Development of Protein-Based Biotherapeutics That Penetrates Cell-Membrane and Induces Anti-Lung Cancer Effect - Improved Cell-Permeable Suppressor of Cytokine Signaling (iCP-SOCS3) Proteins, Polynucleotides Encoding the Same, and Anti-Lung Cancer Compositions Comprising the Same

Abstract

In principle, protein-based biotherapeutics offers a way to control biochemical processes in living cells under non-steady state conditions and with fewer off-target effects than conventional small molecule therapeutics. However, systemic protein delivery in vivo has been proven difficult due to poor tissue penetration and rapid clearance. Protein transduction exploits the ability of some cell-penetrating peptide (CPP) sequences to enhance the uptake of proteins and other macromolecules by mammalian cells. Previously developed hydrophobic CPPs, named membrane translocating sequence (MTS), membrane translocating motif (MTM) and macromolecule transduction domain (MTD), are able to deliver biologically active proteins into a variety of cells and tissues. Various cargo proteins fused to these CPPs have been used to test the functional and/or therapeutic efficacy of protein transduction. Previously, recombinant proteins consisting of suppressor of cytokine signaling 3 (CP-SOCS3) protein fused to the fibroblast growth factor (FGF) 4-derived MTM were developed to inhibit inflammation and apoptosis. However, CP-SOCS3 fusion proteins expressed in bacteria cells were hard to be purified in soluble form. To address these critical limitations, CPP sequences called advanced MTDs (aMTDs) have been developed in this art. The development of this art has been accomplished by (i) analyzing previous developed hydrophobic CPP sequences to identify specific critical factors (CFs) that affect intracellular delivery potential and (ii) constructing artificial aMTD sequences that satisfy for each critical factor. In addition, solubilization domains (SDs) have been incorporated into the aMTD-fused SOCS3 recombinant proteins to enhance solubility with corresponding increases in protein yield and cell-/tissue-permeability. These recombinant SOCS3 proteins fused to aMTD/SD having much higher solubility/yield and cell-/tissue-permeability have been named as improved cell-permeable SOCS3 (iCP-SOCS3) proteins. Previously developed CP-SOCS3 proteins fused to MTM were only tested or used as anti-inflammatory agents to treat acute liver injury. In the present art, iCP-SOCS3 proteins have been tested for use as anti-cancer agents in the treatment of neoplasia in lung. Since SOCS3 is frequently deleted in cancer cells and loss of SOCS3 promotes resistance to apoptosis and proliferation, we reasoned that iCP-SOCS3 could be used as a protein-based intracellular replacement therapy for the treatment of lung cancer. The results demonstrated in this art support this reasoning: treatment of human non-small cell lung carcinoma cells with iCP-SOCS3 results in reduced cancer cell viability, enhanced apoptosis. Furthermore, iCP-SOCS3 inhibited migration/invasion of lung cancer cells. In the present invention with iCP-SOCS3, where SOCS3 is fused to an empirically determined combination of newly developed aMTD and customized SD, macromolecule intracellular transduction technology (MITT) enabled by the advanced MTDs may provide novel protein therapy against lung cancer.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of the filing date of U.S. Provisional Application No. 62/042,493, filed on Aug. 27, 2014, in the United States Patent and Trademark Office, the disclosure of which is incorporated herein in its entirety by reference.

TECHNICAL FIELD

[0002] The present invention pertains to have (i) improved cell-permeable SOCS3 (iCP-SOCS3) proteins as protein-based biotherapeutics, which are well-enhanced in their ability to transport biologically active SOCS3 proteins across the plasma membrane, to increase in its solubility and manufacturing yield, and to induce anti-non-small cell lung carcinoma effect; (ii) polynucleotides that encode the same, and (iii) anti-lung cancer compositions that comprise the same.

BACKGROUND ART

[0003] Worldwide, lung cancer is the most common cause of cancer-related death in men and women, and was responsible for 1.56 million deaths annually. There are two main types of primary lung cancer: non-small cell lung cancer (NSCLC), small cell lung cancer (SCLC). About 85% of lung cancers are NSCLCs which is the most common type of lung cancer. Squamous cell carcinoma, adenocarcinoma, and large cell carcinoma are all subtypes of non-small cell lung cancer. Cytokines including IL-6 and interferon-gamma (IFN-) activate the Janus kinase (JAK)/signal transducers and activators of transcription (STAT) signaling pathway, a vital role promoting the inflammation, carcinogenesis and metastasis in the lung. STAT3, which functions as an oncogene downstream of IL-6/gp130, is hyper-activated in lung cancer cells contributes to increase cell proliferation and inhibits apoptosis.

[0004] Cytokine signaling is strictly regulated by the SOCS family proteins induced by different classes of agonists, including cytokines, hormones and infectious agents. Among them, SOCS1 and SOCS3 are relatively specific to STAT1 and STAT3, respectively. SOCS1 inhibits JAK activation through its N-terminal kinase inhibitory region (KIR) by the direct binding to the activation loop of JAKs, while SOCS3 binds to janus kinases (JAKs)-proximal sites on the receptor through its SH2 domain and inhibits JAK activity that blocks recruitment of STAT3. Both promote anti-inflammatory effects due to the suppression of inflammation-inducing cytokine signaling. Furthermore, the SOCS box, another domain in SOCS proteins, interacts with E3 ubiquitin ligases and/or couples the SH2 domain-binding proteins to the ubiquitin-proteasome pathway. Therefore, SOCSs inhibit cytokine signaling by suppressing JAK kinase activity and degrading the activated cytokine receptor complex.

[0005] A previous study has confirmed that SOCS3 may significantly inhibit the proliferation of lung cancer cells in vitro and indicated that SOCS3 may act as an anti-oncogene involved in the development of tumors. Furthermore, SOCS3 may regulate the movement and migration of tumor cells. Methylation-mediated silencing of SOCS3 has been reported in non-small lung cancer (NSCLC) and other human cancers. In addition to the effect of SOCS3 in inflammation, abnormalities of the JAK/STAT pathway are also associated with cancer. It has been reported that methylationin of CpG islands in the functional SOCS3 promoter is correlated with its transcription silencing in the lung cancer cell lines. Restoration of SOCS3 in lung cancer cells where SOCS3 was methylation-silenced resulted in the down-regulation of active STAT3, induction of apoptosis, and growth suppression of cancer cells. It means that SOCS3 silencing is one of the important mechanisms of constitutive activation of the JAK/STAT pathway in cancer pathogenesis. Therefore, it can be suggested that intracellular SOCS3 protein replacement therapy may be useful in the treatment of lung cancer.

[0006] In the previous study, recombinant SOCS3 proteins that contain a cell-penetrating peptide (CPP)-membrane-translocating motif (MTM) from fibroblast growth factor (FGF)-4 has been reported to negatively control JAK/STAT signaling. These recombinant SOCS3 proteins inhibited STAT phosphorylation, inflammatory cytokines production and MHC-II expression in cultured and primary macrophages. In addition, SOCS3 fused to MTM protected mice challenged with a lethal dose of the SEB super-antigen, by suppressing apoptosis and hemorrhagic necrosis in multiple organs. However, the SOCS3 proteins fused to FGF4-derived MTM displayed extremely low solubility, poor yields and relatively low cell- and tissue-permeability. Therefore, the MTM-fused SOCS3 proteins were not suitable for further clinical development as therapeutic agents. To overcome these limitations, improved SOCS3 recombinant proteins (iCP-SOCS3) fused to the combination of novel hydrophobic CPPs, namely advanced macromolecule transduction domains (aMTDs), to greatly improve the efficiency of membrane penetrating ability in vitro and in vivo with solubilization domains to increase their solubility and manufacturing yield when expressed and purified from bacteria cells.

[0007] In this new art of invention, aMTD/SD-fused SOCS3 recombinant proteins (iCP-SOCS3) have much improved physicochemical characteristics (solubility & yield) and functional activity (cell-/tissue-permeability) compared to the protein fused only to FGF-4-derived MTM. In addition, the newly developed iCP-SOCS3 proteins have now been demonstrated to have therapeutic application in treating the lung cancer, exploiting the ability of SOCS3 to suppress JAK/STAT signaling. The present invention represents that macromolecule intracellular transduction technology (MITT) enabled by the new hydrophobic CPPs that are aMTDs may provide novel protein therapy through SOCS3-intracellular protein replacement against the lung cancer. These findings suggest that restoration of SOCS3 by replenishing the intracellular SOCS3 with iCP-SOCS3 protein creates a new paradigm for anti-cancer therapy, and the intracellular protein replacement therapy with the SOCS3 recombinant protein fused to the combination of aMTD and SD pair may be useful to treat the lung cancer.

SUMMARY

[0008] An aspect of the present invention relates to improved cell-permeable SOCS3 (iCP-SOCS3) capable of mediating the transduction of biologically active macromolecules into live cells.

[0009] iCP-SOCS3 fused to novel hydrophobic CPPs--namely advanced macromolecule transduction domains (aMTDs)--greatly improve the efficiency of membrane penetrating ability in vitro and in vivo of the recombinant proteins.

[0010] iCP-SOCS3 fused to solubilization domains (SDs) greatly increase in their solubility and manufacturing yield when they are expressed and purified in the bacteria system.

[0011] An aspect of the present invention also relates to its therapeutic application for delivery of a biologically active molecule to a cell involving a cell-permeable SOCS3 recombinant protein, where the aMTD is attached to a biologically active cargo molecule.

[0012] Other aspects of the present invention relate to an efficient use of aMTD sequences for drug delivery, protein therapy, intracellular protein therapy, protein replacement therapy and peptide therapy.

[0013] An aspect of the present invention provides improved cell-permeable SOCS3 as a biotherapeutics having improved solubility/yield, cell-/tissue-permeability and anti-lung cancer effects. Therefore, this would allow their practically effective applications in drug delivery and protein therapy including intracellular protein therapy and protein replacement therapy.

BRIEF DESCRIPTION OF DRAWINGS

[0014] The above and other objects, features and other advantages of the present invention will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings.

[0015] FIG. 1 shows the structure of SOCS3 recombinant proteins. A schematic diagram of the His-tagged SOCS3 recombinant protein is illustrated and constructed according to the present invention. The his-tag for affinity purification (white), aMTD165 (black), SOCS3 (gray) and solubilization domain A and B (SDA & SDB, hatched) are shown.

[0016] FIG. 2 shows the construction of expression for SOCS3 recombinant proteins This figure shows the agarose gel electrophoresis analysis showing plasmid DNA fragments encoding SOCS3, aMTDs fused SOCS3 and SD cloned into the pET28 (+) vector according to the present invention.

[0017] FIG. 3 shows inducible expression and purification of SOCS3 recombinant proteins. Expression of SOCS3 recombinant proteins in E. coli before (-) and after (+) induction with IPTG and purification by Ni2+ affinity chromatography (P) were monitored by SDS-PAGE, and stained with Coomassie blue.

[0018] FIG. 4 shows the improvement of solubility/yield with aMTD/SD-fusion. The solubility, yield and recovery (in percent) of soluble form from denatured form are indicated (left). Relative yield of recombinant proteins is normalized to the yield of HS3 protein (Right).

[0019] FIG. 5 shows aMTD-mediated cell-permeability of SOCS3 recombinant proteins. RAW264.7 cells were exposed to FITC-labeled SOCS3 recombinant proteins (10 M) for 1 hr, treated with proteinase K to remove cell-associated but non-internalized proteins and analyzed by flow cytometry. Untreated cells (gray) and equimolar concentration of unconjugated FITC (FITC only, green)-treated cells were served as control.

[0020] FIG. 6 shows aMTD-mediated intracellular delivery and localization of SOCS3 recombinant proteins. Each of NIH3T3 cells was incubated for 1 hour at 37.degree. C. with 10 M FITC-labeled SOCS3 protein. Cell-permeability of SOCS3 recombinant proteins was visualized by utilizing confocal microscopy LSM700 version.

[0021] FIG. 7 shows the systemic delivery of aMTD/SD-fused SOCS3 recombinant proteins In vivo. Cryosections of saline-perfused organs were prepared from mice 1 hr after intraperitoneal injection of FITC only or 600 g FITC-conjugated recombinant SOCS3 proteins, and were analyzed by fluorescence microscopy.

[0022] FIG. 8 shows the structure of SDB-fused SOCS3 recombinant protein. A schematic diagram of the SOCS3 recombinant protein is illustrated and constructed according to the present invention. The his-tag for affinity purification (white), SOCS3 (gray) and solubilization domain B (SDB, hatched) are shown.

[0023] FIG. 9 shows the expression, purification and determination of solubility/yield of SD-fused SOCS3 recombinant protein. Expression of SOCS3 recombinant proteins in E. coli before (-) and after (+) induction with IPTG and purification by Ni2+ affinity chromatography (P) were monitored by SDS-PAGE, and stained with Coomassie blue (Left, top). The solubility, yield and recovery (in percent) of soluble form from denatured form are indicated (Left, bottom). Relative yield of recombinant proteins is normalized to the yield of HS3 protein (Right).

[0024] FIG. 10 shows the mechanism of aMTD-mediated SOCS3 protein uptake into cells. (A-D) RAW264.7 cells were treated with 100 mM EDTA for 3 hrs (A), 5 mg/ml Proteinase K for 10 mins (B), 20 mM taxol for 30 mins (C), or 10 .mu.M antimycin for 2 hrs either without or with 1 mM supplemental ATP for 3 hrs. Cells were exposed for 1 hr to 10 M FITC-labeled HS3 (black), -HS3B (blue) or -HM165S3B (red), treated with proteinase K for 20 mins, and analyzed by flow cytometry. Untreated cells (gray) and equimolar concentration of unconjugated FITC (FITC only, green)-treated cells were served as control. (E) RAW264.7 cells were exposed for the indicated times to 10 .mu.M FITC-labeled HS3 (black), -HS3B (blue) or -HM165S3B (red), treated with proteinase K, and analyzed by flow cytometry.

[0025] FIG. 11 shows aMTD-mediated cell-to-cell delivery. RAW264.7 cells exposed to 10 .mu.M FITC-HS3B or FITC-HM165S3B for 2 hrs, were mixed with non-treated RAW264.7 cells pre-stained with Cy5.5 labeled anti-CD14 antibody, and analyzed by flow cytometry (left, top). The top (right) panel shows a mixture of double negative cells (cells exposed to FITC-HS3B that did not incorporate the protein) and single positive Cy5.5 labeled cells; whereas, second panel from the left contains FITC-Cy5.5 double-positive cells generated by the transfer of FITC-HM165S3B to Cy5.5 labeled cells and the remaining FITC and Cy5.5 single-positive cells. The bottom panels show FITC fluorescence profiles of cell populations before mixing (coded as before) and 1 hr after the same cells were mixed with Cy5.5-labeled cells.

[0026] FIG. 12 shows the inhibition of STAT phosphorylation induced by IFN-. Inhibition of STAT1 phosphorylation detected by immunoblotting analysis. The levels of phosphorylated STAT1 and STAT3 untreated and treated with IFN-were compared to the levels in IFN- -treated RAW 264.7 cells that were pulsed with 10 M of indicated proteins.

[0027] FIG. 13 shows the inhibition of cytokines secretion induced by LPS. Inhibition of TNF- and IL-6 expression by recombinant SOCS3 proteins in primary macrophages isolated from peritoneal exudates of C3H/HeJ mice. Error bars indicate+s.d. of the mean value derived from each assay done in triplicate.

[0028] FIG. 14 shows the cell-permeability of iCP-SOCS3 (HM165S3B) in lung cancer cells. A549 lung cancer cells were exposed to FITC-labeled SOCS3 recombinant proteins (10 M) for 1 hr, treated with proteinase K to remove cell-associated proteins for 20 mins, and analyzed by flow cytometry. Untreated cells (gray) and equimolar concentration of unconjugated FITC (FITC only, green)-treated cells were served as control.

[0029] FIG. 15 shows the tissue distribution of iCP-SOCS3 (HM165S3B) into lung tissue. Cryosections of saline-perfused organs were prepared from mice 1 hr after intraperitoneal injection of FITC only or 600 g FITC-conjugated recombinant SOCS3 proteins, and were analyzed by fluorescence microscopy.

[0030] FIG. 16 shows the inhibition of proliferation in lung cancer cells with iCP-SOCS3. A549 lung cancer cells were seeded in 96 well plates. Next day, cells were treated with DMEM (V), HS3 (1), HM165S3 (2), HM165S3A (3) or HM165S3B (4) recombinant proteins for 96 hrs in the presence of serum (2%). Cell viability was evaluated with the CellTiter-Glo Cell Viability Assay.

[0031] FIG. 17 shows the induction of apoptosis in lung cancer cells with iCP-SOCS3. A549 lung cancer cells were treated for 24 hrs with 10 .mu.M HS3B or HM165S3B proteins and apoptotic cells were visualized by TUNEL staining.

[0032] FIG. 18 shows the stimulation of apoptosis in lung cancer cells with iCP-SOCS3. A549 lung cancer cells were treated for 24 hr with 10 .mu.M HS3B or HM165S3B proteins and analyzed by flow cytometry of cells stained with annexin-V and 7-AAD.

[0033] FIG. 19 shows the inhibition of migration in lung cancer cells with iCP-SOCS3. A549 lung cancer cells were grown to 100% confluence and these procedures were performed on wound-healing assays. The wound areas were examined and photographed at 0 and 48 hrs post-wounding.

[0034] FIG. 20 shows the inhibition of migration/invasion in lung cancer cells with iCP-SOCS3. A549 lung cancer cells were treated with SOCS3 recombinant proteins for 24 hrs, and migration/invasion were measured by Transwell assay. The data shown are representative of three independent experiments. **, p<0.01.

DETAILED DESCRIPTION

[0035] In this invention, it has been hypothesized that exogenously administered SOCS3 proteins could compensate for the apparent inability of endogenously expressed members of this physiologic regulator to interrupt constitutively active cancer-initiating JAK/STAT signaling and excessive cell cycle, resulting in the inhibition of the tumorigenesis. To prove our hypothesis, the SOCS3 recombinant proteins were fused to novel hydrophobic CPPs called aMTDs to improve their cell-/tissue-permeability, additionally adopted solubilization domains to increase their solubility/yield in physiological condition, and then tested whether exogenous administration of SOCS3 proteins can reconstitute their endogenous stores and restore their basic function as the negative feedback regulator that attenuates JAK/STAT signaling. This art of invention has demonstrated "intracellular protein therapy" by designing and introducing cell-permeable form of SOCS3 that has a great potential of anti-cancer therapeutic applicability in lung cancer.

