U.S. patent application number 14/626504 was filed with the patent office on 2016-02-04 for recombinase polymerase amplification.
The applicant listed for this patent is Alere San Diego, Inc.. Invention is credited to Niall A. Armes, Olaf Piepenburg, Derek L. Stemple, Colin H. Williams.
Application Number | 20160032374 14/626504 |
Document ID | / |
Family ID | 46302725 |
Filed Date | 2016-02-04 |
United States Patent
Application |
20160032374 |
Kind Code |
A1 |
Piepenburg; Olaf ; et
al. |
February 4, 2016 |
Recombinase Polymerase Amplification
Abstract
This disclosure describes related novel methods for
Recombinase-Polymerase Amplification (RPA) of a target DNA that
exploit the properties of recombinase and related proteins, to
invade double-stranded DNA with single stranded homologous DNA
permitting sequence specific priming of DNA polymerase reactions.
The disclosed methods have the advantage of not requiring
thermocycling or thermophilic enzymes. Further, the improved
processivity of the disclosed methods may allow amplification of
DNA up to hundreds of megabases in length.
Inventors: |
Piepenburg; Olaf;
(Cambridge, GB) ; Williams; Colin H.; (London,
GB) ; Armes; Niall A.; (Essex, GB) ; Stemple;
Derek L.; (Hertfordship, GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Alere San Diego, Inc. |
San Diego |
CA |
US |
|
|
Family ID: |
46302725 |
Appl. No.: |
14/626504 |
Filed: |
February 19, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14033679 |
Sep 23, 2013 |
8962255 |
|
|
14626504 |
|
|
|
|
13198142 |
Aug 4, 2011 |
8574846 |
|
|
14033679 |
|
|
|
|
12802862 |
Jun 14, 2010 |
8017339 |
|
|
13198142 |
|
|
|
|
12151741 |
May 7, 2008 |
7763427 |
|
|
12802862 |
|
|
|
|
10931916 |
Sep 1, 2004 |
7399590 |
|
|
12151741 |
|
|
|
|
10371641 |
Feb 21, 2003 |
7270981 |
|
|
10931916 |
|
|
|
|
60553999 |
Mar 16, 2004 |
|
|
|
60358563 |
Feb 21, 2002 |
|
|
|
Current U.S.
Class: |
435/5 |
Current CPC
Class: |
C12Q 1/6844 20130101;
C12Q 1/6848 20130101; C12Q 1/70 20130101; C12Q 1/686 20130101; C12Q
1/6844 20130101; C12Q 1/6844 20130101; C12Q 1/686 20130101; C12Q
1/6848 20130101; C12Q 1/686 20130101; C12Q 2527/101 20130101; C12Q
2521/507 20130101; C12Q 1/6848 20130101; C12Q 2521/507 20130101;
C12Q 2522/101 20130101; C12Q 2522/101 20130101; C12Q 2527/125
20130101; C12Q 2527/101 20130101; C12Q 2531/119 20130101; C12Q
2521/507 20130101; C12Q 2521/507 20130101; C12Q 2531/119 20130101;
C12Q 2522/101 20130101; C12Q 2521/507 20130101; C12Q 2522/101
20130101; C12Q 2521/507 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12Q 1/70 20060101 C12Q001/70 |
Claims
1.-187. (canceled)
188. A reagent mixture for nucleic acid amplification comprising;
T4 bacteriophage UvsX; at least one DNA polymerase; and a crowding
agent.
189. The reagent mixture of claim 188, wherein the crowding agent
is selected from the group consisting of polyethylene glycols,
dextran, Ficoll and a combination thereof.
190. The reagent mixture of claim 189, wherein said polyethylene
glycol is selected from the group consisting of PEG1450, PEG3000,
PEG8000, PEG10000, PEG compound (molecular weight 15,000 to
20,000), and combinations thereof.
191. The reagent mixture of claim 188, wherein the at least one
polymerase is selected from the group consisting of prokaryotic
polymerase, eukaryotic polymerase and phage-encoded polymerase.
192. The reagent mixture of claim 191, wherein said eukaryotic
polymerase is selected from the group consisting of pol-.alpha.,
pol-.beta., pol-.delta., and a combination thereof.
193. The reagent mixture of claim 191, wherein the procaryotic
polymerase is selected from the group consisting of E. coli DNA
polymerase I Klenow fragment, bacteriophage T4 gp43 DNA polymerase,
B. stearothermophilus polymerase (Bst), B. subtilis Phi-29
polymerase, B. subtilis polymerase I (Bsu), E. coli DNA polymerase
I, E. coli DNA polymerase II, E. coli DNA polymerase III, E. coli
DNA polymerase IV, E. coli DNA polymerase V and a combination
thereof.
194. The reagent mixture of claim 188, wherein the at least one
polymerase includes at least one DNA polymerase which lacks 3'-5'
exonuclease activity.
195. The reagent mixture of claim 188, wherein the at least one
polymerase comprises a DNA polymerase with strand displacing
properties.
196. The reagent mixture of claim 188, further comprising a first
nucleic acid primer and optionally a second nucleic acid
primer.
197. The reagent mixture of claim 196, wherein the reagent mixture
comprises a first nucleic acid primer and a second nucleic acid
primer.
198. The reagent mixture of claim 196, wherein the first and second
nucleic acid primers are selected from the group consisting of DNA,
RNA, PNA, LNA, morpholino backbone nucleic acid, phosphorothiorate
backbone nucleic acid, and a combination thereof.
199. The reagent mixture of claim 197, further comprising a third
nucleic acid primer.
200. The reagent mixture of claim 199, further comprising a fourth
nucleic acid primer.
201. The reagent mixture of claim 188, wherein the T4 bacteriophage
UvsX is temperature-sensitive.
202. The reagent mixture of claim 188, further comprising at least
one single stranded DNA binding protein.
203. The reagent mixture of claim 202, wherein said single stranded
DNA binding protein is selected from the group consisting of E.
coli SSB, T4 gp32 and combinations thereof.
204. The reagent mixture of claim 188, further comprising a buffer,
ATP or an ATP analog, dNTPs or a mixture of dNTPs and ddNTPs.
205. The reagent mixture of claim 188, further comprising a T4
bacteriophage uvsY.
206. The reagent mixture of claim 188, wherein the dNTP(s) is/are
selected from the group consisting of dATP, dGTP, dCTP, dTTP.
207. The reagent mixture of claim 188, wherein the ATP or ATP
analog is selected from ATP, ATP-.gamma.-S, ATB-.beta.-S, ddATP or
a combination thereof.
208. The reagent mixture of claim 188, further comprising a target
nucleic acid sequence.
209. The reagent mixture of claim 196, at least one primer
comprises a 3' blocking group.
210. A composition comprising: the reagent mixture of claim 188; a
target nucleic acid; and at least on nucleic acid primer.
211. A kit comprising: a T4 bacteriophage UvsX; at least one DNA
polymerase; and a crowding agent.
212. The kit of claim 211, further comprising a first nucleic acid
primer and optionally a second nucleic acid primer.
213. The kit of claim 211, further comprising a buffer, ATP or ATP
analog, dNTPs, or a mixture of dNTPs and ddNTPs.
214. The kit of claim 212, further comprising a third primer and
optionally a fourth primer.
215. The kit of claim 211, wherein the crowding agent is selected
from the group consisting of polyethylene glycols, dextran, Ficoll
and a combination thereof.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 14/033,679, filed Sep. 23, 2013, now U.S. Pat. No. 8,962,255,
which is a continuation of U.S. application Ser. No. 13/198,142,
filed Aug. 4, 2011, now U.S. Pat. No. 8,574,846, which is a
continuation of U.S. application Ser. No. 12/802,862, filed Jun.
14, 2010, now U.S. Pat. No. 8,017,339, which is a divisional of
U.S. application Ser. No. 12/151,741, filed May 7, 2008, now U.S.
Pat. No. 7,763,427, which is a divisional of U.S. application Ser.
No. 10/931,916, filed Sep. 1, 2004, now U.S. Pat. No. 7,399,590.
U.S. application Ser. No. 10/931,916 claims the benefit of U.S.
application 60/553,999 filed Mar. 16, 2004, and is a
continuation-in-part of U.S. application Ser. No. 10/371,641 filed
Feb. 21, 2003, now U.S. Pat. No. 7,270,981, which claims the
benefit of U.S. Application 60/358,563 filed Feb. 21, 2002. All
patents and patent applications cited in this specification are
hereby incorporated by reference herein in their entirety.
BACKGROUND OF THE INVENTION
[0002] The ability to amplify DNA lies at the heart of modern
biological and medical research. This is because most molecular
biology techniques rely on samples containing many identical
molecules to increase the sensitivity of an assay or to prepare
enough material for further processing. Among the various nucleic
acid amplification techniques, polymerase chain reaction (PCR) is
the most common because of its sensitivity and efficiency at
amplifying short nucleic acid sequences.
[0003] While PCR is of great utility, it is also limited in a
number of ways. The first limitation of PCR is that it relies on
multiple cycles of thermal melting (denaturing) at high
temperatures followed by hybridization and elongation at a reduced
temperature. To maximize efficiency and to minimize noise, complex
temperature control of multiple reactions is required. This
necessitates the use of a thermocycler controllable rapid
heating/cooling block made with exotic material (e.g., gold plated
silver blocks), or a robotic mechanism to move samples between
temperature-controlled zones. Because of the high-temperature
required to melt DNA in physiological salt conditions, PCR
technology requires either the addition of fresh polymerase per
cycle or the use of thermostable polymerases. The approach of
adding fresh polymerase has not been automated and is thus labor
intensive and prone to errors (e.g., contamination, dropped tubes,
labeling errors). Furthermore, the need to add enzymes and to mix
each reaction individually presents serious drawbacks that have
limited adaptation of enzyme-addition PCR methods to the small
scale.
[0004] Compared to methods involving the addition of fresh
polymerase, the use of thermostable polymerases in PCR is the most
widely practiced. This approach suffers from the fact that
thermostable polymerases are found in a limited number of
organisms, and the replication mechanisms used by thermophilic
organisms are poorly understood. The available repertoire of
thermostable polymerases is limited to single polypeptide
polymerase enzymes involved in DNA repair, and/or lagging strand
synthesis. DNA repair and/or lagging strand polymerases are poor
choices for DNA amplification because they exhibit poor
processivity (distributive synthesis). In part as a consequence of
using repair and/or lagging strand polymerases (e.g. Taq, Pfu, Vent
polymerases), and due to the formation of inhibitory secondary or
tertiary nucleic acid structures following thermal melting, current
PCR protocols do not readily amplify sequences longer than several
thousands of base pairs. Reliable synthesis (and amplification) of
longer templates will rely on polymerases and auxiliary enzymatic
complexes collectively exhibiting much higher levels of
processivity, strand displacement, and secondary structure
resolution, as well as limiting the formation of inhibitory higher
order nucleic acid structures that may form on cooling
heat-denatured DNA.
[0005] A second limitation of PCR is that it relies on solution
hybridization between oligonucleotides (PCR primers) and denatured
template DNA (i.e., the DNA to be amplified) in an aqueous
environment. To be effective, PCR reactions are performed in a
short time because the thermostable polymerases have a rapidly
declining activity at PCR temperatures. Further, for effective
hybridization in a short time, a feature critical to rapid
turnaround, it is necessary to perform PCR in an environment with
high concentrations of oligonucleotides. The high oligonucleotide
concentration also ensures rapid interaction of target sequences
with the oligonucleotides in competition with the heat-denatured
complementary strand still present in solution. High
oligonucleotide primer concentrations can cause problems,
particularly when the copy number of the target sequence is low and
present in a complex mixture of DNA molecules. This would be the
case, for example, in a PCR of a genome to determine the genetic
polymorphism in one locus.
[0006] One problem with using high oligonucleotide concentrations
is that it enhances the degree of false priming at only partly
matched sequences in the complex DNA mixture. False priming refers
to the hybridization of a primer to a template DNA in PCR even when
the primer sequence is not completely complementary to the template
nucleic acid, which can lead to non-specific amplification of
nucleic acids. Noise, due to false priming, increases with the
oligonucleotide concentration and the complexity of total starting
DNA. In addition, the possibility of false priming increases as the
copy number of target sequences decreases. Where the conditions for
false priming are favorable (i.e., high oligonucleotide
concentration, high complexity, low copy number), errant amplified
sequences can become a dominant reaction product. Consequently it
can be difficult to identify conditions, and oligonucleotides, for
clean amplification of target sequences from a sample DNA without
an excess of false priming background. Thus a further disadvantage
of using PCR is the limited success at cleanly amplifying rare
target DNAs from complex sequences mixtures.
[0007] One solution to the problems of specificity and
template-melting problem incurred by PCR is to employ methods that
rely on the biological properties of the bacterial RecA recombinase
protein, or its prokaryotic and eukaryotic relatives. These
proteins coat single-stranded DNA (ssDNA) to form filaments, which
then scan double-stranded DNA (dsDNA) for regions of sequence
homology. When homologous sequences are located, the nucleoprotein
filament strand invades the dsDNA creating a short hybrid and a
displaced strand bubble known as a D-loop. The free 3'-end of the
filament strand in the D-loop can be extended by DNA polymerases to
synthesize a new complementary strand. The complementary strand
displaces the originally paired strand as it elongates. By
utilizing pairs of oligonucleotides in a manner similar to that
used in PCR it should be possible to amplify target DNA sequences
in an analogous fashion but without any requirement for thermal
melting (thermocycling). This has the advantage both of allowing
the use of heat labile polymerases previously unusable in PCR, and
increasing the fidelity and sensitivity by template scanning and
strand invasion instead of hybridization.
