U.S. patent application number 14/638885 was filed with the patent office on 2016-04-28 for silencing of polo-like kinase expression using interfering rna.
The applicant listed for this patent is PROTIVA BIOTHERAPEUTICS, INC.. Invention is credited to ADAM JUDGE, IAN MACLACHLAN.
Application Number | 20160115483 14/638885 |
Document ID | / |
Family ID | 40823727 |
Filed Date | 2016-04-28 |
United States Patent
Application |
20160115483 |
Kind Code |
A1 |
MACLACHLAN; IAN ; et
al. |
April 28, 2016 |
SILENCING OF POLO-LIKE KINASE EXPRESSION USING INTERFERING RNA
Abstract
The present invention provides compositions comprising
interfering RNA (e.g., siRNA, aiRNA, miRNA) that target polo-like
kinase 1 (PLK-1) expression and methods of using such compositions
to silence PLK-1 expression. More particularly, the present
invention provides unmodified and chemically modified interfering
RNA molecules which silence PLK-1 expression and methods of use
thereof. The present invention also provides serum-stable nucleic
acid-lipid particles (e.g., SNALP) comprising an interfering RNA
molecule described herein, a cationic lipid, and a non-cationic
lipid, which can further comprise a conjugated lipid that inhibits
aggregation of particles. The present invention further provides
methods of silencing PLK-1 gene expression by administering an
interfering RNA molecule described herein to a mammalian subject.
The present invention additionally provides methods of identifying
and/or modifying PLK-1 interfering RNA having immunostimulatory
properties. Methods for sensitizing a cell such as a cancer cell to
the effects of a chemotherapy drug comprising sequentially
delivering PLK-1 interfering RNA followed by the chemotherapy drug
are also provided.
Inventors: |
MACLACHLAN; IAN; (MISSION,
CA) ; JUDGE; ADAM; (VANCOUVER, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
PROTIVA BIOTHERAPEUTICS, INC. |
BURNABY |
|
CA |
|
|
Family ID: |
40823727 |
Appl. No.: |
14/638885 |
Filed: |
March 4, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12343342 |
Dec 23, 2008 |
9006191 |
|
|
14638885 |
|
|
|
|
61017075 |
Dec 27, 2007 |
|
|
|
61045228 |
Apr 15, 2008 |
|
|
|
61100653 |
Sep 26, 2008 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/24.5 |
Current CPC
Class: |
C12N 2310/322 20130101;
A61K 9/127 20130101; C12N 2320/30 20130101; A61P 35/00 20180101;
C12N 2310/321 20130101; C12N 2310/322 20130101; C12N 15/1137
20130101; C12N 2310/3525 20130101; C12N 2310/3231 20130101; C12N
2310/3533 20130101; C12N 2310/321 20130101; C12N 2310/14 20130101;
C12N 2310/322 20130101; A61K 9/1272 20130101; A61K 9/0019 20130101;
C12Y 207/11021 20130101; C12N 15/88 20130101; C12N 2310/335
20130101; A61K 9/1271 20130101; A61P 43/00 20180101; C12N 2310/3521
20130101; C12N 2310/3525 20130101; C12N 2310/3521 20130101; C12N
2310/3533 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1. A modified siRNA molecule comprising a double-stranded region of
about 15 to about 60 nucleotides in length, wherein one or more of
the nucleotides in the double-stranded region comprise modified
nucleotides, and wherein the modified siRNA molecule is capable of
silencing polo-like kinase 1 (PLK-1) expression.
2. The modified siRNA molecule of claim 1, wherein the modified
siRNA molecule comprises modified nucleotides selected from the
group consisting of 2'-O-methyl (2'OMe) nucleotides,
2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy nucleotides,
2'-O-(2-methoxyethyl) (MOE) nucleotides, locked nucleic acid (LNA)
nucleotides, and mixtures thereof.
3. The modified siRNA molecule of claim 1, wherein the modified
siRNA molecule comprises 2'OMe nucleotides.
4. The modified siRNA molecule of claim 1, wherein the modified
siRNA molecule comprises a sense strand having one or more modified
nucleotides in the double-stranded region.
5. The modified siRNA molecule of claim 4, wherein the modified
siRNA molecule further comprises an antisense strand having one or
more modified nucleotides in the double-stranded region.
6. The modified siRNA molecule of claim 1, wherein the modified
siRNA molecule comprises an antisense strand having one or more
modified nucleotides in the double-stranded region.
7. The modified siRNA molecule of claim 6, wherein the modified
siRNA molecule further comprises a sense strand having one or more
modified nucleotides in the double-stranded region.
8. The modified siRNA molecule of claim 1, wherein the modified
siRNA molecule comprises a 3' overhang in one or both strands of
the modified siRNA molecule.
9. The modified siRNA molecule of claim 8, wherein one or more of
the nucleotides in the 3' overhang comprise modified
nucleotides.
10. The modified siRNA molecule of claim 1, wherein less than about
25% of the nucleotides in the double-stranded region comprise
modified nucleotides.
11. The modified siRNA molecule of claim 1, wherein the modified
siRNA molecule is less immunostimulatory than a corresponding
unmodified siRNA sequence.
12. The modified siRNA molecule of claim 1, wherein the modified
siRNA molecule comprises an antisense strand comprising the nucleic
acid sequence of SEQ ID NO:2.
13. The modified siRNA molecule of claim 1, wherein the modified
siRNA molecule comprises a sense strand comprising the nucleic acid
sequence of SEQ ID NO:1.
14. The modified siRNA molecule of claim 1, wherein the modified
siRNA molecule comprises an antisense strand comprising the nucleic
acid sequence of SEQ ID NO:4.
15. The modified siRNA molecule of claim 1, wherein the modified
siRNA molecule comprises a sense strand comprising the nucleic acid
sequence of SEQ ID NO:3.
16. The modified siRNA molecule of claim 1, wherein the modified
siRNA molecule comprises an antisense strand consisting of the
nucleic acid sequence of SEQ ID NO:403.
17. The modified siRNA molecule of claim 1, wherein the modified
siRNA molecule comprises a sense strand consisting of the nucleic
acid sequence of SEQ ID NO:400.
18. The modified siRNA molecule of claim 1, wherein the modified
siRNA molecule is selected from the group consisting of PLK1424
2/6, PLK1424 U4/GU, PLK1424 U4/G, PLK773 G/GU, PLK1425 3/5, and a
mixture thereof.
19. The modified siRNA molecule of claim 1, wherein the modified
siRNA molecule is PLK1424 2/6.
20. The modified siRNA molecule of claim 1, further comprising a
carrier system.
21-113. (canceled)
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S.
application Ser. No. 12/343,342, filed Dec. 23, 2008, allowed,
which application claims priority to U.S. Provisional Application
No. 61/017,075, filed Dec. 27, 2007, U.S. Provisional Application
No. 61/045,228, filed Apr. 15, 2008, and U.S. Provisional
Application No. 61/100,653, filed Sep. 26, 2008, the disclosures of
which are herein incorporated by reference in their entirety for
all purposes.
BACKGROUND OF THE INVENTION
[0002] Cell proliferation and programmed cell death play important
roles in the growth and development of an organism. In
proliferative diseases such as cancer, the processes of cell
proliferation and/or programmed cell death are often perturbed. For
example, a cancer cell may have unregulated cell division through
either the overexpression of a positive regulator of the cell cycle
or the loss of a negative regulator of the cell cycle, perhaps by
mutation. Alternatively, a cancer cell may have lost the ability to
undergo programmed cell death through the overexpression of a
negative regulator of apoptosis. Therefore, there is a need to
develop new therapeutic agents that will restore the processes of
checkpoint control and programmed cell death to cancerous
cells.
[0003] RNA interference (RNAi) is an evolutionarily conserved
process in which recognition of double-stranded RNA (dsRNA)
ultimately leads to posttranscriptional suppression of gene
expression. This suppression is mediated by short dsRNA, also
called small interfering RNA (siRNA), which induces specific
degradation of mRNA through complementary base pairing. In several
model systems, this natural response has been developed into a
powerful tool for the investigation of gene function (see, e.g.,
Elbashir et al., Genes Dev., 15:188-200 (2001); Hammond et al.,
Nat. Rev. Genet., 2:110-119 (2001)). More recently, it was
discovered that introducing synthetic 21-nucleotide dsRNA duplexes
into mammalian cells could efficiently silence gene expression.
Although the precise mechanism is still unclear, RNAi offers a new
way to inactivate genes of interest. In particular, for the
treatment of neoplastic disorders such as cancer, RNAi provides a
potential new approach to modulate (e.g., reduce) the expression of
certain genes, e.g., an anti-apoptotic molecule, a growth factor, a
growth factor receptor, a mitotic spindle protein, a cell cycle
protein, an angiogenic factor, an oncogene, an intracellular signal
transducer, a molecular chaperone, and combinations thereof.
[0004] One such target is the polo-like kinase 1 (PLK-1) gene,
which encodes a member of a family of serine/threonine protein
kinases known as polo-like kinases (see, e.g., Nigg, Curr. Opin.
Cell. Biol., 10:776-783 (1998)). In eukaryotes, the regulated
progression through the cell cycle is controlled by a group of
genes whose expression fluctuates throughout the cycle.
Cyclin-dependent kinases and their associated regulatory subunits,
the cyclins, are the primary regulators of the cell cycle. These
heterodimeric complexes act by phosphorylating downstream targets
that, in turn, trigger signaling events that liberate nuclear
proteins necessary for entry into subsequent phases of the cell
cycle. Polo-like kinases such as PLK-1 contribute to the activation
and inactivation of these heterodimeric complexes.
[0005] As cells progress through the cell cycle, polo-like kinases
undergo fluctuations in abundance, activity, and localization to
control multiple stages of the cell cycle (Hamanaka et al., J.
Biol. Chem., 270:21086-21091 (1995)). This family of kinases also
functions in centrosome maturation (Lane et al., J. Cell. Biol.,
135:1701-1713 (1996)), bipolar spindle formation (Golsteyn et al.,
J. Cell. Biol., 129:1617-1628 (1995)), DNA damage checkpoint
adaptation (Arnaud et al., Chromosoma, 107:424-429 (1998)), and
regulation of the anaphase-promoting complex (Kotani et al., Mol.
Cell, 1:371-380 (1998)).
[0006] PLK-1 was the first member of this family of kinases to be
identified as the mammalian counterpart to the Drosophila
melanogaster gene polo, required for passage through mitosis
(Golsteyn et al., J. Cell. Sci., 107:1509-1517 (1994); Hamanaka et
al., Cell. Growth Differ., 5:249-257 (1994); Holtrich et al., Proc.
Natl. Acad. Sci. U.S.A., 91:1736-1740 (1994); Lake et al., Mol.
Cell. Biol., 13:7793-7801 (1993)). Expression of PLK-1 was shown to
correlate with mitotic activity of cells (Golsteyn et al., J. Cell.
Sci., 107:1509-1517 (1994); Lake et al., Mol. Cell. Biol.,
13:7793-7801 (1993)) and to be high in tumors of several origins
including lung, colon, stomach, smooth muscle, and esophagus
(Holtrich et al., Proc. Natl. Acad. Sci. U.S.A., 91:1736-1740
(1994)). Overexpression or constitutive expression of PLK-1 has
also been shown to induce malignant transformation of mammalian
cells (Mundt et al., Biochem. Biophys. Res. Commun., 239:377-385
(1997); Smith et al., Biochem. Biophys. Res. Commun., 234:397-405
(1997)). Microinjection of PLK-1 antisense RNA into growing mouse
NIH3T3 fibroblast cells was shown to block tritiated thymidine
incorporation, suggesting that PLK-1 expression is restricted to
and required by proliferating cells (Hamanaka et al., Cell. Growth
Differ., 5:249-257 (1994)).
[0007] Further support for this conclusion is found in studies
showing that elevated levels of PLK-1 expression are significant
prognostic indicators of non-small cell lung cancer (Wolf et al.,
Oncogene, 14:543-549 (1997)), breast and lung cancer (Yuan et al.,
Am. J. Pathol., 150:1165-1172 (1997)), esophageal carcinoma
(Tokumitsu et al., Int. J. Oncol., 15:687-692 (1999)), and squamous
cell carcinomas of the head and neck (Knecht et al., Cancer Res.,
59:2794-2797 (1999)). The pharmacological modulation of PLK-1
activity, expression, or function may therefore be an appropriate
point of therapeutic intervention in pathological conditions.
[0008] Currently, there are no known therapeutic agents which
effectively inhibit the synthesis of PLK-1 and investigative
strategies aimed at modulating PLK-1 function have involved the use
of antibodies and antisense oligonucleotides. For example,
inhibition of PLK-1 expression using antisense oligonucleotides
resulted in the loss of cell viability in cultured A549 cells and
anti-tumor activity in nude mice A549 xenografts (Elez et al.,
Biochem. Biophys. Res. Commun., 209:352-356 (2000)). Similarly,
U.S. Pat. No. 6,906,186 describes the inhibition of PLK-1
expression using antisense oligonucleotides in an in vitro cell
culture system. However, these strategies are untested as
therapeutic protocols and consequently there remains a long-felt
need for agents capable of effectively inhibiting PLK-1 function in
vivo.
[0009] Thus, there is a need for compositions and methods for
specifically modulating PLK-1 expression. The present invention
addresses these and other needs.
SUMMARY OF THE INVENTION
[0010] The present invention provides compositions comprising
interfering RNA (e.g., siRNA, aiRNA, miRNA) that target polo-like
kinase 1 (PLK-1) expression and methods of using such compositions
to silence PLK-1 expression. More particularly, the present
invention provides unmodified and chemically modified interfering
RNA molecules which silence PLK-1 expression and methods of use
thereof, e.g., for treating a cancer such as hepatocellular
carcinoma (HCC). The present invention also provides serum-stable
nucleic acid-lipid particles (e.g., SNALP) comprising an
interfering RNA molecule described herein, a cationic lipid, and a
non-cationic lipid, which can further comprise a conjugated lipid
that inhibits aggregation of particles. The present invention
further provides methods of silencing PLK-1 gene expression by
administering an interfering RNA molecule described herein to a
mammalian subject. The present invention additionally provides
methods of identifying and/or modifying PLK-1 interfering RNA
having immunostimulatory properties. Methods for sensitizing a cell
such as a cancer cell to the effects of a chemotherapy drug
comprising sequentially delivering PLK-1 interfering RNA followed
by the chemotherapy drug are also provided.
[0011] In one aspect, the present invention provides a modified
siRNA molecule comprising a double-stranded region of about 15 to
about 60 nucleotides in length (e.g., about 15-60, 15-50, 15-40,
15-30, 15-25, or 19-25 nucleotides in length, or 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, or 25 nucleotides in length), wherein the
modified siRNA molecule is capable of silencing PLK-1
expression.
[0012] Typically, the modified siRNA molecule comprises one, two,
three, four, five, six, seven, eight, nine, ten, or more modified
nucleotides in the double-stranded region. In some embodiments, the
modified siRNA comprises from about 1% to about 100% (e.g., about
1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 95%, or 100%) modified nucleotides in the
double-stranded region. In preferred embodiments, less than about
25% (e.g., less than about 25%, 20%, 15%, 10%, or 5%) or from about
1% to about 25% (e.g., from about 1%-25%, 5%-25%, 10%-25%, 15%-25%,
20%-25%, or 10%-20%) of the nucleotides in the double-stranded
region comprise modified nucleotides.
[0013] In some embodiments, the modified siRNA comprises modified
nucleotides including, but not limited to, 2'-O-methyl (2'OMe)
nucleotides, 2'-deoxy-T-fluoro (2'F) nucleotides, T-deoxy
nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, locked
nucleic acid (LNA) nucleotides, and mixtures thereof. In preferred
embodiments, the modified siRNA comprises 2'OMe nucleotides (e.g.,
2'OMe purine and/or pyrimidine nucleotides) such as, for example,
2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides,
2'OMe-adenosine nucleotides, 2'OMe-cytosine nucleotides, and
mixtures thereof. In certain instances, the modified siRNA does not
comprise 2'OMe-cytosine nucleotides. In other embodiments, the
modified siRNA comprises a hairpin loop structure.
[0014] The modified siRNA can comprise modified nucleotides in one
strand (i.e., sense or antisense) or both strands of the
double-stranded region of the siRNA molecule. Preferably, uridine
and/or guanosine nucleotides are modified at selective positions in
the double-stranded region of the siRNA duplex. With regard to
uridine nucleotide modifications, at least one, two, three, four,
five, six, or more of the uridine nucleotides in the sense and/or
antisense strand can be a modified uridine nucleotide such as a
2'OMe-uridine nucleotide. In some embodiments, every uridine
nucleotide in the sense and/or antisense strand is a 2'OMe-uridine
nucleotide. With regard to guanosine nucleotide modifications, at
least one, two, three, four, five, six, or more of the guanosine
nucleotides in the sense and/or antisense strand can be a modified
guanosine nucleotide such as a 2'OMe-guanosine nucleotide. In some
embodiments, every guanosine nucleotide in the sense and/or
antisense strand is a 2'OMe-guanosine nucleotide.
[0015] In some embodiments, the modified siRNA molecule is less
immunostimulatory than a corresponding unmodified siRNA sequence.
In certain embodiments, the modified siRNA is at least about 5%,
10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%
less immunostimulatory than the corresponding unmodified siRNA
sequence. In other embodiments, the modified siRNA is at least
about 70% (e.g., 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%,
96%, 97%, 98%, 99%, or 100%) less immunostimulatory than the
corresponding unmodified siRNA sequence. It will be readily
apparent to those of skill in the art that the immunostimulatory
properties of the modified siRNA molecule and the corresponding
unmodified siRNA molecule can be determined by, for example,
measuring INF-.alpha. and/or IL-6 levels about two to about twelve
hours after systemic administration in a mammal or transfection of
a mammalian responder cell using an appropriate lipid-based
delivery system (such as the SNALP delivery system or other
lipoplex systems disclosed herein).
[0016] In certain embodiments, the modified siRNA molecule has an
IC.sub.50 (i.e., half-maximal inhibitory concentration) less than
or equal to ten-fold that of the corresponding unmodified siRNA
(i.e., the modified siRNA has an IC.sub.50 that is less than or
equal to ten-times the IC.sub.50 of the corresponding unmodified
siRNA). In other embodiments, the modified siRNA has an IC.sub.50
less than or equal to three-fold that of the corresponding
unmodified siRNA sequence. In yet other embodiments, the modified
siRNA has an IC.sub.50 less than or equal to two-fold that of the
corresponding unmodified siRNA. It will be readily apparent to
those of skill in the art that a dose-response curve can be
generated and the IC.sub.50 values for the modified siRNA and the
corresponding unmodified siRNA can be readily determined using
methods known to those of skill in the art.
[0017] In yet another embodiments, the modified siRNA is capable of
silencing at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%,
45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of
the expression of the target sequence relative to the corresponding
unmodified siRNA sequence.
[0018] In some embodiments, the modified siRNA does not comprise
phosphate backbone modifications, e.g., in the sense and/or
antisense strand of the double-stranded region. In other
embodiments, the modified siRNA does not comprise 2'-deoxy
nucleotides, e.g., in the sense and/or antisense strand of the
double-stranded region. In certain instances, the nucleotide at the
3'-end of the double-stranded region in the sense and/or antisense
strand is not a modified nucleotide. In certain other instances,
the nucleotides near the 3'-end (e.g., within one, two, three, or
four nucleotides of the 3'-end) of the double-stranded region in
the sense and/or antisense strand are not modified nucleotides.
[0019] The modified siRNA molecules of the present invention may
have 3' overhangs of one, two, three, four, or more nucleotides on
one or both sides of the double-stranded region, or may lack
overhangs (i.e., have blunt ends) on one or both sides of the
double-stranded region. Preferably, the modified siRNA has 3'
overhangs of two nucleotides on each side of the double-stranded
region. In certain instances, the 3' overhang on the antisense
strand has complementarity to the target sequence and the 3'
overhang on the sense strand has complementarity to the
complementary strand of the target sequence. Alternatively, the 3'
overhangs do not have complementarity to the target sequence or the
complementary strand thereof. In some embodiments, the 3' overhangs
comprise one, two, three, four, or more nucleotides such as
2'-deoxy (2'H) nucleotides. In certain preferred embodiments, the
3' overhangs comprise deoxythymidine (dT) and/or uridine
nucleotides. In other embodiments, one or more of the nucleotides
in the 3' overhangs on one or both sides of the double-stranded
region comprise modified nucleotides. Non-limiting examples of
modified nucleotides are described above and include 2'OMe
nucleotides, 2'-deoxy-2'F nucleotides, 2'-deoxy nucleotides,
2'-O-2-MOE nucleotides, LNA nucleotides, and mixtures thereof. In
preferred embodiments, one, two, three, four, or more nucleotides
in the 3' overhangs present on the sense and/or antisense strand of
the siRNA comprise 2'OMe nucleotides (e.g., 2'OMe purine and/or
pyrimidine nucleotides) such as, for example, 2'OMe-guanosine
nucleotides, 2'OMe-uridine nucleotides, 2'OMe-adenosine
nucleotides, 2'OMe-cytosine nucleotides, and mixtures thereof.
[0020] The siRNA molecules of the present invention may comprise at
least one or a cocktail (e.g., at least two, three, four, five,
six, seven, eight, nine, ten, or more) of modified siRNA sequences
that silence PLK-1 expression. In certain instances, one or more of
the modified siRNA described herein are present in a cocktail with
one or more (e.g., at least two, three, four, five, six, seven,
eight, nine, ten, or more) unmodified siRNA sequences that silence
PLK-1 expression. In some embodiments, the modified siRNA molecule
comprises a chemically modified (e.g., 2'OMe-modified) version of
at least one or a cocktail of the unmodified sequences set forth in
Tables 1-7. In other embodiments, the modified siRNA molecule
comprises at least one or a cocktail of the modified sequences set
forth in Tables 3, 6, and 10-11. Preferably, the modified siRNA
molecule is selected from the group consisting of PLK1424 2/6,
PLK1424 U4/GU, PLK1424 U4/G, PLK773 G/GU, PLK1425 3/5, and a
mixture thereof.
[0021] In some embodiments, the corresponding unmodified siRNA
sequence comprises at least one, two, three, four, five, six,
seven, or more 5'-GU-3' motifs. The 5'-GU-3' motif can be in the
sense strand, the antisense strand, or both strands of the
unmodified siRNA sequence. The 5'-GU-3' motifs may be adjacent to
each other or, alternatively, they may be separated by 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, or more nucleotides.
[0022] In certain embodiments, the modified siRNA further comprises
a carrier system, e.g., to deliver the modified siRNA into a cell
of a mammal. Examples of carrier systems suitable for use in the
present invention include, but are not limited to, nucleic
acid-lipid particles, liposomes, micelles, virosomes, nucleic acid
complexes, and mixtures thereof. In certain instances, the siRNA is
complexed with a lipid such as a cationic lipid to form a lipoplex.
In certain other instances, the modified siRNA is complexed with a
polymer such as a cationic polymer (e.g., polyethylenimine (PEI))
to form a polyplex. The modified siRNA may also be complexed with
cyclodextrin or a polymer thereof. Preferably, the modified siRNA
is encapsulated in a nucleic acid-lipid particle.
[0023] The present invention also provides a pharmaceutical
composition comprising a modified siRNA molecule described herein
and a pharmaceutically acceptable carrier.
[0024] In another aspect, the present invention provides a nucleic
acid-lipid particle that targets PLK-1 expression. The nucleic
acid-lipid particle comprises a modified siRNA molecule that
silences PLK-1 expression, a cationic lipid, and a non-cationic
lipid. In certain instances, the nucleic acid-lipid particle
further comprises a conjugated lipid that inhibits aggregation of
particles. Preferably, the nucleic acid-lipid particle comprises a
modified siRNA molecule that silences PLK-1 expression, a cationic
lipid, a non-cationic lipid, and a conjugated lipid that inhibits
aggregation of particles.
[0025] The cationic lipid may be, e.g.,
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA),
1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
N,N-dioleyl-N,N-dimethylammonium chloride (DODAC),
dioctadecyldimethylammonium (DODMA), distearyldimethylammonium
(DSDMA), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium
chloride (DOTMA), N,N-distearyl-N,N-dimethylammonium bromide
(DDAB), N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium
chloride (DOTAP),
3-(N--(N',N'-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol),
N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium
bromide (DMRIE),
2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanamin-
iumtrifluoroacetate (DOSPA), dioctadecylamidoglycyl spermine
(DOGS),
3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-oc-
tadecadienoxy)propane (CLinDMA),
2-[5'-(cholest-5-en-3-beta-oxy)-3'-oxapentoxy)-3-dimethy-1-(cis,cis-9',1--
2'-octadecadienoxy)propane (CpLinDMA),
N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA),
1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP),
2,3-Dilinoleoyloxy-N,N-dimethylpropylamine (DLinDAP),
1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP),
1,2-Dilinoleoylcarbamyl-3-dimethylaminopropane (DLinCDAP),
2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA),
2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane
(DLin-K-XTC2-DMA), or mixtures thereof. Cationic lipids such as
CLinDMA, as well as additional cationic lipids, are described in
U.S. Patent Publication No. 20060240554. Cationic lipids such as
DLin-K-DMA, as well as additional cationic lipids, are described in
U.S. Provisional Application No. 61/018,627, filed Jan. 2, 2008,
U.S. Provisional Application No. 61/049,568, filed May 1, 2008, and
U.S. Provisional Application No. 61/104,219, filed Oct. 9, 2008.
Cationic lipids such as DLin-K-XTC2-DMA, as well as additional
cationic lipids, are described in U.S. Provisional Application No.
61/104,212, filed Oct. 9, 2008. The cationic lipid may comprise
from about 2 mol % to about 60 mol %, about 5 mol % to about 45 mol
%, about 5 mol % to about 15 mol %, about 20 mol % to about 50 mol
%, about 30 mol % to about 50 mol %, about 40 mol % to about 50 mol
%, or about 40 mol % of the total lipid present in the
particle.
[0026] The non-cationic lipid may be an anionic lipid or a neutral
lipid including, but not limited to, distearoylphosphatidylcholine
(DSPC), dipalmitoylphosphatidylcholine (DPPC),
dioleoylphosphatidylethanolamine (DOPE),
palmitoyloleoyl-phosphatidylcholine (POPC),
palmitoyloleoyl-phosphatidylethanolamine (POPE),
palmitoyloleyol-phosphatidylglycerol (POPG),
dipalmitoyl-phosphatidylethanolamine (DPPE),
dimyristoyl-phosphatidylethanolamine (DMPE),
distearoyl-phosphatidylethanolamine (DSPE),
monomethyl-phosphatidylethanolamine,
dimethyl-phosphatidylethanolamine,
dielaidoyl-phosphatidylethanolamine (DEPE),
stearoyloleoyl-phosphatidylethanolamine (SOPE), egg
phosphatidylcholine (EPC), cholesterol, or mixtures thereof. The
non-cationic lipid may comprise from about 5 mol % to about 90 mol
%, about 10 mol % to about 85 mol %, about 20 mol % to about 85 mol
%, about 10 mol % (e.g., phospholipid such as DSPC or DPPC only),
or about 60 mol % (e.g., about 10 mol % of a phospholipid such as
DSPC or DPPC and about 48 mol % cholesterol) of the total lipid
present in the particle.
[0027] The conjugated lipid that inhibits aggregation of particles
may be a polyethyleneglycol (PEG)-lipid conjugate, a polyamide
(ATTA)-lipid conjugate, a cationic-polymer-lipid conjugates (CPLs),
or mixtures thereof. In one preferred embodiment, the nucleic
acid-lipid particles comprise either a PEG-lipid conjugate or an
ATTA-lipid conjugate. In certain embodiments, the PEG-lipid
conjugate or ATTA-lipid conjugate is used together with a CPL. The
conjugated lipid that inhibits aggregation of particles may
comprise a polyethyleneglycol-lipid including, e.g., a
PEG-diacylglycerol (DAG), a PEG dialkyloxypropyl (DAA), a
PEG-phospholipid, a PEG-ceramide (Cer), or mixtures thereof. The
PEG-DAA conjugate may be PEG-dilauryloxypropyl (C12), a
PEG-dimyristyloxypropyl (C14), a PEG-dipalmityloxypropyl (C16), and
a PEG-distearyloxypropyl (C18). Additional PEG-lipid conjugates
suitable for use in the present invention include, but are not
limited to, PEG-C-DOMG, described in U.S. Provisional Application
No. 61/039,748, filed Mar. 26, 2008, and
1-[8'-(1,2-Dimyristoyl-3-propanoxy)-carboxamido-3',6'-dioxaoctanyl]carbam-
oyl-.omega.-methyl-poly(ethylene glycol) (2KPEG-DMG), described in
U.S. Pat. No. 7,404,969. In some embodiments, the conjugated lipid
that inhibits aggregation of particles is a CPL that has the
formula: A-W--Y, wherein A is a lipid moiety, W is a hydrophilic
polymer, and Y is a polycationic moiety. W may be a polymer
selected from the group consisting of polyethyleneglycol (PEG),
polyamide, polylactic acid, polyglycolic acid, polylactic
scid/polyglycolic acid copolymers, or combinations thereof, the
polymer having a molecular weight of from about 250 to about 7000
daltons. In some embodiments, Y has at least 4 positive charges at
a selected pH. In some embodiments, Y may be lysine, arginine,
asparagine, glutamine, derivatives thereof, or combinations
thereof. The conjugated lipid that prevents aggregation of
particles may be from 0 mol % to about 20 mol %, about 0.5 mol % to
about 20 mol %, about 1 mol % to about 15 mol %, about 4 mol % to
about 10 mol %, or about 2 mol % of the total lipid present in the
particle.
[0028] In some embodiments, the nucleic acid-lipid particle further
comprises cholesterol or a derivative thereof. Examples of suitable
cholesterol derivatives include, but are not limited to,
cholestanol, cholestanone, cholestenone, coprostanol,
cholesteryl-2'-hydroxyethyl ether, and cholesteryl-4'-hydroxybutyl
ether. The cholesterol or cholesterol derivative may be from 0 mol
% to about 10 mol %, about 2 mol % to about 10 mol %, about 10 mol
% to about 60 mol %, about 20 mol % to about 45 mol %, about 30 mol
% to about 50 mol %, or about 48 mol % of the total lipid present
in the particle.
[0029] In one specific embodiment of the invention, the nucleic
acid-lipid particle comprises 40 mol % DLinDMA, 10 mol % DSPC, 2
mol % PEG-cDMA, and 48 mol % cholesterol.
[0030] In other embodiments of the invention, the nucleic
acid-lipid particle comprises: (a) one or more unmodified and/or
modified siRNA that silence PLK-1 expression; (b) a cationic lipid
comprising from about 50 mol % to about 85 mol % of the total lipid
present in the particle; (c) a non-cationic lipid comprising from
about 13 mol % to about 49.5 mol % of the total lipid present in
the particle; and (d) a conjugated lipid that inhibits aggregation
of particles comprising from about 0.5 mol % to about 2 mol % of
the total lipid present in the particle. In a preferred embodiment,
the siRNA is fully encapsulated within the lipid of the nucleic
acid-lipid particle such that the siRNA in the nucleic acid-lipid
particle is resistant in aqueous solution to degradation by a
nuclease. In a preferred embodiment, the nucleic acid-lipid
particle is substantially non-toxic to mammals.
[0031] In these SNALP embodiments, the nucleic acid-lipid particle
may comprise one or more of the cationic lipids described above. In
a preferred embodiment, the cationic lipid is DLinDMA. The cationic
lipid typically comprises from about 50 mol % to about 85 mol %,
about 50 mol % to about 80 mol %, about 50 mol % to about 75 mol %,
about 50 mol % to about 65 mol %, or about 55 mol % to about 65 mol
% of the total lipid present in the particle.
[0032] The non-cationic lipid in these SNALP embodiments may be an
anionic lipid or a neutral lipid. In one embodiment, the
non-cationic lipid comprises cholesterol or a derivative thereof.
In this embodiment, the cholesterol or cholesterol derivative
comprises from about 30 mol % to about 40 mol % of the total lipid
present in the particle. In another embodiment, the non-cationic
lipid comprises a phospholipid. In yet another embodiment, the
non-cationic lipid comprises a mixture of a phospholipid and
cholesterol or a cholesterol derivative.
[0033] Phospholipids suitable for use in these SNALP embodiments
include, but are not limited to, DPPC, DSPC, DOPE, POPC, POPE,
POPG, DPPE, DMPE, DSPE, monomethyl-phosphatidylethanolamine,
dimethyl-phosphatidylethanolamine, DEPE, SOPE, EPC, and a mixture
thereof. When the non-cationic lipid is a mixture of a phospholipid
and cholesterol or a cholesterol derivative, the phospholipid
comprises from about 4 mol % to about 10 mol % of the total lipid
present in the particle, and the cholesterol or cholesterol
derivative comprises from about 30 mol % to about 40 mol % of the
total lipid present in the particle. If a cholesterol derivative is
used, the cholesterol derivative includes, but is not limited to,
cholestanol, cholestanone, cholestenone, coprostanol,
cholesteryl-2'-hydroxyethyl ether, and cholesteryl-4'-hydroxybutyl
ether. In a preferred embodiment, the phospholipid comprises
DPPC.
[0034] The SNALPs of these embodiments also comprise a conjugated
lipid that inhibits aggregation of the particles. Examples of
suitable conjugated lipids include, but are not limited to, a
PEG-lipid conjugate, a polyamide (ATTA)-lipid conjugate, a
cationic-polymer-lipid conjugates (CPLs), or mixtures thereof. In
one preferred embodiment, the nucleic acid-lipid particles comprise
either a PEG-lipid conjugate or an ATTA-lipid conjugate. In certain
embodiments, the PEG-lipid conjugate or ATTA-lipid conjugate is
used together with a CPL. In a preferred embodiment, the conjugated
lipid is a PEG-lipid.
[0035] Examples of suitable PEG-lipids include, but are not limited
to, a PEG-DAG, a PEG-DAA, a PEG-phospholipid, a PEG-ceramide (Cer),
or mixtures thereof. In a preferred embodiment, the PEG-lipid is a
PEG-DAA conjugate. Examples of suitable PEG-DAA conjugates include,
but are not limited to, a PEG-dilauryloxypropyl (C12), a
PEG-dimyristyloxypropyl (C14), a PEG-dipalmityloxypropyl (C16), and
a PEG-distearyloxypropyl (C18). In a preferred embodiment, the
PEG-DAA conjugate is PEG-dimyristyloxypropyl (C14). In another
preferred embodiment, the PEG-DAA conjugate is
PEG-distearyloxypropyl (C18). Additional PEG-lipid conjugates
include, without limitation, PEG-C-DOMG, 2KPEG-DMG, and a mixture
thereof. The conjugated lipid typically comprises about 0.5 mol %
to about 2 mol % of the total lipid present in the particle.
[0036] Typically, the SNALPs of these embodiments have a
lipid:nucleic acid ratio of about 1 to about 100. In a preferred
embodiment, these SNALPs have a lipid:nucleic acid ratio of about 5
to about 15. In another preferred embodiment, these SNALPs have a
lipid:nucleic acid ratio of about 6. Typically, these SNALPs have a
mean diameter of from about 50 nm to about 150 nm. In a preferred
embodiment, these SNALPs have a mean diameter of from about 70 nm
to about 90 nm.
[0037] In one specific embodiment of the invention, the SNALP
comprises: (a) one or more unmodified and/or modified siRNA that
silence PLK-1 expression; (b) a cationic lipid comprising from
about 56.5 mol % to about 66.5 mol % of the total lipid present in
the particle; (c) a non-cationic lipid comprising from about 31.5
mol % to about 42.5 mol % of the total lipid present in the
particle; and (d) a conjugated lipid that inhibits aggregation of
particles comprising from about 1 mol % to about 2 mol % of the
total lipid present in the particle. This embodiment of SNALP is
generally referred to herein as the "1:62" formulation. In a
preferred embodiment, the cationic lipid is DLinDMA, the
non-cationic lipid is cholesterol and the conjugated lipid is a
PEG-DAA conjugate. Although these are preferred embodiments of the
1:62 formulation, those of skill in the art will appreciate that
other cationic lipids, non-cationic lipids, including other
cholesterol derivatives, and conjugated lipids can be used in the
1:62 formulation as described herein.
[0038] In another specific embodiment of the invention, the SNALP
comprises: (a) one or more unmodified and/or modified siRNA that
silence PLK-1 expression; (b) a cationic lipid comprising from
about 52 mol % to about 62 mol % of the total lipid present in the
particle; (c) a non-cationic lipid comprising from about 36 mol %
to about 47 mol % of the total lipid present in the particle; and
(d) a conjugated lipid that inhibits aggregation of particles
comprising from about 1 mol % to about 2 mol % of the total lipid
present in the particle. This embodiment of SNALP is generally
referred to herein as the "1:57" formulation. In a preferred
embodiment, the cationic lipid is DLinDMA, the non-cationic lipid
is a mixture of a phospholipid (such as DPPC) and cholesterol,
wherein the phospholipid comprises about 5 mol % to about 9 mol %
of the total lipid present in the particle, and the cholesterol (or
cholesterol derivative) comprises about 32 mol % to about 37 mol %
of the total lipid present in the particle, and the PEG-lipid is
PEG-DAA. Although these are preferred embodiments of the 1:57
formulation, those of skill in the art will appreciate that other
cationic lipids, non-cationic lipids (including other phospholipids
and other cholesterol derivatives) and conjugated lipids can be
used in the 1:57 formulation as described herein.
[0039] In some embodiments, the nucleic acid-lipid particles
comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more unmodified or
modified siRNA molecules comprising or consisting of the sequences
set forth in Tables 1-7 and 10-11. In other embodiments, the
nucleic acid-lipid particles comprise modified siRNA molecules
selected from the group consisting of PLK1424 U4/GU, PLK1424 U4/G,
PLK773 G/GU, PLK1425 3/5, and mixtures thereof.
[0040] The nucleic acid-lipid particles of the invention are useful
for the therapeutic delivery of siRNA molecules that silence PLK-1
expression. In one embodiment, a modified siRNA molecule described
herein is formulated into nucleic acid-lipid particles, and the
particles are administered to a mammal (e.g., a rodent such as a
mouse or a primate such as a human, chimpanzee, or monkey)
requiring such treatment. In certain instances, a therapeutically
effective amount of the nucleic acid-lipid particle can be
administered to the mammal, e.g., for treating a cancer such as
hepatocellular carcinoma (HCC). Administration of the nucleic
acid-lipid particle can be by any route known in the art, such as,
e.g., oral, intranasal, intravenous, intraperitoneal,
intramuscular, intra-articular, intralesional, intratracheal,
subcutaneous, or intradermal.
[0041] In certain embodiments, the siRNA molecule in the nucleic
acid-lipid particle is not substantially degraded after exposure of
the particle to a nuclease at 37.degree. C. for at least 20, 30,
45, or 60 minutes, or after incubation of the particle in serum at
37.degree. C. for at least 30, 45, or 60 minutes or at least 2, 3,
4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32,
34, or 36 hours.
[0042] In some embodiments, the siRNA molecule is fully
encapsulated in the nucleic acid-lipid particle. In other
embodiments, the siRNA molecule is complexed with the lipid portion
of the particle.
[0043] The present invention further provides pharmaceutical
compositions comprising the nucleic acid-lipid particles described
herein and a pharmaceutically acceptable carrier.
[0044] In yet another aspect, the siRNA molecules described herein
are used in methods for silencing PLK-1 expression. In particular,
it is an object of the present invention to provide in vitro and in
vivo methods for the treatment of a disease or disorder in a mammal
by downregulating or silencing the transcription and/or translation
of a PLK-1 gene. In one embodiment, the present invention provides
a method for introducing an siRNA that silences expression (e.g.,
mRNA and/or protein levels) of a PLK-1 gene into a cell by
contacting the cell with an siRNA molecule described herein. In
another embodiment, the present invention provides a method for in
vivo delivery of an siRNA molecule that silences expression of a
PLK-1 gene by administering to a mammal an siRNA molecule described
herein. Administration of the siRNA molecule can be by any route
known in the art, such as, e.g., oral, intranasal, intravenous,
intraperitoneal, intramuscular, intra-articular, intralesional,
intratracheal, subcutaneous, or intradermal.
[0045] In these methods, the siRNA molecule that silences PLK-1
expression is typically formulated with a carrier system, and the
carrier system comprising the siRNA molecule is administered to a
mammal requiring such treatment. Alternatively, cells are removed
from a mammal such as a human, the siRNA is delivered in vitro
using a carrier system, and the cells are then administered to the
mammal, such as by injection. Examples of carrier systems suitable
for use in the present invention include, but are not limited to,
nucleic acid-lipid particles, liposomes, micelles, virosomes,
nucleic acid complexes (e.g., lipoplexes, polyplexes, etc.), and
mixtures thereof. The carrier system may comprise at least one or a
cocktail (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) of
siRNA molecules that silence PLK-1 expression. In certain
embodiments, the carrier system comprises at least one or a
cocktail of the sequences set forth in Tables 1-7 and 10-11.
[0046] In some embodiments, the siRNA molecule that silences PLK-1
expression is in a nucleic acid-lipid particle comprising the siRNA
molecule, a cationic lipid, and a non-cationic lipid. Preferably,
the siRNA molecule is in a nucleic acid-lipid particle comprising
the siRNA molecule, a cationic lipid, a non-cationic lipid, and a
conjugated lipid that inhibits aggregation of particles. A
therapeutically effective amount of the nucleic acid-lipid particle
can be administered to a mammal (e.g., a rodent such as a mouse or
a primate such as a human, chimpanzee, or monkey).
[0047] In some embodiments, the mammal has a cell proliferative
disorder. In certain aspects of this embodiment, the mammal has a
cell proliferative disorder selected from the group consisting of
neoplasia (e.g., cancer), hyperplasia, restenosis, cardiac
hypertrophy, immune disorders, and inflammation. Preferably, the
cell proliferative disorder is a neoplastic disorder such as
cancer. In some embodiments, the cancer includes, but is not
limited to, hepatocellular carcinoma (HCC), papilloma,
blastoglioma, Kaposi's sarcoma, melanoma, lung cancer, ovarian
cancer, prostate cancer, squamous cell carcinoma, astrocytoma, head
cancer, neck cancer, bladder cancer, breast cancer, lung cancer,
colorectal cancer, thyroid cancer, pancreatic cancer, gastric
cancer, leukemia, lymphoma, Hodgkin's disease, osteosarcoma,
testicular cancer, and Burkitt's disease.
[0048] In one embodiment, at least about 1%, 2%, 4%, 6%, 8%, 10%,
12%. 14%, 16%, 18%, or 20% of the total injected dose of the
nucleic acid-lipid particles is present in plasma at about 1, 2, 4,
6, 8, 12, 16, 18, or 24 hours after injection. In other
embodiments, more than about 20%, 30%, 40%, or as much as about
60%, 70%, or 80% of the total injected dose of the nucleic
acid-lipid particles is present in plasma at about 1, 4, 6, 8, 10,
12, 20, or 24 hours after injection. In another embodiment, the
effect of the siRNA molecule (e.g., downregulation of the target
PLK-1 sequence) at a site proximal or distal to the site of
administration is detectable at about 12, 24, 48, 72, or 96 hours,
or at about 6, 8, 10, 12, 14, 16, 18, 19, 20, 22, 24, 26, or 28
days after administration of the nucleic acid-lipid particles. In a
further embodiment, downregulation of expression of the target
PLK-1 sequence is detectable at about 12, 24, 48, 72, or 96 hours,
or at about 6, 8, 10, 12, 14, 16, 18, 19, 20, 22, 24, 26, or 28
days after administration. In some embodiments, downregulation of a
PLK-1 gene is determined by detecting mRNA or protein levels in a
biological sample from the mammal. In other embodiments,
downregulation of expression of a PLK-1 sequence is detected by
measuring cell viability or the induction of apoptosis of cells in
a biological sample from the mammal.
[0049] The nucleic acid-lipid particles are suitable for use in
intravenous nucleic acid delivery as they are stable in
circulation, of a size required for pharmacodynamic behavior
resulting in access to extravascular sites, and target cell
populations. The present invention also provides pharmaceutically
acceptable compositions comprising nucleic acid-lipid
particles.
[0050] In a further aspect, the siRNA molecules described herein
are used in methods for sensitizing a cell to the effects of a
chemotherapy drug. In particular, it is an object of the present
invention to provide in vitro and in vivo methods for the treatment
of a cell proliferative disorder in a mammal by downregulating or
silencing the transcription and/or translation of a PLK-1 gene in
combination with administration of a chemotherapy drug. As
described in detail herein, a mammal such as a human can be treated
with a suitable dose of one or more unmodified or modified siRNA
molecules (e.g., formulated in nucleic acid-lipid particles)
before, during, and/or after chemotherapy drug administration. In
preferred embodiments, a cell such as a cancer cell in a mammal
such as a human is contacted with an siRNA that silences PLK-1
expression prior to administering the chemotherapy drug.
[0051] In an additional aspect, the present invention provides
compositions comprising the asymmetrical interfering RNA (aiRNA)
molecules described herein that target PLK-1 expression and methods
of using such compositions to silence PLK-1 expression.
[0052] In a related aspect, the present invention provides
compositions comprising the microRNA (miRNA) molecules described
herein that target PLK-1 expression and methods of using such
compositions to silence PLK-1 expression.
[0053] Other objects, features, and advantages of the present
invention will be apparent to one of skill in the art from the
following detailed description and figures.
BRIEF DESCRIPTION OF THE DRAWINGS
[0054] FIG. 1 illustrates data demonstrating the RNAi activity of
selected SNALP-formulated PLK-1 siRNA sequences in HT29 and Neuro2A
cells.
[0055] FIG. 2 illustrates data demonstrating that the potent
effects of PLK-1 SNALP on cell viability is due to the silencing of
PLK-1 mRNA.
[0056] FIG. 3 illustrates data demonstrating the RNAi activity of
additional SNALP-formulated PLK-1 siRNA sequences in HT29 and
Neuro2A cells.
[0057] FIG. 4 illustrates data demonstrating the activity of
SNALP-formulated PLK1424 and PLK773 in HT29 and LS174T cells.
[0058] FIG. 5 illustrates data demonstrating that SNALP-formulated
PLK1424 and PLK773 induce apoptosis in LS174T cells.
[0059] FIG. 6 illustrates data demonstrating the RNAi activity of
additional SNALP-formulated PLK-1 siRNA sequences in HT29 and
Neuro2A cells.
[0060] FIG. 7 illustrates data demonstrating that different 2'OMe
modification patterns in the PLK1424 siRNA sequence were well
tolerated and the modified siRNA molecules retained potent
activity.
[0061] FIG. 8 illustrates data demonstrating that 2'OMe-modified
PLK1424 siRNAs induced no detectable IL-6 or IFN-.alpha. response
in murine FLT3L DC cultures.
[0062] FIG. 9 illustrates data demonstrating that different 2'OMe
modification patterns in the PLK773 siRNA sequence were well
tolerated and the modified siRNA molecules retained potent
activity.
[0063] FIG. 10 illustrates data demonstrating that different 2'OMe
modification patterns in the PLK1425 siRNA sequence were well
tolerated and the modified siRNA molecules retained potent
activity.
[0064] FIG. 11 illustrates data demonstrating that sequential
combination treatment with PLK-1 SNALP and paclitaxel (taxol)
significantly enhanced the inhibition of Neuro2A and HepG2 cell
growth.
[0065] FIG. 12 illustrates data demonstrating that sequential
combination treatment with PLK-1 SNALP and paclitaxel (taxol)
significantly enhanced the level of apoptosis induced in Neuro2A
cells.
[0066] FIG. 13 illustrates data demonstrating that a treatment
regimen of SNALP-formulated PLK1424 is well tolerated with no
apparent signs of treatment related toxicity in mice bearing Hep3B
liver tumors.
[0067] FIG. 14 illustrates data demonstrating that treatment with
SNALP-formulated PLK1424 caused a significant increase in the
survival of Hep3B tumor-bearing mice.
[0068] FIG. 15 illustrates data demonstrating that treatment with
SNALP-formulated PLK1424 reduced PLK-1 mRNA levels by 50% in
intrahepatic Hep3B tumors growing in mice 24 hours after SNALP
administration.
[0069] FIG. 16 illustrates data demonstrating that a specific
cleavage product of PLK-1 mRNA was detectable in mice treated with
PLK1424 SNALP by 5' RACE-PCR. 10 .mu.l PCR product/well were loaded
onto a 1.5% agarose gel. Lane Nos.: (1) molecular weight (MW)
marker; (2) PBS mouse 1; (3) PBS mouse 2; (4) PBS mouse 3; (5) Luc
SNALP mouse 1; (6) Luc SNALP mouse 2; (7) PLK SNALP mouse 1; (8)
PLK SNALP mouse 2; (9) PLK SNALP mouse 3; and (10) no template
control.
[0070] FIG. 17 illustrates data demonstrating that control (Luc)
SNALP-treated mice displayed normal mitoses in Hep3B tumors (top
panels), whereas PLK1424 SNALP-treated mice exhibited numerous
aberrant mitoses and tumor cell apoptosis in Hep3B tumors (bottom
panels).
[0071] FIG. 18 illustrates data demonstrating that multiple doses
of 1:57 PLK-1 SNALP containing PEG-cDSA induced the regression of
established Hep3B subcutaneous (S.C.) tumors.
[0072] FIG. 19 illustrates data demonstrating mRNA silencing of
1:57 PLK SNALP in S.C. Hep3B tumors following a single intravenous
SNALP administration.
[0073] FIG. 20 illustrates data demonstrating that PLK1-cDSA SNALP
inhibited the growth of large S.C. Hep3B tumors.
[0074] FIG. 21 illustrates data demonstrating tumor-derived PLK-1
mRNA silencing in Hep3B intrahepatic tumors.
[0075] FIG. 22 illustrates data demonstrating the blood clearance
profile of 1:57 PLK-1 SNALP containing either PEG-cDMA or
PEG-cDSA.
[0076] FIG. 23 illustrates data demonstrating an in vitro activity
screen of PLK-1 siRNA sequences. Activity of native PLK-1 siRNA
sequences targeting human PLK-1 mRNA were assessed in the HT29 cell
viability assay. Cells were treated with SNALP formulated PLK-1 or
Luc siRNA at 1 nM (white bar), 5 nM (grey bar), and 25 nM (black
bar). Cell viability was assessed at 72 h using CellTiter Blue
resazurin dye. Two rounds of siRNA design (A & B, C) were
conducted. Sequence numbers represent the siRNA target site in the
hPLK-1 mRNA open reading frame (Genbank Accession No.
NM_005030).
[0077] FIG. 24 illustrates data demonstrating the activity of PLK-1
siRNAs in vitro. Correlation between mRNA silencing and HT29 cell
viability for (A) PLK1424, (B) PLK773, or (C) Luc siRNA treatments.
PLK-1 mRNA was determined by bDNA analysis at 24 h. Duplicate
plates were assessed for cell viability at 72 h. (D) PLK1424 siRNA
causes dose dependent reductions in viability of LS 174T, HT29,
Hep3B, and HepG2 cell cultures. Cells were treated for 72 h with
PLK1424 SNALP at 5 (black bar), 2.5, 1.25, 0.63, and 0.31 (white
bar) nM siRNA. Values in (A)-(D) are expressed as % viability or
PLK-1 mRNA relative to PBS control and reflect mean of 3 separate
experiments (+/-SD) conducted in triplicate cultures. (E) Decreased
cell viability is associated with the induction of apoptosis.
Caspase 3/7 activity in LS 174T cells was assessed 24 h and 48 h
after treatment with SNALP encapsulated PLK773, PLK1424, or Luc
control siRNA. Data represents fold induction over PBS in
triplicate cultures (mean+/-SD triplicate cultures).
[0078] FIG. 25 illustrates data demonstrating the in vivo
characterization of the interferon response induced by
SNALP-formulated siRNA. (a) Time course for the induction of serum
IFN.alpha. and liver IFIT1 mRNA after i.v. administration of SNALP
formulated native (unmodified) ApoB1 siRNA. Balb/c mice (n=4 per
group) were administered 2.5 mg/kg siRNA or lipid vehicle; serum
IFN.alpha. (pg/mL) and IFIT1 mRNA (relative to GAPDH) from whole
liver lysates were assessed after 4, 8, and 16 h by ELISA and bDNA
assay, respectively. (b,c) Measurement of IFIT1 mRNA induction in
target tissues can resolve residual immunostimulatory activity
within siRNAs. Mice were treated with the native ApoB-1 siRNA or
ApoB-1 siRNAs containing selective 2'OMe nucleotides in either the
sense (S) strand or both strands (S+AS). (b) Serum IFN.alpha. and
(c) liver IFIT1 mRNA were assessed 4 h after administration
(mean+SD, n=4). Residual immunostimulatory activity in the absence
of systemic cytokine induction was evident by IFIT1 mRNA induction
in ApoB-1 2'OMe(S) treated mice. This response was fully abrogated
by the incorporation of additional 2'OMe nucleotides into the AS
strand of the siRNA duplex. All siRNAs retained full RNAi
activity.
[0079] FIG. 26 illustrates data demonstrating the in vitro activity
of unmodified versus 2'OMe-modified PLK-1 and KSP siRNA. Activity
of the 2'OMe-modified panels of (A) PLK1424 and (B) PLK773 siRNA.
Unmodified PLK1424 or PLK773 siRNA (black) were compared in the
Hep3B cell viability assay to the 2'OMe modified duplexes 1/A, 2/A,
1/B, 2/B, 1/C, or 2/C that comprise the respective 2'OMe
sense/antisense oligonucleotides (see, Table 6). Data are mean
viability of triplicate cultures relative to PBS treated cells and
representative of 2 independent experiments using SNALP-formulated
siRNA. (C) Cytokine induction by unmodified and 2'OMe PLK-1 siRNA
in vitro. Murine Flt3L DC were treated with 5 .mu.g/mL unmodified
PLK773 or PLK1424 siRNA duplexes (773, 1424) and their constituent
sense (S) or antisense (AS) oligonucleotides or the 2'OMe siRNA
duplexes PLK773-1/B and PLK1424-2/A formulated in SNALP. IFN.alpha.
and IL-6 were assayed in culture supernates at 24 h. Values are
mean+SD of 3 separate experiments conducted in triplicate cultures.
(D,E) Activity of SNALP-formulated KSP2263 siRNA in murine Neuro2a
cells. (D) Correlation between KSP mRNA silencing and cell
viability relative to PBS control. KSP mRNA was determined by bDNA
analysis at 24 h. Duplicate plates were assessed for cell viability
at 72 h. (E) Activity screen comparing the unmodified KSP2263 siRNA
to the panel of 2'OMe-modified duplexes (see, Table 6) in the
Neuro2a cell viability assay. Data represents mean+/-SD triplicate
cultures, relative to PBS treatment.
[0080] FIG. 27 illustrates data demonstrating the detection of the
PLK1424-specific and KSP2263-specific mRNA cleavage products and by
5'RACE-PCR in vitro. (A) HT29 cells were treated with 10 nM
SNALP-formulated PLK1424, Luc siRNA or PBS. RNA was isolated 24
hours after transfection and assayed for the specific PLK-1 mRNA
cleavage product by 5'-RACE-PCR. (B) Neuro2a cells were treated
with SNALP-formulated KSP2263, PLK773 siRNA or PBS. RNA was
isolated 24 hours after transfection and assayed for the specific
mouse KSP mRNA cleavage product by 5'-RACE-PCR. The identity of the
RNAi-specific 476 bp PLK-1 mRNA and 102 bp KSP mRNA cleavage
products were confirmed by direct oligonucleotide sequencing.
[0081] FIG. 28 illustrates data demonstrating that 2'OMe-modified
PLK-1, KSP, or Luc siRNA induce no measurable IFN response in mice.
SNALP-formulated Luc (unmodified) and the 2'OMe-modified Luc-U/U,
PLK1424-2/A, PLK773-1/B, or KSP2263-U/U siRNA were administered at
2 mg/kg i.v. to Balb/C mice. (A) IFIT1 relative to GAPDH mRNA in
liver and spleen was assessed at 4 h by bDNA analysis. (B). Serum
IFN.alpha. was assessed at 6 h by ELISA. SNALP-formulated 2'OMe
siRNAs induced no detectable increase in either IFN.alpha. protein
or IFIT1 mRNA relative to PBS vehicle. Values represent mean+SD
(n=4).
[0082] FIG. 29 illustrates data demonstrating the therapeutic
activity of PLK-1 and KSP siRNA in hepatic tumors. PLK1424-2/A
treatment confers significant survival advantages in acid/beige
mice bearing hepatic Hep3B tumors. Mice were administered
SNALP-formulated PLK1424-2/A (n=15) or Luc-U/U (n=8) at 6.times.2
mg/kg, intravenous twice weekly (d 10 to d 28). (A) Body weights
(mean+SD) over the dosing period expressed as % of initial weight
on d 10. (B) Kaplan-Meier plot of days to euthanization due to
tumor burden. PLK1424-2/A treatment provided significant survival
advantage over control treatment. (p=0.03, Log-rank Mantel Cox
test). (C) Residual hepatic Hep3B tumor burden in mice 24 h after
final administration of PLK1424-2/A siRNA (5.times.2 mg/kg siRNA on
d 8, 11, 14, 18 & 21). Bars represent hGAPDH mRNA/mg liver of
individual mice (mean+/-SD of triplicate analyses) determined by
human-specific bDNA assay (No tumor=livers from non-tumor seeded
mice). See FIG. 32 for additional data. (D) KSP2263-U/U treatment
confers survival advantages in A/J mice bearing hepatic Neuro2a
tumors. Mice were administered SNALP-formulated KSP2263-U/U or
Luc-U/U (n=8) at 5.times.4 mg/kg, intravenous (q3d.times.5 from d 8
to d 21 after tumor seeding). A Kaplan-Meier plot of days to
euthanization due to tumor burden and endpoints are based on
clinical scores as a humane surrogate for survival. Mean SNALP
particle size and (polydispersity) were 83 (0.09), and 90 (0.12) nm
for PLK1424 and Luc formulations, respectively.
[0083] FIG. 30 illustrates data demonstrating that PLK1424 SNALP
confers significant survival advantages in the hepatic Hep3B-nu/nu
mouse model. Mice bearing established hepatic tumors were treated
with PLK1424-2/A or Luc-U/U SNALP (2 mg/kg twice weekly between d11
and d28 after tumor seeding) and monitored for tumor burden until
euthanasia defined by humane endpoints. Data represent 2
independent studies. Median survival of PLK1424 vs Luc in Study
(A)=d 45 and d 67, respectively; p=0.02. and study (B)=d 42 and
undefined, respectively, p=0.008, Log-rank Mantel Cox test. All
animals surviving beyond day 80 were found to be tumor free at
termination of the study on day 100.
