U.S. patent application number 14/955564 was filed with the patent office on 2016-05-05 for cell programming.
This patent application is currently assigned to AUCKLAND UNISERVICES LIMITED. The applicant listed for this patent is AUCKLAND UNISERVICES LIMITED, THE UNIVERSITY OF MELBOURNE. Invention is credited to Bronwen Jane Connor, Mirella Dottori, Christof Maucksch.
Application Number | 20160122712 14/955564 |
Document ID | / |
Family ID | 44355622 |
Filed Date | 2016-05-05 |
United States Patent
Application |
20160122712 |
Kind Code |
A1 |
Connor; Bronwen Jane ; et
al. |
May 5, 2016 |
CELL PROGRAMMING
Abstract
The present invention is concerned with methods for
reprogramming of mammalian somatic cells and in particular to
reprogramming of mature mammalian somatic cells into multi-potent
precursor cells.
Inventors: |
Connor; Bronwen Jane; (North
Shore City, NZ) ; Dottori; Mirella; (Victoria,
AU) ; Maucksch; Christof; (Auckland, NZ) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
THE UNIVERSITY OF MELBOURNE
AUCKLAND UNISERVICES LIMITED |
Victoria
Auckland |
|
AU
NZ |
|
|
Assignee: |
AUCKLAND UNISERVICES
LIMITED
Auckland
NZ
THE UNIVERSITY OF MELBOURNE
Victoria
AU
|
Family ID: |
44355622 |
Appl. No.: |
14/955564 |
Filed: |
December 1, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13576778 |
Aug 2, 2012 |
9228170 |
|
|
PCT/NZ2011/000010 |
Feb 4, 2011 |
|
|
|
14955564 |
|
|
|
|
Current U.S.
Class: |
435/455 ;
435/366; 435/377 |
Current CPC
Class: |
C12N 2501/60 20130101;
C12N 2506/1307 20130101; C12N 2501/385 20130101; C12N 5/0623
20130101; C12N 2501/11 20130101; C12N 2501/91 20130101; C12N
2510/00 20130101; C12N 15/85 20130101; C12N 2501/065 20130101; C12N
2501/115 20130101; C12N 2500/34 20130101; C12N 2501/602
20130101 |
International
Class: |
C12N 5/0797 20060101
C12N005/0797 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 5, 2010 |
NZ |
583115 |
Claims
1. A method of reprogramming a mature mammalian somatic cell into a
reprogrammed multi-potent lineage-specific precursor cell, said
method comprising the steps of: a) delivering one or more factors
to said somatic cell, wherein said one or more factors determine
the lineage specificity of said precursor cell; and b) culturing
said somatic cell under conditions permissive to the culture of
said lineage-specific precursor cell.
2. The method according to claim 1 wherein said mature mammalian
somatic cell is a mature mammalian fibroblast selected from lung
fibroblasts, kidney fibroblasts, cardiac fibroblasts, stromal
fibroblasts, foreskin fibroblasts or dermal fibroblasts.
3. The method according to claim 1 wherein said mature mammalian
somatic cell is a mature human dermal fibroblast.
4. The method according to claim 1 wherein said mature mammalian
somatic cell is a cell from a patient suffering from a neurological
disorder or injury in which tissue regeneration is a component of
healing and wherein said reprogrammed multi-potent lineage-specific
precursor cell is a disease-specific reprogrammed multi-potent
lineage-specific precursor cell.
5. The method according to claim 1 wherein said reprogrammed
multi-potent, lineage-specific precursor cell is a multi-potent
neural precursor cell.
6. The method of claim 5 wherein said multi-potent neural precursor
cell expresses at least one neural cell lineage marker selected
from the group consisting of Pax6, Sox2, Hes 1, Hes 5, Sox1, Sox3,
Mash 1/Ashl 1 and neurogenin 2.
7. The method according to claim 1 wherein said step of delivering
said one or more factors to said somatic cell includes the delivery
of said one or more factors via protein transduction or via protein
expression from non-viral or viral vectors.
8. The method according to claim 1 wherein said one or more factors
are selected from proteins such as transcription factors, nucleic
acids encoding said transcription factors, small molecules capable
of influencing the amount of said transcription factors present in
said somatic cell, or any combination thereof.
9. The method according to claim 8 wherein said transcription
factors are the transcription factors Sox2 and Pax6 or any known
transcription factors which, alone or in combination, are capable
of producing multi-potent neural precursor cells.
10. The method according to claim 1 wherein said step of culturing
said somatic cell includes culturing said cell in medium capable of
supporting growth of said precursor cells.
11. The method according to claim 10 wherein said medium is
supplemented with a chromatin modifying agent capable of
facilitating reprogramming of said somatic cell and wherein said
chromatin modifying agent is selected from agents promoting
acetylation of chromatin, inhibiting deacetylation of chromatin,
altering histone methylation states within chromatin or leading to
DNA demethylation within chromatin.
12. The method according to claim 11 wherein said chromatin
modifying agent is valproic acid at 1 .mu.M.
13. The method according to claim 12 wherein the valproic acid is
used at a concentration of 1 .mu.M.
14. A reprogrammed multi-potent lineage-specific precursor cell
produced by a method according to claim 1.
15. A reprogrammed multi-potent lineage-specific precursor cell
according to claim 14, wherein said precursor cell is a
multi-potent neural precursor cell.
16. The method according to claim 1 wherein said mature mammalian
somatic cell is a mature human dermal fibroblast and wherein said
mature human dermal fibroblast is from a patient suffering from a
neurological disorder or injury in which tissue regeneration is a
component of healing and wherein said reprogrammed multi-potent
lineage-specific precursor cell is a disease-specific reprogrammed
multi-potent lineage-specific precursor cell.
