U.S. patent application number 14/739763 was filed with the patent office on 2016-02-18 for novel epitope for switching to th2 cell and use thereof.
The applicant listed for this patent is Byoung Se Kwon. Invention is credited to Byoung Se Kwon.
Application Number | 20160046691 14/739763 |
Document ID | / |
Family ID | 49984038 |
Filed Date | 2016-02-18 |
United States Patent
Application |
20160046691 |
Kind Code |
A1 |
Kwon; Byoung Se |
February 18, 2016 |
Novel Epitope for Switching to TH2 Cell and Use Thereof
Abstract
The present invention relates to a novel epitope to convert T
cell to type 2 helper T (T.sub.H2) cell. Specifically, the present
invention relates to an epitope constituting the 20.sup.th to
30.sup.th amino acids (SEQ ID No.2) of extracellular domain (ECD)
of activation-inducible tumor necrosis factor receptor (AITR), an
antibody recognizing the epitope, a polynucleotide encoding the
epitope, a polynucleotide encoding the antibody, an expression
vector comprising the polynucleotide encoding the epitope or
antibody, a transformant introduced with the vector, a composition
comprising the antibody for converting T cell to T.sub.H2 cell and
a method of conversion, a pharmaceutical composition comprising the
antibody for preventing or treating autoimmune disease, and a
method for treating autoimmune disease using the antibody.
Inventors: |
Kwon; Byoung Se; (Goyang-si,
KR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Kwon; Byoung Se |
Goyang-si |
|
KR |
|
|
Family ID: |
49984038 |
Appl. No.: |
14/739763 |
Filed: |
June 15, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13861675 |
Apr 12, 2013 |
|
|
|
14739763 |
|
|
|
|
Current U.S.
Class: |
530/327 ;
536/23.5 |
Current CPC
Class: |
A61K 2039/505 20130101;
C07K 2317/21 20130101; C07K 2317/74 20130101; C07K 16/2878
20130101; C07K 2317/55 20130101; C07K 16/3061 20130101; C07K
2317/75 20130101; C07K 14/70578 20130101; C07K 2317/34 20130101;
C07K 14/7151 20130101; A61P 35/00 20180101; C07K 7/06 20130101 |
International
Class: |
C07K 14/715 20060101
C07K014/715 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 8, 2012 |
KR |
10-2012-0061791 |
Aug 13, 2012 |
KR |
10-2012-0088647 |
Claims
1. A polypeptide which is an epitope of activation-inducible tumor
necrosis factor receptor (AITR), defined as an amino acid sequence
represented by SEQ ID No.2, for converting T cell to type 2 helper
T (T.sub.H2) cell.
2. A polynucleotide encoding the polypeptide of claim 1.
Description
CROSS-REFERENCE TO RELATED PATENT APPLICATIONS
[0001] This patent application is a divisional of co-pending U.S.
patent application Ser. No. 13/861,675, filed Apr. 12, 2013, which
is now pending and which claims priority from Korean Application
No. 10-2012-0061791 filed on Jun. 8, 2012, and Korean Application
No. 10-2012-0088647 filed on Aug. 13, 2012, all of which are
incorporated herein by reference in their entireties
TECHNICAL FIELD
[0002] The present invention relates to a novel epitope to convert
T cell to type 2 helper T (T.sub.H2) cell. Specifically, the
present invention relates to an epitope constituting the 20.sup.th
to 30.sup.th amino acids (SEQ ID No.2) of extracellular domain
(ECD) of activation-inducible tumor necrosis factor receptor
(AITR), an antibody recognizing the epitope, a polynucleotide
encoding the epitope, a polynucleotide encoding the antibody, an
expression vector comprising the polynucleotide encoding the
epitope or antibody, a transformant introduced with the vector, a
composition comprising the antibody for converting T cell to
T.sub.H2 cell and a method of conversion for the same, a
pharmaceutical composition comprising the antibody for preventing
or treating autoimmune disease, and a method for treating
autoimmune disease using the antibody.
BACKGROUND ART
[0003] Various types of receptors belonging to the tumor necrosis
factor receptor superfamily (TNFR) superfamily are involved in the
regulation of cell proliferation, cell differentiation, and cell
death. Also, TNFR receptors play an important role in development
of immune response, tumor necrosis, and protection against
autoimmune diseases. Examples of the TNFR receptors include CD28,
4-1BB, OX40, CD40, or CD27.
[0004] Human activation-inducible tumor necrosis factor receptor
(AITR) is a member of TNFR superfamily, and is also called
glucocorticoid-induced TNFR-related protein (GITR), tumor necrosis
factor receptor superfamily member 18 (TNFRSF18), or CD357. AITR is
a type I transmembrane protein of TNFR superfamily.
Immunoregulatory T cell (T.sub.reg cell or CD4.sup.+CD25.sup.high T
cell) constitutively expresses AITR at high level, and when
peripheral blood mononuclear cell (PBMC) is activated, expression
of GITR is rapidly up-regulated. In particular, a signal
transduction through AITR is known to inhibit a suppressive
function of T.sub.reg cells, which in turn increase a resistance of
CD4.sup.+ and CD8.sup.+ T cells to the suppression by T.sub.reg
cells, thereby activating the CD4.sup.+ and CD8.sup.+ T cells.
Also, a monoclonal antibody (mAb, e.g., DTA-1) that specifically
binds to GITR or a physiological ligand thereof i.e., GITRL is
known to enhance antitumor immunity through various in vivo models.
On the other hand, activation of GITR inhibits T.sub.reg cell which
is capable of suppressing the autoreactive T cells, thereby
promoting autoimmune response.
[0005] Although there has not been much information found about the
biological functions of AITR and AITR ligand (AITRL), it is known
that AITR is expressed at basal level in a resting T cell, but its
expression level rapidly increases upon activation of T cell. Also,
it has been reported that AITR expression level was increased in
herniated disc tissue cell isolated from lumber disc herniation
patients as well as in the T.sub.reg cells from active systemic
lupus erythematosus patients.
[0006] AITR binds with TNFR-associated factors (TRAFs) such as
TRAF1, TRAF2 and TRAF3. When AITR interacts with its ligand, this
recruits TRAF2 and ultimately activates NF-.kappa.B/NIK (Kwon, B.
et al., J Biol Chem 274, 6056-6061, 1999). TRAF protein is a type
of cytoplasmic adapter protein, and is involved in signal
transduction for extracellular proliferation, differentiation,
activation and migration. The N-terminal sites of TRAF proteins
vary a lot, and all of the TRAF proteins except for TRAF1 possess a
RING-finger motif at the N-terminal site thereof. A RING-finger is
essential for the TRAF-mediated signal transduction. In the
previous study, when the genes encoding all six types of TRAF
proteins were knockout in mouse by gene targeting, various
phenotypes were observed, suggesting that TRAFs have significantly
various biological functions (Ha, H., Curr Protoc Immunol. Chapter
11:Unit11.9D, 2009).
[0007] A Ca.sup.2+-dependent transcription factor known as nuclear
factor of activated T cells (NFATs) regulates not only T cells but
also various types of growth factors and cytokines. Also, it
regulates cell-to-cell interaction molecules essential for
morphogenesis, development, and other functions in various types of
cells and organs. Recently, NFAT is shown to be an important factor
in induction of specific genetic programs that regulate
differentiation to T.sub.H lineage and effector or regulatory
functions of T.sub.H cells, via the transcriptional regulation of
T.sub.H lineage-specific transcription factors such as T-bet
(T.sub.H1), GATA-3 (T.sub.H2), ROR.gamma.t (T.sub.H17), and Foxp3
(T.sub.reg). In addition, it has been reported that NFAT family
regulates transcription of various cytokines and cytokine receptors
thereof (Macian, F. Nat Rev Immunol. 5, 472-484, 2005).
[0008] One of the most important factors determining the fate of
CD4.sup.+ T cell is cytokine milieu during the TCR-mediated
activation of naive CD4.sup.+ T cell. The major signaling pathway
triggered by cytokines is an activation of the signaling transducer
and activator of transcription (STAT) family proteins. The STAT
proteins play an essential role in differentiation and expansion of
T.sub.H cells. In particular, IFN-.gamma./NFAT1/STAT-1 pathway
activates T-bet which is the master transcription factor specifying
the T.sub.H1 lineage, while NFAT1/STAT-3 pathway activates
ROR.gamma. which is the master transcription factor specifying the
T.sub.H17 lineage. Also, IL-4/NFAT2/STAT-6 pathway activates GATA-3
which is the master transcription factor specifying the T.sub.H2
lineage, and NFAT1/STAT-5 pathway activates Foxp3 which is the
master transcription factor specifying the T.sub.reg lineage. These
complex intracellular signaling cascades play an important role in
determining the differentiation of T.sub.H cell and functions
thereof.
[0009] Naive CD4 T cell can differentiate into four different types
of T cells such as T.sub.H1, T.sub.H2, T.sub.H17, and induced
T.sub.reg cells. Each of the T cells has different function and
among them, T.sub.H2 cell which produces IL-4, IL-5, IL-9, IL-10,
IL-13, and IL-25 mediates immune response to parasites such as
helminthes. Also, T.sub.reg cell is involved in regulation of
immune response and plays an important role in maintaining
self-tolerance. Increasing the number of the T.sub.reg cells or
promoting a suppressive function of T.sub.reg cells are known to be
important factors in treatment of autoimmune diseases and
prevention of allograft rejection (Jinfang Zhu et al., Blood, 112,
1557-1569, 2008).
DISCLOSURE
Technical Problem
[0010] Accordingly, the present inventors have identified a novel
epitope of AITR which can convert various T cells to T.sub.H2
cells. Also, the present inventors have confirmed that an antibody
that specifically binds to the epitope can effectively convert T
cells into T.sub.H2 cells and it can also promote TGF-.beta.
production in T.sub.reg cells. Overall, it was confirmed that the
antibody of the present invention can be used for T.sub.H2 cell
conversion and for the prevention or treatment of autoimmune
disease, thereby completing the present invention.
Technical Solution
[0011] One object of the present invention is to provide a
polypeptide which is an epitope, represented by an amino acid
sequence of SEQ ID No.2, of activation-inducible tumor necrosis
factor receptor (AITR) for converting T cells to T.sub.H2 cell.
[0012] Another object of the present invention is to provide an
antibody specifically recognizing the epitope of AITR, represented
by SEQ ID No.2.
[0013] Another object of the present invention is to provide a
method for preparing the antibody.
[0014] Another object of the present invention is to provide a
polynucleotide encoding the epitope or antibody, an expression
vector comprising the polynucleotide, and a transformant introduced
with the vector.
[0015] Another object of the present invention is to provide a
composition comprising the antibody for converting T cell T.sub.H2
cell.
[0016] Another object of the present invention is to provide a
method for converting T cell to T.sub.H2 cell, comprising the step
of treating T cell with the antibody.
[0017] Another object of the present invention is to provide a
pharmaceutical composition comprising the antibody for preventing
or treating autoimmune diseases.
[0018] Another object of the present invention is to provide a
method for treating autoimmune diseases using the antibody.
Advantageous Effects
[0019] The present invention has identified a new epitope of AITR,
represented by SEQ ID No.2, which can convert T cell to T.sub.H2
cell. Also, it was confirmed that an antibody that can specifically
recognize the epitope can effectively convert T cell to T.sub.H2
cell. Accordingly, the newly identified epitope of the present
invention for converting to T.sub.H2 cells can be used for
treatment of various diseases or research purpose that needs
T.sub.H2 cells. Furthermore, the antibody of the present invention
not only effectively converts T cells to T.sub.H2 cells, but also
increases the suppressive function of T.sub.reg cells effectively.
Therefore, the antibody can be effectively used for preventing or
treating a disease like autoimmune disease which requires
enhancement of the suppressive function of T.sub.reg cells.
DESCRIPTION OF DRAWINGS
[0020] FIGS. 1A-1D demonstrate the process of generating anti-AITR
mAbs from the human antibody library. FIG. 1A shows the Coomassie
blue-stained gel showing the presence of anti-AITR Fab clones
selected by phage displaying; and bivalent forms of anti-AITR mAbs
that were generated from transiently transfected HEK293. FIG. 1B
shows flow cytometry analysis results demonstrating the binding of
anti-AITR mAbs to AITR in AITR-overexpressed Jurkat cells that were
stained with PE-conjugated anti-AITR mAbs. FIG. 1C shows the
proportion of AITR-expressing cells (%) in a population of
CD4.sup.+, CD8.sup.+, and CD19.sup.+ cells. PBMCs were stimulated
with anti-CD3/IL-2 or lipopolysaccharide (LPS) for 2 days and
stained with PE-conjugated anti-AITR mAb (clone A41). FIG. 1D shows
the expression of AITR in activated CD4.sup.+ T cells. The purified
CD4.sup.+ T cells were stimulated with anti-CD3/IL-2 for 3 days.
AITR expression in the activated CD4.sup.+ T cells was detected
with PE-conjugated anti-AITR mAbs.
[0021] FIGS. 2A-2B show the expression of AITR in CD4.sup.+ T cells
in an activation-dependent manner. Isolated PBMCs were stimulated
with anti-CD3/IL-2 or LPS for 2 days. FIG. 2A shows the stimulated
cells stained with PE-conjugated anti-AITR mAb (clone A41) in a
test group of CD4.sup.+, CD8.sup.+, and CD19.sup.+ cells.
Expressions of AITR (arrow pointing) in CD4.sup.+ T cells (upper
panels), CD8.sup.+ T cells (middle panels), and CD19.sup.+ cells
(down panels) were detected by staining both of the non-treated
group or activated group of cells. FIG. 2B shows the stimulated
cells stained with PE-conjugated anti-AITR mAb in a group of
CD11c.sup.+CD14.sup.+, BDCA-2.sup.+ and CD56.sup.+ cells.
