U.S. patent application number 14/803677 was filed with the patent office on 2016-02-25 for methods of treating hemophilia in patients having developed inhibitory antibodies.
This patent application is currently assigned to BAYER HEALTHCARE LLC. The applicant listed for this patent is BAYER HEALTHCARE LLC. Invention is credited to Thomas BARNETT, Jianmin CHEN, Baisong MEI, John E. MURPHY, Clark Q. PAN, Jonathan S. STRAUSS, Liang TANG, Hendri TJANDRA, Deqian WANG.
Application Number | 20160051633 14/803677 |
Document ID | / |
Family ID | 36337298 |
Filed Date | 2016-02-25 |
United States Patent
Application |
20160051633 |
Kind Code |
A1 |
PAN; Clark Q. ; et
al. |
February 25, 2016 |
METHODS OF TREATING HEMOPHILIA IN PATIENTS HAVING DEVELOPED
INHIBITORY ANTIBODIES
Abstract
This invention relates to Factor VIII muteins that are
covalently bound, at a predefined site that is not an N-terminal
amine, to one or more biocompatible polymers such as polyethylene
glycol. The mutein conjugates retain FVIII procoagulant activity
and have improved pharmacokinetic properties.
Inventors: |
PAN; Clark Q.; (Castro
Valley, CA) ; MURPHY; John E.; (Berkeley, CA)
; MEI; Baisong; (Danville, CA) ; STRAUSS; Jonathan
S.; (Walnut Creek, CA) ; TJANDRA; Hendri;
(Union City, CA) ; CHEN; Jianmin; (Concord,
CA) ; BARNETT; Thomas; (Chapel Hill, NC) ;
TANG; Liang; (Richmond, CA) ; WANG; Deqian;
(Concord, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BAYER HEALTHCARE LLC |
Whippany |
NJ |
US |
|
|
Assignee: |
BAYER HEALTHCARE LLC
Whippany
NJ
|
Family ID: |
36337298 |
Appl. No.: |
14/803677 |
Filed: |
July 20, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13748983 |
Jan 24, 2013 |
9096656 |
|
|
14803677 |
|
|
|
|
12540703 |
Aug 13, 2009 |
|
|
|
13748983 |
|
|
|
|
11273896 |
Nov 14, 2005 |
7632921 |
|
|
12540703 |
|
|
|
|
60627277 |
Nov 12, 2004 |
|
|
|
Current U.S.
Class: |
514/14.1 |
Current CPC
Class: |
A61P 31/02 20180101;
A61K 38/00 20130101; A61K 47/60 20170801; C07K 17/08 20130101; A61P
7/04 20180101; C07K 2319/00 20130101; C07K 14/755 20130101; A61P
7/00 20180101; A61K 38/37 20130101 |
International
Class: |
A61K 38/37 20060101
A61K038/37; A61K 47/48 20060101 A61K047/48 |
Claims
1.-35. (canceled)
36. A method for the treatment of hemophilia in a patient who has
already developed factor VIII inhibitory antibodies comprising
administering a therapeutically effective amount of a
pharmaceutical composition of a conjugate having factor VIII
procoagulant activity comprising a functional factor VIII
polypeptide covalently attached to one or more biocompatible
polymers.
37. The method of claim 36, wherein the biocompatible polymer
comprises polyalkylene oxide.
38. The method of claim 36, wherein the biocompatible polymer
comprises polyethylene glycol.
39. The method of claim 38, wherein the polyethylene glycol
comprises methoxypolyethylene glycol.
40. The method of claim 39, wherein the methoxypolyethylene glycol
has a size range of from 3 kD to 100 kD.
41. The method of claim 40, wherein the methoxypolyethylene glycol
has a size range of from 5 kD to 64 kD.
42. The method of claim 41, wherein the methoxypolyethylene glycol
has a size range of from 5 kD to 43 kD.
43. The method of claim 36, wherein the biocompatible polymer is
covalently attached to the functional factor VIII polypeptide at a
site that is or is within 20 angstrom of a binding site for factor
VIII inhibitory antibodies.
44. The method of claim 36, wherein the binding of factor VIII
inhibitory antibodies to the conjugate is less than binding of the
antibodies to the polypeptide when it is not conjugated.
45. The method of claim 36, wherein the conjugate comprises a
functional factor VIII polypeptide comprising the amino acid
sequence of SEQ ID NO: 3 or 4.
46. The method of claim 38, wherein the conjugate is monopegylated
or dipegylated.
47. The method of claim 38, wherein the conjugate comprises a
functional factor VIII polypeptide comprising the amino acid
sequence of SEQ ID NO: 4 or an allelic variant thereof.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 13/748,983 filed on Jan. 24, 2013, which is a
continuation of U.S. patent application Ser. No. 12/540,703 filed
on Aug. 13, 2009, which is a continuation of U.S. patent
application Ser. No. 11/273,896 filed on Nov. 14, 2005 (now U.S.
Pat. No. 7,632,921), which claims benefit of priority to U.S.
Patent App. Ser. No. 60/627,277 filed on Nov. 12, 2004, all of
which applications are hereby incorporated herein by reference in
their entireties.
FIELD OF THE INVENTION
[0002] This invention relates to Factor VIII (FVIII) muteins that
allow coupling, at a defined site, to one or more biocompatible
polymers such as polyethylene glycol. In addition, related
formulations, dosages and methods of administration thereof for
therapeutic purposes are provided. These modified FVIII variants,
and associated compositions and methods are useful in providing a
treatment option with reduced injection frequency and reduced
immunogenic response for individuals afflicted with hemophilia
A.
BACKGROUND OF THE INVENTION
[0003] Hemophilia A is the most common hereditary coagulation
disorder, with an estimated incidence of 1 per 5000 males. It is
caused by deficiency or structural defects in FVIII, a critical
component of the intrinsic pathway of blood coagulation. The
current treatment for hemophilia A involves intravenous injection
of human FVIII. Human FVIII has been produced recombinantly as a
single-chain molecule of approximately 300 kD. It consists of the
structural domains A1-A2-B-A3-C1-C2 (Thompson, 2003, Semin.
Hematol. 29, pp. 11-22). The precursor product is processed into
two polypeptide chains of 200 kD (heavy) and 80 kD (light) in the
Golgi Apparatus, with the two chains held together by metal ions
(Kaufman et al., 1988, J. Biol. Chem. 263, p. 6352; Andersson et
al., 1986, Proc. Natl. Acad. Sci. 83, p. 2979).
[0004] The B-domain of FVIII seems to be dispensable as B-domain
deleted FVIII (BDD, 90 kD A1-A2 heavy chain plus 80 kD light chain)
has also been shown to be effective as a replacement therapy for
hemophilia A. The B-domain deleted FVIII sequence contains a
deletion of all but 14 amino acids of the B-domain.
[0005] Hemophilia A patients are currently treated by intravenous
administration of FVIII on demand or as a prophylactic therapy
administered several times a week. For prophylactic treatment 15-25
IU/kg bodyweight is given of factor VIII three times a week. It is
constantly required in the patient. Because of its short half-life
in man, FVIII must be administered frequently. Despite its large
size of greater than 300 kD for the full-length protein, FVIII has
a half-life in humans of only about 11 hours. (Ewenstein et al,
2004, Semin. Hematol. 41, pp. 1-16). The need for frequent
intravenous injection creates tremendous barriers to patient
compliance. It would be more convenient for the patients if a FVIII
product could be developed that had a longer half-life and
therefore required less frequent administration. Furthermore, the
cost of treatment could be reduced if the half-life were increased
because fewer dosages may then be required.
[0006] An additional disadvantage to the current therapy is that
about 25-30% of patients develop antibodies that inhibit FVIII
activity (Saenko et al, 2002, Haemophilia 8, pp. 1-11). The major
epitopes of inhibitory antibodies are located within the A2 domain
at residues 484-508, the A3 domain at residues 1811-1818, and the
C2 domain. Antibody development prevents the use of FVIII as a
replacement therapy, forcing this group of patients to seek an even
more expensive treatment with high-dose recombinant Factor Vila and
immune tolerance therapy.
[0007] The following studies identified FVIII epitopes of
inhibitory antibodies. In a study of 25 inhibitory plasma samples,
11 were found to bind to the thrombin generated 73 kD light chain
fragment A3C1C2, 4 to the A2 domain, and 10 to both (Fulcher, C. et
al., 1985, Proc. Natl. Acad. Sci. 2(22), pp. 7728-32). In another
study, six of eight A2 domain inhibitors from patients were
neutralized by a recombinant A2 polypeptide (Scandella, D. et al.,
1993, Blood 82(6), pp. 1767-75). Epitopes for six of nine
inhibitors from patients were mapped to A2 residues 379-538
(Scandella, D. et al., 1988, Proc. Natl. Acad. Sci. 85(16), pp.
6152-6). An epitope for 18 heavy-chain inhibitors was localized to
the same N-terminal 18.3 kD region of the A2 domain (Scandella, D.
et al., 1989, Blood 74(5), pp. 1618-26).
[0008] An active, recombinant hybrid human/porcine FVIII molecule,
generated by replacing human A2 domain residues 387-604 with the
homologous porcine sequence, was resistant to a patient A2
inhibitor (Lubin, I. et al., 1994, J. Biol. Chem. 269(12), pp.
8639-41) and resistant to a murine monoclonal antibody mAB 413 IgG
that competes with patient A2 inhibitors for binding to A2
(Scandella, D. et al., 1992, Thromb Haemost. 67(6), pp. 665-71).
This A2 domain epitope was further localized to the A2 domain
residues 484-508 when experiments showed that mAB 413 IgG and four
patient inhibitors did not inhibit a hybrid human/porcine FVIII in
which the A2 domain residues 484-508 were replaced with that of
porcine (Healey, J. et al., 1995, J. Biol. Chem. 270(24), pp.
14505-9). This hybrid FVIII was also more resistant to at least
half of 23 patient plasmas screened (Barrow, R. et al., 2000, Blood
95(2), pp. 564-8). Alanine scanning mutagenesis identified residue
487 to be critical for binding to all five patient inhibitors
tested, while residues 484, 487, 489, and 492 were all important to
interaction with mAB 413 IgG (Lubin, I., J. Biol. Chem. 272(48),
pp. 30191-5). Inhibitory antibody titers in mice receiving the
R484A/R489A/P492A mutant, but not the R484A/R489A mutant, were
significantly lower than in mice receiving control human BDD FVIII
(Parker, E. et al., 2004, Blood 104(3), pp. 704-10). In sum, the
484-508 region of the A2 domain seems to be a binding site for
inhibitors of FVIII activity.
[0009] In addition to the development of an immune response to
FVIII, another problem with conventional therapy is that it
requires frequent dosaging because of the short half-life of FVIII
in vivo. The mechanisms for clearance of FVIII from the circulation
have been studied.
[0010] FVIII clearance from circulation has been partly attributed
to specific binding to the low-density lipoprotein receptor-related
protein (LRP), a hepatic clearance receptor with broad ligand
specificity (Oldenburg et al., 2004, Haemophilia 10 Suppl 4, pp.
133-139). Recently, the low-density lipoprotein (LDL) receptor was
also shown to play a role in FVIII clearance, such as by
cooperating with LRP in regulating plasma levels of FVIII
(Bovenschen et al., 2005, Blood 106, pp. 906-910). Both
interactions are facilitated by binding to cell-surface heparin
sulphate proteoglycans (HSPGs). Plasma half-life in mice can be
prolonged by 3.3-fold when LRP is blocked or 5.5-fold when both LRP
and cell-surface HSPGs are blocked (Sarafanov et al., 2001, J.
Biol. Chem. 276, pp. 11970-11979). HSPGs are hypothesized to
concentrate FVIII on the cell surface and to present it to LRP. LRP
binding sites on FVIII have been localized to A2 residues 484-509
(Saenko et al., 1999, J. Biol. Chem. 274, pp. 37685-37692), A3
residues 1811-1818 (Bovenschen et al., 2003, J. Biol. Chem. 278,
pp. 9370-9377) and an epitope in the C2 domain (Lenting et al.,
1999, J. Biol. Chem. 274, pp. 23734-23739).
[0011] FVIII is also cleared from circulation by the action of
proteases. To understand this effect, one must understand the
mechanism by which FVIII is involved in blood coagulation. FVIII
circulates as a heterodimer of heavy and light chains, bound to
vWF. VWF binding involves FVIII residues 1649-1689 (Foster et al.,
1988, J. Biol. Chem. 263, pp. 5230-5234), and parts of C1
(Jacquemin et al., 2000, Blood 96, pp. 958-965) and C2 domains
(Spiegel, P. et al., 2004, J. Biol. Chem. 279(51), pp. 53691-8).
FVIII is activated by thrombin, which cleaves peptide bonds after
residues 372, 740, and 1689 to generate a heterotrimer of A1, A2,
and A3-C1-C2 domains (Pittman et al., 1988, Proc. Natl. Acad. Sci.
85, pp. 2429-2433). Upon activation, FVIII dissociates from vWF and
is concentrated to the cell surface of platelets by binding to
phospholipid. Phospholipid binding involves FVIII residues 2199,
2200, 2251, and 2252 (Gilbert et al., 2002, J. Biol. Chem. 277, pp.
6374-6381). There it binds to FIX through interactions with FVIII
residues 558-565 (Fay et al., 1994, J. Biol. Chem. 269, pp.
20522-20527) and 1811-1818 (Lenting et al., 1996, J. Biol. Chem.
271, pp. 1935-1940) and FX through interactions with FVIII residues
349-372 (Nogami et al., 2004, J. Biol. Chem. 279, pp. 15763-15771)
and acts as a cofactor for FIX activation of FX, an essential
component of the intrinsic coagulation pathway. Activated FVIII
(FVIIIa) is partly inactivated by the protease activated protein C
(APC) through cleavage after FVIII residues 336 and 562 (Regan et
al., 1996, J. Biol. Chem. 271, pp. 3982-3987). The predominant
determinant of inactivation, however, is the dissociation of the A2
domain from A1 and A3-C1-C2 (Fay et al., 1991, J. Biol. Chem. 266,
pp. 8957-8962).
[0012] One method that has been demonstrated to increase the in
vivo half-life of a protein is PEGylation. PEGylation is the
covalent attachment of long-chained polyethylene glycol (PEG)
molecules to a protein or other molecule. The PEG can be in a
linear form or in branched form to produce different molecules with
different features. Besides increasing the half-life of peptides or
proteins, PEGylation has been used to reduce antibody development,
protect the protein from protease digestion and keep the material
out of the kidney filtrate (Harris et al., 2001, Clinical
Pharmacokinetics 40, pp. 539-51). In addition, PEGylation may also
increase the overall stability and solubility of the protein.
Finally, the sustained plasma concentration of PEGylated proteins
can reduce the extent of adverse side effects by reducing the
trough to peak levels of a drug, thus eliminating the need to
introduce super-physiological levels of protein at early
time-points.
[0013] Random modification of FVIII by targeting primary amines
(N-terminus and lysines) with large polymers such as PEG and
dextran has been attempted with varying degree of success
(WO94/15625, U.S. Pat. No. 4,970,300, U.S. Pat. No. 6,048,720). The
most dramatic improvement, published in a 1994 patent application
(WO94/15625), shows a 4-fold half-life improvement but at a cost of
2-fold activity loss after reacting full-length FVIII with 50-fold
molar excess of PEG. WO2004/075923 discloses conjugates of FVIII
and polyethylene glycol that are created through random
modification. Randomly PEGylated proteins, such as interferon-alpha
(Kozlowski et al, 2001, BioDrugs 15, pp. 419-429) have been
approved as therapeutics in the past.
[0014] This random approach, however, is much more problematic for
the heterodimeric FVIII. FVIII has hundreds of potential PEGylation
sites, including the 158 lysines, the two N-termini, and multiple
histidines, serines, threonines, and tyrosines, all of which could
potentially be PEGylated with reagents primarily targeting primary
amines. For example, the major positional isomer for PEGylated
interferon Alpha-2b was shown to be a histidine (Wang et al., 2000,
Biochemistry 39, pp. 10634-10640). Furthermore, heterogeneous
processing of full length FVIII can lead to a mixture of starting
material that leads to further complexity in the PEGylated
products. An additional drawback to not controlling the site of
PEGylation on FVIII is a potential activity reduction if the PEG
were to be attached at or near critical active sites, especially if
more than one PEG or a single large PEG is conjugated to FVIII.
Because random PEGylation will invariably produce large amounts of
multiply PEGylated products, purification to obtain only
mono-PEGylated products will drastically lower overall yield.
Finally, the enormous heterogeneity in product profile will make
consistent synthesis and characterization of each lot nearly
impossible. Since good manufacturing requires a consistent,
well-characterized product, product heterogeneity is a barrier to
commercialization. For all these reasons, a more specific method
for PEGylating FVIII is desired.
[0015] Various site-directed protein PEGylation strategies have
been summarized in a recent review (Kochendoerfer, G., Curr. Opin.
Chem. Biol. 2005, available online as of Oct. 15, 2005, direct
object identifier doi:10.1016/j.cbpa.2005.10.007). One approach
involves incorporation of an unnatural amino acid into proteins by
chemical synthesis or recombinant expression followed by the
addition of a PEG derivative that will react specifically with the
unnatural amino acid. For example, the unnatural amino acid may be
one that contains a keto group not found in native proteins.
However, chemical synthesis of proteins is not feasible for a
protein as large as FVIII. Current limit of peptide synthesis is
about 50 residues. Several peptides can be ligated to form a larger
piece of polypeptide, but to produce even the B-domain deleted
FVIII would require greater than 20 ligations, which would result
in less than 1% recovery even under ideal reaction condition.
Recombinant expression of proteins with unnatural amino acids has
so far mainly been limited to non-mammalian expression systems.
This approach is expected to be problematic for a large and complex
protein such as FVIII that needs to be expressed in mammalian
systems.
[0016] Another approach to site-specific PEGylation of proteins is
by targeting N-terminal backbone amine with PEG-aldehydes. The low
pH required under this process to achieve specificity over other
amine groups, however, is not compatible with the narrow
near-neutral pH range needed for the stability of FVIII (Wang et
al., 2003, International J. Pharmaceutics 259, pp. 1-15). Moreover,
N-terminal PEGylation of FVIII may not lead to improved plasma
half-life if this region is not involved in plasma clearance. In
fact, the N-terminal region of the FVIII light chain has been
implicated in binding to the von Willebrand factor (vWF), a carrier
protein that is critical for FVIII survival in circulation. By
N-terminal modification of factor VIII, the critically important
association with vWF may be disrupted or weakened. Thus, N-terminal
PEGylation of FVIII may have the opposite effect of reducing plasma
half-life of FVIII.
