Pan-lyssavirus Vaccines Against Rabies

Abstract

Described herein are recombinant rabies viruses encoding rabies virus glycoprotein and at least one heterologous glycoprotein from another lyssavirus, such as Mokola virus, Lagos bat virus and/or West Caucasian bat virus. In particular embodiments, the recombinant rabies virus includes two or three heterologous lyssavirus glycoproteins. The disclosed recombinant rabies viruses can be used as pan-lyssavirus vaccines to provide protection against lyssaviruses that cause rabies.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This is a continuation of U.S. patent application Ser. No. 13/806,622, filed Dec. 21, 2012, which is the U.S. National Stage of International Application No. PCT/US2011/041579, filed Jun. 23, 2011, published in English under PCT Article 21(2), which claims the benefit of U.S. Provisional Application No. 61/358,288, filed Jun. 24, 2010. All of the above-referenced applications are herein incorporated by reference in their entirety.

FIELD

[0002] This disclosure concerns recombinant rabies viruses and their use as pan-lyssavirus vaccines for protection against lyssavirus infections.

BACKGROUND

[0003] The genus Lyssavirus is a member of the Rhabdoviridae family within the order Mononegavirales (viruses with a single-stranded, negative sense genome). Lyssaviruses are the etiological agents of rabies encephalitis in warm-blooded animals and humans (Tordo et al., "Lyssaviruses" In Fauquet et al. eds. Virus taxonomy: the classification and nomenclature of viruses. The 8.sup.th Report of the International Committee on Taxonomy of Viruses. San Diego: Oxford Academic, 2006, pages 623-629; World Health Organization Expert Consultation on Rabies, 5-8 Oct. 2004, first report, World Health Organization Technical report series 931, Geneva: World Health Organization, 2005, pages 15-19). Lyssavirus species include rabies virus (RABV; genotype 1), Lagos bat virus (LBV; genotype 2), Mokola virus (MOKV; genotype 3), Duvenhage virus (DUVV; genotype 4), European bat lyssavirus-1 (EBLV-1; genotype 5), European bat lyssavirus-2 (EBLV-2; genotype 6), Australian bat lyssavirus (ABLV; genotype 7) and four additional species isolated from bats in central Asia and Russia (Aravan virus--ARAV; Khujand virus--KHUV; Irkut virus--IRKV; and West Caucasian bat virus--WCBV) (Kuzmin et al., Emerg. Infect. Dis. 14(12):1887-1889, 2008; Weyer et al., Epidemiol. Infect. 136:670-678, 2007; Kuzmin and Rupprecht, "Bat rabies" In Rabies, 2.sup.nd Edition, New York, Academic Press, 2007, pages 259-307, Jackson and Wunner, eds.).

[0004] Based on phylogeny, immunogenicity and virulence of lyssavirus isolates, two lyssavirus phylogroups have been proposed (Badrane et al., J. Virol. 75:3268-3276, 2001). The division into phylogroups generally correlates with the pattern of vaccine cross-protection observed for lyssaviruses (Badrane et al., J. Virol. 75:3268-3276, 2001; Hanlon et al., Virus Res. 111:44-54, 2005; Nel et al., Expert Rev. Vaccines 4:553-540, 2005). Phylogroupl includes genotypes 1, 4, 5, 6 and 7, as well as ARAV, KHUV and IRKV (Kuzmin et al., Virus Res. 97:65-79, 2003; Kuzmin et al., Virus Res. 111:28-43, 2005; Hanlon et al., Virus Res. 111:44-54, 2005). Currently available commercial vaccines and biologicals are considered to be effective against infections of viruses from this phylogroup (Nel et al., Expert Rev. Vaccines 4:553-540, 2005). However, these vaccines and biologics for rabies do not offer full protection against infection with viruses outside of lyssavirus phylogroup 1 (i.e., genotypes 2 and 3). In addition, WCBV is recognized as the most divergent lyssavirus and exhibits limited relatedness to genotype 2 and 3 viruses. Previous studies have demonstrated little or no cross-neutralization of anti-RABV sera with WCBV (Botvinkin et al., Emerg. Infect. Dis. 9:1623-1625, 2003; Hanlon et al., Virus Res. 111:44-54, 2005).

[0005] Thus, a need exists to develop a rabies vaccine that can protect against a broad spectrum of lyssaviruses, particularly WCBV and lyssaviruses of genotypes 2 and 3.

SUMMARY

[0006] Disclosed herein are recombinant rabies viruses having glycoprotein genes from at least two different lyssaviruses. The disclosed viruses can be used as pan-lyssavirus vaccines to provide protection against infection by multiple genotypes of lyssavirus.

[0007] Provided herein are recombinant rabies viruses. In some embodiments, the genome of the recombinant rabies virus includes rabies virus nucleoprotein (N), phosphoprotein (P), matrix protein (M), RNA-dependent RNA polymerase (L) and glycoprotein (G) genes and at least one, at least two or at least three different heterologous lyssavirus glycoprotein genes. In some embodiments, the lyssavirus is selected from LBV, MOKV, DUVV, EBLV-1, EBLV-2, ABLV, ARAV, KHUV, IRKV and WCBV. In particular embodiments, the lyssavirus is selected from LBV, MOKV and WCBV.

[0008] Further provided is a vector comprising a full-length rabies virus antigenomic DNA. In some embodiments, the antigenomic DNA includes rabies virus N, P, M, L and G genes, and the vector further includes at least one, at least two, or at least three different heterologous lyssavirus G genes. Also provided are cells comprising a rabies virus vector described herein.

[0009] Also provided are compositions comprising one or more recombinant rabies viruses described herein and a pharmaceutically acceptable carrier. Methods of eliciting an immune response in a subject against lyssavirus by administering to the subject one or more of the recombinant rabies viruses disclosed herein is further provided.

[0010] The foregoing and other objects, features, and advantages of the invention will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE FIGURES

[0011] FIG. 1A: Schematic illustration of the ERA transcription plasmid. Positions of the hammerhead ribozymes and antigenomic ERA genome are indicated graphically. Relative positions of the N, P, M G and L proteins are shown in a 5' to 3' direction.

[0012] FIG. 1B: Schematic diagram of the construction of the full-length ERA rabies virus genomic cDNA plasmid pTMF. RT-PCR products F1 and F2 fragments, and restriction enzyme recognition sites (Nhe1, Kpn1, Blp1, Pst1 and Not1) are shown. RdRz-hammerhead and HDVRz-hepatitis delta virus ribozymes are indicated. The diamond symbols indicate that Kpn1 or Pst1 sites were deleted, and the vertical arrows indicate that Nhe1 or Not1 sites were left intact.

[0013] FIG. 2: Schematic illustration of the proposed mechanism of NLST7 RNA polymerase autogene action by pNLST7 plasmids. The DNA-transfection reagent complex is taken into cells by endocytosis. The majority of the DNA released from lysosomes and endosomes is retained in the cell cytoplasm. A limited amount of plasmid is transferred to the nucleus: 1) through a CMV immediate early promoter, the NLST7 gene is transcribed by cellular RNA polymerase II; 2) mature NLST7 mRNA is transported from the nucleus to the cytoplasm for NLST7 RNA polymerase synthesis; 3) newly synthesized NLST7 RNA polymerase is translocated to the nucleus, while a trace amount of NLST7 remains in the cytoplasm; and 4) NLST7 RNA polymerase initiates transcription through a pT7 promoter. By posttranscriptional modifications, additional NLST7 mRNA is produced for protein synthesis, thus increasing virus recovery efficiency.

[0014] FIG. 3: Schematic diagram of ten derivative ERA virus genomes. The size of each gene is not drawn to scale. Symbol "*" denotes mutations of G at amino acid residue 333 (referred to herein as G333) and ".PSI." indicates the Psi-region.

[0015] FIG. 4: Schematic of the construction of ERA-3G. The G333 mutation is introduced into the ERA backbone and two transcriptional (trans) units are added. The transcriptional units are introduced between the P and M genes and between the G and L genes. The MOKV and WCBV G genes are cloned into the transcriptional units to form a recombinant ERA rabies virus with three glycoprotein genes (ERA-3G).

[0016] FIG. 5: Schematic of the construction of ERA-4G. The G333 mutation is introduced into the ERA backbone and three transcriptional (trans) units are added. The transcriptional units are introduced between the N and P genes, between the P and M genes, and between the G and L genes. The LBV, MOKV and WCBV G genes are cloned into the transcriptional units to form a recombinant ERA rabies virus with four glycoprotein genes (ERA-4G).

SEQUENCE LISTING

[0017] The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file, created on Dec. 17, 2015, 135 KB, which is incorporated by reference herein. In the accompanying sequence listing:

[0018] SEQ ID NO: 1 is the nucleotide sequence of recombinant rabies virus ERA recovered by reverse genetics. Nucleotides 4370-4372 of the recombinant virus have been changed (relative to the wild-type virus) from aga to gag, which introduces an Arg to Glu amino acid change in the G protein at residue 333.

[0019] SEQ ID NO: 2 is the amino acid sequence of the rabies virus ERA N protein.

[0020] SEQ ID NO: 3 is the amino acid sequence of the rabies virus ERA P protein.

[0021] SEQ ID NO: 4 is the amino acid sequence of the rabies virus ERA M protein.

[0022] SEQ ID NO: 5 is the amino acid sequence of the rabies virus ERA G protein mutated at amino acid position 333 (from Arg to Glu).

[0023] SEQ ID NO: 6 is the amino acid sequence of the rabies virus ERA L protein.

[0024] SEQ ID NO: 7 is the amino acid sequence of the wild-type rabies virus ERA G protein.

[0025] SEQ ID NOs: 8-11 are the nucleotide sequences of RT-PCR primers for amplification of full-length rabies virus genomic cDNA.

[0026] SEQ ID NOs: 12-15 are oligonucleotide sequences used to synthesize hammerhead and hepatitis delta virus ribozymes.

[0027] SEQ ID NOs: 16-40 are the nucleotide sequences of PCR primers.

[0028] SEQ ID NOs: 41 and 42 are the nucleotide sequences of transcription units for incorporating heterologous ORFs.

[0029] SEQ ID NOs: 43 and 44 are the nucleotide sequences of RT-PCR primers for amplification of the MOKV G gene.

[0030] SEQ ID NOs: 45 and 46 are the nucleotide sequences of RT-PCR primers for amplification of the WCBV G gene.

[0031] SEQ ID NOs: 47 and 48 are the nucleotide and amino acid sequences, respectively, of MOKV G.

[0032] SEQ ID NOs: 49 and 50 are the nucleotide and amino acid sequences, respectively, of WCBV G.

[0033] SEQ ID NOs: 51 and 52 are the nucleotide sequences of RT-PCR primers for amplification of the LBV G gene.

[0034] SEQ ID NOs: 53 and 54 are the nucleotide and amino acid sequences, respectively, of LBV G.

DETAILED DESCRIPTION

I. Abbreviations

[0035] ABLV Australian bat lyssavirus

[0036] ARAV Aravan virus

[0037] CMV cytomegalovirus

[0038] DFA direct fluorescent antibody

[0039] DUVV Duvenhage virus

[0040] EBLV-1 European bat lyssavirus-1

[0041] EBLV-2 European bat lyssavirus-2

[0042] ERA Evelyn-Rokitnicki-Abelseth

[0043] FFU focus-forming unit

[0044] G glycoprotein

[0045] i.m. intramuscular

[0046] IRES internal ribosome entry site

[0047] IRKV Irkut virus

[0048] KHUV Khujand virus

[0049] L RNA-dependent RNA polymerase

[0050] LBV Lagos bat virus

[0051] M matrix protein

[0052] MOKV Mokola virus

[0053] N nucleoprotein

[0054] NLS nuclear localization signal

[0055] ORF open reading frame

[0056] P phosphoprotein

[0057] PAGE polyacrylamide gel electrophoresis

[0058] RABV rabies virus

[0059] RNP ribonucleoprotein

[0060] RABV rabies virus

[0061] WCBV West Caucasian bat virus

II. Terms and Methods

[0062] Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).

[0063] In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:

[0064] Adjuvant: A substance or vehicle that non-specifically enhances the immune response to an antigen. Adjuvants can include a suspension of minerals (alum, aluminum hydroxide, or phosphate) on which antigen is adsorbed; or water-in-oil emulsion in which antigen solution is emulsified in mineral oil (for example, Freund's incomplete adjuvant), sometimes with the inclusion of killed mycobacteria (Freund's complete adjuvant) to further enhance antigenicity. Immunostimulatory oligonucleotides (such as those including a CpG motif) can also be used as adjuvants (for example, see U.S. Pat. Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; 6,339,068; 6,406,705; and 6,429,199). Adjuvants also include biological molecules, such as co-stimulatory molecules. Exemplary biological adjuvants include IL-2, RANTES, GM-CSF, TNF-.alpha., IFN-.gamma., G-CSF, LFA-3, CD72, B7-1, B7-2, OX-40L and 41 BBL.

[0065] Administer: As used herein, administering a composition, such as a vaccine, to a subject means to give, apply or bring the composition into contact with the subject. Administration can be accomplished by any of a number of routes, such as, for example, topical, oral, subcutaneous, intramuscular, intraperitoneal, intravenous, intrathecal and intramuscular.

[0066] Animal: Living multi-cellular vertebrate organisms, a category that includes, for example, mammals and birds. The term mammal includes both human and non-human mammals. The term "animal" includes both human and veterinary subjects, for example, humans, non-human primates, dogs, cats, horses, raccoons, bats, rats, mice, foxes, squirrels, opossum, coyotes, wolves and cows.

[0067] Antibody: A protein (or protein complex) that includes one or more polypeptides substantially encoded by immunoglobulin genes or fragments of immunoglobulin genes. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.

[0068] The basic immunoglobulin (antibody) structural unit is generally a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kDa) and one "heavy" (about 50-70 kDa) chain. The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms "variable light chain" (V.sub.L) and "variable heavy chain" (V.sub.H) refer, respectively, to these light and heavy chains.

[0069] As used herein, the term "antibody" includes intact immunoglobulins as well as a number of well-characterized fragments. For instance, Fabs, Fvs, and single-chain Fvs (SCFvs) that bind to target protein (or epitope within a protein or fusion protein) would also be specific binding agents for that protein (or epitope). These antibody fragments are as follows: (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab', the fragment of an antibody molecule obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody molecule; (3) (Fab').sub.2, the fragment of the antibody obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; (4) F(ab').sub.2, a dimer of two Fab' fragments held together by two disulfide bonds; (5) Fv, a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and (6) single chain antibody, a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule. Methods of making these fragments are routine (see, for example, Harlow and Lane, Using Antibodies: A Laboratory Manual, CSHL, New York, 1999).

[0070] Antibody binding affinity: The strength of binding between a single antibody binding site and a ligand (e.g., an antigen or epitope). The affinity of an antibody binding site X for a ligand Y is represented by the dissociation constant (K.sub.d), which is the concentration of Y that is required to occupy half of the binding sites of X present in a solution. A smaller K.sub.d indicates a stronger or higher-affinity interaction between X and Y and a lower concentration of ligand is needed to occupy the sites. In general, antibody binding affinity can be affected by the alteration, modification and/or substitution of one or more amino acids in the epitope recognized by the antibody paratope. Binding affinity can be measured using any technique known in the art, such as end-point titration in an Ag-ELISA assay.

[0071] Antigen: A compound, composition, or substance that can stimulate the production of antibodies or a T-cell response in an animal, including compositions that are injected or absorbed into an animal. An antigen reacts with the products of specific humoral or cellular immunity, including those induced by heterologous immunogens.

[0072] Antigenomic: In the context of a virus with a negative-strand RNA genome (such as the genome of a lyssavirus), "antigenomic" refers to the complement (positive strand) of the negative strand genome.

[0073] Attenuated: In the context of a live virus, such as a rabies virus, the virus is attenuated if its ability to infect a cell or subject and/or its ability to produce disease is reduced (for example, eliminated). Typically, an attenuated virus retains at least some capacity to elicit an immune response following administration to an immunocompetent subject. In some cases, an attenuated virus is capable of eliciting a protective immune response without causing any signs or symptoms of infection.

[0074] Epitope: An antigenic determinant. These are particular chemical groups, such as contiguous or non-contiguous peptide sequences, on a molecule that are antigenic, that is, that elicit a specific immune response. An antibody binds a particular antigenic epitope based on the three dimensional structure of the antibody and the matching (or cognate) three dimensional structure of the epitope.

[0075] Evelyn-Rokitnicki-Abelseth (ERA): The ERA strain of rabies virus was derived from the Street-Alabama-Dufferin (SAD) strain, first isolated from a rabid dog in Alabama (USA) in 1935. The ERA strain was derived after multiple passages of SAD rabies virus in mouse brains, baby hamster kidney (BHK) cells, and chicken embryos.

[0076] Fusion protein: A protein generated by expression of a nucleic acid sequence engineered from nucleic acid sequences encoding at least a portion of two different (heterologous) proteins. To create a fusion protein, the nucleic acid sequences must be in the same reading frame and contain no internal stop codons in that frame.

[0077] Heterologous: As used herein, a "heterologous nucleic acid sequence" is a nucleic acid sequence that is derived from a different source, species or strain. In some embodiments described herein, the heterologous nucleic acid sequence is a nucleic acid sequence encoding a glycoprotein from a lyssavirus other than rabies virus ERA. In the context of a recombinant ERA rabies virus, a heterologous nucleic acid sequence is any nucleic acid sequence that is not derived from the ERA rabies virus.

[0078] Immune response: A response of a cell of the immune system, such as a B-cell, T-cell, macrophage or polymorphonucleocyte, to a stimulus such as an antigen. An immune response can include any cell of the body involved in a host defense response, including for example, an epithelial cell that secretes an interferon or a cytokine. An immune response includes, but is not limited to, an innate immune response or inflammation. As used herein, a protective immune response refers to an immune response that protects a subject from infection (prevents infection or prevents the development of disease associated with infection).

[0079] Immunize: To render a subject protected from a disease (for example, an infectious disease), such as by vaccination.

[0080] Immunogen: A compound, composition, or substance which is capable, under appropriate conditions, of stimulating an immune response, such as the production of antibodies or a T-cell response in an animal, including compositions that are injected or absorbed into an animal. As used herein, an "immunogenic composition" is a composition comprising an immunogen.

[0081] Immunogenic composition: A composition useful for stimulating or eliciting a specific immune response (or immunogenic response) in a vertebrate. In some embodiments, the immunogenic composition includes a recombinant rabies virus, such as a recombinant rabies virus expressing one or more heterologous glycoproteins (such as the glycoproteins from MOKV, LBV or WCBV). In some embodiments, the immunogenic response is protective or provides protective immunity, in that it enables the animal to better resist infection with or disease progression from the pathogen against which the immunogenic composition is directed (e.g., rabies virus and other lyssaviruses). One specific example of a type of immunogenic composition is a vaccine.

[0082] In some embodiments, an "effective amount" or "immune-stimulatory amount" of an immunogenic composition is an amount which, when administered to a subject, is sufficient to engender a detectable immune response. Such a response may comprise, for instance, generation of antibodies specific to one or more of the epitopes provided in the immunogenic composition. Alternatively, the response may comprise a T-helper or CTL-based response to one or more of the epitopes provided in the immunogenic composition. In other embodiments, a "protective effective amount" of an immunogenic composition is an amount which, when administered to an animal, is sufficient to confer protective immunity upon the animal.

[0083] Inhibiting or treating a disease: Inhibiting the full development of a disease or condition, for example, in a subject who is at risk for a disease. One specific example of a disease is rabies. "Treatment" refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop. As used herein, the term "ameliorating," with reference to a disease, pathological condition or symptom, refers to any observable beneficial effect of the treatment. The beneficial effect can be evidenced, for example, by a delayed onset of clinical symptoms of the disease in a susceptible subject, a reduction in severity of some or all clinical symptoms of the disease, a slower progression of the disease, a reduction in the number of relapses of the disease, an improvement in the overall health or well-being of the subject, or by other parameters well known in the art that are specific to the particular disease.

[0084] Isolated: An "isolated" or "purified" biological component (such as a nucleic acid, peptide, protein, protein complex, or particle) has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, that is, other chromosomal and extra-chromosomal DNA and RNA, and proteins. Nucleic acids, peptides and proteins that have been "isolated" or "purified" thus include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell, as well as chemically synthesized nucleic acids or proteins. The term "isolated" or "purified" does not require absolute purity; rather, it is intended as a relative term. Thus, for example, an isolated biological component is one in which the biological component is more enriched than the biological component is in its natural environment within a cell, or other production vessel. Preferably, a preparation is purified such that the biological component represents at least 50%, such as at least 70%, at least 90%, at least 95%, or greater, of the total biological component content of the preparation.

[0085] Label: A detectable compound or composition that is conjugated directly or indirectly to another molecule to facilitate detection of that molecule. Specific, non-limiting examples of labels include fluorescent tags, enzymatic linkages, and radioactive isotopes.

[0086] Lyssavirus: A genus of viruses that is part of the Rhabdoviridae family within the order Mononegavirales (viruses with a single-stranded, negative sense genome). Lyssaviruses are the etiological agents of rabies encephalitis in warm-blooded animals and humans. Lyssavirus species include rabies virus (RABV; genotype 1), Lagos bat virus (LBV; genotype 2), Mokola virus (MOKV; genotype 3), Duvenhage virus (DUVV; genotype 4), European bat lyssavirus-1 (EBLV-1; genotype 5), European bat lyssavirus-2 (EBLV-2; genotype 6) Australian bat lyssavirus (ABLV; genotype 7) and four additional species isolated from bats in central Asia and Russia (Aravan virus--ARAV; Khujand virus--KHUV; Irkut virus--IRKV; and West Caucasian bat virus--WCBV) (Kuzmin et al., Emerg. Infect. Dis. 14(12):1887-1889, 2008; Weyer et al., Epidemiol. Infect. 136:670-678, 2007; Kuzmin and Rupprecht, "Bat rabies" In Rabies, 2.sup.nd Edition, New York, Academic Press, 2007, pages 259-307, Jackson and Wunner, eds.).

[0087] ORF (open reading frame): A series of nucleotide triplets (codons) coding for amino acids without any termination codons. These sequences are usually translatable into a peptide.

[0088] Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame. If introns are present, the operably linked DNA sequences may not be contiguous.

[0089] Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers useful in this disclosure are conventional. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, Pa., 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compounds or molecules, proteins or antibodies that bind these proteins, viruses or vectors, and additional pharmaceutical agents.

[0090] In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (for example, powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.

[0091] Plasmid: A circular nucleic acid molecule capable of autonomous replication in a host cell.

[0092] Polypeptide: A polymer in which the monomers are amino acid residues joined together through amide bonds. When the amino acids are alpha-amino acids, either the L-optical isomer or the D-optical isomer can be used, the L-isomers being preferred for many biological uses. The terms "polypeptide" or "protein" as used herein are intended to encompass any amino acid molecule and include modified amino acid molecules. The term "polypeptide" is specifically intended to cover naturally occurring proteins, as well as those which are recombinantly or synthetically produced.

[0093] Conservative amino acid substitutions are those substitutions that, when made, least interfere with the properties of the original protein, that is, the structure and especially the function of the protein is conserved and not significantly changed by such substitutions. Examples of conservative substitutions are shown below.

TABLE-US-00001 Original Residue Conservative Substitutions Ala Ser Arg Lys Asn Gln, His Asp Glu Cys Ser Gln Asn Glu Asp His Asn; Gln Ile Leu, Val Leu Ile; Val Lys Arg; Gln; Glu Met Leu; Ile Phe Met; Leu; Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp; Phe Val Ile; Leu

[0094] Conservative substitutions generally maintain (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.

[0095] Amino acids are typically classified in one or more categories, including polar, hydrophobic, acidic, basic and aromatic, according to their side chains. Examples of polar amino acids include those having side chain functional groups such as hydroxyl, sulfhydryl, and amide, as well as the acidic and basic amino acids. Polar amino acids include, without limitation, asparagine, cysteine, glutamine, histidine, selenocysteine, serine, threonine, tryptophan and tyrosine. Examples of hydrophobic or non-polar amino acids include those residues having nonpolar aliphatic side chains, such as, without limitation, leucine, isoleucine, valine, glycine, alanine, proline, methionine and phenylalanine. Examples of basic amino acid residues include those having a basic side chain, such as an amino or guanidino group. Basic amino acid residues include, without limitation, arginine, homolysine and lysine. Examples of acidic amino acid residues include those having an acidic side chain functional group, such as a carboxy group. Acidic amino acid residues include, without limitation aspartic acid and glutamic acid. Aromatic amino acids include those having an aromatic side chain group. Examples of aromatic amino acids include, without limitation, biphenylalanine, histidine, 2-napthylalananine, pentafluorophenylalanine, phenylalanine, tryptophan and tyrosine. It is noted that some amino acids are classified in more than one group, for example, histidine, tryptophan, and tyrosine are classified as both polar and aromatic amino acids. Additional amino acids that are classified in each of the above groups are known to those of ordinary skill in the art.

[0096] Substitutions which in general are expected to produce the greatest changes in protein properties will be non-conservative, for instance changes in which (a) a hydrophilic residue, for example, seryl or threonyl, is substituted for (or by) a hydrophobic residue, for example, leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, for example, lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, for example, glutamyl or aspartyl; or (d) a residue having a bulky side chain, for example, phenylalanine, is substituted for (or by) one not having a side chain, for example, glycine.

[0097] Promoter: A promoter is an array of nucleic acid control sequences which direct transcription of a nucleic acid. A promoter includes necessary nucleic acid sequences near the start site of transcription. A promoter also optionally includes distal enhancer or repressor elements. A "constitutive promoter" is a promoter that is continuously active and is not subject to regulation by external signals or molecules. In contrast, the activity of an "inducible promoter" is regulated by an external signal or molecule (for example, a transcription factor).

[0098] Purified: The term "purified" does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified peptide, protein, virus, or other active compound is one that is isolated in whole or in part from naturally associated proteins and other contaminants. In certain embodiments, the term "substantially purified" refers to a peptide, protein, virus or other active compound that has been isolated from a cell, cell culture medium, or other crude preparation and subjected to fractionation to remove various components of the initial preparation, such as proteins, cellular debris, and other components.

[0099] Rabies: A viral disease that causes acute encephalitis (inflammation of the brain) in warm-blooded animals. Rabies is zoonotic (transmitted by animals), most commonly by a bite from an infected animal but occasionally by other forms of contact. Rabies is almost frequently fatal if post-exposure prophylaxis is not administered prior to the onset of severe symptoms. Rabies is caused by viruses of the Lyssavirus genus.

[0100] Rabies virus (RABV or RABV): A member of the Rhabdoviridae family having a non-segmented RNA genome with negative sense polarity. Rabies virus is the prototype of the Lyssavirus genus. The rabies virus Evelyn-Rokitnicki-Abelseth (ERA) strain is a strain derived from the Street-Alabama-Dufferin (SAD) strain, first isolated from a rabid dog in Alabama (USA) in 1935. The ERA strain was derived after multiple passages of SAD RABV in mouse brains, baby hamster kidney (BHK) cells, and chicken embryos. The complete genomic sequence of the ERA strain is disclosed in PCT Publication No. WO 2007/047459, and the sequence of the ERA strain recovered by reverse genetics is set forth herein as SEQ ID NO: 1.

[0101] Recombinant: A recombinant nucleic acid, protein or virus is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, for example, by genetic engineering techniques. In some embodiments, recombinant rabies virus is generated using reverse genetics, such as the reverse genetics system described in PCT Publication No. WO 2007/047459. In some examples, the recombinant rabies viruses comprise one or more mutations in a viral virulence factors, such as glycoprotein. In other examples, the recombinant rabies viruses comprise a heterologous gene, such as a sequence encoding a glycoprotein from another lyssavirus (such as Mokola virus, West Caucasian bat virus or Lagos bat virus).

[0102] Reverse genetics: Refers to the process of introducing mutations (such as deletions, insertions or point mutations) into the genome of an organism or virus in order to determine the phenotypic effect of the mutation. For example, introduction of a mutation in a specific viral gene enables one to determine the function of the gene.

[0103] Sequence identity: The similarity between two nucleic acid sequences, or two amino acid sequences, is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are.