[0008] Although the use of RecA and its homologues for in vitro
amplification of nucleic acids has been previously described (U.S.
Pat. No. 5,223,414 to Zarling et al., referred to herein as
"Zarling"), the method and results are limited. Zarling's method
has critical failings that limit its ability to achieve exponential
amplification of double-stranded DNA. The failure of the Zarling
method to achieve exponential amplification may be due to its
specification for the use of ATP.gamma.S rather than ATP. The
Zarling method urges the use of ATP.gamma.S, instead of ATP, in the
assembly of RecA nucleoprotein filaments because it results in a
more stable RecA/ssDNA filament structure. Normally, filaments are
assembled in a 5' to 3' direction and will spontaneously
disassemble in the same 5' to 3' direction as RecA hydrolyzes ATP.
This process is dynamic in that assembly and disassembly occurs at
the same time and the amount of assembled filaments is at
equilibrium. If the non-hydrolyzable ATP analog, ATP.gamma.S, is
used, hydrolysis of the ATP.gamma.S and the 5' to 3' disassembly of
the filaments are inhibited. The great stability of
RecA/ATP.gamma.S filaments, both before and after strand exchange,
while helpful in the method of targeting (i.e., the Zarling method)
is detrimental and unpractical for DNA amplification.
[0009] In the Zarling method, RecA protein involved in strand
invasion will remain associated with the double-stranded portion of
the exchanged material after strand exchange. This interaction
occurs because the newly formed duplex is bound in the
high-affinity site of RecA. The displaced strand occupies a
different low-affinity site, unless it is bound to another
single-stranded DNA binding protein (SSB), such as E. coli SSB. If
ATP had been utilized to generate the exchange structure,
spontaneous 5' to 3' disassembly might occur, although the exchange
complex can be quite stable and may require additional factors to
stimulate ATP-dependent disassembly. Regardless of whether
spontaneous or stimulated, in the presence of ATP.gamma.S, 5' to 3'
disassembly of the RecA filament is inhibited (Paulus, B. F. and
Bryant, F. R. (1997). Biochemistry 36, 7832-8; Rosselli, W. and
Stasiak, A. (1990). J Mol Biol 216, 335-52; Shan, Q. et al.,
(1997). J Mol Biol 265, 519-40).
[0010] These RecA/dsDNA complexes are precisely the sites targeted
by the RecA/ssDNA primer complexes used to initiate subsequent
rounds of invasion and synthesis. Indeed, with the RecA bound, the
intermediate may not be accessible to polymerase, and certainly the
dsDNAs can no longer be invaded by RecA/ssDNA primer complexes and
are therefore not amplifiable from this point. Further synthesis
from these templates might occur if initiated at the other end of
the template, which is free of RecA, and this might eventually lead
to physical displacement of the bound RecA. It is not clear,
however, whether many polymerases can displace RecA in this manner.
Moreover, the initiation site for that synthetic round will now be
`blocked` instead. In such a situation, amplification is only
linear with time, and will predominately generate single-stranded
DNA amplification products.
[0011] Thus, the described Zarling method, at best, is likely to
generate little more than small quantities of ssDNA copies from
each template. The linear amplification potentially given by the
Zarling method will only occur in the presence of SSB, since the
displaced strand will continue to bind to the second interaction
site on RecA, and single-stranded DNA will not be released (Mazin,
A. V. and Kowalczykowski, S. C. (1998). EMBO J. 17, 11451-8). This
probably explains why the Zarling method observed additional
faster-migrating fragments when they included SSB. These additional
fragments were most likely displaced single-stranded fragments.
Hence, in the Zarling method only linear amplification of
single-stranded DNA will occur at best. There is, therefore, a need
in the art for an improved recombinase-dependent DNA amplification
method.
[0012] This invention utilizes two new amplification strategies
that avoid any requirement for thermal melting of DNA or
thermostable components. These strategies also overcome the
inefficiencies of the Zarling method. As with the Zarling strategy,
these methods rely on the biological properties of the bacterial
RecA protein, or its prokaryotic and eukaryotic relatives, in
particular, the phage T4 uvsX protein. However, in contrast to the
Zarling method, these methods are devised to achieve exponential
amplification of dsDNA. They achieve this by permitting rapid
regeneration of targetable sequences in the target nucleic acid in
the presence of dynamic recombinase/DNA filaments. Furthermore one
of the methods obviates any requirement for phased replication
initiation from both ends of the target nucleic acid by coupling
leading and lagging strand synthesis to simultaneously generate 2
double-stranded products.
SUMMARY OF THE INVENTION
[0013] The invention provides a method of DNA amplification, termed
RPA, which comprises the following steps. First, a recombinase
agent is contacted with a first and a second nucleic acid primer to
form a first and a second nucleoprotein primer. Second, the first
and second nucleoprotein primers are contacted to a double stranded
target sequence to form a first double stranded structure at a
first portion of said first strand and form a double stranded
structure at a second portion of said second strand so the 3' ends
of said first nucleic acid primer and said second nucleic acid
primer are oriented towards each other on a given template DNA
molecule. Third, the 3' end of said first and second nucleoprotein
primers are extended by DNA polymerases to generate first and
second double stranded nucleic acids, and first and second
displaced strands of nucleic acid. Finally, the second and third
steps are repeated until a desired degree of amplification is
reached.
[0014] The invention also provides for a method of nested RPAs. In
a nested RPA, a first region of nucleic acid is amplified by RPA to
form a first amplified region. Then a second region of nucleic acid
that is completely within the first amplified region is amplified
using RPA to form a second amplified region. This process may be
repeated as often as necessary. For example, a third region of
nucleic acid, which is completely within the second region, may be
amplified from the second amplified region by RPA. In addition to
the one, two and three rounds of RPA discussed above, the invention
contemplates at least 4, and preferably at least 5 rounds of nested
RPAs also.
[0015] The invention also provides for methods of detecting a
genotype using RPA. This method is useful for genotyping, for
detecting a normal or diseased condition, a predisposition, or a
lack of a disposition for a diseased condition. Further, RPA can be
used for detecting the presence of a genome, such as for example, a
genome of a pathogen. In this use, the method is useful for
diagnosis and detection.
[0016] The invention also details the nature and concentrations of
recombinases, single-stranded binding proteins, polymerases, and
nucleotides necessary to establish an effective amplification
reaction. The invention further provides detailed enablement on the
nature of the target DNA, the length, and composition of targeting
oligonucleotides, and the inter-oligonucleotide length optimal for
amplification under various conditions. The invention provides for
the inclusion of additional components, or the use of modified
components, that contribute to establishing a
recombination-polymerase amplification system that is sensitive,
robust, and with optimal signal-to-noise properties. In particular
the use of more than one species of recombinase is demonstrated,
and the utility of engineered and modified analogues of the
recombinases E. coli recA and T4 bacteriophage uvsX, of polymerases
including the E. coli DNA polymerase I Klenow fragment, Bst
polymerase, Phi-29 polymerase, Bacillus subtilis Pol I (Bsu), as
well as single-stranded DNA binding proteins from E. coli and T4
(the gp32 protein) is detailed.
[0017] The utility of forms of gp32 with altered cooperativity
and/or strand assimilation properties is demonstrated. Also shown
is the use of T4 uvsY protein, and of molecular crowding agents in
particular PEG compound, to aid in establishing an optimal reaction
environment. Further the present invention details effects and the
possible use of other enzymes involved in DNA metabolism including
toposiomerases, helicases and nucleases, in order to improve the
amplification behaviour. The present invention also includes the
use of optimised conditions for repeated invasion/extension of a
primer targeted to a supercoiled or linear template to generate a
linear amplification, and the use of this method for DNA
sequencing. The present invention also describes the use of a
recombinase in detection of a specific amplified product of a
reaction by directing oligonucleotides labeled in some manner to
the specific product species and measuring a change in the
appearance or property of the reactants as a consequence.
[0018] Other embodiments, objects, aspects, features, and
advantages of the invention will be apparent from the accompanying
description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] FIG. 1 depicts a schematic representation of RecA/Primer
Loading. Prior to the addition of template DNA and/or Polymerase,
RecA and SSB will compete for binding to single-stranded
oligonucleotide primers. In the presence of a RecR and RecO, RecA
is selectively stabilized onto the single-stranded primers forming
RecA nucleoprotein filaments in a complex with RecO and RecR. This
complex is competent to invade double-stranded DNA to form a D-loop
at sites homologous to the oligonucleotide primers. Alternatively,
RecA, RecO and RecR can be pre-loaded onto oligonucleotide primers
prior to the introduction of SSB to the reaction mixture.
[0020] FIGS. 2A-2B depict a schematic of succeeding steps, shown in
panels (A) and (B), of Leading Strand Recombinase Polymerase
Amplification (lsRPA). RecA/primer nucleoprotein filaments invade
double stranded template DNA preferentially associating with
homologous target sites. As D-loops are formed and synthesis
proceeds displaced single stranded DNA becomes coated with SSB.
RecA release from double-stranded DNA can occur via ATP hydrolysis
in a 5'-3' direction or as a result of helicase/resolvase or
polymerase activity. As synthesis continues, polymerases encounter
SSB bound, displaced, single-stranded template. Double-stranded
target site are re-invaded by RecA/primer nucleoprotein filaments.
Subsequent rounds of lsRPA proceed from re-invaded sites.
[0021] FIGS. 3A-3D depict a schematic of succeeding steps, shown in
panels (A), (B), (C), and (D), of Leading and Lagging Strand
Recombinase Polymerase Amplification. First, the primosome loads
onto the D-loop formed by RecA nucleoprotein filament invasion. The
primosome synthesizes a stretch of RNA primer. Finally, primosome
recruits the clamp loader, which recruits both the sliding clamp
dimer and the asymmetric DNA polymerase core. Synthesis occurs
simultaneously in both the leading and lagging directions.
Eventually lagging strand synthesis stops and the lagging strand
clamp is unloaded. Synthesis of the leading strand continues until
a new site of lagging strand synthesis is formed. While leading
strand synthesis continues a new site of lagging strand synthesis
is formed. Lagging strand synthesis continues back to the previous
Okazaki fragment where the lagging strand clamp is unloaded. DNA
Polymerase I removes the RNA primer, and fills in the gap while DNA
ligase connects the two Okazaki fragments forming a continuous
lagging strand.
[0022] FIG. 4 depicts an example of nested primers chosen for
nested RPA.
[0023] FIG. 5 depicts examples of suitable double stranded template
nucleic acids.
[0024] FIGS. 6A-6B depict the various orientations of the RPA
primer pairs in hybridization with the target nucleic acid.
[0025] FIGS. 7A-7C depict a schematic representation of an RPA
reaction in progress.
[0026] FIGS. 8A-8C depict (A) examples of double stranded primers;
(B) double stranded primers after elongation and after annealing of
the second member of a primer pair; (C) after the elongation of the
second member of a primer pair with the non-invading strand
displaced.
[0027] FIG. 9 depicts investigation into the nature of
double-stranded DNA targets and targeting oligonucleotides.
Experiments using either supercoiled templates or linearized DNAs
suggest that recA catalyses the formation of intermediates capable
of supporting polymerase elongation most readily on supercoiled DNA
or at the ends of linearized DNA. Tester3bio oligonucleotide (SEQ
ID NO:66) is shown.
[0028] FIG. 10 depicts backfire synthesis. Backfire synthesis
occurs when a recA-coated targeting oligonucleotide possessing a 5'
overhang invades a duplex DNA end in the presence of a suitable
polymerase and dNTPs. This new duplex region is stable to
subsequent branch migration and can be utilized as a platform for
other activities. Forward fire, that is the elongation from the
invading oligonucleotide, can also occur.
[0029] FIG. 11 depicts uses of backfire synthesis. Backfire
synthesis can be useful because it generates a branch migration
resistant structure that can be used for application other than
normal oligonucleotide priming. Some examples are shown here
including introduction of a nicking enzyme target site,
introduction of an RNA polymerase promoter, and the linear
generation of short dsDNA fragments through successive
invasion/synthesis/cleavage events.
[0030] FIG. 12 depicts single stranded binding proteins facilitate
recombinase invasion and primer extension. Both E. coli SSB and T4
gp32 with an N-terminal His tag (gp32(N)) stimulate recA-mediated
invasion/elongation on a linear DNA template.
[0031] FIG. 13 depicts the requirement for a minimal
oligonucleotide length or overhang for invasion and elongation
during end targeting of linear templates. When the invading
oligonucleotide is targeted at ends of a linearized template a
minimal oligonucleotide length, or an overhang is needed for
invasion/elongation to occur.
[0032] FIG. 14 depicts paranemic and plectonmeic joints. Schematic
description of the formation of paranemic and plectonemic joints by
recombination events involving DNA ends or embedded sequences.
[0033] FIG. 15 depicts the effect of crowding agents. Crowding
agents can alter the reaction behaviour. In the presence of
polyethylene glycols, gp32(N) and recA recombinase, multiple
invasion events can be stimulated on single templates without the
requirement for 5' overhang in the targeting oligonucleotide.
[0034] FIG. 16 depicts end targeted amplification using leading
strand RPA. Amplification of a target DNA using end-directed
oligonucleotides, recA(C) protein, and the Klenow fragment of E.
coli DNA polymerase I.
[0035] FIG. 17 depicts leading strand RPA and limits of Klenow
processivity. Limited amplification of an approximately 300 base
pair fragment when only 0.5 fmoles of starting template is utilised
with the recA protein, gp32(N), and the Klenow fragment of E. coli.
Strong accumulation of shorter products suggests that the poor
processivity of Klenow (10-50 nucleotides) may underlie the
template concentration dependence of the reaction.
