U.S. patent application number 14/946644 was filed with the patent office on 2016-03-10 for methods for heart regeneration.
This patent application is currently assigned to SALK INSTITUTE FOR BIOLOGICAL STUDIES. The applicant listed for this patent is SALK INSTITUTE FOR BIOLOGICAL STUDIES. Invention is credited to Aitor Aguirre, Juan Carlos Izpisua-Belmonte, Ignacio Sancho-Martinez.
Application Number | 20160068863 14/946644 |
Document ID | / |
Family ID | 51259739 |
Filed Date | 2016-03-10 |
United States Patent
Application |
20160068863 |
Kind Code |
A1 |
Aguirre; Aitor ; et
al. |
March 10, 2016 |
METHODS FOR HEART REGENERATION
Abstract
Methods for heart regeneration are provided. The invention
provided herein includes methods of modulating proliferation of
cardiomyocytes using small molecules and micro RNAs. In
embodiments, the methods provided may be used to increase
proliferation or cardiomyocytes. Further provided are methods to be
used for the treatment of myocardial infarction.
Inventors: |
Aguirre; Aitor; (La Jolla,
CA) ; Sancho-Martinez; Ignacio; (San Diego, CA)
; Izpisua-Belmonte; Juan Carlos; (La Jolla, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
SALK INSTITUTE FOR BIOLOGICAL STUDIES |
La Jolla |
CA |
US |
|
|
Assignee: |
SALK INSTITUTE FOR BIOLOGICAL
STUDIES
La Jolla
CA
|
Family ID: |
51259739 |
Appl. No.: |
14/946644 |
Filed: |
November 19, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14052538 |
Oct 11, 2013 |
9220721 |
|
|
14946644 |
|
|
|
|
61712701 |
Oct 11, 2012 |
|
|
|
Current U.S.
Class: |
514/44R |
Current CPC
Class: |
C12N 15/86 20130101;
C12N 2750/14143 20130101; C12N 2320/30 20130101; C12N 2310/113
20130101; A61K 48/00 20130101; A61K 31/7105 20130101; C12N
2740/15043 20130101; A61K 31/713 20130101; C12N 15/111 20130101;
C12N 2310/141 20130101; A61K 31/7088 20130101 |
International
Class: |
C12N 15/86 20060101
C12N015/86 |
Claims
1. A method of treating a subject with heart damage, comprising:
administering to the subject a therapeutically effective amount of
a nucleic acid encoding an antagonist of a micro RNA (miR) 99 micro
RNA, a nucleic acid encoding an antagonist of a miR 100 micro RNA,
a nucleic acid encoding an antagonist of a let-7a micro RNA, and a
nucleic acid encoding an antagonist of a let-7c micro RNA, thereby
inducing proliferation of cardiomyocytes and treating the heart
damage in the subject.
2. The method of claim 1, comprising administering to the subject a
therapeutically effective amount of a) a lentiviral vector or an
adeno-associated viral (AAV) vector comprising the nucleic acid
encoding the antagonist of the miR 99 micro RNA and the nucleic
acid encoding the antagonist of the miR 100 micro RNA, and b) a
lentiviral vector or an AAV vector encoding the nucleic acid
encoding the antagonist of the let-7a micro RNA and the antagonist
of the let-7c micro RNA.
3. The method of claim 2, wherein a) the lentiviral vector or the
AAV vector comprising the nucleic acid encoding the antagonist of
the miR 99 micro RNA and the antagonist of the miR 100 micro RNA,
and b) the lentiviral vector or the AAV vector encoding the nucleic
acid encoding the antagonist of the let-7a micro RNA and the
antagonist of the let-7c micro RNA, are the same vector.
4. The method of claim 2, wherein a) the lentiviral vector or the
AAV vector comprising the nucleic acid encoding the antagonist of
the miR 99 micro RNA and the antagonist of the miR 100 micro RNA,
and b) the lentiviral vector or the AAV vector encoding the nucleic
acid encoding the antagonist of the let-7a, are different
vectors.
5. The method of claim 1, comprising administering to the subject a
therapeutically effective amount of a nucleic acid molecule
comprising the nucleic acid sequence as set forth in SEQ ID NO:1124
or SEQ ID NO:1125.
6. The method of claim 5, comprising administering to the subject
the therapeutically effective amount of the nucleic acid molecule
comprising the nucleic acid sequence set forth as SEQ ID NO:
1124.
7. The method of claim 5, comprising administering to the subject
the therapeutically effective amount of the nucleic acid molecule
comprising the nucleic acid sequence set forth as SEQ ID NO:
1125.
8. The method of claim 1, further comprising measuring the
proliferation of cardiomyocytes in the subject.
9. The method of claim 1, wherein the method regenerates cardiac
tissue in the subject.
10. The method of claim 1, wherein the subject is a mammal.
11. The method of claim 10, wherein the mammal is a human.
12. The method of claim 10, wherein the method improves ejection
fraction in the subject.
13. The method of claim 1, wherein the heart damage is a myocardial
infarction.
14. The method of claim 13, wherein the method reduces fibrotic
scarring and/or infarct size in the subject.
15. A method of regenerating heart muscle in a subject, comprising
administering to the subject a therapeutically effective amount of
a small molecule that modulates expression or activity of a miR 99
micro RNA-regulated protein, a small molecule that modulates
expression or activity of a miR 100 micro RNA-regulated protein, a
small molecule that modulates expression or activity of a let-7a
micro RNA -regulated protein, and small molecule that modulates
expression or activity of a let-7c micro RNA regulated protein,
thereby forming a treated cardiomyocyte, thereby inducing
proliferation of cardiomyocytes and regenerating heart muscle in
the subject.
16. The method of claim 15, wherein the small molecule that
modulates expression or activity of the miR 99 micro RNA-regulated
protein, the small molecule that modulates expression or activity
of the miR 100 micro RNA-regulated protein, the small molecule that
modulates expression or activity of the let-7a micro RNA -regulated
protein, and/or the small molecule that modulates expression or
activity of the let-7c micro RNA regulated protein is a synthetic
micro RNA molecule.
17. The method of claim 15, further comprising measuring the
proliferation of cardiomyocytes in the subject.
18. The method of claim 15, wherein the subject is human.
19. The method of claim 15, wherein the subject is a mammal.
20. The method of claim 15, wherein the mammal is a human.
21. The method of claim 15, wherein the method improves ejection
fraction in the subject.
22. The method of claim 15, wherein the subject has a myocardial
infarction.
23. The method of claim 22, wherein the method reduces fibrotic
scarring and/or infarct size in the subject.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This is a divisional of U.S. patent application Ser. No.
14/052,538, filed Oct. 11, 2013, which claims the benefit of U.S.
Provisional Appl. No. 61/712,701, filed Oct. 11, 2012. The prior
applications are incorporated herein in their entirety.
BACKGROUND OF THE INVENTION
[0002] Heart failure remains one of the leading causes of mortality
in the developed world. Whereas the mammalian heart is endowed with
certain regenerative potential, endogenous cardiomyocyte
proliferation is insufficient for functional heart repair upon
injury. Interestingly, non-mammalian vertebrates, such as the
zebrafish, can regenerate the damaged heart by inducing
cardiomyocyte dedifferentiation and proliferation. By screening
regenerating zebrafish hearts Applicants identified miR-99/100
down-regulation as a key process driving cardiomyocyte
dedifferentiation. Experimental down-regulation of miR-99/100 in
primary adult murine and human cardiomyocytes led to an increase in
the number of proliferating cardiomyocytes. AAV-mediated in vivo
down-regulation of miR-99/100 after acute myocardial injury in mice
induced mature cardiomyocyte proliferation, diminished infarct size
and improved heart function. Applicants' study unveils conserved
regenerative mechanisms between zebrafish and mammalian
cardiomyocytes and represents a proof-of-concept on the suitability
of activating pro-regenerative responses for healing the diseased
mammalian heart.
BRIEF SUMMARY OF THE INVENTION
[0003] In one aspect, a method of modulating proliferation of a
cardiomyocyte is provided. The method includes (i) transfecting a
cardiomyocyte with a nucleic acid encoding a micro RNA modulator,
thereby forming a transfected cardiomyocyte; and (ii) allowing the
transfected cardiomyocyte to divide, thereby modulating
proliferation of the cardiomyocyte.
[0004] In another aspect, a method of modulating proliferation of a
cardiomyocyte is provided. The method includes (i) contacting a
cardiomyocyte with a small molecule, thereby forming a treated
cardiomyocyte; and (ii) allowing the treated cardiomyocyte to
divide, thereby modulating proliferation of the cardiomyocyte.
[0005] In another aspect, a method of treating myocardial
infarction in a subject in need thereof is provided. The method
includes administering to the subject a therapeutically effective
amount of a nucleic acid encoding a micro RNA modulator, wherein
the RNA modulator increases cardiomyocyte proliferation thereby
treating the myocardial infarction.
[0006] In another aspect, a method of treating myocardial
infarction in a subject in need thereof is provided. The method
includes administering to the subject a therapeutically effective
amount of a nucleic acid encoding an antagonist of a mir 99 micro
RNA and a nucleic acid encoding an antagonist of a let-7a micro
RNA, thereby treating the myocardial infarction.
[0007] In another aspect, a method of treating myocardial
infarction in a subject in need thereof is provided. The method
includes administering to the subject a therapeutically effective
amount of a small molecule, wherein the small molecule increases
cardiomyocyte proliferation thereby treating the myocardial
infarction.
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] FIGS. 1A-1J. miR-99/100 and Let-7a/c are involved in the
early cardiac regenerative response in the zebrafish. (FIG. 1A)
Amputated hearts were allowed to regenerate for 3 and 7 days, and
then analyzed by real time RT-PCR for microRNA candidates
miR-99/100 and Let-7a/c (n=8). (FIGS. 1B, C) FISH/double
immunofluorescence was used to determine cardiomyocyte specific
expression of microRNA-100 (n=5, see also FIG. 6) and its
downstream targets fnt.beta. (FIG. 1B) and smarca5 (FIG. 1C) in
uninjured (left panel) and 7 dpa conditions (right panel).
Cardiomyocytes in regenerating hearts exhibited remarkable low
levels of both miRs, and inversely correlating high levels of
Fnt.beta. and Smarca5. (FIG. 1D) Gene expression fold change of
fnt.beta. and smarca5 in amputated hearts (n=8). (FIG. 1E) Chemical
inhibition of fnt activity with Tipifarnib dramatically reduced
cardiomyocyte proliferation and heart regeneration in amputated
fish, leading to scarring as determined by Masson's Trichromic
(FIG. 1F) staining and BrDU incorporation (FIG. 1G) (n=6). (FIGS.
1H, I, J) Knock-down of fnt.beta. and/or smarca5 in embryos
resulted in abnormally small animals and reduced ventricle size in
cm1c2:GFP animals. The same phenotype was observed upon injection
of miR-99/100 mimics (n>50). Dashed line: amputation plane.
Boxed area: magnified field. Arrowheads: cells of interest.
[0009] FIGS. 2A-2J. Heart regeneration in the fish is controlled by
miR-99/100 and Let-7a/c. (FIG. 2A,B) Dedifferentiating
cardiomyocytes express high levels of Fnt.beta. (from top to
bottom, uninjured, 3 dpa and 7 dpa, panel FIG. 2A) and Smarca5
(from top to bottom, uninjured, 3 dpa and 7 dpa, panel FIG. 2B)
with a 3.5-fold and 7-fold protein increment at 7 dpa,
respectively, (see histogram in FIGS. 2C, D; n=5). (FIGS. 2E, F, G)
Exogenous intra-cardiac administration of miR-99/100 mimics led to
defective cardiac regeneration, scarring and reduced cardiomyocyte
proliferation (n=6). (FIG. 2H) miR-99/100 inhibitors exerted the
opposite effect in uninjured adult animals, inducing significant
cardiac hyperplasia (FIG. 2I) and increased ventricle size (FIG.
2J; n=6). Dashed line: amputation plane. Boxed area: magnified
area. Ec: endocardial cells; cm: cardiomyocytes. Arrowheads: cells
of interest.
[0010] FIGS. 3A-3H. Adult mammalian cardiomyocytes can be directed
to a proliferative state by forced silencing of the miR-99/100
cluster. Expression patterns of the miR-99/100 cluster during
development in murine (FIG. 3A) and human cardiomyocytes (FIG. 3C)
were determined by qRT-PCR (n=6). (FIGS. 3B, D) Dynamics of
cardiomyocyte progenitor marker and Fnt.beta./Smarca5 expression
during murine (FIG. 3B) and human (FIG. 3D) cardiac maturation.
Both Fnt.beta. and Smarca5 are up-regulated at cardiac progenitor
stages, and strongly repressed in adult hearts (n=6). (FIGS. 3E, F)
Cultured adult murine cardiomyocytes transduced with
anti-miR-99/100+anti-Let-7 reverted to a dedifferentiated-like
state, re-expressing GATA4 and dissembling the cytoskeleton (see
also FIG. 17; n=3). (FIGS. 3G, H) Transduction with anti-miRs was
sufficient to efficiently drive adult cardiomyocytes to a
proliferative state (FIG. 3G), with beating functionality (FIG. 3H)
(n=3).
[0011] FIGS. 4A-4L. MicroRNA silencing is sufficient to induce
heart regeneration in a murine model of myocardial infarction.
(FIGS. 4A, B) Organotypic cultures of adult heart tissue were
employed to study the effects of microRNA-99/100 and Let-7a/c
silencing. (FIG. 4A) After 7 days of treatment, myocardial tissue
became disorganized, with a loss of sarcomeric structures as
determined by electron microscopy analysis (n=6). (FIG. 4B)
Furthermore, re-expression of dedifferentiation markers was
detected by immunofluorescence evaluation/quantification, as well
as cardiomyocyte proliferation and FNT.beta. and SMARCA5 expression
in normoxic and hypoxic conditions (n=6). (FIG. 4C) Representative
pictures of echocardiography performed in control (left panel) and
treated animals (right panel) at 18 days post-myocardial infarction
(MI). In vivo silencing of miR-99/100 and Let-7 led to significant
improvements in fractional shortening (FIGS. 4D, F) and ejection
fraction (FIGS. 4E, F) at 18 days post-MI (n=5). (FIG. 4G) Left
panel, reduced infarct size in miR-99/100 and Let-7 treated animals
is confirmed by Masson's trichromic staining; (FIG. 4G) Right
panel, quantification of scar size by Masson's thrichromic staining
(FIG. 4G; n=5). (FIGS. 4H-J) Recovery was accompanied by
cardiomyocyte-specific expression of FNT.beta. (FIG. 4H) and
SMARCA5 (FIG. 4I), as well as GATA4 re-expression (FIG. 4J, right
panel shows quantification of this data) as determined by
immunofluorescence analyses (n=5). (FIGS. 4K, L, panel on the right
shows quantification of this data) Regeneration was mediated by a
dramatic increase in proliferating cardiomyocytes as determined by
PCNA (FIG. 4K) and H3P (FIG. 4L) stainings (n=5). Arrowheads: cells
of interest.
[0012] FIGS. 5A-5C. miR-99/100 and Let-7a/c are located in same
genomic cluster and their functions and protein targets are
conserved across vertebrates. (FIG. 5A) Microarray analysis
identified a subset of differentially regulated microRNAs during
early stages of regeneration in the zebrafish heart (n=4).
Interestingly, most of them were consistently down-regulated. (FIG.
5B) Bioinformatic analysis of the most relevant signaling pathways
targeted by miR-99/100 and Let-7a/c. (FIG. 5C) Genomic organization
and conservation of miR-99/100 and Let-7a/c clusters in vertebrates
(upper left: zebrafish miR-100 cluster; upper right: zebrafish
miR-99 cluster; lower left: human miR-99/100 clusters; lower right:
murine miR-99/100 clusters).
[0013] FIGS. 6A-6D. Expression of miR-99/100 is restricted to
cardiomyocytes and inversely correlates with Fnt.beta. and Smarca5.
(FIGS. 6A-D) FISH/immunofluorescence analyses on zebrafish heart
sections from uninjured and amputated animals at 3 and/or 7 dpa.
(FIGS. 6A, B) FISH/immunofluorescence analysis of miR-100 and
Fnt.beta./Smarca5 expression (see also FIG. 1; n=8). (FIGS. 6C, D)
FISH/immunofluorescent analysis of miR-99 and Fnt.beta./Smarca5
expression during regeneration (upper row, miR-99 effects on Fntb
expression at uninjured (left), 3 dpa (center) and 7 dpa (right)
conditions; lower row, miR-99 effects on Smarca5 expression at
uninjured (left), 3 dpa (center) and 7 dpa (right) conditions).
(n=8). Dashed line: amputation plane. Boxed area: magnified in
inset.
[0014] FIGS. 7A-7B. Relevant protein targets of interest in heart
regeneration regulated by miR-99/100 and Let-7a/c. (FIG. 7A)
Miranda-based binding predictions of miR-99/100 to zebrafish Fntb
(upper panel) and Smarca5 (lower panel) 3' UTRs. (FIG. 7B)
Luciferase assay to determine biochemical binding of miR-99/100 to
the predicted targets Fntb and Smarca5 for zebrafish (upper and
middle rows) and human (lower row) 3'UTRs. Fish and human UTRs were
subcloned in the pGL3 vector and subjected to microRNA mimic
knockdown in vitro. pGL3: empty vector; AS-UTR: antisense-UTR
(negative control); UTR: 3'untranslated region.
[0015] FIGS. 8A-8B. Fnt.alpha., the structural subunit of Fnt, was
constitutively expressed in cardiomyocytes regardless of
regeneration conditions. Fnta expression was determined by
immunofluorescence (FIG. 8A) and qRT-PCR (FIG. 8B, n=4). Dashed
line: amputation plane. Boxed area: magnified section.
[0016] FIGS. 9A-9D. MiR-99/100 plays a role in heart development.
(FIG. 9A) Expression of miR-99/100 is very low during the first
stages of development and dramatically increases at 3 dpf in
zebrafish (n=10). (FIG. 9B) fnt.beta. and smarca5 expression
inversely correlate with miR-99/100 in developing embryos (n=10).
(FIGS. 9C, D) Both Fnt.beta. and Smarca5 are present at high levels
in developing hearts (n=10). V: ventricle; A: atrium; Eb:
erythroblasts.
[0017] FIGS. 10A-10D. Targets of miR-99/100 and Let-7a/c return to
basal levels of expression after cardiomyocytes come back to their
quiescent state. (FIGS. 10A, B) Immunofluorescent stainings for
proliferating cardiomyocytes at 30 dpa, when regeneration in the
zebrafish heart is mostly complete (n=3). Fnt.beta. and Smarca5
presence in the myocardium returned to pre-amputation levels at 30
dpa, when regeneration is mostly completed. (FIG. 10C) Strategy for
the scarring experiments to identify the importance in regeneration
of miR-99/100. (FIG. 10D) Successful heart delivery of antagomiRs
was evaluated by injection of a matched-size Cy5-labelled
oligonucleotide against GFP in cm1c2:GFP animals (n=3).Dashed line:
amputation plane. Boxed area: magnified section.
[0018] FIGS. 11A-11B. Direct substrates of fnt are activated in
regenerating hearts. (FIGS. 11A, B) At 3 and 7 dpa, a significant
fraction of farnesylated proteins was detected in dedifferentiating
cardiomyocytes as determined by immunofluorecence (n=5). Boxed
area: magnified section.
[0019] FIGS. 12A-12F. Signaling downstream of fnt.beta. in the MAPK
signaling pathway were consistently up-regulated in regenerating
hearts. Ras (FIGS. 12A, B, C) and c-myc (FIGS. 12D, E, F),
activators of the MAPK pathway regulated by miR-99/100 and Let-7a/c
were up-regulated as determined by immunofluorescence (FIGS. 12A,D)
and by qRT-PCR (FIGS. 12B,C,E,F; n=5). Dashed line: amputation
plane. Boxed area: magnified section. Arrowheads: cells of
interest.
[0020] FIGS. 13A-13B. Chromatin remodeling is a necessary step in
cardiomyocyte dedifferentiation. (FIGS. 13A,B) The chromatin
remodeling agents Cbx5 (FIG. 13A) and Cbx3a (FIG. 13B), which act
in concert with Smarca5, were found in the nucleus of
dedifferentiating cardiomyocytes indicating a wave of chromatin
remodeling. The following is shown in the histograms of FIG. 13A
and FIG. 13B from left to right: First panel (bottom and top
histogram): DAPI stain, second panel (bottom and top histogram):
MyHC stain; third panel (bottom and top histogram): PCNA stain;
forth panel (bottom and top histogram): Cbx5 stain; fifth panel
(bottom and top histogram): merge of histograms of panels one, two
three and four. (n=4). Arrowheads: cells of interest.
[0021] FIG. 14. Expression of miR-99/100 cluster is a switch to
promote or inhibit cardiomyocyte dedifferentiation and
proliferation in vertebrates. In the proposed model of action,
quiescent cardiomyocytes express high levels of miR-99/100 and
Let-7a/c, which inhibit the expression of key members of the
proliferative activation cascade (Uninjured condition shown in left
panel). Upon injury, cardiomyocytes cease to express these miRs,
leading to the over-expression of key regulators of two parallel
pathways simultaneously: MAPK signaling and chromatin remodeling
(Injury condition shown in right panel). These changes lead to a
proliferation-permissive state in cardiomyocytes, which become more
receptive towards proliferative signals coming from the injured
area and proliferate to replenish the lost tissue. The symbols "X"
indicate blocked pathways.
[0022] FIGS. 15A-15D. FISH/IF for different developmental stages in
the mouse heart. (FIGS. 15A-C) Identical patterns of expression
were found for miR-99/100 and Let-7a/c, as well as Fnt.beta. and
Smarca5, to those observed in the developing zebrafish (FIG. 15A:
embryonic day 11; FIG. 15B: postnatal day 2; FIG. 15C: adult)
(n=6). (FIG. 15D) Quantification showing the number of double
positive cells for miR-99/100 (FIG. 15D upper left), Let-7a/c (FIG.
15D upper right), Fnt.beta. (FIG. 15D lower left) and Smarca5 (FIG.
15D lower right) (n=6).
[0023] FIGS. 16A-16B. Human ESC-derived, proliferation-competent
immature cardiomyocytes (hiCM) possessed the same phenotype
observed in fish and mouse dedifferentiated cardiomyocytes. (FIG.
16A) Immunofluorescence for the indicated proteins in human
embryonic stem cells (FIG. 16A, Images are individual panels of the
merged figure shown at in the last column). (FIG. 16B) hiCMs showed
expression of GATA4, SMARCA5 and FNT.beta., which was progressively
lost with decreased proliferative capacity (n=3). The following is
shown in the histograms of FIG. 16A and FIG. 16B from left to
right: Histograms show immunostaining with DAPI (first panel), MyHC
(second panel), GATA4 (third panel), SMARCA5 (forth panel top),
FNTbeta (forth panel middle), of H3P (forth panel bottom) and a
merged histogram (fifth panel).
[0024] FIGS. 17A-17F. miR silencing leads to dedifferentiation and
proliferation of cardiomyocytes. (FIG. 17A, Images represent
individual panels of the merged image shown in the last column)
Untreated adult murine cardiomyocytes spontaneously disorganized
sarcomeric structures in vitro, but did not dedifferentiate or
express FNT.beta., SMARCA5, GATA4 or proliferative markers.
However, upon lentiviral transduction with anti-Let-7 alone (FIG.
17B, Images represent individual panels of the merged image shown
in the last column) or both anti-Let-7 and anti-miR-99/100 (FIG.
17C, Images represent individual panels of the merged image shown
in the last column) they re-expressed all those markers (n=3).
(FIG. 17D) Functional beating properties were preserved in
dedifferentiated cardiomyocytes, suggesting a degree of spontaneous
redifferentiation, except for anti-Let-7 treatment. (FIGS. 17E, F)
Cardiomyocyte dedifferentiation was evaluated by simultaneously
measuring GATA4 and sarcomeric myosin expression and organization
in cultured cardiomyocytes (n=3).
[0025] FIGS. 18A-18C. microRNA silencing is specific for
cardiomyocytes. (FIG. 18A) Human Fibroblasts (left panel) or
endothelial cells (right panel) expressed basal levels of
FNT.beta., SMARCA5 and negligible levels of miR-99/100 and Let-7a/c
(data not shown), and were insensitive to miR silencing (FIGS. 18A,
B, C), indicating specificity of the treatment in a heart setting.
(FIG. 18C) Images used for quantification of data shown in A and B
(Images represent individual panels of the merged image shown in
the last column) (n=3).
[0026] FIGS. 19A-19B (from top to bottom, confocal analysis of
FNTB, SMARCA5, Cx43, GATA4 and H3P). Histograms to the left
represent positional information from the numbers shown in the
insets. Ex vivo organotypic culture of murine myocardial tissue
reveals sustained cardiomyocyte proliferation. Adult mouse heart
tissue was cultured and treated with empty vector (pmiRZip),
anti-miR-99/100 or both anti-miR-99/100 and anti-Let-7 (lentiviral
activation was followed with a GFP reporter). Confocal analysis
after 7 days of miR silencing led to significantly increased
FNT.beta. and SMARCA5 (FIGS. 19A, B), enhanced numbers of
dedifferentiated cardiomyocytes --determined by Cx43 and GATA4
expression-- (FIG. 19B) and significantly increased number of
proliferating cells (n=4). Dashed line and corresponding numbers:
nuclear profile of representative cells. Boxed area: magnified
section.
[0027] FIGS. 20A-20E. Hypoxic injury in organotypic culture leads
to increased dedifferentiation. (FIG. 20A) Schematic of hypoxia
experiments. (FIG. 20B) Efficient lentiviral delivery was achieved
in ex vivo conditions for all anti-miRs. (FIGS. 20C, D)
Histomorphometric evaluation of the damaged myocardium in normoxic
and hypoxic conditions by employing Masson's trichrome staining
(n=4). (FIG. 20E) The dedifferentiation response was characterized
by GATA4, Cx43, H3P, Fnt.beta. and Smarca5 stainings (From top to
bottom, Cx43, SMARCA5, H3P) (n=4). Dashed line: adjacent necrotic
patch. Boxed area: magnified section. Dashed lines: necrotic
tissue.
[0028] FIGS. 21A-21B. Echocardiography showing functional
improvement in infarcted mice treated with anti-miR-99/100 and
anti-Let-7a (upper panel) and quantification of that data (lower
panel). Animals were subjected to LAD artery ligation to provike
infarction followed by tintramyocardial administration of antimiR
containing AAV2/9 vectors. Functional heart recovery was measured
versus untreated contrail animals. (FIG. 21A) At 18 dpi (days post
infarction) mice treated with antimiR's exhibit a significant
improvement in ejection fraction and fractional shortening, as well
as reduction in scar size. (FIG. 21B) At 3 mpi (months post
infarction) the improvements are still present (left panels,
echocardiographic quantification; right panel, representative
images), with further reduction of scar size and significant
enlargement of the LAVW, indicative of replenishment of the
myocardial mass.
[0029] FIGS. 22A-22B. In vivo regenerative reprogramming by
anti-miR delivery (FIG. 22A). In vivo-induced cardiomyocyte
proliferation by anti-miR delivery (18 days post-infarction) (left
panels, PCNA and H3P staining showing proliferating cardiomyocytes;
right panel, quantification of the data) (FIG. 22B).
[0030] FIGS. 23A-23C. In vivo dedifferentiation by anti-miR
delivery. (FIG. 23A): left panel, GATA4 immunofluorescence; right
panel, quantification of the data shown (FIG. 23B): histogram
showing percentage of dedifferentiated CMs; (FIG. 23C): SMARCA5
immunofluorescence.
[0031] FIGS. 24A-24B. Anti-miR99/100/let-7 delivery enhances
functional recovery after infarction. Echocardiography measurements
in infarcted animals treated with control vs. anti-miR treatment
indicate significant regeneration after treatment (FIG. 24A).
Qunatification of those animals shows statistically significant
functional recovery, both in fraction shortening (left panel) as
well as ejection fraction (right panel).
[0032] FIGS. 25A-25B. Anti-miR99/100/let-7 delivery enhances
functional recovery after infarction. Heart function improvement by
anti-miR treatment is sustained over long periods of time (ejection
fraction) and seems to involve regeneration of the myocardial mass
(LAWV thickening, immunohistological analysis shown in FIG. 25A).
Ultrasound analysis shown in FIG. 25B (abbreviations AW; anterior
wall; ID: internal diameter; reflects heart dilation; PW: posterior
wall).
REFERENCE TO A "SEQUENCE LISTING," A TABLE, OR A COMPUTER PROGRAM
LISTING APPENDIX SUBMITTED AS AN ASCII TEXT FILE
[0033] The Sequence Listing written in file
7158-94960-03_Sequence_Listing, created on Nov. 18, 2015, 7.45 MB,
machine format IBM-PC, MS Windows operating system, is hereby
incorporated by reference.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0034] While various embodiments and aspects of the present
invention are shown and described herein, it will be obvious to
those skilled in the art that such embodiments and aspects are
provided by way of example only. Numerous variations, changes, and
substitutions will now occur to those skilled in the art without
departing from the invention. It should be understood that various
alternatives to the embodiments of the invention described herein
may be employed in practicing the invention.
[0035] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
the application including, without limitation, patents, patent
applications, articles, books, manuals, and treatises are hereby
expressly incorporated by reference in their entirety for any
purpose.
[0036] Unless defined otherwise, technical and scientific terms
used herein have the same meaning as commonly understood by a
person of ordinary skill in the art. See, e.g., Singleton et al.,
DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY 2nd ed., J. Wiley
& Sons (New York, N.Y. 1994); Sambrook et al., MOLECULAR
CLONING, A LABORATORY MANUAL, Cold Springs Harbor Press (Cold
Springs Harbor, N.Y. 1989). Any methods, devices and materials
similar or equivalent to those described herein can be used in the
practice of this invention. The following definitions are provided
to facilitate understanding of certain terms used frequently herein
and are not meant to limit the scope of the present disclosure.