[0084] FIG. 31 illustrates data demonstrating that PLK1424-2/A
SNALP significantly reduces macroscopic tumor burden after
completion of dosing. Results are from individual mice described in
FIG. 37C. Livers from (A) PBS control and (B) PLK1424-2/A SNALP
treated mice showing macroscopic tumor burden in the left lateral
hepatic lobe. (C) Body weights of individual mice shown in (A) and
(B) over the duration of the study from day 8-day 21 after tumor
seeding. Loss of body weight directly correlated with tumor burden
in individual mice.
[0085] FIG. 32 illustrates data demonstrating that PLK-1 SNALP is
well tolerated in mice. Groups of CD1 ICR mice were administered
PBS, PLK773-1/B, or Luc-U/U SNALP to assess potential cumulative
toxicities associated with either PLK-1 silencing or the lipid
vehicle. Mice were treated twice weekly at 2 mg/kg siRNA,
equivalent to the efficacious dosing regimen in tumor studies.
Clinical chemistry and complete blood counts were evaluated 24 h
after dose 5 (day 15) and dose 9 (day 29). siRNA treatment induced
no significant changes in (A) serum liver enzymes alanine
aminotransferase (ALT), aspartate aminotransferase (AST), or
sorbitol dehydrogenase (SDH); (B) Total wbc, lymphocyte or
neutrophil counts and (C) platelet counts at either 15 or 29 days
treatment duration. All values are mean+/-SD (n=6). No changes in
red blood cell parameters were observed.
[0086] FIG. 33 illustrates data demonstrating target mRNA silencing
in hepatic tumors by the RNAi mechanism. (A,B) Target mRNA
silencing and (C,D) detection of RNAi-specific mRNA cleavage
products in tumors following SNALP formulated siRNA administration.
Scid/beige mice with established intrahepatic Hep3B tumors were
administered a single 2 mg/kg dose of SNALP formulated PLK1424-2/A
or Luc-U/U siRNA and RNAi activity assessed by (A) PLK-1 mRNA in
tumor lysates and (C) 5' RACE-PCR analysis. (A) Tumor (human)
PLK-1:GAPDH mRNA ratios 24 h after siRNA administration (Mean+/-SD
of 4 animals). (C) RACE-PCR detects the specific 5' cleavage
product of PLK-1 mRNA from tumors analyzed in (A). Lanes represent
PCR products derived from individual PBS (n=2), Luc-U/U (n=2), and
PLK1424-2/A (n=3) treated mice. (B) mouse KSP mRNA and (D)
5'RACE-PCR analysis of resected hepatic Neuro2a tumors from mice
treated with SNALP formulated KSP2263-U/U siRNA. Data is presented
as in (A) and (C). +=positive control from in vitro Neuro2a cell
lysates treated with KSP2263-U/U siRNA; -=no template control.
RACE-PCR detects the specific 5' cleavage product of mouse KSP mRNA
from tumors. Identities of the predicted 476 bp PLK-1 and 102 bp
KSP PCR products (arrows) were confirmed by direct DNA sequencing.
Mean SNALP particle size and (polydispersity) were 83 (0.09), 90
(0.12), and 88 (0.07) nm for the PLK1424, Luc, and KSP2263
formulations, respectively.
[0087] FIG. 34 illustrates data demonstrating the duration of RNAi
activity within hepatic tumors. (A) 5'-RACE-PCR analysis of Hep3B
liver tumors 24 h, 48 h, 96 h, 7 d, & 10 d after a single
intravenous administration of SNALP-formulated PLK1424-2/A siRNA (2
mg/kg). Specificity of the PLK1424-specific RACE-PCR product
(arrowed) was confirmed by sequencing at d 1 and d 7. (B)
Corresponding levels of PLK-1 mRNA in isolated tumor RNA analyzed
in (A). Duration of RNAi correlated with duration of mRNA silencing
compared to Luc-U/U SNALP treated mice. Data in represent mean
hPLK-1:hGAPDH mRNA ratio+SD (n=3 at each time point). Mean SNALP
particle size and (polydispersity) were 83 (0.09) and 90 (0.12) nm
for PLK1424 and Luc, respectively.
[0088] FIG. 35 illustrates data demonstrating the induction of
monoastral spindle formation by KSP2263 siRNA. HeLa cells were
treated for 16 h with (A) Luc or (B) KSP2263 siRNA at 20 nM then
immunostained for .alpha.-tubulin (FITC). DNA was stained with DAPI
and fluorescent images captured and overlayed. Control cells show
normal bipolar spindles at metaphase compared to monoastral
spindles in KSP2263 treated cells.
[0089] FIG. 36 illustrates data demonstrating that KSP2263-U/U
induces distinct phenotypic changes typical of KSP inhibition in
hepatic tumor cells. Hepatic Neuro2a tumor histology 24 h after a
single intravenous administration of (A) Luc-U/U or (B) KSP2263-U/U
siRNA formulated in SNALP (2 mg/kg siRNA). Images are at 200.times.
magnification and representative of tumors from at least 6
individual mice. Hematoxylin and eosin (H&E) staining reveals
tumor cells with aberrant nuclear figures typical of monoastral
spindles or apoptotic phenotypes in KSP2263-U/U treated mice. (C)
Quantitative histology of H&E stained tumor tissues from mice
treated with SNALP-formulated KSP2263-U/U at 4, 2, 1, or 0.5 mg/kg
siRNA. Tumor cells with condensed chromatin structures were scored
positive and calculated as a % of total tumor cells taken from 10
fields of view. Positive cells included aberrant and typical
mitotic and apoptotic figures. Values are mean+SD of 3 mice. Mean
SNALP particle size and (polydispersity) were 88 (0.07) and 82
(0.08) nm for KSP2263 and Luc, respectively.
[0090] FIG. 37 illustrates data demonstrating that PLK1424-2A
induces distinct phenotypic changes typical of PLK-1 inhibition in
hepatic tumor cells. H&E tumor histology 24 h after single
intravenous administration of 2 mg/kg SNALP formulated (A,C)
Luc-U/U or (B,D) PLK1424-2/A siRNA. Images at (A,B) 200.times. and
(C,D) 400.times. magnification are representative of tumors from at
least 7 individual mice. Mean SNALP particle size and
(polydispersity) were 72 (0.04) and 72 (0.02) nm for PLK1424 and
Luc, respectively.
[0091] FIG. 38 illustrates data demonstrating a comparison of
PLK1424 SNALP comprising either PEG-cDMA or PEG-cDSA in the hepatic
tumor model. (A) Blood clearance of .sup.3H-labelled SNALP
(according to Judge et al., Mol. Ther., 13:328-337 (2006))
comprising either PEG-cDMA or PEG-cDSA following IV administration
in mice. Data are expressed as mean % injected dose (+/-SD, n=4)
remaining in whole blood at 0.25, 0.5, 1, 2, 4, and 8 h after
injection. (B) PLK-1 mRNA silencing in hepatic Hep3B tumors 24 h
after single 2 mg/kg administration of either PLK1424-2/A SNALP
formulations (mean PLK1:GAPDH ratio+/-SD, n=4 mice). (C) Treatment
with PLK1424-2/A SNALP comprising either PEG-cDMA or PEG-cDSA
confers significant survival advantages in scid/beige mice bearing
intrahepatic Hep3B tumors. Mice were administered PLK1424-2/A SNALP
comprising PEG cDMA or PEG-cDSA or Luc-U/U SNALP (PEG-cDMA) at 2
mg/kg twice weekly between d 10 and d 28 after seeding (6 doses).
Time to euthanization due to tumor burden was assessed based on
clinical scores as a humane surrogate to survival. Both PLK1424-2/A
SNALP compositions provided significant survival advantage over
control (p<0.05, Log-rank Mantel Cox test).
[0092] FIG. 39 illustrates data demonstrating the therapeutic
activity of PLK-1 SNALP containing either C14 or C18 PEG-lipids in
subcutaneous tumors. (A) Inhibition of subcutaneous tumor growth by
alternate PLK1424-2/A SNALP formulations. Mice were administered
PLK1424-2/A SNALP comprising either PEG-cDMA or PEG-cDSA (6.times.2
mg/kg intravenous) between d 10 and d 21 after Hep3B tumor seeding.
Values are mean tumor volumes (mm3)+/-SD (n=5). Control=Luc-U/U
siRNA SNALP (PEG-cDMA). (B) Corresponding hPLK-1:hGAPDH mRNA ratio
in subcutaneous Hep3B tumors following single administration (2
mg/kg) of PLK1424-2/A or Luc-U/U siRNA; Mean+SD (n=4). (C) Dose
response of PLK1424-2/A PEG-cDSA SNALP in Hep3B tumors. Mice
bearing established (.about.100 mm.sup.3) tumors were administered
PLK1424-2/A PEG-cDSA SNALP (6.times.3, 1, or 0.5 mg/kg), Luc
PEG-cDSA SNALP (6.times.3 mg/kg), or PBS vehicle every 2-3 days
between days 18-29 after seeding. Values represent mean tumor
volumes (mm.sup.3) (n=5). Mean SNALP particle size and
(polydispersity) were 81 (0.10), 71 (0.03), 82 (0.12), and 74
(0.05) nm for PLK1424 PEG-cDMA, PLK1424 PEG-cDSA, Luc PEG-cDMA, and
Luc PEG-cDSA, respectively.
[0093] FIG. 40 illustrates data demonstrating that different
chemical modification patterns in the PLK1424 siRNA sequence were
well tolerated and the modified siRNA molecules retained potent
activity in killing human tumor cells.
[0094] FIG. 41 illustrates data demonstrating that modified PLK1424
siRNAs did not induce an IFN-.alpha. response that was greater than
the negative controls.
[0095] FIG. 42 illustrates data demonstrating that there was no
significant IFIT1 induction above that of empty SNALP with PLK1424
1/3, PLK1424 2/3, PLK1424 2/4, and PLK1424 2/6 siRNAs.
[0096] FIG. 43 illustrates data demonstrating that all PLK1424
siRNAs tested in Hep3B tumors produced an equivalent level of PLK-1
mRNA silencing in vivo.
DETAILED DESCRIPTION OF THE INVENTION
I. Introduction
[0097] Hepatocellular carcinoma (HCC) is the fifth most common
solid tumor worldwide and the fourth leading cause of cancer
mortality accounting for approximately 400,000 deaths annually
(Thomas et al., J. Clin. Oncol., 23:2892-2899 (2005)). Although
several alternative treatment options exist for HCC, at present
there is no effective chemotherapy regimen for HCC and the
prognosis remains very poor. Surgical resection or complete liver
transplantation are considered the only therapies with curative
potential; however, 70-85% of HCC patients present with advanced
tumors and are often compromised with underlying liver disease that
contraindicates invasive surgery (Llovet et al., J. Natl. Cancer
Inst., 100:698-711 (2008)). Recently, the multi-kinase inhibitor
Sorafenib has been approved for the treatment of unresectable HCC
based on phase III data showing improvements in survival time (10.7
mo versus 7.9 mo for placebo) of patients with advanced disease
(Llovet et al., J. Hepatol., 48 Suppl 1:S20-37 (2008)). With no
other treatment options available, it is likely that Sorafenib will
become part of the standard of care for this patient population.
The liver is also a common site of tumor metastatic disease; for
example, approximately 50% of colorectal cancer patients develop
metastases to the liver, resulting in significant increase in
patient mortality (Steele et al., Annals Surgery, 210:127-138
(1989)). Combinatorial therapy with systemically administered
conventional and targeted chemotherapeutics improves the survival
times of these patients; however, the non-surgical cure for
metastatic colon cancer remains elusive. It is clear that HCC and
metastatic disease in the liver represent a significant unmet
medical need that requires the development of novel therapeutic
agents for more effective treatment options.
[0098] Short interfering RNAs are powerful, target-specific
molecules designed to suppress gene expression through the
endogenous cellular process of RNAi (Elbashir et al., Nature,
411:494-498 (2001)). Since the characterization of this fundamental
gene silencing mechanism, tremendous progress has been made in
developing siRNA as a potentially novel class of therapeutic agent
for a broad spectrum of diseases. However, the primary barrier to
realizing the potential of siRNA therapeutics is the need for drug
delivery vehicles that facilitate disease site targeting and
intracellular delivery of the siRNA (Zimmermann et al., Nature,
441:111-114 (2006); de Fougerolles et al., Nat. Rev. Drug Discov.,
6:443-453 (2007); Behlke, Mol. Ther., 13:644-670 (2006)). While
several groups have investigated the use of alternative nucleotide
chemistry to improve the pharmacologic properties of siRNA
(Soutschek et al., Nature, 432:173-178 (2004); Hall et al., Nucleic
Acids Res., 32:5991-6000 (2004); Morrissey et al., Hepatology,
41:1349-1356 (2005)), other groups have improved in vivo siRNA
delivery by complexing with polycations such as polyethyleneimine
(Urban-Klein et al., Gene Ther., 12:461-466 (2005); Schiffelers et
al., Nucleic Acids Res., 32:e149 (2004)) and cyclodextrin polymers
(Heidel et al., Proc. Natl. Acad. Sci. USA, 104:5715-5721 (2007))
or by encapsulation in lipid-based carriers (Zimmermann et al.,
supra; Morrissey et al., Nat. Biotechnol., 23:1002-1007 (2005);
Judge et al., Mol. Ther., 13:494-505 (2006)). Of particular
interest are those strategies that aim to take advantage of the
"enhanced permeation and retention" effect (Mayer et al., Cancer
Letters, 53:183-190 (1990); Seymour, Crit. Rev. Ther. Drug Carrier
Syst., 9:135-187 (1992)), also referred to as passive targeting,
whereby charge neutral carriers of suitable size can pass through
the fenestrated epithelium observed in sites of clinical interest
such as tumors. In order to take advantage of this effect and
achieve significant enrichment at the target site, carriers must be
small (diameter on the order of 100 nm) and long-circulating,
thereby able to bypass the microcapillary beds of the "first pass"
organs, the lungs, liver and the phagocytic cells of the
reticuloendothelial system. The advantage of such a system that
enriches the accumulation of siRNA at the tumor target site offers
the potential to develop a molecular therapeutic with additional
selectivity over that of non-targeted small molecule drugs.
[0099] Many oncology targets for siRNA have been described in the
literature, although direct evidence that the therapeutic effects
reported in vivo are RNAi-mediated is notably lacking. Targets
generally fall into three broad categories: (i) those that are
involved in the cell cycle or cell division and are directly
cytotoxic when down-regulated; (ii) those that support tumor cell
growth, tumor progression or metastasis such as growth factors,
their receptors or angiogenic factors; and (iii) those that
increase tumor sensitivity to conventional therapeutic approaches
such as anti-apoptotic proteins, drug resistance genes and DNA
repair enzymes. The present invention is drawn to targeting the
expression of an essential cell cycle protein Polo-like kinase 1
(PLK-1).
[0100] Progress through the cell cycle is controlled by kinases,
such as those of the Cyclin-dependant and Polo-like kinase
families. The polo-like kinases are named for Polo, a
serine/threonine kinase first identified in Drosophila Melanogaster
and characterized by their unique phosphopeptide binding polo-box
domain (Barr et al., Nat. Rev. Mol. Cell Biol., 5:429-440 (2004)).
Four mammalian PLK family members, PLK-1, PLK-2 (also known as
Snk), PLK-3 (also known as Prk or Fnk) and PLK-4 (also known as
Sak) have been characterized and shown to have non-redundant roles
in regulating the cell cycle (Barr et al., supra). All have
predicted nuclear localization signals (Taniguchi et al., J. Biol.
Chem., 277:48884-48888 (2002)) and are thought to act in concert on
nuclear substrates involved in various stages of the cell cycle. In
mammalian cells, PLK-1 acts to phosphorylate Cdc25C phosphatase,
cyclin B, a cohesin subunit of the mitotic spindle, subunits of the
anaphase promoting complex, mammalian kinesin-like protein 1 MKLP-1
and other kinesin related proteins. This diverse array of
substrates illustrates the multiple roles of PLK-1 in mitosis and
cytokinesis (Barr et al., supra). Over-expression of PLK-1,
observed in many human tumor types, is a negative prognosticator of
patient outcome (Strebhardt et al., Nat. Rev. Cancer, 6:321-330
(2006)), while inhibition of PLK-1 activity rapidly induces mitotic
arrest and tumor cell apoptosis (Steegmaier et al., Curr. Biol.,
17:316-322 (2007); Liu et al., Proc. Natl. Acad. Sci. USA,
100:5789-5794 (2003)). Depletion of PLK-1 also acts to sensitize
cancer cells to the pro-apoptotic activity of small molecule drugs
(Spankuch et al., Oncogene, 26:5793-5807 (2007)), likely due to its
functional role in the DNA damage and spindle assembly checkpoints.
These features combine to make PLK-1 an exciting target for
therapeutic intervention in oncology.
[0101] As such, targeted silencing of cancer-associated genes such
as PLK-1 by siRNA holds considerable promise as a novel therapeutic
strategy. However, unmodified PLK-1 siRNA sequences can be
immunostimulatory, e.g., stimulate potent inflammatory responses
from innate immune cells, particularly when associated with
delivery vehicles that facilitate intracellular uptake. This
represents a significant barrier to the therapeutic development of
PLK-1 siRNA molecules due to toxicity and off-target gene effects
associated with the inflammatory response. The present invention
overcomes these limitations by reducing or completely abrogating
the immune response to PLK-1 siRNA using the selective
incorporation of modified nucleotides such as 2'-O-methyl (2'OMe)
uridine and/or guanosine nucleotides into either or both strands of
the siRNA. In particular, the immunostimulatory properties of PLK-1
siRNA sequences and their ability to silence PLK-1 expression can
be balanced or optimized by the introduction of minimal and
selective 2'OMe modifications within the double-stranded region of
the siRNA duplex. This can be achieved at therapeutically viable
siRNA doses without cytokine induction, toxicity, and off-target
effects associated with the use of unmodified siRNA.
[0102] Thus, the present invention provides chemically modified
siRNA molecules which silence PLK-1 expression and methods of use
thereof. The present invention also provides nucleic acid-lipid
particles (e.g., SNALP) comprising a modified siRNA molecule
described herein, a cationic lipid, and a non-cationic lipid, which
can further comprise a conjugated lipid that inhibits aggregation
of particles. The present invention further provides methods of
silencing PLK-1 gene expression by administering a modified siRNA
molecule described herein to a mammalian subject. In certain
embodiments, the present invention provides an siRNA therapeutic
targeting human PLK-1 for the treatment of liver cancers such as
HCC and liver metastatic disease. The present invention
additionally provides methods of identifying and/or modifying PLK-1
siRNA having immunostimulatory properties. Methods for sensitizing
a cell such as a cancer cell to the effects of a chemotherapy drug
comprising sequentially delivering PLK-1 siRNA followed by the
chemotherapy drug are also provided.
[0103] Therefore, the present invention demonstrates that
rationally designed siRNA, when delivered using a safe and
effective systemic delivery vehicle, are able to affect therapeutic
PLK-1 gene silencing through the confirmed mechanism of RNAi in the
absence of unintended immune stimulation.
II. Definitions
[0104] As used herein, the following terms have the meanings
ascribed to them unless specified otherwise.
[0105] The term "polo-like kinase 1," "PLK-1," "polo-like kinase,"
or "PLK" refers to a serine/threonine kinase containing two
functional domains: (1) a kinase domain; and (2) a polo-box domain
(see, e.g., Barr et al., Nat. Rev. Mol. Cell Biol., 5:429-440
(2004)). The activity and cellular concentration of PLK-1 are
crucial for the precise regulation of cell division. PLK-1
expression and activity are low throughout the G0, G1, and S phases
of the cell cycle, but begin to rise in G2 and peak during M phase.
PLK-1 is essential for mitosis and cell division and contributes to
the following processes: centrosome maturation and the activation
of maturation-promoting factors by Cdc25C and cyclinB1
phosphorylation; bipolar spindle formation; and DNA damage
checkpoint adaptation (DNA damage inhibits PLK-1 in G2 and
mitosis). PLK-1 is also involved in the activation of components of
the anaphase promoting complex for mitotic exit and cytokinesis.
PLK-1 is overexpressed in many cancer types including hepatoma and
colon cancer, and PLK-1 expression often correlates with poor
patient prognosis. Overexpression of PLK-1 (wild-type or kinase
inactive) results in multinucleation (genetic instability).
Hyperactive PLK-1 overrides the DNA damage checkpoint. Constitutive
PLK-1 expression causes transformation of NIH 3T3 cells. PLK-1
phosphorylates the p53 tumor suppressor, thereby inhibiting the
pro-apoptotic effects of p53. Human PLK-1 mRNA sequences are set
forth in Genbank Accession Nos. NM_005030, X73458, BC014846,
BC003002, HSU01038, and L19559. A mouse PLK-1 mRNA sequence is set
forth in Genbank Accession No. NM_011121. PLK-1 is also known as
serine/threonine protein kinase 13 (STPK13).
[0106] The term "interfering RNA" or "RNAi" or "interfering RNA
sequence" refers to single-stranded RNA (e.g., mature miRNA) or
double-stranded RNA (i.e., duplex RNA such as siRNA, aiRNA, or
pre-miRNA) that is capable of reducing or inhibiting expression of
a target gene (i.e., by mediating the degradation or inhibiting the
translation of mRNAs which are complementary to the sequence of the
interfering RNA) when the interfering RNA is in the same cell as
the target gene. Interfering RNA thus refers to the single-stranded
RNA that is complementary to an mRNA sequence or to the
double-stranded RNA formed by two complementary strands or by a
single, self-complementary strand. Interfering RNA may have
substantial or complete identity to the target gene or may comprise
a region of mismatch (i.e., a mismatch motif). The sequence of the
interfering RNA can correspond to the full length target gene, or a
subsequence thereof.
[0107] Interfering RNA includes "small-interfering RNA" or "siRNA,"
e.g., interfering RNA of about 15-60, 15-50, or 15-40 (duplex)
nucleotides in length, more typically about 15-30, 15-25, or 19-25
(duplex) nucleotides in length, and is preferably about 20-24,
21-22, or 21-23 (duplex) nucleotides in length (e.g., each
complementary sequence of the double-stranded siRNA is 15-60,
15-50, 15-40, 15-30, 15-25, or 19-25 nucleotides in length,
preferably about 20-24, 21-22, or 21-23 nucleotides in length, and
the double-stranded siRNA is about 15-60, 15-50, 15-40, 15-30,
15-25, or 19-25 base pairs in length, preferably about 18-22,
19-20, or 19-21 base pairs in length). siRNA duplexes may comprise
3' overhangs of about 1 to about 4 nucleotides or about 2 to about
3 nucleotides and 5' phosphate termini. Examples of siRNA include,
without limitation, a double-stranded polynucleotide molecule
assembled from two separate stranded molecules, wherein one strand
is the sense strand and the other is the complementary antisense
strand; a double-stranded polynucleotide molecule assembled from a
single stranded molecule, where the sense and antisense regions are
linked by a nucleic acid-based or non-nucleic acid-based linker; a
double-stranded polynucleotide molecule with a hairpin secondary
structure having self-complementary sense and antisense regions;
and a circular single-stranded polynucleotide molecule with two or
more loop structures and a stem having self-complementary sense and
antisense regions, where the circular polynucleotide can be
processed in vivo or in vitro to generate an active double-stranded
siRNA molecule.
[0108] Preferably, siRNA are chemically synthesized. siRNA can also
be generated by cleavage of longer dsRNA (e.g., dsRNA greater than
about 25 nucleotides in length) with the E. coli RNase III or
Dicer. These enzymes process the dsRNA into biologically active
siRNA (see, e.g., Yang et al., Proc. Natl. Acad. Sci. USA,
99:9942-9947 (2002); Calegari et al., Proc. Natl. Acad. Sci. USA,
99:14236 (2002); Byrom et al., Ambion TechNotes, 10(1):4-6 (2003);
Kawasaki et al., Nucleic Acids Res., 31:981-987 (2003); Knight et
al., Science, 293:2269-2271 (2001); and Robertson et al., J. Biol.
Chem., 243:82 (1968)). Preferably, dsRNA are at least 50
nucleotides to about 100, 200, 300, 400, or 500 nucleotides in
length. A dsRNA may be as long as 1000, 1500, 2000, 5000
nucleotides in length, or longer. The dsRNA can encode for an
entire gene transcript or a partial gene transcript. In certain
instances, siRNA may be encoded by a plasmid (e.g., transcribed as
sequences that automatically fold into duplexes with hairpin
loops).
[0109] As used herein, the term "mismatch motif" or "mismatch
region" refers to a portion of an interfering RNA (e.g., siRNA,
aiRNA, miRNA) sequence that does not have 100% complementarity to
its target sequence. An interfering RNA may have at least one, two,
three, four, five, six, or more mismatch regions. The mismatch
regions may be contiguous or may be separated by 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, or more nucleotides. The mismatch motifs or
regions may comprise a single nucleotide or may comprise two,
three, four, five, or more nucleotides.
[0110] An "effective amount" or "therapeutically effective amount"
of an interfering RNA is an amount sufficient to produce the
desired effect, e.g., an inhibition of expression of a target
sequence in comparison to the normal expression level detected in
the absence of the interfering RNA. Inhibition of expression of a
target gene or target sequence is achieved when the value obtained
with the interfering RNA relative to the control is about 90%, 85%,
80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%,
15%, 10%, 5%, or 0%. Suitable assays for measuring expression of a
target gene or target sequence include, e.g., examination of
protein or mRNA levels using techniques known to those of skill in
the art such as dot blots, northern blots, in situ hybridization,
ELISA, immunoprecipitation, enzyme function, as well as phenotypic
assays known to those of skill in the art.
[0111] By "decrease," "decreasing," "reduce," or "reducing" of an
immune response by an interfering RNA is intended to mean a
detectable decrease of an immune response to a given interfering
RNA (e.g., a modified interfering RNA). The amount of decrease of
an immune response by a modified interfering RNA may be determined
relative to the level of an immune response in the presence of an
unmodified interfering RNA. A detectable decrease can be about 5%,
10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95%, 100%, or more lower than the immune
response detected in the presence of the unmodified interfering
RNA. A decrease in the immune response to interfering RNA is
typically measured by a decrease in cytokine production (e.g.,
IFN.gamma., IFN.alpha., TNF.alpha., IL-6, or IL-12) by a responder
cell in vitro or a decrease in cytokine production in the sera of a
mammalian subject after administration of the interfering RNA.
[0112] As used herein, the term "responder cell" refers to a cell,
preferably a mammalian cell, that produces a detectable immune
response when contacted with an immunostimulatory interfering RNA
such as an unmodified siRNA. Exemplary responder cells include,
e.g., dendritic cells, macrophages, peripheral blood mononuclear
cells (PBMCs), splenocytes, and the like. Detectable immune
responses include, e.g., production of cytokines or growth factors
such as TNF-.alpha., IFN-.alpha., IFN-.gamma., IL-1, IL-2, IL-3,
IL-4, IL-5, IL-6, IL-10, IL-12, IL-13, TGF, and combinations
thereof.
[0113] "Substantial identity" refers to a sequence that hybridizes
to a reference sequence under stringent conditions, or to a
sequence that has a specified percent identity over a specified
region of a reference sequence.
[0114] The phrase "stringent hybridization conditions" refers to
conditions under which a nucleic acid will hybridize to its target
sequence, typically in a complex mixture of nucleic acids, but to
no other sequences. Stringent conditions are sequence-dependent and
will be different in different circumstances. Longer sequences
hybridize specifically at higher temperatures. An extensive guide
to the hybridization of nucleic acids is found in Tijssen,
Techniques in Biochemistry and Molecular Biology--Hybridization
with Nucleic Probes, "Overview of principles of hybridization and
the strategy of nucleic acid assays" (1993). Generally, stringent
conditions are selected to be about 5-10.degree. C. lower than the
thermal melting point (T.sub.m) for the specific sequence at a
defined ionic strength pH. The T.sub.m is the temperature (under
defined ionic strength, pH, and nucleic concentration) at which 50%
of the probes complementary to the target hybridize to the target
sequence at equilibrium (as the target sequences are present in
excess, at T.sub.m, 50% of the probes are occupied at equilibrium).
Stringent conditions may also be achieved with the addition of
destabilizing agents such as formamide. For selective or specific
hybridization, a positive signal is at least two times background,
preferably 10 times background hybridization.
[0115] Exemplary stringent hybridization conditions can be as
follows: 50% formamide, 5.times.SSC, and 1% SDS, incubating at
42.degree. C., or, 5.times.SSC, 1% SDS, incubating at 65.degree.
C., with wash in 0.2.times.SSC, and 0.1% SDS at 65.degree. C. For
PCR, a temperature of about 36.degree. C. is typical for low
stringency amplification, although annealing temperatures may vary
between about 32.degree. C. and 48.degree. C. depending on primer
length. For high stringency PCR amplification, a temperature of
about 62.degree. C. is typical, although high stringency annealing
temperatures can range from about 50.degree. C. to about 65.degree.
C., depending on the primer length and specificity. Typical cycle
conditions for both high and low stringency amplifications include
a denaturation phase of 90.degree. C.-95.degree. C. for 30 sec.-2
min., an annealing phase lasting 30 sec.-2 min., and an extension
phase of about 72.degree. C. for 1-2 min. Protocols and guidelines
for low and high stringency amplification reactions are provided,
e.g., in Innis et al. (1990) PCR Protocols, A Guide to Methods and
Applications, Academic Press, Inc. N.Y.
[0116] Nucleic acids that do not hybridize to each other under
stringent conditions are still substantially identical if the
polypeptides which they encode are substantially identical. This
occurs, for example, when a copy of a nucleic acid is created using
the maximum codon degeneracy permitted by the genetic code. In such
cases, the nucleic acids typically hybridize under moderately
stringent hybridization conditions. Exemplary "moderately stringent
hybridization conditions" include a hybridization in a buffer of
40% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
1.times.SSC at 45.degree. C. A positive hybridization is at least
twice background. Those of ordinary skill will readily recognize
that alternative hybridization and wash conditions can be utilized
to provide conditions of similar stringency. Additional guidelines
for determining hybridization parameters are provided in numerous
references, e.g., Current Protocols in Molecular Biology, Ausubel
et al., eds.
[0117] The terms "substantially identical" or "substantial
identity," in the context of two or more nucleic acids, refer to
two or more sequences or subsequences that are the same or have a
specified percentage of nucleotides that are the same (i.e., at
least about 60%, preferably at least about 65%, 70%, 75%, 80%, 85%,
90%, or 95% identity over a specified region), when compared and
aligned for maximum correspondence over a comparison window, or
designated region as measured using one of the following sequence
comparison algorithms or by manual alignment and visual inspection.
This definition, when the context indicates, also refers
analogously to the complement of a sequence. Preferably, the
substantial identity exists over a region that is at least about 5,
10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides in
length.
[0118] For sequence comparison, typically one sequence acts as a
reference sequence, to which test sequences are compared. When
using a sequence comparison algorithm, test and reference sequences
are entered into a computer, subsequence coordinates are
designated, if necessary, and sequence algorithm program parameters
are designated. Default program parameters can be used, or
alternative parameters can be designated. The sequence comparison
algorithm then calculates the percent sequence identities for the
test sequences relative to the reference sequence, based on the
program parameters.
[0119] A "comparison window," as used herein, includes reference to
a segment of any one of a number of contiguous positions selected
from the group consisting of from about 5 to about 60, usually
about 10 to about 45, more usually about 15 to about 30, in which a
sequence may be compared to a reference sequence of the same number
of contiguous positions after the two sequences are optimally
aligned. Methods of alignment of sequences for comparison are well
known in the art. Optimal alignment of sequences for comparison can
be conducted, e.g., by the local homology algorithm of Smith and
Waterman, Adv. Appl. Math., 2:482 (1981), by the homology alignment
algorithm of Needleman and Wunsch, J. Mol. Biol., 48:443 (1970), by
the search for similarity method of Pearson and Lipman, Proc. Natl.
Acad. Sci. USA, 85:2444 (1988), by computerized implementations of
these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin
Genetics Software Package, Genetics Computer Group, 575 Science
Dr., Madison, Wis.), or by manual alignment and visual inspection
(see, e.g., Current Protocols in Molecular Biology, Ausubel et al.,
eds. (1995 supplement)).
[0120] A preferred example of algorithms that are suitable for
determining percent sequence identity and sequence similarity are
the BLAST and BLAST 2.0 algorithms, which are described in Altschul
et al., Nuc. Acids Res., 25:3389-3402 (1977) and Altschul et al.,
J. Mol. Biol., 215:403-410 (1990), respectively. BLAST and BLAST
2.0 are used, with the parameters described herein, to determine
percent sequence identity for the nucleic acids of the invention.
Software for performing BLAST analyses is publicly available
through the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/).
[0121] The BLAST algorithm also performs a statistical analysis of
the similarity between two sequences (see, e.g., Karlin and
Altschul, Proc. Natl. Acad. Sci. USA, 90:5873-5787 (1993)). One
measure of similarity provided by the BLAST algorithm is the
smallest sum probability (P(N)), which provides an indication of
the probability by which a match between two nucleotide sequences
would occur by chance. For example, a nucleic acid is considered
similar to a reference sequence if the smallest sum probability in
a comparison of the test nucleic acid to the reference nucleic acid
is less than about 0.2, more preferably less than about 0.01, and
most preferably less than about 0.001.
[0122] The term "nucleic acid" as used herein refers to a polymer
containing at least two deoxyribonucleotides or ribonucleotides in
either single- or double-stranded form and includes DNA and RNA.
DNA may be in the form of, e.g., antisense molecules, plasmid DNA,
pre-condensed DNA, a PCR product, vectors (P1, PAC, BAC, YAC,
artificial chromosomes), expression cassettes, chimeric sequences,
chromosomal DNA, or derivatives and combinations of these groups.
RNA may be in the form of siRNA, asymmetrical interfering RNA
(aiRNA), microRNA (miRNA), mRNA, tRNA, rRNA, tRNA, vRNA, and
combinations thereof. Nucleic acids include nucleic acids
containing known nucleotide analogs or modified backbone residues
or linkages, which are synthetic, naturally occurring, and
non-naturally occurring, and which have similar binding properties
as the reference nucleic acid. Examples of such analogs include,
without limitation, phosphorothioates, phosphoramidates, methyl
phosphonates, chiral-methyl phosphonates, 2'-O-methyl
ribonucleotides, and peptide-nucleic acids (PNAs). Unless
specifically limited, the term encompasses nucleic acids containing
known analogues of natural nucleotides that have similar binding
properties as the reference nucleic acid. Unless otherwise
indicated, a particular nucleic acid sequence also implicitly
encompasses conservatively modified variants thereof (e.g.,
degenerate codon substitutions), alleles, orthologs, SNPs, and
complementary sequences as well as the sequence explicitly
indicated. Specifically, degenerate codon substitutions may be
achieved by generating sequences in which the third position of one
or more selected (or all) codons is substituted with mixed-base
and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res.,
19:5081 (1991); Ohtsuka et al., J. Biol. Chem., 260:2605-2608
(1985); Rossolini et al., Mol. Cell. Probes, 8:91-98 (1994)).
"Nucleotides" contain a sugar deoxyribose (DNA) or ribose (RNA), a
base, and a phosphate group. Nucleotides are linked together
through the phosphate groups. "Bases" include purines and
pyrimidines, which further include natural compounds adenine,
thymine, guanine, cytosine, uracil, inosine, and natural analogs,
and synthetic derivatives of purines and pyrimidines, which
include, but are not limited to, modifications which place new
reactive groups such as, but not limited to, amines, alcohols,
thiols, carboxylates, and alkylhalides.
[0123] The term "gene" refers to a nucleic acid (e.g., DNA or RNA)
sequence that comprises partial length or entire length coding
sequences necessary for the production of a polypeptide or
precursor polypeptide.
[0124] "Gene product," as used herein, refers to a product of a
gene such as an RNA transcript or a polypeptide.
[0125] The term "lipid" refers to a group of organic compounds that
include, but are not limited to, esters of fatty acids and are
characterized by being insoluble in water, but soluble in many
organic solvents. They are usually divided into at least three
classes: (1) "simple lipids," which include fats and oils as well
as waxes; (2) "compound lipids," which include phospholipids and
glycolipids; and (3) "derived lipids" such as steroids.
[0126] "Lipid vesicle" refers to any lipid composition that can be
used to deliver a compound such as an interfering RNA including,
but not limited to, liposomes, wherein an aqueous volume is
encapsulated by an amphipathic lipid bilayer; or wherein the lipids
coat an interior comprising a large molecular component, such as a
plasmid comprising an interfering RNA sequence, with a reduced
aqueous interior; or lipid aggregates or micelles, wherein the
encapsulated component is contained within a relatively disordered
lipid mixture. The term lipid vesicle encompasses any of a variety
of lipid-based carrier systems including, without limitation,
SPLPs, pSPLPs, SNALPs, liposomes, micelles, virosomes,
lipid-nucleic acid complexes, and mixtures thereof.
[0127] As used herein, "lipid encapsulated" can refer to a lipid
formulation that provides a compound, such as a nucleic acid (e.g.,
an interfering RNA), with full encapsulation, partial
encapsulation, or both. In a preferred embodiment, the nucleic acid
is fully encapsulated in the lipid formulation (e.g., to form an
SPLP, pSPLP, SNALP, or other nucleic acid-lipid particle).
[0128] As used herein, the term "SNALP" refers to a stable nucleic
acid-lipid particle. A SNALP represents a particle made from lipids
(e.g., a cationic lipid, a non-cationic lipid and a conjugated
lipid that prevents aggregation of the particle), wherein the
nucleic acid (e.g., siRNA, aiRNA, miRNA, ssDNA, dsDNA, ssRNA, short
hairpin RNA (shRNA), dsRNA, or a plasmid, including plasmids from
which an interfering RNA is transcribed) is fully encapsulated
within the lipid. As used herein, the term "SNALP" includes an
SPLP, which is the term used to refer to a nucleic acid-lipid
particle comprising a nucleic acid (e.g., a plasmid) encapsulated
within the lipid. SNALPs and SPLPs typically contain a cationic
lipid, a non-cationic lipid, and a lipid conjugate (e.g., a
PEG-lipid conjugate). SNALPs and SPLPs are extremely useful for
systemic applications, as they can exhibit extended circulation
lifetimes following intravenous (i.v.) injection, they can
accumulate at distal sites (e.g., sites physically separated from
the administration site) and they can mediate expression of the
transfected gene or silencing of target gene expression at these
distal sites. SPLPs include "pSPLP," which comprise an encapsulated
condensing agent-nucleic acid complex as set forth in PCT
Publication No. WO 00/03683.
[0129] The nucleic acid-lipid particles of the present invention
typically have a mean diameter of about 50 nm to about 150 nm, more
typically about 60 nm to about 130 nm, more typically about 70 nm
to about 110 nm, most typically about 70 to about 90 nm, and are
substantially nontoxic. In addition, the nucleic acids, when
present in the nucleic acid-lipid particles of the present
invention, are resistant in aqueous solution to degradation with a
nuclease. Nucleic acid-lipid particles and their method of
preparation are disclosed in, e.g., U.S. Patent Publication No.
20040142025 and U.S. Patent Publication No. 20070042031.
[0130] "Lipid formulation" or, alternatively, a "lipid-based
formulation" is used herein to refer to a SNALP that can be used to
deliver a nucleic acid, such as an interfering RNA, to a target
site of interest. In the lipid formulation, which is typically
formed from a cationic lipid, a non-cationic lipid and a lipid
conjugate, the nucleic acid is encapsulated in the lipid, thereby
protecting the nucleic acid from nuclease degradation.
[0131] The term "lipid conjugate" refers to a conjugated lipid that
inhibits aggregation of nucleic acid-lipid particles. Such lipid
conjugates include, but are not limited to, polyamide oligomers
(e.g., ATTA-lipid conjugates), PEG-lipid conjugates, such as PEG
coupled to dialkyloxypropyls, PEG coupled to diacylglycerols, PEG
coupled to cholesterol, PEG coupled to phosphatidylethanolamines,
PEG conjugated to ceramides (see, e.g., U.S. Pat. No. 5,885,613),
cationic PEG lipids, and mixtures thereof. PEG can be conjugated
directly to the lipid or may be linked to the lipid via a linker
moiety. Any linker moiety suitable for coupling the PEG to a lipid
can be used including, e.g., non-ester containing linker moieties
and ester-containing linker moieties. In preferred embodiments,
non-ester containing linker moieties are used.
[0132] The term "amphipathic lipid" refers, in part, to any
suitable material wherein the hydrophobic portion of the lipid
material orients into a hydrophobic phase, while the hydrophilic
portion orients toward the aqueous phase. Hydrophilic
characteristics derive from the presence of polar or charged groups
such as carbohydrates, phosphate, carboxylic, sulfato, amino,
sulfhydryl, nitro, hydroxyl, and other like groups. Hydrophobicity
can be conferred by the inclusion of apolar groups that include,
but are not limited to, long-chain saturated and unsaturated
aliphatic hydrocarbon groups and such groups substituted by one or
more aromatic, cycloaliphatic, or heterocyclic group(s). Examples
of amphipathic compounds include, but are not limited to,
phospholipids, aminolipids, and sphingolipids.
[0133] Representative examples of phospholipids include, but are
not limited to, phosphatidylcholine, phosphatidylethanolamine,
phosphatidylserine, phosphatidylinositol, phosphatidic acid,
palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine,
lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine,
dioleoylphosphatidylcholine, distearoylphosphatidylcholine, and
dilinoleoylphosphatidylcholine. Other compounds lacking in
phosphorus, such as sphingolipid, glycosphingolipid families,
diacylglycerols, and .beta.-acyloxyacids, are also within the group
designated as amphipathic lipids. Additionally, the amphipathic
lipids described above can be mixed with other lipids including
triglycerides and sterols.
[0134] The term "neutral lipid" refers to any of a number of lipid
species that exist either in an uncharged or neutral zwitterionic
form at a selected pH. At physiological pH, such lipids include,
for example, diacylphosphatidylcholine,
diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin,
cholesterol, cerebrosides, and diacylglycerols.
[0135] The term "non-cationic lipid" refers to any amphipathic
lipid as well as any other neutral lipid or anionic lipid.
[0136] The term "anionic lipid" refers to any lipid that is
negatively charged at physiological pH. These lipids include, but
are not limited to, phosphatidylglycerols, cardiolipins,
diacylphosphatidylserines, diacylphosphatidic acids, N-dodecanoyl
phosphatidylethanolamines, N-succinyl phosphatidylethanolamines,
N-glutarylphosphatidylethanolamines, lysylphosphatidylglycerols,
palmitoyloleyolphosphatidylglycerol (POPG), and other anionic
modifying groups joined to neutral lipids.
[0137] The term "cationic lipid" refers to any of a number of lipid
species that carry a net positive charge at a selected pH, such as
physiological pH (e.g., pH of about 7.0). It has been surprisingly
found that cationic lipids comprising alkyl chains with multiple
sites of unsaturation, e.g., at least two or three sites of
unsaturation, are particularly useful for forming nucleic
acid-lipid particles with increased membrane fluidity. A number of
cationic lipids and related analogs, which are also useful in the
present invention, have been described in U.S. Patent Publication
Nos. 20060083780 and 20060240554; U.S. Pat. Nos. 5,208,036;
5,264,618; 5,279,833; 5,283,185; 5,753,613; and 5,785,992; and PCT
Publication No. WO 96/10390. Examples of cationic lipids include,
but are not limited to, 1,2-dilinoleyloxy-N,N-dimethylaminopropane
(DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
N,N-dioleyl-N,N-dimethylammonium chloride (DODAC),
dioctadecyldimethylammonium (DODMA), distearyldimethylammonium
(DSDMA), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium
chloride (DOTMA), N,N-distearyl-N,N-dimethylammonium bromide
(DDAB), N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium
chloride (DOTAP),
3-(N--(N',N'-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol),
N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium
bromide (DMRIE),
2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanamin-
iumtrifluoroacetate (DOSPA), dioctadecylamidoglycyl spermine
(DOGS),
3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-oc-
tadecadienoxy)propane (CLinDMA),
2-[5'-(cholest-5-en-3.beta.-oxy)-3'-oxapentoxy)-3-dimethy-1-(cis,cis-9',1-
-2'-octadecadienoxy)propane (CpLinDMA),
N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA),
1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP),
2,3-Dilinoleoyloxy-N,N-dimethylpropylamine (DLinDAP),
1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP),
1,2-Dilinoleoylcarbamyl-3-dimethylaminopropane (DLinCDAP),
2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA),
2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane
(DLin-K-XTC2-DMA), and mixtures thereof. In some cases, the
cationic lipids comprise a protonatable tertiary amine head group,
C18 alkyl chains, ether linkages between the head group and alkyl
chains, and 0 to 3 double bonds. Such lipids include, e.g., DSDMA,
DLinDMA, DLenDMA, and DODMA. The cationic lipids may also comprise
ether linkages and pH titratable head groups. Such lipids include,
e.g., DODMA.
[0138] The term "hydrophobic lipid" refers to compounds having
apolar groups that include, but are not limited to, long-chain
saturated and unsaturated aliphatic hydrocarbon groups and such
groups optionally substituted by one or more aromatic,
cycloaliphatic, or heterocyclic group(s). Suitable examples
include, but are not limited to, diacylglycerol, dialkylglycerol,
N--N-dialkylamino, 1,2-diacyloxy-3-aminopropane, and
1,2-dialkyl-3-aminopropane.
[0139] The term "fusogenic" refers to the ability of a liposome, a
SNALP, or other drug delivery system to fuse with membranes of a
cell. The membranes can be either the plasma membrane or membranes
surrounding organelles, e.g., endosome, nucleus, etc.
[0140] As used herein, the term "aqueous solution" refers to a
composition comprising in whole, or in part, water.
[0141] As used herein, the term "organic lipid solution" refers to
a composition comprising in whole, or in part, an organic solvent
having a lipid.
[0142] "Distal site," as used herein, refers to a physically
separated site, which is not limited to an adjacent capillary bed,
but includes sites broadly distributed throughout an organism.
[0143] "Serum-stable" in relation to nucleic acid-lipid particles
means that the particle is not significantly degraded after
exposure to a serum or nuclease assay that would significantly
degrade free DNA or RNA. Suitable assays include, for example, a
standard serum assay, a DNAse assay, or an RNAse assay.
[0144] "Systemic delivery," as used herein, refers to delivery that
leads to a broad biodistribution of a compound such as an
interfering RNA within an organism. Some techniques of
administration can lead to the systemic delivery of certain
compounds, but not others. Systemic delivery means that a useful,
preferably therapeutic, amount of a compound is exposed to most
parts of the body. To obtain broad biodistribution generally
requires a blood lifetime such that the compound is not rapidly
degraded or cleared (such as by first pass organs (liver, lung,
etc.) or by rapid, nonspecific cell binding) before reaching a
disease site distal to the site of administration. Systemic
delivery of nucleic acid-lipid particles can be by any means known
in the art including, for example, intravenous, subcutaneous, and
intraperitoneal. In a preferred embodiment, systemic delivery of
nucleic acid-lipid particles is by intravenous delivery.
[0145] "Local delivery," as used herein, refers to delivery of a
compound such as an interfering RNA directly to a target site
within an organism. For example, a compound can be locally
delivered by direct injection into a disease site such as a tumor
or other target site such as a site of inflammation or a target
organ such as the liver, heart, pancreas, kidney, and the like.
[0146] The term "mammal" refers to any mammalian species such as a
human, mouse, rat, dog, cat, hamster, guinea pig, rabbit,
livestock, and the like.
[0147] The term "cancer" refers to any member of a class of
diseases characterized by the uncontrolled growth of aberrant
cells. The term includes all known cancers and neoplastic
conditions, whether characterized as malignant, benign, soft
tissue, or solid, and cancers of all stages and grades including
pre- and post-metastatic cancers. Examples of different types of
cancer include, but are not limited to, liver cancer, lung cancer,
colon cancer, rectal cancer, anal cancer, bile duct cancer, small
intestine cancer, stomach (gastric) cancer, esophageal cancer;
gallbladder cancer, pancreatic cancer, appendix cancer, breast
cancer, ovarian cancer; cervical cancer, prostate cancer, renal
cancer (e.g., renal cell carcinoma), cancer of the central nervous
system, glioblastoma, skin cancer, lymphomas, choriocarcinomas,
head and neck cancers, osteogenic sarcomas, and blood cancers.
Non-limiting examples of specific types of liver cancer include
hepatocellular carcinoma, secondary liver cancer (caused by
metastasis of some other non-liver cancer cell type), and
hepatoblastoma. As used herein, a "tumor" comprises one or more
cancerous cells.
III. Description of the Embodiments
[0148] The present invention provides compositions comprising
interfering RNA (e.g., siRNA, aiRNA, miRNA, etc.) that target PLK-1
expression and methods of using such compositions to silence PLK-1
expression.
[0149] In one aspect, the present invention provides a modified
siRNA molecule comprising a double-stranded region of about 15 to
about 60 nucleotides in length,
[0150] wherein one or more of the nucleotides in the
double-stranded region comprise modified nucleotides, and
[0151] wherein the modified siRNA molecule is capable of silencing
PLK-1 expression.
[0152] In one embodiment, the modified siRNA molecule comprises
modified nucleotides selected from the group consisting of
2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2'F)
nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE)
nucleotides, locked nucleic acid (LNA) nucleotides, and mixtures
thereof. In a preferred embodiment, the modified siRNA molecule
comprises 2'OMe nucleotides. As a non-limiting example, the 2'OMe
nucleotides may be selected from the group consisting of
2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides, and
mixtures thereof.
[0153] In another embodiment, the modified siRNA molecule comprises
a double-stranded region of about 15 to about 30 nucleotides in
length. In certain instances, the modified siRNA molecule comprises
modified nucleotides in one strand of the modified siRNA molecule.
In certain other instances, the modified siRNA molecule comprises
modified nucleotides in both strands of the modified siRNA
molecule. Typically, two, three, four, five, six, seven, or more of
the nucleotides in the double-stranded region comprise modified
nucleotides.
[0154] In some embodiments, less than about 25% of the nucleotides
in the double-stranded region comprise modified nucleotides. In
other embodiments, less than about 20% of the nucleotides in the
double-stranded region comprise modified nucleotides. In yet other
embodiments, less than about 15% of the nucleotides in the
double-stranded region comprise modified nucleotides. In additional
embodiments, from about 10% to about 20% of the nucleotides in the
double-stranded region comprise modified nucleotides.
[0155] In a further embodiment, the modified siRNA molecule is less
immunostimulatory than a corresponding unmodified siRNA sequence.
In such embodiments, the modified siRNA molecule with reduced
immunostimulatory properties advantageously retains RNAi activity
against the target PLK-1 sequence. In another embodiment, the
immunostimulatory properties of the modified siRNA molecules
described herein and their ability to silence PLK-1 expression can
be balanced or optimized by the introduction of minimal and
selective 2'OMe modifications within the siRNA sequence such as,
e.g., within the double-stranded region of the siRNA duplex.
[0156] In certain instances, the modified siRNA molecule is at
least about 70% less immunostimulatory than the corresponding
unmodified siRNA sequence. In certain other instances, the modified
siRNA molecule has an IC.sub.50 that is less than or equal to
ten-fold that of the corresponding unmodified siRNA sequence.
[0157] In some instances, the modified siRNA molecule comprises 3'
overhangs in one strand of the modified siRNA molecule. In other
instances, the modified siRNA molecule comprises 3' overhangs in
both strands of the modified siRNA molecule. In some instances, the
modified siRNA molecule comprises a hairpin loop structure.
[0158] The modified siRNA molecule typically comprises a sense
strand, an antisense strand, or a sense strand and an antisense
strand having one or more modified nucleotides in the
double-stranded region of the siRNA molecule.
[0159] In certain embodiments, the sense strand of the modified
siRNA molecule comprises or consists of one of the sense strand
sequences set forth in Table 1. In one preferred embodiment, the
sense strand comprises or consists of the nucleic acid sequence of
SEQ ID NO:1. In another preferred embodiment, the sense strand
comprises or consists of the nucleic acid sequence of SEQ ID NO:3.
In certain other embodiments, the antisense strand of the modified
siRNA molecule comprises or consists of one of the antisense strand
sequences set forth in Table 1. In one preferred embodiment, the
antisense strand comprises or consists of the nucleic acid sequence
of SEQ ID NO:2. In another preferred embodiment, the antisense
strand comprises or consists of the nucleic acid sequence of SEQ ID
NO:4. As described herein, one or more of the nucleotides in the
sense and/or antisense strand sequences set forth in Table 1 may
comprise modified nucleotides, wherein the modified nucleotides are
located in the double-stranded region of the siRNA molecule. In
some instances, the sense and/or antisense strand contains "dTdT"
or "UU" 3' overhangs. In other instances, the sense and/or
antisense strand contains 3' overhangs that have complementarity to
the target sequence or the complementary strand thereof. In further
instances, the 3' overhang on the sense strand, antisense strand,
or both strands comprises one, two, three, four, or more modified
nucleotides such as those described herein (e.g., 2'OMe
nucleotides).
[0160] In some embodiments, the sense strand of the modified siRNA
molecule comprises or consists of one of the sense strand sequences
set forth in Table 2. In other embodiments, the antisense strand of
the modified siRNA molecule comprises or consists of one of the
antisense strand sequences set forth in Table 2. As described
herein, one or more of the nucleotides in the sense and/or
antisense strand sequences set forth in Table 2 may comprise
modified nucleotides, wherein the modified nucleotides are located
in the double-stranded region of the siRNA molecule. In some
instances, the sense and/or antisense strand contains "dTdT" or
"UU" 3' overhangs. In other instances, the sense and/or antisense
strand contains 3' overhangs that have complementarity to the
target sequence or the complementary strand thereof. In further
instances, the 3' overhang on the sense strand, antisense strand,
or both strands comprises one, two, three, four, or more modified
nucleotides such as those described herein (e.g., 2'OMe
nucleotides).
[0161] In certain embodiments, the sense strand of the modified
siRNA molecule comprises or consists of one of the unmodified sense
strand sequences set forth in Table 3. In one preferred embodiment,
the sense strand comprises or consists of the nucleic acid sequence
of SEQ ID NO:51. In another preferred embodiment, the sense strand
comprises or consists of the nucleic acid sequence of SEQ ID NO:58.
In yet another preferred embodiment, the sense strand comprises or
consists of the nucleic acid sequence of SEQ ID NO:65. In certain
other embodiments, the antisense strand of the modified siRNA
molecule comprises or consists of one of the unmodified antisense
strand sequences set forth in Table 3. In one preferred embodiment,
the antisense strand comprises or consists of the nucleic acid
sequence of SEQ ID NO:52. In another preferred embodiment, the
antisense strand comprises or consists of the nucleic acid sequence
of SEQ ID NO:59. In yet another preferred embodiment, the antisense
strand comprises or consists of the nucleic acid sequence of SEQ ID
NO:66. As described herein, one or more of the nucleotides in the
unmodified sense and/or antisense strand sequences set forth in
Table 3 may comprise modified nucleotides, wherein the modified
nucleotides are located in the double-stranded region of the siRNA
molecule. In some instances, the sense and/or antisense strand
contains "dTdT" or "UU" 3' overhangs. In other instances, the sense
and/or antisense strand contains 3' overhangs that have
complementarity to the target sequence or the complementary strand
thereof. In further instances, the 3' overhang on the sense strand,
antisense strand, or both strands comprises one, two, three, four,
or more modified nucleotides such as those described herein (e.g.,
2'OMe nucleotides).
[0162] In some embodiments, the sense strand of the modified siRNA
molecule comprises or consists of one of the modified sense strand
sequences set forth in Table 3. In one preferred embodiment, the
sense strand comprises or consists of the nucleic acid sequence of
SEQ ID NO:57. In another preferred embodiment, the sense strand
comprises or consists of the nucleic acid sequence of SEQ ID NO:64.
In yet another preferred embodiment, the sense strand comprises or
consists of the nucleic acid sequence of SEQ ID NO:67. In some
instances, the sense strand contains "dTdT" or "UU" 3' overhangs.
In other instances, the sense strand contains 3' overhangs that
have complementarity to the complementary strand of the target
sequence. In further instances, the 3' overhang on the sense strand
comprises one, two, three, four, or more modified nucleotides such
as those described herein (e.g., 2'OMe nucleotides).
[0163] In other embodiments, the antisense strand of the modified
siRNA molecule comprises or consists of one of the modified
antisense strand sequences set forth in Table 3. In one preferred
embodiment, the antisense strand comprises or consists of the
nucleic acid sequence of SEQ ID NO:54. In another preferred
embodiment, the antisense strand comprises or consists of the
nucleic acid sequence of SEQ ID NO:56. In yet another preferred
embodiment, the antisense strand comprises or consists of the
nucleic acid sequence of SEQ ID NO:63. In an additional preferred
embodiment, the antisense strand comprises or consists of the
nucleic acid sequence of SEQ ID NO:68. In some instances, the
antisense strand contains "dTdT" or "UU" 3' overhangs. In other
instances, the antisense strand contains 3' overhangs that have
complementarity to the target sequence. In further instances, the
3' overhang on the antisense strand comprises one, two, three,
four, or more modified nucleotides such as those described herein
(e.g., 2'OMe nucleotides).
[0164] In some embodiments, the sense strand of the modified siRNA
molecule comprises or consists of one of the sense strand sequences
set forth in Tables 4-5. In certain other embodiments, the
antisense strand of the modified siRNA molecule comprises or
consists of one of the antisense strand sequences set forth in
Tables 4-5. As described herein, one or more of the nucleotides in
the sense and/or antisense strand sequences set forth in Tables 4-5
may comprise modified nucleotides, wherein the modified nucleotides
are located in the double-stranded region of the siRNA molecule. In
some instances, the sense and/or antisense strand contains "dTdT"
or "UU" 3' overhangs. In other instances, the sense and/or
antisense strand contains 3' overhangs that have complementarity to
the target sequence or the complementary strand thereof. In further
instances, the 3' overhang on the sense strand, antisense strand,
or both strands comprises one, two, three, four, or more modified
nucleotides such as those described herein (e.g., 2'OMe
nucleotides).
