U.S. patent application number 15/010404 was filed with the patent office on 2016-05-19 for pharmaceutical composition for treating diabetes.
This patent application is currently assigned to Ajinomoto Co., Inc.. The applicant listed for this patent is Ajinomoto Co., Inc.. Invention is credited to Hiroki Inoue, Kaori Kobayashi, Kayo Matsumoto, Tadakiyo NAKAGAWA, Sen Takeshita, Munetaka Tokumasu, Tomomi Yoshida.
Application Number | 20160137633 15/010404 |
Document ID | / |
Family ID | 48192172 |
Filed Date | 2016-05-19 |
United States Patent
Application |
20160137633 |
Kind Code |
A1 |
NAKAGAWA; Tadakiyo ; et
al. |
May 19, 2016 |
PHARMACEUTICAL COMPOSITION FOR TREATING DIABETES
Abstract
Provided is a compound represented by the following general
formula (I), or a pharmaceutically acceptable salt thereof. This
novel compound has a glycogen-synthase activation ability, but
activates a receptor PPAR to a low degree and is highly safe.
##STR00001## In the formula, Ar is an aromatic carbocyclic ring or
a heterocyclic ring; and Ar.sub.2 is represented by any one of the
following rings and the like. ##STR00002##
Inventors: |
NAKAGAWA; Tadakiyo;
(Kawasaki-shi, JP) ; Matsumoto; Kayo;
(Kawasaki-shi, JP) ; Takeshita; Sen;
(Kawasaki-shi, JP) ; Yoshida; Tomomi;
(Kawasaki-shi, JP) ; Tokumasu; Munetaka;
(Kawasaki-shi, JP) ; Inoue; Hiroki; (Kawasaki-shi,
JP) ; Kobayashi; Kaori; (Kawasaki-shi, JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Ajinomoto Co., Inc. |
Chuo-ku |
|
JP |
|
|
Assignee: |
Ajinomoto Co., Inc.
Chuo-ku
JP
|
Family ID: |
48192172 |
Appl. No.: |
15/010404 |
Filed: |
January 29, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14268323 |
May 2, 2014 |
9290487 |
|
|
15010404 |
|
|
|
|
PCT/JP12/78516 |
Nov 2, 2012 |
|
|
|
14268323 |
|
|
|
|
Current U.S.
Class: |
514/210.18 ;
514/230.5; 514/415; 514/422; 514/423; 514/469; 544/105; 548/465;
548/525; 548/533; 549/462 |
Current CPC
Class: |
A61K 31/536 20130101;
C07D 403/12 20130101; C07D 413/12 20130101; C07D 405/12 20130101;
A61P 3/10 20180101; A61P 43/00 20180101; A61K 31/404 20130101; A61K
31/4025 20130101; C07D 207/16 20130101; A61K 31/427 20130101; C07D
307/79 20130101; C07D 409/12 20130101; A61K 31/343 20130101; A61K
31/397 20130101; C07D 307/80 20130101; A61K 31/401 20130101 |
International
Class: |
C07D 413/12 20060101
C07D413/12; C07D 409/12 20060101 C07D409/12; C07D 207/16 20060101
C07D207/16; C07D 403/12 20060101 C07D403/12; C07D 405/12 20060101
C07D405/12; C07D 307/80 20060101 C07D307/80 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 4, 2011 |
JP |
2011-242363 |
Jul 18, 2012 |
JP |
2012-159862 |
Claims
1. A compound of formula (I), or a pharmaceutically acceptable salt
thereof: ##STR00091## wherein Ar is an aromatic carbocyclic ring or
a heterocyclic ring; Ar.sub.2 is represented by any one of the
following rings ##STR00092## these rings may have a substituent,
and the substituent is selected from the group consisting of
acetamido, aminocarbonyl, benzyl, benzyloxy, a halogen,
hydroxyl-lower alkyl, lower alkyl, lower alkoxy-lower alkyl,
phenoxy, phenyl, a formyl group, a cyano group, a cyanoalkyl group,
a hydroxyiminomethyl group, a hydroxyamidino group, an amino group,
an aminoalkyl group, an alkylaminoalkyl group, a dialkylaminoalkyl
group, lower alkoxy, and trifluoro-methoxy; R.sub.2 and R.sub.3 are
independently selected from the group consisting of lower alkyl,
lower alkoxy, trifluoromethyl, a halogen, hydroxy, a hydroxyl-lower
alkyl group, amino, alkylamino, dialkylamino, cyano, and nitro;
R.sub.4 is an amino acid residue bonded to C(O) through a nitrogen
atom of the amino acid; R.sub.5 is a cyanoalkyl group or --CD3, or
is represented by any one of the following substituents
##STR00093## R.sub.6 is hydrogen, a lower alkyl group, a cyanoalkyl
group, a hydroxyalkyl group, or an alkoxyalkyl group, or is
represented by any one of the following substituents ##STR00094##
R.sub.7 and R.sub.8 are each a cyanoalkyl group, a formyl group, an
alkoxycarbonyl group, or a hydroxyiminomethyl group; R.sub.9 is
hydrogen or a lower alkyl group; m is 0, 1, 2, 3, or 4; p is 0, 1,
or 2; and s is 0, 1, or 2.
2. A compound of formula (I), or a pharmaceutically acceptable salt
thereof: ##STR00095## wherein Ar is an aromatic carbocyclic ring or
a heterocyclic ring; Ar.sub.2 is represented by any one of the
following rings ##STR00096## these rings may have a substituent,
and the substituent is selected from the group consisting of
acetamido, aminocarbonyl, benzyl, benzyloxy, a halogen,
hydroxyl-lower alkyl, lower alkyl, lower alkoxy-lower alkyl,
phenoxy, phenyl, lower alkoxy, and trifluoro-methoxy; R.sub.2 and
R.sub.3 are independently selected from the group consisting of
lower alkyl, lower alkoxy, trifluoromethyl, a halogen, hydroxy,
amino, alkylamino, dialkylamino, cyano, and nitro; R.sub.4 is an
amino acid residue bonded to C(O) through a nitrogen atom of the
amino acid; R.sub.5 is --CH2CN or --CD3, or is represented by any
one of the following substituents ##STR00097## R.sub.6 is hydrogen
or a lower alkyl group; m is 0, 1, 2, 3, or 4; p is 0, 1, or 2; and
s is 0, 1, or 2.
3. The compound according to claim 2, or a pharmaceutically
acceptable salt thereof, wherein Ar is a phenyl group, and R.sub.4
represents a proline residue bonded to C(O) through a nitrogen atom
of the proline.
4. The compound according to claim 2, or a pharmaceutically
acceptable salt thereof, wherein Ar is a phenyl group, R.sub.4
represents a proline residue bonded to C(O) through a nitrogen atom
of the proline, and Ar.sub.2 is represented by any one of the
following rings ##STR00098##
5. A pharmaceutical composition, comprising: the compound according
to claim 1 or a pharmaceutically acceptable salt thereof; and a
pharmaceutically acceptable carrier.
6. A pharmaceutical composition, comprising: the compound according
to claim 2 or a pharmaceutically acceptable salt thereof; and a
pharmaceutically acceptable carrier.
7. The compound according to claim 2, or a pharmaceutically
acceptable salt thereof, wherein Ar is an aromatic carbocyclic
ring.
8. The compound according to claim 2, or a pharmaceutically
acceptable salt thereof, wherein Ar is a heterocyclic ring.
9. The compound according to claim 2, or a pharmaceutically
acceptable salt thereof, wherein Ar.sub.2 is represented by
##STR00099##
10. The compound according to claim 7, or a pharmaceutically
acceptable salt thereof, wherein Ar.sub.2 is represented by
##STR00100##
11. The compound according to claim 8, or a pharmaceutically
acceptable salt thereof, wherein Ar.sub.2 is represented by
##STR00101##
12. The compound according to claim 4, or a pharmaceutically
acceptable salt thereof, wherein Ar.sub.2 is represented by
##STR00102##
13. The compound according to claim 4, or a pharmaceutically
acceptable salt thereof, wherein Ar.sub.2 is represented by
##STR00103##
14. A pharmaceutical composition, comprising: the compound
according to claim 7 or a pharmaceutically acceptable salt thereof;
and a pharmaceutically acceptable carrier.
15. A pharmaceutical composition, comprising: the compound
according to claim 8 or a pharmaceutically acceptable salt thereof;
and a pharmaceutically acceptable carrier.
16. A pharmaceutical composition, comprising: the compound
according to claim 9 or a pharmaceutically acceptable salt thereof;
and a pharmaceutically acceptable carrier.
17. A pharmaceutical composition, comprising: the compound
according to claim 10 or a pharmaceutically acceptable salt
thereof; and a pharmaceutically acceptable carrier.
18. A pharmaceutical composition, comprising: the compound
according to claim 11 or a pharmaceutically acceptable salt
thereof; and a pharmaceutically acceptable carrier.
19. A pharmaceutical composition, comprising: the compound
according to claim 12 or a pharmaceutically acceptable salt
thereof; and a pharmaceutically acceptable carrier.
20. A pharmaceutical composition, comprising: the compound
according to claim 13 or a pharmaceutically acceptable salt
thereof; and a pharmaceutically acceptable carrier.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a division of Ser. No.
14/268,323, filed May 2, 2014, which is a continuation of
International Application PCT/JP2012/078516, filed Nov. 2, 2012.
The entire contents of the above applications are incorporated
herein by reference. International Application PCT/JP2012/078516
claims the benefits of priority to Japanese Application No.
2011-242363, filed Nov. 4, 2011, and Japanese Application No.
2012-159862, filed Jul. 18, 2012.
TECHNICAL FIELD
[0002] The present invention relates to a novel compound having a
glycogen synthase-activating function, and to a pharmaceutical
composition for treating diabetes, which contains the compound.
BACKGROUND ART
[0003] Diabetes mellitus is an important disease for people
nowadays, and the incidence of diabetes has been an upward trend in
recent years. Many therapeutic drugs for diabetes have been
developed on the basis of mechanisms of onset of diabetes, and have
been actually used. For example, an insulin sensitivity enhancer,
an .alpha.-glycosidase inhibitor, an insulin secretion promoter,
insulin preparation, and the like have been used alone or in
combination of two or more.
[0004] Under such circumstances as described above, a technique has
been under development, which is adopted to treat diabetes by
activating glycogen synthase, which is a novel mechanism different
from those of the aforementioned conventional therapeutic drugs for
diabetes. Specifically, biaryloxymethylarenecarboxylic acids have
been proposed as compounds capable of activating glycogen synthase
(Patent Literatures 1 to 9).
[0005] Meanwhile, novel, pharmaceutically active compounds are
required to be safe, for example, to have no side effect, in
addition to a predetermined effect(s) for the disease treatment.
Examining peroxisome proliferator-activated receptors PPARs has
been proposed as means for drug safety evaluation (Non Patent
Literature 1). This is due to the facts that: in experimental
animals such as rats, administering certain drugs leads to
hepatomegaly and significantly induces intrahepatic enzymes, and
the long-term administration of the drugs causes liver cancer. The
changes are characterized by significant proliferation of
peroxisomes, which are organelles in the liver. It has been
revealed that a receptor PPAR, especially a subfamily PPAR.alpha.,
activated by a peroxisome proliferator (PP) is involved in the
mechanism of drug-liver peroxisome proliferation-liver
carcinogenesis. This phenomenon has drawn attention at the drug
safety evaluation (particularly, carcinogenicity evaluation) in the
pharmaceutical drug development stage.
CITATION LIST
Patent Literatures
[0006] Patent Literature 1: WO2005/000781 [0007] Patent Literature
2: WO2006/058648 [0008] Patent Literature 3: WO2011/057956 [0009]
Patent Literature 4: WO2011/057959 [0010] Patent Literature 5:
WO2011/057993 [0011] Patent Literature 6: WO2011/058122 [0012]
Patent Literature 7: WO2011/058154 [0013] Patent Literature 8:
WO2011/067174 [0014] Patent Literature 9: WO2011/067266
Non Patent Literature
[0014] [0015] Non Patent Literature 1: Journal of Clinical and
Experimental Medicine (Igaku No Ayumi), Vol. 220, No. 1 (2007) pp.
75-80
SUMMARY OF INVENTION
Problems to be Solved by the Invention
[0016] An object of the present invention is to provide a novel,
highly safe compound, which has a glycogen-synthase activation
ability but activates a receptor PPAR to a low degree.
[0017] Another object of the present invention is to provide a
pharmaceutical composition containing the compound.
[0018] Another object of the present invention is to provide a
pharmaceutical composition for treating diabetes, which contains
the compound.
[0019] Still another object of the present invention is to provide
a glycogen synthase activator containing the compound.
Solution to Problems
[0020] Focusing on biaryl rings of biaryloxymethylarenecarboxylic
acid compounds described in Patent Literatures 1 to 9, the present
invention has been made on the basis of the finding that the above
objects can be efficiently achieved by the alteration and so forth
to a fused heterocyclic ring, in which a 5-membered ring or a
6-membered ring containing an oxygen atom, a sulfur atom, a
nitrogen atom, or the like as a ring-constituting atom is fused to
a phenyl group located at an end.
[0021] Specifically, the present invention provides a compound
represented by the following general formula (I), or a
pharmaceutically acceptable salt thereof:
##STR00003##
[0022] wherein Ar is an aromatic carbocyclic ring or a heterocyclic
ring;
[0023] Ar.sub.2 is represented by any one of the following
rings
##STR00004## [0024] these rings may have a substituent, and [0025]
the substituent is selected from the group consisting of acetamido,
aminocarbonyl, benzyl, benzyloxy, a halogen, hydroxyl-lower alkyl,
lower alkyl, lower alkoxy-lower alkyl, phenoxy, phenyl, a formyl
group, a cyano group, a cyanoalkyl group, a hydroxyiminomethyl
group, a hydroxyamidino group, an amino group, an aminoalkyl group,
an alkylaminoalkyl group, a dialkylaminoalkyl group, lower alkoxy,
and trifluoro-methoxy;
[0026] R.sub.2 and R.sub.3 are independently selected from the
group consisting of lower alkyl, lower alkoxy, trifluoromethyl, a
halogen, hydroxy, a hydroxyl-lower alkyl group, amino, alkylamino,
dialkylamino, cyano, and nitro;
[0027] R.sub.4 is an amino acid residue bonded to C(O) through a
nitrogen atom of the amino acid;
[0028] R.sub.5 is a cyanoalkyl group or --CD3, or is represented by
any one of the following substituents
##STR00005##
[0029] R.sub.6 is hydrogen, a lower alkyl group, a cyanoalkyl
group, a hydroxyalkyl group, or an alkoxyalkyl group, or is
represented by any one of the following substituents
##STR00006##
[0030] R.sub.7 and R.sub.8 are each a cyanoalkyl group, a formyl
group, an alkoxycarbonyl group, or a hydroxyiminomethyl group;
[0031] R.sub.9 is hydrogen or a lower alkyl group;
[0032] m is 0, 1, 2, 3, or 4;
[0033] p is 0, 1, or 2; and
[0034] s is 0, 1, or 2.
DESCRIPTION OF EMBODIMENTS
[0035] In a general formula (I), an aromatic carbocyclic ring
includes aromatic carbocyclic rings such as a phenyl group and a
naphthyl group. Meanwhile, a heterocyclic ring includes 5-membered
to 8-membered heterocyclic rings containing, as a ring-constituting
atom, at least one heteroatom selected from the group consisting of
an oxygen atom, a nitrogen atom, and a sulfur atom. Among them, a
furan group and a thiazole group are preferable.
[0036] In the general formula (I), a lower alkyl group and a lower
alkoxy group preferably have 1 to 6 carbon atoms, more preferably
have 1 to 3 carbon atoms. These may be linear or branched. In
addition, an alkyl group and an alkoxy group in a cyanoalkyl group,
an aminoalkyl group, an alkylaminoalkyl group, a dialkylaminoalkyl
group, an alkylamino group, a dialkylamino group, a hydroxyalkyl
group, an alkoxyalkyl group, and an alkoxycarbonyl group preferably
have 1 to 18 carbon atoms, more preferably have 1 to 6 carbon
atoms, and most preferably have 1 to 3 carbon atoms.
[0037] In the general formula (I), R.sub.2 and R.sub.3 are each
preferably a hydrogen atom or a halogen, more preferably a hydrogen
atom.
[0038] In the general formula (I), R.sub.5 is preferably CH2CN,
--CD3, --CH2CH.dbd.CH2, --CH2C.ident.CH, CH2C(O) CH3, or CH2CH(OH)
CH3, while R.sub.6 is preferably a methyl group, a hydrogen atom,
CH2C(O) CH3, CH2CH2OH, or CH2CN. Additionally, D in --CD3 as
R.sub.5 represents deuterium.
[0039] In the general formula (I), R.sub.7 and R.sub.8 are each
preferably a cyanomethyl group, a methoxycarbonyl group, a
hydroxyiminomethyl group, or a formyl group. R.sub.9 is preferably
hydrogen.
[0040] An amino acid serving as an amino acid residue in the
general formula (I) includes proline, sarcosine,
azetidine-2-carboxylic acid, N-methylalanine,
2,5-dihydro-1H-pyrrole-2-carboxylic acid, and
1,3-thiazolidine-4-carboxylic acid. Among them, proline and
sarcosine are preferable.
[0041] Here, Ar.sub.2 preferably has one, two, or three
substituents, one or two of which are preferably a halogen(s).
[0042] In the general formula (I), preferably m=0, p=0, and
s=0.
[0043] In the general formula (I), Ar.sub.2 is preferably
represented by any one of the following rings which may have a
substituent
##STR00007##
[0044] Of these, Ar.sub.2 is particularly preferably represented by
any one of the following rings which may have a substituent
##STR00008##
[0045] Alternatively, Ar.sub.2 is preferably represented by any one
of the following rings which may have a substituent
##STR00009##
[0046] Further, particularly, the substituent of the above rings is
particularly preferably a halogen, hydroxy-lower alkyl, a lower
alkoxy-lower alkyl group, a formyl group, a cyano group, a
hydroxyiminomethyl group, a dialkylaminoalkyl group, or a lower
alkyl group.
[0047] A compound represented by the general formula (I) of the
present invention and a pharmaceutically acceptable salt thereof
can be synthesized according to the following synthesis scheme:
##STR00010##
[0048] Here, a phenol derivative (1) having a halogen at X1 is
reacted with a benzoic acid ester derivative (2) having a halogen
at X2, for example, in a solvent such as N,N-dimethylformamide
(hereinafter, DMF) in the presence of a base such as potassium
carbonate, so that an ester derivative (3) can be obtained. This is
hydrolyzed to a carboxylic acid, for example, in a solvent such as
methanol in the presence of a base such as sodium hydroxide. After
conversion to an acid chloride using for example thionyl chloride
or the like, the resultant can be reacted with various amino acids,
for example, proline, for example, in a solvent such as
dichloromethane in the presence of a base such as sodium hydroxide
to thereby obtain an amide (4). The amide (4) is subjected to a
coupling reaction, for example, in a solvent such as dioxane or
water in the presence of a base such as sodium carbonate, using
various boronic acid derivatives, and Pd or the like as a catalyst,
so that a compound (5) can be obtained by.
[0049] Alternatively, as shown in the following reaction equation,
a phenol derivative (6) having a boronic acid derivative at X3 is
reacted with a benzoic acid ester derivative (2) having a halogen
at X2, for example, in a solvent such as DMF in the presence of a
base such as potassium carbonate, so that an ester derivative (7)
can be obtained. This is hydrolyzed to a carboxylic acid, for
example, in a solvent such as methanol in the presence of a base
such as sodium hydroxide. The resultant can be reacted with various
amino acids, for example, proline, for example, in a solvent such
as dichloromethane, using for example a condensation agent to
thereby obtain an ester. The resultant can be hydrolyzed, for
example, in a solvent such as methanol in the presence of a base
such as sodium hydroxide to thereby obtain an amide (8). The amide
(8) is subjected to a coupling reaction, for example, in a solvent
such as dioxane or water in the presence of a base such as sodium
carbonate using various halogen derivatives, and Pd or the like as
a catalyst, so that the compound (5) can be obtained.
##STR00011##
[0050] In the present invention, in a case where the compound
represented by the general formula (I) can be made in the form of a
salt, it is only necessary that the salt be pharmaceutically
acceptable. For example, in a case where an acidic group such as a
carboxyl group is present in the formula, the pharmaceutically
acceptable salt for such an acidic group includes an ammonium salt;
salts with alkali metals such as sodium and potassium; salts with
alkaline earth metals such as calcium and magnesium; aluminium
salts; zinc salts; salts with organic amines such as triethylamine,
ethanolamine, morpholine, piperidine, and dicyclohexylamine; and
salts with basic amino acids such as arginine and lysine. Of these,
sodium is preferably used.
[0051] In a case where a basic group is present in the formula, the
pharmaceutically acceptable salt for such a basic group includes
salts with inorganic acids such as hydrochloric acid, sulfuric
acid, phosphoric acid, nitric acid, hydrobromic acid; salts with
organic carboxylic acids such as acetic acid, trifluoroacetic acid,
citric acid, benzoic acid, maleic acid, fumaric acid, tartaric
acid, succinic acid, tannic acid, butyric acid, hibenzic acid,
pamoic acid, enanthic acid, decanoic acid, teoclic acid, salicylic
acid, lactic acid, oxalic acid, mandelic acid, and malic acid; and
salts with organic sulfonic acids such as methanesulfonic acid,
benzenesulfonic acid, and p-toluenesulfonic acid. Of these,
hydrochloric acid and trifluoroacetic acid are preferably used.
[0052] As a method for forming the salt, the compound represented
by the general formula (I) and a required acid or base may be mixed
at an appropriate quantity ratio in a solvent or a dispersant, or
the salt can be obtained from another salt form by cation exchange
or anion exchange.
[0053] The compound of the present invention also includes
solvates, for example, hydrates, alcohol adducts, and the like of
the compound represented by the general formula (I).
[0054] The compound of the present invention may also be converted
to a prodrug. In the present invention, a prodrug refers to a
compound that is converted in vivo so that the compound of the
present invention can be produced. For example, in a case where the
active form contains a carboxyl group or a phosphate group, the
prodrug includes esters of the carboxyl group or the phosphate
group, amides thereof, and the like. Meanwhile, in a case where the
active form contains an amino group, the prodrug includes amides of
the amino group, carbamates thereof, and the like. In a case where
the active form contains a hydroxyl group, the prodrug includes
esters of the hydroxyl group, carbonates thereof, carbamates
thereof, and the like. When the compound of the present invention
is converted to a prodrug, the prodrug may be bonded to an amino
acid or sugars.
[0055] The present invention includes all isotopes of the compound
represented by the general formula (I). The isotopes of the
compound of the present invention each have at least one atom
substituted with an atom having the same atomic number (proton
number) but having a different mass number (sum of the numbers of
protons and neutrons). Examples of the isotopes included in the
compound of the present invention are: a hydrogen atom, a carbon
atom, a nitrogen atom, an oxygen atom, a phosphorus atom, a sulfur
atom, a fluorine atom, a chlorine atom, and the like, including 2H,
3H, 13C, 14C, 15N, 17O, 18O, 31P, 32P, 35S, 18F, 36Cl, and the
like. Particularly, unstable radioisotopes such as 3H and 14C that
release radiation and emit neutrons are useful for a body tissue
distribution test and the like to be conducted on a pharmaceutical
drug or compound. A stable isotope does not decay, so that the
abundance hardly changes and no radiation is released; accordingly,
such a stable isotope can be used safely. The isotope of the
compound of the present invention can be converted according to a
conventional method by replacing a reagent used for synthesis with
a reagent containing a corresponding isotope.
