U.S. patent application number 14/886763 was filed with the patent office on 2016-07-07 for system for optical stimulation of target cells.
The applicant listed for this patent is The Board of Trustees of the Leland Stanford Junior University. Invention is credited to Edward Boyden, Karl Deisseroth, Feng Zhang.
Application Number | 20160194624 14/886763 |
Document ID | / |
Family ID | 39609070 |
Filed Date | 2016-07-07 |
United States Patent
Application |
20160194624 |
Kind Code |
A1 |
Deisseroth; Karl ; et
al. |
July 7, 2016 |
SYSTEM FOR OPTICAL STIMULATION OF TARGET CELLS
Abstract
Various systems and methods are implemented for controlling
stimulus of a cell. One such method is implemented for optical
stimulation of a cell expressing a NpHR ion pump. The method
includes the step of providing a sequence of stimuli to the cell.
Each stimulus increases the probability of depolarization events
occurring in the cell. Light is provided to the cell to activate
the expressed NpHR ion pump, thereby decreasing the probability of
depolarization events occurring in the cell.
Inventors: |
Deisseroth; Karl; (Stanford,
CA) ; Zhang; Feng; (Cambridge, MA) ; Boyden;
Edward; (Cambridge, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Board of Trustees of the Leland Stanford Junior
University |
Stanford |
CA |
US |
|
|
Family ID: |
39609070 |
Appl. No.: |
14/886763 |
Filed: |
October 19, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14665978 |
Mar 23, 2015 |
9187745 |
|
|
14886763 |
|
|
|
|
14219547 |
Mar 19, 2014 |
|
|
|
14665978 |
|
|
|
|
13763119 |
Feb 8, 2013 |
8864805 |
|
|
14219547 |
|
|
|
|
12522520 |
Jan 8, 2010 |
8398692 |
|
|
PCT/US2008/050745 |
Jan 10, 2008 |
|
|
|
13763119 |
|
|
|
|
60903248 |
Feb 23, 2007 |
|
|
|
60879669 |
Jan 10, 2007 |
|
|
|
Current U.S.
Class: |
435/173.4 ;
435/283.1; 607/88 |
Current CPC
Class: |
A61N 2005/0626 20130101;
A61N 5/0601 20130101; A61N 5/0613 20130101; A61N 5/0622 20130101;
G01N 33/502 20130101; A61N 2005/0647 20130101; C12N 5/0602
20130101; A61N 2005/0665 20130101; A61N 2005/0663 20130101; A61N
5/06 20130101; G01N 33/6872 20130101; A61N 2005/0652 20130101; C12N
13/00 20130101 |
International
Class: |
C12N 13/00 20060101
C12N013/00; A61N 5/06 20060101 A61N005/06 |
Claims
1. A method for optical stimulation of a cell expressing an NpHR
ion pump, the method comprising: providing a sequence of stimuli to
the cell, each stimulus increasing the probability of a
depolarization event occurring in the cell; and providing light to
the cell to activate the expressed NpHR ion pump, thereby
decreasing the probability of depolarization events occurring in
the cell.
2. The method of claim 1, wherein the optical light has a
wavelength of around 560 nm.
3. The method of claim 1, wherein the optical light is about 10
mW/mm.sup.2.
4. The method of claim 1, wherein sequence of stimuli to the cell
is a sequence of electrical pulses.
5. The method of claim 1, wherein the cell also expresses a ChR2
ion channel and the sequence of stimuli to the cell is a sequence
of optical pulses.
6. The method of claim 1, wherein the cell is stimulated in
vitro.
7. The method of claim 1, wherein the cell is stimulated in
vivo.
8. An apparatus for optical stimulation of a cell expressing an
NpHR ion pump, the apparatus comprising: a stimulation source that
provides a sequence of stimuli to the cell, each stimulus
increasing the probability of a depolarization event occurring in
the cell; and an optical source for providing light to the cell to
activate the expressed NpHR ion pump, thereby decreasing the
probability of depolarization events occurring in the cell.
9. The apparatus of claim 8, wherein the stimulation source is an
optical light source.
10. The apparatus of claim 8, wherein the stimulation source is an
electrical pulse generator.
Description
RELATED PATENT DOCUMENTS
[0001] This patent document claims benefit under 35 U.S.C.
.sctn.119(e) both of U.S. Provisional Application No. 60/879,669
filed on Jan. 10, 2007 and entitled "Genetically-Targetable Optical
Inactivation of Excitable Cells" and of U.S. Provisional
Application No. 60/903,248 filed on Feb. 23, 2007 and entitled
"Genetically-Targetable Optical Inactivation of Excitable Cells,"
each of which are fully incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention relates generally to systems and
approaches for stimulating target cells, and more particularly, to
using optics to dissuade stimulation-generated pulse trains.
[0003] Various efforts in neuroscience are directed towards
determining whether neural activity in a specific brain region, or
in a set of genetically-identified neurons, contributes to a
particular neural computation, behavior, or neurological or
psychiatric disorder. For centuries, insights have come from
studies of human patients with specific lesions, as exemplified by
Paul Broca's delineation in the 1860s of the eponymous brain area
that, when dysfunctional, results in deficits of speech production.
Many studies have used ablation or pharmacological shutdown of
neurons or brain regions in animals, or careful analysis of
patients, to parse out the physical substrates of normal and
abnormal behavior. However, growing awareness that activity in
multiple brain regions may be coordinated during performance of a
behavior, or in a particular neural dysfunction, has raised the
question of precisely when specific brain regions or neurons
contribute. For example, a large number of in vivo recording
studies have demonstrated, for many brain regions, that specific
neurons can fire action potentials during precise intervals within
a behavioral task. The intervals can last as little as a fraction
of a second; it is possible that specific brain regions or neurons
are required only at specific times in a task, not continuously. In
humans, use of transcranial magnetic stimulation to disrupt the
visual cortex has demonstrated that conscious perception requires
intact cortical performance during temporal windows that last tens
of milliseconds, occurring at precise times after visual stimulus
presentation. Accordingly, a method for disrupting activity in
targeted cell types for very precisely delimited periods of time
(e.g., several milliseconds) could help answer a number of
outstanding questions, and enable novel ones to be asked. For
example, one question involves the identification of the precise
brain regions, cell types, and activity patterns required at each
phase (sensory, decision-making and motor) of a behavioral task.
