U.S. patent application number 14/676863 was filed with the patent office on 2016-02-25 for methods of treating fgf21-associated disorders.
This patent application is currently assigned to IRM LLC. The applicant listed for this patent is Brian R. BOETTCHER, Shari L. CAPLAN, Douglas S. DANIELS, Bernhard H. GEIERSTANGER, Norio HAMAMATSU, Stuart LICHT, Andreas LOEW, Stephen Craig WELDON. Invention is credited to Brian R. BOETTCHER, Shari L. CAPLAN, Douglas S. DANIELS, Bernhard H. GEIERSTANGER, Norio HAMAMATSU, Stuart LICHT, Andreas LOEW, Stephen Craig WELDON.
Application Number | 20160051628 14/676863 |
Document ID | / |
Family ID | 44999776 |
Filed Date | 2016-02-25 |
United States Patent
Application |
20160051628 |
Kind Code |
A1 |
BOETTCHER; Brian R. ; et
al. |
February 25, 2016 |
METHODS OF TREATING FGF21-ASSOCIATED DISORDERS
Abstract
The invention relates to the identification of new polypeptide
and protein variants of fibroblast growth factor 21 (FGF21) that
have improved pharmaceutical properties. Also disclosed are methods
for treating FGF21-associated disorders, including metabolic
conditions.
Inventors: |
BOETTCHER; Brian R.;
(Winchester, MA) ; LOEW; Andreas; (Somerville,
MA) ; CAPLAN; Shari L.; (Lunenburg, MA) ;
DANIELS; Douglas S.; (Arlington, MA) ; GEIERSTANGER;
Bernhard H.; (Solana Beach, CA) ; HAMAMATSU;
Norio; (Belmont, MA) ; LICHT; Stuart;
(Cambridge, MA) ; WELDON; Stephen Craig;
(Leominster, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BOETTCHER; Brian R.
LOEW; Andreas
CAPLAN; Shari L.
DANIELS; Douglas S.
GEIERSTANGER; Bernhard H.
HAMAMATSU; Norio
LICHT; Stuart
WELDON; Stephen Craig |
Winchester
Somerville
Lunenburg
Arlington
Solana Beach
Belmont
Cambridge
Leominster |
MA
MA
MA
MA
CA
MA
MA
MA |
US
US
US
US
US
US
US
US |
|
|
Assignee: |
IRM LLC
Hamilton
BM
NOVARTIS AG
Basel
CH
|
Family ID: |
44999776 |
Appl. No.: |
14/676863 |
Filed: |
April 2, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13296343 |
Nov 15, 2011 |
9023791 |
|
|
14676863 |
|
|
|
|
61415476 |
Nov 19, 2010 |
|
|
|
Current U.S.
Class: |
514/5.3 ;
514/6.7; 514/6.8; 514/6.9; 514/7.3; 514/7.4; 514/9.1; 530/363;
530/387.3; 530/399 |
Current CPC
Class: |
A61K 47/593 20170801;
C07K 2319/31 20130101; A61P 3/06 20180101; C07K 14/50 20130101;
A61K 38/1825 20130101; A61P 1/18 20180101; A61K 47/60 20170801;
A61P 1/16 20180101; C07K 2319/30 20130101; A61P 5/50 20180101; A61P
3/04 20180101; C07K 2319/00 20130101; A61P 3/10 20180101; A61P 3/00
20180101 |
International
Class: |
A61K 38/18 20060101
A61K038/18; A61K 47/48 20060101 A61K047/48; C07K 14/50 20060101
C07K014/50 |
Claims
1. A polypeptide variant having a sequence selected from SEQ ID
NO:5-49.
2. The variant of claim 1, wherein the variant further comprises
one or more of the following modifications: (a) an amino-terminal
truncation of no more than 8 amino acid residues; and (b) a
carboxyl-terminal truncation of no more than 12 amino acid
residues.
3. The variant of claim 1, wherein the variant is covalently linked
to polyethylene glycol (PEG) or polysialic acid.
4. The variant of claim 3, wherein the variant further comprises a
branched, 40 kDa PEG group, covalently linked to a cysteine of the
variant.
5. The variant of claim 1, wherein the variant is fused to a
heterologous amino acid sequence consisting of one of the
following: an IgG constant domain or fragment thereof; Human Serum
Albumin (HSA); and albumin-binding polypeptides.
6. The variant of claim 5, wherein the heterologous amino acid
sequence is fused to the amino-terminal of the variant.
7. The variant of claim 5, wherein the heterologous amino acid
sequence is fused to the carboxy-terminal of the variant.
8. (canceled)
9. The multimer of claim 1, wherein the multimer is a
homodimer.
10-14. (canceled)
15. A method for treating a patient comprising administering to
said patient a therapeutically effective amount of a polypeptide
variant having a sequence selected from SEQ ID NO:5-49, wherein
said patient exhibits one or more of FGF21-associated disorders
16. The method of claim 15, wherein the FGF21-associated disorders
consist of one or more of the following: obesity, type 1 and type 2
diabetes mellitus, pancreatitis, dyslipidemia, nonalcoholic
steatohepatitis (NASH), insulin resistance, hyperinsulinemia,
glucose intolerance, hyperglycemia, metabolic syndrome, and other
metabolic disorders
17. The method of claim 16, wherein the FGF21-associated disorder
consists of type 1 diabetes mellitus.
18. The method of claim 16, wherein the FGF21-associated disorder
consists of type 2 diabetes mellitus.
19. A method for treating a patient comprising administering to
said patient a pharmaceutical composition comprising a
therapeutically effective amount of the polypeptide variant of
claim 1, wherein said patient exhibits one or more of
FGF21-associated disorders.
20. The method of claim 19, wherein said variant further comprises
SEQ ID NO:39, with PEGylation at the cysteine residue at position
154.
21. The method of claim 20, wherein the FGF21-associated disorders
consist of one or more of the following: obesity, type 1 and type 2
diabetes mellitus, pancreatitis, dyslipidemia, nonalcoholic
steatohepatitis (NASH), insulin resistance, hyperinsulinemia,
glucose intolerance, hyperglycemia, metabolic syndrome, and other
metabolic disorders
22. The method of claim 21, wherein the FGF21-associated disorder
consists of type 1 diabetes mellitus.
23. The method of claim 21, wherein the FGF21-associated disorder
consists of type 2 diabetes mellitus.
24. A method for reducing one or more of hyperglycemia,
hyperinsulinemia, liver lipids, and weight gain in a patient in
need, comprising administering to said patient a therapeutically
effective amount of polypeptide variant having a sequence selected
from SEQ ID NO:5-49.
25. The method of claim 24, wherein the variant further comprises
SEQ ID NO:39, with PEGylation at the cysteine residue at position
154.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to new polypeptide of
fibroblast growth factor 21 (FGF21) that have improved
pharmaceutical properties. Also disclosed are methods for treating
FGF21-associated disorders, such as obesity, type 1 and type 2
diabetes mellitus, pancreatitis, dyslipidemia, nonalcoholic
steatohepatitis (NASH), insulin resistance, hyperinsulinemia,
glucose intolerance, hyperglycemia, metabolic syndrome, and other
metabolic disorders, and in reducing the mortality and morbidity of
critically ill patients.
BACKGROUND OF THE INVENTION
[0002] The fibroblast growth factor (FGF) family is characterized
by 22 genetically distinct, homologous ligands, which are grouped
into seven subfamilies. According to the published literature, the
FGF family now consists of at least twenty-three members, FGF-1 to
FGF-23 (Reuss et al., Cell Tissue Res. 313:139-157 (2003).
[0003] FGF-21 was isolated from mouse embryos and is closest to
FGF-19 and FGF-23. This FGF subfamily regulates diverse
physiological processes uncommon to classical FGFs, namely energy
and bile acid homeostasis, glucose and lipid metabolism and
phosphate as well as vitamin D homeostasis. Moreover, unlike
classical FGFs, this subfamily acts in an endocrine fashion.
(Moore, D. D. (2007) Science 316, 1436-8). Fibroblast growth factor
21 (FGF21) has been reported to be preferentially expressed in the
liver (Nishimura et al., Biochimica et Biophysica Acta,
1492:203-206, (2000); patent publication WO01/36640; and patent
publication WO01/18172) and described as a treatment for ischemic
vascular disease, wound healing, and diseases associated with loss
of pulmonary, bronchia or alveolar cell function and numerous other
disorders.
[0004] FGF21 has been identified as a potent metabolic regulator.
Systemic administration of FGF21 to rodents and rhesus monkeys with
diet-induced or genetic obesity and diabetes exerts strong
anti-hyperglycemic and triglyceride-lowering effects, and reduction
of body weight. (Coskun, T, et al. (2008) Endocrinology
149:6018-6027; Kharitonenkov, A, et al. (2005) Journal of Clinical
Investigation 115:1627-1635; Kharitonenkov, A, et al. (2007)
Endocrinology 148:774-781; Xu, J, et al. (2009) Diabetes
58:250-259). FGF21 is a 209 amino acid polypeptide containing a 28
amino acid leader sequence. Human FGF21 has about 79% amino acid
identity to mouse FGF21 and about 80% amino acid identity to rat
FGF21.
[0005] Although FGF-21 activates FGF receptors and downstream
signaling molecules, including FRS2a and ERK, direct interaction of
FGFRs and FGF-21 has not been detected. Furthermore, various
non-adipocyte cells do not respond to FGF-21, even though they
express multiple FGFR isoforms. All of these data suggest that a
cofactor must mediate FGF-21 signaling through FGFRs. Recent
studies have identified .beta.-klotho, which is highly expressed in
liver, adipocytes and in pancreas, as a determinant of the cellular
response to FGF-21 (Kurosu, H. et al. (2007) J Biol Chem 282,
26687-95). .beta.-klotho preferentially binds to FGFR1c and FGFR4.
The .beta.-klotho-FGFR complex, but not FGFR alone, binds to FGF-21
in vitro (Kharitonenkov, A. et al. (2008) J Cell Physiol 215, 1-7).
A similar mechanism has been identified in the FGF-23-klotho-FGFR
system (Urakawa, I. et al. (2006) Nature 444, 770-4).
[0006] The bioactivity of FGF-21 was first identified in a mouse
3T3-L1 adipocyte glucose uptake assay (Kharitonenkov, A. et al.
(2005) J Clin Invest 115, 1627-35). Subsequently, FGF-21 was shown
to induce insulin-independent glucose uptake and GLUT1 expression.
FGF-21 has also been shown to ameliorate hyperglycemia in a range
of diabetic rodent models. In addition, transgenic mice
over-expressing FGF-21 were found to be resistant to diet-induced
metabolic abnormalities, including decreased body weight and fat
mass, and enhancements in insulin sensitivity (Badman, M. K. et al.
(2007) Cell Metab 5, 426-37). Administration of FGF-21 to diabetic
non-human primates caused a decline in fasting plasma glucose,
triglycerides, insulin and glucagon levels, and led to significant
improvements in lipoprotein profiles including a nearly 80%
increase in HDL cholesterol (Kharitonenkov, A. et al. (2007)
Endocrinology 148, 774-81). Importantly, hypoglycemia was not
observed at any point during this NHP study. Moreover, recent
studies identified FGF-21 as an important endocrine hormone that
helps to control adaptation to the fasting state. This provides a
previously missing link, downstream of PPAR.alpha., by which the
liver communicates with the rest of the body in regulating the
biology of energy homeostasis.
[0007] The combined observations that FGF-21 regulates adipose
(lipolysis), liver (fatty acid oxidation and ketogenesis), and
brain (torpor) establish it as a major endocrine regulator of the
response to fasting (Kharitonenkov, A. & Shanafelt, A. B.
(2008) BioDrugs 22, 37-44). However, the problem with using FGF-21
directly as a biotherapeutic is that its half-life is very short.
In mice, the half-life of human FGF21 is 0.5 to 1 hours, and in
cynomolgus monkeys, the half-life is 2 to 3 hours.
[0008] In developing an FGF21 protein for use as a therapeutic in
the treatment of type 1 and type 2 diabetes mellitus and other
metabolic conditions, an increase in half-life and stability would
be desirable. FGF21 proteins having enhanced half-life and
stability would allow for less frequent dosing of patients being
administered the protein. Clearly, there is a need to develop a
stable aqueous protein formulation for the therapeutic protein
FGF21.
[0009] FGF21 may be utilized as a multi-use, sterile pharmaceutical
formulation. However, it has been determined that preservatives,
i.e., m-cresol, have an adverse affect on its stability under these
conditions. The present invention overcomes the significant hurdles
of physical instabilities with the invention of variants of FGF21
that are more stable, less susceptible to proteolysis and enzymatic
degradation, and less likely to aggregate and form complexes, than
wild-type FGF21 under pharmaceutical formulation conditions.
[0010] Thus, the variants of FGF21 of the present invention provide
stable pharmacological protein formulations that are useful for the
treatment of FGF21-associated disorders, such as obesity, type 2
diabetes mellitus, type 1 diabetes mellitus, pancreatitis,
dyslipidemia, nonalcoholic steatohepatitis (NASH), insulin
resistance, hyperinsulinemia, glucose intolerance, hyperglycemia,
metabolic syndrome, hypertension, cardiovascular disease,
atherosclerosis, peripheral arterial disease, stroke, heart
failure, coronary heart disease, kidney disease, diabetic
complications, neuropathy, gastroparesis and other metabolic
disorders, and in reducing the mortality and morbidity of
critically ill patients.
SUMMARY OF THE INVENTION
[0011] The invention relates to the identification of new
polypeptide and protein variants of fibroblast growth factor 21
(FGF21) that have improved pharmaceutical properties, e.g., are
more stable, less susceptible to proteolysis and enzymatic
degradation, and less likely to aggregate and form complexes, than
wild-type FGF21 under pharmaceutical formulation conditions. Also
disclosed are methods for treating FGF21-associated disorders,
including metabolic conditions.
[0012] The FGF21 protein variants of the present invention may be
used as a once weekly injectable either alone or in combination
with oral anti-diabetic agents which will improve the glycemic
control, body weight and lipid profile of type 1 and type 2
diabetes mellitus patients. In a first aspect, the invention
provides polypeptide and protein variants of Fibroblast Growth
Factor 21 (FGF21), which include but are not limited to one or more
of the sequences listed in Table 1, and further described herein.
Said FGF21 variants of Table 1 comprise 4 amino acid N-terminally
truncated mature FGF21 wild-type proteins (i.e., 4 residue
N-terminal truncated versions of the mature FGF21 sequence (SEQ ID
NO:3)) with a variety of site-specific internal modifications. The
variants of Table 1 are numbered relative to the full length FGF21
protein sequence (NCBI reference sequence number
NP.sub.--061986.1); for example, the aspartic acid residue in
position one of Variant 1 (SEQ ID NO:5) corresponds to residue
number 33 of SEQ ID NO:1 (and residue number 5 of mature FGF21
sequence (SEQ ID NO:3)).
TABLE-US-00001 TABLE 1 List of FGF21 variants, amino acid sequences
and amino acid changes relative to wild type FGF21 (SEQ ID NO: 1).
Site-specific modifications made relative to prior art SEQ ID NO: 1
(full length FGF21 SEQ protein sequence (NCBI ID reference sequence
number Variant NO: Sequence NP_061986.1)) 1 5 DSSPLLQFGG QVRQRYLYTD
DAQETEAHLE Q56E, V69A, Q82E, R105G, IREDGTAGGA ADQSPESLLE
LKALKPGVIQ L127V, N149H, Q184E, ILGVKTSRFL CQGPDGALYG SLHFDPEACS
A208T FRELVLEDGY NVYQSEAHGL PLHLPGHKSP HRDPAPRGPA RFLPLPGLPP
ALPEPPGILA PEPPDVGSSD PLSMVGPSQG RSPSYTS 2 6 DSSPLLQFGG QVRQRYLYTD
DAQNTEAHLE Q56N, V69A, Q82N, IREDGTAGGA ADQSPESLLN LKALKPGVIQ
R105K, L127V, N149Q, ILGVKTSRFL CQKPDGALYG SLHFDPEACS Q184N, A208T
FRELVLEDGY NVYQSEAHGL PLHLPGQKSP HRDPAPRGPA RFLPLPGLPP ALPEPPGILA
PNPPDVGSSD PLSMVGPSQG RSPSYTS 5 7 DSSPLLQFGG QVRQRYLYTD DDQQTEAHLE
A54D, D74H, T98A, R105K, IREDGTVGGA AHQSPESLLQ LKALKPGVIQ D130N,
K150R, P158S, ILGVKASRFL CQKPDGALYG SLHFDPEACS R159Q, S195A, G202A
FRELLLENGY NVYQSEAHGL PLHLPGNRSP HRDPASQGPA RFLPLPGLPP ALPEPPGILA
PQPPDVGSSD PLAMVGPSQA RSPSYAS 6 8 DSSPLLQFGG QVRQRYLYTD DDQQTEAHLE
A54D, D74H, K97Q, R105K, IREDGTVGGA AHQSPESLLQ LKALKPGVIQ D130N,
A139T, P158S, ILGVQTSRFL CQKPDGALYG SLHFDPEACS R159Q, S195A, G202A
FRELLLENGY NVYQSETHGL PLHLPGNKSP HRDPASQGPA RFLPLPGLPP ALPEPPGILA
PQPPDVGSSD PLAMVGPSQA RSPSYAS 7 9 DSSPLLQFGG QVRQRYLYTD DAQETEAHLE
Q56E, D74H, T98A, R105K, IREDGTVGGA AHQSPESLLQ LKALKPGVIQ D130N,
K150R, P158S, ILGVKASRFL CQKPDGALYG SLHFDPEACS R159Q, S195A, G202A
FRELLLENGY NVYQSEAHGL PLHLPGNRSP HRDPASQGPA RFLPLPGLPP ALPEPPGILA
PQPPDVGSSD PLAMVGPSQA RSPSYAS 8 10 DSSPLLQFGG QVRQRYLYTD DAQETEAHLE
Q56E, D74H, K97Q, R105K, IREDGTVGGA AHQSPESLLQ LKALKPGVIQ D130N,
A139T, P158S, ILGVQTSRFL CQKPDGALYG SLHFDPEACS R159Q, S195A, G202A
FRELLLENGY NVYQSETHGL PLHLPGNKSP HRDPASQGPA RFLPLPGLPP ALPEPPGILA
PQPPDVGSSD PLAMVGPSQA RSPSYAS 9 11 DSSPLLQFGG QVRQRYLYTD DDQQTEAHLE
A54D, D74H, T98A, R105K, IREDGTVGGA AHQSPESLLQ LKALKPGVIQ D130N,
A139T, P158S, ILGVKASRFL CQKPDGALYG SLHFDPEACS R159Q, S195A, G202A
FRELLLENGY NVYQSETHGL PLHLPGNKSP HRDPASQGPA RFLPLPGLPP ALPEPPGILA
PQPPDVGSSD PLAMVGPSQA RSPSYAS 10 12 DSSPLLQFGG QVRQRYLYTD
DAQETEAHLE Q56E, D74H, T98A, R105K, IREDGTVGGA AHQSPESLLQ
LKALKPGVIQ D130N, A139T, P158S, ILGVKASRFL CQKPDGALYG SLHFDPEACS
R159Q, S195A, G202A FRELLLENGY NVYQSETHGL PLHLPGNKSP HRDPASQGPA
RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQA RSPSYAS 11 13
DSSPLLQFGG QVRQRYLYTD DDQQTEAHLE A54D, D74H, Q82E, R105K,
IREDGTVGGA AHQSPESLLE LKALKPGVIQ D130N, K150R, R159Q, ILGVKTSRFL
CQKPDGALYG SLHFDPEACS S195A FRELLLENGY NVYQSEAHGL PLHLPGNRSP
HRDPAPQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQG RSPSYAS 12
14 DSSPLLQFGG QVRQRYLYTD DDQQTEAHLE A54D, D74H, K97Q, R105K,
IREDGTVGGA AHQSPESLLQ LKALKPGVIQ D130N, K150R, R159Q, ILGVQTSRFL
CQKPDGALYG SLHFDPEACS S195A FRELLLENGY NVYQSEAHGL PLHLPGNRSP
HRDPAPQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQG RSPSYAS 13
15 DSSPLLQFGG QVRQRYLYTD DDQQTEAHLE A54D, D74H, T98A, R105K,
IREDGTVGGA AHQSPESLLQ LKALKPGVIQ D130N, K150R, R159Q, ILGVKASRFL
CQKPDGALYG SLHFDPEACS S195A FRELLLENGY NVYQSEAHGL PLHLPGNRSP
HRDPAPQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQG RSPSYAS 14
16 DSSPLLQFGG QVRQRYLYTD DAQETEAHLE Q56E, D74H, Q82E, R105K,
IREDGTVGGA AHQSPESLLE LKALKPGVIQ D130N, K150R, R159Q, ILGVKTSRFL
CQKPDGALYG SLHFDPEACS S195A FRELLLENGY NVYQSEAHGL PLHLPGNRSP
HRDPAPQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQG RSPSYAS 14-
17 DSSPLLQFGG QVRQRYLYTD DAQETEAHLE Q56E, D74H, Q82E, R105K, R154C,
IREDGTVGGA AHQSPESLLE LKALKPGVIQ D130N, K150R, R154C, L174P
ILGVKTSRFL CQKPDGALYG SLHFDPEACS R159Q, L174P, S195A FRELLLENGY
NVYQSEAHGL PLHLPGNRSP HCDPAPQGPA RFLPLPGLPP APPEPPGILA PQPPDVGSSD
PLAMVGPSQG RSPSYAS 15 18 DSSPLLQFGG QVRQRYLYTD DAQETEAHLE Q56E,
D74H, K97Q, R105K, IREDGTVGGA AHQSPESLLQ LKALKPGVIQ D130N, K150R,
R159Q, ILGVQTSRFL CQKPDGALYG SLHFDPEACS S195A FRELLLENGY NVYQSEAHGL
PLHLPGNRSP HRDPAPQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQG
RSPSYAS 16 19 DSSPLLQFGG QVRQRYLYTD DAQETEAHLE Q56E, D74H, T98A,
R105K, IREDGTVGGA AHQSPESLLQ LKALKPGVIQ D130N, K150R, R159Q,
ILGVKASRFL CQKPDGALYG SLHFDPEACS S195A FRELLLENGY NVYQSEAHGL
PLHLPGNRSP HRDPAPQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQG
RSPSYAS 17 20 DSSPLLQFGG QVRQRYLYTD DAQQTESHLE A59S, D74H, Q82E,
R105K, IREDGTVGGA AHQSPESLLE LKALKPGVIQ D130N, K150R, R159Q,
ILGVKTSRFL CQKPDGALYG SLHFDPEACS S195A FRELLLENGY NVYQSEAHGL
PLHLPGNRSP HRDPAPQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQG
RSPSYAS 18 21 DSSPLLQFGG QVRQRYLYTD DAQQTESHLE A59S, D74H, K97Q,
R105K, IREDGTVGGA AHQSPESLLQ LKALKPGVIQ D130N, K150R, R159Q,
ILGVQTSRFL CQKPDGALYG SLHFDPEACS S195A FRELLLENGY NVYQSEAHGL
PLHLPGNRSP HRDPAPQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQG
RSPSYAS 19 22 DSSPLLQFGG QVRQRYLYTD DAQQTESHLE A59S, D74H, T98A,
R105K, IREDGTVGGA AHQSPESLLQ LKALKPGVIQ D130N, K150R, R159Q,
ILGVKASRFL CQKPDGALYG SLHFDPEACS S195A FRELLLENGY NVYQSEAHGL
PLHLPGNRSP HRDPAPQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQG
RSPSYAS 50 23 DSSPLLQFGG QVRQRYLYTD DDQQTEAHLE A54D, D74H, K97Q,
R105K, IREDGTVGGA AHQSPESLLQ LKALKPGVIQ D130N, K150R, P158S,
ILGVQTSRFL CQKPDGALYG SLHFDPEACS R159Q, S195A, G202A FRELLLENGY
NVYQSEAHGL PLHLPGNRSP HRDPASQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD
PLAMVGPSQA RSPSYAS 51 24 DSSPLLQFGG QVRQRYLYTD DAQETEAHLE Q56E,
D74H, K97Q, R105K, IREDGTVGGA AHQSPESLLQ LKALKPGVIQ D130N, K150R,
P158S, ILGVQTSRFL CQKPDGALYG SLHFDPEACS R159Q, S195A, G202A
FRELLLENGY NVYQSEAHGL PLHLPGNRSP HRDPASQGPA RFLPLPGLPP ALPEPPGILA
PQPPDVGSSD PLAMVGPSQA RSPSYAS 52 25 DSSPLVQFGG QVRQRYLYTD
DAQQTEAHLE L38V, D74H, R105K, D130N, IREDGTVGGA AHQSPESLLQ
LKALKPGVIQ G141S, P158S, R159Q, ILGVKTSRFL CQKPDGALYG SLHFDPEACS
G202A FRELLLENGY NVYQSEAHSL PLHLPGNKSP HRDPASQGPA RFLPLPGLPP
ALPEPPGILA PQPPDVGSSD PLSMVGPSQA RSPSYAS 53 26 DSSPLLQFGG
QVRQRYLYTD DAQETEAHLE Q56E, D74H, Q82E, R105K, IREDGTVGGA
AHQSPESLLE LKALKPGVIQ D130N, K150R, P158S, ILGVKTSRFL CQKPDGALYG
SLHFDPEACS R159Q, L174P, S195A FRELLLENGY NVYQSEAHGL PLHLPGNRSP
HRDPASQGPA RFLPLPGLPP APPEPPGILA PQPPDVGSSD PLAMVGPSQG RSPSYAS 54
27 DSSPLLQFGG QVRQRYLYTD DAQQTEAHLE D74H, Q82E, R105K, A109T,
IREDGTVGGA AHQSPESLLE LKALKPGVIQ D130N, K150R, P158S, ILGVKTSRFL
CQKPDGTLYG SLHFDPEACS R159Q, L174P, S195A FRELLLENGY NVYQSEAHGL
PLHLPGNRSP HRDPASQGPA RFLPLPGLPP APPEPPGILA PQPPDVGSSD PLAMVGPSQG
RSPSYAS 55 28 DSSPLLQFGG QVRQRYLYTD DAQQTEAHLE V69A, D74H, Q82E,
R105K, IREDGTAGGA AHQSPESLLE LKALKPGVIQ D130N, K150R, P158S,
ILGVKTSRFL CQKPDGALYG SLHFDPEACS R159Q, L174P, S195A FRELLLENGY
NVYQSEAHGL PLHLPGNRSP HRDPASQGPA RFLPLPGLPP APPEPPGILA PQPPDVGSSD
PLAMVGPSQG RSPSYAS 56 29 DSSPLLQFGG QVRQRYLYTD DAQQTEAHLE D74H,
T98A, R105K, D130N, IREDGTVGGA AHQSPESLLQ LKALKPGVIQ A139T, P158S,
R159Q, ILGVKASRFL CQKPDGALYG SLHFDPEACS L174P, S195A, G202A
FRELLLENGY NVYQSETHGL PLHLPGNKSP HRDPASQGPA RFLPLPGLPP APPEPPGILA
PQPPDVGSSD PLAMVGPSQA RSPSYAS 57 30 DSSPLLQFGG QVRQRYLYTD
DAQQTEAHLE D74H, T98A, D130N, A139T, IREDGTVGGA AHQSPESLLQ
LKALKPGVIQ K150R, P158S, R159Q, ILGVKASRFL CQRPDGALYG SLHFDPEACS
L174P, S195A, G202A FRELLLENGY NVYQSETHGL PLHLPGNRSP HRDPASQGPA
RFLPLPGLPP APPEPPGILA PQPPDVGSSD PLAMVGPSQA RSPSYAS 58 31
DSSPLLQFGG QVRQRYLYTD DAQQTEAHLE D74H, A109T, D130N, A139T,
IREDGTVGGA AHQSPESLLQ LKALKPGVIQ K150R, P158S, R159Q, ILGVKTSRFL
CQRPDGTLYG SLHFDPEACS L174P, S195A, G202A FRELLLENGY NVYQSETHGL
PLHLPGNRSP HRDPASQGPA RFLPLPGLPP APPEPPGILA PQPPDVGSSD PLAMVGPSQA
RSPSYAS 59 32 DSSPLLQFGG QVRQRYLYTD DACQTEAHLE Q55C, D74H, Q82E,
D130N, IREDGTVGGA AHQSPESLLE LKALKPGVIQ G148C, K150R, P158S,
ILGVKTSRFL CQRPDGALYG SLHFDPEACS R159Q, L174P, S195A FRELLLENGY
NVYQSEAHGL PLHLPCNRSP HRDPASQGPA RFLPLPGLPP APPEPPGILA PQPPDVGSSD
PLAMVGPSQG RSPSYAS 60 33 DSSPLLQFGG QVRQRYLYTD DACQTEAHLE Q55C,
D74H, Q82E, A109T, IREDGTVGGA AHQSPESLLE LKALKPGVIQ D130N, G148C,
K150R, ILGVKTSRFL CQRPDGTLYG SLHFDPEACS P158S, L174P, S195A
FRELLLENGY NVYQSEAHGL PLHLPCNRSP HRDPASRGPA RFLPLPGLPP APPEPPGILA
PQPPDVGSSD PLAMVGPSQG RSPSYAS 61 34 DSSPLLQFGG QVRQRYLYTD
DACQTEAHLE Q55C, V69A, D74H, Q82E, IREDGTAGGA AHQSPESLLE LKALKPGVIQ
D130N, G148C, K150R, ILGVKTSRFL CQRPDGALYG SLHFDPEACS P158S, L174P,
S195A FRELLLENGY NVYQSEAHGL PLHLPCNRSP HRDPASRGPA RFLPLPGLPP
APPEPPGILA PQPPDVGSSD PLAMVGPSQG RSPSYAS 62 35 DSSPLLQFGG
QVRQRYLYTD DACQTEAHLE Q55C, D74H, D130N, A139T, IREDGTVGGA
AHQSPESLLQ LKALKPGVIQ G148C, P158S, R159Q, ILGVKTSRFL CQRPDGALYG
SLHFDPEACS L174P, S195A, G202A FRELLLENGY NVYQSETHGL PLHLPCNKSP
HRDPASQGPA RFLPLPGLPP APPEPPGILA PQPPDVGSSD PLAMVGPSQA RSPSYAS 63
36 DSSPLLQFGG QVRQRYLYTD DACQTEAHLE Q55C, D74H, D130N, A139T,
IREDGTVGGA AHQSPESLLQ LKALKPGVIQ G148C, K150R, P158S, ILGVKTSRFL
CQRPDGALYG SLHFDPEACS L174P, S195A, G202A FRELLLENGY NVYQSETHGL
PLHLPCNRSP HRDPASRGPA RFLPLPGLPP APPEPPGILA PQPPDVGSSD PLAMVGPSQA
RSPSYAS 64 37 DSSPLLQFGG QVRQRYLYTD DACQTEAHLE Q55C, A109T, D130N,
A139T, IREDGTVGGA ADQSPESLLQ LKALKPGVIQ G148C, K150R, P158S,
ILGVKTSRFL CQRPDGTLYG SLHFDPEACS L174P, S195A, G202A FRELLLENGY
NVYQSETHGL PLHLPCNRSP HRDPASRGPA RFLPLPGLPP APPEPPGILA PQPPDVGSSD
PLAMVGPSQA RSPSYAS 73 38 DSSPLLQFGG QVRQRYLYTD DAQETEAHLE Q56E,
D74H, Q82E, R105K, IREDGTVGGA AHQSPESLLE LKALKPGVIQ D130E, K150R,
R159Q, ILGVKTSRFL CQKPDGALYG SLHFDPEACS S195A FRELLLEEGY NVYQSEAHGL
PLHLPGNRSP HRDPAPQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQG
RSPSYAS
76 39 DSSPLLQFGG QVRQRYLYTD DAQETEAHLE Q56E, D74H, Q82E, R105K,
IREDGTVGGA AHQSPESLLE LKALKPGVIQ K150R, R154C, R159Q, ILGVKTSRFL
CQKPDGALYG SLHFDPEACS S195A FRELLLEDGY NVYQSEAHGL PLHLPGNRSP
HCDPAPQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQG RSPSYAS 79
40 DSSPLLQFGG QVRQRYLYTD DAQQTEAHLE D74H, Q82E, R105K, K150R,
IREDGTVGGA AHQSPESLLE LKALKPGVIQ R154C, R159Q, S195A, ILGVKTSRFL
CQKPDGALYG SLHFDPEACS G202A FRELLLEDGY NVYQSEAHGL PLHLPGNRSP
HCDPAPQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQA RSPSYAS 80
41 DSSPLLQFGG QVRQRYLYTD DAQQTEAHLE Q82E, R105K, A109T, K150R,
IREDGTVGGA ADQSPESLLE LKALKPGVIQ R154C, R159Q, S195A, ILGVKTSRFL
CQKPDGTLYG SLHFDPEACS G202A FRELLLEDGY NVYQSEAHGL PLHLPGNRSP
HCDPAPQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQA RSPSYAS 81
42 DSSPLLQFGG QVRQRYLYTD DAQQTEAHLE D74H, Q82E, R105K, K150R,
IREDGTVGGA AHQSPESLLE LKALKPGVIQ R154C, P158S, R159Q, ILGVKTSRFL
CQKPDGALYG SLHFDPEACS S195A FRELLLEDGY NVYQSEAHGL PLHLPGNRSP
HCDPASQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQG RSPSYAS 82
43 DSSPLLQFGG QVRQRYLYTD DAQQTEAHLE Q82E, R105K, A109T, K150R,
IREDGTVGGA ADQSPESLLE LKALKPGVIQ R154C, P158S, R159Q, ILGVKTSRFL
CQKPDGTLYG SLHFDPEACS S195A FRELLLEDGY NVYQSEAHGL PLHLPGNRSP
HCDPASQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQG RSPSYAS 83
44 DSSPLLQFGG QVRQRYLYTD DAQQTEAHLE Q82E, R105K, A109T, K150R,
IREDGTVGGA ADQSPESLLE LKALKPGVIQ R154C, P158S, S195A, ILGVKTSRFL
CQKPDGTLYG SLHFDPEACS G202A FRELLLEDGY NVYQSEAHGL PLHLPGNRSP
HCDPASRGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQA RSPSYAS 84
45 DSSPLLQFGG QVRQRYLYTD DAQQTEAHLE Q82E, A109T, A139T, K150R,
IREDGTVGGA ADQSPESLLE LKALKPGVIQ R154C, P158S, S195A, ILGVKTSRFL
CQRPDGTLYG SLHFDPEACS G202A FRELLLEDGY NVYQSETHGL PLHLPGNRSP
HCDPASRGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQA RSPSYAS 85
46 DSSPLLQFGG QVRQRYLYTD DAQQTEAHLE D74H, Q82E, R105K, D130E,
IREDGTVGGA AHQSPESLLE LKALKPGVIQ K150R, R154C, R159Q, ILGVKTSRFL
CQKPDGALYG SLHFDPEACS S195A FRELLLEEGY NVYQSEAHGL PLHLPGNRSP
HCDPAPQGPA RFLPLPGLPP ALPEPPGILA PQPPDVGSSD PLAMVGPSQG RSPSYAS 86
48 DSSPLLQFGG QVRQRYLYTD DAQQTEAHLE K84R, K87R, K97R, K150R,
IREDGTVGGA ADQSPESLLQ LRALRPGVIQ R154K, L174P, S195A ILGVRTSRFL
CQRPDGALYG SLHFDPEACS FRELLLEDGY NVYQSEAHGL PLHLPGNRSP HKDPAPRGPA
RFLPLPGLPP APPEPPGILA PQPPDVGSSD PLAMVGPSQG RSPSYAS 87 49
DSSPLLQFGG QVRQRYLYTD DACQTEAHLE Q55C, K84R, K87R, K97R, IREDGTVGGA
ADQSPESLLQ LRALRPGVIQ G148C, K150R, R154K, ILGVRTSRFL CQRPDGALYG
SLHFDPEACS L174P, S195A FRELLLEDGY NVYQSEAHGL PLHLPCNRSP HKDPAPRGPA
RFLPLPGLPP APPEPPGILA PQPPDVGSSD PLAMVGPSQG RSPSYAS
[0013] Other embodiments are drawn to polynucleotides encoding the
polypeptide and protein variants of the invention, a vector
containing said polynucleotides and a host cell carrying said
vector.