17. The method according to claim 1 wherein said mature mammalian
somatic cell is a mature human dermal fibroblast and wherein said
reprogrammed multi-potent, lineage-specific precursor cell is a
multi-potent neural precursor cell.
18. The method of claim 19 wherein said multi-potent neural
precursor cell expresses at least one neural cell lineage marker
selected from the group consisting of Pax6, Sox2, Hes 1, Hes 5,
Sox1, Sox3, Mash 1/Ashl 1 and neurogenin 2.
19. The method according to claim 1 wherein said mature mammalian
somatic cell is a mature human dermal fibroblast and wherein said
step of delivering said one or more factors to said somatic cell
includes the delivery of said one or more factors via protein
transduction or via protein expression from non-viral or viral
vectors.
20. The method according to claim 1 wherein said mature mammalian
somatic cell is a mature human dermal fibroblast and wherein said
one or more factors are selected from proteins such as
transcription factors, nucleic acids encoding said transcription
factors, small molecules capable of influencing the amount of said
transcription factors present in said somatic cell, or any
combination thereof.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to reprogramming of mammalian
somatic cells and in particular to reprogramming of mature
mammalian somatic cells.
[0002] The invention has been developed primarily for use as a
method of reprogramming a mature human fibroblast into a
lineage-specific neural precursor cell and will be described
hereinafter with reference to this application. However, it will be
appreciated that the invention is not limited to this particular
field of use.
BACKGROUND OF THE INVENTION
[0003] Any discussion of the prior art throughout the specification
should in no way be considered as an admission that such prior art
is widely known or forms part of the common general knowledge in
the field.
[0004] Embryonic stem cells, derived from the inner cell mass of
mammalian blastocysts, have the capability to grow indefinitely
while maintaining the ability to generate all cell and tissue types
in the body (pluripotency). These properties have lead to
expectations that human embryonic stem cells (hESCs) might be
useful to treat patients with various diseases and injuries,
thereby revolutionizing regenerative medicine.
[0005] Cell transplantation therapy using stem cells may offer a
viable treatment strategy for patients with brain disease or
injury, such as Parkinson's disease, Huntington's disease, stroke
or spinal cord injury by providing new cells to replace those lost
through disease. However, the clinical application of hESCs faces
difficulties regarding ethical concerns relating to the use of
embryos, as well as instances of tissue rejection after
implantation due to immunological incompatibility between patient
and donor cells.
[0006] One way to circumvent these issues is to artificially derive
an embryonic stem cell-like (pluripotent) cell from a mature
somatic cell by inducing a "forced" expression of certain genes.
These artificially derived embryonic stem cell-like cells are known
as induced pluripotent stem (iPS) cells and are believed to be
identical to embryonic stem cells in many respects (Hochedlinger,
K. & Plath, K; (2009) Development 136, 509-523). The generation
of iPS cells from mature somatic cells, such as fibroblast cells
obtained directly from the patient, prevents therapeutic concerns
regarding ethics and/or tissue rejection, and may potentially
provide the optimal cell source for regenerative medicine.
[0007] iPS cells were first generated by Yamanaka and colleagues in
2006 from mouse fibroblast cells (Cell 126, 663-676). The method of
deriving iPS cells traditionally involves the transfection of
certain embryonic stem cell-associated genes into non-pluripotent
cells, such as mature fibroblasts. Transfection is usually achieved
through viral vectors, such as retroviruses. Yamanaka and
colleagues ((2006) Cell 126, 663-676) initially identified 4 key
genes essential for the production of pluripotent stem cells:
Oct-3/4, Sox2, c-Myc and Klf4. Additional studies demonstrated the
requirement of Nanog as a another major determinant of cellular
pluripotency (Okita, K., Ichisaka, T. & Yamanaka, S. (2007)
Nature 448, 313-317; Wernig, M. et al. (2007) Nature 448, 318-324;
and Maherali, N. et al. (2007) Cell Stem Cell 1, 55-70). In 2007,
two independent research groups generated iPS cells from human
cells (Takahashi, K. et al. (2007) Cell 131, 861-872; and Yu, J. et
al. (2007) Science 318, 1917-1920). Applying the same principles
used earlier in mouse cells, Yamanaka and colleagues (Takahashi, K.
et al. (2007) Cell 131, 861-872) successfully transformed human
fibroblasts into pluripotent stem cells using the same 4 pivotal
genes Oct-3/4, Sox2, c-Myc and Klf4 in a retroviral transfection
system. Thomson and colleagues (Yu, J. et al. (2007) Science 318,
1917-1920) used Oct4, Sox2, Nanog and Lin28 using a lentiviral
transfection system. The exclusion of c-Myc in these experiments
was based on evidence that c-Myc is oncogenic and is not necessary
to promote cellular pluripotency.
[0008] The use of neural precursor cells derived from hESCs or iPS
cells bears great therapeutic potential for the treatment of
neurological disorders and injuries such as Parkinson's disease,
Huntington's disease, stroke or spinal cord injury through the
generation of replacement neural cells. Currently cell
transplantation therapy of neural precursor cells requires in vitro
differentiation of the neural precursor cells from hESCs or iPS
cells.
[0009] As reported, both hESCs and iPS cells can be efficiently
differentiated into neural precursor cells, using either
spontaneous or factor-induced differentiation protocols. Those
neural precursor cells are capable of giving rise to neuronal and
glial cells both in culture and in vivo (Wernig, M. et al. (2009)
Proceeding of the National Academy of Science 105, 5856-5861;
Dottori, M. & Pera, M. F. (2008) Methods Mol Biol 438, 19-30;
Reubinoff, B. E. et al. (2001) Nature Biotechnology 19, 1134-1140;
Reubinoff, B. E., Pera, M. F., Fong, C.-Y., Trounson, A. &
Bongso, (2000) Nature Biotechnology 18, 399-404; Itsykson, P. et
al. (2005) Molecular and Cellular Neuroscience 30, 24-36; Pera, M.
