Methods Of Predicting Toxicity

Abstract

Described herein are compounds useful for the treatment and investigation of diseases, methods for the prediction of in vivo toxicity of compounds useful for the treatment and investigation of diseases, and methods of discovering and identifying compounds useful for the treatment and investigation of diseases that have reduced in vivo toxicity.

Description

SEQUENCE LISTING

[0001] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled CORE0101USC1SEQ_ST25.txt, created Nov. 3, 2015, which is 8 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

BACKGROUND

[0002] Oligonucleotides have been used in various biological and biochemical applications. They have been used as primers and probes for the polymerase chain reaction (PCR), as antisense agents used in target validation, drug discovery and development, as ribozymes, as aptamers, and as general stimulators of the immune system. Antisense compounds have been used to modulate target nucleic acids. Antisense compounds comprising a variety of chemical modifications and motifs have been reported. In certain instances, such compounds are useful as research tools, diagnostic reagents, and as therapeutic agents. In certain instances antisense compounds have been shown to modulate protein expression by binding to a target messenger RNA (mRNA) encoding the protein. In certain instances, such binding of an antisense compound to its target mRNA results in cleavage of the mRNA. Antisense compounds that modulate processing of a pre-mRNA have also been reported. Such antisense compounds alter splicing, interfere with polyadenlyation or prevent formation of the 5'-cap of a pre-mRNA. Certain antisense compounds have undesired toxixity. See e.g., Swayze et al., "Antisense oligonucleotides containing locked nucleic acid improve potency but cause significant hepatotoxicity in animals" Nucleic Acid Research (2007) 35(2):687-700). This widespread use of antisense compounds and their vast potential as a potent therapeutic platform has led to an increased demand for rapid, inexpensive, and efficient methods to analyze and quantify the in vitro and in vivo properties of these compounds.

SUMMARY

[0003] The present disclosure provides the following non-limited numbered embodiments:

Embodiment 1

[0004] A method of predicting the in vivo toxicity of an oligomeric compound, wherein the method comprises:

[0005] contacting a cell in vitro with the oligomeric compound; and

[0006] measuring the modulation of the amount or activity of one or more off-target genes.

Embodiment 2

[0007] The method of embodiment 1, wherein the oligomeric compound comprises a gapmer oligonucleotide consisting of 10 to 30 linked nucleosides, wherein the gapmer oligonucleotide has a 5' wing region positioned at the 5' end of a deoxynucleotide gap, and a 3' wing region positioned at the 3' end of the deoxynucleotide gap.

Embodiment 3

[0008] The method of embodiment 2, wherein each of the wing regions is between about 1 to about 7 nucleotides in length.

Embodiment 4

[0009] The method of embodiment 2, wherein each of the wing regions is between about 1 to about 3 nucleotides in length.

Embodiment 5

[0010] The method of embodiment 2, wherein the deoxy gap region is between about 7 to about 18 nucleotides in length.

Embodiment 6

[0011] The method of embodiment 2, wherein the deoxy gap region is between about 11 to about 18 nucleotides in length.

Embodiment 7

[0012] The method of embodiment 2, wherein the deoxy gap region is between about 7 to about 10 nucleotides in length.

Embodiment 8

[0013] The method of any of embodiments 1 to 7, wherein the oligomeric compound comprises at least one modified nucleoside.

Embodiment 9

[0014] The method of embodiment 8, wherein the modified nucleoside is a bicylic modified nucleoside.

Embodiment 10

[0015] The method of embodiment 9, wherein the bicylic modified nucleoside is an LNA nucleoside.

Embodiment 11

[0016] The method embodiment 9, wherein the bicylic modified nucleoside is a 4'-CH.sub.2--O-2' nucleoside.

Embodiment 12

[0017] The method embodiment 9, wherein the bicylic modified nucleoside is a 4'-CH(CH.sub.3)--O-2' nucleoside.

Embodiment 13

[0018] The method of embodiment 8, wherein the modified nucleoside is a 2'-modified nucleoside.

Embodiment 14

[0019] The method of embodiment 12, wherein the 2'-modified nucleoside is substituted at the 2' position with a substituted or unsubstituted --O-alkyl or substituted or unsubstituted --O-(2-acetylamide), wherein the non-bicyclic 2'-modified nucleoside comprises a 2'-OCH.sub.3, 2'-O(CH.sub.2).sub.2OCH.sub.3, or 2'-OCH.sub.2C(O)--NR.sub.1R.sub.2, wherein R.sub.1 and R.sub.2 are independently hydrogen or substituted or unsubstituted alkyl or, in the alternative, are taken together to make a heterocyclic moiety.

Embodiment 15

[0020] The method of embodiment 1, wherein the oligomeric compound comprises a gapmer oligonucleotide consisting of 10 to 30 linked nucleosides wherein the gapmer oligonucleotide has a 5' wing region positioned at the 5' end of a deoxynucleotide gap, and a 3' wing region positioned at the 3' end of the deoxynucleotide gap, wherein at least one nucleoside of at least one of the wing regions is a 4' to 2' bicyclic nucleoside, and wherein at least one nucleoside of at least one of the wing regions is a non-bicyclic 2'-modified nucleoside.

Embodiment 16

[0021] The method of embodiment 15, wherein the 3' wing of the oligomeric compound comprises at least one 4' to 2' bicyclic nucleoside.

Embodiment 17

[0022] The method of any of embodiments 15 to 16, wherein the 5' wing of the oligomeric compound comprises at least one 4' to 2' bicyclic nucleoside.

Embodiment 18

[0023] The method of any of embodiments 15 to 16, wherein the 3' wing of the oligomeric compound comprises at least one non-bicyclic 2' modified nucleoside.

Embodiment 19

[0024] The method of any of embodiments 15 to 18, wherein the 5' wing of the oligomeric compound comprises at least one non-bicyclic 2'-modified nucleoside.

Embodiment 20

[0025] The method of embodiment 15, wherein the 3' wing of the oligomeric compound comprises at least three 4' to 2' bicyclic nucleosides.

Embodiment 21

[0026] The method of embodiment 15, wherein the 3' wing of the oligomeric compound comprises at least three non-bicyclic 2'-modified nucleosides.

Embodiment 22

[0027] The method of embodiment 15, wherein the 5' wing of the oligomeric compound comprises at least three 4' to 2' bicyclic nucleosides.

Embodiment 23

[0028] The method of embodiment 15, wherein the 5' wing of the oligomeric compound comprises at least three non-bicyclic 2'-modified nucleosides.

Embodiment 24

[0029] The method of embodiment 15, wherein the 5' wing of the oligomeric compound comprises at least three 4' to 2' bicyclic nucleosides, and wherein the 3' wing of the oligomeric compound comprises at least three non-bicyclic 2'-modified nucleosides.

Embodiment 25

[0030] The method of embodiment 15, wherein the 3' wing of the oligomeric compound comprises at least three 4' to 2' bicyclic nucleosides, and wherein the 5' wing of the oligomeric compound comprises at least three non-bicyclic 2'-modified nucleosides.

Embodiment 26

[0031] The method of any of embodiments 1 to 25, wherein the non-bicyclic 2'-modified nucleoside is substituted at the 2' position with a substituted or unsubstituted --O-alkyl or substituted or unsubstituted --O-(2-acetylamide), wherein the non-bicyclic 2'-modified nucleoside comprises a 2'-OCH.sub.3, 2'-O(CH.sub.2).sub.2OCH.sub.3, or 2'-OCH.sub.2C(O)--NR.sub.1R.sub.2, wherein R.sub.1 and R.sub.2 are independently hydrogen or substituted or unsubstituted alkyl or, in the alternative, are taken together to make a heterocyclic moiety.

Embodiment 27

[0032] The method of embodiment 26, wherein the non-bicyclic 2'-modified nucleoside is a 2'-O-methyl nucleoside.

Embodiment 28

[0033] The method of embodiment 26, wherein the non-bicyclic 2'-modified nucleoside is a 2'-O(CH.sub.2).sub.2OCH.sub.3.

Embodiment 29

[0034] The method of any of embodiments 1 to 28, wherein the oligomeric compound comprises at least one modified internucleoside linkage.

Embodiment 30

[0035] The method of any of embodiments 1 to 29, wherein at least one modified internucleoside linkage is a phosphorothioate linkage.

Embodiment 31

[0036] The method of any of embodiments 1 to 30, wherein the oligomeric compound comprises at least 3 phosphorothioate linkages.

Embodiment 32

[0037] The method of any of embodiments 1 to 31, wherein each internucleoside linkage in the oligomeric compound comprises a phosphorothioate linkage.

Embodiment 33

[0038] The oligomeric compound of any of embodiments 1 to 32, wherein each of the wing regions is between about 1 to about 7 nucleosides in length.

Embodiment 34

[0039] The oligomeric compound of any of embodiments 1 to 32, wherein each of the wing regions is between about 1 to about 3 nucleosides in length.

Embodiment 35

[0040] The method of any of embodiments 1 to 34, wherein the method of measuring modulation of the amount or activity of one or more off-target genes comprises measuring the increase in expression of one or more off-target genes and the reduction in expression of one or more off-target genes.

Embodiment 36

[0041] The method of any of embodiments 1 to 34, wherein the method of measuring modulation of the amount or activity of one or more off-target genes comprises measuring the increase in expression of one or more off-target genes.

Embodiment 37

[0042] The method of embodiment 1, wherein the method of measuring modulation of the amount or activity of one or more off-target genes comprises measuring the decrease in expression of one or more off-target genes.

Embodiment 38

[0043] The method of any of embodiments 1 to 37, wherein the off-target gene is a sentinel gene.

Embodiment 39

[0044] The method of any of embodiments 1 to 38, wherein at least one sentinel gene is selected from the group consisting of Fbx117, Fto, Gphn, Cadps2, Bcas3, Msi2, BC057079, Chn2, Tbc1d22a, Macrod1, Iqgap2, Vps13b, Atg10, Fggy, Odz3, Vps53, Cgnl1, RAPTOR, Ptprk, Vti1a, Ubac2, Fars2, Ppm1l, Adk, 0610012H03Rik, Itpr2, Sec1512///Exoc6b, Atp9b, Atxn1, Adcy9, Mcph1, Ppp3ca, Bre, Dus41, Rassf1, Mdm2, Brp16, 0610010K14Rik, Rce1, I1f2, Setd1a, and Gar1.

Embodiment 40

[0045] The method of any of embodiments 1 to 38, wherein at least two sentinel genes are selected from the group consisting of Fbx117, Fto, Gphn, Cadps2, Bcas3, Msi2, BC057079, Chn2, Tbc1d22a, Macrod1, Iqgap2, Vps13b, Atg10, Fggy, Odz3, Vps53, Cgnl1, RAPTOR, Ptprk, Vti1a, Ubac2, Fars2, Ppm1l, Adk, 0610012H03Rik, Itpr2, Sec1512///Exoc6b, Atp9b, Atxn1, Adcy9, Mcph1, Ppp3ca, Bre, Dus41, Rassf1, Mdm2, Brp16, 0610010K14Rik, Rce1, I1f2, Setd1a, and Gar1.

Embodiment 41

[0046] The method of any of embodiments 1 to 38, wherein at least three sentinel genes are selected from the group consisting of Fbx117, Fto, Gphn, Cadps2, Bcas3, Msi2, BC057079, Chn2, Tbc1d22a, Macrod1, Iqgap2, Vps13b, Atg10, Fggy, Odz3, Vps53, Cgnl1, RAPTOR, Ptprk, Vti1a, Ubac2, Fars2, Ppm1l, Adk, 0610012H03Rik, Itpr2, Sec1512///Exoc6b, Atp9b, Atxn1, Adcy9, Mcph1, Ppp3ca, Bre, Dus41, Rassf1, Mdm2, Brp16, 0610010K14Rik, Rce1, I1f2, Setd1a, and Gar1.

Embodiment 42

[0047] The method of any of embodiments 1 to 38, wherein at least four sentinel genes are selected from the group consisting of Fbx117, Fto, Gphn, Cadps2, Bcas3, Msi2, BC057079, Chn2, Tbc1d22a, Macrod1, Iqgap2, Vps13b, Atg10, Fggy, Odz3, Vps53, Cgnl1, RAPTOR, Ptprk, Vti1a, Ubac2, Fars2, Ppm1l, Adk, 0610012H03Rik, Itpr2, Sec1512///Exoc6b, Atp9b, Atxn1, Adcy9, Mcph1, Ppp3ca, Bre, Dus41, Rassf1, Mdm2, Brp16, 0610010K14Rik, Rce1, I1f2, Setd1a, and Gar1.

Embodiment 43

[0048] The method of any of embodiments 1 to 42, wherein one sentinel gene is Fbx117.

Embodiment 44

[0049] The method of any of embodiments 1 to 43, wherein one sentinel gene is Fto.

Embodiment 45

[0050] The method of any of embodiments 1 to 44, wherein one sentinel gene is Gphn.

Embodiment 46

[0051] The method of any of embodiments 1 to 45, wherein one sentinel gene is Cadps2.

Embodiment 47

[0052] The method of any of embodiments 1 to 46, wherein one sentinel gene is Bcas3.

Embodiment 48

[0053] The method of any of embodiments 1 to 47, wherein one sentinel gene is Msi2.

Embodiment 49

[0054] The method of any of embodiments 1 to 48, wherein one sentinel gene is BC057079.

Embodiment 50

[0055] The method of any of embodiments 1 to 49, wherein one sentinel gene is Chn2.

Embodiment 51

[0056] The method of any of embodiments 1 to 50, wherein one sentinel gene is Tbc1d22a.

Embodiment 52

[0057] The method of any of embodiments 1 to 51, wherein one sentinel gene is Macrod1.

Embodiment 53

[0058] The method of any of embodiments 1 to 52, wherein one sentinel gene is Iqgap2.

Embodiment 54

[0059] The method of any of embodiments 1 to 53, wherein one sentinel gene is Vps13b.

Embodiment 55

[0060] The method of any of embodiments 1 to 54, wherein one sentinel gene is Atg10.

Embodiment 56

[0061] The method of any of embodiments 1 to 55, wherein one sentinel gene is Fggy.

Embodiment 57

[0062] The method of any of embodiments 1 to 56, wherein one sentinel gene is Odz3.

Embodiment 58

[0063] The method of any of embodiments 1 to 57, wherein one sentinel gene is Vps53.

Embodiment 59

[0064] The method of any of embodiments 1 to 58, wherein one sentinel gene is Cgnl1.

Embodiment 60

[0065] The method of any of embodiments 1 to 59, wherein one sentinel gene is RAPTOR.

Embodiment 61

[0066] The method of any of embodiments 1 to 60, wherein one sentinel gene is Ptprk.

Embodiment 62

[0067] The method of any of embodiments 1 to 61, wherein one sentinel gene is Vti1a.

Embodiment 63

[0068] The method of any of embodiments 1 to 62, wherein one sentinel gene is Ubac2.

Embodiment 64

[0069] The method of any of embodiments 1 to 63, wherein one sentinel gene is Fars2.

Embodiment 65

[0070] The method of any of embodiments 1 to 64, wherein one sentinel gene is Ppm1l.

Embodiment 66

[0071] The method of any of embodiments 1 to 65, wherein one sentinel gene is Adk.

Embodiment 67

[0072] The method of any of embodiments 1 to 66, wherein one sentinel gene is 0610012H03Rik.

Embodiment 68

[0073] The method of any of embodiments 1 to 67, wherein one sentinel gene is Itpr2.

Embodiment 69

[0074] The method of any of embodiments 1 to 68, wherein one sentinel gene is Sec1512///Exoc6b.

Embodiment 70

[0075] The method of any of embodiments 1 to 69, wherein one sentinel gene is Atp9b.

Embodiment 71

[0076] The method of any of embodiments 1 to 70, wherein one sentinel gene is Atxn1.

Embodiment 72

[0077] The method of any of embodiments 1 to 71, wherein one sentinel gene is Adcy9.

Embodiment 73

[0078] The method of any of embodiments 1 to 72, wherein one sentinel gene is Mcph1.

Embodiment 74

[0079] The method of any of embodiments 1 to 73, wherein one sentinel gene is Ppp3ca.

Embodiment 75

[0080] The method of any of embodiments 1 to 74, wherein one sentinel gene is Bre.

Embodiment 76

[0081] The method of any of embodiments 1 to 38, wherein the modulation of the amount or activity of Adcy9, Ptprk, Tbc1d22a, and Exoc6b is measured.

Embodiment 77

[0082] The method of any of embodiments 1 to 38, wherein the modulation of the amount or activity of Fbx117, Fto, Gphn, and Cadps2 is measured.

Embodiment 78

[0083] The method of any of embodiments 1 to 38, wherein the modulation of the increase in expression of one or more of Dus41, Rassf1, Mdm2, Brp16, 0610010K14Rik, Rce1, I1f2, Setd1a, and Gar1 is measured.

Embodiment 79

[0084] The method of any of embodiments 1 to 38, wherein the modulation of the amount or activity of one or more of ADK, FTO, IQGAP2, PPP3CA, PTPRK, and/or RAPTOR is measured.

Embodiment 80

[0085] The method of any of embodiments 1 to 38, wherein the modulation of the amount or activity of ADK and one or more of FTO, IQGAP2, PPP3CA, PTPRK, and/or RAPTOR is measured.

Embodiment 81

[0086] The method of any of embodiments 1 to 38, wherein the modulation of the amount or activity of FTO and one or more of ADK, IQGAP2, PPP3CA, PTPRK, and/or RAPTOR is measured.

Embodiment 82

[0087] The method of any of embodiments 1 to 38, wherein the modulation of the amount or activity of IQGAP2 and one or more of ADK, FTO, PPP3CA, PTPRK, and/or RAPTOR is measured.

Embodiment 83

[0088] The method of any of embodiments 1 to 38, wherein the modulation of the amount or activity of PPP3CA and one or more of ADK, FTO, IQGAP2, PTPRK, and/or RAPTOR is measured.

Embodiment 84

[0089] The method of any of embodiments 1 to 38, wherein the modulation of the amount or activity of PPP3CA and one or more of ADK, FTO, IQGAP2, PTPRK, and/or RAPTOR is measured.

Embodiment 85

[0090] The method of any of embodiments 1 to 38, wherein the modulation of the amount or activity of PTPRK and one or more of ADK, FTO, IQGAP2, PPP3CA, and/or RAPTOR is measured.

Embodiment 86

[0091] The method of any of embodiments 1 to 38, wherein the modulation of the amount or activity of RAPTOR and one or more of ADK, FTO, IQGAP2, PPP3CA, and/or PTPRK is measured.

Embodiment 87

[0092] The method of any of embodiments 1 to 38, wherein the down-regulated sentinel gene has a pre-mRNA length of greater than 176442 nucelobases.

Embodiment 88

[0093] The method of any of embodiments 1 to 38, wherein the down-regulated sentinel gene has a pre-mRNA length of greater than 19862 nucleobases.

Embodiment 89

[0094] The method of any of embodiments 1 to 38, wherein the up-regulated sentinel gene has a pre-mRNA length of less than 19862 nucleobases.

Embodiment 90

[0095] The method of any of embodiments 1 to 38, wherein the up-regulated sentinel gene has a pre-mRNA length of less than 7673 nucleobases.

Embodiment 91

[0096] The method of any of embodiments 1 to 38, wherein the down-regulated sentinel gene has an mRNA length of greater than 3962 nucelobases.

Embodiment 92

[0097] The method of any of embodiments 1 to 38, wherein the down-regulated sentinel gene has an mRNA length of greater than 2652 nucleobases.

Embodiment 93

[0098] The method of any of embodiments 1 to 38, wherein the up-regulated sentinel gene has an mRNA length of less than 2652 nucleobases.

Embodiment 94

[0099] The method of any of embodiments 1 to 38, wherein the up-regulated sentinel gene has an mRNA length of less than 1879 nucleobases.

Embodiment 95

[0100] The method of any of embodiments 1 to 94, wherein the predicted in vivo toxicity of the oligomeric compound is predicted by measurement of hepatotoxicity.

Embodiment 96

[0101] The method of any of embodiments 1 to 94, wherein the predicted in vivo toxicity of the oligomeric compound is predicted by a change in the amount of a liver enzyme.

Embodiment 97

[0102] The method of any of embodiments 1 to 94, wherein the predicted in vivo toxicity of the oligomeric compound is predicted by measurement of ALT.

Embodiment 98

[0103] The method of any of embodiments 1 to 94, wherein the predicted in vivo toxicity of the oligomeric compound is predicted by measurement of AST.

Embodiment 99

[0104] The method of any of embodiments 1 to 94, wherein the cell contacted with the oligomeric compound in vitro is a bEnd3 cell.

Embodiment 100

[0105] An oligomeric compound identified by the method of any of embodiments 1 to 99.

Embodiment 101

[0106] A method of administering the compound of embodiment 100 to an animal.

Embodiment 102

[0107] The in vitro method of determining the in vivo toxicity of any of embodiments 1 to 100, wherein the method comprises administering the oligomeric compound to an animal.

Embodiment 103

[0108] A method of determining the in vivo toxicity of an oligomeric compound, wherein the method comprises:

[0109] contacting a cell with the oligomeric compound in vitro;

[0110] measuring modulation of the amount or activity of one or more off-target genes;

[0111] determining the in vivo toxicity of the oligomeric compound based on the level of amount or activity of the off-target genes; and

[0112] administering the oligomeric compound to an animal.

Embodiment 104

[0113] The method of embodiment 103, wherein the off-target gene is a sentinel gene.

Embodiment 105

[0114] A method of predicting the in vivo or in vitro toxicity of an oligomeric compound, wherein the method comprises: [0115] setting a minimum amount of complementarity between the nucleobase sequence of the oligomeric compound and an off-target gene; [0116] determining the amount of complementarity between the sequence of the oligomeric compound and a group of one or more off-target genes in a genome; [0117] setting a minimum number of off-target genes that have an equal to or greater amount of complementarity between the sequence of the oligomeric compound and a group of one or more off-target genes; and [0118] determining the number of off-target genes in a genome that have an equal to or greater [0119] amount of complementarity between the sequence of the oligomeric compound and a group of one or more off-target genes.

Embodiment 106

[0120] The method of embodiment 105, wherein a computer is used to determine the amount of complementarity between the sequence of the oligomeric compound and a group of one or more off-target genes.

Embodiment 107

[0121] The method of any one of embodiments 105 to 106, wherein a computer is used to determine the number of off-target genes that have an equal to or greater amount of complementarity between the sequence of the oligomeric compound and a group of one or more off-target genes.

Embodiment 108

[0122] The method of any one of embodiments 105 to 107, wherein the amount of complementarity is a measure of the number of consecutive complementary nucleobases between the oligomeric compound and a group of one or more off-target genes.

Embodiment 109

[0123] The method of any one of embodiments 105 to 108, wherein each off-target gene is a sentinel gene.

Embodiment 110

[0124] A method of identifying a sentinel gene, wherein the method comprises: [0125] administering a compound to an animal; [0126] assessing the toxicity of the compound at a timepoint after administration of the compound; [0127] measuring the degree of modulation of one or more one off-target genes; [0128] calculating the correlation between the degree of off-target gene modulation and toxicity; [0129] identifying any off-target genes having a coefficient of determination greater than 0.

Embodiment 111

[0130] The method of embodiment 110, wherein the coefficient of determination is greater than 0.5.

Embodiment 112

[0131] The method of embodiment 110, wherein the coefficient of determination is greater than 0.6.

Embodiment 113

[0132] The method of embodiment 110, wherein the coefficient of determination is greater than 0.7.

Embodiment 114

[0133] The method of embodiment 110, wherein the coefficient of determination is greater than 0.8.

Embodiment 115

[0134] The method of embodiment 110, wherein the coefficient of determination is greater than 0.9.

Embodiment 116

[0135] The method of embodiment any of embodiments 110 to 115, wherein the toxicity is assessed 24 hours after administration of the compound.

Embodiment 117

[0136] The method of any of embodiments 110 to 115, wherein the toxicity is assessed 48 hours after administration of the compound.

Embodiment 118

[0137] The method of any of embodiments 110 to 116, wherein the degree of modulation of one or more one off-target genes is greater than one-fold.

Embodiment 119

[0138] The method of any of embodiments 110 to 116, wherein the degree of modulation of one or more one off-target genes is greater than two-fold.

Embodiment 120

[0139] A method of predicting in vivo toxicity of an oligonucleotide comprising [0140] comparing the nucleobase sequence of the oligonucleotide to the nucleobase sequence of at least one sentinel gene transcript; [0141] determining whether the oligonucleotide is complementary to any regions of the at least one sentinel gene transcript; [0142] predicting whether the oligonucleotide will hybridize to the sentinel gene transcript under physiologically relevant conditions; and [0143] predicting toxicity based on the prediction of hybridization.

Embodiment 121

[0144] A method of identifying at least one antisense compound that is predicted not to be toxic in vivo comprising: [0145] identifying a set of potential antisense compounds, each having a nucleobase sequence complementary to a target nucleic acid; [0146] comparing the nucleobase sequence of each potential antisense compound to the nucleobase sequence of at least one sentinel gene transcript; [0147] identifying potential antisense compounds having a nucleobase sequence complementary to at least one sentinel gene transcript as predicted toxic antisense compounds; [0148] removing the predicted toxic compounds from the set of potential antisense compounds; [0149] identifying one or more of the remaining potential antisense compounds as predicted not to be toxic in vivo.

Embodiment 122

[0150] The method of embodiment 120 or 121, wherein the predicted toxic compounds are 100% complementary to at least one sentinel gene transcript.

Embodiment 123

[0151] The method of embodiment 122, wherein the predicted toxic compounds have not more than one mismatch relative to at least one sentinel gene transcript.

Embodiment 124

[0152] The method of embodiment 122, wherein the predicted toxic compounds have not more than two mismatches relative to at least one sentinel gene transcript.

Embodiment 125

[0153] The method of embodiment 120 or 121, wherein each potential antisense compound is compared to the nucleobase sequence of at least two sentinel gene transcripts.

Embodiment 126

[0154] The method of embodiment 120 or 121, wherein each potential antisense compound is compared to the nucleobase sequence of at least three sentinel gene transcripts.

Embodiment 127

[0155] The method of any of embodiments 120 to 126, wherein at least one sentinel gene is selected from the group consisting of Fbx117, Fto, Gphn, Cadps2, Bcas3, Msi2, BC057079, Chn2, Tbc1d22a, Macrod1, Iqgap2, Vps13b, Atg10, Fggy, Odz3, Vps53, Cgnl1, RAPTOR, Ptprk, Vti1a, Ubac2, Fars2, Ppm1l, Adk, 0610012H03Rik, Itpr2, Sec1512///Exoc6b, Atp9b, Atxn1, Adcy9, Mcph1, Ppp3ca, Bre, Dus41, Rassf1, Mdm2, Brp16, 0610010K14Rik, Rce1, I1f2, Setd1a, and Gar1.

Embodiment 128

[0156] The method of any of embodiments 1 to 127 comprising making at least one antisense compound that is predicted not to be toxic in vivo and testing it in an animal.

DETAILED DESCRIPTION

[0157] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

[0158] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference in their entirety for any purpose.

A. DEFINITIONS

[0159] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Certain such techniques and procedures may be found for example in "Carbohydrate Modifications in Antisense Research" Edited by Sangvi and Cook, American Chemical Society, Washington D.C., 1994; "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., 21.sup.st edition, 2005; and "Antisense Drug Technology, Principles, Strategies, and Applications" Edited by Stanley T. Crooke, CRC Press, Boca Raton, Fla.; and Sambrook et al., "Molecular Cloning, A laboratory Manual," 2.sup.nd Edition, Cold Spring Harbor Laboratory Press, 1989, which are hereby incorporated by reference for any purpose. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.

[0160] Unless otherwise indicated, the following terms have the following meanings:

[0161] As used herein, "nucleoside" means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.

[0162] As used herein, "chemical modification" means a chemical difference in a compound when compared to a naturally occurring counterpart. Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and internucleoside linkage modifications. In reference to an oligonucleotide, chemical modification does not include differences only in nucleobase sequence.

[0163] As used herein, "furanosyl" means a structure comprising a 5-membered ring comprising four carbon atoms and one oxygen atom.

[0164] As used herein, "naturally occurring sugar moiety" means a ribofuranosyl as found in naturally occurring RNA or a deoxyribofuranosyl as found in naturally occurring DNA.

[0165] As used herein, "sugar moiety" means a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside.

[0166] As used herein, "modified sugar moiety" means a substituted sugar moiety or a sugar surrogate.

[0167] As used herein, "substituted sugar moiety" means a furanosyl that is not a naturally occurring sugar moiety. Substituted sugar moieties include, but are not limited to furanosyls comprising substituents at the 2'-position, the 3'-position, the 5'-position and/or the 4'-position. Certain substituted sugar moieties are bicyclic sugar moieties.

[0168] As used herein, "2'-substituted sugar moiety" means a furanosyl comprising a substituent at the 2'-position other than H or OH. Unless otherwise indicated, a 2'-substituted sugar moiety is not a bicyclic sugar moiety (i.e., the 2'-substituent of a 2'-substituted sugar moiety does not form a bridge to another atom of the furanosyl ring.

[0169] As used herein, "MOE" means --OCH.sub.2CH.sub.2OCH.sub.3.

[0170] As used herein, "2'-F nucleoside" refers to a nucleoside comprising a sugar comprising fluoroine at the 2' position. Unless otherwise indicated, the fluorine in a 2'-F nucleoside is in the ribo position (replacing the OH of a natural ribose).

[0171] As used herein, "2'-(ara)-F" refers to a 2'-F substituted nucleoside, wherein the fluoro group is in the arabino position.

##STR00001##

[0172] As used herein the term "sugar surrogate" means a structure that does not comprise a furanosyl and that is capable of replacing the naturally occurring sugar moiety of a nucleoside, such that the resulting nucleoside sub-units are capable of linking together and/or linking to other nucleosides to form an oligomeric compound which is capable of hybridizing to a complementary oligomeric compound. Such structures include rings comprising a different number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings); replacement of the oxygen of a furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and a replacement of the oxygen. Such structures may also comprise substitutions corresponding to those described for substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar surrogates optionally comprising additional substituents). Sugar surrogates also include more complex sugar replacements (e.g., the non-ring systems of peptide nucleic acid). Sugar surrogates include without limitation morpholinos, cyclohexenyls and cyclohexitols.

[0173] As used herein, "bicyclic sugar moiety" means a modified sugar moiety comprising a 4 to 7 membered ring (including but not limited to a furanosyl) comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure. In certain embodiments, the 4 to 7 membered ring is a sugar ring. In certain embodiments the 4 to 7 membered ring is a furanosyl. In certain such embodiments, the bridge connects the 2'-carbon and the 4'-carbon of the furanosyl.

[0174] As used herein, "nucleotide" means a nucleoside further comprising a phosphate linking group. As used herein, "linked nucleosides" may or may not be linked by phosphate linkages and thus includes, but is not limited to "linked nucleotides." As used herein, "linked nucleosides" are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).

[0175] As used herein, "nucleobase" means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified.

[0176] As used herein the terms, "unmodified nucleobase" or "naturally occurring nucleobase" means the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).

[0177] As used herein, "modified nucleobase" means any nucleobase that is not a naturally occurring nucleobase.

[0178] As used herein, "modified nucleoside" means a nucleoside comprising at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. Modified nucleosides comprise a modified sugar moiety and/or a modified nucleobase.

[0179] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside comprising a bicyclic sugar moiety.

[0180] As used herein, "constrained ethyl nucleoside" or "cEt" means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH.sub.3)--O-2'bridge.

[0181] As used herein, "locked nucleic acid nucleoside" or "LNA" means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH.sub.2--O-2'bridge.

[0182] As used herein, "2'-substituted nucleoside" means a nucleoside comprising a substituent at the 2'-position other than H or OH. Unless otherwise indicated, a 2'-substituted nucleoside is not a bicyclic nucleoside.

[0183] As used herein, "2'-deoxynucleoside" means a nucleoside comprising 2'-H furanosyl sugar moiety, as found in naturally occurring deoxyribonucleosides (DNA). In certain embodiments, a 2'-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (e.g., uracil).

[0184] As used herein, "RNA-like nucleoside" means a modified nucleoside that adopts a northern configuration and functions like RNA when incorporated into an oligonucleotide. RNA-like nucleosides include, but are not limited to 3'-endo furanosyl nucleosides and RNA surrogates.

[0185] As used herein, "3'-endo-furanosyl nucleoside" means an RNA-like nucleoside that comprises a substituted sugar moiety that has a 3'-endo conformation. 3'-endo-furanosyl nucleosides include, but are not limited to: 2'-MOE, 2'-F, 2'-OMe, LNA, ENA, and cEt nucleosides.