[0014] Provided herein are methods used to generate said
polypeptides and protein variants, wherein such methods involve
modification of the wild-type FGF21 protein, via e.g., truncations
of the wild-type FGF21 protein, and the site-specific incorporation
of amino acids at positions of interest within the wild-type FGF21
protein. Said modifications enhance the biological properties of
the variants of the invention relative to the wild-type FGF21
protein, as well as, in some cases, serving as points of attachment
for, e.g., labels and protein half-life extension agents, and for
purposes of affixing said variants to the surface of a solid
support. Related embodiments of the invention are methods of
produce cells capable of producing said polypeptide and protein
variants, and of producing vectors containing DNA encoding said
variants.
[0015] In various embodiments, the polypeptide and protein variants
disclosed herein can comprise (a) an amino-terminal truncation of
no more than 8 amino acid residues, wherein the polypeptide is
capable of lowering blood glucose in a mammal; (b) a
carboxyl-terminal truncation of no more than 12 amino acid
residues, wherein the polypeptide is capable of lowering blood
glucose in a mammal; or (c) an amino-terminal truncation of no more
than 8 amino acid residues and a carboxyl-terminal truncation of no
more than 12 amino acid residues, wherein the polypeptide is
capable of lowering blood glucose in a mammal.
[0016] In some embodiments, the polypeptide and protein variants
disclosed herein can be covalently linked to one or more polymers,
such as polyethylene glycol (PEG) or polysialic acid, whether at
the position of site-specific amino acid modifications made
relative to the wild-type FGF21, or at the position of amino acids
commonly shared with the wild-type FGF21. In other embodiments, the
polypeptides of the invention can be fused to a heterologous amino
acid sequence, optionally via a linker, such as GS or
GGGGSGGGGSGGGGS (SEQ ID NO:4). The heterologous amino acid sequence
can be an IgG constant domain or fragment thereof (e.g., the Fc
region), Human Serum Albumin (HSA), or albumin-binding
polypeptides. Such fusion polypeptides disclosed herein can also
form multimers.
[0017] In some embodiments, the fusion heterologous amino acid
sequence (e.g., HSA, Fc, etc.) is fused to the amino-terminal of
the protein variants of the invention. In other embodiments, the
fusion heterologous amino acid sequence (e.g., HSA, Fc, etc.) is
fused to the carboxyl-terminal of the protein variants of the
invention.
[0018] Yet another embodiment is drawn to methods of treating a
patient exhibiting one or more FGF21-associated disorders, such as
obesity, type 2 diabetes mellitus, type 1 diabetes mellitus,
pancreatitis, dyslipidemia, nonalcoholic steatohepatitis (NASH),
insulin resistance, hyperinsulinemia, glucose intolerance,
hyperglycemia, metabolic syndrome, hypertension, cardiovascular
disease, atherosclerosis, peripheral arterial disease, stroke,
heart failure, coronary heart disease, kidney disease, diabetic
complications, neuropathy, gastroparesis and other metabolic
disorders, comprising administering to said patient in need of such
treatment a therapeutically effective amount of one or more human
FGF21 polypeptide and protein variants of the invention or a
pharmaceutical composition thereof.
[0019] The invention also provides pharmaceutical compositions
comprising the polypeptide and protein variants disclosed herein
and a pharmaceutically acceptable formulation agent. Such
pharmaceutical compositions can be used in a method for treating a
metabolic disorder, and the method comprises administering to a
human patient in need thereof a pharmaceutical composition of the
invention. Non-limiting examples of metabolic disorders that can be
treated include type 1 and type 2 diabetes mellitus and
obesity.
[0020] These and other aspects of the invention will be elucidated
in the following detailed description of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1 is a graphical representation showing a drop in liver
triglyceride levels following treatment of ob/ob mice for 12 days
with PEGylated wild type FGF21 and the FGF21 variants of the
invention. Liver samples (<50 mg) were homogenized in
isopropanol: butylated hydroxytoluene (BHT or
2,6-di-tert-butyl-4-methylphenol) at a ratio of 1000:5, using
Qiagen tissue lyser (with one 5-mm bead). Following homogenization,
the samples were gently shaken for 45 min at room temperature and
then spun down at 6000 rpm for 10 min at 4.degree. C. The
supernatants were collected and assayed for triglyceride content
using the Wako triglyceride assay kit.
[0022] FIG. 2 is a graphical representation showing plasma
exposures of FGF21-WT-R154C-PEG and FGF21-V76-154C-PEG in ob/ob
mice treated for 12 days. FGF21-WT-R154C-PEG and FGF21-V76-154C-PEG
were given subcutaneously on days 1, 4, 8 and 11 after 0 h time
point.
[0023] FIGS. 3A and 3B show ob/ob mouse plasma stability of wild
type FGF21 (Panel A) and FGF21-V76-154C-PEG (Panel B). The average
plasma contribution to the pERK activity ("background activity") is
28% (range 12-49%) for the wild type FGF21 samples and 58% (range
46-75%) for the FGF21-V76-154C-PEG samples.
DETAILED DESCRIPTION OF THE INVENTION
[0024] A significant challenge in the development of protein
pharmaceuticals, such as FGF21, including the FGF21 protein
variants of the present invention, is to cope with their physical
and chemical instabilities. The compositional variety and
characteristics of proteins define specific behaviors such as
folding, conformational stability, and unfolding/denaturation. Such
characteristics must be addressed to stabilize proteins when
developing pharmaceutical formulation conditions utilizing aqueous
protein solutions (Wang, W., Int. J. of Pharmaceutics, 18, (1999)).
A desired effect of stabilizing therapeutic proteins of interest,
e.g., the FGF21 protein variants of the present invention, is
increasing resistance to proteolysis and enzymatic degradation,
thereby improving protein stability and reducing protein
aggregation.
[0025] Specifically, in pharmaceutical protein development,
anti-microbial preservative agents such as phenol, m-cresol,
methylparaben, resorcinol, and benzyl alcohol are necessary in
parenteral pharmaceutical formulations that are intended to be a
sterile, multi-use formulation. Unfortunately, these compounds
often adversely affect the stability of the protein product,
triggering association and aggregation, in particular (Maa et al.,
Int. J. of Pharmaceutics 140:155-168 (1996); Lam et al., Pharm.
Res. 14(6):725-729 (1997)).
[0026] The FGF21 polypeptide and protein variants of the present
invention represent modified versions of the full length, wild-type
FGF21 polypeptide, as known in the art. FGF21 wild-type sequence
will serve as a reference sequence (SEQ ID NO:1), for instance,
when comparisons between the FGF21 wild-type sequence and the
protein variants are necessary. The FGF21 wild-type sequence has
NCBI reference sequence number NP.sub.--061986.1, and can be found
in such issued patents as, e.g., U.S. Pat. No. 6,716,626B1,
assigned to Chiron Corporation.
TABLE-US-00002 Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu
Trp Val Ser 1 5 10 15 Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gln
Ala His Pro Ile Pro 20 25 30 Asp Ser Ser Pro Leu Leu Gln Phe Gly
Gly Gln Val Arg Gln Arg Tyr 35 40 45 Leu Tyr Thr Asp Asp Ala Gln
Gln Thr Glu Ala His Leu Glu Ile Arg 50 55 60 Glu Asp Gly Thr Val
Gly Gly Ala Ala Asp Gln Ser Pro Glu Ser Leu 65 70 75 80 Leu Gln Leu
Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 85 90 95 Lys
Thr Ser Arg Phe Leu Cys Gln Arg Pro Asp Gly Ala Leu Tyr Gly 100 105
110 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu
115 120 125 Glu Asp Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu
Pro Leu 130 135 140 His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro
Ala Pro Arg Gly 145 150 155 160 Pro Ala Arg Phe Leu Pro Leu Pro Gly
Leu Pro Pro Ala Leu Pro Glu 165 170 175 Pro Pro Gly Ile Leu Ala Pro
Gln Pro Pro Asp Val Gly Ser Ser Asp 180 185 190 Pro Leu Ser Met Val
Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 195 200 205 Ser 209
[0027] The corresponding cDNA sequence coding for the full-length
FGF21 polypeptide (NCBI reference sequence number
NM.sub.--019113.2) is shown below (SEQ ID NO:2)
TABLE-US-00003 1 atggactcgg acgagaccgg gttcgagcac tcaggactgt
gggtttctgt gctggctggt 61 cttctgctgg gagcctgcca ggcacacccc
atccctgact ccagtcctct cctgcaattc 121 gggggccaag tccggcagcg
gtacctctac acagatgatg cccagcagac agaagcccac 181 ctggagatca
gggaggatgg gacggtgggg ggcgctgctg accagagccc cgaaagtctc 241
ctgcagctga aagccttgaa gccgggagtt attcaaatct tgggagtcaa gacatccagg
301 ttcctgtgcc agcggccaga tggggccctg tatggatcgc tccactttga
ccctgaggcc 361 tgcagcttcc gggagctgct tcttgaggac ggatacaatg
tttaccagtc cgaagcccac 421 ggcctcccgc tgcacctgcc agggaacaag
tccccacacc gggaccctgc accccgagga 481 ccagctcgct tcctgccact
accaggcctg ccccccgcac tcccggagcc acccggaatc 541 ctggcccccc
agccccccga tgtgggctcc tcggaccctc tgagcatggt gggaccttcc 601
cagggccgaa gccccagcta cgcttcctga
[0028] The mature FGF21 sequence lacks a leader sequence and may
also include other modifications of a polypeptide such as
proteolytic processing of the amino terminus (with or without a
leader sequence) and/or the carboxyl terminus, cleavage of a
smaller polypeptide from a larger precursor, N-linked and/or
O-linked glycosylation, and other post-translational modifications
understood by those with skill in the art. A representative example
of a mature FGF21 sequence has the following sequence (SEQ ID NO:3,
which represents amino acid positions 29-209 of full length FGF21
protein sequence (NCBI reference sequence number
NP.sub.--061986.1)):
TABLE-US-00004 His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gln Phe Gly
Gly Gln Val 5 10 15 Arg Gln Arg Tyr Leu Tyr Thr Asp Asp Ala Gln Gln
Thr Glu Ala His 20 25 30 Leu Glu Ile Arg Glu Asp Gly Thr Val Gly
Gly Ala Ala Asp Gln Ser 35 40 45 Pro Glu Ser Leu Leu Gln Leu Lys
Ala Leu Lys Pro Gly Val Ile Gln 50 55 60 Ile Leu Gly Val Lys Thr
Ser Arg Phe Leu Cys Gln Arg Pro Asp Gly 65 70 75 80 Ala Leu Tyr Gly
Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg 85 90 95 Glu Leu
Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gln Ser Glu Ala His 100 105 110
Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro 115
120 125 Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro
Pro 130 135 140 Ala Leu Pro Glu Pro Pro Gly Ile Leu Ala Pro Gln Pro
Pro Asp Val 145 150 155 160 Gly Ser Ser Asp Pro Leu Ser Met Val Gly
Pro Ser Gln Gly Arg Ser 165 170 175 Pro Ser Tyr Ala Ser 180
[0029] The corresponding cDNA sequence coding for the mature FGF21
polypeptide (SEQ ID NO:3) is shown below (SEQ ID NO:47):
TABLE-US-00005 1 caccccatcc ctgactccag tcctctcctg caattcgggg
gccaagtccg gcagcggtac 61 ctctacacag atgatgccca gcagacagaa
gcccacctgg agatcaggga ggatgggacg 121 gtggggggcg ctgctgacca
gagccccgaaagtctcctgc agctgaaagc cttgaagccg 181 ggagttattc
aaatcttggg agtcaagacatccaggttcc tgtgccagcg gccagatggg 240
gccctgtatg gatcgctcca ctttgaccctgaggcctgca gcttccggga gctgcttctt
301 gaggacggat acaatgttta ccagtccgaa gcccacggcc tcccgctgca
cctgccaggg 360 aacaagtccc cacaccggga ccctgcaccccgaggaccag
ctcgcttcct gccactacca 421 ggcctgcccc ccgcactccc ggagccaccc
ggaatcctgg ccccccagcc ccccgatgtg 481 ggctcctcgg accctctgag
catggtgggaccttcccagg gccgaagccc cagctacgct 541 tcctga
[0030] One skilled in the art of expression of proteins will
recognize that methionine or methionine-arginine sequence can be
introduced at the N-terminus of any of the FGF21 protein variants,
for expression in E. coli, and are contemplated within the context
of this invention.
[0031] The terms "FGF21 protein variant," "human FGF21 variant,"
"FGF21 polypeptide or protein variant," "variant," "FGF21 mutant,"
or any like terms, are defined as comprising human FGF21 in which a
naturally occurring (i.e., wild-type) FGF21 amino acid sequence has
been modified, e.g., in which at least one amino acid of the
wild-type protein has been substituted by another amino acid,
and/or removed. Additionally, the variants may include N- and/or
C-terminal truncations relative to the wild-type FGF21 protein.
Generally speaking, a variant possesses some modified property,
structural or functional, of the wild-type protein. For example,
the variant may have enhanced or improved physical stability in
concentrated solutions (e.g., less hydrophobic mediated
aggregation), enhanced or improved plasma stability when incubated
with blood plasma or enhanced or improved bioactivity while
maintaining a favorable bioactivity profile.
[0032] Acceptable amino acid substitutions and modifications which
constitute differences between the FGF21 polypeptide and protein
variants of the invention and wild-type FGF21 include, but are not
limited to, one or more amino acid substitutions, including
substitutions with non-naturally occurring amino acid analogs, and
truncations. Thus, FGF21 protein variants include, but are not
limited to, site-directed FGF21 mutants, truncated FGF21
polypeptides, proteolysis-resistant FGF21 mutants,
aggregation-reducing FGF21 mutants, FGF21 combination mutants, and
FGF21 fusion proteins, as described herein.
[0033] The variant may possess increased compatibility with
pharmaceutical preservatives (e.g., m-cresol, phenol, benzyl
alcohol), thus enabling the preparation of a preserved
pharmaceutical formulation that maintains the physiochemical
properties and biological activity of the protein during storage.
Accordingly, variants with enhanced pharmaceutical stability
relative to wild-type FGF21, have improved physical stability in
concentrated solutions under both physiological and preserved
pharmaceutical formulation conditions, while maintaining biological
potency. By way of non-limiting example, the variants of the
invention may be more resistant to proteolysis and enzymatic
degradation; may have improved stability; and may be less likely to
aggregate, than their wild-type counterparts. As used herein, these
terms are not mutually exclusive or limiting, it being entirely
possible that a given variant has one or more modified properties
of the wild-type protein.
[0034] The invention also encompasses a nucleic acid molecule
encoding an FGF21 polypeptide or protein variant, or variant,
comprising an amino acid sequence that is at least about 95%
(alternately 96%, alternately 97%, alternately 98%, alternately
99%) identical to the amino acid sequence of SEQ ID NO:3, but
wherein specific residues conferring a desirable property to the
FGF21 protein variant, e.g., proteolysis-resistance, increased half
life or aggregation-reducing properties and combinations thereof
have not been further modified. In other words, with the exception
of residues in the FGF21 mutant sequence that have been modified in
order to confer proteolysis-resistance, aggregation-reducing, or
other properties, about 5% (alternately 4%, alternately 3%,
alternately 2%, alternately 1%) of all other amino acid residues in
the FGF21 mutant sequence can be modified. Such FGF21 mutants
possess at least one activity of the wild-type FGF21
polypeptide.
[0035] The invention also encompasses a nucleic acid molecule
comprising a nucleotide sequence that is at least about 95%
(alternately 96%, alternately 97%, alternately 98%, alternately
99%) identical to the nucleotide sequence of SEQ ID NO:47, but
wherein the nucleotides encoding amino acid residues conferring the
encoded FGF21 protein variant's proteolysis-resistance,
aggregation-reducing or other properties have not been further
modified. In other words, with the exception of nucleotides that
encode residues in the FGF21 mutant sequence that have been
modified in order to confer proteolysis-resistance,
aggregation-reducing, or other properties, about 5% (alternately
4%, alternately 3%, alternately 2%, alternately 1%) of all other
nucleotides in the FGF21 mutant sequence can be modified. Such
nucleic acid molecules encode FGF21 mutant polypeptides possessing
at least one activity of the wild-type FGF21 polypeptide.
[0036] Provided herein are methods used to generate the FGF21
polypeptides and protein variants of the invention, wherein such
methods involve site-specific modification of the wild-type FGF21
protein, via e.g., truncations of the wild-type FGF21 protein, and
the site-specific incorporation of amino acids at positions of
interest within the wild-type FGF21 protein. Said modifications
enhance the biological properties of the variants of the invention
relative to the wild-type FGF21 protein, as well as, in some cases,
serving as points of attachment for, e.g., labels and protein
half-life extension agents, and for purposes of affixing said
variants to the surface of a solid support. Related embodiments of
the invention are methods of producing cells capable of producing
said polypeptide and protein variants, and of producing vectors
containing DNA encoding said variants.
[0037] In certain embodiments, such site-specific modifications are
used to attach poly(ethylene glycol)(PEG) to proteins,
polypeptides, and/or peptides. In other embodiments, such
site-specific modifications are used to attach PEG-cholesterol
conjugates (including micelles and liposomes) to proteins,
polypeptides, and/or peptides. In other embodiments, such
site-specific modifications are used to attach sugars (glycosylate)
to proteins, polypeptides, and/or peptides.
[0038] In other embodiments, such site-specific modifications are
used as means of attachment for the production of FGF21 wild-type
and/or variant multimers, e.g., dimers (homodimers or heterodimers)
or trimers. These multimeric FGF21 molecules may additionally have
groups such as PEG, sugars, and/or PEG-cholesterol conjugates
attached or be fused either amino-terminally or carboxy-terminally
to other proteins such as Fc, HSA etc.
[0039] In other embodiments, such site-specific modifications are
used to produce proteins, polypeptides and/or peptides wherein the
position of the site-specifically incorporated pyrrolysine or
pyrrolysine analogue allows for controlled orientation and
attachment of such proteins, polypeptides and/or peptides onto a
surface of a solid support or to have groups such as PEG, sugars
and/or PEG-cholesterol conjugates attached.
[0040] In other embodiments, such site-specific modifications are
used to site-specifically cross-link proteins, polypeptides and/or
peptides thereby forming hetero-oligomers including, but not
limited to, heterodimers and heterotrimers. In other embodiments,
such site-specific modifications are used to site-specifically
cross-link proteins, polypeptides and/or peptides thereby forming
protein-protein conjugates, protein-polypeptide conjugates,
protein-peptide conjugates, polypeptide-polypeptide conjugates,
polypeptide-peptide conjugates or peptide-peptide conjugates.
DEFINITIONS
[0041] Various definitions are used throughout this document. Most
words have the meaning that would be attributed to those words by
one skilled in the art. Words specifically defined either below or
elsewhere in this document have the meaning provided in the context
of the present invention as a whole and as are typically understood
by those skilled in the art.
[0042] As used herein, the term "FGF21" refers to a member of the
fibroblast growth factor (FGF) protein family. An amino acid
sequence of FGF21 (GenBank Accession No. NP.sub.--061986.1) is set
forth as SEQ ID NO:1, the corresponding polynucleotide sequence of
which is set forth as SEQ ID NO:2 (NCBI reference sequence number
NM.sub.--019113.2).
[0043] As used herein, the term "FGF21 receptor" refers to a
receptor for FGF21 (Kharitonenkov, A, et al. (2008) Journal of
Cellular Physiology 215:1-7; Kurosu, H, et al. (2007) JBC
282:26687-26695; Ogawa, Y, et al. (2007) PNAS 104:7432-7437).
[0044] The term "FGF21 polypeptide" refers to a naturally-occurring
polypeptide expressed in humans. For purposes of this disclosure,
the term "FGF21 polypeptide" can be used interchangeably to refer
to any full-length FGF21 polypeptide, e.g., SEQ ID NO:1, which
consists of 209 amino acid residues and which is encoded by the
nucleotide sequence of SEQ ID NO:2; any mature form of the
polypeptide, which consists of 181 amino acid residues, and in
which the 28 amino acid residues at the amino-terminal end of the
full-length FGF21 polypeptide (i.e., which constitute the signal
peptide) have been removed, and variants thereof.
[0045] The term "isolated nucleic acid molecule" refers to a
nucleic acid molecule of the present invention that (1) has been
separated from at least about 50 percent of proteins, lipids,
carbohydrates, or other materials with which it is naturally found
when total nucleic acid is isolated from the source cells, (2) is
not linked to all or a portion of a polynucleotide to which the
"isolated nucleic acid molecule" is linked in nature, (3) is
operably linked to a polynucleotide which it is not linked to in
nature, or (4) does not occur in nature as part of a larger
polynucleotide sequence. Preferably, the isolated nucleic acid
molecule of the present invention is substantially free from any
other contaminating nucleic acid molecules or other contaminants
that are found in its natural environment that would interfere with
its use in polypeptide production or its therapeutic, diagnostic,
prophylactic or research use.
[0046] The term "vector" is used to refer to any molecule (e.g.,
nucleic acid, plasmid, or virus) used to transfer coding
information to a host cell.
[0047] The term "expression vector" refers to a vector that is
suitable for transformation of a host cell and contains nucleic
acid sequences that direct and/or control the expression of
inserted heterologous nucleic acid sequences. Expression includes,
but is not limited to, processes such as transcription,
translation, and RNA splicing, if introns are present.