[0104] Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman (Adv. Appl. Math., 2:482, 1981); Needleman and Wunsch (J. Mol. Biol., 48:443, 1970); Pearson and Lipman (Proc. Natl. Acad. Sci., 85:2444, 1988); Higgins and Sharp (Gene, 73:237-44, 1988); Higgins and Sharp (CABIOS, 5:151-53, 1989); Corpet et al. (Nuc. Acids Res., 16:10881-90, 1988); Huang et al. (Comp. Appls. Biosci., 8:155-65, 1992); and Pearson et al. (Meth. Mol. Biol., 24:307-31, 1994). Altschul et al. (Nature Genet., 6:119-29, 1994) presents a detailed consideration of sequence alignment methods and homology calculations.

[0105] The alignment tools ALIGN (Myers and Miller, CABIOS 4:11-17, 1989) or LFASTA (Pearson and Lipman, 1988) may be used to perform sequence comparisons (Internet Program.COPYRGT. 1996, W. R. Pearson and the University of Virginia, "fasta20u63" version 2.0u63, release date December 1996). ALIGN compares entire sequences against one another, while LFASTA compares regions of local similarity. These alignment tools and their respective tutorials are available on the Internet at the NCSA website. Alternatively, for comparisons of amino acid sequences of greater than about 30 amino acids, the "Blast 2 sequences" function can be employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). When aligning short peptides (fewer than around 30 amino acids), the alignment should be performed using the "Blast 2 sequences" function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). The BLAST sequence comparison system is available, for instance, from the NCBI web site; see also Altschul et al., J. Mol. Biol., 215:403-10, 1990; Gish and States, Nature Genet., 3:266-72, 1993; Madden et al., Meth. Enzymol., 266:131-41, 1996; Altschul et al., Nucleic Acids Res., 25:3389-402, 1997; and Zhang and Madden, Genome Res., 7:649-56, 1997.

[0106] Orthologs (equivalent to proteins of other species) of proteins are in some instances characterized by possession of greater than 75% sequence identity counted over the full-length alignment with the amino acid sequence of specific protein using ALIGN set to default parameters. Proteins with even greater similarity to a reference sequence will show increasing percentage identities when assessed by this method, such as at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, or at least 98% sequence identity. In addition, sequence identity can be compared over the full length of one or both binding domains of the disclosed fusion proteins.

[0107] When significantly less than the entire sequence is being compared for sequence identity, homologous sequences will typically possess at least 80% sequence identity over short windows of 10-20, and may possess sequence identities of at least 85%, at least 90%, at least 95%, or at least 99% depending on their similarity to the reference sequence. Sequence identity over such short windows can be determined using LFASTA; methods are described at the NCSA website. One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is entirely possible that strongly significant homologs could be obtained that fall outside of the ranges provided. Similar homology concepts apply for nucleic acids as are described for protein. An alternative indication that two nucleic acid molecules are closely related is that the two molecules hybridize to each other under stringent conditions.

[0108] Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences, due to the degeneracy of the genetic code. It is understood that changes in nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid sequences that each encode substantially the same protein.

[0109] Subject: Living multi-cellular vertebrate organisms, a category that includes both human and non-human mammals.

[0110] Therapeutically effective amount: A quantity of a specified agent sufficient to achieve a desired effect in a subject being treated with that agent. For example, this may be the amount of a recombinant rabies virus useful for eliciting an immune response in a subject and/or for preventing infection by rabies virus and other lyssaviruses. Ideally, in the context of the present disclosure, a therapeutically effective amount of a recombinant rabies virus is an amount sufficient to increase resistance to, prevent, ameliorate, and/or treat infection caused by one or more lyssaviruses in a subject without causing a substantial cytotoxic effect in the subject. The effective amount of a recombinant rabies virus useful for increasing resistance to, preventing, ameliorating, and/or treating infection in a subject will be dependent on, for example, the subject being treated, the manner of administration of the therapeutic composition and other factors. In some embodiments, the recombinant rabies viruses described herein comprise a nucleic acid sequence encoding one or more glycoproteins from a lyssavirus other than rabies virus ERA.

[0111] Vaccine: A preparation of immunogenic material capable of stimulating an immune response, administered for the prevention, amelioration, or treatment of infectious or other type of disease (such as cancer). The immunogenic material may include attenuated or killed microorganisms (such as attenuated viruses), or antigenic proteins, peptides or DNA derived from them. Vaccines may elicit both prophylactic (preventative) and therapeutic responses. Methods of administration vary according to the vaccine, but may include inoculation, ingestion, inhalation or other forms of administration. Inoculations can be delivered by any of a number of routes, including parenteral, such as intravenous, subcutaneous or intramuscular. Vaccines may be administered with an adjuvant to boost the immune response.

[0112] Vector: A nucleic acid molecule that can be introduced into a host cell, thereby producing a transformed host cell. A vector may include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication (DNA sequences that participate in initiating DNA synthesis). A vector may also include one or more selectable marker genes and other genetic elements known in the art.

[0113] Virus: Microscopic infectious organism that reproduces inside living cells. A virus typically consists essentially of a core of nucleic acid (single- or double-stranded RNA or DNA) surrounded by a protein coat, and in some cases lipid envelope, and has the ability to replicate only inside a living cell. "Viral replication" is the production of additional virus by the occurrence of at least one viral life cycle.

[0114] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Hence "comprising A or B" means including A, or B, or A and B. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

III. Overview of Several Embodiments

[0115] Disclosed herein are recombinant rabies viruses having glycoprotein (G) genes from at least two different lyssaviruses. The disclosed viruses can be used as pan-lyssavirus vaccines to provide protection against infection by multiple genotypes of lyssavirus. Prior to the present disclosure, no vaccines had been described that protect against West Caucasian bat virus and/or lyssaviruses of genotypes 2 (Lagos bat virus) and 3 (Mokola virus). Thus, the recombinant rabies viruses described herein represent a significant advance in the development of vaccines for the prevention of rabies.

[0116] The recombinant rabies viruses exemplified herein are generating using a previously described reverse genetics system based on the ERA strain of rabies virus (PCT Publication No. WO 2007/047459). However, other reverse genetics systems for rabies virus (see, for example, Ito et al., J. Virol. 75(19):9121-9128) could be used to generate recombinant viruses having multiple lyssavirus G genes.

[0117] Provided herein is a recombinant rabies virus, wherein the genome of the recombinant rabies virus comprises rabies virus nucleoprotein (N), phosphoprotein (P), matrix protein (M), RNA-dependent RNA polymerase (L) and glycoprotein (G) genes and at least one, at least two or at least three different heterologous lyssavirus glycoprotein genes, wherein the lyssavirus is selected from Lagos bat virus (LBV), Mokola virus (MOKV), Duvenhage virus (DUVV), European bat lyssavirus-1 (EBLV-1), European bat lyssavirus-2 (EBLV-2), Australian bat lyssavirus (ABLV), Aravan virus (ARAV), Khujand virus (KHUV), Irkut virus (IRKV) and West Caucasian bat virus (WCBV). In particular embodiments, the lyssavirus is selected from LBV, MOKV and WCBV.

[0118] In some embodiments, the recombinant rabies virus comprises two heterologous G genes. In particular examples, the two heterologous G genes are from MOKV and WCBV. In other examples, the two heterologous G genes are from LBV and MOKV. In yet other examples, the two heterologous G genes are from LBV and WCBV.

[0119] In some embodiments, the recombinant rabies virus comprises three heterologous G genes. In particular examples, the three heterologous G genes are from LBV, MOKV and WCBV.

[0120] In some embodiments in which the recombinant rabies virus comprises a MOKV G gene, the nucleotide sequence of the MOKV G gene is at least 80%, is at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleotide sequence of SEQ ID NO: 47. In some embodiments in which the recombinant rabies virus comprises a WCBV G gene, the nucleotide sequence of the WCBV G gene at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleotide sequence of SEQ ID NO: 49. In some embodiments in which the recombinant rabies virus comprises the LBV G gene, the nucleotide sequence of the LBV G gene is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleotide sequence of SEQ ID NO: 53.

[0121] In some examples, the MOKV G gene comprises the nucleotide sequence of SEQ ID NO: 47, the WCBV G gene comprises the nucleotide sequence of SEQ ID NO: 49 and/or the LBV G gene comprises the nucleotide sequence of SEQ ID NO: 53. In particular examples, the MOKV G gene consists of the nucleotide sequence of SEQ ID NO: 47, the WCBV G gene consists of the nucleotide sequence of SEQ ID NO: 49 and/or the LBV G gene consists of the nucleotide sequence of SEQ ID NO: 53.

[0122] The heterologous G genes can be cloned into the rabies virus genome in any suitable location, and in any order, to allow for expression of the heterologous proteins without altering expression of the endogenous rabies virus genes. In some embodiments, heterologous G genes are inserted between the rabies virus P and M genes, between the rabies virus G and L genes and/or between the rabies virus N and P genes. In particular examples, the recombinant rabies virus comprises two heterologous G genes and the heterologous G genes are located between the rabies virus P and M genes and between the G and L genes. In other examples, the recombinant rabies virus comprises three heterologous G genes and the three heterologous G genes are located between the rabies virus N and P genes, between the rabies virus P and M genes and between the rabies virus G and L genes.

[0123] Insertion of heterologous genes into the rabies virus genome can be facilitated by synthesizing a transcriptional unit. The transcriptional unit is inserted at the desired gene junction and the heterologous G gene is cloned into the transcriptional unit. In some embodiments, the nucleotide sequence of the transcriptional unit is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO: 42. In some examples, the transcriptional unit comprises the nucleotide sequence of SEQ ID NO: 42.

[0124] In some embodiments, the genome of the recombinant rabies virus is derived from the rabies virus ERA strain. In some embodiments, the nucleotide sequence of the ERA strain genome comprises a sequence that is at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO: 1. In particular examples, the nucleotide sequence of the ERA strain genome comprises SEQ ID NO: 1.

[0125] In some embodiments, the recombinant rabies virus includes one or more attenuating mutations. In exemplary embodiments, the rabies virus glycoprotein comprises a Glu at amino acid position 333 (SEQ ID NO: 5).

[0126] Further provided is a vector comprising a full-length rabies virus antigenomic DNA, wherein the antigenomic DNA comprises rabies virus N, P, M, L and G genes, and wherein the vector further comprises at least one, at least two, or at least three different heterologous lyssavirus G genes, wherein the lyssavirus is selected from LBV, MOKV, DUVV, EBLV-1, EBLV-2, ABLV, ARAV, KHUV, IRKV and WCBV. In particular embodiments, the lyssavirus is selected from LBV, MOKV and WCBV.

[0127] In some embodiments, the vector comprises two different heterologous lyssavirus G genes. In particular examples, the two heterologous G genes are MOKV and WCBV G genes. In other examples, the two heterologous G genes are MOKV and LBV G genes. In other examples, the two heterologous G genes are LBV and WCBV G genes.

[0128] In some embodiments, the vector comprises three heterologous G genes. In particular examples, the three heterologous G genes are from LBV, MOKV and WCBV.

[0129] In some embodiments in which the vector comprises a MOKV G gene, the nucleotide sequence of the MOKV G gene is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleotide sequence of SEQ ID NO: 47. In some embodiments in which the vector comprises a WCBV G gene, the nucleotide sequence of the WCBV G gene is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleotide sequence of SEQ ID NO: 49. In some embodiments in which the vector comprises the LBV G gene, the nucleotide sequence of the LBV G gene is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleotide sequence of SEQ ID NO: 53.

[0130] In some examples, the MOKV G gene comprises the nucleotide sequence of SEQ ID NO: 47, the WCBV G gene comprises the nucleotide sequence of SEQ ID NO: 49 and/or the LBV G gene comprises the nucleotide sequence of SEQ ID NO: 53. In particular examples, the MOKV G gene consists of the nucleotide sequence of SEQ ID NO: 47, the WCBV G gene consists of the nucleotide sequence of SEQ ID NO: 49 and/or the LBV G gene consists of the nucleotide sequence of SEQ ID NO: 53.

[0131] The heterologous G genes can be cloned into the vector encoding the rabies virus genome in any suitable location, and in any order, to allow for expression of the heterologous proteins without altering expression of the endogenous rabies virus genes. In some embodiments, heterologous G genes are inserted between the rabies virus P and M genes, between the rabies virus G and L genes and/or between the rabies virus N and P genes. In particular examples, the recombinant rabies virus comprises two heterologous G genes and the heterologous G genes are located between the rabies virus P and M genes and between the G and L genes. In other examples, the recombinant rabies virus comprises three heterologous G genes and the three heterologous G genes are located between the rabies virus N and P genes, between the rabies virus P and M genes and between the rabies virus G and L genes.

[0132] In some embodiments, rabies virus antigenomic DNA inserted in the vector is derived from the rabies virus ERA strain. In some examples, the nucleotide sequence of the ERA strain antigenomic DNA comprises a sequence that is at least 90%, at least 95%, at least 98% or at least 99% identical to SEQ ID NO: 1. In particular examples, the nucleotide sequence of the ERA strain antigenomic DNA comprises SEQ ID NO: 1.

[0133] Further provided herein is a cell comprising one or more rabies virus vectors disclosed herein.

[0134] Also provided are compositions comprising the recombinant rabies viruses described herein and a pharmaceutically acceptable carrier. In some embodiments, the compositions further comprise an adjuvant.

[0135] Also contemplated are compositions comprising multiple recombinant rabies viruses, each encoding at least one heterologous G gene. In some embodiments, the compositions comprise (i) a first recombinant rabies virus, wherein the genome of the first recombinant rabies virus comprises a rabies virus G gene and at least one heterologous lyssavirus G gene; and (ii) a second recombinant rabies virus, wherein the genome of the second recombinant rabies virus comprises at least one G gene from a different lyssavirus (i.e. a lyssavirus G gene that is not in the first recombinant rabies virus); wherein the lyssavirus is selected from LBV, MOKV, DUVV, EBLV-1, EBLV-2, ABLV, ARAV, KHUV, IRKV and WCBV. In particular embodiments, the lyssavirus is selected from LBV, MOKV and WCBV. In some examples, the second recombinant rabies virus also includes a rabies virus G gene. In some examples, the first and/or second recombinant rabies virus comprises at least two heterologous G genes.

[0136] In some examples, the composition comprises (i) a first recombinant rabies virus, wherein the genome of the first recombinant rabies virus comprises a rabies virus G gene and a G gene from MOKV and WCBV; and (ii) a second recombinant rabies virus, wherein the genome of the second recombinant rabies virus comprises a G gene from LBV.

[0137] Further provided is a method of eliciting an immune response in a subject against lyssavirus by administering to the subject one or more recombinant rabies viruses or compositions disclosed herein. In some embodiments, the immune response in the subject against lyssavirus protects the subject against infection by at least three different genotypes of lyssavirus. In some embodiments, the immune response in the subject against lyssavirus protects the subject against infection by at least four different genotypes of lyssavirus. In some embodiments, the subject is a human. In other embodiments, the subject is a non-human animal.

IV. Determinants of Rabies Virus Pathogenicity

[0138] Rabies virus (RABV) is a rhabdovirus--a non-segmented RNA virus with negative sense polarity. Within the Rhabdoviridae family, rabies virus is the prototype of the Lyssavirus genus. Lyssaviruses are composed of two major structural components, a nucleocapsid or ribonucleoprotein (RNP), and an envelope in the form of a bilayer membrane surrounding the RNP core. The infectious component of all rhabdoviruses is the RNP core, which consists of the negative strand RNA genome encapsidated by nucleoprotein (N) in combination with RNA-dependent RNA-polymerase (L) and phosphoprotein (P). The membrane surrounding the RNP contains two proteins, the trans-membrane glycoprotein (G) and the matrix (M) protein, located at the inner site of the membrane. Thus, the viral genome codes for these five proteins: the three proteins in the RNP (N, L and P), the matrix protein (M), and the glycoprotein (G).

[0139] The molecular determinants of pathogenicity of various rabies virus strains have not been fully elucidated. RABV pathogenicity was attributed to multigenic events (Yamada et al., Microbiol. Immunol. 50:25-32, 2006). For example, some positions in the RABV genome if mutated, affect viral transcription or replication, reducing virulence. Mutations at serine residue 389 of the phosphorylation site in the N gene (Wu et al., J. Virol. 76:4153-4161, 2002) or GDN core sequence of the highly conserved C motif in the L gene (Schnell and Conzelmann, Virol. 214:522-530, 1995) dramatically reduced RABV transcription and replication.

[0140] The G protein, also referred to as spike protein, is involved in cell attachment and membrane fusion of RABV. The amino acid region at position 330 to 340 (referred to as antigenic site III) of the G protein has been identified as important for virulence of certain strains of RABV. Several studies support the concept that the pathogenicity of fixed RABV strains is determined by the presence of arginine or lysine at amino acid residue 333 of the glycoprotein (Dietzschold et al., Proc. Natl. Acad. Sci. USA 80: 70-74, 1983; Tuffereau et al., Virology 172: 206-212, 1989).

[0141] This phenomenon seems to apply at least to fixed rabies viruses such as CVS, ERA, PV, SAD-B19 and HEP-Flury strains (Anilionis et al., Nature 294:275-278, 1981; Morimoto et al., Virology 173:465-477, 1989). For example, rabies vaccine viruses possessing an amino acid differing from Arg at position 333 of the glycoprotein are described, for instance, in WO 00/32755 (describing RABV mutants in which all three nucleotides in the G protein Arg.sub.333 codon are altered compared to the parent virus, such that the Arg at position 333 is substituted with another amino acid); European Patent 350398 (describing an avirulent RABV mutant SAG1 derived from the Bern SAD strain of RABV, in which the Arg at position 333 of the glycoprotein has been substituted to Ser); and European patent application 583998 (describing an attenuated RABV mutant, SAG2, in which the Arg at position 333 in the G protein has been substituted by Glu).

[0142] Other strains, such as the RC-HL strain, possess an arginine residue at position 333 of the G, but do not cause lethal infection in adult mice (Ito et al., Microl. Immunol. 38:479-482, 1994; Ito et al., J. Virol. 75:9121-9128, 2001). As such, the entire G may contribute to the virulence of RABV, although the determinants or regions have not been fully elucidated.

[0143] The G gene encodes the only protein that induces viral neutralizing antibody. At least three states of RABV glycoprotein are known: the native state (N) being responsible for receptor binding; an active hydrophobic state (A) necessary in the initial step in membrane fusion process (Gaudin, J. Cell Biol. 150:601-612, 2000), and a fusion inactive conformation (I). Correct folding and maturation of the G protein play important roles for immune recognition. The three potential glycosylated positions in ERA G extracellular domain occur at Asn.sup.37, Asn.sup.247 and Asn.sup.319 residues (Wojczyk et al., Glycobiology. 8: 121-130, 1998). Nonglycosylation of G not only affects conformation, but also inhibits presentation of the protein at the cell surface.

[0144] It has been previously demonstrated (see PCT Publication No. WO 2007/047459, which is incorporated herein by reference) that expression of G enhances the anti-RABV immune response. In addition, introduction of an Arg to Glu mutation at amino acid position 333 of RABV ERA glycoprotein results in an attenuated virus (referred to as ERAg3). This attenuated virus is capable of eliciting significant titers of neutralizing antibodies in animals and conferring protection against wild-type virus challenge. Furthermore, as described in PCT Publication No. WO 2007/047459, a recombinant RABV comprising two copies of glycoprotein with the G333 mutation is particularly useful as a vaccine due to its ability to elicit high titers of neutralizing antibodies without morbidity or mortality. In some examples herein, a recombinant rabies virus comprising the G333 mutation in glycoprotein is used as a platform to introduce one or more (such as one, two or three) additional G genes from one or more different genotypes of lyssavirus. However, one of ordinary skill in the art will recognize that any one of a number of recombinant rabies viruses can be used to incorporate heterologous sequences using the reverse genetics systems disclosed in PCT Publication No. WO 2007/047459 (or another rabies virus reverse genetics system) as summarized below.

V. Rabies Virus Reverse Genetics System

[0145] RNA cannot readily be manipulated directly by molecular biological methods. Traditional RNA virus vaccines are from naturally attenuated isolates, which are difficult to control and provide unpredictable results. Reverse genetics technology makes it possible to manipulate RNA viruses as DNA, which can be mutated, deleted or reconstructed according to deliberate designs. Every gene function can be studied carefully, independently, and in concert, which benefits vaccine development. Reverse genetics involves reverse transcription of the RNA viral genome into cDNA, and cloning into a vector, such as a plasmid. After transfection of host cells, the vector is transcribed into RNA, to be encapsidated by viral structural proteins, which can also be supplied by plasmids. The encapsidated RNA forms a ribonucleoprotein complex, which results in virions that can be recovered.

[0146] An efficient reverse genetics system based on the rabies virus ERA strain is described in PCT Publication No. WO 2007/047459, which is incorporated herein by reference. This rabies reverse genetics system is useful for a variety of purposes, including to attenuate ERA virus in a defined manner for vaccine development and to produce ERA virus vectors for expression of heterologous proteins, such as a protein from another lyssavirus for the generation of a pan-lyssavirus vaccine.

[0147] The reverse genetics system disclosed in PCT Publication No. WO 2007/047459 has some or all of the following characteristics, illustrated schematically in FIG. 1A using the exemplary ERA strain antigenomic cDNA.

[0148] The rabies virus reverse genetics system is based on a full length transcription plasmid plus a plurality of helper plasmids (e.g., five helper plasmids). The helper plasmids encode the N, P and L proteins, and optionally the G protein, as well as the T7 polymerase. Although the G protein is not necessary for virus rescue, it improves virus recovery efficiency or virus budding when included in transfection.

[0149] Transcription involves both cellular RNA dependent RNA polymerase II, which is available in mammalian cells, and T7 RNA polymerase, which is supplied by pNLST7 plasmids. The dual polymerases result in virus recovery efficiency that is both high and stable.

[0150] In the transcription plasmid, hammerhead and hepatitis delta virus ribozymes flank a rabies virus (e.g., ERA strain) antigenomic cDNA, enabling the production of authentic 5' and 3' ends of antigenomic viral RNA by transcription. The first ten nucleotides of the hammerhead sequence are designed to be complementary to the first ten nucleotides of the antisense genomic sequence.

[0151] Two modified T7 RNA polymerase constructs support virus recovery more efficiently than the wild type T7 RNA polymerase applied previously. One T7 RNA polymerase has been mutated from the first ATG to AT. The second T7 RNA polymerase has an eight amino acid nuclear localization signal (NLS) derived from the SV40 virus large T antigen fused after the first ATG from the parental T7. Addition of the NLS results in the T7 RNA polymerase being present predominantly in the nucleus. Following transfection mechanism of the NLS modified plasmid, the DNA/transfection reagent complex binds to the surface of the cell. Through endocytosis, the complex is taken into the endosome/lysosome, and the DNA is released into the cytosol. In the absence of the NLS, the majority of the transfected plasmids are retained in the cytosol and only a small percentage of the released DNA reaches the nucleus, where it is transcribed into RNA. After protein synthesis, the NLST7 RNA polymerase is transported back to the cell nucleus, and the helper plasmids (with T7/CMV promoters) in the nucleus will be transcribed by both NLST7 and cellular polymerase II. Thus, more mRNAs of the helper plasmids and cRNA of the full-length pTMF or its derivatives are synthesized and result in high efficiency of virus recovery.

[0152] After the initial expression of NLST7 by the CMV promoter, NLST7 polymerase binds to pT7 for transcription of the NLST7 gene. Through modification of the transcripts in the nucleus, more NLST7 mRNA is synthesized, resulting in greater expression of NLST7 polymerase. The pT7 of the NLST7 polymerase as well as of the full length antigenomic transcription unit is under the control of the NLST7 polymerase, which acts as an "autogene." The autogene mechanism of NLST7 RNA polymerase is illustrated in FIG. 2. After expression of T7 RNA polymerase in the nucleus, the transfected T7 constructs continue to transcribe full length RNA template for N protein encapsidation and/or L protein binding, enhancing virus recovery efficiency.

[0153] The T7 polymerase, and all other plasmids, except the N protein encoding plasmid pTN, are placed under control of both CMV and T7 transcriptional regulatory elements. The N protein encoding nucleic acid is under the control of a T7 promoter and is translated in cap-independent manner based on an IRES (internal ribosome entry site). Cellular RNA polymerase II alone can help the recovery of RABV if all the plasmids were cloned under the control of the CMV promoter. In the ERA reverse genetics system disclosed in PCT Publication No. WO 2007/047459, only pTN is under the control of the T7 promoter and is translated in a cap-independent manner. All other constructs are under control of both CMV and the T7 transcriptional regulatory elements. Typically, in RABV, N synthesis is abundant and the ratio among N, P and L is approximately 50:25:1. To mimic the wild type viral transcription and assembly in RABV reverse genetics, N expression should be the highest. With the aid of NLST7 polymerase and IRES translation mode, N protein is expressed efficiently after plasmid transfection. This reduces competition for transcription with housekeeping genes in host cells, because the T7 transcription initiation signal does not exist in mammalian cells, and results in increased efficiency of T7 transcription.

[0154] In addition, as described in PCT Publication No. WO 2007/047459, to enhance production of viral proteins, the helper plasmids can be constructed to incorporate a Kozak sequence that has been optimized for the translation efficiency for each protein encoding sequence. After five days post-transfection in the ERA reverse genetics system, the rescued viruses reliably and repeatably grew to 10.sup.7 FFU/ml without further amplification.

[0155] Recombinant rabies viruses with favorable properties for vaccination can be designed using, for example, the reverse genetics system disclosed in PCT Publication No. WO 2007/047459. Modified strains having mutated glycoproteins are particularly suited for use as immunogenic compositions. This RABV reverse genetics system also enables a rabies virus vector system for foreign (heterologous) gene expression. An extra transcription unit was previously demonstrated to be functional in two different locations after incorporation into the RABV ERA genome. Thus, the RABV reverse genetics system provides a means for introducing heterologous proteins. In some examples, the heterologous protein is a glycoprotein from a lyssavirus other than the RABV ERA strain.

VI. Administration and Use of Recombinant Rabies Virus Compositions

[0156] The recombinant rabies viruses provided herein comprise at least one heterologous nucleic acid sequence encoding a glycoprotein from a lyssavirus other than RABV ERA. The immunogenic compositions provided herein are designed to provide protection to multiple lyssavirus genotypes, and in some cases, provide protection against all 11 known lyssavirus genotypes. The immunogenic compositions provided herein are contemplated for use with both human and non-human animals.

[0157] The immunogenic formulations may be conveniently presented in unit dosage form and prepared using conventional pharmaceutical techniques. Such techniques include the step of bringing into association the active ingredient and the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers. Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of a sterile liquid carrier, for example, water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets commonly used by one of ordinary skill in the art.

[0158] In certain embodiments, unit dosage formulations are those containing a dose or unit, or an appropriate fraction thereof, of the administered ingredient. It should be understood that in addition to the ingredients particularly mentioned above, formulations encompassed herein may include other agents commonly used by one of ordinary skill in the art.

[0159] The compositions provided herein, including those for use as immunogenic compositions, may be administered through different routes, such as oral, including buccal and sublingual, rectal, parenteral, aerosol, nasal, intramuscular, subcutaneous, intradermal, and topical. They may be administered in different forms, including but not limited to solutions, emulsions and suspensions, microspheres, particles, microparticles, nanoparticles, and liposomes. In some embodiments, the immunogenic compositions are administered orally.

[0160] The volume of administration will vary depending on the route of administration. Those of ordinary skill in the art will know appropriate volumes for different routes of administration.

[0161] Administration can be accomplished by single or multiple doses. The dose administered to a subject in the context of the present disclosure should be sufficient to induce a beneficial therapeutic response over time, such as to prevent lyssavirus infection or the development of rabies. The dose required may vary depending on, for example, the age, weight and general health of the subject.

[0162] The amount of immunogenic composition in each dose is selected as an amount that induces an immunostimulatory response without significant, adverse side effects. Such amount will vary depending upon which specific composition is employed and how it is administered. Initial doses may range from about 1 .mu.g to about 1 mg, with some embodiments having a range of about 10 .mu.g to about 800 and still other embodiments a range of from about 25 .mu.g to about 500 .mu.g. Following an initial administration of the immunogenic composition, subjects may receive one or several booster administrations, adequately spaced. Booster administrations may range from about 1 .mu.g to about 1 mg, with other embodiments having a range of about 10 .mu.g to about 750 .mu.g, and still others a range of about 50 .mu.g to about 500 .mu.g. Periodic boosters at intervals of 1-5 years, for instance three years, may be desirable to maintain the desired levels of protective immunity. In preferred embodiments, subjects receive a single dose of an immunogenic composition.

[0163] Provided herein are pharmaceutical compositions (also referred to as immunogenic or immunostimulatory compositions) which include a therapeutically effective amount of a recombinant RABV alone or in combination with a pharmaceutically acceptable carrier. In some embodiments, the recombinant RABV comprises a heterologous protein, such as glycoprotein from another lyssavirus that causes rabies.

