U.S. patent application number 14/838345 was filed with the patent office on 2016-03-03 for functional myelination of neurons.
The applicant listed for this patent is The United States of America as represented by the Department of Veterans Affairs, The United States of America as represented by the Department of Veterans Affairs, The University of Maryland, Baltimore. Invention is credited to Thomas Hornyak, Sandeep Joshi.
Application Number | 20160060597 14/838345 |
Document ID | / |
Family ID | 55401782 |
Filed Date | 2016-03-03 |
United States Patent
Application |
20160060597 |
Kind Code |
A1 |
Hornyak; Thomas ; et
al. |
March 3, 2016 |
FUNCTIONAL MYELINATION OF NEURONS
Abstract
Hair follicle bulge region/LLP region CD34(+) MeSCs can be
isolated from mammalian skin bearing hair follicles. These cells
are multipotent and retain the ability to differentiate into cells
of neural crest lineage, including glia-like cells that express the
glial marker Gfap, and are able to express myelin basic protein,
and to remyelinate naked (unmyelinated or demyelinated) neuronal
processes with a functional, dense myelin sheath. These cells of
neural crest lineage can be used to produce a dense myelin sheath
on neurons which lack myelin due to genetic defect, trauma, toxin,
infection, or disease process. Therefore, embodiments of the
invention provide methods for preparing such cells, the cells
themselves and compositions containing the cells, as well as
methods for using the cells.
Inventors: |
Hornyak; Thomas; (Bethesda,
MD) ; Joshi; Sandeep; (Elkridge, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The University of Maryland, Baltimore
The United States of America as represented by the Department of
Veterans Affairs |
Baltimore
Washington |
MD
DC |
US
US |
|
|
Family ID: |
55401782 |
Appl. No.: |
14/838345 |
Filed: |
August 27, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62042975 |
Aug 28, 2014 |
|
|
|
Current U.S.
Class: |
435/354 ;
435/368; 435/375; 435/377 |
Current CPC
Class: |
C12N 5/0622 20130101;
C12N 2501/33 20130101; C12N 5/0626 20130101; A61K 35/36 20130101;
C12N 2506/091 20130101; C12N 2501/86 20130101; C12N 5/0623
20130101; C12N 2501/115 20130101; C12N 2501/125 20130101; C12N
2502/081 20130101; C12N 2501/365 20130101 |
International
Class: |
C12N 5/0797 20060101
C12N005/0797 |
Goverment Interests
STATEMENT OF GOVERNMENT INTEREST
[0002] This invention was made with government support under Grant
Number AR064810 awarded by the National Institutes of Health and
under Project Number 1-I01BX002582 awarded by the United States
Department of Veteran Affairs. The government has certain rights in
the invention.
Claims
1. A method of isolating melanocyte stem cells from the hair
follicle of mammalian skin to yield CD34(+) multipotent neural
crest progenitor cells that express the marker Gfap and express
myelin basic protein, comprising the steps of: (a) obtaining a
suspension of skin cells that includes melanocyte stem cells from
the bulge region, the lower permanent portion, or both, of the hair
follicle; (b) separating CD34(+) melanocyte stem cells from said
single cell suspension; and (c) exposing said CD34(+) melanocyte
stem cells to conditions that promote neural crest progenitor
formation, to form CD34(+) multipotent neural crest progenitor
cells that express at least the marker Gfap and myelin basic
protein.
2. The method of claim 1, wherein said conditions that promote
neural crest progenitor formation comprise culturing said CD34(+)
MeSCs in neural crest differentiation medium.
3. Isolated CD34(+) multipotent neural crest progenitor cells made
according to the method of claim 1.
4. The isolated CD34(+) multipotent neural crest progenitor cells
of claim 3, which are at least 80% pure, at least 85% pure, at
least 90% pure, at least 95% pure, at least 97% pure, at least 98%
pure, at least 99% pure, at least 99.5% pure, or at least 99.9%
pure CD34(+) multipotent neural crest progenitor cells.
5. The isolated CD34(+) multipotent neural crest progenitor cells
of claim 3, which are human cells.
6. The isolated CD34(+) multipotent neural crest progenitor cells
of claim 3, which are mouse cells.
7. The isolated CD34(+) multipotent neural crest progenitor cells
of claim 3, wherein the mouse is a Dct-H2BGFP mouse.
8. A composition comprising an acceptable carrier and the isolated
CD34(+) multipotent neural crest progenitor cells of claim 3.
9. Substantially pure isolated CD34(+) multipotent neural crest
progenitor cells from mammalian hair follicle bulge/LPP and lower
permanent portion of the hair follicle, which express at least the
cell marker Gfap and myelin basic protein.
10. A method of producing a dense myelin sheath around an axon
comprising contacting said axon with the isolated CD34(+)
multipotent neural crest progenitor cells of claim 3.
11. The method of claim 10, wherein said contacting results in
myelination.
12. The method of claim 10, wherein said contacting is performed
under conditions comprising culturing said CD34(+) MeSCs in Poly D
Lysine and Laminin coated chambers in the presence of neural crest
differentiation medium said medium comprising ascorbic acid.
13. A method of producing a functional myelin sheath on a axon
which lacks a functional myelin sheath or has become demyelinated,
comprising contacting said axon with the isolated CD34(+)
multipotent neural crest progenitor cells of claim 3.
14. The method of claim 13, wherein said contacting is
administration by direct injection into the area of said axon, or
by intrathecal injection, or intravenously, or by stereotaxic
injection.
15. The method of claim 13, wherein the area of said axon is in the
central nervous system.
16. The method of claim 13, wherein the area of said axon is in the
peripheral nervous system.
17. The method of claim 13, wherein the demyelination of said axon
is immune-mediated, auto-antibody mediated, or caused by a
demyelinating disease, trauma, toxin, bacterial infection, viral
infection, parasitic infection, or genetic defect.
18. The method of claim 17, wherein said demyelinating disease is
selected from the group consisting of: experimental allergic
encephalomyelitis, acute disseminated encephalomyelopathy, acute
hemorrhagic encephalomyelopathy, experimental allergic neuritis,
amoebic meningoencephalitis, Guillain-Barre syndrome, multiple
sclerosis, stroke, traumatic brain injury, and traumatic peripheral
nerve injury, Devic's disease (otherwise known as neuromyelitis
optica (NMO)), NMO spectrum disorder, progressive multifocal
leukoencephalopathy, central pontine myelinolysis, Tabes dorsalis,
optic neuritis, transverse myelitis, progressive inflammatory
neuropathy, myelopathy, chronic inflammatory demyelinating
polyneuropathy, Charcot-Marie-Tooth disease, visna, and the like.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of provisional
application 62/042,975, entitled "Functional Myelination of Neurons
with Melanocyte Stem Cells," filed Aug. 28, 2014, the entire
contents of which are incorporated herein.
BACKGROUND
[0003] Destruction of the myelin sheath is a common theme in a wide
range of neurological disorders, but the underlying causes are many
fold. Demyelination may be immune-mediated, auto-antibody mediated,
or caused by a demyelinating disease, trauma, toxins, bacterial
infection, parasitic infection, viral infection, or genetic defect
and can cause demyelination of neurites. This reduces the speed of
neural transmission or stops it altogether. There is a need for
improved therapies to restore functional myelination of
demyelinated neurons.
[0004] Cholinergic treatments, such as acetylcholinesterase
inhibitors (AChEIs), have been developed and may have beneficial
effects on myelination, myelin repair, and myelin integrity.
Increasing cholinergic stimulation also may act through subtle
trophic effects on brain developmental processes and particularly
on oligodendrocytes and the lifelong myelination process they
support. Glycogen synthase kinase 3.beta. inhibitors such as
lithium chloride also have been found to promote myelination in
mice with damaged facial nerves. Techniques have also been
developed to include surgically implanting oligodendrocyte
precursor cells in the central nervous system and inducing myelin
repair with certain antibodies. While results with oligodendrocyte
stem cell transplantation in mice have been encouraging, whether
this particular technique can be effective in replacing myelin loss
in humans is still unknown.
[0005] Melanocyte stem cells (MeSCs) are undifferentiated
melanocytic precursor cells (MPCs) of the mammalian hair follicle
(HF) responsible for recurrent generation of a large number of
differentiated melanocytes during each HF cycle. To date, MeSCs
have been studied most extensively in the mouse. Specifically, in
murine skin, MeSCs reside within the bulge region of the resting
hair follicle (HF), a continuous part of the outer root sheath that
marks the bottom of the permanent portion of hair follicles.
SUMMARY
[0006] Embodiments of the invention include a method of isolating
melanocyte stem cells from the hair follicle of mammalian skin to
yield CD34(+) multipotent neural crest progenitor cells that can
express myelin basic protein, comprising the steps of: (a)
obtaining a suspension of skin cells that include MeSCs from the
bulge region, the lower permanent portion, or both, of the hair
follicle; (b) separating CD34(+) MeSCs from said single cell
suspension; and (c) exposing said CD34(+) MeSCs to conditions that
promote neural crest progenitor formation, to form CD34(+)
multipotent neural crest progenitor cells that express the marker
Gfap and express myelin basic protein.
[0007] In some embodiments, the conditions that promote neural
crest progenitor formation comprise culturing said CD34(+) MeSCs in
neural crest differentiation medium.
[0008] Further embodiments of the invention include isolated
CD34(+) multipotent neural crest progenitor cells made according to
the methods described above in this paragraph and throughout the
specification. Preferably, the isolated CD34 (+) multipotent neural
crest progenitor cells of embodiments of the invention are at least
80% pure, at least 85% pure, at least 90% pure, at least 95% pure,
at least 97% pure, at least 98% pure, at least 99% pure, at least
99.5% pure, or at least 99.9% pure CD34(+) multipotent neural crest
progenitor cells.
[0009] The cells of the invention and the methods described above
in this paragraph and throughout the specification can involve
isolated CD34(+) multipotent neural crest progenitor cells which
are human cells, which are mouse cells, and which are mouse cells
from a Dct-H2BGFP mouse. In addition, certain embodiments of the
invention comprise a composition comprising an acceptable carrier
and the isolated CD34(+) multipotent neural crest progenitor cells
described above in this paragraph and throughout the specification.
Certain embodiments of the invention also include substantially
pure isolated CD34(+) multipotent neural crest progenitor cells
from mammalian hair follicle bulge, and lower permanent portion of
the hair follicle, which express the cell marker Gfap, and express
myelin basic protein.
[0010] Embodiments of the invention also include a method of
producing a dense myelin sheath around an axon, comprising
contacting said axon with the isolated CD34(+) multipotent neural
crest progenitor cells of the invention as described in the above
paragraph and throughout the specification. This contacting can be
and preferably is under conditions that promote myelination. Such
conditions that promote myelination can comprise culturing said
CD34(+) MeSCs in Poly-D-Lysine and Laminin-coated chambers in the
presence of neural crest differentiation medium said medium
comprising 10 .mu.M ascorbic acid to induce myelination
[0011] Additional embodiments of the invention include a method of
producing a functional myelin sheath on an axon which lacks a
functional myelin sheath or has become demyelinated, comprising
contacting said axon with the isolated CD34(+) multipotent neural
crest progenitor cells described in the above paragraph and
throughout the specification. Such contacting can be administration
by direct injection into the area of said axon, or by intrathecal
injection, or intravenously, or by stereotaxic injection, including
in the central nervous system, the peripheral nervous system, or
both.
[0012] Embodiments of the invention include where the demyelination
of said axon is immune-mediated, auto-antibody mediated, or caused
by a demyelinating disease, trauma, toxin, bacterial infection,
viral infection, parasitic infection, or genetic defect, and where
said demyelinating disease is selected from the group consisting
of: experimental allergic encephalomyelitis, acute disseminated
encephalomyelopathy, acute hemorrhagic encephalomyelopathy,
experimental allergic neuritis, amoebic meningoencephalitis,
Guillain-Barre syndrome, multiple sclerosis, stroke, traumatic
brain injury, and traumatic peripheral nerve injury, Devic's
disease (otherwise known as neuromyelitis optica (NMO)), NMO
spectrum disorder, progressive multifocal leukoencephalopathy,
central pontine myelinolysis, Tabes dorsalis, optic neuritis,
transverse myelitis, progressive inflammatory neuropathy,
myelopathy, chronic inflammatory demyelinating polyneuropathy,
Charcot-Marie-Tooth disease, visna, and the like.
[0013] These and other features, aspects, and advantages of the
present invention will become better understood with regard to the
following description, appended claims, and accompanying
figures.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] The following drawings form part of the present
specification and are included to further demonstrate certain
embodiments of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0015] FIG. 1A-1E are photographs showing the identification of
GFP-expressing melanocyte precursor cells in bulge/LPP and SHG of
telogen HF. Distinct subpopulations of GFP-expressing cells in the
CD34(+) bulge/LPP region (arrows, FIG. 1A) and P-Cad.sup.+ SHG
region (arrows, FIG. 1B) in P56 dorsal skin HFs are shown. FIG. 1C:
Co-localization of Kit protein expression and GFP-expressing cells
from both bulge/LPP and SHG (arrows). Inset boxes show higher
magnification of an individual GFP-expressing cell co-localizing
with c-Kit expression. FIG. 1D: Co-localization of Dct expression
and GFP-expressing cells from both bulge/LPP and SHG (arrows).