Another question involves, for a particular perception (e.g.,
feeling, decision, memory, or action) identifying the precise
number of neurons that must be active within a certain region and
how long the neurons are active. Another question involves the
identification of the causal role of neural synchrony and precise
spike timing in neural computation, plasticity, and pathological
brain function. As memories are encoded, consolidated, and
forgotten, it can be important to identifying how the critical
neural loci of memory changes.
SUMMARY
[0004] The claimed invention is directed to photosensitive
bio-molecular structures and related methods. The present invention
is exemplified in a number of implementations and applications,
some of which are summarized below.
[0005] According to one example embodiment of the present
invention, a method is implemented for optical stimulation of a
cell expressing an NpHR ion pump. The method includes the step of
providing a sequence of stimuli to the cell. Each stimulus
increases the probability of depolarization events occurring in the
cell. Light is provided to the cell to activate the expressed NpHR
ion pump, thereby decreasing the probability of depolarization
events occurring in the cell.
[0006] The above summary of the present invention is not intended
to describe each illustrated embodiment or every implementation of
the present invention. The figures and detailed description that
follow more particularly exemplify these embodiments.
BRIEF DESCRIPTION OF THE DRAWINGS
[0007] The invention may be more completely understood in
consideration of the detailed description of various embodiments of
the invention that follows in connection with the accompanying
drawings, in which:
[0008] FIG. 1A shows sample outward currents elicited by two pulses
of yellow light in a voltage-clamped neuron, consistent with an
embodiment of the present invention;
[0009] FIG. 1B shows sample membrane voltage hyperpolarizations
elicited by two pulses of yellow light, in a current-clamped neuron
held at resting membrane potential, consistent with an embodiment
of the present invention;
[0010] FIG. 1C shows Kinetic properties of yellow light-elicited,
Halo-mediated currents from voltage-clamped neurons, consistent
with an embodiment of the present invention;
[0011] FIG. 1D shows membrane potentials of neurons expressing
Halo-GFP and exposed to yellow light, neurons expressing Halo-GFP
but not exposed to any light, and neurons without transfection with
Halo-GFP, consistent with an embodiment of the present
invention;
[0012] FIG. 1E shows sample membrane hyperpolarizations induced by
5 Hz and 10 Hz trains of yellow light pulses, consistent with an
embodiment of the present invention;
[0013] FIG. 2A shows three voltage traces of a current-clamped
hippocampal neuron, exposed to a Poisson train of yellow light
pulses, consistent with an embodiment of the present invention;
[0014] FIG. 2B shows voltage traces of three different
current-clamped neurons exposed to the same Poisson train of light
pulses (.lamda.=100 ms), consistent with an embodiment of the
present invention;
[0015] FIG. 2C shows properties of hyperpolarization events
elicited by Poisson trains with various inter-pulse intervals,
consistent with an embodiment of the present invention;
[0016] FIG. 2D shows a comparison of the peak hyperpolarization and
the time-to-peak data at the beginning and end of the Poisson
trains, for the neurons described in FIG. 2C, consistent with an
embodiment of the present invention;
[0017] FIG. 3A shows a light-driven spike blockade, demonstrated
for a single hippocampal neuron, consistent with an embodiment of
the present invention;
[0018] FIG. 3B shows population data (n=6 neurons) for
light-driven, Halo-mediated spike blockade, consistent with an
embodiment of the present invention;
[0019] FIG. 4A shows responses of single neurons co-expressing Halo
and ChR2, both under control of the CaMKII promoter, to
rapidly-switched pulses of yellow and blue light, consistent with
an embodiment of the present invention; and
[0020] FIGS. 4B-4D show poisson trains of rapidly-alternating
yellow and blue light pulses elicited rapidly-alternating
hyperpolarizations and depolarizations in the same neuron,
consistent with an embodiment of the present invention.
[0021] While the invention is amenable to various modifications and
alternative forms, specifics thereof have been shown by way of
example in the drawings and will be described in detail. It should
be understood, however, that the intention is not to limit the
invention to the particular embodiments described. On the contrary,
the intention is to cover all modifications, equivalents, and
alternatives falling within the spirit and scope of the
invention.
DETAILED DESCRIPTION
[0022] The present invention is believed to be useful for enabling
practical application of a variety of photosensitive bio-molecular
structures, and the invention has been found to be particularly
suited for use in arrangements and methods dealing with neuron
stimulation. While the present invention is not necessarily limited
to such applications, various aspects of the invention may be
appreciated through a discussion of various examples using this
context.
[0023] The aspects of the present invention are directed to a
technology that enables rapid neural inactivation and release from
inactivation at the millisecond timescale, is safe and effective,
has minimal effects on cellular physiology or survival, and
requires no exogenous chemicals to be delivered. A specific
embodiment of the invention involves a single-component protein
capable of mediating light-induced inhibition, the mammalian
codon-optimized version of the light-driven chloride pump
halorhodopsin, from the archaebacterium Natronobacterium pharaonis
(abbreviated Halo). Although such halobacteria are known to live in
very high saline concentrations (e.g., >1 M), some wild-type
halorhodopsins have been shown to preserve functionality at much
lower chloride concentrations, even at levels comparable to those
found in mammalian cerebrospinal fluid. Applications of the present
invention involve the use of Halo to mediate optical inhibition of
neuronal spiking in a physiologically accurate milicu, in response
to pulses of somatically injected intracellular current (.about.300
PA), with temporal onset and offset of inhibition in the range of
10-15 milliseconds. Moreover, Halo can mediate naturalistic trains
of inhibitory voltage changes at physiologically relevant
frequencies, with minimal attenuation of voltage amplitude from
pulse to pulse.
[0024] Aspects of an embodiment of the invention are also directed
to a single neuron expressing both Halo and the blue-light driven
cation channel Channelrhodopsin-2 (ChR2), neural inhibition and
excitation are controlled at the millisecond timescale by pulses of
yellow and blue light, respectively. In one instance, these
channels provide the capability to create lesions of virally or
transgenically targeted neural circuits over precise timescales, as
well as neuroengineering interfaces for bi-directional control of
excitable cell depolarization and hyperpolarization.