[0036] FIG. 18 depicts spacing dependence of RPA primers. There is
an optimal inter-oligonucleotide length for RPA when using the
Klenow fragment of E. coli DNA polymerase I. The template (SEQ ID
NO:67) and EcoRI overhang (SEQ ID NO:68) sequences are shown.
[0037] FIG. 19 depicts RPA products that are largely double
stranded. RPA reaction can generate double-stranded DNA products as
evidenced by agarose gel electrophoresis and restriction enzyme
cleavage.
[0038] FIG. 20 depicts activity of a recA C-terminal truncation
mutant. Mutant recA protein with a deletion of the C-terminal
acidic peptide (recA(C)delta) can promote strand exchange and
extension in a linear template run-on assay.
[0039] FIG. 21 depicts modified gp32 proteins. Shown is a schematic
representation of the bacteriophage T4 gp32 proteins used in this
study and the position of various modification and mutations. The
6.times. His tags in FIG. 21 are disclosed as SEQ ID NO: 69.
[0040] FIG. 22 depicts activity of gp32 protein. Modified gp32
proteins show a variety of activities in linear invasion/run-on
assays.
[0041] FIG. 23 depicts invasion and extension using uvsX. Modified
uvsX protein with a C terminal His tag (uvsX(C)), or an additional
deletion of the C-terminal acidic peptide, stimulates
invasion/extension in a linear template run-on assay.
[0042] FIG. 24 depicts RPA using uvsX(C). The modified recombinase
uvsX(C) can support DNA amplification in the presence of gp32(N),
the Klenow fragment of E. coli DNA polymerase I and polyethylene
glycol (PEG).
[0043] FIG. 25 depicts wild-type versus modified gp32. The modified
version of gp32, gp32(C) is qualitatively different to wild-type
untagged gp32.
[0044] FIG. 26 depicts titration of gp32 and effect of uvsY.
Titration of gp32 reveals a requirement for a minimal quantity of
gp32, and a requirement for uvsY(N) protein when untagged gp32 is
employed.
[0045] FIG. 27 depicts factors affecting reaction rate and noise.
Shown is a schematic representation of the factors affecting
reaction behavior, particularly reaction rate and noise. The
predicted effects and interactions of gp32, uvsX, UvsY and Peg are
suggested, with the conclusion that an optimal balance between
reaction rate and noise must be struck.
[0046] FIG. 28 depicts effects of PEG. PEG can reduce the average
length of linear invasion/run-on products in an uvsX-mediated
linear run-on experiment in the presence of gp32(C).
[0047] FIG. 29 depicts DNA end directed invasion. Shown is a
schematic depicting possible outcomes of end-directed invasion
events.
[0048] FIG. 30 depicts RPA in a complex sample. The amplification
of specific DNA targets from human genomic DNA.
[0049] FIG. 31 depicts RPA sensitivity. The sensitivity of
amplification of specific DNA targets from human genomic DNA.
[0050] FIG. 32 depicts RPA sensitivity and template independent
artifacts. The sensitivity of amplification of specific DNA targets
from human genomic DNA, and the existence of competing
template-independent primer artifacts.
[0051] FIG. 33 depicts how primer artifacts may arise. Shown is a
schematic representation of the possible mechanism by which primer
artifacts may arise.
[0052] FIG. 34 depicts primer artifact suppression. Shown in
schematic are methods to suppress primer artifacts.
[0053] FIG. 35 depicts the use of hairpin oligonucleotides to
stimulate self-priming of displaced strands. Shown is a schematic
diagram of an amplification using self-complementary hairpin
oligonucleotides deliberately to stimulate self-priming of
displaced strands.
[0054] FIG. 36 depicts conditions that enable highly efficient
noise-free amplification from complex DNA sources. The sensitivity
of amplification of specific DNA targets from human genomic DNA
under optimised conditions that reduce or eliminate primer
artifacts.
[0055] FIG. 37 depicts a schematic representation of RPA method as
shown in (A), (B), and (C).
[0056] FIG. 38 depicts (A) STR markers from two individuals (1 and
2, father and son) amplified with primer pairs for seven
independent markers using RPA conditions C4; (B) Titration of
reaction components to determine concentrations that support in
vitro amplification.
[0057] FIG. 39 depicts (A) Size limits of RPA reactions; (B)
Elongation efficiencies from embedded or end sequences; (C)
Sensitivity of RPA reactions; (D) Human DNA of the indicated copy
number amplified with primers ApoB4 and Apo300 generating a 300 bp
fragment using conditions C2; (E,F) Human DNA from single
individuals amplified with primers D18S51 5' and 3'. Conditions
employed were C2 in (E), and C4 in (F).
[0058] FIG. 40 depicts specificity of RPA reactions for: (A)
Primers BsA3 and BsB3, which amplify a 380 bp fragment using
conditions C3. An asterisk indicates the position of the expected
reaction product, and an arrow indicates the position of the
genomic DNA; (B,C) Oligonucleotides Apo600bio and Apo300rev which
generate a 345 bp fragment using conditions C4; (D) Mixtures of
reaction components assembled in the absence of the indicated
components, PEG and buffer. Primers used are indicated. Target DNA
was human male genomic DNA at 150 copies/.mu.l; (E)
Oligonucleotides targeting three independent loci in human genomic
DNA incubated with overlapping primer pairs of 25, 28, or 32 bases
as indicated.
DETAILED DESCRIPTION OF THE INVENTION
[0059] The present invention provides for Recombinase-Polymerase
Amplification (RPA)--a method for the amplification of target
nucleic acid polymers. It also provides for a general in vitro
environment in which high recombinase activity is maintained in a
highly dynamic recombination environment, supported by ATP. One
benefit of RPA is that it may be performed without the need for
thermal melting of double-stranded templates. Therefore, the need
for expensive thermocyclers is also eliminated. The present
invention describes two related strategies by which RPA can be
configured to permit exponential amplification of target nucleic
acid polymers.
[0060] Throughout this specification, various patents, published
patent applications and scientific references are cited to describe
the state and content of the art. Those disclosures, in their
entireties, are hereby incorporated into the present specification
by reference.
[0061] Leading Strand Recombinase-Polymerase Amplification
(lsRPA)
[0062] In leading strand Recombinase-polymerase Amplification
(lsRPA) single-stranded, or partially single-stranded, nucleic acid
primers are targeted to homologous double-stranded, or partially
double-stranded, sequences using recombinase agents, which would
form D-loop structures. The invading single-stranded primers, which
are part of the D-loops, are used to initiate polymerase synthesis
reactions. A single primer species will amplify a target nucleic
acid sequence through multiple rounds of double-stranded invasion
followed by synthesis. If two opposing primers are used,
amplification of a fragment--the target sequence--can be achieved.
LsRPA is described briefly in FIGS. 1 and 2.
[0063] The target sequence to be amplified, in any of the methods
of the invention, is preferably a double stranded DNA. However, the
methods of the invention are not limited to double stranded DNA
because other nucleic acid molecules, such as a single stranded DNA
or RNA can be turned into double stranded DNA by one of skill in
the arts using known methods. Suitable double stranded target DNA
may be a genomic DNA or a cDNA. An RPA of the invention may amplify
a target nucleic acid at least 10 fold, preferably at least 100
fold, more preferably at least 1,000 fold, even more preferably at
least 10,000 fold, and most preferably at least 1,000,000 fold.
[0064] The target sequence is amplified with the help of
recombinase agents. A recombinase agent is an enzyme that can coat
single-stranded DNA (ssDNA) to form filaments, which can then scan
double-stranded DNA (dsDNA) for regions of sequence homology. When
homologous sequences are located, the nucleoprotein filament
(comprising the recombinase agent) strand invades the dsDNA
creating a short hybrid and a displaced strand bubble known as a
D-loop. Suitable recombinase agents include the E. coli RecA
protein, the T4 uvsX protein, or any homologous protein or protein
complex from any phyla. Eukaryotic RecA homologues are generally
named Rad51 after the first member of this group to be identified.
Other non-homologous recombinase agents may be utilized in place of
RecA, for example as RecT or RecO. Recombinase agents generally
require the presence of ATP, ATP.gamma.S, or other nucleoside
triphosphates and their analogs. It is preferred that recombinase
agents are used in a reaction environment in which regeneration of
targeting sites can occur shortly following a round of D-loop
stimulated synthesis. Completed recombination events involving
recombinase disassembly will avoid a stalling of amplification or
very inefficient linear amplification of ssDNA caused by
oscillating single-sided synthesis from one end to the other.
[0065] Naturally, any derivatives and functional analogs of the
recombinase agent above may also function itself as a recombinase
agent and these derivatives and analogs are also contemplated as
embodiments of the invention. For example, a small peptide from
recA, which has been shown to retain some aspects of the
recombination properties of recA, may be used. This peptide
comprises residues 193 to 212 of E. coli recA and can mediate
pairing of single stranded oligos (Oleg N. Voloshin, Lijang Wang,
R. Daniel Camerini-Otero, Homologous DNA pairing Promoted by a
20-amino Acid Peptide Derived from RecA. Science Vol. 272 10 May
1996).
[0066] Since the use of ATP.gamma.S results in the formation of
stable Recombinase-agent/dsDNA complexes that are likely
incompatible with efficient amplification, it is preferable to use
ATP and auxiliary enzymes to load and maintain the
Recombinase-agent/ssDNA primer complexes. Alternatively, the
limitations of the use of ATP.gamma.S may be overcome by the use of
additional reaction components capable of stripping recA bound to
ATP.gamma.S from exchange complexes. This role might be played by
helicases such as the RuvA/RuvB complex.
[0067] The terms `nucleic acid polymer` or `nucleic acids` as used
in this description can be interpreted broadly and include DNA and
RNA as well as other hybridizing nucleic-acid-like molecules such
as those with substituted backbones e.g. peptide nucleic acids
(PNAs), morpholino backboned nucleic acids, locked nucleic acid or
other nucleic acids with modified bases and sugars.
[0068] Structurally similar to RNA, LNA monomers are bicyclic
compounds that bear a methylene linker that connects the nucleotide
sugar ring's 2'-oxygen to its 4'-carbon. LNA polymers obey standard
base-pairing rules, but their physical properties make them
suitable for mismatch discrimination applications. LNA are
available from Exiqon (Denmark) or Proligo (USA, Colorado).
[0069] One embodiment of the invention is directed to a method of
performing RPA. The method comprises two steps. In the first step,
the following reagents are combined in a reaction: (1) at least one
recombinase; (2) at least one single stranded DNA binding protein;
(3) at least one DNA polymerase; (4) dNTPs or a mixture of dNTPs
and ddNTPs; (5) a crowding agent; (6) a buffer; (7) a reducing
agent; (8) ATP or ATP analog; (9) at least one recombinase loading
protein; (10) a first primer and optionally a second primer; and
(11) a target nucleic acid molecule. In the second step, the
reagents are incubated until a desired degree of amplification is
achieved.
[0070] The recombinase may be uvsX, recA or a combination of both.
The recombinase may also comprise a C terminal deletion of acidic
residues to improve its activity. While any recombinase
concentration disclosed in the specification may be used, preferred
recombinase concentrations may be, for example, in the range of
0.2-12 .mu.M, 0.2-1 .mu.M, 1-4 .mu.M, 4-6 .mu.M, and 6-12
.mu.M.
[0071] The single stranded DNA binding protein may be the E. coli
SSB or the T4 gp32 or a derivative or a combination of these
proteins. gp32 derivative may include, at least, gp32(N), gp32(C),
gp32(C)K3A, gp32(C)R4Q, gp32(C)R4T, gp32K3A, gp32R4Q, gp32R4T and a
combination thereof (See FIG. 13). The DNA binding protein may be
present at a concentration of between 1 .mu.M and 30 .mu.M.
[0072] The DNA polymerase may be a eukaryotic polymerase. Examples
of eukaryotic polymerases include pol-.alpha., pol-.beta.,
pol-.delta., pol-.epsilon. and derivatives and combinations
thereof. Examples of prokaryotic polymerase include E. coli DNA
polymerase I Klenow fragment, bacteriophage T4 gp43 DNA polymerase,
Bacillus stearothermophilus polymerase I large fragment, Phi-29 DNA
polymerase, T7 DNA polymerase, Bacillus subtilis Pol I, E. coli DNA
polymerase I, E. coli DNA polymerase II, E. coli DNA polymerase
III, E. coli DNA polymerase IV, E. coli DNA polymerase V and
derivatives and combinations thereof. In a preferred embodiment,
the DNA polymerase is at a concentration of between 10,000 units/ml
to 10 units/ml, such as between 5000 units/ml to 500 units/ml. In
another preferred embodiment, the DNA polymerase lacks 3'-5'
exonuclease activity. In yet another preferred embodiment, the DNA
polymerase contains strand displacing properties.
[0073] Any of the proteins mentioned in the methods of the
invention is understood to also include its derivative. These
proteins includes at least the following: recombinases, polymerase,
recombinase loading protein, single stranded DNA binding protein,
accessory agents, RecA/ssDNA nucleoprotein filaments stabilizing
agent and the like. The derivative of these proteins include, at
least, a fusion protein comprising a C terminus tag, N terminus
tag, or C and N terminus tags. Non-limiting examples of suitable
sequence tags include 6-histidine (6.times.-His; HHHHHH; SEQ ID
NO:69), c-myc epitope (EQKLISEEDL; SEQ ID NO:70), FLAG.RTM.
octapeptide (DYKDDDDK; SEQ ID NO:71), Protein C (EDQVDPRLIDGK; SEQ
ID NO:72), Tag-100 (EETARFQPGYRS; SEQ ID NO:73), V5 epitope
(GKPIPNPLLGLDST; SEQ ID NO:74), VSV-G (YTDIEMNRLGK; SEQ ID NO:75),
Xpress (DLYDDDDK; SEQ ID NO:76), and hemagglutinin (YPYDVPDYA; SEQ
ID NO:77). Non-limiting examples of suitable protein tags include
.beta.-galactosidase, thioredoxin, His-patch thioredoxin,
IgG-binding domain, intein-chitin binding domain, T7 gene 10,
glutathione-S-transferase (GST), green fluorescent protein (GFP),
and maltose binding protein (MBP). It will be understood by those
in the art that sequence tags and protein tags can be used
interchangeably, e.g., for purification and/or identification
purposes. Accordingly, as used herein, the terms "His tag" and
"hexahistidine tag" encompass all suitable sequence tags and
protein tags as known in the art and indicated in this
paragraph.
