. The method of claim 2, wherein the expression products are RNA
or protein.
4. The method of claim 2, wherein the tumor is a cancer of the
colon, liver, lung, breast, or ovary.
5. The method of claim 1, wherein the detecting the at least first
and second expression products is performed using serial analysis
gene expression (SAGE), polymerase chain reaction, Western blot,
immunoassay, microscopy, flow cytometry, spectrometry, or a
combination thereof.
6. The method of claim 1, wherein the sample is serum sample.
7. The method of claim 1, wherein the method is used to detect the
efficacy of an anti-angiogenic agent for treating pathological
angiogenesis.
8-20. (canceled)
21. The method of claim 2, wherein the tumor is a sarcoma.
22. The method of claim 2, wherein the tumor is a CNS tumor.
23. The method of claim 22, wherein the CNS tumor is a glioma.
24. The method of claim 1, further comprising d) treating the
subject for pathological angiogenesis and/or cancer.
25. The method of claim 1, wherein the subject is a veterinary
subject.
26. The method of claim 24, wherein the veterinary subject is a
dog.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This is a continuation of U.S. application Ser. No.
13/863,674, filed Apr. 16, 2013, which is a divisional of U.S.
application Ser. No. 13/052,878, filed Mar. 21, 2011, which is a
continuation of U.S. application Ser. No. 12/514,297, filed May 8,
2009, now abandoned, which is the U.S. National Stage of
International Application No. PCT/US2007/072395, filed Jun. 28,
2007, which was published in English under PCT Article 21(2), which
in turn claims the benefit of U.S. Provisional Application No.
60/858,068, filed on Nov. 9, 2006 and U.S. Provisional Application
No. 60/879,457, filed on Jan. 8, 2007. The entire disclosures of
the prior applications are considered to be part of the disclosure
of the accompanying application and are hereby incorporated by
reference.
FIELD
[0002] The present disclosure relates to the field of angiogenesis
and endothelial cell markers and in particular, to pathological
angiogenesis endothelial markers and organ-specific endothelial
markers and methods of their uses.
BACKGROUND
[0003] Inhibition of tumor angiogenesis is an anticancer strategy
that has gained widespread support from biologists and clinicians.
In 1971, Dr. Judah Folkman introduced the concept of an "angiogenic
switch" driving tumor growth and malignant progression. There have
since been numerous scientific reports confirming the central
concept that tumor growth is angiogenesis-dependent. Angiogenesis
can occur under "normal" physiological conditions, such as during
growth and development or wound healing, as well as under
"pathological" conditions, such as in the transition of tumors from
a dormant state to a malignant state. The dependency of solid
tumors on new vessel growth has made tumor vessels an appealing
target for cancer therapy.
[0004] Angiogenesis-based tumor therapy has several theoretical
advantages over traditional cancer therapies (such as radiation and
chemotherapy). Anti-angiogenesis therapy targets endothelial cells
that line tumor vessels instead of the tumor cells themselves.
Tumor cells evolve resistance to cancer therapies due to genomic
instability (high variation) and rapid generation time (days). In
contrast, endothelial cells have a higher genomic stability (low
variation) and a longer generation time (months) compared to tumor
cells. Endothelial cells are less likely to "escape" therapy
because they will not undergo mitosis at such a rapid rate and
carry any drug resistance variation through to the next generation
within the lifespan of the therapy. Thus, the genomic stability of
endothelial cells coupled with their longevity make them an
attractive target for therapies directed against them.
[0005] Tumor endothelial markers (TEMs) were reported by St. Croix
et al. (Science, 289: 1197-1201, 2000). St. Croix et al. employed
serial analysis of gene expression (SAGE.TM.) technology to compare
small populations of normal and tumor-derived endothelial cells.
The comparison revealed 79 genes that are potentially involved in
angiogenesis. Of these, 46 genes were specifically expressed at
least ten times higher in tumor-associated endothelium as compared
to normal endothelium from the same patient.
[0006] The use of targeted drug delivery to inhibit tumor growth by
interfering with angiogenesis has recently proven to be successful.
For example, bevacizumab (Avastin.RTM.), an antibody that
neutralizes vascular endothelial growth factor (VEGF; one of the
many proteins involved in the development of a new network of blood
vessels), has been approved by the FDA to treat colorectal cancer.
A remaining challenge, however, is to identify markers that can
differentiate pathological and physiological angiogenesis in order
to selectively deliver therapeutic agents to diseased tissues while
minimizing the potential side effects of the targeted therapy.
SUMMARY
[0007] Disclosed herein are angiogenesis-specific endothelial
markers, including some specific for pathological angiogenesis.
Endothelial cells were isolated from normal, regenerating, and
tumor-bearing livers. Gene expression profiles amongst the multiple
samples were compared by performing serial analysis of gene
expression (SAGE) on the isolated endothelial cells. The
identification of markers highly specific for physiological or
pathological angiogenesis has significant implications for the
development of selective vascular targeted therapies. Thus, methods
of reducing or inhibiting pathological angiogenesis in a subject
are disclosed.
[0008] In one example, the method includes administering a
therapeutically effective amount of a composition that includes one
or more binding agents (such as an antibody) that specifically
binds to one or more of the following pathological angiogenesis
marker proteins: Vscp, CD276, ETSvg4 (Pea3), CD137(4-1BB), MiRP2,
Ubiquitin D (Fat10), Doppel (prion-PLP), Apelin, Plgf, Ptprn
(IA-2), CD109, Ankylosis, and collagen VIII.alpha.1, thereby
inhibiting pathological angiogenesis in the subject. In a further
example, the binding agent is conjugated to one or more therapeutic
molecules, such as chemotherapy agents, cytoxins, radionucleotides
or a combination thereof.
[0009] Methods are disclosed for screening for pathological
angiogenesis in a subject. In particular examples, the method
includes detecting at least one expression product including one or
more of: Vscp, CD276, ETSvg4 (Pea3), CD137(4-1BB), MiRP2, Ubiquitin
D (Fat10), Doppel (prion-PLP), Apelin, Plgf, Ptprn (IA-2), CD109,
Ankylosis, and collagen VIII, 1 in a sample obtained from the
subject. Detection of the at least one expression product can
indicate the presence of pathological angiogenesis in the
subject.
[0010] In addition, disclosed herein are 27 brain-specific
endothelial markers and 15 liver-specific endothelial markers.
These organ-specific endothelial markers can serve as therapeutic
targets to allow molecular agents to be selectively delivered to
specific anatomical sites. Similarly, these organ-specific
endothelial markers can serve as diagnostic targets to allow
diagnostic agents (such as imaging agents) to be selectively
delivered to specific anatomical sites. Thus, methods of delivering
a therapeutic agent to organ-specific endothelial cells are
provided.
[0011] Methods are disclosed for delivering a therapeutic or
diagnostic agent to brain endothelial cells. In particular
examples, the method includes administering a therapeutically
effective amount of a composition that includes a therapeutic
binding agent that preferentially binds to one or more brain
endothelial marker proteins. Such a method can evoke a therapeutic
response in the brain endothelial cells or permit detection of the
cells. In certain cases brain endothelial markers may also
facilitate the selectively delivery of therapeutic agents across
the blood-brain barrier to underlying neuronal cells via
transcytosis. The one or more brain endothelial markers can include
Glucose transporter GLUT-1, Organic anion transporter 2,
Pleiotrophin, ATPase class V, type 10A, Peptidoglycan recognition
protein 1, Organic anion transporter 14, Forkhead box Q1, Organic
anion transporter 3, SN2 (Solute carrier family 38, member 5),
Inter-alpha (globulin) inhibitor H5, Solute carrier 38 member 3,
Zinc finger protein of the cerebellum 2, Testican-2, 3-HMG-CoA
synthase 2, Progestin and adipoQ receptor family member V, APC
down-regulated 1 Drapc1, GDPD phosphodiesterase family Accession
No. NM_001042671, putative transmembrane protein Accession No.
NM_029001, DES2 lipid desaturase/C4-hyroxylase, Kelch repeat and
BTB (POZ) domain, Lipolysis stimulated receptor, Glutathione
S-transferase alpha 4, TNF receptor superfamily member 19, T-box 1,
putative secreted protein Accession No. XM_620023 or combinations
thereof.
[0012] Methods are disclosed for delivering a therapeutic or
diagnostic agent to liver endothelial cells. In particular
examples, the method includes administering a therapeutically
effective amount of a composition that includes a binding agent
that specifically binds to one or more liver endothelial marker
proteins (e.g., deoxyribonuclease 1-like 3, LZP oncoprotein induced
transcript 3, putative transmembrane protein Accession No.
NM_023438, CD32 15, putative G-protein coupled receptor NM_033616,
C-type lectin-like receptor 2, C-type lectin domain family 4 member
g 16, Plexin C1, Wnt9B, Accession No. AK144596, GATA-binding
protein 4, MBL-associated serine protease-3, Renin binding protein,
putative transmembrane protein Accession No. NM_144830, or Retinoic
acid receptor, beta) and a therapeutic agent. Such a method can
evoke a therapeutic response in the liver endothelial cells or
permit detection of the cells.
[0013] The foregoing and other features of the disclosure will
become more apparent from the following detailed description, which
proceeds with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] FIG. 1A includes digital images of heart tissue stained with
immunofluorescently-labeled CD105 (left panel), VE-cadherin (middle
panel) or both CD105 and VE-cadherin (right panel). Scale bar, 20
.mu.m.
[0015] FIG. 1B is a digital image of liver tissue stained with
immunofluorescently-labeled CD105. Scale bar, 20 .mu.m.
[0016] FIG. 1C is a bar graph showing the relative amount of
VE-cadherin detected by quantitative polymerase chain reaction
(QPCR) in cDNA isolated from unfractionated normal whole tissues
(WT), purified endothelial cells (ECs) isolated from normal tissues
(N-ECs) or purified ECs isolated from tumors (T-ECs).
[0017] FIG. 1D is a schematic of a model used to identify genes
expressed during pathological, but not physiological angiogenesis.
ECs were isolated from normal resting livers, regenerating livers,
or tumor bearing livers.
[0018] FIGS. 2A, 2B and 2C are bar graphs illustrating the
expression of various genes in (FIG. 2A) resting normal ECs, (FIG.
2B) regenerating liver ECs and (FIG. 2C) tumor ECs, respectively.
The expression of the various genes was evaluated by real-time
Q-PCR and compared with that of Srnp70, a gene expressed at nearly
identical levels in all ECs as detected by SAGE.
[0019] FIGS. 3A-3I are digital images of various mRNA expressed by
ECs in vivo detected by staining samples with Oatp2 (FIG. 3A),
CD276 (FIG. 3B), ETSvg4 (FIG. 3C), Apelin (FIG. 3D), CD109 (FIG.
3E), MiRP2 (FIG. 3F), CD137 (FIG. 3G), Doppel (FIG. 3H and Vscp
(FIG. 3I). (a) is representative of a brain endothelial marker in
brain tissue, (b) and (c) depict HCT116 tumors grown
subcutaneously, (d-f) depict SW620 tumors grown subcutaneously, and
(g-h) depict KM12 tumors grown in the liver. A dilute counterstain
was applied to the sections to highlight the lack of detectable
expression in the non-ECs of the tumors. Scale bars, 50 .mu.M.
[0020] FIG. 4A includes digital images of human colon samples
stained with immunoflurescently labeled CD276 and von Willebrand
factor (vWF). CD276 was expressed predominantly by the tumor
vessels of the colorectal cancer, but was also expressed at a lower
level by the tumor cells themselves. Expression of CD276 in normal
colonic mucosa was undetectable (top middle panel). As a control,
vessels were stained for vWF, which co-localized with CD276 only in
the tumor sample. Scale bar, 100 .mu.m.
[0021] FIG. 4B includes digital images of angiogenic vessels of the
developing corpus luteum stained with immunoflurescently-labeled
CD276. CD276 expression was undetectable in the angiogenic vessels
of the developing corpus luteum. Sections were counterstained with
DAPI which is shown in the left panels to highlight the epithelial
cells. Scale bar, 200 .mu.m.
[0022] FIG. 5 includes digital images of vessels of human
colorectal cancer. In situ hybridization revealed that CD276 mRNA
is expressed predominantly in the vessels of human colorectal
cancer (middle panel) with a pattern of staining similar to that of
the control endothelial marker VEGFR2 (left panel). In the case of
CD276 the tumor cells also display positive staining, albeit less
intense. At the margin between tumor (T) tissue and normal (N)
colonic mucosa CD276 staining abruptly ends (right panel). The
extracellular staining around the normal crypts represents
non-specific binding of the in situ hybridization reagents to the
mucous (right panel) and is also present in control sections. Scale
bars, 50 .mu.M.
[0023] FIG. 6A is a digital image of an immunoblot including
colorectal tumor (T) and normal (N) colonic mucosa samples.
Immunoblotting with a CD276 monoclonal antibody revealed an
upregulation of CD276 protein in colorectal tumors (T) compared to
normal (N) colonic mucosa.
[0024] FIG. 6B is a digital image of an immunoblot including lung
tumor (T) and normal (N) adjacent lung tissue samples.
Immunoblotting with a CD276 monoclonal antibody revealed an
upregulation of CD276 protein in lung tumors (T) compared to normal
(N) adjacent lung tissue. The normal tissues in A and B were
classified as normal based on gross morphology, but microscopic
disease or inflammatory host cells may have contributed to the low
level CD276 expression observed in these tissues.
[0025] FIGS. 6C-6L are digital images of various samples stained
with a polyclonal CD276 antibody. Immunohistochemical staining with
a polyclonal CD276 antibody revealed a vessel-like pattern in
colorectal cancer (FIGS. 6C-E), non-small cell lung cancer (FIGS.
6F-H), esophageal cancer (I-J), bladder cancer (FIG. 6K) and breast
cancer (FIG. 6L). At the tumor margin (FIG. 6E) CD276 staining was
weak or undetectable in normal colonic mucosa (N) but strong in the
vessels of the adjacent tumor region (T). Vessels from normal
tissues that failed to stain for CD276 were immunoreactive on
control serial sections stained for endothelial proteins such as
vWF. In some tumors, the vessels stained most prominently (FIGS.
6C-E and FIGS. 6H-K) whereas in others, both tumor cells and tumor
vessels were strongly positive (FIGS. 6F-G and L). A strong cell
surface staining pattern in the tumor epithelium was detected under
high power magnification (FIG. 6G). Many of the blood vessels were
readily identified by the presence of blood cells in the lumen; for
example see inset displaying higher power magnification of boxed
region in (FIG. 6H). Sections were lightly counterstained with
hematoxylin. Scale bar, 50 .mu.M.
[0026] FIG. 7 is a digital image of amplification products
generated in tumor cell lines or tumor endothelial cells in the
presence of VE-cadherin, Ubiquitin D or .beta.-actin primers.
RT-PCR was used to verify that Ubiquitin D is expressed by the
tumor endothelial cells (TECs) and not the tumor cells
themselves.
[0027] FIG. 8 is a digital image of an immunoblot including protein
extracts from three subjects with either normal colonic mucosa (N)
or colorectal tumors (T). CD137 expression was elevated in protein
extracts of human colorectal cancer.
[0028] FIG. 9A includes digital images of LEM and BEM genes
identified by SAGE are expressed by ECs in vivo. Localization of
mRNA in ECs was demonstrated for the brain endothelial markers
GLUT-1 (BEM1) and organic anion transporter 2 (BEM2), and the liver
endothelial markers deoxyribonuclease 1-like 3 (LEM1) and oncogenes
induced transcript 3 (LEM2). The BEMs are selectively expressed in
brain endothelium whereas the LEMs are selectively expressed in
liver endothelium. The endothelial control probe, VEGFR2, stains
both brain and liver endothelium. Staining of LEMs is most
prominent in the sinusoidal endothelium, wherein the nuclear body
appears to stain most intensely. A dilute counterstain was applied
to the sections to highlight the lack of detectable expression in
the non-ECs of the tissues. Scale bars, 50 .mu.M
[0029] FIG. 9B includes digital images of localization of Apelin
and Doppel mRNA in subcutaneous implanted LLC tumors.
DETAILED DESCRIPTION
I. Introduction
[0030] Angiogenesis is critical for the progression of many
diseases, including age-related macular degeneration and cancer.
Markers that can distinguish physiological and pathological
angiogenesis are needed in order to selectively deliver
anti-angiogenic or vascular targeting agents to diseased tissues
and minimize the potential side effects of the targeted therapy.
Physiological and pathological angiogenesis are morphologically
distinct. However, the extent of differential gene expression
between these cellular states has remained elusive. Most of the
well-studied molecules thought to regulate tumor angiogenesis, such
as vascular endothelial growth factor (VEGF), basic fibroblast
growth factor (bFGF), the angiopoietins, and their receptors, also
regulate normal physiological angiogenesis.
[0031] The inventors have identified twenty-five
angiogenesis-specific endothelial markers, including thirteen that
are specific for pathological angiogenesis. The genes specific for
pathological angiogenesis were primarily cell surface molecules.
Therefore, this disclosure provides several molecules that can be
used for the therapeutic targeting of tumor vessels. For example, a
binding agent specific to one or more of the disclosed pathological
angiogenesis endothelial marker proteins can be used for targeted
drug delivery to the tumor site. Further, linking or conjugating
the binding agent to a chemical or radioactive toxin can provide a
targeted cytotoxic therapy. In another or additional example, a
binding agent specific to one or more of the disclosed pathological
angiogenesis endothelial marker proteins is labeled with an imaging
tag, such as a fluorophore, thereby providing diagnostic imaging
agents.
[0032] Therefore, methods of reducing or inhibiting pathological
angiogenesis are provided, in some examples a therapeutically
effective amount of a binding agent that specifically binds to at
least one of the disclosed pathological angiogenesis endothelial
marker proteins is administered to a subject. As a result,
pathological angiogenesis in the subject is thereby reduced or
inhibited. Additional methods of diagnosing or treating a tumor are
also provided.
[0033] The present disclosure also provides twenty-seven
brain-specific endothelial markers and fifteen liver-specific
endothelial markers. These organ-specific endothelial markers can
aid in the selective delivery of therapeutic and diagnostic agents
to specific anatomical sites. For example, methods are disclosed
for delivering a therapeutic or diagnostic agent to brain
endothelial cells. In particular examples, the method includes
administering a therapeutically effective amount of a binding
agent, such as an antibody, that specifically binds to at least one
of the disclosed brain endothelial markers, thereby evoking a
therapeutic response in the brain endothelial cells or permitting
imaging of the brain endothelial cells. In another example, the
binding agent, upon binding at least one of the disclosed brain
endothelial markers, would enable the delivery of the agent, via
mechanisms such as transcytosis, across the blood-brain barrier to
the particular cells underlying the brain endothelium, such as
neuronal cells.
[0034] In a further example, the method includes delivering a
therapeutic agent to liver endothelial cells by administering a
therapeutically effective amount of a binding agent that
specifically binds to at least one of the disclosed liver
endothelial marker proteins, thereby evoking a therapeutic response
in the liver endothelial cells or permitting imaging of the liver
endothelial cells.
II. Terms and Abbreviations
[0035] Abbreviations [0036] BEMs brain endothelial markers [0037]
cDNA: complementary DNA [0038] ECs: endothelial cells [0039] LEMs
liver endothelial markers [0040] .mu.g: microgram [0041] .mu.l:
microliter [0042] M: molar [0043] QPCR: quantitative PCR [0044]
PCR: polymerase chain reaction [0045] SAGE: serial analysis of gene
expression
[0046] The following explanations of terms and methods are provided
to better describe the present disclosure and to guide those of
ordinary skill in the art in the practice of the present
disclosure. As used herein and in the appended claims, the singular
forms "a" or "an" or "the" include plural references unless the
context clearly dictates otherwise. For example, reference to "an
endothelial marker" includes a plurality of such markers and
reference to "the antibody" includes reference to one or more
antibodies and equivalents thereof known to those skilled in the
art, and so forth. The term "or" refers to a single element of
stated alternative elements or a combination of two or more
elements, unless the context clearly indicates otherwise. As used
herein, "comprises" means "includes." Thus, "comprising A or B,"
means "including A, B, or A and B," without excluding additional
elements.
[0047] Unless explained otherwise, all technical and scientific
terms used herein have the same meaning as commonly understood to
one of ordinary skill in the art to which this disclosure
belongs.
[0048] Administration: To provide or give a subject an agent, such
as a composition that includes a binding agent that specifically
binds to one or more of the disclosed pathological angiogenesis
endothelial marker proteins (such as those listed in Tables 8 and
9) by any effective route. Exemplary routes of administration
include, but are not limited to, oral, injection (such as
subcutaneous, intramuscular, intradermal, intraperitoneal,
intravenous, and intratumoral), sublingual, rectal, transdermal,
intranasal, vaginal and inhalation routes.
[0049] Agent: Any protein, nucleic acid molecule, compound, small
molecule, organic compound, inorganic compound, or other molecule
of interest. Agent can include a therapeutic agent, a diagnostic
agent or a pharmaceutical agent. A therapeutic or pharmaceutical
agent is one that alone or together with an additional compound
induces the desired response (such as inducing a therapeutic or
prophylactic effect when administered to a subject). In a
particular example, a pharmaceutical agent (such as an antibody to
any of the proteins listed in Tables 8 and 9 conjugated to a
therapeutic agent) significantly reduces angiogenesis.
[0050] Angiogenesis: A physiological process involving the growth
of new blood vessels from pre-existing vessels.
[0051] Angiogenesis can occur under normal physiological conditions
such as during growth and development or wound healing (known as
physiological angiogenesis) as well as pathological conditions such
as in the transition of tumors from a dormant state to a malignant
state (known as pathological angiogenesis).
[0052] Ankylosis: The ANK protein, the product of the progressive
ankylosis (ank) gene, is a multipass transmembrane protein that is
highly conserved in vertebrates. The ANK protein has been shown to
control pyrophosphate levels in cells and may act as a
pyrophosphate transporter that stimulates the elaboration of
extracellular pyrophosphate from intracellular stores. The term
ankylosis includes any ankylosis gene, cDNA, mRNA, or protein from
any organism and that is ankylosis and is increased during
pathological angiogenesis relative to either normal or
physiological angiogenesis conditions. In one example, ANK protein
is expressed during pathological angiogenesis.
[0053] Exemplary nucleic acid and protein sequences for ankylosis
are publicly available. For example, GenBank Accession Nos.:
DQ832285, NM_020332, AK083135, BCO54379, AY358503, and NM_054027
disclose ankylosis nucleic acid sequences and GenBank Accession
Nos.: AAF88038, Q9JHZ2, XP_001132013, NP_473368, and Q9HCJ1
disclose ankylosis protein sequences.
[0054] In one example, ankylosis includes a full-length wild-type
(or native) sequence, as well as ankylosis allelic variants,
fragments, homologs or fusion sequences that retain the ability to
be preferentially expressed during pathological angiogenesis and/or
modulate pathological angiogenesis. In certain examples, ankylosis
has at least 80% sequence identity, for example at least 85%, 90%,
95%, or 98% sequence identity to ankylosis. In other examples,
ankylosis has a sequence that hybridizes under very high stringency
conditions to a sequence set forth in GenBank Accession No.
DQ832285, NM_020332, AK083135, BCO54379, AY358503, or NM_054027 and
retains ankylosis activity (e.g., the capability to be expressed
during pathological angiogenesis and/or modulate pathological
angiogenesis).
[0055] Antibody: A polypeptide ligand including at least a light
chain or heavy chain immunoglobulin variable region which
specifically recognizes and binds an epitope of an antigen, such as
an endothelial marker or a fragment thereof. Antibodies are
composed of a heavy and a light chain, each of which has a variable
region, termed the variable heavy (VH) region and the variable
light (VL) region. Together, the VH region and the VL region are
responsible for binding the antigen recognized by the antibody. In
one example, an antibody specifically binds to one of the proteins
listed in Tables 8 and 9.
[0056] This includes intact immunoglobulins and the variants and
portions of them well known in the art, such as Fab' fragments,
F(ab)'2 fragments, single chain Fv proteins ("scFv"), and disulfide
stabilized Fv proteins ("dsFv"). A scFv protein is a fusion protein
in which a light chain variable region of an immunoglobulin and a
heavy chain variable region of an immunoglobulin are bound by a
linker, while in dsFvs, the chains have been mutated to introduce a
disulfide bond to stabilize the association of the chains. The term
also includes genetically engineered forms such as chimeric
antibodies (for example, humanized murine antibodies),
heteroconjugate antibodies (such as, bispecific antibodies). See
also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co.,
Rockford, Ill.); Kuby, J., Immunology, 3.sup.rd Ed., W.H. Freeman
& Co., New York, 1997.
[0057] Typically, a naturally occurring immunoglobulin has heavy
(H) chains and light (L) chains interconnected by disulfide bonds.
There are two types of light chain, lambda (.lamda.) and kappa (k).
There are five main heavy chain classes (or isotypes) which
determine the functional activity of an antibody molecule: IgM,
IgD, IgG, IgA and IgE.
[0058] Each heavy and light chain contains a constant region and a
variable region, (the regions are also known as "domains"). In
combination, the heavy and the light chain variable regions
specifically bind the antigen. Light and heavy chain variable
regions contain a "framework" region interrupted by three
hypervariable regions, also called "complementarity-determining
regions" or "CDRs". The extent of the framework region and CDRs
have been defined (see, Kabat et al., Sequences of Proteins of
Immunological Interest, U.S. Department of Health and Human
Services, 1991, which is hereby incorporated by reference). The
Kabat database is now maintained online. The sequences of the
framework regions of different light or heavy chains are relatively
conserved within a species. The framework region of an antibody,
that is the combined framework regions of the constituent light and
heavy chains, serves to position and align the CDRs in
three-dimensional space.
[0059] The CDRs are primarily responsible for binding to an epitope
of an antigen. The CDRs of each chain are typically referred to as
CDR1, CDR2, and CDR3, numbered sequentially starting from the
N-terminus, and are also typically identified by the chain in which
the particular CDR is located. Thus, a V.sub.H CDR3 is located in
the variable domain of the heavy chain of the antibody in which it
is found, whereas a V.sub.L CDR1 is the CDR1 from the variable
domain of the light chain of the antibody in which it is found. An
antibody that binds RET will have a specific V.sub.H region and the
V.sub.L region sequence, and thus specific CDR sequences.
Antibodies with different specificities (i.e. different combining
sites for different antigens) have different CDRs. Although it is
the CDRs that vary from antibody to antibody, only a limited number
of amino acid positions within the CDRs are directly involved in
antigen binding. These positions within the CDRs are called
specificity determining residues (SDRs).
[0060] References to "V.sub.H" or "VH" refer to the variable region
of an immunoglobulin heavy chain, including that of an Fv, scFv,
dsFv or Fab. References to "V.sub.L" or "VL" refer to the variable
region of an immunoglobulin light chain, including that of an Fv,
scFv, dsFv or Fab.
[0061] A "monoclonal antibody" is an antibody produced by a single
clone of B-lymphocytes or by a cell into which the light and heavy
chain genes of a single antibody have been transfected. Monoclonal
antibodies are produced by methods known to those of skill in the
art, for instance by making hybrid antibody-forming cells from a
fusion of myeloma cells with immune spleen cells. Monoclonal
antibodies include humanized monoclonal antibodies.
[0062] A "polyclonal antibody" is an antibody that is derived from
different B-cell lines. Polyclonal antibodies are a mixture of
immunoglobulin molecules secreted against a specific antigen, each
recognising a different epitope. These antibodies are produced by
methods known to those of skill in the art, for instance, by
injection of an antigen into a suitable mammal (such as a mouse,
rabbit or goat) that induces the B-lymphocytes to produce IgG
immunoglobulins specific for the antigen which are then purified
from the mammal's serum.