Inset boxes show higher magnification of individual GFP-expressing
cell co-localizing with Dct expression. FIG. 1E: GFP-expressing
cells and anti-CD34 immunofluorescence in P56 dorsal skin HF. The
arrows point out co-localization of bulge/LPP GFP-expressing cell
and CD34 expression and the arrowheads show that SHG GFP-expressing
cells lack CD34 expression. Col IV staining outlines the HF
border.
[0016] FIG. 2A-2C are photographs and graphs illustrating the
separation of bulge/LPP and SHG GFP-expressing melanocyte precursor
cells of telogen HFs. FIG. 2A: is an experimental scheme where
MeSCs identified in HF bulge/LPP and SHG of Dct-H2BGFP mice were
separated using fluorescence activated sorting (FACS) with GFP and
anti-CD34. FIG. 2B: shows the separation of bulge/LPP
(CD34(+)GFP.sup.+), SHG (CD34.sup.-GFP.sup.+) melanocyte precursor
cells and (CD34(+)GFP.sup.-), (CD34.sup.-GFP.sup.-) dermal cells
using FACS with GFP and anti-CD34, showing a representative image
of the FACS. FIG. 2C illustrates quantitative RT-PCR analysis for
the expression of Dct, Krt14, Cdh3, and Cd34 genes among the
CD34(+)GFP.sup.+ (bulge), CD34.sup.-GFP.sup.+ (SHG),
CD34(+)GFP.sup.- and CD34.sup.-GFP.sup.- sorted cell populations.
(*P.ltoreq.0.01 by ANOVA).
[0017] FIG. 3A-3C are photographs and bar graphs representing
distinct melanogenic properties of bulge/LPP and SHG melanocyte
precursor cells of telogen HFs. FIG. 3A: quantitative RT-PCR
analysis for the expression of Tyr, Tyrp1 and Pmel among the
bulge/LPP (CD34(+)GFP.sup.+) and SHG (CD34(+)GFP.sup.+) sorted
cells. FIG. 3B: In vitro melanocyte differentiation potential of
CD34(+)GFP.sup.+ (bulge) and CD34.sup.-GFP.sup.+ (SHG) MeSCs in
melanocyte differentiation culture condition for 4 days (top two
panels) or 7 days (bottom two panels). FIG. 3C: Quantitation data
of the bulge/LPP and SHG melanocyte precursor cell potential to
produce pigmented melanocytes in melanocyte differentiation medium
at the 4.sup.th and 7.sup.th day. (*P.ltoreq.0.01).
[0018] FIG. 4A-4E are photographs and bar graphs illustrating
CD34(+) bulge/LPP MeSCs exhibiting distinct neural crest lineage
potential. FIG. 4A: Formation of non-adherent spheroids was studied
among CD34(+)GFP.sup.+ (bulge/LPP) melanocyte precursors and
CD34.sup.-GFP.sup.+ (SHG) cells when cultured in neural crest stem
cell medium for up to 8 days (top panels). The image in the bottom
panel depicts retention of GFP expression in spheroids formed by
both cell types. FIG. 4B: The size of non-adherent spheroids
derived from bulge/LPP and SHG MeSCs when cultured in neural crest
stem cell medium as determined at days 2, 4, 6 and 8 day.
(*P.ltoreq.0.01). FIG. 4C: Expression of neural crest lineage
markers Gfap, .alpha.-Sma, Tuj1, Krt15 among CD34(+)GFP.sup.+
(bulge) (top panel) and CD34.sup.-GFP.sup.+ (SHG) (bottom panel)
MeSCs following adherent culture in neural crest differentiation
medium. FIG. 4D: Expression of melanocyte lineage marker Tyrp1
among CD34(+)GFP.sup.+ (bulge) (top panel) and CD34.sup.-GFP.sup.+
(SHG) (bottom panel) MeSCs following adherent culture in melanocyte
differentiation medium. In the right two panels, brightfield images
show pigmented melanocytes among cultured CD34(+)GFP.sup.+ (bulge)
(top) and CD34.sup.-GFP.sup.+ (SHG) (bottom) MeSCs. FIG. 4E:
Quantitation of neural crest-derived cell and melanocyte marker
expression frequency after cells were cultured in either neural
crest differentiation (left) or melanocyte differentiation (right)
condition.
[0019] FIG. 5A-5E are photographs illustrating in vitro myelination
properties of CD34(+) bulge/LPP MeSCs. FIG. 5A: Schematic of in
vitro dorsal root ganglion (DRG) co-culture system: For this
experiment, embryonic DRGs from rat at E17 (Lonza) or DRGs from
myelin-deficient neonatal P5 shi/shi mice were isolated. DRG cells
were cultured for one week on Poly-D-Lysine and laminin-coated
24-well plates to develop neurites. CD34(+) or CD34(-)MeSCs
isolated from Dct-H2BGFP mouse skin or rat oligodendroglial cells
(ODC) were then seeded onto the dense neuronal bed. After one week
of co-culture, cells were fixed and studied for myelination of
axons by immunofluorescence for the expression of myelin basic
protein (Mbp) or determining the presence or absence of myelin
sheath formation by electron microscopy. FIG. 5B: Co-cultures of
CD34(+) or CD34(-)MeSCs and rat embryonic DRGs. In the image, the
arrows point to GFP-expressing cells, the solid arrows representing
CD34(+) bulge/LPP MeSCs and the dotted arrows representing
CD34(-)SHG MeSCs in the DRG co-cultures. The second and fourth rows
are high magnification images of their respective lower
magnification top row images. FIG. 5C: The top row depicts Mbp
expressed by ODCs (left panel) and Tuj1 expressed by Shiverer
axonal outgrowths (center). In the bottom row, high magnification
images of the region marked with a white box are shown; it depicts
MBP deposition along a Tuj1-expressing Shiverer axon. FIG. 5D:
Co-cultures of CD34(+) or CD34(-)MeSCs, or DRGs alone with no added
cells, and neonatal Shiverer DRGs. In the image, the arrows point
to GFP-expressing cells, the solid arrows representing CD34(+)
bulge/LPP MeSCs and the dotted arrows representing CD34(-)SHG
melanocyte precursor cells in DRG co-cultures. FIG. 5E:
Electron-dense myelin sheath formation around Shiverer neurites
when co-cultured with CD34(+) or CD34(-)MeSCs or no cells using
electron microscopy. At the right side in either CD34(+) or CD34(-)
MeSCs co-cultured with Shiverer DRGs, high magnification images of
the region marked with black box are shown. In the case where no
cells were co-cultured with Shiverer DRGs, the right image is a
high magnification of the left image.
[0020] FIG. 6A-6E are photographs providing a characterization of
the Dct-Tta.sup.KIH2b-Gfp bitransgenic mouse model. FIG. 6A shows
the expression of H2BGFP in embryonic melanoblast, in the trunk and
sub- and supra-optic region at E12.5. Post-natal H2BGFP in
melanocyte cells of skin hair follicles is shown in FIG. 6B
(anagen) and FIG. 6C (telogen). Expression of H2BGFP in embryonic
melanoblasts (E12.5) are shown in the cross section of the eye
(FIG. 6D) and in the spinal cord (FIG. 6E). FIG. 6E shows two
representative sets of three images.
[0021] FIG. 7A-7B are photographs showing GFP-expressing melanocyte
precursors in whole mount telogen hair follicles. The photographs
show P56 whole mount hair follicles of mouse tail epidermis,
demonstrating GFP expression in CD34(+) bulge/LPP cells (FIG. 7A,
arrowheads) and P-cad+SHG cells (FIG. 7B, arrowheads).
[0022] FIG. 8A-8B show quantitation of GFP-expressing cells within
and outside of the hair follicles. In FIG. 8A, GFP-expressing cells
were quantitated within and outside of the hair follicles of
Dct-Tta.sup.KIH2b-Gfp mouse skin based on staining of Col IV, which
marks the basement membrane or border of hair follicles. Images in
the top panel of FIG. 8A represent GFP-expressing cells within,
outside, and on the border of each hair follicle visualized. The
bottom panel of FIG. 8A is a schematic representation of
GFP-expressing cells depicted as bulge/LPP(*) and SHG (-). FIG. 8B
is a table showing quantitation of GFP-expressing cells from the
bulge/LPP and the SHG compartments of hair follicles in three
different categories, by location within, outside, or on the border
of the hair follicles.
[0023] FIG. 9A-9B show representative FACS sorting schemes used for
isolation of bulge/LPP and SHG melanocyte precursors, based on GFP
and CD34 markers from wild type (FIG. 9A) and Dct-TtaKIH2b-Gfp
mouse (FIG. 9B) skin hair follicles.
[0024] FIG. 10 shows analysis of the total RNA extracted from the
FACS-sorted GFP(+) melanocytes.
[0025] FIG. 11A-11B demonstrate that CD34(+) bulge/LPP melanocyte
stem cells exhibit the neuronal stem cell marker nestin with a
comparison of expression of nestin RNA (FIG. 11A) and nestin
protein (FIG. 11B) in CD34(+) bulge/LPP versus CD34(-) SHG
melanocyte stem cells.
[0026] FIG. 12A-12B relate to co-cultures of cells according to an
embodiment of the invention and Shiverer dorsal root ganglia. In
FIG. 12A, two individual litters were screened for two individual
repeats in the top and bottom panels of the figure, for genotyping
to identify Mbp(+) Shiverer pups, which were further used to
isolate dorsal root ganglia at P5 to P8. FIG. 12B shows a
representative image for GFP-expressing cells CD34(+) or CD34(-) or
No cells) co-cultured along the side of neurites generated from
dorsal root ganglia isolated from Shiverer pups. After the
identification of samples for GFP-expressing cells in their
representative cultures, the samples were fixed and sent for
electron microscopy.
[0027] FIG. 13A-13B show a reanalysis for the purity of
CD34(+)GFP(+) bulge/LPP cells (FIG. 13A) and CD34(-)GFP(+) SHG
cells (FIG. 13B) FACS-sorted melanocyte precursors. A few hundred
cells were reanalyzed from each sorted population to test the
effectiveness of the sorting methods.
DETAILED DESCRIPTION
[0028] Undifferentiated MeSCs residing in the bulge/LPP region and
the secondary hair germ (SHG) regions of the mammalian HF can be
separated into two distinct molecular and functional classes that
are distinguished by their mutually exclusive expression of CD34.
MeSCs that express CD34 or "CD34(+) MeSCs" are isolated from MeSCs
from the bulge/LPP region/LPP of the HF and express high levels of
CD34. These cells have a broader differentiation potential compared
with MeSCs that do not express CD34, or "CD34(-) MeSCs." Of
particular interest are CD34(+) MeSCs that represent a more
primitive and multipotent subset of MeSCs.
[0029] It has been discovered that when these CD34(+) MeSCs are
co-cultured with myelin-deficient DRG neurites (that lack a
functional myelin sheath) under conditions that promote neural
crest progenitor formation, upon differentiation, the resulting
CD34(+) multipotent neural crest progenitor cells express the
marker Gfap and myelin basic protein (Mbp) along axons and to form
a dense, multilayered myelin sheath. Accordingly, these CD34(+)
multipotent neural crest progenitor cells derived from MeSCs from
the HF bulge/LPP region can be used for generation of a dense
myelin sheath as well as therapeutically for demyelinating
diseases, such as multiple sclerosis and optic neuritis.
[0030] In the following description, for the purposes of
explanation, numerous specific details are set forth in order to
provide a thorough understanding of the present invention. It will
be apparent, however, to one skilled in the art that the present
invention may be practiced without these specific details. In order
that the invention may be readily understood and put into practical
effect, particular preferred embodiments will now be described by
way of the following non-limiting examples.
1. DEFINITIONS
[0031] Unless otherwise defined, all technical and scientific terms
used herein are intended to have the same meaning as commonly
understood in the art to which this invention pertains and at the
time of its filing. Although various methods and materials similar
or equivalent to those described herein can be used in the practice
or testing of the present invention, suitable methods and materials
are described below. However, the skilled should understand that
the methods and materials used and described are examples and may
not be the only ones suitable for use in the invention. Moreover,
it should also be understood that as measurements are subject to
inherent variability, any temperature, weight, volume, time
interval, pH, salinity, molarity or molality, range, concentration
and any other measurements, quantities or numerical expressions
given herein are intended to be approximate and not exact or
critical figures unless expressly stated to the contrary. Hence,
where appropriate to the invention and as understood by those of
skill in the art, it is proper to describe the various aspects of
the invention using approximate or relative terms and terms of
degree commonly employed in patent applications, such as: so
dimensioned, about, approximately, substantially, essentially,
consisting essentially of, comprising, and effective amount.