[0017] WO90/12874 discloses site-specific modification of human
IL-3, granulocyte colony stimulating factor and erythropoietin
polypeptides by inserting or substituting a cysteine for another
amino acid, then adding a ligand that has a sulfhydryl reactive
group. The ligand couples selectively to cysteine residues.
Modification of FVIII or any variant thereof is not disclosed.
[0018] For the reasons stated above, there exists a need for an
improved FVIII variant that possesses greater duration of action in
vivo and reduced immunogenicity, while retaining functional
activity. Furthermore, it is desirable that such a protein be
produced as a homogeneous product in a consistent manner.
SUMMARY OF THE INVENTION
[0019] It is an object of the present invention to provide a
biocompatible polymer-conjugated functional FVIII polypeptide
having improved pharmacokinetic characteristics and therapeutic
characteristics.
[0020] It is another object of the present invention to provide a
biocompatible polymer-conjugated B domain deleted FVIII protein
having improved pharmacokinetic properties.
[0021] It is yet another object of the invention to provide a
biocompatible polymer-conjugated functional FVIII polypeptide
having reduced binding to the low-density lipoprotein
receptor-related protein (LRP), low-density lipoprotein (LDL)
receptor, the heparan sulphate proteoglycans (HSPGs) and/or
inhibitory antibodies against FVIII.
[0022] It is yet another object of the present invention to provide
an improved FVIII variant that possesses greater duration of action
in vivo and reduced immunogenicity, which is capable of being
produced as a homogeneous product in a consistent manner.
[0023] In one aspect of the invention there is provided a conjugate
having factor VIII procoagulant activity comprising a functional
factor VIII polypeptide covalently attached at one or more
predefined sites on the polypeptide to one or more biocompatible
polymers, wherein the predefined site is a not an N-terminal amine.
The invention also includes a method for the preparation of this
conjugate comprising mutating a nucleotide sequence that encodes
for the functional factor VIII polypeptide to substitute a coding
sequence for a cysteine residue at a pre-defined site; expressing
the mutated nucleotide sequence to produce a cysteine enhanced
mutein; purifying the mutein; reacting the mutein with the
biocompatible polymer that has been activated to react with
polypeptides substantially only at the introduced cysteine residues
such that the conjugate is formed; and purifying the conjugate. The
invention is also directed to pharmaceutical compositions
comprising the conjugate and a pharmaceutically acceptable adjuvant
and methods of treating hemophilia by administering therapeutically
effective amounts of these pharmaceutical compositions to a mammal
in need thereof.
[0024] The invention also relates to a method for site-directed
PEGylation of a factor VIII mutein comprising (a) expressing a
site-directed factor VIII mutein wherein the mutein has a cysteine
replacement for an amino acid residue on the exposed surface of the
factor VIII mutein and that cysteine is capped; (b) contacting the
cysteine mutein with a reductant under conditions to mildly reduce
the cysteine mutein and to release the cap; (c) removing the cap
and the reductant from the cysteine mutein; and (d) at least about
5 minutes after the removal of the reductant, treating the cysteine
mutein with PEG comprising a sulfhydryl coupling moiety under
conditions such that PEGylated factor VIII mutein is produced.
BRIEF DESCRIPTION OF THE FIGURES
[0025] FIG. 1A-1B. Vector maps and mutagenesis strategy for PEG
muteins. FIG. 1A shows the Mutagenesis Vector and Shuttle Vector.
FIG. 1B shows the Expression Vector.
[0026] FIG. 2. A UV absorbance profile at 280 nm with respect to
time for the PEG2 protein purified over a monoclonal FVIII antibody
chromatography column. The chromatography was performed using an
AKTA.RTM. Explorer 100 chromatography system from Amersham
Bioscience.
[0027] FIG. 3 Three-step site-directed PEGylation method. PEG
represents a cysteine-reactive PEG such as PEG-maleimide. Closed
bars represent disulfide formation while open bars represent
reduced cysteines.
[0028] FIG. 4. Site-directed PEGylation of PEG2.
[0029] FIG. 5. Site-directed PEGylation of PEG6.
[0030] FIG. 6A-6D. Site-directed PEGylation of BDD, PEG2, 4, 5, and
6. FIGS. 6A and 6B were stained with heavy (H) chain antibody while
FIGS. 6C and 6D were stained with light (L) chain antibody. "U" is
unprocessed material containing both H & L.
[0031] FIG. 6E. PEGylation of PEG15 and PEG7 with PEG2 and PEG6 as
controls. Start purified PEG muteins ("S") are reduced with TCEP
and PEGylated with a 12 kD ("12") or a 22 kD ("22") PEG after
removal of the reductant ("R"). Samples were run on 6% Tris-glycine
SDS PAGE and stained with a heavy chain ("HC") antibody on left
panel or light chain ("LC") antibody on right panel. "U" is
unprocessed material containing both HC & LC. PEGylated bands
are highlighted by dots.
[0032] FIG. 6F. PEGylation of PEG2+6 with PEG2 and PEG6 as
controls. PEG2, PEG6, or PEG2+6 is reduced with TCEP and PEGylated
with a 5 kD ("5") or a 43 kD ("43") PEG after removal of the
reductant ("R"). PEG2+6 was also PEGylated with 12, 22, and 33 kD
PEGs. Samples were run on 6% Tris-glycine SDS PAGE and stained with
coomassie for proteins on the left or heavy chain (H) or light
chain (L) antibody. "U" is unprocessed material containing both H
& L. PEGylated bands are highlighted by dots.
[0033] FIG. 6G. PEGylation of wildtype full length FVIII (KG-2)
with PEG2 as a control. Left gel stained with coomassie stain for
proteins and right gel with iodine for PEG. "BDD U" is unprocessed
BDD material containing both H & L. PEGylated bands are
highlighted by dots.
[0034] FIG. 7. Thrombin cleavage of PEGylated PEG2. The N-terminal
half of A2 domain is colored in blue and C-terminal half in green,
with the R8B12 antibody epitope highlighted in dark green (right
FVIII model). PEG2 (lane 1) and 22 kD PEGylated PEG2 (lane2) were
treated with thrombin (lanes 3 and 4, respectively) and then run on
a 7% Tris-Acetate gel (Invitrogen) and stained with the R8B12
antibody. Each lane contains about 50 ng of FVIII.
[0035] FIG. 8. Thrombin cleavage of PEGylated wildtype full-length
FVIII (KG-2). "S"=starting KG-2 material. "R"=reduced KG-2 and
reductant removed. "P"="R" PEGylated with 43 kD PEG. "Pure"="P"
purified away from excess PEG. "L"=light chain. PEGylated bands are
highlighted by dots.
[0036] FIG. 9. Iodine Staining of PEGylated PEG2. 22 or 43 kD
PEGylated PEG2 was run on a 6% TrisGlycine gel and stained with the
R8B12 FVIII antibody (lanes 1 and 2) or iodine (lanes 3 and 4). The
two stains were lined up according to their molecular weight marker
lanes. Lanes 1 and 2 each contains about 30 ng of FVIII while lanes
3 and 4 contain about 2 .mu.g.
[0037] FIG. 10A-10B. MALDI Mass Spectrometry analysis of PEGylated
and UnPEGylated PEG2. MALDI Mass Spectrometry was performed on PEG2
(FIG. 10A) or 22 kD PEGylated PEG2 (FIG. 10B). Upon PEGylation, the
heavy (H) chain peak of PEG2 is greatly reduced and a new peak
(H+PEG), centered at 111 kD (22 kD PEG+89 kD heavy chain), appears.
No PEGylated light (L) chain peak, expected to be centered at 100
kD (22 kD PEG+83 kD light chain) is detected.
[0038] FIG. 11A-11B. MALDI Mass Spectrometry of PEGylated and
unPEGylated PEG2 after thrombin cleavage.
[0039] FIG. 12A-12D. MALDI Mass Spectrometry analysis of PEGylated
PEG6 before and after thrombin cleavage.
[0040] FIG. 13. The UV absorption profile at 280 nm of PEGylated
PEG2 purified on size-exclusion column.
[0041] FIG. 14. The UV absorption profile at 280 nm of PEGylated
and UnPEGylated PEG6 purified on cation exchange column.
[0042] FIG. 15. The UV absorption profile at 280 nm of PEGylated
and UnPEGylated PEG6 purified on size-exclusion column.
[0043] FIG. 16. Activity of PEGylated protein is compared to
activity of the unPEGylated protein as measured by a chromogenic
assay and a coagulation assay. Purified full-length FVIII is
represented as KG-2. The percent activity reported was determined
by dividing the value of sample treated with PEG after reduction
and reductant removal by that of the sample treated with buffer
control taking into consideration the PEGylation yield.
[0044] FIG. 17. Rabbit PK study of PEGylated PEG2 compared to
PEG2.
[0045] FIG. 18. Rabbit PK study of PEGylated PEG2 compared to BDD
and PEG2. P-values are comparisons between PEGylated PEG2 and
BDD.
[0046] FIG. 19. Rabbit PK study of PEGylated PEG6 compared to BDD
and PEG6.
[0047] FIG. 20. Rabbit PK study of PEGylated wildtype full-length
("fl") FVIII compared to unmodified fl FVIII.
[0048] FIG. 21. Hemophilic mouse PK study of PEGylated PEG6
compared to PEG6 and BDD.
[0049] FIG. 22. Normal mouse PK study of 22 and 43 kD PEGylated
PEG2 compared to BDD.
[0050] FIG. 23. Normal mouse PK study of 22 kD PEGylated PEG2
compared to BDD, full time course.
[0051] FIG. 24. The Hemophilic Mouse (BDD) Factor VIII recovery
histogram depicting a pharmacokinetic (PK) assessment of the
half-life of two species of BDD Factor VIII in a hemophilic mouse
assay.
[0052] FIG. 25. Hemophilic mouse kidney laceration study of 22 kD
PEGylated PEG2 compared to BDD. Vehicle treated mice have a blood
loss of 25 uL/gram body weight.
[0053] FIG. 26. Chromogenic Activity of PEGylated PEG2 and BDD in
the presence of increasing amounts of FVIII antibodies. Antibody
epitope is denoted in parenthesis.
[0054] FIG. 27. Chromogenic Activity of PEGylated PEG2 in the
presence of increasing amounts of FVIII mAB 413 antibodies.
[0055] FIG. 28A-28D. Chromogenic activity of BDD, 43 kD PEGylated
PEG2, 33 kD PEGylated PEG6, and 33 kD diPEGylated PEG2+6 in the
presence of human plasma derived from patients that have developed
inhibitors to FVIII. The inhibitor titer and date of blood
collection were noted at the top. FIGS. 28A and 28B include data
collected at patient plasma dilution of 5- to 405-fold. FIG. 28C
focuses on 1:15-fold dilution for patient HRF-828 plasma. FIG. 28D
confirms that the 0.064 IU/mL used for each FVIII sample in the top
two panels was not a saturating dose.
[0056] FIG. 29. PEGylation screening method and validation. Top
panel shows a schematic of PEGylation screening of transiently
expressed PEG muteins. Bottom panel shows a Western analysis of
PEGylated products using a heavy chain ("H")-specific antibody
(left) or a light-chain ("L") specific antibody (right). PEGylated
bands are highlighted by dots. "U" is unprocessed material
containing both H and L.
[0057] FIG. 30. PEGylation screening of PEG15-17. Western analysis
of PEGylated products using heavy chain ("H")-specific antibodies
(R8B12 and 58.12) or light-chain ("L") specific antibodies (C7F7
and GM). All 3 muteins are selective for the heavy chain, with
relative PEGylation efficiency of PEG15-PEG16>PEG17. PEGylated
bands are highlighted by dots. "U" is unprocessed material
containing both H and L.
[0058] FIG. 31. Gel showing PEGylation of PEG2+14 as a function of
reductant concentration. PEG2+14 was treated with 67 to 670 uM of
TCEP for 30 minutes at 4.degree. C. The reductant was removed by
spin-column followed by PEGylation with a 12 kD PEG. Heavy and
light chains of FVIII are highlighted by "H" and "L," respectively.
The two dots point to the PEGylated heavy and light chains.
[0059] FIG. 32A-32F. Deconvoluted Mass Spectra of PEG2+14 treated
with 67 to 670 uM of TCEP followed by reductant removal. FIG. 32A
shows PEG2+14; FIG. 32B shows reduction with 200 uM TCEP; FIG. 32C
shows reduction with 67 uM TCEP; FIG. 32D shows reduction with 400
uM TCEP; FIG. 32E shows reduction with 100 uM TCEP; and FIG. 32F
shows reduction with 670 uM TCEP.
DETAILED DESCRIPTION OF THE INVENTION
[0060] The present invention is based on the discovery that
polypeptides having FVIII activity can be covalently attached at a
predefined site to a biocompatible polymer that is not at an
N-terminal amine, and that such polypeptides substantially retain
their coagulant activity. Furthermore, these polypeptide conjugates
have improved circulation time and reduced antigenicity. The
conjugates of the invention are advantageous over the prior art
conjugates that had random polymer attachments to FVIII or
attachments at an N-terminal. Site-directed attachment allows one
to design modifications that avoid the regions required for
biological activity and thereby to maintain substantial FVIII
activity. It also allows for designing to attach polymers to block
binding at sites involved in FVIII clearance. Site-directed
attachment also allows for a uniform product rather than the
heterogeneous conjugates produced in the art by random polymer
coupling. By avoiding attachment at an N-terminal amine of the
light chain, the conjugates of the present invention avoid the
possible loss of activity from attaching a ligand at an active site
of the FVIII polypeptide. The N-terminal region of the light chain
is believed to be involved in the association of vWF factor to
FVIII, which is a stabilizing association in the circulation.
DEFINITIONS
[0061] Biocompatible polymer. A biocompatible polymer includes
polyalkylene oxides such as without limitation polyethylene glycol
(PEG), dextrans, colominic acids or other carbohydrate based
polymers, polymers of amino acids, biotin derivatives, polyvinyl
alcohol (PVA), polycarboxylates, polyvinylpyrrolidone,
polyethylene-co-maleic acid anhydride, polystyrene-co-malic acid
anhydride, polyoxazoline, polyacryloylmorpholine, heparin, albumin,
celluloses, hydrolysates of chitosan, starches such as
hydroxyethyl-starches and hydroxy propyl-starches, glycogen,
agaroses and derivatives thereof, guar gum, pullulan, inulin,
xanthan gum, carrageenan, pectin, alginic acid hydrolysates, other
bio-polymers and any equivalents thereof. Preferred is polyethylene
glycol, and still more preferred is methoxypolyethylene glycol
(mPEG). Other useful polyalkylene glycol compounds are
polypropylene glycols (PPG), polybutylene glycols (PBG),
PEG-glycidyl ethers (Epox-PEG), PEG-oxycarbonylimidazole (CDI-PEG),
branched polyethylene glycols, linear polyethylene glycols, forked
polyethylene glycols and multi-armed or "super branched"
polyethylene glycols (star-PEG).
[0062] Polyethylene glycol (PEG). "PEG" and "polyethylene glycol"
as used herein are interchangeable and include any water-soluble
poly(ethylene oxide). Typically, PEGs for use in accordance with
the invention comprise the following structure
"--(OCH.sub.2CH.sub.2).sub.n--" where (n) is 2 to 4000. As used
herein, PEG also includes
"--CH.sub.2CH.sub.2--O(CH.sub.2CH.sub.2O).sub.n--CH.sub.2CH.sub.2--"
and "--(OCH.sub.2CH.sub.2).sub.nO--," depending upon whether or not
the terminal oxygens have been displaced. Throughout the
specification and claims, it should be remembered that the term
"PEG" includes structures having various terminal or "end capping"
groups, such as without limitation a hydroxyl or a C.sub.1-20
alkoxy group. The term "PEG" also means a polymer that contains a
majority, that is to say, greater than 50%, of
--OCH.sub.2CH.sub.2-- repeating subunits. With respect to specific
forms, the PEG can take any number of a variety of molecular
weights, as well as structures or geometries such as branched,
linear, forked, and multifunctional.
[0063] PEGylation. PEGylation is a process whereby a polyethylene
glycol (PEG) is covalently attached to a molecule such as a
protein.
[0064] Activated or Active functional group. When a functional
group such as a biocompatible polymer is described as activated,
the functional group reacts readily with an electrophile or a
nucleophile on another molecule.
[0065] B domain deleted FVIII (BDD). As used herein, BDD is
characterized by having the amino acid sequence which contains a
deletion of all but 14 amino acids of the B-domain of FVIII. The
first 4 amino acids of the B-domain (SFSQ, SEQ ID NO:1) are linked
to the 10 last residues of the B-domain (NPPVLKRHQR, SEQ ID NO:2).
(Lind, P. et al, 1995, Eur. J. Biochem. 232, pp. 19-27). The BDD
used herein has the amino acid sequence of SEQ ID NO:3.
[0066] FVIII. Blood clotting Factor VIII (FVIII) is a glycoprotein
synthesized and released into the bloodstream by the liver. In the
circulating blood, it is bound to von Willebrand factor (vWF, also
known as Factor VIII-related antigen) to form a stable complex.
Upon activation by thrombin, it dissociates from the complex to
interact with other clotting factors in the coagulation cascade,
which eventually leads to the formation of a thrombus. Human
full-length FVIII has the amino acid sequence of SEQ ID NO:4,
although allelic variants are possible.
[0067] Functional factor VIII polypeptide. As used herein,
functional factor VIII polypeptide denotes a functional polypeptide
or combination of polypeptides that are capable, in vivo or in
vitro, of correcting human factor VIII deficiencies, characterized,
for example, by hemophilia A. Factor VIII has multiple degradation
or processed forms in the natural state. These are proteolytically
derived from a precursor, one chain protein, as demonstrated
herein. A functional factor VIII polypeptide includes such single
chain protein and also provides for these various degradation
products that have the biological activity of correcting human
factor VIII deficiencies. Allelic variations likely exist. The
functional factor VIII polypeptides include all such allelic
variations, glycosylated versions, modifications and fragments
resulting in derivatives of factor VIII so long as they contain the
functional segment of human factor VIII and the essential,
characteristic human factor VIII functional activity remains
unaffected in kind. Those derivatives of factor VIII possessing the
requisite functional activity can readily be identified by
straightforward in vitro tests described herein. Furthermore,
functional factor VIII polypeptide is capable of catalyzing the
conversion of factor X to Xa in the presence of factor IXa,
calcium, and phospholipid, as well as correcting the coagulation
defect in plasma derived from hemophilia A affected individuals.