Expressions of AITR were detected by staining the non-treated group
(left panels) or activated group (right panels). The representative
flow cytometric profiles are shown as dot plot diagrams. The
proportion of AITR-expressing cells in each cell population is
indicated. One of the results from three independent experiments is
shown in this figure.
[0022] FIGS. 3A-3C show the epitope mapping of the anti-AITR mAbs
of the present invention. FIG. 3A shows a schematic diagram of
full-length AITR and recombinant GST protein lysates used for
antibody production and epitope mapping. Top: an intracellular
domain (ICD) and an extracellular domain (ECD) of AITR. Bottom:
twelve AITR recombinants R1, R2, and R3 to R12 (R3-R12). FIG. 3B
shows western blotting analysis demonstrating a specific binding of
anti-AITR mAbs to each fragment of AITR-ECD. Fragments of AITR-GST
proteins are shown by Coomassie blue staining (Top and left panel).
Molecular weight marker and recombinant GST protein size are
indicated on the left of panel. FIG. 3C shows the position of each
epitope for anti-AITR antibodies (A27, A35, A41, B32, and B62)
within the amino acid sequence of AITR-extracellular domain (ECD)
(SEQ ID No.1).
[0023] FIG. 4A-4B demonstrate the induction of differentiation of
CD4.sup.+ T cells into different phenotypes by anti-AITR mAbs which
recognize different fragments of AITR-ECDs of the present
invention. FIG. 4A shows the analysis of cytokine secretion through
human T.sub.H1/T.sub.H2 cytokine bead array and IL-17A ELISA assay.
The purified CD4.sup.+ T cells were stimulated with
anti-CD3/anti-AITR mAbs (clones A27, A35 or A41) for 3 days. FIG.
4B shows the proportions of cytokine-secreting cells, i.e.,
IL-4.sup.+, IFN-.gamma..sup.+, and IL-17A.sup.+ cells (%). Purified
CD4.sup.+ T cells were stimulated with anti-CD3/IL-2 for 3 days and
treated with anti-AITR mAb or AITR ligand for additional 7 days.
The cultured cells were stained for endogenous IL-4, IFN-.gamma.,
and IL-17A, which were then analyzed by flow cytometry. Then the
proportion of IL-4.sup.+, IFN-.gamma..sup.+, and IL-17A.sup.+ cells
(%) were calculated. The bar graphs (mean.+-.SD) show the average
value of data from three independent experiments, single asterisk,
*p<0.05.
[0024] FIG. 5 shows the induction of cell division in CD4.sup.+ T
cells by anti-AITR mAbs. CFSE-labeled CD4.sup.+ T cells were seeded
in a flat-bottomed 96-well tissue culture plate coated with
anti-CD3/IL-2 and treated with anti-AITR mAbs for 3 days.
Histograms are shown in a resolution able to show up to five cycles
of cell divisions by flow cytometry. The experimental result shown
is based on one of the three independent experiments.
[0025] FIG. 6A-6C show the induction of expression of T.sub.H
lineage-specific marker in CD4.sup.+ T cells. Purified CD4.sup.+ T
cells were stimulated with anti-CD3/IL-2 for 3 days (A), and
treated with anti-AITR mAbs (B) or AITR ligand (C) for additional 7
days. The cultured cells were stained for endogenous IL-4,
IFN-.gamma., and IL-17A, and the surfaces thereof were stained with
PE-conjugated anti-AITR mAb (clone A41). Then the cells were
analyzed by flow cytometry. The experimental result shown is based
on one of the three independent experiments.
[0026] FIGS. 7A-7D demonstrate that the anti-AITR monoclonal
antibodies of the present invention recognizing different ECDs of
AITR recruit different signaling proteins in CD4.sup.+ T cells,
thereby demonstrating different activities. Purified CD4.sup.+ T
cells were stimulated with anti-CD3/IL-2 for 3 days and were
further treated with anti-AITR mAbs for 2, 6, 12, and 24 hr. FIG.
7A shows the western blotting analysis demonstrating the expression
of TRAFs. After 24 hr of culturing, the cultured cells were lysed
and immunoprecipitated with anti-AITR mAbs (clones A27, A35 and
A41) and Protein G. Then the immunoprecipitates were immunoblotted
with anti-TRAF1, anti-TRAF2, anti-TRAF3, anti-TRAF5, anti-TRAF6, or
anti-AITR mAb (clones A27, A35 and A41). FIG. 7B shows the western
blotting analysis demonstrating the expression of NFAT1/2, p-p38,
p-ERK1/2, p-JNK1/2, and p-NF-.kappa.B. The cells were treated with
anti-AITR mAbs for the indicated times and lysed. Then the cell
lysates were analyzed by western blotting using the antibodies
against NFAT1/2, p-p38, p-ERK1/2, p-JNK1/2, and p-NF-.kappa.B. The
expression level of the target proteins was normalized to
.beta.-actin expression level. FIG. 7C shows the flow cytometry
analysis showing the expression of STATs. After 24 hours of
culturing, the cells were analyzed by flow cytometry using the
antibodies against p-STAT-1, p-STAT-3, p-STAT-4, p-STAT-5 and
p-STAT-6. FIG. 7D shows the flow cytometry analysis demonstrating
the expression of STAT proteins and master transcription factors.
After 24 hr of culturing, the cells were stained with T-bet,
GATA-3, or ROR.gamma. t antibody and analyzed by flow cytometry.
Expression of STAT proteins and master transcription factors
(filled histograms, arrow pointing) are shown. Numerical values
indicated in each panel represent an average of the data
(mean.+-.SD) from three independent experiments (compared with
control, open histograms).
[0027] FIG. 8 shows the recruitment of TRAF protein and activation
of signal transduction molecule by anti-AITR mAb in CD4.sup.+ T
cell and T.sub.reg cell.
[0028] FIG. 9 shows the activation of STAT protein and master
transcription factor by anti-AITR mAb in CD4.sup.+ T cell and
T.sub.reg cell.
[0029] FIG. 10 shows the switching effect of anti-AITR mAbs in
CD4.sup.+ T cells. Purified CD4.sup.+ T cells were stimulated with
anti-CD3/IL-2 for 3 days for activation. Then the cells were
further treated with anti-AITR mAbs for additional 7 days.
Subsequently, the treated cells were washed and re-stimulated with
media comprising the antibodies having different or same epitopes
for 7 days. The cells were stained for endogenous cytokines
IFN-.gamma., IL-4, and IL-17A. Then the effector phenotypes were
examined. Also, the number of cell populations was calculated. Data
shown are the average of three independent experimental results
(mean.+-.SD), single asterisk, *p<0.05 (compared to other
groups).
[0030] FIG. 11 shows the switching effect of anti-AITR mAbs in
CD4.sup.+ T cell.
[0031] FIGS. 12A-12D show the AITR-mediated conversion of human
T.sub.reg cell to T.sub.H cell and enhancement of immune
suppressing function of T.sub.reg cell by A41. The sample of CD4+ T
cells isolated from healthy subjects and cancer patients were
treated with anti-CD3/IL-2 for 2 days for activation. FIG. 12A
shows the analysis of the effector phenotypes of cytokines.
CD4.sup.+CD25.sup.high T cells isolated from healthy subjects were
treated with anti-AITR mAbs for 7 days. The cultured cells were
stained for endogenous cytokines IFN-.gamma., IL-4, and IL-17A, and
the effector phenotypes were examined by flow cytometry. FIG. 12B
shows the measurements of the expression level of cytokines. The
cell cultures were collected at the indicated times and the level
of TGF-.beta., IFN-.gamma., IL-4, and IL-17A cytokines therein was
measured. FIG. 12C shows the measurements of the expression level
and mean fluorescence intensity (MFI) of master transcription
factors. The isolated CDeCD25.sup.high T cells were stimulated with
anti-AITR mAbs. The cell cultures were collected at the indicated
times and stained with the antibodies against T-bet, ROR.gamma. t,
GATA-3 and Foxp3. The expression level and mean fluorescence
intensity (MFI) of these transcription factors were measured by
using flow cytometry. FIG. 12D shows the analysis of the effector
phenotypes of master transcription factors. The
CD4.sup.+CD25.sup.high T cells isolated from cancer patients were
stimulated with anti-AITR mAbs for 7 days. Subsequently, the
treated cells were stained for endogenous cytokines IFN-.gamma.,
IL-4, and IL-17A, and the effector phenotypes thereof were analyzed
by flow cytometry. The cells were sorted by using flow cytometry,
which were then treated with anti-AITR mAbs for 7 days. The level
of endogenous cytokines IFN-.gamma., IL-4, and IL-17A in the
cultured cell was measured by using flow cytometry. The number of
cell populations was calculated. The data represents the results
from three independent experiments (mean.+-.SD). *p<0.05
(compared to other groups)
[0032] FIG. 13A-13B show the confirmation of AITR-mediated
conversion of human T.sub.reg cells isolated from healthy subjects
to T.sub.H cells. CD4.sup.+ T cells purified from healthy subjects
were stimulated with anti-CD3/IL-2 for 5 days. FIG. 13A shows the
expression of AITR and Foxp3 in CD4.sup.+CD25.sup.high T cells (R1)
and CD4.sup.+CD25.sup.- T cells (R2). CD4.sup.+CD25.sup.high T
cells (R1) and CD4.sup.+CD25.sup.- T cells (R2) were sorted by FACS
sorter which is a flow cytometry. Then the expression of AITR and
Foxp3 was detected in the sorted cells. FIG. 13B shows the analysis
of effector phenotype of CD4.sup.+CD25.sup.high T cells and
CD4.sup.+CD25.sup.- T cells. The sorted CD4.sup.+CD25.sup.high T
cells and CD4.sup.+CD25.sup.- T cells were stimulated with
anti-AITR mAbs. The stimulated cells were stained for endogenous
cytokines IL-4, IFN-.gamma., and IL-17A and were examined for
effector phenotype by flow cytometry. One of the three independent
experimental results is shown.
[0033] FIG. 14A-14B show the recruitment of TRAFs and activation of
other signal molecules in CD4.sup.+CD25.sup.high T cells by
anti-AITR mAbs. The sorted CD4.sup.+CD25.sup.high T cells were
stimulated with anti-AITR mAbs for 6, 12, or 24 hours. FIG. 14A
shows the western blotting analysis of CD4.sup.+CD25.sup.high T
cells for the expression of TRAF proteins. After 24 hours of
culturing, cell lysates were prepared, which were then
immunoprecipitated with protein G. The immunoprecipitates were
immunoblotted with anti-TRAF1, 2, 3, 5 and 6, or anti-AITR mAb.
FIG. 14B shows the western blotting analysis of
CD4.sup.+CD25.sup.high T cell lysates prepared at the indicated
times for the expression of NFAT1/2, p-p38, p-ERK1/2, p-JNK1/2,
p-NF-.kappa.B, or .beta.-actin. Cell lysates were prepared at the
indicated times and immunoblotted with NFAT1/2, p-p38, p-ERK1/2,
p-JNK1/2, p-NF-.kappa.B, or .beta.-actin. The results were
normalized according to the level of .beta.-actin expression. Data
shown here are representative of three independent experiments.
[0034] FIGS. 15A and B show the induction and activation of STAT
proteins and master transcription factors in CD4.sup.+CD25.sup.high
T cells by anti-AITR mAbs. The sorted CD4.sup.+CD25.sup.high T
cells were stimulated with anti-AITR mAbs. FIG. 15A shows the
analysis of STAT protein expression. After 24 hours of culturing,
the cultured cells were analyzed by flow cytometry using the
antibodies against p-STAT-1, p-STAT-3, p-STAT-4, p-STAT-5 and
p-STAT-6. Expressions of STAT proteins are shown as filled
histograms (arrow pointing) in comparison to the control group
(unfilled histogram). Data are representative of three independent
experiments (mean.+-.SD). FIG. 15B shows the flow cytometry
analysis of T-bet, GATA-3, ROR.gamma. t and Foxp3. Culture cells
were collected at the indicated times and stained with T-bet,
GATA-3, ROR.gamma. t and Foxp3 antibodies, and then analyzed by
flow cytometry. One of the three independent experimental results
is shown.
BEST MODE
[0035] As one aspect, the present invention provides a polypeptide
defined by an amino acid sequence of SEQ ID No.2, which is an
epitope of activation-inducible tumor necrosis factor receptor
(AITR), for converting T cell to type 2 helper T (T.sub.H2)
cell.
[0036] As used herein, "activation-inducible tumor necrosis factor
receptor (AITR)" refers to a type of receptor belonging to TNFR
superfamily, and can be interchangeably used with
glucocorticoid-induced TNFR-related protein (GITR), tumor necrosis
factor receptor superfamily member 18 (TNFRSF18), or CD357. The
AITR may preferably be human AITR, but is not limited thereto.
Information on AITR can be obtained from a well-known database such
as NCBI GenBank. For instance, the information on AITR may be found
by searching with NCBI Reference Sequence: NP.sub.--004186, but is
not limited thereto. The AITR is expressed constitutively at high
level in activated T cell or T.sub.reg cell.
