U.S. patent application number 14/862731 was filed with the patent office on 2016-04-07 for production of vectors for non-dividing host cells.
This patent application is currently assigned to FinVector Vision Therapies Ltd.. The applicant listed for this patent is FinVector Vision Therapies Ltd.. Invention is credited to Kari J. Airenne, Hanna P. LESCH, Seppo Yla-Herttuala.
Application Number | 20160097060 14/862731 |
Document ID | / |
Family ID | 37899177 |
Filed Date | 2016-04-07 |
United States Patent
Application |
20160097060 |
Kind Code |
A1 |
LESCH; Hanna P. ; et
al. |
April 7, 2016 |
Production of Vectors for Non-Dividing Host Cells
Abstract
A high-volume gene therapy vector manufacturing process,
entailing using a recombinant baculovirus to transform a producer
cell, which producer cell in turn produces a recombinant gene
therapy vector which is able to transform host cells even when they
are not dividing.
Inventors: |
LESCH; Hanna P.; (Kuopio,
FI) ; Airenne; Kari J.; (Kuopio, FI) ;
Yla-Herttuala; Seppo; (Kuopio, FI) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
FinVector Vision Therapies Ltd. |
Kuopio |
|
FI |
|
|
Assignee: |
FinVector Vision Therapies
Ltd.
Kuopio
FI
|
Family ID: |
37899177 |
Appl. No.: |
14/862731 |
Filed: |
September 23, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12522646 |
Jul 9, 2009 |
|
|
|
PCT/GB2008/000464 |
Feb 11, 2008 |
|
|
|
14862731 |
|
|
|
|
Current U.S.
Class: |
514/44R ;
435/235.1; 435/239; 435/320.1 |
Current CPC
Class: |
C12N 2740/16045
20130101; C12N 2740/16051 20130101; C12N 2710/14043 20130101; C12N
7/00 20130101; C12N 15/86 20130101; C12N 2740/15043 20130101; A61K
48/00 20130101; C12N 2740/15051 20130101; C12N 2740/16043 20130101;
C12N 2710/14021 20130101; C12N 2710/14051 20130101; C12N 2740/16022
20130101; A61K 48/0091 20130101; C07K 14/005 20130101; C12N
2810/6081 20130101 |
International
Class: |
C12N 15/86 20060101
C12N015/86 |
Claims
1. A method comprising: a. Transducing a mammalian cell with a
baculovirus to make a transduced mammalian producer cell; and then
b. Culturing said transduced mammalian producer cell in culture
media, and harvesting from said transduced mammalian producer cell
and/or culture media a second virus having a therapeutic
transgene.
2. The method of claim 1, wherein said harvesting comprises
harvesting at about 144 hours after said transduction.
3. The method of claim 1, wherein said second virus is derived from
a virus which in its wild state has a single-stranded genome.
4. The method of claim 1, wherein said second virus is able to
transduce a human cell which is not actively dividing.
5. The method of claim 1, wherein said second virus is replication
deficient.
6. The method of claim 1, wherein said second virus can integrate
in host genome at specific site and can produce stable long-term
expression.
7. The method of claim 1, wherein said second virus is
non-immunogenic.
8. A recombinant baculovirus having at least one nucleic acid
sequence coding for a second virus derived from a virus which in
its wild state has a single stranded genome, said second virus
being replication-deficient and having a therapeutic transgene.
9. The recombinant baculovirus of claim 8, wherein said second
virus is able to transduce a human cell which is not actively
dividing.
10. The recombinant baculovirus of claim 8, wherein said second
virus can integrate in the human genome and can produce stable
long-term expression in a transduced human cell.
11. A method comprising: a. Obtaining the recombinant baculovirus
of claim 8; and then b. Transducing a mammalian producer cell with
said recombinant baculovirus to make a transduced mammalian
producer cell; and then c. Culturing said transduced mammalian
producer cell in culture media, and harvesting said second virus
from said transduced mammalian producer cell and/or culture
media.
12. A viral vector able to transfect a human cell which is not
actively dividing, said viral vector produced by a mammalian
producer cell transduced with a recombinant baculovirus.