[0063] A "chimeric antibody" has framework residues from one
species, such as human, and CDRs (which generally confer antigen
binding) from another species, such as a murine antibody that
specifically binds an endothelial marker.
[0064] A "humanized" immunoglobulin is an immunoglobulin including
a human framework region and one or more CDRs from a non-human (for
example a mouse, rat, or synthetic) immunoglobulin. The non-human
immunoglobulin providing the CDRs is termed a "donor," and the
human immunoglobulin providing the framework is termed an
"acceptor." In one embodiment, all the CDRs are from the donor
immunoglobulin in a humanized immunoglobulin. Constant regions need
not be present, but if they are, they are substantially identical
to human immunoglobulin constant regions, e.g., at least about
85-90%, such as about 95% or more identical. Hence, all parts of a
humanized immunoglobulin, except possibly the CDRs, are
substantially identical to corresponding parts of natural human
immunoglobulin sequences. Humanized immunoglobulins can be
constructed by means of genetic engineering (see for example, U.S.
Pat. No. 5,585,089).
[0065] Binding affinity: Affinity of one molecule for another, such
as an antibody for an antigen (for example, the antigens shown in
Tables 8 and 9). In one example, affinity is calculated by a
modification of the Scatchard method described by Frankel et al.,
Mol. Immunol., 16:101-106, 1979. In another example, binding
affinity is measured by an antigen/antibody dissociation rate. In
yet another example, a high binding affinity is measured by a
competition radioimmunoassay. In several examples, a high binding
affinity is at least about 1.times.10.sup.-8 M. In other examples,
a high binding affinity is at least about 1.5.times.10.sup.-8, at
least about 2.0.times.10.sup.-8, at least about
2.5.times.10.sup.-8, at least about 3.0.times.10.sup.-8, at least
about 3.5.times.10.sup.-8, at least about 4.0.times.10.sup.-8, at
least about 4.5.times.10.sup.-8, or at least about
5.0.times.10.sup.-8 M.
[0066] Biological activity: An expression describing the beneficial
or adverse effects of an agent on living matter. When the agent is
a complex chemical mixture, this activity is exerted by the
substance's active ingredient or pharmacophore, but can be modified
by the other constituents. Activity is generally dosage-dependent
and it is not uncommon to have effects ranging from beneficial to
adverse for one substance when going from low to high doses. In one
example, a specific binding agent significantly reduces the
biological activity of the one or more pathological angiogenesis
marker proteins (such as those listed in Table 9) which in turn
inhibits pathological angiogenesis.
[0067] Cancer: Malignant neoplasm that has undergone characteristic
anaplasia with loss of differentiation, increase rate of growth,
invasion of surrounding tissue, and is capable of metastasis.
[0068] CD276: A member of the B7 family of immunoregulatory
molecules that can be induced on T-cells, macrophages and dendritic
cells by a variety of inflammatory cytokines. Its homology to other
co-stimulatory molecules indicates it may have an immunoregulatory
role. In particular examples, expression of CD276 is increased
during pathological angiogenesis. The term CD276 includes any CD276
gene, cDNA, mRNA, or protein from any organism and that is CD276
and is expressed during pathological angiogenesis.
[0069] Nucleic acid and protein sequences for CD276 are publicly
available. For example, GenBank Accession Nos.: DQ832276,
NM_001024736, AK031354, AK155114, NM_133983, and NM_025240 disclose
CD276 nucleic acid sequences, and GenBank Accession Nos.:
NP_598744, NP_079516, and AAK15438 disclose CD276 protein
sequences.
[0070] In one example, CD276 includes a full-length wild-type (or
native) sequence, as well as CD276 allelic variants, fragments,
homologs or fusion sequences that retain the ability to be
expressed during pathological angiogenesis and/or modulate
pathological angiogenesis. In certain examples, CD276 has at least
80% sequence identity, for example at least 85%, 90%, 95%, or 98%
sequence identity to CD276. In other examples, CD276 has a sequence
that hybridizes under very high stringency conditions to a sequence
set forth in GenBank Accession No. DQ832276, NM_001024736,
NP_598744, NP_079516 and AAK15438, or NM_025240 and retains CD276
activity (such as the capability to be expressed during
pathological angiogenesis and/or modulate pathological
angiogenesis).
[0071] Chemotherapy: In cancer treatment, chemotherapy refers to
the administration of one or a combination of compounds to kill or
slow the reproduction of rapidly multiplying cells.
Chemotherapuetic agents include but are not limited to:
5-fluorouracil (5-FU), azathioprine, cyclophosphamide,
antimetabolites (such as Fludarabine), antineoplastics (such as
Etoposide, Doxorubicin, methotrexate, and Vincristine),
carboplatin, cis-platinum and the taxanes, such as taxol and
taxotere. Such agents can be co-administered with the disclosed
endothelial marker molecules to a subject. For example, to treat a
tumor, chemotherapeutic agents can also be administered prior to or
subsequent to administration of the disclosed modified endothelial
marker molecules to a subject or can be conjugated to the disclosed
endothelial markers (e.g., Tables 8 and 9). In one example,
chemotherapeutic agents are co-administered with radiation therapy,
along with the disclosed endothelial molecules for treatment of a
tumor.
[0072] Chimeric antibody: An antibody which includes sequences
derived from two different antibodies, which typically are of
different species. Most typically, chimeric antibodies include
human and murine antibody domains, generally human constant regions
and murine variable regions, murine CDRs and/or murine SDRs. For
example, the variable segments of the genes from a mouse monoclonal
antibody can be joined to human constant segments, such as kappa
and gamma 1 or gamma 3. In one example, a chimeric antibody is a
hybrid protein composed of the variable or antigen-binding domain
from a mouse antibody and the constant or effector domain from a
human antibody (such as an antibody that recognizes one of the
disclosed pathological angiogenesis endothelial markers listed in
Table 9), although other mammalian species can be used, or the
variable region can be produced by molecular techniques. Methods of
making chimeric antibodies are well known in the art, for example,
see U.S. Pat. No. 5,807,715.
[0073] Decrease: To reduce the quality, amount, or strength of
something. In one example, a therapy decreases a tumor (such as the
size of a tumor, the number of tumors, the metastasis of a tumor,
or combinations thereof), or one or more symptoms associated with a
tumor, for example as compared to the response in the absence of
the therapy (such as a therapy administered to affect tumor size by
inhibiting pathological angiogenesis via administration of a
binding agent capable of binding to one or more of the pathological
angiogenesis markers listed in Table 9). In a particular example, a
therapy decreases the size of a tumor, the number of tumors, the
metastasis of a tumor, or combinations thereof, subsequent to the
therapy, such as a decrease of at least 10%, at least 20%, at least
50%, or even at least 90%. Such decreases can be measured using the
methods disclosed herein as well as those known in the art.
[0074] Endothelial cell: Cells that line the interior surface of
blood vessels, forming an interface between circulating blood in
the lumen and the rest of the vessel wall. For example, endothelial
cells line the entire circulatory system. Further, both blood and
lymphatic capillaries are composed of a single layer of endothelial
cells.
[0075] Expression product with Accession No. AK144596: In one
example, AK144596 is a protein that is expressed in liver
endothelial cells. The term expression product with Accession No.
AK144596 includes any expression product with Accession No.
AK144596 gene, cDNA, mRNA, or protein from any organism and that is
an expression product with Accession No. AK144596 capable of
delivering a therapeutic agent specifically to liver endothelial
cells.
[0076] Nucleic acid and protein sequences for expression product
with Accession No. AK144596 are publicly available. For example,
GenBank Accession No: AK144596 discloses an expression product with
Accession No. AK144596 nucleic acid sequence.
[0077] In one example, an expression product with Accession No.
AK144596 includes a full-length wild-type (or native) sequence, as
well as an expression product with Accession No. AK144596 allelic
variants, fragments, homologs or fusion sequences that retain the
ability to deliver therapeutic agents specifically to liver
endothelial cells. In certain examples, an expression product with
Accession No. AK144596 has at least 80% sequence identity, for
example at least 85%, 90%, 95%, or 98% sequence identity to an
expression product with Accession No. AK144596. In other examples,
an expression product with Accession No. AK144596 has a sequence
that hybridizes under very high stringency conditions to a sequence
set forth in GenBank Accession No. AK144596 and retains expression
product with Accession No. AK144596 activity (e.g., the capability
to serve as a liver endothelial cell marker).
[0078] Forkhead box Q1 (FOXQ1): A member of the evolutionarily
conserved winged helix (WH)/forkhead transcription factor gene
family. The protein regulates the expression of other genes. In one
example, FOXQ1 protein is expressed in brain endothelial cells. The
term FOXQ1 includes any FOXQ1 gene, cDNA, mRNA, or protein from any
organism and that is FOXQ1capable of delivering a therapeutic agent
specifically to brain endothelial cells.
[0079] Nucleic acid and protein sequences for FOXQ1 are publicly
available. For example, GenBank Accession Nos.: NM_008239,
AK147202, AF010405, AF225950, and NM_033260 disclose FOXQ1 nucleic
acid sequences and GenBank Accession Nos.: NP_032265, AAH53850, and
NP_150285 disclose FOXQ1 protein sequences.
[0080] In one example, FOXQ1 includes a full-length wild-type (or
native) sequence, as well as FOXQ1 allelic variants, fragments,
homologs or fusion sequences that retain the ability to deliver
therapeutic agents specifically to brain endothelial cells. In
certain examples, FOXQ1 has at least 80% sequence identity, for
example at least 85%, 90%, 95%, or 98% sequence identity to FOXQ1.
In other examples, FOXQ1 has a sequence that hybridizes under very
high stringency conditions to a sequence set forth in GenBank
Accession Nos. NM_008239, AK147202, AF010405, AF225950, or
NM_033260 and retains FOXQ1 (e.g., the capability to serve as a
brain endothelial cell marker).
[0081] Humanized antibodies: An immunoglobulin including a human
framework region and one or more CDRs from a non-human (such as a
mouse, rat, or synthetic) immunoglobulin. A humanized antibody
binds to the same antigen as the donor antibody that provides the
CDRs. In on example, a humanized antibody specifically binds to one
of the proteins listed in Tables 8 and 9.
[0082] The non-human immunoglobulin providing the CDRs is termed a
"donor" and the human immunoglobulin providing the framework is
termed an "acceptor." In one example, all the CDRs are from the
donor immunoglobulin in a humanized immunoglobulin. Constant
regions need not be present, but if they are, they are
substantially identical to human immunoglobulin constant regions,
for instance, at least about 85-90%, such as about 95% or more
identical.
[0083] The donor CDRs of a humanized antibody can have a limited
number of substitutions using amino acids from the acceptor CDR.
Hence, all parts of a humanized immunoglobulin, except possibly the
CDRs, are substantially identical to corresponding parts of natural
human immunoglobulin sequences. The acceptor framework of a
humanized immunoglobulin or antibody can have a limited number of
substitutions by amino acids taken from the donor framework.
Humanized or other monoclonal antibodies can have additional amino
acid substitutions which have substantially no effect on antigen
binding or other immunoglobulin functions. Exemplary conservative
substitutions are described above (see also U.S. Pat. No.
5,585,089). Humanized immunoglobulins can be constructed by means
of genetic engineering, for example, see U.S. Pat. Nos. 5,225,539
and 5,585,089, herein incorporated by reference.
[0084] Hybridization: To form base pairs between complementary
regions of two strands of DNA, RNA, or between DNA and RNA, thereby
forming a duplex molecule. Hybridization conditions resulting in
particular degrees of stringency will vary depending upon the
nature of the hybridization method and the composition and length
of the hybridizing nucleic acid sequences. Generally, the
temperature of hybridization and the ionic strength (such as the
Na+ concentration) of the hybridization buffer will determine the
stringency of hybridization. Calculations regarding hybridization
conditions for attaining particular degrees of stringency are
discussed in Sambrook et al., (1989) Molecular Cloning, second
edition, Cold Spring Harbor Laboratory, Plainview, N.Y. (chapters 9
and 11). The following is an exemplary set of hybridization
conditions and is not limiting:
[0085] Very High Stringency (detects sequences that share at least
90% identity) [0086] Hybridization: 5.times.SSC at 65.degree. C.
for 16 hours [0087] Wash twice: 2.times.SSC at room temperature
(RT) for 15 minutes each [0088] Wash twice: 0.5.times.SSC at
65.degree. C. for 20 minutes each
[0089] High Stringency (detects sequences that share at least 80%
identity) [0090] Hybridization: 5.times.-6.times.SSC at 65.degree.
C.-70.degree. C. for 16-20 hours [0091] Wash twice: 2.times.SSC at
RT for 5-20 minutes each [0092] Wash twice: 1.times.SSC at
55.degree. C.-70.degree. C. for 30 minutes each
[0093] Low Stringency (detects sequences that share at least 50%
identity) [0094] Hybridization: 6.times.SSC at RT to 55.degree. C.
for 16-20 hours [0095] Wash at least twice: 2.times.-3.times.SSC at
RT to 55.degree. C. for 20-30 minutes each.
[0096] Immunoassay: A biochemical test that measures the level of a
substance in a biological sample (such as serum or urine), using
the reaction of an antibody or antibodies to its antigen. The assay
takes advantage of the specific binding of an antibody to its
antigen. The antibodies selected ideally have a high affinity for
the antigen (if there is antigen available, a very high proportion
of it will bind to the antibody). Both the presence of antigen or
antibodies can be measured. For instance, when detecting
pathological angiogenesis the presence of a pathological
angiogenesis marker can be measured.
[0097] Detecting the quantity of antibody or antigen can be
achieved by a variety of methods. One of the most common is to
label the antigen or antibody. The label can include an enzyme
(e.g., luciferase or .beta.-gal), radioisotopes (such as .sup.125I)
or a fluorophore. Other techniques include Western Blot.
[0098] Kelch repeat and BTB (POZ) domain: In one example, the Kelch
repeat and BTB (POZ) domain is expressed in brain endothelial
cells. The term Kelch repeat and BTB (POZ) domain includes any
Kelch repeat and BTB (POZ) domain gene, cDNA, mRNA, or protein from
any organism and that is Kelch repeat and BTB (POZ) domain capable
of delivering a therapeutic agent specifically to brain endothelial
cells.
[0099] Nucleic acid and protein sequences for Kelch repeat and BTB
(POZ) domain are publicly available. For example, GenBank Accession
Nos.: XM_486083, XM_979486, XM_921147, NM_014867, and AB018254
disclose Kelch repeat and BTB (POZ) domain nucleic acid sequences
and GenBank Accession Nos.: XP_926240, XP_486083, and NP_055682
disclose ankylosis protein sequences.
[0100] In one example, Kelch repeat and BTB (POZ) domain includes a
full-length wild-type (or native) sequence, as well as Kelch repeat
and BTB (POZ) domain allelic variants, fragments, homologs or
fusion sequences that retain the ability to deliver therapeutic
agents specifically to brain endothelial cells. In certain
examples, Kelch repeat and BTB (POZ) domain has at least 80%
sequence identity, for example at least 85%, 90%, 95%, or 98%
sequence identity to Kelch repeat and BTB (POZ) domain. In other
examples, Kelch repeat and BTB (POZ) domain has a sequence that
hybridizes under very high stringency conditions to a sequence set
forth in GenBank Accession Nos. XM_486083, XM_486083, XM_979486,
XM_921147, NM_014867, or AB018254 and retains Kelch repeat and BTB
(POZ) domain activity (e.g., the capability to deliver therapeutic
agents to brain endothelial cells).
[0101] Label: A detectable compound. In some examples, a label is
conjugated directly or indirectly to another molecule, such as an
antibody or a protein, to facilitate detection of that molecule.
For example, the label can be capable of detection by ELISA,
spectrophotometry, flow cytometry, or microscopy. Specific,
non-limiting examples of labels include fluorophores,
chemiluminescent agents, enzymatic linkages, and radioactive
isotopes. Methods for labeling and guidance in the choice of labels
appropriate for various purposes are discussed for example in
Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor, N. Y., 1989) and Ausubel et al. (In Current
Protocols in Molecular Biology, John Wiley & Sons, New York,
1998). In a particular example, a label is conjugated to a binding
agent that specifically binds to one or more of the pathological
angiogenesis endothelial markers disclosed in Table 9 to allow for
the detection/screening for pathological angiogenesis and/or the
presence of a tumor in a subject.
[0102] Malignant: Cells that have the properties of anaplasia
invasion and metastasis.
[0103] Mammal: This term includes both human and non-human mammals.
Examples of mammals include, but are not limited to: humans, pigs,
cows, goats, cats, dogs, rabbits and mice.
[0104] MBL-associated serine protease-3 (MASP-3): MASP-3
transcripts encode serine proteases that display distinct substrate
specificity and associate with Mannan-binding lectin complexes. In
one example, MBL-associated serine protease-3 is preferentially
expressed in liver endothelial cells. The term MBL-associated
serine protease-3 includes any MBL-associated serine protease-3
gene, cDNA, mRNA, or protein from any organism and that is a
MBL-associated serine protease-3 capable of delivering a
therapeutic agent specifically to liver endothelial cells.
[0105] Exemplary nucleic acid and protein sequences for
MBL-associated serine protease-3 are publicly available. For
example, GenBank Accession Nos.: AB049755, AK031598, NM_139125,
NM_001879, and NM_001031849 disclose MBL-associated serine
protease-3 nucleic acid sequences and GenBank Accession Nos.:
NP_624302, NP_001870, and NP_001027019 disclose MBL-associated
serine protease-3 protein sequences.
[0106] In one example, a MBL-associated serine protease-3 sequence
includes a full-length wild-type (or native) sequence, as well as
MBL-associated serine protease-3 allelic variants, fragments,
homologs or fusion sequences that retain the ability to deliver
therapeutic agents specifically to liver endothelial cells. In
certain examples, MBL-associated serine protease-3 has at least 80%
sequence identity, for example at least 85%, 90%, 95%, or 98%
sequence identity to a MBL-associated serine protease-3. In other
examples, a MBL-associated serine protease-3 has a sequence that
hybridizes under very high stringency conditions to a sequence set
forth in GenBank Accession No. AB049755, AB049755, AK031598,
NM_139125, NM_001879, or NM_001031849 and retains MBL-associated
serine protease-3 activity (e.g., the capability to deliver
therapeutic agents to liver endothelial cells).
[0107] MiRP2: The MiRP2 gene encodes a small integral membrane
subunit that assembles with HERG, a pore-forming protein, to form a
potassium voltage-gated channel. MiRP2 alters the function of the
channel. Channels formed with mutant MiRP1 subunits display slower
activation, faster deactivation, and increased drug
sensitivity.
[0108] In one example, MiRP2 is expressed during pathological
angiogenesis. The term MiRP2 includes any MiRP2 gene, cDNA, mRNA,
or protein from any organism and that is MiRP2 and is expressed
during pathological angiogenesis.
[0109] Exemplary nucleic acid and protein sequences for MiRP2 are
publicly available. For example, GenBank Accession Nos.: DQ832280,
NM_020574, AK008744, and NM_005472 disclose MiRP2 nucleic acid
sequences and GenBank Accession Nos.: NP_065599, BAB25871, and
NP_005463 disclose MiRP2 protein sequences.
[0110] In one example, MiRP2 includes a full-length wild-type (or
native) sequence, as well as MiRP2 allelic variants, fragments,
homologs or fusion sequences that retain the ability to be
expressed during pathological angiogenesis and/or modulate
pathological angiogenesis. In certain examples, MiRP2 has at least
80% sequence identity, for example at least 85%, 90%, 95%, or 98%
sequence identity to MiRP2. In other examples, MiRP2 has a sequence
that hybridizes under very high stringency conditions to a sequence
set forth in GenBank Accession Nos. DQ832280, NM_020574, AK008744,
or NM_005472 and retains MiRP2 activity (e.g., the capability to be
expressed during pathological angiogenesis and/or modulate
pathological angiogenesis).
[0111] Neoplasm: Abnormal growth of cells.
[0112] Normal Cell: Non-tumor cell, non-malignant, uninfected
cell.
[0113] Oncoprotein induced transcript 3 (Oit3): Encodes a secreted
ZP domain-containing protein. In one example, oncoprotein induced
transcript 3 is expressed in liver endothelial cells. The term
oncoprotein induced transcript 3 includes any oncoprotein induced
transcript 3 gene, cDNA, mRNA, or protein from any organism and
that is a oncoprotein induced transcript 3 capable of delivering a
therapeutic agent specifically to liver endothelial cells.
Oncoprotein induced transcript 3 is also referred to in the
literature as LZP.
[0114] Oncoprotein induced transcript 3 nucleic acid and protein
sequences are publicly available. For example, GenBank Accession
Nos.: NM_010959, AF356506, AY180915, NM_152635, and AY013707
disclose oncoprotein induced transcript 3 nucleic acid sequences
and GenBank Accession Nos.: AA022058, NP_035089, NP_689848, and
AAG40096 disclose oncoprotein induced transcript 3 protein
sequences.
[0115] In one example, a oncoprotein induced transcript 3 sequence
includes a full-length wild-type (or native) sequence, as well as
oncoprotein induced transcript 3 allelic variants, fragments,
homologs or fusion sequences that retain the ability to deliver
therapeutic agents specifically to liver endothelial cells. In
certain examples, oncoprotein induced transcript 3 has at least 80%
sequence identity, for example at least 85%, 90%, 95%, or 98%
sequence identity to a native oncoprotein induced transcript 3. In
other examples, oncoprotein induced transcript 3 has a sequence
that hybridizes under very high stringency conditions to a sequence
set forth in GenBank Accession Nos. NM_010959, AF356506, AY180915,
NM_152635, or AY013707 and retains oncoprotein induced transcript 3
activity.
[0116] Pharmaceutically Carriers: The pharmaceutically acceptable
carriers (vehicles) useful in this disclosure are conventional.
Remington's Pharmaceutical Sciences, by E. W. Martin, Mack
Publishing Co., Easton, Pa., 15th Edition (1975), describes
compositions and formulations suitable for pharmaceutical delivery
of one or more therapeutic agents, such as one or more compositions
that include a binding agent that specifically binds to at least
one of the disclosed pathological angiogenesis marker proteins.
[0117] In general, the nature of the carrier will depend on the
particular mode of administration being employed. For instance,
parenteral formulations can include injectable fluids that include
pharmaceutically and physiologically acceptable fluids such as
water, physiological saline, balanced salt solutions, aqueous
dextrose, glycerol or the like as a vehicle. In addition to
biologically-neutral carriers, pharmaceutical compositions to be
administered can contain minor amounts of non-toxic auxiliary
substances, such as wetting or emulsifying agents, preservatives,
and pH buffering agents and the like, for example sodium acetate or
sorbitan monolaurate, sodium lactate, potassium chloride, calcium
chloride, and triethanolamine oleate.
[0118] Plexin C1 (VESPR): A large transmembrane receptor. In vitro,
plexin-C1 has been shown to bind the GPI-anchored semaphorin Sema7A
and the soluble viral semaphorins SemaVA (A39R) and SemaVB (AHV).
Plexin C1 engagement by SemaVA inhibits integrin-mediated dendritic
cell adhesion and chemotaxis in vitro, suggesting a role for plexin
C1 in dendritic cell migration.
[0119] In an example, plexin C1 is expressed in liver endothelial
cells. The term plexin C1 includes any plexin C1 gene, cDNA, mRNA,
or protein from any organism and that is a plexin C1 capable of
delivering a therapeutic agent specifically to liver endothelial
cells.
[0120] Exemplary nucleic acid and protein sequences for plexin C1
are publicly available. For example, GenBank Accession Nos.:
NM_018797, XM_622776, AB208934, and NM_005761 disclose plexin C1
nucleic acid sequences and GenBank Accession Nos.: NP_061267,
XP_622776, BAD92171, and NP_005752 disclose plexin C1 protein
sequences.
[0121] In one example, a plexin C1 sequence includes a full-length
wild-type (or native) sequence, as well as plexin C1 allelic
variants, fragments, homologs or fusion sequences that retain the
ability to deliver therapeutic agents specifically to liver
endothelial cells. In certain examples, plexin C1 has at least 80%
sequence identity, for example at least 85%, 90%, 95%, or 98%
sequence identity to a plexin C1. In other examples, a plexin C1
has a sequence that hybridizes under very high stringency
conditions to a sequence set forth in GenBank Accession No.
NM_018797, XM_622776, AB208934, or NM_005761 and retains plexin C1
activity (e.g., the capability to deliver therapeutic agents to
liver endothelial cells).
[0122] Polymerase Chain Reaction (PCR): An in vitro amplification
technique that increases the number of copies of a nucleic acid
molecule (for example, a nucleic acid molecule in a sample or
specimen). In an example, a biological sample collected from a
subject is contacted with a pair of oligonucleotide primers, under
conditions that allow for the hybridization of the primers to
nucleic acid template in the sample. The primers are extended under
suitable conditions, dissociated from the template, and then
re-annealed, extended, and dissociated to amplify the number of
copies of the nucleic acid. The product of a PCR can be
characterized by electrophoresis, restriction endonuclease cleavage
patterns, oligonucleotide hybridization or ligation, and/or nucleic
acid sequencing, using standard techniques.
[0123] Preimplantation protein 4 (Prei4): The Prei4 gene is
expressed during mouse preimplantation embryogenesis. It is a
putative glycerophosphodiester phosphodiesterase. In one example,
Prei4 is expressed in brain endothelial cells. The term Prei4
includes any Prei4 gene, cDNA, mRNA, or protein from any organism
and that is Prei4 capable of delivering a therapeutic agent
specifically to brain endothelial cells.
[0124] Nucleic acid and protein sequences for Prei4 are publicly
available. For example, GenBank Accession Nos.: NM_001042671,
NM_028802, BC006887, and NM_019593 disclose Prei4 nucleic acid
sequences and GenBank Accession Nos.: NP_001036136, NP_062539, and
Q9NPB8 disclose Prei4 protein sequences.
[0125] In one example, Prei4 includes a full-length wild-type (or
native) sequence, as well as Prei4 allelic variants, fragments,
homologs or fusion sequences that retain the ability to deliver
therapeutic agents specifically to brain endothelial cells. In
certain examples, Prei4 has at least 80% sequence identity, for
example at least 85%, 90%, 95%, or 98% sequence identity to Prei4.
In other examples, Prei4 has a sequence that hybridizes under very
high stringency conditions to a sequence set forth in GenBank
Accession Nos. NM_001042671, NM_028802, BC006887, or NM_019593 and
retains Prei4 activity (e.g., the capability to deliver therapeutic
agents to brain endothelial cells).
[0126] Probes and primers: Nucleic acid probes and primers can be
readily prepared based on the nucleic acid molecules provided in
this disclosure. A probe includes an isolated nucleic acid attached
to a detectable label or reporter molecule. Exemplary labels
include radioactive isotopes, enzyme substrates, co-factors,
ligands, chemiluminescent or fluorescent agents, haptens, and
enzymes.
[0127] Primers are short nucleic acid molecules such as DNA
oligonucleotides, 10 nucleotides or more in length. Longer DNA
oligonucleotides can be about 15, 17, 20, or 23 nucleotides or more
in length. Primers can be annealed to a complementary target DNA
strand by nucleic acid hybridization to form a hybrid between the
primer and the target DNA strand, and then the primer extended
along the target DNA strand by a DNA polymerase enzyme. Primer
pairs can be used for amplification of a nucleic acid sequence,
e.g., by the polymerase chain reaction (PCR) or other nucleic-acid
amplification methods known in the art.