[0056] A pharmaceutical composition of the present invention can be
preferably used for treatment of diseases mediated by a decrease in
the activity of glycogen synthase. Particularly, the pharmaceutical
composition of the present invention can be preferably used for
treatment of diabetes, especially, type 2 diabetes and impaired
glucose tolerance.
[0057] The pharmaceutical composition and a glycogen synthase
activator of the present invention vary, depending on the
administration target, the administration route, the target
disease, the symptoms, and the like. Nevertheless, the
pharmaceutical composition and the glycogen synthase activator of
the present invention are preferably used for oral administration
as the administration route. The dose in a single administration is
preferably 1 mg to 1000 mg in terms of the active
ingredient/person, more preferably 1 mg to 100 mg in terms of the
active ingredient/person. This dose is desirably administered one
time to three times a day.
[0058] The pharmaceutical composition and the glycogen synthase
activator of the present invention contain the compound represented
by the general formula (I) and/or the pharmaceutically acceptable
salt thereof as the active ingredient, but may also contain various
ingredients generally used in orally administered drugs, for
example, a pharmaceutically or physiologically acceptable solid or
liquid carrier, additive, and the like.
[0059] Examples of the carrier include glucose, lactose, sucrose,
starches, mannitol, dextrins, fatty acid glycerides, polyethylene
glycol, hydroxymethyl starches, ethylene glycol, polyoxyethylene
sorbitan fatty acid esters, gelatins, albumins, amino acids, water,
salines, and the like. In addition, as necessary, commonly-used
additives such as a stabilizer, a moisturizer, an emulsifier, a
binder, and an isotonic agent can also be added as appropriate.
[0060] The additives are not particularly limited, as long as they
are used in accordance with their purposes and also generally used
for the purposes. Specifically, examples thereof include flavors,
sugars, sweeteners, food fiber, vitamins, amino acids such as
monosodium glutamate (MSG), nucleic acids such as inosine
monophosphate (IMP), inorganic salts such as sodium chloride,
water, and the like.
[0061] The pharmaceutical composition and the glycogen synthase
activator of the present invention can be used in orally
administrable forms, such as dry powder, paste, and solution,
without limitation to physical properties.
[0062] Examples of such an orally administrable form include
tablets (including sugar coated tablets, film coated tablets,
sublingual tablets, and orally disintegrating tablets), capsules
(including soft capsules and microcapsules), granules, powders,
troches, syrups, emulsions, suspensions, films (e.g., orally
disintegrating films), lyophilized formulations, and the like.
[0063] Alternatively, the pharmaceutical composition and the
glycogen synthase activator of the present invention can also be
used in the form of parenteral preparations such as injections
(e.g., subcutaneous injections, intravenous injections,
intramuscular injections, intraperitoneal injections, drips),
external preparations (e.g., transdermal preparations, ointments),
suppositories (e.g., rectal suppositories, vaginal suppositories),
pellets, intranasal agents, transpulmonary agents (inhalants), and
eye drops.
[0064] Each of these can be safely administered orally or
parenterally (e.g., locally, rectally, intravenously administered).
These preparations may be controlled-release preparations such as
immediate-release preparations or sustained-release preparations
(e.g., sustained-release microcapsules). These preparations can be
prepared by pharmaceutically common means.
[0065] Additionally, the pharmaceutical composition and the
glycogen synthase activator of the present invention can be used in
combination with other antidiabetic drugs, drugs for diabetic
complications, anti-hyperlipemia drugs, antihypertensives, and/or
anti-obesity drugs (hereinafter, abbreviated as combination drugs).
These combination drugs may be low in molecular weight, or may be
high-molecular-weight proteins, polypeptides, antibodies, nucleic
acids (including antisense nucleic acids, siRNAs, shRNAs),
vaccines, or the like. These combination drugs may be used alone or
in combination of two or more.
[0066] The administration timing of the pharmaceutical composition
and the glycogen synthase activator of the present invention or the
combination drugs is not limited. These may be administered to the
administration target simultaneously, or may be administered with
an interval.
[0067] Note that the antidiabetic drugs include insulin
preparations (e.g., animal insulin preparations extracted from the
pancreas of cattle or pigs; human insulin preparations synthesized
by genetic engineering using Escherichia coli or yeast; insulin
zinc; protamine insulin zinc; insulin fragments or derivatives
(e.g., INS-1), oral insulin preparations), insulin resistance
improvers (e.g., pioglitazone or salts thereof (preferably
hydrochloride), rosiglitazone or salts thereof (preferably
maleate), tesaglitazar), ragaglitazar, muraglitazar, edaglitazone,
metaglidasen, naveglitazar, AMG-131, THR-0921), .alpha.-glucosidase
inhibitors (e.g., voglibose, acarbose, miglitol, emiglitate),
biguanides (e.g., metformin, buformin, or salts thereof (e.g.,
hydrochloride, fumarate, succinate)), insulin secretion promoters
[sulfonylureas (e.g., tolbutamide, glibenclamide, gliclazide,
chlorpropamide, tolazamide, acetohexamide, glyclopyramide,
glimepiride, glipizide, glybuzole), repaglinide, nateglinide,
mitiglinide, or calcium salt hydrates thereof], dipeptidyl
peptidase IV inhibitors (e.g., alogliptin, vildagliptin,
sitagliptin, saxagliptin, T-6666, TS-021), .beta.3 agonists (e.g.,
AJ-9677), GPR40 agonists, GPR120 agonists, GLP-1 receptor agonists
[e.g., GLP-1, GLP-1MR agent, NN-2211, AC-2993 (exendin-4),
BIM-51077, Aib(8,35)hGLP-1(7,37)NH.sub.2, CJC-1131], amylin
agonists (e.g., pramlintide), phosphotyrosine phosphatase
inhibitors (e.g., sodium vanadate), gluconeogenesis inhibitors
(e.g., glycogen phosphorylase inhibitors, glucose-6-phosphatase
inhibitors, glucagon antagonists), SGLT (sodium-glucose
cotransporter) inhibitors (e.g., dapagliflozin, canagliflozin,
ipragliflozin, BI-10773), 11.beta.-hydroxysteroid dehydrogenase
inhibitors (e.g., BVT-3498), adiponectin or agonists thereof, IKK
inhibitors (e.g., AS-2868), leptin resistance improvers,
somatostatin receptor agonists, glucokinase activators (e.g.,
Ro-28-1675), GIP (glucose-dependent insulinotropic peptide), and
the like.
[0068] Further, the compound represented by the general formula (I)
and/or the pharmaceutically acceptable salts thereof can be used in
such forms used for a supplement or the like that they are enclosed
in a granule, a tablet, a gelatin capsule, or the like.
[0069] Next, the present invention will be specifically described
by way of Examples.
EXAMPLES
[0070] Hereinafter, the present invention will be described in more
details by way of Examples. However, the present invention is not
limited to these Examples.
Intermediate 1
##STR00012##
[0071] Synthesis of
1-{3-[(4-iodophenoxy)methyl]benzoyl}-L-proline
[0072] N,N-dimethylformamide (hereinafter, DMF) (100 mL), potassium
carbonate (1.1 g, 7.8 mmol), and methyl 3-(bromomethyl)benzoate
(1.2 g, 5.2 mmol) were added to 4-iodophenol (1.2 g, 5.5 mmol), and
stirred at room temperature overnight. Ethyl acetate was used as an
extraction solvent, and after washing with water, a 1 N sodium
hydroxide aqueous solution, and saturated brine, the resultant was
dried over magnesium sulfate. The solvent was distilled away under
reduced pressure. To the resulting residue (1.9 g, 5.2 mmol),
tetrahydrofuran (hereinafter, THF) (10 mL), methanol (10 mL), and a
1 N sodium hydroxide aqueous solution (20 mL) were added, and
stirred at room temperature for 4 hours. Ethyl acetate was used as
an extraction solvent, and after washing with a 1 N hydrochloric
acid aqueous solution and saturated brine, the resultant was dried
over magnesium sulfate. The solvent was distilled away under
reduced pressure. To the resulting residue, thionyl chloride (20
mL) was added, and stirred at 40.degree. C. for 1 hour. After that,
the solvent was distilled away under reduced pressure. To the
resulting residue, dichloromethane (10 mL), a 1 N sodium hydroxide
aqueous solution (15 mL), and L-proline (1.1 g, 9.2 mmol) were
added, and stirred at room temperature overnight. The solvent was
distilled away under reduced pressure. The resultant was washed
with a 1 N hydrochloric acid aqueous solution and saturated brine,
and then dried over magnesium sulfate. The solvent was distilled
away under reduced pressure. The resulting residue was washed with
a water-acetonitrile mixture solvent, and then dried to thus obtain
the title compound.
[0073] Yield: 1.5 g (3.3 mmol), percentage yield: 64%
[0074] MS (ESI, m/z) 452 [M+H].sup.+
[0075] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta.1.76-1.99 (m,
3H), 2.18-2.33 (m, 1H), 3.38-3.61 (m, 2H), 4.29-4.43 (m, 1H),
5.08-5.19 (m, 2H), 6.84-6.91 (m, 2H), 7.43-7.50 (m, 2H), 7.51-7.64
(m, 4H), 12.55 (br s, 1H).
Example 1
1-(3-{[4-(5-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoyl)-L-
-proline
Step 1 Synthesis of
1,3-dibromo-2-(2-chloroethoxy)-5-fluorobenzene
[0076] DMF (50 mL), 1-bromo-2-chloroethane (1.0 mL, 12 mmol), and
potassium carbonate (1.7 g, 12 mmol) were added to
2,6-dibromo-4-fluorophenol (3.0 g, 11 mmol), and stirred at
50.degree. C. overnight. Ethyl acetate was used as an extraction
solvent, and after washing with water and saturated brine, and the
resultant was dried over magnesium sulfate. The solvent was
distilled away under reduced pressure. The resulting residue was
purified by silica gel column chromatography to thus obtain the
title compound.
[0077] Yield: 2.5 g (7.4 mmol), percentage yield: 56%
[0078] MS (ESI, m/z) 333 [M+H].sup.+
Step 2 Synthesis of 7-bromo-5-fluoro-2,3-dihydro-1-benzofuran
[0079] To the compound (2.5 g, 7.4 mmol) obtained in Step 1, THF
(50 mL) was added. At -78.degree. C., a 2.6 M
n-butyllithium/n-hexane solution (2.9 mL, 7.5 mmol) was added
thereto and stirred for 1 hour, and then stirred at room
temperature overnight. The solvent was distilled away under reduced
pressure. The resulting residue was subjected to reversed-phase
HPLC using ODS as a filler, and eluted with a mixture solution of
water and acetonitrile, which contained trifluoroacetic acid at
0.1% (v/v). The target fraction was lyophilized to thus obtain the
title compound.
[0080] Yield: 300 mg (1.4 mmol), percentage yield: 19%
[0081] MS (ESI, m/z) 218 [M+H].sup.+
Step 3 Synthesis of
3-{[4-(5-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoic
acid
[0082] To the compound (300 mg, 1.4 mmol) obtained in Step 2,
4-hydroxyphenylboronic acid (230 mg, 1.7 mmol), sodium carbonate
(292 mg, 2.8 mmol), tetrakis(triphenylphosphine)palladium(0)
(hereinafter, Pd(PPh3)4) (catalytic amount), 1,4-dioxane (10 mL),
water (3 mL) were added, and stirred at 90.degree. C. for 2 hours.
The solvent was distilled away under reduced pressure. Ethyl
acetate was used as an extraction solvent, and after washing with a
1 N hydrochloric acid aqueous solution and saturated brine, the
resultant was dried over magnesium sulfate. The solvent was
distilled away under reduced pressure. To the resulting residue,
DMF (10 ml), potassium carbonate (280 mg, 2.8 mmol), and methyl
3-(bromomethyl)benzoate (470 mg, 2.1 mmol) were added, and stirred
at 50.degree. C. overnight. Ethyl acetate was used as an extraction
solvent, and after washing with water, a 1 N sodium hydroxide
aqueous solution, and saturated brine, the resultant was dried over
magnesium sulfate. The solvent was distilled away under reduced
pressure. To the resulting residue, THF (5 mL), methanol (5 mL),
and a 1 N sodium hydroxide aqueous solution (10 mL) were added, and
stirred at room temperature for 4 hours. The solvent was distilled
away under reduced pressure. Ethyl acetate was used as an
extraction solvent, and after washing with a 1 N hydrochloric acid
aqueous solution and saturated brine, the resultant was dried over
magnesium sulfate. After the solvent was distilled away under
reduced pressure, the resulting residue was washed with a
water-acetonitrile mixture solvent, and then dried to thus obtain
the title compound.
[0083] Yield: 150 mg (0.41 mmol), percentage yield: 29%
[0084] MS (ESI, m/z) 365 [M+H].sup.+
Step 4 Synthesis of Compound of Example 1
[0085] To the compound (30 mg, 0.082 mmol) obtained in Step 3,
thionyl chloride (2 mL) was added, and stirred at 40.degree. C. for
1 hour. After that, the solvent was distilled away under reduced
pressure. To the resulting residue, dichloromethane (4 mL), a 1 N
sodium hydroxide aqueous solution (2 mL), and L-proline (30 mg,
0.26 mmol) were added, and stirred at room temperature overnight.
The solvent was distilled away under reduced pressure. The
resultant was washed with a 1 N hydrochloric acid aqueous solution
and saturated brine, and then dried over magnesium sulfate. The
solvent was distilled away under reduced pressure. The resulting
residue was purified by reversed-phase HPLC in the same manner as
in Step 2 to thus obtain the title compound.
[0086] Yield: 7 mg (0.015 mmol), percentage yield: 18%
[0087] MS (ESI, m/z) 462 [M+H].sup.+
Example 2
N-(3-{[4-(5-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}-
benzoyl)-N-methylglycine
[0088] An operation similar to that in Step 4 of Example 1 was
performed using N-methylglycine in place of L-proline to thus
obtain the title compound.
[0089] Yield: 7.5 mg (0.0172 mmol), percentage yield: 20%
[0090] MS (ESI, m/z) 436 [M+H].sup.+
Example 3
1-(3-{[4-(4-fluoro-1-benzofuran-7-yl)phenoxy]methyl}benzoyl)-L-proline
[0091] To the intermediate 1 (32 mg, 0.0710 mmol),
4-fluorobenzofuran-7-boronic acid (15.3 mg, 0.0852 mmol), sodium
carbonate (16.6 mg, 0.156 mmol), and
[1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II)
(hereinafter, Pd(dppf)Cl2) (catalytic amount), 1,4-dioxane (0.75
mL), and water (0.25 mL) were added, and stirred at 105.degree. C.
for 1 hour and a half. The insoluble material was filtered off, and
the resultant was purified by reversed-phase HPLC in the same
manner as in Step 2 of Example 1 to thus obtain the title
compound.
[0092] Yield: 21.3 mg (0.0464 mmol), percentage yield: 65%
[0093] MS (ESI, m/z) 460 [M+H].sup.+
[0094] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.75-2.35 (m,
4H), 3.39-3.63 (m, 2H), 4.32-4.44 (m, 1H), 5.16-5.28 (m, 2H),
7.13-7.21 (m, 4H), 7.46-7.64 (m, 5H), 7.77 (d, J=8.8 Hz, 2H), 8.12
(d, J=2.2 Hz, 1H), 12.53 (br s, 1H).
Example 4
1-(3-{[4-(1,3-benzodioxol-4-yl)phenoxy]methyl}benzoyl)-L-proline
[0095] An operation similar to that in Example 3 was performed
using 2,3-methylenedioxyphenylboronic acid in place of
4-fluorobenzofuran-7-boronic acid to thus obtain the title
compound.
[0096] Yield: 23.5 mg (0.0528 mmol), percentage yield: 66%
[0097] MS (ESI, m/z) 446 [M+H].sup.+
[0098] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta.1.74-2.35 (m,
4H), 3.39-3.63 (m, 2H), 4.31-4.45 (m, 1H), 5.13-5.27 (m, 2H), 6.05
(s, 1H), 6.85-6.94 (m, 2H), 7.06-7.14 (m, 3H), 7.31-7.62 (m, 4H),
7.68 (d, J=8.8 Hz, 2H), 12.54 (br s, 1H).
Example 5
1-(3-{[4-(2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoyl-L-proline
[0099] An operation similar to that in Example 3 was performed
using 2,3-dihydro-1-benzofuran-7-boronic acid in place of
4-fluorobenzofuran-7-boronic acid to thus obtain the title
compound.
[0100] Yield: 29.9 mg (0.0674 mmol), percentage yield: 80%
[0101] MS (ESI, m/z) 444 [M+H].sup.+
[0102] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.73-2.32 (m,
4H), 3.22 (t, J=8.7 Hz, 2H), 3.58 (s, 2H), 4.32-4.44 (m, 1H), 4.55
(t, J=8.7 Hz, 2H), 5.11-5.25 (m, 2H), 6.89 (t, J=7.5 Hz, 1H),
7.03-7.10 (m, 2H), 7.14-7.20 (m, 1H), 7.25 (d, J=7.5 Hz, 1H),
7.30-7.52 (m, 2H), 7.54-7.66 (m, 4H).
Example 6
1-(3-{[4-(1-benzofuran-5-yl)phenoxy]methyl}benzoyl-L-proline
[0103] An operation similar to that in Example 3 was performed
using benzofuran-5-boronic acid in place of
4-fluorobenzofuran-7-boronic acid to thus obtain the title
compound.
[0104] Yield: 16.4 mg (0.0371 mmol), percentage yield: 54%
[0105] MS (ESI, m/z) 442 [M+H].sup.+
[0106] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.76-2.00 (m,
3H), 2.20-2.33 (m, 1H), 3.40-3.62 (m, 2H), 4.32-4.44 (m, 1H),
5.15-5.26 (m, 2H), 6.96-7.00 (m, 1H), 7.09-7.14 (m, 2H), 7.31-7.66
(m, 8H), 7.85 (d, J=1.6 Hz, 1H), 8.01 (d, J=2.2 Hz, 1H), 12.57 (br
s, 1H).
Example 7
1-(3-{[4-(1-benzofuran-7-yl)phenoxy]methylbenzoyl-L-proline
[0107] An operation similar to that in Example 3 was performed
using benzofuran-7-boronic acid in place of
4-fluorobenzofuran-7-boronic acid to thus obtain the title
compound.
[0108] Yield: 20.6 mg (0.0467 mmol), percentage yield: 68%
[0109] MS (ESI, m/z) 442 [M+H].sup.+
[0110] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.73-2.35 (m,
4H), 3.42-3.63 (m, 2H), 4.45-4.32 (m, 1H), 5.17-5.29 (m, 2H), 7.03
(d, J=2.2 Hz, 1H), 7.13-7.23 (m, 2H), 7.25-7.70 (m, 7H), 7.75-7.89
(m, 2H), 8.05 (d, J=2.2 Hz, 1H), 12.59 (br s, 1H).
Example 8
1-(3-{[4-(2-methyl-1-benzofuran-7-yl)phenoxy]methyl}benzoyl-L-proline
Step 1 Synthesis of intermediate (A) 7-bromo-2-methyl-1-benzofuran
and intermediate (B) 8-bromo-2H-chromene
##STR00013##
[0112] DMF (10 ml), propargyl bromide (1.14 m, 15.1 mmol), and
potassium carbonate (4.0 g, 29 mmol) were added to 2-bromophenol
(2.5 g, 14.5 mmol), and stirred at room temperature overnight.
Ethyl acetate was used as an extraction solvent, and after washing
with water and saturated brine, the resultant was dried over
magnesium sulfate. The solvent was distilled away under reduced
pressure. To the resulting residue, N,N-dimethylaniline (5 mL) was
added, and stirred at 250.degree. C. for 20 minutes. After that,
cesium fluoride (690 mg, 3.6 mmol) was added thereto and stirred at
250.degree. C. for 4 hours. The resultant was returned to room
temperature, ethyl acetate was used as an extraction solvent, and a
1 N hydrochloric acid aqueous solution was added. Thereafter, the
insoluble material was filtered off with celite, and the resultant
was washed with saturated brine, and then dried over magnesium
sulfate. The solvent was distilled away under reduced pressure.
Portions of the resulting residue were purified by reversed-phase
HPLC in the same manner as in Step 2 of Example 1 to thus obtain
the title compounds (A) and (B).
Step 2 Synthesis of 4-(2-methyl-1-benzofuran-7-yl)phenol
[0113] To the compound (A) (220 mg, 1.0 mmol) obtained in Step
1,4-hydroxyphenylboronic acid (172 mg, 1.3 mmol), sodium carbonate
(220 mg, 2.1 mmol), Pd(PPh3)4 (catalytic amount), 1,4-dioxane (10
mL), and water (3 mL) were added, and stirred at 90.degree. C. for
2 hours. The solvent was distilled away under reduced pressure.
Ethyl acetate was used as an extraction solvent, and after washing
with a 1 N hydrochloric acid aqueous solution and saturated brine,
the resultant was dried over magnesium sulfate. The solvent was
distilled away under reduced pressure. The resulting residue was
purified by reversed-phase HPLC in the same manner as in Step 2 of
Example 1 to thus obtain the title compound.
[0114] Yield: 200 mg (0.89 mmol), percentage yield: 89%.sup.+
[0115] MS (ESI, m/z) 225 [M+H].sup.+
[0116] .sup.1H NMR (DMSO-d.sub.5, 400 MHz) .delta. 3.30 (s, 3H),
6.62 (s, 1H), 6.88 (d, 2H), 7.23 (dd, 1H), 7.31 (s, 1H), 7.42 (s,
1H), 7.71 (d, 2H), 9.52 (s, 1H).
Step 3 Synthesis of Compound of Example 8
[0117] To the compound (200 mg, 0.89 mmol) obtained in Step 2, DMF
(10 ml), potassium carbonate (280 mg, 2.8 mmol), and methyl
3-(bromomethyl)benzoate (470 mg, 2.1 mmol) were added, and stirred
at 50.degree. C. overnight. Ethyl acetate was used as an extraction
solvent, and after washing with water, a 1N sodium hydroxide
aqueous solution, and saturated brine, the resultant was dried over
magnesium sulfate. The solvent was distilled away under reduced
pressure. To the resulting residue, methanol (4 mL) and a 1 N
sodium hydroxide aqueous solution (2 mL) were added, and stirred at
room temperature for 4 hours. The solvent was distilled away under
reduced pressure. Ethyl acetate was used as an extraction solvent,
and after washing with a 1 N hydrochloric acid aqueous solution and
saturated brine, the resultant was dried over magnesium sulfate.
After the solvent was distilled away under reduced pressure, the
resulting residue was washed with a water-acetonitrile mixture
solvent, and then dried. Thionyl chloride (2 mL) was added to 20 mg
of the resulting residue, and stirred at 40.degree. C. for 1 hour.