[0037] As used herein, the term "epitope" refers to a site on
antigen determining the antigen specificity, and can be
interchangeable used with antigen determining group or antigen
determining site. For the purpose of the present invention, the
epitope refers to the site corresponding to 20.sup.th to 30.sup.th
amino acids of AITR-ECD, which can convert T cell to T.sub.H2 cell
or enhance suppressive function of T.sub.reg cell, but is not
limited thereto as long as the sequence has the same converting
activity. Also, the scope of the epitope may include the sequence
having at least 80%, 90%, 95%, 98%, or 99% sequence homology to the
sequence of 20.sup.th to 30.sup.th amino acids of AITR-ECD without
limitation, as long as it has the same activity as the
above-specified sequence. The sequence of 20.sup.th to 30.sup.th
amino acids of AITR-ECD is shown in FIG. 3C and Table 2, and named
as SEQ ID No.2. The present inventors identified for the first time
that an epitope represented by an amino acid sequence of SEQ ID
No.2 is the part that can induce the conversion of T cell T.sub.H2
cell or enhance the suppressive function of T.sub.reg cell. In an
effort to identify the site that can specifically convert T cell to
T.sub.H2 cell in AITR-ECD constituted of 139 amino acids (SEQ ID
No.1), the present inventors have confirmed that when the sequence
of 20.sup.th to 30.sup.th amino acids represented by SEQ ID No.2 is
used as an epitope, it can specifically convert T cell to T.sub.H2
cell. On the other hand, for the antibodies that recognize other
sequences adjacent to 20th to 30.sup.th amino acids as an epitope,
they did not show the converting activity to T.sub.H2 cell, and
thus it was identified that the sequence of 20.sup.th to 30.sup.th
amino acids of the AITR-ECD is highly specific for T cell
conversion to T.sub.H2 cell (Experimental Examples 2 and 4 to
8).
[0038] As used herein, "conversion of T cell to type 2 helper T
(T.sub.H2) cell" refers to converting T cell to T.sub.H2 cell
through antibody binding to a specific epitope of AITR represented
by SEQ ID No.2 or non-antibody protein specifically binding to the
same. Preferably the conversion refers to the conversion of T cell
to T.sub.H2 producing IL-4 through an antibody binding to the
epitope of AITR in T cell represented by SEQ ID No.2, but is not
limited thereto. The conversion of T cell to T.sub.H2 can be
identified by observing the expression or secretion of T.sub.H2
cell-specific marker, for example cytokines such as IL-4;
activation of IL-4/NFAT-2/STAT-6 signal transduction pathway; and
expression or activation of transcription factor such as GATA-3.
The T cell refers to a T cell expressing AITR, and for example it
may be the activated T cell. In one example of the present
invention, it was identified that CD4+ T cell and regulatory T cell
expressed AITR when stimulated by anti-CD3/IL-2 or LPS. The
T.sub.H2 cell is an immune cell secreting 1L-4. T.sub.H2 cell
mediates immune response to parasites. Therefore, a polypeptide of
the present invention which is an epitope of AITR represented by
SEQ ID No.2 that can convert T cell to T.sub.H2 cell can be
effectively used in the development of antibody for converting the
cells to T.sub.H2 cells. In the conversion of T cell to T.sub.H2
cell, the T cell includes various types of T cells such as
CD4.sup.+ T cell, T.sub.H1 cell or T.sub.H17 cell, but is not
limited thereto. In one Example of the present invention, it was
confirmed that CD4.sup.+ T cell can be converted to T.sub.H2 (FIGS.
4A-4B and 6A-6C), and also T.sub.H1 cell or T.sub.H17 cell with
designated cell fate can be converted to T.sub.H2 cell by A41 which
is an antibody that binds to the epitope of SEQ ID No.2 of the
present invention (FIGS. 10 and 11). Thus, epitope of AITR with SEQ
ID No.2 is identified as an important site for conversion of
various T cells to T.sub.H2 cells.
[0039] As used herein, "suppressive function of T.sub.reg cell"
refers to a function of suppressing immune response, that is,
inhibiting the activity, proliferation, or function of various
types of immune cells such as CD8.sup.+ T cells, natural killer
(NK) cells, B cells, but is not limited thereto. The T.sub.reg cell
refers to a type of T cell that can down regulate immune system.
Also, a regulatory T cell can be interchangeably used with
T.sub.reg cell, CD4.sup.+CD25.sup.high cell, or
CD4.sup.+CD25.sup.highFoxp3.sup.+ cell. The T.sub.reg cell
comprises both of natural or constitutive regulatory T cell and
adaptive or inducible regulatory T cell. The suppressive function
of T.sub.reg cell can be enacted through various pathways. To be
specific, the suppressive function can be enacted by 1) suppressing
immune response through secreting inhibitory cytokines such as
IL-10, IL-35, or TGF-.beta., 2) binding to CD80/CD86 expressed in
effector T cell or APC through CTLA4 and inhibiting the functions
thereof, or 3) preventing IL-2 from binding to a receptor of naive
T cells by introducing an alternative IL-2 receptor that has
significantly higher affinity to IL-2 than a natural IL-2 receptor
present in native T cells, but is not limited thereto. The antibody
of the present invention that specifically recognizes the epitope
of SEQ ID No.2 acts to enhance the suppressive function of
T.sub.reg cell. The enhancement of suppressive function can be
confirmed by using a conventional method in the art, and the
example of such method includes monitoring of the activation of
signal transduction pathway such as STAT-5 or the increase of
secretion of cytokines such as TGF-.beta. which functions as a main
regulatory factor in the suppressive function of T.sub.reg
cell.
[0040] In one example of the present invention, it was confirmed
that activated T cell was differentiated into T.sub.H2 cell by A41
which is a representative antibody of the present invention that
specifically recognizes the epitope of SEQ ID No.2. However, other
AITR-specific antibody recognizing the site other than the epitope
of SEQ ID No.2 did not show the above converting activity. To be
specific, A27 antibody recognizing the sequence of 56.sup.st to
65.sup.th amino acids and A35 antibody recognizing the sequence of
41.sup.th to 50.sup.th amino acids could not differentiate T cell
to T.sub.H2 cell, even though these epitope sites were close to the
sequence of 20.sup.th to 30.sup.th amino acids of AITR-ECD (FIGS.
3A-3C, 4A-4B and 6A-6C). In addition, even after the T cell was
converted to the cells that secrete a specific cytokine through
treatment with A27 or A35, the cell could be re-converted to
IL-4-secreting cell, when treated with A41 antibody recognizing the
epitope of SEQ ID No.2 of the present invention (FIGS. 10 and 11).
These results suggest that the epitope of SEQ ID No.2 is
significantly important site in cell conversion to T.sub.H2 cell.
Also, in one example of the present invention, a molecular
mechanism behind the conversion to T.sub.H2 cell through an epitope
of SEQ ID No.2 was investigated. NFAT2 is involved in the
conversion to T.sub.H2 cell and it increases phosphorylation level
of STAT-5 and STAT-6 proteins (FIGS. 7A-7D to 9). In addition, it
was observed that a representative antibody of the present
invention, A41, increased the level of GATA-3 which is a T.sub.H2
cell-specific marker (FIG. 7D), thereby confirming that T cell
could be efficiently converted to T.sub.H2 cell by the present
antibody. Also, when T.sub.reg cell was treated with a
representative antibody of the present invention, A41, the
secretion of inhibitory cytokine such as TGF-.beta. was
significantly increased (FIG. 12B) and the phosphorylation of
STAT-5 was promoted (FIGS. 15A-15B). These results suggest that
when the antibody of the present invention acts specifically to
AITR of T.sub.reg cell, the suppressive function of T.sub.reg cell
can be effectively enhanced.
[0041] As another aspect, the present invention provides an
antibody specifically recognizing an epitope of
activation-inducible tumor necrosis factor receptor (AITR), wherein
the epitope is represented by SEQ ID No.2.
[0042] As used herein, the term "antibody" refers to a protein
molecule that acts as a receptor recognizing an antigen
specifically, comprising an immunoglobulin molecule that responses
to a specific antigen immunologically. Also, the antibody comprises
all of polyclonal antibody, monoclonal antibody, whole antibody,
and antibody fragment. In addition, the scope of antibody includes
a chimeric antibody (for example, humanized murine antibody) and
bivalent or bispecific molecule (for example, bispecific antibody),
diabody, triabody, and tetrabody. The whole antibody is constituted
of two full-length light chains and two full-length heavy chains,
wherein each of the light chains is connected with heavy chains
through disulfide binding. The whole antibody comprises IgA, IgD,
IgE, IgM, and IgG. IgG comprises IgG1, IgG2, IgG3, and IgG4 as
subtypes thereof. The antibody fragment refers to a fragment
capable of binding to antigen, and it comprises Fab, Fab', F(ab')2,
and Fv. The Fab is constituted of variable regions of light chain
and heavy chain, constant region of light chain, and the first
constant region of heavy chain (CH1 domain), having one
antigen-binding site. Fab' is different from Fab in that it has a
hinge region which comprises more than one cysteine residue at
C-terminal of heavy chain CH1 domain. F(ab')2 antibody is formed
through disulfide bonding of cysteine residues in the hinge region
of Fab'. A variable fragment (Fv) refers to a minimized antibody
fragment having heavy chain variable region and light chain
variable region. In a double stranded Fv (dsFv), heavy chain
variable region and light chain variable region are connected
through disulfide bonding while in a single stranded Fv (scFv),
heavy chain variable region and light chain variable region are
covalently bonded through peptide linker. These antibody fragments
can be obtained by treating the antibody with protease (for
example, when a whole antibody is restriction digested with papain,
Fab is obtained and when restriction digested with pepsin, F(ab')2
fragment can be obtained). Preferably, the antibody fragment can be
generated by using genetic recombination technique.
[0043] As used herein, the term "monoclonal antibody" refers to an
antibody molecule that has been obtained from a substantially
identical antibody clone, which shows single-binding specificity
and affinity for a specific epitope.
[0044] Typically, immunoglobulin has heavy chain and light chain
and each of the heavy chain and light chain possesses constant
region and variable region (also known as domains). A variable
region of light chain and heavy chain comprises three variable
regions and four framework regions called
complementarity-determining region (hereinafter referred to as
"CDR"). The CDR mainly acts to bind to an epitope of antigen. CDRs
of each chain is conventionally called CDR1, CDR2, and CDR3
successively starting from the N-terminal, and also they are
distinguished by the chain at which they are located.
[0045] As used herein, the term "human antibody" refers to a
molecule derived from human immunoglobulin, in which all of the
amino acid sequences constituting the antibody including
complementarity-determining regions and framework regions are
composed of amino acid sequences of human immunoglobulin. Human
antibody is conventionally used for treating human diseases, which
has more than three potential advantages. First, human antibody
interacts more favorably with human immune system, and thus it can
destroy the target cell more efficiently, for example through
complement-dependent cytotoxicity (CDC) or antibody-dependent
cell-mediated cytotoxicity (ADCC). Secondly, human immune system
does not recognize the human antibody as a foreign substance.
Thirdly, when smaller dose of drug was administered at lower
frequency, half-life of human antibody in human circulation is
similar to that of naturally-occurring antibodies. In one example
of the present invention, it was confirmed that a human monoclonal
antibody specifically recognizing the epitope of SEQ ID No.2
demonstrates a strong affinity toward AITR and thus can effectively
convert T cell to T.sub.H2 cell and enhance the suppressive
function of T.sub.reg cells (FIGS. 1A-1D to 15A-15B). The heavy
chain and light chain domains of the present antibody having the
activity of converting T cell to T.sub.H2 cell and enhancing the
suppressive function of T.sub.reg cells are all human-derived
showing lower rate of immunogenicity, and thus the antibody can be
effectively used for treating autoimmune disease.
[0046] As used herein, "antibody specifically recognizing an
epitope of activation-inducible tumor necrosis factor receptor
(AITR) represented by SEQ ID No.2" refers to an antibody that can
convert T cell to T.sub.H2 cell by specifically recognizing an
epitope of SEQ ID No.2 or enhance the suppressive function of
T.sub.reg cell, but is not limited thereto. The antibody
particularly enhances the suppressive function of T.sub.reg cells,
for example, production of inhibitory cytokine, TGF-.beta., and
thus it can be effectively used for preventing or treating
autoimmune disease; and for enhancing immunity.
[0047] The antibody specifically recognizing the epitope of SEQ ID
No.2 may preferably comprise a heavy chain variable region
comprising heavy chain complementarity-determining region 1 (CDR1)
represented by SEQ ID No.6; heavy chain CDR2 represented by SEQ ID
No.7; and heavy chain CDR3 represented by SEQ ID No.8, and a light
chain variable region comprising light chain CDR1 represented by
SEQ ID No.10; light chain CDR2 represented by SEQ ID No.11; and
light chain CDR3 represented by SEQ ID No.12. More preferably, the
antibody may comprise an amino acid sequence of heavy chain
variable region represented by SEQ ID No.5 and an amino acid
sequence of light chain variable region represented by SEQ ID No.9,
but is not limited thereto. In one example of the present
invention, a human monoclonal antibody comprising the amino acid
sequence of heavy chain variable region represented by SEQ ID No.5
and the amino acid sequence of light chain variable region
represented by SEQ ID No.9 was named as A41. In addition, the
polynucleotide encoding the antibody may comprise a nucleotide
sequence of a heavy chain variable region represented by SEQ ID
No.13; and a nucleotide sequence of a light chain variable region
represented by SEQ ID No.14, but is not limited thereto.
[0048] In addition, if the antibody of the present invention
comprises a constant region, the constant region may be derived
from IgG, IgA, IgD, IgE, and IgM or a combination or hybrid
thereof.
[0049] As used herein, the term "combination" refers to, when
forming a dimer or polymer, a combination of a polypeptide coding
for single-chain immunoglobulin constant region of same origin with
single-chain polypeptide of different origin. For example, the
dimer or polymer can be formed with more than two constant regions
selected from the group consisting of constant regions of IgG, IgA,
IgD, IgE, and IgM.