From the disclosure of the sequence of the human factor VIII amino
acid sequences and the functional regions herein, the fragments
that can be derived via restriction enzyme cutting of the DNA or
proteolytic or other degradation of human factor VIII protein will
be apparent to those skilled in the art.
[0068] FIX. As used herein, FIX means Coagulation Factor IX, which
is also known as Human Clotting Factor IX, or Plasma Thromboplastin
Component.
[0069] FX. As used herein, FX means Coagulation Factor X, which is
also known by the names Human Clotting Factor X and by the eponym
Stuart-Prower factor.
[0070] Pharmacokinetics. "Pharmacokinetics" ("PK") is a term used
to describe the properties of absorption, distribution, metabolism,
and elimination of a drug in a body. An improvement to a drug's
pharmacokinetics means an improvement in those characteristics that
make the drug more effective in vivo as a therapeutic agent,
especially its useful duration in the body.
[0071] Mutein. A mutein is a genetically engineered protein arising
as a result of a laboratory induced mutation to a protein or
polypeptide.
[0072] Protein. As used herein, protein and polypeptide are
synonyms.
[0073] FVIII clearance receptor. A FVIII clearance receptor as used
herein means a receptor region on a functional FVIII polypeptide
that binds or associates with one or more other molecules to result
in FVIII clearance from the circulation. Factor VIII clearance
receptors include without limitation the regions of the FVIII
molecule that bind LRP, LDL receptor and/or HSPG.
DISCUSSION
[0074] It is envisioned that any functional factor VIII polypeptide
may be mutated at a predetermined site and then covalently attached
at that site to a biocompatible polymer according to the methods of
the invention. Useful polypeptides include, without limitation,
full-length factor VIII having the amino acid sequence as shown in
SEQ ID NO:4 and BDD FVIII having the amino acid sequence as shown
in SEQ ID NO:3. Preferred is BDD FVIII.
[0075] The biocompatible polymer used in the conjugates of the
invention may be any of the polymers discussed above. The
biocompatible polymer is selected to provide the desired
improvement in pharmacokinetics. For example, the identity, size
and structure of the polymer is selected so as to improve the
circulation half-life of the polypeptide having FVIII activity or
decrease the antigenicity of the polypeptide without an
unacceptable decrease in activity. Preferably, the polymer
comprises PEG, and still more preferably has at least 50% of its
molecular weight as PEG. In one embodiment, the polymer is a
polyethylene glycol terminally capped with an end-capping moiety
such as hydroxyl, alkoxy, substituted alkoxy, alkenoxy, substituted
alkenoxy, alkynoxy, substituted alkynoxy, aryloxy and substituted
aryloxy. Still more preferred are polymers comprising
methoxypolyethylene glycol. Yet more preferred are polymers
comprising methoxypolyethylene glycol having a size range from 3 kD
to 100 kD, and more preferably from 5 kD to 64 kD or from 5 kD to
43 kD.
[0076] Preferably the polymer has a reactive moiety. For example,
in one embodiment, the polymer has a sulfhydryl reactive moiety
that can react with a free cysteine on a functional factor VIII
polypeptide to form a covalent linkage. Such sulfhydryl reactive
moieties include thiol, triflate, tresylate, aziridine, oxirane,
S-pyridyl or maleimide moieties. Preferred is a maleimide moiety.
In one embodiment, the polymer is linear and has a "cap" at one
terminus that is not strongly reactive towards sulfhydryls (such as
methoxy) and a sulfhydryl reactive moiety at the other terminus. In
a preferred embodiment, the conjugate comprises PEG-maleimide and
has a size range from 5 kD to 64 kD.
[0077] Further guidance for selecting useful biocompatible polymers
is provided in the examples that follow.
[0078] Site-directed mutation of a nucleotide sequence encoding
polypeptide having FVIII activity may occur by any method known in
the art. Preferred methods include mutagenesis to introduce a
cysteine codon at the site chosen for covalent attachment of the
polymer. This may be accomplished using a commercially available
site-directed mutagenesis kit such as the Stratagene
cQuickChange.TM. II site-directed mutagenesis kit, the Clontech
Transformer site-directed mutagenesis kit no. K1600-1, the
Invitrogen GenTaylor site-directed mutagenesis system no. 12397014,
the Promega Altered Sites II in vitro mutagenesis system kit no.
Q6210, or the Takara Mirus Bio LA PCR mutagenesis kit no. TAK
RR016.
[0079] The conjugates of the invention may be prepared by first
replacing the codon for one or more amino acids on the surface of
the functional FVIII polypeptide with a codon for cysteine,
producing the cysteine mutein in a recombinant expression system,
reacting the mutein with a cysteine-specific polymer reagent, and
purifying the mutein.
[0080] In this system, the addition of a polymer at the cysteine
site can be accomplished through a maleimide active functionality
on the polymer. Examples of this technology are provided infra. The
amount of sulfhydryl reactive polymer used should be at least
equimolar to the molar amount of cysteines to be derivatized and
preferably is present in excess. Preferably, at least a 5-fold
molar excess of sulfhydryl reactive polymer is used, and still more
preferably at least a ten-fold excess of such polymer is used.
Other conditions useful for covalent attachment are within the
skill of those in the art.
[0081] In the examples that follow, the muteins are named in a
manner conventional in the art. The convention for naming mutants
is based on the amino acid sequence for the mature, full length
Factor VIII as provided in SEQ ID NO:4. As a secreted protein,
FVIII contains a signal sequence that is proteolytically cleaved
during the translation process. Following removal of the 19 amino
acid signal sequence, the first amino acid of the secreted FVIII
product is an alanine.
[0082] As is conventional and used herein, when referring to
mutated amino acids in BDD FVIII, the mutated amino acid is
designated by its position in the sequence of full-length FVIII.
For example, the PEG6 mutein discussed below is designated K1808C
because it changes the lysine (K) at the position analogous to 1808
in the full-length sequence to cysteine (C).
[0083] The predefined site for covalent binding of the polymer is
best selected from sites exposed on the surface of the polypeptide
that are not involved in FVIII activity or involved in other
mechanisms that stabilize FVIII in vivo, such as binding to vWF.
Such sites are also best selected from those sites known to be
involved in mechanisms by which FVIII is deactivated or cleared
from circulation. Selection of these sites is discussed in detail
below. Preferred sites include an amino acid residue in or near a
binding site for (a) low density lipoprotein receptor related
protein, (b) a heparin sulphate proteoglycan, (c) low density
lipoprotein receptor and/or (d) factor VIII inhibitory antibodies.
By "in or near a binding site" means a residue that is sufficiently
close to a binding site such that covalent attachment of a
biocompatible polymer to the site would result in steric hindrance
of the binding site. Such a site is expected to be within 20 .ANG.
of a binding site, for example.
[0084] In one embodiment of the invention, the biocompatible
polymer is covalently attached to the functional factor VIII
polypeptide at an amino acid residue in or near (a) a factor VIII
clearance receptor as defined supra, (b) a binding site for a
protease capable of degradation of factor VIII and/or (c) a binding
site for factor VIII inhibitory antibodies. The protease may be
activated protein C (APC). In another embodiment, the biocompatible
polymer is covalently attached at the predefined site on the
functional factor VIII polypeptide such that binding of low-density
lipoprotein receptor related protein to the polypeptide is less
than to the polypeptide when it is not conjugated, and preferably
more than twofold less. In one embodiment, the biocompatible
polymer is covalently attached at the predefined site on the
functional factor VIII polypeptide such that binding of heparin
sulphate proteoglycans to the polypeptide is less than to the
polypeptide when it is not conjugated, and preferably is more than
twofold less. In a further embodiment, the biocompatible polymer is
covalently attached at the predefined site on the functional factor
VIII polypeptide such that binding of factor VIII inhibitory
antibodies to the polypeptide is less than to the polypeptide when
it is not conjugated, preferably more than twofold less than the
binding to the polypeptide when it is not conjugated. In another
embodiment, the biocompatible polymer is covalently attached at the
predefined site on the functional factor VIII polypeptide such that
binding of low density lipoprotein receptor to the polypeptide is
less than to the polypeptide when it is not conjugated, preferably
more than twofold less. In another embodiment, the biocompatible
polymer is covalently attached at the predefined site on the
functional factor VIII polypeptide such that a plasma protease
degrades the polypeptide less than when the polypeptide is not
conjugated. In a further embodiment, the degradation of the
polypeptide by the plasma protease is more than twofold less than
the degradation of the polypeptide when it is not conjugated as
measured under the same conditions over the same time period.
[0085] LRP, LDL receptor, or HSPG binding affinity for FVIII can be
determined using surface plasmon resonance technology (Biacore).
For example, FVIII can be coated directly or indirectly through a
FVIII antibody to a Biacore.TM. chip, and varying concentrations of
LRP can be passed over the chip to measure both on-rate and
off-rate of the interaction (Bovenschen N. et al., 2003, J. Biol.
Chem. 278(11), pp. 9370-7). The ratio of the two rates gives a
measure of affinity. A two-fold, preferably five-fold, more
preferably ten-fold, and even more preferably 30-fold decrease in
affinity upon PEGylation would be desired.
[0086] Degradation of a FVIII by the protease APC can be measured
by any of the methods known to those of skill in the art.
[0087] In one embodiment, the biocompatible polymer is covalently
attached to the polypeptide at one or more of the factor VIII amino
acid positions 81, 129, 377, 378, 468, 487, 491, 504, 556, 570,
711, 1648, 1795, 1796, 1803, 1804, 1808, 1810, 1864, 1903, 1911,
2091, 2118 and 2284. In another embodiment, the biocompatible
polymer is covalently attached to the polypeptide at one or more of
factor VIII amino acid positions 377, 378, 468, 491, 504, 556,
1795, 1796, 1803, 1804, 1808, 1810, 1864, 1903, 1911 and 2284 and
(1) the binding of the conjugate to low-density lipoprotein
receptor related protein is less than the binding of the
unconjugated polypeptide to the low-density lipoprotein receptor
related protein; (2) the binding of the conjugate to low-density
lipoprotein receptor is less than the binding of the unconjugated
polypeptide to the low-density lipoprotein receptor; or (3) the
binding of the conjugate to both low-density lipoprotein receptor
related protein and low-density lipoprotein receptor is less than
the binding of the unconjugated polypeptide to the low-density
lipoprotein receptor related protein and the low-density
lipoprotein receptor.
[0088] In a further embodiment, the biocompatible polymer is
covalently attached to the polypeptide at one or more of factor
VIII amino acid positions 377, 378, 468, 491, 504, 556 and 711 and
the binding of the conjugate to heparin sulphate proteoglycan is
less than the binding of the unconjugated polypeptide to heparin
sulphate proteoglycan. In a further embodiment, the biocompatible
polymer is covalently attached to the polypeptide at one or more of
the factor VIII amino acid positions 81, 129, 377, 378, 468, 487,
491, 504, 556, 570, 711, 1648, 1795, 1796, 1803, 1804, 1808, 1810,
1864, 1903, 1911, 2091, 2118 and 2284 and the conjugate has less
binding to factor VIII inhibitory antibodies than the unconjugated
polypeptide. In a further embodiment, the biocompatible polymer is
covalently attached to the polypeptide at one or more of the factor
VIII amino acid positions 81, 129, 377, 378, 468, 487, 491, 504,
556, 570, 711, 1648, 1795, 1796, 1803, 1804, 1808, 1810, 1864,
1903, 1911, 2091, 2118 and 2284, and preferably at one or more of
positions 377, 378, 468, 491, 504, 556, and 711 and the conjugate
has less degradation from a plasma protease capable of factor VIII
degradation than does the unconjugated polypeptide. More preferred,
the plasma protease is activated protein C.
[0089] In a further embodiment, the biocompatible polymer is
covalently attached to B-domain deleted factor VIII at amino acid
position 129, 491, 1804, and/or 1808, more preferably at 491 or
1808. In a further embodiment, the biocompatible polymer is
attached to the polypeptide at factor VIII amino acid position 1804
and comprises polyethylene glycol. Preferably, the one or more
predefined sites for biocompatible polymer attachment are
controlled by site specific cysteine mutation.
[0090] One or more sites, preferably one or two, on the functional
factor VIII polypeptide may be the predefined sites for polymer
attachment. In particular embodiments, the polypeptide is
mono-PEGylated or diPEGylated.
[0091] The invention also relates to a method for the preparation
of the conjugate comprising mutating a nucleotide sequence that
encodes for the functional factor VIII polypeptide to substitute a
coding sequence for a cysteine residue at a pre-defined site;
expressing the mutated nucleotide sequence to produce a cysteine
enhanced mutein; purifying the mutein; reacting the mutein with the
biocompatible polymer that has been activated to react with
polypeptides at substantially only reduced cysteine residues such
that the conjugate is formed; and purifying the conjugate. In
another embodiment, the invention provides a method for
site-directed PEGylation of a factor VIII mutein comprising: (a)
expressing a site-directed factor VIII mutein wherein the mutein
has a cysteine replacement for an amino acid residue on the exposed
surface of the factor VIII mutein and that cysteine is capped; (b)
contacting the cysteine mutein with a reductant under conditions to
mildly reduce the cysteine mutein and to release the cap; (c)
removing the cap and the reductant from the cysteine mutein; and
(d) at least about 5 minutes, and preferably at least 15 minutes,
still more preferably at least 30 minutes after the removal of the
reductant, treating the cysteine mutein with PEG comprising a
sulfhydryl coupling moiety under conditions such that PEGylated
factor VIII mutein is produced. The sulfhydryl coupling moiety of
the PEG is selected from the group consisting of thiol, triflate,
tresylate, aziridine, oxirane, S-pyridyl and maleimide moieties,
preferably maleimide.
[0092] The invention also concerns pharmaceutical compositions for
parenteral administration comprising therapeutically effective
amounts of the conjugates of the invention and a pharmaceutically
acceptable adjuvant. Pharmaceutically acceptable adjuvants are
substances that may be added to the active ingredient to help
formulate or stabilize the preparation and cause no significant
adverse toxicological effects to the patient. Examples of such
adjuvants are well known to those skilled in the art and include
water, sugars such as maltose or sucrose, albumin, salts, etc.
Other adjuvants are described for example in Remington's
Pharmaceutical Sciences by E. W. Martin. Such compositions will
contain an effective amount of the conjugate hereof together with a
suitable amount of vehicle in order to prepare pharmaceutically
acceptable compositions suitable for effective administration to
the host. For example, the conjugate may be parenterally
administered to subjects suffering from hemophilia A at a dosage
that may vary with the severity of the bleeding episode. The
average doses administered intraveneously are in the range of 40
units per kilogram for pre-operative indications, 15 to 20 units
per kilogram for minor hemorrhaging, and 20 to 40 units per
kilogram administered over an 8-hours period for a maintenance
dose.
[0093] In one embodiment the inventive method involves replacing
one or more surface BDD amino acids with a cysteine, producing the
cysteine mutein in a mammalian expression system, reducing a
cysteine which has been capped during expression by cysteine from
growth media, removing the reductant to allow BDD disulfides to
reform, and reacting with a cysteine-specific biocompatible polymer
reagent, such as such as PEG-maleimide. Examples of such reagents
are PEG-maleimide with PEG sizes such as 5, 22, or 43 kD available
from Nektar Therapeutics of San Carlos, Calif. under Nektar catalog
numbers 2D2M0H01 mPEG-MAL MW 5,000 Da, 2D2M0P01 mPEG-MAL MW 20 kD,
2D3X0P01 mPEG2-MAL MW 40 kD, respectively, or 12 or 33 kD available
from NOF Corporation, Tokyo, Japan under NOF catalog number
Sunbright ME-120MA and Sunbright ME-300MA, respectively. The
PEGylated product is purified using ion-exchange chromatography to
remove unreacted PEG and using size-exclusion chromatography to
remove unreacted BDD. This method can be used to identify and
selectively shield any unfavorable interactions with FVIII such as
receptor-mediated clearance, inhibitory antibody binding, and
degradation by proteolytic enzymes. We noted that the PEG reagent
supplied by Nektar or NOF as 5 kD tested as 6 kD in our laboratory,
and similarly the PEG reagent supplied as linear 20 kD tested as 22
kD, that supplied as 40 kD tested as 43 kD and that supplied as 60
kD tested as 64 kD in our laboratory. To avoid confusion, we use
the molecular weight as tested in our laboratory in the discussion
herein, except for the 5 kD PEG, which we report as 5 kD as the
manufacturer identified it.
[0094] In addition to cysteine mutations at positions 491 and 1808
of BDD (disclosed above), positions 487, 496, 504, 468, 1810, 1812,
1813, 1815, 1795, 1796, 1803, and 1804 were mutated to cysteine to
potentially allow blockage of LRP binding upon PEGylation. Also,
positions 377, 378, and 556 were mutated to cysteine to allow
blockage of both LRP and HSPG binding upon PEGylation. Positions
81, 129, 422, 523, 570, 1864, 1911, 2091, and 2284 were selected to
be equally spaced on BDD so that site-directed PEGylation with
large PEGs (>40 kD) at these positions together with PEGylation
at the native glycosylation sites (41, 239, and 2118) and LRP
binding sites should completely cover the surface of BDD and
identify novel clearance mechanism for BDD.
[0095] In one embodiment, the cell culture medium contains
cysteines that "cap" the cysteine residues on the mutein by forming
disulfide bonds. In the preparation of the conjugate, the cysteine
mutein produced in the recombinant system is capped with a cysteine
from the medium and this cap is removed by mild reduction that
releases the cap before adding the cysteine-specific polymer
reagent. Other methods known in the art for site-specific mutation
of FVIII may also be used, as would be apparent to one of skill in
the art.
EXAMPLES
[0096] STRUCTURE ACTIVITY RELATIONSHIP ANALYSIS OF FVIII. FVIII and
BDD FVIII are very large complex molecules with many different
sites involved in biological reactions. Previous attempts to
covalently modify them to improve pharmacokinetic properties had
mixed results. That the molecules could be specifically mutated and
then a polymer added in a site-specific manner was surprising.
Furthermore, the results of improved pharmacokinetic properties and
retained activity were surprising also, given the problems with
past polymeric conjugates causing nonspecific addition and reduced
activity.
