U.S. patent application number 14/971523 was filed with the patent office on 2016-06-09 for regulation of sodium channels by plunc proteins.
The applicant listed for this patent is The University of North Carolina at Chapel Hill. Invention is credited to Scott Donaldson, Monroe Jack Stutts, Robert Tarran.
Application Number | 20160159879 14/971523 |
Document ID | / |
Family ID | 47914825 |
Filed Date | 2016-06-09 |
United States Patent
Application |
20160159879 |
Kind Code |
A1 |
Tarran; Robert ; et
al. |
June 9, 2016 |
REGULATION OF SODIUM CHANNELS BY PLUNC PROTEINS
Abstract
The present invention relates to the ability of PLUNC proteins,
such as SPLUNC1 and SPLUNC2, to bind to sodium channels and inhibit
activation of the sodium channels. The invention further relates to
methods for regulating of sodium absorption and fluid volume and
treating disorders responsive to modulating sodium absorption by
modulating the binding of PLUNC proteins to sodium channels.
Inventors: |
Tarran; Robert; (Chapel
Hill, NC) ; Stutts; Monroe Jack; (Chapel Hill,
NC) ; Donaldson; Scott; (Chapel Hill, NC) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The University of North Carolina at Chapel Hill |
Chapel Hill |
NC |
US |
|
|
Family ID: |
47914825 |
Appl. No.: |
14/971523 |
Filed: |
December 16, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14345975 |
Mar 20, 2014 |
9127040 |
|
|
PCT/US2012/056112 |
Sep 19, 2012 |
|
|
|
14971523 |
|
|
|
|
61536647 |
Sep 20, 2011 |
|
|
|
Current U.S.
Class: |
530/350 |
Current CPC
Class: |
C07K 7/08 20130101; A61P
1/00 20180101; C07K 14/705 20130101; A61K 38/00 20130101; A61P
11/06 20180101; C07K 14/435 20130101 |
International
Class: |
C07K 14/705 20060101
C07K014/705 |
Claims
1. A polypeptide consisting essentially of the sodium channel
binding domain of a PLUNC protein, or a functional fragment or
homolog thereof.
2-47. (canceled)
Description
RELATED APPLICATIONS
[0001] This application is a continuation application of U.S.
patent application Ser. No. 14/345,975, filed Mar. 20, 2014, which
is a 35 U.S.C. .sctn.371 national phase application of PCT
Application PCT/US2012/056112, filed Sep. 19, 2012, which claims
the benefit under 35 U.S.C. .sctn.119(e) of U.S. Provisional Patent
Application Ser. No. 61/536,647, filed Sep. 20, 2011. The entire
contents of each of these applications is incorporated herein by
reference.
STATEMENT REGARDING ELECTRONIC FILING OF A SEQUENCE LISTING
[0002] A Sequence Listing in ASCII text format, submitted under 37
C.F.R. .sctn.1.821, entitled 5470-527TSXCT_ST25.txt, 7,884 bytes in
size, generated on Dec. 16, 2015 and filed via EFS-Web, is provided
in lieu of a paper copy. This Sequence Listing is hereby
incorporated by reference into the specification for its
disclosures.
FIELD OF THE INVENTION
[0003] The present invention relates to the ability of PLUNC
proteins, such as SPLUNC1 and SPLUNC2, to bind to sodium channels
and inhibit activation of the sodium channels. The invention
further relates to methods for regulating of sodium absorption and
fluid volume and treating disorders responsive to modulating sodium
absorption by modulating the binding of PLUNC proteins to sodium
channels.
BACKGROUND OF THE INVENTION
[0004] Epithelial mucosal surfaces are lined with fluids whose
volume and composition are precisely controlled. In the airways, a
thin film of airway surface liquid helps protect mammalian airways
from infection by acting as a lubricant for efficient mucus
clearance (Chmiel et al., Respir. Res. 4:8 (2003); Knowles et al.,
J. Clin. Invest. 109:571 (2002)). This layer moves cephalad during
mucus clearance and excess liquid that accumulates as two airways
converge is eliminated by Na.sup.+-led airway surface liquid
absorption with Na.sup.+ passing through the epithelial Na.sup.+
channel (ENaC) (Knowles et al., J. Clin. Invest. 109:571 (2002)).
How ENaC activity is sensed and controlled by the airways is poorly
understood. However, there is evidence that reporter molecules in
the airway surface liquid can serve as volume sensing signals whose
dilution or concentration can alter specific cell surface receptors
which control ion transport rates to either absorb or secrete
airway surface liquid as needed (Chambers et al., Respir. Physiol.
Neurobiol. 159:256 (2007)). ENaC must be cleaved by intracellular
furin-type proteases and/or extracellular channel activating
proteases (CAPs) such as prostasin to be active and to conduct
Na.sup.+ (Planes et al., Curr. Top. Dev. Biol. 78:23 (2007);
Rossier, Proc. Am. Thorac. Soc. 1:4 (2004); Vallet et al., Nature
389:607 (1997); Chraibi et al., J. Gen. Physiol. 111:127 (1998)).
ENaC can also be cleaved and activated by exogenous serine
proteases such as trypsin, an action that is attenuated by the
protease inhibitor aprotinin (Vallet et al., Nature 389:607
(1997)). When human bronchial epithelial cultures are mounted in
Ussing chambers where native airway surface liquid is washed away,
ENaC is predominantly active, suggesting that cell attached
proteases are predominant (Bridges et al., Am. J. Physiol. Lung
Cell. Mol. Physiol. 281:L16 (2001); Donaldson et al., J. Biol.
Chem. 277:8338 (2002)). In contrast, under thin film conditions,
where native airway surface liquid is present, ENaC activity is
reduced, suggesting that airway surface liquid contains soluble
proteases inhibitors (Myerburg et al., J. Biol. Chem. 281:27942
(2006); Tarran et al., J. Gen. Physiol. 127:591 (2006)).
[0005] The Palate Lung and Nasal epithelial Clone (PLUNC) family
are secreted proteins that are subdivided into short (SPLUNCs) and
long (LPLUNCs) members which contain either one or two domains
respectively (Bingle et al., Biochim. Biophys. Acta 1493:363
(2000); Weston et al., J. Biol Chem. 274:13698 (1999)). The
original PLUNC gene which is now called SPLUNC1 comprises up to 10%
of total protein in the airway surface liquid and can readily be
detected in both nasal lavage and tracheal secretions (Bingle, C.
D., and Craven, C. J. (2002) PLUNC: a novel family of candidate
host defense proteins expressed in the upper airways and
nasopharynx Hum Mol Genet 11, 937; Campos, M. A., et al. (2004)
Purification and characterization of PLUNC from human
tracheobronchial secretions Am J Respir Cell Mol Biol 30, 184;
Lindahl, M., Stahlbom, B., and Tagesson, C. (2001) Identification
of a new potential airway irritation marker, palate lung nasal
epithelial clone protein, in human nasal lavage fluid with
two-dimensional electrophoresis and matrix-assisted laser
desorption/ionization-time of flight Electrophoresis 22, 1795).
SPLUNC1 is expressed in both submucosal glands, the superficial
epithelia and in neutrophils and in theory, is present in the
correct regions of the lung to be a volume sensing molecule since
it can be secreted onto the mucosal surface of the superficial
epithelial where ENaC is expressed (Bartlett et al., J. Leukoc.
Biol. 83:1201 (2008); Bingle et al., J. Pathol. 205:491
(2005)).
[0006] The present invention addresses previous shortcomings in the
art by disclosing the regulation of sodium channels by PLUNC
proteins and the manipulation of this pathway to regulate sodium
absorption and fluid volume and treat disorders responsive to
modulating sodium absorption.
SUMMARY OF THE INVENTION
[0007] The present invention is based, in part, on the discovery of
the ability of PLUNC proteins to regulate the activity of sodium
channels. Accordingly, in one aspect the invention relates to a
method of inhibiting the activation of a sodium channel, comprising
contacting a sodium channel with a PLUNC protein or a functional
fragment thereof. In one embodiment, the sodium channel is an
epithelial sodium channel (ENaC). In another embodiment, the PLUNC
protein is SPLUNC1 or SPLUNC2. In one embodiment, the PLUNC protein
or a functional fragment thereof binds to the sodium channel.
[0008] Another aspect of the invention relates to a method of
inhibiting sodium absorption through a sodium channel, comprising
contacting the sodium channel with a PLUNC protein or a functional
fragment thereof. In one embodiment, the PLUNC protein or a
functional fragment thereof binds to the sodium channel.
[0009] A further aspect of the invention relates to a method of
increasing the volume of fluid lining an epithelial mucosal
surface, comprising contacting a sodium channel present on the
epithelial mucosal surface with a PLUNC protein or a functional
fragment thereof. In one embodiment, the PLUNC protein or a
functional fragment thereof binds to the sodium channel.
[0010] Another aspect of the invention relates to a method of
reducing the level of a sodium channel present on the surface of a
cell, comprising contacting the sodium channel with a PLUNC protein
or a functional fragment thereof. In one embodiment, the PLUNC
protein or a functional fragment thereof binds to the sodium
channel.
[0011] A further aspect of the invention relates to a method of
treating a disorder responsive to inhibition of sodium absorption
across an epithelial mucosal surface in a subject in need thereof,
comprising delivering to the subject a therapeutically effective
amount of a PLUNC protein or a functional fragment thereof. In one
embodiment, the PLUNC protein or a functional fragment thereof
binds to the sodium channel.
[0012] Another aspect of the invention relates to a method of
regulating salt balance, blood volume, blood pressure, and/or
colonic motility in a subject in need thereof, comprising
delivering to the subject a therapeutically effective amount of a
PLUNC protein or a functional fragment thereof. In one embodiment,
the PLUNC protein or a functional fragment thereof binds to the
sodium channel.
[0013] An additional aspect of the invention relates to a method of
increasing the activation of a sodium channel, comprising
inhibiting the binding of a PLUNC protein to the sodium
channel.
[0014] A further aspect of the invention relates to a method of
increasing sodium absorption through a sodium channel, comprising
inhibiting the binding of a PLUNC protein to the sodium channel,
thereby activating the sodium channel.
[0015] Another aspect of the invention relates to a method of
decreasing the volume of fluid lining an epithelial mucosal
surface, comprising inhibiting the binding of a PLUNC protein to a
sodium channel present in the epithelial mucosal surface, thereby
activating the sodium channel.
[0016] A further aspect of the invention relates to a method of
increasing the level of a sodium channel present on the surface of
a cell, comprising inhibiting the binding of a PLUNC protein to the
sodium channel present on the surface of the cell.
[0017] An additional aspect of the invention relates to a method of
treating a disorder responsive to activation of sodium absorption
in a subject in need thereof, comprising inhibiting the activity of
a PLUNC protein in the subject.
[0018] Another aspect of the invention relates to a method of
regulating salt balance, blood volume, blood pressure (e.g., by
inducing natriuresis), and/or colonic motility in a subject in need
thereof, comprising inhibiting the activity of a PLUNC protein in
the subject.
[0019] A further aspect of the invention relates to a method of
enhancing the sense of taste in a subject, comprising inhibiting
the activity of a PLUNC protein in the subject.
[0020] An additional aspect of the invention relates to a
polypeptide consisting essentially of the sodium channel binding
domain of a PLUNC protein, as well as a polynucleotide encoding the
polypeptide and a vector and/or cell comprising the
polynucleotide.
[0021] Another aspect of the invention relates to a compound that
mimics the sodium channel binding domain of a PLUNC protein and
binds to a sodium channel, wherein cleavage of the sodium channel
by a protease is inhibited when bound to the compound.
[0022] An additional aspect of the invention relates to a SPLUNC1
protein in which the amino acid sequence of the hinge region has
been modified to decrease the pH sensitivity of at least one
bioactivity of SPLUNC1.
[0023] A further aspect of the invention relates to a polypeptide
consisting essentially of a PLUNC protein binding domain of a
sodium channel, as well as a polynucleotide encoding the
polypeptide and a vector and/or cell comprising the
polynucleotide.
[0024] An additional aspect of the invention relates to a compound
that mimics a PLUNC protein binding domain of a sodium channel and
binds to a PLUNC protein, wherein binding of PLUNC protein to the
sodium channel is inhibited when bound to the compound.
[0025] Another aspect of the invention relates to a kit comprising
the polypeptide, polynucleotide, vector, cell, peptidomimetic, or
compound of the invention.
[0026] Another aspect of the invention relates to the use of a
PLUNC protein or a functional fragment thereof for the preparation
of a medicament to treat a disorder responsive to inhibition of
sodium absorption in a subject in need thereof.
[0027] Another aspect of the invention relates to the use of an
inhibitor of a PLUNC protein for the preparation of a medicament to
treat a responsive to activation of sodium absorption in a subject
in need thereof.
[0028] These and other aspects of the invention are set forth in
more detail in the description of the invention below.
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] FIG. 1 shows that SPLUNC1 is present in the airway surface
liquid of human bronchial cultures. Airway surface liquid was
incubated with trypsin-agarose beads.+-.aprotinin and proteins were
separated on 15% SDS gel and visualized with a silver stain. The
outlined bands were then cut out and analyzed by MALDI-MS/MS and
the proteins identified are shown in Table 2. SPLUNC1 was detected
in Bands 1 & 2, and its binding to trypsin was attenuated in
the presence of aprotinin.
[0030] FIG. 2, Panels A-E show the presence and function of SPLUNC1
in airway fluid.
[0031] FIG. 3 shows that SPLUNC1 is cleaved by trypsin. A 60 min
treatment with 1 U/ml trypsin caused both a .about.1 kDa and a 10
kDa shift in SPLUNC1 size. SPLUNC1 was labeled C-terminally with a
V5 tag and detected with an anti-V5 antibody. SPLUNC1 cleavage
products are shown with arrows.
[0032] FIG. 4 shows that SPLUNC1 affects the transepithelial
resistance (Rt) in a similar fashion to amiloride. Human bronchial
epithelial cultures were washed 5.times. with PBS over 1 h to
remove any native SPLUNC1 and then exposed to 50 ng/ml recombinant
SPLUNC1 for 30 min or 100 mM amiloride for 10 min or SPLUNC1
followed by amiloride. All n=12. *=p<0.05 different to
control.
[0033] FIG. 5, Panels A-C show the effect of expressing SPLUNC1 and
ENaC in Xenopus oocytes.
[0034] FIG. 6, Panels A and B show the effect of SPLUNC1 on
cleavage of ENaC.
[0035] FIG. 7, Panels A-E show the effect of expressing SPLUNC1 and
ENaC is Xenopus oocytes.
[0036] FIG. 8 shows a Western blot showing .alpha.ENaC expression
in JME cells stably transfected with pQCXIN-.alpha.-ENaC-YFP but
not in cells from the same passage infected with the empty pQCXIN
vector
[0037] FIG. 9, Panels A and B show binding of SPLUNC1 to ENaC.
[0038] FIG. 10 shows that SPLUNC1 binds to .alpha., .beta. and
.gamma.ENaC subunits. Oocytes were coinjected with 0.3 ng
.alpha..beta..gamma.ENaC subunits.+-.SPLUNC1 (1 ng). Gels show
representative co-immunoprecipitation of V5-tagged SPLUNC1 and
HA-tagged ENaC subunits. Arrowheads denote ENaC or SPLUNC1 bands
and U.I. denotes uninjected control oocytes.
[0039] FIG. 11, Panels A-E show the inhibition of SPLUNC1 with
shRNA.
[0040] FIG. 12 shows that SPLUNC1 is highly expressed in the
trachea, colon and kidney. cDNA was obtained from whole trachea,
kidney, stomach and colon vs. specific SPLUNC1 cDNA.
[0041] FIG. 13 shows the effect of PLUNC family members on ENaC
activity.
[0042] FIG. 14 shows that the ability of SPLUNC1 to inhibit the
transepithelial PD is attenuated by DTT pretreatment in primary
human bronchial epithelial cultures. Cultures were prewashed to
remove endogenous SPLUNC1 and the basal PD was measured (control,
ctrl), then either 50 ng/ml recombinant SPLUNC1 or recombinant
SPLUNC1 that had been reduced with DTT was added, and the PD was
remeasured on the same cultures 45 min later. *=p<0.05 different
from control. .dagger.=p<0.05 different to SPLUNC1 alone.
[0043] FIG. 15 shows a Western blot run under non-denaturing
conditions showing that reduced (i.e., DTT-treated) SPLUNC1
migrates along the gel at a different rate to non-denatured
SPLUNC1.
[0044] FIG. 16, Panels A and B show that SPLUNC1 may inhibit ENaC
by decreasing the number of ENaC channels in the plasma membrane.
Panel A, Surface biotinylation of .alpha.ENaC shows that plasma
membrane ENaC is decreased following coexpression with SPLUNC1 in
oocytes. 1, control; 2, .alpha.ENaC, 3, .alpha.ENaC & SPLUNC1.
Total lysate per lane was 3-4 eggs run on a 10% Gel. Panel B,
addition of MTSET to ENaC containing the .beta.S518C mutant
increases ENaC P.sub.o to 1.0 when coexpressed in oocytes yet the
overall current is still reduced by SPLUNC1 expression, suggesting
that ENaC has been internalized. Open bars, control. Closed bars,
MTSET addition. All n=6.
[0045] FIG. 17 shows the predicted model of SPLUNC1 (SEQ ID
NO:12).
[0046] FIG. 18, Panels A-C show the identification of the active
site of SPLUNC1 (SEQ ID NO:11). Panel A, SPLUNC1 truncants were
constructed. All truncants had deletions starting from the
C-terminus, retained the N-terminal signal sequence and were all
spontaneously secreted from oocytes into the media (as determined
by western blot). Panel B, The effect of these truncants on the
amiloride-sensitive (ENaC) current was determined by 2 electrode
voltage clamp. Deletion of up to 85% of SPLUNC1 resulted in similar
inhibition of ENaC as full length SPLUNC1. All n=10-14. Panel C, An
18 amino acid peptide, corresponding to region 22-39, dubbed S18,
also inhibits both basal and trypsin-stimulated ENaC current when
incubated in the oocyte bath for 1 h at 10 .mu.M. Open bars,
control. Closed bars, S18. n=9. * p<0.05 different to
control.
[0047] FIG. 19 shows a comparison of the SPLUNC1 amino acid
sequence (amino acids 22-39 of SEQ ID NO:1) to the sequence of the
.alpha.26 and .gamma.43 subunits of ENaC (SEQ ID NOS:9 and 10).
[0048] FIG. 20 shows that S18 binds specifically to .beta.ENaC.
Biotinylated-S18 pull-down of ENaC subunits individually expressed
in HEK cells. IN=input, PD=pull-down elution. Input represented 4%
of total lysate. Gel was 4-12% bis-tris gradient gel and was
repeated 3.times..
[0049] FIG. 21, Panels A-C show that extracellular S18 binding
alters intracellular ENaC FRET. Panel A.sub.i, cartoon of
.alpha.ENaC-eGFP and .beta.ENaC-mCherry under basal conditions
(.gamma.ENaC not shown). Panel A.sub.ii We hypothesize that S18
binding to the extracellular loop of .beta.ENaC (1) induces a
conformational change in ENaC which is reflected as altered
intracellular FRET (2). This change may facilitate NEDD4-2-induced
ubiquitination (3), leading to internalization of
.alpha..beta..gamma.ENaC (4). Panel B, acceptor-photobleaching FRET
indicates that .alpha. and .beta.ENaC subunits change their
orientation/distance to each other upon S18 binding, indicating
allostery. In contrast, exposure to aprotinin had no effect. All
n=8-10. Panel C, Typical confocal images of HEK cells expressing
.alpha..gamma.ENaC and .beta.ENaC-eGFP before and 1 h after 100
.mu.M S18. Cell outlines are traced in white.
[0050] FIG. 22, Panels A-D show that S18 inhibits cystic fibrosis
(CF) hyperabsorption. Panel A, Airway surface liquid (ASL) height
with time in CF HBECs measured by XZ confocal microscopy after
apical addition of 20 .mu.l Ringer with rhodamine-dextran.
.box-solid.=control; .tangle-solidup.=10 .mu.M S18. Both n=6. Panel
B, Thin film amiloride-sensitive transepithelial PD measured in the
same cultures as A, with microelectrodes positioned in the ASL and
serosal bath. Open bars, control, closed bars, S18. n=6. Panel C,
Dose response to S18 vs. ASL height in CF primary human bronchial
epithelial cultures (HBECs) measured 8 h after S18 addition. Panel
D, Bar graph of 8 h ASL height in CF HBECs. Control (open bars),
S18 black bars, aprotinin, gray bars. NE, neutrophil elastase. ANS,
activated neutrophil supernatant. All n=6. * p<0.05 different to
vehicle. .dagger.p<0.05 different to aprotinin.
[0051] FIG. 23 shows that S18 is heat-resistant and still inhibits
CF ASL, hyperabsorption after exposure to 67.degree. C. ASL height
was measured in CF HBECs 2 h after exposure to S18, 67.degree. C.
S18 and/or neutrophil elastase (NE). all n=6.
[0052] FIG. 24, Panels A and B show that ASL volume homeostasis
requires correct ASL pH and the presence of SPLUNC1. Normal lung
(NL) (Panel A) and CF (Panel B) HBECs were stably infected with
retrovirus containing either anti-luciferase or anti-SPLUNC1 shRNA
(Garcia-Cabellero et al., 2009). 20 .mu.l Ringer containing
rhodamine-dextran was added and ASL height measured 3 h later. In
some cases, a modified Ringer where 50 mM NaCl was exchanged for
100 mM POPSO was used. Open bars, NL. Black bars, CF. Gray bars, NL
or CF with POPSO. All n=6-9. *=p<0.05 different to control.
.dagger.<0.05 different to NL.
[0053] FIG. 25, Panels A-C show that recombinant SPLUNC1, but not
S18, is dysfunctional in CF ASL and in acidic media. Panel A,
Coomassie-stained gel showing SPLUNC1 purified by S200 gel
filtration column at 0.4 and 0.8 mg/ml (lanes 1 and 2
respectively). Panel B, ASL height in NL (open bars) and CF (closed
bars) HBECs after exposure to 100 .mu.M SPLUNC1 or S18. All n=6.
Panel C, .alpha..beta..gamma.ENaC was expressed in Xenopus laevis
oocytes and the amiloride-sensitive current was measured, as a
specific indicator of ENaC activity. Current on each day was
normalized to basal amiloride-sensitive currents. SPLUNC1 or S18
were added at 100 .mu.M to the bath solution at ph 7.4 (open bars)
or pH 6 (gray bars) for 2 h prior to measuring ENaC activity. All
n=7-10. *=p<0.05 different to control. .dagger.=p<0.05
different between NL and CF.
[0054] FIG. 26, Panels A and B show that SPLUNC1 is resistant to
proteolytic cleavage at pH 6. Panel A, Neutrophil elastase activity
is moderately greater at pH 6 than at pH 7.4. Panel B,
Coomassie-stained gel showing 10 .mu.M SPLUNC1 exposed to 100 nM
Neutrophil elastase at pH 6 and 7.4. The reaction was stopped at
timed intervals.
[0055] FIG. 27 shows that the pH-hinge mutant SPLUNC1 is still
functional in CF airways. ASL height was measured over 24 h by XZ
confocal microscopy in CF HBECs after exposure to 20 ml PBS
containing vehicle, WT SPLUNC1 (30 .mu.M) or the pH-hinge mutant
SPLUNC1 (30 .mu.M). All n=6.
[0056] FIG. 28, Panels A-D show that the S18 peptide does not
affect the function of ASIC1a, -2a and -3 channels.
[0057] FIG. 29, Panels A-C show that the S18 peptide interacts
specifically with the f-ENaC subunit.
[0058] FIG. 30, Panels A-C show that the .beta.-ENaC/S18
interaction is glycosylation dependent.
[0059] FIG. 31 shows alanine scan results for S18.
[0060] FIG. 32 shows that S18 induces natriuresis when added
systemically to mice.
DETAILED DESCRIPTION OF THE INVENTION
[0061] The present invention will now be described in more detail
with reference to the accompanying drawings, in which preferred
embodiments of the invention are shown. This invention may,
however, be embodied in different forms and should not be construed
as limited to the embodiments set forth herein. Rather, these
embodiments are provided so that this disclosure will be thorough
and complete, and will fully convey the scope of the invention to
those skilled in the art.
[0062] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
skill in the art to which this invention belongs. The terminology
used in the description of the invention herein is for the purpose
of describing particular embodiments only and is not intended to be
limiting of the invention. All publications, patent applications,
patents, patent publications and other references cited herein are
incorporated by reference in their entireties for the teachings
relevant to the sentence and/or paragraph in which the reference is
presented.
[0063] Nucleotide sequences are presented herein by single strand
only, in the 5' to 3' direction, from left to right, unless
specifically indicated otherwise. Nucleotides and amino acids are
represented herein in the manner recommended by the IUPAC-IUB
Biochemical Nomenclature Commission, or (for amino acids) by either
the one-letter code, or the three letter code, both in accordance
with 37 C.F.R. .sctn.1.822 and established usage.
[0064] Except as otherwise indicated, standard methods known to
those skilled in the art may be used for cloning genes, amplifying
and detecting nucleic acids, and the like. Such techniques are
known to those skilled in the art. See, e.g., Sambrook et al.,
Molecular Cloning: A Laboratory Manual 2nd Ed. (Cold Spring Harbor,
N. Y., 1989); Ausubel et al. Current Protocols in Molecular Biology
(Green Publishing Associates, Inc. and John Wiley & Sons, Inc.,
New York).
I. DEFINITIONS
[0065] As used in the description of the invention and the appended
claims, the singular forms "a," "an," and "the" are intended to
include the plural forms as well, unless the context clearly
indicates otherwise.
[0066] Also as used herein, "and/or" refers to and encompasses any
and all possible combinations of one or more of the associated
listed items, as well as the lack of combinations when interpreted
in the alternative ("or").
[0067] The term "consists essentially of" (and grammatical
variants), as applied to a polynucleotide or polypeptide sequence
of this invention, means a polynucleotide or polypeptide that
consists of both the recited sequence (e.g., SEQ ID NO) and a total
often or less (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional
nucleotides or amino acids on the 5' and/or 3' or N-terminal and/or
C-terminal ends of the recited sequence such that the function of
the polynucleotide or polypeptide is not materially altered. The
total of ten or less additional nucleotides or amino acids includes
the total number of additional nucleotides or amino acids on both
ends added together. The term "materially altered," as applied to
polynucleotides of the invention, refers to an increase or decrease
in ability to express the encoded polypeptide of at least about 50%
or more as compared to the expression level of a polynucleotide
consisting of the recited sequence. The term "materially altered,"
as applied to polypeptides of the invention, refers to an increase
or decrease in binding activity (e.g., to a sodium channel or PLUNC
protein) of at least about 50% or more as compared to the activity
of a polypeptide consisting of the recited sequence.