[0186] As used herein, "RNA-surrogate nucleoside" means an RNA-like nucleoside that does not comprise a furanosyl. RNA-surrogate nucleosides include, but are not limited to hexitols and cyclopentanes.

[0187] As used herein, "oligonucleotide" means a compound comprising a plurality of linked nucleosides. In certain embodiments, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA) and/or one or more modified nucleosides.

[0188] As used herein "oligonucleoside" means an oligonucleotide in which none of the internucleoside linkages contains a phosphorus atom. As used herein, oligonucleotides include oligonucleosides.

[0189] As used herein, "modified oligonucleotide" means an oligonucleotide comprising at least one modified nucleoside and/or at least one modified internucleoside linkage.

[0190] As used herein "internucleoside linkage" means a covalent linkage between adjacent nucleosides in an oligonucleotide.

[0191] As used herein "naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage.

[0192] As used herein, "modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring internucleoside linkage.

[0193] As used herein, "oligomeric compound" means a polymeric structure comprising two or more sub-structures. In certain embodiments, an oligomeric compound comprises an oligonucleotide. In certain embodiments, an oligomeric compound comprises one or more conjugate groups and/or terminal groups. In certain embodiments, an oligomeric compound consists of an oligonucleotide.

[0194] As used herein, "terminal group" means one or more atom attached to either, or both, the 3' end or the 5' end of an oligonucleotide. In certain embodiments a terminal group is a conjugate group. In certain embodiments, a terminal group comprises one or more terminal group nucleosides.

[0195] As used herein, "conjugate" means an atom or group of atoms bound to an oligonucleotide or oligomeric compound. In general, conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and/or clearance properties.

[0196] As used herein, "conjugate linking group" means any atom or group of atoms used to attach a conjugate to an oligonucleotide or oligomeric compound.

[0197] As used herein, "antisense compound" means a compound comprising or consisting of an oligonucleotide at least a portion of which is complementary to a target nucleic acid to which it is capable of hybridizing, resulting in at least one antisense activity.

[0198] As used herein, "antisense activity" means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.

[0199] As used herein, "detecting" or "measuring" means that a test or assay for detecting or measuring is performed. Such detection and/or measuring may result in a value of zero. Thus, if a test for detection or measuring results in a finding of no activity (activity of zero), the step of detecting or measuring the activity has nevertheless been performed.

[0200] As used herein, "detectable and/or measurable activity" means a statistically significant activity that is not zero.

[0201] As used herein, "essentially unchanged" means little or no change in a particular parameter, particularly relative to another parameter which changes much more. In certain embodiments, a parameter is essentially unchanged when it changes less than 5%. In certain embodiments, a parameter is essentially unchanged if it changes less than two-fold while another parameter changes at least ten-fold. For example, in certain embodiments, an antisense activity is a change in the amount of a target nucleic acid. In certain such embodiments, the amount of a non-target nucleic acid is essentially unchanged if it changes much less than the target nucleic acid does, but the change need not be zero.

[0202] As used herein, "expression" means the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (e.g., splicing, polyadenlyation, addition of 5'-cap), and translation.

[0203] As used herein, "modulation" means a change of amount, activity, or quality when compared to the amount, activity, or quality prior to modulation. For example, "modulation" of a nucleic acid includes any change in the amount or activity of the nucleic acid. In certain embodiments, modulation of a nucleic acid is assessed by comparing the amount and/or activity of the nucleic acid in a sample before and after an intervention or by comparing the amount and/or activity in one sample to the amount or activity of the same gene in another sample. In certain embodiments, modulation of a nucleic acid includes, but is not limited to, a change in the amount in which expression of a certain gene in one sample is reduced (e.g. down regulated) relative to expression of the same gene in another sample. In certain embodiments, a decrease in the expression (e.g. down regulation) of a gene describes a gene which has been observed to have lower expression (e.g. lower mRNA levels), in one sample compared to another sample (e.g. a control). In certain embodiments, modulation of expression includes, but is not limited to, the amount in which expression of a certain gene in one sample is increased (e.g. up regulated) relative to expression of the same gene in another sample. In certain embodiments, an increase in the expression (up regulation) of a gene describes a gene which has been observed to have higher expression (e.g. higher mRNA levels), in one sample compared to another sample (e.g. a control).

[0204] As used herein, "activity" means performance of a function. In certain embodiments, activity of a nucleic acid includes, but is not limited to, expression of an encoded protein, modulation of expression of one or more other nucleic acids, structural functions, and any other biological activity performed by a nucleic acid.

[0205] As used herein, "amount" means amount or concentration.

[0206] As used herein, "target nucleic acid" means a nucleic acid molecule to which an antisense compound hybridizes, resulting in a desired antisense activity.

[0207] As used herein, "off-target nucleic acid" means a nucleic acid molecule other than the target nucleic acid. Because some off-target nucleic acids may share some sequence homology with a target nucleic acid, in certain instances an antisense compound may hybridize to an off-target nucleic acid. In certain embodiments, the amount, activity, or expression of an off-target nucleic acid may be modulated by an antisense compound. Such modulation may have no consequences or may result in one or more antisense activity, including but not limited to toxicity. In certain embodiments, off-target nucleic acids include, but are not limited to, off-target genes.

[0208] As used herein, "sentinel gene" means a gene, the modulation of the amount or activity of which in vitro correlates with toxicity in vivo. In certain embodiments, toxicity is hepatotoxicity. In certain embodiments, sentinel genes include, but are not limited to, off-target genes. In certain embodiments, a decrease in expression of a sentinel gene in vitro correlates with an increase in AST levels in vivo. In certain embodiments, a decrease in expression of a sentinel gene in vitro correlates with an increase in ALT levels in vivo. In certain embodiments, an increase in expression of a sentinel gene in vitro correlates with toxicity in vivo. In certain embodiments, modulation of the amount or activity of a sentinel gene in vitro correlates with in vivo toxicity with a coefficient of determination of at least 0.5. In certain embodiments, modulation of the amount or activity of a sentinel gene in vitro correlates with in vivo toxicity with a coefficient of determination of at least 0.6. In certain embodiments, modulation of the amount or activity of a sentinel gene in vitro correlates with in vivo toxicity with a coefficient of determination of at least 0.7. In certain embodiments, modulation of the amount or activity of a sentinel gene in vitro correlates with in vivo toxicity with a coefficient of determination of at least 0.8.

[0209] As used herein, "mRNA" means an RNA molecule that encodes a protein.

[0210] As used herein, "pre-mRNA" means an RNA transcript that has not been fully processed into mRNA. Pre-RNA includes one or more intron.

[0211] As used herein, "object RNA" means an RNA molecule other than a target RNA, the amount, activity, splicing, and/or function of which is modulated, either directly or indirectly, by a target nucleic acid. In certain embodiments, a target nucleic acid modulates splicing of an object RNA. In certain such embodiments, an antisense compound modulates the amount or activity of the target nucleic acid, resulting in a change in the splicing of an object RNA and ultimately resulting in a change in the activity or function of the object RNA.

[0212] As used herein, "microRNA" means a naturally occurring, small, non-coding RNA that represses gene expression of at least one mRNA. In certain embodiments, a microRNA represses gene expression by binding to a target site within a 3' untranslated region of an mRNA. In certain embodiments, a microRNA has a nucleobase sequence as set forth in miRBase, a database of published microRNA sequences found at http://microrna.sanger.ac.uk/sequences/. In certain embodiments, a microRNA has a nucleobase sequence as set forth in miRBase version 18 released November 2011, which is herein incorporated by reference in its entirety.

[0213] As used herein, "microRNA mimic" means an oligomeric compound having a sequence that is at least partially identical to that of a microRNA. In certain embodiments, a microRNA mimic comprises the microRNA seed region of a microRNA. In certain embodiments, a microRNA mimic modulates translation of more than one target nucleic acids. In certain embodiments, a microRNA mimic is double-stranded.

[0214] As used herein, "differentiating nucleobase" means a nucleobase that differs between two nucleic acids. In certain instances, a target region of a target nucleic acid differs by 1-4 nucleobases from a non-target nucleic acid. Each of those differences is referred to as a differentiating nucleobase. In certain instances, a differentiating nucleobase is a single-nucleotide polymorphism.

[0215] As used herein, "target-selective nucleoside" means a nucleoside of an antisense compound that corresponds to a differentiating nucleobase of a target nucleic acid.

[0216] As used herein, "allele" means one of a pair of copies of a gene existing at a particular locus or marker on a specific chromosome, or one member of a pair of nucleobases existing at a particular locus or marker on a specific chromosome, or one member of a pair of nucleobase sequences existing at a particular locus or marker on a specific chromosome. For a diploid organism or cell or for autosomal chromosomes, each allelic pair will normally occupy corresponding positions (loci) on a pair of homologous chromosomes, one inherited from the mother and one inherited from the father. If these alleles are identical, the organism or cell is said to be "homozygous" for that allele; if they differ, the organism or cell is said to be "heterozygous" for that allele. "Wild-type allele" refers to the genotype typically not associated with disease or dysfunction of the gene product. "Mutant allele" refers to the genotype associated with disease or dysfunction of the gene product.

[0217] As used herein, "targeting" or "targeted to" means the association of an antisense compound to a particular target nucleic acid molecule or a particular region of a target nucleic acid molecule. An antisense compound targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.

[0218] As used herein, "nucleobase complementarity" or "complementarity" when in reference to nucleobases means a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase means a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair. Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.

[0219] As used herein, "non-complementary" in reference to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another.

[0220] As used herein, "complementary" in reference to oligomeric compounds (e.g., linked nucleosides, oligonucleotides, or nucleic acids) means the capacity of such oligomeric compounds or regions thereof to hybridize to another oligomeric compound or region thereof through nucleobase complementarity under stringent conditions. Complementary oligomeric compounds need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. In certain embodiments, complementary oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary). In certain embodiments, complementary oligomeric compounds or regions are 80% complementary. In certain embodiments, complementary oligomeric compounds or regions are 90% complementary. In certain embodiments, complementary oligomeric compounds or regions are 95% complementary. In certain embodiments, complementary oligomeric compounds or regions are 100% complementary.

[0221] As used herein, "mismatch" means a nucleobase of a first oligomeric compound that is not capable of pairing with a nucleobase at a corresponding position of a second oligomeric compound, when the first and second oligomeric compound are aligned. Either or both of the first and second oligomeric compounds may be oligonucleotides.

[0222] As used herein, "hybridization" means the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0223] As used herein, "specifically hybridizes" means the ability of an oligomeric compound to hybridize to one nucleic acid site with greater affinity than it hybridizes to another nucleic acid site. In certain embodiments, an antisense oligonucleotide specifically hybridizes to more than one target site.

[0224] As used herein, "fully complementary" in reference to an oligonucleotide or portion thereof means that each nucleobase of the oligonucleotide or portion thereof is capable of pairing with a nucleobase of a complementary nucleic acid or contiguous portion thereof. Thus, a fully complementary region comprises no mismatches or unhybridized nucleobases in either strand.

[0225] As used herein, "percent complementarity" means the percentage of nucleobases of an oligomeric compound that are complementary to an equal-length portion of a target nucleic acid. Percent complementarity is calculated by dividing the number of nucleobases of the oligomeric compound that are complementary to nucleobases at corresponding positions in the target nucleic acid by the total length of the oligomeric compound.

[0226] As used herein, "percent identity" means the number of nucleobases in a first nucleic acid that are the same type (independent of chemical modification) as nucleobases at corresponding positions in a second nucleic acid, divided by the total number of nucleobases in the first nucleic acid.

[0227] As used herein, "modification motif" means a pattern of chemical modifications in an oligomeric compound or a region thereof. Motifs may be defined by modifications at certain nucleosides and/or at certain linking groups of an oligomeric compound.

[0228] As used herein, "nucleoside motif" means a pattern of nucleoside modifications in an oligomeric compound or a region thereof. The linkages of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only nucleosides are intended to be nucleoside motifs. Thus, in such instances, the linkages are not limited.

[0229] As used herein, "sugar motif" means a pattern of sugar modifications in an oligomeric compound or a region thereof.

[0230] As used herein, "linkage motif" means a pattern of linkage modifications in an oligomeric compound or region thereof. The nucleosides of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only linkages are intended to be linkage motifs. Thus, in such instances, the nucleosides are not limited.

[0231] As used herein, "nucleobase modification motif" means a pattern of modifications to nucleobases along an oligonucleotide. Unless otherwise indicated, a nucleobase modification motif is independent of the nucleobase sequence.

[0232] As used herein, "sequence motif" means a pattern of nucleobases arranged along an oligonucleotide or portion thereof. Unless otherwise indicated, a sequence motif is independent of chemical modifications and thus may have any combination of chemical modifications, including no chemical modifications.

[0233] As used herein, "type of modification" in reference to a nucleoside or a nucleoside of a "type" means the chemical modification of a nucleoside and includes modified and unmodified nucleosides. Accordingly, unless otherwise indicated, a "nucleoside having a modification of a first type" may be an unmodified nucleoside.

[0234] As used herein, "differently modified" mean chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are "differently modified," even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are "differently modified," even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2'-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2'-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.

[0235] As used herein, "the same type of modifications" refers to modifications that are the same as one another, including absence of modifications. Thus, for example, two unmodified DNA nucleoside have "the same type of modification," even though the DNA nucleoside is unmodified. Such nucleosides having the same type modification may comprise different nucleobases.

[0236] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administering to an animal. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile saline. In certain embodiments, such sterile saline is pharmaceutical grade saline.

[0237] As used herein, "substituent" and "substituent group," means an atom or group that replaces the atom or group of a named parent compound. For example a substituent of a modified nucleoside is any atom or group that differs from the atom or group found in a naturally occurring nucleoside (e.g., a modified 2'-substuent is any atom or group at the 2'-position of a nucleoside other than H or OH). Substituent groups can be protected or unprotected. In certain embodiments, compounds of the present invention have substituents at one or at more than one position of the parent compound. Substituents may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to a parent compound.

[0238] Likewise, as used herein, "substituent" in reference to a chemical functional group means an atom or group of atoms differs from the atom or a group of atoms normally present in the named functional group. In certain embodiments, a substituent replaces a hydrogen atom of the functional group (e.g., in certain embodiments, the substituent of a substituted methyl group is an atom or group other than hydrogen which replaces one of the hydrogen atoms of an unsubstituted methyl group). Unless otherwise indicated, groups amenable for use as substituents include without limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (--C(O)R.sub.aa), carboxyl (--C(O)O--R.sub.aa), aliphatic groups, alicyclic groups, alkoxy, substituted oxy (--O--R.sub.aa), aryl, aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino (--N(R.sub.bb)(R.sub.cc)), imino(.dbd.NR.sub.bb), amido (--C(O)N(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)C(O)R.sub.aa), azido (--N.sub.3), nitro (--NO.sub.2), cyano (--CN), carbamido (--OC(O)N(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)C(O)OR.sub.aa), ureido (--N(R.sub.bb)C(O)N(R.sub.bb)(R.sub.cc)), thioureido (--N(R.sub.bb)C(S)N(R.sub.bb)--(R.sub.cc)), guanidinyl (--N(R.sub.bb)C(.dbd.NR.sub.bb)N(R.sub.bb)(R.sub.cc)), amidinyl (--C(.dbd.NR.sub.bb)N(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)C(.dbd.NR.sub.bb)(R.sub.aa)), thiol (--SR.sub.bb), sulfinyl (--S(O)R.sub.bb), sulfonyl (--S(O).sub.2R.sub.bb) and sulfonamidyl (--S(O).sub.2N(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)S--(O).sub.2R.sub.bb). Wherein each R.sub.aa, R.sub.bb and R.sub.cc is, independently, H, an optionally linked chemical functional group or a further substituent group with a preferred list including without limitation, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl. Selected substituents within the compounds described herein are present to a recursive degree.

[0239] As used herein, "alkyl," as used herein, means a saturated straight or branched hydrocarbon radical containing up to twenty four carbon atoms. Examples of alkyl groups include without limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically include from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms (C.sub.1-C.sub.12 alkyl) with from 1 to about 6 carbon atoms being more preferred.

[0240] As used herein, "alkenyl," means a straight or branched hydrocarbon chain radical containing up to twenty four carbon atoms and having at least one carbon-carbon double bond. Examples of alkenyl groups include without limitation, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and the like. Alkenyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkenyl groups as used herein may optionally include one or more further substituent groups.

[0241] As used herein, "alkynyl," means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkynyl groups as used herein may optionally include one or more further substituent groups.

[0242] As used herein, "acyl," means a radical formed by removal of a hydroxyl group from an organic acid and has the general Formula --C(O)--X where X is typically aliphatic, alicyclic or aromatic. Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates and the like. Acyl groups as used herein may optionally include further substituent groups.

[0243] As used herein, "alicyclic" means a cyclic ring system wherein the ring is aliphatic. The ring system can comprise one or more rings wherein at least one ring is aliphatic. Preferred alicyclics include rings having from about 5 to about 9 carbon atoms in the ring. Alicyclic as used herein may optionally include further substituent groups.

[0244] As used herein, "aliphatic" means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms wherein the saturation between any two carbon atoms is a single, double or triple bond. An aliphatic group preferably contains from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms with from 1 to about 6 carbon atoms being more preferred. The straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by heteroatoms include without limitation, polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines Aliphatic groups as used herein may optionally include further substituent groups.

[0245] As used herein, "alkoxy" means a radical formed between an alkyl group and an oxygen atom wherein the oxygen atom is used to attach the alkoxy group to a parent molecule. Examples of alkoxy groups include without limitation, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may optionally include further substituent groups.

[0246] As used herein, "aminoalkyl" means an amino substituted C.sub.1-C.sub.12 alkyl radical. The alkyl portion of the radical forms a covalent bond with a parent molecule. The amino group can be located at any position and the aminoalkyl group can be substituted with a further substituent group at the alkyl and/or amino portions.

[0247] As used herein, "aralkyl" and "arylalkyl" mean an aromatic group that is covalently linked to a C.sub.1-C.sub.12 alkyl radical. The alkyl radical portion of the resulting aralkyl (or arylalkyl) group forms a covalent bond with a parent molecule. Examples include without limitation, benzyl, phenethyl and the like. Aralkyl groups as used herein may optionally include further substituent groups attached to the alkyl, the aryl or both groups that form the radical group.

[0248] As used herein, "aryl" and "aromatic" mean a mono- or polycyclic carbocyclic ring system radicals having one or more aromatic rings. Examples of aryl groups include without limitation, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like. Preferred aryl ring systems have from about 5 to about 20 carbon atoms in one or more rings. Aryl groups as used herein may optionally include further substituent groups.

[0249] As used herein, "halo" and "halogen," mean an atom selected from fluorine, chlorine, bromine and iodine.

[0250] As used herein, "heteroaryl," and "heteroaromatic," mean a radical comprising a mono- or polycyclic aromatic ring, ring system or fused ring system wherein at least one of the rings is aromatic and includes one or more heteroatoms. Heteroaryl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms. Heteroaryl groups typically include one ring atom selected from sulfur, nitrogen or oxygen. Examples of heteroaryl groups include without limitation, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl, quinoxalinyl and the like. Heteroaryl radicals can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or hetero atom. Heteroaryl groups as used herein may optionally include further substituent groups.

B. METHODS OF PREDICTING IN VIVO TOXICITY

[0251] Provided herein are methods for determining the in vitro and in vivo toxicity of oligomeric compounds. In certain embodiments, the methods generally comprise contacting a cell with an oligomeric compound in vitro, measuring the modulation of the activity or amount of one or more off-target genes and predicting the in vivo toxicity of the oligomeric compound based on the in vitro modulation of the activity or amount of one or more of the off-target genes. In certain embodiments, the general methods disclosed herein will enable one having skill in the art to rapidly screen large numbers of new or previously known oligomeric compounds in vitro and predict whether such test oligomeric compounds will be toxic in vivo, based on the in vitro modulation of the amount or activity of certain off-target genes. Thus, the time and expense of administering numerous oligomeric compounds to animals to determine in vivo toxicity may be reduced, and one may more rapidly identify and avoid oligomeric compounds that may have potentially toxic in vivo properties.

[0252] In certain embodiments, the method generally comprises identifying one or more off-target genes, the up- or down-regulation of which in vitro correlates with an increase in toxicity in vivo. In certain embodiments, once such off-target genes are identified, the invention provides methods of screening oligomeric compounds in vitro to determine whether they up- or down-regulate such off-target genes. In certain embodiments, the methods disclosed herein enable one having skill in the art to accurately predict the in vivo toxicity of a given oligomeric compound through the in vitro measurement of certain down-regulated off-target genes. In certain embodiments, the methods disclosed herein enable one having skill in the art to accurately predict the in vivo toxicity of a given oligomeric compound through the in vitro measurement of certain up-regulated off-target genes.

[0253] a. Toxicity

[0254] In vitro or in vivo toxicity may be measured by any method known to those having skill in the art. In some embodiments, toxicity is measured by liver activity. In some embodiments, toxicity is measured by kidney activity. In some embodiments, toxicity is measured by pancreas activity. In some embodiments, toxicity is measured by assessing circulating liver enzymes such as Aspartate transaminase (AST) and/or Alanine transaminase (ALT). In certain such embodiments, AST and/or ALT levels at timepoints after the administration of a test oligomeric compound are compared to baseline values obtained prior to administration, to those of control animals that did not receive test oligomeric compound, or to values known to be associated with normal animals from previous experiments (historical controls) or from literature. In certain embodiments, toxicity is measured by assessing alkaline phosphatase (ALP) levels. In certain such embodiments, ALP levels at timepoints after the administration of a test oligomeric compound are compared to baseline values obtained prior to administration, to those of control animals that did not receive test oligomeric compound, or to values known to be associated with normal animals from previous experiments (historical controls) or from literature. In certain embodiments, toxicity is measured by assessing total bilirubin (TBIL) levels. In certain such embodiments, TBIL levels at timepoints after the administration of a test oligomeric compound are compared to baseline values obtained prior to administration, to those of control animals that did not receive test oligomeric compound, or to values known to be associated with normal animals from previous experiments (historical controls) or from literature. In certain embodiments, toxicity is measured by assessing albumin levels. In certain such embodiments, albumin levels at timepoints after the administration of a test oligomeric compound are compared to baseline values obtained prior to administration, to those of control animals that did not receive test oligomeric compound, or to values known to be associated with normal animals from previous experiments (historical controls) or from literature. In certain embodiments, toxicity is measured by assessing serum glucose levels. In certain such embodiments, serum glucose levels at timepoints after the administration of a test oligomeric compound are compared to baseline values obtained prior to administration, to those of control animals that did not receive test oligomeric compound, or to values known to be associated with normal animals from previous experiments (historical controls) or from literature. In certain embodiments, toxicity is measured by assessing lactate dehydrogenase (LDH) levels. In certain such embodiments, lactate dehydrogenase (LDH) levels at timepoints after the administration of a test oligomeric compound are compared to baseline values obtained prior to administration, to those of control animals that did not receive test oligomeric compound, or to values known to be associated with normal animals from previous experiments (historical controls) or from literature.

[0255] b. Modulation of the Amount or Activity of Off-Target Genes In Vivo

[0256] In certain embodiments the modulation of the amount or activity of off-target genes in vivo may be determined by microarray analysis. After administration of an oligomeric compound to an animal in vivo or a group of animals in vivo, one or more of the animals may be sacrificed and the tissue analyzed by microarray to determine expression levels of a large number of specific genes, or even the entire genome (genome profiling). In certain embodiments, one or more of the animals may be sacrificed and the tissue analyzed by microarray analysis at various times (e.g., 0, 24 hours, 48 hours, 72 hours, 96 hours) after administration of an oligomeric compound. Such microarray analysis may be compared to similar analyses from untreated animals and/or from animals treated with a different oligomeric compound.

[0257] In certain embodiments, toxixity of treated animals is assessed at various times. In certain embodiments, the tissue of the sacrificed animals is analyzed for indications of toxicity by any method known to those having skill in the art. In certain embodiments, any animals not sacrificed for microarray analysis may continue to be observed for indications of acute toxicity at various time points, for example at 24 hours, 48 hours, 72 hours, and 96 hours after administration.

[0258] In certain embodiments, the degree of the change in expression of certain off-target genes as determined by microarray analysis may be correlated with some measure of toxicity. In certain embodiments, the degree of the decrease in expression of certain off-target genes may be correlated with increase in AST levels or ALT levels. In certain embodiments, after microarray analysis, the degree of the increase in expression of certain off-target genes may be correlated with the amount of increase in some measure of toxicity, for example, AST levels or ALT levels. After correlation between the in vivo modulation of the amount or activity of an off-target gene and in vivo toxicity is performed, the off-target genes may be sorted by the coefficient of determination from highest to lowest. In this manner off-target genes may be identified where the in vivo modulation of the amount or activity of a gene correlates strongly with some measure of toxicity (sentinel genes), for example AST levels or ALT levels. In certain embodiments, off-target genes having the strongest correlation between a decrease in in vivo expression and toxicity may be identified as sentinel genes. In certain embodiments, off-target genes having the strongest correlation between a decrease in in vivo expression and increase in AST levels may be identified as sentinel genes. In certain embodiments, off-target genes having the strongest correlation between a decrease in in vivo expression and increase in ALT levels may be identified sentinel genes. In certain embodiments, off-target genes having the strongest correlation between an increase in expression in vivo and toxicity may be identified sentinel genes. In certain embodiments, off-target genes having the strongest correlation between an increase in in vivo expression and increase in ALT levels may be identified as sentinel genes. In certain embodiments, off-target genes having the strongest correlation between an increase in in vivo expression and increase in AST levels may be identified as sentinel genes.

[0259] In certain embodiments, the modulation of the amount or activity of off-target genes may be correlated with one or more measure of toxicity. One having skill in the art may correlate the modulation of the amount or activity of off-target genes with one or more measure of toxicity using any statistical method known to those having skill in the art. In certain embodiments, the correlation of the modulation of the amount or activity of off-target genes with one or more measure of toxicity is assessed by calculating the coefficient of determination. In certain embodiments, the correlation of the modulation of the amount or activity of off-target genes may be correlated with one or more measure of toxicity by using the coefficient of determination, r.sup.2. In this manner sentinel genes may be identified where the in vivo modulation of the amount or activity of an off-target gene in response to an oligomeric compound correlates strongly with some measure of toxicity.

[0260] In certain embodiments the degree of the decrease in expression of an off-target gene may be correlated with an increase in AST levels. In certain embodiments the degree of the decrease in expression of an off-target gene may be correlated with an increase in ALT levels. In certain embodiments the degree of the decrease in expression of an off-target gene may be correlated with an increase in ALP levels. In certain embodiments the degree of the decrease in expression of an off-target gene may be correlated with an increase in TBIL levels. In certain embodiments the degree of the decrease in expression of an off-target gene may be correlated with an increase in albumin levels. In certain embodiments the degree of the decrease in expression of an off-target gene may be correlated with an increase in serum glucose levels. In certain embodiments the degree of the decrease in expression of an off-target gene may be correlated with an increase in LDH levels.

[0261] In certain embodiments the degree of the increase in expression of an off-target gene may be correlated with an increase in AST levels. In certain embodiments the degree of the increase in expression of an off-target gene may be correlated with an increase in ALT levels. In certain embodiments the degree of the increase in expression of an off-target gene may be correlated with an increase in ALP levels. In certain embodiments the degree of the increase in expression of an off-target gene may be correlated with an increase in TBIL levels. In certain embodiments the degree of the increase in expression of an off-target gene may be correlated with an increase in albumin levels. In certain embodiments the degree of the increase in expression of an off-target gene may be correlated with an increase in serum glucose levels. In certain embodiments the degree of the increase in expression of an off-target gene may be correlated with an increase in LDH levels.

[0262] In certain embodiments the degree of the decrease in expression of a sentinel gene may be correlated with an increase in AST levels. In certain embodiments the degree of the decrease in expression of a sentinel gene may be correlated with an increase in ALT levels. In certain embodiments the degree of the decrease in expression of a sentinel gene may be correlated with an increase in ALP levels. In certain embodiments the degree of the decrease in expression of a sentinel gene may be correlated with an increase in TBIL levels. In certain embodiments the degree of the decrease in expression of a sentinel gene may be correlated with an increase in albumin levels. In certain embodiments the degree of the decrease in expression of a sentinel gene may be correlated with an increase in serum glucose levels. In certain embodiments the degree of the decrease in expression of a sentinel gene may be correlated with an increase in LDH levels.

[0263] In certain embodiments the degree of the increase in expression of a sentinel gene may be correlated with an increase in AST levels. In certain embodiments the degree of the increase in expression of a sentinel gene may be correlated with an increase in ALT levels. In certain embodiments the degree of the increase in expression of a sentinel gene may be correlated with an increase in ALP levels. In certain embodiments the degree of the increase in expression of a sentinel gene may be correlated with an increase in TBIL levels. In certain embodiments the degree of the increase in expression of a sentinel gene may be correlated with an increase in albumin levels. In certain embodiments the degree of the increase in expression of a sentinel gene may be correlated with an increase in serum glucose levels. In certain embodiments the degree of the increase in expression of a sentinel gene may be correlated with an increase in LDH levels.

[0264] In certain embodiments, any number of off-target genes may be ranked according to coefficient of determination, r.sup.2, between toxicity and the degree modulation of the amount or activity of off-target gene expression. In certain embodiments, any number of off-target genes may be ranked according to the strength of correlation between toxicity as measured by ALT levels and the degree of the decrease in off-target expression. In certain embodiments, any number of off-target genes may be ranked according to the strength of correlation between toxicity as measured by AST levels and the degree the decrease in off-target gene expression.

[0265] In certain embodiments, any number of sentinel genes may be ranked according to coefficient of determination, r.sup.2, between toxicity and the degree modulation of the amount or activity of sentinel gene expression. In certain embodiments, any number of sentinel genes may be ranked according to the strength of correlation between toxicity as measured by ALT levels and the degree of the decrease in sentinel expression. In certain embodiments, any number of sentinel genes may be ranked according to the strength of correlation between toxicity as measured by AST levels and the degree the decrease in sentinel gene expression.

[0266] In certain embodiments, the 1 to 150 or more off-target genes having the strongest in vivo correlation between a decrease in expression and toxicity may be identified as sentinel genes. In certain embodiments, the 1 to 100 off-target genes having the strongest in vivo correlation between a decrease in expression and toxicity may be identified as sentinel genes. In certain embodiments, the 1 to 50 off-target genes having the strongest in vivo correlation between a decrease in expression and toxicity may be identified as sentinel genes. In certain embodiments, the 1 to 40 off-target genes having the strongest correlation between a decrease in expression and toxicity may be identified as sentinel genes. In certain embodiments, the 1 to 30 off-target genes having the strongest correlation between a decrease in expression and toxicity may be identified as sentinel genes. In certain embodiments, the 1 to 20 off-target genes having the strongest correlation between a decrease in expression and toxicity may be identified as sentinel genes. In certain embodiments, the 1 to 10 off-target genes having the strongest correlation between a decrease in expression and toxicity may be identified as sentinel genes. In certain embodiments, the 1 to 5 off-target genes having the strongest correlation between a decrease in expression and toxicity may be identified as sentinel genes.

[0267] In certain embodiments, the 1 to 150 or more off-target genes having the strongest correlation between an increase in expression and toxicity may be identified as sentinel genes. In certain embodiments, the 1 to 100 off-target genes having the strongest correlation between an increase in expression and toxicity may be identified as sentinel genes. In certain embodiments, the 1 to 50 off-target genes having the strongest correlation between an increase in expression and toxicity may be identified as sentinel genes. In certain embodiments, the 1 to 40 off-target genes having the strongest correlation between an increase in expression and toxicity may be identified as sentinel genes. In certain embodiments, the 1 to 30 off-target genes having the strongest correlation between an increase in expression and toxicity may be identified as sentinel genes. In certain embodiments, the 1 to 20 off-target genes having the strongest correlation between an increase in expression and toxicity may be identified as sentinel genes. In certain embodiments, the 1 to 10 off-target genes having the strongest correlation between an increase in expression and toxicity may be identified as sentinel genes. In certain embodiments, the 1 to 5 off-target genes having the strongest correlation between an increase in expression and toxicity may be identified as sentinel genes.