[0128] Methods for preparing and using probes and primers are
described, for example, in Sambrook et al. (In Molecular Cloning: A
Laboratory Manual, CSHL, New York, 1989), Ausubel et al. (In
Current Protocols in Molecular Biology, Greene Publ. Assoc. and
Wiley-Intersciences, 1998), and Innis et al. (PCR Protocols, A
Guide to Methods and Applications, Academic Press, Inc., San Diego,
Calif., 1990). PCR primer pairs can be derived from a known
sequence, for example, by using computer programs intended for that
purpose such as Primer (Version 0.5, .COPYRGT. 1991, Whitehead
Institute for Biomedical Research, Cambridge, Mass.).
[0129] Progestin and adipoQ receptor family member V (Paqr5): An
integral membrane protein that binds progesterone. Paqr5 is a
putative G-protein coupled receptor involved in signal transduction
in response to steroids such as progesterone.
[0130] In one example, Paqr5 is expressed in brain endothelial
cells. The term Progestin and adipoQ receptor family member V
includes any Progestin and adipoQ receptor family member V gene,
cDNA, mRNA, or protein from any organism and that is Progestin and
adipoQ receptor family member V capable of delivering a therapeutic
agent specifically to brain endothelial cells.
[0131] Exemplary nucleic acid and protein sequences for Progestin
and adipoQ receptor family member V are publicly available. For
example, GenBank Accession Nos: NM_028748, AK035475, AY424283, and
NM_017705 disclose Progestin and adipoQ receptor family member V
nucleic acid sequences and GenBank Accession Nos.: NP_083024,
BAC29072, AAR08371, and NP_060175 disclose Progestin and adipoQ
protein sequences.
[0132] In one example, Progestin and adipoQ receptor family member
V includes a full-length wild-type (or native) sequence, as well as
Progestin and adipoQ receptor family member V allelic variants,
fragments, homologs or fusion sequences that retain the ability to
deliver therapeutic agents specifically to brain endothelial cells.
In certain examples, Progestin and adipoQ receptor family member V
has at least 80% sequence identity, for example at least 85%, 90%,
95%, or 98% sequence identity to Progestin and adipoQ receptor
family member V. In other examples, Progestin and adipoQ receptor
family member V has a sequence that hybridizes under very high
stringency conditions to a sequence set forth in GenBank Accession
Nos. NM_028748, NM_028748, AK035475, AY424283, or NM_017705 and
retains Progestin and adipoQ receptor family member V activity
(e.g., the capability to deliver therapeutic agents to brain
endothelial cells).
[0133] Ptprn (IA-2): PTPRN (IA-2) is a major autoantigen in type 1
diabetes. Autoantibodies against PTPRN appear years before the
development of clinical disease. PTPRN is an enzymatically inactive
member of the transmembrane protein tyrosine phosphatase family and
is an integral component of secretory granules in neuroendocrine
cells. PTPRN is an important regulator of dense core vesicle number
and glucose-induced and basal insulin secretion.
[0134] In one example, Ptprn is expressed during pathological
angiogenesis. The term Ptprn includes any Ptprn gene, cDNA, mRNA,
or protein from any organism and that is Ptprn and is
preferentially expressed during pathological angiogenesis. Ptprn is
also known in the literature as IA-2.
[0135] Exemplary nucleic acid and protein sequences for Ptprn are
publicly available. For example, GenBank Accession Nos.: DQ832283,
NM_008985, AK041296, NM_002846, and L18983 disclose Ptprn nucleic
acid sequences and GenBank Accession Nos.: NP_033011, NP_002837,
and AAA90974 disclose Ptprn (IA-2) protein sequences.
[0136] In one example, Ptprn includes a full-length wild-type (or
native) sequence, as well as Ptprn allelic variants, fragments,
homologs or fusion sequences that retain the ability to be
preferentially expressed during pathological angiogenesis and/or
modulate pathological angiogenesis. In certain examples, Ptprn has
at least 80% sequence identity, for example at least 85%, 90%, 95%,
or 98% sequence identity to Ptprn. In other examples, Ptprn has a
sequence that hybridizes under very high stringency conditions to a
sequence set forth in GenBank Accession Nos. DQ832283, NM_008985,
AK041296, NM_002846, or L18983 and retains Ptprn activity (e.g.,
the capability to be expressed during pathological angiogenesis
and/or modulate pathological angiogenesis).
[0137] Putative G-protein coupled receptor NM_033616 or Component
of Sp100-rs (Csprs): A putative G-protein coupled receptor. In one
example, putative G-protein coupled receptor NM_033616 is expressed
in liver endothelial cells. The term putative G-protein coupled
receptor NM_033616 includes any putative G-protein coupled receptor
NM_033616 gene, cDNA, mRNA, or protein from any organism and that
is a putative G-protein coupled receptor NM_033616 capable of
delivering a therapeutic agent specifically to liver endothelial
cells.
[0138] Exemplary nucleic acid and protein sequences for putative
G-protein coupled receptor NM_033616 are publicly available. For
example, GenBank Accession Nos.: NM_033616, AK037063, and XM_979370
disclose putative G-protein coupled receptor NM_033616 nucleic acid
sequences and GenBank Accession Nos.: NP_291094 and XP_984464
disclose putative G-protein coupled receptor NM_033616 protein
sequences.
[0139] In one example, a putative G-protein coupled receptor
NM_033616 sequence includes a full-length wild-type (or native)
sequence, as well as putative G-protein coupled receptor NM_033616
allelic variants, fragments, homologs or fusion sequences that
retain the ability to deliver therapeutic agents specifically to
liver endothelial cells. In certain examples, putative G-protein
coupled receptor NM_033616 has at least 80% sequence identity, for
example at least 85%, 90%, 95%, or 98% sequence identity to a
putative G-protein coupled receptor NM_033616. In other examples, a
putative G-protein coupled receptor NM_033616 has a sequence that
hybridizes under very high stringency conditions to a sequence set
forth in GenBank Accession Nos. NM_033616, AK037063, or XM_979370
and retains putative G-protein coupled receptor NM_033616 activity
(e.g., the capability to target agents to liver endothelial
cells).
[0140] Putative transmembrane protein Accession No. NM_023438: A
putative transmembrane protein. In one example, putative
transmembrane protein Accession No. NM_023438 is expressed in liver
endothelial cells. The term putative transmembrane protein
Accession No. NM_023438 includes any putative transmembrane protein
Accession No. NM_023438 gene, cDNA, mRNA, or protein from any
organism and that is a putative transmembrane protein Accession No.
NM_023438 capable of delivering a therapeutic agent specifically to
liver endothelial cells.
[0141] Exemplary nucleic acid and protein sequences for putative
transmembrane protein Accession No. NM_023438 are publicly
available. For example, GenBank Accession Nos.: NM_023438,
NM_207313, and BN000149 disclose putative transmembrane protein
Accession No. NM_023438 nucleic acid sequences and GenBank
Accession Nos.: NP_075927, NP_997196, and CAD80169 disclose
putative transmembrane protein Accession No. NM_023438 protein
sequences.
[0142] In one example, a putative transmembrane protein Accession
No. NM_023438 sequence includes a full-length wild-type (or native)
sequence, as well as putative transmembrane protein Accession No.
NM_023438 allelic variants, fragments, homologs or fusion sequences
that retain the ability to deliver therapeutic agents specifically
to liver endothelial cells. In certain examples, putative
transmembrane protein Accession No. NM_023438 has at least 80%
sequence identity, for example at least 85%, 90%, 95%, or 98%
sequence identity to a putative transmembrane protein Accession No.
NM_023438. In other examples, a putative transmembrane protein
Accession No. NM_023438 has a sequence that hybridizes under very
high stringency conditions to a sequence set forth in GenBank
Accession Nos. NM_023438, NM_207313, and BN000149 and retains
putative transmembrane protein Accession No. NM_023438 activity
(e.g., the capability to target agents to liver endothelial
cells).
[0143] Putative transmembrane protein Accession No. NM_029001: A
putative transmembrane protein. In one example, putative
transmembrane protein Accession No. NM_029001 is expressed in brain
endothelial cells. The term putative transmembrane protein
Accession No. NM_029001 includes any putative transmembrane protein
Accession No. NM_029001 gene, cDNA, mRNA, or protein from any
organism and that is a putative transmembrane protein Accession No.
NM_029001 capable of delivering a therapeutic agent specifically to
brain endothelial cells.
[0144] Exemplary nucleic acid and protein sequences for putative
transmembrane protein Accession No. NM_029001 are publicly
available. For example, GenBank Accession Nos.: NM_029001,
NM_024930, and AB181393 disclose putative transmembrane protein
Accession No. NM_029001 nucleic acid sequences and GenBank
Accession Nos.: NP_083277, NP_079206, and BAD93238 disclose
putative transmembrane protein Accession No. NM_029001 protein
sequences.
[0145] In one example, a putative transmembrane protein Accession
No. NM_029001 sequence includes a full-length wild-type (or native)
sequence, as well as putative transmembrane protein Accession No.
NM_029001 allelic variants, fragments, homologs or fusion sequences
that retain the ability to deliver therapeutic agents specifically
to brain endothelial cells. In certain examples, putative
transmembrane protein Accession No. NM_029001 has at least 80%
sequence identity, for example at least 85%, 90%, 95%, or 98%
sequence identity to a putative transmembrane protein Accession No.
NM_029001. In other examples, a putative transmembrane protein
Accession No. NM_029001 has a sequence that hybridizes under very
high stringency conditions to a sequence set forth in GenBank
Accession No. NM_029001, NM_024930, or AB181393 and retains
putative transmembrane protein Accession No. NM_029001 activity
(e.g., the capability to target agents to brain endothelial
cells).
[0146] Putative transmembrane protein Accession No. NM_144830:
NM_144830 encodes a putative transmembrane protein. In one example,
putative transmembrane protein Accession No. NM.sub.-- 144830 is
expressed in liver endothelial cells. The term putative
transmembrane protein Accession No. NM_144830 includes any putative
transmembrane protein Accession No. NM_144830 gene, cDNA, mRNA, or
protein from any organism and that is putative transmembrane
protein Accession No. NM_144830 capable of delivering a therapeutic
agent specifically to liver endothelial cells.
[0147] Exemplary nucleic acid and protein sequences for putative
transmembrane protein Accession No. NM_144830 are publicly
available. For example, GenBank Accession Nos.: NM_144830,
AK154217, NM_145041, and XM_001133074 disclose putative
transmembrane protein Accession No. NM_144830 nucleic acid sequence
and GenBank Accession Nos.: NP_659079, BAE32441, NP_659478, and
XP_001133074 disclose putative transmembrane protein Accession No.
NM_144830 protein sequences.
[0148] In one example, putative transmembrane protein Accession No.
NM_144830 includes a full-length wild-type (or native) sequence, as
well as putative transmembrane protein Accession No. NM_144830
allelic variants, fragments, homologs or fusion sequences that
retain the ability to deliver therapeutic agents specifically to
liver endothelial cells. In certain examples, putative
transmembrane protein Accession No. NM_144830 has at least 80%
sequence identity, for example at least 85%, 90%, 95%, or 98%
sequence identity to putative transmembrane protein Accession No.
NM_144830. In other examples, putative transmembrane protein
Accession No. NM_144830 has a sequence that hybridizes under very
high stringency conditions to a sequence set forth in GenBank
Accession No. NM_144830, AK154217, NM_145041, or XM_001133074 and
retains putative transmembrane protein Accession No. NM_144830
activity (e.g., the capability to target agents to liver
endothelial cells).
[0149] Putative secreted protein Accession No. XM_620023: XM_620023
encodes a putative secreted protein. In one example, putative
secreted protein Accession No. XM_620023 is expressed in brain
endothelial cells. The term putative secreted protein Accession No.
NM_620023 includes any putative secreted protein Accession No.
XM_620023 gene, cDNA, mRNA, or protein from any organism and that
is a putative secreted protein Accession No. NM_620023 capable of
delivering a therapeutic agent specifically to brain endothelial
cells.
[0150] Exemplary nucleic acid and protein sequences for putative
secreted protein Accession No. XM_620023 are publicly available.
For example, GenBank Accession Nos.: XM_620023, AK128180, and
BX648118 disclose secreted protein Accession No. XM_620023 nucleic
acid sequences and GenBank Accession Nos.: XP_620023, BAC87313, and
CAH56187 disclose putative secreted protein Accession No. XM_620023
protein sequences.
[0151] In one example, a putative secreted protein Accession No.
XM_620023 sequence includes a full-length wild-type (or native)
sequence, as well as putative secreted protein Accession No.
XM_620023 allelic variants, fragments, homologs or fusion sequences
that retain the ability to deliver therapeutic agents specifically
to brain endothelial cells. In certain examples, putative secreted
protein Accession No. XM_620023 has at least 80% sequence identity,
for example at least 85%, 90%, 95%, or 98% sequence identity to a
putative secreted protein Accession No. XM_620023. In other
examples, a putative secreted protein Accession No. XM_620023 has a
sequence that hybridizes under very high stringency conditions to a
sequence set forth in GenBank Accession Nos. XM_620023, BAC87313,
and CAH56187 and retains putative secreted protein Accession No.
NM_620023 activity (e.g., the capability to target agents to brain
endothelial cells).
[0152] Sample: Biological specimens containing genomic DNA, cDNA,
RNA, or protein obtained from the cells of a subject, such as those
present in peripheral blood, urine, saliva, semen, tissue biopsy,
surgical specimen, fine needle aspriates, amniocentesis samples and
autopsy material. In one example, a sample includes lung, colon,
breast or liver cancer cells obtained from a subject.
[0153] Sequence identity: The identity/similarity between two or
more nucleic acid sequences, or two or more amino acid sequences,
is expressed in terms of the identity or similarity between the
sequences. Sequence identity can be measured in terms of percentage
identity; the higher the percentage, the more identical the
sequences are. Sequence similarity can be measured in terms of
percentage similarity (which takes into account conservative amino
acid substitutions); the higher the percentage, the more similar
the sequences are. Homologs or orthologs of nucleic acid or amino
acid sequences possess a relatively high degree of sequence
identity/similarity when aligned using standard methods. This
homology is more significant when the orthologous proteins or cDNAs
are derived from species that are more closely related (such as
human and mouse sequences), compared to species more distantly
related (such as human and C. elegans sequences).
[0154] Methods of alignment of sequences for comparison are well
known in the art. Various programs and alignment algorithms are
described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981;
Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson &
Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins &
Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3,
1989; Corpet et al., Nuc. Acids Res. 16:10881-90, 1988; Huang et
al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson
et al., Meth. Mol. Bio. 24:307-31, 1994. Altschul et al., J. Mol.
Biol. 215:403-10, 1990, presents a detailed consideration of
sequence alignment methods and homology calculations.
[0155] The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul
et al., J. Mol. Biol. 215:403-10, 1990) is available from several
sources, including the National Center for Biological Information
(NCBI, National Library of Medicine, Building 38A, Room 8N805,
Bethesda, Md. 20894) and on the Internet, for use in connection
with the sequence analysis programs blastp, blastn, blastx, tblastn
and tblastx. Additional information can be found at the NCBI web
site.
[0156] BLASTN is used to compare nucleic acid sequences, while
BLASTP is used to compare amino acid sequences. To compare two
nucleic acid sequences, the options can be set as follows: --i is
set to a file containing the first nucleic acid sequence to be
compared (such as C:\seq1.txt); --j is set to a file containing the
second nucleic acid sequence to be compared (such as C:\seq2.txt);
--p is set to blastn; --o is set to any desired file name (such as
C:\output.txt); --q is set to -1; --r is set to 2; and all other
options are left at their default setting. For example, the
following command can be used to generate an output file containing
a comparison between two sequences: C:\B12seq --i c:\seq1.txt --j
c:\seq2.txt --p blastn --o c:\output.txt --q -1 --r 2.
[0157] To compare two amino acid sequences, the options of Bl2seq
can be set as follows: --i is set to a file containing the first
amino acid sequence to be compared (such as C:\seq1.txt); --j is
set to a file containing the second amino acid sequence to be
compared (such as C:\seq2.txt); --p is set to blastp; --o is set to
any desired file name (such as C:\output.txt); and all other
options are left at their default setting. For example, the
following command can be used to generate an output file containing
a comparison between two amino acid sequences: C:\B12seq --i
c:\seq1.txt --j c:\seq2.txt --p blastp --o c:\output.txt. If the
two compared sequences share homology, then the designated output
file will present those regions of homology as aligned sequences.
If the two compared sequences do not share homology, then the
designated output file will not present aligned sequences.
[0158] Once aligned, the number of matches is determined by
counting the number of positions where an identical nucleotide or
amino acid residue is presented in both sequences. The percent
sequence identity is determined by dividing the number of matches
either by the length of the sequence set forth in the identified
sequence, or by an articulated length (such as 100 consecutive
nucleotides or amino acid residues from a sequence set forth in an
identified sequence), followed by multiplying the resulting value
by 100. For example, a nucleic acid sequence that has 1166 matches
when aligned with a test sequence having 1154 nucleotides is 75.0
percent identical to the test sequence (1166/1554*100=75.0). The
percent sequence identity value is rounded to the nearest tenth.
For example, 75.11, 75.12, 75.13, and 75.14 are rounded down to
75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to
75.2. The length value will always be an integer. In another
example, a target sequence containing a 20-nucleotide region that
aligns with 20 consecutive nucleotides from an identified sequence
contains a region that shares 75 percent sequence identity to that
identified sequence (15/20*100=75).
[0159] For comparisons of amino acid sequences of greater than
about 30 amino acids, the Blast 2 sequences function is employed
using the default BLOSUM62 matrix set to default parameters, (gap
existence cost of 11, and a per residue gap cost of 1). Homologs
are typically characterized by possession of at least 70% sequence
identity counted over the full-length alignment with an amino acid
sequence using the NCBI Basic Blast 2.0, gapped blastp with
databases such as the nr or swissprot database. Queries searched
with the blastn program are filtered with DUST (Hancock and
Armstrong Comput. Appl. Biosci. 10: 67-70, 1994). Other programs
use SEG. In addition, a manual alignment can be performed. Proteins
with even greater similarity will show increasing percentage
identities when assessed by this method, such as at least 75%, 80%,
85%, 90%, 95%, or 99% sequence identity to any protein listed in
Tables 8 and 9.
[0160] When aligning short peptides (fewer than around 30 amino
acids), the alignment should be performed using the Blast 2
sequences function, employing the PAM30 matrix set to default
parameters (open gap 9, extension gap 1 penalties). Proteins with
even greater similarity to the reference sequence will show
increasing percentage identities when assessed by this method, such
as at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence
identity. When less than the entire sequence is being compared for
sequence identity, homologs will typically possess at least 75%
sequence identity over short windows of 10-20 amino acids, and can
possess sequence identities of at least 85%, 90%, 95% or 98%
depending on their identity to the reference sequence. Methods for
determining sequence identity over such short windows are described
at the NCBI web site.
[0161] One indication that two nucleic acid molecules are closely
related is that the two molecules hybridize to each other under
stringent conditions. Stringent conditions are sequence-dependent
and are different under different environmental parameters. Nucleic
acid sequences that do not show a high degree of identity may
nevertheless encode identical or similar (conserved) amino acid
sequences, due to the degeneracy of the genetic code. Changes in a
nucleic acid sequence can be made using this degeneracy to produce
multiple nucleic acid molecules that all encode substantially the
same protein. Such homologous nucleic acid sequences can, for
example, possess at least 60%, 70%, 80%, 90%, 95%, 98%, or 99%
sequence identity determined by this method. In particular,
homologous nucleic acid sequences can possess at least 60%, 70%,
80%, 90%, 95%, 98% or 99% sequence identity to the nucleic acid
sequences that encode endothelial cell proteins listed in Tables 8
and 9. In a further example, homologous proteins can possess at
least 60%, 70%, 80%, 90%, 95%, 98% or 99% sequence identity to the
endothelial cell proteins listed in Tables 8 and 9.
[0162] One of skill in the art will appreciate that these sequence
identity ranges are provided for guidance only; it is possible that
strongly significant homologs could be obtained that fall outside
the ranges provided.
[0163] An alternative (and not necessarily cumulative) indication
that two nucleic acid sequences are substantially identical is that
the polypeptide which the first nucleic acid encodes is
immunologically cross reactive with the polypeptide encoded by the
second nucleic acid.
[0164] Serial analysis of gene expression (SAGE): A technique that
can be used to characterize gene expression, or more precisely gene
transcription. Briefly, the SAGE approach is a method for the rapid
quantitative and qualitative analysis of mRNA transcripts based
upon the isolation and analysis of short defined sequence tags
(SAGE Tags) corresponding to expressed genes. Each Tag is a short
nucleotide sequence (such as 9-33 base pairs in length) from a
defined position in the transcript. In the SAGE method, the Tags
are dimerized to reduce bias inherent in cloning or amplification
reactions (See, U.S. Pat. No. 5,695,937). SAGE is particularly
suited to the characterization of genes associated with vasculature
stimulation or inhibition because it is capable of detecting rare
sequence, evaluating large numbers of sequences at one time, and to
provide a basis for the identification of previously unknown
genes.
[0165] Specific Binding Agent: An agent that binds substantially
only to a defined target such as a protein, enzyme, polysaccharide,
oligonucleotide, DNA, RNA, recombinant vector or a small molecule.
Thus, a protein-specific binding agent binds substantially only the
defined protein, or to a specific region within the protein. In an
example, a "specific binding agent" includes antibodies and other
agents that bind substantially to a specified polypeptide.
Exemplary antibodies include monoclonal or polyclonal antibodies
that are specific for the polypeptide, as well as immunologically
effective portions ("fragments") thereof. In an example, a
"specific binding agent" is capable of binding to at least one of
the disclosed physiological or pathological angiogenesis
endothelial marker proteins. For instance, the "specific binding
agent" is an antibody specific for at least one of the disclosed
physiological or pathological angiogenesis endothelial marker
proteins. In an additional example, the "specific binding agent" is
capable of interacting with at least one of the organ-specific
endothelial marker proteins.
[0166] The determination that a particular agent binds
substantially only to a specific polypeptide may readily be made by
using or adapting routine procedures. One suitable in vitro assay
makes use of the Western blotting procedure (described in many
standard texts, including Harlow and Lane, Using Antibodies: A
Laboratory Manual, CSHL, New York, 1999). In further examples, the
specific binding agent is capable of binding to a mRNA or small
molecule that results in pathological angiogenesis being
inhibited.
[0167] Subject: Living multicellular vertebrate organisms, a
category which includes both human and veterinary subjects that are
in need of the desired biological effect, such as treatment of a
tumor. Examples include, but are not limited to: humans, apes,
dogs, cats, mice, rats, rabbits, horses, pigs, and cows.
[0168] Therapeutically Effective Amount: An amount of a composition
that alone, or together with an additional therapeutic agent(s)
(for example a chemotherapeutic agent), induces the desired
response (e.g., treatment of a tumor). The preparations disclosed
herein are administered in therapeutically effective amounts.
[0169] In one example, a desired response is to decrease tumor size
or metastasis in a subject to whom the therapy is administered.
Tumor metastasis does not need to be completely eliminated for the
composition to be effective. For example, a composition can
decrease metastasis by a desired amount, for example by at least
20%, at least 50%, at least 60%, at least 70%, at least 80%, at
least 90%, at least 95%, at least 98%, or even at least 100%
(elimination of the tumor), as compared to metastasis in the
absence of the composition.
[0170] In particular examples, it is an amount of the therapeutic
agent conjugated to the specific binding agent effective to
decrease a number of cancer cells, such as in a subject to whom it
is administered, for example a subject having one or more
carcinomas. The cancer cells do not need to be completely
eliminated for the composition to be effective. For example, a
composition can decrease the number of cancer cells by a desired
amount, for example by at least 20%, at least 50%, at least 60%, at
least 70%, at least 80%, at least 90%, at least 95%, at least 98%,
or even at least 100% (elimination of detectable cancer cells), as
compared to the number of cancer cells in the absence of the
composition.
[0171] In other examples, it is an amount of the specific binding
agent for one or more of the disclosed pathological angiogenesis
protein markers capable of reducing pathological angiogenesis by
least 20%, at least 50%, at least 60%, at least 70%, at least 80%,
at least 90%, at least 95%, at least 98%, or even at least 100%
(elimination of detectable pathological angiogenesis) by the
specific binding agent, or both, effective to decrease the
metastasis of a tumor.
[0172] A therapeutically effective amount of a specific binding
agent for at least one of the disclosed pathological angiogenesis
protein markers, or cancer cells lysed by a therapeutic molecule
conjugated to the agent, can be administered in a single dose, or
in several doses, for example daily, during a course of treatment.
However, the therapeutically effective amount can depend on the
subject being treated, the severity and type of the condition being
treated, and the manner of administration. For example, a
therapeutically effective amount of such agent can vary from about
1 .mu.g-10 mg per 70 kg body weight if administered intravenously
and about 10 .mu.g-100 mg per 70 kg body weight if administered
intratumorally.
[0173] Treating a disease: "Treatment" refers to a therapeutic
intervention that ameliorates a sign or symptom of a disease or
pathological condition, such a sign or symptom of a tumor.
Treatment can also induce remission or cure of a condition, such as
a tumor. In particular examples, treatment includes preventing a
disease, for example by inhibiting the full development of a
disease, such as preventing development of a tumor (such as a
metastasis). Prevention of a disease does not require a total
absence of a tumor. For example, a decrease of at least 50% can be
sufficient.
[0174] Tumor: A neoplasm. Includes solid and hematological (or
liquid) tumors. Examples of solid tumors, such as sarcomas and
carcinomas, include, but are not limited to: fibrosarcoma,
myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, and
other sarcomas, synovioma, mesothelioma, Ewing's tumor,
leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid
malignancy, pancreatic cancer, breast cancer, lung cancers, ovarian
cancer, prostate cancer, hepatocellular carcinoma, squamous cell
carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland
carcinoma, sebaceous gland carcinoma, papillary carcinoma,
papillary adenocarcinomas, medullary carcinoma, bronchogenic
carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma,
choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor,
bladder carcinoma, and CNS tumors (such as a glioma, astrocytoma,
medulloblastoma, craniopharyogioma, ependymoma, pinealoma,
hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma,
melanoma, neuroblastoma and retinoblastoma).
[0175] Unit dose: A physically discrete unit containing a
predetermined quantity of an active material calculated to
individually or collectively produce a desired effect, such as a
therapeutic effect. A single unit dose or a plurality of unit doses
can be used to provide the desired effect, such as treatment of a
tumor, for example a metastatic tumor. In one example, a unit dose
includes a desired amount of an agent that decreases or inhibits
pathological angiogenesis.
[0176] Vscp: Encodes an SH2-containing protein. In one example,
Vscp is expressed during pathological angiogenesis. The term Vscp
includes any Vscp gene, cDNA, mRNA, or protein from any organism
and that is Vscp and is expressed during pathological
angiogenesis.
[0177] Exemplary nucleic acid and protein sequences for Vscp are
publicly available. For example, GenBank Accession Nos.: DQ832275,
XM_357399, AK032598, XM_375698, and XM_939275 disclose Vscp nucleic
acid sequences and GenBank Accession Nos.: XP_357399, XP_375698,
and XP_944368 disclose Vscp protein sequences.