[0068] The term "modulate," "modulates," or "modulation" refers to
enhancement (e.g., an increase) or inhibition (e.g., a decrease) in
the specified level or activity.
[0069] The term "enhance" or "increase" refers to an increase in
the specified parameter of at least about 1.25-fold, 1.5-fold,
2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold,
twelve-fold, or even fifteen-fold.
[0070] The term "inhibit" or "reduce" or grammatical variations
thereof as used herein refers to a decrease or diminishment in the
specified level or activity of at least about 15%, 25%, 35%, 40%,
50%, 60%, 75%, 80%, 90%, 95% or more. In particular embodiments,
the inhibition or reduction results in little or essentially no
detectible activity (at most, an insignificant amount, e.g., less
than about 10% or even 5%).
[0071] The term "contact" or grammatical variations thereof as used
with respect to a PLUNC protein and a sodium channel, refers to
bringing the PLUNC protein and the sodium channel in sufficiently
close proximity to each other for one to exert a biological effect
on the other. In some embodiments, the term contact means binding
of the PLUNC protein to the sodium channel.
[0072] A "therapeutically effective" amount as used herein is an
amount that provides some improvement or benefit to the subject.
Alternatively stated, a "therapeutically effective" amount is an
amount that will provide some alleviation, mitigation, or decrease
in at least one clinical symptom in the subject. Those skilled in
the art will appreciate that the therapeutic effects need not be
complete or curative, as long as some benefit is provided to the
subject.
[0073] By the terms "treat," "treating," or "treatment of," it is
intended that the severity of the subject's condition is reduced or
at least partially improved or modified and that some alleviation,
mitigation or decrease in at least one clinical symptom is
achieved.
[0074] As used herein, "nucleic acid," "nucleotide sequence," and
"polynucleotide" are used interchangeably and encompass both RNA
and DNA, including cDNA, genomic DNA, mRNA, synthetic (e.g.,
chemically synthesized) DNA or RNA and chimeras of RNA and DNA. The
term nucleic acid refers to a chain of nucleotides without regard
to length of the chain. The nucleic acid can be double-stranded or
single-stranded. Where single-stranded, the nucleic acid can be a
sense strand or an antisense strand. The nucleic acid can be
synthesized using oligonucleotide analogs or derivatives (e.g.,
inosine or phosphorothioate nucleotides). Such oligonucleotides can
be used, for example, to prepare nucleic acids that have altered
base-pairing abilities or increased resistance to nucleases. The
present invention further provides a nucleic acid that is the
complement (which can be either a full complement or a partial
complement) of a nucleic acid or nucleotide sequence of this
invention.
[0075] An "isolated polynucleotide" is a nucleotide sequence (e.g.,
DNA or RNA) that is not immediately contiguous with nucleotide
sequences with which it is immediately contiguous (one on the 5'
end and one on the 3' end) in the naturally occurring genome of the
organism from which it is derived. Thus, in one embodiment, an
isolated nucleic acid includes some or all of the 5' non-coding
(e.g., promoter) sequences that are immediately contiguous to a
coding sequence. The term therefore includes, for example, a
recombinant DNA that is incorporated into a vector, into an
autonomously replicating plasmid or virus, or into the genomic DNA
of a prokaryote or eukaryote, or which exists as a separate
molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or
restriction endonuclease treatment), independent of other
sequences. It also includes a recombinant DNA that is part of a
hybrid nucleic acid encoding an additional polypeptide or peptide
sequence. An isolated polynucleotide that includes a gene is not a
fragment of a chromosome that includes such gene, but rather
includes the coding region and regulatory regions associated with
the gene, but no additional genes naturally found on the
chromosome.
[0076] The term "isolated" can refer to a nucleic acid, nucleotide
sequence or polypeptide that is substantially free of cellular
material, viral material, and/or culture medium (when produced by
recombinant DNA techniques), or chemical precursors or other
chemicals (when chemically synthesized). Moreover, an "isolated
fragment" is a fragment of a nucleic acid, nucleotide sequence or
polypeptide that is not naturally occurring as a fragment and would
not be found in the natural state. "Isolated" does not mean that
the preparation is technically pure (homogeneous), but it is
sufficiently pure to provide the polypeptide or nucleic acid in a
form in which it can be used for the intended purpose.
[0077] An isolated cell refers to a cell that is separated from
other components with which it is normally associated in its
natural state. For example, an isolated cell can be a cell in
culture medium and/or a cell in a pharmaceutically acceptable
carrier of this invention. Thus, an isolated cell can be delivered
to and/or introduced into a subject. In some embodiments, an
isolated cell can be a cell that is removed from a subject and
manipulated as described herein ex vivo and then returned to the
subject.
[0078] The term "fragment," as applied to a polynucleotide, will be
understood to mean a nucleotide sequence of reduced length relative
to a reference nucleic acid or nucleotide sequence and comprising,
consisting essentially of, and/or consisting of a nucleotide
sequence of contiguous nucleotides identical or almost identical
(e.g., 90%, 92%, 95%, 98%, 99,% identical) to the reference nucleic
acid or nucleotide sequence. Such a nucleic acid fragment according
to the invention may be, where appropriate, included in a larger
polynucleotide of which it is a constituent. In some embodiments,
such fragments can comprise, consist essentially of, and/or consist
of oligonucleotides having a length of at least about 8, 10, 12,
15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, or more
consecutive nucleotides of a nucleic acid or nucleotide sequence
according to the invention. In other embodiments, such fragments
can comprise, consist essentially of, and/or consist of
oligonucleotides having a length of less than about 200, 150, 100,
75, 60, 50, 45, 40, 35, 30, 25, 20, 15, 12, 10, 8, or less
consecutive nucleotides of a nucleic acid or nucleotide sequence
according to the invention.
[0079] The term "fragment," as applied to a polypeptide, will be
understood to mean an amino acid sequence of reduced length
relative to a reference polypeptide or amino acid sequence and
comprising, consisting essentially of, and/or consisting of an
amino acid sequence of contiguous amino acids identical or almost
identical (e.g., 90%, 92%, 95%, 98%, 99% identical) to the
reference polypeptide or amino acid sequence. Such a polypeptide
fragment according to the invention may be, where appropriate,
included in a larger polypeptide of which it is a constituent. In
some embodiments, such fragments can comprise, consist essentially
of, and/or consist of peptides having a length of at least about 4,
6, 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, or
more consecutive amino acids of a polypeptide or amino acid
sequence according to the invention. In other embodiments, such
fragments can comprise, consist essentially of, and/or consist of
peptides having a length of less than about 200, 150, 100, 75, 60,
50, 45, 40, 35, 30, 25, 20, 15, 12, 10, 8, 6, 4, or less
consecutive amino acids of a polypeptide or amino acid sequence
according to the invention.
[0080] A "vector" is any nucleic acid molecule for the cloning of
and/or transfer of a nucleic acid into a cell. A vector may be a
replicon to which another nucleotide sequence may be attached to
allow for replication of the attached nucleotide sequence. A
"replicon" can be any genetic element (e.g., plasmid, phage,
cosmid, chromosome, viral genome) that functions as an autonomous
unit of nucleic acid replication in vivo, i.e., capable of
replication under its own control. The term "vector" includes both
viral and nonviral (e.g., plasmid) nucleic acid molecules for
introducing a nucleic acid into a cell in vitro, ex vivo, and/or in
vivo. A large number of vectors known in the art may be used to
manipulate nucleic acids, incorporate response elements and
promoters into genes, etc. For example, the insertion of the
nucleic acid fragments corresponding to response elements and
promoters into a suitable vector can be accomplished by ligating
the appropriate nucleic acid fragments into a chosen vector that
has complementary cohesive termini. Alternatively, the ends of the
nucleic acid molecules may be enzymatically modified or any site
may be produced by ligating nucleotide sequences (linkers) to the
nucleic acid termini. Such vectors may be engineered to contain
sequences encoding selectable markers that provide for the
selection of cells that contain the vector and/or have incorporated
the nucleic acid of the vector into the cellular genome. Such
markers allow identification and/or selection of host cells that
incorporate and express the proteins encoded by the marker. A
"recombinant" vector refers to a viral or non-viral vector that
comprises one or more heterologous nucleotide sequences (i.e.,
transgenes), e.g., two, three, four, five or more heterologous
nucleotide sequences.
[0081] Viral vectors have been used in a wide variety of gene
delivery applications in cells, as well as living animal subjects.
Viral vectors that can be used include, but are not limited to,
retrovirus, lentivirus, adeno-associated virus, poxvirus,
alphavirus, baculovirus, vaccinia virus, herpes virus, Epstein-Barr
virus, and adenovirus vectors. Non-viral vectors include plasmids,
liposomes, electrically charged lipids (cytofectins), nucleic
acid-protein complexes, and biopolymers. In addition to a nucleic
acid of interest, a vector may also comprise one or more regulatory
regions, and/or selectable markers useful in selecting, measuring,
and monitoring nucleic acid transfer results (delivery to specific
tissues, duration of expression, etc.).
[0082] Vectors may be introduced into the desired cells by methods
known in the art, e.g., transfection, electroporation,
microinjection, transduction, cell fusion, DEAE dextran, calcium
phosphate precipitation, lipofection (lysosome fusion), use of a
gene gun, or a nucleic acid vector transporter (see, e.g., Wu et
al., J. Biol. Chem. 267:963 (1992); Wu et al., J. Biol. Chem.
263:14621 (1988); and Hartmut et al., Canadian Patent Application
No. 2,012,311, filed Mar. 15, 1990).
[0083] In some embodiments, a polynucleotide of this invention can
be delivered to a cell in vivo by lipofection. Synthetic cationic
lipids designed to limit the difficulties and dangers encountered
with liposome-mediated transfection can be used to prepare
liposomes for in vivo transfection of a nucleotide sequence of this
invention (Felgner et al., Proc. Natl. Acad. Sc. USA 84:7413
(1987); Mackey, et al., Proc. Natl. Acad. Sci. U.S.A. 85:8027
(1988); and Ulmer et al., Science 259:1745 (1993)). The use of
cationic lipids may promote encapsulation of negatively charged
nucleic acids, and also promote fusion with negatively charged cell
membranes (Felgner el al., Science 337:387 (1989)). Particularly
useful lipid compounds and compositions for transfer of nucleic
acids are described in International Patent Publications WO95/18863
and WO96/17823, and in U.S. Pat. No. 5,459,127. The use of
lipofection to introduce exogenous nucleotide sequences into
specific organs in vivo has certain practical advantages. Molecular
targeting of liposomes to specific cells represents one area of
benefit. It is clear that directing transfection to particular cell
types would be particularly preferred in a tissue with cellular
heterogeneity, such as pancreas, liver, kidney, and the brain.
Lipids may be chemically coupled to other molecules for the purpose
of targeting (Mackey, et al., 1988, supra). Targeted peptides,
e.g., hormones or neurotransmitters, and proteins such as
antibodies, or non-peptide molecules can be coupled to liposomes
chemically.
[0084] In various embodiments, other molecules can be used for
facilitating delivery of a nucleic acid in vivo, such as a cationic
oligopeptide (e.g., WO95/21931), peptides derived from nucleic acid
binding proteins (e.g., WO96/25508), and/or a cationic polymer
(e.g., WO95/21931).
[0085] It is also possible to introduce a vector in vivo as naked
nucleic acid (see U.S. Pat. Nos. 5,693,622, 5,589,466 and
5,580,859). Receptor-mediated nucleic acid delivery approaches can
also be used (Curiel et al., Hum. Gene Ther. 3:147 (1992); Wu et
al., J. Biol. Chem. 262:4429 (1987)).
[0086] The term "transfection" or "transduction" means the uptake
of exogenous or heterologous nucleic acid (RNA and/or DNA) by a
cell. A cell has been "transfected" or "transduced" with an
exogenous or heterologous nucleic acid when such nucleic acid has
been introduced or delivered inside the cell. A cell has been
"transformed" by exogenous or heterologous nucleic acid when the
transfected or transduced nucleic acid imparts a phenotypic change
in the cell and/or a change in an activity or function of the cell.
The transforming nucleic acid can be integrated (covalently linked)
into chromosomal DNA making up the genome of the cell or it can be
present as a stable plasmid.
[0087] As used herein, the terms "protein" and "polypeptide" are
used interchangeably and encompass both peptides and proteins,
unless indicated otherwise.
[0088] A "fusion protein" is a polypeptide produced when two
heterologous nucleotide sequences or fragments thereof coding for
two (or more) different polypeptides not found fused together in
nature are fused together in the correct translational reading
frame. Illustrative fusion polypeptides include fusions of a
polypeptide of the invention (or a fragment thereof) to all or a
portion of glutathione-S-transferase, maltose-binding protein, or a
reporter protein (e.g., Green Fluorescent Protein,
.beta.-glucuronidase, .beta.-galactosidase, luciferase, etc.),
hemagglutinin, c-myc, FLAG epitope, etc.
[0089] As used herein, a "functional" polypeptide or "functional
fragment" is one that substantially retains at least one biological
activity normally associated with that polypeptide (e.g., binding
to or inhibiting a sodium channel or a PLUNC protein). In
particular embodiments, the "functional" polypeptide or "functional
fragment" substantially retains all of the activities possessed by
the unmodified peptide. By "substantially retains" biological
activity, it is meant that the polypeptide retains at least about
20%, 30%, 40%, 50%, 60%, 75%, 85%, 90%, 95%, 97%, 98%, 99%, or
more, of the biological activity of the native polypeptide (and can
even have a higher level of activity than the native polypeptide).
A "non-functional" polypeptide is one that exhibits little or
essentially no detectable biological activity normally associated
with the polypeptide (e.g., at most, only an insignificant amount,
e.g., less than about 10% or even 5%). Biological activities such
as protein binding and angiogenic activity can be measured using
assays that are well known in the art and as described herein. In
some embodiments, the term "functional fragment" also encompasses
compounds that are mimetics of a portion of the polypeptide (e.g.,
peptidomimetics) that have at least one biological activity that is
substantially the same as an activity associated with the
polypeptide.
[0090] By the term "express" or "expression" of a polynucleotide
coding sequence, it is meant that the sequence is transcribed, and
optionally, translated. Typically, according to the present
invention, expression of a coding sequence of the invention will
result in production of the polypeptide of the invention. The
entire expressed polypeptide or fragment can also function in
intact cells without purification.
[0091] The term "about," as used herein when referring to a
measurable value such as an amount of polypeptide, dose, time,
temperature, enzymatic activity or other biological activity and
the like, is meant to encompass variations of .+-.20%, .+-.10%,
.+-.5%, .+-.1%, .+-.0.5%, or even .+-.0.1% of the specified
amount.
II. DECREASING SODIUM CHANNEL ACTIVATION
[0092] A first aspect of the invention relates to the ability of
PLUNC proteins to bind to a sodium channel and prevent activation
of the sodium channel, thereby inhibiting the flow of sodium ions.
Thus, one aspect of the present invention relates to a method of
inhibiting the activation of a sodium channel, comprising
contacting (e.g., binding) a sodium channel with a PLUNC protein or
a functional fragment thereof. In one embodiment, the sodium
channel is an epithelial sodium channel (ENaC), e.g., human ENaC.
In another embodiment, the sodium channel is one that is similar in
sequence and/or structure to ENaC. The inhibition of sodium channel
activation can be measured by any method known in the art or
disclosed herein, including, without limitation, measuring sodium
flow or change in potential across a membrane, across a cell, or
across a natural or artificial lining. The inhibition can be at
least about 20%, e.g., at least about 30%, 40%, 50%, 60%, 70%, 80%,
90%, or 100% relative to sodium channel activation in the absence
of a PLUNC protein.
[0093] The PLUNC protein can be any protein from the PLUNC family
that can bind to and inhibit the activation of sodium channel,
e.g., binds to i-ENaC. In one embodiment, the PLUNC protein is a
human PLUNC protein. In another embodiment, the PLUNC protein is
SPLUNC1 or SPLUNC2. The PLUNC protein can be a naturally occurring
PLUNC protein or a PLUNC protein in which the amino acid sequence
has been modified (e.g., with insertions, deletions, substitutions,
or any combination thereof). In certain embodiments, the modified
PLUNC protein exhibits a modulation on one or more bioactivity of
the PLUNC protein, e.g., a decrease in pH sensitivity. In other
embodiments, no more than 20 amino acids of the naturally occurring
PLUNC sequence are modified (inserted, deleted or substituted),
e.g., no more than 15, 10, 9, 8, 7, 6, or 5 amino acids.
[0094] The method of inhibiting the activation of a sodium channel
can be carried out, e.g., on an isolated sodium channel, a sodium
channel in an artificial membrane, or a sodium channel in a cell.
In one embodiment, the sodium channel is present in an isolated
cell, e.g., a cultured primary cell or cell line. In another
embodiment, the isolated cell is part of an epithelial cell
culture, e.g., a natural or artificial epithelial lining, e.g., a
cell culture in a device (such as an Ussing chamber) in which
characteristics such as ion flow and/or potential can be measured
across lining. In another embodiment, the cell is part of an
isolated tissue or a tissue culture. In a further embodiment, the
cell can be present in an animal, e.g., an animal that is a disease
model or a subject in need of treatment.
[0095] In one embodiment, the step of contacting (e.g., binding)
the sodium channel with a PLUNC protein comprises delivering the
PLUNC protein or a functional fragment or homolog thereof to a cell
comprising the sodium channel. In another embodiment, the
contacting step (e.g., binding) comprises delivering a
polynucleotide encoding the PLUNC protein or a functional fragment
or homolog thereof to a cell comprising the sodium channel.
[0096] As used herein, the term "homolog" is used to refer to a
polypeptide which differs from a naturally occurring polypeptide by
minor modifications to the naturally occurring polypeptide, but
which significantly retains a biological activity of the naturally
occurring polypeptide. Minor modifications include, without
limitation, changes in one or a few amino acid side chains, changes
to one or a few amino acids (including deletions, insertions,
and/or substitutions), changes in stereochemistry of one or a few
atoms, and minor derivatizations, including, without limitation,
methylation, glycosylation, phosphorylation, acetylation,
myristoylation, prenylation, palmitation, amidation, and addition
of glycosylphosphatidyl inositol. The term "substantially retains,"
as used herein, refers to a fragment, homolog, or other variant of
a polypeptide that retains at least about 20% of the activity of
the naturally occurring polypeptide (e.g., binding to a sodium
channel), e.g., about 30%, 40%, 50% or more. Other biological
activities, depending on the polypeptide, may include pH
sensitivity, enzyme activity, receptor binding, ligand binding,
induction of a growth factor, a cell signal transduction event,
etc.
[0097] In one embodiment, the method comprises delivering to a cell
comprising a sodium channel an isolated PLUNC protein. In exemplary
embodiments, the PLUNC protein comprises, consists essentially of,
or consists of the publicly known amino acid sequence of the PLUNC
protein (e.g., as disclosed in GenBank and disclosed herein) or a
functional fragment thereof. In another embodiment, the isolated
PLUNC protein comprises, consists essentially of, or consists of an
amino acid sequence that is at least 70% identical, e.g., at least
75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the
publicly known amino acid sequence or a functional fragment
thereof.
[0098] The amino acid sequence of human SPLUNC1 (SEQ ID NO: 1) and
human SPLUNC2 (SEQ ID NO:2) are disclosed below. The conserved
cysteine residues that are spaced 43 amino acids apart and may be
important for activity are indicated.
TABLE-US-00001 SPLUNC1 (SEQ ID NO: 1) 10 20 30 40 MEQTGGLIVF
YGLLAQTMAQ FGGLPVPLDQ TLPLNVNPAL 50 60 70 80 PLSPTGLAGS LTNALSNGLL
SGGLLGILEN LPLLDILKPG 90 100 110 120 GGTSGGLLGG LLGKVTSVIP
GLNNIIDIKV TDPQLLELGL 130 140 150 160 VQSPDGHRLY VTIPLGIKLQ
VNTPLVGASL LRLAVKLDIT 170 180 190 200 AEILAVRDKQ ERIHLVLGDC
THSPGSLQIS LLDGLGPLPI 210 220 230 240 QGLLDSLTGI LNKVLPELVQ
GNVCPLVNEV LRGLDITLVH 250 DIVNMLIHGL QFVIKV SPLUNC2 (SEQ ID NO: 2)
10 20 30 40 MLQLWKLVLL CGVLTGTSES LLDNLGNDLS NVVDFLEPVL 50 60 70 80
HEGLETVDNT LKGILEKLKV DLGVLQKSSA WQLAKQKAQE 90 100 110 120
AEKLLNNVIS KLLPTNTDIF GLKISNSLIL DVKAEPIDDG 130 140 150 160
KGLNLSVPVT ANVTVAGPII GQIINLKASL DLLTAVTIET 170 180 190 200
DPQTHQPVAV LGECASDPTS ISLSLLDKHS QIINKFVNSV 210 220 230 240
INTLKSTVSS LLQKEICPLI RIFIHSLDVN VIQQVVDNPQ HKTQLQTLI
[0099] The PLUNC proteins of the invention also include functional
portions or fragments. The length of the fragment is not critical
as long as it substantially retains the biological activity of the
polypeptide (e.g., sodium channel binding activity). Illustrative
fragments comprise at least about 4, 6, 8, 10, 12, 15, 20, 25, 30,
35, 40, 45, 50, 75, 100, 150, 200, or more contiguous amino acids
of a PLUNC protein. In other embodiments, the fragment comprises no
more than about 200, 150, 100, 75, 50, 45, 40, 35, 30, 25, 20, 15,
12, 10, 8, 6, or 4 contiguous amino acids of a PLUNC protein. In
one embodiment, the fragment comprises, consists essentially of, or
consists of a sequence from about residue 20 to about residue 41 of
human SPLUNC1, e.g., about residue 22 to about residue 39, or the
corresponding sequence (e.g., the approximately 20 amino acids
immediately after the signal peptide) from another PLUNC
protein.
[0100] In one embodiment, the functional fragment comprises,
consists essentially of, or consists of the amino acid sequence
GGLPVPLDQTLPLNVNPA (SEQ ID NO: 11), corresponding to amino acids
22-39 of human SPLUNC1, or an amino acid sequence that has at least
70% sequence identity thereto, e.g., at least 75%, 80%, 85%, 90%,
95%, 96%, 97%, 98%, or 99% sequence identity thereto. In another
embodiment, the functional fragment comprises, consists essentially
of, or consists of the partial amino acid sequence LPVPLDQT (SEQ ID
NO:14). Each of these amino acid residues has been shown to be
important for ENaC inhibitory activity.
[0101] Likewise, those skilled in the art will appreciate that the
present invention also encompasses fusion polypeptides (and
polynucleotide sequences encoding the same) comprising a PLUNC
protein (or a functional fragment thereof). For example, it may be
useful to express the polypeptide (or functional fragment) as a
fusion protein that can be recognized by a commercially available
antibody (e.g., FLAG motifs) or as a fusion protein that can
otherwise be more easily purified (e.g., by addition of a poly-His
tail). Additionally, fusion proteins that enhance the stability of
the polypeptide may be produced, e.g., fusion proteins comprising
maltose binding protein (MBP) or glutathione-S-transferase. As
another alternative, the fusion protein can comprise a reporter
molecule. In other embodiments, the fusion protein can comprise a
polypeptide that provides a function or activity that is the same
as or different from the activity of the polypeptide, e.g., a
targeting, binding, or enzymatic activity or function.
[0102] Likewise, it will be understood that the polypeptides
specifically disclosed herein will typically tolerate substitutions
in the amino acid sequence and substantially retain biological
activity. To identify polypeptides of the invention other than
those specifically disclosed herein, amino acid substitutions may
be based on any characteristic known in the art, including the
relative similarity or differences of the amino acid side-chain
substituents, for example, their hydrophobicity, hydrophilicity,
charge, size, and the like.
[0103] Amino acid substitutions other than those disclosed herein
may be achieved by changing the codons of the DNA sequence (or RNA
sequence), according to the following codon table:
TABLE-US-00002 TABLE 1 Amino Acid Codons Alanine Ala A GCA CCC GCG
GCT Cysteine Cys C TGC TGT Aspartic acid Asp D GAC GAT Glutamic
acid Glu E GAA GAG Phenylalanine Phe F TTC TTT Glycine Gly G GGA
GGC GGG GGT Histidine His H CAC CAT Isoleucine Ile I ATA ATC ATT
Lysine Lys K AAA AAG Leucine Leu L TTA TTG CTA CTC CTG CTT
Methionine Met M ATG
[0104] In identifying amino acid sequences encoding polypeptides
other than those specifically disclosed herein, the hydropathic
index of amino acids may be considered. The importance of the
hydropathic amino acid index in conferring interactive biologic
function on a protein is generally understood in the art (see, Kyte
and Doolittle, J. Mol. Biol. 157:105 (1982); incorporated herein by
reference in its entirety). It is accepted that the relative
hydropathic character of the amino acid contributes to the
secondary structure of the resultant protein, which in turn defines
the interaction of the protein with other molecules, for example,
enzymes, substrates, receptors, DNA, antibodies, antigens, and the
like.
[0105] Each amino acid has been assigned a hydropathic index on the
basis of its hydrophobicity and charge characteristics (Kyte and
Doolittle, id.), these are: isoleucine (+4.5); valine (+4.2);
leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5);
methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine
(-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline
(-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5);
aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine
(-4.5).
[0106] Accordingly, the hydropathic index of the amino acid (or
amino acid sequence) may be considered when modifying the
polypeptides specifically disclosed herein.
[0107] It is also understood in the art that the substitution of
amino acids can be made on the basis of hydrophilicity. U.S. Pat.
No. 4,554,101 (incorporated herein by reference in its entirety)
states that the greatest local average hydrophilicity of a protein,
as governed by the hydrophilicity of its adjacent amino acids,
correlates with a biological property of the protein.
[0108] As detailed in U.S. Pat. No. 4,554,101, the following
hydrophilicity values have been assigned to amino acid residues:
arginine (+3.0); lysine (.+-.3.0); aspartate (+3.0.+-.1); glutamate
(+3.0.+-.1); serine (+0.3); asparagine (+0.2); glutamine (+0.2);
glycine (0); threonine (-0.4); proline (-0.5.+-.1); alanine (-0.5);
histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine
(-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3);
phenylalanine (-2.5); tryptophan (-3.4).
[0109] Thus, the hydrophilicity of the amino acid (or amino acid
sequence) may be considered when identifying additional
polypeptides beyond those specifically disclosed herein.
[0110] One aspect of the invention is based on the discovery that
PLUNC proteins inhibit sodium channels in a pH sensitive manner. In
particular, PLUNC proteins are able to inhibit sodium channels at
neutral pH but not at acidic pHs. Without being bound by theory, it
is thought that the PLUNC proteins undergo a conformational change
at acidic pH that prevents exposure of the active site (e.g., amino
acids 22-39 of human SPLUNC1) to sodium channels. Thus, in certain
embodiments, the PLUNC protein of the present invention comprises a
modified amino acid sequence that reduces or eliminates the
inactivation of PLUNC proteins at acidic pHs. In one embodiment, a
pH sensitive hinge region, e.g., one or more of amino acid residues
K94, N103, N104, K138, Q140, N142, and D193, is modified to prevent
a conformational change of the PLUNC protein at acidic pHs. In one
embodiment, one or more amino acids in the hinge region is
substituted, e.g., with alanine. In another embodiment, all of the
amino acids in the hinge region are substituted, e.g., with
alanine. The pH-insensitive modified PLUNC proteins are
advantageously used to inhibit sodium channels under acidic
conditions, e.g., as is found in the lungs of cystic fibrosis
patients.