1. Novel Hydrophobic Cell-Penetrating Peptides--Advanced Macromolecule Transduction Domains

[0036] To address the limitation of previously developed hydrophobic CPPs, novel sequences have been developed. To design new hydrophobic CPPs for intracellular delivery of cargo proteins such as SOCS3, identification of optimal common sequence and/or homologous structural determinants, namely critical factors (CFs), had been crucial. To do it, the physicochemical characteristics of previously published hydrophobic CPPs were analyzed. To keep the similar mechanism on cellular uptake, all CPPs analyzed were hydrophobic region of signal peptide (HRSP)-derived CPPs (e.g. MTS and MTD).

(1) Basic Characteristics of CPPs Sequence.

[0037] These 17 hydrophobic CPPs published from 1995 to 2014 have been analyzed for their 11 different characteristics--sequence, amino acid length, molecular weight, pl value, bending potential, rigidity/flexibility, structural feature, hydropathy, residue structure, amino acid composition, and secondary structure of the sequences. Two peptide/protein analysis programs were used (ExPasy: http://web.expasy.org/protparam/, SoSui: http://harrier.nagahama-i-bio.ac.jp/sosui/sosui_submit.html) to determine various indexes, structural features of the peptide sequences and to design new sequence. Followings are important factors analyzed.

[0038] Average length, molecular weight and pl value of the peptides analyzed were 10.8.+-.2.4, 1,011.+-.189.6 and 5.6.+-.0.1, respectively.

(2) Bending Potential (Proline Position: PP)

[0039] Bending potential (Bending or No-Bending) was determined based on the fact whether proline (P) exists and/or where the amino acid(s) providing bending potential to the peptide in recombinant protein is/are located. Proline differs from the other common amino acids in that its side chain is bonded to the backbone nitrogen atom as well as the alpha-carbon atom. The resulting cyclic structure markedly influences protein architecture which is often found in the bends of folded peptide/protein chain. Eleven out of 17 were determined as `Bending` peptide which means that proline should be present in the middle of sequence for peptide bending and/or located at the end of the peptide for protein bending. As indicated above, peptide sequences could penetrate the plasma membrane in a "bent" configuration. Therefore, bending or no-bending potential is considered as one of the critical factors for the improvement of current hydrophobic CPPs.

(3) Rigidity/Flexibility (Instability Index: II)

[0040] Since one of the crucial structural features of any peptide is based on the fact whether the motif is rigid or flexible, which is an intact physicochemical characteristic of the peptide sequence, instability index (II) of the sequence was determined. The index value representing rigidity/flexibility of the peptide was extremely varied (8.9-79.1), but average value was 40.1.+-.21.9 which suggested that the peptide should be somehow flexible, but not too rigid or flexible.

(4) Hydropathy (Grand Average of Hydropathy: GRAVY) and Structural Feature (Aliphatic Index: AI)

[0041] Alanine (V), valine (V), leucine (L) and isoleucine (I) contain aliphatic side chain and are hydrophobic--that is, they have an aversion to water and like to cluster. These amino acids having hydrophobicity and aliphatic residue enable them to pack together to form compact structure with few holes. Analyzed peptide sequence showed that all composing amino acids were hydrophobic (A, V, L and I) except glycine (G) in only one out of 17 and aliphatic (A, V, L, I, and P). Their hydropathic index (Grand Average of Hydropathy: GRAVY) and aliphatic index (AI) were 2.5.+-.0.4 and 217.9.+-.43.6, respectively.

(5) Secondary Structure (.alpha.-Helix)

[0042] As explained above, the CPP sequences may be supposed to penetrate the plasma membrane directly after inserting into the membranes in a "bent" configuration with hydrophobic sequences adopting an .alpha.-helical conformation. In addition, our analysis strongly indicated that bending potential was crucial. Therefore, structural analysis of the peptides conducted to determine whether the sequence was to form helix or not. Nine peptides were helix and 8 were not. It seems to suggest that helix structure may not be required.

(6) Determination of Critical Factors (CFs)

[0043] In the 11 characteristics analyzed, the following 6 are selected namely "Critical Factors (CFs)" for the development of new hydrophobic CPPs--advanced MTDs: i) amino acid length, ii) bending potential (proline presence and location), iii) rigidity/flexibility (instability index: II), iv) structural feature (aliphatic index: AI), v) hydropathy (GRAVY) and vi) amino acid composition/residue structure (hydrophobic and aliphatic A/a).

1-2. Analysis of Selected Hydrophobic CPPs to Optimize `Critical Factors`

[0044] Since the analyzed data of the 17 different hydrophobic CPPs (analysis A) previously developed during the past 2 decades showed high variation and were hard to make common- or consensus-features, additional analysis B and C was also conducted to optimize the critical factors for better design of improved CPPs-aMTDs.

[0045] In analysis B, 8 CPPs used with each cargo in vivo were selected. Length was 11.+-.3.2, but 3 out of 8 CPPs possessed little bending potential. Rigidity/Flexibility was 41.+-.15, but removing one [MTD85: rigid, with minimal (II: 9.1)] of the peptides increased the overall instability index to 45.6.+-.9.3. This suggested that higher flexibility (40 or higher II) is potentially be better. All other characteristics of the 8 CPPs were similar to the analysis A, including structural feature and hydropathy.

[0046] To optimize the `Common Range and/or Consensus Feature of Critical Factor` for the practical design of aMTDs and the random peptides, which were to prove that the `Critical Factors` determined in the analysis A, B and C were correct to improve the current problems of hydrophobic CPPs--protein aggregation, low solubility/yield, and poor cell/tissue-permeability of the recombinant proteins fused to the MTS/MTM or MTD, and non-common sequence and non-homologous structure of the peptides, empirically selected peptides were analyzed for their structural features and physicochemical factor indexes.

[0047] The peptides which did not have a bending potential, rigid or too flexible sequences (too low or too high Instability Index), or too low or too high hydrophobic CPP were unselected, but secondary structure was not considered because helix structure of sequence was not required. 8 selected CPP sequences that could provide a bending potential and higher flexibility were finally analyzed. Common amino acid length is 12 (11.6.+-.3.0). Proline should be presence in the middle of and/or the end of sequence. Rigidity/Flexibility (II) is 45.5-57.3 (Avg: 50.1.+-.3.6). AI and GRAVY representing structural feature and hydrophobicity of the peptide are 204.7.+-.37.5 and 2.4.+-.0.3, respectively. All peptides are consisted with hydrophobic and aliphatic amino acids (A, V, L, I, and P). Therefore, analysis C was chosen as a standard for the new design of new hydrophobic CPPs (TABLE 1). [0048] 1. Amino Acid Length: 9-13 [0049] 2. Bending Potential (Proline Position: PP): Proline presences in the middle (from 5' to 8' amino acid) and at the end of sequence [0050] 3. Rigidity/Flexibility (Instability Index: II): 40-60 [0051] 4. Structural Feature (Aliphatic Index: AI): 180-220 [0052] 5. Hydropathy (Grand Average of Hydropathy: GRAVY): 2.1-2.6 [0053] 6. Amino Acid Composition: Hydrophobic and Aliphatic amino acids--A, V, L, I and P

TABLE-US-00001 [0053] TABLE 1 [Universal Structure of Newly Develop Hydrophobic CPPs] Summarized Critical Factors of aMTD Newly Designed CPPs Critical Factor Range Bending Potential Proline presences in the middle (5', 6', 7' or 8') (Proline Position: PP) and at the end (12') of peptides Rigidity/Flexibility 40-60 (Instability Index: II) Structural Feature 180-220 (Aliphatic Index: Al) Hydropathy 2.1-2.6 (Grand Average of Hydropathy GRAVY) Length 9-13 (Number of Amino Acid) Amino acid Composition A, V, I, L, P

1-3. Determination of Critical Factors for Development of aMTDs

[0054] For confirming the validity of 6 critical factors providing the optimized cell-/tissue-permeability. All 240 aMTD sequences have been designed and developed based on six critical factors (TABLES 2-1 to 2-6). (The aMTD amino sequences are SEQ ID NOS: 1 to 240, and the aMTD nucleotide sequences are SEQ ID NOS: 241 to 480.)

[0055] All 240 aMTDs (hydrophobic, flexible, bending, aliphatic and helical 12 a/a-length peptides) were practically confirmed by their quantitative and visual cell-permeability. To determine the cell-permeability of aMTDs and random peptides which do not satisfy one or more critical factors have also been designed and tested. Relative cell-permeability of 240 aMTDs to the negative control (random peptide, hydrophilic & non-aliphatic 12A/a length peptide) was significantly increased by up to 164 fold, with average increase of 19.6.+-.1.6. Moreover, compared with reference CPPs (MTM and MTD), novel 240 aMTDs averaged of 13.+-.1.1 (maximum 109.9) and 6.6.+-.0.5 (maximum 55.5) fold higher cell-permeability, respectively. As a result, there were vivid association of cell-permeability of the peptides and critical factors. According to the result from the newly designed and tested novel 240 aMTDs, the empirically optimized critical factors are provided below. [0056] 1. Amino Acid Length: 12 [0057] 2. Bending Potential (Proline Position: PP) [0058] : Proline presences in the middle (from 5' to 8' amino acid) and at the end of sequence [0059] 3. Rigidity/Flexibility (Instability Index: II): 41.3-57.3 [0060] 4. Structural Feature (Aliphatic Index: AI): 187.5-220.0 [0061] 5. Hydropathy (Grand Average of Hydropathy: GRAVY): 2.2-2.6 [0062] 6. Amino Acid Composition: Hydrophobic and Aliphatic amino acids--A, V, L, I and P

TABLE-US-00002 [0062] TABLE 2-1 [Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are Considered and Satisfied (Sequence ID No. 1-46)] Sequence Rigidity/ Sturctural ID Flexibility Feature Hydropathy Residue Number aMTD Sequences Length (II) (Al) (GRAVY) Structure 1 1 AAALAPVVLALP 12 57.3 187.5 2.1 Aliphatic 2 2 AAAVPLLAVVVP 12 41.3 195.0 2.4 Aliphatic 3 3 AALLVPAAVLAP 12 57.3 187.5 2.1 Aliphatic 4 4 ALALLPVAALAP 12 57.3 195.8 2.1 Aliphatic 5 5 AAALLPVALVAP 12 57.3 187.5 2.1 Aliphatic 6 11 VVALAPALAALP 12 57.3 187.5 2.1 Aliphatic 7 12 LLAAVPAVLLAP 12 57.3 211.7 2.3 Aliphatic 8 13 AAALVPVVALLP 12 57.3 203.3 2.3 Aliphatic 9 21 AVALLPALLAVP 12 57.3 211.7 2.3 Aliphatic 10 22 AVVLVPVLAAAP 12 57.3 195.0 2.4 Aliphatic 11 23 VVLVLPAAAAVP 12 57.3 195.0 2.4 Aliphatic 12 24 IALAAPALIVAP 12 50.2 195.8 2.2 Aliphatic 13 25 IVAVAPALVALP 12 50.2 203.3 2.4 Aliphatic 14 42 VAALPVVAVVAP 12 57.3 186.7 2.4 Aliphatic 15 43 LLAAPLVVAAVP 12 41.3 187.5 2.1 Aliphatic 16 44 ALAVPVALLVAP 12 57.3 203.3 2.3 Aliphatic 17 61 VAALPVLLAALP 12 57.3 211.7 2.3 Aliphatic 18 62 VALLAPVALAVP 12 57.3 203.3 2.3 Aliphatic 19 63 AALLVPALVAVP 12 57.3 203.3 2.3 Aliphatic 20 64 AIVALPVAVLAP 12 50.2 203.3 2.4 Aliphatic 21 65 IAIVAPVVALAP 12 50.2 203.3 2.4 Aliphatic 22 81 AALLPALAALLP 12 57.3 204.2 2.1 Aliphatic 23 82 AVVLAPVAAVLP 12 57.3 195.0 2.4 Aliphatic 24 83 LAVAAPLALALP 12 41.3 195.8 2.1 Aliphatic 25 84 AAVAAPLLLALP 12 41.3 195.8 2.1 Aliphatic 26 85 LLVLPAAALAAP 12 57.3 195.8 2.1 Aliphatic 27 101 LVALAPVAAVLP 12 57.3 203.3 2.3 Aliphatic 28 102 LALAPAALALLP 12 57.3 204.2 2.1 Aliphatic 29 103 ALIAAPILALAP 12 57.3 204.2 2.2 Aliphatic 30 104 AVVAAPLVLALP 12 41.3 203.3 2.3 Aliphatic 31 105 LLALAPAALLAP 12 57.3 204.1 2.1 Aliphatic 32 121 AIVALPALALAP 12 50.2 195.8 2.2 Aliphatio 33 123 AAIIVPAALLAP 12 50.2 195.8 2.2 Aliphatic 34 124 IAVALPALIAAP 12 50.3 195.8 2.2 Aliphatic 35 141 AVIVLPALAVAP 12 50.2 203.3 2.4 Aliphatio 36 143 AVLAVPAVLVAP 12 57.3 195.0 2.4 Aliphatic 37 144 VLAIVPAVALAP 12 50.2 203.3 2.4 Aliphatic 38 145 LLAVVPAVALAP 12 57.3 203.3 2.3 Aliphatic 39 161 AVIALPALIAAP 12 57.3 195.8 2.2 Aliphatic 40 162 AVVALPAALIVP 12 50.2 203.3 2.4 Aliphatic 41 163 LALVLPAALAAP 12 57.3 195.8 2.1 Aliphatic 42 164 LAAVLPALLAAP 12 57.3 195.8 2.1 Aliphatic 43 165 ALAVPVALAIVP 12 50.2 203.3 2.4 Aliphatic 44 182 ALIAPVVALVAP 12 57.3 203.3 2.4 Aliphatic 45 183 LLAAPVVIALAP 12 57.3 211.6 2.4 Aliphatic 46 184 LAAIVPAIIAVP 12 50.2 211.6 2.4 Aliphatic

TABLE-US-00003 TABLE 2-2 [Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are Considered and Satisfied (Sequence ID No. 47-92)] Sequence Rigidity/ Sturctural ID Flexibility Feature Hydropathy Residue Number aMTD Sequences Length (II) (Al) (GRAVY) Structure 47 185 AALVLPLIIAAP 12 41.3 220.0 2.4 Aliphatic 48 201 LALAVPALAALP 12 57.3 195.5 2.1 Aliphatic 49 204 LIAALPAVAALP 12 57.3 195.5 2.2 Aliphatic 50 205 ALALVPAIAALP 12 57.3 195.8 2.2 Aliphatic 51 221 AAILAPIVALAP 12 50.2 195.8 2.2 Aliphatic 52 222 ALLIAPAAVIAP 12 57.3 195.8 2.2 Aliphatic 53 223 AILAVPIAVVAP 12 57.3 203.3 2.4 Aliphatic 54 224 ILAAVPIALAAP 12 57.3 195.8 2.2 Aliphatic 55 225 VAALLPAAAVLP 12 57.3 187.5 2.1 Aliphatic 56 241 AAAVVPVLLVAP 12 57.3 195.0 2.4 Aliphatic 57 242 AALLVPALVAAP 12 57.3 187.5 2.1 Aliphatic 58 243 AAVLLPVALAAP 12 57.3 187.5 2.1 Aliphatic 59 245 AAALAPVLALVP 12 57.3 187.5 2.1 Aliphatic 60 261 LVLVPLLAAAAP 12 41.3 211.6 2.3 Aliphatic 61 262 ALIAVPAIIVAP 12 50.2 211.6 2.4 Aliphatic 62 263 ALAVIPAAAILP 12 54.9 195.8 2.2 Aliphatic 63 264 LAAAPVVIVIAP 12 50.2 203.3 2.4 Aliphatic 64 265 VLAIAPLLAAVP 12 41.3 211.6 2.3 Aliphatic 65 281 ALIVLPAAVAVP 12 50.2 203.3 2.4 Aliphatic 66 282 VLAVAPALIVAP 12 50.2 203.3 2.4 Aliphatic 67 283 AALLAPALIVAP 12 50.2 195.8 2.2 Aliphatic 68 284 ALIAPAVALIVP 12 50.2 211.7 2.4 Aliphatic 69 285 AIVLLPAAVVAP 12 50.2 203.3 2.4 Aliphatic 70 301 VIAAPVLAVLAP 12 57.3 203.3 2.4 Aliphatic 71 302 LALAPALALLAP 12 57.3 204.2 2.1 Aliphatic 72 304 AIILAPIAAIAP 12 57.3 204.2 2.3 Aliphatic 73 305 IALAAPILLAAP 12 57.3 204.2 2.2 Aliphatic 74 321 IVAVALPALAVP 12 50.2 203.3 2.3 Aliphatic 75 322 VVAIVLPALAAP 12 50.2 203.3 2.3 Aliphatic 76 323 IVAVALPVALAP 12 50.2 203.3 2.3 Aliphatic 77 324 IVAVALPAALVP 12 50.2 203.3 2.3 Aliphatic 78 325 IVAVALPAVALP 12 50.2 203.3 2.3 Aliphatic 79 341 IVAVALPAVLAP 12 50.2 203.3 2.3 Aliphatic 80 342 VIVALAPAVLAP 12 50.2 203.3 2.3 Aliphatic 81 343 IVAVALPALVAP 12 50.2 203.3 2.3 Aliphatic 82 345 ALLIVAPVAVAP 12 50.2 203.3 2.3 Aliphatic 83 361 AVVIVAPAVIAP 12 50.2 195.0 2.4 Aliphatic 84 363 AVLAVAPALIVP 12 50.2 203.3 2.3 Aliphatic 85 364 LVAAVAPALIVP 12 50.2 203.3 2.3 Aliphatic 86 365 AVIVVAPALLAP 12 50.2 203.3 2.3 Aliphatic 87 381 VVAIVLPAVAAP 12 50.2 195.0 2.4 Aliphatic 88 382 AAALVIPAILAP 12 54.9 195.8 2.2 Aliphatic 89 383 VIVALAPALLAP 12 50.2 211.6 2.3 Aliphatic 90 384 VIVAIAPALLAP 12 50.2 211.6 2.4 Aliphatic 91 385 IVAIAVPALVAP 12 50.2 203.3 2.4 Aliphatic 92 401 AALAVIPAAILP 12 54.9 195.8 2.2 Aliphatic