[0032] Generally, nomenclature used in connection with, and
techniques of, cell and tissue culture, molecular biology,
immunology, microbiology, genetics, protein, and nucleic acid
chemistry and hybridization described herein are those well-known
and commonly used in the art. The methods and techniques of the
present invention are generally performed according to conventional
methods well known in the art and as described in various general
and more specific references that are cited and discussed
throughout the present specification unless otherwise indicated.
See, e.g., Sambrook et al. Molecular Cloning: A Laboratory Manual,
2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y. (1989); Ausubel et al., Current Protocols in Molecular
Biology, Greene Publishing Associates (1992, and Supplements to
2002); Harlow and Lan, Antibodies: A Laboratory Manual, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1990);
Principles of Neural Science, 4th ed., Eric R. Kandel, James H.
Schwartz, Thomas M. Jessell editors. McGraw-Hill/Appleton &
Lange: New York, N. Y. (2000). Unless defined otherwise, all
technical and scientific terms used herein have the same meaning as
commonly understood by one of ordinary skill in the art.
[0033] The term "administering" as used herein, means delivery, for
example of a CD34+ multipotent neural crest progenitor cell.
[0034] The term "bulge region/lower permanent portion" as used
herein, refers to an anatomical location in the outer root sheath
at and below the insertion point of the arrector pili muscle of the
hair follicle. The "lower permanent portion" (LPP) is synonymous
with the bulge in the mouse hair follicle. This term is used to
distinguish it from the secondary hair germ (SHG), where CD34(-)
MeSCs are found, and is a structure that disappears during certain
phases of the hair follicle growth cycle. It houses several types
of stem cells, which supply the entire hair follicle with new
cells. These stem cells develop in situ into epithelial cells and
melanocytes. Melanocyte stem cells have been identified in the
bulge/LPP and secondary hair germ compartment of telogen HFs.
[0035] The term "CD34(+) melanocyte stem cell" or "CD34(+) MeSC" as
used herein, means a subset of undifferentiated MeSCs in mouse HFs
which express the membrane protein CD34 and have the ability to
differentiate into cells of neural crest lineage that express at
least the cell markers Gfap and Mbp.
[0036] The term "CD34(-) melanocyte stem cell" or "CD34(-) MeSC" as
used herein, means a subset of undifferentiated MeSCs in mouse HFs
which do not express CD34 and have the ability to differentiate as
a melanocyte cell but not cells of a glial lineage.
[0037] The term "contacting" as used herein, means bringing into
close physical association or immediate proximity, including
physically touching. For example, "contacting" can include exposing
the extracellular surface of a demyelinated axon with solution or
suspension containing cells.
[0038] The term "Dct-H2BGFP.sup.KI mouse" or
"Dct-Tta.sup.KIH2b-GFP" or "DCT-H2BGFP" as used herein, is a
knock-in mouse model expressing the tetracycline-regulated
transactivator (tTA) gene under the control of the murine
dopachrome tautomerase (Dct) melanocyte specific promoter to allow
a melanocyte specific tTA transactivation in vivo and designed to
drive expression of H2BGFP constitutively in bitransgenic Dct-tTA
knock-in-TRE-H2BGFP mice in the absence of doxycycline.
[0039] The term "demyelination" as used herein, means damage to the
myelin sheath around nerve process, or its absence.
[0040] The term "demyelinating disease" as used herein, means any
condition that results in damage to or absence of the protective
covering (myelin sheath) that surrounds nerve fibers in the brain
and spinal cord, or in the peripheral nervous system. When the
myelin sheath is damaged, nerve impulses slow or even stop, causing
neurological problems.
[0041] The term "detectable" refers to any amount that can be
discerned by an assay or measurement system known to a person of
skill in the art, above background, to a degree of statistical
certainty, for example a P value of .ltoreq.0.05 as a measure of
statistical significance or to any level suitable for the analysis
being conducted according to standards acceptable to the person of
skill in the art.
[0042] The term "dorsal root ganglion," (or spinal ganglion) (also
known as a posterior root ganglion), as used herein, means a
cluster of nerve cell bodies (a ganglion) in a posterior root of a
spinal nerve.
[0043] The term "exposing" when referring to exposing to conditions
that promote neural crest progenitor formation, refers to
subjecting to any environment under which neural crest progenitors
are formed, or under which a stem cell differentiates or partially
differentiates to form a lineage of cells derived from neural crest
progenitors. Thus, the term includes subjecting to any condition
wherein cells, including MeSCs, have or gain the capacity to
differentiate into neural or glial cell types, including myelin
basic protein-expressing cells, myelin depositing cells, glia or
Schwann cells. Such conditions can be in vitro or in vivo.
[0044] The terms "express," "expression," and "expressing," as used
herein with respect to gene products, indicate that the gene
product of interest is produced by the cell at a detectable level.
"Significant expression" refers to expression of the gene product
of interest to 10% above the minimum detectable expression. Cells
with "high expression" or "high levels" of expression of a given
expression product are the 10% of cells in a given sample or
population of cells that exhibit the highest expression of the
expression product. Cells with "low expression" of a given
expression product are the 10% of cells in a given sample or
population of cells that exhibit the lowest expression of the
expression product (which can be no expression).
[0045] The term "hair follicle" is used according to the usual
meaning in the art, and includes skin appendages of the vertebrate
skin, preferably mammalian skin, that have the ability to
periodically and stereotypically regenerate in order to
continuously produce new hair over a lifetime. The term is
contemplated to refer to any hair follicle of any vertebrate,
preferably a mammal, including human and mouse hair follicles, as
well as any research, working or companion mammal.
[0046] The terms "isolated," "isolating," "purified," "purifying,"
"enriched," and "enriching," as used herein with respect to cells,
means that the MeSCs at some point in time were separated and
sorted to produce two subsets: CD34(+) MeSCs and CD34(-) MeSCs both
of which are capable of directed differentiation. "Highly
purified," "highly enriched," and "highly isolated," when used with
respect to cells, indicates that the cells of interest are at least
about 70%, about 75%, about 80%, about 85% about 90% or more of the
cells, about 95%, at least 99% pure, at least 99.5% pure, or at
least 99.9% pure or more of the cells, and can preferably be about
95% or more of the differentiated cells.
[0047] The term "melanocyte stem cell," or "MeSC" as used herein,
refers to undifferentiated stem cells residing within the bulge
and/or lower permanent portion and/or SHG region of the mammalian
HF. In situ, these cells are responsible for pigment regeneration
during recurrent HF cycles.
[0048] The term "myelin" as used herein, refers to a fatty white
insulating substance that surrounds neuronal processes, forming in
multiple layers, the "myelin sheath," usually around only the axon
of a neuron. It is essential for the proper functioning of the
nervous system and is an outgrowth of a type of glial cell
sometimes referred to as Schwann cells. A functional myelin sheath
is a densely applied layer of fatty membrane which increases
transmission in a neuronal projection or axon to which it is
applied.
[0049] The term "myelin basic protein" as used herein, refers to a
protein important in the process of myelination of nerves in the
nervous system. The myelin sheath is a multi-layered membrane,
unique to the nervous system that functions as an insulator to
greatly increase the velocity of axonal impulse conduction.
[0050] The term "neurite," as used herein, means any projection
from the cell body of a neuron. This projection can be either an
axon or a dendrite, particularly in its undifferentiated stage. In
certain embodiments, the "neurite" preferably is an axon.
[0051] The term "neuron," as used herein, means an electrically
excitable cell that processes and transmits information through
electrical and/or chemical signals. These signals between neurons
occur via synapses, specialized connections with other cells.
Neurons can connect to each other to form neural networks. Neurons
are the core components of the brain and spinal cord of the central
nervous system (CNS), and of the ganglia of the peripheral nervous
system (PNS). Specialized types of neurons include: sensory neurons
which respond to touch, sound, light and all other stimuli
affecting the cells of the sensory organs that then send signals to
the spinal cord and brain, motor neurons that receive signals from
the brain and spinal cord to cause muscle contractions and affect
glandular outputs, and interneurons which connect neurons to other
neurons within the same region of the brain, or spinal cord in
neural networks. A typical neuron consists of a cell body (soma),
dendrites, and an axon.
[0052] The term "population" as used herein when used with respect
to cells, means a group or collection of cells that share one or
more characteristics. The term "subpopulation," when used with
respect to cells, refers to a population of cells that are only a
portion or "subset" of a population of cells.
[0053] The term "acceptable carrier" as used herein, means
excipients, emollients, and stabilizers or stabilizing agents or
other acceptable materials, compositions, or structures involved in
holding, carrying, transporting, or delivering any subject cell or
composition. Each means must be "acceptable" in the sense of being
compatible with the other ingredients of a subject composition and
not injurious to the subject.
[0054] The term "multipotent" as used herein, refers to a property
of any stem cell or progenitor cell, meaning that it has the
ability to differentiate into two or more different cell types. The
term includes totipotent, pluripotent, oligopotent and bipotent. It
therefore describes a property of both embryonic stem cells and
adult stem cells, any of which can divide through mitosis to
produce more stem cells and can differentiate into two or more
specialized cells. A "multipotent neural crest progenitor cell
refers to a cell that has the capacity to differentiate into cells
of at least the neural crest lineage, which includes any of the
diverse cells of the neural crest, including but not limited to
melanocytes, craniofacial cartilage, craniofacial bone, smooth
muscle, peripheral neurons, enteric neurons, and glia, including
Schwann cells.
[0055] The term "remyelination" as used herein means the
regenerative process by which a demyelinated axon is reinvested
with a new myelin sheath. It is associated with functional recovery
and maintenance of axonal health. It can occur as a spontaneous
regenerative response following demyelination in a range of
pathologies including immune-mediated, auto-antibody mediated, or
caused by a demyelinating disease, trauma, toxin, bacterial
infection, viral infection, parasitic infection, or genetic
defect.
[0056] The term "Schwann cells" or "SCs" are a type of cell found
throughout the entire peripheral nervous system (PNS). The PNS
includes all nerves going out to muscles as well as sensory nerves
coming from the muscles back to the spinal cord. Schwann cells are
a type of "support" cell in the PNS. Schwann cells myelinate
individual nerve fibers (e.g., axons), which is necessary for
sending appropriate electrical signals throughout the nervous
system. Schwann cells are not stem cells. They are adult cells and
can only be Schwann cells in their natural environment. Schwann
cells are absolutely essential for regeneration in the injured
PNS.
[0057] The term "single cell suspension" as used herein, means
tissue broken up into single cells suspended in a liquid of some
type as opposed to clumps of cells or tissue attached to each other
by extra cellular matrix.
[0058] The terms "subject," "host," and "patient," as used herein,
are used interchangeably and mean a mammalian animal being treated
with the present compositions, including, but not limited to,
vertebrates, simians, humans, felines, canines, equines, rodents
(including rats, mice and the like), bovines, porcines, ovines,
caprines, mammalian farm animals, mammalian sport animals, and
mammalian pets.
[0059] The terms "substantially pure," "substantially purified,"
and "substantially enriched" as used herein with respect to cells
means the isolated cell population of mammalian melanocyte stem
cells that includes at least 80% pure, and preferably at least 85%
pure, at least 90% pure, at least 95% pure, at least 97% pure, at
least 98% pure, at least 99% pure, at least 99.5% pure, or at least
99.9% pure cells of the type in question, for example, CD34(+)
multipotent neural crest progenitor cells.
[0060] The term "skin-derived precursors" or "SKPs" as used herein
means an endogenous multipotent precursor cell present in human
skin that can be isolated and expanded and differentiated into both
neural and mesodermal cell types. SKPs share characteristics with,
and have multipotentiality similar to, embryonic neural crest stem
cells. SKPs derive from endogenous adult dermal precursors that
exhibit properties similar to embryonic neural-crest stem
cells.
[0061] As used herein, a "therapeutic agent" means a compound or
molecule capable of producing an effect. Preferably, the effect is
beneficial.
[0062] As used herein, "therapeutically effective amount" means an
amount sufficient to treat a subject afflicted with a demyelination
which is immune-mediated, auto-antibody mediated, due to a
demyelinated disease, or due to trauma, a toxin, a viral infection
a bacterial infection, or genetic defect to alleviate a symptom or
a complication associated with the disease.
[0063] The term "treating" as used herein, means slowing, stopping,
or reversing the effects of a demyelination, or causing
remyelination or partial remyelination, when demyelination is
immune-mediated, auto-antibody mediated, due to a demyelinated
disease, or due to trauma, a toxin, a viral infection, a bacterial
infection, a parasitic infection, or genetic defect. As used
herein, the terms "treatment," "treating," and the like, as used
herein refer to obtaining a desired pharmacologic and/or
physiologic effect. The effect may be prophylactic in terms of
completely or partially preventing a condition or disease or
symptom thereof and/or may be therapeutic in terms of a partial or
complete cure for a condition or disease and/or adverse effect
attributable to the condition or disease. "Treatment," includes any
treatment of a condition or disease in a mammal, particularly in a
human, and includes: (a) preventing the condition or disease or
symptom thereof from occurring in a subject which may be
predisposed to the condition or disease but has not yet been
diagnosed as having it; (b) inhibiting the condition or disease or
symptom thereof, such as, arresting its development; and (c)
relieving, alleviating or ameliorating the condition or disease or
symptom thereof, such as, for example, causing regression of the
condition or disease or symptom thereof.