13. The viral vector of claim 12, wherein said viral vector has a
therapeutic transgene.
14. The viral vector of claim 12, said viral vector comprises virus
derived from a virus which in its wild state has a single stranded
genome.
15. A method comprising: a. Obtaining the viral vector of claim 12;
and b. Transducing a human patient's cells with said viral
vector.
16. A method comprising: a. Obtaining the viral vector of claim 13;
and b. Transducing a human patient's cells with said viral
vector.
17. A method comprising: a. Obtaining the viral vector of claim 14;
and b. Transducing a human patient's cells with said viral vector.
Description
FIELD OF THE INVENTION
[0001] The invention relates to methods for the production of
lentiviral vectors.
BACKGROUND OF THE INVENTION
[0002] Lentiviruses, such as Human Immunodeficiency Virus I, are
promising tools for gene therapy due to their ability to transduce
and integrate into genome of both dividing and non-dividing cells.
Lentiviral vectors can be pseudotyped by various viral surface
proteins such the envelope glycoprotein G of the vesicular
stomatitis virus (VSV-G). Pseudotyping broadens the transduction
range of lentiviruses and long-term transgene expression has been
obtained in many different cells and tissues (Delenda, 2004).
Pseudotyping also strengthens fragile lentiviruses and enables
concentration to high titers by ultrasentrifugation (Burns et al.,
1993).
[0003] The third generation lentiviral vector particles are
commonly prepared by transient plasmid transfection in the 293T
human embryonic kidney (HEK 293T) cells. Transfection is made by
cotransfecting i) packaging plasmid containing gag-pol, ii) the
self-inactivating transfer vector plasmid iii) envelope
glycoprotein expressing plasmid and iv) rev expressing plasmid
(Follenzi and Naldini, 2002). In vivo experiments in preclinical
large animal models and human clinical trials require large amounts
of viral particles. Currently there is no optimal large scale
packaging system available for lentiviruses. Stable large scale
vector production systems have been developed but the toxicity of
the lentiviral enzymes and the fusogenic VSV-G prohibit
constitutive expression and only possibilities at the moment is to
use inducible cell lines (Pacchia et al., 2001; Farson et al.,
2001) or replace the most toxic VSV-G with other less-toxic
glycoprotein (Kumar et al., 2003). Stable cell lines suffer from
the gene silencing that occurs during the long culture periods
needed for sequential addition of packaging constructs. On the
contrary, transient plasmid-based production systems are very
laborious and inefficient, and suffer from batch-to-batch
variation. None of these systems have proven to be ideal for the
large scale production of lentiviruses and, therefore, there is
clear need for efficient new methods.
SUMMARY OF THE INVENTION
[0004] In this study we have constructed four recombinant
baculoviruses BAC-transfer, BAC-gag-pol, BAC-VSVg and BAC-rev,
derived from Autographa californica multicapsid
nucleopolyhedrovirus (AcMNPV) expressing all elements needed for
the lentivirus vector generation in mammalian cells. By
transducting 293T cells with these baculoviruses we were able to
produce functional lentivirus. Preferably, all the elements needed
for the production of functional lentiviruses are cloned into three
baculoviruses. More preferably, they are cloned into two
baculoviruses, and most preferably, they are cloned into one
baculovirus. This may be achieved by combining the features of
BAC-transfer, BAC-gag-pol, BAS-VSVg and BAG-rev into three or fewer
baculoviruses.
[0005] Baculovirus-produced lentiviruses transduced mammalian cells
as efficient as conventionally produced lentiviruses. Different
baculovirus concentrations were used to find optimal baculovirus
concentration for lentivirus production. The un-concentrated
lentiviral titers in cell culture mediums were on avarege
1.21.times.10.sup.8 TU/ml which are comparable to titers of the
lentivirus produced by conventional four plasmid method. Lentivirus
transduced Hela cells were grown three months without loosing the
GFP expression. Our results show for the first time that
baculoviruses can be used for the production of lentiviruses in
mammalian cells. Baculovirus technology offers an attractive
possibility to scalable virus production as a result of ease
production and concentration of baculovirses, efficient
transduction of suspension mammalian cells in serum free conditions
and safety of the baculoviruses. The lentiviral vector may also be
produced with the baculovirus capsid-displaying viral protein rev,
tat, net, vit or vpu, by fusing the viral protein to a baculovirus
protein. The baculovirus protein may be the capsid protein, vp39.