[0097] In one embodiment, the invention concerns site-directed
mutagenesis using cysteine-specific ligands such as PEG-maleimide.
A non-mutated BDD does not have any available cysteines to react
with a PEG-maleimide, so only the mutated cysteine position will be
the site of PEGylation. More specifically, BDD FVIII has 19
cysteines, 16 of which form disulfides and the other 3 of which are
free cysteines (McMullen et al., 1995, Protein Sci. 4, pp.
740-746). The structural model of BDD suggests that all 3 free
cysteines are buried (Stoliova-McPhie et al., 2002, Blood 99, pp.
1215-1223). Because oxidized cysteines cannot be PEGylated by
PEG-maleimides, the 16 cysteines that form disulfides in BDD cannot
be PEGylated without being first reduced. Based on the structural
models of BDD, the 3 free cysteines in BDD may not be PEGylated
without first denaturing the protein to expose these cysteines to
the PEG reagent. Thus, it does not appear feasible to achieve
specific PEGylation of BDD by PEGylation at native cysteine
residues without dramatically altering the BDD structure, which
will most likely destroy its function.
[0098] The redox state of the 4 cysteines in the B domain of
full-length FVIII is unknown. PEGylation of the 4 cysteines in the
B domain may be possible if they do not form disulfides and are
surface exposed. However, because full-length FVIII and BDD have a
similar pharmacokinetic (PK) profile and similar half-lives in vivo
(Gruppo et al., 2003, Haemophilia 9, pp. 251-260), B domain
PEGylation is unlikely to result in improved plasma half-life
unless the PEG happens to also protect non-B domain regions.
[0099] To determine the predefined site on a polypeptide having
FVIII activity for polymer attachment that will retain factor VIII
activity and improve pharmacokinetics, the following guidelines are
presented based on BDD FVIII. Modifications should be targeted
toward clearance, inactivation, and immunogenic mechanisms such as
LRP, HSPG, APC, and inhibitory antibody binding sites.
Stoilova-McPhie, S. et al., 2002, Blood 99(4), pp. 1215-23 shows
the structure of BDD. For example, to prolong half-life, a single
PEG can be introduced at a specific site at or near LRP binding
sites in A2 residues 484-509 and A3 residues 1811-1818.
Introduction of the bulky PEG at these sites should disrupt FVIII's
ability to bind LRP and reduce the clearance of FVIII from
circulation. It is also believed that to prolong half-life without
significantly affecting activity that a PEG can be introduced at
residue 1648, which is at the junction of the B domain and the A3
domain in the full-length molecule and in the 14-amino acid linker
I the BDD between the A2 and A3 domains.
[0100] Specificity of PEGylation can be achieved by engineering
single cysteine residues into the A2 or A3 domains using
recombinant DNA mutagenesis techniques followed by site-specific
PEGylation of the introduced cysteine with a cysteine-specific PEG
reagent such as PEG-maleimide. Another advantage of PEGylating at
484-509 and 1811-1818 is that these two epitopes represent two of
the three major classes of inhibitory antigenic sites in patients.
To achieve maximal effect of improved circulating half-life and
reduction of immunogenic response, both A2 and A3 LRP binding sites
can be PEGylated to yield a diPEGylated product. It should be noted
that PEGylation within the 1811-1818 region may lead to significant
loss of activity since this region is also involved in FIX binding.
Site-directed PEGylation within 558-565 should abolish HSPG
binding, but may also reduce activity as this region also binds to
FIX.
[0101] Additional surface sites can be PEGylated to identify novel
clearance mechanism of FVIII. PEGylation of the A2 domain may offer
additional advantage in that the A2 domain dissociates from FVIII
upon activation and is presumably removed from circulation faster
than the rest of FVIII molecule because of its smaller size.
PEGylated A2, on the other hand, may be big enough to escape kidney
clearance and have a comparable plasma half-life to the rest of
FVIII and thus can reconstitute the activated FVIII in vivo.
[0102] IDENTIFICATION OF PEGylation SITES IN A2 AND A3 REGIONS.
Five positions (Y487, L491, K496, L504 and Q468 corresponding to
PEG1-5 positions) at or near the putative A2 LRP binding region
were selected as examples for site-directed PEGylation based on the
high surface exposure and outward direction of their Ca to C13
trajectory. Furthermore, these residues are roughly equidistant
from each other in the three-dimensional structure of the molecule,
so that together they can represent this entire region. Eight
positions (1808, 1810, 1812, 1813, 1815, 1795, 1796, 1803, 1804
corresponding to PEG6-14) at or near the putative A3 LRP binding
region were selected as examples for site-directed PEGylation. PEG6
(K1808) is adjacent to 1811-1818 and the natural N-linked
glycosylation site at 1810. PEGylation at position 1810 (PEG7) will
replace the sugar with a PEG. Mutation at the PEG8 position T1812
will also abolish the glycosylation site. Although the PEG9
position (K1813) was predicted to be pointing inward, it was
selected in case the structure model is not correct. PEG10 (Y1815)
is a bulky hydrophobic amino acid within the LRP binding loop, and
may be a critical interacting residue since hydrophobic amino acids
are typically found at the center of protein-protein interactions.
Because the 1811-1818 region has been reported to be involved in
both LRP and FIX binding, PEGylation within this loop was thought
possibly to result in reduced activity. Thus, PEG11-PEG14 (1795,
1796, 1803, 1804) were designed to be near the 1811-1818 loop but
not within the loop so that one can dissociate LRP and FIX binding
with different PEG sizes.
[0103] To block both LRP binding sites simultaneously, double
PEGylation at, for example, the PEG2 and PEG6 position, can be
generated.
[0104] Since the 558-565 region has been shown to bind to both HSPG
and FIX, no sites were designed within this region. Instead,
PEG15-PEG17 (377, 378, and 556) were designed in between the A2 LRP
and HSPG binding regions so that an attached PEG may interfere both
interactions and disrupt possible interactions between them.
Additional sites that are surface exposed and outwardly pointing
could also be selected within or near the LRP and HPSG binding
regions. To identify novel clearance mechanisms, FVIII can be
systematically PEGylated. In addition to PEG1-17, the three other
natural glycosylation sites, namely, N41, N239, and N2118
corresponding to PEG18-20 can be used as tethering points for
PEGylation since they should be surface exposed. Surface areas
within a 20 angstrom radius from the C13 atoms of PEG2, PEG6, and
the four glycosylation sites were mapped onto the BDD model in
addition to functional interaction sites for vWF, FIX, FX,
phospholipid, and thrombin.
[0105] PEG21-29 corresponding to Y81, F129, K422, K523, K570,
N1864, T1911, Q2091, and Q2284 were then selected based on their
ability to cover nearly the entire remaining BDD surface with a 20
angstrom radius from each of their C13 atoms. These positions were
also selected because they are fully exposed, outwardly pointing,
and far away from natural cysteines to minimize possible incorrect
disulfide formation. The 20 angstrom radius is chosen because a
large PEG, such as a 64 kD branched PEG, is expected to have the
potential to cover a sphere with about a 20 angstrom radius.
PEGylation of PEG21-29 together with PEG2 and PEG6 and
glycosylation sites PEG18, 19, and 20 is likely to protect nearly
the entire non-functional surface of FVIII.
[0106] PEGylation positions that lead to enhanced properties such
as improved PK profile, greater stability, or reduced
immunogenicity can be combined to generate multi-PEGylated product
with maximally enhanced properties. PEG30 and PEG31 were designed
by removing the exposed disulfides in A2 and A3 domain,
respectively. PEG30, or C630A, should free up its disulfide partner
C711 for PEGylation. Likewise, PEG31, C1899A should allow C1903 to
be PEGylated.
[0107] MUTAGENESIS. Substrates for site-directed PEGylation of
FVIII may be generated by introducing a cysteine codon at the site
chosen for PEGylation. The Stratagene cQuickChange.TM. II
site-directed mutagenesis kit was used to make all of the PEG
mutants (Stratagene kit 200523 from Stratagene Corporation, La
Jolla, Calif.). The cQuikChange.TM. site-directed mutagenesis
method is performed using PfuTurbo.RTM. DNA polymerase and a
temperature cycler. Two complimentary oligonucleotide primers,
containing the desired mutation, are elongated using PfuTurbo,
which will not displace the primers. dsDNA containing the wildtype
FVIII gene is used as a template. Following multiple elongation
cycles, the product is digested with DpnI endonuclease, which is
specific for methylated DNA. The newly synthesized DNA, containing
the mutation, is not methylated, whereas the parental wild-type DNA
is methylated. The digested DNA is then used to transform XL-1 Blue
super-competent cells.
[0108] The mutagenesis efficiency is almost 80%. The mutagenesis
reactions were performed in either pSK207+BDD C2.6 or pSK207+BDD
(FIG. 1). Successful mutagenesis was confirmed by DNA sequencing
and appropriate fragments, containing the mutation, were
transferred into the FVIII backbone in the mammalian expression
vector pSS207+BDD. After transfer, all of the mutations were again
sequence-confirmed. For A3 muteins PEG 6, 7, 8, 9, and 10,
mutagenesis was done in the vector pSK207+BDD C2.6. After being
confirmed by sequencing, the mutant fragment, KpnI/Pme was
subcloned into pSK207+BDD. The BDD mutein was then subcloned into
the pSS207+BDD expression vector. For A3 muteins PEG 11, 12, 13,
14, the mutagenesis was done directly in the vector pSK207+BDD and
sequence-confirmed mutant BDD were then subcloned into pSS207+BDD.
For A2 muteins PEG 1, 2, 3, 4, 5, the mutagenesis was done in the
pSK207+BDD C2.6vector. The sequence confirmed mutant was subcloned
into pSK207+BDD and then to pSS207+BDD.
The Primers (Sense Stand Only) Used for Mutagenesis are Listed for
Each Reaction
TABLE-US-00001 [0109] PEG1, Y487C: (SEQ ID NO: 5)
GATGTCCGTCCTTTGTGCTCAAGGAGATTACCA PEG2, L491C: (SEQ ID NO: 6)
TTGTATTCAAGGAGATGCCCAAAAGGTGTAAAAC PEG3, K496C: (SEQ ID NO: 7)
TTACCAAAAGGTGTATGCCATTTGAAGGATTTTC PEG4, L504C: (SEQ ID NO: 8)
AAGGATTTTCCAATTTGCCCAGGAGAAATATTC PEG5, Q468C: (SEQ ID NO: 9)
GATTATATTTAAGAATTGCGCAAGCAGACCATAT PEG6, K1808C: (SEQ ID NO: 10)
TAGAAAAAACTTTGTCTGCCCTAATGAAACCAAAAC PEG7, N1810C: (SEQ ID NO: 11)
AACTTTGTCAAGCCTTGCGAAACCAAAACTTAC PEG8, T1812C: (SEQ ID NO: 12)
GTCAAGCCTAATGAATGCAAAACTTACTTTTGGA PEG9, K1813C: (SEQ ID NO: 13)
CAAGCCTAATGAAACCTGCACTTACTTTTGGAAAG PEG10, Y1815C: (SEQ ID NO: 14)
CTAATGAAACCAAAACTTGCTTTTGGAAAGTGCAAC PEG11, D1795C: (SEQ ID NO: 15)
ATTTCTTATGAGGAATGCCAGAGGCAAGGAGCA PEG12, Q1796C: (SEQ ID NO: 16)
TCTTATGAGGAAGATTGCAGGCAAGGAGCAGAA PEG13, R1803C: (SEQ ID NO: 17)
CAAGGAGCAGAACCTTGCAAAAACTTTGTCAAGCCT PEG14, K1804C: (SEQ ID NO: 18)
GGAGCAGAACCTAGATGCAACTTTGTCAAGCCT PEG15, K377C: (SEQ ID NO: 19)
CGCTCAGTTGCCAAGTGTCATCCTAAAACTTGG PEG16, H378C: (SEQ ID NO: 20)
TCAGTTGCCAAGAAGTGTCCTAAAACTTGGGTA PEG17, K556C: (SEQ ID NO: 21)
CTCCTCATCTGCTACTGCGAATCTGTAGATCAA PEG18, N41C: (SEQ ID NO: 22)
CAAAATCTTTTCCATTCTGCACCTCAGTCGTGTAC PEG19, N239C: (SEQ ID NO: 23)
GTCAATGGTTATGTATGCAGGTCTCTGCCAGGT PEG20, N2118C: (SEQ ID NO: 24)
CAGACTTATCGAGGATGTTCCACTGGAACCTTA PEG21, Y81C: (SEQ ID NO: 25)
ATCCAGGCTGAGGTTTGTGATACAGTGGTCATT PEG22, F129C: (SEQ ID NO: 26)
GAAGATGATAAAGTCTGTCCTGGTGGAAGCCAT PEG23, K422C: (SEQ ID NO: 27)
CAGCGGATTGGTAGGTGTTACAAAAAAGTCCGA PEG24, K523C: (SEQ ID NO: 28)
GAAGATGGGCCAACTTGCTCAGATCCTCGGTGC PEG25, K570C: (SEQ ID NO: 29)
CAGATAATGTCAGACTGCAGGAATGTCATCCTG PEG26, N1864C: (SEQ ID NO: 30)
CACACTAACACACTGTGTCCTGCTCATGGGAGA PEG27, T1911C, (SEQ ID NO: 31)
CAGATGGAAGATCCCTGCTTTAAAGAGAATTAT PEG28, Q2091C: (SEQ ID NO: 32)
ACCCAGGGTGCCCGTTGCAAGTTCTCCAGCCTC PEG29, Q2284C: (SEQ ID NO: 33)
AAAGTAAAGGTTTTTTGCGGAAATCAAGACTCC PEG30, C630A: (SEQ ID NO: 34)
TTGCAGTTGTCAGTTGCTTTGCATGAGGTGGCA PEG31, C1899A: (SEQ ID NO: 35)
AATATGGAAAGAAACGCTAGGGCTCCCTGCAAT
[0110] MUTEIN EXPRESSION. After insertion in a vector that confers
resistance to Hygromycin B, the PEG muteins were transfected into
HKB11 cells (U.S. Pat. No. 6,136,599) complexed with 293 Fectin
Transfection Reagent (Invitrogen Corp. Cat#12347-019) per the
manufacturer's instructions. FVIII expression at three days
post-transfection was assessed by Coatest chromogenic assay
(Chromogenix Corp. Cat#821033, see Example 12 Chromogenic Assay)
(Table 1). The transfected cells were then placed under selective
pressure with 50 .mu.g/ml of Hyg B in a growth medium supplemented
with 5% FBS. When Hyg B-resistant colonies appeared, they were
manually picked and screened for FVIII expression by Coatest
chromogenic assay. The FVIII expressing stable cells were then
adapted to a medium containing HPPS supplement. The cells were
expanded and seeded at 1.times.106 cells/ml in shaking flasks with
fresh media. Tissue culture fluid (TCF), harvested after 3 days,
was used for purification of FVIII BDD muteins. The FVIII activity
of the TCF was assayed by Coatest (Table 1).
TABLE-US-00002 TABLE 1 Expression level of PEG Muteins from
transient and stable transfections. Summary of PEG Mutein Titers
Titer (IU/ml) Mutation Mutein ID Transient Stable Cells Y487C PEG1
0.07 N/A L491C PEG2 0.60 1.96 K496C PEG3 0.45 N/A L504C PEG4 0.38
5.57 Q468C PEG5 0.69 8.14 K1808C PEG6 0.54 2.73 N1810C PEG7 0.21
0.5 T1812C PEG8 0.16 N/A K1813C PEG9 0.35 7.74 Y1815C PEG10 0.09
N/A D1795C PEG11 0.27 N/A Q1796C PEG12 0.29 N/A R1803C PEG13 0.11
N/A K1804C PEG14 0.18 1.14 L491C/K1808C PEG2+6 0.11 2.48
L491C/K1804C PEG2+14 0.13 7.19 K377C PEG15 0.11 12.58 H378C PEG16
0.15 0.97 K556C PEG17 0.09 0.15 N41C PEG18 0.05 N/A N239C PEG19
0.16 N/A N2118C PEG20 0.13 N/A Y81C PEG21 0.36 N/A F129C PEG22 0.25
2.55 K422C PEG23 0.28 N/A K523C PEG24 <0.05 N/A K570C PEG25
<0.05 N/A N1864C PEG26 0.15 N/A T1911C PEG27 0.28 N/A Q2091C
PEG28 0.20 N/A Q2284C PEG29 0.17 N/A C630A PEG30 <0.05 0.20
C1899A PEG31 0.30 1.80
[0111] MUTEIN PURIFICATION. Upon collecting the cell culture
supernatant containing the secreted mutein FVIII protein, the
supernatant is filtered through a 0.2 micron membrane filter to
remove any remaining cells. The supernatant is then concentrated by
either ultrafiltration or anion exchange. It is then applied to an
immunoaffinity column where the cell culture media components and
the majority of the host cell protein impurities are removed. The
immunoaffinity column eluate is then buffer exchanged by
diafiltration into a formulation buffer containing sucrose and
frozen. Yield and recovery of protein across a monoclonal FVIII
antibody column was assessed by chromogenic assay. Samples of load,
flow through, various eluate fractions, strip, and the diafiltered
eluate of a chromatography run were assayed for FVIII activity
(Table 2). Table 2 shows the recovery of the PEG2 mutein from a
monoclonal antibody column. The antibodies are C7F7 antibodies. The
percent recovery in Table 2 is determined by the chromogenic assay.
The final yield was 73%. Shown in FIG. 2 is a plot of the UV
absorbance at 280 nm with respect to time for the PEG2 protein
purified over a monoclonal FVIII antibody chromatography column.
The chromatography was performed using an AKTA.RTM. Explorer 100
chromatography system from Amersham Bioscience. This instrument
employs a multi-wavelength UV-Visible monitor and a 2 mm flow cell.
The PEG2 mutein is eluted from the column in the presence of high
salt and elution peak is indicated by both the absorbance at 280 nm
and FVIII activity assay.
TABLE-US-00003 TABLE 2 Recovery of PEG2 mutein from monoclonal
FVIII antibody column. Step % Recovery C7F7 Load 100 C7F7 Flow
through 1.1 C7F7 Wash 0.2 C7F7 Eluate 86 C7F7 Strip 0.0 Post UF/DF
73
[0112] PEGYLATION. Native full-length FVIII or BDD cannot be
PEGylated by cysteine-specific PEGs without reduction and
denaturation at over 100-fold excess PEG: protein ratio (data not
shown), confirming the hypothesis based on the BDD structure model
that all native cysteines form disulfides or are buried within
FVIII. FVIII cysteine muteins expressed and purified using the
standard protocols listed above could not be PEGylated with a
cysteine-specific PEG maleimide reagent, presumably because the
introduced FVIII cysteine is "capped" by reacting with sulfhydryl
groups such as cysteine and .beta.-mecaptoethanol present in the
cell growth media. This issue can potentially be resolved by
eliminating cysteines and .beta.-mecaptoethanol from the culture
media, but this may lead to lower FVIII production and would not
prevent sulfhydryls released by the cells from blocking the
introduced FVIII cysteine.