F. et al. (2004) Journal of Cell Science 117, 1269-1280).
[0010] Previous work, including that of the inventors, demonstrates
that hESC-derived or iPS-derived neural precursor cells survive
transplantation into the injured adult rodent brain and
differentiate towards both neuronal and glial cell fates--some
studies demonstrating recovery of function (i.e: Bjorklund,
Sanchez-Pernaute et al. (2002) PNAS 99: 2344-2349; Kim, Auerbach et
al. (2002) Nature 418: 50-56; Ben-Hur, Idelson et al. (2004) Stem
Cells 22(7): 1246-1255, Dinsmore, Ratliff et al. (1996) Cell
Transplantation 5(2): 131-143; Dihne, Bernreuther et al. (2006)
Stem Cells 24(6): 1458-1466; Riess, Molcanyi et al. (2007) Journal
of Neurotrauma 24(1): 216-225; Song, Lee et al. (2007) Neuroscience
Letters 423(1): 58-61; Aubry, Bugi et al. (2008) PNAS; Dali,
Zhi-Jian et al. (2008) Stem Cells 26(1): 55-63; Hatami, Mehrjardi
et al. (2009) Cytotherapy 11(5): 618-630; Hicks, Lappalainen et al.
(2009) European Journal of Neuroscience 29(3): 562-574, Vazey et
al. (2010) Cell Transplantation, 19; 1055-1062).sub..
[0011] However, the formation of tumours, such as teratomas,
following transplantation of hESC-derived neural precursor cells
has been observed in a number studies (Roy, N. S. et al. (2006) Nat
Med 12, 1259-1268; Erdo, F. et al. (2003) J Cereb Blood Flow Metab
23, 780-785 (2003); Hedlund, E. et al. (2007) Stem Cell 25,
1126-1135; Pruszak, J., Sonntag, K.-C., Aung, M. H.,
Sanchez-Pernaute, R. & Isacson, O. (2007) Stem Cells 25,
2257-2268; Bjorklund, L. M. et al. (2002) Proceeding of the
National Academy of Science 99, 2344-2349; (Riess, Molcanyi et al.
(2007) Journal of Neurotrauma 24(1): 216-225; Aubry, Bugi et al.
(2008) PNAS; Vazey et al. (2010) Cell Transplantation, 19;
1055-1062), and was noted by Wernig and colleagues (2009)
Proceeding of the National Academy of Science 105, 5856-5861) in a
recent study in which iPS cell-derived neural precursors were
transplanted into a 6-OHDA lesion model of Parkinson's disease. The
formation of teratomas is thought to result from a proportion of
the transplanted cells retaining an undifferentiated (i.e.
pluripotent) state. Accordingly, teratoma formation following
transplantation of hESC- or iPS cell-derived neural precursor cells
presents a major obstacle for the clinical application of stem cell
therapy, as tumour formation as a clinical result of cell
transplantation therapy in human patients is unacceptable.
[0012] In light of the limitations shown for hESCs and iPS cells
(including ethical considerations, tissue rejection and
tumourgenicity), a need for a source of cells for central nervous
system (CNS) transplantation therapy exists.
[0013] As said above, reprogramming mature somatic cells, as
demonstrated by the generation of iPS cells, removes ethical
concerns raised over the use of hESCs and also allows for the
transplantation of cells obtained from the patient's own body
(autologous transplantation), addressing issues of tissue
rejection. However, the use of iPS cells does not address the
concerns of tumour formation associated in transplantation therapy
resulting from co-transplantation of a proportion of non-committed
pluripotent cells.
[0014] It is an object of the present invention to overcome or
ameliorate at least one of the disadvantages of the prior art, or
to provide a useful alternative.
SUMMARY OF THE INVENTION
[0015] It has unexpectedly been found that mature mammalian somatic
cells such as mature mammalian fibroblasts, can be reprogrammed
directly into multi-potent lineage-specific precursor cells. This
reprogramming does not require reprogramming of the cell's genetic
profile to a pluripotent state, such as is required for induced
pluripotent stem (iPS) cells, and shows that delivering certain
combinations of lineage-specific transcription factors to the
somatic cells reprograms the somatic cells into a committed (i.e.
lineage specific) multi potent precursor cell.
[0016] The inventors surprisingly found that, for example,
delivering the transcription factors Sox2 and Pax6 to mature human
fibroblasts reprograms the fibroblasts to a multi-potent
lineage-specific neural precursor cell which expresses the neural
precursor cell and immature neuronal markers Pax6, Sox2, Hes1,
Sox3, Ngn2 and Mash 1.
[0017] Accordingly, in a first aspect the present invention relates
to a method of reprogramming a mature mammalian somatic cell into a
reprogrammed multi-potent lineage-specific precursor cell, said
method comprising the steps of: [0018] a) delivering one or more
factors to said somatic cell, wherein said one or more factors
determine the lineage specificity of said precursor cell; and
[0019] b) culturing said somatic cell under conditions permissive
to the culture of said lineage-specific precursor cell.
[0020] Preferably the mature mammalian somatic cell is a mature
mammalian fibroblast. Fibroblasts can be obtained from any source
such as, for example lung fibroblasts, kidney fibroblasts, cardiac
fibroblasts, stromal fibroblasts, foreskin fibroblasts and the
like, when used in the methods of the present invention. However,
as will be appreciated, mature human dermal fibroblasts provide a
convenient source of somatic cells. Fibroblasts may be conveniently
obtained from a commercial source or, if desired, isolated from
tissue sources using well established and documented laboratory
techniques and equipment.