[0268] The methods described herein enable one having skill in the art to then identify any number of off-target genes, sentinel genes, or transcripts. The methods described herein enable one having skill in the art to then identify any number of off-target genes, sentinel genes, or transcripts wherein the decrease in expression of the sentinel gene or transcript is correlated to some measure of toxicity. The methods described herein enable one having skill in the art to then identify any number of off-target genes, sentinel genes, or transcripts wherein the increase in expression of the sentinel gene or transcript is correlated to some measure of toxicity. In this manner, one having skill in the art may identify any number of off-target genes, sentinel genes, or transcripts according to the correlation between the modulation of the amount or activity of the off-target genes, sentinel genes, or transcripts in vivo and any measure of toxicity. In certain embodiments, the off-target genes, sentinel genes, or transcripts identified may be used for further in vitro evaluation to develop a sub-set of in vitro off-target genes, sentinel genes, or transcripts that correlate to in vivo toxicity. In certain embodiments, at least one antisense compound that is predicted not to be toxic in vivo is made and then tested in an animal.

[0269] In certain embodiments, sentinel genes are identified empirically. For example, in certain embodiments, oligomeric compounds that modulate the amount or activity of a particular off target gene in vitro are found to cause toxicity when administered in vivo. Such observed correlation between modulation of the amount or activity of an off-target gene in vitro and corresponding in vivo toxicity does not necessarily indicate that modulation of the amount or activity of the off target gene is the cause of the observed toxicity. Indeed, an off-target gene might not even be modulated in vivo. The utility of the observation, however, is independent of mechanism. Regardless of causation, oligomeric compounds that modulate the amount or activity of a strongly correlated off-target sentinel gene are predicted to be toxic in vivo. In certain embodiments, homology between an oligomeric compound and a sentinel gene does not result in the modulation of the amount or activity of said sentinel gene. In certain embodiments, homology between an oligomeric compound and an off-target gene does not result in the modulation of the amount or activity of said off target gene. In certain embodiments, an oligomeric compound modulates the amount or activity of an off-target gene without hybridizing to said off-target gene. In certain embodiments, an oligomeric compound modulates the amount or activity of a sentinel gene without hybridizing to said sentinel gene.

[0270] c. Modulation of the Amount or Activity of Off-Target Genes In Vivo

[0271] In certain embodiments, the modulation of the amount or activity of any number of off-target genes in response to any given oligonucleotide may be measured in vitro. Any suitable cell lines that express genes of interest may be used for the in vitro screen. In certain embodiments hepatocyte cell lines may be used. In certain embodiments, BEND cell lines may be used. In certain embodiments, HeLa cell lines may be used. In certain embodiments HepG2 cell lines may be used. The degree of modulation of the amount or activity of the off-target genes in-vitro may then be compared with off-target genes that have been identified as being modulated in vivo. In this manner, off-target genes that have a high amount of modulation of amount or activity in vivo and which also have a high amount of modulation of amount or activity in vitro may be identified. In certain embodiments, the modulation of the amount or activity of off-target genes identified as having a high correlation between measurements of acute toxicity and a decrease in expression in vivo may be correlated with the degree of a decrease in expression in vitro. In certain embodiments, the modulation of the amount or activity of off-target genes identified as having a high correlation between acute toxicity and an increase in expression in vivo may be correlated with the modulation of amount or activity in vitro. In certain embodiments, certain off-target genes may be identified that have a high correlation between a change in the modulation of amount or activity in vivo and a change in the modulation of amount or activity in vitro. For example, in certain embodiments, certain off-target genes identified as demonstrating a relatively strong decrease in expression in vivo, will also demonstrate a relatively strong decrease in expression in vitro. In certain embodiments, the identification of such in vitro off-target genes, for example, genes that demonstrate a decrease in expression upon transfection with a given oligomeric compound, will then predict a decrease in expression of the same off-target genes in vivo, and therefore will predict toxicity in vivo. Once in vitro off-target genes are identified, then any oligomeric compound maybe screened in vitro by transfecting a cell with the oligomeric compound and measuring the modulation of the amount or activity of one or more identified off-target genes. In some embodiments, this method reduces the need for an acute single-dose in vivo screen for most oligomeric compounds.

[0272] Any method known to those having skill in the art may be used to measure the modulation of the amount or activity of the off-target genes in vitro. In certain embodiments, cells may be transfected with oligomeric compounds using electroporation. Other suitable transfection reagents known in the art include, but are not limited to, CYTOFECTIN.TM., LIPOFECTAMINE.TM., OLIGOFECTAMINE.TM., and FUGENE.TM. In certain embodiments, RT-PCR is used to measure the modulation of the amount or activity of off-target genes in vitro.

[0273] d. Certain Off-Target Genes

[0274] In certain embodiments, the modulation of the amount or activity of one or more off-target genes in vitro is used to determine the toxicity of an oligomeric compound in vivo. In certain embodiments the decrease in expression of one or more off-target genes in vitro is used to determine the toxicity of an oligomeric compound in vivo. In certain embodiments the increase in expression of one or more off-target genes in vitro is used to determine the toxicity of an oligomeric compound in vivo.

[0275] In certain embodiments, the amount of the decrease in expression in vitro of one or more of the off-target genes listed in Table 1 below may be used to determine the toxicity of an oligomeric compound in vivo.

TABLE-US-00001 TABLE 1 In Vitro Off-Target Genes Symbol Official Name Adcy9 adenylate cyclase 9 Ptprk protein tyrosine phosphatase, receptor type, K Tbc1d22a TBC1 domain family, member 22a Exoc6b exocyst complex component 6B Fto fat mass and obesity associated RAPTOR regulatory associated protein of MTOR, complex 1 Iqgap2 IQ motif containing GTPase activating protein 2 Vti1a vesicle transport through interaction with t-SNAREs homolog 1A BC057079 cDNA sequence BC057079 Fbxl17 F-box and leucine-rich repeat protein 17 Bre brain and reproductive organ-expressed protein Cgnl1 cingulin-like 1 Msi2 Musashi homolog 2 (Drosophila) Mcph1 microcephaly, primary autosomal recessive 1 Atxn1 ataxin 1 Vps13b vacuolar protein sorting 13B (yeast) Cadps2 Ca2+-dependent activator protein for secretion 2 Ppp3ca protein phosphatase 3, catalytic subunit, alpha isoform Ppm1l protein phosphatase 1 (formerly 2C)-like Ubac2 ubiquitin associated domain containing 2 Bcas3 breast carcinoma amplified sequence 3 Gphn gephyrin Atp9b ATPase, class II, type 9B Chn2 chimerin (chimaerin) 2 Fars2 phenylalanine-tRNA synthetase 2 (mitochondrial) Adk adenosine kinase Odz3 odd Oz/ten-m homolog 3 (Drosophila) Macrod1 MACRO domain containing 1 Atg10 Autophagy-related protein 10 Fggy carbohydrate kinase domain containing Vps53 vacuolar protein sorting 53 homolog (S. cerevisiae) Itpr2 inositol 1,4,5-triphosphate receptor, type 2 0610012H03Rik Riken cDNA 0610012H03 gene

[0276] In certain embodiments, the degree of the increase in expression in vitro of one or more of the off-target genes listed in Table 2 below may be used to determine the toxicity of an oligomeric compound in vivo.

TABLE-US-00002 TABLE 2 In Vitro Off-Target Genes Symbol Gene ID Rassf1 56289 Dus41 71916 Mdm2 17246 Brp16 59053 0610010K14Rik 104457 Rce1 19671 Ilf2 67781 Setd1a 233904 Gar1 68147 FAM203A 59053

[0277] In certain embodiments, the amount of the decrease in expression in vitro of one or more of the off-target genes listed in Table 3 below may be used to determine the toxicity of an oligomeric compound in vivo.

TABLE-US-00003 TABLE 3 In Vitro Off-Target Genes Symbol Gene ID Rsrc1 66880 Cadps2 320405 Aprin 100710 Faf1 14084 Sntg2 268534 Odz3 23965 St3gal3 20441 Sox5 20678 BC033915 70661 A530050D06Rik 104816 Fbxl17 50758 Msi2 76626 Pard3 93742 4933407C03Rik 74440 Itpr1 16438 Zdhhc14 224454 Rrbp1 81910 Mtmr14 97287 Dpyd 99586 Ptprd 19266 Pcca 110821 Lmf1 76483 Iqgap2 544963 Centg2 347722 Btbd9 224671 Ubac2 68889 Ptprk 19272 R3hdm2 71750 Psme4 103554 Ppp3ca 19055 Vps53 68299 Vps13b 666173 Mgl1 23945 Chn2 69993 Atxn1 20238 Acot7 70025 Lpp 210126 Itpr2 16439 Mapkap1 227743 Stx8 55943 Ghr 14600 Bcas3 192197 Exoc6b///Sec1512 75914 9030420J04Rik 71544 Pck1 18534 Ube2e2 218793 Pik3c2g 18705 1300010F03Rik 219189 Apbb2 11787 Mcph1 244329 Sergef 27414 Adcy9 11515 Pkp4 227937 Ascc3 77987 Enpp2 18606 Sel11 20338 Macrod1 107227 Vti1a 53611 Wdr7 104082 4932417H02Rik 74370 Bach2 12014 0610012H03Rik 74088 Adk 11534 Dym 69190 Pitpnm2 19679 Slc41a2 338365 Fgfr2 14183 Bre 107976 Gphn 268566 Mical3 194401 Fars2 69955 Ap3b1 11774 Vps13a 271564 Skap2 54353 Sds 231691 Cova1///Enox2 209224 Pitpnc1 71795 Large 16795 Lrba 80877 Atg10 66795 Atp9b 50771 Cask 12361 Ppm11 242083 Alcam 11658 Atg7 74244 Nfia 18027 Supt3h 109115 Med27 68975 Cgnl1 68178 Dennd1a 227801 Smoc1 64075 Prkca 18750 2210408F21Rik 73652 Map2k5 23938 Dock4 238130 LOC100036521 100036521 Sil1 81500 Tbc1d22a 223754 2310009E04Rik 75578 BC057079 230393 Fhit 14198 Uvrag 78610 Dtnb 13528 Fto 26383 Immp21 93757

[0278] In certain embodiments, the measurement of the modulation of the amount or activity of more than one off-target gene in vitro may increase the probability of predicting toxicity in vivo. For example, in certain embodiments, a cell is transfected with an oligomeric compound of interest and then the modulation of the amount or activity of two or more off-target genes is measured. In such embodiments, if both off-target genes are modulated then there is a higher probability that the oligomeric compound of interest is toxic than if only one of the two off-target genes were modulated. In certain embodiments, a cell is transfected with an oligomeric compound of interest and then the modulation of the amount or activity of three or more off-target genes is measured. In such embodiments, if all three off-target genes are modulated then there is a higher probability that the oligomeric compound of interest is toxic than if only one of the three off-target genes were modulated. In certain embodiments, a cell is transfected with an oligomeric compound of interest and then the modulation of the amount or activity of four or more off-target genes is measured. In such embodiments, if all four off-target genes are modulated or if two of the four off-target genes are modulated or if three of the four off-target genes are modulated then there is a higher probability that the oligomeric compound of interest is toxic than if only one of the four off-target genes were modulated. Likewise, in certain embodiments, if three of the four off-target genes were modulated then there is a higher probability that the oligomeric compound of interest is toxic than if only one of the four off-target genes were modulated or if two of the four off-target genes were modulated. In certain embodiments, a cell is transfected with an oligomeric compound of interest and then the modulation of the amount or activity of five or more off-target genes is measured. In such embodiments, if all five off-target genes are modulated or if two of the five off-target genes are modulated or if three of the five or four of the five off-target genes are modulated then there is a higher probability that the oligomeric compound of interest is toxic than if only one of the four off-target genes were modulated. In certain embodiments, a cell is transfected with an oligomeric compound of interest and then the modulation of the amount or activity of at least six off-target genes is measured. In such embodiments, if all six off-target genes are modulated or if two of the six off-target genes are modulated or if three of the six or four of the six or five of the six off-target genes are modulated then there is a higher probability that the oligomeric compound of interest is toxic than if only one of the four off-target genes were modulated.

[0279] In certain embodiments the off-target gene is Adcy9. In certain embodiments the off-target gene is Ptprk. In certain embodiments the off-target gene is Tbc1d22a. In certain embodiments the off-target gene is Exoc6b. In certain embodiments the off-target gene is Fto. In certain embodiments the off-target gene is RAPTOR. In certain embodiments the off-target gene is Iqgap2. In certain embodiments the off-target gene is Vti1a. In certain embodiments the off-target gene is BC057079. In certain embodiments the off-target gene is Fbx117. In certain embodiments the off-target gene is Bre. In certain embodiments the off-target gene is Cgnl1. In certain embodiments the off-target gene is Msi2. In certain embodiments the off-target gene is Mcph1. In certain embodiments the off-target gene is Atxn1. In certain embodiments the off-target gene is Vps13b. In certain embodiments the off-target gene is Cadps2. In certain embodiments the off-target gene is Ppp3ca. In certain embodiments the off-target gene is Ppm1l. In certain embodiments the off-target gene is Ubac2. In certain embodiments the off-target gene is Bcas3. In certain embodiments the off-target gene is Gphn. In certain embodiments the off-target gene is Atp9b. In certain embodiments the off-target gene is Chn2. In certain embodiments the off-target gene is Fars2. In certain embodiments the off-target gene is Adk. In certain embodiments the off-target gene is Odz3. In certain embodiments the off-target gene is Macrod1. In certain embodiments the off-target gene is Atg10. In certain embodiments the off-target gene is Fggy. In certain embodiments the off-target gene is Vps53. In certain embodiments the off-target gene is Itpr2. In certain embodiments the off-target gene is 0610012H03Rik.

[0280] In certain embodiments the off-target gene is Rassf1. In certain embodiments the off-target gene is Dus41. In certain embodiments the off-target gene is Mdm2. In certain embodiments the off-target gene is Brp16. In certain embodiments the off-target gene is 0610010K14Rik. In certain embodiments the off-target gene is Rce1. In certain embodiments the off-target gene is I1f2. In certain embodiments the off-target gene is Setd1a. In certain embodiments the off-target gene is Gar1. In certain embodiments the off-target gene is FAM203A.

[0281] In certain embodiments the off-target gene is Rsrc1. In certain embodiments the off-target gene is Cadps2. In certain embodiments the off-target gene is Aprin. In certain embodiments the off-target gene is Faf1. In certain embodiments the off-target gene is Sntg2. In certain embodiments the off-target gene is Odz3. In certain embodiments the off-target gene is St3gal3. In certain embodiments the off-target gene is Sox5. In certain embodiments the off-target gene is BC033915. In certain embodiments the off-target gene is A530050D06Rik. In certain embodiments the off-target gene is Fbx117. In certain embodiments the off-target gene is Msi2. In certain embodiments the off-target gene is Pard3. In certain embodiments the off-target gene is 4933407C03Rik. In certain embodiments the off-target gene is Itpr1. In certain embodiments the off-target gene is Zdhhc14. In certain embodiments the off-target gene is Rrbp1. In certain embodiments the off-target gene is Mtmr14. In certain embodiments the off-target gene is Dpyd. In certain embodiments the off-target gene is Ptprd. In certain embodiments the off-target gene is Pcca. In certain embodiments the off-target gene is Lmf1. In certain embodiments the off-target gene is Iqgap2. In certain embodiments the off-target gene is Centg2. In certain embodiments the off-target gene is Btbd9. In certain embodiments the off-target gene is Ubac2. In certain embodiments the off-target gene is Ptprk. In certain embodiments the off-target gene is R3hdm2. In certain embodiments the off-target gene is Psme4. In certain embodiments the off-target gene is Ppp3ca. In certain embodiments the off-target gene is Vps53. In certain embodiments the off-target gene is Vps13b. In certain embodiments the off-target gene is Mgl1. In certain embodiments the off-target gene is Chn2. In certain embodiments the off-target gene is Atxn1. In certain embodiments the off-target gene is Acot7. In certain embodiments the off-target gene is Lpp. In certain embodiments the off-target gene is Itpr2. In certain embodiments the off-target gene is Mapkap1. In certain embodiments the off-target gene is Stx8. In certain embodiments the off-target gene is Ghr. In certain embodiments the off-target gene is Bcas3. In certain embodiments the off-target gene is Exoc6b///Sec1512. In certain embodiments the off-target gene is 9030420J04Rik.

[0282] In certain embodiments the off-target gene is Pck1. In certain embodiments the off-target gene is Ube2e2. In certain embodiments the off-target gene is Pik3c2g. In certain embodiments the off-target gene is 1300010F03Rik. In certain embodiments the off-target gene is Apbb2. In certain embodiments the off-target gene is Mcph1. In certain embodiments the off-target gene is Sergef. In certain embodiments the off-target gene is Adcy9. In certain embodiments the off-target gene is Pkp4. In certain embodiments the off-target gene is Ascc3. In certain embodiments the off-target gene is Enpp2. In certain embodiments the off-target gene is Sel1l. In certain embodiments the off-target gene is Macrod1. In certain embodiments the off-target gene is Vti1a. In certain embodiments the off-target gene is Wdr7. In certain embodiments the off-target gene is 4932417H02Rik. In certain embodiments the off-target gene is Bach2. In certain embodiments the off-target gene is 0610012H03Rik. In certain embodiments the off-target gene is Adk. In certain embodiments the off-target gene is Dym. In certain embodiments the off-target gene is Pitpnm2. In certain embodiments the off-target gene is Slc41a2. In certain embodiments the off-target gene is Fgfr2. In certain embodiments the off-target gene is Bre. In certain embodiments the off-target gene is Gphn. In certain embodiments the off-target gene is Mical3. In certain embodiments the off-target gene is Fars2. In certain embodiments the off-target gene is Ap3b1. In certain embodiments the off-target gene is Vps13a. In certain embodiments the off-target gene is Skap2. In certain embodiments the off-target gene is Sds. In certain embodiments the off-target gene is Cova1///Enox2. In certain embodiments the off-target gene is Pitpnc1. In certain embodiments the off-target gene is Large. In certain embodiments the off-target gene is Lrba.

[0283] In certain embodiments the off-target gene is Atg10. In certain embodiments the off-target gene is Atp9b. In certain embodiments the off-target gene is Cask. In certain embodiments the off-target gene is Ppm1l. In certain embodiments the off-target gene is Alcam. In certain embodiments the off-target gene is Atg7. In certain embodiments the off-target gene is Nfia. In certain embodiments the off-target gene is Supt3h. In certain embodiments the off-target gene is Med27. In certain embodiments the off-target gene is Cgnl1. In certain embodiments the off-target gene is Dennd1a. In certain embodiments the off-target gene is Smoc1. In certain embodiments the off-target gene is Prkca. In certain embodiments the off-target gene is 2210408F21Rik. In certain embodiments the off-target gene is Map2k5. In certain embodiments the off-target gene is Dock4. In certain embodiments the off-target gene is LOC100036521. In certain embodiments the off-target gene is Sil1. In certain embodiments the off-target gene is Tbc1d22a. In certain embodiments the off-target gene is 2310009E04Rik. In certain embodiments the off-target gene is BC057079. In certain embodiments the off-target gene is Fhit. In certain embodiments the off-target gene is Uvrag. In certain embodiments the off-target gene is Dtnb. In certain embodiments the off-target gene is Fto. In certain embodiments the off-target gene is Immp21.

[0284] In certain embodiments the off-target gene is 4932417H02Rik. In certain embodiments the off-target gene is mKIAA0919///Sec1512///Exoc6b. In certain embodiments the off-target gene is Fbx117. In certain embodiments the off-target gene is Chn2. In certain embodiments the off-target gene is Fto. In certain embodiments the off-target gene is AK053274///mKIAA0532///Vps13b///AK049111. In certain embodiments the off-target gene is Lrba///Lba. In certain embodiments the off-target gene is Fars2. In certain embodiments the off-target gene is Pomt2. In certain embodiments the off-target gene is Wwc1. In certain embodiments the off-target gene is Atg10. In certain embodiments the off-target gene is Gng12. In certain embodiments the off-target gene is Smg6. In certain embodiments the off-target gene is 2310008H04Rik. In certain embodiments the off-target gene is Ptprk. In certain embodiments the off-target gene is Cadps2. In certain embodiments the off-target gene is Supt3h. In certain embodiments the off-target gene is St3gal3. In certain embodiments the off-target gene is Atg7. In certain embodiments the off-target gene is Fggy. In certain embodiments the off-target gene is Ube2e2. In certain embodiments the off-target gene is Immp21. In certain embodiments the off-target gene is Bcas3. In certain embodiments the off-target gene is Mnat1. In certain embodiments the off-target gene is Itpr2. In certain embodiments the off-target gene is Adcy9. In certain embodiments the off-target gene is Slc17a2. In certain embodiments the off-target gene is Sergef. In certain embodiments the off-target gene is Smoc1. In certain embodiments the off-target gene is Dym. In certain embodiments the off-target gene is Nfia. In certain embodiments the off-target gene is Odz3. In certain embodiments the off-target gene is Enox2. In certain embodiments the off-target gene is Tbc1d5. In certain embodiments the off-target gene is BC057079. In certain embodiments the off-target gene is Cob1. In certain embodiments the off-target gene is Msi2. In certain embodiments the off-target gene is Esr1. In certain embodiments the off-target gene is Dexi. In certain embodiments the off-target gene is AA536749. In certain embodiments the off-target gene is Efna5. In certain embodiments the off-target gene is Med27. In certain embodiments the off-target gene is Cdkal1. In certain embodiments the off-target gene is Atp9b. In certain embodiments the off-target gene is Igfbp4. In certain embodiments the off-target gene is Saa4. In certain embodiments the off-target gene is Fry1. In certain embodiments the off-target gene is Mical3///Kiaa0819.

[0285] In certain embodiments the off-target gene is Itpr1. In certain embodiments the off-target gene is AK031097///Ppm11. In certain embodiments the off-target gene is Pard3. In certain embodiments the off-target gene is Mgmt. In certain embodiments the off-target gene is Mtmr14. In certain embodiments the off-target gene is Pik3c2g. In certain embodiments the off-target gene is Fndc3b. In certain embodiments the off-target gene is Cask. In certain embodiments the off-target gene is Galnt10. In certain embodiments the off-target gene is Tbc1d22a. In certain embodiments the off-target gene is Macrod1. In certain embodiments the off-target gene is Clec16a. In certain embodiments the off-target gene is Dis312. In certain embodiments the off-target gene is Cyp2j9. In certain embodiments the off-target gene is Sntg2. In certain embodiments the off-target gene is Sil1. In certain embodiments the off-target gene is 1300010F03Rik. In certain embodiments the off-target gene is Cux1. In certain embodiments the off-target gene is 1110012L19Rik. In certain embodiments the off-target gene is Prnpip1. In certain embodiments the off-target gene is Atxn1. In certain embodiments the off-target gene is Gpr39. In certain embodiments the off-target gene is Ghr. In certain embodiments the off-target gene is Ptprd. In certain embodiments the off-target gene is Errfi1. In certain embodiments the off-target gene is AK137808///Gtdc1. In certain embodiments the off-target gene is Atp11c. In certain embodiments the off-target gene is Prkag2. In certain embodiments the off-target gene is Lrit1. In certain embodiments the off-target gene is Tnrc6b. In certain embodiments the off-target gene is Cgnl1. In certain embodiments the off-target gene is Large. In certain embodiments the off-target gene is Gphn. In certain embodiments the off-target gene is Bbs9. In certain embodiments the off-target gene is Pcx. In certain embodiments the off-target gene is mKIAA1188///Clmn. In certain embodiments the off-target gene is Pet1121. In certain embodiments the off-target gene is Stxbp5. In certain embodiments the off-target gene is Ext2. In certain embodiments the off-target gene is Dtnbp1. In certain embodiments the off-target gene is Arsb. In certain embodiments the off-target gene is Zdhhc14. In certain embodiments the off-target gene is Mbnl2. In certain embodiments the off-target gene is Dtnb. In certain embodiments the off-target gene is Pitpnm2.

[0286] In certain embodiments the off-target gene is Herc2. In certain embodiments the off-target gene is Enpp2. In certain embodiments the off-target gene is Vti1a. In certain embodiments the off-target gene is Dock4///mKIAA0716. In certain embodiments the off-target gene is Dpyd. In certain embodiments the off-target gene is Arsg. In certain embodiments the off-target gene is Pcca. In certain embodiments the off-target gene is Snd1. In certain embodiments the off-target gene is Ccdc91. In certain embodiments the off-target gene is Acsm5. In certain embodiments the off-target gene is Gtf2i. In certain embodiments the off-target gene is Slc39a11. In certain embodiments the off-target gene is Adarb1. In certain embodiments the off-target gene is Pcnx. In certain embodiments the off-target gene is Zcchc7. In certain embodiments the off-target gene is Bbs4. In certain embodiments the off-target gene is Uroc1. In certain embodiments the off-target gene is Cdh2. In certain embodiments the off-target gene is Map2k2. In certain embodiments the off-target gene is BC038349. In certain embodiments the off-target gene is 5033414K04Rik. In certain embodiments the off-target gene is Epb4.1. In certain embodiments the off-target gene is Dock1. In certain embodiments the off-target gene is Pank1. In certain embodiments the off-target gene is Slc4a4. In certain embodiments the off-target gene is Tmtc2. In certain embodiments the off-target gene is Ncrna00153. In certain embodiments the off-target gene is BC099512. In certain embodiments the off-target gene is Farp1. In certain embodiments the off-target gene is Nfib. In certain embodiments the off-target gene is Arhgef11. In certain embodiments the off-target gene is Got1. In certain embodiments the off-target gene is Cables1. In certain embodiments the off-target gene is Elovl5. In certain embodiments the off-target gene is Usp20. In certain embodiments the off-target gene is Myo9b. In certain embodiments the off-target gene is Nedd41///mKIAA0439. In certain embodiments the off-target gene is 0610012H03Rik. In certain embodiments the off-target gene is D430042009Rik. In certain embodiments the off-target gene is Ehbp1. In certain embodiments the off-target gene is Ttc7b. In certain embodiments the off-target gene is Sel1l. In certain embodiments the off-target gene is Vps13a///CHAC.

[0287] In certain embodiments the off-target gene is Ddb2. In certain embodiments the off-target gene is Rnf213. In certain embodiments the off-target gene is Myole. In certain embodiments the off-target gene is Masp2. In certain embodiments the off-target gene is Gfra1. In certain embodiments the off-target gene is Hsd17b2. In certain embodiments the off-target gene is Rapgef6///mKIAA4052. In certain embodiments the off-target gene is Ascc3///AK144867. In certain embodiments the off-target gene is Prkca. In certain embodiments the off-target gene is Parva. In certain embodiments the off-target gene is Fert2. In certain embodiments the off-target gene is Stau2. In certain embodiments the off-target gene is Mapkap1. In certain embodiments the off-target gene is AK140547///Ralgps1. In certain embodiments the off-target gene is Sox5. In certain embodiments the off-target gene is Chdh. In certain embodiments the off-target gene is Smad3. In certain embodiments the off-target gene is Skap2. In certain embodiments the off-target gene is Mad1///Mad111. In certain embodiments the off-target gene is Pdzrn3. In certain embodiments the off-target gene is Arid1b. In certain embodiments the off-target gene is Aspg. In certain embodiments the off-target gene is Anxa6. In certain embodiments the off-target gene is Arfgef1. In certain embodiments the off-target gene is Hs6st1. In certain embodiments the off-target gene is Arhgap26///mKIAA0621. In certain embodiments the off-target gene is Wdr7.

[0288] In certain embodiments the off-target gene is B230342M21Rik///N4bp211. In certain embodiments the off-target gene is Asph. In certain embodiments the off-target gene is Iqgap2. In certain embodiments the off-target gene is Ugcgl1. In certain embodiments the off-target gene is BC033915. In certain embodiments the off-target gene is mKIAA0665///Rab11fip3. In certain embodiments the off-target gene is Sox6. In certain embodiments the off-target gene is Fbxo31. In certain embodiments the off-target gene is Ubac2. In certain embodiments the off-target gene is Hmgn3. In certain embodiments the off-target gene is 4930402H24Rik. In certain embodiments the off-target gene is Foxp1. In certain embodiments the off-target gene is Cd9912. In certain embodiments the off-target gene is C530044N13Rik///Cpped1. In certain embodiments the off-target gene is Trappc9///1810044A24Rik. In certain embodiments the off-target gene is Rabgap1l. In certain embodiments the off-target gene is Tbl1x. In certain embodiments the off-target gene is Hs2st1. In certain embodiments the off-target gene is Tmem16k///Ano10. In certain embodiments the off-target gene is Agap1. In certain embodiments the off-target gene is Map2k5. In certain embodiments the off-target gene is Susd4. In certain embodiments the off-target gene is Rbms1///AK011205. In certain embodiments the off-target gene is Gig18. In certain embodiments the off-target gene is 4933407C03Rik///mKIAA1694. In certain embodiments the off-target gene is Oaf. In certain embodiments the off-target gene is Cadm1. In certain embodiments the off-target gene is Tsc2. In certain embodiments the off-target gene is Zbtb20. In certain embodiments the off-target gene is Aig1. In certain embodiments the off-target gene is Zfp277///AK172713.

[0289] In certain embodiments the off-target gene is Nsmaf. In certain embodiments the off-target gene is Ppp1ca. In certain embodiments the off-target gene is Vav2. In certain embodiments the off-target gene is Mgl1. In certain embodiments the off-target gene is Ppnr. In certain embodiments the off-target gene is 2310007H09Rik. In certain embodiments the off-target gene is M113. In certain embodiments the off-target gene is Peli2. In certain embodiments the off-target gene is Spag9///JSAP2. In certain embodiments the off-target gene is Ctnna1. In certain embodiments the off-target gene is Ostf1. In certain embodiments the off-target gene is 11-Sep. In certain embodiments the off-target gene is Man2a1. In certain embodiments the off-target gene is Nlk. In certain embodiments the off-target gene is AU040829. In certain embodiments the off-target gene is Apbb2. In certain embodiments the off-target gene is Nsmce2. In certain embodiments the off-target gene is Btbd9. In certain embodiments the off-target gene is Rap1gds1. In certain embodiments the off-target gene is Cryl1. In certain embodiments the off-target gene is Slco2a1. In certain embodiments the off-target gene is Ubr1. In certain embodiments the off-target gene is Lrrc16a///Lrrc16. In certain embodiments the off-target gene is Mon2. In certain embodiments the off-target gene is Fbxw7. In certain embodiments the off-target gene is Ppp3ca.

[0290] In certain embodiments the off-target gene is AK040794///Acaca. In certain embodiments the off-target gene is Man1a. In certain embodiments the off-target gene is Rbms3. In certain embodiments the off-target gene is Adipor2. In certain embodiments the off-target gene is Ryr3. In certain embodiments the off-target gene is Tpk1. In certain embodiments the off-target gene is Pepd. In certain embodiments the off-target gene is C2cd21. In certain embodiments the off-target gene is Akap7. In certain embodiments the off-target gene is BC030307. In certain embodiments the off-target gene is Fam149b. In certain embodiments the off-target gene is Spop. In certain embodiments the off-target gene is Xrcc4. In certain embodiments the off-target gene is Dip2c. In certain embodiments the off-target gene is 1700009P17Rik. In certain embodiments the off-target gene is Pdia5. In certain embodiments the off-target gene is Pck1. In certain embodiments the off-target gene is Vps53. In certain embodiments the off-target gene is Eefsec. In certain embodiments the off-target gene is Pbld. In certain embodiments the off-target gene is Dennd1a. In certain embodiments the off-target gene is Ncoa1. In certain embodiments the off-target gene is Fign.

[0291] In certain embodiments the off-target gene is 4933421E11Rik. In certain embodiments the off-target gene is Rpusd4. In certain embodiments the off-target gene is AK019895///Chchd8. In certain embodiments the off-target gene is Ange12. In certain embodiments the off-target gene is Thumpd3. In certain embodiments the off-target gene is Polr2d. In certain embodiments the off-target gene is Gadd45a. In certain embodiments the off-target gene is Ece2. In certain embodiments the off-target gene is 2310009B15Rik. In certain embodiments the off-target gene is 1110002N22Rik. In certain embodiments the off-target gene is Setd1a. In certain embodiments the off-target gene is 2810432D09Rik. In certain embodiments the off-target gene is Serbp1. In certain embodiments the off-target gene is 2310039H08Rik. In certain embodiments the off-target gene is Mtap1s. In certain embodiments the off-target gene is Plek2. In certain embodiments the off-target gene is Bola1. In certain embodiments the off-target gene is AK172713///9430016H08Rik. In certain embodiments the off-target gene is 1700052N19Rik. In certain embodiments the off-target gene is Rnf6. In certain embodiments the off-target gene is Thtpa. In certain embodiments the off-target gene is Ormdl1. In certain embodiments the off-target gene is 2900026A02Rik. In certain embodiments the off-target gene is Polr2a. In certain embodiments the off-target gene is Ywhah. In certain embodiments the off-target gene is Krt18. In certain embodiments the off-target gene is Zfp518b. In certain embodiments the off-target gene is Spryd4. In certain embodiments the off-target gene is 0610010K14Rik. In certain embodiments the off-target gene is AU021838///Mipol1. In certain embodiments the off-target gene is Adam32. In certain embodiments the off-target gene is 2810422O20Rik. In certain embodiments the off-target gene is Lgals3 bp. In certain embodiments the off-target gene is Ltv1. In certain embodiments the off-target gene is Fahd1. In certain embodiments the off-target gene is 0610007P22Rik. In certain embodiments the off-target gene is Sf3b4. In certain embodiments the off-target gene is Fermt2. In certain embodiments the off-target gene is Znhit3. In certain embodiments the off-target gene is Znf746. In certain embodiments the off-target gene is Trnau1ap. In certain embodiments the off-target gene is Rpl13. In certain embodiments the off-target gene is Rpl24. In certain embodiments the off-target gene is Pdgfa. In certain embodiments the off-target gene is Tmem41a. In certain embodiments the off-target gene is Cep78. In certain embodiments the off-target gene is I1f2. In certain embodiments the off-target gene is 2510049J12Rik. In certain embodiments the off-target gene is Ap4b1. In certain embodiments the off-target gene is Ppp1r11. In certain embodiments the off-target gene is Arfgap2. In certain embodiments the off-target gene is Aldoc.