[0050] As used herein, the term "hybrid" refers to the presence of
more than two immunoglobulin heavy chain constant regions of
different origins within a single-chain immunoglobulin heavy chain
constant region. For example, a hybrid of domains can be formed
with 1 to 4 domains selected from the group consisting of CH1, CH2,
CH3, and CH4 of IgG, IgA, IgD, IgE, and IgM. Meanwhile, a
combination or hybrid of heavy chain constant regions of the
subtypes of IgG such as IgG1, IgG2, IgG3, and IgG4 is also
possible. The combination and hybrid are the same as described
above.
[0051] Also, if the antibody of the present invention comprises a
light chain constant region, the light chain constant region may be
derived from lambda(.lamda.) or kappa(.kappa.) light chain.
[0052] In one example of the present invention, A41 that
specifically binds to the epitope of AITR with SEQ ID No.2 was
selected from a human antibody library (Experimental Example 1),
and their specific binding to AITR was confirmed (FIGS. 1A-1D). In
addition, the antibody recognition sites on AITR-ECD were
identified (FIGS. 3A-3C and Table 2). Also, it was confirmed that
unlike other antibodies that recognize other sites of AITR, the
above-described antibodies can convert T cell to T.sub.H2 cell
(FIGS. 4A-4B to 11), and furthermore, even the T cells that were
already differentiated into specific T cell, the antibodies can
re-convert the cell to T.sub.H2 cell (Experimental Examples 7 and
8, and FIGS. 10 and 11). In addition, when the antibody of the
present invention acted to T.sub.reg cells, it increased the
production level of TGF-.beta. in T.sub.reg cells, thereby
enhancing the suppressive function of T.sub.reg cells and at the
same time, the phosphorylation level of STAT-5 was also increased
(FIGS. 12A-12D to 15A-15B). These results support that the
AITR-specific antibody of the present invention that recognizes an
epitope of SEQ ID No.2 can be used for prevention or treatment of
autoimmune disease that requires efficient conversion of T cell to
T.sub.H2 cell; and enhancement of suppressive function of T.sub.reg
cells.
[0053] As another aspect, the present invention provides a method
for preparing the antibody.
[0054] The antibody of the present invention can be easily prepared
by a conventional method for production of antibody. For example, a
monoclonal antibody can be prepared by generating hybridoma with B
lymphocyte obtained from immunized animals (Koeher and Milstein,
1976, Nature, 256:495), and phage display technique, but is not
limited thereto. A polyclonal antibody can be easily prepared by a
conventional method for production of antibody, and also it can be
prepared by using an antigen comprising the epitope of the present
invention.
[0055] Production of antibody library by using phage display
technique is done by obtaining an antibody gene directly from B
lymphocyte without producing hybridoma and expressing the antibody
on the phage surface. By using the phage display technique, many
limitations associated with the production of monoclonal antibody
can be overcome by B-cell immortalization. In general, a phage
display technique consists of the steps of (1) inserting
oligonucleotides of random sequences to the nucleotide sequence
corresponding to N-terminal of phage coat protein pHIII (or pIV);
(2) expressing a fusion protein of a partial naive coat protein and
a polypeptide coded by the oligonucleotide of random sequence; (3)
treating a receptor material that can bind to the polypeptide coded
by the oligonucleotide; (4) eluting the peptide-phage particles
bound to receptors by lowering pH or using competitive molecules
for binding to the receptors; (5) amplifying a phage sample eluted
by panning within the host cells; (6) repeating the above process
to obtain desired amount of phage products; and 7) determining the
sequence of active peptide among the DNA sequences of phage clones
selected by panning.
[0056] Preferably, production of a monoclonal antibody of the
present invention can be done by using phage display technique.
Those skilled in the art can easily perform each step of the
preparation method of the present invention according to a
conventional phage display technique, for example a method
described in Barbas et al. (METHODS: A Companion to Methods in
Enzymology 2:119, 1991; J. Virol. 2001 July; 75(14):6692-9) and
Winter et al. (Ann. Rev. Immunol. 12:433, 1994). A type of phage
that can be used for generating antibody library includes
filamentous phage such as fd, M13, f1, If1, Ike, Zj/Z, Ff, Xf, Pf1,
or Pf3 phage, but is not limited thereto. In addition, a type of
vector that can be used for expressing heterologous gene on
filamentous phage surface includes a phage vector such as fUSE5,
fAFF1, fd-CAT1, or fdtetDOG or a phagemid vector such as pHEN1,
pComb3, pComb8, or pSEX, but is not limited thereto. Also, a type
of helper phage that can be used for providing a wild-type coat
protein which is required for the successful reinfection of
recombinant phage for amplification includes M13K07 or VSCM13
helper phage, but is not limited thereto.
[0057] The hybridoma-derived monoclonal antibody or polynucleotide
encoding phage display clones of the present invention can be
easily isolated and analyzed for the sequence thereof through a
conventional process. For example, oligonucleotide primers designed
to specifically amplify the heavy chain and light chain coding
region from hybridoma or phage template DNA can be used. Once the
polynucleotide is isolated, it can be inserted to an expression
vector, which can be subsequently introduced to a suitable host
cell, thereby producing a desired monoclonal antibody from the
transformed host cell (i.e., transformant). Therefore, the method
for preparing the antibody of the present invention may be a method
for preparing antibody comprising the step of amplifying the
expression vector comprising polynucleotide encoding the antibody,
but is not limited thereto.
[0058] As another aspect, the present invention provides a
polynucleotide encoding the epitope or antibody, an expression
vector comprising the polynucleotide, and a transformant introduced
with the vector.
[0059] The antibody is the same as described above.
[0060] The expression vector of the present invention comprising a
polynucleotide encoding the epitope or antibody is not limited to,
but may be a vector that can replicate and/or express the
polynucleotide in eukaryotic cells including animal cells (for
example, human, monkey, rabbit, rat, hamster, and mouse cell etc),
plant cell, yeast cell, insect cell, or bacterial cell (for
example, E. coli), or prokaryotic cells. Preferably, the vector may
be a vector wherein the nucleotide is operably linked to a suitable
promoter for the expression thereof in a host cell and at least one
selection marker is included. For example, the expression vector of
the present invention may be in a form of a phage vector, plasmid
vector, cosmid vector, mini-chromosome vector, viral vector, or
retroviral vector wherein the polynucleotide is introduced.
[0061] The expression vector comprising polynucleotide encoding the
antibody may be an expression vector comprising each of
polynucleotides encoding the heavy chain or light chain of the
antibody, or an expression vector comprising all of polynucleotides
encoding heavy chain or light chain.
[0062] The transformant of the present invention wherein the
expression vector is introduced is not limited to, but may be
prepared from bacterial cells such as E. coli, Streptomyces, and
Salmonella typhimurium; yeast cells; fungal cells such as Pichia
pastoris; insect cells such as Drosophila, Spodoptera Sf9 cell;
animal cells such as Chinese hamster ovary (CHO) cells, mouse bone
marrow cell SP2/0, human lymphoblastoid, COS, mouse bone marrow
cell NSO, 293T, BOW melanoma cell lines, HT-1080, baby hamster
kidney (BHK) cells, human embryonic kidney (HEK) cells, human
retinal cell PERC.6; or plant cells by transforming the same with
the expression vector.
[0063] As used herein, the term "introduction" refers to a method
of transferring a vector comprising the polynucleotide encoding
epitope or antibody to a host cell. Such introduction can be done
by using various methods known in the art such as Calcium
phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection,
polybrene-mediated transfection, electroporation, microinjection,
liposome fusion, lipofectamine, and protoplast fusion. Also,
transduction refers to a transfer of a target molecule into the
cell by using viral particles through infection. Furthermore, a
vector can be introduced to the host cell through gene bombardment.
In the present invention, the term introduction can be
interchangeably used with transfection.
[0064] As another aspect, the present invention provides a
composition comprising the antibody for converting T cell to type 2
helper T (T.sub.H2) cell.
[0065] The antibody, T cell, T.sub.H2 cell, and conversion of T
cell to T.sub.H2 cell are the same as described above. The antibody
of the present invention specifically recognizing the epitope of
AITR represented by SEQ ID No.2 can convert T cell to T.sub.H2 cell
specifically, and thus a composition comprising the antibody can be
used for the conversion of T cell to T.sub.H2 cell. Especially,
since the composition of the present invention can re-convert the
already differentiated cell (e.g., T.sub.H1 cell or T.sub.H17 cell)
to T.sub.H2 cell, it can be diversely used depending on the
purpose.
[0066] As another aspect, the present invention provides a method
for converting T cell to type 2 helper T (T.sub.H2) cell,
comprising treating T cell with the antibody.
[0067] The antibody, T cell, T.sub.H2 cell, and conversion of T
cell to T.sub.H2 cell are the same as described above. When the T
cell, for example CD4.sup.+ T cell, T.sub.H1 cell, or T.sub.H17
cell, are treated with the antibody of the present invention, it
can be effectively converted to T.sub.H2 cell, and thus the
antibody can be effectively used in the treatment of diseases that
need the function of T.sub.H2 cell by converting T cell to T.sub.H2
cell.
[0068] As another aspect, the present invention provides a
pharmaceutical composition for preventing or treating autoimmune
disease, comprising the antibody.
[0069] The antibody is the same as described above.
[0070] As used herein, the term "autoimmune disease" refers to
diseases that are directly or indirectly caused by an inappropriate
immune response against the subject's own antigen. Type of
autoimmune diseases is not limited but may include rheumatic
arthritis, systemic scleroderma, systemic lupus erythematosus,
atopic dermatitis, psoriasis, areata alopecia, asthma, Crohn's
disease, Behcet's disease, Sjogren's syndrome, Guilliain-Barre
syndrome, chronic thyroiditis, multiple sclerosis, polymyositis,
ankylosing spondylitis, encephalomyelitis, fibrositis, or
polyarteritis nodosa.
[0071] As used herein, the term "prevention" refers to all actions
that suppress or delay the onset of autoimmune disease by
administering a composition.
[0072] As used herein, the term "treatment" refers to all actions
that can alleviate or beneficially change the symptoms of
autoimmune disease by administering a composition.
[0073] The pharmaceutical composition may additionally comprise a
pharmaceutically acceptable carrier.
[0074] As used herein, the term "pharmaceutically acceptable
carrier" refers to a carrier or diluent that does not inhibit a
biological activity and feature of the administered compound
without irritating an organism. Types of pharmaceutical carriers
suitable for a composition of liquid formulation include saline
solution, sterile water, Ringer's solution, buffered saline
solution, albumin solution, dextrose solution, maltodextrin
solution, glycerol, ethanol, and a combination thereof, as a
sterilized and acceptable carrier to the organism. If necessary,
other conventional additives such as antioxidant, buffer solution,
and bacteriostatic agent can be added. Also, the pharmaceutical
composition may be formulated into a formulation for injection such
as aqueous solution, suspension, emulsion; pill, capsule, granule,
and tablet by further adding a diluent, dispersant, surfactant,
binder, and lubricant.
[0075] The pharmaceutical composition may be in a form of various
oral or parenteral formulations. The composition is formulated with
conventional diluents or excipients, including fillers, extenders,
binders, wetting agents, disintegrants, and surfactants. Solid
formulations for oral administration include tablets, pills,
powders, granules, and capsules. These solid formulations are
prepared by mixing one or more compounds with at least one of
excipients, for example, starch, calcium carbonate, sucrose,
lactose, and gelatin. Also, other than the simple excipients,
lubricants such as magnesium stearate and talc are used. In
addition, types of liquid formulation for oral administration
include a suspension, solution, emulsion and syrup. To this liquid
formulation, not only a commonly used diluent such as water and
liquid paraffin may be added, but also various types of excipients
such as wetting agents, sweetening agents, flavors, and
preservatives can be added. Types of formulations for parenteral
administration include sterilized aqueous solutions, non-aqueous
solutions, suspensions, emulsions, lyophilized formulation, and
suppositories. As non-aqueous solvent and suspending agent,
propylene glycol, polyethylene glycol, vegetable oils such as olive
oil, and injectable esters such as ethyl oleate may be used. The
base composition for suppository may include witepsol, macrogol,
tween 61, cacao butter, laurin butter, and glycerinated
gelatin.
[0076] The pharmaceutical composition of the present invention may
be formulated in any one of the forms selected from the group
consisting of tablets, pills, powders, granules, capsules,
suspension, solutions, emulsions, syrups, sterilized aqueous
solution, non-aqueous solution, lyophilized formulation and
suppository.
[0077] The composition of the present invention is administered in
a pharmaceutically effective amount.
[0078] As used herein, the term "pharmaceutically effective amount"
refers to an amount sufficient to treat a disease, at a reasonable
benefit/risk ratio applicable to any medical treatment. The
effective dosage level of the composition may be determined by the
factors including a type of subject, severity of condition, an age
and sex of subject, a type of virus infected, an activity of drug,
a sensitivity towards drug, duration and route of administration,
excretion rate, duration of treatment, a type of drugs used in
combination with the composition, and other factors well-known in
the medical field. The composition of the present invention may be
administered alone or in combination with other medicines, and it
may be administered sequentially or simultaneously with
conventional medicines. Also, the present composition may be
administered in single or multiple doses. In view of all of these
factors, it is important to administer the composition in a minimum
amount yielding the maximum possible effect without causing side
effects, which can be easily determined by those skilled in the
art.