[0165] In certain embodiments, the sense strand of the modified
siRNA molecule comprises or consists of one of the unmodified sense
strand sequences set forth in Table 6. In one preferred embodiment,
the sense strand comprises or consists of the nucleic acid sequence
of SEQ ID NO:211. In another preferred embodiment, the sense strand
comprises or consists of the nucleic acid sequence of SEQ ID
NO:218. In certain other embodiments, the antisense strand of the
modified siRNA molecule comprises or consists of one of the
unmodified antisense strand sequences set forth in Table 6. In one
preferred embodiment, the antisense strand comprises or consists of
the nucleic acid sequence of SEQ ID NO:212. In another preferred
embodiment, the antisense strand comprises or consists of the
nucleic acid sequence of SEQ ID NO:219. As described herein, one or
more of the nucleotides in the unmodified sense and/or antisense
strand sequences set forth in Table 6 may comprise modified
nucleotides, wherein the modified nucleotides are located in the
double-stranded region of the siRNA molecule. In some instances,
one or both of the uridine nucleotides in the "UU" 3' overhang on
the sense and/or antisense strand comprises modified nucleotides
such as those described herein (e.g., 2'OMe-uridine
nucleotides).
[0166] In some embodiments, the sense strand of the modified siRNA
molecule comprises or consists of one of the modified sense strand
sequences set forth in Table 6. In one preferred embodiment, the
sense strand comprises or consists of the nucleic acid sequence of
SEQ ID NO:214. In another preferred embodiment, the sense strand
comprises or consists of the nucleic acid sequence of SEQ ID
NO:220. In some instances, one or both of the uridine nucleotides
in the "UU" 3' overhang on the sense strand comprises modified
nucleotides such as those described herein (e.g., 2'OMe-uridine
nucleotides).
[0167] In other embodiments, the antisense strand of the modified
siRNA molecule comprises or consists of one of the modified
antisense strand sequences set forth in Table 6. In one preferred
embodiment, the antisense strand comprises or consists of the
nucleic acid sequence of SEQ ID NO:215. In another preferred
embodiment, the antisense strand comprises or consists of the
nucleic acid sequence of SEQ ID NO:216. In yet another preferred
embodiment, the antisense strand comprises or consists of the
nucleic acid sequence of SEQ ID NO:223. In some instances, one or
both of the uridine nucleotides in the "UU" 3' overhang on the
antisense strand comprises modified nucleotides such as those
described herein (e.g., 2'OMe-uridine nucleotides).
[0168] In some embodiments, the sense strand of the modified siRNA
molecule comprises or consists of one of the sense strand sequences
set forth in Table 7. In other embodiments, the antisense strand of
the modified siRNA molecule comprises or consists of a sequence
that is complementary to one of the sense strand sequences set
forth in Table 7 (except for the "UU" 3' overhang). As described
herein, one or more of the nucleotides in the sense sequences set
forth in Table 7 and/or the complementary antisense strand
sequences may comprise modified nucleotides, wherein the modified
nucleotides are located in the double-stranded region of the siRNA
molecule. In some instances, one or both of the uridine nucleotides
in the "UU" 3' overhang on the sense and/or antisense strand
comprises modified nucleotides such as those described herein
(e.g., 2'OMe-uridine nucleotides).
[0169] In some embodiments, the sense strand of the modified siRNA
molecule comprises or consists of one of the modified sense strand
sequences set forth in Table 10. In one preferred embodiment, the
sense strand comprises or consists of the nucleic acid sequence of
SEQ ID NO:400. In other embodiments, the antisense strand of the
modified siRNA molecule comprises or consists of one of the
modified antisense strand sequences set forth in Table 10. In one
preferred embodiment, the antisense strand comprises or consists of
the nucleic acid sequence of SEQ ID NO:403. In some instances, one
or both of the nucleotides in the 3' overhang on the sense and/or
antisense strand comprises modified nucleotides such as those
described herein (e.g., 2'OMe-uridine nucleotides).
[0170] In certain embodiments, the modified siRNA molecule is
selected from the group consisting of any one or more of the siRNA
molecules set forth in Table 11. In preferred embodiments, the
modified siRNA molecule is PLK1424 2/6.
[0171] In certain other embodiments, the modified siRNA molecule is
selected from the group consisting of PLK1424 2/6, PLK1424 U4/GU,
PLK1424 U4/G, PLK773 G/GU, PLK1425 3/5, and a mixture thereof.
[0172] In another embodiment, the modified siRNA molecule further
comprises a carrier system. In certain instances, the carrier
system is selected from the group consisting of a nucleic
acid-lipid particle, a liposome, a micelle, a virosome, a nucleic
acid complex, and mixtures thereof. Generally, the nucleic acid
complex may comprise the modified siRNA complexed with a cationic
lipid, a cationic polymer, a cyclodextrin, or mixtures thereof. As
a non-limiting example, the modified siRNA molecule may be
complexed with a cationic polymer, wherein the cationic polymer is
polyethylenimine (PEI). In preferred embodiments, the carrier
system is a nucleic acid-lipid particle.
[0173] In other embodiments, the present invention provides a
pharmaceutical composition comprising a modified siRNA molecule
described herein and a pharmaceutically acceptable carrier.
[0174] In another aspect, the present invention provides a nucleic
acid-lipid particle comprising: [0175] a modified siRNA molecule
described herein; [0176] a cationic lipid; and [0177] a
non-cationic lipid.
[0178] In some embodiments, the cationic lipid is a member selected
from the group consisting of
1,2-Dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA),
1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
N,N-dioleyl-N,N-dimethylammonium chloride (DODAC),
N,N-distearyl-N,N-dimethylammonium bromide (DDAB),
N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride
(DOTAP), distearyldimethylammonium (DSDMA),
N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride
(DOTMA), N,N-dimethyl-2,3-dioleyloxypropylamine (DODMA),
3-(N--(N',N'-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol),
N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium
bromide (DMRIE),
2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanamin-
iumtrifluoroacetate (DOSPA), dioctadecylamidoglycyl spermine
(DOGS),
3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-oc-
tadecadienoxy)propane (CLinDMA),
2-[5'-(cholest-5-en-3-beta-oxy)-3'-oxapentoxy)-3-dimethy-1-(cis,cis-9',1--
T-octadecadienoxy)propane (CpLinDMA),
N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA),
1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP),
2,3-Dilinoleoyloxy-N,N-dimethylpropylamine (DLinDAP),
1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP),
1,2-Dilinoleoylcarbamyl-3-dimethylaminopropane (DLinCDAP),
2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA),
2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane
(DLin-K-XTC2-DMA), and a mixture thereof. In a preferred
embodiment, the cationic lipid is DLinDMA.
[0179] In certain embodiments, the non-cationic lipid is an anionic
lipid. In certain other embodiments, the non-cationic lipid is a
neutral lipid.
[0180] In some embodiments, the non-cationic lipid is a member
selected from the group consisting of distearoylphosphatidylcholine
(DSPC), dioleoylphosphatidylethanolamine (DOPE),
palmitoyloleoyl-phosphatidylcholine (POPC),
palmitoyloleoyl-phosphatidylethanolamine (POPE),
palmitoyloleyol-phosphatidylglycerol (POPG),
dipalmitoyl-phosphatidylcholine (DPPC),
dipalmitoyl-phosphatidylethanolamine (DPPE),
dimyristoyl-phosphatidylethanolamine (DMPE),
distearoyl-phosphatidylethanolamine (DSPE),
monomethyl-phosphatidylethanolamine,
dimethyl-phosphatidylethanolamine,
dielaidoyl-phosphatidylethanolamine (DEPE),
stearoyloleoyl-phosphatidylethanolamine (SOPE), egg
phosphatidylcholine (EPC), cholesterol, and a mixture thereof. In a
preferred embodiment, the non-cationic lipid is DSPC, DPPC, or
DSPE.
[0181] In another embodiment, the nucleic acid-lipid particle
further comprises a conjugated lipid that inhibits aggregation of
particles. In certain instances, the conjugated lipid that inhibits
aggregation of particles is a member selected from the group
consisting of a polyethyleneglycol (PEG)-lipid conjugate, a
polyamide (ATTA)-lipid conjugate, and a mixture thereof. In some
embodiments, the PEG-lipid conjugate is a member selected from the
group consisting of a PEG-diacylglycerol, a PEG dialkyloxypropyl, a
PEG-phospholipid, a PEG-ceramide, and a mixture thereof. In a
preferred embodiment, the conjugated lipid that inhibits
aggregation of particles comprises a PEG-dialkyloxypropyl (PEG-DAA)
conjugate. In certain instances, the PEG-DAA conjugate is a member
selected from the group consisting of a PEG-dilauryloxypropyl
(C.sub.12) conjugate, a PEG-dimyristyloxypropyl (C.sub.14)
conjugate, a PEG-dipalmityloxypropyl (C.sub.16) conjugate, and a
PEG-distearyloxypropyl (C.sub.18) conjugate. In a preferred
embodiment, the PEG-DAA conjugate is a PEG-dimyristyloxypropyl
(C.sub.14) conjugate. Additional PEG-lipid conjugates include,
e.g., PEG-C-DOMG, 2KPEG-DMG, or mixtures thereof.
[0182] In some embodiments, the cationic lipid comprises from about
20 mol % to about 50 mol % of the total lipid present in the
particle. In a preferred embodiment, the cationic lipid comprises
about 40 mol % of the total lipid present in the particle.
[0183] In other embodiments, the non-cationic lipid comprises from
about 5 mol % to about 90 mol % of the total lipid present in the
particle. In certain instances, the non-cationic lipid comprises
about 10 mol % of the total lipid present in the particle. In
certain other instances, the non-cationic lipid comprises about 60
mol % of the total lipid present in the particle.
[0184] In further embodiments, the PEG-DAA conjugate comprises from
0 mol % to about 20 mol % of the total lipid present in the
particle. In a preferred embodiment, the PEG-DAA conjugate
comprises about 2 mol % of the total lipid present in the
particle.
[0185] In additional embodiments, the nucleic acid-lipid particle
further comprises cholesterol. In certain instances, the
cholesterol comprises from about 10 mol % to about 60 mol % of the
total lipid present in the particle. In a preferred embodiment, the
cholesterol comprises about 48 mol % of the total lipid present in
the particle.
[0186] In another embodiment, the modified siRNA in the nucleic
acid-lipid particle is not substantially degraded after exposure of
the particle to a nuclease at 37.degree. C. for 20 minutes. In a
related embodiment, the modified siRNA in the nucleic acid-lipid
particle is not substantially degraded after incubation of the
particle in serum at 37.degree. C. for 30 minutes. In a preferred
embodiment, the modified siRNA is fully encapsulated in the nucleic
acid-lipid particle.
[0187] In certain instances, the particle has an siRNA:lipid mass
ratio of from about 0.01 to about 0.2. In certain other instances,
the particle has an siRNA:lipid mass ratio of from about 0.02 to
about 0.1. In yet other instances, the particle has an siRNA:lipid
mass ratio of about 0.08.
[0188] In some instances, the particle has a median diameter of
from about 50 nm to about 150 nm. In other instances, the particle
has a median diameter of from about 70 nm to about 90 nm.
[0189] In yet another aspect, the present invention provides a
nucleic acid-lipid particle comprising: [0190] (a) an siRNA
molecule that silences PLK-1 expression; [0191] (b) a cationic
lipid comprising from about 50 mol % to about 85 mol % of the total
lipid present in the particle; [0192] (c) a non-cationic lipid
comprising from about 13 mol % to about 49.5 mol % of the total
lipid present in the particle; and [0193] (d) a conjugated lipid
that inhibits aggregation of particles comprising from about 0.5
mol % to about 2 mol % of the total lipid present in the
particle.
[0194] In one embodiment, the siRNA molecule comprises a
double-stranded region of about 15 to about 60 nucleotides in
length. In another embodiment, the siRNA molecule comprises at
least one of the sequences set forth in Tables 1-7 and 10-11.
[0195] In certain embodiments, the cationic lipid is a member
selected from the group consisting of DLinDMA, DLenDMA, DODAC,
DDAB, DOTAP, DSDMA, DOTMA, DODMA, DC-Chol, DMRIE, DOSPA, DOGS,
CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP,
DLinCDAP, DLin-K-DMA, DLin-K-XTC2-DMA, and a mixture thereof. In a
preferred embodiment, the cationic lipid comprises DLinDMA.
[0196] In another embodiment, the non-cationic lipid comprises
cholesterol or a derivative thereof. In certain instances, the
cholesterol or derivative thereof comprises from about 30 mol % to
about 45 mol % of the total lipid present in the particle.
Generally, the cholesterol derivative is a member selected from the
group consisting of cholestanol, cholestanone, cholestenone,
coprostanol, cholesteryl-2'-hydroxyethyl ether, and
cholesteryl-4'-hydroxybutyl ether.
[0197] In one alternative embodiment, the non-cationic lipid
comprises a phospholipid. In another alternative embodiment, the
non-cationic lipid comprises a mixture of a phospholipid and
cholesterol or a derivative thereof. In such embodiments, the
phospholipid may be a member selected from the group consisting of
DPPC, DSPC, DOPE, POPC, POPE, POPG, DPPE, DMPE, DSPE, DEPE, SOPE,
EPC, monomethyl-phosphatidylethanolamine,
dimethyl-phosphatidylethanolamine, and a mixture thereof. In
certain instances, the phospholipid comprises from about 4 mol % to
about 10 mol % of the total lipid present in the particle and the
cholesterol comprises from about 30 mol % to about 40 mol % of the
total lipid present in the particle. In a preferred embodiment, the
phospholipid comprises DPPC.
[0198] In yet another embodiment, the conjugated lipid that
inhibits aggregation of particles is a member selected from the
group consisting of a polyethyleneglycol (PEG)-lipid conjugate, a
polyamide (ATTA)-lipid conjugate, and a mixture thereof. In some
embodiments, the PEG-lipid conjugate is a member selected from the
group consisting of a PEG-diacylglycerol, a PEG dialkyloxypropyl, a
PEG-phospholipid, a PEG-ceramide, and a mixture thereof. In a
preferred embodiment, the conjugated lipid that inhibits
aggregation of particles comprises a PEG-dialkyloxypropyl (PEG-DAA)
conjugate. In certain instances, the PEG-DAA conjugate is a member
selected from the group consisting of a PEG-dilauryloxypropyl
(C.sub.12) conjugate, a PEG-dimyristyloxypropyl (C.sub.14)
conjugate, a PEG-dipalmityloxypropyl (C.sub.16) conjugate, and a
PEG-distearyloxypropyl (C.sub.18) conjugate. In one preferred
embodiment, the PEG-DAA conjugate is a PEG-dimyristyloxypropyl
(C.sub.14) conjugate. In another preferred embodiment, the PEG-DAA
conjugate comprises a PEG-distearyloxypropyl (C.sub.18) conjugate.
Additional PEG-lipid conjugates include, e.g., PEG-C-DOMG,
2KPEG-DMG, or mixtures thereof.
[0199] In a further embodiment, the nucleic acid in the nucleic
acid-lipid particle is not substantially degraded after exposure of
the particle to a nuclease at 37.degree. C. for 20 minutes. In a
related embodiment, the nucleic acid in the nucleic acid-lipid
particle is not substantially degraded after incubation of the
particle in serum at 37.degree. C. for 30 minutes. In a preferred
embodiment, the nucleic acid is fully encapsulated in the nucleic
acid-lipid particle.
[0200] In certain embodiments, the particle has a lipid:siRNA mass
ratio of from about 1 to about 100. In certain other embodiments,
the particle has a lipid:siRNA mass ratio of from about 5 to about
15. Preferably, the particle has a lipid:siRNA mass ratio of about
6. In some instances, the particle has a median diameter of from
about 50 nm to about 150 nm. In other instances, the particle has a
median diameter of from about 70 nm to about 90 nm.
[0201] In one preferred embodiment, the present invention provides
a nucleic acid-lipid particle comprising: [0202] (a) an siRNA
molecule that silences PLK-1 expression; [0203] (b) a cationic
lipid comprising from about 56.5 mol % to about 66.5 mol % of the
total lipid present in the particle; [0204] (c) a non-cationic
lipid comprising from about 31.5 mol % to about 42.5 mol % of the
total lipid present in the particle; and [0205] (d) a conjugated
lipid that inhibits aggregation of particles comprising from about
1 mol % to about 2 mol % of the total lipid present in the
particle.
[0206] In one embodiment, the siRNA molecule comprises a
double-stranded region of about 15 to about 60 nucleotides in
length. In another embodiment, the siRNA molecule comprises at
least one of the sequences set forth in Tables 1-7 and 10-11.
[0207] In certain embodiments, the cationic lipid is a member
selected from the group consisting of DLinDMA, DLenDMA, DODAC,
DDAB, DOTAP, DSDMA, DOTMA, DODMA, DC-Chol, DMRIE, DOSPA, DOGS,
CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP,
DLinCDAP, DLin-K-DMA, DLin-K-XTC2-DMA, and a mixture thereof.
Preferably, the cationic lipid comprises DLinDMA.
[0208] In other embodiments, the non-cationic lipid comprises
cholesterol a derivative thereof. Preferably, the non-cationic
lipid comprises cholesterol.
[0209] In further embodiments, the conjugated lipid that inhibits
aggregation of particles is a PEG-lipid conjugate selected from the
group consisting of a PEG-diacylglycerol, a PEG dialkyloxypropyl, a
PEG-phospholipid, a PEG-ceramide, and a mixture thereof.
Preferably, the conjugated lipid that inhibits aggregation of
particles comprises a PEG-DAA conjugate. Additional PEG-lipid
conjugates include, e.g., PEG-C-DOMG, 2KPEG-DMG, or mixtures
thereof.
[0210] In another preferred embodiment, the present invention
provides a nucleic acid-lipid particle, comprising: [0211] (a) an
siRNA molecule that silences PLK-1 expression; [0212] (b) a
cationic lipid comprising from about 52 mol % to about 62 mol % of
the total lipid present in the particle; [0213] (c) a non-cationic
lipid comprising from about 36 mol % to about 47 mol % of the total
lipid present in the particle; and [0214] (d) a conjugated lipid
that inhibits aggregation of particles comprising from about 1 mol
% to about 2 mol % of the total lipid present in the particle.
[0215] In one embodiment, the siRNA molecule comprises a
double-stranded region of about 15 to about 60 nucleotides in
length. In another embodiment, the siRNA molecule comprises at
least one of the sequences set forth in Tables 1-7 and 10-11.
[0216] In certain embodiments, the cationic lipid is a member
selected from the group consisting of DLinDMA, DLenDMA, DODAC,
DDAB, DOTAP, DSDMA, DOTMA, DODMA, DC-Chol, DMRIE, DOSPA, DOGS,
CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP,
DLinCDAP, DLin-K-DMA, DLin-K-XTC2-DMA, and a mixture thereof.
Preferably, the cationic lipid comprises DLinDMA.
[0217] In certain other embodiments, the non-cationic lipid
comprises a phospholipid. In alternative embodiments, the
non-cationic lipid comprises a mixture of a phospholipid and
cholesterol or a derivative thereof. The phospholipid may be, for
example, DPPC, DSPC, DOPE, POPC, POPE, POPG, DPPE, DMPE, DSPE,
DEPE, SOPE, EPC, monomethyl-phosphatidylethanolamine,
dimethyl-phosphatidylethanolamine, or a mixture thereof.
Preferably, the non-cationic lipid comprises a mixture of DPPC and
cholesterol. In such instances, the DPPC typically comprises from
about 5 mol % to about 9 mol % of the total lipid present in the
particle and the cholesterol typically comprises from about 32 mol
% to about 37 mol % of the total lipid present in the particle.
[0218] In further embodiments, the conjugated lipid that inhibits
aggregation of particles is a PEG-lipid conjugate selected from the
group consisting of a PEG-diacylglycerol, a PEG dialkyloxypropyl, a
PEG-phospholipid, a PEG-ceramide, and a mixture thereof.
Preferably, the conjugated lipid that inhibits aggregation of
particles comprises a PEG-DAA conjugate. Additional PEG-lipid
conjugates include, e.g., PEG-C-DOMG, 2KPEG-DMG, or mixtures
thereof.
[0219] In a further aspect, the present invention provides a
pharmaceutical composition comprising a nucleic acid-lipid particle
described herein and a pharmaceutically acceptable carrier.
[0220] In another aspect, the present invention provides a method
for introducing an siRNA that silences PLK-1 expression into a
cell, comprising contacting the cell with a nucleic acid-lipid
particle described herein.
[0221] In one embodiment, the cell is in a mammal. Preferably, the
mammal is a human.
[0222] In yet another aspect, the present invention provides a
method for the in vivo delivery of a nucleic acid, comprising
administering to a mammalian subject a nucleic acid-lipid particle
described herein.
[0223] In some embodiments, the administration is selected from the
group consisting of oral, intranasal, intravenous, intraperitoneal,
intramuscular, intra-articular, intralesional, intratracheal,
subcutaneous, and intradermal. In a preferred embodiment, the
mammalian subject is a human.
[0224] In a further aspect, the present invention provides a method
for treating cancer in a mammalian subject in need thereof,
comprising administering to the mammalian subject a therapeutically
effective amount of a nucleic acid-lipid particle described
herein.
[0225] In certain embodiments, the cancer is liver cancer (e.g.,
hepatocellular carcinoma). In a preferred embodiment, the mammalian
subject is a human.
[0226] In another aspect, the present invention provides a method
for introducing an siRNA that silences PLK-1 expression into a
cell, the method comprising contacting the cell with a modified
siRNA molecule described herein.
[0227] In one embodiment, the modified siRNA molecule is in a
carrier system. The carrier system may be, for example, a nucleic
acid-lipid particle, a liposome, a micelle, a virosome, a nucleic
acid complex, or a mixture thereof. Typically, the nucleic acid
complex comprises the modified siRNA molecule complexed with a
cationic lipid, a cationic polymer, a cyclodextrin, or a mixture
thereof. In certain instances, the modified siRNA molecule is
complexed with a cationic polymer, wherein the cationic polymer is
polyethylenimine (PEI). In a preferred embodiment, the carrier
system is a nucleic acid-lipid particle comprising: the modified
siRNA molecule; a cationic lipid; and a non-cationic lipid.
[0228] In certain embodiments, the nucleic acid-lipid particle
further comprises a conjugated lipid that prevents aggregation of
particles. In other embodiments, the presence of the nucleic
acid-lipid particle is detectable at least 1 hour after
administration of the particle. In yet other embodiments, more than
10% of a plurality of the particles are present in the plasma of a
mammal about 1 hour after administration. In further embodiments,
the cell is in a mammal. Preferably, the mammal is a human.
[0229] In yet another aspect, the present invention provides a
method for in vivo delivery of an siRNA that silences PLK-1
expression, the method comprising administering to a mammalian
subject a modified siRNA molecule described herein.
[0230] In one embodiment, the modified siRNA molecule is in a
carrier system. The carrier system may be, for example, a nucleic
acid-lipid particle, a liposome, a micelle, a virosome, a nucleic
acid complex, or a mixture thereof. Typically, the nucleic acid
complex comprises the modified siRNA molecule complexed with a
cationic lipid, a cationic polymer, a cyclodextrin, or a mixture
thereof. In certain instances, the modified siRNA molecule is
complexed with a cationic polymer, wherein the cationic polymer is
polyethylenimine (PEI). In a preferred embodiment, the carrier
system is a nucleic acid-lipid particle comprising: the modified
siRNA molecule; a cationic lipid; and a non-cationic lipid.
[0231] In certain embodiments, the nucleic acid-lipid particle
further comprises a conjugated lipid that prevents aggregation of
particles. In other embodiments, the administration is selected
from the group consisting of oral, intranasal, intravenous,
intraperitoneal, intramuscular, intra-articular, intralesional,
intratracheal, subcutaneous, and intradermal. In a preferred
embodiment, the mammalian subject is a human.
[0232] In still yet another aspect, the present invention provides
a method for treating cancer in a mammalian subject in need
thereof, comprising administering to the mammalian subject a
therapeutically effective amount of a modified siRNA molecule
described herein.
[0233] In certain embodiments, the cancer is liver cancer (e.g.,
hepatocellular carcinoma). In a preferred embodiment, the mammalian
subject is a human.
[0234] In a further aspect, the present invention provides a method
for modifying an immunostimulatory siRNA that silences PLK-1
expression, the method comprising: [0235] (a) providing an
unmodified siRNA sequence capable of silencing PLK-1 expression,
wherein the unmodified siRNA sequence has immunostimulatory
properties and comprises a double-stranded sequence of about 15 to
about 60 nucleotides in length; and [0236] (b) modifying the
unmodified siRNA sequence by substituting one or more nucleotides
with modified nucleotides, [0237] thereby generating a modified
siRNA molecule that is less immunostimulatory than the unmodified
siRNA sequence and is capable of silencing PLK-1 expression.
[0238] In one embodiment, the modified siRNA molecule comprises
modified nucleotides selected from the group consisting of
2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2'F)
nucleotides, T-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE)
nucleotides, locked nucleic acid (LNA) nucleotides, and mixtures
thereof. In a preferred embodiment, the modified siRNA molecule
comprises 2'OMe nucleotides. As a non-limiting example, the 2'OMe
nucleotides may be selected from the group consisting of
TOMe-guanosine nucleotides, 2'OMe-uridine nucleotides, and mixtures
thereof.
[0239] Typically, two, three, four, five, six, seven, or more of
the nucleotides in the unmodified siRNA sequence are substituted
with modified nucleotides. In some embodiments, less than about 25%
of the nucleotides in the double-stranded region of the unmodified
siRNA sequence are substituted with modified nucleotides. In other
embodiments, less than about 20% of the nucleotides in the
double-stranded region of the unmodified siRNA sequence are
substituted with modified nucleotides. In yet other embodiments,
less than about 15% of the nucleotides in the double-stranded
region of the unmodified siRNA sequence are substituted with
modified nucleotides. In additional embodiments, from about 10% to
about 20% of the nucleotides in the double-stranded region of the
unmodified siRNA sequence are substituted with modified
nucleotides.
[0240] In certain instances, the modified siRNA molecule is at
least about 70% less immunostimulatory than the unmodified siRNA
sequence. In certain other instances, the modified siRNA molecule
has an IC.sub.50 that is less than or equal to ten-fold that of the
unmodified siRNA sequence.
[0241] In some embodiments, the method further comprises: (c)
confirming that the modified siRNA molecule is less
immunostimulatory by contacting the modified siRNA molecule with a
mammalian responder cell under conditions suitable for the
responder cell to produce a detectable immune response.
[0242] In a related aspect, the present invention provides a method
for identifying and modifying an immunostimulatory siRNA that
silences PLK-1 expression, the method comprising: [0243] (a)
contacting an unmodified siRNA sequence capable of silencing PLK-1
expression with a mammalian responder cell under conditions
suitable for the responder cell to produce a detectable immune
response; [0244] (b) identifying the unmodified siRNA sequence as
an immunostimulatory siRNA by the presence of a detectable immune
response in the responder cell; and [0245] (c) modifying the
unmodified siRNA sequence by substituting one or more nucleotides
with modified nucleotides, thereby generating a modified siRNA
molecule that is less immunostimulatory than the unmodified siRNA
sequence.
[0246] In one embodiment, the modified siRNA molecule comprises
modified nucleotides selected from the group consisting of
2'-O-methyl (TOMe) nucleotides, 2'-deoxy-T-fluoro (2'F)
nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE)
nucleotides, locked nucleic acid (LNA) nucleotides, and mixtures
thereof. In a preferred embodiment, the modified siRNA molecule
comprises 2'OMe nucleotides. As a non-limiting example, the TOMe
nucleotides may be selected from the group consisting of
2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides, and
mixtures thereof.
[0247] Typically, two, three, four, five, six, seven, or more of
the nucleotides in the unmodified siRNA sequence are substituted
with modified nucleotides. In some embodiments, less than about 25%
of the nucleotides in the double-stranded region of the unmodified
siRNA sequence are substituted with modified nucleotides. In other
embodiments, less than about 20% of the nucleotides in the
double-stranded region of the unmodified siRNA sequence are
substituted with modified nucleotides. In yet other embodiments,
less than about 15% of the nucleotides in the double-stranded
region of the unmodified siRNA sequence are substituted with
modified nucleotides. In additional embodiments, from about 10% to
about 20% of the nucleotides in the double-stranded region of the
unmodified siRNA sequence are substituted with modified
nucleotides.
[0248] In certain instances, the modified siRNA molecule is at
least about 70% less immunostimulatory than the unmodified siRNA
sequence. In certain other instances, the modified siRNA molecule
has an IC.sub.50 that is less than or equal to ten-fold that of the
unmodified siRNA sequence.
[0249] In some embodiments, the mammalian responder cell is a
peripheral blood mononuclear cell or dendritic cell. In other
embodiments, the detectable immune response comprises production of
a cytokine or growth factor selected from the group consisting of
TNF-.alpha., IFN-.alpha., IFN-.beta., IFN-.gamma., IL-6, IL-12, and
combinations thereof. In further embodiments, the detectable immune
response comprises induction of interferon-induced protein with
tetratricopeptide repeats 1 (IFIT1) mRNA.
[0250] In another aspect, the present invention provides a method
for sensitizing a cell to the effects of a chemotherapy drug, the
method comprising contacting the cell with an siRNA molecule that
silences PLK-1 expression prior to administering the chemotherapy
drug.
[0251] In one embodiment, the siRNA molecule comprises a
double-stranded region of about 15 to about 60 nucleotides in
length. In another embodiment, the cell is contacted with a
modified siRNA molecule that silences PLK-1 expression. In certain
instances, one or more of the nucleotides in the double-stranded
region comprise modified nucleotides. Preferably, the modified
nucleotides are selected from the group consisting of
TOMe-guanosine nucleotides, 2'OMe-uridine nucleotides, and mixtures
thereof. In certain other instances, the modified siRNA molecule is
less immunostimulatory than a corresponding unmodified siRNA
sequence.
[0252] In some embodiments, the siRNA molecule is in a carrier
system. Non-limiting examples of carrier systems include a nucleic
acid-lipid particle, a liposome, a micelle, a virosome, a nucleic
acid complex, and a mixture thereof. In a preferred embodiment, the
carrier system is a nucleic acid-lipid particle comprising: the
siRNA molecule; a cationic lipid; and a non-cationic lipid.
[0253] In other embodiments, the nucleic acid-lipid particle
further comprises a conjugated lipid that prevents aggregation of
particles. In certain instances, the cell is a cancer cell. In a
further embodiment, the cancer cell is in a mammal. Preferably, the
mammal is a human.
[0254] In certain embodiments, the chemotherapy drug is selected
from the group consisting of paclitaxel, fluorouracil (5-FU),
irinotecan, sorafenib, and mixtures thereof.
[0255] In further aspects, the present invention provides
compositions comprising the asymmetrical interfering RNA (aiRNA)
molecules described herein that target PLK-1 expression and methods
of using such compositions to silence PLK-1 expression.
[0256] In one embodiment, the aiRNA molecule comprises a
double-stranded (duplex) region of about 10 to about 25 (base
paired) nucleotides in length,
[0257] wherein the aiRNA molecule comprises an antisense strand
comprising 5' and 3' overhangs, and
[0258] wherein the aiRNA molecule is capable of silencing PLK-1
expression.
[0259] In certain instances, the aiRNA molecule comprises a
double-stranded (duplex) region of about 12-20, 12-19, 12-18,
13-17, or 14-17 (base paired) nucleotides in length, more typically
12, 13, 14, 15, 16, 17, 18, 19, or 20 (base paired) nucleotides in
length. In certain other instances, the 5' and 3' overhangs on the
antisense strand comprise sequences that are complementary to the
target PLK-1 mRNA, and may optionally further comprise nontargeting
sequences. In some embodiments, each of the 5' and 3' overhangs on
the antisense strand comprises or consists of one, two, three,
four, five, six, seven, or more nucleotides. Exemplary aiRNA
molecules targeting PLK-1 mRNA are provided in Table 8.
[0260] In other embodiments, the aiRNA molecule comprises modified
nucleotides selected from the group consisting of 2'-O-methyl
(2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy
nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, locked
nucleic acid (LNA) nucleotides, and mixtures thereof. In a
preferred embodiment, the aiRNA molecule comprises 2'OMe
nucleotides. As a non-limiting example, the 2'OMe nucleotides may
be selected from the group consisting of 2'OMe-guanosine
nucleotides, 2'OMe-uridine nucleotides, and mixtures thereof.
[0261] In related aspects, the present invention provides
compositions comprising the microRNA (miRNA) molecules described
herein that target PLK-1 expression and methods of using such
compositions to silence PLK-1 expression.
[0262] In one embodiment, the miRNA molecule comprises about 15 to
about 60 nucleotides in length, wherein the miRNA molecule is
capable of silencing PLK-1 expression.
[0263] In certain instances, the miRNA molecule comprises about
15-50, 15-40, or 15-30 nucleotides in length, more typically about
15-25 or 19-25 nucleotides in length, and are preferably about
20-24, 21-22, or 21-23 nucleotides in length. In a preferred
embodiment, the miRNA molecule is a mature miRNA molecule targeting
PLK-1 mRNA. Exemplary miRNA molecules targeting PLK-1 mRNA are
provided in Table 9.
[0264] In some embodiments, the miRNA molecule comprises modified
nucleotides selected from the group consisting of 2'-O-methyl
(2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy
nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides, locked
nucleic acid (LNA) nucleotides, and mixtures thereof. In a
preferred embodiment, the miRNA molecule comprises 2'OMe
nucleotides. As a non-limiting example, the 2'OMe nucleotides may
be selected from the group consisting of 2'OMe-guanosine
nucleotides, 2'OMe-uridine nucleotides, and mixtures thereof.
IV. Interfering RNA
A. siRNAs
[0265] The unmodified and modified siRNA molecules of the present
invention are capable of silencing PLK-1 expression and are
typically about 15 to 60 nucleotides in length. The modified siRNA
molecules are generally less immunostimulatory than a corresponding
unmodified siRNA sequence and retain RNAi activity against the
target PLK-1 sequence. In some embodiments, the modified siRNA
contains at least one 2'OMe purine or pyrimidine nucleotide such as
a 2'OMe-guanosine, 2'OMe-uridine, 2'OMe-adenosine, and/or
2'OMe-cytosine nucleotide. In preferred embodiments, one or more of
the uridine and/or guanosine nucleotides are modified. The modified
nucleotides can be present in one strand (i.e., sense or antisense)
or both strands of the siRNA. The siRNA sequences may have
overhangs (e.g., 3' or 5' overhangs as described in Elbashir et
al., Genes Dev., 15:188 (2001) or Nykanen et al., Cell, 107:309
(2001)), or may lack overhangs (i.e., have blunt ends).
[0266] The modified siRNA generally comprises from about 1% to
about 100% (e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,
11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%,
24%, 25%, 26%, 27%, 28%, 29%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%) modified nucleotides in
the double-stranded region of the siRNA duplex. In certain
embodiments, one, two, three, four, five, six, seven, eight, nine,
ten, or more of the nucleotides in the double-stranded region of
the siRNA comprise modified nucleotides.
[0267] In some embodiments, less than about 25% (e.g., less than
about 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%,
13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%) of the
nucleotides in the double-stranded region of the siRNA comprise
modified nucleotides.
[0268] In other embodiments, from about 1% to about 25% (e.g., from
about 1%-25%, 2%-25%, 3%-25%, 4%-25%, 5%-25%, 6%-25%, 7%-25%,
8%-25%, 9%-25%, 10%-25%, 11%-25%, 12%-25%, 13%-25%, 14%-25%,
15%-25%, 16%-25%, 17%-25%, 18%-25%, 19%-25%, 20%-25%, 21%-25%,
22%-25%, 23%-25%, or 24%-25%) or from about 1% to about 20% (e.g.,
from about 1%-20%, 2%-20%, 3%-20%, 4%-20%, 5%-20%, 6%-20%, 7%-20%,
8%-20%, 9%-20%, 10%-20%, 11%-20%, 12%-20%, 13%-20%, 14%-20%,
15%-20%, 16%-20%, 17%-20%, 18%-20%, or 19%-20%) of the nucleotides
in the double-stranded region of the siRNA comprise modified
nucleotides.
[0269] In further embodiments, e.g., when one or both strands of
the siRNA are selectively modified at uridine and/or guanosine
nucleotides, the resulting modified siRNA can comprise less than
about 30% modified nucleotides (e.g., less than about 30%, 29%,
28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%,
15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%
modified nucleotides) or from about 1% to about 30% modified
nucleotides (e.g., from about 1%-30%, 2%-30%, 3%-30%, 4%-30%,
5%-30%, 6%-30%, 7%-30%, 8%-30%, 9%-30%, 10%-30%, 11%-30%, 12%-30%,
13%-30%, 14%-30%, 15%-30%, 16%-30%, 17%-30%, 18%-30%, 19%-30%,
20%-30%, 21%-30%, 22%-30%, 23%-30%, 24%-30%, 25%-30%, 26%-30%,
27%-30%, 28%-30%, or 29%-30% modified nucleotides).
[0270] 1. Selection of siRNA Sequences
[0271] Suitable siRNA sequences can be identified using any means
known in the art. Typically, the methods described in Elbashir et
al., Nature, 411:494-498 (2001) and Elbashir et al., EMBO 1,
20:6877-6888 (2001) are combined with rational design rules set
forth in Reynolds et al., Nature Biotech., 22(3):326-330
(2004).
[0272] Generally, the nucleotide sequence 3' of the AUG start codon
of a transcript from the target gene of interest is scanned for
dinucleotide sequences (e.g., AA, NA, CC, GG, or UU, wherein N=C,
G, or U) (see, e.g., Elbashir et al., EMBO J., 20:6877-6888
(2001)). The nucleotides immediately 3' to the dinucleotide
sequences are identified as potential siRNA sequences (i.e., a
target sequence or a sense strand sequence). Typically, the 19, 21,
23, 25, 27, 29, 31, 33, 35, or more nucleotides immediately 3' to
the dinucleotide sequences are identified as potential siRNA
sequences. In some embodiments, the dinucleotide sequence is an AA
or NA sequence and the 19 nucleotides immediately 3' to the AA or
NA dinucleotide are identified as a potential siRNA sequences.
siRNA sequences are usually spaced at different positions along the
length of the target gene. To further enhance silencing efficiency
of the siRNA sequences, potential siRNA sequences may be analyzed
to identify sites that do not contain regions of homology to other
coding sequences, e.g., in the target cell or organism. For
example, a suitable siRNA sequence of about 21 base pairs typically
will not have more than 16-17 contiguous base pairs of homology to
coding sequences in the target cell or organism. If the siRNA
sequences are to be expressed from an RNA Pol III promoter, siRNA
sequences lacking more than 4 contiguous A's or T's are
selected.
[0273] Once a potential siRNA sequence has been identified, a
complementary sequence (i.e., an antisense strand sequence) can be
designed. A potential siRNA sequence can also be analyzed using a
variety of criteria known in the art. For example, to enhance their
silencing efficiency, the siRNA sequences may be analyzed by a
rational design algorithm to identify sequences that have one or
more of the following features: (1) G/C content of about 25% to
about 60% G/C; (2) at least 3 A/Us at positions 15-19 of the sense
strand; (3) no internal repeats; (4) an A at position 19 of the
sense strand; (5) an A at position 3 of the sense strand; (6) a U
at position 10 of the sense strand; (7) no G/C at position 19 of
the sense strand; and (8) no G at position 13 of the sense strand.
siRNA design tools that incorporate algorithms that assign suitable
values of each of these features and are useful for selection of
siRNA can be found at, e.g., http://boz094.ust.hk/RNAi/siRNA. One
of skill in the art will appreciate that sequences with one or more
of the foregoing characteristics may be selected for further
analysis and testing as potential siRNA sequences.
[0274] Additionally, potential siRNA sequences with one or more of
the following criteria can often be eliminated as siRNA: (1)
sequences comprising a stretch of 4 or more of the same base in a
row; (2) sequences comprising homopolymers of Gs (i.e., to reduce
possible non-specific effects due to structural characteristics of
these polymers; (3) sequences comprising triple base motifs (e.g.,
GGG, CCC, AAA, or TTT); (4) sequences comprising stretches of 7 or
more G/Cs in a row; and (5) sequences comprising direct repeats of
4 or more bases within the candidates resulting in internal
fold-back structures. However, one of skill in the art will
appreciate that sequences with one or more of the foregoing
characteristics may still be selected for further analysis and
testing as potential siRNA sequences.
[0275] In some embodiments, potential siRNA sequences may be
further analyzed based on siRNA duplex asymmetry as described in,
e.g., Khvorova et al., Cell, 115:209-216 (2003); and Schwarz et
al., Cell, 115:199-208 (2003). In other embodiments, potential
siRNA sequences may be further analyzed based on secondary
structure at the mRNA target site as described in, e.g., Luo et
al., Biophys. Res. Commun., 318:303-310 (2004). For example, mRNA
secondary structure can be modeled using the Mfold algorithm
(available at
http://www.bioinfoxpLedu/applications/mfold/rna/form1.cgi) to
select siRNA sequences which favor accessibility at the mRNA target
site where less secondary structure in the form of base-pairing and
stem-loops is present.
[0276] Once a potential siRNA sequence has been identified, the
sequence can be analyzed for the presence of any immunostimulatory
properties, e.g., using an in vitro cytokine assay or an in vivo
animal model. Motifs in the sense and/or antisense strand of the
siRNA sequence such as GU-rich motifs (e.g., 5'-GU-3', 5'-UGU-3',
5'-GUGU-3', 5'-UGUGU-3', etc.) can also provide an indication of
whether the sequence may be immunostimulatory. Once an siRNA
molecule is found to be immunostimulatory, it can then be modified
to decrease its immunostimulatory properties as described herein.
As a non-limiting example, an siRNA sequence can be contacted with
a mammalian responder cell under conditions such that the cell
produces a detectable immune response to determine whether the
siRNA is an immunostimulatory or a non-immunostimulatory siRNA. The
mammalian responder cell may be from a naive mammal (i.e., a mammal
that has not previously been in contact with the gene product of
the siRNA sequence). The mammalian responder cell may be, e.g., a
peripheral blood mononuclear cell (PBMC), a macrophage, and the
like. The detectable immune response may comprise production of a
cytokine or growth factor such as, e.g., TNF-.alpha., IFN-.alpha.,
IFN-.gamma., IL-6, IL-12, or a combination thereof. An siRNA
molecule identified as being immunostimulatory can then be modified
to decrease its immunostimulatory properties by replacing at least
one of the nucleotides on the sense and/or antisense strand with
modified nucleotides. For example, less than about 30% (e.g., less
than about 30%, 25%, 20%, 15%, 10%, or 5%) of the nucleotides in
the double-stranded region of the siRNA duplex can be replaced with
modified nucleotides such as 2'OMe nucleotides. The modified siRNA
can then be contacted with a mammalian responder cell as described
above to confirm that its immunostimulatory properties have been
reduced or abrogated.
[0277] Suitable in vitro assays for detecting an immune response
include, but are not limited to, the double monoclonal antibody
sandwich immunoassay technique of David et al. (U.S. Pat. No.
4,376,110); monoclonal-polyclonal antibody sandwich assays (Wide et
al., in Kirkham and Hunter, eds., Radioimmunoassay Methods, E. and
S. Livingstone, Edinburgh (1970)); the "Western blot" method of
Gordon et al. (U.S. Pat. No. 4,452,901); immunoprecipitation of
labeled ligand (Brown et al., J. Biol. Chem., 255:4980-4983
(1980)); enzyme-linked immunosorbent assays (ELISA) as described,
for example, by Raines et al., J. Biol. Chem., 257:5154-5160
(1982); immunocytochemical techniques, including the use of
fluorochromes (Brooks et al., Clin. Exp. Immunol., 39:477 (1980));
and neutralization of activity (Bowen-Pope et al., Proc. Natl.
Acad. Sci. USA, 81:2396-2400 (1984)). In addition to the
immunoassays described above, a number of other immunoassays are
available, including those described in U.S. Pat. Nos. 3,817,827;
3,850,752; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074;
and 4,098,876.
[0278] A non-limiting example of an in vivo model for detecting an
immune response includes an in vivo mouse cytokine induction assay
as described in, e.g., Judge et al., Mol. Ther., 13:494-505 (2006).
In certain embodiments, the assay that can be performed as follows:
(1) siRNA can be administered by standard intravenous injection in
the lateral tail vein; (2) blood can be collected by cardiac
puncture about 6 hours after administration and processed as plasma
for cytokine analysis; and (3) cytokines can be quantified using
sandwich ELISA kits according to the manufacturer's instructions
(e.g., mouse and human IFN-.alpha. (PBL Biomedical; Piscataway,
N.J.); human IL-6 and TNF-.alpha. (eBioscience; San Diego, Calif.);
and mouse IL-6, TNF-.alpha., and IFN-.gamma. (BD Biosciences; San
Diego, Calif.)).
[0279] Monoclonal antibodies that specifically bind cytokines and
growth factors are commercially available from multiple sources and
can be generated using methods known in the art (see, e.g., Kohler
et al., Nature, 256: 495-497 (1975) and Harlow and Lane,
ANTIBODIES, A LABORATORY MANUAL, Cold Spring Harbor Publication,
New York (1999)). Generation of monoclonal antibodies has been
previously described and can be accomplished by any means known in
the art (Buhring et al., in Hybridoma, Vol. 10, No. 1, pp. 77-78
(1991)). In some methods, the monoclonal antibody is labeled (e.g.,
with any composition detectable by spectroscopic, photochemical,
biochemical, electrical, optical, or chemical means) to facilitate
detection.
[0280] 2. Generating siRNA Molecules
[0281] siRNA can be provided in several forms including, e.g., as
one or more isolated small-interfering RNA (siRNA) duplexes, as
longer double-stranded RNA (dsRNA), or as siRNA or dsRNA
transcribed from a transcriptional cassette in a DNA plasmid. The
siRNA sequences may have overhangs (e.g., 3' or 5' overhangs as
described in Elbashir et al., Genes Dev., 15:188 (2001) or Nykanen
et al., Cell, 107:309 (2001), or may lack overhangs (i.e., to have
blunt ends).
[0282] An RNA population can be used to provide long precursor
RNAs, or long precursor RNAs that have substantial or complete
identity to a selected target sequence can be used to make the
siRNA. The RNAs can be isolated from cells or tissue, synthesized,
and/or cloned according to methods well known to those of skill in
the art. The RNA can be a mixed population (obtained from cells or
tissue, transcribed from cDNA, subtracted, selected, etc.), or can
represent a single target sequence. RNA can be naturally occurring
(e.g., isolated from tissue or cell samples), synthesized in vitro
(e.g., using T7 or SP6 polymerase and PCR products or a cloned
cDNA), or chemically synthesized.
[0283] To form a long dsRNA, for synthetic RNAs, the complement is
also transcribed in vitro and hybridized to form a dsRNA. If a
naturally occurring RNA population is used, the RNA complements are
also provided (e.g., to form dsRNA for digestion by E. coli RNAse
III or Dicer), e.g., by transcribing cDNAs corresponding to the RNA
population, or by using RNA polymerases. The precursor RNAs are
then hybridized to form double stranded RNAs for digestion. The
dsRNAs can be directly administered to a subject or can be digested
in vitro prior to administration.
[0284] Methods for isolating RNA, synthesizing RNA, hybridizing
nucleic acids, making and screening cDNA libraries, and performing
PCR are well known in the art (see, e.g., Gubler and Hoffman, Gene,
25:263-269 (1983); Sambrook et al., supra; Ausubel et al., supra),
as are PCR methods (see, U.S. Pat. Nos. 4,683,195 and 4,683,202;
PCR Protocols: A Guide to Methods and Applications (Innis et al.,
eds, 1990)). Expression libraries are also well known to those of
skill in the art. Additional basic texts disclosing the general
methods of use in this invention include Sambrook et al., Molecular
Cloning, A Laboratory Manual (2nd ed. 1989); Kriegler, Gene
Transfer and Expression: A Laboratory Manual (1990); and Current
Protocols in Molecular Biology (Ausubel et al., eds., 1994).
[0285] Preferably, siRNA are chemically synthesized. The
oligonucleotides that comprise the siRNA molecules of the present
invention can be synthesized using any of a variety of techniques
known in the art, such as those described in Usman et al., J. Am.
Chem. Soc., 109:7845 (1987); Scaringe et al., Nucl. Acids Res.,
18:5433 (1990); Wincott et al., Nucl. Acids Res., 23:2677-2684
(1995); and Wincott et al., Methods Mol. Bio., 74:59 (1997). The
synthesis of oligonucleotides makes use of common nucleic acid
protecting and coupling groups, such as dimethoxytrityl at the
5'-end and phosphoramidites at the 3'-end. As a non-limiting
example, small scale syntheses can be conducted on an Applied
Biosystems synthesizer using a 0.2 .mu.mol scale protocol.
Alternatively, syntheses at the 0.2 .mu.mol scale can be performed
on a 96-well plate synthesizer from Protogene (Palo Alto, Calif.).
However, a larger or smaller scale of synthesis is also within the
scope of the present invention. Suitable reagents for
oligonucleotide synthesis, methods for RNA deprotection, and
methods for RNA purification are known to those of skill in the
art.
[0286] The siRNA molecules of the present invention can also be
synthesized via a tandem synthesis technique, wherein both strands
are synthesized as a single continuous oligonucleotide fragment or
strand separated by a cleavable linker that is subsequently cleaved
to provide separate fragments or strands that hybridize to form the
siRNA duplex. The linker can be a polynucleotide linker or a
non-nucleotide linker. The tandem synthesis of siRNA can be readily
adapted to both multiwell/multiplate synthesis platforms as well as
large scale synthesis platforms employing batch reactors, synthesis
columns, and the like. Alternatively, siRNA molecules can be
assembled from two distinct oligonucleotides, wherein one
oligonucleotide comprises the sense strand and the other comprises
the antisense strand of the siRNA. For example, each strand can be
synthesized separately and joined together by hybridization or
ligation following synthesis and/or deprotection. In certain other
instances, siRNA molecules can be synthesized as a single
continuous oligonucleotide fragment, where the self-complementary
sense and antisense regions hybridize to form an siRNA duplex
having hairpin secondary structure.
[0287] 3. Modifying siRNA Sequences
[0288] In certain aspects, the siRNA molecules of the present
invention comprise a duplex having two strands and at least one
modified nucleotide in the double-stranded region, wherein each
strand is about 15 to about 60 nucleotides in length.
Advantageously, the modified siRNA is less immunostimulatory than a
corresponding unmodified siRNA sequence, but retains the capability
of silencing the expression of a target sequence. In preferred
embodiments, the degree of chemical modifications introduced into
the siRNA molecule strikes a balance between reduction or
abrogation of the immunostimulatory properties of the siRNA and
retention of RNAi activity. As a non-limiting example, an siRNA
molecule that targets PLK-1 can be minimally modified (e.g., less
than about 30%, 25%, 20%, 15%, 10%, or 5% modified) at selective
uridine and/or guanosine nucleotides within the siRNA duplex to
eliminate the immune response generated by the siRNA while
retaining its capability to silence PLK-1 expression.
[0289] Examples of modified nucleotides suitable for use in the
present invention include, but are not limited to, ribonucleotides
having a 2'-O-methyl (2'OMe), 2'-deoxy-2'-fluoro (2'F), 2'-deoxy,
5-C-methyl, 2'-O-(2-methoxyethyl) (MOE), 4'-thio, 2'-amino, or
2'-C-allyl group. Modified nucleotides having a Northern
conformation such as those described in, e.g., Saenger, Principles
of Nucleic Acid Structure, Springer-Verlag Ed. (1984), are also
suitable for use in the siRNA molecules of the present invention.
Such modified nucleotides include, without limitation, locked
nucleic acid (LNA) nucleotides (e.g., 2'-O,
4'-C-methylene-(D-ribofuranosyl) nucleotides),
2'-O-(2-methoxyethyl) (MOE) nucleotides, 2'-methyl-thio-ethyl
nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides,
2'-deoxy-2'-chloro (2'Cl) nucleotides, and 2'-azido nucleotides. In
certain instances, the siRNA molecules of the present invention
include one or more G-clamp nucleotides. A G-clamp nucleotide
refers to a modified cytosine analog wherein the modifications
confer the ability to hydrogen bond both Watson-Crick and Hoogsteen
faces of a complementary guanine nucleotide within a duplex (see,
e.g., Lin et al., J. Am. Chem. Soc., 120:8531-8532 (1998)). In
addition, nucleotides having a nucleotide base analog such as, for
example, C-phenyl, C-naphthyl, other aromatic derivatives, inosine,
azole carboxamides, and nitroazole derivatives such as
3-nitropyrrole, 4-nitroindole, 5-nitroindole, and 6-nitroindole
(see, e.g., Loakes, Nucl. Acids Res., 29:2437-2447 (2001)) can be
incorporated into the siRNA molecules of the present invention.
[0290] In certain embodiments, the siRNA molecules of the present
invention further comprise one or more chemical modifications such
as terminal cap moieties, phosphate backbone modifications, and the
like. Examples of terminal cap moieties include, without
limitation, inverted deoxy abasic residues, glyceryl modifications,
4',5'-methylene nucleotides, 1-(.beta.-D-erythrofuranosyl)
nucleotides, 4'-thio nucleotides, carbocyclic nucleotides,
1,5-anhydrohexitol nucleotides, L-nucleotides, .alpha.-nucleotides,
modified base nucleotides, threo-pentofuranosyl nucleotides,
acyclic 3',4'-seco nucleotides, acyclic 3,4-dihydroxybutyl
nucleotides, acyclic 3,5-dihydroxypentyl nucleotides,
3'-3'-inverted nucleotide moieties, 3'-3'-inverted abasic moieties,
3'-2'-inverted nucleotide moieties, 3'-2'-inverted abasic moieties,
5'-5'-inverted nucleotide moieties, 5'-5'-inverted abasic moieties,
3'-5'-inverted deoxy abasic moieties, 5'-amino-alkyl phosphate,
1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate,
6-aminohexyl phosphate, 1,2-aminododecyl phosphate, hydroxypropyl
phosphate, 1,4-butanediol phosphate, 3'-phosphoramidate,
5'-phosphoramidate, hexylphosphate, aminohexyl phosphate,
3'-phosphate, 5'-amino, 3'-phosphorothioate, 5'-phosphorothioate,
phosphorodithioate, and bridging or non-bridging methylphosphonate
or 5'-mercapto moieties (see, e.g., U.S. Pat. No. 5,998,203;
Beaucage et al., Tetrahedron 49:1925 (1993)). Non-limiting examples
of phosphate backbone modifications (i.e., resulting in modified
internucleotide linkages) include phosphorothioate,
phosphorodithioate, methylphosphonate, phosphotriester, morpholino,
amidate, carbamate, carboxymethyl, acetamidate, polyamide,
sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and
alkylsilyl substitutions (see, e.g., Hunziker et al., Nucleic Acid
Analogues: Synthesis and Properties, in Modern Synthetic Methods,
VCH, 331-417 (1995); Mesmaeker et al., Novel Backbone Replacements
for Oligonucleotides, in Carbohydrate Modifications in Antisense
Research, ACS, 24-39 (1994)). Such chemical modifications can occur
at the 5'-end and/or 3'-end of the sense strand, antisense strand,
or both strands of the siRNA.
[0291] In some embodiments, the sense and/or antisense strand of
the siRNA molecule can further comprise a 3'-terminal overhang
having about 1 to about 4 (e.g., 1, 2, 3, or 4) 2'-deoxy
ribonucleotides and/or any combination of modified and unmodified
nucleotides. Additional examples of modified nucleotides and types
of chemical modifications that can be introduced into the modified
siRNA molecules of the present invention are described, e.g., in UK
Patent No. GB 2,397,818 B and U.S. Patent Publication Nos.
20040192626, 20050282188, and 20070135372.
[0292] The modified siRNA molecules of the present invention can
optionally comprise one or more non-nucleotides in one or both
strands of the siRNA. As used herein, the term "non-nucleotide"
refers to any group or compound that can be incorporated into a
nucleic acid chain in the place of one or more nucleotide units,
including sugar and/or phosphate substitutions, and allows the
remaining bases to exhibit their activity. The group or compound is
abasic in that it does not contain a commonly recognized nucleotide
base such as adenosine, guanine, cytosine, uracil, or thymine and
therefore lacks a base at the 1'-position.
[0293] In other embodiments, chemical modification of the siRNA
comprises attaching a conjugate to the chemically-modified siRNA
molecule. The conjugate can be attached at the 5' and/or 3'-end of
the sense and/or antisense strand of the chemically-modified siRNA
via a covalent attachment such as, e.g., a biodegradable linker.
The conjugate can also be attached to the chemically-modified
siRNA, e.g., through a carbamate group or other linking group (see,
e.g., U.S. Patent Publication Nos. 20050074771, 20050043219, and
20050158727). In certain instances, the conjugate is a molecule
that facilitates the delivery of the chemically-modified siRNA into
a cell. Examples of conjugate molecules suitable for attachment to
the chemically-modified siRNA of the present invention include,
without limitation, steroids such as cholesterol, glycols such as
polyethylene glycol (PEG), human serum albumin (HSA), fatty acids,
carotenoids, terpenes, bile acids, folates (e.g., folic acid,
folate analogs and derivatives thereof), sugars (e.g., galactose,
galactosamine, N-acetyl galactosamine, glucose, mannose, fructose,
fucose, etc.), phospholipids, peptides, ligands for cellular
receptors capable of mediating cellular uptake, and combinations
thereof (see, e.g., U.S. Patent Publication Nos. 20030130186,
20040110296, and 20040249178; U.S. Pat. No. 6,753,423). Other
examples include the lipophilic moiety, vitamin, polymer, peptide,
protein, nucleic acid, small molecule, oligosaccharide,
carbohydrate cluster, intercalator, minor groove binder, cleaving
agent, and cross-linking agent conjugate molecules described in
U.S. Patent Publication Nos. 20050119470 and 20050107325. Yet other
examples include the 2'-O-alkyl amine, 2'-O-alkoxyalkyl amine,
polyamine, C5-cationic modified pyrimidine, cationic peptide,
guanidinium group, amidininium group, cationic amino acid conjugate
molecules described in U.S. Patent Publication No. 20050153337.