Further, the lentivirus may be produced using a transgene or
transgene cassette.
[0006] The resulting lentiviruses may be pseutotyped with
heterologous proteins or other ligands, such VSV-g, gp64, avidin,
streptavidin or biotin.
DESCRIPTION OF THE DRAWINGS
[0007] The following drawings illustrate embodiments of the
invention.
[0008] FIG. 1 shows cloned baculovirus donor plasmids,
BAC-transfer, BAC-gag-pol, BAC-VSVg and BAC-rev.
[0009] FIG. 2 is a schematic picture about baculovirus-mediated
lentivirus production.
[0010] FIG. 3 shows the effect of baculovirus (MOI) on the titers
of the produced lentiviral particles. Titers were determined by
measuring the number of transduced GFP positive cells after
different dilutions of the virus using FACS (A).
DESCRIPTION OF THE PREFERRED EMBODIMENTS
Materials and Methods
[0011] Constructs needed for the HIV-1 based lentivirus vector
production were subcloned to baculovirus donor vectors pFastBac1
(Invitrogen, Carlsbad, Calif., USA) driven by the human
cytomegalovirus (CMV) promoter. Lentivirus transfer construct was a
third-generation self-inactivating vector expressing GFP marker
gene driven by the phosphoglycerate kinase (PGK) promoter. Transfer
construct was isolated from plasmid LV1-GFP in two parts and
subcloned into pBAC-transfer donor vector polylinker. This
PmlI/NheI/PstI/SalI/AfllI/PacI/SpeI/MluI/PmeI/EcoRI/ApaI/SwaI/AscI-polyli-
nker was earlier cloned to the AvrlI site of pFastBac1. The
sequence of the polylinker was
5'CACGTGGCTAGCCTGCAGGTCGACCTTAAGTTAATTAAACTAGTACGCGTGTTTA
AACGAATTCGGGCCCATTTAAATGGCGCGCC-3'. The donor vector had also red
marker gene DsRed cloned under polyhedrin promoter for easy
baculovirus tittering (Mahonen et al. unpublished data). First part
of the transfer construct was digested by BsrBI and AscI and
subcloned to the SwaI/AscI site of the donor vector polylinker.
Second part of the insert was digested by AscI and AvrlI and cloned
to the AscI and Avr lI site of the modified plasmid.
[0012] Packaging construct cassette expressing gag and pot driven
by CMV was cut from plasmid pMDLg/pRRE by ApaLI digestion and
subcloned into the SmlI site of the pBAC-gag-pot donor vector
polylinker. ApaLI ends were blunted by T4 DNA Polymerase
(Finnzymes, Helsinki, Finland) before ligation.
[0013] VSV-G expressed envelope construct from plasmid pCMV-G was
subcloned in two parts to the pBAC-VSV-g donor vector. First part
was digested by NotI and EcoRI. NotI end was blunted before EcoRI
digestion by T4 DNA Polymerase. This part was subcloned to
Smll/EcoRI site of the polylinker. Second part of the construct was
digested from pCMV-G by EcoRI and subcloned to the polylinker EcoRI
site.
[0014] HIV-1 rev protein is essential in production of
lentiviruses. Rev cDNA was synthesized by polymerase chain reaction
(PCR) from vector pRSV-REV and subcloned to pBAC-rev donor vector
under CMV promoter. CMV promoter was earlier digested with NruI and
EcoRI from vector pcDNA3 and subcloned to SwaI/EcoRI site of the
polylinker. The Rev cDNA is totally 349 bp. The forward primer was
5'CGAAGGAATTCGTCGCCACCATGGCAGGAAGAAGCGGA-3' (sequence tor
nucleotides 1-18 of rev gene in bold, Kozak consensus sequence in
italic, EcoRI site underlined) and the reverse primer was
5'AGCTAGCTAGCGTATTCTCCTGACTCCAATATTGT-3' (sequence 349-325 for
nucleotides of rev gene, NheI site underlined). The amplified
fragment was then digested with EcoRI and NheI, purified using a
Wizard Cleanup kit (Promega, Madison, Wis. USA) and subcloned to
EcoRI/NheI site of the polylinker.