[0037] "Nucleic acid" refers to deoxyribonucleotides or
ribonucleotides and polymers thereof in either single- or
double-stranded form, and complements thereof. The term
"polynucleotide" refers to a linear sequence of nucleotides. The
term "nucleotide" typically refers to a single unit of a
polynucleotide, i.e., a monomer. Nucleotides can be
ribonucleotides, deoxyribonucleotides, or modified versions
thereof. Examples of polynucleotides contemplated herein include
single and double stranded DNA, single and double stranded RNA
(including siRNA), and hybrid molecules having mixtures of single
and double stranded DNA and RNA. The terms also encompass nucleic
acids containing known nucleotide analogs or modified backbone
residues or linkages, which are synthetic, naturally occurring, and
non-naturally occurring, which have similar binding properties as
the reference nucleic acid, and which are metabolized in a manner
similar to the reference nucleotides. Examples of such analogs
include, without limitation, phosphorothioates, phosphoramidates,
methyl phosphonates, chiral-methyl phosphonates, and 2-O-methyl
ribonucleotides.
[0038] A "miRNA" or "microRNA" as provided herein refers to a
nucleic acid that forms a double stranded RNA, which double
stranded RNA has the ability to reduce or inhibit expression of a
gene or target gene when expressed in the same cell as the gene or
target gene. The complementary portions of the nucleic acid that
hybridize to form the double stranded molecule typically have
substantial or complete identity. In one embodiment, a microRNA
refers to a nucleic acid that has substantial or complete identity
to a target gene and forms a double stranded miRNA. In embodiments,
the miRNA inhibits gene expression by interacting with a
complementary cellular mRNA thereby interfering with the expression
of the complementary mRNA. Typically, the nucleic acid is at least
about 15-50 nucleotides in length (e.g., each complementary
sequence of the double stranded miRNA is 15-50 nucleotides in
length, and the double stranded miRNA is about 15-50 base pairs in
length). In other embodiments, the length is 20-30 base
nucleotides, preferably about 20-25 or about 24-29 nucleotides in
length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30
nucleotides in length.
[0039] The words "complementary" or "complementarity" refer to the
ability of a nucleic acid in a polynucleotide to form a base pair
with another nucleic acid in a second polynucleotide. For example,
the sequence A-G-T is complementary to the sequence T-C-A.
Complementarity may be partial, in which only some of the nucleic
acids match according to base pairing, or complete, where all the
nucleic acids match according to base pairing.
[0040] The terms "protein", "peptide", and "polypeptide" are used
interchangeably to denote an amino acid polymer or a set of two or
more interacting or bound amino acid polymers. The terms apply to
amino acid polymers in which one or more amino acid residue is an
artificial chemical mimetic of a corresponding naturally occurring
amino acid, as well as to naturally occurring amino acid polymers
and non-naturally occurring amino acid polymer.
[0041] The term "amino acid" refers to naturally occurring and
synthetic amino acids, as well as amino acid analogs and amino acid
mimetics that function in a manner similar to the naturally
occurring amino acids. Naturally occurring amino acids are those
encoded by the genetic code, as well as those amino acids that are
later modified, e.g., hydroxyproline, .gamma.-carboxyglutamate, and
O-phosphoserine. Amino acid analogs refers to compounds that have
the same basic chemical structure as a naturally occurring amino
acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl
group, an amino group, and an R group, e.g., homoserine,
norleucine, methionine sulfoxide, methionine methyl sulfonium. Such
analogs have modified R groups (e.g., norleucine) or modified
peptide backbones, but retain the same basic chemical structure as
a naturally occurring amino acid. Amino acid mimetics refers to
chemical compounds that have a structure that is different from the
general chemical structure of an amino acid, but that functions in
a manner similar to a naturally occurring amino acid. The terms
"non-naturally occurring amino acid" and "unnatural amino acid"
refer to amino acid analogs, synthetic amino acids, and amino acid
mimetics which are not found in nature.
[0042] Amino acids may be referred to herein by either their
commonly known three letter symbols or by the one-letter symbols
recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
Nucleotides, likewise, may be referred to by their commonly
accepted single-letter codes.
[0043] "Conservatively modified variants" applies to both amino
acid and nucleic acid sequences. With respect to particular nucleic
acid sequences, conservatively modified variants refers to those
nucleic acids which encode identical or essentially identical amino
acid sequences, or where the nucleic acid does not encode an amino
acid sequence, to essentially identical sequences. Because of the
degeneracy of the genetic code, a large number of functionally
identical nucleic acids encode any given protein. For instance, the
codons GCA, GCC, GCG and GCU all encode the amino acid alanine.
Thus, at every position where an alanine is specified by a codon,
the codon can be altered to any of the corresponding codons
described without altering the encoded polypeptide. Such nucleic
acid variations are "silent variations," which are one species of
conservatively modified variations. Every nucleic acid sequence
herein which encodes a polypeptide also describes every possible
silent variation of the nucleic acid. One of skill will recognize
that each codon in a nucleic acid (except AUG, which is ordinarily
the only codon for methionine, and TGG, which is ordinarily the
only codon for tryptophan) can be modified to yield a functionally
identical molecule. Accordingly, each silent variation of a nucleic
acid which encodes a polypeptide is implicit in each described
sequence with respect to the expression product, but not with
respect to actual probe sequences.
[0044] The terms "identical" or percent "identity," in the context
of two or more nucleic acids or proteins, refer to two or more
sequences or subsequences that are the same or have a specified
percentage of nucleotides or amino acids that are the same (i.e.,
about 60% identity, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified
region, when compared and aligned for maximum correspondence over a
comparison window or designated region) as measured using a BLAST
or BLAST 2.0 sequence comparison algorithms with default parameters
described below, or by manual alignment and visual inspection. See
e.g., the NCBI web site at ncbi.nlm.nih.gov/BLAST. Such sequences
are then said to be "substantially identical." This definition also
refers to, or may be applied to, the compliment of a test sequence.
The definition also includes sequences that have deletions and/or
additions, as well as those that have substitutions. Identity
typically exists over a region that is at least about 50 amino
acids or nucleotides in length, or over a region that is 50-100
amino acids or nucleotides in length, or over the entire length of
a given sequence.
[0045] The term "gene" means the segment of DNA involved in
producing a protein; it includes regions preceding and following
the coding region (leader and trailer) as well as intervening
sequences (introns) between individual coding segments (exons). The
leader, the trailer as well as the introns include regulatory
elements that are necessary during the transcription and the
translation of a gene. Further, a "protein gene product" is a
protein expressed from a particular gene.
[0046] The word "expression" or "expressed" as used herein in
reference to a gene means the transcriptional and/or translational
product of that gene. The level of expression of a DNA molecule in
a cell may be determined on the basis of either the amount of
corresponding mRNA that is present within the cell or the amount of
protein encoded by that DNA produced by the cell (Sambrook et al.,
1989, Molecular Cloning: A Laboratory Manual, 18.1-18.88).
[0047] The term "recombinant" when used with reference, e.g., to a
cell, or nucleic acid, protein, or vector, indicates that the cell,
nucleic acid, protein or vector, has been modified by the
introduction of a heterologous nucleic acid or protein or the
alteration of a native nucleic acid or protein, or that the cell is
derived from a cell so modified. Thus, for example, recombinant
cells express genes that are not found within the native
(non-recombinant) form of the cell or express native genes that are
otherwise abnormally expressed, under expressed or not expressed at
all.
[0048] The term "heterologous" when used with reference to portions
of a nucleic acid or protein indicates that the nucleic acid or
protein comprises two or more subsequences that are not found in
the same relationship to each other in nature. For instance, the
nucleic acid is typically recombinantly produced, having two or
more sequences from unrelated genes arranged to make a new
functional nucleic acid, e.g., a promoter from one source and a
coding region from another source. Similarly, a heterologous
protein indicates that the protein comprises two or more
subsequences that are not found in the same relationship to each
other in nature (e.g., a fusion protein).
[0049] The term "exogenous" refers to a molecule or substance
(e.g., nucleic acid or protein) that originates from outside a
given cell or organism. Conversely, the term "endogenous" refers to
a molecule or substance that is native to, or originates within, a
given cell or organism.
[0050] A "vector" is a nucleic acid that is capable of transporting
another nucleic acid into a cell. A vector is capable of directing
expression of a protein or proteins encoded by one or more genes
carried by the vector when it is present in the appropriate
environment.
[0051] A "viral vector" is a viral-derived nucleic acid that is
capable of transporting another nucleic acid into a cell. A viral
vector is capable of directing expression of a protein or proteins
encoded by one or more genes carried by the vector when it is
present in the appropriate environment. Examples for viral vectors
include, but are not limited to retroviral, adenoviral, lentiviral
and adeno-associated viral vectors.
[0052] A "cell culture" is an in vitro population of cells residing
outside of an organism. The cell culture can be established from
primary cells isolated from a cell bank or animal, or secondary
cells that are derived from one of these sources and immortalized
for long-term in vitro cultures.
[0053] The terms "culture," "culturing," "grow," "growing,"
"maintain," "maintaining," "expand," "expanding," etc., when
referring to cell culture itself or the process of culturing, can
be used interchangeably to mean that a cell is maintained outside
the body (e.g., ex vivo) under conditions suitable for survival.
Cultured cells are allowed to survive, and culturing can result in
cell growth, differentiation, or division. The term does not imply
that all cells in the culture survive or grow or divide, as some
may naturally sense, etc. Cells are typically cultured in media,
which can be changed during the course of the culture.
[0054] The terms "media" and "culture solution" refer to the cell
culture milieu. Media is typically an isotonic solution, and can be
liquid, gelatinous, or semi-solid, e.g., to provide a matrix for
cell adhesion or support. Media, as used herein, can include the
components for nutritional, chemical, and structural support
necessary for culturing a cell.
[0055] The term "derived from," when referring to cells or a
biological sample, indicates that the cell or sample was obtained
from the stated source at some point in time. For example, a cell
derived from an individual can represent a primary cell obtained
directly from the individual (i.e., unmodified), or can be
modified, e.g., by introduction of a recombinant vector, by
culturing under particular conditions, or immortalization. In some
cases, a cell derived from a given source will undergo cell
division and/or differentiation such that the original cell is no
longer exists, but the continuing cells will be understood to
derive from the same source.
[0056] The term "transfection" or "transfecting" is defined as a
process of introducing a nucleic acid molecule to a cell using
non-viral or viral-based methods. The nucleic acid molecule can be
a sequence encoding complete proteins or functional portions
thereof. Typically, a nucleic acid vector, comprising the elements
necessary for protein expression (e.g., a promoter, transcription
start site, etc.). Non-viral methods of transfection include any
appropriate transfection method that does not use viral DNA or
viral particles as a delivery system to introduce the nucleic acid
molecule into the cell. Exemplary non-viral transfection methods
include calcium phosphate transfection, liposomal transfection,
nucleofection, sonoporation, transfection through heat shock,
magnification and electroporation. For viral-based methods, any
useful viral vector can be used in the methods described herein.
Examples of viral vectors include, but are not limited to
retroviral, adenoviral, lentiviral and adeno-associated viral
vectors. In some aspects, the nucleic acid molecules are introduced
into a cell using a retroviral vector following standard procedures
well known in the art.
[0057] Expression of a transfected gene can occur transiently or
stably in a host cell. During "transient expression" the
transfected nucleic acid is not integrated into the host cell
genome, and is not transferred to the daughter cell during cell
division. Since its expression is restricted to the transfected
cell, expression of the gene is lost over time. In contrast, stable
expression of a transfected gene can occur when the gene is
co-transfected with another gene that confers a selection advantage
to the transfected cell. Such a selection advantage may be a
resistance towards a certain toxin that is presented to the cell.
Expression of a transfected gene can further be accomplished by
transposon-mediated insertion into to the host genome. During
transposon-mediated insertion, the gene is positioned in a
predictable manner between two transposon linker sequences that
allow insertion into the host genome as well as subsequent
excision.
[0058] The terms "inhibitor," "repressor" or "antagonist" or
"downregulator" interchangeably refer to a substance that results
in a detectably lower expression or activity level as compared to a
control. The inhibited expression or activity can be 10%, 20%, 30%,
40%, 50%, 60%, 70%, 80%, 90% or less than that in a control. In
certain instances, the inhibition is 1.5-fold, 2-fold, 3-fold,
4-fold, 5-fold, 10-fold, or more in comparison to a control.
[0059] The terms "therapy," "treatment," and "amelioration" refer
to any reduction in the severity of symptoms, e.g., of a
neurodegenerative disorder or neuronal injury. As used herein, the
terms "treat" and "prevent" are not intended to be absolute terms.
Treatment can refer to any delay in onset, amelioration of
symptoms, improvement in patient survival, increase in survival
time or rate, etc. The effect of treatment can be compared to an
individual or pool of individuals not receiving the treatment, or
to the same patient prior to treatment or at a different time
during treatment. In some aspects, the severity of disease is
reduced by at least 10%, as compared, e.g., to the individual
before administration or to a control individual not undergoing
treatment. In some aspects the severity of disease is reduced by at
least 25%, 50%, 75%, 80%, or 90%, or in some cases, no longer
detectable using standard diagnostic techniques.
[0060] The term "therapeutically effective amount," as used herein,
refers to that amount of the therapeutic agent sufficient to
ameliorate a given disorder or symptoms. For example, for the given
parameter, a therapeutically effective amount will show an increase
or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%,
80%, 90%, or at least 100%. Therapeutic efficacy can also be
expressed as "-fold" increase or decrease. For example, a
therapeutically effective amount can have at least a 1.2-fold,
1.5-fold, 2-fold, 5-fold, or more effect over a control.
[0061] "Subject," "patient," "individual in need of treatment" and
like terms are used interchangeably and refer to, except where
indicated, mammals such as humans and non-human primates, as well
as rabbits, rats, mice, goats, pigs, and other mammalian species.
The term does not necessarily indicate that the subject has been
diagnosed with a particular disease, but typically refers to an
individual under medical supervision.
Methods of Modulating Cardiomyocyte Proliferation
[0062] Provided herein are methods of modulating proliferation of a
cardiomyocyte using micro RNA modulators. A micro RNA modulator as
used herein refers to an agent capable of modulating the level of
expression of a micro RNA (e.g. let-7a, mir 100). In some
embodiments, the micro RNA modulator is encoded by a nucleic acid.
In other embodiments, the micro RNA modulator is a small molecule
(e.g. a chemical compound, synthetic micro RNA molecule). In some
embodiments, the micro RNA modulator decreases the level of
expression of a micro RNA compared to the level of expression in
the absence of the micro RNA modulator. Where the micro RNA
modulator decreases the level of expression of a micro RNA relative
to the absence of the modulator, the micro RNA modulator is an
antagonist of said micro RNA. In other embodiments, the micro RNA
modulator increases the level expression of a micro RNA compared to
the level of expression in the absence of the micro RNA modulator.
Where the micro RNA modulator increases the level of expression of
a micro RNA relative to the absence of the modulator, the micro RNA
modulator is an agonist of the micro RNA.
[0063] In one aspect, a method of modulating proliferation of a
cardiomyocyte is provided. The method includes (i) transfecting a
cardiomyocyte with a nucleic acid encoding a micro RNA modulator,
thereby forming a transfected cardiomyocyte; and (ii) allowing the
transfected cardiomyocyte to divide, thereby modulating
proliferation of the cardiomyocyte. In some embodiments, the
nucleic acid is a lentiviral vector. In embodiments, the nucleic
acid includes a nucleic acid sequence as set forth in SEQ ID
NO:1124 or SEQ ID NO:1125. In some embodiments, the nucleic acid is
a lentiviral vector. In embodiments, the nucleic acid includes a
nucleic acid sequence as set forth in SEQ ID NO:1124 and SEQ ID
NO:1125. In embodiments, the nucleic acid includes a nucleic acid
sequence as set forth in SEQ ID NO:1124. In embodiments, the
nucleic acid includes a nucleic acid sequence as set forth in SEQ
ID NO:1125. In embodiments, the nucleic acid has the sequence as
set forth in SEQ ID NO:1124 or SEQ ID NO:1125. In embodiments, the
nucleic acid has the sequence as set forth in SEQ ID NO:1124. In
embodiments, the nucleic acid has the sequence as set forth in SEQ
ID NO:1125.
[0064] In other embodiments, the micro RNA modulator is an
antagonist of a mir 99 micro RNA, a let-7a micro RNA, a mir 100
micro RNA, a mir 4458 micro RNA, a mir 4500 micro RNA or a mir 89
micro RNA. In some embodiments, the proliferation of the
cardiomyocyte is increased compared to a control cardiomyocyte
lacking the nucleic acid encoding said RNA modulator. In some
embodiments, the micro RNA modulator is an agonist of a mir 99
micro RNA, a let-7a micro RNA, a mir 100 micro RNA, a mir 4458
micro RNA, a mir 4500 micro RNA or a mir 89 micro RNA.
[0065] In another aspect, a method of modulating proliferation of a
cardiomyocyte is provided. The method includes (i) contacting a
cardiomyocyte with a small molecule, thereby forming a treated
cardiomyocyte; and (ii) allowing the treated cardiomyocyte to
divide, thereby modulating proliferation of the cardiomyocyte. In
some embodiments, the proliferation of the cardiomyocyte is
increased compared to a control cardiomyocyte lacking the small
molecule. In some further embodiment, the small molecule modulates
expression of a mir 99 micro RNA-regulated protein, a let-7a micro
RNA-regulated protein, a mir 100 micro RNA-regulated protein, a mir
4458 micro RNA-regulated protein, a mir 4500 micro RNA-regulated
protein or a mir 89 micro RNA-regulated protein. In other
embodiments, the small molecule is a chemical compound. In some
embodiments, the small molecule is a synthetic micro RNA molecule.
In embodiments, the synthetic micro RNA molecule includes a nucleic
acid sequence as set forth in SEQ ID NO:1124 or SEQ ID NO:1125. In
embodiments, the synthetic micro RNA molecule includes a nucleic
acid sequence as set forth in SEQ ID NO:1124 and SEQ ID NO:1125. In
embodiments, the synthetic micro RNA molecule includes a nucleic
acid sequence as set forth in SEQ ID NO:1124. In embodiments, the
synthetic micro RNA molecule includes a nucleic acid sequence as
set forth in SEQ ID NO:1125. In embodiments, the synthetic micro
RNA molecule has a nucleic acid sequence as set forth in SEQ ID
NO:1124. In embodiments, the synthetic micro RNA molecule has a
nucleic acid sequence as set forth in SEQ ID NO:1125.
[0066] In other embodiments, the proliferation of the cardiomyocyte
is increased compared to a control cardiomyocyte lacking the
synthetic micro RNA molecule. In some embodiments, the synthetic
micro RNA molecule is an antagonist of a mir 99 micro RNA, a let-7a
micro RNA, a mir 100 micro RNA, a mir 4458 micro RNA, a mir 4500
micro RNA or a mir 89 micro RNA. In other embodiments, the
synthetic micro RNA molecule is an agonist of a mir 99 micro RNA, a
let-7a micro RNA, a mir 100 micro RNA, a mir 4458 micro RNA, a mir
4500 micro RNA or a mir 89 micro RNA.
[0067] In another aspect, a method of treating myocardial
infarction in a subject in need thereof is provided. The method
includes administering to the subject a therapeutically effective
amount of a nucleic acid encoding a micro RNA modulator, wherein
the RNA modulator increases cardiomyocyte proliferation thereby
treating the myocardial infarction. In some embodiments, the micro
RNA modulator is an antagonist of a mir 99 micro RNA, a let-7a
micro RNA, a mir 100 micro RNA, a mir 4458 micro RNA, a mir 4500
micro RNA or a mir 89 micro RNA. In embodiments, the micro RNA
modulator is an antagonist of a mir 99 micro RNA and an antagonist
of a let-7a micro RNA. In embodiments, the nucleic acid includes a
nucleic acid sequence as set forth in SEQ ID NO:1124 or SEQ ID
NO:1125. In embodiments, the nucleic acid includes a nucleic acid
sequence as set forth in SEQ ID NO:1124. In embodiments, the
nucleic acid includes a nucleic acid sequence as set forth in SEQ
ID NO:1125. In embodiments, the nucleic acid includes a nucleic
acid sequence as set forth in SEQ ID NO:1124 and SEQ ID
NO:1125.
[0068] In embodiments, the method includes administering to the
subject a therapeutically effective amount of a first nucleic acid
and a second nucleic acid, wherein the first nucleic acid encodes
an antagonist of a mir 99 micro RNA and the second nucleic acid
encodes an antagonist of a let-7a micro RNA. In embodiments, the
administering to the subject a therapeutically effective amount of
a nucleic acid includes administering a first nucleic acid and a
second nucleic acid, wherein the first nucleic acid encodes an
antagonist of a mir 99 micro RNA and the second nucleic acid
encodes an antagonist of a let-7a micro RNA.
[0069] In another aspect, a method of treating myocardial
infarction in a subject in need thereof is provided. The method
includes administering to the subject a therapeutically effective
amount of a nucleic acid encoding an antagonist of a mir 99 micro
RNA and a nucleic acid encoding an antagonist of a let-7a micro
RNA, thereby treating the myocardial infarction.
[0070] In another aspect, a method of treating myocardial
infarction in a subject in need thereof is provided. The method
includes administering to the subject a therapeutically effective
amount of a small molecule, wherein the small molecule increases
cardiomyocyte proliferation thereby treating the myocardial
infarction. In some embodiments, the small molecule modulates
expression of a mir 99 micro RNA-regulated protein, a let-7a micro
RNA-regulated protein, a mir 100 micro RNA-regulated protein, a mir
4458 micro RNA-regulated protein, a mir 4500 micro RNA-regulated
protein or a mir 89 micro RNA-regulated protein. In embodiments,
the small molecule modulates expression of a mir 99 micro
RNA-regulated protein and a let-7a micro RNA-regulated protein. In
some other embodiments, the small molecule is a chemical compound.
In other embodiments, the small molecule is a synthetic micro RNA
molecule. In embodiments, the synthetic micro RNA molecule includes
a nucleic acid sequence as set forth by SEQ ID NO:1124 or SEQ ID
NO:1125. In embodiments, the synthetic micro RNA molecule includes
a nucleic acid sequence as set forth by SEQ ID NO:1124 and SEQ ID
NO:1125. In embodiments, the synthetic micro RNA molecule includes
a nucleic acid sequence as set forth by SEQ ID NO:1124. In
embodiments, the synthetic micro RNA molecule includes a nucleic
acid sequence as set forth by SEQ ID NO:1125. In some embodiments,
the synthetic micro RNA molecule is an antagonist of a mir 99 micro
RNA, a let-7a micro RNA, a mir 100 micro RNA, a mir 4458 micro RNA,
a mir 4500 micro RNA or a mir 89 micro RNA.
EXAMPLES
[0071] Heart failure remains one of the leading causes of mortality
in the developed world. Whereas the mammalian heart is endowed with
certain regenerative potential, endogenous cardiomyocyte
proliferation is insufficient for functional heart repair upon
injury. Interestingly, non-mammalian vertebrates, such as the
zebrafish, can regenerate the damaged heart by inducing
cardiomyocyte dedifferentiation and proliferation. By screening
regenerating zebrafish hearts Applicants identified miR-99/100
down-regulation as a key process driving cardiomyocyte
dedifferentiation. Experimental down-regulation of miR-99/100 in
primary adult murine and human cardiomyocytes led to an increase in
the number of proliferating cardiomyocytes. AAV-mediated in vivo
down-regulation of miR-99/100 after acute myocardial injury in mice
induced mature cardiomyocyte proliferation, diminished infarct size
and improved heart function. Applicants' study unveils conserved
regenerative mechanisms between zebrafish and mammalian
cardiomyocytes and represents a proof-of-concept on the suitability
of activating pro-regenerative responses for healing the diseased
mammalian heart.
[0072] Cardiovascular disease remains the leading cause of
mortality in the developed world. Attempts at developing curative
strategies have mainly focused on the activation of endogenous
cardiac progenitor cells and the transplantation of in
vitro-derived cardiomyocytes (A. Aguirre et al., Cell Stem Cell 12,
275-284 (2013); S. R. Braam et al., Trends in pharmacological
sciences 30, 536-45 (2009)). More recently, in vivo reprogramming
strategies have emerged as potential treatments for heart failure
(L. Qian et al., Nature (2012), doi:10.1038/nature11044; K. Song et
al., Nature 485, 599-604 (2012) A. Eulalio et al., Nature (2012),
doi:10.1038/nature11739). Along this line, a recent report by
Porrello et al. has highlighted a remarkable regenerative capacity
in neonatal murine hearts upon injury (E. R. Porrello et al.,
Science (New York, N.Y.) 331, 1078-80 (2011)). Although adult
mammalian cardiomyocytes retain a certain ability to proliferate
(S. E. Senyo et al., Nature, 2-6 (2012)), endogenous regenerative
responses during adulthood are largely insufficient for
replenishing the lost cardiac tissue. Noticeably, heart repair can
be induced upon manipulation of miRNA pathways identified as
drivers of cardiomyocyte proliferation in neonatal murine models
(A. Eulalio et al., Nature (2012), doi:10.1038/nature11739L; E. R.
Porrello et al., Circulation research 109, 670-9 (2011)). This may
suggest that the mechanisms underlying heart regeneration at birth
are still present, yet dormant and/or repressed, in adult murine
hearts. Other vertebrates, such as the zebrafish, are able,
throughout their entire lifetime, to activate endogenous
regenerative responses that lead to complete cardiomyocyte-mediated
heart regeneration similar to that observed in neonatal mice (R.
Zhang et al., Nature (2013), doi:10.1038/nature12322; K. D. Poss et
al., Science (New York, N.Y.) 298, 2188-90 (2002); A. Raya et al.,
Proceedings of the National Academy of Sciences of the United
States of America 100 Suppl, 11889-95 (2003); C. Jopling et al.,
Nature 464, 606-9 (2010); K. Kikuchi et al., Nature 464, 601-5
(2010)). Together, these observations led us to hypothesize on the
existence of conserved pro-regenerative pathways between zebrafish
and mammals (A. W. Seifert et al., Nature 489, 561-5 (2012)), and
if present, whether they could be altered to drive terminally
differentiated mammalian cardiomyocytes to a regeneration-competent
state.
[0073] To first elucidate the presence of conserved regulatory
pathways underlying regeneration Applicants decided to focus on
microRNAs promoting cardiomyocyte dedifferentiation in the
zebrafish. Expression of 90 microRNAs was significantly changed 3
days post amputation (dpa) of the ventricular apex (FIG. 5A).
Bioinformatic analysis of signaling pathways and GO processes
indicated significant enrichment in proliferation pathways, as well
as processes related to chromatin remodeling (S. L. Paige et al.,
Cell 151, 221-32 (2012)), morphogenesis and kinase activity (FIG.
5B). Interestingly, two well-defined down-regulated microRNA
clusters (miR-99/Let-7a and miR-100/Let-7c) were highly conserved
in sequence and genomic organization across different vertebrates
(FIG. 5C). Putative protein targets were also shared between
zebrafish and mammals (Table S1 and Table S2). Further expression
analysis demonstrated a significant down-regulation of miR-99/100
and Let-7a/c during the early regenerative stages (3-7 dpa) (FIG.
1A) in agreement with previous reports (C. Jopling et al., Nature
464, 606-9 (2010)). Noticeably, miR-99/100 and Let-7a/c expression
(data not shown) was high and confined to cardiomyocytes in
uninjured hearts, and almost undetectable upon injury (FIGS. 1, B
and C and FIG. 6). microRNA target prediction highlighted two
proteins specifically expressed in the regenerating zebrafish
heart, Fnt.beta. (beta subunit of farnesyl-transferase) and Smarca5
(SWI/SNF-related matrix associated actin-dependent regulator of
chromatin subfamily a, member 5) (FIGS. 1, B to D and FIG. 6).
Binding experiments confirmed miRNA targeting of the 3'UTRs in both
human and zebrafish Fnt.beta. and Smarca5 (a C. Mueller et al.,
2H., Oncogene, 1-9 (2012)) (FIG. 7). Accompanying Fnt.beta.
up-regulation, the structural subunit of fnt (Fnt.alpha.) was also
expressed during heart regeneration (FIG. 8). Chemical inhibition
of fnt with the specific antagonist tipifarnib significantly
impaired heart regeneration by decreasing the number of
proliferating cardiomyocytes (FIG. 1, E to G). Taken together,
these data suggest that targets downstream of miR-99/100 play a
functional role during heart regeneration.
[0074] Since regeneration might be considered to a large extent
redolent of development (J. P. Brockes, A. Kumar, Annual review of
cell and developmental biology 24, 525-49 (2008); J. L. Whited, C.
J. Tabin, 2-4 (2010); D. Knapp, E. M. Tanaka, Current Opinion in
Genetics & Development (2012), doi:10.1016/j.gde.2012.09.006)
Applicants next decided to investigate the role of miR-99/100 and
their target proteins Fnt.beta. and Smarca5 during zebrafish heart
development and maturation. qRT-PCR and immunofluorescence analyses
demonstrated low levels of miR-99/100 expression during early heart
development concomitantly with high levels of Smarca5 and Fnt.beta.
(FIG. 9). Functional analyses by injection of miR-99/100 mimics,
and/or fnt.beta./smarca5 translation-blocking morpholinos in
one-cell stage cm1c2:GFP transgenic fish embryos resulted in a
significantly reduced ventricle size in spite of the presence of
apparently normal heart anatomical structures (ventricle, atrium,
valve) (FIG. 1, H to J). To determine if cardiomyocytes showing
up-regulation of Fnt.beta. and Smarca5 progress into a
proliferative state, Applicants analyzed the expression of nuclear
proliferative markers at different time points post-amputation
(FIG. 2, A to D). In all cases high levels of Fnt.beta. and Smarca5
correlated with PCNA and/or H3P expression in the nucleus.
Concomitantly, disorganized sarcomeric structures were particularly
evident at 7 dpa (FIGS. 2, A and B). miR-99/100 expression levels,
and their respective protein targets, returned to basal levels when
regeneration of the ventricle was mostly complete at 30 dpa (FIGS.
10, A and B). Next, Applicants designed a series of in vivo
experiments to exogenously manipulate miR-99/100 levels with mimics
and antagomiRs in adult regenerating animals (FIGS. 10, C and D).
Intra-cardiac injection of miR-99/100 mimics efficiently blocked
the regenerative response in all animals tested (FIGS. 2, E and F)
and BrdU incorporation confirmed that cardiomyocyte proliferation
was significantly disrupted in mimic-treated animals (FIG. 2G).