[0178] In one example, Vscp includes a full-length wild-type (or
native) sequence, as well as Vscp allelic variants, fragments,
homologs or fusion sequences that retain the ability to be
expressed during pathological angiogenesis and/or modulate
pathological angiogenesis. In certain examples, Vscp has at least
80% sequence identity, for example at least 85%, 90%, 95%, or 98%
sequence identity to Vscp. In other examples, Vscp has a sequence
that hybridizes under very high stringency conditions to a sequence
set forth in GenBank Accession No. DQ832275, XM_357399, AK032598,
XM_375698, and XM_939275 and retains Vscp activity (e.g., the
capability to be expressed during pathological angiogenesis and/or
modulate pathological angiogenesis).
[0179] Western blot: A method in molecular
biology/biochemistry/immunogenetics to detect protein in a
biological sample, such as a tissue homogenate or extract. Gel
electrophoresis can be employed to separate denatured proteins by
mass. Following separation, the proteins are transferred out of the
gel and onto a membrane (typically nitrocellulose), where they are
"probed" using antibodies specific to the protein. As a result, the
amount of protein in the sample can be examined and compared to
other protein levels. Other techniques also using antibodies allow
detection of proteins in tissues (immunohistochemistry) and cells
(immunocytochemistry).
[0180] Additional terms commonly used in molecular genetics can be
found in Benjamin Lewin, Genes V published by Oxford University
Press, 1994 (ISBN 0-19-854287-9); Kendrew et al (eds.), The
Encyclopedia of Molecular Biology, published by Blackwell Science
Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.),
Molecular Biology and Biotechnology: a Comprehensive Desk
Reference, published by VCH Publishers, Inc., 1995 (ISBN
1-56081-569-8).
Methods of Treatment
[0181] It is shown herein that pathological angiogenesis is
associated with the increased expression of at least thirteen
endothelial cell proteins (such as the pathological angiogenesis
marker proteins listed in Table 9). It is also demonstrated that
these proteins are not increased during physiological angiogenesis.
In addition, expression levels of various endothelial cell proteins
have been found to be dependent upon the organ in which the
proteins are expressed. Based on these observations, methods of
treating pathological angiogenesis, such as pathological
angiogenesis associated with a tumor, are disclosed. Further,
methods of delivering a therapeutic agent to a specific organ to
treat a disease are disclosed.
[0182] Methods are disclosed herein for treating pathological
angiogenesis, such as that associated with a tumor. In one example,
the method includes administering a therapeutically effective
amount of a composition to a subject in which the composition
includes a specific binding agent that preferentially binds to one
or more pathological angiogenesis marker proteins listed in Table 9
or a subset thereof, such as at least 1, at least 2, at least 3, at
least 5, at least 10, or at least 12 (for example, 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, or 13 of those listed). In particular
examples, the one or more pathological angiogenesis marker proteins
are Vscp, CD276, MiRP2, Ptprn (IA-2), ankylosis or combinations
thereof. The specific binding agent can be an antibody to one or
more of the pathological angiogenesis marker proteins conjugated to
a therapeutic molecule, such as a cytotoxin, chemotherapeutic
reagent, radionucleotide or a combination thereof.
[0183] Inhibiting Pathological Angiogenesis
[0184] Pathological angiogenesis is a physiological process
involving the growth of new blood vessels under pathological
conditions. For example, pathological angiogenesis is involved in
the transition of tumors from a dormant state to a malignant state.
Inhibition of pathological angiogenesis does not require 100%
inhibition, but can include at least a reduction (such as a
reduction of at least 10% or at least 25%) if not a complete
inhibition of new blood vessels associated with a specific
pathological condition.
[0185] In an example, inhibiting pathological angiogenesis can be
used to treat a tumor. Treatment of a tumor by reducing new blood
vessel growth can include preventing or delaying the development of
the tumor in a subject (such as preventing metastasis of a tumor),
and also includes reducing signs or symptoms associated with the
presence of such a tumor (for example by reducing the size or
volume of the tumor or a metastasis thereof). Such reduced growth
can in some examples decrease or slow metastasis of the tumor, or
reduce the size or volume of the tumor by at least 10%, at least
20%, at least 50%, or at least 75%. For example, pathological
angiogenesis can be inhibited to treat cancer such as a liver,
breast, colon and lung cancer. In another example, inhibition of
pathological angiogenesis includes reducing the invasive activity
of the tumor in the subject, for example by reducing the ability of
the tumor to metastasize by reducing or inhibiting new blood vessel
growth. In some examples, treatment using the methods disclosed
herein prolongs the time of survival of the subject.
[0186] Specific Binding Agents
[0187] Specific binding agents are agents that bind with higher
affinity to a molecule of interest, than to other molecules. For
example, a specific binding agent can be one that binds with high
affinity to one of the proteins listed in Tables 8 and 9, but does
not substantially bind to another protein. In a specific example, a
specific binding agent binds to one of the proteins listed in
Tables 8 and 9 with a binding affinity in the range of 0.1 to 20
nM.
[0188] Examples of specific binding agents include antibodies,
ligands, recombinant proteins, peptide mimetics, and soluble
receptor fragments. One specific example of a specific binding
agent is an antibody, such as a monoclonal or polyclonal antibody.
Methods of making antibodies that can be used clinically are known
in the art. Particular antibodies and methods that can be used to
produce them are described in detail below.
[0189] Another specific example of a specific binding agent is a
cell surface receptor ligand. Many cell surface receptors have
natural ligands that often bind the receptors with high affinity.
The ligands, that can be either soluble or cell surface bound, can
be used to direct cytotoxic agents to tumors. For example, VEGF has
been fused to the toxin gelonin and used in preclinical models to
prevent the growth of several tumor types. In an example, the
ligand is cell surface receptor itself and a recombinant protein
including the extracellular portion of the ligand can be used as a
specific binding agent. For instance, the extracellular domain can
be fused to a toxin or labeled with an agent that allows detection
of the tumor endothelium. In a particular example, the cell surface
ligand 4-1BBL can be used as a specific binding agent for CD137. In
other examples, the ligand for CD276 or CD109 can be used.
[0190] In a further example, small molecular weight inhibitors or
antagonists of the receptor protein can be used to regulate
pathological angiogenesis. In a particular example, small molecular
weight inhibitors or antagonists of the MiRP2 protein are used to
inhibit pathological angiogenesis.
[0191] In other specific examples, the function of secreted
proteins that participate in angiogenesis may be altered by using
antibodies that recognize the secreted proteins, or soluble
recombinant receptor fragments. An example of this is bevacizumab
(Avastin), a monoclonal antibody that recognizes VEGF which has
been approved by the FDA for the treatment of human metastatic
colorectal cancer and non-small cell lung cancer. The VEGF-trap is
a receptor fusion protein that also binds to and blocks VEGF and is
also currently in clinical development.
[0192] Specific binding agents can be therapeutic, for example by
reducing or inhibiting the biological activity of a protein. For
example, a specific binding agent that binds with high affinity to
one of the proteins listed in Tables 8 and 9, may substantially
reduce the biological function of the protein (for example, the
ability of the protein to promote pathological angiogenesis). In
other examples, a specific binding agent is conjugated to a
therapeutic molecule, for example an anti-tumor agent. In this way,
the specific binding agent permits targeting of the therapeutic
molecule to the cells of interest, such as vascular endothelium.
Such agents can be administered in therapeutically effective
amounts to individuals in need thereof, such as a subject having a
tumor.
[0193] Therapeutic Molecules
[0194] Therapeutic molecules include agents that can be used to
treat a disease, such as a tumor. In a specific example, a
therapeutic molecule is one that alone or together with an
additional compound induces the desired therapeutic response. One
or more therapeutic molecules can be conjugated directly or
indirectly to a specific binding agent, such as an antibody that
binds to one of the proteins listed in Tables 8 and 9. For example,
an antibody that binds to CD276, or Vscp can be conjugated to an
anti-tumor agent.
[0195] In an example, a therapeutic agent is an anti-tumor agent
such as a cytotoxin, chemotherapeutic reagent, radionucleotide or a
combination thereof. Non-limiting examples of suitable
chemotherapeutic agents for coupling to antibodies to achieve an
anti-tumor effect include fluorouracil, doxorubicin, adriamycin,
daunorubicin, methotrexate, daunomycin, neocarzinostatin, and
carboplatin. For example, the anti-tumor agent 5-fluorouracil can
be conjugated to a specific binding agent to treat a tumor such as
breast cancer. Non-limiting examples of suitable toxins include
bacterial, plant, and other toxins such as diphtheria toxin,
pseudomonas exotoxin A, staphylococcal enterotoxin A, abrin-A
toxin, ricin A (deglycosylated ricin A and native ricin A),
TGF-alpha toxin, cytotoxin from Chinese cobra (naja naja atra), and
gelonin (a plant toxin). For example, the anti-tumor agent
diphtheria toxin can be conjugated to a specific binding agent such
as CD276 to treat a tumor such as cancer.
[0196] Additional therapeutic agents can be used for coupling to
specific binding agents (such as antibodies) to generate an
anti-tumor agent. In an example, a therapeutic agent is a ribosome
inactivating protein from plants, bacteria and fungi. Non-limiting
examples of suitable ribosome inactivating proteins for coupling to
specific binding agents (e.g., antibodies) include restrictocin (a
ribosome inactivating protein produced by Aspergillus restrictus),
saporin (a ribosome inactivating protein from Saponaria
officinalis), and RNase.
[0197] In a particular example, a therapeutic composition that
includes a therapeutically effective amount of a binding agent
specific for one or more of the disclosed organ-specific or
pathological angiogenesis marker proteins (as listed in Tables 8
and 9) further includes therapeutically effective amounts of one or
more other biologically active compounds. Examples of biologically
active compounds include, but are not limited to: anti-neoplastic
agents (such as chemotherapeutics), antibiotics, alkylating agents,
antioxidants, adjuvants, and so forth (such as those listed below
under "additional treatments"). However, one skilled in the art
will appreciate that the composition including a therapeutically
effective amount of a binding agent specific for one or more of the
disclosed pathological angiogenesis or organ-specific marker
proteins and the other biologically active compounds can also be
administered separately (instead of in a single composition).
[0198] Depending on the endothelial marker, ligands or antibodies
that target them may be directly shuttled across the endothelial
layer into the underlying tissue by a process known as
transcytosis. [For example, see McIntosh et al. Proc. Natl. Acad.
Sci. U.S. A. 2002 99(4):1996; Gumbleton et al. J. Control Release.
2003 87(1-3):139-51]. Thus, site-directed pharmacodelivery may be
accomplished by use of cell surface endothelial markers specific
for certain organs, such as liver or brain endothelium. Drugs can
be conjugated to antibodies for selective delivery. A higher local
concentration of drug may result in higher efficacy with fewer side
effects. Even if antibodies directed to a particular endothelial
marker do not naturally enter a transcytotic pathway, they can be
forced to do so, for example through the generation of a bispecific
antibody that targets both the endothelial marker and a protein
present in caveolae, such as Caveolin-1.
[0199] Pre-Screening Subjects
[0200] In some examples, subjects are initially screened to
determine if they have increased expression levels of the disclosed
pathological angiogenesis markers in their serum, whether they have
a tumor that has increased expression levels of the disclosed
pathological angiogenesis markers or a combination thereof. For
example, the pathological angiogenesis markers provided herein can
be used to screen subjects to determine if they are candidates for
the disclosed therapies (see Section III.B).
[0201] Exemplary Tumors
[0202] A tumor is an abnormal growth of tissue that results from
excessive cell division. A particular example of a tumor is cancer.
For example, the current application provides methods for the
treatment (such as the prevention or reduction of metastasis) of
tumors (such as cancers). In some examples, the tumor is treated in
vivo, for example in a mammalian subject, such as a human subject.
Exemplary tumors that can be treated using the disclosed methods
include, but are not limited to: cancers of the liver, breast,
colon, and lung, including metastases of such tumors to other
organs.
[0203] Treating Particular Organs
[0204] In further examples, methods of delivering a therapeutic or
diagnostic agent to a specific organ to treat a disease are
disclosed. In specific examples, the method includes administering
a therapeutically effective amount of a composition that includes a
binding agent that preferentially binds to one or more
organ-specific endothelial marker proteins provided in Table 8 and
a therapeutic agent to evoke a therapeutic response in the specific
organ.
[0205] In one example, a therapeutic agent is delivered to the
brain via a composition including a specific binding agent (such as
an antibody) to one or more of the disclosed brain endothelial
marker proteins in Table 8 and a therapeutic agent to evoke a
desired therapeutic response. For example, the one or more brain
endothelial marker proteins is Glucose transporter GLUT-1, Organic
anion transporter 2, Pleiotrophin, ATPase class V, type 10A,
Peptidoglycan recognition protein 1, Organic anion transporter 14,
Forkhead box Q1, Organic anion transporter 3, SN2 (Solute carrier
family 38, member 5), Inter-alpha (globulin) inhibitor H5, Solute
carrier 38 member 3, Zinc finger protein of the cerebellum 2,
Testican-2, 3-HMG-CoA synthase 2, Progestin and adipoQ receptor
family member V, APC down-regulated 1 Drapc1, GDPD
phosphodiesterase family Accession No. NM_001042671, putative
transmembrane protein Accession No. NM_029001, DES2 lipid
desaturase/C4-hyroxylase, Kelch repeat and BTB (POZ) domain,
Lipolysis stimulated receptor, Glutathione S-transferase alpha 4,
TNF receptor superfamily member 19, T-box 1 or putative secreted
protein Accession No. XM_620023). In another example, the one or
more brain endothelial marker proteins include GDPD
phosphodiesterase family Accession No. NM_001042671, Forkhead box
Q1 (FOXQ1), putative transmembrane protein Accession No. NM_029001,
Kelch repeat and BTB (POZ) domain, Progestin and adipoQ receptor
family member V, or putative secreted protein Accession No.
XM_620023 or combinations thereof such as at least 1, at least 2,
at least 3, or at least 5 (for example, 1, 2, 3, 4, 5, or 6).
[0206] In a particular example, the desired therapeutic response is
to reduce the growth of brain tumor cells or even kill the brain
tumor cells (for example the therapeutic agent inducing cells to
undergo apoptosis). Such reduced growth can in some examples
decrease or slow metastasis of the brain tumor, or reduce the size
or volume of the brain tumor. In another example, the desired
therapeutic response is to treat a disease of the brain such as
depression or a stroke.
[0207] In additional examples, a therapeutic agent is delivered to
the liver via a composition including a specific binding agent to
the one or more liver endothelial marker proteins and a therapeutic
agent to evoke a desired therapeutic response. In an example, the
specific binding agent is an antibody that specifically binds to
one or more of the liver endothelial marker proteins disclosed in
Table 8. In a further example, the one or more liver endothelial
marker proteins is deoxyribonuclease 1-like 3, LZP oncoprotein
induced transcript 3, putative transmembrane protein Accession No.
NM_023438, CD32 15, putative G-protein coupled receptor NM_033616,
C-type lectin-like receptor 2, C-type lectin domain family 4 member
g 16, Plexin C1, Wnt9B, Accession No. AK144596, GATA-binding
protein 4, MBL-associated serine protease-3, Renin binding protein,
putative transmembrane protein Accession No. NM_144830, or Retinoic
acid receptor, beta. In another example, the one or more liver
endothelial marker proteins includes oncoprotein induced transcript
3, putative transmembrane protein Accession No. NM_023438, putative
G-protein coupled receptor NM_033616, Plexin C1, MBL-associated
serine protease-3, Accession No. AK144596, putative transmembrane
protein Accession No. NM_144830 or combinations thereof such as at
least 1, at least 2, at least 3, or at least 5 (for example, 1, 2,
3, 4, 5, 6, or 7).
[0208] In an example, the desired therapeutic response is to reduce
the growth of liver tumor cells or even kill the liver tumor cells
(for example the therapeutic agent inducing cells to undergo
apoptosis). Such reduced growth can in some examples decrease or
slow metastasis of the liver tumor, or reduce the size or volume of
a liver tumor. In another example, the desired therapeutic response
is to treat a liver disease.
[0209] In further examples, a diagnostic agent is delivered to a
specific organ such as the brain or liver via a composition
including a specific binding agent such as an antibody to one or
more of the disclosed organ-specific endothelial marker proteins in
Table 8. For example, a diagnostic agent can be delivered to the
brain via a specific binding agent that is capable of binding to
one or more of the disclosed brain endothelial marker proteins to
identify brain endothelial cells or to identify a tumor. For
instance, the vessels in tumors are often tortuous and dilated
compared to normal vessels. In an example, organ-specific vessel
markers can be used to detect tumors in a particular organ such as
the liver or brain.
[0210] Administration
[0211] Methods of administration of the disclosed compositions are
routine, and can be determined by a skilled clinician. For example,
the disclosed therapies (such as those that include a binding agent
specific for one or more of the disclosed pathological angiogenesis
marker proteins listed in Table 9 or the organ-specific markers
listed in Table 8) can be administered via injection,
intratumorally, orally, topically, transdermally, parenterally, or
via inhalation or spray. In a particular example, a composition is
administered intravenously to a mammalian subject, such as a
human.
[0212] The therapeutically effective amount of the agents
administered can vary depending upon the desired effects and the
subject to be treated. In one example, the method includes daily
administration of at least 1 .mu.g of the composition to the
subject (such as a human subject). For example, a human can be
administered at least 1 .mu.g or at least 1 mg of the composition
daily, such as 10 .mu.g to 100 .mu.g daily, 100 .mu.g to 1000 .mu.g
daily, for example 10 .mu.g daily, 100 .mu.g daily, or 1000 .mu.g
daily. In one example, the subject is administered at least 1 .mu.g
(such as 1-100 .mu.g) intravenously of the composition including a
binding agent that specifically binds to one or more of the
disclosed organ-specific or pathological angiogenesis marker
proteins. In one example, the subject is administered at least 1 mg
intramuscularly (for example in an extremity) of such composition.
The dosage can be administered in divided doses (such as 2, 3, or 4
divided doses per day), or in a single dosage daily.
[0213] In particular examples, the subject is administered the
therapeutic composition that includes a binding agent specific for
one or more of the disclosed organ-specific or pathological
angiogenesis marker proteins on a multiple daily dosing schedule,
such as at least two consecutive days, 10 consecutive days, and so
forth, for example for a period of weeks, months, or years. In one
example, the subject is administered the therapeutic composition
that a binding agent specific for one or more of the disclosed
organ-specific or pathological angiogenesis marker proteins daily
for a period of at least 30 days, such as at least 2 months, at
least 4 months, at least 6 months, at least 12 months, at least 24
months, or at least 36 months.
[0214] The therapeutic compositions, such as those that include a
binding agent specific for one or more of the disclosed
pathological angiogenesis or organ-specific marker proteins, can
further include one or more biologically active or inactive
compounds (or both), such as anti-neoplastic agents and
conventional non-toxic pharmaceutically acceptable carriers,
respectively.
[0215] In a particular example, a therapeutic composition that
includes a therapeutically effective amount of a binding agent
specific for one or more of the disclosed pathological angiogenesis
or organ-specific marker proteins further includes one or more
biologically inactive compounds. Examples of such biologically
inactive compounds include, but are not limited to: carriers,
thickeners, diluents, buffers, preservatives, and carriers. The
pharmaceutically acceptable carriers useful for these formulations
are conventional (see Remington's Pharmaceutical Sciences, by E. W.
Martin, Mack Publishing Co., Easton, Pa., 19th Edition (1995)). In
general, the nature of the carrier will depend on the particular
mode of administration being employed. For instance, parenteral
formulations can include injectable fluids that include
pharmaceutically and physiologically acceptable fluids such as
water, physiological saline, balanced salt solutions, aqueous
dextrose, glycerol or the like as a vehicle. For solid compositions
(for example, powder, pill, tablet, or capsule forms), conventional
non-toxic solid carriers can include, for example, pharmaceutical
grades of mannitol, lactose, starch, or magnesium stearate. In
addition to biologically-neutral carriers, pharmaceutical
compositions to be administered can include minor amounts of
non-toxic auxiliary substances, such as wetting or emulsifying
agents, preservatives, and pH buffering agents and the like, for
example sodium acetate or sorbitan monolaurate.
[0216] Additional Treatments
[0217] In particular examples, prior to, during, or following
administration of a therapeutic amount of an agent that reduces or
inhibits pathological angiogenesis due to the interaction of a
binding agent with one or more of the disclosed pathological
angiogenesis marker proteins, the subject can receive one or more
other therapies. In one example, the subject receives one or more
treatments to remove or reduce the tumor prior to administration of
a therapeutic amount of a composition including a binding agent
specific for one or more of the disclosed pathological angiogenesis
marker proteins.
[0218] Examples of such therapies include, but are not limited to,
surgical treatment for removal or reduction of the tumor (such as
surgical resection, cryotherapy, or chemoembolization), as well as
anti-tumor pharmaceutical treatments which can include
radiotherapeutic agents, anti-neoplastic chemotherapeutic agents,
antibiotics, alkylating agents and antioxidants, kinase inhibitors,
and other agents. Particular examples of additional therapeutic
agents can that can be used include microtubule binding agents, DNA
intercalators or cross-linkers, DNA synthesis inhibitors, DNA
and/or RNA transcription inhibitors, antibodies, enzymes, enzyme
inhibitors, and gene regulators. These agents (which are
administered at a therapeutically effective amount) and treatments
can be used alone or in combination. Methods and therapeutic
dosages of such agents are known to those skilled in the art, and
can be determined by a skilled clinician.
[0219] "Microtubule binding agent" refers to an agent that
interacts with tubulin to stabilize or destabilize microtubule
formation thereby inhibiting cell division. Examples of microtubule
binding agents that can be used in conjunction with the disclosed
therapy include, without limitation, paclitaxel, docetaxel,
vinblastine, vindesine, vinorelbine (navelbine), the epothilones,
colchicine, dolastatin 15, nocodazole, podophyllotoxin and
rhizoxin. Analogs and derivatives of such compounds also can be
used and are known to those of ordinary skill in the art. For
example, suitable epothilones and epothilone analogs are described
in International Publication No. WO 2004/018478. Taxoids, such as
paclitaxel and docetaxel, as well as the analogs of paclitaxel
taught by U.S. Pat. Nos. 6,610,860; 5,530,020; and 5,912,264 can be
used.
[0220] Suitable DNA and/or RNA transcription regulators, including,
without limitation, actinomycin D, daunorubicin, doxorubicin and
derivatives and analogs thereof also are suitable for use in
combination with the disclosed therapies.
[0221] DNA intercalators and cross-linking agents that can be
administered to a subject include, without limitation, cisplatin,
carboplatin, oxaliplatin, mitomycins, such as mitomycin C,
bleomycin, chlorambucil, cyclophosphamide and derivatives and
analogs thereof.
[0222] DNA synthesis inhibitors suitable for use as therapeutic
agents include, without limitation, methotrexate,
5-fluoro-5'-deoxyuridine, 5-fluorouracil and analogs thereof.
[0223] Examples of suitable enzyme inhibitors include, without
limitation, camptothecin, etoposide, formestane, trichostatin and
derivatives and analogs thereof.
[0224] Suitable compounds that affect gene regulation include
agents that result in increased or decreased expression of one or
more genes, such as raloxifene, 5-azacytidine,
5-aza-2'-deoxycytidine, tamoxifen, 4-hydroxytamoxifen, mifepristone
and derivatives and analogs thereof.
[0225] Kinase inhibitors include Gleevac, Iressa, and Tarceva that
prevent phosphorylation and activation of growth factors.
[0226] Other therapeutic agents, for example anti-tumor agents,
that may or may not fall under one or more of the classifications
above, also are suitable for administration in combination with the
disclosed therapies. By way of example, such agents include
adriamycin, apigenin, rapamycin, zebularine, cimetidine, and
derivatives and analogs thereof.
[0227] In one example, the therapeutic composition (such as one
including a binding agent specific for one or more of the disclosed
pathological angiogenesis marker proteins) is injected into the
subject in the presence of an adjuvant. An adjuvant is an agent
that when used in combination with an immunogenic agent augments or
otherwise alters or modifies a resultant immune response. In some
examples, an adjuvant increases the titer of antibodies induced in
a subject by the immunogenic agent. In one example, the one or more
peptides are administered to the subject as an emulsion with IFA
and sterile water for injection (for example an intravenous or
intramuscular injection). Incomplete Freund's Adjuvant (Seppic,
Inc.) can be used as the Freund's Incomplete Adjuvant (IFA)
(Fairfield, N.J.). In some examples, IFA is provided in 3 ml of a
mineral oil solution based on mannide oleate (Montanide ISA-51). At
the time of injection, the peptide(s) is mixed with the Montanide
ISA.51 and then administered to the subject. Other adjuvants can be
used, for example, Freund's complete adjuvant, B30-MDP, LA-15-PH,
montanide, saponin, aluminum hydroxide, alum, lipids, keyhole
lympet protein, hemocyanin, a mycobacterial antigen, and
combinations thereof.
[0228] In some examples, the subject receiving the therapeutic
peptide composition (such as one including a binding agent specific
for one or more of the disclosed pathological angiogenesis marker
proteins) is also administered interleukin-2 (IL-2), for example
via intravenous administration. In particular examples, IL-2
(Chiron Corp., Emeryville, Calif.) is administered at a dose of at
least 500,000 IU/kg as an intravenous bolus over a 15 minute period
every eight hours beginning on the day after administration of the
peptides and continuing for up to 5 days. Doses can be skipped
depending on subject tolerance.
[0229] In some examples, the disclosed compositions can be
co-administered with a fully human antibody to cytotoxic
T-lymphocyte antigen-4 (anti-CTLA-4). In some example subjects
receive at least 1 mg/kg anti-CTLA-4 (such as 3 mg/kg every 3 weeks
or 3 mg/kg as the initial dose with subsequent doses reduced to 1
mg/kg every 3 weeks).
[0230] In one example, at least a portion of the tumor (such as a
metastatic tumor) is surgically removed (for example via
cryotherapy), irradiated, chemically treated (for example via
chemoembolization) or combinations thereof, prior to administration
of the disclosed therapies (such as administration of a binding
agent specific for one or more of the disclosed pathological
angiogenesis marker proteins). For example, a subject having a
metastatic tumor can have all or part of the tumor surgically
excised prior to administration of the disclosed therapies (such as
one including a binding agent specific for one or more of the
disclosed pathological angiogenesis marker proteins). In another
particular example, the subject has a metastatic tumor and is
administered radiation therapy, chemoembolization therapy, or both,
prior to administration of the disclosed therapies (such as one
including a binding agent specific for one or more of the disclosed
pathological angiogenesis marker proteins).
[0231] In another example, the disclosed pathological angiogenesis
marker proteins can be used as "surrogate" markers of angiogenesis
that can also be used to detect the efficacy of other previously
disclosed anti-angiogenic agents in clinical trials.
Screening Subjects for Pathological Angiogenesis
[0232] Subjects can be screened prior to initiating the disclosed
therapies, for example to determine whether the subject has
pathological angiogenesis, a tumor, or a combination thereof. For
example, the presence of one or more of the disclosed pathological
angiogenesis marker proteins listed in Table 9 can indicate that
the subject has pathological angiogenesis and the tumor associated
with the angiogenesis can be treated using the methods provided
herein. In one example, the pathological angiogenesis marker
proteins are detected in a serum sample, such as pathological
angiogenesis markers known to be secreted (e.g., Apelin, sCD137 and
plgf), or cell surface molecules that are susceptible to enzymatic
cleavage at the cell surface (e.g., CD276, MiRP2, Doppel, PTPRN,
CD109 or ankylosis). In another example, the proteins are detected
in a tumor biopsy. Thus, the presence of the respective
pathological angiogenesis marker proteins can be used to diagnose,
or determine the prognosis of, a tumor in a subject.