[0079] In autoimmune disease, T.sub.reg cell takes a key role in
the suppression of immune responses, and thus there have been many
attempts to increase the number of T.sub.reg cells and enhance the
suppressive function of T.sub.reg cells for treating the autoimmune
disease (Kim et al., Korean J Otorhinolaryngol-Head Neck Surg,
53:737-48, 2010). In this regard, the antibody of the present
invention recognizing the epitope of AITR with SEQ ID No.2
increases the production of TGF-.beta. which is an inhibitory
cytokine of T.sub.reg cell having immune suppressive function.
Therefore, the antibody of the present invention can be effectively
used for the prevention or treatment of autoimmune disease through
enhancing the suppressive function of T.sub.reg cells.
[0080] In one Example of the present invention, it was identified
that the antibody of the present invention that binds to the
epitope of SEQ ID No.2 increases the production of TGF-.beta. which
is an inhibitory cytokine of T.sub.reg cells, thereby confirming
that the present antibody can be used for the prevention and
treatment of autoimmune disease (FIG. 12B).
[0081] As another aspect, the present invention provides a method
for treating autoimmune disease, comprising administering the
antibody to a subject in need thereof.
[0082] The antibody and autoimmune disease are the same as
described above.
[0083] The method for treating autoimmune disease may be a method
comprising the step of administering the pharmaceutical composition
comprising the antibody and pharmaceutically acceptable carrier in
addition to a subject having autoimmune disease or suspected of
having autoimmune disease. The pharmaceutically acceptable carrier
is the same as described above. The method for treating autoimmune
disease may preferably be a method comprising the step of
administering the composition comprising the antibody to a subject
having autoimmune disease.
[0084] The type of subject includes mammals and birds such as cows,
pigs, sheep, chickens, dogs, and human, and is not limited as long
as autoimmune disease in the subject can be treated by
administration of the composition of the present invention.
[0085] The composition may be administered in single or multiple
doses in a pharmaceutically effective amount. In this regard, the
composition may be administered in a form of solutions, powders,
aerosols, capsules, enteric-coated tablets or capsules or
suppositories. The routes for administration include
intraperitoneal, intravenous, intramuscular, subcutaneous,
intradermal, oral, topical, intranasal, intrapulmonary and
intrarectal administration, but are not limited thereto. However,
since peptides are digestible when orally administered, the active
ingredients of a composition for oral administration need to be
coated or formulated such that they can be protected against
degradation in stomach. In addition, a pharmaceutical composition
may be administered through a certain apparatus capable of
transporting the active ingredients into a target cell.
[0086] The pharmaceutical composition of the present invention may
comprise an antibody that specifically binds to the epitope of SEQ
ID No.2. The antibody can increase the production of TGF-.beta.
which is an inhibitory cytokine of T.sub.reg cells, thereby
enhancing the suppressive function of T.sub.reg cells. Therefore,
through administering the pharmaceutical composition comprising the
antibody into the body, the onset or progression of autoimmune
disease can be prevented, thereby preventing or treating autoimmune
disease.
MODE FOR INVENTION
[0087] Hereinafter, the present invention is described in more
detail with reference to Examples. However, these Examples are for
illustrative purposes only, and the invention is not intended to be
limited by these Examples.
Example 1
Cell Isolation
[0088] Peripheral venous blood samples newly collected from healthy
individuals and cancer patients were treated with heparin and
peripheral-blood mononuclear cells (PBMCs) were isolated by
Ficoll-paque gradient centrifugation (GE Healthcare, Piscataway,
N.J.). The isolated PBMCs were resuspended in RPMI 1640 medium
containing 1% FBS for 2 days. Subsequently, naive CD4.sup.+ T cell
subsets were collected through positive selection using
anti-CD4.sup.+ antibodies (Miltenyi Biotec, Gladbach, Germany). The
purity of the selected CD4.sup.+ T cell fractions was approximately
97%.
[0089] In order to obtain high purity of CD4.sup.+CD25.sup.high/- T
cells, the isolated CD4.sup.+ T cells were stimulated with 0.1
.mu.g/ml anti-CD3 antibodies (HIT3a; BD PharMingen, San Diego,
Calif.) for 7 days, and 100 U/ml IL-2 (Interleukin-2; PeproTech,
Rocky Hill, N.J.) was added every 2 days. Subsequently, the
cultured CD4+ T cells were stained with the PE-cy5-conjugated
anti-CD25 antibody and FITC-conjugated anti-CD4 antibody. Finally,
the CD4.sup.+CD25.sup.high T cells or CD4.sup.+CD25.sup.- T cells
were isolated by using FACS Aria (BD Biosciences, San Jose,
Calif.).
Example 2
Antibodies and Flow Cytometry
[0090] In the flow cytometry experiment, the present inventors used
fluorochrome-conjugated antibodies against CD4, CD8, CD11c,
IFN-.gamma., Foxp3, CTLA-4, CD62L, CD45RO, CD45RA (BD Bioscience),
CD19, CD56, CD14, CD127, IL-4, IL-17A, GATA-3, T-bet, ROR.gamma. t
(ebioscience, San Diego, Calif.), and BDCA-2 (Miltenyi Biotec).
Also, for anti-AITR antibody, biotinylated AITR-specific antibodies
(A27, A35, A41, B32, and B62 clones) were used. Intracellular level
of cytokines was measured after 5 hour-long pre-incubation with 50
ng/ml phorbol 12-myristate 13-acetate (PMA), 10 .mu.g/ml ionomycin,
and 10 .mu.g/ml Brefeldin A (Sigma-Aldrich, St Louis. Mo.).
FACSCalibur flow cytometer (BD Bioscience) was used for all of the
flow cytometry analysis and WinMDI software (Ver. 2.9, Scripps.
Institute) was used for data analysis.
Example 3
Preparation of Soluble AITR and AITR-Overexpressing Cell
[0091] Specific binding of human anti-AITR mAbs was measured by
using Enzyme-linked immunosorbent assay (ELISA) or FACS. In order
to generate a fusion protein of a water-soluble AITR-ECD (26.sup.th
to 139.sup.th amino acids) and GST protein, a GST-tagged AITR-ECD
expression vector (pGEX-6p-1/AITR-ECD) was constructed. First,
AITR-coding sequence was amplified by PCR using a sense primer and
antisense primer shown in Table 1 and using cDNA extracted from the
activated CD4.sup.+ T cells as a PCR template. Then the amplified
AITR-coding sequence was restriction digested with BamHI/XhoI, and
cloned into a vector pGEX-6p-1 to generate a GST-tagged AITR-ECD
expression vector (pGEX-6p-1/AITR-ECD).
TABLE-US-00001 TABLE 1 SEQ ID Sequence (5'.fwdarw.3') No. Forward
AAGCTTGGTCAGCGCCCCACCGGG 49 Primer Reverse CCGGCAGAGCCGCCTTAACTCGAG
50 Primer
[0092] The pGEX-6p-1/AITR-ECD was transformed into E. coli
(BL21-DE3-pLyss) and the protein expression was induced by adding
0.20 mM IPTG. The recombinant AITR-GST proteins expressed in E.
coli were purified by running them through a glutathione agarose 4B
bead column.
[0093] For generating AITR-overexpressing cells, the gene fragment
encoding AITR-transmembrane domain (TM)-ECD was inserted in-frame
with CD5L sequence in a mammalian vector pcDNA3.1(+), i.e.
pcDNA3.1(+)/CD5L-AITR-TM-ECD. Then pcDNA3.1(+)/Empty vector or
pcDNA3.1(+)/CD5L-AITR-TM-ECD vector was transient transfected into
Jurkat cells by electroporation. AITR expression on cell surface
was detected by staining with biotin-conjugated anti-AITR mAb.
Example 4
Preparation of Anti-AITR Monoclonal Antibodies (Anti-AITR mAbs)
[0094] The pCANTAB5E phagemid vector comprising human Fab antibody
cDNA library was transformed into TG1 E. coli cells. Subsequently,
the transformants were cultured in 2.times.YT broth containing 100
.mu.g/ml ampicillin and 50 .mu.g/ml kanamycin, and then
superinfected with M13K07 helper phage. After culturing the cells
at 30.degree. C. for 24 hours, the cell culture was centrifuged
down to collect culture supernatant only. Then the supernatant was
added with 3.3% (w/w) polyethylene glycol (Sigma) and 2.3% (w/w)
NaCl to precipitate recombinant phage particles obtained. The
precipitated phage particles were resuspended in 2.times.YT
broth.
[0095] Biopanning was performed using the above-prepared suspension
as a library in order to select the phage specific to a human
AITR-GST fusion protein by phage display (1 to 4 times biopanning).
Among the recombinant phage particles from the culture supernatant
of each clone, a positive clone of human AITR-GST fusion protein
was selected through ELISA.
[0096] In addition, to generate a bivalent form of antibody, Fab
genes (V.sub.H and V.sub.L) obtained from phage displaying were
prepared by PCR, and then cloned into a restriction enzyme site of
the expression vector pDCMV-DHFR. As a result, an antibody gene and
construct thereof of five different clones (A27, A35, A41, B32, and
B62) were obtained. To generate a bivalent form of anti-human AITR
mAbs, the construct of antibody gene was transiently transfected
into HEK293 and CHO cells, and the protein products were purified
from the culture supernatant by using a protein G column (GE
Healthcare).
Example 5
Epitope Mapping of Anti-AITR Monoclonal Antibodies (Anti-AITR
mAbs)
[0097] For identifying a precise epitope recognized by the
anti-AITR mAbs of the present invention, twelve different fragments
(R1 to R12) corresponding to AITR-ECD were prepared and cloned into
a GST-vector, pGEX-6p-1 (FIG. 3A).
[0098] The pGEX-6p-1/R1-R12 was transformed into E. coli cell line,
BL21-DE3-pLyss, and the protein expression was induced by adding
0.20 mM IPTG. The recombinant R1-GST to R12-GST fusion proteins
expressed in E. coli were purified by running them through a
glutathione agarose 4B bead column (Peptron). At this time,
horseradish peroxidase-coupled anti-human IgG was diluted 10,000
times (Sigma Aldrich, St Louis, Mo., USA). Also, chemiluminescence
was monitored by using SuperSignal West Pico Chemiluminescence
Substrate (Pierce, Rockford, Ill.).
Example 6
Cell Division and Cytokine Analysis
[0099] In the present invention, CD4.sup.+ T cells were labeled
with CFSE (Molecular Probes, Invitrogen). The proliferation of
CFSE-labeled CD4.sup.+ T cells (5.times.10.sup.5 cells/well) was
stimulated by treating the cells with anti-CD3 antibody (0.1
.mu.g/ml)/IL-2 (100 U/ml) and 5 .mu.g/ml anti-AITR mAb for 72 hr.
After 72 hours of culturing, the cell-free supernatant was
separated and analyzed for cytokine level by using TH2/T.sub.h2
cytokines bead array kit (BD Bioscience), human TGF-.beta.1
Quantikine ELISA kit (R&D system, Minneapolis, Minn.), and
human IL-17A ELISA kit (Abcam, Cambridge, UK).
Example 7
Analysis of Differentiated Effector in CD4+ T Cell
[0100] Purified CD4.sup.+ T cells (5.times.10.sup.5 cells/well)
were stimulated with 0.1 .mu.g/ml anti-CD3 antibody and 100 U/ml
IL-2 for 3 days. Then, the cultured cells were treated with 5
.mu.g/ml anti-AITR mAbs or 0.1 .mu.g/ml AITR ligand (AITRL) for
another 7 days.
[0101] Subsequently, the differentiated effector T cell subsets
were washed with 1.times.PBS, and then cultured with a fresh medium
containing 5 .mu.g/ml anti-AITR antibody recognizing different
epitope for another 7 days while adding 100 U/ml IL-2 for every 2
days. Then the cultured cells were harvested and endogenous
IFN-.gamma., IL-4 and IL-17A were stained for three-color flow
cytometry analysis.
Example 8
Analysis of Interaction Between AITR and TRAFs
[0102] Purified CD4.sup.+ T cells (5.times.10.sup.5 cells/well)
were stimulated with 0.1 .mu.g/ml anti-CD3 antibody and 100 U/ml
IL-2 for 2 days. The cultured cells were treated with 5 .mu.g/ml
anti-AITR mAbs for 24 hr. Then the cells were lysed with 100 .mu.l
RIPA buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% Nonidet P-40,
0.25% Na-deoxycholate, 1 mM PMSF, protease inhibitors, and
phosphatase inhibitors).
[0103] For immunoprecipitation, cell lysates were incubated with 20
.mu.l of 1:1 slurry of protein G-sepharose for 1 hour. Then, the
precipitate was washed with 1.times.PBS, and protein complexes were
eluted. Western blot analysis of eluate was performed by using
anti-TRAFs (TRAF1, TRAF2, TRAF3, TRAF5, and TRAF6) (Santa Cruz
Biotechnology, Santa Cruz, Calif.) or anti-AITR mAbs and using
horseradish peroxidase-conjugated goat anti-rabbit IgG or
anti-human IgG as a secondary antibody.
[0104] In a separate experiment, the sorted CD4.sup.+CD25.sup.high
T cells (5.times.10.sup.5 cells/well) were stimulated with 5
.mu.g/ml anti-AITR mAbs for 24 hr and the interaction between AITR
and TRAF was analyzed by using the same method described above.