[0025] One embodiment of the present invention involves a designed
fusion protein having the mammalian codon-optimized form of N.
pharaonis halorhodopsin (Halo), with EGFP added in-frame at the
C-terminus for ease of visualization. When expressed using the
CaMKII promoter, which targets excitatory neurons of the forebrain,
Halo-EGFP fluoresced brightly and appeared evenly distributed in
the neuron. When exposed to .about.10 mW/mm.sup.2 yellow light
(e.g., from a xenon lamp, filtered by a standard Texas red
excitation filter (bandpass, 560.+-.27.5 nm, Chroma),
voltage-clamped hippocampal neurons expressing Halo can experience
outward currents with rapid onset, stable steady-state, and abrupt
shut-off with cessation of illumination. In some instances, no
supplementation of the culture medium or the recording medium with
the halorhodopsin cofactor all-trans retinal is necessary. This is
believed to be due to levels of all-trans retinal naturally
occurring in mammalian neurons in culture and in live brain that
are high enough to enable type I opsins without chemical
supplementation.
[0026] FIG. 1 shows the results of an experimental test of
millisecond-timescale, yellow light-driven, neuronal
hyperpolarization with Halo. A cultured hippocampal neuron
expressing mammalian codon-optimized N. pharaonis halorhodopsin
(Halo) fused to GFP under the CaMKII promoter is used.
[0027] FIG. 1A shows sample outward currents elicited by two
1-second pulses of yellow (560.+-.27.5 nm) light (.about.10
mW/mm.sup.2) in a voltage-clamped neuron held at -70 mV. Yellow
bars in this and subsequent figures indicate the period of yellow
light exposure.
[0028] FIG. 1C shows Kinetic properties of yellow light-elicited,
Halo-mediated currents from voltage-clamped neurons. FIG. 1Ci shows
15-85% current onset time. FIG. 1Cii shows 85-15% offset time. For
each measurement, data is presented from neurons held at -70 mV
(n=14 neurons), -30 mV (n=10), and +10 mV (n=10) (left to right).
Bars represent mean.+-.standard error of the mean (S.E.M.).
[0029] FIG. 1B shows sample membrane voltage hyperpolarizations
elicited by two 1-second pulses of yellow light, in a
current-clamped neuron held at resting membrane potential.
[0030] FIG. 1D shows membrane potentials of neurons expressing
Halo-GFP and exposed to yellow light (left, n=14), expressing
Halo-GFP but not exposed to any light (middle, n=11), and without
transfection with Halo-GFP (right, n=8). *** denotes significant
difference between the Halo-GFP+light condition and each of the
other two conditions (p<0.0001; Fisher's partial least-squares
difference (PLSD) post hoc test after ANOVA).
[0031] FIG. 1E shows sample membrane hyperpolarizations induced by
5 Hz (top) and 10 Hz (bottom) trains of yellow light pulses, with
light pulse durations of 50 ms (top) and 25 ms (bottom),
respectively.
[0032] In related experimental tests, the light pulses elicited
pulse amplitudes of 56.9.+-.23.4 pA (mean.+-.st. dev.; n=14
neurons). Repeating a 1-second pulse of yellow light twice, spaced
by 1 second in darkness, resulted in identical pulse amplitudes
each time (p>0.50, paired t-test), as shown in FIG. 1A.
[0033] This stable current amplitude appears to be consistent with
what is known about the halorhodopsin photocycle. As befits a
chloride pump, the current amplitude did not vary significantly
with holding voltage (F=0.004, p>0.95, ANOVA with factor of
holding voltage), nor did any measured kinetic parameters vary,
such as the onset or offset times of the current pulses (F<0.6,
p>0.55 for all comparisons, ANOVA; FIG. 1C). The onset and
offset times of elicited currents were seen to be on the order
.about.10-15 ms at all holding voltages tested. This suggests that
Halo is a viable candidate for ultratransient shutdown of spike
trains (FIG. 1Ci, 1Cii). When held in current clamp, hippocampal
neurons underwent peak hyperpolarizations of -21.6.+-.11.3 mV
(mean.+-.st. dev.; n=11 neurons) in response to pulses of yellow
light, with no difference between the peak hyperpolarizations
achieved by two pulses separated by a 1-second pause (p>0.85,
paired t-test; FIG. 1B). These large voltage changes were
relatively rapid, with onset and offset times of 68.+-.57 and
73.+-.39 ms, respectively. Thus, Halo has been shown to be capable
of reliably mediating hyperpolarizations of significant magnitude,
with fast onset and offset times at the beginning and end of light
exposure.
[0034] Several control experiments were implemented to evaluate
whether Halo has unanticipated side effects, such as altering basal
cell physiology or increasing the propensity for cell death. First,
the basal state of Halo-expressing neurons electrophysiologically
was characterized when no light was present. When measured in
darkness, no difference was seen between the resting potentials of
neurons expressing Halo and those of neighboring neurons in the
culture that were untransfected (p>0.20, n=11 Halo-positive
cells, n=8 Halo-negative cells; FIG. 1D). This result suggests that
basal neural activity would be little affected by the presence of
Halo. On the other hand, Halo-expressing neurons illuminated with
yellow light were significantly hyperpolarized, with respect to
both Halo-expressing neurons in darkness and non-transfected cells
(p<0.0001 for both of these comparisons, Fisher's partial least
squares difference post hoc test after ANOVA (F=28.4, p<0.0001)
with factor of experimental condition; FIG. 1D). An independent
assay for unanticipated effects on cell health, the
membrane-impermeant DNA stain ethidium homodimer-1 was used to
detect the cell membrane breakdown accompanying cell death for one
week in Halo-expressing cells. Little difference was found in the
prevalence of cell death between Halo-positive and Halo-negative
neurons: 16/308 (5.2%) non-transfected neurons counted, and 1/22
(4.5%) Halo-expressing neurons counted, were labeled by ethidium
homodimer-1, indicating that Halo was not toxic over the course of
the one-week experiment (x2=0.02, p>0.85).
[0035] In an effort to explore the uses Halo could present in the
analysis and engineering of intact neural circuits, an experiment
was performed to determine whether the fast response times of Halo
could support naturalistic sequences of hyperpolarization events,
in response to trains of brief pulses of yellow light.
[0036] FIG. 2 shows high-fidelity Halo-mediated naturalistic trains
of inhibitory events. FIG. 2A shows three voltage traces of a
current-clamped hippocampal neuron, exposed to a Poisson train of
yellow light pulses. Each light pulse lasts 10 ms, and the Poisson
train has a mean inter-pulse interval of A=100 ms.
[0037] FIG. 2B shows voltage traces of three different
current-clamped neurons exposed to the same Poisson train of light
pulses (.lamda.=100 ms).