2. BACKGROUND
Neural Crest
[0064] Stem cells are defined by their ability to both self-renew
and give rise to multiple lineages in vivo and/or in vitro. The
embryonic neural crest is a multipotent tissue that gives rise to a
plethora of differentiated cell types in the adult organism and is
unique to vertebrate embryos. The neural crest is an ideal source
for multipotent adult stem cells. The neural crest is derived from
the ectoderm but has sometimes been called the fourth germ layer
because of its importance. The neural crest cells originate at the
dorsal most region of the neural tube. The neural crest cells
migrate extensively to generate a prodigious number of
differentiated cell types. These cell types include (1) the neurons
and glial cells of the sensory, sympathetic, and parasympathetic
nervous systems, (2) the epinephrine-producing (medulla) cells of
the adrenal gland, (3) the pigment-containing cells of the
epidermis, and (4) many of the skeletal and connective tissue
components of the head. The fate of the neural crest cells depends,
to a large degree, on where they migrate to and settle. Significant
advances have been made in the past few years isolating neural
crest stem cell lines that can be maintained in vitro and can give
rise to many neural crest derivatives either in vitro or when
placed back into the context of an embryo.
Schwann Cells
[0065] The myelinating Schwann cells in peripheral nerves are
derived from the neural crest, Schwann cell development occurs
through a series of transitional embryonic and postnatal phases,
which are tightly controlled by a number of signals. During the
early embryonic phases, neural crest cells are specified to give
rise to Schwann cell precursors. These SCPs the first transitional
stage in the Schwann cell lineage, and then generate the immature
Schwann cells. At birth, the immature Schwann cells differentiate
into the myelinating Schwann cells that populate the mature nerve
trunks. See Woodhoo, A. "Development of the Schwann Cell Lineage:
From the Neural Crest to the Myelinated Nerve," GLIA 56:1481-1490
(2008).
[0066] Schwann cells have been proposed for a number of clinical
applications based on their ability to remyelinate demyelinated
lesions (Blakemore and Crang, 1985; Kohama et al., 2001) and to
promote regeneration and remyelination in the injured spinal cord
(Takami et al., 2002; Pearse et al., 2004). Schwann cells which are
the principal glial cells of the peripheral nervous system, and
myelinate individual nerve fibers (e.g., axons), which is necessary
for sending appropriate electrical signals throughout the nervous
system, They can be dedifferentiated in vitro to a glia/melanocyte
precursor. Melanocytes and glia can be derived from a common
bipotent neural crest precursor.
3. OVERVIEW
[0067] MeSCs residing in the bulge/LPP region of the HF and the
secondary hair germ (SHG) regions of the mammalian HF can be
separated into two distinct molecular and functional classes that
are distinguished by their mutually exclusive expression of CD34.
CD34 expressing MeSCs known as CD34(+) MeSCs isolated from MeSCs in
the bulge/LPP region of the HF exhibit express high levels of CD34.
CD34(+) MeSCs have a broader differentiation potential compared
with non-CD34 expressing cells known as CD34(-) MeSCs. Of
particular interest are CD34(+) MeSCs that represent the more
primitive subset of the MeSCs. It has been discovered that these
CD34(+) MeSCs, under conditions that promote neural crest
progenitor formation and ultimately myelination, form cells that
express at least one of the markers Gfap, Mbp, .alpha.-Sma, Tuj1,
Krt15, and nestin. These CD34(+) multipotent neural crest
progenitor cells have the ability to produce a functional, dense,
multilayered myelin sheath on neuronal axons.
[0068] Without being bound by theory, the observation that, in one
example, a loose myelin sheath was observed in a co-culture of
CD34(-) MeSCs with shi/shi neurites may suggest either that a
subset of these CD34(-) MeSCs possess a limited ability to generate
a myelin sheath, that these CD34(-) MeSCs were incompletely
separated from CD34(+) MeSCs, or that a cell surface protein not
yet identified will be more optimal than CD34 for identifying which
CD34(+) multipotent neural crest progenitor cells selectively
possess glial potential.
[0069] Mouse and human SKPs isolated non-specifically from
mammalian dermis possess similar molecular and cellular
differentiation properties of the highly-specific, CD34(+)
multipotent neural crest progenitor cells that now have been found
to differentiate from CD34(+) MeSCs that were isolated from the
MeSCs found in the HF bulge/LPP. CD34(+) expression can be detected
in a subset of human skin SKPs. The discovery of the unique
differentiation properties of CD34(+) MeSCs indicates that human
SKPs with this ability can be isolated and used therapeutically for
demyelinating diseases, including, but not limited to, multiple
sclerosis and optic neuritis. Furthermore, CD34(+) MeSCs can be
used as a discovery tool for markers of highly-specific human
skin-derived stem cell subsets that can be leveraged for these
therapeutic purposes.
4. EMBODIMENTS
[0070] The CD34(+) MeSCs subject to conditions that promote neural
crest progenitor formation are able to form CD34(+) multipotent
neural crest progenitor cells that express at least one of the
markers Gfap, Mbp, a-Sma, Tuj1, Krt15 and nestin. They also have
the ability to produce a functional, dense, multilayered myelin
sheath on neuronal axons. Accordingly, methods of making these
isolated MeSCs comprising these CD34(+) multipotent neural crest
progenitor cells, compositions and kits comprising them, are
provided. Methods for producing a dense myelin sheath around the
neurite are also provided.
A. Methods of Isolating MeSCs to Yield CD34(+) Multipotent Neural
Crest Progenitor Cells
[0071] Certain embodiments described herein relate to methods of
isolating MeSCs from the mammalian skin HF to yield CD34(+)
multipotent neural crest progenitor cells that can express at least
one of the markers Gfap, Mbp, a-Sma, Tuj1, Krt15, and nestin. The
method includes obtaining a suspension of skin cells that includes
MeSCs from the bulge/LPP region, the lower permanent portion, or
both, of the hair follicle. Then, CD34(+) MeSCs are separated from
the single cell suspension. The CD34(+) MeSCs are then exposed to
conditions that promote neural crest progenitor formation to form
CD34(+) multipotent neural crest progenitor cells that express at
least one of the markers Gfap, Mbp, a-Sma, Tuj1, Krt15, and
nestin.
[0072] In a preferred embodiment, the method comprises preparing a
cell suspension from mammalian dermal tissue comprising HFs. Such a
cell suspension generally comprises CD34(+) MeSCs and CD34(-)
MeSCs. CD34(+) MeSCs are separated from the cell suspension using
any convenient method known in the art, for example, a
fluorescence-based sorting techniques and expression labels.
Suitable labels include, but are not limited to green fluorescent
protein (GFP), varieties of other fluorescent proteins including
yellow and red, other optical labels utilized for cell separation
whose expression is driven by the Dct promoter, CD34, or other cell
surface markers whose expression is highly correlated with the
expression of GFP or its derivatives, or CD34, or both. Anti-CD34
antibody is preferred to specifically label the CD34(+) MeSCs to
produce CD34(+) multipotent neural crest progenitor cells.
[0073] Techniques for labeling, sorting, fluorescence activated
cell sorting (FACS), and enrichment of cells are well known in the
art. Useful examples are described in WO 2001/022507 and U.S.
application Ser. No. 13/391,251 (US 2012-0220030 A1), which are
hereby incorporated by reference in their entirety, and
specifically for their description of cell labeling, sorting, and
enrichment. The cells can be identified, separated, and/or enriched
based on cell markers. It will be understood by those of skill in
the art that the stated expression levels reflect detectable
amounts of the marker protein on the cell surface. Generally, cell
markers can be assessed by staining or labeling cells with probes
that specifically bind the marker of interest and that generate a
detectable signal.
[0074] CD34(+) MeSCs and CD34(-) MeSCs were subjected to gene
expression and in vitro cell culture studies for assessment of
their neural crest lineage potential as well as the melanogenic
properties of CD34(+) multipotent neural crest progenitor cells and
their ability to myelinate axons. Sorted CD34(+) MeSCs and CD34(-)
MeSCs were counted and used either for primary cultures or for
quantitative real-time PCR (qRT-PCR) by extracting RNA from
respective cell populations. In preferred embodiments, molecular
techniques such as quantitative RT-PCR were used to show high
levels of Dct and low levels of Krt14 expression in bulge/LPP and
SHG isolated multipotent neural crest progenitor cells. Cdh3
(P-cadherin, a SHG compartment marker) is high only in CD34(-)
GFP(+) multipotent neural crest progenitor cells.
[0075] Biological properties of both CD34(+) and CD34(-)
multipotent neural crest stem cells were determined by introducing
the CD34(+) MeSCs and CD34(-) MeSCs in melanocyte differentiation
conditions for a period of seven days. Recipes for media can vary
in pH, glucose concentration, growth factors, and the presence of
other nutrients. Classically, the control of stem cell fate has
been attributed to genetic and molecular mediators (growth factors,
cytokines, and transcription factors). Useful examples of
melanocyte differentiation conditions are described in "Culture of
human melanocytes. Its contribution to the knowledge of melanocyte
physiology," Pathol Biol (Paris) 1992 February; 40 (2): 114-20 and
"In Vitro Dedifferentiation of Melanocytes from Adult Epidermis,"
PLOS, published Feb. 23, 2001. Culture conditions vary widely for
each cell type, but the artificial environment in which the cells
are cultured invariably consists of a suitable vessel containing
the following: (i) a substrate or medium that supplies the
essential nutrients (amino acids, carbohydrates, vitamins,
minerals). (ii) growth factors, (iii) hormones, (iv) gases
(O.sub.2. CO.sub.2), and (v) a regulated physico-chemical
environment (pH, osmotic pressure, temperature). One of ordinary
skill in the art could readily optimize the differentiation
conditions.
[0076] In preferred embodiments, these conditions included plating
the cells in 24-well plates with melanocyte differentiation
inducing culture medium containing 5% fetal bovine serum (FBS), 50
ng/ml stem cell factor (SCF), 20 nM endothelin-3, 2.5 ng/ml basic
fibroblast growth factor (FGF), 100 nM a-melanocyte stimulating
hormone (.alpha.-MSH), 1 .mu.M phosphoethanolamine, 10 .mu.M
ethanolamine, 1 mg/mL insulin and 1% penicillin/streptomycin in
RPMI 1640 medium. Notably, CD34(-) MeSCs formed dendritic
structures and produced new pigmented melanocytes, while CD34(+)
MeSCs did not. The data suggest CD34(-) MeSCs possess significantly
higher potential to produce pigmented melanocytes relative to
bulge/LPP cells in melanocyte differentiation medium. Based on
molecular and biological properties, the CD34(-) melanocyte stem
cells under these conditions produced more advanced states of
melanocyte differentiation whereas notably, CD34(+) MeSCs represent
a primitive neural crest cell state.
[0077] Melanocytes are neural crest derived cells. The CD34(+)
MeSCs and CD34(-) MeSCs were introduced into neural crest stem cell
medium. Useful examples for generating neural crest stem cell
medium are described in Bixby S. et al., 2002 and in Pfaltzgraff E
R et al., 2012. One of ordinary skill in the art could readily
determine the necessary components and percentages of components in
an effort to optimize the medium to desired experimental protocols.
As set forth below, a person of ordinary skill in the art having
knowledge of the components of these type of media could optimize
different concentrations of the components to arrive at desired
medium including nutrients needed for long-term growth of
cells.