TABLE-US-00004 TABLE 2-3 [Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are Considered and Satisfied (Sequence ID No. 93-138)] Sequence Rigidity/ Sturctural ID Flexibility Feature Hydropathy Residue Number aMTD Sequences Length (II) (Al) (GRAVY) Structure 93 402 ALAAVIPAAILP 12 54.9 195.8 2.2 Aliphatic 94 403 AAALVIPAAILP 2 54.9 195.6 2.2 Aliphatic 95 404 LAAAVIPAAILP 2 54.9 195.8 2.2 Aliphatic 96 405 LAAAVIPVAILP 12 54.9 211.7 2.4 Aliphatic 97 421 AAILAAPLIAVP 12 57.3 195.8 2.2 Aliphatic 98 422 VVAILAPLLAAP 12 57.3 211.7 2.4 Aliphatic 99 424 AVVVAAPVLALP 12 57.3 195.0 2.4 Aliphatic 100 425 AVVAIAPVLALP 12 57.3 203.3 2.4 Aliphatic 101 442 ALAALVPAVLVP 12 57.3 203.3 2.3 Aliphatic 102 443 ALAALVPVALVP 12 57.3 203.3 2.3 Aliphatic 103 444 LAAALVPVALVP 12 57.3 203.3 2.3 Aliphatic 104 445 ALAALVPALVVP 12 57.3 203.3 2.3 Aliphatic 105 461 IAAVIVPAVALP 12 50.2 203.3 2.4 Aliphatic 106 462 IAAVLVPAVALP 12 57.3 203.3 2.4 Aliphatic 107 463 AVAILVPLLAAP 12 57.3 211.7 2.4 Aliphatic 108 464 AVVILVPLAAAP 12 57.3 203.3 2.4 Aliphatic 109 465 IAAVIVPVAALP 12 50.2 203.3 2.4 Aliphatic 110 481 AIAIAIVPVALP 12 50.2 211.6 2.4 Aliphatic 111 482 ILAVAAIPVAVP 12 54.9 203.3 2.4 Aliphatic 112 483 ILAAAIIPAALP 12 54.9 204.1 2.2 Aliphatic 113 484 LAVVLAAPAIVP 12 50.2 203.3 2.4 Aliphatic 114 485 AILAAIVPLAVP 12 50.2 211.6 2.4 Aliphatic 115 501 VIVALAVPALAP 12 50.2 203.3 2.4 Aliphatic 116 502 AIVALAVPVLAP 12 50.2 203.3 2.4 Aliphatic 117 503 AAIIIVLPAALP 12 50.2 220.0 2.4 Aliphatic 118 504 LIVALAVPALAP 12 50.2 211.7 2.4 Aliphatic 119 505 AIIIVIAPAAAP 12 50.2 195.8 2.3 Aliphatic 120 521 LAALIVVPAVAP 12 50.2 203.3 2.4 Aliphatic 121 522 ALLVIAVPAVAP 12 57.3 203.3 2.4 Aliphatic 122 524 AVALIVVPALAP 12 50.2 203.3 2.4 Aliphatic 123 525 ALAIVVAPVAVP 12 50.2 195.0 2.4 Aliphatic 124 541 LLALIIAPAAAP 12 57.3 204.1 2.1 Aliphatic 125 542 ALALIIVPAVAP 12 50.2 211.6 2.4 Aliphatic 126 543 LLAALIAPAALP 12 57.3 204.1 2.1 Aliphatic 127 544 IVALIVAPAAVP 12 43.1 203.3 2.4 Aliphatic 128 545 VVLVLAAPAAVP 12 57.3 195.0 2.3 Aliphatic 129 561 AAVAIVLPAVVP 12 50.2 195.0 2.4 Aliphatic 130 562 ALIAAIVPALVP 12 50.2 211.7 2.4 Aliphatic 131 563 ALAVIVVPALAP 12 50.2 203.3 2.4 Aliphatic 132 564 VAIALIVPALAP 12 50.2 211.7 2.4 Aliphatic 133 565 VAIVLVAPAVAP 12 50.2 195.0 2.4 Aliphatic 134 582 VAVALIVPALAP 12 50.2 203.3 2.4 Aliphatic 135 583 AVILALAPIVAP 12 50.2 211.6 2.4 Aliphatic 136 585 ALIVAIAPALVP 12 50.2 211.6 2.4 Aliphatic 137 601 AAILIAVPIAAP 12 57.3 195.8 2.3 Aliphatic 138 602 VIVALAAPVLAP 12 50.2 203.3 2.4 Aliphatic

TABLE-US-00005 TABLE 2-4 [Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are Considered and Satisfied (Sequence ID No. 139-184)] Sequence Rigidity/ Sturctural ID Flexibility Feature Hydropathy Residue Number aMTD Sequences Length (II) (Al) (GRAVY) Structure 139 603 VLVALAAPVIAP 12 57.3 203.3 2.4 Aliphatic 140 604 VALIAVAPAVVP 12 57.3 195.0 2.4 Aliphatic 141 605 VIAAVLAPVAVP 12 57.3 195.0 2.4 Aliphatic 142 622 ALIVLAAPVAVP 12 50.2 203.3 2.4 Aliphatic 143 623 VAAAIALPAIVP 12 50.2 187.5 2.3 Aliphatic 144 625 ILAAAAAPLIVP 12 50.2 195.8 2.2 Aliphatic 145 643 LALVLAAPAIVP 12 50.2 211.6 2.4 Aliphatic 146 645 ALAVVALPAIVP 12 50.2 203.3 2.4 Aliphatic 147 661 AAILAPIVAALP 12 50.2 195.8 2.2 Aliphatic 148 664 ILIAIAIPAAAP 12 54.9 204.1 2.3 Aliphatic 149 665 LAIVLAAPVAVP 12 50.2 203.3 2.3 Aliphatic 150 666 AAIAIIAPAIVP 12 50.2 195.8 2.3 Aliphatic 151 667 LAVAIVAPALVP 12 50.2 203.3 2.3 Aliphatic 152 683 LAIVLAAPAVLP 12 50.2 211.7 2.4 Aliphatic 153 684 AAIVLALPAVLP 12 50.2 211.7 2.4 Aliphatic 154 685 ALLVAVLPAALP 12 57.3 211.7 2.3 Aliphatic 155 686 AALVAVLPVALP 12 57.3 203.3 2.3 Aliphatic 156 687 AILAVALPLLAP 12 57.3 220.0 2.3 Aliphatic 157 703 IVAVALVPALAP 12 50.2 203.3 2.4 Aliphatic 158 705 IVAVALLPALAP 12 50.2 211.7 2.4 Aliphatic 159 706 IVAVALLPAVAP 12 50.2 203.3 2.4 Aliphatic 160 707 IVALAVLPAVAP 12 50.2 203.3 2.4 Aliphatic 161 724 VAVLAVLPALAP 12 57.3 203.3 2.3 Aliphatic 162 725 IAVLAVALAVLP 12 57.3 203.3 2.3 Aliphatic 163 726 LAVAIIAPAVAP 12 57.3 187.5 2.2 Aliphatic 164 727 VALAIALPAVLP 12 57.3 211.6 2.3 Aliphatic 165 743 AIAIALVPVALP 12 57.3 211.6 2.4 Aliphatic 166 744 AAVVIVAPVALP 12 50.2 195.0 2.4 Aliphatic 167 746 VAIIVVAPALAP 12 50.2 203.3 2.4 Aliphatic 168 747 VALLAIAPALAP 12 57.3 195.8 2.2 Aliphatic 169 763 VAVLIAVPALAP 12 57.3 203.3 2.3 Aliphatic 170 764 AVALAVLPAVVP 12 57.3 195.0 2.3 Aliphatic 171 765 AVALAVVPAVLP 12 57.3 195.0 2.3 Aliphatic 172 766 IVVIAVAPAVAP 12 50.2 195.0 2.4 Aliphatic 173 767 IVVAAVVPALAP 12 50.2 195.0 2.4 Aliphatic 174 783 IVALVPAVAIAP 12 50.2 203.3 2.5 Aliphatic 175 784 VAALPAVALVVP 12 57.3 195.0 2.4 Aliphatic 176 786 LVAIAPLAVLAP 12 41.3 211.7 2.4 Aliphatic 177 787 AVALVPVIVAAP 12 50.2 195.0 2.4 Aliphatic 178 788 AIAVAIAPVALP 12 57.3 187.5 2.3 Aliphatic 179 803 AIALAVPVLALP 12 57.3 211.7 2.4 Aliphatic 180 805 LVLIAAAPIALP 12 41.3 220.0 2.4 Aliphatic 181 806 LVALAVPAAVLP 12 57.3 203.3 2.3 Aliphatic 182 807 AVALAVPALVLP 12 57.3 203.3 2.3 Aliphatic 183 808 LVVLAAAPLAVP 12 41.3 203.3 2.3 Aliphatic 184 809 LIVLAAPALAAP 12 50.2 195.8 2.2 Aliphatic

TABLE-US-00006 TABLE 2-5 [Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are Considered and Satisfied (Sequence ID No. 185-230)] Sequence Rigidity/ Sturctural ID Flexibility Feature Hydropathy Residue Number aMTD Sequences Length (II) (Al) (GRAVY) Structure 185 810 VIVLAAPALAAP 12 50.2 187.5 2.2 Aliphatic 186 811 AVVLAVPALAVP 12 57.3 195.0 2.3 Aliphatic 187 824 LIIVAAAPAVAP 12 50.2 187.5 2.3 Aliphatic 188 825 IVAVIVAPAVAP 12 43.2 195.0 2.5 Aliphatic 189 826 LVALAAPIIAVP 12 41.3 211.7 2.4 Aliphatic 190 827 IAAVLAAPALVP 12 57.3 187.5 2.2 Aliphatic 191 828 IALLAAPIIAVP 12 41.3 220.0 2.4 Aliphatic 192 829 AALALVAPVIVP 12 50.2 203.3 2.4 Aliphatic 193 830 IALVAAPVALVP 12 57.3 203.3 2.4 Aliphatic 194 831 IIVAVAPAAIVP 12 43.2 203.3 2.5 Aliphatic 195 832 AVAAIVPVIVAP 12 43.2 195.0 2.5 Aliphatic 196 843 AVLVLVAPAAAP 12 41.3 219.2 2.5 Aliphatic 197 844 VVALLAPLIAAP 12 41.3 211.8 2.4 Aliphatic 198 845 AAVVIAPLLAVP 12 41.3 203.3 2.4 Aliphatic 199 846 IAVAVAAPLLVP 12 41.3 203.3 2.4 Aliphatic 200 847 LVAIVVLPAVAP 12 50.2 219.2 2.6 Aliphatic 201 848 AVAIVVLPAVAP 12 50.2 195.0 2.4 Aliphatic 202 849 AVILLAPLIAAP 12 57.3 220.0 2.4 Aliphatic 203 850 LVIALAAPVALP 12 57.3 211.7 2.4 Aliphatic 204 851 VLAVVLPAVALP 12 57.3 219.2 2.5 Aliphatic 205 852 VLAVAAPAVLLP 12 57.3 203.3 2.3 Aliphatic 206 863 AAVVLLPIIAAP 12 41.3 211.7 2.4 Aliphatic 207 864 ALLVIAPAIAVP 12 57.3 211.7 2.4 Aliphatic 208 865 AVLVIAVPAIAP 12 57.3 203.3 2.5 Aliphatic 209 867 ALLVVIAPLAAP 12 41.3 211.7 2.4 Aliphatic 210 868 VLVAAILPAAIP 12 54.9 211.7 2.4 Aliphatic 211 870 VLVAAVLPIAAP 12 41.3 203.3 2.4 Aliphatic 212 872 VLAAAVLPLVVP 12 41.3 219.2 2.5 Aliphatic 213 875 AIAIVVPAVAVP 12 50.2 195.0 2.4 Aliphatic 214 877 VAIIAVPAVVAP 12 57.3 195.0 2.4 Aliphatic 215 878 IVALVAPAAVVP 12 50.2 195.0 2.4 Aliphatic 216 879 AAIVLLPAVVVP 12 50.2 219.1 2.5 Aliphatic 217 881 AALIVVPAVAVP 12 50.2 195.0 2.4 Aliphatic 218 882 AIALVVPAVAVP 12 57.3 195.0 2.4 Aliphatic 219 883 LAIVPAAIAALP 12 50.2 195.8 2.2 Aliphatic 220 885 LVAIAPAVAVLP 12 57.3 203.3 2.4 Aliphatic 221 887 VLAVAPAVAVLP 12 57.3 195.0 2.4 Aliphatic 222 888 ILAVVAIPAAAP 12 54.9 187.5 2.3 Aliphatic 223 889 ILVAAAPIAALP 12 57.3 195.8 2.2 Aliphatic 224 891 ILAVAAIPAALP 12 54.9 195.8 2.2 Aliphatic 225 893 VIAIPAILAAAP 12 54.9 195.8 2.3 Aliphatic 226 895 AIIIVVPAIAAP 12 50.2 211.7 2.5 Aliphatic 227 896 AILIVVAPIAAP 12 50.2 211.7 2.5 Aliphatic 228 897 AVIVPVAIIAAP 12 50.2 203.3 2.5 Aliphatic 229 899 AVVIALPAVVAP 12 57.3 195.0 2.4 Aliphatic 230 900 ALVAVIAPVVAP 12 57.3 195.0 2.4 Aliphatic

TABLE-US-00007 TABLE 2-6 [Newly Developed Hydrophobic CPPs-240 aMTDs That All Critical Factors Are Considered and Satisfied (Sequence ID No. 231-240)] Sequence Rigidity/ Sturctural ID Flexibility Feature Hydropathy Residue Number aMTD Sequences Length (II) (Al) (GRAVY) Structure 231 901 ALVAVLPAVAVP 12 57.3 195.0 2.4 Aliphatic 232 902 ALVAPLLAVAVP 12 41.3 203.3 2.3 Aliphatic 233 904 AVLAVVAPVVAP 12 57.3 186.7 2.4 Aliphatic 234 905 AVIAVAPLVVAP 12 41.3 195.0 2.4 Aliphatic 235 906 AVIALAPVVVAP 12 57.3 195.0 2.4 Aliphatic 236 907 VAIALAPVVVAP 12 57.3 195.0 2.4 Aliphatic 237 908 VALALAPVVVAP 12 57.3 195.0 2.3 Aliphatic 238 910 VAALLPAVVVAP 12 57.3 195.0 2.3 Aliphatic 239 911 VALALPAVVVAP 12 57.3 195.0 2.3 Aliphatic 240 912 VALLAPAVVVAP 12 57.3 195.0 2.3 Aliphatic 52.6 .+-. 5.1 201.7 .+-. 7.8 2.3 .+-. 0.1

[0063] These examined critical factors are within the range that we have set for our critical factors; therefore, we were able to confirm that the aMTDs that satisfy these critical factors have much higher cell-permeability (TABLE 3) and intracellular delivery potential compared to reference hydrophobic CPPs reported during the past two decades.

TABLE-US-00008 TABLE 3 [Summarized Critical Factors of aMTD After In-Depth Analysis of Experimental Results] Summarized Critical Factors of aMTD Analysis of Experimental Results Critical Factor Range Bending Potential Proline presences in the middle (5', 6', 7' or 8') (Proline Position: PP) and at the end (12') of peptides Rigidity/Flexibility 41.3-57.3 (Instability Index: II) Structural Feature 187.5-220.0 (Aliphatic Index: Al) Hydropathy 2.2-2.6 (Grand Average of Hydropathy GRAVY) Length 12 (Number of Amino Acid) Amino acid Composition A, V, I, L, P

2. Development of SOCS3 Recombinant Proteins Fused to aMTD and Solubilization Domain 2-1. Design of Novel Hydrophobic CPPs-aMTDs for Development of Recombinant SOCS3 Proteins

[0064] Based on these six critical factors proven by experimental data, newly designed advanced macromolecule transduction domains (aMTDs) have been developed, and optimized for their practical therapeutic usage to facilitate protein translocation across the membrane. For this present invention, cell-permeable SOCS3 recombinant proteins have been developed by adopting aMTD165 (TABLE 4) that satisfied all 6 critical factors (TABLE 5).

TABLE-US-00009 TABLE 4 [Amino Acid and Nucleotide Sequence of Newly Developed Advanced MTD 165 Which Follow All Critical Factors] ID Amino Acid Sequence Nucleotide Sequence 165 ALAVPVALAIVP GCG CTG GCG GTG CCG GTG GCG CTG GCG ATT GTG CCG

TABLE-US-00010 TABLE 5 [Critical Factors of aMTD165] Bending Potential Prolin Rigidity/ Sturctural Theoretical M.W. Position Flexibility Feature Hydropathy ID Length pl (Da) 5' 6' 12' (II) (Al) (GRAVY) 165 12 5.57 1133.4 -- 1 1 50.2 195.8 2.2

2-2. Selection of Solubilization Domain (SD) for 50053 Recombinant Proteins

[0065] In the previous study, recombinant cargo (SOCS3) proteins fused to hydrophobic CPP could be expressed in bacteria system and purified with single-step affinity chromatography; however, protein dissolved in physiological buffers (e.q. PBS, DMEM or RPMI1640 etc.) was highly insoluble and had extremely low. Therefore, an additional non-functional protein domain (solubilization domain: SD; TABLE 6) has been fused to the recombinant proteins at their C terminus to improve low solubility/yield and to enhance relative cell-/tissue-permeability.

