U.S. patent application number 14/991756 was filed with the patent office on 2016-05-12 for mammalian receptors as targets for antibody and active vaccination therapy against mold infections.
The applicant listed for this patent is LOS ANGELES BIOMEDICAL RESEARCH INSTITUTE AT HARBOR-UCLA MEDICAL CENTER. Invention is credited to John E. Edwards, Scott Filler, Yue Fu, Ashraf S. Ibrahim, Mingfu Liu, Brad J. Spellberg.
Application Number | 20160130330 14/991756 |
Document ID | / |
Family ID | 43647949 |
Filed Date | 2016-05-12 |
United States Patent
Application |
20160130330 |
Kind Code |
A1 |
Ibrahim; Ashraf S. ; et
al. |
May 12, 2016 |
MAMMALIAN RECEPTORS AS TARGETS FOR ANTIBODY AND ACTIVE VACCINATION
THERAPY AGAINST MOLD INFECTIONS
Abstract
The present invention provides therapeutic compositions and
methods for treating and preventing fungal disease or conditions
including mucormycosis. The therapeutic methods and compositions of
the invention include antibody, antibody fragments, siRNA and
vaccine compositions having or directed against a GRP78 polypeptide
or an antigenic fragment of the polypeptide.
Inventors: |
Ibrahim; Ashraf S.; (Irvine,
CA) ; Liu; Mingfu; (Carson, CA) ; Spellberg;
Brad J.; (Rancho Palos Verdes, CA) ; Filler;
Scott; (Rancho Palos Verdes, CA) ; Fu; Yue;
(Torrance, CA) ; Edwards; John E.; (Palos Verdes
Estates, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
LOS ANGELES BIOMEDICAL RESEARCH INSTITUTE AT HARBOR-UCLA MEDICAL
CENTER |
TORRANCE |
CA |
US |
|
|
Family ID: |
43647949 |
Appl. No.: |
14/991756 |
Filed: |
January 8, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14139683 |
Dec 23, 2013 |
9259467 |
|
|
14991756 |
|
|
|
|
12874126 |
Sep 1, 2010 |
|
|
|
14139683 |
|
|
|
|
61239026 |
Sep 1, 2009 |
|
|
|
Current U.S.
Class: |
424/133.1 ;
424/152.1; 424/172.1 |
Current CPC
Class: |
A61K 39/0005 20130101;
C07K 2317/76 20130101; C07K 16/18 20130101; A61K 2039/505 20130101;
C12N 2799/06 20130101; C07K 16/14 20130101; A61K 39/0002 20130101;
C07K 2317/77 20130101; C12N 2310/14 20130101; A61K 31/713 20130101;
C07K 2317/24 20130101; A61P 31/10 20180101; A61K 39/39575 20130101;
C12N 2310/531 20130101; C12N 15/1138 20130101; C12N 2799/027
20130101 |
International
Class: |
C07K 16/18 20060101
C07K016/18 |
Goverment Interests
[0002] This invention was made in part with U.S. Government support
under NIH grant 011671 awarded by NIAID. The U.S. Government can
have certain rights in the invention.
Claims
1. A method of preventing or treating mucormycosis, comprising
administering a composition to a human subject having mucormycosis,
wherein the composition comprises a therapeutically effective
amount of an antibody or antibody fragment thereof that
specifically binds to human glucose-regulated protein, 78kD,
(GRP78) polypeptide or an antigenic fragment thereof, wherein said
mucormycosis is caused by a fungus of the order Mucorales.
2. The method of claim 1, wherein the antibody or fragment thereof
blocks or abrogates endocytosis of the fungus by a human
endothelial cell line that expresses the GRP78.
3. The method of claim 1, wherein the fungus is of the family
Mucoraceae.
4. The method of claim 3, wherein the fungus is selected from the
genus Rhizopus, Mucor, and Cunninghamella.
5. The method of claim 4, wherein the fungus is a Mucor
species.
6. The method of claim 4, wherein the fungus is a Cunninghamella
species.
7. The method of claim 3, wherein said fungus is selected from the
fungi species of Rhizopus oryzae, Rhizopus microsporus, Rhizopus
microsporus var. rhizopodiformis, Absidia corymbifera,
Apophysomyces elegans, Cunninghamella bertholletiae, and Rhizomucor
pusillus.
8. The method of claim 1, wherein said mucormycosis is selected
from rhinocerebral mucormycosis, pulmonary mucormycosis,
gastrointestinal mucormycosis, disseminated mucormycosis, bone
mucormycosis, mediastinum mucormycosis, trachea mucormycosis,
kidney mucormycosis, peritoneum mucormycosis, superior vena cava
mucormycosis and external otitis mucormycosis.
9. The method of claim 1, wherein the human subject is
immunocompromised.
10. The method of claim 1, wherein the human subject is suffering
from diabetes mellitus.
11. The method of claim 1, wherein the human subject is suffering
from diabetic ketoacidosis.
12. The method of claim 1, wherein the human subject is suffering
from trauma.
13. The method of claim 1, wherein the antibody is a monoclonal
antibody, or the antibody fragment is a fragment of said monoclonal
antibody.
14. The method of claim 1, wherein the antibody is a humanized
monoclonal antibody, or the antibody fragment is a fragment of the
humanized monoclonal antibody.
Description
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/139,683 filed Dec. 23, 2013, entitled
MAMMALIAN RECEPTORS AS TARGETS FOR ANTIBODY AND ACTIVE VACCINATION
THERAPY AGAINST MOLD INFECTIONS, and designated by Attorney Docket
No. 022098-0436608; which is a continuation of U.S. patent
application Ser. No. 12/874,126 filed Sep. 1, 2010, entitled
MAMMALIAN RECEPTORS AS TARGETS FOR ANTIBODY AND ACTIVE VACCINATION
THERAPY AGAINST MOLD INFECTIONS, now abandoned; which claims the
benefit of priority to U.S. provisional patent application No.
61/239,026 filed Sep. 1, 2009, entitled MAMMALIAN RECEPTORS AS
TARGETS FOR ANTIBODY AND ACTIVE VACCINATION THERAPY AGAINST MOLD
INFECTIONS. The entire content of the foregoing applications is
incorporated herein by reference, including all text, tables and
drawings.
BACKGROUND OF THE INVENTION
[0003] The instant application contains a Sequence Listing which
has been submitted in ASCII format via EFS-Web and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Jan. 8, 2016, is named LaBioMed0444894_ST25.txt and is 2,389
bytes in size.
[0004] This invention generally relates to compositions and methods
for treating and preventing infectious diseases in a patient and,
more particularly, relates to compositions and methods using
antibodies, antibody fragments, small interfering RNAs or vaccines
for treating and preventing opportunistic fungal diseases.
[0005] About 180 of the 250,000 known fungal species are recognized
to cause disease (mycosis) in man and animal. Some of fungi can
establish an infection in all exposed subjects, e.g., the systemic
pathogens Histoplasma capsulatum and Coccidioides immitis. Others,
such as Candida, Asergillus species and Zygomycetes are opportunist
pathogens which ordinarily cause disease only in a compromised
host. Fungi of the class Zygomycetes, order Mucorales, can cause
Mucormycosis, a potentially deadly fungal infection in human Fungi
belonging to the order Mucorales are distributed into at least six
families, all of which can cause mucormycosis (Ibrahim et al.
Zygomycosis, p. 241-251, in W. E. Dismukes, P. G. Pappas, and J. D.
Sobel (ed.), Clinical Mycology, Oxford University Press, New York
(2003); Kwon-Chung, K. J., and J. E. Bennett, Mucormycosis, p.
524-559, Medical Mycology, Lea & Febiger, Philadelphia (1992),
and Ribes et al. Zygomycetes in Human Disease, Clin Microbiol Rev
13:236-301 (2000)). However, fungi belonging to the family
Mucoraceae, and specifically the species Rhizopus oryzae (Rhizopus
arrhizus), are by far the most common cause of infection (Ribes et
al., supra). Increasing cases of mucormycosis have been also
reported due to infection with Cunninghamella spp. in the
Cunninghamellaceae family (Cohen-Abbo et al., Clinical Infectious
Diseases 17:173-77 (1993); Kontoyianis et al., Clinical Infectious
Diseases 18:925-28 (1994); Kwon-Chung et al., American Journal of
Clinical Pathology 64:544-48 (1975), and Ventura et al., Cancer
58:1534-36 (1986)). The remaining four families of the Mucorales
order are less frequent causes of disease (Bearer et al., Journal
of Clinical Microbiology 32:1823-24 (1994); Kamalam and Thambiah,
Sabouraudia 18:19-20 (1980); Kemna et al., Journal of Clinical
Microbiology 32:843-45 (1994); Lye et al., Pathology 28:364-65
(1996), and Ribes et al., (supra)).
[0006] The agents of mucormycosis almost uniformly affect
immunocompromised hosts (Spellberg et al., Clin. Microbiol. Rev.
18:556-69 (2005)). The major risk factors for mucormycosis include
uncontrolled diabetes mellitus in ketoacidosis known as diabetes
ketoacidosis (DKA), other forms of metabolic acidosis, treatment
with corticosteroids, organ or bone marrow transplantation,
neutropenia, trauma and burns, malignant hematological disorders,
and deferoxamine chelation-therapy in subjects receiving
hemodialysis.
[0007] Recent reports have demonstrated a striking increase in the
number of reported cases of mucormycosis over the last two decades
(Gleissner et al., Leuk. Lymphoma 45(7):1351-60 (2004)). There has
also been an alarming rise in the incidence of mucormycosis at
major transplant centers. For example, at the Fred Hutchinson
Cancer Center, Marr et al. have described a greater than doubling
in the number of cases from 1985-1989 to 1995-1999 (Marr et al.,
Clin. Infect. Dis. 34(7):909-17 (2002)). Similarly, Kontoyiannis et
al. have described a greater than doubling in the incidence of
mucormycosis in transplant subjects over a similar time-span
(Kontoyiannis et al, Clin. Infect. Dis. 30(6):851-6 (2000)). Given
the increasing prevalence of diabetes, cancer, and organ
transplantation in the aging United States population, the rise in
incidence of mucormycosis is anticipated to continue unabated for
the foreseeable future.
[0008] Available therapies for invasive mucormycosis include
attempts to reverse the underlying predisposing factors, emergent,
wide-spread surgical debridement of the infected area, and
adjunctive antifungal therapy (Edwards, J., Jr., Zygomycosis, p.
1192-1199. In P. Hoeprich and M. Jordan (ed.), Infectious Disease,
4th ed. J.B. Lippincott Co., Philadelphia (1989); Ibrahim et al.,
(2003), supra; Kwon-Chung and Bennett, supra; Sugar, A. M., Agent
of Mucormycosis and Related Species, p. 2311-2321. In G. Mandell,
J. Bennett, and R. Dolin (ed.), Principles and Practices of
Infectious Diseases, 4th ed. Churchill Livingstone, New York
(1995)).
[0009] Currently, Amphotericin B (AmB) remains the only antifungal
agent approved for the treatment of invasive mucormycosis (Id.).
Because the fungus is relatively resistant to AmB, high doses are
required, which frequently cause nephrotoxicity and other adverse
effects (Sugar, supra). Also, in the absence of surgical removal of
the infected focus (such as excision of the eye in subjects with
rhinocerebral mucormycosis), antifungal therapy alone is rarely
curative (Edwards, J. (1989), supra; Ibrahim et al., (2003),
supra). Even when surgical debridement is combined with high-dose
AmB, the mortality associated with mucormycosis exceeds 50% (Sugar,
supra). In subjects with disseminated disease mortality approaches
100% (Husain et al., Clin Infect Dis 37:221-29 (2003)). Because of
this unacceptably high mortality rate, and the extreme morbidity of
highly disfiguring surgical therapy, it has been imperative to
develop new strategies to treat and prevent invasive
mucormycosis.
[0010] A hallmark of mucormycosis is the virtually uniform presence
of extensive angioinvasion with resultant vessel thrombosis and
tissue necrosis (Ibrahim et al., (2003), supra. and Spellberg et
al., (2005), supra.) This angioinvasive character is associated
with the ability of the organism to hematogenously disseminate to
other target organs. Furthermore, ischemic necrosis of infected
tissues as a result of fungal angioinvasion can prevent delivery of
adequate levels of antifungal therapies, and is likely an important
mechanism by which the fungus survives despite therapy with
fungicidal agents. For these reasons, damage of and penetration
through endothelial cells lining blood vessels is likely a critical
step in R. oryzae's pathogenetic strategy. R. oryzae spores and
hyphae have been shown to damage human umbilical vein endothelial
cells in vitro (Ibrahim et al., Infect Immun 73(2):778, (2005)).
Such injury requires adherence of the fungus to endothelial cells
followed by invasion into the cells. Adherence to endothelial cells
is believed to be mediated by a specific receptor since it was
found to be saturable (Ibrahim et al., Infect Immun 73(2):778,
(2005)).
[0011] Therefore, there exists a need for compounds and methods
that can reduce the risk of mucormycosis pathogenesis and provide
effective therapies without adverse effects. The present invention
satisfies this need and provides related advantages as well.
SUMMARY OF THE INVENTION
[0012] In accordance with the embodiments outlined in this
disclosure, the present invention provides pharmaceutical
compositions for treating or preventing a fungal condition in a
subject in need thereof, having an antibody or antibody fragment
thereof that specifically binds to a GRP78 polypeptide or a
fragment thereof; and a pharmaceutically acceptable excipient or
carrier.
[0013] In another embodiment, the present invention provides
pharmaceutical compositions for treating or preventing a fungal
condition in a subject in need thereof, having a small interfering
RNA composed of the nucleotide sequence CTTGTTGGTGGCTCGACTCGA (SEQ
ID NO. 1); and a pharmaceutically acceptable excipient or
carrier.
[0014] In another embodiment, the present invention provides
vaccine compositions for immunization of a subject against a fungal
condition, having a GRP78 polypeptide, or an antigenic fragment of
said polypeptide, and a pharmaceutically acceptable carrier.
[0015] In another embodiment, the present invention provides
methods of treating or preventing a fungal condition by
administering to a subject having, or susceptible to having, a
fungal condition a therapeutically effective amount of an antibody
or antibody fragment thereof that specifically binds to a GRP78
polypeptide or a fragment thereof.
[0016] In another embodiment, the present invention provides
methods of treating or preventing a fungal condition by
administering to a subject having, or susceptible to having, a
fungal condition an immunogenic amount of a GRP78 polypeptide, or
an immunogenic fragment thereof.
[0017] In another embodiment, the present invention provides
methods of treating or preventing a fungal condition by
administering to a subject having, or susceptible to having, a
fungal condition a therapeutically effective amount of a small
interfering RNA composed of the nucleotide sequence
CTTGTTGGTGGCTCGACTCGA (SEQ ID NO. 1).
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1, panels A-D, show endothelial cell surface GRP78
binds to Mucorales germlings Panel A) Endothelial cell surface
proteins were labeled with NHS-biotin as described in Isberg and
Leong, Cell 60(5):861 (1990) and then extracted with
n-octyl-.beta.-D-glucopyranoside in PBS containing Ca.sup.2+ and
Mg.sup.2+ and protease inhibitors. The labeled proteins (250 .mu.g)
were incubated with equal volumes of spores (8.times.10.sup.8) or
germlings (2.times.108) of R. oryzae followed by extensive rinsing
with PBS containing Ca.sup.2+ and Mg.sup.2+ to remove the unbound
proteins. The membrane proteins that remained bound to the
organisms were eluted with 6M urea, separated on 10% SDS-PAGE, and
identified by immunoblotting with an anti-biotin monoclonal Ab.
Proteins from another SDS-PAGE were stained with SYPRO Ruby and the
bands excised for sequencing. Panel B) The same membrane that was
probed with anti-biotin Ab (Panel A) was stripped and then probed
with anti-GRP78 Ab. Panel C) R. oryzae spores were germinated as
described in Ibrahim et al., Infect Immun. 73(2):778 (2005) at
different time intervals and assayed for binding to endothelial
cell surface protein Immunoblotting against anti-GRP78 Ab was
carried out as in panels A and B. Panel D) An immunoblot of
endothelial cell surface proteins bound to different Mucorales was
developed with an anti-GRP78 Ab. "Total membrane" refers to total
endothelial cell membrane proteins. "M" refers to molecular weight
marker.
[0019] FIG. 2, panels A-H, show GRP78 on intact endothelial cells
co-localizes with R. oryzae germlings that are being endocytosed.
Panels A-D are confocal microscopic images of endothelial cells
infected with R. oryzae cells that have been germinated for 1 hour.
Panels E-H are confocal microscopic images of endothelial cells
infected with R. oryzae cells that have been germinated for 2
hours. Confluent endothelial cells on a 12-mm-diameter glass
coverslip were infected with 10.sup.5/ml R. oryzae germlings After
60-minute incubation at 37.degree. C., the cells were fixed with 3%
paraformaldehyde, washed, blocked, and then permeabilized as
described in Phan et al., J. Bio. Chem 280(11):10455 (2005). The
cells were stained with GRP78 using rabbit anti-GRP78 polyclonal Ab
(Abcam), followed by a counterstain with goat anti-rabbit IgG
conjugated with ALEXA FLUOR 488 (Molecular Probes, Invitrogen)
(Panels B and F). To detect F-actin, the cells were incubated with
ALEXA FLUOR 568-labeled phalloidin (Molecular Probes) per the
manufacturer's instructions (Panels C and G). A merged image is
shown in Panels D and H. Panels A and E are the same fields taken
with differential interference contrast imaging. Arrows indicate
GRP78 and microfilaments that have accumulated around R. oryzae.
Scale bars: 30 .mu.l (Panels A-D) and 20 .mu.m (Panels E-H).
[0020] FIG. 3, panels A-D, show anti-GRP78 Ab blocks endothelial
cell endocytosis of and damage by R. oryzae but not damage caused
by C. albicans or A. fumigatus. Adherence and endocytosis
(determined by differential fluorescence) assays were carried out
using endothelial cells split on 12-mm glass coverslips, while
damage was carried out using the 96-well plate .sup.51Cr release
method. Endothelial cells were incubated with 50 .mu.g/ml
anti-GRP78 or anti-p53 Ab (control) (Santa Cruz Biotechnology Inc.)
for 1 hour prior to addition of R. oryzae germlings Blocking of
GRP78 with Ab abrogates endocytosis of R. oryzae by endothelial
cells (data derived from >700 fungal cells interacting with
approximately 200 endothelial cells/each group/experiment, with an
average of 59% cells being endocytosed in the control) (Panel A)
and reduces the ability of the fungus to cause endothelial cell
damage (Panel B). However, anti-GRP78 Ab did not block damage
caused by C. albicans (Panel C) or A. fumigatus (Panel D).
*P<0.01 compared with anti-p53 Ab by Wilcoxon rank-sum test. n=6
slides per group from 3 independent experiments for endocytosis,
and n=6 wells per group from 2 independent experiments for damage
assay. Data are expressed as median.+-.interquartile range.