[0038] FIG. 2C shows properties of hyperpolarization events
elicited by Poisson trains with inter-pulse interval .lamda.=100 ms
(i, ii) and .lamda.=200 ms (iii, iv), plotted versus onset time of
each light pulse. Plots (i) and (iii) show the peak of each
hyperpolarization event, as well as the across-trials standard
deviation of these amplitude values across ten trials. Plots (ii)
and (iv) show the latency between the onset time of the light pulse
and the time of the hyperpolarization peak, as well as the
across-trials standard deviation of these timing values across ten
trials. All plotted points are across-neuron mean.+-.S.E.M. (n=5
neurons).
[0039] FIG. 2D shows a comparison of the peak hyperpolarization (i)
and the time-to-peak (ii) data at the beginning (first 5) and end
(last 5) of the .lamda.=100 ms and .lamda.=200 ms Poisson trains,
for the n=5 neurons described in FIG. 2C. In (i): for each neuron,
the average of the first 5 or last 5 hyperpolarization peaks or the
across-trials standard deviation of these amplitude values was
first computed, then the across-neuron mean.+-.S.E.M. was plotted.
In (ii): for each neuron, the average of the first 5 or last 5
times-to-peak or the across-trials standard deviation of these
times-to-peak were first computed, then the across-neuron
mean.+-.S.E.M. was plotted.
[0040] FIG. 2A shows three traces of hyperpolarization events
elicited in a single neuron, resulting from repeatedly playing back
a Poisson train (mean inter-pulse interval, .lamda.=100 ms, 59
pulses), of 10 ms-duration yellow light pulses, to simulate
stochastic synaptic inhibitory input. FIG. 2B shows three such
hyperpolarization traces, taken from different neurons. The
variability of such trains was remarkably low in many
regards--across ten repeated trials in a single cell, across
multiple cells (n=5 neurons), and over time throughout a sustained
train of 59 pulses (FIG. 2C, 2D). It was found that for
hyperpolarizations elicited by 10 ms-duration light pulses during a
.lamda.=100 ms Poisson train, the mean amplitude was -4.56 mV
(averaged across trials and neurons), but the trial-to-trial
standard deviation of this amplitude was only 0.40 mV (averaged
across neurons, FIG. 2Ci and FIG. 2Di). The trial-to-trial jitter
of the time the hyperpolarization took to reach its peak value was
also small, 1.27 ms (averaged across neurons, FIG. 2Cii and FIG.
2Dii). The neuron-to-neuron variability of amplitude and timing was
somewhat larger than the trial-to-trial variability, with standard
deviations of 1.45 mV and 1.78 ms, respectively, but demonstrating
that precise inhibitory control of a population of neurons could
proceed with millivolt and millisecond resolution. Finally, the
through-train sustainability of light-elicited voltage changes was
quantitatively examined by comparing the amplitude mean and
amplitude variability, and timing variability of the
hyperpolarization events elicited by the first five light pulses to
those of the last five light pulses in the train (FIGS. 2Di and
2Dii, left side). Little or no difference was seen for any of these
statistics between the beginning and end of a train (p>0.10 for
all measures, t-test). Identical conclusions held for the
.lamda.=200 ms Poisson train with 46 pulses (FIGS. 2Ciii and 2Civ,
and FIGS. 2Di and 2Dii, right side). The high temporal and
amplitude fidelity of Halo-mediated hyperpolarizations suggests
uses for Halo in simulating inhibitory synaptic inputs, with great
precision.
[0041] FIG. 3 shows reliable and repeatable Halo-mediated neural
inactivation, at single-spike temporal resolution. FIG. 3A shows a
light-driven spike blockade, demonstrated for a single hippocampal
neuron. At the top of FIG. 3A, labeled with "I-injection," neuronal
firing of 20 spikes at 5 Hz are induced by pulsed somatic current
injection (.about.300 pA, 4 ms). In the middle of FIG. 3A, labeled
with "light," light membrane hyperpolarizations are induced by two
periods of yellow light, timed so as to be capable of blocking
spikes 7-11 and spike 17 out of the train of 20 spikes. At the
bottom of FIG. 3A, labeled as "I-injection+Light", yellow light
drives Halo to block neuron spiking (note significant reductions of
spikes 7-11 and of spike 17), while leaving spikes elicited during
periods of darkness largely intact.
[0042] FIG. 3B shows population data (n=6 neurons) for
light-driven, Halo-mediated spike blockade, showing high spike
probability during periods of darkness (spikes 1-6, 12-16, and
18-20), and low spike probability during periods of yellow-light
illumination (spikes 7-11 and spike 17). Error bars are smaller
than the points plotted.
[0043] Such experiment were implemented to analyze the ability of
Halo to enable rapidly inducible and reversible silencing of neuron
spiking. Such ability can be useful to enable time-resolved parsing
of the precise neural substrates of behavior. Neurons were
intracellularly injected with trains of somatic current pulses
(.about.300 PA, lasting .about.4 ms), causing them to fire action
potentials at 5 Hz with 100% success rate (FIG. 3A, "I-injection").
Yellow-light pulses were scheduled to occur during the times when
certain spikes (i.e., spikes 7-11 and 17) would occur during the
somatic current injection protocol (FIG. 3A). The light pulses and
the somatic current pulses were presented together (FIG. 3A,
"I-injection+light", three trials shown). Spiking was effectively
blocked during the periods of yellow-light exposure. The rapid
onset and offset kinetics of Halo allowed the deletion of even
single spikes. For instance, the second yellow-light pulse, timed
for silencing just spike 17, was able to effectively eliminate
spike 17 without affecting the firing of spikes 16 or 18 at all.
The experiment was repeated five times on each of n=6 neurons (FIG.
3B). During periods when the yellow light was off, it was found
that somatic current pulses elicited a spike 98.7% of the time. In
contrast, during periods when the yellow light was on, somatic
current pulses elicited a spike only 1.2% of the time. The second
pulse of yellow light reduced the probability of firing spike 17 to
3.3%, whereas spikes 16 and 18 still fired 96.7% of the time, not
significantly different from the spikes at the beginning of the
train, before any light exposure at all (X.sup.2=1.02, p>0.30).
The temporal precision of Halo in silencing spikes therefore offers
the possibility of creating ultratransient (yet precise and
effective) lesions of activity in targeted neurons.
