U.S. patent application number 15/012553 was filed with the patent office on 2016-07-07 for medical composition containing stauntonia hexaphylla extract.
This patent application is currently assigned to Jeonnam Bioindustry Foundation. The applicant listed for this patent is Jeonnam Bioindustry Foundation, YUNGJIN PHARM.CO., LTD.. Invention is credited to Chul Yung CHOI, Wook Jin JANG, Hee Sook KIM, Hyun KIM, Jae Gap KIM, Sun Oh KIM, Dong Wook LEE, Gyu Ok LEE, Sang O PAN, Ka Hyon PARK, Hee Jin SEOL.
Application Number | 20160193265 15/012553 |
Document ID | / |
Family ID | 50185141 |
Filed Date | 2016-07-07 |
United States Patent
Application |
20160193265 |
Kind Code |
A1 |
CHOI; Chul Yung ; et
al. |
July 7, 2016 |
MEDICAL COMPOSITION CONTAINING STAUNTONIA HEXAPHYLLA EXTRACT
Abstract
Disclosed is an antipyretic drug comprising a Stauntonia
Hexaphylla leaf extract as an active ingredient. The antipyretic
drug is developed based on the finding that the Stauntonia
Hexaphylla leaf extract has no cytotoxicity and exhibits superior
antipyretic effects, as compared to conventional antipyretic drugs
having antipyretic effects. An antipyretic composition comprising
the Stauntonia Hexaphylla leaf extract as an active ingredient
exhibits potent antipyretic effect.
Inventors: |
CHOI; Chul Yung; (Gwangju,
KR) ; PAN; Sang O; (Gwangju, KR) ; SEOL; Hee
Jin; (Gwangju, KR) ; LEE; Gyu Ok;
(Jangheung-gun, KR) ; PARK; Ka Hyon;
(Jangheung-gun, KR) ; KIM; Hee Sook; (Goseong-gun,
KR) ; JANG; Wook Jin; (Jangheung-gun, KR) ;
KIM; Hyun; (Gwangju, KR) ; LEE; Dong Wook;
(Jangheung-gun, KR) ; KIM; Sun Oh; (Gwangju,
KR) ; KIM; Jae Gap; (Bucheon-si, KR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Jeonnam Bioindustry Foundation
YUNGJIN PHARM.CO., LTD. |
Naju-si
Seoul |
|
KR
KR |
|
|
Assignee: |
Jeonnam Bioindustry
Foundation
Naju-si
KR
YUNGJIN PHARM.CO., LTD.
Seoul
KR
|
Family ID: |
50185141 |
Appl. No.: |
15/012553 |
Filed: |
February 1, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14239521 |
Mar 19, 2014 |
|
|
|
PCT/KR2012/003867 |
May 16, 2012 |
|
|
|
15012553 |
|
|
|
|
Current U.S.
Class: |
424/774 |
Current CPC
Class: |
A61P 13/12 20180101;
A61P 17/02 20180101; A61P 27/02 20180101; A61K 8/9789 20170801;
A61P 9/10 20180101; A61P 25/00 20180101; A61P 37/00 20180101; A61P
1/18 20180101; A61P 39/00 20180101; A61P 7/10 20180101; A61P 11/08
20180101; A61P 21/00 20180101; A61P 37/06 20180101; A61P 29/02
20180101; A61P 11/00 20180101; A61P 37/08 20180101; A61P 17/00
20180101; A61P 1/04 20180101; A61P 5/14 20180101; A61P 1/16
20180101; A61P 29/00 20180101; A61Q 19/00 20130101; A61K 36/185
20130101; A61P 1/02 20180101; A61P 31/04 20180101 |
International
Class: |
A61K 36/185 20060101
A61K036/185; A61Q 19/00 20060101 A61Q019/00; A61K 8/97 20060101
A61K008/97 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 18, 2011 |
KR |
10-2011-0082023 |
Apr 16, 2012 |
KR |
10-2012-0038977 |
May 11, 2012 |
KR |
10-2012-0050532 |
Claims
1. An anti-inflammatory composition comprising a Stauntonia
Hexaphylla fraction obtained by fractionating a Stauntonia
Hexaphylla leaf water extract with ethyl acetate or chloroform as a
fractionation solvent leaf hot water extract as an active
ingredient and a pharmaceutically acceptable carrier.
2. A cosmetic composition for relieving or alleviating inflammation
comprising a Stauntonia Hexaphylla fraction obtained by
fractionating a Stauntonia Hexaphylla leaf water extract with ethyl
acetate or chloroform as a fractionation solvent as an active
ingredient and a pharmaceutically acceptable carrier.
3. An anti-pyretic composition comprising a Stauntonia Hexaphylla
fraction obtained by fractionating a Stauntonia Hexaphylla leaf
water extract with chloroform or ethyl acetate as a fractionation
solvent leaf hot water extract as an active ingredient and a
pharmaceutically acceptable carrier.
4. Method of inflammation treatment comprising administering a
composition comprising a Stauntonia Hexaphylla fraction as an
active ingredient obtained by fractionating a Stauntonia Hexaphylla
leaf water extract with ethyl acetate or chloroform as a
fractionation solvent, and a pharmaceutically acceptable
carrier.
5. Method of anti-pyretic treatment comprising administering a
composition comprising Stauntonia Hexaphylla fraction as an active
ingredient obtained by fractionating a Stauntonia Hexaphylla leaf
water extract with ethyl acetate or chloroform as a fractionation
solvent, and a pharmaceutically acceptable carrier.
Description
[0001] This application is a Continuation of copending application
Ser. No. 14/239,521 filed on Mar. 19, 2014, which is the U.S.
National Phase of PCT/KR2012/003867, filed May 16, 2012, and which
claims priority to Application No. 10-2011-0082023 filed in Korea,
on Aug. 18, 2011, Application No. 10-2012-0038977 filed in Korea,
on Apr. 16, 2012, and Application No. 10-2012-0050532 filed in
Korea, on May 11, 2012. The entire contents of all of the above
applications are hereby incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates to a composition comprising a
Stauntonia Hexaphylla extract and use of the Stauntonia Hexaphylla
extract.
[0004] 2. Description of the Related Art
[0005] An inflammatory response is an immune response which locally
occurs, when cells or tissues are damaged or broken due to various
causes, for example, exposure to harmful substances or organic
systems including external infectious agents such as bacteria,
fungi, viruses or a variety of allergens, so that the damage is
minimized and damaged sites are restored to an original state.
[0006] In addition, various causes inducing inflammation include
physical causes such as trauma, burns, frostbite and radioactivity,
chemical causes such as chemicals, for example acids, and
immunological causes such as antibody response. Furthermore,
inflammation may be caused by imbalance of vessels or hormones.
[0007] The inflammatory response is a defense mechanism which is
useful for protecting biological systems and removing substances
produced by tissue damage, and involves symptoms including
enzymatic activation caused by inflammation-mediators and
immunocytes present in local vessels or body fluids, secretion of
inflammation-mediators, infiltration of body fluids, cell
migration, tissue destruction, erythema, edema, fever, pain or the
like. Such symptoms may cause dysfunction.
[0008] In a normal case, inflammation functions to remove external
infectious agents or neutralize or remove disease factors and to
regenerate damaged tissues and thereby to restore normal structures
and functions through an in vivo inflammatory response. However, as
antigens are not continuously removed or inflammation becomes
serious over a predetermined level or chronic due to specific
endogenous substances, diseases such as hypersensitiveness or
chronic inflammation may disadvantageously propagate. Inflammatory
response is found in most clinical diseases and enzymes involved in
inflammatory response are known to play an important role in
carcinogenesis. In addition, inflammation is an obstacle in the
course of treatment such as blood transfusion, medication or organ
transplantation.
[0009] An inflammatory response is involved in various biochemical
events in vivo. In particular, inflammatory response is initiated
or controlled by inflammatory response-associated enzymes produced
by immunocytes.
[0010] As has recently been revealed, progression of in vivo
inflammatory response is known to be involved in enzymatic
activities of cyclooxygenase (COX). The COX enzyme is a main enzyme
involved in biosynthesis of prostaglandin present in biological
systems. Two iso-enzymes, i.e., COX-1 and COX-2, are known. COX-1
exists in tissues such as stomach or kidney and is responsible for
maintenance of normal homeostasis. On the other hand, COX-2 is
temporarily and rapidly expressed in cells by mitogens or cytokines
upon inflammation or other immune responses.
[0011] Another potent inflammation mediator, nitric oxide (NO), is
synthesized from L-arginine through NO synthetase (NOS) and is
produced in various types of cells in response to exterior stress
such as UV light, or substances such as endotoxins or cytokines.
Such inflammation stimuli increase expression of inducible NOS
(iNOS) in cells and induce production of NO in cells through iNOS,
thus activating macrophage cells and resulting in inflammatory
response.
[0012] Accordingly, research associated with substances inhibiting
production of NO is recently underway for efficient alleviation of
inflammation. However, anti-inflammatory substances developed
through such research have several side effects. For example,
nonsteroidal anti-inflammatory drugs used in the treatment of acute
inflammatory diseases or chronic inflammatory diseases are known to
inhibit both COX-2 enzymes and COX-1 enzymes and thus cause side
effects such as gastrointestinal disorders.
[0013] Meanwhile, cosmetics are routinely used to protect the skin
and realize beautification and cleanliness. However, cosmetic
compositions utilize ingredients indispensible for formation of
cosmetic products which are inconsistent with skin protection
application. For example, the ingredients include surfactants,
preservatives, flavorings, UV blockers, pigments and various
ingredients to impart other efficacies and effects. The ingredients
necessarily used for production of cosmetics are known to cause
side effects, such as inflammation, pimples or edema, to the
skin.
[0014] In addition, serum and sweat secreted from the body, and
fatty acids, higher alcohols and proteins as cosmetic components
are decomposed to highly toxic substances by resident flora present
in the skin, thus inducing skin inflammation. It is well-known that
UV light emitted from the sun may also induce skin
inflammation.
[0015] As such, factors causing skin side effects are always
potential in cosmetics and a variety of research has been made to
solve the factors. Substances used to date to alleviate irritation
such as erythema or edema and inflammation include non-steroid
substances such as flufenamic acid, ibuprofen, benzydamine and
indomethacin, steroid substances such as prednisolone and
dexamethasone. Allantoin, azulene, .epsilon.-aminocaproic acid,
hydrocortisone, licorice acid and derivatives thereof
.beta.-glycyrrhizinic acid, glycyrrhizinic acid derivatives) are
known to be effective in anti-inflammation.
[0016] However, indomethacin, generally used as an
anti-inflammatory agent, is unsuitable for use in cosmetics,
hydrocortisone has a limited dose, licorice acid and derivatives
thereof do not provide substantial effects due to limited
concentration upon practical application caused by difficulty in
stabilization or poor solubility. Use of most anti-inflammatory
agents known to date is limited due to problems in terms of skin
safety or stability upon cosmetic mixing.
[0017] In addition, mechanisms of therapeutic agents associated
with gastritis are primarily associated with H2-blockers which
block the second histamine receptor (H2 receptor) to reduce
secretion of gastric acid from parietal cells. The reduced gastric
acid prevents additional damage of damaged parietal cells (such as
gastric ulcers). Such H2-blockers disturb metabolisms of other
drugs, that is, potent inhibitors of P-450 in the liver, and thus
require attention when administered in combination with other
drugs. H2-blockers may cause side effects such as gynecomastia,
impotence and hypoactive sexual desire disorder may occur in men
due to exhibit anti-androgen effects. In addition, H2-blockers pass
through the placenta and cerebrovascular barriers, thus causing
more dangerous side effects to pregnant women or the elderly, and
resulting in headache, confusion, stupor or dizziness.