[0164] Pharmaceutically acceptable carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The carrier and composition can be sterile, and the formulation suits the mode of administration. The composition can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, and magnesium carbonate. Any of the common pharmaceutical carriers, such as sterile saline solution or sesame oil, can be used. The medium can also contain conventional pharmaceutical adjunct materials such as, for example, pharmaceutically acceptable salts to adjust the osmotic pressure, buffers, preservatives and the like. Other media that can be used with the compositions and methods provided herein are normal saline and sesame oil.

[0165] The recombinant RABVs described herein can be administered alone or in combination with other therapeutic agents to enhance antigenicity. For example, the recombinant viruses can be administered with an adjuvant, such as Freund incomplete adjuvant or Freund's complete adjuvant.

[0166] Optionally, one or more cytokines, such as IL-2, IL-6, IL-12, RANTES, GM-CSF, TNF-.alpha., or IFN-.gamma., one or more growth factors, such as GM-CSF or G-CSF; one or more molecules such as OX-40L or 41 BBL, or combinations of these molecules, can be used as biological adjuvants (see, for example, Salgaller et al., 1998, J. Surg. Oncol. 68(2):122-38; Lotze et al., 2000, Cancer J. Sci. Am. 6(Suppl 1):S61-6; Cao et al., 1998, Stem Cells 16(Suppl 1):251-60; Kuiper et al., 2000, Adv. Exp. Med. Biol. 465:381-90). These molecules can be administered systemically (or locally) to the host.

[0167] A number of means for inducing cellular responses, both in vitro and in vivo, are known. Lipids have been identified as agents capable of assisting in priming CTL in vivo against various antigens. For example, as described in U.S. Pat. No. 5,662,907, palmitic acid residues can be attached to the alpha and epsilon amino groups of a lysine residue and then linked (for example, via one or more linking residues, such as glycine, glycine-glycine, serine, serine-serine, or the like) to an immunogenic peptide. The lipidated peptide can then be injected directly in a micellar form, incorporated in a liposome, or emulsified in an adjuvant. As another example, E. coli lipoproteins, such as tripalmitoyl-S-glycerylcysteinlyseryl-serine can be used to prime tumor specific CTL when covalently attached to an appropriate peptide (see, Deres et al., Nature 342:561, 1989). Further, as the induction of neutralizing antibodies can also be primed with the same molecule conjugated to a peptide which displays an appropriate epitope, two compositions can be combined to elicit both humoral and cell-mediated responses where that is deemed desirable.

[0168] The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described.

EXAMPLES

Example 1

Construction of Plasmids for a Reverse Genetics System for Rabies Virus

[0169] This example describes the design and development of a reverse genetics system for rabies virus. Rabies virus strain ERA was obtained from the ATCC and was prepared as described (Wu et al., J. Virol. 76, 4153-4161, 2002). To obtain virus genome full-length virus cDNA, BSR cells (a clone of baby hamster kidney, BHK, cells) were infected with ERA strain virus and grown in Dulbecco's minimal essential medium supplemented with 10% of fetal bovine serum. Supernatants were recovered and subjected to centrifugation at 22,000 g for 1 hour. The virus pellets were collected for viral genomic RNA purification by use of a RNA virus extraction kit purchased from Qiagen (Valencia, Calif.) according to the manufacturer's instructions. The integrity of viral genomic RNA was confirmed by gel electrophoresis. Viral genomic cDNA was transcribed with the first-strand cDNA synthesis kit from Life Technologies (Carlsbad, Calif.). The reverse transcription (RT) reaction mixture was applied to amplification by the polymerase chain reaction (PCR) for the synthesis of full-length viral genomic cDNA, N, P, G and L genes, respectively. For assembling the full-length virus genomic cDNA, a pTMF plasmid was constructed in four sequential steps as illustrated schematically in FIG. 1B. Superscript III reverse transcriptase and proof reading platinum pfx polymerase (Life Technologies, Carlsbad, Calif.) were applied for cDNA transcript synthesis and consecutive PCR amplifications. For reverse transcription reactions, 1 .mu.g of purified genomic RNA was used in the RT reaction mix and incubated at 50.degree. C. for 80 min, followed by heating at 85.degree. C. for 5 minutes to inactivate Superscript III. After the RT reaction, 1 unit of RNaseH was added to digest template RNA in the cDNA-RNA hybrids.

[0170] To generate full-length virus genomic cDNA, two overlapping fragments were amplified by RT-PCR as follows: Fragment1 (F1) was RT-PCR amplified with primers: Le5-Kpn (CCGGGTACCACGCTTAAC AACCAGATCAAAGA; SEQ ID NO: 8, Kpn1 recognition site shown in bold) and Le3-Blp (TAGGTCGCTTGCTAAGCACTCCTGGTAGGAC; SEQ ID NO: 9, Blp1 recognition site shown in bold). Fragment 2 (F2) was RT-PCR amplified with primers: Tr5-Blp (GTCCTACCAGGAGTGCTTAGCAAGCGACCTA; SEQ ID NO: 10, Blp1 recognition site shown in bold) and Tr3-Pst (AAAACTGCAGACGCTTAACAAATAAACAACAAAA; SEQ ID NO: 11, Pst1 recognition site shown in bold). After successful synthesis of the above two fragments, F1 digested by Kpn1 and Blp1 restriction enzymes was subjected to gel purification and cloned to pBluescriptIISK(+) phagemid (Stratagene, La Jolla, Calif.) to form the pSKF1 plasmid. The gel purified F2 fragment, cut by Blp1 and Pst1 was consecutively cloned to the pSKF1 plasmid to form the full-length viral antigenomic cDNA. Hammerhead ribozyme (oligo1, CAAGGCTAGCTGTTAAGCGTCTGATGAGTCCGTGAGGACGAAACTATAGGAAAGGAA TTCCTATAGTCGGTACCACGCT; SEQ ID NO: 12, Nhe1 and Kpn1 recognition sites shown in bold; oligo2, AGCGTGGTACCGACTATAGGAATTCCTTTCCTATAGTTTCGTCCTCACGGACTCATCAG ACGCTTAACAGCTAGCCTTG; SEQ ID NO: 13, Kpn1 and Nhe1 recognition sites shown in bold) was synthesized containing a Nhe1 recognition site at the 5' end and a Kpn1 site at the 3' end. This was fused ahead of the 5' end of the F1 fragment. A hepatitis delta virus ribozyme (oligo3, GACCTGCAGGGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCTGGGCATCCGA AGGAGGACGCACGTCCACTCGGATGGCTAAGGGAGGGCGCGGCCGCACTC; SEQ ID NO: 14, Pst1 and Not1 recognition sites shown in bold; oligo4, GAGTGCGGCCGCGCCCTCCCTTAGCCATCCGAGTGGACGTGCGTCCTCCTTCGGATGC CCAGGTCGGACCGCGAGGAGGTGGAGATGCCATGCCGACCCCTGCAGGTC; SEQ ID NO: 15, Not1 and Pst1 recognition sites shown in bold) (Symons, Annu. Rev. Biochem. 61: 641-671, 1992) was synthesized, having a Pst1 site at its 5' end and a Not1 site at its 3' end, and was fused to the 3' end of the F2 fragment. The connective Kpn1 recognition site, between the hammerhead ribozyme and the F1 fragment, and the Pst1 site between the F2 fragment and the hepatitis delta virus ribozyme, were deleted by site-directed mutagenesis. The full-length viral antigenomic cDNA was sandwiched by the hammerhead and hepatitis delta virus ribozymes. This was removed and cloned to the pBluescriptIISK(+) phagemid to make a pSKF construct. The full viral antigenomic cDNA with two ribozymes was fused downstream of the T7 transcription initiation site under control of the CMV immediate-early promoter in pcDNA3.1/Neo (+) plasmid (Life Technologies, Carlsbad, Calif.). This last step finished the construction of the pTMF plasmid.

[0171] The wild type ERA viral genome includes a polyA tract of eight residues (polyA.sub.8) in the intergenic region between the G and Psi regions. To distinguish the rescued ERA (rERA) virus from the parental strain, a stretch of seven A (polyA.sub.7) was introduced to the pTMF construct by deletion of one A instead of the original polyA.sub.8. After rERA virus was recovered, RT-PCR was performed and subsequent sequence data confirmed the existence of the introduced poly A.sub.7 sequence marker.

[0172] pTN plasmid: The N gene was amplified by RT-PCR with primers (5N: ACCACCATGGATGCCGACAAGATTG; SEQ ID NO: 16, Nco1 recognition site and start codon shown in bold; and 3N: GGCCCATGGTTATGAGTCACTCGAATATGTCTT; SEQ ID NO: 17, Nco1 recognition site and stop codon shown in bold) and cloned to the pCITE-2a(+) (Cap-Independent Translation Enhancer) plasmid (Novagen, Madison Wis.).

[0173] pMP plasmid: the P gene was amplified by RT-PCR with primers (5P: TTGGTACCACCATGAGCAAGATCTTTGTCAATC; SEQ ID NO: 18, Kpn1 recognition site and start codon shown in bold; and 3P: GGAGAGGAATTCTTAGCAAGATGTATAGCGATTC; SEQ ID NO: 19, EcoR1 recognition site and stop codon shown in bold) and cloned to the pcDNA3.1/Neo (+) plasmid.

[0174] pMG plasmid: the G gene was amplified by RT-PCR with primers (5G: TTGGTACCACCATGGTTCCTCAGGCTCTCCTG; SEQ ID NO: 20, Kpn1 recognition site and start codon shown in bold; and 3G: AAAACTGCAGTCACAGTCTGGTCTCACCCCCAC; SEQ ID NO: 21, Pst1 recognition site and stop codon shown in bold) and cloned to the pcDNA3.1/Neo (+) plasmid.

[0175] pML plasmid: the L gene was amplified by RT-PCR with primers (5L: ACCGCTAGCACCACCATGCTCGATCCTGGAGAGGTC; SEQ ID NO: 22, Nhe1 recognition site and start codon shown in bold; and 3L: AAAACTGCAGTCACAGGCAACTGTAGTCTAGTAG; SEQ ID NO: 23, Pst1 recognition site and stop codon shown in bold) and cloned to the pcDNA3.1/Neo (+) plasmid.

[0176] pT7 plasmid: genomic DNA from bacteria BL-21 (Novagene, Madison, Wis.) was extracted with the Dneasy Tissue Kit (Qiagen, Valencia, Calif.) according to the manufacturer's instructions. The T7 RNA polymerase gene was amplified from the purified genomic DNA by PCR with primers (5T7: TCGCTAGCACCACCATGAACACGATTAACATCGCTAAG; SEQ ID NO: 24, Nhe1 recognition site and start codon shown in bold; and 3T7: GATGAATTCTTACGCGAACGCGAAGTCCGACTC; SEQ ID NO: 25, EcoR1 recognition site and stop codon shown in bold) and cloned to the pcDNA3.1/Neo (+) plasmid.

[0177] pNLST7 plasmid: an eight amino acid nuclear location signal (NLS), derived from SV40 large T antigen, was added to the N terminus of the T7 RNA polymerase by PCR amplification, using the pT7 plasmid as the template, with primers (5T7NLS: TCGCTAGCCACCATGCCAAAAAAGAAGAGAAAGGTAGAAAACACGATTAACATCGCT AAGAAC; SEQ ID NO: 26, NLS shown in bold and 3T7 primer). The amplified fragment was designated NLST7, and was cloned to pcDNA3.1/Neo (+) to form the pNLST7 construct.

[0178] pGFP plasmid: Monster Green Fluorescent Protein (GFP) plasmid phMGFP was purchased from Promega (Madison, Wis.). The GFP gene was amplified by PCR with primers (GFP5: AAAACTGCAGGCCACCATGGGCGTGATCAAG; SEQ ID NO: 27, Pst1 recognition site and start codon shown in bold; and GFP3: CCGCTCGGTACCTATTAGCCGGCCTGGCGGG; SEQ ID NO: 28, Kpn1 recognition site and stop codon shown in bold) and cloned to the pcDNA3.1/Neo (+) plasmid.

[0179] All plasmid constructs were sequenced at least three times to confirm the absence of unexpected mutations or deletions after cloning, site-directed mutagenesis, or gene deletion. Additionally, the presence of a marker sequence consisting of a polyA tract having seven adenosine residues rather than the eight residues observed in the wild type ERA genome between the glycoprotein and Psi region was confirmed.

Example 2

Defined Modification of Rabies Virus Evelyn-Rokitnicki-Abelseth (ERA) Strain

[0180] In addition to the parental ERA virus strain described above, derivative virus strains were developed using the reverse genetics system disclosed herein. Several exemplary modified viruses were produced, namely ERA--(deletion of the whole psi-region), ERAgreen1 (green florescent protein gene inserted in ERA viral genome psi region), ERAgreen2 (green florescent protein gene inserted in phosphoprotein and matrix protein intergenic region), ERA2g (containing an extra copy of glycoprotein in the psi-region), ERAg3 (with a mutation at amino acid 333 in glycoprotein), ERA2g3 (with an extra copy of mutated glycoprotein at Aa333 in psi-region), ERA-G (with glycoprotein deleted) ERAgm (M and G genes switched in the genome), and ERAgmg (two copies of G in the rearranged ERAgm construct) These derivatives are illustrated schematically in FIG. 3. By optimizing the growth conditions as described, all of the rescued viruses can be obtained at virus titers of 10.sup.9 to 10.sup.10 ffu/ml in both tissue culture flasks and bioreactors.

Gene Deletion and Site-Directed Mutagenesis in the Reverse Genetics System

[0181] Deletion of the Psi Region of the Rabies Virus ERA Genome

[0182] The complete Psi-region of the rabies virus ERA genome was deleted as follows: 3'.DELTA..psi. fragment was amplified using pTMF as template by PCR with primers (5.DELTA..psi.: CCCTCTGCAGTTTGGTACCGTCGAGAAAAAAACATTAGATCAGAAG; SEQ ID NO: 29, Pst1 and Kpn1 recognition sites shown in bold; and Le3-Blp primer) and was cloned to pCR-BluntII-TOPO vector (Life Technologies, Carlsbad, Calif.) for the construction of pP.DELTA.5.psi. plasmid. The 5'.DELTA..psi. fragment was amplified using the same template by PCR with primers (SnaB5: ATGAACTTTCTACGTAAGATAGTG; SEQ ID NO: 30, SnaB1 recognition site shown in bold; and 3.DELTA..psi.: CAAACTGCAGAGGGGTGTTAGTTTTTTTCAAAAAGAACCCCCCAAG; SEQ ID NO: 31, Pst1 recognition site shown in bold) was successively cloned to the above pP.DELTA.5.psi. plasmid to finish the construction of the pP.DELTA..psi. plasmid. The fragment recovered by SnaB1 and Pst1 restriction enzyme digestion from the pP.DELTA..psi. plasmid substituted the counterpart in the pSKF construct to make the pSKF.DELTA..psi. plasmid. The whole DNA fragment containing the ERA genomic cDNA, digested by Nhe1 and Not1 from pSKF.DELTA..psi. plasmid, was re-cloned to the pcDNA3.1/Neo (+) plasmid to finalize the construction of pTMF.DELTA..psi.. For verification of the rescued strain lacking Psi, designated Era-, primers covering the Psi-region were applied in RT-PCR with total RNA from ERA-infected BSR cells. A 400 bp fragment corresponding to the Psi region was amplified only from rERA virus, but not from ERA. Sequence data verified the complete deletion of the Psi-region.

[0183] Deletion of the Glycoprotein Gene in the Rabies Virus ERA Genome:

[0184] The 5'g.DELTA..psi. fragment was amplified using pSKF as template by PCR with primers (SnaB5 primer, and 3.DELTA.g: CAAACTGCAGAGGGGTGTTAGTTTTTTTCACATCCAAGAGGATC; SEQ ID NO: 32). After digestion by SnaB1 and Pst1 restriction enzymes, this recovered fragment was cloned to replace its counterpart in the pSKF.DELTA..psi. construct. The 3'g.DELTA..psi. fragment was amplified using the same template by PCR with primers (5.DELTA.g: CCTCTGCAGTTTGGTACCTTGAAAAAAACCTGGGTTCAATAG; SEQ ID NO: 33, and Le3-Blp primer), and was consecutively cloned to the modified pSKF.DELTA..psi., to replace its counterpart. The final fragment, recovered by SnaB1 and Blp1 restriction enzymes cut from this pSKF.DELTA..psi. without the G gene, was re-cloned to pcDNA3.1/Neo (+) plasmid to form the pTMF.DELTA.g construct for virus recovery.

[0185] Glycoprotein Gene Site-Directed Mutagenesis:

[0186] Site directed mutagenesis to introduce a three nucleotide change from AGA to GAG at amino acid position 333 of the glycoprotein was performed as previously described (Wu et al., J. Virol. 76: 4153-4161, 2002). The primers in the mutagenesis reaction were M5G primer: CTCACTACAAGTCAGTCGAGACTTGGAATGAGATC (SEQ ID NO: 34, the three mutated nucleotides shown in bold) and M3G primer: GACTGACTTTGAGTGAGCATCGGCTTCCATCAAGG (SEQ ID NO: 35). For the recovered strain (ERAg3), three nucleotide changes from AGA to GAG at amino acid position 333 (aa333) were confirmed by sequencing after RT-PCR with primers 5G and 3G. After confirmation by DNA sequencing, the mutated G was cloned back to the pTMF plasmid to make the pTMFg3 construct for virus recovery. The glycoprotein encoded by this mutated G gene is represented by SEQ ID NO: 7.

Incorporation of an Exogenous ORF into ERA Rabies Virus Genome

[0187] To express exogenous ORFs in RABV, an extra transcription unit with Pst1 and Kpn1 recognition sites were created and incorporated at the Psi or P-M gene intergenic regions, respectively. In brief, for creation of an extra transcription unit at the Psi-region, the same steps were followed, except for the 5.DELTA..psi. fragment amplification step, the 3.DELTA..psi. primer was changed to 3.DELTA..psi.cis: CCAAACTGCAGCGAAAGGAGGGGTGTTAGTTTTTTTCATGATGAACCCCCCAAGGGGA GG (SEQ ID NO: 36). The final construct without the Psi-region, but with an extra transcription unit, was designated as pMTF.DELTA..psi.cis. The GFP, ERA G, or mutated G at amino acid residues 333 were cloned to this transcriptional unit to form pMTFgfp1, pMTF2g, pMTFg3, pMTF2g3 constructs, respectively, for virus rescue.

[0188] To incorporate an extra transcription unit to the P-M intergenic region, the cisp5 fragment was amplified using pMTF as template with primers cis55: GACTCACTATAGGGAGACCCAAGCTGGCTAGCTGTTAAG (SEQ ID NO: 37), cis53: CCAAACTGCAGCGAAAGGAGGGGTGTTAGTTTTTTTCATGTTGACTTTAGGACATCTCG G (SEQ ID NO: 38), and was cloned in substitution of its counterpart in the pMTF plasmid. The cisp3 fragment was amplified and cloned in a similar way with primers cis35: CCTTTCGCTGCAGTTTGGTACCGTCGAGAAAAAAACAGGCAACACCACTGATAAAATG AAC (SEQ ID NO: 39) and cis33: CCTCCCCTTCAAGAGGGCCCCTGGAATCAG (SEQ ID NO: 40). After assembling the cisp5 and cisp3 fragments together, the final construct was designated as pMTFcisp, for accepting ORFs. The recombinant construct containing the GFP gene was named pTMFgfp2 for virus recovery.

[0189] To produce an ERA derivative, designated ERAgm, in which the glycoprotein encoding sequence was reversed in order with the matrix protein encoding sequence, the glycoprotein gene was deleted as described above. The G gene (amplified as disclosed above) was then inserted between P and M genes, yielding a rabies virus genome in the order of N-P-G-M-L. Similarly, the same strategy was applied to produce the ERAg3m derivative, in which the glycoprotein has a triple nucleotide mutation at 333 amino acid residue (from AGA to GAG) by substituting the G gene produced by site directed mutagenesis as described above. To produce the ERAgmg construct, an extra copy of glycoprotein gene was inserted between P and M genes, and made the rabies virus genome in the order of N-P-G-M-G-L.

[0190] An extra transcription unit was modified and incorporated into two different regions of the ERA genome, namely psi-region and P-M intergenic region. When heterologous ORFs are incorporated into these transcription units, designated trans 1 and trans 2, respectively, efficient production of the encoded product results.

Sequence of the transcription unit is: CTAACACCCCTCCTTTCGCTGCAGTTTGGTACCGTCGAGAAAAAAA (SEQ ID NO: 41, Pst1 and Kpn1 were underlined).

Example 3

Recovery of Parental and Derivative Viruses

[0191] This example describes the recovery of parental ERA virus and exemplary derivatives using the reverse genetics system disclosed herein. BSR cells were transfected at near 80% confluence in six-well-plates with viral full length transcription plasmid pTMF (pTMF.DELTA..psi., pTMFg3, pTMF2g, pTMF2g3, pTMFgfp1, pTMFgfp2, pTMF.DELTA.g, pTMFgm, or pTMFgmg, respectively) at 3 .mu.g/well, together with five helper plasmids: pTN (1 .mu.g/well), pMP (0.5 .mu.g/well), pML (0.5 .mu.g/well), pMG (0.5 .mu.g/well) and pNLST7 (1 .mu.g/well) by TransIT-LT1 reagent (Mirus, Madison, Wis.) following the protocol recommended by the manufacturer. Four days after transfection, 1 ml of fresh BSR cell suspension (about 5.times.10.sup.5 cells) was added to each well. Cells were incubated at 37.degree. C., 5% CO.sub.2 for 3 days. Cell supernatants were collected for virus titration.

[0192] To titrate the recovered virus, monolayers of BSR cells in LAB-TEK eight-well-plates (Naperville, Ill.) were infected with serial 10-fold dilutions of virus supernatant and incubated at 37.degree. C., 0.5% CO.sub.2 for 48 h. Cells were fixed in 80% chilled acetone at room temperature for 1 h and stained with FITC-labeled anti-rabies virus N monoclonal antibody at 37.degree. C. for 30 minutes. After three rinses of the plates with PBS, stained foci were counted using direct fluorescent microscopy. Details for direct RABV fluorescent assay (DFA) can be found on the World Wide Web at cdc.gov/ncidod/dvrd/rabies/professional/publications/DFA-diagnosis/DFA_pr- otocol.htm.

[0193] All of the viruses except ERA-G were recovered at high titer from cultured BSR cells as indicated in Table 1. Surprisingly, rearrangement and switching of the G gene with the M gene did not hinder recovery of recombinant derivative ERA virus. Rearrangement of the G gene in the RABV genomes was previously not believed feasible due to cell death from overexpression of G protein (Faber et al., J. Virol. 76:3374-3381, 2002). However, these results demonstrate that rearrangement is possible in the ERA strain. Accordingly, it is likely that RABV gene shuffling is possible not only for the G gene, but also for other genes as well.

[0194] The ERA-G (without G) virus was recovered after plasmid transfection following the same procedure as for the other viral constructs rescue, but virus foci were very limited and restrained in local areas after the first round of transfection. The rescued virus was not capable of spreading further to the nearby healthy BSR cells even after one week of incubation at 37.degree. C., 5% CO.sub.2. Infection of normal BSR cells with the above transfection supernatants presented single cell staining in the DFA test, which suggested the recovered virus was incapable of spread. The ERA-G virus was amplified using a BHK cell line that constitutively expresses ERA G (PCT Publication No. WO 2007/047459). By indirect fluorescent assay screening, a pool of BHK cells expressing G were selected and maintained for amplification of ERA-G virus. With the aid of the BHK-G cell line, ERA-G virus grew to 10.sup.7 ffu/ml. Total RNA from ERA-G virus-infected BHK-G cells was extracted for Northern blot analysis with a G gene probe. The G gene was absent in the viral genomic RNA, however G mRNA was detected, which came from infected supportive BHK-G cells. In purified ERA-G viral genomic RNA, no hybridization signal was detected by G probe, indicating the deletion of the G gene in the ERA genome.

Example 4

Growth of Rescued ERA Virus and its Derivatives to High Titer in a Bioreactor

[0195] In oral vaccine development, high virus titer is typically required to elicit reliable immunity after administration. This example demonstrates that the ERA virus and derivatives can be grown to high titer in a bioreactor at volumes applicable to commercial scale-up. All 10 rescued ERA viruses were amplified in a bioreactor, CELLine AD1000 (IBS Integra Bioscience, Chur, Switherland) to titers ranging from 10.sup.7 to 10.sup.10 ffu/ml. In brief, BSR cells were transfected with the exemplary antigenome transcription vectors and helper vectors, as described above. Cells were inoculated at a multiplicity of infection of 1 virion per cell, at a concentration of 10.sup.6 cells/ml in one tenth the bioreactor vessel volume. Transfected cells were grown at 37.degree. C., 5% CO.sub.2 in DMEM supplemented with 10% fetal bovine serum. The supernatant was harvested every three to five days for between two and three harvests. The deficient ERA-G grew less well compared with other viruses, with only 10.sup.8 ffu/ml for the ERA-G (Table 1).

TABLE-US-00002 TABLE 1 Full-length plasmid constructs and corresponding rescued viruses Titers Titers Plasmid Rescued ffu/ml from ffu/ml in constructs viruses cultured cells bioreactors pTMF rERA 5 .times. 10.sup.7 .sup. 3 .times. 10.sup.10 pTMF.DELTA..psi. ERA- 6.3 .times. 10.sup.7 .sup. 3.2 .times. 10.sup.10 pTMFg3 ERAg3 3 .times. 10.sup.6 1.8 .times. 10.sup.9 pTMFgfp1 ERAgreen1 3.5 .times. 10.sup.6 5.6 .times. 10.sup.9 pTMFgfp2 ERAgreen2 2 .times. 10.sup.7 6.2 .times. 10.sup.9 pTMF2g ERA2g 1.6 .times. 10.sup.6 3.9 .times. 10.sup.9 pTMF2g3 ERA2g3 8 .times. 10.sup.7 4.6 .times. 10.sup.9 pTMF.DELTA.g ERA-G 1.2 .times. 10.sup.2 1.5 .times. 10.sup.7 pTMFgm ERAgm 5.31 .times. 10.sup.6 1.9 .times. 10.sup.9 pTMFgmg ERAgmg 3.1 .times. 10.sup.6 1.2 .times. 10.sup.9

Example 5

Expression of Exogenous Proteins from Extra Transcriptional Units in Rabies Virus

[0196] This example demonstrates the expression of recombinant proteins from a heterologous ORF inserted into a rabies virus vector. In this example, the ERA virus vector is used as a prototype rabies virus vector. To construct ERA virus as a vector for accepting ORFs, a conservative RABV transcriptional unit between the N and P genes was modified and introduced into the ERA genome at two different locations: 1) at the psi region (trans 1), and 2) at the P-M intergenic region (trans 2). The transcriptional unit was designed to possess two unique restriction enzyme recognition sites to facilitate introduction of heterologous polynucleotide sequences (TTTTTTTGATTGTGGGGAGGAAAGCGACGTCAAACCATGGCAGCTCTTTTTTT; SEQ ID NO: 42, Pst1 and Kpn1 sites shown in bold).

[0197] In a first example, the GFP gene was cloned into this unit for virus recovery, since GFP expression could be observed directly under a UV microscope when the transfected BSR cells were still incubating. Expression of the GFP protein was directly visible by fluorescent microscopy with an excitation filter of 470.+-.20 nm. The ERAgreen2 (GFP gene inserted after P gene in RABV genome-trans 2)-infected cells showed clear green foci after three days of plasmid transfection, while ERAgreen1 (GFP gene inserted after G gene in the "traditional" .PSI. region-trans 1) did not present obvious green foci until five days post-transfection. The introduced transcriptional unit was functional in the RABV genome at both locations, although expression and accumulation was apparent more rapidly when GFP was expressed from trans 2. Thus, these results also indicate that the level of expression from a heterologous ORF can be modulated by selecting the transcription unit into which the ORF is cloned.

[0198] In other examples, 1) an additional copy of ERA G; or 2) an additional copy of ERA G with an amino acid substitution at position 333, was incorporated into the ERA viral genome. The successfully rescued viruses were named ERA2g and ERA2g3, respectively. Since quantitation of viral G expression was not practical, the relative increase in expression levels of G in ERA2g and ERA2g3-infected cells was confirmed by Northern-blot with a G probe. In brief, the ERA G gene probe was labeled using the Dig DNA Labeling Kit (Roche, Indianapolis, Ind.) and imaged with Dig Nucleic Acid Detection Kit (Roche, Indianapolis, Ind.) and was measured by density spectrophotometry. The tandem linked G genes in the recovered viruses were also confirmed by RT-PCR with 5G and 3G primers. A predominant band indicating a single G copy was observed at 1.5 kb. In addition, a second weaker band was observed at approximately 3.0 kb indicative of the two Gs in a tandem arrangement.