[0078] DMEM (Dulbecco's Modified Eagle Medium)
[0079] Composition of Neurobasal Medium
TABLE-US-00001 Components Concentration (mg/L) Amino Acids Glycine
30.0 L-Alanine 2.0 L-Arginine hydrochloride 84.0 L-Asparagine-H2O
0.83 L-Cysteine 31.5 L-Histidine hydrochloride-H2O 42.0
L-Isoleucine 105.0 L-Leucine 105.0 L-Lysine hydrochloride 146.0
L-Methionine 30.0 L-Phenylalanine 66.0 L-Proline 7.76 L-Serine 42.0
L-Threonine 95.0 L-Tryptophan 16.0 L-Tyrosine 72.0 L-Valine 94.0
Vitamins Choline chloride 4.0 D-Calcium pantothenate 4.0 Folic Acid
4.0 Niacinamide 4.0 Pyridoxal hydrochloride 4.0 Riboflavin 0.4
Thiamine hydrochloride 4.0 Vitamin B12 0.0068 i-Inositol 7.2
Inorganic Salts Calcium Chloride (CaCl2) (anhyd.) 200.0 Ferric
Nitrate (Fe(NO3)3''9H2O) 0.1 Magnesium Chloride (anhydrous) 77.3
Potassium Chloride (KCl) 400.0 Sodium Bicarbonate (NaHCO3) 2200.0
Sodium Chloride (NaCl) 3000.0 Sodium Phosphate monobasic
(NaH2PO4--H2O) 125.0 Zinc sulfate (ZnSO4--7H2O) 0.194 Other
Components D-Glucose (Dextrose) 4500.0 HEPES 2600.0 Phenol Red 8.1
Sodium Pyruvate 25.0
[0080] Composition of B-27 Supplement
TABLE-US-00002 Components Vitamins Biotin DL Alpha Tocopherol
Acetate DL Alpha-Tocopherol Vitamin A (acetate) Proteins BSA, fatty
acid free Fraction V Catalase Human Recombinant Insulin Human
Transferrin Superoxide Dismutase Other Components Corticosterone
D-Galactose Ethanolamine HCl Glutathione (reduced) L-Carnitine HCl
Linoleic Acid Linolenic Acid Progesterone Putrescine 2HCl Sodium
Selenite T3 (triodo-I-thyronine)
[0081] Composition of N2-Supplement
TABLE-US-00003 Components Concentration (mg/L) Proteins Human
Transferrin (Holo) 10000.0 Insulin Recombinant Full Chain 500.0
Other Components Progesterone 0.63 Putrescine 1611.0 Selenite
0.52
[0082] In preferred embodiments, the neural crest stem cell medium
would comprise DMEM (low glucose), 30% neurobasal medium, 15% chick
embryo extract, 2% B27 supplement, 1% N2 supplement, 117 nM
retinoic acid, 50 .mu.M f.beta.-mercaptoethanol, 20 ng/ml
insulin-like growth factor (IGF), and 20 ng/ml fibroblast growth
factor (FGF). CD34(+) MeSCs formed larger non-adherent spheroids
and these spheroids maintained GFP expression as compared with
CD34(-) stem cell populations. For example, neural crest stem cell
medium may comprise DMEM-low (Gibco, product 11885-084) and 15%
chick embryo extract (prepared as described in Stemple and
Anderson, 1992), 20 ng/mL recombinant human bFGF (R&D Systems,
Minneapolis, Minn.), 1% N2 supplement (Gibco), 2% B27 supplement
(Gibco), 50 M 2-mercaptoethanol, 35 mg/mL (110 nM) retinoic acid
(Sigma), penicillin/streptomycin (Biowhittaker), and 20 ng/ml IGF1
(R&D Systems).
[0083] Next, the CD34(+) MeSCs and CD34(-) MeSCs from spheroids
were subjected to differentiation using neural crest
differentiation culture medium containing a similar medium as
neural crest stem cell culture. In preferred embodiments, instead
of 15% chick embryo extract and 20 ng/ml FGF, the medium contained
1% chick embryo extract and 10 ng/ml FGF. As discussed previously,
a person of skill in the art could readily optimize the medium.
See, for example "Culturing Nerve Cells," edited by Gary Banker and
Kimberly Gosling for proposed culture media.
[0084] Once these two cell types from the spheroids differentiated,
CD34(+) multipotent neural crest progenitor cells exhibited
multiple lineage markers such as myofibroblast, glial, neuronal,
K15, and nestin whereas CD34(-) SHG multipotent neural crest
progenitor cells did not when in neural crest differentiation
medium. In contrast, when these two cell types were introduced into
the melanocyte differentiation culture medium, both multipotent
neural crest progenitor cell types expressed melanocyte marker
(Tyrp1) but only CD34(-) SHG stem cells produced melanized cells.
CD34(+) multipotent neural crest progenitor cells expressed higher
glial lineage marker indicating these cells possess higher glial
lineage potential. Glial cells are known to express Mbp and
contribute to the myelination of axons in the CNS and the PNS.
B. Isolated CD34(+) Multipotent Neural Crest Progenitor Cells
[0085] MeSCs are cells localized to the bulge/LPP region of the
mammalian hair follicle. These MeSCs are identified specifically in
this region of the hair follicle by the expression of the proteins
Dct and Kit and CD34. Both Dct and Kit are known markers of MeSCs,
and CD34 is expressed in the bulge/LPP region of the hair follicle.
In certain situations, namely in a Dct-H2BGFP.sup.KI mouse which
contains both the Dct-tTA.sup.KI and the TRE-H2BGFP transgene,
these MeSCs express GFP and CD34. As a result, the MeSCs can be
separated to provide two subsets based on CD34 expression (i.e.,
CD34(+) or CD34(-)) and isolated specifically from MeSCs of mouse
hair follicles using FACS and other similar techniques.
[0086] These techniques include: (i) utilizing the expression of
GFP and CD34, (ii) using primary antibodies recognizing CD34 on the
cell surface and conjugated to a fluorescent or other suitable
optical label, (iii) using secondary antibodies which recognize and
bind to a primary antibody binding CD34, and conjugated to a
fluorescent or other suitable optical label, (iv) conjugated to
another mechanism which enables fluorescent or other suitable
optical detection of the CD34-expressing cell. These melanocyte
stem cells are further distinguished by their high expression
(relative to GFP- or Dct-cells isolated from skin) of the Dct gene
and by their high expression (relative to GFP+CD34(-) cells
isolated from other regions of the hair follicle) of the Cd34
gene.
[0087] CD34+ multipotent neural crest progenitor cells express
glial markers and produce a multilayered myelin sheath surrounding
unmyelinated neurons. These cells are distinguished from other
cells by their recent or distant derivation from a CD34+MeSC, or
its substantial embodiment, as defined above. These CD34(+)
multipotent neural crest progenitor cells are located outside of
the hair follicle or skin, having been isolated from MeSCs removed
from the natural environment by a suitable procedure such as
trypsinization or other enzymatic digestion of the skin. The
CD34(+) multipotent neural crest progenitor cells are further
distinguished by their isolation and separation from CD34(+) MeSCs
in the cell suspension of dissociated skin cells using suitable
markers, such as expression of GFP in a Dct-H2BGFP.sup.KI
transgenic background and CD34.
[0088] Following the removal of CD34(+) MeSCs from the natural
environment and subsequent culture of these CD34(+) MeSCs in neural
crest differentiation medium, the resulting CD34(+) multipotent
neural crest progenitor cells express Gfap. Furthermore, following
removal of CD34(+) MeSCs from their natural environment in skin and
co-culturing the CD34(+) MeSCs in neural crest differentiation
medium with neurons, the resulting CD34(+) multipotent neural crest
progenitor cells express Mbp in a neuronal distribution on proximal
neurites and form a myelin sheath surrounding those neurites. These
properties are maintained whether the CD34(+) MeSCs are removed
from the natural environment and placed thereafter in neuronal
co-culture in neural crest differentiation medium, or whether the
CD34(+) MeSCs are removed from the natural environment, cultured
and expanded for a short or long duration of time, with or without
intervening events that can include passaging of the cells, in
neural crest stem cell medium, then placed thereafter in neuronal
co-culture in neural crest differentiation medium.
[0089] Therefore, in one embodiment, the present invention relates
to MeSCs comprising CD34(+) multipotent neural crest progenitor
cells isolated from hair follicle bulge/LPP of the mammalian hair
follicle. The isolated MeSCs may be obtained from any mammal,
preferably from a human or a mouse, for example a Dct-H2BGFP
mouse.
[0090] The isolated population of CD34(+) multipotent neural crest
progenitor cells is substantially pure. The isolated cell
population of CD34(+) multipotent neural crest progenitor cells
includes at least 80% pure, at least 85% pure, at least 90% pure,
at least 95% pure, at least 97% pure, at least 98% pure, at least
99% pure, at least 99.5% pure, or at least 99.9% pure CD34(+)
multipotent neural crest progenitor cells. These cells may be human
or mouse cells (e.g., a Dct-H2BGFP mouse).
[0091] In other words, the term "substantially pure" refers to a
population of CD34(+) multipotent neural crest progenitor cells
that contain fewer than about 0.1%, fewer than about 0.5%, more
preferably fewer than about 1%, more preferably fewer than about
2%, more preferably fewer than about 3%, more preferably fewer than
about 5%, more preferably than about 10%, more preferably fewer
than about 15%, and more preferably fewer than about 20% of other
cells, for example, CD34(-) MeSCs. This high level of purity is
obtained by following the methods set forth herein (e.g., gene
expression, FACS, reanalysis of FACs-isolated cell populations by
FACS) without any need for additional purification steps to further
purify the cells.
[0092] The CD34(+) multipotent neural crest progenitor cells are
highly purified after cell sorting, and show a .about.400-fold
increase in the level of CD34 gene expression compared to CD34(-)
MeSCs separated in the same procedure. The data provide evidence
that the CD34(+) MeSCs isolated from the skin expressing GFP can be
highly purified from other GFP expressing stem cells that do not
express CD34. Hence, cells should be greater than 99.5% pure on the
basis of CD34 expression. Cells also show a 1000-fold increase in
gene expression of the melanocyte stem cell-specific gene Dct
compared to non-melanocyte stem cell CD34(+) cells obtained in the
same procedure. This result indicates that the CD34(+) MeSCs
isolated from the skin also on the basis of GFP expression
represent at least a 99.9% pure CD(34+) multipotent neural crest
progenitor cell population. Thus, the methods described below
provide an efficient, time saving method for producing CD34(+)
multipotent neural crest progenitor cells to be used for, but not
limited to, therapeutic, research, or other purposes.
[0093] In certain embodiments, CD34(+) multipotent neural crest
progenitor cells may be described as a mixture of cells at
different stages of differentiation towards a mature Schwann cell.
See Table 1, Conrad et al., "Embryonic Corneal Schwann Cells
Express Some Schwann Cell Markers mRNAs, but No Mature Schwann Cell
Marker Proteins" Invest Ophthalmol Vis Sci. 2009 September; 50 (9):
4173-4184.
C. Methods of Producing Dense Myelin Sheaths
[0094] Dorsal root ganglion co-culture systems are well established
in the art as a model for the study the myelination of neurites.
This model system was used to test whether a functional myelin
sheath can be produced once a neuron lacks a functional myelin
sheath or has become demyelinated. In certain embodiments, a method
of producing a dense myelin sheath around an axon. The axon is
contacted with the isolated CD34(+) multipotent neural crest
progenitor cells under conditions that promote neural crest
progenitor formation. These conditions include, but are not limited
to, culturing the CD34(+) MeSCs in Poly-D-Lysine and Laminin-coated
chambers in the presence of neural crest differentiation medium.
Components of the neural crest differentiation medium are available
commercially and readily described in the art. In preferred
embodiments, neural crest differentiation medium may comprise 10
.mu.M ascorbic acid.
D. Methods of Producing a Functional Myelin Sheath
[0095] Demyelination is the loss of the myelin sheath insulating
the nerves. It may be immune-mediated, auto-antibody mediated, or
caused by a demyelinating disease, trauma, toxin, bacterial
infection, viral infection, parasitic infection, or genetic defect.
Demyelination is the hallmark of some neurodegenerative autoimmune
diseases, including any demyelinating disease or Schwann cell
disease described herein, including but not limited to experimental
allergic encephalomyelitis, acute disseminated encephalomyopathy,
acute hemorrhagic encephalomyelopathy, experimental allergic
neuritis, amoebic meningoencephalitis, Guillain-Barresyndrome,
multiple sclerosis, stroke, traumatic brain injury, and traumatic
peripheral nerve injury, Devic's disease (otherwise known as
neuromyelitis optica (NMO), NMO spectrum disorder, progressive
multifocal leukoencephalopathy, central pontine myelinolysis, Tabes
dorsalis, optic neuritis, transverse myelitis, progressive
inflammatory neuropathy, myelopathy, chronic inflammatory
demyelinating polyneuropathy, central pontine myelinosis, inherited
demyelinating diseases such as leukodystrophy, Charcot-Marie-Tooth
disease and visna. Sufferers of pernicious anemia can also suffer
nerve damage if the condition is not diagnosed quickly. Subacute
combined degeneration of spinal cord secondary to pernicious anemia
can lead to slight peripheral nerve damage to severe damage to the
central nervous system, affecting speech, balance, and cognitive
awareness. When myelin degrades, conduction of signals along the
nerve can be impaired or lost, and the nerve eventually withers. A
serious myelin deterioration condition is Canavan Disease.
[0096] Accordingly, in preferred embodiments, methods are provided
for producing a functional myelin sheath on an axon which lacks a
functional myelin sheath or has become demyelinated. The axon may
be in the central nervous system or peripheral nervous system and
is contacted with the isolated CD34(+) multipotent neural crest
progenitor cells described herein. Contact may occur by direct
injection into the area of the demyelinated neuron or by
intrathecal injection, intravenously, or by stereotaxic injection.
One of ordinary skill in the art would recognize that the above
methods of administration are not limited. Depending on the
demyelinating conditions, one may chose an alternative way of
administration.
D. Compositions and Kits
[0097] Isolated CD34(+) multipotent neural crest progenitor cells
described herein can be formulated into compositions, in particular
therapeutic compositions. Accordingly, compositions comprising
CD34(+) multipotent neural crest progenitor cells are described
herein.