After that, the solvent was distilled away under reduced pressure.
To the resulting residue, dichloromethane (4 mL), a 1 N sodium
hydroxide aqueous solution (2 mL), and L-proline (30 mg, 0.26 mmol)
were added, and stirred at room temperature overnight. The solvent
was distilled away under reduced pressure. The resultant was washed
with a 1 N hydrochloric acid aqueous solution and saturated brine,
and then dried over magnesium sulfate. The solvent was distilled
away under reduced pressure. The resulting residue was purified by
reversed-phase HPLC in the same manner as in Step 2 of Example 1 to
thus obtain the title compound.
[0118] Yield: 5 mg (0.010 mmol)
[0119] MS (ESI, m/z) 456 [M+H].sup.+
Example 9
1-(3-{[4-(2H-chromen-7-yl)phenoxy]methyl}benzoyl-L-proline
Step 1 Synthesis of 4-(2H-chromen-7-yl)phenol
[0120] To the compound (B) (120 mg, 0.57 mmol) obtained in Step 1
of Example 8, 4-hydroxyphenylboronic acid (94 mg, 0.68 mmol),
sodium carbonate (121 mg, 1.1 mmol), Pd(PPh3)4 (catalytic amount),
1,4-dioxane (10 mL), and water (3 mL) were added, and stirred at
90.degree. C. for 2 hours. The solvent was distilled away under
reduced pressure. Ethyl acetate was used as an extraction solvent,
and after washing with a 1 N hydrochloric acid aqueous solution and
saturated brine, the resultant was dried over magnesium sulfate.
The solvent was distilled away under reduced pressure. The
resulting residue was purified by reversed-phase HPLC in the same
manner as in Step 2 of Example 1 to thus obtain the title
compound.
[0121] Yield: 90 mg (0.40 mmol), percentage yield: 70%
[0122] MS (ESI, m/z) 225 [M+H].sup.+
[0123] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 4.72 (s, 2H),
5.91 (d, 1H), 6.58 (d, 1H), 6.77 (d, 2H), 6.92-7.23 (m, 2H), 7.23
(d, 2H), 9.42 (s, 1H).
Step 2 Synthesis of Compound of Example 9
[0124] To the compound (90 mg, 0.40 mmol) obtained in Step 1, DMF
(10 ml), potassium carbonate (138 mg, 0.60 mmol), and methyl
3-(bromomethyl)benzoate (110 mg, 0.60 mmol) were added, and stirred
at 50.degree. C. overnight. Ethyl acetate was used as an extraction
solvent, and after washing with water, a 1 N sodium hydroxide
aqueous solution, and saturated brine, the resultant was dried over
magnesium sulfate. The solvent was distilled away under reduced
pressure. To the resulting residue, methanol (4 mL) and a 1N sodium
hydroxide aqueous solution (2 mL) were added, and stirred at room
temperature for 4 hours. The solvent was distilled away under
reduced pressure. Ethyl acetate was used as an extraction solvent,
and after washing with a 1 N hydrochloric acid aqueous solution and
saturated brine, the resultant was dried over magnesium sulfate.
After the solvent was distilled away under reduced pressure, the
resulting residue was washed with a water-acetonitrile mixture
solvent, and then dried. Thionyl chloride (2 mL) was added to 10 mg
of the resulting residue, and stirred at 40.degree. C. for 1 hour.
After that, the solvent was distilled away under reduced pressure.
To the resulting residue, dichloromethane (4 mL), a 1 N sodium
hydroxide aqueous solution (2 mL), and L-proline (30 mg, 0.26 mmol)
were added, and stirred at room temperature overnight. The solvent
was distilled away under reduced pressure. The resultant was washed
with a 1 N hydrochloric acid aqueous solution and saturated brine,
and then dried over magnesium sulfate. The solvent was distilled
away under reduced pressure. The resulting residue was purified by
reversed-phase HPLC in the same manner as in Step 2 of Example 1 to
thus obtain the title compound.
[0125] Yield: 3 mg (0.007 mmol)
[0126] MS (ESI, m/z) 456 [M+H].sup.+
Example 10
1-(3-{[4-(4-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoyl-L--
proline
Step 1 Synthesis of
4-(4-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenol
[0127] 1,4-Dioxane (12 mL) and water (4 mL) were added to
4-bromophenol (315 mg, 1.82 mmol), 4-fluorobenzofuran-7-boronic
acid (360 mg, 2.00 mmol), sodium carbonate (405 mg, 3.82 mmol), and
Pd(dppf)Cl2 (catalytic amount), and stirred at 100.degree. C. for 2
hours and a half. The reaction solution was concentrated under
reduced pressure. To the residue, ethyl acetate and 1 N
hydrochloric acid were added and stirred. After that, the insoluble
material was filtered off, and extraction was performed with ethyl
acetate. The organic phase was washed with a saturated aqueous
sodium hydrogen carbonate solution and saturated brine, and then
dried over anhydrous magnesium sulfate. The solvent was distilled
away under reduced pressure. The resulting residue was purified by
silica gel chromatography (hexane/ethyl acetate). To the resulting
solid (352 mg, 1.54 mmol), ammonium acetate (59 mg, 0.770 mmol) was
added. After dissolved in methanol (35 mL), the reaction was
carried out using a continuous hydrogenation reaction apparatus
(10% palladium-carbon, 50 bar, 50.degree. C., 1 mL/minute, once).
The reaction solution was concentrated under reduced pressure. The
resulting residue was dissolved in ethanol (35 mL) and chloroform
(1 mL), and reacted using a continuous hydrogenation reaction
apparatus (10% palladium-carbon, 50 bar, 60.degree. C., 1
mL/minute, 3 times). The reaction solution was concentrated under
reduced pressure. The resulting residue was purified by
reversed-phase HPLC in the same manner as in Step 2 of Example 1 to
thus obtain the title compound.
[0128] Yield: 45 mg (0.195 mmol), percentage yield: 11%
[0129] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 3.30 (t, J=8.8 Hz,
2H), 4.67 (t, J=8.8 Hz, 2H), 6.63 (t, J=8.4 Hz, 1H), 6.84-6.91 (m,
2H), 7.18 (dd, J=8.6, 5.7 Hz, 1H), 7.48-7.55 (m, 2H).
Step 2 Synthesis of
3-{[4-(4-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoate
methyl
[0130] To 45 mg (0.195 mmol) of the compound obtained in Step 1,
methyl 3-(bromomethyl)benzoate (67 mg, 0.293 mmol), potassium
carbonate (54 mg, 0.390 mmol), and DMF (2 mL) was added, and
stirred at room temperature for 4.5 hours. The mixture was
concentrated under reduced pressure. The resulting residue was
diluted with ethyl acetate, washed with 1 N hydrochloric acid, a
saturated aqueous sodium hydrogen carbonate solution, and saturated
brine, and then dried over anhydrous magnesium sulfate. The solvent
was distilled away under reduced pressure. The resulting residue
was purified by silica gel chromatography (hexane/ethyl acetate) to
thus obtain the title compound.
[0131] Yield: 73.5 mg (0.194 mmol), percentage yield:
quantitative
[0132] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 3.30 (t, J=8.8 Hz,
2H), 3.93 (s, 3H), 4.67 (t, J=8.8 Hz, 2H), 5.14 (s, 2H), 6.64 (t,
J=8.4 Hz, 1H), 6.99-7.05 (m, 2H), 7.16-7.21 (m, 1H), 7.47 (t, J=7.7
Hz, 1H), 7.54-7.59 (m, 2H), 7.63-7.68 (m, 1H), 7.98-8.03 (m, 1H),
8.10-8.15 (m, 1H).
Step 3 Synthesis of
3-{[4-(4-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoic
acid
[0133] To the compound (71.1 mg, 0.188 mmol) obtained in Step 2,
methanol (1 mL) and THF (1 mL) were added, and a 1 N lithium
hydroxide aqueous solution (0.5 mL) was added thereto under
ice-cooling. After the mixture was stirred at room temperature for
7 hours, 1 N hydrochloric acid (1 mL) was added thereto. The
precipitated solid was collected by filtration and dried to thus
obtain the title compound.
[0134] Yield: 61.9 mg (0.170 mmol), percentage yield: 90%
[0135] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 3.27 (t, J=8.8
Hz, 2H), 4.65 (t, J=8.8 Hz, 2H), 5.23 (s, 2H), 6.75 (t, J=8.5 Hz,
1H), 7.04-7.10 (m, 2H), 7.30 (dd, J=8.6, 5.8 Hz, 1H), 7.51-7.60 (m,
3H), 7.69-7.74 (m, 1H), 7.88-7.93 (m, 1H), 8.02-8.06 (m, 1H), 13.01
(br s, 1H).
Step 4 Synthesis of Compound of Example 10
[0136] To the compound (30.0 mg, 0.0823 mmol) of Step 3, thionyl
chloride (1 mL) and DMF (catalytic amount) were added, and stirred
at 50.degree. C. for 30 minutes. The reaction solution was
concentrated under reduced pressure. To the resulting residue,
ethyl acetate was added to suspend the residue therein, and the
suspension was concentrated under reduced pressure. The resulting
residue was dissolved in dichloromethane (1 mL), and added dropwise
under ice-cooling to a mixture solution of L-proline (28.4 mL,
0.247 mmol) in a dichloromethane (1 mL)-1 N sodium hydroxide
aqueous solution (1 mL).
After the mixture was stirred at room temperature for 1 hour, 1 N
hydrochloric acid (1 mL) was added thereto. The mixture was
concentrated under reduced pressure. The resulting residue was
purified by reversed-phase HPLC in the same manner as in Step 2 of
Example 1 to thus obtain the title compound.
[0137] Yield: 28.6 mg (0.0620 mmol), percentage yield: 75%
[0138] MS (ESI, m/z) 462 [M+H].sup.+
[0139] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.75-1.97 (m,
3H), 2.19-2.34 (m, 1H), 3.27 (t, J=8.7 Hz, 2H), 3.39-3.53 (m, 2H),
4.30-4.44 (m, 1H), 4.65 (t, J=8.7 Hz, 2H), 5.11-5.25 (m, 2H), 6.75
(t, J=8.5 Hz, 1H), 7.07 (d, J=8.9 Hz, 2H), 7.26-7.52 (m, 4H),
7.54-7.62 (m, 3H).
Intermediate 2
##STR00014##
[0140] Synthesis of
1-(3-{[4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy]methyl}benz-
oyl)-L-proline
[0141] DMF (125 mL) was added to
4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenol (8.46 g, 38
mmol), methyl 3-(bromomethyl)benzoate (8.8 g, 38 mmol), and
potassium carbonate (10.6 g, 77 mmol), and stirred at room
temperature overnight. The resultant was diluted with ethyl
acetate, washed with water and saturated brine, and then dried over
anhydrous magnesium sulfate. The solvent was distilled away under
reduced pressure. To the resulting residue, methanol (150 mL),
water (30 mL), and lithium hydroxide (4.8 g, 114 mmol) were added,
and stirred at room temperature overnight. After the solvent was
distilled away under reduced pressure, the resultant was diluted
with ethyl acetate, then washed with 1 N hydrochloric acid and
saturated brine, and dried over anhydrous magnesium sulfate. The
solvent was distilled away under reduced pressure. To the resulting
residue, dichloromethane (150 mL),
1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride
(hereinafter, WSC) (7.34 g, 38.2 mmol), tert-butyl L-prolinate
(7.95 g, 38.2 mmol), and triethylamine (9.65 mL, 69.4 mmol) were
added, and stirred at room temperature overnight. The resultant was
washed with water, 1 N hydrochloric acid, 1 N sodium hydroxide, and
saturated brine, and then dried over anhydrous magnesium sulfate.
The solvent was distilled away under reduced pressure, and the
residue was purified by silica gel chromatography (hexane/ethyl
acetate). To the resulting compound, TFA (150 mL) was added, and
stirred at room temperature for 3 hours. The solvent was distilled
away under reduced pressure to thus obtain the title compound.
[0142] Yield: 15.1 g (33.5 mmol), percentage yield: 88%
[0143] MS (ESI, m/z) 452 [M+H].sup.+
Intermediate 3
##STR00015##
[0144] Synthesis of tert-butyl
1-{3-[(4-iodophenoxy)methyl]benzoyl}-L-prolinate
[0145] An operation similar to that in the synthesis of the
intermediate 1 was performed using L-proline-tert-butyl ester in
place of L-proline to thus obtain the title compound.
[0146] Yield: 8.17 g (16.1 mmol), percentage yield: 46%
[0147] MS (ESI, m/z) 508 [M+H].sup.+
Example 11
1-(3-{[4-(6-fluoro-2H-chromen-7-yl)phenoxy]methyl}benzoyl)-L-proline
[0148] DMF (10 ml), propargyl bromide (0.83 ml, 11.0 mmol), and
potassium carbonate (2.87 g, 20.8 mmol) were added to
2-bromo-4-fluorophenol (1.16 mL, 10.4 mmol), and stirred at room
temperature overnight. Ethyl acetate was used as an extraction
solvent, and after washing with water and saturated brine, the
resultant was dried over magnesium sulfate. The solvent was
distilled away under reduced pressure. To the resulting residue,
N,N-dimethylaniline (1 mL) was added, and stirred at 230.degree. C.
for 20 minutes. After that, cesium fluoride (165 mg, 1.09 mmol) was
added thereto and stirred at 230.degree. C. for 4 hours. The
resultant was returned to room temperature, ethyl acetate was used
as an extraction solvent, and a 1 N hydrochloric acid aqueous
solution was added. Thereafter, the insoluble material was filtered
off with celite, and the resultant was washed with saturated brine,
and then dried over magnesium sulfate. The solvent was distilled
away under reduced pressure. A portion of the resulting residue was
purified by reversed-phase HPLC in the same manner as in Step 2 of
Example 1. To the resulting compound (690 mg, 3.0 mmol),
4-hydroxyphenylboronic acid (500 mg, 3.6 mmol), sodium carbonate
(640 mg, 6.0 mmol), Pd(PPh3)4 (catalytic amount), 1,4-dioxane (10
mL), and water (3 mL) were added, and stirred at 90.degree. C. for
2 hours. The solvent was distilled away under reduced pressure.
Ethyl acetate was used as an extraction solvent, and after washing
with a 1 N hydrochloric acid aqueous solution and saturated brine,
the resultant was dried over magnesium sulfate. The solvent was
distilled away under reduced pressure. To the resulting residue,
DMF (10 ml), potassium carbonate (830 mg, 6.0 mmol), and methyl
3-(bromomethyl)benzoate (825 mg, 3.6 mmol) were added, and stirred
at 50.degree. C. overnight. Ethyl acetate was used as an extraction
solvent, and after washing with water, a 1 N sodium hydroxide
aqueous solution, and saturated brine, the resultant was dried over
magnesium sulfate. The solvent was distilled away under reduced
pressure. To the resulting residue, methanol (4 mL) and a 1 N
sodium hydroxide aqueous solution (2 mL) were added, and stirred at
room temperature for 4 hours. The solvent was distilled away under
reduced pressure. Ethyl acetate was used as an extraction solvent,
and after washing with a 1 N hydrochloric acid aqueous solution and
saturated brine, the resultant was dried over magnesium sulfate.
After the solvent was distilled away under reduced pressure, the
resulting residue was washed with a water-acetonitrile mixture
solvent, and then dried. To the resulting residue, thionyl chloride
(2 mL) was added, and stirred at 40.degree. C. for 1 hour. After
that, the solvent was distilled away under reduced pressure. To the
resulting residue, dichloromethane (4 mL), a 1 N sodium hydroxide
aqueous solution (2 mL), and L-proline (30 mg, 0.26 mmol) were
added, and stirred at room temperature overnight. The solvent was
distilled away under reduced pressure. The resultant was washed
with a 1 N hydrochloric acid aqueous solution and saturated brine,
and then dried over magnesium sulfate. The solvent was distilled
away under reduced pressure. The resulting residue was purified by
reversed-phase HPLC in the same manner as in Step 2 of Example 1 to
thus obtain the title compound.
[0149] Yield: 10 mg (0.021 mmol)
[0150] MS (ESI, m/z) 474 [M+H].sup.+
Example 12
1-(3-{[4-(5-fluoro-1-benzofuran-7-yl)phenoxy]methyl}benzoyl)-L-proline
Step 1 Synthesis of 7-bromo-5-fluoro-1-benzofuran
[0151] Bromoacetaldehyde dimethyl acetal (1.17 mL, 10.0 mmol) and a
catalytic amount of sodium iodide were added to a solution (25 mL)
of 2-bromo-4-fluorophenol (0.548 mL, 5.00 mmol) and potassium
carbonate (1.38 g, 10.0 mmol) in DMF, and stirred at 80.degree. C.
overnight. The solvent was distilled away under reduced pressure.
The residue was diluted with ethyl acetate, washed with water and
saturated brine, and then dried over anhydrous magnesium sulfate.
The solvent was distilled away under reduced pressure. The
resulting residue was purified by silica gel chromatography
(hexane/ethyl acetate). The resulting compound (1.12 g, 4.01 mmol)
was dissolved in chlorobenzene (5 mL), and added at 120.degree. C.
to a solution (5 mL) of a polyphosphoric acid (1.5 g) in
chlorobenzene. After the reaction solution was stirred at
120.degree. C. overnight, the solvent was distilled away under
reduced pressure. To the residue, ethyl acetate and water were
added. Under ice-cooling, this was poured into a 1 N sodium
hydroxide aqueous solution, and stirred. After that, the insoluble
material was filtered off, and extraction was performed with ethyl
acetate. The organic phase was washed with saturated brine, and
then dried over anhydrous magnesium sulfate. The solvent was
distilled away under reduced pressure. The resulting residue was
purified by silica gel chromatography (hexane) to thus obtain the
title compound.
[0152] Yield: 215 mg (1.00 mmol), percentage yield: 200
[0153] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 6.80-6.84 (m, 1H),
7.20-7.25 (m, 2H), 7.71-7.74 (m, 1H).
Step 2 Synthesis of 4-(5-fluoro-1-benzofuran-7-yl)phenol
[0154] To the compound (210 mg, 0.977 mmol) of Step 1,
4-hydroxyphenylboronic acid (162 mg, 1.17 mmol), sodium carbonate
(228 mg, 2.15 mmol), and Pd(dppf)Cl2 (catalytic amount),
1,4-dioxane (1.2 mL) and water (0.4 mL) were added, and stirred at
100.degree. C. for 2 hours. The reaction solution was concentrated
under reduced pressure. To the residue, ethyl acetate and 1 N
hydrochloric acid were added and stirred. After that, the insoluble
material was filtered off, and extraction was performed with ethyl
acetate. The organic phase was washed with saturated brine, and
then dried over anhydrous magnesium sulfate. The solvent was
distilled away under reduced pressure. The resulting residue was
purified by silica gel chromatography (hexane/ethyl acetate) to
thus obtain the title compound.
[0155] Yield: 173 mg (0.758 mmol), percentage yield: 76%
[0156] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 4.95 (s, 1H), 6.79
(d, J=2.2 Hz, 1H), 6.94-7.00 (m, 2H), 7.12-7.21 (m, 2H), 7.71 (d,
J=2.2 Hz, 1H), 7.73-7.78 (m, 2H).
Step 3 Synthesis of
3-{[4-(5-fluoro-1-benzofuran-7-yl)phenoxy]methyl}benzoic acid
[0157] To the compound (170 mg, 0.745 mmol) of Step 2, methyl
3-(bromomethyl)benzoate (256 mg, 1.12 mmol), and potassium
carbonate (206 mg, 1.49 mmol), DMF (4 mL) was added, and stirred
overnight. The solvent was distilled away under reduced pressure,
and after diluted with ethyl acetate, the resultant was washed with
the water and saturated brine, and then dried over anhydrous
magnesium sulfate. The solvent was distilled away under reduced
pressure. The resulting residue was purified by silica gel
chromatography (hexane/ethyl acetate). To the resulting compound
(267 mg, 0.709 mmol), methanol (5 mL) and THF (5 mL) were added. A
1 N lithium hydroxide aqueous solution (1.5 mL) was added thereto
under ice-cooling, and stirred at room temperature overnight. After
a 1 N hydrochloric acid aqueous solution (2 mL) were added thereto
under ice-cooling, the solid obtained by concentrating the solvent
was collected by filtration to thus obtain the title compound.
[0158] Yield: 241 mg (0.665 mmol), percentage yield: 94%
[0159] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 5.29 (s, 2H),
7.03 (d, J=2.2 Hz, 1H), 7.17-7.22 (m, 2H), 7.34-7.45 (m, 2H), 7.55
(t, J=7.7 Hz, 1H), 7.74 (d, J=7.9 Hz, 1H), 7.84-7.90 (m, 2H),
7.90-7.94 (m, 1H), 8.07 (s, 1H), 8.13 (d, J=2.2 Hz, 1H), 13.05 (br
s, 1H).
Step 4 Synthesis of Compound of Example 12
[0160] An operation similar to that in Step 4 of Example 10 was
performed using the compound (35.1 mg, 0.0971 mmol) of Step 3 in
place of
3-{[4-(4-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoic
acid to thus obtain the title compound.
[0161] Yield: 26.8 mg (0.0583 mmol), percentage yield: 60%
[0162] MS (ESI, m/z) 460 [M+H].sup.+
[0163] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.74-2.36 (m,
4H), 3.40-3.63 (m, 2H), 4.32-4.45 (m, 1H), 5.16-5.32 (m, 2H), 7.03
(d, J=2.2 Hz, 1H), 7.16-7.22 (m, 2H), 7.33-7.65 (m, 6H), 7.84-7.90
(m, 2H), 8.13 (d, J=2.1 Hz, 1H).
Example 13
1-(3-{[4-(7-fluoro-1,3-benzodioxol-4-yl)phenoxy]methyl}benzoyl)-L-proline
[0164] An operation similar to that in Example 3 was performed
using 4-fluoro-2,3-methylenedioxyphenylboronic acid (17.7 mg,
0.0960 mmol) in place of 4-fluorobenzofuran-7-boronic acid to thus
obtain the title compound.
[0165] Yield: 22.9 mg (0.0494 mmol), percentage yield: 62%
[0166] MS (ESI, m/z) 464 [M+H].sup.+
[0167] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.75-2.34 (m,
4H), 3.37-3.62 (m, 2H), 4.30-4.45 (m, 1H), 5.11-5.26 (m, 2H), 6.17
(s, 2H), 6.88-6.95 (m, 1H), 7.07-7.14 (m, 3H), 7.31-7.61 (m, 4H),
7.64 (d, J=8.8 Hz, 2H).
Example 14
1-(3-{[4-(7-fluoro-1-benzofuran-5-yl)phenoxy]methyl}benzoyl)-L-proline
Step 1 Synthesis of 5-bromo-7-fluoro-1-benzofuran
[0168] An operation similar to that in Step 1 of Example 12 was
performed using 4-bromo-2-fluorophenol (0.876 mL, 8.00 mmol) in
place of 2-bromo-4-fluorophenol to thus obtain the title
compound.
[0169] Yield: 242 mg (1.13 mmol), percentage yield: 14%
Step 2 Synthesis of 4-(7-fluoro-1-benzofuran-5-yl)phenol
[0170] An operation similar to that in Step 2 of Example 12 was
performed using the compound (242 mg, 1.13 mmol) of Step 1 in place
of 7-bromo-5-fluoro-1-benzofuran to thus obtain the title
compound.