[0113] In another aspect of the invention, a three-step method was
developed to allow site-specific PEGylation of FVIII (FIG. 3). In
step 1, the purified FVIII cysteine mutein at about 1 .mu.M is
mildly reduced with reductants such as about 0.7 mM
Tris(2-carboxyethyl)phosphine (TCEP) or 0.07 mM dithiothreitol
(DTT) for 30 minutes at 4.degree. C. to release the "cap." In step
2, the reductant is removed along with the "cap" by a
size-exclusion chromatography (SEC) method such as running the
sample through a spin column (BioRad.RTM.) to allow FVIII
disulfides to reform while leaving the introduced cysteine free and
reduced. In step 3, at least 30 minutes after the removal of the
reductant, the freed FVIII cysteine mutein is treated with at least
10-fold molar excess of PEG-maleimide with sizes ranging from 5 to
64 kD (Nektar Therapeutics and N.O.F. Corporation) for at least 1
hour at 4.degree. C. This method yields highly consistent product
profile with reproducible data for dozens of reactions repeated by
different individuals.
[0114] Because the spin column method for removal of TCEP is not
scaleable, gel filtration desalting chromatography was selected.
However, upon testing this method using a TCEP spike sample, it was
shown that the TCEP eluted at measurable levels in the column void
and not just in the salt fraction as would be expected from a
molecule with its low molecular weight. Western Blot assays showed
significant background PEGylation probably due to incomplete
removal of TCEP. In the meantime separate experiments showed that
C7F7 purified material could be significantly purified further from
other protein impurities using an anion exchange chromatography
media combined with a salt gradient. It was then decided to reduce
the C7F7 material with TCEP as described above and then process the
material over the anion exchange column. Because of charge
difference the FVIII protein would be retained while the TCEP would
flow through the column and not be retained. At the same time
during the gradient salt elution the FVIII protein would be
purified away from the majority of remaining protein impurities.
This meant that the later occurring PEGylation would be
theoretically more homogeneous with purer starting material.
However, upon testing with a spike sample of TCEP, it was shown
that measurable levels of TCEP were found eluting in the gradient
with the FVIII. Therefore it was decided to implement gel
filtration desalting chromatography after anion exchange
chromatography so these two steps when used in sequence would
result in complete removal of TCEP and elimination of non-specific
PEGylation.
[0115] PEGYLATION ANALYSIS BY SDS PAGE AND WESTERN BLOT. The
PEGylated product can be analyzed by electrophoresis on a reducing
6% TrisGlycine SDS polyacrylamide gel (Invitrogen). Following
electrophoresis, the gel can be stained with Coomassie Blue to
identify all the proteins or subjected to a standard Western Blot
protocol to identify PEGylation pattern on different regions of
FVIII. Staining of the blot with a mouse monoclonal R8B12 or C7F7
antibody raised against the C-terminal region of the FVIII heavy
chain or the N-terminal region of the VIII light chain,
respectively, should identify PEGylation of the respective chains.
Staining with the 413 antibody against the 484-509 region of FVIII
will determine whether PEGylation is indeed site-specific or not
for muteins such as PEG1-4. Likewise, staining with the CLB-CAg A
antibody that recognizes the 1801-1823 region of FVIII will
determine if PEGylation is site-specific or not for muteins such as
PEG6-10.
[0116] PEG2 (L491C) PEGylation was shown to be selective for the
heavy chain over light chain and particularly selective for the
484-509 region (FIG. 4) while PEG6 (K1808C) was shown to be
selective for the light chain over the heavy chain (FIG. 5).
[0117] For the study depicted in FIG. 4, the PEG2 mutein (lanes 1
and 8) is reduced with TCEP followed by TCEP removal (lanes 2 and
9) and treatment with 5, 12, 22, 33, or 43 kD PEG-maleimide (lanes
3-7 and 10-14). UnPEGylated FVIII runs as unprocessed (H+L) and
processed heavy (H) and light (L) chain bands. All three bands are
detectable on the Coomassie Blue stained gel (lower right) whereas
Western Staining with chain-specific antibodies reveal only the
unprocessed and the corresponding chain. Using R8B12 staining
(upper left), the heavy chain (H) band is dramatically reduced in
intensity when PEG2 is treated with PEG-maleimide and a new band is
created that runs higher than the parent H band proportional to the
size of the PEG. Using C7F7 staining (lower left), the light chain
(L) bands (multiple bands due to heterogenous glycosylation) do not
change intensity. The unprocessed H+L band for both stains are
shifted because the H chain is part of the unprocessed FVIII.
Coomassie staining also confirms much more PEGylation of the heavy
chain, i.e. reduction of H band intensity, than of the light chain.
Finally, the PEGylated bands lose relatively more intensity on the
413 antibody stain (upper right) than R8B12 stain in a PEG
size-dependent fashion presumably due to site-specific PEGylation
of 491, which blocks the binding of 413 antibody to 484-509.
Quantities of FVIII loaded per lane are about 30 ng for the two
left gels, about 1000 ng for the upper right gel, and about 2000 ng
for the lower right gel.
[0118] Reduction followed by removal of reductant does not change
the migration of FVIII (lane 1 vs. 2 and 8 vs. 9). Addition of 22
kD PEG to PEG2 blocks the binding of the 413 antibody, consistent
with specific PEGylation at the 491 position (FIG. 4 upper right
gel). This also suggests that PEGylated PEG2 will have lower
immunogenicity in man because the 413 antibody has been shown to
share the same epitope as human A2 inhibitory antibodies (Scandella
et al., 1992, Thromb. Haemost. 67, pp. 665-71).
[0119] For the study depicted in FIG. 5, the PEG6 mutein is reduced
with TCEP followed by TCEP removal (lanes 1 and 6) and treatment
with 5, 12, 22, or 33 kD PEG-maleimide (lanes 2-5 and 7-10).
UnPEGylated FVIII runs as unprocessed (H+L) and processed heavy (H)
and light (L) chain bands. Because the PEG6 (K1808) mutation
resides on the light chain, PEGylation was detected only on the
light chain and not the heavy chain. Amount of FVIII loaded per
lane is about 100 ng for the left gel and about 30 ng for the right
gel.
[0120] The BDD that was run as a control did not show any
significant PEGylation upon treatment with greater than 100-fold
molar excess of PEG-maleimide even after the reduction and
reductant removal procedure described above (FIG. 6A-6D). The same
method was also applied to PEG4 and PEGS (FIG. 6A-6D). Compared to
PEG2, these muteins were not PEGylated as efficiently, but they
were selective for the heavy chain similar to PEG2 (L491C). PEG6
(K1808C) PEGylation efficiency is relatively low, perhaps because
it is very close to the N-linked glycosylation site at N1810, which
may block PEGylation at position 1808. Thus, we designed PEG7
(N1810C) to remove the native glycosylation site at 1810. PEG7
shows improved PEGylation efficiency compared to PEG6 in a
head-to-head comparison (FIG. 6E). Similarly PEG15 shows slightly
better PEGylation efficiency than PEG2. PEG2+6, a double mutant of
BDD, can be PEGylated on both heavy and light chains since PEG2 is
a heavy chain cysteine mutation while PEG6 is a light chain
mutation (FIG. 6F). This method was also applied to wildtype
full-length FVIII (FIG. 6G). PEGylation was detected for the
largest fragment of heavy chain that includes A1, A2, and most of
the B domain. The PEGylation pattern suggests monoPEGylation and
that there is only a single cysteine PEGylated.
[0121] PEGYLATION ANALYSIS BY THROMBIN CLEAVAGE AND WESTERN BLOT.
The PEGylated product can be treated with thrombin (40 IU/ug FVIII)
at 37.degree. C. for 30 minutes. The thrombin used also contains
APC as a contaminant. Thrombin cleavage will generate the 50 kD A1
and 43 kD A2 domains from the heavy chain while the APC cleavage
will split the A2 domain further into the 21 and 22 kD fragments
(FIG. 7). Staining with the R8B12 antibody, which recognizes the
C-terminus of the heavy chain, will identify only the intact A2
domain and the 21 kD C-terminal fragment (FVIII 562-740). Thus, if
PEG2 PEGylation was specific for position 491, the 43 kD A2 domain
should be PEGylated but not the 21 kD C-terminal fragment. This was
indeed confirmed by the Western blot for the 22 kD PEGylated PEG2
shown on FIG. 7. Thus, by elimination, PEG2 PEGylation has been
localized to the N-terminal 22 kD fragment (FVIII 373-561) of A2
domain. Since PEG-maleimide is completely selective for cysteines
at pH 6.8 and the only native FVIII cysteines within 373-561 come
from a buried disulfide between 528 and 554, PEG2 is very likely
PEGylated on the introduced cysteine at position 491. Western
staining of thrombin-treated PEGylated PEG2 with a FVIII heavy
chain N-terminal antibody showed no PEGylation of the A1 domain
(data not shown). Selective PEGylation of PEG2 using thrombin
cleavage method has also been confirmed for PEGs of 5, 12, 33, and
43 kDs (data not shown). Thrombin cleavage of PEGylated wildtype
full-length FVIII shows that only B domain is PEGylated (FIG.
8)
[0122] PEGYLATION ANALYSIS BY IODINE STAINING. To confirm that the
newly created bands on Coomassie Blue and Western staining were
indeed PEGylated bands, barium-iodine staining, which is specific
for PEG, was used (FIG. 9). PEGylated PEG2 was run on a 6%
TrisGlycine gel (Invitrogen) and stained with the R8B12 heavy chain
antibody or a barium-iodine solution (Lee et al, Pharm Dev Technol.
1999 4:269-275). The PEGylated bands matched between the two stains
using the molecular weight marker to line them up, thus confirming
FVIII heavy chain PEGylation.
[0123] PEGYLATION ANALYSIS BY MALDI-MASS SPEC. To confirm the
PEGylation of the A2 domain in the heavy chain, the rFVIII sample,
before and after PEGylation was analyzed by matrix-assisted laser
desorption/ionization (MALDI) mass spectrometry. The samples were
mixed and crystallized on the MALDI target plate with a sinapinic
acid matrix in 30% acetonitrile, 0.1% TFA. They were then analyzed
in a Voyager DE-PRO spectrometer in positive, linear mode. The
results, shown in FIG. 10, showed the light chain of PEG2 centered
at 83 kD and the heavy chain (HC) at 89 kD. The spectrum acquired
for the PEGylated sample showed a drop in the HC peak and a new
peak, centered at 111 kD, to form. This confirms PEGylation of the
heavy chain. No PEGylated light chain (at 105 kD) was observed
above detection limit.
[0124] The samples were then both subjected to thrombin digestion
at 20 units of thrombin/mg FVIII at 37.degree. C. for 30 minutes,
following FVIII concentration determination by amino acid analysis
(Commonwealth Biotechnologies, Inc). The heavy chain was cleaved
into a 46 kD (A1) N-terminal fraction and a 43 kD (A2) fraction.
The MALDI spectrum acquired for the PEGylated sample (FIG. 11)
shows the loss of the 43 kD peak and the development of a new 65 kD
peak, due to the PEGylated A2 domain. PEGylation of the LC is again
not observed above the detection limit. These results again confirm
PEGylation of the A2 domain of FVIII. The same analysis was applied
to PEGylated PEG6, confirming PEGylation of the light chain A3C1C2
fragment (FIG. 12).
[0125] Activity Measurement
[0126] COAGULATION ASSAY. The clotting FVIII:C test method is a
one-stage assay based upon the activated partial thromboplastin
time (aPTT). FVIII acts as a cofactor in the presence of Factor
IXa, calcium, and phospholipid in the enzymatic conversion of
Factor X to Xa. In this assay, the diluted test samples are
incubated at 37.degree. C. with a mixture of FVIII deficient plasma
substrate and aPTT reagent. Calcium chloride is added to the
incubated mixture and clotting is initiated. An inverse
relationship exists between the time (seconds) it takes for a clot
to form and logarithm of the concentration of FVIII:C. Activity
levels for unknown samples are interpolated by comparing the
clotting times of various dilutions of test material with a curve
constructed from a series of dilutions of standard material of
known activity and are reported in International Units per mL
(IU/mL).
[0127] CHROMOGENIC ASSAY. The chromogenic assay method consists of
two consecutive steps where the intensity of color is proportional
to the FVIII activity. In the first step, Factor X is activated to
FXa by FIXa with its cofactor, FVIIIa, in the presence of optimal
amounts of calcium ions and phospholipids. Excess amounts of Factor
X are present such that the rate of activation of Factor X is
solely dependent on the amount of FVIII. In the second step, Factor
Xa hydrolyzes the chromogenic substrate to yield a chromophore and
the color intensity is read photometrically at 405 nm. Potency of
an unknown is calculated and the validity of the assay is checked
with the slope-ratio statistical method. Activity is reported in
International Units per mL (IU/mL).
[0128] The 1811-1818 loop is involved in binding to FIX, but the
importance of individual positions within this loop has not been
determined. PEG7-10 muteins display nearly identical specific
chromogenic activity relative to native FVIII (Table 3). Table 3
shows the percent specific activity (S.A.) of PEG muteins and
PEGylated PEG2 or PEG6 relative to BDD. S.A. was determined by
dividing the chromogenic, coagulation, or vWF binding activity by
the total antigen ELISA (TAE) value. The S.A. of PEGylated muteins
was then divided by the S.A. of BDD (8 IU/ug chromogenic, 5 IU/ug
coagulation, and 1 vWF/TAE) and multiplied by 100 to obtain the
percent S.A. listed in Table 3 under the headings chromogenic,
coagulation and vWF/TAE.
TABLE-US-00004 TABLE 3 Percent specific activity (S.A.) of PEG
muteins and PEGylated PEG2 and PEG6 relative to BDD. Chromo- Coagu-
Mutation genic lation vWF/TAE BDD 100 100 100 PEG1 Y487C PEG2 L491C
125 130 138 PEG2 red L491C 137 141 98 PEG2-5 kD PEG L491C 124 93
125 PEG2-12 kD PEG L491C 118 25 71 PEG2-22 kD PEG L491C 103 13 87
PEG2-33 kD PEG L491C 130 17 59 PEG2-43 kD PEG L491C 91 9 57 PEG3
K496C PEG4 L504C PEG5 Q468C 92 PEG6 K1808C 83 60 100 PEG6-33 kD PEG
K1808C 42 6 90 PEG7 N1810C 100 PEG8 T1812C 100 PEG9 K1813C 83 PEG10
Y1815C 75 PEG11 D1795C PEG12 Q1796C PEG13 R1803C PEG14 K1804C
PEG2+6 491C/1808C PEG15 K377C 82 PEG16 H378C 126 PEG17 K556C 43
PEG18 N41C 80 PEG19 N239C PEG20 N2118C 127 PEG21 Y81C PEG22 F129C
83 PEG23 K422C PEG24 K523C PEG25 K570C PEG26 N1864C PEG27 T1911C
PEG28 Q2091C PEG29 Q2284C
[0129] As used in Table 3, "PEG2 red" is PEG2 mutein that has been
treated with reductant followed by the removal of reductant. This
reduction procedure did not significantly alter the three
functional activities of FVIII. PEG2 mutein conjugated to PEGs
ranging from 5 kD (PEG2-5 kD) to 43 kD (PEG2-43 kD) did not lose a
significant amount of chromogenic activity, but had greatly lower
coagulation activity as the PEG size increases beyond 5 kD. There
may be a modest reduction in vWF binding for larger size PEGylated
PEG2 also.
[0130] TOTAL ANTIGEN ELISA (TAE). FVIII is captured on a microtiter
plate that has been coated with a polyclonal FVIII antibody. The
FVIII bound is detected with a biotinylated polyclonal rFVIII
antibody and streptavidin horseradish peroxidase (HRP) conjugate.
The peroxidase-streptavidin complex produces a color reaction upon
addition of the tetramethylbenzidine (TMB) substrate. Sample
concentrations are interpolated from a standard curve using four
parameter fit models. FVIII results are reported in .mu.g/m L.
[0131] vWF BINDING ELISA. FVIII is allowed to bind to vWf in Severe
Hemophilic Plasma in solution. The FVIII-vWf complex is then
captured on a microtiter plate that has been coated with a
vWf-specific monoclonal antibody. The FVIII bound to the vWf is
detected with a FVIII polyclonal antibody and a horseradish
peroxidase-anti-rabbit conjugate. The peroxidase-conjugated
antibody complex produces a color reaction upon addition of the
substrate. Sample concentrations are interpolated from a standard
curve using four parameter fit model. FVIII binding results are
reported in .mu.g/m L. There was no significant impact on any of
the activities upon PEGylation, which would be consistent with
PEGylation at the B domain.
TABLE-US-00005 TABLE 4 Specific activity (S.A.) of wildtype full
length FVIII (KG-2) before and after PEGylation with different
sizes of PEG. TAE Coagulation Assay Chromogenic Assay vWF ELISA
Sample ug/mL IU/mL IU/ug % Start IU/mL IU/ug % Start ug/mL vWF/TAE
% Start KG-2 start 1.31 4.8 3.6 100 5.60 4.3 100 0.42 0.32 100
Reduced only 0.93 3.1 3.4 93 4.08 4.4 103 KG-2-5kD PEG 0.71 2.5 3.5
96 3.09 4.3 102 KG-2-12kD PEG 0.59 2.3 3.9 107 2.99 5.0 118
KG-2-22kD PEG 0.63 2.5 3.9 108 3.06 4.8 113 0.19 0.30 94 KG-2-30kD
PEG 0.59 2.5 4.1 114 3.01 5.1 119 0.19 0.32 100 KG-2-43kD PEG 0.52
2.4 4.6 128 2.86 5.5 129
[0132] PURIFICATION OF PEGylated FVIII BY ION-EXCHANGE
CHROMATOGRAPHY. PEGylated FVIII is applied to an anion exchange
column or cation exchange column where the protein binds to the
column while any excess free PEG reagent does not bind and is
removed in the flow through. The PEG mutein is then eluted from the
column with a sodium chloride gradient. A barium-iodine stained
4-12% Bis-Tris gel of load, flow through, and gradient fractions
was used to confirm that the column elution fractions have
PEGylated mutein.