[0098] The ability to preserve stem cells is critical for their use
in clinical and research applications. Preservation of cells
permits the transportation of cells between sites, as well as
completion of safety and quality control testing. Preservation
permits development of cell banks with different major
histocompatibility complex genotypes and genetically modified
clones. As collection of stem cells from sources such as umbilical
cord blood can be difficult to predict or control, the ability to
preserve cells permits the banking of stem cells until later use in
the research lab or clinical application. The ability to preserve
cells permits completion of quality and safety testing before use
as well as transportation of the cells between the sites of
collection, processing and clinical administration. Finally, the
ability to preserve cells used therapeutically facilitates the
development of a manufacturing paradigm for stem cell based
therapies.
[0099] Losses during transfer and dilution can be minimized by
using an "acceptable carrier", such as specific "stabilizing
agents" including but not limited to heparin, platelet-derived
growth factors (Yeh et al., 1.993) and stem cell factors. In
certain embodiments, these compositions can include CD34(+)
multipotent neural crest progenitor cells that are in acceptable
carriers that are compatible with the CD34(+) multipotent neural
crest progenitor cells. Optionally, the compositions also may
contain other ingredients, such as hormones or other factors which
can assist in appropriate differentiation of the cells to be
administered,
[0100] In certain embodiments, a composition may be administered in
a number of ways either alone or in combination with other
treatments, either simultaneously or sequentially depending on the
condition to be treated and whether local or systemic treatment is
desired. Administration may be by direct injection into the area of
demyelination, or by intrathecal injection, or intravenously, or by
stereotaxic injection. The route of administration can be selected
based on the disease or condition, the effect desired, and the
nature of the cells being used. Actual methods of preparing dosage
forms are known, or will be apparent, to those skilled in the art.
(See Remington's Pharmaceutical Sciences, 20.sup.th Edition, 2000,
pub. Lippincott, Williams & Wilkins.) Where a composition as
described herein is to be administered to an individual,
administration is preferably in a "prophylactically effective
amount" or a "therapeutically effective amount," this being
sufficient to show benefit to the individual.
[0101] The number of administrations can vary. Introducing CD(34+)
multipotent neural crest progenitor cells in the subject can be a
one-time event. Alternatively, administration may be, for example,
daily, weekly, or monthly. The actual amount administered, and rate
and time-course of administration, will depend on the age, sex,
weight, of the subject, the stage of the disease, and severity of
what is being treated. Prescription of treatment, e.g., decisions
on dosage is within the responsibility of general practitioners and
other medical doctors.
[0102] The materials described herein as well as other materials
can be packaged together in any suitable combination as a kit
useful for performing, or aiding in the performance of, the
disclosed method. It is useful if the kit components in a given kit
are designed and adapted for use together in the disclosed method.
For example disclosed are kits for isolating CD34(+) MeSCs from
skin cells, the kit including antibodies specific for detection and
sorting of cells expressing CD34(+). The kits also can contain
media for proliferating, storing, differentiating, and/or inducing
the cells. The kits can also contain materials for collection of
cells.
[0103] Compositions may be placed within containers, or kits, along
with packaging material which provides instructions regarding the
use of such pharmaceutical compositions. Generally, such
instructions will include a tangible expression describing the
reagent concentration, as well as within certain embodiments,
relative amounts of excipient ingredients or diluents (e.g., water,
saline or PBS) which may be necessary to reconstitute the
pharmaceutical composition.
5. SUMMARY OF EXPERIMENTAL RESULTS
[0104] The following is a summary of results of experiments
described in the Examples of this application: [0105]
Dct-H2BGFP.sup.ki bitransgenic mice have nuclear GFP-expressing
melanocyte precursors in the bulge/LPP (CD34(+)) and SHG (P-cad+)
of telogen HFs of dorsal skin and tail and were separated based on
CD34 expression; [0106] CD34-GFP+ (SHG) melanocyte precursors
express higher levels of melanogenic genes and produced higher
percentage of pigmented cells when grown in melanocyte
differentiation medium; [0107] CD34(+)GFP+ (bulge/LPP) MeSCs form
larger spheroids under neural crest stem cell differentiation
conditions and also express multiple neural crest cell lineage
markers when induced to differentiate in neural crest cell
differentiation medium; [0108] In DRG co-culture system,
differentiated CD34(+)GFP+ (bulge/LPP) multipotent neural crest
progenitor cells express myelin basic protein and contribute to
myelination of surrounding axons; and [0109] These findings showed
that bulge/LPP CD34(+) MeSCs are capable of neural crest lineage
differentiation to produce cells that can functionally myelinate
neurons.
6. EXAMPLES
[0110] The invention is illustrated herein by the experiments
described by the following examples, which should not be construed
as limiting. The contents of all references, pending patent
applications and published patents, cited throughout this
application are hereby expressly incorporated by reference. Those
skilled in the art will understand that this invention may be
embodied in many different forms and should not be construed as
limited to the embodiments set forth herein. Rather, these
embodiments are provided so that this disclosure will fully convey
the invention to those skilled in the art. Many modifications and
other embodiments of the invention will come to mind in one skilled
in the art to which this invention pertains having the benefit of
the teachings presented in the foregoing description. Although
specific terms are employed, they are used as in the art unless
otherwise indicated.
Example 1
Materials and Methods
Generation and Characterization of Dct-H2BGFP.sup.KI Bitransgenic
Mouse Model.
[0111] A knock-in mouse model expressing the tetracycline-regulated
transactivator (tTA) gene under the control of the murine
dopachrome tautomerase (Dct) melanocyte specific promoter was used
to identify MeSCs. The transgenic mouse was generated to allow a
melanocyte specific tTA transactivation in vivo. The transgenic
cassette expressing the tTA gene under the control of the Dct
promoter was inserted in the Hprt gene. The Hprt gene is localized
on the X-chromosome. This transgenic mouse was then crossed with
TRE-H2BGFP mice to generate a bitransgenic mouse model. The Dct-tTA
knock-in mouse was designed to drive expression of H2BGFP
constitutively in bitransgenic Dct-tTA knock-in; TRE-H2BGFP mice in
the absence of doxycycline. See FIG. 6A-6E for photographs
providing a characterization of the Dct-TtaKIH2b-Gfp bitransgenic
mouse model.
Immunofluorescence Assay
[0112] Dorsal skin obtained from the transgenic mice at the
indicated ages was embedded in OCT compound and cryosections cut
with a thickness of 10 .mu.m to observe H2BGFP expression. For
immunofluorescence, cryosections were fixed in 4% paraformaldehyde
in PBS for 10 min at room temperature and blocked with blocking
buffer (10% FBS, 1% BSA and 0.1% Triton-x) for 1 hour at room
temperature. Primary antibodies for CD34 (rat monoclonal antibody,
clone Ram34, BD Biosciences), P-Cadherin (goat polyclonal antibody,
R & D Systems), c-Kit (rat monoclonal antibody, Cedarlane), Dct
(alpha-Pep-8) (rabbit polyclonal antibody, a gift from Dr. Vincent
Hearing, NIH), or nestin (mouse monoclonal antibody, Chemicon) at
1:200 dilution were added and incubated at 4.degree. C. overnight.
To detect the primary antibody, isotype-matched Cy3-conjugated
secondary antibodies (Jackson Immunogenetics) or Alexa
647-conjugated secondary antibodies (Invitrogen) were added at a
1:1000 dilution and incubated for 1 hour at room temperature.
Coverslips were mounted using mounting solution with DAPI
(Vectashield, Vector Laboratories). Fluorescence was detected using
an Olympus upright fluorescence microscope, Slidebook imaging
software. See FIG. 11A-11B also, for data demonstrating that
CD34(+) bulge/LPP melanocyte stem cells exhibit the neuronal stem
cell marker nestin with a comparison of expression of nestin RNA
(FIG. 11A) and nestin protein (FIG. 11B) in CD34(+) bulge/LPP
versus CD34(-) SHG melanocyte stem cells.
[0113] For immunofluorescence detection in primary-cultured cells,
cells were washed with PBS and fixed with 4% PFA at room
temperature for 10 min. PBS containing 10% FBS and 1% BSA was used
for blocking at room temperature for 1 hour. After blocking, cells
were incubated with 1:200 dilution of primary antibodies for a-SMA
(mouse monoclonal antibody, Sigma Aldrich), GFAP (rabbit polyclonal
antibody, Dako), Tuj1 (mouse monoclonal antibody, Sigma Aldrich),
K15 (mouse monoclonal antibody, Chemicon), Tyrp1 (alpha-Pep-1)
(rabbit polyclonal antibody, a gift from Dr. Vincent Hearing, NIH),
.beta.-Actin, or Mbp (rat monoclonal antibody, Abcam) at 4.degree.
C. overnight followed by incubation with Cy3-conjugated secondary
antibody or Alexa 647-conjugated secondary antibody at room
temperature for 1 hour. Coverslips were mounted using mounting
solution with DAPI (Vectashield, Vector Laboratories). Fluorescence
was detected using an Olympus upright fluorescence microscope,
Slidebook imaging software.
[0114] For whole mount hair follicle staining, whole mounts of
mouse tail epidermis were prepared as described previously (Bruan
et al., 2003 and Estrach S et al., 2006). A scalpel was used to
slit the tail lengthways. Skin was peeled from the tail, cut into
pieces (0.5.times.0.5 cm.sup.2) and incubated in 5 mM EDTA in PBS
at 37.degree. C. for four hours. Forceps were used to gently peel
the intact sheet of epidermis away from the dermis and the
epidermal tissue was fixed in 4% formal saline (Sigma) for 2 hours
at room temperature. Fixed epidermal sheets were stored in PBS
containing 0.2% sodium azide at 4.degree. C. for up to 8 weeks
prior to labelling. For immunofluorescence staining of whole mount
hair follicle, epidermal sheets were blocked and permeabilised by
incubation in blocking buffer containing 10% FBS, 1% BSA and 0.5%
Triton-X in PBS for 30 minutes. Primary antibodies were diluted in
the blocking buffer and tissue was incubated overnight at 4.degree.
C. with gentle agitation. Epidermal whole mounts were then washed
for at least 4 hours in PBS, changing the buffer several times.
Incubation with secondary antibodies was performed in the same way.
Samples were rinsed in distilled water and mounted in mounting
solution with DAPI. See FIG. 7A-7B for photographs showing
GFP-expressing melanocyte precursors in whole mount telogen hair
follicles. See also FIG. 8A-8B, showing quantitation of
GFP-expressing cells in locations of the hair follicle.
Preparation of Single Cells from Dermal Skin and Fluorescence
Activated Sorting (FACS)
[0115] Dorsal skin samples were obtained from transgenic mice at
different ages immediately following euthanasia and fat was removed
from the dermis using fine forceps. Defatted skin was incubated in
0.5% of trypsin (USB) dissolved in PBS at 37.degree. C. for 30 min.
Epidermis was peeled away from the dermis following incubation, and
the remaining dermis was cut into small pieces. The cut dermal
pieces are placed in to digestion medium containing 0.2 mg/ml
Liberase Thermolysin low (Roche) and were incubated in 37.degree.
C. water bath for 45 to 60 min. The digested dermal mixture was
added into PBS containing 0.05% DNase (Sigma) and 5% FBS. Single
cells could be extracted from the dermis by repeated plunging with
a 60 cc syringe followed by filtration through 40 .mu.m nylon mesh
(BD Falcon). The dermal cell suspension was generated in 5% FBS/PBS
and was ready to stain with respective antibodies and FACS. This
procedure was done under aseptic conditions.
[0116] To separate the hair follicle bulge/LPP and SHG cells of
Dct-H2BGFP.sup.ki bitransgenic mice FACS with GFP and anti-CD34
marker the dermal cells were incubated with Alexa 647-conjugated
anti-CD34 antibody in for 30 min at 4.degree. C. 7-AAD was added to
the CD34 labeled dermal cell suspension in 5% FBS/PBS, and cell
sorting was performed using a BD FACSArial instrument
(Becton-Dickenson). Sorted cells were counted and used either for
primary cultures or for quantitative real-time PCR (qRT-PCR) by
extracting RNA from respective cell populations. See FIG. 9A-9B for
representative FACS sorting schemes. See also FIG. 13A-13B, which
provide FACS reanalysis for the purity of CD34(+)GFP(+) bulge/LPP
cells (FIG. 13A) and CD34(-)GFP(+) SHG cells (FIG. 13B) FACS-sorted
melanocyte precursors. A few hundred cells were reanalyzed from
each sorted population to test the effectiveness of the sorting
methods.
RNA Extraction, cDNA Synthesis and qRT-PCR
[0117] Total RNA was extracted from sorted cells using RNeasy Micro
Kit (Qiagen) as per manufacturer's protocol. The cell lysate in RNA
solution was mixed with equal volume of 70% ethanol and transferred
to a spin column. After series of centrifugation, incubation with a
DNase I incubation mix and washing with washing solution, the spin
column membrane was eluted with 14 .mu.l RNase free water. The
quantity and quality of isolated RNA was determined with an Agilent
2100 Bioanalyzer using RNA PicoChips (Agilent). To synthesize
first-strand cDNA from total RNA the SuperScript III First-Strand
Synthesis System for RT-PCR (Invitrogen) was used. The total RNA
was incubated with random hexamer primer along with dNTP at
65.degree. C. for 5 min, added to a mixture of reverse
transcriptase, MgCl2, RNaseOUT, DTT and reaction buffer incubated
at 25.degree. C. for 10 min, followed by 50.degree. C. for 50 min
and reaction is terminated at 85.degree. C. for 5 min incubation.
qRT-PCR analysis for the differential gene expression among the
sorted cell population was determined using LightCycler 480 SYBER
Green I Master (Roche) and running them on LightCycler 480
instrument (Roche). See FIG. 10 for analysis of the total RNA
extracted from the FACS-sorted GFP(+) melanocytes.