[0048] The term "operably linked" is used herein to refer to an
arrangement of flanking sequences wherein the flanking sequences so
described are configured or assembled so as to perform their usual
function. Thus, a flanking sequence operably linked to a coding
sequence may be capable of effecting the replication, transcription
and/or translation of the coding sequence. For example, a coding
sequence is operably linked to a promoter when the promoter is
capable of directing transcription of that coding sequence. A
flanking sequence need not be contiguous with the coding sequence,
so long as it functions correctly. Thus, for example, intervening
untranslated yet transcribed sequences can be present between a
promoter sequence and the coding sequence and the promoter sequence
can still be considered "operably linked" to the coding
sequence.
[0049] The term "host cell" is used to refer to a cell which has
been transformed, or is capable of being transformed with a nucleic
acid sequence and then of expressing a selected gene of interest.
The term includes the progeny of the parent cell, whether or not
the progeny is identical in morphology or in genetic make-up to the
original parent, so long as the selected gene is present.
[0050] The term "amino acid," as used herein, refers to naturally
occurring amino acids, unnatural amino acids, amino acid analogues
and amino acid mimetics that function in a manner similar to the
naturally occurring amino acids, all in their D and L stereoisomers
if their structure allows such stereoisomeric forms. Amino acids
are referred to herein by either their name, their commonly known
three letter symbols or by the one-letter symbols recommended by
the IUPAC-IUB Biochemical Nomenclature Commission.
[0051] The term "naturally occurring" when used in connection with
biological materials such as nucleic acid molecules, polypeptides,
host cells, and the like, refers to materials which are found in
nature and are not manipulated by man. Similarly, "non-naturally
occurring" as used herein refers to a material that is not found in
nature or that has been structurally modified or synthesized by
man. When used in connection with nucleotides, the term "naturally
occurring" refers to the bases adenine (A), cytosine (C), guanine
(G), thymine (T), and uracil (U). When used in connection with
amino acids, the term "naturally occurring" refers to the 20
conventional amino acids (i.e., alanine (A), cysteine (C), aspartic
acid (D), glutamic acid (E), phenylalanine (F), glycine (G),
histidine (H), isoleucine (I), lysine (K), leucine (L), methionine
(M), asparagine (N), proline (P), glutamine (Q), arginine (R),
serine (S), threonine (T), valine (V), tryptophan (W), and tyrosine
(Y)), as well as selenocysteine, pyrrolysine (PYL), and
pyrroline-carboxy-lysine (PCL).
[0052] Pyrrolysine (PYL) is an amino acid naturally found within
methylamine methyltransferases of methanogenic archaea of the
family Methanosarcina. Pyrrolysine is a lysine analogue
co-translationally incorporated at in-frame UAG codons in the
respective mRNA, and it is considered the 22nd natural amino
acid.
[0053] As described at least in PCT patent publication WO2010/48582
(applicant IRM, LLC), attempts to biosynthesize pyrrolysine (PYL)
in E. coli resulted in the formation of a "demethylated
pyrrolysine," referred to herein as pyrroline-carboxy-lysine, or
PCL. "PCL," as used herein, refers to either PCL-A or PCL-B.
[0054] The terms "non-natural amino acid" and "unnatural amino
acid," as used herein, are interchangeably intended to represent
amino acid structures that cannot be generated biosynthetically in
any organism using unmodified or modified genes from any organism,
whether the same or different. The terms refer to an amino acid
residue that is not present in the naturally occurring (wild-type)
FGF21 protein sequence or the sequences of the FGF21 variants of
the present invention. These include, but are not limited to,
modified amino acids and/or amino acid analogues that are not one
of the 20 naturally occurring amino acids, selenocysteine,
pyrrolysine (PYL), or pyrroline-carboxy-lysine (PCL). Such
non-natural amino acid residues can be introduced by substitution
of naturally occurring amino acids, and/or by insertion of
non-natural amino acids into the naturally occurring (wild-type)
FGF21 protein sequence or the sequences of the FGF21 variants of
the invention. The non-natural amino acid residue also can be
incorporated such that a desired functionality is imparted to the
FGF21 molecule, for example, the ability to link a functional
moiety (e.g., PEG).
[0055] In addition, it is understood that such "unnatural amino
acids" require a modified tRNA and a modified tRNA synthetase (RS)
for incorporation into a protein. These "selected" orthogonal
tRNA/RS pairs are generated by a selection process as developed by
Schultz et al. or by random or targeted mutation. As way of
example, pyrroline-carboxy-lysine is a "natural amino acid" as it
is generated biosynthetically by genes transferred from one
organism into the host cells and as it is incorporated into
proteins by using natural tRNA and tRNA synthetase genes, while
p-aminophenylalanine (See, Generation of a bacterium with a 21
amino acid genetic code, Mehl R A, Anderson J C, Santoro S W, Wang
L, Martin A B, King D S, Horn D M, Schultz P G. J Am Chem Soc. 2003
Jan. 29; 125(4):935-9) is an "unnatural amino acid" because,
although generated biosynthetically, it is incorporated into
proteins by a "selected" orthogonal tRNA/tRNA synthetase pair.
[0056] Modified encoded amino acids include, but are not limited
to, hydroxyproline, .gamma.-carboxyglutamate, 0-phosphoserine,
azetidinecarboxylic acid, 2-aminoadipic acid, 3-aminoadipic acid,
beta-alanine, aminopropionic acid, 2-aminobutyric acid,
4-aminobutyric acid, 6-aminocaproic acid, 2-aminoheptanoic acid,
2-aminoisobutyric acid, 3-aminoisobutyric acid, 2-aminopimelic
acid, tertiary-butylglycine, 2,4-diaminoisobutyric acid, desmosine,
2,2'-diaminopimelic acid, 2,3-diaminoproprionic acid,
N-ethylglycine, N-methylglycine, N-ethylasparagine, homoproline,
hydroxylysine, allo-hydroxylysine, 3-hydroxyproline,
4-hydroxyproline, isodesmosine, allo-isoleucine, N-methylalanine,
N-methylglycine, N-methylisoleucine, N-methylpentylglycine,
N-methylvaline, naphthalanine, norvaline, norleucine, ornithine,
pentylglycine, pipecolic acid and thioproline. The term "amino
acid" also includes naturally occurring amino acids that are
metabolites in certain organisms but are not encoded by the genetic
code for incorporation into proteins. Such amino acids include, but
are not limited to, ornithine, D-ornithine, and D-arginine.
[0057] The term "amino acid analogue," as used herein, refers to
compounds that have the same basic chemical structure as a
naturally occurring amino acid, by way of example only, an
.alpha.-carbon that is bound to a hydrogen, a carboxyl group, an
amino group, and an R group Amino acid analogues include the
natural and unnatural amino acids which are chemically blocked,
reversibly or irreversibly, or their C-terminal carboxy group,
their N-terminal amino group and/or their side-chain functional
groups are chemically modified. Such analogues include, but are not
limited to, methionine sulfoxide, methionine sulfone,
S-(carboxymethyl)-cysteine, 5-(carboxymethyl)-cysteine sulfoxide,
S-(carboxymethyl)-cysteine sulfone, aspartic acid-(beta-methyl
ester), N-ethylglycine, alanine carboxamide, homoserine,
norleucine, and methionine methyl sulfonium.
[0058] The term "amino acid mimetics," as used herein, refers to
chemical compounds that have a structure that is different from the
general chemical structure of an amino acid, but functions in a
manner similar to a naturally occurring amino acid.
[0059] The term "biologically active FGF21 variant" refers to any
FGF21 polypeptide variant described herein that possesses an
activity of the wild-type FGF21 polypeptide, such as the ability to
lower blood glucose, insulin, triglyceride, or cholesterol; reduce
body weight; and to improve glucose tolerance, energy expenditure,
or insulin sensitivity, regardless of the type or number of
modifications that have been introduced into the FGF21 polypeptide
variant. FGF21 polypeptide variants possessing a somewhat decreased
level of FGF21 activity relative to the wild-type FGF21 polypeptide
can nonetheless be considered to be biologically active FGF21
polypeptide variants.
[0060] The terms "effective amount" and "therapeutically effective
amount" each refer to the amount of an FGF21 protein variant used
to support an observable level of one or more biological activities
of the wild-type FGF21 polypeptide, such as the ability to lower
blood glucose, insulin, triglyceride or cholesterol levels; reduce
liver triglyceride or lipid levels; reduce body weight; or improve
glucose tolerance, energy expenditure, or insulin sensitivity. For
example, a "therapeutically-effective amount" administered to a
patient exhibiting, suffering, or prone to suffer from
FGF21-associated disorders (such as type 1 or type 2 diabetes
mellitus, obesity, or metabolic syndrome), is such an amount which
induces, ameliorates or otherwise causes an improvement in the
pathological symptoms, disease progression, physiological
conditions associated with or resistance to succumbing to the afore
mentioned disorders. For the purposes of the present invention a
"subject" or "patient" is preferably a human, but can also be an
animal, more specifically, a companion animal (e.g., dogs, cats,
and the like), farm animals (e.g., cows, sheep, pigs, horses, and
the like) and laboratory animals (e.g., rats, mice, guinea pigs,
and the like).
[0061] The term "pharmaceutically acceptable carrier" or
"physiologically acceptable carrier" as used herein refers to one
or more formulation materials suitable for accomplishing or
enhancing the delivery of an FGF21 protein variant.
[0062] The term "antigen" refers to a molecule or a portion of a
molecule that is capable of being bound by an antibody, and
additionally that is capable of being used in an animal to produce
antibodies that are capable of binding to an epitope of that
antigen. An antigen may have one or more epitopes.
[0063] The term "native Fc" refers to molecule or sequence
comprising the sequence of a non-antigen-binding fragment resulting
from digestion of whole antibody or produced by other means,
whether in monomeric or multimeric form, and can contain the hinge
region. The original immunoglobulin source of the native Fc is
preferably of human origin and can be any of the immunoglobulins,
although IgG1 and IgG2 are preferred. Native Fc molecules are made
up of monomeric polypeptides that can be linked into dimeric or
multimeric forms by covalent (i.e., disulfide bonds) and
non-covalent association. The number of intermolecular disulfide
bonds between monomeric subunits of native Fc molecules ranges from
1 to 4 depending on class (e.g., IgG, IgA, and IgE) or subclass
(e.g., IgG1, IgG2, IgG3, IgA1, and IgGA2). One example of a native
Fc is a disulfide-bonded dimer resulting from papain digestion of
an IgG (see Ellison et al., 1982, Nucleic Acids Res. 10: 4071-9).
The term "native Fc" as used herein is generic to the monomeric,
dimeric, and multimeric forms. The term "Fc variant" refers to a
molecule or sequence that is modified from a native Fc but still
comprises a binding site for the salvage receptor, FcRn (neonatal
Fc receptor). International Publication Nos. WO 97/34631 and WO
96/32478 describe exemplary Fc variants, as well as interaction
with the salvage receptor, and are hereby incorporated by
reference. Thus, the term "Fc variant" can comprise a molecule or
sequence that is humanized from a non-human native Fc. Furthermore,
a native Fc comprises regions that can be removed because they
provide structural features or biological activity that are not
required for the fusion molecules of the FGF21 mutants of the
present invention. Thus, the term "Fc variant" comprises a molecule
or sequence that lacks one or more native Fc sites or residues, or
in which one or more Fc sites or residues has be modified, that
affect or are involved in: (1) disulfide bond formation, (2)
incompatibility with a selected host cell, (3) N-terminal
heterogeneity upon expression in a selected host cell, (4)
glycosylation, (5) interaction with complement, (6) binding to an
Fc receptor other than a salvage receptor, or (7)
antibody-dependent cellular cytotoxicity (ADCC). Fc variants are
described in further detail hereinafter.
[0064] The term "Fc domain" encompasses native Fc and Fc variants
and sequences as defined above. As with Fc variants and native Fc
molecules, the term "Fc domain" includes molecules in monomeric or
multimeric form, whether digested from whole antibody or produced
by other means. In some embodiments of the present invention, an Fc
domain can be fused to FGF21 or a FGF21 mutant (including a
truncated form of FGF21 or a FGF21 mutant) via, for example, a
covalent bond between the Fc domain and the FGF21 sequence. Such
fusion proteins can form multimers via the association of the Fc
domains and both these fusion proteins and their multimers are an
aspect of the present invention.
[0065] The term "polyethylene glycol" or "PEG" refers to a
polyalkylene glycol compound or a derivative thereof, with or
without coupling agents or derviatization with coupling or
activating moieties.
[0066] The term "FGF21-associated disorders," and terms similarly
used herein, includes but is not limited to obesity, type 1 and
type 2 diabetes mellitus, pancreatitis, dyslipidemia, nonalcoholic
steatohepatitis (NASH), insulin resistance, hyperinsulinemia,
glucose intolerance, hyperglycemia, metabolic syndrome,
hypertension, cardiovascular disease, atherosclerosis, peripheral
arterial disease, stroke, heart failure, coronary heart disease,
kidney disease, diabetic complications, neuropathy, gastroparesis
and other metabolic disorders.
[0067] "Type 2 diabetes mellitus" is a condition characterized by
excess glucose production in spite of the availability of insulin,
and circulating glucose levels remain excessively high as a result
of inadequate glucose clearance.
[0068] "Type 1 diabetes mellitus" is a condition characterized by
high blood glucose levels caused by total lack of insulin. This
occurs when the body's immune system attacks the insulin-producing
beta cells in the pancreas and destroys them. The pancreas then
produces little or no insulin.
[0069] "Pancreatitis" is inflammation of the pancreas.
[0070] "Dyslipidemia" is a disorder of lipoprotein metabolism,
including lipoprotein overproduction or deficiency. Dyslipidemias
may be manifested by elevation of the total cholesterol,
low-density lipoprotein (LDL) cholesterol and triglyceride
concentrations, and a decrease in high-density lipoprotein (HDL)
cholesterol concentration in the blood.
[0071] "Nonalcoholic steatohepatitis (NASH)" is a liver disease,
not associated with alcohol consumption, characterized by fatty
change of hepatocytes, accompanied by intralobular inflammation and
fibrosis.
[0072] "Glucose intolerance," or Impaired Glucose Tolerance (IGT)
is a pre-diabetic state of dysglycemia that is associated with
increased risk of cardiovascular pathology. The pre-diabetic
condition prevents a subject from moving glucose into cells
efficiently and utilizing it as an efficient fuel source, leading
to elevated glucose levels in blood and some degree of insulin
resistance.
[0073] "Hyperglycemia" is defined as an excess of sugar (glucose)
in the blood.
[0074] "Hypoglycemia", also called low blood sugar, occurs when
your blood glucose level drops too low to provide enough energy for
your body's activities.
[0075] "Hyperinsulinemia" is defined as a higher-than-normal level
of insulin in the blood.
[0076] "Insulin resistance" is defined as a state in which a normal
amount of insulin produces a subnormal biologic response.
[0077] "Obesity," in terms of the human subject, can be defined as
that body weight over 20 percent above the ideal body weight for a
given population (R. H. Williams, Textbook of Endocrinology, 1974,
p. 904-916).
[0078] "Metabolic syndrome" can be defined as a cluster of at least
three of the following signs: abdominal fat--in most men, a 40-inch
waist or greater; high blood sugar--at least 110 milligrams per
deciliter (mg/dl) after fasting; high triglycerides--at least 150
mg/dL in the bloodstream; low HDL--less than 40 mg/dl; and, blood
pressure of 130/85 mmHg or higher.
[0079] "Hypertension" or high blood pressure that is a transitory
or sustained elevation of systemic arterial blood pressure to a
level likely to induce cardiovascular damage or other adverse
consequences. Hypertension has been arbitrarily defined as a
systolic blood pressure above 140 mmHg or a diastolic blood
pressure above 90 mmHg.
[0080] "Cardiovascular diseases" are diseases related to the heart
or blood vessels.
[0081] "Peripheral arterial disease" occurs when plaque builds up
in the arteries that carry blood to the head, organs and limbs.
Over time, plaque can harden and narrow the arteries which limits
the flow of oxygen-rich blood to organs and other parts of the the
body.
[0082] "Atherosclerosis" is a vascular disease characterized by
irregularly distributed lipid deposits in the intima of large and
medium-sized arteries, causing narrowing of arterial lumens and
proceeding eventually to fibrosis and calcification. Lesions are
usually focal and progress slowly and intermittently. Limitation of
blood flow accounts for most clinical manifestations, which vary
with the distribution and severity of lesions.
[0083] "Stroke" is any acute clinical event, related to impairment
of cerebral circulation, that lasts longer than 24 hours. A stroke
involves irreversible brain damage, the type and severity of
symptoms depending on the location and extent of brain tissue whose
circulation has been compromised.
[0084] "Heart failure", also called congestive heart failure, is a
condition in which the heart can no longer pump enough blood to the
rest of the body.
[0085] "Coronary heart disease", also called coronary artery
disease, is a narrowing of the small blood vessels that supply
blood and oxygen to the heart.
[0086] "Kidney disease" or nephropathy is any disease of the
kidney. Diabetic nephropathy is a major cause of morbidity and
mortality in people with type 1 or type 2 diabetes mellitus.
[0087] "Diabetic complications" are problems, caused by high blood
glucose levels, with other body functions such as kidneys, nerves
(neuropathies), feet (foot ulcers and poor circulation) and eyes
(e.g. retinopathies). Diabetes also increases the risk for heart
disease and bone and joint disorders. Other long-term complications
of diabetes include skin problems, digestive problems, sexual
dysfuntion and problems with teeth and gums.
[0088] "Neuroapathies" are any diseases involving the cranial
nerves or the peripheral or autonomic nervous system.
[0089] "Gastroparesis" is weakness of gastric peristalsis, which
results in delayed emptying of the bowels.
[0090] The critically ill patients encompassed by the present
invention generally experience an unstable hypermetabolic state.
This unstable metabolic state is due to changes in substrate
metabolism, which may lead to relative deficiencies in some
nutrients. Generally there is an increased oxidation of both fat
and muscle.
[0091] Moreover, critically ill patients are preferably patients
that experience systemic inflammatory response syndrome or
respiratory distress. A reduction in morbidity means reducing the
likelihood that a critically ill patient will develop additional
illnesses, conditions, or symptoms or reducing the severity of
additional illnesses, conditions, or symptoms. For example reducing
morbidity may correspond to a decrease in the incidence of
bacteremia or sepsis or complications associated with multiple
organ failure.
[0092] As used herein, the singular forms "a," "an" and "the"
include plural references unless the content clearly dictates
otherwise. Thus, for example, reference to "an antibody" includes a
mixture of two or more such antibodies.
[0093] As used herein, the term "about" refers to +/-20%, +/-10%,
or +/-5% of a value.
[0094] The terms "polypeptide" and "protein", are used
interchangeably and refer to a polymeric form of amino acids of any
length, which can include coded and non-coded amino acids,
chemically or biochemically modified or derivatized amino acids,
and polypeptides having modified peptide backbones. The term
includes fusion proteins, including, but not limited to, fusion
proteins with a heterologous amino acid sequence, fusions with
heterologous and homologous leader sequences, with or without
N-terminal methionine residues; immunologically tagged proteins;
and the like.
[0095] The terms "individual", "subject", "host" and "patient" are
used interchangeably and refer to any subject for whom diagnosis,
treatment, or therapy is desired, particularly humans. Other
subjects may include cattle, dogs, cats, guinea pigs, rabbits,
rats, mice, horses, and the like. In some preferred embodiments the
subject is a human.
[0096] As used herein, the term "sample" refers to biological
material from a patient. The sample assayed by the present
invention is not limited to any particular type. Samples include,
as non-limiting examples, single cells, multiple cells, tissues,
tumors, biological fluids, biological molecules, or supernatants or
extracts of any of the foregoing. Examples include tissue removed
for biopsy, tissue removed during resection, blood, urine, lymph
tissue, lymph fluid, cerebrospinal fluid, mucous, and stool
samples. The sample used will vary based on the assay format, the
detection method and the nature of the tumors, tissues, cells or
extracts to be assayed. Methods for preparing samples are well
known in the art and can be readily adapted in order to obtain a
sample that is compatible with the method utilized.
[0097] As used herein, the term "biological molecule" includes, but
is not limited to, polypeptides, nucleic acids, and
saccharides.
[0098] As used herein, the term "modulating" refers to a change in
the quality or quantity of a gene, protein, or any molecule that is
inside, outside, or on the surface of a cell. The change can be an
increase or decrease in expression or level of the molecule. The
term "modulates" also includes changing the quality or quantity of
a biological function/activity including, without limitation, the
ability to lower blood glucose, insulin, triglyceride, or
cholesterol levels; to reduce liver lipid or liver triglyceride
levels; to reduce body weight; and to improve glucose tolerance,
energy expenditure, or insulin sensitivity.
[0099] As used herein, the term "modulator" refers to a composition
that modulates one or more physiological or biochemical events
associated with an FGF21-associated disorder, such as type 1 or
type 2 diabetes mellitus or a metabolic condition like obesity.
Said events include but are not limited to the ability to lower
blood glucose, insulin, triglyceride, or cholesterol levels; to
reduce liver lipid or liver triglyceride levels; to reduce body
weight; and to improve glucose tolerance, energy expenditure, or
insulin sensitivity.
[0100] A "gene product" is a biopolymeric product that is expressed
or produced by a gene. A gene product may be, for example, an
unspliced RNA, an mRNA, a splice variant mRNA, a polypeptide, a
post-translationally modified polypeptide, a splice variant
polypeptide etc. Also encompassed by this term are biopolymeric
products that are made using an RNA gene product as a template
(i.e. cDNA of the RNA). A gene product may be made enzymatically,
recombinantly, chemically, or within a cell to which the gene is
native. In some embodiments, if the gene product is proteinaceous,
it exhibits a biological activity. In some embodiments, if the gene
product is a nucleic acid, it can be translated into a
proteinaceous gene product that exhibits a biological activity.
[0101] "Modulation of FGF21 activity," as used herein, refers to an
increase or decrease in FGF21 activity that can be a result of, for
example, interaction of an agent with an FGF21 polynucleotide or
polypeptide, inhibition of FGF21 transcription and/or translation
(e.g., through antisense or siRNA interaction with the FGF21 gene
or FGF21 transcript, through modulation of transcription factors
that facilitate FGF21 expression), and the like. For example,
modulation of a biological activity refers to an increase or a
decrease in a biological activity. FGF21 activity can be assessed
by means including, without limitation, assaying blood glucose,
insulin, triglyceride, or cholesterol levels in a subject,
assessing FGF21 polypeptide levels, or by assessing FGF21
transcription levels. Comparisons of FGF21 activity can also be
accomplished by, e.g., measuring levels of an FGF21 downstream
biomarker, and measuring increases in FGF21 signaling. FGF21
activity can also be assessed by measuring: cell signaling; kinase
activity; glucose uptake into adipocytes; blood insulin,
triglyceride, or cholesterol level fluctuations; liver lipid or
liver triglyceride level changes; interactions between FGF21 and an
FGF21 receptor; or phosphorylation of an FGF21 receptor. In some
embodiments phosphorylation of an FGF21 receptor can be tyrosine
phosphorylation. In some embodiments modulation of FGF21 activity
can cause modulation of an FGF21-related phenotype.
[0102] A "FGF21 downstream biomarker," as used herein, is a gene or
gene product, or measurable indicia of a gene or gene product. In
some embodiments, a gene or activity that is a downstream marker of
FGF21 exhibits an altered level of expression, or in a vascular
tissue. In some embodiments, an activity of the downstream marker
is altered in the presence of an FGF21 modulator. In some
embodiments, the downstream markers exhibit altered levels of
expression when FGF21 is perturbed with an FGF21 modulator of the
present invention. FGF21 downstream markers include, without
limitation, glucose or 2-deoxy-glucose uptake, pERK and other
phosphorylated or acetylated proteins or NAD levels.
[0103] As used herein, the term "up-regulates" refers to an
increase, activation or stimulation of an activity or quantity. For
example, in the context of the present invention, FGF21 modulators
may increase the activity of an FGF21 receptor. In one embodiment,
one or both of FGFR-1c or FGFR-4 may be upregulated in response to
an FGF21 modulator. Upregulation can also refer to an FGF21-related
activity, such as e.g., the ability to lower blood glucose,
insulin, triglyceride, or cholesterol levels; to reduce liver lipid
or triglyceride levels; to reduce body weight; to improve glucose
tolerance, energy expenditure, or insulin sensitivity; or to cause
phosphorylation of an FGF21 receptor; or to increase an FGF21
downstream marker. The FGFR21 receptor can be one or both of
FGFR-1c or FGFR-4. Up-regulation may be at least 25%, at least 50%,
at least 75%, at least 100%, at least 150%, at least 200%, at least
250%, at least 400%, or at least 500% as compared to a control.
[0104] As used herein, the term "N-terminus" refers to at least the
first 10 amino acids of a protein.
[0105] As used herein, the terms "N-terminal domain" and
"N-terminal region" are used interchangeably and refer to a
fragment of a protein that begins at the first amino acid of the
protein and ends at any amino acid in the N-terminal half of the
protein. For example, the N-terminal domain of FGF21 is from amino
acid 1 of SEQ ID NO:1 to any amino acid between about amino acids
10 and 105 of SEQ ID NO:1.
[0106] As used herein, the term "C-terminus" refers to at least the
last 10 amino acids of a protein.
[0107] As used herein, the terms "C-terminal domain" and
"C-terminal region" are used interchangeably and refer to a
fragment of a protein that begins at any amino acid in the
C-terminal half of the protein and ends at the last amino acid of
the protein. For example, the C-terminal domain of FGF21 begins at
any amino acid from amino acid 105 to about amino acid 200 of SEQ
ID NO:1 and ends at amino acid 209 of SEQ ID NO:1.
[0108] The term "domain" as used herein refers to a structural part
of a biomolecule that contributes to a known or suspected function
of the biomolecule. Domains may be co-extensive with regions or
portions thereof and may also incorporate a portion of a
biomolecule that is distinct from a particular region, in addition
to all or part of that region.
[0109] As used herein, the term "signal domain" (also called
"signal sequence" or "signal peptide") refers to a peptide domain
that resides in a continuous stretch of amino acid sequence at the
N-terminal region of a precursor protein (often a membrane-bound or
secreted protein) and is involved in post-translational protein
transport. In many cases the signal domain is removed from the
full-length protein by specialized signal peptidases after the
sorting process has been completed. Each signal domain specifies a
particular destination in the cell for the precursor protein. The
signal domain of FGF21 is amino acids 1-28 of SEQ ID NO:1.
[0110] As used herein, the term "receptor binding domain" refers to
any portion or region of a protein that contacts a membrane-bound
receptor protein, resulting in a cellular response, such as a
signaling event.
[0111] As used herein, the term "ligand binding domain" refers to
any portion or region of a protein retaining at least one
qualitative binding activity of a corresponding native sequence of
FGF21.
[0112] The term "region" refers to a physically contiguous portion
of the primary structure of a biomolecule. In the case of proteins,
a region is defined by a contiguous portion of the amino acid
sequence of that protein. In some embodiments a "region" is
associated with a function of the biomolecule.
[0113] The term "fragment" as used herein refers to a physically
contiguous portion of the primary structure of a biomolecule. In
the case of proteins, a portion is defined by a contiguous portion
of the amino acid sequence of that protein and refers to at least
3-5 amino acids, at least 8-10 amino acids, at least 11-15 amino
acids, at least 17-24 amino acids, at least 25-30 amino acids, and
at least 30-45 amino acids. In the case of oligonucleotides, a
portion is defined by a contiguous portion of the nucleic acid
sequence of that oligonucleotide and refers to at least 9-15
nucleotides, at least 18-30 nucleotides, at least 33-45
nucleotides, at least 48-72 nucleotides, at least 75-90
nucleotides, and at least 90-130 nucleotides. In some embodiments,
portions of biomolecules have a biological activity. In the context
of the present invention, FGF21 polypeptide fragments do not
comprise the entire FGF21 polypeptide sequence set forth in SEQ ID
NO:1.
[0114] A "native sequence" polypeptide is one that has the same
amino acid sequence as a polypeptide derived from nature. Such
native sequence polypeptides can be isolated from nature or can be
produced by recombinant or synthetic means. Thus, a native sequence
polypeptide can have the amino acid sequence of naturally occurring
human polypeptide, murine polypeptide, or polypeptide from any
other mammalian species.
[0115] As used herein, the phrase "homologous nucleotide sequence,"
or "homologous amino acid sequence," or variations thereof, refers
to sequences characterized by a homology, at the nucleotide level
or amino acid level, of at least a specified percentage and is used
interchangeably with "sequence identity". Homologous nucleotide
sequences include those sequences coding for isoforms of proteins.
Such isoforms can be expressed in different tissues of the same
organism as a result of, for example, alternative splicing of RNA.
Alternatively, isoforms can be encoded by different genes.