[0018] Accordingly, there is a need for substances which are
derived from natural substances, efficiently inhibit production of
NO, inhibit expression of iNOS and TNF-a, efficiently inhibit
activities of COX-2 enzymes, exhibit excellent anti-inflammatory
effects, and have little or no side effects or cytotoxicity and
thus have almost no limit in terms of content because they are
derived from natural substances.
[0019] In particular, at present, research and development
associated with anti-inflammatory drugs as natural medicines using
natural ingredients, or cosmetics or cosmetic components using
natural ingredients in order to satisfy consumer demands are
actively underway.
[0020] In addition, an anti-pyretic drug is a medicine which acts
to lower fever, elevated body temperature, and is also referred to
as an anti-pyretic and analgesic drug because it generally acts to
alleviate both fever and pain.
[0021] Currently believed hypothesis regarding action mechanism
associated with the anti-pyretic drug is that the anti-pyretic drug
inhibits biosynthesis of prostaglandin (PG) and thereby alleviates
fever and realizes anti-pyretic action.
[0022] Specifically, upon fever, prostaglandin levels in
thermoregulatory centers of the hypothalamus increase. For this
reason, fever activity is inhibited and anti-pyretic effect is thus
obtained by reducing prostaglandin levels in the thermoregulatory
centers. In addition, prostaglandin is a known pain-inducing
mediator. However, a variety of mechanisms associated with fever
symptoms have been suggested.
[0023] Currently prescribed anti-pyretic drugs include salicylic
acid derivatives such as aspirin, aniline derivatives such as
acetanilide and phenacetin, and pyrazolone derivatives such as
antipyrine, aminopyrine or sulpyrine. In addition, among
anti-inflammatory drugs, there are nonsteroidal anti-inflammatory
drugs having anti-pyretic and analgesic actions such as
indomethacin.
[0024] As described above, correlation between anti-pyretic and
analgesic actions and anti-inflammatory effects, that is,
inflammation-alleviating effects, is often found. However, some
drugs have no almost anti-inflammatory action, but have potent
anti-pyretic action, whereas other drugs have almost no
anti-pyretic action, but have potent anti-inflammatory effects.
Therefore, anti-inflammatory effect is determined to be not
necessarily directly related to anti-pyretic and analgesic
effects.
[0025] Accordingly, there is a need for development of substances
which are derived from natural substances, not chemicals causing
problems involved in various side effects, such as aniline agents
causing acute intoxication, exhibit superior anti-pyretic action
and have almost no risk of the side effects or cytotoxicity because
they are derived from natural substances.
[0026] In particular, at present, research and development
associated with anti-inflammatory drugs as natural medicines using
natural ingredients in order to satisfy consumer demands are
actively underway.
SUMMARY OF THE INVENTION
[0027] Therefore, the present invention has been made in view of
the above problems, and it is one object of the present invention
to provide an anti-inflammatory composition, as an active
ingredient, containing a plant extract which has a low probability
of occurrence of problems associated with side effects.
[0028] It is another object of the present invention to provide an
anti-pyretic composition containing, as an active ingredient, a
plant extract which has a low probability of occurrence of problems
associated with side effects.
[0029] In accordance with the present invention, the above and
other objects can be accomplished by the provision of an
anti-inflammatory composition comprising a Stauntonia Hexaphylla
extract as an active ingredient. The anti-inflammatory composition
may be a medical composition, for example, an anti-pyretic and
analgesic drug. In addition, the anti-inflammatory composition may
be provided as an active ingredient of a cosmetic composition for
inhibiting inflammation.
[0030] In another aspect of the present invention, provided is an
anti-inflammatory drug comprising a Stauntonia Hexaphylla extract
as an active ingredient.
[0031] In another aspect of the present invention, provided is a
cosmetic composition for relieving or alleviating inflammation,
comprising a Stauntonia Hexaphylla extract as an active
ingredient.
[0032] In another aspect of the present invention, provided is an
anti-pyretic composition comprising a Stauntonia Hexaphylla extract
as an active ingredient. The anti-pyretic composition may be a
medical composition, for example, an anti-pyretic drug or an
anti-pyretic and analgesic drug.
[0033] During research associated with naturally-derived
anti-inflammation, the inventors of the present invention found
that a Stauntonia Hexaphylla extract exhibits superior
anti-inflammatory effects. More specifically, the Stauntonia
Hexaphylla extract efficiently inhibits secretion of NO, suppresses
expression of iNOS related to production of NO, and inhibits
activities of cyclooxygenase (COX) enzymes which progress
inflammatory response associated with biosynthesis of prostaglandin
present in the body. In addition, it has been found that, among
various solvent fractions of Stauntonia Hexaphylla leaf extracts,
an ethyl acetate fraction efficiently inhibits both NO production
and COX enzyme activity, as compared to other solvent fractions, so
long as problems associated with toxicity are not generated.
[0034] In addition, during research associated with
anti-inflammatory agents derived from natural substances, the
inventors of the present invention found that a Stauntonia
Hexaphylla extract exhibits superior anti-pyretic effects. More
specifically, the Stauntonia Hexaphylla extract is found to have
remarkably superior anti-pyretic effects, whereas other plant
extracts having anti-inflammatory effects have no or almost no
anti-pyretic effects. In addition, it has been found that, among
various solvent fractions of Stauntonia Hexaphylla extracts, an
ethyl acetate fraction exhibits superior anti-pyretic effects, as
compared to other fractions, so long as problems associated with
toxicity are not generated.
[0035] Hereinafter, the prevent invention will be described in more
detail.
[0036] The present invention is directed to an anti-inflammatory
composition comprising a Stauntonia Hexaphylla extract as an active
ingredient.
[0037] Stauntonia Hexaphylla is a creeping evergreen plant of
dicotyledonous ranales Lardizabalaceae, which is also called
"Stauntonia Hexaphylla tree".
[0038] Stauntonia Hexaphylla is a monoecism. Leaves of Stauntonia
Hexaphylla are alternate phyllotaxis and palmately compound leaves
composed of five to seven small leaflets. Flowers of Stauntonia
Hexaphylla bloom in May, are yellowish white in color and are
racemous inflorescence. Fruits of Stauntonia Hexaphylla are
egg-shaped or oval berries and have a length of 5 cm to 10 cm,
ripen to reddish brown in October, and flesh thereof is more
delicious than clematis berries. Seeds of Stauntonia Hexaphylla
have an egg-like oval shape and are black in color. Stauntonia
Hexaphylla is predominantly found in Korea, Japan, Taiwan or China.
Stauntonia Hexaphylla is mainly grown in the valleys and woods in
the south regions such as Jeollanam-do, Gyeongsangnam-do and
Chungcheongnam-do in Korea.
[0039] The Stauntonia Hexaphylla extract may be produced in
accordance with a common production method of plant extracts. For
example, the Stauntonia Hexaphylla extract is produced by
extracting fruits, flowers, leaves, branches, stems, roots or peels
of Stauntonia Hexaphylla, or grains obtained by crushing these
substances (hereinafter, simply referred to as "grains") preferably
leaves of Stauntonia Hexaphylla or fruits of Stauntonia Hexaphylla,
more preferably leaves of Stauntonia Hexaphylla, with an extraction
solvent, or by extracting the same with an extraction solvent and
then fractionating the resulting crude extracts with a
fractionation solvent. Leaves of Stauntonia Hexaphylla are
harvested in a great amount as compared to other sites thereof, are
thus easy to produce and exhibit superior anti-inflammatory
effects. Accordingly, the Stauntonia Hexaphylla extract is
preferably a Stauntonia Hexaphylla leaf extract.
[0040] The extraction solvent may comprise at least one selected
from the group consisting of water and organic solvents. The
organic solvent may be a polar solvent such as alcohol having 1 to
5 carbon atoms, diluted alcohol, ethyl acetate or acetone, a
non-polar solvent such as ether, chloroform, benzene, hexane or
dichloromethane, or a mixture thereof. The alcohol having 1 to 5
carbon atoms may be methanol, ethanol, propanol, butanol,
isopropanol or the like, but the present invention is not limited
thereto. In addition, the diluted alcohol may be obtained by
diluting alcohol with water at a concentration of 50% (v/v) to
99.9% (v/v).
[0041] The extraction solvent of the Stauntonia Hexaphylla extract
preferably comprises at least one selected from the group
consisting of water, alcohols having 1 to 5 carbon atoms, diluted
alcohol and mixtures thereof, more preferably comprises at least
one selected from the group consisting of water, alcohols having 1
to 4 carbon atoms and a mixture thereof, and even more preferably
comprises water.
[0042] The extraction may be carried out 50.degree. C. to
150.degree. C., or 75.degree. C. to 130.degree. C., or 90.degree.
C. to 120.degree. C., but the present invention is not limited
thereto. In addition, the extraction time is not particularly
limited, but may be 10 minutes to 12 hours, or 30 minutes to 6
hours, or 2 hours to 4 hours.
[0043] The Stauntonia Hexaphylla extract according to the present
invention may be produced in accordance with a general method of
producing plant extracts. Specifically, the method may be hot
extraction including hot water extraction, cold-immersion
extraction, warm-immersion extraction, ultrasonic extraction or the
like and may be carried out using an ordinary extractor, ultrasonic
extractor or fractionator.
[0044] In addition, the extract extracted with a solvent may then
be subjected to fractionation using at least one solvent selected
from the group consisting of hexane, chloroform, ethyl acetate,
methylene chloride, ethyl ether, acetone, butanol, water and
mixtures thereof. The solvent used for fractionation may be a
combination of two or more types and may be used sequentially or in
combination according to the polarity of solvent to prepare
respective solvent extracts.
[0045] A fraction of the Stauntonia Hexaphylla extract is
preferably an ethyl acetate fraction or a chloroform fraction, more
preferably an ethyl acetate fraction.
[0046] The prepared extract or the fraction obtained by the
fractionation process may then be subjected to filtration,
concentration and/or drying to remove the solvent. Specifically,
the filtration may be carried out using a filter paper or vacuum
filter, the concentration may be carried out by
vacuum-concentration using a vacuum concentrator, for example, a
rotary evaporator, and the drying may be for example
freeze-drying.
[0047] The Stauntonia Hexaphylla extract, for example, a Stauntonia
Hexaphylla leaf hot water extract or a Stauntonia Hexaphylla fruit
hot water extract is found to have no cytotoxicity even when
treated at a concentration of 200 .mu.g/ml as a result of MTT
analysis.
[0048] Accordingly, the anti-inflammatory composition may be used
to inhibit inflammation, or to treat, relieve, alleviate or prevent
inflammation.
[0049] The inflammation includes general inflammatory diseases and
the inflammatory diseases for example include one or more selected
from the group consisting of various chronic inflammatory diseases,
such as various dermatitis including atopic dermatitis,
dermatomyositis, polymyositis, allergies, systemic lupus
erythematosus, pemphigus, aphthous stomatitis, retinitis,
gastritis, hepatitis, bronchitis, esophagitis, colitis,
pancreatitis, colitis, nephritis, decubitus, lupus, chronic
thyroiditis and multiple sclerosis, various acute inflammatory
diseases such as sepsis, shock, radiation injury and organ
transplant rejection, generalized edema and localized edema.
[0050] Accordingly, the anti-inflammatory composition may be used
to treat, prevent or relieve inflammatory diseases.
[0051] The allergies include anaphylaxis, allergic rhinitis,
asthma, allergic conjunctivitis, allergic dermatitis, atopic
dermatitis, contact dermatitis, urticaria, insect allergies, food
allergies and medication allergies.