[0111] In embodiments of the invention, the polynucleotide encoding
the PLUNC protein (or functional fragment) will hybridize to the
nucleic acid sequences encoding PLUNC proteins that are known in
the art or fragments thereof under standard conditions as known by
those skilled in the art and encode a functional polypeptide or
functional fragment thereof.
[0112] For example, hybridization of such sequences may be carried
out under conditions of reduced stringency, medium stringency or
even stringent conditions (e.g., conditions represented by a wash
stringency of 35-40% formamide with 5.times.Denhardt's solution,
0.5% SDS and 1.times.SSPE at 37.degree. C.; conditions represented
by a wash stringency of 40-45% formamide with 5.times.Denhardt's
solution, 0.5% SDS, and 1.times.SSPE at 42.degree. C.; and
conditions represented by a wash stringency of 50% formamide with
5.times.Denhardt's solution, 0.5% SDS and 1.times.SSPE at
42.degree. C., respectively) to the polynucleotide sequences
encoding the PLUNC protein or functional fragments thereof
specifically disclosed herein. See, e.g., Sambrook et al.,
Molecular Cloning: A Laboratory Manual 2nd Ed. (Cold Spring Harbor,
N. Y., 1989).
[0113] In other embodiments, polynucleotide sequences encoding the
PLUNC protein have at least about 70%, 80%, 85%, 90%, 95%, 96%,
97%, 98%, 99% or higher sequence identity with the publicly known
nucleic acid sequences (disclosed in GenBank) or functional
fragments thereof and encode a functional polypeptide or functional
fragment thereof.
[0114] Further, it will be appreciated by those skilled in the art
that there can be variability in the polynucleotides that encode
the polypeptides (and fragments thereof) of the present invention
due to the degeneracy of the genetic code. The degeneracy of the
genetic code, which allows different nucleic acid sequences to code
for the same polypeptide, is well known in the literature (See,
e.g., Table 1).
[0115] Likewise, the polypeptides (and fragments thereof) of the
invention include polypeptides that have at least about 70%, 80%,
85%, 90%, 95%, 96%, 97%, 98%, 99% or higher amino acid sequence
identity with the publicly known polypeptide sequences.
[0116] As is known in the art, a number of different programs can
be used to identify whether a polynucleotide or polypeptide has
sequence identity or similarity to a known sequence. Sequence
identity or similarity may be determined using standard techniques
known in the art, including, but not limited to, the local sequence
identity algorithm of Smith & Waterman, Adv. Appl. Math 2:482
(1981), by the sequence identity alignment algorithm of Needleman
& Wunsch, J. Mol. Biol. 48:443 (1970), by the search for
similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci.
USA 85:2444 (1988), by computerized implementations of these
algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin
Genetics Software Package, Genetics Computer Group, 575 Science
Drive, Madison, Wis.), the Best Fit sequence program described by
Devereux et al., Nucl. Acid Res. 12:387 (1984), preferably using
the default settings, or by inspection.
[0117] An example of a useful algorithm is PILEUP. PILEUP creates a
multiple sequence alignment from a group of related sequences using
progressive, pairwise alignments. It can also plot a tree showing
the clustering relationships used to create the alignment. PILEUP
uses a simplification of the progressive alignment method of Feng
& Doolittle, J. Mol. Evol. 35:351 (1987); the method is similar
to that described by Higgins & Sharp, CABIOS 5:151 (1989).
[0118] Another example of a useful algorithm is the BLAST
algorithm, described in Altschul et al., J. Mol. Biol. 215:403
(1990) and Karlin et al., Proc. Natl. Acad. Sci. USA 90:5873
(1993). A particularly useful BLAST program is the WU-BLAST-2
program which was obtained from Altschul et al., Meth. Enzymol.,
266:460 (1996); blast.wustl/edu/blast/README.html. WU-BLAST-2 uses
several search parameters, which are preferably set to the default
values. The parameters are dynamic values and are established by
the program itself depending upon the composition of the particular
sequence and composition of the particular database against which
the sequence of interest is being searched; however, the values may
be adjusted to increase sensitivity.
[0119] An additional useful algorithm is gapped BLAST as reported
by Altschul et al., Nucleic Acids Res. 25:3389 (1997).
[0120] A percentage amino acid sequence identity value is
determined by the number of matching identical residues divided by
the total number of residues of the "longer" sequence in the
aligned region. The "longer" sequence is the one having the most
actual residues in the aligned region (gaps introduced by
WU-Blast-2 to maximize the alignment score are ignored).
[0121] In a similar manner, percent nucleic acid sequence identity
with respect to the coding sequence of the polypeptides disclosed
herein is defined as the percentage of nucleotide residues in the
candidate sequence that are identical with the nucleotides in the
polynucleotide specifically disclosed herein.
[0122] The alignment may include the introduction of gaps in the
sequences to be aligned. In addition, for sequences which contain
either more or fewer amino acids than the polypeptides specifically
disclosed herein, it is understood that in one embodiment, the
percentage of sequence identity will be determined based on the
number of identical amino acids in relation to the total number of
amino acids. Thus, for example, sequence identity of sequences
shorter than a sequence specifically disclosed herein, will be
determined using the number of amino acids in the shorter sequence,
in one embodiment. In percent identity calculations relative weight
is not assigned to various manifestations of sequence variation,
such as insertions, deletions, substitutions, etc.
[0123] In one embodiment, only identities are scored positively
(+1) and all forms of sequence variation including gaps are
assigned a value of "0," which obviates the need for a weighted
scale or parameters as described below for sequence similarity
calculations. Percent sequence identity can be calculated, for
example, by dividing the number of matching identical residues by
the total number of residues of the "shorter" sequence in the
aligned region and multiplying by 100. The "longer" sequence is the
one having the most actual residues in the aligned region.
[0124] Those skilled in the art will appreciate that the isolated
polynucleotides encoding the polypeptides of the invention will
typically be associated with appropriate expression control
sequences, e.g., transcription/translation control signals and
polyadenylation signals.
[0125] It will further be appreciated that a variety of
promoter/enhancer elements can be used depending on the level and
tissue-specific expression desired. The promoter can be
constitutive or inducible, depending on the pattern of expression
desired. The promoter can be native or foreign and can be a natural
or a synthetic sequence. By foreign, it is intended that the
transcriptional initiation region is not found in the wild-type
host into which the transcriptional initiation region is
introduced. The promoter is chosen so that it will function in the
target cell(s) of interest.
[0126] To illustrate, the polypeptide coding sequence can be
operatively associated with a cytomegalovirus (CMV) major
immediate-early promoter, an albumin promoter, an Elongation Factor
1-.alpha. (EF1-.alpha.) promoter, a P.gamma.K promoter, a MFG
promoter, or a Rous sarcoma virus promoter.
[0127] Inducible promoter/enhancer elements include
hormone-inducible and metal-inducible elements, and other promoters
regulated by exogenously supplied compounds, including without
limitation, the zinc-inducible metallothionein (MT) promoter; the
dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV)
promoter, the T7 polymerase promoter system (see WO 98/10088); the
ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA
93:3346 (1996)); the tetracycline-repressible system (Gossen et
al., Proc. Natl. Acad. Sci. USA 89:5547 (1992)); the
tetracycline-inducible system (Gossen et al., Science 268:1766
(1995); see also Harvey et al., Curr. Opin. Chem. Biol. 2:512
(1998)); the RU486-inducible system (Wang et al., Nat. Biotech.
15:239 (1997); Wang et al., Gene Ther., 4:432 (1997)); and the
rapamycin-inducible system (Magari et al., J. Clin. Invest.
100:2865 (1997)).
[0128] Moreover, specific initiation signals are generally required
for efficient translation of inserted polypeptide coding sequences.
These translational control sequences, which can include the ATG
initiation codon and adjacent sequences, can be of a variety of
origins, both natural and synthetic.
[0129] The present invention further provides cells comprising the
isolated polynucleotides and polypeptides of the invention. The
cell may be a cultured cell or a cell in vivo, e.g., for use in
therapeutic methods, diagnostic methods, screening methods, methods
for studying the biological action of the PLUNC proteins, in
methods of producing the polypeptides, or in methods of maintaining
or amplifying the polynucleotides of the invention, etc. In another
embodiment, the cell is an ex vivo cell that has been isolated from
a subject. The ex vivo cell may be modified and then reintroduced
into the subject for diagnostic or therapeutic purposes.
[0130] In particular embodiments, the cell is an untransformed
epithelial cell or a cell from an epithelial cell line.
[0131] The isolated polynucleotide can be incorporated into an
expression vector. Expression vectors compatible with various host
cells are well known in the art and contain suitable elements for
transcription and translation of nucleic acids. Typically, an
expression vector contains an "expression cassette," which
includes, in the 5' to 3' direction, a promoter, a coding sequence
encoding a PLUNC protein or sodium channel or functional fragment
thereof operatively associated with the promoter, and, optionally,
a termination sequence including a stop signal for RNA polymerase
and a polyadenylation signal for polyadenylase.
[0132] Non-limiting examples of promoters of this invention include
CYC1, HIS3, GAL1, GAL4, GAL10, ADH1, PGK, PHO5, GAPDH, ADC1, TRP1,
URA3, LEU2, ENO, TPI, and alkaline phosphatase promoters (useful
for expression in Saccharomyces); AOX1 promoter (useful for
expression in Pichia); .beta.-lactamase, lac, ara, tet, trp,
IP.sub.L, IP.sub.R, T7, tac, and trc promoters (useful for
expression in Escherichia coli); light regulated-, seed specific-,
pollen specific-, ovary specific-, pathogenesis or disease
related-promoters, cauliflower mosaic virus 35S, CMV 35S minimal,
cassaya vein mosaic virus (CsVMV), chlorophyll a/b binding protein,
ribulose 1,5-bisphosphate carboxylase, shoot-specific promoters,
root specific promoters, chitinase, stress inducible promoters,
rice tungro bacilliform virus, plant super-promoter, potato leucine
aminopeptidase, nitrate reductase, mannopine synthase, nopaline
synthase, ubiquitin, zein protein, and anthocyanin promoters
(useful for expression in plant cells).
[0133] Further examples of animal and mammalian promoters known in
the art include, but are not limited to, the SV40 early (SV40e)
promoter region, the promoter contained in the 3' long terminal
repeat (LTR) of Rous sarcoma virus (RSV), the promoters of the E1A
or major late promoter (MLP) genes of adenoviruses (Ad), the
cytomegalovirus (CMV) early promoter, the herpes simplex virus
(HSV) thymidine kinase (TK) promoter, baculovirus IE1 promoter,
elongation factor 1 alpha (EF1) promoter, phosphoglycerate kinase
(PGK) promoter, ubiquitin (Ubc) promoter, an albumin promoter, the
regulatory sequences of the mouse metallothionein-L promoter and
transcriptional control regions, the ubiquitous promoters (HPRT,
vimentin, .alpha.-actin, tubulin and the like), the promoters of
the intermediate filaments (desmin, neurofilaments, keratin, GFAP,
and the like), the promoters of therapeutic genes (of the MDR, CFTR
or factor VIII type, and the like), pathogenesis and/or
disease-related promoters, and promoters that exhibit tissue
specificity, such as the elastase 1 gene control region, which is
active in pancreatic acinar cells; the insulin gene control region
active in pancreatic beta cells, the immunoglobulin gene control
region active in lymphoid cells, the mouse mammary tumor virus
control region active in testicular, breast, lymphoid and mast
cells; the albumin gene promoter, the Apo AI and Apo AII control
regions active in liver, the alpha-fetoprotein gene control region
active in liver, the alpha 1-antitrypsin gene control region active
in the liver, the beta-globin gene control region active in myeloid
cells, the myelin basic protein gene control region active in
oligodendrocyte cells in the brain, the myosin light chain-2 gene
control region active in skeletal muscle, and the gonadotropic
releasing hormone gene control region active in the hypothalamus,
the pyruvate kinase promoter, the villin promoter, the promoter of
the fatty acid binding intestinal protein, the promoter of smooth
muscle cell .alpha.-actin, and the like. In addition, any of those
expression sequences of this invention can be modified by addition
of enhancer and/or regulatory sequences and the like.
[0134] Enhancers that may be used in embodiments of the invention
include but are not limited to: an SV40 enhancer, a cytomegalovirus
(CMV) enhancer, an elongation factor 1 (EFI) enhancer, yeast
enhancers, viral gene enhancers, and the like.
[0135] Termination control regions, i.e., terminator or
polyadenylation sequences, may be derived from various genes native
to the preferred hosts. In some embodiments of the invention, the
termination control region may comprise or be derived from a
synthetic sequence, a synthetic polyadenylation signal, an SV40
late polyadenylation signal, an SV40 polyadenylation signal, a
bovine growth hormone (BGH) polyadenylation signal, viral
terminator sequences, or the like.
[0136] It will be apparent to those skilled in the art that any
suitable vector can be used to deliver the polynucleotide to a cell
or subject. The vector can be delivered to cells in vivo. In other
embodiments, the vector can be delivered to cells ex vivo, and then
cells containing the vector are delivered to the subject. The
choice of delivery vector can be made based on a number of factors
known in the art, including age and species of the target host, in
vitro versus in vivo delivery, level and persistence of expression
desired, intended purpose (e.g., for therapy or screening), the
target cell or organ, route of delivery, size of the isolated
polynucleotide, safety concerns, and the like.
[0137] Suitable vectors include plasmid vectors, viral vectors
(e.g., retrovirus, alphavirus; vaccinia virus; adenovirus,
adeno-associated virus and other parvoviruses, lentivirus,
poxvirus, or herpes simplex virus), lipid vectors, poly-lysine
vectors, synthetic polyamino polymer vectors, and the like.
[0138] Any viral vector that is known in the art can be used in the
present invention. Protocols for producing recombinant viral
vectors and for using viral vectors for nucleic acid delivery can
be found in Ausubel et al., Current Protocols in Molecular Biology
(Green Publishing Associates, Inc. and John Wiley & Sons, Inc.,
New York) and other standard laboratory manuals (e.g., Vectors for
Gene Therapy. In: Current Protocols in Human Genetics. John Wiley
and Sons, Inc.: 1997).
[0139] Non-viral transfer methods can also be employed. Many
non-viral methods of nucleic acid transfer rely on normal
mechanisms used by mammalian cells for the uptake and intracellular
transport of macromolecules. In particular embodiments, non-viral
nucleic acid delivery systems rely on endocytic pathways for the
uptake of the nucleic acid molecule by the targeted cell. Exemplary
nucleic acid delivery systems of this type include liposomal
derived systems, poly-lysine conjugates, and artificial viral
envelopes.
[0140] In particular embodiments, plasmid vectors are used in the
practice of the present invention. For example, naked plasmids can
be introduced into muscle cells by injection into the tissue.
Expression can extend over many months, although the number of
positive cells is typically low (Wolff et al., Science 247:247
(1989)). Cationic lipids have been demonstrated to aid in
introduction of nucleic acids into some cells in culture (Felgner
and Ringold, Nature 337:387 (1989)). Injection of cationic lipid
plasmid DNA complexes into the circulation of mice has been shown
to result in expression of the DNA in lung (Brigham et al., Am. J.
Med. Sci. 298:278 (1989)). One advantage of plasmid DNA is that it
can be introduced into non-replicating cells.
[0141] In a representative embodiment, a nucleic acid molecule
(e.g., a plasmid) can be entrapped in a lipid particle bearing
positive charges on its surface and, optionally, tagged with
antibodies against cell surface antigens of the target tissue
(Mizuno et al., No Shinkei Geka 20:547 (1992); PCT publication WO
91/06309; Japanese patent application 1047381; and European patent
publication EP-A-43075).
[0142] Liposomes that consist of amphiphilic cationic molecules are
useful as non-viral vectors for nucleic acid delivery in vitro and
in vivo (reviewed in Crystal, Science 270:404 (1995); Blaese et
al., Cancer Gene Ther. 2:291 (1995); Behr et al., Bioconjugatle
Chem. 5:382 (1994); Remy et al., Bioconjugate Chem. 5:647 (1994);
and Gao et al., Gene Therapy 2:710 (1995)). The positively charged
liposomes are believed to complex with negatively charged nucleic
acids via electrostatic interactions to form lipid:nucleic acid
complexes. The lipid:nucleic acid complexes have several advantages
as nucleic acid transfer vectors. Unlike viral vectors, the
lipid:nucleic acid complexes can be used to transfer expression
cassettes of essentially unlimited size. Since the complexes lack
proteins, they can evoke fewer immunogenic and inflammatory
responses. Moreover, they cannot replicate or recombine to form an
infectious agent and have low integration frequency. A number of
publications have demonstrated that amphiphilic cationic lipids can
mediate nucleic acid delivery in vivo and in vitro (Felgner el al.,
Proc. Natl. Acad. Sc. USA 84:7413 (1987); Loeffler et al., Meth.
Enzymol. 217:599 (1993); Felgner et al., J. Biol. Chem. 269:2550
(1994)).
[0143] Several groups have reported the use of amphiphilic cationic
lipid:nucleic acid complexes for in vivo transfection both in
animals and in humans (reviewed in Gao et al., Gene Therapy 2:710
(1995); Zhu et al., Science 261:209 (1993); and Thierry et al.,
Proc. Natl. Acad. Sci. USA 92:9742 (1995)). U.S. Pat. No. 6,410,049
describes a method of preparing cationic lipid:nucleic acid
complexes that have a prolonged shelf life.
[0144] Expression vectors can be designed for expression of
polypeptides in prokaryotic or eukaryotic cells. For example,
polypeptides can be expressed in bacterial cells such as E. coli,
insect cells (e.g., the baculovirus expression system), yeast
cells, plant cells or mammalian cells. Some suitable host cells are
discussed further in Goeddel, Gene Expression Technology: Methods
in Enzymology 185, Academic Press, San Diego, Calif. (1990).
Examples of bacterial vectors include pQE70, pQE60, pQE-9 (Qiagen),
pBS, pD10, phagescript, psiX174, pbluescript SK, pbsks, pNH8A,
pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3,
pDR540, and pRIT5 (Pharmacia). Examples of vectors for expression
in the yeast S. cerevisiae include pYepSec1 (Baldari et al., EMBO
J. 6:229 (1987)), pMFa (Kurjan and Herskowitz, Cell 30:933 (1982)),
pJRY88 (Schultz et al., Gene 54:113 (1987)), and pYES2 (Invitrogen
Corporation, San Diego, Calif.). Baculovirus vectors available for
expression of nucleic acids to produce proteins in cultured insect
cells (e.g., Sf9 cells) include the pAc series (Smith et al., Mol.
Cell. Biol. 3:2156 (1983)) and the pVL series (Lucklow and Summers
Virology 170:31 (1989)).
[0145] Examples of mammalian expression vectors include pWLNEO,
pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, PBPV, pMSG, PSVL
(Pharmacia), pCDM8 (Seed, Nature 329:840 (1987)) and pMT2PC
(Kaufman et al., EMBO J. 6:187 (1987)). When used in mammalian
cells, the expression vector's control functions are often provided
by viral regulatory elements. For example, commonly used promoters
are derived from polyoma, adenovirus 2, cytomegalovirus and Simian
Virus 40.
[0146] Viral vectors have been used in a wide variety of gene
delivery applications in cells, as well as living animal subjects.
Viral vectors that can be used include, but are not limited to,
retrovirus, lentivirus, adeno-associated virus, poxvirus,
alphavirus, baculovirus, vaccinia virus, herpes virus, Epstein-Barr
virus, adenovirus, geminivirus, and caulimovirus vectors. Non-viral
vectors include plasmids, liposomes, electrically charged lipids
(cytofectins), nucleic acid-protein complexes, and biopolymers. In
addition to a nucleic acid of interest, a vector may also comprise
one or more regulatory regions, and/or selectable markers useful in
selecting, measuring, and monitoring nucleic acid transfer results
(delivery to specific tissues, duration of expression, etc.).
[0147] In addition to the regulatory control sequences discussed
above, the recombinant expression vector can contain additional
nucleotide sequences. For example, the recombinant expression
vector can encode a selectable marker gene to identify host cells
that have incorporated the vector.
[0148] Vector DNA can be introduced into prokaryotic or eukaryotic
cells via conventional transformation or transfection techniques.
As used herein, the terms "transformation" and "transfection" refer
to a variety of art-recognized techniques for introducing foreign
nucleic acids (e.g., DNA and RNA) into a host cell, including
calcium phosphate or calcium chloride co-precipitation,
DEAE-dextran-mediated transfection, lipofection, electroporation,
microinjection, DNA-loaded liposomes, lipofectamine-DNA complexes,
cell sonication, gene bombardment using high velocity
microprojectiles, and viral-mediated transfection. Suitable methods
for transforming or transfecting host cells can be found in
Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd Ed.
(Cold Spring Harbor, N. Y., 1989), and other laboratory
manuals.
[0149] If stable integration is desired, often only a small
fraction of cells (in particular, mammalian cells) integrate the
foreign DNA into their genome. In order to identify and select
integrants, a nucleic acid that encodes a selectable marker (e.g.,
resistance to antibiotics) can be introduced into the host cells
along with the nucleic acid of interest. Preferred selectable
markers include those that confer resistance to drugs, such as
G418, hygromycin and methotrexate. Nucleic acids encoding a
selectable marker can be introduced into a host cell on the same
vector as that comprising the nucleic acid of interest or can be
introduced on a separate vector. Cells stably transfected with the
introduced nucleic acid can be identified by drug selection (e.g.,
cells that have incorporated the selectable marker gene will
survive, while the other cells die).
[0150] Polypeptides and fragments of the invention can be modified
for in vivo use by the addition, at the amino- and/or
carboxyl-terminal ends, of a blocking agent to facilitate survival
of the relevant polypeptide in vivo. This can be useful in those
situations in which the peptide termini tend to be degraded by
proteases prior to cellular uptake. Such blocking agents can
include, without limitation, additional related or unrelated
peptide sequences that can be attached to the amino and/or carboxyl
terminal residues of the peptide to be administered. This can be
done either chemically during the synthesis of the peptide or by
recombinant DNA technology by methods familiar to artisans of
average skill. Alternatively, blocking agents such as pyroglutamic
acid or other molecules known in the art can be attached to the
amino and/or carboxyl terminal residues, or the amino group at the
amino terminus or carboxyl group at the carboxyl terminus can be
replaced with a different moiety. Likewise, the peptides can be
covalently or noncovalently coupled to pharmaceutically acceptable
"carrier" proteins prior to administration.
[0151] In one embodiment, the polynucleotides, vectors,
polypeptides, or homologs thereof of the invention are administered
directly to a subject. Generally, the compounds of the invention
will be suspended in a pharmaceutically-acceptable carrier (e.g.,
physiological saline) and administered orally or by intravenous
infusion, or administered subcutaneously, intramuscularly,
intrathecally, intraperitoneally, intrarectally, intravaginally,
intranasally, intragastrically, intratracheally, or
intrapulmonarily. They can be delivered directly to the site of the
disease or disorder, such as lungs, kidney, or intestines. The
dosage required depends on the choice of the route of
administration; the nature of the formulation; the nature of the
patient's illness; the subject's size, weight, surface area, age,
and sex; other drugs being administered; and the judgment of the
attending physician. Suitable dosages are in the range of
0.01-100.0 .mu.g/kg. Wide variations in the needed dosage are to be
expected in view of the variety of polynucleotides, polypeptides,
fragments, and homologs available and the differing efficiencies of
various routes of administration. For example, oral administration
would be expected to require higher dosages than administration by
i.v. injection. Variations in these dosage levels can be adjusted
using standard empirical routines for optimization as is well
understood in the art. Administrations can be single or multiple
(e.g., 2-, 3-, 4-, 6-, 8-, 10-; 20-, 50-, 100-, 150-, or more
fold). Encapsulation of the polynucleotides, polypeptides,
fragments, and homologs in a suitable delivery vehicle (e.g.,
polymeric microparticles or implantable devices) may increase the
efficiency of delivery, particularly for oral delivery.
[0152] According to certain embodiments, the polynucleotides,
vectors, polypeptides, or homologs thereof can be targeted to
specific cells or tissues in vivo. Targeting delivery vehicles,
including liposomes and viral vector systems are known in the art.
For example, a liposome can be directed to a particular target cell
or tissue by using a targeting agent, such as an antibody, soluble
receptor or ligand, incorporated with the liposome, to target a
particular cell or tissue to which the targeting molecule can bind.
Targeting liposomes are described, for example, in Ho et al.,
Biochemistry 25:5500 (1986); Ho et al., J. Biol. Chem. 262:13979
(1987); Ho et al., J. Biol. Chem. 262:13973 (1987); and U.S. Pat.
No. 4,957,735 to Huang et al., each of which is incorporated herein
by reference in its entirety). Enveloped viral vectors can be
modified to deliver a nucleic acid molecule to a target cell by
modifying or substituting an envelope protein such that the virus
infects a specific cell type. In adenoviral vectors, the gene
encoding the attachment fibers can be modified to encode a protein
domain that binds to a cell-specific receptor. Herpesvirus vectors
naturally target the cells of the central and peripheral nervous
system. Alternatively, the route of administration can be used to
target a specific cell or tissue. For example, intracoronary
administration of an adenoviral vector has been shown to be
effective for the delivery of a gene cardiac myocytes (Maurice et
al., J. Clin. Invest. 104:21 (1999)). Intravenous delivery of
cholesterol-containing cationic liposomes has been shown to
preferentially target pulmonary tissues (Liu et al., Nature
Biotechnol. 15:167 (1997)), and effectively mediate transfer and
expression of genes in vivo. Other examples of successful targeted
in vivo delivery of nucleic acid molecules are known in the art.
Finally, a recombinant nucleic acid molecule can be selectively
(i.e., preferentially, substantially exclusively) expressed in a
target cell by selecting a transcription control sequence, and
preferably, a promoter, which is selectively induced in the target
cell and remains substantially inactive in non-target cells.
[0153] Another aspect of the invention relates to a method of
inhibiting sodium absorption through a sodium channel, comprising
contacting (e.g., binding) the sodium channel with a PLUNC protein
or a functional fragment or homolog thereof. Inhibition of sodium
absorption can be measured by any technique known in the art or
disclosed herein.
[0154] Another aspect of the invention relates to a method of
increasing the volume of fluid lining an epithelial mucosal
surface, comprising contacting (e.g., binding) a sodium channel
present on the epithelial mucosal surface with a PLUNC protein or a
functional fragment or homolog thereof. The volume of fluid lining
an epithelial mucosal surface can be measured by any technique
known in the art or disclosed herein.