[0292] In certain embodiments the off-target gene is Hus1. In certain embodiments the off-target gene is Ppp2r1a. In certain embodiments the off-target gene is Setd6. In certain embodiments the off-target gene is AK036897///Trex1. In certain embodiments the off-target gene is Rpp38. In certain embodiments the off-target gene is Nars. In certain embodiments the off-target gene is Mrp150. In certain embodiments the off-target gene is Mthfd2. In certain embodiments the off-target gene is 2010321M09Rik. In certain embodiments the off-target gene is Lrrc57. In certain embodiments the off-target gene is Cox18. In certain embodiments the off-target gene is Umps. In certain embodiments the off-target gene is Prdx3. In certain embodiments the off-target gene is Usp18. In certain embodiments the off-target gene is Isgf3g. In certain embodiments the off-target gene is Nol11. In certain embodiments the off-target gene is Brf2. In certain embodiments the off-target gene is Ppid. In certain embodiments the off-target gene is Myadm. In certain embodiments the off-target gene is Krt8. In certain embodiments the off-target gene is Avpi1. In certain embodiments the off-target gene is Rab3d. In certain embodiments the off-target gene is Hn1. In certain embodiments the off-target gene is Ino80b. In certain embodiments the off-target gene is 2310016C08Rik. In certain embodiments the off-target gene is Gtf3a. In certain embodiments the off-target gene is Srrt. In certain embodiments the off-target gene is Nsbp1. In certain embodiments the off-target gene is Polr2h. In certain embodiments the off-target gene is Tomm5. In certain embodiments the off-target gene is Slc1a4. In certain embodiments the off-target gene is Bxdc2. In certain embodiments the off-target gene is Gemin4. In certain embodiments the off-target gene is Gb1. In certain embodiments the off-target gene is C87414///AA792892. In certain embodiments the off-target gene is AK052711. In certain embodiments the off-target gene is Ddx52. In certain embodiments the off-target gene is Commd3. In certain embodiments the off-target gene is Shmt2. In certain embodiments the off-target gene is Tmem97. In certain embodiments the off-target gene is Spy. In certain embodiments the off-target gene is Gar1. In certain embodiments the off-target gene is Esco2. In certain embodiments the off-target gene is 2310047B19Rik. In certain embodiments the off-target gene is Pop7.

[0293] In certain embodiments the off-target gene is Plrg1. In certain embodiments the off-target gene is Cct4. In certain embodiments the off-target gene is Cc19. In certain embodiments the off-target gene is Pnp1. In certain embodiments the off-target gene is Etaa1. In certain embodiments the off-target gene is Prss8. In certain embodiments the off-target gene is Rce1. In certain embodiments the off-target gene is Usp22. In certain embodiments the off-target gene is Ruvbl2. In certain embodiments the off-target gene is Impdh2. In certain embodiments the off-target gene is Npb. In certain embodiments the off-target gene is Exosc2. In certain embodiments the off-target gene is Dus41. In certain embodiments the off-target gene is 1700029J07Rik. In certain embodiments the off-target gene is 1700123020Rik. In certain embodiments the off-target gene is Nudt2. In certain embodiments the off-target gene is Gltpd1. In certain embodiments the off-target gene is Dbr1. In certain embodiments the off-target gene is Insl6. In certain embodiments the off-target gene is Rps4x. In certain embodiments the off-target gene is Ccdc51. In certain embodiments the off-target gene is Mrto4. In certain embodiments the off-target gene is Gde1. In certain embodiments the off-target gene is Hexim2. In certain embodiments the off-target gene is Atmin. In certain embodiments the off-target gene is Msl1. In certain embodiments the off-target gene is Qars. In certain embodiments the off-target gene is Dak. In certain embodiments the off-target gene is Ccrk. In certain embodiments the off-target gene is Armc6. In certain embodiments the off-target gene is 2810008M24Rik. In certain embodiments the off-target gene is Kdelc1///1700029F09Rik. In certain embodiments the off-target gene is Srd5a3. In certain embodiments the off-target gene is Hirip3. In certain embodiments the off-target gene is A430005L14Rik. In certain embodiments the off-target gene is BC026590. In certain embodiments the off-target gene is Cldn3///Wbscr25. In certain embodiments the off-target gene is Zfp637. In certain embodiments the off-target gene is Fen1. In certain embodiments the off-target gene is Alg5. In certain embodiments the off-target gene is Als2cr2///Stradb.

[0294] In certain embodiments the off-target gene is Rpl29. In certain embodiments the off-target gene is Tmub1. In certain embodiments the off-target gene is Rpl8. In certain embodiments the off-target gene is Zfp161. In certain embodiments the off-target gene is D4Wsu114e. In certain embodiments the off-target gene is Ddx28. In certain embodiments the off-target gene is Npm1. In certain embodiments the off-target gene is Nkrf. In certain embodiments the off-target gene is 1110058L19Rik. In certain embodiments the off-target gene is Snapc4. In certain embodiments the off-target gene is Nme3. In certain embodiments the off-target gene is Peo1. In certain embodiments the off-target gene is Rpl19. In certain embodiments the off-target gene is Pbx2. In certain embodiments the off-target gene is 2210411K11Rik. In certain embodiments the off-target gene is Rps10. In certain embodiments the off-target gene is Rps8. In certain embodiments the off-target gene is Nol6. In certain embodiments the off-target gene is Rps21. In certain embodiments the off-target gene is Hsd3b4. In certain embodiments the off-target gene is Parp16. In certain embodiments the off-target gene is Palm. In certain embodiments the off-target gene is Trip6. In certain embodiments the off-target gene is Acot6. In certain embodiments the off-target gene is Abhd14a. In certain embodiments the off-target gene is Mrp140. In certain embodiments the off-target gene is Rps12. In certain embodiments the off-target gene is Ptrh2. In certain embodiments the off-target gene is Trim21. In certain embodiments the off-target gene is Necap1. In certain embodiments the off-target gene is Ythdc1. In certain embodiments the off-target gene is Gpn3. In certain embodiments the off-target gene is Sfrs6. In certain embodiments the off-target gene is ENSMUSG00000059775///Rps26. In certain embodiments the off-target gene is Nup43. In certain embodiments the off-target gene is Rnps1. In certain embodiments the off-target gene is Psip1. In certain embodiments the off-target gene is Btbd6. In certain embodiments the off-target gene is Cdkn2aipn1. In certain embodiments the off-target gene is Rpl7. In certain embodiments the off-target gene is Eif2b4. In certain embodiments the off-target gene is Psma4. In certain embodiments the off-target gene is Zscan12. In certain embodiments the off-target gene is Rpl31. In certain embodiments the off-target gene is Kbtbd7. In certain embodiments the off-target gene is Dtwd1. In certain embodiments the off-target gene is 4930473A06Rik///AK029637. In certain embodiments the off-target gene is Mfap3. In certain embodiments the off-target gene is Ccdc130. In certain embodiments the off-target gene is Cdc34. In certain embodiments the off-target gene is Ifi30. In certain embodiments the off-target gene is Chac2. In certain embodiments the off-target gene is Ufsp1.

[0295] In certain embodiments the off-target gene is Gemin6. In certain embodiments the off-target gene is Igtp. In certain embodiments the off-target gene is Ankrd49. In certain embodiments the off-target gene is AK206957///AK050697. In certain embodiments the off-target gene is Ccdc32. In certain embodiments the off-target gene is ENSMUSG00000053178. In certain embodiments the off-target gene is Rccd1. In certain embodiments the off-target gene is Med11. In certain embodiments the off-target gene is 2810416G20Rik. In certain embodiments the off-target gene is F8a. In certain embodiments the off-target gene is Adat2. In certain embodiments the off-target gene is Sat1. In certain embodiments the off-target gene is Zcchc8. In certain embodiments the off-target gene is Pnrc2. In certain embodiments the off-target gene is Tmem129. In certain embodiments the off-target gene is Mrps22. In certain embodiments the off-target gene is 4930572J05Rik. In certain embodiments the off-target gene is Rpl12. In certain embodiments the off-target gene is Ino80c. In certain embodiments the off-target gene is Cdca7. In certain embodiments the off-target gene is Uspl1. In certain embodiments the off-target gene is BC031781. In certain embodiments the off-target gene is 2200002D01Rik. In certain embodiments the off-target gene is Hexim1. In certain embodiments the off-target gene is Thnsl1.

[0296] In certain embodiments the off-target gene is AK009724. In certain embodiments the off-target gene is Thyn1///mThy28. In certain embodiments the off-target gene is Prpf6. In certain embodiments the off-target gene is Med21. In certain embodiments the off-target gene is Wbp5. In certain embodiments the off-target gene is Iars. In certain embodiments the off-target gene is Mfsd10. In certain embodiments the off-target gene is Nt5dc2. In certain embodiments the off-target gene is 2010003K11Rik. In certain embodiments the off-target gene is Rpp21. In certain embodiments the off-target gene is Gimap1. In certain embodiments the off-target gene is Rassf7. In certain embodiments the off-target gene is Scrn2. In certain embodiments the off-target gene is Cd3eap. In certain embodiments the off-target gene is Ccdc85b. In certain embodiments the off-target gene is AK087382. In certain embodiments the off-target gene is Psmg1. In certain embodiments the off-target gene is Atic. In certain embodiments the off-target gene is Tmem179b. In certain embodiments the off-target gene is Kbtbd4. In certain embodiments the off-target gene is Tmem60. In certain embodiments the off-target gene is 2810026P18Rik. In certain embodiments the off-target gene is Zfp213. In certain embodiments the off-target gene is Psmg2. In certain embodiments the off-target gene is AA881470. In certain embodiments the off-target gene is Eef1d. In certain embodiments the off-target gene is Chchd5. In certain embodiments the off-target gene is Ube216. In certain embodiments the off-target gene is Gstm4. In certain embodiments the off-target gene is Taf1a. In certain embodiments the off-target gene is Slc26a1. In certain embodiments the off-target gene is Eral1. In certain embodiments the off-target gene is Mrp115///AK017820. In certain embodiments the off-target gene is Ccdc23. In certain embodiments the off-target gene is Fb1. In certain embodiments the off-target gene is C130022K22Rik. In certain embodiments the off-target gene is L00554292. In certain embodiments the off-target gene is Mrps18b. In certain embodiments the off-target gene is Tmem177. In certain embodiments the off-target gene is Brp16. In certain embodiments the off-target gene is Tlcd2. In certain embodiments the off-target gene is Rdh14. In certain embodiments the off-target gene is Tmem185b. In certain embodiments the off-target gene is Rpl35. In certain embodiments the off-target gene is Mrpl11. In certain embodiments the off-target gene is Ythdf2. In certain embodiments the off-target gene is Pdcd2. In certain embodiments the off-target gene is Eif2s3x. In certain embodiments the off-target gene is Aldoa.

[0297] In certain embodiments the off-target gene is Kat2a. In certain embodiments the off-target gene is Rdm1. In certain embodiments the off-target gene is Rplp2. In certain embodiments the off-target gene is 2610301G19Rik. In certain embodiments the off-target gene is Rpl3. In certain embodiments the off-target gene is Tnnc1. In certain embodiments the off-target gene is Pgam1. In certain embodiments the off-target gene is Smug1. In certain embodiments the off-target gene is 2310004I24Rik. In certain embodiments the off-target gene is Sap30. In certain embodiments the off-target gene is 1500012F01Rik. In certain embodiments the off-target gene is Sf3b3. In certain embodiments the off-target gene is Tagap///Tagap1. In certain embodiments the off-target gene is Ripk4. In certain embodiments the off-target gene is BC160215///Ids. In certain embodiments the off-target gene is Cbr4. In certain embodiments the off-target gene is Usp42. In certain embodiments the off-target gene is Trp53. In certain embodiments the off-target gene is Psmb6. In certain embodiments the off-target gene is Tapbpl. In certain embodiments the off-target gene is Jtv1. In certain embodiments the off-target gene is Khsrp. In certain embodiments the off-target gene is Oasl1. In certain embodiments the off-target gene is Hgs. In certain embodiments the off-target gene is Rps20. In certain embodiments the off-target gene is H2afx. In certain embodiments the off-target gene is Psmb4. In certain embodiments the off-target gene is Tgm1. In certain embodiments the off-target gene is Daxx. In certain embodiments the off-target gene is C1k2///Scamp3. In certain embodiments the off-target gene is Sfrs7. In certain embodiments the off-target gene is Slc35a4. In certain embodiments the off-target gene is Chtf8. In certain embodiments the off-target gene is Fiz1. In certain embodiments the off-target gene is Snrnp25. In certain embodiments the off-target gene is Tax1bp1. In certain embodiments the off-target gene is Rcan3. In certain embodiments the off-target gene is Scnm1. In certain embodiments the off-target gene is Coil. In certain embodiments the off-target gene is Cog8. In certain embodiments the off-target gene is Cdk4. In certain embodiments the off-target gene is Lsm2. In certain embodiments the off-target gene is Klf6. In certain embodiments the off-target gene is Cct8. In certain embodiments the off-target gene is Tmem107. In certain embodiments the off-target gene is Noc21. In certain embodiments the off-target gene is Armc10. In certain embodiments the off-target gene is C430004E15Rik. In certain embodiments the off-target gene is Rangrf. In certain embodiments the off-target gene is Kbtbd2. In certain embodiments the off-target gene is Impact. In certain embodiments the off-target gene is Rnmtl1. In certain embodiments the off-target gene is Fnta. In certain embodiments the off-target gene is Srxn1. In certain embodiments the off-target gene is Rpp14. In certain embodiments the off-target gene is AK003073. In certain embodiments the off-target gene is Rp115.

[0298] In certain embodiments the off-target gene is ENSMUSG00000074747. In certain embodiments the off-target gene is Casp2. In certain embodiments the off-target gene is 6330503K22Rik. In certain embodiments the off-target gene is Xaf1. In certain embodiments the off-target gene is Pus1. In certain embodiments the off-target gene is Rnf187. In certain embodiments the off-target gene is 2610024G14Rik. In certain embodiments the off-target gene is Mrps23. In certain embodiments the off-target gene is Mat2a. In certain embodiments the off-target gene is Eif5. In certain embodiments the off-target gene is Fem1b. In certain embodiments the off-target gene is Rp118. In certain embodiments the off-target gene is Mrps30. In certain embodiments the off-target gene is Rp128. In certain embodiments the off-target gene is Otub1. In certain embodiments the off-target gene is Mapk6. In certain embodiments the off-target gene is Tlr6. In certain embodiments the off-target gene is Rps24. In certain embodiments the off-target gene is Eif4a1. In certain embodiments the off-target gene is Pigp. In certain embodiments the off-target gene is Rars. In certain embodiments the off-target gene is Pyroxd1. In certain embodiments the off-target gene is Pabpc4. In certain embodiments the off-target gene is Rps19. In certain embodiments the off-target gene is Mrps16. In certain embodiments the off-target gene is Abcf2. In certain embodiments the off-target gene is Rilpl2. In certain embodiments the off-target gene is Thoc1. In certain embodiments the off-target gene is Gpatch4. In certain embodiments the off-target gene is AK009175. In certain embodiments the off-target gene is Eif2b2.

C. METHODS OF PREDICTING IN VITRO OR IN VIVO TOXICITY

[0299] In certain embodiments, a computer or any other means may be used to determine the amount of sequence complementarity between the nucleobase sequence of any oligomeric compound and the nucleobase sequence of any off-target gene. In certain embodiments, a computer or any other means may be used to determine the amount of sequence complementarity between the nucleobase sequence of any oligomeric compound and the nucleobase sequence of any sentinel gene. In certain embodiments, oligomeric compounds having high amounts of complementarity between their nucleobase sequence and any number of off-target genes and/or sentinel genes may indicate toxicity. In certain embodiments, one having skill in the art may select a minimum amount of complementarity between the nucleobase sequence of the oligomeric compound and the nucleobase sequence of any given off-target gene and/or sentinel gene. In certain embodiments, the nucleobase sequence of an oligomeric compound may have 90% complementarity with the nucleobase sequence of an off-target gene and/or sentinel gene. In certain embodiments, the nucleobase sequence of an oligomeric compound may have 100% complementarity with the nucleobase sequence of an off-target gene and/or sentinel gene.

[0300] In certain embodiments, the nucleobase sequence of an oligomeric compound may have 1 to 2 mismatches relative to the nucleobase sequence of an off-target gene and/or sentinel gene. In certain embodiments, the nucleobase sequence of an oligomeric compound may have 1 mismatch relative to the nucleobase sequence of an off-target gene and/or sentinel gene. In certain embodiments, the nucleobase sequence of an oligomeric compound may have 2 mismatches relative to the nucleobase sequence of an off-target gene and/or sentinel gene.

[0301] In certain embodiments, after one having skill in the art has selected a minimum amount of complementarity between the nucleobase sequence of the oligomeric compound and the nucleobase sequence of any given off-target gene and/or sentinel gene, the number of off-target genes and/or sentinel genes in a genome having an equal to or greater amount of complementarity with the oligomeric compound may be identified. In certain embodiments, before one having skill in the art has selected a minimum amount of complementarity between the nucleobase sequence of the oligomeric compound and the nucleobase sequence of any given off-target gene and/or sentinel gene, the total number of off-target genes and/or sentinel genes in a genome having an equal to or greater amount of complementarity with the oligomeric compound may be identified. In some embodiments, a computer is used to identify the number of off-target genes and/or sentinel gene in a genome that have an equal to or greater amount of complementarity with the oligomeric compound.

[0302] In certain embodiments, the total number of off-target genes and/or sentinel genes having an equal to or greater amount of complementarity with the oligomeric compound may be identified. In certain embodiments, the greater the number of off-target genes and/or sentinel genes having an equal to or greater amount of complementarity with the oligomeric compound indicates greater probability of in vitro and in vivo toxicity.

D. OLIGOMERIC COMPOUNDS

[0303] Certain methods disclosed herein provide for the identification of oligomeric compounds. In certain embodiments, the methods disclosed herein may be used to discover novel non-toxic oligomeric compounds. In certain embodiments, the methods disclosed herein may be used to discover novel non-toxic oligomer modifications or oligomer motifs. In certain embodiments, at least one oligomeric compounds that is predicted not to be toxic in vivo is made and then tested in an animal.

[0304] In certain embodiments, the present invention provides oligomeric compounds. In certain embodiments, such oligomeric compounds comprise oligonucleotides optionally comprising one or more conjugate and/or terminal groups. In certain embodiments, an oligomeric compound consists of an oligonucleotide. In certain embodiments, oligonucleotides comprise one or more chemical modifications. Such chemical modifications include modifications of one or more nucleoside (including modifications to the sugar moiety and/or the nucleobase) and/or modifications to one or more internucleoside linkage.

[0305] a. Certain Modified Nucleosides

[0306] In certain embodiments, provided herein are oligomeric compounds comprising or consisting of oligonuleotides comprising at least one modified nucleoside. Such modified nucleosides comprise a modified sugar moeity, a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

[0307] i. Certain Modified Sugar Moieties

[0308] In certain embodiments, compounds of the invention comprise one or more modified nucleosides comprising a modified sugar moiety. Such compounds comprising one or more sugar-modified nucleosides may have desirable properties, such as enhanced nuclease stability or increased binding affinity with a target nucleic acid relative to an oligonucleotide comprising only nucleosides comprising naturally occurring sugar moieties. In certain embodiments, modified sugar moieties are substituted sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of substituted sugar moieties.

[0309] In certain embodiments, modified sugar moieties are substituted sugar moieties comprising one or more non-bridging sugar substituent, including but not limited to substituents at the 2' and/or 5' positions. Examples of sugar substituents suitable for the 2'-position, include, but are not limited to: 2'-F, 2'-OCH.sub.3 ("OMe" or "O-methyl"), and 2'-O(CH.sub.2).sub.2OCH.sub.3 ("MOE"). In certain embodiments, sugar substituents at the 2' position is selected from allyl, amino, azido, thio, O-allyl, O--C.sub.1-C.sub.10 alkyl, O--C.sub.1-C.sub.10 substituted alkyl; OCF.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2--O--N(Rm)(Rn), and O--CH.sub.2--C(.dbd.O)--N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C.sub.1-C.sub.10 alkyl. Examples of sugar substituents at the 5'-position, include, but are not limited to: 5'-methyl (R or S); 5'-vinyl, and 5'-methoxy. In certain embodiments, substituted sugars comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties (see, e.g., PCT International Application WO 2008/101157, for additional 5',2'-bis substituted sugar moieties and nucleosides).

[0310] Nucleosides comprising 2'-substituted sugar moieties are referred to as 2'-substituted nucleosides. In certain embodiments, a 2'-substituted nucleoside comprises a 2'-substituent group selected from halo, allyl, amino, azido, SH, CN, OCN, CF.sub.3, OCF.sub.3, O, S, or N(R.sub.m)-alkyl; O, S, or N(R.sub.m)-alkenyl; O, S or N(R.sub.m)-alkynyl; O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3, O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n) or O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group or substituted or unsubstituted C.sub.1-C.sub.10 alkyl. These 2'-substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol, thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and alkynyl.

[0311] In certain embodiments, a 2'-substituted nucleoside comprises a 2'-substituent group selected from F, NH.sub.2, N.sub.3, OCF.sub.3, O--CH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2--CH.dbd.CH.sub.2, O--CH.sub.2--CH.dbd.CH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and N-substituted acetamide (O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n) where each R.sub.m and R.sub.n is, independently, H, an amino protecting group or substituted or unsubstituted C.sub.1-C.sub.10 alkyl.

[0312] In certain embodiments, a 2'-substituted nucleoside comprises a sugar moiety comprising a 2'-substituent group selected from F, OCF.sub.3, O--CH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O--(CH.sub.2).sub.2--O--N(CH.sub.3).sub.2, --O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and O--CH.sub.2--C(.dbd.O)--N(H)CH.sub.3.

[0313] In certain embodiments, a 2'-substituted nucleoside comprises a sugar moiety comprising a 2'-substituent group selected from F, O--CH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.

[0314] Certain modified sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4' to 2' sugar substituents, include, but are not limited to: --[C(R.sub.a)(R.sub.b)].sub.n--, --[C(R.sub.a)(R.sub.b)].sub.n--O--, --C(R.sub.aR.sub.b)--N(R)--O-- or, --C(R.sub.aR.sub.b)--O--N(R)--; 4'-CH.sub.2-2', 4'-(CH.sub.2).sub.2-2', 4'-(CH.sub.2).sub.3-2', 4'-(CH.sub.2)--O-2' (LNA); 4'-(CH.sub.2)--S-2; 4'-(CH.sub.2).sub.2--O-2' (ENA); 4'-CH(CH.sub.3)--O-2' (cEt) and 4'-CH(CH.sub.2OCH.sub.3)--O-2', and analogs thereof (see, e.g., U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4'-C(CH.sub.3)(CH.sub.3)--O-2' and analogs thereof, (see, e.g., WO2009/006478, published Jan. 8, 2009); 4'-CH.sub.2--N(OCH.sub.3)-2' and analogs thereof (see, e.g., WO2008/150729, published Dec. 11, 2008); 4'-CH.sub.2--O--N(CH.sub.3)-2' (see, e.g., US2004/0171570, published Sep. 2, 2004); 4'-CH.sub.2--O--N(R)-2', and 4'-CH.sub.2--N(R)--O-2'-, wherein each R is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl; 4'-CH.sub.2--N(R)--O-2', wherein R is H, C.sub.1-C.sub.12 alkyl, or a protecting group (see, U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4'-CH.sub.2--C(H)(CH.sub.3)-2' (see, e.g., Chattopadhyaya, et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH.sub.2--C(.dbd.CH.sub.2)-2' and analogs thereof (see, published PCT International Application WO 2008/154401, published on Dec. 8, 2008).

[0315] In certain embodiments, such 4' to 2' bridges independently comprise from 1 to 4 linked groups independently selected from --[C(R.sub.a)(R.sub.b)].sub.n--, --C(R.sub.a).dbd.C(R.sub.b)--, --C(R.sub.a).dbd.N--, --C(.dbd.NR.sub.a)--, --C(.dbd.O)--, --C(.dbd.S)--, --O--, --Si(R.sub.a).sub.2--, --S(.dbd.O).sub.x--, and --N(R.sub.a)--;

[0316] wherein:

[0317] x is 0, 1, or 2;

[0318] n is 1, 2, 3, or 4;

[0319] each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl (S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and

[0320] each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(.dbd.O)--H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.

[0321] Nucleosides comprising bicyclic sugar moieties are referred to as bicyclic nucleosides or BNAs. Bicyclic nucleosides include, but are not limited to, (A) .alpha.-L-Methyleneoxy (4'-CH.sub.2--O-2') BNA, (B) .beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') BNA (also referred to as locked nucleic acid or LNA), (C) Ethyleneoxy (4'-(CH.sub.2).sub.2--O-2') BNA, (D) Aminooxy (4'-CH.sub.2--O--N(R)-2') BNA, (E) Oxyamino (4'-CH.sub.2--N(R)--O-2') BNA, (F) Methyl(methyleneoxy) (4'-CH(CH.sub.3)--O-2') BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4'-CH.sub.2--S-2') BNA, (H) methylene-amino (4'-CH.sub.2--N(R)-2') BNA, (I) methyl carbocyclic (4'-CH.sub.2--CH(CH.sub.3)-2') BNA, (J) propylene carbocyclic (4'-(CH.sub.2).sub.3-2') BNA, and (K) Ethylene(methoxy) (4'-(CH(CH.sub.2OMe)-O-2') BNA (also referred to as constrained MOE or cMOE) as depicted below.

##STR00002## ##STR00003##

wherein Bx is a nucleobase moiety and R is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl.

[0322] Additional bicyclic sugar moieties are known in the art, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Pat. Nos. 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191, 6,670,461, and 7,399,845; WO 2004/106356, WO 1994/14226, WO 2005/021570, and WO 2007/134181; U.S. Patent Publication Nos. US2004/0171570, US2007/0287831, and US2008/0039618; U.S. patent Ser. Nos. 12/129,154, 60/989,574, 61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and 61/099,844; and PCT International Applications Nos. PCT/US2008/064591, PCT/US2008/066154, and PCT/US2008/068922.

[0323] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, a nucleoside comprising a 4'-2' methylene-oxy bridge, may be in the .alpha.-L configuration or in the .beta.-D configuration. Previously, .alpha.-L-methyleneoxy (4'-CH.sub.2--O-2') bicyclic nucleosides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

[0324] In certain embodiments, substituted sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5'-substituted and 4'-2' bridged sugars). (see, PCT International Application WO 2007/134181, published on Nov. 22, 2007, wherein LNA is substituted with, for example, a 5'-methyl or a 5'-vinyl group).

[0325] In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the naturally occurring sugar is substituted, e.g., with a sulfer, carbon or nitrogen atom. In certain such embodiments, such modified sugar moiety also comprises bridging and/or non-bridging substituents as described above. For example, certain sugar surrogates comprise a 4'-sulfer atom and a substitution at the 2'-position (see, e.g., published U.S. Patent Application US2005/0130923, published on Jun. 16, 2005) and/or the 5' position. By way of additional example, carbocyclic bicyclic nucleosides having a 4'-2' bridge have been described (see, e.g., Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740).

[0326] In certain embodiments, sugar surrogates comprise rings having other than 5-atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, C J. Bioorg. & Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA), and those compounds having Formula VII:

##STR00004##

wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula VII:

[0327] Bx is a nucleobase moiety;

[0328] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group;

q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted C.sub.2-C.sub.6 alkynyl; and

[0329] each of R.sub.1 and R.sub.2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2, NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2, and CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.

[0330] In certain embodiments, the modified THP nucleosides of Formula VII are provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is fluoro and R.sub.2 is H, R.sub.1 is methoxy and R.sub.2 is H, and R.sub.1 is methoxyethoxy and R.sub.2 is H.

[0331] Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see, e.g., review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841-854).

[0332] Combinations of modifications are also provided without limitation, such as 2'-F-5'-methyl substituted nucleosides (see PCT International Application WO 2008/101157 Published on Aug. 21, 2008 for other disclosed 5',2'-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5'-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007/134181, published on Nov. 22, 2007 wherein a 4'-CH.sub.2--O-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

[0333] In certain embodiments, the present invention provides oligonucleotides comprising modified nucleosides. Those modified nucleotides may include modified sugars, modified nucleobases, and/or modified linkages. The specific modifications are selected such that the resulting oligonucleotides possess desirable characteristics. In certain embodiments, oligonucleotides comprise one or more RNA-like nucleosides. In certain embodiments, oligonucleotides comprise one or more DNA-like nucleotides.

[0334] b. Certain Modified Nucleobases

[0335] In certain embodiments, nucleosides of the present invention comprise one or more unmodified nucleobases. In certain embodiments, nucleosides of the present invention comprise one or more modified nucleobases.

[0336] In certain embodiments, modified nucleobases are selected from: universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil; 5-propynylcytosine; 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (--C.ident.C--CH.sub.3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and 3-deazaadenine, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine ([5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288.

[0337] Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, U.S. Pat. Nos. 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,645,985; 5,681,941; 5,750,692; 5,763,588; 5,830,653 and 6,005,096, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.

[0338] c. Certain Internucleoside Linkages

[0339] In certain embodiments, nucleosides may be linked together using any internucleoside linkage to form oligonucleotides. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters (P.dbd.O), phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates (P.dbd.S). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (--CH.sub.2--N(CH.sub.3)--O--CH.sub.2--), thiodiester (--O--C(O)--S--), thionocarbamate (--O--C(O)(NH)--S--); siloxane (--O--Si(H).sub.2--O--); and N,N'-dimethylhydrazine (--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--). Modified linkages, compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

[0340] The oligonucleotides described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), .alpha. or .beta. such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the antisense compounds provided herein are all such possible isomers, as well as their racemic and optically pure forms.

[0341] Neutral internucleoside linkages include without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH.sub.2--N(CH.sub.3)--O-5'), amide-3 (3'-CH.sub.2--C(.dbd.O)--N(H)-5'), amide-4 (3'-CH.sub.2--N(H)--C(.dbd.O)-5'), formacetal (3'-O--CH.sub.2--O-5'), and thioformacetal (3'-S--CH.sub.2--O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH.sub.2 component parts.

[0342] d. Certain Motifs

[0343] In certain embodiments, oligomeric compounds comprise or consist of oligonucleotides. In certain embodiments, such oligonucleotides comprise one or more chemical modification. In certain embodiments, chemically modified oligonucleotides comprise one or more modified sugars. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleobases. In certain embodiments, chemically modified oligonucleotides comprise one or more modified internucleoside linkages. In certain embodiments, the chemical modifications (sugar modifications, nucleobase modifications, and/or linkage modifications) define a pattern or motif. In certain embodiments, the patterns of chemical modifications of sugar moieties, internucleoside linkages, and nucleobases are each independent of one another. Thus, an oligonucleotide may be described by its sugar modification motif, internucleoside linkage motif and/or nucleobase modification motif (as used herein, nucleobase modification motif describes the chemical modifications to the nucleobases independent of the sequence of nucleobases).

[0344] e. Certain Sugar Motifs

[0345] In certain embodiments, oligonucleotides comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar motif. Such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

[0346] In certain embodiments, the oligonucleotides comprise or consist of a region having a gapmer sugar motif, which comprises two external regions or "wings" and a central or internal region or "gap." The three regions of a gapmer sugar motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap. In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric sugar gapmer). In certain embodiments, the sugar motifs of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric sugar gapmer).