[0021] FIG. 4, panels A-C show downregulation of endothelial cell
GRP78 expression with siRNA reduces the number of endocytosed
organisms and subsequent damage to endothelial cells Endothelial
cells were transduced with lentivirus containing either shRNA
targeting GRP78 or a scrambled sequence (Non-target shRNA).
Transduction of endothelial cells with GRP78 shRNA lentiviruses
reduced GRP78 transcript levels (Panel A), diminished the number of
endocytosed R. oryzae germlings (data derived from >800 fungal
cells interacting with approximately 250 endothelial cells/each
group/experiment, with an average of 76% being endocytosed in the
non-target shRNA) (Panel B), and blocked R. oryzae-induced
endothelial cell damage (Panel C). *P<0.005 compared with
non-target shRNA by Wilcoxon rank-sum test for all comparisons. n=6
slides per group from 3 independent experiments for endocytosis,
and n=6 wells per group from 2 independent experiments for damage
assay. Data are expressed as median.+-.interquartile range.
[0022] FIG. 5, panels A-C, show heterologous overexpression of
GRP78 in CHO cells makes them more susceptible to R. oryzae-induced
invasion and subsequent damage. The C.1 cell line, which was
derived from parental DHFR-deficient CHO cells engineered to
overexpress GRP78, was found to overexpress GRP78 (Panel A).
*P=0.01 compared with parent cells by nonparametric Wilcoxon
rank-sum test; n=6 per each group. C.1 cells were able to
endocytose more R. oryzae germlings (data derived from >950
fungal cells interacting with approximately 300 CHO cells; each
group experiment, with an average of 40.9% being endocytosed in the
parent cells) (Panel B) and were more susceptible to R.
oryzae-induced damage (Panel C). *P<0.005 compared with parent
cells by Wilcoxon rank-sum test. n=6 slides per group from 3
independent experiments for endocytosis, and n=6 wells per group
from 2 independent experiments for damage assay. Data are expressed
as median.+-.interquartile range.
[0023] FIG. 6, panels A and B, show chelation of endothelial cell
iron protects them from invasion and subsequent injury by R.
oryzae. Panel A) Endothelial cells were incubated with the iron
chelator phenanthroline (60 WA), cytochalasin D (200 nM), or
phenanthroline saturated with Hemin (20 .mu.M) for 16 hours, then
the cells were rinsed and processed for endocytosis and adherence
(data derived from >400 fungal cells interacting with
approximately 150 endothelial cells/each group/experiment, with an
average of 77% being endocytosed in the control). Panel B)
Endothelial cells were treated with varying concentrations of
phenanthroline for 16 h then the iron chelator was removed prior to
carrying out R. oryzae-induced endothelial cell injury as above. *
p<0.001 vs. control (R. oryzae germlings without
phenanthroline), by Wilcoxon Rank Sum test. n=6 slides per group
from 3 independent experiments for endocytosis, and n=8 wells per
group from 2 independent experiments for damage assay. Data are
expressed as medians.+-.interquartile ranges.
[0024] FIG. 7, panels A-D, show acidosis as well as iron and
glucose concentrations consistent with those seen in DKA patients
induce expression of GRP78. Endothelial cells were incubated at
various pHs with or without phenanthroline (Panel A), with iron
(Panel B) or glucose (Panel C) concentrations often seen in DKA
patients for 5 hours (for studying the effect of acidosis or iron)
or 20 hours (for studying the effect of glucose), then the
expression of GRP78 was quantified by real-time RT-PCR. n=6 wells
per group from 2 independent experiments. Data are expressed as
median.+-.interquartile range. Cell surface expression of GRP78 on
endothelial cells (n=4 per group from 2 independent experiments)
exposed to FeCl.sub.3 was quantified using FACS analysis following
staining with anti-GRP78 mAb, then counterstaining with anti-mouse
ALEXA FLUOR 488-labeled Ab (Panel D). Data are presented as percent
of median fluorescent cells .+-.interquartile range. *P<0.01
versus pH 7.4 or the same pH with phenanthroline; **P<0.05
versus 1 mg/ml glucose or 0 FeCl.sub.3 by Wilcoxon rank-sum
test.
[0025] FIG. 8, panels A and B, show glucose and iron concentrations
consistent with those seen in DKA patients induce expression of
GRP78 and subsequent penetration of and damage to endothelial cells
by R. oryzae. Endothelial cells exposed to high concentrations of
iron (Panels in row A) or glucose (Panels in row B) were
subsequently evaluated for their susceptibility to R.
oryzae-mediated endocytose and damage. The endocytosis data were
derived from more than 600 fungal cells interacting with
approximately 200 endothelial cells/each group/experiment, with an
average of 51% and 58% endocytosis for no FeCl.sub.3 and 1 mg/ml
glucose, respectively. *P<0.01 compared with no FeCl.sub.3 or
with 1 mg/ml glucose by Wilcoxon rank-sum test. n=6 slides per
group from 3 independent experiments for endocytosis, and n=9 wells
per group from 3 independent experiments for damage assay. Data are
expressed as median.+-.interquartile range.
[0026] FIG. 9, panels A and B, show anti-GRP78 mAb blocked
endothelial cell endocytosis of (see panel A) and subsequent damage
by (see panel B) R. oryzae. Endothelial cells were incubated with
R. oryzae in the presence of 50 .mu.g anti-GRP78 Ab or anti-p53 Ab
(control). The endocytosis data were derived from more than 500
fungal cells interacting with approximately 150 endothelial
cells/each group/experiment, with an average of 71% endocytosis in
the control. *P<002 versus anti-p53 Ab. n=6 slides per group
from 3 independent experiments for endocytosis, and n=6 wells per
group from 2 independent experiments for damage assay. Data are
expressed as median.+-.interquartile range.
[0027] FIG. 10, panels A-C, show GRP78 is overexpressed in various
tissues of DKA mice and anti-GRP78 immune serum protects mice from
mucormycosis. Different organs harvested from DKA or normal mice
(n=7 per arm) were processed for GRP78 quantification by real time
RT-PCR. Panels A-C shows GRP78 expression in sinus tissue, lung
tissue, and brain tissue, respectively. * p<0.05 compared to
normal mice. Data are expressed as medians.+-.interquartile
ranges.
[0028] FIG. 11 shows anti-GRP78 immune serum protects mice from
mucormycosis. Survival of mice (n=18, from 2 independent
experiments with similar results) infected intranasally with R.
oryzae (10.sup.5 spores actual inoculum) and treated with
anti-GRP78 immune or non-immune sera. ** p=0.037 by log-rank test.
The experiment was terminated on day 90 with all remaining mice
appearing healthy.
DETAILED DESCRIPTION OF THE INVENTION
[0029] This invention is directed to the use of compositions and
methods that directly and/or indirectly inhibit the GRP78
polypeptide which facilitates fungal-induced penetration and
subsequent damage of endothelial cells, specifically those involved
in the onset of mucormycosis. Expression of the GRP78 polypeptide
is described herein to be enhanced in the presence of elevated
glucose and iron levels, consistent with typical levels seen in
patients suffering from diabetic ketoacidosis (DKA). Enhanced GRP78
expression results in increased endocytosis and subsequent damage
to endothelial cells. Inhibition of the GRP78 polypeptide,
described herein, impedes the ability of the fungi to penetrate and
subsequently damage endothelial cells. Therefore, the compositions
and methods of the current invention in targeting and inhibiting
the GRP78 polypeptide will prevent fungal-induced penetration and
subsequent damage of endothelial cells, which constitutes an
effective and targeted therapy against fungal conditions.
[0030] In one embodiment, the invention is directed to a
pharmaceutical composition for treating or preventing a fungal
condition. The pharmaceutical composition includes an effective
dose of an antibody or antibody fragment thereof that specifically
binds to a GRP78 polypeptide. In one aspect, the pharmaceutical
composition of the invention inhibits the receptor activity of
GRP78, thereby preventing penetration through and damage of
endothelial cells by a fungus. In another aspect, a composition of
the invention further comprises a pharmaceutically acceptable
excipient or carrier.
[0031] In another embodiment, the invention is directed to an
immunogenic composition such as a vaccine. The immunogenic
composition includes an effective dose of GRP78 polypeptide or an
antigenic fragment thereof that confers protection against a fungal
condition in a subject. The vaccine composition of the invention
induces host humoral and/or cell mediated immune response against
GRP78 polypeptide. In another embodiment, a composition of the
invention further includes an adjuvant that can boost the
immunogenicity of the vaccine composition. In a further aspect, the
subject is a human.
[0032] In yet another embodiment, the invention includes an
inhibitor of GRP78 nucleic acid such as an siRNA. The GRP78
inhibitor includes a vector expressing one or more siRNAs that
include sequences sufficiently complementary to a portion of the
GRP78 nucleic acid for inhibiting GRP78 transcription or
translation levels. For example, as described in Example I,
interfering RNAs against host GRP78 were prepared, which were shown
to inhibit GRP78 expression in endothelial cells and showed a
significant reduction in R. oryzae-induced endocytosis and
subsequent damage. Therefore, in one aspect, the invention provides
a pharmaceutical composition for treating or preventing a fungal
condition in a subject in need thereof, comprising a small
interfering RNA having the nucleotide sequence
CTTGTTGGTGGCTCGACTCGA (SEQ ID NO. 1). In another aspect, a
composition of the invention further comprises a pharmaceutically
acceptable excipient or carrier.
[0033] Generally, nucleic acid is an RNA, for example, mRNA or
pre-mRNA, or DNA, such as cDNA and genomic DNA. An GRP78 nucleic
acid, for example, refers to a nucleic acid molecule (RNA, mRNA,
cDNA, or genomic DNA, either single- or double-stranded)
corresponding to GRP78 polypeptide or an immunogenic fragment
thereof. DNA molecules can be doubled-stranded or singled-stranded.
Single stranded RNA or DNA can be either the coding or sense
strand, or the non-coding or antisense strand. The nucleic acid
molecule or nucleotide sequence can include all or a portion of the
coding sequence of the gene and can further include additional
non-coding sequences such as introns and non-coding 3' and 5'
sequences (including promoter, regulatory, poly-A stretches or
enhancer sequences, for example). In addition, the nucleic acid
molecule or nucleotide sequence can be fused to another sequence,
for example, a label, a marker or a sequence that encodes a
polypeptide that assists in isolation or purification of the
polypeptide. Such sequences include, but are not limited to, those
that encode a selection marker (e.g. an antibiotic resistance gene,
or a reporter sequence), those that encode a repetition of
histidine (HIS tag) and those that encode a
glutathione-S-transferase (GST) fusion protein. The nucleic acid
molecule or nucleotide sequence can include a nucleic acid molecule
or nucleotide sequence which is synthesized chemically or by
recombinant means, such nucleic acid molecule or nucleotide
sequence is suitable for use in recombinant DNA processes and
within genetically engineered protein synthesis systems.
[0034] The term "polypeptide" refers to a chain of two or more
amino acids covalently linked by a peptide bond. Particular
polypeptides of interest in the context of this invention are amino
acid subsequences having antigenic epitopes. Antigenic epitopes are
well known in the art and include sequence and/or structural
determinants substantially responsible for the immunogenic
properties of a polypeptide and being capable of evoking an immune
response. Functional domains of the GRP78 polypeptide are also
considered to fall within the scope of the invention. Polypeptides
also undergo maturation or post-translational modification
processes that can include, for example, glycosylation, proteolytic
cleavage, lipidization, signal peptide cleavage, propeptide
cleavage, phosphorylation, and such like.
[0035] GRP78 (also known as immunoglobulin heavy chain binding
protein (BiP); endoplasmic reticulum lumenal Ca(.sup.2+)-binding
protein grp78; heat shock 70 kDa protein 5 (HSPA5); and heat shock
70kD protein 5 (glucose-regulated protein, 78kD)) is a member of
the HSP70 protein family that can be located on the cell surface
(Wang et al., Antioxidants & Redox Signaling In Press (2009))
and is a key regulator of the unfolded protein response (UPR) (Ni
and Lee, FEBS Lett 581(19):3641 (2007)). GRP78 was discovered as a
cellular protein induced by glucose starvation (Lee, Cancer Res
67(8):3496 (2007)). GRP78 is present in the endoplasmic reticulum
as a major chaperone involved in many cellular processes, including
protein folding and assembly, marking misfolded proteins for
proteasome degradation, regulating Ca.sup.2+ homeostasis, and
serving as a sensor for endoplasmic reticulum stress (Li and Lee,
Curt Mol Med 6(1):45 (2006)). Despite its main function as a
cellular chaperone protein, recent studies reported the
translocation of a fraction of GRP78 to the cell surface in a
variety of cells (Davidson et al., Cancer Res 65(11):4663 (2005);
Misra et al., Cell Signal 16(8):929 (2004); Hardy et al., Biochem
Pharmacol 75(4):891 (2008); Jindadamrongwech et al., Arch. Virol.
149(5):915 (2004) and Triantafilou et al., J. Virol. 76(2):633
(2002)). The polypeptide sequence of GRP78 has been previously
identified and described for several species including Homo
sapiens, Pongo abelii, Pan troglodytes, Mus musculus, Rattus
norvegicus, Cricetulus griseus, Bos Taurus, Canis lupus familiaris,
and others. See, for example, the amino acid sequences described by
the Nation Center for Biotechnology Information (NCBI) identified
by the following accession and gene identification (GI) numbers:
NP_005338.1 (GI:16507237); AAF13605.1 (GI:6470150); NP_005338.1
(GI:16507237); P11021.2 (GI:14916999); NP_001126927.1
(GI:197101513): NP_001156906.1 (GI:254540168); AA065155.1
(GI:29164908); A27414 (GI:90188); AAI19954.1 (GI:111308468);
XP_537847.2 (GI:73968072), all of which are herein incorporated by
reference. The corresponding nucleic acid cDNA, mRNA or genomic
sequences have also been identified and described for the above
species as described by NCBI and identified by the following
accession and gene identification (GI) numbers: NM_005347.3
(GI:194097371); M19645.1 (GI:183644); AF188611.1 (GI:6470149);
AF216292.1 (GI:7229461); NM_001133455.1 (GI:197101512);
XM_001146903.1 (GI:114689310); NM_001163434.1 (GI:254540167);
NM_022310.3 (GI:254540165); NM_013083.1 (GI:25742762); M17169.1
(GI:191090); NM_001075148.1 (GI:115495026); XM_537847.2
(GI:73968071), all of which are herein incorporated by
reference.
[0036] The term "immunogenic" or "antigenic" as it is used herein
refers to a portion of a protein that is recognized by a T-cell
and/or B-cell antigen receptor. The immunogenic portion generally
includes at least 5 amino acid residues, preferably at least 10,
more preferably at least 20, and still more preferably at least 30
amino acid residues of an GRP78 polypeptide or a variant thereof.
Preferred immunogenic portions can contain a small N- and/or
C-terminal fragment (e.g., 5-30 amino acids, preferably 10-25 amino
acids).
[0037] A variant polypeptide contains at least one amino acid
change compared to the target polypeptide. Polypeptide variants of
GRP78 can exhibit at least about 39%, more preferably at least
about 50%, and even more preferably at least about 70% identity to
the GRP78 polypeptide. A polynucleotide variant includes a
substantially homologous polynucleotide that deviates in some bases
from the identified polynucleotide, usually caused by mutations
such as substitution, insertion, deletion or transposition.
Polynucleotide variants preferably exhibit at least about 60% (for
fragments with 10 or more nucleotides), more preferably at least
about 70%, 80% or 90%, and even more preferably at least about 95%,
98% or 99% identity to the identified polynucleotide.
[0038] The term "fragment" as used herein with reference to a GRP78
polypeptide is intended to refer to a polypeptide having a portion
of GRP78 amino acid sequence. Useful fragments include those that
retain one or more of the biological activities of the polypeptide.
Such biologically active fragments can have a wide range of lengths
including, for example, 4, 6, 10, 15, 20, 25, 30, 40, 50, 100, or
more amino acid in length. In addition to activity, biologically
active fragments also can be characterized by, for example, a
motif, domain, or segment that has been identified by analysis of
the polypeptide sequence using methods well known in the art. Such
regions can include, for example, a signal peptide, extracellular
domain, transmembrane segment, ligand binding region, zinc finger
domain and/or glycosylation site.
[0039] The term "vaccine", as used herein, refers to a composition
that can be administered to an individual to protect the individual
against an infectious disease. Vaccines protect against diseases by
inducing or increasing an immune response in an animal against the
infectious disease. An exemplary infectious disease amenable to
treatment with the vaccines of the invention is mucormycosis. The
vaccine-mediated protection can be humoral and/or cell mediated
immunity induced in host when a subject is challenged with, for
example, GRP78 or an immunogenic portion or fragment thereof.
[0040] The term "adjuvant" is intended to mean a composition with
the ability to enhance an immune response to an antigen generally
by being delivered with the antigen at or near the site of the
antigen. Ability to increase an immune response is manifested by an
increase in immune mediated protection. Enhancement of humoral
immunity can be determined by, for example, an increase in the
titer of antibody raised to the antigen. Enhancement of cellular
immunity can be measured by, for example, a positive skin test,
cytotoxic T-cell assay, ELISPOT assay for IFN-gamma or IL-2.
Adjuvants are well known in the art. Exemplary adjuvants include,
for example, Freud's complete adjuvant, Freud's incomplete
adjuvant, aluminum adjuvants, MF59 and QS21.
[0041] The term "antibody" as used herein refers to immunoglobulin
molecules and immunologically active portion of immunoglobulin
molecules. Antibodies can be prepared by any of a variety of
techniques known to those skilled in the art (see, for example,
Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring
Harbor Laboratories, Cold Spring Harbor, N. Y., 1988 and Brekke and
Sandlie, Therapeutic Antibodies for Human Diseases at the Dawn of
the Twenty-First Century, Nature 52(2):52-62 (2003)). The present
invention provides polyclonal and monoclonal antibodies that bind
specifically to a polypeptide of the invention or fragment or
variant thereof. Monoclonal antibodies of the invention, for
example, include a population of antibody molecules that contain
only one species of antigen binding site capable of immunoreacting
with a particular epitope of a polypeptide of the invention or a
fragment or variant thereof. Monoclonal antibodies can be coupled
to one or more therapeutic agents. Suitable agents in this regard
include differentiation inducers, drugs, toxins, and derivatives
thereof. A therapeutic agent can be coupled (e.g., covalently
bonded) to a suitable monoclonal antibody either directly or
indirectly (e.g., via a linker group).
[0042] The terms "vector", "cloning vector" and "expression vector"
mean the vehicle by which a nucleic acid can be introduced into a
host cell. The vector can be used for propagation or harboring a
nucleic acid or for polypeptide expression of an encoded sequence.
A wide variety of vectors are known in the art and include, for
example, plasmids, phages and viruses. Exemplary vectors can be
found described in, for example, Sambrook et al., Molecular
Cloning: A Laboratory Manual, Third Ed., Cold Spring Harbor
Laboratory, New York (2001); Ausubel et al., Current Protocols in
Molecular Biology, John Wiley and Sons, Baltimore, Md. (1999).