Additional examples include the hydrophobic group, membrane active
compound, cell penetrating compound, cell targeting signal,
interaction modifier, and steric stabilizer conjugate molecules
described in U.S. Patent Publication No. 20040167090. Further
examples include the conjugate molecules described in U.S. Patent
Publication No. 20050239739. The type of conjugate used and the
extent of conjugation to the chemically-modified siRNA molecule can
be evaluated for improved pharmacokinetic profiles,
bioavailability, and/or stability of the siRNA while retaining RNAi
activity. As such, one skilled in the art can screen
chemically-modified siRNA molecules having various conjugates
attached thereto to identify ones having improved properties and
full RNAi activity using any of a variety of well-known in vitro
cell culture or in vivo animal models.
B. aiRNAs
[0294] Like siRNA, asymmetrical interfering RNA (aiRNA) can recruit
the RNA-induced silencing complex (RISC) and lead to effective
silencing of a variety of genes in mammalian cells by mediating
sequence-specific cleavage of the target mRNA between nucleotide 10
and 11 relative to the 5' end of the antisense strand (Sun et al.,
Nat. Biotech., 26:1379-1382 (2008)). Typically, an aiRNA molecule
comprises a short RNA duplex having a sense strand and an antisense
strand, wherein the duplex contains overhangs at the 3' and 5' ends
of the antisense strand. The aiRNA is generally asymmetric because
the sense strand is shorter on both ends when compared to the
complementary antisense strand. In some aspects, the aiRNA
molecules of the present invention may be designed, synthesized,
and annealed under conditions similar to those used for siRNA
molecules. As a non-limiting example, aiRNA sequences may be
selected and generated using the methods described above for
selecting siRNA sequences.
[0295] In another embodiment, aiRNA duplexes of various lengths
(e.g., about 10-25, 12-20, 12-19, 12-18, 13-17, or 14-17 base
pairs, more typically 12, 13, 14, 15, 16, 17, 18, 19, or 20 base
pairs) may be designed with overhangs at the 3' and 5' ends of the
antisense strand to target an mRNA of interest. In certain
instances, the sense strand of the aiRNA molecule is about 10-25,
12-20, 12-19, 12-18, 13-17, or 14-17 nucleotides in length, more
typically 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in
length. In certain other instances, the antisense strand of the
aiRNA molecule is about 15-60, 15-50, or 15-40 nucleotides in
length, more typically about 15-30, 15-25, or 19-25 nucleotides in
length, and is preferably about 20-24, 21-22, or 21-23 nucleotides
in length.
[0296] In some embodiments, the 5' antisense overhang contains one,
two, three, four, or more nontargeting nucleotides (e.g., "AA",
"UU", "dTdT", etc.). In other embodiments, the 3' antisense
overhang contains one, two, three, four, or more nontargeting
nucleotides (e.g., "AA", "UU", "dTdT", etc.). In certain aspects,
the aiRNA molecules described herein may comprise one or more
modified nucleotides, e.g., in the double-stranded (duplex) region
and/or in the antisense overhangs. As a non-limiting example, aiRNA
sequences may comprise one or more of the modified nucleotides
described above for siRNA sequences. In a preferred embodiment, the
aiRNA molecule comprises 2'OMe nucleotides such as, for example,
2'OMe-guanosine nucleotides, 2'OMe-uridine nucleotides, or mixtures
thereof.
[0297] In certain embodiments, the aiRNA molecule of the present
invention comprises an antisense strand which corresponds to the
antisense strand of an siRNA molecule, e.g., one of the siRNA
molecules described herein which displays PLK-1 silencing activity.
In some instances, aiRNAs targeting PLK-1 mRNA are administered
using a carrier system described herein such as a nucleic
acid-lipid particle. In a preferred embodiment, the nucleic
acid-lipid particle comprises: (a) one or more aiRNA molecules
targeting PLK-1 mRNA; (b) a cationic lipid (e.g., DLinDMA); and (c)
a non-cationic lipid (e.g., DSPC, DPPC, DSPE, and/or cholesterol).
In certain instances, the nucleic acid-lipid particle may further
comprise a conjugated lipid that prevents aggregation of particles
(e.g., PEG-DAA). Non-limiting examples of aiRNA molecules suitable
for modulating (e.g., silencing) PLK-1 expression are provided in
Table 8 of Example 17.
C. miRNAs
[0298] Generally, microRNAs (miRNA) are single-stranded RNA
molecules of about 21-23 nucleotides in length which regulate gene
expression. miRNAs are encoded by genes from whose DNA they are
transcribed, but miRNAs are not translated into protein (non-coding
RNA); instead, each primary transcript (a pri-miRNA) is processed
into a short stem-loop structure called a pre-miRNA and finally
into a functional mature miRNA. Mature miRNA molecules are either
partially or completely complementary to one or more messenger RNA
(mRNA) molecules, and their main function is to downregulate gene
expression. The identification of miRNAs is described, e.g., in
Lagos-Quintana et al., Science, 294:853-858; Lau et al., Science,
294:858-862; and Lee et al., Science, 294:862-864.
[0299] The genes encoding miRNAs are much longer than the processed
mature miRNA molecule. miRNAs are first transcribed as primary
transcripts or pri-miRNA with a cap and poly-A tail and processed
to short, .about.70-nucleotide stem-loop structures known as
pre-miRNA in the cell nucleus. This processing is performed in
animals by a protein complex known as the Microprocessor complex,
consisting of the nuclease Drosha and the double-stranded RNA
binding protein Pasha (Denli et al., Nature, 432:231-235 (2004)).
These pre-miRNAs are then processed to mature miRNAs in the
cytoplasm by interaction with the endonuclease Dicer, which also
initiates the formation of the RNA-induced silencing complex (RISC)
(Bernstein et al., Nature, 409:363-366 (2001). Either the sense
strand or antisense strand of DNA can function as templates to give
rise to miRNA.
[0300] When Dicer cleaves the pre-miRNA stem-loop, two
complementary short RNA molecules are formed, but only one is
integrated into the RISC complex. This strand is known as the guide
strand and is selected by the argonaute protein, the catalytically
active RNase in the RISC complex, on the basis of the stability of
the 5' end (Preall et al., Curr. Biol., 16:530-535 (2006)). The
remaining strand, known as the anti-guide or passenger strand, is
degraded as a RISC complex substrate (Gregory et al., Cell,
123:631-640 (2005)). After integration into the active RISC
complex, miRNAs base pair with their complementary mRNA molecules
and induce target mRNA degradation and/or translational
silencing.
[0301] Mammalian miRNAs are usually complementary to a site in the
3' UTR of the target mRNA sequence. In certain instances, the
annealing of the miRNA to the target mRNA inhibits protein
translation by blocking the protein translation machinery. In
certain other instances, the annealing of the miRNA to the target
mRNA facilitates the cleavage and degradation of the target mRNA
through a process similar to RNA interference (RNAi). miRNAs may
also target methylation of genomic sites which correspond to
targeted mRNAs. Generally, miRNAs function in association with a
complement of proteins collectively termed the miRNP.
[0302] In certain aspects, the miRNA molecules described herein are
about 15-100, 15-90, 15-80, 15-75, 15-70, 15-60, 15-50, or 15-40
nucleotides in length, more typically about 15-30, 15-25, or 19-25
nucleotides in length, and are preferably about 20-24, 21-22, or
21-23 nucleotides in length. In certain other aspects, the miRNA
molecules described herein may comprise one or more modified
nucleotides. As a non-limiting example, miRNA sequences may
comprise one or more of the modified nucleotides described above
for siRNA sequences. In a preferred embodiment, the miRNA molecule
comprises 2'OMe nucleotides such as, for example, 2'OMe-guanosine
nucleotides, 2'OMe-uridine nucleotides, or mixtures thereof.
[0303] In some embodiments, miRNAs targeting PLK-1 mRNA are
administered using a carrier system described herein such as a
nucleic acid-lipid particle. In a preferred embodiment, the nucleic
acid-lipid particle comprises: (a) one or more miRNA molecules
targeting PLK-1 mRNA; (b) a cationic lipid (e.g., DLinDMA); and (c)
a non-cationic lipid (e.g., DSPC, DPPC, DSPE, and/or cholesterol).
In certain instances, the nucleic acid-lipid particle may further
comprise a conjugated lipid that prevents aggregation of particles
(e.g., PEG-DAA). Non-limiting examples of miRNA molecules suitable
for modulating (e.g., silencing) PLK-1 expression are provided in
Table 9 of Example 18.
[0304] In other embodiments, one or more agents that block the
activity of a miRNA targeting PLK-1 mRNA are administered using a
carrier system described herein (e.g., a nucleic acid-lipid
particle). Examples of blocking agents include, but are not limited
to, steric blocking oligonucleotides, locked nucleic acid
oligonucleotides, and Morpholino oligonucleotides. Such blocking
agents may bind directly to the miRNA or to the miRNA binding site
on the target mRNA.
V. Carrier Systems Containing Interfering RNA
[0305] In one aspect, the present invention provides carrier
systems containing one or more interfering RNA described herein,
e.g., unmodified or modified siRNA, aiRNA, or miRNA. In some
embodiments, the carrier system is a lipid-based carrier system
such as a stabilized nucleic acid-lipid particle (e.g., SNALP or
SPLP), cationic lipid or liposome nucleic acid complexes (i.e.,
lipoplexes), a liposome, a micelle, a virosome, or a mixture
thereof. In other embodiments, the carrier system is a
polymer-based carrier system such as a cationic polymer-nucleic
acid complex (i.e., polyplex). In additional embodiments, the
carrier system is a cyclodextrin-based carrier system such as a
cyclodextrin polymer-nucleic acid complex. In further embodiments,
the carrier system is a protein-based carrier system such as a
cationic peptide-nucleic acid complex. Preferably, the carrier
system is a stabilized nucleic acid-lipid particle such as a SNALP
or SPLP. One skilled in the art will appreciate that the
interfering RNA of the present invention can also be delivered as a
naked molecule.
[0306] A. Stabilized Nucleic Acid-Lipid Particles
[0307] The stabilized nucleic acid-lipid particles (SNALP) of the
present invention typically comprise an interfering RNA molecule as
described herein, a cationic lipid (e.g., a cationic lipid of
Formula I or II), and a non-cationic lipid. The SNALP can further
comprise a lipid conjugate (i.e., a conjugated lipid that inhibits
aggregation of the particles). In some embodiments, the SNALP may
comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the
modified interfering RNA molecules described herein, alone or in
combination with at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more
unmodified interfering RNA molecules.
[0308] The SNALP of the present invention typically have a mean
diameter of about 50 nm to about 150 nm, more typically about 60 nm
to about 130 nm, more typically about 70 nm to about 110 nm, most
typically about 70 to about 90 nm, and are substantially nontoxic.
In addition, the nucleic acids are resistant in aqueous solution to
degradation with a nuclease when present in the nucleic acid-lipid
particles. Nucleic acid-lipid particles and their method of
preparation are disclosed in, e.g., U.S. Pat. Nos. 5,753,613;
5,785,992; 5,705,385; 5,976,567; 5,981,501; 6,110,745; and
6,320,017; and PCT Publication No. WO 96/40964.
[0309] 1. Cationic Lipids
[0310] Any of a variety of cationic lipids may be used in the
stabilized nucleic acid-lipid particles of the present invention,
either alone or in combination with one or more other cationic
lipid species or non-cationic lipid species.
[0311] Cationic lipids which are useful in the present invention
can be any of a number of lipid species which carry a net positive
charge at physiological pH. Such lipids include, but are not
limited to, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC),
dioctadecyldimethylammonium (DODMA), distearyldimethylammonium
(DSDMA), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium
chloride (DOTMA), N,N-distearyl-N,N-dimethylammonium bromide
(DDAB), N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium
chloride (DOTAP),
3-(N--(N',N'-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol),
N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium
bromide (DMRIE),
2,3-dioleyloxy-N-[2(spermine-carboxamoyl)ethyl]-N,N-dimethyl-1-propanamin-
iumtrifluoroacetate (DOSPA), dioctadecylamidoglycyl spermine
(DOGS),
3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-oc-
tadecadienoxy)propane (CLinDMA),
2-[5'-(cholest-5-en-3.beta.-oxy)-3'-oxapentoxy)-3-dimethy-1-(cis,cis-9',1-
-2'-octadecadienoxy)propane (CpLinDMA),
N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA),
1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP),
2,3-Dilinoleoyloxy-N,N-dimethylpropylamine (DLinDAP),
1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP),
1,2-Dilinoleoylcarbamyl-3-dimethylaminopropane (DLinCDAP),
2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA),
2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane
(DLin-K-XTC2-DMA), and mixtures thereof. A number of these lipids
and related analogs have been described in U.S. Patent Publication
Nos. 20060083780 and 20060240554; U.S. Pat. Nos. 5,208,036;
5,264,618; 5,279,833; 5,283,185; 5,753,613; and 5,785,992; and PCT
Publication No. WO 96/10390. Additionally, a number of commercial
preparations of cationic lipids are available and can be used in
the present invention. These include, for example, LIPOFECTIN.RTM.
(commercially available cationic liposomes comprising DOTMA and
DOPE, from GIBCO/BRL, Grand Island, N.Y., USA); LIPOFECTAMINE.RTM.
(commercially available cationic liposomes comprising DOSPA and
DOPE, from GIBCO/BRL); and TRANSFECTAM.RTM. (commercially available
cationic liposomes comprising DOGS from Promega Corp., Madison,
Wis., USA).
[0312] Furthermore, cationic lipids of Formula I having the
following structures are useful in the present invention.
##STR00001##
wherein R.sup.1 and R.sup.2 are independently selected and are H or
C.sub.1-C.sub.3 alkyls, R.sup.3 and R.sup.4 are independently
selected and are alkyl groups having from about 10 to about 20
carbon atoms, and at least one of R.sup.3 and R.sup.4 comprises at
least two sites of unsaturation. In certain instances, R.sup.3 and
R.sup.4 are both the same, i.e., R.sup.3 and R.sup.4 are both
linoleyl (C.sub.18), etc. In certain other instances, R.sup.3 and
R.sup.4 are different, i.e., R.sup.3 is tetradecatrienyl (C.sub.14)
and R.sup.4 is linoleyl (C.sub.18). In a preferred embodiment, the
cationic lipid of Formula I is symmetrical, i.e., R.sup.3 and
R.sup.4 are both the same. In another preferred embodiment, both
R.sup.3 and R.sup.4 comprise at least two sites of unsaturation. In
some embodiments, R.sup.3 and R.sup.4 are independently selected
from the group consisting of dodecadienyl, tetradecadienyl,
hexadecadienyl, linoleyl, and icosadienyl. In a preferred
embodiment, R.sup.3 and R.sup.4 are both linoleyl. In some
embodiments, R.sup.3 and R.sup.4 comprise at least three sites of
unsaturation and are independently selected from, e.g.,
dodecatrienyl, tetradectrienyl, hexadecatrienyl, linolenyl, and
icosatrienyl. In particularly preferred embodiments, the cationic
lipid of Formula I is 1,2-dilinoleyloxy-N,N-dimethylaminopropane
(DLinDMA) or 1,2-dilinolenyloxy-N,N-dimethylaminopropane
(DLenDMA).
[0313] Moreover, cationic lipids of Formula II having the following
structures are useful in the present invention.
##STR00002##
wherein R.sup.1 and R.sup.2 are independently selected and are H or
C.sub.1-C.sub.3 alkyls, R.sup.3 and R.sup.4 are independently
selected and are alkyl groups having from about 10 to about 20
carbon atoms, and at least one of R.sup.3 and R.sup.4 comprises at
least two sites of unsaturation. In certain instances, R.sup.3 and
R.sup.4 are both the same, i.e., R.sup.3 and R.sup.4 are both
linoleyl (C.sub.18), etc. In certain other instances, R.sup.3 and
R.sup.4 are different, i.e., R.sup.3 is tetradectrienyl (C.sub.14)
and R.sup.4 is linoleyl (C.sub.18). In a preferred embodiment, the
cationic lipids of the present invention are symmetrical, i.e.,
R.sup.3 and R.sup.4 are both the same. In another preferred
embodiment, both R.sup.3 and R.sup.4 comprise at least two sites of
unsaturation. In some embodiments, R.sup.3 and R.sup.4 are
independently selected from the group consisting of dodecadienyl,
tetradecadienyl, hexadecadienyl, linoleyl, and icosadienyl. In a
preferred embodiment, R.sup.3 and R.sup.4 are both linoleyl. In
some embodiments, R.sup.3 and R.sup.4 comprise at least three sites
of unsaturation and are independently selected from, e.g.,
dodecatrienyl, tetradectrienyl, hexadecatrienyl, linolenyl, and
icosatrienyl.
[0314] In some embodiments, the cationic lipid comprises from about
2 mol % to about 60 mol %, from about 5 mol % to about 50 mol %,
from about 10 mol % to about 50 mol %, from about 20 mol % to about
50 mol %, from about 20 mol % to about 40 mol %, from about 30 mol
% to about 40 mol %, or about 40 mol % of the total lipid present
in the particle.
[0315] In other embodiments, the cationic lipid comprises from
about 50 mol % to about 85 mol %, about 50 mol % to about 80 mol %,
about 50 mol % to about 75 mol %, about 50 mol % to about 65 mol %,
or about 55 mol % to about 65 mol % of the total lipid present in
the particle.
[0316] It will be readily apparent to one of skill in the art that
depending on the intended use of the particles, the proportions of
the components can be varied and the delivery efficiency of a
particular formulation can be measured using, e.g., an endosomal
release parameter (ERP) assay.
[0317] 2. Non-Cationic Lipids
[0318] The non-cationic lipids used in the stabilized nucleic
acid-lipid particles of the present invention can be any of a
variety of neutral uncharged, zwitterionic, or anionic lipids
capable of producing a stable complex.
[0319] Non-limiting examples of non-cationic lipids include
phospholipids such as lecithin, phosphatidylethanolamine,
lysolecithin, lysophosphatidylethanolamine, phosphatidylserine,
phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM),
cephalin, cardiolipin, phosphatidic acid, cerebrosides,
dicetylphosphate, distearoylphosphatidylcholine (DSPC),
dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine
(DPPC), dioleoylphosphatidylglycerol (DOPG),
dipalmitoylphosphatidylglycerol (DPPG),
dioleoylphosphatidylethanolamine (DOPE),
palmitoyloleoyl-phosphatidylcholine (POPC),
palmitoyloleoyl-phosphatidylethanolamine (POPE),
palmitoyloleyol-phosphatidylglycerol (POPG),
dioleoylphosphatidylethanolamine
4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal),
dipalmitoyl-phosphatidylethanolamine (DPPE),
dimyristoyl-phosphatidylethanolamine (DMPE),
distearoyl-phosphatidylethanolamine (DSPE),
monomethyl-phosphatidylethanolamine,
dimethyl-phosphatidylethanolamine,
dielaidoyl-phosphatidylethanolamine (DEPE),
stearoyloleoyl-phosphatidylethanolamine (SOPE),
lysophosphatidylcholine, dilinoleoylphosphatidylcholine, and
mixtures thereof. Other diacylphosphatidylcholine and
diacylphosphatidylethanolamine phospholipids can also be used. The
acyl groups in these lipids are preferably acyl groups derived from
fatty acids having C.sub.10-C.sub.24 carbon chains, e.g., lauroyl,
myristoyl, palmitoyl, stearoyl, or oleoyl.
[0320] Additional examples of non-cationic lipids include sterols
such as cholesterol and derivatives thereof such as cholestanol,
cholestanone, cholestenone, and coprostanol.
[0321] In some embodiments, the non-cationic lipid present in the
SNALP comprises or consists of cholesterol, e.g., a
phospholipid-free SNALP. In other embodiments, the non-cationic
lipid present in the SNALP comprises or consists of one or more
phospholipids, e.g., a cholesterol-free SNALP. In further
embodiments, the non-cationic lipid present in the SNALP comprises
or consists of a mixture of one or more phospholipids and
cholesterol.
[0322] Other examples of non-cationic lipids suitable for use in
the present invention include nonphosphorous containing lipids such
as, e.g., stearylamine, dodecylamine, hexadecylamine, acetyl
palmitate, glycerolricinoleate, hexadecyl stereate, isopropyl
myristate, amphoteric acrylic polymers, triethanolamine-lauryl
sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amides,
dioctadecyldimethyl ammonium bromide, ceramide, sphingomyelin, and
the like.
[0323] In some embodiments, the non-cationic lipid comprises from
about 5 mol % to about 90 mol %, from about 10 mol % to about 85
mol %, from about 20 mol % to about 80 mol %, about 10 mol % (e.g.,
phospholipid only), or about 60 mol % (e.g., phospholipid and
cholesterol) of the total lipid present in the particle. If
present, the cholesterol or cholesterol derivative typically
comprises from about 0 mol % to about 10 mol %, from about 2 mol %
to about 10 mol %, from about 10 mol % to about 60 mol %, from
about 12 mol % to about 58 mol %, from about 20 mol % to about 55
mol %, from about 30 mol % to about 50 mol %, or about 48 mol % of
the total lipid present in the particle.
[0324] In other embodiments, the non-cationic lipid comprises from
about 13 mol % to about 49.5 mol %, about 20 mol % to about 45 mol
%, about 25 mol % to about 45 mol %, about 30 mol % to about 45 mol
%, about 35 mol % to about 45 mol %, about 20 mol % to about 40 mol
%, about 25 mol % to about 40 mol %, or about 30 mol % to about 40
mol % of the total lipid present in the particle.
[0325] In certain embodiments, the cholesterol present in
phospholipid-free nucleic acid-lipid particles comprises from about
30 mol % to about 45 mol %, about 30 mol % to about 40 mol %, about
35 mol % to about 45 mol %, or about 35 mol % to about 40 mol % of
the total lipid present in the particle. As a non-limiting example,
a phospholipid-free nucleic acid-lipid particle may comprise
cholesterol at about 37 mol % of the total lipid present in the
particle.
[0326] In certain other embodiments, the cholesterol present in
nucleic acid-lipid particles containing a mixture of phospholipid
and cholesterol comprises from about 30 mol % to about 40 mol %,
about 30 mol % to about 35 mol %, or about 35 mol % to about 40 mol
% of the total lipid present in the particle. As a non-limiting
example, a nucleic acid-lipid particle comprising a mixture of
phospholipid and cholesterol may comprise cholesterol at about 34
mol % of the total lipid present in the particle.
[0327] In embodiments where the nucleic acid-lipid particles
contain a mixture of phospholipid and cholesterol, the phospholipid
may comprise from about 2 mol % to about 12 mol %, about 4 mol % to
about 10 mol %, about 5 mol % to about 10 mol %, about 5 mol % to
about 9 mol %, or about 6 mol % to about 8 mol % of the total lipid
present in the particle. As a non-limiting example, a nucleic
acid-lipid particle comprising a mixture of phospholipid and
cholesterol may comprise a phospholipid such as DPPC at about 7 mol
% of the total lipid present in the particle.
[0328] 3. Lipid Conjugate
[0329] In addition to cationic and non-cationic lipids, the
stabilized nucleic acid-lipid particles of the present invention
may comprise a lipid conjugate. The conjugated lipid is useful in
that it prevents the aggregation of particles. Suitable conjugated
lipids include, but are not limited to, PEG-lipid conjugates,
ATTA-lipid conjugates, cationic-polymer-lipid conjugates (CPLs),
and mixtures thereof. In certain embodiments, the particles
comprise either a PEG-lipid conjugate or an ATTA-lipid conjugate
together with a CPL.
[0330] In a preferred embodiment, the lipid conjugate is a
PEG-lipid. Examples of PEG-lipids include, but are not limited to,
PEG coupled to dialkyloxypropyls (PEG-DAA) as described in, e.g.,
PCT Publication No. WO 05/026372, PEG coupled to diacylglycerol
(PEG-DAG) as described in, e.g., U.S. Patent Publication Nos.
20030077829 and 2005008689, PEG coupled to phospholipids such as
phosphatidylethanolamine (PEG-PE), PEG conjugated to ceramides as
described in, e.g., U.S. Pat. No. 5,885,613, PEG conjugated to
cholesterol or a derivative thereof, and mixtures thereof.
Additional PEG-lipids include, without limitation, PEG-C-DOMG,
2KPEG-DMG, and a mixture thereof.
[0331] PEG is a linear, water-soluble polymer of ethylene PEG
repeating units with two terminal hydroxyl groups. PEGs are
classified by their molecular weights; for example, PEG 2000 has an
average molecular weight of about 2,000 daltons, and PEG 5000 has
an average molecular weight of about 5,000 daltons. PEGs are
commercially available from Sigma Chemical Co. and other companies
and include, for example, the following: monomethoxypolyethylene
glycol (MePEG-OH), monomethoxypolyethylene glycol-succinate
(MePEG-S), monomethoxypolyethylene glycol-succinimidyl succinate
(MePEG-S-NHS), monomethoxypolyethylene glycol-amine
(MePEG-NH.sub.2), monomethoxypolyethylene glycol-tresylate
(MePEG-TRES), and monomethoxypolyethylene
glycol-imidazolyl-carbonyl (MePEG-IM). Other PEGs such as those
described in U.S. Pat. Nos. 6,774,180 and 7,053,150 (e.g., mPEG (20
KDa) amine) are also useful for preparing the PEG-lipid conjugates
of the present invention. In addition,
monomethoxypolyethyleneglycol-acetic acid (MePEG-CH.sub.2COOH) is
particularly useful for preparing PEG-lipid conjugates including,
e.g., PEG-DAA conjugates.
[0332] In a preferred embodiment, the PEG has an average molecular
weight of from about 550 daltons to about 10,000 daltons, more
preferably from about 750 daltons to about 5,000 daltons, more
preferably from about 1,000 daltons to about 5,000 daltons, more
preferably from about 1,500 daltons to about 3,000 daltons, and
even more preferably about 2,000 daltons. The PEG can be optionally
substituted by an alkyl, alkoxy, acyl, or aryl group. The PEG can
be conjugated directly to the lipid or may be linked to the lipid
via a linker moiety. Any linker moiety suitable for coupling the
PEG to a lipid can be used including, e.g., non-ester containing
linker moieties and ester-containing linker moieties. In a
preferred embodiment, the linker moiety is a non-ester containing
linker moiety. As used herein, the term "non-ester containing
linker moiety" refers to a linker moiety that does not contain a
carboxylic ester bond (--OC(O)--). Suitable non-ester containing
linker moieties include, but are not limited to, amido
(--C(O)NH--), amino (--NR--), carbonyl (--C(O)--), carbamate
(--NHC(O)O--), urea (--NHC(O)NH--), disulphide (--S--S--), ether
(--O--), succinyl (--(O)CCH.sub.2CH.sub.2C(O)--), succinamidyl
(--NHC(O)CH.sub.2CH.sub.2C(O)NH--), ether, disulphide, as well as
combinations thereof (such as a linker containing both a carbamate
linker moiety and an amido linker moiety). In a preferred
embodiment, a carbamate linker is used to couple the PEG to the
lipid.
[0333] In other embodiments, an ester containing linker moiety is
used to couple the PEG to the lipid. Suitable ester containing
linker moieties include, e.g., carbonate (--OC(O)O--), succinoyl,
phosphate esters (--O--(O)POH--O--), sulfonate esters, and
combinations thereof.
[0334] Phosphatidylethanolamines having a variety of acyl chain
groups of varying chain lengths and degrees of saturation can be
conjugated to PEG to form the lipid conjugate. Such
phosphatidylethanolamines are commercially available, or can be
isolated or synthesized using conventional techniques known to
those of skilled in the art. Phosphatidylethanolamines containing
saturated or unsaturated fatty acids with carbon chain lengths in
the range of C.sub.10 to C.sub.20 are preferred.
Phosphatidylethanolamines with mono- or diunsaturated fatty acids
and mixtures of saturated and unsaturated fatty acids can also be
used. Suitable phosphatidylethanolamines include, but are not
limited to, dimyristoyl-phosphatidylethanolamine (DMPE),
dipalmitoyl-phosphatidylethanolamine (DPPE),
dioleoylphosphatidylethanolamine (DOPE), and
distearoyl-phosphatidylethanolamine (DSPE).
[0335] The term "ATTA" or "polyamide" refers to, without
limitation, compounds disclosed in U.S. Pat. Nos. 6,320,017 and
6,586,559. These compounds include a compound having the
formula:
##STR00003##
wherein R is a member selected from the group consisting of
hydrogen, alkyl and acyl; R.sup.1 is a member selected from the
group consisting of hydrogen and alkyl; or optionally, R and
R.sup.1 and the nitrogen to which they are bound form an azido
moiety; R.sup.2 is a member of the group selected from hydrogen,
optionally substituted alkyl, optionally substituted aryl and a
side chain of an amino acid; R.sup.3 is a member selected from the
group consisting of hydrogen, halogen, hydroxy, alkoxy, mercapto,
hydrazino, amino and NR.sup.4R.sup.5, wherein R.sup.4 and R.sup.5
are independently hydrogen or alkyl; n is 4 to 80; m is 2 to 6; p
is 1 to 4; and q is 0 or 1. It will be apparent to those of skill
in the art that other polyamides can be used in the compounds of
the present invention.
[0336] The term "diacylglycerol" refers to a compound having 2
fatty acyl chains, R' and R.sup.2, both of which have independently
between 2 and 30 carbons bonded to the 1- and 2-position of
glycerol by ester linkages. The acyl groups can be saturated or
have varying degrees of unsaturation. Suitable acyl groups include,
but are not limited to, lauroyl (C.sub.12), myristoyl (C.sub.14),
palmitoyl (C.sub.16), stearoyl (C.sub.18), and icosoyl (C.sub.20).
In preferred embodiments, R.sup.1 and R.sup.2 are the same, i.e.,
R.sup.1 and R.sup.2 are both myristoyl (i.e., dimyristoyl), R.sup.1
and R.sup.2 are both stearoyl (i.e., distearoyl), etc.
Diacylglycerols have the following general formula:
##STR00004##
[0337] The term "dialkyloxypropyl" refers to a compound having 2
alkyl chains, R.sup.1 and R.sup.2, both of which have independently
between 2 and 30 carbons. The alkyl groups can be saturated or have
varying degrees of unsaturation. Dialkyloxypropyls have the
following general formula:
##STR00005##
wherein R.sup.1 and R.sup.2 are independently selected and are
long-chain alkyl groups having from about 10 to about 22 carbon
atoms.
[0338] In a preferred embodiment, the PEG-lipid is a PEG-DAA
conjugate having the following formula:
##STR00006##
wherein R.sup.1 and R.sup.2 are independently selected and are
long-chain alkyl groups having from about 10 to about 22 carbon
atoms; PEG is a polyethyleneglycol; and L is a non-ester containing
linker moiety or an ester containing linker moiety as described
above. The long-chain alkyl groups can be saturated or unsaturated.
Suitable alkyl groups include, but are not limited to, lauryl
(C.sub.12), myristyl (C.sub.14), palmityl (C.sub.16), stearyl
(C.sub.18), and icosyl (C.sub.20). In preferred embodiments,
R.sup.1 and R.sup.2 are the same, i.e., R.sup.1 and R.sup.2 are
both myristyl (i.e., dimyristyl), R.sup.1 and R.sup.2 are both
stearyl (i.e., distearyl), etc.
[0339] In Formula VI above, the PEG has an average molecular weight
ranging from about 550 daltons to about 10,000 daltons, more
preferably from about 750 daltons to about 5,000 daltons, more
preferably from about 1,000 daltons to about 5,000 daltons, more
preferably from about 1,500 daltons to about 3,000 daltons, and
even more preferably about 2,000 daltons. The PEG can be optionally
substituted with alkyl, alkoxy, acyl, or aryl. In a preferred
embodiment, the terminal hydroxyl group is substituted with a
methoxy or methyl group.
[0340] In a preferred embodiment, "L" is a non-ester containing
linker moiety. Suitable non-ester containing linkers include, but
are not limited to, an amido linker moiety, an amino linker moiety,
a carbonyl linker moiety, a carbamate linker moiety, a urea linker
moiety, an ether linker moiety, a disulphide linker moiety, a
succinamidyl linker moiety, and combinations thereof. In a
preferred embodiment, the non-ester containing linker moiety is a
carbamate linker moiety (i.e., a PEG-C-DAA conjugate). In another
preferred embodiment, the non-ester containing linker moiety is an
amido linker moiety (i.e., a PEG-A-DAA conjugate). In yet another
preferred embodiment, the non-ester containing linker moiety is a
succinamidyl linker moiety (i.e., a PEG-S-DAA conjugate).
[0341] The PEG-DAA conjugates are synthesized using standard
techniques and reagents known to those of skill in the art. It will
be recognized that the PEG-DAA conjugates will contain various
amide, amine, ether, thio, carbamate, and urea linkages. Those of
skill in the art will recognize that methods and reagents for
forming these bonds are well known and readily available. See,
e.g., March, ADVANCED ORGANIC CHEMISTRY (Wiley 1992); Larock,
COMPREHENSIVE ORGANIC TRANSFORMATIONS (VCH 1989); and Furniss,
VOGEL'S TEXTBOOK OF PRACTICAL ORGANIC CHEMISTRY, 5th ed. (Longman
1989). It will also be appreciated that any functional groups
present may require protection and deprotection at different points
in the synthesis of the PEG-DAA conjugates. Those of skill in the
art will recognize that such techniques are well known. See, e.g.,
Green and Wuts, PROTECTIVE GROUPS IN ORGANIC SYNTHESIS (Wiley
1991).
[0342] Preferably, the PEG-DAA conjugate is a dilauryloxypropyl
(C.sub.12)-PEG conjugate, dimyristyloxypropyl (C.sub.14)-PEG
conjugate, a dipalmityloxypropyl (C.sub.16)-PEG conjugate, or a
distearyloxypropyl (C.sub.18)-PEG conjugate. Those of skill in the
art will readily appreciate that other dialkyloxypropyls can be
used in the PEG-DAA conjugates of the present invention.
[0343] In addition to the foregoing, it will be readily apparent to
those of skill in the art that other hydrophilic polymers can be
used in place of PEG. Examples of suitable polymers that can be
used in place of PEG include, but are not limited to,
polyvinylpyrrolidone, polymethyloxazoline, polyethyloxazoline,
polyhydroxypropyl methacrylamide, polymethacrylamide and
polydimethylacrylamide, polylactic acid, polyglycolic acid, and
derivatized celluloses such as hydroxymethylcellulose or
hydroxyethylcellulose.
[0344] In addition to the foregoing components, the particles
(e.g., SNALPs or SPLPs) of the present invention can further
comprise cationic poly(ethylene glycol) (PEG) lipids or CPLs (see,
e.g., Chen et al., Bioconj. Chem., 11:433-437 (2000)). Suitable
SPLPs and SPLP-CPLs for use in the present invention, and methods
of making and using SPLPs and SPLP-CPLs, are disclosed, e.g., in
U.S. Pat. No. 6,852,334 and PCT Publication No. WO 00/62813.
[0345] Suitable CPLs include compounds of Formula VII:
A-W--Y (VII),
wherein A, W, and Y are as described below.
[0346] With reference to Formula VII, "A" is a lipid moiety such as
an amphipathic lipid, a neutral lipid, or a hydrophobic lipid that
acts as a lipid anchor. Suitable lipid examples include, but are
not limited to, diacylglycerolyls, dialkylglycerolyls,
N--N-dialkylaminos, 1,2-diacyloxy-3-aminopropanes, and
1,2-dialkyl-3-aminopropanes.
[0347] "W" is a polymer or an oligomer such as a hydrophilic
polymer or oligomer. Preferably, the hydrophilic polymer is a
biocompatible polymer that is nonimmunogenic or possesses low
inherent immunogenicity. Alternatively, the hydrophilic polymer can
be weakly antigenic if used with appropriate adjuvants. Suitable
nonimmunogenic polymers include, but are not limited to, PEG,
polyamides, polylactic acid, polyglycolic acid, polylactic
acid/polyglycolic acid copolymers, and combinations thereof. In a
preferred embodiment, the polymer has a molecular weight of from
about 250 to about 7,000 daltons.
[0348] "Y" is a polycationic moiety. The term polycationic moiety
refers to a compound, derivative, or functional group having a
positive charge, preferably at least 2 positive charges at a
selected pH, preferably physiological pH. Suitable polycationic
moieties include basic amino acids and their derivatives such as
arginine, asparagine, glutamine, lysine, and histidine; spermine;
spermidine; cationic dendrimers; polyamines; polyamine sugars; and
amino polysaccharides. The polycationic moieties can be linear,
such as linear tetralysine, branched or dendrimeric in structure.
Polycationic moieties have between about 2 to about 15 positive
charges, preferably between about 2 to about 12 positive charges,
and more preferably between about 2 to about 8 positive charges at
selected pH values. The selection of which polycationic moiety to
employ may be determined by the type of particle application which
is desired.
[0349] The charges on the polycationic moieties can be either
distributed around the entire particle moiety, or alternatively,
they can be a discrete concentration of charge density in one
particular area of the particle moiety e.g., a charge spike. If the
charge density is distributed on the particle, the charge density
can be equally distributed or unequally distributed. All variations
of charge distribution of the polycationic moiety are encompassed
by the present invention.
[0350] The lipid "A" and the nonimmunogenic polymer "W" can be
attached by various methods and preferably by covalent attachment.
Methods known to those of skill in the art can be used for the
covalent attachment of "A" and "W." Suitable linkages include, but
are not limited to, amide, amine, carboxyl, carbonate, carbamate,
ester, and hydrazone linkages. It will be apparent to those skilled
in the art that "A" and "W" must have complementary functional
groups to effectuate the linkage. The reaction of these two groups,
one on the lipid and the other on the polymer, will provide the
desired linkage. For example, when the lipid is a diacylglycerol
and the terminal hydroxyl is activated, for instance with NHS and
DCC, to form an active ester, and is then reacted with a polymer
which contains an amino group, such as with a polyamide (see, e.g.,
U.S. Pat. Nos. 6,320,017 and 6,586,559), an amide bond will form
between the two groups.
[0351] In certain instances, the polycationic moiety can have a
ligand attached, such as a targeting ligand or a chelating moiety
for complexing calcium. Preferably, after the ligand is attached,
the cationic moiety maintains a positive charge. In certain
instances, the ligand that is attached has a positive charge.
Suitable ligands include, but are not limited to, a compound or
device with a reactive functional group and include lipids,
amphipathic lipids, carrier compounds, bioaffinity compounds,
biomaterials, biopolymers, biomedical devices, analytically
detectable compounds, therapeutically active compounds, enzymes,
peptides, proteins, antibodies, immune stimulators, radiolabels,
fluorogens, biotin, drugs, haptens, DNA, RNA, polysaccharides,
liposomes, virosomes, micelles, immunoglobulins, functional groups,
other targeting moieties, or toxins.
[0352] In some embodiments, the lipid conjugate (e.g., PEG-lipid)
comprises from about 0 mol % to about 20 mol %, from about 0.5 mol
% to about 20 mol %, from about 1.5 mol % to about 18 mol %, from
about 4 mol % to about 15 mol %, from about 5 mol % to about 12 mol
%, or about 2 mol % of the total lipid present in the particle.
[0353] In other embodiments, the lipid conjugate (e.g., PEG-lipid)
comprises from about 0.1 mol % to about 10 mol %, about 0.1 mol %
to about 5 mol %, about 0.2 mol % to about 5 mol %, about 0.3 mol %
to about 5 mol %, about 0.4 mol % to about 5 mol %, about 0.5 mol %
to about 5 mol %, about 0.5 mol % to about 2 mol %, about 0.5 mol %
to about 1.5 mol %, about 0.5 mol % to about 1 mol %, about 1 mol %
to about 2 mol %, or about 1.5 mol % of the total lipid present in
the particle.
[0354] One of ordinary skill in the art will appreciate that the
concentration of the lipid conjugate can be varied depending on the
lipid conjugate employed and the rate at which the nucleic
acid-lipid particle is to become fusogenic.
[0355] By controlling the composition and concentration of the
lipid conjugate, one can control the rate at which the lipid
conjugate exchanges out of the nucleic acid-lipid particle and, in
turn, the rate at which the nucleic acid-lipid particle becomes
fusogenic. For instance, when a PEG-phosphatidylethanolamine
conjugate or a PEG-ceramide conjugate is used as the lipid
conjugate, the rate at which the nucleic acid-lipid particle
becomes fusogenic can be varied, for example, by varying the
concentration of the lipid conjugate, by varying the molecular
weight of the PEG, or by varying the chain length and degree of
saturation of the acyl chain groups on the phosphatidylethanolamine
or the ceramide. In addition, other variables including, for
example, pH, temperature, ionic strength, etc. can be used to vary
and/or control the rate at which the nucleic acid-lipid particle
becomes fusogenic. Other methods which can be used to control the
rate at which the nucleic acid-lipid particle becomes fusogenic
will become apparent to those of skill in the art upon reading this
disclosure.
[0356] B. Additional Carrier Systems
[0357] Non-limiting examples of additional lipid-based carrier
systems suitable for use in the present invention include
lipoplexes (see, e.g., U.S. Patent Publication No. 20030203865; and
Zhang et al., J. Control Release, 100:165-180 (2004)), pH-sensitive
lipoplexes (see, e.g., U.S. Patent Publication No. 20020192275),
reversibly masked lipoplexes (see, e.g., U.S. Patent Publication
Nos. 20030180950), cationic lipid-based compositions (see, e.g.,
U.S. Pat. No. 6,756,054; and U.S. Patent Publication No.
20050234232), cationic liposomes (see, e.g., U.S. Patent
Publication Nos. 20030229040, 20020160038, and 20020012998; U.S.
Pat. No. 5,908,635; and PCT Publication No. WO 01/72283), anionic
liposomes (see, e.g., U.S. Patent Publication No. 20030026831),
pH-sensitive liposomes (see, e.g., U.S. Patent Publication No.
20020192274; and AU 2003210303), antibody-coated liposomes (see,
e.g., U.S. Patent Publication No. 20030108597; and PCT Publication
No. WO 00/50008), cell-type specific liposomes (see, e.g., U.S.
Patent Publication No. 20030198664), liposomes containing nucleic
acid and peptides (see, e.g., U.S. Pat. No. 6,207,456), liposomes
containing lipids derivatized with releasable hydrophilic polymers
(see, e.g., U.S. Patent Publication No. 20030031704),
lipid-entrapped nucleic acid (see, e.g., PCT Publication Nos. WO
03/057190 and WO 03/059322), lipid-encapsulated nucleic acid (see,
e.g., U.S. Patent Publication No. 20030129221; and U.S. Pat. No.
5,756,122), other liposomal compositions (see, e.g., U.S. Patent
Publication Nos. 20030035829 and 20030072794; and U.S. Pat. No.
6,200,599), stabilized mixtures of liposomes and emulsions (see,
e.g., EP1304160), emulsion compositions (see, e.g., U.S. Pat. No.
6,747,014), and nucleic acid micro-emulsions (see, e.g., U.S.
Patent Publication No. 20050037086).
[0358] Examples of polymer-based carrier systems suitable for use
in the present invention include, but are not limited to, cationic
polymer-nucleic acid complexes (i.e., polyplexes). To form a
polyplex, a nucleic acid (e.g., interfering RNA) is typically
complexed with a cationic polymer having a linear, branched, star,
or dendritic polymeric structure that condenses the nucleic acid
into positively charged particles capable of interacting with
anionic proteoglycans at the cell surface and entering cells by
endocytosis. In some embodiments, the polyplex comprises nucleic
acid (e.g., interfering RNA) complexed with a cationic polymer such
as polyethylenimine (PEI) (see, e.g., U.S. Pat. No. 6,013,240;
commercially available from Qbiogene, Inc. (Carlsbad, Calif.) as In
vivo jetPEI.TM., a linear form of PEI), polypropylenimine (PPI),
polyvinylpyrrolidone (PVP), poly-L-lysine (PLL), diethylaminoethyl
(DEAE)-dextran, poly(.beta.-amino ester) (PAE) polymers (see, e.g.,
Lynn et al., J. Am. Chem. Soc., 123:8155-8156 (2001)), chitosan,
polyamidoamine (PAMAM) dendrimers (see, e.g., Kukowska-Latallo et
al., Proc. Natl. Acad. Sci. USA, 93:4897-4902 (1996)), porphyrin
(see, e.g., U.S. Pat. No. 6,620,805), polyvinylether (see, e.g.,
U.S. Patent Publication No. 20040156909), polycyclic amidinium
(see, e.g., U.S. Patent Publication No. 20030220289), other
polymers comprising primary amine, imine, guanidine, and/or
imidazole groups (see, e.g., U.S. Pat. No. 6,013,240; PCT
Publication No. WO/9602655; PCT Publication No. WO95/21931; Zhang
et al., J. Control Release, 100:165-180 (2004); and Tiera et al.,
Curr. Gene Ther., 6:59-71 (2006)), and a mixture thereof. In other
embodiments, the polyplex comprises cationic polymer-nucleic acid
complexes as described in U.S. Patent Publication Nos. 20060211643,
20050222064, 20030125281, and 20030185890, and PCT Publication No.
WO 03/066069; biodegradable poly(.beta.-amino ester)
polymer-nucleic acid complexes as described in U.S. Patent
Publication No. 20040071654; microparticles containing polymeric
matrices as described in U.S. Patent Publication No. 20040142475;
other microparticle compositions as described in U.S. Patent
Publication No. 20030157030; condensed nucleic acid complexes as
described in U.S. Patent Publication No. 20050123600; and
nanocapsule and microcapsule compositions as described in AU
2002358514 and PCT Publication No. WO 02/096551.
[0359] In certain instances, the interfering RNA may be complexed
with cyclodextrin or a polymer thereof. Non-limiting examples of
cyclodextrin-based carrier systems include the
cyclodextrin-modified polymer-nucleic acid complexes described in
U.S. Patent Publication No. 20040087024; the linear cyclodextrin
copolymer-nucleic acid complexes described in U.S. Pat. Nos.
6,509,323, 6,884,789, and 7,091,192; and the cyclodextrin
polymer-complexing agent-nucleic acid complexes described in U.S.
Pat. No. 7,018,609. In certain other instances, the interfering RNA
may be complexed with a peptide or polypeptide. An example of a
protein-based carrier system includes, but is not limited to, the
cationic oligopeptide-nucleic acid complex described in PCT
Publication No. WO95/21931.
VI. Preparation of Nucleic Acid-Lipid Particles
[0360] The serum-stable nucleic acid-lipid particles of the present
invention, in which the interfering RNA described herein is
encapsulated in a lipid bilayer and is protected from degradation,
can be formed by any method known in the art including, but not
limited to, a continuous mixing method, a direct dilution process,
a detergent dialysis method, or a modification of a reverse-phase
method which utilizes organic solvents to provide a single phase
during mixing of the components.
[0361] In preferred embodiments, the cationic lipids are lipids of
Formula I and II or combinations thereof. In other preferred
embodiments, the non-cationic lipids are egg sphingomyelin (ESM),
distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine
(DOPC), 1-palmitoyl-2-oleoyl-phosphatidylcholine (POPC),
dipalmitoyl-phosphatidylcholine (DPPC),
monomethyl-phosphatidylethanolamine,
dimethyl-phosphatidylethanolamine, 14:0 PE
(1,2-dimyristoyl-phosphatidylethanolamine (DMPE)), 16:0 PE
(1,2-dipalmitoyl-phosphatidylethanolamine (DPPE)), 18:0 PE
(1,2-distearoyl-phosphatidylethanolamine (DSPE)), 18:1 PE
(1,2-dioleoyl-phosphatidylethanolamine (DOPE)), 18:1 trans PE
(1,2-dielaidoyl-phosphatidylethanolamine (DEPE)), 18:0-18:1 PE
(1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE)), 16:0-18:1 PE
(1-palmitoyl-2-oleoyl-phosphatidylethanolamine (POPE)),
polyethylene glycol-based polymers (e.g., PEG 2000, PEG 5000,
PEG-modified diacylglycerols, or PEG-modified dialkyloxypropyls),
cholesterol, or combinations thereof. In still other preferred
embodiments, the organic solvents are methanol, chloroform,
methylene chloride, ethanol, diethyl ether, or combinations
thereof.
[0362] In a preferred embodiment, the present invention provides
for nucleic acid-lipid particles produced via a continuous mixing
method, e.g., process that includes providing an aqueous solution
comprising a nucleic acid such as an interfering RNA in a first
reservoir, providing an organic lipid solution in a second
reservoir, and mixing the aqueous solution with the organic lipid
solution such that the organic lipid solution mixes with the
aqueous solution so as to substantially instantaneously produce a
liposome encapsulating the nucleic acid (e.g., interfering RNA).
This process and the apparatus for carrying this process are
described in detail in U.S. Patent Publication No. 20040142025.
[0363] The action of continuously introducing lipid and buffer
solutions into a mixing environment, such as in a mixing chamber,
causes a continuous dilution of the lipid solution with the buffer
solution, thereby producing a liposome substantially
instantaneously upon mixing. As used herein, the phrase
"continuously diluting a lipid solution with a buffer solution"
(and variations) generally means that the lipid solution is diluted
sufficiently rapidly in a hydration process with sufficient force
to effectuate vesicle generation. By mixing the aqueous solution
comprising a nucleic acid with the organic lipid solution, the
organic lipid solution undergoes a continuous stepwise dilution in
the presence of the buffer solution (i.e., aqueous solution) to
produce a nucleic acid-lipid particle.
[0364] The serum-stable nucleic acid-lipid particles formed using
the continuous mixing method typically have a size of from about 50
nm to about 150 nm, from about 60 nm to about 130 nm, from about 70
nm to about 110 nm, or from about 70 nm to about 90 nm. The
particles thus formed do not aggregate and are optionally sized to
achieve a uniform particle size.
[0365] In another embodiment, the present invention provides for
nucleic acid-lipid particles produced via a direct dilution process
that includes forming a liposome solution and immediately and
directly introducing the liposome solution into a collection vessel
containing a controlled amount of dilution buffer. In preferred
aspects, the collection vessel includes one or more elements
configured to stir the contents of the collection vessel to
facilitate dilution. In one aspect, the amount of dilution buffer
present in the collection vessel is substantially equal to the
volume of liposome solution introduced thereto. As a non-limiting
example, a liposome solution in 45% ethanol when introduced into
the collection vessel containing an equal volume of dilution buffer
will advantageously yield smaller particles.
[0366] In yet another embodiment, the present invention provides
for nucleic acid-lipid particles produced via a direct dilution
process in which a third reservoir containing dilution buffer is
fluidly coupled to a second mixing region. In this embodiment, the
liposome solution formed in a first mixing region is immediately
and directly mixed with dilution buffer in the second mixing
region. In preferred aspects, the second mixing region includes a
T-connector arranged so that the liposome solution and the dilution
buffer flows meet as opposing 180.degree. flows; however,
connectors providing shallower angles can be used, e.g., from about
27.degree. to about 180.degree.. A pump mechanism delivers a
controllable flow of buffer to the second mixing region. In one
aspect, the flow rate of dilution buffer provided to the second
mixing region is controlled to be substantially equal to the flow
rate of liposome solution introduced thereto from the first mixing
region. This embodiment advantageously allows for more control of
the flow of dilution buffer mixing with the liposome solution in
the second mixing region, and therefore also the concentration of
liposome solution in buffer throughout the second mixing process.
Such control of the dilution buffer flow rate advantageously allows
for small particle size formation at reduced concentrations.
[0367] These processes and the apparatuses for carrying out these
direct dilution processes are described in detail in U.S. Patent
Publication No. 20070042031.
[0368] The serum-stable nucleic acid-lipid particles formed using
the direct dilution process typically have a size of from about 50
nm to about 150 nm, from about 60 nm to about 130 nm, from about 70
nm to about 110 nm, or from about 70 nm to about 90 nm. The
particles thus formed do not aggregate and are optionally sized to
achieve a uniform particle size.
[0369] In some embodiments, the particles are formed using
detergent dialysis. Without intending to be bound by any particular
mechanism of formation, a nucleic acid such as an interfering RNA
is contacted with a detergent solution of cationic lipids to form a
coated nucleic acid complex. These coated nucleic acids can
aggregate and precipitate. However, the presence of a detergent
reduces this aggregation and allows the coated nucleic acids to
react with excess lipids (typically, non-cationic lipids) to form
particles in which the nucleic acid is encapsulated in a lipid
bilayer. Thus, the serum-stable nucleic acid-lipid particles can be
prepared as follows:
[0370] (a) combining a nucleic acid with cationic lipids in a
detergent solution to form a coated nucleic acid-lipid complex;
[0371] (b) contacting non-cationic lipids with the coated nucleic
acid-lipid complex to form a detergent solution comprising a
nucleic acid-lipid complex and non-cationic lipids; and
[0372] (c) dialyzing the detergent solution of step (b) to provide
a solution of serum-stable nucleic acid-lipid particles, wherein
the nucleic acid is encapsulated in a lipid bilayer and the
particles are serum-stable and have a size of from about 50 nm to
about 150 nm.
[0373] An initial solution of coated nucleic acid-lipid complexes
is formed by combining the nucleic acid with the cationic lipids in
a detergent solution. In these embodiments, the detergent solution
is preferably an aqueous solution of a neutral detergent having a
critical micelle concentration of 15-300 mM, more preferably 20-50
mM. Examples of suitable detergents include, for example,
N,N'-((octanoylimino)-bis-(trimethylene))-bis-(D-gluconamide)
(BIGCHAP); BRIJ 35; Deoxy-BIGCHAP; dodecylpoly(ethylene glycol)
ether; Tween 20; Tween 40; Tween 60; Tween 80; Tween 85; Mega 8;
Mega 9; Zwittergent.RTM. 3-08; Zwittergent.RTM. 3-10; Triton X-405;
hexyl-, heptyl-, octyl- and nonyl-f3-D-glucopyranoside; and
heptylthioglucopyranoside; with octyl .beta.-D-glucopyranoside and
Tween-20 being the most preferred. The concentration of detergent
in the detergent solution is typically about 100 mM to about 2 M,
preferably from about 200 mM to about 1.5 M.
[0374] The cationic lipids and nucleic acids will typically be
combined to produce a charge ratio (+/-) of about 1:1 to about
20:1, in a ratio of about 1:1 to about 12:1, or in a ratio of about
2:1 to about 6:1. Additionally, the overall concentration of
nucleic acid in solution will typically be from about 25 .mu.g/ml
to about 1 mg/ml, from about 25 .mu.g/ml to about 200 .mu.g/ml, or
from about 50 .mu.g/ml to about 100 .mu.g/ml. The combination of
nucleic acids and cationic lipids in detergent solution is kept,
typically at room temperature, for a period of time which is
sufficient for the coated complexes to form. Alternatively, the
nucleic acids and cationic lipids can be combined in the detergent
solution and warmed to temperatures of up to about 37.degree. C.,
about 50.degree. C., about 60.degree. C., or about 70.degree. C.
For nucleic acids which are particularly sensitive to temperature,
the coated complexes can be formed at lower temperatures, typically
down to about 4.degree. C.
[0375] The detergent solution of the coated nucleic acid-lipid
complexes is then contacted with non-cationic lipids to provide a
detergent solution of nucleic acid-lipid complexes and non-cationic
lipids. The non-cationic lipids which are useful in this step
include, diacylphosphatidylcholine, diacylphosphatidylethanolamine,
ceramide, sphingomyelin, cephalin, cardiolipin, and cerebrosides.
In preferred embodiments, the non-cationic lipids are
diacylphosphatidylcholine, diacylphosphatidylethanolamine,
ceramide, or sphingomyelin. The acyl groups in these lipids are
preferably acyl groups derived from fatty acids having
C.sub.10-C.sub.24 carbon chains. More preferably, the acyl groups
are lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl. In
particularly preferred embodiments, the non-cationic lipids are
DSPC, DOPE, POPC, egg phosphatidylcholine (EPC), cholesterol, or a
mixture thereof. In the most preferred embodiments, the nucleic
acid-lipid particles are fusogenic particles with enhanced
properties in vivo and the non-cationic lipid is DSPC or DOPE. In
addition, the nucleic acid-lipid particles of the present invention
may further comprise cholesterol. In other preferred embodiments,
the non-cationic lipids can further comprise polyethylene
glycol-based polymers such as PEG 2,000, PEG 5,000, and PEG
conjugated to a diacylglycerol, a ceramide, or a phospholipid, as
described in, e.g., U.S. Pat. No. 5,820,873 and U.S. Patent
Publication No. 20030077829. In further preferred embodiments, the
non-cationic lipids can further comprise polyethylene glycol-based
polymers such as PEG 2,000, PEG 5,000, and PEG conjugated to a
dialkyloxypropyl.
[0376] The amount of non-cationic lipid which is used in the
present methods is typically from about 2 to about 20 mg of total
lipids to 50 .mu.g of nucleic acid. Preferably, the amount of total
lipid is from about 5 to about 10 mg per 50 .mu.g of nucleic
acid.
[0377] Following formation of the detergent solution of nucleic
acid-lipid complexes and non-cationic lipids, the detergent is
removed, preferably by dialysis. The removal of the detergent
results in the formation of a lipid-bilayer which surrounds the
nucleic acid providing serum-stable nucleic acid-lipid particles
which have a size of from about 50 nm to about 150 nm, from about
60 nm to about 130 nm, from about 70 nm to about 110 nm, or from
about 70 nm to about 90 nm. The particles thus formed do not
aggregate and are optionally sized to achieve a uniform particle
size.
[0378] The serum-stable nucleic acid-lipid particles can be sized
by any of the methods available for sizing liposomes. The sizing
may be conducted in order to achieve a desired size range and
relatively narrow distribution of particle sizes.
[0379] Several techniques are available for sizing the particles to
a desired size. One sizing method, used for liposomes and equally
applicable to the present particles, is described in U.S. Pat. No.
4,737,323. Sonicating a particle suspension either by bath or probe
sonication produces a progressive size reduction down to particles
of less than about 50 nm in size. Homogenization is another method
which relies on shearing energy to fragment larger particles into
smaller ones. In a typical homogenization procedure, particles are
recirculated through a standard emulsion homogenizer until selected
particle sizes, typically between about 60 and about 80 nm, are
observed. In both methods, the particle size distribution can be
monitored by conventional laser-beam particle size discrimination,
or QELS.
[0380] Extrusion of the particles through a small-pore
polycarbonate membrane or an asymmetric ceramic membrane is also an
effective method for reducing particle sizes to a relatively
well-defined size distribution. Typically, the suspension is cycled
through the membrane one or more times until the desired particle
size distribution is achieved. The particles may be extruded
through successively smaller-pore membranes, to achieve a gradual
reduction in size.