[0133] PURIFICATION OF PEGylated FVIII BY SIZE-EXCLUSION
CHROMATOGRAPHY. The anion exchange fractions containing the
majority of PEG2 mutein are pooled and concentrated by
ultrafiltration then applied to a size exclusion column. The column
is then eluted using the formulation buffer. Because of the
difference in the size and shape of the protein depends on whether
PEG is bound to the protein, this column separates the PEGylated
PEG2 mutein from that of any remaining PEG2, which is not
PEGylated. The PEGylated mutein FVIII fractions are pooled based on
having the most FVIII activity then frozen for subsequent animal
studies and molecular characterization. FIG. 13 compares the
elution of non-PEGylated PEG2 mutein versus that of the 43 kD
PEGylated PEG2 mutein. The PEGylated PEG2 elutes significantly
earlier, which indicates an increase in its size and shape from the
covalently attached PEG.
[0134] With muteins such as PEG6 that show lower efficiencies of
PEGylation, i.e. less than 50%, the most effective purification
scheme to yield highly pure mono-PEGylated product is to use a
combination of cation exchange chromatography followed by size
exclusion chromatography. For example, with PEG6, the cation
exchange chromatography purifies the PEGylated PEG6 (earlier
eluting fraction, FIG. 14) away from the majority of un-PEGylated
PEG6 (later eluting fraction, FIG. 15). The size exclusion
chromatography then polishes the PEGylated protein (earlier eluting
fraction, FIG. 15) from the remainder of un-PEGylated protein
(later eluting fraction FIG. 15).
[0135] EFFECT OF PEG SIZE ON ACTIVITY. To test whether PEG sizes
have an effect on both coagulation and chromogenic activities of
FVIII upon PEGylation, purified full-length FVIII, PEG2, PEG6, and
PEG14 were reduced by TCEP followed by reductant removal and
reaction with a buffer control or PEGs ranging from 6 kD to 64 kD.
The resulting PEGylated FVIII was directly assayed without removal
of excess PEG or unPEGylated FVIII. Control experiments showed that
the excess PEG has no effect on FVIII activity.
[0136] FIG. 16 shows the results of this study. Purified
full-length FVIII is represented as KG-2 in FIG. 16. The percent
activity reported in FIG. 16 was determined by dividing the value
of sample treated with PEG after reduction and reductant removal by
that of the sample treated with buffer control taking into
consideration the PEGylation yield. PEGylation yields were
comparable across all PEGs for any given FVIII construct. They are
about 80% for KG-2, PEG2, and PEG14 and about 40% for PEG6. For
example, PEG14 buffer control treated has a coagulation activity of
6.8 IU/mL vs. 3.2 IU/mL for the 12 kD PEGylated PEG14 sample.
However, the PEGylation efficiency was about 80%, meaning the 3.2
IU/mL represents the aggregate activity of about 80% PEGylated and
about 20% unPEGylated. Assuming the unPEGylated sample has the same
activity as the buffer control treated PEG14, the percent activity
of unPEGylated for the PEGylated PEG14 works out to be 34%=(3.2-6.8
times 20%)/(6.8 times 80%).
[0137] PEGylation within the A2 or A3 domain at PEG2, PEG6, or
PEG14 position of BDD led to dramatic losses of coagulation
activity when PEG size increases beyond 6 kD. However, PEGylation
within the B domain at a native B-domain cysteine of the
full-length FVIII had no effect on the coagulation activity.
Interestingly, the chromogenic activity is not affected for all
PEGylated constructs. This may be due to assay differences. It is
possible that the small chromogenic peptide substrate has an easier
access to a PEGylated FVIII/FIX/FX complex than the larger protein
substrate used in the coagulation assay. Alternatively, PEG may
affect activation of the mutein. This would be more readily
detected by the one-stage coagulation assay than the two-stage
chromogenic assay.
[0138] To confirm the observation of PEG effects on the coagulation
activity of PEG2, 6, and 14, several PEGylated contructs were
purified away from excess PEG and unPEGylated. Since PEG does not
have any effect on the chromogenic activity, the chromogenic to
coagulation activity ratio is a good estimate on the relative
effect of PEG on coagulation activity (Table 5). Larger PEGs at a
given position such as PEG2 and a higher number of PEGs as in the
case with the PEG2+6 construct induce a greater loss of coagulation
activity.
TABLE-US-00006 TABLE 5 Ratio of Chromogenic to Coagulation for
Purified PEGylated BDD. Chromogenic IU/mL/ Coagulation IU/mL
PEGylated BDD Raw Ratio relative Sample ID PEG Ratio to BDD BDD no
PEG 1.7 1 PEG2 (pool2) 22 kD 491 9 5 PEG2 43 kD* 491 25 15 PEG6 12
kD 1808 5 3 PEG6 (old) 33 kD 1808 13 7 PEG6 (new) 33 kD 1808 8 5
PEG2+6 (LSP25) 33 kD at 491, Mono 10 6 PEG2+6 (LSP22) 33 kD at
491/1808, Di 24 14 PEG2+6 (ESP) 33 kD at 491/1808/A3, Tri 60 35
PEG22 64 kD* 129 14 8 PEG14 12 kD 1804 3.2 1.9 PEG14 20 kD* 1804
4.2 2.5 PEG14 33 kD 1804 5 2.9 PEG2+14 (ESP19) 33 kD at 491/1804,
Di 21 12 *branched PEG
[0139] RABBIT PK STUDY. To understand the effects of PEGylation on
the pharmacokinetics (PK) of FVIII, PK studies were performed in a
number of species. NZW SPF rabbits were used for the study: 10
females, 5 rabbits per group, 2 groups (PEG2 FVIII and 22 kD
PEGylated PEG2). Samples were diluted into sterile PBS with a final
concentration of 100 IU/mL (chromogenic units). Each rabbit
received a dose of 1 ml/kg (100 IU/kg) of the diluted test or
control substance via marginal ear vein. At various times
post-injection, blood samples (1 mL) were drawn into a 1 mL syringe
(charged with 100 .mu.L of 3.8% Na-Citrate) from the central ear
artery at defined time points after dosing. Plasma samples were
incubated with R8B12 heavy chain antibody coated on a 96-well plate
to specifically capture the dosed human FVIII. The activity of the
captured FVIII was determined by the chromogenic assay (FIG. 17).
PEGylated PEG2 and PEGylated PEG6 were also compared with BDD
(FIGS. 18 and 19), with PEGylated muteins showing an improvement in
plasma recovery compared to BDD. PEGylated wildtype full-length
FVIII did not appear to show much improvement (FIG. 20).
[0140] MOUSE PK STUDY. As a second species, ICR normal or
hemophilic, FVIII deficient, mice (Taconic, Hudson, N.Y.) were used
in PK studies. Normal mice were used for the study, 5 mice per
group per time point. Test materials were diluted into formulation
buffer to a nominal final concentration of 25 IU/mL. Each mouse can
be administered 4 mL/kg (.about.0.1 mL total volume) of the dilute
test material via tail vein. Blood samples (0.45 or 0.3 mL for
normal or hemophilic mouse study, respectively) are drawn into a 1
mL syringe (charged with 50 or 30 .mu.L of 3.8% Na-Citrate for
normal or hemophilic mouse study, respectively) from the inferior
vena cava at the indicated time point (one animal per sample).
Plasma samples are assayed for FVIII concentration using the
chromogenic assay method described above. PEGylated PEG6 shows
greater plasma recovery compared to BDD or PEG6 (FIG. 21).
PEGylated PEG2 shows greater plasma recovery compared to BDD (FIGS.
22 and 23).
TABLE-US-00007 TABLE 6 PK study summary of PEGylated FVIII showing
plasma half-lives in hours. Construct Half-life, hr Species BDD 6.6
Normal Rabbit PEG2 4.8 Normal Rabbit PEG2-22 kD PEG 7.5 Normal
Rabbit PEG2-43 kD PEG 8.0 Normal Rabbit PEG6-12 kD PEG 8.2 Normal
Rabbit PEG6-33 kD PEG* 9.6 Normal Rabbit PEG6-33 kD PEG 17.4 Normal
Rabbit BDD 4.5 Normal Mouse PEG2-22 kD PEG 7.3 Normal Mouse PEG6-12
kD 5.3 Normal Mouse PEG14-33 kD PEG 7.3 Normal Mouse PEG14-12 kD
PEG 5.5 Normal Mouse PEG22-64 kD 9.2 Normal Mouse *Initial prep of
33 kD PEGylated PEG6 with half-life of 9.6 hr in rabbits was not as
pure as a later prep that yielded 17.4 hr.
TABLE-US-00008 TABLE 7 Plasma recovery of PEGylated PEG muteins in
hemophilic mice. Fold- improvement in plasma recovery at 16 hours
post-injection compared to the BDD control performed on the same
date is reported. Mutein PEG Fold PEG 6 12 kD 2.9 PEG 6 33 kD 2.9
PEG 2+6 33 kD 3.3 PEG 14 33 kD 2.5 PEG 2+6 33 kD 4.4 PEG 2+14 33 kD
2.1 PEG22 64 kD 3.2
[0141] HEMOPHILIC MOUSE (BDD) FACTOR VIII RECOVERY. The Hemophilic
Mouse (BDD) Factor VIII recovery histogram shown in FIG. 24 depicts
a pharmacokinetic (PK) assessment of the half-life of two species
of BDD Factor VIII in a hemophilic mouse assay. This assay was
designed to measure plasma concentrations of both BDD Factor VIII
(referred to in FIG. 24 as "wt" or wild type BDD Factor VIII) and
the PEG 2+6 double PEGylated variant of BDD Factor VIII (and
identified elsewhere herein as the L491C, K1808C double variant of
BDD Factor VIII) at three time points post intravenous
administration in a mouse model. While the PK assessments at both
the 0.8 and 4 hour time points were comparable, the 16 hour
assessment is particularly note worthy. At 16 hours, approximately
four times (400%) as much of the doubly PEGylated BDD Factor VIII
variant (PEG 2+6) remained in the mouse plasma 16 hours after
administration as compared to the un-PEGylated molecule.
[0142] KIDNEY LACERATION MODEL. To determine if PEGylated FVIII
muteins were efficacious at stopping a bleed in a hemophilic mouse,
the kidney laceration model was employed. Hemophilic mice (C57/BL6
with a disrupted FVIII gene) are anesthetized under isofluorane and
weighed. The inferior vena cava was exposed and 100 ul of either
saline or FVIII were injected using a 31 gauge needle. The needle
was carefully removed and pressure applied at the sight of
injection for 30-45 seconds to prevent bleeding. After two minutes,
the right kidney was exposed and held between the forceps along the
vertical axis. Using a #15 scalpel, the kidney was cut horizontally
to a depth of 3 mm. To insure a uniform depth of the lesion, kidney
was lightly held in the middle to expose equal tissue on either
side of the forceps. The exposed surface of the kidney was cut to
the depth of the forceps. Blood loss was quantified as described
above. Different doses of FVIII were tested on mice to characterize
the dose response relationship of FVIII on kidney bleeding.
PEGylated PEG2 shows comparable potency to BDD in reducing blood
loss after mouse kidney injury (FIG. 25). Thus, although the
coagulation activity of PEGylated PEG2 is lower than that of BDD,
this kidney laceration model shows that the in vivo efficacy of
PEGylated PEG2 was not measurably reduced compared to BDD,
consistent with the chromogenic assay data.
[0143] ANTIBODY INHIBITION ASSAY. Adding a high molecular weight
polymer such as polyethylene glycol (PEG) specifically at position
491 (i.e. PEG2) should reduce binding and sensitivity to mAB 413,
and by extension to a large proportion of patient inhibitory
antibodies since many patients develop inhibitor antibodies against
the same mAB 413 epitope. To test this, increasing amounts of mAB
413 was incubated with non-saturating amounts (0.003 IU/mL) of BDD
or 43 kD PEGylated PEG2 and tested for functional activity in a
chromogenic assay (FIG. 26). R8B12, a non-inhibitory antibody, and
ESH4, an inhibitory antibody that targets the C2 domain were used
as controls. PEGylated PEG2 is indeed more resistant to mAB 413
inhibition than BDD and shows a similar inhibition pattern in the
presence of the control antibodies that do not bind near the 491
position. Furthermore, the protection effect of PEG against mAB 413
inhibition is dependent on PEG size, with larger PEGs having a
greater effect (FIG. 27). To test whether PEGylated FVIII is more
resistant to inhibitor antibodies from patients, chromogenic
activity was measured in the presence of a panel of plasma derived
from hemophilia A patients who have developed inhibitors to FVIII.
Of the 8 patient plasma tested, 43 kD PEGylated PEG2 was more
resistant to patient plasma inhibition than BDD in 4 patient plasma
samples. For example, PEGylated PEG2, PEG6, or PEG2+6 showed
greater residual activity than BDD in one patient plasma but not in
another plasma (FIG. 28). The diPEGylated PEG2+6 appears to be more
resistant than monoPEGylated PEG2 or PEG6. These results suggest
that PEGylated PEG muteins can be more effective in treating
patients that develop inhibitors to FVIII.
[0144] HIGH THROUGHPUT PEGYLATION SCREENING. PEGylation efficiency
of a particular PEG mutein is unpredictable, especially since there
is no direct structural information of BDD. For example, based on
the structure model of BDD, one would predict the PEGylation
efficiency of PEG4 and PEGS should be very high, similar to that of
PEG2 and PEG15 since all three positions are surface exposed and
point outwardly according to the structure. Thus, to use PEG to
search for novel clearance mechanism via systematic PEGylation will
require a large number of muteins to be screened.
[0145] To rapidly screen a large number of PEG muteins, a novel
high throughput method has been developed that can test PEGylation
efficiency and functional activity of PEGylated products from
transiently transfected muteins. As little as 5-10 mL of
transiently expressed PEG muteins with an FVIII chromogenic value
of as low as 0.1-0.2 IU/mL is concentrated by about 50-fold using
Amicon-centra Ultra device MWCO 30K so that the concentration of
FVIII reaches above 1 nM, near the affinity range of antibody to
FVIII interaction. The concentrated PEG mutein (.about.300 uL) is
incubated with .about.30 uL of C7F7 FVIII antibody resin overnight
at 4.degree. C., washed, eluted, dialyzed, and reduced. The
reductant is removed and the reduced PEG muteins is PEGylated and
run on a Western analysis as described above (FIGS. 29 and 30).
Relative PEGylation efficiency of transiently expressed PEG muteins
matches exactly to that of purified PEG muteins.
[0146] Dozens of PEG muteins can be screened by this method in one
to two months. For example, PEG14 (K1804C BDD) had at least about
80% PEGylation of light chain with a 12 kD PEG and no PEGylation of
heavy chain (data not shown), consistent with the K1804C mutation
located on the light chain. The Ca to CB distance between K1804 and
K1808 (PEG6 position) is only 8.4 angstrom based on the BDD
structure, suggesting that the introduction of a 43 kD PEG at this
position will have similar improvement in PK as the 33 kD PEGylated
PEG6, with the advantage of much higher PEGylation yield. Relative
PEGylation yield for all PEG muteins tested are summarized in Table
8. PEGylation was highly selective for the particular FVIII chain
where the cysteine mutation was introduced, in that every mutein
with the cysteine in the heavy chain only gets PEGylated on the
heavy chain while every mutein with the cysteine in the light chain
gets PEGylated on the light chain. Mutein numbers 2 to 31 represent
cysteine mutations of BDD replacing the native amino acid at the
position listed with a cysteine. PEG2+6 is a double mutein of BDD
where position 491 and 1808 were substituted with cysteines. A1 and
A2, (and B domain for KG-2, the full-length FVIII) belong to the
heavy chain while A3, C1, and C2 belong to the light chain.
PEGylation efficiency was estimated from running the PEGylated
products on a SDS PAGE comparing the intensities of the PEGylated
band with unPEGylated band: +++.about.>80% PEGylation yield,
++.about.30-70% yield, +.about.10-30% yield, and -.about.<10%
yield.
TABLE-US-00009 TABLE 8 PEGylation efficiency for various PEGylated
FVIII. PEG Mutein Position Domain H-PEG L-PEG 2 491 A2 +++ - 4 504
A2 + - 5 468 A2 + - 6 1808 A3 - ++ 7 1810 A3 - ++ 8 1812 A3 - - 9
1815 A3 - - 11 1795 A3 - + 12 1796 A3 - + 13 1803 A3 - ++ 14 1804
A3 - +++ 15 377 A2 +++ - 16 378 A2 +++ - 17 556 A2 ++ - 20 2118 A3
- + 21 81 A1 ++ - 22 129 A1 ++ - 23 422 A2 - - 25 570 A2 - - 26
1864 A3 - ++ 27 1911 A3 - +++ 28 2091 C1 - ++ 29 2284 C2 - + 30 711
A2 + - 31 1903 A3 - ++ 2+6 490/1808 A2/A3 +++ ++ 2+14 490/1804
A2/A3 +++ +++ KG-2 B +++ -
[0147] MASS SPECTROMETRY ANALYSIS OF REDUCED PEG MUTEINS. To
determine the identity of the "cap" that prevents direct PEGylation
of PEG muteins or full-length FVIII, PEG2+14 was reduced with TCEP
at concentrations ranging from 67 uM to 670 uM. PEGylation yield
increased in proportion to increasing amounts of TCEP (FIG. 31).
The same samples were also analyzed by mass spectrometry prior to
PEGylation (FIG. 32). In order to have a protein domain that could
be directly studied, the samples were digested with thrombin at a
ratio of 20 units/mg FVIII for 30 minutes at 37.degree. C. Thrombin
cleavage produces an A2 fragment that includes residues 372 to 740
and no occupied glycosylation sites. The digested sample was
injected onto a C4 reversed phase liquid chromatography system and
the eluent from the column was introduced directly into the
quadrupole time-of-flight mass spectrometer via an electrospray
interface. The mass spectrum from under the chromatographic peak
corresponding to the A2 domain was deconvoluted to provide a
protein intact mass value. Prior to reduction, the A2 domain of
PEG2+14 yields a mass that is 118 daltons larger than theoretically
predicted. As the TCEP concentration is increased, a new peak that
has the precise predicted mass of A2 domain appears. The proportion
of this new peak increases as the TCEP concentration is increased.