[0052] The generalized edema may specifically be selected from the
group consisting of congestive heart failure, constrictive
pericarditis, restrictive cardiomyopathy, liver cirrhosis, renal
failure, nephrotic syndrome and a combination thereof. The
localized edema is a swelling of a portion of skin and soft
tissues, and specifically includes cellulitis accompanied with
inflammation of the skin and soft tissues, drainage disorders of
veins or lymphatic vessels, burns accompanied with partial loss of
the skin and soft tissues, insect bites, and bacterial
infection.
[0053] Accordingly, the anti-inflammatory composition of the
present invention may be applied as a composition for treating or
preventing inflammatory diseases, or a food composition for
treating or preventing inflammatory diseases. The food composition
is for example a health functional food composition for preventing
or relieving inflammatory diseases.
[0054] The health functional food means a group of foods having
added values provided by physical, biochemical and biotechnological
methods so that the corresponding food performs or exerts intended
functions suitable for specific applications, or a processed food
to be designed so that a composition of the food sufficiently
exhibits desired body modulation functions such as biological
defense rhythm control, and disease prevention and restoration.
[0055] The health functional food may comprise a sitologically
acceptable food auxiliary additive, and may further include a
suitable carrier, excipient and diluent commonly used for
preparation of health functional foods.
[0056] The health functional food composition for preventing or
relieving inflammatory diseases according to the present invention
may comprise the Stauntonia Hexaphylla extract in an amount of
0.001% by weight to 99.9% by weight or 0.01% by weight to 50% by
weight or 0.1% by weight to 30% by weight or 0.1% by weight to 15%
by weight, based on the total weight of the food.
[0057] The anti-inflammatory composition may be used as a drug
ingredient or for medical or pharmaceutical applications. In this
regard, the anti-inflammation composition may be a medical
composition, for example, an anti-pyretic and analgesic drug.
[0058] The anti-inflammatory composition comprising the Stauntonia
Hexaphylla extract as an active ingredient may be directly applied
to animals including humans. The animals are a family of organisms,
contrast to plants, which mainly intake organic matter as nutrients
and are differentiated into digestive, excretory and respiratory
organs, and are preferably mammals, more preferably humans.
[0059] The Stauntonia Hexaphylla extract may be used alone in the
anti-inflammatory composition and may further comprise a
pharmaceutically acceptable carrier, excipient, diluent or
adjuvant. More specifically, when the composition comprising the
Stauntonia Hexaphylla extract may be used as a drug ingredient or
for medical or pharmaceutical applications, the Stauntonia
Hexaphylla extract may be mixed with a pharmaceutically acceptable
carrier or excipient or be diluted with a diluting agent in
accordance with a general method before use.
[0060] In this case, a content of the Stauntonia Hexaphylla extract
in the composition may be 0.001% by weight to 99.9% by weight, 0.1%
by weight to 99% by weight or 1% by weight to 50% by weight, but
the present invention is not limited thereto. The content of the
extract may be controlled to a reasonable level according to usage
form and method of the composition.
[0061] Examples of the pharmaceutically acceptable carrier,
excipient or diluent include, but are not limited to, one or more
selected from the group consisting of lactose, dextrose, sucrose,
sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia
rubber, alginate, gelatin, calcium phosphate, calcium silicate,
cellulose, methyl cellulose, microcrystalline cellulose,
polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl
hydroxybenzoate, talc, magnesium stearate, mineral oil, dextrin,
calcium carbonate, propylene glycol, liquid paraffin, and
physiological saline, but any ordinary carrier, excipient or
diluent may be used without limitation to these substances. In
addition, the pharmaceutical composition may further comprise
ordinary fillers, extenders, binders, disintegrating agents,
anti-agglutinating agents, lubricating agents, wetting agents, pH
control agents, nutrients, vitamins, electrolytes, alginic acid and
salts thereof, pectic acid and salts thereof, protective colloids,
glycerin, flavoring agents, emulsifiers or preservatives. These
ingredients may be added singly or in combination to the Stauntonia
Hexaphylla extract, the active ingredient.
[0062] In addition, the composition of the present invention may
further comprise, in addition to the active ingredient, well-known
substances determined to have anti-inflammatory effects, for
example, substances used as COX-2 inhibitors, NO inhibitors or
anti-inflammatory drugs.
[0063] The composition may be administered orally or parenterally
when used as a drug ingredient and the composition may be, for
example, administered through various routes including oral,
transdermal, subcutaneous, intravenous and muscular routes.
[0064] In addition, a formulation of the composition may be varied
according to usage form and the composition may be formulated by a
method well-known in the art so that the active ingredient is
rapidly, sustained or delayed released after administration to a
mammalian animal. Generally, solid preparations for oral
administration include tablets, caplets, soft or hard capsules,
pills, powders, granules and the like. These preparations may be,
for example, prepared by mixing one or more excipients, such as
starch, calcium carbonate, sucrose, lactose and gelatin. In
addition, in addition to a simple excipient, lubricants such as
magnesium stearate or talc may also be used. Liquid preparations
for oral administration include suspensions, liquids and solutions
for internal use, emulsions, syrups and the like. The liquid
preparations may comprise various excipients, for example, wetting
agents, sweeting agents, flavoring agents and preservatives, in
addition to water and liquid paraffin which are commonly used
simple diluents.
[0065] Preparations for parenteral administration include creams,
lotions, ointments, plasters, liquids and solutions, aerosols,
fluid extracts, elixirs, infusions, sachets, patches, injections
and the like.
[0066] Furthermore, the composition of the present invention may be
formulated using a reasonable method well-known in the art to which
the present invention pertains or a method described in the
Remington's Pharmaceutical Science (recent edition, Mack Publishing
Company, Easton Pa.).
[0067] Dose of the composition may be determined in consideration
of dosage method, age and sex of takers, severity and conditions of
patients, intake of active ingredient in the body, inactivation
ratio and drugs used in conjunction therewith. The dose may be for
example 0.1 mg/kg (body weight) to 500 mg/kg (body weight), 0.1
mg/kg (body weight) to 400 mg/kg (body weight) or 1 mg/kg (body
weight) to 300 mg/kg (body weight), based on the active ingredient
per day. The composition may be administered once or in several
portions. The dose is not construed as limiting the scope of the
present invention in any aspect.
[0068] In addition, the present invention provides an
anti-inflammatory composition comprising the Stauntonia Hexaphylla
extract as an active ingredient.
[0069] In addition, the present invention provides an
anti-inflammatory drug comprising the Stauntonia Hexaphylla extract
as an active ingredient.
[0070] The Stauntonia Hexaphylla extract is preferably a Stauntonia
Hexaphylla leaf hot water extract, more preferably an ethyl acetate
fraction of a Stauntonia Hexaphylla leaf hot water extract.
[0071] The anti-inflammatory drug may comprise the active
ingredient alone and may further comprise a pharmaceutically
acceptable carrier or excipient according to formulation, usage
form and usage purpose. When the anti-inflammatory drug is provided
as a mixture, the active ingredient may be present in an amount of
0.1% by weight to 99.9% by weight, with respect to the total weight
of the anti-inflammatory drug, but is generally present in an
amount of 0.001% by weight to 50% by weight.
[0072] The anti-inflammatory drug may be used for preventing and
treating various chronic inflammatory diseases such as lupus and
multiple sclerosis, various acute inflammatory diseases such as
sepsis, shock, radiation injury and organ transplant rejection,
ophthalmologic diseases, bronchitis, or inflammatory bowel
diseases.
[0073] Examples of the carrier or excipient include, but are not
limited to, water, dextrin, calcium carbonate, lactose, propylene
glycol, liquid paraffin, physiological saline, dextrose, sucrose,
sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gelatin,
calcium phosphate, calcium silicate, cellulose, methyl cellulose,
polyvinyl pyrrolidone, methyl hydroxybenzoate, propyl
hydroxybenzoate, talc, magnesium stearate and mineral oil. The
carrier or excipient may be used in combination of two or more
types.
[0074] In addition, when the anti-inflammatory drug is provided as
a medicine, the medicine may further comprise ordinary fillers,
extenders, binders, disintegrating agents, surfactants,
anti-agglutinating agents, lubricating agents, wetting agents,
flavorings, emulsifiers, preservatives or the like.
[0075] In addition, the anti-inflammatory drug of the present
invention may further comprise, in addition to the active
ingredient, a well-known compound or plant extract having
anti-inflammatory activity, and the compound or the plant extract
may be present in an amount of 0.1 parts by weight to 99.9 parts by
weight or 0.5 parts by weight to 20 parts by weight, with respect
to 100 parts by weight of the active ingredient.
[0076] The anti-inflammatory drug may be formulated into a suitable
form determined according to usage form and in particular, may be
formulated by a method well-known in the art so that the active
ingredient is rapidly, sustained or delayed released after
administration to a mammalian animal. Specifically, examples of the
formulation include plasters, granules, lotions, liniments,
limonages, powders, syrups, eye ointments, liquids and solutions,
aerosols, extracts, elixirs, ointments, fluidextracts, emulsions,
suspensions, decoctions, infusions, eye drops, tablets,
suppositories, injections, spirits, capsules, creams, pills, soft
or hard gelatin capsules and the like.
[0077] The anti-inflammatory drug according to the present
invention may be administered orally or parenterally and may be,
for example, used through dermal, intramuscular, intraperitoneal,
intravenous, subcutaneous, nasal, epidural and oral routes. The
dose may be determined in consideration of dosage method, age, sex
and body weight of takers, severity of diseases and the like. For
example, the anti-inflammatory drug of the present invention may be
administered one or more times in a daily dose of 0.1 mg/kg (body
weight) to 100 mg/kg (body weight), based on the active ingredient.
However, the dose is provided only as an example and the present
invention is not limited thereto.
[0078] In addition, the present invention provides a cosmetic
composition comprising the Stauntonia Hexaphylla extract as an
active ingredient.
[0079] The Stauntonia Hexaphylla extract is free of both problems
associated with side effects because it is derived from a natural
substance, has no cytotoxicity, and efficiently regulates
inflammation induced by ingredients contained in cosmetics and
inflammation induced by external environments due to potent
inflammation-inhibitory effect and thus superior anti-inflammatory
and anti-irritant activities. Accordingly, the Stauntonia
Hexaphylla extract may be used as an active ingredient of the
cosmetic composition having the effects of relieving, preventing
and alleviating inflammation. In this regard, the cosmetic
composition may be a cosmetic composition for relieving or
alleviating inflammation.
[0080] The Stauntonia Hexaphylla extract is preferably a Stauntonia
Hexaphylla leaf hot water extract, more preferably an ethyl acetate
fraction of a Stauntonia Hexaphylla hot water extract.
[0081] The cosmetic composition may be utilized in applications
including skin-care cosmetics, make-up cosmetics, body cosmetics,
hair cosmetics, scalp cosmetics, shaving cosmetics or oral
cosmetics.
[0082] Examples of the skin-care cosmetics include creams, lotions,
packs, massage creams, emulsions and the like, examples of the
makeup cosmetics include foundations, makeup bases, lipsticks, eye
shadows, eyeliners, mascaras, eyebrow pencils and the like, and
examples of body cosmetics include soaps, liquid detergents, bath
preparations, sunscreen creams, sunscreen oils and the like.
Examples of the hair cosmetics include hair shampoos, conditioners,
hair treatments, hair mousse, hair liquids, pomade, hair colors,
hair bleaches, color rinses and the like, and examples of the scalp
cosmetics include hair tonics, scalp treatments or the like.
Examples of the shaving cosmetics include aftershave lotions or
shaving creams and examples of the oral cosmetics include
toothpaste, mouth washes and the like.
[0083] In addition to the active ingredient, ingredients commonly
blended with cosmetic compositions, for example, humectants, UV
absorbers, vitamins, animal and plant extracts, digesters,
whitening agents, vasodilators, astringents, refreshing agents and
hormone drugs, may be further blended with the cosmetic
composition, according to intended use and properties of the
cosmetic composition. In addition, the cosmetic composition may
further comprise a base ingredient to permeate or migrate the drug
or the active ingredient into skin tissues.