[0155] A further aspect of the invention relates to a method of
reducing the level of a sodium channel present on the surface of a
cell, comprising contacting (e.g., binding) the sodium channel with
a PLUNC protein or a functional fragment or homolog thereof.
[0156] An additional aspect of the invention relates to a method of
treating a disorder responsive to inhibition of sodium absorption
across an epithelial mucosal surface in a subject in need thereof,
comprising delivering to the subject a therapeutically effective
amount of a PLUNC protein or a functional fragment or homolog
thereof. The disorder can be, for example, a lung disorder (e.g., a
disorder associated with mucus clearance, cystic fibrosis, chronic
obstructive pulmonary disease, acute or chronic bronchitis, or
asthma), a gastrointestinal disorder (e.g., inflammatory bowel
disease), a kidney disorder, or a cardiovascular disorder.
[0157] Another aspect of the invention relates to a method of
regulating salt balance, blood volume, blood pressure (e.g., by
inducing natriuresis), and/or colonic motility in a subject in need
thereof, comprising delivering to the subject a therapeutically
effective amount of a PLUNC protein or a functional fragment or
homolog thereof.
III. INCREASING SODIUM CHANNEL ACTIVATION
[0158] A different aspect of the invention relates to methods of
preventing the binding of a PLUNC protein to a sodium channel,
thereby allowing activation of the sodium channel and increasing
the flow of sodium ions. Thus, one aspect of the invention relates
to a method of increasing the activation of a sodium channel,
comprising inhibiting the binding of a PLUNC protein to the sodium
channel. In one embodiment, the sodium channel is an epithelial
sodium channel (ENaC), e.g., human ENaC. In another embodiment, the
sodium channel is one that is similar in sequence and/or structure
to ENaC. In another embodiment, inhibiting the binding of a PLUNC
protein increases cleavage of the sodium channel by a protease,
thereby leading to activation of the channel. The binding of a
PLUNC protein to the sodium channel can be measured by any method
known in the art or as disclosed herein. The activation of the
sodium channel can be at least about 20%, e.g., at least about 30%,
40%, 50%, 60%, 70%, 80%, 90%, or 100% relative to sodium channel
activation in the absence of inhibition of binding.
[0159] The PLUNC protein can be any protein from the PLUNC family
that can bind to and inhibit the activation of sodium channel. In
one embodiment, the PLUNC protein is a human PLUNC protein, as well
as functional fragments and homologs thereof. In another
embodiment, the PLUNC protein is SPLUNC1 or SPLUNC2.
[0160] The method of inhibiting the activation of a sodium channel
can be carried out, e.g., on an isolated sodium channel, a sodium
channel in an artificial membrane, or a sodium channel in a cell.
In one embodiment, the sodium channel is present in an isolated
cell, e.g., a cultured primary cell or cell line. In another
embodiment, the isolated cell is part of an epithelial cell
culture, e.g., a natural or artificial epithelial lining, e.g., a
cell culture in a device (such as an Ussing chamber) in which
characteristics such as ion flow and/or potential can be measured
across lining or an isolated tissue or tissue culture. In a further
embodiment, the cell can be present in an animal, e.g., an animal
that is a disease model or a subject in need of treatment.
[0161] In one embodiment, inhibiting the binding of a PLUNC protein
comprises delivering a PLUNC protein inhibitor to the PLUNC
protein. The PLUNC protein inhibitor can be any compound or
molecule that inhibits the ability of PLUNC to bind to a sodium
channel or in any other manner inhibits the activation of the
sodium channel. In one embodiment, the PLUNC protein inhibitor is
an antibody that specifically recognizes the PLUNC protein, e.g.,
the active site of the PLUNC protein.
[0162] The term "antibody" or "antibodies" as used herein refers to
all types of immunoglobulins, including IgG, IgM, IgA, IgD, and
IgE. The antibody can be monoclonal or polyclonal and can be of any
species of origin, including (for example) mouse, rat, rabbit,
horse, goat, sheep, camel, or human, or can be a chimeric antibody.
See, e.g., Walker et al., Molec. Immunol. 26:403 (1989). The
antibodies can be recombinant monoclonal antibodies produced
according to the methods disclosed in U.S. Pat. No. 4,474,893 or
U.S. Pat. No. 4,816,567. The antibodies can also be chemically
constructed according to the method disclosed in U.S. Pat. No.
4,676,980.
[0163] Antibody fragments included within the scope of the present
invention include, for example, Fab, Fab', F(ab').sub.2, and Fv
fragments; diabodies; linear antibodies; single-chain antibody
molecules; and multispecific antibodies formed from antibody
fragments. Such fragments can be produced by known techniques. For
example, F(ab').sub.2 fragments can be produced by pepsin digestion
of the antibody molecule, and Fab fragments can be generated by
reducing the disulfide bridges of the F(ab') fragments.
Alternatively, Fab expression libraries can be constructed to allow
rapid and easy identification of monoclonal Fab fragments with the
desired specificity (Huse et al., Science 254:1275 (1989)).
[0164] Antibodies of the invention may be altered or mutated for
compatibility with species other than the species in which the
antibody was produced. For example, antibodies may be humanized or
camelized. Humanized forms of non-human (e.g., murine) antibodies
are chimeric immunoglobulins, immunoglobulin chains or fragments
thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other
antigen-binding subsequences of antibodies) which contain minimal
sequence derived from non-human immunoglobulin. Humanized
antibodies include human immunoglobulins (recipient antibody) in
which residues from a complementarity determining region (CDR) of
the recipient are replaced by residues from a CDR of a non-human
species (donor antibody) such as mouse, rat or rabbit having the
desired specificity, affinity and capacity. In some instances, Fv
framework residues of the human immunoglobulin are replaced by
corresponding non-human residues. Humanized antibodies may also
comprise residues which are found neither in the recipient antibody
nor in the imported CDR or framework sequences. In general, the
humanized antibody will comprise substantially all of at least one,
and typically two, variable domains, in which all or substantially
all of the CDR regions correspond to those of a non-human
immunoglobulin and all or substantially all of the FR regions are
those of a human immunoglobulin consensus sequence. The humanized
antibody optimally also will comprise at least a portion of an
immunoglobulin constant region (Fc), typically that of a human
immunoglobulin (Jones et al., Nature 321:522 (1986); Riechmann et
al., Nature, 332:323 (1988); and Presta, Curr. Op. Struct. Biol.
2:593 (1992)).
[0165] Methods for humanizing non-human antibodies are well known
in the art. Generally, a humanized antibody has one or more amino
acid residues introduced into it from a source which is non-human.
These non-human amino acid residues are often referred to as
"import" residues, which are typically taken from an "import"
variable domain. Humanization can be essentially performed
following the method of Winter and co-workers (Jones et al., Nature
321:522 (1986); Riechmann et al., Nature 332:323 (1988); Verhoeyen
et al., Science 239:1534 (1988)), by substituting rodent CDRs or
CDR sequences for the corresponding sequences of a human antibody.
Accordingly, such "humanized" antibodies are chimeric antibodies
(U.S. Pat. No. 4,816,567), wherein substantially less than an
intact human variable domain has been substituted by the
corresponding sequence from a non-human species. In practice,
humanized antibodies are typically human antibodies in which some
CDR residues and possibly some FR residues are substituted by
residues from analogous sites in rodent antibodies.
[0166] Human antibodies can also be produced using various
techniques known in the art, including phage display libraries
(Hoogenboom and Winter, J. Mol. Biol. 227:381 (1991); Marks et al.,
J. Mol. Biol. 222:581 (1991)). The techniques of Cole el al. and
Boerner et al. are also available for the preparation of human
monoclonal antibodies (Cole et al., Monoclonal Antibodies and
Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J.
Immunol. 147:86 (1991)). Similarly, human antibodies can be made by
introducing human immunoglobulin loci into transgenic animals,
e.g., mice in which the endogenous immunoglobulin genes have been
partially or completely inactivated. Upon challenge, human antibody
production is observed, which closely resembles that seen in humans
in all respects, including gene rearrangement, assembly, and
antibody repertoire. This approach is described, for example, in
U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126;
5,633,425; 5,661,016, and in the following scientific publications:
Marks et al., Bio/Technology 10:779 (1992); Lonberg et al., Nature
368:856 (1994); Morrison, Nature 368:812 (1994); Fishwild et al.,
Nature Biotechnol. 14:845 (1996); Neuberger, Nature Biotechnol.
14:826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13:65
(1995).
[0167] Polyclonal antibodies used to carry out the present
invention can be produced by immunizing a suitable animal (e.g.,
rabbit, goat, etc.) with an antigen to which a monoclonal antibody
to the target binds, collecting immune serum from the animal, and
separating the polyclonal antibodies from the immune serum, in
accordance with known procedures.
[0168] Monoclonal antibodies used to carry out the present
invention can be produced in a hybridoma cell line according to the
technique of Kohler and Milstein, Nature 265:495 (1975). For
example, a solution containing the appropriate antigen can be
injected into a mouse and, after a sufficient time, the mouse
sacrificed and spleen cells obtained. The spleen cells are then
immortalized by fusing them with myeloma cells or with lymphoma
cells, typically in the presence of polyethylene glycol, to produce
hybridoma cells. The hybridoma cells are then grown in a suitable
medium and the supenatant screened for monoclonal antibodies having
the desired specificity. Monoclonal Fab fragments can be produced
in E. coli by recombinant techniques known to those skilled in the
art. See, e.g., Huse, Science 246:1275 (1989).
[0169] Antibodies specific to the target polypeptide can also be
obtained by phage display techniques known in the art.
[0170] Various immunoassays can be used for screening to identify
antibodies having the desired specificity for the polypeptides of
this invention. Numerous protocols for competitive binding or
immunoradiometric assays using either polyclonal or monoclonal
antibodies with established specificity are well known in the art.
Such immunoassays typically involve the measurement of complex
formation between an antigen and its specific antibody (e.g.,
antigen/antibody complex formation). A two-site, monoclonal-based
immunoassay utilizing monoclonal antibodies reactive to two
non-interfering epitopes on the polypeptides or peptides of this
invention can be used as well as a competitive binding assay.
[0171] Antibodies can be conjugated to a solid support (e.g.,
beads, plates, slides or wells formed from materials such as latex
or polystyrene) in accordance with known techniques. Antibodies can
likewise be conjugated to detectable groups such as radiolabels
(e.g., .sup.35S, .sup.125I, .sup.131I), enzyme labels (e.g.,
horseradish peroxidase, alkaline phosphatase), and fluorescence
labels (e.g., fluorescein) in accordance with known techniques.
Determination of the formation of an antibody/antigen complex in
the methods of this invention can be by detection of, for example,
precipitation, agglutination, flocculation, radioactivity, color
development or change, fluorescence, luminescence, etc., as is well
known in the art.
[0172] In one embodiment, the PLUNC protein inhibitor is an aptamer
that specifically recognizes the PLUNC protein, e.g., the active
site of the PLUNC protein. Recently, small structured
single-stranded RNAs, also known as RNA aptamers, have emerged as
viable alternatives to small-molecule and antibody-based therapy
(Que-Gewirth et al., Gene Ther. 14:283 (2007); Ireson et al., Mol.
Cancer Ther. 5:2957 (2006)). RNA aptamers specifically bind target
proteins with high affinity, are quite stable, lack immunogenicity,
and elicit biological responses. Aptamers are evolved by means of
an iterative selection method called SELEX (systematic evolution of
ligands by exponential enrichment) to specifically recognize and
tightly bind their targets by means of well-defined complementary
three-dimensional structures.
[0173] RNA aptamers represent a unique emerging class of
therapeutic agents (Que-Gewirth et al., Gene Ther. 14:283 (2007);
Ireson el al., Mol. Cancer Ther. 5:2957 (2006)). They are
relatively short (12-30 nucleotide) single-stranded RNA
oligonucleotides that assume a stable three-dimensional shape to
tightly and specifically bind selected protein targets to elicit a
biological response. In contrast to antisense oligonucleotides, RNA
aptamers can effectively target extracellular targets. Like
antibodies, aptamers possess binding affinities in the low
nanomolar to picomolar range. In addition, aptamers are heat
stable, lack immunogenicity, and possess minimal interbatch
variability. Chemical modifications, such as amino or fluoro
substitutions at the 2' position of pyrimidines, may reduce
degradation by nucleases. The biodistribution and clearance of
aptamers can also be altered by chemical addition of moieties such
as polyethylene glycol and cholesterol. Further, SELEX allows
selection from libraries consisting of up to 10.sup.15 ligands to
generate high-affinity oligonucleotide ligands to purified
biochemical targets.
[0174] In another embodiment, the PLUNC protein inhibitor is a
nucleic acid-based inhibitor, e.g., a siRNA, antisense
oligonucleotide, ribozyme, etc.
[0175] The term "antisense nucleotide sequence" or "antisense
oligonucleotide" as used herein, refers to a nucleotide sequence
that is complementary to a specified DNA or RNA sequence. Antisense
oligonucleotides and nucleic acids that express the same can be
made in accordance with conventional techniques. See, e.g., U.S.
Pat. No. 5,023,243 to Tullis; U.S. Pat. No. 5,149,797 to Pederson
et al. The antisense nucleotide sequence can be complementary to
the entire nucleotide sequence encoding the polypeptide or a
portion thereof of at least 10, 20, 40, 50, 75, 100, 150, 200, 300,
or 500 contiguous bases and will reduce the level of polypeptide
production.
[0176] Those skilled in the art will appreciate that it is not
necessary that the antisense nucleotide sequence be fully
complementary to the target sequence as long as the degree of
sequence similarity is sufficient for the antisense nucleotide
sequence to hybridize to its target and reduce production of the
polypeptide. As is known in the art, a higher degree of sequence
similarity is generally required for short antisense nucleotide
sequences, whereas a greater degree of mismatched bases will be
tolerated by longer antisense nucleotide sequences.
[0177] For example, hybridization of such nucleotide sequences can
be carried out under conditions of reduced stringency, medium
stringency or even stringent conditions (e.g., conditions
represented by a wash stringency of 35-40% formamide with
5.times.Denhardt's solution, 0.5% SDS and 1.times.SSPE at
37.degree. C.; conditions represented by a wash stringency of
40-45% formamide with 5.times.Denhardt's solution, 0.5% SDS, and
1.times.SSPE at 42.degree. C.; and/or conditions represented by a
wash stringency of 50% formamide with 5.times.Denhardt's solution,
0.5% SDS and 1.times.SSPE at 42.degree. C., respectively) to the
nucleotide sequences specifically disclosed herein. See, e.g.,
Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd Ed.
(Cold Spring Harbor, N. Y., 1989).
[0178] In other embodiments, antisense nucleotide sequences of the
invention have at least about 70%, 80%, 90%, 95%, 97%, 98% or
higher sequence similarity with the complement of the coding
sequences specifically disclosed herein and will reduce the level
of polypeptide production.
[0179] The length of the antisense nucleotide sequence (i.e., the
number of nucleotides therein) is not critical as long as it binds
selectively to the intended location and reduces transcription
and/or translation of the target sequence, and can be determined in
accordance with routine procedures. In general, the antisense
nucleotide sequence will be from about eight, ten or twelve
nucleotides in length up to about 20, 30, 50, 75 or 100
nucleotides, or longer, in length.
[0180] An antisense nucleotide sequence can be constructed using
chemical synthesis and enzymatic ligation reactions by procedures
known in the art. For example, an antisense nucleotide sequence can
be chemically synthesized using naturally occurring nucleotides or
various modified nucleotides designed to increase the biological
stability of the molecules or to increase the physical stability of
the duplex formed between the antisense and sense nucleotide
sequences, e.g., phosphorothioate derivatives and acridine
substituted nucleotides can be used. Examples of modified
nucleotides which can be used to generate the antisense nucleotide
sequence include 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomet-hyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, S-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopenten-yladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-S-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine. Alternatively, the antisense nucleotide sequence
can be produced using an expression vector into which a nucleic
acid has been cloned in an antisense orientation (i.e., RNA
transcribed from the inserted nucleic acid will be of an antisense
orientation to a target nucleic acid of interest).
[0181] The antisense nucleotide sequences of the invention further
include nucleotide sequences wherein at least one, or all, of the
internucleotide bridging phosphate residues are modified
phosphates, such as methyl phosphonates, methyl phosphonothioates,
phosphoromorpholidates, phosphoropiperazidates and
phosphoramidates. For example, every other one of the
internucleotide bridging phosphate residues can be modified as
described. In another non-limiting example, the antisense
nucleotide sequence is a nucleotide sequence in which one, or all,
of the nucleotides contain a 2' lower alkyl moiety (e.g.,
C.sub.1-C.sub.4, linear or branched, saturated or unsaturated
alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl,
2-propenyl, and isopropyl). For example, every other one of the
nucleotides can be modified as described. See also, Furdon et al.,
Nucleic Acids Res. 17:9193 (1989); Agrawal el al., Proc. Natl.
Acad. Sci. USA 87:1401 (1990); Baker et al., Nucleic Acids Res.
18:3537 (1990); Sproat et al., Nucleic Acids Res. 17:3373 (1989);
Walder and Walder, Proc. Natl. Acad. Sci. USA 85:5011 (1988);
incorporated by reference herein in their entireties for their
teaching of methods of making antisense molecules, including those
containing modified nucleotide bases).
[0182] Triple helix base-pairing methods can also be employed to
inhibit PLUNC proteins. Triple helix pairing is believed to work by
inhibiting the ability of the double helix to open sufficiently for
the binding of polymerases, transcription factors, or regulatory
molecules. Recent therapeutic advances using triplex DNA have been
described in the literature (e.g., Gee et al., (1994) In: Huber et
al., Molecular and Immunologic Approaches, Futura Publishing Co.,
Mt. Kisco, N.Y.).
[0183] Small Interference (si) RNA, also known as RNA interference
(RNAi) molecules, provides another approach for modulating the
expression of PLUNC proteins. siRNA is a mechanism of
post-transcriptional gene silencing in which double-stranded RNA
(dsRNA) corresponding to a coding sequence of interest is
introduced into a cell or an organism, resulting in degradation of
the corresponding mRNA. The mechanism by which siRNA achieves gene
silencing has been reviewed in Sharp et al., Genes Dev. 15:485
(2001); and Hammond et al., Nature Rev. Gen. 2:110 (2001)). The
siRNA effect persists for multiple cell divisions before gene
expression is regained. siRNA is therefore a powerful method for
making targeted knockouts or "knockdowns" at the RNA level. siRNA
has proven successful in human cells, including human embryonic
kidney and HeLa cells (see, e.g., Elbashir el al., Nature 411:494
(2001)). In one embodiment, silencing can be induced in mammalian
cells by enforcing endogenous expression of RNA hairpins (see
Paddison el al., Proc. Natl. Acad Sci. USA 99:1443 (2002)). In
another embodiment, transfection of small (21-23 nt) dsRNA
specifically inhibits nucleic acid expression (reviewed in Caplen,
Trends Biotechnol. 20:49 (2002)).
[0184] siRNA technology utilizes standard molecular biology
methods. dsRNA corresponding to all or a part of a target coding
sequence to be inactivated can be produced by standard methods,
e.g., by simultaneous transcription of both strands of a template
DNA (corresponding to the target sequence) with T7 RNA polymerase.
Kits for production of dsRNA for use in siRNA are available
commercially, e.g., from New England Biolabs, Inc. Methods of
transfection of dsRNA or plasmids engineered to make dsRNA are
routine in the art.
[0185] MicroRNA (miRNA), single stranded RNA molecules of about
21-23 nucleotides in length, can be used in a similar fashion to
siRNA to modulate gene expression (see U.S. Pat. No.
7,217,807).
[0186] Silencing effects similar to those produced by siRNA have
been reported in mammalian cells with transfection of a mRNA-cDNA
hybrid construct (Lin et al., Biochem. Biophys. Res. Commun.
281:639 (2001)), providing yet another strategy for silencing a
coding sequence of interest.
[0187] The expression of PLUNC proteins can also be inhibited using
ribozymes. Ribozymes are RNA molecules that cleave nucleic acids in
a site-specific fashion. Ribozymes have specific catalytic domains
that possess endonuclease activity (Kim et al., Proc. Natl. Acad.
Sci. USA 84:8788 (1987); Gerlach et al., Nature 328:802 (1987);
Forster and Symons, Cell 49:211 (1987)). For example, a large
number of ribozymes accelerate phosphoester transfer reactions with
a high degree of specificity, often cleaving only one of several
phosphoesters in an oligonucleotide substrate (Michel and Westhof,
J. Mol. Biol. 216:585 (1990); Reinhold-Hurek and Shub, Nature
357:173 (1992)). This specificity has been attributed to the
requirement that the substrate bind via specific base-pairing
interactions to the internal guide sequence ("IGS") of the ribozyme
prior to chemical reaction.
[0188] Ribozyme catalysis has primarily been observed as part of
sequence-specific cleavage/ligation reactions involving nucleic
acids (Joyce, Nature 338:217 (1989)). For example, U.S. Pat. No.
5,354,855 reports that certain ribozymes can act as endonucleases
with a sequence specificity greater than that of known
ribonucleases and approaching that of the DNA restriction enzymes.
Thus, sequence-specific ribozyme-mediated inhibition of gene
expression may be particularly suited to therapeutic applications
(Scanlon el al., Proc. Natl. Acad Sci. USA 88:10591 (1991); Sarver
et al., Science 247:1222 (1990); Sioud et al., J. Mol. Biol.
223:831 (1992)).
[0189] In another embodiment, the PLUNC protein inhibitor is a
mimetic (e.g., a peptidomimetic) of the sodium channel binding site
recognized by a PLUNC protein. The term "mimetic" refers to a
compound that has at least 50% of at least one biological activity
of a PLUNC protein (e.g., sodium channel binding), e.g., at least
60%, 70%, 80%, or 90% of the biological activity. The term
"mimetic" as used herein is intended to be interpreted broadly and
encompasses organic and inorganic molecules. Organic compounds
include, but are not limited to, small molecules, polypeptides,
lipids, carbohydrates, coenzymes, aptamers, and nucleic acid
molecules (e.g., gene delivery vectors, antisense oligonucleotides,
siRNA, all as described above). The mimetic can further be a
compound that is identified by any of the screening methods
described below.
[0190] Peptidomimetic compounds are designed based upon the amino
acid sequences of the functional polypeptide fragments.
Peptidomimetic compounds are synthetic compounds having a
three-dimensional conformation (i.e., a "peptide motif") that is
substantially the same as the three-dimensional conformation of a
selected-peptide. The peptide motif provides the peptidomimetic
compound with the ability to enhance angiogenesis in a manner
qualitatively identical to that of the functional fragment from
which the peptidomimetic was derived. Peptidomimetic compounds can
have additional characteristics that enhance their therapeutic
utility, such as increased cell permeability and prolonged
biological half-life.
[0191] The peptidomimetics typically have a backbone that is
partially or completely non-peptide, but with side groups that are
identical to the side groups of the amino acid residues that occur
in the peptide on which the peptidomimetic is based. Several types
of chemical bonds, e.g., ester, thioester, thioamide, retroamide,
reduced carbon A, dimethylene and ketomethylene bonds, are known in
the art to be generally useful substitutes for peptide bonds in the
construction of protease-resistant peptidomimetics.
[0192] Another aspect of the invention relates to a method of
increasing sodium absorption through a sodium channel, comprising
inhibiting the binding of a PLUNC protein to the sodium channel,
thereby activating the sodium channel.
[0193] An additional aspect of the invention relates to a method of
decreasing the volume of fluid lining an epithelial mucosal
surface, comprising inhibiting the binding of a PLUNC protein to a
sodium channel present in the epithelial mucosal surface, thereby
activating the sodium channel.
[0194] A further aspect of the invention relates to a method of
increasing the level of a sodium channel present on the surface of
a cell, comprising inhibiting the binding of a PLUNC protein to the
sodium channel present on the surface of the cell.
[0195] Another aspect of the invention relates to a method of
treating a disorder responsive to activation of sodium absorption
in a subject in need thereof, comprising inhibiting the activity of
a PLUNC protein in the subject. In one embodiment, the disorder is
a lung disorder (e.g., pulmonary edema), a gastrointestinal
disorder, a kidney disorder, or a cardiovascular disorder.
[0196] A further aspect of the invention relates to a method of
regulating salt balance, blood volume, blood pressure, and/or
colonic motility in a subject in need thereof, comprising
inhibiting the activity of a PLUNC protein in the subject.
[0197] An additional aspect of the invention relates to a method of
enhancing the sense of taste in a subject, comprising inhibiting
the activity of a PLUNC protein in the subject.
IV. POLYPEPTIDES, POLYNUCLEOTIDES, AND MIMETICS
[0198] A third aspect of the invention relates to products that can
be used to carry out the methods disclosed herein. Thus, one aspect
of the invention relates to a polypeptide consisting essentially of
the sodium channel binding domain of a PLUNC protein. The sodium
channel binding domain is the minimal fragment of the PLUNC protein
required to have substantially the same binding activity to the
sodium channel as the full length PLUNC protein. The term
"substantially the same binding activity" refers to an activity
that is at least about 50% of the binding activity of the full
length protein, e.g., at least about 60%, 70%, 80%, or 90% of the
binding activity. In one embodiment, the PLUNC protein is a human
PLUNC protein. In another embodiment, the PLUNC protein is SPLUNC1
or SPLUNC2. In certain embodiments, the fragment comprises,
consists essentially of, or consists of the amino acid sequence
starting immediately C-terminal of the signal peptide or starting
within 1, 2, 3, 4, or 5 amino acids of the C-terminus of the signal
peptide and continuing for about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30
or more amino acids or any range therein. In one embodiment, the
fragment comprises, consists essentially of, or consists of a
sequence from about residue 20 to about residue 41 of human SPLUNC1
(SEQ ID NO: 1), e.g., about residue 22 to about residue 39, or the
corresponding sequence (e.g., the approximately 20 amino acids
immediately after the signal peptide) from another PLUNC protein.
In other embodiments, the fragment comprises, consists essentially
of, or consists of a sequence starting from amino acid 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, or 30 and ending with amino acid 35,
36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 of SEQ ID NO:1. In one
embodiment, the sodium channel is ENaC, e.g., human ENaC. In
another embodiment, the sodium channel is one that is similar in
sequence and/or structure to ENaC.
[0199] In one embodiment, the functional fragment comprises,
consists essentially of, or consists of the amino acid sequence
GGLPVPLDQTLPLNVNPA (SEQ ID NO:11), corresponding to amino acids
22-39 of human SPLUNC1, or an amino acid sequence that has at least
70% sequence identity thereto, e.g., at least 75%, 80%, 85%, 90%,
95%, 96%, 97%, 98%, or 99% sequence identity thereto. In another
embodiment, the functional fragment comprises, consists essentially
of, or consists of the partial amino acid sequence LPVPLDQT (SEQ ID
NO: 14). Each of these amino acid residues has been shown to be
important for ENaC inhibitory activity.