The 118 dalton difference can be accounted for by cysteinylation at
residue Cys 491 via disulfide formation with a cystine (119 Da) and
instrumental accuracy. Thus this shows that the PEG muteins are
capped by a cysteine, which prevents direct PEGylation.
[0148] All of the references disclosed herein are hereby
incorporated herein in their entireties.
Sequence CWU 1
1
3514PRTArtificial SequenceThe first four amino acids for the
B-domain of Human Factor VIII Sequence 1Ser Phe Ser
Gln1210PRTArtificial SequenceThe last ten amino acids for the
B-domain of Human Factor VIII Sequence 2Asn Pro Pro Val Leu Lys Arg
His Gln Arg1 5 1031457PRTArtificial SequenceDerived from human
factor VIII sequence 3Met Gln Ile Glu Leu Ser Thr Cys Phe Phe Leu
Cys Leu Leu Arg Phe1 5 10 15Cys Phe Ser Ala Thr Arg Arg Tyr Tyr Leu
Gly Ala Val Glu Leu Ser 20 25 30Trp Asp Tyr Met Gln Ser Asp Leu Gly
Glu Leu Pro Val Asp Ala Arg 35 40 45Phe Pro Pro Arg Val Pro Lys Ser
Phe Pro Phe Asn Thr Ser Val Val 50 55 60Tyr Lys Lys Thr Leu Phe Val
Glu Phe Thr Val His Leu Phe Asn Ile65 70 75 80Ala Lys Pro Arg Pro
Pro Trp Met Gly Leu Leu Gly Pro Thr Ile Gln 85 90 95Ala Glu Val Tyr
Asp Thr Val Val Ile Thr Leu Lys Asn Met Ala Ser 100 105 110His Pro
Val Ser Leu His Ala Val Gly Val Ser Tyr Trp Lys Ala Ser 115 120
125Glu Gly Ala Glu Tyr Asp Asp Gln Thr Ser Gln Arg Glu Lys Glu Asp
130 135 140Asp Lys Val Phe Pro Gly Gly Ser His Thr Tyr Val Trp Gln
Val Leu145 150 155 160Lys Glu Asn Gly Pro Met Ala Ser Asp Pro Leu
Cys Leu Thr Tyr Ser 165 170 175Tyr Leu Ser His Val Asp Leu Val Lys
Asp Leu Asn Ser Gly Leu Ile 180 185 190Gly Ala Leu Leu Val Cys Arg
Glu Gly Ser Leu Ala Lys Glu Lys Thr 195 200 205Gln Thr Leu His Lys
Phe Ile Leu Leu Phe Ala Val Phe Asp Glu Gly 210 215 220Lys Ser Trp
His Ser Glu Thr Lys Asn Ser Leu Met Gln Asp Arg Asp225 230 235
240Ala Ala Ser Ala Arg Ala Trp Pro Lys Met His Thr Val Asn Gly Tyr
245 250 255Val Asn Arg Ser Leu Pro Gly Leu Ile Gly Cys His Arg Lys
Ser Val 260 265 270Tyr Trp His Val Ile Gly Met Gly Thr Thr Pro Glu
Val His Ser Ile 275 280 285Phe Leu Glu Gly His Thr Phe Leu Val Arg
Asn His Arg Gln Ala Ser 290 295 300Leu Glu Ile Ser Pro Ile Thr Phe
Leu Thr Ala Gln Thr Leu Leu Met305 310 315 320Asp Leu Gly Gln Phe
Leu Leu Phe Cys His Ile Ser Ser His Gln His 325 330 335Asp Gly Met
Glu Ala Tyr Val Lys Val Asp Ser Cys Pro Glu Glu Pro 340 345 350Gln
Leu Arg Met Lys Asn Asn Glu Glu Ala Glu Asp Tyr Asp Asp Asp 355 360
365Leu Thr Asp Ser Glu Met Asp Val Val Arg Phe Asp Asp Asp Asn Ser
370 375 380Pro Ser Phe Ile Gln Ile Arg Ser Val Ala Lys Lys His Pro
Lys Thr385 390 395 400Trp Val His Tyr Ile Ala Ala Glu Glu Glu Asp
Trp Asp Tyr Ala Pro 405 410 415Leu Val Leu Ala Pro Asp Asp Arg Ser
Tyr Lys Ser Gln Tyr Leu Asn 420 425 430Asn Gly Pro Gln Arg Ile Gly
Arg Lys Tyr Lys Lys Val Arg Phe Met 435 440 445Ala Tyr Thr Asp Glu
Thr Phe Lys Thr Arg Glu Ala Ile Gln His Glu 450 455 460Ser Gly Ile
Leu Gly Pro Leu Leu Tyr Gly Glu Val Gly Asp Thr Leu465 470 475
480Leu Ile Ile Phe Lys Asn Gln Ala Ser Arg Pro Tyr Asn Ile Tyr Pro
485 490 495His Gly Ile Thr Asp Val Arg Pro Leu Tyr Ser Arg Arg Leu
Pro Lys 500 505 510Gly Val Lys His Leu Lys Asp Phe Pro Ile Leu Pro
Gly Glu Ile Phe 515 520 525Lys Tyr Lys Trp Thr Val Thr Val Glu Asp
Gly Pro Thr Lys Ser Asp 530 535 540Pro Arg Cys Leu Thr Arg Tyr Tyr
Ser Ser Phe Val Asn Met Glu Arg545 550 555 560Asp Leu Ala Ser Gly
Leu Ile Gly Pro Leu Leu Ile Cys Tyr Lys Glu 565 570 575Ser Val Asp
Gln Arg Gly Asn Gln Ile Met Ser Asp Lys Arg Asn Val 580 585 590Ile
Leu Phe Ser Val Phe Asp Glu Asn Arg Ser Trp Tyr Leu Thr Glu 595 600
605Asn Ile Gln Arg Phe Leu Pro Asn Pro Ala Gly Val Gln Leu Glu Asp
610 615 620Pro Glu Phe Gln Ala Ser Asn Ile Met His Ser Ile Asn Gly
Tyr Val625 630 635 640Phe Asp Ser Leu Gln Leu Ser Val Cys Leu His
Glu Val Ala Tyr Trp 645 650 655Tyr Ile Leu Ser Ile Gly Ala Gln Thr
Asp Phe Leu Ser Val Phe Phe 660 665 670Ser Gly Tyr Thr Phe Lys His
Lys Met Val Tyr Glu Asp Thr Leu Thr 675 680 685Leu Phe Pro Phe Ser
Gly Glu Thr Val Phe Met Ser Met Glu Asn Pro 690 695 700Gly Leu Trp
Ile Leu Gly Cys His Asn Ser Asp Phe Arg Asn Arg Gly705 710 715
720Met Thr Ala Leu Leu Lys Val Ser Ser Cys Asp Lys Asn Thr Gly Asp
725 730 735Tyr Tyr Glu Asp Ser Tyr Glu Asp Ile Ser Ala Tyr Leu Leu
Ser Lys 740 745 750Asn Asn Ala Ile Glu Pro Arg Ser Phe Ser Gln Asn
Pro Pro Val Leu 755 760 765Lys Arg His Gln Arg Glu Ile Thr Arg Thr
Thr Leu Gln Ser Asp Gln 770 775 780Glu Glu Ile Asp Tyr Asp Asp Thr
Ile Ser Val Glu Met Lys Lys Glu785 790 795 800Asp Phe Asp Ile Tyr
Asp Glu Asp Glu Asn Gln Ser Pro Arg Ser Phe 805 810 815Gln Lys Lys
Thr Arg His Tyr Phe Ile Ala Ala Val Glu Arg Leu Trp 820 825 830Asp
Tyr Gly Met Ser Ser Ser Pro His Val Leu Arg Asn Arg Ala Gln 835 840
845Ser Gly Ser Val Pro Gln Phe Lys Lys Val Val Phe Gln Glu Phe Thr
850 855 860Asp Gly Ser Phe Thr Gln Pro Leu Tyr Arg Gly Glu Leu Asn
Glu His865 870 875 880Leu Gly Leu Leu Gly Pro Tyr Ile Arg Ala Glu
Val Glu Asp Asn Ile 885 890 895Met Val Thr Phe Arg Asn Gln Ala Ser
Arg Pro Tyr Ser Phe Tyr Ser 900 905 910Ser Leu Ile Ser Tyr Glu Glu
Asp Gln Arg Gln Gly Ala Glu Pro Arg 915 920 925Lys Asn Phe Val Lys
Pro Asn Glu Thr Lys Thr Tyr Phe Trp Lys Val 930 935 940Gln His His
Met Ala Pro Thr Lys Asp Glu Phe Asp Cys Lys Ala Trp945 950 955
960Ala Tyr Phe Ser Asp Val Asp Leu Glu Lys Asp Val His Ser Gly Leu
965 970 975Ile Gly Pro Leu Leu Val Cys His Thr Asn Thr Leu Asn Pro
Ala His 980 985 990Gly Arg Gln Val Thr Val Gln Glu Phe Ala Leu Phe
Phe Thr Ile Phe 995 1000 1005Asp Glu Thr Lys Ser Trp Tyr Phe Thr
Glu Asn Met Glu Arg Asn 1010 1015 1020Cys Arg Ala Pro Cys Asn Ile
Gln Met Glu Asp Pro Thr Phe Lys 1025 1030 1035Glu Asn Tyr Arg Phe
His Ala Ile Asn Gly Tyr Ile Met Asp Thr 1040 1045 1050Leu Pro Gly
Leu Val Met Ala Gln Asp Gln Arg Ile Arg Trp Tyr 1055 1060 1065Leu
Leu Ser Met Gly Ser Asn Glu Asn Ile His Ser Ile His Phe 1070 1075
1080Ser Gly His Val Phe Thr Val Arg Lys Lys Glu Glu Tyr Lys Met
1085 1090 1095Ala Leu Tyr Asn Leu Tyr Pro Gly Val Phe Glu Thr Val
Glu Met 1100 1105 1110Leu Pro Ser Lys Ala Gly Ile Trp Arg Val Glu
Cys Leu Ile Gly 1115 1120 1125Glu His Leu His Ala Gly Met Ser Thr
Leu Phe Leu Val Tyr Ser 1130 1135 1140Asn Lys Cys Gln Thr Pro Leu
Gly Met Ala Ser Gly His Ile Arg 1145 1150 1155Asp Phe Gln Ile Thr
Ala Ser Gly Gln Tyr Gly Gln Trp Ala Pro 1160 1165 1170Lys Leu Ala
Arg Leu His Tyr Ser Gly Ser Ile Asn Ala Trp Ser 1175 1180 1185Thr
Lys Glu Pro Phe Ser Trp Ile Lys Val Asp Leu Leu Ala Pro 1190 1195
1200Met Ile Ile His Gly Ile Lys Thr Gln Gly Ala Arg Gln Lys Phe
1205 1210 1215Ser Ser Leu Tyr Ile Ser Gln Phe Ile Ile Met Tyr Ser
Leu Asp 1220 1225 1230Gly Lys Lys Trp Gln Thr Tyr Arg Gly Asn Ser
Thr Gly Thr Leu 1235 1240 1245Met Val Phe Phe Gly Asn Val Asp Ser
Ser Gly Ile Lys His Asn 1250 1255 1260Ile Phe Asn Pro Pro Ile Ile
Ala Arg Tyr Ile Arg Leu His Pro 1265 1270 1275Thr His Tyr Ser Ile
Arg Ser Thr Leu Arg Met Glu Leu Met Gly 1280 1285 1290Cys Asp Leu
Asn Ser Cys Ser Met Pro Leu Gly Met Glu Ser Lys 1295 1300 1305Ala
Ile Ser Asp Ala Gln Ile Thr Ala Ser Ser Tyr Phe Thr Asn 1310 1315
1320Met Phe Ala Thr Trp Ser Pro Ser Lys Ala Arg Leu His Leu Gln
1325 1330 1335Gly Arg Ser Asn Ala Trp Arg Pro Gln Val Asn Asn Pro
Lys Glu 1340 1345 1350Trp Leu Gln Val Asp Phe Gln Lys Thr Met Lys
Val Thr Gly Val 1355 1360 1365Thr Thr Gln Gly Val Lys Ser Leu Leu
Thr Ser Met Tyr Val Lys 1370 1375 1380Glu Phe Leu Ile Ser Ser Ser
Gln Asp Gly His Gln Trp Thr Leu 1385 1390 1395Phe Phe Gln Asn Gly
Lys Val Lys Val Phe Gln Gly Asn Gln Asp 1400 1405 1410Ser Phe Thr
Pro Val Val Asn Ser Leu Asp Pro Pro Leu Leu Thr 1415 1420 1425Arg
Tyr Leu Arg Ile His Pro Gln Ser Trp Val His Gln Ile Ala 1430 1435
1440Leu Arg Met Glu Val Leu Gly Cys Glu Ala Gln Asp Leu Tyr 1445
1450 145542332PRTHomo SapiensHuman factor VIII sequence 4Ala Thr
Arg Arg Tyr Tyr Leu Gly Ala Val Glu Leu Ser Trp Asp Tyr1 5 10 15Met
Gln Ser Asp Leu Gly Glu Leu Pro Val Asp Ala Arg Phe Pro Pro 20 25
30Arg Val Pro Lys Ser Phe Pro Phe Asn Thr Ser Val Val Tyr Lys Lys
35 40 45Thr Leu Phe Val Glu Phe Thr Asp His Leu Phe Asn Ile Ala Lys
Pro 50 55 60Arg Pro Pro Trp Met Gly Leu Leu Gly Pro Thr Ile Gln Ala
Glu Val65 70 75 80Tyr Asp Thr Val Val Ile Thr Leu Lys Asn Met Ala
Ser His Pro Val 85 90 95Ser Leu His Ala Val Gly Val Ser Tyr Trp Lys
Ala Ser Glu Gly Ala 100 105 110Glu Tyr Asp Asp Gln Thr Ser Gln Arg
Glu Lys Glu Asp Asp Lys Val 115 120 125Phe Pro Gly Gly Ser His Thr
Tyr Val Trp Gln Val Leu Lys Glu Asn 130 135 140Gly Pro Met Ala Ser
Asp Pro Leu Cys Leu Thr Tyr Ser Tyr Leu Ser145 150 155 160His Val
Asp Leu Val Lys Asp Leu Asn Ser Gly Leu Ile Gly Ala Leu 165 170
175Leu Val Cys Arg Glu Gly Ser Leu Ala Lys Glu Lys Thr Gln Thr Leu
180 185 190His Lys Phe Ile Leu Leu Phe Ala Val Phe Asp Glu Gly Lys
Ser Trp 195 200 205His Ser Glu Thr Lys Asn Ser Leu Met Gln Asp Arg
Asp Ala Ala Ser 210 215 220Ala Arg Ala Trp Pro Lys Met His Thr Val
Asn Gly Tyr Val Asn Arg225 230 235 240Ser Leu Pro Gly Leu Ile Gly
Cys His Arg Lys Ser Val Tyr Trp His 245 250 255Val Ile Gly Met Gly
Thr Thr Pro Glu Val His Ser Ile Phe Leu Glu 260 265 270Gly His Thr
Phe Leu Val Arg Asn His Arg Gln Ala Ser Leu Glu Ile 275 280 285Ser
Pro Ile Thr Phe Leu Thr Ala Gln Thr Leu Leu Met Asp Leu Gly 290 295
300Gln Phe Leu Leu Phe Cys His Ile Ser Ser His Gln His Asp Gly
Met305 310 315 320Glu Ala Tyr Val Lys Val Asp Ser Cys Pro Glu Glu
Pro Gln Leu Arg 325 330 335Met Lys Asn Asn Glu Glu Ala Glu Asp Tyr
Asp Asp Asp Leu Thr Asp 340 345 350Ser Glu Met Asp Val Val Arg Phe
Asp Asp Asp Asn Ser Pro Ser Phe 355 360 365Ile Gln Ile Arg Ser Val
Ala Lys Lys His Pro Lys Thr Trp Val His 370 375 380Tyr Ile Ala Ala
Glu Glu Glu Asp Trp Asp Tyr Ala Pro Leu Val Leu385 390 395 400Ala
Pro Asp Asp Arg Ser Tyr Lys Ser Gln Tyr Leu Asn Asn Gly Pro 405 410
415Gln Arg Ile Gly Arg Lys Tyr Lys Lys Val Arg Phe Met Ala Tyr Thr
420 425 430Asp Glu Thr Phe Lys Thr Arg Glu Ala Ile Gln His Glu Ser
Gly Ile 435 440 445Leu Gly Pro Leu Leu Tyr Gly Glu Val Gly Asp Thr
Leu Leu Ile Ile 450 455 460Phe Lys Asn Gln Ala Ser Arg Pro Tyr Asn
Ile Tyr Pro His Gly Ile465 470 475 480Thr Asp Val Arg Pro Leu Tyr
Ser Arg Arg Leu Pro Lys Gly Val Lys 485 490 495His Leu Lys Asp Phe
Pro Ile Leu Pro Gly Glu Ile Phe Lys Tyr Lys 500 505 510Trp Thr Val
Thr Val Glu Asp Gly Pro Thr Lys Ser Asp Pro Arg Cys 515 520 525Leu
Thr Arg Tyr Tyr Ser Ser Phe Val Asn Met Glu Arg Asp Leu Ala 530 535
540Ser Gly Leu Ile Gly Pro Leu Leu Ile Cys Tyr Lys Glu Ser Val
Asp545 550 555 560Gln Arg Gly Asn Gln Ile Met Ser Asp Lys Arg Asn
Val Ile Leu Phe 565 570 575Ser Val Phe Asp Glu Asn Arg Ser Trp Tyr
Leu Thr Glu Asn Ile Gln 580 585 590Arg Phe Leu Pro Asn Pro Ala Gly
Val Gln Leu Glu Asp Pro Glu Phe 595 600 605Gln Ala Ser Asn Ile Met
His Ser Ile Asn Gly Tyr Val Phe Asp Ser 610 615 620Leu Gln Leu Ser
Val Cys Leu His Glu Val Ala Tyr Trp Tyr Ile Leu625 630 635 640Ser
Ile Gly Ala Gln Thr Asp Phe Leu Ser Val Phe Phe Ser Gly Tyr 645 650
655Thr Phe Lys His Lys Met Val Tyr Glu Asp Thr Leu Thr Leu Phe Pro
660 665 670Phe Ser Gly Glu Thr Val Phe Met Ser Met Glu Asn Pro Gly
Leu Trp 675 680 685Ile Leu Gly Cys His Asn Ser Asp Phe Arg Asn Arg
Gly Met Thr Ala 690 695 700Leu Leu Lys Val Ser Ser Cys Asp Lys Asn