[0074] The dNTPs includes, for example, dATP, dGTP, dCTP, and dTTP.
In leading and lagging strand RPA, ATP, GTP, CTP, and UTP may also
be included for synthesis of RNA primers. In addition, ddNTPs
(ddATP, ddTTP, ddGTP and ddGTP) may be used to generate fragment
ladders. The dNTP may be used at a concentration of between 1 .mu.M
to 200 .mu.M of each NTP species. A mixture of dNTP and ddNTP may
be used with ddNTP concentrations at 1/100 to 1/1000 of that of the
dNTP (1 .mu.M to 200 .mu.M).
[0075] The crowding agents used in the RPA include polyethylene
glycol (PEG), dextran and ficoll. The crowding agent may be at a
concentration of between 1% to 12% by volume or 1% to 12% by weight
of the reaction. While all PEGs are useful, preferred PEGs include
PEG1450, PEG3000, PEG8000, PEG10000, PEG compound molecular weight
15000-to 20,000 (also known as Carbowax 20M), and a combination
thereof.
[0076] The buffer solution in an RPA may be a Tris-HCl buffer, a
Tris-Acetate buffer, or a combination thereof. The buffers may be
present at a concentration of between 10 to 100 mM. The buffered pH
may be between 6.5 to 9.0. The buffer may further contain Mg ions
(e.g., in the form of Mg Acetate) at a concentration between 1 to
100 mM with a concentration of between 5 to 15 mM being preferred.
One preferred Mg concentration is 10 mM (Mg concentration or Mg
Acetate concentration).
[0077] Reducing agents to be used include DTT. The DTT
concentration may be between 1 mM and 10 mM.
[0078] The ATP or ATP analog may be any of ATP, ATP-.gamma.-S,
ATP-.beta.-S, ddATP or a combination thereof. A preferred ATP or
ATP analog concentration is between 1 and 10 mM.
[0079] Recombinase loading protein may include, for example,
T4uvsY, E. coli recO, E. coli recR and derivatives and combinations
of these proteins. One preferred concentration of these proteins is
between 0.2 and 8 .mu.M.
[0080] The primers used may be made from DNA, RNA, PNA, LNA,
morpholino backbone nucleic acid, phosphorothiorate backbone
nucleic acid and a combination thereof. Combinations thereof in
this can refers to a single nucleic acid molecules which may
contain one or more of one base connected to one of more of another
base. Preferred concentration of these molecules may be in the
range of between 25 nM to 1000 nM. In one preferred embodiment, the
primers may contain a non-phosphate linkage between the two bases
at its 3' end and is resistant to 3' to 5' nuclease activity. In
another embodiment, the primers may contain a locked nucleic acid
at its 3' ultimate base or 3' penultimate base. For example, in a
nucleic acid of the sequence 5'-AGT-3', the T is the 3' ultimate
base and the G is the 3' penultimate base. The primers may be at
least 20 bases in length or at least 30 bases in length. In one
preferred embodiment, the primers are between 20 to 50 bases in
length. In another preferred embodiment, the primers are between 20
to 40 bases in length such as between 30 to 40 bases in length.
[0081] The primers may contain additional 5' sequence that is not
complementary to the target nucleic acid. These 5' sequence may
contain, for example a restriction endonuclease recognition site.
The primers may be partly double stranded with a single stranded 3'
end.
[0082] In addition, any nucleic acid of any of the methods of the
invention may be labeled with a detectable label. A detectable
label includes, for example, a fluorochrome, an enzyme, a
fluorescence quencher, an enzyme inhibitor, a radioactive label and
any combination thereof.
[0083] The target nucleic acid may be single stranded or double
stranded. It is known that single stranded nucleic acids would be
converted to double stranded nucleic acid in the methods of the
invention. The target nucleic acid may be supercoiled or linear.
The sequence to be amplified (target nucleic acid) may be in
between other sequences. The sequence to be amplified may also be
at one end of a linear nucleic acid. In one embodiment, the target
nucleic acid is linear and not connected to non-target nucleic
acids. In other words, where the target nucleic acid is linear, it
can be in any of the following formats:
[0084] 1. [non-target nucleic acid]-[target nucleic
acid]-[non-target nucleic acid]
[0085] 2. [non-target nucleic acid]-[target nucleic acid]
[0086] 3. [target nucleic acid]-[non-target nucleic acid]
[0087] 4. [target nucleic acid]
[0088] It should be noted that the arrangement above is intended to
represent both single stranded nucleic acids and double stranded
nucleic acids. "1" may be described as a target nucleic acid
molecule which is linear with two ends and wherein both ends are
linked to a non-target nucleic acid molecule. "2" may be described
as a target nucleic acid molecule which is linear with two ends and
wherein one end is linked to a non-target nucleic acid molecule.
"3" may be described as a target nucleic acid molecule which is a
linear nucleic acid molecule (with no non-target nucleic acid).
[0089] In another embodiment, the target nucleic acid may be a
single-stranded nucleic acid which is converted to a double
stranded nucleic acid by a polymerase or a double stranded nucleic
acid denatured by the action of heat or chemical treatment.
[0090] The target nucleic acid may be of any concentration such as
less than 10,000 copies, less than 1000 copies, less than 100
copies, less than 10 copies or 1 copy in a reaction. A reaction
volume may be 5 .mu.l, 10 .mu.l, 20 .mu.l, 30 .mu.l, 50 .mu.l, 75
.mu.l, 100 .mu.l, 300 .mu.l, 1 ml, 3 ml, 10 ml, 30 ml, 50 ml or 100
ml.
[0091] The reaction may be incubated between 5 minutes and 16
hours, such as between 15 minutes and 3 hours or between 30 minutes
and 2 hours. The incubation may be performed until a desired degree
of amplification is achieved. The desired degree of amplification
may be 10 fold, 100 fold, 1000 fold, 10,000 fold, 100,000 fold or
1,000,000 fold amplification. Incubation temperature may be between
20.degree. C. and 50.degree. C., between 20.degree. C. and
40.degree. C., such as between 20.degree. C. and 30.degree. C. One
advantage of the methods of the invention is that the temperature
is not critical and precise control, while preferred, is not
absolutely necessary. For example, in a field environment, it is
sufficient to keep the RPA at room temperature, or close to body
temperature (35.degree. C. to 38.degree. C.) by placing the sample
in a body crevice. Furthermore, the RPA may be performed without
temperature induced melting of the template nucleic acid.
[0092] In another embodiment of the invention, the RPA further
comprise accessory agents. These accessory agents includes
helicase, topoisomerase, resolvase and a combination thereof which
possess unwinding, relaxing, and resolving activities respectively
on DNA. The accessory agents may also include RuvA, RuvB, RuvC,
RecG, PriA, PriB, PriC, DnaT, DnaB, DnaC, DnaG, DnaX clamp loader,
polymerase core complex, DNA ligase and a sliding clamp and a
combination thereof. The sliding claim may be E. coli .beta.-dimer
sliding clamp, the eukaryotic PCNA sliding clamp, or the T4 sliding
clamp gp45 and a combination thereof. The accessory agents may
include, in addition, DNA Polymerase III holoenzyme complex
consisting of .beta.-Clamp, DnaX Clamp Loader, and the Polymerase
Core Complex. These latter accessory agents would allow the
performance of leading and lagging RPA.
[0093] In another embodiment, the RPA may be performed in the
presence of a RecA/ssDNA nucleoprotein filaments stabilizing agent.
Examples of such stabilizing include RecR, RecO, RecF and a
combination thereof. These stabilizing agents may be present at a
concentration of between 0.01 .mu.M to 20 .mu.M. Other examples of
stabilizing agents include the T4 uvsY protein which stabilizes
uvsX/ssDNA nucleoprotein complexes.
[0094] Other components of RPA include a system for ATP
regeneration (convert ADP to ATP). Such system may be, for example,
phosphocreatine and creatine kinase.
[0095] The RPA reaction may also include a system to regenerate ADP
from AMP and to convert pyrophosphate to phosphate
(pyrophosphate).
[0096] In one preferred embodiment, the RPA reaction as listed
above are performed with E. coli components completely by using
recA, SSB, recO, recR and E coli polymerase.
[0097] In another preferred embodiment, the RPA reaction is
performed with T4 components by using uvsX, gp32, uvxY, and T4
polymerase.
[0098] In one preferred embodiment, RPA may be performed by
combining the following reagents: (1) a uvsX recombinase at a
concentration of between 0.2 to 12 .mu.M; (2) a gp32 single
stranded DNA binding protein at a concentration between 1 to 30
.mu.M; (3) a Bacillus subtilis DNA polymerase I large fragment (Bsu
polymerase) at a concentration between 500 to 5000 units per ml;
(4) dNTPs or a mixture of dNTPs and ddNTPs at a concentration of
between 1-300 .mu.M; (5) polyethylene glycol at a concentration of
between 1% to 12% by weight or by volume; (6) Tris-acetate buffer
at a concentration of between 1 mM to 60 mM; (7) DTT at a
concentration of between 1 mM-10 mM; (8) ATP at a concentration of
between 1 mM-10 mM; (9) uvsY at a concentration of between 0.2
.mu.M-8 .mu.M; (10) a first primer and optionally a second primer,
wherein said primers are at a concentration of between 50 nM to 1
.mu.M; and (11) a target nucleic acid molecule of at least one
copy. After the reaction is assembled, it is incubated until a
desired degree of amplification is achieved. This is usually within
2 hours, preferably within 1 hour, such as, for example, in 50
minutes.
[0099] One advantage of the invention is that the reagents for RPA,
with the possible exception of the crowding agent and buffer, may
be freeze dried (i.e., lyophilized) before use. Freeze dried
reagent offer the advantage of not requiring refrigeration to
maintain activity. For example, a tube of RPA reagents may be
stored at room temperature. This advantage is especially useful in
field conditions where access to refrigeration is limited.
[0100] In one embodiment, the RPA reagents may be freeze dried onto
the bottom of a tube, or on a bead (or another type of solid
support). To perform an RPA reaction, the reagents are
reconstituted in a buffer solution and with a crowding reagent, or
simply a buffered solution or water, dependant on the composition
of the freeze-dried reagents. Then a target nucleic acid, or a
sample suspected to contain a target nucleic acid is added. The
reconstitution liquid may also contain the sample DNA. The
reconstituted reaction is incubated for a period of time and the
amplified nucleic acid, if present, is detected.
[0101] Detection may be performed using any method, such as, for
example, using electrophoresis on an agarose or PAGE gel followed
by ethidium bromide staining.
[0102] In any of the methods of the invention, the reagents that
can be freeze dried before use would include, at least, the
recombinase, the single stranded DNA binding protein, the DNA
polymerase, the dNTPs or the mixture of dNTPs and ddNTPs, the
reducing agent, the ATP or ATP analog, the recombinase loading
protein, and the first primer and optionally a second primer or a
combination of any of these.
[0103] In one preferred embodiment, the reagents are assembled by
combining the reagents such that when constituted, they will have
the following concentrations: (1) a uvsX recombinase at a
concentration of between 0.2 to 12 .mu.M; (2) a gp32 single
stranded DNA binding protein at a concentration between 1 to 30
.mu.M; (3) a T4 gp43 DNA polymerase or Bsu polymerase at a
concentration between 500 to 5000 units per ml; (4) dNTPs or a
mixture of dNTPs and ddNTPs at a concentration of between 1-300
.mu.M; (5) DTT at a concentration of between 1 mM-10 mM; (6) ATP at
a concentration of between 1 mM-10 mM; (7) uvsY at a concentration
of between 0.2 .mu.M-8 .mu.M. Optionally, a first primer and
optionally a second prime may be added where their concentration
would be between 50 nM to 1 .mu.M when reconstituted. The reagents
are freeze dried before use. Stabilizing agents such as trehalose
sugar may be included in the freeze dried mixture, for example at
20 mM to 200 mM and most optimally 40 mM to 80 mM in the
reconstituted reaction, in order to improve freeze-drying
performance and shelf life. If desired, the freeze dried reagents
may be stored for 1 day, 1 week, 1 month or 1 year or more before
use.
[0104] In use, the reagents are reconstituted with buffer (a)
Tris-acetate buffer at a concentration of between 1 mM to 60 mM;
and (b) polyethylene glycol at a concentration of between 1% to 12%
by weight or by volume, or (c) with water. If the primers were not
added before freeze drying, they can be added at this stage.
Finally, a target nucleic acid, or a sample suspected of containing
a target nucleic acid is added to begin the reaction. The target,
or sample, nucleic acid may be contained within the reconstitution
buffer as a consequence of earlier extraction or processing steps.
The reaction is incubated until a desired degree of amplification
is achieved.