[0381] In another group of embodiments, the serum-stable nucleic
acid-lipid particles can be prepared as follows:
[0382] (a) preparing a mixture comprising cationic lipids and
non-cationic lipids in an organic solvent;
[0383] (b) contacting an aqueous solution of nucleic acid with the
mixture in step (a) to provide a clear single phase; and
[0384] (c) removing the organic solvent to provide a suspension of
nucleic acid-lipid particles, wherein the nucleic acid is
encapsulated in a lipid bilayer and the particles are stable in
serum and have a size of from about 50 nm to about 150 nm.
[0385] The nucleic acids (e.g., interfering RNA), cationic lipids,
and non-cationic lipids which are useful in this group of
embodiments are as described for the detergent dialysis methods
above.
[0386] The selection of an organic solvent will typically involve
consideration of solvent polarity and the ease with which the
solvent can be removed at the later stages of particle formation.
The organic solvent, which is also used as a solubilizing agent, is
in an amount sufficient to provide a clear single phase mixture of
nucleic acid and lipids. Suitable solvents include, but are not
limited to, chloroform, dichloromethane, diethylether, cyclohexane,
cyclopentane, benzene, toluene, methanol, or other aliphatic
alcohols such as propanol, isopropanol, butanol, tert-butanol,
iso-butanol, pentanol and hexanol. Combinations of two or more
solvents may also be used in the present invention.
[0387] Contacting the nucleic acid with the organic solution of
cationic and non-cationic lipids is accomplished by mixing together
a first solution of nucleic acid, which is typically an aqueous
solution, and a second organic solution of the lipids. One of skill
in the art will understand that this mixing can take place by any
number of methods, for example, by mechanical means such as by
using vortex mixers.
[0388] After the nucleic acid has been contacted with the organic
solution of lipids, the organic solvent is removed, thus forming an
aqueous suspension of serum-stable nucleic acid-lipid particles.
The methods used to remove the organic solvent will typically
involve evaporation at reduced pressures or blowing a stream of
inert gas (e.g., nitrogen or argon) across the mixture.
[0389] The serum-stable nucleic acid-lipid particles thus formed
will typically be sized from about 50 nm to about 150 nm, from
about 60 nm to about 130 nm, from about 70 nm to about 110 nm, or
from about 70 nm to about 90 nm. To achieve further size reduction
or homogeneity of size in the particles, sizing can be conducted as
described above.
[0390] In other embodiments, the methods will further comprise
adding non-lipid polycations which are useful to effect the
delivery to cells using the present compositions. Examples of
suitable non-lipid polycations include, but are limited to,
hexadimethrine bromide (sold under the brand name POLYBRENE.RTM.,
from Aldrich Chemical Co., Milwaukee, Wis., USA) or other salts of
heaxadimethrine. Other suitable polycations include, for example,
salts of poly-L-ornithine, poly-L-arginine, poly-L-lysine,
poly-D-lysine, polyallylamine, and polyethyleneimine.
[0391] In certain embodiments, the formation of the nucleic
acid-lipid particles can be carried out either in a mono-phase
system (e.g., a Bligh and Dyer monophase or similar mixture of
aqueous and organic solvents) or in a two-phase system with
suitable mixing.
[0392] When formation of the complexes is carried out in a
mono-phase system, the cationic lipids and nucleic acids are each
dissolved in a volume of the mono-phase mixture. Combination of the
two solutions provides a single mixture in which the complexes
form. Alternatively, the complexes can form in two-phase mixtures
in which the cationic lipids bind to the nucleic acid (which is
present in the aqueous phase), and "pull" it into the organic
phase.
[0393] In another embodiment, the serum-stable nucleic acid-lipid
particles can be prepared as follows:
[0394] (a) contacting nucleic acids with a solution comprising
non-cationic lipids and a detergent to form a nucleic acid-lipid
mixture;
[0395] (b) contacting cationic lipids with the nucleic acid-lipid
mixture to neutralize a portion of the negative charge of the
nucleic acids and form a charge-neutralized mixture of nucleic
acids and lipids; and
[0396] (c) removing the detergent from the charge-neutralized
mixture to provide the nucleic acid-lipid particles in which the
nucleic acids are protected from degradation.
[0397] In one group of embodiments, the solution of non-cationic
lipids and detergent is an aqueous solution. Contacting the nucleic
acids with the solution of non-cationic lipids and detergent is
typically accomplished by mixing together a first solution of
nucleic acids and a second solution of the lipids and detergent.
One of skill in the art will understand that this mixing can take
place by any number of methods, for example, by mechanical means
such as by using vortex mixers. Preferably, the nucleic acid
solution is also a detergent solution. The amount of non-cationic
lipid which is used in the present method is typically determined
based on the amount of cationic lipid used, and is typically of
from about 0.2 to about 5 times the amount of cationic lipid,
preferably from about 0.5 to about 2 times the amount of cationic
lipid used.
[0398] In some embodiments, the nucleic acids are precondensed as
described in, e.g., U.S. patent application Ser. No.
09/744,103.
[0399] The nucleic acid-lipid mixture thus formed is contacted with
cationic lipids to neutralize a portion of the negative charge
which is associated with the nucleic acids (or other polyanionic
materials) present. The amount of cationic lipids used will
typically be sufficient to neutralize at least 50% of the negative
charge of the nucleic acid. Preferably, the negative charge will be
at least 70% neutralized, more preferably at least 90% neutralized.
Cationic lipids which are useful in the present invention, include,
for example, DLinDMA and DLenDMA. These lipids and related analogs
are described in U.S. Patent Publication No. 20060083780.
[0400] Contacting the cationic lipids with the nucleic acid-lipid
mixture can be accomplished by any of a number of techniques,
preferably by mixing together a solution of the cationic lipid and
a solution containing the nucleic acid-lipid mixture. Upon mixing
the two solutions (or contacting in any other manner), a portion of
the negative charge associated with the nucleic acid is
neutralized. Nevertheless, the nucleic acid remains in an
uncondensed state and acquires hydrophilic characteristics.
[0401] After the cationic lipids have been contacted with the
nucleic acid-lipid mixture, the detergent (or combination of
detergent and organic solvent) is removed, thus forming the nucleic
acid-lipid particles. The methods used to remove the detergent will
typically involve dialysis. When organic solvents are present,
removal is typically accomplished by evaporation at reduced
pressures or by blowing a stream of inert gas (e.g., nitrogen or
argon) across the mixture.
[0402] The particles thus formed will typically be sized from about
50 nm to several microns, about 50 nm to about 150 nm, from about
60 nm to about 130 nm, from about 70 nm to about 110 nm, or from
about 70 nm to about 90 nm. To achieve further size reduction or
homogeneity of size in the particles, the nucleic acid-lipid
particles can be sonicated, filtered, or subjected to other sizing
techniques which are used in liposomal formulations and are known
to those of skill in the art.
[0403] In other embodiments, the methods will further comprise
adding non-lipid polycations which are useful to effect the
lipofection of cells using the present compositions. Examples of
suitable non-lipid polycations include, hexadimethrine bromide
(sold under the brandname POLYBRENE.RTM., from Aldrich Chemical
Co., Milwaukee, Wis., USA) or other salts of hexadimethrine. Other
suitable polycations include, for example, salts of
poly-L-ornithine, poly-L-arginine, poly-L-lysine, poly-D-lysine,
polyallylamine, and polyethyleneimine. Addition of these salts is
preferably after the particles have been formed.
[0404] In another aspect, the serum-stable nucleic acid-lipid
particles can be prepared as follows:
[0405] (a) contacting an amount of cationic lipids with nucleic
acids in a solution; the solution comprising from about 15%-35%
water and about 65%-85% organic solvent and the amount of cationic
lipids being sufficient to produce a +/- charge ratio of from about
0.85 to about 2.0, to provide a hydrophobic nucleic acid-lipid
complex;
[0406] (b) contacting the hydrophobic, nucleic acid-lipid complex
in solution with non-cationic lipids, to provide a nucleic
acid-lipid mixture; and
[0407] (c) removing the organic solvents from the nucleic
acid-lipid mixture to provide nucleic acid-lipid particles in which
the nucleic acids are protected from degradation.
[0408] The nucleic acids (e.g., interfering RNA), non-cationic
lipids, cationic lipids, and organic solvents which are useful in
this aspect of the invention are the same as those described for
the methods above which used detergents. In one group of
embodiments, the solution of step (a) is a mono-phase. In another
group of embodiments, the solution of step (a) is two-phase.
[0409] In preferred embodiments, the non-cationic lipids are ESM,
DSPC, DOPC, POPC, DPPC, monomethyl-phosphatidylethanolamine,
dimethyl-phosphatidylethanolamine, DMPE, DPPE, DSPE, DOPE, DEPE,
SOPE, POPE, PEG-based polymers (e.g., PEG 2000, PEG 5000,
PEG-modified diacylglycerols, or PEG-modified dialkyloxypropyls),
cholesterol, or combinations thereof. In still other preferred
embodiments, the organic solvents are methanol, chloroform,
methylene chloride, ethanol, diethyl ether or combinations
thereof.
[0410] In one embodiment, the nucleic acid is an interfering RNA as
described herein; the cationic lipid is DLindMA, DLenDMA, DODAC,
DDAB, DOTMA, DOSPA, DMRIE, DOGS, or combinations thereof; the
non-cationic lipid is ESM, DOPE, PEG-DAG, DSPC, DPPC, DPPE, DMPE,
monomethyl-phosphatidylethanolamine,
dimethyl-phosphatidylethanolamine, DSPE, DEPE, SOPE, POPE,
cholesterol, or combinations thereof (e.g., DSPC and PEG-DAA); and
the organic solvent is methanol, chloroform, methylene chloride,
ethanol, diethyl ether or combinations thereof.
[0411] As above, contacting the nucleic acids with the cationic
lipids is typically accomplished by mixing together a first
solution of nucleic acids and a second solution of the lipids,
preferably by mechanical means such as by using vortex mixers. The
resulting mixture contains complexes as described above. These
complexes are then converted to particles by the addition of
non-cationic lipids and the removal of the organic solvent. The
addition of the non-cationic lipids is typically accomplished by
simply adding a solution of the non-cationic lipids to the mixture
containing the complexes. A reverse addition can also be used.
Subsequent removal of organic solvents can be accomplished by
methods known to those of skill in the art and also described
above.
[0412] The amount of non-cationic lipids which is used in this
aspect of the invention is typically an amount of from about 0.2 to
about 15 times the amount (on a mole basis) of cationic lipids
which was used to provide the charge-neutralized nucleic acid-lipid
complex. Preferably, the amount is from about 0.5 to about 9 times
the amount of cationic lipids used.
[0413] In one embodiment, the nucleic acid-lipid particles prepared
according to the above-described methods are either net charge
neutral or carry an overall charge which provides the particles
with greater gene lipofection activity. Preferably, the nucleic
acid component of the particles is a nucleic acid which interferes
with the production of an undesired protein. In other preferred
embodiments, the non-cationic lipid may further comprise
cholesterol.
[0414] In some embodiments, the nucleic acid to lipid ratios
(mass/mass ratios) in a formed nucleic acid-lipid particle will
range from about 0.01 to about 0.2, from about 0.02 to about 0.1,
from about 0.03 to about 0.1, or from about 0.01 to about 0.08. The
ratio of the starting materials also falls within this range. In
other embodiments, the nucleic acid-lipid particle preparation uses
about 400 .mu.g nucleic acid per 10 mg total lipid or a nucleic
acid to lipid mass ratio of about 0.01 to about 0.08 and, more
preferably, about 0.04, which corresponds to 1.25 mg of total lipid
per 50 .mu.g of nucleic acid. In other preferred embodiments, the
particle has a nucleic acid:lipid mass ratio of about 0.08.
[0415] In other embodiments, the lipid to nucleic acid ratios
(mass/mass ratios) in a formed nucleic acid-lipid particle will
range from about 1 (1:1) to about 100 (100:1), from about 5 (5:1)
to about 100 (100:1), from about 1 (1:1) to about 50 (50:1), from
about 2 (2:1) to about 50 (50:1), from about 3 (3:1) to about 50
(50:1), from about 4 (4:1) to about 50 (50:1), from about 5 (5:1)
to about 50 (50:1), from about 1 (1:1) to about 25 (25:1), from
about 2 (2:1) to about 25 (25:1), from about 3 (3:1) to about 25
(25:1), from about 4 (4:1) to about 25 (25:1), from about 5 (5:1)
to about 25 (25:1), from about 5 (5:1) to about 20 (20:1), from
about 5 (5:1) to about 15 (15:1), from about 5 (5:1) to about 10
(10:1), about 5 (5:1), 6 (6:1), 7 (7:1), 8 (8:1), 9 (9:1), 10
(10:1), 11 (11:1), 12 (12:1), 13 (13:1), 14 (14:1), or 15 (15:1).
The ratio of the starting materials also falls within this
range.
[0416] As previously discussed, the conjugated lipid may further
include a CPL. A variety of general methods for making SNALP-CPLs
(CPL-containing SNALPs) are discussed herein. Two general
techniques include "post-insertion" technique, that is, insertion
of a CPL into for example, a pre-formed SNALP, and the "standard"
technique, wherein the CPL is included in the lipid mixture during
for example, the SNALP formation steps. The post-insertion
technique results in SNALPs having CPLs mainly in the external face
of the SNALP bilayer membrane, whereas standard techniques provide
SNALPs having CPLs on both internal and external faces. The method
is especially useful for vesicles made from phospholipids (which
can contain cholesterol) and also for vesicles containing
PEG-lipids (such as PEG-DAAs and PEG-DAGs). Methods of making
SNALP-CPL, are taught, for example, in U.S. Pat. Nos. 5,705,385;
6,586,410; 5,981,501; 6,534,484; and 6,852,334; U.S. Patent
Publication No. 20020072121; and PCT Publication No. WO
00/62813.
VII. Kits
[0417] The present invention also provides nucleic acid-lipid
particles in kit form. The kit may comprise a container which is
compartmentalized for holding the various elements of the nucleic
acid-lipid particles (e.g., the nucleic acids and the individual
lipid components of the particles). In some embodiments, the kit
may further comprise an endosomal membrane destabilizer (e.g.,
calcium ions). The kit typically contains the nucleic acid-lipid
particle compositions of the present invention, preferably in
dehydrated form, with instructions for their rehydration and
administration.
[0418] As explained herein, the SNALPs of the present invention can
be tailored to preferentially target particular tissues or organs
of interest. Preferential targeting of SNALPs is carried out by
controlling the composition of the SNALP itself. For instance, as
set forth in Examples 14 and 15, it has been found that the 1:57
PEG-cDSA SNALP formulation can be used to preferentially target
tumors outside of the liver, whereas the 1:57 PEG-cDMA SNALP
formulation can be used to preferentially target the liver. In
certain instances, however, it may be desirable to have a targeting
moiety attached to the surface of the particle to further enhance
the targeting of the SNALP. Methods of attaching targeting moieties
(e.g., antibodies, proteins) to lipids (such as those used in the
present particles) are known to those of skill in the art.
VIII. Administration of Nucleic Acid-Lipid Particles
[0419] Once formed, the serum-stable nucleic acid-lipid particles
(SNALP) of the present invention are useful for the introduction of
nucleic acids (e.g., interfering RNA) into cells. Accordingly, the
present invention also provides methods for introducing a nucleic
acid (e.g., interfering RNA) into a cell. The methods are carried
out in vitro or in vivo by first forming the particles as described
above and then contacting the particles with the cells for a period
of time sufficient for delivery of the nucleic acid to the cells to
occur.
[0420] The nucleic acid-lipid particles of the present invention
can be adsorbed to almost any cell type with which they are mixed
or contacted. Once adsorbed, the particles can either be
endocytosed by a portion of the cells, exchange lipids with cell
membranes, or fuse with the cells. Transfer or incorporation of the
nucleic acid portion of the particle can take place via any one of
these pathways. In particular, when fusion takes place, the
particle membrane is integrated into the cell membrane and the
contents of the particle combine with the intracellular fluid.
[0421] The nucleic acid-lipid particles of the present invention
can be administered either alone or in a mixture with a
pharmaceutically-acceptable carrier (e.g., physiological saline or
phosphate buffer) selected in accordance with the route of
administration and standard pharmaceutical practice. Generally,
normal buffered saline (e.g., 135-150 mM NaCl) will be employed as
the pharmaceutically-acceptable carrier. Other suitable carriers
include, e.g., water, buffered water, 0.4% saline, 0.3% glycine,
and the like, including glycoproteins for enhanced stability, such
as albumin, lipoprotein, globulin, etc. Additional suitable
carriers are described in, e.g., REMINGTON'S PHARMACEUTICAL
SCIENCES, Mack Publishing Company, Philadelphia, Pa., 17th ed.
(1985). As used herein, "carrier" includes any and all solvents,
dispersion media, vehicles, coatings, diluents, antibacterial and
antifungal agents, isotonic and absorption delaying agents,
buffers, carrier solutions, suspensions, colloids, and the like.
The phrase "pharmaceutically-acceptable" refers to molecular
entities and compositions that do not produce an allergic or
similar untoward reaction when administered to a human.
[0422] The pharmaceutically-acceptable carrier is generally added
following particle formation. Thus, after the particle is formed,
the particle can be diluted into pharmaceutically-acceptable
carriers such as normal buffered saline.
[0423] The concentration of particles in the pharmaceutical
formulations can vary widely, i.e., from less than about 0.05%,
usually at or at least about 2 to 5%, to as much as about 10 to 90%
by weight, and will be selected primarily by fluid volumes,
viscosities, etc., in accordance with the particular mode of
administration selected. For example, the concentration may be
increased to lower the fluid load associated with treatment. This
may be particularly desirable in patients having
atherosclerosis-associated congestive heart failure or severe
hypertension. Alternatively, particles composed of irritating
lipids may be diluted to low concentrations to lessen inflammation
at the site of administration.
[0424] The pharmaceutical compositions of the present invention may
be sterilized by conventional, well-known sterilization techniques.
Aqueous solutions can be packaged for use or filtered under aseptic
conditions and lyophilized, the lyophilized preparation being
combined with a sterile aqueous solution prior to administration.
The compositions can contain pharmaceutically-acceptable auxiliary
substances as required to approximate physiological conditions,
such as pH adjusting and buffering agents, tonicity adjusting
agents and the like, for example, sodium acetate, sodium lactate,
sodium chloride, potassium chloride, and calcium chloride.
Additionally, the particle suspension may include lipid-protective
agents which protect lipids against free-radical and
lipid-peroxidative damages on storage. Lipophilic free-radical
quenchers, such as alphatocopherol and water-soluble iron-specific
chelators, such as ferrioxamine, are suitable.
[0425] A. In Vivo Administration
[0426] Systemic delivery for in vivo therapy, i.e., delivery of a
therapeutic nucleic acid to a distal target cell via body systems
such as the circulation, has been achieved using nucleic acid-lipid
particles such as those disclosed in PCT Publication Nos. WO
05/007196, WO 05/121348, WO 05/120152, and WO 04/002453. The
present invention also provides fully encapsulated nucleic
acid-lipid particles that protect the nucleic acid from nuclease
degradation in serum, are nonimmunogenic, are small in size, and
are suitable for repeat dosing.
[0427] For in vivo administration, administration can be in any
manner known in the art, e.g., by injection, oral administration,
inhalation (e.g., intranasal or intratracheal), transdermal
application, or rectal administration. Administration can be
accomplished via single or divided doses. The pharmaceutical
compositions can be administered parenterally, i.e.,
intraarticularly, intravenously, intraperitoneally, subcutaneously,
or intramuscularly. In some embodiments, the pharmaceutical
compositions are administered intravenously or intraperitoneally by
a bolus injection (see, e.g., U.S. Pat. No. 5,286,634).
Intracellular nucleic acid delivery has also been discussed in
Straubringer et al., Methods Enzymol., 101:512 (1983); Mannino et
al., Biotechniques, 6:682 (1988); Nicolau et al., Crit. Rev. Ther.
Drug Carrier Syst., 6:239 (1989); and Behr, Acc. Chem. Res., 26:274
(1993). Still other methods of administering lipid-based
therapeutics are described in, for example, U.S. Pat. Nos.
3,993,754; 4,145,410; 4,235,871; 4,224,179; 4,522,803; and
4,588,578. The lipid-nucleic acid particles can be administered by
direct injection at the site of disease or by injection at a site
distal from the site of disease (see, e.g., Culver, HUMAN GENE
THERAPY, MaryAnn Liebert, Inc., Publishers, New York. pp.
70-71(1994)).
[0428] The compositions of the present invention, either alone or
in combination with other suitable components, can be made into
aerosol formulations (i.e., they can be "nebulized") to be
administered via inhalation (e.g., intranasally or intratracheally)
(see, Brigham et al., Am. J. Sci., 298:278 (1989)). Aerosol
formulations can be placed into pressurized acceptable propellants,
such as dichlorodifluoromethane, propane, nitrogen, and the
like.
[0429] In certain embodiments, the pharmaceutical compositions may
be delivered by intranasal sprays, inhalation, and/or other aerosol
delivery vehicles. Methods for delivering nucleic acid compositions
directly to the lungs via nasal aerosol sprays have been described,
e.g., in U.S. Pat. Nos. 5,756,353 and 5,804,212. Likewise, the
delivery of drugs using intranasal microparticle resins and
lysophosphatidyl-glycerol compounds (U.S. Pat. No. 5,725,871) are
also well-known in the pharmaceutical arts. Similarly, transmucosal
drug delivery in the form of a polytetrafluoroetheylene support
matrix is described in U.S. Pat. No. 5,780,045.
[0430] Formulations suitable for parenteral administration, such
as, for example, by intraarticular (in the joints), intravenous,
intramuscular, intradermal, intraperitoneal, and subcutaneous
routes, include aqueous and non-aqueous, isotonic sterile injection
solutions, which can contain antioxidants, buffers, bacteriostats,
and solutes that render the formulation isotonic with the blood of
the intended recipient, and aqueous and non-aqueous sterile
suspensions that can include suspending agents, solubilizers,
thickening agents, stabilizers, and preservatives. In the practice
of this invention, compositions are preferably administered, for
example, by intravenous infusion, orally, topically,
intraperitoneally, intravesically, or intrathecally.
[0431] Generally, when administered intravenously, the nucleic
acid-lipid formulations are formulated with a suitable
pharmaceutical carrier. Many pharmaceutically acceptable carriers
may be employed in the compositions and methods of the present
invention. Suitable formulations for use in the present invention
are found, for example, in REMINGTON'S PHARMACEUTICAL SCIENCES,
Mack Publishing Company, Philadelphia, Pa., 17th ed. (1985). A
variety of aqueous carriers may be used, for example, water,
buffered water, 0.4% saline, 0.3% glycine, and the like, and may
include glycoproteins for enhanced stability, such as albumin,
lipoprotein, globulin, etc. Generally, normal buffered saline
(135-150 mM NaCl) will be employed as the pharmaceutically
acceptable carrier, but other suitable carriers will suffice. These
compositions can be sterilized by conventional liposomal
sterilization techniques, such as filtration. The compositions may
contain pharmaceutically acceptable auxiliary substances as
required to approximate physiological conditions, such as pH
adjusting and buffering agents, tonicity adjusting agents, wetting
agents and the like, for example, sodium acetate, sodium lactate,
sodium chloride, potassium chloride, calcium chloride, sorbitan
monolaurate, triethanolamine oleate, etc. These compositions can be
sterilized using the techniques referred to above or,
alternatively, they can be produced under sterile conditions. The
resulting aqueous solutions may be packaged for use or filtered
under aseptic conditions and lyophilized, the lyophilized
preparation being combined with a sterile aqueous solution prior to
administration.
[0432] In certain applications, the nucleic acid-lipid particles
disclosed herein may be delivered via oral administration to the
individual. The particles may be incorporated with excipients and
used in the form of ingestible tablets, buccal tablets, troches,
capsules, pills, lozenges, elixirs, mouthwash, suspensions, oral
sprays, syrups, wafers, and the like (see, e.g., U.S. Pat. Nos.
5,641,515, 5,580,579, and 5,792,451). These oral dosage forms may
also contain the following: binders, gelatin; excipients,
lubricants, and/or flavoring agents. When the unit dosage form is a
capsule, it may contain, in addition to the materials described
above, a liquid carrier. Various other materials may be present as
coatings or to otherwise modify the physical form of the dosage
unit. Of course, any material used in preparing any unit dosage
form should be pharmaceutically pure and substantially non-toxic in
the amounts employed.
[0433] Typically, these oral formulations may contain at least
about 0.1% of the nucleic acid-lipid particles or more, although
the percentage of the particles may, of course, be varied and may
conveniently be between about 1% or 2% and about 60% or 70% or more
of the weight or volume of the total formulation. Naturally, the
amount of particles in each therapeutically useful composition may
be prepared is such a way that a suitable dosage will be obtained
in any given unit dose of the compound. Factors such as solubility,
bioavailability, biological half-life, route of administration,
product shelf life, as well as other pharmacological considerations
will be contemplated by one skilled in the art of preparing such
pharmaceutical formulations, and as such, a variety of dosages and
treatment regimens may be desirable.
[0434] Formulations suitable for oral administration can consist
of: (a) liquid solutions, such as an effective amount of the
packaged nucleic acid (e.g., interfering RNA) suspended in diluents
such as water, saline, or PEG 400; (b) capsules, sachets, or
tablets, each containing a predetermined amount of the nucleic acid
(e.g., interfering RNA), as liquids, solids, granules, or gelatin;
(c) suspensions in an appropriate liquid; and (d) suitable
emulsions. Tablet forms can include one or more of lactose,
sucrose, mannitol, sorbitol, calcium phosphates, corn starch,
potato starch, microcrystalline cellulose, gelatin, colloidal
silicon dioxide, talc, magnesium stearate, stearic acid, and other
excipients, colorants, fillers, binders, diluents, buffering
agents, moistening agents, preservatives, flavoring agents, dyes,
disintegrating agents, and pharmaceutically compatible carriers.
Lozenge forms can comprise the nucleic acid (e.g., interfering RNA)
in a flavor, e.g., sucrose, as well as pastilles comprising the
nucleic acid (e.g., interfering RNA) in an inert base, such as
gelatin and glycerin or sucrose and acacia emulsions, gels, and the
like containing, in addition to the nucleic acid (e.g., interfering
RNA), carriers known in the art.
[0435] In another example of their use, nucleic acid-lipid
particles can be incorporated into a broad range of topical dosage
forms. For instance, the suspension containing the nucleic
acid-lipid particles can be formulated and administered as gels,
oils, emulsions, topical creams, pastes, ointments, lotions, foams,
mousses, and the like.
[0436] When preparing pharmaceutical preparations of the nucleic
acid-lipid particles of the invention, it is preferable to use
quantities of the particles which have been purified to reduce or
eliminate empty particles or particles with nucleic acid associated
with the external surface.
[0437] The methods of the present invention may be practiced in a
variety of hosts. Preferred hosts include mammalian species, such
as primates (e.g., humans and chimpanzees as well as other nonhuman
primates), canines, felines, equines, bovines, ovines, caprines,
rodents (e.g., rats and mice), lagomorphs, and swine.
[0438] The amount of particles administered will depend upon the
ratio of nucleic acid to lipid, the particular nucleic acid used,
the disease state being diagnosed, the age, weight, and condition
of the patient, and the judgment of the clinician, but will
generally be between about 0.01 and about 50 mg per kilogram of
body weight, preferably between about 0.1 and about 5 mg/kg of body
weight, or about 10.sup.8-10.sup.10 particles per administration
(e.g., injection).
[0439] B. In Vitro Administration
[0440] For in vitro applications, the delivery of nucleic acids
(e.g., interfering RNA) can be to any cell grown in culture,
whether of plant or animal origin, vertebrate or invertebrate, and
of any tissue or type. In preferred embodiments, the cells are
animal cells, more preferably mammalian cells, and most preferably
human cells.
[0441] Contact between the cells and the nucleic acid-lipid
particles, when carried out in vitro, takes place in a biologically
compatible medium. The concentration of particles varies widely
depending on the particular application, but is generally between
about 1 .mu.mol and about 10 mmol. Treatment of the cells with the
nucleic acid-lipid particles is generally carried out at
physiological temperatures (about 37.degree. C.) for periods of
time of from about 1 to 48 hours, preferably of from about 2 to 4
hours.
[0442] In one group of preferred embodiments, a nucleic acid-lipid
particle suspension is added to 60-80% confluent plated cells
having a cell density of from about 10.sup.3 to about 10.sup.5
cells/ml, more preferably about 2.times.10.sup.4 cells/ml. The
concentration of the suspension added to the cells is preferably of
from about 0.01 to 0.2 .mu.g/ml, more preferably about 0.1
.mu.g/ml.
[0443] Using an Endosomal Release Parameter (ERP) assay, the
delivery efficiency of the SNALP or other lipid-based carrier
system can be optimized. An ERP assay is described in detail in
U.S. Patent Publication No. 20030077829. More particularly, the
purpose of an ERP assay is to distinguish the effect of various
cationic lipids and helper lipid components of SNALPs based on
their relative effect on binding/uptake or fusion
with/destabilization of the endosomal membrane. This assay allows
one to determine quantitatively how each component of the SNALP or
other lipid-based carrier system affects delivery efficiency,
thereby optimizing the SNALPs or other lipid-based carrier systems.
Usually, an ERP assay measures expression of a reporter protein
(e.g., luciferase, .beta.-galactosidase, green fluorescent protein
(GFP), etc.), and in some instances, a SNALP formulation optimized
for an expression plasmid will also be appropriate for
encapsulating an interfering RNA. In other instances, an ERP assay
can be adapted to measure downregulation of transcription or
translation of a target sequence in the presence or absence of an
interfering RNA (e.g., siRNA). By comparing the ERPs for each of
the various SNALPs or other lipid-based formulations, one can
readily determine the optimized system, e.g., the SNALP or other
lipid-based formulation that has the greatest uptake in the
cell.
[0444] C. Cells for Delivery of Interfering RNA
[0445] The compositions and methods of the present invention are
used to treat a wide variety of cell types, in vivo and in vitro.
Suitable cells include, e.g., hematopoietic precursor (stem) cells,
fibroblasts, keratinocytes, hepatocytes, endothelial cells,
skeletal and smooth muscle cells, osteoblasts, neurons, quiescent
lymphocytes, terminally differentiated cells, slow or noncycling
primary cells, parenchymal cells, lymphoid cells, epithelial cells,
bone cells, and the like. In preferred embodiments, an interfering
RNA (e.g., siRNA) is delivered to cancer cells such as, e.g., lung
cancer cells, colon cancer cells, rectal cancer cells, anal cancer
cells, bile duct cancer cells, small intestine cancer cells,
stomach (gastric) cancer cells, esophageal cancer cells,
gallbladder cancer cells, liver cancer cells, pancreatic cancer
cells, appendix cancer cells, breast cancer cells, ovarian cancer
cells, cervical cancer cells, prostate cancer cells, renal cancer
cells, cancer cells of the central nervous system, glioblastoma
tumor cells, skin cancer cells, lymphoma cells, choriocarcinoma
tumor cells, head and neck cancer cells, osteogenic sarcoma tumor
cells, and blood cancer cells.
[0446] In vivo delivery of nucleic acid-lipid particles
encapsulating an interfering RNA (e.g., siRNA) is suited for
targeting cells of any cell type. The methods and compositions can
be employed with cells of a wide variety of vertebrates, including
mammals, such as, e.g, canines, felines, equines, bovines, ovines,
caprines, rodents (e.g., mice, rats, and guinea pigs), lagomorphs,
swine, and primates (e.g. monkeys, chimpanzees, and humans).
[0447] To the extent that tissue culture of cells may be required,
it is well-known in the art. For example, Freshney, Culture of
Animal Cells, a Manual of Basic Technique, 3rd Ed., Wiley-Liss, New
York (1994), Kuchler et al., Biochemical Methods in Cell Culture
and Virology, Dowden, Hutchinson and Ross, Inc. (1977), and the
references cited therein provide a general guide to the culture of
cells. Cultured cell systems often will be in the form of
monolayers of cells, although cell suspensions are also used.
[0448] D. Detection of SNALP
[0449] In some embodiments, the nucleic acid-lipid particles are
detectable in the subject at about 8, 12, 24, 48, 60, 72, or 96
hours, or 6, 8, 10, 12, 14, 16, 18, 19, 22, 24, 25, or 28 days
after administration of the particles. The presence of the
particles can be detected in the cells, tissues, or other
biological samples from the subject. The particles may be detected,
e.g., by direct detection of the particles, detection of the
interfering RNA (e.g., siRNA) sequence, detection of the target
sequence of interest (i.e., by detecting expression or reduced
expression of the sequence of interest), or a combination
thereof.
[0450] 1. Detection of Particles
[0451] Nucleic acid-lipid particles can be detected using any
methods known in the art. For example, a label can be coupled
directly or indirectly to a component of the SNALP or other carrier
system using methods well-known in the art. A wide variety of
labels can be used, with the choice of label depending on
sensitivity required, ease of conjugation with the SNALP component,
stability requirements, and available instrumentation and disposal
provisions. Suitable labels include, but are not limited to,
spectral labels such as fluorescent dyes (e.g., fluorescein and
derivatives, such as fluorescein isothiocyanate (FITC) and Oregon
Green.TM.; rhodamine and derivatives such Texas red, tetrarhodimine
isothiocynate (TRITC), etc., digoxigenin, biotin, phycoerythrin,
AMCA, CyDyes.TM., and the like; radiolabels such as .sup.3H,
.sup.125I, .sup.35S, .sup.14C, .sup.32P, .sup.33P, etc.; enzymes
such as horse radish peroxidase, alkaline phosphatase, etc.;
spectral colorimetric labels such as colloidal gold or colored
glass or plastic beads such as polystyrene, polypropylene, latex,
etc. The label can be detected using any means known in the
art.
[0452] 2. Detection of Nucleic Acids
[0453] Nucleic acids (e.g., interfering RNA) are detected and
quantified herein by any of a number of means well-known to those
of skill in the art. The detection of nucleic acids proceeds by
well-known methods such as Southern analysis, Northern analysis,
gel electrophoresis, PCR, radiolabeling, scintillation counting,
and affinity chromatography. Additional analytic biochemical
methods such as spectrophotometry, radiography, electrophoresis,
capillary electrophoresis, high performance liquid chromatography
(HPLC), thin layer chromatography (TLC), and hyperdiffusion
chromatography may also be employed.
[0454] The selection of a nucleic acid hybridization format is not
critical. A variety of nucleic acid hybridization formats are known
to those skilled in the art. For example, common formats include
sandwich assays and competition or displacement assays.
Hybridization techniques are generally described in, e.g., "Nucleic
Acid Hybridization, A Practical Approach," Eds. Hames and Higgins,
IRL Press (1985).
[0455] The sensitivity of the hybridization assays may be enhanced
through use of a nucleic acid amplification system which multiplies
the target nucleic acid being detected. In vitro amplification
techniques suitable for amplifying sequences for use as molecular
probes or for generating nucleic acid fragments for subsequent
subcloning are known. Examples of techniques sufficient to direct
persons of skill through such in vitro amplification methods,
including the polymerase chain reaction (PCR) the ligase chain
reaction (LCR), Q.beta.-replicase amplification and other RNA
polymerase mediated techniques (e.g., NASBA.TM.) are found in
Sambrook et al., In Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory Press (2000); and Ausubel et al., SHORT
PROTOCOLS IN MOLECULAR BIOLOGY, eds., Current Protocols, Greene
Publishing Associates, Inc. and John Wiley & Sons, Inc. (2002);
as well as U.S. Pat. No. 4,683,202; PCR Protocols, A Guide to
Methods and Applications (Innis et al. eds.) Academic Press Inc.
San Diego, Calif. (1990); Arnheim & Levinson (Oct. 1, 1990),
C&EN 36; The Journal Of NIH Research, 3:81 (1991); Kwoh et al.,
Proc. Natl. Acad. Sci. USA, 86:1173 (1989); Guatelli et al., Proc.
Natl. Acad. Sci. USA, 87:1874 (1990); Lomeli et al., J Clin. Chem.,
35:1826 (1989); Landegren et al., Science, 241:1077 (1988); Van
Brunt, Biotechnology, 8:291 (1990); Wu and Wallace, Gene, 4:560
(1989); Barringer et al., Gene, 89:117 (1990); and Sooknanan and
Malek, Biotechnology, 13:563 (1995). Improved methods of cloning in
vitro amplified nucleic acids are described in U.S. Pat. No.
5,426,039. Other methods described in the art are the nucleic acid
sequence based amplification (NASBA.TM., Cangene, Mississauga,
Ontario) and Q.beta.-replicase systems. These systems can be used
to directly identify mutants where the PCR or LCR primers are
designed to be extended or ligated only when a select sequence is
present. Alternatively, the select sequences can be generally
amplified using, for example, nonspecific PCR primers and the
amplified target region later probed for a specific sequence
indicative of a mutation.
[0456] Nucleic acids for use as probes, e.g., in in vitro
amplification methods, for use as gene probes, or as inhibitor
components are typically synthesized chemically according to the
solid phase phosphoramidite triester method described by Beaucage
et al., Tetrahedron Letts., 22:1859 1862 (1981), e.g., using an
automated synthesizer, as described in Needham VanDevanter et al.,
Nucleic Acids Res., 12:6159 (1984). Purification of
polynucleotides, where necessary, is typically performed by either
native acrylamide gel electrophoresis or by anion exchange HPLC as
described in Pearson et al., J. Chrom., 255:137 149 (1983). The
sequence of the synthetic polynucleotides can be verified using the
chemical degradation method of Maxam and Gilbert (1980) in Grossman
and Moldave (eds.) Academic Press, New York, Methods in Enzymology,
65:499.
[0457] An alternative means for determining the level of
transcription is in situ hybridization. In situ hybridization
assays are well-known and are generally described in Angerer et
al., Methods Enzymol., 152:649 (1987). In an in situ hybridization
assay, cells are fixed to a solid support, typically a glass slide.
If DNA is to be probed, the cells are denatured with heat or
alkali. The cells are then contacted with a hybridization solution
at a moderate temperature to permit annealing of specific probes
that are labeled. The probes are preferably labeled with
radioisotopes or fluorescent reporters.
IX. Administration of Chemotherapeutic Agents
[0458] In some embodiments, the present invention provides methods
for sensitizing a cell to the effects of a chemotherapy drug by
administering a PLK-1 interfering RNA (e.g., using a suitable
carrier system) in combination with the chemotherapy drug. The
methods can be carried out in vitro using standard tissue culture
techniques or in vivo by administering the interfering RNA and
chemotherapy drug as described herein or using any means known in
the art. In preferred embodiments, this combination of therapeutic
agents is delivered to a cancer cell in a mammal such as a
human.
[0459] In certain aspects, a patient about to begin chemotherapy is
first pretreated with a suitable dose of one or more nucleic
acid-lipid particles (e.g., SNALP) containing PLK-1 interfering RNA
(e.g., siRNA). The patient can be pretreated with a suitable dose
of one or more nucleic acid-lipid particles at any reasonable time
prior to chemotherapy drug administration. As non-limiting
examples, the dose of one or more nucleic acid-lipid particles can
be administered about 96, 84, 72, 60, 48, 36, 24, 23, 22, 21, 20,
19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1,
0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 hours, or any
interval thereof, before chemotherapy drug administration.
[0460] Additionally, a patient about to begin chemotherapy can be
pretreated with more than one dose of nucleic acid-lipid particles
(e.g., SNALP) containing PLK-1 interfering RNA (e.g., siRNA) at
different times before chemotherapy drug administration. As such,
the methods of the present invention can further comprise
administering a second dose of nucleic acid-lipid particles prior
to chemotherapy drug administration. In certain instances, the
nucleic acid-lipid particles of the first dose are the same as the
nucleic acid-lipid particles of the second dose. In certain other
instances, the nucleic acid-lipid particles of the first dose are
different from the nucleic acid-lipid particles of the second dose.
Preferably, the two pretreatment doses use the same nucleic
acid-lipid particles, e.g., SNALP containing the same PLK-1
interfering RNA sequence. One skilled in the art will appreciate
that the second dose of nucleic acid-lipid particles can occur at
any reasonable time following the first dose. As a non-limiting
example, if the first dose was administered about 12 hours before
chemotherapy drug administration, the second dose can be
administered about 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.9, 0.8,
0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 hours, or any interval
thereof, before chemotherapy drug administration. One skilled in
the art will also appreciate that the second dose of nucleic
acid-lipid particles can be the same or a different dose. In
additional embodiments of the present invention, the patient can be
pretreated with a third, fourth, fifth, sixth, seventh, eighth,
ninth, tenth, or more dose of the same or different nucleic
acid-lipid particles prior to chemotherapy drug administration.
[0461] A patient can also be treated with a suitable dose of one or
more nucleic acid-lipid particles (e.g., SNALP) containing PLK-1
interfering RNA (e.g., siRNA) at any reasonable time during
chemotherapy drug administration. As such, the methods of the
present invention can further comprise administering a dose of
nucleic acid-lipid particles during chemotherapy drug
administration. One skilled in the art will appreciate that more
than one dose of nucleic acid-lipid particles can be administered
at different times during chemotherapy drug administration. As a
non-limiting example, a SNALP containing an unmodified and/or
modified PLK-1 siRNA sequence can be administered at the beginning
of chemotherapy drug administration, while chemotherapy drug
administration is in progress, and/or at the end of chemotherapy
drug administration. One skilled in the art will also appreciate
that the pretreatment and intra-treatment (i.e., during
chemotherapy drug administration) doses of nucleic acid-lipid
particles can be the same or a different dose.
[0462] In addition, a patient can be treated with a suitable dose
of one or more nucleic acid-lipid particles (e.g., SNALP)
containing PLK-1 interfering RNA (e.g., siRNA) at any reasonable
time following chemotherapy drug administration. As such, the
methods of the present invention can further comprise administering
a dose of nucleic acid-lipid particles after chemotherapy drug
administration. As non-limiting examples, the dose of one or more
nucleic acid-lipid particles can be administered about 0.1, 0.2,
0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 36, 48, 60,
72, 84, 96, 108, or more hours, or any interval thereof, after
chemotherapy drug administration. In certain instances, the same
nucleic acid-lipid particle is used before and after chemotherapy
drug administration. In certain other instances, a different
nucleic acid-lipid particle is used following chemotherapy drug
administration. One skilled in the art will appreciate that more
than one dose of nucleic acid-lipid particles can be administered
at different times following chemotherapy drug administration. One
skilled in the art will also appreciate that the pretreatment and
posttreatment (i.e., following chemotherapy drug administration)
doses of nucleic acid-lipid particles can be the same or a
different dose.
[0463] Chemotherapy drugs can be administered with a suitable
pharmaceutical excipient as necessary and can be carried out via
any of the accepted modes of administration. Thus, administration
can be, for example, oral, buccal, sublingual, gingival, palatal,
intravenous, topical, subcutaneous, transcutaneous, transdermal,
intramuscular, intra-joint, parenteral, intra-arteriole,
intradermal, intraventricular, intracranial, intraperitoneal,
intravesical, intrathecal, intralesional, intranasal, rectal,
vaginal, or by inhalation. By "co-administer" it is meant that a
chemotherapy drug is administered at the same time, just prior to,
or just after the administration of a second drug or therapeutic
agent (e.g., a nucleic acid-lipid particle, another chemotherapy
drug, a drug useful for reducing the side-effects associated with
chemotherapy, a radiotherapeutic agent, a hormonal therapeutic
agent, an immunotherapeutic agent, etc.).
[0464] Non-limiting examples of chemotherapy drugs suitable for use
in the present invention include platinum-based drugs (e.g.,
oxaliplatin, cisplatin, carboplatin, spiroplatin, iproplatin,
satraplatin, etc.), alkylating agents (e.g., cyclophosphamide,
ifosfamide, chlorambucil, busulfan, melphalan, mechlorethamine,
uramustine, thiotepa, nitrosoureas, etc.), anti-metabolites (e.g.,
5-fluorouracil (5-FU), azathioprine, methotrexate, leucovorin,
capecitabine, cytarabine, floxuridine, fludarabine, gemcitabine,
pemetrexed, raltitrexed, etc.), plant alkaloids (e.g., vincristine,
vinblastine, vinorelbine, vindesine, podophyllotoxin, paclitaxel
(taxol), docetaxel, etc.), topoisomerase inhibitors (e.g.,
irinotecan, topotecan, amsacrine, etoposide (VP16), etoposide
phosphate, teniposide, etc.), antitumor antibiotics (e.g.,
doxorubicin, adriamycin, daunorubicin, epirubicin, actinomycin,
bleomycin, mitomycin, mitoxantrone, plicamycin, etc.), tyrosine
kinase inhibitors (e.g., gefitinib (Iressa.RTM.), sunitinib
(Sutent.RTM.; SUI 1248), erlotinib (Tarceva.RTM.; OSI-1774),
lapatinib (GW572016; GW2016), canertinib (CI 1033), semaxinib
(SU5416), vatalanib (PTK787/ZK222584), sorafenib (BAY 43-9006),
imatinib (Gleevec.RTM.; STI571), dasatinib (BMS-354825),
leflunomide (SU101), vandetanib (Zactima.TM.; ZD6474), etc.),
pharmaceutically acceptable salts thereof, stereoisomers thereof,
derivatives thereof, analogs thereof, and combinations thereof.
[0465] The nucleic acid-lipid particles and/or chemotherapy drugs
described herein can also be co-administered with conventional
hormonal therapeutic agents including, but not limited to, steroids
(e.g., dexamethasone), finasteride, aromatase inhibitors,
tamoxifen, and gonadotropin-releasing hormone agonists (GnRH) such
as goserelin.
[0466] Additionally, the nucleic acid-lipid particles and/or
chemotherapy drugs described herein can be co-administered with
conventional immunotherapeutic agents including, but not limited
to, immunostimulants (e.g., Bacillus Calmette-Guerin (BCG),
levamisole, interleukin-2, alpha-interferon, etc.), monoclonal
antibodies (e.g., anti-CD20, anti-HER2, anti-CD52, anti-HLA-DR, and
anti-VEGF monoclonal antibodies), immunotoxins (e.g., anti-CD33
monoclonal antibody-calicheamicin conjugate, anti-CD22 monoclonal
antibody-pseudomonas exotoxin conjugate, etc.), and
radioimmunotherapy (e.g., anti-CD20 monoclonal antibody conjugated
to .sup.111In, .sup.90Y, or .sup.131I, etc.).
[0467] In a further embodiment, the nucleic acid-lipid particles
and/or chemotherapy drugs described herein can be co-administered
with conventional radiotherapeutic agents including, but not
limited to, radionuclides such as .sup.47Sc, .sup.64Cu, .sup.67Cu,
.sup.89Sr, .sup.86Y, .sup.87Y, .sup.90Y, .sup.105Rh, .sup.111Ag,
.sup.111In, .sup.117mSn, .sup.149Pm, .sup.153Sm, .sup.166Ho,
.sup.177Lu, .sup.186Re, .sup.188Re, .sup.211At, and .sup.212Bi,
optionally conjugated to antibodies directed against tumor
antigens.
[0468] A therapeutically effective amount of a chemotherapy drug
may be administered repeatedly, e.g., at least 2, 3, 4, 5, 6, 7, 8,
or more times, or the dose may be administered by continuous
infusion. The dose may take the form of solid, semi-solid,
lyophilized powder, or liquid dosage forms, such as, for example,
tablets, pills, pellets, capsules, powders, solutions, suspensions,
emulsions, suppositories, retention enemas, creams, ointments,
lotions, gels, aerosols, foams, or the like, preferably in unit
dosage forms suitable for simple administration of precise dosages.
One skilled in the art will appreciate that administered dosages of
chemotherapy drugs will vary depending on a number of factors,
including, but not limited to, the particular chemotherapy drug or
set of chemotherapy drugs to be administered, the mode of
administration, the type of application, the age of the patient,
and the physical condition of the patient. Preferably, the smallest
dose and concentration required to produce the desired result
should be used. Dosage should be appropriately adjusted for
children, the elderly, debilitated patients, and patients with
cardiac and/or liver disease. Further guidance can be obtained from
studies known in the art using experimental animal models for
evaluating dosage.
[0469] As used herein, the term "unit dosage form" refers to
physically discrete units suitable as unitary dosages for human
subjects and other mammals, each unit containing a predetermined
quantity of a chemotherapy drug calculated to produce the desired
onset, tolerability, and/or therapeutic effects, in association
with a suitable pharmaceutical excipient (e.g., an ampoule). In
addition, more concentrated dosage forms may be prepared, from
which the more dilute unit dosage forms may then be produced. The
more concentrated dosage forms thus will contain substantially more
than, e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times
the amount of the chemotherapy drug.
[0470] Methods for preparing such dosage forms are known to those
skilled in the art (see, e.g., REMINGTON'S PHARMACEUTICAL SCIENCES,
18TH ED., Mack Publishing Co., Easton, Pa. (1990)). The dosage
forms typically include a conventional pharmaceutical carrier or
excipient and may additionally include other medicinal agents,
carriers, adjuvants, diluents, tissue permeation enhancers,
solubilizers, and the like. Appropriate excipients can be tailored
to the particular dosage form and route of administration by
methods well known in the art (see, e.g., REMINGTON'S
PHARMACEUTICAL SCIENCES, supra).
[0471] Examples of suitable excipients include, but are not limited
to, lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum
acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium
silicate, microcrystalline cellulose, polyvinylpyrrolidone,
cellulose, water, saline, syrup, methylcellulose, ethylcellulose,
hydroxypropylmethylcellulose, and polyacrylic acids such as
Carbopols, e.g., Carbopol 941, Carbopol 980, Carbopol 981, etc. The
dosage forms can additionally include lubricating agents such as
talc, magnesium stearate, and mineral oil; wetting agents;
emulsifying agents; suspending agents; preserving agents such as
methyl-, ethyl-, and propyl-hydroxy-benzoates (i.e., the parabens);
pH adjusting agents such as inorganic and organic acids and bases;
sweetening agents; and flavoring agents. The dosage forms may also
comprise biodegradable polymer beads, dextran, and cyclodextrin
inclusion complexes.
[0472] For oral administration, the therapeutically effective dose
can be in the form of tablets, capsules, emulsions, suspensions,
solutions, syrups, sprays, lozenges, powders, and sustained-release
formulations. Suitable excipients for oral administration include
pharmaceutical grades of mannitol, lactose, starch, magnesium
stearate, sodium saccharine, talcum, cellulose, glucose, gelatin,
sucrose, magnesium carbonate, and the like.
[0473] In some embodiments, the therapeutically effective dose
takes the form of a pill, tablet, or capsule, and thus, the dosage
form can contain, along with a chemotherapy drug, any of the
following: a diluent such as lactose, sucrose, dicalcium phosphate,
and the like; a disintegrant such as starch or derivatives thereof;
a lubricant such as magnesium stearate and the like; and a binder
such a starch, gum acacia, polyvinylpyrrolidone, gelatin, cellulose
and derivatives thereof. A chemotherapy drug can also be formulated
into a suppository disposed, for example, in a polyethylene glycol
(PEG) carrier.
[0474] Liquid dosage forms can be prepared by dissolving or
dispersing a chemotherapy drug and optionally one or more
pharmaceutically acceptable adjuvants in a carrier such as, for
example, aqueous saline (e.g., 0.9% w/v sodium chloride), aqueous
dextrose, glycerol, ethanol, and the like, to form a solution or
suspension, e.g., for oral, topical, or intravenous administration.
A chemotherapy drug can also be formulated into a retention
enema.
[0475] For topical administration, the therapeutically effective
dose can be in the form of emulsions, lotions, gels, foams, creams,
jellies, solutions, suspensions, ointments, and transdermal
patches. For administration by inhalation, a chemotherapy drug can
be delivered as a dry powder or in liquid form via a nebulizer. For
parenteral administration, the therapeutically effective dose can
be in the form of sterile injectable solutions and sterile packaged
powders. Preferably, injectable solutions are formulated at a pH of
from about 4.5 to about 7.5.
[0476] The therapeutically effective dose can also be provided in a
lyophilized form. Such dosage forms may include a buffer, e.g.,
bicarbonate, for reconstitution prior to administration, or the
buffer may be included in the lyophilized dosage form for
reconstitution with, e.g., water. The lyophilized dosage form may
further comprise a suitable vasoconstrictor, e.g., epinephrine. The
lyophilized dosage form can be provided in a syringe, optionally
packaged in combination with the buffer for reconstitution, such
that the reconstituted dosage form can be immediately administered
to a subject.
X. Examples
[0477] The present invention will be described in greater detail by
way of specific examples. The following examples are offered for
illustrative purposes, and are not intended to limit the invention
in any manner. Those of skill in the art will readily recognize a
variety of noncritical parameters which can be changed or modified
to yield essentially the same results.
Example 1
Materials and Methods
[0478] siRNA:
[0479] All siRNA molecules used in these studies were chemically
synthesized by the University of Calgary (Calgary, AB), Dharmacon
Inc. (Lafayette, Colo.), or Integrated DNA Technologies
(Coralville, Iowa). The siRNAs were desalted and annealed using
standard procedures.
[0480] Lipid Encapsulation of siRNA:
[0481] Unless otherwise indicated, siRNA molecules were
encapsulated into nucleic acid-lipid particles composed of the
following lipids: synthetic cholesterol (Sigma-Aldrich Corp.; St.
Louis, Mo.); the phospholipid DSPC
(1,2-distearoyl-sn-glycero-3-phosphocholine; Avanti Polar Lipids;
Alabaster, Ala.); the PEG-lipid PEG-cDMA (3-N-[(-Methoxy
poly(ethylene
glycol)2000)carbamoyl]-1,2-dimyrestyloxy-propylamine); and the
cationic lipid DLinDMA
(1,2-Dilinoleyloxy-3-(N,N-dimethyl)aminopropane) in the molar ratio
48:10:2:40, respectively. In other words, unless otherwise
indicated, siRNAs were encapsulated into liposomes of the following
"2:40" SNALP formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and
48% cholesterol. In some embodiments, siRNA molecules were
encapsulated into nucleic acid-lipid particles composed of the
following lipids: the lipid conjugate PEG-cDMA; the cationic lipid
DLinDMA; the phospholipid DPPC
(1,2-dipalmitoyl-sn-glycero-3-phosphocholine; Avanti Polar Lipids;
Alabaster, Ala.); and synthetic cholesterol in the molar ratio
1.4:57.1:7.1:34.3, respectively. In other words, siRNAs were
encapsulated into SNALPs of the following "1:57" formulation: 1.4%
PEG-cDMA; 57.1% DLinDMA; 7.1% DPPC; and 34.3% cholesterol. In other
embodiments, siRNA molecules were encapsulated into
phospholipid-free SNALPs composed of the following lipids: the
lipid conjugate PEG-cDMA; the cationic lipid DLinDMA; and synthetic
cholesterol in the molar ratio 1.5:61.5:36.9, respectively. In
other words, siRNAs were encapsulated into phospholipid-free SNALPs
of the following "1:62" formulation: 1.5% PEG-cDMA; 61.5% DLinDMA;
and 36.9% cholesterol. For vehicle controls, empty particles with
identical lipid composition were formed in the absence of siRNA. It
should be understood that the 1:57 formulation and 1:62 formulation
are target formulations, and that the amount of lipid (both
cationic and non-cationic) present and the amount of lipid
conjugate present in the formulation may vary. Typically, in the
1:57 formulation, the amount of cationic lipid will be 57 mol
%.+-.5 mol %, and the amount of lipid conjugate will be 1.5 mol
%.+-.0.5 mol %, with the balance of the 1:57 formulation being made
up of non-cationic lipid (e.g., phospholipid, cholesterol, or a
mixture of the two). Similarly, in the 1:62 formulation, the amount
of cationic lipid will be 62 mol %.+-.5 mol %, and the amount of
lipid conjugate will be 1.5 mol %.+-.0.5 mol %, with the balance of
the 1:62 formulation being made up of the non-cationic lipid (e.g.,
cholesterol).
[0482] Cell Viability Assay:
[0483] Cell viability of in vitro cell cultures was assessed using
the commercial reagent CellTiter-Blue.RTM. (Promega Corp.; Madison,
Wis.), a resazurin dye that is reduced by metabolically active
cells to the fluorogenic product resorufin. Various cancer cell
lines were cultured in vitro using standard tissue culture
techniques. 48-72 hours after treatment with siRNA formulations
and/or chemotherapy drugs, the CellTiter-Blue.RTM. reagent was
added to the culture to quantify the metabolic activity of the
cells, which is a measure of cell viability.
[0484] Target mRNA Quantitation:
[0485] The QuantiGene.RTM. branched DNA assay (Panomics, Inc.;
Fremont, Calif.) was used to quantify the reduction of target mRNA
in cell cultures treated with SNALP. Cell lysates were prepared
according to the manufacturer's instructions and used directly for
PLK1 mRNA quantification. Relative PLK-1 mRNA levels are expressed
relative to the vehicle (PBS) treated control cells. Specific probe
sets used for detection of mRNA were designed to target human PLK-1
mRNA (Genbank Accession No. NM_005030). These probe sets are cross
reactive with mouse PLK-1.
[0486] Apoptosis/Caspase 3/7 Assay:
[0487] The level of Caspase 3 and 7 enzyme activity in siRNA
treated cells was assessed using the commercial reagent
Apo-ONE.RTM. (Promega Corp., Madison, Wis.). This assay is based on
the specific enzymatic cleavage of the Caspase 3/7 substrate
(Z-DEVD)2-Rhodamine 110 to a fluorogenic product and is used to
quantify the level of apoptosis in cultured cells. The relative
level of Caspase 3/7 activity was assessed in a number of cancer
cell lines at 24-48 hours after treatment with siRNA formulations
and/or chemotherapy drugs.
[0488] Cytokine Induction Assays:
[0489] Flt3-ligand derived murine dendritic cells (Flt3L DC) were
generated as described by Gilliet et al. (J. Exp. Med.,
195:953-958) using 100 ng/ml murine Flt3-ligand (PeproTech Inc.;
Rocky Hill, N.J.) supplemented media. Femurs and tibiae of female
Balb/C mice were isolated and rinsed in sterile PBS. The ends of
bones were cut and marrow harvested in complete media (RPMI 1640,
10% heat inactivated FBS, 1% penicillin/streptomycin, 2 mM
L-glutamine, 1 mM sodium pyruvate, 25 mM HEPES, 50 .mu.M
2-mercaptoethanol). Bone marrow cells were passed through a 70
.mu.m strainer, centrifuged at 1000 rpm for 7 minutes, and
resuspended in complete media supplemented with 100 ng/ml murine
Flt3L to 2.times.10.sup.6 cells/ml. 2 mls of cells were seeded in
6-well plates and 1 ml fresh complete media added every two or
three days. On day 9 of culture, non-adherent cells were washed in
complete media and plated into 96-well plates at concentrations
ranging from 0.5 to 2.5.times.10.sup.5 cells/well. 2'OMe-modified
and unmodified (0/0) PLK-1 SNALP were diluted in PBS and added to
Flt3L DC cultures at 5 .mu.g/ml siRNA. Cells were incubated for 24
hours at 37.degree. C. before supernatants were assayed for
cytokines by ELISA.