[0200] In another aspect, the invention relates to a PLUNC protein
in which the wild-type amino acid sequence has been modified (e.g.,
with insertions, deletions, substitutions, or any combination
thereof). In certain embodiments, the modified PLUNC protein
exhibits a modulation of one or more bioactivity of the PLUNC
protein, e.g., a decrease in pH sensitivity. In other embodiments,
no more than 20 amino acids of the naturally occurring PLUNC
sequence are modified (inserted, deleted or substituted), e.g., no
more than 15, 10, 9, 8, 7, 6, or 5 amino acids.
[0201] In certain embodiments, the PLUNC protein of the present
invention comprises a modified amino acid sequence that reduces or
eliminates the inactivation of PLUNC proteins at acidic pHs. In one
embodiment, a pH sensitive hinge region is modified to prevent a
conformational change of the PLUNC protein at acidic pHs. In one
embodiment, one or more amino acids in the hinge region is
substituted, e.g., with alanine. In another embodiment, all of the
amino acids in the hinge region are substituted, e.g., with
alanine. In particular embodiments, the pH sensitive hinge region
comprises, consists essentially of, or consists of amino acid
residues K94, N103, N104, K138, Q140, N142, and D193 of SEQ ID NO:
1 and any one or more of these residues can be modified. In certain
embodiments, 1, 2, 3, 4, 5, 6, or 7 of these residues are
substituted with another amino acid, e.g., alanine.
[0202] A further aspect of the invention relates to a
polynucleotide encoding a polypeptide consisting essentially of the
sodium channel binding domain of a PLUNC protein. Another aspect of
the invention relates to a polynucleotide encoding a modified PLUNC
protein of the invention.
[0203] Another aspect of the invention relates to a vector
comprising the polynucleotide of the invention4
[0204] An additional aspect of the invention relates to a cell
comprising the polynucleotide and/or vector of the invention. In
one embodiment, the cell is an isolated cell, e.g., a cultured
primary cell or cell line. In another embodiment, the isolated cell
is part of an epithelial cell culture, e.g., a natural or
artificial epithelial lining, e.g., a cell culture in a device
(such as an Ussing chamber) in which characteristics such as ion
flow and/or potential can be measured across the lining, an
isolated tissue, or tissue culture. In a further embodiment, the
cell can be present in an animal, e.g., an animal that is a disease
model or a subject in need of treatment.
[0205] A further aspect of the invention relates to a compound that
mimics the sodium channel binding domain of a PLUNC protein and
binds to a sodium channel, e.g., binds to .beta.-ENaC, wherein
cleavage of the sodium channel by a protease is inhibited when
bound to the compound. In one embodiment, the compound is a
peptidomimetic. The term "compound" as used herein is intended to
be interpreted broadly and encompasses organic and inorganic
molecules. Organic compounds include, but are not limited to, small
molecules, polypeptides, lipids, carbohydrates, coenzymes,
aptamers, and nucleic acid molecules (e.g., gene delivery vectors,
antisense oligonucleotides, siRNA, all as described above). The
compound can further be a compound that is identified by any of the
screening methods described below.
[0206] The compounds of the present invention can optionally be
delivered in conjunction with other therapeutic agents. The
additional therapeutic agents can be delivered concurrently with
the compounds of the invention. As used herein, the word
"concurrently" means sufficiently close in time to produce a
combined effect (that is, concurrently can be simultaneously, or it
can be two or more events occurring within a short time period
before or after each other).
[0207] Another aspect of the invention relates to a polypeptide
consisting essentially of a PLUNC protein binding domain of a
sodium channel. As used herein, a PLUNC protein binding domain of a
sodium channel is the minimal portion of the sodium channel amino
acid sequence necessary for binding to a PLUNC protein. In one
embodiment, the PLUNC protein binding domain is the extracellular
portion of the sodium channel.
[0208] A further aspect of the invention relates to a
polynucleotide encoding a polypeptide consisting essentially of the
PLUNC protein binding domain of a sodium channel.
[0209] Another aspect of the invention relates to a vector
comprising the polynucleotide of the invention.
[0210] An additional aspect of the invention relates to a cell
comprising the polynucleotide and/or vector of the invention. In
one embodiment, the cell is an isolated cell, e.g., a cultured
primary cell or cell line. In another embodiment, the isolated cell
is part of an epithelial cell culture, e.g., a natural or
artificial epithelial lining, e.g., a cell culture in a device
(such as an Ussing chamber) in which characteristics such as ion
flow and/or potential can be measured across the lining. In a
further embodiment, the cell can be present in an animal, e.g., an
animal that is a disease model or a subject in need of
treatment.
[0211] A further aspect of the invention relates to a compound that
mimics the PLUNC protein binding domain of a sodium channel and
binds to a PLUNC protein, wherein binding of PLUNC protein to the
sodium channel is inhibited when bound to the compound. In one
embodiment, the compound is a peptidomimetic.
[0212] Another aspect of the invention relates to a kit comprising
the polypeptide, polynucleotide, vector, cell, peptidomimetic, or
compound of the invention and useful for carrying out the methods
of the invention. The kit may further comprise additional reagents
for carrying out the methods (e.g., buffers, containers) as well as
instructions.
V. DIAGNOSIS AND MONITORING OF DISORDERS RESPONSIVE TO MODULATION
OF SODIUM ABSORPTION
[0213] The identification of the interaction between PLUNC proteins
and sodium channels provides targets to be used for detection and
diagnosis of disorders responsive to modulation of sodium
absorption.
[0214] One aspect of the invention relates to methods of detecting
disorders responsive to modulation of sodium absorption in a
subject, comprising obtaining a sample from the subject and
determining the expression and/or activity of one or more PLUNC
proteins or a functional fragment thereof in the sample, wherein an
increase or decrease in expression and/or activity relative to the
level of expression and/or activity in a control sample is
indicative of a disorder responsive to modulation of sodium
absorption and that can be treated by modulation of PLUNC proteins.
In one embodiment, the sample is from a diseased tissue such as
lung, kidney or intestinal tissue. In another embodiment, the
tissue is not diseased tissue.
[0215] In this aspect, the expression and/or activity of more than
one PLUNC protein may be determined, e.g., 2, 3, 4, or more
proteins. In one embodiment, said one or more proteins is selected
from the group consisting of SPLUNC1 and SPLUNC2. The tissue sample
may be obtained by any method known in the art, such as surgery,
biopsy, lavage, aspiration, etc. The sample may be a bodily fluid,
e.g., blood, serum, plasma, saliva, urine, cerebrospinal fluid,
perspiration, etc. The control sample may be from a normal (i.e.,
non-diseased) portion of the same tissue or cell type in the
subject, from a different tissue or cell type in the subject, from
a matched individual, or may be a standard derived from the average
of measurements taken from a population of subjects.
[0216] In one embodiment, determining the expression and/or
activity of one or more PLUNC proteins comprises determining the
level of a nucleic acid encoding said one or more proteins.
Determining the level of a nucleic acid can be carried out by any
means known in the art and as described herein, such as Northern
blots, dot blots, PCR, RT-PCR, quantitative PCR, sequence analysis,
gene microarray analysis, in situ hybridization, and detection of a
reporter gene.
[0217] In another embodiment, determining the expression and/or
activity of one or more PLUNC proteins comprises determining the
level of said one or more proteins or a functional fragment
thereof. Determining the level of a protein can be carried out by
any means known in the art and as described herein, such as Western
blots, immunoblots, immunoprecipitation, immunohistochemistry,
immunofluorescence, enzyme-linked immunosorbant assays, and
radioimmunoassays.
[0218] In a further embodiment, determining the expression and/or
activity of one or more PLUNC proteins comprises determining the
activity of said one or more polypeptides or a functional fragment
thereof. The activity may be any activity associated with the
protein, including, without limitation, sodium channel binding
activity, inhibition of sodium channel activation, and ability to
decrease the number of sodium channels on the surface of a
cell.
VI. SCREENING ASSAYS AND ANIMAL MODELS
[0219] The identification of binding and regulatory interactions
between PLUNC proteins and sodium channels provides targets that
can be used to screen for agents that modulate binding and sodium
absorption as well as models for studying the process of sodium
channel regulation and fluid regulation in vitro or in animals.
[0220] One aspect of the invention relates to methods of
identifying a compound that inhibits binding of PLUNC proteins to
sodium channels or mimics binding of PLUNC proteins to sodium
channels, comprising determining the binding of PLUNC proteins to
sodium channels and/or activity of sodium channels in the presence
and absence of a test compound, and selecting a compound that
increases or decreases the binding of PLUNC proteins to sodium
channels and/or activation of sodium channels relative to the level
in the absence of the compound.
[0221] In this aspect, the assay may be a cell-based or cell-free
assay. In one embodiment, the cell may be a primary cell, e.g., an
epithelial cell. In another embodiment, the cell is from a cell
line, e.g., an epithelial cell line. The cell may be contacted with
the compound in vitro (e.g., in a culture dish) or in an animal
(e.g., a transgenic animal or an animal model). In one embodiment,
the detected increase or decrease in binding and/or activity is
statistically significant, e.g., at least p<0.05, e.g.,
p<0.01, 0.005, or 0.001. In another embodiment, the detected
increase or decrease is at least about 10%, 20%, 30%, 40%, 50%,
60&, 70%, 80%, 90%, 100% or more relative to the amount in the
absence of the test compound.
[0222] Any desired end-point can be detected in a screening assay,
e.g., binding to the polypeptide, gene or RNA, modulation of the
activity of the polypeptide, modulation of sodium-regulated
pathways, and/or interference with binding by a known regulator of
a polynucleotide or polypeptide. Methods of detecting the foregoing
activities are known in the art and include the methods disclosed
herein.
[0223] Any compound of interest can be screened according to the
present invention. Suitable test compounds include organic and
inorganic molecules. Suitable organic molecules can include but are
not limited to small molecules (compounds less than about 1000
Daltons), polypeptides (including enzymes, antibodies, and Fab'
fragments), carbohydrates, lipids, coenzymes, and nucleic acid
molecules (including DNA, RNA, and chimerics and analogs thereof)
and nucleotides and nucleotide analogs.
[0224] Further, the methods of the invention can be practiced to
screen a compound library, e.g., a small molecule library, a
combinatorial chemical compound library, a polypeptide library, a
cDNA library, a library of antisense nucleic acids, and the like,
or an arrayed collection of compounds such as polypeptide and
nucleic acid arrays.
[0225] In one representative embodiment, the invention provides
methods of screening test compounds to identify a test compound
that binds to a PLUNC protein or a sodium channel. Compounds that
are identified as binding to the protein can be subject to further
screening (e.g., for modulation of sodium absorption) using the
methods described herein or other suitable techniques.
[0226] Also provided are methods of screening compounds to identify
those that modulate the activity of a PLUNC protein or sodium
channel. The term "modulate" is intended to refer to compounds that
enhance (e.g., increase) or inhibit (e.g., reduce) the activity of
the protein (or functional fragment). For example, the interaction
of the polypeptide or functional fragment with a binding partner
can be evaluated. As another alternative, physical methods, such as
NMR, can be used to assess biological function. Activity of the
PLUNC protein or sodium channel can be evaluated by any method
known in the art, including the methods disclosed herein.
[0227] Compounds that are identified as modulators of activity can
optionally be further screened using the methods described herein
(e.g., for binding to the PLUNC protein or sodium channel or
functional fragment thereof, polynucleotide or RNA, and the like).
The compound can directly interact with the polypeptide or
functional fragment, polynucleotide or mRNA and thereby modulate
its activity. Alternatively, the compound can interact with any
other polypeptide, nucleic acid or other molecule as long as the
interaction results in a modulation of the activity of the
polypeptide or functional fragment.
[0228] The screening assay can be a cell-based or cell-free assay.
Further, the PLUNC protein or sodium channel (or functional
fragment thereof) or polynucleotide can be free in solution,
affixed to a solid support, expressed on a cell surface, or located
within a cell.
[0229] With respect to cell-free binding assays, test compounds can
be synthesized or otherwise affixed to a solid substrate, such as
plastic pins, glass slides, plastic wells, and the like. For
example, the test compounds can be immobilized utilizing
conjugation of biotin and streptavidin by techniques well known in
the art. The test compounds are contacted with the polypeptide or
functional fragment thereof and washed. Bound polypeptide can be
detected using standard techniques in the art (e.g., by radioactive
or fluorescence labeling of the polypeptide or functional fragment,
by ELISA methods, and the like).
[0230] Alternatively, the target can be immobilized to a solid
substrate and the test compounds contacted with the bound
polypeptide or functional fragment thereof. Identifying those test
compounds that bind to and/or modulate the PLUNC protein or sodium
channel or functional fragment can be carried out with routine
techniques. For example, the test compounds can be immobilized
utilizing conjugation of biotin and streptavidin by techniques well
known in the art. As another illustrative example, antibodies
reactive with the polypeptide or functional fragment can be bound
to the wells of the plate, and the polypeptide trapped in the wells
by antibody conjugation. Preparations of test compounds can be
incubated in the polypeptide (or functional fragment)-presenting
wells and the amount of complex trapped in the well can be
quantitated.
[0231] In another representative embodiment, a fusion protein can
be provided which comprises a domain that facilitates binding of
the polypeptide to a matrix. For example, glutathione-S-transferase
fusion proteins can be adsorbed onto glutathione sepharose beads
(Sigma Chemical, St. Louis, Mo.) or glutathione derivatized
microtitre plates, which are then combined with cell lysates (e.g.,
.sup.35S-labeled) and the test compound, and the mixture incubated
under conditions conducive to complex formation (e.g., at
physiological conditions for salt and pH). Following incubation,
the beads are washed to remove any unbound label, and the matrix
immobilized and radiolabel detected directly, or in the supernatant
after the complexes are dissociated. Alternatively, the complexes
can be dissociated from the matrix, separated by SDS-PAGE, and the
level of PLUNC protein or sodium channel or functional fragment
thereof found in the bead fraction quantitated from the gel using
standard electrophoretic techniques.
[0232] Another technique for compound screening provides for high
throughput screening of compounds having suitable binding affinity
to the polypeptide of interest, as described in published PCT
application WO84/03564. In this method, a large number of different
small test compounds are synthesized on a solid substrate, such as
plastic pins or some other surface. The test compounds are reacted
with the PLUNC protein or sodium channel or functional fragment
thereof and washed. Bound polypeptide is then detected by methods
well known in the art. Purified polypeptide or a functional
fragment can also be coated directly onto plates for use in the
aforementioned drug screening techniques. Alternatively,
non-neutralizing antibodies can be used to capture the peptide and
immobilize it on a solid support.
[0233] With respect to cell-based assays, any suitable cell can be
used, including bacteria, yeast, insect cells (e.g., with a
baculovirus expression system), avian cells, mammalian cells, or
plant cells. In exemplary embodiments, the assay is carried out in
a cell line that naturally expresses the polynucleotide or produces
the polypeptide, e.g., epithelial cells. Further, in other
embodiments, it is desirable to use nontransformed cells (e.g.,
primary cells) as transformation may alter the function of the
polypeptide.
[0234] The screening assay can be used to detect compounds that
bind to or modulate the activity of the native PLUNC protein or
sodium channel (e.g., polypeptide that is normally produced by the
cell). Alternatively, the cell can be modified to express (e.g.,
overexpress) a recombinant polypeptide or functional fragment
thereof. According to this embodiment, the cell can be transiently
or stably transformed with a polynucleotide encoding the PLUNC
protein or sodium channel or functional fragment, and can be stably
transformed, for example, by stable integration into the genome of
the organism or by expression from a stably maintained episome
(e.g., Epstein Barr Virus derived episomes). In another embodiment,
a polynucleotide encoding a reporter molecule can be linked to a
regulatory element of the polynucleotide encoding a PLUNC protein
or sodium channel and used to identify compounds that modulate
expression of the polypeptide.
[0235] In a cell-based assay, the compound to be screened can
interact directly with the PLUNC protein or sodium channel or
functional fragment thereof (i.e., bind to it) and modulate the
activity thereof. Alternatively, the compound can be one that
modulates polypeptide activity (or the activity of a functional
fragment) at the nucleic acid level. To illustrate, the compound
can modulate transcription of the gene (or transgene), modulate the
accumulation of mRNA (e.g., by affecting the rate of transcription
and/or turnover of the mRNA), and/or modulate the rate and/or
amount of translation of the mRNA transcript.
[0236] As a further type of cell-based binding assay, the PLUNC
protein or sodium channel or functional fragment thereof can be
used as a "bait protein" in a two-hybrid or three-hybrid assay
(see, e.g., U.S. Pat. No. 5,283,317; Zervos et al., Cell 72:223
(1993); Madura et al., J. Biol. Chem. 268:12046 (1993); Bartel el
al., Biotechniques 14:920 (1993); Iwabuchi et al., Oncogene 8:1693
(1993); and PCT publication WO94/10300), to identify other
polypeptides that bind to or interact with the polypeptide of the
invention or functional fragment thereof.
[0237] The two-hybrid system is based on the modular nature of most
transcription factors, which consist of separable DNA-binding and
activation domains. Briefly, the assay utilizes two different DNA
constructs. In one construct, the polynucleotide that encodes the
PLUNC protein or sodium channel or functional fragment thereof is
fused to a nucleic acid encoding the DNA binding domain of a known
transcription factor (e.g., GAL-4). In the other construct, a DNA
sequence, optionally from a library of DNA sequences, that encodes
an unidentified protein ("prey" or "sample") is fused to a nucleic
acid that codes for the activation domain of the known
transcription factor. If the "bait" and the "prey" proteins are
able to interact in vivo, forming a complex, the DNA-binding and
activation domains of the transcription factor are brought into
close proximity. This proximity allows transcription of a reporter
sequence (e.g., LacZ), which is operably linked to a
transcriptional regulatory site responsive to the transcription
factor. Expression of the reporter can be detected and cell
colonies containing the functional transcription factor can be
isolated and used to obtain the nucleic acid encoding the
polypeptide that exhibited binding to the PLUNC protein or sodium
channel or functional fragment.
[0238] Screening assays can also be carried out in vivo in animals.
Thus, as still a further aspect, the invention provides a
transgenic non-human animal comprising an isolated polynucleotide
encoding a PLUNC protein or sodium channel or functional fragment
thereof, which can be produced according to methods well-known in
the art. The transgenic non-human animal can be from any species,
including avians and non-human mammals. According to this aspect of
the invention, suitable non-human mammals include mice, rats,
rabbits, guinea pigs, goats, sheep, pigs, and cattle. Suitable
avians include chickens, ducks, geese, quail, turkeys, and
pheasants.
[0239] The polynucleotide encoding the polypeptide or functional
fragment can be stably incorporated into cells within the
transgenic animal (typically, by stable integration into the genome
or by stably maintained episomal constructs). It is not necessary
that every cell contain the transgene, and the animal can be a
chimera of modified and unmodified cells, as long as a sufficient
number of cells comprise and express the polynucleotide encoding
the polypeptide or functional fragment so that the animal is a
useful screening tool.
[0240] Exemplary methods of using the transgenic non-human animals
of the invention for in vivo screening of compounds that modulate
sodium regulation, and/or the activity of a PLUNC protein or sodium
channel comprise administering a test compound to a transgenic
non-human animal (e.g., a mammal such as a mouse) comprising an
isolated polynucleotide encoding a PLUNC protein or sodium channel
or functional fragment thereof stably incorporated into the genome
and detecting whether the test compound modulates sodium regulation
and/or polypeptide activity (or the activity of a functional
fragment). It is known in the art how to measure these responses in
vivo.
[0241] Methods of making transgenic animals are known in the art.
DNA or RNA constructs can be introduced into the germ line of an
avian or mammal to make a transgenic animal. For example, one or
several copies of the construct can be incorporated into the genome
of an embryo by standard transgenic techniques.
[0242] In an exemplary embodiment, a transgenic non-human animal is
produced by introducing a transgene into the germ line of the
non-human animal. Transgenes can be introduced into embryonal
target cells at various developmental stages. Different methods are
used depending on the stage of development of the embryonal target
cell. The specific line(s) of any animal used should, if possible,
be selected for general good health, good embryo yields, good
pronuclear visibility in the embryo, and good reproductive
fitness.
[0243] Introduction of the transgene into the embryo can be
accomplished by any of a variety of means known in the art such as
microinjection, electroporation, lipofection, or a viral vector.
For example, the transgene can be introduced into a mammal by
microinjection of the construct into the pronuclei of the
fertilized mammalian egg(s) to cause one or more copies of the
construct to be retained in the cells of the developing mammal(s).
Following introduction of the transgene construct into the
fertilized egg, the egg can be incubated in vitro for varying
amounts of time, or reimplanted into the surrogate host, or both.
One common method is to incubate the embryos in vitro for about 1-7
days, depending on the species, and then reimplant them into the
surrogate host.
[0244] The progeny of the transgenically manipulated embryos can be
tested for the presence of the construct by Southern blot analysis
of a segment of tissue. An embryo having one or more copies of the
exogenous cloned construct stably integrated into the genome can be
used to establish a permanent transgenic animal line.
[0245] Transgenically altered animals can be assayed after birth
for the incorporation of the construct into the genome of the
offspring. This can be done by hybridizing a probe corresponding to
the polynucleotide sequence coding for the polypeptide or a segment
thereof onto chromosomal material from the progeny. Those progeny
found to contain at least one copy of the construct in their genome
are grown to maturity.
[0246] Methods of producing transgenic avians are also known in the
art, see, e.g., U.S. Pat. No. 5,162,215.
[0247] In particular embodiments, to create an animal model in
which the activity or expression of a PLUNC protein or sodium
channel is decreased, it is desirable to inactivate, replace or
knock-out the endogenous gene encoding the polypeptide by
homologous recombination with a transgene using embryonic stem
cells. In this context, a transgene is meant to refer to
heterologous nucleic acid that upon insertion within or adjacent to
the gene results in a decrease or inactivation of gene expression
or polypeptide amount or activity.
[0248] A knock-out of a gene means an alteration in the sequence of
a gene that results in a decrease of function of the gene,
preferably such that the gene expression or polypeptide amount or
activity is undetectable or insignificant. Knock-outs as used
herein also include conditional knock-outs, where alteration of the
gene can occur upon, for example, exposure of the animal to a
substance that promotes gene alteration (e.g., tetracycline or
ecdysone), introduction of an enzyme that promotes recombination at
a gene site (e.g., Cre in the Cre-lox system), or other method for
directing the gene alteration postnatally. Knock-out animals may be
prepared using methods known to those of skill in the art. See, for
example, Hogan, el al. (1986) Manipulating the Mouse Embryo: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y.
[0249] A knock-out construct is a nucleic acid sequence, such as a
DNA or RNA construct, which, when introduced into a cell, results
in suppression (partial or complete) of expression of a polypeptide
encoded by endogenous DNA in the cell. A knock-out construct as
used herein may include a construct containing a first fragment
from the 5' end of the gene encoding a PLUNC protein or sodium
channel, a second fragment from the 3' end of the gene and a DNA
fragment encoding a selectable marker positioned between the first
and second fragments. It should be understood by the skilled
artisan that any suitable 5' and 3' fragments of a gene may be used
as long as the expression of the corresponding gene is partially or
completely suppressed by insertion of the transgene. Suitable
selectable markers include, but are not limited to, neomycin,
puromycin and hygromycin. In addition, the construct may contain a
marker, such as diphtheria toxin A or thymidine kinase, for
increasing the frequency of obtaining correctly targeted cells.
Suitable vectors include, but are not limited to, pBLUESCRIPT,
pBR322, and pGEM7.
[0250] Alternatively, a knock-out construct may contain RNA
molecules such as antisense RNA, siRNA, and the like to decrease
the expression of a gene encoding a PLUNC protein or sodium
channel. Typically, for stable expression the RNA molecule is
placed under the control of a promoter. The promoter may be
regulated, if deficiencies in the protein of interest may lead to a
lethal phenotype, or the promoter may drive constitutive expression
of the RNA molecule such that the gene of interest is silenced
under all conditions of growth. While homologous recombination
between the knock-out construct and the gene of interest may not be
necessary when using an RNA molecule to decrease gene expression,
it may be advantageous to target the knock-out construct to a
particular location in the genome of the host organism so that
unintended phenotypes are not generated by random insertion of the
knock-out construct.
[0251] The knock-out construct may subsequently be incorporated
into a viral or nonviral vector for delivery to the host animal or
may be introduced into embryonic stem (ES) cells. ES cells are
typically selected for their ability to integrate into and become
part of the germ line of a developing embryo so as to create germ
line transmission of the knock-out construct. Thus, any ES cell
line that can do so is suitable for use herein. Suitable cell lines
which may be used include, but are not limited to, the 129J ES cell
line or the J1 ES cell line. The cells are cultured and prepared
for DNA insertion using methods well-known to the skilled artisan
(e.g., see Robertson (1987) In: Teratocarcinomas and Embryonic Stem
Cells: A Practical Approach, E. J. Robertson, ed. IRL Press,
Washington, D.C.; Bradley et al., Curr. Topics Develop. Biol.
20:357 (1986); Hogan et al., (1986) Manipulating the Mouse Embryo:
A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.).
[0252] Insertion of the knock-out construct into the ES cells may
be accomplished using a variety of methods well-known in the art,
including, for example, electroporation, microinjection, and
calcium phosphate treatment. For insertion of the DNA or RNA
sequence, the knock-out construct nucleic acids are added to the ES
cells under appropriate conditions for the insertion method chosen.
If the cells are to be electroporated, the ES cells and construct
nucleic acids are exposed to an electric pulse using an
electroporation machine (electroporator) and following the
manufacturer's guidelines for use. After electroporation, the cells
are allowed to recover under suitable incubation conditions. The
cells are then screened for the presence of the knockout
construct.
[0253] Each knock-out construct to be introduced into the cell is
first typically linearized if the knock-out construct has been
inserted into a vector. Linearization is accomplished by digesting
the knock-out construct with a suitable restriction endonuclease
selected to cut only within the vector sequence and not within the
knock-out construct sequence.
[0254] Screening for cells which contain the knock-out construct
(homologous recombinants) may be done using a variety of methods.
For example, as described herein, cells can be processed as needed
to render DNA in them available for hybridization with a nucleic
acid probe designed to hybridize only to cells containing the
construct. For example, cellular DNA can be probed with
.sup.32P-labeled DNA which locates outside the targeting fragment.
This technique can be used to identify those cells with proper
integration of the knock-out construct. The DNA can be extracted
from the cells using standard methods (e.g., see, Sambrook et al.,
Molecular Cloning: A Laboratory Manual 2nd Ed. (Cold Spring Harbor,
N. Y., 1989)). The DNA may then be analyzed by Southern blot with a
probe or probes designed to hybridize in a specific pattern to
genomic DNA digested with one or more particular restriction
enzymes.