Homologous nucleotide sequences include nucleotide sequences
encoding for a protein of a species other than humans, including,
but not limited to, mammals. Homologous nucleotide sequences also
include, but are not limited to, naturally occurring allelic
variations and mutations of the nucleotide sequences set forth
herein. Homologous amino acid sequences include those amino acid
sequences which contain conservative amino acid substitutions and
which polypeptides have the same binding and/or activity. In some
embodiments, a nucleotide or amino acid sequence is homologous if
it has at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%
identity. In some embodiments, a nucleotide or amino acid sequence
is homologous if it has 1-10, 10-20, 20-30, 30-40, 40-50, or 50-60
nucleotide/amino acid substitutions, additions, or deletions. In
some embodiments, the homologous amino acid sequences have no more
than 5 or no more than 3 conservative amino acid substitutes.
[0116] Percent homology or identity can be determined by, for
example, the Gap program (Wisconsin Sequence Analysis Package,
Version 8 for UNIX, Genetics Computer Group, University Research
Park, Madison Wis.), using default settings, which uses the
algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2,
482-489). In some embodiments, homology between the probe and
target is between about 75% to about 85%. In some embodiments,
nucleic acids have nucleotides that are at least about 95%, about
97%, about 98%, about 99% and about 100% homologous to SEQ ID NO:2,
or a portion thereof.
[0117] Homology may also be at the polypeptide level. In some
embodiments, polypeptides are about 95%, about 97%, about 98%,
about 99% and about 100% homologous to SEQ ID NO:1, or a portion
thereof. The degree or percentage identity of an FGF21 variant of
the present invention ("invention sequence" e.g. Variant 1 or SEQ
ID NO:5) and a different amino acid sequence ("foreign sequence"
e.g. SEQ ID NO:1 with L174 changed to P174) is calculated as the
number of exact matches in an alignment of the two sequences
divided by the length of the "invention sequence" or the "foreign
sequence", whichever is shortest. The result is expressed as
percent identity. For example, Variant 1 (SEQ ID NO:5), has 94.9%
identity to wild type FGF21 with L174 changed to P174 (SEQ ID NO:1
with L174 changed to P174). For these two sequences there are 168
identical amino acids and the total length is 177 amino acids.
Thus, the percent identity is (168/177).times.100=94.9%.
[0118] As used herein, the term "mixing" refers to the process of
combining one or more compounds, cells, molecules, and the like
together in the same area. This may be performed, for example, in a
test tube, petri dish, or any container that allows the one or more
compounds, cells, or molecules, to be mixed.
[0119] As used herein, the term "substantially purified" refers to
a compound (e.g., either a polynucleotide or a polypeptide or an
antibody) that is removed from its natural environment and is at
least 60% free, at least 75% free, and at least 90% free from other
components with which it is naturally associated.
[0120] The term "pharmaceutically acceptable carrier" refers to a
carrier for administration of a therapeutic agent, such as
antibodies or a polypeptide, genes, and other therapeutic agents.
The term refers to any pharmaceutical carrier that does not itself
induce the production of antibodies harmful to the individual
receiving the composition, and which can be administered without
undue toxicity. Suitable carriers can be large, slowly metabolized
macromolecules such as proteins, polysaccharides, polylactic acids,
polyglycolic acids, polymeric amino acids, amino acid copolymers,
lipid aggregates and inactive virus particles. Such carriers are
well known to those of ordinary skill in the art. Pharmaceutically
acceptable carriers in therapeutic compositions can include liquids
such as water, saline, glycerol and ethanol. Auxiliary substances,
such as wetting or emulsifying agents, pH buffering substances, and
the like, can also be present in such vehicles.
[0121] Naturally occurring disulfide bonds, as provided by cysteine
residues, generally increase thermodynamic stability of proteins.
Successful examples of increased thermodynamic stability, as
measured in increase of the melting temperature, are multiple
disulfide-bonded mutants of the enzymes T4 lysozyme (Matsumura, et
al., PNAS 86:6562-6566 (1989)) and barnase (Johnson et al., J. Mol.
Biol. 268:198-208 (1997)). An aspect of the present invention is an
enhancement of the physical stability of FGF21 in the presence of a
preservative, achieved by the presence of disulfide bonds within
the variants, which constrain the flexibility of wild type FGF21
and thereby limit access of the preservative to the hydrophobic
core of the protein.
[0122] The second aspect of the present invention therefore
provides variants of human FGF21, or a biologically active peptide
thereof, with enhanced pharmaceutical stability engendered by the
incorporation of additional disulfide bonds, e.g., via
incorporating or substituting cysteine residues into the wild-type
FGF21 protein or the polypeptide and protein variants of the
invention. One skilled in the art will recognize that the native
cysteines, cysteine 103 and cysteine 121, could be utilized as loci
to introduce a novel disulfide bond that may impart improved
properties, in addition to the suggested embodiments describer
herein.
[0123] These include FGF-21 with the substitution of a cysteine for
two or more of the following: glutamine 46, arginine 47, tyrosine
48, leucine 49, tyrosine 50, threonine 51, aspartate 52, aspartate
53, alanine 54, glutamine 55, glutamine 56, threonine 57, glutamate
58, alanine 59, histidine 60, leucine 61, glutamate 62, isoleucine
63, valine 69, glycine 70, glycine 71, alanine 72, alanine 73,
leucine 144, histidine 145, leucine 146, proline 147, glycine 148,
asparagine 149, lysine 150, serine 151, proline 152, histidine 153,
arginine 154, aspartate 155, proline 156, alanine 157, proline 158,
arginine 159, glycine 160, proline 161, alanine 162, arginine 163.
phenylalanine 164, wherein the numbering of the amino acids is
based on the full length 209 amino acid hFGF21 sequence SEQ ID
NO:1
[0124] Furthermore, variants of human FGF21, or a biologically
active peptide thereof, are provided with engineered disulfide
bonds, in addition to the naturally occurring one at Cys103-Cys121,
are as follows: Gln46Cys-Ala59Cys, Gln46Cys-His60Cys,
Gln46Cys-Leu61Cys, Gln46Cys-Glu62Cys, Gln46Cys-Ile63Cys,
Arg47Cys-Ala59Cys, Arg47Cys-His60Cys, Arg47Cys-Leu61Cys,
Arg47Cys-Glu62Cys, Arg47Cys-Ile63Cys, Tyr48Cys-Ala59Cys,
Tyr48Cys-His60Cys, Tyr48Cys-Leu61Cys, Tyr48Cys-Glu62Cys,
Tyr48Cys-Ile63Cys, Leu49Cys-Ala59Cys, Leu49Cys-His60Cys,
Leu49Cys-Leu61Cys, Leu49Cys-Glu62Cys, Leu49Cys-Ile63Cys,
Tyr50Cys-Ala59Cys, Tyr50Cys-His60Cys, Tyr50Cys-Lue61Cys,
Tyr50Cys-Glu62Cys, Tyr50Cys-Ile63Cys, Leu144Cys-Gly160Cys,
Leu144Cys-Pro161Cys, Leu144Cys-Ala162Cys, Leu144Cys-Arg163Cys,
Leu144Cys-Phe164Cys, His145Cys-Gly160Cys, His145Cys-Pro161Cys,
His145Cys-Ala162Cys, His145Cys-Arg163Cys, His145Cys-Phe164Cys,
Leu146Cys-Gly160Cys, Leu146Cys-Pro161Cys, Leu146Cys-Ala162Cys,
Leu146Cys-Arg163Cys, Leu146Cys-Phe164Cys, Pro147Cys-Gly160Cys,
Pro147Cys-Pro161Cys, Pro147Cys-Ala162Cys, Pro147Cys-Arg163Cys,
Pro147Cys-Phe164Cys, Gly148Cys-Gly160Cys, Gly148Cys-Pro161Cys,
Gly148Cys-Ala162Cys, Gly148Cys-Arg163Cys, Gly148Cys-Phe164Cys,
Thr57Cys-Val69Cys, Thr57Cys-Gly70Cys, Thr57Cys-Gly71Cys,
Thr57Cys-Ala72Cys, Thr57Cys-Ala73Cys, Glu58Cys-Val69Cys,
Glu58Cys-Glu70Cys, Glu58Cys-G71Cys, Glu58Cys-Ala72Cys,
Glu58Cys-Ala73Cys, Ala59Cys-Val69Cys, Ala59Cys-Gly70Cys,
Ala59Cys-Gly71Cys, Ala59Cys-Ala72Cys, Ala59Cys-Ala73Cys,
His60Cys-Val69Cys, His60Cys-Gly70Cys, His60Cys-Gly71Cys,
His60Cys-Ala72Cys, His60Cys-Ala73Cys, Leu61Cys-Val69Cys,
Leu61Cys-Gly70Cys, Leu61Cys-Gly71Cys, Leu61Cys-Ala72Cys,
Leu61Cys-Ala73Cys, Arg47Cys-Gly148Cys, Tyr48Cys-Gly148Cys,
Leu49Cys-Gly148Cys, Tyr50Cys-Gly148Cys, Thr51Cys-Gly148Cys,
Asp52Cys-Gly148Cys, Asp53Cys-Gly148Cys, Ala54Cys-Gly148Cys,
Gln55Cys-Gly148Cys, Gln56Cys-Gly148Cys, Thr57Cys-Gly148Cys,
Glu58Cys-Gly148Cys, Arg47Cys-Asn149Cys, Tyr48Cys-Asn149Cys,
Leu49Cys-Asn149Cys, Tyr50Cys-Asn149Cys, Thr51Cys-Asn149Cys,
Asp52Cys-Asn149Cys, Asp53Cys-Asn149Cys, Ala54Cys-Asn149Cys,
Gln55Cys-Asn149Cys, Gln56Cys-Asn149Cys, Thr57Cys-Asn149Cys,
Glu58Cys-Asn149Cys, Arg47Cys-Lys150Cys, Tyr48Cys-Lys150Cys,
Leu49Cys-Lys150Cys, Tyr50Cys-Lys150Cys, Thr51Cys-Lys150Cys,
Asp52Cys-Lys150Cys, Asp53Cys-Lys150Cys, Ala54Cys-Lys150Cys,
Gln55Cys-Lys150Cys, Gln56Cys-Lys150Cys, Thr57Cys-Lys150Cys,
Glu58Cys-Lys150Cys, Arg47Cys-Ser151Cys, Tyr48Cys-Ser151Cys,
Leu49Cys-Ser151Cys, Tyr50Cys-Ser151Cys, Thr51Cys-Ser151Cys,
Asp52Cys-Ser151Cys, Asp53Cys-Ser151Cys, Ala54Cys-Ser151Cys,
Gln55Cys-Ser151Cys, Gln56Cys-Ser151Cys, Thr57Cys-Ser151Cys,
Glu58Cys-Ser151Cys, Arg47Cys-Pro152Cys, Tyr48Cys-Pro152Cys,
Leu49Cys-Pro152Cys, Tyr50Cys-Pro152Cys, Thr51Cys-Pro152Cys,
Asp52Cys-Pro152Cys, Asp53Cys-Pro152Cys, Ala54Cys-Pro152Cys,
Gln55Cys-Pro152Cys, Gln56Cys-Pro152Cys, Thr57Cys-Pro152Cys,
Glu58Cys-Pro152Cys, Arg47Cys-His153Cys, Tyr48Cys-His153Cys,
Leu49Cys-His153Cys, Tyr50Cys-His153Cys, Thr51Cys-His153Cys,
Asp52Cys-His153Cys, Asp53Cys-His153Cys, Ala54Cys-His153Cys,
Gln55Cys-His153Cys, Gln56Cys-His153Cys, Thr57Cys-His153Cys,
Glu58Cys-His153Cys, Arg47Cys-Arg154Cys, Tyr48Cys-Arg154Cys,
Leu49Cys-Arg154Cys, Tyr50Cys-Arg154Cys, Thr51Cys-Arg154Cys,
Asp52Cys-Arg154Cys, Asp53Cys-Arg154Cys, Ala54Cys-Arg154Cys,
Gln55Cys-Arg154Cys, Gln56Cys-Arg154Cys, Thr57Cys-Arg154Cys,
Glu58Cys-Arg154Cys, Arg47Cys-Asp155Cys, Tyr48Cys-Asp155Cys,
Leu49Cys-Asp155Cys, Tyr50Cys-Asp155Cys, Thr51Cys-Asp155Cys,
Asp52Cys-Asp155Cys, Asp53Cys-Asp155Cys, Ala54Cys-Asp155Cys,
Gln55Cys-Asp155Cys, Gln56Cys-Asp155Cys, Thr57Cys-Asp155Cys,
Glu58Cys-Asp155Cys, Arg47Cys-Pro156Cys, Tyr48Cys-Pro156Cys,
Leu49Cys-Pro156Cys, Tyr50Cys-Pro156Cys, Thr51Cys-Pro156Cys,
Asp52Cys-Pro156Cys, Asp53Cys-Pro156Cys, Ala54Cys-Pro156Cys,
Gln55Cys-Pro156Cys, Gln56Cys-Pro156Cys, Thr57Cys-Pro156Cys,
Glu58Cys-Pro156Cys, Arg47Cys-Ala157Cys, Tyr48Cys-Ala157Cys,
Leu49Cys-Ala157Cys, Tyr50Cys-Ala157Cys, Thr51Cys-Ala157Cys,
Asp52Cys-Ala157Cys, Asp53Cys-Ala157Cys, Ala54Cys-Ala157Cys,
Gln55Cys-Ala157Cys, Gln56Cys-Ala157Cys, Thr57Cys-Ala157Cys,
Glu58Cys-Ala157Cys, Arg47Cys-Pro158Cys, Tyr48Cys-Pro158Cys,
Leu49Cys-Pro158Cys, Tyr50Cys-Pro158Cys, Thr51Cys-Pro158Cys,
Asp52Cys-Pro158Cys, Asp53Cys-Pro158Cys, Ala54Cys-Pro158Cys,
Gln55Cys-Pro158Cys, Gln56Cys-Pro158Cys, Thr57Cys-Pro158Cys,
Glu58Cys-Pro158Cys, Arg47Cys-Arg159Cys, Tyr48Cys-Arg159Cys,
Leu49Cys-Arg159Cys, Tyr50Cys-Arg159Cys, Thr51Cys-Arg159Cys,
Asp52Cys-Arg159Cys, Asp53Cys-Arg159Cys, Ala54Cys-Arg159Cys,
Gln55Cys-Arg159Cys, Gln56Cys-Arg159Cys, Thr57Cys-Arg159Cys,
Glu58Cys-Arg159Cys, Arg47Cys-G160Cys, Tyr48Cys-G160Cys,
Leu49Cys-G160Cys, Tyr50Cys-Gly160Cys, Thr51Cys-Gly160Cys,
Asp52Cys-Gly160Cys, Asp53Cys-Gly160Cys, Ala54Cys-Gly160Cys,
Gln55Cys-Gly160Cys, Gln56Cys-Gly160Cys, Thr57Cys-Gly160Cys,
Glu58Cys-Gly160Cys, Arg47Cys-Pro161Cys, Tyr48Cys-Pro161Cys,
Leu49Cys-Pro161 Cys, Tyr50Cys-Pro161 Cys, Thr51Cys-Pro161Cys,
Asp52Cys-Pro161 Cys, Asp53Cys-Pro161 Cys, Ala54Cys-Pro161 Cys,
Gln55Cys-Pro161Cys, Gln56Cys-Pro161Cys, Thr57Cys-Pro161Cys,
Glu58Cys-Pro161Cys, Arg47Cys-Ala162Cys, Tyr48Cys-Ala162Cys,
Leu49Cys-Ala162Cys, Tyr50Cys-Ala162Cys, Thr51Cys-Ala162Cys,
Asp52Cys-Ala162Cys, Asp53Cys-Ala162Cys, Ala54Cys-Ala162Cys,
Gln55Cys-Ala162Cys, Gln56Cys-Ala162Cys, Thr57Cys-Ala162Cys,
Glu58Cys-Ala162Cys, Arg47Cys-Arg163Cys, Tyr48Cys-Arg163Cys,
Leu49Cys-Arg163Cys, Tyr50Cys-Arg163Cys, Thr51Cys-Arg163Cys,
Asp52Cys-Arg163Cys, Asp53Cys-Arg163Cys, Ala54Cys-Arg163Cys,
Gln55Cys-Arg163Cys, Gln56Cys-Arg163Cys, Thr57Cys-Arg163Cys,
Glu58Cys-Arg163Cys
[0125] The third aspect of the present invention provides variants
of human FGF21, or a biologically active peptide thereof,
comprising a substitution of any charged and/or polar but uncharged
amino acid at any of the amino acid positions indicated in the
first embodiment of the present invention combined with the
substitution of a cysteine at two or more amino acid positions
indicated in the second embodiment of the invention.
[0126] It is well known in the art that a significant challenge in
the development of protein pharmaceuticals is to deal with the
physical and chemical instabilities of proteins. This is even more
apparent when a protein pharmaceutical formulation is intended to
be a multiple use, injectable formulation requiring a stable,
concentrated and preserved solution, while maintaining a favorable
bioactivity profile. Detailed biophysical characterization of
wild-type FGF21 established that a concentrated protein solution
(>5 mg/ml), when exposed to stress conditions, such as high
temperature or low pH, lead to accelerated association and
aggregation (i.e., poor physical stability and biopharmaceutical
properties). Exposure of a concentrated protein solution of FGF21
to pharmaceutical preservatives (e.g., m-cresol) also had a
negative impact on physical stability.
[0127] Therefore, an embodiment of the present invention is to
enhance physical stability of concentrated solutions, while
maintaining chemical stability and biological potency, under both
physiological and preserved formulation conditions. It is thought
that association and aggregation may result from hydrophobic
interactions, since, at a given protein concentration, temperature,
and ionic strength have considerable impact on physical stability.
For the most part, non-conserved, presumed surface exposed amino
acid residues were targeted. The local environment of these
residues was analyzed and, those that were not deemed structurally
important were selected for mutagenesis. One method to initiate
specific changes is to further decrease the pI of the protein by
introducing glutamic acid residues ("glutamic acid scan"). It is
hypothesized that the introduction of charged substitutes would
inhibit hydrophobic-mediated aggregation via charge-charge
repulsion and potentially improve preservative compatibility. In
addition, one skilled in the art would also recognize that with
sufficient degree of mutagenesis the pI could be shifted into a
basic pH range by the introduction of positive charge with or
without concomitant decrease in negative charge, thus allowing for
charge-charge repulsion.
[0128] Although the embodiments of the present invention concern
the physical and chemical stability under both physiological and
preserved pharmaceutical formulation conditions, maintaining the
biological potency of the variants as compared to wild-type FGF21
is an important factor of consideration as well. Therefore, the
biological potency of the variants of the present invention is
defined by the ability of the variants to affect glucose uptake as
measured in the in vitro 3T3-L1 adipocyte 2-DOG uptake cell assay
(Example 3) and/or the lowering of plasma glucose levels, as well
as, plasma triglycerides, as measured in vivo in the ob/ob mouse
assay (Example 5).
[0129] The variants of FGF21 administered according to this
invention may be generated and/or isolated by any means known in
the art. The most preferred method for producing the variant is
through recombinant DNA methodologies and is well known to those
skilled in the art. Such methods are described in Current Protocols
in Molecular Biology (John Wiley & Sons, Inc.), which is
incorporated herein by reference.
[0130] Additionally, the preferred embodiments include a
biologically active peptide derived from the variant described
herein. Such a peptide will contain at least one of the
substitutions described and the variant will possess biological
activity. The peptide may be produced by any and all means known to
those skilled in the art, examples of which included but are not
limited to enzymatic digestion, chemical synthesis or recombinant
DNA methodologies.
[0131] It is established in the art that fragments of peptides of
certain fibroblast growth factors are biologically active. See for
example, Baird et al., Proc. Natl. Acad. Sci (USA) 85:2324-2328
(1988), and J. Cell. Phys. Suppl. 5:101-106 (1987). Therefore, the
selection of fragments or peptides of the variant is based on
criteria known in the art. For example, it is known that dipeptidyl
peptidase IV (DPP-IV) is a serine type protease involved in
inactivation of neuropeptides, endocrine peptides, and cytokines
(Damme et al. Chem. Immunol. 72: 42-56, (1999)). The N-terminus of
FGF21 (HisProllePro) contains two dipeptides that could potentially
be substrates to DPP-IV, resulting in a fragment of FGF21 truncated
at the N-terminus by 4 amino acids. Unexpectedly, this fragment of
wild-type FGF21 has been demonstrated to retain biological activity
(Table 2), thus, variants of the present invention truncated at the
N-terminus by up to 4 amino acids, is an embodiment of the present
invention.
[0132] The invention also encompasses polynucleotides encoding the
above-described variants that may be in the form of RNA or in the
form of DNA, which DNA includes cDNA, genomic DNA, and synthetic
DNA. The DNA may be double-stranded or single-stranded. The coding
sequences that encode the variants of the present invention may
vary as a result of the redundancy or degeneracy of the genetic
code.
[0133] The polynucleotides that encode for the variants of the
invention may include the following: only the coding sequence for
the variant, the coding sequence for the variant and additional
coding sequence such as a functional polypeptide, or a leader or
secretory sequence or a pro-protein sequence; the coding sequence
for the variant and non-coding sequence, such as introns or
non-coding sequence 5' and/or 3' of the coding sequence for the
variant. Thus the term "polynucleotide encoding a variant"
encompasses a polynucleotide that may include not only coding
sequence for the variant but also a polynucleotide, which includes
additional coding and/or non-coding sequence.
[0134] The invention further relates to variants of the described
polynucleotides that encode for fragments, analogs and derivatives
of the polypeptide that contain the indicated substitutions. The
variant of the polynucleotide may be a naturally occurring allelic
variant of the human FGF21 sequence, a non-naturally occurring
variant, or a truncated variant as described above. Thus, the
present invention also includes polynucleotides encoding the
variants described above, as well as variants of such
polynucleotides, which variants encode for a fragment, derivative
or analog of the disclosed variant. Such nucleotide variants
include deletion variants, substitution variants, truncated
variants, and addition or insertion variants as long as at least
one of the indicated amino acid substitutions of the first or
second embodiments is present.
[0135] The polynucleotides of the invention will be expressed in
hosts after the sequences have been operably linked to (i.e.,
positioned to ensure the functioning of) an expression control
sequence. These expression vectors are typically replicable in the
host organisms either as episomes or as an integral part of the
host chromosomal DNA. Commonly, expression vectors will contain
selection markers, e.g., tetracycline, neomycin, and dihydrofolate
reductase, to permit detection of those cells transformed with the
desired DNA sequences. The FGF21 variant can be expressed in
mammalian cells, insect, yeast, bacterial or other cells under the
control of appropriate promoters. Cell free translation systems can
also be employed to produce such proteins using RNAs derived from
DNA constructs of the present invention.
[0136] E. coli is a prokaryotic host useful particularly for
cloning the polynucleotides of the present invention. Other
microbial hosts suitable for use include Bacillus subtilus,
Salmonella typhimurium, and various species of Serratia,
Pseudomonas, Streptococcus, and Staphylococcus, although others may
also be employed as a matter of choice. In these prokaryotic hosts,
one can also make expression vectors, which will typically contain
expression control sequences compatible with the host cell (e.g.,
an origin of replication). In addition, any of a number of
well-known promoters may be present, such as the lactose promoter
system, a tryptophan (trp) promoter system, a beta-lactamase
promoter system, or a promoter system from phages lambda or T7. The
promoters will typically control expression, optionally with an
operator sequence, and have ribosome binding site sequences and the
like, for initiating and completing transcription and
translation.
[0137] One skilled in the art of expression of proteins will
recognize that methionine or methionine-arginine sequence can be
introduced at the N-terminus of the mature sequence (SEQ ID NO: 3)
for expression in E. coli and are contemplated within the context
of this invention. Thus, unless otherwise noted, variants of the
present invention expressed in E. coli have a methionine sequence
introduced at the N-terminus.
[0138] Other microbes, such as yeast or fungi, may also be used for
expression. Pichia pastoris, Saccharomyces cerevisiae,
Schizosaccharomyces pombe, and Pichia angusta are examples of
preferred yeast hosts, with suitable vectors having expression
control sequences, such as promoters, including 3-phosphoglycerate
kinase or other glycolytic enzymes, and an origin of replication,
termination sequences and the like as desired. Aspergillus niger,
Trichoderma reesei; and Schizophyllum commune, are examples of
fungi hosts, although others may also be employed as a matter of
choice.
[0139] Mammalian tissue cell culture may also be used to express
and produce the polypeptides of the present invention. Eukaryotic
cells are actually preferred, because a number of suitable host
cell lines capable of secreting intact variants have been developed
in the art, and include the CHO cell lines, various COS cell lines,
NSO cells, Syrian Hamster Ovary cell lines, HeLa cells, or human
embryonic kidney cell lines (i.e. HEK293, HEK293EBNA).
[0140] Expression vectors for these cells can include expression
control sequences, such as an origin of replication, a promoter, an
enhancer, and necessary processing information sites, such as
ribosome binding sites, RNA splice sites, polyadenylation sites,
and transcriptional terminator sequences. Preferred expression
control sequences are promoters derived from SV40, adenovirus,
bovine papilloma virus, cytomegalovirus, Raus sarcoma virus, and
the like. Preferred polyadenylation sites include sequences derived
from SV40 and bovine growth hormone.
[0141] The vectors containing the polynucleotide sequences of
interest (e.g., the variants of FGF21 and expression control
sequences) can be transferred into the host cell by well-known
methods, which vary depending on the type of cellular host. For
example, calcium chloride transfection is commonly utilized for
prokaryotic cells, whereas calcium phosphate treatment or
electroporation may be used for other cellular hosts.
[0142] Various methods of protein purification may be employed and
such methods are known in the art and described, for example, in
Deutscher, Methods in Enzymology 182: 83-9 (1990) and Scopes,
Protein Purification: Principles and Practice, Springer-Verlag, NY
(1982). The purification step(s) selected will depend, for example,
on the nature of the production process used for the variants of
FGF21.
[0143] The FGF21 variant-containing compositions should be
formulated and dosed in a fashion consistent with good medical
practice, taking into account the clinical condition of the
patient, the site of delivery of the FGF21 variant composition, the
method of administration, the scheduling of administration, and
other factors known to practitioners. The "therapeutically
effective amount" of the FGF21 variant for purposes herein is thus
determined by such considerations.
[0144] The pharmaceutical compositions of the FGF21 variants and of
the present invention may be administered by any means that achieve
the generally intended purpose: to treat type 1 and type 2 diabetes
mellitus, obesity, metabolic syndrome, or critically ill patients.
The term "parenteral" as used herein refers to modes of
administration that include intravenous, intramuscular,
intraperitoneal, intrasternal, subcutaneous, and intraarticular
injection and infusion. The dosage administered will be dependent
upon the age, health, and weight of the recipient, kind of
concurrent treatment, if any, frequency of treatment, and the
nature of the effect desired. Compositions within the scope of the
invention include all compositions wherein an FGF21 variant is
present in an amount that is effective to achieve the desired
medical effect for treatment type 1 or type 2 diabetes mellitus,
obesity, or metabolic syndrome. While individual needs may vary
from one patient to another, the determination of the optimal
ranges of effective amounts of all of the components is within the
ability of the clinician of ordinary skill.
[0145] The variants of FGF21 of the present invention can be
formulated according to known methods to prepare pharmaceutically
useful compositions. A desired formulation would be one that is a
stable lyophilized product that is reconstituted with an
appropriate diluent or an aqueous solution of high purity with
optional pharmaceutically acceptable carriers, preservatives,
excipients or stabilizers [Remington's Pharmaceutical Sciences 16th
edition (1980)]. The variants of the present invention may be
combined with a pharmaceutically acceptable buffer, and the pH
adjusted to provide acceptable stability, and a pH acceptable for
administration.
[0146] For parenteral administration, in one embodiment, the FGF21
variants are formulated generally by mixing one or more of them at
the desired degree of purity, in a unit dosage injectable form
(solution, suspension, or emulsion), with a pharmaceutically
acceptable carrier, i.e., one that is non-toxic to recipients at
the dosages and concentrations employed and is compatible with
other ingredients of the formulation. Preferably, one or more
pharmaceutically acceptable anti-microbial agents may be added.
Phenol, m-cresol, and benzyl alcohol are preferred pharmaceutically
acceptable anti-microbial agents.
[0147] Optionally, one or more pharmaceutically acceptable salts
may be added to adjust the ionic strength or tonicity. One or more
excipients may be added to further adjust the isotonicity of the
formulation. Glycerin, sodium chloride, and mannitol are examples
of an isotonicity adjusting excipient.
[0148] Those skilled in the art can readily optimize
pharmaceutically effective dosages and administration regimens for
therapeutic compositions comprising an FGF21 variant, as determined
by good medical practice and the clinical condition of the
individual patient. A typical dose range for the FGF21 variants of
the present invention will range from about 0.01 mg per day to
about 1000 mg per day (or about 0.05 mg per week to about 5000 mg
per week administered once per week) for an adult. Preferably, the
dosage ranges from about 0.1 mg per day to about 100 mg per day (or
about 0.5 mg per week to about 500 mg per week adminstered once per
week), more preferably from about 1.0 mg/day to about 10 mg/day (or
about 5 mg per week to about 50 mg per week administered once per
week). Most preferably, the dosage is about 1-5 mg/day (or about 5
mg per week to about 25 mg per week administered once per week).