TABLE-US-00011 TABLE 6 [Information of Solublization Domains] Protein Instability SD Genbank ID Origin (kDa) pl Index (II) GRAVY A CP000113.1 Bacteria 23 4.6 48.1 -0.1 B BC086945.1 Pansy 11 4.9 43.2 -0.9 C CP012127.1 Human 12 5.8 30.7 -0.1 D CP012127.1 Bacteria 23 5.9 26.3 -0.1 E CP011550.1 Human 11 5.3 44.4 -0.9 F NG_034970 Human 34 7.1 56.1 -0.2

[0066] According to the specific aim, solubilization domain A (SDA) and B (SDB) were first selected. We hypothesize that fusion of SOCS3 with SDs and novel hydrophobic CPP, aMTD, would greatly increase solubility/yield and cell-/tissue-permeability of recombinant cargo proteins--SOCS3--for the clinical application. SDA is a soluble tag, a tandem repeat of 2 N-terminal domain (NTD) sequences of CP.sub.--000113.1, which is a very stable soluble protein present in a spore surface coat of Myxococcus xanthus. SDB, a heme-binding part of cytochrome, provides a visual aid for estimating expression level and solubility. Bacteria expressing SDB containing fusion proteins appears red when the fused proteins are soluble.

2-3. Preparation of SOCS3 Recombinant Proteins

[0067] Histidine-tagged human SOCS3 proteins were designed (FIG. 1) and constructed by amplifying the SOCS3 cDNA (225 amino acids) from nt 4 to 678 using primers [TABLE 7] for SOCS3 cargo fused to aMTD. The PCR products were subcloned with NdeI (5') and BamHI (3') into pET-28a(+). Coding sequences for SDA or SDB were fused to the C terminus of his-tagged aMTD-fused SOCS3 and cloned at between the BamHI (5') and SalI (3') sites in pET-28a(+) (FIG. 2).

[0068] PCR primers for SOCS3 and SDA and/or SDB fused to SOCS3 are summarized in TABLES 7, 8 and 9, respectively. The cDNA and amino acid sequences of histidine tag are provided in SEQ ID NO: 481 and 482, and cDNA and amino acid sequences of aMTDs are indicated in SEQ ID NO: 483 and 484, respectively. The cDNA and amino acid sequences are displayed in SEQ ID NO: 485 and 486 (S0053); SEQ ID NO: 487 and 488 (SDA); and SEQ ID NO: 489 and 490 (SDB), respectively.

TABLE-US-00012 [cDNA Sequence of Histidine Tag] SEQ ID NO: 481 ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGC [Amino Acid Sequence of Histidine Tag] SEQ ID NO: 482 Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro Arg Gly Ser [cDNA Sequences of aMTDs] SEQ ID NO: 483 Please see TABLE 4 [Amino Acid Sequences of aMTDs] SEQ ID NO: 484 Please see TABLE 4 [cDNA Sequence of human SOC53] SEQ ID NO: 485 ATGGTCACCC ACAGCAAGTT TCCCGCCGCC GGGATGAGCC GCCCCCTGGA CACCAGCCTG CGCCTCAAGA CCTTCAGCTC CAAGAGCGAG TACCAGCTGG TGGTGAACGC AGTGCGCAAG CTGCAGGAGA GCGGCTTCTA CTGGAGCGCA GTGACCGGCG GCGAGGCGAA CCTGCTGCTC AGTGCCGAGC CCGCCGGCAC CTTTCTGATC CGCGACAGCT CGGACCAGCG CCACTTCTTC ACGCTCAGCG TCAAGACCCA GTCTGGGACC AAGAACCTGC GCATCCAGTG TGAGGGGGGC AGCTTCTCTC TGCAGAGCGA TCCCCGGAGC ACGCAGCCCG TGCCCCGCTT CGACTGCGTG CTCAAGCTGG TGCACCACTA CATGCCGCCC CCTGGAGCCC CCTCCTTCCC CTCGCCACCT ACTGAACCCT CCTCCGAGGT GCCCGAGCAG CCGTCTGCCC AGCCACTCCC TGGGAGTCCC CCCAGAAGAG CCTATTACAT CTACTCCGGG GGCGAGAAGA TCCCCCTGGT GTTGAGCCGG CCCCTCTCCT CCAACGTGGC CACTCTTCAG CATCTCTGTC GGAAGACCGT CAACGGCCAC CTGGACTCCT ATGAGAAAGT CACCCAGCTG CCGGGGCCCA TTCGGGAGTT CCTGGACCAG TACGATGCCC CGCTT [Amino Acid Sequence of human S0053] SEQ ID NO: 486 Met Val Thr His Ser Lys Phe Pro Ala Ala Gly Met Ser Arg Pro Leu Asp Thr Ser Leu Arg Leu Lys Thr Phe Ser Ser Lys Ser Glu Tyr Gln Leu Val Val Asn Ala Val Arg Lys Leu Gln Glu Ser Gly Phe Tyr Trp Ser Ala Val Thr Gly Gly Glu Ala Asn Leu Leu Leu Ser Ala Glu Pro Ala Gly Thr Phe Leu Ile Arg Asp Ser Ser Asp Gln Arg His Phe Phe Thr Leu Ser Val Lys Thr Gln Ser Gly Thr Lys Asn Leu Arg Ile Gln Cys Gly Gly Gly Ser Phe Ser Leu Gln Ser Asp Pro Arg Ser Thr Gln Pro Val Pro Arg Phe Asp Cys Val Leu Lys Leu Val His His Tyr Met Pro Pro Pro Gly Ala Pro Ser Phe Pro Ser Pro Pro Thr Glu Pro Ser Ser Glu Val Pro Glu Gln Pro Ser Ala Gln Pro Leu Pro Gly Ser Pro Pro Arg Arg Ala Tyr Tyr Ile Tyr Ser Gly Gly Glu Lys Ile Pro Leu Val Leu Ser Arg Pro Leu Ser Ser Asn Val Ala Thr Leu Gln His Leu Cys Arg Lys Thr Val Asn Gly His Leu Asp Ser Tyr Glu Lys Val Thr Gln Leu Pro Gly Pro Ile Arg Glu Phe Leu Asp Gln Tyr Asp Ala Pro Leu [cDNA Sequences of SDA] SEQ ID NO: 487 ATGGCAAATATT ACCGTTTTCTAT AACGAAGACTTC CAGGGTAAGCAG GTCGATCTGCCG CCTGGCAACTAT ACCCGCGCCCAG TTGGCGGCGCTG GGCATCGAGAAT AATACCATCAGC TCGGTGAAGGTG CCGCCTGGCGTG AAGGCTATCCTG TACCAGAACGAT GGTTTCGCCGGC GACCAGATCGAA GTGGTGGCCAAT GCCGAGGAGTTG GGCCCGCTGAAT AATAACGTCTCC AGCATCCGCGTC ATCTCCGTGCCC GTGCAGCCGCGC ATGGCAAATATT ACCGTTTTCTAT AACGAAGACTTC CAGGGTAAGCAG GTCGATCTGCCG CCTGGCAACTAT ACCCGCGCCCAG TTGGCGGCGCTG GGCATCGAGAAT AATACCATCAGC TCGGTGAAGGTG CCGCCTGGCGTG AAGGCTATCCTC TACCAGAACGAT GGTTTCGCCGGC GACCAGATCGAA GTGGTGGCCAAT GCCGAGGAGCTG GGTCCGCTGAAT AATAACGTCTCC AGCATCCGCGTC ATCTCCGTGCCG GTGCAGCCGAGG [Amino Acid Sequences of SDA] SEQ ID NO: 488 Met Ala Asn ile Thr Val Phe Tyr Asn Glu Asp Phe Gln Gly Lys Gln Val Asp Leu Pro Pro Gly Asn Tyr Thr Arg Ala Gln Leu Ala Ala Leu Gly Ile Glu Asn Asn Thr Ile Ser Ser Val Lys Val Pro Pro Gly Val Lys Ala Ile Leu Tyr Gln Asn Asp Gly Phe Ala Gly Asp Gln Ile Glu Val Val Ala Asn Ala Glu Glu Leu Gly Pro Leu Asn Asn Asn Val Ser Ser Ile Arg Val Ile Ser Val Pro Val Gln Pro Arg Met Ala Asn Ile Thr Val Phe Tyr Asn Glu Asp Phe Gln Gly Lys Gln Val Asp Leu Pro Pro Gly Asn Tyr Thr Arg Ala Gln Leu Ala Ala Leu Gly ile Glu Asn Asn Thr Ile Ser Ser Val Lys Val Pro Pro Gly Val Lys Ala Ile Leu Tyr Gln Asn Asp Gly Phe Ala Gly Asp Gln Ile Glu Val Val Ala Asn Ala Glu Glu Leu Gly Pro Leu Asn Asn Asn Val Ser Ser Ile Arg Val Ile Ser Val Pro Val Gln Pro Arg [cDNA Sequences of SDB] SEQ ID NO: 489 ATGGCA GAACAAAGCG ACAAGGATGT GAAGTACTAC ACTCTGGAGG AGATTCAGAA GCACAAAGAC AGCAAGAGCA CCTGGGTGAT CCTACATCAT AAGGTGTACG ATCTGACCAA GTTTCTCGAA GAGCATCCTG GTGGGGAAGA AGTCCTGGGC GAGCAAGCTG GGGGTGATGC TACTGAGAAC TTTGAGGACG TCGGGCACTC TACGGATGCA CGAGAACTGT CCAAAACATA CATCATCGGG GAGCTCCATC CAGATGACAG ATCAAAGATA GCCAAGCCTT CGGAAACCCT T [Amino Acid Sequences of SDB] SEQ ID NO: 490 Met Ala Glu Gln Ser Asp Lys Asp Val Lys Tyr Tyr Thr Leu Glu Glu Ile Gln Lys His Lys Asp Ser Lys Ser Thr Trp Val Ile Leu His His Lys Val Tyr Asp Leu Thr Lys Phe Leu Glu Glu His Pro Gly Gly Glu Glu Val Leu Gly Glu Gln Ala Gly Gly Asp Ala Thr Glu Asn Phe Glu Asp Val Gly His Ser Thr Asp Ala Arg Glu Leu Ser Lys Thr Tyr Ile Ile Gly Glu Leu His Pro Asp Asp Arg Ser Lys Ile Ala Lys Pro Ser Glu Thr Leu

[0069] The SOCS3 recombinant proteins were expressed in E. coli BL21-CodonPlus (DE3) cells, grown to an OD.sub.600 of 0.6 and induced for 3 hrs with 0.6 mM isopropyl-.beta.-D-thiogalactopyranoside (IPTG). The proteins were purified by Ni2.sup.+ affinity chromatography and dissolved in a physiological buffer such as DMEM medium.

TABLE-US-00013 TABLE 7 [PCR Primers for His-Tagged SOCS3 Proteins] aMTD Recombinant Cargo ID Protein 5' Primers 3' Primers SOCS3 -- HS3 5'-GGAATTCCAT 5'-CCCSGATCCT ATGGTCACCCACA TAAAGCGGGGCAT GCARGTTTCCCGC CGTACTGGTCCAG CGCC-3' GAA-3' 165 HM.sub.165S3 5'-GGAATTCCAT 165 HM.sub.165S3A ATGGCGCTGGCGG 5'-CCGGATCCAA 165 HM.sub.165S3B TGCCGGTGGCGCT GCGGGGCATCGTA GGCGATTGTGCCG CTGGTCCAGGAA-3' GTCACCCACAGCA AGTTTC-3' -- HS3B 5'-GGAATTCCAT ATGGTCACCCACA GCAAGTTTCCCGC CGCC-3'

TABLE-US-00014 TABLE 8 [PCR Primers for aMTD/SDA-Fused SOCS3 Proteins] Recombinant Cargo SD Protein 5' Primers 3' Primers SOCS3 SDA HM.sub.165S3A 5'-CCCGGATCCATG 5'-CGCGTCGACTTA GCAAATATTACCGTT CCTCGGCTGCACCGG TTCTATAACGAA-3' CACGGCGATGAC-3'

TABLE-US-00015 TABLE 9 [PCR Primers for aMTD/SDB-Fused SOCS3 Proteins] Recombinant Cargo SD Protein 5' Primers 3' Primers SOCS3 SDB HM.sub.165S3B 5'-CCCGGATCCGC 5'-CGCGTCGACTTA HS3B AGAACAAAGCGACA AAGGGTTTCCGAAGG AGGATGTGAAG-3' CTTGGCTATCTT-3'

2-4. Determination of Solubility and Yield of Each SOCS3 Recombinant Protein

[0070] The histidine-tagged SOCS3 proteins were expressed, purified, and prepared in soluble form (FIG. 3). The yield of each soluble SOCS3 recombinant proteins was determined by measuring absorbance (A450).

[0071] SOCS3 recombinant proteins containing aMTD165 and solubilization domain (HM.sub.165S3A and HM.sub.165S3B) had little tendency to precipitate whereas recombinant SOCS3 proteins lacking a solubilization domain (HS3 and HM.sub.165S3) were largely insoluble. Solubility of aMTD/SD-fused SOCS3 proteins was scored on a 5 point scale compared with that of SOCS3 proteins lacking the solubilization domain (FIG. 4).

[0072] Yields per L of E. coli for each recombinant protein (mg/L) ranged from 1 to 47 mg/L (FIG. 4). Yields of SOCS3 proteins containing an aMTD and SDB (HM.sub.165S3B) were 50% higher than his-tagged SOCS3 protein (HS3).

3. aMTD/SD-Fused SOCS3 Recombinant Proteins Significantly Increase Cell- and Tissue-Permeability 3-1. aMTD/SD-Fused 50053 Recombinant Proteins are Cell-Permeable

[0073] To examine protein uptake, SOCS3 recombinant proteins were conjugated to 5/6-fluorescein isothiocyanate (FITC). RAW 264.7 (FIG. 5) or NIH3T3 cells (FIG. 6) were treated with 10 M FITC-labeled SOCS3 recombinant proteins. The cells were washed three times with ice-cold PBS and treated with proteinase K to remove surface-bound proteins, and internalized proteins were measured by flow cytometry (FIG. 5) and visualized by confocal laser scanning microscopy (FIG. 6). SOCS3 proteins containing aMTD165 (HM165S3, HM165S3A and HM165S3B) efficiently entered the cells (FIGS. 5 and 6) and were localized to various extents in cytoplasm (FIG. 6). In contrast, SOCS3 protein (HS3) containing lacking aMTD did not appear to enter cells. While all SOCS3 proteins containing aMTD165 transduced into the cells, HM165S3B displayed more uniform cellular distribution, and protein uptake of HM165S3B was also very efficient.

3-2. aMTD/SD-Fused SOCS3 Recombinant Proteins Enhance the Systemic Delivery to a Variety of Tissues

[0074] To further investigate in vivo delivery of SOCS3 recombinant proteins, FITC-labeled SOCS3 proteins were monitored following intraperitoneal (IP) injections in mice. Tissue distributions of fluorescence-labeled-SOCS3 proteins in different organs was analyzed by fluorescence microscopy (FIG. 7). SOCS3 recombinant proteins fused to aMTD165 (HM.sub.165S3, HM.sub.165S3A and HM.sub.165S3B) were distributed to a variety of tissues (liver, kidney, spleen, lung, heart and, to a lesser extent, brain). Predictably, liver showed highest levels of fluorescent cell-permeable SOCS3 since intraperitoneal administration favors the delivery of proteins to this organ via the portal circulation. SOCS3 containing aMTD165 was detectable to a lesser degree in lung, spleen and heart. aMTD/SDB-fused SOCS3 recombinant protein (HM.sub.165S3B) showed the highest systemic delivery of SOCS3 protein to the tissues comparable to the SOCS3 containing only aMTD (HM.sub.165S3) or aMTD/SDA (HM165S3A) proteins. These data suggest that SOCS3 protein containing both of aMTD165 and SDB leads to higher cell-/tissue-permeability due to the increase in solubility and stability of the protein, and it displayed a dramatic synergic effect on cell-/tissue-permeability.

3-3. aMTD-Mediated Intracellular Delivery is Bidirectional Mode

[0075] SOCS3 recombinant proteins lacking SD (HS3 and HM165S3) were less soluble, produced lower yields, and showed tendency to precipitate when they were expressed and purified in E. coli. Therefore, we additionally designed (FIG. 8) and constructed SOCS3 recombinant protein containing only SDB (without aMTD165: HS3B) as a negative control. As expected, its solubility and yield increased compared to that of SOCS3 proteins lacking SDB (HS3; FIG. 9). Therefore, HS3B proteins were used as a control protein.

[0076] We next investigated how of aMTD165-mediated intracellular delivery was occurred. The aMTD-mediated intracellular delivery of SOCS3 protein did not require protease-sensitive protein domains displayed on the cell surface (FIG. 10B), microtubule function (FIG. 10C), or ATP utilization (FIG. 10D), since aMTD165-dependent uptake [compare to HS3 (black) and HS3B (blue)] was essentially unaffected by treating cells with proteinase K, taxol, or the ATP depleting agent, antimycin. Conversely, aMTD165-fused SOCS3 proteins uptake was blocked by treatment with EDTA and low temperature (FIGS. 10A and E), indicating the importance of membrane integrity and fluidity for aMTD-mediated protein transduction.

[0077] Moreover, we also tested whether cells treated with aMTD165-fused SOCS3 protein could transfer the protein to neighboring cells. For this, cells transduced with FITC-HM165S3B (green) were mixed with CD14-labeled cells (red), and cell-to-cell protein transfer was assessed by flow cytometry, scoring for CD14/FITC double-positive cells. Efficient cell-to-cell transfer of HM165S3B, but not HS3 or HS3B (FIG. 11), suggests that SOCS3 recombinant proteins containing aMTD165 are capable of bidirectional passage across the plasma membrane.

4. aMTD/SD-Fused SOCS3 Protein Efficiently Inhibits Cellular Processes 4-1. aMTD/SD-Fused SOCS3 Protein Inhibits the Activation of STATs Induced by INF-.gamma.

[0078] The ultimate test of cell-penetrating efficiency is a determination of intracellular activity of SOCS3 proteins transported by aMTD. Since endogenous SOCS3 are known to block phosphorylation of STAT1 and STAT3 by IFN-.gamma.-mediated Janus kinases (JAK) 1 and 2 activation, we demonstrated whether cell-permeable SOCS3 inhibits the phosphorylation of STATs. All SOCS3 recombinant proteins containing aMTD (HM.sub.165S3, HM.sub.165S3A and HM.sub.165S3B), suppressed IFN-.gamma.-induced phosphorylation of STAT1 and STAT3 (FIG. 12). In contrast, STAT phosphorylation was readily detected in cells exposed to HS3, which lacks the aMTD motif required for membrane penetration (FIG. 12), indicating that HS3, which lacks an MTD sequence and did not enter the cells, has no biological activity.