[0171] Yield: 239 mg (1.05 mmol), percentage yield: 93%
[0172] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 4.85 (s, 1H), 6.83
(dd, J=2.9, 2.1 Hz, 1H), 6.89-6.94 (m, 2H), 7.22 (dd, J=12.0, 1.4
Hz, 1H), 7.44-7.51 (m, 3H), 7.67 (d, J=2.1 Hz, 1H).
Step 3 Synthesis of
3-{[4-(7-fluoro-1-benzofuran-5-yl)phenoxy]methyl}benzoic acid
[0173] An operation similar to that in Step 3 of Example 12 was
performed using the compound (236 mg, 1.03 mmol) of Step 2 in place
of 4-(5-fluoro-1-benzofuran-7-yl)phenol to thus obtain the title
compound.
[0174] Yield: 333 mg (0.919 mmol), percentage yield: 89%
[0175] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 5.26 (s, 2H),
7.08-7.16 (m, 3H), 7.47-7.57 (m, 2H), 7.64-7.69 (m, 2H), 7.70-7.75
(m, 2H), 7.89-7.94 (m, 1H), 8.06 (s, 1H), 8.12 (d, J=2.1 Hz, 1H),
13.04 (br s, 1H).
Step 4 Synthesis of Compound of Example 14
[0176] An operation similar to that in Step 4 of Example 10 was
performed using the compound (36.2 mg, 0.100 mmol) of Step 3 in
place of
3-{[4-(4-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoic
acid to thus obtain the title compound.
[0177] Yield: 21.1 mg (0.0459 mmol), percentage yield: 46%
[0178] MS (ESI, m/z) 460 [M+H].sup.+
[0179] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.73-2.31 (m,
5H), 3.42-3.65 (m, 2H), 4.30-4.46 (m, 1H), 5.14-5.29 (m, 2H),
7.06-7.16 (m, 3H), 7.31-7.54 (m, 4H), 7.59 (dd, J=9.1, 4.2 Hz, 2H),
7.66 (d, J=8.7 Hz, 2H), 7.72 (d, J=1.5 Hz, 1H), 8.11 (d, J=2.1 Hz,
1H), 12.59 (br s, 1H).
Example 15
1-(3-{[4-(4,5-difluoro-1-benzofuran-7-yl)phenoxy]methyl}benzoyl)-L-proline
Step 1 Synthesis of 7-bromo-4,5-difluoro-1-benzofuran
[0180] An operation similar to that in Step 1 of Example 12 was
performed using 2-bromo-4,5-difluorophenol (2.51 g, 12.0 mmol) in
place of 2-bromo-4-fluorophenol to thus obtain the title
compound.
[0181] Yield: 572 mg (2.45 mmol), percentage yield: 20%
[0182] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 6.98 (d, J=2.2 Hz,
1H), 7.31-7.38 (m, 1H), 7.69 (d, J=2.2 Hz, 1H).
Step 2 Synthesis of Compound of Example 15
[0183] To the intermediate 2 (36.1 mg, 0.0800 mmol), the compound
(22.4 mg, 0.0960 mmol) of Step 1, sodium carbonate (18.7 mg, 0.176
mmol), and Pd(dppf)Cl2 (catalytic amount), 1,4-dioxane (0.75 mL)
and water (0.25 mL) were added, and stirred at 100.degree. C. for 2
hours. After the insoluble material was filtered off, the resultant
was purified by reversed-phase HPLC in the same manner as in Step 2
of Example 1 to thus obtain the title compound.
[0184] Yield: 21.1 mg (0.0459 mmol), percentage yield: 46%
[0185] MS (ESI, m/z) 460 [M+H].sup.+
[0186] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.81-2.05 (m,
3H), 2.26-2.38 (m, 1H), 3.46-3.68 (m, 2H), 4.38-4.50 (m, 2H),
5.23-5.36 (m, 2H), 7.21-7.26 (m, 2H), 7.28 (d, J=2.2 Hz, 1H),
7.38-7.70 (m, 5H), 7.85-7.91 (m, 2H), 8.24 (d, J=2.2 Hz, 1H).
Example 16
1-(3-{[4-(6,7-difluoro-1-benzofuran-5-yl)phenoxy]methyl}benzoyl)-L-proline
Step 1 Synthesis of 5-bromo-6,7-difluoro-1-benzofuran
[0187] An operation similar to that in Step 1 of Example 12 was
performed using 4-bromo-2,3-difluorophenol (2.09 g, 10.0 mmol) in
place of 2-bromo-4-fluorophenol to thus obtain the title
compound.
[0188] Yield: 774 mg (3.32 mmol), percentage yield: 33%
[0189] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 6.75 (dd, J=2.8,
2.2 Hz, 1H), 7.54 (dd, J=5.7, 2.0 Hz, 1H), 7.69 (d, J=2.2 Hz,
1H).
Step 2 Synthesis of Compound of Example 16
[0190] An operation similar to that in Step 2 of Example 15 was
performed using the compound (18.6 mg, 0.0800 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0191] Yield: 20.3 mg (0.0425 mmol), percentage yield: 53%
[0192] MS (ESI, m/z) 460 [M+H].sup.+
[0193] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.73-2.36 (m,
4H), 3.39-3.66 (m, 2H), 4.32-4.45 (m, 1H), 5.16-5.28 (m, 2H),
7.06-7.12 (m, 1H), 7.16 (d, J=8.8 Hz, 2H), 7.30-7.66 (m, 7H), 8.16
(d, J=2.1 Hz, 1H), 12.55 (br s, 1H).
Example 17
1-(3-{[4-(4,7-difluoro-1-benzofuran-5-yl)phenoxy]methyl}benzoyl)-L-proline
Step 1 Synthesis of 5-bromo-4,7-difluoro-1-benzofuran
[0194] An operation similar to that in Step 1 of Example 12 was
performed using 4-bromo-2,5-difluorophenol (2.09 g, 10.0 mmol) in
place of 2-bromo-4-fluorophenol to thus obtain the title
compound.
[0195] Yield: 1.48 g (6.35 mmol), percentage yield: 64%
[0196] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 6.80 (dd, J=3.4,
1.5 Hz, 1H), 7.27-7.33 (m, 1H), 7.71 (d, J=2.1 Hz, 1H).
Step 2 Synthesis of Compound of Example 17
[0197] An operation similar to that in Step 2 of Example 15 was
performed using the compound (18.6 mg, 0.0800 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0198] Yield: 24.8 mg (0.0519 mmol), percentage yield: 65%
[0199] MS (ESI, m/z) 478 [M+H].sup.+
[0200] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.79-2.35 (m,
4H), 3.40-3.61 (m, 2H), 4.32-4.46 (m, 1H), 5.17-5.29 (m, 2H),
7.10-7.19 (m, 2H), 7.23 (t, J=2.5 Hz, 1H), 7.31-7.65 (m, 7H), 8.19
(d, J=2.2 Hz, 1H), 12.53 (br s, 1H).
Example 18
1-(3-{[4-(5,6-difluoro-2H-chromen-7-yl)phenoxy]methyl}benzoyl)-L-proline
[0201] 3-Bromopropionic acid (2.0 g, 13.2 mmol), sodium hydroxide
(960 mg, 23.9 mmol), and water (20 mL) were added to
2-bromo-4,5-difluorophenol (2.5 g, 11.96 mmol), and stirred at
100.degree. C. for 1 hour. Ethyl acetate was used as an extraction
solvent, and after washing with a 1 N hydrochloric acid aqueous
solution and saturated brine, the resultant was dried over
magnesium sulfate. The solvent was distilled away under reduced
pressure. To the resulting residue, 5 g of polyphosphoric acid was
added, and stirred at 100.degree. C. for 1 hour. After cooling,
ethyl acetate was used as an extraction solvent, and the resultant
was washed with a 1 N sodium hydroxide aqueous solution, and
saturated brine, and then dried over magnesium sulfate. The solvent
was distilled away under reduced pressure. Of the resulting
residue, 200 mg was dissolved in methanol (20 mL), sodium
borohydride (35 mg, 1.91 mmol) was added thereto, and stirred at
room temperature for 1 hour. The solvent was distilled away under
reduced pressure. Ethyl acetate was used as an extraction solvent,
and after was washing with water and saturated brine, the resultant
was dried over magnesium sulfate. The solvent was distilled away
under reduced pressure. To the resulting residue, p-TsOH (catalytic
amount) and toluene (20 mL) were added, and stirred at 90.degree.
C. for 2 hours. Ethyl acetate was used as an extraction solvent,
and after washing with water and saturated brine, the resultant was
dried over magnesium sulfate. The solvent was distilled away under
reduced pressure. An operation similar to that in Example 9 was
performed on the resulting compound to thus obtain the title
compound.
[0202] Yield: 1.4 mg (0.029 mmol)
[0203] MS (ESI, m/z) 492 [M+H].sup.+
Example 19
1-(3-{[4-(4,5-difluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoy-
l)-L-proline
Step 1 Synthesis of 4-(4,5-difluoro-1-benzofuran-7-yl)phenol
[0204] An operation similar to that in Step 2 of Example 12 was
performed using 7-bromo-4,5-difluoro-1-benzofuran (501 mg, 2.15
mmol) in place of 7-bromo-5-fluoro-1-benzofuran to thus obtain the
title compound.
[0205] Yield: 568 mg (2.31 mmol), percentage yield:
quantitative
Step 2 Synthesis of
4-(4,5-difluoro-2,3-dihydro-1-benzofuran-7-yl)phenol
[0206] The compound (568 mg, 2.31 mmol) of Step 1 was dissolved in
acetic acid (25 mL), and a catalytic amount of 10% palladium-carbon
was added thereto, and stirred in a hydrogen atmosphere of 4 atm
overnight. The insoluble material was filtered off, and the solvent
was distilled away under reduced pressure. The resulting residue
was purified by reversed-phase HPLC in the same manner as in Step 2
of Example 1 to thus obtain the title compound.
[0207] Yield: 336 mg (1.35 mmol), percentage yield: 59%
[0208] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 3.32 (td, J=8.8,
0.8 Hz, 2H), 4.67 (t, J=8.8 Hz, 2H), 4.84 (br s, 1H), 6.85-6.91 (m,
2H), 7.04 (dd, J=11.8, 8.0 Hz, 1H), 7.48-7.54 (m, 2H).
Step 3 Synthesis of
3-{[4-(4,5-difluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoic
acid
[0209] An operation similar to that in Step 3 of Example 12 was
performed using the compound (333 mg, 1.34 mmol) of Step 2 in place
of 4-(5-fluoro-1-benzofuran-7-yl)phenol to thus obtain the title
compound.
[0210] Yield: 500 mg (1.31 mmol), percentage yield: 98%
[0211] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 3.27-3.38 (m,
2H), 4.67 (t, J=8.7 Hz, 2H), 5.23 (s, 2H), 7.05-7.11 (m, 2H), 7.37
(dd, J=12.3, 8.2 Hz, 1H), 7.54 (t, J=7.7 Hz, 1H), 7.60-7.66 (m,
2H), 7.71 (d, J=7.7 Hz, 1H), 7.91 (d, J=7.7 Hz, 1H), 8.04 (s, 1H),
13.03 (s, 1H).
Step 4 Synthesis of Compound of Example 19
[0212] An operation similar to that in Step 4 of Example 10 was
performed using the compound (95.6 mg, 0.250 mmol) of Step 3 in
place of
3-{[4-(4-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoic
acid to thus obtain the title compound.
[0213] Yield: 78.8 mg (0.164 mmol), percentage yield: 66%
[0214] MS (ESI, m/z) 480 [M+H].sup.+
[0215] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.75-2.33 (m,
4H), 3.33 (t, J=8.7 Hz, 2H), 3.37-3.63 (m, 2H), 4.30-4.44 (m, 1H),
4.67 (t, J=8.7 Hz, 2H), 5.11-5.25 (m, 2H), 7.04-7.12 (m, 2H),
7.29-7.69 (m, 7H), 12.62 (br s, 1H).
Example 20
1-(3-{[4-(4,6-difluoro-1-benzofuran-7-yl)phenoxy]methyl}benzoyl)-L-proline
Step 1 Synthesis of 7-bromo-4,6-difluoro-1-benzofuran
[0216] An operation similar to that in Step 1 of Example 12 was
performed using 2-bromo-3,5-difluorophenol (915 mg, 4.38 mmol) in
place of 2-bromo-4-fluorophenol to thus obtain the title
compound.
[0217] Yield: 716 mg (3.07 mmol), percentage yield: 70%
[0218] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 6.87 (t, J=9.2 Hz,
1H), 6.92 (d, J=2.2 Hz, 1H), 7.67 (d, J=2.2 Hz, 1H).
Step 2 Synthesis of Compound of Example 20
[0219] An operation similar to that in Step 2 of Example 15 was
performed using the compound (18.6 mg, 0.0800 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0220] Yield: 13.0 mg (0.0272 mmol), percentage yield: 34%
[0221] MS (ESI, m/z) 478 [M+H].sup.+
[0222] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.74-2.33 (m,
4H), 3.40-3.60 (m, 2H), 4.29-4.44 (m, 1H), 5.23 (d, J=27.8 Hz, 2H),
7.14 (d, J=2.2 Hz, 1H), 7.16-7.21 (m, 2H), 7.27-7.64 (m, 7H), 8.10
(d, J=2.2 Hz, 1H), 12.55 (br s, 1H).
Example 21
1-(3-{[4-(4,5-difluoro-3-methyl-1-benzofuran-7-yl)phenoxy]methyl}benzoyl)--
L-proline
Step 1 Synthesis of 7-bromo-4,5-difluoro-3-methyl-1-benzofuran
[0223] An operation similar to that in Step 1 of Example 12 was
performed using 2-bromo-4,5-difluorophenol (1.05 g, 5.00 mmol) in
place of 2-bromo-4-fluorophenol, and bromoacetone (0.504 mL, 6.00
mmol) in place of bromoacetaldehyde dimethyl acetal to thus obtain
the title compound.
[0224] Yield: 150 mg (0.607 mmol), percentage yield: 12%
[0225] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 2.35 (d, J=0.9 Hz,
3H), 7.27-7.32 (m, 1H), 7.43-7.40 (m, 1H).
Step 2 Synthesis of Compound of Example 21
[0226] An operation similar to that in Step 2 of Example 15 was
performed using the compound (24.7 mg, 0.100 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0227] Yield: 31.2 mg (0.0635 mmol), percentage yield: 64%
[0228] MS (ESI, m/z) 492 [M+H].sup.+
[0229] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.74-2.01 (m,
3H), 2.20-2.31 (m, 1H), 2.34 (s, 3H), 3.44-3.62 (m, 2H), 4.31-4.44
(m, 1H), 5.15-5.28 (m, 2H), 7.13-7.21 (m, 2H), 7.30-7.64 (m, 5H),
7.76-7.83 (m, 2H), 7.91 (s, 1H), 12.52 (br s, 1H).
Example 22
1-(3-{[4-(5-fluoro-2,2-dimethyl-2,3-dihydro-1-benzofuran-7-yl)phenoxy]meth-
yl}benzoyl)-L-proline
Step 1 Synthesis of
2-bromo-4-fluoro-1-[(2-methylprop-2-en-1-yl)oxy]benzene
[0230] Potassium carbonate (829 mg, 6.00 mmol) and
3-chloro-2-methyl-1-propene (0.591 mL, 6.00 mmol) were added to a
solution (25 mL) of 2-bromo-4-fluorophenol (955 mg, 5.00 mmol) in
DMF, and stirred at 60.degree. C. overnight. The solvent was
distilled away under reduced pressure, and after diluted with ethyl
acetate, the resultant was washed with water and saturated brine,
and then dried over anhydrous magnesium sulfate. The solvent was
distilled away, and the resulting residue was purified by silica
gel chromatography (hexane/ethyl acetate) to thus obtain the title
compound.
[0231] Yield: 1.17 g (4.76 mmol), percentage yield: 95%
[0232] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 1.81-1.91 (m, 3H),
4.46 (s, 2H), 4.96-5.05 (m, 1H), 5.11-5.18 (m, 1H), 6.83 (dd,
J=9.1, 4.8 Hz, 1H), 6.92-6.99 (m, 1H), 7.28-7.33 (m, 1H).
Step 2 Synthesis of
7-bromo-5-fluoro-2,2-dimethyl-2,3-dihydro-1-benzofuran
[0233] A solution (1 mL) of the compound (560 mg, 2.28 mmol) of
Step 1 in N-methyl-2-pyrrolidinone was irradiated with a microwave
in a tightly-sealed container, and stirred at 200.degree. C. for 1
hour. To the reaction solution, ethyl acetate and hexane were
added. After washing with water and saturated brine, the resultant
was dried over anhydrous magnesium sulfate. The solvent was
distilled away under reduced pressure. The residue was purified by
silica gel chromatography. To the resulting compound (368 mg, 1.50
mmol), formic acid (2 mL) and water (0.2 mL) were added, and
stirred at 100.degree. C. overnight. The reaction solution was
diluted with ethyl acetate, and after washed with water and
saturated brine, the resultant was dried over anhydrous magnesium
sulfate. The solvent was distilled away under reduced pressure. The
resulting residue was purified by silica gel chromatography
(hexane/ethyl acetate) to thus obtain the title compound.
[0234] Yield: 315 mg (1.29 mmol), percentage yield: 57%
[0235] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 1.51 (s, 6H), 3.08
(d, J=0.9 Hz, 2H), 6.78-6.83 (m, 1H), 6.98-7.03 (m, 1H).
Step 3 Synthesis of Compound of Example 22
[0236] An operation similar to that in Step 2 of Example 15 was
performed using the compound (24.5 mg, 0.100 mmol) of Step 2 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0237] Yield: 40.6 mg (0.0829 mmol), percentage yield: 83%
[0238] MS (ESI, m/z) 492 [M+H].sup.+
[0239] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.43 (s, 6H),
1.72-2.02 (m, 3H), 2.17-2.35 (m, 1H), 3.04 (s, 2H), 3.41-3.63 (m,
2H), 4.31-4.45 (m, 1H), 5.10-5.28 (m, 2H), 6.96-7.01 (m, 1H),
7.05-7.11 (m, 3H), 7.31-7.62 (m, 4H), 7.63-7.70 (m, 2H), 12.55 (br
s, 1H).
Example 23
1-(3-{[4-(4,5-difluoro-2-methyl-1-benzofuran-7-yl)phenoxy]methyl}benzoyl)--
L-proline
Step 1 Synthesis of 7-bromo-4,5-difluoro-2-methyl-1-benzofuran
[0240] Potassium carbonate (1.38 g, 10.0 mmol) and propargyl
bromide (0.414 mL, 5.50 mmol) were added to a solution (25 mL) of
2-bromo-4,5-difluorophenol (1.05 g, 5.00 mmol) in DMF, and stirred
at room temperature overnight. The solvent was distilled away under
reduced pressure, and after diluted with ethyl acetate, the
resultant was washed with water and saturated brine, and dried over
anhydrous magnesium sulfate. The solvent was distilled away, and
the residue was purified by silica gel chromatography (hexane/ethyl
acetate). To the resulting compound (1.18 g, 4.78 mmol), cesium
fluoride (872 mg, 5.74 mmol) and dimethylaniline (7 mL) were added,
and stirred at 170.degree. C. overnight. To the reaction solution,
ethyl acetate and a 2 N hydrochloric acid aqueous solution were
added and stirred. After the insoluble material was filtered off,
extraction was performed with ethyl acetate. The organic phase was
washed with a saturated aqueous sodium hydrogen carbonate solution
and saturated brine, and then dried over anhydrous magnesium
sulfate. The solvent was distilled away under reduced pressure. The
resulting residue was purified by silica gel chromatography
(hexane) to thus obtain the title compound.
[0241] Yield: 164 mg (0.664 mmol), percentage yield: 14%
[0242] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 2.50 (d, J=1.0 Hz,
3H), 6.57 (q, J=1.0 Hz, 1H), 7.22 (dd, J=10.2, 6.9 Hz, 1H).
Step 2 Synthesis of Compound of Example 23
[0243] An operation similar to that in Step 2 of Example 15 was
performed using the compound (26.8 mg, 0.108 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0244] Yield: 42.9 mg (0.0873 mmol), percentage yield: 81%
[0245] MS (ESI, m/z) 492 [M+H].sup.+
[0246] 1H NMR (DMSO-d6, 400 MHz) .delta. 1.74-2.33 (m, 4H), 2.49
(s, 3H), 3.53-3.64 (m, 2H), 4.31-4.45 (m, 1H), 5.15-5.31 (m, 2H),
6.84 (d, J=1.1 Hz, 1H), 7.15-7.20 (m, 2H), 7.32-7.64 (m, 5H),
7.78-7.83 (m, 2H), 12.60 (br s, 1H).
Example 24
1-(3-{[4-(2,3-dihydro-1H-inden-4-yl)phenoxy]methyl}benzoyl)-L-proline
[0247] 7-Bromo-1H-indene (250 mg, 1.28 mmol),
4-hydroxyphenylboronic acid (212 mg, 1.54 mmol), sodium carbonate
(270 mg, 2.56 mmol), Pd(PPh3)4 (catalytic amount), 1,4-dioxane (10
mL), and water (3 mL) were added, and stirred at 90.degree. C. for
8 hours. The solvent was distilled away under reduced pressure.
Ethyl acetate was used as an extraction solvent, and after washing
with a 1 N hydrochloric acid aqueous solution and saturated brine,
the resultant was dried over magnesium sulfate. The solvent was
distilled away under reduced pressure. To half of the resulting
residue, methanol (10 mL) and a catalytic amount of 10%
palladium-carbon were added, and stirred in a hydrogen atmosphere
at room temperature overnight. The insoluble material was filtered
off, and the solvent was distilled away under reduced pressure. An
operation similar to that in Step 2 of Example 9 was performed on
the resulting residue to thus obtain the title compound.
[0248] Yield: 3.1 mg (0.007 mmol)
[0249] MS (ESI, m/z) 442 [M+H].sup.+
Example 25
1-(3-{[4-(7-fluoro-1-benzofuran-4-yl)phenoxy]methyl}benzoyl)-L-proline
Step 1 Synthesis of 4-bromo-7-fluoro-1-benzofuran
[0250] An operation similar to that in Step 1 of Example 12 was
performed using 5-bromo-2-fluorophenol (0.561 mL, 5.00 mmol) in
place of 2-bromo-4-fluorophenol to thus obtain the title
compound.
[0251] Yield: 191 mg (0.888 mmol), percentage yield: 18%
[0252] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 6.85 (dd, J=2.7,
2.2 Hz, 1H), 6.95 (dd, J=10.2, 8.6 Hz, 1H), 7.31 (dd, J=8.6, 3.7
Hz, 1H), 7.70 (d, J=2.2 Hz, 1H).
Step 2 Synthesis of 4-(7-fluoro-1-benzofuran-4-yl)phenol
[0253] An operation similar to that in Step 2 of Example 12 was
performed using the compound (182 mg, 0.846 mmol) of Step 1 in
place of 7-bromo-5-fluoro-1-benzofuran to thus obtain the title
compound.