[0044] A specific embodiment of the present invention includes the
use of one member of the type I opsin family, Channelrhodopsin-2
(ChR2), which has received recent attention for its ability to
drive neural excitation in response to pulses of blue light
(centered around 470 nm). The ability to drive excitation and
inhibition in the same neuron, using two different wavelengths of
light, could enable answers to questions for which no current
technology permits resolution. For example, synchronous neural
activity has been correlated with higher-order functions, such as
attention and abnormal patterns of neural synchrony that are
associated with certain neurological and psychiatric disorders. The
ability to drive a neuron with balanced but randomly varying
excitation and inhibition may allow alteration of the precise
timing of membrane voltage fluctuations, in principle permitting
neural synchronization or desynchronization without any side
effects, such as alteration of spike rate. This may open up new
experiments in testing the causal role of neural synchrony in
behavior and pathology.
[0045] Single neurons co-expressing Halo and ChR2, both under
control of the CaMKII promoter, were implemented to allow for
response to rapidly-switched pulses of yellow and blue light with
hyperpolarizations and depolarizations, respectively (FIG. 4A).
Poisson trains (.lamda.=100 ms) of rapidly-alternating yellow and
blue light pulses elicited rapidly-alternating hyperpolarizations
and depolarizations in the same neuron (FIG. 4B). In one
experiment, the same Poisson train was played back twice with the
first train beginning on a blue pulse FIG. 4B and the second train
beginning on a yellow pulse, FIG. 4C so that in the second trace,
depolarizations were converted into hyperpolarizations and vice
versa. In principle, these traces should be quite similar, but with
inverted voltage scale. Indeed, FIG. 4C shows an inverted trace
superimposed over the trace in FIG. 4B. The degree of superposition
suggests that this approach may indeed be a viable method for
high-fidelity, bi-directional control of neural activity at the
millisecond timescale (FIG. 4C).
[0046] The inhibition provided by Halo is strong enough to silence
neurons firing spikes in response to significant intracellular
somatic current injections (FIG. 3), yet the photocurrents can
appear and disappear within 10-15 milliseconds of light onset and
offset, respectively (FIG. 1). Furthermore, the amplitude and
timing of responses is reliable from trial to trial, and the
amplitude of the voltage changes induced by pulses of yellow light
does not detectably run down over time (FIG. 2). The use of Halo
can be particularly useful for a number of reasons. For example,
the timescale of inducing of and subsequent release of voltage
inhibition by Halo is relatively fast.
[0047] According to another embodiment of the present invention,
Halo is used without ChR2. Millisecond pulses of light can be used
with Halo-expressing cells to induce hyperpolarizations of several
millivolts, and therefore, may be useful for simulating background
or well-timed synaptic activity. Studying the function of not only
specific cell types, but specific classes of inhibitory synapse,
can be accomplished by creating fusion proteins in which Halo is
targeted to specific locations where inhibitory synapses uniquely
cluster, such as the axon initial segment.
[0048] The ability to functionally lesion brain regions or cell
types in a rapidly reversible fashion opens up a large class of
experiments in which specific neuron populations must be
inactivated for precise, sub-second durations during a task. ChR2,
another type I opsin which obligately requires all-trans-retinal
for its function, has been shown to function in slices of mammalian
brain tissue, or even in the central nervous system in vivo,
without needing any chemical supplementation. Therefore, it is
believed that no supplementation will be needed for Halo in the
intact mammalian brain and in brain slice experiments. Other labs
working on classical neural model organisms such as Drosophila and
C. elegans have devised ways of delivering all-trans-retinal to the
nervous systems of such animals in order to enable ChR2 function,
and thus, it is likely that these retinal-delivery protocols would
also work for enabling Halo function in these invertebrates.
[0049] The ability to study the causal role of neural synchrony in
behavior, neural computation, and neural pathology may be a
particularly significant role for ChR2 and Halo, working in
concert. The newly-enabled power to drive both excitation and
inhibition of genetically-targeted neurons with blue and yellow
light seems to be particularly valuable for probing synchrony by
utilizing multiple wavelengths to perform both excitation and
inhibition in the same specimen. The ability to synchronize and
desynchronize neurons by balanced, yet random, patterns of
excitation and inhibition may open up new horizons into
understanding the causal role of neural synchrony in brain function
and disease, an area of longstanding, yet growing, interest.
[0050] Optical methods for altering neural circuit function have
appeal in part because in principle they can use technology
developed for brain imaging. The ability to use optical fibers to
image deep neural circuits, for example, also enables the
stimulation of deep brain structures. Two-photon excitation methods
may prove valuable for driving opsin activities, up to 1 mm deep.
Another key aspect of optical methods of neural control is the
speed with which activation and inactivation can take place, since
it is trivial to modulate light intensity at high speeds, faster
than most physiologically relevant processes. Nevertheless,
non-optical and chemical approaches will continue to find many
powerful uses for reliable, enduring inhibition of specific brain
circuits and cell types, especially when large regions of deep
brain tissue are involved.
[0051] From a neuroengineering standpoint, optical prosthetics
capable of inhibiting neural activity may present less-invasive
strategies for treating disorders of neural hyperactivity. ChR2 has
already proven to be well-tolerated in intact mammalian neural
circuits for up to a year. If Halo gains a similar track record, it
is possible that Halo-enabled prosthetics may open up new horizons
in controlling disorders of excitable cells, such as epilepsy,
depression, neuropathic pain, and cardiac hyperexcitability. In the
immediate future, the ability to study the effects of well-timed
neuron or circuit inactivation in animal models of disease will
rapidly reveal new principles for selecting neural circuit targets
for treatment of specific disorders. There are also implications of
the use of Halo in biotechnological scenarios, such as
high-throughput drug screening. Several proposals (and even
commercially-available systems) exist for using electrical
stimulation to activate excitable cells, thus facilitating the
screening of depolarization-gated ion channels. The discovery of
drugs that target hyperpolarization-activated channels, such as the
family of channels mediating the hyperpolarization-activated cation
currents I(h) and I(f), may be useful for identifying possible
drugs for tackling problems such as absence seizures, bradycardia,
and other disorders. An all-optical method for screening for such
drugs, which uses light of one frequency to drive inhibition, and
light of another frequency to observe changes in fluorescence of an
ion-sensitive chemical or genetically encoded sensor, may
revolutionize this process. Thus, Halo not only presents a number
of unique features that enable effective, and rapidly inducible and
reversible, inhibition to be applied to a number of neural circuit
questions, but may open up new horizons in biotechnology as
well.