[0233] In one example, pathological angiogenesis can be screened
for by detecting at least one expression product including one or
more of: Vscp, CD276, ETSvg4 (Pea3), CD137(4-1BB), MiRP2, Ubiquitin
D (Fat10), Doppel (prion-PLP), Apelin, Plgf, Ptprn (IA-2), CD109,
Ankylosis, and collagen VIII, 1, in a sample obtained from the
subject. In some examples, detection of the at least one expression
product indicates pathological angiogenesis in the subject. In a
further example, detection of the at least one expression product
indicates the presence of a tumor, such as cancer. For example, the
biological sample can be incubated with an antibody that
specifically binds to one or more of the disclosed pathological
angiogenesis marker proteins. The primary antibody can include a
detectable label. For example, the primary antibody can be directly
labeled, or the sample can be subsequently incubated with a
secondary antibody that is labeled (for example with a fluorescent
label). The label can then be detected, for example by microscopy,
ELISA, flow cytometery, or spectrophotometry. In another example,
the biological sample is analyzed by Western blotting for the
presence of at least one of the disclosed pathological angiogenesis
marker proteins (see Table 9). In some examples, the level of
expression of at least one of the disclosed angiogenesis marker
proteins can be compared to the level of expression of such
proteins in a control (e.g., non-cancer sample) or reference
value.
[0234] In one example, the antibody that specifically binds an
endothelial marker (such as those listed in Table 9) is directly
labeled with a detectable label. In another example, each antibody
that specifically binds an endothelial marker (the first antibody)
is unlabeled and a second antibody or other molecule that can bind
the human antibody that specifically binds the respective
endothelial marker is labeled. As is well known to one of skill in
the art, a second antibody is chosen that is able to specifically
bind the specific species and class of the first antibody. For
example, if the first antibody is a human IgG, then the secondary
antibody can be an anti-human-IgG. Other molecules that can bind to
antibodies include, without limitation, Protein A and Protein G,
both of which are available commercially.
[0235] Suitable labels for the antibody or secondary antibody
include various enzymes, prosthetic groups, fluorescent materials,
luminescent materials, magnetic agents and radioactive materials.
Non-limiting examples of suitable enzymes include horseradish
peroxidase, alkaline phosphatase, beta-galactosidase, or
acetylcholinesterase. Non-limiting examples of suitable prosthetic
group complexes include streptavidin/biotin and avidin/biotin.
Non-limiting examples of suitable fluorescent materials include
umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin. A non-limiting exemplary luminescent material is
luminol; a non-limiting exemplary magnetic agent is gadolinium, and
non-limiting exemplary radioactive labels include .sup.125I,
.sup.131I, .sup.35S or .sup.3H.
[0236] In an alternative example, endothelial markers can be
assayed in a biological sample by a competition immunoassay
utilizing endothelial marker standards labeled with a detectable
substance and an unlabeled antibody that specifically binds the
desired endothelial marker. In this assay, the biological sample
(such as serum), the labeled endothelial marker standards and the
antibody that specifically binds the desired endothelial marker are
combined and the amount of labeled endothelial marker standard
bound to the unlabeled antibody is determined. The amount of
endothelial marker in the biological sample is inversely
proportional to the amount of labeled endothelial marker standard
bound to the antibody that specifically binds the endothelial
marker.
[0237] In one example, a subject is screened by determining whether
that have increased levels of one or more of the disclosed
pathological angiogenesis marker proteins in their serum (for
example relative to a level present in a serum sample from a
subject not having a tumor), for example using an antibody that
specifically binds one or more of the disclosed pathological
angiogenesis markers (such as those described below).
[0238] As an alternative to analyzing the sample for the presence
of proteins, the presence of nucleic acids can be determined. For
example, the biological sample can be incubated with primers that
permit the amplification of one or more of the pathological
angiogenesis marker mRNAs, under conditions sufficient to permit
amplification of such products (see, for example, primer sequences
provided in Example 1). Exemplary methods include SAGE and PCR. In
another example, the biological sample is incubated with probes
that can bind to one or more of the disclosed pathological
angiogenesis marker nucleic acid sequences (such as cDNA, genomic
DNA, or RNA (such as mRNA)) under high stringency conditions. The
resulting hybridization products can then be detected using methods
known in the art. In one example, a subject is screened by
determining whether that have increased levels of one or more the
disclosed pathological angiogenesis marker nucleic acids in their
serum (for example relative to a level present in adjacent
non-tumor cells from the same subject), for example detecting mRNA
expression of one or more the disclosed pathological angiogenesis
markers.
Generation of Antibodies
[0239] One of ordinary skill in the art can readily generate
antibodies which specifically bind to the disclosed endothelial
marker proteins. These antibodies can be monoclonal or polyclonal.
They can be chimeric or humanized. Any functional fragment or
derivative of an antibody can be used including Fab, Fab', Fab2,
Fab'2, and single chain variable regions. So long as the fragment
or derivative retains specificity of binding for the endothelial
marker protein it can be used in the methods provided herein.
Antibodies can be tested for specificity of binding by comparing
binding to appropriate antigen to binding to irrelevant antigen or
antigen mixture under a given set of conditions. If the antibody
binds to appropriate antigen at least 2, at least 5, at least 7 or
10 times more than to irrelevant antigen or antigen mixture, then
it is considered to be specific.
[0240] In an example, monoclonal antibodies are generated to the
endothelial cell markers disclosed in Tables 8 and 9. These
monoclonal antibodies each include a variable heavy (VH) and a
variable light (VL) chain and specifically bind to the specific
endothelial cell markers. For example, the antibody can bind the
specific endothelial cell markers with an affinity constant of at
least 10.sup.6 M.sup.-1, such as at least 10.sup.7 M.sup.-1, at
least 10.sup.8 M.sup.-1, at least 5.times.10.sup.8 M.sup.-1, or at
least 10.sup.9 M.sup.-1.
[0241] The specific antibodies can include a V.sub.L polypeptide
having amino acid sequences of the complementarity determining
regions (CDRs) that are at least about 90% identical, such as at
least about 95%, at least about 98%, or at least about 99%
identical to the amino acid sequences of the specific endothelial
marker proteins and a V.sub.H polypeptide having amino acid
sequences of the CDRs that are at least about 90% identical, such
as at least about 95%, at least about 98%, or at least about 99%
identical to the amino acid sequences of the specific endothelial
marker proteins.
[0242] In one example, the sequence of the specificity determining
regions of each CDR is determined. Residues that are outside the
SDR (non-ligand contacting sites) are substituted. For example, in
any of the CDR sequences, at most one, two or three amino acids can
be substituted. The production of chimeric antibodies, which
include a framework region from one antibody and the CDRs from a
different antibody, is well known in the art. For example,
humanized antibodies can be routinely produced. The antibody or
antibody fragment can be a humanized immunoglobulin having CDRs
from a donor monoclonal antibody that binds one of the disclosed
endothelial marker proteins and immunoglobulin and heavy and light
chain variable region frameworks from human acceptor immunoglobulin
heavy and light chain frameworks. Generally, the humanized
immunoglobulin specifically binds to one of the disclosed
endothelial marker proteins with an affinity constant of at least
10.sup.7 M.sup.-1, such as at least 10.sup.8 M.sup.-1 at least
5.times.10.sup.8 M.sup.-1 or at least 10.sup.9 M.sup.-1.
[0243] In another example, human monoclonal antibodies to the
disclosed specific endothelial marker proteins in Tables 8 and 9
are produced. Human monoclonal antibodies can be produced by
transferring donor complementarity determining regions (CDRs) from
heavy and light variable chains of the donor mouse immunoglobulin
into a human variable domain, and then substituting human residues
in the framework regions when required to retain affinity. The use
of antibody components derived from humanized monoclonal antibodies
obviates potential problems associated with the immunogenicity of
the constant regions of the donor antibody. For example, when mouse
monoclonal antibodies are used therapeutically, the development of
human anti-mouse antibodies (HAMA) leads to clearance of the murine
monoclonal antibodies and other possible adverse events. Chimeric
monoclonal antibodies, with human constant regions, humanized
monoclonal antibodies, retaining only murine CDRs, and "fully
human" monoclonal antibodies made from phage libraries or
transgenic mice have all been used to reduce or eliminate the
murine content of therapeutic monoclonal antibodies.
[0244] Techniques for producing humanized monoclonal antibodies are
described, for example, by Jones et al., Nature 321:522, 1986;
Riechmann et al., Nature 332:323, 1988; Verhoeyen et al., Science
239:1534, 1988; Carter et al., Proc. Natl. Acad. Sci. U.S.A.
89:4285, 1992; Sandhu, Crit. Rev. Biotech. 12:437, 1992; and Singer
et al., J. Immunol. 150:2844, 1993. The antibody may be of any
isotype, but in several embodiments the antibody is an IgG,
including but not limited to, IgG.sub.1, IgG.sub.2, IgG.sub.3 and
IgG.sub.4.
[0245] In one example, the sequence of the humanized immunoglobulin
heavy chain variable region framework can be at least about 65%
identical to the sequence of the donor immunoglobulin heavy chain
variable region framework. Thus, the sequence of the humanized
immunoglobulin heavy chain variable region framework can be at
least about 75%, at least about 85%, at least about 99% or at least
about 95%, identical to the sequence of the donor immunoglobulin
heavy chain variable region framework. Human framework regions, and
mutations that can be made in a humanized antibody framework
regions, are known in the art (see, for example, in U.S. Pat. No.
5,585,089).
[0246] Antibodies, such as murine monoclonal antibodies, chimeric
antibodies, and humanized antibodies, include full length molecules
as well as fragments thereof, such as Fab, F(ab').sub.2, and Fv,
which include a heavy chain and light chain variable region and are
capable of binding the epitopic determinant. These antibody
fragments retain some ability to selectively bind with their
antigen or receptor. These fragments include: (1) Fab, the fragment
which contains a monovalent antigen-binding fragment of an antibody
molecule, can be produced by digestion of whole antibody with the
enzyme papain to yield an intact light chain and a portion of one
heavy chain; (2) Fab', the fragment of an antibody molecule can be
obtained by treating whole antibody with pepsin, followed by
reduction, to yield an intact light chain and a portion of the
heavy chain; two Fab' fragments are obtained per antibody molecule;
(3) (Fab').sub.2, the fragment of the antibody that can be obtained
by treating whole antibody with the enzyme pepsin without
subsequent reduction; F(ab').sub.2 is a dimer of two Fab' fragments
held together by two disulfide bonds; (4) Fv, a genetically
engineered fragment containing the variable region of the light
chain and the variable region of the heavy chain expressed as two
chains; and (5) Single chain antibody (such as scFv), defined as a
genetically engineered molecule containing the variable region of
the light chain, the variable region of the heavy chain, linked by
a suitable polypeptide linker as a genetically fused single chain
molecule. Methods of making these fragments are known in the art
(see for example, Harlow and Lane, Antibodies: A Laboratory Manual,
Cold Spring Harbor Laboratory, New York, 1988). Fv antibodies are
typically about 25 kDa and contain a complete antigen-binding site
with three CDRs per each heavy chain and each light chain. To
produce these antibodies, the V.sub.H and the V.sub.L can be
expressed from two individual nucleic acid constructs in a host
cell. If the V.sub.H and the V.sub.L are expressed
non-contiguously, the chains of the Fv antibody are typically held
together by noncovalent interactions. However, these chains tend to
dissociate upon dilution, so methods have been developed to
crosslink the chains through glutaraldehyde, intermolecular
disulfides, or a peptide linker. Thus, in one example, the Fv can
be a disulfide stabilized Fv (dsFv), wherein the heavy chain
variable region and the light chain variable region are chemically
linked by disulfide bonds.
[0247] In an additional example, the Fv fragments include V.sub.H
and V.sub.L chains connected by a peptide linker. These
single-chain antigen binding proteins (scFv) are prepared by
constructing a structural gene comprising DNA sequences encoding
the V.sub.H and V.sub.L domains connected by an oligonucleotide.
The structural gene is inserted into an expression vector, which is
subsequently introduced into a host cell such as E. coli. The
recombinant host cells synthesize a single polypeptide chain with a
linker peptide bridging the two V domains. Methods for producing
scFvs are known in the art (see Whitlow et al., Methods: a
Companion to Methods in Enzymology, Vol. 2, page 97, 1991; Bird et
al., Science 242:423, 1988; U.S. Pat. No. 4,946,778; Pack et al.,
Bio/Technology 11:1271, 1993; and Sandhu, supra).
[0248] Antibody fragments can be prepared by proteolytic hydrolysis
of the antibody or by expression in E. coli of DNA encoding the
fragment. Antibody fragments can be obtained by pepsin or papain
digestion of whole antibodies by conventional methods. For example,
antibody fragments can be produced by enzymatic cleavage of
antibodies with pepsin to provide a 5S fragment denoted
F(ab').sub.2. This fragment can be further cleaved using a thiol
reducing agent, and optionally a blocking group for the sulfhydryl
groups resulting from cleavage of disulfide linkages, to produce
3.5S Fab' monovalent fragments. Alternatively, an enzymatic
cleavage using pepsin produces two monovalent Fab' fragments and an
Fc fragment directly (see U.S. Pat. No. 4,036,945 and U.S. Pat. No.
4,331,647, and references contained therein; Nisonhoff et al.,
Arch. Biochem. Biophys. 89:230, 1960; Porter, Biochem. J. 73:119,
1959; Edelman et al., Methods in Enzymology, Vol. 1, page 422,
Academic Press, 1967; and Coligan et al. at sections 2.8.1-2.8.10
and 2.10.1-2.10.4).
[0249] Other methods of cleaving antibodies, such as separation of
heavy chains to form monovalent light-heavy chain fragments,
further cleavage of fragments, or other enzymatic, chemical, or
genetic techniques may also be used, so long as the fragments bind
to the antigen that is recognized by the intact antibody.
[0250] One of skill will realize that conservative variants of the
antibodies can be produced. Such conservative variants employed in
antibody fragments, such as dsFv fragments or in scFv fragments,
will retain critical amino acid residues necessary for correct
folding and stabilizing between the V.sub.H and the V.sub.L
regions, and will retain the charge characteristics of the residues
in order to preserve the low pI and low toxicity of the molecules.
Amino acid substitutions (such as at most one, at most two, at most
three, at most four, or at most five amino acid substitutions) can
be made in the V.sub.H and the V.sub.L regions to increase yield.
Conservative amino acid substitution tables providing functionally
similar amino acids are well known to one of ordinary skill in the
art. The following six groups are examples of amino acids that are
considered to be conservative substitutions for one another: 1)
Alanine (A), Serine (S), Threonine (T); 2) Aspartic acid (D),
Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine
(R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M),
Valine (V); and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan
(W).
[0251] Antibodies are commercially available for many of the
endothelial markers disclosed herein (see Tables 1-4).
TABLE-US-00001 TABLE 1 Antibodies for Brain Endothelial Markers
(BEMs) Gene Acces- sion No. Gene Commercial Source NM_011400
Glucose transporter GLUT-1 abcam .RTM. NM_030687 Organic anion
transporter 2 Alpha Diagnostic International NM_008973 Pleiotrophin
abcam .RTM. NM_009728 ATPase, class V, type 10A Orbigen NM_009402
Peptidoglycan recognition IMGENEX protein 1 NM_008239 Forkhead box
Q1 abcam .RTM. NM_031194 Organic anion transporter 3 Alpha
Diagnostic International NM_172479 SN2, Solute carrier family 38,
abcam .RTM. member 5 NM_010703 Lymphoid enhancer binding Aviva
Systems Biology factor 1 NM_011404 Solute carrier family 7,
BIODESIGN member 5 International NM_023805 Solute carrier family
38, BD Biosciences member 3 Pharmingen NM_009574 Zinc finger
protein of the BIODESIGN cerebellum 2 International NM_052994
Testican-2 R & D Systems NM_028748 Progestin and adipoQ
receptor Abnova Corporation family member V NM_010357 Glutathione
S-transferase, Lab Vision alpha 4 NM_011532 T-box 1 BioCarta
TABLE-US-00002 TABLE 2 Antibodies for Liver Endothelial Markers
(LEMs) Gene Acces- sion No. Gene Commercial Source NM_007870
Deoxyribonuclease 1-like 3 Abnova .RTM. Corporation AK150613 CD32
15 Eurogenetics NM_019985 C-type lectin-like receptor 2 R & D
Systems NM_018797 Plexin C1 Novus Biologicals NM_008092
GATA-binding protein 4 CeMines AB049755 MBL-associated serine
HyCult biotechnology protease-3 b.v. NM_023132 Renin binding
protein Novus Biologicals NM_011243 Retinoic acid receptor, beta
abcam .RTM.
TABLE-US-00003 TABLE 3 Antibodies for Physiological Angiogenesis
Endothelial Markers Gene Acces- sion No. Gene Commercial Source
NM_026785 Ube2c Novus biologicals NM_011623 DNA topo II Leinco
Technologies, Inc. NM_008381 Inhibin beta-B AbDSerotec NM_025415
Cks2 Novus biologicals NM_009387 TK1 Novus biologicals NM_011607
Tenascin C abcam .RTM. NM_024435 Neurotensin Calbiochem NM_145150
Prc1 Biolegend XM_133912 Ki67 antigen abcam .RTM. NM_016780
beta-Integrin ABR - Affinity BioReagents
TABLE-US-00004 TABLE 4 Antibodies for Pathological Angiogenesis
Endothelial Markers Gene Acces- sion No. Gene Commercial Source
DQ832276 CD276 (B7-H3) eBioscience, Inc. DQ832277 ETSvg4 (Pea3)
Santa Cruz Biotechnology DQ832278 CD137 (4-1BB) GeneTex DQ832280
MiRP2 almone labs NM_023137 Ubiquitin D (FAT10) R & D Systems
DQ832281 Doppel (Prion-PLP) abcam .RTM. DQ832282 Apelin
ABR-Affinity BioReagents NM_008827 Plgf R & D Systems DQ832283
Ptprn (IA-2) abcam .RTM. DQ832284 CD109 abcam .RTM. NM_007739 Coll.
VIII, .alpha.1 Cosmo Bio Corp., Ltd.
[0252] Conjugation of Therapeutic or Diagnostic Agents to
Antibodies
[0253] Binding agents, such as antibodies of this disclosure, can
be conjugated or linked to an effector molecule, such as a
therapeutic agent (such as an anti-tumor agent) or a diagnostic
agent (such as a fluorescent moiety), using any number of methods
known to those of skill in the art (for example, see Harlow and
Lane, Using Antibodies: A Laboratory Manual, CSHL, New York, 1999;
Yang et al., Nature, 382:319-24, 1996). Both covalent and
noncovalent attachment means can be used.
[0254] The procedure for attaching an effector molecule to an
antibody varies according to the chemical structure of the
effector. Polypeptides typically contain a variety of functional
groups; such as carboxylic acid (COOH), free amine (--NH.sub.2) or
sulfhydryl (--SH) groups, which are available for reaction with a
suitable functional group on an antibody to result in the binding
of the effector molecule. Alternatively, the antibody is
derivatized to expose or attach additional reactive functional
groups. The derivatization can involve attachment of any of a
number of linker molecules such as those available from Pierce
Chemical Company, Rockford, Ill. The linker can be any molecule
used to join the antibody to the effector molecule (e.g.,
therapeutic agent or diagnostic agent). The linker is capable of
forming covalent bonds to both the antibody and to the effector
molecule. Suitable linkers are well known to those of skill in the
art and include, but are not limited to, straight or branched-chain
carbon linkers, heterocyclic carbon linkers, or peptide linkers.
Where the antibody and the effector molecule are polypeptides, the
linkers can be joined to the constituent amino acids through their
side groups (such as through a disulfide linkage to cysteine) or to
the alpha carbon amino and carboxyl groups of the terminal amino
acids.
[0255] In some circumstances, it is desirable to free the effector
molecule from the antibody when the immunoconjugate has reached its
target site. Therefore, in these circumstances, immunoconjugates
can include linkages that are cleavable in the vicinity of the
target site. Cleavage of the linker to release the effector
molecule from the antibody may be prompted by enzymatic activity or
conditions to which the immunoconjugate is subjected either inside
the target cell or in the vicinity of the target site. When the
target site is a tumor, a linker which is cleavable under
conditions present at the tumor site (for example, when exposed to
tumor-associated enzymes or acidic pH) can be used.
[0256] In view of the large number of methods that have been
reported for attaching a variety of radiodiagnostic compounds,
radiotherapeutic compounds, label (such as enzymes or fluorescent
molecules) drugs, toxins, and other agents to antibodies one
skilled in the art will be able to determine a suitable method for
attaching a given agent to an antibody or other polypeptide.
[0257] The subject matter of the present disclosure is further
illustrated by the following non-limiting Examples.
EXAMPLES
Example 1
Materials and Methods
[0258] Cell Lines and Animal Studies.
[0259] EMT6 cells were a kind gift of Dr. Robert S. Kerbel, KM12SM
cells were a kind gift of Isaiah J. Fidler, HCT116 cells were from
the DCT tumor repository (NCI, Frederick) and LS174T, SW620, CT26
and LLC were from the American Type Culture Collection (Manassas,
Va.). Tumor cell lines were maintained in DMEM containing 10% fetal
bovine serum. Tumors were made by inoculating
5.times.10.sup.5-1.times.10.sup.6 cells subcutaneously or
intrasplenically. To produce liver metastasis by intrasplenic
injection, the spleen was exteriorized through a left lateral
incision prior to tumor cell injection. The tumor cell suspension
was allowed to enter the portal circulation over a period of five
minutes, after which the spleen was removed and the skin sutured.
For partial hepatectomy, the liver was exposed through a midline
abdominal incision and the two anterior lobes were exteriorized and
the suspensory ligaments severed. The left lateral and caudal lobes
were gently tied off using 6-0 sterile silk prior to excision
leaving a 3 mm stump above the silk. The procedure results in the
removal of .about.70% of liver volume. The remaining liver was
placed back into the peritoneal cavity and the peritoneal cavity
and skin are sutured.
[0260] Endothelial Cell Isolations and Construction of SAGE
Libraries.
[0261] Immediately following CO.sub.2 euthanasia, normal or tumor
tissues were resected, diced with a razor, and digested in
Hepatocyte Wash Buffer (Invitrogen, Carlsbad, Calif.) containing 2
mg/ml collagenase A (Roche) for 1-hour at 37.degree. C. All
subsequent steps were performed on ice or at 4.degree. C. After
filtering sequentially through 100 and 25-.mu.m mesh, cells were
pelleted and rinsed repeatedly with PBS containing 0.5% BSA
(PBS/BSA) until the supernatant was transparent. To remove
hematopoietic cells from the sample, cells were incubated with a
mixture of streptavidin-linked dynabeads (Dynal, Lake Success,
N.Y.) that had been separately pre-bound to biotin anti-CD19,
biotin anti-CD45 (BD Pharmingen, San Diego, Calif.) or biotin
anti-F480 (Caltag Laboratories, Burlingame, Calif.) and then mixed
at a 1:1:1 ratio. To prevent non-specific binding of Fc-receptor
containing cells in the positive selection, anti-CD16/32 antibodies
(Fc Block; BD Pharmingen) were added to the cell suspension. To
label ECs from heart, kidney, intestine, liver, lung, KM12 tumors
and LS174T tumors, biotinylated rat anti-mouse CD105 (eBioscience,
San Diego, Calif.) was added; to label ECs from spleen, CT26 tumors
or LLC tumors biotinylated goat anti-mouse VE-cadherin (R&D
Systems, Minneapolis, Minn.) was added, and to label ECs from
brain, muscle, EMT6 tumors and SW620 a mixture of both antibodies
was added. After rinsing 5.times.with PBS/BSA, streptavidin-linked
dynabeads were added to the cell suspension, rotated 5 minutes at
4.degree. C., diluted to 40 ml with PBS/BSA and bead-bound cells
were captured using a Dynal MPC-50 magnet. Captured ECs were rinsed
5-10 times until only bead-bound cells were observed. Cells were
resuspended in mRNA lysis/binding buffer for SAGE or mRNA
extraction buffer for RT-PCR. After removing the beads, lysates
were stored at -80.degree. C. until ready to use.
[0262] Construction of SAGE Libraries.
[0263] LongSAGE libraries were constructed using the I-SAGE Long
Kit (Invitrogen) and a previously established MicroSAGE protocol by
St. Croix et al. (available from John Hopkins Oncology Center,
Baltimore, Md. 21231) which is herein incorporated by reference in
its entirety. Ditags were PCR amplified using biotinylated primers
to facilitate efficient linker removal and Mme-I enzyme was
purchased from New England Biolabs (Ipswich, Mass.). SAGE tags used
to identify various endothelial cell markers are included in Tables
5A-5D. Some genes have multiple tags due to alternative
polyadenylation sites, internal polyA stretches, and antisense
transcripts. The number of times each tag was observed was
normalized to 100,000 tags and is indicated in parenthesis
following the tag sequence in Tables 5A-5D. For genes with multiple
SAGE tags, counts for individual tags were summed to obtain the
total number of tags. Each tag is preceded by the sequence CATG.
Antisense tags are followed by an asterisk.