[0254] Yield: 160 mg (0.701 mmol), percentage yield: 83%
[0255] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 4.91 (s, 1H),
6.92-6.97 (m, 3H), 7.08 (dd, J=10.4, 8.3 Hz, 1H), 7.17 (dd, J=8.3,
4.2 Hz, 1H), 7.43-7.48 (m, 2H), 7.69 (d, J=2.2 Hz, 1H).
Step 3 Synthesis of
3-{[4-(7-fluoro-1-benzofuran-4-yl)phenoxy]methyl}benzoic acid
[0256] An operation similar to that in Step 3 of Example 12 was
performed using the compound (157 mg, 0.688 mmol) of Step 2 in
place of 4-(5-fluoro-1-benzofuran-7-yl)phenol to thus obtain the
title compound.
[0257] Yield: 223 mg (0.615 mmol), percentage yield: 89%
[0258] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 5.27 (s, 2H),
7.12 (dd, J=3.1, 2.2 Hz, 1H), 7.15-7.20 (m, 2H), 7.27-7.32 (m, 2H),
7.53-7.60 (m, 3H), 7.72-7.77 (m, 1H), 7.90-7.94 (m, 1H), 8.07 (s,
1H), 8.17 (d, J=2.2 Hz, 1H), 13.05 (br s, 1H).
Step 4 Synthesis of Compound of Example 25
[0259] An operation similar to that in Step 4 of Example 10 was
performed using the compound (35.2 mg, 0.0971 mmol) of Step 3 in
place of
3-{[4-(4-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoic
acid to thus obtain the title compound.
[0260] Yield: 2.3 mg (0.00501 mmol), percentage yield: 5.2%
[0261] MS (ESI, m/z) 460 [M+H].sup.+
Example 26
1-(3-{[4-(1H-indol-4-yl)phenoxy]methyl}benzoyl)-L-proline
[0262] An operation similar to that in Example 3 was performed
using indole-4-boronic acid pinacol ester (23.3 mg, 0.0960 mmol) in
place of 4-fluorobenzofuran-7-boronic acid to thus obtain the title
compound.
[0263] Yield: 16.8 mg (0.0381 mmol), percentage yield: 48%
[0264] MS (ESI, m/z) 441 [M+H].sup.+
[0265] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.75-2.02 (m,
3H), 2.19-2.35 (m, 1H), 3.40-3.64 (m, 2H), 4.32-4.45 (m, 1H),
5.14-5.30 (m, 2H), 6.52 (s, 1H), 7.03 (d, J=7.2 Hz, 1H), 7.11-7.19
(m, 3H), 7.31-7.65 (m, 8H), 11.21 (s, 1H), 12.57 (br s, 1H).
Example 27
1-(3-{[4-(8-fluoro-2H-chromen-5-yl)phenoxy]methyl}benzoyl)-L-proline
[0266] A similar operation to that in Example 18 was performed
using 2-fluoro-5-bromophenol (3.13 g, 16.39 mmol) in place of
2-bromo-4,5-difluorophenol (2.5 g, 11.96 mmol) to thus obtain the
title compound.
[0267] Yield: 3.4 mg (0.007 mmol)
[0268] MS (ESI, m/z) 474 [M+H].sup.+
Example 28
1-(3-{[4-(1-benzothien-7-yl)phenoxy]methyl}benzoyl)-L-proline
[0269] An operation similar to that in Example 3 was performed
using 1-benzothien-7-ylboronic acid (17.1 mg, 0.0960 mmol) in place
of 4-fluorobenzofuran-7-boronic acid to thus obtain the title
compound.
[0270] Yield: 12.8 mg (0.0280 mmol), percentage yield: 35%
[0271] MS (ESI, m/z) 458 [M+H].sup.+
[0272] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.76-2.35 (m,
4H), 3.41-3.63 (m, 2H), 4.33-4.45 (m, 1H), 5.18-5.31 (m, 2H),
7.16-7.23 (m, 2H), 7.33-7.70 (m, 9H), 7.79 (d, J=5.5 Hz, 1H), 7.86
(dd, J=7.9, 0.9 Hz, 1H), 12.66 (br s, 1H).
Example 29
1-(3-{[4-(7-fluoro-1H-indol-4-yl)phenoxy]methyl}benzoyl)-L-proline
[0273] An operation similar to that in Step 2 of Example 15 was
performed using 4-bromo-7-fluoro-1H-indole (26.7 mg, 0.125 mmol) in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0274] Yield: 7.0 mg (0.0153 mmol), percentage yield: 12%
[0275] MS (ESI, m/z) 492 [M+H].sup.+
[0276] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.74-2.37 (m,
4H), 3.42-3.63 (m, 2H), 4.32-4.45 (m, 1H), 5.14-5.28 (m, 2H),
6.55-6.63 (m, 1H), 6.94-7.01 (m, 2H), 7.14 (d, J=8.7 Hz, 2H),
7.31-7.65 (m, 7H), 11.72 (s, 1H), 12.59 (br s, 1H).
Example 30
1-(3-{[4-(6,7-difluoro-1-benzofuran-4-yl)phenoxy]methyl}benzoyl)-L-proline
Step 1 Synthesis of 4-bromo-6,7-difluoro-1-benzofuran
[0277] An operation similar to that in Step 1 of Example 12 was
performed using 5-bromo-2,3-difluorophenol (2.09 g, 10.0 mmol) in
place of 2-bromo-4-fluorophenol to thus obtain the title
compound.
[0278] Yield: 1.48 g (6.35 mmol), percentage yield: 64%
[0279] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 6.80 (dd, J=3.4,
1.5 Hz, 1H), 7.27-7.33 (m, 1H), 7.71 (d, J=2.1 Hz, 1H).
Step 2 Synthesis of Compound of Example 30
[0280] An operation similar to that in Step 2 of Example 15 was
performed using the compound (18.6 mg, 0.0800 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0281] Yield: 17.9 mg (0.0375 mmol), percentage yield: 47%
[0282] MS (ESI, m/z) 478 [M+H].sup.+
[0283] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.74-2.36 (m,
4H), 3.39-3.65 (m, 2H), 4.31-4.44 (m, 1H), 5.17-5.30 (m, 2H),
7.12-7.21 (m, 3H), 7.32-7.64 (m, 7H), 8.21 (d, J=2.2 Hz, 1H), 12.60
(br s, 1H).
Example 31
1-(3-{[4-(7,8-difluoro-2H-chromen-5-yl)phenoxy]methyl}benzoyl)-L-proline
[0284] A similar operation to that in Example 18 was performed
using 2,3-difluoro-5-bromophenol (2.65 g, 12.68 mmol) in place of
2-bromo-4,5-difluorophenol (2.5 g, 11.96 mmol) to thus obtain the
title compound.
[0285] Yield: 2.7 mg (0.005 mmol)
[0286] MS (ESI, m/z) 492 [M+H].sup.+
Example 32
1-(3-{[4-(3-oxo-3,4-dihydro-2H-1,4-benzoxazin-8-yl)phenoxy]methyl}benzoyl)-
-L-proline
Step 1 8-bromo-4H-benzoxazin-3-one
[0287] 2-Amino-6-bromophenol (1.0 g, 5.32 mmol) was dissolved in
DMF (20 mL), and potassium carbonate (1.6 g, 11.7 mmol) and
chloroacetyl chloride (0.466 mL, 5.85 mmol) were added thereto, and
stirred at room temperature overnight. After diluted with ethyl
acetate, the resultant was washed with water and saturated brine,
and dried over anhydrous magnesium sulfate. The solvent was
distilled away, and the residue washed with an ethyl acetate-hexane
mixture solvent to thus obtain the title compound.
[0288] Yield: 1.1 mg (4.85 mmol), percentage yield: 91%
[0289] MS (ESI, m/z) 228 [M+H].sup.+
Step 2 Synthesis of Example 32
[0290] An operation similar to that in Step 2 of Example 15 was
performed using the compound (18 mg, 0.079 mmol) of Step 1 in place
of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0291] Yield: 4 mg (0.008 mmol), percentage yield: 10%
[0292] MS (ESI, m/z) 473 [M+H].sup.+
Example 33
1-(3-{[4-(6,7-difluoro-1H-indol-4-yl)phenoxy]methyl}benzoyl)-L-proline
Step 1 Synthesis of 4-bromo-6,7-difluoro-1H-indole
[0293] A solution (20 mL) of 5-Bromo-1,2-difluoro-3-nitrobenzene
(1.19 g, 5.00 mmol) in THF was cooled to -50.degree. C. To this, a
1 M vinylmagnesium bromide/THF solution (15 mL) was added dropwise.
After the mixture was stirred at -40.degree. C. for 4 hours, a
saturated aqueous ammonium chloride solution was added thereto, and
concentrated under reduced pressure. The reaction solution was
diluted with ethyl acetate, and after washed with saturated brine,
the resultant was dried over anhydrous magnesium sulfate. The
resultant was concentrated under reduced pressure. The resulting
residue was purified by silica gel chromatography (hexane) to thus
obtain the title compound.
[0294] Yield: 145 mg (0.625 mmol), percentage yield: 12%
[0295] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 6.58 (td, J=3.2,
2.4 Hz, 1H), 7.17 (dd, J=10.4, 6.3 Hz, 1H), 7.28 (dd, J=3.2, 2.4
Hz, 1H), 8.50 (br s, 1H).
Step 2 Synthesis of Compound of Example 33
[0296] An operation similar to that in Step 2 of Example 15 was
performed using the compound (28.2 mg, 0.121 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0297] Yield: 37.0 mg (0.0777 mmol), percentage yield: 64%
[0298] MS (ESI, m/z) 477 [M+H].sup.+
[0299] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.76-2.32 (m,
4H), 3.40-3.52 (m, 2H), 4.32-4.45 (m, 1H), 5.16-5.29 (m, 2H),
6.54-6.62 (m, 1H), 7.06 (dd, J=12.3, 6.8 Hz, 1H), 7.12-7.19 (m,
2H), 7.31-7.68 (m, 7H), 11.90 (s, 1H), 12.64 (br s, 1H).
Example 34
1-[3-({[4',5'-difluoro-2'-(prop-2-yn-1-yloxy)biphenyl-4-yl]oxy}methyl)benz-
oyl]-L-proline
Step 1 tert-butyl
1-(3-{[(4',5'-difluoro-2'-hydroxybiphenyl-4-yl)oxy]methyl}benzoyl)-L-prol-
inate
[0300] To the intermediate 3 (1.6 g, 3.16 mmol),
2-hydroxy-4,5-difluorophenylboronic acid (576 mg, 3.31 mmol),
sodium carbonate (680 mg, 2.15 mmol), and Pd(PPh3)4 (catalytic
amount), 1,4-dioxane (24 mL) and water (8 mL) were added, and
stirred at 100.degree. C. for 2 hours. The reaction solution was
concentrated under reduced pressure. To the residue, ethyl acetate
and 1 N hydrochloric acid were added and stirred. After that, the
insoluble material was filtered off, and extraction was performed
with ethyl acetate. The organic phase was washed with saturated
brine, and then dried over anhydrous magnesium sulfate. The solvent
was distilled away under reduced pressure. The resulting residue
was purified by reversed-phase HPLC in the same manner as in Step 2
of Example 1 to thus obtain the title compound.
[0301] Yield: 1.2 g (2.35 mmol), percentage yield: 74%
[0302] MS (ESI, m/z) 510 [M+H].sup.+
Step 2 Synthesis of Example 34
[0303] The compound (30 mg, 0.059 mmol) obtained in Step 1 was
dissolved in DMF (2 mL), and potassium carbonate (12 mg, 0.088
mmol) and propargyl bromide (0.007 mL, 0.088 mmol) were added
thereto, and stirred at room temperature overnight. After diluted
with ethyl acetate, the resultant was washed with water and
saturated brine, and dried over anhydrous magnesium sulfate. The
solvent was distilled away, and to the residue, TFA (2 mL) was
added, and stirred for 2 hours. The solvent was distilled away, and
the resulting residue was purified by reversed-phase HPLC in the
same manner as in Step 2 of Example 1 to thus obtain the title
compound.
[0304] Yield: 5.3 mg (0.011 mmol), percentage yield: 19%
[0305] MS (ESI, m/z) 492 [M+H].sup.+
Example 35
1-[3-({[2'-(cyanomethoxy)-4',5'-difluorobiphenyl-4-yl]oxy}methyl)benzoyl]--
L-proline
[0306] A similar operation to that in Step 2 of Example 34 was
performed using bromoacetonitrile (0.006 mL, 0.088 mmol) in place
of propargyl bromide to thus obtain the title compound.
[0307] Yield: 2.0 mg (0.004 mmol), percentage yield: 7%
[0308] MS (ESI, m/z) 493 [M+H].sup.+
Example 36
1-[3-({[2'-(allyloxy)-4',5'-difluorobiphenyl-4-yl]oxy}methyl)benzoyl]-L-pr-
oline
[0309] A similar operation to that in Step 2 of Example 34 was
performed using allyl bromide (0.006 mL, 0.088 mmol) in place of
propargyl bromide to thus obtain the title compound.
[0310] Yield: 6.2 mg (0.013 mmol), percentage yield: 17%
[0311] MS (ESI, m/z) 494 [M+H].sup.+
Example 37
1-(3-{[(4',5'-difluoro-2'-d.sub.3
methoxybiphenyl-4-yl)oxy]methyl}benzoyl)-L-proline
[0312] A similar operation to that in Step 2 of Example 34 was
performed using iodomethane-d3 (0.003 mL, 0.088 mmol) in place of
propargyl bromide to thus obtain the title compound.
[0313] Yield: 5.3 mg (0.011 mmol), percentage yield: 15%
[0314] MS (ESI, m/z) 471 [M+H].sup.+
Example 38
1-[3-({[4',5'-difluoro-2'-(methylthio)biphenyl-4-yl]oxy}methyl)benzoyl]-L--
proline
Step 1 Synthesis of 1-bromo-4,5-difluoro-2-(methylthio)benzene
[0315] Potassium carbonate (310 mg, 2.22 mmol) and iodomethane
(0.138 mL, 2.22 mmol) were added to a solution (10 mL) of
2-bromo-4,5-difluorothiophenol (400 mg, 1.78 mmol) in DMF, and
stirred at room temperature overnight. After diluted with ethyl
acetate, the resultant was washed with water and saturated brine,
and then dried over anhydrous magnesium sulfate. The solvent was
distilled away, and the resulting residue was purified by silica
gel chromatography (hexane/ethyl acetate) to thus obtain the title
compound.
[0316] Yield: 404 mg (1.69 mmol), percentage yield: 95%
[0317] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 2.46 (s, 3H), 6.97
(dd, J=10.9, 7.6 Hz, 1H), 7.39 (dd, J=9.5, 7.6 Hz, 1H).
Step 2 Synthesis of Compound of Example 38
[0318] An operation similar to that in Step 2 of Example 15 was
performed using the compound (180 mg, 0.753 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0319] Yield: 112 mg (0.232 mmol), percentage yield: 31%
[0320] MS (ESI, m/z) 484 [M+H].sup.+
[0321] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.75-2.01 (m,
3H), 2.19-2.35 (m, 1H), 2.39 (s, 3H), 3.41-3.62 (m, 2H), 4.31-4.44
(m, 1H), 5.13-5.26 (m, 2H), 7.05-7.11 (m, 2H), 7.25-7.63 (m, 8H),
12.55 (br s, 1H).
Example 39
1-(3-{[4-(4,5-difluoro-1-benzothien-7-yl)phenoxy]methyl}benzoyl)-L-proline
Step 1 Synthesis of 7-bromo-4,5-difluoro-1-benzothiophene
[0322] An operation similar to that in Step 1 of Example 12 was
performed using 2-bromo-4,5-difluorothiophenol (1.31 g, 5.83 mmol)
in place of 2-bromo-4-fluorophenol to thus obtain the title
compound.
[0323] Yield: 1.0 g (4.0 mmol), percentage yield: 69%
[0324] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 7.40 (ddd, J=9.6,
6.4, 0.5 Hz, 1H), 7.60-7.54 (m, 2H).
Step 2 Synthesis of Compound of Example 39
[0325] To the intermediate 2 (110 mg, 0.243 mmol), the compound
(50.4 mg, 0.202 mmol) of Step 1, sodium carbonate (47.1 mg, 0.444
mmol), and Pd(dppf)Cl2 (catalytic amount), 1,4-dioxane (0.75 mL)
and water (0.25 mL) were added, and stirred at 100.degree. C. for 2
hours. Further, the intermediate 2 (50.0 mg, 0.111 mmol) and
Pd(dppf)Cl2 (14.8 mg, 0.0202 mmol) were added thereto. The mixture
was irradiated with a microwave in a tightly-sealed container, and
stirred at 130.degree. C. for 30 minutes. After the insoluble
material was filtered off, the resultant was purified by
reversed-phase HPLC in the same manner as in Step 2 of Example 1 to
thus obtain the title compound.
[0326] Yield: 30.2 mg (0.0612 mmol), percentage yield: 30%
[0327] MS (ESI, m/z) 460 [M+H].sup.+
[0328] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.76-2.02 (m,
3H), 2.21-2.36 (m, 1H), 3.53-3.67 (m, 2H), 4.33-4.45 (m, 1H),
5.18-5.32 (m, 2H), 7.17-7.24 (m, 2H), 7.33-7.70 (m, 8H), 8.00 (d,
J=5.6 Hz, 1H), 12.51 (s, 1H).
Example 40
1-(3-{[(4',5'-difluoro-2'mercaptobiphenyl-4-yl)oxy]methyl}benzoyl)-L-proli-
ne
[0329] 2-Bromo-4,5-difluorothiophenol (280 mg, 1.24 mmol) was
dissolved in dichloromethane (10 mL), and 2,4,6-trimethoxybenzyl
alcohol (246 mg, 1.24 mmol) and trifluoroacetic acid (0.125 mL,
1.61 mmol) were added thereto, and stirred at room temperature for
1 hour. A saturated aqueous sodium hydrogen carbonate solution was
added thereto. After diluted with ethyl acetate, the resultant was
washed with water and saturated brine, and dried over anhydrous
magnesium sulfate. The solvent was distilled away, and the residue
was purified by silica gel chromatography (hexane/ethyl acetate).
To the resulting compound (140 mg, 0.35 mmol), the intermediate 2
(180 mg, 0.39 mmol), sodium carbonate (200 mg, 1.89 mmol), Pd
(dppf)Cl2 (catalytic amount), 1,4-dioxane (0.75 mL), and water
(0.25 mL) were added, and stirred at 100.degree. C. for 2 hours.
After the insoluble material was filtered off, the resultant was
purified by reversed-phase HPLC in the same manner as in Step 2 of
Example 1. To the resulting residue, trifluoroacetic acid (0.8 mL),
triethylsilane (0.3 mL), and dichloromethane (8 mL) were added, and
stirred at room temperature for 1 hour. The resultant was purified
by reversed-phase HPLC in the same manner as in Step 2 of Example 1
to thus obtain the title compound.
[0330] Yield: 20 mg (0.043 mmol), percentage yield: 3.4%
[0331] MS (ESI, m/z) 470 [M+H].sup.+
Example 41
1-(3-{[4-(6,7-difluoro-2-methyl-1H-indol-4-yl)phenoxy]methyl}benzoyl)-L-pr-
oline
Step 1 Synthesis of 4-bromo-6,7-difluoro-2-methyl-1H-indole
[0332] An operation similar to that in Step 1 of Example 33 was
performed using a 0.5 M isopropenylmagnesium bromide/THF solution
(30 mL) in place of a 1 M vinylmagnesium bromide/THF solution to
thus obtain the title compound.
[0333] Yield: 400 mg (1.63 mmol), percentage yield: 33%
[0334] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 2.46 (s, 3H),
6.22-6.26 (m, 1H), 7.10 (dd, J=10.5, 6.3 Hz, 1H), 8.20 (br s,
1H).
Step 2 Synthesis of Compound of Example 41
[0335] An operation similar to that in Step 2 of Example 15 was
performed using the compound (61.3 mg, 0.249 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0336] Yield: 50.1 mg (0.102 mmol), percentage yield: 41%
[0337] MS (ESI, m/z) 491 [M+H].sup.+
[0338] .sup.1H NMR (DMSO-d.sub.5, 400 MHz) .delta. 1.76-2.32 (m,
4H), 2.38 (s, 3H), 3.42-3.63 (m, 2H), 4.31-4.44 (m, 1H), 5.16-5.28
(m, 2H), 6.29 (s, 1H), 6.99 (dd, J=12.4, 6.9 Hz, 1H), 7.09-7.17 (m,
2H), 7.31-7.64 (m, 6H), 11.66 (s, 1H), 12.55 (br s, 1H).
Example 42
1-{3-[({3'-[(cyanomethyl)amino]-4',5'-difluorobiphenyl-4-yl}oxy)methyl]ben-
zoyl}-L-proline trifluoroacetic acid salt
Step 1 Synthesis of
tert-butyl(5-bromo-2,3-difluorophenyl)(cyanomethyl)carbamate
[0339] A solution (3 mL) of
tert-butyl(5-bromo-2,3-difluorophenyl)carbamate (182 mg, 0.591
mmol) in DMF was added to a suspension of 60% sodium hydride-oil
dispersion (31.2 mg) in DMF, and stirred at room temperature for 15
minutes. To the reaction solution, bromoacetonitrile (0.041 mL,
0.591 mmol) was added, and stirred at room temperature for 4 hours.
After quenched with a saturated aqueous ammonium chloride solution
under ice-cooling, extraction was performed with ethyl acetate. The
resulting organic phase was dried over anhydrous magnesium sulfate.
The solvent was distilled away under reduced pressure. The
resulting residue was purified by silica gel chromatography
(hexane/ethyl acetate) to thus obtain the title compound.
[0340] Yield: 142 mg (0.409 mmol), percentage yield: 69%
[0341] MS (ESI, m/z) 348 [M+H].sup.+
[0342] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 1.45 (br s, 9H),
4.46 (br s, 2H), 7.28-7.33 (m, 1H), 7.33-7.39 (m, 1H).
Step 2 Synthesis of
1-{3-[({3'-[(tert-butoxycarbonyl)(cyanomethyl)amino]-4',5'-difluorobiphen-
yl-4-yl}oxy)methyl]benzoyl}-L-proline
[0343] An operation similar to that in Step 2 of Example 15 was
performed using the compound (95.5 mg, 0.275 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0344] Yield: 109 mg (0.184 mmol), percentage yield: 67%
[0345] MS (ESI, m/z) 592 [M+H].sup.+
[0346] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.40 (s, 9H),
1.75-2.32 (m, 4H), 3.41-3.62 (m, 2H), 4.31-4.45 (m, 1H), 4.69-4.83
(m, 2H), 5.15-5.30 (m, 2H), 7.14 (d, J=8.8 Hz, 2H), 7.31-7.63 (m,
5H), 7.68 (d, J=8.8 Hz, 2H), 7.73-7.81 (m, 1H), 12.55 (br s,
1H).
Step 3 Synthesis of Compound of Example 42
[0347] To a solution (2 mL) of the compound (90.5 mg, 0.153 mmol)
of Step 2 in dichloromethane, trifluoroacetic acid (1 mL) was
added, and stirred at room temperature for 1 hour. The solvent was
distilled away under reduced pressure. The resulting residue was
purified by reversed-phase HPLC in the same manner as in Step 2 of
Example 1 to thus obtain the title compound.