4-2. aMTD/SD-Fused SOCS3 Recombinant Protein Inhibits the Secretion of Inflammatory Cytokines TNF-.alpha. and IL-6

[0079] We next investigated the effect of cell-permeable SOCS3 proteins on cytokines secretion. Treatment of C3H/HeJ primary peritoneal macrophages with SOCS3 proteins containing aMTD165 suppressed TNF-.alpha. and IL-6 secretion induced by the combination of IFN-.gamma. and LPS by 50-90% during subsequent 9 hrs of incubation (FIG. 13). In particular, aMTD165/SDB-fused SOCS3 recombinant protein showed the greatest inhibitory effect on cytokine secretion. In contrast, cytokine secretion in macrophages treated with non-permeable SOCS3 protein (HS3) was unchanged, indicating that recombinant SOCS3 lacking the aMTD doesn't affect intracellular signaling. Therefore, we conclude that differences in the biological activities of HM.sub.165S3B as compared to HS3B are due to the differences in protein uptake mediated by the aMTD sequence. In light of solubility/yield, cell-/tissue-permeability, and biological effect, SOCS3 recombinant protein containing aMTD and SDB (HM.sub.165S3B) is a prototype of a new generation of improved cell-permeable SOCS3 (iCP-SOCS3), and will be selected for further evaluation as a potential anti-tumor agent.

5. iCP-SOCS3 Suppresses Pro-Tumorigenic Functions in Lung Cancer Cells 5-1. iCP-50053 Enhances the Cellular Uptake into Lung Cancer Cells and the Systemic Delivery to the Lung Tissue

[0080] Although lung cancer is one of the most common cancers with a high mortality rate, there are few drugs for treating this lethal disorder. Since constitutive activation of STAT3 is found in various cancers and SOCS3 is closely related to the development of lung cancer, we first chose lung cancer as a primary indication of the iCP-SOCS3 as an anti-cancer agent.

[0081] To determine the cell-permeability of iCP-SOCS3 in the lung cancer cells, cellular uptake of FITC-labeled SOCS3 recombinant proteins was quantitatively evaluated by flow cytometry. FITC-HM.sub.165S3B recombinant protein (iCP-SOCS3) promoted the transduction into cultured A549 lung cancer cells (FIG. 14). In addition, iCP-SOCS3 proteins enhanced the systemic delivery to lung tissue after intraperitoneal injection (FIG. 15). Therefore, these data indicate that iCP-SOCS3 protein could be intracellularly delivered and distributed to the lung cells and tissue, contributing for beneficial biotherapeutic effects.

5-2. iCP-50053 Inhibits Viability of Lung Cancer Cells

[0082] Since the endogenous level of SOCS3 protein is reduced in lung cancer patients, and SOCS3 negatively regulates cell growth and motility in cultured lung cancer cells, we investigated whether iCP-SOCS3 inhibits cell viability through SOCS3 intracellular delivery in lung cancer cells. As shown in FIG. 16, SOCS3 recombinant proteins containing aMTD165 significantly suppressed cancer cell proliferation. HM.sub.165S3B (iCP-SOCS3) protein was the most cytotoxic to A549 lung cancer cells--over 80% in 10 .mu.M treatment (p<0.01)--especially compared to vehicle alone (i.e. exposure of cells to culture media without recombinant proteins; FIG. 16, left). However, neither cell-permeable SOCS3 protein adversely affected the cell viability of non-cancer cells (NIH3T3) even after exposing these cells to equal concentrations (10 .mu.M) of protein over 4 days (FIG. 16, right). These results suggest that the iCP-SOCS3 protein is not overly toxic to normal cells and selectively kills cancer cells, and would have a great ability to inhibit cell survival-associated phenotypes in lung cancer without any severe aberrant effects as a protein-based biotherapeutics.

5-3. iCP-SOCS3 Protein Induces Apoptosis in Lung Cancer Cells

[0083] To further determine the effect of iCP-SOCS3 on the tumorigenicity of lung cancer cells, we subsequently investigated whether iCP-SOCS3 regulates apoptosis in A549 cells. HM.sub.165S3B protein (iCP-SOCS3) was a considerably efficient inducer of apoptosis in A549 cells, as assessed either by a fluorescent terminal dUTP nick-end labeling (TUNEL) assay (FIG. 17) and Annexin V staining (FIG. 18). Consistently, no changes in TUNEL and Annexin V staining were observed in A549 cells treated with HS3B compared to untreated cells (Vehicle).

5-4. iCP-SOCS3 Inhibits Migration/Invasion of Lung Cancer Cells

[0084] We next examined the ability of iCP-SOCS3 to influence cell migration. A549 cells were treated with recombinant proteins for 2 hrs, the monolayers were wounded, and cell migration in the wound was monitored after 48 hrs (FIG. 19). HM.sub.165S3B protein (iCP-SOCS3) suppressed the repopulation of wounded monolayer although SOCS3 protein lacking aMTD165 (HS3B) had no effect on the cell migration. Consistent with this, A549 cells treated with HM.sub.165S3B recombinant protein (iCP-SOCS3) also showed significant inhibitory effect on their Transwell migration compared with untreated cells (Vehicle) and non-permeable SOCS3 protein-treated cells (HS3B; FIG. 20). In addition, A549 cells treated with HM.sub.165S3B recombinant protein (iCP-SOCS3) caused remarkable decrease in invasion compared with the control proteins (HS3B; FIG. 21). Taken together, these data indicate that iCP-SOCS3 contributes to inhibit tumorigenic activities of lung cancer cells.

Example

[0085] The following examples are presented to aid practitioners of the invention, to provide experimental support for the invention, and to provide model protocols. In no way are these examples to be understood to limit the invention.

Example 1

Development of Novel Advanced Macromolecule Transduction Domain (aMTD)

[0086] H-regions of signal sequences (HRSP)-derived CPPs (MTM, MTS and MTD) do not have a common sequence, a sequence motif, and/or a common structural homologous feature. In this invention, the aim is to develop improved hydrophobic CPPs formatted in the common sequence and structural motif that satisfy newly determined `critical factors` to have a `common function`, to facilitate protein translocation across the membrane with similar mechanism to the analyzed CPPs. 6 critical factors have been selected to artificially develop novel hydrophobic CPP, namely advanced macromolecule transduction domain (aMTD). These 6 critical factors include the followings: amino acid length of the peptides (ranging from 9 to 13 amino acids), bending potentials (dependent with the presence and location of proline in the middle of sequence (at 5', 6', 7' or 8' amino acid) and at the end of peptide (at 12')), instability index (II) for rigidity/flexibility (II: 40-60), grand average of hydropathy (GRAVY) for hydropathy (GRAVY: 2.1-2.4), and aliphatic index (AI) for structural features (AI: 180-220). Based on these standardized critical factors, new hydrophobic peptide sequences, namely advanced macromolecule transduction domain peptides (aMTDs), in this invention have been developed and selected to be fused with the cargo protein, SOCS3, to develop improved cell-permeable SOCS3 recombinant protein (iCP-SOCS3).

Example 2

Construction of Expression Vectors for Recombinant SOCS3 Proteins

[0087] Histidine-tagged human SOCS3 proteins were constructed by amplifying the SOCS3 cDNA (225 amino acids) for aMTD fused to SOCS3 cargo. The PCR reactions (100 ng genomic DNA, 10 pmol each primer, each 0.2 mM dNTP mixture, lx reaction buffer and 2.5 U Pfu(+) DNA polymerase (Doctor protein, Korea)) were digested on the restriction enzyme site between Nde I (5') and Sal I (3') involving 35 cycles of denaturing (95.degree. C.), annealing (62.degree. C.), and extending (72.degree. C.) for 45 sec each. For the last extension cycle, the PCR reactions remained for 10 min at 72.degree. C. The PCR products were subcloned into 6.times.His expression vector, pET-28a(+) (Novagen). Coding sequence for SDA or SDB fused to C terminus of his-tagged aMTD-SOCS3 was cloned at BamHI (5') and SalI (3') in pET-28a(+) from PCR-amplified DNA segments and confirmed by DNA sequence analysis of the resulting plasmids.

Example 3

Inducible Expression, Purification, and Preparation of Recombinant Proteins

[0088] The recombinant proteins were purified from E. coli BL21-CodonPlus (DE3) cells grown to an A600 of 0.6 and induced for 3 hrs with 0.6 mM IPTG. Denatured recombinant proteins were purified by Ni2+ affinity chromatography as directed by the supplier (Qiagen, Hilden, Germany). After purification, they were dialyzed against a refolding buffer (0.55 M guanidine HCl, 0.44 M L-arginine, 50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 100 mM NDSB, 2 mM reduced glutathione, and 0.2 mM oxidized glutathione) and changed to a physiological buffer such as DMEM medium.

Example 4

Determination of Quantitative Cell-Permeability of Recombinant Proteins

[0089] For quantitative cell-permeability, recombinant SOCS3 proteins were conjugated to 5/6-fluorescein isothiocyanate (FITC) according to the manufacturer's instructions (Sigma-Aldrich, St. Louis, Mo.). RAW 264.7 cells were treated with 10 .mu.M FITC-labeled recombinant proteins for 1 hr at 37.degree. C., washed three times with cold PBS, and treated with proteinase K (10 .mu.g/mL) for 20 min at 37.degree. C. to remove cell-surface bound proteins. Cell-permeability of these recombinant proteins was analyzed by flow cytometry (Guava, Millipore, Darmstadt, Germany) using the FlowJo cytometric analysis software.

Example 5

Determination of Intracellular Localization of SOCS3 Recombinant Proteins

[0090] For visual cell permeability, NIH3T3 cells were cultured on coverslips in 24-well plates and with 10 .mu.M FITC-conjugated recombinant proteins for 1 hr at 37.degree. C. These cells on coverslips were washed with PBS, fixed with 4% formaldehyde for 10 min, and washed three times with PBS at room temperature. Coverslips were mounted with VECTASHIELD Mounting Medium (Vector laboratories, Burlingame, Calif.) with DAPI (4',6-diamidino-2-phenylindole) for nuclear staining. Intracellular localization of fluorescent signal was determined by confocal laser scanning microscopy (LM700, Zeiss, Germany).

Example 6

Determination of Tissue Distribution of Recombinant SOCS3 Proteins

[0091] ICR mice (6-week-old, female) were injected intraperitoneally (600 .mu.g/head) with either FITC only or FITC-conjugated SOCS3 recombinant proteins. After 2 hrs, the liver, kidney, spleen, lung, heart, and brain were isolated, washed with an O.C.T. compound (Sakura), and frozen on dry ice. Cryosections (20 .mu.m) were analyzed by fluorescence microscopy (Carl Zeiss, Gottingen, Germany).

Example 7

Mechanism of aMTD-Mediated Intracellular Delivery

[0092] RAW264.7 cells were pretreated with different agents to assess the effect of various conditions on protein uptake: (i) 5 .mu.g/ml proteinase K for 10 min, (ii) 20 .mu.M Taxol for 30 min, (iii) 10 .mu.M antimycin in the presence or absence of 1 mM ATP for 2 hrs, (iv) incubation on ice (or maintained at 37.degree. C.) for 60 min, and (v) 100 mM EDTA for 3 hrs. These agents were used at concentrations known to be active in other applications. The cells were then incubated with 10 .mu.M FITC-labeled proteins for 1 hr at 37.degree. C., washed three times with ice-cold phosphate-buffered saline, treated with proteinase K (10 .mu.g/ml for 5 min at 37.degree. C.) to remove cell-surface bound proteins, and analyzed by flow cytometry. To assess cell-to-cell protein transfer, RAW264.7 cells containing FITC-conjugated protein were prepared in the same way and mixed with untreated cells labeled with PreCP-Cy5.5-CD14 antibody for 2 hrs. Cell-to-cell protein transfer, resulting in FITC-Cy5.5 double-positive cells, was monitored by flow cytometry.

Example 8

STAT Phosphorylation: Western Blot Analysis

[0093] PANC-1 cells (Korean Cell Line Bank, Seoul, Korea) were cultured in modified Eagle's medium (DMEM; Welgene, Daege, Korea) supplemented with 10% (v/v) FBS, penicillin (100 units/ml), and streptomycin (10 g/ml, Gibco BRL) and pretreated with 10 M of SOCS3 recombinant proteins for 2 hrs followed by exposing the cells to agonists (100 ng/ml IFN-) for 15 min. Cells were lysed with RIPA lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 0.5% sodium deoxycholate, 10 mM NaF, and 2 mM Na3VO4) containing a protease inhibitor cocktail and then centrifuged at 13,000.times.g for 15 min at 4.degree. C. Equal amounts of lysates were resolved by SDS-PAGE, transferred onto PVDF membranes, and probed with phospho (pY701)-specific STAT1 (Cell Signaling, Danvers, Mass.).

Example 9

Cytokine Measurement: Cytometric Bead Array (CBA) Assay

[0094] Peritoneal macrophages were obtained from C3H/HeJ mice. Peritoneal macrophages were incubated with 10 .mu.M recombinant proteins (1:HS3, 2:HM165S3, 3:HM165S3A and 4:HM165S3B, respectively) for 1 hr at 37.degree. C. and then stimulated them with LPS (500 ng/ml) and/or IFN- (100 U/ml) without removing iCP-SOCS3 proteins for 3, 6, or 9 hrs. The culture media were collected, and the extracellular levels of cytokine were measured by a cytometric bead array (BD Biosciences, Pharmingen) according to the manufacturer's instructions.

Example 10

Cell Proliferation: CellTiter-Glo Cell Viability Assay

[0095] Cells originated from lung cancer and mouse fibroblast (NIH3T3) were purchased (ATCC, Manassas, Va.) and maintained as recommended by the supplier. These cells (3.times.103/well) were seeded in 96 well plates. The next day, cells were treated with DMEM (vehicle) or recombinant SOCS3 proteins for 96 hrs in the presence of serum (2%). Proteins were replaced daily. Cell growth and survival were evaluated with the CellTiter-Glo Cell Viability Assay (Promega, Madison, Wis.). Measurements using a Luminometer (Turner Designs, Sunnyvale, Calif.) were conducted following the manufacturer's protocol.

Example 11

Apoptosis: TUNEL Assay

[0096] Apoptotic cells were analyzed using terminal dUTP nick-end labeling (TUNEL) assay with In Situ Cell Death Detection kit TMR red (Roche, 4056 Basel, Switzerland). Cells were treated with either 10 .mu.M SOCS3 recombinant protein or buffer alone for 16 hrs with 2% fetal bovine serum. Treated cells were washed with cold PBS two times, fixed in 4% paraformaldehyde (PFA, Junsei, Tokyo, Japan) for 1 hr at room temperature, and incubated in 0.1% Triton X-100 for 2 min on the ice. Cells were washed with cold PBS twice, and treated TUNEL reaction mixture for 1 hr at 37.degree. C. in dark, washed cold PBS three times and observed by fluorescence microscopy (Nikon, Tokyo, Japan).

Example 12

Apoptosis: Annexin V/7-AAD Staining

[0097] Annexin V/7-Aminoactinomycin D (7-AAD) staining was performed using flow cytometry according to the manufacturer's guidelines. Briefly, 1.times.106 cells were washed three times with ice-cold PBS. The cells were then resuspended in 100 .mu.l of binding buffer and incubated with 1 .mu.l of 7-AAD and 1 .mu.l of annexin V-PE for 30 min in the dark at 37.degree. C. Flow cytometric analysis was immediately performed using a guava easyCyte.TM. 8 Instrument (Merck Millipore).

Example 13

Cell Migration: Wound-Healing Assay

[0098] Cells were seeded into 12-well plates, grown to 90% confluence, and incubated with 10 .mu.M HS3, HM16553, HM165S3A or HM165S3B in serum-free medium for 2 hrs prior to changing the growth medium. The cells were washed twice with PBS, and the monolayer at the center of the well was "wounded" by scraping with a pipette tip. Cells were cultured for an additional 48 hrs and cell migration was observed by phase contrast microscopy. The migration is quantified by counting the number of cells that migrated from the wound edge into the clear area.

Example 14

Transwell Migration Assay

[0099] The lower surface of Transwell inserts (Costar) was coated with gelatin (10 g/ml), and the membranes were allowed to dry for 1 hr at room temperature. The Transwell inserts were assembled into a 24-well plate, and the lower chamber was filled with growth media containing 10% FBS and FGF2 (10 g/ml). Cells (5.times.105) were added to each upper chamber, and the plate was incubated at 37.degree. C. in a 5% CO2 incubator for 24 hrs. Migrated cells were stained with 0.6% hematoxylin and 0.5% eosin and counted.

Example 15

Invasion Assay

[0100] The lower surface of Transwell inserts (Costar) was coated with gelatin (10 g/ml), the upper surface of Transwell inserts was coated with matrigel (40 g per well; BD Biosciences), and the membranes were allowed to dry for 1 hr at room temperature. The Transwell inserts were assembled into a 24-well plate, and the lower chamber was filled with growth media containing 10% FBS and FGF2 (10 g/ml). Cells (5.times.105) were added to each upper chamber, and the plate was incubated at 37.degree. C. in a 5% CO2 incubator for 24 hrs. Migrated cells were stained with 0.6% hematoxylin and 0.5% eosin and counted.

Example 16

Statistical Analysis

[0101] All data are presented as mean.+-.s.d. Differences between groups were tested for statistical significance using Student's t-test and were considered significant at p<0.05 or p<0.01.

[0102] It will be apparent to those skilled in the art that various modifications can be made to the above-described exemplary embodiments of the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention covers all such modifications provided that they come within the scope of the appended claims and their equivalents.