[0084] The formulation of the cosmetic composition may be provided
as a suitable form according to intended use and properties of the
cosmetic composition and examples of the formulation include
aqueous solutions, solubilizing agents, emulsions, oils, gels,
pastes, ointments, aerosols, water-oil di-layer systems or
water-oil-powder tri-layer systems. The examples of the formulation
are provided only for exemplification and are not construed as
limiting the formulation and form of the cosmetic composition of
the present invention.
[0085] The active ingredient may be present in an amount of 0.001%
by weight to 50% by weight, preferably 0.01% by weight to 20% by
weight, based on the total weight of the cosmetic composition, but
the content may be suitably controlled according to contents of
ingredients, other than the active ingredient, contained in the
formulation or the cosmetic composition, and is not construed as
limiting the content of the active ingredient according to the
present invention.
[0086] The present invention is directed to an anti-pyretic
composition comprising a Stauntonia Hexaphylla extract as an active
ingredient.
[0087] The Stauntonia Hexaphylla extract may be produced in
accordance with a common production method of plant extracts. For
example, the Stauntonia Hexaphylla extract is produced by
extracting leaves, branches, stems, roots or peels of Stauntonia
Hexaphylla, or grains obtained by crushing these substances
(hereinafter, simply referred to as "grains"), preferably leaves of
Stauntonia Hexaphylla, with an extraction solvent, or by extracting
the same with an extraction solvent and then fractionating the
resulting crude extract with a fractionation solvent.
[0088] Leaves of Stauntonia Hexaphylla are harvested in a great
amount as compared to other sites thereof, are thus easy to produce
and exhibit superior anti-inflammatory effects. Accordingly, the
Stauntonia Hexaphylla extract is preferably a Stauntonia Hexaphylla
leaf extract.
[0089] The extraction solvent may comprise at least one selected
from the group consisting of water and organic solvents. The
organic solvent may be a polar solvent such as alcohol having 1 to
5 carbon atoms, diluted alcohol, ethyl acetate or acetone, a
non-polar solvent such as ether, chloroform, benzene, hexane or
dichloromethane, or a mixture thereof.
[0090] The extraction solvent of the Stauntonia Hexaphylla extract
preferably comprises at least one selected from the group
consisting of water, alcohols having 1 to 5 carbon atoms, diluted
alcohol and mixtures thereof, more preferably comprises any one
selected from the group consisting of water, alcohols having 1 to 4
carbon atoms and a mixture thereof, and even more preferably
comprises water. The extraction may be carried out 50.degree. C. to
150.degree. C., or 75.degree. C. to 120.degree. C., or 90.degree.
C. to 115.degree. C., but the present invention is not limited
thereto. In addition, the extraction time is not particularly
limited, but may be 10 minutes to 12 hours, or 30 minutes to 8
hours, or 2 hours to 6 hours.
[0091] The Stauntonia Hexaphylla leaf extract according to the
present invention may be produced in accordance with a general
method of producing plant extracts. Specifically, the method may be
hot extraction including hot water extraction, cold-immersion
extraction, warm-immersion extraction, ultrasonic extraction or the
like and may be carried out using an ordinary extractor, ultrasonic
extractor or fractionator.
[0092] In addition, the extract extracted with a solvent may then
be subjected to fractionation using at least one solvent selected
from the group consisting of hexane, chloroform, methylene
chloride, ethyl acetate, ethyl ether, acetone, butanol, water and
mixtures thereof. The solvent used for fractionation may be a
combination of two or more types and may be used sequentially or in
combination according to the polarity of solvent to prepare
respective solvent extracts.
[0093] A fraction of the prepared Stauntonia Hexaphylla solvent
extract, specifically, a fraction of the Stauntonia Hexaphylla leaf
hot water extract is preferably an ethyl acetate fraction, a
chloroform fraction or a butanol fraction, more preferably an ethyl
acetate fraction or a chloroform fraction, even more preferably, an
ethyl acetate fraction.
[0094] The prepared extract or the fraction obtained by the
fractionation process may then be subjected to filtration,
concentration and/or drying to remove the solvent. Specifically,
the filtration may be carried out using a filter paper or vacuum
filter, the concentration may be carried out by
vacuum-concentration using a vacuum concentrator, for example, a
rotary evaporator, and the drying may be for example
freeze-drying.
[0095] The anti-pyretic composition may be used as a drug or for
medical or pharmaceutical applications. In this regard, the
anti-pyretic composition may be a medical composition, for example,
an anti-pyretic drug, or an anti-pyretic and analgesic drug.
[0096] When the anti-pyretic composition is used for medical or
pharmaceutical applications, the anti-pyretic composition may be
used for inhibiting abnormal generated heat (fever) or treating or
preventing abnormal fever accompanied by diseases.
[0097] In this regard, the present invention is directed to an
anti-pyretic composition comprising the Stauntonia Hexaphylla
extract as an active ingredient. The anti-pyretic composition
comprising the Stauntonia Hexaphylla extract, preferably, the
Stauntonia Hexaphylla leaf extract, as an active ingredient, may be
used for inhibiting, treating, relieving or preventing abnormal
fever or abnormal fever accompanied by diseases or disorders and
may be specifically an anti-pyretic and analgesic drug.
[0098] Regarding the anti-pyretic composition comprising the
Stauntonia Hexaphylla extract as an active ingredient, the
Stauntonia Hexaphylla extract is a Stauntonia Hexaphylla leaf
extract, preferably a chloroform fraction, an ethyl acetate
fraction or a butanol fraction of the Stauntonia Hexaphylla leaf
extract, more preferably, an ethyl acetate fraction or a chloroform
fraction of the Stauntonia Hexaphylla leaf extract, even more
preferably an ethyl acetate fraction of the Stauntonia Hexaphylla
leaf extract.
[0099] The abnormal fever means an abnormally high body
temperature.
[0100] The anti-pyretic drug is used to eliminate abnormal fever
and refers to a medicine used to lower an abnormally elevated body
temperature to a reasonable level. Previously reported anti-pyretic
drugs include antipyrin, antifebrin, aspirin, salipyrin and the
like. The anti-pyretic drug is also called an "anti-pyretic and
analgesic drug" because it generally has the effect of alleviating
pain.
[0101] The anti-pyretic composition comprising the Stauntonia
Hexaphylla extract as an active ingredient may be directly applied
to animals including humans. The animals are a family of organisms,
contrast to plants, which mainly intake organic matter as nutrients
and are differentiated into digestive, excretory and respiratory
organs, and are preferably mammals, more preferably humans.
[0102] The Stauntonia Hexaphylla extract may be used alone in the
anti-pyretic composition and a pharmaceutically acceptable carrier,
excipient, diluent or adjuvant may further added.
[0103] More specifically, when the composition comprising the
Stauntonia Hexaphylla extract may be used as a drug or for medical
or pharmaceutical applications, the Stauntonia Hexaphylla extract
may be mixed with a pharmaceutically acceptable carrier or
excipient or be diluted with a diluting agent in accordance with a
general method before use.
[0104] In this case, a content of the Stauntonia Hexaphylla extract
in the composition may be 0.001% by weight to 99.9% by weight, 0.1%
by weight to 99% by weight or 1% by weight to 50% by weight, but
the present invention is not limited thereto. The content of the
extract may be controlled to a reasonable level according to usage
form and method of the composition.
[0105] Examples of the pharmaceutically acceptable carrier,
excipient or diluent include, but are not limited to, one or more
selected from the group consisting of lactose, dextrose, sucrose,
sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia
rubber, alginate, gelatin, calcium phosphate, calcium silicate,
cellulose, methyl cellulose, microcrystalline cellulose,
polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl
hydroxybenzoate, talc, magnesium stearate, mineral oil, dextrin,
calcium carbonate, propylene glycol, liquid paraffin, and
physiological saline, but any ordinary carrier, excipient or
diluent may be used without limitation to these substances. The
carrier or the excipient may be used in combination of two or more
types.
[0106] In addition, the anti-pyretic composition may further
comprise ordinary fillers, extenders, binders, disintegrating
agents, anti-agglutinating agents, lubricating agents, wetting
agents, pH control agents, nutrients, vitamins, electrolytes,
alginic acid and salts thereof, pectic acid and salts thereof,
protective colloids, glycerin, flavoring agents, emulsifiers or
preservatives. These ingredients may be added singly or in
combination to the Stauntonia Hexaphylla extract, the active
ingredient.
[0107] In addition, the anti-pyretic composition may further
comprise, in addition to the active ingredient, a well-known
substance considered to have anti-pyretic effect.
[0108] In addition, the anti-pyretic drug may further comprise, in
addition to the active ingredient, a well-known compound or plant
extract considered to have anti-pyretic effect and may be present
in an amount of 0.1 parts by weight to 99.9 parts by weight or 0.5
parts by weight to 20 parts by weight, based on 100 parts by weight
of the active ingredient.
[0109] The composition may be administered orally or parenterally
when used for a drug and the composition may be, for example,
administered through various routes including oral, transdermal,
subcutaneous, intravenous and muscular routes.
[0110] In addition, a formulation of the composition may be varied
according to usage form and the composition may be formulated by a
method well-known in the art so that the active ingredient is
rapidly, sustained or delayed released after administration to a
mammalian animal.
[0111] Generally, solid preparations for oral administration
include tablets, caplets, soft or hard capsules, pills, powders,
granules and the like. These preparations may be, for example,
prepared by mixing one or more excipients, such as starch, calcium
carbonate, sucrose, lactose and gelatin. In addition, in addition
to a simple excipient, lubricants such as magnesium stearate or
talc may also be used. Liquid preparations for oral administration
include suspensions, liquids and solutions for internal use,
emulsions, syrups and the like. The liquid preparations may
comprise various excipients, for example, wetting agents, sweeting
agents, flavoring agents and preservatives, in addition to water
and liquid paraffin which are commonly used simple diluents.
[0112] Preparations for parenteral administration include creams,
lotions, ointments, plasters, liquids and solutions, aerosols,
fluid extracts, elixirs, infusions, sachets, patches, injections
and the like.
[0113] Furthermore, the composition of the present invention may be
formulated using a reasonable method well-known in the art to which
the present invention pertains or a method described in the
Remington's Pharmaceutical Science (recent edition, Mack Publishing
Company, Easton Pa.).
[0114] Dose of the composition may be determined in consideration
of dosage method, age and sex of takers, severity and conditions of
patients, intake of active ingredient in the body, inactivation
ratio and drugs used in conjunction therewith. The dose may be for
example 0.1 mg/kg (body weight) to 500 mg/kg (body weight), 0.1
mg/kg (body weight) to 400 mg/kg (body weight) or 1 mg/kg (body
weight) to 300 mg/kg (body weight), based on the active ingredient
per day. The composition may be administered once or in several
portions. The dose is not construed as limiting the scope of the
present invention in any aspect.
Advantageous Effects
[0115] The Stauntonia Hexaphylla extract of the present invention
is an edible plant-derived extract, is free of problems associated
with side effects and safety, is determined to have considerably
low cytotoxicity as a result of MTT analysis and exhibits
anti-inflammatory and anti-pyretic effects, thus being used for
medicines or cosmetics requiring anti-inflammatory effects and
medications requiring anti-pyretic effects.