In Vitro Cell Culture
[0118] To study the melanocyte differentiation potential of
bulge/LPP and SHG MPCs from telogen HFs, these cell types were
introduced into a melanocyte differentiation condition. For
melanocyte differentiation culture, cells were plated in 24 well
plates with melanocyte differentiation inducing culture medium
containing 5% FBS, stem cell factor (SCF) (50 ng/ml; Peprotech),
endothelin-3 (20 nM; Sigma), basic fibroblast growth factor (FGF)
(2.5 ng/ml; R&D Systems), a-melanocyte stimulating hormone
(.alpha.-MSH) (100 nM; Sigma), phosphoethanolamine (1 .mu.M;
Sigma), ethanolamine (10 .mu.M; Sigma), insulin (1 mg/ml; Sigma)
and 1% Penicillin/streptomycin in RPMI 1640 medium.
[0119] For spheroid formation, cells were cultured in ultra-low
attachment 24 well plates, with neural crest stem cell medium as
described previously (Bixby S et al., 2002 and Pfaltzgraff E R et
al., 2012) containing DMEM (low glucose), 30% neurobasal Medium,
15% chick embryo extract, 2% B27 supplement, 1% N2 supplement, 117
nM retinoic Acid, 50 .mu.M .beta.-mercaptoethanol, 20 ng/ml
insulin-like growth factor (IGF), 20 ng/ml FGF and 1%
penicillin/streptomycin. For neural crest multi-lineage cell
culture study, cells were cultured in 30 .mu.g/ml fibronectin
coated 8-well chamber slides in neural crest differentiation
culture medium containing similar medium (with 1% chick embryo
extract and 10 ng/ml FGF) for 8 days as described previously (Bixby
S. et al., 2002).
[0120] Rat glial precursor cells (Invitrogen) were cultured on
Poly-D-Lysine coated plates in glial precursor cell growth medium
containing Knockout DMEM/F-12, 2 mM Glutamax supplement, 2% StemPro
NSC SFM supplement, 20 ng/ml FGF, 20 ng/ml EGF, and 10 ng/ml
PDGF-AA as per the manufacturer's descriptions. To induce
differentiation of glial precursor cells into mature
oligodendroglial cells (ODC), cells were cultured on Laminin and
Poly-D-Lysine coated plates in glial differentiation culture medium
containing similar medium (without PDGF-AA and FGF).
Dorsal Root Ganglion (DRG) Co-Cultures
[0121] Isolation and culture of DRGs from Shiverer pups was
performed as described previously (O'Meara R W et al., 2011).
Shiverer pups (P5 to P8) were euthanized according to institutional
guidelines and the spine is extracted. The excess muscle and bone
from the spine was trimmed away and placed in a petri dish with a
ventral side-up. Using dissection scissors, the spinal column was
cut medially starting caudally in a longitudinal fashion. The
spinal column was gently opened by two pairs of forceps and the
spinal cord was exposed. DRGs were found beneath and lateral to the
spinal cord. Using fine tipped forceps the DRGs were removed and
transferred to ice cold Hank's buffered salt solution in a new
Petri dish. DRGs were transferred to a 1.5 mL centrifuge tube
containing 500 .mu.L of ice cold HBSS and were pelleted by spinning
at 1200 rpm for 5 min at 4.degree. C. Supernatant is discarded and
a 500 .mu.L of pre-warmed DRG papain solution is added and DRGs are
incubated at 37.degree. C. for 10 min. Supernatant was discarded
and a 500 .mu.L of pre-warmed Collagenase A solution was added and
DRGs were incubated at 37.degree. C. for 10 min. Supernatant was
discarded and DRGs were washed twice with 1 mL of DRGN media (DMEM
containing 10% FBS). Finally, DRGs were dissociated by triturating
them with the BSA-coated glass pasture pipette and once
dissociation is achieved, the suspension was passed through a 40
.mu.m filter into a sterile Petri dish containing 7 mL of DRGN
media. The Petri dish was incubated at 8.5% CO.sub.2 for 1 hour 15
min. During this step many contaminating cells including fibroblast
and glial cells strongly adhered to the Petri dish, thereby
enriching cell suspension for DRGs. The cell suspension containing
DRGs was collected by pelleting and was cultured in 10 ug/ml
laminin and 30 ug/ml Poly-D-Lysine coated 24 well plate in DRGN
media in 37.degree. C. tissue culture incubator at 8.5% CO.sub.2
overnight. The next day, DRGN media was replaced with OL media
(DMEM with 2% B27 supplement, 1% N2 Supplement, 1.times. glutamine,
0.5% FBS and 1% penicillin/streptomycin) and with a 10 .mu.M
5'-Fluro-deoxyuridine (FuDR) to prevent the proliferation of
contaminating fibroblasts and glial cells. On Day 5, full media was
changed with OL media (without FuDR) and on Day 7 the DRGs formed
an extensive neurite bed, ready to be co-cultured.
[0122] For DRG co-cultures, CD34(+) or CD34(-)MeSCs isolated from
Dct-Tta.sup.KIH2b-Gfp mouse skin or rat oligodendroglial cells
(ODC) (Invitrogen) were then seeded onto the dense neuronal bed
generated either by Shiverer or rat embryonic DRGs. For co-cultures
of CD34(+) or CD34(-)MeSCs, Shiverer or rat embryonic DRGs, cells
were cultured in Poly-D-Lysine and Laminin-coated neural crest
differentiation medium containing 10 .mu.M ascorbic acid to induce
myelination. For co-cultures of rat ODCs and Shiverer DRGs, cells
were cultured in glial cell differentiation medium. After one week
of co-culture, cells were fixed and subjected to study myelination
of axons by immunostaining for the expression of Mbp and myelin
sheath formation by electron microscopy. See FIG. 12A-12B for data
relating to co-cultures of cells according to an embodiment of the
invention and Shiverer dorsal root ganglia, including Shiverer
mouse genotyping and photomicrographs of the co-cultures.
Electron Microscopy
[0123] The preparation of DRG co-cultures for electron microscopy
was achieved by removing the medium and washing twice with the
sodium cacodylate buffer (0.1M sodium cacodylate+3 mM CaCl2; PH
7.4). The DRG cells from co-cultures were fixed with 3%
glutaraldehyde in sodium cacodylate buffer for 30 min at room
temperature and then cool at 4.degree. C. They were then postfixed
in 1% osmium ferricyanide and 2% uranyl acetate, dehydrated in
ascending ethanol concentrations, rinsed in acetonitrile, and
embedded in Spurr's epoxy resin. Following sectioning, they were
stained with saturated uranyl acetate in 50% ethanol and lead
citrate, and viewed in a Philips/FEI BioTwin CM120 transmission
electron microscope operated at 80 kV.
Statistical Analysis
[0124] The statistical analysis for the qRT-PCR of differential
gene expression among sorted cells (FIG. 2C FIG. 3A) was performed
using one-way ANOVA. For the quantification data of the bulge/LPP
and SHG melanocyte precursor cell potential to produce pigmented
melanocytes in melanocyte differentiation medium at 4.sup.th and
7.sup.th day (FIG. 3C), two-way ANOVA was applied, n=5 independent
determinations for bulge/LPP and SHG melanocyte precursor cell
images. The statistical analysis for the quantification of
bulge/LPP MeSCs and SHG melanocyte precursor cells ability to form
larger spheroids when cultured in neural crest stem cell medium
measured at 2.sup.nd, 4.sup.th, 6.sup.th and 8.sup.th day (FIG. 4B)
was determined using two-way ANOVA, n=5 independent determinations
for bulge/LPP and SHG melanocyte precursor cell images.
List of Primer Sequences
[0125] Mouse Dct
TABLE-US-00004 (SEQ ID NO: 1) Forward: 5' TTCGCAAAGGCTATGCGC-3'
(SEQ ID NO: 2) Reverse: 5' GTTACTACCCAGGTCAGGCCAG-3'.
[0126] Mouse Cytokeratin 14
TABLE-US-00005 (SEQ ID NO: 3) Forward: ATCGAGGACCTGAAGAGCAA (SEQ ID
NO: 4) Reverse: GGCTCTCAATCTGCATCTCC (SEQ ID NO: 4) Forward: 5'
CGGCCAACGATCCCATT-3' (SEQ ID NO: 5) Reverse: 5'
TGCCTTCGCAGCCATTG-3'
[0127] Tyr
[0128] Tyrp1
TABLE-US-00006 (SEQ ID NO: 6) Forward: 5'
GTGTTCCCTAGCTCAGTTCTCTGG-3' (SEQ ID NO: 7) Reverse: 5'
TCCTCTGACTGATACCTT-3'
[0129] Gapdh
TABLE-US-00007 (SEQ ID NO: 7) Forward - TGCAGTGGCAAAGTGGAGATTGTTG
(SEQ ID NO: 8) Reverse - TGTAGCCCAAGATGCCCTTCAG.
[0130] Pmel17
TABLE-US-00008 (SEQ ID NO: 9) Forward: 5' -
TCCAGGAATCAGGACTGGCTTGGT - 3' (SEQ ID NO: 10) Reverse: 5' -
GTGAAGGTTGAACTGGCGTG - 3'
[0131] P-Cad
TABLE-US-00009 (SEQ ID NO: 11) FWD 5' - ACAGCATCACAGGGCCTGGC - 3'
(SEQ ID NO: 12) REV 5' - TGGCTCCTTCGGCTCTTGGC - 3'
[0132] Shiverer Genotyping
[0133] Mutant Primer (303 bp)
TABLE-US-00010 Mbp.sup.shi Fwd (SEQ ID NO: 13) ACC GTC CTG AGA CCA
TTG TC Mbp.sup.shi Rev (SEQ ID NO: 14) GTG CTT ATC TAG TGT ATG CCT
GTG
[0134] Internal Positive Control (200 bp)
TABLE-US-00011 Control Fwd (SEQ ID NO: 15) CAA ATG TTG CTT GTC TGG
TG Control Rev (SEQ ID NO: 16) GTC AGT CGA GTG CAC AGT TT
[0135] WT Shiverer Primer (411 bp) {Overlaps 3.sup.rd Exon and
3.sup.rd Intron}
TABLE-US-00012 WT.sup.shi Fwd (SEQ ID NO: 17) GGCCGGACCCAAGATGAAAAC
WT.sup.shi Rev (SEQ ID NO: 18) TGTTGGCCTAAAGCACCCTAC
Example 2
Identification of GFP-Expressing MPCs in Bulge/LPP and SHG of
Telogen HF
[0136] To identify melanocyte label-retaining cells with the
properties of melanocyte stem cells (MeSCs) in the telogen, or
resting stage, murine hair follicle (HF), Dct-H2BGFP mice were
developed. Dct-H2BGFP mice are bitransgenic mice with both the
Dct-tTA and TRE-H2BGFP transgenes. To overcome problems with the
fidelity of expression of randomly inserted Dct-tTA transgenes,
instead a version of Dct-tTA mice was generated in which the
transgene was inserted into the Hprt gene locus using gene
targeting. By manipulating the administration of doxycycline to
these mice, quiescent melanocyte label-retaining cells (LRCs) could
be generated and visualized in the telogen HF. Similar to cells
from the Tet-On iDct-GFP mice, Dct-H2BGFP cells were present in
both the CD34-expressing bulge/LPP region of the HF and the
CD34-negative, P-cadherin-expressing secondary hair germ (SHG)
region at the base of the telogen HF (FIG. 1A and FIG. 1B).
Dct-H2BGFP cells in second telogen expressed the MeSC markers Kit
(FIG. 1C) and Dct (FIG. 1D). Careful observation of Dct-H2BGFP
cells in the bulge/LPP HF region revealed not only that these cells
were present in the CD34(+) region, but also appeared to express
CD34 (FIG. 1E).
Example 3
Isolation and Characterization of CD34(+) Vs. CD34(-)MeSCs in HF at
2.sup.nd Telogen
[0137] CD34 expression selectively by bulge/LPP Dct-H2BGFP cells
provided a strategy to separate these cells from SHG Dct-H2BGFP
cells to evaluate their molecular and functional properties. Single
cell suspensions prepared from shaven, dorsal skin of approximately
8-week-old (P56) mice, an age when all HFs are synchronously in the
telogen stage, were incubated with anti-CD34 antibody and prepared
(FIG. 2A) for fluorescence-activated cell sorting (FACS).
Dct-H2BGFP cells could be separated into distinct CD34(+) and
CD34(-) populations using FACS.