The appropriate dose of an FGF21 variant administered will result
in lowering blood glucose levels and increasing energy expenditure
by faster and more efficient glucose utilization, and thus is
useful for treating type 1 and type 2 diabetes mellitus, obesity
and metabolic syndrome.
[0149] In addition, because hyperglycemia and insulin resistance
are common in critically ill patients given nutritional support,
some ICUs administer insulin to treat excessive hyperglycemia in
fed critically ill patients. In fact, recent studies document the
use of exogenous insulin to maintain blood glucose at a level no
higher than 110 mg per deciliter reduced morbidity and mortality
among critically ill patients in the surgical intensive care unit,
regardless of whether they had a history of diabetes (Van den
Berghe, et al. N Engl J Med., 345(19):1359, (2001)). Thus, variants
of FGF21 of the present invention are uniquely suited to help
restore metabolic stability in metabolically unstable critically
ill patients. Variants of FGF21 are unique in that they stimulate
glucose uptake and enhances insulin sensitivity but do not induce
hypoglycemia.
[0150] In another aspect of the present invention, variants of
FGF21 for use as a medicament for the treatment of type 1 and type
2 diabetes mellitus, obesity, metabolic syndrome, or critically ill
patients is contemplated.
[0151] Having now described the present invention in detail, the
same will be more clearly understood by reference to the following
examples, which are included herewith for purposes of illustration
only and are not intended to be limiting of the invention.
[0152] The practice of the present invention will employ, unless
otherwise indicated, conventional methods of chemistry,
biochemistry, molecular biology, immunology and pharmacology,
within the skill of the art. Such techniques are explained fully in
the literature. See, e.g., Remington's Pharmaceutical Sciences,
18th Edition (Easton, Pa.: Mack Publishing Company, 1990); Methods
In Enzymology (S. Colowick and N. Kaplan, eds., Academic Press,
Inc.); and Handbook of Experimental Immunology, Vols. I-IV (D. M.
Weir and C. C. Blackwell, eds., 1986, Blackwell Scientific
Publications); and Sambrook et al., Molecular Cloning: A Laboratory
Manual (2nd Edition, 1989).
Site-Specific FGF21 Mutants
[0153] The term "site-specific FGF21 mutant" or "substituted FGF21
mutant" refers to an FGF21 mutant polypeptide having an amino acid
sequence that differs from the amino acid sequence of a naturally
occurring FGF21 polypeptide sequence, e.g., SEQ ID NO:1 and
variants thereof. Site-specific FGF21 mutants can be generated by
introducing amino acid substitutions, either conservative or
non-conservative and using naturally or non-naturally occurring
amino acids, at particular positions of the FGF21 polypeptide.
[0154] "Conservative amino acid substitution" can involve a
substitution of a native amino acid residue (i.e., a residue found
in a given position of the wild-type FGF21 polypeptide sequence)
with a nonnative residue (i.e., a residue that is not found in a
given position of the wild-type FGF21 polypeptide sequence) such
that there is little or no effect on the polarity or charge of the
amino acid residue at that position. Conservative amino acid
substitutions also encompass non-naturally occurring amino acid
residues that are typically incorporated by chemical peptide
synthesis rather than by synthesis in biological systems. These
include peptidomimetics, and other reversed or inverted forms of
amino acid moieties.
[0155] Naturally occurring residues can be divided into classes
based on common side chain properties:
[0156] (1) hydrophobic: norleucine, Met, Ala, Val, Leu, Ile;
[0157] (2) neutral hydrophilic: Cys, Ser, Thr;
[0158] (3) acidic: Asp, Glu;
[0159] (4) basic: Asn, Gln, His, Lys, Arg;
[0160] (5) residues that influence chain orientation: Gly, Pro;
[0161] (6) aromatic: Trp, Tyr, Phe; and
[0162] (7) selenocysteine, pyrrolysine (PYL), and
pyrroline-carboxy-lysine (PCL).
[0163] Conservative substitutions can involve the exchange of a
member of one of these classes for another member of the same
class. Non-conservative substitutions can involve the exchange of a
member of one of these classes for a member from another class.
[0164] Desired amino acid substitutions (whether conservative or
non-conservative) can be determined by those skilled in the art at
the time such substitutions are desired.
Truncated FGF21 Polypeptides
[0165] One embodiment of the present invention is directed to
truncated forms of the mature FGF21 polypeptide (SEQ ID NO:3). This
embodiment of the present invention arose from an effort to
identify truncated FGF21 polypeptides that are capable of providing
an activity that is similar, and in some instances superior, to
untruncated forms of the mature FGF21 polypeptide.
[0166] As used herein, the term "truncated FGF21 polypeptide"
refers to an FGF21 polypeptide in which amino acid residues have
been removed from the amino-terminal (or N-terminal) end of the
FGF21 polypeptide, amino acid residues have been removed from the
carboxyl-terminal (or C-terminal) end of the FGF21 polypeptide, or
amino acid residues have been removed from both the amino-terminal
and carboxyl-terminal ends of the FGF21 polypeptide. The various
truncations disclosed herein were prepared as described herein.
[0167] The activity of N-terminally truncated FGF21 polypeptides
and C-terminally truncated FGF21 polypeptides can be assayed using
an in vitro phospho-ERK assay. Specific details of the in vitro
assays that can be used to examine the activity of truncated FGF21
polypeptides can be found in the examples.
[0168] The activity of the truncated FGF21 polypeptides of the
present invention can also be assessed in an in vivo assay, such as
ob/ob mice. Generally, to assess the in vivo activity of a
truncated FGF21 polypeptide, the truncated FGF21 polypeptide can be
administered to a test animal intraperitoneally. After a desired
incubation period (e.g., one hour or more), a blood sample can be
drawn, and blood glucose levels can be measured.
[0169] a. N-Terminal Truncations
[0170] In some embodiments of the present invention, N-terminal
truncations comprise 1, 2, 3, 4, 5, 6, 7, or 8 amino acid residues
from the N-terminal end of the mature FGF21 polypeptide. Truncated
FGF21 polypeptides having N-terminal truncations of fewer than 9
amino acid residues retain the ability of the mature FGF21
polypeptide to lower blood glucose in an individual. Accordingly,
in particular embodiments, the present invention encompasses
truncated forms of the mature FGF21 polypeptide or FGF21 protein
variants having N-terminal truncations of 1, 2, 3, 4, 5, 6, 7, or 8
amino acid residues.
[0171] b. C-Terminal Truncations
[0172] In some embodiments of the present invention, C-terminal
truncations comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 amino
acid residues from the C-terminal end of the mature FGF21
polypeptide. Truncated FGF21 polypeptides having C-terminal
truncations of fewer than 13 amino acid residues exhibited an
efficacy of at least 50% of the efficacy of wild-type FGF21 in an
in vitro ELK-luciferase assay (Yie J. et al. FEBS Letts 583:19-24
(2009)), indicating that these FGF21 mutants retain the ability of
the mature FGF21 polypeptide to lower blood glucose in an
individual. Accordingly, in particular embodiments, the present
invention encompasses truncated forms of the mature FGF21
polypeptide or FGF21 protein variants having C-terminal truncations
of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 amino acid
residues.
[0173] c. N-Terminal and C-Terminal Truncations
[0174] In some embodiments of the present invention, truncated
FGF21 polypeptides can have a combination of N-terminal and
C-terminal truncations. Truncated FGF21 polypeptides having a
combination of N-terminal and C-terminal truncations share the
activity of corresponding truncated FGF21 polypeptides having
either the N-terminal or C-terminal truncations alone. In other
words, truncated FGF21 polypeptides having both N-terminal
truncations of fewer than 9 amino acid residues and C-terminal
truncations of fewer than 13 amino acid residues possess similar or
greater blood glucose-lowering activity as truncated FGF21
polypeptides having N-terminal truncations of fewer than 9 amino
acid residues or truncated FGF21 polypeptides having C-terminal
truncations of fewer than 13 amino acid residues. Accordingly, in
particular embodiments, the present invention encompasses truncated
forms of the mature FGF21 polypeptide or FGF21 protein variants
having both N-terminal truncations of 1, 2, 3, 4, 5, 6, 7, or 8
amino acid residues and C-terminal truncations of 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, or 12 amino acid residues.
[0175] As with all FGF21 variants of the present invention,
truncated FGF21 polypeptides can optionally comprise an
amino-terminal methionine residue, which can be introduced by
directed mutation or as a result of a bacterial expression
process.
[0176] The truncated FGF21 polypeptides of the present invention
can be prepared as described in the examples described herein.
Those of ordinary skill in the art, familiar with standard
molecular biology techniques, can employ that knowledge, coupled
with the instant disclosure, to make and use the truncated FGF21
polypeptides of the present invention. Standard techniques can be
used for recombinant DNA, oligonucleotide synthesis, tissue
culture, and transformation (e.g., electroporation, lipofection).
See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual,
supra, which is incorporated herein by reference for any purpose.
Enzymatic reactions and purification techniques can be performed
according to manufacturer's specifications, as commonly
accomplished in the art, or as described herein. Unless specific
definitions are provided, the nomenclatures utilized in connection
with, and the laboratory procedures and techniques of, analytical
chemistry, synthetic organic chemistry, and medicinal and
pharmaceutical chemistry described herein are those well known and
commonly used in the art. Standard techniques can be used for
chemical syntheses; chemical analyses; pharmaceutical preparation,
formulation, and delivery; and treatment of patients.
[0177] The truncated FGF21 polypeptides of the present invention
can also be fused to another entity, which can impart additional
properties to the truncated FGF21 polypeptide. In one embodiment of
the present invention, a truncated FGF21 polypeptide can be fused
to an IgG constant domain or fragment thereof (e.g., the Fc
region), Human Serum Albumin (HSA), or albumin-binding
polypeptides. Such fusion can be accomplished using known molecular
biological methods and/or the guidance provided herein. The
benefits of such fusion polypeptides, as well as methods for making
such fusion polypeptides, are discussed in more detail herein.
FGF21 Fusion Proteins
[0178] As used herein, the term "FGF21 fusion polypeptide" or
"FGF21 fusion protein" refers to a fusion of one or more amino acid
residues (such as a heterologous protein or peptide) at the
N-terminus or C-terminus of any FGF21 protein variant described
herein.
[0179] Heterologous peptides and polypeptides include, but are not
limited to, an epitope to allow for the detection and/or isolation
of an FGF21 protein variant; a transmembrane receptor protein or a
portion thereof, such as an extracellular domain or a transmembrane
and intracellular domain; a ligand or a portion thereof which binds
to a transmembrane receptor protein; an enzyme or portion thereof
which is catalytically active; a polypeptide or peptide which
promotes oligomerization, such as a leucine zipper domain; a
polypeptide or peptide which increases stability, such as an
immunoglobulin constant region; a functional or non-functional
antibody, or a heavy or light chain thereof; and a polypeptide
which has an activity, such as a therapeutic activity, different
from the FGF21 protein variants of the present invention. Also
encompassed by the present invention are FGF21 mutants fused to
human serum albumin (HSA).
[0180] FGF21 fusion proteins can be made by fusing heterologous
sequences at either the N-terminus or at the C-terminus of an FGF21
protein variant. As described herein, a heterologous sequence can
be an amino acid sequence or a non-amino acid-containing polymer.
Heterologous sequences can be fused either directly to the FGF21
protein variant or via a linker or adapter molecule. A linker or
adapter molecule can be one or more amino acid residues (or -mers),
e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9 residues (or -mers), preferably
from 10 to 50 amino acid residues (or -mers), e.g., 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 residues (or
-mers), and more preferably from 15 to 35 amino acid residues (or
-mers). A linker or adapter molecule can also be designed with a
cleavage site for a DNA restriction endonuclease or for a protease
to allow for the separation of the fused moieties.
[0181] a. Fc Fusions
[0182] In one embodiment of the present invention, an FGF21 protein
variant is fused to one or more domains of an Fc region of human
IgG. Antibodies comprise two functionally independent parts, a
variable domain known as "Fab," that binds an antigen, and a
constant domain known as "Fc," that is involved in effector
functions such as complement activation and attack by phagocytic
cells. An Fc has a long serum half-life, whereas a Fab is
short-lived (Capon et al., 1989, Nature 337: 525-31). When joined
together with a therapeutic protein, an Fc domain can provide
longer half-life or incorporate such functions as Fc receptor
binding, protein A binding, complement fixation, and perhaps even
placental transfer (Capon et al., 1989).
[0183] In vivo pharmacokinetic analysis indicated that human FGF21
has a short half-life of about 0.5 to 1 hours in mice due to rapid
clearance and in vivo degradation. Therefore, to extend the
half-life of FGF21 an Fc sequence was fused to the N- or C-terminal
end of the FGF21 polypeptide. The fusion of an Fc region to
wild-type FGF21, in particularly Fc fused to the N-terminus of
wild-type FGF21, did not extend the half-life as expected, however,
which led to an investigation of the proteolytic degradation of
FGF21 in vivo and the identification of FGF21 mutants that were
resistant to such degradation.
[0184] Throughout the disclosure, Fc-FGF21 refers to a fusion
protein in which the Fc sequence is fused to the N-terminus of
FGF21. Similarly, throughout the disclosure, FGF21-Fc refers to a
fusion protein in which the Fc sequence is fused to the C-terminus
of FGF21.
[0185] The resulting FGF21 fusion protein can be purified, for
example, by the use of a Protein A affinity column. Peptides and
proteins fused to an Fc region have been found to exhibit a
substantially greater half-life in vivo than the unfused
counterpart. Also, a fusion to an Fc region allows for
dimerization/multimerization of the fusion polypeptide. The Fc
region can be a naturally occurring Fc region, or can be altered to
improve certain qualities, such as therapeutic qualities,
circulation time, or reduced aggregation.
[0186] Useful modifications of protein therapeutic agents by fusion
with the "Fc" domain of an antibody are discussed in detail in
International Publication No. WO 00/024782, which is hereby
incorporated by reference in its entirety. This document discusses
linkage to a "vehicle" such as polyethylene glycol (PEG), dextran,
or an Fc region.
[0187] b. Fusion Protein Linkers
[0188] When forming the fusion proteins of the present invention, a
linker can, but need not, be employed. When present, the linker's
chemical structure may not critical, since it serves primarily as a
spacer. The linker can be made up of amino acids linked together by
peptide bonds. In some embodiments of the present invention, the
linker is made up of from 1 to 20 amino acids linked by peptide
bonds, wherein the amino acids are selected from the 20 naturally
occurring amino acids. In various embodiments, the 1 to 20 amino
acids are selected from the amino acids glycine, serine, alanine,
proline, asparagine, glutamine, and lysine. In some embodiments, a
linker is made up of a majority of amino acids that are sterically
unhindered, such as glycine and alanine. In some embodiments,
linkers are polyglycines, polyalanines, combinations of glycine and
alanine (such as poly(Gly-Ala)), or combinations of glycine and
serine (such as poly(Gly-Ser)). While a linker of 15 amino acid
residues has been found to work particularly well for FGF21 fusion
proteins, the present invention contemplates linkers of any length
or composition.
[0189] The linkers described herein are exemplary, and linkers that
are much longer and which include other residues are contemplated
by the present invention. Non-peptide linkers are also contemplated
by the present invention. For example, alkyl linkers such as can be
used. These alkyl linkers can further be substituted by any
non-sterically hindering group, including, but not limited to, a
lower alkyl (e.g., C1-C6), lower acyl, halogen (e.g., Cl, Br), CN,
NH2, or phenyl. An exemplary non-peptide linker is a polyethylene
glycol linker, wherein the linker has a molecular weight of 100 to
5000 kD, for example, 100 to 500 kD.
Chemically-Modified FGF21 Mutants
[0190] Chemically modified forms of the FGF21 protein variants
described herein, including the truncated forms of FGF21 described
herein, can be prepared by one skilled in the art, given the
disclosures described herein. Such chemically modified FGF21
mutants are altered such that the chemically modified FGF21 mutant
is different from the unmodified FGF21 mutant, either in the type
or location of the molecules naturally attached to the FGF21
mutant. Chemically modified FGF21 mutants can include molecules
formed by the deletion of one or more naturally-attached chemical
groups.
[0191] In one embodiment, FGF21 protein variants of the present
invention can be modified by the covalent attachment of one or more
polymers. For example, the polymer selected is typically
water-soluble so that the protein to which it is attached does not
precipitate in an aqueous environment, such as a physiological
environment. Included within the scope of suitable polymers is a
mixture of polymers. Preferably, for therapeutic use of the
end-product preparation, the polymer will be pharmaceutically
acceptable. Non-water soluble polymers conjugated to FGF21 protein
variants of the present invention also form an aspect of the
invention.
[0192] Exemplary polymers each can be of any molecular weight and
can be branched or unbranched. The polymers each typically have an
average molecular weight of between about 2 kDa to about 100 kDa
(the term "about" indicating that in preparations of a
water-soluble polymer, some molecules will weigh more and some less
than the stated molecular weight). The average molecular weight of
each polymer is preferably between about 5 kDa and about 50 kDa,
more preferably between about 12 kDa and about 40 kDa, and most
preferably between about 20 kDa and about 35 kDa.
[0193] Suitable water-soluble polymers or mixtures thereof include,
but are not limited to, N-linked or O-linked carbohydrates, sugars,
phosphates, polyethylene glycol (PEG) (including the forms of PEG
that have been used to derivatize proteins, including
mono-(C1-C10), alkoxy-, or aryloxy-polyethylene glycol),
monomethoxy-polyethylene glycol, dextran (such as low molecular
weight dextran of, for example, about 6 kD), cellulose, or other
carbohydrate based polymers, poly-(N-vinyl pyrrolidone)polyethylene
glycol, propylene glycol homopolymers, polypropylene oxide/ethylene
oxide co-polymers, polyoxyethylated polyols (e.g., glycerol), and
polyvinyl alcohol. Also encompassed by the present invention are
bifunctional crosslinking molecules that can be used to prepare
covalently attached FGF21 protein variant multimers. Also
encompassed by the present invention are FGF21 mutants covalently
attached to polysialic acid.
[0194] In some embodiments of the present invention, an FGF21
mutant is covalently, or chemically, modified to include one or
more water-soluble polymers, including, but not limited to,
polyethylene glycol (PEG), polyoxyethylene glycol, or polypropylene
glycol. See, e.g., U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144;
4,670,417; 4,791,192; and 4,179,337. In some embodiments of the
present invention, an FGF21 mutant comprises one or more polymers,
including, but not limited to, monomethoxy-polyethylene glycol,
dextran, cellulose, another carbohydrate-based polymer,
poly-(N-vinyl pyrrolidone)-polyethylene glycol, propylene glycol
homopolymers, a polypropylene oxide/ethylene oxide co-polymer,
polyoxyethylated polyols (e.g., glycerol), polyvinyl alcohol, or
mixtures of such polymers.
[0195] In some embodiments of the present invention, an FGF21
mutant is covalently-modified with PEG subunits. In some
embodiments, one or more water-soluble polymers are bonded at one
or more specific positions (for example, at the N-terminus) of the
FGF21 mutant. In some embodiments, one or more water-soluble
polymers are randomly attached to one or more side chains of an
FGF21 mutant. In some embodiments, PEG is used to improve the
therapeutic capacity of an FGF21 mutant. Certain such methods are
discussed, for example, in U.S. Pat. No. 6,133,426, which is hereby
incorporated by reference for any purpose.
[0196] In embodiments of the present invention wherein the polymer
is PEG, the PEG group can be of any convenient molecular weight,
and can be linear or branched. The average molecular weight of the
PEG group will preferably range from about 2 kD to about 100 kDa,
and more preferably from about 5 kDa to about 50 kDa, e.g., 10, 20,
30, 40, or 50 kDa. The PEG groups will generally be attached to the
FGF21 mutant via acylation or reductive alkylation through a
reactive group on the PEG moiety (e.g., an aldehyde, amino, thiol,
or ester group) to a reactive group on the FGF21 mutant (e.g., an
aldehyde, amino, or ester group).
[0197] Branched PEG derivatives, also known as "Y-shaped" PEG
derivatives, contain two linear methoxy PEG chain attached to a
central core. The sterically bulky structure of these "Y-shaped"
PEG derivatives will facilitate the single point attachment of the
modified molecules. By way of example, three kinds of "Y-shaped"
PEG derivatives are Y-NHS-40K (useful for amine PEGylation);
Y-MAL-40K (useful for thiol PEGylation); and Y-ALD-40K (e.g.,
Y-AALD-40K and Y-PALD-40K)(useful for N-terminal PEGylation). For
amine PEGylation, the "Y-shape" NHS ester will react with the amino
group of lysine(s) or the N-terminal amine in biological active
molecules to produce a stable amide linkage(s). This NHS ester will
couple with the targeted molecules at pH 7-8. For thiol PEGylation,
the "Y-shape" maleimide will react with the thiol groups in
biological active molecules to generates a stable
3-thiosuccinimidyl ether linkage. This maleimide will couple with
the targeted molecules at pH 5.0-6.5 in the presence of other
functional groups. For N-terminal PEGylation, The "Y-shape"
aldehyde will preferably react with the N-terminal amine in
biological active molecules to produce a stable amine linkage in
the presence of a reducing reagent such as sodium cyanoborohydride.
This aldehyde will couple with the N-terminal amine of the targeted
molecules at pH 5-8. Reagents for performing branched PEGylation
are available through, e.g., JenKem Technology.
[0198] The PEGylation of a polypeptide, including the FGF21 mutants
of the present invention, can be specifically carried out using any
of the PEGylation reactions known in the art. Such reactions are
described, for example, in the following references: Francis et
al., 1992, Focus on Growth Factors 3: 4-10; European Patent Nos. 0
154 316 and 0 401 384; and U.S. Pat. No. 4,179,337. For example,
PEGylation can be carried out via an acylation reaction or an
alkylation reaction with a reactive polyethylene glycol molecule
(or an analogous reactive water-soluble polymer) as described
herein. For the acylation reactions, a selected polymer should have
a single reactive ester group. For reductive alkylation, a selected
polymer should have a single reactive aldehyde group. A reactive
aldehyde is, for example, polyethylene glycol propionaldehyde,
which is water stable, or mono C1-C10 alkoxy or aryloxy derivatives
thereof (see, e.g., U.S. Pat. No. 5,252,714).
[0199] In some embodiments of the present invention, a useful
strategy for the attachment of the PEG group to a polypeptide
involves combining, through the formation of a conjugate linkage in
solution, a peptide and a PEG moiety, each bearing a special
functionality that is mutually reactive toward the other. The
peptides can be easily prepared with conventional solid phase
synthesis. The peptides are "preactivated" with an appropriate
functional group at a specific site. The precursors are purified
and fully characterized prior to reacting with the PEG moiety.
Ligation of the peptide with PEG usually takes place in aqueous
phase and can be easily monitored by reverse phase analytical HPLC.
The PEGylated peptides can be easily purified by preparative HPLC
and characterized by analytical HPLC, amino acid analysis and laser
desorption mass spectrometry.
[0200] Polysaccharide polymers are another type of water-soluble
polymer that can be used for protein modification. Therefore, the
FGF21 mutants of the present invention fused to a polysaccharide
polymer form embodiments of the present invention. Dextrans are
polysaccharide polymers comprised of individual subunits of glucose
predominantly linked by alpha 1-6 linkages. The dextran itself is
available in many molecular weight ranges, and is readily available
in molecular weights from about 1 kD to about 70 kD. Dextran is a
suitable water-soluble polymer for use as a vehicle by itself or in
combination with another vehicle (e.g., Fc). See, e.g.,
International Publication No. WO 96/11953. The use of dextran
conjugated to therapeutic or diagnostic immunoglobulins has been
reported. See, e.g., European Patent Publication No. 0 315 456,
which is hereby incorporated by reference. The present invention
also encompasses the use of dextran of about 1 kD to about 20
kD.
[0201] In general, chemical modification can be performed under any
suitable condition used to react a protein with an activated
polymer molecule. Methods for preparing chemically modified
polypeptides will generally comprise the steps of: (a) reacting the
polypeptide with the activated polymer molecule (such as a reactive
ester or aldehyde derivative of the polymer molecule) under
conditions whereby a FGF21 protein variant becomes attached to one
or more polymer molecules, and (b) obtaining the reaction products.
The optimal reaction conditions will be determined based on known
parameters and the desired result. For example, the larger the
ratio of polymer molecules to protein, the greater the percentage
of attached polymer molecule. In one embodiment of the present
invention, chemically modified FGF21 mutants can have a single
polymer molecule moiety at the amino-terminus (see, e.g., U.S. Pat.
No. 5,234,784)
[0202] In another embodiment of the present invention, FGF21
protein variants can be chemically coupled to biotin. The
biotin/FGF21 protein variants are then allowed to bind to avidin,
resulting in tetravalent avidin/biotin/FGF21 protein variants.
FGF21 protein variants can also be covalently coupled to
dinitrophenol (DNP) or trinitrophenol (TNP) and the resulting
conjugates precipitated with anti-DNP or anti-TNP-IgM to form
decameric conjugates with a valency of 10.
[0203] Generally, conditions that can be alleviated or modulated by
the administration of the present chemically modified FGF21 mutants
include those described herein for FGF21 protein variants. However,
the chemically modified FGF21 mutants disclosed herein can have
additional activities, enhanced or reduced biological activity, or
other characteristics, such as increased or decreased half-life, as
compared to unmodified FGF21 mutants.
[0204] Therapeutic Compositions of FGF21 Mutants and Administration
Thereof
[0205] Therapeutic compositions comprising FGF21 mutants are within
the scope of the present invention, and are specifically
contemplated in light of the identification of several mutant FGF21
sequences exhibiting enhanced properties. Such FGF21 mutant
pharmaceutical compositions can comprise a therapeutically
effective amount of an FGF21 protein variant in admixture with a
pharmaceutically or physiologically acceptable formulation agent
selected for suitability with the mode of administration.
[0206] Acceptable formulation materials preferably are nontoxic to
recipients at the dosages and concentrations employed.
[0207] The pharmaceutical composition can contain formulation
materials for modifying, maintaining, or preserving, for example,
the pH, osmolarity, viscosity, clarity, color, isotonicity, odor,
sterility, stability, rate of dissolution or release, adsorption,
or penetration of the composition. Suitable formulation materials
include, but are not limited to, amino acids (such as glycine,
glutamine, asparagine, arginine, or lysine), antimicrobials,
antioxidants (such as ascorbic acid, sodium sulfite, or sodium
hydrogen-sulfite), buffers (such as borate, bicarbonate, Tris-HCl,
citrates, phosphates, or other organic acids), bulking agents (such
as mannitol or glycine), chelating agents (such as ethylenediamine
tetraacetic acid (EDTA)), complexing agents (such as caffeine,
polyvinylpyrrolidone, beta-cyclodextrin, or
hydroxypropyl-beta-cyclodextrin), fillers, monosaccharides,
disaccharides, and other carbohydrates (such as glucose, mannose,
or dextrins), proteins (such as serum albumin, gelatin, or
immunoglobulins), coloring, flavoring and diluting agents,
emulsifying agents, hydrophilic polymers (such as
polyvinylpyrrolidone), low molecular weight polypeptides,
salt-forming counterions (such as sodium), preservatives (such as
benzalkonium chloride, benzoic acid, salicylic acid, thimerosal,
phenethyl alcohol, methylparaben, propylparaben, chlorhexidine,
sorbic acid, or hydrogen peroxide), solvents (such as glycerin,
propylene glycol, or polyethylene glycol), sugar alcohols (such as
mannitol or sorbitol), suspending agents, surfactants or wetting
agents (such as pluronics; PEG; sorbitan esters; polysorbates such
as polysorbate 20 or polysorbate 80; triton; tromethamine;
lecithin; cholesterol or tyloxapal), stability enhancing agents
(such as sucrose or sorbitol), tonicity enhancing agents (such as
alkali metal halides; preferably sodium or potassium chloride; or
mannitol sorbitol), delivery vehicles, diluents, excipients and/or
pharmaceutical adjuvants (see, e.g., Remington's Pharmaceutical
Sciences (18th Ed., A. R. Gennaro, ed., Mack Publishing Company
1990), and subsequent editions of the same, incorporated herein by
reference for any purpose).
[0208] The optimal pharmaceutical composition will be determined by
a skilled artisan depending upon, for example, the intended route
of administration, delivery format, and desired dosage (see, e.g.,
Remington's Pharmaceutical Sciences, supra). Such compositions can
influence the physical state, stability, rate of in vivo release,
and rate of in vivo clearance of the FGF21 protein variant.