Example 9
Analysis of Phosphorylation of Endogenous Signaling Pathway
Protein
[0105] Purified CD4.sup.+ T cells (1.times.10.sup.6 cells/well)
were stimulated with anti-CD3 antibody and IL-2 for 3 days. The
cultured cells were treated with anti-AITR mAbs for 2, 6, 12 and 24
hours. Then the cells were harvested and the suspension thereof was
prepared. Levels of phospho-STATs (STAT1, STAT2, STAT3, STAT4,
STAT5, and STAT6) and master transcription factors (T-bet, GATA-3,
ROR.gamma. t and Foxp3) were analyzed by flow cytometry. The cells
in the culture were lysed with RIPA buffer. Subsequently, total
protein extract was resolved on 8% to 12% SDS-polyacrylamide gel
electrophoresis and immunoblotted with antibodies against NFAT1/2,
p-p38, p-ERK1/2, p-JNK1/2, and p-NF-.kappa.B (Cell Signaling,
Danvers, Mass., USA). The same blot was re-probed with an
anti-.beta.-actin antibody as a control for protein loading.
[0106] In a separate experiment, the sorted CD4.sup.+CD25.sup.high
T cells (5.times.10.sup.5 cells/well) were stimulated with 5
.mu.g/ml anti-AITR mAbs and phosphorylation of the proteins
involved in intracellular signaling pathway was analyzed by the
same method described above.
Example 10
Phenotype Conversion of Human CD4.sup.+CD25.sup.highFoxp3.sup.+
(T.sub.reg) Cell to Different Subset
[0107] Human T.sub.reg cells isolated from healthy subjects and
cancer patients were sorted by the method described in Example 1.
The cells were stimulated with 5 .mu.g/ml anti-AITR mAbs for 7 days
while adding 100 U/ml IL-2 every 2 days. Then the cultured cells
were harvested and the expression of AITR, CTLA-4, CD62L, CD127,
CD45RO and CD45RA on cell surface was confirmed. Also, endogenous
IFN-.gamma., IL-4 and IL-17A and master transcription factors were
stained and the cells were analyzed by flow cytometry. In addition,
culture supernatants were collected and the expression of
IFN-.gamma., IL-4, IL-17A, and TGF-.beta. was confirmed.
[0108] In a separate experiment, the sorted CD4.sup.+CD25.sup.-
(non-T.sub.reg) cells (5.times.10.sup.6 cells/well) were stimulated
with 5 .mu.g/ml anti-AITR mAbs. Culture cells were stained for
endogenous IFN-.gamma., IL-4 and IL-17A and then analyzed by
three-color flow cytometry.
Example 11
Statistical Analysis
[0109] All experimental data were analyzed with a statistical
program called Prism 5.0 GraphPad (San Diego, Calif.). Student's
t-test was performed to determine the statistical significance of
the difference between test groups.
Experimental Example 1
Generation of Anti-AITR Monoclonal Antibodies
[0110] As described in Example 4, five Fab antibodies against AITR
were selected from a human Fab antibody library and named as A27,
A35, A41, B32, and B62. The antibody A41 comprises a heavy chain
variable region of SEQ ID No.5 and a light chain variable region of
SEQ ID No.9, and the antibody A27 comprises a heavy chain variable
region of SEQ ID No.15 and a light chain variable region of SEQ ID
No.19. The antibody B32 comprises a heavy chain variable region of
SEQ ID No.25 and a light chain variable region of SEQ ID No.29, and
the antibody A35 comprises a heavy chain variable region of SEQ ID
No.35 and a light chain variable region of SEQ ID No.39. The
antibody B62 comprises a heavy chain variable region of SEQ ID
No.45 and a light chain variable region of SEQ ID No.46.
[0111] In addition, anti-AITR genes were generated by grafting
V.sub.H and V.sub.L DNA sequences into a human IgG.sub.1 backbone.
Anti-AITR mAbs A27, A35, A41, B32, and B62, were produced by
transient transfection of the antibody constructs into HEK293 cells
(FIG. 1A). These antibodies showed similar affinity to AITR in the
AITR-overexpressed Jurkat cells (FIG. 1B).
Experimental Example 2
Epitope Mapping of Anti-AITR Monoclonal Antibodies
[0112] In this experiment, epitopes recognized by five human
anti-AITR mAbs selected in Experimental Example 1 were identified.
To confirm the epitope, AITR-GST fusion proteins named as R1 to R12
were used (FIGS. 3A-3C). Immunoblotting results of R0-GST to
R12-GST proteins with anti-AITR mAbs demonstrated that the five
antibodies were classified into 3 groups based on their recognition
site of AITR, i.e., epitope. A27 and B32 specifically bound to R1
and R2 sites; A35 and B62 specifically bound to R1 to R4 and R8 to
R11; and A41 specifically bound to R1 to R6, R8, and R9 (FIG. 3B).
As a result of investigating the epitope sites more precisely, it
was confirmed that A27 and B32 specifically recognized the sequence
of 56.sup.th to 65.sup.th amino acids (AA 56-65) of AITR-ECD;
[0113] A35 and B62 specifically recognized the sequence of
41.sup.st to 50.sup.th amino acids (AA 41-50) of AITR-ECD; and A41
specifically recognized the sequence of 20.sup.th to 30.sup.th
amino acids (AA 20-30) of AITR-ECD (FIG. 3C and Table 2). The
epitope site recognized by A41 was named as SEQ ID No.2; the
epitope site recognized by A27 and B32 was named as SEQ ID No.3;
and the epitope site recognized by A35 and B62 was named as SEQ ID
No.4.
TABLE-US-00002 TABLE 2 Anti- SEQ ID body Epitope No. A41
GTDARCCRVHT (AA 20-30) 2 A27 & HCGDPCCTTC (AA56-65) 3 B32 A35
& ECCSEWDCMC (AA41-50) 4 B62
Experimental Example 3
Expression of AITR in Immune Cell
[0114] The expression of AITR was up-regulated after stimulation of
PBMCs, but when PBMCs were not stimulated, mRNA of AITR was not
detected. Also, the expression of AITR was significantly
up-regulated after CD3 stimulation in T cells. Furthermore, the
expression of AITR was analyzed in T cells, B cells, NK cells, and
monocytes by flow cytometry. The results demonstrated that the
human anti-AITR mAbs of the present invention mainly recognized
AITR in the activated CD4.sup.+ T cells which had nearly 40-fold
higher expression of AITR. When the antibodies were used in
CD8.sup.+ T cells, B cells, NK cells, and monocytes, neither of
resting nor activated AITR was detected (FIG. 1C).
[0115] These results demonstrate that the anti-AITR mAbs of the
present invention recognize rapidly up-regulated AITR expression in
the activated CD4.sup.+ T cell population, through TCR-mediated
activated signal.
Experimental Example 4
Co-Stimulation of Cell Division and Cytokine Production in
Differentiated CD4+ T Cell Population by AITR Signaling
[0116] After identifying that AITR is expressed mainly in the
activated CD4.sup.+ T cells (FIG. 1C), the role of AITR was
investigated as a co-stimulatory molecule in proliferation and
cytokine secretion.
[0117] Purified CFSE-labeled CD4.sup.+ T cells were stimulated with
immobilized anti-CD3 and cultured in the presence of anti-AITR
mAbs. Unlike when cultured with anti-CD3 only, when the cells were
co-cultured with anti-AITR mAbs and anti-CD3, the proliferation of
activated CD4+ T cells was significantly increased (FIG. 5).
[0118] Subsequently, the culture supernatant was analyzed to
identify a type of cytokine secreted depending on the type of
anti-AITR mAbs. The results demonstrated that the antibodies of the
present invention recognizing different sites of AITR changed the
level of different cytokines. To be specific, cell treatment with a
comparative antibody A27 significantly increased the level of
T.sub.H1 cytokines IL-2 and IFN-.gamma., whereas treatment with a
comparative antibody A35, unlike with A27, increased the level of
T.sub.H17 cytokine IL-17A. On the other hand, cell treatment with
A41 of the present invention significantly increased the level of
T.sub.H2 cytokines IL-2, IL-4, and IL-5 (FIG. 4A).
[0119] In addition, the markers of phenotypic CD4.sup.+ T cells for
the expression of IFN-.gamma., IL-17A, and IL-4 in the activated
CD4.sup.+ T cells were analyzed when the CD4.sup.+ T cells were
treated with the anti-AITR mAbs or AITRL of the present invention.
The results show that when treated with A41 of the present
invention, the number of IL-4-producing CD4.sup.+ T cells was
increased (91.5.+-.6.21%); when treated with a comparative antibody
A27, the number of IFN-.gamma.-producing CD4.sup.+ T cells was
increased (90.2.+-.0.50%); and when treated with a comparative
antibody A35, the number of IL-17A-producing CD4.sup.+ T cells was
increased (37.8.+-.0.11%). Furthermore, the ligand thereof, i.e.
AITRL promoted the production of IFN-.gamma. in T.sub.H1 CD4.sup.+
T cells (FIG. 4B).
[0120] Taken together, these results demonstrate that anti-AITR
mAbs of the present invention can act as a co-stimulatory signal in
CD4.sup.+ T cells and promote the cell differentiation to a
specific T.sub.H cell and cytokine secretion. In particular, these
results support that the antibody of the present invention can
induce different effects depending on the recognition sites of
AITR. To be specific, as A41 antibody of the present invention
recognizes the epitope of SEQ ID No.2 among many different sites of
AITR in CD4.sup.+ T cell, it can differentiate the cell to produce
a T.sub.H2 cell cytokine, IL-4, among different cytokines.
Experimental Example 5
Interaction Between AITR-Family Proteins and TRAF-Family Proteins
and Downstream Signal Transduction
[0121] Previous studies have reported that tumor necrosis factor
receptor-associated factor (TRAF) proteins are involved in
activation of NF-.kappa.B and that downstream signaling molecules
such as ERK1/2, JNK1/2, and p38 can be activated by TNFR family
members. Also, cytoplasmic domain of AITR contains acidic residues
that are conserved in mouse or human and are involved in
association of AITR with TRAF protein. AITR is known to interact
with TRAF1, TRAF2, and TRAF3, but not with TRAF5 and TRAF6 (Kwon B
et al., J Biol Chem 274, 6056-6061, 1999; Ha, H et al., Curr Protoc
Immunol. Chapter11:Unit11.9D, 2009). Hence, the present inventors
investigated the type of TRAF protein that AITR interacts with when
AITR is activated by the anti-AITR mAbs of the present invention in
the activated CD4.sup.+ T cells.
[0122] AITR-TRAF complexes were immunoprecipitated with Protein G,
from the lysate of activated CD4.sup.+ T cell by using anti-AITR
mAbs and the immunoprecipitates were immunoblotted with anti-TRAF
antibody and anti-AITR mAbs.
[0123] The results demonstrate that the antibodies of the present
invention recognizing different sites of AITR recruit different
types of TRAF protein to AITR (FIG. 7A).
[0124] That is, A41 which recognizes the epitope of SEQ ID No.2 of
the present invention recruited TRAF3 and TRAF5, whereas a
comparative antibody A27 which recognizes the epitope of SEQ ID
No.3 of the present invention recruited TRAF1 and TRAF2 to AITR,
and a comparative antibody A35 which recognizes the epitope of SEQ
ID No.4 recruited TRAF6 to AITR. These results suggest that
depending on the site of AITR recognized by each antibody,
different cytoplasmic signaling can be induced. Furthermore, A41 of
the present invention that recruits TRAF3 and TRAF5 activated
p-ERK1/2, whereas a comparative antibody A27 that recruits TRAF1
and TRAF2 activated p-JNK1/2 and p-NF-.kappa.B. On the other hand,
a comparative antibody A35 of the present invention which recruits
TRAF6 activated p-p38 and p-NF-.kappa.B (FIGS. 7A, 7B, and 8).
[0125] T cells express NFAT1, NFAT2, and NFAT3, and NFAT proteins
are essential for producing effector cytokine when TCR is activated
in T.sub.H cells. T cells also play important roles in regulating
T.sub.H cell differentiation. For this reason, the present
inventors investigated whether NFAT1 or NFAT2 can be activated when
CD4.sup.+ T cells are treated with anti-AITR mAbs of the present
invention. As a result, it was found that a comparative antibody
A27 recognizing the epitope of SEQ ID No.3 and A35 recognizing the
epitope of SEQ ID No.4 increased the number of activated NFAT1 in a
time-dependent manner. Unlike A27 and A35, A41 of the present
invention increased the expression of NFAT2, but not NFAT1 (FIG.
7B).
[0126] These results suggest that AITR contains a binding domain
for TRAFs or adaptor cytoplasmic molecules that can activate
downstream signaling. Also, the results demonstrate that depending
on the site of AITR recognized by anti-AITR mAbs, different types
of TRAF proteins can be recruited, which then activates different
cytoplasmic signaling pathways. Moreover, the AITR antibody
specific to the epitope of SEQ ID No.2 of the present invention not
only activate specific TRAF proteins, but also show specific NFAT
activities. This result suggests that depending on the site of AITR
recognized by AITR antibody, different NFAT translocates into the
nucleus, which then induces different NFAT-dependent gene
expression.
[0127] These results support that particularly A41 of the present
invention recognize the epitope of SEQ ID No.2 among many sites of
AITR and recruit TRAF3 and TRAF5 among many different types of
TRAFs, which then induce p-ERK1/2-mediated cytoplasmic signaling
pathways, thereby converting the cell to the IL-4-producing cell,
wherein IL-4 is a cytokine of T.sub.H2 cell.
Experimental Example 6
Transcription Factors and STATs Protein Activated Differentiation
of CD4.sup.+ T Cells with Anti-AITR mAbs
[0128] Previous studies have reported that signaling transducer and
activation of transcription (STAT) proteins and master
transcription factors are essential in fate determination of
T.sub.H cell and cytokine production (Hermann-Kleiter, N. &
Baier G, Blood. 15, 2989-2997, 2010). Hence, the present inventors
investigated the activities of STAT proteins and master
transcription factors in the CD4.sup.+ T cells activated by
anti-AITR mAbs of the present invention.