[0043] The term "treating" or "treatment," as it is used herein is
intended to mean an amelioration of a clinical symptom indicative
of a fungal condition. Amelioration of a clinical symptom includes,
for example, a decrease or reduction in at least one symptom of a
fungal condition in a treated individual compared to pretreatment
levels or compared to an individual with a fungal condition. The
term "treating" also is intended to include the reduction in
severity of a pathological condition, a chronic complication or an
opportunistic fungal infection which is associated with a fungal
condition. Such pathological conditions, chronic complications or
opportunistic infections are exemplified below with reference to
mucormycosis. Mucormycosis and other such pathological conditions,
chronic complications and opportunistic infections also can be
found described in, for example, Merck Manual, Sixteenth Edition,
1992, and Spellberg et al., Clin. Microbio. Rev. 18:556-69
(2005).
[0044] The term "preventing" or "prevention," as it is used herein
is intended to mean a forestalling of a clinical symptom indicative
of a fungal condition. Such forestalling includes, for example, the
maintenance of normal physiological indicators in an individual at
risk of infection by a fungus or fungi prior to the development of
overt symptoms of the condition or prior to diagnosis of the
condition. Therefore, the term "preventing" includes the
prophylactic treatment of individuals to guard them from the
occurrence of a fungal condition. Preventing a fungal condition in
an individual also is intended to include inhibiting or arresting
the development of the fungal condition. Inhibiting or arresting
the development of the condition includes, for example, inhibiting
or arresting the occurrence of abnormal physiological indicators or
clinical symptoms such as those described above and/or well known
in the art. Therefore, effective prevention of a fungal condition
would include maintenance of normal body temperature, weight,
psychological state as well as lack of lesions or other
pathological manifestations in an individual predisposed to a
fungal condition. Individuals predisposed to a fungal condition
include an individual who is immunocompromised, for example, but
not limited to, an individual with AIDS, azotemia, diabetes
mellitus, diabetic ketoacidosis, neutropenia, bronchiectasis,
emphysema, TB, lymphoma, leukemia, or burns, or an individual
undergoing chemotherapy, bone marrow-, stem cell- and/or solid
organ transplantation or an individual with a history of
susceptibility to a fungal condition. Inhibiting or arresting the
development of the condition also includes, for example, inhibiting
or arresting the progression of one or more pathological
conditions, chronic complications or susceptibility to an
opportunistic infection associated with a fungal condition.
[0045] A "subject," "individual" or "patient" is used
interchangeably herein, and refers to a vertebrate, preferably a
mammal, more preferably a human Mammals include, but are not
limited to, murines, rats, rabbits, simians, bovines, ovines,
porcines, canines, felines, farm animals, sport animals, pets,
equines, and primates, particularly humans.
[0046] The term "fungal condition" as used herein refers to fungal
diseases, infection, or colonization including superficial mycoses
(i.e., fungal diseases of skin, hair, nail and mucous membranes;
for example, ringworm or yeast infection), subcutaneous mycoses
(i.e., fungal diseases of subcutaneous tissues, fascia and bone;
for example, mycetoma, chromomycosis, or sporotichosis), and
systemic mycoses (i.e., deep-seated fungal infections generally
resulting from the inhalation of air-borne spores produced by
causal moulds; for example, zygomycosis, aspergillosis,
cryptococcosis, candidiasis, histoplasmosis, coccidiomycosis,
paracoccidiomycosis, fusariosis (hyalohyphomycoses), blastomycosis,
penicilliosis or sporotrichosis.
[0047] As used herein, the term "zygomycosis" is intended to mean a
fungal condition caused by fungi of the class Zygomycetes,
comprised of the orders Mucorales and Entomophthorales. The
Entomophthorales are causes of subcutaneous and mucocutaneous
infections known as entomophthoromycosis, which largely afflict
immunocompetent hosts in developing countries. Zygomycosis is also
referred to as mucormycosis and the two terms are used
interchangeably to refer to similar types of fungal infections.
[0048] As used herein, the term "mucormycosis" is intended to mean
a fungal condition caused by fungi of the order Mucorales.
Mucormycosis is a life-threatening fungal infection almost
uniformly affecting immunocompromised hosts in either developing or
industrialized countries. Fungi belonging to the order Mucorales
are distributed into at least six families, all of which can cause
cutaneous and deep infections. Species belonging to the family
Mucoraceae are isolated more frequently from patients with
mucormycosis than any other family. Among the Mucoraceae, Rhizopus
oryzae (Rhizopus arrhizus) is a common cause of infection. Other
exemplary species of the Mucoraceae family that cause a similar
spectrum of infections include, for example, Rhizopus microsporus
var. rhizopodiformis, Absidia corymbifera, Apophysomyces elegans,
Mucor species, Rhizomucor pusillus and Cunninghamella spp
(Cunninghamellaceae family) Mucormycosis is well known in the art
and includes, for example, rhinocerebral mucormycosis, pulmonary
mucormycosis, gastrointestinal mucormycosis, disseminated
mucormycosis, bone mucormycosis, mediastinum mucormycosis, trachea
mucormycosis, kidney mucormycosis, peritoneum mucormycosis,
superior vena Cava mucormycosis or external otitis
mucormycosis.
[0049] Fungi belonging to the order Mucorales are currently
distributed into the families of Choanephoraceae;
Cunninghamellaceae; Mucoraceae; Mycotyphaceae; Phycomycetaceae;
Pilobolaceae; Saksenaeaceae; Syncephalastraceae; and
Umbelopsidaceae. Each of these fungi families consists of one or
more genera. For example, fungi belonging to the order Mucorales,
family Mucoraceae, are further classified into the genera of
Absidia (e.g., A. corymbifera); Actinomucor (e.g., A. elegans);
Amylomyces (e.g., A. rouxii); Apophysomyces; Backusella (e.g., B.
circina); Benjaminiella (e.g., B. multispora); Chaetocladium (e.g.,
C. brefeldii); Circinella (e.g., C. angarensis); Cokeromyces (e.g.,
C. recurvatus); Dicranophora (e.g., D. fulva); Ellisomyces (e.g.,
E. anomalus; Helicostylum (e.g., H. elegans); Hyphomucor (e.g., H.
assamensis); Kirkomyces (e.g., K. cordensis); Mucor (e.g., M.
amphibiorum); Parasitella (e.g., P. parasitica); Philophora (e.g.,
P. agaricina); Pilaira (e.g., P. anomala); Pirella (e.g., P.
circinans); Rhizomucor (e.g., R. endophyticus); Rhizopodopsis
(e.g., R. javensis); Rhizopus; Sporodiniella (e.g., S. umbellata);
Syzygites (e.g., S. megalocarpus); Thamnidium (e.g., T. elegans);
Thermomucor (e.g., T. indicae-seudaticae); and Zygorhynchus (e.g.,
Z. califomiensis). The genus Rhizopus, for example, consists of R.
azygosporus; R. caespitosus; R. homothallicus; R. oryzae; R.
microsporus, R. microsporus var. rhizopodiformis and R. schipperae
species.
[0050] The Choanephoraceae family consists of fungi genera
Blakeslea (e.g., B. monospora), Choanephora (e.g., C.
cucurbitarum), Gilbertella (e.g., G. hainanensis), and Poitrasia
(e.g., P. circinans). The Cunninghamellaceae family consists of
genera Chlamydoabsidia (e.g., C. padenii); Cunninghamella (e.g., C.
antarctica); Gongronella (e.g., G. butleri); Halteromyces (e.g., H.
radiatus); and Hesseltinella (e.g., H. vesiculosa). The
Mycotyphaceae family consists of fungi genus Mvcotypha (e.g., M.
africana). The Phycomycetaceae family consists of fungi genus
Phycomyces (e.g., P. blakesleeanus) and Spinellus (e.g., S.
chalybeus). The Pilobolaceae family consists of fungi genera
Pilobolus (e.g., P. longipes) and Utharomyces (e.g., U.
epallocaulus). The Saksenaeaceae family consists of fungi genera
Apophysomyces (e.g., A. elegans) and Saksenaea (e.g., S.
vasiformis). The Syncephalastraceae family consists of fungi genera
Dichotomocladium (e.g., D. elegans); Fennellomyces (e.g., F.
gigacellularis); Mycocladus (e.g., M. blakesleeanus); Phascolomyces
(e.g., P. articulosus); Protomycocladus (e.g., P. faisalabadensis);
Syncephalastrum (e.g., S. monosporum); Thamnostylum (e.g., T.
lucknowense); Zychaea (e.g., Z. mexicana). Finally, the
Umbelopsidaceae family consists of fungi genus Umbelopsis (e.g., U.
angularis).
[0051] As used herein, the term "pharmaceutically acceptable
carrier" includes any and all pharmaceutical grade solvents,
buffers, oils, lipids, dispersion media, coatings, isotonic and
absorption facilitating agents and the like that are compatible
with the active ingredient. These pharmaceutically acceptable
carriers can be prepared from a wide range of pharmaceutical grade
materials appropriate for the chosen mode of administration, e.g.,
injection, intranasal administration, oral administration, etc. For
the purposes of this invention, the terms "pharmaceutical" or
"pharmaceutically acceptable" further refer to compositions
formulated by known techniques to be non-toxic and, when desired,
used with carriers or additives that can be safely administered to
humans. In a specific embodiment, the term "pharmaceutically
acceptable" means approved by a regulatory agency of the Federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, and more
particularly in humans. The term "carrier" refers to a diluent,
adjuvant, excipient, or vehicle with which the therapeutic is
administered. Such pharmaceutical carriers can be sterile liquids,
such as water and oils, including those of petroleum, animal,
vegetable or synthetic origin, such as peanut oil, soybean oil,
mineral oil, sesame oil and the like. Water is a preferred carrier
when the pharmaceutical composition is administered intravenously.
Saline solutions and aqueous dextrose and glycerol solutions can
also be employed as liquid carriers, particularly for injectable
solutions. Suitable pharmaceutical excipients include starch,
glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk,
silica gel, sodium stearate, glycerol monostearate, talc, sodium
chloride, dried skim milk, glycerol, propylene, glycol, water,
ethanol and the like.
[0052] The term "immunogenic amount" as used herein refers an
effective amount of a particular epitope of a polypeptide of the
invention or a fragment or variant thereof that can induce the host
immune response against the polypeptide or the infectious agent
expressing the polypeptide. This amount is generally in the range
of 20 .mu.g to 10 mg of antigen per dose of vaccine and depends on
the subject to be treated, capacity of the subject's immune system
to synthesize antibodies, and the degree of protection desired. The
precise amount of immunogen required can be calculated by various
methods such as, for example, antibody titration. The term
effective amount refers to an amount of a compound or compositions
that is sufficient to provide a desired result. Thus, as used to
describe a vaccine, an effective amount refers to an amount of a
compound or composition (e.g., an antigen) that is sufficient to
produce or elicit a protective immune response. An effective amount
with respect to an immunological composition is an amount that is
sufficient to elicit an immune response, whether or not the
response is protective.
[0053] The "therapeutically effective amount" will vary depending
on the polypeptide, polynucleotide, antibody, antibody fragment or
compositions, the disease and its severity and the age, weight,
etc., of the patient to be treated all of which is within the skill
of the attending clinician. It is contemplated that a
therapeutically effective amount of one or more of a
polynucleotide, polypeptide, antibody, antibody fragment or
composition described herein will alter a fungal pathogen
penetration through and damage of endothelial cells in the patient
as compared to the absence of treatment. As such, fungal
pathogenesis is decreased. A therapeutically effective amount is
distinguishable from an amount having a biological effect (a
"biologically effective amount"). A polypeptide, polynucleotide,
antibody, antibody fragment or compositions of the present
invention may have one or more biological effects in vitro or even
in vivo, such as reducing function of a GRP78 polypeptide. A
biological effect, however, may not result in any clinically
measurable therapeutically effect as described herein as determined
by methods within the skill of the attending clinician.
[0054] The present invention, in part, relates to the discovery
that GRP78 gene product is overexpressed in the presence of
elevated concentrations of glucose and iron and mediates
penetration through and damage of endothelial cells by a fungal
pathogen such as R. oryzae in mucormycosis. Moreover, inhibition of
GRP78 polypeptide protected subjects from mucormycosis, particular
those suffering from diabetic ketoacidosis.
[0055] Accordingly, different compositions are disclosed herein for
effective inhibition of GRP78 polypeptide, GRP78 nucleic acid
and/or its function in treating mucormycosis or other fungal
diseases. These inhibitory compositions include vaccines,
antisense, siRNA, antibody or any other compositions capable of
effectively targeting and inhibiting the function of GRP78
polypeptide. Such compositions will reduce and/or prevent the
growth of the fungus in the infected tissues. The compositions of
the invention also are useful in prophylactic settings to decrease
onset and/or prevent infection from occurring. In addition, any of
the GRP78 inhibitory compositions disclosed herein can further be
supplemented and/or combined with other known antifungal therapies
including, for example, Amphotericin B or iron chelators. Exemplary
iron chelators include Deferiprone and Deferasirox.
[0056] In one embodiment, the invention provides a vaccine
composition having a GRP78 polypeptide or an antigenic fragment or
variant of the polypeptide. The vaccine composition also can
include an adjuvant. The formulation of the vaccine composition of
the invention is effective in inducing protective immunity in a
subject by stimulating both specific humoral (neutralizing
antibodies) and effector cell mediated immune responses against
GRP78 polypeptide. The vaccine composition of the invention is also
used in the treatment or prophylaxis of fungal infections such as,
for example, mucormycosis.
[0057] The vaccine of the present invention will contain an
immunoprotective quantity of GRP78 polypeptide antigens and is
prepared by methods well known in the art. The preparation of
vaccines is generally described in, for example, M. F. Powell and
M. J. Newman, eds., "Vaccine Design (the subunit and adjuvant
approach)," Plenum Press (1995); A. Robinson, M. Cranage, and M.
Hudson, eds., "Vaccine Protocols (Methods in Molecular Medicine),"
Humana Press (2003); and D. Ohagan, ed., "Vaccine Adjuvants:
Preparation Methods and Research Protocols (Methods in Molecular
Medicine)," Humana Press (2000).
[0058] GRP78 polypeptide, and peptide fragments or variants thereof
can include immunogenic epitopes, which can be identified using
methods known in the art and described in, for example, Geysen et
al. Proc. Natl. Acad. Sci. USA 81: 3998 (1984)). Briefly, hundreds
of overlapping short peptides, e.g., hexapeptides, can be
synthesized covering the entire amino acid sequence of the target
polypeptide (i.e., GRP78). The peptides while still attached to the
solid support used for their synthesis are then tested for
antigenicity by an ELISA method using a variety of antisera.
Antiserum against GRP78 protein can be obtained by known
techniques, Kohler and Milstein, Nature 256: 495-499 (1975), and
can be humanized to reduce antigenicity, see, for example, U.S.
Pat. No. 5,693,762, or produced in transgenic mice leaving an
unrearranged human immunoglobulin gene, see, for example, U.S. Pat.
No. 5,877,397. Once an epitope bearing hexapeptide reactive with
antibody raised against the intact protein is identified, the
peptide can be further tested for specificity by amino acid
substitution at every position and/or extension at both C and/or N
terminal ends. Such epitope bearing polypeptides typically contain
at least six to fourteen amino acid residues, and can be produced,
for example, by polypeptide synthesis using methods well known in
the art or by fragmenting an GRP78 polypeptide. With respect to the
molecule used as immunogens pursuant to the present invention,
those skilled in the art will recognize that the GRP78 polypeptide
can be truncated or fragmented without losing the essential
qualities as an immunogenic vaccine. For example, GRP78 polypeptide
can be truncated to yield an N-terminal fragment by truncation from
the C-terminal end with preservation of the functional properties
of the molecule as an immunogen. Similarly, C-terminal fragments
can be generated by truncation from the N-terminal end with
preservation of the functional properties of the molecule as an
immunogen. Other modifications in accord with the teachings and
guidance provided herein can be made pursuant to this invention to
create other GRP78 polypeptide functional fragments, immunogenic
fragments, variants, analogs or derivatives thereof, to achieve the
therapeutically useful properties described herein with the native
protein.
[0059] The vaccine compositions of the invention further contain
conventional pharmaceutical carriers. Suitable carriers are well
known to those of skill in the art. These vaccine compositions can
be prepared in liquid unit dose forms. Other optional components,
e.g., pharmaceutical grade stabilizers, buffers, preservatives,
excipients and the like can be readily selected by one of skill in
the art. However, the compositions can be lyophilized and
reconstituted prior to use. Alternatively, the vaccine compositions
can be prepared in any manner appropriate for the chosen mode of
administration, e.g., intranasal administration, oral
administration, etc. The preparation of a pharmaceutically
acceptable vaccine, having due regard to pH, isotonicity, stability
and the like, is within the skill of the art.
[0060] The immunogenicity of the vaccine compositions of the
invention can further be enhanced if the vaccine further comprises
an adjuvant substance. Various methods of achieving adjuvant effect
for the vaccine are known. General principles and methods are
detailed in "The Theory and Practical Application of Adjuvants",
1995, Duncan E. S. Stewart-Tull (ed.), John Wiley & Sons Ltd,
ISBN 0-471-95170-6, and also in "Vaccines: New Generations
Immunological Adjuvants", 1995, Gregoriadis G et al. (eds.), Plenum
Press, New York, ISBN 0-306-45283-9, both of which are hereby
incorporated by reference herein.
[0061] Preferred adjuvants facilitate uptake of the vaccine
molecules by antigen presenting cells (APCs), such as dendritic
cells, and activate these cells. Non-limiting examples are selected
from the group consisting of an immune targeting adjuvant; an
immune modulating adjuvant such as a toxin, a cytokine, and a
mycobacterial derivative; an oil formulation; a polymer; a micelle
forming adjuvant; a saponin; an immunostimulating complex matrix
(ISCOM.RTM. matrix); a particle; DDA (dimethyldioctadecylammonium
bromide); aluminum adjuvants; DNA adjuvants; and an encapsulating
adjuvant. Liposome formulations are also known to confer adjuvant
effects, and therefore liposome adjuvants are included according to
the invention.
[0062] In addition to vaccination of subjects susceptible to fungal
infections such as mucormycosis, the vaccine compositions of the
present invention can be used to treat, immunotherapeutically,
subjects suffering from a variety of fungal infections.
Accordingly, vaccines that contain one or more of GRP78
polynucleotides, polypeptides and/or antibody compositions
described herein in combination with adjuvants, and that act for
the purposes of prophylactic or therapeutic use, are also within
the scope of the invention. In an embodiment, vaccines of the
present invention will induce the body's own immune system to seek
out and inhibit GRP78 molecules.