[0199] These results demonstrate that introduction of transcription units into the ERA genome can be used to express diverse heterologous proteins from introduced ORFs. Furthermore, expression of the protein encoded by the heterologous ORF is modulated by the position into which the ORF is inserted. Thus, ERA virus is a widely adaptable vector for the expression of recombinant proteins.

Example 6

Construction and Characterization of Recombinant Rabies Virus with Three Glycoprotein Genes

[0200] This example describes the generation and characterization of a recombinant ERA strain rabies virus encoding three different glycoprotein genes. The recombinant virus, referred to as ERA-3G, comprises rabies virus glycoprotein, Mokola virus (MOKV) glycoprotein and West Caucasian bat virus (WCBV) glycoprotein. The cloning strategy for ERA-3G is shown in FIG. 4. The rabies virus reverse genetics system used to generate this virus in described in the Examples above. ERA-3G includes the attenuating mutation in the glycoprotein gene that results in an arginine to glutamic acid change at amino acid residue 433 of the protein (SEQ ID NO: 5).

[0201] The G genes from MOKV and WCBV were cloned into the ERA backbone by RT-PCR using viral genomic RNA as template from virus-infected cells. The following primers were used for amplification of the glycoprotein genes:

TABLE-US-00003 MokolaG5 - (SEQ ID NO: 43) CGACTGCAGATGAATATACCTTGCTTTGTTGTGATTC MokolaG3 - (SEQ ID NO: 44) CGTGGTACCTCATGTACCTGGAAGCCCTTTATAGGACTC WCBVG5 - (SEQ ID NO: 45) CATCTGCTAGCAATGGCTTCCTACTTTGCGTTG WCBVG3 - (SEQ ID NO: 46) TTCAATGGTACCTTATTGGGCAGTTTGTCCCTT

[0202] The amplified G genes for MOKV (SEQ ID NO: 47) and WCBV (SEQ ID NO: 49) were confirmed by sequencing. Two extra transcription units were synthesized (each with the sequence of SEQ ID NO: 42) and introduced into the gene junctions between the phosphoprotein (P) and the matrix protein (M), and the G and the RNA dependent RNA polymerase (L) (FIG. 4). The MOKV G was cloned into the gene junction between the P and M, and WCBV G into the gene junction between the G and L in the ERA genome backbone.

[0203] Recombinant virus was recovered by transfection of the above described construct into BSR cells using the method described in Example 3. Approximately 5-7 days following transfection, BSR cells were fixed for DFA staining using FITC-conjugated anti-rabies antibodies.

[0204] The recovered ERA-3G virus was characterized with a one-step growth curve in BSR cells. Virus titer was evaluated at 24, 48, 72, 96 and 120 hours after infection. At the 72, 96 and 120 hour time points, virus titer in bioreactor incubation ranged from 10.sup.8 to 10.sup.9 focus forming unit (ffu)/ml.

[0205] ERA-3G virus was then tested in a hamster model to determine whether vaccination with ERA-3G provides protection against challenge with RABV, LBV, MOKV and/or WCBV. Nine hamsters were vaccinated (i.m.) with either ERA-3G, RabAvert.TM. (Chiron Corporation, Emeryville, Calif.), or IMRAB.TM. (Merial, Duluth, Ga.). RabAvert.TM. was administered on days 0, 7 and 14, while ERA-3G and IMRAB.TM. were administered on day 0. Animals were challenged with RABV, LBV, MOK or WCBV on day 22. Control animals received no vaccine. The results of the challenge experiment are shown in Table 2.

TABLE-US-00004 TABLE 2 Survivorship of hamsters after pre-exposure vaccination and i.m. challenge with several lyssaviruses Group RABV (I-151) LBV (SA) MOK (SA) WCBV RabAvert .TM. 9/9 0/9 0/9 5/9 IMRAB .TM. 9/9 1/9 0/9 3/9 ERA-3G 9/9 1/9 9/9 9/9 Control 0/9 0/9 0/9 1/9

[0206] The results demonstrate that ERA-3G provides complete protection against RABV, MOK and WCBV. In contrast, the currently available vaccines RabAvert.TM. and IMRAB.TM., provide protection only against RABV.

[0207] For animal vaccine development, ERA-3G will be adapted to growth in chicken embryo fibroblast (CEF) and Vero cells. It is believed that ERA-3G will grow to high titers ranging from 10.sup.8 to 10.sup.9 ffu/ml in the BSR cells for animal vaccine development. For human vaccine development, ERA-3G will be adapted to CEF and Vero cells. It is believed that ERA-3G titers in the CEF and BSR cells after adaptation will be comparable to virus growth in BSR cells. The purity of ERA-3G will be verified, and the seed virus will be prepared for industrial production. Potential mycoplasma contamination will be tested using a standard PCR method.

Example 7

Construction and Characterization of Recombinant Rabies Virus with Four Glycoprotein Genes

[0208] This example describes the generation and characterization of a recombinant ERA strain rabies virus encoding three different glycoprotein genes. The recombinant virus, referred to as ERA-4G, comprises rabies virus glycoprotein, Lagos bat virus (LBV) glycoprotein, MOKV glycoprotein and WCBV glycoprotein. The cloning strategy for ERA-4G is shown in FIG. 5. The rabies virus reverse genetics system used to generate this virus in described in the Examples above. ERA-4G includes the attenuating mutation in the G gene that results in an arginine to glutamic acid change at amino acid residue 433 of the protein (SEQ ID NO: 5).

[0209] The G genes from LBV, MOKV and WCBV were cloned into the ERA backbone by RT-PCR using viral genomic RNA as template from virus-infected cells. The following primers were used for amplification of the glycoprotein genes:

TABLE-US-00005 LagosG5 - (SEQ ID NO: 51) CGACTGCAGATGAGTCAACTAAATTTGATACCCTTTTTC LagosG3 - (SEQ ID NO: 52) CCGTACGTATCAGACATTAGAGGTACCCTTATAAGATTCCCA MokolaG5 - (SEQ ID NO: 43) CGACTGCAGATGAATATACCTTGCTTTGTTGTGATTC MokolaG3 - (SEQ ID NO: 44) CGTGGTACCTCATGTACCTGGAAGCCCTTTATAGGACTC WCBVG5 - (SEQ ID NO: 45) CATCTGCTAGCAATGGCTTCCTACTTTGCGTTG WCBVG3 - (SEQ ID NO: 46) TTCAATGGTACCTTATTGGGCAGTTTGTCCCTT

[0210] The amplified G genes for LBV (SEQ ID NO: 53), MOKV (SEQ ID NO: 47) and WCBV (SEQ ID NO: 49) were confirmed by sequencing. Three extra transcription units were synthesized (each with the sequence of SEQ ID NO: 42) and introduced into the gene junctions between the N and P genes, between the P and M genes, and the G and L genes (FIG. 5). The LBV G was cloned into the gene junction between N and P, MOKV G was cloned into the gene junction between P and M, and WCBV G was cloned into the gene junction between the G and L in the ERA genome backbone.

[0211] Recombinant virus was recovered by transfection of the above described construct into BSR cells using the method described in Example 3. Approximately 5-7 days following transfection, BSR cells were fixed for DFA staining using FITC-conjugated anti-rabies antibodies.

[0212] The recovered ERA-4G virus was characterized with a one-step growth curve in BSR cells. Virus titer was determined at 24, 48, 72, 96 and 120 hours after infection. The results are shown in Table 3 below.

TABLE-US-00006 TABLE 3 Growth of ERA-4G in BSR cells Timepoint (h) 24 48 72 96 120 Titer (ffu/ml) 1 .times. 10.sup.3 5 .times. 10.sup.3 1.2 .times. 10.sup.5 1.3 .times. 10.sup.7 3.2 .times. 10.sup.5

[0213] ERA-4G virus will be tested in a hamster model to determine whether vaccination with ERA-4G confers protection against challenge with lyssaviruses RABV, LBV, MOKV and WCBV. The vaccination and challenge experiment will be performed as described for ERA-3G in Example 6.

[0214] For animal vaccine development, ERA-4G will be adapted to growth in chicken embryo fibroblast (CEF) and Vero cells. It is believed that ERA-4G will grow to high titers ranging from 10.sup.8 to 10.sup.9 ffu/ml in the BSR cells for animal vaccine development. For human vaccine development, ERA-4G will be adapted to CEF and Vero cells. It is believed that ERA-4G titers in the CEF and BSR cells after adaptation will be comparable to virus growth in BSR cells. The purity of ERA-4G will be verified, and the seed virus will be prepared for industrial production. Potential mycoplasma contamination will be tested using a standard PCR method.

[0215] In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are only preferred examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Sequence CWU 1

1

54111930DNAArtificial SequenceRecombinant ERA rabies virus genome 1acgcttaaca accagatcaa agaaaaaaca gacattgtca attgcaaagc aaaaatgtaa 60cacccctaca atg gat gcc gac aag att gta ttc aaa gtc aat aat cag 109 Met Asp Ala Asp Lys Ile Val Phe Lys Val Asn Asn Gln 1 5 10 gtg gtc tct ttg aag cct gag att atc gtg gat caa cat gag tac aag 157Val Val Ser Leu Lys Pro Glu Ile Ile Val Asp Gln His Glu Tyr Lys 15 20 25 tac cct gcc atc aaa gat ttg aaa aag ccc tgt ata acc cta gga aag 205Tyr Pro Ala Ile Lys Asp Leu Lys Lys Pro Cys Ile Thr Leu Gly Lys 30 35 40 45 gct ccc gat tta aat aaa gca tac aag tca gtt ttg tca ggc atg agc 253Ala Pro Asp Leu Asn Lys Ala Tyr Lys Ser Val Leu Ser Gly Met Ser 50 55 60 gcc gcc aaa ctt gat cct gac gat gta tgt tcc tat ttg gca gcg gca 301Ala Ala Lys Leu Asp Pro Asp Asp Val Cys Ser Tyr Leu Ala Ala Ala 65 70 75 atg cag ttt ttt gag ggg aca tgt ccg gaa gac tgg acc agc tat gga 349Met Gln Phe Phe Glu Gly Thr Cys Pro Glu Asp Trp Thr Ser Tyr Gly 80 85 90 atc gtg att gca cga aaa gga gat aag atc acc cca ggt tct ctg gtg 397Ile Val Ile Ala Arg Lys Gly Asp Lys Ile Thr Pro Gly Ser Leu Val 95 100 105 gag ata aaa cgt act gat gta gaa ggg aat tgg gct ctg aca gga ggc 445Glu Ile Lys Arg Thr Asp Val Glu Gly Asn Trp Ala Leu Thr Gly Gly 110 115 120 125 atg gaa ctg aca aga gac ccc act gtc cct gag cat gcg tcc tta gtc 493Met Glu Leu Thr Arg Asp Pro Thr Val Pro Glu His Ala Ser Leu Val 130 135 140 ggt ctt ctc ttg agt ctg tat agg ttg agc aaa ata tcc ggg caa aac 541Gly Leu Leu Leu Ser Leu Tyr Arg Leu Ser Lys Ile Ser Gly Gln Asn 145 150 155 act ggt aac tat aag aca aac att gca gac agg ata gag cag att ttt 589Thr Gly Asn Tyr Lys Thr Asn Ile Ala Asp Arg Ile Glu Gln Ile Phe 160 165 170 gag aca gcc cct ttt gtt aaa atc gtg gaa cac cat act cta atg aca 637Glu Thr Ala Pro Phe Val Lys Ile Val Glu His His Thr Leu Met Thr 175 180 185 act cac aaa atg tgt gct aat tgg agt act ata cca aac ttc aga ttt 685Thr His Lys Met Cys Ala Asn Trp Ser Thr Ile Pro Asn Phe Arg Phe 190 195 200 205 ttg gcc gga acc tat gac atg ttt ttc tcc cgg att gag cat cta tat 733Leu Ala Gly Thr Tyr Asp Met Phe Phe Ser Arg Ile Glu His Leu Tyr 210 215 220 tca gca atc aga gtg ggc aca gtt gtc act gct tat gaa gac tgt tca 781Ser Ala Ile Arg Val Gly Thr Val Val Thr Ala Tyr Glu Asp Cys Ser 225 230 235 gga ctg gta tca ttt act ggg ttc ata aaa caa atc aat ctc acc gct 829Gly Leu Val Ser Phe Thr Gly Phe Ile Lys Gln Ile Asn Leu Thr Ala 240 245 250 aga gag gca ata cta tat ttc ttc cac aag aac ttt gag gaa gag ata 877Arg Glu Ala Ile Leu Tyr Phe Phe His Lys Asn Phe Glu Glu Glu Ile 255 260 265 aga aga atg ttt gag cca ggg cag gag aca gct gtt cct cac tct tat 925Arg Arg Met Phe Glu Pro Gly Gln Glu Thr Ala Val Pro His Ser Tyr 270 275 280 285 ttc atc cac ttc cgt tca cta ggc ttg agt ggg aaa tct cct tat tca 973Phe Ile His Phe Arg Ser Leu Gly Leu Ser Gly Lys Ser Pro Tyr Ser 290 295 300 tca aat gct gtt ggt cac gtg ttc aat ctc att cac ttt gta gga tgc 1021Ser Asn Ala Val Gly His Val Phe Asn Leu Ile His Phe Val Gly Cys 305 310 315 tat atg ggt caa gtc aga tcc cta aat gca acg gtt att gct gca tgt 1069Tyr Met Gly Gln Val Arg Ser Leu Asn Ala Thr Val Ile Ala Ala Cys 320 325 330 gct cct cat gaa atg tct gtt cta ggg ggc tat ctg gga gag gaa ttc 1117Ala Pro His Glu Met Ser Val Leu Gly Gly Tyr Leu Gly Glu Glu Phe 335 340 345 ttc ggg aaa ggg aca ttt gaa aga aga ttc ttc aga gat gag aaa gaa 1165Phe Gly Lys Gly Thr Phe Glu Arg Arg Phe Phe Arg Asp Glu Lys Glu 350 355 360 365 ctt caa gaa tac gag gcg gct gaa ctg aca aag act gac gta gca ctg 1213Leu Gln Glu Tyr Glu Ala Ala Glu Leu Thr Lys Thr Asp Val Ala Leu 370 375 380 gca gat gat gga act gtc aac tct gac gac gag gac tac ttc tca ggt 1261Ala Asp Asp Gly Thr Val Asn Ser Asp Asp Glu Asp Tyr Phe Ser Gly 385 390 395 gaa acc aga agt ccg gag gct gtt tat act cga atc atg atg aat gga 1309Glu Thr Arg Ser Pro Glu Ala Val Tyr Thr Arg Ile Met Met Asn Gly 400 405 410 ggt cga cta aag aga tct cac ata cgg aga tat gtc tca gtc agt tcc 1357Gly Arg Leu Lys Arg Ser His Ile Arg Arg Tyr Val Ser Val Ser Ser 415 420 425 aat cat caa gcc cgt cca aac tca ttc gcc gag ttt cta aac aag aca 1405Asn His Gln Ala Arg Pro Asn Ser Phe Ala Glu Phe Leu Asn Lys Thr 430 435 440 445 tat tcg agt gac tca taagaagttg aacaacaaaa tgccggaaat ctacggattg 1460Tyr Ser Ser Asp Ser 450 tgtatatcca tcatgaaaaa aactaacacc cctcctttcg aaccatccca aac atg 1516 Met agc aag atc ttt gtc aat cct agt gct att aga gcc ggt ctg gcc gat 1564Ser Lys Ile Phe Val Asn Pro Ser Ala Ile Arg Ala Gly Leu Ala Asp 455 460 465 ctt gag atg gct gaa gaa act gtt gat ctg atc aat aga aat atc gaa 1612Leu Glu Met Ala Glu Glu Thr Val Asp Leu Ile Asn Arg Asn Ile Glu 470 475 480 gac aat cag gct cat ctc caa ggg gaa ccc ata gaa gtg gac aat ctc 1660Asp Asn Gln Ala His Leu Gln Gly Glu Pro Ile Glu Val Asp Asn Leu 485 490 495 cct gag gat atg ggg cga ctt cac ctg gat gat gga aaa tcg ccc aac 1708Pro Glu Asp Met Gly Arg Leu His Leu Asp Asp Gly Lys Ser Pro Asn 500 505 510 515 cct ggt gag atg gcc aag gtg gga gaa ggc aag tat cga gag gac ttt 1756Pro Gly Glu Met Ala Lys Val Gly Glu Gly Lys Tyr Arg Glu Asp Phe 520 525 530 cag atg gat gaa gga gag gat ctt agc ttc ctg ttc cag tca tac ctg 1804Gln Met Asp Glu Gly Glu Asp Leu Ser Phe Leu Phe Gln Ser Tyr Leu 535 540 545 gaa aat gtt gga gtc caa ata gtc aga caa atg agg tca gga gag aga 1852Glu Asn Val Gly Val Gln Ile Val Arg Gln Met Arg Ser Gly Glu Arg 550 555 560 ttt ctc aag ata tgg tca cag acc gta gaa gag att ata tcc tat gtc 1900Phe Leu Lys Ile Trp Ser Gln Thr Val Glu Glu Ile Ile Ser Tyr Val 565 570 575 gcg gtc aac ttt ccc aac cct cca gga aag tct tca gag gat aaa tca 1948Ala Val Asn Phe Pro Asn Pro Pro Gly Lys Ser Ser Glu Asp Lys Ser 580 585 590 595 acc cag act act ggc cga gag ctc aag aag gag aca aca ccc act cct 1996Thr Gln Thr Thr Gly Arg Glu Leu Lys Lys Glu Thr Thr Pro Thr Pro 600 605 610 tct cag aga gaa agc caa tca tcg aaa gcc agg atg gcg gct caa att 2044Ser Gln Arg Glu Ser Gln Ser Ser Lys Ala Arg Met Ala Ala Gln Ile 615 620 625 gct tct ggc cct cca gcc ctt gaa tgg tcg gcc acc aat gaa gag gat 2092Ala Ser Gly Pro Pro Ala Leu Glu Trp Ser Ala Thr Asn Glu Glu Asp 630 635 640 gat cta tca gtg gag gct gag atc gct cac cag att gca gaa agt ttc 2140Asp Leu Ser Val Glu Ala Glu Ile Ala His Gln Ile Ala Glu Ser Phe 645 650 655 tcc aaa aaa tat aag ttt ccc tct cga tcc tca ggg ata ctc ttg tat 2188Ser Lys Lys Tyr Lys Phe Pro Ser Arg Ser Ser Gly Ile Leu Leu Tyr 660 665 670 675 aat ttt gag caa ttg aaa atg aac ctt gat gat ata gtt aaa gag gca 2236Asn Phe Glu Gln Leu Lys Met Asn Leu Asp Asp Ile Val Lys Glu Ala 680 685 690 aaa aat gta cca ggt gtg acc cgt tta gcc cat gac ggg tcc aaa ctc 2284Lys Asn Val Pro Gly Val Thr Arg Leu Ala His Asp Gly Ser Lys Leu 695 700 705 ccc cta aga tgt gta ctg gga tgg gtc gct ttg gcc aac cct aag aaa 2332Pro Leu Arg Cys Val Leu Gly Trp Val Ala Leu Ala Asn Pro Lys Lys 710 715 720 ttc cag ttg tta gtc gaa tcc gac aag ctg agt aaa atc atg caa gat 2380Phe Gln Leu Leu Val Glu Ser Asp Lys Leu Ser Lys Ile Met Gln Asp 725 730 735 gac ttg aat cgc tat aca tct tgc taaccgaacc tctccactca gtccctctag 2434Asp Leu Asn Arg Tyr Thr Ser Cys 740 745 acaataaagt ccgagatgtc ctaaagtcaa catgaaaaaa acaggcaaca ccactgataa 2494a atg aac ttt cta cgt aag ata gtg aaa aat tgc agg gac gag gac act 2543 Met Asn Phe Leu Arg Lys Ile Val Lys Asn Cys Arg Asp Glu Asp Thr 750 755 760 caa aaa ccc tct ccc gtg tca gcc cct ctg gat gac gat gac ttg tgg 2591Gln Lys Pro Ser Pro Val Ser Ala Pro Leu Asp Asp Asp Asp Leu Trp 765 770 775 ctt cca ccc cct gaa tac gtc ccg ctg aaa gaa ctt aca agc aag aag 2639Leu Pro Pro Pro Glu Tyr Val Pro Leu Lys Glu Leu Thr Ser Lys Lys 780 785 790 795 aac atg agg aac ttt tgt atc aac gga ggg gtt aaa gtg tgt agc ccg 2687Asn Met Arg Asn Phe Cys Ile Asn Gly Gly Val Lys Val Cys Ser Pro 800 805 810 aat ggt tac tcg ttc agg atc ctg cgg cac att ctg aaa tca ttc gac 2735Asn Gly Tyr Ser Phe Arg Ile Leu Arg His Ile Leu Lys Ser Phe Asp 815 820 825 gag ata tat tct ggg aat cat agg atg atc ggg tta gcc aaa gta gtt 2783Glu Ile Tyr Ser Gly Asn His Arg Met Ile Gly Leu Ala Lys Val Val 830 835 840 att gga ctg gct ttg tca gga tct cca gtc cct gag ggc atg aac tgg 2831Ile Gly Leu Ala Leu Ser Gly Ser Pro Val Pro Glu Gly Met Asn Trp 845 850 855 gta tac aaa ttg agg aga acc ttt atc ttc cag tgg gct gat tcc agg 2879Val Tyr Lys Leu Arg Arg Thr Phe Ile Phe Gln Trp Ala Asp Ser Arg 860 865 870 875 ggc cct ctt gaa ggg gag gag ttg gaa tac tct cag gag atc act tgg 2927Gly Pro Leu Glu Gly Glu Glu Leu Glu Tyr Ser Gln Glu Ile Thr Trp 880 885 890 gat gat gat act gag ttc gtc gga ttg caa ata aga gtg att gca aaa 2975Asp Asp Asp Thr Glu Phe Val Gly Leu Gln Ile Arg Val Ile Ala Lys 895 900 905 cag tgt cat atc cag ggc aga atc tgg tgt atc aac atg aac ccg aga 3023Gln Cys His Ile Gln Gly Arg Ile Trp Cys Ile Asn Met Asn Pro Arg 910 915 920 gca tgt caa cta tgg tct gac atg tct ctt cag aca caa agg tcc gaa 3071Ala Cys Gln Leu Trp Ser Asp Met Ser Leu Gln Thr Gln Arg Ser Glu 925 930 935 gag gac aaa gat tcc tct ctg ctt cta gaa taatcagatt atatcccgca 3121Glu Asp Lys Asp Ser Ser Leu Leu Leu Glu 940 945 aatttatcac ttgtttacct ctggaggaga gaacatatgg gctcaactcc aacccttggg 3181agcaatataa caaaaaacat gttatggtgc cattaaaccg ctgcatttca tcaaagtcaa 3241gttgattacc tttacatttt gatcctcttg gatgtgaaaa aaactattaa catccctcaa 3301aagactcaag gaaag atg gtt cct cag gct ctc ctg ttt gta ccc ctt ctg 3352 Met Val Pro Gln Ala Leu Leu Phe Val Pro Leu Leu 950 955 960 gtt ttt cca ttg tgt ttt ggg aaa ttc cct att tac acg ata cca gac 3400Val Phe Pro Leu Cys Phe Gly Lys Phe Pro Ile Tyr Thr Ile Pro Asp 965 970 975 aag ctt ggt ccc tgg agc ccg att gac ata cat cac ctc agc tgc cca 3448Lys Leu Gly Pro Trp Ser Pro Ile Asp Ile His His Leu Ser Cys Pro 980 985 990 aac aat ttg gta gtg gag gac gaa gga tgc acc aac ctg tca ggg ttc 3496Asn Asn Leu Val Val Glu Asp Glu Gly Cys Thr Asn Leu Ser Gly Phe 995 1000 1005 tcc tac atg gaa ctt aaa gtt gga tac atc tta gcc ata aaa atg 3541Ser Tyr Met Glu Leu Lys Val Gly Tyr Ile Leu Ala Ile Lys Met 1010 1015 1020 aac ggg ttc act tgc aca ggc gtt gtg acg gag gct gaa acc tat 3586Asn Gly Phe Thr Cys Thr Gly Val Val Thr Glu Ala Glu Thr Tyr 1025 1030 1035 act aac ttc gtt ggt tat gtc aca acc acg ttc aaa aga aag cat 3631Thr Asn Phe Val Gly Tyr Val Thr Thr Thr Phe Lys Arg Lys His 1040 1045 1050 ttc cgc cca aca cca gat gca tgt aga gcc gcg tac aac tgg aag 3676Phe Arg Pro Thr Pro Asp Ala Cys Arg Ala Ala Tyr Asn Trp Lys 1055 1060 1065 atg gcc ggt gac ccc aga tat gaa gag tct cta cac aat ccg tac 3721Met Ala Gly Asp Pro Arg Tyr Glu Glu Ser Leu His Asn Pro Tyr 1070 1075 1080 cct gac tac cac tgg ctt cga act gta aaa acc acc aag gag tct 3766Pro Asp Tyr His Trp Leu Arg Thr Val Lys Thr Thr Lys Glu Ser 1085 1090 1095 ctc gtt atc ata tct cca agt gtg gca gat ttg gac cca tat gac 3811Leu Val Ile Ile Ser Pro Ser Val Ala Asp Leu Asp Pro Tyr Asp 1100 1105 1110 aga tcc ctt cac tcg agg gtc ttc cct agc ggg aag tgc tca gga 3856Arg Ser Leu His Ser Arg Val Phe Pro Ser Gly Lys Cys Ser Gly 1115 1120 1125 gta gcg gtg tct tct acc tac tgc tcc act aac cac gat tac acc 3901Val Ala Val Ser Ser Thr Tyr Cys Ser Thr Asn His Asp Tyr Thr 1130 1135 1140 att tgg atg ccc gag aat ccg aga cta ggg atg tct tgt gac att 3946Ile Trp Met Pro Glu Asn Pro Arg Leu Gly Met Ser Cys Asp Ile 1145 1150 1155 ttt acc aat agt agg ggg aag aga gca tcc aaa ggg agt gag act 3991Phe Thr Asn Ser Arg Gly Lys Arg Ala Ser Lys Gly Ser Glu Thr 1160 1165 1170 tgc ggc ttt gta gat gaa aga ggc cta tat aag tct tta aaa gga 4036Cys Gly Phe Val Asp Glu Arg Gly Leu Tyr Lys Ser Leu Lys Gly 1175 1180 1185 gca tgc aaa ctc aag tta tgt gga gtt cta gga ctt aga ctt atg 4081Ala Cys Lys Leu Lys Leu Cys Gly Val Leu Gly Leu Arg Leu Met 1190 1195 1200 gat gga aca tgg gtc gcg atg caa aca tca aat gaa acc aaa tgg 4126Asp Gly Thr Trp Val Ala Met Gln Thr Ser Asn Glu Thr Lys Trp 1205 1210 1215 tgc ccc ccc gat cag ttg gtg aac ctg cac gac ttt cgc tca gac 4171Cys Pro Pro Asp Gln Leu Val Asn Leu His Asp Phe Arg Ser Asp 1220 1225 1230 gaa att gag cac ctt gtt gta gag gag ttg gtc agg aag aga gag 4216Glu Ile Glu His Leu Val Val Glu Glu Leu Val Arg Lys Arg Glu 1235 1240 1245 gag tgt ctg gat gca cta gag tcc atc atg aca acc aag tca gtg 4261Glu Cys Leu Asp Ala Leu Glu Ser Ile Met Thr Thr Lys Ser Val 1250 1255 1260 agt ttc aga cgt ccc agt cat tta aga aaa ctt gtc cct ggg ttt 4306Ser Phe Arg Arg Pro Ser His Leu Arg Lys Leu Val Pro Gly Phe 1265 1270 1275 gga aaa gca tat acc ata ttc aac aag acc ttg