Sequence CWU 1

1

490112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 1Ala Ala Ala Leu Ala Pro Val Val Leu Ala Leu Pro1 5 10 212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 2Ala Ala Ala Val Pro Leu Leu Ala Val Val Val Pro1 5 10 312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 3Ala Ala Leu Leu Val Pro Ala Ala Val Leu Ala Pro1 5 10 412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 4Ala Leu Ala Leu Leu Pro Val Ala Ala Leu Ala Pro1 5 10 512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 5Ala Ala Ala Leu Leu Pro Val Ala Leu Val Ala Pro1 5 10 612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 6Val Val Ala Leu Ala Pro Ala Leu Ala Ala Leu Pro1 5 10 712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 7Leu Leu Ala Ala Val Pro Ala Val Leu Leu Ala Pro1 5 10 812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 8Ala Ala Ala Leu Val Pro Val Val Ala Leu Leu Pro1 5 10 912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 9Ala Val Ala Leu Leu Pro Ala Leu Leu Ala Val Pro1 5 10 1012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 10Ala Val Val Leu Val Pro Val Leu Ala Ala Ala Pro1 5 10 1112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 11Val Val Leu Val Leu Pro Ala Ala Ala Ala Val Pro1 5 10 1212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 12Ile Ala Leu Ala Ala Pro Ala Leu Ile Val Ala Pro1 5 10 1312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 13Ile Val Ala Val Ala Pro Ala Leu Val Ala Leu Pro1 5 10 1412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 14Val Ala Ala Leu Pro Val Val Ala Val Val Ala Pro1 5 10 1512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 15Leu Leu Ala Ala Pro Leu Val Val Ala Ala Val Pro1 5 10 1612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 16Ala Leu Ala Val Pro Val Ala Leu Leu Val Ala Pro1 5 10 1712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 17Val Ala Ala Leu Pro Val Leu Leu Ala Ala Leu Pro1 5 10 1812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 18Val Ala Leu Leu Ala Pro Val Ala Leu Ala Val Pro1 5 10 1912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 19Ala Ala Leu Leu Val Pro Ala Leu Val Ala Val Pro1 5 10 2012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 20Ala Ile Val Ala Leu Pro Val Ala Val Leu Ala Pro1 5 10 2112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 21Ile Ala Ile Val Ala Pro Val Val Ala Leu Ala Pro1 5 10 2212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 22Ala Ala Leu Leu Pro Ala Leu Ala Ala Leu Leu Pro1 5 10 2312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 23Ala Val Val Leu Ala Pro Val Ala Ala Val Leu Pro1 5 10 2412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 24Leu Ala Val Ala Ala Pro Leu Ala Leu Ala Leu Pro1 5 10 2512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 25Ala Ala Val Ala Ala Pro Leu Leu Leu Ala Leu Pro1 5 10 2612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 26Leu Leu Val Leu Pro Ala Ala Ala Leu Ala Ala Pro1 5 10 2712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 27Leu Val Ala Leu Ala Pro Val Ala Ala Val Leu Pro1 5 10 2812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 28Leu Ala Leu Ala Pro Ala Ala Leu Ala Leu Leu Pro1 5 10 2912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 29Ala Leu Ile Ala Ala Pro Ile Leu Ala Leu Ala Pro1 5 10 3012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 30Ala Val Val Ala Ala Pro Leu Val Leu Ala Leu Pro1 5 10 3112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 31Leu Leu Ala Leu Ala Pro Ala Ala Leu Leu Ala Pro1 5 10 3212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 32Ala Ile Val Ala Leu Pro Ala Leu Ala Leu Ala Pro1 5 10 3312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 33Ala Ala Ile Ile Val Pro Ala Ala Leu Leu Ala Pro1 5 10 3412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 34Ile Ala Val Ala Leu Pro Ala Leu Ile Ala Ala Pro1 5 10 3512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 35Ala Val Ile Val Leu Pro Ala Leu Ala Val Ala Pro1 5 10 3612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 36Ala Val Leu Ala Val Pro Ala Val Leu Val Ala Pro1 5 10 3712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 37Val Leu Ala Ile Val Pro Ala Val Ala Leu Ala Pro1 5 10 3812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 38Leu Leu Ala Val Val Pro Ala Val Ala Leu Ala Pro1 5 10 3912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 39Ala Val Ile Ala Leu Pro Ala Leu Ile Ala Ala Pro1 5 10 4012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 40Ala Val Val Ala Leu Pro Ala Ala Leu Ile Val Pro1 5 10 4112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 41Leu Ala Leu Val Leu Pro Ala Ala Leu Ala Ala Pro1 5 10 4212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 42Leu Ala Ala Val Leu Pro Ala Leu Leu Ala Ala Pro1 5 10 4312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 43Ala Leu Ala Val Pro Val Ala Leu Ala Ile Val Pro1 5 10 4412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 44Ala Leu Ile Ala Pro Val Val Ala Leu Val Ala Pro1 5 10 4512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 45Leu Leu Ala Ala Pro Val Val Ile Ala Leu Ala Pro1 5 10 4612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 46Leu Ala Ala Ile Val Pro Ala Ile Ile Ala Val Pro1 5 10 4712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 47Ala Ala Leu Val Leu Pro Leu Ile Ile Ala Ala Pro1 5 10 4812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 48Leu Ala Leu Ala Val Pro Ala Leu Ala Ala Leu Pro1 5 10 4912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 49Leu Ile Ala Ala Leu Pro Ala Val Ala Ala Leu Pro1 5 10 5012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 50Ala Leu Ala Leu Val Pro Ala Ile Ala Ala Leu Pro1 5 10 5112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 51Ala Ala Ile Leu Ala Pro Ile Val Ala Leu Ala Pro1 5 10 5212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 52Ala Leu Leu Ile Ala Pro Ala Ala Val Ile Ala Pro1 5 10 5312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 53Ala Ile Leu Ala Val Pro Ile Ala Val Val Ala Pro1 5 10 5412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 54Ile Leu Ala Ala Val Pro Ile Ala Leu Ala Ala Pro1 5 10 5512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 55Val Ala Ala Leu Leu Pro Ala Ala Ala Val Leu Pro1 5 10 5612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 56Ala Ala Ala Val Val Pro Val Leu Leu Val Ala Pro1 5 10 5712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 57Ala Ala Leu Leu Val Pro Ala Leu Val Ala Ala Pro1 5 10 5812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 58Ala Ala Val Leu Leu Pro Val Ala Leu Ala Ala Pro1 5 10 5912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 59Ala Ala Ala Leu Ala Pro Val Leu Ala Leu Val Pro1 5 10 6012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 60Leu Val Leu Val Pro Leu Leu Ala Ala Ala Ala Pro1 5 10 6112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 61Ala Leu Ile Ala Val Pro Ala Ile Ile Val Ala Pro1 5 10 6212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 62Ala Leu Ala Val Ile Pro Ala Ala Ala Ile Leu Pro1 5 10 6312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 63Leu Ala Ala Ala Pro Val Val Ile Val Ile Ala Pro1 5 10 6412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 64Val Leu Ala Ile Ala Pro Leu Leu Ala Ala Val Pro1 5 10 6512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 65Ala Leu Ile Val Leu Pro Ala Ala Val Ala Val Pro1 5 10 6612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 66Val Leu Ala Val Ala Pro Ala Leu Ile Val Ala Pro1 5 10 6712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 67Ala Ala Leu Leu Ala Pro Ala Leu Ile Val Ala Pro1 5 10 6812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 68Ala Leu Ile Ala Pro Ala Val Ala Leu Ile Val Pro1 5 10 6912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 69Ala Ile Val Leu Leu Pro Ala Ala Val Val Ala Pro1 5 10 7012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 70Val Ile Ala Ala Pro Val Leu Ala Val Leu Ala Pro1 5 10 7112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 71Leu Ala Leu Ala Pro Ala Leu Ala Leu Leu Ala Pro1 5 10 7212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 72Ala Ile Ile Leu Ala Pro Ile Ala Ala Ile Ala Pro1 5 10 7312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 73Ile Ala Leu Ala Ala Pro Ile Leu Leu Ala Ala Pro1 5 10 7412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 74Ile Val Ala Val Ala Leu Pro Ala Leu Ala Val Pro1 5 10 7512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 75Val Val Ala Ile Val Leu Pro Ala Leu Ala Ala Pro1 5 10 7612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 76Ile Val Ala Val Ala Leu Pro Val Ala Leu Ala Pro1 5 10 7712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 77Ile Val Ala Val Ala Leu Pro Ala Ala Leu Val Pro1 5 10 7812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 78Ile Val Ala Val Ala Leu Pro Ala Val Ala Leu Pro1 5 10 7912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 79Ile Val Ala Val Ala Leu Pro Ala Val Leu Ala Pro1 5 10 8012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 80Val Ile Val Ala Leu Ala Pro Ala

Val Leu Ala Pro1 5 10 8112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 81Ile Val Ala Val Ala Leu Pro Ala Leu Val Ala Pro1 5 10 8212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 82Ala Leu Leu Ile Val Ala Pro Val Ala Val Ala Pro1 5 10 8312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 83Ala Val Val Ile Val Ala Pro Ala Val Ile Ala Pro1 5 10 8412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 84Ala Val Leu Ala Val Ala Pro Ala Leu Ile Val Pro1 5 10 8512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 85Leu Val Ala Ala Val Ala Pro Ala Leu Ile Val Pro1 5 10 8612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 86Ala Val Ile Val Val Ala Pro Ala Leu Leu Ala Pro1 5 10 8712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 87Val Val Ala Ile Val Leu Pro Ala Val Ala Ala Pro1 5 10 8812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 88Ala Ala Ala Leu Val Ile Pro Ala Ile Leu Ala Pro1 5 10 8912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 89Val Ile Val Ala Leu Ala Pro Ala Leu Leu Ala Pro1 5 10 9012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 90Val Ile Val Ala Ile Ala Pro Ala Leu Leu Ala Pro1 5 10 9112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 91Ile Val Ala Ile Ala Val Pro Ala Leu Val Ala Pro1 5 10 9212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 92Ala Ala Leu Ala Val Ile Pro Ala Ala Ile Leu Pro1 5 10 9312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 93Ala Leu Ala Ala Val Ile Pro Ala Ala Ile Leu Pro1 5 10 9412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 94Ala Ala Ala Leu Val Ile Pro Ala Ala Ile Leu Pro1 5 10 9512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 95Leu Ala Ala Ala Val Ile Pro Ala Ala Ile Leu Pro1 5 10 9612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 96Leu Ala Ala Ala Val Ile Pro Val Ala Ile Leu Pro1 5 10 9712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 97Ala Ala Ile Leu Ala Ala Pro Leu Ile Ala Val Pro1 5 10 9812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 98Val Val Ala Ile Leu Ala Pro Leu Leu Ala Ala Pro1 5 10 9912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 99Ala Val Val Val Ala Ala Pro Val Leu Ala Leu Pro1 5 10 10012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 100Ala Val Val Ala Ile Ala Pro Val Leu Ala Leu Pro1 5 10 10112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 101Ala Leu Ala Ala Leu Val Pro Ala Val Leu Val Pro1 5 10 10212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 102Ala Leu Ala Ala Leu Val Pro Val Ala Leu Val Pro1 5 10 10312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 103Leu Ala Ala Ala Leu Val Pro Val Ala Leu Val Pro1 5 10 10412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 104Ala Leu Ala Ala Leu Val Pro Ala Leu Val Val Pro1 5 10 10512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 105Ile Ala Ala Val Ile Val Pro Ala Val Ala Leu Pro1 5 10 10612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 106Ile Ala Ala Val Leu Val Pro Ala Val Ala Leu Pro1 5 10 10712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 107Ala Val Ala Ile Leu Val Pro Leu Leu Ala Ala Pro1 5 10 10812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 108Ala Val Val Ile Leu Val Pro Leu Ala Ala Ala Pro1 5 10 10912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 109Ile Ala Ala Val Ile Val Pro Val Ala Ala Leu Pro1 5 10 11012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 110Ala Ile Ala Ile Ala Ile Val Pro Val Ala Leu Pro1 5 10 11112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 111Ile Leu Ala Val Ala Ala Ile Pro Val Ala Val Pro1 5 10 11212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 112Ile Leu Ala Ala Ala Ile Ile Pro Ala Ala Leu Pro1 5 10 11312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 113Leu Ala Val Val Leu Ala Ala Pro Ala Ile Val Pro1 5 10 11412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 114Ala Ile Leu Ala Ala Ile Val Pro Leu Ala Val Pro1 5 10 11512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 115Val Ile Val Ala Leu Ala Val Pro Ala Leu Ala Pro1 5 10 11612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 116Ala Ile Val Ala Leu Ala Val Pro Val Leu Ala Pro1 5 10 11712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 117Ala Ala Ile Ile Ile Val Leu Pro Ala Ala Leu Pro1 5 10 11812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 118Leu Ile Val Ala Leu Ala Val Pro Ala Leu Ala Pro1 5 10 11912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 119Ala Ile Ile Ile Val Ile Ala Pro Ala Ala Ala Pro1 5 10 12012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 120Leu Ala Ala Leu Ile Val Val Pro Ala Val Ala Pro1 5 10 12112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 121Ala Leu Leu Val Ile Ala Val Pro Ala Val Ala Pro1 5 10 12212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 122Ala Val Ala Leu Ile Val Val Pro Ala Leu Ala Pro1 5 10 12312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 123Ala Leu Ala Ile Val Val Ala Pro Val Ala Val Pro1 5 10 12412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 124Leu Leu Ala Leu Ile Ile Ala Pro Ala Ala Ala Pro1 5 10 12512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 125Ala Leu Ala Leu Ile Ile Val Pro Ala Val Ala Pro1 5 10 12612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 126Leu Leu Ala Ala Leu Ile Ala Pro Ala Ala Leu Pro1 5 10 12712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 127Ile Val Ala Leu Ile Val Ala Pro Ala Ala Val Pro1 5 10 12812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 128Val Val Leu Val Leu Ala Ala Pro Ala Ala Val Pro1 5 10 12912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 129Ala Ala Val Ala Ile Val Leu Pro Ala Val Val Pro1 5 10 13012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 130Ala Leu Ile Ala Ala Ile Val Pro Ala Leu Val Pro1 5 10 13112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 131Ala Leu Ala Val Ile Val Val Pro Ala Leu Ala Pro1 5 10 13212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 132Val Ala Ile Ala Leu Ile Val Pro Ala Leu Ala Pro1 5 10 13312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 133Val Ala Ile Val Leu Val Ala Pro Ala Val Ala Pro1 5 10 13412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 134Val Ala Val Ala Leu Ile Val Pro Ala Leu Ala Pro1 5 10 13512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 135Ala Val Ile Leu Ala Leu Ala Pro Ile Val Ala Pro1 5 10 13612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 136Ala Leu Ile Val Ala Ile Ala Pro Ala Leu Val Pro1 5 10 13712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 137Ala Ala Ile Leu Ile Ala Val Pro Ile Ala Ala Pro1 5 10 13812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 138Val Ile Val Ala Leu Ala Ala Pro Val Leu Ala Pro1 5 10 13912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 139Val Leu Val Ala Leu Ala Ala Pro Val Ile Ala Pro1 5 10 14012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 140Val Ala Leu Ile Ala Val Ala Pro Ala Val Val Pro1 5 10 14112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 141Val Ile Ala Ala Val Leu Ala Pro Val Ala Val Pro1 5 10 14212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 142Ala Leu Ile Val Leu Ala Ala Pro Val Ala Val Pro1 5 10 14312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 143Val Ala Ala Ala Ile Ala Leu Pro Ala Ile Val Pro1 5 10 14412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 144Ile Leu Ala Ala Ala Ala Ala Pro Leu Ile Val Pro1 5 10 14512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 145Leu Ala Leu Val Leu Ala Ala Pro Ala Ile Val Pro1 5 10 14612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 146Ala Leu Ala Val Val Ala Leu Pro Ala Ile Val Pro1 5 10 14712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 147Ala Ala Ile Leu Ala Pro Ile Val Ala Ala Leu Pro1 5 10 14812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 148Ile Leu Ile Ala Ile Ala Ile Pro Ala Ala Ala Pro1 5 10 14912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 149Leu Ala Ile Val Leu Ala Ala Pro Val Ala Val Pro1 5 10 15012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 150Ala Ala Ile Ala Ile Ile Ala Pro Ala Ile Val Pro1 5 10 15112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 151Leu Ala Val Ala Ile Val Ala Pro Ala Leu Val Pro1 5 10 15212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 152Leu Ala Ile Val Leu Ala Ala Pro Ala Val Leu Pro1 5 10 15312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 153Ala Ala Ile Val Leu Ala Leu Pro Ala Val Leu Pro1 5 10 15412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 154Ala Leu Leu Val Ala Val Leu Pro Ala Ala Leu Pro1 5 10 15512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 155Ala Ala Leu Val Ala Val Leu Pro Val Ala Leu Pro1 5 10 15612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 156Ala Ile Leu Ala Val Ala Leu Pro Leu Leu Ala Pro1 5 10 15712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 157Ile Val Ala Val Ala Leu Val Pro Ala Leu Ala Pro1 5 10 15812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 158Ile Val Ala Val Ala Leu Leu Pro Ala Leu Ala Pro1 5 10 15912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain

(aMTD) Sequences for Improvement of Cell-Permeability 159Ile Val Ala Val Ala Leu Leu Pro Ala Val Ala Pro1 5 10 16012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 160Ile Val Ala Leu Ala Val Leu Pro Ala Val Ala Pro1 5 10 16112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 161Val Ala Val Leu Ala Val Leu Pro Ala Leu Ala Pro1 5 10 16212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 162Ile Ala Val Leu Ala Val Ala Pro Ala Val Leu Pro1 5 10 16312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 163Leu Ala Val Ala Ile Ile Ala Pro Ala Val Ala Pro1 5 10 16412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 164Val Ala Leu Ala Ile Ala Leu Pro Ala Val Leu Pro1 5 10 16512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 165Ala Ile Ala Ile Ala Leu Val Pro Val Ala Leu Pro1 5 10 16612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 166Ala Ala Val Val Ile Val Ala Pro Val Ala Leu Pro1 5 10 16712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 167Val Ala Ile Ile Val Val Ala Pro Ala Leu Ala Pro1 5 10 16812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 168Val Ala Leu Leu Ala Ile Ala Pro Ala Leu Ala Pro1 5 10 16912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 169Val Ala Val Leu Ile Ala Val Pro Ala Leu Ala Pro1 5 10 17012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 170Ala Val Ala Leu Ala Val Leu Pro Ala Val Val Pro1 5 10 17112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 171Ala Val Ala Leu Ala Val Val Pro Ala Val Leu Pro1 5 10 17212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 172Ile Val Val Ile Ala Val Ala Pro Ala Val Ala Pro1 5 10 17312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 173Ile Val Val Ala Ala Val Val Pro Ala Leu Ala Pro1 5 10 17412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 174Ile Val Ala Leu Val Pro Ala Val Ala Ile Ala Pro1 5 10 17512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 175Val Ala Ala Leu Pro Ala Val Ala Leu Val Val Pro1 5 10 17612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 176Leu Val Ala Ile Ala Pro Leu Ala Val Leu Ala Pro1 5 10 17712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 177Ala Val Ala Leu Val Pro Val Ile Val Ala Ala Pro1 5 10 17812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 178Ala Ile Ala Val Ala Ile Ala Pro Val Ala Leu Pro1 5 10 17912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 179Ala Ile Ala Leu Ala Val Pro Val Leu Ala Leu Pro1 5 10 18012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 180Leu Val Leu Ile Ala Ala Ala Pro Ile Ala Leu Pro1 5 10 18112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 181Leu Val Ala Leu Ala Val Pro Ala Ala Val Leu Pro1 5 10 18212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 182Ala Val Ala Leu Ala Val Pro Ala Leu Val Leu Pro1 5 10 18312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 183Leu Val Val Leu Ala Ala Ala Pro Leu Ala Val Pro1 5 10 18412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 184Leu Ile Val Leu Ala Ala Pro Ala Leu Ala Ala Pro1 5 10 18512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 185Val Ile Val Leu Ala Ala Pro Ala Leu Ala Ala Pro1 5 10 18612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 186Ala Val Val Leu Ala Val Pro Ala Leu Ala Val Pro1 5 10 18712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 187Leu Ile Ile Val Ala Ala Ala Pro Ala Val Ala Pro1 5 10 18812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 188Ile Val Ala Val Ile Val Ala Pro Ala Val Ala Pro1 5 10 18912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 189Leu Val Ala Leu Ala Ala Pro Ile Ile Ala Val Pro1 5 10 19012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 190Ile Ala Ala Val Leu Ala Ala Pro Ala Leu Val Pro1 5 10 19112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 191Ile Ala Leu Leu Ala Ala Pro Ile Ile Ala Val Pro1 5 10 19212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 192Ala Ala Leu Ala Leu Val Ala Pro Val Ile Val Pro1 5 10 19312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 193Ile Ala Leu Val Ala Ala Pro Val Ala Leu Val Pro1 5 10 19412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 194Ile Ile Val Ala Val Ala Pro Ala Ala Ile Val Pro1 5 10 19512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 195Ala Val Ala Ala Ile Val Pro Val Ile Val Ala Pro1 5 10 19612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 196Ala Val Leu Val Leu Val Ala Pro Ala Ala Ala Pro1 5 10 19712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 197Val Val Ala Leu Leu Ala Pro Leu Ile Ala Ala Pro1 5 10 19812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 198Ala Ala Val Val Ile Ala Pro Leu Leu Ala Val Pro1 5 10 19912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 199Ile Ala Val Ala Val Ala Ala Pro Leu Leu Val Pro1 5 10 20012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 200Leu Val Ala Ile Val Val Leu Pro Ala Val Ala Pro1 5 10 20112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 201Ala Val Ala Ile Val Val Leu Pro Ala Val Ala Pro1 5 10 20212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 202Ala Val Ile Leu Leu Ala Pro Leu Ile Ala Ala Pro1 5 10 20312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 203Leu Val Ile Ala Leu Ala Ala Pro Val Ala Leu Pro1 5 10 20412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 204Val Leu Ala Val Val Leu Pro Ala Val Ala Leu Pro1 5 10 20512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 205Val Leu Ala Val Ala Ala Pro Ala Val Leu Leu Pro1 5 10 20612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 206Ala Ala Val Val Leu Leu Pro Ile Ile Ala Ala Pro1 5 10 20712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 207Ala Leu Leu Val Ile Ala Pro Ala Ile Ala Val Pro1 5 10 20812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 208Ala Val Leu Val Ile Ala Val Pro Ala Ile Ala Pro1 5 10 20912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 209Ala Leu Leu Val Val Ile Ala Pro Leu Ala Ala Pro1 5 10 21012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 210Val Leu Val Ala Ala Ile Leu Pro Ala Ala Ile Pro1 5 10 21112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 211Val Leu Val Ala Ala Val Leu Pro Ile Ala Ala Pro1 5 10 21212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 212Val Leu Ala Ala Ala Val Leu Pro Leu Val Val Pro1 5 10 21312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 213Ala Ile Ala Ile Val Val Pro Ala Val Ala Val Pro1 5 10 21412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 214Val Ala Ile Ile Ala Val Pro Ala Val Val Ala Pro1 5 10 21512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 215Ile Val Ala Leu Val Ala Pro Ala Ala Val Val Pro1 5 10 21612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 216Ala Ala Ile Val Leu Leu Pro Ala Val Val Val Pro1 5 10 21712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 217Ala Ala Leu Ile Val Val Pro Ala Val Ala Val Pro1 5 10 21812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 218Ala Ile Ala Leu Val Val Pro Ala Val Ala Val Pro1 5 10 21912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 219Leu Ala Ile Val Pro Ala Ala Ile Ala Ala Leu Pro1 5 10 22012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 220Leu Val Ala Ile Ala Pro Ala Val Ala Val Leu Pro1 5 10 22112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 221Val Leu Ala Val Ala Pro Ala Val Ala Val Leu Pro1 5 10 22212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 222Ile Leu Ala Val Val Ala Ile Pro Ala Ala Ala Pro1 5 10 22312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 223Ile Leu Val Ala Ala Ala Pro Ile Ala Ala Leu Pro1 5 10 22412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 224Ile Leu Ala Val Ala Ala Ile Pro Ala Ala Leu Pro1 5 10 22512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 225Val Ile Ala Ile Pro Ala Ile Leu Ala Ala Ala Pro1 5 10 22612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 226Ala Ile Ile Ile Val Val Pro Ala Ile Ala Ala Pro1 5 10 22712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 227Ala Ile Leu Ile Val Val Ala Pro Ile Ala Ala Pro1 5 10 22812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 228Ala Val Ile Val Pro Val Ala Ile Ile Ala Ala Pro1 5 10 22912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 229Ala Val Val Ile Ala Leu Pro Ala Val Val Ala Pro1 5 10 23012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 230Ala Leu Val Ala Val Ile Ala Pro Val Val Ala Pro1 5 10 23112PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 231Ala Leu Val Ala Val Leu Pro Ala Val Ala Val Pro1 5 10 23212PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 232Ala Leu Val Ala Pro Leu Leu Ala Val Ala Val Pro1 5 10 23312PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 233Ala Val Leu Ala Val Val Ala Pro Val Val Ala Pro1 5 10 23412PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 234Ala Val Ile Ala Val Ala Pro Leu Val Val Ala Pro1 5 10 23512PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 235Ala Val Ile Ala Leu Ala Pro Val Val Val Ala Pro1 5 10 23612PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 236Val Ala Ile Ala Leu Ala Pro Val Val Val Ala Pro1 5 10 23712PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 237Val Ala Leu Ala Leu Ala Pro Val Val Val Ala Pro1

5 10 23812PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 238Val Ala Ala Leu Leu Pro Ala Val Val Val Ala Pro1 5 10 23912PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 239Val Ala Leu Ala Leu Pro Ala Val Val Val Ala Pro1 5 10 24012PRTArtificial SequenceAdvanced Macromolecule Transduction Domain (aMTD) Sequences for Improvement of Cell-Permeability 240Val Ala Leu Leu Ala Pro Ala Val Val Val Ala Pro1 5 10 24136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 241gcggcggcgc tggcgccggt ggtgctggcg ctgccg 3624236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 242gcggcggcgg tgccgctgct ggcggtggtg gtgccg 3624336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 243gcggcgctgc tggtgccggc ggcggtgctg gcgccg 3624436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 244gcgctggcgc tgctgccggt ggcggcgctg gcgccg 3624536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 245gcggcggcgc tgctgccggt ggcgctggtg gcgccg 3624636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 246gtggtggcgc tggcgccggc gctggcggcg ctgccg 3624736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 247ctgctggcgg cggtgccggc ggtgctgctg gcgccg 3624836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 248gcggcggcgc tggtgccggt ggtggcgctg ctgccg 3624936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 249gcggtggcgc tgctgccggc gctgctggcg gtgccg 3625036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 250gcggtggtgc tggtgccggt gctggcggcg gcgccg 3625136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 251gtggtgctgg tgctgccggc ggcggcggcg gtgccg 3625236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 252attgcgctgg cggcgccggc gctgattgtg gcgccg 3625336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 253attgtggcgg tggcgccggc gctggtggcg ctgccg 3625436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 254gtggcggcgc tgccggtggt ggcggtggtg gcgccg 3625536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 255ctgctggcgg cgccgctggt ggtggcggcg gtgccg 3625636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 256gcgctggcgg tgccggtggc gctgctggtg gcgccg 3625736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 257gtggcggcgc tgccggtgct gctggcggcg ctgccg 3625836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 258gtggcgctgc tggcgccggt ggcgctggcg gtgccg 3625936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 259gcggcgctgc tggtgccggc gctggtggcg gtgccg 3626036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 260gcgattgtgg cgctgccggt ggcggtgctg gcgccg 3626136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 261attgcgattg tggcgccggt ggtggcgctg gcgccg 3626236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 262gcggcgctgc tgccggcgct ggcggcgctg ctgccg 3626336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 263gcggtggtgc tggcgccggt ggcggcggtg ctgccg 3626436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 264ctggcggtgg cggcgccgct ggcgctggcg ctgccg 3626536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 265gcggcggtgg cggcgccgct gctgctggcg ctgccg 3626636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 266ctgctggtgc tgccggcggc ggcgctggcg gcgccg 3626736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 267ctggtggcgg tggcgccggt ggcggcggtg ctgccg 3626836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 268ctggcgctgg cgccggcggc gctggcgctg ctgccg 3626936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 269gcgctgattg cggcgccgat tctggcgctg gcgccg 3627036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 270gcggtggtgg cggcgccgct ggtgctggcg ctgccg 3627136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 271ctgctggcgc tggcgccggc ggcgctgctg gcgccg 3627236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 272gcgattgtgg cgctgccggc gctggcgctg gcgccg 3627336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 273gcggcgatta ttgtgccggc ggcgctgctg gcgccg 3627436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 274attgcggtgg cgctgccggc gctgattgcg gcgccg 3627536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 275gcggtgattg tgctgccggc gctggcggtg gcgccg 3627636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 276gcggtgctgg cggtgccggc ggtgctggtg gcgccg 3627736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 277gtgctggcga ttgtgccggc ggtggcgctg gcgccg 3627836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 278ctgctggcgg tggtgccggc ggtggcgctg gcgccg 3627936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 279gcggtgattg cgctgccggc gctgattgcg gcgccg 3628036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 280gcggtggtgg cgctgccggc ggcgctgatt gtgccg 3628136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 281ctggcgctgg tgctgccggc ggcgctggcg gcgccg 3628236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 282ctggcggcgg tgctgccggc gctgctggcg gcgccg 3628336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 283gcgctggcgg tgccggtggc gctggcgatt gtgccg 3628436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 284gcgctgattg cgccggtggt ggcgctggtg gcgccg 3628536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 285ctgctggcgg cgccggtggt gattgcgctg gcgccg 3628636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 286ctggcggcga ttgtgccggc gattattgcg gtgccg 3628736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 287gcggcgctgg tgctgccgct gattattgcg gcgccg 3628836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 288ctggcgctgg cggtgccggc gctggcggcg ctgccg 3628936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 289ctgattgcgg cgctgccggc ggtggcggcg ctgccg 3629036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 290gcgctggcgc tggtgccggc gattgcggcg ctgccg 3629136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 291gcggcgattc tggcgccgat tgtggcgctg gcgccg 3629236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 292gcgctgctga ttgcgccggc ggcggtgatt gcgccg 3629336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 293gcgattctgg cggtgccgat tgcggtggtg gcgccg 3629436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 294attctggcgg cggtgccgat tgcgctggcg gcgccg 3629536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 295gtggcggcgc tgctgccggc ggcggcggtg ctgccg 3629636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 296gcggcggcgg tggtgccggt gctgctggtg gcgccg 3629736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 297gcggcgctgc tggtgccggc gctggtggcg gcgccg 3629836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 298gcggcggtgc tgctgccggt ggcgctggcg gcgccg 3629936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 299gcggcggcgc tggcgccggt gctggcgctg gtgccg 3630036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 300ctggtgctgg tgccgctgct ggcggcggcg gcgccg 3630136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 301gcgctgattg cggtgccggc gattattgtg gcgccg 3630236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 302gcgctggcgg tgattccggc ggcggcgatt ctgccg 3630336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 303ctggcggcgg cgccggtggt gattgtgatt gcgccg 3630436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 304gtgctggcga ttgcgccgct gctggcggcg gtgccg 3630536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 305gcgctgattg tgctgccggc ggcggtggcg gtgccg 3630636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 306gtgctggcgg

tggcgccggc gctgattgtg gcgccg 3630736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 307gcggcgctgc tggcgccggc gctgattgtg gcgccg 3630836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 308gcgctgattg cgccggcggt ggcgctgatt gtgccg 3630936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 309gcgattgtgc tgctgccggc ggcggtggtg gcgccg 3631036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 310gtgattgcgg cgccggtgct ggcggtgctg gcgccg 3631136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 311ctggcgctgg cgccggcgct ggcgctgctg gcgccg 3631236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 312gcgattattc tggcgccgat tgcggcgatt gcgccg 3631336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 313attgcgctgg cggcgccgat tctgctggcg gcgccg 3631436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 314attgtggcgg tggcgctgcc ggcgctggcg gtgccg 3631536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 315gtggtggcga ttgtgctgcc ggcgctggcg gcgccg 3631636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 316attgtggcgg tggcgctgcc ggtggcgctg gcgccg 3631736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 317attgtggcgg tggcgctgcc ggcggcgctg gtgccg 3631836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 318attgtggcgg tggcgctgcc ggcggtggcg ctgccg 3631936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 319attgtggcgg tggcgctgcc ggcggtgctg gcgccg 3632036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 320gtgattgtgg cgctggcgcc ggcggtgctg gcgccg 3632136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 321attgtggcgg tggcgctgcc ggcgctggtg gcgccg 3632236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 322gcgctgctga ttgtggcgcc ggtggcggtg gcgccg 3632336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 323gcggtggtga ttgtggcgcc ggcggtgatt gcgccg 3632436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 324gcggtgctgg cggtggcgcc ggcgctgatt gtgccg 3632536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 325ctggtggcgg cggtggcgcc ggcgctgatt gtgccg 3632636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 326gcggtgattg tggtggcgcc ggcgctgctg gcgccg 3632736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 327gtggtggcga ttgtgctgcc ggcggtggcg gcgccg 3632836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 328gcggcggcgc tggtgattcc ggcgattctg gcgccg 3632936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 329gtgattgtgg cgctggcgcc ggcgctgctg gcgccg 3633036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 330gtgattgtgg cgattgcgcc ggcgctgctg gcgccg 3633136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 331attgtggcga ttgcggtgcc ggcgctggtg gcgccg 3633236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 332gcggcgctgg cggtgattcc ggcggcgatt ctgccg 3633336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 333gcgctggcgg cggtgattcc ggcggcgatt ctgccg 3633436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 334gcggcggcgc tggtgattcc ggcggcgatt ctgccg 3633536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 335ctggcggcgg cggtgattcc ggcggcgatt ctgccg 3633636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 336ctggcggcgg cggtgattcc ggtggcgatt ctgccg 3633736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 337gcggcgattc tggcggcgcc gctgattgcg gtgccg 3633836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 338gtggtggcga ttctggcgcc gctgctggcg gcgccg 3633936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 339gcggtggtgg tggcggcgcc ggtgctggcg ctgccg 3634036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 340gcggtggtgg cgattgcgcc ggtgctggcg ctgccg 3634136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 341gcgctggcgg cgctggtgcc ggcggtgctg gtgccg 3634236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 342gcgctggcgg cgctggtgcc ggtggcgctg gtgccg 3634336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 343ctggcggcgg cgctggtgcc ggtggcgctg gtgccg 3634436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 344gcgctggcgg cgctggtgcc ggcgctggtg gtgccg 3634536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 345attgcggcgg tgattgtgcc ggcggtggcg ctgccg 3634636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 346attgcggcgg tgctggtgcc ggcggtggcg ctgccg 3634736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 347gcggtggcga ttctggtgcc gctgctggcg gcgccg 3634836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 348gcggtggtga ttctggtgcc gctggcggcg gcgccg 3634936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 349attgcggcgg tgattgtgcc ggtggcggcg ctgccg 3635036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 350gcgattgcga ttgcgattgt gccggtggcg ctgccg 3635136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 351attctggcgg tggcggcgat tccggtggcg gtgccg 3635236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 352attctggcgg cggcgattat tccggcggcg ctgccg 3635336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 353ctggcggtgg tgctggcggc gccggcgatt gtgccg 3635436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 354gcgattctgg cggcgattgt gccgctggcg gtgccg 3635536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 355gtgattgtgg cgctggcggt gccggcgctg gcgccg 3635636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 356gcgattgtgg cgctggcggt gccggtgctg gcgccg 3635736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 357gcggcgatta ttattgtgct gccggcggcg ctgccg 3635836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 358ctgattgtgg cgctggcggt gccggcgctg gcgccg 3635936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 359gcgattatta ttgtgattgc gccggcggcg gcgccg 3636036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 360ctggcggcgc tgattgtggt gccggcggtg gcgccg 3636136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 361gcgctgctgg tgattgcggt gccggcggtg gcgccg 3636236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 362gcggtggcgc tgattgtggt gccggcgctg gcgccg 3636336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 363gcgctggcga ttgtggtggc gccggtggcg gtgccg 3636436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 364ctgctggcgc tgattattgc gccggcggcg gcgccg 3636536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 365gcgctggcgc tgattattgt gccggcggtg gcgccg 3636636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 366ctgctggcgg cgctgattgc gccggcggcg ctgccg 3636736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 367attgtggcgc tgattgtggc gccggcggcg gtgccg 3636836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 368gtggtgctgg tgctggcggc gccggcggcg gtgccg 3636936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 369gcggcggtgg cgattgtgct gccggcggtg gtgccg 3637036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 370gcgctgattg cggcgattgt gccggcgctg gtgccg 3637136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 371gcgctggcgg tgattgtggt gccggcgctg gcgccg 3637236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 372gtggcgattg cgctgattgt gccggcgctg gcgccg 3637336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 373gtggcgattg tgctggtggc gccggcggtg gcgccg 3637436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 374gtggcggtgg cgctgattgt gccggcgctg gcgccg 3637536DNAArtificial SequenceThe polynucleotide sequence