[0052] An experimental hippocampal neuron culture, transfection,
and survival assay was implemented according to the following
methods. Hippocampal regions CA3-CAI of postnatal day 0 or day 1
Sprague-Dawley rats (Charles River) were isolated and treated with
trypsin (1 mglml) for 12 minutes. Digestion was stopped by Hanks
solution supplemented with 20% fetal bovine serum and trypsin
inhibitor. Tissue was dissociated with silicone-coated Pasteur
pipettes and centrifuged at 1000 rpm at 4.degree. C. for 10
minutes. Dissociated neurons were plated on glass coverslips
pre-coated with Matrigel (BD Biosciences) at a rough density of
approximately two hippocampi per 24 coverslips. Neurons were
transfected using a commercially available calcium phosphate
transfection kit (Invitrogen), at 3-5 days in vitro. GFP
fluorescence was used to identify successfully-transfected neurons,
indicating a net transfection efficiency of .about.7%. All images
and electrophysiological recordings were made on 9-15 day-in-vitro
neurons (approximately 4-10 days after transfection). Confocal
images of transfected neurons were taken with a Zeiss LSM 510
confocal microscope. Cell death count was carried out on living
cultures, seven days after transfection, by adding 4 .mu.M ethidium
homodimer-1 (Invitrogen) to the culture medium for 10 minutes at
37.degree. C., then washing the cells with Tyrode's solution (see
below). GFP-positive and negative neurons were counted for positive
and negative ethidium fluorescence, in five regions on each of
three coverslips for this viability assay.
[0053] An experiment regarding electrophysiology and optical
methods was implemented according to the following methods. Whole
cell patch clamp recording was made on 9-15 day-in-vitro neurons
using a Multiclamp 700B amplifier, connected to a Digidata 1440
digitizer (Molecular Devices) attached to a PC running pClamp 10.
During recording, neurons were bathed in Tyrode's solution
containing (in mM) 138 NaCl, 2.4 KCl, 2 CaCl, 2 MgCl, 10 HEPES, 10
Glucose, 24 sucrose, 10 .mu.M NBQX, 10 .mu.M gabazine and 50 .mu.M
D-APV. Borosilicate glass (Warner) pipettes were filled with a
solution containing (in mM) 130 K-Gluconate, 7 KCl, 2 NaCl, 1
MgCl2, 0.4 EGTA, 10 HEPES, 2 ATP-Mg, 0.3 GTP-Tris and 20 sucrose.
Pipette resistance was .about.6 M.OMEGA., and the access resistance
was 10-25 M.OMEGA., which was monitored throughout the
voltage-clamp recording. Resting membrane potential was 52-70 mV in
current-clamp recording.
[0054] Photocurrents were first measured with pairs of 1-second
long light pulses, separated by periods of darkness lasting 1
second, while holding neurons in voltage clamp at -70 mV, -30 mV
and +10 mV to assay the properties of Halo. Light-induced membrane
hyperpolarizations were induced by 1 second duration light pulses,
separated by periods of 1 second darkness, in neurons
current-clamped at resting membrane potential. Light pulse trains
were synthesized by custom software written in MATLAB (Mathworks),
and then played to the DG-4 light source through a
digital-to-analog converter on the Digidata 1440. For the
spike-blockade experiment, spikes were first induced via somatic
current injection through the patch pipette. Most of the neurons
patched easily fired action potentials with 100% probability, in
response to .about.300 pA current injections (4 ms duration). For
each neuron, injected somatic current magnitudes guaranteed 100%
firing rate of 20 spikes, at a rate of 5 Hz.
[0055] A DG-4 optical switch with 300-W xenon lamp (Sutter
Instruments) was used to deliver all light pulses, for Halo or ChR2
activation. A Texas Red filter set (Chroma, excitation 560/55,
diachronic 595LP, emission 645/75) was used to deliver yellow light
to activate Halo. The same diachroic mirror was also used to
deliver blue light, but with an excitation filter 480/40 in the
DG-4, to allow ChR2 excitation. Note that the DC595LP dichroic
mirror only reflects 35% of incident 460-500 nm light through the
objective; custom-coated dichroics that reflect light all the way
into the ultraviolet (as are available from companies such as
Chroma) would be optimal.
[0056] According to one embodiment of the present invention, the
survival replication, differentiation, or death of cells is
modulated by electrical activity from Halo. With appropriate light
pulses, Halo-expressing cells can be guided down any one of these
pathways, depending on the precise pattern of stimulation used to
drive activation of Halo. A specific electrical activity pattern
results in a specific pattern of downstream signal transduction and
in a specific cellular fate response. Therefore, targeting Halo to
specific cells, then exposing them to particular light patterns,
enables them to be optically driven towards survival,
differentiation, replication, or death. This has many potential
applications.
[0057] For example, in the case where the target cell is a stem
cell, particular patterns of activity will drive the replication or
differentiation of stem cells (including human embryonic stem
cells), or drive the death of the stem cells (in the case where
excessive replication is desired to cease). If the target cells are
tumor or cancer cells, then targeting Halo to those cells will
permit the use of specific and appropriate patterns of light to
drive activity, and thus kill the tumor or cancer cells. If the
target cells are immune cells, then silencing the cells can prevent
the calcium waves that insure cell survival, and reduce the
prevalence of autoimmune disease.
[0058] Other target cells of this kind may include secretory or
organ cells or their precursors, cardiac or other muscle cells, or
glial cells in the brain. In each of these cases, it is desirable
to control the replication, differentiation, and death of these
cells precisely. Halo will be useful for controlling these things
in vitro, in vivo in experimental animals, or in vivo in humans
(before or after transplantation into the body)--wherever light can
be delivered, such as through the skin, via small LEDs, or lasers,
or through optical fibers or thin optical endoscopes.
[0059] Screening for drugs that modulate ion channel function
(e.g., blocking or facilitating ion channel function) can be
accomplished using Halo to screen for drugs that modulate ion
channel function. One embodiment involves one or more of the
following steps:
1) stably express Halo in a cell line; 2) stably express an ion
channel of interest ("channel n") in the same cell line; 3) label
the cells with a voltage sensitive dye (or other indicator, see
below); 4) expose said cells to light, and record the fluorescence
of the voltage sensitive dye; 5) expose said cells to a candidate
compound that monitors the function of channel n; and 6) expose
said cells to light a second time, and record the fluorescence of
the voltage sensitive dye.