[0105] Any of the RPA reaction conditions discussed anywhere in
this specification may be freeze dried. For example, the following
reagents can be assembled by combining each reagent such that when
constituted, they will have the following concentrations: (1)
100-200 ng/.mu.l uvsX recombinase; (2) 600 ng/.mu.l gp32; (3) 20
ng/.mu.l Bsu polymerase or T4 polymerase; (4) 200 .mu.M dNTPs; (5)
1 mM DTT (6) 3 mM ATP or an ATP analog; (7) 16 ng/.mu.l to 60
ng/.mu.l uvsY; (8) 50 nM to 300 nM of a first primer and 50 nM to
300 nM of a second primer; (9) 80 mM Potassium acetate; (10) 10 mM
Magnesium acetate; (11) 20 mM Phosphocreatine; (12) 50 ng/.mu.l to
100 ng/.mu.l Creatine kinase. The reagents may be freeze dried onto
the bottom of a tube or in a well of a multi-well container. The
reagent may be dried or attached onto a mobile solid support such
as a bead or a strip, or a well.
[0106] In use, the tube with the reagent may be reconstituted with
(1) Tris-acetate buffer at a concentration of between 1 mM to 60 mM
and polyethylene glycol at a concentration of between 1% to 12% by
weight or by volume. If the reagents were dried or attached to a
mobile solid support, the support may be dropped in a tube and
reconstituted. As discussed above, the primers may be dried as part
of the reagent or added after reconstitution. Finally, a target
nucleic acid, or a sample suspected of containing a target nucleic
acid is added to begin the reaction. The reaction is incubated
until a desired degree of amplification is achieved.
[0107] As another example, the following reagents can be assembled
by combining each reagent such that when constituted, they will
have the following concentrations: (1) 100-200 ng/.mu.l uvsX
recombinase; (2) 300-1000 ng/.mu.l gp32; (3) 10-50 ng/.mu.l Bsu
polymerase or T4 polymerase; (4) 50-500 .mu.M dNTPs; (5) 0.1 to 10
mM DTT; (6) 3 mM ATP or an ATP analog; (7) 16 ng/.mu.l to 60
ng/.mu.l uvsY; (8) 50 nM to 1000 nM of a first primer and 50 nM to
1000 nM of a second primer; (9) 40 mM to 160 mM Potassium acetate;
(10) 5 mM to 20 mM Magnesium acetate; (11) 10 mM to 40 mM
Phosphocreatine; (12) 50 ng/.mu.l to 200 ng/.mu.l Creatine kinase.
These reagents are freeze dried and stored. In use, the reagents
are reconstituted with Tris-acetate buffer at a concentration of
between 1 mM to 60 mM and polyethylene glycol at a concentration of
between 1% to 12% by weight or by volume. The primers, item 8
above, may be omitted before freeze drying and added after
reconstitution. To initiate the RPA, a target nucleic acid, or a
sample suspected of containing a target nucleic acid is added. The
reaction is incubated until a desired degree of amplification is
achieved.
[0108] Another embodiment of the invention comprises a kit for
performing RPA. The kit may comprise any of the reagents discussed
above for RPA in the concentrations described above. The reagents
of the kit may be freeze dried. For example, the kit may contain
(1) 100-200 ng/.mu.l uvsX recombinase; (2) 300 ng/.mu.l to 1000
ng/.mu.l gp32; (3) 10 ng/.mu.l to 50 ng/.mu.l Bsu polymerase or T4
polymerase; (4) 50 .mu.M to 500 .mu.M dNTPs; (5) 0.1 to 10 mM DTT;
(6) 1 mM to 5 mM ATP or an ATP analog; (7) 16 ng/.mu.l to 60
ng/.mu.l uvsY; (8) 50 nM to 1000 nM of a first primer and 50 nM to
1000 nM of a second primer (optional); (9) 40 mM to 160 mM
Potassium acetate; (10) 5 mM to 20 mM Magnesium acetate; (11) 10 mM
to 40 mM Phosphocreatine; (12) 50 ng/.mu.l to 200 ng/.mu.l Creatine
kinase.
[0109] In a preferred embodiment, RPA is performed with several
auxiliary enzymes that can promote efficient disassembly of
Recombinase-agent/dsDNA complexes after DNA synthesis initiation.
These auxiliary enzymes include those that are capable of
stimulating 3' to 5' disassembly and those capable of supporting 5'
to 3' disassembly.
[0110] Auxiliary enzymes include several polymerases that can
displace RecA in the 3' to 5' direction and can stimulate 3' to 5'
disassembly of Recombinase-agent/dsDNA complexes (Pham et al.,
2001). These DNA polymerase include E. coli PolV and homologous
polymerase of other species. Normally in the life of E. coli,
displacement of RecA in the 3' to 5' direction occurs as part of
SOS-lesion-targeted synthesis in concert with SSB, sliding clamps
and DNA polymerase. The polymerase essential for this activity in
E. coli is PolV, a member of the recently discovered superfamily of
polymerases including UmuC, DinB, Rad30, and Rev1, whose function
in vivo is to copy DNA lesion templates. Critical to RPA, the in
vitro 3' to 5' disassembly of RecA filaments cannot be catalyzed by
PolI, PolIII, or PolIV alone. Only PolV, in concert with SSB, has
measurable ATP-independent 3' to 5' RecA/dsDNA disassembly
activity. In effect, PolV pushes and removes RecA from DNA in a 3'
to 5' direction ahead of the polymerase (Pham et al., 2001; Tang et
al., 2000). Inclusion of PolV or a functional homologue may improve
the amplification efficiency.
[0111] Other auxiliary enzymes include a class of enzymes called
helicases that can be used to promote the disassembly of RecA from
dsDNA. These promote disassembly in both the 5' to 3' and 3' to 5'
directions. Helicases are essential components of the recombination
process in vivo and function to move the branch points of
recombination intermediates from one place to another, to separate
strands, and to disassemble and recycle components bound to DNA.
After the first round of invasion/synthesis has occurred in RPA,
two new DNA duplexes are "marked" by the presence of RecA bound
over the site to which primers must bind for additional rounds of
synthesis. In such a situation dsDNA tends to occupy the high
affinity site in RecA, or homologs, until it is actively displaced,
either by ATP hydrolysis-dependent dissociation in the 5' to 3'
direction, which may be limiting, or by 3' to 5' dissociation by
some other active process. An ideal helicase complex for
stimulating disassembly of RecA from intermediates consists of the
E. coli proteins RuvA and RuvB. The RuvAB complex promotes branch
migration, and dissociates the RecA protein, allowing RecA to be
recycled (Adams et al., 1994). Normally, the RuvAB complex is
targeted to recombination intermediates, particularly Holliday
junction-like structures. As it works the RuvAB complex encircles
DNA and forces RecA from the DNA in an ATP-driven translocation
(Cromie and Leach, 2000; Eggleston and West, 2000). This RecA
dissociation activity has been demonstrated using supercoiled dsDNA
bound with RecA, which does not even possess Holliday junctions
(Adams et al., PNAS 1994). The RuvAB complex can recognize branched
structures within the RecA coated DNA. Incorporation of RuvAB into
the RPA mixture will promote the dissociation of RecA from dsDNA
following strand exchange and displacement, allowing renewed
synthesis of the duplicated template from the same site.
Additionally, the RuvAB complex can act in concert with RuvC, which
finally cuts and resolves Holliday junctions. With RuvC added to
the RPA reaction mixture, complicated structures such as Holliday
junctions formed at invasion sites, can be resolved. Resolvase
activity, such as that provided by RuvC, is particularly important
when the targeting oligonucleotides are partially double-stranded.
In such situations reverse branch migration can generate Holliday
junctions, which can then be resolved by the RuvABC complex, to
generate clean separated amplification products.
[0112] Still other auxiliary enzymes include the E. coli RecG
protein. RecG can stimulate disassembly of branch structures. In
vivo this protein functions to reverse replication forks at sites
of DNA damage by unwinding both leading and lagging strands driving
the replication fork back to generate a 4-way junction (Cox et al.,
2000; Dillingham and Kowalczykowski, 2001; Singleton et al., 2001).
In vivo such junctions function as substrates for strand switching
to allow lesion bypass. In vitro RecG will bind to D-loops, and
will lead to a decrease in D-loop structures by driving reverse
branch migration. RecG prefers a junction with double-stranded
elements on either side, hence partly double-stranded targeting
oligonucleotides, homologous to the targeting site in both
single-stranded and double-stranded regions, would be ideal. This
would stimulate reverse branch migration and formation of a
Holliday junction, which can be resolved by the RuvABC complex. In
vivo RecG and RuvAB may compete to give different outcomes of
recombination since branch migration will be driven in both
directions (McGlynn and Lloyd, 1999; McGlynn et al., 2000). In both
cases the proteins target junction DNA coated with RecA, and
disassemble it in an active manner.
[0113] Other auxiliary enzymes useful in an RPA reaction mixture
are those that allow continual generation of RecA nucleoprotein
filaments in the presence of ATP and SSB. In order to allow removal
of RecA at the appropriate moments, it is preferred to use ATP
rather than ATP.gamma.S in an RPA reaction. Unfortunately
RecA/ssDNA filaments formed with ATP spontaneously depolymerize in
the 5' to 3' direction, and in the presence of SSB, as required
here, repolymerization will not occur at significant rates. The
solution to this problem is the use of the RecO, RecR, and possibly
RecF proteins. Alternatively the uvsY protein may be employed to
stabilize the T4 uvsX nucleoprotein filaments in a similar manner.
In the presence of SSB and ATP, RecA/ssDNA filaments dissociate
(Bork et al., 2001; Webb et al., 1995; Webb et al., 1997; Webb et
al., 1999). If RecA/ssDNA is incubated in the presence of RecO and
RecR proteins this dissociation does not occur. Indeed the RecR
protein remains associated with the filament and stabilizes the
structure indefinitely. Even if ssDNA is bound by SSB, in the
presence of RecR and RecO, filaments of RecA can reassemble
displacing SSB. In the T4 phage system similar properties are
attributed to the uvsY protein. Thus it is possible to obviate the
use of ATP.gamma.S, if necessary, by using ATP in the presence of
RecO and RecR to maintain RecA/ssDNA filament integrity, or uvsY to
maintain the uvsX/ssDNA filament integrity. The RecF protein
interacts with the RecO and RecR system in a seemingly opposing
manner RecF competes with RecR tending to drive filament
disassembly in vitro. It is likely that all three components in
vivo function together to control the generation of invading
structures, while limiting the extent of RecA coating of ssDNA. In
another preferred embodiment, RecF is included in RPA reactions at
an appropriate concentration to re-capitulate the dynamics of the
in vivo processes. In addition, RecF may facilitate dissociation of
RecA-coated intermediates after invasion has occurred.
[0114] As described, the use of ATP rather than ATP.gamma.S, and/or
the use of displacing polymerases and helicases (e.g. the RuvA/RuvB
complex), RecO, RecR and RecF, or alternatively the T4 uvsX
recombinase with the uvsY protein, should permit exponential
amplification of double-stranded DNA by driving continual
regeneration of targeting sites. This method, however, remains
responsive to differences in initiation rate that might occur at
the two opposing targeting sites. Such differences may lead to a
decrease in amplification efficiency, and to the production of some
single-stranded DNA. The PCR method largely avoids these
complications because temperature cycling leads to coordinated
synthesis from either side. In another embodiment, a situation
analogous to the PCR condition just described may be induced by
using temperature sensitive (ts) mutants of RecA that are
non-functional at 42.degree. C., but function at lower temperatures
in the range 25 to 37.degree. C. (Alexseyev et al., 1996; Hickson
et al., 1981). In this case, synthesis from either end can be
synchronized by periodic lowering to the permissive temperature and
then raising the reaction to a temperature non-permissive for the
mutant RecA protein function, but permissive for the other
components. By performing RPA with tsRecA mutants in combination
with cycling of reaction temperatures, the number of molecules of
DNA produced can be controlled. While this will require some
mechanism to provide temperature cycling, the temperatures are well
below those that would require the use of thermophile-derived
proteins. Indeed, a simple chemical-based or portable low-power
temperature-cycling device may be sufficient to control such
reaction cycles.
[0115] RPA, as all other present-day nucleic acid amplification
methods, employs polymerases to generate copies of template nucleic
acid molecules. It is a necessity of most nucleic acid polymerases
that incorporation requires a free 3'-hydroxyl moiety on the
terminal sugar of a short stretch of double-stranded nucleic acid
adjacent to the site of new synthesis. This stretch of
double-stranded nucleic acid is typically formed on a template by a
short complementary sequence, called a primer, which serves as an
initiation site for the polymerase synthesis reaction. In some
cases a 3' modification, such as a sulfydryl, may utilized to prime
the synthesis reaction. The primer nucleic acid, which is
base-paired with the template and extended by the polymerase, can
be RNA or DNA. In vivo during genomic DNA replication, RNA primer
sequences are synthesized de novo onto template DNA by primase
enzymes. Typically, for in vitro reactions the primer is supplied
as a short, often chemically synthesized, single-stranded DNA (or
modified DNA or RNA), and is usually referred to as an
oligonucleotide primer. The primer is often of a specific sequence,
although random primers can also be used. The primer is targeted to
complementary sequences by virtue of its specific base-pairing
capacity. Formation of hybrids between the oligonucleotide primer
and target nucleic acid are typically formed by incubation of the
two in solution under conditions of salt, pH, and temperature that
allow spontaneous annealing.
[0116] In the case of the PCR the oligonucleotide primer is usually
in vast excess for two main reasons. First, the high concentration
will drive rapid annealing. Second, as the reaction proceeds
through rounds of melting, annealing and extension the primer is
consumed and becomes limiting. PCR targeted nucleic acids are often
initially double-stranded in character, and if not, become double
stranded following the first synthetic cycle. Such double-stranded
molecules cannot anneal new oligonucleotides at temperature and
solvent conditions appropriate for the catalytic activity and
stability of most prokaryotic and eukaryotic proteins.