[0255] Once appropriate ES cells are identified, they are
introduced into an embryo using standard methods. They can be
introduced using microinjection, for example. Embryos at the proper
stage of development for integration of the ES cell to occur are
obtained, such as by perfusion of the uterus of pregnant females.
For example, mouse embryos at 3-4 days development can be obtained
and injected with ES cells using a micropipet. After introduction
of the ES cell into the embryo, the embryo is introduced into the
uterus of a pseudopregnant female mouse. The stage of the
pseudopregnancy is selected to enhance the chance of successful
implantation. In mice, 2-3 days pseudopregnant females are
appropriate.
[0256] Germline transmission of the knockout construct may be
determined using standard methods. Offspring resulting from
implantation of embryos containing the ES cells described above are
screened for the presence of the desired alteration (e.g.,
knock-out of the PLUNC protein). This may be done, for example, by
obtaining DNA from offspring (e.g., tail DNA) to assess for the
knock-out construct, using known methods (e.g., Southern analysis,
dot blot analysis, PCR analysis). See, for example, Sambrook et
al., Molecular Cloning: A Laboratory Manual 2nd Ed. (Cold Spring
Harbor, N. Y., 1989). Offspring identified as chimeras may be
crossed with one another to produce homozygous knock-out
animals.
[0257] Mice are often used as animal models because they are easy
to house, relatively inexpensive, and easy to breed. However, other
knock-out animals may also be made in accordance with the present
invention such as, but not limited to, monkeys, cattle, sheep,
pigs, goats, horses, dogs, cats, guinea pigs, rabbits and rats.
Accordingly, appropriate vectors and promoters well-known in the
art may be selected and used to generate a transgenic animal
deficient in expression of a PLUNC protein or sodium channel.
[0258] In another embodiment, animal models may be created using
animals that are not transgenic.
VII. PHARMACEUTICAL COMPOSITIONS
[0259] As a further aspect, the invention provides pharmaceutical
formulations and methods of administering the same to achieve any
of the therapeutic effects (e.g., modulation of sodium absorption)
discussed above. The pharmaceutical formulation may comprise any of
the reagents discussed above in a pharmaceutically acceptable
carrier, e.g., a polynucleotide encoding a PLUNC protein or sodium
channel or a fragment thereof, a PLUNC protein or sodium channel or
fragment thereof, an antibody against a PLUNC protein, an antisense
oligonucleotide, an siRNA molecule, a ribozyme, an aptamer, a
peptidomimetic, a small molecule, or any other compound that
modulates the activity of a PLUNC protein or sodium channel,
including compounds identified by the screening methods described
herein.
[0260] By "pharmaceutically acceptable" it is meant a material that
is not biologically or otherwise undesirable, i.e., the material
can be administered to a subject without causing any undesirable
biological effects such as toxicity.
[0261] The formulations of the invention can optionally comprise
medicinal agents, pharmaceutical agents, carriers, adjuvants,
dispersing agents, diluents, and the like.
[0262] The compounds of the invention can be formulated for
administration in a pharmaceutical carrier in accordance with known
techniques. See, e.g., Remington, The Science And Practice of
Pharmacy (9.sup.th Ed. 1995). In the manufacture of a
pharmaceutical formulation according to the invention, the compound
(including the physiologically acceptable salts thereof) is
typically admixed with, Inter alia, an acceptable carrier. The
carrier can be a solid or a liquid, or both, and is preferably
formulated with the compound as a unit-dose formulation, for
example, a tablet, which can contain from 0.01 or 0.5% to 95% or
99% by weight of the compound. One or more compounds can be
incorporated in the formulations of the invention, which can be
prepared by any of the well-known techniques of pharmacy.
[0263] A further aspect of the invention is a method of treating
subjects in vivo, comprising administering to a subject a
pharmaceutical composition comprising a compound of the invention
in a pharmaceutically acceptable carrier, wherein the
pharmaceutical composition is administered in a therapeutically
effective amount. Administration of the compounds of the present
invention to a human subject or an animal in need thereof can be by
any means known in the art for administering compounds.
[0264] The formulations of the invention include those suitable for
oral, rectal, topical, buccal (e.g., sub-lingual), vaginal,
parenteral (e.g., subcutaneous, intramuscular including skeletal
muscle, cardiac muscle, diaphragm muscle and smooth muscle,
intradermal, intravenous, intraperitoneal), topical (i.e., both
skin and mucosal surfaces, including airway surfaces), intranasal,
transdermal, intraarticular, intrathecal, and inhalation
administration, administration to the liver by intraportal
delivery, as well as direct organ injection (e.g., into the liver,
into the brain for delivery to the central nervous system, into the
pancreas, or into a tumor or the tissue surrounding a tumor). The
most suitable route in any given case will depend on the nature and
severity of the condition being treated and on the nature of the
particular compound which is being used.
[0265] For injection, the carrier will typically be a liquid, such
as sterile pyrogen-free water, pyrogen-free phosphate-buffered
saline solution, bacteriostatic water, or Cremophor EL[R] (BASF,
Parsippany, N.J.). For other methods of administration, the carrier
can be either solid or liquid.
[0266] For oral administration, the compound can be administered in
solid dosage forms, such as capsules, tablets, and powders, or in
liquid dosage forms, such as elixirs, syrups, and suspensions.
Compounds can be encapsulated in gelatin capsules together with
inactive ingredients and powdered carriers, such as glucose,
lactose, sucrose, mannitol, starch, cellulose or cellulose
derivatives, magnesium stearate, stearic acid, sodium saccharin,
talcum, magnesium carbonate and the like. Examples of additional
inactive ingredients that can be added to provide desirable color,
taste, stability, buffering capacity, dispersion or other known
desirable features are red iron oxide, silica gel, sodium lauryl
sulfate, titanium dioxide, edible white ink and the like. Similar
diluents can be used to make compressed tablets. Both tablets and
capsules can be manufactured as sustained release products to
provide for continuous release of medication over a period of
hours. Compressed tablets can be sugar coated or film coated to
mask any unpleasant taste and protect the tablet from the
atmosphere, or enteric-coated for selective disintegration in the
gastrointestinal tract. Liquid dosage forms for oral administration
can contain coloring and flavoring to increase patient
acceptance.
[0267] Formulations suitable for buccal (sub-lingual)
administration include lozenges comprising the compound in a
flavored base, usually sucrose and acacia or tragacanth; and
pastilles comprising the compound in an inert base such as gelatin
and glycerin or sucrose and acacia.
[0268] Formulations of the present invention suitable for
parenteral administration comprise sterile aqueous and non-aqueous
injection solutions of the compound, which preparations are
preferably isotonic with the blood of the intended recipient. These
preparations can contain anti-oxidants, buffers, bacteriostats and
solutes which render the formulation isotonic with the blood of the
intended recipient. Aqueous and non-aqueous sterile suspensions can
include suspending agents and thickening agents. The formulations
can be presented in unit\dose or multi-dose containers, for example
sealed ampoules and vials, and can be stored in a freeze-dried
(lyophilized) condition requiring only the addition of the sterile
liquid carrier, for example, saline or water-for-injection
immediately prior to use.
[0269] Extemporaneous injection solutions and suspensions can be
prepared from sterile powders, granules and tablets of the kind
previously described. For example, in one aspect of the present
invention, there is provided an injectable, stable, sterile
composition comprising a compound of the invention, in a unit
dosage form in a sealed container. The compound or salt is provided
in the form of a lyophilizate which is capable of being
reconstituted with a suitable pharmaceutically acceptable carrier
to form a liquid composition suitable for injection thereof into a
subject. The unit dosage form typically comprises from about 10 mg
to about 10 grams of the compound or salt. When the compound or
salt is substantially water-insoluble, a sufficient amount of
emulsifying agent which is pharmaceutically acceptable can be
employed in sufficient quantity to emulsify the compound or salt in
an aqueous carrier. One such useful emulsifying agent is
phosphatidyl choline.
[0270] Formulations suitable for rectal administration are
preferably presented as unit dose suppositories. These can be
prepared by admixing the compound with one or more conventional
solid carriers, for example, cocoa butter, and then shaping the
resulting mixture.
[0271] Formulations suitable for topical application to the skin
preferably take the form of an ointment, cream, lotion, paste, gel,
spray, aerosol, or oil. Carriers which can be used include
petroleum jelly, lanoline, polyethylene glycols, alcohols,
transdermal enhancers, and combinations of two or more thereof.
[0272] Formulations suitable for transdermal administration can be
presented as discrete patches adapted to remain in intimate contact
with the epidermis of the recipient for a prolonged period of time.
Formulations suitable for transdermal administration can also be
delivered by iontophoresis (see, for example, Tyle, Pharm. Res.
3:318 (1986)) and typically take the form of an optionally buffered
aqueous solution of the compound. Suitable formulations comprise
citrate or bis\tris buffer (pH 6) or ethanol/water and contain from
0.1 to 0.2M of the compound.
[0273] The compound can alternatively be formulated for nasal
administration or otherwise administered to the lungs of a subject
by any suitable means, e.g., administered by an aerosol suspension
of respirable particles comprising the compound, which the subject
inhales. The respirable particles can be liquid or solid. The term
"aerosol" includes any gas-borne suspended phase, which is capable
of being inhaled into the bronchioles or nasal passages.
Specifically, aerosol includes a gas-borne suspension of droplets,
as can be produced in a metered dose inhaler or nebulizer, or in a
mist sprayer. Aerosol also includes a dry powder composition
suspended in air or other carrier gas, which can be delivered by
insufflation from an inhaler device, for example. See Ganderton
& Jones, Drug Delivery to the Respiratory Tract, Ellis Horwood
(1987); Gonda (1990) Critical Reviews in Therapeutic Drug Carrier
Systems 6:273-313; and Raeburn et al., J. Pharmacol. Toxicol. Meth.
27:143 (1992). Aerosols of liquid particles comprising the compound
can be produced by any suitable means, such as with a
pressure-driven aerosol nebulizer or an ultrasonic nebulizer, as is
known to those of skill in the art. See, e.g., U.S. Pat. No.
4,501,729. Aerosols of solid particles comprising the compound can
likewise be produced with any solid particulate medicament aerosol
generator, by techniques known in the pharmaceutical art.
[0274] Alternatively, one can administer the compound in a local
rather than systemic manner, for example, in a depot or
sustained-release formulation.
[0275] Further, the present invention provides liposomal
formulations of the compounds disclosed herein and salts thereof.
The technology for forming liposomal suspensions is well known in
the art. When the compound or salt thereof is an aqueous-soluble
salt, using conventional liposome technology, the same can be
incorporated into lipid vesicles. In such an instance, due to the
water solubility of the compound or salt, the compound or salt will
be substantially entrained within the hydrophilic center or core of
the liposomes. The lipid layer employed can be of any conventional
composition and can either contain cholesterol or can be
cholesterol-free. When the compound or salt of interest is
water-insoluble, again employing conventional liposome formation
technology, the salt can be substantially entrained within the
hydrophobic lipid bilayer which forms the structure of the
liposome. In either instance, the liposomes which are produced can
be reduced in size, as through the use of standard sonication and
homogenization techniques.
[0276] The liposomal formulations containing the compounds
disclosed herein or salts thereof, can be lyophilized to produce a
lyophilizate which can be reconstituted with a pharmaceutically
acceptable carrier, such as water, to regenerate a liposomal
suspension.
[0277] In the case of water-insoluble compounds, a pharmaceutical
composition can be prepared containing the water-insoluble
compound, such as for example, in an aqueous base emulsion. In such
an instance, the composition will contain a sufficient amount of
pharmaceutically acceptable emulsifying agent to emulsify the
desired amount of the compound. Particularly useful emulsifying
agents include phosphatidyl cholines and lecithin.
[0278] In particular embodiments, the compound is administered to
the subject in a therapeutically effective amount, as that term is
defined above. Dosages of pharmaceutically active compounds can be
determined by methods known in the art, see, e.g., Remington's
Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa.). The
therapeutically effective dosage of any specific compound will vary
somewhat from compound to compound, and patient to patient, and
will depend upon the condition of the patient and the route of
delivery. As a general proposition, a dosage from about 0.1 to
about 50 mg/kg will have therapeutic efficacy, with all weights
being calculated based upon the weight of the compound, including
the cases where a salt is employed. Toxicity concerns at the higher
level can restrict intravenous dosages to a lower level such as up
to about 10 mg/kg, with all weights being calculated based upon the
weight of the compound, including the cases where a salt is
employed. A dosage from about 10 mg/kg to about 50 mg/kg can be
employed for oral administration. Typically, a dosage from about
0.5 mg/kg to 5 mg/kg can be employed for intramuscular injection.
Particular dosages are about 1 .mu.mol/kg to 50 .mu.mol/kg, and
more particularly to about 22 .mu.mol/kg and to 33 .mu.mol/kg of
the compound for intravenous or oral administration,
respectively.
[0279] In particular embodiments of the invention, more than one
administration (e.g., two, three, four, or more administrations)
can be employed over a variety of time intervals (e.g., hourly,
daily, weekly, monthly, etc.) to achieve therapeutic effects.
[0280] The present invention finds use in veterinary and medical
applications. Suitable subjects include both avians and mammals,
with mammals being preferred. The term "avian" as used herein
includes, but is not limited to, chickens, ducks, geese, quail,
turkeys, and pheasants. The term "mammal" as used herein includes,
but is not limited to, humans, bovines, ovines, caprines, equines,
felines, canines, lagomorphs, etc. Human subjects include neonates,
infants, juveniles, and adults.
[0281] The present invention is more particularly described in the
following examples that are intended as illustrative only since
numerous modifications and variations therein will be apparent to
those skilled in the art.
Example 1
Experimental Methods
[0282] Tissue Procurement and Cell Culture:
[0283] Cells were harvested by enzymatic digestion from human
bronchial tissue as previously described under a protocol approved
by the UNC School of Medicine IRB (Tarran el al., J. Gen. Physiol.
127:591 (2006)). Human excess donor lungs and excised recipient
lungs were obtained at the time of lung transplantation from
portions of main stem or lumbar bronchi and cells were harvested by
enzymatic digestion. All preparations were maintained at an
air-liquid interface in a modified bronchial epithelial medium and
used 2-5 weeks after seeding on 12 mm T-Clear inserts (Corning
Costar) coated with human placental type VI collagen (Sigma).
Phosphate buffered saline (PBS) was used for washing human
bronchial epithelial culture mucosal surfaces. HBECs were
maintained at an air-liquid interface in a modified bronchial
epithelial growth medium (BEGM) with 5% CO.sub.2 at 37.degree. C.
and used 2-5 weeks after seeding on 12-mm T-clear inserts
(Corning-Costar, Corning, N.Y., USA) (Randell, Methods Mol. Biol.
742:285 (2011)).
[0284] HEK293T cells were cultured in DMEM/F12 medium containing
10% FBS, 1.times. penicillin/streptomycin, 0.2 .mu.g/mL puromycin,
and 0.1 mM hygromycin at 37.degree. C./5% CO.sub.2 on 6-well
plastic plates. Cells were transfected according to the
manufacturer's instructions using Lipofectamine 2000 (Invitrogen,
Carlsbad, Calif., USA). Cells were transfected when 90-95%
confluent with 0.5 .mu.g of plasmid DNA per construct per well and
incubated at 37.degree. C./5% CO.sub.2 overnight. CHO cell lines
stably expressing human ASIC1a, human ASIC2a and rat ASIC3 were
used in the electrophysiological measurements of ASICs (Poirot, J.
Biol. Chem. 279: 38448 (2004)).
[0285] Identification of SPLUNC1:
[0286] Airway surface liquid was collected by lavaging human
bronchial epithelial cultures with 100 .mu.l PBS at 37.degree. C.
for 15 min. The lavage was then centrifuged for 5 min at 4000 rpm
to remove dead cells and the supernatants were incubated overnight
on an end-over-end rotator at 4.degree. C. with trypsin-agarose
beads (Sigma).+-.aprotinin (Sigma). The beads were eluted using 30
.mu.l Laemmli buffer, boiled at 95.degree. C. for 5 min, separated
on a 15% sodium dodecyl sulfate polyacrylamide gel electrophoresis
(SDS PAGE) gel per the University of North Carolina-Duke Michael
Hooker Proteomics Center standard procedures. Visible bands were
excised and prepared for mass spectrometry analysis by MALDI-MS/MS
as described previously (Loiselle et al., J. Proteome Res. 4:992
(2005)).
[0287] Peptides:
[0288] Peptides were synthesized and purified by the UNC
Microprotein Sequencing and Peptide Synthesis Facility. The
sequence of the G22-A39 peptide is: GGLPVPLDQTLPLNVNPA (SEQ ID NO:
11). A control peptide of G22-A39 was made by alphabetizing the
sequence, named ABC. The sequence of ABC is: ADGGLLLLNNPPPPQTVV
(SEQ ID NO: 13). Both peptides were used with either a free or
biotinylated N-terminus as needed. Biotinylation had no effect on
G22-A39's ability to inhibit ENaC (n=6).
[0289] Microelectrode Studies.
[0290] A single-barreled potential difference-sensing electrode was
placed in the airway surface liquid by micromanipulator and used in
conjunction with a macroelectrode in the serosal solution to
measure transepitholial voltage using a voltmeter (World Precision
Instruments). Trypsin (2 U/ml; Sigma) was added mucosally as a dry
powder in perfluorocarbon to test for changes in regulation of ENaC
as previously described (Tarran et al., J. Gen. Physiol. 127:591
(2006)). Transepithelial resistance was routinely measured using
the EVOM system (WPI) as previously described (Tarran et al., J.
Gen. Physiol. 127:591 (2006)).
[0291] Oocyte Studies.
[0292] Xenopus laevis oocytes were harvested and injected as
described (Donaldson, et al., J. Biol. Chem. 277:8338 (2002)).
Defolliculated healthy stage V-VI oocytes were injected with 0.3 ng
of cRNA of each ENaC subunit. Injected oocytes were kept in
modified Barth's saline (in mM: 88 NaCl, 1 KCl, 2.4 NaHCO.sub.3,
0.3 Ca(NO.sub.3).sub.2, 0.41 CaCl.sub.2, 0.82 MgSO.sub.4, and 15
HEPES, adjusted to pH 7.35 with Tris). Oocytes were studied 24 hr
after injection using the two electrode voltage clamp technique as
previously described (Donaldson, et al., J. Biol. Chem. 277:8338
(2002)). Oocytes were clamped at a holding potential of -60 mV. The
change in amiloride-sensitive whole cell current as an indicator of
ENaC activity was determined by subtracting the corresponding
current value measured in the presence of 10 .mu.M amiloride from
that measured before the application of amiloride. Where
appropriate, oocytes were incubated with G22-A39 or ABC for 1 h
prior to recording. In some experiments .beta.-ENaC.sup.S518C was
used which forms ENaCs that are locked into an open probability
near 1.0 by exposure to the sulfhydral reactive reagent
[2-(Trimethyl-ammonium)ethyl]methanethiosulphonate bromide (MTSET).
MTSET was added at a concentration of 1 mM to the oocyte bath as
previously described (Snyder, J. Clin. Invest. 105: 45 (2000)).
[0293] Western Blotting:
[0294] Airway surface liquid collected as described above was also
placed in protease-inhibitor cocktail (Roche) for Western blotting.
The protein concentration was determined using the BCA Assay
(Pierce). To obtain SPLUNC1 from Xenopus oocytes, oocytes were
lysed in Laemmli buffer or oocyte media was directly sampled and
placed in Laemmli buffer. Proteins were resolved using SDS-PAGE and
transferred to a Polyvinylidene Fluoride (PVDF) membrane. The
membrane was then probed using .alpha.Splunc1 or .alpha.V5
antibodies and a Donkey anti-Mouse HRP antibody (R&D). The
blots were then incubated with ECL reagents (Pierce).
[0295] Binding Assay:
[0296] JME nasal epithelial cells which did not express ENaC were
stably infected with a lentivirus containing yfp-.alpha.ENaC or
empty vector (control). JME cells were incubated with varying
concentrations of Texas red-labeled SPLUNC1 for 30 min followed by
a 5.times. wash with PBS. After this time images were acquired with
a Nikon Ti-S inverted microscope and were quantified to obtain
specific and non-specific binding using Image J. Data were then
fitted with a Hill Plot to obtain the K.sub.d.
[0297] shRNA-Induced Knockdown of SPLUNC1:
[0298] Our strategy was to select shRNA sequences from Dharmacon
that targeted SPLUNC1 effectively by using transient siRNA in an
immortalized human airway epithelial cell line (denoted AALEB)
(Lundberg et al., Oncogene 21:4577 (2002)). We then generated
viruses encoding the most effective siRNA. Passage-1 airway cells
surviving one week of selection were then trypsinized and plated
down on 12 mm T-clear inserts and differentiated under air liquid
interface conditions. At the time of the functional assays, we
measured airway surface liquid SPLUNC1 protein levels by Western
blot to verify stable knockdown. An anti-luciferase
shRNA-expressing adenovirus was infected separately as a
control.
[0299] Confocal Microscopy:
[0300] To label airway surface liquid, Ringer containing Texas
Red-dextran (2 mg/ml; Invitrogen) was added to human bronchial
epithelial culture mucosal surfaces. Perfluorocarbon was added
mucosally to prevent evaporation of the airway surface liquid and
the culture placed in a chamber containing 100 .mu.l Ringer on the
stage of a Leica SP5 confocal microscope with a 63.times. glycerol
immersion objective. 5 points per culture were scanned and an
average airway surface liquid height determined. For confocal
microscopy human bronchial epithelial cultures were bathed
serosally in a modified Ringer solution containing (mM): 116 NaCl,
10 NaHCO.sub.3, 5.1 KCl, 1.2 CaCl.sub.2, 1.2 MgCl.sub.2, 20 TES, 10
glucose, pH 7.4). At all other times, human bronchial epithelial
cultures were maintained in a modified BEGM growth medium which
contained 24 mM NaHCO.sub.3 gassed with 5% CO.sub.2.
Perfluorocarbon (FC-77) was obtained from 3M and had no effect on
ASL height as previously reported.
[0301] Flp-in HEK293 Cell Culture and SPLUNC1 Protein
Purification:
[0302] Flp-In HEK293 cells (Invitrogen) were transfected with
pcDNA5/FRT/V5-his-TOPO/hSplunc1 vector. SPLUNC1-expressing clones
were selected using hygromycin, isolated, and analyzed for
expression. The clones which stably express SPLUNC1 were cultured
in T75 flasks in DMEMH media containing 5% Fetal Bovine Serum and
at 37.degree. C. in 5% CO.sub.2. His-tagged SPLUNC1 was purified
from cultured media by dialyzing the media into the His-Select
Binding Buffer (50 mM sodium phosphate, pH 8.0, 300 mM sodium
chloride, 10 mM imidazole) overnight at 4.degree. C., incubating
the dialyzed media with His-Select Nickel Affinity Matrix (Sigma)
for 4 hours at 4.degree. C. on an end-over-end rotator in the
presence of protease inhibitors (Roche), applied to a column, and
washed with 40 ml of His-Select Binding Buffer. SPLUNC1 was then
eluted from the Cobalt affinity matrix in 0.5 ml fractions with 600
mM imidazole in His-Select Binding Buffer. Purified SPLUNC1 was
then exchanged into Ringer. Cultured media from FlpIn HEK293 cells
lacking SPLUNC1 was processed in the same way as media from FlpIn
HEK293-SPLUNC1 cells and used as control for experiments where
purified SPLUNC1 was added.
[0303] Fluorogenic Assay:
[0304] To determine whether SPLUNC1 inhibited trypsin activity we
assayed cleavage of the Di-tert-butyl
dicarbonate-Gln-Ala-Arg-7-methoxycoumarin-4-yl)acetyl (BGAR-MCA)
fluorogenic substrate in Ringer (Peptides Int.) excited at 350 nm
and emission collected at 460 nm in a 96 well plate reader format
(Wallac 1420 VICTOR.sup.2). For cell-free assays, reactions were
carried out in 50 .mu.l Ringer in a 96 well plate format with 100
.mu.M BGAR-MCA. To measure endogenous protease activity in human
bronchial epithelial cultures, 30 .mu.l Ringer with 100 .mu.M
BGAR-MCA were placed directly onto the mucosal surfaces of human
bronchial epithelial cultures grown on 12 mm T-clear inserts and
the cultures were assayed in 12 well plates.
[0305] Co-Immunoprecipitation:
[0306] Xenopus oocytes were injected with either HA-N-Terminus or
V5-C-Terminus (HA-NT/V5-CT) tagged subunits in combination with
wild type (WT) untagged rat a .alpha..beta..gamma.ENaC subunits
(0.3 ng cRNA each) with or without V5-tagged SPLUNC1 and CAP2 (1 ng
cRNA each). After 24 h, 40 eggs per experimental condition were
lysed with buffer containing (in mM): 20 Tris, 50 NaCl, 50 NaF, 10
.beta.-glycerophosphate, 5 Na4P.sub.2O.sub.7 pyrophosphate, 1 EDTA,
pH 7.5 and protease inhibitors (complete, Roche), aprotinin
(Sigma). Cell lysates were prepared by passing the eggs through a
27G1/2 needle twice and by centrifugation at 3,600 rpm for 10
minutes at 4.degree. C. Supernatants were transferred to new tubes
and samples were spun at 14,000 rpm for 20 minutes at 4.degree. C.
Supernatants were discarded and pellets were solubilized in (mM) 50
Tris, 100 NaCl, 0.1% Triton X-100, 0.1% NP-40, 20 NaF, 10
Na.sub.4P.sub.2O.sub.7, 10 EDTA+protease inhibitor cocktail
(Sigma), pH 7.5. Total inputs were taken from whole cell samples
representing 4% of total protein. Solubilized proteins were
incubated with 50 .mu.l of protein A and 5 .mu.l of anti-HA
antibody (Covance) overnight while tumbling at 4.degree. C. Samples
were washed three times with (mM) 150 NaCl 50 Tris pH 7.5 buffer.
Laemmli buffer was added and samples were loaded on a 15% gradient
Tris-glycine gel after incubation for 10 minutes at 96.degree. C.
Samples were transferred to PVDF membranes and Western blot
analysis was performed using an anti-V5 (Invitrogen) monoclonal
antibody. SPLUNC1 bound to ENaC only when ENaC and SPLUNC1 lysates
were used. Uninjected and SPLUNC1 lysates lacking ENaC were both
negative for co-immunoprecipitation.
[0307] Generation of Yfp-.alpha.ENaC Expressing Cell Line and
SPLUNC1 Binding Assay:
[0308] The yfp-.alpha.ENaC construct has previously been shown to
function normally (Berdiev et al., J. Biol. Chem. 282:36481 (2007))
and was subcloned into a lentiviral vector (pQCXIN). JME nasal
epithelial cells express functional ENaCs (Tong et al., Am. J.
Physiol. Lung Cell. Mol. Physiol. 287:L928 (2004)). However, this
attribute is lost after several passages. Thus, passaged JME cells
that no longer expressed ENaC were stably infected with a
lentivirus containing yfp-.alpha.ENaC or an empty vector as a
control and the presence or absence of .alpha.ENaC was confirmed
using an antibody that was constructed "in-house" that was directed
against .alpha.ENaC (FIG. 8).