atg gaa gcc gat 4351Gly Lys Ala Tyr Thr Ile Phe Asn Lys Thr Leu Met Glu Ala Asp 1280 1285 1290 gct cac tac aag tca gtc gag act tgg aat gag atc ctc cct tca 4396Ala His Tyr Lys Ser Val Glu Thr Trp Asn Glu Ile Leu Pro Ser 1295 1300 1305 aaa ggg tgt tta aga gtt ggg ggg agg tgt cat cct cat gtg aac 4441Lys Gly Cys Leu Arg Val Gly Gly Arg Cys His Pro His Val Asn 1310 1315 1320 ggg gtg ttt ttc aat ggt ata ata tta gga cct gac ggc aat gtc 4486Gly Val Phe Phe Asn Gly Ile Ile Leu Gly Pro Asp Gly Asn Val 1325 1330 1335 tta atc cca gag atg caa tca tcc ctc ctc cag caa cat atg gag 4531Leu Ile Pro Glu Met Gln Ser Ser Leu Leu Gln Gln His Met Glu 1340 1345 1350 ttg ttg gaa tcc tcg gtt atc ccc ctt gtg cac ccc ctg gca gac 4576Leu Leu Glu Ser Ser Val Ile Pro Leu Val His Pro Leu Ala Asp 1355 1360 1365 ccg tct acc gtt ttc aag gac ggt gac gag gct gag gat ttt gtt 4621Pro Ser Thr Val Phe Lys Asp Gly Asp Glu Ala Glu Asp Phe Val 1370 1375 1380 gaa gtt cac ctt ccc gat gtg cac aat cag gtc tca gga gtt gac 4666Glu Val His Leu Pro Asp Val His Asn Gln Val Ser Gly Val Asp 1385 1390 1395 ttg ggt ctc ccg aac tgg ggg aag tat gta tta ctg agt gca ggg 4711Leu Gly Leu Pro Asn Trp Gly Lys Tyr Val Leu Leu Ser Ala Gly 1400 1405 1410 gcc ctg act gcc ttg atg ttg ata att ttc ctg atg aca tgt tgt 4756Ala Leu Thr Ala Leu Met Leu Ile Ile Phe Leu Met Thr Cys Cys 1415 1420 1425 aga aga gtc aat cga tca gaa cct acg caa cac aat ctc aga ggg 4801Arg Arg Val Asn Arg Ser Glu Pro Thr Gln His Asn Leu Arg Gly 1430 1435 1440 aca ggg agg gag gtg tca gtc act ccc caa agc ggg aag atc ata 4846Thr Gly Arg Glu Val Ser Val Thr Pro Gln Ser Gly Lys Ile Ile 1445 1450 1455 tct tca tgg gaa tca cac aag agt ggg ggt gag acc aga ctg 4888Ser Ser Trp Glu Ser His Lys Ser Gly Gly Glu Thr Arg Leu 1460 1465 1470 tgaggactgg ccgtcctttc aactatccaa gtcctgaaga tcacctcccc ttggggggtt 4948ctttttgaaa aaaacctggg ttcaatagtc ctcctcgaac tccatgcaac tgggtagatt 5008caagagtcat gagattttca ttaatcctct cagttgatca agcaagatca tgtagattct 5068cataataggg gagatcttct agcagtttca gtgactaacg gtactttcat tctccaggaa 5128ctgacaccaa cagttgtaga caaaccacgg ggtgtctcgg gtgactctgt gcttgggcac 5188agacaaaggt catggtgtgt tccatgatag cggactcagg atgagttaat tgagagaggc 5248agtcttcctc ccgtgaagga cataagcagt agctcacaat catcccgcgt ctcagcaaag 5308tgtgcataat tataaagtgc tgggtcatct aagcttttca gtcgagaaaa aaacattaga 5368tcagaagaac aactggcaac acttctcaac ctgagaccta cttcaag atg ctc gat 5424 Met Leu Asp 1475 cct gga gag gtc tat gat gac cct att gac cca atc gag tta gag 5469Pro Gly Glu Val Tyr Asp Asp Pro Ile Asp Pro Ile Glu Leu Glu 1480 1485 1490 gat gaa ccc aga gga acc ccc act gtc ccc aac atc ttg agg aac 5514Asp Glu Pro Arg Gly Thr Pro Thr Val Pro Asn Ile Leu Arg Asn 1495 1500 1505 tct gac tac aat ctc aac tct cct ttg ata gaa gat cct gct aga 5559Ser Asp Tyr Asn Leu Asn Ser Pro Leu Ile Glu Asp Pro Ala Arg 1510 1515 1520 cta atg tta gaa tgg tta aaa aca ggg aat aga cct tat cgg atg 5604Leu Met Leu Glu Trp Leu Lys Thr Gly Asn Arg Pro Tyr Arg Met 1525 1530 1535 act cta aca gac aat tgc tcc agg tct ttc aga gtt ttg aaa gat 5649Thr Leu Thr Asp Asn Cys Ser Arg Ser Phe Arg Val Leu Lys Asp 1540 1545 1550 tat ttc aag aag gta gat ttg ggt tct ctc aag gtg ggc gga atg 5694Tyr Phe Lys Lys Val Asp Leu Gly Ser Leu Lys Val Gly Gly Met 1555 1560 1565 gct gca cag tca atg att tct ctc tgg tta tat ggt gcc cac tct 5739Ala Ala Gln Ser Met Ile Ser Leu Trp Leu Tyr Gly Ala His Ser 1570 1575 1580 gaa tcc aac agg agc cgg aga tgt ata aca gac ttg gcc cat ttc 5784Glu Ser Asn Arg Ser Arg Arg Cys Ile Thr Asp Leu Ala His Phe 1585 1590 1595 tat tcc aag tcg tcc ccc ata gag aag ctg ttg aat ctc acg cta 5829Tyr Ser Lys Ser Ser Pro Ile Glu Lys Leu Leu Asn Leu Thr Leu 1600 1605 1610 gga aat aga ggg ctg aga atc ccc cca gag gga gtg tta agt tgc 5874Gly Asn Arg Gly Leu Arg Ile Pro Pro Glu Gly Val Leu Ser Cys 1615 1620 1625 ctt gag agg gtt gat tat gat aat gca ttt gga agg tat ctt gcc 5919Leu Glu Arg Val Asp Tyr Asp Asn Ala Phe Gly Arg Tyr Leu Ala 1630 1635 1640 aac acg tat tcc tct tac ttg ttc ttc cat gta atc acc tta tac 5964Asn Thr Tyr Ser Ser Tyr Leu Phe Phe His Val Ile Thr Leu Tyr 1645 1650 1655 atg aac gcc cta gac tgg gat gaa gaa aag acc atc cta gca tta 6009Met Asn Ala Leu Asp Trp Asp Glu Glu Lys Thr Ile Leu Ala Leu 1660 1665 1670 tgg aaa gat tta acc tca gtg gac atc ggg aag gac ttg gta aag 6054Trp Lys Asp Leu Thr Ser Val Asp Ile Gly Lys Asp Leu Val Lys 1675 1680 1685 ttc aaa gac caa ata tgg gga ctg ccg atc gtg aca aag gac ttt 6099Phe Lys Asp Gln Ile Trp Gly Leu Pro Ile Val Thr Lys Asp Phe 1690 1695 1700 gtt tac tcc caa agt tcc aat tgt ctt ttt gac aga aac tac aca 6144Val Tyr Ser Gln Ser Ser Asn Cys Leu Phe Asp Arg Asn Tyr Thr 1705 1710 1715 ctt atg cta aaa gaa ctt ttc ttg tct cgc ttc aac tcc tta atg 6189Leu Met Leu Lys Glu Leu Phe Leu Ser Arg Phe Asn Ser Leu Met 1720 1725 1730 gtc ttg ctc tct ccc cca gag ccc cga tac tca gat gac ttg ata 6234Val Leu Leu Ser Pro Pro Glu Pro Arg Tyr Ser Asp Asp Leu Ile 1735 1740 1745 tct caa cta tgc cag ctg tac att gct ggg gat caa gtc ttg tct 6279Ser Gln Leu Cys Gln Leu Tyr Ile Ala Gly Asp Gln Val Leu Ser 1750 1755 1760 atg tgt gga aac tcc ggc tat gaa gtc atc aaa ata ttg gag cca 6324Met Cys Gly Asn Ser Gly Tyr Glu Val Ile Lys Ile Leu Glu Pro 1765 1770 1775 tat gtc gtg aat agt tta gtc cag aga gca gaa aag ttt agg cct 6369Tyr Val Val Asn Ser Leu Val Gln Arg Ala Glu Lys Phe Arg Pro 1780 1785 1790 ctc att cat tcc ttg gga gac ttt cct gta ttt ata aaa gac aag 6414Leu Ile His Ser Leu Gly Asp Phe Pro Val Phe Ile Lys Asp Lys 1795 1800 1805 gta agt caa ctt gaa gag acg ttc ggt ccc tgt gca aga agg ttc 6459Val Ser Gln Leu Glu Glu Thr Phe Gly Pro Cys Ala Arg Arg Phe 1810 1815 1820 ttt agg gct ctg gat caa ttc gac aac ata cat gac ttg gtt ttt 6504Phe Arg Ala Leu Asp Gln Phe Asp Asn Ile His Asp Leu Val Phe 1825 1830 1835 gtg tat ggc tgt tac agg cat tgg ggg cac cca tat ata gat tat 6549Val Tyr Gly Cys Tyr Arg His Trp Gly His Pro Tyr Ile Asp Tyr 1840 1845 1850 cga aag ggt ctg tca aaa cta tat gat cag gtt cac att aaa aaa 6594Arg Lys Gly Leu Ser Lys Leu Tyr Asp Gln Val His Ile Lys Lys 1855 1860 1865 gtg ata gat aag tcc tac cag gag tgc tta gca agc gac cta gcc 6639Val Ile Asp Lys Ser Tyr Gln Glu Cys Leu Ala Ser Asp Leu Ala 1870 1875 1880 agg agg atc ctt aga tgg ggt ttt gat aag tac tcc aag tgg tat 6684Arg Arg Ile Leu Arg Trp Gly Phe Asp Lys Tyr Ser Lys Trp Tyr 1885 1890 1895 ctg gat tca aga ttc cta gcc cga gac cac ccc ttg act cct tat 6729Leu Asp Ser Arg Phe Leu Ala Arg Asp His Pro Leu Thr Pro Tyr 1900 1905 1910 atc aaa acc caa aca tgg cca ccc aaa cat att gta gac ttg gtg 6774Ile Lys Thr Gln Thr Trp Pro Pro Lys His Ile Val Asp Leu Val 1915 1920 1925 ggg gat aca tgg cac aag ctc ccg atc acg cag atc ttt gag att 6819Gly Asp Thr Trp His Lys Leu Pro Ile Thr Gln Ile Phe Glu Ile 1930 1935 1940 cct gaa tca atg gat ccg tca gaa ata ttg gat gac aaa tca cat 6864Pro Glu Ser Met Asp Pro Ser Glu Ile Leu Asp Asp Lys Ser His 1945 1950 1955 tct ttc acc aga acg aga cta gct tct tgg ctg tca gaa aac cga 6909Ser Phe Thr Arg Thr Arg Leu Ala Ser Trp Leu Ser Glu Asn Arg 1960 1965 1970 ggg gga cct gtt cct agc gaa aaa gtt att atc acg gcc ctg tct 6954Gly Gly Pro Val Pro Ser Glu Lys Val Ile Ile Thr Ala Leu Ser 1975 1980 1985 aag ccg cct gtc aat ccc cga gag ttt ctg agg tct ata gac ctc 6999Lys Pro Pro Val Asn Pro Arg Glu Phe Leu Arg Ser Ile Asp Leu 1990 1995 2000 gga gga ttg cca gat gaa gac ttg ata att ggc ctc aag cca aag 7044Gly Gly Leu Pro Asp Glu Asp Leu Ile Ile Gly Leu Lys Pro Lys 2005 2010 2015 gaa cgg gaa ttg aag att gaa ggt cga ttc ttt gct cta atg tca 7089Glu Arg Glu Leu Lys Ile Glu Gly Arg Phe Phe Ala Leu Met Ser 2020 2025 2030 tgg aat cta aga ttg tat ttt gtc atc act gaa aaa ctc ttg gcc 7134Trp Asn Leu Arg Leu Tyr Phe Val Ile Thr Glu Lys Leu Leu Ala 2035 2040 2045 aac tac atc ttg cca ctt ttt gac gcg ctg act atg aca gac aac 7179Asn Tyr Ile Leu Pro Leu Phe Asp Ala Leu Thr Met Thr Asp Asn 2050 2055 2060 ctg aac aag gtg ttt aaa aag ctg atc gac agg gtc acc ggg caa 7224Leu Asn Lys Val Phe Lys Lys Leu Ile Asp Arg Val Thr Gly Gln 2065 2070 2075 ggg ctt ttg gac tat tca agg gtc aca tat gca ttt cac ctg gac 7269Gly Leu Leu Asp Tyr Ser Arg Val Thr Tyr Ala Phe His Leu Asp 2080 2085 2090 tat gaa aag tgg aac aac cat caa aga tta gag tca aca gag gat 7314Tyr Glu Lys Trp Asn Asn His Gln Arg Leu Glu Ser Thr Glu Asp 2095 2100 2105 gta ttt tct gtc cta gat caa gtg ttt gga ttg aag aga gtg ttt 7359Val Phe Ser Val Leu Asp Gln Val Phe Gly Leu Lys Arg Val Phe 2110 2115 2120 tct aga aca cac gag ttt ttt caa aag gcc tgg atc tat tat tca 7404Ser Arg Thr His Glu Phe Phe Gln Lys Ala Trp Ile Tyr Tyr Ser 2125 2130 2135 gac aga tca gac ctc atc ggg tta cgg gag gat caa ata tac tgc 7449Asp Arg Ser Asp Leu Ile Gly Leu Arg Glu Asp Gln Ile Tyr Cys 2140 2145 2150 tta gat gcg tcc aac ggc cca acc tgt tgg aat ggc cag gat ggc 7494Leu Asp Ala Ser Asn Gly Pro Thr Cys Trp Asn Gly Gln Asp Gly 2155 2160 2165 ggg cta gaa ggc tta cgg cag aag ggc tgg agt cta gtc agc tta 7539Gly Leu Glu Gly Leu Arg Gln Lys Gly Trp Ser Leu Val Ser Leu 2170 2175 2180 ttg atg ata gat aga gaa tct caa atc agg aac aca aga acc aaa 7584Leu Met Ile Asp Arg Glu Ser Gln Ile Arg Asn Thr Arg Thr Lys 2185 2190 2195 ata cta gct caa gga gac aac cag gtt tta tgt ccg aca tat atg 7629Ile Leu Ala Gln Gly Asp Asn Gln Val Leu Cys Pro Thr Tyr Met 2200 2205 2210 ttg tcg cca ggg cta tct caa gag ggg ctc ctc tat gaa ttg gag 7674Leu Ser Pro Gly Leu Ser Gln Glu Gly Leu Leu Tyr Glu Leu Glu 2215 2220 2225 aga ata tca agg aat gca ctt tcg ata tac aga gcc gtc gag gaa 7719Arg Ile Ser Arg Asn Ala Leu Ser Ile Tyr Arg Ala Val Glu Glu 2230 2235 2240 ggg gca tct aag cta ggg ctg atc atc aag aaa gaa gag acc atg 7764Gly Ala Ser Lys Leu Gly Leu Ile Ile Lys Lys Glu Glu Thr Met 2245 2250 2255 tgt agt tat gac ttc ctc atc tat gga aaa acc cct ttg ttt aga 7809Cys Ser Tyr Asp Phe Leu Ile Tyr Gly Lys Thr Pro Leu Phe Arg 2260 2265 2270 ggt aac ata ttg gtg cct gag tcc aaa aga tgg gcc aga gtc tct 7854Gly Asn Ile Leu Val Pro Glu Ser Lys Arg Trp Ala Arg Val Ser 2275 2280 2285 tgc gtc tct aat gac caa ata gtc aac ctc gcc aat ata atg tcg 7899Cys Val Ser Asn Asp Gln Ile Val Asn Leu Ala Asn Ile Met Ser 2290 2295 2300 aca gtg tcc acc aat gcg cta aca gtg gca caa cac tct caa tct 7944Thr Val Ser Thr Asn Ala Leu Thr Val Ala Gln His Ser Gln Ser 2305 2310 2315 ttg atc aaa ccg atg agg gat ttt ctg ctc atg tca gta cag gca 7989Leu Ile Lys Pro Met Arg Asp Phe Leu Leu Met Ser Val Gln Ala 2320 2325 2330 gtc ttt cac tac ctg cta ttt agc cca atc tta aag gga aga gtt 8034Val Phe His Tyr Leu Leu Phe Ser Pro Ile Leu Lys Gly Arg Val 2335 2340 2345 tac aag att ctg agc gct gaa ggg gat agc ttt ctc cta gcc atg 8079Tyr Lys Ile Leu Ser Ala Glu Gly Asp Ser Phe Leu Leu Ala Met 2350 2355 2360 tca agg ata atc tat cta gat cct tct ttg gga ggg gta tct gga 8124Ser Arg Ile Ile Tyr Leu Asp Pro Ser Leu Gly Gly Val Ser Gly 2365 2370 2375 atg tcc ctc gga aga ttc cat ata cga cag ttc tca gac cct gtc 8169Met Ser Leu Gly Arg Phe His Ile Arg Gln Phe Ser Asp Pro Val 2380 2385 2390 tct gaa ggg tta tcc ttc tgg aga gag atc tgg tta agc tcc cac 8214Ser Glu Gly Leu Ser Phe Trp Arg Glu Ile Trp Leu Ser Ser His 2395 2400 2405 gag tcc tgg att cac gcg ttg tgt caa gag gct gga aac cca gat 8259Glu Ser Trp Ile His Ala Leu Cys Gln Glu Ala Gly Asn Pro Asp 2410 2415 2420 ctt gga gag aga aca ctc gag agc ttc act cgc ctt cta gaa gat 8304Leu Gly Glu Arg Thr Leu Glu Ser Phe Thr Arg Leu Leu Glu Asp 2425 2430 2435 cct acc acc tta aat atc aga gga ggg gcc agt cct acc att cta 8349Pro Thr Thr Leu Asn Ile Arg Gly Gly Ala Ser Pro Thr Ile Leu 2440 2445 2450 ctc aag gat gca atc aga aag gct tta tat gac gag gtg gac aag 8394Leu Lys Asp Ala Ile Arg Lys Ala Leu Tyr Asp Glu Val Asp Lys 2455 2460 2465 gtg gag aat tca gag ttt cga gag gca atc ctg ttg tcc aag acc 8439Val Glu Asn Ser Glu Phe Arg Glu Ala Ile Leu Leu Ser Lys Thr 2470 2475 2480 cat aga gat aat ttt ata ctc ttc tta aca tct gtt gag cct ctg

8484His Arg Asp Asn Phe Ile Leu Phe Leu Thr Ser Val Glu Pro Leu 2485 2490 2495 ttt cct cga ttt ctc agt gag cta ttc agt tcg tct ttt ttg gga 8529Phe Pro Arg Phe Leu Ser Glu Leu Phe Ser Ser Ser Phe Leu Gly 2500 2505 2510 atc ccc gag tca atc att gga ttg ata caa aac tcc cga acg ata 8574Ile Pro Glu Ser Ile Ile Gly Leu Ile Gln Asn Ser Arg Thr Ile 2515 2520 2525 aga agg cag ttt aga aag agt ctc tca aaa act tta gaa gaa tcc 8619Arg Arg Gln Phe Arg Lys Ser Leu Ser Lys Thr Leu Glu Glu Ser 2530 2535 2540 ttc tac aac tca gag atc cac ggg att agt cgg atg acc cag aca 8664Phe Tyr Asn Ser Glu Ile His Gly Ile Ser Arg Met Thr Gln Thr 2545 2550 2555 cct cag agg gtt ggg ggg gtg tgg cct tgc tct tca gag agg gca 8709Pro Gln Arg Val Gly Gly Val Trp Pro Cys Ser Ser Glu Arg Ala 2560 2565 2570 gat cta ctt agg gag atc tct tgg gga aga aaa gtg gta ggc acg 8754Asp Leu Leu Arg Glu Ile Ser Trp Gly Arg Lys Val Val Gly Thr 2575 2580 2585 aca gtt cct cac cct tct gag atg ttg ggg tta ctt ccc aag tcc 8799Thr Val Pro His Pro Ser Glu Met Leu Gly Leu Leu Pro Lys Ser 2590 2595 2600 tct att tct tgc act tgt gga gca aca gga gga ggc aat cct aga 8844Ser Ile Ser Cys Thr Cys Gly Ala Thr Gly Gly Gly Asn Pro Arg 2605 2610 2615 gtt tct gta tca gta ctc ccg tcc ttt gat cag tca ttt ttt tca 8889Val Ser Val Ser Val Leu Pro Ser Phe Asp Gln Ser Phe Phe Ser 2620 2625 2630 cga ggc ccc cta aag ggg tac ttg ggc tcg tcc acc tct atg tcg 8934Arg Gly Pro Leu Lys Gly Tyr Leu Gly Ser Ser Thr Ser Met Ser 2635 2640 2645 acc cag cta ttc cat gca tgg gaa aaa gtc act aat gtt cat gtg 8979Thr Gln Leu Phe His Ala Trp Glu Lys Val Thr Asn Val His Val 2650 2655 2660 gtg aag aga gct cta tcg tta aaa gaa tct ata aac tgg ttc att 9024Val Lys Arg Ala Leu Ser Leu Lys Glu Ser Ile Asn Trp Phe Ile 2665 2670 2675 act aga gat tcc aac ttg gct caa gct cta att agg aac att atg 9069Thr Arg Asp Ser Asn Leu Ala Gln Ala Leu Ile Arg Asn Ile Met 2680 2685 2690 tct ctg aca ggc cct gat ttc cct cta gag gag gcc cct gtc ttc 9114Ser Leu Thr Gly Pro Asp Phe Pro Leu Glu Glu Ala Pro Val Phe 2695 2700 2705 aaa agg acg ggg tca gcc ttg cat agg ttc aag tct gcc aga tac 9159Lys Arg Thr Gly Ser Ala Leu His Arg Phe Lys Ser Ala Arg Tyr 2710 2715 2720 agc gaa gga ggg tat tct tct gtc tgc ccg aac ctc ctc tct cat 9204Ser Glu Gly Gly Tyr Ser Ser Val Cys Pro Asn Leu Leu Ser His 2725 2730 2735 att tct gtt agt aca gac acc atg tct gat ttg acc caa gac ggg 9249Ile Ser Val Ser Thr Asp Thr Met Ser Asp Leu Thr Gln Asp Gly 2740 2745 2750 aag aac tac gat ttc atg ttc cag cca ttg atg ctt tat gca cag 9294Lys Asn Tyr Asp Phe Met Phe Gln Pro Leu Met Leu Tyr Ala Gln 2755 2760 2765 aca tgg aca tca gag ctg gta cag aga gac aca agg cta aga gac 9339Thr Trp Thr Ser Glu Leu Val Gln Arg Asp Thr Arg Leu Arg Asp 2770 2775 2780 tct acg ttt cat tgg cac ctc cga tgc aac agg tgt gtg aga ccc 9384Ser Thr Phe His Trp His Leu Arg Cys Asn Arg Cys Val Arg Pro 2785 2790 2795 att gac gac gtg acc ctg gag acc tct cag atc ttc gag ttt ccg 9429Ile Asp Asp Val Thr Leu Glu Thr Ser Gln Ile Phe Glu Phe Pro 2800 2805 2810 gat gtg tcg aaa aga ata tcc aga atg gtt tct ggg gct gtg cct 9474Asp Val Ser Lys Arg Ile Ser Arg Met Val Ser Gly Ala Val Pro 2815 2820 2825 cac ttc cag agg ctt ccc gat atc cgt ctg aga cca gga gat ttt 9519His Phe Gln Arg Leu Pro Asp Ile Arg Leu Arg Pro Gly Asp Phe 2830 2835 2840 gaa tct cta agc ggt aga gaa aag tct cac cat atc gga tca gct 9564Glu Ser Leu Ser Gly Arg Glu Lys Ser His His Ile Gly Ser Ala 2845 2850 2855 cag ggg ctc tta tac tca atc tta gtg gca att cac gac tca gga 9609Gln Gly Leu Leu Tyr Ser Ile Leu Val Ala Ile His Asp Ser Gly 2860 2865 2870 tac aat gat gga acc atc ttc cct gtc aac ata tac gac aag gtt 9654Tyr Asn Asp Gly Thr Ile Phe Pro Val Asn Ile Tyr Asp Lys Val 2875 2880 2885 tcc cct aga gac tat ttg aga ggg ctc gca agg gga gta ttg ata 9699Ser Pro Arg Asp Tyr Leu Arg Gly Leu Ala Arg Gly Val Leu Ile 2890 2895 2900 gga tcc tcg att tgc ttc ttg aca aga atg aca aat atc aat att 9744Gly Ser Ser Ile Cys Phe Leu Thr Arg Met Thr Asn Ile Asn Ile 2905 2910 2915 aat aga cct ctt gaa ttg atc tca ggg gta atc tca tat att ctc 9789Asn Arg Pro Leu Glu Leu Ile Ser Gly Val Ile Ser Tyr Ile Leu 2920 2925 2930 ctg agg cta gat aac cat ccc tcc ttg tac ata atg ctc aga gaa 9834Leu Arg Leu Asp Asn His Pro Ser Leu Tyr Ile Met Leu Arg Glu 2935 2940 2945 ccg tct ctt aga gga gag ata ttt tct atc cct cag aaa atc ccc 9879Pro Ser Leu Arg Gly Glu Ile Phe Ser Ile Pro Gln Lys Ile Pro 2950 2955 2960 gcc gct tat cca acc act atg aaa gaa ggc aac aga tca atc ttg 9924Ala Ala Tyr Pro Thr Thr Met Lys Glu Gly Asn Arg Ser Ile Leu 2965 2970 2975 tgt tat ctc caa cat gtg cta cgc tat gag cga gag ata atc acg 9969Cys Tyr Leu Gln His Val Leu Arg Tyr Glu Arg Glu Ile Ile Thr 2980 2985 2990 gcg tct cca gag aat gac tgg cta tgg atc ttt tca gac ttt aga 10014Ala Ser Pro Glu Asn Asp Trp Leu Trp Ile Phe Ser Asp Phe Arg 2995 3000 3005 agt gcc aaa atg acg tac cta acc ctc att act tac cag tct cat 10059Ser Ala Lys Met Thr Tyr Leu Thr Leu Ile Thr Tyr Gln Ser His 3010 3015 3020 ctt cta ctc cag agg gtt gag aga aac cta tct aag agt atg aga 10104Leu Leu Leu Gln Arg Val Glu Arg Asn Leu Ser Lys Ser Met Arg 3025 3030 3035 gat aac ctg cga caa ttg agt tcc ttg atg agg cag gtg ctg ggc 10149Asp Asn Leu Arg Gln Leu Ser Ser Leu Met Arg Gln Val Leu Gly 3040 3045 3050 ggg cac gga gaa gat acc tta gag tca gac gac aac att caa cga 10194Gly His Gly Glu Asp Thr Leu Glu Ser Asp Asp Asn Ile Gln Arg 3055 3060 3065 ctg cta aaa gac tct tta cga agg aca aga tgg gtg gat caa gag 10239Leu Leu Lys Asp Ser Leu Arg Arg Thr Arg Trp Val Asp Gln Glu 3070 3075 3080 gtg cgc cat gca gct aga acc atg act gga gat tac agc ccc aac 10284Val Arg His Ala Ala Arg Thr Met Thr Gly Asp Tyr Ser Pro Asn 3085 3090 3095 aag aag gtg tcc cgt aag gta gga tgt tca gaa tgg gtc tgc tct 10329Lys Lys Val Ser Arg Lys Val Gly Cys Ser Glu Trp Val Cys Ser 3100 3105 3110 gct caa cag gtt gca gtc tct acc tca gca aac ccg gcc cct gtc 10374Ala Gln Gln Val Ala Val Ser Thr Ser Ala Asn Pro Ala Pro Val 3115 3120 3125 tcg gag ctt gac ata agg gcc ctc tct aag agg ttc cag aac cct 10419Ser Glu Leu Asp Ile Arg Ala Leu Ser Lys Arg Phe Gln Asn Pro 3130 3135 3140 ttg atc tcg ggc ttg aga gtg gtt cag tgg gca acc ggt gct cat 10464Leu Ile Ser Gly Leu Arg Val Val Gln Trp Ala Thr Gly Ala His 3145 3150 3155 tat aag ctt aag cct att cta gat gat ctc aat gtt ttc cca tct 10509Tyr Lys Leu Lys Pro Ile Leu Asp Asp Leu Asn Val Phe Pro Ser 3160 3165 3170 ctc tgc ctt gta gtt ggg gac ggg tca ggg ggg ata tca agg gca 10554Leu Cys Leu Val Val Gly Asp Gly Ser Gly Gly Ile Ser Arg Ala 3175 3180 3185 gtc ctc aac atg ttt cca gat gcc aag ctt gtg ttc aac agt ctc 10599Val Leu Asn Met Phe Pro Asp Ala Lys Leu Val Phe Asn Ser Leu 3190 3195 3200 tta gag gtg aat gac ctg atg gct tcc gga aca cat cca ctg cct 10644Leu Glu Val Asn Asp Leu Met Ala Ser Gly Thr His Pro Leu Pro 3205 3210 3215 cct tca gca atc atg agg gga gga aat gat atc gtc tcc aga gtg 10689Pro Ser Ala Ile Met Arg Gly Gly Asn Asp Ile Val Ser Arg Val 3220 3225 3230 ata gat ttt gac tca atc tgg gaa aaa ccg tcc gac ttg aga aac 10734Ile Asp Phe Asp Ser Ile Trp Glu Lys Pro Ser Asp Leu Arg Asn 3235 3240 3245 ttg gca acc tgg aaa tac ttc cag tca gtc caa aag cag gtc aac 10779Leu Ala Thr Trp Lys Tyr Phe Gln Ser Val Gln Lys Gln Val Asn 3250 3255 3260 atg tcc tat gac ctc att att tgc gat gca gaa gtt act gac att 10824Met Ser Tyr Asp Leu Ile Ile Cys Asp Ala Glu Val Thr Asp Ile 3265 3270 3275 gca tct atc aac cgg ata acc ctg tta atg tcc gat ttt gca ttg 10869Ala Ser Ile Asn Arg Ile Thr Leu Leu Met Ser Asp Phe Ala Leu 3280 3285 3290 tct ata gat gga cca ctc tat ttg gtc ttc aaa act tat ggg act 10914Ser Ile Asp Gly Pro Leu Tyr Leu Val Phe Lys Thr Tyr Gly Thr 3295 3300 3305 atg cta gta aat cca aac tac aag gct att caa cac ctg tca aga 10959Met Leu Val Asn Pro Asn Tyr Lys Ala Ile Gln His Leu Ser Arg 3310 3315 3320 gcg ttc ccc tcg gtc aca ggg ttt atc acc caa gta act tcg tct 11004Ala Phe Pro Ser Val Thr Gly Phe Ile Thr Gln Val Thr Ser Ser 3325 3330 3335 ttt tca tct gag ctc tac ctc cga ttc tcc aaa cga ggg aag ttt 11049Phe Ser Ser Glu Leu Tyr Leu Arg Phe Ser Lys Arg Gly Lys Phe 3340 3345 3350 ttc aga gat gct gag tac ttg acc tct tcc acc ctt cga gaa atg 11094Phe Arg Asp Ala Glu Tyr Leu Thr Ser Ser Thr Leu Arg Glu Met 3355 3360 3365 agc ctt gtg tta ttc aat tgt agc agc ccc aag agt gag atg cag 11139Ser Leu Val Leu Phe Asn Cys Ser Ser Pro Lys Ser Glu Met Gln 3370 3375 3380 aga gct cgt tcc ttg aac tat cag gat ctt gtg aga gga ttt cct 11184Arg Ala Arg Ser Leu Asn Tyr Gln Asp Leu Val Arg Gly Phe Pro 3385 3390 3395 gaa gaa atc ata tca aat cct tac aat gag atg atc ata act ctg 11229Glu Glu Ile Ile Ser Asn Pro Tyr Asn Glu Met Ile Ile Thr Leu 3400 3405 3410 att gac agt gat gta gaa tct ttt cta gtc cac aag atg gtt gat 11274Ile Asp Ser Asp Val Glu Ser Phe Leu Val His Lys Met Val Asp 3415 3420 3425 gat ctt gag tta cag agg gga act ctg tct aaa gtg gct atc att 11319Asp Leu Glu Leu Gln Arg Gly Thr Leu Ser Lys Val Ala Ile Ile 3430 3435 3440 ata gcc atc atg ata gtt ttc tcc aac aga gtc ttc aac gtt tcc 11364Ile Ala Ile Met Ile Val Phe Ser Asn Arg Val Phe Asn Val Ser 3445 3450 3455 aaa ccc cta act gac ccc ttg ttc tat cca ccg tct gat ccc aaa 11409Lys Pro Leu Thr Asp Pro Leu Phe Tyr Pro Pro Ser Asp Pro Lys 3460 3465 3470 atc ctg agg cac ttc aac ata tgt tgc agt act atg atg tat cta 11454Ile Leu Arg His Phe Asn Ile Cys Cys Ser Thr Met Met Tyr Leu 3475 3480 3485 tct act gct tta ggt gac gtc cct agc ttc gca aga ctt cac gac 11499Ser Thr Ala Leu Gly Asp Val Pro Ser Phe Ala Arg Leu His Asp 3490 3495 3500 ctg tat aac aga cct ata act tat tac ttc aga aag caa ttc att 11544Leu Tyr Asn Arg Pro Ile Thr Tyr Tyr Phe Arg Lys Gln Phe Ile 3505 3510 3515 cga ggg aac gtt tat cta tct tgg agt tgg tcc aac gac acc tca 11589Arg Gly Asn Val Tyr Leu Ser Trp Ser Trp Ser Asn Asp Thr Ser 3520 3525 3530 gtg ttc aaa agg gta gcc tgt aat tct agc ctg agt ctg tca tct 11634Val Phe Lys Arg Val Ala Cys Asn Ser Ser Leu Ser Leu Ser Ser 3535 3540 3545 cac tgg atc agg ttg att tac aag ata gtg aag act acc aga ctc 11679His Trp Ile Arg Leu Ile Tyr Lys Ile Val Lys Thr Thr Arg Leu 3550 3555 3560 gtt ggc agc atc aag gat cta tcc aga gaa gtg gaa aga cac ctt 11724Val Gly Ser Ile Lys Asp Leu Ser Arg Glu Val Glu Arg His Leu 3565 3570 3575 cat agg tac aac agg tgg atc acc cta gag gat atc aga tct aga 11769His Arg Tyr Asn Arg Trp Ile Thr Leu Glu Asp Ile Arg Ser Arg 3580 3585 3590 tca tcc cta cta gac tac agt tgc ctg tgaaccggat actcctggaa 11816Ser Ser Leu Leu Asp Tyr Ser Cys Leu 3595 3600 gcctgcccat gctaagactc ttgtgtgatg tatcttgaaa aaaacaagat cctaaatctg 11876aacctttggt tgtttgattg tttttctcat ttttgttgtt tatttgttaa gcgt 119302450PRTArtificial SequenceSynthetic Construct 2Met Asp Ala Asp Lys Ile Val Phe Lys Val Asn Asn Gln Val Val Ser 1 5 10 15 Leu Lys Pro Glu Ile Ile Val Asp Gln His Glu Tyr Lys Tyr Pro Ala 20 25 30 Ile Lys Asp Leu Lys Lys Pro Cys Ile Thr Leu Gly Lys Ala Pro Asp 35 40 45 Leu Asn Lys Ala Tyr Lys Ser Val Leu Ser Gly Met Ser Ala Ala Lys 50 55 60 Leu Asp Pro Asp Asp Val Cys Ser Tyr Leu Ala Ala Ala Met Gln Phe 65 70 75 80 Phe Glu Gly Thr Cys Pro Glu Asp Trp Thr Ser Tyr Gly Ile Val Ile 85 90 95 Ala Arg Lys Gly Asp Lys Ile Thr Pro Gly Ser Leu Val Glu Ile Lys 100 105 110 Arg Thr Asp Val Glu Gly Asn Trp Ala Leu Thr Gly Gly Met Glu Leu 115 120 125 Thr Arg Asp Pro Thr Val Pro Glu His Ala Ser Leu Val Gly Leu Leu 130 135 140 Leu Ser Leu Tyr Arg Leu Ser Lys Ile Ser Gly Gln Asn Thr Gly Asn 145 150 155 160 Tyr Lys Thr Asn Ile Ala Asp Arg Ile Glu Gln Ile Phe Glu Thr Ala 165 170 175 Pro Phe Val Lys Ile Val Glu His His Thr Leu Met Thr Thr His Lys 180 185 190 Met Cys Ala Asn Trp Ser Thr Ile Pro Asn Phe Arg Phe Leu Ala Gly 195 200 205 Thr Tyr Asp Met Phe Phe Ser Arg Ile Glu His Leu Tyr Ser Ala Ile 210 215 220