[0347] i. Certain Nucleobase Modification Motifs

[0348] In certain embodiments, oligonucleotides comprise chemical modifications to nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or nucleobases modification motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is chemically modified.

[0349] In certain embodiments, oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3'-end of the oligonucleotide. In certain embodiments the block is within 3 nucleotides of the 3'-end of the oligonucleotide. In certain such embodiments, the block is at the 5'-end of the oligonucleotide. In certain embodiments the block is within 3 nucleotides of the 5'-end of the oligonucleotide.

[0350] In certain embodiments, nucleobase modifications are a function of the natural base at a particular position of an oligonucleotide. For example, in certain embodiments each purine or each pyrimidine in an oligonucleotide is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each cytosine is modified. In certain embodiments, each uracil is modified.

[0351] In certain embodiments, oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In certain embodiments, oligonucleotides having a gapmer sugar motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobases is in the central gap of an oligonucleotide having a gapmer sugar motif. In certain embodiments, the sugar is an unmodified 2'deoxynucleoside. In certain embodiments, the modified nucleobase is selected from: a 2-thio pyrimidine and a 5-propyne pyrimidine

[0352] In certain embodiments, some, all, or none of the cytosine moieties in an oligonucleotide are 5-methyl cytosine moieties. Herein, 5-methyl cytosine is not a "modified nucleobase." Accordingly, unless otherwise indicated, unmodified nucleobases include both cytosine residues having a 5-methyl and those lacking a 5 methyl. In certain embodiments, the methylation state of all or some cytosine nucleobases is specified.

[0353] ii. Certain Nucleoside Motifs

[0354] In certain embodiments, oligonucleotides comprise nucleosides comprising modified sugar moieties and/or nucleosides comprising modified nucleobases. Such motifs can be described by their sugar motif and their nucleobase motif separately or by their nucleoside motif, which provides positions or patterns of modified nucleosides (whether modified sugar, nucleobase, or both sugar and nucleobase) in an oligonucleotide.

[0355] In certain embodiments, the oligonucleotides comprise or consist of a region having a gapmer nucleoside motif, which comprises two external regions or "wings" and a central or internal region or "gap." The three regions of a gapmer nucleoside motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties and/or nucleobases of the nucleosides of each of the wings differ from at least some of the sugar moieties and/or nucleobase of the nucleosides of the gap. Specifically, at least the nucleosides of each wing that are closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) differ from the neighboring gap nucleosides, thus defining the boundary between the wings and the gap. In certain embodiments, the nucleosides within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside that differs from one or more other nucleosides of the gap. In certain embodiments, the nucleoside motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the nucleoside motifs of the 5'-wing differs from the nucleoside motif of the 3'-wing (asymmetric gapmer).

[0356] 1. Certain 5'-Wings

[0357] In certain embodiments, the 5'-wing of a gapmer consists of 1 to 5 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 2 to 5 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 3 to 5 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 4 or 5 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 1 to 4 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 1 to 3 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 1 or 2 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 2 to 4 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 2 or 3 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 3 or 4 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 1 nucleoside. In certain embodiments, the 5'-wing of a gapmer consists of 2 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 3 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 4 linked nucleosides. In certain embodiments, the 5'-wing of a gapmer consists of 5 linked nucleosides.

[0358] In certain embodiments, the 5'-wing of a gapmer comprises at least one bicyclic nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least two bicyclic nucleosides. In certain embodiments, the 5'-wing of a gapmer comprises at least three bicyclic nucleosides. In certain embodiments, the 5'-wing of a gapmer comprises at least four bicyclic nucleosides. In certain embodiments, the 5'-wing of a gapmer comprises at least one constrained ethyl nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one LNA nucleoside. In certain embodiments, each nucleoside of the 5'-wing of a gapmer is a bicyclic nucleoside. In certain embodiments, each nucleoside of the 5'-wing of a gapmer is a constrained ethyl nucleoside. In certain embodiments, each nucleoside of the 5'-wing of a gapmer is a LNA nucleoside.

[0359] In certain embodiments, the 5'-wing of a gapmer comprises at least one non-bicyclic modified nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one 2'-substituted nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one 2'-MOE nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one 2'-OMe nucleoside. In certain embodiments, each nucleoside of the 5'-wing of a gapmer is a non-bicyclic modified nucleoside. In certain embodiments, each nucleoside of the 5'-wing of a gapmer is a 2'-substituted nucleoside. In certain embodiments, each nucleoside of the 5'-wing of a gapmer is a 2'-MOE nucleoside. In certain embodiments, each nucleoside of the 5'-wing of a gapmer is a 2'-OMe nucleoside.

[0360] In certain embodiments, the 5'-wing of a gapmer comprises at least one 2'-deoxynucleoside. In certain embodiments, each nucleoside of the 5'-wing of a gapmer is a 2'-deoxynucleoside. In a certain embodiments, the 5'-wing of a gapmer comprises at least one ribonucleoside. In certain embodiments, each nucleoside of the 5'-wing of a gapmer is a ribonucleoside. In certain embodiments, one, more than one, or each of the nucleosides of the 5'-wing is an RNA-like nucleoside.

[0361] In certain embodiments, the 5'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2'-substituted nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2'-MOE nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2'-OMe nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2'-deoxynucleoside.

[0362] In certain embodiments, the 5'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2'-substituted nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2'-MOE nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2'-OMe nucleoside. In certain embodiments, the 5'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2'-deoxynucleoside.

[0363] In certain embodiments, the 5'-wing of a gapmer has a nucleoside motif selected from among the following: ADDA; ABDAA; ABBA; ABB; ABAA; AABAA; AAABAA; AAAABAA; AAAAABAA; AAABAA; AABAA; ABAB; ABADB; ABADDB; AAABB; AAAAA; ABBDC; ABDDC; ABBDCC; ABBDDC; ABBDCC; ABBC; AA; AAA; AAAA; AAAAB; AAAAAAA; AAAAAAAA; ABBB; AB; ABAB; AAAAB; AABBB; AAAAB; and AABBB, wherein each A is a modified nucleoside of a first type, each B is a modified nucleoside of a second type, each C is a modified nucleoside of a third type, and each D is an unmodified deoxynucleoside.

[0364] In certain embodiments, an oligonucleotide comprises any 5'-wing motif provided herein. In certain such embodiments, the oligonucleotide is a 5'-hemimer (does not comprise a 3'-wing). In certain embodiments, such an oligonucleotide is a gapmer. In certain such embodiments, the 3'-wing of the gapmer may comprise any nucleoside motif.

[0365] 2. Certain 3'-Wings

[0366] In certain embodiments, the 3'-wing of a gapmer consists of 1 to 5 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 2 to 5 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 3 to 5 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 4 or 5 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 1 to 4 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 1 to 3 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 1 or 2 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 2 to 4 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 2 or 3 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 3 or 4 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 1 nucleoside. In certain embodiments, the 3'-wing of a gapmer consists of 2 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 3linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 4 linked nucleosides. In certain embodiments, the 3'-wing of a gapmer consists of 5 linked nucleosides.

[0367] In certain embodiments, the 3'-wing of a gapmer comprises at least one bicyclic nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one constrained ethyl nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one LNA nucleoside. In certain embodiments, each nucleoside of the 3'-wing of a gapmer is a bicyclic nucleoside. In certain embodiments, each nucleoside of the 3'-wing of a gapmer is a constrained ethyl nucleoside. In certain embodiments, each nucleoside of the 3'-wing of a gapmer is a LNA nucleoside.

[0368] In certain embodiments, the 3'-wing of a gapmer comprises at least one non-bicyclic modified nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least two non-bicyclic modified nucleosides. In certain embodiments, the 3'-wing of a gapmer comprises at least three non-bicyclic modified nucleosides. In certain embodiments, the 3'-wing of a gapmer comprises at least four non-bicyclic modified nucleosides. In certain embodiments, the 3'-wing of a gapmer comprises at least one 2'-substituted nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one 2'-MOE nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one 2'-OMe nucleoside. In certain embodiments, each nucleoside of the 3'-wing of a gapmer is a non-bicyclic modified nucleoside. In certain embodiments, each nucleoside of the 3'-wing of a gapmer is a 2'-substituted nucleoside. In certain embodiments, each nucleoside of the 3'-wing of a gapmer is a 2'-MOE nucleoside. In certain embodiments, each nucleoside of the 3'-wing of a gapmer is a 2'-OMe nucleoside.

[0369] In certain embodiments, the 3'-wing of a gapmer comprises at least one 2'-deoxynucleoside. In certain embodiments, each nucleoside of the 3'-wing of a gapmer is a 2'-deoxynucleoside. In a certain embodiments, the 3'-wing of a gapmer comprises at least one ribonucleoside. In certain embodiments, each nucleoside of the 3'-wing of a gapmer is a ribonucleoside. In certain embodiments, one, more than one, or each of the nucleosides of the 5'-wing is an RNA-like nucleoside.

[0370] In certain embodiments, the 3'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2'-substituted nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2'-MOE nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2'-OMe nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2'-deoxynucleoside.

[0371] In certain embodiments, the 3'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2'-substituted nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2'-MOE nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2'-OMe nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2'-deoxynucleoside.

[0372] In certain embodiments, the 3'-wing of a gapmer comprises at least one LNA nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one LNA nucleoside and at least one 2'-substituted nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one LNA nucleoside and at least one 2'-MOE nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one LNA nucleoside and at least one 2'-OMe nucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one LNA nucleoside and at least one 2'-deoxynucleoside.

[0373] In certain embodiments, the 3'-wing of a gapmer comprises at least one bicyclic nucleoside, at least one non-bicyclic modified nucleoside, and at least one 2'-deoxynucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one constrained ethyl nucleoside, at least one non-bicyclic modified nucleoside, and at least one 2'-deoxynucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one LNA nucleoside, at least one non-bicyclic modified nucleoside, and at least one 2'-deoxynucleoside.

[0374] In certain embodiments, the 3'-wing of a gapmer comprises at least one bicyclic nucleoside, at least one 2'-substituted nucleoside, and at least one 2'-deoxynucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one constrained ethyl nucleoside, at least one 2'-substituted nucleoside, and at least one 2'-deoxynucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one LNA nucleoside, at least one 2'-substituted nucleoside, and at least one 2'-deoxynucleoside.

[0375] In certain embodiments, the 3'-wing of a gapmer comprises at least one bicyclic nucleoside, at least one 2'-MOE nucleoside, and at least one 2'-deoxynucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one constrained ethyl nucleoside, at least one 2'-MOE nucleoside, and at least one 2'-deoxynucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one LNA nucleoside, at least one 2'-MOE nucleoside, and at least one 2'-deoxynucleoside.

[0376] In certain embodiments, the 3'-wing of a gapmer comprises at least one bicyclic nucleoside, at least one 2'-OMe nucleoside, and at least one 2'-deoxynucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one constrained ethyl nucleoside, at least one 2'-OMe nucleoside, and at least one 2'-deoxynucleoside. In certain embodiments, the 3'-wing of a gapmer comprises at least one LNA nucleoside, at least one 2'-OMe nucleoside, and at least one 2'-deoxynucleoside.

[0377] In certain embodiments, the 3'-wing of a gapmer has a nucleoside motif selected from among the following: ABB; ABAA; AAABAA, AAAAABAA; AABAA; AAAABAA; AAABAA; ABAB; AAAAA; AAABB; AAAAAAAA; AAAAAAA; AAAAAA; AAAAB; AAAA; AAA; AA; AB; ABBB; ABAB; AABBB; wherein each A is a modified nucleoside of a first type, each B is a modified nucleoside of a second type. In certain embodiments, an oligonucleotide comprises any 3'-wing motif provided herein. In certain such embodiments, the oligonucleotide is a 3'-hemimer (does not comprise a 5'-wing). In certain embodiments, such an oligonucleotide is a gapmer. In certain such embodiments, the 5'-wing of the gapmer may comprise any nucleoside motif.

[0378] 3. Certain Central Regions (Gaps)

[0379] In certain embodiments, the gap of a gapmer consists of 6 to 20 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 to 15 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 to 12 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 to 10 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 to 9 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 to 8 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 or 7 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 7 to 10 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 7 to 9 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 7 or 8 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 8 to 10 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 8 or 9 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 6 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 7 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 8 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 9 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 10 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 11 linked nucleosides. In certain embodiments, the gap of a gapmer consists of 12 linked nucleosides.

[0380] In certain embodiments, each nucleoside of the gap of a gapmer is a 2'-deoxynucleoside. In certain embodiments, the gap comprises one or more modified nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer is a 2'-deoxynucleoside or is a modified nucleoside that is "DNA-like." In such embodiments, "DNA-like" means that the nucleoside has similar characteristics to DNA, such that a duplex comprising the gapmer and an RNA molecule is capable of activating RNase H. For example, under certain conditions, 2'-(ara)-F have been shown to support RNase H activation, and thus is DNA-like. In certain embodiments, one or more nucleosides of the gap of a gapmer is not a 2'-deoxynucleoside and is not DNA-like. In certain such embodiments, the gapmer nonetheless supports RNase H activation (e.g., by virtue of the number or placement of the non-DNA nucleosides).

[0381] In certain embodiments, gaps comprise a stretch of unmodified 2'-deoxynucleoside interrupted by one or more modified nucleosides, thus resulting in three sub-regions (two stretches of one or more 2'-deoxynucleosides and a stretch of one or more interrupting modified nucleosides). In certain embodiments, no stretch of unmodified 2'-deoxynucleosides is longer than 5, 6, or 7 nucleosides. In certain embodiments, such short stretches is achieved by using short gap regions. In certain embodiments, short stretches are achieved by interrupting a longer gap region.

[0382] 4. Certain Gapmer Motifs

[0383] In certain embodiments, a gapmer comprises a 5'-wing, a gap, and a 3' wing, wherein the 5'-wing, gap, and 3' wing are independently selected from among those discussed above. For example, in certain embodiments, a gapmer has a 5'-wing, a gap, and a 3'-wing having features selected from among those listed in the following non-limiting table:

TABLE-US-00004 TABLE 4 Certain Gapmer Nucleoside Motifs 5'-wing 3'-wing region Central gap region region ADDA DDDDDD ABB ABBA DDDADDDD ABAA AAAAAAA DDDDDDDDDDD AAA AAAAABB DDDDDDDD BBAAAAA ABB DDDDADDDD ABB ABB DDDDBDDDD BBA ABB DDDDDDDDD BBA AABAA DDDDDDDDD AABAA ABB DDDDDD AABAA AAABAA DDDDDDDDD AAABAA AAABAA DDDDDDDDD AAB ABAB DDDDDDDDD ABAB AAABB DDDDDDD BBA ABADB DDDDDDD BBA ABA DBDDDDDDD BBA ABA DADDDDDDD BBA ABAB DDDDDDDD BBA AA DDDDDDDD BBBBBBBB ABB DDDDDD ABADB AAAAB DDDDDDD BAAAA ABBB DDDDDDDDD AB AB DDDDDDDDD BBBA ABBB DDDDDDDDD BBBA AB DDDDDDDD ABA ABB DDDDWDDDD BBA AAABB DDDWDDD BBAAA ABB DDDDWWDDD BBA ABADB DDDDDDD BBA ABBDC DDDDDDD BBA ABBDDC DDDDDD BBA ABBDCC DDDDDD BBA ABB DWWDWWDWW BBA ABB DWDDDDDDD BBA ABB DDWDDDDDD BBA ABB DWWDDDDDD BBA AAABB DDWDDDDDD AA BB DDWDWDDDD BBABBBB ABB DDDD(.sup.ND)DDDD BBA AAABB DDD(.sup.ND)DDD BBAAA ABB DDDD(.sup.ND)(.sup.ND)DDD BBA ABB D(.sup.ND)(.sup.ND)D(.sup.ND)(.sup.ND)D(.sup.ND)(.sup.ND) BBA ABB D(.sup.ND)DDDDDDD BBA ABB DD(.sup.ND)DDDDDD BBA ABB D(.sup.ND)(.sup.ND)DDDDDD BBA AAABB DD(.sup.ND)DDDDDD AA BB DD(.sup.ND)D(.sup.ND)DDDD BBABBBB

wherein each A is a modified nucleoside of a first type, each B is a modified nucleoside of a second type and each W is a modified nucleoside of either the first type, the second type or a third type, each D is a nucleoside comprising an unmodified 2'deoxy sugar moiety and unmodified nucleobase, and .sup.ND is modified nucleoside comprising a modified nucleobase and an unmodified 2'deoxy sugar moiety.

[0384] In certain embodiments, each A comprises a modified sugar moiety. In certain embodiments, each A comprises a 2'-substituted sugar moiety. In certain embodiments, each A comprises a 2'-substituted sugar moiety selected from among F, ara-F, OCH.sub.3 and O(CH.sub.2).sub.2--OCH.sub.3. In certain embodiments, each A comprises a bicyclic sugar moiety. In certain embodiments, each A comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, .alpha.-L-LNA, ENA and 2'-thio LNA. In certain embodiments, each A comprises a modified nucleobase. In certain embodiments, each A comprises a modified nucleobase selected from among 2-thio-thymidine nucleoside and 5-propyne uridine nucleoside.

[0385] In certain embodiments, each B comprises a modified sugar moiety. In certain embodiments, each B comprises a 2'-substituted sugar moiety. In certain embodiments, each B comprises a 2'-substituted sugar moiety selected from among F, (ara)-F, OCH.sub.3 and O(CH.sub.2).sub.2--OCH.sub.3. In certain embodiments, each B comprises a bicyclic sugar moiety. In certain embodiments, each B comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, .alpha.-L-LNA, ENA and 2'-thio LNA. In certain embodiments, each B comprises a modified nucleobase. In certain embodiments, each B comprises a modified nucleobase selected from among 2-thio-thymidine nucleoside and 5-propyne urindine nucleoside.

[0386] In certain embodiments, each C comprises a modified sugar moiety. In certain embodiments, each C comprises a 2'-substituted sugar moiety. In certain embodiments, each C comprises a 2'-substituted sugar moiety selected from among F, (ara)-F, OCH.sub.3 and O(CH.sub.2).sub.2--OCH.sub.3. In certain embodiments, each C comprises a 5'-substituted sugar moiety. In certain embodiments, each C comprises a 5'-substituted sugar moiety selected from among 5'-Me, and 5'-(R)-Me. In certain embodiments, each C comprises a bicyclic sugar moiety. In certain embodiments, each C comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, .alpha.-L-LNA, ENA and 2'-thio LNA. In certain embodiments, each C comprises a modified nucleobase. In certain embodiments, each C comprises a modified nucleobase selected from among 2-thio-thymidine and 5-propyne uridine.

[0387] In certain embodiments, each W comprises a modified sugar moiety. In certain embodiments, each W comprises a 2'-substituted sugar moiety. In certain embodiments, each W comprises a 2'-substituted sugar moiety selected from among F, (ara)-F, OCH.sub.3 and O(CH.sub.2).sub.2--OCH.sub.3. In certain embodiments, each W comprises a 5'-substituted sugar moiety. In certain embodiments, each W comprises a 5'-substituted sugar moiety selected from among 5'-Me, and 5'-(R)-Me. In certain embodiments, each W comprises a bicyclic sugar moiety. In certain embodiments, each W comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, .alpha.-L-LNA, ENA and 2'-thio LNA. In certain embodiments, each W comprises a sugar surrogate. In certain embodiments, each W comprises a sugar surrogate selected from among HNA and F-HNA.

[0388] In certain embodiments, at least one of A or B comprises a bicyclic sugar moiety, and the other comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2'-F sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2'-F sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside and the other of A or B comprises a 2'-F sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2'-(ara)-F sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2'-(ara)-F sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside and the other of A or B comprises a 2'-(ara)-F sugar moiety.

[0389] In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2'-substituted sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2'-substituted sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2'-substituted sugar moiety. In certain embodiments, A is an .alpha.-L-LNA nucleoside and B comprises a 2'-substituted sugar moiety.

[0390] In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2'-MOE sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2'-MOE sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2'-MOE sugar moiety. In certain embodiments, A is an .alpha.-L-LNA nucleoside and B comprises a 2'-MOE sugar moiety.

[0391] In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2'-F sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2'-F sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2'-F sugar moiety. In certain embodiments, A is an .alpha.-L-LNA nucleoside and B comprises a 2'-F sugar moiety.

[0392] In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2'-(ara)-F sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2'-(ara)-F sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2'-(ara)-F sugar moiety. In certain embodiments, A is an .alpha.-L-LNA nucleoside and B comprises a 2'-(ara)-F sugar moiety.

[0393] In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2'-MOE sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2'-MOE sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2'-MOE sugar moiety. In certain embodiments, B is an .alpha.-L-LNA nucleoside and A comprises a 2'-MOE sugar moiety.

[0394] In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2'-F sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2'-F sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2'-F sugar moiety. In certain embodiments, B is an .alpha.-L-LNA nucleoside and A comprises a 2'-F sugar moiety.

[0395] In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2'-(ara)-F sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2'-(ara)-F sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2'-(ara)-F sugar moiety. In certain embodiments, B is an .alpha.-L-LNA nucleoside and A comprises a 2'-(ara)-F sugar moiety.

[0396] In certain embodiments, at least one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-substituted sugar moiety and W comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-substituted sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-substituted sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-substituted sugar moiety, and W comprises a modified nucleobase.

[0397] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a modified nucleobase.

[0398] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a modified nucleobase.

[0399] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a modified nucleobase.

[0400] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-substituted sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-substituted sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-substituted sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-substituted sugar moiety, and W comprises a 2-thio-thymidine nucleobase.

[0401] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 2-thio-thymidine nucleobase.

[0402] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 2-thio-thymidine nucleobase.

[0403] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises 2-thio-thymidine nucleobase.

[0404] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase.

[0405] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5-propyne uridine nucleobase.

[0406] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5-propyne uridine nucleobase.

[0407] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a sugar surrogate.

[0408] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a sugar surrogate.

[0409] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises sugar surrogate.

[0410] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a HNA sugar surrogate.

[0411] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a sugar HNA surrogate.

[0412] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a HNA sugar surrogate.

[0413] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a F-HNA sugar surrogate.

[0414] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a F-HNA sugar surrogate.

[0415] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a F-HNA sugar surrogate.

[0416] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-Me DNA sugar moiety.

[0417] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety.

[0418] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety.

[0419] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety.

[0420] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety.

[0421] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety.

[0422] In certain embodiments, at least two of A, B or W comprises a 2'-substituted sugar moiety, and the other comprises a bicyclic sugar moiety. In certain embodiments, at least two of A, B or W comprises a bicyclic sugar moiety, and the other comprises a 2'-substituted sugar moiety. In certain embodiments, a gapmer has a sugar motif other than: E-K-K-(D).sub.9-K-K-E; E-E-E-E-K-(D).sub.9-E-E-E-E-E; E-K-K-K-(D).sub.9-K-K-K-E; K-E-E-K-(D).sub.9-K-E-E-K; K-D-D-K-(D).sub.9-K-D-D-K; K-E-K-E-K-(D).sub.9-K-E-K-E-K; K-D-K-D-K-(D).sub.9-K-D-K-D-K; E-K-E-K-(D).sub.9-K-E-K-E; E-E-E-E-E-K-(D).sub.9-E-E-E-E-E; or E-K-E-K-E-(D).sub.9-E-K-E-K-E, wherein K is a nucleoside comprising a cEt sugar moiety and E is a nucleoside comprising a 2'-MOE sugar moiety.

[0423] iii. Certain Internucleoside Linkage Motifs

[0424] In certain embodiments, oligonucleotides comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, internucleoside linkages are arranged in a gapped motif, as described above for nucleoside motif. In such embodiments, the internucleoside linkages in each of two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments the internucleoside linkages in the wings are phosphodiester and the internucleoside linkages in the gap are phosphorothioate. The nucleoside motif is independently selected, so such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped nucleoside motif and if it does have a gapped nucleoside motif, the wing and gap lengths may or may not be the same.

[0425] In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides of the present invention comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.

[0426] In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3' end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3' end of the oligonucleotide.

[0427] In certain embodiments, oligonucleotides comprise one or more methylphosponate linkages. In certain embodiments, oligonucleotides having a gapmer nucleoside motif comprise a linkage motif comprising all phosphorothioate linkages except for one or two methylphosponate linkages. In certain embodiments, one methylphosponate linkage is in the central gap of an oligonucleotide having a gapmer nucleoside motif.

[0428] iv. Certain Modification Motifs

[0429] Modification motifs define oligonucleotides by nucleoside motif (sugar motif and nucleobase motif) and linkage motif. For example, certain oligonucleotides have the following modification motif: [0430] A.sub.sA.sub.sA.sub.sD.sub.sD.sub.sD.sub.sD.sub.s(.sup.ND).sub.sD.sub.sD.- sub.sD.sub.sD.sub.sB.sub.sB.sub.sB; wherein each A is a modified nucleoside comprising a 2'-substituted sugar moiety; each D is an unmodified 2'-deoxynucleoside; each B is a modified nucleoside comprising a bicyclic sugar moiety; .sup.ND is a modified nucleoside comprising a modified nucleobase; and s is a phosphorothioate internucleoside linkage. Thus, the sugar motif is a gapmer motif. The nucleobase modification motif is a single modified nucleobase at 8.sup.th nucleoside from the 5'-end. Combining the sugar motif and the nucleobase modification motif, the nucleoside motif is an interrupted gapmer where the gap of the sugar modified gapmer is interrupted by a nucleoside comprising a modified nucleobase. The linkage motif is uniform phosphorothioate. The following non-limiting Table further illustrates certain modification motifs:

TABLE-US-00005 [0430] TABLE 5 Certain Modification Motifs 5'-wing region Central gap region 3'-wing region B.sub.sB.sub.s .sub.sD.sub.sD.sub.sD.sub.sD.sub.sD.sub.sD.sub.sD.sub.sD.sub.sD.sub.s A.sub.sA.sub.sA.sub.sA.sub.sA.sub.sA.sub.sA.sub.sA AsBsBs DsDsDsDsDsDsDsDsDs BsBsA AsBsBs DsDsDsDs(.sup.ND)SDsDsDsDs BsBsA AsBsBs DsDsDsDsAsDsDsDsDs BsBsA AsBsBs DsDsDsDsBsDsDsDsDs BsBsA AsBsBs DsDsDsDsWsDsDsDsDs BsBsA AsBsBsBs DsDsDsDsDsDsDsDsDs BsBsAsBsB AsBsBs DsDsDsDsDsDsDsDsDs BsBsAsBsB BsBsAsBsBs DsDsDsDsDsDsDsDsDs BsBsA AsBsBs DsDsDsDsDsDsDsDsDs BsBsAsBsBsBsB AsAsBsAsAs DsDsDsDsDsDsDsDsDs BsBsA AsAsAsBsAsAs DsDsDsDsDsDsDsDsDs BsBsA AsAsBsAsAs DsDsDsDsDsDsDsDsDs AsAsBsAsA AsAsAsBsAsAs DsDsDsDsDsDsDsDsDs AsAsBsAsAsA AsAsAsAsBsAsAs DsDsDsDsDsDsDsDsDs BsBsA AsBsAsBs DsDsDsDsDsDsDsDsDs BsAsBsA AsBsAsBs DsDsDsDsDsDsDsDsDs AsAsBsAsAs AsBsBs DsDsDsDsDsDsDsDsDs BsAsBsA BsBsAsBsBsBsB DsDsDsDsDsDsDsDsDs BsAsBsA AsAsAsAsAs DsDsDsDsDsDsDsDsDs AsAsAsAsA AsAsAsAsAs DsDsDsDsDsDsDs AsAsAsAsA AsAsAsAsAs DsDsDsDsDsDsDsDsDs BsBsAsBsBsBsB AsAsAsBsBs DsDsDsDsDsDsDs BsBsA AsBsAsBs DsDsDsDsDsDsDsDs BsBsA AsBsAsBs DsDsDsDsDsDsDs AsAsAsBsBs AsAsAsAsBs DsDsDsDsDsDsDs BsAsAsAsA BsBs DsDsDsDsDsDsDsDs ASA AsAs DsDsDsDsDsDsDs AsAsAsAsAsAsAsA AsAsAs DsDsDsDsDsDsDs AsAsAsAsAsAsA AsAsAs DsDsDsDsDsDsDs AsAsAsAsAsA AsBs DsDsDsDsDsDsDs BsBsBsA AsBsBsBs DsDsDsDsDsDsDsDsDs BSA AsBs DsDsDsDsDsDsDsDsDs BsBsBsA AsAsAsBsBs DsDsDs(.sup.ND)sDsDsDs BsBsAsAsA AsAsAsBsBs DsDsDsAsDsDsDs BsBsAsAsA AsAsAsBsBs DsDsDsBsDsDsDs BsBsAsAsA AsAsAsAsBs DsDsDsDsDsDsDs BsAsAsAsA AsAsBsBsBs DsDsDsDsDsDsDs BsBsBsAsA AsAsAsAsBs DsDsDsDsDsDsDs AsAsAsAsAs AsAsAsBsBs DsDsDsDsDsDsDs AsAsAsAsAs AsAsBsBsBs DsDsDsDsDsDsDs AsAsAsAsAs AsAsAsAsAs DsDsDsDsDsDsDs BsAsAsAsAs AsAsAsAsAs DsDsDsDsDsDsDs BsBsAsAsAs AsAsAsAsAs DsDsDsDsDsDsDs BsBsBsAsAs AsBsBs DsDsDsDs(.sup.ND)s(.sup.ND)sDsDsDs BsBsA AsBsBs Ds(.sup.ND)s(.sup.ND)sDs(.sup.ND)s(.sup.ND)sDs(.sup.ND)s(.sup.ND)s BsBsA AsBsBs Ds(.sup.ND)sDsDsDsDsDsDsDs BsBsA AsBsBs DsDs(.sup.ND)sDsDsDsDsDsDs BsBsA AsBsBs Ds(.sup.ND)s(.sup.ND)sDsDsDsDsDsDs BsBsA AsBsBs DsDs(D)zDsDsDsDsDsDs BsBsA AsBsBs Ds(D)zDsDsDsDsDsDsDs BsBsA AsBsBs (D)zDsDsDsDsDsDsDsDs BsBsA AsBsBs DsDsAsDsDsDsDsDsDs BsBsA AsBsBs DsDsBsDsDsDsDsDsDs BsBsA AsBsBs AsDsDsDsDsDsDsDsDs BsBsA AsBsBs BsDsDsDsDsDsDsDsDs BsBsA AsBsAsBs DsDs(D)zDsDsDsDsDsDs BsBsBsAsAs AsAsAsBsBs DsDs(.sup.ND)SDsDsDsDsDsDs ASA AsBsBsBs Ds(D)zDsDsDsDsDsDsDs AsAsAsBsBs AsBsBs DsDsDsDsDsDsDsDs(D)z BsBsA AsAsBsBsBs DsDsDsAsDsDsDs BsBsBsAsA AsAsBsBsBs DsDsDsBsDsDsDs BsBsBsAsA AsBsAsBs DsDsDsAsDsDsDs BsBsAsBsBsBsB AsBsBsBs DsDsDsDs(D)zDsDsDsDs BsA AsAsBsBsBs DsDsAsAsDsDsDs BsBsA AsBsBs DsDsDsDs(D)zDsDsDsDs BsBsBsA BsBs DsDs(.sup.ND)sDs(.sup.ND)sDsDsDsDs BsBsAsBsBsBsB

wherein each A and B are nucleosides comprising differently modified sugar moieties, each D is a nucleoside comprising an unmodified 2'deoxy sugar moiety, each W is a modified nucleoside of either the first type, the second type or a third type, each .sup.ND is a modified nucleoside comprising a modified nucleobase, s is a phosphorothioate internucleoside linkage, and z is a non-phosphorothioate internucleoside linkage.

[0431] In certain embodiments, each A comprises a modified sugar moiety. In certain embodiments, each A comprises a 2'-substituted sugar moiety. In certain embodiments, each A comprises a 2'-substituted sugar moiety selected from among F, (ara)-F, OCH.sub.3 and O(CH.sub.2).sub.2--OCH.sub.3. In certain embodiments, each A comprises a bicyclic sugar moiety. In certain embodiments, each A comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, .alpha.-L-LNA, ENA and 2'-thio LNA. In certain embodiments, each A comprises a modified nucleobase. In certain embodiments, each A comprises a modified nucleobase selected from among 2-thio-thymidine nucleoside and 5-propyne uridine nucleoside. In certain embodiments, each B comprises a modified sugar moiety. In certain embodiments, each B comprises a 2'-substituted sugar moiety. In certain embodiments, each B comprises a 2'-substituted sugar moiety selected from among F, (ara)-F, OCH.sub.3 and O(CH.sub.2).sub.2--OCH.sub.3. In certain embodiments, each B comprises a bicyclic sugar moiety. In certain embodiments, each B comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, .alpha.-L-LNA, ENA and 2'-thio LNA. In certain embodiments, each B comprises a modified nucleobase. In certain embodiments, each B comprises a modified nucleobase selected from among 2-thio-thymidine nucleoside and 5-propyne urindine nucleoside.