Conversely, microRNA inhibition of size-matched sibling fish led to
significantly enlarged hearts (FIGS. 2, H and I). Histological
analysis indicated cardiomyocyte proliferation in the absence of
cardiac hypertrophy (FIG. 2J), suggesting hyperplasia as the
underlying mechanism of action of miRNA-99/100. Applicants next
decided to study the downstream signaling mechanisms of miR-99/100
and Let-7a/c. Applicants detected increased farnesylation as a
consequence of fnt activity in regenerating hearts at 3 and 7 dpa
(FIG. 11). Ras family proteins, targets of fnt, appeared
up-regulated and preferentially located to the cell membrane (FIG.
12, A to C). Similarly, c-Myc, a transcription factor essential for
cellular proliferation downstream of this pathway, was
significantly up-regulated and localized to the cell nucleus in
dedifferentiating cardiomyocytes (FIG. 12, D to F). Interestingly,
Cbx5 and Cbx3a, chromatin-remodeling proteins critical in
proliferating cardiomyocytes (J. K. Takeuchi et al., Nature
communications 2, 187 (2011); N. Collins et al., Nature genetics
32, 627-32 (2002); S. H. Kwon, J. L. Workman, BioEssays: news and
reviews in molecular, cellular and developmental biology 33, 280-9
(2011)), demonstrated enhanced expression at 7 dpa, when Smarca5
levels in the nucleus were highest (FIG. 13). Taken together,
Applicants' results indicate that miR-99/100 down-regulation plays
a role, possibly by chromatin remodeling, in the dedifferentiation
process that leads to zebrafish heart regeneration (FIG. 14).
[0075] In light of the evolutionary conservation of their
structures and downstream signaling pathways, Applicants wondered
whether microRNA-99/100 and Let-7a/c functions would be similar
between mammals and zebrafish. To this end, Applicants first
analyzed microRNA-99/100 and FNT.beta./SMARCA5 expression in
developing and adult murine hearts. qRT-PCR and immunofluorescence
analyses highlighted a progressive up-regulation of microRNA-99/100
paralleling cardiac maturation and FNT.beta./SMARCA5
down-regulation (FIGS. 3, A and B and FIG. 15). Analyses of human
cardiomyocytes at progressive differentiation stages, including
adult heart samples, demonstrated a peak in miR-99/100 expression
in adult mature human cardiomyocytes, a point at which
FNT.beta./SMARCA5 expression was undetectable (FIGS. 3, C and D).
hESC-derived immature proliferative cardiomyocytes (hiCM) expressed
GATA4 (a cardiac progenitor marker), FNT.beta., SMARCA5 and
intermediate-low levels of the identified miRNAs (FIG. 16)
resembling a regenerative, proliferative state as described before
(K. Kikuchi et al., Nature 464, 601-5 (2010), C. Jopling et al.,
Nature reviews. Molecular cell biology 12, 79-89 (2011)).
[0076] Applicants next sought to evaluate the effects of microRNA
down-regulation in adult murine cardiomyocytes. Seven days after
shRNA-mediated microRNA silencing significant up-regulation of
SMARCA5 and FNT.beta. was observed accompanied by an increased
amount of cardiomyocytes with disorganized sarcomeric structures
and immature morphology (FIGS. 3, E and F and FIG. 17, A to C).
Further analysis demonstrated enhanced proliferation paralleling
GATA4 and PCNA re-expression (FIG. 3, E to G and FIG. 17). These
effects were more pronounced when miR-99/100 and Let-7a/c were
simultaneously blocked (FIG. 3G and FIG. 17). Similarly, microRNA
silencing in human cardiomyocytes resulted in increased
proliferation and higher numbers of beating colonies (FIGS. 3, G
and H and Videos 1 to 5). Functional analyses demonstrated minimal
changes in the beating rate before and after anti-miR delivery
(FIG. 17D). Indicative of cardiomyocyte specificity, microRNA
down-regulation did not affect proliferation or FNT.beta./SMARCA5
expression in human fibroblasts or vascular cells (FIG. 18).
Organotypic cultures of adult murine hearts, a setting more closely
resembling physiological conditions (M. Brandenburger et al.,
Cardiovascular research 93, 50-9 (2012)), demonstrated low to
undetectable levels of FNT.beta./SMARCA5 (FIG. 19). Delivery of
anti-miR-99/100 and/or anti-miR-Let-7 to murine heart organotypic
slices resulted in cardiomyocyte proliferation as demonstrated by
down-regulation of MyHC as well as re-expression of GATA4 and H3
phosporylation (FIG. 19). Ultrastructural electron microscopy
analysis confirmed cytoskeletal disassembly (FIG. 4A). Further
supporting these observations, Connexin 43 (Cx43), an essential
component of coupling GAP junctions in cardiomyocytes, was
profoundly down-regulated (FIG. 19). Next, Applicants mimicked
tissue ischemia and heart damage in organotypic slices to determine
the effects of the treatment upon injury (FIG. 20A). Control
organotypic slices developed necrotic areas accompanied by marginal
proliferation under hypoxic conditions whereas anti-microRNA
delivery resulted in reduced necrosis (FIG. 20B to D) and the
appearance of proliferative cardiomyocyte populations (FIG. 4B and
FIG. 20D).
[0077] Lastly, Applicants decided to test the efficacy of
anti-microRNA delivery for the induction of regeneration in a
murine model of myocardial infarction. Following LAD artery
ligation, anti-miR-99/100 and anti-Let-7 were administered by
injection of serotype 9 adeno-associated viral (AAV) particles,
specifically targeting the cardiomyocyte population, in the
periphery of the infarcted area. 18 days after treatment, both
ejection fraction and fractional shortening significantly improved
in the treated group (FIG. 4, C to F). Reduced fibrotic scarring
and infarct sizes were readily observed three weeks after LAD
artery ligation, indicative of an underlying regenerative response
(FIG. 4G). Treated animals exhibited increased numbers of
FNT.beta./SMARCA5 positive cardiomyocytes, as well as a marked
increase of cardiomyoctes re-expressing GATA4. PCNA and H3P
staining demonstrated increased DNA synthesis and cardiomyocyte
mitosis (FIG. 4, H to L). Of note, the number of mitotic
cardiomyocytes was higher in areas of trabeculated muscle as
opposed to the myocardium proper. Taken together, all these
observations indicate that anti-miR delivery in adult murine
cardiomyocytes suffices for the induction of a pro-regenerative
proliferative response towards repairing a damaged heart.
[0078] These observations constitute a proof-of-concept on how
animal models naturally capable of regeneration can be used for the
identification of regenerative factors that may, subsequently, be
applied to mammals. Experimental manipulation of conserved
microRNAs unveiled during adult zebrafish heart regeneration led to
similar responses in mice after heart infarction (replenishment of
the lost cardiac tissue and inhibition of scar formation). In vivo
activation of conserved cardiac regenerative responses may help to
circumvent many of the problems associated with heart cell
transplantation as well as those associated with reprogramming
technologies (A. Aguirre et al., Cell Stem Cell 12, 275-284 (2013),
M. a. Laflamme, C. E. Murry, Nature 473, 326-335 (2011)), serving
as an additional tool to the clinical armamentarium of regenerative
medicine towards the treatment of human heart disease (K. R. Chien
et al., Journal of molecular and cellular cardiology 53, 311-3
(2012)).
Experimental Procedures
[0079] Detailed experimental procedures can be found in
Supplementary information.
[0080] Animals. Wild-type zebrafish (AB) and cm1c2:GFP were
maintained at 28.5.degree. C. by standard methods, unless otherwise
indicated. All protocols were previously approved and performed
under institutional guidelines.
[0081] Culture and isolation of adult mouse ventricular myocytes.
Wild-type mice (C57B6/J) were sacrificed and hearts were quickly
recovered and washed with ice-cold Ca.sup.2+-free ModifedTyrode's
Solution (MTS). Ventricles were dissected from the rest of the
heart and subjected to enzymatic digestion (Liberase DH, Roche) for
10-15 min in a spinner flask at 37 C under continuous agitation.
Afterwards cells were pelleted by short centrifugation, resuspended
in KB solution and cardiomyocytes were left to sediment by gravity,
thus greatly reducing the presence of other contaminating cell
types. Calcium was restore to 1 mM in a step-wise fashion in three
gradual steps and subsequently cardiomyocytes were centrifuged,
resuspended in culture medium (IMDM 5%, 1% Pen/Strep, 0.1 ng/ml
FGFb, 1 ng/ml TGF-.beta.3) and seeded in laminin-coated
tissue-culture plates. Cells were kept in culture for 1 week.
[0082] Lentiviral and AAV constructs. Anti-miR constructs,
miRZip-99/100 and miRZip-let7 (SBI), were used according to the
manufacturer instructions. As respective controls, the anti-miRs
were removed from the parent vector by digesting with BamH1 and
EcoR1, end filled and re-ligated. Lentiviruses were packaged by
transfecting in 293T cells followed by spinfection in the
respective mouse or human ES derived cardiomyocytes. AAVs were
generated as described before (Eulalio et al, 2012). Briefly, the
antimiR constructs contained in the miRZip vectors were excised and
ligated into pZacf-U6-luc-ZsGreen. Serotype 9 AAVs were packaged by
transfection of 293T cells with the appropriate plasmids.
[0083] Organotypic heart slice culture. Mice ventricles were washed
in cold Modified Tyrode's Solution, embedded in 4% low melting
point agarose and immediately cut into 300 .mu.m slices using a
vibratome (Leica). Heart slices were then maintained in complete
IMDM 5%, 1% Pent/Strep in 12-well plates at the medium-air
interface using 0.4 .mu.m membrane transwells (Corning) at 37 C in
a 5% CO.sub.2 incubator. For experimental hypoxia-like conditions,
slices were kept in a hypoxia chamber incubator for 4 hours at 37
C, 5% O.sub.2. Lentiviral transduction was performed by immersion
of the slices in virus-containing medium for 24 h.
[0084] Myocardial infarction. Myocardial infarction was induced CD1
mice (8-12 weeks old) by permanent left anterior descending (LAD)
coronary artery ligation. Briefly, mice were anesthetized with an
injection of ketamine and xylazine, intubated and placed on a
rodent ventilator. Body temperature was maintained at 37.degree. C.
on a heating pad. After removing the pericardium, a descending
branch of the LAD coronary artery was visualized with a
stereomicroscope and occluded with a nylon suture. Ligation was
confirmed by the whitening of a region of the left ventricle.
Recombinant AAV vectors, at a dose of 10.sup.11 viral genome
particles per animal, were injected immediately after LAD ligation
into the myocardium bordering the infarct zone (single injection),
using an insulin syringe with incorporated 30-gauge needle. Three
groups of animals were studied, receiving AAV9-control (shRNA-Luc),
AAV9-antimiR-99/100 or AAV9-anti-Let-7a/c. The chest was closed,
and the animals moved to a prone position until the occurrence of
spontaneous breathing. BrdU was administered intraperitoneally (500
.mu.g per animal) every 2 days, for a period of ten days.
Echocardiography analysis was performed at days 12, 30 and 60 after
infarction, as described below, and hearts were collected at 12
(n=6 animals per group) and 60 (n=10 animals per group) days after
infarction.
[0085] Echocardiography analysis. To evaluate left ventricular
function and dimensions, transthoracic two-dimensional
echocardiography was performed on mice sedated with 5% isoflurane
at 12, 30 and 60 days after myocardial infarction, using a Visual
Sonics Vevo 770 Ultrasound (Visual Sonics) equipped with a 30-MHz
linear array transducer. M-mode tracings in parasternal short axis
view were used to measure left ventricular anterior and posterior
wall thickness and left ventricular internal diameter at
end-systole and end-diastole, which were used to calculate left
ventricular fractional shortening and ejection fraction.
[0086] Heart collection and histological analysis. At the end of
the studies, animals were anaesthetized with 5% isoflurane and then
killed by injection of 10% KCl, to stop the heart at diastole. The
heart was excised, briefly washed in PBS, weighted, fixed in 10%
formalin at room temperature, embedded in paraffin and further
processed for histology or immunofluorescence. Haematoxylin--eosin
and Masson's trichrome staining were performed according to
standard procedures, and analysed for regular morphology and extent
of fibrosis. Infarct size was measured as the percentage of the
total left ventricular area showing fibrosis.
[0087] Zebrafish heart amputation. Adult fish were anaesthetized in
0.4% Tricaine and secured, ventral side uppermost, in a slotted
sponge. Watchmaker forceps were used to remove the surface scales
and penetrate the skin, muscle and pericardial sac. Once exposed,
the ventricle was gently pulled at the apex and cut with iridectomy
scissors. After surgery, fish were immediately returned to system
water.
[0088] Cryosectioning. At the specified time points, hearts were
removed, washed in PBS-EDTA 0.4% and fixed for 20 min in 4%
paraformaldehyde at 4.degree. C. Afterwards, they were washed
several times in PBS, equilibrated in 30% sucrose, and then frozen
for cryosectioning. 10 tm slices were obtained with a cryostat
(Leica).
[0089] Real time RT-PCR. For RNA, tissue was obtained from adult
heart ventricles from different time points and conditions,
extensively washed in PBS-EDTA 0.4% to remove blood, and then
mechanically homogenized and processed using RNeasy kit (Qiagen) as
per manufacturer's instructions. RT and PCR were performed using
Quantitect Reverse Transcription Kit (Qiagen) and Quantitect
Primers for the following genes: Fntb, Fnta, Smarca5, myc-a, myc-b,
H-rasa, H-rasb, N-ras, K-ras, tnnt2. For miRNAs, small RNA (<200
pb) was obtained employing the miRNeasy mini kit (Qiagen) using the
same procedure as before. RT and PCR reactions were carried out
employing miRCURY LNA RT and PCR kits (Exiqon) and stem-loop LNA
primers (Exiqon).
[0090] MicroRNA microarrays. RNA was obtained as for PCR
applications. GenechipmiRNA 2.0 microarrays were purchased from
Affymetrix and small RNA labeling was performed using FlashTag HSR
labeling kit (Genesphere). 200 ng of small RNA was polyA-tailed and
biotin conjugated. After labelling, RNA was hybridized using
GeneChip reagents (Affymetrix) and protocols as indicated by the
manufacturer. The chip contains hybridization probes for the
miRbase v15 annotations, including 248 zebrafish miRNAs. MicroRNA
data was analyzed by using the R package.
[0091] Bioinformatic analysis of miRNA targets. Signaling pathways
and downstream target prediction related to the identified miRNAs
were determined by using DIANA, Miranda and TargetScan. Gene
ontology analysis was performed with DAVID software.
[0092] Fluorescence in situ hybridization. 10 .mu.m heart slices
were further fixed in 4% PFA for 10 min at room temperature, washed
in PBS and acetylated for 10 min in acetylation solution. After
washing in PBS, samples were treated with proteinase K,
prehybridized for 4 h and hybrydized overnight at the appropriate
temperature with LNA DIG-labeled probes for the corresponding
miRNAs (Exiqon). The next day slides were washed and immunolabeled
with anti-DIG-alkaline phosphatase antibodies (1:2,000) and
antibodies against cardiomyocytic proteins of interest (1:100)
overnight at 4.degree. C. Secondary antibody incubation was
performed as for immunofluorescence experiments. Alkaline
phosphatase activity was detected by incubating samples in a Fast
Red solution (Dako) for 2 hours. Samples were then washed, mounted
in Vecta-shield and imaged in a confocal microscope. Fast Red
fluorescence was detected with Cy3 settings.
[0093] Immunofluorescence. Tissue slices were fixed for 15 min in
4% paraformaldehyde, washed in PBS-gly 0.3 M, and blocked in
PBS-10% donkey serum, 0.5% TX-100, 0.5% BSA for 1 hour. Primary
antibodies were diluted at the appropriate concentrations in PBS-1%
donkey serum, 0.5% TX-100, 0.5% BSA and incubated overnight. After
washing, slices were incubated overnight with secondary antibodies,
washed and mounted in Vecta-shield. Antibodies employed are listed
in table S3.
[0094] Cell culture. COS7 cells were maintained in DMEM (high
glucose) supplemented with 10% FBS, L-Glutamine and non-essential
amino acids (Invitrogen). Human ES cells, H1 and H9 (WA1 and WA9,
WiCell), were cultured in chemically defined hES/hiPS growth media,
mTeSR1 on growth factor reduced matrigel (BD biosciences) coated
plates. Briefly, 70-80% confluent hES/iPS cells were treated with
dispase (Invitrogen) for 7 minutes at 37.degree. C. and the
colonies were dispersed to small clusters and lifted carefully
using a 5 ml glass pipette, at a ratio of .about.1:4.
[0095] Culture and isolation of adult mouse ventricular myocytes.
Wild-type mice (C57B6/J) were sacrificed and hearts were quickly
recovered and washed with ice-cold Ca.sup.2+-free ModifedTyrode's
Solution (MTS). Ventricles were dissected from the rest of the
heart and subjected to enzymatic digestion (Liberase DH, Roche) for
10-15 min in a spinner flask at 37 C under continuous agitation.
Afterwards cells were pelleted by short centrifugation, resuspended
in KB solution and cardiomyocytes were left to sediment by gravity,
thus greatly reducing the presence of other contaminating cell
types. Calcium was restore to 1 mM in a step-wise fashion in three
gradual steps and subsequently cardiomyocytes were centrifuged,
resuspended in culture medium (IMDM 5%, 1% Pen/Strep, 0.1 ng/ml
FGFb, 1 ng/ml TGF-.beta.3) and seeded in laminin-coated
tissue-culture plates. Cells were kept in culture for 1 week.
[0096] Differentiation of Human ES cells to immature
cardiomyocytes. Human ES cells grown on matrigel dots (BD
biosciences) were carefully dissociated using dispase and were
plated on low attachment plates in EB media (IMDM, 20% FBS, 2.25 nM
L-Glutamine and non-essential aminoacids). After 6 days of
suspension in culture, the EBs were seeded on gelatin-coated plates
in EB media. Spontaneously beating EBs were manually picked and
used for further analysis. For directed differentiation, human ES
cells grown in mTeSR on matrigel coated plates were treated with 12
.mu.M GSK3.beta. inhibitor CHIR 99021 (Stemgent) in cardiomyocyte
differentiation base media (RPMI 1640 supplemented with 125
.mu.g/ml human holo-transferrin (Sigma-Aldrich)) for 24 hours,
followed by 24 hour of rest in the base media. On day 3, the cells
were treated with 5 .mu.M WNT inhibitor, IWP4 (Stemgent) for 48
hours, followed by treatment with Cardiac differentiation base
media supplemented with 20 .mu.g/ml human Insulin (SAFC) until
colonies started beating.
[0097] Lentiviral constructs. Anti-miR constructs, miRZip-99/100
and miRZip-let7 (SBI), were used according to the manufacturer
instructions. As respective controls, the anti-miRs were removed
from the parent vector by digesting with BamH1 and EcoR1, end
filled and re-ligated. Lentiviruses were packaged by transfecting
in 293T cells followed by spinfection in the respective mouse or
human ES derived cardiomyocytes.
[0098] Luciferase constructs and microRNA binding validation. 3'
UTR of human and zebrafish FNTB and SMARCA5 were amplified with the
indicated primers using genomic DNA as a template and were cloned
into PGL3 vector (Promega) at the Xho1 site downstream of
luciferase gene. COS7 cells (seeded at 3.times.10.sup.4 cells per
well of a 12 well plate and grown for 24 hours) were transfected
with 50 ng each of indicated luciferase reporter vectors, pRL TK
(Renilla luciferase control vector, Promega) either in the presence
or absence of 20 nM or 40 nM of double stranded DNA oligonucleotide
mimics of miR-99 or miR-100 (Dharmacon) using Lipofectamine
(Invitrogen) following manufacturer's protocol. 12-16 hours
post-transfection, cells were lysed using passive lysis buffer
(Promega). Luminescent signals arising from the cell lysates
obtained 12 hours post transfection of COST cells with appropriate
luciferase constructs were measured using the Dual Luciferase assay
system (Promega) in a Synergy H1 hybrid reader (BioTek). The
relative luminescence intensity of each sample was calculated after
normalization with corresponding Renilla luciferase activity, and
were represented as % values compared to the corresponding sample
without the miR mimic.
[0099] Confocal microscopy. Samples were imaged using a Zeiss L710
confocal microscope. For every sample, at least two different
fields were examined at two different magnifications (using a
20.times. objective and a 63.times. oil-immersion objective).
Z-stacks were obtained for further analysis and 3D reconstruction.
For intensity comparison purposes, images were taken with the same
settings (pinhole size, laser intensity, etc).
[0100] Organotypic heart slice culture. Mice ventricles were washed
in cold Modified Tyrode's Solution, embedded in 4% low melting
point agarose and immediately cut into 300 .mu.m slices using a
vibratome (Leica). Heart slices were then maintained in complete
IMDM 5%, 1% Pent/Strep in 12-well plates at the medium-air
interface using 0.4 .mu.m membrane transwells (Corning) at 37 C in
a 5% CO.sub.2 incubator. For experimental hypoxia-like conditions,
slices were kept in a hypoxia chamber incubator for 4 hours at 37
C, 5% O.sub.2. Lentiviral transduction was performed by immersion
of the slices in virus-containing medium for 24 h.
[0101] Morpholino and microRNA injections in zebrafish embryos.
Morpholinos (Gene Tools) were dissolved in water at a 2 mM stock
concentration and diluted to a 2 ng/nl working concentration in
PBS/phenol red solution. Embryo injections were performed by
injecting .about.1 nl morpholino solution at the 1-cell stage using
a FemtoJet (Eppendorf). For microRNA mimic injection, a miR-99/100
equimolar mixture at 2 ng/nl in PBS was employed. Morphants were
evaluated at 24, 48 and 72 h in a StereoLumar stereoscope
(Zeiss).
[0102] In vivo microRNA delivery. MicroRNA siRNA mimics without
chemical modifications were purchased from Life Technologies,
dissolved in nuclease-free water and complexed to jetPEI (10 N/P
ratio) for in vivo, intra-cardiac administration. 0.2 .mu.g siRNA
was injected per animal every 2 days. To determine the efficiency
of the delivery, a control Cy5-labeled siRNA directed against GFP
was used in cm1c2:GFP animals. MicroRNA inhibitors against the
miR-99/100 family were purchased from Exiqon and used at 0.2
.mu.gsiRNA per animal every 2 days.
[0103] Tipifarnib injections. Tipifarnib was dissolved in DMSO at
10 mg/ml and 2 .mu.l were administered by intraperitoneal injection
(final concentration 0.02 mg/animal) every 2 days for 14 days.
Control animals were administered DMSO.
[0104] BrdU labeling. Fish were anaesthetized in 0.4% Tricaine, and
10 .mu.l of a 10 mg/ml solution of BrdU (in PBS) was injected into
the abdominal cavity once every 2 days for 14 days. At that point,
hearts were removed and fixed overnight in 4% paraformaldehyde at
4.degree. C., washed in PBS, equilibrated in 30% sucrose in PBS and
frozen for cryosectioning.
[0105] Histology and histomorphometry. Masson's trichrome staining
was performed in 10 .mu.m tissue slices by immersion in Bouin's
fixative followed by sequential incubation in Weigert'shematoxylin,
Acid Fuchsin, phosphotungstic/phosphomolybdic acid, Aniline Blue
and acetic acid. After washes, slices were mounted for bright field
observation. Histomorphometric measurements were performed with
Fiji. Injured areas were quantified in four independent different
slices per animal (four animals were used per condition) and
normalized to whole tissue area.
[0106] Statistical analysis. Results are expressed as mean.+-.SEM.
Statistical significance was determined by Student's t-test.
Results are representative of at least 3 independent experiments
except when otherwise indicated.