Arg Val Gly Thr Val Val Thr Ala Tyr Glu Asp Cys Ser Gly Leu Val 225 230 235 240 Ser Phe Thr Gly Phe Ile Lys Gln Ile Asn Leu Thr Ala Arg Glu Ala 245 250 255 Ile Leu Tyr Phe Phe His Lys Asn Phe Glu Glu Glu Ile Arg Arg Met 260 265 270 Phe Glu Pro Gly Gln Glu Thr Ala Val Pro His Ser Tyr Phe Ile His 275 280 285 Phe Arg Ser Leu Gly Leu Ser Gly Lys Ser Pro Tyr Ser Ser Asn Ala 290 295 300 Val Gly His Val Phe Asn Leu Ile His Phe Val Gly Cys Tyr Met Gly 305 310 315 320 Gln Val Arg Ser Leu Asn Ala Thr Val Ile Ala Ala Cys Ala Pro His 325 330 335 Glu Met Ser Val Leu Gly Gly Tyr Leu Gly Glu Glu Phe Phe Gly Lys 340 345 350 Gly Thr Phe Glu Arg Arg Phe Phe Arg Asp Glu Lys Glu Leu Gln Glu 355 360 365 Tyr Glu Ala Ala Glu Leu Thr Lys Thr Asp Val Ala Leu Ala Asp Asp 370 375 380 Gly Thr Val Asn Ser Asp Asp Glu Asp Tyr Phe Ser Gly Glu Thr Arg 385 390 395 400 Ser Pro Glu Ala Val Tyr Thr Arg Ile Met Met Asn Gly Gly Arg Leu 405 410 415 Lys Arg Ser His Ile Arg Arg Tyr Val Ser Val Ser Ser Asn His Gln 420 425 430 Ala Arg Pro Asn Ser Phe Ala Glu Phe Leu Asn Lys Thr Tyr Ser Ser 435 440 445 Asp Ser 450 3297PRTArtificial SequenceSynthetic Construct 3Met Ser Lys Ile Phe Val Asn Pro Ser Ala Ile Arg Ala Gly Leu Ala 1 5 10 15 Asp Leu Glu Met Ala Glu Glu Thr Val Asp Leu Ile Asn Arg Asn Ile 20 25 30 Glu Asp Asn Gln Ala His Leu Gln Gly Glu Pro Ile Glu Val Asp Asn 35 40 45 Leu Pro Glu Asp Met Gly Arg Leu His Leu Asp Asp Gly Lys Ser Pro 50 55 60 Asn Pro Gly Glu Met Ala Lys Val Gly Glu Gly Lys Tyr Arg Glu Asp 65 70 75 80 Phe Gln Met Asp Glu Gly Glu Asp Leu Ser Phe Leu Phe Gln Ser Tyr 85 90 95 Leu Glu Asn Val Gly Val Gln Ile Val Arg Gln Met Arg Ser Gly Glu 100 105 110 Arg Phe Leu Lys Ile Trp Ser Gln Thr Val Glu Glu Ile Ile Ser Tyr 115 120 125 Val Ala Val Asn Phe Pro Asn Pro Pro Gly Lys Ser Ser Glu Asp Lys 130 135 140 Ser Thr Gln Thr Thr Gly Arg Glu Leu Lys Lys Glu Thr Thr Pro Thr 145 150 155 160 Pro Ser Gln Arg Glu Ser Gln Ser Ser Lys Ala Arg Met Ala Ala Gln 165 170 175 Ile Ala Ser Gly Pro Pro Ala Leu Glu Trp Ser Ala Thr Asn Glu Glu 180 185 190 Asp Asp Leu Ser Val Glu Ala Glu Ile Ala His Gln Ile Ala Glu Ser 195 200 205 Phe Ser Lys Lys Tyr Lys Phe Pro Ser Arg Ser Ser Gly Ile Leu Leu 210 215 220 Tyr Asn Phe Glu Gln Leu Lys Met Asn Leu Asp Asp Ile Val Lys Glu 225 230 235 240 Ala Lys Asn Val Pro Gly Val Thr Arg Leu Ala His Asp Gly Ser Lys 245 250 255 Leu Pro Leu Arg Cys Val Leu Gly Trp Val Ala Leu Ala Asn Pro Lys 260 265 270 Lys Phe Gln Leu Leu Val Glu Ser Asp Lys Leu Ser Lys Ile Met Gln 275 280 285 Asp Asp Leu Asn Arg Tyr Thr Ser Cys 290 295 4202PRTArtificial SequenceSynthetic Construct 4Met Asn Phe Leu Arg Lys Ile Val Lys Asn Cys Arg Asp Glu Asp Thr 1 5 10 15 Gln Lys Pro Ser Pro Val Ser Ala Pro Leu Asp Asp Asp Asp Leu Trp 20 25 30 Leu Pro Pro Pro Glu Tyr Val Pro Leu Lys Glu Leu Thr Ser Lys Lys 35 40 45 Asn Met Arg Asn Phe Cys Ile Asn Gly Gly Val Lys Val Cys Ser Pro 50 55 60 Asn Gly Tyr Ser Phe Arg Ile Leu Arg His Ile Leu Lys Ser Phe Asp 65 70 75 80 Glu Ile Tyr Ser Gly Asn His Arg Met Ile Gly Leu Ala Lys Val Val 85 90 95 Ile Gly Leu Ala Leu Ser Gly Ser Pro Val Pro Glu Gly Met Asn Trp 100 105 110 Val Tyr Lys Leu Arg Arg Thr Phe Ile Phe Gln Trp Ala Asp Ser Arg 115 120 125 Gly Pro Leu Glu Gly Glu Glu Leu Glu Tyr Ser Gln Glu Ile Thr Trp 130 135 140 Asp Asp Asp Thr Glu Phe Val Gly Leu Gln Ile Arg Val Ile Ala Lys 145 150 155 160 Gln Cys His Ile Gln Gly Arg Ile Trp Cys Ile Asn Met Asn Pro Arg 165 170 175 Ala Cys Gln Leu Trp Ser Asp Met Ser Leu Gln Thr Gln Arg Ser Glu 180 185 190 Glu Asp Lys Asp Ser Ser Leu Leu Leu Glu 195 200 5524PRTArtificial SequenceSynthetic Construct 5Met Val Pro Gln Ala Leu Leu Phe Val Pro Leu Leu Val Phe Pro Leu 1 5 10 15 Cys Phe Gly Lys Phe Pro Ile Tyr Thr Ile Pro Asp Lys Leu Gly Pro 20 25 30 Trp Ser Pro Ile Asp Ile His His Leu Ser Cys Pro Asn Asn Leu Val 35 40 45 Val Glu Asp Glu Gly Cys Thr Asn Leu Ser Gly Phe Ser Tyr Met Glu 50 55 60 Leu Lys Val Gly Tyr Ile Leu Ala Ile Lys Met Asn Gly Phe Thr Cys 65 70 75 80 Thr Gly Val Val Thr Glu Ala Glu Thr Tyr Thr Asn Phe Val Gly Tyr 85 90 95 Val Thr Thr Thr Phe Lys Arg Lys His Phe Arg Pro Thr Pro Asp Ala 100 105 110 Cys Arg Ala Ala Tyr Asn Trp Lys Met Ala Gly Asp Pro Arg Tyr Glu 115 120 125 Glu Ser Leu His Asn Pro Tyr Pro Asp Tyr His Trp Leu Arg Thr Val 130 135 140 Lys Thr Thr Lys Glu Ser Leu Val Ile Ile Ser Pro Ser Val Ala Asp 145 150 155 160 Leu Asp Pro Tyr Asp Arg Ser Leu His Ser Arg Val Phe Pro Ser Gly 165 170 175 Lys Cys Ser Gly Val Ala Val Ser Ser Thr Tyr Cys Ser Thr Asn His 180 185 190 Asp Tyr Thr Ile Trp Met Pro Glu Asn Pro Arg Leu Gly Met Ser Cys 195 200 205 Asp Ile Phe Thr Asn Ser Arg Gly Lys Arg Ala Ser Lys Gly Ser Glu 210 215 220 Thr Cys Gly Phe Val Asp Glu Arg Gly Leu Tyr Lys Ser Leu Lys Gly 225 230 235 240 Ala Cys Lys Leu Lys Leu Cys Gly Val Leu Gly Leu Arg Leu Met Asp 245 250 255 Gly Thr Trp Val Ala Met Gln Thr Ser Asn Glu Thr Lys Trp Cys Pro 260 265 270 Pro Asp Gln Leu Val Asn Leu His Asp Phe Arg Ser Asp Glu Ile Glu 275 280 285 His Leu Val Val Glu Glu Leu Val Arg Lys Arg Glu Glu Cys Leu Asp 290 295 300 Ala Leu Glu Ser Ile Met Thr Thr Lys Ser Val Ser Phe Arg Arg Pro 305 310 315 320 Ser His Leu Arg Lys Leu Val Pro Gly Phe Gly Lys Ala Tyr Thr Ile 325 330 335 Phe Asn Lys Thr Leu Met Glu Ala Asp Ala His Tyr Lys Ser Val Glu 340 345 350 Thr Trp Asn Glu Ile Leu Pro Ser Lys Gly Cys Leu Arg Val Gly Gly 355 360 365 Arg Cys His Pro His Val Asn Gly Val Phe Phe Asn Gly Ile Ile Leu 370 375 380 Gly Pro Asp Gly Asn Val Leu Ile Pro Glu Met Gln Ser Ser Leu Leu 385 390 395 400 Gln Gln His Met Glu Leu Leu Glu Ser Ser Val Ile Pro Leu Val His 405 410 415 Pro Leu Ala Asp Pro Ser Thr Val Phe Lys Asp Gly Asp Glu Ala Glu 420 425 430 Asp Phe Val Glu Val His Leu Pro Asp Val His Asn Gln Val Ser Gly 435 440 445 Val Asp Leu Gly Leu Pro Asn Trp Gly Lys Tyr Val Leu Leu Ser Ala 450 455 460 Gly Ala Leu Thr Ala Leu Met Leu Ile Ile Phe Leu Met Thr Cys Cys 465 470 475 480 Arg Arg Val Asn Arg Ser Glu Pro Thr Gln His Asn Leu Arg Gly Thr 485 490 495 Gly Arg Glu Val Ser Val Thr Pro Gln Ser Gly Lys Ile Ile Ser Ser 500 505 510 Trp Glu Ser His Lys Ser Gly Gly Glu Thr Arg Leu 515 520 62127PRTArtificial SequenceSynthetic Construct 6Met Leu Asp Pro Gly Glu Val Tyr Asp Asp Pro Ile Asp Pro Ile Glu 1 5 10 15 Leu Glu Asp Glu Pro Arg Gly Thr Pro Thr Val Pro Asn Ile Leu Arg 20 25 30 Asn Ser Asp Tyr Asn Leu Asn Ser Pro Leu Ile Glu Asp Pro Ala Arg 35 40 45 Leu Met Leu Glu Trp Leu Lys Thr Gly Asn Arg Pro Tyr Arg Met Thr 50 55 60 Leu Thr Asp Asn Cys Ser Arg Ser Phe Arg Val Leu Lys Asp Tyr Phe 65 70 75 80 Lys Lys Val Asp Leu Gly Ser Leu Lys Val Gly Gly Met Ala Ala Gln 85 90 95 Ser Met Ile Ser Leu Trp Leu Tyr Gly Ala His Ser Glu Ser Asn Arg 100 105 110 Ser Arg Arg Cys Ile Thr Asp Leu Ala His Phe Tyr Ser Lys Ser Ser 115 120 125 Pro Ile Glu Lys Leu Leu Asn Leu Thr Leu Gly Asn Arg Gly Leu Arg 130 135 140 Ile Pro Pro Glu Gly Val Leu Ser Cys Leu Glu Arg Val Asp Tyr Asp 145 150 155 160 Asn Ala Phe Gly Arg Tyr Leu Ala Asn Thr Tyr Ser Ser Tyr Leu Phe 165 170 175 Phe His Val Ile Thr Leu Tyr Met Asn Ala Leu Asp Trp Asp Glu Glu 180 185 190 Lys Thr Ile Leu Ala Leu Trp Lys Asp Leu Thr Ser Val Asp Ile Gly 195 200 205 Lys Asp Leu Val Lys Phe Lys Asp Gln Ile Trp Gly Leu Pro Ile Val 210 215 220 Thr Lys Asp Phe Val Tyr Ser Gln Ser Ser Asn Cys Leu Phe Asp Arg 225 230 235 240 Asn Tyr Thr Leu Met Leu Lys Glu Leu Phe Leu Ser Arg Phe Asn Ser 245 250 255 Leu Met Val Leu Leu Ser Pro Pro Glu Pro Arg Tyr Ser Asp Asp Leu 260 265 270 Ile Ser Gln Leu Cys Gln Leu Tyr Ile Ala Gly Asp Gln Val Leu Ser 275 280 285 Met Cys Gly Asn Ser Gly Tyr Glu Val Ile Lys Ile Leu Glu Pro Tyr 290 295 300 Val Val Asn Ser Leu Val Gln Arg Ala Glu Lys Phe Arg Pro Leu Ile 305 310 315 320 His Ser Leu Gly Asp Phe Pro Val Phe Ile Lys Asp Lys Val Ser Gln 325 330 335 Leu Glu Glu Thr Phe Gly Pro Cys Ala Arg Arg Phe Phe Arg Ala Leu 340 345 350 Asp Gln Phe Asp Asn Ile His Asp Leu Val Phe Val Tyr Gly Cys Tyr 355 360 365 Arg His Trp Gly His Pro Tyr Ile Asp Tyr Arg Lys Gly Leu Ser Lys 370 375 380 Leu Tyr Asp Gln Val His Ile Lys Lys Val Ile Asp Lys Ser Tyr Gln 385 390 395 400 Glu Cys Leu Ala Ser Asp Leu Ala Arg Arg Ile Leu Arg Trp Gly Phe 405 410 415 Asp Lys Tyr Ser Lys Trp Tyr Leu Asp Ser Arg Phe Leu Ala Arg Asp 420 425 430 His Pro Leu Thr Pro Tyr Ile Lys Thr Gln Thr Trp Pro Pro Lys His 435 440 445 Ile Val Asp Leu Val Gly Asp Thr Trp His Lys Leu Pro Ile Thr Gln 450 455 460 Ile Phe Glu Ile Pro Glu Ser Met Asp Pro Ser Glu Ile Leu Asp Asp 465 470 475 480 Lys Ser His Ser Phe Thr Arg Thr Arg Leu Ala Ser Trp Leu Ser Glu 485 490 495 Asn Arg Gly Gly Pro Val Pro Ser Glu Lys Val Ile Ile Thr Ala Leu 500 505 510 Ser Lys Pro Pro Val Asn Pro Arg Glu Phe Leu Arg Ser Ile Asp Leu 515 520 525 Gly Gly Leu Pro Asp Glu Asp Leu Ile Ile Gly Leu Lys Pro Lys Glu 530 535 540 Arg Glu Leu Lys Ile Glu Gly Arg Phe Phe Ala Leu Met Ser Trp Asn 545 550 555 560 Leu Arg Leu Tyr Phe Val Ile Thr Glu Lys Leu Leu Ala Asn Tyr Ile 565 570 575 Leu Pro Leu Phe Asp Ala Leu Thr Met Thr Asp Asn Leu Asn Lys Val 580 585 590 Phe Lys Lys Leu Ile Asp Arg Val Thr Gly Gln Gly Leu Leu Asp Tyr 595 600 605 Ser Arg Val Thr Tyr Ala Phe His Leu Asp Tyr Glu Lys Trp Asn Asn 610 615 620 His Gln Arg Leu Glu Ser Thr Glu Asp Val Phe Ser Val Leu Asp Gln 625 630 635 640 Val Phe Gly Leu Lys Arg Val Phe Ser Arg Thr His Glu Phe Phe Gln 645 650 655 Lys Ala Trp Ile Tyr Tyr Ser Asp Arg Ser Asp Leu Ile Gly Leu Arg 660 665 670 Glu Asp Gln Ile Tyr Cys Leu Asp Ala Ser Asn Gly Pro Thr Cys Trp 675 680 685 Asn Gly Gln Asp Gly Gly Leu Glu Gly Leu Arg Gln Lys Gly Trp Ser 690 695 700 Leu Val Ser Leu Leu Met Ile Asp Arg Glu Ser Gln Ile Arg Asn Thr 705 710 715 720 Arg Thr Lys Ile Leu Ala Gln Gly Asp Asn Gln Val Leu Cys Pro Thr 725 730 735 Tyr Met Leu Ser Pro Gly Leu Ser Gln Glu Gly Leu Leu Tyr Glu Leu 740 745 750 Glu Arg Ile Ser Arg Asn Ala Leu Ser Ile Tyr Arg Ala Val Glu Glu 755 760 765 Gly Ala Ser Lys Leu Gly Leu Ile Ile Lys Lys Glu Glu Thr Met Cys 770 775 780 Ser Tyr Asp Phe Leu Ile Tyr Gly Lys Thr Pro Leu Phe Arg Gly Asn 785 790 795 800 Ile Leu Val Pro Glu Ser Lys Arg Trp Ala Arg Val Ser Cys Val Ser 805 810 815 Asn Asp Gln Ile Val Asn Leu Ala Asn Ile Met Ser Thr Val Ser Thr 820 825 830 Asn Ala Leu Thr Val Ala Gln His Ser Gln Ser Leu Ile Lys Pro Met 835 840 845 Arg Asp Phe Leu Leu Met Ser Val Gln Ala Val Phe His Tyr Leu Leu 850 855 860 Phe Ser Pro Ile Leu Lys Gly Arg Val Tyr Lys Ile Leu Ser Ala Glu 865 870 875 880 Gly Asp Ser Phe Leu Leu Ala Met Ser Arg Ile Ile Tyr Leu Asp Pro 885 890 895 Ser Leu Gly Gly Val Ser Gly Met Ser Leu Gly Arg Phe His Ile Arg 900 905 910 Gln Phe Ser Asp Pro Val Ser Glu Gly Leu Ser Phe Trp Arg Glu Ile 915 920 925 Trp Leu Ser Ser His Glu Ser Trp Ile His Ala Leu Cys Gln Glu Ala 930 935 940 Gly Asn Pro Asp Leu Gly Glu Arg Thr Leu Glu Ser Phe Thr Arg Leu 945 950 955 960 Leu Glu Asp Pro Thr Thr Leu Asn Ile Arg Gly Gly Ala Ser Pro Thr 965 970 975 Ile Leu Leu Lys Asp Ala Ile Arg Lys Ala Leu Tyr Asp Glu Val Asp 980 985 990 Lys Val Glu Asn Ser Glu Phe Arg Glu Ala Ile Leu Leu Ser Lys Thr 995 1000 1005 His Arg Asp Asn Phe Ile Leu Phe Leu Thr Ser Val Glu Pro Leu 1010 1015 1020 Phe Pro Arg Phe Leu Ser Glu Leu Phe Ser Ser Ser Phe Leu Gly