[0015] Recombinant baculovirus delivery vectors were constructed by
Bac-to-bac method according to the manufacturer's instruction
(Invitrogen). Viruses were concentrated at high titers and purified
as described. The virus titering was determined by end-point
dilution assay using sf9 cells (Airenne et al., 2000).
[0016] 293T were cultured in DMEM suplemented with 10% fetal bovine
serum (FBS). Cells were plated 24 h before transduction.
Transduction was performed with varying virus concentrations, MOIs
(multiplicity of infections) were between 250-1000 pfu per cell.
The baculoviruses 8AV-transfer, BAC-gag-poi, BAC-VSVg and BAG-rev
were added in the serum-free DMEM. After 4 h incubation at
+37.degree. C. fresh medium was changed. The cell supernatant was
collected 48 h after transduction and centrifuged at 1500 rpm for
10 min. at room temperature. As a control we prepared lentiviruses
also by conventional transient plasmid trasfection into 293T cell
(Kankkonen et al., 2004).
[0017] The unconcentrated viral supernatant after collection was
used to transduce Hela cells with different dilutions. The
functional titers of lentiviruses were determined by analysing the
number of virus particles able to transduce cells. Titering was
performed by FACS analysis (FACS Calibur) as described earlier
(Follenzi and Naldini, 2002). The comparison of different
production method was done by comparing functional titers of the
lentivirus preps. To follow up the lentivirus transgene expression
the transduced Hela-cells were cultured 3 months to follow up the
GFP expression.
Results
[0018] With four baculoviruses at MOI 500, lentivirus titers were
on average 6.0.times.10.sup.5 TU/ml. Higher titers were obtained
with higher baculovirus concentrations. The optimal baculovirus
concentration turned out MOI 750 and the lentivirus titers were on
average 1.2.times.10.sup.8 TU/ml. These results are in line to
titers by the commonly used transient calsium-chloride transfection
method of four plasmid (average 3.9.times.10.sup.6 TU/ml). Decrease
of the titer was seen after high baculovirus concentration of MOI
1000, possible due to increased toxicity of the VSVG protein (FIG.
3). To exclude the possibility that the GFP expression comes from
the baculovirus expressing the transfer construct the lentivirus
transduced cells were grown three months without loosing the GFP
expression. Baculovirus is not an integrative vector and gene
expression from baculovirus vectors is usually lost after two weeks
(Airenne et at. 2000) whereas transgene expression from the
integrated lentivirus was stable if no silencing of the transgene
cassette occurs Delenda, 2004)
Discussion
[0019] In vivo experiments in preclinical large animal models and
human clinical trials require large amounts of viral particles.
Currently, there is no optimal large scale packaging system
available for lentiviruses. Stable large scale vector production
systems have been developed but the toxicity of the lentiviral
enzymes and the fusogenic VSV-G prohibit constitutive expression
and only possible at this moment is to use inducible cell lines
(Pacchia et al., 2001; Farson et al., 2001) or replace the most
toxic VSV-G with other non-toxic glycoprotein (Kumar et al., 2003).
Stable cell lines suffer from the gene silencing that occurs during
the long culture periods necessary for sequential addition of
packaging constructs. On the contrary, transient plasmid-based
production systems are very laborious. Hence none of these systems
have proved ideal for the large scale production of lentiviruses
and, therefore, new methods are needed.
[0020] Baculoviruses have several advantages for vector production.
They have a large insert capasity, and are capable of transducing
many mammalian cell lines with high efficiency. However,
baculoviruses are not able to replicate in mammalian cells and
viruses are easy to produce in high titers (Hofmann et at, 1995).