[0063] In another embodiment, the invention provides a
pharmaceutical composition for treating or preventing a fungal
condition having an antisense or a small interfering RNA selected
from the group consisting of a nucleotide sequence that is
substantially complimentary to a portion of an GRP78 nucleic acid
sequence; a nucleotide sequence that is substantially complimentary
to at least 12 contiguous nucleotide bases of GRP78 sequence; a
nucleotide RNAi sequence that is substantially complimentary to at
least 18 contiguous nucleotide bases of GRP78 sequence; and a
pharmaceutically acceptable excipient or carrier. In one aspect,
the small interfering RNA includes the nucleotide sequence
CTTGTTGGTGGCTCGACTCGA (SEQ ID NO. 1). In another aspect, the
pharmaceutical composition further includes an adjuvant.
[0064] Antisense nucleic acid molecules of the invention can be
designed using the nucleotide sequences of the GRP78 genes
identified herein or their complementary strands thereof, and/or a
portion or variant thereof, constructed using enzymatic ligation
reactions by procedures known in the art of the genetic
engineering. For example, an antisense nucleic acid molecule (e.g.,
an antisense oligonucleotide) can be chemically synthesized using
naturally occurring nucleotides or variously modified nucleotides
designed to hybridize with a control region of a gene (e.g.,
promoter, enhancer, or transcription initiation region) to inhibit
the expression of the GRP78 gene through triple-helix formation.
Alternatively, the antisense nucleic acid molecule can be designed
to hybridize with the transcript of a gene (i.e., mRNA), and thus
inhibit the translation of GRP78 by inhibiting the binding of the
transcript to ribosomes. The antisense methods and protocols are
generally described in, for example, C. Stein, A. Krieg, eds.,
"Applied Antisense Oligonucleotide Technology" Wiley-Liss, Inc.
(1998); or U.S. Pat. Nos. 5,965,722; 6,339,066; 6,358,931; and
6,359,124.
[0065] The present invention also provides, as antisense molecules,
nucleic acids or nucleotide sequences that contain a fragment,
portion or variant that hybridizes under high stringency conditions
to a nucleotide sequence of the GRP78 genes described herein, or
their complementary strands. The nucleic acid fragments of the
invention are at least about 12, generally at least about 15, 18,
21, or 25 nucleotides, and can be 40, 50, 70, 100, 200, or more
nucleotides in length. Longer fragments, for example, 30 or more
nucleotides in length, which encode antigenic polypeptides
described hereinafter, are particularly useful, such as for the
generation of antibodies.
[0066] Particular small nucleic acid molecules that are of use in
the invention are short stretches of double stranded RNA that are
known as short interfering RNAs (siRNAs) These interfering RNA
(RNAi) allow for the selective inhibition of GRP78 gene function in
vivo. In the present invention, siRNA has been used to knock-down
GRP78 expression in an in vitro endothelial cell model of
mucormycosis infection, and in doing so it demonstrates a dramatic
effect on preventing endocytosis. The siRNA approach relies on an
innate cellular response to combat viral infection. In this
process, double stranded mRNAs are recognized and cleaved by the
dicer RNase resulting in 21-23 nucleotide long stretches of RNAi.
These RNAis are incorporated into and unwound by the RNA-inducing
silencing complex (RISC). The single antisense strand then guides
the RISC to mRNA containing the complementary sequence resulting in
endonucleolytic cleavage of the mRNA, see Elbashir et al. (Nature
411; 494-498 (2001)). Hence, this technique provides a means for
the targeting and degradation of GRP78 mRNA in vivo in a subject
thus preventing the fungal pathogen.
[0067] The present invention further provides inhibitory antibodies
(monoclonal or polyclonal) and antigen-binding fragments thereof,
that are capable of binding to and inhibition of GRP78 polypeptide
function. The antibody inhibitors of the present invention can bind
to GRP78, or a portion, fragment, variant thereof, and interfere
with or inhibit the protein function, i.e., receptor mediated
penetration through and damage of endothelial cells by fungal
pathogens. Furthermore, such antibodies can bind to GRP78 and
interfere with or inhibit the proper localization or conformation
of the protein within the host cell. An antibody, or
antigen-binding fragment thereof, is said to "specifically bind,"
"immunologically bind," and/or is "immunologically reactive" to an
GRP78 polypeptide of the invention if it reacts at a detectable
level with the GRP78 polypeptide, and does not react detectably
with unrelated polypeptides under similar conditions.
[0068] In addition, recombinant antibodies, such as chimeric and
humanized antibodies, including both human and non-human portions,
which can be made using standard recombinant DNA techniques, are
within the scope of the invention. Also included within the term
"antibody" are fragments, such as the Fab, F(ab'). The GRP78
specific monoclonal antibodies of the invention have specific
binding activity to GRP78, or a functional fragment thereof, in
pathogenic fungi responsible for mucormycosis.
[0069] Methods for raising polyclonal antibodies, for example, in a
rabbit, goat, mouse or other mammal, are well known in the art
(Harlow and Lane, eds. "Antibodies: A laboratory Manual," Cold
Spring harbor Laboratory Press (1999); Harlow et al., Using
Antibodies: A Laboratory Manual, Cold Spring harbor Laboratory
Press (1999); C. Borrebaeck, ed., Antibody Engineering: A Practical
Guide, W.H. Freeman and Co., Publishers, pp. 130-120 (1991)). The
production of anti-peptide antibodies commonly involves the use of
host animals such as rabbits, mice, guinea pigs, or rats. If a
large amount of serum is needed, larger animals such as sheep,
goats, horses, pigs, or donkeys can be used Animals are usually
chosen based on the amount of antiserum required and suitable
animals include rabbits, mice, rats, guinea pigs, and hamsters.
These animals yield a maximum of 10-50 .mu.L, 100-200 .mu.L and 1-2
mL of serum per single bleed, respectively (Harlow and Lane, supra,
1999). Rabbits are very useful for the production of polyclonal
antisera, since they can be safely and repeatedly bled and produce
high volumes of antiserum. Two injections two to four weeks apart
with 15-50 .mu.g of antigen in a suitable adjuvant such as, for
example, Freund's Complete Adjuvant can be followed by blood
collection and analysis of the antiserum.
[0070] In addition, monoclonal antibodies can be obtained using
methods that are well known and routine in the art (Harlow and
Lane, supra, 1999). A peptide portion of a protein such as GRP78,
for use as an immunogen, can be determined by methods well known in
the art. Spleen cells from an immunized mouse can be fused to an
appropriate myeloma cell line to produce hybridoma cells. Cloned
hybridoma cell lines can be screened using a labeled protein to
identify clones that secrete the corresponding antibodies,
respectively. Hybridomas expressing the monoclonal antibodies
having a desirable specificity and affinity can be isolated and
utilized as a continuous source of the antibody.
[0071] Humanized antibodies can be constructed by conferring
essentially any antigen binding specificity onto a human antibody
framework. Methods of constructing humanized antibodies are useful
to prepare an antibody appropriate for practicing the methods of
the invention and avoiding host immune responses against the
antibody when used therapeutically. The antibodies described herein
can be used to generate therapeutic modulating substances for
reducing the severity of a condition associated with fibroblast
mediated.
[0072] Humanization of an antibody can be accomplished by methods
well known in the art such as complementary determining region
(CDR)-grafting and optimization of framework and CDR residues. For
example, humanization of an antibody can be accomplished by
CDR-grafting as described in Fiorentini et al., Immunotechnology
3(1): 45-59 (1997), which is incorporated herein be reference.
Briefly, CDR-grafting involves recombinantly splicing CDRs from a
nonhuman antibody into a human framework region to confer binding
activity onto the resultant grafted antibody, or variable region
binding fragment thereof. Once the CDR-grafted antibody, or
variable region binding fragment is made, binding affinity
comparable to the nonhuman antibody can be reacquired by subsequent
rounds of affinity maturation strategies known in the art.
Humanization of a rabbit polyclonal antibody can be accomplished by
similar methods as described in Rader et al, J. Biol. Chem.
275(18): 13668-13676 (2000), which is incorporated herein be
reference.
[0073] Humanization of a nonhuman antibody useful as a modulating
substance for practicing a method of the invention can also be
achieved by simultaneous optimization of framework and CDR
residues, which permits the rapid identification of co-operatively
interacting framework and CDR residues, as described in Wu et al.,
J. Mol. Biol. 294(1): 151-162 (1999), which is incorporated herein
by reference. Briefly, a combinatorial library that examines a
number of potentially important framework positions is expressed
concomitantly with focused CDR libraries consisting of variants
containing random single amino acid mutations in the third CDR of
the heavy and light chains. By this method, multiple Fab variants
containing as few as one nonhuman framework residue and displaying
up to approximately 500-fold higher affinity than the initial
chimeric Fab can be identified. Screening of combinatorial
framework-CDR libraries permits identification of monoclonal
antibodies with structures optimized for function, including
instances in which the antigen induces conformational changes in
the monoclonal antibody. The enhanced humanized variants contain
fewer nonhuman framework residues than antibodies humanized by
sequential in vitro humanization and affinity maturation strategies
known in the art.
[0074] It is further contemplated that a modulating substance
useful for practicing a method of the invention can be a human
antibody. Human antibodies can be produced by methods known in the
art that involve immunizing a transgenic nonhuman animal with the
desired antigen. The transgenic nonhuman animal can be modified
such that it fails to produce endogenous antibodies, but instead
produces B-cells which secrete fully human immunoglobulins. The
antibodies produced can be obtained from the animal directly or
from immortalized B-cells derived from the transgenic nonhuman
animal. Alternatively, the genes encoding the immunoglobulins with
human variable regions can be recovered and expressed to obtain the
antibodies directly or modified to obtain analogs of antibodies
such as, for example, single chain F, molecules. Thus, it is
contemplated to produce a modulating substance useful for
practicing a method of the invention that is a fully human
immunoglobulin to a specific antigen or to produce an analog of the
immunoglobulin by a process that includes immunizing a nonhuman
animal with antigen under conditions that stimulate an immune
response.
[0075] The nonhuman animal that produces a human antibody can be
modified to be substantially incapable of producing endogenous
heavy or light immunoglobulin chain, but capable of producing
immunoglobulins with both human variable and constant regions. In
the resulting immune response, the animal produces B cells which
secrete immunoglobulins that are fully human and specific for the
antigen, for example, GRP78. The human immunoglobulin of desired
specificity can be directly recovered from the animal, for example,
from the serum, or primary B cells can be obtained from the animal
and immortalized. The immortalized B cells can be used directly as
the source of human antibodies or, alternatively, the genes
encoding the antibodies can be prepared from the immortalized B
cells or from primary B cells of the blood or lymphoid tissue, for
example, spleen, tonsils, lymph nodes, bone marrow, of the
immunized animal and expressed in recombinant hosts, with or
without modifications, to produce the immunoglobulin or its
analogs. In addition, the genes encoding the repertoire of
immunoglobulins produced by the immunized animal can be used to
generate a library of immunoglobulins to permit screening for those
variable regions which provide the desired affinity. Clones from
the library which have the desired characteristics can then be used
as a source of nucleotide sequences encoding the desired variable
regions for further manipulation to generate human antibodies or
analogs with these characteristics using standard recombinant
techniques. Various techniques for preparing human antibodies using
transgenic nonhuman animals, for example, transgenic mice, are well
known in the art and described, for example, in Fishwild et al.,
Nature Biotechnology 14: 845-851 (1996); Heijnen et al., Journal of
Clinical Investigation 97: 331-338 (1996); Lonberg et al. Nature
368:856-859 (1994); Morrison, Nature 368:812-813 (1994); Neuberger,
Nature Biotechnology 14: 826 (1996); Chadd and Chamow, Curl. Opin.
Biotechnol. 12(2):188-94 (2001); Russel et al., Infection and
Immunity 1820-1826 (2000); Gallo et al., European Journal of
Immunology 30:534-540 (2000); Davis et al., Cancer Metastasis Rev.
18(4):421-5 (1999); Green, Journal of Immunological
Methods-231:11-23 (1999) Yang et al., Journal of Leukocyte Biology
66:401-410 (1999); Jakobovits, Advanced Drug Delivery Reviews
31:33-42 (1998); Green and Jakobovits, J. Exp. Med. 188(3):483-495
(1998); Jakobovits, Exp. Opin. Invest. Drugs 7(4):607-614 (1998);
Mendez et al., Nature Genetics 15:146-156 (1997); Jakobovits,
Weir's Handbook of Experimental Immunology, The Integrated Immune
System, Vol. IV: 194.1-194.7 (1996), each of which is incorporated
herein by reference. Furthermore, various techniques known in the
art for preparation of a human antibody are described in U.S. Pat.
Nos. 6,162,963; 6,150,584; 6,114,598; 6,111,166; 6,096,311 and
6,075,181, each of which is incorporated herein by reference.
[0076] As described herein, an antibody can be a modulating
substance useful for practicing a method of the invention and can
include, for example, a polyclonal antibody, monoclonal antibody as
well as recombinant versions and functional fragments thereof.
Recombinant versions of antibodies include a wide variety of
constructions ranging from simple expression and co-assembly of
encoding heavy and light chain cDNAs to specialty constructs termed
designer antibodies. Recombinant methodologies, combined with the
extensive characterization of polypeptides within the
immunoglobulin superfamily, and particularly antibodies, provides
the ability to design and construct a vast number of different
types, styles and specificities of binding molecules derived from
immunoglobulin variable and constant region binding domains.
Specific examples include chimeric antibodies, where the constant
region of one antibody is substituted with that of another
antibody, and humanized antibodies, described above, where the
complementarity determining regions (CDR) from one antibody are
substituted with those from another antibody.
[0077] Other recombinant versions of antibodies include, for
example, functional antibody variants where the variable region
binding domain or functional fragments responsible for maintaining
antigen binding is fused to an Fc receptor binding domain from the
antibody constant region. Such variants are essentially truncated
forms of antibodies that remove regions non-essential for antigen
and Fc receptor binding. Truncated variants can have single
valency, for example, or alternatively be constructed with multiple
valencies depending on the application and need of the user.
Additionally, linkers or spacers can be inserted between the
antigen and Fc receptor binding domains to optimize binding
activity as well as contain additional functional domains fused or
attached to effect biological functions other than, for example,
binding to a receptor autoantigen so as to inhibit its interaction
with an endogenous immunoglobulin; binding to a chemoattractant
molecule or its receptor to neutralize the cell recruitment
activity of the chemoattractant molecule; or binding to a
chemoattractant molecule receptor to prevent the release of the
chemoattractant molecule from a fibroblast cell. Those skilled in
the art will know how to construct recombinant antibodies in light
of the art knowledge regarding antibody engineering and given the
guidance and teachings herein. A description of recombinant
antibodies, functional fragments and variants and antibody-like
molecules can be found, for example, in "Antibody Engineering," 2nd
Edition, (Carl A. K. Borrebaeck, Ed.) Oxford University Press, New
York, (1995).
[0078] Additional functional variants of antibodies that can be
used as modulating substances useful for practicing a method of the
invention include antibody-like molecules other than antigen
binding-Fc receptor binding domain fusions. For example,
antibodies, functional fragments and fusions thereof containing a
Fc receptor binding domain can be produced to be bispecific in that
one variable region binding domain exhibits binding activity for
one antigen and the other variable region binding domain exhibits
binding activity for a second antigen. Such bispecific antibodies
can be advantageous in the methods of the invention because a
single bispecific antibody will contain two different target
antigen binding species. Therefore, a single molecular entity can
be administered to achieve neutralization of, for example,
GRP78.
[0079] An antibody useful as a modulating substance for practicing
the method of the invention can also be an immunoadhesion or
bispecific immunoadhesion. Immunoadhesions are antibody-like
molecules that combine the binding domain of a non-antibody
polypeptide with the effector functions of an antibody of an
antibody constant domain. The binding domain of the non-antibody
polypeptide can be, for example, a ligand or a cell surface
receptor having ligand binding activity Immunoadhesions can contain
at least the Fc receptor binding effector functions of the antibody
constant domain. Specific examples of ligands and cell surface
receptors that can be used for the antigen binding domain of an
immunoadhesion include, for example, a T cell receptor such as the
CCR5 receptor that recognizes GRP78. It is understood that other
ligands and ligand receptors known in the art can similarly be used
for the antigen binding domain of an immunoadhesion. In addition,
multivalent and multispecific immunoadhesions can be constructed
for use as a modulating substance for reducing the severity of a
condition associated with fibroblast mediated T-lymphocyte
infiltration. The construction of bispecific antibodies,
immunoadhesions, bispecific immunoadhesions and other
heteromultimeric polypeptides which can be used in the invention
methods is the individual matter of, for example, U.S. Pat. Nos.
5,807,706 and 5,428,130, which are incorporated herein by
reference.
[0080] Moreover, portions or fragments or variants of the GRP78
nucleotide sequence identified herein (and the corresponding
complete gene sequence) can be used in various ways as
polynucleotide reagents. For example, these sequences can be used
to identify and express recombinant polypeptides for analysis,
characterization, or therapeutic use. The sequences can
additionally be used as reagents in the screening and/or diagnostic
assays described hereinafter, and can also be included as
components of kits (e.g., diagnostic kits) for use in the screening
and/or diagnostic assays.
[0081] The compositions of the present invention in inhibiting
GRP78 can be applied to subjects who are suffering from a wide
variety of fungal infections including zygomycosis and
mucormycosis. The compositions of the invention can further be
supplemented with other antifungal agents (e.g., Amphotericin,
Deferiprone, Deferasirox). Alternatively, the compositions of the
invention can be applied prophylactically to all subjects who are
at high risk of developing mucormycosis or other fungal infections
(e.g., via active immunization). This would not be considered an
over treatment giving the high mortality and morbidity of
mucormycosis in view of the current antifungal and surgical
debridement treatment.
[0082] Further, the invention is also directed to host cells in
which immunogenic GRP78 polypeptides or GRP78 inhibitory
nucleotides (e.g., siRNA or antisense molecules) can be produced.
The term "host cell" is understood to refer not only to the
particular subject cell but also to the progeny or potential
progeny of the foregoing cell. A host cell can be any prokaryotic
(e.g., E. coli) or eukaryotic cell (e.g., yeast, insect cells, or
mammalian cells, such as CHO or COS cells). Other suitable host
cells are known to those skilled in the art. Vectors expressing
such immunogenic inhibitory molecules can be introduced into
prokaryotic or eukaryotic cells via conventional transfection or
transformation techniques (see, Sambrook et al., Molecular Cloning:
A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring
Harbor, N. Y., 1989).
[0083] According to another aspect of the present invention, any of
the above-described compositions can be used for treating or
prevention of a fungal condition. A fungal condition is an aberrant
condition or infection causes by a pathogenic fungus. Symptoms of a
fungal condition that can be ameliorated by a method of the
invention include, for example, fever, chills, night sweats,
anorexia, weight loss, malaise, depression and lung, skin or other
lesions. Other symptoms or characteristic manifestations include,
for example, dissemination from a primary focus, acute or subacute
presentations, progressive pneumonia, fungemia, manifestations of
extrapulmonary dissemination, chronic meningitis, progressive
disseminated histoplasmosis as a generalized involvement of the
reticuloendothelial system (liver, spleen, bone marrow) and
blastomycosis as single or multiple skin lesions. Effective
treatment of an individual with a fungal condition, for example,
will result in a reduction one or more of such symptoms in the
treated individual. Numerous other clinical symptoms of fungal
conditions are well known in the art and also can be used as a
measure of amelioration or reduction in the severity of a fungal
condition using the methods of the invention described herein.