[0348] Yield: 32.8 mg (0.0542 mmol), percentage yield: 35%
[0349] MS (ESI, m/z) 492 [M+H].sup.+
[0350] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.76-2.32 (m,
4H), 3.45-3.63 (m, 2H), 4.30-4.49 (m, 3H), 5.12-5.28 (m, 2H), 6.60
(br s, 1H), 6.93-7.03 (m, 2H), 7.12 (d, J=8.8 Hz, 2H), 7.31-7.67
(m, 6H), 12.67 (br s, 1H).
Example 43
1-(3-{[(4',5'-difluoro-2'-formylbiphenyl-4-yl)oxy]methyl}benzoyl)-L-prolin-
e
[0351] An operation similar to that in Example 3 was performed
using 4,5-difluoro-2-formylphenylboronic acid (97 mg, 0.52 mmol) in
place of 4-fluorobenzofuran-7-boronic acid to thus obtain the title
compound.
[0352] Yield: 90 mg (0.19 mmol), percentage yield: 46%
[0353] MS (ESI, m/z) 466 [M+H].sup.+
Example 44
1-[3-({[4',5'-difluoro-2'-(methoxycarbonyl)biphenyl-4-yl]oxy}methyl)benzoy-
l]-L-proline
[0354] An operation similar to that in Example 3 was performed
using methyl
4,5-difluoro-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzoa-
te (155 mg, 0.52 mmol) in place of 4-fluorobenzofuran-7-boronic
acid to thus obtain the title compound.
[0355] Yield: 70 mg (0.14 mmol), percentage yield: 32%
[0356] MS (ESI, m/z) 496 [M+H].sup.+
Example 45
1-[3-({4-[4,5-difluoro-3-(methoxymethyl)-1-benzofuran-7-yl]phenoxy}methyl)-
benzoyl]-L-proline
Step 1 Synthesis of
7-bromo-4,5-difluoro-3-(methoxymethyl)-1-benzofuran
[0357] To the compound (49.4 mg, 0.200 mmol) of Step 1 of Example
21, N-bromosuccinimide (hereinafter, NBS) (39.2 mg, 0.220 mmol),
and a catalytic amount of benzoyl peroxide (hereinafter, BPO),
carbon tetrachloride (2 mL) was added, and heated under reflux
overnight. After the resultant was returned to room temperature,
the insoluble material was filtered off. The solvent was distilled
away under reduced pressure. The resulting residue was dissolved in
methanol (2 mL), and a 25% sodium methoxide methanol solution (0.2
mL) was added thereto and heated under reflux for 3 hours. The
resultant was returned to room temperature, and the solvent was
distilled away under reduced pressure. To the resulting residue, 1
N hydrochloric acid (1 mL) and a saturated aqueous ammonium
chloride solution were added, and extraction was performed with
ethyl acetate. The organic phase was dried over anhydrous magnesium
sulfate. The solvent was distilled away under reduced pressure. The
resulting residue was purified by silica gel chromatography to thus
obtain the title compound.
[0358] Yield: 22.9 mg (0.0826 mmol), percentage yield: 41%
[0359] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 3.47 (s, 3H), 4.62
(d, J=1.0 Hz, 2H), 7.30-7.38 (m, 1H), 7.63-7.68 (m, 1H).
Step 2 Synthesis of Compound of Example 45
[0360] An operation similar to that in Step 2 of Example 15 was
performed using the compound (22.9 mg, 0.0826 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0361] Yield: 22.9 mg (0.0439 mmol), percentage yield: 53%
[0362] MS (ESI, m/z) 522 [M+H].sup.+
[0363] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.76-2.32 (m,
4H), 3.32 (s, 3H), 3.42-3.63 (m, 2H), 4.32-4.45 (m, 1H), 4.54-4.63
(m, 2H), 5.18-5.31 (m, 2H), 7.15-7.22 (m, 2H), 7.40-7.66 (m, 5H),
7.78-7.84 (m, 2H), 8.16 (s, 1H), 12.55 (br s, 1H).
Example 46
1-[3-({4-[3-(cyanomethyl)-4,5-difluoro-1-benzofuran-7-yl]phenoxy}methyl)be-
nzoyl]-L-proline
Step 1 Synthesis of
(7-bromo-4,5-difluoro-1-benzofuran-3-yl)acetonitrile
[0364] To the compound (98.8 mg, 0.400 mmol) of Step 1 of Example
21, NBS (78.3 mg, 0.440 mmol), and a catalytic amount of BPO,
carbon tetrachloride (4 mL) was added, and heated under reflux
overnight. The resultant was returned to room temperature, and the
solvent was distilled away under reduced pressure. The resulting
residue was diluted with dichloromethane, washed with a saturated
aqueous sodium hydrogen carbonate solution and saturated brine, and
then dried over anhydrous magnesium sulfate. The solvent was
distilled away under reduced pressure. The resulting residue was
dissolved in acetonitrile (2 mL), and sodium cyanide (39.2 mg,
0.800 mmol) and water (0.2 mL) were added thereto, and stirred at
50.degree. C. for 30 minutes. To the reaction solution, a 1 N
sodium hydroxide aqueous solution was added. After concentrated
under reduced pressure, the resultant was diluted with ethyl
acetate, washed with water and saturated brine, and then dried over
anhydrous magnesium sulfate. The solvent was distilled away under
reduced pressure. The resulting residue was purified by silica gel
chromatography to thus obtain the title compound.
[0365] Yield: 38.8 mg (0.143 mmol), percentage yield: 36%
[0366] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 3.89 (d, J=1.4 Hz,
2H), 7.38-7.43 (m, 1H), 7.76 (s, 1H).
Step 2 Synthesis of Compound of Example 46
[0367] An operation similar to that in Step 2 of Example 15 was
performed using the compound (37.0 mg, 0.136 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0368] Yield: 29.4 mg (0.0569 mmol), percentage yield: 42%
[0369] MS (ESI, m/z) 517 [M+H].sup.+
[0370] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.77-2.32 (m,
4H), 3.40-3.63 (m, 2H), 4.18-4.26 (m, 2H), 4.32-4.46 (m, 1H),
5.18-5.30 (m, 2H), 7.15-7.22 (m, 2H), 7.40-7.97 (m, 7H), 8.15-8.25
(m, 1H), 12.54 (br s, 1H).
Example 47
1-[3-({[3',4'-difluoro-5'-(prop-2-yn-1-yloxy)biphenyl-4-yl]oxy}methyl)benz-
oyl]-L-proline
Step 1 Synthesis of tert-butyl
1-(3-{[(3',4'-difluoro-5'-hydroxybiphenyl-4-yl)oxy]methyl}benzoyl)-L-prol-
inate
[0371] DMF (125 mL) was added to
4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenol (8.46 g, 38
mmol), methyl 3-(bromomethyl)benzoate (8.8 g, 38 mmol), and
potassium carbonate (10.6 g, 77 mmol), and stirred at room
temperature overnight. The resultant was diluted with ethyl
acetate, washed with water and saturated brine, and then dried over
anhydrous magnesium sulfate. The solvent was distilled away under
reduced pressure. To the resulting residue, methanol (150 mL),
water (30 mL), and lithium hydroxide (4.8 g, 114 mmol) were added,
and stirred at room temperature overnight. After the solvent was
distilled away under reduced pressure, the resultant was diluted
with ethyl acetate, then washed with 1 N hydrochloric acid and
saturated brine, and dried over anhydrous magnesium sulfate. The
solvent was distilled away under reduced pressure. To the resulting
residue, dichloromethane (150 mL), WSC (7.34 g, 38.2 mmol),
tert-butyl L-prolinate (7.95 g, 38.2 mmol), and triethylamine (9.65
ml, 69.4 mmol) were added, and stirred at room temperature
overnight. After washed with water, 1 N hydrochloric acid, 1 N
sodium hydroxide, and saturated brine, the resultant was dried over
anhydrous magnesium sulfate. The solvent was distilled away under
reduced pressure, and the residue was purified by silica gel
chromatography (hexane/ethyl acetate). To the resulting compound
(451 mg, 1.0 mmol), 5-bromo-2,3-difluorophenol (230 mg, 1.1 mmol),
sodium carbonate (160 mg, 1.5 mmol), and Pd(dppf)Cl2 (catalytic
amount), 1,4-dioxane (12 mL) and water (4 mL) were added, and
stirred at 100.degree. C. for 2 hours. The reaction solution was
concentrated under reduced pressure. To the residue, ethyl acetate
and 1 N hydrochloric acid were added and stirred. After that, the
insoluble material was filtered off, and extraction was performed
with ethyl acetate. The organic phase was washed with saturated
brine, and then dried over anhydrous magnesium sulfate. After the
solvent was distilled away under reduced pressure, the resulting
residue was purified by reversed-phase HPLC in the same manner as
in Step 2 of Example 1 to thus obtain the title compound.
[0372] Yield: 230 mg (0.45 mmol), percentage yield: 45%
[0373] MS (ESI, m/z) 510 [M+H].sup.+
Step 2 Synthesis of Compound of Example 47
[0374] An operation similar to that in Step 2 of Example 34 was
performed using the compound (106 mg, 0.208 mmol) of Step 1 in
place of tert-butyl
1-(3-{[(4',5'-difluoro-2'-hydroxybiphenyl-4-yl)oxy]methyl}benzoyl)-L-prol-
inate to thus obtain the title compound.
[0375] Yield: 75.9 mg (0.154 mmol), percentage yield: 74%
[0376] MS (ESI, m/z) 492 [M+H].sup.+
[0377] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.75-2.33 (m,
4H), 3.43-3.62 (m, 2H), 3.67 (t, J=2.4 Hz, 1H), 4.31-4.44 (m, 1H),
5.06 (d, J=2.4 Hz, 2H), 5.16-5.28 (m, 2H), 7.09-7.15 (m, 2H),
7.28-7.36 (m, 2H), 7.40-7.62 (m, 4H), 7.62-7.68 (m, 2H), 12.52 (br
s, 1H).
Example 48
1-[3-({[3'-(cyanomethoxy)-4',5'-difluorobiphenyl-4-yl]oxy}methyl)benzoyl]--
L-proline
[0378] An operation similar to that in Example 35 was performed
using the compound (81.7 mg, 0.160 mmol) obtained in Step 1 of
Example 47 in place of tert-butyl
1-(3-{[(4',5'-difluoro-2'-hydroxybiphenyl-4-yl)oxy]methyl}benzoyl)-L-prol-
inate to thus obtain the title compound.
[0379] Yield: 37.6 mg (0.0763 mmol), percentage yield: 48%
[0380] MS (ESI, m/z) 493 [M+H].sup.+
[0381] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.74-2.34 (m,
4H), 3.55-3.65 (m, 2H), 4.29-4.46 (m, 1H), 5.15-5.31 (m, 2H), 5.42
(s, 2H), 7.11-7.17 (m, 2H), 7.31-7.63 (m, 6H), 7.66-7.71 (m, 2H),
12.63 (br s, 1H).
Example 49
1-[3-({[3',4'-difluoro-5'-(2-oxopropoxy)biphenyl-4-yl]oxy}methyl)benzoyl]--
L-proline
Step 1 Synthesis of tert-butyl
1-[3-({[3',4'-difluoro-5'-(2-oxopropoxy)biphenyl-4-yl]oxy}methyl)benzoyl]-
-L-prolinate
[0382] The compound (106 mg, 0.208 mmol) of Step 1 of Example 47
was dissolved in DMF (2 mL), and potassium carbonate (57.5 mg,
0.416 mmol) and bromoacetone (0.0192 mL, 0.229 mmol) were added
thereto, and stirred at room temperature for 5 hours. The solvent
was distilled away under reduced pressure. The resulting residue
was diluted with ethyl acetate, washed with water and saturated
brine, and then dried over anhydrous magnesium sulfate. The
resultant was purified by silica gel chromatography to thus obtain
the title compound.
[0383] Yield: 106 mg (0.187 mmol), percentage yield: 90%
[0384] MS (ESI, m/z) 566 [M+H].sup.+
Step 2 Synthesis of Compound of Example 49
[0385] To a solution of the compound (40.0 mg, 0.0707 mmol) of Step
1 in dichloromethane (2 mL), trifluoroacetic acid (1 mL) was added,
and stirred at room temperature for 1 hour. The solvent was
distilled away under reduced pressure. The resulting residue was
purified by reversed-phase HPLC in the same manner as in Step 2 of
Example 1 to thus obtain the title compound.
[0386] Yield: 26.8 mg (0.0526 mmol), percentage yield: 74%
[0387] MS (ESI, m/z) 510 [M+H].sup.+
[0388] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.76-2.01 (m,
3H), 2.17 (s, 3H), 2.20-2.31 (m, 1H), 3.42-3.63 (m, 2H), 4.30-4.45
(m, 1H), 5.10 (s, 2H), 5.15-5.28 (m, 2H), 7.06-7.16 (m, 3H),
7.23-7.66 (m, 7H), 12.55 (br s, 1H).
Example 50
1-[3-({[3',4'-difluoro-5'-(2-hydroxypropoxy)biphenyl-4-yl]oxy}methyl)benzo-
yl]-L-proline
[0389] To a solution (1.5 mL) of the compound (66.0 mg, 0.117 mmol)
of Step 1 of Example 49 in methanol, sodium borohydride (5.3 mg,
0.14 mmol) was added, and stirred at room temperature for 1 hour.
After a saturated aqueous ammonium chloride solution was added to
the reaction solution, the mixture was concentrated under reduced
pressure, and extracted with ethyl acetate. The organic phase was
washed with a saturated aqueous sodium hydrogen carbonate solution
and saturated brine, and dried over anhydrous magnesium sulfate.
After that, the solvent was distilled away under reduced pressure.
The resulting residue was dissolved in dichloromethane (2 mL), and
trifluoroacetic acid (1 mL) was added thereto, and stirred at room
temperature for 1 hour. The solvent was distilled away under
reduced pressure. The resulting residue was purified by
reversed-phase HPLC in the same manner as in Step 2 of Example 1,
to thus obtain the title compound.
[0390] Yield: 34.9 mg (0.0682 mmol), percentage yield: 58%
[0391] MS (ESI, m/z) 512 [M+H].sup.+
[0392] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.17 (d, J=6.0
Hz, 3H), 1.76-2.32 (m, 4H), 3.40-3.61 (m, 2H), 3.95-4.08 (m, 4H),
4.31-4.44 (m, 1H), 5.15-5.27 (m, 2H), 7.10 (d, J=8.8 Hz, 2H),
7.19-7.62 (m, 6H), 7.66 (d, J=8.8 Hz, 2H), 12.62 (br s, 1H).
Example 51
1-{3-[({4',5'-difluoro-2'-[(2-oxopropyl)thio]biphenyl-4-yl}oxy)methyl]benz-
oyl}-L-proline
Step 1 Synthesis of 1-[(2-bromo-4,5-difluorophenyl)thio]acetone
[0393] 2-Bromo-4,5-difluorobenzenethiol (900 mg, 4.00 mmol) and
potassium carbonate (1.11 g, 8.00 mmol) were suspended in DMF (20
mL), and bromoacetone (0.403 mL, 4.80 mmol) was added thereto, and
stirred at room temperature overnight. The reaction solution was
concentrated under reduced pressure. After diluted with ethyl
acetate, the resultant was washed with water and saturated brine,
and dried over anhydrous magnesium sulfate. The solvent was
distilled away under reduced pressure. The resulting residue was
purified by silica gel chromatography (hexane/ethyl acetate) to
thus obtain the title compound.
[0394] Yield: 804 mg (2.86 mmol), percentage yield: 71%
[0395] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 2.32 (s, 3H), 3.69
(s, 2H), 7.19 (dd, J=10.4, 7.8 Hz, 1H), 7.42 (dd, J=9.4, 7.5 Hz,
1H).
Step 2 Synthesis of Compound of Example 51
[0396] An operation similar to that in Step 2 of Example 15 was
performed using the compound (28.1 mg, 0.100 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0397] Yield: 9.7 mg (0.019 mmol), percentage yield: 18%
[0398] MS (ESI, m/z) 526 [M+H].sup.+
Example 52
1-{3-[({4',5'-difluoro-2'-[(hydroxyimino)methyl]biphenyl-4-yl}oxy)methyl]b-
enzoyl}-L-proline
[0399] The compound (20 mg, 0.043 mmol) of Example 43 was dissolved
in acetic acid (5 mL), and sodium acetate (45 mg, 0.56 mmol) and
hydroxylamine hydrochloride (14 mg, 0.21 mmol) were added thereto,
and stirred at 60.degree. C. for 2 hours. After that, acetic
anhydride (0.026 mL, 0.28 mmol) was added thereto, and stirred at
100.degree. C. for 2 hours. After cooling, the solvent was
distilled away, and the resulting residue was purified by
reversed-phase HPLC in the same manner as in Step 2 of Example 1 to
thus obtain the title compound.
[0400] Yield: 7 mg (0.015 mmol), percentage yield: 34%
[0401] MS (ESI, m/z) 481 [M+H].sup.+
Example 53
1-(3-{[4-(3-cyano-4,5-difluoro-1-benzofuran-7-yl)phenoxy]methyl}benzoyl-L--
proline
Step 1 Synthesis of
7-bromo-3-bromomethyl-4,5-difluoro-1-benzofuran
[0402] the compound (2.6 g, 10.5 mmol) of Step 1 of Example 21, NBS
(2.06 g, 11.58 mmol), BPO (catalytic amount), and carbon
tetrachloride (120 mL) were added, and heated under reflux
overnight. After cooling, the solvent was distilled away. After
diluted with ethyl acetate, the resultant was washed with water and
saturated brine, and then dried over anhydrous magnesium sulfate.
The solvent was distilled away, and the resulting residue was
purified by silica gel chromatography (hexane/ethyl acetate) to
thus obtain the title compound.
[0403] Yield: 1.47 g (4.51 mmol), percentage yield: 43%
Step 2 Synthesis of
7-bromo-4,5-difluoro-3-hydroxymethyl-1-benzofuran
[0404] The compound (1.47 g, 4.51 mmol) obtained in Step 1 was
dissolved in acetonitrile (50 mL), and potassium acetate (660 mg,
6.76 mmol) was added thereto, and stirred at 60.degree. C. for 3
hours. After cooling, the solvent was distilled away, and to the
resulting residue, methanol (20 mL) and potassium carbonate (1.56
g, 11.28 mmol) were added, and stirred at room temperature for 2
hours. The solvent was distilled away. After diluted with ethyl
acetate, the resultant was washed with water and saturated brine,
and then dried over anhydrous magnesium sulfate. The solvent was
distilled away, and the resulting residue was purified by silica
gel chromatography (hexane/ethyl acetate) to thus obtain the title
compound.
[0405] Yield: 900 mg (3.42 mmol), percentage yield: 76%
Step 3 Synthesis of 7-bromo-4,5-difluoro-3-formyl-1-benzofuran
[0406] The compound obtained in Step 2 (700 mg, 2.66 mmol) was
dissolved in dichloromethane (50 mL), and manganese dioxide (1.4 g)
was added thereto, and stirred at room temperature overnight. After
filtration, the solvent was distilled away, and the resulting
residue was purified by silica gel chromatography (hexane/ethyl
acetate) to thus obtain the title compound.
[0407] Yield: 400 mg (1.53 mmol), percentage yield: 58%
Step 4 Synthesis of 7-bromo-3-cyano-4,5-difluoro-1-benzofuran
[0408] The compound (360 mg, 1.38 mmol) obtained in Step 3 was
dissolved in acetic acid (5 mL), and sodium acetate (450 mg, 5.5
mmol) and hydroxylamine hydrochloride (140 mg, 2.1 mmol) were added
thereto, and stirred at 60.degree. C. for 2 hours. After that,
acetic anhydride (0.26 mL, 2.75 mmol) was added thereto, and
stirred at 100.degree. C. for 2 hours. After cooling, the solvent
was distilled away, and the resulting residue was purified by
silica gel chromatography (hexane/ethyl acetate) to thus obtain the
title compound.
[0409] Yield: 290 mg (1.12 mmol), percentage yield: 81%
Step 5 Synthesis of Compound of Example 53
[0410] An operation similar to that in Step 2 of Example 15 was
performed using the compound (290 mg, 1.12 mmol) obtained in Step 4
in place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the
title compound.
[0411] Yield: 70 mg (0.14 mmol), percentage yield: 12%
[0412] MS (ESI, m/z) 503 [M+H].sup.+
Example 54
1-(3-{[4-(2-cyano-4,5-difluoro-1-benzofuran-7-yl)phenoxy]methyl}benzoyl-L--
proline
Step 1 Synthesis of
7-bromo-2-bromomethyl-4,5-difluoro-1-benzofuran
[0413] An operation similar to that in Step 1 of Example 53 was
performed using the compound (2.6 g, 10.5 mmol) of Step 1 of
Example 23 in place of the compound of Step 1 of Example 21 to thus
obtain the title compound.
[0414] Yield: 3.43 g (10.5 mmol), percentage yield: 100%
[0415] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 4.56 (s, 2H), 6.95
(s, 1H), 7.35 (dd, J=10.1, 6.9 Hz, 1H).
Step 2 Synthesis of
7-bromo-4,5-difluoro-2-hydroxymethyl-1-benzofuran
[0416] An operation similar to that in Step 2 of Example 53 was
performed using the compound (1.8 g, 5.52 mmol) obtained in Step 1
in place of the compound of Step 1 of Example 53 to thus obtain the
title compound.
[0417] Yield: 1.08 g (4.1 mmol), percentage yield: 74%
[0418] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 2.01-2.12 (m, 1H),
4.81 (s, 2H), 6.88 (t, J=0.8 Hz, 1H), 7.31 (dd, J=10.1, 6.9 Hz,
1H).
Step 3 7-bromo-4,5-difluoro-2-formyl-1-benzofuran
[0419] An operation similar to that in Step 3 of Example 53 was
performed using the compound (1.08 g, 4.1 mmol) obtained in Step 2
in place of the compound of Step 2 of Example 53 to thus obtain the
title compound.
[0420] Yield: 720 mg (2.76 mmol), percentage yield: 67%
Step 4 7-bromo-2-cyano-4,5-difluoro-1-benzofuran
[0421] An operation similar to that in Step 4 of Example 53 was
performed using the compound (360 mg, 1.38 mmol) obtained in Step 3
in place of the compound of Step 3 of Example 53 to thus obtain the
title compound.
[0422] Yield: 260 mg (1.01 mmol), percentage yield: 81%
Step 5
[0423] An operation similar to that in Step 2 of Example 15 was
performed using the compound (260 mg, 1.01 mmol) obtained in Step 4
in place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the
title compound.
[0424] Yield: 140 mg (0.28 mmol), percentage yield: 24%
[0425] MS (ESI, m/z) 503 [M+H].sup.+
Example 55
1-(3-{[4-(4,5-difluoro-3-methyl-1-benzothien-7-yl)phenoxy]methyl}benzoyl)--
L-proline
Step 1 Synthesis of
7-bromo-4,5-difluoro-3-methyl-1-benzothiophene
[0426] A polyphosphoric acid (1.86 g) was suspended in
chlorobenzene (8 mL), and a solution (8 mL) of the compound (730
mg, 2.60 mmol) of Step 1 of Example 51 in chlorobenzene was added
thereto at 120.degree. C., and stirred at 140.degree. C. overnight.