TABLE-US-00005 TABLE 5A SAGE tags used to identify Brain
Endothelial Markers. SEQ ID NO: Acc # SAGE Tags 1 NM_011400
AGAAGGACCTCGGAGGC (512) 2 NM_011400 TGCTTCCAGTATGTGGA (124) 3
NM_011400 GTGITTGTGTGGCCCTC* (104) 4 NM_011400 AGAAGGACTTCGGAGGC
(8) 5 NM_011400 CCTGAATTGCTGAGGCC (5) 6 NM_030687 AGGGACTTCAGTCCCTC
(137) 7 NM_030687 ATAAAAAATATTTACTG (11) 8 NM_030687
CCCCACCAAAAATCAAT (9) 9 NM_008973 AAATCCTTTCACTTTGG (72) 10
NM_008973 TAAACTACTTCTCTTGT (15) 11 NM_008973 TTTCAATCTTATCTTAA (7)
12 NM_009728 GGTCTGACAGCTCCGGT (32) 13 NM_009402 GACCGGGTACCCGCAAA
(40) 14 NM_021471 ACAAACCTCTAAGGATG (15) 15 NM_021471
CGCTGCAAGGGATCGTG (7) 16 NM_021471 TAAATGAATAAAAGCAT (4) 17
NM_008239 GGGTAAATGATGACTAC (15) 18 NM_008239 GGCAAGTTCCCCTTTTT (9)
19 NM_008239 GAGTGGTTCCCTGATGT* (5) 20 NM_031194 CTCTCAGAACAAAGACT
(14) 21 NM_031194 CCAACCTACTCTATTGC (5) 22 NM_172479
AGAGGAGGTATGGGAGG 23 NM_172471 AGGAGAGTGTCTAAAAG (24) 24 NM_172471
CACAAATATTTACCATT (13) 25 NM_172471 AGTTTCCACCTTTATTC (4) 26
NM_010703 GTGGTAAGAGAAGCTCC (12) 27 NM_011404 TCACTGCCCTGAAAGAC
(23) 28 NM_023805 ACTTACATTCCACTGCT (20) 29 NM_009574
TGATGTTTCAGTGCTTT (8) 30 NM_009574 AGTCCTCCCCTCAGGGC (6) 31
NM_009574 CTTCCTAGTCTTTTTGA (2) 32 NM_052994 TTTTAGTAAGAAAGCAG (49)
33 NM_052994 CCTCAGCACGCCCTCAG (27) 34 NM_052994 GGACCCCTGACTGTGAT
(4) 35 NM_008256 CTGCTGTGGACCAGAGC (19) 36 NM_008256
AATGTGTTCTATCCCTC (7) 37 NM_028748 ACTTCAGAATGTGCCAG (7) 38
NM_028748 GTGGATGCCAATTTGCC (5) 39 NM_028748 ATACCAAACACGCCAAT (3)
40 AK172004 GTGCATACTTGAGGGGG (68) 41 NM_001042671
ACTTTAATACCACTTAG* (6) 42 NM_001042671 CAGAAAAATAAATGTCC (4) 43
NM_001042671 TATTGACAGAAGTTAAA (4) 44 NM_029001 CACAAGCTGTTAGAGGC
(11) 45 NM_029001 CTTACAATGAGAAGCGA (6) 46 NM_029001
GGCGCCACACAACGTTG (4) 47 NM_029001 TCCTGCCATTCACAAAT (3) 48
NM_029001 TGATTGGCTTACCTCAG (2) 49 NM_027299 GAACACCACGACTTCCC (19)
50 XM_486083 CGGAAACTGCCAGTGCT (37) 51 XM_486083 CGGAAACTGCCAAAAAA
(2) 52 NM_017405 GGAGCAGGAACCCCTTC (46) 53 NM_010357
TATGCAGATGGCACCCA (36) 54 NM_013869 GCTCTTAAGAGAGTTTG (9) 55
NM_011532 CGGGTTTCCCGCCCGCC (17) 56 XM_620023 CAACGCCAGCCTCTCCC
(6)
TABLE-US-00006 TABLE 5B SAGE tags used to identify Liver
Endothelial Markers. SEQ ID NO: Acc # SAGE Tags 57 NM_007870
TGTAACCTGAAGAAATA (122) 58 NM_007870 CAGATAGCTTAGACCTA* (38) 59
NM_007870 GGTGATTTCAACGCCGG (16) 60 NM_007870 GTGCTTGCTTGTGTGCA*
(15) 61 NM_007870 CCAAATCTGTCCTGTTG* (6) 62 NM_010959
CAGGCAAACCACTCATA (28) 63 NM_010959 ATCTCCTAGATACCTAA (26) 64
NM_010959 AAAGGACTGGCTGGCTG (5) 65 NM_023438 GGGTGGGTGAAGGCAGA (16)
66 AK150613 TTACTTTAATAGTAAAA (66) 67 AK150613 GTACAGTGTAGATAATT
(32) 68 AK150613 TATAGGCTTTCTAAAAA* (6) 69 AK150613
AGTTCAGAGTGTAGACA (5) 70 AK150613 TGTGTGGGCTGCCTATG* (5) 71
AK150613 ATTACCAGAACCACATT (5) 72 AK150613 CGAAGGGACCCACAACC (4) 73
NM_033616 GGTCTTACCTCACCACG (22) 74 NM_033616 TTGCTTGGAACCGCATT*
(5) 75 NM_019985 CAATAAAAGATCTGGAC (14) 76 NM_029465
CTTTAGTGACCCCAGCT (219) 77 NM_029465 ATGGTGGGCACTGCTCA* (14) 78
NM_029465 TCCTCTGGAATCATTGG (6) 79 NM_018797 AGTCCTGTGTGAGCCTT (23)
80 NM_029465 ATGGTGGGCACTGCTCA* (14) 81 NM_029465 TCCTCTGGAATCATTGG
(6) 82 NM_011719 CTTCCTGTCTGAGCACT (9) 83 AK144596
GGGTTGTAAGGAATTTT (16) 84 NM_008092 CCTGCCCCTCCTCCACA (7) 85
NM_008092 ATAGCAGCTGTCCTAGG (2) 86 AB049755 TAAAGGATACTATATTT (6)
87 AB049755 AGTCCTGGGTTCTGTCC (4) 88 NM_023132 AAGGCTCGAAATAAAGA
(5) 89 NM_144830 GATGAATCTTTTTCAAG (14) 90 NM_144830
GATTCTCTGCATCAGGC (7) 91 NM_144830 TTGGTTACCCAGCTCCG (5) 92
NM_011243 GAGTCTCCTGGCAAAGA (10) 93 NM_011243 AATAACCAGGCCTCACG
(1)
TABLE-US-00007 TABLE 5C SAGE tags used to identify Physiological
Angiogenesis Endothelial Markers. Gene (SEQ ID NO) SAGE tags Ube2c
ACATCTGGTGACAAAGG (47) (SEQ ID NO: 94) Ube2c GGTATCTGCTGGACAGG (5)
(SEQ ID NO: 95) TRAF4af1 CTGTCCCCTTGTCTCTC (31) (SEQ ID NO: 96)
TRAF4af1 GAGCTGTCTTATGTGTC (2) (SEQ ID NO: 97) TRAF4af1
TTTCCGAGTCTCTAGAG* (1) (SEQ ID NO: 98) TRAF4af1 TTTCCGAGTCTCTAGAG*
(1) (SEQ ID NO: 99) DNA topo II alpha AGAAGTTGCTCGTACCT (60) (SEQ
ID NO: 100) DNA topo II alpha CCCCTGTGGTATCTGAC (7) (SEQ ID NO:
101) DNA topo II alpha GAGTTGTCACCGCTGCA (5) (SEQ ID NO: 102) DNA
topo II alpha TTACAGAGAGCAAAGCT (4) (SEQ ID NO: 103) DNA topo II
alpha TAGGTTGCTTAAAGAAA (3) (SEQ ID NO: 104) DNA topo II alpha
ACCAAAAAGCAAGTTGG (2) (SEQ ID NO: 105) DNA topo II alpha
GGCAATTGTCTTCTCTG (1) (SEQ ID NO: 106) DNA topo II alpha
GCTTAAACAAAATGCAT (1) (SEQ ID NO: 107) Ckap2 CCTAAGTATGGTACAGG (25)
(SEQ ID NO: 108) Inhibin beta-B GTTAGTCAGAAACTGCC (98) (SEQ ID NO:
109) Inhibin beta-B TACAGTATAAGACAATA (22) (SEQ ID NO: 110) Inhibin
beta-B AACGTAAAATACTTAAG (20) (SEQ ID NO: 111) Inhibin beta-B
GGTCTTTGAGGGAGCAG (4) (SEQ ID NO: 112) Inhibin beta-B
TCCCCTGCCCAGTTCAC (4) (SEQ ID NO: 113) Inhibin beta-B
CTTTGAGGCCAGCAGAG (1) (SEQ ID NO: 114) Cks2 CGCTGTATTCTTCACAG (41)
(SEQ ID NO: 115) Thymidine kinase 1 GAGTGCTTCCGAGAAGC (66) (SEQ ID
NO: 116) Tenascin C GTCATTCTCCGAGCCAG (76) (SEQ ID NO: 117)
Tenascin C GTGTTGCTGTCACTAGG* (3) (SEQ ID NO: 118) Tenascin C
AGTACTCAATCCAGTTT (1) (SEQ ID NO: 119) Neurotensin
TAAATTGGATGCAATGT (22) (SEQ ID NO: 120) Neurotensin
GATATTTTGCCTGTCAA (13) (SEQ ID NO: 121) Neurotensin
ATGACGACCTTGTTGGC (2) (SEQ ID NO: 122) Prc1 GAGTCAGCAACTTTGCA (38)
(SEQ ID NO: 123) Prc1 AAGTAATTCTGGTAACA (1) (SEQ ID NO: 124) Prc1
ATGCCGAGATTGTACGG (1) (SEQ ID NO: 125) Ki67 antigen
AGGAAGATCACCAGGGA (48) (SEQ ID NO: 126) Ki67 antigen
CTAATGGCCCATTAGTG (4) (SEQ ID NO: 127) Ki67 antigen
AAGGAAGAAAGCTCTGC (2) (SEQ ID NO: 128) Ki67 antigen
CTTGAGGTCTAGAGGAA (2) (SEQ ID NO: 129) Ki67 antigen
AGAGAATTTTCCATACT (1) (SEQ ID NO: 130) Ki67 antigen
ATTTCCATCTTCATACC* (1) (SEQ ID NO: 131) Integrin beta 3
CTAGGCAAGAACATTAC (45) (SEQ ID NO: 132) Integrin beta 3
ACCGGAAGGAATTTGCT (6) (SEQ ID NO: 133) Integrin beta 3
ATGCCCGGCAGGTGCTC (3) (SEQ ID NO: 134) Integrin beta 3
GACTACCCATCTCTGGG (3) (SEQ ID NO: 135) Integrin beta 3
GTTTGCTCTGCTGGCAT (2) (SEQ ID NO: 136)
TABLE-US-00008 TABLE 5D SAGE tags used to identify Pathological
Angiogenesis Endothelial Markers. Gene (SEQ ID NO.) SAGE tags Vscp
GCTCTGTGTCTATGCAG (22) (SEQ ID NO: 137) Vscp GCTCTCTTGTGTGCACT
(16), (SEQ ID NO: 138) Vscp GCTGGCACTGGTAACCT (8) (SEQ ID NO: 139)
Vscp GGGGAAGGCTGGTGGTC* (2) (SEQ ID NO: 140) Vscp CAGAGGGCTGGGGCCGG
(1) (SEQ ID NO: 141) CD276 AGACTGTAAACTGGGTG (17) (SEQ ID NO: 142)
CD276 GGACTCTGTAAACTGGG (17) (SEQ ID NO: 143) CD276
GGACTCTGGCCAGCACC (1) (SEQ ID NO: 144) CD276 GTGCTATTCTGGAGCTG (1)
(SEQ ID NO: 145) Ets variant gene 4 TGGGCGGCAGCTGGGGG (27) (SEQ ID
NO: 146) Ets variant gene 4 CAATGTGGGAAGTGGAG (4) (SEQ ID NO: 147)
Ets variant gene 4 GGGGGTTGGGAGAGGGG (2) (SEQ ID NO: 148) Ets
variant gene 4 TGGGAGGCAGCTGGGGG (2) (SEQ ID NO: 149) CD137
ACTCCTGGACAGCTCAA (29) (SEQ ID NO: 150) CD137 CATCATATTTGCACACA (4)
(SEQ ID NO: 151) CD137 GGAAACAACTGTTACAA (3) (SEQ ID NO: 152) CD137
GTGGACTGGAAGGCCGC (2) (SEQ ID NO: 153) CD137 GGTCTCCCCCTTCAGAC (1)
(SEQ ID NO: 154) MiRP2 AGAAACCTTGATAAAAC (84) (SEQ ID NO: 155)
Ubiquitin D GCTGACTACAACATCAA (11) (SEQ ID NO: 156) Prion-PLP
AAGTATTCCACAGTACA (16) (SEQ ID NO: 157) Prion-PLP AAGCAGGGCGGAACCTT
(5) (SEQ ID NO: 158) Prion-PLP TGTGTTCTTAGGCATCT (2) (SEQ ID NO:
159) Prion-PLP GTCATCTAAAAGGACTA (2) (SEQ ID NO: 160) Prion-PLP
TGATTTTGACTGCAAAT (1) (SEQ ID NO: 161) Apelin GTTCTATACTCTTCTGG
(11) (SEQ ID NO: 162) Apelin TAAATATGTCTTTATAA (9) (SEQ ID NO: 163)
Apelin TTCTTCTCAGAGGCCTC (1) (SEQ ID NO: 164) Placental growth
factor TAGAGGGGACCCAGTCT (24) (SEQ ID NO: 165) Placental growth
factor CCTTCAATGCAGCCGGG (3) (SEQ ID NO: 166) Placental growth
factor GCCTTTCAAGGGGGCAG (1) (SEQ ID NO: 167) PTPRN
GGAAGCAGACAGCAGGC (19) (SEQ ID NO: 168) PTPRN GGCCCCCTCCGGCCCCA*
(1) (SEQ ID NO: 169) PTPRN TGATCTCCCAGGAGATG (1) (SEQ ID NO: 170)
CD109 GCGACAGTCTCACTCTG (13) (SEQ ID NO: 171) CD109
TCTCTATATCTCCTTCT (2) (SEQ ID NO: 172) CD109 TTACCTCAGTCCAGACA (2)
(SEQ ID NO: 173) Progressive ankylosis ACTAGAAAATTAAACAG (18) (SEQ
ID NO: 174) Collagen VIII, alpha 1 TAAAAAAAAGAGAAAAA (14) (SEQ ID
NO: 175) Collagen VIII, alpha 1 TACAAATAAAAACTAAA (2) (SEQ ID NO:
176) Collagen VIII, alpha 1 ATGTACACATACGACGA (1) (SEQ ID NO: 177)
Collagen VIII, alpha 1 GGATACAATAAATATCC (1) (SEQ ID NO: 178)
[0264] Quantitative PCR.
[0265] mRNA was purified using the Quick Prep Micro mRNA
purification kit (Amersham, Piscataway, N.J.). Single-stranded cDNA
was generated using Superscript III first strand synthesis system
(Invitrogen) following the manufacturer's directions. Quantitative
PCR was performed with an MX4000 using Brilliant SYBR Green QPCR
Master Mix and threshold cycle numbers were obtained using MX4000
software v4.20 (Stratagene, La Jolla, Calif.). Primer sets for each
sequence analyzed are included in Table 5E below. Endothelial cells
used in QPCR are provided in Table 5F. Antibodies against the
endothelial selection markers CD105, VE-cadherin (VE-cad) or both
were used in the positive selection to immunopurify the endothelial
cells. Endothelial cells were derived from the host strain
indicated and then used to generate cDNA for QPCR. Nude: NCr
nu/nu.
TABLE-US-00009 TABLE 5E Primer sets for QPCR. SEQ ID NO (Forward,
Reverse) Gene Forward Primer Reverse Primer Normalizers 179, 180
Snrp70 CTCCTCCTCCAACAAGAGCAG CGATGAAGGCATAACCACG 181, 182
VE-cadherin GCTACCTGCCCACCATCG CATCCACTGCTGTCACACGG Brain
endothelial Marker Primers 183, 184 Glut-1 ATCCCAGCAGCAAGAAGGTG
ATCATCAGCATGGAGTTCCG 185, 186 Oatp2 TGGAACTGGAACCAACATGG
AGGTATGGCTCCCAGCGAG Physiological Angiogenesis Marker Primers 187,
188 Ube2c GTGGGCAAGCGGCTACAG CGATGTTGGGTTCTCCTAGC 189, 190 TRAFaf1
ATCGAGACGAGAGAATGGGC GGAGTCCGTGTGATCTGTGG 191, 192 DNA topo II
ACTGCTCCGCCCAGATACC CCATAGCCATTTCGACCACC alpha 193, 194 Ckap2
CTCAGCCTATTGAAGAGATGCG AGCGTCTCACTGGTGTCAGG 195, 196 Inhibin
GCGTCTCCGAGATCATCAGC TGACCCGTACCTTCCTCCTG beta-B 197, 198 Thymidine
ATCGCCCAGTACAAGTGCC GGAAGGTCCCATCCAGCG kinase 1 199, 200 Tenascin C
TTTGGCTTGGACTGGATAACC TGCCCATCAGGTTGACACG 201, 202 Neurotensin
GAAGATGTGAGAGCCCTGGAG CCTGGATTATCTCCCAGTGTTG 203, 204 Prc1
CTACACCCAACAGTAGCATTCG TCCGTCAGTCCAGTCCAGG 205, 206 Ki67 antigen
CGCACACTTCCCGCTGAG GCTCGCCTTGATGGTTCC 207, 208 Integrin
CGGGATGACATCGAGCAG ACACTCAGGCTCTTCCACCAC beta 3 Pathophysiological
Angiogenesis Marker Primers 209, 210 Vscp CCGTCATATTCGCCTGGG
TGCTGGCAGGTGCTCTAGG 211, 212 CD276 CTTGTTCGATGTTCACAGCG
GCCGTAGAGCTGTCTTGGATC 213, 214 Ets variant AACGAAGTCTCCAAATCTGTCC
AGGTGGAATTAGGCCTGGG gene 4 215, 216 CD137 CAGCATAGGTGGACAGCCG
CACACCACGTCCTTCTCCG 217, 218 MiRP2 GGAGACAGATCGTAGAGGCG
GGAAGCAGCCAGAGTCGTG 219, 220 Ubiqutin D GTCCGCACCTGTGTTGTCC
CATCTTCCAGCTTCTTTCCG 221, 222 Prion-PLP TAGCAGAGAACCGAGATTCACC
GCTTCAGAGCAGCCTTCGTAG 223, 224 Apelin AATCTGAGGCTCTGCGTGC
GCCCTTCAATCCTGCTTTAGA 225, 226 Placental GTGCCTTGAAGGACCTTGG
AGCAGCCACTACAGCGACTC growth factor 227, 228 PTPRN
GGTGTCGGAGCACATCTGG TCAAACTGGTCCTTAGAACGG 229, 230 CD109
CGGCACTACCTCTGAGCAGT AACCTGAATGGACCAGTCACC 231, 232 Progressive
TCACTGGATGGCTGATGACAC TGTTGGAGGCATGTCGGTC ankylosis 233, 234
Collagen TTCCACAGTACCAGCCCTTG CTCCACGGGGACCTTGTTC VIII, alpha 1
TABLE-US-00010 TABLE 5F Endothelial cells for QPCR. Strain
Selection Marker Normal ECs Brain Nude CD105 & VE-cad Heart
Nude CD105 & VE-cad Kidney Nude CD105 Spleen Nude VE-cad
Intestine C57BL/6 CD105 Lung Nude CD105 liver Nude CD105 Reg. Liv.
Ecs 6 h Nude CD105 18 h Nude CD105 40 h Nude CD105 72 h Nude CD105
96 h Nude CD105 Tumor ECs CT26 Balb/c CD105 & VE-cad EMT6
Balb/c CD105 & VE-cad KM12SM Nude CD105 & VE-cad LLC
C57BL/6 CD105 & VE-cad LS174T Nude CD105 SW620 Nude CD105 &
VE-cad
[0266] All primers were designed to span large introns thereby
preventing potential amplification of contaminating genomic DNA.
Primers were only used if they produced a single band of the
expected size upon gel electrophoresis and failed to produce primer
dimer products as assessed by gel electrophoresis and melting point
analysis on the MX4000. Conditions for amplification were: one
cycle of 95.degree. C., 10 min followed by 40 cycles of 95.degree.
C., 20 sec, 56.degree. C., 30 sec, and 72.degree. C., 30 sec.
Quantitative PCR reactions were performed in duplicate and
threshold cycle numbers were averaged. Gene expression was
normalized to that of the 70Kd U1 small nuclear ribonucleoprotein
polypeptide A (Srnp70), a gene that is uniformly expressed in all
ECs as assessed by SAGE. Relative expression was calculated using
the formula 2.sup.(Rt-Et)/2.sup.(Rn-En) where Rt is the threshold
cycle number observed in the experimental sample for Srnp70, Et is
the threshold cycle number observed in the experimental sample for
the gene of interest (GOI), R.sub.n is the average threshold cycle
number observed for Srnp70 in all the N-EC samples and E.sub.n is
the average threshold cycle number observed for the GOI in all the
N-EC samples.
[0267] In Situ Hybridization.
[0268] Digoxigenin (DIG)-labeled antisense RNA probes were
generated by PCR amplification of 500-600 basepair products
incorporating T7 promoters into the antisense primers. In vitro
transcription was performed with DIG RNA labeling reagents and T7
RNA polymerase according to the manufacturer's instructions (Roche,
Indianapolis, Ind.). Tumors and normal tissues were dissected,
embedded in OCT, frozen in a dry ice-methanol bath, and
cryosectioned at 10 .mu.m. All sections were immediately fixed with
4% paraformaldehyde, permeabilized with proteinase K, rinsed with
5.times.SSC and incubated with RNA probes (100 ng/ml) diluted in
ISH solution (Dako, Carpinteria, Calif.) overnight at 55.degree. C.
After washing three times with 2.times.SSC, sections were incubated
at 37.degree. C. with RNase Cocktail (Ambion, Austin, Tex.) diluted
1:200 in 2.times.SSC. Slides were stringently washed twice in
2.times.SSC/50% deionized formamide (American Bioanalytical,
Natick, Mass.) and then once with 0.1.times.SSC at 55.degree. C.
Before immunodetection, tissues were treated with peroxidase
blocking reagent (DAKO) and blocked with 1% blocking reagent
(Roche) containing purified, nonspecific rabbit immunoglobulins
(DAKO). For signal amplification, a horseradish peroxidase-rabbit
anti-DIG antibody (DAKO) was used to catalyze the deposition of
FITC-tyramide (GenPoint Fluorescein kit, DAKO). Further
amplification was achieved by adding horseradish peroxidase-rabbit
anti-FITC (DAKO), biotin-tyramide (GenPoint Kit, DAKO), and then
alkaline phosphatase rabbit anti-biotin (DAKO). Signal was detected
with the alkaline phosphatase substrate Fast Red TR/Napthol AS-MX
(Sigma Chemical Co., St. Louis, Mo.). Cells were counterstained
with a 1/40 diluted stock of hematoxylin and mounted with Aqueous
Mounting Medium (BioGenex, San Ramon, Calif.).
[0269] Immunofluorescent Studies.
[0270] Dual-color immunofluorescence was performed on fresh-frozen
sections fixed in Leukoperm (Serotec, Raleigh, N.C.). For CD105
detection, sections were stained with rat anti-mouse CD105 followed
by FITC-linked goat-anti-rat (Jackson Immunoresearch Laboratories,
West Grove, Pa.) and 488 goat anti-FITC (Invitrogen). VE-cadherin
was detected using goat anti-mouse VE-cadherin followed by
rhodamine-streptavidin (Vector Laboratories, Burlingame, Calif.).
For dual CD276 and vWF immunofluorescence staining, tissues were
simultaneously stained using a mouse anti-CD276 (R&D)
monoclonal antibody and a rabbit anti-vWF polyclonal antibody
(Dako). CD276 was detected with a FITC-conjugated goat anti-mouse
antibody (Jackson Immunoresearch Laboratories) followed by a 488
goat-anti-FITC antibody (Invitrogen) and a 488 donkey anti-goat
antibody (Invitrogen). vWF was detected using a biotin-linked
donkey anti-rabbit antibody (Jackson Immunoresearch Laboratories)
followed by rhodamine-streptavidin (Vector Laboratories,
Burlingame, Calif.). Images were captured using a Nikon Eclipse
E600 microscope.
[0271] Immunohistochemical Studies.
[0272] Paraffin sections were deparaffinized, incubated with
proteinase K, heated at 95.degree. C. for 20 min in citrate buffer
(pH 6) (Invitrogen), and treated with peroxidase blocking reagent
(Dako). Sections were incubated with a biotin-labelled polyclonal
antibody against CD276 (R&D) followed by an HRP-conjugated
anti-biotin antibody (Dako) and visualized by DAB
(diaminobenzidine) staining. Sections were lightly counterstained
with hematoxylin.
[0273] Immunoblot Studies.
[0274] A CD276 expression vector was made by excising a human CD276
cDNA from an EST (accession number BC7472032) using the restriction
enzymes EcoR1 and Not1 and cloning the fragment into the same sites
of the expression vector pcDNA3.1(+) (Invitrogen). Sequencing of
the CD276/pcDNA3 vector revealed that it contained a full length
CD276 cDNA corresponding to transcript variant 1 (accession number
NM_001024736). CD276/pcDNA3 was transfected into 293 cells using
lipofectamine, and stable transfectants selected with Geneticin. To
generate extracts for immunoblotting, colorectal tissues stored at
-80.degree. C. were thawed, diced with a razor, immediately
homogenized in cold TNT buffer [50 mM Tris (pH 7.5), 75 mM NaCl, 1%
triton X-100 containing a cocktail of protease inhibitors (Roche)]
and clarified by centrifugation. Protein extracts from tissues or
lysed 293 cells were separated by SDS-PAGE and transferred to a
PDVF membrane (Millipore). Immunoblots were probed with a
monoclonal anti-CD276 antibody (eBioscience) or an anti-actin
antibody (Chemicon) followed by an HRP-conjugated anti-mouse
secondary antibody (Jackson), and visualized using the ECL plus
system (Amersham) according to the supplier's instructions.
Example 2
Purification of Endothelial Cells from Normal and Malignant
Tissues
[0275] This example describes methods used to immunopurify
endothelial cells (ECs) from various tissue types.
[0276] Initial attempts to purify ECs involved antibody recognition
of CD31, the conventional cell surface marker used for affinity
purification of mouse ECs, were difficult because of its cross
reactivity with hematopoietic cells. CD105 (endoglin) and/or
VE-cadherin were found to be specifically localized to the ECs of
normal and tumor tissues. For example, as illustrated in FIG. 1A,
immunofluorescence staining of heart tissue demonstrated
co-localization of CD105 (green) with VE-cadherin (red) in the
heart vessels. Further, FIG. 1B demonstrates immunofluorscence
staining of liver tissue with CD105 (green). CD105 was determined
to be a preferred marker in liver because CD105 stained all the
endothelium including sinusoidal ECs whereas VE-cadherin did
not.
[0277] The cell isolation involved tissue dissociation, the removal
of non-ECs, and the positive selection of ECs using magnetic beads
coupled to either anti-VE-cadherin or anti-CD105 antibodies, the
choice depending on the tissue being dissociated (see Example 1,
Material and Methods). To assess the purity of the isolated cells,
QPCR analysis was performed on cDNA generated directly from
unfractionated normal whole tissues (WT), purified ECs isolated
from normal tissues (N-ECs) or ECs isolated from tumors. As
illustrated in FIG. 1C, a marked enrichment of endothelial-specific
genes such as VE-cadherin was found in each of the purified
fractions compared to unfractionated whole tissues, but little
contamination by hematopoietic cells, as judged by CD45 expression.
For example, VE-cadherin was enriched 110 to 530-fold in the
endothelial fractions. The modest level of VE-cadherin found in the
unfractionated heart and lung sample is presumably due to a higher
proportion of ECs in these tissues. Gene expression was normalized
to that of the Eif4h, a gene found to be uniformly expressed in all
cells as assessed by SAGE (Velculescu et al. Nat. Genet. 23: 387-8,
1999). Unfractionated brain was used to calibrate relative
expression because this tissue had the lowest VE-cadherin
expression levels.
[0278] FIG. 1D provides a model used to identify genes expressed
during pathological but not physiological angiogenesis. ECs were
isolated from normal resting livers, regenerating livers, or tumor
bearing livers.
Example 3
Identification of Organ-Specific Endothelial Cell Markers
[0279] This example illustrates methods used to identify 27 brain
and 15 liver specific endothelial cell markers.
[0280] Antibodies against the endothelial selection markers CD105,
VE-cadherin (VE-cad) or both were used in the positive selection to
immunopurify the endothelial cells. Endothelial cells were derived
from the host strain indicated, and the number of SAGE tags
obtained for each library is indicated. These SAGE libraries
utilized a 21 nucleotide "long tag" which facilitates the mapping
of genes directly to genomic DNA even when EST or cDNA sequence was
unavailable (Saha et al., Nat. Biotechnol. 20: 508-12, 2002). For
SAGE comparisons, all endothelial cell libraries were normalized to
100,000 tags except for kidney which was normalized to 30,000 tags
due to the lower number of tags obtained for the kidney endothelial
cell library. As illustrated in Table 6, 700,189 tags were obtained
from these 7 normal EC libraries.
TABLE-US-00011 TABLE 6 Identification of 7 normal EC libraries.
Strain Selection Marker No. Tags Normal ECs Brain C57BL/6 CD105
& VE-cad 168,029 Heart Balb/c CD105 86966 Kidney Nude CD105
29884 Spleen C57BL/6 VE-cad 93150 Lung Nude CD105 104998 Muscle
C57BL/6 CD105 & VE-cad 107,726 Liver Nude CD105 109436 Reg.