Example 4
Separation of Bulge/LPP and SHG GFP-Expressing MPCs of Telogen
HFs
[0138] Although the percentage yield of cells comprising these
populations differed slightly between experiments, in general
0.1-0.3% of the dermal cell suspension contained CD34(+) and
0.5-1.0% CD34(-)Dct-H2BGFP cells (FIG. 2B), comparable to previous
findings with iDct-GFP mice. To further evaluate the specificity of
these cell populations, RNA was isolated and relative gene
expression for specific marker genes determined (FIG. 2C). These
results confirmed that Dct-H2BGFP cells expressed endogenous Dct at
significantly higher levels than the basal keratinocyte gene Krt14,
with Dct expression marginally higher in CD34(-)Dct-H2BGFP cells
compared to CD34(+) counterparts. Furthermore, Cd34 expression was
significantly higher in the CD34(+) Dct-H2BGFP cells, with
expression of Cdh3, encoding P-cadherin, reciprocally elevated in
the CD34(-)Dct-H2BGFP cells corresponding to the
P-cadherin-expression SHG population.
Example 5
Quantitation of Melanogenic Markers in CD34(+) and CD34(-)MeSCs
from Telogen HFs of Dct-H2BGFP.sup.ki Mice and Distinct Melanogenic
Properties of Bulge/LPP and SHG MPCs of Telogen HFs
[0139] The ability to separate subsets of HF MeSCs, defined by
Dct-H2BGFP expression during telogen, prompted the evaluation of
the relative expression of the melanogenic genes Tyr, Tyrp1, and
Dct within these subsets. Quantitative RT-PCR results (FIG. 3A)
showed that relative expression of all three melanogenic genes
measured was significantly higher in the CD34 (-)MeSCs present in
the SHG compared to the CD34 (+) cells from the HF bulge/LPP,
suggesting that the SHG MeSCs are at a more advanced state of
melanocytic differentiation than the cells in the bulge/LPP. To
test this notion functionally, cells were sorted, cultured in
melanocyte differentiation medium, and observed after 4 and 7 days
in culture. Only cultured cells in the CD34(-)Dct-H2BGFP cell
culture exhibited visible pigmentation following these in vitro
culture periods (FIG. 3B). Quantification of cell pigmentation and
morphology (FIG. 3C) confirmed that significant numbers of
pigmented cells only developed in the cultures of CD34(-)
Dct-H2BGFP cells, with CD34(+) MeSCs principally maintaining a
round, rather than dendritic, non-pigmented appearance even after 7
days of in vitro culture in melanocyte differentiation program.
These findings provided further evidence that the CD34(+) bulge/LPP
MeSC population is functionally distinct from the CD34(-)SHG
population.
Example 6
CD34(+) Bulge/LPP MeSCs Exhibit Distinct Neural Crest Lineage
Potential in Forming Non-Adherent Spheroids and Exhibiting Multiple
Lineage Markers
[0140] A prior study described skin-derived cells, expressing
neural crest cell markers p75 and Sox10, with both capable of
growing in culture as spheroids under non-adherent conditions.
These cells were reported to exhibit both melanocyte and glial
differentiation potential [Wong, 2006]. Based upon this
observation, the ability of CD34(+) and CD34(-) cells to grow as
spheroids under non-adherent conditions in neural crest stem cell
(NCSC) medium was tested. Both populations of cells were capable of
growth as spheroids, although spheroids from CD34(+) MeSCs were
larger than those from CD34(-) MeSCs (FIG. 4A, FIG. 4B). Cells
growing as spheroids were placed in adherent, neural crest cell
culture conditions and studied for expression of proteins
characteristically expressed by distinct, neural crest-derived cell
types, such as Gfap as a marker of glial cells, Tuj1 antigen
(.beta.3-tubulin) as a marker of neurons, and .alpha.-smooth muscle
actin (Sma) as a marker of myofibroblasts [Morrison, 1999], as well
as the primitive keratin Krt15. Only adherent cells derived from
CD34(+) MeSCs expressed this diversity of neural crest-derived cell
markers (FIG. 4C). Adherent cells derived from CD34(+) and
CD34(-)MeSC spheroids both showed expression of the melanocyte
marker Tyrp1, although only cells derived from CD34(-)MeSCs also
revealed visible pigmentation (FIG. 4D). Quantification of the
expression of markers in individual cells (FIG. 4E) showed that of
all the neural crest-derived cell type markers expressed in cells
derived from CD34(+) MeSCs, Gfap was the most frequently expressed.
Tyrp1 was expressed in the majority of cells cultured in melanocyte
differentiation medium derived either from CD34(+) or CD34(-)MeSCs,
although the percentage of Tyrp1-expressing cells was higher in
adherent cells derived initially from CD34(-)MeSCs (FIG. 4E).
Example 7
CD34(+) Bulge/LPP MeSCs Expressing Mbp are Able to Myelinate
Neurites in an eDRG Co-Culture System
[0141] Frequent expression of Gfap in cellular derivatives of
CD34(+) MeSCs, as well as the glial and melanocyte potential
reported from skin-derived neural crest-like stem cells [Wong,
2006], suggested that the CD34(+) MeSC subset might possess the
ability to differentiate as glia in culture. To test this notion,
systems used previously were adapted to study the ability of
oligodendroglial cells (ODCs) to myelinate neurons [Colognato, GLIA
55: 537-545 2007.] to the MeSC system. Dorsal root ganglia (DRG)
were isolated from either wild-type or Shiverer (shi/shi) mice.
Mice of the shi/shi genotype lack myelin basic protein (Mbp) and
develop a "shivering" phenotype, or tremor, eventually dying
between 3-4 months of age. CD34(+) and CD34(-)MeSCs, and rat ODCs
as positive controls, were co-cultured with neurites extending from
wild-type or shi/shi DRGs and studied for their ability to express
Mbp in a neuronal distribution (FIG. 5A).
[0142] In co-cultures with rat DRGs, CD34(+) MeSCs selectively
exhibited Mbp expression in their vicinity in a neuronal pattern
(FIG. 5B), similar to the pattern of Mbp expression observed with
rat ODGs on shi/shi neurites as a positive control (FIG. 5C).
Furthermore, CD34(+) MeSCs also selectively exhibited the ability
to express Mbp along shi/shi neurites (FIG. 5D), compared with
CD34(-)MeSCs or no added cells. This result suggested that CD34(+)
bulge/LPP MeSCs selectively possess the ability to generate a de
novo myelin sheath. To determine the ability of CD34(+) MeSCs to
generate compact myelin indicative of functional myelination,
co-cultures of CD34(+) and CD34(-)MeSCs with shi/shi DRGs were
again initiated, with resulting cultures examined using electron
microscopy (EM) for evidence of compact myelin surrounding neurites
in the vicinity of MeSC cell bodies. EM analysis of co-cultures of
CD34(+) MeSCs revealed evidence of compact myelin in 6/8 cultures.
In contrast, a loose myelin sheath was detected in only 1/8
CD34(-)MeSC co-cultures, and no myelin sheath was observed
surrounding shi/shi neurites when no MeSCs were added.
Example 8
In Vivo Demyelination Animal Model and Use of CD34(+) MeSCs for
Remyelination of Neuronal Axons
[0143] Several animal models of demyelination exist, including
experimental autoimmune encephalomyelitis, experimental autoimmune
neuritis, curprizone model for toxic demyelination, and Theiler's
viral induced encephalitis. Homozygous shiverer (Shi) mice are
widely used as a model of demyelinating disorders. Shi mice have a
spontaneous deletion of multiple exons in the gene encoding myelin
basic protein (MBP), which results in pronounced ataxia by 2 to 3
weeks of age and the onset of fatal seizures by .about.8 to 14
weeks (3-6). One variant of this model is the immunodeficient Shi x
RAG2-/- mouse, which displays a milder CNS phenotype and a longer
life span of .about.18 to 21 weeks. Delivery of freshly isolated
human oligodendrocyte progenitor cells from the brain tissue of
fetuses at 9 to 22 weeks of gestation into multiple CNS sites in
asymptomatic newborn Shi x RAG2-/- mice resulted in diffuse CNS
myelination and markedly prolonged survival in some of the
animals.
[0144] We will provide in vivo data showing that indirect and
direct administration in vivo of CD34(+) multipotent neural crest
progenitor cells to myelin basic protein (MBP)-deficient mice in a
demyelination animal model will attenuate clinical symptoms.
Evidence of indirect administration in vivo will include dorsal
root ganglion treated ex vivo with CD34(+) MeSCs and re-implanted
into the area of demyelination will drastically reduce symptoms.
Mice will be given CD34(+) multipotent neural crest progenitor
cells in an amount ranging from 100 .mu.g/100 .mu.l/mouse via
intraperitoneal injection, intrathecal injection, or intralesional
injection at day 0, day 4, day 7, and day 10. Clinical symptoms
will be assessed according to a clinical score system. These
results show that CD34(+) multipotent neural crest progenitor cells
administered to mice having a demyelinating disease will have
therapeutic utility and dramatically reduce the symptoms of the
disease. These results will provide in vivo evidence that
demyelinating diseases can be treated by direct administration of
therapeutically effective amounts of CD34(+) multipotent neural
crest progenitor cells to an animal in vivo.
REFERENCES
[0145] All references cited herein are hereby incorporated by
reference in their entirety. [0146] Estrach S, Ambler C A, Lo Celso
C, Hozumi K, Watt F M. Jagged 1 is a beta-catenin target gene
required for ectopic hair follicle formation in adult epidermis.
Development. 2006 November; 133(22):4427-38. Epub 2006 Oct. 11.
[0147] Braun K M, Niemann C, Jensen U B, Sundberg J P, Silva-Vargas
V, Watt F M. Manipulation of stem cell proliferation and lineage
commitment: visualization of label-retaining cells in whole mounts
of mouse epidermis. Development. 2003 November; 130(21):5241-55.
Epub 2003 Sep. 3. [0148] Bixby S, Kruger G M, Mosher J T, Joseph N
M, Morrison S J. Cell-intrinsic differences between stem cells from
different regions of the peripheral nervous system regulate the
generation of neural diversity. Neuron. 2002 Aug. 15; 35(4):643-56.
[0149] Pfaltzgraff E R, Mundell N A, Labosky P A. Isolation and
culture of neural crest cells from embryonic murine neural tube. J
Vis Exp. 2012 Jun. 2; (64):e4134. doi: 10.3791/4134. [0150] O'Meara
R W, Ryan S D, Colognato H, Kothary R. Derivation of enriched
oligodendrocyte cultures and oligodendrocyte/neuron myelinating
co-cultures from post-natal murine tissues. J Vis Exp. 2011 Aug.
21; (54). pii: 3324. doi: 10.3791/3324.
Sequence CWU 1
1
20118DNAArtificial SequenceSynthetic primer Mouse Dct Forward
1ttcgcaaagg ctatgcgc 18222DNAArtificial SequenceSynthetic primer
Mouse Dct Reverse 2gttactaccc aggtcaggcc ag 22320DNAArtificial
SequenceSynthetic primer Mouse Cytokeratin 14 Forward 3atcgaggacc
tgaagagcaa 20420DNAArtificial SequenceSynthetic primer Mouse
Cytokeratin 14 Reverse 4ggctctcaat ctgcatctcc 20517DNAArtificial
SequenceSynthetic primer Tyr Reverse 5tgccttcgca gccattg
17624DNAArtificial SequenceSynthetic primer Tyrp1 Forward
6gtgttcccta gctcagttct ctgg 24718DNAArtificial SequenceSynthetic
primer Tyrp1 Reverse 7tcctctgact gatacctt 18822DNAArtificial
SequenceSynthetic primer Gapdh Reverse 8tgtagcccaa gatgcccttc ag
22924DNAArtificial SequenceSynthetic primer Pmel17 Forward
9tccaggaatc aggactggct tggt 241020DNAArtificial SequenceSynthetic
primer Pmel17 Reverse 10gtgaaggttg aactggcgtg 201120DNAArtificial
SequenceSynthetic primer P-Cad FWD 11acagcatcac agggcctggc
201220DNAArtificial SequenceSynthetic primer P-Cad REV 12tggctccttc
ggctcttggc 201320DNAArtificial SequenceSynthetic primer Mbpshi Fwd
13accgtcctga gaccattgtc 201424DNAArtificial SequenceSynthetic
primer Mbpshi Rev 14gtgcttatct agtgtatgcc tgtg 241520DNAArtificial
SequenceSynthetic primer Control Fwd 15caaatgttgc ttgtctggtg
201620DNAArtificial SequenceSynthetic primer Control Rev
16gtcagtcgag tgcacagttt 201721DNAArtificial SequenceSynthetic
primer WTshi Fwd 17ggccggaccc aagatgaaaa c 211821DNAArtificial
SequenceSynthetic primer WTshi Rev 18tgttggccta aagcacccta c
211917DNAArtificial SequenceSynthetic primer Tyr Forward
19cggccaacga tcccatt 172025DNAArtificial SequenceSynthetic primer
Gapdh Forward 20tgcagtggca aagtggagat tgttg 25
* * * * *