Consequently, in order to allow cycles of amplification the
original template and the newly synthesized strands must be first
separated before annealing can occur once again. In practice this
is achieved by thermal melting. For PCR, temperatures of at least
80.degree. C. are required for thermal melting of most
double-stranded nucleic acid molecules of lengths greater than 100
base pairs. In most PCR protocols a temperature of 90 to
100.degree. C. is applied to melt the DNA. Such temperatures allow
only rare thermostable enzymes to be used. These polymerases are
typically derived from thermophilic prokaryotes.
[0117] The advantage of RPA is that it allows the formation of
short stretches of double-stranded nucleic acids bearing a free
3'-OH for extension from double-stranded templates without thermal
melting. This is achieved by using the RecA protein from E. coli
(or a RecA relative from other phyla including the T4 uvsX
protein). In the presence of ATP, dATP, ddATP, UTP, ATP.gamma.S,
and possibly other types of nucleoside triphosphates and their
analogs, RecA or uvsX will form a nucleoprotein filament around
single-stranded DNA. This filament will then scan double-stranded
DNA. When homologous sequences are located the recombinase will
catalyze a strand invasion reaction and pairing of the
oligonucleotide with the homologous strand of the target DNA. The
original pairing strand is displaced by strand invasion leaving a
bubble of single stranded DNA in the region.
[0118] RecA protein can be obtained from commercial sources.
Alternatively it can be purified according to standard protocols
e.g. (Cox et al., 1981; Kuramitsu et al., 1981). RecA homologues
have been purified from thermophilic organisms including
Thermococcus kodakaraensis (Rashid et al., 2001), Thermotoga
maritima (Wetmur et al., 1994), Aquifex pyrophilus (Wetmur et al.,
1994), Pyrococcus furiosus (Komori et al., 2000), Thermus aquaticus
(Wetmur et al., 1994), Pyrobaculum islandicum (Spies et al., 2000),
and Thermus thermophilus (Kato and Kuramitsu, 1993). RecA has also
been purified from other prokaryotes e.g. Salmonella typhimurium
(Pierre and Paoletti, 1983), Bacillus subtilis (Lovett and Roberts,
1985), Streptococcus pneumoniae (Steffen and Bryant, 2000),
Bacteroides fragilis (Goodman et al., 1987), Proteus mirabilis
(West et al., 1983), Rhizobium meliloti (Better and Helinski,
1983), Pseudomonas aeruginosa (Kurumizaka et al., 1994), from
eukaryotes e.g. Saccharomyces cerevisiae (Heyer and Kolodner,
1989), Ustilago maydis (Bennett and Holloman, 2001), including
vertebrates e.g. Human Rad51 (Baumann et al., 1997) and Xenopus
laevis (Maeshima et al., 1996), as well as plants including
broccoli (Tissier et al., 1995). We here also show that E. coli
recA, and T4 uvsX protein, can be purified from overexpression
cultures using a hexahistidine tag at the C terminus, and remain
biologically active. This is of great utility for the production of
recombinant protein.
[0119] For clarity of description, leading strand
Recombinase-Polymerase Amplification method (lsRPA) can be divided
into four phases.
[0120] Sequence Targeting
[0121] RPA is initiated by targeting sequences using synthetic
oligonucleotides coated with RecA, or a functional homologue such
as the T4 uvsX protein. In order to permit exponential
amplification two such synthetic oligonucleotides would be employed
in a manner such that their free 3'-ends are orientated toward one
another. Nucleoprotein filaments comprising these oligonucleotides
and recombinase protein will identify targets in complex DNA
rapidly and specifically. Once targeted the recombinase protein
catalyses strand exchange such that D-loop structures are formed.
It may be necessary to use ATP rather than ATP.gamma.S in the
procedure for efficient amplification. If ATP is used, RecO, RecR,
and/or RecF, molecules may prove essential for efficient
amplification, or uvsY protein if uvsX recombinase is employed.
[0122] Initiation of DNA Synthesis
[0123] DNA polymerases will detect and bind to the hybrid between
the invading oligonucleotides and the template DNA and initiate DNA
synthesis from the free 3'-hydroxyl exposed in the hybrid. Exposure
of this 3'-hydroxyl, and subsequent DNA synthesis, will likely
require disassembly of recombinase protein from the double-stranded
hybrid formed by strand exchange. To attain this disassembly it
will probably be necessary to employ ATP, which can support
spontaneous disassembly of recombinase from invasion complexes.
Additionally disassembly can be stimulated/enhanced by the use of
other proteins contained within the reaction mixture such as RuvA,
RuvB, RuvC, recG, other helicases, or other stimulatory components,
which can act to strip recombinase from the strand exchange
product.
[0124] Strand Displacement DNA Synthesis and Replicon
Separation.
[0125] As the DNA polymerases synthesize complementary copies of
template DNAs using the free 3'-hydroxyls of invading
oligonucleotides, or their partly extended products, the
polymerases displace single-stranded DNAs, which may be coated with
single strand binding proteins (SSB) included in the reaction. In
an ideal configuration, invasion of oligonucleotides at both ends
of the target nucleic acid sequence will occur in similar
timeframes, such that two polymerases on the same template nucleic
acid will initially progress toward one another. When these
extending complexes meet one another, the original template should
simply fall apart, and the polymerases will continue to synthesize
without a need for strand displacement, now copying SSB-bound ssDNA
template. Because of steric hinderance, polymerases may become
dissociated from the template temporarily when the polymerases meet
to permit the separation of the two template strands
[0126] Completion of Synthesis and Re-Invasion.
[0127] Once the template strands have separated, polymerases can
complete the extension to the end of the template (or past the
sequence acting as the second, facing, targeting site if the
initial template is longer than the desired product). To permit
exponential amplification it is necessary for new products to be
targeted and replicated in a manner similar to the original
templates, that is from both targeted ends. The newly synthesized
targeted site will be freely available to targeting
recombinase/oligonucleotide filaments. The site initially used to
prime synthesis should also have been freed as a consequence of the
use of conditions in the reaction that favor disassembly of
recombinase from strand exchange products. Providing the
re-invasion at this latter site occurs in less time than it takes
the polymerase to synthesize past the second targeting site, be
primed at that second site, and return to the first site, then
single-stranded DNA will not be the primary product and exponential
amplification will occur. Having multiple synthetic complexes
operating on the same template raises the possibility that very
short amplification times can be achieved.
[0128] Recombinase-Polymerase Amplification (RPA) Using
Simultaneous Leading and Lagging Strand Synthesis
[0129] In our description of (leading strand RPA) lsRPA we detail a
multi-component system with the capacity to regenerate targeting
sequences thus permitting exponential amplification of
double-stranded DNA. Unlike the Zarling method, lsRPA avoids the
linear production of single-stranded DNA. There is another approach
to solving this problem that completely avoids the possibility of
single-stranded products and a requirement for simultaneous end
initiation. This method necessarily involves a more complex
reaction mixture. Nevertheless all of the required components are
now well understood and should be amenable to assembly into a
single system. This system will recapitulate events occurring
during the normal replication cycle of cells to permit coupled
leading and lagging strand synthesis. This method, leading/lagging
strand RPA is described briefly in FIGS. 1 and 3.
[0130] During normal replication in vivo, double-stranded DNA is
simultaneously separated into 2 strands and both are copied to give
2 new molecules of double-stranded DNA by a replication machine.
This `machine` couples conventional 5' to 3' leading strand
synthesis with lagging strand synthesis, in which short RNA primers
are synthesized onto template nucleic acids by primase enzymes.
During lagging strand synthesis, short fragments of DNA are
produced, called Okazaki fragments, which are ligated together to
form contiguous lagging strands. This simultaneous
leading-strand/lagging-strand synthesis is responsible for
duplication of the entire genome of prokaryotic and eukaryotic
organisms alike. The essential components of this system have been
identified and characterized biochemically. The components can be
assembled in vitro to achieve a more efficient amplification than
possible using only leading-strand synthesis.
[0131] The essential components of the replication `machine` are
now well characterized for E. coli and certain other organisms such
as T4 phage. This machine comprises the PolIII holoenzyme (Glover
and McHenry, 2001; Kelman and O'Donnell, 1995) and the primosome
(Benkovic et al., 2001; Marians, 1999). The PolIII holoenzyme is
made up of ten polypeptide components. Each holoenzyme contains
two, asymmetrically oriented, core structures, each consisting of a
polymerase (a subunit) and two additional core components the
.epsilon. subunit, which possesses 3' to 5' exonuclease activity,
and the .theta. subunit. In addition to the core complex another
set of polypeptides provide the holoenzyme with processivity and
couple leading and lagging strand synthesis. The .beta.-dimer
sliding clamp encircles the template DNA affixing the complex to
the template with extremely high affinity. The sliding clamp loaded
onto DNA by the DnaX clamp loader comprising the
.tau..sub.2.gamma..delta..delta.'.chi..psi. polypeptide
subunits.
[0132] For clarity of description, the RPA method can be divided
into four phases. In reality all phases will occur simultaneously
in a single reaction.
[0133] 1) Sequence Targeting
[0134] RPA is initiated by targeting sequences using synthetic
oligonucleotides coated with RecA, or T4 uvsX, or a functional
homologue. Such nucleoprotein filaments will identify targets in
complex DNA rapidly and specifically. Once targeted, the RecA or
uvsX protein catalyses strand exchange such that a D-loop structure
is formed. It may be necessary to use ATP rather than ATP.gamma.S
in the procedure for efficient amplification. The linkage of
leading and lagging strand syntheses however may obviate the
requirement for very rapid recombinase stripping after initiation
of synthesis. If ATP is used, RecO, RecR, and RecF may need to be
employed with bacterial recA recombinase, or the T4 uvsY, proteins
may prove essential for efficient amplification with T4 uvsX
protein.
[0135] 2) Primosome Assembly
[0136] Primosomes can be assembled at D-loops. Normally, in E.
coli, D-loop structures are formed by RecA as part of the mechanism
to rescue damaged DNA in vivo, or during other forms of
recombination. The purpose of the combined action of RecA-mediated
strand exchange and primosome assembly is to generate a replication
fork. A replication fork is the nucleoprotein structure comprising
the separated template DNA strands and the replisome. The replisome
consists of the polymerase holoenzyme complex, the primosome, and
other components needed to simultaneously replicate both strands of
template DNA. Primosomes provide both the DNA unwinding and the
Okazaki fragment priming functions required for replication fork
progression. Similar primosome assembly occurs at recombination
intermediates in T4 phage directed by gp59 and gp41 protein.
[0137] Primosome assembly has been studied intensively through
genetic and biochemical analysis in E. coli. The minimal set of
polypeptides required for this process is well known and exist as
purified components. The primosome assembly proteins are PriA,
PriB, PriC, DnaT, DnaC, DnaB, and DnaG. These proteins have been
shown sufficient to assemble a primosome complex on bacteriophage
.PHI.X174 DNA in vitro (Kornberg and Baker, 1992; Marians, 1992).
PriA binds to the primosome assembly site (PAS) on the .PHI.X174
chromosome. Then PriB, DnaT, and PriC bind sequentially to the
PriA-DNA complex. PriB appears to stabilize PriA at the PAS and
facilitate the binding of DnaT (Liu et al., 1996). PriC is only
partially required for the full assembly reaction. Omission of PriC
from the reaction will lower priming 3 to 4 fold (Ng and Marians,
1996a; Ng and Marians, 1996b). The function of PriC in the
bacterium is genetically redundant to PriB. DnaC then loads DnaB
into the complex in an ATP-dependent fashion. This PriABC-DnaBT
complex is competent to translocate along the chromosome. The DnaG
primase can interact transiently with the complex to synthesize RNA
primers.
[0138] During replication in E. coli, DnaB and DnaG function as a
helicase and primase respectively. These two components are
continually required in association with the PolIII holoenzyme to
synthesize primers for the Okazaki fragments. Hence, DnaB and DnaG
are the core components of the mobile primosome associated with the
replication fork. The other primosome components described are
essential for assembly of the primosome onto DNA, and for
associating a dimeric polymerase. The primosome assembly proteins
are required for the re-establishment of replication forks at
recombination intermediates formed by RecA and strand exchange.
PriA can initiate assembly of a replisome, competent for DNA
synthesis, on recombination intermediates. It is possible to target
D-loops in vitro with a mixture of PriA, PriB, and DnaT, which are
then competent to incorporate DnaB and DnaC. Once a primosome has
been formed at the D-loop, all that remains to initiate replication
is to load a holoenzyme complex to the site. Alternatively in the
phage T4 system the gp59 helicase loader protein recruits and
assembles the gp41 replicative helicase to D-loop structures
[0139] 3) Fork Assembly and Initiation of DNA Synthesis
[0140] Replication forks will assemble at the site of primosome
assembly. In E. coli the presence of a free 3'-end on the invading
strand of the D-loop stimulates the DnaX clamp loader complex
detailed earlier to assemble a .beta.-dimer at this site to act as
a sliding clamp. The holoenzyme and 2 core units are joined
together by the scaffold t subunit. The t subunit also has
interaction surfaces for the .beta.-dimer, for the clamp loader,
and for the DnaB helicase component of the primosome. These
multiple interactions are necessary to coordinate synthesis of both
leading and lagging strands using the 2 asymmetrically joined core
polymerase complexes. In T4 phage the gp59/41 proteins with uvsY
and gp32 proteins, and with other components coordinate assembly of
the sliding clamp gp45 aided by gp44 and gp62 proteins initiates
replisome assembly.