After further stirred at 155.degree. C. two nights, the resultant
was returned to room temperature, and the reaction solution was
concentrated under reduced pressure, and diluted with ethyl
acetate. To the mixture liquid, a 1 N sodium hydroxide aqueous
solution was added under ice-cooling for the neutralization, and
the insoluble material was filtered off. The filtrate was extracted
with ethyl acetate, washed with saturated brine, and then dried
over anhydrous magnesium sulfate. The resultant was concentrated
under reduced pressure. The resulting residue was purified by
silica gel chromatography (hexane) to thus obtain the title
compound.
[0427] Yield: 430 mg (1.63 mmol), percentage yield: 63%
[0428] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta.2.57 (dd, J=2.5,
1.2 Hz, 3H), 7.11-7.13 (m, 1H), 7.32-7.38 (m, 1H).
Step 2 Synthesis of Compound of Example 55
[0429] An operation similar to that in Step 2 of Example 15 was
performed using the compound (32.9 mg, 0.125 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0430] Yield: 33.4 mg (0.0658 mmol), percentage yield: 53%
[0431] MS (ESI, m/z) 508 [M+H].sup.+
[0432] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.76-2.32 (m,
4H), 2.56 (d, J=1.5 Hz, 3H), 3.43-3.63 (m, 2H), 4.32-4.46 (m, 1H),
5.16-5.31 (m, 2H), 7.16-7.21 (m, 2H), 7.32-7.66 (m, 8H), 12.62 (br
s, 1H).
Example 56
1-[3-({4-[4,5-difluoro-3-(hydroxymethyl)-1-benzofuran-7-yl]phenoxy}methyl)-
benzoyl]-L-proline
[0433] An operation similar to that in Step 2 of Example 15 was
performed using the compound (39.5 mg, 0.150 mmol) of Step 2 of
Example 53 in place of 7-bromo-4,5-difluoro-1-benzofuran to thus
obtain the title compound.
[0434] Yield: 18.2 mg (0.0359 mmol), percentage yield: 24%
[0435] MS (ESI, m/z) 508 [M+H].sup.+
[0436] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.76-2.32 (m,
4H), 3.39-3.61 (m, 2H), 4.32-4.44 (m, 1H), 4.62-4.72 (m, 2H),
5.16-5.31 (m, 2H), 7.14-7.21 (m, 2H), 7.40-7.64 (m, 5H), 7.77-7.84
(m, 2H), 8.02 (s, 1H), 12.71 (br s, 1H).
Example 57
1-{3-[(4-{2-[amino(hydroxyimino)methyl]4,5-difluoro-1-benzofuran-7-yl}phen-
oxy)methyl]benzoyl}-L-proline
[0437] The compound (20 mg, 0.04 mmol) of Example 54 was dissolved
in ethanol (5 mL), and hydroxylamine hydrochloride (14 mg, 0.21
mmol) and triethylamine (0.058 mL, 0.42 mmol) were added thereto,
and stirred at room temperature for 2 hours. After that, the
solvent was distilled away, and the resulting residue was purified
by reversed-phase HPLC in the same manner as in Step 2 of Example 1
to thus obtain the title compound.
[0438] Yield: 4.4 mg (0.008 mmol), percentage yield: 20%
[0439] MS (ESI, m/z) 536 [M+H].sup.+
Example 58
1-{3-[(4-{4,5-difluoro-2-[(hydroxyimino)methyl]-1-benzofuran-7-yl}phenoxy)-
methyl]benzoyl}-L-proline
[0440] The compound (20 mg, 0.04 mmol) of Example 54 was dissolved
in acetic acid (5 mL), and sodium acetate (45 mg, 0.56 mmol) and
hydroxylamine hydrochloride (14 mg, 0.21 mmol) were added thereto,
and at 60.degree. C. for 2 hours and stirred. After that, acetic
anhydride (0.026 mL, 0.28 mmol) were added to, at 100.degree. C.
for 2 hours and stirred. After cooling, the solvent was distilled
away, and the resulting residue was purified by reversed-phase HPLC
in the same manner as in Step 2 of Example 1 to thus obtain the
title compound.
[0441] Yield: 3 mg (0.006 mmol), percentage yield: 15%
[0442] MS (ESI, m/z) 521 [M+H].sup.+
Example 59
2S)-1-(3-{[4-(4,5-difluoro-1-benzofuran-7-yl)phenoxy]methyl}benzoyl)
azetidine-2-carboxylic acid
Step 1 Synthesis of
3-{[4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy]methyl}benzoic
acid
[0443] DMF (125 mL) was added to
4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenol (8.46 g, 38
mmol), methyl 3-(bromomethyl)benzoate (8.8 g, 38 mmol), and
potassium carbonate (10.6 g, 77 mmol), and stirred at room
temperature overnight. The resultant was diluted with ethyl
acetate, washed with water and saturated brine, and then dried over
anhydrous magnesium sulfate. The solvent was distilled away under
reduced pressure, and to the resulting residue, methanol (150 mL),
water (30 mL), and lithium hydroxide (4.8 g, 114 mmol) were added,
and stirred at room temperature overnight. After the solvent was
distilled away under reduced pressure, the resultant was diluted
with ethyl acetate, then washed with 1 N hydrochloric acid and
saturated brine, and dried over anhydrous magnesium sulfate. After
the solvent was distilled away under reduced pressure, the solid
was collected by filtration.
[0444] Yield: 7.17 g (20.3 mmol), percentage yield: 53%
Step 2 Synthesis of
3-{[4-(4,5-difluoro-1-benzofuran-7-yl)-phenoxy]methyl}benzoic
acid
[0445] To the compound (1.67 g, 4.72 mmol) obtained in Step 1,
7-bromo-4,5-difluoro-1-benzofuran (1.1 g, 4.72 mmol), sodium
carbonate (1.0 g, 9.44 mmol), and Pd(dppf)Cl2 (catalytic amount),
1,4-dioxane (24 mL) and water (8 mL) were added, and stirred at
100.degree. C. for 2 hours. The reaction solution was concentrated
under reduced pressure. To the residue, ethyl acetate and 1 N
hydrochloric acid were added and stirred. After that, the insoluble
material was filtered off, and extraction was performed with ethyl
acetate. The organic phase was washed with saturated brine, and
then dried over anhydrous magnesium sulfate. The solvent was
distilled away under reduced pressure, and the solid was collected
by filtration.
[0446] Yield: 1.43 g (3.76 mmol), percentage yield: 79%
[0447] MS (ESI, m/z) 381 [M+H].sup.+
Step 3 Synthesis of Compound of Example 59
[0448] An operation similar to that in Step 4 of Example 10 was
performed using the compound (38.0 mg, 0.100 mmol) of Step 2 in
place of
3-{[4-(5-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoic
acid, and (2S)-azetidine-2-carboxylic acid (30.3 mg, 0.300 mmol) in
place of L-proline to thus obtain the title compound.
[0449] Yield: 7.75 mg (0.0167 mmol), percentage yield: 17%
[0450] MS (ESI, m/z) 464 [M+H].sup.+
[0451] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 2.90-3.04 (m,
3H), 3.96 (s, 1H), 4.15 (s, 1H), 5.18-5.30 (m, 2H), 7.15-7.22 (m,
2H), 7.23 (d, J=2.3 Hz, 1H), 7.35-7.65 (m, 5H), 7.80-7.86 (m, 2H),
8.19 (d, J=2.2 Hz, 1H), 12.83 (br s, 1H).
Example 60
1-(3-{[4-(4,5-difluoro-1-benzofuran-7-yl)-2-fluorophenoxy]methyl}benzoyl)--
L-proline
Step 1 Synthesis of
3-{[4-(4,5-difluorobenzofuran-7-yl)-2-fluoro-phenoxy]methyl}benzoic
acid
[0452] 1,4-Dioxane (12 mL) and water (4 mL) were added to
2-fluoro-4-hydroxyphenylboronic acid (475 mg, 3.0 mmol),
7-bromo-4,5-difluoro-1-benzofuran (590 mg, 2.53 mmol), sodium
carbonate (540 mg, 5.1 mmol), and Pd(dppf)Cl2 (catalytic amount),
and stirred at 100.degree. C. for 2 hours. The reaction solution
was concentrated under reduced pressure. To the residue, ethyl
acetate and 1 N hydrochloric acid were added and stirred. After
that, the insoluble material was filtered off, and extraction was
performed with ethyl acetate. The organic phase was washed with
saturated brine, and then dried over anhydrous magnesium sulfate.
The solvent was distilled away under reduced pressure. Then, to the
resulting residue, methyl 3-(bromomethyl)benzoate (595 mg, 2.6
mmol), potassium carbonate (414 mg, 3.0 mmol), and DMF (4 mL) were
added, and stirred overnight. After diluted with ethyl acetate, the
resultant was washed with water and saturated brine, and dried over
anhydrous magnesium sulfate. The solvent was distilled away under
reduced pressure. To the resulting residue, methanol (5 mL), water
(2 mL), THF (5 mL), and lithium hydroxide (210 mg, 5.0 mmol) were
added, and stirred at room temperature overnight. The reaction
solution was concentrated under reduced pressure, and extraction
was performed with ethyl acetate. The organic phase was washed with
saturated brine, and then dried over anhydrous magnesium sulfate.
After the solvent was distilled away under reduced pressure, the
resulting solid was collected by filtration to thus obtain the
title compound.
[0453] Yield: 241 mg (0.60 mmol), percentage yield: 24%
Step 2 Synthesis of Compound of Example 60
[0454] A similar operation similar to that in Step 4 of Example 10
was performed using the compound (40.0 mg, 0.100 mmol) of Step 1 in
place of
3-{[4-(5-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoic
acid to thus obtain the title compound.
[0455] Yield: 21.7 mg (0.0559 mmol), percentage yield: 55%
[0456] MS (ESI, m/z) 496 [M+H].sup.+
[0457] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.74-2.02 (m,
3H), 2.21-2.35 (m, 1H), 3.49-3.54 (m, 2H), 4.33-4.46 (m, 1H),
5.26-5.38 (m, 2H), 7.25 (d, J=2.2 Hz, 1H), 7.34-7.74 (m, 7H), 7.80
(dd, J=12.8, 2.1 Hz, 1H), 8.21 (d, J=2.2 Hz, 1H), 12.57 (br s,
1H).
Example 61
1-[3-({[2'-(cyanomethyl)-4',5'-difluorobiphenyl-4-yl]oxy}methyl)benzoyl]-L-
-proline
Step 1 Synthesis of 2-(2-bromo-4,5-difluorophenyl)acetamide
[0458] 2-Bromo-4,5-difluorophenylacetic acid (251 mg, 1.00 mmol)
was dissolved in thionyl chloride (3 mL), and stirred at 50.degree.
C. for 30 minutes. The resultant was concentrated under reduced
pressure, and the residue was dissolved in dichloromethane (5 mL).
After that, 28% ammonia water (1 mL) were added thereto under
ice-cooling, and stirred at room temperature for 1 hour. To the
reaction solution, ammonium carbonate (50 mg) was added, and
further stirred at room temperature for 1 hour. Then, 1 N
hydrochloric acid was added thereto until the resultant became
acidic under ice-cooling. The reaction solution was extracted with
ethyl acetate, and the organic phase was washed with a saturated
aqueous sodium hydrogen carbonate solution and saturated brine, and
then dried over anhydrous magnesium sulfate. The solvent was
distilled away under reduced pressure to thus obtain the title
compound without purification.
[0459] Yield: 186 mg (0.744 mmol), percentage yield: 74%
[0460] MS (ESI, m/z) 250 [M+H].sup.+
[0461] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 3.56 (s, 2H),
7.24 (d, J=174.2 Hz, 2H), 7.51 (dd, J=11.7, 8.6 Hz, 1H), 7.80 (dd,
J=10.3, 7.8 Hz, 1H).
Step 2 Synthesis of (2-bromo-4,5-difluorophenyl)acetonitrile
[0462] The compound (143 mg, 0.572 mmol) of Step 1 was dissolved in
THF. Pyridine (0.138 mL, 1.71 mmol) was added thereto,
trifluoroacetic anhydride (0.119 mL, 0.858 mmol) was added thereto
at -5.degree. C. to 0.degree. C., and stirred at room temperature
for 1 hour. The reaction solution was concentrated under reduced
pressure. After diluted with ethyl acetate, the resultant was
washed with 1 N hydrochloric acid, a saturated aqueous sodium
hydrogen carbonate solution, and saturated brine, and then dried
over anhydrous magnesium sulfate. The solvent was distilled away
under reduced pressure to thus obtain the title compound without
purification.
[0463] Yield: 126 mg (0.543 mmol), percentage yield: 95%
[0464] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 3.79 (s, 2H),
7.38-7.44 (m, 1H), 7.44-7.50 (m, 1H).
Step 3 Synthesis of Compound of Example 61
[0465] An operation similar to that in Step 2 of Example 15 was
performed using the compound (34.3 mg, 0.148 mmol) of Step 2 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0466] Yield: 41.4 mg (0.0869 mmol), percentage yield: 59%
[0467] MS (ESI, m/z) 477 [M+H].sup.+
[0468] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.77-2.33 (m,
4H), 3.43-3.63 (m, 2H), 3.88 (s, 2H), 4.30-4.46 (m, 1H), 5.14-5.26
(m, 2H), 7.14 (d, J=8.6 Hz, 2H), 7.29-7.68 (m, 8H), 12.54 (br s,
1H).
Example 62
1-(3-{[4-(4,5-difluoro-2-methyl-1-benzothien-7-yl)phenoxy]methyl}benzoyl)--
L-proline
Step 1 Synthesis of
7-bromo-4,5-difluoro-2-methyl-1-benzothiophene
[0469] 2-Bromo-4,5-difluorothiophenol (4.68 g, 20.8 mmol),
2,3-dichloro-1-propene (2.1 mL, 22.9 mmol), potassium carbonate
(3.45 g, 24.9 mmol), and acetone (100 mL) were added, and stirred
at 60.degree. C. for 2 hours. The solvent was distilled away under
reduced pressure, and after diluted with ethyl acetate, the
resultant was washed with water and saturated brine, and then dried
over anhydrous magnesium sulfate. The solvent was distilled away,
and to the resulting residue, dimethylaniline (50 mL) was added,
and stirred at 220.degree. C. overnight. After cooling, ethyl
acetate and a 2 N hydrochloric acid aqueous solution were added to
the reaction solution and stirred. After the insoluble material was
filtered off, extraction was performed with ethyl acetate. The
organic phase was washed with a saturated aqueous sodium hydrogen
carbonate solution and saturated brine, and then dried over
anhydrous magnesium sulfate. The solvent was distilled away under
reduced pressure. The resulting residue was purified by silica gel
chromatography (hexane) to thus obtain the title compound.
[0470] Yield: 4.12 g (15.66 mmol), percentage yield: 75%
[0471] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 2.61 (d, J=1.2 Hz,
3H), 7.18-7.21 (m, 1H), 7.27-7.31 (m, 1H).
Step 2 Synthesis of Compound of Example 62
[0472] An operation similar to that in Step 2 of Example 15 was
performed using the compound (38.9 mg, 0.148 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0473] Yield: 36.9 mg (0.0727 mmol), percentage yield: 49%
[0474] MS (ESI, m/z) 508 [M+H].sup.+
[0475] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.75-2.33 (m,
4H), 2.58 (s, 3H), 3.45-3.64 (m, 2H), 4.32-4.45 (m, 1H), 5.16-5.33
(m, 2H), 7.15-7.22 (m, 2H), 7.32-7.66 (m, 8H), 12.59 (s, 1H).
Example 63
N-(3-{[4-(4,5-difluoro-1-benzofuran-7-yl)phenoxy]methyl}benzoyl)-N-methyl--
L-alanine
[0476] An operation similar to that in Step 4 of Example 10 was
performed using the compound (38.0 mg, 0.100 mmol) of Step 2 of
Example 59 in place of
3-{[4-(5-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoic
acid, and N-methyl-L-alanine (30.9 mg, 0.300 mmol) in place of
L-proline to thus obtain the title compound.
[0477] Yield: 17.4 mg (0.0374 mmol), percentage yield: 37%
[0478] MS (ESI, m/z) 466 [M+H].sup.+
[0479] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.29-1.47 (m,
3H), 2.81-2.91 (m, 3H), 4.23-4.99 (m, 1H), 5.25 (s, 2H), 7.15-7.21
(m, 2H), 7.23 (d, J=2.3 Hz, 1H), 7.27-7.66 (m, 5H), 7.82 (d, J=8.7
Hz, 2H), 8.18 (d, J=2.2 Hz, 1H), 12.98 (br s, 1H).
Example 64
(2S)-1-(3-{[4-(4,5-difluoro-1-benzofuran-7-yl)phenoxy]methyl}benzoyl)-2,5--
dihydro-1H-pyrrole-2-carboxylic acid
[0480] An operation similar to that in Step 4 of Example 10 was
performed using the compound (38.0 mg, 0.100 mmol) of Step 2 of
Example 59 in place of
3-{[4-(5-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoic
acid, and (2S)-2,5-dihydro-1H-pyrrole-2-carboxylic acid (14.7 mg,
0.130 mmol) in place of L-proline to thus obtain the title
compound.
[0481] Yield: 14.1 mg (0.0297 mmol), percentage yield: 30%
[0482] MS (ESI, m/z) 476 [M+H].sup.+
[0483] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 4.10-4.20 (m,
1H), 4.31-4.41 (m, 1H), 5.16-5.32 (m, 3H), 5.84-5.97 (m, 1H),
6.00-6.19 (m, 1H), 7.15-7.22 (m, 2H), 7.23 (d, J=2.3 Hz, 1H),
7.41-7.69 (m, 5H), 7.79-7.86 (m, 2H), 8.19 (d, J=2.2 Hz, 1H), 12.98
(br s, 1H).
Example 65
1-(3-{[4-(4,5-difluoro-2-formyl-1-benzothien-7-yl)phenoxy]methyl}benzoyl)--
L-proline
Step 1 Synthesis of
7-bromo-2-(bromomethyl)-4,5-difluoro-1-benzothiophene
[0484] An operation similar to that in Step 1 of Example 53 was
performed using the compound (386 mg, 1.47 mmol) of Step 1 of
Example 62 in place of the compound of Step 1 of Example 21 to thus
obtain the title compound.
[0485] Yield: 500 mg (1.47 mmol), percentage yield: 99%
Step 2 Synthesis of
7-bromo-4,5-difluoro-2-formyl-1-benzothiophene
[0486] Operations similar to those in Steps 2 and 3 of Example 53
were performed using 500 mg (1.47 mmol) of the compound obtained in
Step 1 in place of the compound of Step 1 of Example 53 to thus
obtain the title compound.
[0487] Yield: 244 mg (0.87 mmol), percentage yield: 59%
Step 3 Synthesis of Compound of Example 65
[0488] An operation similar to that in Step 2 of Example 15 was
performed using the compound (244 mg, 0.87 mmol) obtained in Step 2
in place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the
title compound.
[0489] Yield: 55 mg (0.11 mmol), percentage yield: 12%
[0490] MS (ESI, m/z) 522 [M+H].sup.+
Example 66
1-[3-({4-[4,5-difluoro-2-(hydroxymethyl)-1-benzothien-7-yl]phenoxy}methyl)-
benzoyl]-L-proline
[0491] The compound (12 mg, 0.022 mmol) of Example 65 was dissolved
in methanol (2 mL), and sodium borohydride (2 mg, 0.045 mmol) was
stirred at room temperature for 1 hour. The reaction solution was
purified by reversed-phase HPLC in the same manner as in Step 2 of
Example 1 to thus obtain the title compound.
[0492] Yield: 3 mg (0.006 mmol), percentage yield: 27%
[0493] MS (ESI, m/z) 520 [M+H].sup.+
Example 67
1-(3-{[4-(2-cyano-4,5-difluoro-1-benzothien-7-yl)phenoxy]methyl}benzoyl)-L-
-proline
[0494] The compound (75 mg, 0.14 mmol) of Example 65 was dissolved
in acetic acid (5 mL), and sodium acetate (45 mg, 0.56 mmol) and
hydroxylamine hydrochloride (14 mg, 0.21 mmol) were added thereto,
and stirred at 60.degree. C. for 2 hours. After that, acetic
anhydride (0.026 mL, 0.28 mmol) was added thereto, and stirred at
100.degree. C. for 2 hours. After cooling, the solvent was
distilled away, and the resulting residue was purified by
reversed-phase HPLC in the same manner as in Step 2 of Example 1 to
thus obtain the title compound.
[0495] Yield: 13 mg (0.025 mmol), percentage yield: 18%
[0496] MS (ESI, m/z) 519 [M+H].sup.+
Example 68
(4R)-3-(3-{[4-(4,5-difluoro-1-benzofuran-7-yl)phenoxy]methyl}benzoyl)-1,3--
thiazolidine-4-carboxylic acid
[0497] An operation similar to that in Step 4 of Example 10 was
performed using the compound (38.0 mg, 0.100 mmol) of Step 2 of
Example 59 in place of
3-{[4-(5-fluoro-2,3-dihydro-1-benzofuran-7-yl)phenoxy]methyl}benzoic
acid, and (4R)-1,3-thiazolidine-4-carboxylic acid (40.0 mg, 0.300
mmol) in place of L-proline to thus obtain the title compound.
[0498] Yield: 1.41 mg (0.00285 mmol), percentage yield: 2.8%
[0499] MS (ESI, m/z) 496 [M+H].sup.+
[0500] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 2.83-3.05 (m,
2H), 3.96-4.31 (m, 2H), 4.30-5.74 (m, 3H), 7.15-7.22 (m, 2H), 7.23
(d, J=2.3 Hz, 1H), 7.45-7.67 (m, 5H), 7.79-7.85 (m, 2H), 8.19 (d,
J=2.2 Hz, 1H).
Example 69
1-{3-[({4',5'-difluoro-2'-[(2-hydroxyethyl)thio]biphenyl-4-yl}oxy)methyl]b-
enzoyl}-L-proline
[0501] 2-Bromo-4,5-difluorothiophenol (438 mg, 1.95 mmol), ethylene
carbonate (260 mg, 2.92 mmol), potassium carbonate (400 mg, 2.92
mmol), and DMF (10 ml) were added, and stirred at 100.degree. C.
for 2 hours. After diluted with ethyl acetate, the resultant was
washed with water and saturated brine, and then dried over
anhydrous magnesium sulfate. The solvent was distilled away, and
the resulting residue was purified by silica gel chromatography
(hexane). After that, an operation similar to that in Step 2 of
Example 15 was performed using the above-obtained compound (60 mg,
0.22 mmol) in place of 7-bromo-4,5-difluoro-1-benzofuran to thus
obtain the title compound.
[0502] Yield: 5 mg (0.01 mmol), percentage yield: 4%
[0503] MS (ESI, m/z) 515 [M+H].sup.+
Example 70
1-[3-({4-[4,5-difluoro-2-(hydroxymethyl)-1-benzofuran-7-yl]phenoxy}methyl)-
benzoyl]-L-proline
[0504] An operation similar to that in Step 2 of Example 15 was
performed using the compound (44.7 mg, 0.170 mmol) of Step 2 of
Example 53 in place of 7-bromo-4,5-difluoro-1-benzofuran to thus
obtain the title compound.