[0084] Diagnosis of a fungal condition can be confirmed by
isolating causative fungi from, for example, sputum, urine, blood,
bone marrow, or specimens from infected tissues. For example,
fungal infections can be diagnosed histopathologically with a high
degree of reliability based on distinctive morphologic
characteristics of invading fungi and/or by immunohistochemistry
and the like selective for identifying antigens. Assessment of the
activity of the infection also can be based on cultures taken from
many different sites, fever, leukocyte counts, clinical and
laboratory parameters related to specific involved organs (e.g.,
liver function tests), and immunoserologic tests. The clinical
significance of positive sputum cultures also can be corroborated
by confirmation of tissue invasion.
[0085] Fungal infection, or mycoses, of humans and animals include,
for example, superficial fungal infections that affect the outer
layers of skin; fungal infections of the mucous membranes including
the mouth (thrush), vaginal and anal regions, such as those caused
by Candida albicans, and fungal infections that affect the deeper
layers of skin and internal organs are capable of causing serious,
often fatal illness, such as those caused by, for example, Rhizopus
oryzae. Fungal infections are well known in the art and include,
for example, zygomycosis, mucormycosis, aspergillosis,
cryptococcosis, candidiasis, histoplasmosis, coccidiomycosis,
paracoccidiomycosis, fusariosis (hyalohyphomycosis), blastomycosis,
penicilliosis or sporotrichosis. These and other fungal infections
can be found described in, for example, Merck Manual, Sixteenth
Edition, 1992, and in Spellberg et al., Clin. Microbio. Rev.
18:556-69 (2005).
[0086] The fungal conditions caused by fungi of the genus Candida,
candidiasis, can occur, for example, in the skin and mucous
membranes of the mouth, respiratory tract and/or vagina as well as
invade the bloodstream, especially in immunocompromised
individuals. Candidiasis also is known in the art as candidosis or
moniliasis. Exemplary species of the genus Candida include, for
example, Candida albicans, Candida krusei, Candida tropicalis,
Candida glabrata and Candida parapsilosis.
[0087] The fungal diseases caused by the genus Aspergillus include,
for example, allergic aspergillosis, which affects asthma, cystic
fibrosis and sinusitis patients; acute invasive aspergillosis,
which shows increased incidence in patients with weakened immunity
such as in cancer patients, patients undergoing chemotherapy and
AIDS patients; disseminated invasive aspergillosis, which is
widespread throughout the body, and opportunistic Aspergillus
infection, which is characterized by inflammation and lesions of
the ear and other organs. Aspergillus is a genus of around 200
fungi. Aspergillus species causing invasive disease include, for
example, Aspergillus fumigatus and Aspergillus flavus. Aspergillus
species causing allergic disease include, for example, Aspergillus
jimligatus and Aspergillus clavatus. Other exemplary Aspergillus
infectious species include, for example, Aspergillus terreus and
Aspergillus nidulans.
[0088] The fungal conditions such as, for example, zygomycosis and
mucormycosis which are caused by saprophytic mould fungi include
rhinocerebral mucormycosis, pulmonary mucormycosis,
gastrointestinal mucormycosis, disseminated mucormycosis, bone
mucormycosis, mediastinum mucormycosis, trachea mucormycosis,
kidney mucormycosis, peritoneum mucormycosis, superior vena cava
mucormycosis or external otitis mucormycosis. Infectious agents
causing mucormycosis are of the order Mucorales which include
species from Rhizopus genus such as, for example, Rhizopus oryzae
(Rhizopus arrhizus), Rhizopus microsporus, Rhizopus microsporus
var. rhizopodiformis; or species from Absidia genus such as, for
example, Absidia corymbifera; or species from Apophysomyces genus
such as, for example, Apophysomyces elegans; or species from Mucor
genus such as, for example, Mucor amphibiorum; or species from
Rhizomucor genus such as, for example, Rhizomucor pusillus; or
species from Cunninghamella genus (in the Cunninghamellaceae
family) such as, for example, Cunninghamella bertholletiae.
[0089] Various methods are described herein for effective
inhibition of GRP78 molecule and/or its function in treatment of
mucormycosis and other fungal diseases These inhibiting methods
involve vaccines, antisense, siRNA, antibody, or any other
compositions capable of effectively targeting and inhibiting the
function of GRP78. Such methods will reduce or prevent the growth
of the fungus in the infected tissues by inhibiting the penetration
through and damage of endothelial cells. An immunotherapeutic
inhibition of fungal penetration through and damage of endothelial
cells using a GRP78 antibody, polypeptide or functional fragment
thereof or a variant thereof is useful in this context because: (i)
the morbidity and mortality associated with mucormycosis, for
example, continues to increase, even with currently available
antifungal therapy; (ii) a rising incidence of antifungal
resistance is associated with the increasing use of antifungal
agents; iii) the population of patients at risk for serious
zygomycosis, mucormycosis, candidosis, or aspergillosis, for
example, is well-defined and very large, and includes, e.g.,
post-operative patients, transplant patients, cancer patients, low
birth weight infants, subjects with diabetes ketoacidosis (DKA) and
other forms of metabolic acidosis, subjects receiving treatment
with corticosteroids, subjects with neutropenia, trauma, burns, and
malignant hematological disorders, and subjects receiving
deferoxamine chelation-therapy or hemodialysis; and iv) a high
percentage of the patients who develop serious fungal infections
are not neutropenic, and thus can respond to a vaccine or a
competitive polypeptide or compound inhibitor. For these reasons,
Zygomycetes or Candida, for example, are fungal targets for passive
immunotherapy, active immunotherapy or a combination of passive or
active immunotherapy.
[0090] Without be bound by theory, it is completed that
mechanistically, GRP78 polypeptide acts in a receptor dependent
manor for pathogenic fungal penetration and damage of endothelial
cells. More specifically, the germling form of the fungus binds to
the GRP78 membrane bound polypeptide and the GRP79 polypeptide
mediated germling endocytosis by endothelial cells but not
adherence to the endothelial cells.
[0091] Therefore, the methods of the present invention in
inhibiting GRP78 can be applied to subjects who are suffering from
a wide variety of fungal infections including zygomycosis and
mucormycosis. The methods of the invention can further be
supplemented with other antifungal agents (e.g., Amphotericin,
Deferiprone, Deferasirox). Alternatively, the methods of the
invention can be applied prophylactically to all subjects who are
at high risk of developing mucormycosis or other fungal infections
(e.g., via active immunization). This would not be considered an
over treatment giving the high mortality and morbidity of
mucormycosis in view of the current antifungal and surgical
debridement treatment.
[0092] Accordingly, in one aspect, the invention provides a method
of treating or preventing disseminated mucormycosis or other fungal
conditions. The method includes administering to a subject having,
or susceptible to having, a fungal condition an immunogenic amount
of a GRP78 polypeptide, or an immunogenic fragment thereof in a
pharmaceutically acceptable medium or adjuvant. The preparation of
vaccines is generally described in, for example, M. F. Powell and
M. J. Newman, eds., "Vaccine Design (the subunit and adjuvant
approach)," Plenum Press (1995); A. Robinson, M. Cranage, and M.
Hudson, eds., "Vaccine Protocols (Methods in Molecular Medicine),"
Humana Press (2003); and D. Ohagan, ed., "Vaccine Adjuvants:
Preparation Methods and Research Protocols (Methods in Molecular
Medicine)," Humana Press (2000).
[0093] The vaccine compositions are administrated in a manner
compatible with the dosage formulation and in such amount as will
be prophylactically effective with or without an adjuvant. The
quantity to be administered, which is generally in the range of 1
to 10 mg, preferably 1 to 1000 .mu.g of antigen per dose, depends
on the subject to be treated, capacity of the subject's immune
system to synthesize antibodies, and the degree of protection
desired. Precise amounts of active ingredient required to be
administered can depend on the judgment of the practitioner and can
be peculiar to each subject. Moreover, the amount of polypeptide in
each vaccine dose is selected as an immunogenic amount which
induces an immunoprotective response. Particularly useful
immunogenic amounts include an amount of GRP78 polypeptide that
also is devoid of significant, adverse side effects. Such amount
will vary depending upon the immunogenic strength of an GRP78
polypeptide selected for vaccination. Useful immunogenic amounts of
an GRP78 polypeptide or immunogenic fragment thereof include, for
example, doses ranging from about 1-1000 .mu.g. In certain
embodiments, useful immunogenic amounts of an GRP78 polypeptide or
immunogenic fragment thereof include about 2-100 .mu.g, and
particularly useful dose ranges can range from about 4-40 .mu.g,
including for example, 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 35
and 40 .mu.g as well as all values in between the above exemplified
amounts. An optimal immunogenic amount for a selected GRP78
polypeptide vaccine of the invention can be ascertained using
methods well known in the art such as determination of antibody
titers and other immune responses in subjects as exemplified
previously. Following an initial vaccination, subjects receive a
boost in about 3-4 weeks. Vaccine delivery methods is further
described, for example, in S. Cohen and H. Bernstein, eds.,
"Microparticulate Systems for the Delivery of Proteins and Vaccines
(Drugs and The Pharmaceutical Sciences)," Vol. 77, Marcel Dekker,
Inc. (1996). Encapsulation within liposomes is described, for
example, by Fullerton, U.S. Pat. No. 4,235,877. Conjugation of
proteins to macromolecules is disclosed, for example, by Likhite,
U.S. Pat. No. 4,372,945 and by Armor et al., U.S. Pat. No.
4,474,757.
[0094] In another embodiment, the invention provides a method for
treating or preventing a fungal condition, comprising administering
to a subject having, or susceptible to having, a fungal condition a
therapeutically effective amount of an antisense RNA selected from
the group consisting of a nucleotide sequence that is substantially
complimentary to a portion of an GRP78 nucleic acid sequence or a
nucleotide sequence that is substantially complimentary to at least
12 contiguous nucleotide bases of GRP78 sequence and a
pharmaceutically acceptable excipient or carrier.
[0095] The antisense oligonucleotides used in accordance with this
invention can be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including Applied Biosystems.
Any other means for such synthesis can also be employed, however
the actual synthesis of the oligonucleotides are well within the
talents of those skilled in the art. It is also well known to use
similar techniques to prepare other oligonucleotides such as the
phosphorothioates and alkylated derivatives. As described earlier,
an antisense nucleic acid molecule (e.g., an antisense
oligonucleotide) can be chemically synthesized using naturally
occurring nucleotides or variously modified nucleotides designed to
hybridize with a control region of a gene (e.g., promoter,
enhancer, or transcription initiation region) to inhibit the
expression of the GRP78 gene through triple-helix formation.
Alternatively, the antisense nucleic acid molecule can be designed
to hybridize with the transcript of GRP78 (i.e., mRNA), and thus
inhibit the translation of GRP78 by inhibiting the binding of the
transcript to ribosomes. The antisense methods and protocols are
generally described in, for example, C. Stein, A. Krieg, eds.,
"Applied Antisense Oligonucleotide Technology" Wiley-Liss, Inc.
(1998); or U.S. Pat. Nos. 5,965,722; 6,339,066; 6,358,931; and
6,359,124.
[0096] The antisense compositions of the invention can be delivered
to a subject in need thereof with variety of means known in the
art. For example, microparticles such as polystyrene
microparticles, biodegradable particles, liposomes or microbubbles
containing the antisense compositions in releasable form can be
used for direct delivery of the compositions into tissues via
injection. In some embodiments of the invention, the antisense
oligonucleotides can be prepared and delivered in a viral vector
such as hepatitis B virus (see, for example, Ji et al., J. Viral
Hepat. 4:167 173 (1997)); in adeno-associated virus (see, for
example, Xiao et al. Brain Res. 756:76 83 (1997)); or in other
systems including but not limited to an HVJ (Sendai virus)-liposome
gene delivery system (see, for example, Kaneda et al. Ann. N.Y.
Acad. Sci. 811:299 308 (1997)); a "peptide vector" (see, for
example, Vidal et al. CR Acad. Sci 111 32):279 287 (1997)); as a
gene in an episomal or plasmid vector (see, for example, Cooper et
al. Proc. Natl. Acad. Sci. U.S.A. 94:6450 6455 (1997), Yew et al.
Hum Gene Ther. 8:575 584 (1997)); as a gene in a peptide-DNA
aggregate (see, for example, Niidome et al. J. Biol. Chem.
272:15307 15312 (1997)); as "naked DNA" (see, for example, U.S.
Pat. No. 5,580,859 and U.S. Pat. No. 5,589,466); in lipidic vector
systems (see, for example, Lee et al. Crit Rev Ther Drug Carrier
Syst. 14:173 206 (1997)); polymer coated liposomes (Marin et al.,
U.S. Pat. No. 5,213,804 issued Can 25, 1993; Woodle et al., U.S.
Pat. No. 5,013,556 issued Can 7, 1991); cationic liposomes (Epand
et al., U.S. Pat. No. 5,283,185 issued Feb. 1, 1994; Jessee, J. A.
U.S. Pat. No. 5,578,475 issued Nov. 26, 1996; Rose et al, U.S. Pat.
No. 5,279,833 issued Jan. 18, 1994; Gebeyehu et al., U.S. Pat. No.
5,334,761 issued Aug. 2, 1994); gas filled microspheres (Unger et
al., U.S. Pat. No. 5,542,935 issued Aug. 6, 1996), ligand-targeted
encapsulated macromolecules (Low et al. U.S. Pat. No. 5,108,921
issued Apr. 28, 1992; Curiel et al., U.S. Pat. No. 5,521,291 issued
Can 28, 1996; Groman et al., U.S. Pat. No. 5,554,386 issued Sep.
10, 1996; Wu et al., U.S. Pat. No. 5,166,320 issued Nov. 24,
1992).
[0097] The invention also provides a method of treating or
preventing a fungal condition in a subject in need thereof,
including exposing said fungi to a small interfering RNA against
GRP78. In one aspect, small interfering RNA sequence that is
substantially complimentary to at least 18 contiguous nucleotide
bases of GRP78 sequence is used that is capable of binding to an
GRP78 nucleotide sequence or a fragment thereof. In another aspect
the small interfering RNA includes the nucleotide sequence
CTTGTTGGTGGCTCGACTCGA (SEQ ID NO. 1).
[0098] Double-stranded RNA (dsRNA) also known as small-interfering
RNA (siRNA) induces sequence-specific post-transcriptional gene
silencing in many organisms by a process known as RNA interference
(RNAi). In the present invention, as described in Example I, RNAi
has been prepared and used to knock-down GRP78 expression in a DKA
mouse model of mucormycosis infection, and in doing so it
demonstrates a dramatic effect on survival and protection against
the infection.
[0099] The siRNA is usually administered as a pharmaceutical
composition. The administration can be carried out by known
methods, wherein a nucleic acid is introduced into a desired target
cell in vitro or in vivo. Commonly used gene transfer techniques
include calcium phosphate, DEAE-dextran, electroporation and
microinjection and viral methods (Graham et al. Virol. 52, 456
(1973); McCutchan et al. J. Natl. Cancer Inst. 41, 351(1968); Chu
et al. Nucl Acids Res. 15, 1311 (1987); Fraley et al. J. Biol.
Chem. 255, 10431 (1980); Capecchi, Cell 22, 479 (1980); and
cationic liposomes (Feigner et al. Proc. Natl. Acad. Sci USA 84,
7413 (1987)). Commercially available cationic lipid formulations
are e.g. TFX 50.TM. (Promega) or LIPOFECTAMIN2000.TM.
(Invitrogen).
[0100] The invention also provides a method of treating or
preventing a fungal condition in a subject in need thereof,
including administering a therapeutically effective amount of an
antibody inhibitor of GRP78. In one embodiment, the antibody
inhibitor of GRP78 is an antibody or antibody fragment that
specifically binds to an GRP78 nucleotide polypeptide or a fragment
thereof.
[0101] As described earlier the antibody inhibitors of GRP78 are
capable of binding to and inhibition of GRP78 function. The
antibody inhibitors of the present invention can bind to GRP78, a
portion, fragment, or variant thereof, and interfere with or
inhibit the protein function. These antibodies can inhibit GRP78 by
negatively affecting, for example, the protein's proper membrane
localization, folding or conformation, its substrate binding
ability.
[0102] The antibodies of the present invention can be generated by
any suitable method known in the art. Polyclonal antibodies against
GRP78 can be produced by various procedures well known in the art.
For example, an GRP78 peptide antigenic can be administered to
various host animals including, but not limited to, rabbits, mice,
rats, etc. to induce the production of sera containing polyclonal
antibodies specific for the antigen. Various adjuvants can be used
to increase the immunological response, depending on the host
species, and include but are not limited to, Freund's (complete and
incomplete), mineral gels such as aluminum hydroxide, alum
(ALHYDROGEL), surface active substances such as lysolecithin,
pluronic polyols, polyanions, peptides, oil emulsions, keyhole
limpet hemocyanins, dinitrophenol, and potentially useful human
adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium
parvum. Such adjuvants are also well known in the art.
[0103] GRP78 peptide antigens suitable for producing antibodies of
the invention can be designed, constructed and employed in
accordance with well-known techniques. See, e.g., ANTIBODIES: A
LABORATORY MANUAL, Chapter 5, p. 75-76, Harlow & Lane Eds.,
Cold Spring Harbor Laboratory (1988); Czernik, Methods In
Enzymology, 201: 264-283 (1991); Merrifield, J. Am. Chem. Soc. 85:
21-49 (1962)). Monoclonal antibodies of the present invention can
be prepared using a wide variety of techniques known in the art
including the use of hybridoma, recombinant, and phage display
technologies, or a combination thereof. For example, monoclonal
antibodies can be produced using hybridoma techniques including
those known in the art and taught, for example, in Harlow et al.,
Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory
Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal Antibodies
and T-Cell Hybridomas 563-681 (Elsevier, N. Y., 1981) (said
references incorporated by reference in their entireties).
[0104] The antibodies of the present invention can also be
generated using various phage display methods known in the art. In
phage display methods, functional antibody domains are displayed on
the surface of phage particles which carry the polynucleotide
sequences encoding them. In a particular embodiment, such phage can
be utilized to display antigen binding domains expressed from a
repertoire or combinatorial antibody library (e.g., human or
murine). Phage expressing an antigen binding domain that binds the
antigen of interest can be selected or identified with antigen,
e.g., using labeled antigen or antigen bound or captured to a solid
surface or bead. Phage used in these methods are typically
filamentous phage including fd and M13 binding domains expressed
from phage with Fab, Fv or disulfide stabilized Fv antibody domains
recombinantly fused to either the phage gene III or gene VIII
protein. Examples of phage display methods that can be used to make
the antibodies of the present invention include those disclosed in
U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717;
5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637;
5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is
incorporated herein by reference in its entirety.