[0060] If the fluorescence is greater during step 6) than step 4),
then the candidate drug facilitates channel function. If the
fluorescence is smaller during step 6) than step 4), then the
candidate drug diminishes channel function. If the fluorescence is
equal in steps 4) and 6) (allowing for any bleaching of the dye),
then the drug does not affect channel function. In this way, drugs
that affect channel function can be detected extremely rapidly.
[0061] Steps 1) and 2) of the above process may take several hours
or days, but the resulting cell line then suffices for the
screening of many (perhaps millions of) drugs, which modulate
channel n. Steps 3), 4), 5), and 6) take only a few seconds each;
preferably, steps 4), 5), and 6) each take less than 1 second.
Steps 4), 5), and 6) take place in a robotic device that moves a
96- or 384-well plate into the focus of an optical beam (see the
last section for details on devices). The wells of the plate would
all contain the same cell line, in order to facilitate the
screening of drugs that affect a particular channel, or each well
would contain cells of a different cell line, in order to
facilitate the screening of one drug against many different
channels ("screening against side effects," see below).
[0062] Step 3 can include the use of a voltage-sensitive dye for
fast kinetics; however, another dye (e.g., a calcium-sensitive dye
in the case that channel n is a calcium channel) could also serve
to indicate whether channel function is modulated by the drug.
Genetically encoded indicators of voltage or calcium would also be
useful for reading out the activity of the cell (e.g., FLASH,
GCaMP2, cameleon, etc.). In this case, these indicators would be
stably expressed in the cell line as well. Other methods of reading
out whether the drug had an effect could also be useful for
supplementing this readout (e.g., immunostaining for the
phosphorylation of a site that is phosphorylated during or after
periods of ion channel activity).
[0063] Blindness and other sensory deficits affect millions of
people worldwide, severely impacting their quality of life. Halo
can be targeted to somatic cells in the human patient to provide a
type of sensory prostheses. For example, some forms of blindness
destroy photosensor function but leave signal processing in
downstream neurons intact. In such diseases, such as macular
degeneration or retinitis pigmentosa, targeting Halo to the "off"
retinal ganglion cells (e.g., by injecting viruses expressing Halo
into the retinal cell layers inside the eye) would enable
restoration of visual function. As light increases in the
environment, Halo would inhibit the "off" cells, causing increased
visual responses in the brain. In such patients treated with Halo
targeted to retinal ganglion cells, the retinal ganglion cells
would themselves become photosensitive, enabling vision with
resolution comparable to the native eye, and not requiring invasive
technology beyond that point. Halo is sufficiently sensitive to
detect sunlight (power .about.1 kW/m 2), with maximal sensitivity
in the part of the spectrum that is greatest in sunlight.
Expressing Halo in a retinal cell, accompanied with a projection
device that would amplify the ambient light, would enable vision
inside or in lowlight conditions.
[0064] Another implementation of Halo involves situations where the
central nervous system neurons in a person are infected with virus
expressing Halo (or otherwise come to express Halo). These neurons
would then be inhibitable by pulses of yellow light. This gene
therapy approach would therefore allow optical inhibition of
precise neuronal targets in the brain. If the targeted neurons are
epileptic, this would enable silencing of those cells without
needing ablative surgery. If the targeted neurons were in the
frontal cortex or other parts of the brain, these light-sensitive
neurons would permit optical modulation of emotion or cognition. If
the targeted neurons were in the spinal cord, neurons that mediate
pain stimuli could then be inhibited by light.
[0065] In general, such a gene therapy approach opens up a new kind
of generalized prosthetic in defined parts of the nervous system.
The prosthetic allows light to be converted into neural
activity.
[0066] In another instance, Halo is targeted to specific and
different parts of a cell. For example, targeting Halo to the axon
hillock using the AIS (axon initial segment) targeting sequence
allows more powerful inhibition. Fusing Halo to a targeting
sequence of DNA, so that the resultant protein contains both Halo
and the targeting peptide, allows Halo to be sent to the
presynaptic terminal, the postsynaptic terminal, the nucleus, or
other intracellular compartments. Such targeting sequences include
PDZ domains, glutamate and GABA receptor C-terminal sequences, ion
channel C-terminal sequences, presynaptic scaffolding targeting
sequences, and other targeting sequences. These versions of Halo
can then be used to trigger specific intracellular signaling
events, including those important for neuroprotection, memory, or
other enduring signaling functions.
[0067] In a combinatorial fashion, these reagents could complement
the other applications of Halo. For example, these reagents could
be useful for drug screening (e.g., finding drugs that modulate the
function of a channel in a particular subcellular compartment).
These reagents could also be useful for prosthetic devices (e.g.,
driving activity on the dendrites of a neuron, to more closely
mimic natural synaptic activity).
[0068] Various embodiments, including but not limited to those
involving drug screening, employ an optical imaging device
containing 1) a light source (LED, lamp, laser) for illuminating
the cell expressing Halo and driving a change in cell voltage, 2) a
light source for illuminating a dye or indicator, possibly the same
light source as used for driving the voltage change, and 3) a
switch for alternating between the two light sources or a
beamsplitter for simultaneous non-interfering delivery of both
kinds of light. The fluorescence of the dye or indicator would be
measured by a sensor (CCD camera, PMT, or photodiode). This kind of
device can be useful for ion channel drug screening, as described
above. The device itself consists of a robotic arm for moving a
plate (e.g., a 384-well plate) through the arena where the light
sources and sensor are present.
[0069] In one embodiment, diagnostic applications, as mentioned
herein, use a combined light source imaging device. For example,
taking cells from a patient, expressing Halo in them, and then
exposing them to light, can be used to reveal patient-specific ion
channel syndromes in biopsy samples or in cells of the circulatory
system.
[0070] For various implementations, an implantable or head-mounted
LED, or other small light source can be used. Such a light source
can be implanted under the skin, under the skull, deep within the
brain, or deep within another organ of interest, in which
Halo-expressing cells are also located (either exogenously
introduced, or endogenously located and targeted with a virus).
This device can be used for stimulating Halo in cells located
directly adjacent to the light source. A strip of LEDs, each
individually controllable, is useful. For the example of the
cortical implant, a 2-dimensional array of LEDs is useful.
[0071] For medical applications, various embodiments have LEDs that
are remotely powered. A remotely-powered LED can be made, for
example, by combining an LED in a closed-loop series circuit with
an inductor. This would allow radiofrequency (RF) energy or rapidly
changing magnetic fields (e.g., delivered by a transcranial
magnetic resonance (TMS) coil) to temporarily power-up the
inductor, and thus the connected LED, allowing local delivery of
light, even deep in a brain structure. In certain embodiments, such
a device is implanted under the skin, under the skull, deep within
the brain, or deep within another organ of interest in which
Halo-expressing cells are also located (either exogenously
introduced, or endogenously located and targeted with a virus).