[0021] In some preferred embodiments the mature mammalian somatic
cell is a cell from a patient suffering from a neurological
disorder or injury in which tissue regeneration is a component of
healing and the reprogrammed multi-potent lineage-specific
precursor cell is a disease-specific reprogrammed multi-potent
lineage-specific precursor cell.
[0022] In some preferred embodiments the reprogrammed multi-potent,
lineage-specific precursor cell is a multi-potent neural precursor
cell. Preferably, the multi-potent neural precursor cell expresses
at least one neural cell lineage marker selected from the group
consisting of Pax6, Sox2, Hes 1, Hes 5, Sox1, Sox3, Mash 1/Ashl 1
and neurogenin 2.
[0023] Preferably the step of delivering one or more factors to the
somatic cell preferably includes the delivery of the one or more
factors via protein transduction or via protein expression from
non-viral or viral vectors, using techniques well known in the
art.
[0024] Preferably, the one or more factors are selected from
proteins such as transcription factors, nucleic acids encoding the
transcription factors, small molecules capable of influencing the
amount of the transcription factor present in the somatic cell, or
any combinations thereof. More preferably the factors are the
transcription factors Sox2 and Pax6 or any known transcription
factors which, alone or in combination, are capable of producing
multi-potent neural precursor cells in a method according to the
invention.
[0025] Typically, the step of culturing the somatic cell includes
culturing the cell in any medium capable of supporting growth of
precursor cells, such as for example stem cell medium.
[0026] Preferably the medium is supplemented with a chromatin
modifying agent capable of facilitating the reprogramming of the
somatic cell. The chromatin modifying agent may be selected from
agents promoting acetylation of chromatin, inhibiting deacetylation
of chromatin, altering histone methylation states within chromatin
or leading to DNA demethylation within chromatin. Preferably the
chromatin modifying agent is valproic acid. Even more preferable is
valproic acid at a concentration of 1 .mu.M.
[0027] In a second aspect the present invention relates to a
reprogrammed multi-potent lineage-specific precursor cell produced
by a method according to the first aspect. The precursor cell is
preferably a multi-potent neural precursor cell.
DEFINITIONS
[0028] In the context of this specification the following terms are
defined as follows:
"comprising"
[0029] Unless the context clearly requires otherwise, throughout
the description and the claims, the words "comprise", "comprising",
and the like are to be construed in an inclusive sense as opposed
to an exclusive or exhaustive sense; that is to say, in the sense
of "including, but not limited to".
"mature"
[0030] In so far as this term refers to cells it is to be construed
to refer to cells which have reached their final differentiation
state, i.e. cells which no longer have a potential to further
differentiate. Such cells can be found at various developmental
stages including embryonal, post natal or adult stages, but, as
will be appreciated, are most conveniently sourced from adults.
"neural"
[0031] In so far as this term refers to cells of the nervous system
it is to be construed to include "neuronal" and "glial" cells.
"lineage"
[0032] In so far as this term refers to cell lineages, a lineage is
a genealogic pedigree of cells related through mitotic
division.
"lineage-specific"
[0033] In so far as this term refers to cells, it refers to the
differentiation state to which a cell has become committed.
"precursor cell"
[0034] In so far as this term refers to cells, it refers to a cell
capable of differentiating into a number of cell and/or tissue
types of a cell lineage.
"pluripotent"
[0035] In so far as this term refers to cells, it refers to a cell
capable of differentiating into cell and/or tissue types of all
cell lineages, excluding extra embryonic cell and/or tissue
types.
"multi-potent"
[0036] In so far as this term refers to cells, it refers to a cell
capable of differentiating into of cell and/or tissue types of
multiple but not all cell lineages.
"induced multi-potent neural precursor (iMNP) cell"
[0037] This term refers to a type of multi-potent precursor cell
which has been artificially derived from a non-pluripotent or
multi-potent source, typically a mature somatic cell, by inducing
expression of certain genes characteristic for cells of neural
lineage. Therefore, iMNP cells are only capable of differentiating
into neural cell and/or tissue types.
BRIEF DESCRIPTION OF THE DRAWINGS
[0038] A preferred embodiment of the invention will now be
described, by way of example only, with reference to the
accompanying figures in which:
[0039] FIG. 1. FIG. 1 is a flowchart comparing the steps (route A)
necessary to produce neurons, astrocytes, and oligodendrocytes from
neural precursor cells derived from induced pluripotent stem (iPS)
cells as known in the art, with the steps (route B) necessary to
produce these cells from induced multi-potent neural precursor
(iMNP) cells derived from a mature human fibroblast in a method
according to the invention;
[0040] FIGS. 2A-2E. FIGS. 2A-2C are a series of epifluorescence
images of phycoerythrin (PE) transduced cells using either the
ProDeliverIn (FIG. 2B) or Proteofectene (FIG. 2C) transduction
systems. PE fluorescent signal can be seen in both ProDeliverin
(FIG. 2B) and Proteofectene (FIG. 2C) transduced cells (arrows),
while no intracellular PE fluorescent signal was observed in
control experiments (FIG. 2A). FIGS. 2D and 2E are series of
fluorescence activated cell sorting (FACs) blots showing (FIG. 2D)
the analysis of human dermal fibroblasts (HDF) transduced with PE
using the ProDeliverin and the Proteofectene system, while (FIG.
2E) shows FACs blots similar to the ones of FIG. 2(D) comparing PE
and ProDeliverin ratios of 1:1, 1:2 and 1:3;
[0041] FIGS. 3A-3C. FIG. 3A 3 is an epifluorescence image of
phycoerythrin (PE) transduced cells using the ProDeliverin
transduction system. FIGS. 3B and 3C are fluorescence activated
cell sorting (FACs) blots showing the analysis of (FIG. 3B) control
and (FIG. 3C) PE protein transduced human dermal fibroblasts (HDF)
using the ProDeliverin system at a PE and ProDeliverin ratios of
1:2. FIG. 3 (C) demonstrates that a transduction efficiency of
approximately 50% can be achieved.