[0505] Yield: 12.0 mg (0.0236 mmol), percentage yield: 14%
[0506] MS (ESI, m/z) 508 [M+H].sup.+
Example 71
1-{3-[({2'-[(cyanomethyl)thio]-4',5'-difluorobiphenyl-4-yl}oxy)methyl]benz-
oyl}-L-proline
Step 1 Synthesis of
[(2-bromo-4,5-difluorophenyl)thio]acetonitrile
[0507] An operation similar to that in Step 1 of Example 38 was
performed using bromoacetonitrile (0.167 mL, 2.40 mmol) in place of
iodomethane to thus obtain the title compound.
[0508] Yield: 500 mg (1.89 mmol), percentage yield: 95%
[0509] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 3.65 (s, 2H),
7.56-7.49 (m, 2H).
Step 2 Synthesis of Compound of Example 71
[0510] An operation similar to that in Step 2 of Example 15 was
performed using the compound (44.9 mg, 0.170 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0511] Yield: 21.4 mg (0.0421 mmol), percentage yield: 25%
[0512] MS (ESI, m/z) 509 [M+H].sup.+
[0513] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.76-2.34 (m,
4H), 3.41-3.62 (m, 2H), 4.19 (s, 2H), 4.31-4.45 (m, 1H), 5.14-5.28
(m, 2H), 7.08-7.14 (m, 2H), 7.27-7.36 (m, 2H), 7.41-7.63 (m, 5H),
7.71 (dd, J=11.4, 7.8 Hz, 1H), 12.64 (br s, 1H).
Example 72
1-{3-[({2'-[(2-cyanoethyl)thio]-4',5'-difluorobiphenyl-4-yl}oxy)methyl]ben-
zoyl}-L-proline
Step 1 Synthesis of
3-[(2-bromo-4,5-difluorophenyl)thio]propanenitrile
[0514] An operation similar to that in Step 1 of Example 38 was
performed using 3-bromopropionitrile (0.196 mL, 2.40 mmol) in place
of iodomethane to thus obtain the title compound.
[0515] Yield: 538 mg (1.89 mmol), percentage yield: 97%
[0516] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 2.65 (t, J=7.2 Hz,
1H), 3.16 (t, J=7.2 Hz, 1H), 7.32 (dd, J=10.0, 7.8 Hz, 1H), 7.49
(dd, J=9.4, 7.5 Hz, 1H).
Step 2 Synthesis of Compound of Example 72
[0517] An operation similar to that in Step 2 of Example 15 was
performed using the compound (47.3 mg, 0.170 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0518] Yield: 21.5 mg (0.0411 mmol), percentage yield: 24%
[0519] MS (ESI, m/z) 523 [M+H].sup.+
[0520] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.75-2.32 (m,
4H), 2.76 (t, J=6.9 Hz, 2H), 3.16 (t, J=6.9 Hz, 2H), 3.42-3.61 (m,
2H), 4.32-4.45 (m, 1H), 5.13-5.26 (m, 2H), 7.06-7.13 (m, 2H),
7.28-7.54 (m, 5H), 7.56-7.68 (m, 3H), 12.54 (br s, 1H).
Example 73
Synthesis of
1-[3-({4-[4,5-difluoro-2-(methoxymethyl)-1-benzofuran-7-yl]phenoxy}methyl-
)benzoyl]-L-proline
Step 1 7-bromo-4,5-difluoro-2-(methoxymethyl)-1-benzofuran
[0521] The compound (489 mg, 1.50 mmol) of Step 1 of Example 54 was
dissolved in methanol (7 mL), and a 25% sodium methoxide methanol
solution (1.5 mL) were added thereto, and heated under reflux for 3
hours. The resultant was returned to room temperature, and the
solvent was distilled away under reduced pressure. The resulting
residue was diluted with ethyl acetate, washed with water and
saturated brine, and then dried over anhydrous magnesium sulfate.
The solvent was distilled away under reduced pressure. The
resulting residue was purified by silica gel chromatography
(hexane/ethyl acetate) to thus obtain the title compound.
[0522] Yield: 334 mg (1.21 mmol), percentage yield: 80%
[0523] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 3.48 (s, 3H), 4.57
(d, J=0.5 Hz, 2H), 6.87-6.90 (m, 1H), 7.31 (dd, J=10.1, 6.9 Hz,
1H).
Step 2 Synthesis of Compound of Example 73
[0524] An operation similar to that in Step 2 of Example 15 was
performed using the compound (47.1 mg, 0.170 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0525] Yield: 56.5 mg (0.108 mmol), percentage yield: 64%
[0526] MS (ESI, m/z) 522 [M+H].sup.+
[0527] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.75-2.35 (m,
4H), 3.33 (s, 3H), 3.40-3.62 (m, 2H), 4.31-4.44 (m, 1H), 4.58 (s,
2H), 5.18-5.30 (m, 2H), 7.16-7.22 (m, 3H), 7.32-7.64 (m, 5H),
7.79-7.84 (m, 2H), 12.54 (br s, 1H).
Example 74
1-[3-({4-[4,5-difluoro-2-(methoxymethyl)-1-benzothien-7-yl]phenoxy}methyl)-
benzoyl]-L-proline
Step 1 Synthesis of
7-bromo-4,5-difluoro-2-(methoxymethyl)-1-benzothiophene
[0528] An operation similar to that in Step 1 of Example 73 was
performed using the compound (121 mg, 0.354 mmol) of Step 1 of
Example 65 in place of the compound of Step 1 of Example 54 to thus
obtain the title compound without purification.
[0529] Yield: 102 mg (0.348 mmol), percentage yield: 98%
[0530] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 3.46 (s, 3H), 4.71
(d, J=0.9 Hz, 2H), 7.35 (dd, J=9.7, 6.4 Hz, 1H), 7.40-7.43 (m,
1H).
Step 2 Synthesis of Compound of Example 74
[0531] An operation similar to that in Step 2 of Example 15 was
performed using the compound (44.0 mg, 0.150 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0532] Yield: 38.5 mg (0.0716 mmol), percentage yield: 48%
[0533] MS (ESI, m/z) 538 [M+H].sup.+
[0534] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.75-2.01 (m,
3H), 2.21-2.31 (m, 1H), 3.33 (s, 3H), 3.42-3.62 (m, 2H), 4.33-4.45
(m, 1H), 4.72 (s, 2H), 5.19-5.29 (m, 2H), 7.16-7.23 (m, 2H),
7.32-7.69 (m, 8H), 12.54 (br s, 1H).
Example 75
1-{3-[(4-{2-[(dimethylamino)methyl]-4,5-difluoro-1-benzothien-7-yl}phenoxy-
)methyl]benzoyl}-L-proline trifluoroacetic acid salt
Step 1 Synthesis of
[(7-bromo-4,5-difluoro-1-benzothien-2-yl)methyl]dimethylamine
[0535] Acetonitrile (1 mL) was added to a solution (0.5 mL) of 2.0
M dimethylamine in THF, and a solution (2 mL) of the compound (121
mg, 0.354 mmol) of Step 1 of Example 65 in acetonitrile was added
dropwise under ice-cooling, and stirred at room temperature
overnight. The solvent was distilled away under reduced pressure.
The resulting residue was diluted with ethyl acetate, washed with a
saturated aqueous sodium hydrogen carbonate solution, and then
dried over anhydrous sodium sulfate. The solvent was distilled away
under reduced pressure to thus obtain the title compound.
[0536] Yield: 109 mg (0.356 mmol), percentage yield:
quantitative
[0537] MS (ESI, m/z) 307 [M+H].sup.+
[0538] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta. 2.35 (s, 6H), 3.72
(s, 2H), 7.30-7.36 (m, 2H).
Step 2 Synthesis of Compound of Example 75
[0539] An operation similar to that in Step 2 of Example 15 was
performed using the compound (45.9 mg, 0.150 mmol) of Step 1 in
place of 7-bromo-4,5-difluoro-1-benzofuran to thus obtain the title
compound.
[0540] Yield: 41.2 mg (0.0620 mmol), percentage yield: 41%
[0541] MS (ESI, m/z) 551 [M+H].sup.+
[0542] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) .delta. 1.75-2.32 (m,
4H), 2.81 (s, 6H), 3.39-3.63 (m, 2H), 4.32-4.46 (m, 1H), 4.66 (s,
2H), 5.20-5.31 (m, 2H), 7.19-7.25 (m, 2H), 7.33-7.71 (m, 7H), 7.84
(s, 1H), 10.02 (br s, 1H), 12.53 (br s, 1H).
[0543] Tables 1-1 to 1-5 show structural formulas of the compounds
obtained in Examples described above.
Tables 1-1 to 1-5
TABLE-US-00001 ##STR00016## compound of Ex. 1 ##STR00017## compound
of Ex. 2 ##STR00018## compound of Ex. 3 ##STR00019## compound of
Ex. 4 ##STR00020## compound of Ex. 5 ##STR00021## compound of Ex. 6
##STR00022## compound of Ex. 7 ##STR00023## compound of Ex. 8
##STR00024## compound of Ex. 9 ##STR00025## compound of Ex. 10
##STR00026## compound of Ex. 11 ##STR00027## compound of Ex. 12
##STR00028## compound of Ex. 13 ##STR00029## compound of Ex. 14
##STR00030## compound of Ex. 15 ##STR00031## compound of Ex. 16
##STR00032## compound of Ex. 17 ##STR00033## compound of Ex. 18
##STR00034## compound of Ex. 19 ##STR00035## compound of Ex. 20
##STR00036## compound of Ex. 21 ##STR00037## compound of Ex. 22
##STR00038## compound of Ex. 23 ##STR00039## compound of Ex. 24
##STR00040## compound of Ex. 25 ##STR00041## compound of Ex. 26
##STR00042## compound of Ex. 27 ##STR00043## compound of Ex. 28
##STR00044## compound of Ex. 29 ##STR00045## compound of Ex. 30
##STR00046## compound of Ex. 31 ##STR00047## compound of Ex. 32
##STR00048## compound of Ex. 33 ##STR00049## compound of Ex. 34
##STR00050## compound of Ex. 35 ##STR00051## compound of Ex. 36
##STR00052## compound of Ex. 37 ##STR00053## compound of Ex. 38
##STR00054## compound of Ex. 39 ##STR00055## compound of Ex. 40
##STR00056## compound of Ex. 41 ##STR00057## compound of Ex. 42
##STR00058## compound of Ex. 43 ##STR00059## compound of Ex. 44
##STR00060## compound of Ex. 45 ##STR00061## compound of Ex. 46
##STR00062## compound of Ex. 47 ##STR00063## compound of Ex. 48
##STR00064## compound of Ex. 49 ##STR00065## compound of Ex. 50
##STR00066## compound of Ex. 51 ##STR00067## compound of Ex. 52
##STR00068## compound of Ex. 53 ##STR00069## compound of Ex. 54
##STR00070## compound of Ex. 55 ##STR00071## compound of Ex. 56
##STR00072## compound of Ex. 57 ##STR00073## compound of Ex. 58
##STR00074## compound of Ex. 59 ##STR00075## compound of Ex. 60
##STR00076## compound of Ex. 61 ##STR00077## compound of Ex. 62
##STR00078## compound of Ex. 63 ##STR00079## compound of Ex. 64
##STR00080## compound of Ex. 65 ##STR00081## compound of Ex. 66
##STR00082## compound of Ex. 67 ##STR00083## compound of Ex. 68
##STR00084## compound of Ex. 69 ##STR00085## compound of Ex. 70
##STR00086## compound of Ex. 71 ##STR00087## compound of Ex. 72
##STR00088## compound of Ex. 73 ##STR00089## compound of Ex. 74
##STR00090## compound of Ex. 75
Test Example 1
Measurement of Glycogen Synthase Activity
[0545] A human GYS1 expression plasmid (pCDNA3.1(+)-hGYS1) was
constructed by the following method. Using a human skeletal muscle
cDNA of Human MTC Panel I (Takara Bio Inc., 636742) as a template,
a human GYS1 gene was amplified by a PCR method using cloning
primers (Forward Primer: ATGCCTTTAAACCGCAC, Reverse Primer:
TTAGTTACGCTCCTCGC). Using the amplified human GYS1 sequence as a
template, a restriction enzyme sequence was added by a PCR method
using sub-cloning primers (Forward Primer:
CCCTCGAGACCATGCCTTTAAACCGCACTT, Reverse Primer:
GGTCTAGATTAGTTACGCTCCTCGCCCAG). Then, the human GYS1 gene was
introduced between a Xho I site and a Xba I site of pCDNA3.1(+)
(Invitrogen Corporation, V790-20).
[0546] Glycogen synthase was prepared by the following method
according to the published article (THE JOURNAL OF BIOLOGICAL
CHEMISTRY Vol. 269, No. 41: 25534-25542, 1994). Human
kidney-derived HEK293T cells were seeded in a dish (Thermo Fisher
Scientific Inc., 168381) using a 10% FBS-containing DMEM (Nacalai
Tesque, Inc., 0845874) medium, and cultured overnight. Then, using
Lipofectamine LTX (Invitrogen Corporation, 15338-100), the human
GYS1 expression vector was transfected according to the attached
manual. After culturing under conditions of 37.degree. C. and 5%
CO.sub.2 for 2 days, the resultant was dissolved in a lysis buffer
(50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 2 mM EGTA, 100 mM NaF, 1 mM
PMSF, 1 mM DTT, 1.times.Complete (Roche Diagnostics K. K.,
1873580)), homogenized, and then centrifuged at 16000.times.g at
4.degree. C. for 15 minutes. To the precipitated fraction, a lysis
buffer was added. Re-dissolved fractions were used as glycogen
synthase for evaluation.
[0547] The glycogen synthase activity was measured by the following
method. To a polystyrene 96-well plate, a solution containing 30 mM
glycylglycine (pH 7.3), 40 mM KCl, 20 mM MgCl.sub.2, 9.2% DMSO
containing one of the test compounds at various concentrations, and
10 mM glucose-6-phosphate (Sigma-Aldrich Corporation, G7879) was
added by 12 .mu.L/well.
[0548] Next, a substrate solution containing 30 mM glycylglycine
(pH 7.3), 4.3 mg/mL of glycogen (Sigma-Aldrich Corporation, G8876),
21.6 mM UDP-glucose (Sigma-Aldrich Corporation, U4625), 21.6 mM
phosphoenolpyruvic acid (Sigma-Aldrich Corporation, P0564), and
4.05 mM NADH (Sigma-Aldrich Corporation, N8129) was added by 18
.mu.L/well.
[0549] Further, an enzyme solution containing 50 mM Tris-HCl (pH
8.0), 27 mM DTT (Nacalai Tesque, Inc., 14128-04), 0.2 mg/mL of
bovine serum albumin, 0.17 mg/mL of the glycogen synthase, 1.5
.mu.L of a pyruvate kinase/lactate dehydrogenase solution
(Sigma-Aldrich Corporation, P0294) was added by 18 .mu.L/well to
prepare a reaction solution. After the reaction solution was
incubated (at 30.degree. C. for 25 minutes for Examples 1 to 10, at
37.degree. C. for 20 minutes for Examples 11 to 75), the absorbance
at 340 nm was measured using Benchmark Plus (Bio-Rad Laboratories,
Inc.).
[0550] The activities of the test compounds were calculated by the
following method. The change in the absorbance (.DELTA.A340) was
calculated by subtracting the absorbance at 340 nm of the reaction
solution containing the compound and DMSO from the absorbance at
340 nm of a reaction solution not containing the compound but
containing only DMSO. The .DELTA.A340 of the reaction solution
containing the compound of Example 1 in WO/2011/058154 at the final
concentration of 10 .mu.M was taken as 100% to calculate the
relative activity (%) of the test compounds at various
concentrations. EC50 representing the concentration of the compound
which induces an increase in the relative activity to 50% was
calculated using XLfit (idbs). Tables 2-1 and 2-2 show the
result.
TABLE-US-00002 TABLE 2-1 EC50 (.mu.M) compound of Ex. 1 0.26
compound of Ex. 2 0.59 compound of Ex. 3 0.11 compound of Ex. 4
0.25 compound of Ex. 5 0.50 compound of Ex. 6 0.33 compound of Ex.
7 0.26 compound of Ex. 8 0.82 compound of Ex. 9 0.32 compound of
Ex. 10 0.35 compound of Ex. 11 0.78 compound of Ex. 12 0.35
compound of Ex. 13 0.27 compound of Ex. 14 0.07 compound of Ex. 15
0.022 compound of Ex. 16 0.035 compound of Ex. 17 0.27 compound of
Ex. 18 0.10 compound of Ex. 19 0.031 compound of Ex. 20 0.064
compound of Ex. 21 0.054 compound of Ex. 22 0.18 compound of Ex. 23
0.11 compound of Ex. 24 0.67 compound of Ex. 25 0.40 compound of
Ex. 26 0.16 compound of Ex. 27 0.21 compound of Ex. 28 0.89
compound of Ex. 29 0.23 compound of Ex. 30 0.14 compound of Ex. 31
0.10 compound of Ex. 32 0.75 compound of Ex. 33 0.034 compound of
Ex. 34 0.017 compound of Ex. 35 0.015 compound of Ex. 36 0.11
compound of Ex. 37 0.010 compound of Ex. 38 0.029 compound of Ex.
39 0.042 compound of Ex. 40 0.11 compound of Ex. 41 0.10 compound
of Ex. 42 0.054 compound of Ex. 43 0.070 compound of Ex. 44 0.81
compound of Ex. 45 0.80 compound of Ex. 46 0.15 compound of Ex. 47
0.15 compound of Ex. 48 0.12 compound of Ex. 49 0.22 compound of
Ex. 50 0.41 compound of Ex. 51 0.083 compound of Ex. 52 0.061
compound of Ex. 53 0.61 compound of Ex. 54 0.26 compound of Ex. 55
0.085 compound of Ex. 56 0.044 compound of Ex. 57 0.14 compound of
Ex. 58 0.045 compound of Ex. 59 0.15 compound of Ex. 60 0.16
TABLE-US-00003 TABLE 2-2 EC50 (.mu.M) compound of Ex. 61 0.79
compound of Ex. 62 0.27 compound of Ex. 63 0.22 compound of Ex. 64
0.14 compound of Ex. 65 0.30 compound of Ex. 66 0.074 compound of
Ex. 67 0.59 compound of Ex. 68 0.34 compound of Ex. 69 0.13
compound of Ex. 70 0.20 compound of Ex. 71 0.038 compound of Ex. 72
0.19 compound of Ex. 73 0.065 compound of Ex. 74 0.20 compound of
Ex. 1 in 0.1~0.25 WO/2011/058154
Test Example 2
Measurement of PPAR-.alpha. Activity
[0551] The PPAR-.alpha. activity was measured according to the
published article (THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 270,
No. 22: 12953-12956, 1995).
[0552] Plasmids used for the PPAR-.alpha. activity measurement were
constructed as follows. A luciferase expression plasmid
(UASx5-TK-Luc) used was obtained by introducing a sequence, in
which five yeast GAL4-binding sequences are linked in tandem,
upstream of a thymidine kinase promoter of pTAL-Luc (Takara Bio
Inc., 6252-1). A PPAR-.alpha. receptor expression plasmid
(hGR-GAL4-hPPAR.alpha.) used was obtained by introducing a human GR
N-terminal region (1-76 aa), a yeast GAL4 DNA-binding region (1-147
aa), and a PPAR.alpha. ligand-binding region (167-468 aa) between a
Not I site and a Sal I site of pExchange-1 Core Vector (Invitrogen
Corporation, 211176).
[0553] A reporter assay was conducted by the following method using
Cercopithecus aethiops kidney-derived CV-1 cells. The CV-1 cells
were seeded in a 96-well plate (Thermo Fisher Scientific Inc.,
4938) at 2.times.10.sup.4 cells/well using a 10% FBS-containing
DMEM (Nacalai Tesque, Inc., 0845874) medium. After culturing under
conditions of 37.degree. C. and 5% CO.sub.2 for 2 hours, the
plasmids were transfected. Lipofectamine LTX (Invitrogen
Corporation, 15338-100) was used for the transfection according to
the attached manual. The plasmid solution was prepared by adding a
mixture solution of the luciferase expression plasmid and the
PPAR-.alpha. receptor expression plasmid to OPTI-MEM I (Invitrogen
Corporation, 11058-021). After the transfection was conducted, the
test compound was added, and cultured at 37.degree. C. in the
presence of 5% CO.sub.2 for 18 to 20 hours. After the culturing was
completed, the luciferase activity was measured with Luminescensor
JNR (ATTO) using Bright-Glo (Promega Corporation, E2620).
[0554] The fold induction of PPAR-.alpha. by the test compounds was
calculated by the following method. For the compounds of Examples
1, 4, 5, 7, and 9, PPAR-.alpha. relative fold induction (%) was
defined as 100 (A/B), where A represents the maximum value of
PPAR-.alpha. activities with the test compound at 0.3 .mu.M, 1
.mu.M, 3 .mu.M, 10 .mu.M, 30 .mu.M, and 100 .mu.M, and B represents
the PPAR-.alpha. activity with the compound in WO/2011/058154 at
100 .mu.M. For the compounds of Examples 11, 15, 19, 22, 26, and
32, PPAR-.alpha. relative fold induction (%) was defined as 100
(A/B), where A represents the maximum value of PPAR-.alpha.
activities with the test compound at 3 .mu.M, 10 .mu.M, 30 .mu.M,
and 100 .mu.M, and B represents the PPAR-.alpha. activity with the
compound in WO/2011/058154 at 100 .mu.M. Table 3 shows the
result.
TABLE-US-00004 TABLE 3 PPAR.alpha. relative fold induction (%)
compound of Ex. 1 10 compound of Ex. 4 17 compound of Ex. 5 10
compound of Ex. 7 17 compound of Ex. 9 11 compound of Ex. 11 18
compound of Ex. 15 20 compound of Ex. 19 12 compound of Ex. 22 15
compound of Ex. 26 13 compound of Ex. 32 3 compound of Ex. 40 10
compound of Ex. 42 13 compound of Ex. 43 11 compound of Ex. 44 10
compound of Ex. 49 17 compound of Ex. 50 15 compound of Ex. 51 15
compound of Ex. 52 18 compound of Ex. 53 15 compound of Ex. 56 6.4
compound of Ex. 58 19 compound of Ex. 61 10 compound of Ex. 65 11
compound of Ex. 66 18 compound of Ex. 69 8.6 compound of Ex. 70 7.9
compound of Ex. 71 8.6 compound of Ex. 72 15 compound of Ex. 1 in
100 WO/2011/058154
Sequence CWU 1
1
4117DNAArtificial SequenceForward Primer 1atgcctttaa accgcac
17217DNAArtificial SequenceReverse Primer 2ttagttacgc tcctcgc
17330DNAArtificial SequenceForward Primer 3ccctcgagac catgccttta
aaccgcactt 30429DNAArtificial SequenceReverse Primer 4ggtctagatt
agttacgctc ctcgcccag 29
* * * * *