TABLE-US-00001 TABLE S1 miR-99/100 predicted targets SEQ Total
Target Representative ID Representative context + Aggregate
Publication gene transcript NO: Gene name miRNA score PCT (s) FGFR3
NM_000142 1 fibroblast growth hsa-miR-99a -0.47 <0.1 2005,
factor receptor 3 2007, 2009 IGF1R NM_000875 2 insulin-like growth
hsa-miR-100 -0.26 <0.1 2007, factor 1 receptor 2009 PPP3CA
NM_000944 3 protein phosphatase hsa-miR-99a -0.26 <0.1 2009 3,
catalytic subunit, alpha isozyme ZNF197 NM_001024855 4 zinc finger
protein hsa-miR-100 -0.65 <0.1 197 TTC39A NM_001080494 5
tetratricopeptide hsa-miR-99a -0.55 <0.1 2007, repeat domain 39A
2009 NXF1 NM_001081491 6 nuclear RNA export hsa-miR-100 -0.2 0.11
2009 factor 1 SMARCA4 NM_001128844 7 SWI/SNF related, hsa-miR-100
-0.26 0.11 matrix associated, actin dependent regulator of
chromatin, subfamily a, member 4 LRRC8B NM_001134476 8 leucine rich
repeat hsa-miR-99a -0.29 <0.1 containing 8 family, member B
EIF2C2 NM_001164623 9 eukaryotic translation hsa-miR-100 -0.4
<0.1 2005, initiation factor 2C, 2 2007, 2009 TMEM135
NM_001168724 10 transmembrane hsa-miR-100 -0.28 0.11 protein 135
CLDN11 NM_001185056 11 claudin 11 hsa-miR-100 -0.29 <0.1 2009
BMPR2 NM_001204 12 bone morphogenetic hsa-miR-100 -0.28 0.11 2005,
protein receptor, type 2007, II (serine/threonine 2009 kinase)
INSM1 NM_002196 13 insulinoma- hsa-miR-99a -0.25 <0.1 2005,
associated 1 2007 PPP1CB NM_002709 14 protein phosphatase
hsa-miR-100 -0.31 0.11 2009 1, catalytic subunit, beta isozyme FZD5
NM_003468 15 frizzled family hsa-miR-100 -0.3 <0.1 2007,
receptor 5 2009 SMARCA5 NM_003601 16 SWI/SNF related, hsa-miR-100
-0.45 <0.1 2005, matrix associated, 2007, actin dependent 2009
regulator of chromatin, subfamily a, member 5 PPFIA3 NM_003660 17
protein tyrosine hsa-miR-100 -0.3 0.11 2005, phosphatase, receptor
2007, type, f polypeptide 2009 (PTPRF), interacting protein
(liprin), alpha 3 MTOR NM_004958 18 mechanistic target of
hsa-miR-100 -0.38 <0.1 2005, rapamycin 2007, (serine/threonine
2009 kinase) ST5 NM_005418 19 suppression of hsa-miR-100 -0.33
<0.1 tumorigenicity 5 HOXA1 NM_005522 20 homeobox A1 hsa-miR-99a
-0.33 <0.1 2005, 2007, 2009 HS3ST3B1 NM_006041 21 heparan
sulfate hsa-miR-99a -0.59 <0.1 2005, (glucosamine) 3-O- 2007,
sulfotransferase 3B1 2009 HS3ST2 NM_006043 22 heparan sulfate
hsa-miR-100 -0.6 <0.1 2005, (glucosamine) 3-O- 2007,
sulfotransferase 2 2009 ICMT NM_012405 23 isoprenylcysteine
hsa-miR-99a -0.15 <0.1 2005, carboxyl 2007, methyltransferase
2009 BAZ2A NM_013449 24 bromodomain hsa-miR-100 -0.46 <0.1 2005,
adjacent to zinc 2007, finger domain, 2A 2009 ZZEF1 NM_015113 25
zinc finger, ZZ-type hsa-miR-100 -0.42 <0.1 2005, with EF-hand
2007, domain 1 2009 NIPBL NM_015384 26 Nipped-B homolog hsa-miR-99a
-0.3 0.11 (Drosophila) PI15 NM_015886 27 peptidase inhibitor
hsa-miR-99a -0.19 0.11 2009 15 ZBTB7A NM_015898 28 zinc finger and
BTB hsa-miR-100 -0.16 0.11 2007, domain containing 2009 7A PPPDE1
NM_016076 29 PPPDE peptidase hsa-miR-99a -0.26 0.11 2009 domain
containing 1 EPDR1 NM_017549 30 ependymin related hsa-miR-100 -0.69
<0.1 2009 protein 1 (zebrafish) RAVER2 NM_018211 31
ribonucleoprotein, hsa-miR-99a -0.44 <0.1 2007, PTB-binding 2
2009 CYP26B1 NM_019885 32 cytochrome P450, hsa-miR-100 -0.14
<0.1 2005, family 26, subfamily 2007, B, polypeptide 1 2009
TAOK1 NM_020791 33 TAO kinase 1 hsa-miR-100 -0.21 <0.1 MBNL1
NM_021038 34 muscleblind-like hsa-miR-99a -0.2 <0.1 2005,
(Drosophila) 2007, 2009 MTMR3 NM_021090 35 myotubularin related
hsa-miR-99a -0.18 <0.1 2005, protein 3 2007, 2009 ADCY1
NM_021116 36 adenylate cyclase 1 hsa-miR-99a -0.4 <0.1 2005,
(brain) 2007, 2009 RRAGD NM_021244 37 Ras-related GTP hsa-miR-100
-0.35 <0.1 binding D TRIB2 NM_021643 38 tribbles homolog 2
hsa-miR-100 -0.31 <0.1 2005, (Drosophila) 2007, 2009 CEP85
NM_022778 39 centrosomal protein hsa-miR-99a -0.29 0.11 2007, 85
kDa 2009 RMND5A NM_022780 40 required for meiotic hsa-miR-99a -0.15
0.11 nuclear division 5 homolog A (S. cerevisiae) THAP2 NM_031435
41 THAP domain hsa-miR-100 -0.64 0.11 2007, containing, apoptosis
2009 associated protein 2 FZD8 NM_031866 42 frizzled family
hsa-miR-100 -0.34 <0.1 2005, receptor 8 2007, 2009 KBTBD8
NM_032505 43 kelch repeat and hsa-miR-100 -0.6 <0.1 2007, BTB
(POZ) domain 2009 containing 8 SLC44A1 NM_080546 44 solute carrier
family hsa-miR-100 -0.31 <0.1 2007, 44, member 1 2009 ZNRF2
NM_147128 45 zinc and ring finger 2 hsa-miR-100 -0.24 0.11
ST6GALNAC4 NM_175039 46 ST6 (alpha-N-acetyl- hsa-miR-99a -0.56
<0.1 neuraminyl-2,3-beta- galactosyl-1,3)-N-
acetylgalactosaminide alpha-2,6- sialyltransferase 4 GRHL1
NM_198182 47 grainyhead-like 1 hsa-miR-99a -0.3 0.11 2009
(Drosophila)
TABLE-US-00002 TABLE S2 Let-7a/c predicted targets. SEQ Total
Target Representative ID Representative context + Aggregate
Publication gene transcript NO: Gene name miRNA score PCT (s) ADRB2
NM_000024 48 adrenergic, beta-2-, hsa-miR- -0.47 0.63 2005,
receptor, surface 4458 2007, 2009 ADRB3 NM_000025 49 adrenergic,
beta-3-, hsa-miR- -0.28 0.98 2005, receptor 4458 2007, 2009 FAS
NM_000043 50 Fas (TNF receptor hsa-miR-98 -0.32 0.85 2009
superfamily, member 6) ATP7B NM_000053 51 ATPase, Cu++ hsa-miR-
-0.09 0.93 2009 transporting, beta 4458 polypeptide CAPN3 NM_000070
52 calpain 3, (p94) hsa-miR- -0.15 0.92 2009 4458 CLCN5 NM_000084
53 chloride channel 5 hsa-let-7c -0.4 >0.99 2007, 2009 COL1A1
NM_000088 54 collagen, type I, alpha 1 hsa-miR- -0.18 0.89 2005,
4500 2007, 2009 COL1A2 NM_000089 55 collagen, type I, alpha 2
hsa-miR- -0.41 0.95 2005, 4500 2007, 2009 COL3A1 NM_000090 56
collagen, type III, hsa-miR- -0.37 0.92 2005, alpha 1 4458 2007,
2009 CYP19A1 NM_000103 57 cytochrome P450, hsa-let-7f -0.22 0.9
2005, family 19, subfamily 2007, A, polypeptide 1 2009 DMD
NM_000109 58 dystrophin hsa-let-7d -0.29 0.84 2005, 2007, 2009
ERCC6 NM_000124 59 excision repair cross- hsa-let-7d -0.46 0.95
2005, complementing 2007, rodent repair 2009 deficiency,
complementation group 6 GALC NM_000153 60 galactosylceramidase
hsa-miR- -0.27 0.93 2009 4458 GHR NM_000163 61 growth hormone
hsa-miR-98 -0.16 0.87 2005, receptor 2007, 2009 HK2 NM_000189 62
hexokinase 2 hsa-miR- -0.06 0.89 2005, 4500 2007, 2009 TBX5
NM_000192 63 T-box 5 hsa-miR- -0.16 0.94 2005, 4500 2007, 2009 INSR
NM_000208 64 insulin receptor hsa-let-7i -0.11 0.99 2007, 2009
ITGB3 NM_000212 65 integrin, beta 3 hsa-miR- -0.21 >0.99 2005,
(platelet glycoprotein 4458 2007, IIIa, antigen CD61) 2009 RB1
NM_000321 66 retinoblastoma 1 hsa-miR- -0.1 0.83 2005, 4500 2007,
2009 SCN5A NM_000335 67 sodium channel, hsa-miR- -0.04 0.95 2005,
voltage-gated, type V, 4458 2007, alpha subunit 2009 SGCD NM_000337
68 sarcoglycan, delta hsa-miR- >-0.02 0.7 2005, (35 kDa
dystrophin- 4458 2007, associated 2009 glycoprotein) TSC1 NM_000368
69 tuberous sclerosis 1 hsa-miR- -0.22 0.95 2005, 4458 2007, 2009
CDKN1A NM_000389 70 cyclin-dependent hsa-let-7i -0.24 0.76 2009
kinase inhibitor 1A (p21, Cip1) TPP1 NM_000391 71 tripeptidyl
peptidase I hsa-miR- -0.24 0.97 2009 4458 COL5A2 NM_000393 72
collagen, type V, hsa-miR- -0.16 0.95 2005, alpha 2 4458 2007, 2009
GALE NM_000403 73 UDP-galactose-4- hsa-miR- -0.28 0.91 2005,
epimerase 4458 2007, 2009 LOR NM_000427 74 loricrin hsa-let-7g
-0.27 0.88 2009 RAG1 NM_000448 75 recombination hsa-let-7a -0.17
0.76 2009 activating gene 1 AMT NM_000481 76 aminomethyltransferase
hsa-let-7a -0.29 0.82 2009 COL4A5 NM_000495 77 collagen, type IV,
hsa-miR- -0.14 0.91 2005, alpha 5 4500 2007, 2009 KCNJ11 NM_000525
78 potassium inwardly- hsa-let-7d -0.44 0.78 2009 rectifying
channel, subfamily J, member 11 TP53 NM_000546 79 tumor protein p53
hsa-let-7d -0.28 0.93 2009 DCX NM_000555 80 doublecortin hsa-let-7d
-0.05 0.87 2005, 2007 IL6R NM_000565 81 interleukin 6 receptor
hsa-miR- -0.16 0.94 4500 IL10 NM_000572 82 interleukin 10
hsa-let-7e -0.14 0.94 2005, 2007, 2009 IL6 NM_000600 83 interleukin
6 hsa-miR- -0.15 0.73 2007 (interferon, beta 2) 4500 IGF1 NM_000618
84 insulin-like growth hsa-let-7f -0.1 0.97 2009 factor 1
(somatomedin C) NOS1 NM_000620 85 nitric oxide synthase hsa-miR-
-0.11 0.95 1 (neuronal) 4458 FASLG NM_000639 86 Fas ligand (TNF
hsa-miR- -0.26 0.98 2005, superfamily, member 4458 2007, 6) 2009
ADRB1 NM_000684 87 adrenergic, beta-1-, hsa-miR- -0.25 0.98 2007,
receptor 4500 2009 CACNA1D NM_000720 88 calcium channel, hsa-let-7b
-0.07 0.88 2005, voltage-dependent, L 2007, type, alpha 1D 2009
subunit CACNA1E NM_000721 89 calcium channel, hsa-miR- -0.01 0.93
2005, voltage-dependent, R 4500 2007, type, alpha 1E subunit 2009
GABRA6 NM_000811 90 gamma-aminobutyric hsa-let-7d -0.16 0.84 2009
acid (GABA) A receptor, alpha 6 HTR1E NM_000865 91
5-hydroxytryptamine hsa-let-7d -0.27 0.89 2009 (serotonin) receptor
1E HTR4 NM_000870 92 5-hydroxytryptamine hsa-let-7a -0.12 0.94
2005, (serotonin) receptor 4 2007, 2009 IGF1R NM_000875 93
insulin-like growth hsa-let-7b -0.42 >0.99 2007, factor 1
receptor 2009 OPRM1 NM_000914 94 opioid receptor, mu 1 hsa-miR-
-0.2 0.92 2005, 4500 2007, 2009 PTAFR NM_000952 95
platelet-activating hsa-miR- -0.69 0.94 factor receptor 4500
NKIRAS2 NM_001001349 96 NFKB inhibitor hsa-miR- -0.09 0.88 2005,
interacting Ras-like 2 4458 2007, 2009 ATP2B4 NM_001001396 97
ATPase, Ca++ hsa-let-7f -0.05 0.93 2005, transporting, plasma 2007,
membrane 4 2009 RORC NM_001001523 98 RAR-related orphan hsa-miR-
-0.12 0.93 2005, receptor C 4458 2007, 2009 GDF6 NM_001001557 99
growth differentiation hsa-miR- -0.5 0.98 2005, factor 6 4500 2007,
2009 MTUS1 NM_001001924 100 microtubule hsa-let-7d -0.14 0.71 2009
associated tumor suppressor 1 PPARA NM_001001928 101 peroxisome
hsa-miR- -0.04 0.97 2007, proliferator-activated 4458 2009 receptor
alpha GOLGA7 NM_001002296 102 golgin A7 hsa-miR- -0.15 0.7 2005,
4500 2007, 2009 WNK3 NM_001002838 103 WNK lysine deficient hsa-miR-
-0.09 0.91 protein kinase 3 4458 CACNA1I NM_001003406 104 calcium
channel, hsa-miR- -0.1 0.92 2009 voltage-dependent, T 4458 type,
alpha 1I subunit SMAD2 NM_001003652 105 SMAD family hsa-miR- -0.09
0.9 2007, member 2 4458 2009 C18orf1 NM_001003674 106 chromosome 18
open hsa-miR- -0.01 0.76 reading frame 1 4500 KLHL31 NM_001003760
107 kelch-like 31 hsa-let-7d -0.34 0.93 2009 (Drosophila) MGLL
NM_001003794 108 monoglyceride lipase hsa-miR- >-0.03 0.99 2005,
4458 2007, 2009 DLGAP1 NM_001003809 109 discs, large hsa-miR- -0.03
0.81 (Drosophila) 4500 homolog-associated protein 1 CD200
NM_001004196 110 CD200 molecule hsa-miR-98 -0.12 0.75 ZNF740
NM_001004304 111 zinc finger protein hsa-let-7d >-0.02 0.94
2007, 740 2009 LIN28B NM_001004317 112 lin-28 homolog B (C.
elegans) hsa-let-7d -0.98 >0.99 2007, 2009 PLEKHG7 NM_001004330
113 pleckstrin homology hsa-miR- -0.34 0.94 2009 domain containing,
4458 family G (with RhoGef domain) member 7 TRIM67 NM_001004342 114
tripartite motif hsa-let-7f -0.08 >0.99 2007, containing 67 2009
NRARP NM_001004354 115 NOTCH-regulated hsa-miR- -0.2 0.67 2005,
ankyrin repeat protein 4458 2007, 2009 ITGA11 NM_001004439 116
integrin, alpha 11 hsa-miR- -0.07 0.77 4458 YPEL2 NM_001005404 117
yippee-like 2 hsa-miR- -0.15 0.96 2009 (Drosophila) 4500 PLCXD3
NM_001005473 118 phosphatidylinositol- hsa-miR- -0.19 0.8 2005,
specific 4458 2007 phospholipase C, X domain containing 3 CPM
NM_001005502 119 carboxypeptidase M hsa-miR- -0.27 0.95 2005, 4458
2007, 2009 EDA NM_001005609 120 ectodysplasin A hsa-miR- -0.06 0.92
2005, 4458 2007, 2009 ZNF473 NM_001006656 121 zinc finger protein
hsa-let-7d -0.31 0.98 2009 473 NTRK3 NM_001007156 122 neurotrophic
tyrosine hsa-let-7f -0.16 0.82 2009 kinase, receptor, type 3
IGF2BP2 NM_001007225 123 insulin-like growth hsa-let-7b -0.4
>0.99 2007, factor 2 mRNA 2009 binding protein 2 BRWD1
NM_001007246 124 bromodomain and hsa-let-7d -0.5 0.73 WD repeat
domain containing 1 PRDM2 NM_001007257 125 PR domain containing
hsa-let-7g -0.35 0.87 2, with ZNF domain GEMIN7 NM_001007269 126
gem (nuclear hsa-miR- -0.37 <0.1 2009 organelle) associated 4500
protein 7 IRGQ NM_001007561 127 immunity-related hsa-let-7g -0.11
0.85 GTPase family, Q BCAP29 NM_001008405 128 B-cell receptor-
hsa-miR- -0.16 0.94 2007, associated protein 29 4500 2009 STEAP3
NM_001008410 129 STEAP family hsa-miR- -0.28 0.98 2009 member 3
4458 KIAA2022 NM_001008537 130 KIAA2022 hsa-let-7g -0.12 0.92 2009
USP20 NM_001008563 131 ubiquitin specific hsa-miR- -0.06 0.84
peptidase 20 4500 FNIP1 NM_001008738 132 folliculin interacting
hsa-miR-98 -0.22 0.98 2007, protein 1 2009 ACSL6 NM_001009185 133
acyl-CoA synthetase hsa-let-7d -0.39 0.98 2005, long-chain family
2007, member 6 2009 MFAP3L NM_001009554 134 microfibrillar-
hsa-miR- -0.09 0.93 2009 associated protein 3- 4500 like MEIS3
NM_001009813 135 Meis homeobox 3 hsa-miR- -0.26 0.92 2005, 4458
2007, 2009 KIAA0930 NM_001009880 136 KIAA0930 hsa-let-7d -0.06
>0.99 2007, 2009 C20orf194 NM_001009984 137 chromosome 20 open
hsa-miR- -0.18 >0.99 2009 reading frame 194 4500 ARHGAP28
NM_001010000 138 Rho GTPase hsa-let-7a -0.35 0.95 2005,
activating protein 28 2007, 2009 PM20D2 NM_001010853 139 peptidase
M20 hsa-let-7a -0.19 0.78 domain containing 2 ACER2 NM_001010887
140 alkaline ceramidase 2 hsa-miR- -0.15 0.94 2007, 4458 2009
SLC5A9 NM_001011547 141 solute carrier family 5 hsa-miR- -0.5 0.79
2009 (sodium/glucose 4458 cotransporter), member 9 NAA30
NM_001011713 142 N(alpha)- hsa-miR- -0.16 0.94 2007,
acetyltransferase 30, 4500 2009 NatC catalytic subunit NHLRC3
NM_001012754 143 NHL repeat hsa-let-7a -0.27 0.95 2007, containing
3 2009 SNX30 NM_001012994 144 sorting nexin family hsa-let-7d -0.15
0.95 2009 member 30 FIGNL2 NM_001013690 145 fidgetin-like 2
hsa-miR- -1.07 >0.99 2009 4458 C8orf58 NM_001013842 146
chromosome 8 open hsa-let-7d -0.42 0.97 2009 reading frame 58
DCUN1D2 NM_001014283 147 DCN1, defective in hsa-let-7b -0.13 0.94
2007, cullin neddylation 1, 2009 domain containing 2 (S.
cerevisiae) KATNAL1 NM_001014380 148 katanin p60 subunit hsa-miR-
-0.28 0.94 2009 A-like 1 4458 USP21 NM_001014443 149 ubiquitin
specific hsa-miR- -0.12 0.92 2005, peptidase 21 4458 2007, 2009
DDX19B NM_001014449 150 DEAD (Asp-Glu-Ala- hsa-miR- -0.47 0.97
2007, As) box polypeptide 4500 2009 19B RTKN NM_001015055 151
rhotekin hsa-miR-98 -0.14 0.76 GOPC NM_001017408 152
golgi-associated PDZ hsa-miR- -0.1 0.87 2009 and coiled-coil motif
4500 containing CALN1 NM_001017440 153 calneuron 1 hsa-miR- -0.15
0.92 2009 4458 C14orf28 NM_001017923 154 chromosome 14 open
hsa-let-7g -1.25 >0.99 2007, reading frame 28 2009 OPA3
NM_001017989 155 optic atrophy 3 hsa-miR- -0.42 0.71 (autosomal
recessive, 4458 with chorea and spastic paraplegia) DKK3
NM_001018057 156 dickkopf homolog 3 hsa-let-7d -0.1 0.93 2007,
(Xenopus laevis) 2009 SERF2 NM_001018108 157 small EDRK-rich
hsa-let-7d -0.55 0.85 factor 2 IQCB1 NM_001023570 158 IQ motif
containing hsa-miR- -0.3 0.88 2009 B1 4500 SBK1 NM_001024401 159
SH3-binding domain hsa-let-7b -0.1 0.94 2007, kinase 1 2009 CD276
NM_001024736 160 CD276 molecule hsa-miR- -0.06 0.71 4458 BCL7A
NM_001024808 161 B-cell hsa-miR- -0.06 0.9 2005, CLL/lymphoma 7A
4500 2007, 2009 KCTD21 NM_001029859 162 potassium channel
hsa-miR-98 -0.54 0.98 2007, tetramerisation 2009 domain containing
21 SLC10A7 NM_001029998 163 solute carrier family hsa-miR-98 -0.25
0.94 10 (sodium/bile acid cotransporter family), member 7 CTNS
NM_001031681 164 cystinosin, lysosomal hsa-let-7d -0.12 0.93 2005,
cystine transporter 2007, 2009 RBFOX2 NM_001031695 165 RNA binding
protein, hsa-miR-98 -0.19 0.94 2005, fox-1 homolog (C. elegans) 2
2007, 2009 PLD3 NM_001031696 166 phospholipase D hsa-miR- -0.13 0.9
2005, family, member 3 4458 2007, 2009 ERGIC1 NM_001031711 167
endoplasmic hsa-let-7d -0.21 0.93 reticulum-golgi intermediate
compartment (ERGIC) 1 TMPO NM_001032283 168 thymopoietin hsa-miR-
-0.1 0.83 4500 STK24 NM_001032296 169 serine/threonine hsa-miR-
-0.11 0.93 2009 kinase 24 4458 MYCL1 NM_001033081 170 v-myc
hsa-let-7a -0.09 0.88 2007, myelocytomatosis 2009 viral oncogene
homolog 1, lung carcinoma derived (avian) SRGAP3 NM_001033117 171
SLIT-ROBO Rho hsa-miR- -0.13 0.94 2005, GTPase activating 4500
2007, protein 3 2009 WIPI2 NM_001033518 172 WD repeat domain,
hsa-let-7e -0.34 0.92 2009 phosphoinositide interacting 2 RRM2
NM_001034 173 ribonucleotide hsa-miR- -0.36 0.95 2007, reductase M2
4500 2009 ARL5A NM_001037174 174 ADP-ribosylation hsa-let-7g -0.13
0.94 2007, factor-like 5A 2009 CDC42SE1 NM_001038707 175 CDC42
small effector 1 hsa-miR- -0.22 0.71 2009 4500 TRIM71 NM_001039111
176 tripartite motif hsa-miR- -0.89 >0.99 2007, containing 71
4458 2009 TRIOBP NM_001039141 177 TRIO and F-actin hsa-miR- -0.12
0.86 2009 binding protein 4458 GK5 NM_001039547 178 glycerol kinase
5 hsa-let-7d -0.16 0.85 (putative) KREMEN1 NM_001039570 179 kringle
containing hsa-miR- -0.17 0.97 2007, transmembrane 4458 2009
protein 1 SEC14L1 NM_001039573 180 SEC14-like 1 (S. cerevisiae)
hsa-miR- -0.18 0.92 2005, 4500 2007, 2009 KCNC4 NM_001039574 181
potassium voltage- hsa-miR- -0.1 0.84 2009 gated channel, Shaw-
4500 related subfamily, member 4 TMPPE NM_001039770 182
transmembrane hsa-miR- -0.17 0.84 2009 protein with 4458
metallophosphoesterase domain CHIC1 NM_001039840 183 cysteine-rich
hsa-miR- >-0.04 >0.99 2009 hydrophobic domain 1 4458 MLLT4
NM_001040000 184 myeloid/lymphoid or hsa-miR- -0.16 0.74 2007,
mixed-lineage 4458 2009 leukemia (trithorax homolog, Drosophila);
translocated to, 4 PQLC2 NM_001040125 185 PQ loop repeat hsa-miR-
-0.3 0.95 2009 containing 2 4458 PEG10 NM_001040152 186 paternally
expressed hsa-miR- -0.02 0.71 2009 10 4458 MTMR12 NM_001040446 187
myotubularin related hsa-miR- -0.06 0.9 2009 protein 12 4458 PTPRD
NM_001040712 188 protein tyrosine hsa-miR- -0.22 0.96 2007,
phosphatase, receptor 4500 2009 type, D KIAA0895L NM_001040715 189
KIAA0895-like hsa-let-7i -0.14 0.93 2007, 2009 USP44 NM_001042403
190 ubiquitin specific hsa-miR- -0.14 0.93 2009 peptidase 44 4458
RUFY2 NM_001042417 191 RUN and FYVE hsa-miR-98 -0.27 0.82 domain
containing 2 C6orf204 NM_001042475 192 chromosome 6 open hsa-miR-
-0.13 0.94 reading frame 204 4458 DLGAP4 NM_001042486 193 discs,
large hsa-let-7d -0.31 0.97 2009 (Drosophila) homolog-associated
protein 4 C2orf88 NM_001042519 194 chromosome 2 open hsa-miR- -0.17
0.89 2009 reading frame 88 4500 ATPAF1 NM_001042546 195 ATP
synthase hsa-let-7d -0.43 0.92 2009 mitochondrial F1 complex
assembly factor 1 FRS2 NM_001042555 196 fibroblast growth
hsa-let-7i -0.04 0.86 2007, factor receptor 2009 substrate 2 EIF4G2
NM_001042559 197 eukaryotic translation hsa-let-7d -0.27 0.92 2005,
initiation factor 4 2007, gamma, 2 2009 DPH3 NM_001047434 198 DPH3,
KTI11 hsa-let-7i -0.4 0.98 homolog (S. cerevisiae) UHRF1
NM_001048201 199 ubiquitin-like with hsa-let-7d -0.17 0.94 2009 PHD
and ring finger domains 1 TNFRSF1B NM_001066 200 tumor necrosis
factor hsa-miR- -0.09 0.99 2005, receptor superfamily, 4458 2007,
member 1B 2009 CDC14B NM_001077181 201 CDC14 cell division hsa-miR-
-0.08 0.88 2009 cycle 14 homolog B 4500 (S. cerevisiae) ATG9A
NM_001077198 202 ATG9 autophagy hsa-let-7d -0.03 0.74 related 9
homolog A (S. cerevisiae) SREK1 NM_001077199 203 splicing
regulatory hsa-miR- -0.09 0.92 2005, glutamine/lysine-rich 4458
2007, protein 1 2009 IKZF2 NM_001079526 204 IKAROS family zinc
hsa-let-7g -0.13 0.98 2007, finger 2 (Helios) 2009 CPEB1
NM_001079533 205 cytoplasmic hsa-miR- -0.44 0.91 2007,
polyadenylation 4500 2009 element binding protein 1 FNDC3A
NM_001079673 206 fibronectin type III hsa-let-7d -0.39 0.97 2005,
domain containing 3A 2007, 2009 GYG2 NM_001079855 207 glycogenin 2
hsa-let-7a -0.22 0.88 2009 VAV3 NM_001079874 208 vav 3 guanine
hsa-miR- -0.11 0.92 2005, nucleotide exchange 4500 2007, factor
2009 DMP1 NM_001079911 209 dentin matrix acidic hsa-miR- -0.21 0.94
2005, phosphoprotein 1 4500 2007, 2009 LDB3 NM_001080114 210 LIM
domain binding 3 hsa-miR- -0.09 0.84 2009 4458 GJC1 NM_001080383
211 gap junction protein, hsa-miR- -0.42 0.95 2009 gamma 1, 45 kDa
4500 KIAA1147 NM_001080392 212 KIAA1147 hsa-miR- -0.15 0.86 2007,
4458 2009 SLC45A4 NM_001080431 213 solute carrier family hsa-let-7d
-0.08 0.91 2003, 45, member 4 2007, 2009 DNA2 NM_001080449 214 DNA
replication hsa-miR- -0.53 0.6 2009 helicase 2 homolog 4458 (yeast)
MYO5B NM_001080467 215 myosin VB hsa-let-7g -0.04 0.78 2009 ZNF697
NM_001080470 216 zinc finger protein hsa-miR- -0.14 0.93 2007, 697
4458 2009 ZNF275 NM_001080485 217 zinc finger protein hsa-miR-
-0.11 0.99 2007, 275 4458 2009 MGA NM_001080541 218 MAX gene
associated hsa-miR- -0.12 0.91 2007, 4500 2009 THOC2 NM_001081550
219 THO complex 2 hsa-miR- -0.17 0.85 2007, 4458 2009 CPSF4
NM_001081559 220 cleavage and hsa-miR- -0.12 0.77 2005,
polyadenylation 4458 2007, specific factor 4, 2009 30 kDa C11orf57
NM_001082969 221 chromosome 11 open hsa-let-7f -0.25 0.89 2007,
reading frame 57 2009 E2F5 NM_001083588 222 E2F transcription
hsa-miR- -0.3 0.86 2009 factor 5, p130-binding 4500 ANKRD12
NM_001083625 223 ankyrin repeat hsa-miR- >-0.02 0.77 domain 12
4458 FOXN3 NM_001085471 224 forkhead box N3 hsa-miR- >-0.01 0.82
4458 MEX3A NM_001093725 225 mex-3 homolog A (C. elegans) hsa-miR-98
-0.15 0.92 2009 HIC1 NM_001098202 226 hypermethylated in hsa-miR-
-0.05 0.84 2009 cancer 1 4458 MGAT3 NM_001098270 227 mannosyl
(beta-1,4-)- hsa-miR- >-0.02 0.66 glycoprotein beta-1,4- 4458 N-
acetylglucosaminyltransferase SLC4A4 NM_001098484 228 solute
carrier family hsa-miR- -0.16 0.95 2005, 4, sodium bicarbonate 4458
2007, cotransporter, 2009 member 4 FAM104A NM_001098832 229 family
with sequence hsa-miR- -0.21 0.92 2007, similarity 104, 4458 2009
member A ATXN7L3 NM_001098833 230 ataxin 7-like 3 hsa-miR- -0.06
0.74 4500 BTBD9 NM_001099272 231 BTB (POZ) domain hsa-let-7a -0.16
0.95 2009 containing 9
NIPAL4 NM_001099287 232 NIPA-like domain hsa-miR- -0.17 0.93 2009
containing 4 4458 SH3RF3 NM_001099289 233 SH3 domain hsa-miR- -0.08
0.92 2009 containing ring finger 3 4458 GXYLT1 NM_001099650 234
glucoside hsa-miR- -0.37 0.99 2009 xylosyltransferase 1 4500 PTAR1
NM_001099666 235 protein hsa-miR- -0.15 0.98 2009 prenyltransferase
4500 alpha subunit repeat containing 1 FBXL19 NM_001099784 236
F-box and leucine- hsa-miR- -0.1 0.7 2009 rich repeat protein 19
4458 ACTA1 NM_001100 237 actin, alpha 1, skeletal hsa-let-7c -0.21
0.72 2005, muscle 2007 PHACTR2 NM_001100164 238 phosphatase and
actin hsa-miR- -0.15 0.94 2009 regulator 2 4500 MOBKL3 NM_001100819
239 MOB1, Mps One hsa-let-7a -0.12 0.93 2005, Binder kinase 2007,
activator-like 3 2009 (yeast) PACS2 NM_001100913 240 phosphofurin
acidic hsa-miR- -0.14 0.79 2009 cluster sorting protein 2 4458
IGLON5 NM_001101372 241 IgLON family hsa-let-7d -0.04 0.94 2009
member 5 SAMD12 NM_001101676 242 sterile alpha motif hsa-miR- -0.05
0.94 2009 domain containing 12 4500 DTX2 NM_001102594 243 deltex
homolog 2 hsa-let-7d -0.46 >0.99 2005, (Drosophila) 2007, 2009
FAM118A NM_001104595 244 family with sequence hsa-miR- -0.28 0.98
2007, similarity 118, 4500 2009 member A FAM123C NM_001105193 245
family with sequence hsa-miR- -0.25 0.87 2009 similarity 123C 4500
PCDH19 NM_001105243 246 protocadherin 19 hsa-miR- -0.12 0.95 2007,
4500 2009 ZFYVE16 NM_001105251 247 zinc finger, FYVE hsa-miR- -0.16
0.71 2009 domain containing 16 4500 SWT1 NM_001105518 248 SWT1 RNA
hsa-let-7b -0.21 0.85 2007, endoribonuclease 2009 homolog (S.