[0209] The primary vehicle or carrier in a pharmaceutical
composition can be either aqueous or non-aqueous in nature. For
example, a suitable vehicle or carrier for injection can be water,
physiological saline solution, or artificial cerebrospinal fluid,
possibly supplemented with other materials common in compositions
for parenteral administration. Neutral buffered saline or saline
mixed with serum albumin are further exemplary vehicles. Other
exemplary pharmaceutical compositions comprise Tris buffer of about
pH 7.0-8.5, or acetate buffer of about pH 4.0-5.5, which can
further include sorbitol or a suitable substitute. In one
embodiment of the present invention, FGF21 protein variant
compositions can be prepared for storage by mixing the selected
composition having the desired degree of purity with optional
formulation agents (Remington's Pharmaceutical Sciences, supra) in
the form of a lyophilized cake or an aqueous solution. Further, the
FGF21 protein variant product can be formulated as a lyophilizate
using appropriate excipients such as sucrose.
[0210] The FGF21 protein variant pharmaceutical compositions can be
selected for parenteral delivery. Alternatively, the compositions
can be selected for inhalation or for delivery through the
digestive tract, such as orally. The preparation of such
pharmaceutically acceptable compositions is within the skill of the
art.
[0211] The formulation components are present in concentrations
that are acceptable to the site of administration. For example,
buffers are used to maintain the composition at physiological pH or
at a slightly lower pH, typically within a pH range of from about 5
to about 8.
[0212] When parenteral administration is contemplated, the
therapeutic compositions for use in this invention can be in the
form of a pyrogen-free, parenterally acceptable, aqueous solution
comprising the desired FGF21 protein variant in a pharmaceutically
acceptable vehicle. A particularly suitable vehicle for parenteral
injection is sterile distilled water in which an FGF21 protein
variant is formulated as a sterile, isotonic solution, properly
preserved. Yet another preparation can involve the formulation of
the desired molecule with an agent, such as injectable
microspheres, bio-erodible particles, polymeric compounds (such as
polylactic acid or polyglycolic acid), beads, or liposomes, that
provides for the controlled or sustained release of the product
which can then be delivered via a depot injection. Hyaluronic acid
can also be used, and this can have the effect of promoting
sustained duration in the circulation. Other suitable means for the
introduction of the desired molecule include implantable drug
delivery devices.
[0213] In one embodiment, a pharmaceutical composition can be
formulated for inhalation. For example, an FGF21 protein variant
can be formulated as a dry powder for inhalation. FGF21 protein
variant inhalation solutions can also be formulated with a
propellant for aerosol delivery. In yet another embodiment,
solutions can be nebulized. Pulmonary administration is further
described in International Publication No. WO 94/20069, which
describes the pulmonary delivery of chemically modified
proteins.
[0214] It is also contemplated that certain formulations can be
administered orally. In one embodiment of the present invention,
FGF21 protein variants that are administered in this fashion can be
formulated with or without those carriers customarily used in the
compounding of solid dosage forms such as tablets and capsules. For
example, a capsule can be designed to release the active portion of
the formulation at the point in the gastrointestinal tract when
bioavailability is maximized and pre-systemic degradation is
minimized. Additional agents can be included to facilitate
absorption of the FGF21 protein variant. Diluents, flavorings, low
melting point waxes, vegetable oils, lubricants, suspending agents,
tablet disintegrating agents, and binders can also be employed.
[0215] Another pharmaceutical composition can involve an effective
quantity of FGF21 protein variants in a mixture with non-toxic
excipients that are suitable for the manufacture of tablets. By
dissolving the tablets in sterile water, or another appropriate
vehicle, solutions can be prepared in unit-dose form. Suitable
excipients include, but are not limited to, inert diluents, such as
calcium carbonate, sodium carbonate or bicarbonate, lactose, or
calcium phosphate; or binding agents, such as starch, gelatin, or
acacia; or lubricating agents such as magnesium stearate, stearic
acid, or talc.
[0216] Additional FGF21 protein variant pharmaceutical compositions
will be evident to those skilled in the art, including formulations
involving FGF21 protein variants in sustained- or
controlled-delivery formulations. Techniques for formulating a
variety of other sustained- or controlled-delivery means, such as
liposome carriers, bio-erodible microparticles or porous beads and
depot injections, are also known to those skilled in the art (see,
e.g., International Publication No. WO 93/15722, which describes
the controlled release of porous polymeric microparticles for the
delivery of pharmaceutical compositions, and Wischke &
Schwendeman, 2008, Int. J Pharm. 364: 298-327, and Freiberg &
Zhu, 2004, Int. J Pharm. 282: 1-18, which discuss
microsphere/microparticle preparation and use).
[0217] Additional examples of sustained-release preparations
include semipermeable polymer matrices in the form of shaped
articles, e.g. films, or microcapsules. Sustained release matrices
can include polyesters, hydrogels, polylactides (U.S. Pat. No.
3,773,919 and European Patent No. 0 058 481), copolymers of
L-glutamic acid and gamma ethyl-L-glutamate (Sidman et al., 1983,
Biopolymers 22: 547-56), poly(2-hydroxyethyl-methacrylate) (Langer
et al., 1981, J. Biomed. Mater. Res. 15: 167-277 and Langer, 1982,
Chem. Tech. 12: 98-105), ethylene vinyl acetate (Langer et al.,
supra) or poly-D-3-hydroxybutyric acid (European Patent No. 0 133
988). Sustained-release compositions can also include liposomes,
which can be prepared by any of several methods known in the art.
See, e.g., Epstein et al., 1985, Proc. Natl. Acad. Sci. U.S.A. 82:
3688-92; and European Patent Nos. 0 036 676, 0 088 046, and 0 143
949.
[0218] The FGF21 protein variant pharmaceutical composition to be
used for in vivo administration typically must be sterile. This can
be accomplished by filtration through sterile filtration membranes.
Where the composition is lyophilized, sterilization using this
method can be conducted either prior to, or following,
lyophilization and reconstitution. The composition for parenteral
administration can be stored in lyophilized form or in a solution.
In addition, parenteral compositions generally are placed into a
container having a sterile access port, for example, an intravenous
solution bag or vial having a stopper pierceable by a hypodermic
injection needle.
[0219] Once the pharmaceutical composition has been formulated, it
can be stored in sterile vials as a solution, suspension, gel,
emulsion, solid, or as a dehydrated or lyophilized powder. Such
formulations can be stored either in a ready-to-use form or in a
form (e.g., lyophilized) requiring reconstitution prior to
administration.
[0220] In a specific embodiment, the present invention is directed
to kits for producing a single-dose administration unit. The kits
can each contain both a first container having a dried protein and
a second container having an aqueous formulation. Also included
within the scope of this invention are kits containing single and
multi-chambered pre-filled syringes (e.g., liquid syringes and
lyosyringes).
[0221] The effective amount of an FGF21 protein variant
pharmaceutical composition to be employed therapeutically will
depend, for example, upon the therapeutic context and objectives.
One skilled in the art will appreciate that the appropriate dosage
levels for treatment will thus vary depending, in part, upon the
molecule delivered, the indication for which the FGF21 protein
variant is being used, the route of administration, and the size
(body weight, body surface, or organ size) and condition (the age
and general health) of the patient. Accordingly, the clinician can
titer the dosage and modify the route of administration to obtain
the optimal therapeutic effect. A typical dosage can range from
about 0.1 .mu.g/kg to up to about 100 mg/kg or more, depending on
the factors mentioned above. In other embodiments, the dosage can
range from 0.1 .mu.g/kg up to about 100 mg/kg; or 1 .mu.g/kg up to
about 100 mg/kg; or 5 .mu.g/kg, 10 .mu.g/kg, 15 .mu.g/kg, 20
.mu.g/kg, 25 .mu.g/kg, 30 .mu.g/kg, 35 .mu.g/kg, 40 .mu.g/kg, 45
.mu.g/kg, 50 .mu.g/kg, 55 .mu.g/kg, 60 .mu.g/kg, 65 .mu.g/kg, 70
.mu.g/kg, 75 .mu.g/kg, up to about 100 mg/kg. In yet other
embodiments, the dosage can be 50 .mu.g/kg, 100 .mu.g/kg, 150
.mu.g/kg, 200 .mu.g/kg, 250 .mu.g/kg, 300 .mu.g/kg, 350 .mu.g/kg,
400 .mu.g/kg, 450 .mu.g/kg, 500 .mu.g/kg, 550 .mu.g/kg, 600
.mu.g/kg, 650 .mu.g/kg, 700 .mu.g/kg, 750 .mu.g/kg, 800 .mu.g/kg,
850 .mu.g/kg, 900 .mu.g/kg, 950 .mu.g/kg, 100 .mu.g/kg, 200
.mu.g/kg, 300 .mu.g/kg, 400 .mu.g/kg, 500 .mu.g/kg, 600 .mu.g/kg,
700 .mu.g/kg, 800 .mu.g/kg, 900 .mu.g/kg, 1000 .mu.g/kg, 2000
.mu.g/kg, 3000 .mu.g/kg, 4000 .mu.g/kg, 5000 .mu.g/kg, 6000
.mu.g/kg, 7000 .mu.g/kg, 8000 .mu.g/kg, 9000 .mu.g/kg or 10
mg/kg.
[0222] The frequency of dosing will depend upon the pharmacokinetic
parameters of the FGF21 protein variant in the formulation being
used. Typically, a clinician will administer the composition until
a dosage is reached that achieves the desired effect. The
composition can therefore be administered as a single dose, as two
or more doses (which may or may not contain the same amount of the
desired molecule) over time, or as a continuous infusion via an
implantation device or catheter. Further refinement of the
appropriate dosage is routinely made by those of ordinary skill in
the art and is within the ambit of tasks routinely performed by
them. Appropriate dosages can be ascertained through use of
appropriate dose-response data.
[0223] The route of administration of the pharmaceutical
composition is in accord with known methods, e.g., orally; through
injection by intravenous, intraperitoneal, intracerebral
(intraparenchymal), intracerebroventricular, intramuscular,
intraocular, intraarterial, intraportal, or intralesional routes;
by sustained release systems (which may also be injected); or by
implantation devices. Where desired, the compositions can be
administered by bolus injection or continuously by infusion, or by
implantation device.
[0224] Alternatively or additionally, the composition can be
administered locally via implantation of a membrane, sponge, or
other appropriate material onto which the desired molecule has been
absorbed or encapsulated. Where an implantation device is used, the
device can be implanted into any suitable tissue or organ, and
delivery of the desired molecule can be via diffusion,
timed-release bolus, or continuous administration.
Therapeutic Uses of FGF21 Polypeptide Mutants
[0225] FGF21 protein variants can be used to treat, diagnose,
ameliorate, or prevent a number of diseases, disorders, or
conditions, including, but not limited to metabolic disorders. In
one embodiment, the metabolic disorder to be treated is diabetes,
e.g., type 2 diabetes mellitus. In another embodiment, the
metabolic disorder is obesity. Other embodiments include metabolic
conditions or disorders such as type 1 diabetes mellitus,
pancreatitis, dyslipidemia, nonalcoholic steatohepatitis (NASH),
insulin resistance, hyperinsulinemia, glucose intolerance,
hyperglycemia, metabolic syndrome, hypertension, cardiovascular
disease, atherosclerosis, peripheral arterial disease, stroke,
heart failure, coronary heart disease, kidney disease, diabetic
complications, neuropathy, gastroparesis and other metabolic
disorders.
[0226] In application, a disorder or condition such as type 1 or
type 2 diabetes mellitus or obesity can be treated by administering
an FGF21 protein variant as described herein to a patient in need
thereof in the amount of a therapeutically effective dose. The
administration can be performed as described herein, such as by IV
injection, intraperitoneal injection, intramuscular injection, or
orally in the form of a tablet or liquid formation. In most
situations, a desired dosage can be determined by a clinician, as
described herein, and can represent a therapeutically effective
dose of the FGF21 mutant polypeptide. It will be apparent to those
of skill in the art that a therapeutically effective dose of FGF21
mutant polypeptide will depend, inter alia, upon the administration
schedule, the unit dose of antigen administered, whether the
nucleic acid molecule or polypeptide is administered in combination
with other therapeutic agents, the immune status and the health of
the recipient. The term "therapeutically effective dose," as used
herein, means that amount of FGF21 mutant polypeptide that elicits
the biological or medicinal response in a tissue system, animal, or
human being sought by a researcher, medical doctor, or other
clinician, which includes alleviation of the symptoms of the
disease or disorder being treated.
Pharmaceutical Compositions
[0227] The present invention also provides pharmaceutical
compositions comprising one or more of the FGF21 variants or
mutants described herein and a pharmaceutically acceptable carrier.
In some embodiments the pharmaceutical compositions are prepared as
injectables, either as liquid solutions or suspensions; solid forms
suitable for solution in, or suspension in, liquid vehicles prior
to injection can also be prepared. Liposomes are included within
the definition of a pharmaceutically acceptable carrier.
Pharmaceutically acceptable salts can also be present in the
pharmaceutical composition, e.g., mineral acid salts such as
hydrochlorides, hydrobromides, phosphates, sulfates, and the like;
and the salts of organic acids such as acetates, propionates,
malonates, benzoates, and the like. A thorough discussion of
pharmaceutically acceptable excipients is available in Remington:
The Science and Practice of Pharmacy (1995) Alfonso Gennaro,
Lippincott, Williams, & Wilkins.
Fusion Proteins and FGF21-Derived Peptidic Compounds
[0228] In another embodiment, the FGF21 variants of the present
invention can be made into a fusion protein or peptidic compound
derived from the the FGF21 variants amino acid sequences. Such
fusion proteins and peptidic compounds can be made using standard
techniques known in the art. For example, peptidic compounds can be
made by chemical synthesis using standard peptide synthesis
techniques and then introduced into cells by a variety of means
known in the art for introducing peptides into cells (e.g.,
liposome and the like).
[0229] The in vivo half-life of the fusion protein or peptidic
compounds of the invention can be improved by making peptide
modifications, such as the addition of N-linked glycosylation sites
into FGF21 variants, or conjugating FGF21 variants to poly(ethylene
glycol)(PEG; pegylation), e.g., via lysine-monopegylation or
cysteine-monopegylation. Such techniques have proven to be
beneficial in prolonging the half-life of therapeutic protein
drugs. It is expected that pegylation of the FGF21 variants of the
invention may result in similar pharmaceutical advantages.
[0230] In addition, pegylation can be achieved in any part of a
polypeptide of the invention by the introduction of a nonnatural
amino acid. Certain nonnatural amino acids can be introduced by the
technology described in Deiters et al., J Am Chem Soc
125:11782-11783, 2003; Wang and Schultz, Science 301:964-967, 2003;
Wang et al., Science 292:498-500, 2001; Zhang et al., Science
303:371-373, 2004 or in U.S. Pat. No. 7,083,970. Briefly, some of
these expression systems involve site-directed mutagenesis to
introduce a nonsense codon, such as an amber TAG, into the open
reading frame encoding a polypeptide of the invention. Such
expression vectors are then introduced into a host that can utilize
a tRNA specific for the introduced nonsense codon and charged with
the nonnatural amino acid of choice. Particular nonnatural amino
acids that are beneficial for purpose of conjugating moieties to
the polypeptides of the invention include those with acetylene and
azido side chains. The FGF21 variants containing these novel amino
acids can then be pegylated at these chosen sites in the
protein.
EXAMPLES
Example 1
Preparation and PEGylation of FGF21 Variant Proteins
[0231] Expression constructs for FGF21 variants: The FGF21 variants
were cloned into the modified E. coli expression vector pET30a,
described by Achmuller et al. (2007) (Nature Methods 4:1037-1043),
to generate in-frame fusions to a hexa-histidine tag followed by
the N.sup.pro-EDDIE tag at the N-terminus of FGF21 (aa 33-209).
[0232] Expression and Purification of FGF21 Variants:
[0233] The pET30a-His-N.sup.pro-EDDIE-FGF21 expression plasmid was
transformed into E. coli BL21 Star (DE3) competent cells
(Invitrogen). Overnight growth from a single colony of freshly
transformed cells was carried out in 50 mL of Terrific Broth (TB)
containing 50 .mu.g/mL of kanamycin at 37.degree. C. The
pre-culture was transferred into 1 L of TB medium with kanamycin
and cultured in baffled flasks at 37.degree. C. with shaking at 250
rpm. After 6 hour of culture, expression of FGF21 was induced by
the addition of IPTG at a final concentration of 1 mM, and the
cultures were grown overnight at 37.degree. C. The cells were then
harvested and resuspended into 50 mL of ice-cold lysis buffer; 50
mM Tris-HCl, pH 8, 150 mM NaCl, 1 mM EDTA, followed by lysis using
a Microfluidizer.TM..
[0234] Inclusion bodies (IBs) were precipitated by centrifugation
at 30,000.times.g for 1 hour at 4.degree. C. The IBs were washed
with 50 mM Tris-HCl, pH 8, 150 mM NaCl and then dissolved into 30
mL of dissolving buffer; 10 mM Tris-HCl, pH8, 100 mM
NaH.sub.2PO.sub.4, 6 M GnHCl. The dissolved IBs were clarified by
centrifugation at 30,000.times.g for 1 hour at 25.degree. C. The IB
solution was loaded onto a 5 mL column of Ni-NTA high performance
resin (GE Healthcare) equilibrated with the dissolving buffer.
Proteins bound to the resin were eluted by decreasing the pH to
4.5. The eluate was conditioned by adjusting pH and adding
dithiothreitol (DTT) at a concentration of 20 mM. The conditioned
eluate was slowly diluted into 1 L of refolding buffer; 50 mM
Tris-HCl, pH 8, 0.5 M arginine, 20 mM DTT, followed by incubation
for 2 days at 4.degree. C. The diluted sample was concentrated and
buffer-exchanged into 20 mM Tris-HCl, pH 9 using an ultrafiltration
method. The concentrated sample was loaded onto a 10 mL column of Q
sepharose fast flow resin (GE Healthcare) equilibrated with 20 mM
Tri-HCl (pH9).
[0235] After washing the resin with the equilibration buffer,
proteins bound to the resin were eluted with 20 mM Tris-HCl, pH 9,
500 mM NaCl. To remove the cleaved off His-N.sup.pro fusion
fragment and any uncleaved fusion protein from the refolded FGF21
protein, the eluate was loaded onto a 5 mL column of Ni-NTA high
performance resin equilibrated with 20 mM Tris, pH 8.0, 50 mM
imidazole, and the flow-through fraction containing FGF21 was
collected. To reduce endotoxin levels, the FGF21 fraction was
treated with an EndoTrap HD resin (Hyglos) equilibrated with 10 mM
Tris, pH 8, 50 mM imidazole, 500 mM NaCl, 1 mM CaCl.sub.2. The
low-endotoxin sample was dialyzed against PBS and then sterilized
with a 0.22 .mu.m filter. The purified FGF21 protein was
snap-frozen in liquid nitrogen and stored at -80.degree. C. Protein
concentration was determined by absorbance at 280 nm using 9362 M-1
cm-1 as the molar extinction coefficient for FGF21. Protein purity
and integrity were determined by HPLC, SDS-PAGE and liquid
chromatography-mass spectrometry.
[0236] Cysteine PEGylation of FGF21 Variants:
[0237] hsFGF21 (R154C) variants have tendency to dimerize via the
engineered cysteine; therefore, prior to PEGylation the protein
solution (typically 5 mg/ml in Tris buffer) was mildly reduced with
5 mM mercaptoethylamine for 30 minutes on ice and immediately
desalted in 20 mM Tris, pH 7. The freshly reduced protein
(typically 3 mg/ml) was then immediately PEGylated with 1.5
equivalent of 40 kDa branched maleimido-PEG reagent (NOF catalog #
GL2-400MA from the Sunbright series) for 3 hours on ice. The
PEGylated protein was finally purified by anion exchange
chromatography (MonoQ) with overall yields of about 25%.
[0238] N-Terminal PEGylation of FGF21 Variants:
[0239] The final concentration of the FGF21 variant and the 40 kDa
branched PEG reagent (NOF catalog # GL2-400AL3 from the Sunbright
series; 3:1 molar ratio to FGF21) was 3-4 mg/mL and 9-12 mg/mL,
respectively. The buffer was 50 mM sodium acetate, pH 6.0, 25 mM
sodium chloride and 40 mM sodium cyanoborohydride. The reaction
mixtures were tumbled gently at 4.degree. C. for 44 hr and the
reaction conversion was monitored over several time points.
Approximate conversion at 20 hr was 50% and at 44 hr was 70%.
Example 2
Generation of Human FGF21 Disulfide Variants
[0240] Cloning Library:
[0241] The vector pGAPZalphaA (Invitrogen, Carlsbad, Calif.) was
modified by adding a .beta.-lactamase expression cassette in the
vector's unique BamHI site. The .beta.-lactamase expression
cassette was generated as described by Hribar, et al (2008)
BioTechniques 44:477-84. The human FGF21 cDNA encoding amino acids
33 to 209 was cloned into the modified pGAPZ alphaA vector after
the glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter in
frame with N-terminal sequences including an alpha mating factor
secretion signal sequence, a six histidine affinity purification
tag, and a Tobacco Etch Virus (TEV) protease recognition sequence.
A library of hFGF21 constructs was generated with each construct
having Cys103 and Cys121 that are in the wild-type sequence as well
as two wild-type amino acids that were mutated to cysteines. The
library was made by generating PCR fragments of the hFGF21 amino
acid 33-209 coding region with primers that encoded a cysteine in
place of the wild-type amino acid. The PCR fragments were designed
so that they shared sixteen base pairs of identical sequence with
each other or the linearized modified pGAPZalphaA vector so that
they could be joined using the In-Fusion enzyme (Takara Bio Co
USA). Each construct was sequence verified before it was used for
yeast strain generation.
[0242] Generating Yeast Strains:
[0243] The Pichia pastoris yeast strain SMD1168H (Invitrogen) was
modified by disrupting the YPS1 gene as described by Yao et al
(2009) J Biotechnol. January 15; 139(2):131-6. The modified strain
(SMD1168H delta YPS1) had resistance to 300 .mu.g/mL blasticidin.
About 5-10 .mu.g of sequence verified plasmid DNA was digested with
Avr II and was mixed with SMD1168H delta YPS1 cells that were
prepared according to Invitrogen's manual for pGAPZ.alpha.-A. The
cells mixed with a linearized plasmid in a 0.2 cm cuvette (Bio-Rad,
Hercules, Calif.). The cuvette with the cells and linearized
plasmid was incubated on ice for 5 min. The cuvette was pulsed
using a Gene Pulser-II (Bio-Rad) with voltage set to 1.5 kV, the
capacitor set to 25 .mu.F, and the pulse controller set to 400
Ohms.
[0244] Immediately after the pulse, 1 mL of ice-cold 1 M sorbitol
was added to the cuvette, and its contents were transferred to a
sterile 15 mL tube. The tube was incubated at 30.degree. C. without
shaking for 2 h. The electroporated cells were spread on YPDS (1%
yeast extract, 2% peptone, 2% dextrose, 1M sorbitol, and 2% agar)
plates containing 100 .mu.g/mL zeocin (zeo). The plates were
incubated from 3-10 days at 30.degree. C. until colonies formed.
Twenty four colonies of each construct were picked and used to
inoculate 1 mL YPD growth medium containing 100 .mu.g/mL zeocin in
a 96-well deep-well plate. The plate was incubated overnight at
30.degree. C. in a shaker (Sheldon Manufacturing, Cornelius, Oreg.)
at 900 RPM. A 10 .mu.L aliquot of each culture was removed and
diluted into 990 .mu.L of PBS (pH 7.4) in a 96-well deep-well
plate.
[0245] For colorimetric determination of .beta.-lactamase activity,
50 .mu.L of 1:100 diluted culture was transferred into a 96-well
microtiter plate. Nitrocefin (1 mg; EMD Chemicals, Gibbstown, N.J.)
was dissolved in 100 .mu.L DMSO and diluted into 1.9 mL PBS to
obtain a working solution of 1 mM. The nitrocefin working solution
(50 uL) was added into each well for a final concentration of 500
uM. After the addition of nitrocefin, the plate was incubated at
room temperature (RT) in the dark for 5 min. Absorbance at 492 nm
was measured on a Spectramax Plus microtiter plate reader
(Molecular Devices, Sunnyvale, Calif.) to determine the
.beta.-lactamase activity. Glycerol stocks of the two strains with
the highest .beta.-lactamase activity for each construct were made
and stored at -80.degree. C.
[0246] Small Scale Expression and Purification of hFGF21 Disulfide
Variants:
[0247] The hFGF21 disulfide variant glycerol stocks from the two
strains with the highest .beta.-lactamase specific activity for
each construct were used to inoculate 1 mL of Buffered Complex
Glucose Medium (1% yeast extract, 2% peptone, 100 mM potassium
phosphate, pH 6.0, 1.34% YNB, 4.times.10-5% biotin, 2% glucose, and
2% casamino acids) in 96-well deep-well plates. The cultures were
grown at 30.degree. C. with shaking at 900 RPM (Sheldon
Manufacturing, Cornelius, Oreg.) for approximately 48 h until the
cell growth reached saturation. An aliquot of the saturated culture
(25 uL) was used to inoculate 5 mL of Buffered Complex Glucose
Medium in 24-well deep-well plates. The plates were incubated
overnight at 30.degree. C. in a shaker (Sheldon Manufacturing,
Cornelius, Oreg.) at 350 RPM. After about 24 h the plates were
centrifuged at 2500.times.g for 15 min. The media was aspirated off
of the pelleted cells and added to an Amicon ultra-15 centrifugal
filter unit (Millipore, Billerica, Mass.) with a 10 kDa cutoff
membrane. Ten mL of PBS, pH 7.4 containing 10 mM imidazole and
1.times. Halt EDTA-free protease inhibitor cocktail (Thermo,
Rockford, Ill.) was added to the media in the concentrator to bring
the total volume to 15 mL.
[0248] The filter unit was centrifuged at 4000 RMP in a Sorvall
Legend RT plus centrifuge (Thermo) for 30 min. The concentrator
flow through was discarded and about 13 mL of PBS, pH 7.4 was added
to the concentrated media. The filter unit was centrifuged again at
4000 RMP for 30 min. The concentrated buffer exchanged sample was
loaded onto a nickel-nitrilotriacetic acid (Ni-NTA) spin column
(Qiagen, Valencia, Calif.). The column was centrifuged at
270.times.g (1600 rpm) in a Sorvall Legend Micro 21R centrifuge
(Thermo) for 5 min, and then washed two times with 600 uL of PBS,
pH 7.4 containing 10 mM imidazole. The 6 HIS tagged hFGF21 variants
were eluted with 200 uL of PBS, pH 7.4 containing 300 mM
imidazole.
[0249] Medium Scale Expression and Purification of hFGF21 Disulfide
Variants:
[0250] The hFGF21 disulfide variant glycerol stocks from the
strains that expressed hFGF21 disulfide variants with the highest
activity, when tested in the two point pERK cellular assay (10 and
100 nM), were used to inoculate 5 mL of Buffered Complex Glucose
Medium (1% yeast extract, 2% peptone, 100 mM potassium phosphate,
pH 6.0, 1.34% YNB, 4.times.10-5% biotin, 2% glucose, and 2%
casamino acids) containing 100 .mu.g/mL zeocin in a 50 mL sterile
tube. The cultures were grown at 30.degree. C. with shaking at 250
RPM for approximately 48 h until the cell growth reached
saturation. An aliquot of the saturated culture (50 uL) was used to
inoculate 100 mL of Buffered Complex Glucose Medium in a 250 mL
Ultra Yield flask (Thomson Instrument Co, Oceanside, Calif.). The
flasks were incubated overnight at 30.degree. C. in a shaker at 300
RPM. After about 24 h the cells were centrifuged at 2500.times.g
for 15 min. The media (80 mL) was aspirated off of the pelleted
cells and added to a Centricon-70 centrifugal filter unit
(Millipore, Billerica, Mass.) with a 10 kDa cutoff membrane. The
filter unit was centrifuged at 4000 RMP in a Sorvall Legend RT plus
centrifuge (Thermo) for 30 min. The remaining clarified media
(about 20 mL) was added to a Centricon-70 centrifugal filter and
the total volume in the filter was increased to 80 mL by adding
PBS, pH7.4 containing 10 mM imidazole and 1.times.EDTA-free Halt
protease inhibitor cocktail. The filter unit was centrifuged again
at 4000 rpm for 30 min. The volume of the concentrated media in the
filter unit was increased to 80 mL by adding PBS, pH 7.4 containing
10 mM. The filter unit was centrifuged again at 4000 rpm for 30
min.
[0251] The concentrated buffer exchanged sample was loaded onto a 1
mL His-Gravitrap column (GE Lifesciences, Piscataway, N.J.) that
was pre-equilibrated with PBS, pH 7.4 containing 10 mM imidazole.