[0129] A flow cytometric analysis was performed using the
antibodies against p-STATs (p-STAT-1, p-STAT-3, p-STAT-4, p-STAT-5,
and p-STAT-6) and T-bet, GATA-3, and ROR.gamma. t. As a result,
compared to the group treated with anti-CD4 and IL-2 only without
anti-AITR antibody, the group treated with A27 showed increased
number of activated p-STAT-1 (52.8.+-.0.25%), p-STAT-4
(54.2.+-.0.19%), and T-bet (80.2.+-.0.08%). The group treated with
A35 showed increased number of activated p-STAT-3 (63.1.+-.1.24%)
and ROR.gamma. t (53.4.+-.2.18%), and the group treated with A41
showed increased number of activated p-STAT-5 (85.1.+-.0.38%),
p-STAT-6 (79.2.+-.0.12%), and GATA-3 (76.5.+-.0.11%) (FIGS. 7C, 7D,
and 9).
[0130] These results suggest that the anti-AITR mAbs of the present
invention recognizing different sites of AITR can induce different
signaling cascades mediated by AITR in CD4.sup.+ T cells.
Especially, these results support that the A41 antibody of the
present invention recognizing the epitope of SEQ ID No.2 mediates
the cell fate determination of T.sub.H cell via a signaling pathway
mediated by STAT-5, STAT-6, and GATA-3.
Experimental Example 7
Conversion of T Cell to T.sub.H2 Cell by Anti-AITR mAbs
[0131] Experimental Examples 5 and 6 showed that the anti-AITR mAbs
of the present invention specifically binding to the epitope of SEQ
ID No.2 regulate a specific signal transduction factor involved in
T.sub.H cell fate determination in CD4.sup.+ T cells. That is,
according to the epitope sites within AITR, T cell can be converted
to a totally different type of T.sub.H cell. Hence, the present
inventors hypothesized that by targeting different epitope sites
recognized by anti-AITR mAbs of the present invention, functional
phenotype of CD4.sup.+ T cells can be converted. To confirm this,
CD4.sup.+ T cells were treated with the representative antibodies
A27, A35, and A41 which recognize three different sites of AITR to
determine the converting activity thereof.
[0132] The results showed that a comparative antibody A35 converted
IFN-.gamma.-producing cells (99.2.+-.0.21%) that were initially
induced by A27, a comparative antibody specific to the epitope of
SEQ ID No.2, to IL-17A-producing cells (18.8.+-.0.23%). A41 of the
present invention converted IFN-.gamma.-producing cells
(99.2.+-.0.21%) to IL-4-producing cells (38.7.+-.0.32%). In
addition, A35-induced IL-17A-producing cells (35.2.+-.0.60%) were
converted to IFN-.gamma.-producing cells (82.6.+-.1.21%) by a
comparative antibody A27, and converted to IL-4-producing cells
(70.5.+-.0.62%) by A41 of the present invention. A41-induced
IL-4-producing cells (98.2.+-.0.29%) were converted to
IFN-.gamma.-producing cells (90.1.+-.0.42%) by A27 antibody, and
converted to IL-17A-producing cells (16.9.+-.0.58%) by a
comparative antibody A35 (FIGS. 10 and 11).
[0133] These results demonstrate that the antibody of the present
invention that is specific to the AITR epitope of SEQ ID No.2 can
convert the T cell to a specific cytokine-producing cell by
recognizing the specific site of AITR, i.e. epitope of SEQ ID No.2
(AA 20-30). Furthermore, these results support that A41 of the
present invention recognizing the epitope of SEQ ID No.2 can
convert the T cell specifically to IL-4-producing T.sub.H2 cell,
unlike a comparative antibody A27 that induces cell conversion to
IFN-.gamma.-producing T.sub.H1 cell, and a comparative antibody A35
that induces cell conversion to IL-17A-producing T.sub.H17
cell.
Experimental Example 8
Enhancement of Suppressive Function of
CD4.sup.+CD25.sup.highFoxp3.sup.+ (T.sub.reg) Cell by Anti-AITR
Antibody
[0134] It is known that GITR or AITR acts as a co-stimulatory
molecule in T.sub.reg cell, and the expression thereof remains high
intrinsically in T.sub.reg cell even without activation. Hence, the
present inventors investigated the role of AITR in T.sub.reg cells
when stimulated by anti-AITR mAbs.
[0135] First, after stimulation with anti-CD3 and IL-2, T.sub.reg
cells (CD4.sup.+CD25.sup.high cells) and non-T.sub.reg cells
(CD4.sup.+CD25.sup.- cells) were isolated from healthy subjects and
cancer patients by FACS-sorter. Both of T.sub.reg cells isolated
from healthy subjects and cancer patients showed constitutive
expression of Foxp3 and AITR. Non-T.sub.reg cells showed a lower
expression of AITR than in T.sub.reg cells. The number of T.sub.reg
cells isolated from cancer patients was three times higher than
that from healthy subjects.
[0136] Based on the results from the experimental example, it was
determined whether the anti-AITR mAbs of the present invention can
convert T.sub.reg cells. The results showed that A41 recognizing
the epitope of SEQ ID No.2 of the present invention could not
convert the T.sub.reg cells isolated from both healthy subjects and
cancer patients. On the other hand, a comparative antibody A35
converted T.sub.reg cells from healthy subjects to IL-17A-producing
cells (10.4.+-.0.32%), but not the T.sub.reg cells from cancer
patients. Also, another comparative antibody A27 converted the
T.sub.reg cells from both healthy subjects and cancer patients to
IFN-.gamma.-producing cells (93.9.+-.0.12% and 88.2.+-.0.43%
respectively) (FIGS. 12A, 12D, and 13B). In addition, when the
secreted cytokines were analyzed, A27 and A35 decreased TGF-.beta.
secretion, but increased the secretion of IFN-.gamma. and IL-17A.
On the other hand, A41 of the present invention increased
TGF-.beta. secretion in a time-dependent manner which is involved
in the suppressive function of T.sub.reg cells (FIG. 12B). These
results support that A41 of the present invention which
specifically recognizes the epitope of AITR of SEQ ID No.2
increases the secretion of TGF-.beta. in T.sub.reg cells, thereby
enhancing the suppressive function of T.sub.reg cells.
[0137] Furthermore, the mechanisms behind signal transduction were
analyzed to investigate the reasons for inducing different effects
in T.sub.reg cells. As a result, it was observed that as shown in
Experimental Example 5, a comparative antibody A27 recruited TRAF1
and TRAF2 and increased the expression of NFAT1, thereby activating
p-JNK1/2 and p-NF-kB signaling pathways. A35 recruited TRAF6 and
activated p-p38 and p-NF-kB signaling pathways (FIGS. 7A-7D and
14A-14B). These results demonstrate that comparative antibodies A27
and A35 reduce the expression of Foxp3 but increase the expression
of T-bet or ROR.gamma. t through the above signaling pathways.
Through these mechanisms, a comparative antibody A27 can convert
T.sub.reg cell to T.sub.H1 cell, and A35 can convert T.sub.reg cell
to T.sub.H17 cell (FIGS. 9, 12C, and 15A-15B).
[0138] On the other hand, when T.sub.reg cells were treated with
A41 of the present invention, it did not change the expression
level of a T.sub.reg cell marker, Foxp3, in T.sub.reg cell as well
as the level of GATA-3 (FIGS. 9, 12C, and 15A-15B). Also, when A41
recruited TRAF protein to AITR in T.sub.reg cells, it recruited
TRAF3 more strongly than TRAF5, and activated ERK1/2, NF-kB, and
STAT5, thereby inducing a signaling cascade through NFAT1
transcription factor. Therefore, it was determined that A41 of the
present invention induces different signaling cascade from the
antibodies recognizing other epitopes (FIGS. 9 and 14A-14B).
[0139] These results support that the antibody of the present
invention recognizing the epitope of SEQ ID No.2 can enhance the
suppressive function of T.sub.reg cell, through different signaling
pathway from those of other epitopes.
[0140] Based on the above description, it should be understood by
those skilled in the art that various alternatives to the
embodiments of the invention described herein may be employed in
practicing the invention without departing from the technical idea
or essential features of the invention as defined in the following
claims. In this regard, the above-described examples are for
illustrative purposes only, and the invention is not intended to be
limited by these examples. The scope of the present invention
should be understood to include all of the modifications or
modified form derived from the meaning and scope of the following
claims or its equivalent concepts.
Sequence CWU 1
1
501139PRTArtificial SequenceExtracellular domain(ECD) of AITR 1Gly
Gln Arg Pro Thr Gly Gly Pro Gly Cys Gly Pro Gly Arg Leu Leu 1 5 10
15 Leu Gly Thr Gly Thr Asp Ala Arg Cys Cys Arg Val His Thr Thr Arg
20 25 30 Cys Cys Arg Asp Tyr Pro Gly Glu Glu Cys Cys Ser Glu Trp
Asp Cys 35 40 45 Met Cys Val Gln Pro Glu Phe His Cys Gly Asp Pro
Cys Cys Thr Thr 50 55 60 Cys Arg His His Pro Cys Pro Pro Gly Gln
Gly Val Gln Ser Gln Gly 65 70 75 80 Lys Phe Ser Phe Gly Phe Gln Cys
Ile Asp Cys Ala Ser Gly Thr Phe 85 90 95 Ser Gly Gly His Glu Gly
His Cys Lys Pro Trp Thr Asp Cys Thr Gln 100 105 110 Phe Gly Phe Leu
Thr Val Phe Pro Gly Asn Lys Thr His Asn Ala Val 115 120 125 Cys Val
Pro Gly Ser Pro Pro Ala Glu Pro Pro 130 135 211PRTArtificial
SequenceEpitope of A41 2Gly Thr Asp Ala Arg Cys Cys Arg Val His Thr
1 5 10 310PRTArtificial SequenceEpitope of A27 or B32 3His Cys Gly
Asp Pro Cys Cys Thr Thr Cys 1 5 10 410PRTArtificial SequenceEpitope
of A35 or B62 4Glu Cys Cys Ser Glu Trp Asp Cys Met Cys 1 5 10
5127PRTArtificial Sequencea heavy chain variable region of A41 5Gln
Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10
15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45 Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr
Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn
Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gly Ile Ala Ala
Ala Gly Pro Pro Tyr Tyr Tyr Tyr Tyr Tyr 100 105 110 Tyr Met Asp Val
Trp Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120 125
68PRTArtificial SequenceCDR1 of a heavy chain variable region of
A41 6Gly Phe Thr Phe Ser Ser Tyr Ala 1 5 78PRTArtificial
SequenceCDR2 of a heavy chain variable region of A41 7Ile Ser Tyr
Asp Gly Ser Asn Lys 1 5 820PRTArtificial SequenceCDR3 of a heavy
chain variable region of A41 8Ala Arg Gly Ile Ala Ala Ala Gly Pro
Pro Tyr Tyr Tyr Tyr Tyr Tyr 1 5 10 15 Tyr Met Asp Val 20
9107PRTArtificial Sequencea light chain variable region of A41 9Asp
Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10
15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Thr Ile Tyr Asn Tyr
20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu
Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser
Arg Phe Gly Gly 50 55 60 Arg Gly Tyr Gly Thr Asp Phe Thr Leu Thr
Ile Asn Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Phe Cys
Gln Gln Ser Tyr Thr Ser Pro Leu 85 90 95 Thr Phe Gly Gln Gly Thr
Lys Val Asp Ile Lys 100 105 106PRTArtificial SequenceCDR1 of a
light chain variable region of A41 10Gln Thr Ile Tyr Asn Tyr 1 5
113PRTArtificial SequenceCDR2 of a light chain variable region of
A41 11Ala Ala Ser 1 129PRTArtificial SequenceCDR3 of a light chain
variable region of A41 12Gln Gln Ser Tyr Thr Ser Pro Leu Thr 1 5
13381DNAArtificial Sequencea heavy chain variable region of A41
13caggtccagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc
60tcctgtgcag cctctggatt caccttcagt agctatgcta tgcactgggt ccgccaggct
120ccaggcaagg ggctggagtg ggtggcagtt atatcatatg atggaagtaa
taaatactac 180gcagactccg tgaagggccg attcaccatc tccagagaca
attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agctgaggac
acggctgtgt attactgtgc gagaggaata 300gcagcagctg ggccccccta
ctactactac tactactaca tggacgtctg gggcaaaggg 360accacggtca