[0105] The antibodies of the invention can be assayed for
immunospecific binding by any method known in the art. The
immunoassays which can be used include but are not limited to
competitive and non-competitive assay systems using techniques such
as western blots, radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoprecipitation
assays, precipitin reactions, gel diffusion precipitin reactions,
immunodiffusion assays, agglutination assays, complement-fixation
assays, immunoradiometric assays, fluorescent immunoassays, protein
A immunoassays, to name but a few. Such assays are routine and well
known in the art. See, e.g., Sambrook, Fitsch & Maniatis,
Molecular Cloning: A Laboratory Manual, Second Edition Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
[0106] Specific binding can be determined by any of a variety of
measurements known to those skilled in the art including, for
example, affinity (K.sub.a or K.sub.d), association rate
(k.sub.on), dissociation rate (k.sub.off), avidity or a combination
thereof. Antibodies of the present invention can also be described
or specified in terms of their binding affinity to GRP78. Preferred
binding affinities include those with a dissociation constant or
K.sub.d less than 5.times.10.sup.-2 M, 10.sup.-2 M,
5.times.10.sup.-3M, 10.sup.-3M, 5.times.10.sup.-4 M, 10.sup.-4 M,
5.times.10.sup.-5 M, 10.sup.-5 M, 5.times.10.sup.-6M, 10.sup.-6M,
5.times.10.sup.-7 M, 10.sup.-7 M, 5.times.10.sup.-8M, 10.sup.-8M,
5.times.10.sup.-9M, 10.sup.-9M, 5.times.10.sup.-10 M, 10.sup.-10 M,
5.times.10.sup.-11M, 10.sup.-11M, 5.times.10.sup.-12M, 10.sup.-12M,
5.times.10.sup.-13 M, 10.sup.-13 M, 5.times.10.sup.-14M, 10.sup.-14
M, 5.times.10.sup.-15 M, or 10.sup.-15M.
[0107] An exemplary approach in which the antibodies of the present
invention can be used as GRP78 inhibitors includes binding to and
inhibiting GRP78 polypeptides locally or systemically in the body
or by direct cytotoxicity of the antibody, e.g. as mediated by
complement (CDC) or by effector cells (ADCC). The antibodies of
this invention can be advantageously utilized in combination with
other monoclonal or chimeric antibodies, or with lymphokines or
hematopoietic growth factors (such as, e.g., IL-2, IL-3 and IL-7),
for example, which serve to increase the number or activity of
effector cells which interact with the antibodies.
[0108] The antibodies of the invention can be administered alone or
in combination with other types of treatments such as, for example,
anti-fungal therapies. In one embodiment, GRP78 antibodies are
administered to a human patient for therapy or prophylaxis.
[0109] Various delivery systems are known and can be used to
administer the antibody inhibitors of the invention, e.g.,
encapsulation in liposomes, microparticles, microcapsules,
recombinant cells capable Methods of introduction include but are
not limited to intradermal, intramuscular, intraperitoneal,
intravenous, subcutaneous, intranasal, epidural, and oral routes.
The compounds or compositions can be administered by any convenient
route, for example by infusion or bolus injection, by absorption
through epithelial or mucocutaneous linings (e.g., oral mucosa,
rectal and intestinal mucosa, etc.) and can be administered
together with other biologically active agents. Administration can
be systemic or local. Pulmonary administration can also be
employed, e.g., by use of an inhaler or nebulizer, and formulation
with an aerosolizing agent.
[0110] For antibodies, the dosage administered to a subject is
typically 0.1 mg/kg to 100 mg/kg of the subject's body weight.
Preferably, the dosage administered to a subject is between 0.1
mg/kg and 20 mg/kg of the subject's body weight, more preferably 1
mg/kg to 10 mg/kg of the subject's body weight. Generally,
humanized or human antibodies have a longer half-life within the
human body than antibodies from other species due to the immune
response to the foreign polypeptides. Thus, lower dosages of
humanized antibodies and less frequent administration is often
possible. Further, the dosage and frequency of administration of
antibodies of the invention can be reduced by enhancing uptake and
tissue penetration (e.g., into the brain) of the antibodies by
modifications such as, for example, lipidation.
[0111] In pharmaceutical dosage forms, the compositions of the
invention including vaccine, antisense, siRNA and antibodies can be
used alone or in appropriate association, as well as in
combination, with each other or with other pharmaceutically active
compounds. Administration of the agents can be achieved in various
ways, including oral, buccal, nasal, rectal, parenteral,
intraperitoneal, intradermal, transdermal, subcutaneous,
intravenous, intra-arterial, intracardiac, intraventricular,
intracranial, intratracheal, and intrathecal administration, etc.,
or otherwise by implantation or inhalation. Thus, the subject
compositions can be formulated into preparations in solid,
semi-solid, liquid or gaseous forms, such as tablets, capsules,
powders, granules, ointments, solutions, suppositories, enemas,
injections, inhalants and aerosols. The following methods and
excipients are merely exemplary and are in no way limiting.
[0112] Any of treatment modalities disclosed herein can be combined
and administered to a subject suffering from a fungal infection or
being at risk for developing a fungal infection (prophylactic
vaccination or treatment). In a combination therapy, for example, a
subject can first receive a vaccine of the invention to generate an
immune response towards the fungi, then an antisense, siRNA and/or
antibody that can target GRP78 of the subject and further augment
the fungal treatment. In one embodiment of the treatment, the
vaccine of the invention is used in combination with an antisense,
siRNA and/or antibody against GRP78 for treating or preventing a
fungal condition such as, for example, mucormycosis. In another
embodiment, the antibodies of the invention are used in combination
with antisense and/or siRNA for treating the fungal condition.
[0113] The compositions of the inventions, either alone or in
combination, can further be combined one or more methods or
compositions available for fungal therapy. In one embodiment, the
compositions of the invention can be used in concert with a
surgical method to treat a fungal infection. In yet another
embodiment, the compositions of the invention can be used in
combination with a drug or radiation therapy for treating a fungal
condition. Antifungal drugs that are useful for combination therapy
with the compositions of the invention include, but are not limited
to, amphotericin B, iron chelators such as, for example,
Deferasirox, Deferiprone, POSACONAZOLE.RTM., FLUCONAZOLE.RTM.,
ITRACONAZOLE.RTM. and/or KETOCONAZOLE.RTM.. Radiations useful in
combination therapies for treating fungal infections include
electromagnetic radiations such as, for example, near infrared
radiation with specific wavelength and energy useful for treating
fungal infections. In combination therapy, chemotherapy or
irradiation is typically followed by administration of the vaccine
in such a way that the formation of an effective anti-fungal immune
response is not compromised by potential residual effects of the
prior treatment.
[0114] In a further embodiment of combination therapy, the
compositions of the invention can be combined with immunocytokine
treatments. Without wishing to be bound by theory, it is believed
that, for example, a vaccine generates a more effective immune
response against, for example, an infection when a cytokine
promoting the immune response is present at the site of the
infection. For example, useful immunocytokines are those that
elicit Thl response, such as IL-2 or IL-12. During a combination
therapy, for example, a subject can first receive a vaccine of the
invention to generate an immune response towards a fungal
infection, then an immunocytokine that can target the fungi and
support the immune response in fighting the infection. Preferred
immunocytokines typically have, for example, an antibody moiety
that recognizes a surface antigen characteristic of the fungi
Immunocytokines typically also have a cytokine moiety such as IL-2,
IL-12, or others that preferentially direct a Thl response.
Immunocytokines suitable for the invention are described in U.S.
Pat. No. 5,650,150, the contents of which are hereby incorporated
by reference.
[0115] In another embodiment of combination therapy, combinations
of the compositions of the invention can be administered either
concomitantly, e.g., as an admixture, separately but simultaneously
or concurrently; or sequentially. This includes presentations in
which the combined agents are administered together as a
therapeutic mixture, and also procedures in which the combined
agents are administered separately but simultaneously, e.g., as
through separate intravenous lines into the same individual.
Administration "in combination" further includes the separate
administration of one of the compounds or agents given first,
followed by the second. In another specific embodiment,
compositions of the invention are used in any combination with
amphotericin B, Deferasirox, Deferiprone, POSACONAZOLE.RTM.,
FLUCONAZOLE.RTM., ITRACONAZOLE.RTM., and/or KETOCONAZOLE.RTM. to
prophylactically treat, prevent, and/or diagnose an opportunistic
fungal infection.
[0116] The invention, therefore, provides methods of treatment,
inhibition and prophylaxis by administration to a subject of a
therapeutically effective amount of one or more compounds or
pharmaceutical compositions of the invention. In a preferred
aspect, the compositions of the invention are substantially
purified (e.g., substantially free from substances that limit their
effect or produce undesired side-effects). The subject is
preferably an animal, including but not limited to animals such as
cows, pigs, horses, chickens, cats, dogs, etc., and is preferably a
mammal, and most preferably human.
[0117] As discussed above, various delivery systems are known and
can be used to administer the compositions of the invention. The
compositions can be administered by any convenient route, for
example by infusion or bolus injection, by absorption through
epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and
intestinal mucosa, etc.) and can be administered together with
other biologically active agents. Administration can be systemic or
local.
[0118] In a specific embodiment, it can be desirable to administer
the pharmaceutical compounds or compositions of the invention
locally to the area in need of treatment; this can be achieved by,
for example, and not by way of limitation, local infusion during
surgery, topical application, e.g., in conjunction with a wound
dressing after surgery, by injection, by means of a catheter, by
means of a suppository, or by means of an implant, said implant
being of a porous, non-porous, or gelatinous material, including
membranes, such as sialastic membranes, or fibers. Preferably, when
administering a protein, including a vaccine or antibody, of the
invention, care must be taken to use materials to which the protein
does not absorb. In another embodiment, the compound or composition
can be delivered in liposomes. In yet another embodiment, the
compounds or compositions can be delivered in a controlled release
system.
[0119] In an embodiment, the compositions are formulated in
accordance with routine procedures as a pharmaceutical composition
adapted for intravenous administration to human beings. Typically,
compositions for intravenous administration are solutions in
sterile isotonic aqueous buffer. Where necessary, the composition
can also include a solubilizing agent and a local anesthetic such
as lignocaine to ease pain at the site of the injection. Generally,
the ingredients are supplied either separately or mixed together in
unit dosage form, for example, as a dry lyophilized powder or water
free concentrate in a hermetically sealed container such as an
ampoule indicating the quantity of active agent. Where the
compositions are to be administered by infusion, they can be
dispensed with an infusion bottle containing sterile pharmaceutical
grade water or saline. Where the compositions are administered by
injection, an ampoule of sterile water for injection or saline can
be provided so that the ingredients can be mixed prior to
administration.
[0120] The compounds of the invention can also be formulated as
neutral or salt forms. Pharmaceutically acceptable salts include
those formed with anions such as those derived from hydrochloric,
phosphoric, acetic, oxalic, tartaric acids, etc., and those formed
with cations such as those derived from sodium, potassium,
ammonium, calcium, ferric hydroxides, isopropylamine,
trimethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
[0121] The amount of the compounds or compositions of the invention
which will be effective in the treatment, inhibition and prevention
of a fungal disease or condition can be determined by standard
clinical techniques. In addition, in vitro assays can optionally be
employed to help identify optimal dosage ranges. The precise dose
to be employed in the formulation will also depend on the route of
administration, and the seriousness of the disease or condition,
and should be decided according to the judgment of the practitioner
and each subject's circumstances. Effective doses can be
extrapolated from dose-response curves derived from in vitro or
animal model test systems.
[0122] It is understood that modifications which do not
substantially affect the activity of the various embodiments of
this invention are also included within the definition of the
invention provided herein. Accordingly, the following examples are
intended to illustrate but not limit the present invention.
EXAMPLES
Example I
Endothelial Cell Receptor GRP78 is Required for Mucormycosis
Pathogenesis
[0123] Mucormycosis is a life-threatening infection caused by fungi
of the order Mucorales, the most common etiologic species of which
is Rhizopus oryzae. The most common predisposing risk factor for
mucormycosis is diabetes mellitus, and it has been long established
that patients with diabetic ketoacidosis (DKA) have a unique
predisposition to this infection (Ibrahim et al., Clinical
Mycology, Dismukes et al., eds. New York, N.Y.: Oxford University
Press, pp. 241-251 (2003) Spellberg et al., Clin. Microbiol Rev.
18(3):556-569 (2005)). Unfortunately, despite surgical debridement
and first-line antifungal therapy, the overall mortality of
mucormycosis remains unacceptably high, and survivors are typically
left with considerable disfigurement from the infection and surgery
(Spellberg (2005) supra; Gleissner et al., Leuk Lymphoma
45(7):1351-1360 (2004)).
[0124] A hallmark of mucormycosis is the presence of extensive
angioinvasion with resultant vessel thrombosis and tissue necrosis
(Ibrahim et al., Clinical Mycology, Dismukes et al., eds. New York,
N.Y.: Oxford University Press, pp. 241-251 (2003); Spellberg et
al., (2005) supra). Ischemic necrosis of infected tissues can
prevent delivery of leukocytes and antifungal agents to the foci of
infection. Thus, angioinvasion is a key factor in the pathogenesis
of mucormycosis. During angioinvasion, the organism invades and
damages vascular endothelial cells. Therefore, understanding the
mechanisms by which these processes occur will lead to new
approaches to prevent and/or treat mucormycosis.
[0125] R. oryzae strains were previously described to adhere to
human umbilical vein endothelial cells in vitro and invade these
cells by induced endocytosis (Ibrahim et al., Infect Immun.
73(2):778-783 (2005)). Endocytosed R. oryzae damages endothelial
cells, and prevention of endocytosis abrogates the ability of the
organisms to cause endothelial cell damage (Ibrahim et al., (2005)
supra). In the experiments described herein, the receptor
responsible for R. oryzae adherence to and invasion through
endothelial cells is described. Furthermore, the influence of
glucose and iron levels to regulate the expression the receptor are
shown to be consistent with those seen during DKA.
[0126] R. oryzae and culture conditions. Several clinical Mucorales
isolates were used in this study. R. oryzae 99-880 and Mucor sp
99-932 are brain isolates, while R. oryzae 99-892 and Rhizopus sp
99-1150 were isolated from lungs of infected patients and obtained
from the Fungus Testing Laboratory, University of Texas Health
Science Center at San Antonio, San Antonio, Tex., USA.
Cunninghamella bertholletiae 182 is also a clinical isolate and was
a gift from Thomas Walsh (NIH, Bethesda, Md., USA). Rhizopus
microsporus ATCC 20577 is an environmental isolate obtained from
ATCC. A. fumigatus AF293 and C. albicans SC5314 are clinical
isolates that were used to determine whether anti-GRP78 Ab blocks
endothelial cell damage caused by these two organisms. Mucorales
were grown on potato dextrose agar (PDA; BD Biosciences Diagnostic
Systems) plates for 3-5 days at 37.degree. C., while A. fumigatus
and C. albicans were grown on Sabouraud dextrose agar (SDA) plates
for 2 weeks and 48 hours, respectively, at 37.degree. C. The
sporangiospores were collected in endotoxin-free Dulbecco's PBS
containing 0.01% TWEEN 80 (for Mucorales) and 0.2% TWEEN 80 (for A.
fumigatus), washed with PBS, and counted with a hemocytometer to
prepare the final inocula. For C. albicans, blastospores were
collected in PBS after the organisms were grown in YPD medium (1%
yeast extract [Difco Laboratories], 2% Bacto Peptone [Difco
Laboratories], and 2% glucose [Sigma-Aldrich]) at 30.degree. C.
overnight. To form germlings, spores were incubated in liquid YPD
medium at 37.degree. C. with shaking for 1-3 hours based on the
assay under study. Germlings were washed twice with RPMI 1640
without glutamine (Irvine Scientific) for all assays used, except
in experiments involving isolation of the endothelial cell
receptor, for which the germlings were washed twice with PBS (plus
Ca.sup.2+ and Mg.sup.2+).
[0127] Endothelial Cells and CHO Cells.
[0128] Endothelial cells were collected from umbilical vein
endothelial cells by the method of Jaffe et al. (Jaffe et al., J
Gin Invest. 52(11):2745-2756 (1973)). The cells were harvested by
using collagenase and were grown in M-199 (Gibco BRL) enriched with
10% fetal bovine serum, 10% defined bovine calf serum, 1-glutamine,
penicillin, and streptomycin (all from Gemini Bio-Products).
Second-passage cells were grown to confluency in 96-well tissue
culture plates (Costar) on fibronectin (BD Biosciences). All
incubations were in 5% CO.sub.2 at 37.degree. C. The reagents were
tested for endotoxin using a chromogenic limulus amebocyte lysate
assay (BioWhittaker Inc.), and the endotoxin concentrations were
less than 0.01 IU/ml. Endothelial cell collection was approved by
the Institutional Review Board of Los Angeles Biomedical Research
Institute at Harbor-UCLA Medical Center. CHO cell line C.1, which
was derived from parental DHFR-deficient CHO cells engineered to
overexpress GRP78s, was a gift of Randall Kaufman, University of
Michigan, Ann Arbor, Mich., USA (Reddy et al., J. Biol. Chem.
278(23):20915-20924 (2003); Morris et al., J. Biol. Chem.
272(7):4327-4334 (1997)).
[0129] Extraction of Endothelial Cell Membrane Proteins.
[0130] Endothelial cell membrane proteins were extracted according
to the method of Isberg and Leong (Isberg and Leong, Cell
60(5):861-871 (1990). Briefly, confluent endothelial cells in
100-mm-diameter tissue culture dishes were rinsed twice with warm
Dulbecco's PBS containing Ca.sup.2+ and Mg.sup.2+ (PBS-CM) and then
incubated with EZ-Link Sulfo-NHS-LS-Biotin (0.5 mg/ml; Pierce) in
PBS-CM for 12 minutes at 37.degree. C. in 5% CO.sub.2. The cells
were then rinsed extensively with cold PBS-CM and scraped from the
tissue culture dishes. The endothelial cells were collected by
centrifugation at 500 g for 5 minutes at 4.degree. C. and then
lysed by incubation for 20 minutes on ice in PBS-CM containing 5.8%
n-octyl-[3-d-glucopyranoside (w/v) (Calbiochem) and protease
inhibitors (1 mM phenylmethylsulfonyl fluoride, 1 ug/ml pepstatin
A, 1 ug/ml leupeptin, and 1 aprotinin) (Sigma-Aldrich). The cell
debris was removed by centrifugation at 5,000 g for 5 minutes at
4.degree. C. The supernatant was collected and centrifuged at
100,000 g for 1 hour at 4.degree. C. The concentration of the
endothelial cell proteins in the resulting supernatant was
determined using the Bradford method (Bio-Rad).