The column was washed with 10 mL of PBS, pH 7.4 containing 20 mM
imidazole. The 6HIS tagged hFGF21 variants were eluted with 2.5 mL
of PBS, pH 7.4 containing 300 mM imidazole. The 2.5 mL of elution
buffer was applied to a 10 mL PD-10 desalting column that was
pre-equilibrated with 25 mL of PBS, pH 7.4 containing 10 mM
imidazole. The 6HIS tagged disulfide variants were eluted from the
desalting column with 3.5 mL of PBS, pH 7.4 containing 10 mM
imidazole.
[0252] The 6HIS tag was removed from the desalted affinity-purified
hFGF21 disulfide variants by adding ProTEV protease (250 units;
Promega, Madison, Wis.) and incubating the sample at room
temperature for 2 h and overnight at 4.degree. C. The tag-cleaved
hFGF21 disulfide variants loaded onto a 1 mL His-Gravitrap column
that was pre-equilibrated with PBS, pH 7.4 containing 10 mM
imidazole. The flow-through containing the tag-cleaved hFGF21
disulfide variants was collected. The His-Gravitrap column was
washed with 5 mL with PBS, pH 7.4 containing 10 mM imidazole. The
column flow through was collected and added to the flow through
from the tag cleavage reaction. The combined flow-through samples
(about 8.5 mL) were concentrated to about 1 mL with Amicon ultra-15
centrifugal filter with a 10 kDa cutoff membranes. The concentrated
hFGF21 disulfide variants were frozen at -80.degree. C. until being
assayed in the pERK cellular assay.
Example 3
Measuring 2-Deoxyglucose (2-DOG) Uptake
[0253] More recently, FGF21 has been shown to stimulate
glucose-uptake in mouse 3T3-L1 adipocytes in the presence and
absence of insulin, and to decrease fed and fasting blood glucose,
triglycerides, and glucagon levels in ob/ob and db/db mice and 8
week old ZDF rats in a dose-dependent manner, thus, providing the
basis for the use of FGF21 as a therapy for treating diabetes and
obesity (see, e.g., patent publication WO03/011213, and
Kharitonenkov et al., (2005) Jour. of Clinical Invest.
115:1627-1635). Also, FGF21 was observed to stimulate tyrosine
phosphorylation of FGFR-1 and FGFR-2 in 3T3-L1 adipocytes.
[0254] 3T3-L1 fibroblasts were purchased from ATCC (Catalog #
CL173). The cells were grown to confluency in 150 cm petri-dish and
were maintained in DMEM with high glucose (Invitrogen #11995065)
supplemented with 10% Fetal Bovine Serum and 1%
penicillin-streptomycin for an additional 4 days. Cells were then
differentiated in the above media supplemented with 4 .mu.g/ml
insulin (Sigma Catalog #1-5500), 115 .mu.g/ml IBMX (Sigma Catalog
#15879) and 0.0975 .mu.g/ml dexamethasone (Sigma Catalog # D1756)
for 3 days after which the differentiation media was replaced with
complete DMEM. One plate of differentiated 3T3-L1 adipocytes were
seeded on four 96-well plates the day after medium replacement.
[0255] The adipocytes were then treated with FGF21-WT and FGF21
variants (see Table 2 for list of variants; 30 pM to 100 nM is the
typical concentration range used) overnight in complete medium. The
adipocytes treated with FGF21 samples are serum starved in 50 .mu.l
per well KRH buffer (0.75% Na Cl; 0.038% KCl; 0.0196% CaCl2; 0.032%
MgSO4; 0.025M Hepes, pH 7.5; 0.5% BSA; 2 mM sodium pyruvate) for 2
hours. The wells for blank were added with 1 .mu.l (final
concentration 5 .mu.g/ml) cytochalasin B for 15 min. [3H]-2-DOG
(20.6 mci/mmol, 1 mci/ml), which was diluted 1:20 in 5.1 mM cold
2-DOG, 1 .mu.l diluted 2-DOG per well was added to the cells and
incubated for 5 min. The cells were washed with 100 .mu.l/well KRH
buffer three times. 40 .mu.l/well 1% SDS were added to cells and
the cells were shaken for at least 10 min. 200 .mu.l/well
scintillation fluid were added and the plates were shaken overnight
and read in beta-microplate reader. The values obtained from an
entire column/row which were treated with cytochalasin B was
averaged and subtracted from all other values. The data were
analyzed by GraphPad prism software, the results of which are
summarized in Table 2.
TABLE-US-00006 TABLE 2 Summary of EC50 values and relative
potencies (Fold-WT) of FGF21 WT and FGF21 variants in the 3T3-L1
adipocyte 2-deoxy-glucose (2-DOG) uptake assay. EC50 Fold- Variant
ID Standardized name (nM) WT (1) N V5 hFGF21(33-209)-V5 3.3 1.5 1
V7 hFGF21(33-209)-V7 3.9 1.8 1 V8 hFGF21(33-209)-V8 1.8 0.8 1 V9
hFGF21(33-209)-V9 3.1 1.0 1 V10 hFGF21(33-209)-V10 2.8 1.3 1 V11
hFGF21(33-209)-V11 3.4 1.6 1 V12 hFGF21(33-209)-V12 3.2 1.5 1 V13
hFGF21(33-209)-V13 2.9 1.3 1 V14 hFGF21(33-209)-V14-pool1 0.56 1.0
7 V14-N130D hFGF21(33-209)-V14-pool2 0.60 1.5 4 V14-N-PEG
hFGF21(33-209)-V14pool1-N-40 kDa bPEG-AL 5.7 8.8 3 V14-R154C, L174P
hFGF21(33-209)-V14-R154C, L174P 0.58 1.1 6 V14-L174P, R154C-PEG
hFGF21(33-209)-V14-L174P, R154C-40 kDa bPEG-MA 4.3 8.9 6 V15
hFGF21(33-209)-V15 3.2 1.5 1 V16 hFGF21(33-209)-V16 3.1 1.4 1 V18
hFGF21(33-209)-V18 2.6 0.8 1 V53 hFGF21(33-209)-V53 0.78 1.4 3 V54
hFGF21(33-209)-V54 2.5 1.1 1 V55 hFGF21(33-209)-V55 3.7 1.7 1 V56
hFGF21(33-209)-V56 3.0 1.3 1 V57 hFGF21(33-209)-V57 0.60 0.69 4 V58
hFGF21(33-209)-V58 0.31 1.1 1 V59 hFGF21(33-209)-V59 0.67 0.69 3
V60 hFGF21(33-209)-V60 1.0 0.5 1 V61 hFGF21(33-209)-V61 1.9 0.9 1
V62 hFGF21(33-209)-V62 1.5 0.7 1 V63 hFGF21(33-209)-V63 1.9 0.9 1
V64 hFGF21(33-209)-V64 0.56 0.3 1 V73 hFGF21(33-209)-V73 1.1 2.8 2
V73-N-PEG hFGF21(33-209)-V73-N-40 kDa bPEG-AL 0.89 1.8 2 V76
hFGF21(33-209)-V76 0.77 1.0 1 V76-154C-PEG
hFGF21(33-209)-V76-154C-40 kDa bPEG-MA 1.8 4.5 2 V79
hFGF21(33-209)-V79 2.3 2.3 1 V80 hFGF21(33-209)-V80 0.66 0.7 1 V81
hFGF21(33-209)-V81 0.83 0.8 1 V82 hFGF21(33-209)-V82 10 2.0 1 V83
hFGF21(33-209)-V83 7.4 1.5 1 V84 hFGF21(33-209)-V84 1.6 2.8 3 V85
hFGF21(33-209)-V85 1.1 1.5 1 WT hFGF21(33-209)-WT-CH 0.99 1.0 20
WT-L174P hFGF21(33-209)-WT-AM 2.2 1.5 3 WT-N-PEG
hFGF21(33-209)-WT-N-40 kDa bPEG-AL 1.1 3.1 2 WT-R154C
hFGF21(33-209)-WT-R154C 0.42 1.2 2 WT-R154C-PEG
hFGF21(33-209)-WT-R154C-40 kDa bPEG-MA 1.4 3.3 2 (1) "Fold-WT" is
ratio of EC50 value of the FGF21 variant to FGF21-WT carried out
"head to head" in the same experiment.
Example 4
pERK in Cell Western (ICW) Assay
[0256] HEK293 cells stably transfected with human .beta.-klotho
were cultured in DMEM high glucose, 10% FBS, 1% PS and 600 ng/ml
G418 are seeded in poly-D-lysine coated 96-well plates (BD
bioscience, 356640) at 30,000 cells per well overnight. The cells
were serum starved in DMEM high glucose, 0.5% BSA and 10 mM HEPES
for 4 hours. WT FGF21 and the FGF21 variants (see Table 3 for list
of variants) were diluted to various concentrations (100 pM to 300
nM is the typical concentration range used) in starvation medium.
The cells were stimulated with FGF21 for 10 min. Following FGF21
stimulation, the media was aspirated from the wells and the cells
were washed once with 100 .mu.l cold PBS and then fixed with 100
.mu.l of 4% formaldehyde for 15 mins at RT and followed by an
additional 10 mins incubation with 100 .mu.l ice-cold methanol.
[0257] After fixation, the cells were washed with 0.3% Triton X-100
in PBS four times, 5 mins each. 150 .mu.l Odyssey Blocking Buffer
was added to the permeabilized cells at room temperature for 1.5
hours. Phospho-ERK (pERK) antibody was diluted to a concentration
of 0.17 .mu.g/ml (1:200 dilution, or the dilutions indicated), and
total-ERK (tERK) antibody was diluted to a concentration of 2.2
.mu.g/ml (1:200 dilution, or the dilutions indicated) in Odyssey
Blocking Buffer. 50 .mu.l was added to every well, omitting one
column which was only treated with secondary antibody to normalize
for background. The plate was covered with the wet paper tower and
lid to prevent evaporation and then incubated at 4.degree. C.
overnight.
[0258] Afterwards, the primary antibody was aspirated and the cells
were washed four times with 0.3% Tween 20 in PBS for 5 mins each.
During the washing, the secondary antibody reaction mixture was
prepared in Odyssey Blocking Buffer containing 1:1000-diluted (or
the dilutions indicated) goat anti-mouse Alexa 680 and
1:1000-diluted (or the dilutions indicated) IRDye800 goat
anti-rabbit antibody. Once the washing was completed, 40 .mu.l of
the reaction mixture was added to each well. Plates were covered
with black lid to protect the secondary antibody from light, and
plates were incubated at RT for 1 hr on a shaker. Finally, the
cells were washed again four times with 0.3% Tween 20 in PBS for 5
min each and then scanned on the LI-COR Bioscience Odyssey Infrared
Imaging System (Li-Cor Biosciences, Lincoln, Nebr.) in the 700 nm
(red) and 800 nm (green) channels. Alexa 680 stained the tERK with
far-red fluorescence (emission wavelength 668 nm), while IRDye800
stained the pERK with green fluorescence (emission wavelength 800
nm). To eliminate the fluorescent background, the values obtained
from an entire column/row which was treated with only secondary
antibody was averaged and subtracted from all other values obtained
from the plate. For normalization of the amount of pERK present in
each sample, the values for pERK in each well was divided by the
values of tERK. The data were analyzed by GraphPad prism software,
the results of which are summarized in Table 3.
TABLE-US-00007 TABLE 3 Summary of EC50 values and relative
potencies (Fold-WT) of FGF21 WT and FGF21 variants in the pERK
cellular assay using HEK293 cells stably transfected with human
.beta.-klotho. EC50 Fold- Variant ID Standardized Name (nM) WT (1)
N V5 hFGF21(33-209)-V5 26 9.3 1 V7 hFGF21(33-209)-V7 19 6.8 1 V8
hFGF21(33-209)-V8 14 5.0 1 V9 hFGF21(33-209)-V9 13 2.4 1 V10
hFGF21(33-209)-V10 18 3.3 1 V11 hFGF21(33-209)-V11 28 18 1 V12
hFGF21(33-209)-V12 14 5.0 1 V13 hFGF21(33-209)-V13 11 4.0 1 V14
hFGF21(33-209)-V14-pool1 6.7 1.4 6 V14-N130D
hFGF21(33-209)-V14-pool2 5.3 1.4 3 V14-N-PEG hFGF21(33-209)-V14pool
1-N-40 kDa bPEG-AL 107 22 5 V14-R154C, L174P
hFGF21(33-209)-V14-R154C, L174P 6.7 1.0 3 V14-L174P, R154C-PEG
hFGF21(33-209)-V14-L174P, R154C-40 kDa bPEG- 21 3.3 3 MA V15
hFGF21(33-209)-V15 3.3 1.2 1 V16 hFGF21(33-209)-V16 11 6.5 1 V18
hFGF21(33-209)-V18 15 2.7 1 V52 hFGF21(33-209)-V52 66 94 1 V53
hFGF21(33-209)-V53 4.2 1.3 3 V54 hFGF21(33-209)-V54 25 9.2 1 V55
hFGF21(33-209)-V55 34 13 1 V56 hFGF21(33-209)-V56 37 14 1 V57
hFGF21(33-209)-V57 22 5.4 3 V58 hFGF21(33-209)-V58 3.6 2.6 1 V59
hFGF21(33-209)-V59 6.5 1.6 3 V60 hFGF21(33-209)-V60 7.6 2.2 1 V61
hFGF21(33-209)-V61 22 6.3 1 V62 hFGF21(33-209)-V62 24 6.8 1 V63
hFGF21(33-209)-V63 13 3.7 1 V64 hFGF21(33-209)-V64 2.9 0.80 1 V73
hFGF21(33-209)-V73 5.8 1.7 3 V73-N-PEG hFGF21(33-209)-V73-N-40 kDa
bPEG-AL 191 66 2 V76 hFGF21(33-209)-V76 3.4 0.47 3 V76-154C-PEG
hFGF21(33-209)-V76-154C-40 kDa-bPEG-MA 8.3 2.4 4 V79
hFGF21(33-209)-V79 2.2 0.40 1 V80 hFGF21(33-209)-V80 2.2 0.40 1 V81
hFGF21(33-209)-V81 11 2.1 1 V82 hFGF21(33-209)-V82 1.5 2.7 1 V83
hFGF21(33-209)-V83 0.21 0.38 1 V84 hFGF21(33-209)-V84 4.5 1.1 3 V85
hFGF21(33-209)-V85 2.0 0.30 1 V86 hFGF21(33-209)-V86 8.5 4.5 1 V87
hFGF21(33-209)-V87 1.9 1.6 1 WT hFGF21(33-209)-WT-CH 7.4 1.0 33
WT-R154C hFGF21(33-209)-WT-R154C 4.2 1.3 3 WT-R154C-PEG
hFGF21(33-209)-WT-R154C-40 kDa bPEG-MA 9.0 2.9 3 WT-N-PEG
hFGF21(33-209)-WT-N-40 kDa bPEG-AL 20 6.3 3 WT-L174P
hFGF21(33-209)-WT-AM 5.7 1.5 3 (1) "Fold-WT" is ratio of the EC50
value of the FGF21 variant to the EC50 value of FGF21-WT carried
out "head to head" in the same experiment.
Example 5
In Vivo Tests of FGF21 and FGF21 Variants--Pharmacodynamics and
Plasma Exposures
[0259] The ob/ob mouse is a mouse model for type 2 diabetes. The
mice lack functional leptin and are characterized by hyperglycemia,
insulin resistance, hyerphagia, hepatic steatosis and obesity. Male
ob/ob mice (10-13 weeks old) were used to measure the effect on
blood glucose of the following: (1) wild type FGF21, (2) FGF21
variants, (3) PEGylated wild type FGF21, and (4) PEGylated FGF21
variants.
[0260] The wild type FGF21, variant FGF21 or PBS vehicle were
administered s.c. at 1 mg/kg and 4 ml/kg once daily for 5 days. On
the first day of the study, tail blood glucose and body weight were
measured and mice were allocated into different groups (n=8 per
group) with mean glucose and body weight matched among the groups.
Blood glucose was measured using a glucometer (OneTouch) on days 1,
3 and 5 before dosing and 2 and 4 hours after dosing. The results
of these studies are summarized in Table 4.
TABLE-US-00008 TABLE 4 Percent reduction of total glucose AUC by
FGF21 variants during 5-day screening studies in ob/ob mice.
Glucose AUC Variant Dose reduction vs. ID (mg/kg) vehicle Fold
change over WT V1 1 mg/kg -30% 0.86 V5 1 mg/kg -25% 1.19 V7 1 mg/kg
-25% 1.19 V8 1 mg/kg -16% 0.76 V9 1 mg/kg -20% 0.95 V10 1 mg/kg
-31% 1.48 V11 1 mg/kg -29% 0.83 V12 1 mg/kg -31% 0.89 V13 1 mg/kg
-27% 0.87 V14 exp1 1 mg/kg -33% 0.94 V14 exp2 1 mg/kg -37% 1.06 V14
exp3 1 mg/kg -36% 1.16 V14- 1 mg/kg -30% 0.97 R154C, L174P V15 1
mg/kg -26% 0.74 V16 1 mg/kg -24% 0.69 V18 1 mg/kg -20% 0.95 V53 1
mg/kg -32% 1.03 V54 1 mg/kg -25% 0.78 V55 1 mg/kg -22% 0.69 V56 1
mg/kg -20% 0.63 Fold change over WT (1) V57 1 mg/kg -18% 0.90 V58 1
mg/kg -20% 0.65 V59 1 mg/kg -22% 0.69 V60 1 mg/kg -21% 1.05 V61 1
mg/kg -5% 0.25 V62 1 mg/kg -2% 0.10 V63 1 mg/kg -13% 0.65 V73 1
mg/kg -26% 0.74 V76 1 mg/kg -30% 0.86 exp1 V76 1 mg/kg -16% 1.45
exp2 V79 1 mg/kg -30% 1.15 V80 1 mg/kg -23% 0.88 V81 1 mg/kg -24%
0.92 V82 1 mg/kg -31% 1.19 V83 1 mg/kg -32% 1.23 exp1 V83 1 mg/kg
-30% 2.73 exp2 V84 1 mg/kg -23% 0.88 V85 1 mg/kg -16% 1.45 WT- 1
mg/kg -28% 0.92 L174P WT 1 mg/kg -27% (n = 9) 1.0 (1) "Fold change
over WT" is the ratio of the "Glucose AUC reduction" of the FGF21
variant to the "Glucose AUC reduction" of FGF21-WT carried out
"head to head" in the same experiment.
[0261] Mice were administered s.c. with PEGylated FGF21 wild type
at 1 mg/kg, PEGylated FGF21 variants at 0.3, 1 or 3 mg/kg, or PBS
vehicle at 4 ml/kg at 2 times a week for 2 weeks. On the first day
of the study, tail blood glucose and body weight were measured and
mice were allocated into different groups (n=8 per group) with mean
glucose and body weight matched among the groups. Blood glucose was
measured using a glucometer on days 1, 4, 8 and 11 before dosing
and 4 hours after dosing. Additional blood glucose measurements
were taken at 24 hours post each dose, on days 2, 5, 9 and 12.
Plasma insulin was measured on day 1 before dosing and day 12, 24
hours post the last dose. Plasma triglycerides were measured on day
1 before dosing and day 5, 24 hours post the second dose. The
results of these studies are summarized in Table 5.
TABLE-US-00009 TABLE 5 % changes versus vehicle in plasma glucose,
insulin, triglyceride (TG), body weight (BW) gain, liver TG/lipid
by PEGylated FGF21 wild type (WT) and variants during 12-day
studies in ob/ob mice. Total Plasma Dose Glucose Plasma BW Liver TG
TG Variant ID (mg/kg) AUC Insulin gain (or lipid) (day 5) WT-N-PEG,
1.0 -8% -24% -4% -19% (lipid) -48% exp 1 WT-N-PEG, 1.0 -24% -45%
-1% -3% -35% exp 2 WT-R154C- 1.0 -30% -40% -5% -18% (lipid) -59%
PEG, exp 1 V14-N-PEG 0.3 +2% -17% +1% +7% -29% V14-N-PEG 1.0 +1%
-39% -1% +6% -40% V14-N-PEG 3.0 -11% -39% 0% +7% -24% V14-L174P,
0.3 -8% -6% 0% -19% -24% R154C-PEG V14-L174P, 1.0 -4% -49% -2% -4%
-43% R154C-PEG V14-L174P, 3.0 -17% -48% -3% -33% -44% R154C-PEG
WT-N-PEG, 1.0 -8% +21% +1% -5% -17% exp 3 WT-R154C- 1.0 -28% -14%
-1% -7% -53% PEG, exp 3 V73-N-PEG 0.3 -1% +29% +2% +1% +24%
V73-N-PEG 1.0 0% +24% +2% -1% +7% V73-N-PEG 3.0 -16% +8% +3% +8%
-22% V76-154C- 0.3 -20% +22% 0% -3% -24% PEG V76-154C- 1.0 -20%
-21% -1% -25% -45% PEG V76-154C- 3.0 -31% -38% -5% -40% -51%
PEG
[0262] The V76-154C-PEG variant exhibits an excellent in vivo
metabolic profile, as seen in Table 5. V76-154C-PEG also exhibits
excellent liver triglyceride lowering properties (-25% liver
triglyceride change, significantly different from the vehicle
control group; FIG. 1) compared with FGF21-WT-R154C-PEG (-7% Liver
Triglyceride change, not significantly different from the vehicle
control group; FIG. 1). When both were dosed at 1 mg/kg in the same
study (WT-R154C-PEG, exp3), the plasma exposures (FIG. 2) for both
compounds were equivalent and other efficacy endpoints (Total
Glucose AUC, plasma insulin, body weight gain, and plasma
triglycerides) were not significantly different.
Example 6
Plasma Stability Assay with Wild Type FGF21 and PEGylated FGF21
Variants
[0263] to determine the plasma stability of wild type FGF21
(FGF21-WT) in comparison to PEGylated FGF21 variants, a plasma
stability assay was implemented. Ten (10) ml of FGF21-WT (4.84
mg/ml) and 35.5 .mu.l of FGF21-V76-154C-PEG (2.12 mg/ml) were added
to 90 .mu.l and 264.5 .mu.l of ob/ob mouse plasma (90% and 88%
plasma). Each sample was made in 5 aliquots and incubated for 1 hr,
4 hr, 24 hr, 48 hr and 72 hr. Plasma-treated samples were stored at
4.degree. C. until samples from all the time points were collected.
Nine (9) .mu.l of plasma-treated FGF21-WT and 27 .mu.l of
plasma-treated FGF21-V76-154C-PEG were added to 750 .mu.l of medium
(300 nM FGF21-WT with 1.2% plasma and 450 nM FGF21-V76-154C-PEG
with 3.6% plasma) and serially diluted 1:3 in media 8 times. HEK293
cells, stably transfected with human .beta.-klotho, were treated
with proteins for 10 min followed by standard protocols of pERK
ICW. Untreated FGF21-WT, FGF21-V76-154C-PEG and 1.2% and 3.6% mouse
plasma are also included as controls. The results of these
experiments are graphically depicted by FIGS. 3A and 3B.
[0264] While FGF21-WT lost activity over a short time frame (1-4
hours) when incubated with mouse plasma at 37.degree. C.,
V76-154C-PEG by contrast retained its full activity for at least 72
hours when incubated with mouse plasma at 37.degree. C.
[0265] While the present invention has been described with
reference to the specific embodiments thereof, it should be
understood by those skilled in the art that various changes may be
made and equivalents may be substituted without departing from the
true spirit and scope of the invention. In addition, many
modifications may be made to adapt a particular situation,
material, composition of matter, process, process step or steps, to
the objective, spirit and scope of the present invention. All such
modifications are intended to be within the scope of the present
invention.