[0042] FIG. 4. FIG. 4 shows schematic plasmid maps illustrating
features of the pCMV-huSox2 and pCMV-huPax6 plasmids.
[0043] FIGS. 5A-5C. FIG. 5A is an epifluorescence image of Green
Fluorescent Protein (eGFP) transduced HDF cells using the
Lipofectamine LTX gene delivery agent. FIGS. 5B and 5C are
fluorescence activated cell sorting (FACs) blots showing the
analysis of (FIG. 5B) control and (FIG. 5C) eGFP transfected HDF
cells using the Lipofectamine LTX gene delivery agent at a ratio of
6:1 (v/m). FIG. 5 (C) demonstrates that a transduction efficiency
of approximately 12% can be achieved.
[0044] FIGS. 6A-6F. FIGS. 6A-6E are brightfield images of iMNP
colony formation. FIG. 6 (A) demonstrates mature HDF cells in
culture prior to Sox2/Pax6 plasmid transfection. FIG. 6 (B)
demonstrates the formation of iMNP colonies approximately 30 days
following Sox2/Pax6 plasmid co-transfection using the Lipofectamine
LTX gene delivery agent. FIGS. 6 (C to E) represent the formation
of secondary colonies following the dissociation of primary
colonies. FIG. 6 (C) is an image of secondary colony formation 1
day following dissociation of primary colonies. FIG. 6 (D) is an
image of secondary colonies 4 days following dissociation of
primary colonies. FIG. 6 (E) is an image of a secondary colony 10
days following dissociation of primary colonies. FIG. 6 (F) is a
graph demonstrating the number of iMNP colonies of a given size
(diameter) as a percentage of the total colonies measured prior to
dissociation (pre diss), and 6, 10 and 14 days following
dissociation. Colonies measured prior to dissociation represent
primary colonies. Colonies measured after dissociation represent
secondary colony formation. The graph demonstrates the formation of
secondary colonies by 6 days following dissociation. The size of
secondary colonies generated following dissociation is increased
compared to primary colonies.
[0045] FIG. 7. FIG. 7 is a RT-PCR panel demonstrating the
expression of the neural precursor cell and immature neuronal
marker genes Hes1, Sox3, Pax6, Sox2, Ngn2, and Mash1, and the
pluripotency marker gene Oct3/4 in control (GFP or PE) and
Sox2/Pax6 transfected or transduced iMNP colonies. Positive
controls are samples from human embryonic stem cell cultures (hESC)
and from human neural precursor cell cultures (hNP).
[0046] FIGS. 8A-8F. FIGS. 8A-8F are epifluorescence images of
Sox2/Pax6 transfected iMNP colonies expressing the immature
neuronal markers Mash1 (red; FIG. 8A and FIG. 8D) and Ngn2 (green;
FIG. 8B and FIG. 8E). Images in (FIG. 8C and FIG. 8F) demonstrate
co-expression of Mash1 (red) and Ngn2 (green). DAPI (blue) is used
to detect individual cell nuclei (FIG. 8A, FIG. 8B, FIG. 8D and
FIG. 8E).
PREFERRED EMBODIMENT OF THE INVENTION
[0047] Cell transplantation therapy using stem cells may offer a
viable treatment strategy for patients with brain disease or
injury, such as Parkinson's disease, Huntington's disease, stroke
or spinal cord injury, by providing new cells to replace those lost
through disease. Embryonic stem cells have the capability to grow
indefinitely while maintaining the ability to generate all cell
types in the body. These properties have lead to expectations that
human embryonic stem cells might be useful to treat patients with
various diseases or injuries, including brain injury and disease,
thereby revolutionising regenerative medicine.
[0048] However, the clinical application of human embryonic stem
cells faces difficulties regarding the use of embryos, as well as
issues of tissue rejection after implantation due to immunological
incompatibility between patient and donor cells. One way to
circumvent these issues is to artificially derive a stem-like cell
from mature somatic cells, such as fibroblast cells, by inducing a
"forced" expression of certain genes (FIG. 1A). These artificially
derived stem cells are known as induced pluripotent stem cells (iPS
cells) and are believed to be identical to embryonic stem cells in
many respects. As such, the generation of iPS cells from mature
somatic cells, such as fibroblast cells, obtained directly from the
patient prevents therapeutic concerns regarding ethics and tissue
rejection, and may potentially provide the optimal cell source for
regenerative medicine.
[0049] In order for embryonic stem cells or iPS cells to be used
for the treatment of brain disease or injury, they must first be
directed to form neural (brain) precursor cells prior to
transplantation. However, results from the inventors' research and
that of others has demonstrated that transplantation of neural
precursor cells derived from either embryonic stem cells or iPS
cells can lead to the formation of tumours due to the contamination
of a population of pluripotent cells still un-committed to a
specific cell lineage.
[0050] The present invention relates to reprogramming of mammalian
somatic cells by delivering one or more selected factors to the
cells which determine the lineage specificity of the reprogrammed
cell. In one or more preferred embodiments the present invention
provides the use of mature mammalian fibroblasts in the
reprogramming methods described. Fibroblasts are found within
fibrous connective tissue and are associated with the formation of
collagen fibres and ground substance of connective tissue. While
mammalian fibroblasts from any source such as, for example lung
fibroblasts, kidney fibroblasts, cardiac fibroblasts, stromal
fibroblasts, foreskin fibroblasts and the like, may be used in the
methods of the present invention, mature mammalian dermal
fibroblasts provide a convenient source of somatic cells. Such
fibroblasts can be conveniently obtained from a commercial source
or, if desired, may be isolated from various tissues using well
established and documented techniques.