[0309] Recombinant SPLUNC1 was labeled with Texas red according to
the manufacturer's instructions (Pierce) and was freshly labeled on
the day of each binding experiment. JME cells were plated on 12 mm
T-Clear culture inserts (Corning Costar) and were cultured until
confluent. Cultures were then washed 3.times. with PBS to remove
cellular debris and incubated with varying concentrations of Texas
red-SPLUNC1 for 30 min in PBS.sup.++ (with Ca.sup.2+ and Mg.sup.2+;
10 .mu.l total volume) followed by a 5.times. wash with PBS. After
this time yfp (514 nm excitation) and Texas red fluorescence (590
nm excitation) were imaged under a 60.times. water objective on a
Nikon Ti-S inverted microscope equipped with an Orca CCD camera
(Hamamatsu) switchable filter wheels (Ludl). Background
fluorescence was subtracted from all images and the mean
thresholded intensity was quantified to obtain specific and
non-specific binding using Image J.
[0310] PCR and Primer Sequences:
[0311] PCR was performed using Amplitaq Gold Mastermix (ABI) and
primers specific for SPLUNC1 at a final concentration of 200 nM.
The primers used were: forward 5'-ctgatggccaccgtcctat-3' (SEQ ID
NO:3) and reverse 5'-aggtggatcctctcctgctt-3' (SEQ ID NO:4). The
reaction was performed according to the manufacturer's instructions
with an extension time of 30 seconds for an Eppendorf MasterCycler.
Water was used as a negative control, and SPLUNC1 cDNA as a
positive control. Human cDNA was prepared from 200 ng of RNA using
superscript II (Invitrogen), and 1 .mu.l was used for each
reaction. A product of the appropriate size .about.150 bp was
detected by gel electrophoresis.
[0312] Electrophysiological Measurements of Acid-Sensing Ion
Channels (ASICs):
[0313] Previously described cell lines expressing human ASIC1a,
human ASIC2a and rat ASIC3 were used in these experiments (Poirot,
J. Biol. Chem. 279: 38448 (2004))). Electrophysiological
measurements were carried out with an EPC10 patch-clamp amplifier
(HEKA Electronics, Lambrecht, Germany) as previously described
(Blanchard et al., Pflugers Arch. 461:123 (2011)).
[0314] Peptide Pull-Down Assay and Western Blotting:
[0315] HEK293T cells were transfected with double-tagged human ENaC
subunits with HA and V5 epitopes at the N- and C-termini,
respectively, in combination with wild-type untagged subunit cDNA.
When all three ENaC subunits were expressed, 0.5 .mu.g of each
subunit were transfected per well. When expressed individually,
0.75 .mu.g of the subunit were transfected per well. The
transfected cells were lysed 24 h later using NP-40 buffer with
1.times. complete EDTA-free protease inhibitor (Roche, Basel,
Switzerland). The lysate was centrifuged at 16,300.times.g for 15
minutes at 4.degree. C. and the supernatant collected. Protein
concentration was determined using the BCA assay and 500 .mu.g of
protein plus 0.25 mg peptide and 100 .mu.L of neutravidin were
added to a spin column and rotated end-over-end at 4.degree. C. for
24 h (all ThermoFisher Scientific, Rockford, Ill., USA).
Flow-through was collected by centrifugation at 1000.times.g for 30
s. The beads were then washed 5.times. with NP-40 buffer. Bound
protein was eluted by boiling at 95.degree. C. for 10 minutes in 75
.mu.L of 2.times.LDS NuPAGE sample buffer with 1.times.sample
reducing agent followed by centrifugation at 16,300.times.g for 2
minutes. Samples were resolved on 4-12% Bis-Tris gels in MES and
transferred to a nitrocellulose membrane using iBlot, setting P3
for 8 min (Invitrogen, Carlsbad, Calif., USA). The membrane was
probed using 1:1000 anti-V5 antibody (Invitrogen, Carlsbad, Calif.,
USA) overnight at 4.degree. C. in 3% fish gelatin in TBS-T. The
blot was then incubated for 1 h at room temperature with an ECL
sheep anti-mouse IgG secondary antibody and detected by ECL reagent
(ThermoFisher Scientific, Waltham, Mass., USA) or by incubation
with a goat anti-mouse IRDye secondary antibody and analyzed by an
Odyssey infrared imaging system (LI-COR Biosciences, Lincoln,
Nebr., USA).
[0316] Deglycosylation:
[0317] Peptide pull-down assays were performed as described above.
Samples were eluted by the addition of 100 .mu.L of 0.1 M sodium
citrate, pH 5.5, 0.1% SDS to the beads and incubating at
100.degree. C. for 2 minutes, followed by centrifugation at
16,300.times.g for 2 minutes. The samples were divided equally, and
one half was treated with 1 .mu.L of EndoH and incubated at
37.degree. C. for 2 min. After incubation, all samples were
lyophilized and then reconstituted in 30 .mu.L LDS NuPAGE sample
buffer with 1.times. sample reducing agent (Invitrogen, Carlsbad,
Calif., USA). Western blots were completed as described above. A
concentration of 5 .mu.g/ml tunicamycin (Sigma-Aldrich, St Louis,
Mo., USA) was added to the cell transfection media and the cells
were incubated overnight at 37.degree. C./5% CO.sub.2. The
following day the protocol for the peptide pull-down assay was
performed as described above.
[0318] ASL Height Measurement:
[0319] To label the ASL, PBS containing 10 kDa Rhodamine dextran
(0.2-2 mg/mL; Invitrogen, Carlsbad, Calif., USA) was added to HBEC
mucosal surfaces as previously described (Tarran et al., Mol. Cell
8:149 (2001)). When added, peptides with or without 100 nM
neutrophil elastase, 1 U/mL aprotinin, activated neutrophil
supernatant (ANS) (Haynes et al., Am. J. Physiol. Heart Circ.
Physiol. 294:H379 (2008)) or 10 .mu.M sivelestat (Sigma-Aldrich, St
Louis, Mo., USA) were added to the mucosal surface along with the
Rhodamine dextran. Bumetanide (100 .mu.M) was added to the serosal
solution.
[0320] In Vivo Studies:
[0321] To study the effects of SPLUNC1-derived peptides on the in
vivo kidney, mice were anesthetized. After a baseline 45 min
control clearance period, S18-type peptide or amiloride were
infused intravenously over 30 min and the natriuretic response
recorded over the subsequent 2-3 h.
[0322] Statistical Analyses:
[0323] All data are presented as the mean.+-.SE for n experiments.
Airway cultures derived from three or more separate donors were
used for each study and each oocyte study was repeated on three
separate occasions. Differences between means were tested for
statistical significance using paired or unpaired t tests or their
non parametric equivalent as appropriate to the experiment. From
such comparisons, differences yielding P.ltoreq.0.05 were judged to
be significant. All binding assays were fitted to the Hill
equation.
Example 2
Identification of SPLUNC1
[0324] Based on the ability of normal human bronchial epithelial
cultures to regulate airway surface liquid height to 7 .mu.m, which
was paralleled by a decrease in trypsin-sensitive ENaC activity, we
speculated that a soluble protease inhibitor is present in the
airway surface liquid during normal airway surface liquid volume
homeostasis. We searched for potential protease inhibitors/ENaC
regulators by incubating trypsin-coated beads with airway surface
liquid and performing a proteomic analysis. Airway surface liquid
was collected by lavaging human bronchial epithelial cultures with
100 .mu.l PBS at 37.degree. C. for 15 min, incubated overnight at
4.degree. C. with trypsin-agarose beads.+-.aprotinin, separated on
a 15% SDS page gel and visualized with a silver stain (FIG. 1).
Bands were removed from the gel for analysis by mass spectrometry
and the identities of these proteins are listed in Table 2. Of
note, SPLUNC1 was visible as a .about.26 kD protein (band 1) and as
a .about.19 kD fragment (band 2) and its binding to trypsin was
moderately out-competed by the addition of the protease inhibitor
aprotinin (FIG. 1). The mass spectrometry analysis allowed us to
identify SPLUNC1 as one of the major proteins that bound to the
trypsin-beads (FIG. 2, Panel A; Table 2). The presence of SPLUNC1
was confirmed in airway surface liquid by Western blot (FIG. 2,
Panel B).
TABLE-US-00003 TABLE 2 Band No. Protein Name Accession No. 1
SPLUNC1 AAF70860 2 SPLUNC1 AAF70860 AY513239 AAR89906 3 Complement
C3 Precursor C3HU 4 Hypothetical Protein Q8WVW5_HUMAN
[0325] To better study SPLUNC1, we stably transfected
V5/6His-tagged SPLUNC1 into HEK293 cells and purified secreted
V5/6His-SPLUNC1 from HEK293 media over a nickel column. Recombinant
SPLUNC1 (rSPLUNC1) could be detected using the anti-V5 antibody
(FIG. 3) and a brief (30 min) incubation with trypsin resulted in
the appearance of cleavage products of C-terminally V5-tagged
rSPLUNC1, indicating that SPLUNC1 is a substrate for serine
proteases (FIG. 3). To test whether SPLUNC1 was capable of altering
airway ion transport, we then measured the transepithelial voltage
under thin film conditions in human bronchial epithelial cultures
.+-.rSPLUNC1 with time. Washing the mucosal surface of human
bronchial epithelial cultures with PBS has previously been shown to
maximally activate ENaC (Tarran et al., J. Gen. Physiol. 127:591
(2006)) and also removes endogenous SPLUNC1 (FIG. 3). Under these
conditions, 20 .mu.l of Ringer containing 50 ng/ml of rSPLUNC1
significantly reduced the transepithelial voltage (FIG. 2, Panel
C). In contrast, a purified SPLUNC1-free fraction of HEK293 media
was without effect (FIG. 2, Panel C). To confirm that this
inhibition was due to altered ENaC regulation, we exposed human
bronchial epithelial cultures to trypsin for 30 min after the 1 h
rSPLUNC1 exposure. Trypsin was without effect in the control human
bronchial epithelial cultures, suggesting that ENaC remained fully
active. However, mucosal trypsin exposure significantly raised the
transepithelial voltage in the SPLUNC1-exposed group, suggesting
that ENaC had been inhibited by rSPLUNC1 (FIG. 2, Panel C).
Inhibition of the transepithelial voltage occurred at identical
rates following both rSPLUNC1 and aprotinin addition and the
effects of these compounds were not additive. However, in both
cases, these effects were reversed by trypsin-exposure (FIG. 2,
Panels D and E). Taken together, these data suggest (i) that both
molecules operated through a common pathway and (ii) that this was
an ENaC-specific effect (FIG. 2, Panels D and E). Further, when
airway surface liquid was left to accumulate on human bronchial
epithelial culture surfaces for 24 h (i.e., the cultures were not
pre-washed with Ringer), the transepithelial voltage was
significantly lower than in washed cultures and rSPLUNC1 addition
was without further effect, suggesting that the spontaneous
accumulation of an endogenous inhibitor in the airway surface
liquid reduces the transepithelial voltage and that maximum
inhibition is reached at steady state (FIG. 2, Panel E).
[0326] Since SPLUNC1 binds to trypsin (FIG. 3), we explored the
possibility that SPLUNC1 is proteolytically cleaved in the process.
There was both a .about.1 kDa and a 10 kDa shift in mobility of
C-terminally V5-tagged rSPLUNC1. The .about.16 kDa band, likely
corresponds to the 2.sup.nd SPLUNC1 band detected by mass
spectrometry (FIG. 1 and Table 2), suggesting that endogenous
SPLUNC1 is cleaved in airway surface liquid.
Example 3
SPLUNC1 Regulates Ion Transport
[0327] To test whether passive fluxes were affected by SPLUNC1
exposure, we measured the effects of amiloride on transepithelial
voltage vs. transepithelial electrical resistance.+-.rSPLUNC1.
Amiloride reduced the transepithelial voltage by 54% (n=12) and
rSPLUNC1 addition to the same amiloride-treated cultures was
without further effect (n=12). In parallel, both amiloride and
rSPLUNC1 increased the transepithelial electrical resistance by
.about.33% and again the effects were not additive, suggesting that
amiloride and SPLUNC1 both act on ENaC in the apical membrane and
increase the apical membrane resistance in human bronchial
epithelia, rather than by affecting paracellular transport (FIG.
4).
[0328] To further investigate how SPLUNC1 regulated ion transport
and ENaC in particular, we expressed .alpha..beta..gamma.ENaC in
Xenopus laevis oocytes and either exposed oocytes to rSPLUNC1 or
coinjected SPLUNC1 cRNA into the oocytes with
.alpha..beta..gamma.ENaC. ENaC currents were reduced by .about.70%
when oocytes were incubated with rSPLUNC1 prior to recording (FIG.
5, Panel A). Due to the larger volumes required for oocyte
incubations, SPLUNC1 was added at a 10.times. lower concentration
than in the human bronchial epithelial cultures (5 ng/ml).
Similarly, co-expression of .alpha..beta..gamma.ENaC and SPLUNC1
also resulted in ENaC inhibition by .about.70% (FIG. 5, Panel A).
SPLUNC1 could not be detected in media from oocytes injected with
.alpha..beta..gamma.ENaC (FIG. 5, Panel B). However, SPLUNC1 was
readily detected in the media after coinjection of SPLUNC1 and
.alpha..beta..gamma.ENaC cRNAs (FIG. 5, Panel B). Since SPLUNC1
could be detected in the oocyte media (FIG. 5), it is likely that
co-expressed SPLUNC1 was secreted by the oocytes and inhibited ENaC
externally in a similar fashion to rSPLUNC1.
[0329] To test whether SPLUNC1 specifically inhibited ENaC, we
either exposed CFTR-expressing oocytes to 5 ng/ml rSPLUNC1 or
co-expressed SPLUNC1 and CFTR. In both cases, we co-expressed CFTR
with the .beta.2 adrenergic receptor (.beta.2AR) which can be
stimulated with isoproterenol to raise cAMP and stimulate CFTR
(Uezono et al., Receptors Channels 1:233 (1993)). Following 10
.mu.M isoproterenol exposure, CFTR was robustly activated and
unlike with ENaC, rSPLUNC1 exposure or injection of SPLUNC1 cRNA
had no inhibitory effect on CFTR activity, suggesting that the
inhibitory effects of SPLUNC1 are specific for ENaC (FIG. 5, Panel
C).
Example 4
SPLUNC1 Inhibits Cleavage of ENaC
[0330] Since SPLUNC1 bound to trypsin-agarose beads (FIG. 1) and
affected the trypsin sensitivity of ENaC (FIG. 2, Panel C), we next
tested whether SPLUNC1 could alter serine protease activity.
Despite rSPLUNC1 being capable of inhibiting ENaC by .about.70% in
both human bronchial epithelia and oocytes (FIGS. 1 and 2), 50
ng/ml rSPLUNC1 had only a modest affect (.about.10%) on the ability
of either 1.0 or 0.3 U/ml trypsin to cleave a fluorogenic substrate
(Di-tert-butyl
dicarbonate-Gln-Ala-Arg-7-methoxycoumarin-4-yl)acetyl; BGAR-MCA),
unlike 2 U/ml aprotinin which inhibited trypsin activity by
.about.100% (FIG. 6, Panel A). Airway epithelia express serine
proteases and mucosal addition of Ringer solution containing
BGAR-MCA to human bronchial epithelial cultures resulted in
spontaneous BGAR-MCA cleavage with time that was inhibited by
aprotinin addition, confirming that serine proteases are indeed
active on the mucosal surface of airway epithelia (FIG. 6, Panel
B). rSPLUNC1 had no significant affect on BGAR-MCA cleavage in
human bronchial epithelial mucosal surfaces, suggesting that
SPLUNC1 does not inhibit ENaC by inhibiting serine protease
activity (FIG. 6, Panel B).
[0331] Proteolytic cleavage of .alpha. and .gamma. subunits is
required for ENaC activation (Mueller et al., J. Biol. Chem.
282:33475 (2007); Adebamiro et al., J. Gen. Physiol. 130:611
(2007)) and since CAP2 is highly expressed in human bronchial
epithelial cultures (Tarran et al., J. Gen. Physiol. 127:591
(2006)), we tested whether SPLUNC1 could alter .alpha. and .gamma.
ENaC cleavage by CAP2. Due to the relative scarcity of purified
rSPLUNC1, we elected to co-express SPLUNC1 and ENaC rather than use
rSPLUNC1 for subsequent oocyte studies since SPLUNC1 is secreted at
sufficient quantities from oocytes to inhibit ENaC (FIG. 5). When
.alpha..beta..gamma.ENaC and CAP2 were co-expressed in oocytes,
both full-length ENaC subunits and cleaved .alpha. and .gamma.
fragments were detected with a V5 antibody (FIG. 7, Panels A and
B). However, in the presence of SPLUNC1, only full-length .alpha.
and .gamma. ENaC subunits could be observed, suggesting that
SPLUNC1 protects ENaC from proteolytic cleavage despite SPLUNC1
having no observable intrinsic anti-protease activity (FIG. 7A,
7B). Since we probed with a V5 antibody, SPLUNC, which is also
V5-tagged was visible as a 26 kD band. However, SPLUNC1 could be
differentiated from ENaC cleavage fragments based on its size and
position on the gel (FIG. 7, Panels A and B). To confirm that
SPLUNC1 prevented functional activation of ENaC by CAPs, we
co-expressed ENaC.+-.SPLUNC1 with prostasin (CAP1) and CAP2 both of
which are present in the airways. As previously described, both
CAPs significantly increased basal ENaC currents (Vuagniaux el al.,
J. Gen. Physiol. 120:191 (2002)). However, the ability of both
proteases to activate ENaC was significantly reduced by SPLUNC1
(FIG. 7, Panel C). Similarly, trypsin-exposure also increased ENaC
activity and this stimulation was attenuated by SPLUNC1 (FIG. 7,
Panel D). The furin-insensitive
.alpha..sub.R205,231K,.beta.,.gamma..sub.R138K ENaC mutant was also
inhibited by SPLUNC1, suggesting that this effect is not mediated
by convertases such as furin (Hughey et al., J. Biol. Chem.
279:18111 (2004)) (FIG. 7, Panel E).
Example 5
SPLUNC1 Binds to ENaC
[0332] Since SPLUNC1 prevented cleavage and activation of ENaC, but
did not appear to be a serine protease inhibitor in the same
fashion as aprotinin, we hypothesized that SPLUNC1 could
specifically bind to ENaC to protect it from proteolysis. To test
this hypothesis, we utilized an airway cell line (JME cells) that
had been extensively passaged and did not express ENaC, which we
used to measure non-specific binding after infection with a
lentivirus containing an empty vector. To measure specific binding,
we then infected these cells with a lentivirus containing
yfp-tagged .alpha.ENaC since the .alpha.ENaC subunit alone has
previously been shown to form functional Na.sup.+ channels, albeit
with a significantly smaller conductance (Kizer et al., Proc. Natl.
Acad. Sci. USA 94:1013 (1997); McDonald et al., Am. J. Physiol.
268:C1157 (1995)). Stable .alpha.ENaC expression was confirmed by
western blot (FIG. 8). To qualitatively test the relationship
between yfp-.alpha.ENaC expression and SPLUNC1 binding, we plated
JME cells on glass coverslips and incubated these cells with
varying concentrations of Texas red-labeled rSPLUNC1. As can be
seen in FIG. 9, Panel A, Texas red-rSPLUNC1 and yfp-.alpha.ENaC
clearly colocalize whilst rSPLUNC1 binding to JME cells infected
with the lentiviral vector alone was reduced and more diffuse (FIG.
9, Panel A). To quantitatively address this issue, we then
polarized these cells on filters for seven days. We then incubated
these polarized cells with varying concentrations of Texas
red-rSPLUNC1 for 30 min followed by a 5.times. wash with PBS. The
subsequent binding isotherm shows a clear difference between
non-specific (empty vector-transfected) binding which did not
saturate and specific (yfp-.alpha.ENaC) binding which was
significantly greater and saturable (FIG. 9, Panel B). Using this
graph, we calculated that the K.sub.d was 55 ng/ml (FIG. 9, Panel
B). Thus, if SPLUNC1 is indeed a volume sensor in the airways, this
data suggests that it will be able to change ENaC activity over a
narrow range of concentrations.
[0333] Xenopus oocytes are autofluorescent, making this type of
fluorescent binding assay difficult. To test whether SPLUNC1 could
also bind to ENaC subunits in Xenopus oocytes, we co-expressed
HA-tagged N-terminus and V5-tagged C-terminus (HA-NTN/V5-CT)
.alpha..beta..gamma. ENaC subunits in combination with wild type
(WT) untagged subunits and V5-tagged SPLUNC1 (for example,
.alpha.-HA-NT/V5-CT,.beta.,.gamma.-ENaC.+-.SPLUNC1-V5) and
immunoprecipitated ENaC using anti-HA monoclonal antibodies. We
then probed for V5-tagged SPLUNC1 and found that SPLUNC1 bound to
all three ENaC subunits (FIG. 10). Thus, rather than being a
protease inhibitor, we propose that SPLUNC1 protects .alpha. and
.gamma. ENaC from being cleaved by serine proteases, perhaps being
cleaved itself in the process.
[0334] We have previously shown that human bronchial epithelial
cultures rapidly absorb excess airway surface liquid and then
absorption slows and a steady state airway surface liquid height of
.about.7 .mu.m is maintained (Tarran et al., (J. Biol. Chem.
280:35751 (2005)). To ask if endogenous SPLUNC1 was required as
part of this homeostatic mechanism, we knocked down SPLUNC1 using
two different an anti-SPLUNC1 shRNA sequences that were
incorporated into retroviruses that were used to infect human
bronchial epithelial cultures. The shRNAs had the following
sequences.
TABLE-US-00004 shRNA No. 1 Sense AUAAAGUCCUGCCUGAGUUUU (SEQ ID NO:
5) shRNA No. 1 Anti-sense 5' PAACUCAGGCAGGACUUUAUUU (SEQ ID NO: 6)
shRNA No. 2 Sense GCAGGAAGCUUGACAAAUGUU (SEQ ID NO: 7) shRNA No. 2
Anti-sense 5' PCAUUUGUCAAGCUUCCUGCUU (SEQ ID NO: 8)
[0335] Successful knockdown was confirmed by qPCR and western blot
(FIG. 5, Panels A and B) and since no difference in knockdown was
detected between each sequence, the subsequent results were pooled.
Human bronchial epithelial cultures infected with a control shRNA
(anti-luciferase), rapidly absorbed a test solution of 20 .mu.l
Ringer until an airway surface liquid height of 7 pun was reached,
after which time absorption slowed and airway surface liquid height
was maintained at 7 .mu.m as has previously been described for
non-infected human bronchial epithelial cultures (FIG. 11, Panels C
and D) (Tarran et al., J. Gen. Physiol. 127:591 (2006); Tarran et
al., (J. Biol. Chem. 280:35751 (2005)). This regulation was
paralleled by a decline in the transepithelial voltage which could
be restored by mucosal exposure to trypsin (FIG. 11E). Importantly,
cultures lacking SPLUNC1 failed to regulate airway surface liquid
height with time and exhibited increased airway surface liquid
absorption during the initial phase followed by a failure to
maintain steady-state airway surface liquid height at 7 .mu.m (FIG.
11, Panels C and D). Further, the transepithelial voltage failed to
decline in human bronchial epithelial cultures lacking SPLUNC1 and
remained both elevated and trypsin-insensitive, suggesting that
ENaC remained fully activated. Regulation of both airway surface
liquid height and the transepithelial voltage was restored by the
addition of 50 ng/ml rSPLUNC1 to the airway surface liquid (FIG.
11, Panels C-E), suggesting that SPLUNC1 indeed acts as a reporter
molecule in the airway surface liquid that regulates ENaC activity
to maintain appropriate airway surface liquid volume control.
[0336] We propose that SPLUNC1 binds specifically to an
extracellular domain of ENaC, preventing the channel from being
cleaved and activated by serine proteases. It has been proposed
that the extracellular loops of ENaC play a role in channel gating
and the .alpha. and .gamma. subunits of ENaC have been reported to
contain short inhibitory segments that are removed during
proteolytic cleavage to activate the channel (Carattino et al., J.
Biol. Chem. 283:25290 (2008); Carattino et al., Am. J. Physiol.
Renal Physiol. 294:F47 (2008)). We speculate that ENaC subunits
that have already been cleaved by extracellular serine proteases
are likely to be SPLUNC1-insensitive. However, as new ENaCs are
inserted in the plasma membrane, SPLUNC1 binds to them, preventing
their cleavage and resulting in a decline in ENaC-mediated
currents. The onset of inhibition (30-60 min; FIG. 2, Panels C and
D) is comparable with aprotinin-inhibition rates in human bronchial
epithelial cultures (Bridges et al., Am. J. Physiol. Lung Cell Mol.
Physiol. 281:L16 (2001); Donaldson et al., J. Biol. Chem. 277:8338
(2002)) and is consistent with this model. While the cleavage model
is generally accepted, it is also conceivable that proteins which
bind to the extracellular loops of ENaC could induce sufficient
conformational changes to modulate the activity of the channel.
While the slow kinetics of the inhibition with SPLUNC1 are most
compatible with the cleavage hypothesis (FIG. 2), we cannot as yet
formally exclude the possibility that SPLUNC1 can bind to ENaC and
either induce a conformational change in the extracellular loops
and/or the pore to block the channel or directly block the channel
pore itself. Further, in this study, we did not differentiate
between possible effects of SPLUNC1 on the number of ENaC channels
vs. their open probability. Since both basal and protease-activated
ENaC currents were reduced in the presence of SPLUNC1, the relative
increase from basal to protease-activated currents is
similar.+-.SPLUNC1 (FIG. 7). Thus, we cannot exclude the
possibility that SPLUNC1 decreases the number of ENaC channels in
the plasma membrane. If this was the case, then the pool of surface
ENaCs available to be cleaved would be reduced, which could explain
both the reduction in ENaC cleavage and protease-activated currents
in the presence of SPLUNC1.
[0337] In addition to being expressed in the airways, ENaC is also
expressed in aldosterone-sensitive epithelial cells in the colon
and kidney where it plays an important role in the control of
sodium balance, blood volume, and blood pressure (Kunzelmann el
al., Physiol. Rev. 82:245 (2002); Rossier el al., Annu. Rev.