Baculoviruses have been widely used In large scale protein
production in insect cells and for the production of viral-like
particles (VLP), like influence virus-like particles (Galarza et
al., 2005), rotavirus-like particles (Shuttleworth et al., 2005)
and papillomavirus-like particles (Zheng et al., 2004) in insect
cells and hepatitis VLP in mammalian cells (Chen et al., 2005). The
goal in VLP production has been vaccine development. Functional
intact viruses have also been produced with hybrid baculoviruses in
insect cells as well as in mammalian cells: AAV vectors were
produced in insect cells and were comparable to 293 mammalian
cell-produced AAV (Urabe et al., 2002). In mammalian cells
baculovirus-mediated production has been developed for recombinant
influence viruses (Poomputsa et al., 2003), AAV (Sollerbrant et
al., 2001) and adenoviruses (Cheshenko et al., 2001).
[0021] Some attempts have been reported to use hybrid viruses in
lentiviral production Lentiviruses have been produced earlier by
hybrid adenoviruses in mammalian cells (Kuate et al., 2004).
Baculovirus mediated production of lentivirus-like particles in
insect cells has also been achieved (Gheysen et al., 1989; Morikawa
et al., 1998; Nermut et al., 1994) but the production of functional
lentiviruses in insect cells is demanding since the presence of
active proteases leads to immature formation of VLPs. Presumably
premature protease activity results the degrading the intracellular
pool of Gag precursor before particle assembly (Adamson et al.,
2003).
[0022] In the current study we demonstrate for the first time the
generation of functional lentiviruses using hybrid baculoviruses.
This study was performed using four recombinant baculoviruses with
equal amount of each virus during the transduction. Lentivirus
titers produce to baculoviruses were comparable to lentivirus
titers produced with conventional four plasmid transfection
methods. The method may be improved by optimizing further the
amount of each baculovirus in the transduction as is usually done
with plasmid transfections. The boor condition of the producing
cells was observed when very high doses of baculovirses were used.
This was probably due to the VSV-G toxicity since no problems were
detected when VSV-G expressing baculovirus was left out and the
total number of baculovirus particles were kept the same (data not
shown). Baculoviruses used in this study were based on the basic
non-modified baculovirus vectors. By using improved 2.sup.nd
generation baculoviruses together with further optimized
transduction conditions should enable the use of less MOI for the
lentivirus production. This could include modification of the
baculovirus envelope with pseudotyping, adding e.g. WPRE to enhance
the transcription or to optimize further medium conditions (Mahonen
et al. unpublished data).
[0023] Baculoviruses have a large cloning capacity up to 50 kb
allowing the possibility to transfering all the elements required
for the lentivirus production into one or two baculoviruses. An
efficient lentivirus vector production system by a single
helper-dependent adenovirus (Kubo and Mitani, 2003) and a
retrovirus vector production system by single vaccinia virus
(Konetschny et al., 2003) have already been described. However, one
of the main problems associated with the use of lentiviral vectors
is the possibility for the generation of a pathogenic human viruses
and a major concern is how to minimize the risk for the formation
of replication-competent lentivirus.
[0024] To avoid these problems, all non-essential factors needed
for the pathogenesis of lentivirus diseases have been deleted and
only the necessary elements required for the transferring of the
virus genetic elements (gag, pol and rev) are present in the latest
third generation vectors (Dull et al., 1998; Miyoshi et al., 1998).
Originally to minimize the risk for the generation of
replication-competent lentivirus through recombination the
constructs were divided in to four separate plasmids.
[0025] However, no replication competent lentivirus was detected in
a single virus based production (Kubo and Mitani, 2003). Scott el
at recently demonstrated that baculovirseses are efficient in
transducing suspension 293-based HEK-F cells in serum-free
conditions and production of proteins was even increased in
optimized large scale conditions (Scott et al., 2007). The
production of lentiviruses via single baculovirus in serum-free
large scale conditions should be considered.
[0026] In conclusion, our study demonstrates that hybrid
baculoviruses may be very useful to solve the problems regarding
large scale production of lentivirus vectors. Baculovirus
technology offers an attractive possibility to scalable lentivirus
production as a result of ease production and concentration of
baculoviruses, efficient transduction of suspension mammalian cells
in serum free conditions and safety of the baculoviruses.