[0131] Isolation of Endothelial Cell Receptors that Bind to
Mucorales.
[0132] Live Mucorales spores (8.times.10.sup.8) or an equivalent
volume of 1-3 hour germlings (approximately 2.times.10.sup.8 cells)
were incubated for 1 hour on ice with 250 jig of biotin-labeled
endothelial cell surface proteins in PBS-CM plus 1.5%
n-octyl-(3-d-glucopyranoside and protease inhibitors. The unbound
endothelial cell proteins were washed away by 3 rinses with this
buffer. The endothelial cell proteins that remained bound to the
fungal cells were eluted twice with 6 M urea (Fluka), and the
supernatant was combined and concentrated to an appropriate volume
with a Microcon centrifugal filter (10,000 MWCO; Millipore). The
proteins were then separated on 10% SDS-PAGE and transferred to
PVDF-plus membranes (GE Water & Process Technologies). The
membrane was then treated with Western Blocking Reagent (Roche) and
probed with a mouse anti-biotin monoclonal Ab (Sigma-Aldrich). The
membrane was then washed and incubated with secondary Ab,
HRP-conjugated sheep anti-mouse IgG (Sigma-Aldrich). After
incubation with SuperSignal West Dura Extended Duration Substrate
(Pierce), the signals were detected using a CCD camera.
[0133] To identify endothelial cell proteins that bound to
Mucorales, endothelial cell membrane proteins were incubated with
R. oryzae germlings as above. The eluted proteins were separated by
SDS-PAGE, and the gel was stained with SYPRO Ruby (Molecular
Probes, Invitrogen). The major band at approximately 75 kDa was
excised and microsequenced using MALDITOF MS/MS (Emory University
Microchemical Facility).
[0134] To confirm the identity of GRP78, endothelial cell membrane
proteins that bound to R. oryzae were separated on an
SDS-polyacrylamide gel and transferred to PVDF-plus membranes.
Membranes were probed with a rabbit anti-GRP78 Ab (Abeam), followed
by HRP-conjugated goat anti-rabbit IgG (Pierce) as a secondary Ab.
After incubation with SuperSignal West Dura Extended Duration
Substrate (Pierce), the signals were detected using a CCD
camera.
[0135] Colocalization of GRP78 with Phagocytosed R. oryzae
Germlings by Indirect Immunofluorescence.
[0136] A modified method as previously described was used (Phan et
al., J. Biol. Chem. 280(11):10455-10461 (2005)). Confluent
endothelial cells on a 12-mm-diameter glass coverslip were infected
with 10.sup.5/ml R. oryzae cells in RPMI 1640 medium that had been
pregerminated for 1 or 3 hours. After 60 minutes incubation at
37.degree. C., the cells were gently washed twice with HBSS to
remove unbound organisms and then fixed with 3% paraformaldehyde.
After washing with 1% BSA (Fisher) prepared in PBS-CM, the cells
were incubated for 1 hour with rabbit anti-GRP78 Ab (Abcam), then
counterstained with ALEXA FLUOR 488-labeled goat anti-rabbit IgG
(Molecular Probes, Invitrogen). Cells were then permeabilized for 5
minutes in 0.5% TRITON X-100 and incubated with ALEXA FLUOR
568-labeled phalloidin (Molecular Probes) for 1 hour to detect
F-actin. After washing, the coverslip was mounted on a glass slide
with a drop of ProLong Gold antifade reagent (Molecular Probes,
Invitrogen) and viewed by confocal microscopy. The final confocal
images were produced by combining optical sections taken through
the z axis.
[0137] Interactions of Fungi with Endothelial or CHO Cells.
[0138] The number of organisms endocytosed by endothelial cells or
CHO cells was determined using a modification of a previously
described differential fluorescence assay (Ibrahim et al., Infect
Immun. 63(11):4368-4374 (1995)). Briefly, 12-mm glass coverslips in
a 24-well cell culture plate were coated with fibronectin for at
least 4 hours and seeded with endothelial or CHO cells until
confluency. After washing twice with pre-warmed HBSS, the cells
were then infected with 10' cells of R. oryzae in RPMI 1640 medium
that had been germinated for 1 hour. Following incubation for 3
hours, the cells were fixed in 3% paraformaldehyde and were stained
for 1 hour with 1% UVITEX.RTM. (a gift from Jay Isharani,
Ciba-Geigy, Greensboro, N.C., USA), which specifically binds to the
chitin of the fungal cell wall. After washing 3 times with PBS, the
coverslips were mounted on a glass slide with a drop of ProLong
Gold antifade reagent and sealed with nail polish. The total number
of cell-associated organisms (i.e., germlings adhering to
monolayer) was determined by phase-contrast microscopy. The same
field was examined by epifluorescence microscopy, and the number of
uninternalized germlings (which were brightly fluorescent) was
determined. The number of endocytosed organisms was calculated by
subtracting the number of fluorescent organisms from the total
number of visible organisms. At least 400 organisms were counted in
20-40 different fields on each slide. Two slides per arm were used
for each experiment, and the experiment was performed in triplicate
on different days.
[0139] R. oryzae-induced endothelial or CHO cell damage was
quantified by using a chromium (.sup.51Cr) release assay (Ibrahim
et al., J Infect Dis. 198(7):1083-1090 (2008)). Briefly,
endothelial cells or CHO cells grown in 96-well tissue culture
plates containing detachable wells were incubated with 1 .mu.Ci per
well of Na.sub.2.sup.51CrO.sub.4 (ICN) in M-199 medium (for
endothelial cells) or Alpha minimum Eagle's medium (for CHO cells)
for 16 hours.
[0140] On the day of the experiment, the unincorporated .sup.51Cr
was aspirated, and the wells were washed twice with warmed HB SS
(Irvine Scientific). Cells were infected with fungal germlings
(1.5.times.10.sup.5 germinated for 1 hour) suspended in 150 .mu.l
RPMI 1640 medium (Irvine Scientific) supplemented with glutamine
Spontaneous .sup.51Cr release was determined by incubating
endothelial or CHO cells in RPMI 1640 medium supplemented with
glutamine without R. oryzae. After 3 hours of incubation at
37.degree. C. in a 5% CO.sub.2 incubator, 50% of the medium was
aspirated from each well and transferred to glass tubes, and the
cells were manually detached and placed into another set of tubes.
The amount of .sup.51Cr in the aspirate and the detached well was
determined by gamma counting. The total amount .sup.51Cr
incorporated by endothelial cells in each well equaled the sum of
radioactive counts per minute of the aspirated medium plus the
radioactive counts of the corresponding detached wells. After the
data were corrected for variations in the amount of tracer
incorporated in each well, the percentage of specific endothelial
cell release of .sup.51Cr was calculated by the following formula:
[(experimental release.times.2)-(spontaneous
release.times.2)]/[total incorporation-(spontaneous
release.times.2)]. Each experimental condition was tested at least
in triplicate and the experiment repeated at least once.
[0141] For Ab blocking of adherence, endocytosis, or damage caused
by R. oryzae, the assays were carried out as above except that
endothelial cells were incubating with 50 .mu.g anti-GRP78 or
anti-p53 Ab (as an isotype matching control) (Santa Cruz
Biotechnology Inc.) for 1 hour prior to addition of R. oryzae
germlings Similar experiments were carried out to determine the
effect of anti-GRP78 Ab on A. fumigatus- and C. albicans-induced
damage to endothelial cells, with the exception that the damage
assay was carried out for 20 hours and 3 hours, respectively.
[0142] To determine the effects of chelating endothelial cell iron
on interactions with R. oryzae, endothelial cells were incubated
with different concentrations of phenanthroline for 16 hours. To
prevent chelation of the radioisotope, .sup.51Cr was added to
endothelial cells 24 hours prior to the addition of phenanthroline
(Fratti et al., Infect Immun. 66(1):191-196 (1998)). To confirm
that the effects of phenanthroline on R. oryzae-induced endocytosis
by and damage of endothelial cells were due to chelation of
endothelial cell iron, exogenous iron in the form of hemin was
added to endothelial cells at a final concentration of 20 .mu.M, 2
hours before phenanthroline (Fratti et al., supra). As a positive
control for prevention of endocytosis, the microfilament disruptant
cytochalasin D (Sigma-Aldrich) was added at a concentration of 200
nM simultaneously with R. oryzae germlings, and endocytosis was
determined as above (Ibrahim et al., Infect Immun. 63(11):4368-4374
(1995)).
[0143] Transduction of Endothelial Cells with shRNA Lentiviral
Particles.
[0144] The shRNA lentiviral particles, including TurboGFP control
(SH0003V), non-target control (SH0002V), and GRP78 target
(TRCNO1024) were purchased from Sigma-Aldrich. The non-target
control contains a scrambled sequence (CAACAAGATGAAGAGCACCAA (SEQ
ID NO: 2)) not targeting any known human gene, while lentiviruses
targeting the GRP78 gene contain sequence CTTGTTGGTGGCTCGACTCGA
(SEQ ID NO: 1).
[0145] The transductions were performed according to the
manufacturer's protocol. Briefly, 1.6.times.10.sup.4 endothelial
cells were seeded into 96-well plate and incubated for about 20
hours at 37.degree. C. in a 5% CO.sub.2 incubator. Cells were
infected with lentiviral particles at an MOI of 20 in the presence
of 8 .mu.g/ml polybrene (Sigma-Aldrich) overnight. The transduced
cells were incubated in fresh M199 medium for 4 more days.
Puromycin at 0.2 .mu.g/ml was added to select for
puromycin-resistant cell pools, which usually took approximately 10
days of incubating at 37.degree. C. in 5% CO.sub.2. The
puromycin-resistant cells were passaged until an appropriate amount
of cells was obtained for endocytosis or damage assays as above.
Reduction of GRP78 expression was confirmed by using real time
RT-PCR (see below).
[0146] Quantification of GRP78 Expression.
[0147] For quantification of GRP78 expression in endothelial or CHO
cells, real time RT-PCR was carried out using a Power SYBR Green
Cells-to-CT kit (Applied Biosystems) to extract RNA from
2.times.10.sup.4 cells. Primers to amplify GRP78 from endothelial
cells and CHO cells were 5'-GGAAAGAAGGTTACCCATGC-3' (SEQ ID NO: 3)
and 5'-AGAAGAGACACATCGAAGGT-3' (SEQ ID NO: 4). Primers
5'-ACCATCTTCCAGGAGCGAG-3' (SEQ ID NO: 5) and
5'-TAAGCAGTTGGTGGTGCAG-3' (SEQ ID NO: 6) were used to amplify the
housekeeping gene GAPDH, which was used as a control.
[0148] Effect of Acidosis, Iron, Glucose, Mannitol, and Statins on
R. oryzae-Endothelial Cell Interactions.
[0149] To study the effect of acidosis, endothelial cells exposed
to different pHs, ranging from 6.8 to 7.4, were grown in MEM
buffered with HEPES for 5 hours in the presence or absence of
phenanthroline. Next, endothelial cells were washed twice with cold
PBS, and GRP78 total expression was quantified by real-time RT-PCR.
To study the effect of glucose and iron on endothelial cell GRP78
expression levels and subsequent interactions of endothelial cells
with R. oryzae germlings, we incubated endothelial cells in MEM
with varying FeCl.sub.3 or glucose concentrations for 5 hours or 20
hours, respectively (pilot studies demonstrated maximum enhancement
of GRP78 expression at these time points). To study the effect of
hyperosmolarity and statins on GRP78 expression, endothelial cells
in MEM were incubated with 1, 4, or 8 mg/ml mannitol or 5, 20, or
40 .mu.g/ml lovastatin for 20 hours. MEM did not have any
glutamate, since this acid was found to induce expression of GRP78
(Yu et al., Exp Neurol. 155(2):302-314 (1999)). GRP78 expression,
endocytosis, and damage assays were conducted as above.
[0150] Cell surface expression of GRP78 on endothelial cells
exposed to varying concentrations of FeCl.sub.3 was quantified
using FACS analysis. Briefly, endothelial cells grown in 25-cm
flasks were dissociated using 1.5 ml enzyme-free dissociation
buffer (Invitrogen). Cells were blocked with 50% goat serum, then
stained with monoclonal anti-GRP78 Ab (BD Biosciences) at 1:100 for
1 hour. Endothelial cells were counterstained with ALEXA FLUOR
488-labeled anti-mouse IgG at 1:100 for 1 hour. Endothelial cells
exposed to a similar concentration of FeCl.sub.3 or glucose and
stained with an isotype matching control IgG (BD Biosciences) were
used as negative control. A FACS Caliber (BD) instrument equipped
with an argon laser emitting at 488 nm was used for flow cytometric
analysis. Fluorescence data were collected with logarithmic
amplifiers. The population percent fluorescence of 5.times.10.sup.3
events was calculated using CellQuest software (BD).
[0151] In Vivo Studies.
[0152] For in vivo studies, DKA was induced in BALB/c male mice
(>20 g) (National Cancer Institute) with a single i.p. injection
of 190 mg/kg streptozotocin in 0.2 ml citrate buffer 10 days prior
to fungal challenge (Ibrahim et al., Antimicrob Agents Chemother.
47(10):3343-3344 (2003)). Glycosuria and ketonuria were confirmed
in all mice 7 days after streptozotocin treatment. To determine the
available serum iron in DKA versus normal mice, serum samples were
obtained from mice (n=11) and the serum iron levels measured using
the method of Artis et al. (Artis et al., Diabetes 31(12):1109-1114
(1982)).
[0153] For quantification of GRP78 expression in mouse organs,
lungs, brain, or sinus from normal or DKA mice were harvested 14
days following DKA induction (Ibrahim et al., Antimicrob Agents
Chemother. 47(10):3343-3344 (2003)). Organs were stored in RNAlater
solution (Ambion). Approximately 25 mg of brain or lung tissues was
processed for RNA extraction using the RNAqueous-4PCR Kit (Ambion).
Sinus bone was homogenized in liquid nitrogen (Fu et al., FEMS
Microbiol Lett. 235(1):169-176 (2004).) and RNA was extracted using
the QIAGEN RNeasy Kit. For mouse GRP78 expression, primers
5'-TCTTGCCATTCAAGGTGGTTG-3' (SEQ ID NO: 7) and
5'-TTCTTTCCCAAATACGCCTCAG-3' (SEQ ID NO: 8) were used, while
primers to amplify the housekeeping gene GAPDH were as above.
Calculations and statistical analyses were carried out as described
in ABI PRISM 7000 Sequence Detection System User Bulletin 2
(Applied Biosystems).
[0154] To generate immune serum for passive immunization, normal
BALB/c mice were immunized by s.c. injection of 20 .mu.g
recombinant hamster GRP78 (which is more than 98% identical to
murine or human GRP78) mixed with CFA (Sigma-Aldrich) or with CFA
alone mixed with PBS to generate non-immune control serum (Ibrahim
et al., Infect Immure. 73(2):999-1005 (2005); Spellberg et al., J
Infect Dis. 194(2):256-260 (2006)). Mice were boosted in incomplete
Freund's adjuvant (IFA) 3 weeks later. Twelve days after the boost,
serum was collected from GRP78-immunized or control mice (i.e.,
mice vaccinated with CFA/IFA without GRP78). Anti-GRP78 Ab titers
were determined by using ELISA plates coated with 5 .mu.g/ml of
recombinant hamster GRP78 as previously described (Ibrahim et al.,
(2005) supra). Immune or control sera (0.25 ml) were administered
i.p. to DKA recipient mice 2 hours before intranasal infection with
10.sup.5 R. oryzae 99-880 spores. Sera doses were repeated 3 days
after infection, and survival of mice was followed for 90 days
after infection. All procedures involving mice were approved by the
Institutional Animal Use and Care Committee of the Los Angeles
Biomedical Research Institute at Harbor-UCL Medical Center,
according to the NIH guidelines for animal housing and care.
[0155] Statistics.
[0156] Differences in GRP78 expression and fungi-endothelial cell
interactions were compared by the nonparametric Wilcoxon rank-sum
test. The nonparametric log-rank test was used to determine
differences in survival times. Comparisons with P values less than
0.05 were considered significant.
[0157] GRP78 Binds to Mucorales Germlings but not Spores.
[0158] Because R. oryzae is likely to interact with endothelial
cells in the germling form during angioinvasion (Ibrahim et al.,
Infect Immun. 73(2):778-783 (2005)), we used the affinity
purification process developed by Isberg and Leong (Isberg and
Leong, Cell 60(5):861-871 (1990)) to identify an endothelial cell
receptor for R. oryzae germlings. When incubated with extracts of
endothelial cell membrane proteins, R. oryzae bound to a major band
at 78 kDa. Lesser and inconsistent binding was found to a band at
approximately 70 kDa and bands between 100-150 kDa (FIG. 1A).
[0159] The major band at 78 kDa that bound to germlings was excised
for protein identification by matrix-assisted laser
desorption/ionization-time-of-flight tandem mass spectrometry
(MALDI-TOF MS/MS) analysis. Several potential matches were
identified, including human glucose-regulated protein 78 (GRP78).
GRP78 was selected for further investigation due to its expression
being likely regulated in DKA. To verify that endothelial cell
GRP78 bound R. oryzae germlings, immunoblots containing endothelial
cell membrane proteins were probed with an anti-GRP78 polyclonal Ab
raised against a synthetic peptide corresponding to amino acids
24-43 of human GRP78. This polyclonal Ab recognized the
germling-bound 78-kDa band (FIG. 1B). Time course studies revealed
that GRP78 was bound by germlings after 1-3 hours of germination
but not by R. oryzae spores (FIG. 1C). Finally, endothelial cell
GRP78 bound to germlings of other Mucorales family members that are
known to cause mucormycosis, including another strain of R. oryzae,
and strains of Rhizopus microsporus, Mucor species, and
Cunninghamella species.
[0160] Indirect immunofluorescence was used to verify that GRP78 on
intact endothelial cells was bound by R. oryzae. Endothelial cells
expressed GRP78 on the cell surface (FIG. 2, B and F), in
accordance with previous reports (Li and Lee, Curr Mol Med.
6(1):45-54 (2006); Davidson et al., Cancer Res. 65(11): 4663-4672
(2005)). When endothelial cells were infected with R. oryzae
germlings, GRP78 co-localized with R. oryzae (FIG. 2, D and H).
These fungal cells were being endocytosed because they were
surrounded by endothelial cell microfilaments (FIG. 2, C and G).
These findings confirm that during endocytosis, R. oryzae germlings
bind to GRP78 on intact endothelial cells.
[0161] GRP78 is a Receptor for R. oryzae Germlings.
[0162] Because endocytosis of the fungus is a prerequisite for R.
oryzae to cause endothelial cell damage (Ibrahim et al., (2005)
supra), whether blocking the function or expression of GRP78 would
protect endothelial cells from R. oryzae-induced endocytosis and
subsequent damage was determined Endocytosis, but not adherence, of
R. oryzae germlings was abrogated by addition of an anti-GRP78 but
not control polyclonal Ab, the latter of which targeted p53, which
is not expressed by endothelial cells (FIG. 3A). The anti-GRP78 Ab
reduced by more than 40% damage to endothelial cells caused by R.
oryzae germlings (FIG. 3B) but not Candida albicans (FIG. 3C) or
Aspergillus fumigatus (FIG. 3D).