that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 375gcggtgattc tggcgctggc gccgattgtg gcgccg 3637636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 376gcgctgattg tggcgattgc gccggcgctg gtgccg 3637736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 377gcggcgattc tgattgcggt gccgattgcg gcgccg 3637836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 378gtgattgtgg cgctggcggc gccggtgctg gcgccg 3637936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 379gtgctggtgg cgctggcggc gccggtgatt gcgccg 3638036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 380gtggcgctga ttgcggtggc gccggcggtg gtgccg 3638136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 381gtgattgcgg cggtgctggc gccggtggcg gtgccg 3638236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 382gcgctgattg tgctggcggc gccggtggcg gtgccg 3638336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 383gtggcggcgg cgattgcgct gccggcgatt gtgccg 3638436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 384attctggcgg cggcggcggc gccgctgatt gtgccg 3638536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 385ctggcgctgg tgctggcggc gccggcgatt gtgccg 3638636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 386gcgctggcgg tggtggcgct gccggcgatt gtgccg 3638736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 387gcggcgattc tggcgccgat tgtggcggcg ctgccg 3638836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 388attctgattg cgattgcgat tccggcggcg gcgccg 3638936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 389ctggcgattg tgctggcggc gccggtggcg gtgccg 3639036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 390gcggcgattg cgattattgc gccggcgatt gtgccg 3639136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 391ctggcggtgg cgattgtggc gccggcgctg gtgccg 3639236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 392ctggcgattg tgctggcggc gccggcggtg ctgccg 3639336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 393gcggcgattg tgctggcgct gccggcggtg ctgccg 3639436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 394gcgctgctgg tggcggtgct gccggcggcg ctgccg 3639536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 395gcggcgctgg tggcggtgct gccggtggcg ctgccg 3639636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 396gcgattctgg cggtggcgct gccgctgctg gcgccg 3639736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 397attgtggcgg tggcgctggt gccggcgctg gcgccg 3639836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 398attgtggcgg tggcgctgct gccggcgctg gcgccg 3639936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 399attgtggcgg tggcgctgct gccggcggtg gcgccg 3640036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 400attgtggcgc tggcggtgct gccggcggtg gcgccg 3640136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 401gtggcggtgc tggcggtgct gccggcgctg gcgccg 3640236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 402attgcggtgc tggcggtggc gccggcggtg ctgccg 3640336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 403ctggcggtgg cgattattgc gccggcggtg gcgccg 3640436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 404gtggcgctgg cgattgcgct gccggcggtg ctgccg 3640536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 405gcgattgcga ttgcgctggt gccggtggcg ctgccg 3640636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 406gcggcggtgg tgattgtggc gccggtggcg ctgccg 3640736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 407gcggcgattc tggcgattgt ggcgccgctg gcgccg 3640836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 408gtggcgctgc tggcgattgc gccggcgctg gcgccg 3640936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 409gtggcggtgc tgattgcggt gccggcgctg gcgccg 3641036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 410gcggtggcgc tggcggtgct gccggcggtg gtgccg 3641136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 411gcggtggcgc tggcggtggt gccggcggtg ctgccg 3641236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 412attgtggtga ttgcggtggc gccggcggtg gcgccg 3641336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 413attgtggtgg cggcggtggt gccggcgctg gcgccg 3641436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 414attgtggcgc tggtgccggc ggtggcgatt gcgccg 3641536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 415gtggcggcgc tgccggcggt ggcgctggtg gtgccg 3641636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 416ctggtggcga ttgcgccgct ggcggtgctg gcgccg 3641736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 417gcggtggcgc tggtgccggt gattgtggcg gcgccg 3641836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 418gcgattgcgg tggcgattgc gccggtggcg ctgccg 3641936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 419gcgattgcgc tggcggtgcc ggtgctggcg ctgccg 3642036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 420ctggtgctga ttgcggcggc gccgattgcg ctgccg 3642136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 421ctggtggcgc tggcggtgcc ggcggcggtg ctgccg 3642236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 422gcggtggcgc tggcggtgcc ggcgctggtg ctgccg 3642336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 423ctggtggtgc tggcggcggc gccgctggcg gtgccg 3642436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 424ctgattgtgc tggcggcgcc ggcgctggcg gcgccg 3642536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 425gtgattgtgc tggcggcgcc ggcgctggcg gcgccg 3642636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 426gcggtggtgc tggcggtgcc ggcgctggcg gtgccg 3642736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 427ctgattattg tggcggcggc gccggcggtg gcgccg 3642836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 428attgtggcgg tgattgtggc gccggcggtg gcgccg 3642936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 429ctggtggcgc tggcggcgcc gattattgcg gtgccg 3643036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 430attgcggcgg tgctggcggc gccggcgctg gtgccg 3643136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 431attgcgctgc tggcggcgcc gattattgcg gtgccg 3643236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 432gcggcgctgg cgctggtggc gccggtgatt gtgccg 3643336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 433attgcgctgg tggcggcgcc ggtggcgctg gtgccg 3643436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 434attattgtgg cggtggcgcc ggcggcgatt gtgccg 3643536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 435gcggtggcgg cgattgtgcc ggtgattgtg gcgccg 3643636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 436gcggtgctgg tgctggtggc gccggcggcg gcgccg 3643736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 437gtggtggcgc tgctggcgcc gctgattgcg gcgccg 3643836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 438gcggcggtgg tgattgcgcc gctgctggcg gtgccg 3643936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 439attgcggtgg cggtggcggc gccgctgctg gtgccg 3644036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 440ctggtggcga ttgtggtgct gccggcggtg gcgccg 3644136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 441gcggtggcga ttgtggtgct gccggcggtg gcgccg 3644236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 442gcggtgattc tgctggcgcc gctgattgcg gcgccg 3644336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of

Cell-Permeability 443ctggtgattg cgctggcggc gccggtggcg ctgccg 3644436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 444gtgctggcgg tggtgctgcc ggcggtggcg ctgccg 3644536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 445gtgctggcgg tggcggcgcc ggcggtgctg ctgccg 3644636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 446gcggcggtgg tgctgctgcc gattattgcg gcgccg 3644736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 447gcgctgctgg tgattgcgcc ggcgattgcg gtgccg 3644836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 448gcggtgctgg tgattgcggt gccggcgatt gcgccg 3644936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 449gcgctgctgg tggtgattgc gccgctggcg gcgccg 3645036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 450gtgctggtgg cggcgattct gccggcggcg attccg 3645136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 451gtgctggtgg cggcggtgct gccgattgcg gcgccg 3645236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 452gtgctggcgg cggcggtgct gccgctggtg gtgccg 3645336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 453gcgattgcga ttgtggtgcc ggcggtggcg gtgccg 3645436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 454gtggcgatta ttgcggtgcc ggcggtggtg gcgccg 3645536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 455attgtggcgc tggtggcgcc ggcggcggtg gtgccg 3645636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 456gcggcgattg tgctgctgcc ggcggtggtg gtgccg 3645736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 457gcggcgctga ttgtggtgcc ggcggtggcg gtgccg 3645836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 458gcgattgcgc tggtggtgcc ggcggtggcg gtgccg 3645936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 459ctggcgattg tgccggcggc gattgcggcg ctgccg 3646036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 460ctggtggcga ttgcgccggc ggtggcggtg ctgccg 3646136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 461gtgctggcgg tggcgccggc ggtggcggtg ctgccg 3646236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 462attctggcgg tggtggcgat tccggcggcg gcgccg 3646336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 463attctggtgg cggcggcgcc gattgcggcg ctgccg 3646436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 464attctggcgg tggcggcgat tccggcggcg ctgccg 3646536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 465gtgattgcga ttccggcgat tctggcggcg gcgccg 3646636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 466gcgattatta ttgtggtgcc ggcgattgcg gcgccg 3646736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 467gcgattctga ttgtggtggc gccgattgcg gcgccg 3646836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 468gcggtgattg tgccggtggc gattattgcg gcgccg 3646936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 469gcggtggtga ttgcgctgcc ggcggtggtg gcgccg 3647036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 470gcgctggtgg cggtgattgc gccggtggtg gcgccg 3647136DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 471gcgctggtgg cggtgctgcc ggcggtggcg gtgccg 3647236DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 472gcgctggtgg cgccgctgct ggcggtggcg gtgccg 3647336DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 473gcggtgctgg cggtggtggc gccggtggtg gcgccg 3647436DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 474gcggtgattg cggtggcgcc gctggtggtg gcgccg 3647536DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 475gcggtgattg cgctggcgcc ggtggtggtg gcgccg 3647636DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 476gtggcgattg cgctggcgcc ggtggtggtg gcgccg 3647736DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 477gtggcgctgg cgctggcgcc ggtggtggtg gcgccg 3647836DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 478gtggcggcgc tgctgccggc ggtggtggtg gcgccg 3647936DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 479gtggcgctgg cgctgccggc ggtggtggtg gcgccg 3648036DNAArtificial SequenceThe polynucleotide sequence that encodes advanced Macromolecule Transduction Domain (aMTD) peptide for Improvement of Cell-Permeability 480gtggcgctgc tggcgccggc ggtggtggtg gcgccg 3648157DNAArtificial SequencecDNA Sequence of Histidine Tag 481atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagc 5748219PRTArtificial SequenceAmino Acid Sequence of Histidine Tag 482Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro 1 5 10 15 Arg Gly Ser 48336DNAArtificial SequencecDNA Sequences of aMTDs 483gcgctggcgg tgccggtggc gctggcgatt gtgccg 3648412PRTArtificial SequenceAmino Acid Sequences of aMTDs 484Ala Leu Ala Val Pro Val Ala Leu Ala Ile Val Pro 1 5 10 485675DNAArtificial SequencecDNA Sequence of human SOCS3 485atggtcaccc acagcaagtt tcccgccgcc gggatgagcc gccccctgga caccagcctg 60cgcctcaaga ccttcagctc caagagcgag taccagctgg tggtgaacgc agtgcgcaag 120ctgcaggaga gcggcttcta ctggagcgca gtgaccggcg gcgaggcgaa cctgctgctc 180agtgccgagc ccgccggcac ctttctgatc cgcgacagct cggaccagcg ccacttcttc 240acgctcagcg tcaagaccca gtctgggacc aagaacctgc gcatccagtg tgaggggggc 300agcttctctc tgcagagcga tccccggagc acgcagcccg tgccccgctt cgactgcgtg 360ctcaagctgg tgcaccacta catgccgccc cctggagccc cctccttccc ctcgccacct 420actgaaccct cctccgaggt gcccgagcag ccgtctgccc agccactccc tgggagtccc 480cccagaagag cctattacat ctactccggg ggcgagaaga tccccctggt gttgagccgg 540cccctctcct ccaacgtggc cactcttcag catctctgtc ggaagaccgt caacggccac 600ctggactcct atgagaaagt cacccagctg ccggggccca ttcgggagtt cctggaccag 660tacgatgccc cgctt 675486225PRTArtificial SequenceAmino Acid Sequence of human SOCS3 486Met Val Thr His Ser Lys Phe Pro Ala Ala Gly Met Ser Arg Pro Leu 1 5 10 15 Asp Thr Ser Leu Arg Leu Lys Thr Phe Ser Ser Lys Ser Glu Tyr Gln 20 25 30 Leu Val Val Asn Ala Val Arg Lys Leu Gln Glu Ser Gly Phe Tyr Trp 35 40 45 Ser Ala Val Thr Gly Gly Glu Ala Asn Leu Leu Leu Ser Ala Glu Pro 50 55 60 Ala Gly Thr Phe Leu Ile Arg Asp Ser Ser Asp Gln Arg His Phe Phe 65 70 75 80 Thr Leu Ser Val Lys Thr Gln Ser Gly Thr Lys Asn Leu Arg Ile Gln 85 90 95 Cys Gly Gly Gly Ser Phe Ser Leu Gln Ser Asp Pro Arg Ser Thr Gln 100 105 110 Pro Val Pro Arg Phe Asp Cys Val Leu Lys Leu Val His His Tyr Met 115 120 125 Pro Pro Pro Gly Ala Pro Ser Phe Pro Ser Pro Pro Thr Glu Pro Ser 130 135 140 Ser Glu Val Pro Glu Gln Pro Ser Ala Gln Pro Leu Pro Gly Ser Pro 145 150 155 160 Pro Arg Arg Ala Tyr Tyr Ile Tyr Ser Gly Gly Glu Lys Ile Pro Leu 165 170 175 Val Leu Ser Arg Pro Leu Ser Ser Asn Val Ala Thr Leu Gln His Leu 180 185 190 Cys Arg Lys Thr Val Asn Gly His Leu Asp Ser Tyr Glu Lys Val Thr 195 200 205 Gln Leu Pro Gly Pro Ile Arg Glu Phe Leu Asp Gln Tyr Asp Ala Pro 210 215 220 Leu 225 487552DNAArtificial SequencecDNA Sequences of SDA 487atggcaaata ttaccgtttt ctataacgaa gacttccagg gtaagcaggt cgatctgccg 60cctggcaact atacccgcgc ccagttggcg gcgctgggca tcgagaataa taccatcagc 120tcggtgaagg tgccgcctgg cgtgaaggct atcctgtacc agaacgatgg tttcgccggc 180gaccagatcg aagtggtggc caatgccgag gagttgggcc cgctgaataa taacgtctcc 240agcatccgcg tcatctccgt gcccgtgcag ccgcgcatgg caaatattac cgttttctat 300aacgaagact tccagggtaa gcaggtcgat ctgccgcctg gcaactatac ccgcgcccag 360ttggcggcgc tgggcatcga gaataatacc atcagctcgg tgaaggtgcc gcctggcgtg 420aaggctatcc tctaccagaa cgatggtttc gccggcgacc agatcgaagt ggtggccaat 480gccgaggagc tgggtccgct gaataataac gtctccagca tccgcgtcat ctccgtgccg 540gtgcagccga gg 552488184PRTArtificial SequenceAmino Acid Sequences of SDA 488Met Ala Asn Ile Thr Val Phe Tyr Asn Glu Asp Phe Gln Gly Lys Gln 1 5 10 15 Val Asp Leu Pro Pro Gly Asn Tyr Thr Arg Ala Gln Leu Ala Ala Leu 20 25 30 Gly Ile Glu Asn Asn Thr Ile Ser Ser Val Lys Val Pro Pro Gly Val 35 40 45 Lys Ala Ile Leu Tyr Gln Asn Asp Gly Phe Ala Gly Asp Gln Ile Glu 50 55 60 Val Val Ala Asn Ala Glu Glu Leu Gly Pro Leu Asn Asn Asn Val Ser 65 70 75 80 Ser Ile Arg Val Ile Ser Val Pro Val Gln Pro Arg Met Ala Asn Ile 85 90 95 Thr Val Phe Tyr Asn Glu Asp Phe Gln Gly Lys Gln Val Asp Leu Pro 100 105 110 Pro Gly Asn Tyr Thr Arg Ala Gln Leu Ala Ala Leu Gly Ile Glu Asn 115 120 125 Asn Thr Ile Ser Ser Val Lys Val Pro Pro Gly Val Lys Ala Ile Leu 130 135 140 Tyr Gln Asn Asp Gly Phe Ala Gly Asp Gln Ile Glu Val Val Ala Asn 145 150 155 160 Ala Glu Glu Leu Gly Pro Leu Asn Asn Asn Val Ser Ser Ile Arg Val 165 170 175 Ile Ser Val Pro Val Gln Pro Arg 180 489297DNAArtificial SequencecDNA Sequences of SDB 489atggcagaac aaagcgacaa ggatgtgaag tactacactc tggaggagat tcagaagcac 60aaagacagca agagcacctg ggtgatccta catcataagg tgtacgatct gaccaagttt 120ctcgaagagc atcctggtgg ggaagaagtc ctgggcgagc aagctggggg tgatgctact 180gagaactttg aggacgtcgg gcactctacg gatgcacgag aactgtccaa aacatacatc 240atcggggagc tccatccaga tgacagatca aagatagcca agccttcgga aaccctt 29745099PRTArtificial SequenceAmino Acid Sequences of SDB 450Met Ala Glu Gln Ser Asp Lys Asp Val Lys Tyr Tyr Thr Leu Glu Glu 1 5 10 15 Ile Gln Lys His Lys Asp Ser Lys Ser Thr Trp Val Ile Leu His His 20 25 30 Lys Val Tyr Asp Leu Thr Lys Phe Leu Glu Glu His Pro Gly Gly Glu 35 40 45 Glu Val Leu Gly Glu Gln Ala Gly Gly Asp Ala Thr Glu Asn Phe Glu 50 55 60 Asp Val Gly His Ser Thr Asp Ala Arg Glu Leu Ser Lys Thr Tyr Ile 65 70 75 80 Ile Gly Glu Leu His Pro Asp Asp Arg Ser Lys Ile Ala Lys Pro Ser 85 90 95 Glu Thr Leu

Claims

1. The list of amino acid sequences of SOCS3 recombinant proteins fused to newly invented hydrophobic cell-penetrating peptides (CPPs)--advanced macromolecule transduction domains (aMTDs) and solubilization domain (SD).

2. The list of cDNA sequences of the SOCS3 recombinant proteins fused to newly invented hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs) and solubilization domain (SD) of claim 1.

3. A list of 240 aMTD amino acid sequences according to claim 1 that satisfy all six critical factors as shown in TABLE 3

4. Varied numbers and locations of solubilization domain (SD) according to claim 1 that are fused to SOCS3 recombinant proteins for high solubility and yield

5. The result of therapeutic applicability in lung cancer with SOCS3 recombinant proteins fused to newly invented hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs) and solubilization domain (SD)