Physiol. 64:877 (2002)). In the colon, the primary flux is in the
absorptive direction. However, ion transport can switch from being
absorptive to being secretory to help regulate salt balance
(Charney el al., Am. J. Physiol. 247:G1 (1984); Garty et al.,
Physiol. Rev. 77:359 (1997)). In the kidney, ENaC is the
rate-limiting step for salt reabsorption in the collecting duct
(20) and aldosterone induces a shift in the molecular weight of
.gamma. ENaC from 85 kDa to .about.75 kDa, consistent with
physiological proteolytic clipping of the extracellular loop
(Masilamani et al., J. Clin. Invest. 104:R19 (1999)). As their
acronym suggests, palate lung and nasal epithelial clone (PLUNC)
family members expression was thought to be limited to a few
specific tissues (Bingle et al., Biochim. Biophys. Acta 1493:363
(2000)). We performed PCR to determine whether SPLUNC1 was also
expressed in other ENaC-expressing tissues. Interestingly, SPLUNC1
was highly expressed in the kidney and colon, but was not expressed
in the stomach (FIG. 12), suggesting that SPLUNC1 is expressed in
other ENaC-expressing tissues beyond the lung/palate and nasal
epithelia. Thus, SPLUNC1 expression in these tissues could
potentially add an additional layer of regulation to further
modulate ENaC activity and salt absorption.
[0338] SPLUNC1 expression is increased in cystic fibrosis lungs,
especially in the surface epithelium of the proximal and distal
airways (Bingle et al., Respir. Res. 8:79 (2007)) and this
upregulation may be due to the increased inflammation seen in CF
lungs (Chmiel et al., Respir. Res. 4:8 (2003)). However, cystic
fibrosis lungs are typified by Na.sup.+ hyperabsorption and mucus
dehydration (Boucher, Pflugers Arch. 445:495 (2003)) so it is
unlikely that SPLUNC1 exerts any significant inhibitory effect on
ENaC under these conditions. Further, we have previously
demonstrated that cystic fibrosis bronchial epithelial cultures do
not decrease ENaC activity with time (Tarran et al., J. Gen.
Physiol. 127:591 (2006); Tarran et al., J. Biol. Chem. 280:35751
(2005)). CFTR expression is not required for SPLUNC1 to inhibit
ENaC, as demonstrated in our oocytes studies, suggesting that this
inability of SPLUNC1 to regulate ENaC is not an innate property of
cystic fibrosis airways (FIG. 5A). However, the serine proteascs
that activate ENaC are upregulated in cystic fibrosis airway
epithelia (Myerburg et al., Am. J. Physiol. Lung Cell Mol. Physiol.
294:L932 (2008)) and neutrophil elastase, which also activates
ENaC, is increased in cystic fibrosis airways (Birrer et al., Am.
J. Respir. Crit. Care Med. 150:207 (1994); Caldwell et al., Am. J.
Physiol. Lung Cell Mol. Physiol. 288:L813 (2005); Konstan et al.,
Am J. Respir. Crit. Care Med. 150:448 (1994)). Thus, it is possible
that the excessive protease upregulation seen in cystic fibrosis
airways (Myerburg et al., Am. J. Physiol. Lung Cell Mol. Physiol.
294:L932 (2008)) interferes with the normal regulation of ENaC by
SPLUNC1 and other potential ENaC regulators and thereby shifts the
balance from anti-proteases and less ENaC activity to a
protease-replete state with more ENaC activity, overwhelming the
ability of SPLUNC1 to inactivate ENaC and contributing to cystic
fibrosis airway surface liquid volume depletion.
[0339] In summary, we have identified SPLUNC1 as a novel
extracellular protein inhibitor of ENaC that is present in the
airway surface liquid. In normal airways, SPLUNC1 is highly
expressed in submucosal glands with moderate expression in surface
epithelium of the proximal airways with little expression in the
distal airways (Bingle et al., Respir. Res. 8:79 (2007)). Thus, we
propose that SPLUNC1 is secreted from glands and surface epithelium
where it serves as a reporter molecule whose dilution or
concentration can adjust ENaC activity to regulate airways
hydration and mucus clearance. Since SPLUNC1 is secreted by
proximal airways, we propose that this regulation primarily occurs
in the proximal airways, with little effect in the distal
airways.
Example 6
SPLUNC2 Inhibits ENaC
[0340] SPLUNC1, SPLUNC2, or LPLUNC1 were expressed in Xenopus
oocytes as described in Example 3. The effect of SPLUNC1, SPLUNC2,
and LPLUNC1 on amiloride-sensitive currents was measured (FIG. 13).
Current is displayed relative to amiloride-sensitive current from
.alpha.,.beta.,.gamma. ENaC-expressing oocytes (CTRL, white bar,
n=18). Oocytes co-expressing SPLUNC1 showed a .about.70% reduction
in ENaC current (p<0.0001; n=22). Those co-expressing SPLUNC2
(n=22) exhibited borderline significance (i.e., not significant
with ANOVA and significant (p=0.045) with an unpaired t-test).
Oocytes co-expressing LPLUNC1 (n=17) had no significant ENaC
current reduction in this system. The * denotes p<0.05
difference compared to control oocytes expressing
.alpha.,.beta.,.gamma. ENaC.
Example 7
Reduction Inhibits SPLUNC1 Activity
[0341] The effect of reducing agents on SPLUNC1 activity was tested
in primary human bronchial epithelial cultures (FIG. 14). Cultures
were prewashed to remove endogenous SPLUNC1 and the basal PD was
measured (control, ctrl), then either 50 ng/ml recombinant SPLUNC1
or recombinant SPLUNC1 that had been reduced with DTT was added,
and the PD was remeasured on the same cultures 45 min later.
Pretreatment with DTT abolished SPLUNC1 activity. Western blot
analysis under non-denaturing conditions showing that reduced
(i.e., DTT-treated) SPLUNC1 migrates along the gel at a different
rate than non-denatured SPLUNC1 (FIG. 15).
Example 8
SPLUNC1 May Decrease the Number of ENaC Channels
[0342] The effect of SPLUNC1 on the number of ENaC channels in the
plasma membrane was tested by expressing SPLUNC1 and .alpha.ENaC in
Xenopus oocytes. After surface biotinylation of .alpha.ENaC, total
lysate was prepared and lysate from 3-4 eggs was separated on a 10%
gel. FIG. 16, Panel A shows that plasma membrane ENaC is decreased
following coexpression with SPLUNC1 in oocytes. The addition of
MTSET to ENaC containing the .beta.S518C mutant increases ENaC
P.sub.o to 1.0 when coexpressed in oocytes yet the overall current
is still reduced by SPLUNC1 expression, suggesting that ENaC has
been internalized (FIG. 16, Panel B).
Example 9
Identification of the SPLUNC1 Active Site
[0343] SPLUNC1 is a 256 amino acid protein that contains an
N-terminal signal sequence that enables the protein to be secreted
extracellularly. A predicted model of SPLUNC1 is shown in FIG. 17.
The N-terminal region including the ENaC inhibitory site
(highlighted in grey) has no predicted structure. C-terminal
truncation mutants of SPLUNC1 were prepared and examined for the
ability to inhibit ENaC channels in Xenopus oocytes. The mutant
proteins are shown in FIG. 18, Panel A. The N-terminal signal
peptide sequence (amino acids 1-19) and putative active site (amino
acids 22-39) are indicated. Each mutant was tested in the oocyte
current inhibition assay described in Example 3. The activity of
the truncation mutants is shown in FIG. 18, Panel B. Significant
inhibition (all p<0.0001) of ENaC was observed with the
full-length, 60%, 30%, and 15% proteins. However, deletion of 89%
or 98% of SPLUNC1 prevented its inhibition of ENaC. As amino acids
1-19 of SPLUNC1 are a signal sequence that enables the protein to
be secreted, this leaves a predicted inhibitory peptide of about 20
amino acids (residues 20-41) as the likely active site for SPLUNC1.
Notably, all truncates were secreted into the extracellular media,
as checked by western blot, consistent with the hypothesis that
SPLUNC1 acts extracellularly.
[0344] An 18 amino acid peptide that covered the N-terminus portion
of SPLUNC1 was prepared, dubbed S18 (SEQ ID NO: 11). When placed in
the bath solution for 1 h, this peptide inhibited ENaC to the same
degree as the full length protein, suggesting that we had
identified the active site of SPLUNC1 (FIG. 18, Panel C). It is
interesting to note that amino acids 22-39 of SPLUNC1 share
.about.40% homology with the inhibitory fragments of ENaC that are
excised upon proteolytic cleavage and are known to inhibit ENaC
(FIG. 19). However, since SPLUNC1 acts by reducing the number of
ENaC channels at the plasma membrane, whilst the .alpha.26 and
.gamma.43 subunits of ENaC act by reducing the open probability of
ENaC, their mechanism of action appears to markedly differ.
[0345] SPLUNC1 can be co-immunoprecipitated with either a, J, or
.gamma.ENaC. However, when either .alpha., .beta., or .gamma.ENaC
are immunoprecipitated, the other two subunits are also pulled down
as part of a complex. To better define which subunits interact with
SPLUNC1, we coexpressed each subunit individually and performed a
pull down with biotinylated S18. This peptide binds exclusively to
.beta.ENaC without any detectable binding to .alpha. or .gamma.ENaC
(FIG. 20).
Example 10
Characterization of S18
[0346] Since ENaC is regulated by NEDD4-2 binding to its C-termini,
which leads to ubiquitination of its N-termini and internalization,
we propose that S18 causes a conformational change in ENaC, leading
to increased ubiquitination followed by internalization (FIG. 21,
Panel A). As a first step towards understanding the mechanism of
action of SPLUNC1, we performed FRET on fluorescently tagged ENaCs.
FRET between .alpha.ENaC-eGFP and P3ENaC-mCherry was significantly
diminished after one hour of exposure to S18, indicating that
extracellular S18 binding induced a change in orientation between
.alpha. and .beta.ENaC C-termini, potentially through an allosteric
mechanism (FIG. 21, Panels A and B). Furthermore, .beta.ENaC-eGFP
internalized upon S18 binding (FIG. 21, Panel C), consistent with
our surface biotinylation data from oocytes.
[0347] We added 10 .mu.M S18 to the apical surface of CF HBECs to
test whether this peptide was capable of inhibiting ENaC and CF ASL
volume hyperabsorption. S18 significantly blocked ASL absorption
and reduced the amiloride-sensitive PD over 24 h (FIG. 22, Panels A
and B), suggesting that this peptide inhibited ENaC. We then
performed a full dose response for S18 by measuring ASL height in
CF HBECs 8 h post-S18 addition (FIG. 22, Panel C). The IC.sub.50
was 0.6 .mu.M. The serine protease inhibitor aprotinin also reduces
CF ASL hyperabsorption but did not prevent neutrophil clastase from
activating ENaC (FIG. 22, Panel D). Importantly, S18 also prevented
CF ASL hyperabsorption in the presence of neutrophil elastase (FIG.
22, Panel D), and in the presence of activated neutrophil
supernatant, which has high clastase and cathepsin activity. These
data suggest that S18 is still functional in the presence of
proteases and may be useful in damping down Na.sup.+
hyperabsorption in CF lungs, which usually exhibit higher levels of
proteolytic activity.
[0348] Preliminary structural analysis detected no known structural
motifs in the S18 region of SPLUNC1. In agreement, we also find no
structure to the S18 peptide by circular dichroism. It may be that
this is an intrinsically disordered region of SPLUNC1. Such
intrinsically disordered proteins (IDPs), where the lack of order
is an essential part of their function have only been described in
the last decade. IDPs frequently assume a temporary conformation
upon binding to their target protein, and can lose this structure
when the binding is ended. To test the robustness of S18, we heated
the peptide to 67.degree. C. for 30 min and then exposed CF
cultures to heated peptide. As can be seen, this maneuver had no
effect on the ability of S18 to inhibit CF ASL absorption, even in
the presence of neutrophil elastase (FIG. 23).
[0349] In agreement with previous researchers, we found NL ASL pH
to be .about.pH 7, while CF ASL pH was acidic (FIG. 23). Since the
cystic fibrosis transmembrane conductance regulator (CFTR) is not
required for SPLUNC1 to inhibit ENaC in oocytes (FIG. 21, Panel B),
we hypothesized that SPLUNC1 fails to function at acid pH in CF
HBECs. To test this hypothesis, we measured the effect of
recombinant SPLUNC1 addition to NL and CF HBECs lacking endogenous
SPLUNC1 at different pH. To raise CF ASL pH we used a modified
isotonic Ringer's solution in which 50 mM NaCl was exchanged for
100 mM POPSO (osmolarity was maintained at 300 mOsm), a biological
buffer with a pKa of 7.8. CF HBECs acidify the ASL incredibly
quickly (20 .mu.l pH 7.4 standard Ringer added apically is at pH 6
within 1 h). Hence, POPSO was chosen since its pKa of 7.8 helped
keep ASL pH>7 for 3 h, a suitable timeframe to measure changes
in ASL absorption rates.
[0350] In NL HBECs lacking SPLUNC1, addition of recombinant SPLUNC1
in standard Ringer was sufficient to restore ASL volume regulation
(FIG. 24, Panel A). However, SPLUNC1 knockdown had no effect in CF
HBECs (FIG. 24, Panel B).
[0351] The POPSO-Ringer was added to the apical surfaces of NL and
CF HBECs and ASL height measured 3 h later. Under these conditions,
POPSO had no effect on NL ASL height (FIG. 24, Panel A). However,
CF ASL height was significantly elevated (FIG. 24, Panel B).
Interestingly, stable knockdown of SPLUNC1 abolished the effects of
POPSO in CF HBECs and addition of both POPSO and recombinant
SPLUNC1 were required to restore CF ASL volume homeostasis (FIG.
24B). Similar results were obtained when CF ASL pH was raised with
bicarbonate and with HEPES, albeit with a shorter duration of
action.
[0352] The SPLUNC1 used in FIG. 24 was purified from BHK cells.
However, we also purified SPLUNC1 from E. coli (FIG. 25, Panel A).
In paired cultures, measured at the same time, S18, but not SPLUNC1
inhibited CF ASL absorption (FIG. 25, Panel B). These data suggest
that the purified SPLUNC1 is functional and remains pH-sensitive.
To directly investigate the pH effects of SPLUNC1 vs. S18 on ENaC,
we exposed Xenopus oocytes to recombinant SPLUNC1 vs. S18 and
measured amiloridc-sensitive current at pH 6 and 7.4. Changing pH
had no direct effect on ENaC activity. However, the inhibitory
effects of SPLUNC1, but not S18, were abolished at pH 6 (FIG. 25,
Panel C), consistent with the ASL data shown in the FIG. 25, Panel
B.
[0353] Based on SPLUNC1 but not S18's pH-sensitivity (FIG. 25,
Panels B and C), we hypothesized that SPLUNC1 undergoes a
conformational change, and binds to itself at pH 6. To test this,
we exposed SPLUNC1 to neutrophil elastase at pH 6 vs. 7.4 (FIG.
26). This maneuver had a modest effect on neutrophil elastase
activity, as measured by cleavage of a fluorogenic substrate (FIG.
26, Panel A). In contrast, SPLUNC1 was resistant to cleavage by
neutrophil elastase at pH 6 (FIG. 26, Panel B). This is consistent
with our hypothesis that less SPLUNC1 is exposed at low pH.
Example 11
Mutant SPLUNC1 Active in CF Airways
[0354] Since 518 still inhibits ENaC at pH 6, we hypothesized that
other domains of SPLUNC1 contribute to its pH-sensitivity. Our
model predicts that SPLUNC1 has a pH-sensitive hinge region that
allows the N-terminus to fold at acidic pH and sequester S18 into a
binding pocket (pH hinge shown in black in FIG. 17). To test this
hypothesis, we made and purified a mutant SPLUNC1 where all amino
acids in the hinge domain were mutated to alanines. The mutations
included K94A, N103A, N104A, K138A, Q140A, N142A, and D193A. This
mutant significantly inhibited ASL absorption in CF cultures,
unlike WT SPLUNC1, which was tested concurrently (FIG. 27).
Example 12
The S18 Peptide does not Affect the Function of ASIC1a, -2a and -3
Channels
[0355] Whole-cell currents were measured from CHO cells stably
expressing acid-sensing ion channel (ASIC) subunits, voltage
clamped to -60 mV. Stimulations lasted 5 s and were performed every
45 s. A) A typical experiment with an ASIC1a-expressing cell is
shown in FIG. 28, Panel A. Cells were stimulated three times with
pH 6.6 (ASIC1a and -3) or pH 4 (ASIC2a). Between stimulations,
cells were returned to a pH 7.4 conditioning solution for 40 s to
allow recovery from inactivation. The conditioning solution was
then switched to a pH 7.4 solution containing 10 .mu.M S18. Three
stimulations in the presence of 10 .mu.M S18 were performed before
washing off the peptide. Current amplitudes of the above described
experiments were normalized to the first control value and plotted
as a function of time (FIG. 28, Panel B). S118 was added at T=0 s.
ASIC1a=.box-solid., ASIC2a= , ASIC3=.tangle-solidup., all n=3.
Cells were incubated for 40 s in a pH 7.1 (ASIC1a and -3) or 5.6
(ASIC2a) conditioning solution, then activated using an acidic
stimulus (pH 5 for ASIC1a and -3, and pH 4 for ASIC2a) (FIG. 28,
Panel C). Experiments were performed with or without 10 .mu.M S18
in the conditioning solution. Current amplitudes measured during
the acidic stimulus were normalized to the control amplitude
obtained with a pH 7.4 conditioning solution. Open bars=control,
closed bars=S18, all n=3-4. Cells expressing ASIC1a were stimulated
three times with a pH 6.6 stimulus before 40 .mu.g/ml trypsin was
added to the pH 7.4 solution (FIG. 28, Panel D). Stimulations were
performed every 45 s. The protocol was performed with or without 10
.mu.M S18 in all solutions. The average current is plotted as a
function of time. Trypsin was added at T=0 s.
Control=.largecircle., S18=.box-solid., all n=3-5. As ASICs are a
subfamily of ENaC/Deg superfamily of ion channels, these results
demonstrate the specificity of S18 for ENaCs.
Example 13
S18 interacts specifically with the .beta.-ENaC subunit
[0356] FIG. 29, Panel A shows a typical western blot of the
triple-transfected .alpha..beta..gamma.-ENaC peptide pull-down
assay. The pull-down assay was performed with one V5-tagged subunit
and two untagged subunits as designated. FIG. 29, Panel B shows a
typical western blot of the S18 peptide pull-down assay of
individually expressed ENaC subunits. IN=input, PD=pull-down
elution. FIG. 29, Panel C shows a typical western blot showing the
pull-down assay performed with S18 or ADG. No .beta.-ENaC was
observed in the elution with the ADG peptide confirming that the
observed .beta.-ENaC is from specific interaction with the S18,
n=3.
Example 14
The .beta.-ENaC/S1S Interaction is Glycosylation Dependent
[0357] FIG. 30, Panel A shows a typical western blot of the
.alpha..beta..gamma.-ENaC peptide pull-down assay with the
.beta.-ENaC subunit V5-tagged and untagged .alpha. and .gamma.-ENaC
subunits. The pull-down assay was performed and the elution treated
with EndoH. FIG. 30, Panel B shows a typical western blot of the
.beta.-ENaC only peptide pull-down assay with the .beta.-ENaC
subunit V5-tagged. The pull-down assay was performed and the
elution treated with EndoH. PD=pull-down elution, PD+E=pull-down
elution with EndoH treatment. FIG. 30, Panel C shows a typical
western blot of the tunicamycin treated .beta.-ENaC only pull-down
assay. IN(T)=input of tunicamycin treated sample, PD (1)=pull-down
elution of tunicamycin treated sample, n=3. These data show that
the interaction between S18 and the .beta.-ENaC subunit is
glycosylation dependent.
Example 15
Alanine Scan Results for S18
[0358] ASL height was measured 6 h after exposure to vehicle,
control peptide, S18 or S18 with specific residues mutated to
alanine as outlined in FIG. 31. The dashed line shows height of
vehicle and control peptide (i.e. no effect on ASL height). NB, G1,
G2 and A18 were not mutated. The red box shows the region of S18
which appears to be critical for inhibition of ENaC. * p<0.05
vs. control. All n=6.
Example 16
S18 Induces Natriuresis when Added Systemically to Mice
[0359] Urinary Na.sup.+ output was measured in unconscious mice
(FIG. 32). Amiloride (38 nmol/g BW/h; .box-solid.) and S18 (250
nmol/g BW/h; .tangle-solidup.) were added during the infusion
period and urinary Na.sup.+ excretion (U.sub.NaV) was measured
throughout. These data show that S18 induces natriuresis when
administered to animals.
[0360] The foregoing is illustrative of the present invention, and
is not to be construed as limiting thereof. The invention is
defined by the following claims, with equivalents of the claims to
be included therein.
Sequence CWU 1
1
141256PRTHomo sapiens 1Met Phe Gln Thr Gly Gly Leu Ile Val Phe Tyr
Gly Leu Leu Ala Gln 1 5 10 15 Thr Met Ala Gln Phe Gly Gly Leu Pro
Val Pro Leu Asp Gln Thr Leu 20 25 30 Pro Leu Asn Val Asn Pro Ala
Leu Pro Leu Ser Pro Thr Gly Leu Ala 35 40 45 Gly Ser Leu Thr Asn
Ala Leu Ser Asn Gly Leu Leu Ser Gly Gly Leu 50 55 60 Leu Gly Ile
Leu Glu Asn Leu Pro Leu Leu Asp Ile Leu Lys Pro Gly 65 70 75 80 Gly
Gly Thr Ser Gly Gly Leu Leu Gly Gly Leu Leu Gly Lys Val Thr 85 90
95 Ser Val Ile Pro Gly Leu Asn Asn Ile Ile Asp Ile Lys Val Thr Asp
100 105 110 Pro Gln Leu Leu Glu Leu Gly Leu Val Gln Ser Pro Asp Gly
His Arg 115 120 125 Leu Tyr Val Thr Ile Pro Leu Gly Ile Lys Leu Gln
Val Asn Thr Pro 130 135 140 Leu Val Gly Ala Ser Leu Leu Arg Leu Ala
Val Lys Leu Asp Ile Thr 145 150 155 160 Ala Glu Ile Leu Ala Val Arg
Asp Lys Gln Glu Arg Ile His Leu Val 165 170 175 Leu Gly Asp Cys Thr
His Ser Pro Gly Ser Leu Gln Ile Ser Leu Leu 180 185 190 Asp Gly Leu
Gly Pro Leu Pro Ile Gln Gly Leu Leu Asp Ser Leu Thr 195 200 205 Gly
Ile Leu Asn Lys Val Leu Pro Glu Leu Val Gln Gly Asn Val Cys 210 215
220 Pro Leu Val Asn Glu Val Leu Arg Gly Leu Asp Ile Thr Leu Val His
225 230 235 240 Asp Ile Val Asn Met Leu Ile His Gly Leu Gln Phe Val
Ile Lys Val 245 250 255 2249PRTHomo sapiens 2Met Leu Gln Leu Trp
Lys Leu Val Leu Leu Cys Gly Val Leu Thr Gly 1 5 10 15 Thr Ser Glu
Ser Leu Leu Asp Asn Leu Gly Asn Asp Leu Ser Asn Val 20 25 30 Val
Asp Lys Leu Glu Pro Val Leu His Glu Gly Leu Glu Thr Val Asp 35 40
45 Asn Thr Leu Lys Gly Ile Leu Glu Lys Leu Lys Val Asp Leu Gly Val
50 55 60 Leu Gln Lys Ser Ser Ala Trp Gln Leu Ala Lys Gln Lys Ala
Gln Glu 65 70 75 80 Ala Glu Lys Leu Leu Asn Asn Val Ile Ser Lys Leu
Leu Pro Thr Asn 85 90 95 Thr Asp Ile Phe Gly Leu Lys Ile Ser Asn
Ser Leu Ile Leu Asp Val 100 105 110 Lys Ala Glu Pro Ile Asp Asp Gly
Lys Gly Leu Asn Leu Ser Phe Pro 115 120 125 Val Thr Ala Asn Val Thr
Val Ala Gly Pro Ile Ile Gly Gln Ile Ile 130 135 140 Asn Leu Lys Ala
Ser Leu Asp Leu Leu Thr Ala Val Thr Ile Glu Thr 145 150 155 160 Asp
Pro Gln Thr His Gln Pro Val Ala Val Leu Gly Glu Cys Ala Ser 165 170
175 Asp Pro Thr Ser Ile Ser Leu Ser Leu Leu Asp Lys His Ser Gln Ile
180 185 190 Ile Asn Lys Phe Val Asn Ser Val Ile Asn Thr Leu Lys Ser
Thr Val 195 200 205 Ser Ser Leu Leu Gln Lys Glu Ile Cys Pro Leu Ile
Arg Ile Phe Ile 210 215 220 His Ser Leu Asp Val Asn Val Ile Gln Gln
Val Val Asp Asn Pro Gln 225 230 235 240 His Lys Thr Gln Leu Gln Thr
Leu Ile 245 319DNAArtificialPCR primer 3ctgatggcca ccgtcctat
19420DNAArtificialPCR primer 4aggtggatcc tctcctgctt
20521RNAArtificialAnti-SPLUNC1 shRNA sequence 5auaaaguccu
gccugaguuu u 21621RNAArtificialAnti-SPLUNC1 shRNA sequence
6aacucaggca ggacuuuauu u 21721RNAArtificialAnti-SPLUNC1 shRNA
sequence 7gcaggaagcu ugacaaaugu u 21821RNAArtificialAnti-SPLUNC1
shRNA sequence 8cauuugucaa gcuuccugcu u 21919PRTHomo
sapiensMISC_FEATURE(1)..(19)Amino acids 4-22 of the alpha 26
subunit of ENaC 9Gly Ala Leu Pro His Pro Leu Gln Arg Leu Arg Thr
Pro Pro Pro Pro 1 5 10 15 Asn Pro Ala 1014PRTHomo
sapiensMISC_FEATURE(1)..(14)Amino acids 11-24 of the gamma 43
subunit of ENaC 10Gly Thr Pro Pro Arg Phe Leu Asn Leu Ile Pro Leu
Leu Val 1 5 10 1118PRTHomo sapiens 11Gly Gly Leu Pro Val Pro Leu
Asp Gln Thr Leu Pro Leu Asn Val Asn 1 5 10 15 Pro Ala 1272PRTHomo
sapiens 12Gly Gly Leu Pro Val Pro Leu Asp Gln Thr Leu Pro Leu Asn
Val Asn 1 5 10 15 Pro Ala Leu Pro Leu Ser Pro Thr Gly Leu Ala Gly
Ser Leu Thr Asn 20 25 30 Ala Leu Ser Asn Gly Leu Leu Ser Gly Gly
Leu Leu Gly Ile Leu Glu 35 40 45 Asn Leu Pro Leu Leu Asp Ile Leu
Lys Pro Gly Gly Gly Thr Ser Gly 50 55 60 Gly Leu Leu Gly Gly Leu
Leu Gly 65 70 1318PRTArtificialControl peptide sequence 13Ala Asp
Gly Gly Leu Leu Leu Leu Asn Asn Pro Pro Pro Pro Gln Thr 1 5 10 15
Val Val 148PRTHomo sapiens 14Leu Pro Val Pro Leu Asp Gln Thr 1
5
* * * * *