[0141] In E. coli the primosomal primase, DnaG, synthesizes a short
RNA primer onto the unwound lagging strand DNA template. In the
presence of the holoenzyme, the clamp loader recognizes the RNA/DNA
duplex and loads a second .beta.-dimer clamp onto this site. The
presence of an active primosome and the interaction of the t
subunit with DnaB are critical to ensure simultaneous
leading/lagging strand synthesis. Without this interaction the
polymerase will move away from the primosome site without
coupling.
[0142] A replication fork is now assembled. Synthesis of both
leading and lagging strand will now occur simultaneously, and the
DnaB helicase will separate template strands ahead of the oncoming
holoenzyme. The lagging strand holoenzyme core will generate
Okazaki fragments of 1 to 2 kilobases in length. Once the lagging
strand polymerase encounters the previous RNA primer, it
dissociates from the .beta.-clamp and synthesis is initiated from a
newly assembled clamp loaded in the vicinity of the front of the
leading strand. The same lagging strand holoenzyme core will be
re-used since it is physically tethered to leading strand core.
[0143] There is a dynamic interaction between .beta.-dimer clamps,
core subunits, and clamp loaders. Their affinities can switch
depending upon the physical circumstances. The .beta.-dimer that
has been `abandoned` at the end of the Okazaki fragments may be
recycled via active removal by clamp loaders, or excess .delta.
subunit that may be present.
[0144] The RNA primers at the ends of Okazaki fragments are removed
by the 5' to 3' exonuclease activity of DNA polymerase I. DNA
ligase then joins the Okazaki fragments together forming a
continuous lagging strand.
[0145] 4) Fork Meeting and Termination
[0146] In RPA, replication is initiated at two distant sites and
the replication forks are oriented toward each other. As
replication forks converge the two original template strands will
dissociate from one another as they become separated entirely both
behind, and in front, of each fork. The leading strand core of each
fork will then complete synthesis, the remaining RNA primers will
be processed, and the final products will be two double-stranded
molecules. We can reasonably expect to amplify DNA's on the order
of several Megabases (Mb) by such an approach. In this disclosure,
megabase also encompasses megabasepairs. Based on the known
synthetic rate of the PolIII holoenzyme we can expect the
replication forks to proceed at a rate of approximately 1 Mb/1000
seconds, i.e., approximately 15 to 20 minutes per cycle for a 1 Mb
fragment.
[0147] The final consideration is the mechanism by which rapid
exponential amplification of DNA will be achieved. The key to this
process will be to allow efficient reinvasion of the targeting
sites by the use of mixtures of helicases, resolvases and the RecO,
RecR, and RecF proteins. Under appropriate conditions reinvasion
and primosome assembly should be possible shortly after a
holoenzyme has moved away from the fork-assembly site. Continual
invasions should present no problems since the DNA will simply
become branched at many points. Each branch will naturally resolve
as it encounters the oncoming fork. Under these conditions it may
be possible to achieve enormous amplification in times similar to
the time taken to replicate the DNA only once. It may be critical
however to limit the concentrations of targeting oligonucleotides
to avoid nucleotide depletion prior to the completion of
synthesis.
[0148] In addition to the holoenzyme complex, the replication
machine employs another complex known as the primosome, which
synthesizes the lagging strand and moves the replication fork
forwards. The primosome complex comprises a helicase encoded by
DnaB and a primase encoded by DnaG. Finally, in addition to the
proteins of the holoenzyme and primosome, replication requires the
activity of single-stranded DNA binding protein (SSB), E. coli DNA
polymerase I and DNA ligase. These latter two components are
required to process Okazaki fragments.
[0149] Nested RPA
[0150] In another embodiment, RPA amplification may be performed in
a process referred to herein as "nested RPA." A difficulty in
detecting a rare sequence is that there can be a high ratio of
non-target to target sequence. The ability of a RPA to discriminate
between target and non-target DNA and amplify only target sequences
is a key aspect of improved sensitivity. Discrimination between
non-target and target is a reflection of the specificity of the
primers and reaction conditions. The more specific a reaction is
the greater the relative amount of the specific target sequence
that is produced and the easier that product is to detect. An
increase in specificity can, therefore, increase sensitivity as
well.
[0151] The need for improved sensitivity and specificity can be
addressed by using nested RPA. The nested RPA involves a first RPA
of a first region of DNA. Then the reaction mixture is diluted, for
example, by 10, 20, 30, 40, 50, 75, or 100 fold or more to reduce
the concentration of the first primer pair, and a second primer
pair is introduced into the reaction mixture and RPA repeated.
According to one embodiment of the invention, the second primer
pair is designed to be internal to the first primer pair to amplify
a subsequence of the first RPA product. The method increases
specific amplification, i.e., reduces non-specific background
amplification products and therefore increases sensitivity. Such
non-specific amplification products, although they arise by virtue
of fortuitous partial homology to the flanking primers, are
unlikely to also have sufficient homology to the nested primers to
continue to amplify. Detection and specificity of RPA may be
further improved by labeling one or both of the second primer pair
such that only primers amplified with one or both of the second
primer pair is detected.
[0152] Nested RPA is not limited to the use of two sets of primer.
Naturally, more sets of primers may be used to increase specificity
or sensitivity. Thus, three, four, or five pairs of primers may be
used. Furthermore, the different sets of primers, as another
embodiment of the invention, may share common primers as
illustrated in FIG. 4.
[0153] In FIG. 4, the primer sets are designed to be used
sequentially. For example, a first RPA is performed with primer set
1, a second RPA using the amplified product of the first RPA is
performed with a primer set 2, a third RPA using the amplified
product of the second RPA is performed with a primer set 3, a
fourth RPA using the amplified sequence of the third RPA is
performed with a primer set 4, and finally, a fifth RPA is
performed using the amplified product of the fourth RPA is
performed with a primer set 5. In this case, primer set 1, 2, and
3, share a common primer-primer (a). Primer 3, 4, and 5 share a
common primer-primer (b).
[0154] Nested RPA may be performed using any of the two RPA methods
described as well as a combination of the two methods in any
particular order. That is, RPA may be performed solely by leading
strand RPA, solely by leading and lagging strand RPA, or a
combination of leading strand RPA and leading and lagging strand
RPA in any particular order.
[0155] One benefit of any of the RPA methods of the invention is
the size of the amplified product. While current methods of
amplification such as PCR are limited to an upper limit of about 10
Kb, RPA methods are capable of amplifying regions of nucleic acids
of up to hundreds of megabases. For leading/lagging strand RPA, the
sizes of a target sequence to be amplified can be hundreds of
megabases, such as, for example, less than 500 megabases, less than
300 megabase, less than 100 megabase, less than 70 megabase, less
than 50 megabase, less than 25 megabase, less than 10 megabase,
less than 5 megabase, less than 2 megabases, less than one
megabase, less than 500 kb, less than 200 kb, less than 100 kb,
less than 50 kb, less than 25 kb, or less than 10 kb, less than 5
kb, less than 2 kb, less than 1 kb. For lsRPA, the sizes of a
target sequence can be in the megabase range such as, less than 5
megabase, less than 2 megabases, less than one megabase, less than
500 kb, less than 200 kb, less than 100 kb, less than 50 kb, less
than 25 kb, or less than 10 kb, less than 5 kb, less than 2 kb,
less than 1 kb.
[0156] General Considerations for Reconstituting and Enabling
Recombinase-Mediated Amplification Reactions
[0157] Both lsRPA and leading/lagging RPA rely on similar use of
recombinase proteins to target oligonucleotide primers, however
they differ in the mode by which the new daughter duplexes are
formed during amplification. In leading/lagging RPA a full
replication fork is established that simultaneously synthesises
leading and lagging strands so that two new duplexes are
concomitantly formed. In leading strand RPA (lsRPA), only leading
strand synthesis occurs so that synthesis generates one duplex and
one displaced single-stranded DNA as products.
[0158] In RPA DNA synthesis initiated after strand exchange is
accomplished by a polymerase. During extension of the newly
synthesised strand the polymerase must be able to displace the
outgoing strand, either alone or in combination with a helicase
capable of mediating outgoing strand displacement. Extension of the
invading primer results eventually in the release of the outgoing
strand as a single-stranded DNA. To ensure that geometric
amplification occurs, and that the reaction produces a vast
majority of double-stranded DNA, it is necessary for this displaced
single-stranded DNA to serve as template for DNA synthesis from the
opposite direction. This is a central consideration for
amplification using lsRPA. Two other central considerations are the
polymerase species used, and the existence of a stable, dynamic,
recombinase system that functions efficiently in the presence
saturating levels of single-strand binding proteins. These
considerations are important for both the leading/lagging RPA and
lsRPA.
[0159] A) Ensuring Generation of Double-Stranded DNA from the
Displaced Strand
[0160] The generation of the second strand of DNA in lsRPA can be
achieved in one of several ways:
[0161] 1) The displaced single-stranded DNA can simply hybridise to
the complementary strand which has been displaced from invasion and
extension of a second `facing` targeting oligonucleotide.
Alternatively the displaced single-stranded DNA can hybridise
directly with the second `facing` oligonucleotide. Such
hybridisation events may occur spontaneously, or may be mediated by
the strand assimilating activities of DNA binding proteins such as
recombinases or single-stranded DNA binding proteins. Following
hybridisation a polymerase will extend from the free 3'end to
generate a double-stranded product. Note that for this to occur
efficiently the reaction environment must enable hybridisation of
complementary single-stranded DNAs, a situation not always
compatible with the other aspects of the RPA reaction. In some
circumstances a hybridising oligonucleotide with a modified
backbone, unable to interact with most DNA binding protein, could
be used.
[0162] 2) If strand-displacement synthesis begins simultaneously
from opposing oligonucleotide primer on the same template then the
two converging replication complexes will eventually meet somewhere
in the middle of the template. Provided that these converging
complexes are able to pass one another the template strands will
separate and each complex will complete replication by copying a
single-stranded rather than double-stranded template with no
further need for strand displacement.
[0163] 3) If the outgoing strand possesses the capacity to form a
hairpin then self-priming second strand synthesis may occur. This
activity would result in a covalently linked duplex with a hairpin
at one end, which could become a target for further
invasion/extension reactions. This situation is not ideal for many
applications, as it will generate products with variable lengths
and structures. This may, however, be acceptable for detection
assays, such as some diagnostic tests. Furthermore it may be
possible to engineer primers such that after the first few rounds
of invasion/extension most outgoing strands are capable of
self-priming. This mode of duplex DNA formation may be very
efficient.
[0164] Which of these three general processes dominate in an lsRPA
reaction will depend on many factors. The most important factors
are the distance separating the two oligonucleotides primers in the
target, the invasion rate, and the sequence of the oligonucleotides
and template.
[0165] In the second general format of RPA, leading/lagging RPA,
the generation of substantial single-stranded DNA is avoided by
establishing a full replication fork at the invasion site. A full
replication fork permits the simultaneous copying of both leading
and lagging strands (which would be equivalent to the outgoing
strand). Leading/lagging RPA is elegant in its avoidance of the
generation of single-stranded DNA, however a larger number of
distinct proteins is required to generate full replication forks.
Nevertheless most aspects of optimisation for RPA reactions apply
to both lsRPA and leading/lagging RPA.
[0166] B) Choice of Polymerase, or Polymerase/Helicase System
[0167] The lsRPA method is similar in some respects to PCR. Both
processes use of pairs of oligonucleotide primers orientated with
3' ends pointed toward one another in the target DNA and both
methods achieve geometric amplification through the use of reaction
products as targets for subsequent rounds of DNA synthesis. There
are, however, fundamental differences in the reaction
configurations. For example, in RPA target DNA is double-stranded
prior to synthesis, whereas in PCR it is single-stranded after
thermal separation of strands. In RPA, DNA synthesis must
necessarily use DNA polymerases or polymerase complexes capable of
strand displacement. Furthermore, because partially copied strands
are physically associated with displaced strand through the
template, there is a risk that if the polymerase dissociates
temporarily from the template the 3' end of the new strand, and
eventually the whole new strand, will be lost by the action of
branch migration or another phenomenon known as bubble migration.
This suggests that ideally processive polymerases will be used for
RPA reactions. It is also important to consider that if converging
replication complexes cannot readily pass one another without
polymerase dissociation then some processive polymerases may
inhibit the RPA reaction on some templates. In summary the ideal
choice of polymerase will depend on the precise format and
objective of the particular RPA reaction, in particular the size of
the product to be amplified.
[0168] C) Establishment of a Stable Persistent Active Recombinase
Activity in a Noise-Suppressed Environment
[0169] A third consideration is how to establish a stable, but
dynamic, recombinase activity, while silencing the noise generated
by aberrant primer annealing seen at low temperatures. This means
establishing a reaction environment that balances several seemingly
incompatible requirements. For efficient RPA recombinase proteins
must remain active while assembled into oligonucleotide/recombinase
filaments scanning for target double-stranded DNAs. These complexes
must also disassemble after completing strand exchanges to permit
DNA synthesis. This must happen in an environment rich in
single-stranded DNA proteins. These proteins are needed to
stimulate recombination and DNA synthesis while preventing aberrant
oligonucleotide behaviour by melting secondary structures.
Fundamentally, the recombinases and single-stranded binding
proteins are in competition for oligonucleotide binding. While the
single-strand binding proteins are necessary to enable efficient
strand displacement during synthesis, they suppress recombination
activity because they have a higher affinity for single-stranded
DNA and bind with more cooperativity than do recombinases.
[0170] Establishment of a functional recombinase/replication
reaction environment requires nucleotide cofactors. RecA, and other
recombinases, require nucleotide co-factors, such as ATP, to
assemble filaments onto single-stranded DNA, perform homology
searches, and complete strand exchange. We have surmised that
non-hydrolysable analogues such as ATP-.gamma.-S would be
incompatible with RPA because the extremely high stability of the
3-stranded DNA/recA intermediate formed in the presence of with
ATP-.gamma.-S would prevent reinvasion at primer targets and would
thus prevent efficient amplification. They may even prevent any
useful access of polymerase to the recombination intermediate.