1025 1030 1035 Ile Pro Glu Ser Ile Ile Gly Leu Ile Gln Asn Ser Arg Thr Ile 1040 1045 1050 Arg Arg Gln Phe Arg Lys Ser Leu Ser Lys Thr Leu Glu Glu Ser 1055 1060 1065 Phe Tyr Asn Ser Glu Ile His Gly Ile Ser Arg Met Thr Gln Thr 1070 1075 1080 Pro Gln Arg Val Gly Gly Val Trp Pro Cys Ser Ser Glu Arg Ala 1085 1090 1095 Asp Leu Leu Arg Glu Ile Ser Trp Gly Arg Lys Val Val Gly Thr 1100 1105 1110 Thr Val Pro His Pro Ser Glu Met Leu Gly Leu Leu Pro Lys Ser 1115 1120 1125 Ser Ile Ser Cys Thr Cys Gly Ala Thr Gly Gly Gly Asn Pro Arg 1130 1135 1140 Val Ser Val Ser Val Leu Pro Ser Phe Asp Gln Ser Phe Phe Ser 1145 1150 1155 Arg Gly Pro Leu Lys Gly Tyr Leu Gly Ser Ser Thr Ser Met Ser 1160 1165 1170 Thr Gln Leu Phe His Ala Trp Glu Lys Val Thr Asn Val His Val 1175 1180 1185 Val Lys Arg Ala Leu Ser Leu Lys Glu Ser Ile Asn Trp Phe Ile 1190 1195 1200 Thr Arg Asp Ser Asn Leu Ala Gln Ala Leu Ile Arg Asn Ile Met 1205 1210 1215 Ser Leu Thr Gly Pro Asp Phe Pro Leu Glu Glu Ala Pro Val Phe 1220 1225 1230 Lys Arg Thr Gly Ser Ala Leu His Arg Phe Lys Ser Ala Arg Tyr 1235 1240 1245 Ser Glu Gly Gly Tyr Ser Ser Val Cys Pro Asn Leu Leu Ser His 1250 1255 1260 Ile Ser Val Ser Thr Asp Thr Met Ser Asp Leu Thr Gln Asp Gly 1265 1270 1275 Lys Asn Tyr Asp Phe Met Phe Gln Pro Leu Met Leu Tyr Ala Gln 1280 1285 1290 Thr Trp Thr Ser Glu Leu Val Gln Arg Asp Thr Arg Leu Arg Asp 1295 1300 1305 Ser Thr Phe His Trp His Leu Arg Cys Asn Arg Cys Val Arg Pro 1310 1315 1320 Ile Asp Asp Val Thr Leu Glu Thr Ser Gln Ile Phe Glu Phe Pro 1325 1330 1335 Asp Val Ser Lys Arg Ile Ser Arg Met Val Ser Gly Ala Val Pro 1340 1345 1350 His Phe Gln Arg Leu Pro Asp Ile Arg Leu Arg Pro Gly Asp Phe 1355 1360 1365 Glu Ser Leu Ser Gly Arg Glu Lys Ser His His Ile Gly Ser Ala 1370 1375 1380 Gln Gly Leu Leu Tyr Ser Ile Leu Val Ala Ile His Asp Ser Gly 1385 1390 1395 Tyr Asn Asp Gly Thr Ile Phe Pro Val Asn Ile Tyr Asp Lys Val 1400 1405 1410 Ser Pro Arg Asp Tyr Leu Arg Gly Leu Ala Arg Gly Val Leu Ile 1415 1420 1425 Gly Ser Ser Ile Cys Phe Leu Thr Arg Met Thr Asn Ile Asn Ile 1430 1435 1440 Asn Arg Pro Leu Glu Leu Ile Ser Gly Val Ile Ser Tyr Ile Leu 1445 1450 1455 Leu Arg Leu Asp Asn His Pro Ser Leu Tyr Ile Met Leu Arg Glu 1460 1465 1470 Pro Ser Leu Arg Gly Glu Ile Phe Ser Ile Pro Gln Lys Ile Pro 1475 1480 1485 Ala Ala Tyr Pro Thr Thr Met Lys Glu Gly Asn Arg Ser Ile Leu 1490 1495 1500 Cys Tyr Leu Gln His Val Leu Arg Tyr Glu Arg Glu Ile Ile Thr 1505 1510 1515 Ala Ser Pro Glu Asn Asp Trp Leu Trp Ile Phe Ser Asp Phe Arg 1520 1525 1530 Ser Ala Lys Met Thr Tyr Leu Thr Leu Ile Thr Tyr Gln Ser His 1535 1540 1545 Leu Leu Leu Gln Arg Val Glu Arg Asn Leu Ser Lys Ser Met Arg 1550 1555 1560 Asp Asn Leu Arg Gln Leu Ser Ser Leu Met Arg Gln Val Leu Gly 1565 1570 1575 Gly His Gly Glu Asp Thr Leu Glu Ser Asp Asp Asn Ile Gln Arg 1580 1585 1590 Leu Leu Lys Asp Ser Leu Arg Arg Thr Arg Trp Val Asp Gln Glu 1595 1600 1605 Val Arg His Ala Ala Arg Thr Met Thr Gly Asp Tyr Ser Pro Asn 1610 1615 1620 Lys Lys Val Ser Arg Lys Val Gly Cys Ser Glu Trp Val Cys Ser 1625 1630 1635 Ala Gln Gln Val Ala Val Ser Thr Ser Ala Asn Pro Ala Pro Val 1640 1645 1650 Ser Glu Leu Asp Ile Arg Ala Leu Ser Lys Arg Phe Gln Asn Pro 1655 1660 1665 Leu Ile Ser Gly Leu Arg Val Val Gln Trp Ala Thr Gly Ala His 1670 1675 1680 Tyr Lys Leu Lys Pro Ile Leu Asp Asp Leu Asn Val Phe Pro Ser 1685 1690 1695 Leu Cys Leu Val Val Gly Asp Gly Ser Gly Gly Ile Ser Arg Ala 1700 1705 1710 Val Leu Asn Met Phe Pro Asp Ala Lys Leu Val Phe Asn Ser Leu 1715 1720 1725 Leu Glu Val Asn Asp Leu Met Ala Ser Gly Thr His Pro Leu Pro 1730 1735 1740 Pro Ser Ala Ile Met Arg Gly Gly Asn Asp Ile Val Ser Arg Val 1745 1750 1755 Ile Asp Phe Asp Ser Ile Trp Glu Lys Pro Ser Asp Leu Arg Asn 1760 1765 1770 Leu Ala Thr Trp Lys Tyr Phe Gln Ser Val Gln Lys Gln Val Asn 1775 1780 1785 Met Ser Tyr Asp Leu Ile Ile Cys Asp Ala Glu Val Thr Asp Ile 1790 1795 1800 Ala Ser Ile Asn Arg Ile Thr Leu Leu Met Ser Asp Phe Ala Leu 1805 1810 1815 Ser Ile Asp Gly Pro Leu Tyr Leu Val Phe Lys Thr Tyr Gly Thr 1820 1825 1830 Met Leu Val Asn Pro Asn Tyr Lys Ala Ile Gln His Leu Ser Arg 1835 1840 1845 Ala Phe Pro Ser Val Thr Gly Phe Ile Thr Gln Val Thr Ser Ser 1850 1855 1860 Phe Ser Ser Glu Leu Tyr Leu Arg Phe Ser Lys Arg Gly Lys Phe 1865 1870 1875 Phe Arg Asp Ala Glu Tyr Leu Thr Ser Ser Thr Leu Arg Glu Met 1880 1885 1890 Ser Leu Val Leu Phe Asn Cys Ser Ser Pro Lys Ser Glu Met Gln 1895 1900 1905 Arg Ala Arg Ser Leu Asn Tyr Gln Asp Leu Val Arg Gly Phe Pro 1910 1915 1920 Glu Glu Ile Ile Ser Asn Pro Tyr Asn Glu Met Ile Ile Thr Leu 1925 1930 1935 Ile Asp Ser Asp Val Glu Ser Phe Leu Val His Lys Met Val Asp 1940 1945 1950 Asp Leu Glu Leu Gln Arg Gly Thr Leu Ser Lys Val Ala Ile Ile 1955 1960 1965 Ile Ala Ile Met Ile Val Phe Ser Asn Arg Val Phe Asn Val Ser 1970 1975 1980 Lys Pro Leu Thr Asp Pro Leu Phe Tyr Pro Pro Ser Asp Pro Lys 1985 1990 1995 Ile Leu Arg His Phe Asn Ile Cys Cys Ser Thr Met Met Tyr Leu 2000 2005 2010 Ser Thr Ala Leu Gly Asp Val Pro Ser Phe Ala Arg Leu His Asp 2015 2020 2025 Leu Tyr Asn Arg Pro Ile Thr Tyr Tyr Phe Arg Lys Gln Phe Ile 2030 2035 2040 Arg Gly Asn Val Tyr Leu Ser Trp Ser Trp Ser Asn Asp Thr Ser 2045 2050 2055 Val Phe Lys Arg Val Ala Cys Asn Ser Ser Leu Ser Leu Ser Ser 2060 2065 2070 His Trp Ile Arg Leu Ile Tyr Lys Ile Val Lys Thr Thr Arg Leu 2075 2080 2085 Val Gly Ser Ile Lys Asp Leu Ser Arg Glu Val Glu Arg His Leu 2090 2095 2100 His Arg Tyr Asn Arg Trp Ile Thr Leu Glu Asp Ile Arg Ser Arg 2105 2110 2115 Ser Ser Leu Leu Asp Tyr Ser Cys Leu 2120 2125 7524PRTRabies virus ERA strain 7Met Val Pro Gln Ala Leu Leu Phe Val Pro Leu Leu Val Phe Pro Leu 1 5 10 15 Cys Phe Gly Lys Phe Pro Ile Tyr Thr Ile Pro Asp Lys Leu Gly Pro 20 25 30 Trp Ser Pro Ile Asp Ile His His Leu Ser Cys Pro Asn Asn Leu Val 35 40 45 Val Glu Asp Glu Gly Cys Thr Asn Leu Ser Gly Phe Ser Tyr Met Glu 50 55 60 Leu Lys Val Gly Tyr Ile Leu Ala Ile Lys Met Asn Gly Phe Thr Cys 65 70 75 80 Thr Gly Val Val Thr Glu Ala Glu Thr Tyr Thr Asn Phe Val Gly Tyr 85 90 95 Val Thr Thr Thr Phe Lys Arg Lys His Phe Arg Pro Thr Pro Asp Ala 100 105 110 Cys Arg Ala Ala Tyr Asn Trp Lys Met Ala Gly Asp Pro Arg Tyr Glu 115 120 125 Glu Ser Leu His Asn Pro Tyr Pro Asp Tyr His Trp Leu Arg Thr Val 130 135 140 Lys Thr Thr Lys Glu Ser Leu Val Ile Ile Ser Pro Ser Val Ala Asp 145 150 155 160 Leu Asp Pro Tyr Asp Arg Ser Leu His Ser Arg Val Phe Pro Ser Gly 165 170 175 Lys Cys Ser Gly Val Ala Val Ser Ser Thr Tyr Cys Ser Thr Asn His 180 185 190 Asp Tyr Thr Ile Trp Met Pro Glu Asn Pro Arg Leu Gly Met Ser Cys 195 200 205 Asp Ile Phe Thr Asn Ser Arg Gly Lys Arg Ala Ser Lys Gly Ser Glu 210 215 220 Thr Cys Gly Phe Val Asp Glu Arg Gly Leu Tyr Lys Ser Leu Lys Gly 225 230 235 240 Ala Cys Lys Leu Lys Leu Cys Gly Val Leu Gly Leu Arg Leu Met Asp 245 250 255 Gly Thr Trp Val Ala Met Gln Thr Ser Asn Glu Thr Lys Trp Cys Pro 260 265 270 Pro Asp Gln Leu Val Asn Leu His Asp Phe Arg Ser Asp Glu Ile Glu 275 280 285 His Leu Val Val Glu Glu Leu Val Arg Lys Arg Glu Glu Cys Leu Asp 290 295 300 Ala Leu Glu Ser Ile Met Thr Thr Lys Ser Val Ser Phe Arg Arg Pro 305 310 315 320 Ser His Leu Arg Lys Leu Val Pro Gly Phe Gly Lys Ala Tyr Thr Ile 325 330 335 Phe Asn Lys Thr Leu Met Glu Ala Asp Ala His Tyr Lys Ser Val Arg 340 345 350 Thr Trp Asn Glu Ile Leu Pro Ser Lys Gly Cys Leu Arg Val Gly Gly 355 360 365 Arg Cys His Pro His Val Asn Gly Val Phe Phe Asn Gly Ile Ile Leu 370 375 380 Gly Pro Asp Gly Asn Val Leu Ile Pro Glu Met Gln Ser Ser Leu Leu 385 390 395 400 Gln Gln His Met Glu Leu Leu Glu Ser Ser Val Ile Pro Leu Val His 405 410 415 Pro Leu Ala Asp Pro Ser Thr Val Phe Lys Asp Gly Asp Glu Ala Glu 420 425 430 Asp Phe Val Glu Val His Leu Pro Asp Val His Asn Gln Val Ser Gly 435 440 445 Val Asp Leu Gly Leu Pro Asn Trp Gly Lys Tyr Val Leu Leu Ser Ala 450 455 460 Gly Ala Leu Thr Ala Leu Met Leu Ile Ile Phe Leu Met Thr Cys Cys 465 470 475 480 Arg Arg Val Asn Arg Ser Glu Pro Thr Gln His Asn Leu Arg Gly Thr 485 490 495 Gly Arg Glu Val Ser Val Thr Pro Gln Ser Gly Lys Ile Ile Ser Ser 500 505 510 Trp Glu Ser His Lys Ser Gly Gly Glu Thr Arg Leu 515 520 832DNAArtificial SequenceSynthetic oligonucleotide 8ccgggtacca cgcttaacaa ccagatcaaa ga 32931DNAArtificial SequenceSynthetic oligonucleotide 9taggtcgctt gctaagcact cctggtagga c 311031DNAArtificial SequenceSynthetic oligonucleotide 10gtcctaccag gagtgcttag caagcgacct a 311134DNAArtificial SequenceSynthetic oligonucleotide 11aaaactgcag acgcttaaca aataaacaac aaaa 341279DNAArtificial SequenceSynthetic oligonucleotide 12caaggctagc tgttaagcgt ctgatgagtc cgtgaggacg aaactatagg aaaggaattc 60ctatagtcgg taccacgct 791379DNAArtificial SequenceSynthetic oligonucleotide 13agcgtggtac cgactatagg aattcctttc ctatagtttc gtcctcacgg actcatcaga 60cgcttaacag ctagccttg 7914108DNAArtificial SequenceSynthetic oligonucleotide 14gacctgcagg ggtcggcatg gcatctccac ctcctcgcgg tccgacctgg gcatccgaag 60gaggacgcac gtccactcgg atggctaagg gagggcgcgg ccgcactc 10815108DNAArtificial SequenceSynthetic oligonucleotide 15gagtgcggcc gcgccctccc ttagccatcc gagtggacgt gcgtcctcct tcggatgccc 60aggtcggacc gcgaggaggt ggagatgcca tgccgacccc tgcaggtc 1081625DNAArtificial SequenceSynthetic oligonucleotide 16accaccatgg atgccgacaa gattg 251733DNAArtificial SequenceSynthetic oligonucleotide 17ggcccatggt tatgagtcac tcgaatatgt ctt 331833DNAArtificial SequenceSynthetic oligonucleotide 18ttggtaccac catgagcaag atctttgtca atc 331934DNAArtificial SequenceSynthetic oligonucleotide 19ggagaggaat tcttagcaag atgtatagcg attc 342032DNAArtificial SequenceSynthetic oligonucleotide 20ttggtaccac catggttcct caggctctcc tg 322133DNAArtificial SequenceSynthetic oligonucleotide 21aaaactgcag tcacagtctg gtctcacccc cac 332236DNAArtificial SequenceSynthetic oligonucleotide 22accgctagca ccaccatgct cgatcctgga gaggtc 362334DNAArtificial SequenceSynthetic oligonucleotide 23aaaactgcag tcacaggcaa ctgtagtcta gtag 342438DNAArtificial SequenceSynthetic oligonucleotide 24tcgctagcac caccatgaac acgattaaca tcgctaag 382533DNAArtificial SequenceSynthetic oligonucleotide 25gatgaattct tacgcgaacg cgaagtccga ctc 332663DNAArtificial SequenceSynthetic oligonucleotide 26tcgctagcca ccatgccaaa aaagaagaga aaggtagaaa acacgattaa catcgctaag 60aac 632731DNAArtificial SequenceSynthetic oligonucleotide 27aaaactgcag gccaccatgg gcgtgatcaa g 312831DNAArtificial SequenceSynthetic oligonucleotide 28ccgctcggta cctattagcc ggcctggcgg g 312946DNAArtificial SequenceSynthetic oligonucleotide 29ccctctgcag tttggtaccg tcgagaaaaa aacattagat cagaag 463024DNAArtificial SequenceSynthetic oligonucleotide 30atgaactttc tacgtaagat agtg 243146DNAArtificial SequenceSynthetic oligonucleotide 31caaactgcag aggggtgtta gtttttttca aaaagaaccc cccaag 463244DNAArtificial SequenceSynthetic oligonucleotide 32caaactgcag aggggtgtta gtttttttca catccaagag gatc 443342DNAArtificial SequenceSynthetic oligonucleotide 33cctctgcagt ttggtacctt gaaaaaaacc tgggttcaat ag 423435DNAArtificial SequenceSynthetic oligonucleotide 34ctcactacaa gtcagtcgag acttggaatg agatc 353535DNAArtificial SequenceSynthetic oligonucleotide 35gactgacttt gagtgagcat cggcttccat caagg 353660DNAArtificial SequenceSynthetic oligonucleotide 36ccaaactgca gcgaaaggag gggtgttagt ttttttcatg atgaaccccc caaggggagg 603739DNAArtificial SequenceSynthetic oligonucleotide 37gactcactat agggagaccc aagctggcta gctgttaag 393860DNAArtificial SequenceSynthetic oligonucleotide 38ccaaactgca gcgaaaggag gggtgttagt ttttttcatg ttgactttag gacatctcgg 603961DNAArtificial SequenceSynthetic oligonucleotide 39cctttcgctg cagtttggta ccgtcgagaa aaaaacaggc aacaccactg ataaaatgaa 60c

614030DNAArtificial SequenceSynthetic oligonucleotide 40cctccccttc aagagggccc ctggaatcag 304146DNAArtificial SequenceSynthetic oligonucleotide 41ctaacacccc tcctttcgct gcagtttggt accgtcgaga aaaaaa 464253DNAArtificial SequenceSynthetic oligonucleotide 42tttttttgat tgtggggagg aaagcgacgt caaaccatgg cagctctttt ttt 534337DNAArtificial SequenceSynthetic oligonucleotide 43cgactgcaga tgaatatacc ttgctttgtt gtgattc 374439DNAArtificial SequenceSynthetic oligonucleotide 44cgtggtacct catgtacctg gaagcccttt ataggactc 394533DNAArtificial SequenceSynthetic oligonucleotide 45catctgctag caatggcttc ctactttgcg ttg 334633DNAArtificial SequenceSynthetic oligonucleotide 46ttcaatggta ccttattggg cagtttgtcc ctt 33471569DNAMokola virusCDS(1)..(1569) 47atg aat ata cct tgc ttt gtt gtg att ctt gga ttc aca act aca tat 48Met Asn Ile Pro Cys Phe Val Val Ile Leu Gly Phe Thr Thr Thr Tyr 1 5 10 15 tct ctt ggg gaa ttt cct ttg tac aca att ccc gag aag ata gag aaa 96Ser Leu Gly Glu Phe Pro Leu Tyr Thr Ile Pro Glu Lys Ile Glu Lys 20 25 30 tgg acc cca ata gac atg atc cat cta agc tgc ccc aac aac tta tta 144Trp Thr Pro Ile Asp Met Ile His Leu Ser Cys Pro Asn Asn Leu Leu 35 40 45 tcc gag gag gaa ggt tgc aat aca gag tcg ccc ctc acc tac ttc gag 192Ser Glu Glu Glu Gly Cys Asn Thr Glu Ser Pro Leu Thr Tyr Phe Glu 50 55 60 ctc aag agt ggt tac tta gct cat cag aaa gtt ccg ggg ttt acc tgt 240Leu Lys Ser Gly Tyr Leu Ala His Gln Lys Val Pro Gly Phe Thr Cys 65 70 75 80 aca ggg gta gtg aat gag gcg gag aca tac aca aat ttt gtc ggg tat 288Thr Gly Val Val Asn Glu Ala Glu Thr Tyr Thr Asn Phe Val Gly Tyr 85 90 95 gtc acc aca aac ttc aaa aga aaa cac ttt aag cct aca gtc tcc gcc 336Val Thr Thr Asn Phe Lys Arg Lys His Phe Lys Pro Thr Val Ser Ala 100 105 110 tgt cgt gat gcc tac aac tgg aaa gcg tcc ggg gat ccc agg tat gag 384Cys Arg Asp Ala Tyr Asn Trp Lys Ala Ser Gly Asp Pro Arg Tyr Glu 115 120 125 gag tca ctg cac act cct tac cct gac agc agc tgg ttg aga act gta 432Glu Ser Leu His Thr Pro Tyr Pro Asp Ser Ser Trp Leu Arg Thr Val 130 135 140 act acc acc aaa gaa tcc ctt ctt ata ata tcg cct agc atc gtg gag 480Thr Thr Thr Lys Glu Ser Leu Leu Ile Ile Ser Pro Ser Ile Val Glu 145 150 155 160 atg gat gta tat ggc agg act ctc cat tcc ccc atg ttc cct tca ggg 528Met Asp Val Tyr Gly Arg Thr Leu His Ser Pro Met Phe Pro Ser Gly 165 170 175 ata tgt tct aag ctc tat ccc tct gtt cca tcc tgc aaa acc aac cat 576Ile Cys Ser Lys Leu Tyr Pro Ser Val Pro Ser Cys Lys Thr Asn His 180 185 190 gat tac aca tta tgg ctg cca gaa gat cct agt ttg agt tta atc tgt 624Asp Tyr Thr Leu Trp Leu Pro Glu Asp Pro Ser Leu Ser Leu Ile Cys 195 200 205 gat att ttc act tct ggc agc gga agg aag gcc atg aat ggg tcc cgc 672Asp Ile Phe Thr Ser Gly Ser Gly Arg Lys Ala Met Asn Gly Ser Arg 210 215 220 atc tgc gga ttc aag gat gaa agg gga ttt tac aga tct ttg aaa ggc 720Ile Cys Gly Phe Lys Asp Glu Arg Gly Phe Tyr Arg Ser Leu Lys Gly 225 230 235 240 gct tgt aag ctg aca ttg tgc gga agg cct ggg atc aga tta ttt gac 768Ala Cys Lys Leu Thr Leu Cys Gly Arg Pro Gly Ile Arg Leu Phe Asp 245 250 255 gga act tgg gtc tct ttt aca agg cca gaa gtt cac gtg tgg tgc acc 816Gly Thr Trp Val Ser Phe Thr Arg Pro Glu Val His Val Trp Cys Thr 260 265 270 cct aac caa ttg gtc aat ata cac aat gat aga ata gat gag atc gag 864Pro Asn Gln Leu Val Asn Ile His Asn Asp Arg Ile Asp Glu Ile Glu 275 280 285 cac ctg att gtt gaa gac att gtc aaa aga agg gag gag tgt tta gac 912His Leu Ile Val Glu Asp Ile Val Lys Arg Arg Glu Glu Cys Leu Asp 290 295 300 act cta gag aca gta ttt atg tct caa tca att agt ttt agg agg ttg 960Thr Leu Glu Thr Val Phe Met Ser Gln Ser Ile Ser Phe Arg Arg Leu 305 310 315 320 agc cac ttt cgg aaa ttg gtt ccc gga tat ggg aaa gct tac acc att 1008Ser His Phe Arg Lys Leu Val Pro Gly Tyr Gly Lys Ala Tyr Thr Ile 325 330 335 ttg aat ggt agc ctg atg gaa gca aat gtc tac tat aaa aga gtt gac 1056Leu Asn Gly Ser Leu Met Glu Ala Asn Val Tyr Tyr Lys Arg Val Asp 340 345 350 agg tgg gcg gac att tta ccc tct aag gga tgt ctg aaa gtc ggg caa 1104Arg Trp Ala Asp Ile Leu Pro Ser Lys Gly Cys Leu Lys Val Gly Gln 355 360 365 caa tgt atg gac cct gtc aac gga gtc ctc ttc aat ggg att atc aaa 1152Gln Cys Met Asp Pro Val Asn Gly Val Leu Phe Asn Gly Ile Ile Lys 370 375 380 ggt cca gat ggc cag atc ttg atc cct gaa atg cag tca gag cag ctc 1200Gly Pro Asp Gly Gln Ile Leu Ile Pro Glu Met Gln Ser Glu Gln Leu 385 390 395 400 aag cag cat atg gac tta tta aag gca gca gtg ttc cct ctc aga cat 1248Lys Gln His Met Asp Leu Leu Lys Ala Ala Val Phe Pro Leu Arg His 405 410 415 cct tta atc agc caa gac gcc atc ttt aag aaa gac ggg gag gca gat 1296Pro Leu Ile Ser Gln Asp Ala Ile Phe Lys Lys Asp Gly Glu Ala Asp 420 425 430 gat ttt gtg gac ctc cat atg cca gat gta cac aaa tct gta tca gat 1344Asp Phe Val Asp Leu His Met Pro Asp Val His Lys Ser Val Ser Asp 435 440 445 gtc gac ttg ggt ttg cct cac tgg ggg ttt tgg atg ttg atc ggg gca 1392Val Asp Leu Gly Leu Pro His Trp Gly Phe Trp Met Leu Ile Gly Ala 450 455 460 act gta gtg gca ttt ttg gtc ttg gtg tgt ctg ctc cgt gtc tgc tgt 1440Thr Val Val Ala Phe Leu Val Leu Val Cys Leu Leu Arg Val Cys Cys 465 470 475 480 aag aga gtg agg agg aga ggt tca cga cgt aca act cag gag atc ccc 1488Lys Arg Val Arg Arg Arg Gly Ser Arg Arg Thr Thr Gln Glu Ile Pro 485 490 495 ctc aac gtt tcc tct gtc ccc gtc cct cgg gcc aca gtg gtg tca tca 1536Leu Asn Val Ser Ser Val Pro Val Pro Arg Ala Thr Val Val Ser Ser 500 505 510 tgg gag tcc tat aaa ggg ctt cca ggt aca tga 1569Trp Glu Ser Tyr Lys Gly Leu Pro Gly Thr 515 520 48522PRTMokola virus 48Met Asn Ile Pro Cys Phe Val Val Ile Leu Gly Phe Thr Thr Thr Tyr 1 5 10 15 Ser Leu Gly Glu Phe Pro Leu Tyr Thr Ile Pro Glu Lys Ile Glu Lys 20 25 30 Trp Thr Pro Ile Asp Met Ile His Leu Ser Cys Pro Asn Asn Leu Leu 35 40 45 Ser Glu Glu Glu Gly Cys Asn Thr Glu Ser Pro Leu Thr Tyr Phe Glu 50 55 60 Leu Lys Ser Gly Tyr Leu Ala His Gln Lys Val Pro Gly Phe Thr Cys 65 70 75 80 Thr Gly Val Val Asn Glu Ala Glu Thr Tyr Thr Asn Phe Val Gly Tyr 85 90 95 Val Thr Thr Asn Phe Lys Arg Lys His Phe Lys Pro Thr Val Ser Ala 100 105 110 Cys Arg Asp Ala Tyr Asn Trp Lys Ala Ser Gly Asp Pro Arg Tyr Glu 115 120 125 Glu Ser Leu His Thr Pro Tyr Pro Asp Ser Ser Trp Leu Arg Thr Val 130 135 140 Thr Thr Thr Lys Glu Ser Leu Leu Ile Ile Ser Pro Ser Ile Val Glu 145 150 155 160 Met Asp Val Tyr Gly Arg Thr Leu His Ser Pro Met Phe Pro Ser Gly 165 170 175 Ile Cys Ser Lys Leu Tyr Pro Ser Val Pro Ser Cys Lys Thr Asn His 180 185 190 Asp Tyr Thr Leu Trp Leu Pro Glu Asp Pro Ser Leu Ser Leu Ile Cys 195 200 205 Asp Ile Phe Thr Ser Gly Ser Gly Arg Lys Ala Met Asn Gly Ser Arg 210 215 220 Ile Cys Gly Phe Lys Asp Glu Arg Gly Phe Tyr Arg Ser Leu Lys Gly 225 230 235 240 Ala Cys Lys Leu Thr Leu Cys Gly Arg Pro Gly Ile Arg Leu Phe Asp 245 250 255 Gly Thr Trp Val Ser Phe Thr Arg Pro Glu Val His Val Trp Cys Thr 260 265 270 Pro Asn Gln Leu Val Asn Ile His Asn Asp Arg Ile Asp Glu Ile Glu 275 280 285 His Leu Ile Val Glu Asp Ile Val Lys Arg Arg Glu Glu Cys Leu Asp 290 295 300 Thr Leu Glu Thr Val Phe Met Ser Gln Ser Ile Ser Phe Arg Arg Leu 305 310 315 320 Ser His Phe Arg Lys Leu Val Pro Gly Tyr Gly Lys Ala Tyr Thr Ile 325 330 335 Leu Asn Gly Ser Leu Met Glu Ala Asn Val Tyr Tyr Lys Arg Val Asp 340 345 350 Arg Trp Ala Asp Ile Leu Pro Ser Lys Gly Cys Leu Lys Val Gly Gln 355 360 365 Gln Cys Met Asp Pro Val Asn Gly Val Leu Phe Asn Gly Ile Ile Lys 370 375 380 Gly Pro Asp Gly Gln Ile Leu Ile Pro Glu Met Gln Ser Glu Gln Leu 385 390 395 400 Lys Gln His Met Asp Leu Leu Lys Ala Ala Val Phe Pro Leu Arg His 405 410 415 Pro Leu Ile Ser Gln Asp Ala Ile Phe Lys Lys Asp Gly Glu Ala Asp 420 425 430 Asp Phe Val Asp Leu His Met Pro Asp Val His Lys Ser Val Ser Asp 435 440 445 Val Asp Leu Gly Leu Pro His Trp Gly Phe Trp Met Leu Ile Gly Ala 450 455 460 Thr Val Val Ala Phe Leu Val Leu Val Cys Leu Leu Arg Val Cys Cys 465 470 475 480 Lys Arg Val Arg Arg Arg Gly Ser Arg Arg Thr Thr Gln Glu Ile Pro 485 490 495 Leu Asn Val Ser Ser Val Pro Val Pro Arg Ala Thr Val Val Ser Ser 500 505 510 Trp Glu Ser Tyr Lys Gly Leu Pro Gly Thr 515 520 491578DNAWest Caucasian bat virusCDS(1)..(1578) 49atg gct tcc tac ttt gcg ttg gtc ttg aac ggg atc tct atg gtt ttc 48Met Ala Ser Tyr Phe Ala Leu Val Leu Asn Gly Ile Ser Met Val Phe 1 5 10 15 agt caa ggt ctt ttc ccc ctt tac act atc cct gac cat ctg gga cca 96Ser Gln Gly Leu Phe Pro Leu Tyr Thr Ile Pro Asp His Leu Gly Pro 20 25 30 tgg acc ccc ata gat cta agt cac ctt cac tgc ccg aac aat ctt tat 144Trp Thr Pro Ile Asp Leu Ser His Leu His Cys Pro Asn Asn Leu Tyr 35 40 45 act gat gcc tct tat tgt aca act gaa caa agc ata acc tac aca gag 192Thr Asp Ala Ser Tyr Cys Thr Thr Glu Gln Ser Ile Thr Tyr Thr Glu 50 55 60 ttg aag gtc gga tca tct gtg tca caa aaa atc ccc gga ttt aca tgt 240Leu Lys Val Gly Ser Ser Val Ser Gln Lys Ile Pro Gly Phe Thr Cys 65 70 75 80 acg ggg gta aga act gaa tct gta aca tat acc aac ttt gtt ggc tat 288Thr Gly Val Arg Thr Glu Ser Val Thr Tyr Thr Asn Phe Val Gly Tyr 85 90 95 gtg act acc acg ttc aag aaa aaa cac ttt cct cct aaa tcc agg gac 336Val Thr Thr Thr Phe Lys Lys Lys His Phe Pro Pro Lys Ser Arg Asp 100 105 110 tgt aga gag gcg tat gag agg aag aaa gca gga gat cct aga tat gaa 384Cys Arg Glu Ala Tyr Glu Arg Lys Lys Ala Gly Asp Pro Arg Tyr Glu 115 120 125 gag tct tta gcc cac cca tat cct gac aac agt tgg ctg aga aca gtg 432Glu Ser Leu Ala His Pro Tyr Pro Asp Asn Ser Trp Leu Arg Thr Val 130 135 140 act aca aca aag gat tcc tgg gtg atc atc gag ccc agt gta gtg gag 480Thr Thr Thr Lys Asp Ser Trp Val Ile Ile Glu Pro Ser Val Val Glu 145 150 155 160 tta gat ata tac aca agt gcc ttg tat tca cct ctt ttc aag gat gga 528Leu Asp Ile Tyr Thr Ser Ala Leu Tyr Ser Pro Leu Phe Lys Asp Gly 165 170 175 aca tgt tca aaa tct aga aca tat tcc ccc tac tgt cca acc aat cat 576Thr Cys Ser Lys Ser Arg Thr Tyr Ser Pro Tyr Cys Pro Thr Asn His 180 185 190 gac ttc acc att tgg atg cca gag agt gaa aac ata aga tct gcc tgt 624Asp Phe Thr Ile Trp Met Pro Glu Ser Glu Asn Ile Arg Ser Ala Cys 195 200 205 aat ctg ttt tcc aca agt aga ggg aaa cta gtc agg aac cgc aca tcc 672Asn Leu Phe Ser Thr Ser Arg Gly Lys Leu Val Arg Asn Arg Thr Ser 210 215 220 acc tgc ggg att atc gat gag aga ggg ctg ttc aga tca gtt aaa gga 720Thr Cys Gly Ile Ile Asp Glu Arg Gly Leu Phe Arg Ser Val Lys Gly 225 230 235 240 gca tgc aaa ata tca ata tgc ggt agg cag gga atc cgt tta gtg gat 768Ala Cys Lys Ile Ser Ile Cys Gly Arg Gln Gly Ile Arg Leu Val Asp 245 250 255 gga act tgg atg tct ttt aga tac tca gag tac tta cct gtg tgt tct 816Gly Thr Trp Met Ser Phe Arg Tyr Ser Glu Tyr Leu Pro Val Cys Ser 260 265 270 cca tca cag ctg atc aac acg cac gac atc aag gtc gat gag ctg gag 864Pro Ser Gln Leu Ile Asn Thr His Asp Ile Lys Val Asp Glu Leu Glu 275 280 285 aat gct ata gtt tta gac ttg att agg agg aga gaa gaa tgt ctt gac 912Asn Ala Ile Val Leu Asp Leu Ile Arg Arg Arg Glu Glu Cys Leu Asp 290 295 300 acc cta gaa aca att ttg atg tca gga tct gtg agt cac agg agg ctg 960Thr Leu Glu Thr Ile Leu Met Ser Gly Ser Val Ser His Arg Arg Leu 305 310 315 320 agt cat ttc aga aag ctg gtt cca gga tct ggg aag gct tac tct tat 1008Ser His Phe Arg Lys Leu Val Pro Gly Ser Gly Lys Ala Tyr Ser Tyr 325 330 335 ata aac ggc acc tta atg gaa tca gat gct cac tac atc aag gta gag 1056Ile Asn Gly Thr Leu Met Glu Ser Asp Ala His Tyr Ile Lys Val Glu 340 345 350 aat tgg tca gag gtc atc cca cac aaa gga tgt ctc atg gtc ggg ggc 1104Asn Trp Ser Glu Val Ile Pro His Lys Gly Cys Leu Met Val Gly Gly 355 360 365 aaa tgc tat gag cca gtc aat gat gtg tat ttc aac ggg atc att cgg 1152Lys Cys Tyr Glu Pro Val Asn Asp Val Tyr Phe Asn Gly Ile Ile Arg 370 375 380 gat tca aat aat cag atc ttg ata cct gag atg cag tcc agt ctt ctc 1200Asp Ser Asn Asn Gln Ile Leu Ile Pro Glu Met Gln Ser Ser Leu Leu 385 390 395 400 aga gaa cat gtt gac ctg ttg aag gct aat ata gtt ccg ttc agg cat 1248Arg Glu His Val Asp Leu Leu Lys Ala Asn Ile Val Pro Phe Arg His 405 410 415 cca atg tta ctt agg tcc ttc aca tct gac act gaa gaa gat atc gtc 1296Pro Met Leu Leu Arg Ser Phe Thr Ser Asp Thr Glu Glu Asp Ile Val 420 425 430 gag ttt gtc aac cct cat ctc caa gat acc cag aag ttg gtg tca gat 1344Glu Phe Val Asn Pro His Leu Gln Asp Thr Gln Lys Leu Val Ser Asp 435 440 445