cerevisiae) CAP1 NM_001105530 249 CAP, adenylate hsa-miR- -0.14
0.85 2005, cyclase-associated 4500 2007, protein 1 (yeast) 2009
FAM135A NM_001105531 250 family with sequence hsa-let-7f -0.19 0.85
2005, similarity 135, 2007, member A 2009 ZBTB10 NM_001105539 251
zinc finger and BTB hsa-miR- -0.06 0.72 2005, domain containing 10
4500 2007 NEFM NM_001105541 252 neurofilament, hsa-let-7f -0.16
0.86 2007, medium polypeptide 2009 FBXO45 NM_001105573 253 F-box
protein 45 hsa-miR- -0.06 0.89 2009 4458 ACVR2B NM_001106 254
activin A receptor, hsa-miR- -0.03 >0.99 2007, type IIB 4500
2009 C12orf51 NM_001109662 255 chromosome 12 open hsa-miR- -0.09
0.92 2009 reading frame 51 4458 GSG1L NM_001109763 256 GSG1-like
hsa-miR- -0.08 0.73 4458 ACVR1C NM_001111031 257 activin A
receptor, hsa-miR- -0.48 0.99 2005, type IC 4458 2007, 2009 C3orf63
NM_001112736 258 chromosome 3 open hsa-miR- -0.02 0.91 2009 reading
frame 63 4458 HIPK2 NM_001113239 259 homeodomain hsa-let-7d -0.03
0.94 2009 interacting protein kinase 2 AMOT NM_001113490 260
angiomotin hsa-miR- -0.12 0.76 4458 ARHGEF7 NM_001113513 261 Rho
guanine hsa-let-7a -0.14 0.94 nucleotide exchange factor (GEF) 7
CTSC NM_001114173 262 cathepsin C hsa-miR- -0.15 0.89 2009 4458
ADCY9 NM_001116 263 adenylate cyclase 9 hsa-miR- -0.03 0.91 2005,
4458 2007, 2009 NAPEPLD NM_001122838 264 N-acyl hsa-miR- -0.05 0.94
2007, phosphatidylethanolamine 4458 2009 phospholipase D CASK
NM_001126054 265 calcium/calmodulin- hsa-let-7d -0.04 0.91
dependent serine protein kinase (MAGUK family) ELF4 NM_001127197
266 E74-like factor 4 (ets hsa-let-7a -0.17 0.94 2007, domain
transcription 2009 factor) TET2 NM_001127208 267 tet oncogene
family hsa-miR- -0.16 0.96 member 2 4458 CBX5 NM_001127321 268
chromobox homolog 5 hsa-miR- -0.17 >0.99 4458 CRY2 NM_001127457
269 cryptochrome 2 hsa-miR- -0.12 0.93 2005, (photolyase-like) 4458
2007, 2009 STXBP5 NM_001127715 270 syntaxin binding hsa-let-7d
-0.15 0.8 2009 protein 5 (tomosyn) SULF1 NM_001128204 271 sulfatase
1 hsa-miR- -0.1 0.85 2009 4500 SMARCAD1 NM_001128429 272
SWI/SNF-related, hsa-let-7f -0.57 0.95 2005, matrix-associated
2007, actin-dependent 2009 regulator of chromatin, subfamily a,
containing DEAD/H box 1 RASGRP1 NM_001128602 273 RAS guanyl
releasing hsa-miR- -0.34 0.97 2005, protein 1 (calcium 4458 2007,
and DAG-regulated) 2009 PAK1 NM_001128620 274 p21 protein hsa-miR-
-0.18 0.78 2005, (Cdc42/Rac)- 4500 2007, activated kinase 1 2009
SPIRE1 NM_001128626 275 spire homolog 1 hsa-let-7a -0.04 0.92 2009
(Drosophila) CALU NM_001130674 276 calumenin hsa-miR- -0.19 0.93
2005, 4458 2007, 2009 STYX NM_001130701 277
serine/threonine/tyrosine hsa-miR- -0.09 0.93 interacting protein
4500 GAS7 NM_001130831 278 growth arrest-specific 7 hsa-miR- -0.28
0.98 2005, 4500 2007, 2009 RTCD1 NM_001130841 279 RNA terminal
hsa-miR- -0.2 0.88 phosphate cyclase 4458 domain 1 TGFBR1
NM_001130916 280 transforming growth hsa-let-7f -0.52 >0.99
2005, factor, beta receptor 1 2007, 2009 TTLL6 NM_001130918 281
tubulin tyrosine hsa-miR- -0.26 0.76 ligase-like family, 4458
member 6 TMEM194A NM_001130963 282 transmembrane hsa-let-7a -0.07
0.94 2009 protein 194A MEF2C NM_001131005 283 myocyte enhancer
hsa-miR- -0.24 0.87 factor 2C 4458 SAP30L NM_001131062 284
SAP30-like hsa-miR- >-0.02 0.92 4458 CCNJ NM_001134375 285
cyclin J hsa-miR- -0.44 0.94 2005, 4458 2007, 2009 CYB561D1
NM_001134400 286 cytochrome b-561 hsa-let-7d -0.33 0.91 domain
containing 1 CDV3 NM_001134422 287 CDV3 homolog hsa-miR- -0.13 0.98
2007, (mouse) 4500 2009 LRRC8B NM_001134476 288 leucine rich repeat
hsa-miR- -0.07 0.88 containing 8 family, 4500 member B PBX3
NM_001134778 289 pre-B-cell leukemia hsa-miR-98 -0.32 0.99 2005,
homeobox 3 2007, 2009 FNDC3B NM_001135095 290 fibronectin type III
hsa-miR- -0.16 0.98 2005, domain containing 3B 4500 2007, 2009
TMPRSS2 NM_001135099 291 transmembrane hsa-let-7b -0.32 0.98 2007,
protease, serine 2 2009 HDHD1 NM_001135565 292 haloacid hsa-miR-
-0.28 0.62 2005, dehalogenase-like 4500 2007, hydrolase domain 2009
containing 1 LOC221710 NM_001135575 293 hypothetical protein
hsa-miR- -0.01 0.78 LOC221710 4458 SPATA2 NM_001135773 294
spermatogenesis hsa-let-7a -0.07 0.94 2005, associated 2 2007, 2009
C9orf7 NM_001135775 295 chromosome 9 open hsa-miR- -0.12 0.92 2005,
reading frame 7 4500 2007, 2009 SYT1 NM_001135805 296 synaptotagmin
I hsa-miR- -0.16 0.87 2005, 4458 2007, 2009 TMEM2 NM_001135820 297
transmembrane hsa-let-7g -0.41 0.98 2005, protein 2 2007, 2009
PIK3IP1 NM_001135911 298 phosphoinositide-3- hsa-let-7a -0.19 0.85
2005, kinase interacting 2007, protein 1 2009 TTC39C NM_001135993
299 tetratricopeptide hsa-miR- -0.06 0.86 repeat domain 39C 4500
ABL2 NM_001136000 300 v-abl Abelson murine hsa-let-7f -0.23
>0.99 2009 leukemia viral oncogene homolog 2 MICAL3 NM_001136004
301 microtubule hsa-let-7g -0.22 0.83 associated monoxygenase,
calponin and LIM domain containing 3 LMLN NM_001136049 302
leishmanolysin-like hsa-miR- -0.13 0.9 (metallopeptidase M8 4500
family) LRIG3 NM_001136051 303 leucine-rich repeats hsa-miR- -0.49
0.96 2005, and immunoglobulin- 4458 2007, like domains 3 2009
ZNF879 NM_001136116 304 zinc finger protein hsa-miR- -0.34 0.95 879
4458 ATXN7L3B NM_001136262 305 ataxin 7-like 3B hsa-miR- >-0.01
0.91 4458 VASH2 NM_001136474 306 vasohibin 2 hsa-let-7d -0.13 0.93
2007, 2009 BTF3L4 NM_001136497 307 basic transcription hsa-miR-
-0.12 0.9 2009 factor 3-like 4 4458 SYT2 NM_001136504 308
synaptotagmin II hsa-miR- -0.16 0.94 2009 4500 ATXN1L NM_001137675
309 ataxin 1-like hsa-miR- >-0.02 0.93 4458 NIPA1 NM_001142275
310 non imprinted in hsa-miR- -0.2 0.99 2007, Prader- 4458 2009
Willi/Angelman syndrome 1 RBFOX1 NM_001142333 311 RNA binding
protein, hsa-let-7f -0.18 0.86 2005, fox-1 homolog (C. elegans) 1
2007, 2009 GNAL NM_001142339 312 guanine nucleotide hsa-miR- -0.13
0.95 2005, binding protein (G 4500 2007, protein), alpha 2009
activating activity polypeptide, olfactory type SCN4B NM_001142348
313 sodium channel, hsa-miR-98 -0.08 0.93 2009 voltage-gated, type
IV, beta CTIF NM_001142397 314 CBP80/20-dependent hsa-let-7a -0.1
0.77 translation initiation factor RPUSD3 NM_001142547 315 RNA
pseudouridylate hsa-miR- -0.42 0.89 2007, synthase domain 4500 2009
containing 3 BBX NM_001142568 316 bobby sox homolog hsa-let-7d
-0.11 0.81 (Drosophila) CLP1 NM_001142597 317 CLP1, cleavage and
hsa-miR- -0.32 0.68 2007 polyadenylation 4458 factor I subunit,
homolog (S. cerevisiae) TMOD2 NM_001142885 318 tropomodulin 2
hsa-miR- -0.12 0.98 (neuronal) 4458 PLEKHG6 NM_001144856 319
pleckstrin homology hsa-miR- -0.37 0.98 2007, domain containing,
4458 2009 family G (with RhoGef domain) member 6 LIPT2 NM_001144869
320 lipoyl(octanoyl) hsa-miR- -0.43 0.87 transferase 2 4458
(putative) SLC30A7 NM_001144884 321 solute carrier family
hsa-let-7d -0.07 0.9 2009 30 (zinc transporter), member 7 NEDD4L
NM_001144964 322 neural precursor cell hsa-miR- -0.06 0.94
expressed, 4500 developmentally down-regulated 4-like PALM3
NM_001145028 323 paralemmin 3 hsa-miR- -0.12 0.91 4458
LRRC10B NM_001145077 324 leucine rich repeat hsa-let-7a -0.07 0.62
containing 10B GRID2IP NM_001145118 325 glutamate receptor,
hsa-miR- -0.26 0.94 ionotropic, delta 2 4458 (Grid2) interacting
protein CDK6 NM_001145306 326 cyclin-dependent hsa-miR- -0.08 0.85
kinase 6 4458 ZNF566 NM_001145343 327 zinc finger protein
hsa-let-7f -0.25 0.93 2009 566 ZNF652 NM_001145365 328 zinc finger
protein hsa-miR- -0.15 >0.99 652 4458 POTEM NM_001145442 329
POTE ankyrin hsa-miR- -0.22 <0.1 domain family, 4500 member M
ZNF200 NM_001145446 330 zinc finger protein hsa-let-7d -0.37
>0.99 2009 200 SOX6 NM_001145811 331 SRY (sex determining
hsa-let-7d -0.16 0.72 region Y)-box 6 SLCO5A1 NM_001146008 332
solute carrier organic hsa-miR- -0.08 0.81 2005, anion transporter
4500 2007, family, member 5A1 2009 NEK3 NM_001146099 333 NIMA
(never in hsa-miR- -0.35 0.91 2009 mitosis gene a)- 4500 related
kinase 3 SLC6A15 NM_001146335 334 solute carrier family 6 hsa-miR-
-0.15 0.94 (neutral amino acid 4500 transporter), member 15 SLC25A4
NM_001151 335 solute carrier family hsa-miR- -0.15 0.94 2005, 25
(mitochondrial 4500 2007 carrier; adenine nucleotide translocator),
member 4 KLF8 NM_001159296 336 Kruppel-like factor 8 hsa-miR- -0.11
0.81 4458 BEGAIN NM_001159531 337 brain-enriched hsa-miR- -0.36
0.99 2005, guanylate kinase- 4458 2007, associated homolog 2009
(rat) BEND4 NM_001159547 338 BEN domain hsa-miR-98 -0.24 >0.99
2009 containing 4 SYNCRIP NM_001159673 339 synaptotagmin hsa-miR-
-0.29 0.96 binding, cytoplasmic 4458 RNA interacting protein BZW2
NM_001159767 340 basic leucine zipper hsa-let-7a -0.24 0.81 2007,
and W2 domains 2 2009 CANT1 NM_001159772 341 calcium activated
hsa-miR- -0.19 0.89 2009 nucleotidase 1 4458 ZNF583 NM_001159860
342 zinc finger protein hsa-let-7f -0.44 0.98 2007, 583 2009 RNF170
NM_001160223 343 ring finger protein hsa-let-7d -0.41 0.98 170
PANX2 NM_001160300 344 pannexin 2 hsa-miR- -0.1 0.92 2005, 4458
2007, 2009 TMC7 NM_001160364 345 transmembrane hsa-let-7d -0.12
0.92 2005, channel-like 7 2007, 2009 IGF2BP1 NM_001160423 346
insulin-like growth hsa-miR- -0.4 >0.99 2007, factor 2 mRNA 4500
2009 binding protein 1 SYNC NM_001161708 347 syncoilin, hsa-miR-
-0.48 <0.1 intermediate filament 4500 protein SULF2 NM_001161841
348 sulfatase 2 hsa-miR- -0.12 0.91 4458 APBA1 NM_001163 349
amyloid beta (A4) hsa-let-7a -0.11 0.94 precursor protein- binding,
family A, member 1 CECR6 NM_001163079 350 cat eye syndrome
hsa-let-7d -0.14 0.95 2005, chromosome region, 2007, candidate 6
2009 PCYT1B NM_001163264 351 phosphate hsa-miR- >-0.02 0.91
2007, cytidylyltransferase 1, 4458 2009 choline, beta CPA4
NM_001163446 352 carboxypeptidase A4 hsa-miR- -0.37 0.93 2005, 4458
2007, 2009 GTF2I NM_001163636 353 general transcription hsa-miR-
-0.2 0.85 2007, factor IIi 4458 2009 DLC1 NM_001164271 354 deleted
in liver cancer 1 hsa-miR- -0.22 >0.99 2005, 4458 2007, 2009
SLC37A4 NM_001164277 355 solute carrier family hsa-let-7d -0.11 0.7
37 (glucose-6- phosphate transporter), member 4 ANKRD33B
NM_001164440 356 ankyrin repeat hsa-miR- >-0.03 0.25 domain 33B
4458 C16orf52 NM_001164579 357 chromosome 16 open hsa-miR- -0.09
0.83 reading frame 52 4458 KIAA1549 NM_001164665 358 KIAA1549
hsa-miR- >-0.02 0.94 2009 4458 PITPNM3 NM_001165966 359 PITPNM
family hsa-miR- >-0.02 0.94 member 3 4458 EPB41 NM_001166005 360
erythrocyte hsa-let-7a -0.06 0.76 2009 membrane protein band 4.1
(elliptocytosis 1, RH- linked) CEP120 NM_001166226 361 centrosomal
protein hsa-miR- -0.22 0.92 2007, 120 kDa 4458 2009 GRIK2
NM_001166247 362 glutamate receptor, hsa-miR- -0.12 0.86 2005,
ionotropic, kainate 2 4500 2007, 2009 SPATA13 NM_001166271 363
spermatogenesis hsa-miR- >-0.02 0.64 associated 13 4458 TRAPPC1
NM_001166621 364 trafficking protein hsa-miR- N/A 0.12 2005,
particle complex 1 4458 2007, 2009 TMED5 NM_001167830 365
transmembrane hsa-miR- -0.11 0.95 2005, emp24 protein 4500 2007,
transport domain 2009 containing 5 SBNO1 NM_001167856 366
strawberry notch hsa-miR- -0.17 0.95 homolog 1 4458 (Drosophila)
TIMM17B NM_001167947 367 translocase of inner hsa-miR- -0.16 0.93
2005, mitochondrial 4458 2007, membrane 17 2009 homolog B (yeast)
GPR156 NM_001168271 368 G protein-coupled hsa-miR- -0.21 0.95
receptor 156 4458 EDN1 NM_001168319 369 endothelin 1 hsa-miR- -0.31
0.86 2009 4500 TXLNG NM_001168683 370 taxilin gamma hsa-miR- -0.32
0.95 4500 TMEM135 NM_001168724 371 transmembrane hsa-let-7a -0.11
0.93 protein 135 AFF2 NM_001169122 372 AF4/FMR2 family, hsa-miR-
-0.22 0.92 2009 member 2 4458 GPR137 NM_001170726 373 G
protein-coupled hsa-let-7b -0.16 0.67 2003, receptor 137 2007, 2009
LCOR NM_001170765 374 ligand dependent hsa-miR- -0.14 0.96 2007,
nuclear receptor 4500 2009 corepressor IGSF1 NM_001170963 375
immunoglobulin hsa-let-7f -0.38 0.93 2009 superfamily, member 1
STRBP NM_001171137 376 spermatid perinuclear hsa-miR- -0.2 0.89
2005, RNA binding protein 4458 2007, 2009 C3orf52 NM_001171747 377
chromosome 3 open hsa-miR- -0.23 0.85 2009 reading frame 52 4458
CSRNP3 NM_001172173 378 cysteine-serine-rich hsa-let-7c -0.05 0.87
nuclear protein 3 OLR1 NM_001172632 379 oxidized low density
hsa-miR- -0.12 0.88 2005, lipoprotein (lectin- 4458 2007, like)
receptor 1 2009 RAB40C NM_001172663 380 RAB40C, member hsa-let-7a
-0.1 0.91 2005, RAS oncogene family 2007, 2009 ZNF347 NM_001172674
381 zinc finger protein hsa-miR- -0.41 <0.1 347 4458 ZNF641
NM_001172681 382 zinc finger protein hsa-miR- -0.2 0.93 641 4458
PPARGC1B NM_001172698 383 peroxisome hsa-miR- -0.31 >0.99 2005,
proliferator-activated 4500 2007, receptor gamma, 2009 coactivator
1 beta PPP1R16B NM_001172735 384 protein phosphatase 1, hsa-miR-
-0.07 0.94 2005, regulatory (inhibitor) 4458 2007, subunit 16B 2009
FOXP2 NM_001172766 385 forkhead box P2 hsa-miR- -0.33 >0.99 4500
CRBN NM_001173482 386 cereblon hsa-miR- -0.2 0.74 4458 LMX1A
NM_001174069 387 LIM homeobox hsa-miR-98 -0.16 0.92 2007,
transcription factor 1, 2009 alpha POLL NM_001174084 388 polymerase
(DNA hsa-miR- -0.31 <0.1 2009 directed), lambda 4458 NCOA3
NM_001174087 389 nuclear receptor hsa-miR- -0.1 0.84 2005,
coactivator 3 4458 2007 TRPM6 NM_001177310 390 transient receptor
hsa-miR- -0.2 0.98 2005, potential cation 4458 2007, channel,
subfamily 2009 M, member 6 CPEB2 NM_001177381 391 cytoplasmic
hsa-let-7b -0.21 0.98 2005, polyadenylation 2007, element binding
2009 protein 2 HDX NM_001177478 392 highly divergent hsa-let-7g
-0.38 0.97 homeobox PPP2R2A NM_001177591 393 protein phosphatase 2,
hsa-miR- -0.19 0.94 regulatory subunit B, 4458 alpha STX3
NM_001178040 394 syntaxin 3 hsa-let-7g -0.41 0.98 2007, 2009 PARP8
NM_001178055 395 poly (ADP-ribose) hsa-miR- -0.23 0.98 polymerase
family, 4458 member 8 BCAT1 NM_001178091 396 branched chain
hsa-miR- -0.1 0.95 2009 amino-acid 4500 transaminase 1, cytosolic
CPEB3 NM_001178137 397 cytoplasmic hsa-miR- -0.15 0.96 2005,
polyadenylation 4458 2007, element binding 2009 protein 3 SLAMF6
NM_001184714 398 SLAM family hsa-miR- -0.22 0.88 2007, member 6
4458 2009 PEX11B NM_001184795 399 peroxisomal hsa-miR- -0.34 0.51
2009 biogenesis factor 11 4458 beta PHF8 NM_001184896 400 PHD
finger protein 8 hsa-miR- >-0.02 0.92 2005, 4458 2007, 2009
CLDN12 NM_001185072 401 claudin 12 hsa-miR- -0.34 0.98 2005, 4458
2007, 2009 BACH1 NM_001186 402 BTB and CNC hsa-let-7c -0.31
>0.99 2005, homology 1, basic 2007, leucine zipper 2009
transcription factor 1 ATG16L1 NM_001190266 403 ATG16 autophagy
hsa-miR- -0.09 0.92 2007, related 16-like 1 (S. cerevisiae) 4458
2009 NCOR1 NM_001190440 404 nuclear receptor hsa-miR- -0.05 0.92
corepressor 1 4458 COL11A1 NM_001190709 405 collagen, type XI,
hsa-miR- -0.1 0.77 alpha 1 4458 YAF2 NM_001190977 406 YY1
associated factor 2 hsa-let-7a -0.05 0.94 2009 BCL2L1 NM_001191 407
BCL2-like 1 hsa-miR- -0.2 0.9 2005, 4458 2007, 2009 IKBKE
NM_001193321 408 inhibitor of kappa hsa-let-7b -0.13 0.94 2005,
light polypeptide gene 2007, enhancer in B-cells, 2009 kinase
epsilon SECISBP2L NM_001193489 409 SECIS binding hsa-miR- -0.08
0.81 protein 2-like 4458 SLC1A4 NM_001193493 410 solute carrier
family 1 hsa-let-7d -0.05 0.98 2009 (glutamate/neutral amino acid
transporter), member 4 SLC30A6 NM_001193513 411 solute carrier
family hsa-miR- -0.31 0.92 30 (zinc transporter), 4458 member 6
POGZ NM_001194937 412 pogo transposable hsa-miR- -0.16 0.88 2005,
element with ZNF 4458 2007, domain 2009 PTPRU NM_001195001 413
protein tyrosine hsa-let-7a -0.14 0.92 2009 phosphatase, receptor
type, U
ANKRD28 NM_001195098 414 ankyrin repeat hsa-miR- -0.2 0.84 2009
domain 28 4458 PTP4A2 NM_001195100 415 protein tyrosine hsa-let-7b
-0.07 0.75 phosphatase type IVA, member 2 LOC100507421 NM_001195278
416 transmembrane hsa-miR- -0.06 0.85 protein 178-like 4458 DICER1
NM_001195573 417 dicer 1, ribonuclease hsa-miR- -0.05 >0.99 2009
type III 4458 MLLT10 NM_001195626 418 myeloid/lymphoid or
hsa-let-7i -0.15 0.86 2005, mixed-lineage 2007, leukemia (trithorax
2009 homolog, Drosophila); translocated to, 10 TGFBR3 NM_001195683
419 transforming growth hsa-let-7g -0.39 0.98 factor, beta receptor
III PLD5 NM_001195811 420 phospholipase D hsa-miR-98 -0.18 0.86
family, member 5 PLEKHA8 NM_001197026 421 pleckstrin homology
hsa-let-7a -0.32 0.99 domain containing, family A (phosphoinositide
binding specific) member 8 DPYSL3 NM_001197294 422
dihydropyrimidinase- hsa-miR- -0.03 0.84 2009 like 3 4500 GABPA
NM_001197297 423 GA binding protein hsa-miR- -0.09 0.92 2007,
transcription factor, 4500 2009 alpha subunit 60 kDa PRDM1
NM_001198 424 PR domain containing hsa-let-7a -0.05 0.74 2005, 1,
with ZNF domain 2007, 2009 RUNX1T1 NM_001198625 425 runt-related
hsa-miR- -0.05 0.91 transcription factor 1; 4458 translocated to, 1
(cyclin D-related) POU2F1 NM_001198783 426 POU class 2 hsa-miR-
-0.02 >0.99 homeobox 1 4458 A1CF NM_001198818 427 APOBEC1
hsa-miR- -0.11 <0.1 complementation 4500 factor ABCC10
NM_001198934 428 ATP-binding cassette, hsa-miR- -0.16 0.82 2005,
sub-family C 4458 2007 (CFTR/MRP), member 10 SMAP2 NM_001198978 429
small ArfGAP2 hsa-miR- -0.21 0.82 2007, 4458 2009 AMMECR1L
NM_001199140 430 AMME chromosomal hsa-let-7d -0.11 <0.1 2007,
region gene 1-like 2009 TOR1AIP2 NM_001199260 431 torsin A
interacting hsa-miR- >-0.03 0.98 protein 2 4458 UCHL5
NM_001199261 432 ubiquitin carboxyl- hsa-let-7f -0.04 <0.1
terminal hydrolase L5 PHOSPHO2- NM_001199290 433 PHOSPHO2-
hsa-let-7f -0.2 0.95 KLHL23 KLHL23 readthrough CNOT2 NM_001199302
434 CCR4-NOT hsa-let-7d -0.14 0.86 2007, transcription 2009
complex, subunit 2 MUTED NM_001199322 435 muted homolog hsa-let-7c
-0.1 0.82 2009 (mouse) CPD NM_001199775 436 carboxypeptidase D
hsa-let-7d -0.18 0.95 2005, 2007, 2009 POC1B- NM_001199781 437
POC1B-GALNT4 hsa-let-7a -0.1 0.84 GALNT4 readthrough EGR3
NM_001199880 438 early growth response 3 hsa-miR- >-0.03 0.67
2005, 4458 2007, 2009 DNAL1 NM_001201366 439 dynein, axonemal,
hsa-miR- -0.03 0.94 2009 light chain 1 4458 RNF7 NM_001201370 440
ring finger protein 7 hsa-miR- -0.18 0.94 2005, 4458 2007, 2009
TRMT1L NM_001202423 441 TRM1 tRNA hsa-miR- -0.16 0.65
methyltransferase 1- 4458 like HSPE1- NM_001202485 442 HSPE1-MOBKL3
hsa-let-7a -0.12 0.93 MOBKL3 readthrough UBE2G2 NM_001202489 443
ubiquitin-conjugating hsa-miR- -0.14 0.94 2009 enzyme E2G 2 4458
MXD1 NM_001202513 444 MAX dimerization hsa-miR- -0.23 0.94 2007,
protein 1 4458 2009 CUX1 NM_001202543 445 cut-like homeobox 1
hsa-miR- -0.05 0.77 4458 SEMA4G NM_001203244 446 sema domain,
hsa-let-7a -0.22 0.9 2005, immunoglobulin 2007, domain (Ig), 2009
transmembrane domain (TM) and short cytoplasmic domain,
(semaphorin) 4G EZH2 NM_001203247 447 enhancer of zeste hsa-miR-
N/A 0.86 2005, homolog 2 4458 2007, (Drosophila) 2009 PPT2
NM_001204103 448 palmitoyl-protein hsa-miR- -0.29 <0.1
thioesterase 2 4458 MDM4 NM_001204171 449 Mdm4 p53 binding
hsa-let-7a -0.27 >0.99 protein homolog (mouse) RGS6 NM_001204416
450 regulator of G-protein hsa-miR- -0.22 0.95 2009 signaling 6
4458 NPEPL1 NM_001204872 451 aminopeptidase-like 1 hsa-let-7f -0.15
0.94 2005, 2007, 2009 PBX1 NM_001204961 452 pre-B-cell leukemia
hsa-let-7g -0.28 0.94 homeobox 1 KLF9 NM_001206 453 Kruppel-like
factor 9 hsa-miR- -0.18 0.92 2005, 4500 2007, 2009 CD86
NM_001206924 454 CD86 molecule hsa-miR- -0.2 0.6 2009 4500 POU2F2
NM_001207025 455 POU class 2 hsa-miR- -0.14 0.89 2007, homeobox 2
4458 2009 CLASP2 NM_001207044 456 cytoplasmic linker hsa-let-7g
-0.14 0.94 2005, associated protein 2 2007, 2009 BZW1 NM_001207067
457 basic leucine zipper hsa-let-7f -0.48 0.99 2005, and W2 domains
1 2007, 2009 MEIS2 NM_001220482 458 Meis homeobox 2 hsa-miR- -0.18
0.86 2005, 4458 2007, 2009 CCNT2 NM_001241 459 cyclin T2 hsa-miR-
-0.1 0.76 4458 ATAD2B NM_001242338 460 ATPase family, AAA hsa-miR-
>-0.03 0.66 2009 domain containing 2B 4458 FAM59A NM_001242409
461 family with sequence hsa-let-7f -0.17 0.94 similarity 59,
member A FBXO32 NM_001242463 462 F-box protein 32 hsa-let-7b -0.26
0.95 MAP4K4 NM_001242559 463 mitogen-activated hsa-miR- -0.2 0.99
2005, protein kinase kinase 4458 2007, kinase kinase 4 2009 NXT2
NM_001242617 464 nuclear transport hsa-let-7g -0.21 0.86 2005,
factor 2-like export 2007, factor 2 2009 GFOD1 NM_001242628 465
glucose-fructose hsa-miR- -0.29 <0.1 oxidoreductase 4458 domain
containing 1 ARHGEF38 NM_001242729 466 Rho guanine hsa-miR- -0.53
0.94 nucleotide exchange 4500 factor (GEF) 38 ZNF322A NM_001242797
467 zinc finger protein hsa-let-7a -0.47 0.96 2009 322A CHD4
NM_001273 468 chromodomain hsa-miR- -0.17 0.83 2005, helicase DNA
binding 4500 2007, protein 4 2009 CHUK NM_001278 469 conserved
helix-loop- hsa-miR- -0.27 0.74 helix ubiquitous 4500 kinase AP1S1
NM_001283 470 adaptor-related hsa-miR- -0.27 0.88 2005, protein
complex 1, 4458 2007, sigma 1 subunit 2009 DUSP4 NM_001394 471 dual
specificity hsa-miR- -0.17 0.94 2007, phosphatase 4 4500 2009 DUSP9
NM_001395 472 dual specificity hsa-miR- -0.07 0.93 2005,
phosphatase 9 4500 2007, 2009 DYRK1A NM_001396 473 dual-specificity
hsa-miR- -0.15 0.84 2005, tyrosine-(Y)- 4500 2007, phosphorylation
2009 regulated kinase 1A GATM NM_001482 474 glycine hsa-let-7a
-0.44 0.96 2009 amidinotransferase (L-arginine:glycine
amidinotransferase) ACVR2A NM_001616 475 activin A receptor,
hsa-let-7a -0.24 0.98 2007, type IIA 2009 AKT2 NM_001626 476 v-akt
murine hsa-let-7i -0.15 0.88 2009 thymoma viral oncogene homolog 2
ARL4D NM_001661 477 ADP-ribosylation hsa-miR- -0.19 0.94 2009
factor-like 4D 4500 POLR3D NM_001722 478 polymerase (RNA) III
hsa-miR- -0.28 0.91 2007, (DNA directed) 4500 2009 polypeptide D,
44 kDa CCND2 NM_001759 479 cyclin D2 hsa-miR- -0.14 >0.99 2005,
4458 2007, 2009 CCNF NM_001761 480 cyclin F hsa-let-7d -0.4 0.92
2009 CDC25A NM_001789 481 cell division cycle 25 hsa-miR- -0.42 0.9
2005, homolog A (S. pombe) 4458 2007, 2009 CCR7 NM_001838 482
chemokine (C-C hsa-let-7f -0.36 0.96 2005, motif) receptor 7 2007,
2009 COL4A1 NM_001845 483 collagen, type IV, hsa-miR- -0.15 0.92
2005, alpha 1 4458 2007, 2009 COL4A2 NM_001846 484 collagen, type
IV, hsa-miR-98 -0.17 0.94 2005, alpha 2 2007, 2009 COL4A6 NM_001847
485 collagen, type IV, hsa-miR- -0.34 <0.1 2009 alpha 6 4458
COL9A3 NM_001853 486 collagen, type IX, hsa-let-7a -0.11 0.86 2009
alpha 3 COL15A1 NM_001855 487 collagen, type XV, hsa-miR- -0.18
0.93 2005, alpha 1 4500 2007, 2009 SLC31A1 NM_001859 488 solute
carrier family hsa-miR- -0.12 0.94 2009 31 (copper 4458
transporters), member 1 SLC31A2 NM_001860 489 solute carrier family
hsa-let-7a -0.17 0.71 2005, 31 (copper 2007 transporters), member 2
MASP1 NM_001879 490 mannan-binding hsa-let-7a -0.34 0.94 2007,
lectin serine peptidase 2009 1 (C4/C2 activating component of Ra-
reactive factor) CTPS NM_001905 491 CTP synthase hsa-miR- -0.19
0.79 4458 DLST NM_001933 492 dihydrolipoamide S- hsa-miR- -0.17