[0432] In certain embodiments, each W comprises a modified sugar moiety. In certain embodiments, each W comprises a 2'-substituted sugar moiety. In certain embodiments, each W comprises a 2'-substituted sugar moiety selected from among F, (ara)-F, OCH.sub.3 and O(CH.sub.2).sub.2--OCH.sub.3. In certain embodiments, each W comprises a 5'-substituted sugar moiety. In certain embodiments, each W comprises a 5'-substituted sugar moiety selected from among 5'-Me, and 5'-(R)-Me. In certain embodiments, each W comprises a bicyclic sugar moiety. In certain embodiments, each W comprises a bicyclic sugar moiety selected from among cEt, cMOE, LNA, .alpha.-L-LNA, ENA and 2'-thio LNA. In certain embodiments, each W comprises a sugar surrogate. In certain embodiments, each W comprises a sugar surrogate selected from among HNA and F-HNA.

[0433] In certain embodiments, at least one of A or B comprises a bicyclic sugar moiety, and the other comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside and the other of A or B comprises a 2'-substituted sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside and the other of A or B comprises a 2'-MOE sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2'-F sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2'-F sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside and the other of A or B comprises a 2'-F sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside and the other of A or B comprises a 2'-(ara)-F sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside and the other of A or B comprises a 2'-(ara)-F sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside and the other of A or B comprises a 2'-(ara)-F sugar moiety.

[0434] In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2'-substituted sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2'-substituted sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2'-substituted sugar moiety. In certain embodiments, A is an .alpha.-L-LNA nucleoside and B comprises a 2'-substituted sugar moiety.

[0435] In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2'-MOE sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2'-MOE sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2'-MOE sugar moiety. In certain embodiments, A is an .alpha.-L-LNA nucleoside and B comprises a 2'-MOE sugar moiety.

[0436] In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2'-F sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2'-F sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2'-F sugar moiety. In certain embodiments, A is an .alpha.-L-LNA nucleoside and B comprises a 2'-F sugar moiety.

[0437] In certain embodiments, A comprises a bicyclic sugar moiety, and B comprises a 2'-(ara)-F sugar moiety. In certain embodiments, A is an LNA nucleoside and B comprises a 2'-(ara)-F sugar moiety. In certain embodiments, A is a cEt nucleoside and B comprises a 2'-(ara)-F sugar moiety. In certain embodiments, A is an .alpha.-L-LNA nucleoside and B comprises a 2'-(ara)-F sugar moiety.

[0438] In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2'-MOE sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2'-MOE sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2'-MOE sugar moiety. In certain embodiments, B is an .alpha.-L-LNA nucleoside and A comprises a 2'-MOE sugar moiety.

[0439] In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2'-F sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2'-F sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2'-F sugar moiety. In certain embodiments, B is an .alpha.-L-LNA nucleoside and A comprises a 2'-F sugar moiety.

[0440] In certain embodiments, B comprises a bicyclic sugar moiety, and A comprises a 2'-(ara)-F sugar moiety. In certain embodiments, B is an LNA nucleoside and A comprises a 2'-(ara)-F sugar moiety. In certain embodiments, B is a cEt nucleoside and A comprises a 2'-(ara)-F sugar moiety. In certain embodiments, B is an .alpha.-L-LNA nucleoside and A comprises a 2'-(ara)-F sugar moiety.

[0441] In certain embodiments, at least one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-substituted sugar moiety and W comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-substituted sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-substituted sugar moiety, and C comprises a modified nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-substituted sugar moiety, and W comprises a modified nucleobase.

[0442] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a modified nucleobase.

[0443] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a modified nucleobase.

[0444] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a modified nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a modified nucleobase.

[0445] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-substituted sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-substituted sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-substituted sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-substituted sugar moiety, and W comprises a 2-thio-thymidine nucleobase.

[0446] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 2-thio-thymidine nucleobase.

[0447] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 2-thio-thymidine nucleobase.

[0448] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 2-thio-thymidine nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises 2-thio-thymidine nucleobase.

[0449] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and C comprises a 5-propyne uridine nucleobase.

[0450] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and C comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5-propyne uridine nucleobase.

[0451] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5-propyne uridine nucleobase. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5-propyne uridine nucleobase.

[0452] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a sugar surrogate.

[0453] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a sugar surrogate.

[0454] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises sugar surrogate.

[0455] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a HNA sugar surrogate.

[0456] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a sugar HNA surrogate.

[0457] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a HNA sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a HNA sugar surrogate.

[0458] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a F-HNA sugar surrogate.

[0459] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a F-HNA sugar surrogate.

[0460] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a F-HNA sugar surrogate. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a F-HNA sugar surrogate.

[0461] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-Me DNA sugar moiety.

[0462] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety.

[0463] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-Me DNA sugar moiety.

[0464] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-MOE sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety.

[0465] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety.

[0466] In certain embodiments, one of A or B comprises a bicyclic sugar moiety, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is a cEt nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety. In certain embodiments, one of A or B is an .alpha.-L-LNA nucleoside, another of A or B comprises a 2'-(ara)-F sugar moiety, and W comprises a 5'-(R)-Me DNA sugar moiety.

[0467] In certain embodiments, at least two of A, B or W comprises a 2'-substituted sugar moiety, and the other comprises a bicyclic sugar moiety. In certain embodiments, at least two of A, B or W comprises a bicyclic sugar moiety, and the other comprises a 2'-substituted sugar moiety.

[0468] f. Certain Overall Lengths

[0469] In certain embodiments, the present invention provides oligomeric compounds including oligonucleotides of any of a variety of ranges of lengths. In certain embodiments, the invention provides oligomeric compounds or oligonucleotides consisting of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X<Y. For example, in certain embodiments, the invention provides oligomeric compounds which comprise oligonucleotides consisting of 8 to 9, 8 to 10, 8 to 11, 8 to 12, 8 to 13, 8 to 14, 8 to 15, 8 to 16, 8 to 17, 8 to 18, 8 to 19, 8 to 20, 8 to 21, 8 to 22, 8 to 23, 8 to 24, 8 to 25, 8 to 26, 8 to 27, 8 to 28, 8 to 29, 8 to 30, 9 to 10, 9 to 11, 9 to 12, 9 to 13, 9 to 14, 9 to 15, 9 to 16, 9 to 17, 9 to 18, 9 to 19, 9 to 20, 9 to 21, 9 to 22, 9 to 23, 9 to 24, 9 to 25, 9 to 26, 9 to 27, 9 to 28, 9 to 29, 9 to 30, 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10 to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22, 10 to 23, 10 to 24, 10 to 25, 10 to 26, 10 to 27, 10 to 28, 10 to 29, 10 to 30, 11 to 12, 11 to 13, 11 to 14, 11 to 15, 11 to 16, 11 to 17, 11 to 18, 11 to 19, 11 to 20, 11 to 21, 11 to 22, 11 to 23, 11 to 24, 11 to 25, 11 to 26, 11 to 27, 11 to 28, 11 to 29, 11 to 30, 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides. In embodiments where the number of nucleosides of an oligomeric compound or oligonucleotide is limited, whether to a range or to a specific number, the oligomeric compound or oligonucleotide may, nonetheless further comprise additional other substituents. For example, an oligonucleotide comprising 8-30 nucleosides excludes oligonucleotides having 31 nucleosides, but, unless otherwise indicated, such an oligonucleotide may further comprise, for example one or more conjugates, terminal groups, or other substituents. In certain embodiments, a gapmer oligonucleotide has any of the above lengths.

[0470] Further, where an oligonucleotide is described by an overall length range and by regions having specified lengths, and where the sum of specified lengths of the regions is less than the upper limit of the overall length range, the oligonucleotide may have additional nucleosides, beyond those of the specified regions, provided that the total number of nucleosides does not exceed the upper limit of the overall length range.

[0471] g. Certain Oligonucleotides

[0472] In certain embodiments, oligonucleotides of the present invention are characterized by their modification motif and overall length. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar-gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region. Likewise, such sugar-gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. One of skill in the art will appreciate that such motifs may be combined to create a variety of oligonucleotides. Herein if a description of an oligonucleotide or oligomeric compound is silent with respect to one or more parameter, such parameter is not limited. Thus, an oligomeric compound described only as having a gapmer sugar motif without further description may have any length, internucleoside linkage motif, and nucleobase modification motif. Unless otherwise indicated, all chemical modifications are independent of nucleobase sequence.

[0473] h. Certain Conjugate Groups

[0474] In certain embodiments, oligomeric compounds are modified by attachment of one or more conjugate groups. In general, conjugate groups modify one or more properties of the attached oligomeric compound including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance. Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional conjugate linking moiety or conjugate linking group to a parent compound such as an oligomeric compound, such as an oligonucleotide. Conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes. Certain conjugate groups have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).

[0475] In certain embodiments, a conjugate group comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

[0476] In certain embodiments, conjugate groups are directly attached to oligonucleotides in oligomeric compounds. In certain embodiments, conjugate groups are attached to oligonucleotides by a conjugate linking group. In certain such embodiments, conjugate linking groups, including, but not limited to, bifunctional linking moieties such as those known in the art are amenable to the compounds provided herein. Conjugate linking groups are useful for attachment of conjugate groups, such as chemical stabilizing groups, functional groups, reporter groups and other groups to selective sites in a parent compound such as for example an oligomeric compound. In general a bifunctional linking moiety comprises a hydrocarbyl moiety having two functional groups. One of the functional groups is selected to bind to a parent molecule or compound of interest and the other is selected to bind essentially any selected group such as chemical functional group or a conjugate group. In some embodiments, the conjugate linker comprises a chain structure or an oligomer of repeating units such as ethylene glycol or amino acid units. Examples of functional groups that are routinely used in a bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In some embodiments, bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), and the like.

[0477] Some nonlimiting examples of conjugate linking moieties include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other linking groups include, but are not limited to, substituted C.sub.1-C.sub.10 alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0478] Conjugate groups may be attached to either or both ends of an oligonucleotide (terminal conjugate groups) and/or at any internal position.

[0479] In certain embodiments, conjugate groups are at the 3'-end of an oligonucleotide of an oligomeric compound. In certain embodiments, conjugate groups are near the 3'-end. In certain embodiments, conjugates are attached at the 3' end of an oligomeric compound, but before one or more terminal group nucleosides. In certain embodiments, conjugate groups are placed within a terminal group.

[0480] In certain embodiments, the present invention provides oligomeric compounds. In certain embodiments, oligomeric compounds comprise an oligonucleotide. In certain embodiments, an oligomeric compound comprises an oligonucleotide and one or more conjugate and/or terminal groups. Such conjugate and/or terminal groups may be added to oligonucleotides having any of the motifs discussed above. Thus, for example, an oligomeric compound comprising an oligonucleotide having region of alternating nucleosides may comprise a terminal group.

E. ANTISENSE COMPOUNDS

[0481] In certain embodiments, oligomeric compounds provided herein are antisense compounds. Such antisense compounds are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, antisense compounds specifically hybridize to one or more target nucleic acid. In certain embodiments, a specifically hybridizing antisense compound has a nucleobase sequence comprising a region having sufficient complementarity to a target nucleic acid to allow hybridization and result in antisense activity and insufficient complementarity to any non-target so as to avoid non-specific hybridization to any non-target nucleic acid sequences under conditions in which specific hybridization is desired (e.g., under physiological conditions for in vivo or therapeutic uses, and under conditions in which assays are performed in the case of in vitro assays).

[0482] In certain embodiments, the present invention provides antisense compounds comprising oligonucleotides that are fully complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are 95% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 90% complementary to the target nucleic acid.

[0483] In certain embodiments, such oligonucleotides are 85% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 80% complementary to the target nucleic acid. In certain embodiments, an antisense compound comprises a region that is fully complementary to a target nucleic acid and is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain such embodiments, the region of full complementarity is from 6 to 14 nucleobases in length.

[0484] a. Certain Antisense Activities and Mechanisms

[0485] In certain antisense activities, hybridization of an antisense compound results in recruitment of a protein that cleaves of the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The "DNA" in such an RNA:DNA duplex, need not be unmodified DNA. In certain embodiments, the invention provides antisense compounds that are sufficiently "DNA-like" to elicit RNase H activity. Such DNA-like antisense compounds include, but are not limited to gapmers having unmodified deoxyfuronose sugar moieties in the nucleosides of the gap and modified sugar moieties in the nucleosides of the wings.

[0486] Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid; a change in the ratio of splice variants of a nucleic acid or protein; and/or a phenotypic change in a cell or animal.

[0487] In certain embodiments, compounds comprising oligonucleotides having a gapmer nucleoside motif described herein have desirable properties compared to non-gapmer oligonucleotides or to gapmers having other motifs. In certain circumstances, it is desirable to identify motifs resulting in a favorable combination of potent antisense activity and relatively low toxicity. In certain embodiments, compounds of the present invention have a favorable therapeutic index (measure of potency divided by measure of toxicity).

F. CERTAIN PHARMACEUTICAL COMPOSITIONS

[0488] In certain embodiments, the present invention provides pharmaceutical compositions comprising one or more antisense compound. In certain embodiments, such pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more antisense compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more antisense compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile water. In certain embodiments, the sterile saline is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile phosphate-buffered saline (PBS). In certain embodiments, the sterile saline is pharmaceutical grade PBS.

[0489] In certain embodiments, antisense compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0490] Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising antisense compounds comprise one or more oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0491] A prodrug can include the incorporation of additional nucleosides at one or both ends of an oligomeric compound which are cleaved by endogenous nucleases within the body, to form the active antisense oligomeric compound.

[0492] Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.

[0493] In certain embodiments, pharmaceutical compositions provided herein comprise one or more modified oligonucleotides and one or more excipients. In certain such embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

[0494] In certain embodiments, a pharmaceutical composition provided herein comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.

[0495] In certain embodiments, a pharmaceutical composition provided herein comprises one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.

[0496] In certain embodiments, a pharmaceutical composition provided herein comprises a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80.TM. and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80.TM.; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.

[0497] In certain embodiments, a pharmaceutical composition provided herein is prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration.

[0498] In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, such suspensions may also contain suitable stabilizers or agents that increase the solubility of the pharmaceutical agents to allow for the preparation of highly concentrated solutions.

[0499] In certain embodiments, a pharmaceutical composition is prepared for transmucosal administration. In certain of such embodiments penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

[0500] In certain embodiments, a pharmaceutical composition provided herein comprises an oligonucleotide in a therapeutically effective amount. In certain embodiments, the therapeutically effective amount is sufficient to prevent, alleviate or ameliorate symptoms of a disease or to prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art.

[0501] In certain embodiments, one or more modified oligonucleotide provided herein is formulated as a prodrug. In certain embodiments, upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically or therapeutically more active form of an oligonucleotide. In certain embodiments, prodrugs are useful because they are easier to administer than the corresponding active form. For example, in certain instances, a prodrug may be more bioavailable (e.g., through oral administration) than is the corresponding active form. In certain instances, a prodrug may have improved solubility compared to the corresponding active form. In certain embodiments, prodrugs are less water soluble than the corresponding active form. In certain instances, such prodrugs possess superior transmittal across cell membranes, where water solubility is detrimental to mobility. In certain embodiments, a prodrug is an ester. In certain such embodiments, the ester is metabolically hydrolyzed to carboxylic acid upon administration. In certain instances the carboxylic acid containing compound is the corresponding active form. In certain embodiments, a prodrug comprises a short peptide (polyaminoacid) bound to an acid group. In certain of such embodiments, the peptide is cleaved upon administration to form the corresponding active form.

[0502] In certain embodiments, the present invention provides compositions and methods for reducing the amount or activity of a target nucleic acid in a cell. In certain embodiments, the cell is in an animal. In certain embodiments, the animal is a mammal. In certain embodiments, the animal is a rodent. In certain embodiments, the animal is a primate. In certain embodiments, the animal is a non-human primate. In certain embodiments, the animal is a human.

[0503] In certain embodiments, the present invention provides methods of administering a pharmaceutical composition comprising an oligomeric compound of the present invention to an animal. Suitable administration routes include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, through inhalation, intrathecal, intracerebroventricular, intraperitoneal, intranasal, intraocular, intratumoral, and parenteral (e.g., intravenous, intramuscular, intramedullary, and subcutaneous). In certain embodiments, pharmaceutical intrathecals are administered to achieve local rather than systemic exposures. For example, pharmaceutical compositions may be injected directly in the area of desired effect (e.g., into the liver).

NONLIMITING DISCLOSURE AND INCORPORATION BY REFERENCE

[0504] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.

[0505] Although the sequence listing accompanying this filing identifies each sequence as either "RNA" or "DNA" as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as "RNA" or "DNA" to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2'-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2'-OH for the natural 2'-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).

[0506] Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence "AUCGAUCG" and those having some DNA bases and some RNA bases such as "AUCGATCG" and oligomeric compounds having other modified or naturally occurring bases, such as "AT.sup.meCGAUCG," wherein .sup.meC indicates a cytosine base comprising a methyl group at the 5-position.

EXAMPLES

[0507] The following examples illustrate certain embodiments of the present invention and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.

Example 1

Synthesis of Oligomeric Compounds

[0508] The oligomeric compounds used in accordance with this disclosure may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as alkylated derivatives and those having phosphorothioate linkages.

[0509] Oligomeric compounds: Unsubstituted and substituted phosphodiester (P.dbd.O) oligomeric compounds, including without limitation, oligonucleotides can be synthesized on an automated DNA synthesizer (Applied Biosystems model 394) using standard phosphoramidite chemistry with oxidation by iodine.

[0510] In certain embodiments, phosphorothioate internucleoside linkages (P.dbd.S) are synthesized similar to phosphodiester internucleoside linkages with the following exceptions: thiation is effected by utilizing a 10% w/v solution of 3,H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the oxidation of the phosphite linkages. The thiation reaction step time is increased to 180 sec and preceded by the normal capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55.degree. C. (12-16 hr), the oligomeric compounds are recovered by precipitating with greater than 3 volumes of ethanol from a 1 M NH.sub.4OAc solution. Phosphinate internucleoside linkages can be prepared as described in U.S. Pat. No. 5,508,270.

[0511] Alkyl phosphonate internucleoside linkages can be prepared as described in U.S. Pat. No. 4,469,863.

[0512] 3'-Deoxy-3'-methylene phosphonate internucleoside linkages can be prepared as described in U.S. Pat. No. 5,610,289 or 5,625,050.

[0513] Phosphoramidite internucleoside linkages can be prepared as described in U.S. Pat. No. 5,256,775 or U.S. Pat. No. 5,366,878.

[0514] Alkylphosphonothioate internucleoside linkages can be prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively).

[0515] 3'-Deoxy-3'-amino phosphoramidate internucleoside linkages can be prepared as described in U.S. Pat. No. 5,476,925.

[0516] Phosphotriester internucleoside linkages can be prepared as described in U.S. Pat. No. 5,023,243.

[0517] Borano phosphate internucleoside linkages can be prepared as described in U.S. Pat. Nos. 5,130,302 and 5,177,198.

[0518] Oligomeric compounds having one or more non-phosphorus containing internucleoside linkages including without limitation methylenemethylimino linked oligonucleosides, also identified as MMI linked oligonucleosides, methylenedimethylhydrazo linked oligonucleosides, also identified as MDH linked oligonucleosides, methylenecarbonylamino linked oligonucleosides, also identified as amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked oligonucleosides, also identified as amide-4 linked oligonucleosides, as well as mixed backbone oligomeric compounds having, for instance, alternating MMI and P.dbd.O or P.dbd.S linkages can be prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023, 5,489,677, 5,602,240 and 5,610,289.

[0519] Formacetal and thioformacetal internucleoside linkages can be prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564.

[0520] Ethylene oxide internucleoside linkages can be prepared as described in U.S. Pat. No. 5,223,618.

Example 2

Isolation and Purification of Oligomeric Compounds

[0521] After cleavage from the controlled pore glass solid support or other support medium and deblocking in concentrated ammonium hydroxide at 55.degree. C. for 12-16 hours, the oligomeric compounds, including without limitation oligonucleotides and oligonucleosides, are recovered by precipitation out of 1 M NH.sub.4OAc with >3 volumes of ethanol. Synthesized oligomeric compounds are analyzed by electrospray mass spectroscopy (molecular weight determination) and by capillary gel electrophoresis. The relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis is determined by the ratio of correct molecular weight relative to the -16 amu product (+/-32+/-48). For some studies oligomeric compounds are purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171. Results obtained with HPLC-purified material are generally similar to those obtained with non-HPLC purified material.

Example 3

Synthesis of Oligomeric Compounds Using the 96 Well Plate Format

[0522] Oligomeric compounds, including without limitation oligonucleotides, can be synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a 96-well format. Phosphodiester internucleoside linkages are afforded by oxidation with aqueous iodine. Phosphorothioate internucleoside linkages are generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard base-protected beta-cyanoethyl-diiso-propyl phosphoramidites can be purchased from commercial vendors (e.g. PE-Applied Biosystems, Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard nucleosides are synthesized as per standard or patented methods and can be functionalized as base protected beta-cyanoethyldiisopropyl phosphoramidites.

[0523] Oligomeric compounds can be cleaved from support and deprotected with concentrated NH.sub.4OH at elevated temperature (55-60.degree. C.) for 12-16 hours and the released product then dried in vacuo. The dried product is then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.

Example 4

Analysis of Oligomeric Compounds Using the 96-Well Plate Format

[0524] The concentration of oligomeric compounds in each well can be assessed by dilution of samples and UV absorption spectroscopy. The full-length integrity of the individual products can be evaluated by capillary electrophoresis (CE) in either the 96-well format (Beckman P/ACE.TM. MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACE.TM. 5000, ABI 270). Base and backbone composition is confirmed by mass analysis of the oligomeric compounds utilizing electrospray-mass spectroscopy. All assay test plates are diluted from the master plate using single and multi-channel robotic pipettors. Plates are judged to be acceptable if at least 85% of the oligomeric compounds on the plate are at least 85% full length.

Example 5

In Vitro Treatment of Cells with Oligomeric Compounds

[0525] The effect of oligomeric compounds on target nucleic acid expression is tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. Cell lines derived from multiple tissues and species can be obtained from American Type Culture Collection (ATCC, Manassas, Va.).

[0526] The following cell type is provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, ribonuclease protection assays or RT-PCR.

[0527] b.END cells: The mouse brain endothelial cell line b.END was obtained from Dr. Werner Risau at the Max Plank Institute (Bad Nauheim, Germany). b.END cells are routinely cultured in DMEM, high glucose (Invitrogen Life Technologies, Carlsbad, Calif.) supplemented with 10% fetal bovine serum (Invitrogen Life Technologies, Carlsbad, Calif.). Cells are routinely passaged by trypsinization and dilution when they reached approximately 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #353872, BD Biosciences, Bedford, Mass.) at a density of approximately 3000 cells/well for uses including but not limited to oligomeric compound transfection experiments.

[0528] Experiments involving treatment of cells with oligomeric compounds:

[0529] When cells reach appropriate confluency, they are treated with oligomeric compounds using a transfection method as described.

[0530] LIPOFECTIN.TM.

[0531] When cells reached 65-75% confluency, they are treated with one or more oligomeric compounds. The oligomeric compound is mixed with LIPOFECTIN.TM. Invitrogen Life Technologies, Carlsbad, Calif.) in Opti-MEM.TM.-1 reduced serum medium (Invitrogen Life Technologies, Carlsbad, Calif.) to achieve the desired concentration of the oligomeric compound(s) and a LIPOFECTIN.TM. concentration of 2.5 or 3 .mu.g/mL per 100 nM oligomeric compound(s). This transfection mixture is incubated at room temperature for approximately 0.5 hours. For cells grown in 96-well plates, wells are washed once with 100 .mu.L OPTI-MEM.TM.-1 and then treated with 130 .mu.L, of the transfection mixture. Cells grown in 24-well plates or other standard tissue culture plates are treated similarly, using appropriate volumes of medium and oligomeric compound(s). Cells are treated and data are obtained in duplicate or triplicate. After approximately 4-7 hours of treatment at 37.degree. C., the medium containing the transfection mixture is replaced with fresh culture medium. Cells are harvested 16-24 hours after treatment with oligomeric compound(s).

[0532] Other suitable transfection reagents known in the art include, but are not limited to, CYTOFECTIN.TM., LIPOFECTAMINE.TM., OLIGOFECTAMINE.TM., and FUGENE.TM.. Other suitable transfection methods known in the art include, but are not limited to, electroporation.

Example 6

Real-Time Quantitative PCR Analysis of Target mRNA Levels

[0533] Quantitation of target mRNA levels is accomplished by real-time quantitative PCR using the ABI PRISM.TM. 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., FAM or JOE, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 5' end of the probe and a quencher dye (e.g., TAMRA, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 3' end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 3' quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5'-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM.TM. Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.

[0534] Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be "multiplexed" with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only ("single-plexing"), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and coefficient of determination of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed multiplexable. Other methods of PCR are also known in the art.

[0535] RT and PCR reagents are obtained from Invitrogen Life Technologies (Carlsbad, Calif.). RT, real-time PCR is carried out by adding 20 .mu.L PCR cocktail (2.5.times.PCR buffer minus MgCl.sub.2, 6.6 mM MgCl.sub.2, 375 .mu.M each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM.RTM. Taq, 5 Units MuLV reverse transcriptase, and 2.5.times.ROX dye) to 96-well plates containing 30 .mu.L total RNA solution (20-200 ng). The RT reaction is carried out by incubation for 30 minutes at 48.degree. C. Following a 10 minute incubation at 95.degree. C. to activate the PLATINUM.RTM. Taq, 40 cycles of a two-step PCR protocol are carried out: 95.degree. C. for 15 seconds (denaturation) followed by 60.degree. C. for 1.5 minutes (annealing/extension).

[0536] Gene target quantities obtained by RT, real-time PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RIBOGREEN.TM. (Molecular Probes, Inc. Eugene, Oreg.). GAPDH expression is quantified by real time RT-PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RiboGreen.TM. RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.). Methods of RNA quantification by RIBOGREEN.TM. are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374).

[0537] In this assay, 170 .mu.L of RIBOGREEN.TM. working reagent (RIBOGREEN.TM. reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 30 .mu.L purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485 nm and emission at 530 nm.

Example 7

Analysis of Oligonucleotide Inhibition of Target Expression

[0538] Antisense modulation of a target expression can be assayed in a variety of ways known in the art. For example, a target mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR. Real-time quantitative PCR is presently desired. RNA analysis can be performed on total cellular RNA or poly(A)+mRNA. One method of RNA analysis of the present disclosure is the use of total cellular RNA as described in other examples herein. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISM.TM. 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.

[0539] Protein levels of a target can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA) or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Methods for preparation of polyclonal antisera are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of monoclonal antibodies is taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley & Sons, Inc., 1997.

[0540] Immunoprecipitation methods are standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley & Sons, Inc., 1998. Western blot (immunoblot) analysis is standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked immunosorbent assays (ELISA) are standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc., 1991.

Example 8

Design of Phenotypic Assays and In Vivo Studies for the Use of Target Inhibitors

Phenotypic Assays

[0541] Once target inhibitors have been identified by the methods disclosed herein, the oligomeric compounds are further investigated in one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the treatment of a particular disease state or condition.

[0542] Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to investigate the role and/or association of a target in health and disease. Representative phenotypic assays, which can be purchased from any one of several commercial vendors, include those for determining cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, Oreg.; PerkinElmer, Boston, Mass.), protein-based assays including enzymatic assays (Panvera, LLC, Madison, Wis.; BD Biosciences, Franklin Lakes, N.J.; Oncogene Research Products, San Diego, Calif.), cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor, Mich.), triglyceride accumulation (Sigma-Aldrich, St. Louis, Mo.), angiogenesis assays, tube formation assays, cytokine and hormone assays and metabolic assays (Chemicon International Inc., Temecula, Calif.; Amersham Biosciences, Piscataway, N.J.).

[0543] In one non-limiting example, cells determined to be appropriate for a particular phenotypic assay (i.e., MCF-7 cells selected for breast cancer studies; adipocytes for obesity studies) are treated with a target inhibitors identified from the in vitro studies as well as control compounds at optimal concentrations which are determined by the methods described above. At the end of the treatment period, treated and untreated cells are analyzed by one or more methods specific for the assay to determine phenotypic outcomes and endpoints.

[0544] Phenotypic endpoints include changes in cell morphology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Measurements of cellular status which include pH, stage of the cell cycle, intake or excretion of biological indicators by the cell, are also endpoints of interest.

[0545] Measurement of the expression of one or more of the genes of the cell after treatment is also used as an indicator of the efficacy or potency of the a target inhibitors. Hallmark genes, or those genes suspected to be associated with a specific disease state, condition, or phenotype, are measured in both treated and untreated cells.

Example 9

RNA Isolation

[0546] Poly(A)+mRNA isolation

[0547] Poly(A)+mRNA is isolated according to Miura et al., (Clin. Chem., 1996, 42, 1758-1764). Other methods for poly(A)+mRNA isolation are routine in the art. Briefly, for cells grown on 96-well plates, growth medium is removed from the cells and each well is washed with 200 .mu.L cold PBS. 60 .mu.L lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) is added to each well, the plate is gently agitated and then incubated at room temperature for five minutes. 55 .mu.L of lysate is transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine Calif.). Plates are incubated for 60 minutes at room temperature, washed 3 times with 200 .mu.L of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate is blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60 .mu.L of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70.degree. C., is added to each well, the plate is incubated on a 90.degree. C. hot plate for 5 minutes, and the eluate is then transferred to a fresh 96-well plate.

[0548] Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions.

Total RNA Isolation

[0549] Total RNA is isolated using an RNEASY 96.TM. kit and buffers purchased from Qiagen Inc. (Valencia, Calif.) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium is removed from the cells and each well is washed with 200 .mu.L cold PBS. 150 .mu.L Buffer RLT is added to each well and the plate vigorously agitated for 20 seconds. 150 .mu.L of 70% ethanol is then added to each well and the contents mixed by pipetting three times up and down. The samples are then transferred to the RNEASY 96.TM. well plate attached to a QIAVAC.TM. manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum is applied for 1 minute. 500 .mu.L of Buffer RW1 is added to each well of the RNEASY 96.TM. plate and incubated for 15 minutes and the vacuum is again applied for 1 minute. An additional 500 .mu.L of Buffer RW1 is added to each well of the RNEASY 96.TM. plate and the vacuum is applied for 2 minutes. 1 mL of Buffer RPE is then added to each well of the RNEASY 96.TM. plate and the vacuum applied for a period of 90 seconds. The Buffer RPE wash is then repeated and the vacuum is applied for an additional 3 minutes. The plate is then removed from the QIAVAC.TM. manifold and blotted dry on paper towels. The plate is then re-attached to the QIAVAC.TM. manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA is then eluted by pipetting 140 .mu.L of RNAse free water into each well, incubating 1 minute, and then applying the vacuum for 3 minutes.

[0550] The repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.). Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.

Example 10

Target-Specific Primers and Probes

[0551] Probes and primers may be designed to hybridize to a target sequence, using published sequence information.

[0552] For example, for human PTEN, the following primer-probe set was designed using published sequence information (GENBANK.TM. accession number U92436.1, SEQ ID NO: 1).

TABLE-US-00006 Forward primer: (SEQ ID NO: 2) AATGGCTAAGTGAAGATGACAATCAT Reverse primer: (SEQ ID NO: 3) TGCACATATCATTACACCAGTTCGT And the PCR probe: (SEQ ID NO: 4) FAM-TTGCAGCAATTCACTGTAAAGCTGGAAAGG-TAMRA, where FAM is the fluorescent dye and TAMRA is the quencher dye.

Example 11

Western Blot Analysis of Target Protein Levels

[0553] Western blot analysis (immunoblot analysis) is carried out using standard methods. Cells are harvested 16-20 h after oligonucleotide treatment, washed once with PBS, suspended in Laemmli buffer (100 .mu.l/well), boiled for 5 minutes and loaded on a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and transferred to membrane for western blotting. Appropriate primary antibody directed to a target is used, with a radiolabeled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands are visualized using a PHOSPHORIMAGER.TM. (Molecular Dynamics, Sunnyvale Calif.).