Thr Gly Asp Tyr Tyr Glu705 710 715 720Asp Ser Tyr Glu Asp Ile Ser
Ala Tyr Leu Leu Ser Lys Asn Asn Ala 725 730 735Ile Glu Pro Arg Ser
Phe Ser Gln Asn Ser Arg His Pro Ser Thr Arg 740 745 750Gln Lys Gln
Phe Asn Ala Thr Thr Ile Pro Glu Asn Asp Ile Glu Lys 755 760 765Thr
Asp Pro Trp Phe Ala His Arg Thr Pro Met Pro Lys Ile Gln Asn 770 775
780Val Ser Ser Ser Asp Leu Leu Met Leu Leu Arg Gln Ser Pro Thr
Pro785 790 795 800His Gly Leu Ser Leu Ser Asp Leu Gln Glu Ala Lys
Tyr Glu Thr Phe 805 810 815Ser Asp Asp Pro Ser Pro Gly Ala Ile Asp
Ser Asn Asn Ser Leu Ser 820 825 830Glu Met Thr His Phe Arg Pro Gln
Leu His His Ser Gly Asp Met Val 835 840 845Phe Thr Pro Glu Ser Gly
Leu Gln Leu Arg Leu Asn Glu Lys Leu Gly 850 855 860Thr Thr Ala Ala
Thr Glu Leu Lys Lys Leu Asp Phe Lys Val Ser Ser865 870 875 880Thr
Ser Asn Asn Leu Ile Ser Thr Ile Pro Ser Asp Asn Leu Ala Ala 885 890
895Gly Thr Asp Asn Thr Ser Ser Leu Gly Pro Pro Ser Met Pro Val His
900 905 910Tyr Asp Ser Gln Leu Asp Thr Thr Leu Phe Gly Lys Lys Ser
Ser Pro 915 920 925Leu Thr Glu Ser Gly Gly Pro Leu Ser Leu Ser Glu
Glu Asn Asn Asp 930 935 940Ser Lys Leu Leu Glu Ser Gly Leu Met Asn
Ser
Gln Glu Ser Ser Trp945 950 955 960Gly Lys Asn Val Ser Ser Thr Glu
Ser Gly Arg Leu Phe Lys Gly Lys 965 970 975Arg Ala His Gly Pro Ala
Leu Leu Thr Lys Asp Asn Ala Leu Phe Lys 980 985 990Val Ser Ile Ser
Leu Leu Lys Thr Asn Lys Thr Ser Asn Asn Ser Ala 995 1000 1005Thr
Asn Arg Lys Thr His Ile Asp Gly Pro Ser Leu Leu Ile Glu 1010 1015
1020Asn Ser Pro Ser Val Trp Gln Asn Ile Leu Glu Ser Asp Thr Glu
1025 1030 1035Phe Lys Lys Val Thr Pro Leu Ile His Asp Arg Met Leu
Met Asp 1040 1045 1050Lys Asn Ala Thr Ala Leu Arg Leu Asn His Met
Ser Asn Lys Thr 1055 1060 1065Thr Ser Ser Lys Asn Met Glu Met Val
Gln Gln Lys Lys Glu Gly 1070 1075 1080Pro Ile Pro Pro Asp Ala Gln
Asn Pro Asp Met Ser Phe Phe Lys 1085 1090 1095Met Leu Phe Leu Pro
Glu Ser Ala Arg Trp Ile Gln Arg Thr His 1100 1105 1110Gly Lys Asn
Ser Leu Asn Ser Gly Gln Gly Pro Ser Pro Lys Gln 1115 1120 1125Leu
Val Ser Leu Gly Pro Glu Lys Ser Val Glu Gly Gln Asn Phe 1130 1135
1140Leu Ser Glu Lys Asn Lys Val Val Val Gly Lys Gly Glu Phe Thr
1145 1150 1155Lys Asp Val Gly Leu Lys Glu Met Val Phe Pro Ser Ser
Arg Asn 1160 1165 1170Leu Phe Leu Thr Asn Leu Asp Asn Leu His Glu
Asn Asn Thr His 1175 1180 1185Asn Gln Glu Lys Lys Ile Gln Glu Glu
Ile Glu Lys Lys Glu Thr 1190 1195 1200Leu Ile Gln Glu Asn Val Val
Leu Pro Gln Ile His Thr Val Thr 1205 1210 1215Gly Thr Lys Asn Phe
Met Lys Asn Leu Phe Leu Leu Ser Thr Arg 1220 1225 1230Gln Asn Val
Glu Gly Ser Tyr Asp Gly Ala Tyr Ala Pro Val Leu 1235 1240 1245Gln
Asp Phe Arg Ser Leu Asn Asp Ser Thr Asn Arg Thr Lys Lys 1250 1255
1260His Thr Ala His Phe Ser Lys Lys Gly Glu Glu Glu Asn Leu Glu
1265 1270 1275Gly Leu Gly Asn Gln Thr Lys Gln Ile Val Glu Lys Tyr
Ala Cys 1280 1285 1290Thr Thr Arg Ile Ser Pro Asn Thr Ser Gln Gln
Asn Phe Val Thr 1295 1300 1305Gln Arg Ser Lys Arg Ala Leu Lys Gln
Phe Arg Leu Pro Leu Glu 1310 1315 1320Glu Thr Glu Leu Glu Lys Arg
Ile Ile Val Asp Asp Thr Ser Thr 1325 1330 1335Gln Trp Ser Lys Asn
Met Lys His Leu Thr Pro Ser Thr Leu Thr 1340 1345 1350Gln Ile Asp
Tyr Asn Glu Lys Glu Lys Gly Ala Ile Thr Gln Ser 1355 1360 1365Pro
Leu Ser Asp Cys Leu Thr Arg Ser His Ser Ile Pro Gln Ala 1370 1375
1380Asn Arg Ser Pro Leu Pro Ile Ala Lys Val Ser Ser Phe Pro Ser
1385 1390 1395Ile Arg Pro Ile Tyr Leu Thr Arg Val Leu Phe Gln Asp
Asn Ser 1400 1405 1410Ser His Leu Pro Ala Ala Ser Tyr Arg Lys Lys
Asp Ser Gly Val 1415 1420 1425Gln Glu Ser Ser His Phe Leu Gln Gly
Ala Lys Lys Asn Asn Leu 1430 1435 1440Ser Leu Ala Ile Leu Thr Leu
Glu Met Thr Gly Asp Gln Arg Glu 1445 1450 1455Val Gly Ser Leu Gly
Thr Ser Ala Thr Asn Ser Val Thr Tyr Lys 1460 1465 1470Lys Val Glu
Asn Thr Val Leu Pro Lys Pro Asp Leu Pro Lys Thr 1475 1480 1485Ser
Gly Lys Val Glu Leu Leu Pro Lys Val His Ile Tyr Gln Lys 1490 1495
1500Asp Leu Phe Pro Thr Glu Thr Ser Asn Gly Ser Pro Gly His Leu
1505 1510 1515Asp Leu Val Glu Gly Ser Leu Leu Gln Gly Thr Glu Gly
Ala Ile 1520 1525 1530Lys Trp Asn Glu Ala Asn Arg Pro Gly Lys Val
Pro Phe Leu Arg 1535 1540 1545Val Ala Thr Glu Ser Ser Ala Lys Thr
Pro Ser Lys Leu Leu Asp 1550 1555 1560Pro Leu Ala Trp Asp Asn His
Tyr Gly Thr Gln Ile Pro Lys Glu 1565 1570 1575Glu Trp Lys Ser Gln
Glu Lys Ser Pro Glu Lys Thr Ala Phe Lys 1580 1585 1590Lys Lys Asp
Thr Ile Leu Ser Leu Asn Ala Cys Glu Ser Asn His 1595 1600 1605Ala
Ile Ala Ala Ile Asn Glu Gly Gln Asn Lys Pro Glu Ile Glu 1610 1615
1620Val Thr Trp Ala Lys Gln Gly Arg Thr Glu Arg Leu Cys Ser Gln
1625 1630 1635Asn Pro Pro Val Leu Lys Arg His Gln Arg Glu Ile Thr
Arg Thr 1640 1645 1650Thr Leu Gln Ser Asp Gln Glu Glu Ile Asp Tyr
Asp Asp Thr Ile 1655 1660 1665Ser Val Glu Met Lys Lys Glu Asp Phe
Asp Ile Tyr Asp Glu Asp 1670 1675 1680Glu Asn Gln Ser Pro Arg Ser
Phe Gln Lys Lys Thr Arg His Tyr 1685 1690 1695Phe Ile Ala Ala Val
Glu Arg Leu Trp Asp Tyr Gly Met Ser Ser 1700 1705 1710Ser Pro His
Val Leu Arg Asn Arg Ala Gln Ser Gly Ser Val Pro 1715 1720 1725Gln
Phe Lys Lys Val Val Phe Gln Glu Phe Thr Asp Gly Ser Phe 1730 1735
1740Thr Gln Pro Leu Tyr Arg Gly Glu Leu Asn Glu His Leu Gly Leu
1745 1750 1755Leu Gly Pro Tyr Ile Arg Ala Glu Val Glu Asp Asn Ile
Met Val 1760 1765 1770Thr Phe Arg Asn Gln Ala Ser Arg Pro Tyr Ser
Phe Tyr Ser Ser 1775 1780 1785Leu Ile Ser Tyr Glu Glu Asp Gln Arg
Gln Gly Ala Glu Pro Arg 1790 1795 1800Lys Asn Phe Val Lys Pro Asn
Glu Thr Lys Thr Tyr Phe Trp Lys 1805 1810 1815Val Gln His His Met
Ala Pro Thr Lys Asp Glu Phe Asp Cys Lys 1820 1825 1830Ala Trp Ala
Tyr Phe Ser Asp Val Asp Leu Glu Lys Asp Val His 1835 1840 1845Ser
Gly Leu Ile Gly Pro Leu Leu Val Cys His Thr Asn Thr Leu 1850 1855
1860Asn Pro Ala His Gly Arg Gln Val Thr Val Gln Glu Phe Ala Leu
1865 1870 1875Phe Phe Thr Ile Phe Asp Glu Thr Lys Ser Trp Tyr Phe
Thr Glu 1880 1885 1890Asn Met Glu Arg Asn Cys Arg Ala Pro Cys Asn
Ile Gln Met Glu 1895 1900 1905Asp Pro Thr Phe Lys Glu Asn Tyr Arg
Phe His Ala Ile Asn Gly 1910 1915 1920Tyr Ile Met Asp Thr Leu Pro
Gly Leu Val Met Ala Gln Asp Gln 1925 1930 1935Arg Ile Arg Trp Tyr
Leu Leu Ser Met Gly Ser Asn Glu Asn Ile 1940 1945 1950His Ser Ile
His Phe Ser Gly His Val Phe Thr Val Arg Lys Lys 1955 1960 1965Glu
Glu Tyr Lys Met Ala Leu Tyr Asn Leu Tyr Pro Gly Val Phe 1970 1975
1980Glu Thr Val Glu Met Leu Pro Ser Lys Ala Gly Ile Trp Arg Val
1985 1990 1995Glu Cys Leu Ile Gly Glu His Leu His Ala Gly Met Ser
Thr Leu 2000 2005 2010Phe Leu Val Tyr Ser Asn Lys Cys Gln Thr Pro
Leu Gly Met Ala 2015 2020 2025Ser Gly His Ile Arg Asp Phe Gln Ile
Thr Ala Ser Gly Gln Tyr 2030 2035 2040Gly Gln Trp Ala Pro Lys Leu
Ala Arg Leu His Tyr Ser Gly Ser 2045 2050 2055Ile Asn Ala Trp Ser
Thr Lys Glu Pro Phe Ser Trp Ile Lys Val 2060 2065 2070Asp Leu Leu
Ala Pro Met Ile Ile His Gly Ile Lys Thr Gln Gly 2075 2080 2085Ala
Arg Gln Lys Phe Ser Ser Leu Tyr Ile Ser Gln Phe Ile Ile 2090 2095
2100Met Tyr Ser Leu Asp Gly Lys Lys Trp Gln Thr Tyr Arg Gly Asn
2105 2110 2115Ser Thr Gly Thr Leu Met Val Phe Phe Gly Asn Val Asp
Ser Ser 2120 2125 2130Gly Ile Lys His Asn Ile Phe Asn Pro Pro Ile
Ile Ala Arg Tyr 2135 2140 2145Ile Arg Leu His Pro Thr His Tyr Ser
Ile Arg Ser Thr Leu Arg 2150 2155 2160Met Glu Leu Met Gly Cys Asp
Leu Asn Ser Cys Ser Met Pro Leu 2165 2170 2175Gly Met Glu Ser Lys
Ala Ile Ser Asp Ala Gln Ile Thr Ala Ser 2180 2185 2190Ser Tyr Phe
Thr Asn Met Phe Ala Thr Trp Ser Pro Ser Lys Ala 2195 2200 2205Arg
Leu His Leu Gln Gly Arg Ser Asn Ala Trp Arg Pro Gln Val 2210 2215
2220Asn Asn Pro Lys Glu Trp Leu Gln Val Asp Phe Gln Lys Thr Met
2225 2230 2235Lys Val Thr Gly Val Thr Thr Gln Gly Val Lys Ser Leu
Leu Thr 2240 2245 2250Ser Met Tyr Val Lys Glu Phe Leu Ile Ser Ser
Ser Gln Asp Gly 2255 2260 2265His Gln Trp Thr Leu Phe Phe Gln Asn
Gly Lys Val Lys Val Phe 2270 2275 2280Gln Gly Asn Gln Asp Ser Phe
Thr Pro Val Val Asn Ser Leu Asp 2285 2290 2295Pro Pro Leu Leu Thr
Arg Tyr Leu Arg Ile His Pro Gln Ser Trp 2300 2305 2310Val His Gln
Ile Ala Leu Arg Met Glu Val Leu Gly Cys Glu Ala 2315 2320 2325Gln
Asp Leu Tyr 2330533DNAArtificial SequencePrimer PEG1 used for
Mutagenesis 5gatgtccgtc ctttgtgctc aaggagatta cca
33634DNAArtificial SequencePrimer PEG2 used for Mutagenesis
6ttgtattcaa ggagatgccc aaaaggtgta aaac 34734DNAArtificial
SequencePrimer PEG3 used for Mutagenesis 7ttaccaaaag gtgtatgcca
tttgaaggat tttc 34833DNAArtificial SequencePrimer PEG4 used for
Mutagenesis 8aaggattttc caatttgccc aggagaaata ttc
33934DNAArtificial SequencePrimer PEG 5 used for Mutagenesis
9gattatattt aagaattgcg caagcagacc atat 341036DNAArtificial
SequencePrimer PEG6 used for Mutagenesis 10tagaaaaaac tttgtctgcc
ctaatgaaac caaaac 361133DNAArtificial SequencePrimer PEG7 used for
Mutagenesis 11aactttgtca agccttgcga aaccaaaact tac
331234DNAArtificial SequencePrimer PEG8 used for Mutagenesis
12gtcaagccta atgaatgcaa aacttacttt tgga 341335DNAArtificial
SequencePEG9 Primer used for Mutagenesis 13caagcctaat gaaacctgca
cttacttttg gaaag 351436DNAArtificial SequencePrimer PEG10 used for
Mutagenesis 14ctaatgaaac caaaacttgc ttttggaaag tgcaac
361533DNAArtificial SequencePrimer PEG11 used for Mutagenesis
15atttcttatg aggaatgcca gaggcaagga gca 331633DNAArtificial
SequencePrimer PEG12 used for Mutagenesis 16tcttatgagg aagattgcag
gcaaggagca gaa 331736DNAArtificial SequencePrimer PEG13 used for
Mutagenesis 17caaggagcag aaccttgcaa aaactttgtc aagcct
361833DNAArtificial SequencePrimer PEG14 used for Mutagenesis
18ggagcagaac ctagatgcaa ctttgtcaag cct 331933DNAArtificial
SequencePrimer PEG15 used for Mutagenesis 19cgctcagttg ccaagtgtca
tcctaaaact tgg 332033DNAArtificial SequencePrimer PEG16 used for
Mutagenesis 20tcagttgcca agaagtgtcc taaaacttgg gta
332133DNAArtificial SequencePrimer PEG17 used for Mutagenesis
21ctcctcatct gctactgcga atctgtagat caa 332235DNAArtificial
SequencePrimer PEG18 used for Mutagenesis 22caaaatcttt tccattctgc
acctcagtcg tgtac 352333DNAArtificial SequencePrimer PEG19 used for
Mutagenesis 23gtcaatggtt atgtatgcag gtctctgcca ggt
332433DNAArtificial SequencePrimer PEG20 used for Mutagenesis
24cagacttatc gaggatgttc cactggaacc tta 332533DNAArtificial
SequencePrimer PEG21 used for Mutagenesis 25atccaggctg aggtttgtga
tacagtggtc att 332633DNAArtificial SequencePrimer PEG22 used for
Mutagenesis 26gaagatgata aagtctgtcc tggtggaagc cat
332733DNAArtificial SequencePrimer PEG23 used for Mutagenesis
27cagcggattg gtaggtgtta caaaaaagtc cga 332833DNAArtificial
SequencePrimer PEG24 used for Mutagenesis 28gaagatgggc caacttgctc
agatcctcgg tgc 332933DNAArtificial SequencePrimer PEG25 used for
Mutagenesis 29cagataatgt cagactgcag gaatgtcatc ctg
333033DNAArtificial SequencePrimer PEG26 used for Mutagenesis
30cacactaaca cactgtgtcc tgctcatggg aga 333133DNAArtificial
SequencePrimer PEG27 used for Mutagenesis 31cagatggaag atccctgctt
taaagagaat tat 333233DNAArtificial SequencePrimer PEG28 used for
Mutagenesis 32acccagggtg cccgttgcaa gttctccagc ctc
333333DNAArtificial SequencePrimer PEG29 used for Mutagenesis
33aaagtaaagg ttttttgcgg aaatcaagac tcc 333433DNAArtificial
SequencePrimer PEG30 used for Mutagenesis 34ttgcagttgt cagttgcttt
gcatgaggtg gca 333533DNAArtificial SequencePrimer PEG31 used for
Mutagenesis 35aatatggaaa gaaacgctag ggctccctgc aat 33
* * * * *