[0051] As indicated above, the present invention, in particular,
relates to a method of reprogramming a mature human fibroblast into
a lineage-specific multi-potent neural precursor cell (FIG.
1B).
[0052] Generally, the step of delivering one or more selected
factors to mature mammalian cells in the context of the present
invention includes the delivery of factors such as, for example
proteins or genes, by standard delivery techniques. These standard
techniques have been described, for example in: "Viral Vectors for
Gene Therapy--Methods and Protocols" Series: Methods in Molecular
Medicine, Vol. 76, Machida, Curtis A. (Ed.) 2003, 608 p. 117; in
Gene Therapy Protocols--Volume 2 "Design and Characterization of
Gene Transfer Vectors" Series: Methods in Molecular Biology, Vol.
434, LeDoux, Joseph (Ed.) 3rd ed., 2008, XII, 314 p. 59; in Gene
Delivery to Mammalian Cells, Volume 2 "Viral Gene Transfer
Techniques" Series: Methods in Molecular Biology, Vol. 246, Heiser,
William C. (Ed.) 2004, 592 p. 69; in Gene Delivery to Mammalian
Cells Volume 1 "Nonviral Gene Transfer Techniques" Series: Methods
in Molecular Biology, Vol. 245, Heiser, William C. (Ed.) 2004, 320
p. 36; and/or in "RNA Silencing--Methods and Protocols" Series:
Methods in Molecular Biology, Vol. 309, Carmichael, Gordon (Ed.)
2005, 352 p. 74, all of which are herein incorporated by reference
in their entirety.
[0053] The factors delivered to the mature mammalian cells can be
selected from proteins such as transcription factors, nucleic acids
encoding the transcription factors, small molecules capable of
influencing the amount of the transcripton factors present in the
somatic cell, or any combinations thereof.
[0054] The invention is further described by the following
non-limiting examples.
EXAMPLE 1
Source and Maintenance of Adult Human Dermal Fibroblast (HDF)
Cells
[0055] Mature human dermal fibroblast (HDF) cells, as a convenient
model to exemplify the invention, were purchased from Cell
Applications Inc, (San Diego, USA).
[0056] HDF cells were maintained in Fibroblast Growth Media (Cell
Applications) with 2% heat-activated FBS (Invitrogen, USA), in
accordance with manufacturer's instructions and common laboratory
cell culture techniques and equipment.
EXAMPLE 2
Culture and Programming of Adult Human Dermal Fibroblast (HDF)
Cells
[0057] After completing protein transduction (Example 4) or plasmid
transfection (Example 5), HDF cells were harvested by
trypsinization and transferred to either a 6-well (Nunc, Denmark)
or a 24-well plate (Nunc) for proliferation. Approximately 3 days
post-transfection or post-transduction, the cell media was changed
to Neurobasal A (NBA) proliferation medium comprising Neurobasal-A
(Invitrogen), 1% D-glucose (Sigma Aldrich), 1%
Penicillin/Streptomycin/Glutamine (Invitrogen), 2% B27 supplement
with Retinoic acid (Invitrogen), 0.2% EGF (Peprotech, USA), 0.08%
FGF-2 (Peprotech), 0.2% Heparin (Sigma Aldrich, USA) and Valproic
acid (Sigma Aldrich) to a concentration of 1 .mu.M. The media was
changed thrice weekly, and cells were replated regularly (2-8 times
up to a maximum of weekly replating, becoming more regular as
colonies began to develop) to remove non-reprogrammed cells until
widespread colony formation was achieved.
EXAMPLE 3
Establishment And Optimisation Of Protein Transduction
Technique
[0058] Fluorescent R-phycoerythrin protein (PE) was either obtained
from Oz Bioscience or Sigma-Aldrich. To optimise protein
transduction 5.times.10.sup.4 HDF cells were plated in 24-well
plates 24 hrs before transduction. One hour before transduction
Fibroblast Growth Media was removed and replaced by pre-warmed
serum-free D-MEM. Fluorescent R-phycoerythrin protein (PE; 1 .mu.g)
was mixed with either ProDeliverin (Oz Bioscience, France) or
Proteofectene (Biontex, USA) in ratios of 1:1, 1:2 and 1:3 (m/v),
incubated for 20 min to form complexes and added onto HDF cells,
respectively. The transduction medium was replaced with normal
Fibroblast Growth Media after 3 hrs. To further optimise efficient
protein transduction, HDF cells were also incubated with PE-protein
transduction complexes for 48 hrs in normal Fibroblast Growth
Media. Twenty-four hours post transduction, the uptake of PE was
analysed by epifluorescence microscopy using a Nikon Eclipse
TE2000U (Nikon) and flow cytometry analysis using a BD LSR-II
(Becton Dickinson, USA). Control experiments were performed adding
PE without the transduction reagent to the cells.
Results
[0059] Protein transduction of mature HDFs using either
ProDeliverin or Proteofectene resulted in cellular uptake of
fluorescent PE protein using a 1:2 ratio of protein to transduction
reagent whereas no intracellular PE could be observed in control
experiments adding PE without transduction reagent to the cells
(FIGS. 2A-C)
[0060] FACS analysis revealed 23% cell transduction using the
ProDeliverin system compared to 13% cell transduction with the
Proteofectene system when using 1 .mu.g PE protein in a ratio of
1:2 (FIG. 2D).