REFERENCE LIST
[0027] Adamson, C. S., M. Nermut, and I. M. Jones. 2003. Control of
human immunodeficiency virus type-1 protease activity in insect
cells expressing Gag-Pol rescues assembly of immature but not
mature virus-like particles. Virology 308: 157-165. [0028] Airenne,
K. J., M .O. Hiltunen, M. P. Turunen, A. M. Turunen, O. H.
Laitinen, M. S. Kulomaa, and S. Yla-Herttuala. 2000.
Baculovirus-mediated periadventitial gene transfer to rabbit
carotid artery. Gene Ther. 7: 1499-1504. [0029] Burns, J .C., T.
Friedmann, W. Driever, M. Burrascano, and J. K. Yee. 1993.
Vesicular stomatitis virus G glycoprotein pseudotyped retroviral
vectors: concentration to very high titer and efficient gene
transfer into mammalian and nonmammalian cells. Proc. Natl. Acad.
Sci. U.S.A. 90: 8033-8037. [0030] Chen, Y. H., J. C. Wu, K. C.
Wang, Y. W. Chiang, C. W. Lai, Y. C. Chung, and Y. C. Hu. 2005.
Baculovirus-mediated production of HDV-like particles in BHK cells
using a novel oscillating bioreactor. J. Biotechnol. 118: 135-147.
[0031] Cheshenko, N., N. Krougliak, R. C. Eisensmith, and V. A.
Krougliak. 2001. A novel system for the production of fully deleted
adenovirus vectors that does not require helper adenovirus. Gene
Ther. 8! 846-854. [0032] Delenda, C. 2004. Lentiviral vectors:
optimization of packaging, transduction and gene expression. J.
Gene Med. 6 Suppl 1: S125-S138. [0033] Dull, T., R. Zufferey, M.
Kelly, R. J. Mandel, M. Nguyen. D. Trono, and L. Naldini. 1998. A
third-generation lentivirus vector with a conditional packaging
system. J. Virol. 72; 8463-8471. [0034] Farson, D., R. Witt, R.
McGuinness, T. Dull, M. Kelly, J. Song, R. Radeke, A. Bukovsky, A.
Consiglio, and L. Naldini. 2001. A new-generation stable inducible
packaging cell line for lentiviral vectors. Hum. Gene Ther. 12:
981-997. [0035] Follenzi, A. and L. Naldini. 2002. Generation of
HIV-1 derived lentiviral vectors. Methods Enzymol. 346: 454-465.
[0036] Galarza, J. M., T. Latham, and A. Cupo. 2005. Virus-like
particle vaccine conferred complete protection against a lethal
influenza virus challenge. Viral Immunol. 18: 365-372. [0037]
Gheysen, D., E. Jacobs, F. F. de, C. Thiriart, M. Francotte, D.
Thines, and W. M. De. 1989. Assembly and release of HIV-1 precursor
Pr55gag virus-like particles from recombinant baculovirus-infected
insect cells. Cell 59: 103-112. [0038] Hofmann, C., V. Sandig, G.
Jennings, M. Rudolph, P. Schlag, and M. Strauss. 1995. Efficient
gene transfer into human hepatocytes by baculovirus vectors. Proc.
Natl. Acad. Sci. U.S.A. 92: 10099-10103. [0039] Kankkonen, H. M.,
E. Vahakangas, R. A. Marr, T. Pakkanen, A. Laurema, P. Leppanen, J.
Jalkanen, I. M. Verma, and S. Yia-Herttuala. 2004. Long-term
lowering of plasma cholesterol levels in LDL-receptor-deficient
WHHL rabbits by gene therapy. Mol. Ther. 9: 548-556. [0040]
Konetschny, C., G. W. Holzer, C. Urban, T. Hammerle, J. Mayrhofer,
and F. G. Falkner. 2003. Generation of transduction-competent
retroviral vectors by infection with a single hybrid vaccinia
virus. J. Virol. 77: 7017-7025. [0041] Kuate, S., D. Stefanou, D.