ccgtctcctc a 38114321DNAArtificial Sequencea light chain variable
region of A41 14gacatccaga tgacccagtc tccatcctcc ctgtctgctt
ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gaccatttac aactatctaa
attggtatca gcagaagcca 120gggaaagccc ctaagctcct gatctatgct
gcatccagtt tgcaaagtgg ggtcccatca 180aggttcggtg gccgtggata
tgggacagat ttcactctca ccatcaacag tctgcaacct 240gaagattttg
caacttactt ctgtcaacag agttacacga gtcctctcac ttttggccag
300gggaccaaag tggatatcaa a 32115128PRTArtificial Sequencea heavy
chain variable region of A27 15Gln Val Gln Leu Val Gln Ser Gly Thr
Gln Val Lys Met Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Lys
Ala Ser Gly Tyr Thr Phe Asp Asp Tyr 20 25 30 Gly Ile Gly Trp Val
Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Trp Ile
Ser Pro Tyr Thr His Arg Thr Asn Ser Ser Pro Lys Leu 50 55 60 Gln
Asp Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr 65 70
75 80 Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr
Cys 85 90 95 Ala Arg Asp Gly Thr Tyr Tyr Asp Phe Trp Ser Gly Tyr
Phe Asp Asn 100 105 110 Gly Ala Phe Asp Ile Trp Gly Gln Gly Thr Leu
Val Thr Val Ser Ser 115 120 125 168PRTArtificial SequenceCDR1 of a
heavy chain variable region of A27 16Gly Tyr Thr Phe Asp Asp Tyr
Gly 1 5 178PRTArtificial SequenceCDR2 of a heavy chain variable
region of A27 17Ile Ser Pro Tyr Thr His Arg Thr 1 5
1821PRTArtificial SequenceCDR3 of a heavy chain variable region of
A27 18Ala Arg Asp Gly Thr Tyr Tyr Asp Phe Trp Ser Gly Tyr Phe Asp
Asn 1 5 10 15 Gly Ala Phe Asp Ile 20 19110PRTArtificial Sequencea
light chain variable region of A27 19Gln Ser Val Val Thr Gln Pro
Pro Ser Val Ser Ala Ala Pro Gly Gln 1 5 10 15 Lys Val Thr Ile Ser
Cys Ser Gly Ser Thr Ser Asn Ile Gly Asn Asn 20 25 30 Tyr Val Ser
Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile
Tyr Asp Asn Tyr Lys Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser 50 55
60 Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Arg
65 70 75 80 Thr Gly Asp Glu Ala Asp Tyr Phe Cys Gly Thr Trp Asp Ser
Ser Leu 85 90 95 Asn Ala Trp Val Phe Gly Gly Gly Thr Lys Leu Thr
Val Leu 100 105 110 208PRTArtificial SequenceCDR1 of a light chain
variable region of A27 20Thr Ser Asn Ile Gly Asn Asn Tyr 1 5
213PRTArtificial SequenceCDR2 of a light chain variable region of
A27 21Asp Asn Tyr 1 2211PRTArtificial SequenceCDR3 of a light chain
variable region of A27 22Gly Thr Trp Asp Ser Ser Leu Asn Ala Trp
Val 1 5 10 23384DNAArtificial Sequencea heavy chain variable region
of A27 23caggtccagc tggtgcagtc tggaactcag gtgaagatgc ctggggcctc
agtgaaggtc 60tcctgcaagg cttctggtta cacctttgac gactatggta tcggctgggt
gcgacaggcc 120cctggacaag ggcttgaatg gatgggatgg atcagccctt
acactcatag gacaaattct 180tcaccgaagc tccaggacag agtcaccatg
accacagaca catccacgag cacagcctac 240atggagctga ggagcctgag
atctgacgac acggccgtgt attactgtgc gagagatggg 300acgtattacg
atttttggag tggttatttc gacaatggtg cttttgatat ctggggccaa
360ggcaccctgg tcaccgtctc ctca 38424330DNAArtificial Sequencea light
chain variable region of A27 24cagtctgtcg tgacgcagcc gccctcagtg
tctgcggccc caggacagaa ggtcaccatc 60tcctgctctg gaagcacctc caacattggg
aataattatg tatcctggta ccagcaactc 120ccaggaacag cccccaaact
cctcatttat gacaattata agcgaccctc tgggattcct 180gaccgattct
ctggctccaa gtctggcacg tcagccaccc tgggcatcac cggactccgg
240actggggacg aggccgatta tttctgcgga acatgggata gtagcctgaa
tgcttgggtg 300ttcggcgggg ggaccaagct gaccgtccta
33025123PRTArtificial Sequencea heavy chain variable region of B32
25Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly 1
5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Thr
Tyr 20 25 30 Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
Glu Trp Val 35 40 45 Ser Gly Ile Thr Gly Ser Ala Gly Gly Gly Ser
Thr Asn Tyr Ala Asp 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ser
Arg Asp Asn Ser Lys Asn Thr 65 70 75 80 Leu Tyr Leu Gln Met Asn Ser
Leu Arg Ala Glu Asp Thr Ala Val Tyr 85 90 95 Tyr Cys Ala Lys Gly
Tyr Ser Ser Asn Trp Arg Ser Ala Phe Asp Ile 100 105 110 Trp Gly Gln
Gly Thr Met Val Thr Val Ser Ser 115 120 268PRTArtificial
SequenceCDR1 of a heavy chain variable region of B32 26Gly Phe Thr
Phe Ser Thr Tyr Gly 1 5 2710PRTArtificial SequenceCDR2 of a heavy
chain variable region of B32 27Ile Thr Gly Ser Ala Gly Gly Gly Ser
Thr 1 5 10 2814PRTArtificial SequenceCDR3 of a heavy chain variable
region of B32 28Ala Lys Gly Tyr Ser Ser Asn Trp Arg Ser Ala Phe Asp
Ile 1 5 10 29108PRTArtificial Sequencea light chain variable region
of B32 29Ser Tyr Glu Leu Met Gln Pro Pro Ser Val Ser Val Ser Pro
Gly Gln 1 5 10 15 Thr Ala Gly Ile Thr Cys Ser Gly Asp Ala Leu Pro
Lys Gln Tyr Ala 20 25 30 Tyr Trp Tyr Gln Gln Arg Pro Gly Gln Ala
Pro Val Leu Leu Ile Tyr 35 40 45 Lys Asp Thr Glu Arg Pro Ser Gly
Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60 Ser Ser Gly Thr Thr Val
Thr Leu Thr Ile Ser Gly Val Gln Ala Glu 65 70 75 80 Asp Glu Ala Asp
Tyr Tyr Cys Gln Ser Ala Asp Ser Ser Gly Thr Tyr 85 90 95 Pro Val
Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 306PRTArtificial
SequenceCDR1 of a light chain variable region of B32 30Ala Leu Pro
Lys Gln Tyr 1 5 313PRTArtificial SequenceCDR2 of a light chain
variable region of B32 31Lys Asp Thr 1 3211PRTArtificial
SequenceCDR3 of a light chain variable region of B32 32Gln Ser Ala
Asp Ser Ser Gly Thr Tyr Pro Val 1 5 10 33369DNAArtificial Sequencea
heavy chain variable region of B32 33gaggtccagc tgttggagtc
tgggggaggc ttgatacagc ctggggggtc cctgagactc 60tcctgtgcag cctctggatt
cacatttagc acctacggca tgagctgggt ccgccaggct 120ccagggaagg
ggctggagtg ggtctcaggt attactggta gtgctggtgg tggtagcaca
180aattacgcag actccgtgaa gggccggttc accatctcca gagacaattc
caagaacacg 240ctgtatctgc aaatgaacag cctgagagcc gaggacacgg
ccgtttatta ctgtgcgaag 300gggtatagca gcaactggcg gtcagctttt
gatatctggg gccaagggac aatggtcacc 360gtctcctca 36934324DNAArtificial
Sequencea light chain variable region of B32 34tcctatgagc
tgatgcagcc accctcggtg tcagtgtccc caggacagac ggccgggatc 60acctgctctg
gagatgcatt gccaaagcaa tatgcttatt ggtaccagca gaggccaggc
120caggcccctg tgttgctcat atataaagac actgagaggc cctcagggat
ccctgagcga 180ttctctggct ccagctcagg gacaacagtc acgttgacca
tcagtggagt ccaggcagaa 240gacgaggctg actattactg tcaatcagca
gacagcagtg gtacttatcc ggtgttcggc 300ggagggacca agctgaccgt ccta
32435130PRTArtificial Sequencea heavy chain variable region of A35
35Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1
5 10 15 Ser Leu Arg Leu Ser Cys Ser Ala Ser Gly Phe Ser Phe Ser Ser
Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
Glu Tyr Val 35 40 45 Ser Gly Ile Ser Asp Asn Gly Gly Ser Thr Lys
Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp
Asn Ser Gln Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Ser Ser Leu Arg
Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gly Gly Pro
Thr Tyr Tyr Asp Phe Trp Ser Gly Tyr Tyr Thr 100 105 110 Asp Glu Asp
Ala Phe Asp Ile Trp Gly Gln Gly Thr Leu Val Thr Val 115 120 125 Ser
Ser 130 368PRTArtificial SequenceCDR1 of a heavy chain variable
region of A35 or B62 36Gly Phe Ser Phe Ser Ser Tyr Ala 1 5
378PRTArtificial SequenceCDR2 of a heavy chain variable region of
A35 or B62 37Ile Ser Asp Asn Gly Gly Ser Thr 1 5 3823PRTArtificial
SequenceCDR3 of a heavy chain variable region of A35 or B62 38Ala
Arg Gly Gly Pro Thr Tyr Tyr Asp Phe Trp Ser Gly Tyr Tyr Thr 1 5 10
15 Asp Glu Asp Ala Phe Asp Ile 20 39107PRTArtificial Sequencea
light chain variable region of A35 39Glu Ile Val Met Thr Gln Ser
Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile
Thr Cys Arg Ala Ser Gln Ser Ile Asn Asn Tyr 20 25 30 Leu Asn Trp
Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr
Ala Thr Ser Arg Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55
60 Ser Gly Ser Gly Ala Asp Leu Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Phe
Pro Trp 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100
105 406PRTArtificial SequenceCDR1 of a light chain variable region
of A35 or B62 40Gln Ser Ile Asn Asn Tyr 1 5 413PRTArtificial
SequenceCDR2 of a light chain variable region of A35 or B62 41Ala
Thr Ser 1 429PRTArtificial SequenceCDR3 of a light chain variable
region of A35 or B62 42Gln Gln Ser Tyr Ser Phe Pro Trp Thr 1 5
43390DNAArtificial Sequencea heavy chain variable region of A35
43gaagtgcagc tggtgcagtc tgggggaggc ttggtccagc cgggggggtc cctaagactc
60tcctgttcag cctctggatt cagcttcagt agttatgcta tgcactgggt ccgccaggct
120ccagggaagg gactggaata tgtctcaggt attagtgata atggaggtag
cacaaagtac 180gcagactcag tgaagggcag attcaccatc tccagagaca
attcccagaa cacgctgtat 240cttcaaatga gcagcctgag atctgaggac
acggccgtgt attactgtgc gagaggcggg 300cccacgtatt acgatttttg
gagtggttat tataccgacg aagatgcttt tgatatctgg 360ggccaaggca
ccctggtcac cgtctcctcg 39044321DNAArtificial Sequencea light chain
variable region of A35 44gaaattgtaa tgacacagtc tccatcctcc
ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gagtattaac
aactatttaa actggtatca gcaaaaaccc 120gggaaagccc ctaagctcct
aatctatgct acatccaggt tgcagagtgg cgtcccatcc 180aggttcagtg
gcagtggatc tggggcagat ctcactctca ccatcagcag tctgcaacct
240gaagatgttg caacttatta ctgtcaacag agctacagtt tcccgtggac
gttcggccaa 300gggaccaagg tggagatcaa a 32145134PRTArtificial
Sequencea heavy chain variable region of B62 45Glu Val Gln Leu Glu
Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val 1 5 10 15 Gln Pro Gly
Gly Ser Leu Arg Leu Ser Cys Ser Ala Ser Gly Phe Ser 20 25 30 Phe
Ser Ser Tyr Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly 35 40
45 Leu Glu Tyr Val Ser Gly Ile Ser Asp Asn Gly Gly Ser Thr Lys Tyr
50 55 60 Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn
Ser Gln 65
70 75 80 Asn Thr Leu Tyr Leu Gln Met Ser Ser Leu Arg Ser Glu Asp
Thr Ala 85 90 95 Val Tyr Tyr Cys Ala Arg Gly Gly Pro Thr Tyr Tyr
Asp Phe Trp Ser 100 105 110 Gly Tyr Tyr Thr Asp Glu Asp Ala Phe Asp
Ile Trp Gly Gln Gly Thr 115 120 125 Leu Val Thr Val Ser Ser 130
46107PRTArtificial Sequencea light chain variable region of B62
46Glu Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1
5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Asn Asn
Tyr 20 25 30 Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys
Leu Leu Ile 35 40 45 Tyr Ala Thr Ser Arg Leu Gln Ser Gly Val Pro
Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Ala Asp Leu Thr Leu
Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr
Cys Gln Gln Ser Tyr Ser Phe Pro Trp 85 90 95 Thr Phe Gly Gln Gly
Thr Lys Val Glu Ile Lys 100 105 47402DNAArtificial Sequencea heavy
chain variable region of B62 47gaagtgcagc tggaagtgca gctggtgcag
tctgggggag gcttggtcca gccggggggg 60tccctaagac tctcctgttc agcctctgga
ttcagcttca gtagttatgc tatgcactgg 120gtccgccagg ctccagggaa
gggactggaa tatgtctcag gtattagtga taatggaggt 180agcacaaagt
acgcagactc agtgaagggc agattcacca tctccagaga caattcccag
240aacacgctgt atcttcaaat gagcagcctg agatctgagg acacggccgt
gtattactgt 300gcgagaggcg ggcccacgta ttacgatttt tggagtggtt
attataccga cgaagatgct 360tttgatatct ggggccaagg caccctggtc
accgtctcct cg 40248321DNAArtificial Sequencea light chain variable
region of B62 48gaaattgtaa tgacacagtc tccatcctcc ctgtctgcat
ctgtaggaga cagagtcacc 60atcacttgcc gggcaagtca gagtattaac aactatttaa
actggtatca gcaaaaaccc 120gggaaagccc ctaagctcct aatctatgct
acatccaggt tgcagagtgg cgtcccatcc 180aggttcagtg gcagtggatc
tggggcagat ctcactctca ccatcagcag tctgcaacct 240gaagatgttg
caacttatta ctgtcaacag agctacagtt tcccgtggac gttcggccaa
300gggaccaagg tggagatcaa a 3214924DNAArtificial Sequenceforward
primer 49aagcttggtc agcgccccac cggg 245024DNAArtificial
Sequencereverse primer 50ccggcagagc cgccttaact cgag 24
* * * * *