0.95 2005, succinyltransferase 4500 2007, (E2 component of 2- 2009
oxo-glutarate complex) DSG3 NM_001944 493 desmoglein 3 hsa-miR-
-0.16 <0.1 4500 HBEGF NM_001945 494 heparin-binding EGF-
hsa-miR- -0.17 0.73 like growth factor 4500 DUSP7 NM_001947 495
dual specificity hsa-let-7b -0.07 0.94 phosphatase 7 ELK4 NM_001973
496 ELK4, ETS-domain hsa-miR- -0.14 0.94 protein (SRF 4458
accessory protein 1) EZH1 NM_001991 497 enhancer of zeste
hsa-let-7a -0.14 0.88 2009 homolog 1 (Drosophila) GLRX NM_002064
498 glutaredoxin hsa-let-7d -0.23 0.78 2009 (thioltransferase) GNS
NM_002076 499 glucosamine (N- hsa-miR- >-0.01 0.88 2005,
acetyl)-6-sulfatase 4458 2007, 2009 HLF NM_002126 500 hepatic
leukemia hsa-miR- -0.06 0.87 2007, factor 4500 2009 HMGA1 NM_002131
501 high mobility group hsa-let-7i -0.25 0.94 2005, AT-hook 1 2007,
2009 IDH2 NM_002168 502 isocitrate hsa-let-7d -0.12 0.83 2005,
dehydrogenase 2 2007 (NADP+), mitochondrial IL13 NM_002188 503
interleukin 13 hsa-miR- -0.32 0.98 2005, 4500 2007, 2009 ITGB8
NM_002214 504 integrin, beta 8 hsa-let-7i -0.1 0.94 2007,
2009 KCNA6 NM_002235 505 potassium voltage- hsa-miR- >-0.03 0.44
2009 gated channel, shaker- 4458 related subfamily, member 6 KPNA1
NM_002264 506 karyopherin alpha 1 hsa-miR- -0.15 0.93 2007,
(importin alpha 5) 4458 2009 KPNA4 NM_002268 507 karyopherin alpha
4 hsa-miR- -0.08 0.97 2005, (importin alpha 3) 4458 2007 LBR
NM_002296 508 lamin B receptor hsa-miR- -0.21 0.98 2009 4458 LY75
NM_002349 509 lymphocyte antigen hsa-let-7d -0.17 0.8 2009 75
MAP3K3 NM_002401 510 mitogen-activated hsa-miR- -0.06 0.95 2005,
protein kinase kinase 4458 2007, kinase 3 2009 MSR1 NM_002445 511
macrophage hsa-let-7a -0.37 0.98 scavenger receptor 1 NGF NM_002506
512 nerve growth factor hsa-miR- -0.34 0.93 2009 (beta polypeptide)
4458 NOVA1 NM_002515 513 neuro-oncological hsa-let-7d -0.11 0.92
2005, ventral antigen 1 2007, 2009 NRAS NM_002524 514 neuroblastoma
RAS hsa-miR- -0.35 >0.99 2005, viral (v-ras) oncogene 4500 2007,
homolog 2009 P2RX1 NM_002558 515 purinergic receptor hsa-miR- -0.12
0.9 2009 P2X, ligand-gated ion 4458 channel, 1 PAPPA NM_002581 516
pregnancy-associated hsa-miR-98 -0.2 >0.99 2005, plasma protein
A, 2007, pappalysin 1 2009 PBX2 NM_002586 517 pre-B-cell leukemia
hsa-miR- -0.22 >0.99 2005, homeobox 2 4500 2007, 2009 PDGFB
NM_002608 518 platelet-derived hsa-miR- -0.11 0.88 2005, growth
factor beta 4458 2007, polypeptide 2009 PIGA NM_002641 519
phosphatidylinositol hsa-miR- -0.29 0.94 2005, glycan anchor 4500
2007, biosynthesis, class A 2009 PLAGL2 NM_002657 520 pleiomorphic
hsa-miR- -0.12 0.91 2005, adenoma gene-like 2 4500 2007, 2009 MAPK6
NM_002748 521 mitogen-activated hsa-let-7b -0.38 0.94 2005, protein
kinase 6 2007, 2009 MAPK11 NM_002751 522 mitogen-activated hsa-miR-
-0.11 0.79 2009 protein kinase 11 4458 MAPK9 NM_002752 523
mitogen-activated hsa-miR- -0.05 0.77 protein kinase 9 4458 PTPRO
NM_002848 524 protein tyrosine hsa-let-7d -0.14 0.88 2009
phosphatase, receptor type, O RALB NM_002881 525 v-ral simian
leukemia hsa-miR- -0.17 0.94 2009 viral oncogene 4458 homolog B
(ras related; GTP binding protein) RBMS1 NM_002897 526 RNA binding
motif, hsa-let-7d -0.25 0.96 single stranded interacting protein 1
RBMS2 NM_002898 527 RNA binding motif, hsa-let-7a -0.1 0.98 single
stranded interacting protein 2 RCN1 NM_002901 528 reticulocalbin 1,
EF- hsa-let-7d -0.17 0.85 2009 hand calcium binding domain RDX
NM_002906 529 radixin hsa-let-7a -0.25 0.75 2005, 2007, 2009 RGS16
NM_002928 530 regulator of G-protein hsa-miR- -0.31 0.98 2005,
signaling 16 4500 2007, 2009 S100A8 NM_002964 531 S100 calcium
binding hsa-miR- -0.18 0.69 protein A8 4500 CCL3 NM_002983 532
chemokine (C-C hsa-miR- -0.23 0.87 2009 motif) ligand 3 4458
ST3GAL1 NM_003033 533 ST3 beta-galactoside hsa-miR- >-0.01 0.89
alpha-2,3- 4458 sialyltransferase 1 ST8SIA1 NM_003034 534 ST8
alpha-N-acetyl- hsa-let-7f -0.29 0.94 2009 neuraminide alpha-
2,8-sialyltransferase 1 SLC6A1 NM_003042 535 solute carrier family
6 hsa-miR- -0.19 0.95 2005, (neurotransmitter 4458 2007,
transporter, GABA), 2009 member 1 SMARCC1 NM_003074 536 SWI/SNF
related, hsa-let-7g -0.13 0.91 2005, matrix associated, 2007, actin
dependent 2009 regulator of chromatin, subfamily c, member 1 SNX1
NM_003099 537 sorting nexin 1 hsa-miR- -0.2 <0.1 2009 4458 STRN
NM_003162 538 striatin, calmodulin hsa-miR- -0.14 0.95 binding
protein 4458 TEAD3 NM_003214 539 TEA domain family hsa-miR- -0.08
0.91 2007, member 3 4458 2009 THBS1 NM_003246 540 thrombospondin 1
hsa-let-7c -0.16 0.86 2009 THRSP NM_003251 541 thyroid hormone
hsa-let-7d -0.62 0.74 2009 responsive VSNL1 NM_003385 542
visinin-like 1 hsa-miR- -0.11 0.79 2005, 4458 2007, 2009 ZNF202
NM_003455 543 zinc finger protein hsa-let-7d -0.36 <0.1 202 BSN
NM_003458 544 bassoon (presynaptic hsa-let-7a -0.09 0.94 2009
cytomatrix protein) MLL2 NM_003482 545 myeloid/lymphoid or hsa-miR-
-0.26 0.98 2007, mixed-lineage 4458 2009 leukemia 2 HMGA2 NM_003483
546 high mobility group hsa-miR- -1.04 >0.99 2005, AT-hook 2
4458 2007, 2009 SNN NM_003498 547 stannin hsa-miR- -0.15 0.87 2005,
4458 2007, 2009 EEA1 NM_003566 548 early endosome hsa-miR- -0.21
0.94 2007, antigen 1 4458 2009 ZNF282 NM_003575 549 zinc finger
protein hsa-miR- >-0.02 0.94 2009 282 4458 DYRK2 NM_003583 550
dual-specificity hsa-miR- -0.12 0.87 2009 tyrosine-(Y)- 4500
phosphorylation regulated kinase 2 SLC4A7 NM_003615 551 solute
carrier family hsa-let-7g -0.02 0.81 2005, 4, sodium bicarbonate
2007 cotransporter, member 7 MAP4K3 NM_003618 552 mitogen-activated
hsa-miR-98 -0.46 0.96 2005, protein kinase kinase 2007, kinase
kinase 3 2009 NDST2 NM_003635 553 N-deacetylase/N- hsa-miR- -0.32
0.96 2005, sulfotransferase 4458 2007, (heparan 2009 glucosaminyl)
2 IKBKAP NM_003640 554 inhibitor of kappa hsa-miR- -0.27 0.93 2005,
light polypeptide gene 4458 2007, enhancer in B-cells, 2009 kinase
complex- associated protein CHRD NM_003741 555 chordin hsa-miR-
-0.15 0.87 2005, 4458 2007 NCOA1 NM_003743 556 nuclear receptor
hsa-let-7d -0.07 0.7 2005, coactivator 1 2007 IRS2 NM_003749 557
insulin receptor hsa-miR- -0.28 0.98 2005, substrate 2 4458 2007,
2009 GALNT4 NM_003774 558 UDP-N-acetyl-alpha- hsa-let-7a -0.1 0.84
2009 D- galactosamine:polypeptide N-
acetylgalactosaminyltransferase 4 (GalNAc-T4) RNMT NM_003799 559
RNA (guanine-7-) hsa-miR- -0.31 <0.1 methyltransferase 4458
TNFSF9 NM_003811 560 tumor necrosis factor hsa-let-7d -0.35 0.98
2009 (ligand) superfamily, member 9 SNAP23 NM_003825 561
synaptosomal- hsa-miR- -0.26 0.93 2005, associated protein, 4500
2007, 23 kDa 2009 RIOK3 NM_003831 562 RIO kinase 3 (yeast) hsa-miR-
-0.26 0.94 2005, 4500 2007, 2009 SUCLG2 NM_003848 563 succinate-CoA
ligase, hsa-let-7a -0.14 0.89 2009 GDP-forming, beta subunit EIF2S2
NM_003908 564 eukaryotic translation hsa-miR- -0.22 0.92 2009
initiation factor 2, 4458 subunit 2 beta, 38 kDa MBD2 NM_003927 565
methyl-CpG binding hsa-let-7f -0.29 >0.99 domain protein 2 WASL
NM_003941 566 Wiskott-Aldrich hsa-let-7d -0.17 0.87 2009
syndrome-like RNF8 NM_003958 567 ring finger protein 8 hsa-miR-
-0.1 0.68 4500 OSMR NM_003999 568 oncostatin M receptor hsa-miR-
-0.27 0.94 2005, 4458 2007, 2009 E2F2 NM_004091 569 E2F
transcription hsa-let-7d -0.28 0.94 2009 factor 2 FGF11 NM_004112
570 fibroblast growth hsa-miR-98 -0.26 0.93 2005, factor 11 2007,
2009 TARBP2 NM_004178 571 TAR (HIV-1) RNA hsa-miR- -0.2 0.93 2009
binding protein 2 4458 SEMA3F NM_004186 572 sema domain, hsa-miR-
-0.16 0.72 2005, immunoglobulin 4458 2007 domain (Ig), short basic
domain, secreted, (semaphorin) 3F SYT7 NM_004200 573 synaptotagmin
VII hsa-miR-98 -0.25 0.98 2007, 2009 AURKB NM_004217 574 aurora
kinase B hsa-miR- -0.26 0.78 4458 CYTH3 NM_004227 575 cytohesin 3
hsa-miR- -0.02 0.9 2005, 4458 2007, 2009 SEMA4F NM_004263 576 sema
domain, hsa-miR- -0.4 0.97 2009 immunoglobulin 4500 domain (Ig),
transmembrane domain (TM) and short cytoplasmic domain,
(semaphorin) 4F CHST3 NM_004273 577 carbohydrate hsa-miR- -0.11
0.99 2009 (chondroitin 6) 4458 sulfotransferase 3 AKAP6 NM_004274
578 A kinase (PRKA) hsa-let-7c -0.28 0.95 2005, anchor protein 6
2007, 2009 SLC25A27 NM_004277 579 solute carrier family hsa-miR-
-0.29 0.95 2005, 25, member 27 4458 2007, 2009 ACVR1B NM_004302 580
activin A receptor, hsa-let-7g -0.12 0.95 2005, type IB 2007, 2009
CASP3 NM_004346 581 caspase 3, apoptosis- hsa-let-7b -0.4 0.99
2005, related cysteine 2007, peptidase 2009 CDC34 NM_004359 582
cell division cycle 34 hsa-miR- -0.47 >0.99 2005, homolog (S.
cerevisiae) 4500 2007, 2009 DUSP1 NM_004417 583 dual specificity
hsa-miR- -0.18 0.87 2005, phosphatase 1 4500 2007, 2009 DVL3
NM_004423 584 dishevelled, dsh hsa-let-7f -0.41 0.89 2009 homolog 3
(Drosophila) EPHA4 NM_004438 585 EPH receptor A4 hsa-miR- -0.18
0.87 2005, 4500 2007, 2009 FGF5 NM_004464 586 fibroblast growth
hsa-miR- -0.11 0.93 2009 factor 5 4458 GALNT2 NM_004481 587
UDP-N-acetyl-alpha- hsa-miR- -0.18 0.94 2005, D- 4500 2007,
galactosamine:polypeptide 2009 N- acetylgalactosaminyltransferase 2
(GalNAc-T2) USP6 NM_004505 588 ubiquitin specific hsa-let-7a -0.18
0.92 2005, peptidase 6 (Tre-2 2007, oncogene) 2009 NAP1L1 NM_004537
589 nucleosome assembly hsa-let-7d -0.41 >0.99 2005, protein
1-like 1 2007, 2009
NRTN NM_004558 590 neurturin hsa-miR- N/A 0.85 2007, 4458 2009
RPS6KA3 NM_004586 591 ribosomal protein S6 hsa-miR-98 -0.1 0.94
2005, kinase, 90 kDa, 2007, polypeptide 3 2009 COIL NM_004645 592
coilin hsa-miR- -0.5 0.96 2005, 4500 2007, 2009 KCNQ4 NM_004700 593
potassium voltage- hsa-let-7d -0.18 0.94 gated channel, KQT- like
subfamily, member 4 NUMBL NM_004756 594 numb homolog hsa-miR- -0.04
0.94 2005, (Drosophila)-like 4500 2007, 2009 NDST3 NM_004784 595
N-deacetylase/N- hsa-let-7d -0.18 0.83 sulfotransferase (heparan
glucosaminyl) 3 POLR2D NM_004805 596 polymerase (RNA) II hsa-let-7b
-0.42 <0.1 2009 (DNA directed) polypeptide D HAND1 NM_004821 597
heart and neural crest hsa-let-7a -0.44 0.98 2005, derivatives
expressed 1 2007, 2009 NTN1 NM_004822 598 netrin 1 hsa-miR- -0.26
0.84 2009 4500 ONECUT2 NM_004852 599 one cut homeobox 2 hsa-miR-
-0.13 >0.99 2007, 4500 2009 AKAP5 NM_004857 600 A kinase (PRKA)
hsa-miR- >-0.03 0.72 2009 anchor protein 5 4458 IGDCC3 NM_004884
601 immunoglobulin hsa-miR- -0.72 >0.99 2003, superfamily, DCC
4500 2007, subclass, member 3 2009 SEC24C NM_004922 602 SEC24
family, hsa-miR-98 -0.1 0.82 2005, member C (S. cerevisiae) 2007,
2009 DAPK1 NM_004938 603 death-associated hsa-let-7g -0.18 0.93
2009 protein kinase 1 DOCK3 NM_004947 604 dedicator of hsa-miR-
-0.07 0.9 2005, cytokinesis 3 4458 2007, 2009 KCNC1 NM_004976 605
potassium voltage- hsa-miR- -0.1 0.91 2009 gated channel, Shaw-
4458 related subfamily, member 1 NME4 NM_005009 606 non-metastatic
cells 4, hsa-let-7d -0.19 0.94 2003, protein expressed in 2005,
2007, 2009 QARS NM_005051 607 glutaminyl-tRNA hsa-let-7i -0.37 0.2
2005, synthetase 2007, 2009 SCD NM_005063 608 stearoyl-CoA
hsa-miR-98 -0.33 0.95 2007, desaturase (delta-9- 2009 desaturase)
SIM2 NM_005069 609 single-minded hsa-let-7d -0.08 0.9 2009 homolog
2 (Drosophila) ADRBK2 NM_005160 610 adrenergic, beta, hsa-miR-98
-0.15 0.89 2009 receptor kinase 2 CBFA2T3 NM_005187 611
core-binding factor, hsa-miR- -0.06 0.94 2005, runt domain, alpha
4458 2007, subunit 2; 2009 translocated to, 3 CBL NM_005188 612
Cas-Br-M (murine) hsa-miR- -0.07 0.96 2005, ecotropic retroviral
4500 2007, transforming 2009 sequence CBX2 NM_005189 613 chromobox
homolog 2 hsa-miR- -0.15 0.94 2007, 4458 2009 CEBPD NM_005195 614
CCAAT/enhancer hsa-let-7d -0.09 0.86 2009 binding protein (C/EBP),
delta ARID3A NM_005224 615 AT rich interactive hsa-miR- -0.11 0.9
2007, domain 3A 4458 2009 (BRIGHT-like) EPHA3 NM_005233 616 EPH
receptor A3 hsa-miR- -0.14 0.93 2005, 4500 2007 ERCC4 NM_005236 617
excision repair cross- hsa-miR- -0.1 0.98 2009 complementing 4500
rodent repair deficiency, complementation group 4 GNG5 NM_005274
618 guanine nucleotide hsa-miR- -0.28 0.81 2005, binding protein (G
4458 2007, protein), gamma 5 2009 HAS2 NM_005328 619 hyaluronan
synthase 2 hsa-let-7d -0.12 0.87 2005, 2007, 2009 HDLBP NM_005336
620 high density hsa-miR- -0.21 0.98 2007, lipoprotein binding 4458
2009 protein MYCN NM_005378 621 v-myc hsa-let-7i -0.34 0.95 2005,
myelocytomatosis 2007, viral related 2009 oncogene, neuroblastoma
derived (avian) NUP98 NM_005387 622 nucleoporin 98 kDa hsa-let-7d
-0.23 0.85 PRKAB2 NM_005399 623 protein kinase, AMP- hsa-miR-
>-0.02 0.89 2009 activated, beta 2 non- 4458 catalytic subunit
SLC20A1 NM_005415 624 solute carrier family hsa-miR- -0.31 0.87
2005, 20 (phosphate 4458 2007 transporter), member 1 WNT1 NM_005430
625 wingless-type MMTV hsa-let-7d -0.07 0.88 2005, integration site
2007, family, member 1 2009 GABBR2 NM_005458 626 gamma-aminobutyric
hsa-miR- -0.07 0.89 2009 acid (GABA) B 4458 receptor, 2 MED6
NM_005466 627 mediator complex hsa-let-7d -0.14 0.86 2005, subunit
6 2007, 2009 SH2B3 NM_005475 628 SH2B adaptor protein 3 hsa-miR-
-0.13 0.94 2007, 4500 2009 INPP5A NM_005539 629 inositol hsa-let-7d
-0.1 0.92 2005, polyphosphate-5- 2007, phosphatase, 40 kDa 2009
ISLR NM_005545 630 immunoglobulin hsa-let-7b -0.23 0.86 superfamily
containing leucine- rich repeat LIMK2 NM_005569 631 LIM domain
kinase 2 hsa-miR-98 -0.14 0.76 MDFI NM_005586 632 MyoD family
hsa-miR- -0.11 0.94 2007, inhibitor 4500 2009 ZNF354A NM_005649 633
zinc finger protein hsa-miR- -0.27 0.93 2005, 354A 4500 2007, 2009
SOX13 NM_005686 634 SRY (sex determining hsa-let-7g -0.16 0.9 2005,
region Y)-box 13 2007, 2009 ABCC5 NM_005688 635 ATP-binding
cassette, hsa-miR- -0.34 0.67 2005, sub-family C 4500 2007,
(CFTR/MRP), 2009 member 5 DPP3 NM_005700 636 dipeptidyl-peptidase 3
hsa-miR- -0.35 0.91 2005, 4458 2007, 2009 GIPC1 NM_005716 637 GIPC
PDZ domain hsa-miR- -0.26 0.9 2007, containing family, 4458 2009
member 1 TSPAN2 NM_005725 638 tetraspanin 2 hsa-let-7g -0.09 0.94
2009 PLXNC1 NM_005761 639 plexin C1 hsa-miR- -0.33 0.33 4458 AASS
NM_005763 640 aminoadipate- hsa-miR- -0.16 <0.1 semialdehyde
4458 synthase FARP1 NM_005766 641 FERM, RhoGEF hsa-miR- -0.16 0.93
2005, (ARHGEF) and 4500 2007, pleckstrin domain 2009 protein 1
(chondrocyte-derived) NME6 NM_005793 642 non-metastatic cells 6,
hsa-miR- -0.27 0.94 2005, protein expressed in 4458 2007,
(nucleoside- 2009 diphosphate kinase) SPEG NM_005876 643 SPEG
complex locus hsa-let-7d -0.11 0.9 2009 DNAJA2 NM_005880 644 DnaJ
(Hsp40) hsa-miR- -0.28 0.79 homolog, subfamily 4458 A, member 2
APC2 NM_005883 645 adenomatosis hsa-miR- -0.11 0.83 2009 polyposis
coli 2 4458 MEF2D NM_005920 646 myocyte enhancer hsa-miR- >-0.04
0.94 2005, factor 2D 4458 2007, 2009 MAP3K1 NM_005921 647
mitogen-activated hsa-miR- -0.39 0.86 2009 protein kinase kinase
4458 kinase 1 MMP11 NM_005940 648 matrix hsa-let-7d -0.12 0.92
2007, metallopeptidase 11 2009 (stromelysin 3) ALKBH1 NM_006020 649
alkB, alkylation repair hsa-miR- -0.16 0.89 2009 homolog 1 (E.
coli) 4500 APBB3 NM_006051 650 amyloid beta (A4) hsa-let-7a -0.41
0.98 2005, precursor protein- 2007, binding, family B, 2009 member
3 DAGLA NM_006133 651 diacylglycerol lipase, hsa-miR- -0.27 0.97
2007, alpha 4458 2009 PRKAA2 NM_006252 652 protein kinase, AMP-
hsa-let-7f -0.17 0.93 2009 activated, alpha 2 catalytic subunit
RANBP2 NM_006267 653 RAN binding protein 2 hsa-miR- -0.38 0.98
2005, 4458 2007, 2009 DPF2 NM_006268 654 D4, zinc and double
hsa-let-7g -0.21 0.94 2005, PHD fingers family 2 2007, 2009 CCL7
NM_006273 655 chemokine (C-C hsa-miR- -0.39 0.9 2009 motif) ligand
7 4458 TNFAIP3 NM_006290 656 tumor necrosis factor, hsa-miR- -0.08
0.92 2009 alpha-induced protein 3 4458 SMC1A NM_006306 657
structural hsa-let-7a -0.46 >0.99 2009 maintenance of
chromosomes 1A PCGF3 NM_006315 658 polycomb group ring hsa-let-7a
-0.11 0.98 2005, finger 3 2007, 2009 CRTAP NM_006371 659 cartilage
associated hsa-miR- -0.11 0.94 2005, protein 4500 2007, 2009 APPBP2
NM_006380 660 amyloid beta hsa-miR- -0.02 0.92 2005, precursor
protein 4458 2007 (cytoplasmic tail) binding protein 2 OLFM4
NM_006418 661 olfactomedin 4 hsa-miR- -0.37 <0.1 4500 ARID3B
NM_006465 662 AT rich interactive hsa-let-7i -0.72 >0.99 2005,
domain 3B 2007, (BRIGHT-like) 2009 IGF2BP3 NM_006547 663
insulin-like growth hsa-let-7a -0.33 0.96 2007, factor 2 mRNA 2009
binding protein 3 CLDN16 NM_006580 664 claudin 16 hsa-miR-98 -0.3
<0.1 MAP3K2 NM_006609 665 mitogen-activated hsa-let-7a -0.1 0.8
protein kinase kinase kinase 2 ARPP19 NM_006628 666 cAMP-regulated
hsa-miR-98 -0.09 0.98 2005, phosphoprotein, 2007, 19 kDa 2009
PGRMC1 NM_006667 667 progesterone receptor hsa-miR- -0.46 0.98
2005, membrane component 1 4458 2007, 2009 CYP46A1 NM_006668 668
cytochrome P450, hsa-let-7a -0.17 0.89 2007, family 46, subfamily
2009 A, polypeptide 1 SUB1 NM_006713 669 SUB1 homolog (S.
cerevisiae) hsa-miR- -0.36 0.84 4500 BTG2 NM_006763 670 BTG family,
member 2 hsa-miR- -0.12 0.89 2005, 4458 2007, 2009 PKIA NM_006823
671 protein kinase hsa-miR- -0.18 0.94 (cAMP-dependent, 4458
catalytic) inhibitor alpha B3GNT1 NM_006876 672 UDP- hsa-miR- -0.34
0.93 2007, GlcNAc:betaGal beta- 4500 2009 1,3-N-
acetylglucosaminyltransferase 1 CALM1 NM_006888 673 calmodulin 1
hsa-miR- -0.1 0.93 2005, (phosphorylase 4500 2007, kinase, delta)
2009 PRRX1 NM_006902 674 paired related hsa-miR-98 -0.05 0.95 2007,
homeobox 1 2009 RNF5 NM_006913 675 ring finger protein 5 hsa-miR-
-0.26 0.64 2005, 4458 2007, 2009 ZNF24 NM_006965 676 zinc finger
protein 24 hsa-miR- -0.12 0.94
4500 ADAMTS1 NM_006988 677 ADAM hsa-miR-98 -0.12 0.84 2009
metallopeptidase with thrombospondin type 1 motif, 1 ZNF197
NM_006991 678 zinc finger protein hsa-let-7a -0.38 0.12 197 SLC35D2
NM_007001 679 solute carrier family hsa-let-7d -0.48 0.98 2005, 35,
member D2 2007, 2009 CNTRL NM_007018 680 centriolin hsa-miR- -0.42
0.98 2009 4458 ADAMTS8 NM_007037 681 ADAM hsa-miR- -0.4 0.98 2007,
metallopeptidase with 4500 2009 thrombospondin type 1 motif, 8
ADAMTS5 NM_007038 682 ADAM hsa-miR- -0.18 0.95 2005,
metallopeptidase with 4458 2007, thrombospondin type 2009 1 motif,
5 UTRN NM_007124 683 utrophin hsa-miR- -0.35 0.9 2007, 4458 2009
ZNF81 NM_007137 684 zinc finger protein 81 hsa-miR- -0.07 0.81 4500
TUSC2 NM_007275 685 tumor suppressor hsa-miR- -0.12 0.93 2005,
candidate 2 4458 2007, 2009 AP4E1 NM_007347 686 adaptor-related
hsa-miR- >-0.02 0.57 protein complex 4, 4458 epsilon 1 subunit
NID2 NM_007361 687 nidogen 2 hsa-miR- -0.16 0.92 2005,
(osteonidogen) 4500 2007, 2009 BRD3 NM_007371 688 bromodomain
hsa-miR- -0.11 0.94 2005, containing 3 4500 2007, 2009 ICOS
NM_012092 689 inducible T-cell co- hsa-let-7b -0.24 0.92 2009
stimulator ANGPTL2 NM_012098 690 angiopoietin-like 2 hsa-miR- -0.13
0.93 2005, 4458 2007, 2009 BACE2 NM_012105 691 beta-site APP-
hsa-miR- -0.27 0.93 2009 cleaving enzyme 2 4500 FZD4 NM_012193 692
frizzled family hsa-miR- -0.33 0.94 2007, receptor 4 4500 2009
EIF2C1 NM_012199 693 eukaryotic translation hsa-miR- -0.16 0.93
2005, initiation factor 2C, 1 4500 2007, 2009 B3GAT3 NM_012200 694
beta-1,3- hsa-miR- -0.18 0.88 2009 glucuronyltransferase 3 4458
(glucuronosyltransferase I) MGAT4A NM_012214 695 mannosyl
(alpha-1,3-)- hsa-miR- -0.29 0.95 2005, glycoprotein beta- 4500
2007, 1,4-N- 2009 acetylglucosaminyltransferase, isozyme A HS2ST1
NM_012262 696 heparan sulfate 2-O- hsa-miR-98 -0.06 0.89 2009
sulfotransferase 1 ESPL1 NM_012291 697 extra spindle pole
hsa-miR-98 -0.28 0.57 bodies homolog 1 (S. cerevisiae) PXDN
NM_012293 698 peroxidasin homolog hsa-miR- -0.12 >0.99 2007,
(Drosophila) 4500 2009 GAB2 NM_012296 699 GRB2-associated hsa-miR-
-0.15 0.6 2009 binding protein 2 4458 PLA2G15 NM_012320 700
phospholipase A2, hsa-miR- -0.09 0.92 2005, group XV 4458 2007,
2009 DNAJB9 NM_012328 701 DnaJ (Hsp40) hsa-miR- -0.1 0.91 2005,
homolog, subfamily 4500 2007, B, member 9 2009 MYCBP NM_012333 702
c-myc binding protein hsa-miR- -0.08 0.98 2009 4458 MYO1F NM_012335
703 myosin IF hsa-miR- -0.22 0.93 2007, 4500 2009 NNT NM_012343 704
nicotinamide hsa-miR- -0.26 0.87 2009 nucleotide 4458
transhydrogenase PLDN NM_012388 705 pallidin homolog hsa-miR- -0.07
0.94 2005, (mouse) 4500 2007, 2009 CDK14 NM_012395 706
cyclin-dependent hsa-miR- -0.16 0.67 kinase 14 4500 ICMT NM_012405
707 isoprenylcysteine hsa-miR- >-0.03 0.98 2009 carboxyl 4458
methyltransferase RAB3GAP2 NM_012414 708 RAB3 GTPase hsa-let-7d
-0.18 0.94 activating protein subunit 2 (non- catalytic) PPARGC1A
NM_013261 709 peroxisome hsa-miR- -0.11 0.83 2005,
proliferator-activated 4500 2007, receptor gamma, 2009 coactivator
1 alpha EEF2K NM_013302 710 eukaryotic elongation hsa-let-7d -0.17
0.95 2007, factor-2 kinase 2009 SLC30A4 NM_013309 711 solute
carrier family hsa-let-7a -0.14 0.94 2005, 30 (zinc transporter),
2007, member 4 2009 HCFC2 NM_013320 712 host cell factor C2
hsa-miR- -0.04 0.91 4500 ATG4B NM_013325 713 ATG4 autophagy
hsa-let-7a -0.19 0.79 2009 related 4 homolog B (S. cerevisiae)
GPR132 NM_013345 714 G protein-coupled hsa-let-7f -0.21 <0.1
receptor 132 TRHDE NM_013381 715 thyrotropin-releasing hsa-let-7d
-0.19 0.99 2005, hormone degrading 2007, enzyme 2009 SLC25A24
NM_013386 716 solute carrier family hsa-miR- -0.24 0.94 2005, 25
(mitochondrial 4458 2007, carrier; phosphate 2009 carrier), member
24 WDR37 NM_014023 717 WD repeat domain 37 hsa-let-7a -0.21 0.99
2005, 2007, 2009 PSORS1C2 NM_014069 718 psoriasis hsa-let-7d -0.15
0.93 susceptibility 1 candidate 2 SCN11A NM_014139 719 sodium
channel, hsa-miR- -0.36 0.91 2007, voltage-gated, type 4458 2009
XI, alpha subunit HOXC11 NM_014212 720 homeobox C11 hsa-miR- -0.08
0.94 2005, 4458 2007, 2009 LIMD1 NM_014240 721 LIM domains
hsa-let-7b -0.05 0.92 2005, containing 1 2007, 2009 HABP4 NM_014282
722 hyaluronan binding hsa-miR- -0.18 0.94 2009 protein 4 4458 TGDS
NM_014305 723 TDP-glucose 4,6- hsa-miR- -0.24 0.95 2009 dehydratase
4500 SMUG1 NM_014311 724 single-strand- hsa-let-7d -0.35 0.92 2009
selective monofunctional uracil-DNA glycosylase 1 CACNG4 NM_014405
725 calcium channel, hsa-miR- -0.17 0.84 2005, voltage-dependent,
4458 2007, gamma subunit 4 2009 KIAA1274 NM_014431 726 KIAA1274
hsa-miR-98 -0.38 0.98 2009 ZKSCAN5 NM_014569 727 zinc finger with
hsa-miR- -0.1 0.77 KRAB and SCAN 4458 domains 5 ERO1L NM_014584 728
ERO1-like (S. cerevisiae) hsa-miR- -0.18 0.88 2009 4500 SOCS7
NM_014598 729 suppressor of hsa-miR- >-0.02 0.92 cytokine
signaling 7 4458 UBXN4 NM_014607 730 UBX domain protein 4
hsa-let-7a -0.15 0.89 2005, 2007, 2009 RALGPS1 NM_014636 731 Ral
GEF with PH hsa-miR- -0.15 0.94 2005, domain and SH3 4500 2007,
binding motif 1 2009 TTLL4 NM_014640 732 tubulin tyrosine
hsa-let-7d -0.56 >0.99 2003, ligase-like family, 2005, member 4
2007, 2009 ZNF516 NM_014643 733 zinc finger protein hsa-miR- -0.04
0.95 2009 516 4500 GREB1 NM_014668 734 growth regulation by
hsa-miR- -0.17 0.88 2009 estrogen in breast 4500 cancer 1 ULK2
NM_014683 735 unc-51-like kinase 2 hsa-miR-98 -0.14 0.95 2005, (C.