BRIEF DESCRIPTION OF THE DRAWINGS
[0116] The above and other objects, features and other advantages
of the present invention will be more clearly understood from the
following detailed description taken in conjunction with the
accompanying drawings, in which:
[0117] FIG. 1 is a schematic diagram illustrating a process of
preparing a Stauntonia Hexaphylla leaf hot water extract and
solvent fractions thereof according to an embodiment of the present
invention;
[0118] FIG. 2 is a schematic diagram illustrating a process of
preparing a Stauntonia Hexaphylla fruit hot water extract and
solvent fractions thereof according to an embodiment of the present
invention;
[0119] FIG. 3 is a graph showing measurement results of
cytotoxicity of the Stauntonia Hexaphylla leaf extract using
RAW264.7 cell lines by MTT assay according to an embodiment of the
present invention, wherein + means treated with LPS (1 .mu.g/ml) or
the extract, - means non-treated, an SHL value of a horizontal axis
represents a dose (.mu.g/ml) of the Stauntonia Hexaphylla leaf hot
water extract and a vertical axis represents relative cytotoxicity
(%) as compared to a control group not-treated with any sample;
[0120] FIG. 4 is a graph showing measurement results of
cytotoxicity of the Stauntonia Hexaphylla fruit extract using
RAW264.7 cell lines by MTT assay according to an embodiment of the
present invention, wherein + means treated with LPS (1 .mu.g/ml) or
the extract, - means non-treated, an SH value of a vertical axis
represents a dose (.mu.g/ml) of the Stauntonia Hexaphylla fruit hot
water extract;
[0121] FIG. 5 is a graph showing NO secretion measured to determine
anti-inflammatory effects of the Stauntonia Hexaphylla leaf hot
water extract using RAW264.7 cell lines according to an embodiment
of the present invention, wherein + means treated together with LPS
(1 .mu.g/ml), - means non-treated with LPS (1 .mu.g/ml), an SHL
value of a horizontal axis represents a dose (.mu.g/ml) of the
Stauntonia Hexaphylla leaf hot water extract and a vertical axis
represents relative NO secretion (%) as compared to a control group
treated only with LPS;
[0122] FIG. 6 is a graph showing mRNA levels of
inflammation-associated cytokine measured to determine
anti-inflammatory effects of the Stauntonia Hexaphylla leaf hot
water extract according to an embodiment of the present invention,
wherein + means treated with LPS (1 .mu.g/ml) or a solvent
fraction, - means non-treated with any sample, and a value of a
horizontal axis represents a dose (.mu.g/ml) of the Stauntonia
Hexaphylla leaf hot water extract;
[0123] FIG. 7 is a graph showing expression of iNOS and COX-2
measured to determine anti-inflammatory effects of the Stauntonia
Hexaphylla leaf hot water extract according to an embodiment of the
present invention wherein, + means treated with LPS (1 .mu.g/ml) or
a solvent fraction, - means non-treated with any sample, and a
value of a horizontal axis represents a dose (.mu.g/ml) of the
Stauntonia Hexaphylla leaf hot water extract;
[0124] FIG. 8 is a graph showing levels of transferred mRNA of
inflammation-associated cytokines detected by RT-PCR to determine
anti-inflammatory effects of the Stauntonia Hexaphylla fruit hot
water extract according to an embodiment of the present invention
using macrophage primary cells, wherein + means treated with LPS (1
.mu.g/ml), - means non-treated with LPS (1 .mu.g/ml), an SHL value
of a horizontal axis represents a dose (.mu.g/ml) of the Stauntonia
Hexaphylla fruit hot water extract and a vertical axis represents a
type of cytokines;
[0125] FIG. 9 is a graph showing produced levels of TNF-.alpha.
among inflammation-associated cytokines to determine
anti-inflammatory effects of the Stauntonia Hexaphylla fruit hot
water extract using macrophage primary cells according to an
embodiment of the present invention, wherein + means treated
together with LPS (1 .mu.g/ml), - means non-treated with LPS, a
horizontal axis represents a dose (.mu.g/ml) of the Stauntonia
Hexaphylla fruit hot water extract and a vertical axis represents a
level of produced TNF-.alpha.;
[0126] FIG. 10 is a graph showing cytotoxicity of the Stauntonia
Hexaphylla leaf hot water extract measured by MTT assay using
RAW264.7 cell lines according to an embodiment of the present
invention, wherein + means treated with LPS (1 .mu.g/ml) or a
solvent fraction, - means not treated with any sample, values of a
horizontal axis represents doses (.mu.g/ml) of different solvent
fractions of the Stauntonia Hexaphylla leaf hot water extract and a
vertical axis represents cytotoxicity (%) as compared to a control
group not treated with any sample;
[0127] FIG. 11 is a graph showing levels of secreted NO measured to
determine anti-inflammatory effects of different solvent fractions
of the Stauntonia Hexaphylla leaf hot water extract using RAW264.7
cell lines according to an embodiment of the present invention,
wherein + means treated with LPS (1 .mu.g/ml) or the solvent
fraction, - means not treated with any sample, characters and
values of a horizontal axis represent types and doses (50 .mu.g/ml)
of different solvent fractions of the Stauntonia Hexaphylla leaf
hot water extract and a vertical axis represents relative NO
secretion (%) as compared to a control group treated only with
LPS;
[0128] FIG. 12 is a graph showing COX-2 inhibitory activity
measured based on COX-2 activity to determine anti-inflammatory
effects of the solvent fractions of the Stauntonia Hexaphylla leaf
hot water extract according to an embodiment of the present
invention, wherein solvents distinguishing different curves
represent fractionation solvents, a horizontal axis represents time
passed after treatment and a vertical axis represents COX-2
activity;
[0129] FIG. 13 is a graph showing results of alleviation of fever
induced by LPS in order to determine anti-inflammatory effects of
the Stauntonia Hexaphylla leaf hot water extract using test animals
according to an embodiment of the present invention, wherein a
value of a horizontal axis represents time (hour, h) passed after
administration with samples and a value of a vertical axis
represents a measured body temperature; and
[0130] FIG. 14 is a graph showing results of alleviation of fever
induced by LPS in order to determine anti-inflammatory effects of
the fractions of the Stauntonia Hexaphylla leaf hot water extract
according to an embodiment of the present invention using test
animals, wherein a value of a horizontal axis represent time (hour,
h) passed after administration with samples and values of a
vertical axis represent variation in body temperature changed from
a body temperature measured before sample administration, that is,
value calculated by subtracting a body temperature of a test animal
measured before sample administration from a body temperature of
the test animal measured at the corresponding time.
DETAILED DESCRIPTION OF THE INVENTION
[0131] Hereinafter, configurations and effects of the present
invention will be described in more detail with reference to
specific examples and comparative examples for better understating
of the present invention. The following examples are provided only
for clear understanding only and should not be construed as
limiting the scope and spirit of the present invention. The scope
of the present invention to be protected should be interpreted by
the claims and all technical concepts equivalent thereto fall
within the scope of the present invention to be protected.
Example 1
Preparation of Stauntonia Hexaphylla Extract and Fraction
1-1. Preparation of Stauntonia Hexaphylla Extract
[0132] A Stauntonia Hexaphylla leaf hot water extract was prepared
at 110.degree. C. using hot water and 10 kg of a Stauntonia
Hexaphylla leaf in accordance with a hot water extraction method
illustrated in FIG. 1. In addition, a Stauntonia Hexaphylla fruit
hot water extract was prepared at 100.degree. C. using 40 L of hot
water and 2,100 g of a Stauntonia Hexaphylla fruit in accordance
with a hot water extraction method described in FIG. 2.
[0133] More specifically, 200 L of distilled water was added to 10
kg of a Stauntonia Hexaphylla leaf washed with distilled water, and
hot water extraction was then performed while heating the resulting
mixture in an electric medicine boiling pot at 100.degree. C. for 3
hours. In addition, 40 L of distilled water was added to 2,100 g of
a Stauntonia Hexaphylla fruit washed with distilled water, and hot
water extraction was then performed while heating the resulting
mixture in an electric medicine boiling pot at 100.degree. C. for 3
hours.
[0134] After the extraction, each extract was filtered through a
400 mesh filter cloth and the resulting filtrate was concentrated
using a vacuum rotary concentrator. The residue left after the
filtration was extracted, filtered and concentrated under vacuum
two more times in the same manner as above using the equivalent
amount of distilled water.
[0135] The Stauntonia Hexaphylla leaf hot water extract and the
Stauntonia Hexaphylla fruit hot water extract prepared by the
process were freeze-dried using a freeze-dryer. 1 kg of the
Stauntonia Hexaphylla leaf hot water extract was obtained through
the freeze-drying. As a result, a yield obtained by the Stauntonia
Hexaphylla leaf hot water extraction was determined to be 10%. In
addition, 148 g of the Stauntonia Hexaphylla fruit hot water
extract was obtained through the freeze-drying. As a result, a
yield obtained by the Stauntonia Hexaphylla fruit hot water
extraction was determined to be 7%.
1-2. Preparation of Fractions of Stauntonia Hexaphylla Extract
[0136] Fractions of the Stauntonia Hexaphylla leaf hot water
extract and the Stauntonia Hexaphylla fruit hot water extract were
prepared in accordance with the method illustrated in FIG. 1 or
2.
[0137] Specifically, 250 g of the Stauntonia Hexaphylla leaf hot
water extract was thoroughly dissolved in 5 L of distilled water,
the resulting solution was charged in a fractionating column and 5
L of hexane was added thereto, followed by mixing and fractionation
to separate a hexane layer as a hexane-soluble layer from an
aqueous layer as a hexane-insoluble layer. The hexane layer was
collected to prepare a hexane fraction solution.
[0138] 5 L of chloroform was added to the remaining solution
(aqueous layer), followed by mixing and fractionation, to separate
a chloroform layer as a chloroform-soluble layer and an aqueous
layer as a chloroform-insoluble layer. The chloroform layer was
collected to prepare a chloroform fraction solution.
[0139] 5 L of ethyl acetate was added to the remaining solution
(aqueous layer), followed by mixing and fractionation, to separate
an ethyl acetate layer as an ethyl acetate-soluble layer and an
aqueous layer as an ethyl acetate-insoluble layer. The ethyl
acetate layer was collected to prepare an ethyl acetate fraction
solution.
[0140] 5 L of butanol was added to the remaining solution (aqueous
layer), followed by mixing and fractionation, to separate a butanol
layer as a butanol-soluble layer and an aqueous layer as a
butanol-insoluble layer. The butanol layer was collected to prepare
a butanol fraction solution.
[0141] The butanol-insoluble layer left after fractionation and
separation of the butanol-soluble layer was concentrated to remove
the remaining organic solvent, thereby preparing a water fraction
solution.
[0142] The respective fraction solutions thus obtained were
filtered in a vacuum filtration system, concentrated and
freeze-dried at -20.degree. C. to completely remove the solvents,
which were used for the present experiment. Through the process,
0.02 g of a hexane fraction (0.015%), 0.67 g of a chloroform
fraction (0.27%), 2 g of an ethyl acetate fraction (1.05%) and
68.75 g of a butanol fraction (27.5%) were obtained and used as
samples.
[0143] In the preparation process, the hexane fraction was found to
be unsuitable for use because it might cause problems associated
with industrial processes due to excessively low yield. The
obtained extracts and fractions were freeze-stored until they were
used for experiments. In addition, the butanol and water fractions
were found to have high yield, and economic efficiency and
industrial applicability were thus considered to be excellent due
to high fraction yields.
[0144] In addition, a fraction of the Stauntonia Hexaphylla fruit
hot water extract was prepared by a method including completely
dissolving 40 g of the Stauntonia Hexaphylla fruit hot water
extract in 1 L of distilled water, respectively adding 1 L of
fractionation solvents, that is, hexane, chloroform, ethyl acetate
and butanol in a fractionating column in the same manner as above,
followed by mixing and fractionation, thereby separating the
solvent-soluble layers.
[0145] The fraction solutions of the Stauntonia Hexaphylla fruit
hot water extract thus obtained were filtered in a vacuum
filtration system, concentrated and freeze-dried at -20.degree. C.
to completely remove the solvents, which were then used in the
present experiments. Through the process, 0.1 g of a hexane
fraction, 0.6 g of a chloroform fraction, 2 g of an ethyl acetate
fraction and 15 g of a butanol fraction were obtained and used as
samples.