Example 12

2-10-2 LNA Gapmers

[0554] The following gapmers comprising a 2-10-2 LNA motif were prepared using the procedures as described above. A subscript "1" indicates a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH.sub.2--O-2'bridge.

TABLE-US-00007 TABLE 6 LNA Gapmers SEQ ISIS No. Motif Sequence Backbone ID NO 457847 2-10-2 C.sub.1C.sub.1TGGTGTACACC.sub.1C.sub.1 Uniform PS 5 457848 2-10-2 G.sub.1G.sub.1TCCCTGCAGTA.sub.1C.sub.1 Uniform PS 6

Example 13

FVII on-Target Knockdown

[0555] The inhibitory concentrations of ISIS No. 457847 and ISIS No. 457848 are presented in Table 6. The inhibitory concentrations were calculated by plotting the doses of ISIS No. 457847 and ISIS No. 457848 versus the percent inhibition of FVII mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 10%, 20%, 50%, 80%, and 90% inhibition of FVII mRNA expression was achieved compared to the control. This example demonstrates that both Isis No. 457847 and Isis No. 457848 are potent inhibitors of FVII, and that Isis No. 457848 is a more potent inhibitor of FVII than Isis No. 457847. In this example, FVII is the "target," all other genes are "off-target genes."

TABLE-US-00008 TABLE 7 24 hours Dose (mg/kg) Isis No. 457847 Dose (mg/kg) Isis No. 457848 IC.sub.10 39 21 IC.sub.20 30 15 IC.sub.50 19 9 IC.sub.80 12 5 IC.sub.90 9 4

Example 14

In Vivo Acute Toxicity Study: Identification of Sentinel Genes

[0556] Balb/c mice were subcutaneously administered saline, Isis No. 457847, or 457848 at different doses as shown in the table below. Four out of the eight mice in each group were sacrificed 24 hours after administration. Immediately after each mouse was sacrificed, the livers were frozen in liquid nitrogen and then sent to Expression Analysis (Durham, N.C.) for whole genome expression. Gene expression analysis on each of livers of the sacrificed mice was performed using a microarray to obtain whole genome profiling.

[0557] Results from the microarray indicated that treatment with both Isis No. 457847 and Isis No. 457848 induced more off-target down regulation than off-target up regulation.

[0558] For Isis No. 457848 at 100 mg/kg, it was found that 1617 off-target genes experienced a two-fold change in modulation of amount or activity, meaning that 1617 genes either decreased expression by at least two-fold, or increased expression by at least two-fold. For Isis No. 457847 at 200 mg/kg, it was found that 225 off-target genes experienced a two-fold change in modulation of amount or activity, meaning that 225 genes either decreased expression by at least two-fold, or increased expression by at least two-fold.

[0559] Comparison and analysis of the changes in the modulation of amount or activity of these off-target genes resulted in the identification of 143 off-target genes (e.g. sentinel genes) that experienced a two-fold change in modulation of amount or activity after administration of both 100 mg/kg of Isis No. 457848 and 200 mg/kg of Isis No. 457847. These 143 overlapping off-target genes are listed in Table 9.

TABLE-US-00009 TABLE 8 Isis No. Dose (mg/kg) Number of Mice Saline 0 8 457847 200 8 457847 100 8 457847 50 8 457847 25 8 457847 12.5 8 Saline 0 8 457848 200 8 457848 100 8 457848 50 8 457848 25 8 457848 12.5 8

TABLE-US-00010 TABLE 9 Off-Target Gene Identification Symbol Gene ID Rexo4 227656 1810044A24Rik 76510 Atic 108147 Ccdc85b 240514 Capzb 12345 Abat 268860 Pdss2 71365 Gcnt2 14538 Cadps2 320405 Vav2 22325 Prei4 74182 Prkag2 108099 Dnajc12 30045 Rab8a 17274 Lrit1 239037 Pawr 114774 St3gal3 20441 Pank1 75735 Ssbp3 72475 Cdo1 12583 Dusp8 18218 Kctd17 72844 A530050D06Rik 104816 Fbxl17 50758 Zfhx3 11906 Ide 15925 1810020D17Rik 66273 Msi2 76626 Pard3 93742 Ythdf3 229096 Usp18 24110 BC023892 212943 4933407C03Rik 74440 Itpr1 16438 Dnaic1 68922 Tssc1 380752 BC048546 232400 Ctnnbl1 66642 Luc7l2 192196 Snd1 56463 Ero1lb 67475 Tyk2 54721 Centg2 347722 Zfp260 26466 Zfp281 226442 Ptprk 19272 Ppp3ca 19055 Adam32 353188 Ppp1r1b 19049 Crip2 68337 Ddc 13195 D630033O11Rik 235302 Chn2 69993 BC018242 235044 Ergic1 67458 Mapkap1 227743 Wwox 80707 Stx8 55943 Bcas3 192197 Exoc6b///Sec15l2 75914 Ube2e2 218793 Parva 57342 Agpat2 67512 Adcy9 11515 Pkp4 227937 Pcbd2 72562 Fbxl20 72194 Scly 50880 Macrod1 107227 Vti1a 53611 Abhd2 54608 4932417H02Rik 74370 Pgs1 74451 Tmem162 76415 Adk 11534 BC029169 208659 Nedd41 83814 Ank 11732 1190005F20Rik 98685 Atg5 11793 Gck 103988 Mgmt 17314 Adam23 23792 Dym 69190 Pitpnm2 19679 Nfib 18028 Bre 107976 Gphn 268566 Gapvd1 66691 Fars2 69955 Sfi1 78887 Tulp4 68842 Sds 231691 Sgms2 74442 Exoc4 20336 Pitpnc1 71795 Tox 252838 Lrba 80877 Npb 208990 LOC100046025 100046025 Myo1b 17912 Ppm11 242083 Prnpip1 140546 Pdzrn3 55983 Atg7 74244 Supt3h 109115 Hsd3b4 15495 Cryl1 68631 Ece1 230857 Mrap 77037 Smoc1 64075 Ext2 14043 Ccdc91 67015 Hamp 84506 LOC100036521 100036521 Mnat1 17420 Eps1511 13859 Alg14 66789 Paqr7 71904 Cdca7 66953 Arntl 11865 Slc17a2 218103 2310009E04Rik 75578 Lace1 215951 BC057079 230393 F7 14068 1810026J23Rik 69773 Uvrag 78610 Triobp 110253 Fto 26383 Herc2 15204 Parn 74108 Fndc3b 72007 Sfxn5 94282 Epb4.1 269587 D930001I22Rik 228859 Immp21 93757 Slc39a11 69806 Hamp2 66438 Rtp3 235636 6720458F09Rik 328162 Slc6a6 21366 Dynll1 56455

Example 15

ALT and AST Toxicity

[0560] ALT and AST levels were measured in the remaining mice every 24 hours. All mice given Isis No. 457848 either were sacrificed after 48 hours or died before the 48 hour time point. Any remaining mice were then sacrificed at 96 hours. ALT and AST levels were measured by taking a sample of blood from each of the mice, centrifuging the sample, and then analyzing the plasma. ALT or AST levels greater than 10 times the baseline indicated toxicity.

TABLE-US-00011 TABLE 10 ALT Levels at 24 hours Treatment ALT (IU/mL) Isis No. Dose (mg/kg) Duration (hours) Mean STDEV Saline 0 24 90 59 457847 100 24 41 16 457847 200 24 35 2 457848 100 24 41 6 457848 200 24 73 42

TABLE-US-00012 TABLE 11 ALT Levels at 48 hours Treatment ALT (IU/mL) Isis No. Dose (mg/kg) Duration (hours) Mean STDEV Saline 0 48 63 63 457847 100 48 30 0 457847 200 48 35 7 457848 100 48 17717 4243 457848 200 48 16667 NA

TABLE-US-00013 TABLE 12 ALT Levels at 72 hours Treatment ALT (IU/mL) Isis No. Dose (mg/kg) Duration (hours) Mean STDEV Saline 0 72 17 1 457847 100 72 178 64 457847 200 72 284 180 457848 100 72 Lethal NA 457848 200 72 Lethal NA

TABLE-US-00014 TABLE 13 ALT Levels at 96 hours Treatment ALT (IU/mL) Isis No. Dose (mg/kg) Duration (hours) Mean STDEV Saline 0 96 24 4 457847 100 96 1632 775 457847 200 96 15267 2620 457848 100 96 Lethal NA 457848 200 96 Lethal NA

TABLE-US-00015 TABLE 14 AST Levels at 24 hours Treatment AST (IU/mL) Isis No. Dose (mg/kg) Duration (hours) Mean STDEV Saline 0 24 113 46 457847 100 24 85 27 457847 200 24 75 13 457848 100 24 104 21 457848 200 24 91 35

TABLE-US-00016 TABLE 15 AST Levels at 48 hours Treatment AST (IU/mL) Isis No. Dose (mg/kg) Duration (hours) Mean STDEV Saline 0 48 116 157 457847 100 48 98 37 457847 200 48 87 32 457848 100 48 16735 3426 457848 200 48 19859 NA

TABLE-US-00017 TABLE 16 AST Levels at 72 hours Treatment AST (IU/mL) Isis No. Dose (mg/kg) Duration (hours) Mean STDEV Saline 0 72 27 3 457847 100 72 157 84 457847 200 72 164 65 457848 100 72 Lethal NA 457848 200 72 Lethal NA

TABLE-US-00018 TABLE 17 AST Levels at 96 hours Treatment AST (IU/mL) Isis No. Dose (mg/kg) Duration (hours) Mean STDEV Saline 0 96 41 3 457847 100 96 1026 538 457847 200 96 9480 3094 457848 100 96 Lethal NA 457848 200 96 Lethal NA

Example 16

Correlation Between Off-Target Gene Modulation and Toxicity: Overlapping Off-Target Genes

[0561] The degree of the change in modulation of amount or activity of each of the 143 overlapping off-target genes shown in Table 9 may be correlated with the amount of acute toxicity. For example, these off-target genes may be correlated with the increase in AST or ALT levels described in Example 15. Identifying the off-target genes having the highest correlation between the degree of modulation of amount or activity of expression and acute toxicity would yield a sub-set of genes of interest for further in-vitro validation.

Example 17

In Vitro Validation of Off-Target Genes and Identification and Selection of Sentinel Genes

[0562] After identifying a sub-set of off-target genes of interest for further in-vitro validation, in vitro cells may be used to validate the sub-set of off-target genes, for example, in vitro cells may be used to validate the 143 overlapping off-target genes shown in Table 9.

[0563] For example, to validate the 143 overlapping off-target genes shown in Table 9, primary hepatocytes from male Balb/c mice would be isolated. The isolated hepatocytes would be electroporated with water or Isis No. 457848 or Isis No. 457847 at concentrations of 15 .mu.M. At 2.5 hours after electroporation, the cells would then be refed with 100 .mu.M of warm growth medium. At 16 hours after electroporation, the cells would be washed and lysed with RLT+BME. The cells would then be shaken for 1 minute before sealing and freesing at -80.degree. C. Lysate would be used to purify the cells for RT-PCR analysis and genes would be measured by RT-PCR and Ribogreen and UV are read for each sample.

[0564] After obtaining the RT-PCR analysis of off-target genes that demonstrated strong amounts of modulation of amount or activity in vivo, the off-target genes that also show strong amounts of modulation of amount or activity in vitro may now be identified. For example, if one of the overlapping off-target genes shows a strong amount of down regulation in vivo upon the administration of a given oligonucleotide, and also demonstrates a strong amount of down regulation in vitro when administered the same oligonucleotide, then this off-target gene may be identified as a good indicator of toxicity (e.g. sentinel gene). Now, one can administer a cell any number of different oligonucleotides having any number of motifs and modifications, and then monitor the regulation of the identified off-target gene by RT-PCR or any other suitable method known to those having skill in the art. In this manner the in vivo toxicity of any number of different oligonucleotides having any number of motifs and modifications, may be predicted from an in vitro assay.

Example 18

Correlation Between Off-Target Gene Modulation and Toxicity: Isis No. 457848

[0565] The degree of modulation of amount or activity each of the 1617 off-target genes identified after administration of 100 mg/kg of Isis No. 457848 may be correlated with the degree of increase in acute toxicity. For example, these off-target genes may be correlated with an increase in AST or ALT levels. Identifying the off-target genes having the highest correlation between modulation of amount or activity and acute toxicity would yield a sub-set of genes of interest for further in-vitro validation as detailed in Example 11 above.

Example 19

Correlation Between Off-Target Gene Modulation and Toxicity: Isis No. 457847

[0566] The degree of modulation of amount or activity of each of the 225 off-target genes identified after administration of 200 mg/kg of Isis No. 457847 may be correlated with the degree of increase in acute toxicity. For example, these off-target genes may be correlated with an increase in AST or ALT levels. Identifying the off-target genes having the highest correlation between modulation of amount or activity and acute toxicity would yield a sub-set of genes of interest for further in-vitro validation as detailed in Example 11 above.

Example 20

3-10-3 LNA Gapmers

[0567] The following 3-10-3 LNA gapmers were prepared using the procedures as described above. A subscript "1" indicates a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH.sub.2--O-2'bridge. Each of the gapmers below have a full phosphorothioate backbone. Table 18 below illustrates the sequences and targets of each compound.

TABLE-US-00019 TABLE 18 3-10-3 LNA Gapmers SEQ Isis No. Target Sequence ID NO. 569713 NA/ASO ctrl G.sub.1A.sub.1C.sub.1GCGCCTGAAGG.sub.1T.sub.1T.sub.1 7 571035 FVII C.sub.1A.sub.1G.sub.1ATATAGGACTG.sub.1G.sub.1A.sub.1 8 571033 FXI A.sub.1T.sub.1C.sub.1CAGAGATGCCT.sub.1C.sub.1C.sub.1 9 569714 FXI G.sub.1G.sub.1C.sub.1CACCACGCTGT.sub.1C.sub.1A.sub.1 10 571034 FXI T.sub.1G.sub.1C.sub.1CACCGTAGACA.sub.1C.sub.1G.sub.1 11 569715 SOD1 G.sub.1G.sub.1A.sub.1CACATTGGCCA.sub.1C.sub.1A.sub.1 12 569716 FVII C.sub.1C.sub.1C.sub.1TGGTGTACACC.sub.1C.sub.1C.sub.1 13 569717 PTEN A.sub.1T.sub.1C.sub.1ATGGCTGCAGC.sub.1T.sub.1T.sub.1 14 569718 FVII T.sub.1G.sub.1G.sub.1TCCCTGCAGTA.sub.1C.sub.1T.sub.1 15 569719 FXI G.sub.1T.sub.1C.sub.1TGTGCATCTCT.sub.1C.sub.1C.sub.1 16 569720 FXI G.sub.1T.sub.1C.sub.1AGTATCCCAGT.sub.1G.sub.1T.sub.1 17 569721 SOD1 T.sub.1G.sub.1A.sub.1GGTCCTGCACT.sub.1G.sub.1G.sub.1 18 554219 Survivin C.sub.1T.sub.1C.sub.1A.sub.1ATCCATGGC.sub.1A.sub.1G.sub.1C 19

Example 21

Off-Target Analysis of 3-10-3 LNA Gapmers

[0568] A series of antisense LNA containing oligonucleotides targeting a broad range of targets were designed and synthesized as described above. Balb/c mice were separated into different groups and each group of mice was subcutaneously administered saline, or a single dose of Isis No. 569713, 571035, 571033, 569714, 571034, 569715, 569716, 569717, 569718, 569719, 569720, 569721, or 554219. In order to create a dose-response curve, the mice in each group were administered single doses of Isis No. 569713, 571035, 571033, 569714, 571034, 569715, 569716, 569717, 569718, 569719, 569720, 569721, and 554219 at different concentrations ranging from 1 mg/kg to 300 mg/kg. At 24 hours post administration, half of the mice in each group for each dosage concentration were sacrificed. Immediately after each mouse was sacrificed, the livers were frozen in liquid nitrogen and then sent to Expression Analysis (Durham, N.C.) for whole genome expression. Gene expression analysis on each of livers of the sacrificed mice was performed using a microarray to obtain whole genome profiling. For each of the mice that were not sacrificed, samples were taken and ALT and AST levels were measured. Animals found dead prior to 96 hours were assigned an ALT value of 20000 IU/mL. A dose-response curve was then generated that plotted dose concentration (mg/kg) vs. ALT levels (IU/mL). The dose response curve for each of Isis No. 569713, 571035, 571033, 569714, 571034, 569715, 569716, 569717, 569718, 569719, 569720, 569721, or 554219 was then analyzed and used to calculate the minimum dosage required to produce 1000 IU/ml ALT at 96h. As the table below illustrates, doses ranging from 11 mg/kg to 300 mg/kg resulted in ALT levels greater than 1000 IU/ml for 7 compounds: Isis Nos. 569716, 569717, 569718, 569719, 569720, 569721, and 554219. The remaining compounds did not produce ALT levels greater than 1000 IU/ml, even after a single dose of 300 mg/kg.

TABLE-US-00020 TABLE 19 1.sup.st Toxic Dose (mg/kg) > 1000 IU/ml ALT at 96 h 1.sup.st Toxic Dose On-Target Dose (mg/kg) > 1000 SEQ Isis No. Target Species (mg/kg) IU/ml ALT at 96 h ID NO. 569713 NA/ASO Mouse 300 >300 7 Ctrl 571035 FVII Human 300 >300 8 571033 FXI Mouse 300 >300 9 569714 FXI Mouse 300 >300 10 571034 FXI Mouse 300 >300 11 569715 SOD1 Mouse 300 >300 12 569716 FVII Mouse 33 300 13 569717 PTEN Mouse <33 33 14 569718 FVII Mouse <33 100 15 569719 FXI Mouse <11 11 16 569720 FXI Mouse 33 100 17 569721 SOD1 Mouse <33 33 18 554219 Survivin Human 33 300 19

Example 22

Correlation Between Off-Target Gene Modulation and ALT Increase

[0569] Gene expression analysis on each of the mice sacrificed at 24 hours post-administration from Example 21 were analyzed. Expression of each gene on the array was normalized to saline control. The fold change of each downregulated gene as measured at 24 hours post administration was then correlated to the increase in ALT measured at 96 hours. The genes that illustrated the strongest correlation between down-regulation and an increase in ALT were then ranked according to r.sup.2 values as illustrated in Table 20. Similarly, the genes that illustrated the strongest correlation between up-regulation and an increase in ALT were then ranked according to r.sup.2 values as illustrated in Table 21.

TABLE-US-00021 TABLE 20 Down Regulated Genes Correlated to ALT Increase Gene Regulation Entrez (Up or Gene ID Gene Symbol r.sup.2 Down) 74370 4932417H02Rik 0.881570237 Down 75914 mKIAA0919///Sec15l2/// 0.877706718 Down Exoc6b 50758 Fbxl17 0.871834582 Down 69993 Chn2 0.868472413 Down 26383 Fto 0.857328609 Down 666173 AK053274///mKIAA0532/// 0.852912584 Down Vps13b///AK049111 80877 Lrba///Lba 0.831826949 Down 69955 Fars2 0.825377409 Down 217734 Pomt2 0.816819711 Down 211652 Wwc1 0.814841424 Down 66795 Atg10 0.797656754 Down 14701 Gng12 0.793469536 Down 103677 Smg6 0.789202811 Down 224008 2310008H04Rik 0.78792452 Down 19272 Ptprk 0.785719243 Down 320405 Cadps2 0.785433781 Down 109115 Supt3h 0.782544958 Down 20441 St3gal3 0.782160893 Down 74244 Atg7 0.771958613 Down 75578 Fggy 0.770141201 Down 218793 Ube2e2 0.768562158 Down 93757 Immp2l 0.766370426 Down 192197 Bcas3 0.763707226 Down 17420 Mnat1 0.763237657 Down 16439 Itpr2 0.755316427 Down 11515 Adcy9 0.752314856 Down 218103 S1c17a2 0.751397383 Down 27414 Sergef 0.74669734 Down 64075 Smoc1 0.745821158 Down 69190 Dym 0.745739189 Down 18027 Nfia 0.745678305 Down 23965 Odz3 0.745633647 Down 209224 Enox2 0.745318111 Down 72238 Tbc1d5 0.74475067 Down 230393 BC057079 0.743701723 Down 12808 Cob1 0.743510516 Down 76626 Msi2 0.74312008 Down 13982 Esr1 0.743009136 Down 58239 Dexi 0.741767493 Down 26936 AA536749 0.740805736 Down 13640 Efna5 0.738026555 Down 68975 Med27 0.737264649 Down 68916 Cdkal1 0.73405334 Down 50771 Atp9b 0.73127855 Down 16010 Igfbp4 0.729708609 Down 20211 Saa4 0.725536568 Down 72313 Fryl 0.723712037 Down 194401 Mical3///Kiaa0819 0.722136142 Down 16438 Itprl 0.721919362 Down 242083 AK031097///Ppm11 0.720131701 Down 93742 Pard3 0.719281305 Down 17314 Mgmt 0.717297987 Down 97287 Mtmr14 0.715716221 Down 18705 Pik3c2g 0.711058186 Down 72007 Fndc3b 0.707287944 Down 12361 Cask 0.706570871 Down 171212 Galnt10 0.704933641 Down 223754 Tbc1d22a 0.703695636 Down 107227 Macrod1 0.698975352 Down 74374 Clec16a 0.697481709 Down 208718 Dis3l2 0.696060142 Down 74519 Cyp2j9 0.695058095 Down 268534 Sntg2 0.694530379 Down 81500 Sil1 0.694446922 Down 219189 1300010F03Rik 0.694202597 Down 13047 Cux1 0.69203827 Down 68618 1110012L19Rik 0.688947418 Down 140546 Prnpip1 0.688766285 Down 20238 Atxn1 0.68713467 Down 71111 Gpr39 0.686579986 Down 14600 Ghr 0.683133879 Down 19266 Ptprd 0.679746496 Down 74155 Errfi1 0.679613946 Down 227835 AK137808///Gtdc1 0.678056969 Down 320940 Atp11c 0.677044007 Down 108099 Prkag2 0.676318162 Down 239037 Lrit1 0.676002874 Down 213988 Tnrc6b 0.672130399 Down 68178 Cgnl1 0.67019584 Down 16795 Large 0.669312813 Down 268566 Gphn 0.663682789 Down 319845 Bbs9 0.66198502 Down 18563 Pcx 0.659174176 Down 94040 mKIAA1188///Clmn 0.659028801 Down 229487 Pet112l 0.658191741 Down 78808 Stxbp5 0.65802987 Down 14043 Ext2 0.655674984 Down 94245 Dtnbp1 0.653677345 Down 11881 Arsb 0.652843338 Down 224454 Zdhhc14 0.651947144 Down 105559 Mbnl2 0.650606525 Down 13528 Dtnb 0.65026389 Down 19679 Pitpnm2 0.649808523 Down 15204 Herc2 0.649722071 Down 18606 Enpp2 0.648732736 Down 53611 Vti1a 0.645315814 Down 238130 Dock4///mKIAA0716 0.644365345 Down 99586 Dpyd 0.643599698 Down 74008 Arsg 0.643248092 Down 110821 Pcca 0.642571153 Down 56463 Snd1 0.640221713 Down 67015 Ccdc91 0.637646731 Down 272428 Acsm5 0.636080214 Down 14886 Gtf2i 0.635173991 Down 69806 Slc39a11 0.634795581 Down 110532 Adarb1 0.632312769 Down 54604 Pcnx 0.631496126 Down 319885 Zcchc7 0.63146848 Down 102774 Bbs4 0.630868233 Down 243537 Uroc1 0.626857311 Down 12558 Cdh2 0.626328157 Down 26396 Map2k2 0.626020226 Down 233977 BC038349 0.625763342 Down 98496 5033414K04Rik 0.622537661 Down 269587 Epb4.1 0.622028322 Down 330662 Dock1 0.621512901 Down 75735 Pank1 0.621009598 Down 54403 Slc4a4 0.61967098 Down 278279 Tmtc2 0.617639658 Down 228730 Ncrna00153 0.617418242 Down 73652 BC099512 0.616894972 Down 223254 Farp1 0.616836211 Down 18028 Nfib 0.616081199 Down 213498 Arhgef11 0.615577511 Down 14718 Got1 0.614119517 Down 63955 Cables1 0.613107576 Down 68801 Elovl5 0.612792288 Down 74270 Usp20 0.612454854 Down 17925 Myo9b 0.611954099 Down 83814 Nedd41///mKIAA0439 0.611375334 Down 74088 0610012H03Rik 0.610067554 Down 233865 D430042O09Rik 0.609934771 Down 216565 Ehbp1 0.609655313 Down 104718 Ttc7b 0.609371418 Down 20338 Sel11 0.608270142 Down 271564 Vps13a///CHAC 0.608063281 Down 107986 Ddb2 0.606166164 Down 672511 Rnf213 0.605363852 Down 71602 Myo1e 0.604467637 Down 17175 Masp2 0.603726298 Down 14585 Gfra1 0.603632842 Down 15486 Hsd17b2 0.603323943 Down 192786 Rapgef6///mKIAA4052 0.60322277 Down 77987 Ascc3///AK144867 0.602976597 Down 18750 Prkca 0.602949949 Down 57342 Parva 0.602253239 Down 14158 Fert2 0.601937675 Down 29819 Stau2 0.601830334 Down 227743 Mapkap1 0.601738633 Down 241308 AK140547///Ralgps1 0.599029779 Down 20678 Sox5 0.59802968 Down 218865 Chdh 0.597817574 Down 17127 Smad3 0.597594387 Down 54353 Skap2 0.597275862 Down 17120 Mad1///Mad111 0.597192128 Down 55983 Pdzrn3 0.596823197 Down 239985 Arid1b 0.596763305 Down 104816 Aspg 0.596526332 Down 11749 Anxa6 0.59605341 Down 211673 Arfgef1 0.594411456 Down 50785 Hs6st1 0.593828373 Down 71302 Arhgap26///mKIAA0621 0.593619374 Down 104082 Wdr7 0.592931146 Down 100637 B230342M21Rik///N4bp2l1 0.592696965 Down 65973 Asph 0.592305859 Down 544963 Iqgap2 0.591705376 Down 320011 Ugcgl1 0.5897969 Down 70661 BC033915 0.58976308 Down 215445 mKIAA0665///Rab11fip3 0.589224941 Down 20679 Sox6 0.588615413 Down 76454 Fbxo31 0.588503735 Down 68889 Ubac2 0.587940107 Down 94353 Hmgn3 0.586699681 Down 228602 4930402H24Rik 0.586564331 Down 108655 Foxp1 0.586468849 Down 171486 Cd99l2 0.586443991 Down 223978 C530044N13Rik///Cpped1 0.585623518 Down 76510 Trappc9///1810044A24Rik 0.582060196 Down 29809 Rabgap11 0.581796202 Down 21372 Tbl1x 0.581345739 Down 23908 Hs2st1 0.581201637 Down 102566 Tmem16k///Ano10 0.579746255 Down 347722 Agap1 0.579494425 Down 23938 Map2k5 0.579447394 Down 96935 Susd4 0.578851694 Down 56878 Rbms1///AK011205 0.578650042 Down 100036521 Gig18 0.578509922 Down 74440 4933407C03Rik///mKIAA1694 0.578167843 Down 102644 Oaf 0.577524669 Down 54725 Cadm1 0.576998479 Down 22084 Tsc2 0.576392104 Down 56490 Zbtb20 0.575959654 Down 66253 Aig1 0.5755063 Down 246196 Zfp277///AK172713 0.575391946 Down 18201 Nsmaf 0.573842299 Down 19045 Ppp1ca 0.573112804 Down 22325 Vav2 0.57267834 Down 23945 Mgll 0.572572051 Down 26930 Ppnr 0.571883753 Down 76429 2310007H09Rik 0.570953791 Down 231051 Mll3 0.57076196 Down 93834 Peli2 0.570020747 Down 70834 Spag9///JSAP2 0.56678755 Down 12385 Ctnna1 0.566049233 Down 20409 Ostf1 0.565624252 Down 52398 11-Sep 0.563024508 Down 17158 Man2a1 0.563022255 Down 18099 Nlk 0.562409972 Down 216831 AU040829 0.561880909 Down 11787 Apbb2 0.561732807 Down 68501 Nsmce2 0.561289726 Down 224671 Btbd9 0.56054694 Down 229877 Rap1gds1 0.560281909 Down 68631 Cryl1 0.560090087 Down 24059 Slco2a1 0.560080102 Down 22222 Ubr1 0.559857296 Down 68732 Lrrc16a///Lrrc16 0.559393676 Down 67074 Mon2 0.559331869 Down 50754 Fbxw7 0.559122106 Down 19055 Ppp3ca 0.558920628 Down 107476 AK040794///Acaca 0.558791978 Down 17155 Man1a 0.558773698 Down 207181 Rbms3 0.558605596 Down 68465 Adipor2 0.558226759 Down 20192 Ryr3 0.557339048 Down 29807 Tpk1 0.557197421 Down 18624 Pepd 0.557093355 Down 71764 C2cd2l 0.555663167 Down 432442 Akap7 0.55457384 Down 103220 BC030307 0.554449533 Down 105428 Fam149b 0.554372745 Down 20747 Spop 0.554035756 Down 108138 Xrcc4 0.55386123 Down 208440 Dip2c 0.553415197 Down 75472 1700009P17Rik 0.553150905 Down 72599 Pdia5 0.552830011 Down 18534 Pck1 0.552604806 Down 68299 Vps53 0.552307087 Down 65967 Eefsec 0.549508286 Down 68371 Pbld 0.547859009 Down