[0163] To complement the Ab blocking studies, GRP78 expression was
suppressed to determine its impact on adherence, endocytosis, and
endothelial cell damage. Because GRP78 is essential (Luo et al.,
Mol Cell Biol. 26(15):5688-5697 (2006)), shRNA was used to
downregulate its expression. Transduction of endothelial cells with
a lentivirus containing GRP78 shRNA mediated an 80% reduction in
GRP78 transcript levels compared with endothelial cells transduced
by non-target shRNA lentivirus (FIG. 4A). This suppression of GRP78
expression resulted in a significant reduction in endothelial cell
endocytosis of R. oryzae germlings and subsequent endothelial cell
damage (FIG. 4, B and C). Collectively, these results show that
GRP78 is essential for maximal endocytosis of R. oryzae germlings
by endothelial cells.
[0164] As an additional confirmatory method, the cell line C.1 was
used, which was derived from parental dihydrofolate
reductase-deficient (DHFR-deficient) CHO cells engineered to
overexpress hamster GRP78 (Reddy et al., J Biol Chem.
278(23):20915-20924 (2003); Morris et al., J. Biol. Chem.
272(7):4327-4334 (1997)). C.1 cells overexpressed GRP78 transcript
by 26-fold compared with their parent cells (FIG. 5A). The C.1
cells had a 40% increase in endocytosis of R. oryzae germlings,
which resulted in a more than 50% increase in damage (FIG. 5, B and
C) compared with the parent CHO cells, which do not overexpress
GRP78. These results were specific to R. oryzae germlings, because
CHO cells overexpressing GRP78 had no effect on endocytosis of R.
oryzae spores, which do not bind GRP78 (data not shown). Thus, the
enhanced endocytosis of germlings induced by GRP78 overexpression
is not the result of a generalized increase in endocytosis. These
results show that GRP78 functions as an endothelial cell receptor
for R. oryzae germlings.
[0165] Iron Regulates Endothelial Cell Damage by R. oryzae.
[0166] Patients with elevated available serum iron, such as DKA
patients (Antis et al., Diabetes 31(12):1109-1114 (1982)) or those
treated with deferoxamine (an iron siderophore that provides
Rhizopus with exogenous iron) (Boelaert et al., J Clin Invest.
91(5):1979-1986 (1993)), are uniquely predisposed to developing
mucormycosis. Furthermore, the iron chelator Deferasirox, which
reduces available serum iron, is effective in treating experimental
hematogenously disseminated mucormycosis (Ibrahim et al, J Clin
Invest. 117(9):2649-2657 (2007)). Given the role of iron in the
pathogenesis of mucormycosis infections, we sought to define the
impact of iron levels on endothelial cell endocytosis of R. oryzae.
Endothelial cell adherence, endocytosis, and damage caused by R.
oryzae were compared following exposure to phenanthroline (an iron
chelator) with or without exogenous iron. As a positive control, R.
oryzae germlings were incubated on endothelial cells that were
exposed to the microfilament disruptant cytochalasin D, which
prevents endocytosis (Ibrahim et al., Infect Immun.
63(11):4368-4374 (1995)). None of the treatments altered fungal
adherence to endothelial cells (FIG. 6A). However, similar to
cytochalasin D, phenanthroline reduced endothelial cell endocytosis
of R. oryzae by approximately 70% (FIG. 6A). Further, the addition
of exogenous iron completely reversed the inhibition of endocytosis
caused by the iron chelator. Finally, phenanthroline prevented R.
oryzae-induced endothelial cell damage in a concentration-dependent
manner (FIG. 6B). Thus, iron regulates the susceptibility of
endothelial cells to damage caused by R. oryzae by modulating
endocytosis of the organism.
[0167] Iron and Glucose are Inducers of GRP78.
[0168] Patients with DKA have elevated levels of available serum
iron, likely due to release of iron from binding proteins in the
presence of acidosis (Antis et al., supra). High iron and glucose
concentrations similar to those seen in DKA patients induce
expression of GRP78, make the host more susceptible to
mucormycosis. This is confirmed by the acidosis affects on the
expression of GRP78 through an iron-related mechanism Endothelial
cells were incubated at pH values similar to those seen in patients
with DKA, and their GRP78 expression was quantified by real-time
RT-PCR. Lower pH values significantly enhanced expression of
endothelial cell GRP78 compared with the normal blood pH of 7.4
(FIG. 7A). Furthermore, addition of the iron chelator
phenanthroline in the setting of acidosis reversed GRP78 expression
back to normal levels seen with pH 7.4, indicating that the impact
of acidosis is to release free iron from iron-binding proteins and
that the increased free iron is the direct mediator of GRP78
expression.
[0169] To further study the role of iron and glucose directly on
endothelial cell GRP78 expression, endothelial cells were incubated
in increasing concentrations of FeCl.sub.3 and glucose for varying
time intervals and quantified the level of GRP78 transcript by
real-time RT-PCR. Endothelial cells incubated with concentrations
of iron present in sera collected from patients with DKA (Artis et
al., supra) induced up to a 12-fold increase in endothelial cell
GRP78 expression compared with endothelial cells incubated with no
iron (FIG. 7B). Similarly, incubating endothelial cells with
glucose at 4 or 8 mg/ml led to a 3- or 4-fold increase in mRNA
expression of GRP78, respectively, compared with cells incubated in
a normal physiological concentration of glucose (1 mg/ml, P=0.005)
(FIG. 7C). To discern whether GRP78 overexpression in response to
glucose was due to hyperglycemia itself, or rather to
hyperosmolarity caused by the increased glucose, the expression of
GRP78 was measured after incubating endothelial cells with similar
concentrations of mannitol (i.e., 1, 4, and 8 mg/ml) for 20 hours.
No change in GRP78 expression was noticed (data not shown),
indicating that hyperglycemia and not hyperosmolarity is
responsible for the enhanced GRP78 expression. Because HMG-CoA
reductase inhibitors (i.e., statins) might affect mucormycosis
incidence in diabetic patients (Kontoyiannis D P., Clin Infect Dis.
44(8):1089-1090 (2007)), the impact of lovastatin on GRP78
expression was tested. No evidence of alterations in expression in
the presence of the statin was found (data not shown).
[0170] To confirm that the increased mRNA expression of GRP78
translated into increased protein surface expression, endothelial
cells were incubated with 0, 15, or 50 .mu.M FeCl.sub.3, the latter
of which mediated the strongest increase in mRNA transcription, and
stained them with anti-GRP78 monoclonal Ab or isotype control.
Fluorescence was quantified by flow cytometry. Surface expression
of GRP78 protein increased by 150% in the presence of high iron
levels (FIG. 7D).
[0171] Iron- and glucose-induced GRP78 overexpression enhances
susceptibility of endothelial cells to R. oryzae-induced invasion
and damage. Incubation of endothelial cells with either 15 or 50
.mu.M FeCl.sub.3 enhanced R. oryzae-induced endocytosis and
subsequent damage by 80% compared with endothelial cells incubated
without exogenous FeCl.sub.3 (FIG. 8A). Similarly, incubation of
endothelial cells with 4-8 mg/ml glucose resulted in approximately
20% and 40% increases in endocytosis of and damage caused by R.
oryzae, respectively, when compared with endothelial cells
incubated in 1 mg/ml glucose (FIG. 8B). Importantly, the anti-GRP78
Ab blocked this enhanced endothelial cell susceptibility to R.
oryzae-induced damage, confirming the specificity of the increased
susceptibility to overexpression of GRP78 (FIG. 9). Collectively,
these results show that iron and glucose concentrations consistent
with those seen in patients with DKA induce the overexpression of
GRP78, resulting in enhanced endocytosis and damage of endothelial
cells.
[0172] GRP78 During Mucormycosis In Vivo.
[0173] To determine the potential role for GRP78 in mediating
susceptibility to mucormycosis in vivo, Grp78 expression was
quantified by RT-PCR in mice with DKA (which, like humans, are
hypersusceptible to mucormycosis) (Waldorf et al., J Clin Invest.
74(1):150-160 (1984)) and in normal mice. Mice were rendered
diabetic with streptozotocin (Waldorf et al., supra; Ibrahim et
al., Antimicrob Agents Chemother. 47(10):3343-3344 (2003)).
Diabetes was confirmed by measurement of increased urinary glucose
levels. Concordant with the establishment of DKA, diabetic mice had
a decrease in blood pH from 7.8 (normal for mice) to 7.3-7.2,
associated with increased levels of urinary glucose (250-1,000
mg/dl) and urinary ketone bodies (.gtoreq.5 mg/dl) as determined by
Keto-Diastix strip testing. We also compared levels of serum-free
iron (i.e., unbound by carrier proteins such as transferrin) in DKA
mice with those in normal mice. In accordance with the results
found in humans (Artis et al., supra), DKA mice (n=11) had
approximately 5-fold-higher levels of serum-free iron than normal
mice (median[25th quartile, 75th quartile], 7.29 [4.3, 11.8] .mu.M
vs. 1.69 [1.3, 2.3] .mu.M; P=0.03 by Wilcoxon rank-sum test).
Finally, concordant with the regulation of GRP78 expression by iron
and glucose levels, DKA mice were found to express 2- to
5-fold-higher levels of Grp78 mRNA in sinus, lungs, and brain
compared with normal mice (FIG. 10A-C).
[0174] To determine the potential for abrogation of GRP78 function
as a treatment for mucormycosis, female BALB/c mice were vaccinated
with recombinant hamster GRP78 (which is more than 98% identical to
murine or human GRP78), and serum was collected from
GRP78-immunized or control mice. The median anti-GRP78 Ab titer of
serum collected from vaccinated mice was found to be 1:128,000
compared with a titer of 1:600 in the serum collected from mice
vaccinated with adjuvant alone as determined by ELISA (P=0.005).
The efficacy of the anti-GRP78 serum was compared with that of the
non-immune serum in protecting naive mice from R. oryzae infection.
DKA mice were treated intraperitoneally with anti-GRP78 or
non-immune serum 2 hours prior to intranasal infection with
10.sup.5 spores of R. oryzae. Another dose of serum was given on
day+3 relative to infection. DKA mice that received anti-GRP78
serum had marked improvement in survival compared with mice treated
with non-immune serum (FIG. 11). Lungs and brains harvested from
surviving mice were found to be sterile at the end of the
experiment.
[0175] As evidenced by the experimental examples described herein,
host GRP78 plays a critical role in susceptibility to mucormycosis
and that increased GRP78 expression offers an explanation for the
unique susceptibility to mucormycosis of hyperglycemic hosts with
elevated available serum iron. While mucormycosis can occur in
patients with profound neutropenia or those receiving high doses of
corticosteroids (Spellberg et al., (2005) supra; Roden et al., C/in
Infect Dis. 41(5):634-653 (2005)), the most common risk factor for
mucormycosis is diabetes (Spellberg et al., (2005) supra; Ibrahim
et al., (2008) supra). Although the attack rate of mucormycosis is
substantially higher in patients with DKA than in diabetic patients
who are not acidotic, less than half of diabetic patients with
mucormycosis are acidotic (Roden et al., supra; Reed et al., Clin.
Infect Dis. 47(3):364-371 (2008)). Therefore, diabetes is a risk
for mucormycosis even in the absence of acidosis, but acidosis
enhances the predisposition of diabetic patients to mucormycosis.
The causes of this predisposition of patients with diabetes, and
DKA in particular, to mucormycosis has never been adequately
explained.
[0176] The results described herein elucidate the predisposition of
diabetic and DKA patients to mucormycosis. GRP78 expression was
enhanced in hosts with elevated available serum iron levels and
high glucose concentrations, and this enhanced expression of GRP78
resulted in increased endocytosis of R. oryzae by human endothelial
cells and subsequent enhanced damage to the cells. Furthermore,
suppression of GRP78 function by Ab and its reduced expression
levels by shRNA blocked R. oryzae uptake and resulting damage to
human endothelial cells. In contrast, the anti-GRP78 Abs did not
block fungal endothelial cell damage mediated by C. albicans or A.
fumigatus, two other fungal pathogens that do not have an increased
attack rate in patients with DKA. These results clearly show that
mice with DKA, which had elevated levels of glucose and available
iron and overexpressed Grp78 in relevant target tissues, were
protected from mucormycosis infection when the receptor was blocked
by Abs. These exciting results demonstrate GRP78-blocking
strategies can be used as a therapeutic intervention in treating or
preventing mucormycosis.
[0177] Exposure to hyperglycemia of iron-sequestering proteins,
such as apotransferrin and hemoglobin, has been shown to damage the
proteins and cause them to release free iron in serum (Kar and
Chakraborti, Indian J Exp Biol. 37(2):190-192 (1999); van
Campenhout et al., Free Radic Res. 37(10):1069-1077 (2003)).
Therefore, diabetes can result in increased serum-free iron even in
the absence of acidosis. Furthermore, acidosis has been shown to
markedly increase dissociation of iron from sequestering proteins
in serum from DKA patients, independent of glucose levels (Artis et
al., supra). The data presented herein confirms that hyperglycemia
as well as increased iron levels in the absence of hyperglycemia
increase expression of GRP78 in host cells. Thus, increased GRP78
expression caused by hyperglycemia results in the predisposition of
non-acidotic diabetic patients to mucormycosis, whereas the
potentiation of increased free iron levels caused by acidosis
results in the marked increase in attack rate of mucormycosis in
patients with DKA.
[0178] GRP78 (also known as BiP/HSPA5) was discovered as a cellular
protein induced by glucose starvation (Lee A S, Cancer Res.
67(8):3496-3499 (2007)). It is a member of the HSP70 protein family
that is mainly present in the endoplasmic reticulum. It functions
as a major chaperone that is involved in many cellular processes,
including protein folding and assembly, marking misfolded proteins
for proteasome degradation (Ni and Lee, FEBS Lett.
581(19):3641-3651 (2007)), regulating Ca.sup.2+ homeostasis, and
serving as a sensor for endoplasmic reticulum stress (Li and Lee,
Curr Mol Med. 6(1):45-54 (2006)). GRP78 has also been reported to
be antiapoptotic and plays critical cytoprotective roles in early
embryogenesis, oncogenesis, neurodegenerative diseases, and
atherosclerosis (Lee A S, Cancer Res. 67(8):3496-3499 (2007)). More
recently, GRP78 overexpression was shown to inhibit both
insulin-dependent and endoplasmic reticulum stress-induced SREBP-1
activation, resulting in reduction of hepatic steatosis in obese
mice (Kammoun et al., J Clin Invest. 119(5):1201-1215 (2009)).
[0179] Despite its main function as a cellular chaperone protein,
recent studies reported the translocation of a fraction of GRP78 to
the cell surface in a variety of cells (Wang et al., Antioxid Redox
Signal. 11(9):2307-2316 (2009)). In fact, GRP78 has been reported
to function as a receptor for a variety of ligands, including (a)
the angiogenesis inhibitor Kringle 5 (Davidson et al., Cancer Res.
65(11): 4663-4672 (2005)), (b) the activated proteinase inhibitor
a2-macroglobulin (Misra et al., Cell Signal 16(8):929-938 (2004)),
(c) a synthetic 12-aa peptide (Hardy et al., Biochem Pharmacol.
75(4):891-899 (2008)), (d) dengue virus serotype 2
(Jindadamrongwech et al., Arch Virol. 149(5):915-927 (2004).) and
(e) a coreceptor for Coxsackievirus A9 (Triantafilou et al., J
Viol. 76(2):633-643 (2002)). The results described here show for
the first time that GRP78 acts as a receptor for fungal pathogens.
GRP78 was found to act as a receptor for invasion but not adherence
of Mucorales to endothelial cells. Similarly, N-cadherin was shown
to mediate invasion but not adherence of C. albicans to endothelial
cells (Phan et al., J Biol Chem. 280(11):10455-10461 (2005)),
demonstrating that adherence and invasion are two independent
processes mediated by different receptors. The fungal ligand for
GRP78 that mediates invasion of endothelial cells is under active
investigation.
[0180] With regard to the effect of iron on GRP78, previous work
demonstrated paradoxical effects of iron on GRP78 expression in
animal models. For example, mRNA and protein levels of GRP78 were
decreased in iron-fed C57BL/6 mice, while they were unchanged in
iron-fed 129/Sv mice (Faye et al., Blood Cells Mol Dis.
39(3):229-237 (2007)). In contrast, rats with chronic or acute iron
overloaded had increased GRP78 expression in hearts and livers
compared with control rats (Lou et al., Clin Exp Pharmacol Physiol.
36(7):612-618 (2009)). As described herein, iron was found to have
a drastic effect on increasing the cell surface expression of
GRP78. Higher glucose concentrations also increased expression of
GRP78, but to a lesser extent. These results are in agreement with
the findings of Mote et al., who reported that Chinese hamster lung
fibroblasts expressed 30% more GRP78 when cultured in medium with a
glucose concentration of 4.5 mg/ml compared with medium with a
glucose concentration of 1.5 mg/ml (Mote et al., Mech Ageing Dev.
104(2):149-158 (1998)).
[0181] As described herein, the DKA mice have elevated available
serum iron and increased serum glucose, and expressed more GRP78 in
their organs. This underscore the physiological relevance of the
above in vitro findings. Anti-GRP78 Ab was found to protected DKA
mice from R. oryzae infection. The mechanism of immunological
protection is currently under investigation.
[0182] In summary, through multiple independent lines of
investigation, GRP78 was demonstrated to function as a receptor for
Mucorales that facilitates fungus-induced penetration and
subsequent damage of endothelial cells. Additionally, expression of
the receptor and subsequent invasion of and damage to endothelial
cells in a receptor-dependent manner were increased in the presence
of elevated concentrations of iron and glucose, consistent with
those seen in patients with DKA. Anti-GRP78 Ab was found to
protected DKA mice from infection with mucormycosis. These results
prove why DKA patients are uniquely susceptible to mucormycosis
infections and provide methods and compositions for therapeutic
interventions against extremely lethal mucormycosis.
[0183] Although the invention has been described with reference to
the disclosed embodiments, those skilled in the art will readily
appreciate that the specific examples and studies detailed above
are only illustrative of the invention. It should be understood
that various modifications can be made without departing from the
spirit of the invention. Accordingly, the invention is limited only
by the following claims.
Sequence CWU 1
1
8121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1cttgttggtg gctcgactcg a
21221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 2caacaagatg aagagcacca a
21320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 3ggaaagaagg ttacccatgc 20420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
4agaagagaca catcgaaggt 20519DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 5accatcttcc aggagcgag
19619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 6taagcagttg gtggtgcag 19721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
7tcttgccatt caaggtggtt g 21822DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 8ttctttccca aatacgcctc ag
22
* * * * *