Hoffmann, O. Wildner, and K. Uberla. 2004. Production of lentiviral
vectors by transient expression of minimal packaging genes from
recombinant adenoviruses. J. Gene Med. 6: 1197-1205. [0042] Kubo,
S. and K. Mitani. 2003. A new hybrid system capable of efficient
lentiviral vector production and stable gene transfer mediated by a
single helper-dependent adenoviral vector. J. Virol. 77: 2964-2971.
[0043] Kurnar, M., B. P. Bradow, and J. Zimmerberg. 2003.
Large-scale production of pseudotyped lentiviral vectors using
baculovirus GP64. Hum. Gene Ther. 14: 67-77. [0044] Miyoshi, H., U.
Blomer, M. Takahashi, F. H. Gage, and I. M. Verma. 1998.
Development of a self-inactivating lentivirus vector. J. Virol. 72:
8150-8157. [0045] Morikawa, Y., W. H. Zhang, D. J. Hockley, M. V.
Nermut, and I. M. Jones. 1998. Detection of a trimeric human
immunodeficiency virus type 1 Gag intermediate is dependent on
sequences in the matrix protein, p17. J. Virol. 72; 7659-7663.
[0046] Nermut, M. V., D. J. Hockley, J. B. Jowett, I. M. Jones, M.
Garreau, and D. Thomas. 1994. Fullerene-like organization of HIV
gag-protein shell in virus-like particles produced by recombinant
baculovirus. Virology 198: 288-296. [0047] Pacchia, A. L., M. E.
Adlelson, M. Kaul, Y. Ron, and J. P. Dougherty. 2001. An inducible
packaging cell system for safe, efficient lentiviral vector
production in the absence of HIV-1 accessory proteins. Virology
282: 77-86. [0048] Poomputsa, K., G. Kittel, A. Egorov, W. Ernst,
and R. Grabherr. 2003. Generation of recombinant influenza virus
using baculovirus delivery vector. J. Virol., Methods 110: 111-114.
[0049] Scott, M. J., S. S. Modha, A. D. Rhodes, N. M. Broadway, P.
I. Hardwicke, H. J. Zhao, K. M. Kennedy-Wilson, S. M. Sweitzer, and
S. L. Martin. 2007. Efficient expression of secreted proteases via
recombinant. BacMam virus. Protein Expr. Purif. 52: 104-116. [0050]
Shuttleworth, G., D. C. Eckery, and P. Awram. 2005. Oral and
intraperitoneal immunization with rotavirus 2/6 virus-like
particles stimulates a systemic and mucosal immune response in
mice. Arch. Virol. 150: 341-349. [0051] Sollerbrant, K., J. Elmen,
C. Wahlestedt, J. Acker, H. Leblois-Prehaud, M. Latta-Mahieu, P.
Yeh, and M. Perricaudet. 2001. A novel method using
baculovirus-mediated gene transfer for production of recombinant
adeno-associated virus vectors. J. Gen. Viral. 82: 2051-2060.
[0052] Urabe, M., C. Ding, and R. M. Kotin. 2002. Insect cells as a
factory to produce adeno-associated virus type 2 vectors. Hum. Gene
Ther. 13:1935-1943. [0053] Zheng, J., J. Ma, X. F. Yang, H. L. Liu,
H. W. Cheng, L. S. Si, and Y. L. Wang. 2004. Highly efficient and
economical baculovirus expression system for preparing human
papillomavirus type 16 virus-like particle. Acta Biochim. Biophys.
Sin. (Shanghai) 36: 548-552.
Sequence CWU 1
1
3186DNAArtificial SequenceLinker 1cacgtggcta gcctgcaggt cgaccttaag
ttaattaaac tagtacgcgt gtttaaacga 60attcgggccc atttaaatgg cgcgcc
86238DNAArtificial SequencePrimer 2cgaaggaatt cgtcgccacc atggcaggaa
gaagcgga 38335DNAArtificial SequencePrimer 3agctagctag cgtattctcc
tgactccaat attgt 35
* * * * *