Optionally, another device is used to remotely deliver RF or
magnetic energy (e.g., placed nearby or worn on the patient) for
activating the implanted device.
[0072] N. pharaonis halorhodopsin with mammalian-optimized codon
usage was synthesized as a DNA sequence according to the sequence
listing provided on the following page as Sequence Listing A.
[0073] The various embodiments described above are provided by way
of illustration only and should not be construed to limit the
invention. Based on the above discussion and illustrations, those
skilled in the art will readily recognize that various
modifications and changes may be made to the present invention
without strictly following the exemplary embodiments and
applications illustrated and described herein. For instance, such
changes may include the use of digital logic or microprocessors to
control the emitted light. Such modifications and changes do not
depart from the true spirit and scope of the present invention,
which is set forth in the following claims.
SEQUENCE LISTING A
[0074] The N. pharaonis halorhodpsin with mammalian-optimized codon
usage was synthesized according to the following DNA sequence (876
base pairs).
TABLE-US-00001 ATGACTGAGACCCTCCCACCCGTGACTGAAAGCGCCGTCGCTCTGCAAG
CAGAGGTTACCCAGCGGGAGCTGTTCGAGTTCGTCCTCAACGACCCCCT
CCTGGCTTCTAGCCTCTACATCAACATTGCTCTGGCAGGCCTGTCTATA
CTGCTGTTCGTCTTCATGACCAGGGGACTCGATGACCCTAGGGCTAAAC
TGATTGCAGTGAGCACAATTCTGGTTCCCGTGGTCTCTATCGCTTCCTA
CACTGGGCTGGCATCTGGTCTCACAATCAGTGTCCTGGAAATGCCAGCT
GGCCACTTTGCCGAAGGGAGTTCTGTCATGCTGGGAGGCGAAGAGGTCG
ATGGGGTTGTCACAATGTGGGGTCGCTACCTCACCTGGGCTCTCAGTAC
CCCCATGATCCTGCTGGCACTCGGACTCCTGGCCGGAAGTAACGCCACC
AAACTCTTCACTGCTATTACATTCGATATCGCCATGTGCGTGACCGGGC
TCGCAGCTGCCCTCACCACCAGCAGCCATCTGATGAGATGGTTTTGGTA
TGCCATCTCTTGTGCCTGCTTTCTGGTGGTGCTGTATATCCTGCTGGTG
GAGTGGGCTCAGGATGCCAAGGCTGCAGGGACAGCCGACATGTTTAATA
CACTGAAGCTGCTCACTGTGGTGATGTGGCTGGGTTACCCTATCGTTTG
GGCACTCGGCGTGGAGGGAATCGCAGTTCTGCCTGTTGGTGTGACAAGC
TGGGGCTACTCCTTCCTGGACATTGTGGCCAAGTATATTTTTGCCTTTC
TGCTGCTGAATTATCTGACTTCCAATGAGTCCGTGGTGTCCGGCTCCAT
ACTGGACGTGCCATCCGCCAGCGGCACACCTGCCGATGACTGA).
[0075] The Halo-GFP fusion protein was generated by PCR
amplification of the Halo gene with primers
5'GAATTCGCCACCATGACTGAGACCCTCCCACCCGTG and
3'GGATCCGTCATCGGCAGGTGTGCCGCTGGC and inserted into the EcoR and
BamHI cites of pEGFP-N3 (Clontech), which has the CMV promoter. The
Halo-GFP fusion protein sequence was then PCR amplified with
primers 5'CCGGTGCCACCATGACTGAGACCCTCCCACCCGTG and
3'GAATTCTTACTTGTACAGCTCGTCCATCGG and inserted into lentiviral
vector FCK(1.3)GW containing the CaMKII promoter via Agel and EcoRI
sites. All constructs were verified by sequencing. The
channelrhodopsin construct used in various experiments, FCK-hCmC,
contains the human/mammalian codon-optimized gene ChR2 fused to
fluorescent protein mCherry, under the CaMKII promoter.
Sequence CWU 1
1
51876DNAArtificial Sequencemammalian codon-optimized sequence from
Natronobacterium pharaonis 1atgactgaga ccctcccacc cgtgactgaa
agcgccgtcg ctctgcaagc agaggttacc 60cagcgggagc tgttcgagtt cgtcctcaac
gaccccctcc tggcttctag cctctacatc 120aacattgctc tggcaggcct
gtctatactg ctgttcgtct tcatgaccag gggactcgat 180gaccctaggg
ctaaactgat tgcagtgagc acaattctgg ttcccgtggt ctctatcgct
240tcctacactg ggctggcatc tggtctcaca atcagtgtcc tggaaatgcc
agctggccac 300tttgccgaag ggagttctgt catgctggga ggcgaagagg
tcgatggggt tgtcacaatg 360tggggtcgct acctcacctg ggctctcagt
acccccatga tcctgctggc actcggactc 420ctggccggaa gtaacgccac
caaactcttc actgctatta cattcgatat cgccatgtgc 480gtgaccgggc
tcgcagctgc cctcaccacc agcagccatc tgatgagatg gttttggtat
540gccatctctt gtgcctgctt tctggtggtg ctgtatatcc tgctggtgga
gtgggctcag 600gatgccaagg ctgcagggac agccgacatg tttaatacac
tgaagctgct cactgtggtg 660atgtggctgg gttaccctat cgtttgggca
ctcggcgtgg agggaatcgc agttctgcct 720gttggtgtga caagctgggg
ctactccttc ctggacattg tggccaagta tatttttgcc 780tttctgctgc
tgaattatct gacttccaat gagtccgtgg tgtccggctc catactggac
840gtgccatccg ccagcggcac acctgccgat gactga 876236DNAArtificial
Sequenceprimer 2gaattcgcca ccatgactga gaccctccca cccgtg
36330DNAArtificial Sequenceprimer 3ggatccgtca tcggcaggtg tgccgctggc
30435DNAArtificial Sequenceprimer 4ccggtgccac catgactgag accctcccac
ccgtg 35530DNAArtificial Sequenceprimer 5gaattcttac ttgtacagct
cgtccatcgg 30
* * * * *