Example 2
Cytotoxicity Test of Extracts and Fractions
[0146] To determine cytotoxicity of the Stauntonia Hexaphylla leaf
hot water extract, the Stauntonia Hexaphylla fruit hot water
extract and the Stauntonia Hexaphylla leaf hot water extract
fraction prepared in Example 1, mouse macrophage primary cells,
RAW264.7 cells available from ATCC were used.
[0147] DMEM/F12 (Dulbecco's modified Eagle's medium/Nutrient
Mixture Ham's F12), FBS (fetal bovine serum), L-glutamine and
penicillin-streptomycin used for culturing the cells were obtained
from Gibco/BRL (USA).
[0148] The RAW264.7 cells were cultured in a DMEM/F12 medium
supplemented with 10% FBS, 1% penicillin-streptomycin and 1%
L-glutamine and incubated at 37.degree. C. and at a predetermined
humidity in a CO.sub.2 incubator (5% CO.sub.2/95% air).
[0149] The cells were cultured to a confluence of about 80% on a
culture dish, and a monolayer of the cells was rinsed with PBS (pH
7.4) and then washed. Then, the cells were treated with 0.25%
trypsin and 2.56 mmol/L of EDTA and were then passage-cultured. The
cells were fed with a fresh medium every two days.
[0150] The cultured cells were seeded on a 48 well-plate at a
density of 50,000 cells/well and further cultured for 24 hours.
After 24 hours, a control group treated with only LPS, without
treating with any sample, and experimental groups treated with LPS
and solutions of the Stauntonia Hexaphylla leaf extracts and
fractions thereof obtained in Example 1 prepared at different
concentrations in DMSO which had been determined not to have any
effect on cell viability were further cultured for 24 hours, the
culture solutions were removed and the number of viable cells was
measured by MTT assay. MTT assay was performed by the following
method.
[0151] First, the cell culture medium was removed, each well was
treated with 1 mL of a DMEM/F12 medium containing 1 mg/mL of MTT
and the cells were further cultured at 37.degree. C. and a
predetermined humidity in a CO.sub.2 incubator for 4 hours. After
removing the medium, a tetrazolium bromide salt was removed,
formazan crystals produced in each well were dissolved in 200 .mu.l
of DMSO, and absorbance at a wavelength of 540 nm was measured in a
microplate reader (BIO-RAD) to determine cell viability.
[0152] Results of treatment with the Stauntonia Hexaphylla leaf
extract were expressed as means of measured values obtained by
repeating the test three times and are shown in FIG. 3. Results of
treatment with the Stauntonia Hexaphylla fruit extract were
expressed as means of measured values obtained by repeating the
test three times and are shown in FIG. 4. Results of treatment with
the fraction of the Stauntonia Hexaphylla leaf hot water extract
were expressed as means of measured values obtained by repeating
the test three times and are shown in FIG. 10.
[0153] As can be seen from FIG. 3, all groups treated with the
Stauntonia Hexaphylla leaf hot water extract prepared in Example
1-1 at different concentrations, specifically, at different
concentrations ranging from 50 .mu.g/ml to 200 .mu.g/ml, had no
effects on cell proliferation even after 24 hours, as compared to
the control group treated with only LPS, without treating with any
sample. From the results, it was determined that the Stauntonia
Hexaphylla leaf extract had no cytotoxicity at a concentration of
less than or equal to 200 .mu.g/ml.
[0154] In addition, as can be seen from FIG. 4, as a result of
comparison between groups treated with the Stauntonia Hexaphylla
fruit extract prepared in Example 1-1 at different concentrations,
specifically, at different concentrations ranging from 50 .mu.g/ml
to 200 .mu.g/ml, for 24 hours, and the control group treated with
only LPS, without treating with any sample, all treated groups had
no effects on cell proliferation. From the results, it was
determined that the Stauntonia Hexaphylla fruit extract had no
cytotoxicity at a concentration of less than or equivalent to 200
.mu.g/ml.
[0155] In addition, as can be seen from FIG. 10, in case of the
fractions of the Stauntonia Hexaphylla leaf hot water extract
prepared in Example 1-2, an experimental group treated with 25
.mu.g/ml of the hexane fraction exhibited a significant decrease in
cell viability, which demonstrated that the experimental group had
cytotoxicity. In addition, an experimental group treated with 100
.mu.g/ml of the ethyl acetate fraction exhibited an insignificant
and slight decrease in cell viability, whereas an experimental
group treated with 200 .mu.g/ml of the ethyl acetate fraction
exhibited a significant decrease in cell viability, which
demonstrated that the ethyl acetate fraction was safe at a
concentration of less than or equal to 100 .mu.g/ml. In case of
other solvent fractions, cell viability was maintained at 50
.mu.g/ml or 100 .mu.g/ml, and fractions using solvents other than
hexane, as fractionation solvents, had no cytotoxicity and were
safe, when treated with the extract at a concentration of 50
.mu.g/ml.
Example 3
Determination of Anti-Inflammatory Effect of Stauntonia Hexaphylla
Leaf Extract and Fraction Thereof
[0156] The RAW 264.7 cells cultured in Example 2 were used to
determine anti-inflammatory effect of the Stauntonia Hexaphylla
leaf extract and fractions thereof prepared in Example 1.
[0157] The cells were treated with the Stauntonia Hexaphylla leaf
hot water extract or solvent fractions thereof prepared in Example
1, together with LPS, and cultured for 24 hours in the same manner
as in Example 2. The cultured solution was centrifuged at 3,000 rpm
for 5 minutes and a supernatant was separated. The supernatant was
treated and reacted with an equal amount of Griess reagent (1%
sulfanilamide, 0.1% naphthyl-ethylene diamine dihydrochloride, 2%
phosphoric acid, Promega, USA), and NO secretion was measured at
540 nm. The results are shown in FIGS. 5 and 11.
[0158] As can be seen from FIG. 5, a control group not treated with
LPS was found to exhibit low NO secretion. On the other hand, an
experimental group treated with LPS was found to exhibit a
prominent increase in NO secretion due to inflammation induced by
LPS. In addition, in spite of treatment with LPS, groups treated
with the Stauntonia Hexaphylla leaf hot water extract prepared in
Example 1 exhibited a concentration-dependent decrease in NO
secretion. In particular, a group treated with 100 .mu.g/ml of the
Stauntonia Hexaphylla leaf hot water extract decreased NO secretion
to 80% of the control group inflammation-induced by LPS, a group
treated with 200 .mu.g/ml of the Stauntonia Hexaphylla leaf hot
water extract decreased NO secretion to about 70% of the control
group inflammation-induced by LPS, which demonstrated that the
Stauntonia Hexaphylla leaf extract had anti-inflammatory
effects.
[0159] The Stauntonia Hexaphylla leaf hot water extract had no
effect on cell survival and was thus determined to have no
cytotoxicity, when it was treated at a concentration of 200
.mu.g/ml in Example 2. Accordingly, the Stauntonia Hexaphylla leaf
extract was determined to have no cytotoxicity, be safe and exhibit
superior anti-inflammatory effect.
[0160] In addition, as can be seen from FIG. 11, the water fraction
exhibited almost no decrease in NO secretion, when treated with the
extract at a concentration of 50 .mu.g/ml which had been determined
to enable all fractions to be safe in Example 2. In addition, the
butanol fraction was found to exhibit NO secretion corresponding to
60% of the control group and was thus considered to have
anti-inflammatory effect. Meanwhile, the chloroform fraction and
the ethyl acetate fraction of the Stauntonia Hexaphylla leaf hot
water extract exhibited NO secretions which were equal to or less
than 20% of the control group. This demonstrated that the ethyl
acetate fraction and the chloroform fraction had remarkably
excellent inhibitory effect on NO production at a concentration
having no effect on cytotoxicity.
Example 4
Determination of Anti-Inflammatory Effect Through Measurement of
Inflammation-Associated Cytokine mRNA Levels
[0161] To ascertain anti-inflammatory effect of the Stauntonia
Hexaphylla leaf hot water extract which had been determined to
exhibit superior anti-inflammatory effect based on NO secretion in
Example 3 again, variation in mRNA level of inflammatory
response-associated cytokine, specifically, iNOS was ascertained
using macrophage primary cells.
[0162] In order to obtain macrophage primary cells, 32 4-week old
male mice (ICR mouse) having a body weight of 15 g to 20 g and 32
Sprague-Dawley mice were obtained from Samtako Inc. (Korea), the
respective mice were classified into 16 groups and 4 mice per group
were placed and bred. The test animals were bred at a temperature
of 20.degree. C. to 24.degree. C. and at a humidity of 60% to 70%
under the day-night illumination condition at 12-hour intervals,
and were freely fed with water and feed. The feed used herein was a
solid feed (Samyang Feed Co., Korea). The test animals were bred
under the same conditions for 7 days, adapted to laboratory
environments and used for further testing.
[0163] Macrophage primary cells (2.times.10.sup.6 cells/ml)
obtained from the test animals were cultured in a serum starvation
medium for 24 hours. After culturing, the cells were treated with
LPS (0.5 mg/ml) or LPS (0.5 mg/ml) and different concentrations of
the Stauntonia Hexaphylla leaf hot water extract and cultured for
24 hours. After 24 hours, RNA was isolated from the cultured cells.
The RNA isolation was performed by the following method.
[0164] Specifically, the cultured cells were lysed in a GIT
solution (easy BLUE Total RNA extraction kit, Intron Biotechnology
Inc., Korea), and centrifuged at room temperature at 10,000 rpm for
5 minutes, and a supernatant was discarded to obtain a pellet. 1 ml
of 0.1% DEPC solution (Sigma, USA) was added to the pellet, the
resulting mixture was centrifuged at 12,000 rpm for 2 minutes
again, and the supernatant was discarded to obtain a pellet. 0.5 ml
of guanidinium was added to the obtained pellet, followed by
vortexing. Furthermore, 0.5 ml of a
phenol/chloroform/iso-amylalcohol mix solution (25:24:1) was added
to the resulting mixture, followed by vortexing and centrifugation
at 12,000 rpm for 3 minutes to obtain a supernatant. The
supernatant was homogeneously mixed with an equal amount of
iso-propylalcohol and allowed to stand at -20.degree. C. for 30
minutes. Then, the resulting mixture was centrifuged at 12,000 rpm
for 10 minutes, the supernatant was discarded, and the pellet was
washed with a 70% aqueous ethanol solution and was dried under
vacuum to isolate RNA.
[0165] The isolated RNA was dissolved in 1 ml of a 0.1% DEPC
solution and was used to measure a content of mRNA of
inflammation-associated cytokine. The mRNA content of the
inflammation-associated cytokine, iNOS, was measured in accordance
with the following method.
[0166] Superscript II reverse transcriptase (Invitrogen, USA) was
added to 3 .mu.g of the isolated RNA, followed by incubation at
42.degree. C. for 105 minutes and then at 70.degree. C. for 15
minutes, to obtain cDNA. The obtained cDNA was quantified by
real-time PCR. Primer sequences and test conditions used for
real-time PCR are shown in the following Table 1.
TABLE-US-00001 TABLE 1 Target Annealing mRNA Primer sequence Tm
(0.degree. C.) iNOS Sense CAGAGGACCCAGAGACAAG 50.8 Anti-sense
ACCTGATGTTGCCATTGTTG
[0167] As a result of real-time PCR, an image showing comparison of
iNOS content with .beta.-actin content is shown in FIG. 6.