Liv. Ecs 24 h Nude CD105 105,145 48 h Nude CD105 174880 72 h Nude
CD105 115,209 Tumor Ecs CT26 Balb/c VE-cad 93,981 EMT6 Balb/c CD105
& VE-cad 114,910 KM12 Nude CD105 167124 LLC C57BL/6 VE-cad
104,283 SW620 Nude CD105 & VE-cad 112312
[0281] Analysis of the transcripts revealed the presence of
multiple endothelial-specific transcripts, while epithelial,
hematopoietic and hepatocyte markers were absent or rare (See
Tables 7A and 7B). Tag counts for endothelial, hematopoietic,
epithelial, hepatocyte, pericyte/smooth muscle cell, lymphatic
endothelial, and fibroblasts markers were obtained by normalizing
to 100,000 tags for each of the SAGE libraries shown. The
hematopoietic cell fraction (HCF) control was derived from 53,271
SAGE tags. This SAGE library was constructed from hematopoietic
cells that had been purified from collagenase dispersed KM12SM
tumors using a mixture of magnetic beads coupled to anti-F480,
anti-CD45, anti-CD68 and anti-CD19 antibodies. The unfractionated
(Unfrac.) liver control was derived from 37,162 SAGE tags
originating from C57BL/6 whole liver and is publicly available at
SAGEmap (World Wide Web address of
ncbi.nlm.nih.gov/projects/SAGE/). The unfractionated intestine
control was derived from 115,942 SAGE tags originating from
microscope-dissected small intestine of a late gestation embryo
also available at SAGEmap. The endothelial libraries are the same
as those found in Table 6.
[0282] Tables 7A and 7B. Multiple endothelial-specific transcripts
in the 7 normal EC libraries.
TABLE-US-00012 TABLE 7A Endothelial purity in normal endothelial
cells and controls. Controls Unfra. Unfra. Normal ECs Liver
Intestine HCF Brain Heart Kidney Liver Lung Muscle Spleen
Endothelial 5 3 0 77 117 80 74 104 106 9 CD31 markers (PECAM) 0 2 0
24 46 30 60 25 24 15 CD105 (Endoglin) 3 1 0 213 32 60 33 210 30 37
Claudin 5 8 12 0 46 53 50 55 94 104 14 VE-cadherin 0 2 0 13 13 50
82 18 21 3 VEGFR2 0 0 0 224 137 10 58 48 72 0 vonWillebrand Factor
Hematopoietic 0 0 15 0 0 0 0 0 0 0 CD18 markers 0 0 15 0 0 0 0 0 0
0 CD45(Ly-5) 0 0 43 0 0 0 0 0 0 0 Interleukin 10 0 0 30 0 0 0 0 0 0
0 Macrophage scavenger Rec. 2 Endothelial 5 19 0 0 0 0 0 1 0 0
Cytokeratin 8 markers 0 17 0 0 0 0 0 4 0 0 E-cadherin Hepatocyte
501 0 0 0 0 0 3 0 0 0 Albumin markers 414 0 0 0 0 0 0 0 0 0
Fibrinogen, B beta Pericyte/SMC 0 2 2 2 1 3 0 0 0 0 NG2 (Cspg4)
markers 0 24 0 1 1 0 0 0 0 0 Calponin-1 Lymphatic 0 1 0 1 0 0 0 6 0
0 Podoplanin endothelial 0 1 0 0 2 0 0 0 2 4 Prox-1 markers
Fibroblast 0 3 0 0 0 0 0 0 1 0 Fibroblast markers Activation
Protein
TABLE-US-00013 TABLE 7B Endothelial purity in regenerativing liver
endothelial cells and tumor endothelial cells Reg. Liver ECs Tumor
ECs 24 hr 48 hr 72 hr CT26 EMT6 KM12SM LLC SW620 Endothelial 95 90
69 85 77 34 151 82 CD31 (PECAM) markers 40 50 37 10 22 20 15 22
CD105 (Endoglin) 16 13 20 35 37 13 62 22 Claudin 5 46 51 52 63 50
28 116 58 VE-cadherin 12 45 38 21 14 17 9 29 VEGFR2 133 58 45 56 23
25 52 36 vonWillebrand Factor Hematopoietic 1 0 2 1 1 0 0 0 CD18
Markers 0 0 2 0 0 0 1 0 CD45(Ly-5) 0 0 2 0 0 0 0 0 Interleukin 10 0
0 0 0 0 0 0 0 Macrophage scavenger Rec. 2 Epithelial 0 0 0 0 3 0 0
0 Cytokeratin 8 Markers 0 0 0 0 0 0 0 0 E-cadherin Hepatocyte 0 3 2
0 0 1 0 0 Albumin markers 0 0 0 0 0 0 0 0 Fibrinogen, B beta
Pericyte/SMC 0 1 1 0 1 1 0 0 NG2 (Cspg4) markers 0 0 0 0 0 2 0 2
Calponin-1 Lymphatic 1 0 0 2 4 2 0 0 Podoplanin endothelial 0 0 1 0
0 0 0 0 Prox-1 markers Fibroblast 0 0 0 0 1 1 0 1 Fibroblast
Activation Protein markers
[0283] Brain Endothelial Markers (BEMs) were defined as genes that
were expressed 20-fold or higher in brain compared to all other
normal endothelium (see Table 8, below). The most abundant and
differentially expressed gene identified was the brain glucose
transporter Glut-1, a blood-brain barrier (BBB) marker previously
found to be expressed on the luminal surface of brain endothelium
(Farrell & Pardridge, Proc. Natl. Acad. Sci. U.S.A. 88:5779-83,
1991; Pardridge et al. J. Biol. Chem. 265:18035-40, 1990). Thirteen
of the 27 BEMs (.about.50%) appear to reside at the cell surface
and at least 9 of these are transporters potentially involved in
BBB function. Seven of the BEMs, including five cell surface
transporters, were previously localized to brain endothelium by in
situ staining. Some of the cell surface transporters have also been
identified in liver tissues where they appear to be expressed
predominantly by hepatocytes or other non-ECs (Gu et al. Proc.
Natl. Acad. Sci. U.S.A. 97:3230-5, 2000; Konig et al. Am. J.
Physiol. Gastrointest. Liver Physiol. 278:G156-64, 2000; and Mesh
et al. Eur. J. Biochem. 271:3103-14, 2004). Intracellular enzymes,
such as glutathione-S-transferase alpha 4 (Gsta4), were also
identified which may be involved in protecting the brain from toxic
chemicals that enter the blood.
[0284] Liver Endothelial Markers (LEMs) were defined as genes that
were expressed 20-fold or higher in liver compared to all other
normal endothelium (Table 8). The most highly expressed gene was
deoxyribonuclease 1-like 3, a recently identified nuclease that may
be involved with chromatin clearance from the circulation (Napirei
et al. Biochem. J. 389:355-64, 2005). CD32 is a low affinity Fc
.gamma.-receptor that is a known marker of liver sinusoidal ECs
(Muro et al. Am. J. Pathol. 143:105-20, 1993). Two lectin-like
receptors, one of which was shown recently to be expressed
predominantly by sinusoidal ECs of human liver and lymph node (Liu
et al. J. Biol. Chem. 279:18748-58, 2004) were also identified.
Seven of the LEMs identified appear to reside at the cell surface,
including three that have not yet been characterized. These results
highlight the complexity of blood vessels and demonstrate the
existence of multiple organ-specific endothelial markers in
different tissues.
TABLE-US-00014 TABLE 8 Organ-specific endothelial cell markers.
GenBank Brain Heart Kidney Liver Lung Muscle Spleen Acc. #
Description* Brain endothelial markers 1 754 8 1 2 1 12 4 NM_011400
GLUT-1 2 157 0 0 0 0 1 0 NM_030687 Organic anion transporter 2 3 93
0 1 0 0 1 1 NM_008973 Pleiotrophin 4 32 0 0 0 0 0 0 NM_009728
ATPase, class V, type 10A 5 40 0 0 0 1 0 0 NM_009402 Peptidoglycan
recognition protein 1 6 26 0 0 0 0 0 0 NM_021471 Organic anion
transp. 14 7 29 0 0 0 0 0 0 NM_008239 Forkhead box Q1 8 19 0 0 0 0
0 0 NM_031194 Organic anion transporter 3 9 73 0 0 0 3 0 0
NM_172479 SN2, Solute carrier family 38, member 5 10 40 0 0 0 1 2 0
NM_172471 Inter-alpha (globulin) inhibitor H5 11 12 0 0 0 0 0 0
NM_010703 Lymphoid enhancer binding factor 1 12 23 0 0 0 0 0 1
NM_011404 Slc7a5 aa transporter 13 20 1 0 0 0 0 0 NM_023805 Solute
carrier family 38, member 3 14 17 0 0 0 0 0 0 NM_009574 Zinc finger
protein of the cerebellum 2 15 81 6 0 0 1 3 0 NM_052994 Testican-2
16 26 0 1 0 1 1 0 NM_008256 3-HMG-CoA synthase 2 17 15 0 0 0 0 0 0
NM_028748 Progestin and adipoQ receptor family member V 18 68 0 1 2
1 0 1 AK172004 APC down-regulated 1, Drapc1 19 13 0 0 1 0 0 0
NM_027096 Unknown, GDPD phosphodiesterase family 20 26 0 0 3 1 0 0
NM_029001 Unknown, putative transmembrane protein 21 19 1 0 0 0 1 0
NM_027299 DES2, lipid desaturase/ C4- hydroxylase 22 39 0 1 0 2 0 1
XM_486083 Unknown, kelch repeat and BTB (POZ) domain 23 46 2 1 0 1
1 0 NM_017405 Lipolysis stimulated receptor 24 36 2 0 0 1 1 0
NM_010357 Glutathione S-transferase, alpha 4 25 9 0 0 0 1 0 0
NM_013869 TNF receptor superfamily, member 19 26 17 1 0 0 0 1 0
NM_011532 T-box 1 27 6 0 0 0 1 0 0 XM_620023 Unknown, putative
transmembrane protein Liver endothelial markers 1 0 0 0 196 0 0 0
NM_007870 Deoxyribonuclease 1-like 3 2 0 0 0 58 0 0 3 NM_010959
LZP, oncoprotein induced transcript 3 3 0 0 0 16 0 0 0 NM_023438
Unknown.sup..dagger-dbl., putative transmembrane protein 4 1 0 0
123 0 0 6 AK150613 CD32 5 0 1 0 33 0 1 1 NM_033616 Unknown,
putative G-protein coupled receptor 6 0 1 0 14 0 0 0 NM_019985
C-type lectin-like receptor 2 7 0 0 0 216 0 0 24 NM_029465 Clec4g
(LSECtin) 8 0 1 0 42 2 1 0 NM_018797 Plexin C1 9 0 1 0 9 0 0 0
NM_011719 Wnt9B 10 1 0 0 16 1 0 0 AK144596 Unknown 11 0 1 0 9 0 0 0
NM_008092 GATA-binding protein 4 12 0 0 0 10 1 2 0 AB049755
MBL-associated serine protease-3 13 0 0 0 5 0 0 1 NM_023132 Renin
binding protein 14 0 0 0 16 1 2 1 NM_144830 Unknown, putative
transmembrane protein 15 1 0 1 11 0 0 0 NM_011243 Retinoic acid
receptor, beta
Example 3
Gene Expression in Resting Normal ECs, Regenerating Liver ECs and
Tumor ECs
[0285] This example illustrates the expression of various markers
in resting normal ECs, regenerating liver ECs and tumor ECs.
[0286] In order to identify genes that were elevated during
physiological angiogenesis, ECs were isolated from liver at 24-,
48- or 72-hours following partial hepatectomy, the period during
which endothelial growth is thought to occur (Michalopoulos &
DeFrances. Science 276:60-66, 1997). In total, 395,234 SAGE tags
were isolated from regenerating liver (See Table 6). Gene
expression patterns of regenerating liver ECs were compared with a
combined set of EC libraries derived from all non-proliferating
normal organs including resting liver (see FIG. 1D). This
comparison revealed 12 genes that were overexpressed in
regenerating liver ECs compared to non-angiogenic ECs (Table 9),
which were referred to as physiological angiogenesis endothelial
markers.
[0287] At least seven of these genes may be involved in regulating
progression through the cell cycle, consistent with the fact that
these ECs are dividing. For example, the most abundant
physiological angiogenesis marker is an ubiquitin-conjugating
enzyme, Ube2c. Its human counterpart, UbcH10, is involved in
progression through the G1 phase of the cell cycle (Townsley et al.
Proc. Natl. Acad. Sci. U.S.A. 94:2362-7, 1997; and Rape &
Kirschner. Nature 432:588-95, 2004). Protein regulator of
cytokinesis 1 (PRC1) is a mitotic spindle-associated CDK substrate
that is involved in cytokinesis (Jiang et al. Mol. Cell 2:877-85,
1998). DNA topoisomerase II-alpha (Top2a), Thymidine Kinase 1 (TK1)
and the Ki67 antigen are markers of proliferating cells (Gerdes et
al. J. Immunol. 133: 1710-1715, 1984; Sampson et al. J. Pathol.
168: 179-185, 1992; and Bradshaw Proc. Natl. Acad. Sci. U.S.A.
80:5588-91, 1983). One extracellular matrix glycoprotein, Tenascin
C, is frequently associated with angiogenesis of malignant tumors,
inflamed tissues and healing wounds (Tanaka et al. Int. J. Cancer
108: 31-40, 2004; and Zagzag et al. Cancer Res. 56: 182-9, 1996).
The only physiological angiogenesis endothelial marker identified
encoding a predicted cell surface product was integrin .beta., a
receptor that partners with integrin av and is thought to regulate
angiogenesis (Brooks et al. Science 264:569-71, 1994).
TABLE-US-00015 TABLE 9 Physiological and Pathological Angiogenesis
Endothelial Cell Markers. Normal resting ECs Reg. Liver ECs Tumor
ECs GenBank Brain Heart Kidney Liver Lung Muscle Spleen 24 h 48 h
72 h CT26 EMT KM LLC SW Acc. # Description Physiological
Angiogenesis Markers 0 0 0 0 0 0 0 0 10 14 5 3 4 9 0 NM_026785
Ube2c* 0 0 0 0 0 0 0 1 5 11 0 5 2 3 2 NM_026412 TRAF4af1 0 0 0 1 1
0 0 0 17 16 5 8 3 11 10 NM_011623 DNA topo II.alpha.* 0 0 0 0 0 0 0
0 4 3 3 2 2 8 0 NM_001004140 Ckap2* 1 1 0 1 0 2 0 19 11 3 31 28 14
20 11 NM_008381 Inhibin beta-B 0 0 0 1 0 0 0 0 4 6 5 6 5 5 7
NM_025415 Cks2* 1 0 0 1 0 0 0 4 13 12 7 6 1 8 5 NM_009387 TK1* 0 0
0 0 1 2 0 0 2 6 5 14 16 24 12 NM_011607 Tenascin C 0 3 0 0 0 0 0 5
3 3 5 5 3 9 1 NM_024435 Neurotensin 0 0 0 1 1 0 0 0 5 10 5 3 4 10 0
NM_145150 Prc1* 0 0 0 0 1 1 2 0 11 12 7 7 2 5 4 XM_133912 Ki67
antigen* 0 1 0 1 0 1 1 3 5 3 17 10 6 4 9 NM_016780
Integrin-.beta.3.sup..dagger. Pathological Angiogenesis Markers 0 0
0 0 1 0 0 1 1 1 7 11 0 26 4 DQ832275 Vscp 0 1 0 0 0 0 0 0 1 0 1 6 3
10 16 DQ832276 CD276.sup..dagger. (B7-H3) 0 0 0 0 1 0 0 0 0 1 6 4 5
9 12 DQ832277 ETSvg4 (Pea3) 0 1 0 0 0 0 0 0 0 0 8 2 1 26 3
DQ832278.sup..parallel. CD137.sup..dagger. (4-1BB) 0 2 1 0 0 0 1 0
0 0 15 5 19 8 37 DQ832280 MiRP2.sup..dagger. 0 0 0 0 0 0 0 0 0 0 3
5 0 2 1 NM_023137 Ubiquitin D (FAT10) 0 0 0 0 0 1 1 0 0 0 1 3 0 17
5 DQ832281 Doppel.sup..dagger. (Prion-PLP) 0 0 1 0 1 0 0 0 0 0 0 6
2 7 7 DQ832282 Apelin 1 1 1 0 0 0 0 0 0 0 2 10 4 5 7 NM_008827 Plgf
0 1 0 0 1 0 0 0 0 0 14 1 1 5 0 DQ832283 Ptprn.sup..dagger. (IA-2) 0
0 1 0 0 0 0 1 0 1 0 6 3 7 1 DQ832284 CD109.sup..dagger. 1 0 0 0 0 0
0 2 1 0 10 1 1 5 1 DQ832285 Ankylosis.sup..dagger. 0 0 1 0 1 0 0 1
0 0 3 2 8 1 5 NM_007739 Coll. VIII, .alpha.1 *Genes encoding
products thought to be important in cell cycle control
.sup..dagger.Encodes known or predicted cell surface protein
.sup..dagger-dbl.Gene name is given followed by alternative names
in parenthesis .sup..parallel.The Genbank accession number for the
secreted variant sCD137 is DQ832279
[0288] Gene expression was evaluated by real-time QPCR and compared
with that of Srnp70, a gene expressed at nearly identical levels in
all ECs, by SAGE. Organic-anion-transporter 2 (Oatp2) is a BEM,
Ube2c, TRAFaf1, and DNA topoisomerase II.alpha. (Top2a) are
physiological angiogenesis markers, and Vscp, CD276, Ptprn and
CD137 are pathological angiogenesis markers. For physiological and
pathological angiogenesis markers, the results are expressed as the
ratio between the gene of interest and Srnp70 expression and are
normalize to the average expression in all non-angiogenic normal
ECs. For Oatp2, samples were normalized to the average expression
in intestinal, heart and kidney ECs. For comparison, normal ECs
from resting liver (time=zero hours) were grouped with the
regenerating liver ECs.
[0289] QPCR analysis confirmed that each of the physiological
angiogenesis markers (Table 9) were induced in the regenerating
liver ECs, with peak levels ranging from 15- to 100-fold over
non-proliferating ECs (FIGS. 2A and 2B). All of the physiological
angiogenesis markers genes identified were also found to be
overexpressed in tumor endothelial cells (see Table 9), providing
further evidence that expression of these genes is upregulated
during angiogenesis. Although most of the genes displayed maximum
mRNA expression at 72 hours, the genes encoding inhibin-beta B and
.alpha.3-integrin reached their peak expression levels by 6 hours.
Such early endothelial response genes may be important upstream
regulators of the angiogenic cascade.
[0290] Each of the disclosed pathological angiogenesis genes
detected by QPCR had a similar pattern of expression to that
predicted by the SAGE analysis, with levels of expression barely
detectable in regenerating liver endothelium (FIG. 2A and FIG. 2C).
Most of the genes were overexpressed in the ECs of all of the
tumors examined, although 6 of the genes (Ankylosis, Apelin, MiRP2,
CD109, Doppel and Ubiquitin D) were overexpressed in the vessels of
only a subset of the tumor types. Ubiquitin D was only expressed in
the vessels of mouse tumors (CT26, EMT6 and LLC), but was
essentially undetectable by QPCR in tissue culture-derived tumor
cells.
[0291] RT-PCR was used to verify that Ubiquitin D is expressed by
the tumor endothelial cells (TECs) and not the tumor cells
themselves. To generate cDNA for RT-PCR, mRNA was extracted from
CT26, EMT6 and LLC tumor cell lines grown in tissue culture, the
corresponding tumor cells isolated from tumors grown in vivo, or
the corresponding TECs isolated from the same tumors. To isolate
tumor cell-enriched fractions in vivo, tumors were dispersed with
collagenase and endothelial cells and hematopoietic cells were
removed using magnetic dynabeads coupled to CD105 and CD45. Tumor
endothelial cells were isolated as described in the Examples (such
as Example 1). PCR amplification of VE-cadherin was used as a
control to verify the endothelial origin of the purified tumor
endothelial cells, and .beta.-actin was used as housekeeping
control to ensure the presence of similar amounts of template in
each of the samples. As illustrated in FIG. 7, Ubiquitin D mRNA was
essentially undetectable when RT-PCR was performed on in vivo tumor
cell-enriched fractions or the tumor cell lines grown in tissue
culture indicating that such expression is not due to the presence
of contaminating tumor cells.
Example 4
Pathological Angiogenesis Endothelial Marker Genes Identified by
SAGE are Expressed by ECs in Tumor Vessels In Vivo
[0292] This example demonstrates that the tumor endothelial marker
genes identified by SAGE (Example 1) are expressed by ECs in tumor
vessels in vivo. To exclude the possibility that the differentially
expressed transcripts were derived from other contaminating
non-ECs, mRNA in situ hybridization studies using a highly
sensitive non-radioactive technique were performed (FIG. 3, FIG.
9A, FIG. 9B and Table 10).
[0293] Table 10 illustrates in situ hybridization results of BEMs
and LEMs in normal adult brain and liver tissues. Expression of BEM
or LEM mRNA was analyzed in resting adult brain and liver tissues
and scored as negative (-), moderately positive (+), moderate to
strongly positive (++) or strongly positive (+++) based on the
staining intensity of endothelial cells. In these experiments,
brain and liver tissues were placed next to each other in frozen
tissue blocks so that the two tissues could be sectioned together
and processed simultaneously. Four brain endothelial markers were
localized to ECs throughout the brain whereas expression in liver
was undetectable (Table 10). Similarly, an analysis of five liver
endothelial markers revealed that each was readily detectable in
liver endothelium but not brain endothelium. Liver endothelial
markers were expressed predominantly in the sinusoidal ECs with a
pattern of staining similar to that of the endothelial control
VEGFR2 (Table 10). However, LEMS, a previously uncharacterized
putative G-protein coupled receptor, was also found in the larger
vessels of central veins, portal veins and hepatic arteries
TABLE-US-00016 TABLE 10 In situ hybrization of brain endothelial
markers and liver endothelial markers in normal adult brain and
liver tissues. Liver Liver capillaries large vessel (Sinusoidal
ECs.sup..dagger. Brain ECs) (CV, PV & HA) ECs Controls CD31 +
+++ + VEGFR2 +++ - ++ Brain BEM1 (GLUT-1) - - +++ Endothelial BEM2
(Oat2) - - ++ Markers BEM3 (Ptn) - - .sup. ++.sup..sctn. BEM4
(Atp10a) - - + Liver LEM1 +++ - - Endothelial (Dnase1l3) Markers
LEM2 (Oit3) +++ - - LEM5 (Csprs) ++ ++ - LEM6 (Clec1b) + - - LEM8
(Plxnc1) +++ - -* .sup..dagger.CV: central vein; PV: portal vein;
HA: hepatic artery .sup..sctn.Pericytes appear to be responsible
for predominant staining of blood vessels and neuronal cells are
also positive. *Negative for blood vessel staining but some
neuronal cells are positive.
[0294] Localization of mRNA in ECs (red stain) was demonstrated by
examining Oatp2, a representative brain endothelial marker in brain
tissue (FIG. 3, panel a), and various tumor endothelial markers in
tumor tissues including CD276, ETSvg4, Apelin, CD109, MiRP2, CD137,
Doppel and Vscp, as illustrated in FIG. 3 panel b through i,
respectively. Panels (b) and (c) depict HCT116 tumors grown
subcutaneously, FIGS. 3D-3F depict SW620 tumors grown
subcutaneously, and FIGS. 3G and 3F depict KM12 tumors grown in the
liver. A dilute counterstain was applied to the sections to
highlight the lack of detectable expression in the non-ECs of the
tumors. These signals were specific because their patterns matched
those observed with endothelial control probes such as VE-cadherin
and von Willebrand factor (vWF), and omission of the antisense
riboprobes or substitution with a sense control resulted in a loss
of signal in each case. The data demonstrate that the disclosed
tumor endothelial markers are expressed predominantly by the
vessels within each of the tumors.
Example 5
Co-Localization of CD276 with vWF in Human Colon Cancer
[0295] This example illustrates that the differential expression of
CD276 (a tumor endothelial marker) is maintained at the protein
level in human colorectal cancer and demonstrates that CD276 can be
used for tumor-specific vascular targeting.
[0296] To demonstrate that protein expression patterns of the
disclosed tumor endothelial markers followed mRNA expression
patterns, co-immunofluorescence studies with antibodies against
CD276, the most differentially expressed cell surface receptor
identified, and the endothelial marker vWF were performed using 6
normal and 6 malignant colorectal tissues. As illustrated in FIG.
4A, CD276 was expressed predominantly by the tumor vessels of the
colorectal cancer, but was also expressed at a lower level by the
tumor cells themselves. Expression of CD276 in normal colonic
mucosa was undetectable (top middle panel). As a control, vessels
were stained for vWF, which co-localized with CD276 only in the
tumor sample.
[0297] The human corpus luteum was stained to determine if the
normal angiogenic vessels of this tissue express CD276. Unlike the
vWF control, CD276 expression was undetectable in the angiogenic
vessels of the developing corpus luteum (see FIG. 4B). Sections
were counterstained with DAPI (left panels of FIG. 4B) to highlight
the epithelial cells.
[0298] These results demonstrate that the differential expression
of CD276 is maintained at the protein level in human colorectal
cancer and indicate that CD276 is a useful target for
tumor-specific vascular targeting.
Example 6
mRNA is Expressed in Human Colorectal Cancer Vessels
[0299] This example illustrates that CD276 mRNA is expressed in
human colorectal cancer and indicates that CD276 can be used for
tumor-specific vascular targeting.
[0300] Riboprobes against human CD276 were generated and mRNA in
situ hybridization on normal and malignant colorectal tissues was
performed.
[0301] As shown in FIG. 5, CD276 mRNA was most prominent in the
tumor vessels, with a pattern of expression similar to that of the
endothelial control VEGFR2 (left panel). CD276 expression was also
detected in the tumor cells themselves, albeit at a lower level. In
contrast, CD276 expression was undetectable in normal colonic
mucosa, and an analysis of the tumor margin showed a striking
on/off pattern of staining at the tumor/normal border (FIG. 5,
right panel). For instance, the margin between tumor (T) tissue and
normal (N) colonic mucosa CD276 staining abruptly ends (right
panel). Further, extracellular staining around the normal crypts
was observed and represents non-specific binding of the in situ
hybridization reagents to the mucous (right panel); similar
staining was also detected in control sections.
[0302] These results demonstrate that CD276 mRNA is expressed in
human colorectal cancer and indicate that CD276 is a target for
tumor-specific vascular targeting.
Example 7
CD276 Protein is Overexpressed in Human Tumors
[0303] This example illustrates that CD276 is overexpressed in
human tumors and indicates that CD276 is a target for
tumor-specific vascular targeting.
[0304] CD276 protein expression patterns were evaluated using
anti-CD276 antibodies. The overall level of CD276 was assessed in
extracts taken from 12 normal and 12 malignant colorectal tissues,
10 of which were derived from the same patient (P1-P10). As shown
in FIG. 6A, CD276 was clearly elevated in 11 of the 12 tumors,
while the remaining matched normal/tumor pair (case P7) displayed
unaltered expression. CD276 protein migrated at a size similar to
that observed in 293 cells transfected with the 4IgG-containing
form of CD276 (293/CD276). The faint product present in 293 parent
cells may represent low-level endogenous CD276 expression which was
also detected at the mRNA level in these cells by RT-PCR.