227801 Dennd1a 0.547051646 Down 17977 Ncoa1 0.545367828 Down 60344 Fign 0.54532852 Down

TABLE-US-00022 TABLE 21 Up Regulated Genes Correlated to ALT Increase Gene Regulation Entrez (Up or Gene ID Gene Symbol r.sup.2 Down) 321000 4933421E11Rik 0.828781401 Up 71989 Rpusd4 0.821214015 Up 68185 AK019895///Chchd8 0.812766903 Up 52477 Angel2 0.809563061 Up 14911 Thumpd3 0.804718994 Up 69241 Polr2d 0.80039532 Up 13197 Gadd45a 0.792167641 Up 107522 Ece2 0.784864986 Up 69549 2310009B15Rik 0.784498393 Up 68550 1110002N22Rik 0.783538519 Up 233904 Setd1a 0.763731607 Up 69961 2810432D09Rik 0.758340494 Up 66870 Serbp1 0.752501221 Up 67101 2310039H08Rik 0.747968837 Up 270058 Mtap1s 0.744064198 Up 27260 Plek2 0.741994766 Up 69168 Bola1 0.738818242 Up 68115 AK172713///9430016H08Rik 0.738387466 Up 73419 1700052N19Rik 0.738021033 Up 74132 Rnf6 0.734273477 Up 105663 Thtpa 0.73343318 Up 227102 Ormdl1 0.730356662 Up 243219 2900026A02Rik 0.728731593 Up 20020 Polr2a 0.727986948 Up 22629 Ywhah 0.727808243 Up 16668 Krt18 0.727121927 Up 100515 Zfp518b 0.724764518 Up 66701 Spryd4 0.722478849 Up 104457 0610010K14Rik 0.717842951 Up 328099 AU021838///Mipol1 0.715445754 Up 353188 Adam32 0.71430195 Up 69962 2810422O20Rik 0.713719025 Up 19039 Lgals3bp 0.713151192 Up 353258 Ltv1 0.710511059 Up 68636 Fahd1 0.709898912 Up 68327 0610007P22Rik 0.709257388 Up 107701 Sf3b4 0.706098027 Up 218952 Fermt2 0.702510392 Up 448850 Znhit3 0.702398266 Up 69228 Znf746 0.700863921 Up 71787 Trnau1ap 0.700801498 Up 270106 Rpl13 0.700293178 Up 68193 Rpl24 0.699970694 Up 18590 Pdgfa 0.699591372 Up 66664 Tmem41a 0.698860497 Up 208518 Cep78 0.698481328 Up 67781 Ilf2 0.698448036 Up 70291 2510049J12Rik 0.69714475 Up 67489 Ap4b1 0.692430642 Up 76497 Ppp1r11 0.691954689 Up 77038 Arfgap2 0.690659625 Up 11676 Aldoc 0.687782385 Up 15574 Hus1 0.687124907 Up 51792 Ppp2r1a 0.686680263 Up 66083 Setd6 0.685885535 Up 22040 AK036897///Trex1 0.685752435 Up 227522 Rpp38 0.685477194 Up 70223 Nars 0.685365907 Up 28028 Mrpl50 0.682327964 Up 17768 Mthfd2 0.682320691 Up 69882 2010321M09Rik 0.682121395 Up 66606 Lrrc57 0.681908453 Up 231430 Cox18 0.680319474 Up 22247 Umps 0.679307722 Up 11757 Prdx3 0.678891516 Up 24110 Usp18 0.678408208 Up 16391 Isgf3g 0.677375454 Up 68979 Nol11 0.676746807 Up 66653 Brf2 0.676339046 Up 67738 Ppid 0.676289037 Up 50918 Myadm 0.674621176 Up 16691 Krt8 0.674433977 Up 69534 Avpi1 0.673529456 Up 19340 Rab3d 0.670975146 Up 15374 Hn1 0.670724081 Up 70020 Ino80b 0.670427391 Up 69573 2310016C08Rik 0.668340356 Up 66596 Gtf3a 0.667461159 Up 83701 Srrt 0.666193892 Up 50887 Nsbp1 0.664511092 Up 245841 Polr2h 0.663503343 Up 68512 Tomm5 0.662237729 Up 55963 Slc1a4 0.661815979 Up 67832 Bxdc2 0.660961873 Up 276919 Gemin4 0.660309894 Up 56716 Gbl 0.658651254 Up 100554 C87414///AA792892 0.658411355 Up 235302 AK052711 0.657733584 Up 78394 Ddx52 0.656175645 Up 12238 Commd3 0.655418374 Up 108037 Shmt2 0.655013627 Up 69071 Tmem97 0.654795198 Up 64406 Sp5 0.654602739 Up 68147 Gar1 0.654371413 Up 71988 Esco2 0.653785092 Up 66962 2310047B19Rik 0.653171224 Up 74097 Pop7 0.652820242 Up 53317 Plrg1 0.650910996 Up 12464 Cct4 0.650849041 Up 20308 Ccl9 0.650463831 Up 18950 Pnp1 0.647576204 Up 68145 Etaa1 0.646511359 Up 76560 Prss8 0.645826963 Up 19671 Rce1 0.645558171 Up 216825 Usp22 0.644677729 Up 20174 Ruvbl2 0.644207037 Up 23918 Impdh2 0.644160463 Up 208990 Npb 0.643688534 Up 227715 Exosc2 0.643331854 Up 71916 Dus41 0.642261732 Up 69479 1700029J07Rik 0.641809029 Up 58248 1700123O20Rik 0.641420014 Up 66401 Nudt2 0.640767939 Up 79554 Gltpd1 0.640567138 Up 83703 Dbr1 0.64042371 Up 27356 Insl6 0.638467326 Up 20102 Rps4x 0.6383911 Up 66658 Ccdc51 0.637337398 Up 69902 Mrto4 0.637181622 Up 56209 Gde1 0.637166586 Up 71059 Hexim2 0.635654881 Up 234776 Atmin 0.635066457 Up 74026 Msl1 0.63337818 Up 97541 Qars 0.632918392 Up 225913 Dak 0.632596985 Up 105278 Ccrk 0.632551012 Up 76813 Armc6 0.632428466 Up 75616 2810008M24Rik 0.63153931 Up 75623 Kdelc1///1700029F09Rik 0.631128792 Up 57357 Srd5a3 0.630154401 Up 233876 Hirip3 0.629817864 Up 97159 A430005L14Rik 0.628500508 Up 230234 BC026590 0.628443782 Up 12739 Cldn3///Wbscr25 0.628153864 Up 232337 Zfp637 0.627445127 Up 14156 Fen1 0.62707061 Up 66248 Alg5 0.626283145 Up 227154 Als2cr2///Stradb 0.626171704 Up 622707 Rpl29 0.625940105 Up 64295 Tmub1 0.62580345 Up 26961 Rpl8 0.624738153 Up 22666 Zfp161 0.62395442 Up 28010 D4Wsu114e 0.623435791 Up 71986 Ddx28 0.623316076 Up 18148 Npm1 0.622979601 Up 77286 Nkrf 0.622712352 Up 68002 1110058L19Rik 0.622440056 Up 227644 Snapc4 0.622065994 Up 79059 Nme3 0.621781774 Up 226153 Peo1 0.621769908 Up 19921 Rpl19 0.621648931 Up 18515 Pbx2 0.621321591 Up 664968 2210411K11Rik 0.620986253 Up 67097 Rps10 0.62018374 Up 100040298 Rps8 0.620012694 Up 230082 Nol6 0.619384089 Up 66481 Rps21 0.619315838 Up 15495 Hsd3b4 0.619240278 Up 214424 Parp16 0.618433307 Up 18483 Palm 0.617369158 Up 22051 Trip6 0.617293652 Up 217700 Acot6 0.617209221 Up 68644 Abhd14a 0.61700942 Up 18100 Mrpl40 0.616505506 Up 20042 Rps12 0.616251041 Up 217057 Ptrh2 0.615272427 Up 20821 Trim21 0.614943327 Up 67602 Necap1 0.613081792 Up 231386 Ythdc1 0.612826851 Up 68080 Gpn3 0.612417706 Up 67996 Sfrs6 0.611610127 Up 27370 ENSMUSG00000059775/// 0.610651846 Up Rps26 69912 Nup43 0.610583513 Up 19826 Rnps1 0.610497157 Up 101739 Psip1 0.609866248 Up 399566 Btbd6 0.609659323 Up 52626 Cdkn2aipnl 0.608900685 Up 19989 Rpl7 0.607843346 Up 13667 Eif2b4 0.607447824 Up 26441 Psma4 0.607302102 Up 22758 Zscan12 0.605678685 Up 667682 Rpl31 0.605360844 Up 211255 Kbtbd7 0.605148748 Up 69185 Dtwd1 0.605123393 Up 320226 4930473A06Rik///AK029637 0.604141033 Up 216760 Mfap3 0.603674722 Up 67736 Ccdc130 0.603600403 Up 216150 Cdc34 0.603531354 Up 65972 Ifi30 0.603338123 Up 68044 Chac2 0.602240646 Up 70240 Ufsp1 0.601764375 Up 67242 Gemin6 0.601630906 Up 16145 Igtp 0.601376355 Up 56503 Ankrd49 0.600941885 Up 214489 AK206957///AK050697 0.600265025 Up 269336 Ccdc32 0.600259909 Up 208595 ENSMUSG00000053178 0.6002454 Up 269955 Rccd1 0.600195992 Up 66172 Med11 0.600137828 Up 100040353 2810416G20Rik 0.600052118 Up 14070 F8a 0.599086685 Up 66757 Adat2 0.598703368 Up 20229 Sat1 0.598621988 Up 70650 Zcchc8 0.59793997 Up 52830 Pnrc2 0.597172683 Up 68366 Tmem129 0.596902461 Up 64655 Mrps22 0.596839038 Up 223626 4930572J05Rik 0.596704273 Up 269261 Rpl12 0.596680782 Up 225280 Ino80c 0.59649754 Up 66953 Cdca7 0.596271741 Up 231915 Uspl1 0.596199279 Up 208768 BC031781 0.595639474 Up 72275 2200002D01Rik 0.595226971 Up 192231 Hexim1 0.595082591 Up 208967 Thnsl1 0.594889153 Up 381792 AK009724 0.593903234 Up 77862 Thyn1///mThy28 0.593293926 Up 68879 Prpf6 0.592652691 Up 108098 Med21 0.592576963 Up 22381 Wbp5 0.592072955 Up 105148 Iars 0.592040457 Up 68294 Mfsd10 0.591390672 Up 70021 Nt5dc2 0.590503402 Up 69861 2010003K11Rik 0.590433914 Up 67676 Rpp21 0.589799041 Up 16205 Gimap1 0.588793908 Up 66985 Rassf7 0.588743485 Up 217140 Scrn2 0.588506321 Up 70333 Cd3eap 0.588454054 Up 240514 Ccdc85b 0.588420718 Up 109163 AK087382 0.588267639 Up 56088 Psmg1 0.588101108 Up 108147 Atic 0.58752055 Up 67706 Tmem179b 0.587035814 Up 67136 Kbtbd4 0.58667231 Up 212090 Tmem60 0.585540086 Up 72655 2810026P18Rik 0.584433095 Up 449521 Zfp213 0.584222958 Up 107047 Psmg2 0.582393668 Up 231841 AA881470 0.581273744 Up

66656 Eef1d 0.581247585 Up 66170 Chchd5 0.581205624 Up 56791 Ube2l6 0.581062896 Up 14865 Gstm4 0.58002253 Up 21339 Taf1a 0.579742839 Up 231583 Slc26a1 0.579592368 Up 57837 Eral1 0.579409625 Up 27395 Mrpl15///AK017820 0.578731847 Up 69216 Ccdc23 0.578281126 Up 14113 Fbl 0.578077881 Up 232236 C130022K22Rik 0.57804613 Up 554292 LOC554292 0.577954571 Up 66973 Mrps18b 0.577310846 Up 66343 Tmem177 0.577302833 Up 59053 Brp16 0.577115872 Up 380712 Tlcd2 0.576999831 Up 105014 Rdh14 0.576469122 Up 226351 Tmem185b 0.575340901 Up 66489 Rpl35 0.574558571 Up 66419 Mrpl11 0.574368522 Up 213541 Ythdf2 0.573980554 Up 18567 Pdcd2 0.573748231 Up 26905 Eif2s3x 0.573638411 Up 11674 Aldoa 0.573198881 Up 14534 Kat2a 0.572866985 Up 66599 Rdm1 0.57158232 Up 67186 Rplp2 0.571268544 Up 219158 2610301G19Rik 0.571254833 Up 100043000 Rpl3 0.570441285 Up 21924 Tnnc1 0.569822051 Up 18648 Pgam1 0.569389772 Up 71726 Smug1 0.569262976 Up 66358 2310004I24Rik 0.569017971 Up 60406 Sap30 0.568829534 Up 68949 1500012F01Rik 0.568756138 Up 101943 Sf3b3 0.568595763 Up 72536 Tagap///Tagap1 0.568292844 Up 72388 Ripk4 0.568112975 Up 15931 BC160215///Ids 0.568096931 Up 234309 Cbr4 0.568058926 Up 76800 Usp42 0.567858939 Up 22059 Trp53 0.566787444 Up 19175 Psmb6 0.565451493 Up 213233 Tapbp1 0.565247118 Up 231872 Jtv1 0.5650143 Up 16549 Khsrp 0.56470297 Up 231655 Oasl1 0.564257429 Up 15239 Hgs 0.564155733 Up 67427 Rps20 0.564113737 Up 15270 H2afx 0.563830152 Up 19172 Psmb4 0.563063414 Up 21816 Tgm1 0.562841486 Up 13163 Daxx 0.562685101 Up 24045 Clk2///Scamp3 0.562455587 Up 225027 Sfrs7 0.562278505 Up 67843 Slc35a4 0.560934038 Up 214987 Chtf8 0.560908881 Up 23877 Fiz1 0.560848911 Up 78372 Snrnp25 0.560175416 Up 52440 Tax1bp1 0.559550144 Up 53902 Rcan3 0.559014128 Up 69269 Scnm1 0.558513651 Up 12812 Coil 0.558208066 Up 97484 Cog8 0.557842373 Up 12567 Cdk4 0.557273744 Up 27756 Lsm2 0.557213698 Up 23849 Klf6 0.556951617 Up 12469 Cct8 0.556929134 Up 66910 Tmem107 0.556716411 Up 57741 Noc2l 0.556220338 Up 67211 Armc10 0.556028811 Up 97031 C430004E15Rik 0.555933123 Up 57785 Rangrf 0.555885298 Up 210973 Kbtbd2 0.555784936 Up 16210 Impact 0.555775361 Up 67390 Rnmtl1 0.555625742 Up 14272 Fnta 0.555039858 Up 76650 Srxn1 0.554132183 Up 67053 Rpp14 0.554111651 Up 68763 AK003073 0.554047447 Up 66480 Rpl15 0.55308007 Up 382423 ENSMUSG00000074747 0.552900656 Up 12366 Casp2 0.552565452 Up 101565 6330503K22Rik 0.552523353 Up 327959 Xafl 0.552462295 Up 56361 Pus1 0.552350536 Up 108660 Rnf187 0.552206839 Up 56412 2610024G14Rik 0.551909024 Up 64656 Mrps23 0.551870129 Up 232087 Mat2a 0.551664066 Up 217869 Eif5 0.551630047 Up 14155 Fem1b 0.551581421 Up 19899 Rpl18 0.550314468 Up 59054 Mrps30 0.550202135 Up 100039731 Rpl28 0.550102699 Up 107260 Otub1 0.549562967 Up 50772 Mapk6 0.549277905 Up 21899 Tlr6 0.548283895 Up 20088 Rps24 0.548272783 Up 13681 Eif4a1 0.548199142 Up 56176 Pigp 0.547310532 Up 104458 Rars 0.547261513 Up 232491 Pyroxd1 0.546887964 Up 230721 Pabpc4 0.546883546 Up 20085 Rps19 0.546638269 Up 66242 Mrps16 0.54599052 Up 27407 Abcf2 0.5459486 Up 80291 Rilpl2 0.545930544 Up 225160 Thoc1 0.545914264 Up 66614 Gpatch4 0.545621087 Up 100217418 AK009175 0.545345774 Up 217715 Eif2b2 0.545319888 Up

Example 23

Selection of Off-Target Genes as Sentinel Genes

[0570] Any off-target gene that demonstrates a correlation between up regulation or down regulation and an increase in ALT or some other value predictive of toxicity may be selected for in vitro validation. In certain embodiments, a single gene that demonstrates correlation between down regulation and ALT increase may be selected for in vitro validation. In certain embodiments, a single gene that demonstrates correlation between up regulation and ALT increase may be selected for in vitro validation. In certain embodiments, a gene from Table 20 that demonstrates correlation between down regulation and ALT increase may be selected for in vitro validation. In certain embodiments, a single gene from Table 21 that demonstrates correlation between up regulation and ALT increase may be selected for in vitro validation. In certain embodiments, one or more genes from Table 20 that demonstrates a correlation between down regulation and ALT increase may be selected for in vitro validation. In certain embodiments, one or more genes from Table 21 that demonstrates a correlation between up regulation and ALT increase may be selected for in vitro validation. In certain embodiments, one or more genes from Table 20 and one or more genese from Table 21 that demonstrate a correlation between modulation and ALT increase may be selected for in vitro validation.

[0571] After identifying a sub-set of off-target genes, in vitro cells may be used to validate the sub-set of off-target genes. For example, in vitro cells may be used to validate the off-target genes shown in Table 20. For example, in vitro cells may be used to validate the off-target genes shown in Table 21.

[0572] To validate any of the off-target genes in Table 20 or Table 21, primary hepatocytes from male Balb/c mice are isolated. The isolated hepatocytes are electroporated with water or any compound that produced an increase in ALT levels of greater than 1000 IU. At 2.5 hours after electroporation, the cells can then be refed with 100 .mu.M of warm growth medium. At 16 hours after electroporation, the cells are washed and lysed with RLT+BME. The cells are shaken for 1 minute before sealing and freesing at -80.degree. C. Lysate is used to purify the cells for RT-PCR analysis. Genes may be measured by RT-PCR and Ribogreen and UV are read for each sample.

[0573] After obtaining the RT-PCR analysis of off-target genes that demonstrated strong amounts of modulation of amount or activity in vivo, the off-target genes that also show strong amounts of modulation of amount or activity in vitro may now be identified. For example, if one of the off-target genes shows a strong amount of down regulation in vivo upon the administration of a given oligonucleotide, and also demonstrates a strong amount of down regulation in vitro when administered the same oligonucleotide, then this off-target gene may be identified as a good indicator of toxicity (e.g. sentinel gene). In the future, one could then administer a cell any number of different oligonucleotides having any number of motifs and modifications, and then monitor the regulation of the identified off-target gene by RT-PCR or any other suitable method known to those having skill in the art. In this manner the in vivo toxicity of any number of different oligonucleotides having any number of motifs and modifications, may be identified.

Example 24

Median Length of mRNA Transcripts

[0574] Data from the whole genome expression in Example 21 was analyzed. Each down regulated gene was ranked according to its mRNA length. Each unchanged gene was ranked according to its mRNA length. Each up regulated gene was ranked according to its mRNA length. The median length of each down regulated gene's mRNA, unchanged gene's mRNA, and up regulated gene's mRNA was then calculated. The results are presented below in Table 22.

TABLE-US-00023 TABLE 22 Median Length of mRNA Transcripts Modulation Median Length Down Regulated 3962 Unchanged 2652 Up Regulated 1879

Example 25

Median Length of Pre-mRNA Transcripts

[0575] Data from the whole genome expression in Example 21 was analyzed. Each down regulated gene was ranked according to its pre-mRNA length. Each unchanged gene was ranked according to its pre-mRNA length. Each up regulated gene was ranked according to its pre-mRNA length. The median length of each down regulated gene's pre-mRNA, unchanged gene's pre-mRNA, and up regulated gene's pre-mRNA was then calculated. The results are presented below in Table 23.

TABLE-US-00024 TABLE 23 Median Length of Pre-mRNA Transcripts Modulation Median Length Down Regulated 176442 Unchanged 19862 Up Regulated 7673

Example 26

Combined Effects of Sentinel Genes

[0576] Six off-target genes, the modulation of which correlate strongly to ALT and/or AST increases were selected: RAPTOR, FTO, PPP3CA, PTPRK, IQGAP2, and ADK. These genes were identified as sentinel genes. Six 5-10-5 MOE gapmers with phosphorothioate backbones were then designed. Each 5-10-5 MOE gapmer targeted a different sentinel gene. For example, the RAPTOR 5-10-5 MOE gapmer would target and knock down the RAPTOR gene. For example, the FTO 5-10-5 MOE gapmer would target and knock down the FTO gene. For example, the PPP3CA 5-10-5 MOE gapmer would target and knock down the PPP3CA gene. For example, the PTPRK 5-10-5 MOE gapmer would target and knock down the PTPRK gene. For example, the IQGAP2 5-10-5 MOE gapmer would target and knock down the IQGAP2 gene. For example, the ADK 5-10-5 MOE gapmer would target and knock down the ADK gene. Balb/c mice were then separated into groups of 4 mice. Each group of mice was then given a subcutaneous 50 mg/kg dose seven times every other day of the various 5-10-5 MOE gapmers as illustrated in Table 24 below. Mice were then bled at 24 hours after every other dose and a necropsy was performed 48 hours after the last dose. ALT was then measured. Isis No.: 104838 is a 5-10-5 MOE gapmer that does not match a mouse target and was used to ensure that the mice received standardized doses of gapmers. This example shows that the modulation of combinations of sentinel genes may correlate to higher increases ALT levels as compared to increases in ALT levels associated with the modulation of singular sentinel genes.

TABLE-US-00025 TABLE 24 Combined Effects of Sentinel Genes ASO (mg/kg) ALT (IU/mL RAPTOR FTO PPP3CA PTPRK IQGAP2 ADK 104838 Mean Std. Dev 0 0 0 0 0 0 0 27.6 12.5 0 0 0 0 0 0 200 77 8.8 0 0 0 0 0 0 300 131.8 20.5 0 0 0 0 0 50 0 40.5 10 0 0 0 0 50 0 0 50.8 8.7 0 0 0 50 0 0 150 103.3 11.2 0 0 50 0 0 0 150 44.3 8.7 0 0 50 50 50 50 100 201.5 23.7 0 50 0 0 0 0 150 46.5 8.1 0 50 0 50 50 50 100 199.3 82.8 0 50 50 0 50 50 100 127.5 28.8 0 50 50 50 0 50 100 179 101.1 0 50 50 50 50 0 100 210.5 32.4 0 50 50 50 50 50 50 170.8 48.3 50 0 0 0 0 0 150 125.5 8.1 50 0 0 50 50 50 100 276.8 54.9 50 0 50 0 50 50 100 498.3 61 50 0 50 50 0 50 100 323.5 82 50 0 50 50 50 0 100 247 47.5 50 0 50 50 50 50 50 300.5 109.8 50 50 0 0 50 50 100 546.5 394 50 50 0 50 0 0 50 378.3 144.5 50 50 0 50 0 50 100 386.3 91.2 50 50 0 50 50 0 100 402.8 119.2 50 50 0 50 50 50 50 361.5 73.3 50 50 50 0 0 50 100 354.8 95.3 50 50 50 0 50 0 100 553 178.7 50 50 50 0 50 50 50 851.5 32.3 50 50 50 50 0 0 100 785 286.3 50 50 50 50 0 0 0 929.3 100 50 50 50 50 0 50 50 801.3 237.6 50 50 50 50 50 0 50 1169.3 257.8 50 50 50 50 50 50 0 458.3 73.8

Sequence CWU 1

1

1913160DNAHomo sapiens 1cctcccctcg cccggcgcgg tcccgtccgc ctctcgctcg cctcccgcct cccctcggtc 60ttccgaggcg cccgggctcc cggcgcggcg gcggaggggg cgggcaggcc ggcgggcggt 120gatgtggcag gactctttat gcgctgcggc aggatacgcg ctcggcgctg ggacgcgact 180gcgctcagtt ctctcctctc ggaagctgca gccatgatgg aagtttgaga gttgagccgc 240tgtgaggcga ggccgggctc aggcgaggga gatgagagac ggcggcggcc gcggcccgga 300gcccctctca gcgcctgtga gcagccgcgg gggcagcgcc ctcggggagc cggccggcct 360gcggcggcgg cagcggcggc gtttctcgcc tcctcttcgt cttttctaac cgtgcagcct 420cttcctcggc ttctcctgaa agggaaggtg gaagccgtgg gctcgggcgg gagccggctg 480aggcgcggcg gcggcggcgg cggcacctcc cgctcctgga gcggggggga gaagcggcgg 540cggcggcggc cgcggcggct gcagctccag ggagggggtc tgagtcgcct gtcaccattt 600ccagggctgg gaacgccgga gagttggtct ctccccttct actgcctcca acacggcggc 660ggcggcggcg gcacatccag ggacccgggc cggttttaaa cctcccgtcc gccgccgccg 720caccccccgt ggcccgggct ccggaggccg ccggcggagg cagccgttcg gaggattatt 780cgtcttctcc ccattccgct gccgccgctg ccaggcctct ggctgctgag gagaagcagg 840cccagtcgct gcaaccatcc agcagccgcc gcagcagcca ttacccggct gcggtccaga 900gccaagcggc ggcagagcga ggggcatcag ctaccgccaa gtccagagcc atttccatcc 960tgcagaagaa gccccgccac cagcagcttc tgccatctct ctcctccttt ttcttcagcc 1020acaggctccc agacatgaca gccatcatca aagagatcgt tagcagaaac aaaaggagat 1080atcaagagga tggattcgac ttagacttga cctatattta tccaaacatt attgctatgg 1140gatttcctgc agaaagactt gaaggcgtat acaggaacaa tattgatgat gtagtaaggt 1200ttttggattc aaagcataaa aaccattaca agatatacaa tctttgtgct gaaagacatt 1260atgacaccgc caaatttaat tgcagagttg cacaatatcc ttttgaagac cataacccac 1320cacagctaga acttatcaaa cccttttgtg aagatcttga ccaatggcta agtgaagatg 1380acaatcatgt tgcagcaatt cactgtaaag ctggaaaggg acgaactggt gtaatgatat 1440gtgcatattt attacatcgg ggcaaatttt taaaggcaca agaggcccta gatttctatg 1500gggaagtaag gaccagagac aaaaagggag taactattcc cagtcagagg cgctatgtgt 1560attattatag ctacctgtta aagaatcatc tggattatag accagtggca ctgttgtttc 1620acaagatgat gtttgaaact attccaatgt tcagtggcgg aacttgcaat cctcagtttg 1680tggtctgcca gctaaaggtg aagatatatt cctccaattc aggacccaca cgacgggaag 1740acaagttcat gtactttgag ttccctcagc cgttacctgt gtgtggtgat atcaaagtag 1800agttcttcca caaacagaac aagatgctaa aaaaggacaa aatgtttcac ttttgggtaa 1860atacattctt cataccagga ccagaggaaa cctcagaaaa agtagaaaat ggaagtctat 1920gtgatcaaga aatcgatagc atttgcagta tagagcgtgc agataatgac aaggaatatc 1980tagtacttac tttaacaaaa aatgatcttg acaaagcaaa taaagacaaa gccaaccgat 2040acttttctcc aaattttaag gtgaagctgt acttcacaaa aacagtagag gagccgtcaa 2100atccagaggc tagcagttca acttctgtaa caccagatgt tagtgacaat gaacctgatc 2160attatagata ttctgacacc actgactctg atccagagaa tgaacctttt gatgaagatc 2220agcatacaca aattacaaaa gtctgaattt ttttttatca agagggataa aacaccatga 2280aaataaactt gaataaactg aaaatggacc tttttttttt taatggcaat aggacattgt 2340gtcagattac cagttatagg aacaattctc ttttcctgac caatcttgtt ttaccctata 2400catccacagg gttttgacac ttgttgtcca gttgaaaaaa ggttgtgtag ctgtgtcatg 2460tatatacctt tttgtgtcaa aaggacattt aaaattcaat taggattaat aaagatggca 2520ctttcccgtt ttattccagt tttataaaaa gtggagacag actgatgtgt atacgtagga 2580attttttcct tttgtgttct gtcaccaact gaagtggcta aagagctttg tgatatactg 2640gttcacatcc tacccctttg cacttgtggc aacagataag tttgcagttg gctaagagag 2700gtttccgaaa ggttttgcta ccattctaat gcatgtattc gggttagggc aatggagggg 2760aatgctcaga aaggaaataa ttttatgctg gactctggac catataccat ctccagctat 2820ttacacacac ctttctttag catgctacag ttattaatct ggacattcga ggaattggcc 2880gctgtcactg cttgttgttt gcgcattttt ttttaaagca tattggtgct agaaaaggca 2940gctaaaggaa gtgaatctgt attggggtac aggaatgaac cttctgcaac atcttaagat 3000ccacaaatga agggatataa aaataatgtc ataggtaaga aacacagcaa caatgactta 3060accatataaa tgtggaggct atcaacaaag aatgggcttg aaacattata aaaattgaca 3120atgatttatt aaatatgttt tctcaattgt aaaaaaaaaa 3160226DNAArtificial sequencePrimer 2aatggctaag tgaagatgac aatcat 26325DNAArtificial sequencePrimer 3tgcacatatc attacaccag ttcgt 25430DNAArtificial sequenceProbe 4ttgcagcaat tcactgtaaa gctggaaagg 30514DNAArtificial sequenceSynthetic oligonucleotide 5cctggtgtac accc 14614DNAArtificial sequenceSynthetic oligonucleotide 6ggtccctgca gtac 14716DNAArtificial sequenceSynthetic oligonucleotide 7gacgcgcctg aaggtt 16816DNAArtificial sequenceSynthetic oligonucleotide 8cagatatagg actgga 16916DNAArtificial sequenceSynthetic oligonucleotide 9atccagagat gcctcc 161016DNAArtificial sequenceSynthetic oligonucleotide 10ggccaccacg ctgtca 161116DNAArtificial sequenceSynthetic oligonucleotide 11tgccaccgta gacacg 161216DNAArtificial sequenceSynthetic oligonucleotide 12ggacacattg gccaca 161316DNAArtificial sequenceSynthetic oligonucleotide 13ccctggtgta cacccc 161416DNAArtificial sequenceSynthetic oligonucleotide 14atcatggctg cagctt 161516DNAArtificial sequenceSynthetic oligonucleotide 15tggtccctgc agtact 161616DNAArtificial sequenceSynthetic oligonucleotide 16gtctgtgcat ctctcc 161716DNAArtificial sequenceSynthetic oligonucleotide 17gtcagtatcc cagtgt 161816DNAArtificial sequenceSynthetic oligonucleotide 18tgaggtcctg cactgg 161916DNAArtificial sequenceSynthetic oligonucleotide 19ctcaatccat ggcagc 16

Claims

1.-128. (canceled)

129. A method of identifying at least one antisense compound that is predicted not to be toxic in vivo comprising: identifying a set of potential antisense compounds, each having a nucleobase sequence complementary to a target nucleic acid; comparing the nucleobase sequence of each potential antisense compound to the nucleobase sequence of at least one sentinel gene transcript; identifying potential antisense compounds having a nucleobase sequence complementary to at least one sentinel gene transcript as predicted toxic antisense compounds; removing the predicted toxic compounds from the set of potential antisense compounds; identifying one or more of the remaining potential antisense compounds as predicted not to be toxic in vivo.

130. The method of claim 129, wherein the predicted toxic compounds are 90% complementary to at least one sentinel gene transcript.

131. The method of claim 129, wherein the predicted toxic compounds are 95% complementary to at least one sentinel gene transcript.

132. The method of claim 129, wherein the predicted toxic compounds are 100% complementary to at least one sentinel gene transcript.

133. The method of claim 129, wherein the predicted toxic compounds have not more than one mismatch relative to at least one sentinel gene transcript.

134. The method of claim 129, wherein the predicted toxic compounds have not more than two mismatches relative to at least one sentinel gene transcript.

135. The method of claim 129, wherein each potential antisense compound is compared to the nucleobase sequence of at least two sentinel gene transcripts.

136. The method of claim 129, wherein each potential antisense compound is compared to the nucleobase sequence of at least three sentinel gene transcripts.

137. The method of claim 129, wherein at least one sentinel gene is selected from the group consisting of Fbx117, Fto, Gphn, Cadps2, Bcas3, Msi2, BC057079, Chn2, Tbc1d22a, Macrod1, Iqgap2, Vps13b, Atg10, Fggy, Odz3, Vps53, Cgnl1, RAPTOR, Ptprk, Vti1a, Ubac2, Fars2, Ppm1l, Adk, 0610012H03Rik, Itpr2, Sec1512///Exoc6b, Atp9b, Atxn1, Adcy9, Mcph1, Ppp3ca, Bre, Dus41, Rassf1, Mdm2, Brp16, 0610010K14Rik, Rce1, Ilf2, Setd1a, and Gar1.

138. The method of claim 129, wherein at least one sentinel gene is selected from the group consisting of RAPTOR, Ppp3ca, Fto, Iqgap2, Ptprk, and Adk.

139. The method of claim 130, wherein at least one sentinel gene is selected from the group consisting of Fbx117, Fto, Gphn, Cadps2, Bcas3, Msi2, BC057079, Chn2, Tbc1d22a, Macrod1, Iqgap2, Vps13b, Atg10, Fggy, Odz3, Vps53, Cgnl1, RAPTOR, Ptprk, Vti1a, Ubac2, Fars2, Ppm1l, Adk, 0610012H03Rik, Itpr2, Sec1512///Exoc6b, Atp9b, Atxn1, Adcy9, Mcph1, Ppp3ca, Bre, Dus41, Rassf1, Mdm2, Brp16, 0610010K14Rik, Rce1, Ilf2, Setd1a, and Gar1.

140. The method of claim 130, wherein at least one sentinel gene is selected from the group consisting of RAPTOR, Ppp3ca, Fto, Iqgap2, Ptprk, and Adk.

141. The method of claim 134, wherein at least one sentinel gene is selected from the group consisting of Fbx117, Fto, Gphn, Cadps2, Bcas3, Msi2, BC057079, Chn2, Tbc1d22a, Macrod1, Iqgap2, Vps13b, Atg10, Fggy, Odz3, Vps53, Cgnl1, RAPTOR, Ptprk, Vti1a, Ubac2, Fars2, Ppm1l, Adk, 0610012H03Rik, Itpr2, Sec1512///Exoc6b, Atp9b, Atxn1, Adcy9, Mcph1, Ppp3ca, Bre, Dus41, Rassf1, Mdm2, Brp16, 0610010K14Rik, Rce1, Ilf2, Setd1a, and Gar1.

142. The method of claim 134, wherein at least one sentinel gene is selected from the group consisting of RAPTOR, Ppp3ca, Fto, Iqgap2, Ptprk, and Adk.

143. The method of claim 129, wherein the antisense compound comprises a gapmer oligonucleotide consisting of 10 to 30 linked nucleosides, wherein the gapmer oligonucleotide has a 5' wing region positioned at the 5' end of a deoxynucleotide gap, and a 3' wing region positioned at the 3' end of the deoxynucleotide gap.

144. The method of claim 143, wherein the oligomeric compound comprises at least one modified nucleoside.

145. The method of claim 144, wherein the modified nucleoside is a bicyclic modified nucleoside.

146. The method of claim 145, wherein the bicyclic modified nucleoside is an LNA.

147. The method of claim 145, wherein the bicyclic modified nucleoside is a 4'-CH(CH.sub.3)--O-2' nucleoside.

148. The method of claim 145, wherein the bicyclic modified nucleoside is an ENA.