[0168] As shown in FIG. 6, a control group not treated with LPS did
not exhibit mRNA of inflammation-associated cytokine, iNOS, at all,
whereas a group treated only with LPS exhibited a remarkably high
level of mRNA of iNOS. In addition, a group treated with the
Stauntonia Hexaphylla leaf hot water extract prepared in Example 1,
in spite of being treated with LPS, exhibited a
concentration-dependent decrease in mRNA content of iNOS. The
concentration-dependent decrease in iNOS mRNA content upon
treatment with the Stauntonia Hexaphylla leaf hot water extract
demonstrated that the Stauntonia Hexaphylla leaf hot water extract
exhibited superior anti-inflammatory effects.
Example 5
Determination of Inhibitory Activity on Expression of
Inflammation-Associated iNOS and COX-2
[0169] To ascertain anti-inflammatory effect of the Stauntonia
Hexaphylla leaf hot water extract which had been determined to
exhibit superior anti-inflammatory effect based on NO secretion and
decrease in mRNA content of iNOS in Examples 3 and 4 again,
inhibitory activity on expression of iNOS and COX-2 was
confirmed.
[0170] Specifically, the macrophage primary cells obtained in
Example 4 were plated on a 24 well plate at a density of
1.times.10.sup.5 cells/ml controlled using a DMEM medium and
pre-incubated in a 5% CO.sub.2 incubator for 18 hours. After
pre-culturing, the cells were treated with the Stauntonia
Hexaphylla leaf hot water extract at different concentrations (0.1
.mu.g/ml, 1 .mu.g/ml, 10 .mu.g/ml, 100 .mu.g/ml and 200 .mu.g/ml),
cultured for one hour, treated with LPS (1 .mu.g/ml) and cultured
under the same conditions as the pre-culturing. After culturing for
24 hours, the cells were harvested, washed with phosphate buffered
saline (PBS) three times, dissolved in cell lysis buffer (50 mM
Tris-HCl (pH 7.5), 150 mM NaCl, 1% Nonidet P-40, 2 mM EDTA, 1 mM
EGTA, 1 mM NaVO3, 10 mM NaF, 1 mM dithiothreitol, 1 mM
phenylmethylsulfonyl fluoride, 25 .mu.g/ml aprotinin, 25 .mu.g/ml
leupeptin) at 4.degree. C. for 30 minutes, and centrifuged at
4.degree. C. and 15,000 rpm for 15 minutes to remove cell membrane
ingredients.
[0171] Protein concentration was quantified by standardizing bovine
serum albumin (BSA) and using Bio-Rad Protein Assay Kit. 20 .mu.g
of the isolated protein was loaded on a 10% mini gel SDS-PAGE, and
degenerated and separated, the protein was transferred to a
nitrocellulose membrane (BIO-RAD, Richmond, Calif., USA) at 350 mA
for one hour. The protein-transferred membrane was blocked in a
TTBS (0.1% Tween 20+TBS) solution containing 5% skim milk at room
temperature for 2 hours.
[0172] An anti-mouse iNOS (Calbiochem, La Jolla, USA) as an
antibody used to detect an amount of expressed iNOS, and an
anti-mouse COX-2 (BD Biosciences Pharmingen, SanJose, USA) as an
antibody used to detect an amount of expressed COX-2, were diluted
in TTBS solution at 1:1,000, reacted at room temperature for 2
hours and washed with TTBS three times. HRP (horse radish
peroxidase)-conjugated anti-mouse IgG (Amersham Pharmacia Biotech,
LittleChalfont, UK) as a secondary antibody was diluted at 1:5,000,
reacted at room temperature for 30 minutes, washed with TTBS three
times, and reacted with an ECL substrate (Amersham Biosciences,
Piscataway, N.J., USA) for 30 seconds and amounts of expressed iNOS
and COX-2 were measured using a chemiluminescence imaging system
(ATTO AE-9150 EZ-Capture II, Japan). Measurement results of the
expressed amounts are shown in FIG. 7.
[0173] As can be seen from FIG. 7, a control group not treated with
LPS did not exhibit inflammation-associated proteins, that is, iNOS
and COX-2, whereas a group treated only with LPS exhibited
remarkably high levels of iNOS and COX-2. In addition, a group
treated with the Stauntonia Hexaphylla leaf hot water extract
prepared in Example 1, in spite of treatment with LPS, exhibited a
concentration-dependent decrease in iNOS and COX-2 contents. The
concentration-dependent decrease in iNOS and COX-2 contents upon
treatment with the Stauntonia Hexaphylla leaf hot water extract
demonstrated that the Stauntonia Hexaphylla leaf hot water extract
exhibited superior anti-inflammatory effects.
Example 6
Determination of Anti-Inflammatory Effect Through Measurement of
Inflammation-Associated Cytokine mRNA Levels
[0174] In order to determine anti-inflammatory effect of the
Stauntonia Hexaphylla fruit hot water extract prepared in Example
1, variation in mRNA content of inflammatory response-associated
cytokine was ascertained using macrophage primary cells.
[0175] In order to obtain the macrophage primary cells, 32 4-week
male mice (ICR mouse) having a body weight of 15 g to 20 g and 32
Sprague-Dawley mice were obtained from Samtako Inc. (Korea), the
respective mice were divided into 16 groups and 4 mice per group
were placed and bred. The test animals were bred at a temperature
of 20.degree. C. to 24.degree. C. and at a humidity of 60% to 70%
under the day-night illumination condition at 12-hour intervals and
were freely fed with water and feed. The feed used herein was a
solid feed (Samyang Feed Co., Korea). The test animals were bred
under the same conditions for 7 days, adapted to laboratory
environments and used for further tests.
[0176] Macrophage primary cells (2.times.10.sup.6 cells/ml)
obtained from the test animals were cultured in a serum starvation
medium for 24 hours. After culturing, the cells were treated with
LPS (0.5 mg/ml), or LPS (0.5 mg/ml) and different concentrations of
the Stauntonia Hexaphylla leaf hot water extract and cultured for
24 hours. After 24 hours, RNA was isolated from the cultured cells.
The RNA isolation was performed by the following method.
[0177] Specifically, the cultured cells were lysed in a GIT
solution (easy BLUE Total RNA extraction kit, Intron Biotechnology
Inc., Korea), and centrifuged at room temperature at 10,000 rpm for
5 minutes, and a supernatant was discarded to obtain a pellet. 1 ml
of 0.1% DEPC solution (Sigma, USA) was added to the pellet, the
resulting mixture was centrifuged at 12,000 rpm for 2 minutes
again, and the supernatant was discarded to obtain a pellet. 0.5 ml
of guanidinium was added to the obtained pellet, followed by
vortexing. Furthermore, 0.5 ml of a
phenol/chloroform/iso-amylalcohol mix solution (25:24:1) was added
to the resulting mixture, followed by vortexing and centrifugation
at 12,000 rpm for 3 minutes to obtain a supernatant. The
supernatant was homogeneously mixed with an equal amount of
iso-propylalcohol and allowed to stand at -20.degree. C. for 30
minutes. Then, the resulting mixture was centrifuged at 12,000 rpm
for 10 minutes, the supernatant was discarded, and the pellet was
washed with a 70% aqueous ethanol solution and was dried under
vacuum to isolate RNA.
[0178] The isolated RNA was dissolved in 1 ml of a 0.1% DEPC
solution and was then used to measure a content of mRNA of
inflammation-associated cytokine. The mRNA contents of the
inflammation-associated cytokines, IL-1.beta., IFN-.gamma. and
TNF-a, were measured by the following method.
[0179] Superscript II reverse transcriptase (Invitrogen, USA) was
added to 3 .mu.g of the isolated RNA, followed by incubation at
42.degree. C. for 105 minutes and then at 70.degree. C. for 15
minutes, to obtain cDNA. The obtained cDNA was quantified by
real-time PCR. Primer sequences and test conditions used for the
real-time PCR are shown in the following Table 2.
TABLE-US-00002 TABLE 2 mRNA Annealing Target Primer sequence Tm
(0.degree. C.) TNF-a Sense GGCAGGTCTACTTTGGAGTCATTGC 62.2 Anti-
ACATTCGAGGCTCCAGTGAATTCGG sense IFN-.gamma. sense
GCGGCTGACTGAACTCAGATTGTAG 50 Anti- GTCACAGTTTTCAGCTGTATAGGG sense
IL-1.beta. Sense TGCAGAGTTCCTACATGGTCAACC 55 Anti-
GTGCTGCCTAATGTCCCCTTGAATC sense
[0180] As a result of real-time PCR, an image showing comparison of
IL-1.beta., IFN-.gamma. and TNF-a contents with .beta.-actin
content is shown in FIG. 8.
[0181] As shown in FIG. 8, a control group not treated with LPS did
not exhibit mRNAs of inflammation-associated cytokines, IL-1.beta.,
IFN-.gamma. and TNF-a, at all, whereas a group treated only with
LPS exhibited remarkably high levels of mRNAs of IL-1.beta.,
IFN-.gamma. and TNF-a IL-1.beta.. In addition, a group treated with
the Stauntonia Hexaphylla fruit hot water extract prepared in
Example 1, in spite of treatment with LPS exhibited a
concentration-dependent decrease in mRNA contents of IL-1.beta.,
IFN-.gamma. and TNF-a, in particular, a prominent decrease in mRNA
content of IL-1.beta..
Example 7
Determination of Anti-Inflammatory Effect Through Measurement of
Inflammation-Associated Cytokine, TNF-a, Level
[0182] To ascertain anti-inflammatory effects of the Stauntonia
Hexaphylla fruit hot water extract which had been determined to
exhibit superior anti-inflammatory effect based on variation in
mRNA content of inflammatory response-associated cytokine in
Example 6, again, variation in TNF-a among inflammatory
response-associated cytokine was confirmed using macrophage primary
cells.
[0183] The macrophage primary cells were obtained by breeding test
animals in the same manner as in Example 6. Macrophage primary
cells (2.times.10.sup.6 cells/ml) obtained from the test animals
were cultured in the same manner as in Example 5. Measurement of
amount of produced TNF-a was carried out using an image analysis
program (UVIband) supplied from UVITEC fluorescence imaging
systems.
[0184] Specifically, TNF-a and .beta.-actin bands separated by
agarose gel electrophoresis were image-scanned through the UVITEC
fluorescence imaging system. Volumes (intensities) of TNF-a bands
and .beta.-actin bands of a normal group, a control group induced
by LPS, and experimental groups treated with different
concentrations of the Stauntonia Hexaphylla fruit extract were
quantified from the scanned images using an image analysis program
(UVIband). TNF-a content was determined as a relative content of
TNF-a with respect to .beta.-actin expressed in the normal group
(relative %, TNF-a/.beta.-actin) and results were shown in FIG.
9.
[0185] As can be seen from FIG. 9, a control group not treated with
LPS was determined to exhibit a small level of
inflammation-associated cytokin, that is, TNF-a, whereas a group
treated only with LPS exhibited a remarkably high level of TNF-a.
In addition, a group treated with the Stauntonia Hexaphylla fruit
hot water extract prepared in Example 1, in spite of treatment with
LPS was determined to exhibit a concentration-dependent decrease in
TNF-a content.
Example 8
Determination of Inhibitory Effect of Fraction Against COX-2
(Cyclooxygenase-2)
[0186] To ascertain anti-inflammatory effect of the fraction of the
Stauntonia Hexaphylla leaf hot water extract which had been
determined to exhibit superior anti-inflammatory effect based on NO
secretion in Example 3 again, inhibitory activity against COX-2
enzyme was confirmed.
[0187] First, 5-week old Sprague-Dawley male white mice (Samtako
Inc. Korea) were adapted to laboratory environments for 7 days and
used for testing. The test animals were bred at a temperature of
20.degree. C. to 24.degree. C., at a humidity of 60% to 70% under
the day-night illumination condition at 12-hour intervals and were
freely fed with water and feed. The feed used herein was a solid
feed (Samyang Feed Co., Korea). The test animals were bred under
the same conditions for 7 days, adapted to laboratory environments
and then used for testing.