[0061] When comparing different ratios of PE protein and
ProDeliverin, a 1:2 ratio resulted in the highest amount of 13%
PE-positive cells compared to 6.5% with a ratio of 1:1 and 11% with
a 1:3 ratio 48 hrs post transduction when 0.5m PE protein was
applied and incubated for 3 hrs (FIG. 2E). Transduction efficiency
could be improved to 54% PE-positive cells using the ProDeliverin
system by using 5 .mu.g PE protein in a ratio of 1:2 and increasing
incubation time to 48 hrs (FIGS. 3B and C). The cellular uptake of
fluorescent PE protein (red) is shown in FIG. 3A.
EXAMPLE4
Delivering Transcription Factors Via Protein Transduction
[0062] Recombinant Sox2-TAT protein was commercially obtained from
Preprotech. Recombinant Pax6 protein was commercially obtained from
Abnova. Co-transduction of Sox2-TAT (Peprotech) and Pax6 (Abnova,
Taiwan) full-length proteins was performed by incubating mature
HDFs at a density of 5.times.10.sup.5 in uncoated coated six-well
plates with 5 .mu.g protein mixture and ProDeliverin in a ratio 1:2
(m/v) for 48 hrs in Fibroblast Growth Media. After 48 hrs the
protein transduction media was replaced with NBA proliferation
media containing 1 .mu.M valproic acid and cultured for further 24
hrs. Four protein transduction cycles were applied to the HDF cells
before they were completely changed to NBA proliferation media
containing 1 .mu.M valproic acid. Media was changed every 2-3 days
with weekly replating until widespread colonies were observed. The
colonies were then isolated for PCR or immunocytochemical analysis
(Examples 7 and 8).
EXAMPLE 5
Delivering Transcription Factors Via Plasmid Transfection
[0063] cDNAs of Sox2 and Pax6 were purchased from Addgene and
Invitrogen and cloned into pDNA backbones to be driven under the
CMV promoter, respectively (see FIG. 4). The plasmids were
amplified and purified using a PureLink HiPure Plasmid Filter
Maxiprep Kit (Invitrogen). Transfections were performed with the
Lipofectamine LTX reagent (Invitrogen), and 5.times.10.sup.5 HDF
cells per well were seeded into uncoated 6-well plates 24 hr prior
to the transfection. Gene transfer complexes were formed by mixing
the Plus Reagent (Invitrogen) with 1 .mu.g of each pDNA in Optimem
medium (Invitrogen), then adding LTX gene delivery agent at a ratio
of 6:1 (v/m). Cells were incubated with the transfection mixture
for 5 hours, then were given fresh Fibroblast Growth media. After 3
days the cells were given NBA proliferation media containing 1
.mu.M valproic acid. The media was changed every 2-3 days, with
regular replating occurring until colonies were observed. The
colonies were isolated for PCR and immunocytochemical analysis
(Examples 7 and 8). Control experiments were performed using an
eGFP control plasmid.
Results
[0064] FACS analysis revealed that 12% of cells were transfected
with eGFP (FIG. 5C) using LTX reagent as described, compared to 0%
for untransfected cells (FIG. 5B). The cellular uptake of
fluorescent eGFP plasmid (green) is shown in FIG. 5A.
EXAMPLE 6
Assessment of Colony Development and Proliferation of iMNP
Cells
[0065] HDF cells were transfected as in Example 5 and switched to
NBA proliferation media containing 1 .mu.M valproic acid 3 days
post-transfection and cultured as per Example 2. Colonies formed
within 30 days. A cohort of colonies were then dissociated to 5-10
cell colonies by scraping and mechanical trituration to assess the
ability of the colonies to self-renew and form secondary colonies.
The dissociated colonies were replated onto uncoated 6 well plates
(Nunc) and cultured in NBA proliferation media containing 1 .mu.M
valproic acid. The 5-10 cell colonies formed secondary colonies
over a period of 14 days. The diameter (size) of the secondary
colonies was measured and plotted as a percentage of measured
colonies against 4 time points--pre-dissocation ("pre diss."), 6
days post-dissociation, 10 days post-dissociation and 14 days
post-dissociation.
Results
[0066] Primary iMNP colonies began to form within 7 days of
Sox2/Pax6 transfection. Non-reprogrammed cells were removed by
regular replating until widespread colony formation was achieved
approximately 30 days following transfection (FIGS. 6A and B). Most
importantly, colony formation did not require the presence of a
feeder cell layer. We estimate an efficiency of colony formation at
approximately 0.05% of total HDFs plated.
[0067] Induced MNP colonies formed from Sox2/Pax6 transfection also
exhibited the ability to undergo self-renewal by the formation of
secondary iMNP colonies from dissociated primary iMNP colonies.
Secondary colonies developed by 4 to 6 days following dissociation
of primary colonies (FIGS. 6C to F). Both the number and size of
the secondary colonies was increased compared to the primary
colonies (FIG. 6F). Secondary iMNP colony formation appeared to
plateau by 6 days following dissociation.
EXAMPLE 7
Characterisation of Mature Human Dermal Fibroblast Derived iMNP
Cells by RT-PCR
[0068] Total RNA was isolated from iMNP cells and normal mature HDF
cells using a PureLink RNA Mini Kit (Invitrogen). CDNA was produced
from total RNA using a Superscript reverse transcriptase
(Invitrogen) following the manufacturer's protocol. Expression of
neural precursor cell and immature neuronal markers were detected
by RT-PCR using a Taq DNA polymerase (New England) and the
following primers listed in Table 1.