[0490] Cytokine ELISA:
[0491] Interferon-.alpha. and IL-6 in culture supernatants were
quantified using sandwich ELISA kits according to manufacturer's
instructions. These were mouse IFN-.alpha. (PBL Biomedical;
Piscataway, N.J.) and mouse IL-6 (eBioscience; San Diego,
Calif.).
Example 2
Selection of Candidate PLK-1 siRNA Molecules
[0492] Candidate PLK-1 siRNA sequences were identified by imputing
the human PLK-1 mRNA sequence (Genbank Accession No. NM_005030) or
the mouse PLK-1 mRNA sequence (Genbank Accession No. NM_011121)
into the Whitehead Institute for Biomedical Research siRNA design
algorithm (see, e.g., Elbashir et al., Genes Dev., 15:188-200
(2001); Schwarz et al., Cell, 115:199-208 (2003); and Khvorova et
al Cell, 115: 209-216 (2003); available at
http://jura.wi.mit.edu/bioc/siRNAext/home.php). siRNA fulfilling
the following criteria were selected: (1) NN(N19)NN target
sequences; (2) thermodynamically less stable 5' antisense end
(Difference <-2.0); (3) G/C content between 30-70%; and (4) no
four nucleotide stretches of the same base. Selected sequences were
verified and the positions within both human and mouse target
sequences were identified.
[0493] BLASTn searches against the human and mouse sequence
databases were then performed on all selected sequences. Sequences
were eliminated that cross-hybridized with >15 of its internal
nucleotides.
[0494] The candidate sequences are shown in Tables 1-2.
TABLE-US-00001 TABLE 1 siRNA sequences that target human PLK-1
expression. SEQ ID SEQ ID siRNA Sense Strand (5' .fwdarw. 3') NO:
Antisense Strand (5' .fwdarw. 3') NO: PLK1424 AGAUCACCCUCCUUAAAUA 1
UAUUUAAGGAGGGUGAUCU 2 PLK773 AGACCUACCUCCGGAUCAA 3
UUGAUCCGGAGGUAGGUCU 4 PLK126 GGUCCUAGUGGACCCACGC 5
GCGUGGGUCCACUAGGACC 6 PLK412 CUCCUGGAGCUGCACAAGA 7
UCUUGUGCAGCUCCAGGAG 8 PLK694 GUGGAUGUGUGGUCCAUUG 9
CAAUGGACCACACAUCCAC 10 PLK772 GAGACCUACCUCCGGAUCA 11
UGAUCCGGAGGUAGGUCUC 12 PLK832 GCCGCCUCCCUCAUCCAGA 13
UCUGGAUGAGGGAGGCGGC 14 PLK837 CUCCCUCAUCCAGAAGAUG 15
CAUCUUCUGGAUGAGGGAG 16 PLK1081 CCAGUGGUUCGAGAGACAG 17
CUGUCUCUCGAACCACUGG 18 PLK1195 GAGGCUGAGGAUCCUGCCU 19
AGGCAGGAUCCUCAGCCUC 20 PLK1229 GGGUCAGCAAGUGGGUGGA 21
UCCACCCACUUGCUGACCC 22 PLK1232 UCAGCAAGUGGGUGGACUA 23
UAGUCCACCCACUUGCUGA 24 PLK1233 CAGCAAGUGGGUGGACUAU 25
AUAGUCCACCCACUUGCUG 26 PLK1242 GGUGGACUAUUCGGACAAG 27
CUUGUCCGAAUAGUCCACC 28 PLK1345 GACAGCCUGCAGUACAUAG 29
CUAUGUACUGCAGGCUGUC 30 PLK1556 GCGCCAUCAUCCUGCACCU 31
AGGUGCAGGAUGAUGGCGC 32
[0495] The number after "PLK" in Table 1 refers to the nucleotide
position of the 5' base of the sense strand relative to the start
codon (ATG) of the human PLK-1 mRNA sequence NM_005030. In certain
embodiments, the sense and/or antisense strand comprises modified
nucleotides such as 2'-O-methyl (2'OMe) nucleotides,
2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy nucleotides,
2'-O-(2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid
(LNA) nucleotides. In some instances, the sense and/or antisense
strand contains "dTdT" or "UU" 3' overhangs. In other instances,
the sense and/or antisense strand contains 3' overhangs that have
complementarity to the target sequence or the complementary strand
thereof. As a non-limiting example, the PLK1424 sense strand (SEQ
ID NO:1) may contain a "UU" 3' overhang and the PLK1424 antisense
strand (SEQ ID NO:2) may contain a "UC" 3' overhang. As another
non-limiting example, the PLK773 sense strand (SEQ ID NO:3) may
contain a "GA" 3' overhang and the PLK773 antisense strand (SEQ ID
NO:4) may contain a "CU" 3' overhang. In further embodiments, the
3' overhang on the sense strand, antisense strand, or both strands
may comprise one, two, three, four, or more modified nucleotides
such as those described above.
TABLE-US-00002 TABLE 2 siRNA sequences that target mouse PLK-1
expression. SEQ ID SEQ ID siRNA Sense Strand (5' .fwdarw. 3') NO:
Antisense Strand (5' .fwdarw. 3') NO: mPLK1399 CCCAUCCCAAUUCCUUGAU
33 AUCAAGGAAUUGGGAUGGG 34 mPLK1424 AGAUCACUCUCCUCAACUA 35
UAGUUGAGGAGAGUGAUCU 36 mPLK1425 GAUCACUCUCCUCAACUAU 37
AUAGUUGAGGAGAGUGAUC 38 mPLK1428 CACUCUCCUCAACUAUUUC 39
GAAAUAGUUGAGGAGAGUG 40 mPLK1434 CCUCAACUAUUUCCGCAAU 41
AUUGCGGAAAUAGUUGAGG 42 mPLK1607 AGGACCACACCAAACUUAU 43
AUAAGUUUGGUGUGGUCCU 44 mPLK1608 GGACCACACCAAACUUAUC 45
GAUAAGUUUGGUGUGGUCC 46 mPLK1650 GACCUACAUCAACGAGAAG 47
CUUCUCGUUGAUGUAGGUC 48 mPLK1668 GAGGGACUUCCAAACGUAC 49
GUACGUUUGGAAGUCCCUC 50
[0496] The number after "mPLK" in Table 2 refers to the nucleotide
position of the 5' base of the sense strand relative to the start
codon (ATG) of the mouse PLK-1 mRNA sequence NM_011121. In certain
embodiments, the sense and/or antisense strand comprises modified
nucleotides such as 2'-O-methyl (2'OMe) nucleotides,
2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy nucleotides,
2'-O-(2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid
(LNA) nucleotides. In some instances, the sense and/or antisense
strand contains "dTdT" or "UU" 3' overhangs. In other instances,
the sense and/or antisense strand contains 3' overhangs that have
complementarity to the target sequence or the complementary strand
thereof. In further embodiments, the 3' overhangs may comprise
modified nucleotides such as those described above.
Example 3
siRNAs Targeting PLK-1 Inhibit the Growth of Cancer Cells
[0497] Various PLK-1 siRNAs were formulated as SNALP ("2:40" SNALP
formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and 48%
cholesterol) and evaluated for their inhibitory effects on cell
growth in vitro. HT29 (human colon adenocarcinoma) or Neuro2A
(mouse neuroblastoma) cells were treated with various PLK-1 SNALP
at a range of siRNA concentrations and their effect on cell
viability was evaluated. Viability of cell cultures is expressed as
% viability relative to PBS treated controls. FIG. 1A shows that
SNALP containing PLK1424 were highly potent at killing human tumor
cells. This siRNA sequence is specific to human PLK-1, as shown by
its inactivity in the mouse cell line (FIG. 1B). SNALP containing
either PLK1081 or PLK1345 also inhibited the growth of human tumor
cells, but at higher siRNA concentrations (FIG. 1A). PLK1345, which
was designed to be conserved between murine and human PLK-1, was
effective at inhibiting the growth of mouse Neuro2A cells at higher
siRNA concentrations (FIG. 1B). siRNA targeting Luciferase (Luc)
was used as a control SNALP.
Example 4
Dose-Dependent Silencing of PLK-1 mRNA in Cancer Cells by siRNAs
Targeting PLK-1
[0498] PLK-1 SNALP ("2:40" SNALP formulation: 2% PEG-cDMA; 40%
DLinDMA; 10% DSPC; and 48% cholesterol) were tested for their
ability to silence PLK-1 mRNA in HT29 cells. Cells were plated in
duplicates at relatively high concentrations (10,000 cells/well).
QuantiGene.RTM. analysis was performed at 24 hours following
transfection to detect the level of mRNA down-regulation. A visual
score of the transfected cells was obtained at 48 hours following
transfection. Cell viability analysis was performed at 72 hours
following transfection. FIG. 2A shows the relative silencing of
PLK-1 mRNA by PLK1424 and PLK1081 at 24 hours versus a
non-targeting (GFP) siRNA control. FIG. 2B shows the subsequent
effects of these siRNA on cell viability at 72 hours. The results
confirm that the potent effects of PLK-1 SNALP on cell viability is
due to the silencing of PLK-1 mRNA.
Example 5
Additional siRNAs Targeting PLK-1 Inhibit the Growth of Cancer
Cells
[0499] Additional PLK-1 siRNA molecules were formulated as SNALP
("2:40" SNALP formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and
48% cholesterol) and evaluated for their inhibitory effects on cell
growth in vitro. HT29 or Neuro2A cells were plated in triplicate at
5000 cells/well and 2500 cells/well, respectively. PLK-1 SNALP
dosages were as follows: 25 nM; 5 nM; and 1 nM. Cell viability
analysis was performed at 72 hours following transfection. SNALP
containing a non-targeting (GFP) siRNA were used as a negative
control. FIG. 3A shows that PLK694, PLK773, PLK832, PLK1195,
PLK1229, PLK1233, PLK1424, and PLK1556 were effective at killing
human tumor cells, with PLK1424 demonstrating the most potent
effects. FIG. 3B shows that mPLK1424 and mPLK1425 were the most
active mouse-specific siRNA sequences. PLK773 and PLK1229 were the
most potent human/mouse cross-reactive siRNA molecules.
Example 6
siRNAs Targeting PLK-1 Are Active in Different Colon Cancer Cell
Lines
[0500] SNALP containing PLK1424 or PLK773 siRNA ("2:40" SNALP
formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and 48%
cholesterol) were tested for their effects on cell viability and
silencing of PLK-1 mRNA in HT29 and LS174T human colon cancer
cells. Cells were plated in triplicate at .about.10,000 cells/well.
SNALP dosages were as follows: 30 nM; 10 nM; 3.3 nM; 1.1 nM; 0.37
nM; and 0.12 nM. Branched DNA mRNA assays were performed 24 hours
following transfection. Cell viability assays were performed at 72
hours following transfection. SNALP containing a non-targeting
(GFP) siRNA were used as a negative control. FIG. 4 shows that
PLK1424 and PLK773 SNALP were effective at reducing PLK-1 mRNA
levels and inhibiting cell growth in both HT29 and LS174T cells.
The effects on cell viability correlated with silencing of the
target PLK-1 mRNA.
Example 7
siRNAs Targeting PLK-1 Induce Apoptosis in Colon Cancer Cells
[0501] SNALP containing PLK1424 or PLK773 siRNA ("2:40" SNALP
formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and 48%
cholesterol) were further tested for their effects on inducing the
apoptosis of LS174T cells. Cells were plated in triplicate at
.about.10,000 cells/well. SNALP dosages were as follows: 30 nM; 10
nM; and 3.3 nM. Caspase 3/7 assays were performed at 24, 48, and 72
hours following transfection. SNALP containing a non-targeting
(GFP) siRNA were used as a negative control. FIG. 5 shows that
PLK1424 and PLK773 SNALP induced a significant amount of apoptosis
in LS174T cells at all SNALP doses tested.
Example 8
Additional siRNAs Targeting PLK-1 Inhibit the Growth of Cancer
Cells
[0502] Additional PLK-1 siRNA molecules were formulated as SNALP
("2:40" SNALP formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and
48% cholesterol) and evaluated for their inhibitory effects on cell
growth in vitro. HT29 or Neuro2A cells were plated in triplicate at
5000 cells/well and 2500 cells/well, respectively. PLK-1 SNALP
dosages were as follows: 30 nM; 10 nM; and 3.3 nM. Cell viability
analysis was performed at 72 hours following transfection. SNALP
containing a non-targeting (GFP) siRNA were used as a negative
control. FIG. 6A shows that PLK772, PLK1232, PLK1242, and PLK1424
were effective at killing human tumor cells, with PLK1424
demonstrating the most potent effects. FIG. 6B shows that mPLK1607,
mPLK1608, and mPLK1668 were the most active mouse-specific PLK-1
siRNA sequences. PLK1232 was the most potent human/mouse
cross-reactive siRNA molecule.
Example 9
Modified PLK-1 siRNAs are Non-Immunostimulatory and Inhibit the
Growth of Cancer Cells
[0503] PLK-1 siRNA molecules containing 2'-O-methyl (2'OMe)
nucleotides at selective positions within the double-stranded
region of the siRNA duplex were formulated as SNALP ("2:40" SNALP
formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and 48%
cholesterol) and evaluated for their inhibitory effects on cell
growth in vitro. The modified PLK-1 siRNA sequences are shown in
Table 3. HT29 cells were plated in triplicate at 5000 cells/well.
Cell viability analysis was performed at 72 hours following
transfection with a range of PLK-1 SNALP dosages. SNALP containing
a non-targeting (GFP) siRNA were used as a negative control.
TABLE-US-00003 TABLE 3 siRNA duplexes comprising sense and
antisense PLK-1 RNA polynucleotides. % Modified in siRNA PLK-1
siRNA Sequence DS Region PLK1424 5'-AGAUCACCCUCCUUAAAUANN-3' (SEQ
ID NO: 51) 0/38 = 0% 3'-NNUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 52)
PLK1424 U3/GU 5'-AGAUCACCCUCCUUAAAUANN-3' (SEQ ID NO: 53) 5/38 =
13.2% 3'-NNUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 54) PLK1424 U3/UG
5'-AGAUCACCCUCCUUAAAUANN-3' (SEQ ID NO: 53) 7/38 = 18.4%
3'-NNUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 55) PLK1424 U3/G
5'-AGAUCACCCUCCUUAAAUANN-3' (SEQ ID NO: 53) 6/38 = 15.8%
3'-NNUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 56) PLK1424 U4/GU
5'-AGAUCACCCUCCUUAAAUANN-3' (SEQ ID NO: 57) 6/38 = 15.8%
3'-NNUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 54) PLK1424 U4/UG
5'-AGAUCACCCUCCUUAAAUANN-3' (SEQ ID NO: 57) 8/38 = 21%
3'-NNUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 55) PLK1424 U4/G
5'-AGAUCACCCUCCUUAAAUANN-3' (SEQ ID NO: 57) 7/38 = 18.4%
3'-NNUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 56) PLK773
5'-AGACCUACCUCCGGAUCAANN-3' (SEQ ID NO: 58) 0/38 = 0%
3'-NNUCUGGAUGGAGGCCUAGUU-5' (SEQ ID NO: 59) PLK773 U/U
5'-AGACCUACCUCCGGAUCAANN-3' (SEQ ID NO: 60) 6/38 = 15.8%
3'-NNUCUGGAUGGAGGCCUAGUU-5' (SEQ ID NO: 61) PLK773 U/G
5'-AGACCUACCUCCGGAUCAANN-3' (SEQ ID NO: 60) 7/38 = 18.4%
3'-NNUCUGGAUGGAGGCCUAGUU-5' (SEQ ID N0: 62) PLK773 U/GU
5'-AGACCUACCUCCGGAUCAANN-3' (SEQ ID NO: 60) 6/38 = 15.8%
3'-NNUCUGGAUGGAGGCCUAGUU-5' (SEQ ID NO: 63) PLK773 G/U
5'-AGACCUACCUCCGGAUCAANN-3' (SEQ ID NO: 64) 5/38 = 13.2%
3'-NNUCUGGAUGGAGGCCUAGUU-5' (SEQ ID NO: 61) PLK773 G/G
5'-AGACCUACCUCCGGAUCAANN-3' (SEQ ID NO: 64) 6/38 = 15.8%
3'-NNUCUGGAUGGAGGCCUAGUU-5' (SEQ ID NO: 62) PLK773 G/GU
5'-AGACCUACCUCCGGAUCAANN-3' (SEQ ID NO: 64) 5/38 = 13.2%
3'-NNUCUGGAUGGAGGCCUAGUU-5' (SEQ ID NO: 63) PLK1425
5'-GAUCACCCUCCUUAAAUAUNN-3' (SEQ ID NO: 65) 0/38 = 0%
3'-NNCUAGUGGGAGGAAUUUAUA-5' (SEQ ID NO: 66) PLK1425 3/2
5'-GAUCACCCUCCUUAAAUAUNN-3' (SEQ ID NO: 67) 3/38 = 7.9%
3'-NNCUAGUGGGAGGAAUUUAUA-5' (SEQ ID NO: 66) PLK1425 3/5
5'-GAUCACCCUCCUUAAAUAUNN-3' (SEQ ID NO: 67) 5/38 = 13.2%
3'-NNCUAGUGGGAGGAAUUUAUA-5' (SEQ ID NO: 68) PLK1425 3/6
5'-GAUCACCCUCCUUAAAUAUNN-3' (SEQ ID NO: 67) 6/38 = 15.8%
3'-NNCUAGUGGGAGGAAUUUAUA-5' (SEQ ID NO: 69) PLK1425 3/7
5'-GAUCACCCUCCUUAAAUAUNN-3' (SEQ ID NO: 67) 7/38 = 18.4%
3'-NNCUAGUGGGAGGAAUUUAUA-5' (SEQ ID NO: 70) PLK1425 3/8
5'-GAUCACCCUCCUUAAAUAUNN-3' (SEQ ID N0: 67) 7/38 = 18.4%
3'-NNCUAGUGGGAGGAAUUUAUA-5' (SEQ ID NO: 71) PLK1425 4/2
5'-GAUCACCCUCCUUAAAUAUNN-3' (SEQ ID NO: 72) 4/38 = 10.5%
3'-NNCUAGUGGGAGGAAUUUAUA-5' (SEQ ID NO: 66) PLK1425 4/5
5'-GAUCACCCUCCUUAAAUAUNN-3' (SEQ ID NO: 72) 6/38 = 15.8%
3'-NNCUAGUGGGAGGAAUUUAUA-5' (SEQ ID NO: 68) PLK14254/6
5'-GAUCACCCUCCUUAAAUAUNN-3' (SEQ ID NO: 72) 7/38 = 18.4%
3'-NNCUAGUGGGAGGAAUUUAUA-5' (SEQ ID N0: 69) PLK1425 4/7
5'-GAUCACCCUCCUUAAAUAUNN-3' (SEQ ID NO: 72) 8/38 = 21%
3'-NNCUAGUGGGAGGAAUUUAUA-5' (SEQ ID NO: 70) PLK14254/8
5'-GAUCACCCUCCUUAAAUAUNN-3' (SEQ ID NO: 72) 8/38 = 21%
3'-NNCUAGUGGGAGGAAUUUAUA-5' (SEQ ID NO: 71) Column 1: The number
after ''PLK'' refers to the nucleotide position of the 5' base of
the sense strand relative to the start codon (ATG) of the human
PLK-1 mRNA sequence NM_005030. Column 2: 2'-O-methyl (2'OMe)
nucleotides are indicated in bold and underlined. The siRNA can
alternatively or additionally comprise 2'-deoxy-2'-fluoro (2'F)
nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE)
nucleotides, and/or locked nucleic acid (LNA) nucleotides. N =
deoxythymidine (dT) nucleotide, modified or unmodified uridine (U)
ribonucleotide, or modified or unmodified ribonucleotide having
complementarity to the target sequence or the complementary strand
thereof. Column 3: The number and percentage of modified
nucleotides in the double-stranded (DS) region of the siRNA duplex
are provided.
[0504] FIG. 7 shows that different chemical modification patterns
in the PLK1424 siRNA sequence were well tolerated and the modified
siRNA molecules retained potent activity. The most active modified
siRNA molecules, PLK1424 U4/GU and PLK1424 U3/GU, were as potent as
the unmodified PLK1424 sequence in killing human tumor cells.
PLK1424 U4/G and PLK1424 U3/G showed similar activity to that of
the unmodified PLK1424 sequence. SNALP containing 2'OMe-modified
PLK1424 siRNAs were also tested for immunostimulatory activity in
murine FLT3L DC cultures. FIG. 8 shows that modified PLK1424 siRNAs
induced no detectable cytokine (i.e., IL-6 or IFN-.alpha.) response
in this cell culture system.
[0505] FIG. 9 shows that different chemical modification patterns
in the PLK773 siRNA sequence were well tolerated and the modified
siRNA molecules retained potent activity. The most active modified
siRNA molecule, PLK773 G/GU, was more potent than the unmodified
PLK1424 sequence in killing human tumor cells. PLK773 G/U and
PLK773 U/GU showed similar activity to that of the unmodified
PLK773 sequence.
[0506] FIG. 10 shows that different chemical modification patterns
in the PLK1425 siRNA sequence were well tolerated and the modified
siRNA molecules retained potent activity. The most active modified
siRNA molecule, PLK1425 3/5, was more potent than the unmodified
PLK1425 sequence in killing human tumor cells. PLK1425 siRNAs
containing modified antisense strand 5, 7, or 8 retained RNAi
activity.
[0507] This example illustrates that minimal 2'OMe modifications at
selective positions in the PLK-1 siRNA duplex are sufficient to
decrease the immunostimulatory properties of PLK-1 siRNAs while
retaining RNAi activity. In particular, selective 2'OMe-uridine
and/or 2'OMe-guanosine modifications at less than about 25% of the
nucleotide positions in the double-stranded region provide PLK-1
siRNAs with a desirable combination of silencing and
non-immunostimulatory properties.
Example 10
PLK-1 SNALP Pretreatment Sensitizes Cancer Cells to the Effects of
Chemotherapy Drugs
[0508] SNALP containing PLK1424 U4/GU or PLK773 G/GU siRNA ("2:40"
SNALP formulation: 2% PEG-cDMA; 40% DLinDMA; 10% DSPC; and 48%
cholesterol) were evaluated to determine whether sequential dosing
of the SNALP before chemotherapy drug treatment produces
synergistic effects in vitro in human and mouse cell lines. HepG2
(human hepatocellular liver carcinoma) and Neuro2A cells were
plated in triplicate at 10,000 cells/well and 5000 cells/well,
respectively. SNALP containing the modified PLK-1 siRNA molecules
were added to the cells 24 hours after plating at a range of
dosages. Media was changed and chemotherapy drugs were added to the
cells 24 hours after SNALP treatment at a range of dosages. For
example, paclitaxel (taxol) doses ranged from between 0.31 nM-10 nM
for human cells and 6.25 nM-200 nM for mouse cells. Cell viability
analysis or an apoptosis assay was performed at 48 or 24 hours
following chemotherapy drug treatment, respectively. SNALP
containing a non-targeting (Luc) siRNA were used as a negative
control.
[0509] FIG. 11 shows that the sequential administration of PLK-1
SNALP followed by paclitaxel significantly enhanced the killing of
both Neuro2A and HepG2 cells. In particular, suboptimal doses of
PLK-1 SNALP and paclitaxel were more effective than either agent
alone. Similar synergistic effects were observed for sequential
combination therapy with PLK-1 SNALP followed by fluorouracil
(5-FU) or irinotecan at higher SNALP doses. FIG. 12 shows that the
sequential combination dosing of PLK-1 SNALP followed by paclitaxel
significantly enhanced the level of apoptosis induction at both
SNALP concentrations. The increased apoptosis correlated with the
enhanced effects of this drug combination on cell viability.
[0510] This example illustrates that pretreatment with SNALP
containing PLK-1 siRNA sensitizes cancer cells to the toxic effects
of chemotherapy drugs such as paclitaxel, 5-FU, and irinotecan.
This example further illustrates that the sequential administration
of PLK-1 SNALP followed by chemotherapy drugs induces significant
levels of apoptosis in cancer cells, correlating with the decreases
in cell viability observed with this combination of dosing.
Example 11
Selection of Additional Candidate Human PLK-1 siRNA Molecules
[0511] Additional human PLK-1 siRNA sequences were designed.
Candidate PLK-1 siRNA sequences were identified by imputing the
human PLK-1 mRNA sequence (Genbank Accession No. NM_005030) into
the Whitehead Institute for Biomedical Research siRNA design
algorithm (see, e.g., Elbashir et al., Genes Dev., 15:188-200
(2001); Schwarz et al., Cell, 115:199-208 (2003); and Khvorova et
al Cell, 115:209-216 (2003); available at
http://jura.wi.mit.edu/bioc/siRNAext/home.php). siRNA fulfilling
the following criteria were selected (Table 4): (1) NA(N19)NN
target sequences; (2) thermodynamically less stable 5' antisense
end (Difference <-2.0); (3) G/C content between 30-70%; and (4)
no four nucleotide stretches of the same base. A second set of
siRNA (Table 5) were selected on the following criteria: (1)
NN(N19)NN target sequences; (2) thermodynamically less stable 5'
antisense end (Difference <-2.0); (3) Thermodynamics of 5'
antisense end >-6 (-6 to 0); (4) G/C content between 30-70%; and
(5) no four nucleotide stretches of the same base. Selected
sequences were verified and the positions within the human PLK-1
target sequence were identified.
[0512] BLASTn searches against the human and mouse sequence
databases were then performed on all selected sequences. Sequences
were eliminated that cross-hybridized with >17 of its internal
nucleotides.
[0513] The candidate sequences are shown in Tables 4-5.
TABLE-US-00004 TABLE 4 Additional siRNA sequences that target human
PLK-1 expression. Sense SEQ ID Antisense SEQ ID siRNA Strand (5'
.fwdarw. 3') NO: Strand (5' .fwdarw. 3') NO: PLK(-23)
GGUCUGCAGCGCAGCUUCG 73 CGAAGCUGCGCUGCAGACC 74 PLK(-15)
GCGCAGCUUCGGGAGCAUG 75 CAUGCUCCCGAAGCUGCGC 76 PLK272
AGCCGCACCAGAGGGAGAA 77 UUCUCCCUCUGGUGCGGCU 78 PLK273
GCCGCACCAGAGGGAGAAG 79 CUUCUCCCUCUGGUGCGGC 80 PLK288
GAAGAUGUCCAUGGAAAUA 81 UAUUUCCAUGGACAUCUUC 82 PLK363
GGACAACGACUUCGUGUUC 83 GAACACGAAGUCGUUGUCC 84 PLK420
GCUGCACAAGAGGAGGAAA 85 UUUCCUCCUCUUGUGCAGC 86 PLK429
GAGGAGGAAAGCCCUGACU 87 AGUCAGGGCUUUCCUCCUC 88 PLK431
GGAGGAAAGCCCUGACUGA 89 UCAGUCAGGGCUUUCCUCC 90 PLK438
AGCCCUGACUGAGCCUGAG 91 CUCAGGCUCAGUCAGGGCU 92 PLK439
GCCCUGACUGAGCCUGAGG 93 CCUCAGGCUCAGUCAGGGC 94 PLK450
GCCUGAGGCCCGAUACUAC 95 GUAGUAUCGGGCCUCAGGC 96 PLK456
GGCCCGAUACUACCUACGG 97 CCGUAGGUAGUAUCGGGCC 98 PLK498
CCUGCACCGAAACCGAGUU 99 AACUCGGUUUCGGUGCAGG 100 PLK504
CCGAAACCGAGUUAUUCAU 101 AUGAAUAACUCGGUUUCGG 102 PLK589
CUGGCAACCAAAGUCGAAU 103 AUUCGACUUUGGUUGCCAG 104 PLK618
GAGGAAGAAGACCCUGUGU 105 ACACAGGGUCUUCUUCCUC 106 PLK627
GACCCUGUGUGGGACUCCU 107 AGGAGUCCCACACAGGGUC 108 PLK629
CCCUGUGUGGGACUCCUAA 109 UUAGGAGUCCCACACAGGG 110 PLK663
GGUGCUGAGCAAGAAAGGG 111 CCCUUUCUUGCUCAGCACC 112 PLK693
GGUGGAUGUGUGGUCCAUU 113 AAUGGACCACACAUCCACC 114 PLK710
UUGGGUGUAUCAUGUAUAC 115 GUAUACAUGAUACACCCAA 116 PLK736
GUGGGCAAACCACCUUUUG 117 CAAAAGGUGGUUUGCCCAC 118 PLK744
ACCACCUUUUGAGACUUCU 119 AGAAGUCUCAAAAGGUGGU 120 PLK745
CCACCUUUUGAGACUUCUU 121 AAGAAGUCUCAAAAGGUGG 122 PLK774
GACCUACCUCCGGAUCAAG 123 CUUGAUCCGGAGGUAGGUC 124 PLK776
CCUACCUCCGGAUCAAGAA 125 UUCUUGAUCCGGAGGUAGG 126 PLK780
CCUCCGGAUCAAGAAGAAU 127 AUUCUUCUUGAUCCGGAGG 128 PLK884
CCAUUAACGAGCUGCUUAA 129 UUAAGCAGCUCGUUAAUGG 130 PLK894
GCUGCUUAAUGACGAGUUC 131 GAACUCGUCAUUAAGCAGC 132 PLK903
UGACGAGUUCUUUACUUCU 133 AGAAGUAAAGAACUCGUCA 134 PLK1024
GUCCUCAAUAAAGGCUUGG 135 CCAAGCCUUUAUUGAGGAC 136 PLK1137
GCAGCUGCACAGUGUCAAU 137 AUUGACACUGUGCAGCUGC 138 PLK1235
GCAAGUGGGUGGACUAUUC 139 GAAUAGUCCACCCACUUGC 140 PLK1319
CACGCCUCAUCCUCUACAA 141 UUGUAGAGGAUGAGGCGUG 142 PLK1321
CGCCUCAUCCUCUACAAUG 143 CAUUGUAGAGGAUGAGGCG 144 PLK1347
CAGCCUGCAGUACAUAGAG 145 CUCUAUGUACUGCAGGCUG 146 PLKI363
GAGCGUGACGGCACUGAGU 147 ACUCAGUGCCGUCACGCUC 148 PLK1404
UCCCAACUCCUUGAUGAAG 149 CUUCAUCAAGGAGUUGGGA 150 PLK1409
ACUCCUUGAUGAAGAAGAU 151 AUCUUCUUCAUCAAGGAGU 152 PLK1422
GAAGAUCACCCUCCUUAAA 153 UUUAAGGAGGGUGAUCUUC 154 PLK1430
CCCUCCUUAAAUAUUUCCG 155 CGGAAAUAUUUAAGGAGGG 156 PLK1457
UGAGCGAGCACUUGCUGAA 157 UUCAGCAAGUGCUCGCUCA 158 PLK1550
CCCGCAGCGCCAUCAUCCU 159 AGGAUGAUGGCGCUGCGGG 160 PLK1577
GCAACGGCAGCGUGCAGAU 161 AUCUGCACGCUGCCGUUGC 162 PLK1580
ACGGCAGCGUGCAGAUCAA 163 UUGAUCUGCACGCUGCCGU 164 PLK1581
CGGCAGCGUGCAGAUCAAC 165 GUUGAUCUGCACGCUGCCG 166 PLK1586
GCGUGCAGAUCAACUUCUU 167 AAGAAGUUGAUCUGCACGC 168 PLK1620
GCUCAUCUUGUGCCCACUG 169 CAGUGGGCACAAGAUGAGC 170 PLK1640
UGGCAGCCGUGACCUACAU 171 AUGUAGGUCACGGCUGCCA 172 PLK1645
GCCGUGACCUACAUCGACG 173 CGUCGAUGUAGGUCACGGC 174 PLK1658
UCGACGAGAAGCGGGACUU 175 AAGUCCCGCUUCUCGUCGA 176 PLK1667
AGCGGGACUUCCGCACAUA 177 UAUGUGCGGAAGUCCCGCU 178 PLK1668
GCGGGACUUCCGCACAUAC 179 GUAUGUGCGGAAGUCCCGC 180 PLK1704
GGAGUACGGCUGCUGCAAG 181 CUUGCAGCAGCCGUACUCC 182 PLK1775
GCUCACGCUCGGCCAGCAA 183 UUGCUGGCCGAGCGUGAGC 184 PLK1794
CCGUCUCAAGGCCUCCUAA 185 UUAGGAGGCCUUGAGACGG 186
[0514] The number after "PLK" in Table 4 refers to the nucleotide
position of the 5' base of the sense strand relative to the start
codon (ATG) of the human PLK-1 mRNA sequence NM_005030. In certain
embodiments, the sense and/or antisense strand comprises modified
nucleotides such as 2'-O-methyl (2'OMe) nucleotides,
2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy nucleotides,
2'-O-(2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid
(LNA) nucleotides. In some instances, the sense and/or antisense
strand contains "dTdT" or "UU" 3' overhangs. In other instances,
the sense and/or antisense strand contains 3' overhangs that have
complementarity to the target sequence or the complementary strand
thereof. In further embodiments, the 3' overhangs may comprise
modified nucleotides such as those described above.
TABLE-US-00005 TABLE 5 Additional siRNA sequences that target human
PLK-1 expression. Sense SEQ ID Antisense SEQ ID siRNA Strand (5'
.fwdarw. 3') NO: Strand (5' .fwdarw. 3') NO: PLK287
AGAAGAUGUCCAUGGAAAU 187 AUUUCCAUGGACAUCUUCU 188 PLK461
GAUACUACCUACGGCAAAU 189 AUUUGCCGUAGGUAGUAUC 190 PLK500
UGCACCGAAACCGAGUUAU 191 AUAACUCGGUUUCGGUGCA 192 PLK591
GGCAACCAAAGUCGAAUAU 193 AUAUUCGACUUUGGUUGCC 194 PLK630
CCUGUGUGGGACUCCUAAU 195 AUUAGGAGUCCCACACAGG 196 PLK632
UGUGUGGGACUCCUAAUUA 197 UAAUUAGGAGUCCCACACA 198 PLK1016
CCCUCACAGUCCUCAAUAA 199 UUAUUGAGGACUGUGAGGG 200 PLK1017
CCUCACAGUCCUCAAUAAA 201 UUUAUUGAGGACUGUGAGG 202 PLK1018
CUCACAGUCCUCAAUAAAG 203 CUUUAUUGAGGACUGUGAG 204 PLK1795
CGUCUCAAGGCCUCCUAAU 205 AUUAGGAGGCCUUGAGACG 206 PLK1796
GUCUCAAGGCCUCCUAAUA 207 UAUUAGGAGGCCUUGAGAC 208 PLK1797
UCUCAAGGCCUCCUAAUAG 209 CUAUUAGGAGGCCUUGAGA 210
[0515] The number after "PLK" in Table 5 refers to the nucleotide
position of the 5' base of the sense strand relative to the start
codon (ATG) of the human PLK-1 mRNA sequence NM_005030. In certain
embodiments, the sense and/or antisense strand comprises modified
nucleotides such as 2'-O-methyl (2'OMe) nucleotides,
2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy nucleotides,
2'-O-(2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid
(LNA) nucleotides. In some instances, the sense and/or antisense
strand contains "dTdT" or "UU" 3' overhangs. In other instances,
the sense and/or antisense strand contains 3' overhangs that have
complementarity to the target sequence or the complementary strand
thereof. In further embodiments, the 3' overhangs may comprise
modified nucleotides such as those described above.
Example 12
siRNAs Targeting PLK-1 Increase Survival of Hep3B Tumor-Bearing
Mice
[0516] SNALP containing PLK-1 siRNA ("1:57" SNALP formulation: 1.4%
PEG-cDMA; 57.1% DLinDMA; 7.1% DPPC; and 34.3% cholesterol) were
tested for their effects on the survival of CD1 nu/nu mice bearing
Hep3B liver tumors.
Experimental Groups
[0517] 20 CD1 nu/nu mice were seeded as follows:
TABLE-US-00006 # Tumor # SNALP SNALP Group Mice seeding SNALP Mice
dosing IV dose Sacrifice Assay A 20 to I.H. Luc 1:57 9 Days 11, 14,
10 .times. 2 When Survival B seed 1.5 .times. 10.sup.6 PLK 1424 9
17, 21, 25, 28, mg/kg moribund Body Weights Hep3B 1:57 32, 35, 39,
42
Test Articles
[0518] All samples were filter-sterilized prior to dilution to
working concentration. All tubes were labeled with the formulation
date, lipid composition, and nucleic acid concentration. SNALP
samples were provided at 0.2 mg/ml nucleic acid. A minimum of 20 ml
of each SNALP was required to perform the study. Formulations for
this study contained:
TABLE-US-00007 Group Test Article Description A Luc U/U SNALP 1:57
(28 mM lipid) B PLK1424 U4/GU SNALP 1:57 (28 mM lipid) PLK1424 U4/G
SNALP 1:57 (28 mM lipid)
Procedures
[0519] Day 0 Mice will receive Anafen by SC injection (100 .mu.g in
20 .mu.l saline) immediately prior to surgery. Individual mice are
anesthetized by isoflourane gas inhalation and eye lube applied to
prevent excessive eye drying. While maintained under gas anesthesia
from a nose cone, a single 1.5 cm incision across the midline will
be made below the sternum. The left lateral hepatic lobe is then
exteriorized using an autoclaved cotton wool bud. 25 .mu.l of tumor
cells suspended in PBS is injected into the lobe at a shallow angle
using a leur tip Hamilton syringe (50 .mu.l) and 30 G (3/8'')
needle. Cells will be injected slowly (.about.30 s) and a swab
applied to the puncture wound immediately after needle withdrawal.
After any bleeding has stopped (.about.1 min), the incision is
closed with 5-6 sutures in the muscle wall and 3-4 skin clips. Cell
suspensions will be thoroughly mixed immediately prior to each
injection. Mice will recover from anesthesia in a clean cage lined
with paper towel and monitored closely for 2-4 hours. Animals are
then returned to normal housing. [0520] Day 1 All mice will be
lightly anesthetized by isoflourane gas and the sutures examined.
Animals will then receive Anafen by SC injection (100 .mu.g in 20
.mu.l saline). [0521] Day 10 Mice will be randomized into the
appropriate treatment groups. [0522] Day 11 Groups A, B--Day 11:
All Animals will be administered SNALP at 2 mg/kg by IV injection
via the lateral tail vein. Mice will be dosed according to body
weight (10 ml/kg). Dosing will be repeated for 5 consecutive days
based on initial weight. [0523] Day 14-35 Groups A, B--Days 14, 17,
21, 25, 28, 32, 35: All Animals will be re-administered SNALP at 2
mg/kg by IV injection via the lateral tail vein. Mice will be dosed
according to body weight (10 ml/kg). [0524] Body weights Groups:
Mice will be weighed on the day of dosing for 5 weeks, then twice
weekly until close of the study. [0525] Endpoint: Tumor burden and
formulations are expected to be well tolerated. Mice that exhibit
signs of distress associated with the treatment or tumor burden are
terminated at the discretion of the vivarium staff. [0526]
Termination: Mice are anesthetized with a lethal dose of
ketamine/xylazine followed by cervical dislocation. [0527] Data
Analysis: Survival and body weights are assayed.
Results
[0528] FIG. 13 shows the mean body weights of mice during
therapeutic dosing of PLK1424 SNALP in the Hep3B intrahepatic
(I.H.) tumor model. The treatment regimen was well tolerated with
no apparent signs of treatment-related toxicity.
[0529] FIG. 14 shows that treatment with SNALP-formulated PLK1424
caused a significant increase in the survival of Hep3B
tumor-bearing mice. This in vivo anti-tumor effect was observed in
the absence of any apparent toxicity or immune stimulation.
Example 13
siRNAs Targeting PLK-1 Increase Survival of Hep3B Tumor-Bearing
Mice
[0530] The objectives of this study were as follows: [0531] 1. To
determine the level of mRNA silencing in established Hep3B liver
tumors following a single IV administration of PLK1424 SNALP.
[0532] 2. To confirm the mechanism of mRNA silencing by detecting
specific RNA cleavage products using RACE-PCR. [0533] 3. To confirm
induction of tumor cell apoptosis by histopathology.
[0534] The "1:57" SNALP formulation (1.4% PEG-cDMA; 57.1% DLinDMA;
7.1% DPPC; and 34.3% cholesterol) was used for this study.
Experimental Groups
[0535] 20 SCID/beige mice were seeded as follows:
TABLE-US-00008 # Tumor # SNALP Group Mice seeding SNALP Mice dosing
IV Sacrifice Assay A 20 to I.H. PBS 6 1 .times. 2 mg/kg 24 h after
Tumor QG B seed 1 .times. 10.sup.6 Luc 1:57 7 Day 20 treatment
Tumor RACE-PCR C Hep3B PLK 1424 7 Histopathology 1:57
Test Articles
[0536] All samples were filter-sterilized prior to dilution to
working concentration. All tubes were labeled with the formulation
date, lipid composition, and nucleic acid concentration. SNALP
samples were provided at 0.2 mg/ml nucleic acid. A minimum of 2 ml
of SNALP was required to perform the study. Formulations for this
study contained:
TABLE-US-00009 Group Test Article Description A PBS B Luc U/U 1:57
SNALP C PLK1424 U4/GU 1:57 SNALP
Procedures
[0537] Day 0 Mice will receive Anafen by SC injection (100 .mu.g in
20 .mu.l saline) immediately prior to surgery. Individual mice are
anesthetized by isoflourane gas inhalation and eye lube applied to
prevent excessive eye drying. While maintained under gas anesthesia
from a nose cone, a single 1.5 cm incision across the midline will
be made below the sternum. The left lateral hepatic lobe is then
exteriorized using an autoclaved cotton wool bud. 25 .mu.l of tumor
cells suspended in PBS is injected into the lobe at a shallow angle
using a leur tip Hamilton syringe (50 .mu.l) and 30 G (3/8'')
needle. Cells will be injected slowly (.about.30 s) and a swab
applied to the puncture wound immediately after needle withdrawal.
After any bleeding has stopped (.about.1 min), the muscle wall
incision is closed with 5-6 sutures. The skin incision is then
closed with 3-4 metal skin clips. Cell suspensions will be
thoroughly mixed immediately prior to each injection. Mice will
recover from anesthesia in a clean cage lined with paper towel and
monitored closely for 2-4 hours. Animals are then returned to
normal housing. [0538] Day 1 All mice will be lightly anesthetized
by isoflourane gas and the sutures examined. Animals will then
receive Anafen by SC injection (100 .mu.g in 20 .mu.l saline).
[0539] Day 7 Mice will be randomized into the appropriate treatment
groups. [0540] Day 20 Groups A-C: Mice will be weighed and then
administered either PBS, Luc, or PLK1424 SNALP by IV injection via
the lateral tail vein. SNALP will be dosed at 2 mg/kg or equivalent
volume (10 ml/kg) according to body weight. [0541] Day 21 Groups
A-C: All mice will be weighed and then euthanized by lethal
anesthesia. [0542] Tumor bearing liver lobes from all mice in each
group will be weighed and collected into RNALater for RNA analysis.
[0543] Endpoint: Tumor burden and formulations are expected to be
well tolerated. Mice that exhibit signs of distress associated with
the treatment or tumor burden are terminated at the discretion of
the vivarium staff. [0544] Termination: Mice are anaesthetized with
a lethal dose of ketamine/xylazine followed by cervical
dislocation. [0545] Data Analysis: mRNA analysis of liver tumors by
bDNA (QG) assay and RACE-PCR. [0546] Tumor cell apoptosis by
histopathology.
Results
[0547] Body weights were monitored from day 14 onwards to assess
tumor progression. On Day 20, 6 mice showing greatest weight loss
were randomized into each of the 3 groups and treated. All six mice
had substantial-large I.H. tumors at sacrifice (Day 21). Treatment
of the remaining 14 mice was therefore initiated on the Day 21
(sacrifice Day 22). 10/14 mice had substantial tumors; 2/14 mice
had small/probable tumors; and 2/14 mice had no visible tumor
burden.
[0548] FIG. 15 shows data from Quantigene assays used to measure
human (tumor)-specific PLK-1 mRNA levels. A single 2 mg/kg dose of
PLK1424 U4/GU SNALP reduced PLK-1 mRNA levels by about 50% in
intrahepatic Hep3B tumors growing in mice.
[0549] FIG. 16 shows that a specific cleavage product of PLK-1 mRNA
was detectable in mice treated with PLK1424 SNALP by 5' RACE-PCR.
No specific PCR product was detectable in mice treated with either
PBS or control (Luc) SNALP. Nucleotide sequencing of the PCR
product confirmed the predicted cleavage site by PLK1424
siRNA-mediated RNA interference in the PLK-1 mRNA.
[0550] FIG. 17 shows Hep3B tumor histology in mice treated with
either Luc SNALP (top) or PLK1424 SNALP (bottom). Luc SNALP-treated
mice displayed normal mitoses in Hep3B tumors, whereas PLK1424
SNALP-treated mice exhibited numerous aberrant mitoses and tumor
cell apoptosis in Hep3B tumors.
Conclusion
[0551] This example illustrates that a single administration of
PLK1424 SNALP to Hep3B tumor-bearing mice induced significant in
vivo silencing of PLK-1 mRNA. This reduction in PLK-1 mRNA was
confirmed to be mediated by RNA interference using 5' RACE-PCR
analysis. Importantly, PLK-1 mRNA silencing by SNALP-formulated
PLK1424 profoundly disrupted tumor cell proliferation (mitosis),
causing subsequent apoptosis of tumor cells. As demonstrated in the
previous example, this anti-tumor effect translated into extended
survival times in the tumor-bearing mice.
Example 14
Comparison of PLK-1 SNALP Containing Either PEG-cDMA or PEG-cDSA in
a Subcutaneous Hep3B Tumor Model
[0552] This example demonstrates the utility of the PEG-lipid
PEG-cDSA (3-N-[(-Methoxypoly(ethylene
glycol)2000)carbamoyl]-1,2-distearyloxypropylamine) in the 1:57
formulation for systemically targeting distal (e.g., subcutaneous)
tumors. In particular, this example compares the tumor targeting
ability of PLK-1 SNALPs containing either PEG-cDMA (C.sub.14) or
PEG-cDSA (C.sub.18). Readouts are tumor growth inhibition and PLK1
mRNA silencing. The PLK-1 siRNA used was PLK1424 U4/GU, the
sequence of which is provided in Table 3.
[0553] Subcutaneous (S.C.) Hep3B tumors were established in
scid/beige mice. Multi-dose anti-tumor efficacy of PLK-1 SNALP was
evaluated for the following groups (n=5 for each group): (1)
"Luc-cDMA"--PEG-cDMA Luc SNALP; (2) "PLK-cDMA"--PEG-cDMA PLK-1
SNALP; and (3) "PLK-cDSA"--PEG-cDSA PLK-1 SNALP. Administration of
6.times.2 mg/kg siRNA was initiated once tumors reached about 5 mm
in diameter (Day 10). Dosing was performed on Days 10, 12, 14, 17,
19, and 21. Tumors were measured by caliper twice weekly.
[0554] FIG. 18 shows that multiple doses of PLK-1 SNALP containing
PEG-cDSA induced the regression of established Hep3B S.C. tumors.
In particular, 5/5 tumors in the PLK1-cDSA treated mice appeared
flat, measurable only by discoloration at the tumor site.
[0555] FIG. 19 shows the mRNA silencing of PLK SNALP in S.C. Hep3B
tumors following a single intravenous SNALP administration. The
extent of silencing observed with the PLK1-cDSA SNALP correlated
with the anti-tumor activity in the multi-dose study shown in FIG.
18.
[0556] The Luc-cDMA SNALP-treated group, which had developed large
S.C. tumors at Day 24, were then administered PLK-cDSA SNALP on
Days 24, 26, 28, 31, 33, and 35. There was no additional dosing of
the original PLK-1 SNALP-treated groups. The results from this
crossover doing study with large established tumors is provided in
FIG. 20, which shows that PLK1-cDSA SNALP inhibited the growth of
large S.C. Hep3B tumors.
[0557] A comparison of the effect of PEG-cDMA and PEG-cDSA 1:57
SNALPs on PLK-1 mRNA silencing was performed using established
intrahepatic Hep3B tumors in scid/beige mice. A single 2 mg/kg dose
of PLK-1 SNALP containing either PEG-cDMA or PEG-cDSA was
administered intravenously. Liver/tumor samples were collected at
24 and 96 hours after SNALP treatment. Control=2 mg/kg Luc-cDMA
SNALP at 24 hours.
[0558] FIG. 21 shows that PLK-cDMA SNALP and PLK-cDSA SNALP had
similar silencing activities after 24 hours, but that the PLK-cDSA
SNALP may increase the duration of mRNA silencing in intrahepatic
tumors.
[0559] FIG. 22 shows the blood clearance profile of PLK-1 SNALP
containing either PEG-cDMA or PEG-cDSA. The extended blood
circulation times observed for the PLK-cDSA SNALP may enable the
increased accumulation and activity at distal (e.g., subcutaneous)
tumor sites.
[0560] Thus, this study shows that the PEG-cDSA SNALP formulation
can be used to preferentially target tumors outside of the liver,
whereas the PEG-cDMA SNALP can be used to preferentially target the
liver.
Example 15
Confirming the RNAi-Mediated Mechanism of Action of siRNA-Based
Cancer Therapeutics
[0561] Short interfering RNAs (siRNA) that specifically silence the
expression of cancer-related genes offer a novel therapeutic
approach in oncology. However, it remains critical to delineate the
true mechanism underlying their therapeutic activity. This example
describes the development of chemically-modified siRNA targeting
the essential cell cycle proteins Polo-like kinase1 (PLK-1) and
kinesin spindle protein (KSP; also known as Eg5). siRNA formulated
in lipid nanoparticles (SNALP) displayed potent anti-tumor efficacy
in both hepatic and subcutaneous tumor models, exhibiting a degree
of target gene silencing following a single intravenous
administration that was sufficient to cause extensive mitotic
disruption and tumor cell apoptosis. Specificity and siRNA
mechanism of action was confirmed by: (1) the use of appropriately
designed siRNA formulations that induced no measurable immune
response, therefore excluding the potential for non-specific
efficacy; (2) induction of RNAi-specific mRNA cleavage products in
tumor cells; (3) correlation of this active RNAi signature with the
duration of target mRNA silencing; and (4) confirmation of
functional target inhibition by histologic biomarkers. This example
provides results which represent a significant advance in the
development of siRNA-based cancer therapeutics, and serves to
highlight the technical requirements needed to support a conclusion
that RNAi is the primary mechanism of siRNA-mediated therapeutic
effects.
Introduction
[0562] Short interfering RNA (siRNA) are target-specific
double-stranded RNA molecules designed to suppress gene expression
through the endogenous cellular process of RNA interference (RNAi)
(1). Since the characterization of this fundamental gene silencing
mechanism, tremendous progress has been made in developing siRNA as
a potentially novel class of therapeutic agent for a broad spectrum
of diseases including cancer, viral infection, and metabolic
disorders.
[0563] Many siRNA targets in oncology have been described in the
literature, although direct evidence that their therapeutic effects
in tumor models are mediated by RNAi is notably lacking. The
interpretation of anti-tumor activity attributable to siRNA is
problematic due to the potential for off-target effects of the
nucleic acids, including their propensity to activate immune
responses through TLR-dependent (2-4) and independent mechanisms
(5, 6). These types of response are known to elicit anti-tumor
effects, primarily through the actions of interferons and
inflammatory cytokines that exert anti-angiogenic, pro-apoptotic,
and adjuvant effects that enhance cellular immunity (7, 8). Many of
these mechanisms remain active in the immunodeficient mouse strains
typically used as hosts for human tumor xenografts, including
SCID/beige mice that lack functional lymphocyte and NK cell
populations (9, 10). Induction of the innate immune response by
nucleic acids can also have significant toxicologic consequences
(11). Clinical experience with certain recombinant cytokines and
TLR agonists (12, 13) including liposomal plasmid DNA has shown
that human subjects can be exquisitely sensitive to the toxic
effects of these agents when compared to preclinical models.
Therefore, additional caution is required if considering an immune
stimulatory siRNA for clinical development (14, 15).
[0564] The incorporation of modified nucleotide chemistries into
siRNA has been widely utilized to improve their pharmacologic and
nuclease resistant properties (16). We first reported that
extensive chemical modification to siRNA molecules could provide
the additional benefit of preventing their recognition by the
mammalian immune system (17). This has led to the rational design
of 2'-O-methyl (2'OMe) modified siRNA constructs that have
inherently low immunostimulatory potential in vivo (18).
[0565] To establish proof that systemically administered siRNA can
elicit RNAi-mediated anti-cancer efficacy in the absence of
measurable immune activation, we have selected the essential cell
cycle proteins kinesin spindle protein (KSP, Eg5) (19) and
Polo-like kinase 1 (PLK-1) (20) as validated cancer targets with
well characterized mechanisms of direct tumor cell killing. KSP is
a mitotic spindle motor protein that drives chromosome segregation
during mitosis. Inhibition of KSP blocks the formation of bipolar
mitotic spindles, causing cell cycle arrest, activation of the
mitotic checkpoint and induction of apoptosis (21). In mammalian
cells, PLK-1 acts to phosphorylate a number of cell cycle proteins,
including Cdc25C, cyclin B, cohesin subunit SCC-1, subunits of the
anaphase promoting complex, mammalian kinesin-like protein 1, and
other kinesin-related proteins. This diverse array of substrates
reflects the multiple roles of PLK-1 in mitosis and cytokinesis
(22). Over-expression of PLK-1, observed in many human tumor types,
is a negative prognosticator of patient outcome (20), while
inhibition of PLK-1 activity rapidly induces mitotic arrest and
tumor cell apoptosis (23, 24). Depletion of PLK-1 may also
sensitize cancer cells to the pro-apoptotic activity of small
molecule drugs (25), likely due to the role of PLK-1 in the DNA
damage and spindle assembly checkpoints.
[0566] One of the primary barriers to realizing the potential of
siRNA therapeutics is the requirement for drug delivery vehicles to
facilitate disease site targeting, cellular uptake, and cytoplasmic
delivery of the siRNA (26-28). Common approaches to delivery
include complexing the siRNA with polycations such as
polyethyleneimine (29, 30) and cyclodextrin polymers (31) or
incorporation into cationic lipid-based carriers (17, 18, 26, 32).
We have previously described the development of stable nucleic
acid-lipid particles (SNALP) as an effective systemic delivery
vehicle for targeting siRNA to the murine and non-human primate
liver and have demonstrated therapeutic effects in silencing
endogenous hepatocyte (18, 26) and viral gene transcripts (17). The
accumulation of SNALP within tissues of clinical interest takes
advantage of passive disease site targeting (33, 34), whereby
charge neutral carriers of suitable size (around 100 nm diameter or
smaller) can pass through the fenestrated epithelium of tumors,
sites of inflammation, and the healthy liver. This avoids the
requirement for active targeting moieties such as peptides,
antibodies, and receptor ligands that may otherwise be candidates
for incorporation into siRNA delivery vehicles to enhance target
cell selectivity (31, 35, 36).
[0567] This example describes the development of SNALP formulated
siRNA as novel cancer therapeutics. Results demonstrate that
rationally designed siRNA targeting PLK-1 or KSP, when delivered
with an effective systemic delivery vehicle, are able to affect
therapeutic gene silencing in solid tumors. The specificity and
mechanism of action is confirmed using a combination of
methodologies that demonstrate RNAi-mediated silencing of target
mRNA causing mitotic disruption in tumor cells typical of target
inhibition. This can be achieved in the complete absence of immune
stimulation through the use of appropriately designed, chemically
modified siRNA.
Results
[0568] In Vitro Characterization of PLK-1 siRNA Activity
[0569] PLK-1 represents a validated gene target in oncology whose
inhibition is known to cause mitotic arrest and apoptosis in
proliferating tumor cell cultures (20). We designed and screened a
panel of novel PLK-1 siRNA for anti-proliferative activity in the
human HT29 colon cancer cell line (FIG. 23). This screen identified
PLK1424 as the most potent human siRNA and PLK773 as the most
potent mouse, rat, and human cross-reactive siRNA based on PLK-1
sequence homology. These lead siRNA were formulated into a SNALP
composition that has been shown to effectively target siRNA to the
liver of rodents and non-human primates (26). Treatment of HT29
cells with formulated PLK1424 and PLK773 siRNA caused a
dose-dependent decrease in cell viability that correlated with the
degree of PLK-1 mRNA silencing (FIG. 24A-C). PLK1424 siRNA
displayed potent activity in a range of human cancer cell lines,
including LS174T colon carcinoma and HepG2 and He3B hepatocellular
carcinoma (HCC) cell lines (FIG. 24D), that was associated with the
dose-dependent induction of apoptosis 48 h after siRNA transfection
(FIG. 24E).
Design of PLK-1 and KSP siRNA for In Vivo Applications
[0570] Prior to the in vivo assessment of synthetic siRNA, it is
essential to anticipate the potential effects of immune stimulation
on the biological system under consideration and take steps to
mitigate this risk (11). We have previously reported that the
selective introduction of 2'OMe-guanosine or 2'OMe-uridine residues
into siRNA abrogates its capacity to activate an immune response
(18, 37). This original strategy proposed restricting 2'OMe
modifications to the siRNA sense strand in order to minimize the
potential of negatively impacting RNAi activity (18). While this
approach remains broadly applicable for synthetic siRNA (37), we
have found through extensions to our original studies that certain
siRNA sequences incorporating a TOMe-modified sense strand, for
example the U(S)-ApoB1 duplex (18), may retain low-grade
immunostimulatory activity. This was only evidenced by the
induction of IFN-inducible p56 IFIT1 mRNA in the liver and spleen
following intravenous administration of SNALP-formulated U(S)-ApoB1
siRNA in mice, despite there being no measurable serum cytokine
response (FIG. 25). This residual IFIT1 induction, however, could
be fully abrogated by the selective introduction of 2'OMe
nucleotides to the antisense (AS) strand of the duplex (FIG. 25).
These findings provided the rationale for our design and testing of
2'OMe siRNA against oncology targets.