[0305] CD276 protein expression levels were assessed in 6 lung
tumor samples. As illustrated in FIG. 6B, CD276 protein expression
levels were increased in each of the lung tumor samples as compared
with protein levels detected in patient-matched control samples.
All tumor samples appeared to overexpress the predominant 4-IgG
form of CD276, as exogenous overexpression of this form in
transfected 293 cells resulted in a product of similar size (FIG.
6A).
[0306] To determine the cellular source of this up-regulated
protein, immunohistochemistry was performed on paraffin sections
obtained from 10 patient-matched samples of normal colonic mucosa
and colorectal cancer. Ten patient-matched samples of non-small
cell lung cancer were also analyzed along with adjacent normal lung
tissue. All samples represented different cases than those used for
the western analysis. Staining with a CD276 polyclonal antibody
revealed a vessel-like pattern in all cases of human colorectal or
lung cancer analyzed, but not in matched normal tissues (FIGS.
6C-6H and Table 11).
[0307] Moreover, this vessel-like pattern of staining was also
observed in each of a smaller number of breast, esophageal and
bladder cancers, but not in corresponding normal tissues (FIGS.
6I-6L). Similar expression patterns were observed using an
independent monoclonal antibody. CD276 overexpression was
frequently detected in the tumor cells while normal epithelium was
uniformly negative. The highest tumor-cell expression levels of
CD276 were found in lung and breast cancer where they matched that
found in tumor endothelium (FIGS. 6F, 6G and 6L). These results
demonstrate that CD276 protein is overexpressed in multiple types
of human tumors and demonstrate that CD276 is a target for
tumor-specific vascular targeting.
TABLE-US-00017 TABLE 11 Immunohistological staining of CD276 in
normal and tumor tissues. Vessel staining.sup..dagger.
Epithelial/tumor cell staining Normal Tumor Normal Tumor Colon 0/10
10/10 0/10 0/10* Lung 0/10 10/10 0/10 5/10 Breast 0/3 3/3 0/3 3/3
Bladder 0/2 3/3 0/2 3/3 Esophagus 4/4 1/4 *CD276 immunoreactivity
in the tumor cells was considered negative in all colon samples by
IH because expression levels were close to background, but could be
detected in the same cells using a more sensitive IF protocol (see
FIG. 4). .sup..dagger.Vessel staining refers to that which lines
the inner surface of vessels as shown in FIG. 6. Occasional
staining of the outer adventitia was also observed in some larger
blood vessels, particularly in lung tissues, but is not included
here. All normal tissue used was patient-matched to the tumor
samples. Vessels from normal tissues that failed to stain for CD276
were immunoreactive on control sections stained for endothelial
proteins such as vWF.
Example 8
Inhibition of Pathological Angiogenesis to Treat a Tumor
[0308] This example describes methods that can be used to
significantly reduce pathological angiogenesis, for example as a
means to treat a tumor, such as cancer. One skilled in the art will
appreciate that similar methods can be used with any of the
pathological angiogenesis inhibitors shown in Table 9 to treat any
tumor that expresses the target angiogenesis protein.
[0309] Based upon the teaching disclosed herein, pathological
angiogenesis can be reduced or inhibited by administering a
therapeutically effective amount of a composition, wherein the
composition includes a specific binding agent that preferentially
binds to one or more pathological angiogenesis marker proteins
comprising Vscp, CD276, ETSvg4 (Pea3), CD137(4-1BB), MiRP2,
Ubiquitin D (Fat10), Doppel (prion-PLP), Apelin, Plgf, Ptprn
(IA-2), CD109, Ankylosis, and collagen VIII.alpha.1, thereby
inhibiting pathological angiogenesis in the subject.
[0310] In an example, a subject who has been diagnosed with a
disease associated with or caused by pathological angiogenesis such
as a tumor is identified. Following subject selection, a
therapeutic effective dose of the composition including the
specific binding agent is administered to the subject. For example,
a therapeutic effective dose of a specific binding agent to one or
more of the disclosed pathological angiogenesis markers is
administered to the subject to inhibit pathological angiogenesis.
In a further example, the specific binding agent is an antibody
conjugated to a therapeutic molecule (such as therapeutic molecule
is a cytotoxin, chemotherapeutic reagent, radionucleotide or a
combination thereof). The amount of the composition administered to
prevent, reduce, inhibit, and/or treat pathological angiogenesis or
a condition associated with it depends on the subject being
treated, the severity of the disorder, and the manner of
administration of the therapeutic composition. Ideally, a
therapeutically effective amount of an agent is the amount
sufficient to prevent, reduce, and/or inhibit, and/or treat the
disorder (e.g., cancer) in a subject without causing a substantial
cytotoxic effect in the subject.
[0311] In one specific example, naked antibodies are administered
at 5 mg per kg every two weeks or 10 mg per kg every two weeks
depending upon the cancer. In an example, the antibodies are
administered continuously. In another example, antibodies or
antibody fragments conjugated to cytotoxic agents (immunotoxins)
are administered at 50 .mu.g per kg given twice a week for 2 to 3
weeks.
Example 9
Screening of Subjects for Pathological Angiogenesis
[0312] According to the teachings herein, pathological angiogenesis
can be screened for by detecting at least one expression product
comprising one or more of: Vscp, CD276, ETSvg4 (Pea3),
CD137(4-1BB), MiRP2, Ubiquitin D (Fat10), Doppel (prion-PLP),
Apelin, Plgf, Ptprn (IA-2), CD109, Ankylosis, and collagen VIII, 1,
in a sample obtained from the subject and compared to a control
(sample obtained from a subject without pathological angiogenesis)
or reference value. In one example, detection of the at least one
expression product indicates pathological angiogenesis in the
subject. In a further example, detection of the at least one
expression product indicates the presence of a tumor such as
cancer. The expression product can be RNA or protein. An RNA
expression product can be detected by SAGE or PCR by methods
described above (see, for example, Example 1). A protein expression
product can be detected by Western blot or immunoassay (see, for
example, Example 1). However, the disclosure is not limited to
particular methods of detection.
Example 10
Delivering a Therapeutic Agent to Organ-Specific Cells
[0313] Based upon the teaching disclosed herein, a therapeutic
agent can be delivered to organ-specific cells by administering a
therapeutically effective amount of a composition, wherein the
composition includes a binding agent that preferentially binds to
one or more of the disclosed brain endothelial marker proteins or
liver endothelial markers and the therapeutic agent, thereby
evoking a therapeutic response in the organ-specific endothelial
cells. The one or more brain endothelial markers can include
Glucose transporter GLUT-1, Organic anion transporter 2,
Pleiotrophin, ATPase class V, type 10A, Peptidoglycan recognition
protein 1, Organic anion transporter 14, Forkhead box Q1, Organic
anion transporter 3, SN2 (Solute carrier family 38, member 5),
Inter-alpha (globulin) inhibitor H5, Solute carrier 38 member 3,
Zinc finger protein of the cerebellum 2, Testican-2, 3-HMG-CoA
synthase 2, Progestin and adipoQ receptor family member V, APC
down-regulated 1 Drapc1, GDPD phosphodiesterase family Accession
No. NM_001042671, putative transmembrane protein Accession No.
NM_029001, DES2 lipid desaturase/C4-hyroxylase, Kelch repeat and
BTB (POZ) domain, Lipolysis stimulated receptor, Glutathione
S-transferase alpha 4, TNF receptor superfamily member 19, T-box 1
or putative secreted protein Accession No. XM_620023. The one or
more liver endothelial markers can include liver endothelial marker
proteins such as deoxyribonuclease 1-like 3, LZP oncoprotein
induced transcript 3, putative transmembrane protein Accession No.
NM_023438, CD32 15, putative G-protein coupled receptor NM_033616,
C-type lectin-like receptor 2, C-type lectin domain family 4 member
g 16, Plexin C1, Wnt9B, Accession No. AK144596, GATA-binding
protein 4, MBL-associated serine protease-3, Renin binding protein,
putative transmembrane protein Accession No. NM_144830, or Retinoic
acid receptor, beta.
[0314] In an example, a subject who is in need of delivery of a
therapeutic agent to either a brain endothelial cell or a liver
endothelial cell is identified. Following subject selection, a
therapeutic effective dose of the composition including the
specific binding agent is administered to the subject. For example,
a therapeutic effective dose of a specific binding agent to one or
more of the disclosed pathological angiogenesis markers is
administered to the subject to inhibit tumor growth in the brain or
liver. The specific binding agent can be an antibody to one or more
of the organ-specific endothelial markers in which the antibody is
conjugated to the therapeutic agent such as a cytotoxin,
chemotherapeutic reagent, radionucleotide or a combination
thereof.
[0315] In view of the many possible embodiments to which the
principles of the disclosure may be applied, it should be
recognized that the illustrated examples are only examples of the
disclosed matter and should not be taken as limiting the scope of
the disclosure. Rather, the scope of the disclosure is defined by
the following claims. We therefore claim as our invention all that
comes within the scope and spirit of these claims.
Sequence CWU 1
1
234117DNAArtificial sequenceSynthetic nucleic acid SAGE tag
1agaaggacct cggaggc 17217DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 2tgcttccagt atgtgga 17317DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 3gtgtttgtgt ggccctc
17417DNAArtificial sequenceSynthetic nucleic acid SAGE tag
4agaaggactt cggaggc 17517DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 5cctgaattgc tgaggcc 17617DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 6agggacttca gtccctc
17717DNAArtificial sequenceSynthetic nucleic acid SAGE tag
7ataaaaaata tttactg 17817DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 8ccccaccaaa aatcaat 17917DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 9aaatcctttc actttgg
171017DNAArtificial sequenceSynthetic nucleic acid SAGE tag
10taaactactt ctcttgt 171117DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 11tttcaatctt atcttaa 171217DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 12ggtctgacag ctccggt
171317DNAArtificial sequenceSynthetic nucleic acid SAGE tag
13gaccgggtac ccgcaaa 171417DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 14acaaacctct aaggatg 171517DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 15cgctgcaagg gatcgtg
171617DNAArtificial sequenceSynthetic nucleic acid SAGE tag
16taaatgaata aaagcat 171717DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 17gggtaaatga tgactac 171817DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 18ggcaagttcc ccttttt
171917DNAArtificial sequenceSynthetic nucleic acid SAGE tag
19gagtggttcc ctgatgt 172017DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 20ctctcagaac aaagact 172117DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 21ccaacctact ctattgc
172217DNAArtificial sequenceSynthetic nucleic acid SAGE tag
22agaggaggta tgggagg 172317DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 23aggagagtgt ctaaaag 172417DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 24cacaaatatt taccatt
172517DNAArtificial sequenceSynthetic nucleic acid SAGE tag
25agtttccacc tttattc 172617DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 26gtggtaagag aagctcc 172717DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 27tcactgccct gaaagac
172817DNAArtificial sequenceSynthetic nucleic acid SAGE tag
28acttacattc cactgct 172917DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 29tgatgtttca gtgcttt 173017DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 30agtcctcccc tcagggc
173117DNAArtificial sequenceSynthetic nucleic acid SAGE tag
31cttcctagtc tttttga 173217DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 32ttttagtaag aaagcag 173317DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 33cctcagcacg ccctcag
173417DNAArtificial sequenceSynthetic nucleic acid SAGE tag
34ggacccctga ctgtgat 173517DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 35ctgctgtgga ccagagc 173617DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 36aatgtgttct atccctc
173717DNAArtificial sequenceSynthetic nucleic acid SAGE tag
37acttcagaat gtgccag 173817DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 38gtggatgcca atttgcc 173917DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 39ataccaaaca cgccaat
174017DNAArtificial sequenceSynthetic nucleic acid SAGE tag
40gtgcatactt gaggggg 174117DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 41actttaatac cacttag 174217DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 42cagaaaaata aatgtcc
174317DNAArtificial sequenceSynthetic nucleic acid SAGE tag
43tattgacaga agttaaa 174417DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 44cacaagctgt tagaggc 174517DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 45cttacaatga gaagcga
174617DNAArtificial sequenceSynthetic nucleic acid SAGE tag
46ggcgccacac aacgttg 174717DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 47tcctgccatt cacaaat 174817DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 48tgattggctt acctcag
174917DNAArtificial sequenceSynthetic nucleic acid SAGE tag
49gaacaccacg acttccc 175017DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 50cggaaactgc cagtgct 175117DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 51cggaaactgc caaaaaa
175217DNAArtificial sequenceSynthetic nucleic acid SAGE tag
52ggagcaggaa ccccttc 175317DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 53tatgcagatg gcaccca 175417DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 54gctcttaaga gagtttg
175517DNAArtificial sequenceSynthetic nucleic acid SAGE tag
55cgggtttccc gcccgcc 175617DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 56caacgccagc ctctccc 175717DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 57tgtaacctga agaaata
175817DNAArtificial sequenceSynthetic nucleic acid SAGE tag
58cagatagctt agaccta 175917DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 59ggtgatttca acgccgg 176017DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 60gtgcttgctt gtgtgca
176117DNAArtificial sequenceSynthetic nucleic acid SAGE tag
61ccaaatctgt cctgttg 176217DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 62caggcaaacc actcata 176317DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 63atctcctaga tacctaa
176417DNAArtificial sequenceSynthetic nucleic acid SAGE tag
64aaaggactgg ctggctg 176517DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 65gggtgggtga aggcaga 176617DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 66ttactttaat agtaaaa
176717DNAArtificial sequenceSynthetic nucleic acid SAGE tag
67gtacagtgta gataatt 176817DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 68tataggcttt ctaaaaa 176917DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 69agttcagagt gtagaca
177017DNAArtificial sequenceSynthetic nucleic acid SAGE tag
70tgtgtgggct gcctatg 177117DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 71attaccagaa ccacatt 177217DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 72cgaagggacc cacaacc
177317DNAArtificial sequenceSynthetic nucleic acid SAGE tag
73ggtcttacct caccacg 177417DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 74ttgcttggaa ccgcatt 177517DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 75caataaaaga tctggac
177617DNAArtificial sequenceSynthetic nucleic acid SAGE tag
76ctttagtgac cccagct 177717DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 77atggtgggca ctgctca 177817DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 78tcctctggaa tcattgg
177917DNAArtificial sequenceSynthetic nucleic acid SAGE tag
79agtcctgtgt gagcctt 178017DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 80atggtgggca ctgctca 178117DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 81tcctctggaa tcattgg
178217DNAArtificial sequenceSynthetic nucleic acid SAGE tag
82cttcctgtct gagcact 178317DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 83gggttgtaag gaatttt 178417DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 84cctgcccctc ctccaca
178517DNAArtificial sequenceSynthetic nucleic acid SAGE tag
85atagcagctg tcctagg 178617DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 86taaaggatac tatattt 178717DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 87agtcctgggt tctgtcc
178817DNAArtificial sequenceSynthetic nucleic acid SAGE tag
88aaggctcgaa ataaaga 178917DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 89gatgaatctt tttcaag 179017DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 90gattctctgc atcaggc
179117DNAArtificial sequenceSynthetic nucleic acid SAGE tag
91ttggttaccc agctccg 179217DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 92gagtctcctg gcaaaga 179317DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 93aataaccagg cctcacg
179417DNAArtificial sequenceSynthetic nucleic acid SAGE tag
94acatctggtg acaaagg 179517DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 95ggtatctgct ggacagg 179617DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 96ctgtcccctt gtctctc
179717DNAArtificial sequenceSynthetic nucleic acid SAGE tag
97gagctgtctt atgtgtc 179817DNAArtificial sequenceSynthetic nucleic
acid SAGE tag 98tttccgagtc tctagag 179917DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 99tttccgagtc tctagag
1710017DNAArtificial sequenceSynthetic nucleic acid SAGE tag
100agaagttgct cgtacct 1710117DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 101cccctgtggt atctgac 1710217DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 102gagttgtcac cgctgca
1710317DNAArtificial sequenceSynthetic nucleic acid SAGE tag
103ttacagagag caaagct 1710417DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 104taggttgctt aaagaaa 1710517DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 105accaaaaagc aagttgg
1710617DNAArtificial sequenceSynthetic nucleic acid SAGE tag
106ggcaattgtc ttctctg 1710717DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 107gcttaaacaa aatgcat 1710817DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 108cctaagtatg gtacagg
1710917DNAArtificial sequenceSynthetic nucleic acid SAGE tag
109gttagtcaga aactgcc 1711017DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 110tacagtataa gacaata 1711117DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 111aacgtaaaat acttaag
1711217DNAArtificial sequenceSynthetic nucleic acid SAGE tag
112ggtctttgag ggagcag 1711317DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 113tcccctgccc agttcac 1711417DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 114ctttgaggcc agcagag
1711517DNAArtificial sequenceSynthetic nucleic acid SAGE tag
115cgctgtattc ttcacag 1711617DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 116gagtgcttcc gagaagc 1711717DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 117gtcattctcc gagccag
1711817DNAArtificial sequenceSynthetic nucleic acid SAGE tag
118gtgttgctgt cactagg 1711917DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 119agtactcaat ccagttt 1712017DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 120taaattggat gcaatgt
1712117DNAArtificial sequenceSynthetic nucleic acid SAGE tag
121gatattttgc ctgtcaa 1712217DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 122atgacgacct tgttggc 1712317DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 123gagtcagcaa ctttgca
1712417DNAArtificial sequenceSynthetic nucleic acid SAGE tag
124aagtaattct ggtaaca 1712517DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 125atgccgagat tgtacgg 1712617DNAArtificial
sequenceSynthetic nucleic acid SAGE tag
126aggaagatca ccaggga 1712717DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 127ctaatggccc attagtg 1712817DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 128aaggaagaaa gctctgc
1712917DNAArtificial sequenceSynthetic nucleic acid SAGE tag
129cttgaggtct agaggaa 1713017DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 130agagaatttt ccatact 1713117DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 131atttccatct tcatacc
1713217DNAArtificial sequenceSynthetic nucleic acid SAGE tag
132ctaggcaaga acattac 1713317DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 133accggaagga atttgct 1713417DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 134atgcccggca ggtgctc
1713517DNAArtificial sequenceSynthetic nucleic acid SAGE tag
135gactacccat ctctggg 1713617DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 136gtttgctctg ctggcat 1713717DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 137gctctgtgtc tatgcag
1713817DNAArtificial sequenceSynthetic nucleic acid SAGE tag
138gctctcttgt gtgcact 1713917DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 139gctggcactg gtaacct 1714017DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 140ggggaaggct ggtggtc
1714117DNAArtificial sequenceSynthetic nucleic acid SAGE tag
141cagagggctg gggccgg 1714217DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 142agactgtaaa ctgggtg 1714317DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 143ggactctgta aactggg
1714417DNAArtificial sequenceSynthetic nucleic acid SAGE tag
144ggactctggc cagcacc 1714517DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 145gtgctattct ggagctg 1714617DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 146tgggcggcag ctggggg
1714717DNAArtificial sequenceSynthetic nucleic acid SAGE tag
147caatgtggga agtggag 1714817DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 148gggggttggg agagggg 1714917DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 149tgggaggcag ctggggg
1715017DNAArtificial sequenceSynthetic nucleic acid SAGE tag
150actcctggac agctcaa 1715117DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 151catcatattt gcacaca 1715217DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 152ggaaacaact gttacaa
1715317DNAArtificial sequenceSynthetic nucleic acid SAGE tag
153gtggactgga aggccgc 1715417DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 154ggtctccccc ttcagac 1715517DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 155agaaaccttg ataaaac
1715617DNAArtificial sequenceSynthetic nucleic acid SAGE tag
156gctgactaca acatcaa 1715717DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 157aagtattcca cagtaca 1715817DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 158aagcagggcg gaacctt
1715917DNAArtificial sequenceSynthetic nucleic acid SAGE tag
159tgtgttctta ggcatct 1716017DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 160gtcatctaaa aggacta 1716117DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 161tgattttgac tgcaaat
1716217DNAArtificial sequenceSynthetic nucleic acid SAGE tag
162gttctatact cttctgg 1716317DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 163taaatatgtc tttataa 1716417DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 164ttcttctcag aggcctc
1716517DNAArtificial sequenceSynthetic nucleic acid SAGE tag
165tagaggggac ccagtct 1716617DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 166ccttcaatgc agccggg 1716717DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 167gcctttcaag ggggcag
1716817DNAArtificial sequenceSynthetic nucleic acid SAGE tag
168ggaagcagac agcaggc 1716917DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 169ggccccctcc ggcccca 1717017DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 170tgatctccca ggagatg
1717117DNAArtificial sequenceSynthetic nucleic acid SAGE tag
171gcgacagtct cactctg 1717217DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 172tctctatatc tccttct 1717317DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 173ttacctcagt ccagaca
1717417DNAArtificial sequenceSynthetic nucleic acid SAGE tag
174actagaaaat taaacag 1717517DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 175taaaaaaaag agaaaaa 1717617DNAArtificial
sequenceSynthetic nucleic acid SAGE tag 176tacaaataaa aactaaa
1717717DNAArtificial sequenceSynthetic nucleic acid SAGE tag
177atgtacacat acgacga 1717817DNAArtificial sequenceSynthetic
nucleic acid SAGE tag 178ggatacaata aatatcc 1717921DNAArtificial
sequenceSynthetic nucleic acid PCR primer 179ctcctcctcc aacaagagca
g 2118019DNAArtificial sequenceSynthetic nucleic acid PCR primer
180cgatgaaggc ataaccacg 1918118DNAArtificial sequenceSynthetic
nucleic acid PCR primer 181gctacctgcc caccatcg 1818220DNAArtificial
sequenceSynthetic nucleic acid PCR primer 182catccactgc tgtcacacgg
2018320DNAArtificial sequenceSynthetic nucleic acid PCR primer
183atcccagcag caagaaggtg 2018420DNAArtificial sequenceSynthetic
nucleic acid PCR primer 184atcatcagca tggagttccg
2018520DNAArtificial sequenceSynthetic nucleic acid PCR primer
185tggaactgga accaacatgg 2018619DNAArtificial sequenceSynthetic
nucleic acid PCR primer 186aggtatggct cccagcgag
1918718DNAArtificial sequenceSynthetic nucleic acid PCR primer
187gtgggcaagc ggctacag 1818820DNAArtificial sequenceSynthetic
nucleic acid PCR primer 188cgatgttggg ttctcctagc
2018920DNAArtificial sequenceSynthetic nucleic acid PCR primer
189atcgagacga gagaatgggc 2019020DNAArtificial sequenceSynthetic
nucleic acid PCR primer 190ggagtccgtg tgatctgtgg
2019119DNAArtificial sequenceSynthetic nucleic acid PCR primer
191actgctccgc ccagatacc 1919220DNAArtificial sequenceSynthetic
nucleic acid PCR primer 192ccatagccat ttcgaccacc
2019322DNAArtificial sequenceSynthetic nucleic acid PCR primer
193ctcagcctat tgaagagatg cg 2219420DNAArtificial sequenceSynthetic
nucleic acid PCR primer 194agcgtctcac tggtgtcagg
2019520DNAArtificial sequenceSynthetic nucleic acid PCR primer
195gcgtctccga gatcatcagc 2019620DNAArtificial sequenceSynthetic
nucleic acid PCR primer 196tgacccgtac cttcctcctg
2019719DNAArtificial sequenceSynthetic nucleic acid PCR primer
197atcgcccagt acaagtgcc 1919818DNAArtificial sequenceSynthetic
nucleic acid PCR primer 198ggaaggtccc atccagcg 1819921DNAArtificial
sequenceSynthetic nucleic acid PCR primer 199tttggcttgg actggataac
c 2120019DNAArtificial sequenceSynthetic nucleic acid PCR primer
200tgcccatcag gttgacacg 1920121DNAArtificial sequenceSynthetic
nucleic acid PCR primer 201gaagatgtga gagccctgga g
2120222DNAArtificial sequenceSynthetic nucleic acid PCR primer
202cctggattat ctcccagtgt tg 2220322DNAArtificial sequenceSynthetic
nucleic acid PCR primer 203ctacacccaa cagtagcatt cg
2220419DNAArtificial sequenceSynthetic nucleic acid PCR primer
204tccgtcagtc cagtccagg 1920518DNAArtificial sequenceSynthetic
nucleic acid PCR primer 205cgcacacttc ccgctgag 1820618DNAArtificial
sequenceSynthetic nucleic acid PCR primer 206gctcgccttg atggttcc
1820718DNAArtificial sequenceSynthetic nucleic acid PCR primer
207cgggatgaca tcgagcag 1820821DNAArtificial sequenceSynthetic
nucleic acid PCR primer 208acactcaggc tcttccacca c
2120918DNAArtificial sequenceSynthetic nucleic acid PCR primer
209ccgtcatatt cgcctggg 1821019DNAArtificial sequenceSynthetic
nucleic acid PCR primer 210tgctggcagg tgctctagg
1921120DNAArtificial sequenceSynthetic nucleic acid PCR primer
211cttgttcgat gttcacagcg 2021221DNAArtificial sequenceSynthetic
nucleic acid PCR primer 212gccgtagagc tgtcttggat c
2121322DNAArtificial sequenceSynthetic nucleic acid PCR primer
213aacgaagtct ccaaatctgt cc 2221419DNAArtificial sequenceSynthetic
nucleic acid PCR primer 214aggtggaatt aggcctggg
1921519DNAArtificial sequenceSynthetic nucleic acid PCR primer
215cagcataggt ggacagccg 1921619DNAArtificial sequenceSynthetic
nucleic acid PCR primer 216cacaccacgt ccttctccg
1921720DNAArtificial sequenceSynthetic nucleic acid PCR primer
217ggagacagat cgtagaggcg 2021819DNAArtificial sequenceSynthetic
nucleic acid PCR primer 218ggaagcagcc agagtcgtg
1921919DNAArtificial sequenceSynthetic nucleic acid PCR primer
219gtccgcacct gtgttgtcc 1922020DNAArtificial sequenceSynthetic
nucleic acid PCR primer 220catcttccag cttctttccg
2022122DNAArtificial sequenceSynthetic nucleic acid PCR primer
221tagcagagaa ccgagattca cc 2222221DNAArtificial sequenceSynthetic
nucleic acid PCR primer 222gcttcagagc agccttcgta g
2122319DNAArtificial sequenceSynthetic nucleic acid PCR primer
223aatctgaggc tctgcgtgc 1922421DNAArtificial sequenceSynthetic
nucleic acid PCR primer 224gcccttcaat cctgctttag a
2122519DNAArtificial sequenceSynthetic nucleic acid PCR primer
225gtgccttgaa ggaccttgg 1922620DNAArtificial sequenceSynthetic
nucleic acid PCR primer 226agcagccact acagcgactc
2022719DNAArtificial sequenceSynthetic nucleic acid PCR primer
227ggtgtcggag cacatctgg 1922821DNAArtificial sequenceSynthetic
nucleic acid PCR primer 228tcaaactggt ccttagaacg g
2122920DNAArtificial sequenceSynthetic nucleic acid PCR primer
229cggcactacc tctgagcagt 2023021DNAArtificial sequenceSynthetic
nucleic acid PCR primer 230aacctgaatg gaccagtcac c
2123121DNAArtificial sequenceSynthetic nucleic acid PCR primer
231tcactggatg gctgatgaca c 2123219DNAArtificial sequenceSynthetic
nucleic acid PCR primer 232tgttggaggc atgtcggtc
1923320DNAArtificial sequenceSynthetic nucleic acid PCR primer
233ttccacagta ccagcccttg 2023419DNAArtificial sequenceSynthetic
nucleic acid PCR primer 234ctccacgggg accttgttc 19
* * * * *