elegans) 2007, 2009 SEC14L5 NM_014692 736 SEC14-like 5 (S.
cerevisiae) hsa-let-7d -0.14 0.98 2009 TBKBP1 NM_014726 737 TBK1
binding protein 1 hsa-miR- -0.36 0.97 2007, 4500 2009 RIMS3
NM_014747 738 regulating synaptic hsa-miR- >-0.01 0.92 2009
membrane exocytosis 3 4458 TSC22D2 NM_014779 739 TSC22 domain
hsa-miR- -0.16 0.87 2005, family, member 2 4458 2007, 2009 LRIG2
NM_014813 740 leucine-rich repeats hsa-let-7d -0.48 0.95 2005, and
immunoglobulin- 2007, like domains 2 2009 ZBTB39 NM_014830 741 zinc
finger and BTB hsa-miR- -0.04 0.98 2007, domain containing 39 4458
2009 TRANK1 NM_014831 742 tetratricopeptide hsa-let-7b -0.3 0.85
2009 repeat and ankyrin repeat containing 1 TECPR2 NM_014844 743
tectonin beta- hsa-let-7d -0.13 0.94 2005, propeller repeat 2007,
containing 2 2009 ZBTB5 NM_014872 744 zinc finger and BTB
hsa-let-7f -0.23 0.92 2005, domain containing 5 2007, 2009 LPGAT1
NM_014873 745 lysophosphatidylglycerol hsa-let-7g -0.34 >0.99
2005, acyltransferase 1 2007, 2009 HELZ NM_014877 746 helicase with
zinc hsa-let-7d -0.28 0.9 finger RNF44 NM_014901 747 ring finger
protein 44 hsa-let-7i -0.14 0.94 2005, 2007, 2009 AAK1 NM_014911
748 AP2 associated kinase 1 hsa-miR- >-0.03 0.92 2007, 4458 2009
DZIP1 NM_014934 749 DAZ interacting hsa-miR- -0.11 0.94 2005,
protein 1 4500 2007, 2009 MLXIP NM_014938 750 MLX interacting
hsa-miR- -0.11 0.8 protein 4458 BAHD1 NM_014952 751 bromo adjacent
hsa-miR- -0.05 0.89 2005, homology domain 4458 2007, containing 1
2009 CEP164 NM_014956 752 centrosomal protein hsa-miR- -0.08 0.93
2005, 164 kDa 4458 2007, 2009 RUFY3 NM_014961 753 RUN and FYVE
hsa-let-7f -0.13 0.93 2007, domain containing 3 2009 BTBD3
NM_014962 754 BTB (POZ) domain hsa-let-7c -0.19 0.92 2005,
containing 3 2007, 2009 MON2 NM_015026 755 MON2 homolog (S.
cerevisiae) hsa-miR- -0.09 0.94 2007, 4458 2009 NMNAT2 NM_015039
756 nicotinamide hsa-miR- >-0.01 0.72 nucleotide 4458
adenylyltransferase 2 RRP1B NM_015056 757 ribosomal RNA hsa-miR-
-0.09 0.93 2007, processing 1 homolog 4458 2009 B (S. cerevisiae)
SLC8A2 NM_015063 758 solute carrier family 8 hsa-miR- -0.07 0.91
2005, (sodium/calcium 4458 2007, exchanger), member 2 2009 DDN
NM_015086 759 dendrin hsa-miR- -0.18 0.92 2009 4500 TAB2 NM_015093
760 TGF-beta activated hsa-miR- -0.16 0.83 2005, kinase 1/MAP3K7
4500 2007, binding protein 2 2009 HIC2 NM_015094 761
hypermethylated in hsa-miR- -0.45 >0.99 2003, cancer 2 4458
2005, 2007, 2009 PLXND1 NM_015103 762 plexin D1 hsa-miR- -0.35 0.98
2007, 4500 2009 ZC3H3 NM_015117 763 zinc finger CCCH- hsa-let-7d
-0.3 0.98 2007, type containing 3 2009 FRMD4B NM_015123 764 FERM
domain hsa-miR- -0.31 0.86 2009 containing 4B 4500 DTX4 NM_015177
765 deltex homolog 4 hsa-miR- -0.06 0.98 2009 (Drosophila) 4500
OTUD3 NM_015207 766 OTU domain hsa-miR- >-0.01 0.82 2009
containing 3 4458 KHNYN NM_015299 767 KH and NYN domain hsa-let-7f
-0.44 0.93 containing USP24 NM_015306 768 ubiquitin specific
hsa-miR- -0.26 0.93 2009 peptidase 24 4458 FAM189A1 NM_015307 769
family with sequence hsa-miR- -0.19 0.94 2009
similarity 189, 4458 member A1 LEPROTL1 NM_015344 770 leptin
receptor hsa-let-7d -0.09 0.82 2005, overlapping 2007
transcript-like 1 ZFYVE26 NM_015346 771 zinc finger, FYVE hsa-miR-
-0.38 0.98 2005, domain containing 26 4458 2007, 2009 PARM1
NM_015393 772 prostate androgen- hsa-miR- -0.24 0.97 2009 regulated
mucin-like 4458 protein 1 ARMC8 NM_015396 773 armadillo repeat
hsa-miR- -0.1 0.87 containing 8 4500 AHCTF1 NM_015446 774 AT hook
containing hsa-miR- -0.38 0.4 2007, transcription factor 1 4458
2009 MYRIP NM_015460 775 myosin VIIA and Rab hsa-miR- -0.11 0.85
2005, interacting protein 4458 2007, 2009 SLC22A23 NM_015482 776
solute carrier family hsa-miR- -0.27 0.98 22, member 23 4458 PNKD
NM_015488 777 paroxysmal hsa-miR- -0.14 0.76 2007, nonkinesigenic
4458 2009 dyskinesia SEC31B NM_015490 778 SEC31 homolog B (S.
cerevisiae) hsa-miR- -0.15 0.82 2009 4458 C15orf39 NM_015492 779
chromosome 15 open hsa-let-7a -0.31 0.93 2009 reading frame 39
LRIG1 NM_015541 780 leucine-rich repeats hsa-miR- N/A 0.95 2005,
and immunoglobulin- 4458 2007, like domains 1 2009 OSBPL3 NM_015550
781 oxysterol binding hsa-miR- -0.2 0.95 2005, protein-like 3 4458
2007, 2009 LTN1 NM_015565 782 listerin E3 ubiquitin hsa-let-7d
-0.22 0.93 2005, protein ligase 1 2007, 2009 PLA2G3 NM_015715 783
phospholipase A2, hsa-let-7a -0.35 0.91 2009 group III DCAF8
NM_015726 784 DDB1 and CUL4 hsa-miR- -0.1 0.66 associated factor 8
4500 WARS2 NM_015836 785 tryptophanyl tRNA hsa-miR- -0.3 <0.1
2009 synthetase 2, 4458 mitochondrial MBTPS2 NM_015884 786
membrane-bound hsa-miR- -0.06 0.86 transcription factor 4458
peptidase, site 2 HOOK1 NM_015888 787 hook homolog 1 hsa-miR- -0.12
0.94 2007, (Drosophila) 4458 2009 TAF9B NM_015975 788 TAF9B RNA
hsa-let-7a -0.3 0.98 2009 polymerase II, TATA box binding protein
(TBP)-associated factor, 31 kDa GOLT1B NM_016072 789 golgi
transport 1B hsa-miR- -0.18 0.98 2005, 4500 2007, 2009 CERCAM
NM_016174 790 cerebral endothelial hsa-let-7d -0.15 0.93 2007, cell
adhesion 2009 molecule VGLL3 NM_016206 791 vestigial like 3
hsa-miR- -0.11 0.94 2009 (Drosophila) 4458 NLK NM_016231 792
nemo-like kinase hsa-miR- -0.14 0.87 2005, 4500 2007, 2009 SCARA3
NM_016240 793 scavenger receptor hsa-miR- -0.03 0.77 class A,
member 3 4500 IMPG2 NM_016247 794 interphotoreceptor hsa-let-7i
-0.31 0.95 matrix proteoglycan 2 TOB2 NM_016272 795 transducer of
ERBB2, 2 hsa-miR- >-0.02 0.94 2005, 4458 2007, 2009 PLEKHO1
NM_016274 796 pleckstrin homology hsa-miR- -0.2 0.79 2007, domain
containing, 4458 2009 family O member 1 ANKFY1 NM_016376 797
ankyrin repeat and hsa-miR- >-0.03 0.98 2005, FYVE domain 4458
2007, containing 1 2009 LUC7L3 NM_016424 798 LUC7-like 3 (S.
cerevisiae) hsa-miR- -0.05 0.85 2005, 4500 2007, 2009 RAB8B
NM_016530 799 RAB8B, member hsa-let-7f -0.07 0.92 2007 RAS oncogene
family GCNT4 NM_016591 800 glucosaminyl (N- hsa-miR- -0.34 0.91
2007, acetyl) transferase 4, 4500 2009 core 2 UFM1 NM_016617 801
ubiquitin-fold hsa-miR- -0.36 0.63 2009 modifier 1 4458 ZNF644
NM_016620 802 zinc finger protein hsa-miR- -0.28 0.97 2005, 644
4458 2007, 2009 FZD3 NM_017412 803 frizzled family hsa-miR-98 -0.2
>0.99 receptor 3 RBM38 NM_017495 804 RNA binding motif hsa-miR-
-0.25 0.98 2007, protein 38 4458 2009 STAB2 NM_017564 805 stabilin
2 hsa-miR- -0.13 0.9 2005, 4500 2007, 2009 KIF21B NM_017596 806
kinesin family hsa-miR- >-0.03 0.95 2007, member 21B 4458 2009
EIF2C4 NM_017629 807 eukaryotic translation hsa-let-7d -0.17 0.95
2005, initiation factor 2C, 4 2007, 2009 BNC2 NM_017637 808
basonuclin 2 hsa-let-7g -0.03 0.88 2005, 2007, 2009 KLHL24
NM_017644 809 kelch-like 24 hsa-miR- >-0.01 0.87 2007,
(Drosophila) 4458 2009 GDAP2 NM_017686 810 ganglioside induced
hsa-let-7d -0.33 0.97 2009 differentiation associated protein 2
FBXL12 NM_017703 811 F-box and leucine- hsa-miR- -0.32 0.92 2007,
rich repeat protein 12 4458 2009 ANKRD49 NM_017704 812 ankyrin
repeat hsa-miR- -0.25 0.9 2007, domain 49 4500 2009 UHRF1BP1
NM_017754 813 UHRF1 binding hsa-miR- -0.03 0.85 protein 1 4500
INO80D NM_017759 814 INO80 complex hsa-miR- -0.12 0.91 2005,
subunit D 4500 2007, 2009 CHD7 NM_017780 815 chromodomain hsa-miR-
-0.07 0.86 2005, helicase DNA binding 4500 2007, protein 7 2009
SEMA4C NM_017789 816 sema domain, hsa-let-7i -0.32 0.98 2005,
immunoglobulin 2007, domain (Ig), 2009 transmembrane domain (TM)
and short cytoplasmic domain, (semaphorin) 4C CMTM6 NM_017801 817
CKLF-like MARVEL hsa-let-7c -0.16 <0.1 transmembrane domain
containing 6 HIF1AN NM_017902 818 hypoxia inducible hsa-miR- -0.47
0.94 2009 factor 1, alpha subunit 4500 inhibitor STX17 NM_017919
819 syntaxin 17 hsa-miR- -0.16 0.97 2005, 4500 2007, 2009 USP47
NM_017944 820 ubiquitin specific hsa-let-7d -0.14 0.94 2007,
peptidase 47 2009 PDPR NM_017990 821 pyruvate hsa-miR- -0.3 0.95
2005, dehydrogenase 4500 2007, phosphatase 2009 regulatory subunit
C9orf40 NM_017998 822 chromosome 9 open hsa-let-7f -0.55 0.76 2009
reading frame 40 XKR8 NM_018053 823 XK, Kell blood group hsa-miR-
-0.49 0.98 2007, complex subunit- 4458 2009 related family, member
8 PRPF38B NM_018061 824 PRP38 pre-mRNA hsa-miR- -0.32 0.26 2007,
processing factor 38 4458 2009 (yeast) domain containing B IPO9
NM_018085 825 importin 9 hsa-miR- -0.06 0.78 2009 4500 FIGN
NM_018086 826 fidgetin hsa-let-7d -0.56 >0.99 2007, 2009 CDCA8
NM_018101 827 cell division cycle hsa-miR- -0.17 0.94 2009
associated 8 4458 FAM178A NM_018121 828 family with sequence
hsa-miR-98 -0.24 0.98 2003, similarity 178, 2005, member A 2007,
2009 LRRC20 NM_018205 829 leucine rich repeat hsa-miR- -0.04 0.87
2009 containing 20 4458 ETNK2 NM_018208 830 ethanolamine kinase 2
hsa-miR- -0.14 0.93 2005, 4458 2007, 2009 TMEM143 NM_018273 831
transmembrane hsa-miR- -0.23 0.9 2009 protein 143 4500 BRF2
NM_018310 832 BRF2, subunit of hsa-miR- -0.43 <0.1 2009 RNA
polymerase III 4500 transcription initiation factor, BRF1-like
DDX19A NM_018332 833 DEAD (Asp-Glu-Ala- hsa-miR- -0.47 0.94 2007,
As) box polypeptide 4500 2009 19A FGD6 NM_018351 834 FYVE, RhoGEF
and hsa-miR- -0.32 0.99 2009 PH domain 4458 containing 6 ACER3
NM_018367 835 alkaline ceramidase 3 hsa-let-7d -0.2 0.93 SYNJ2BP
NM_018373 836 synaptojanin 2 hsa-miR- -0.11 0.85 binding protein
4500 PAG1 NM_018440 837 phosphoprotein hsa-miR- -0.3 0.98 2009
associated with 4458 glycosphingolipid microdomains 1 ACTR10
NM_018477 838 actin-related protein hsa-let-7f -0.34 0.75 2009 10
homolog (S. cerevisiae) LGR4 NM_018490 839 leucine-rich repeat
hsa-miR- -0.2 0.92 2005, containing G protein- 4500 2007, coupled
receptor 4 2009 YOD1 NM_018566 840 YOD1 OTU hsa-miR- -0.57 >0.99
2007, deubiquinating 4500 2009 enzyme 1 homolog (S. cerevisiae)
SLC16A10 NM_018593 841 solute carrier family hsa-miR- -0.14 0.86
2009 16, member 10 4500 (aromatic amino acid transporter) ETNK1
NM_018638 842 ethanolamine kinase 1 hsa-miR- -0.05 0.92 2007, 4500
2009 B3GAT1 NM_018644 843 beta-1,3- hsa-let-7d -0.02 0.9 2009
glucuronyltransferase 1 (glucuronosyltransferase P) BIN3 NM_018688
844 bridging integrator 3 hsa-let-7g -0.22 0.92 2005, 2007, 2009
YIPF1 NM_018982 845 Yip1 domain family, hsa-let-7d -0.18 0.71
member 1 SSH1 NM_018984 846 slingshot homolog 1 hsa-let-7a -0.17
0.95 2005, (Drosophila) 2007, 2009 SMCR7L NM_019008 847
Smith-Magenis hsa-let-7f -0.08 0.94 2007, syndrome 2009 chromosome
region, candidate 7-like CCDC93 NM_019044 848 coiled-coil domain
hsa-miR- -0.07 0.62 2009 containing 93 4458 CRCT1 NM_019060 849
cysteine-rich C- hsa-miR- -0.28 0.92 2009 terminal 1 4500 CCDC76
NM_019083 850 coiled-coil domain hsa-let-7f -0.38 0.72 containing
76 UBFD1 NM_019116 851 ubiquitin family hsa-miR- -0.1 0.87 2007,
domain containing 1 4458 2009 TMEM234 NM_019118 852 transmembrane
hsa-let-7a -0.37 0.92 2009 protein 234 RNF20 NM_019592 853 ring
finger protein 20 hsa-let-7g -0.27 0.7 2005, 2007 GPCPD1 NM_019593
854 glycerophosphocholine hsa-miR- -0.42 >0.99 2007,
phosphodiesterase 4500 2009 GDE1 homolog (S. cerevisiae) ABCB9
NM_019624 855 ATP-binding cassette, hsa-miR-98 -0.3 0.95 2005,
sub-family B 2007, (MDR/TAP), member 9 2009 UGGT1 NM_020120 856
UDP-glucose hsa-miR- -0.22 0.98 2007, glycoprotein 4458 2009
glucosyltransferase 1 KCMF1 NM_020122 857 potassium channel
hsa-let-7g -0.02 0.93 2009 modulatory factor 1 C1GALT1 NM_020156
858 core 1 synthase, hsa-miR-98 -0.07 0.98 glycoprotein-N-
acetylgalactosamine 3-beta- galactosyltransferase, 1 SLC12A9
NM_020246 859 solute carrier family hsa-miR- -0.29 0.98 2009
12 4458 (potassium/chloride transporters), member 9 MNT NM_020310
860 MAX binding protein hsa-let-7d -0.02 0.93 2005, 2007, 2009
VANGL2 NM_020335 861 vang-like 2 (van hsa-miR- -0.06 >0.99 2007,
gogh, Drosophila) 4458 2009 KIAA1244 NM_020340 862 KIAA1244
hsa-miR- >-0.02 0.79 4458 ENTPD7 NM_020354 863 ectonucleoside
hsa-let-7d -0.17 0.94 triphosphate diphosphohydrolase 7 AVEN
NM_020371 864 apoptosis, caspase hsa-let-7i -0.22 0.59 activation
inhibitor SCYL3 NM_020423 865 SCY1-like 3 (S. cerevisiae)
hsa-let-7f -0.18 0.93 2005, 2007, 2009 ASPHD2 NM_020437 866
aspartate beta- hsa-miR- -0.02 0.8 hydroxylase domain 4458
containing 2 GALNT1 NM_020474 867 UDP-N-acetyl-alpha- hsa-miR-
-0.47 >0.99 2005, D- 4500 2007, galactosamine:polypeptide 2009
N- acetylgalactosaminyltransferase 1 (GalNAc-T1) MRS2 NM_020662 868
MRS2 magnesium hsa-let-7f -0.48 0.91 2009 homeostasis factor
homolog (S. cerevisiae) RAB22A NM_020673 869 RAB22A, member
hsa-miR- -0.15 0.88 2009 RAS oncogene family 4500 ZNF512B NM_020713
870 zinc finger protein hsa-miR- -0.31 >0.99 2007, 512B 4458
2009 PLEKHH1 NM_020715 871 pleckstrin homology hsa-miR- -0.2 0.93
2007, domain containing, 4500 2009 family H (with MyTH4 domain)
member 1 NLN NM_020726 872 neurolysin hsa-miR- -0.1 0.79
(metallopeptidase M3 4458 family) INTS2 NM_020748 873 integrator
complex hsa-let-7a -0.3 0.84 2007, subunit 2 2009 STARD9 NM_020759
874 StAR-related lipid hsa-miR- -0.7 0.79 transfer (START) 4458
domain containing 9 SRGAP1 NM_020762 875 SLIT-ROBO Rho hsa-miR-
-0.08 0.73 GTPase activating 4458 protein 1 CASKIN1 NM_020764 876
CASK interacting hsa-let-7i -0.1 0.89 2005, protein 1 2007, 2009
KCTD16 NM_020768 877 potassium channel hsa-miR- -0.19 0.87 2009
tetramerisation 4458 domain containing 16 RGAG1 NM_020769 878
retrotransposon gag hsa-let-7f -0.14 0.79 2005, domain containing 1
2007 MIB1 NM_020774 879 mindbomb homolog 1 hsa-let-7f -0.15
>0.99 2007, (Drosophila) 2009 ALPK3 NM_020778 880 alpha-kinase 3
hsa-miR- >-0.02 0.84 2009 4458 PDP2 NM_020786 881 pyruvate
hsa-let-7b -0.18 0.92 2009 dehyrogenase phosphatase catalytic
subunit 2 TAOK1 NM_020791 882 TAO kinase 1 hsa-let-7g -0.07 0.91
ARHGAP20 NM_020809 883 Rho GTPase hsa-let-7a -0.11 0.93 2005,
activating protein 20 2007, 2009 KIAA1467 NM_020853 884 KIAA1467
hsa-miR- -0.15 0.83 2009 4458 ZSWIM5 NM_020883 885 zinc finger,
SWIM- hsa-miR- -0.29 0.97 2009 type containing 5 4458 PLXNA4
NM_020911 886 plexin A4 hsa-miR- -0.15 >0.99 2009 4500 SLC7A14
NM_020949 887 solute carrier family 7 hsa-let-7d -0.07 0.94 (orphan
transporter), member 14 IGDCC4 NM_020962 888 immunoglobulin
hsa-let-7a -0.24 0.98 2005, superfamily, DCC 2007, subclass, member
4 2009 SPTBN4 NM_020971 889 spectrin, beta, non- hsa-miR- -0.07
0.87 2007, erythrocytic 4 4458 2009 XK NM_021083 890 X-linked Kx
blood hsa-miR- -0.29 0.93 2009 group (McLeod 4458 syndrome) MTMR3
NM_021090 891 myotubularin related hsa-let-7a -0.05 0.88 2009
protein 3 SLC5A6 NM_021095 892 solute carrier family 5 hsa-let-7f
-0.21 0.93 2007, (sodium-dependent 2009 vitamin transporter),
member 6 COL14A1 NM_021110 893 collagen, type XIV, hsa-miR- -0.3
0.71 2007 alpha 1 4500 PMAIP1 NM_021127 894 phorbol-12-myristate-
hsa-miR- -0.17 0.9 2009 13-acetate-induced 4500 protein 1 FAM108C1
NM_021214 895 family with sequence hsa-miR-98 -0.2 0.72 similarity
108, member C1 RRAGD NM_021244 896 Ras-related GTP hsa-miR- -0.1
0.93 binding D 4500 CDH22 NM_021248 897 cadherin 22, type 2
hsa-miR- -0.23 0.88 4500 SNX6 NM_021249 898 sorting nexin 6
hsa-let-7c -0.38 0.98 2009 SENP2 NM_021627 899 SUMO1/sentrin/SMT
hsa-miR- -0.17 0.8 2005, 3 specific peptidase 2 4458 2007, 2009
TRIB2 NM_021643 900 tribbles homolog 2 hsa-miR- -0.11 0.84 2005,
(Drosophila) 4458 2007, 2009 SPCS3 NM_021928 901 signal peptidase
hsa-miR- -0.06 0.81 complex subunit 3 4458 homolog (S. cerevisiae)
FKBP10 NM_021939 902 FK506 binding hsa-let-7d -0.08 0.65 protein
10, 65 kDa TIA1 NM_022037 903 TIA1 cytotoxic hsa-let-7f -0.12 0.93
granule-associated RNA binding protein GAN NM_022041 904 gigaxonin
hsa-miR- -0.26 0.98 2005, 4500 2007, 2009 CERS2 NM_022075 905
ceramide synthase 2 hsa-let-7c -0.11 0.69 PRSS22 NM_022119 906
protease, serine, 22 hsa-miR-98 -0.2 0.84 SNX16 NM_022133 907
sorting nexin 16 hsa-miR- -0.23 0.94 2005, 4500 2007, 2009 XYLT1
NM_022166 908 xylosyltransferase I hsa-miR- >-0.03 0.99 2007,
4458 2009 DNAJC1 NM_022365 909 DnaJ (Hsp40) hsa-let-7d -0.21 0.85
2005, homolog, subfamily 2007, C, member 1 2009 NSD1 NM_022455 910
nuclear receptor hsa-miR- -0.12 0.76 binding SET domain 4458
protein 1 HIF3A NM_022462 911 hypoxia inducible hsa-let-7b -0.35
>0.99 2009 factor 3, alpha subunit ZMAT3 NM_022470 912 zinc
finger, matrin- hsa-miR- >-0.01 0.73 type 3 4458 TTC31 NM_022492
913 tetratricopeptide hsa-miR- -0.36 0.87 2009 repeat domain 31
4458 MESDC1 NM_022566 914 mesoderm hsa-miR- -0.15 0.8 2005,
development 4500 2007, candidate 1 2009 ELOVL4 NM_022726 915 ELOVL
fatty acid hsa-miR- -0.16 0.94 2005, elongase 4 4500 2007, 2009
FAM160B2 NM_022749 916 family with sequence hsa-miR- -0.06 0.92
2005, similarity 160, 4458 2007, member B2 2009 AEN NM_022767 917
apoptosis enhancing hsa-miR- -0.31 0.93 2009 nuclease 4458 RNF38
NM_022781 918 ring finger protein 38 hsa-let-7g -0.13 0.7 2005,
2007, 2009 ANKRA2 NM_023039 919 ankyrin repeat, family hsa-miR-
-0.19 0.84 A (RFXANK-like), 2 4458 ZSWIM4 NM_023072 920 zinc
finger, SWIM- hsa-miR- -0.03 0.79 2007 type containing 4 4458 OTUB2
NM_023112 921 OTU domain, hsa-miR- -0.09 0.65 ubiquitin aldehyde
4458 binding 2 LRFN4 NM_024036 922 leucine rich repeat hsa-miR-
-0.12 0.89 2007, and fibronectin type 4458 2009 III domain
containing 4 GNPTAB NM_024312 923 N-acetylglucosamine- hsa-miR-
-0.48 0.95 2007, 1-phosphate 4500 2009 transferase, alpha and beta
subunits EFHD2 NM_024329 924 EF-hand domain hsa-let-7f -0.19 0.97
2005, family, member D2 2007, 2009 HOXD1 NM_024501 925 homeobox D1
hsa-miR- -0.25 0.93 2005, 4500 2007, 2009 ADIPOR2 NM_024551 926
adiponectin receptor 2 hsa-let-7f -0.16 0.94 2005, 2007, 2009 CCNJL
NM_024565 927 cyclin J-like hsa-let-7f -0.12 0.89 2009 SRD5A3
NM_024592 928 steroid 5 alpha- hsa-let-7a -0.4 0.84 reductase 3
THAP9 NM_024672 929 THAP domain hsa-miR- -0.47 0.9 containing 9
4458 LIN28A NM_024674 930 lin-28 homolog A (C. elegans) hsa-let-7i
-0.25 0.98 2005, 2007, 2009 KCTD17 NM_024681 931 potassium channel
hsa-miR- -0.24 0.98 2007, tetramerisation 4458 2009 domain
containing 17 C15orf29 NM_024713 932 chromosome 15 open hsa-miR-
-0.18 0.94 2005, reading frame 29 4458 2007, 2009 MOBKL2B NM_024761
933 MOB1, Mps One hsa-miR- >-0.03 0.93 2009 Binder kinase 4458
activator-like 2B (yeast) ATP8B4 NM_024837 934 ATPase, class I,
type hsa-let-7a -0.25 0.94 2009 8B, member 4 EIF2C3 NM_024852 935
eukaryotic translation hsa-let-7f -0.13 0.83 2005, initiation
factor 2C, 3 2007, 2009 L2HGDH NM_024884 936 L-2-hydroxyglutarate
hsa-let-7a -0.05 0.98 2009 dehydrogenase C7orf58 NM_024913 937
chromosome 7 open hsa-let-7g -0.14 0.92 2005, reading frame 58
2007, 2009 PHC3 NM_024947 938 polyhomeotic hsa-let-7b -0.05 0.84
2009 homolog 3 (Drosophila) CEP135 NM_025009 939 centrosomal
protein hsa-let-7b -0.34 0.95 2009 135 kDa ARHGEF15 NM_025014 940
Rho guanine hsa-miR- -0.23 0.94 2005, nucleotide exchange 4500
2007, factor (GEF) 15 2009 VCPIP1 NM_025054 941 valosin containing
hsa-miR- >-0.01 0.76 2005, protein (p97)/p47 4458 2007 complex
interacting protein 1 FRAS1 NM_025074 942 Fraser syndrome 1
hsa-let-7b -0.42 0.95 2005, 2007, 2009 NYNRIN NM_025081 943 NYN
domain and hsa-let-7d -0.32 >0.99 2007, retroviral integrase
2009 containing CHD9 NM_025134 944 chromodomain hsa-let-7a -0.07
0.74 2005, helicase DNA binding 2007 protein 9 KIAA1539 NM_025182
945 KIAA1539 hsa-miR- -0.25 0.92 2005, 4458 2007, 2009 EDEM3
NM_025191 946 ER degradation hsa-miR- -0.21 0.98 2007, enhancer,
4500 2009 mannosidase alpha- like 3 TRIB1 NM_025195 947 tribbles
homolog 1 hsa-miR- -0.1 0.92 2005, (Drosophila) 4500 2007, 2009
TRABD NM_025204 948 TraB domain hsa-miR- -0.22 0.73 2007,
containing 4458 2009 MED28 NM_025205 949 mediator complex hsa-miR-
-0.45 0.32 subunit 28 4500 SOST NM_025237 950 sclerostin hsa-miR-
-0.04 0.87 2009 4500 LIMD2 NM_030576 951 LIM domain hsa-let-7i
-0.38 0.95 2007, containing 2 2009 CPEB4 NM_030627 952 cytoplasmic
hsa-let-7d -0.08 0.96 2005, polyadenylation 2007, element binding
2009
protein 4 DUSP16 NM_030640 953 dual specificity hsa-let-7d -0.19
0.97 2005, phosphatase 16 2007, 2009 C1orf21 NM_030806 954
chromosome 1 open hsa-let-7g -0.03 0.77 reading frame 21 LBH
NM_030915 955 limb bud and heart hsa-let-7g -0.07 0.92 2005,
development homolog 2007, (mouse) 2009 FAM103A1 NM_031452 956
family with sequence hsa-miR- -0.42 0.87 2009 similarity 103, 4458
member A1 SLC25A18 NM_031481 957 solute carrier family hsa-miR-
-0.34 0.94 2005, 25 (mitochondrial 4458 2007, carrier), member 18
2009 KCTD10 NM_031954 958 potassium channel hsa-miR- >-0.02 0.86
2009 tetramerisation 4458 domain containing 10 STARD3NL NM_032016
959 STARD3 N-terminal hsa-miR- -0.15 0.91 2005, like 4458 2007,
2009 STK40 NM_032017 960 serine/threonine hsa-miR- -0.25 0.95 2007,
kinase 40 4458 2009 UTP15 NM_032175 961 UTP15, U3 small hsa-let-7b
-0.16 0.79 2009 nucleolar ribonucleoprotein, homolog (S.