[0571] A similar approach to siRNA design was applied to PLK1424
and PLK773 to generate duplexes that possessed no measurable immune
stimulatory effects yet retaining full RNAi activity. This step was
regarded as a pre-requisite to conducting in vivo studies in order
to conclude the specificity of anti-tumor effects that may be
observed. 2'OMe-U or 2'OMe-G nucleotides were substituted into the
native sense and AS oligonucleotides to form a panel of modified
PLK1424 and PLK773 duplexes (Table 6) that were then screened for
the preservation of RNAi activity. 2'OMe-PLK1424 duplexes
containing the modified AS strands A or B showed similar
anti-proliferative activity to the native PLK1424 sequence when
paired with either of the modified sense strands 1 or 2.
TOMe-PLK1424 containing AS strand C displayed anti-proliferative
activity at higher concentrations (FIG. 26A). The panel of
2'OMe-PLK773 duplexes displayed modest differences in activity
compared to the native PLK773 sequence (FIG. 26B). We selected
PLK1424-2/A and PLK773-1/B siRNA duplexes (comprising the
designated 2'OMe-modified sense/AS strands) for evaluation in an in
vitro immune stimulation model. As expected, native PLK1424 and
PLK773 siRNA and their constituent single stranded RNA (ssRNA)
stimulated murine Flt3-ligand derived dendritic cells to produce
high levels of both IFN.alpha. and IL-6 (FIG. 26C), whereas this
immune reactivity was completely abrogated in the PLK1424-2/A and
PLK773-1/B duplexes.
TABLE-US-00010 TABLE 6 PLK-1, KSP, and Luc siRNA sequences with
2'OMe modification patterns. Sequence SEQ ID Name Strand (5'-3' 21
mer) NO: PLK1424 S AGAUCACCCUCCUUAAAUAUU 211 PLK1424 AS
UAUUUAAGGAGGGUGAUCUUU 212 PLK1424-1 S AGAUCACCCUCCUUAAAUAUU 213
PLK1424-2 S AGAUCACCCUCCUUAAAUAUU 214 PLK1424-A AS
UAUUUAAGGAGGGUGAUCUUU 215 PLK1424-B AS UAUUUAAGGAGGGUGAUCUUU 216
PLK1424-C AS UAUUUAAGGAGGGUGAUCUUU 217 PLK773 S
AGACCUACCUCCGGAUCAAUU 218 PLK773 AS UUGAUCCGGAGGUAGGUCUUU 219
PLK773-1 S AGACCUACCUCCGGAUCAAUU 220 PLK773-2 S
AGACCUACCUCCGGAUCAAUU 221 PLK773-A AS UUGAUCCGGAGGUAGGUCUUU 222
PLK773-B AS UUGAUCCGGAGGUAGGUCUUU 223 PLK773-C AS
UUGAUCCGGAGGUAGGUCUUU 224 KSP2263 S CUGAAGACCUGAAGACAAUdTdT 225
KSP2263 AS AUUGUCUUCAGGUCUUCAGdTdT 226 KSP2263-U S
CUGAAGACCUGAAGACAAUdTdT 227 KSP2263-G S CUGAAGACCUGAAGACAAUdTdT 228
KSP2263-U AS AUUGUCUUCAGGUCUUCAGdTdT 229 KSP2263-G AS
AUUGUCUUCAGGUCUUCAGdTdT 230 Luc S GAUUAUGUCCGGUUAUGUAUU 231 Luc AS
UACAUAACCGGACAUAAUCUU 232 Luc-U S GAUUAUGUCCGGUUAUGUAUU 233 Luc-U
AS UACAUAACCGGACAUAAUCUU 234 2'-O-methyl (2'OMe) nucleotides are
indicated in bold and underlined. The sense (S) or antisense
(AS)strand can alternatively or additionally comprise
2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy nucleotides,
2'-O-(2-methoxyethyl) (MOE) nucleotides, and/or locked nucleic acid
(LNA) nucleotides.
[0572] To demonstrate the utility of this approach to siRNA design,
the same methodology was applied to a published siRNA targeting KSP
(38). The selected KSP siRNA (termed KSP2263 from its original
description) has full sequence homology to mouse and human KSP mRNA
and showed potent anti-proliferative effects in both human and
mouse cancer cell lines. As an example, treatment of mouse Neuro2a
cells with SNALP-formulated KSP2263 induced dose-dependent
reductions in KSP mRNA 24 h after transfection, correlating with a
subsequent loss of cell viability at 72 h (FIG. 26D). A panel of
modified KSP2263 duplexes containing 2'OMe-U or 2'OMe-G nucleotides
(Table 6) was then screened in this assay. In this case, each
combination of the two modified sense and AS strands generated a
duplex with equivalent potency to the native KSP2263 sequence,
confirming preservation of RNAi activity (FIG. 26E). We selected
the 2'OMe-modified variant KSP2263-U/U for further
characterization.
Confirmation of the RNAi Mechanism by 5' RACE-PCR
[0573] The detection of specific RNA cleavage products generated by
RISC-mediated hydrolysis of target mRNA is the definitive marker
confirming RNAi as the mechanism of gene silencing (39, 40).
Activated RISC cleaves target mRNA precisely between the
nucleotides complementary to positions 10 and 11 of the siRNA AS
strand generating an mRNA cleavage product that is unique to the
siRNA sequence. This can be detected in cells using an
appropriately designed 5'-rapid amplification of cDNA ends-PCR
method (RACE-PCR). We developed RACE-PCR assays to detect the
PLK1424-specific cleavage product of human PLK-1 mRNA and the
KSP2263-specific cleavage product of mouse KSP mRNA. Treatment of
HT29 cells with PLK1424-2/A generated the predicted 476 bp 5'
RACE-PCR product and oligonucleotide sequencing across the 5'
ligation site confirmed its identity as the human PLK-1 mRNA
product cleaved at the 5' position 1433 (relative to ATG start
site) (FIG. 27). Similarly, a predicted 102 bp RACE-PCR product was
amplified from Neuro2a cells treated with KSP2263-U/U siRNA that
corresponded to mouse KSP mRNA cleaved at position 2129 (FIG.
27).
Characterization of the Immune Response to 2'OMe PLK-1 and KSP
siRNA In Vivo
[0574] To confirm the abrogation of immune stimulation by the 2'OMe
siRNA in vivo, Balb/c mice were treated intravenously with
SNALP-formulated PLK1424-2/A, PLK773-1/B, KSP2263-U/U, or a control
2'OMe siRNA targeting luciferase (Luc-U/U). IFIT1 mRNA and serum
cytokines were assessed 4-6 h after SNALP administration based on
the approximate time of peak response for these markers. In these
studies, SNALP-formulated native Luc siRNA (Table 6) was used as a
positive control for immune stimulation. Intravenous administration
of this unmodified siRNA induced 83-fold and 247-fold increases in
IFIT1 mRNA in the liver and spleen, respectively, compared to PBS
treated controls (FIG. 28A). This was consistent with the detection
of systemic IFN.alpha. in these animals (FIG. 28B). In contrast,
the PLK1424-2/A, PLK773-1/B, KSP2263-U/U, or Luc-U/U siRNAs induced
no measurable IFN.alpha. or increase in IFIT1 mRNA in the liver or
spleen relative to PBS treated animals, confirming that these
SNALP-formulated siRNA caused no discernable IFN signaling in
either the liver as primary target organ for this formulation or in
secondary lymphoid tissues (FIG. 28). As previously reported (18),
the administration of SNALP-formulated TOMe siRNA induced no
increase in other serum cytokines including IL-6, IL-10, IL-12,
TNF, or IFN.gamma. and displayed a similar lack of immune
reactivity in primary human immune cell cultures.
[0575] This siRNA design and screening approach can be applied to
any given sequence to rapidly identify siRNA in which the chemical
modifications are well tolerated with respect to RNAi activity and
predicted to fully abrogate immune stimulation. Unlike other
chemical modification strategies for siRNA, enhancing nuclease
resistance was not a primary design consideration since SNALP, the
intended delivery vehicle for in vivo studies, is known to protect
unmodified siRNA from nuclease degradation for greater than 24 h in
serum (18). However, the 2'OMe modification pattern can take into
account the avoidance of: (1) position 9 in the sense strand based
on the observation that efficient activation of RISC involves
initial cleavage of the siRNA sense strand between positions 9-10
and this can be inhibited by the introduction of nuclease resistant
chemistries at this linkage (41, 42); and (2) the 5' antisense
terminus where modified chemistries may interfere with effective
RNA loading into RISC (43, 44).
Therapeutic Inhibition of Tumor Growth by Systemic siRNA
Administration
[0576] Orthotopic liver tumor models were established to examine
the pharmacodynamics and therapeutic efficacy of SNALP-formulated
PLK1424-2/A and KSP2263-U/U siRNA. These were a Hep3B xenograft in
scid/beige mice as a representative model of human HCC and a
syngeneic Neuro2a tumor model in immune competent A/J mice. Tumor
cells were injected directly into the left lateral liver lobe to
establish primary intrahepatic tumors (45). This procedure resulted
in histologically distinct, localized tumor nodules in greater than
90% of mice in both models.
[0577] To evaluate the therapeutic efficacy of SNALP formulated
PLK1 siRNA, mice bearing established Hep3B liver tumors were
treated with 2 mg/kg PLK1424-2/A or Luc-U/U siRNA by intravenous
administration twice weekly for 3 weeks, until control groups
displayed symptoms of extensive tumor burden. We have found
progressive body weight loss to be a good indicator of hepatic
tumor burden in the Hep3B-scid/beige mouse model. Weight loss in
Luc-U/U treated mice was evident 12-16 days after tumor
implantation and proceeded throughout the remainder of the study
(FIG. 29A). In contrast, PLK1424-2/A SNALP treated mice typically
maintained body weight over the duration of treatment, indicating
that the siRNA formulation was well tolerated and suggesting
therapeutic benefit. Death is not an acceptable endpoint in animal
studies; therefore, a humane endpoint was defined according to
daily clinical scores which were an aggregate of weight loss, body
condition, and abdominal distension. In this aggressive orthotopic
model, the time until first euthanization in the Luc-U/U group was
28 d after tumor seeding with a median survival time of 32 d. By
comparison, the times to first euthanization and median survival in
the PLK1424-2/A SNALP treated mice were significantly extended to
44 d and 51 d, respectively (p<0.05; FIG. 29B). Similar
extensions to survival times were observed in repeat studies
utilizing athymic nu/nu mice as hosts (FIG. 30).
[0578] The extent of Hep3B liver tumor burden was then assessed at
the completion of dosing with PLK1424-2/A on day 22 after tumor
implantation (1 day after the fifth siRNA dose). At autopsy, only 2
of 6 PLK1424-2/A treated mice had visible tumors localized around
the site of cell implantation into the liver lobe, compared to
extensive macroscopic tumor burden in corresponding control animals
(FIG. 31). Species-specific probe sets to human GAPDH (hGAPDH) mRNA
detected low levels of this tumor-derived signal in 5 of 6
PLK1424-2/A treated mice, ranging from 2 to 6-fold above the
background signal from normal mouse liver (FIG. 29C), indicating
that tumor growth was significantly suppressed but not completely
eradicated by this treatment regime.
[0579] To examine more closely the tolerability of systemic siRNA
administration, multi-dose toxicity studies were conducted using
the mouse surrogate PLK773-1/B. Repeat administration of SNALP
formulated PLK773-1/B at 2 mg/kg, twice weekly (mirroring the
therapeutic dosing regimen) caused no significant changes in serum
liver enzymes, total wbc, lymphocyte and neutrophil counts,
platelet numbers, or rbc parameters assessed after 15 and 29 days
of continuous treatment (FIG. 32). These results indicated that the
therapeutic dosing regime established in the orthotopic tumor model
caused minimal hepatocellular toxicity and no significant bone
marrow dysfunction of the type frequently observed with the
systemic administration of small molecule anti-mitotic drugs.
[0580] The therapeutic effect of SNALP-formulated KSP2263-U/U siRNA
in syngeneic Neuro2a liver tumors was next evaluated. Median
survival time of mice receiving Luc-U/U SNALP (4 mg/kg,
Q3d.times.5) was 20 d in this model, compared to 28 d in the
KSP2263-U/U treatment group (FIG. 29D), demonstrating therapeutic
efficacy with SNALP-formulated siRNA for another oncology
target.
Confirmation of RNAi-Mediated Tumor Gene Silencing In Vivo
[0581] Despite demonstrating that the 2'OMe siRNA did not induce a
measurable immune response in mice, it remained critical to show
that RNAi was the primary mechanism underlying the potent
therapeutic effects of these PLK-1 and KSP siRNA formulations. A
single intravenous administration of SNALP-formulated PLK1424-2/A
(2 mg/kg) caused a significant reduction in tumor-derived human
PLK-1 (hPLK-1) mRNA in hepatic hep3B tumors 24 h after
administration (45%+/-6.8% of hPLK-1 mRNA levels in PBS-treated
mice; FIG. 33A). A similar reduction in mouse KSP mRNA expression
was achieved using an equivalent dose of KSP2263-U/U in the hepatic
Neuro2a tumor model (FIG. 33B). In contrast to KSP and PLK-1
expression in tumors, endogenous expression of both these genes in
the surrounding non-proliferative liver was found to be very low,
below the level of detection of the branched DNA assay employed in
these studies. Since the expression of cell cycle genes such as
PLK-1 and KSP are typically down-regulated as cells exit cell cycle
(22), any non-specific, anti-proliferative effects induced by siRNA
or the delivery vehicle would cause a general decrease in their
expression within tumors. We therefore confirmed RNAi as the
mechanism responsible for mRNA silencing in vivo by the 5'-RACE PCR
method. A PCR product of the predicted size was readily amplified
from hepatic Hep3B tumor samples taken 24 h after administration of
PLK1424-2/A SNALP (FIG. 33C). Oligonucleotide sequencing of the 476
bp PCR product from three individual mice confirmed its identity as
the predicted 5' cut end of hPLK-1 mRNA. This PCR product was not
evident in tumors taken from Luc-U/U siRNA treated mice or in liver
samples from non-tumor bearing animals. RACE-PCR analysis also
confirmed the specific induction of RNAi-mediated KSP mRNA cleavage
within tumors of KSP2263-U/U treated animals (FIG. 33D).
5'-RACE-PCR to Monitor the Duration of RNAi in Tumors
[0582] To determine the duration of active RNAi within the tumor, a
cohort of Hep3B tumor-bearing mice was treated with PLK1424-2/A
SNALP (2 mg/kg by intravenous administration) and collected tumors
24 h, 48 h, 96 h, 7 d, and 10 d after administration for analysis
by 5' RACE-PCR. Active PLK-1 mRNA cleavage remained strong at 48
and 96 h and was still evident 7 d after a single siRNA
administration. A weak signal was detected in PLK1424 treated
animals on Day 10 (FIG. 34A). The duration of RNAi determined by
RACE-PCR closely correlated with the level of hPLK-1 mRNA silencing
in these liver tumors (FIG. 34B), providing further confirmation
that RNAi was the primary mechanism for reductions in PLK-1 mRNA.
Since the cleaved mRNA species are inherently unstable in the cell
cytoplasm, it can be concluded that active RISC-mediated cleavage
of the target mRNA persisted for 7-10 days after a single siRNA
treatment. This suggests that active RNAi continued to occur either
within a subset of tumor cells at sub-cytotoxic levels or within an
initially non-proliferative population that subsequently entered
cell cycle and re-expressed PLK-1 mRNA.
RNAi-Mediated Anti-Tumor Activity Assessed by Histology
[0583] Many anti-mitotic drugs, including KSP (46) and PLK-1
inhibitors (47, 48), induce distinct nuclear phenotypes that
reflect their underlying mechanism of action. We therefore used
conventional histology as a biomarker to assess whether the degree
of RNAi-mediated gene silencing in vivo was sufficient to induce
the desired anti-mitotic effect in tumor cells. Inhibition of KSP
prevents bipolar spindle formation and centrosome segregation,
leading to the formation of characteristic monoastral spindles. We
first confirmed that the treatment of tumor cells with KSP2263-U/U
siRNA induced the distinct monoastral nuclear phenotype in vitro
(FIG. 35). Conventional histology on Neuro2a tumors from
KSP2263-U/U treated mice revealed significant numbers of tumor
cells with aberrant mitotic figures typical of monoastral and
apoptotic cells (46) 24 h after SNALP administration (FIG. 36A, B).
This dramatic pharmacodynamic response to KSP2263-U/U treatment was
dose-dependent with maximal effects observed at 2 mg/kg siRNA based
on quantitative histology scores (FIG. 36C). This analysis
estimated .about.13% of total Neuro2a tumor cells with condensed
chromatin structures at 24 h post siRNA treatment, compared to
.about.3% of cells displaying typical mitotic figures in control
tumors.
[0584] Histological analysis of Hep3B liver tumors from PLK1424-2/A
SNALP treated mice also revealed abundant tumor cells with
condensed chromatin structures and aberrant mitotic figures (FIG.
37). These phenotypic changes were consistent with the dysregulated
chromosomal segregation and apoptosis that is induced by PLK-1
inhibition (47) and were in striking contrast to the typical
mitotic figures evident in the tumor histology of control treated
animals.
[0585] These molecular and cellular pharmacodynamic studies
confirmed that the degree of RNAi-mediated silencing achieved by a
single intravenous administration of SNALP-formulated PLK or KSP
siRNA was sufficient to cause mitotic dysfunction in a substantial
proportion of tumor cells. Histological assessments of drug
activity in both models demonstrated that "affected" cells were
distributed throughout established tumors, indicating good
penetration of the lipidic delivery vehicle. Taken together, this
battery of tests provided conclusive evidence that the potent
therapeutic effects of these SNALP formulated siRNA, in the absence
of a measurable immune response, are the result of RNAi.
Therapeutic Activity of SNALP-Formulated siRNA in Subcutaneous
Tumors
[0586] To expand the general utility of this technology in
oncology, the performance of this liver-targeting SNALP formulation
(26) was tested for delivering siRNA to tumors outside of the
liver. For vehicles containing poly(ethylene)glycol conjugated
lipids (PEG-lipids) such as SNALP, increased blood residency time
and tumor accumulation can be achieved by incorporating PEG-lipids
with longer alkyl chains that associate more strongly with the
lipid particle and provide greater shielding in the blood
compartment (49). Replacing the C14 PEG-lipid (PEG-cDMA) with the
C18 analogue PEG-cDSA (50) had the effect of significantly
increasing the blood circulation time of PLK1424-2/A SNALP in mice
without altering its therapeutic efficacy in hepatic tumors (FIG.
38; median survival PLK PEG-cDMA=51 d, PLK PEG-cDSA=53 d versus Luc
Control PEG-cDMA=33 d; p<0.05).
[0587] Despite a relatively short blood circulation time and rapid
distribution to the liver, repeat administration of PEG-cDMA SNALP
containing PLK1424-2/A caused significant inhibition of
subcutaneous Hep3B tumor growth compared to Luc-U/U siRNA treatment
controls (FIG. 39A). PLK1424-2/A formulated in an equivalent
PEG-cDSA SNALP exhibited more potent anti-tumor effects, inducing
regression of established tumors (.about.7 mm diameter) through the
dosing period (FIG. 39A). This difference in activity correlated
with the degree of gene silencing induced by these PLK1424-2/A
SNALP in subcutaneous tumors (FIG. 39B). As in the hepatic tumor
models, this was confirmed as being mediated by RNAi by both
RACE-PCR and tumor histology. Finally, the therapeutic dose
response of the PEG-cDSA PLK1424-2/A formulation was established in
the subcutaneous model. Dose-dependent inhibition of tumor growth
was evident from 0.5 to 3.0 mg/kg PLK1424-2/A siRNA (FIG. 39C). At
the lowest dose level tested, this represented a total cumulative
dose of 3 mg/kg siRNA over a 2 week period.
Discussion
[0588] Delineating the mechanism of action for nucleic acid based
drugs has historically been confounded by underlying immune
stimulation or other non-specific effects induced by the nucleic
acid (51, 52). This remains a valid concern for the burgeoning
field of siRNA-based therapeutics (11). Assessment of target mRNA
or protein down-regulation is necessary, but not sufficient to
conclude RNAi as the underlying mechanism as these changes may also
be symptomatic of the off-target effects induced by siRNA. This
example on the development of SNALP-formulated siRNA for oncology
applications describes the methodology used to confirm both the
specificity and mechanism of action underlying the potent
siRNA-mediated anti-tumor efficacy in preclinical models. This
involved a combination of approaches: (1) the design of both active
and control siRNA formulations with no apparent capacity to
activate an immune response, therefore excluding as best as
possible the potential for non-specific efficacy; (2) the selection
of validated oncology targets (PLK-1 and KSP) with direct
anti-tumor effects and distinctive histological biomarkers of
functional target inhibition; (3) the use of RACE-PCR to confirm
induction of the RNAi-specific mRNA cleavage product in tumor
cells; and (4) the correlation of this active RNAi signature with
the duration of target mRNA silencing in tumors. This example is
the first report describing anti-tumor effects of siRNA to formally
demonstrate. RNAi as the primary mechanism of action. Furthermore,
this approach to preclinical study design can be generalized to
other targets in oncology and readily adopted by researchers in the
RNAi field.
[0589] To evaluate the therapeutic potential of gene silencing in
tumors without the confounding effects of immune stimulation, 2'OMe
modified siRNA were designed that completely abolish the
immunostimulatory activity of unmodified (native) RNA duplexes when
administered in a delivery vehicle. It is well established that the
large majority of native siRNA duplexes have the inherent capacity
to activate the innate immune response through the endosomal TLR7
and/or TLR8 pathway, particularly when cellular uptake is
facilitated by delivery vehicles (2, 3, 18, 53). Naked
(non-formulated) siRNA duplexes of 21 bp or longer have also been
reported to activate cell surface TLR3 on endothelial cells,
causing non-specific anti-angiogenic effects in models of choroidal
neovascularization (4). The consequences of immune activation by
siRNA in tumor models was recently illustrated by the potent
anti-tumor effects elicited by both active and non-targeting immune
stimulatory siRNA constructs through the activation of immune
effector functions (15). The TOMe siRNAs described herein induced
no measurable cytokine response in mice. There was also no
induction of the IFN inducible gene IFIT1 in either the liver,
representing the primary target organ for these delivery vehicles,
or within secondary lymphoid tissues. IFIT1 expression is
responsive to local IFN signaling within tissues, and is also
induced directly via dsRNA receptors, including TLR3, through an
IFN-independent pathway (54-56). Its measure can therefore be
considered more broadly indicative of siRNA-mediated immune
activation compared to the induction of particular systemic
cytokines. Taken together, these results indicate that the
appropriate design of TOMe siRNA can not only circumvent the
activation of endosomal TLR7/8 (2, 3, 18, 53), but also TLR3 (56).
This likely reflects the fact that encapsulation of siRNA within
delivery vehicles such as SNALP effectively shields the RNA from
exposure to TLR3 on the cell surface. It is important that
researchers confirm the full abrogation of an immune response to
their selected siRNA in the context of their preferred delivery
vehicle and animal model.
[0590] A number of strategies for chemically modifying siRNA have
been proposed, primarily with the intent to produce nuclease
resistant duplexes (16). This example illustrates that strategies
incorporating 2'OMe-G, -U, or -A residues into both strands of the
duplex will generate non-immunostimulatory siRNA. One such method
for siRNA design employs alternating 2'OMe nucleotides throughout
both strands of the duplex (57). Santel and colleagues (58) have
tested these 2'OMe siRNA against the angiogenic target CD31 in
tumor models using a lipoplex formulation that transfects vascular
endothelium. Anti-tumor effects in these studies were correlated
with specific reductions in CD31 expression and tumor vasculature
in the apparent absence of overt immune stimulation. While the
authors did not confirm the induction of RNAi in their models and
only looked at systemic IFN.alpha. 24 h after siRNA administration,
the report represents one of very few published RNAi studies in
oncology to use chemically modified siRNA constructs predicted to
have minimal immunostimulatory capacity. It should be noted that
this siRNA design is based on blunt-ended 19mer duplexes that, as
naked molecules, are predicted not to activate TLR3 (4). This
assumption needs to be formally tested for these lipoplexed siRNA
to ensure complexing of short siRNA does not enable their
engagement of cell surface TLR3 or other RNA receptors.
[0591] Target silencing by siRNA may offer several advantages over
functional inhibition by small molecule drugs. By its nature, RNAi
is highly specific and allows for the selective inhibition of
closely related proteins compared to the relative promiscuity of
kinase inhibitors. Current PLK-1 inhibitors for example also
inhibit PLK-2 and PLK-3 kinase activity (23, 59), raising some
concern that concomitant inhibition of these family members may
have opposing effects in controlling cell division (60). The
biological response to protein depletion by RNAi can also differ
from its functional inhibition by small molecules, for example, the
loss of both kinase and polo-box functionality upon PLK-1 gene
silencing (61). The duration of drug effect that can be achieved
with siRNA is another attractive advantage. Once RNAi is
established within mammalian cells, gene silencing can persist for
many days, due to the relative stability of activated RISC in the
presence of its complementary mRNA (26, 62). Therefore, the
maintenance of drug activity for an siRNA therapeutic is uncoupled
from the requirement to maintain an effective drug concentration in
the blood. We have found that active RNAi in our tumor models
persisted for up to 10 days based on detection of the specific mRNA
cleavage product by RACE-PCR. Interestingly, this duration of
effect was substantially shorter than that observed in comparable
studies targeting ApoB expression in the healthy mouse liver in
which silencing at the mRNA level slowly resolved between 14 and 28
days after siRNA administration (26). We believe that the
attenuation of RNAi in the tumor most likely results from the
effective killing of PLK-1 silenced tumor cells and from the
dilution of activated RISC through the proliferation of cells
receiving sub-lethal doses of PLK-1 siRNA (62).
[0592] This example demonstrates that systemic administration of
SNALP-formulated siRNA can trigger RNAi-mediated cleavage of mRNA
within solid tumors, silencing target expression at a magnitude
sufficient to induce the mitotic disruption and apoptosis of tumor
cells. This specific drug effect translates into robust therapeutic
anti-cancer activity in models of human HCC. Significant inhibition
of tumor growth, correlating with marked improvements in clinical
signs, ultimately led to significant increases in survival
times.
[0593] The multi-kinase inhibitor Sorafenib has recently been
approved for the treatment of unresectable HCC based on limited
phase III data (63) and it is likely that Sorafenib will become the
standard of care for this indication. As a result, there is utility
in using SNALP-formulated siRNA in combination with small molecule
drugs. In fact, our studies indicate that a combination of
Sorafenib and PLK-1 SNALP is well tolerated in mice and shows
promising signs of activity in tumor models.
[0594] Current treatment options are limited for patients with
primary liver cancer or liver metastatic disease and prognoses
remain poor. The clinical development of therapeutic siRNAs
targeting key genes in cancer development, such as PLK-1 and KSP,
coupled with a systemic delivery vehicle capable of targeting
hepatic and disseminated tumors, offers an exciting opportunity for
this significant unmet medical need.
Methods
[0595] siRNA. siRNA sequences targeting human PLK-1 (Genbank
Accession No. NM_005030) were selected using a standard siRNA
design algorithm (40, 64). Target sequences of PLK-1 siRNAs are
listed in Table 7. All siRNA were synthesized as oligonucleotides
by Integrated DNA Technologies and received as desalted,
deprotected RNA. Integrity of annealed duplexes was confirmed by
20% PAGE. siRNA were formulated into SNALP comprised of synthetic
cholesterol (Sigma), DSPC
(1,2-distearoyl-sn-glycero-3-phosphocholine; Avanti Polar Lipids),
PEG-cDMA (3-N-(-Methoxy poly(ethylene
glycol)2000)carbamoyl-1,2-dimyrestyloxy-propylamine), and DLinDMA
(1,2-Dilinoleyloxy-3-(N,N-dimethyl)aminopropane) as previously
described (26). Formulations used for in vivo studies comprised a
final lipid:siRNA mass ratio of 9:1. In the experiments indicated,
PEG-cDMA was substituted at equimolar concentrations with the C18
analogue PEG-cDSA (50). All stabilized lipid particles were
dialyzed in PBS prior to use and were stable as a wet preparation
stored at 4.degree. C. for greater than 6 months.
TABLE-US-00011 TABLE 7 siRNAsequences targeting human PLK-1. siRNA
Sense Strand (5' .fwdarw. 3') SEQ ID NO: 126 GGUCCUAGUGGACCCACGCUU
235 272 AGCCGCACCAGAGGGAGAAUU 236 273 GCCGCACCAGAGGGAGAAGUU 237 363
GGACAACGACUUCGUGUUCUU 238 412 CUCCUGGAGCUGCACAAGAUU 239 450
GCCUGAGGCCCGAUACUACUU 240 498 CCUGCACCGAAACCGAGUUUU 241 618
GAGGAAGAAGACCCUGUGUUU 242 627 GACCCUGUGUGGGACUCCUUU 243 629
CCCUGUGUGGGACUCCUAAUU 244 630 CCUGUGUGGGACUCCUAAUUU 245 693
GGUGGAUGUGUGGUCCAUUUU 246 694 GUGGAUGUGUGGUCCAUUGUU 247 736
GUGGGCAAACCACCUUUUGUU 248 744 ACCACCUUUUGAGACUUCUUU 249 745
CCACCUUUUGAGACUUCUUUU 250 772 GAGACCUACCUCCGGAUCAUU 251 773
AGACCUACCUCCGGAUCAAUU 218 776 CCUACCUCCGGAUCAAGAAUU 252 780
CCUCCGGAUCAAGAAGAAUUU 253 832 GCCGCCUCCCUCAUCCAGAUU 254 837
CUCCCUCAUCCAGAAGAUGUU 255 1137 GCAGCUGCACAGUGUCAAUUU 256 1195
GAGGCUGAGGAUCCUGCCUUU 257 1229 GGGUCAGCAAGUGGGUGGAUU 258 1232
UCAGCAAGUGGGUGGACUAUU 259 1233 CAGCAAGUGGGUGGACUAUUU 260 1242
GGUGGACUAUUCGGACAAGUU 261 1319 CACGCCUCAUCCUCUACAAUU 262 1321
CGCCUCAUCCUCUACAAUGUU 263 1347 CAGCCUGCAGUACAUAGAGUU 264 1404
UCCCAACUCCUUGAUGAAGUU 265 1409 ACUCCUUGAUGAAGAAGAUUU 266 1424
AGAUCACCCUCCUUAAAUAUU 211 1457 UGAGCGAGCACUUGCUGAAUU 267 1550
CCCGCAGCGCCAUCAUCCUUU 268 1556 GCGCCAUCAUCCUGCACCUUU 269 1577
GCAACGGCAGCGUGCAGAUUU 270 1580 ACGGCAGCGUGCAGAUCAAUU 271 1620
GCUCAUCUUGUGCCCACUGUU 272 1658 UCGACGAGAAGCGGGACUUUU 273
[0596] The number under "siRNA" in Table 7 refers to the nucleotide
position of the 5' base of the sense strand relative to the start
codon (ATG) of the human PLK-1 mRNA sequence NM_005030. In certain
embodiments, the sense strand comprises modified nucleotides such
as 2'-O-methyl (2'OMe) nucleotides, 2'-deoxy-2'-fluoro (2'F)
nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE)
nucleotides, and/or locked nucleic acid (LNA) nucleotides.
[0597] Cell Cultures.
[0598] The cell lines Hep3B, HepG2, HT29, LS174T, and Neuro2a cells
were obtained from the American Type Culture Collection (ATCC;
Manassas, Va.) and cultured in the recommended basal media with 10%
heat inactivated FBS and 1% penicillin-streptomycin. For in vivo
tumor studies, Hep3B or Neuro2a cells were cultured in T175 flasks,
harvested and washed once in PBS prior to implantation. For in
vitro siRNA activity assays, cell lines were cultured in 96 well
plates in the presence of SNALP formulated siRNA. Cell viability
was assessed after 72 h using the resazurin dye CellTiter Blue
(Promega Corp). Corresponding PLK-1 or KSP mRNA silencing activity
was assessed in replicate plates at 24 h by the bDNA assay
(Panomics Inc.). The level of Caspase 3 and 7 enzyme activity in
siRNA treated cells was assessed using the fluorescent Caspase 3/7
substrate (Z-DEVD)2-Rhodamine 110 reagent Apo-ONE (Promega
Corp.).
[0599] In Vitro Immune Stimulation Assays.
[0600] Mouse Flt3L dendritic cell cultures were generated as
described previously (65). In brief, bone marrow from Balb/C mice
was harvested in complete media (RPMI 1640, 10% FBS, 1%
penicillin/streptomycin, 2 mM L-glutamine, 1 mM sodium pyruvate, 25
mM HEPES, 50 uM 2-mercaptoethanol), passed through a 70 micron
strainer and resuspended to 2.times.106 cells/mL in complete media
supplemented with 100 ng/mL murine Flt3L (Peprotech). Cells were
seeded in 6-well plates and 1 mL fresh Flt3L media added every
three days. On day 9 of culture, non-adherent cells were plated
into 96 well plates at a concentration 2.times.105 cells/well.
Formulated siRNA were diluted in PBS and added to the cells for 24
h before supernatants were assayed for cytokines by ELISA.
[0601] In Vivo Immune Stimulation Assays.
[0602] All animal studies were performed at Protiva Biotherapeutics
in accordance with Canadian Council on Animal Care guidelines and
following protocol approval by the Institutional Animal Care and
Use Committee. 6-8 week old Balb/C mice were obtained from Harlan
and subject to a two week acclimation period prior to use. Mice
were administered SNALP formulated siRNA (2 mg/kg) in PBS via
standard intravenous injection in the lateral tail vein. Blood was
collected by cardiac puncture and processed as plasma for cytokine
analysis. Liver and spleen were collected into RNALater (Sigma Co.)
for IFIT1 mRNA analysis.
[0603] Intrahepatic Tumor Models.
[0604] Liver tumors were established in mice by direct intrahepatic
injection of Hep3B or Neuro2a tumor cells (45). Female scid/beige
mice (Charles River Laboratories) and male A/J mice (Jackson
Laboratories) were used as hosts for the Hep3B and Neuro2a tumors,
respectively. Animals received Anafen by SC injection immediately
prior to surgery. Individual mice were anaesthetized by isoflourane
gas inhalation and eye lube applied to prevent excessive eye
drying. While maintained under gas anaesthesia, a single 1.5 cm
incision across the midline was made below the sternum and the left
lateral hepatic lobe exteriorized. 1.times.10.sup.6 Hep3B cells or
1.times.10.sup.5 Neuro2a cells suspended in 25 pt PBS were injected
slowly into the lobe at a shallow angle using a Hamilton syringe
and 30 G needle. A swab was then applied to the puncture wound to
stop any bleeding prior to suturing. Mice were allowed to recover
from anaesthesia in a sterile cage and monitored closely for 2-4 h
before being returned to conventional housing.
[0605] Eight to 11 days after tumor implantation, mice were
randomized into treatment groups. siRNA SNALP formulations or PBS
vehicle control were administered by standard intravenous injection
via the lateral tail vein, calculated on a mg siRNA/kg basis
according to individual animal weights (10 mL/kg injection volume).
Body weights were then monitored throughout the duration of the
study as an indicator of developing tumor burden and treatment
tolerability. For efficacy studies, defined humane endpoints were
determined as a surrogate for survival. Assessments were made by
qualified veterinary technicians based on a combination of clinical
signs, weight loss, and abdominal distension to define the day of
euthanization due to tumor burden.
[0606] Subcutaneous Tumor Models.
[0607] Hep3B tumors were established in female scid/beige mice by
subcutaneous injection of 3.times.10.sup.6 cells in 50 .mu.L PBS
into the left hind flank. Mice were randomized into treatment
groups 10-17 days after seeding as tumors became palpable. siRNA
SNALP formulations were administered as described above. Tumors
were measured in 2 dimensions (Width.times.Length) to assess tumor
growth using digital calipers. Tumor volume was calculated using
the equation a.times.b.times.b/2 where a and b largest and smallest
diameters, respectively, and expressed as group mean+/-SD.
[0608] Measurement of Human PLK-1 and GAPDH mRNA in Tumor
Tissues.
[0609] Tumors were harvested directly into RNALater and stored at
4.degree. C. until processing. 100 mg tumor tissue was homogenized
in Tissue and Lysis Solution (EpiCentre Biotechnologies) containing
50 mg/ml proteinase K (EpiCentre) in a Fastprep tissue homogenizer
followed by incubation in a 65.degree. C. waterbath for 15 min and
centrifuged to clarify lysates. mRNA analysis in FIG. 33B was
performed on purified RNA isolated according the 5'-RACE-PCR
protocol. Human PLK-1 and GAPDH mRNA were measured in tumor lystes
by the QuantiGene bDNA assay (Panomics) as per the manufacturer's
instructions (Quantigene 1.0 Manual). Human-specific PLK-1
(NM_005030) and GAPDH (NM_002046) probe sets were designed by
Panomics and demonstrated to have minimal cross-reactivity to the
mouse counterpart mRNA. Data were expressed as mean PLK-1:GAPDH
ratio+/-SD of individual animals. Tumor burden was assessed by
homogenizing the complete liver from tumor bearing mice and
measuring the total hGAPDH signal (RLU's) within the liver. Values
were expressed as hGAPDH RLU/mg total liver.
[0610] Measurement of IFIT1 mRNA in Mouse Tissues.
[0611] Murine liver and spleen were processed for bDNA assay to
quantitate IFIT1 mRNA as described above. The IFIT1 probe set was
specific to mouse IFIT1 mRNA (positions 4-499 of NM_008331) and the
GAPDH probe set was specific to mouse GAPDH mRNA (positions 9-319
of NM 008084). Data is shown as the ratio of IFIT1 relative light
units (RLU) to GAPDH RLU.
[0612] 5' RNA Ligase Mediated Rapid Amplification of cDNA Ends (5'
RLM RACE).
[0613] Total RNA was isolated from in vitro cultured cells by
direct lysis in TRIZOL (Invitrogen, Carlsbad, Calif.). For in vivo
tumor samples, tissues were harvested into RNAlater (Sigma Co.) and
stored at 4.degree. C. for at least 24 h prior to processing. 30 mg
tumor tissue was homogenized in 1 mL TRIZOL then processed to
isolate total RNA. RNA quality was confirmed by gel electrophoresis
(1% agarose TBE). 5' RLM RACE was performed according to the
Invitrogen GeneRacer manual with modifications. Primers were
designed using the Primer 3 software. 10 .mu.g total RNA was mixed
with 1.3 ng GeneRacer RNA adaptor
TABLE-US-00012 (5'-CGACUGGAGCACGAGGACACUGACAUGGACUGAAGG
AGUAGAAA-3'; SEQ ID NO: 274),
heated to 65.degree. C. for 5 min and snap-cooled on ice prior to
ligation. RNA ligation was performed at 37.degree. C. for 1 h in
1.times. ligase buffer, 30 U RNase-Out (Invitrogen) and 30 U RNA
ligase (Ambion Inc, Austin, Tex.). Samples were then purified by
diafiltration using Microcon 100 filters as per the manufacturer's
instructions for nucleic acids (Millipore Inc). 10 .mu.L of the RNA
ligation product was reverse transcribed using Superscript III
(Invitrogen) and a PLK-1-specific primer
TABLE-US-00013 (5'-GGACAAGGCTGTAGAACCCACAC-3'; SEQ ID NO: 275)
designed downstream of the predicted PLK1424 siRNA cut site.
Reverse transcription was carried out at 55.degree. C. for 50 min
followed by inactivation at 70.degree. C. for 15 min and
snap-cooling on ice. 5' RLM RACE PCR was performed using forward
(GR5) and reverse (PLK1424rev) primers in the GeneRacer adaptor and
3' end of PLK-1 mRNA, respectively, to span the predicted PLK1424
cut site. PCR primer sequences were as follows:
TABLE-US-00014 GR5- (SEQ ID NO: 276) 5'-CGACTGGAGCACGAGGACACTGA-3';
and PLK1424rev- (SEQ ID NO: 277) 5'-CCAGATGCAGGTGGGAGTGAGGA-3'.
PCR was performed using a BIO-RAD iCycler using touchdown PCR
conditions of 94.degree. C. for 2 min (1 cycle), 94.degree. C. for
30 sec and 72.degree. C. for 1 min (5 cycles), 94.degree. C. for 30
sec and 70.degree. C. for 1 min (5 cycles), 94.degree. C. for 30
sec, 65.degree. C. for 30 sec and 68.degree. C. for 1 min (25
cycles), and 68.degree. C. for 10 min (1 cycle). PCR products were
run on a 2% TBE Agarose 1000 (Invitrogen) gel and stained with 1
.mu.g/ml ethidium bromide. The identity of PCR products was
confirmed by direct sequencing of the gel-purified products using
the following sequencing primers:
TABLE-US-00015 GeneRacer 5' Seq- (SEQ ID NO: 278)
ACTGGAGCACGAGGACAC-3'; and PLK1424 3' Seq- (SEQ ID NO: 279)
5'-GAGACGGGCAGGGATATAG-3'.
Similar assay conditions and primer design were employed to amplify
the cleaved KSP mRNA product by KSP2263 siRNA using the following
unique primers:
TABLE-US-00016 KSP-specific cDNA primer (SEQ ID NO: 280)
5'-GCTGCTCTCGTGGTTCAGTTCTC-3', RACE primer KSPrev (SEQ ID NO: 281)
5'-GCCCAACTACTGCTTAACTGGCAAA-3', and KSP sequencing primer (SEQ ID
NO: 282) 5'-TGGGTTTCCTTTATTGTCTT-3'.
[0614] Histology.
[0615] Tumors were harvested from mice 24 h after siRNA
administration and fixed directly in 10% buffered formalin. Tissues
were then processed as paraffin embedded tissue sections and
stained with Hematoxyilin and Eosin using conventional histological
techniques. Quantitative analysis of stained sections was performed
by counting the number of mitotic/apoptotic cells displaying
condensed chromatin structures as a percentage of total tumor
cells. Values for each tumor were derived from means of 10 fields
of view at 400.times. magnification.
[0616] Cytokine ELISA.
[0617] All cytokines were quantified using sandwich ELISA kits.
These were mouse interferon-.alpha. (PBL Biomedical; Piscataway,
N.J.) and human and mouse IL-6 (BD Biosciences; San Diego,
Calif.).
[0618] ApoB-1 siRNA Sequences.
[0619] The following ApoB-1 siRNA (5'-3') sequences were used in
the experiments shown in FIG. 25:
TABLE-US-00017 Sense- (SEQ ID NO: 283) GUCAUCACACUGAAUACCAAU; 2'OMe
sense- (SEQ ID NO: 284) GUCAUCACACUGAAUACCAAU; Antisense (AS)- (SEQ
ID NO: 285) AUUGGUAUUCAGUGUGAUGACAC; 2'OMe AS- (SEQ ID NO: 286)
AUUGGUAUUCAGUGUGAUGACAC.
2'OMe nucleotides are indicated in bold and underlined.
[0620] Statistical Analysis.
[0621] Comparison of survival times were performed on Kaplan-Meier
plots by the Log-rank (Mantel Cox) test. Differences were deemed
significant for P values less than 0.05.
REFERENCES
[0622] (1) Elbashir, S. M. et al. 2001. Duplexes of 21-nucleotide
RNAs mediate RNA interference in cultured mammalian cells. Nature
411: 494-498. [0623] (2) Judge, A. D. et al. 2005.
Sequence-dependent stimulation of the mammalian innate immune
response by synthetic siRNA. Nat Biotechnol 23: 457-462. [0624] (3)
Hornung, V. et al. 2005. Sequence-specific potent induction of
IFN-alpha by short interfering RNA in plasmacytoid dendritic cells
through TLR7. Nat Med 11: 263-270. [0625] (4) Kleinman, M. E. et
al. 2008. Sequence and target-independent angiogenesis suppression
by siRNA via TLR3. Nature 452:591-597. [0626] (5) Hornung, V. et
al. 2006. 5'-Triphosphate RNA is the ligand for RIG-I. Science 314:
994-997. [0627] (6) Marques, J. T. et al. 2006. A structural basis
for discriminating between self and nonself double-stranded RNAs in
mammalian cells. Nat Biotechnol 24: 559-565. [0628] (7) Krieg, A.
M. 2006. Therapeutic potential of Toll-like receptor 9 activation.
Nat Rev Drug Discov 5: 471-484. [0629] (8) von Marschall, Z. et al.
2003. Effects of interferon alpha on vascular endothelial growth
factor gene transcription and tumor angiogenesis. J Natl Cancer
Inst 95:437-448. [0630] (9) Lanuti, M. et al. 2000. Cationic
lipid:bacterial DNA complexes elicit adaptive cellular immunity in
murine intraperitoneal tumor models. Cancer Res 60: 2955-2963.
[0631] (10) Buhtoiarov, I. N., Lum, H. D., Berke, G., Sondel, P.
M., and Rakhmilevich, A. L. 2006. Synergistic activation of
macrophages via CD40 and TLR9 results in T cell independent
antitumor effects. J Immunol 176: 309-318. [0632] (11) Judge, A.,
and MacLachlan, I. 2008. Overcoming the innate immune response to
small interfering RNA. Hum Gene Ther 19: 111-124. [0633] (12)
Michie, H. R. et al. 1988. Detection of Circulating Tumor Necrosis
Factor after Endotoxin Administration. N. Engl. J. Med. 318:
1481-1486. [0634] (13) Stevenson, H. C. et al. 1985. A phase I
evaluation of poly(I,C)-LC in cancer patients. J Biol Response Mod.
4: 650-655. [0635] (14) Schlee, M., Barchet, W., Hornung, V., and
Hartmann, G. 2007. Beyond double-stranded RNA-type I IFN induction
by 3pRNA and other viral nucleic acids. Curr Top Microbiol Immunol
316: 207-230. [0636] (15) Poeck, H. et al. 2008.
5'-triphosphate-siRNA: turning gene silencing and Rig-I activation
against melanoma. Nat Med. 14: 1256-1263. [0637] (16) Manoharan, M.
2004. RNA interference and chemically modified small interfering
RNAs. Curr. Opin. Chem. Biol. 8: 570-579. [0638] (17) Morrissey, D.
V. et al. 2005. Potent and persistent in vivo anti-HBV activity of
chemically modified siRNAs. Nat Biotechnol 23: 1002-1007. [0639]
(18) Judge, A. D., Bola, G., Lee, A. C., and MacLachlan, I. 2006.
Design of non-inflammatory synthetic siRNA mediating potent gene
silencing in vivo. Mol Ther 13: 494-505. [0640] (19) Knight, S. D.,
and Parrish, C. A. 2008. Recent progress in the identification and
clinical evaluation of inhibitors of the mitotic kinesin KSP. Curr
Top Med Chem 8: 888-904. [0641] (20) Strebhardt, K., and Ullrich,
A. 2006. Targeting polo-like kinase 1 for cancer therapy. Nat Rev
Cancer 6: 321-330. [0642] (21) Tao, W. et al. 2005. Induction of
apoptosis by an inhibitor of the mitotic kinesin KSP requires both
activation of the spindle assembly checkpoint and mitotic slippage.
Cancer Cell 8: 49-59. [0643] (22) Barr, F. A., Sillje, H. H., and
Nigg, E. A. 2004. Polo-like kinases and the orchestration of cell
division. Nat Rev Mol Cell Biol 5:429-440. [0644] (23) Steegmaier,
M. et al. 2007. BI 2536, a potent and selective inhibitor of
polo-like kinase 1, inhibits tumor growth in vivo. Curr Biol 17:
316-322. [0645] (24) Liu, X., and Erikson, R. L. 2003. Polo-like
kinase (Plk)1 depletion induces apoptosis in cancer cells. Proc
Natl Acad Sci USA 100: 5789-5794. [0646] (25) Spankuch, B.,
Kurunci-Csacsko, E., Kaufmann, M., and Strebhardt, K. 2007.
Rational combinations of siRNAs targeting Plk1 with breast cancer
drugs. Oncogene 26: 5793-5807. [0647] (26) Zimmermann, T. S. et al.
2006. RNAi-mediated gene silencing in non-human primates. Nature
441: 111-114. [0648] (27) de Fougerolles, A., Vornlocher, H. P.,
Maraganore, J., and Lieberman, J. 2007. Interfering with disease: a
progress report on siRNA-based therapeutics. Nat Rev Drug Discov 6:
443-453. [0649] (28) Behlke, M. A. 2006. Progress towards in vivo
use of siRNAs. Mol Ther. 13: 644-670. [0650] (29) Urban-Klein, B.,
Werth, S., Abuharbeid, S., Czubayko, F., and Aigner, A. 2005.
RNAi-mediated gene-targeting through systemic application of
polyethylenimine (PEI)-complexed siRNA in vivo. Gene Ther. 12:
461-466. [0651] (30) Schiffelers R. M et al. 2004. Cancer siRNA
therapy by tumor selective delivery with ligand-targeted sterically
stabilized nanoparticle. Nucleic Acids Res. 32: e149. [0652] (31)
Heidel, J. D. et al. 2007. Administration in non-human primates of
escalating intravenous doses of targeted nanoparticles containing
ribonucleotide reductase subunit M2 siRNA. Proc Natl Acad Sci USA
104: 5715-5721. [0653] (32) Santel, A. et al. 2006. A novel
siRNA-lipoplex technology for RNA interference in the mouse
vascular endothelium. Gene Ther 13: 1222-1234. [0654] (33) Mayer,
L., Bally, M., Cullis, P., Wilson, S., and Emerman, J. 1990.
Comparison of free and liposome encapsulated doxorubicin tumor drug
uptake and anti-tumor efficacy in the SC115 murine mammary tumor.
Cancer Letters 53: 183-190. [0655] (34) Seymour, L. W. 1992.
Passive tumor targeting of soluble macromolecules and drug
conjugates. Crit Rev Ther Drug Carrier Syst 9: 135-187. [0656] (35)
Chono, S., Li, S. D., Conwell, C. C., and Huang, L. 2008. An
efficient and low immunostimulatory nanoparticle formulation for
systemic siRNA delivery to the tumor. J Control Release 131: 64-69.
[0657] (36) Peer, D., Park, E. J., Morishita, Y., Carman, C. V.,
and Shimaoka, M. 2008. Systemic leukocyte-directed siRNA delivery
revealing cyclin D1 as an anti-inflammatory target. Science 319:
627-630. [0658] (37) Robbins, M. et al. 2008. Misinterpreting the
therapeutic effects of siRNA caused by immune stimulation. Hum Gene
Ther. PMID 18713023. [0659] (38) Weil, D., Garcon, L., Harper, M.,
Dumenil, D., Dautry, F., and Kress, M. 2002. Targeting the kinesin
Eg5 to monitor siRNA transfection in mammalian cells. Biotechniques
33: 1244-1248. [0660] (39) Soutschek, J. et al. 2004. Therapeutic
silencing of an endogenous gene by systemic administration of
modified siRNAs. Nature 432: 173-178. [0661] (40) Elbashir, S. M.,
Lendeckel, W., and Tuschl, T. 2001. RNA interference is mediated by
21- and 22-nucleotide RNAs. Genes Dev. 15: 188-200. [0662] (41)
Matranga, C., Tomari, Y., Shin, C., Bartel, D. P., and Zamore, P.
D. 2005. Passenger-strand cleavage facilitates assembly of siRNA
into Agog-containing RNAi enzyme complexes. Cell 123: 607-620.
[0663] (42) Leuschner, P. J., Ameres, S. L., Kueng, S., and
Martinez, J. 2006. Cleavage of the siRNA passenger strand during
RISC assembly in human cells. EMBO Rep 7: 314-320. [0664] (43)
Prakash, T. et al. 2005. Positional effect of chemical
modifications on short interference RNA activity in mammalian
cells. J. Med. Chem. 48: 4247-4253. [0665] (44) Chiu, Y., and Rana,
T. 2003. siRNA function in RNAi: A chemical modification analysis.
RNA 9: 1034-1048. [0666] (45) Yao, X. et al. 2003. A novel
orthotopic tumor model to study growth factors and oncogenes in
hepatocarcinogenesis. Clin Cancer Res 9: 2719-2726. [0667] (46)
Sakowitz, R. et al. 2004. Antitumor activity of kinesin inhibitor.
Cancer Research 64: 3276-3280. [0668] (47) Lenart, P. et al. 2007.
The small-molecule inhibitor BI 2536 reveals novel insights into
mitotic roles of polo-like kinase 1. Curr Biol 17: 304-315. [0669]
(48) Spankuch-Schmitt, B., Bereiter-Hahn, J., Kaufmann, M., and
Strebhardt, K. 2002. Effect of RNA silencing of polo-like kinase-1
(PLK1) on apoptosis and spindle formation in human cancer cells. J
Natl Cancer Inst 94: 1863-1877. [0670] (49) Ambegia, E. et al.
2005. Stabilized plasmid-lipid particles containing
PEG-diacylglycerols exhibit extended circulation lifetimes and
tumor selective gene expression. Biochimica et Biophysica Acta
1669: 155-163. [0671] (50) Heyes, J., Hall, K., Tailor, V., Lenz,
R., and MacLachlan, I. 2006. Synthesis and characterisation of
novel poly(ethylene glycol)-lipid conjugates suitable for use in
drug delivery. Journal of Controlled Release 112: 280-290. [0672]
(51) Krieg, A. M. 2002. CpG motifs in bacterial DNA and their
immune effects. Annu. Rev. Immunol. 20: 709-760. [0673] (52)
Castro, J. E. et al. 2006. Thymidine-phosphorothioate
oligonucleotides induce activation and apoptosis of CLL cells
independently of CpG motifs or BCL-2 gene interference. Leukemia
20: 680-688. [0674] (53) Diebold, S. S. et al. 2006. Nucleic acid
agonists for Toll-like receptor 7 are defined by the presence of
uridine ribonucleotides. Eur J Immunol 36: 3256-3267. [0675] (54)
Der, S. D., Zhou, A., Williams, B. R., and Silverman, R. H. 1998.
Identification of genes differentially regulated by interferon
alpha, beta, or gamma using oligonucleotide arrays. Proc Natl Acad
Sci USA 95: 15623-15628. [0676] (55) Geiss, G. et al. 2001. A
comprehensive view of regulation of gene expression by
double-stranded RNA-mediated cell signaling. J Biol Chem 276:
30178-30182. [0677] (56) Sarkar, S. N., Smith, H. L., Rowe, T. M.,
and Sen, G. C. 2003. Double-stranded RNA signaling by Toll-like
receptor 3 requires specific tyrosine residues in its cytoplasmic
domain. J Biol Chem 278: 4393-4396. [0678] (57) Czauderna, F. et
al. 2003. Structural variations and stabilising modifications of
synthetic siRNAs in mammalian cells. Nucl. Acids Res. 31:
2705-2716. [0679] (58) Santel, A. et al. 2006. RNA interference in
the mouse vascular endothelium by systemic administration of
siRNA-lipoplexes for cancer therapy. Gene Ther 13: 1360-1370.
[0680] (59) Johnson, E. F., Stewart, K. D., Woods, K. W., Giranda,
V. L., and Luo, Y. 2007. Pharmacological and functional comparison
of the polo-like kinase family: insight into inhibitor and
substrate specificity. Biochemistry 46: 9551-9563. [0681] (60)
Malumbres, M., and Barbacid, M. 2007. Cell cycle kinases in cancer.
Curr Opin Genet Dev 17: 60-65. [0682] (61) McInnes, C. et al. 2006.
Inhibitors of Polo-like kinase reveal roles in spindle-pole
maintenance. Nat Chem Biol 2: 608-617. [0683] (62) Bartlett, D. W.,
and Davis, M. E. 2006. Insights into the kinetics of siRNA-mediated
gene silencing from live-cell and live-animal bioluminescent
imaging. Nucleic Acids Res 34: 322-333. [0684] (63) Llovet, J. M.,
and Bruix, J. 2008. Novel advancements in the management of
hepatocellular carcinoma in 2008. J Hepatol 48 Suppl 1:S20-37.
[0685] (64) Schwarz, D. S. et al. 2003. Asymetry in the assembly of
the RNAi enzyme complex. Cell 115: 119-208. [0686] (65) Gilliet, M.
et al. 2002. The development of murine plasmacytoid dendritic cell
precursors is differentially regulated by FLT3-ligand and
granulocyte/macrophage colony-stimulating factor. J Exp Med 195:
953-958.
Example 16
Synthesis of Cholesteryl-2'-Hydroxyethyl Ether
[0687] Step 1:
[0688] A 250 ml round bottom flask containing cholesterol (5.0 g,
12.9 mmol) and a stir bar was sealed and flushed with nitrogen.
Toluenesulphonyl chloride (5.0 g, 26.2 mmol) was weighed into a
separate 100-mL round bottom flask, also sealed and flushed with
nitrogen. Anhydrous pyridine (2.times.50 ml) was delivered to each
flask. The toluenesulphonyl chloride solution was then transferred,
via cannula, into the 250 ml flask, and the reaction stirred
overnight. The pyridine was removed by rotovap, and methanol (80
ml) added to the residue. This was then stirred for 1 hour until a
homogeneous suspension was obtained. The suspension was filtered,
washed with acetonitrile (50 ml), and dried under vacuum to yield
cholesteryl tosylate as a fluffy white solid (6.0 g, 86%).
[0689] Step 2:
[0690] Cholesteryl tosylate (2.0 g, 3.7 mmol), 1,4-dioxane (50 mL),
and ethylene glycol (4.6 g, 74 mmol) were added to a 100 ml flask
containing a stir bar. The flask was fitted with a condenser, and
refluxed overnight. The dioxane was then removed by rotovap, and
the reaction mixture suspended in water (100 ml). The solution was
transferred to a separating funnel and extracted with chloroform
(3.times.100 ml). The organic phases were combined, washed with
water (2.times.150 ml), dried over magnesium sulphate, and the
solvent removed. The crude product was purified by column
chromatography (5% acetone/hexane) to yield the product as a white
solid (1.1 g, 69%).
[0691] The structures of the cholesterol derivatives
cholesteryl-2'-hydroxyethyl ether and cholesteryl-4'-hydroxybutyl
ether are as follows:
##STR00007##
Example 17
Exemplary aiRNA Molecules Targeting PLK-1
[0692] Table 8 provides non-limiting examples of aiRNA molecules
that are suitable for modulating (e.g., silencing) PLK-1
expression. The first set of aiRNA molecules comprises the PLK1424
siRNA antisense strand sequence (SEQ ID NO:2). The second set of
aiRNA molecules comprises the PLK773 siRNA antisense strand
sequence (SEQ ID NO:4).