TABLE-US-00001 Oct 4: (SEQ ID NO: 1) Oct4-FP GTGAGAGGCAACCTGGAGAATT
(SEQ ID NO: 2) Oct4-RP CATTCCTAGAAGGGCAGGCACC Sox1: (SEQ ID NO: 3)
Sox1-FP CAGTACAGCCCCATCTCCAAC (SEQ ID NO: 4) Sox1-RP
GCGGGCAAGTACATGCTGA Sox2: (SEQ ID NO: 5) Sox2-FP
GCCGAGTGGAAACTTTTGTCG (SEQ ID NO: 6) Sox2-RP GCAGCGTGTACTTATCCTTCTT
Sox3: (SEQ ID NO: 7) Sox3-FP CGCGGGTTCCTGCTGATTT (SEQ ID NO: 8)
Sox3-RP CGGGGTTCTTGAGTTCAGTCT Pax6: (SEQ ID NO: 9) Pax6-FP
TCACAGCGGAGTGAATCAGC (SEQ ID NO: 10) Pax6-RP TATCGTTGGTACAGACCCCCTC
Mash1: (SEQ ID NO: 11) Mash1-FP GAATGGACTTTGGAAGCAG (SEQ ID NO: 12)
Mash1-RP AACTGGTTAGGATAGATACA Hes1: (SEQ ID NO: 13) Hes1-FP
GCACAGAAAGTCATCAAAGCC (SEQ ID NO: 14) Hes1-RP TTGATCTGGGTCATGCAGTTG
Hes5: (SEQ ID NO: 15) Hes5-FP TTCTCAGAGAATGTGTGTGCAGAGT (SEQ ID NO:
16) Hes5-RP GGTCAGACACTTGGCAGAAGATG Ngn2: (SEQ ID NO: 17) Ngn2-FP
GCTGGCATCTGCTCTATTCC (SEQ ID NO: 18) Ngn2-RP
ATGAAGCAATCCTCCCTCCT
Results
[0069] Sox2/Pax6 iMNP colonies consistently expressed a full range
of the neural precursor cell genes Hes1, Sox3, Sox2, and Pax6 (FIG.
7). In addition, colonies were observed to express the immature
neuronal markers Ngn2 and Mash1 (FIG. 7). The expression of neural
precursor cell and immature neuronal marker genes was seen in
colonies generated by either plasmid transfection or protein
transduction. Expression of Hes1, Sox3, Sox2, Pax 6, Ngn2 or Mash1
was occasionally detected in control (GFP transfected or PE
transduced) colonies (FIG. 7; cell line 11 and cell line 8). This
may indicate that culture of adult HDF cells in NBA proliferation
media containing 1 .mu.M valproic acid alone may be sufficient to
promote induction of neural precursor genes. However, it is
apparent from the results presented in FIG. 7 that transfection or
transduction of adult HDFs with Sox2 and Pax6 is required to
consistently obtain induction of a wide range of neural precursor
cell and immature neuronal marker genes.
[0070] FIG. 7 also demonstrates expression of the pluripotency gene
Oct3/4 in both control and Sox2/Pax6 transduced or transfected
colonies. Expression of Oct3/4 does not in itself indicate
pluripotency of the resulting colonies but most likely demonstrates
the expression of Oct3/4 in adult HDF cells (Zangrossi et al,
(2007) Stem Cells 25: 11675-1680; Chin et al, (2009) Biochemical
and Biophysical Research Communications 388: 247-251)
EXAMPLE 8
Characterisation of Immature Neuronal Cells from iMNP Cells by
Immunocytochemistry
[0071] Colonies were fixed in 4% paraformaldehyde and standard
double-label fluorescent immunocytochemical procedures were
performed using human-specific antibodies directed against the
immature neuronal markers Mash1/Ashl1 (Chemicon), and Neurogenin2
(Chemicon, USA). DAPI was used as a counterstain for cell nuclei.
Untreated HDF cells were used as a negative control. The standard
fluorescent immunocytochemical procedures have, for example, been
described in "Immunocytochemical Methods and Protocols" Series:
Methods in Molecular Biology, Edited by Constance Oliver and Maria
Celia Jamur, 3.sup.rd edition, 2010 Humana Press, which is
incorporated herein in its entirety.
Results
[0072] A population of Sox2/Pax6 iMNP colonies were observed to
express the immature neuronal markers Mash1 and Ngn2 (FIG. 8). As
demonstrated in FIGS. 8C and F, individual cells within the
colonies expressing Mash1 also expressed Ngn2. This indicates a
population of cells within the iMNP colony have been reprogrammed
towards an immature neuronal lineage.
[0073] Although the invention has been described by way of example,
it should be appreciated that variations and modifications may be
made without departing from the scope of the invention.
Furthermore, where known equivalents exist to specific features,
such equivalents are incorporated as if specifically referred to in
this specification.
Sequence CWU 1
1
18122DNAHomo sapiens 1gtgagaggca acctggagaa tt 22222DNAHomo sapiens
2cattcctaga agggcaggca cc 22321DNAHomo sapiens 3cagtacagcc
ccatctccaa c 21419DNAHomo sapiens 4gcgggcaagt acatgctga
19521DNAHomo sapiens 5gccgagtgga aacttttgtc g 21622DNAHomo sapiens
6gcagcgtgta cttatccttc tt 22719DNAHomo sapiens 7cgcgggttcc
tgctgattt 19821DNAHomo sapiens 8cggggttctt gagttcagtc t
21920DNAHomo sapiens 9tcacagcgga gtgaatcagc 201022DNAHomo sapiens
10tatcgttggt acagaccccc tc 221119DNAHomo sapiens 11gaatggactt
tggaagcag 191220DNAHomo sapiens 12aactggttag gatagataca
201321DNAHomo sapiens 13gcacagaaag tcatcaaagc c 211421DNAHomo
sapiens 14ttgatctggg tcatgcagtt g 211525DNAHomo sapiens
15ttctcagaga atgtgtgtgc agagt 251623DNAHomo sapiens 16ggtcagacac
ttggcagaag atg 231720DNAHomo sapiens 17gctggcatct gctctattcc
201820DNAHomo sapiens 18atgaagcaat cctccctcct 20
* * * * *