cerevisiae) LOXL4 NM_032211 962 lysyl oxidase-like 4 hsa-let-7a
-0.13 0.94 2005, 2007, 2009 DDI2 NM_032341 963 DNA-damage hsa-miR-
-0.46 0.98 2007, inducible 1 homolog 4500 2009 2 (S. cerevisiae)
MEGF11 NM_032445 964 multiple EGF-like- hsa-miR- -0.05 0.88 2009
domains 11 4500 DOT1L NM_032482 965 DOT1-like, histone hsa-miR- N/A
0.99 2005, H3 methyltransferase 4458 2007, (S. cerevisiae) 2009
C6orf168 NM_032511 966 chromosome 6 open hsa-miR- -0.22 0.95 2009
reading frame 168 4458 PARD6B NM_032521 967 par-6 partitioning
hsa-let-7a -0.29 0.95 2007, defective 6 homolog 2009 beta (C.
elegans) USP38 NM_032557 968 ubiquitin specific hsa-miR- -0.33 0.85
2005, peptidase 38 4500 2007, 2009 USP32 NM_032582 969 ubiquitin
specific hsa-let-7a -0.2 0.93 2005, peptidase 32 2007, 2009 LOXL3
NM_032603 970 lysyl oxidase-like 3 hsa-miR- -0.1 0.79 2005, 4458
2007, 2009 FOXP1 NM_032682 971 forkhead box P1 hsa-let-7g -0.04
0.85 2009 SFT2D3 NM_032740 972 SFT2 domain hsa-let-7a -0.34 <0.1
2009 containing 3 LINGO1 NM_032808 973 leucine rich repeat
hsa-let-7d -0.3 0.89 2009 and Ig domain containing 1 ZNF341
NM_032819 974 zinc finger protein hsa-let-7a -0.42 <0.1 341
PPP1R15B NM_032833 975 protein phosphatase 1, hsa-let-7c -0.44
>0.99 2005, regulatory (inhibitor) 2007, subunit 15B 2009 CGNL1
NM_032866 976 cingulin-like 1 hsa-miR- -0.2 0.94 2005, 4458 2007,
2009 RAB11FIP4 NM_032932 977 RAB11 family hsa-let-7d -0.27 >0.99
2003, interacting protein 4 2005, (class II) 2007, 2009 C5orf62
NM_032947 978 chromosome 5 open hsa-let-7d -0.38 0.92 2007, reading
frame 62 2009 ZCCHC3 NM_033089 979 zinc finger, CCHC hsa-miR- -0.16
0.93 2007, domain containing 3 4458 2009 NKD1 NM_033119 980 naked
cuticle hsa-let-7a -0.2 0.95 2005, homolog 1 2007, (Drosophila)
2009 SCRT2 NM_033129 981 scratch homolog 2, hsa-miR- -0.05 0.88
2005, zinc finger protein 4458 2007, (Drosophila) 2009 SURF4
NM_033161 982 surfeit 4 hsa-let-7a -0.02 0.87 2005, 2007, 2009 PURB
NM_033224 983 purine-rich element hsa-miR- -0.03 0.87 2009 binding
protein B 4458 RASL10B NM_033315 984 RAS-like, family 10, hsa-miR-
-0.06 0.94 2005, member B 4458 2007, 2009 C20orf54 NM_033409 985
chromosome 20 open hsa-miR- -0.3 <0.1 reading frame 54 4458
FAM125B NM_033446 986 family with sequence hsa-miR- >-0.01 0.77
2007, similarity 125, 4458 2009 member B TSPYL5 NM_033512 987
TSPY-like 5 hsa-miR- -0.24 0.58 4458 TRIM41 NM_033549 988
tripartite motif hsa-let-7f -0.22 0.92 containing 41 STARD13
NM_052851 989 StAR-related lipid hsa-let-7g -0.4 >0.99 2005,
transfer (START) 2007, domain containing 13 2009 VPS26B NM_052875
990 vacuolar protein hsa-miR- -0.15 0.9 2009 sorting 26 homolog B
4500 (S. pombe) EGLN2 NM_053046 991 egl nine homolog 2 hsa-miR-
-0.16 0.93 2005, (C. elegans) 4500 2007, 2009 CCND1 NM_053056 992
cyclin D1 hsa-let-7b -0.12 0.99 2005, 2007, 2009 GALNTL2 NM_054110
993 UDP-N-acetyl-alpha- hsa-miR- -0.2 0.94 2005, D- 4500 2007,
galactosamine:polypeptide 2009 N- acetylgalactosaminyltransferase-
like 2 C20orf112 NM_080616 994 chromosome 20 open hsa-let-7b -0.22
0.97 reading frame 112 TMEM41A NM_080652 995 transmembrane hsa-miR-
-0.13 0.94 protein 41A 4458 ADAMTS14 NM_080722 996 ADAM hsa-miR-
-0.18 0.93 2007, metallopeptidase with 4458 2009 thrombospondin
type 1 motif, 14 ZNF280B NM_080764 997 zinc finger protein
hsa-let-7d -0.34 0.98 2007, 280B 2009 SOCS4 NM_080867 998
suppressor of hsa-miR- -0.15 0.91 2005, cytokine signaling 4 4500
2007, 2009 KLHL6 NM_130446 999 kelch-like 6 hsa-let-7d -0.32 0.95
2007, (Drosophila) 2009 TSPAN18 NM_130783 1000 tetraspanin 18
hsa-miR- -0.08 0.94 4500 UNC5A NM_133369 1001 unc-5 homolog A (C.
elegans) hsa-let-7d -0.12 0.9 2007, 2009 GRIN3A NM_133445 1002
glutamate receptor, hsa-miR- >-0.01 0.87 2009 ionotropic,
N-methyl- 4458 D-aspartate 3A PYGO2 NM_138300 1003 pygopus homolog
2 hsa-miR- -0.07 0.92 2005, (Drosophila) 4500 2007, 2009 DCAF15
NM_138353 1004 DDB1 and CUL4 hsa-miR- -0.17 0.95 2007, associated
factor 15 4458 2009 MARS2 NM_138395 1005 methionyl-tRNA hsa-let-7d
-0.37 0.94 2009 synthetase 2, mitochondrial MARCH9 NM_138396 1006
membrane-associated hsa-miR- -0.09 0.78 2007, ring finger (C3HC4) 9
4500 2009 ZNF689 NM_138447 1007 zinc finger protein hsa-miR- -0.29
0.94 2009 689 4500 CTHRC1 NM_138455 1008 collagen triple helix
hsa-miR- -0.31 0.76 2009 repeat containing 1 4458 C11orf84
NM_138471 1009 chromosome 11 open hsa-miR- -0.14 0.94 2005, reading
frame 84 4458 2007, 2009 H2AFV NM_138635 1010 H2A histone family,
hsa-miR- >-0.03 <0.1 member V 4458 CD200R1 NM_138806 1011
CD200 receptor 1 hsa-let-7a -0.38 0.82 2009 ADAMTS15 NM_139055 1012
ADAM hsa-let-7i -0.38 >0.99 metallopeptidase with thrombospondin
type 1 motif, 15 LIPH NM_139248 1013 lipase, member H hsa-miR-
-0.29 0.94 2009 4500 PPTC7 NM_139283 1014 PTC7 protein hsa-let-7d
-0.06 0.85 2007, phosphatase homolog 2009 (S. cerevisiae) GNAT1
NM_144499 1015 guanine nucleotide hsa-let-7g -0.14 <0.1 binding
protein (G protein), alpha transducing activity polypeptide 1
CNOT6L NM_144571 1016 CCR4-NOT hsa-miR- -0.02 0.92 2007,
transcription 4458 2009 complex, subunit 6- like MAPK1IP1L
NM_144578 1017 mitogen-activated hsa-miR- -0.03 0.99 2009 protein
kinase 1 4458 interacting protein 1- like TEX261 NM_144582 1018
testis expressed 261 hsa-miR- -0.04 0.8 2009 4458 FOPNL NM_144600
1019 FGFR1OP N-terminal hsa-let-7a -0.13 0.88 2009 like KLHL23
NM_144711 1020 kelch-like 23 hsa-let-7f -0.2 0.95 (Drosophila)
SMCR8 NM_144775 1021 Smith-Magenis hsa-let-7d -0.16 0.95 2009
syndrome chromosome region, candidate 8 TSPEAR NM_144991 1022
thrombospondin-type hsa-let-7a -0.16 0.9 2005, laminin G domain and
2007 EAR repeats TET3 NM_144993 1023 tet oncogene family hsa-miR-98
-0.19 >0.99 2009 member 3 CCNY NM_145012 1024 cyclin Y
hsa-let-7d -0.22 0.94 SLC2A12 NM_145176 1025 solute carrier family
2 hsa-miR- -0.2 0.93 2007, (facilitated glucose 4500 2009
transporter), member 12 B3GNT7 NM_145236 1026 UDP- hsa-miR- -0.2
0.98 GlcNAc:betaGal beta- 4458 1,3-N- acetylglucosaminyltransferase
7 KIFC2 NM_145754 1027 kinesin family hsa-miR- -0.16 0.64 member C2
4500 MTPN NM_145808 1028 myotrophin hsa-let-7d -0.04 0.82 2005,
2007, 2009 SYT11 NM_152280 1029 synaptotagmin XI hsa-miR- -0.13
0.98 2005, 4458 2007, 2009 POGLUT1 NM_152305 1030 protein O-
hsa-let-7f -0.14 0.87 2007, glucosyltransferase 1 2009 GRPEL2
NM_152407 1031 GrpE-like 2, hsa-let-7i -0.18 0.93 2009
mitochondrial (E. coli) RNF165 NM_152470 1032 ring finger protein
hsa-miR- -0.19 >0.99 2007, 165 4458 2009 ZNF362 NM_152493 1033
zinc finger protein hsa-miR- -0.08 0.98 2007, 362 4458 2009 ARL6IP6
NM_152522 1034 ADP-ribosylation-like hsa-miR- -0.33 0.83 factor 6
interacting 4500 protein 6 SLC16A14 NM_152527 1035 solute carrier
family hsa-miR-98 -0.18 0.94 2007, 16, member 14 2009
(monocarboxylic acid transporter 14) C7orf60 NM_152556 1036
chromosome 7 open hsa-let-7a -0.06 0.87 2005, reading frame 60
2007, 2009 FAM116A NM_152678 1037 family with sequence hsa-miR-
-0.08 0.7 similarity 116, 4458 member A SENP5 NM_152699 1038
SUMO1/sentrin hsa-miR- -0.17 0.94 2005, specific peptidase 5 4458
2007, 2009 HOXA9 NM_152739 1039 homeobox A9 hsa-let-7d -0.16 0.85
2005, 2007, 2009 SDK1 NM_152744 1040 sidekick homolog 1, hsa-miR-
-0.14 0.95 cell adhesion 4458 molecule (chicken) SCUBE3 NM_152753
1041 signal peptide, CUB hsa-miR- >-0.02 0.88 2005, domain,
EGF-like 3 4458 2007, 2009 RICTOR NM_152756 1042 RPTOR independent
hsa-miR- -0.14 0.98 2007, companion of MTOR, 4500 2009 complex 2
YTHDF3 NM_152758 1043 YTH domain family, hsa-miR- -0.1 0.86 2005,
member 3 4500 2007,
2009 MFSD8 NM_152778 1044 major facilitator hsa-miR-98 -0.33 0.91
superfamily domain containing 8 COL24A1 NM_152890 1045 collagen,
type XXIV, hsa-let-7a -0.19 0.92 2005, alpha 1 2007, 2009 UHRF2
NM_152896 1046 ubiquitin-like with hsa-let-7d -0.41 0.89 2005, PHD
and ring finger 2007, domains 2 2009 PXT1 NM_152990 1047
peroxisomal, testis hsa-let-7f -0.54 0.93 2009 specific 1 NPHP3
NM_153240 1048 nephronophthisis 3 hsa-let-7f -0.49 >0.99 2009
(adolescent) BRWD3 NM_153252 1049 bromodomain and hsa-let-7i -0.12
0.95 WD repeat domain containing 3 ATXN7L2 NM_153340 1050 ataxia
7-like 2 hsa-miR- -0.18 0.75 2007 4458 GPR26 NM_153442 1051 G
protein-coupled hsa-miR- -0.17 0.95 2009 receptor 26 4500 LCORL
NM_153686 1052 ligand dependent hsa-miR- -0.2 0.78 2007, nuclear
receptor 4458 2009 corepressor-like FAM43A NM_153690 1053 family
with sequence hsa-miR- -0.16 0.82 2009 similarity 43, member A 4458
TTL NM_153712 1054 tubulin tyrosine ligase hsa-miR- -0.08 0.94
2007, 4458 2009 ATP2A2 NM_170665 1055 ATPase, Ca++ hsa-miR- -0.28
0.96 2005, transporting, cardiac 4500 2007 muscle, slow twitch 2
IL28RA NM_170743 1056 interleukin 28 hsa-miR- -0.17 0.72 receptor,
alpha 4458 (interferon, lambda receptor) RDH10 NM_172037 1057
retinol dehydrogenase hsa-miR-98 -0.19 0.95 2005, 10 (all-trans)
2007, 2009 DCUN1D3 NM_173475 1058 DCN1, defective in hsa-miR- -0.21
0.98 2007, cullin neddylation 1, 4500 2009 domain containing 3 (S.
cerevisiae) LSM11 NM_173491 1059 LSM11, U7 small hsa-let-7b -0.35
0.94 2005, nuclear RNA 2007, associated 2009 SLC38A9 NM_173514 1060
solute carrier family hsa-miR- -0.17 0.82 2005, 38, member 9 4458
2007 KLHDC8B NM_173546 1061 kelch domain hsa-miR- -0.35 0.98 2009
containing 8B 4458 RFX6 NM_173560 1062 regulatory factor X, 6
hsa-let-7d -0.24 0.95 2005, 2007, 2009 PRR14L NM_173566 1063
proline rich 14-like hsa-miR- -0.03 0.9 4458 UBN2 NM_173569 1064
ubinuclein 2 hsa-miR- >-0.02 0.94 2009 4458 PGM2L1 NM_173582
1065 phosphoglucomutase hsa-miR- -0.05 >0.99 2005, 2-like 1 4458
2007, 2009 ANKRD52 NM_173595 1066 ankyrin repeat hsa-miR- >-0.06
0.96 2009 domain 52 4458 RIMKLA NM_173642 1067 ribosomal hsa-let-7b
-0.08 <0.1 modification protein rimK-like family member A
CCDC141 NM_173648 1068 coiled-coil domain hsa-miR- -0.17 0.95
containing 141 4458 SLC9A9 NM_173653 1069 solute carrier family 9
hsa-miR- -0.11 0.89 2005, (sodium/hydrogen 4458 2007, exchanger),
member 9 2009 C3orf64 NM_173654 1070 chromosome 3 open hsa-let-7d
-0.21 >0.99 2007, reading frame 64 2009 CRB2 NM_173689 1071
crumbs homolog 2 hsa-miR- -0.12 0.93 2009 (Drosophila) 4458 PRTG
NM_173814 1072 protogenin hsa-miR-98 -0.56 >0.99 2007, 2009
SREK1IP1 NM_173829 1073 SREK1-interacting hsa-let-7g -0.12 0.95
2007, protein 1 2009 FAM84B NM_174911 1074 family with sequence
hsa-miR- -0.13 0.58 2007 similarity 84, member B 4500 ZPLD1
NM_175056 1075 zona pellucida-like hsa-miR- -0.2 0.94 2009 domain
containing 1 4458 TXLNA NM_175852 1076 taxilin alpha hsa-let-7b
-0.1 0.9 2009 CHSY3 NM_175856 1077 chondroitin sulfate hsa-miR-
-0.17 0.75 2007 synthase 3 4500 C19orf39 NM_175871 1078 chromosome
19 open hsa-let-7d -0.32 0.77 reading frame 39 ANKRD43 NM_175873
1079 ankyrin repeat hsa-miR- -0.22 0.94 2007, domain 43 4500 2009
FLJ36031 NM_175884 1080 hypothetical protein hsa-let-7g -0.31 0.88
2007, FLJ36031 2009 C5orf51 NM_175921 1081 chromosome 5 open
hsa-miR- -0.26 0.94 2005, reading frame 51 4458 2007, 2009 PRR18
NM_175922 1082 proline rich 18 hsa-miR- -0.13 0.72 4500 CXorf36
NM_176819 1083 chromosome X open hsa-let-7e -0.02 0.81 reading
frame 36 PDE12 NM_177966 1084 phosphodiesterase 12 hsa-let-7a -0.25
0.98 2007, 2009 SESTD1 NM_178123 1085 SEC14 and spectrin hsa-miR-
-0.19 0.92 domains 1 4500 SNAI3 NM_178310 1086 snail homolog 3
hsa-let-7i -0.18 0.56 2007 (Drosophila) TMEM26 NM_178505 1087
transmembrane hsa-miR- -0.1 0.93 2009 protein 26 4458 NAT8L
NM_178557 1088 N-acetyltransferase 8- hsa-miR-98 -0.05 0.94 like
(GCN5-related, putative) RSPO2 NM_178565 1089 R-spondin 2
hsa-let-7d -0.3 0.88 2007, 2009 MTDH NM_178812 1090 metadherin
hsa-miR-98 -0.1 0.95 AGPAT6 NM_178819 1091 1-acylglycerol-3-
hsa-let-7d -0.24 0.98 phosphate O- acyltransferase 6
(lysophosphatidic acid acyltransferase, zeta) MFSD4 NM_181644 1092
major facilitator hsa-let-7a -0.31 0.98 superfamily domain
containing 4 TMTC3 NM_181783 1093 transmembrane and hsa-miR- -0.01
0.79 tetratricopeptide 4500 repeat containing 3 SLC46A3 NM_181785
1094 solute carrier family hsa-miR- -0.13 0.74 46, member 3 4500
USP12 NM_182488 1095 ubiquitin specific hsa-let-7f -0.37 0.9
peptidase 12 DDX26B NM_182540 1096 DEAD/H (Asp-Glu- hsa-let-7f
-0.25 0.94 2009 Ala-Asp/His) box polypeptide 26B GDPD1 NM_182569
1097 glycerophosphodiester hsa-miR- -0.19 0.94 2005,
phosphodiesterase 4458 2007, domain containing 1 2009 SP8 NM_182700
1098 Sp8 transcription hsa-miR- -0.16 0.92 2007, factor 4458 2009
ARRDC4 NM_183376 1099 arrestin domain hsa-miR- -0.15 0.94 2005,
containing 4 4458 2007, 2009 KIF1B NM_183416 1100 kinesin family
hsa-miR- -0.07 0.88 member 1B 4458 TMEM65 NM_194291 1101
transmembrane hsa-miR- -0.2 0.94 2007, protein 65 4500 2009 SLC16A9
NM_194298 1102 solute carrier family hsa-miR- -0.25 0.9 2009 16,
member 9 4458 (monocarboxylic acid transporter 9) E2F6 NM_198256
1103 E2F transcription hsa-let-7c -0.21 0.98 2007, factor 6 2009
ANKRD46 NM_198401 1104 ankyrin repeat hsa-miR- -0.19 0.87 2009
domain 46 4458 NRK NM_198465 1105 Nik related kinase hsa-let-7i
-0.07 0.94 2005, 2007, 2009 NHLRC2 NM_198514 1106 NHL repeat
hsa-let-7d -0.08 0.83 containing 2 ZNF710 NM_198526 1107 zinc
finger protein hsa-let-7d -0.24 >0.99 2003, 710 2007, 2009
TMEM110 NM_198563 1108 transmembrane hsa-miR- -0.24 0.94 2007,
protein 110 4458 2009 RAB15 NM_198686 1109 RAB15, member hsa-miR-
-0.16 0.94 2005, RAS onocogene 4458 2007, family 2009 DHX57
NM_198963 1110 DEAH (Asp-Glu-Ala- hsa-miR- -0.25 0.88 2005,
Asp/His) box 4500 2007, polypeptide 57 2009 MED8 NM_201542 1111
mediator complex hsa-let-7f -0.42 0.92 subunit 8 ZNF784 NM_203374
1112 zinc finger protein hsa-miR- -0.21 0.83 2009 784 4458 PPAPDC2
NM_203453 1113 phosphatidic acid hsa-miR- -0.2 0.94 2007,
phosphatase type 2 4500 2009 domain containing 2 SPRYD4 NM_207344
1114 SPRY domain hsa-miR- -0.2 0.94 2007, containing 4 4458 2009
FREM2 NM_207361 1115 FRAS1 related hsa-miR- -0.07 0.94 2009
extracellular matrix 4458 protein 2 C10orf140 NM_207371 1116
chromosome 10 open hsa-let-7d -0.13 0.85 2005, reading frame 140
2007, 2009
TABLE-US-00003 TABLE S3 3' UTR sequences. Human FNTB (SEQ ID NO:
1117) 5'AGGACCTGGGTCCCGGCAGCTCTTTGCTCACCCATCTCCCCAG
TCAGACAAGGTTTATACGTTTCAATACATACTGCATTCTGTGCTA
CACAAGCCTTAGCCTCAGTGGAGCTGTGGTTCTCTTGGTACTTTC
TTGTCAAACAAAACCAATGGCTCTGGGTTTGGAGAACACAGTGGC
TGGTTTTAAAAATTCTTTCCACACCTGTCAAACCAAAAATCTATC
AGCCCACGTGGTGTGGTTGGTGAACAGTGCATGCCAGGAGGAAGC
AGTCCCTCCTCACCAGCTCTCCAGCCAGGACGATCACACAGAGAT
GAATGGCATCTGAGTATTACGGCATCCAGAGCCACTGCTGACTCC
CACTTGCACGCCACCATTCAGTCACCAGACTGGGTGCCCTCCGAT
GGGTGGAATAAGTCTGCTTCATGCCAAGGCTGGGCTTTGGGTCCC
ACCAAGATGAGTTCTCTGTAAGACTGTGGTGGAGTTGCACCAGGA
GGTGCCTCTGCCTCTCGACTTGCACCCTGGTCATTTGTAAGGGAA
AAGAGCTGGAGGTGGGGAGAGAAAGATCTCCTTCAGTTGGGAGTC
CTTCCACTTCAACACTGGAGAACTGAGCCTTGCATCTCTCCAGGG
TCCAAGGCCACGCTTGGTGCACAGGCAAGACTTGCTTCAGCCCCA
GGTGTGGTGACTTAGACCTAGGAAACCAATTATGAGTGGAAAGTG
ACCCTCTAGTTCAACTGTGCCAGAGGAAACAGCCCTCCAGTGCCC
ACCTGCCTCACTCCTCCCTATCATGTACCGTGAAAACCCCCTCTG
ATGGCCTCAAGGCAGTGCCTGCAGGCCGAGGCCCTTCTGGGGGTT
TCTATCTTTCTTCCACCAGACTCCAAGCCCACTCTCCTCCAAGAC
TGTGTTGTCTTTTCTCACCAAGAGTATTAACACTACTAAGTCTTT
CACCTTAACTTATGACTCAGGATTTATTCACGTCCTGCCCACTCT
AGGCTCACAGGAATAAAATCAAGTGCTAGACACACTGGCTGCTAC
TAAGGCACTAGCCTCTGTAGCTGGTGGTGGCAGCGTGGGGTGCCG
CCCAGCGTGCTGGGTCCTGGCAGTGCCTCTGCTGTGCTGCACATT
GAGCCCTTTCTCAGTCAGTGGAGTATCAAGTTGGGCCATCTGTCT
ACTGACCTGGCCTTCATGTAAGCAGCTGTGGGCTGCGGGCAGACA
GGAGCTCAGAGATGCAGCATGAGGCGCTTAGAAAAACCTGGCCAT
TTGCTGCCTCTAATTCCCTTTTGCTTTG-3' Zebrafish Fntb (SEQ ID NO: 1118)
5'ACTATCTATTTTTCAACTGTAAACATATTGGGGGATTTGGGCT
AGCTTGAACTGTGCAGAGGAATCTTCTGTAAATGCTGTAGCCAAA
TGTCCTTTGCTGGTGTGTACAGCGTCTACAGATGGAGAAACACTC
TGAGGCCTGATCTGCTGCTGCTTCAGCATGAGGTTATGGGTTTTA
GCCAGGATAAACAGTAGAGACTGACTAGGTAAGGTGTTTTTTCAT
GCACCAGTCATTGATTGATATTTTATTGCACATGCCAGCTTATTT
TGGGCAAAATGTTCCCAGAGTGTACGTGGCAGTGGGTTCTGGACA
GAAATAAAGACTTGGATGGAAA-3' Zebrafish Smarca5 (SEQ ID NO: 1119)
5'GCAGGCAGGCATTTCACACACCTCACTCGGCGAGGAGCTTCAG
TACAGCAATACTGCATTGATTGTTACGGGTCCCACTCATGTACTG
TATGGATTTGCAGCACTGATCCTCGCCTCTCAAGTAGCTTGGCCT
TCTTAACAAGGTGTAGAGTTGTAAATTAGGTCTCTTTTAGTTATA
TAATGTAACTACGGCTGTGCTGTCGGATGTGTTTTGTATTTATGG
CTACTTCAAATTTTTTTTTGTACCACATTCCATTTGCTTGTATCA
GTTTAATTTGCAGTCTTTACCCCCTCATTATTAGTGTCTTCAGTA
TTGTATTGTCTCTGTATCCGCCATTGGAAAGTGACTAATAAATGT
GGTTTTTATAAATGCTGCTCTGTATGTTTCCTACAAATAAATGTA
ATGTCTTTTGCCTTGTA-3'
TABLE-US-00004 TABLE S4 MiR mimics and antagomiR sequences. miRs
used Sequence Dre-miR-100 mimic 5'-AACCCGUAGAUCCG AACUUGUG-3' (SEQ
ID NO: 1120) 5'-CAAGCUUGUAUCUA UAGGUAUC-3' (SEQ ID NO: 1121)
Dre-miR-99 mimic 5'-AACCCGUAGAUCCG AUCUUGUG-3' (SEQ ID NO: 1122)
5'-CAAGCUCGAUUCUA UGGGUCUC-3' (SEQ ID NO: 1123) Dre-miR-99
inhibitor 5'-ACAAGTTCGGATCT ACGGGT-3' (SEQ ID NO: 1124) Dre-miR-100
inhibitor 5'-ACAAGATCGGATCT ACGGGT-3' (SEQ ID NO: 1125) GFP siRNA
5'-GGCUACGUCCAGGA (delivery control) GCGCACC-3' (SEQ ID NO: 1126)
5'-GGUGCGCUCCUGGA CGUAGCC-3'-Cy5 (SEQ ID NO: 1127) Fntb morpholino
5'-GCGCCTCTTCCATG (translation-blocking) ATGAGCTCTCA-3' (SEQ ID NO:
1128) Smarca5 morpholino 5'-CTTCTTCCCGCTGC (translation-blocking)
TGCTCCATGCT-3' (SEQ ID NO: 1129)
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20160068863A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20160068863A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References