[0188] The abdomen of the test animals (SD male white mice) was
administered with 10 ml of 4% thioglycolate, and abdominal
macrophage primary cells were proliferated for 3 days and the mice
were cervically dislocated. Abdominal macrophage primary cells were
collected from the SD male white mice prepared by cervical
dislocation.
[0189] Specifically, after 10 ml of HBSS was added to the abdomen,
abdominal macrophage primary cells were collected using a syringe
and transferred to a conical tube. The abdominal macrophage primary
cells were centrifuged at 13,000 rpm for 5 minutes, washed with a
DMEM medium twice, seeded on a petri dish having a diameter of 60
mm and incubated in a CO.sub.2 cell incubator for 4 hours. After
incubation, floating cells were removed and adhered cells were
stabilized for 24 hours, then proteins were isolated from the
cells, which were further used.
[0190] The isolated proteins were treated with 50 mg/ml of the
fractions of the Stauntonia Hexaphylla leaf hot water extract
obtained in Example 1, stabilized for 30 minutes and cyclooxygenase
enzyme activity was measured using a COX fluorescent activity assay
kit (Cayman ChemicalCompany, Item No. 700200). Results of the
measured enzyme activity are shown in FIG. 12.
[0191] As can be seen from FIG. 12, the water fraction of the
Stauntonia Hexaphylla leaf hot water extract did not exhibit any
inhibitory effects, and the hexane fraction and the butanol
fraction exhibited low inhibitory activity, whereas the ethyl
acetate fraction and the chloroform fraction exhibited remarkably
superior inhibitory activity. In particular, difference in
inhibitory activity was prominent with the passage of time. In
particular, the ethyl acetate fraction of the Stauntonia Hexaphylla
leaf hot water extract exhibited the most superior COX-2 inhibitory
activity.
Example 9
Determination of Antipyretic Effects of Extracts and Fractions
9-1. Determination of Antipyretic Effect of Stauntonia Hexaphylla
Leaf Extract
[0192] Test animals were used to determine antipyretic effects of
the Stauntonia Hexaphylla leaf extract and fractions thereof
prepared in Example 1.
[0193] The test animals herein used were 5-week old Sprague-Dawley
male white mice obtained from Samtako Inc. (Korea). The test
animals were bred at a temperature of 20.degree. C. to 24.degree.
C. and at a humidity of 60% to 70% under the day-night illumination
condition at 12-hour intervals and were freely fed with water and
feed. The feed used herein was a solid feed (Samyang Feed Co.,
Korea). The test animals were bred under the same conditions for 7
days, adapted to laboratory environments and then used for
testing.
[0194] The test of fever induced by lipopolysaccharide (LPS) as a
bacterial endotoxin to ascertain antipyretic efficacy using the
test animals was carried out using a method suggested by Vilela F C
et. al (Anti-inflammatory and antipyretic effects of Sonchus
oleraceus in rats. J Ethnopharmacol. 17; 127(3):737-41(2010)).
[0195] Specifically, 5 mice were randomly selected from the test
animals and set as a first group, and 500 .mu.g/kg of
lipopolysaccharide (LPS, Sigma, USA) was intraperitoneally injected
into the mice to induce fever. Body temperature was measured as
follows. Rectal body temperature was measured using a rectal
thermometer (Portable Thermocouple Thermometer (Physitemp
Instruments, USA) and a stainless steel rectal probe for rats
(Physitemp Instruments, USA) and body temperatures of SD mice were
measured three times before the test to minimize an temperature
increase caused by temperature measurement stress.
[0196] First, in order to determine antipyretic effects of the
Stauntonia Hexaphylla leaf hot water extract, a negative control
group (LPS) not treated with any sample, a first positive control
group (APAP) orally administered with 50 mg/kg of acetaminophen
(APAP, Sigma, USA), a conventional drug, found to have antipyretic
effect, and a second positive control group (Dexamethasone) orally
administered with 1 mg/kg of dexamethasone (Sigma, USA) were
used.
[0197] First, 500 .mu.g/kg of a fever-inducing substance (LPS) was
intraperitoneally injected (i.p.) into the test animals that
finished preparations for minimization of temperature increase
caused by temperature measurement stress, and a non-treated group
(LPS), a group (SHL-200) orally administered with 200 mg/kg of the
Stauntonia Hexaphylla leaf hot water extraction, a group (APAP)
orally administered with 50 mg/kg of acetaminophen, and a group
(Dexamethasone) orally administered with 1 mg/kg of dexamethasone
were prepared according to type of test groups. In addition, 200
mg/kg of the Stauntonia Hexaphylla leaf hot water extract was
orally administered one hour after administration of the
fever-inducing substance (SHL-200 (1 h)), and rectal temperatures
were measured at one hour, 4 hours and 8 hours over 8 hours in
total after the administration of the fever-inducing substance. The
measurement results are shown in FIG. 12 and the following Table 3.
Values of the following Table 3 mean body temperatures (.degree.
C.) measured at different times.
TABLE-US-00003 TABLE 3 Normal LPS SHL 200 SHL 200(1 h)
Dexamethasone APAP 0 h 37.2 37.2 37.2 37.2 37.2 37.2 1 h 37.55 .+-.
0.21 38.2 .+-. 0.68 36.65 .+-. 0.69 38.23 .+-. 0.41 37.3 .+-. 0.52
36.58 .+-. 0.67 4 h 37.65 .+-. 0.07 37.85 .+-. 0.33 37.20 .+-. 0.45
36.95 .+-. 0.54 37.6 .+-. 0.12 37.53 .+-. 0.59 8 h 37.55 .+-. 0.07
37.6 .+-. 0.61 37.7 .+-. 0.14 37.73 .+-. 0.22 37.73 .+-. 0.13 37.78
.+-. 0.13
[0198] As can be seen from FIG. 13 and Table 3, the group
administered with the fever-inducing substance (LPS) exhibited a
sharp increase by about 1.degree. C. to 1.8.degree. C. or more,
from one hour onwards. However, the group administered with the
Stauntonia Hexaphylla leaf hot water extract (SHL-200) according to
the present invention exhibited a remarkable decrease in body
temperature. This decrease was greater than that of the group
(Dexamethasone) orally administered with 1 mg/kg of dexamethasone
and was substantially equivalent to that of the group (APAP) orally
administered with 50 mg/kg of acetaminophen generally used as an
antipyretic drug, which demonstrated that SHL-200 exhibited the
superior antipyretic effects. On 4 hours after administration,
SHL-200 did not exhibited an increase in body temperature, as
compared to the group (APAP) orally administered with 50 mg/kg of
acetaminophen, which demonstrated that SHL-200 also exhibited
superior persistence.
[0199] In addition, in case of a group (SHL-200(1 h)) orally
administered with 200 mg/kg of the Stauntonia Hexaphylla leaf hot
water extract at one hour after administration of the
fever-inducing substance (LPS), body temperature was sharply
increased like the control group and then was considerably
decreased and on 4 hours, decreased to a level, similar to the
group (APAP) orally administered with the fever-inducing substance
and 50 mg/kg of acetaminophen, which demonstrated the Stauntonia
Hexaphylla leaf hot water extract exerted effective actions even
after fever began, that is, body temperature was elevated to a
predetermined level.
9-2. Determination of Antipyretic Effect of Fraction of Stauntonia
Hexaphylla Leaf Extract
[0200] In order to determine antipyretic effects of the fraction of
the Stauntonia Hexaphylla leaf extract prepared in Example 1-2,
test animals (5-week old SD male white mice (Samtako Inc., Korea))
bred in the same manner as in Example 9-1 were used.
[0201] Like Example 9-1 to determine antipyretic efficacy using the
test animals, LPS-induced fever was carried out using a bacterial
endotoxin (Lipopolysaccharide (LPS) from E. coli 0111:B4 (Sigma,
USA)) by a method suggested by Vilela F C et. al., and body
temperature was measured using a rectal thermometer.
[0202] First, in order to determine antipyretic effects of the
Stauntonia Hexaphylla leaf hot water extract, a negative control
group (LPS) not administered with any sample, and a positive
control group (Ibuprofen) orally administered with ibuprofen
(Daewoong Pharmaceutical Co., Ltd., Korea) as a conventional drug
known to have antipyretic effect were used. In addition, a hexane
fraction (Hx), a chloroform fraction (CHCl.sub.3), an ethyl acetate
fraction (EA) and a butanol fraction (BuOH) were respectively
administered in a dose of 20 mg/kg to experimental groups.
[0203] First, rectal body temperatures of test animals were
measured three times using a body thermometer (Portable
Thermocouple Thermometer, physitemp, USA) before the test to
minimize temperature increase caused by temperature measurement
stress.
[0204] The test animals subjected to temperature measurement were
orally administered with different contents of respective samples
at 5 minutes before administration of the fever-inducing substance,
the bacterial endotoxin (LPS), after 5 minutes, 500 .mu.g/kg of the
bacterial endotoxin was intraperitoneally injected (i.p.) into the
animals, and rectal body temperature of test animals was measured
at intervals of 30 minutes for 2 hours. Measurement results are
shown in FIG. 14.
[0205] As can be seen from FIG. 14, the normal group (Normal) not
administered with any sample exhibited almost no variation in body
temperature, but the group administered with the fever-inducing
substance (LPS) exhibited a sharp increase in body temperature by
1.degree. C. or higher from 30 minutes onward after the
administration, maintained the body temperature increased by about
1.degree. C. even at one hour, and exhibited an increase in body
temperature by about 0.5.degree. C. even at 2 hours. Meanwhile,
when the group administered with the hexane fraction of the
Stauntonia Hexaphylla leaf hot water extract was small temperature
increment, but exhibited a rather high final temperature at 2
hours, as compared to the group administered with the
fever-inducing substance. The butanol fraction exhibited a small
temperature increment and an overall low body temperature increase
effect, as compared to the hexane fraction. Meanwhile, the group
administered with the chloroform fraction exhibited an increase in
body temperature in an early stage, but returned to a substantially
normal body temperature at 2 hours, which demonstrated that the
group administered with the chloroform fraction exhibited
inhibitory effect on increase in body temperature, that is,
antipyretic effect. The body temperature of the ethyl acetate
fraction returned to a normal body temperature at 1 hour, but was
lower than an initial temperature at 2 hours. This demonstrated
that the ethyl acetate fraction exhibited remarkably superior
antipyretic effect comparable to ibuprofen generally used as an
antipyretic drug and demonstrated to have antipyretic effects.
[0206] Although the preferred embodiments of the present invention
have been disclosed for illustrative purposes, those skilled in the
art will appreciate that various modifications, additions and
substitutions are possible, without departing from the scope and
spirit of the invention as disclosed in the accompanying claims.
Sequence CWU 1
1
8119DNAArtificial SequenceiNOS_Sense 1cagaggaccc agagacaag
19220DNAArtificial SequenceiNOS_Anti-sense 2acctgatgtt gccattgttg
20325DNAArtificial SequenceTNF-a_Sense 3ggcaggtcta ctttggagtc attgc
25425DNAArtificial SequenceTNF-a_Anti-sense 4acattcgagg ctccagtgaa
ttcgg 25525DNAArtificial SequenceIFN-r_Sense 5gcggctgact gaactcagat
tgtag 25624DNAArtificial SequenceIFN-r_Anti-sense 6gtcacagttt
tcagctgtat aggg 24724DNAArtificial SequenceIL-1b_Sense 7tgcagagttc
ctacatggtc aacc 24825DNAArtificial SequenceIL-1b_Anti-sense
8gtgctgccta atgtcccctt gaatc 25
* * * * *