atg gat ctc ggg tta tca gac tgg aag aga tat cta cta att gga tct 1392Met Asp Leu Gly Leu Ser Asp Trp Lys Arg Tyr Leu Leu Ile Gly Ser 450 455 460 ttg gcc gta gga gga gtg gta gca atc tta ttc atc gga aca tgt tgt 1440Leu Ala Val Gly Gly Val Val Ala Ile Leu Phe Ile Gly Thr Cys Cys 465 470 475 480 ctg aga tgt aga gca ggg aga aac aga aga aca atc cga tcc aat cat 1488Leu Arg Cys Arg Ala Gly Arg Asn Arg Arg Thr Ile Arg Ser Asn His 485 490 495 agg tca ttg tcc cat gac gtg gtg ttc cat aaa gat aag gat aaa gtg 1536Arg Ser Leu Ser His Asp Val Val Phe His Lys Asp Lys Asp Lys Val 500 505 510 att act tct tgg gaa tct tac aag gga caa act gcc caa taa 1578Ile Thr Ser Trp Glu Ser Tyr Lys Gly Gln Thr Ala Gln 515 520 525 50525PRTWest Caucasian bat virus 50Met Ala Ser Tyr Phe Ala Leu Val Leu Asn Gly Ile Ser Met Val Phe 1 5 10 15 Ser Gln Gly Leu Phe Pro Leu Tyr Thr Ile Pro Asp His Leu Gly Pro 20 25 30 Trp Thr Pro Ile Asp Leu Ser His Leu His Cys Pro Asn Asn Leu Tyr 35 40 45 Thr Asp Ala Ser Tyr Cys Thr Thr Glu Gln Ser Ile Thr Tyr Thr Glu 50 55 60 Leu Lys Val Gly Ser Ser Val Ser Gln Lys Ile Pro Gly Phe Thr Cys 65 70 75 80 Thr Gly Val Arg Thr Glu Ser Val Thr Tyr Thr Asn Phe Val Gly Tyr 85 90 95 Val Thr Thr Thr Phe Lys Lys Lys His Phe Pro Pro Lys Ser Arg Asp 100 105 110 Cys Arg Glu Ala Tyr Glu Arg Lys Lys Ala Gly Asp Pro Arg Tyr Glu 115 120 125 Glu Ser Leu Ala His Pro Tyr Pro Asp Asn Ser Trp Leu Arg Thr Val 130 135 140 Thr Thr Thr Lys Asp Ser Trp Val Ile Ile Glu Pro Ser Val Val Glu 145 150 155 160 Leu Asp Ile Tyr Thr Ser Ala Leu Tyr Ser Pro Leu Phe Lys Asp Gly 165 170 175 Thr Cys Ser Lys Ser Arg Thr Tyr Ser Pro Tyr Cys Pro Thr Asn His 180 185 190 Asp Phe Thr Ile Trp Met Pro Glu Ser Glu Asn Ile Arg Ser Ala Cys 195 200 205 Asn Leu Phe Ser Thr Ser Arg Gly Lys Leu Val Arg Asn Arg Thr Ser 210 215 220 Thr Cys Gly Ile Ile Asp Glu Arg Gly Leu Phe Arg Ser Val Lys Gly 225 230 235 240 Ala Cys Lys Ile Ser Ile Cys Gly Arg Gln Gly Ile Arg Leu Val Asp 245 250 255 Gly Thr Trp Met Ser Phe Arg Tyr Ser Glu Tyr Leu Pro Val Cys Ser 260 265 270 Pro Ser Gln Leu Ile Asn Thr His Asp Ile Lys Val Asp Glu Leu Glu 275 280 285 Asn Ala Ile Val Leu Asp Leu Ile Arg Arg Arg Glu Glu Cys Leu Asp 290 295 300 Thr Leu Glu Thr Ile Leu Met Ser Gly Ser Val Ser His Arg Arg Leu 305 310 315 320 Ser His Phe Arg Lys Leu Val Pro Gly Ser Gly Lys Ala Tyr Ser Tyr 325 330 335 Ile Asn Gly Thr Leu Met Glu Ser Asp Ala His Tyr Ile Lys Val Glu 340 345 350 Asn Trp Ser Glu Val Ile Pro His Lys Gly Cys Leu Met Val Gly Gly 355 360 365 Lys Cys Tyr Glu Pro Val Asn Asp Val Tyr Phe Asn Gly Ile Ile Arg 370 375 380 Asp Ser Asn Asn Gln Ile Leu Ile Pro Glu Met Gln Ser Ser Leu Leu 385 390 395 400 Arg Glu His Val Asp Leu Leu Lys Ala Asn Ile Val Pro Phe Arg His 405 410 415 Pro Met Leu Leu Arg Ser Phe Thr Ser Asp Thr Glu Glu Asp Ile Val 420 425 430 Glu Phe Val Asn Pro His Leu Gln Asp Thr Gln Lys Leu Val Ser Asp 435 440 445 Met Asp Leu Gly Leu Ser Asp Trp Lys Arg Tyr Leu Leu Ile Gly Ser 450 455 460 Leu Ala Val Gly Gly Val Val Ala Ile Leu Phe Ile Gly Thr Cys Cys 465 470 475 480 Leu Arg Cys Arg Ala Gly Arg Asn Arg Arg Thr Ile Arg Ser Asn His 485 490 495 Arg Ser Leu Ser His Asp Val Val Phe His Lys Asp Lys Asp Lys Val 500 505 510 Ile Thr Ser Trp Glu Ser Tyr Lys Gly Gln Thr Ala Gln 515 520 525 5139DNAArtificial SequenceSynthetic oligonucleotide 51cgactgcaga tgagtcaact aaatttgata ccctttttc 395242DNAArtificial SequenceSynthetic oligonucleotide 52ccgtacgtat cagacattag aggtaccctt ataagattcc ca 42531569DNALagos vat virusCDS(1)..(1569) 53atg agt caa cta aat ttg ata ccc ttt ttc tgt gta att ata gtc ttg 48Met Ser Gln Leu Asn Leu Ile Pro Phe Phe Cys Val Ile Ile Val Leu 1 5 10 15 tct gta gag gac ttt cct cta tat aca att cct gaa aag ata ggt cct 96Ser Val Glu Asp Phe Pro Leu Tyr Thr Ile Pro Glu Lys Ile Gly Pro 20 25 30 tgg act ccg atc gac ctg atc cat ctg agc tgt cct aat aat ttg cag 144Trp Thr Pro Ile Asp Leu Ile His Leu Ser Cys Pro Asn Asn Leu Gln 35 40 45 tca gag gat gaa gga tgt ggt acc tca tca gtc ttc agt tat gta gag 192Ser Glu Asp Glu Gly Cys Gly Thr Ser Ser Val Phe Ser Tyr Val Glu 50 55 60 ctc aag aca ggt tat ctc act cat cag aaa gtg tct ggg ttc acc tgt 240Leu Lys Thr Gly Tyr Leu Thr His Gln Lys Val Ser Gly Phe Thr Cys 65 70 75 80 aca gga gtg gtt aat gag gct gtc aca tac act aac ttt gtc gga tat 288Thr Gly Val Val Asn Glu Ala Val Thr Tyr Thr Asn Phe Val Gly Tyr 85 90 95 gtg aca acc acc ttt aag cgg aaa cat ttc aag ccg acg gca ttg gct 336Val Thr Thr Thr Phe Lys Arg Lys His Phe Lys Pro Thr Ala Leu Ala 100 105 110 tgc aga gat gct tat cat tgg aag att tct ggg gat cca agg tat gag 384Cys Arg Asp Ala Tyr His Trp Lys Ile Ser Gly Asp Pro Arg Tyr Glu 115 120 125 gag tct ctc cac aca cca tat cct gac aac agc tgg ttg agg aca gtt 432Glu Ser Leu His Thr Pro Tyr Pro Asp Asn Ser Trp Leu Arg Thr Val 130 135 140 acc aca acc aaa gaa tct ctt gtg ata atc tct cca agc att gtg gag 480Thr Thr Thr Lys Glu Ser Leu Val Ile Ile Ser Pro Ser Ile Val Glu 145 150 155 160 atg gat gta tat agt aga aca ctt cat tct ccc atg ttt ccc acc ggg 528Met Asp Val Tyr Ser Arg Thr Leu His Ser Pro Met Phe Pro Thr Gly 165 170 175 acc tgt tct agg ttc tat ccg tca tcc cct tct tgt gcc aca aat cat 576Thr Cys Ser Arg Phe Tyr Pro Ser Ser Pro Ser Cys Ala Thr Asn His 180 185 190 gat tac act tta tgg ctt cca gat gac cct aat ctg agt ttg gca tgt 624Asp Tyr Thr Leu Trp Leu Pro Asp Asp Pro Asn Leu Ser Leu Ala Cys 195 200 205 gat atc ttt gtg acc agc aca ggg aaa aag tca atg aat ggc tct aga 672Asp Ile Phe Val Thr Ser Thr Gly Lys Lys Ser Met Asn Gly Ser Arg 210 215 220 atg tgt gga ttt aca gac gag aga ggg tat tac cgg aca ata aaa gga 720Met Cys Gly Phe Thr Asp Glu Arg Gly Tyr Tyr Arg Thr Ile Lys Gly 225 230 235 240 gct tgt aaa ctg aca tta tgt ggg aaa cca ggt ttg agg tta ttt gat 768Ala Cys Lys Leu Thr Leu Cys Gly Lys Pro Gly Leu Arg Leu Phe Asp 245 250 255 ggc aca tgg ata tcc ttc ccc cgc ccg gaa gtc act acc cgg tgc ctt 816Gly Thr Trp Ile Ser Phe Pro Arg Pro Glu Val Thr Thr Arg Cys Leu 260 265 270 cct aat cag tta gtc aat att cac aac aat agg ata gat gaa gtt gag 864Pro Asn Gln Leu Val Asn Ile His Asn Asn Arg Ile Asp Glu Val Glu 275 280 285 cat ctg att gta gaa gat ctc att cga aaa aga gaa gag tgt ttg gac 912His Leu Ile Val Glu Asp Leu Ile Arg Lys Arg Glu Glu Cys Leu Asp 290 295 300 act tta gag aca gtt tta atg tcc aaa tca atc agt ttt aga cga cta 960Thr Leu Glu Thr Val Leu Met Ser Lys Ser Ile Ser Phe Arg Arg Leu 305 310 315 320 agt cac ttc aga aaa tta gtg cca gga tat ggg aag gct tac act att 1008Ser His Phe Arg Lys Leu Val Pro Gly Tyr Gly Lys Ala Tyr Thr Ile 325 330 335 tta aat ggg agc tta atg gaa act aac gtt cat tat tta aag gtt gac 1056Leu Asn Gly Ser Leu Met Glu Thr Asn Val His Tyr Leu Lys Val Asp 340 345 350 aat tgg agt gaa ata ctg cct tcc aag gga tgt tta aaa ata aac aat 1104Asn Trp Ser Glu Ile Leu Pro Ser Lys Gly Cys Leu Lys Ile Asn Asn 355 360 365 cag tgt gtt gct cat tat aag ggg gtc ttc ttt aac ggg atc atc aag 1152Gln Cys Val Ala His Tyr Lys Gly Val Phe Phe Asn Gly Ile Ile Lys 370 375 380 gga cca gat ggt cat att tta atc ccc gag atg cag tca agt ttg ttg 1200Gly Pro Asp Gly His Ile Leu Ile Pro Glu Met Gln Ser Ser Leu Leu 385 390 395 400 aaa cag cac atg gac ctc ttg aag gca gcg gtt ttt ccc ttg aaa cat 1248Lys Gln His Met Asp Leu Leu Lys Ala Ala Val Phe Pro Leu Lys His 405 410 415 cct ctg att gaa ccg ggc tct ttg ttc aat aag gat ggt gat gcc gat 1296Pro Leu Ile Glu Pro Gly Ser Leu Phe Asn Lys Asp Gly Asp Ala Asp 420 425 430 gaa ttt gtt gat gtc cac atg cct gat gta cat aag ttg gta tca gat 1344Glu Phe Val Asp Val His Met Pro Asp Val His Lys Leu Val Ser Asp 435 440 445 gtc gac ttg ggg cta ccc gat tgg agc ctt tat gcg ttg ata ggg gca 1392Val Asp Leu Gly Leu Pro Asp Trp Ser Leu Tyr Ala Leu Ile Gly Ala 450 455 460 act att ata gct ttc ttt ata ctg ata tgt ctt att cgt atc tgc tgc 1440Thr Ile Ile Ala Phe Phe Ile Leu Ile Cys Leu Ile Arg Ile Cys Cys 465 470 475 480 aag aag ggg ggt cgg aga aac tct ccc aca aat aga cct gat ctt cct 1488Lys Lys Gly Gly Arg Arg Asn Ser Pro Thr Asn Arg Pro Asp Leu Pro 485 490 495 ata ggg ttg tct act aca cct caa ccc aag tct aaa gtg ata tca tca 1536Ile Gly Leu Ser Thr Thr Pro Gln Pro Lys Ser Lys Val Ile Ser Ser 500 505 510 tgg gaa tct tat aag ggt acc tct aat gtc tga 1569Trp Glu Ser Tyr Lys Gly Thr Ser Asn Val 515 520 54522PRTLagos vat virus 54Met Ser Gln Leu Asn Leu Ile Pro Phe Phe Cys Val Ile Ile Val Leu 1 5 10 15 Ser Val Glu Asp Phe Pro Leu Tyr Thr Ile Pro Glu Lys Ile Gly Pro 20 25 30 Trp Thr Pro Ile Asp Leu Ile His Leu Ser Cys Pro Asn Asn Leu Gln 35 40 45 Ser Glu Asp Glu Gly Cys Gly Thr Ser Ser Val Phe Ser Tyr Val Glu 50 55 60 Leu Lys Thr Gly Tyr Leu Thr His Gln Lys Val Ser Gly Phe Thr Cys 65 70 75 80 Thr Gly Val Val Asn Glu Ala Val Thr Tyr Thr Asn Phe Val Gly Tyr 85 90 95 Val Thr Thr Thr Phe Lys Arg Lys His Phe Lys Pro Thr Ala Leu Ala 100 105 110 Cys Arg Asp Ala Tyr His Trp Lys Ile Ser Gly Asp Pro Arg Tyr Glu 115 120 125 Glu Ser Leu His Thr Pro Tyr Pro Asp Asn Ser Trp Leu Arg Thr Val 130 135 140 Thr Thr Thr Lys Glu Ser Leu Val Ile Ile Ser Pro Ser Ile Val Glu 145 150 155 160 Met Asp Val Tyr Ser Arg Thr Leu His Ser Pro Met Phe Pro Thr Gly 165 170 175 Thr Cys Ser Arg Phe Tyr Pro Ser Ser Pro Ser Cys Ala Thr Asn His 180 185 190 Asp Tyr Thr Leu Trp Leu Pro Asp Asp Pro Asn Leu Ser Leu Ala Cys 195 200 205 Asp Ile Phe Val Thr Ser Thr Gly Lys Lys Ser Met Asn Gly Ser Arg 210 215 220 Met Cys Gly Phe Thr Asp Glu Arg Gly Tyr Tyr Arg Thr Ile Lys Gly 225 230 235 240 Ala Cys Lys Leu Thr Leu Cys Gly Lys Pro Gly Leu Arg Leu Phe Asp 245 250 255 Gly Thr Trp Ile Ser Phe Pro Arg Pro Glu Val Thr Thr Arg Cys Leu 260 265 270 Pro Asn Gln Leu Val Asn Ile His Asn Asn Arg Ile Asp Glu Val Glu 275 280 285 His Leu Ile Val Glu Asp Leu Ile Arg Lys Arg Glu Glu Cys Leu Asp 290 295 300 Thr Leu Glu Thr Val Leu Met Ser Lys Ser Ile Ser Phe Arg Arg Leu 305 310 315 320 Ser His Phe Arg Lys Leu Val Pro Gly Tyr Gly Lys Ala Tyr Thr Ile 325 330 335 Leu Asn Gly Ser Leu Met Glu Thr Asn Val His Tyr Leu Lys Val Asp 340 345 350 Asn Trp Ser Glu Ile Leu Pro Ser Lys Gly Cys Leu Lys Ile Asn Asn 355 360 365 Gln Cys Val Ala His Tyr Lys Gly Val Phe Phe Asn Gly Ile Ile Lys 370 375 380 Gly Pro Asp Gly His Ile Leu Ile Pro Glu Met Gln Ser Ser Leu Leu 385 390 395 400 Lys Gln His Met Asp Leu Leu Lys Ala Ala Val Phe Pro Leu Lys His 405 410 415 Pro Leu Ile Glu Pro Gly Ser Leu Phe Asn Lys Asp Gly Asp Ala Asp 420 425 430 Glu Phe Val Asp Val His Met Pro Asp Val His Lys Leu Val Ser Asp 435 440 445 Val Asp Leu Gly Leu Pro Asp Trp Ser Leu Tyr Ala Leu Ile Gly Ala 450 455 460 Thr Ile Ile Ala Phe Phe Ile Leu Ile Cys Leu Ile Arg Ile Cys Cys 465 470 475 480 Lys Lys Gly Gly Arg Arg Asn Ser Pro Thr Asn Arg Pro Asp Leu Pro 485 490 495 Ile Gly Leu Ser Thr Thr Pro Gln Pro Lys Ser Lys Val Ile Ser Ser 500 505 510 Trp Glu Ser Tyr Lys Gly Thr Ser Asn Val 515 520

Claims

1. A recombinant rabies virus, the genome of which comprises rabies virus nucleoprotein (N), phosphoprotein (P), matrix protein (M), RNA-dependent RNA polymerase (L) and glycoprotein (G) genes and at least two different heterologous lyssavirus G genes, wherein the lyssavirus is selected from the group consisting of Lagos bat virus (LBV), Mokola virus (MOKV), Duvenhage virus (DUVV), European bat lyssavirus-1 (EBLV-1), European bat lyssavirus-2 (EBLV-2), Australian bat lyssavirus (ABLV), Aravan virus (ARAV), Khujand virus (KHUV), Irkut virus (IRKV) and West Caucasian bat virus (WCBV).

2. The recombinant rabies virus of claim 1, comprising two different heterologous lyssavirus G genes and the two heterologous G genes are MOKV and WCBV G genes.

3. The recombinant rabies virus of claim 2, wherein the nucleotide sequence of the MOKV G gene is at least 95% identical to the nucleotide sequence of SEQ ID NO: 47, the nucleotide sequence of the WCBV G gene is at least 95% identical to the nucleotide sequence of SEQ ID NO: 49, or both.

4. The recombinant rabies virus of claim 2, wherein the MOKV G gene comprises the nucleotide sequence of SEQ ID NO: 47, the WCBV G gene comprises the nucleotide sequence of SEQ ID NO: 49, or both.

5. The recombinant rabies virus of claim 2, wherein the two heterologous G genes are located between the rabies virus P and M genes and between the rabies virus G and L genes.

6. The recombinant rabies virus of claim 1, wherein the genome is derived from the rabies virus ERA strain.

7. The recombinant rabies virus of claim 1, wherein the rabies virus glycoprotein comprises a Glu at amino acid position 333 (SEQ ID NO: 5).

8. A vector comprising a full-length rabies virus antigenomic DNA, wherein the antigenomic DNA comprises rabies virus N, P, M, L and G genes, and at least two different heterologous lyssavirus G genes, wherein the lyssavirus is selected from LBV, MOKV, DUVV, EBLV-1, EBLV-2, ABLV, ARAV, KHUV, IRKV and WCBV.

9. The vector of claim 8, comprising two different heterologous lyssavirus G genes and the two heterologous G genes are MOKV and WCBV G genes.

10. The vector of claim 9, wherein the nucleotide sequence of the MOKV G gene is at least 95% identical to the nucleotide sequence of SEQ ID NO: 47, the nucleotide sequence of the WCBV G gene is at least 95% identical to the nucleotide sequence of SEQ ID NO: 49, or both.

11. The vector of claim 9, wherein the MOKV G gene comprises the nucleotide sequence of SEQ ID NO: 47, the WCBV G gene comprises the nucleotide sequence of SEQ ID NO: 49, or both.

12. The vector of claim 9, wherein the two heterologous G genes are located between the rabies virus P and M genes and between the rabies virus G and L genes.

13. The vector of claim 8, wherein the antigenomic DNA is derived from the rabies virus ERA strain.

14. A cell comprising the vector of claim 8.

15. A composition comprising the recombinant rabies virus of claim 1 and a pharmaceutically acceptable carrier.

16. A method of eliciting an immune response in a subject against lyssavirus, comprising administering to the subject the recombinant rabies virus of claim 1.

17. The method of claim 16, wherein the immune response in the subject against lyssavirus protects the subject against infection by at least three different genotypes of lyssavirus.