[0693] The 5' antisense overhang may contain one, two, three, four,
or more nontargeting nucleotides (e.g., "AA", "UU", "dTdT", etc.).
Preferably, the 5' antisense overhang contains two nontargeting
nucleotides. The 3' antisense overhang may contain one, two, three,
four, or more nontargeting nucleotides. The aiRNA molecules may
comprise one or more modified nucleotides, e.g., in the
double-stranded (duplex) region and/or in the antisense overhangs.
Examples of modified nucleotides are described herein and include
2'-O-methyl (2'OMe) nucleotides, T-deoxy-2'-fluoro (TF)
nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE)
nucleotides, and locked nucleic acid (LNA) nucleotides. The aiRNA
molecules may further comprise one of the carrier systems described
herein (e.g., a nucleic acid particle) and find utility in treating
cancers such as liver cancer (e.g., hepatocellular carcinoma).
TABLE-US-00018 TABLE 8 aiRNA duplexes comprising sense and
antisense PLK-1 RNA polynucleotides. aiRNA PLK-1 aiRNA Sequence
PLK1424 (12 bp/1) 5'-CCCUCCUUAAAU-3' (SEQ ID NO: 287)
3'-UCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 2) PLK1424 (12 bp/2)
5'-ACCCUCCUUAAA-3' (SEQ ID NO: 288) 3'-UCUAGUGGGAGGAAUUUAU-5' (SEQ
ID NO: 2) PLK1424 (12 bp/3) 5'-CACCCUCCUUAA-3' (SEQ ID NO: 289)
3'-UCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 2) PLK1424 (13 bp/1)
5'-ACCCUCCUUAAAU-3' (SEQ ID NO: 290) 3'-UCUAGUGGGAGGAAUUUAU-5' (SEQ
ID NO: 2) PLK1424 (13 bp/2) 5'-CACCCUCCUUAAA-3' (SEQ ID NO: 291)
3'-UCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 2) PLK1424 (13 bp/3)
5'-UCACCCUCCUUAA-3' (SEQ ID NO: 292) 3'-UCUAGUGGGAGGAAUUUAU-5' (SEQ
ID NO: 2) PLK1424 (14 bp/1) 5'-CACCCUCCUUAAAU-3' (SEQ ID NO: 293)
3'-UCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 2) PLK1424 (14 bp/2)
5'-UCACCCUCCUUAAA-3' (SEQ ID NO: 294) 3'-UCUAGUGGGAGGAAUUUAU-5'
(SEQ ID NO: 2) PLK1424 (14 bp/3) 5'-AUCACCCUCCUUAA-3' (SEQ ID NO:
295) 3'-UCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 2) PLK1424 (15 bp/1)
5'-UCACCCUCCUUAAAU-3' (SEQ ID NO: 296) 3'-UCUAGUGGGAGGAAUUUAU-5'
(SEQ ID NO: 2) PLK1424 (15 bp/2) 5'-AUCACCCUCCUUAAA-3' (SEQ ID NO:
297) 3'-UCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 2) PLK1424 (15 bp/3)
5'-GAUCACCCUCCUUAA-3' (SEQ ID NO: 298) 3'-UCUAGUGGGAGGAAUUUAU-5'
(SEQ ID NO: 2) PLK1424 (16 bp/1) 5'-AUCACCCUCCUUAAAU-3' (SEQ ID NO:
299) 3'-UCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 2) PLK1424 (16 bp/2)
5'-GAUCACCCUCCUUAAA-3' (SEQ ID NO: 300) 3'-UCUAGUGGGAGGAAUUUAU-5'
(SEQ ID NO: 2) PLK1424 (17 bp) 5'-GAUCACCCUCCUUAAAU-3' (SEQ ID NO:
301) 3'-UCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 2) PLK773 (12 bp/1)
5'-ACCUCCGGAUCA-3' (SEQ ID NO: 302) 3'-UCUGGAUGGAGGCCUAGUU-5' (SEQ
ID NO: 4) PLK773 (12 bp/2) 5'-UACCUCCGGAUC-3' (SEQ ID NO: 303)
3'-UCUGGAUGGAGGCCUAGUU-5' (SEQ ID NO: 4) PLK773 (12 bp/3)
5'-CUACCUCCGGAU-3' (SEQ ID NO: 304) 3'-UCUGGAUGGAGGCCUAGUU-5' (SEQ
ID NO: 4) PLK773 (13 bp/1) 5'-UACCUCCGGAUCA-3' (SEQ ID NO: 305)
3'-UCUGGAUGGAGGCCUAGUU-5' (SEQ ID NO: 4) PLK773 (13 bp/2)
5'-CUACCUCCGGAUC-3' (SEQ ID NO: 306) 3'-UCUGGAUGGAGGCCUAGUU-5' (SEQ
ID NO: 4) PLK773 (13 bp/3) 5'-CCUACCUCCGGAU-3' (SEQ ID NO: 307)
3'-UCUGGAUGGAGGCCUAGUU-5' (SEQ ID NO: 4) PLK773 (14 bp/1)
5'-CUACCUCCGGAUCA-3' (SEQ ID NO: 308) 3'-UCUGGAUGGAGGCCUAGUU-5'
(SEQ ID NO: 4) PLK773 (14 bp/2) 5'-CCUACCUCCGGAUC-3' (SEQ ID NO:
309) 3'-UCUGGAUGGAGGCCUAGUU-5' (SEQ ID NO: 4) PLK773 (14 bp/3)
5'-ACCUACCUCCGGAU-3' (SEQ ID NO: 310) 3'-UCUGGAUGGAGGCCUAGUU-5'
(SEQ ID NO: 4) PLK773 (15 bp/1) 5'-CCUACCUCCGGAUCA-3' (SEQ ID NO:
311) 3'-UCUGGAUGGAGGCCUAGUU-5' (SEQ ID NO: 4) PLK773 (15 bp/2)
5'-ACCUACCUCCGGAUC-3' (SEQ ID NO: 312) 3'-UCUGGAUGGAGGCCUAGUU-5'
(SEQ ID NO: 4) PLK773 (15 bp/3) 5'-GACCUACCUCCGGAU-3' (SEQ ID NO:
313) 3'-UCUGGAUGGAGGCCUAGUU-5' (SEQ ID NO: 4) PLK773 (16 bp/1)
5'-ACCUACCUCCGGAUCA-3' (SEQ ID NO: 314) 3'-UCUGGAUGGAGGCCUAGUU-5'
(SEQ ID NO: 4) PLK773 (16 bp/2) 5'-GACCUACCUCCGGAUC-3' (SEQ ID NO:
315) 3'-UCUGGAUGGAGGCCUAGUU-5' (SEQ ID NO: 4) PLK773 (17 bp)
5'-GACCUACCUCCGGAUCA-3' (SEQ ID NO: 316) 3'-UCUGGAUGGAGGCCUAGUU-5'
(SEQ ID NO: 4)
Example 18
Exemplary miRNA Molecules Targeting PLK-1
[0694] Table 9 provides non-limiting examples of miRNA molecules
that are suitable for modulating (e.g., silencing) PLK-1
expression. The miRNA molecules described herein may comprise one
or more modified nucleotides. Examples of modified nucleotides are
described herein and include 2'-O-methyl (2'OMe) nucleotides,
2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy nucleotides,
2'-O-(2-methoxyethyl) (MOE) nucleotides, and locked nucleic acid
(LNA) nucleotides. The 5' and/or 3' ends of the miRNA sequence may
contain one, two, three, four, or more nontargeting nucleotides. In
certain instances, a fragment of one of the miRNA sequences set
forth in Table 9 may be used for modulating (e.g., silencing) PLK-1
expression. In certain other instances, an agent that blocks the
interaction between one or more of the miRNA molecules set forth in
Table 9 and their target PLK-1 mRNA sequence(s) may be used for
modulating (e.g., silencing) PLK-1 expression. The miRNA molecules
or blocking agents thereof may further comprise one of the carrier
systems described herein (e.g., a nucleic acid particle) and find
utility in treating cancers such as hepatocellular carcinoma.
[0695] Unmodified or modified pre-miRNA sequences corresponding to
any of the mature miRNA sequences listed in Table 9 are also
suitable for use in the present invention, e.g., to modulate (e.g.,
silence) PLK-1 expression. The pre-miRNA molecule may further
comprise one of the carrier systems described herein (e.g., a
nucleic acid particle) and find utility in treating cancers such as
liver cancer (e.g., hepatocellular carcinoma).
TABLE-US-00019 TABLE 9 miRNA sequences that target human PLK-1
expression. Mature Pre-miRNA Mature miRNA Mature miRNA Mature miRNA
miRNA Accession Name Accession No. Sequence (5' .fwdarw. 3') SEQ ID
NO: No. hsa-miR-509-3-5p MIMAT0004975 UACUGCAGACGUGGCAAUCAUG 317
MI0005717 mmu-miR-705 MIMAT0003495 GGUGGGAGGUGGGGUGGGCA 318
MI0004689 hsa-miR-509-5p MIMAT0004779 UACUGCAGACAGUGGCAAUCA 319
MI0003196 hsa-miR-505* MIMAT0004776 GGGAGCCAGGAAGUAUUGAUGU 320
MI0003190 mmu-miR-762 MIMAT0003892 GGGGCUGGGGCCGGGACAGAGC 321
MI0004215 hsa-miR-149* MIMAT0004609 AGGGAGGGACGGGGGCUGUGC 322
MI0000478 hsa-miR-183 MIMAT0000261 UAUGGCACUGGUAGAAUUCACU 323
MI0000273 hsa-miR-9* M1MAT0000442 AUAAAGCUAGAUAACCGAAAGU 324
MI0000466 mmu-miR-673-3p MIMAT0004824 UCCGGGGCUGAGUUCUGUGCACC 325
MI0004601 hsa-miR-630 MIMAT0003299 AGUAUUCUGUACCAGGGAAGGU 326
MI0003644 hsa-miR-491-3p MIMAT0004765 CUUAUGCAAGAUUCCCUUCUAC 327
MI0003126 hsa-miR-559 MIMAT0003223 UAAAGUAAAUAUGCACCAAAA 328
MI0003565 hsa-miR-593* MIMAT0003261 AGGCACCAGCCAGGCAUUGCUCAGC 329
MI0003605 mmu-miR-327 MIMAT0004867 ACUUGAGGGGCAUGAGGAU 330
MI0005493 hsa-let-7f-2* MIMAT0004487 CUAUACAGUCUACUGUCUUUCC 331
MI0000068 hsa-miR-100 MIMAT0000098 AACCCGUAGAUCCGAACUUGUG 332
MI0000102 hsa-miR-767-3p MIMAT0003883 UCUGCUCAUACCCCAUGGUUUCU 333
MI0003763 hsa-miR-532-3p MIMAT0004780 CCUCCCACACCCAAGGCUUGCA 334
MI0003205 hsa-miR-106b* MIMAT0004672 CCGCACUGUGGGUACUUGCUGC 335
MI0000734 hsa-miR-568 MIMAT0003232 AUGUAUAAAUGUAUACACAC 336
MI0003574 hsa-miR-652 MIMAT0003322 AAUGGCGCCACUAGGGUUGUG 337
MI0003667 hsa-let-7e* MIMAT0004485 CUAUACGGCCUCCUAGCUUUCC 338
MI0000066 hsa-miR-340 MIMAT0004692 UUAUAAAGCAAUGAGACUGAUU 339
MI0000802 hsa-miR-198 MIMAT0000228 GGUCCAGAGGGGAGAUAGGUUC 340
MI0000240 hsa-miR-548b-5p MIMAT0004798 AAAAGUAAUUGUGGUUUUGGCC 341
MI0003596 hsa-miR-452* MIMAT0001636 CUCAUCUGCAAAGAAGUAAGUG 342
MI0001733 hsa-miR-148b* MIMAT0004699 AAGUUCUGUUAUACACUCAGGC 343
MI0000811 hsa-let-7g* MIMAT0004584 CUGUACAGGCCACUGCCUUGC 344
MI0000433 hsa-miR-488 MIMAT0004763 UUGAAAGGCUAUUUCUUGGUC 345
MI0003123 mmu-miR-693-5p MIMAT0003472 CAGCCACAUCCGAAAGUUUUC 346
MI0004662 hsa-miR-136 MIMAT0000448 ACUCCAUUUGUUUUGAUGAUGGA 347
MI0000475 hsa-miR-744 MIMAT0004945 UGCGGGGCUAGGGCUAACAGCA 348
MI0005559 hsa-miR-324-3p MIMAT0000762 ACUGCCCCAGGUGCUGCUGG 349
MI0000813 hsa-miR-320 MIMAT0000510 AAAAGCUGGGUUGAGAGGGCGA 350
MI0000542 hsa-miR-99a MIMAT0000097 AACCCGUAGAUCCGAUCUUGUG 351
MI0000101 hsa-miR-590-5p MIMAT0003258 GAGCUUAUUCAUAAAAGUGCAG 352
MI0003602 hsa-miR-622 MIMAT0003291 ACAGUCUGCUGAGGUUGGAGC 353
MI0003636 hsa-miR-151-5p MIMAT0004697 UCGAGGAGCUCACAGUCUAGU 354
MI0000809 hsa-miR-142-5p MIMAT0000433 CAUAAAGUAGAAAGCACUACU 355
MI0000458 hsa-miR-648 MIMAT0003318 AAGUGUGCAGGGCACUGGU 356
MI0003663 hsa-miR-643 MIMAT0003313 ACUUGUAUGCUAGCUCAGGUAG 357
MI0003658 hsa-miR-19a* MIMAT0004490 AGUUUUGCAUAGUUGCACUACA 358
MI0000073 hsa-miR-516b MIMAT0002859 AUCUGGAGGUAAGAAGCACUUU 359
MI0003172 hsa-miR-296-5p MIMAT0000690 AGGGCCCCCCCUCAAUCCUGU 360
MI0000747 hsa-miR-619 MIMAT0003288 GACCUGGACAUGUUUGUGCCCAGU 361
MI0003633 mmu-miR-742 MIMAT0004237 GAAAGCCACCAUGCUGGGUAAA 362
MI0005206 hsa-miR-147b MIMAT0004928 GUGUGCGGAAAUGCUUCUGCUA 363
MI0005544 mmu-miR-466h MIMAT0004884 UGUGUGCAUGUGCUUGUGUGUA 364
MI0005511 mmu-miR-700 MIMAT0003490 CACGCGGGAACCGAGUCCACC 365
MI0004684 hsa-miR-941 MIMAT0004984 CACCCGGCUGUGUGCACAUGUGC 366
MI0005763 hsa-miR-21 MIMAT0000076 UAGCUUAUCAGACUGAUGUUGA 367
MI0000077 mmu-miR-666-5p MIMAT0003737 AGCGGGCACAGCUGUGAGAGCC 368
MI0004553 hsa-miR-17* MIMAT0000071 ACUGCAGUGAAGGCACUUGUAG 369
MI0000071 hsa-miR-188-3p MIMAT0004613 CUCCCACAUGCAGGGUUUGCA 370
MI0000484 hsa-miR-520d-5p MIMAT0002855 CUACAAAGGGAAGCCCUUUC 371
MI0003164 hsa-miR-19a MIMAT0000073 UGUGCAAAUCUAUGCAAAACUGA 372
MI0000073 hsa-miR-153 MIMAT0000439 UUGCAUAGUCACAAAAGUGAUC 373
MI0000463 hsa-miR-554 MIMAT0003217 GCUAGUCCUGACUCAGCCAGU 374
MI0003559 hsa-miR-610 MIMAT0003278 UGAGCUAAAUGUGUGCUGGGA 375
MI0003623 hsa-miR-454 MIMAT0003885 UAGUGCAAUAUUGCUUAUAGGGU 376
MI0003820 hsa-miR-10b* MIMAT0004556 ACAGAUUCGAUUCUAGGGGAAU 377
MI0000267 hsa-miR-654-5p MIMAT0003330 UGGUGGGCCGCAGAACAUGUGC 378
MI0003676 mmu-miR-466f-5p MIMAT0004881 UACGUGUGUGUGCAUGUGCAUG 379
MI0005507 hsa-miR-210 MIMAT0000267 CUGUGCGUGUGACAGCGGCUGA 380
MI0000286 hsa-miR-603 MIMAT0003271 CACACACUGCAAUUACUUUUGC 381
MI0003616 hsa-miR-216b MIMAT0004959 AAAUCUCUGCAGGCAAAUGUGA 382
MI0005569 minu-miR-704 M1MAT0003494 AGACAUGUGCUCUGCUCCUAG 383
MI0004688 hsa-miR-331-5p MIMAT0004700 CUAGGUAUGGUCCCAGGGAUCC 384
MI0000812 mmu-miR-434-3p MIMAT0001422 UUUGAACCAUCACUCGACUCCU 385
MI0001526 hsa-miR-589 MIMAT0004799 UGAGAACCACGUCUGCUCUGAG 386
MI0003599 hsa-miR-548b-3p MIMAT0003254 CAAGAACCUCAGUUGCUUUUGU 387
MI0003596 hsa-miR-10a* MIMAT0004555 CAAAUUCGUAUCUAGGGGAAUA 388
MI0000266 hsa-miR-604 MIMAT0003272 AGGCUGCGGAAUUCAGGAC 389
MI0003617 hsa-miR-485-3p MIMAT0002176 GUCAUACACGGCUCUCCUCUCU 390
MI0002469 mmu-miR-883b-3p MIMAT0004851 UAACUGCAACAUCUCUCAGUAU 391
MI0005477 hsa-miR-329 MIMAT0001629 AACACACCUGGUUAACCUCUUU 392
MI0001725 hsa-miR-585 MIMAT0003250 UGGGCGUAUCUGUAUGCUA 393
MI0003592 hsa-miR-55 lb MIMAT0003233 GCGACCCAUACUUGGUUUCAG 394
MI0003575 hsa-miR-886-3p MIMAT0004906 CGCGGGUGCUUACUGACCCUU 395
MI0005527 mmu-miR-714 MIMAT0003505 CGACGAGGGCCGGUCGGUCGC 396
MI0004699 mmu-miR-293 MIMAT0000371 AGUGCCGCAGAGUUUGUAGUGU 397
MI0000391 hsa-miR-95 MIMAT0000094 UUCAACGGGUAUUUAUUGAGCA 398
MI0000097 hsa-miR-99b MIMAT0000689 CACCCGUAGAACCGACCUUGCG 399
MI0000746 The Accession Nos. for the mature miRNA and pre-miRNA
sequences correspond to entries that can be found in the miRBase
Sequence Database from the Sanger Institute. The miRBase Sequence
Database is a searchable database of published miRNA sequences and
annotation.
Example 19
Additional Modified PLK-1 siRNAs are Non-Immunostimulatory and
Inhibit the Growth of Cancer Cells
[0696] PLK-1 siRNA molecules containing 2'-O-methyl (2'OMe)
nucleotides at selective positions on the sense and antisense
strands of the siRNA were formulated as SNALP and evaluated for
their inhibitory effects on cell growth in vitro. The modified
PLK-1 siRNA sense and antisense strand sequences are shown in Table
10. Exemplary double-stranded modified PLK-1 siRNA molecules
generated from the sequences of Table 10 are shown in Table 11.
TABLE-US-00020 TABLE 10 Modified PLK-1 sense and antisense strand
siRNA sequences. SEQ ID siRNA 5' .fwdarw. 3' Sequence Strand NO:
PLK1424-1 AGAUCACCCUCCUUAAAUAUU Sense 214 PLK1424-2
AGAUCACCCUCCUUAAAUAUU Sense 400 PLK1424-3 UAUUUAAGGAGGGUGAUCUUU
Antisense 215 PLK1424-4 UAUUUAAGGAGGGUGAUCUUC Antisense 401
PLK1424-5 UAUUUAAGGAGGGUGAUCUUC Antisense 402 PLK1424-6
UAUUUAAGGAGGGUGAUCUUC Antisense 403 PLK1424-7 UAUUUAAGGAGGGUGAUCUUU
Antisense 216 PLK1424-8 UAUUUAAGGAGGGUGAUCUUU Antisense 404
PLK773-1 AGACCUACCUCCGGAUCAAUU Sense 220 PLK773-2
AGACCUACCUCCGGAUCAAGA Sense 405 PLK773-3 UUGAUCCGGAGGUAGGUCUUU
Antisense 223 PLK773-4 UUGAUCCGGAGGUAGGUCUCU Antisense 406 PLK773-5
UUGAUCCGGAGGUAGGUCUCU Antisense 407 Column 1: The number after
''PLK'' refers to the nucleotide position of the 5' base of the
sense strand relative to the start codon (ATG) of the human PLK-1
mRNA sequence NM_005030. Column 2: 2'-O-methyl (2'OMe) nucleotides
are indicated in bold and underlined. The siRNA can alternatively
or additionally comprise 2'-deoxy-2'-fluoro (2'F) nucleotides,
2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE) nucleotides,
and/or locked nucleic acid (LNA) nucleotides.
TABLE-US-00021 TABLE 11 PLK-1 siRNA molecules comprising modified
sense and antisense strand sequences. % 2'OMe- % Modified siRNA
PLK-1 siRNA Sequence Modified in DS Region PLK1424 1/3
5'-AGAUCACCCUCCUUAAAUAUU-3' (SEQ ID NO: 214) 6/42 = 14.3% 6/38 =
15.8% 3'-UUUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 215) PLK1424 1/4
5'-AGAUCACCCUCCUUAAAUAUU-3' (SEQ ID NO: 214) 6/42 = 14.3% 6/38 =
15.8% 3'-CUUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 401) PLKI424 1/5
5'-AGAUCACCCUCCUUAAAUAUU-3' (SEQ ID NO: 214) 7/42 = 16.7% 6/38 =
15.8% 3'-CUUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 402) PLK1424 1/6
5'-AGAUCACCCUCCUUAAAUAUU-3' (SEQ ID NO: 214) 8/42 = 19% 7/38 =
18.4% 3'-CUUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 403) PLK1424 1/7
5'-AGAUCACCCUCCUUAAAUAUU-3' (SEQ ID NO: 214) 7/42 = 16.7% 7/38 =
18.4% 3'-UUUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 216) PLK1424 1/8
5'-AGAUCACCCUCCUUAAAUAUU-3' (SEQ ID NO: 214) 9/42 = 21.4% 9/38 =
23.7% 3'-UUUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 404) PLK1424 2/3
5'-AGAUCACCCUCCUUAAAUAUU-3' (SEQ ID NO: 400) 7/42 = 16.7% 6/38 =
15.8% 3'-UUUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 215) PLK1424 2/4
5'-AGAUCACCCUCCUUAAAUAUU-3' (SEQ ID NO: 400) 7/42 = 16.7% 6/38 =
15.8% 3'-CUUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 401) PLK1424 2/5
5'-AGAUCACCCUCCUUAAAUAUU-3' (SEQ ID NO: 400) 8/42 = 19% 6/38 =
15.8% 3'-CpUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 402) PLK1424 2/6
5'-AGAUCACCCUCCUUAAAUAUU-3' (SEQ ID NO: 400) 9/42 = 21.4% 7/38 =
18.4% 3'-CUUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 403) PLK1424 2/7
5'-AGAUCACCCUCCUUAAAUAUU-3' (SEQ ID NO: 400) 8/42 = 19% 7/38 =
18.4% 3'-UUUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 216) PLK 1424 2/8
5'-AGAUCACCCUCCUUAAAUAUU-3' (SEQ ID NO: 400) 10/42 = 23.8% 9/38 =
23.7% 3'-UUUCUAGUGGGAGGAAUUUAU-5' (SEQ ID NO: 404) Column 1: The
number after ''PLK'' refers to the nucleotide position of the 5'
base of the sense strand relative to the start codon (ATG) of the
human PLK-1 mRNA sequence NM_005030. Column 2: 2'-O-methyl (2'OMe)
nucleotides are indicated in bold and underlined. The siRNA duplex
can alternatively or additionally comprise 2'-deoxy-2'-fluoro (2'F)
nucleotides, 2'-deoxy nucleotides, 2'-O-(2-methoxyethyl) (MOE)
nucleotides, and/or locked nucleic acid (LNA) nucleotides. Column
3: The number and percentage of 2'OMe-modified nucleotides in the
siRNA molecule are provided. Column 4: The number and percentage of
modified nucleotides in the double-stranded (DS) region of the
siRNA molecule are provided.
[0697] Cell Viability Assays.
[0698] For in vitro PLK-1 siRNA activity assays, HT29 cells were
cultured in 96 well plates in the presence of SNALP formulated
PLK-1 siRNA. Cell viability analysis was performed at 72 hours
following transfection with a range of PLK-1 SNALP dosages. FIG. 40
shows that different chemical modification patterns in the PLK1424
siRNA sequence were well tolerated and the modified siRNA molecules
retained potent activity in killing human tumor cells.
[0699] In Vivo Immune Stimulation Assays.
[0700] Animal studies were performed to test for the
immunostimulatory activity of SNALP containing 2'OMe-modified
PLK1424 siRNAs. Six-week-old female CD1 ICR mice were used in this
study. Mice were administered SNALP formulated siRNA resuspended in
PBS via standard intravenous injection in the lateral tail vein and
then sacrificed 4 hours after SNALP administration. The
tolerability of the treatment regime was monitored by animal
appearance and behavior. Blood was collected by cardiac puncture
and processed as plasma for cytokine analysis of IFN-.alpha. and
IL-6 protein levels by ELISA. Liver and spleen from the same
animals were collected into RNALater (Sigma Co.) for IFIT1 mRNA
analysis by bDNA (QG) assay.
Test Articles
TABLE-US-00022 [0701] siRNA Treat End Data & Sample Group Test
Article siRNA n Lot dose day point collection A PBS N/A 4 N/A Day 0
4 h Body weights at B 1:57 PEG-cDMA PLK1424 1/3 4 390-062608-1 3
dosing C (28 mM) PLK1424 2/3 4 390-062608-2 mg/kg Terminal Plasma D
pH loaded PLK1424 2/4 4 390-062608-3 4 h after injection E PLK1424
2/5 4 390-062608-4 Half of left lateral F PLK1424 2/6 4
390-062608-5 lobe of liver into G BimA mod 2/3 4 390-062608-7
RNAlater and the H Empty 4 390-062608-8 whole spleen into
RNAlater.
[0702] FIG. 41 shows that modified PLK1424 siRNAs did not induce an
IFN-.alpha. response that was greater than the "PBS" and "Empty"
negative controls. Only the BimA siRNA positive control induced
IFN-.alpha. protein in plasma above the level of detection (15.6
pg/ml). FIG. 42 shows that there was no significant IFIT1 induction
above that of empty SNALP with PLK1424 1/3, PLK1424 2/3, PLK1424
2/4, and PLK1424 2/6 siRNAs. The IFIT1 QG analysis was more
sensitive than the IFN-.alpha. ELISA for measuring immunogenicity
because it resolved low-grade immune stimulation.
[0703] Subcutaneous Tumor Models.
[0704] Hep3B tumors were established in scid/beige mice by
subcutaneous injection of tumor cells into the left hind flank.
PLK1424 siRNA SNALP formulations were then administered by
intravenous injection as a 3 mg/kg single dose. The extent of PLK-1
mRNA knockdown was determined in the Hep3B tumors about 24 hours
after SNALP administration. FIG. 43 shows that all PLK1424 siRNAs
tested produced an equivalent level of PLK-1 mRNA silencing in
vivo.
[0705] In Vivo PEG-Lipid Antibody Induction Assays.
[0706] Animal studies were performed to test for the induction of
an antibody response to 2'OMe-modified PLK1424 siRNAs that were
encapsulated in a 1:57 SNALP formulation containing the lipid
conjugate PEG-cDMA. Six-week-old female CD1 ICR mice were used in
this study. Mice were administered SNALP formulated siRNA
resuspended in PBS via standard intravenous injection in the
lateral tail vein at Days 0, 7, and 14. Mice were then sacrificed
on Day 21. The tolerability of the treatment regime was monitored
by animal appearance, behavior, and body weight. Anti-PEG-lipid IgG
and IgM antibodies in plasma at Days 7, 14, and 21 were measured by
ELISA.
[0707] SNALP containing PLK1424 1/3 siRNA was substantially less
immunogenic than SNALP containing the corresponding unmodified
PLK1424 siRNA sequence. In particular, PLK1424 1/3 SNALP had a
significantly lower potential for generating an IgG or IgM antibody
response against the PEG-lipid conjugate PEG-cDMA. In addition,
SNALP containing either PLK1424 2/3, PLK1424 2/4, or PLK1424 2/6
siRNA produced almost no detectable antibody responses against the
PEG-lipid. In fact, PLK1424 2/6 SNALP consistently had the lowest
antibody response to PEG-cDMA out of all PLK-1 siRNA sequences
tested. As such, the present invention provides methods for
designing and optimizing PLK-1 siRNA sequences to substantially
reduce or abrogate the immunogenic properties of unmodified siRNA
sequences.
[0708] It is to be understood that the above description is
intended to be illustrative and not restrictive. Many embodiments
will be apparent to those of skill in the art upon reading the
above description. The scope of the invention should, therefore, be
determined not with reference to the above description, but should
instead be determined with reference to the appended claims, along
with the full scope of equivalents to which such claims are
entitled. The disclosures of all articles and references, including
patent applications, patents, PCT publications, and Genbank
Accession Nos., are incorporated herein by reference for all
purposes.
Sequence CWU 1
1
407119RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 1agaucacccu ccuuaaaua 19219RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 2uauuuaagga gggugaucu 19319RNAArtificial Sequencesynthetic
human polo-like kinase 1 (PLK-1) siRNA sense strand 3agaccuaccu
ccggaucaa 19419RNAArtificial Sequencesynthetic human polo-like
kinase 1 (PLK-1) siRNA antisense strand 4uugauccgga gguaggucu
19519RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 5gguccuagug gacccacgc 19619RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 6gcgugggucc acuaggacc 19719RNAArtificial Sequencesynthetic
human polo-like kinase 1 (PLK-1) siRNA sense strand 7cuccuggagc
ugcacaaga 19819RNAArtificial Sequencesynthetic human polo-like
kinase 1 (PLK-1) siRNA antisense strand 8ucuugugcag cuccaggag
19919RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 9guggaugugu gguccauug
191019RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 10caauggacca cacauccac
191119RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 11gagaccuacc uccggauca
191219RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 12ugauccggag guaggucuc
191319RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 13gccgccuccc ucauccaga
191419RNAArtificial Sequencehuman polo-like kinase 1 (PLK-1) siRNA
antisense strand 14ucuggaugag ggaggcggc 191519RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 15cucccucauc cagaagaug 191619RNAArtificial Sequencesynthetic
human polo-like kinase 1 (PLK-1) siRNA antisense strand
16caucuucugg augagggag 191719RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) siRNA sense strand 17ccagugguuc
gagagacag 191819RNAArtificial Sequencesynthetic human polo-like
kinase 1 (PLK-1) siRNA antisense strand 18cugucucucg aaccacugg
191919RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 19gaggcugagg auccugccu
192019RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 20aggcaggauc cucagccuc
192119RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 21gggucagcaa gugggugga
192219RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 22uccacccacu ugcugaccc
192319RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 23ucagcaagug gguggacua
192419RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 24uaguccaccc acuugcuga
192519RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 25cagcaagugg guggacuau
192619RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 26auaguccacc cacuugcug
192719RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 27gguggacuau ucggacaag
192819RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 28cuuguccgaa uaguccacc
192919RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 29gacagccugc aguacauag
193019RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 30cuauguacug caggcuguc
193119RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 31gcgccaucau ccugcaccu
193219RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 32aggugcagga ugauggcgc
193319RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA sense strand 33cccaucccaa uuccuugau
193419RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA antisense strand 34aucaaggaau ugggauggg
193519RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA sense strand 35agaucacucu ccucaacua
193619RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA antisense strand 36uaguugagga gagugaucu
193719RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA sense strand 37gaucacucuc cucaacuau
193819RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA antisense strand 38auaguugagg agagugauc
193919RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA sense strand 39cacucuccuc aacuauuuc
194019RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA antisense strand 40gaaauaguug aggagagug
194119RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA sense strand 41ccucaacuau uuccgcaau
194219RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA antisense strand 42auugcggaaa uaguugagg
194319RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA sense strand 43aggaccacac caaacuuau
194419RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA antisense strand 44auaaguuugg ugugguccu
194519RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA sense strand 45ggaccacacc aaacuuauc
194619RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA antisense strand 46gauaaguuug guguggucc
194719RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA sense strand 47gaccuacauc aacgagaag
194819RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA antisense strand 48cuucucguug auguagguc
194919RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA sense strand 49gagggacuuc caaacguac
195019RNAArtificial Sequencesynthetic mouse polo-like kinase 1
(PLK-1) siRNA antisense strand 50guacguuugg aagucccuc
195121RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 51agaucacccu ccuuaaauan n
215221RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 52uauuuaagga gggugaucun n
215321RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA sense strand 53agancacccn ccunaaauan n
215421RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA antisense strand 54uauuuaanga gggugancun n
215521RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA antisense strand 55uauunaagga nggngancun n
215621RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA antisense strand 56uauuuaagna gngunaucun n
215721RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA sense strand 57agancacccn ccunaaanan n
215821RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 58agaccuaccu ccggaucaan n
215921RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 59uugauccgga gguaggucun n
216021RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA sense strand 60agaccnaccn ccggancaan n
216121RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA antisense strand 61uuganccgga ggnaggncun n
216221RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA antisense strand 62uuganccnga nguagnucun n
216321RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA antisense strand 63uugauccgna gnuaggncun n
216421RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA sense strand 64anaccuaccu ccngaucaan n
216521RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 65gaucacccuc cuuaaauaun n
216621RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 66auauuuaagg agggugaucn n
216721RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA sense strand 67gancacccuc cunaaanaun n
216821RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA antisense strand 68auauuuaang agggugancn n
216921RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA antisense strand 69auauuuaagn agngunaucn n
217021RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA antisense strand 70auauunaagg anggngancn n
217121RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA antisense strand 71auaunuaang agggunancn n
217221RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) modified siRNA sense strand 72gancacccnc cunaaanaun n
217319RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 73ggucugcagc gcagcuucg
197419RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 74cgaagcugcg cugcagacc
197519RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 75gcgcagcuuc gggagcaug
197619RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 76caugcucccg aagcugcgc
197719RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 77agccgcacca gagggagaa
197819RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 78uucucccucu ggugcggcu
197919RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 79gccgcaccag agggagaag
198019RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 80cuucucccuc uggugcggc
198119RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 81gaagaugucc auggaaaua
198219RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 82uauuuccaug gacaucuuc
198319RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 83ggacaacgac uucguguuc
198419RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 84gaacacgaag ucguugucc
198519RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 85gcugcacaag aggaggaaa
198619RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 86uuuccuccuc uugugcagc
198719RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 87gaggaggaaa gcccugacu
198819RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 88agucagggcu uuccuccuc
198919RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 89ggaggaaagc ccugacuga
199019RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 90ucagucaggg cuuuccucc
199119RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 91agcccugacu gagccugag
199219RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 92cucaggcuca gucagggcu
199319RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 93gcccugacug agccugagg
199419RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 94ccucaggcuc agucagggc
199519RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 95gccugaggcc cgauacuac
199619RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 96guaguaucgg gccucaggc
199719RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 97ggcccgauac uaccuacgg
199819RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 98ccguagguag uaucgggcc
199919RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 99ccugcaccga aaccgaguu
1910019RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 100aacucgguuu cggugcagg
1910119RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 101ccgaaaccga guuauucau
1910219RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 102augaauaacu cgguuucgg
1910319RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 103cuggcaacca aagucgaau
1910419RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 104auucgacuuu gguugccag
1910519RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 105gaggaagaag acccugugu
1910619RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 106acacaggguc uucuuccuc
1910719RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 107gacccugugu gggacuccu
1910819RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 108aggaguccca cacaggguc
1910919RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 109cccugugugg gacuccuaa
1911019RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 110uuaggagucc cacacaggg
1911119RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 111ggugcugagc aagaaaggg
1911219RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 112cccuuucuug cucagcacc
1911319RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 113gguggaugug ugguccauu
1911419RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 114aauggaccac acauccacc
1911519RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 115uuggguguau cauguauac
1911619RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 116guauacauga uacacccaa
1911719RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 117gugggcaaac caccuuuug
1911819RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 118caaaaggugg uuugcccac
1911919RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 119accaccuuuu gagacuucu
1912019RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 120agaagucuca aaagguggu
1912119RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 121ccaccuuuug agacuucuu
1912219RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 122aagaagucuc aaaaggugg
1912319RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 123gaccuaccuc cggaucaag
1912419RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA antisense strand 124cuugauccgg agguagguc
1912519RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 125ccuaccuccg gaucaagaa
1912619RNAArtificial Sequencehuman polo-like kinase 1 (PLK-1) siRNA
antisense strand 126uucuugaucc ggagguagg 1912719RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 127ccuccggauc aagaagaau 1912819RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 128auucuucuug auccggagg 1912919RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 129ccauuaacga gcugcuuaa 1913019RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 130uuaagcagcu cguuaaugg 1913119RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 131gcugcuuaau gacgaguuc 1913219RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 132gaacucguca uuaagcagc 1913319RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 133ugacgaguuc uuuacuucu 1913419RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 134agaaguaaag aacucguca 1913519RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 135guccucaaua aaggcuugg 1913619RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 136ccaagccuuu auugaggac 1913719RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 137gcagcugcac agugucaau 1913819RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 138auugacacug ugcagcugc 1913919RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 139gcaagugggu ggacuauuc 1914019RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 140gaauagucca cccacuugc 1914119RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 141cacgccucau ccucuacaa 1914219RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 142uuguagagga ugaggcgug 1914319RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 143cgccucaucc ucuacaaug 1914419RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 144cauuguagag gaugaggcg 1914519RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 145cagccugcag uacauagag 1914619RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 146cucuauguac ugcaggcug 1914719RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 147gagcgugacg gcacugagu 1914819RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 148acucagugcc gucacgcuc 1914919RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 149ucccaacucc uugaugaag 1915019RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 150cuucaucaag gaguuggga 1915119RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 151acuccuugau gaagaagau 1915219RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 152aucuucuuca ucaaggagu 1915319RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 153gaagaucacc cuccuuaaa 1915419RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 154uuuaaggagg gugaucuuc 1915519RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 155cccuccuuaa auauuuccg 1915619RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 156cggaaauauu uaaggaggg 1915719RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 157ugagcgagca cuugcugaa 1915819RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 158uucagcaagu gcucgcuca 1915919RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 159cccgcagcgc caucauccu 1916019RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 160aggaugaugg cgcugcggg 1916119RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 161gcaacggcag cgugcagau 1916219RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 162aucugcacgc ugccguugc 1916319RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 163acggcagcgu gcagaucaa 1916419RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 164uugaucugca cgcugccgu 1916519RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 165cggcagcgug cagaucaac 1916619RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 166guugaucugc acgcugccg 1916719RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 167gcgugcagau caacuucuu 1916819RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 168aagaaguuga ucugcacgc 1916919RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 169gcucaucuug ugcccacug 1917019RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 170cagugggcac aagaugagc 1917119RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 171uggcagccgu gaccuacau 1917219RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 172auguagguca cggcugcca 1917319RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 173gccgugaccu acaucgacg 1917419RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 174cgucgaugua ggucacggc 1917519RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 175ucgacgagaa gcgggacuu 1917619RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 176aagucccgcu ucucgucga 1917719RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 177agcgggacuu ccgcacaua 1917819RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 178uaugugcgga agucccgcu 1917919RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 179gcgggacuuc cgcacauac 1918019RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 180guaugugcgg aagucccgc 1918119RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 181ggaguacggc ugcugcaag 1918219RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 182cuugcagcag ccguacucc 1918319RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 183gcucacgcuc ggccagcaa 1918419RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 184uugcuggccg agcgugagc 1918519RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 185ccgucucaag gccuccuaa 1918619RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 186uuaggaggcc uugagacgg 1918719RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 187agaagauguc cauggaaau 1918819RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 188auuuccaugg acaucuucu 1918919RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 189gauacuaccu acggcaaau 1919019RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 190auuugccgua gguaguauc 1919119RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 191ugcaccgaaa ccgaguuau 1919219RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 192auaacucggu uucggugca 1919319RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 193ggcaaccaaa gucgaauau 1919419RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 194auauucgacu uugguugcc 1919519RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 195ccuguguggg acuccuaau 1919619RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 196auuaggaguc ccacacagg 1919719RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 197ugugugggac uccuaauua 1919819RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 198uaauuaggag ucccacaca 1919919RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 199cccucacagu ccucaauaa 1920019RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 200uuauugagga cugugaggg 1920119RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 201ccucacaguc cucaauaaa 1920219RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 202uuuauugagg acugugagg 1920319RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 203cucacagucc ucaauaaag 1920419RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 204cuuuauugag gacugugag 1920519RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1)
siRNA sense strand 205cgucucaagg ccuccuaau 1920619RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 206auuaggaggc cuugagacg 1920719RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 207gucucaaggc cuccuaaua 1920819RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 208uauuaggagg ccuugagac 1920919RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 209ucucaaggcc uccuaauag 1921019RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 210cuauuaggag gccuugaga 1921121RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 211agaucacccu ccuuaaauau u 2121221RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA antisense
strand 212uauuuaagga gggugaucuu u 2121321RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) modified siRNA
sense strand 213agancacccn ccunaaauau u 2121421RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) modified siRNA
sense strand 214agancacccn ccunaaanau u 2121521RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) modified siRNA
antisense strand 215uauuuaanga gggugancuu u 2121621RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) modified siRNA
antisense strand 216uauuuaagna gngunaucuu u 2121721RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) modified siRNA
antisense strand 217uauunaagga nggngancuu u 2121821RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
strand 218agaccuaccu ccggaucaau u 2121921RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) siRNA sense
antistrand 219uugauccgga gguaggucuu u 2122021RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) modified siRNA
sense strand 220anaccuaccu ccngaucaau u 2122121RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) modified siRNA
sense strand 221agaccnaccn ccggancaau u 2122221RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) modified siRNA
antisense strand 222uuganccgga ggnaggncuu u 2122321RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) modified siRNA
antisense strand 223uugauccgna gnuaggncuu u 2122421RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) modified siRNA
antisense strand 224uuganccnga nguagnucuu u 2122521DNAArtificial
Sequencesynthetic human kinesin spindle protein (KSP, Eg5) siRNA
sense strand 225cugaagaccu gaagacaaut t 2122621DNAArtificial
Sequencesynthetic human kinesin spindle protein (KSP, Eg5) siRNA
antisense strand 226auugucuuca ggucuucagt t 2122721DNAArtificial
Sequencesynthetic human kinesin spindle protein (KSP, Eg5) modified
siRNA sense strand 227cngaagaccn gaagacaant t 2122821DNAArtificial
Sequencesynthetic human kinesin spindle protein (KSP, Eg5) modified
siRNA sense strand 228cunaanaccu naanacaaut t 2122921DNAArtificial
Sequencesynthetic human kinesin spindle protein (KSP, Eg5) modified
siRNA antisense strand 229auugucunca ggncuncagt t
2123021DNAArtificial Sequencesynthetic human kinesin spindle
protein (KSP, Eg5) modified siRNA antisense strand 230auunucuuca
gnucuucant t 2123121RNAArtificial Sequencesynthetic luciferase
(Luc) siRNA sense strand 231gauuaugucc gguuauguau u
2123221RNAArtificial Sequencesynthetic luciferase (Luc) siRNA
antisense strand 232uacauaaccg gacauaaucu u 2123321RNAArtificial
Sequencesynthetic luciferase (Luc) modified siRNA sense strand
233ganuangncc ggnnangnau u 2123421RNAArtificial Sequencesynthetic
luciferase (Luc) modified siRNA antisense strand 234uacanaaccg
gacanaancu u 2123521RNAArtificial Sequencesynthetic human polo-like
kinase 1 (PLK-1) siRNA sense strand 235gguccuagug gacccacgcu u
2123621RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 236agccgcacca gagggagaau u
2123721RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 237gccgcaccag agggagaagu u
2123821RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 238ggacaacgac uucguguucu u
2123921RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 239cuccuggagc ugcacaagau u
2124021RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 240gccugaggcc cgauacuacu u
2124121RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 241ccugcaccga aaccgaguuu u
2124221RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 242gaggaagaag acccuguguu u
2124321RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 243gacccugugu gggacuccuu u
2124421RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 244cccugugugg gacuccuaau u
2124521RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 245ccuguguggg acuccuaauu u
2124621RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 246gguggaugug ugguccauuu u
2124721RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 247guggaugugu gguccauugu u
2124821RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 248gugggcaaac caccuuuugu u
2124921RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 249accaccuuuu gagacuucuu u
2125021RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 250ccaccuuuug agacuucuuu u
2125121RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 251gagaccuacc uccggaucau u
2125221RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 252ccuaccuccg gaucaagaau u
2125321RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 253ccuccggauc aagaagaauu u
2125421RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 254gccgccuccc ucauccagau u
2125521RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 255cucccucauc cagaagaugu u
2125621RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 256gcagcugcac agugucaauu u
2125721RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 257gaggcugagg auccugccuu u
2125821RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 258gggucagcaa guggguggau u
2125921RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 259ucagcaagug gguggacuau u
2126021RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 260cagcaagugg guggacuauu u
2126121RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 261gguggacuau ucggacaagu u
2126221RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 262cacgccucau ccucuacaau u
2126321RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 263cgccucaucc ucuacaaugu u
2126421RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 264cagccugcag uacauagagu u
2126521RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 265ucccaacucc uugaugaagu u
2126621RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 266acuccuugau gaagaagauu u
2126721RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 267ugagcgagca cuugcugaau u
2126821RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 268cccgcagcgc caucauccuu u
2126921RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 269gcgccaucau ccugcaccuu u
2127021RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 270gcaacggcag cgugcagauu u
2127121RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 271acggcagcgu gcagaucaau u
2127221RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 272gcucaucuug ugcccacugu u
2127321RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) siRNA sense strand 273ucgacgagaa gcgggacuuu u
2127444RNAArtificial Sequencesynthetic 5' RNA ligase mediated rapid
amplification of cDNA ends (5' RLM RACE) GeneRacer RNA adaptor
274cgacuggagc acgaggacac ugacauggac ugaaggagua gaaa
4427523DNAArtificial Sequencesynthetic reverse transcription
PLK-1-specific primer 275ggacaaggct gtagaaccca cac
2327623DNAArtificial Sequencesynthetic 5' RNA ligase mediated rapid
amplification of cDNA ends (5' RLM RACE) PCR forward primer GR5
276cgactggagc acgaggacac tga 2327723DNAArtificial Sequencesynthetic
5' RNA ligase mediated rapid amplification of cDNA ends (5' RLM
RACE) PCR reverse primer PLK1424rev 277ccagatgcag gtgggagtga gga
2327818DNAArtificial Sequencesynthetic sequencing primer GeneRacer
5' Seq 278actggagcac gaggacac 1827919DNAArtificial
Sequencesynthetic sequencing primer PLK1424 3' Seq 279gagacgggca
gggatatag 1928023DNAArtificial Sequencesynthetic unique
amplification KSP-specific cDNA primer 280gctgctctcg tggttcagtt ctc
2328125DNAArtificial Sequencesynthetic unique amplification RACE
primer KSPrev 281gcccaactac tgcttaactg gcaaa 2528220DNAArtificial
Sequencesynthetic unique amplification KSP sequencing primer
282tgggtttcct ttattgtctt 2028321RNAArtificial Sequencesynthetic
ApoB-1 siRNA sense strand 283gucaucacac ugaauaccaa u
2128421RNAArtificial Sequencesynthetic ApoB-1 modified siRNA 2'OMe
sense strand 284gncancacac ngaanaccaa n 2128523RNAArtificial
Sequencesynthetic ApoB-1 siRNA antisense (AS) strand 285auugguauuc
agugugauga cac 2328623RNAArtificial Sequencesynthetic ApoB-1
modified siRNA 2'OMe antisense (AS) strand 286auugguaunc anunuganga
cac 2328712RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) asymmetrical interfering RNA (aiRNA) sense strand
287cccuccuuaa au 1228812RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) asymmetrical interfering RNA (aiRNA)
sense strand 288acccuccuua aa 1228912RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) asymmetrical
interfering RNA (aiRNA) sense strand 289cacccuccuu aa
1229013RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) asymmetrical interfering RNA (aiRNA) sense strand
290acccuccuua aau 1329113RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) asymmetrical interfering RNA (aiRNA)
sense strand 291cacccuccuu aaa 1329213RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) asymmetrical
interfering RNA (aiRNA) sense strand 292ucacccuccu uaa
1329314RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) asymmetrical interfering RNA (aiRNA) sense strand
293cacccuccuu aaau 1429414RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) asymmetrical interfering RNA (aiRNA)
sense strand 294ucacccuccu uaaa 1429514RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) asymmetrical
interfering RNA (aiRNA) sense strand 295aucacccucc uuaa
1429615RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) asymmetrical interfering RNA (aiRNA) sense strand
296ucacccuccu uaaau 1529715RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) asymmetrical interfering RNA (aiRNA)
sense strand 297aucacccucc uuaaa 1529815RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) asymmetrical
interfering RNA (aiRNA) sense strand 298gaucacccuc cuuaa
1529916RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) asymmetrical interfering RNA (aiRNA) sense strand
299aucacccucc uuaaau 1630016RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) asymmetrical interfering RNA (aiRNA)
sense strand 300gaucacccuc cuuaaa 1630117RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) asymmetrical
interfering RNA (aiRNA) sense strand 301gaucacccuc cuuaaau
1730212RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) asymmetrical interfering RNA (aiRNA) sense strand
302accuccggau ca 1230312RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) asymmetrical
interfering RNA (aiRNA) sense strand 303uaccuccgga uc
1230412RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) asymmetrical interfering RNA (aiRNA) sense strand
304cuaccuccgg au 1230513RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) asymmetrical interfering RNA (aiRNA)
sense strand 305uaccuccgga uca 1330613RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) asymmetrical
interfering RNA (aiRNA) sense strand 306cuaccuccgg auc
1330713RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) asymmetrical interfering RNA (aiRNA) sense strand
307ccuaccuccg gau 1330814RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) asymmetrical interfering RNA (aiRNA)
sense strand 308cuaccuccgg auca 1430914RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) asymmetrical
interfering RNA (aiRNA) sense strand 309ccuaccuccg gauc
1431014RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) asymmetrical interfering RNA (aiRNA) sense strand
310accuaccucc ggau 1431115RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) asymmetrical interfering RNA (aiRNA)
sense strand 311ccuaccuccg gauca 1531215RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) asymmetrical
interfering RNA (aiRNA) sense strand 312accuaccucc ggauc
1531315RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) asymmetrical interfering RNA (aiRNA) sense strand
313gaccuaccuc cggau 1531416RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) asymmetrical interfering RNA (aiRNA)
sense strand 314accuaccucc ggauca 1631516RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) asymmetrical
interfering RNA (aiRNA) sense strand 315gaccuaccuc cggauc
1631617RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) asymmetrical interfering RNA (aiRNA) sense strand
316gaccuaccuc cggauca 1731722RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 317uacugcagac guggcaauca ug 2231820RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 318ggugggaggu ggggugggca
2031921RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 319uacugcagac
aguggcaauc a 2132022RNAArtificial Sequencesynthetic human polo-like
kinase 1 (PLK-1) silencing mature microRNA (miRNA) sequence
320gggagccagg aaguauugau gu 2232122RNAArtificial Sequencesynthetic
human polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 321ggggcugggg ccgggacaga gc 2232221RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 322agggagggac gggggcugug c
2132322RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 323uauggcacug
guagaauuca cu 2232422RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 324auaaagcuag auaaccgaaa gu 2232523RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 325uccggggcug aguucugugc acc
2332622RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 326aguauucugu
accagggaag gu 2232722RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 327cuuaugcaag auucccuucu ac 2232821RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 328uaaaguaaau augcaccaaa a
2132925RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 329aggcaccagc
caggcauugc ucagc 2533019RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 330acuugagggg caugaggau 1933122RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 331cuauacaguc uacugucuuu cc
2233222RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 332aacccguaga
uccgaacuug ug 2233323RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 333ucugcucaua ccccaugguu ucu 2333422RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 334ccucccacac ccaaggcuug ca
2233522RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 335ccgcacugug
gguacuugcu gc 2233620RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 336auguauaaau guauacacac 2033721RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 337aauggcgcca cuaggguugu g
2133822RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 338cuauacggcc
uccuagcuuu cc 2233922RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 339uuauaaagca augagacuga uu 2234022RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 340gguccagagg ggagauaggu uc
2234122RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 341aaaaguaauu
gugguuuugg cc 2234222RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 342cucaucugca aagaaguaag ug 2234322RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 343aaguucuguu auacacucag gc
2234421RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 344cuguacaggc
cacugccuug c 2134521RNAArtificial Sequencesynthetic human polo-like
kinase 1 (PLK-1) silencing mature microRNA (miRNA) sequence
345uugaaaggcu auuucuuggu c 2134621RNAArtificial Sequencesynthetic
human polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 346cagccacauc cgaaaguuuu c 2134723RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 347acuccauuug uuuugaugau gga
2334822RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 348ugcggggcua
gggcuaacag ca 2234920RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 349acugccccag gugcugcugg 2035022RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 350aaaagcuggg uugagagggc ga
2235122RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 351aacccguaga
uccgaucuug ug 2235222RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 352gagcuuauuc auaaaagugc ag 2235321RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 353acagucugcu gagguuggag c
2135421RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 354ucgaggagcu
cacagucuag u 2135521RNAArtificial Sequencesynthetic human polo-like
kinase 1 (PLK-1) silencing mature microRNA (miRNA) sequence
355cauaaaguag aaagcacuac u 2135619RNAArtificial Sequencesynthetic
human polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 356aagugugcag ggcacuggu 1935722RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 357acuuguaugc uagcucaggu ag
2235822RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 358aguuuugcau
aguugcacua ca 2235922RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 359aucuggaggu aagaagcacu uu 2236021RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 360agggcccccc cucaauccug u
2136124RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 361gaccuggaca
uguuugugcc cagu 2436222RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 362gaaagccacc augcugggua aa 2236322RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 363gugugcggaa augcuucugc ua
2236422RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 364ugugugcaug
ugcuugugug ua 2236521RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 365cacgcgggaa ccgaguccac c 2136623RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 366cacccggcug ugugcacaug ugc
2336722RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 367uagcuuauca
gacugauguu ga 2236822RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 368agcgggcaca gcugugagag cc 2236922RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 369acugcaguga aggcacuugu ag
2237021RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 370cucccacaug
caggguuugc a 2137120RNAArtificial Sequencesynthetic human polo-like
kinase 1 (PLK-1) silencing mature microRNA (miRNA) sequence
371cuacaaaggg aagcccuuuc 2037223RNAArtificial Sequencesynthetic
human polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 372ugugcaaauc uaugcaaaac uga 2337322RNAArtificial
Sequencehuman polo-like kinase 1 (PLK-1) silencing mature microRNA
(miRNA) sequence 373uugcauaguc acaaaaguga uc 2237421RNAArtificial
Sequencehuman polo-like kinase 1 (PLK-1) silencing mature microRNA
(miRNA) sequence 374gcuaguccug acucagccag u 2137521RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 375ugagcuaaau gugugcuggg a
2137623RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 376uagugcaaua
uugcuuauag ggu 2337722RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 377acagauucga uucuagggga au 2237822RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 378uggugggccg cagaacaugu gc
2237922RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 379uacgugugug
ugcaugugca ug 2238022RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 380cugugcgugu gacagcggcu ga 2238122RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 381cacacacugc aauuacuuuu gc
2238222RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 382aaaucucugc
aggcaaaugu ga 2238321RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 383agacaugugc ucugcuccua g 2138422RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 384cuagguaugg ucccagggau cc
2238522RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 385uuugaaccau
cacucgacuc cu 2238622RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 386ugagaaccac gucugcucug ag 2238722RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 387caagaaccuc aguugcuuuu gu
2238822RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 388caaauucgua
ucuaggggaa ua 2238919RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 389aggcugcgga auucaggac 1939022RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 390gucauacacg gcucuccucu cu
2239122RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 391uaacugcaac
aucucucagu au 2239222RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 392aacacaccug guuaaccucu uu 2239319RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA)
sequence 393ugggcguauc uguaugcua 1939421RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 394gcgacccaua cuugguuuca g
2139521RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 395cgcgggugcu
uacugacccu u 2139621RNAArtificial Sequencesynthetic human polo-like
kinase 1 (PLK-1) silencing mature microRNA (miRNA) sequence
396cgacgagggc cggucggucg c 2139722RNAArtificial Sequencesynthetic
human polo-like kinase 1 (PLK-1) silencing mature microRNA (miRNA)
sequence 397agugccgcag aguuuguagu gu 2239822RNAArtificial
Sequencesynthetic human polo-like kinase 1 (PLK-1) silencing mature
microRNA (miRNA) sequence 398uucaacgggu auuuauugag ca
2239922RNAArtificial Sequencesynthetic human polo-like kinase 1
(PLK-1) silencing mature microRNA (miRNA) sequence 399cacccguaga
accgaccuug cg 2240021RNAArtificial Sequencesynthetic human
polo-like kinase 1 (PLK-1) modified siRNA sense strand
400agancacccn ccunaaanan u 2140121RNAArtificial Sequencesynthetic
human polo-like kinase 1 (PLK-1) modified siRNA antisense strand
401uauuuaanga gggugancuu c 2140221RNAArtificial Sequencesynthetic
human polo-like kinase 1 (PLK-1) modified siRNA antisense strand
402uauuuaanga gggugancun c 2140321RNAArtificial Sequencesynthetic
human polo-like kinase 1 (PLK-1) modified siRNA antisense strand
403uauuuaanga gggunancun c 2140421RNAArtificial Sequencesynthetic
human polo-like kinase 1 (PLK-1) modified siRNA antisense strand
404uauuuaanna gngunancuu u 2140521RNAArtificial Sequencesynthetic
human polo-like kinase 1 (PLK-1) modified siRNA sense strand
405anaccuaccu ccngaucaag a 2140621RNAArtificial Sequencesynthetic
human polo-like kinase 1 (PLK-1) modified siRNA antisense strand
406uugauccgna gnuaggncuc u 2140721RNAArtificial Sequencesynthetic
human polo-like kinase 1 (PLK-1) modified siRNA antisense strand
407uuganccgna gnuaggncuc u 21
* * * * *
References