Sequence CWU 1
1
491209PRTHomo sapiens 1Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser
Gly Leu Trp Val Ser1 5 10 15 Val Leu Ala Gly Leu Leu Leu Gly Ala
Cys Gln Ala His Pro Ile Pro 20 25 30 Asp Ser Ser Pro Leu Leu Gln
Phe Gly Gly Gln Val Arg Gln Arg Tyr 35 40 45 Leu Tyr Thr Asp Asp
Ala Gln Gln Thr Glu Ala His Leu Glu Ile Arg 50 55 60 Glu Asp Gly
Thr Val Gly Gly Ala Ala Asp Gln Ser Pro Glu Ser Leu65 70 75 80 Leu
Gln Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 85 90
95 Lys Thr Ser Arg Phe Leu Cys Gln Arg Pro Asp Gly Ala Leu Tyr Gly
100 105 110 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu
Leu Leu 115 120 125 Glu Asp Gly Tyr Asn Val Tyr Gln Ser Glu Ala His
Gly Leu Pro Leu 130 135 140 His Leu Pro Gly Asn Lys Ser Pro His Arg
Asp Pro Ala Pro Arg Gly145 150 155 160 Pro Ala Arg Phe Leu Pro Leu
Pro Gly Leu Pro Pro Ala Leu Pro Glu 165 170 175 Pro Pro Gly Ile Leu
Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp 180 185 190 Pro Leu Ser
Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 195 200 205 Ser
2630DNAHomo sapiens 2atggactcgg acgagaccgg gttcgagcac tcaggactgt
gggtttctgt gctggctggt 60cttctgctgg gagcctgcca ggcacacccc atccctgact
ccagtcctct cctgcaattc 120gggggccaag tccggcagcg gtacctctac
acagatgatg cccagcagac agaagcccac 180ctggagatca gggaggatgg
gacggtgggg ggcgctgctg accagagccc cgaaagtctc 240ctgcagctga
aagccttgaa gccgggagtt attcaaatct tgggagtcaa gacatccagg
300ttcctgtgcc agcggccaga tggggccctg tatggatcgc tccactttga
ccctgaggcc 360tgcagcttcc gggagctgct tcttgaggac ggatacaatg
tttaccagtc cgaagcccac 420ggcctcccgc tgcacctgcc agggaacaag
tccccacacc gggaccctgc accccgagga 480ccagctcgct tcctgccact
accaggcctg ccccccgcac tcccggagcc acccggaatc 540ctggcccccc
agccccccga tgtgggctcc tcggaccctc tgagcatggt gggaccttcc
600cagggccgaa gccccagcta cgcttcctga 6303181PRTHomo sapiens 3His Pro
Ile Pro Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val1 5 10 15
Arg Gln Arg Tyr Leu Tyr Thr Asp Asp Ala Gln Gln Thr Glu Ala His 20
25 30 Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gln
Ser 35 40 45 Pro Glu Ser Leu Leu Gln Leu Lys Ala Leu Lys Pro Gly
Val Ile Gln 50 55 60 Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys
Gln Arg Pro Asp Gly65 70 75 80 Ala Leu Tyr Gly Ser Leu His Phe Asp
Pro Glu Ala Cys Ser Phe Arg 85 90 95 Glu Leu Leu Leu Glu Asp Gly
Tyr Asn Val Tyr Gln Ser Glu Ala His 100 105 110 Gly Leu Pro Leu His
Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro 115 120 125 Ala Pro Arg
Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro 130 135 140 Ala
Leu Pro Glu Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val145 150
155 160 Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gln Gly Arg
Ser 165 170 175 Pro Ser Tyr Ala Ser 180 415DNAArtificial
SequenceLinker 4ggggsggggs ggggs 155177PRTHomo sapiens 5Asp Ser Ser
Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu
Tyr Thr Asp Asp Ala Gln Glu Thr Glu Ala His Leu Glu Ile Arg 20 25
30 Glu Asp Gly Thr Ala Gly Gly Ala Ala Asp Gln Ser Pro Glu Ser Leu
35 40 45 Leu Glu Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu
Gly Val 50 55 60 Lys Thr Ser Arg Phe Leu Cys Gln Gly Pro Asp Gly
Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser
Phe Arg Glu Leu Val Leu 85 90 95 Glu Asp Gly Tyr Asn Val Tyr Gln
Ser Glu Ala His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly His Lys
Ser Pro His Arg Asp Pro Ala Pro Arg Gly 115 120 125 Pro Ala Arg Phe
Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 130 135 140 Pro Pro
Gly Ile Leu Ala Pro Glu Pro Pro Asp Val Gly Ser Ser Asp145 150 155
160 Pro Leu Ser Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Thr
165 170 175 Ser6177PRTHomo sapiens 6Asp Ser Ser Pro Leu Leu Gln Phe
Gly Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala
Gln Asn Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr
Ala Gly Gly Ala Ala Asp Gln Ser Pro Glu Ser Leu 35 40 45 Leu Asn
Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55 60
Lys Thr Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu Tyr Gly65
70 75 80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu
Val Leu 85 90 95 Glu Asp Gly Tyr Asn Val Tyr Gln Ser Glu Ala His
Gly Leu Pro Leu 100 105 110 His Leu Pro Gly Gln Lys Ser Pro His Arg
Asp Pro Ala Pro Arg Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu Pro
Gly Leu Pro Pro Ala Leu Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala
Pro Asn Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu Ser
Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Thr 165 170 175
Ser7177PRTHomo sapiens 7Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln
Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Asp Gln Gln Thr
Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly Gly
Ala Ala His Gln Ser Pro Glu Ser Leu 35 40 45 Leu Gln Leu Lys Ala
Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys Ala Ser
Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu Tyr Gly65 70 75 80 Ser
Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85 90
95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu Pro Leu
100 105 110 His Leu Pro Gly Asn Arg Ser Pro His Arg Asp Pro Ala Ser
Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro
Ala Leu Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro
Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly Pro
Ser Gln Ala Arg Ser Pro Ser Tyr Ala 165 170 175 Ser8177PRTHomo
sapiens 8Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln
Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Asp Gln Gln Thr Glu Ala His
Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala His
Gln Ser Pro Glu Ser Leu 35 40 45 Leu Gln Leu Lys Ala Leu Lys Pro
Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Gln Thr Ser Arg Phe Leu
Cys Gln Lys Pro Asp Gly Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe
Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asn
Gly Tyr Asn Val Tyr Gln Ser Glu Thr His Gly Leu Pro Leu 100 105 110
His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Ser Gln Gly 115
120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro
Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly
Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly Pro Ser Gln Ala
Arg Ser Pro Ser Tyr Ala 165 170 175 Ser9177PRTHomo sapiens 9Asp Ser
Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10 15
Leu Tyr Thr Asp Asp Ala Gln Glu Thr Glu Ala His Leu Glu Ile Arg 20
25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala His Gln Ser Pro Glu Ser
Leu 35 40 45 Leu Gln Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile
Leu Gly Val 50 55 60 Lys Ala Ser Arg Phe Leu Cys Gln Lys Pro Asp
Gly Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala Cys
Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asn Gly Tyr Asn Val Tyr
Gln Ser Glu Ala His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly Asn
Arg Ser Pro His Arg Asp Pro Ala Ser Gln Gly 115 120 125 Pro Ala Arg
Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 130 135 140 Pro
Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145 150
155 160 Pro Leu Ala Met Val Gly Pro Ser Gln Ala Arg Ser Pro Ser Tyr
Ala 165 170 175 Ser10177PRTHomo sapiens 10Asp Ser Ser Pro Leu Leu
Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp
Asp Ala Gln Glu Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp
Gly Thr Val Gly Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40 45
Leu Gln Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50
55 60 Gln Thr Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu Tyr
Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu
Leu Leu Leu 85 90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu Thr
His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly Asn Lys Ser Pro His
Arg Asp Pro Ala Ser Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu
Pro Gly Leu Pro Pro Ala Leu Pro Glu 130 135 140 Pro Pro Gly Ile Leu
Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu
Ala Met Val Gly Pro Ser Gln Ala Arg Ser Pro Ser Tyr Ala 165 170 175
Ser11177PRTHomo sapiens 11Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly
Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Asp Gln Gln
Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly
Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40 45 Leu Gln Leu Lys
Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys Ala
Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu Tyr Gly65 70 75 80
Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85
90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu Thr His Gly Leu Pro
Leu 100 105 110 His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala
Ser Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro
Pro Ala Leu Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro
Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly
Pro Ser Gln Ala Arg Ser Pro Ser Tyr Ala 165 170 175 Ser12177PRTHomo
sapiens 12Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln
Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Gln Glu Thr Glu Ala His
Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala His
Gln Ser Pro Glu Ser Leu 35 40 45 Leu Gln Leu Lys Ala Leu Lys Pro
Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys Ala Ser Arg Phe Leu
Cys Gln Lys Pro Asp Gly Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe
Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asn
Gly Tyr Asn Val Tyr Gln Ser Glu Thr His Gly Leu Pro Leu 100 105 110
His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Ser Gln Gly 115
120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro
Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly
Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly Pro Ser Gln Ala
Arg Ser Pro Ser Tyr Ala 165 170 175 Ser13177PRTHomo sapiens 13Asp
Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10
15 Leu Tyr Thr Asp Asp Asp Gln Gln Thr Glu Ala His Leu Glu Ile Arg
20 25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala His Gln Ser Pro Glu
Ser Leu 35 40 45 Leu Glu Leu Lys Ala Leu Lys Pro Gly Val Ile Gln
Ile Leu Gly Val 50 55 60 Lys Thr Ser Arg Phe Leu Cys Gln Lys Pro
Asp Gly Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala
Cys Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asn Gly Tyr Asn Val
Tyr Gln Ser Glu Ala His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly
Asn Arg Ser Pro His Arg Asp Pro Ala Pro Gln Gly 115 120 125 Pro Ala
Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 130 135 140
Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145
150 155 160 Pro Leu Ala Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser
Tyr Ala 165 170 175 Ser14177PRTHomo sapiens 14Asp Ser Ser Pro Leu
Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr
Asp Asp Asp Gln Gln Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu
Asp Gly Thr Val Gly Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40
45 Leu Gln Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val
50 55 60 Gln Thr Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu
Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg
Glu Leu Leu Leu 85 90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu
Ala His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly Asn Arg Ser Pro
His Arg Asp Pro Ala Pro Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro
Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 130 135 140 Pro Pro Gly Ile
Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro
Leu Ala Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170
175 Ser15177PRTHomo sapiens 15Asp Ser Ser
Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu
Tyr Thr Asp Asp Asp Gln Gln Thr Glu Ala His Leu Glu Ile Arg 20 25
30 Glu Asp Gly Thr Val Gly Gly Ala Ala His Gln Ser Pro Glu Ser Leu
35 40 45 Leu Gln Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu
Gly Val 50 55 60 Lys Ala Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly
Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser
Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asn Gly Tyr Asn Val Tyr Gln
Ser Glu Ala His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly Asn Arg
Ser Pro His Arg Asp Pro Ala Pro Gln Gly 115 120 125 Pro Ala Arg Phe
Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 130 135 140 Pro Pro
Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145 150 155
160 Pro Leu Ala Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala
165 170 175 Ser16177PRTHomo sapiens 16Asp Ser Ser Pro Leu Leu Gln
Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp
Ala Gln Glu Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly
Thr Val Gly Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40 45 Leu
Glu Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55
60 Lys Thr Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu Tyr
Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu
Leu Leu Leu 85 90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu Ala
His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly Asn Arg Ser Pro His
Arg Asp Pro Ala Pro Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu
Pro Gly Leu Pro Pro Ala Leu Pro Glu 130 135 140 Pro Pro Gly Ile Leu
Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu
Ala Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170 175
Ser17177PRTHomo sapiens 17Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly
Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Gln Glu
Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly
Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40 45 Leu Glu Leu Lys
Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys Thr
Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu Tyr Gly65 70 75 80
Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85
90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu Pro
Leu 100 105 110 His Leu Pro Gly Asn Arg Ser Pro His Cys Asp Pro Ala
Pro Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro
Pro Ala Pro Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro
Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly
Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170 175 Ser18177PRTHomo
sapiens 18Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln
Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Gln Glu Thr Glu Ala His
Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala His
Gln Ser Pro Glu Ser Leu 35 40 45 Leu Gln Leu Lys Ala Leu Lys Pro
Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Gln Thr Ser Arg Phe Leu
Cys Gln Lys Pro Asp Gly Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe
Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asn
Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu Pro Leu 100 105 110
His Leu Pro Gly Asn Arg Ser Pro His Arg Asp Pro Ala Pro Gln Gly 115
120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro
Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly
Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly Pro Ser Gln Gly
Arg Ser Pro Ser Tyr Ala 165 170 175 Ser19177PRTHomo sapiens 19Asp
Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10
15 Leu Tyr Thr Asp Asp Ala Gln Glu Thr Glu Ala His Leu Glu Ile Arg
20 25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala His Gln Ser Pro Glu
Ser Leu 35 40 45 Leu Gln Leu Lys Ala Leu Lys Pro Gly Val Ile Gln
Ile Leu Gly Val 50 55 60 Lys Ala Ser Arg Phe Leu Cys Gln Lys Pro
Asp Gly Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala
Cys Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asn Gly Tyr Asn Val
Tyr Gln Ser Glu Ala His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly
Asn Arg Ser Pro His Arg Asp Pro Ala Pro Gln Gly 115 120 125 Pro Ala
Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 130 135 140
Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145
150 155 160 Pro Leu Ala Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser
Tyr Ala 165 170 175 Ser20177PRTHomo sapiens 20Asp Ser Ser Pro Leu
Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr
Asp Asp Ala Gln Gln Thr Glu Ser His Leu Glu Ile Arg 20 25 30 Glu
Asp Gly Thr Val Gly Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40
45 Leu Glu Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val
50 55 60 Lys Thr Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu
Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg
Glu Leu Leu Leu 85 90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu
Ala His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly Asn Arg Ser Pro
His Arg Asp Pro Ala Pro Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro
Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 130 135 140 Pro Pro Gly Ile
Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro
Leu Ala Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170
175 Ser21177PRTHomo sapiens 21Asp Ser Ser Pro Leu Leu Gln Phe Gly
Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Gln
Gln Thr Glu Ser His Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val
Gly Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40 45 Leu Gln Leu
Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Gln
Thr Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu Tyr Gly65 70 75
80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu
85 90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu
Pro Leu 100 105 110 His Leu Pro Gly Asn Arg Ser Pro His Arg Asp Pro
Ala Pro Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu
Pro Pro Ala Leu Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln
Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val
Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170 175
Ser22177PRTHomo sapiens 22Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly
Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Gln Gln
Thr Glu Ser His Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly
Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40 45 Leu Gln Leu Lys
Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys Ala
Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu Tyr Gly65 70 75 80
Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85
90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu Pro
Leu 100 105 110 His Leu Pro Gly Asn Arg Ser Pro His Arg Asp Pro Ala
Pro Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro
Pro Ala Leu Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro
Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly
Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170 175 Ser23177PRTHomo
sapiens 23Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln
Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Asp Gln Gln Thr Glu Ala His
Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala His
Gln Ser Pro Glu Ser Leu 35 40 45 Leu Gln Leu Lys Ala Leu Lys Pro
Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Gln Thr Ser Arg Phe Leu
Cys Gln Lys Pro Asp Gly Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe
Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asn
Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu Pro Leu 100 105 110
His Leu Pro Gly Asn Arg Ser Pro His Arg Asp Pro Ala Ser Gln Gly 115
120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro
Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly
Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly Pro Ser Gln Ala
Arg Ser Pro Ser Tyr Ala 165 170 175 Ser24177PRTHomo sapiens 24Asp
Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10
15 Leu Tyr Thr Asp Asp Ala Gln Glu Thr Glu Ala His Leu Glu Ile Arg
20 25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala His Gln Ser Pro Glu
Ser Leu 35 40 45 Leu Gln Leu Lys Ala Leu Lys Pro Gly Val Ile Gln
Ile Leu Gly Val 50 55 60 Gln Thr Ser Arg Phe Leu Cys Gln Lys Pro
Asp Gly Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala
Cys Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asn Gly Tyr Asn Val
Tyr Gln Ser Glu Ala His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly
Asn Arg Ser Pro His Arg Asp Pro Ala Ser Gln Gly 115 120 125 Pro Ala
Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 130 135 140
Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145
150 155 160 Pro Leu Ala Met Val Gly Pro Ser Gln Ala Arg Ser Pro Ser
Tyr Ala 165 170 175 Ser25177PRTHomo sapiens 25Asp Ser Ser Pro Leu
Val Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr
Asp Asp Ala Gln Gln Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu
Asp Gly Thr Val Gly Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40
45 Leu Gln Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val
50 55 60 Lys Thr Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu
Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg
Glu Leu Leu Leu 85 90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu
Ala His Ser Leu Pro Leu 100 105 110 His Leu Pro Gly Asn Lys Ser Pro
His Arg Asp Pro Ala Ser Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro
Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 130 135 140 Pro Pro Gly Ile
Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro
Leu Ser Met Val Gly Pro Ser Gln Ala Arg Ser Pro Ser Tyr Ala 165 170
175 Ser26177PRTHomo sapiens 26Asp Ser Ser Pro Leu Leu Gln Phe Gly
Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Gln
Glu Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val
Gly Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40 45 Leu Glu Leu
Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys
Thr Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu Tyr Gly65 70 75
80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu
85 90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu
Pro Leu 100 105 110 His Leu Pro Gly Asn Arg Ser Pro His Arg Asp Pro
Ala Ser Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu
Pro Pro Ala Pro Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln
Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val
Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170 175
Ser27177PRTHomo sapiens 27Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly
Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Gln Gln
Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly
Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40 45 Leu Glu Leu Lys
Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys Thr
Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Thr Leu Tyr Gly65 70 75 80
Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85
90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu Pro
Leu 100 105 110 His Leu Pro Gly Asn Arg Ser Pro His Arg Asp Pro Ala
Ser Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro
Pro Ala Pro Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro
Pro Asp Val Gly Ser Ser Asp145 150 155
160 Pro Leu Ala Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala
165 170 175 Ser28177PRTHomo sapiens 28Asp Ser Ser Pro Leu Leu Gln
Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp
Ala Gln Gln Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly
Thr Ala Gly Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40 45 Leu
Glu Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55
60 Lys Thr Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu Tyr
Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu
Leu Leu Leu 85 90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu Ala
His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly Asn Arg Ser Pro His
Arg Asp Pro Ala Ser Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu
Pro Gly Leu Pro Pro Ala Pro Pro Glu 130 135 140 Pro Pro Gly Ile Leu
Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu
Ala Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170 175
Ser29177PRTHomo sapiens 29Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly
Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Gln Gln
Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly
Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40 45 Leu Gln Leu Lys
Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys Ala
Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu Tyr Gly65 70 75 80
Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85
90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu Thr His Gly Leu Pro
Leu 100 105 110 His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala
Ser Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro
Pro Ala Pro Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro
Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly
Pro Ser Gln Ala Arg Ser Pro Ser Tyr Ala 165 170 175 Ser30177PRTHomo
sapiens 30Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln
Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Gln Gln Thr Glu Ala His
Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala His
Gln Ser Pro Glu Ser Leu 35 40 45 Leu Gln Leu Lys Ala Leu Lys Pro
Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys Ala Ser Arg Phe Leu
Cys Gln Arg Pro Asp Gly Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe
Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asn
Gly Tyr Asn Val Tyr Gln Ser Glu Thr His Gly Leu Pro Leu 100 105 110
His Leu Pro Gly Asn Arg Ser Pro His Arg Asp Pro Ala Ser Gln Gly 115
120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro
Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly
Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly Pro Ser Gln Ala
Arg Ser Pro Ser Tyr Ala 165 170 175 Ser31177PRTHomo sapiens 31Asp
Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10
15 Leu Tyr Thr Asp Asp Ala Gln Gln Thr Glu Ala His Leu Glu Ile Arg
20 25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala His Gln Ser Pro Glu
Ser Leu 35 40 45 Leu Gln Leu Lys Ala Leu Lys Pro Gly Val Ile Gln
Ile Leu Gly Val 50 55 60 Lys Thr Ser Arg Phe Leu Cys Gln Arg Pro
Asp Gly Thr Leu Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala
Cys Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asn Gly Tyr Asn Val
Tyr Gln Ser Glu Thr His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly
Asn Arg Ser Pro His Arg Asp Pro Ala Ser Gln Gly 115 120 125 Pro Ala
Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 130 135 140
Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145
150 155 160 Pro Leu Ala Met Val Gly Pro Ser Gln Ala Arg Ser Pro Ser
Tyr Ala 165 170 175 Ser32177PRTHomo sapiens 32Asp Ser Ser Pro Leu
Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr
Asp Asp Ala Cys Gln Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu
Asp Gly Thr Val Gly Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40
45 Leu Glu Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val
50 55 60 Lys Thr Ser Arg Phe Leu Cys Gln Arg Pro Asp Gly Ala Leu
Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg
Glu Leu Leu Leu 85 90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu
Ala His Gly Leu Pro Leu 100 105 110 His Leu Pro Cys Asn Arg Ser Pro
His Arg Asp Pro Ala Ser Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro
Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 130 135 140 Pro Pro Gly Ile
Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro
Leu Ala Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170
175 Ser33177PRTHomo sapiens 33Asp Ser Ser Pro Leu Leu Gln Phe Gly
Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Cys
Gln Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val
Gly Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40 45 Leu Glu Leu
Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys
Thr Ser Arg Phe Leu Cys Gln Arg Pro Asp Gly Thr Leu Tyr Gly65 70 75
80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu
85 90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu
Pro Leu 100 105 110 His Leu Pro Cys Asn Arg Ser Pro His Arg Asp Pro
Ala Ser Arg Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu
Pro Pro Ala Pro Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln
Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val
Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170 175
Ser34177PRTHomo sapiens 34Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly
Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Cys Gln
Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Ala Gly
Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40 45 Leu Glu Leu Lys
Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys Thr
Ser Arg Phe Leu Cys Gln Arg Pro Asp Gly Ala Leu Tyr Gly65 70 75 80
Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85
90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu Pro
Leu 100 105 110 His Leu Pro Cys Asn Arg Ser Pro His Arg Asp Pro Ala
Ser Arg Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro
Pro Ala Pro Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro
Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly
Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170 175 Ser35177PRTHomo
sapiens 35Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln
Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Cys Gln Thr Glu Ala His
Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala His
Gln Ser Pro Glu Ser Leu 35 40 45 Leu Gln Leu Lys Ala Leu Lys Pro
Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys Thr Ser Arg Phe Leu
Cys Gln Arg Pro Asp Gly Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe
Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asn
Gly Tyr Asn Val Tyr Gln Ser Glu Thr His Gly Leu Pro Leu 100 105 110
His Leu Pro Cys Asn Lys Ser Pro His Arg Asp Pro Ala Ser Gln Gly 115
120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro
Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly
Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly Pro Ser Gln Ala
Arg Ser Pro Ser Tyr Ala 165 170 175 Ser36177PRTHomo sapiens 36Asp
Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10
15 Leu Tyr Thr Asp Asp Ala Cys Gln Thr Glu Ala His Leu Glu Ile Arg
20 25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala His Gln Ser Pro Glu
Ser Leu 35 40 45 Leu Gln Leu Lys Ala Leu Lys Pro Gly Val Ile Gln
Ile Leu Gly Val 50 55 60 Lys Thr Ser Arg Phe Leu Cys Gln Arg Pro
Asp Gly Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala
Cys Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asn Gly Tyr Asn Val
Tyr Gln Ser Glu Thr His Gly Leu Pro Leu 100 105 110 His Leu Pro Cys
Asn Arg Ser Pro His Arg Asp Pro Ala Ser Arg Gly 115 120 125 Pro Ala
Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 130 135 140
Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145
150 155 160 Pro Leu Ala Met Val Gly Pro Ser Gln Ala Arg Ser Pro Ser
Tyr Ala 165 170 175 Ser37177PRTHomo sapiens 37Asp Ser Ser Pro Leu
Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr
Asp Asp Ala Cys Gln Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu
Asp Gly Thr Val Gly Gly Ala Ala Asp Gln Ser Pro Glu Ser Leu 35 40
45 Leu Gln Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val
50 55 60 Lys Thr Ser Arg Phe Leu Cys Gln Arg Pro Asp Gly Thr Leu
Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg
Glu Leu Leu Leu 85 90 95 Glu Asn Gly Tyr Asn Val Tyr Gln Ser Glu
Thr His Gly Leu Pro Leu 100 105 110 His Leu Pro Cys Asn Arg Ser Pro
His Arg Asp Pro Ala Ser Arg Gly 115 120 125 Pro Ala Arg Phe Leu Pro
Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 130 135 140 Pro Pro Gly Ile
Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro
Leu Ala Met Val Gly Pro Ser Gln Ala Arg Ser Pro Ser Tyr Ala 165 170
175 Ser38177PRTHomo sapiens 38Asp Ser Ser Pro Leu Leu Gln Phe Gly
Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Gln
Glu Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val
Gly Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40 45 Leu Glu Leu
Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys
Thr Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu Tyr Gly65 70 75
80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu
85 90 95 Glu Glu Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu
Pro Leu 100 105 110 His Leu Pro Gly Asn Arg Ser Pro His Arg Asp Pro
Ala Pro Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu
Pro Pro Ala Leu Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln
Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val
Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170 175
Ser39177PRTHomo sapiens 39Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly
Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Gln Glu
Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly
Gly Ala Ala His Gln Ser Pro Glu Ser Leu 35 40 45 Leu Glu Leu Lys
Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys Thr
Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Ala Leu Tyr Gly65 70 75 80
Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85
90 95 Glu Asp Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu Pro
Leu 100 105 110 His Leu Pro Gly Asn Arg Ser Pro His Cys Asp Pro Ala
Pro Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro
Pro Ala Leu Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro
Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly
Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170 175 Ser40177PRTHomo
sapiens 40Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln
Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Gln Gln Thr Glu Ala His
Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala His
Gln Ser Pro Glu Ser Leu 35 40 45 Leu Glu Leu Lys Ala Leu Lys Pro
Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys Thr Ser Arg Phe Leu
Cys Gln Lys Pro Asp Gly Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe
Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asp
Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu Pro Leu 100 105 110
His Leu Pro Gly Asn Arg Ser Pro His Cys Asp Pro Ala Pro Gln Gly 115
120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu
Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val
Gly Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly Pro Ser Gln
Ala Arg Ser Pro Ser Tyr Ala 165 170 175 Ser41177PRTHomo sapiens
41Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1
5 10 15 Leu Tyr Thr Asp Asp Ala Gln Gln Thr Glu Ala His Leu Glu Ile
Arg 20 25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gln Ser Pro
Glu Ser Leu 35 40 45 Leu Glu Leu Lys Ala Leu Lys Pro Gly Val Ile
Gln Ile Leu Gly Val 50 55 60 Lys Thr Ser Arg Phe Leu Cys Gln Lys
Pro Asp Gly Thr Leu Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu
Ala Cys Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asp Gly Tyr Asn
Val Tyr Gln Ser Glu Ala His Gly Leu Pro Leu 100 105 110 His Leu Pro
Gly Asn Arg Ser Pro His Cys Asp Pro Ala Pro Gln Gly 115 120 125 Pro
Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 130 135
140 Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser
Asp145 150 155 160 Pro Leu Ala Met Val Gly Pro Ser Gln Ala Arg Ser
Pro Ser Tyr Ala 165 170 175 Ser42177PRTHomo sapiens 42Asp Ser Ser
Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu
Tyr Thr Asp Asp Ala Gln Gln Thr Glu Ala His Leu Glu Ile Arg 20 25
30 Glu Asp Gly Thr Val Gly Gly Ala Ala His Gln Ser Pro Glu Ser Leu
35 40 45 Leu Glu Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu
Gly Val 50 55 60 Lys Thr Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly
Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser
Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asp Gly Tyr Asn Val Tyr Gln
Ser Glu Ala His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly Asn Arg
Ser Pro His Cys Asp Pro Ala Ser Gln Gly 115 120 125 Pro Ala Arg Phe
Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 130 135 140 Pro Pro
Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145 150 155
160 Pro Leu Ala Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala
165 170 175 Ser43177PRTHomo sapiens 43Asp Ser Ser Pro Leu Leu Gln
Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp
Ala Gln Gln Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly
Thr Val Gly Gly Ala Ala Asp Gln Ser Pro Glu Ser Leu 35 40 45 Leu
Glu Leu Lys Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55
60 Lys Thr Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Thr Leu Tyr
Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu
Leu Leu Leu 85 90 95 Glu Asp Gly Tyr Asn Val Tyr Gln Ser Glu Ala
His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly Asn Arg Ser Pro His
Cys Asp Pro Ala Ser Gln Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu
Pro Gly Leu Pro Pro Ala Leu Pro Glu 130 135 140 Pro Pro Gly Ile Leu
Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu
Ala Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170 175
Ser44177PRTHomo sapiens 44Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly
Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Gln Gln
Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly
Gly Ala Ala Asp Gln Ser Pro Glu Ser Leu 35 40 45 Leu Glu Leu Lys
Ala Leu Lys Pro Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys Thr
Ser Arg Phe Leu Cys Gln Lys Pro Asp Gly Thr Leu Tyr Gly65 70 75 80
Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85
90 95 Glu Asp Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu Pro
Leu 100 105 110 His Leu Pro Gly Asn Arg Ser Pro His Cys Asp Pro Ala
Ser Arg Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro
Pro Ala Leu Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro
Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly
Pro Ser Gln Ala Arg Ser Pro Ser Tyr Ala 165 170 175 Ser45177PRTHomo
sapiens 45Asp Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln
Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Gln Gln Thr Glu Ala His
Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala Asp
Gln Ser Pro Glu Ser Leu 35 40 45 Leu Glu Leu Lys Ala Leu Lys Pro
Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Lys Thr Ser Arg Phe Leu
Cys Gln Arg Pro Asp Gly Thr Leu Tyr Gly65 70 75 80 Ser Leu His Phe
Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Asp
Gly Tyr Asn Val Tyr Gln Ser Glu Thr His Gly Leu Pro Leu 100 105 110
His Leu Pro Gly Asn Arg Ser Pro His Cys Asp Pro Ala Ser Arg Gly 115
120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro
Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly
Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val Gly Pro Ser Gln Ala
Arg Ser Pro Ser Tyr Ala 165 170 175 Ser46177PRTHomo sapiens 46Asp
Ser Ser Pro Leu Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10
15 Leu Tyr Thr Asp Asp Ala Gln Gln Thr Glu Ala His Leu Glu Ile Arg
20 25 30 Glu Asp Gly Thr Val Gly Gly Ala Ala His Gln Ser Pro Glu
Ser Leu 35 40 45 Leu Glu Leu Lys Ala Leu Lys Pro Gly Val Ile Gln
Ile Leu Gly Val 50 55 60 Lys Thr Ser Arg Phe Leu Cys Gln Lys Pro
Asp Gly Ala Leu Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala
Cys Ser Phe Arg Glu Leu Leu Leu 85 90 95 Glu Glu Gly Tyr Asn Val
Tyr Gln Ser Glu Ala His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly
Asn Arg Ser Pro His Cys Asp Pro Ala Pro Gln Gly 115 120 125 Pro Ala
Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 130 135 140
Pro Pro Gly Ile Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145
150 155 160 Pro Leu Ala Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser
Tyr Ala 165 170 175 Ser47546DNAHomo sapiens 47caccccatcc ctgactccag
tcctctcctg caattcgggg gccaagtccg gcagcggtac 60ctctacacag atgatgccca
gcagacagaa gcccacctgg agatcaggga ggatgggacg 120gtggggggcg
ctgctgacca gagccccgaa agtctcctgc agctgaaagc cttgaagccg
180ggagttattc aaatcttggg agtcaagaca tccaggttcc tgtgccagcg
gccagatggg 240gccctgtatg gatcgctcca ctttgaccct gaggcctgca
gcttccggga gctgcttctt 300gaggacggat acaatgttta ccagtccgaa
gcccacggcc tcccgctgca cctgccaggg 360aacaagtccc cacaccggga
ccctgcaccc cgaggaccag ctcgcttcct gccactacca 420ggcctgcccc
ccgcactccc ggagccaccc ggaatcctgg ccccccagcc ccccgatgtg
480ggctcctcgg accctctgag catggtggga ccttcccagg gccgaagccc
cagctacgct 540tcctga 54648177PRTHomo sapiens 48Asp Ser Ser Pro Leu
Leu Gln Phe Gly Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr
Asp Asp Ala Gln Gln Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu
Asp Gly Thr Val Gly Gly Ala Ala Asp Gln Ser Pro Glu Ser Leu 35 40
45 Leu Gln Leu Arg Ala Leu Arg Pro Gly Val Ile Gln Ile Leu Gly Val
50 55 60 Arg Thr Ser Arg Phe Leu Cys Gln Arg Pro Asp Gly Ala Leu
Tyr Gly65 70 75 80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg
Glu Leu Leu Leu 85 90 95 Glu Asp Gly Tyr Asn Val Tyr Gln Ser Glu
Ala His Gly Leu Pro Leu 100 105 110 His Leu Pro Gly Asn Arg Ser Pro
His Lys Asp Pro Ala Pro Arg Gly 115 120 125 Pro Ala Arg Phe Leu Pro
Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 130 135 140 Pro Pro Gly Ile
Leu Ala Pro Gln Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro
Leu Ala Met Val Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170
175 Ser49177PRTHomo sapiens 49Asp Ser Ser Pro Leu Leu Gln Phe Gly
Gly Gln Val Arg Gln Arg Tyr1 5 10 15 Leu Tyr Thr Asp Asp Ala Cys
Gln Thr Glu Ala His Leu Glu Ile Arg 20 25 30 Glu Asp Gly Thr Val
Gly Gly Ala Ala Asp Gln Ser Pro Glu Ser Leu 35 40 45 Leu Gln Leu
Arg Ala Leu Arg Pro Gly Val Ile Gln Ile Leu Gly Val 50 55 60 Arg
Thr Ser Arg Phe Leu Cys Gln Arg Pro Asp Gly Ala Leu Tyr Gly65 70 75
80 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu
85 90 95 Glu Asp Gly Tyr Asn Val Tyr Gln Ser Glu Ala His Gly Leu
Pro Leu 100 105 110 His Leu Pro Cys Asn Arg Ser Pro His Lys Asp Pro
Ala Pro Arg Gly 115 120 125 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu
Pro Pro Ala Pro Pro Glu 130 135 140 Pro Pro Gly Ile Leu Ala Pro Gln
Pro Pro Asp Val Gly Ser Ser Asp145 150 155 160 Pro Leu Ala Met Val
Gly Pro Ser Gln Gly Arg Ser Pro Ser Tyr Ala 165 170 175 Ser
* * * * *