Earlier attempts to amplify DNA using E. coli recA (Zarling et al)
were probably limited by the ATP-.gamma.-S in the described
reactions.
[0171] The requirement for ATP in the reaction and the fact that
recombinase-complexes will be dynamically forming and disassembling
introduces additional complexities, primarily due to complex
interactions and competition between key reaction components. In
particular single-stranded binding proteins, such as the E. coli
single-stranded binding proteins, such as E. coli SSB or T4 phage
gp32 protein, are necessary to stimulate recombination by recA and
homologues, due both to their capacity to collect the outgoing
strand, and to melt secondary structures in single-stranded DNAs
thus enhancing recombinase loading. In RPA it is likely that
single-stranded binding proteins will further stimulate DNA
synthesis by binding and stabilising the displaced DNA strand,
preventing undesirable branch migration.
[0172] Despite the clear requirement for single-stranded binding
proteins, these proteins generally have a considerably higher
affinity for single-stranded DNA than recombinases such as recA, or
uvsX, and can inhibit nucleation of recombinase/DNA filaments.
Moreover, as filaments formed in the presence of ATP undergo
end-dependant disassembly (Bork, Cox and Inman J Biol Chem. 2001
Dec. 7; 276(49):45740-3), such filaments are likely to be rapidly
saturated with single-stranded binding proteins and inactivated
soon after initiation of the reaction. Thus for efficient RPA
conditions that prevent inactivation of the reaction components are
key in establishing robust amplification.
[0173] We have predicted a potentially stable reaction composition
using E. coli recA protein in the presence of ATP and the E. coli
single-stranded binding protein SSB, or the T4 uvsX protein in the
presence of gp32. We suggested the presence of recO, recR, and
possibly recF proteins (Bork, Cox and Inman EMBO J. 2001 Dec. 17;
20(24):7313-22), could lead to an environment in which pre-loaded
recA filaments were stabilised, and in which recA could nucleate
successfully onto SSB-bound oligonucleotides. A similar recombinase
loading system has been described in other organisms including the
recombination/replication/repair system of bacteriophage T4. The T4
recombinase uvsX can be loaded onto single-stranded DNA coated with
the T4 single-stranded DNA binding protein gp32 by the action of a
third component, the uvsY protein (Morrical and Alberts J Biol
Chem. 1990 Sep. 5; 265(25):15096-103). Interestingly a principal
role of this recombination system in vivo is to permit
recombination-dependant DNA synthesis by assembling replication
components at recombination intermediates such as D-loops (Formosa
and Alberts Cell. 1986 Dec. 5; 47(5):793-806). This process is
similar to what should happen in RPA driven from D-loops made by
the invasion of synthetic oligonucleotides. In addition to
interactions between the three components uvsX, uvsY, and gp32,
there are also interactions between these components and the
replication machinery such as the polymerase, clamp loader,
primase/helicase, and dda helicase (Reddy, Weitzel and Von Hippel,
Proc Natl Acad Sci USA. 1993 Apr. 15; 90(8):3211-5., Hacker and
Alberts, J Biol Chem. 1992 Oct. 15; 267(29):20674-81). Taken
together these facts suggest that the components of the T4
recombination/replication machinery would perhaps be even more
ideal for RPA than the E. coli equivalents.
[0174] In addition to the use of recombinase loading proteins, such
as recO and recR, or uvsY, there are other ways to create an
appropriate balance between recombinase activity and the activity
of single-stranded DNA binding proteins. The DNA binding and/or
cooperativity behaviour of recombinases and single-stranded DNA
binding proteins can be modulated by mutation. In addition,
recombinases from different sources have distinct properties
(Eggler, Lusetti and Cox, J Biol Chem. 2003 May 2;
278(18):16389-96. Epub 2003 Feb. 20, Villemain et al., J Biol Chem.
2000 Oct. 6; 275(40):31496-504). This suggests that a range of
recombinase and single-strand DNA binding protein activities could
be explored. The use of mutated proteins or proteins from different
species, in a set of optimisation experiments could lead to the
identification of an optimal ratio of the competing recombinase and
single-stranded binding activities. Ultimately the activities would
be balanced such that DNA association/dissociation for the two
DNA-binding species permits sufficient recombinase activity
together with sufficient DNA melting activity of the single-strand
DNA binding protein to perform its necessary functions also. In
addition, reduction of noise due to mispriming may be achieved
through the optimisation of such parameters as oligonucleotide
sequence design, reaction buffer, the use of partly modified
oligonucleotides, the use of part duplex oligonucleotides or the
addition of other specific reaction components detailed below.
[0175] Here we provide the results of experiments that validate the
RPA method. In particular, we provide a description and
demonstration of reaction compositions capable of supporting DNA
amplification. We demonstrate that relatively short synthetic
oligonucleotides can be used to target specific sequences and
support initiation of DNA synthesis. We describe the requirements
for particular types and concentrations of certain recombinases,
single-stranded binding proteins, ATP, and oligonucleotide
concentrations. We further describe the optimisation and modulation
of the reaction environment, which supports an active and dynamic
recombination system with desired rate behaviour, through the
inclusion of crowding agents (such as polyethylene glycols),
recombinase loading factors and/or mutated proteins with altered
biochemical activities. We establish that in the presence of
distributive polymerases at least (e.g. the E. coli DNA polymerase
I Klenow fragment), there are substantial improvements in
amplification efficiency when the distance between the
amplification priming sites is optimised. We establish that a
balance between polymerase exonuclease activity and oligonucleotide
protecting agents must be employed to avoid non-specific
degradation of oligonucleotide primers. We show that amplification
of sequences embedded within linear (or relaxed) DNA substrates is
relatively inefficient (at least with very distributive polymerases
such as Klenow), whereas amplification reactions directed toward
the ends of linear DNA substrates are most effective. We provide
methods to prepare target DNA to be more efficiently amplified in
an lsRPA reaction, including the methods of thermal or chemical
melting or restriction enzyme digestion. We also provide evidence
that the nature of the single-stranded binding protein is critical
to establish efficient RPA reactions, and provide a rationale for
this. Furthermore we suggest improvements and novel approaches to
reduce noise and optimise amplification reactions performed at
relatively low, or ambient, temperatures by the use of
part-double-stranded oligonucleotides, or oligonucleotide wholly or
partly lacking a phosphate backbone. We also provide evidence that
other enzymes and proteins involved in DNA metabolism can influence
RPA reactions, and some may be configured to improve reaction
efficiency and specificity. These include topoisomerases, which can
relax recombination/replication intermediates and may aid targeting
of embedded sequences, as well as helicases such as T4 dda helicase
or T4 gp41 which can improve the polymerase initiation and
elongation efficiency, particularly if non-strand displacing
polymerases are used. Finally we show that priA and the ruvA/B
helicases have activities that might be used to optimise
amplification efficiency.
[0176] Selection of RPA Reagents and Reaction Parameters
[0177] The details of leading strand RPA, leading and lagging
strand RPA, and nested RPA were listed above. This section will
describe the selection of reagents and parameter for any of the
three methods discussed above.
[0178] One benefit of RPA is that the amplified product of RPA is
double stranded DNA that could be used for other molecular biology
procedures. Thus, RPA may be combined with other methods in
molecular biology. For example, the starting material for RPA may
be a PCR amplified fragment. Alternatively, the product of an RPA
may be used for PCR.
[0179] If necessary, the RPA products in any of the methods of the
invention may be purified. For example, in the nested RPA method,
the amplified product may be purified after each RPA step before a
subsequent RPA step. Methods of purification of nucleic acids are
known in the art and would include, at least, phenol extraction,
nucleic acid precipitation (e.g., with salt and ethanol), column
chromatography (e.g., size exclusion, ionic column, affinity column
and the like) or any combination of these techniques.
[0180] As discussed, the primers used in RPA may be "double
stranded" or "capable of forming double stranded structures." These
terms refer to DNA molecules that exist in a double stranded
condition in a reaction solution such as a RPA reaction solution or
a PCR reaction solution. The composition of a PCR solution is
known. The composition of a RPA reaction is listed in this detailed
description section and in the Examples.
[0181] The primers may have a single stranded region for
hybridization to the target DNA in the presence of a recombinase
agent. The single stranded region may be, for example, about 10
bases about 15 bases, about 20 bases, about 25 bases, about 30
bases, about 40 bases, and about 50 bases. Even longer regions such
as about 75 bases, about 100 bases, about 150 bases or more may be
used but it is not necessary. The choice of single stranded regions
will depend on the complexity of the starting nucleic acid so that
for example, a human genome may require a longer primer while a
plasmid may require a much shorter primer.
[0182] The two strands of nucleic acid in a double stranded DNA
need not be completely complementary. For example, the
double-stranded region of a double-stranded DNA may differ by up to
1% in sequence. That is, the sequence of two strands of nucleic
acid may differ by one base in one hundred bases and would still
exist in a double stranded condition in solution. Nucleic acids
with 1% difference in their complementary sequence are contemplated
as double stranded DNA for the purposes of this disclosure.
[0183] In addition, the target nucleic acid (i.e., the nucleic acid
to be amplified by the RPA methods of the invention) may be
partially double stranded and partially single stranded. For
example, nucleic acid in any of the configuration of FIG. 5 would
be suitable as a target nucleic acid of the invention. As
discussed, the target nucleic acid may be RNA. RNA can be converted
to double-stranded cDNA using known methods and the double-stranded
cDNA may be used as the target nucleic acid. As shown if FIG. 5,
the template nucleic acid may have any combination of ends selected
from 3' overhang, 5' overhang, or blunt ends.
[0184] The lsRPA method of the invention comprises at least the
following steps. First, a recombinase agent is contacted to two
nucleic acid primers (referred to herein as a first and a second
primer) to form two nucleoprotein primers (referred to herein as a
first nucleoprotein primer and a second nucleoprotein primer).
[0185] Second, the first and second nucleoprotein primers are
contacted to the template nucleic acid to form a double stranded
structure at a first portion of the first strand and a second
double stranded structure at a second portion of the second strand.
The two primers are designed so that when hybridized, they are
pointed at each other as illustrated in FIG. 6A. Alternatively,
primer 1 and primer 2 may hybridize different target nucleic acids
as illustrated in FIG. 6B.
[0186] Third, the nucleoprotein primers are extended at their 3'
ends to generate a first and a second double stranded nucleic acid
(FIG. 7A). Where the primers are hybridized to different target
nucleic acids, the elongation of the primers will generate
displaced strands (FIG. 7B). In this case, the two displaced
strands that result from primer elongation may hybridize and form a
new double stranded template nucleic acid (FIG. 7C).
[0187] Step two and three are repeated until the desired degree of
amplification is reached. The process is a dynamic process in that
primer hybridization to the target nucleic acid and elongation are
allowed to proceed continuously. One advantage of this invention is
that the amplification is performed continuously without the need
for temperature cycling or enzyme addition after initiation of the
reaction.
[0188] In an embodiment, steps two and three are repeated at least
5 times. Preferably, it is repeated at least 10 times. More
preferably, it is repeated at least 20 times, such as at least 30
times. Most preferably, the two steps are repeated at least 50
times. For multiple repetitions of the amplification step (e.g.,
step 2 and 3) a RPA of the invention is preferably started with a
primer to target nucleic acid ration of at least 100 to 1,
preferably at least 300 to 1, and most preferably at least 1000 to
1. That is, there are at least 100, 300 or 1000 copies of the
primer per copy of a target nucleic acid.
[0189] In an optional step, after a sufficient round of
amplification, additional components may be added to the reaction
after a period of time to enhance the overall amplification
efficiency. In one embodiment, the additional components may be one
or more of the following: recombinase agents, one or more primers,
polymerase, and one or more of the additional agents (discussed in
a separate section below).
[0190] In a preferred embodiment, a small fraction of a first RPA
reaction is used as a supply of template DNA for subsequent rounds
or RPA amplification. In this method, a first RPA amplification
reaction is performed on a target nucleic acid. After the first RPA
reaction, a small fraction of the total reaction is used as a
substitute of the target nucleic acid for a subsequent round of RPA
reaction. The fraction may be, for example, less than about 10% of
the first reaction. Preferably, the fraction may be less than about
5% of the first reaction. More preferably, the fraction may be less
than 2% of the first reaction. Most preferably, the fraction may be
less than 1% of the initial reaction.
[0191] The primer used in RPA is preferably DNA although PNA, and
RNA are also suitable for use as primers. It is noted that in fact,
in DNA replication, DNA polymerases elongate genomic DNA from RNA
primers.
[0192] Synthetic oligonucleotides may serve as DNA primer and can
be used as substrates for formation of nucleoprotein filaments with
RecA or its homologues. Sequences as short as 15 nucleotides are
capable of targeting double-stranded DNA (Hsieh et al., 1992). Such
oligonucleotides can be synthesized according to standard
phophoroamidate chemistry, or otherwise. Modified bases and/or
linker backbone chemistries may be desirable and functional in some
cases. Additionally oligonucleotides may be modified at their ends,
either 5' or 3', with groups that serve various purposes e.g.
fluorescent groups, quenchers, protecting (blocking) groups
(reversible or not), magnetic tags, proteins etc. In some cases
single-stranded oligonucleotides may be used for strand invasion,
in others only partly single stranded nucleic acids may be used,
the 5' stretch of sequence of an invading nucleic acid being
already hybridized to an oligonucleotide.
[0193] In another embodiment of the invention, the primers may
comprise a 5' region that is not homologous to the target nucleic
acid. It should be noted that the processes of the invention should
be functional even if the primers are not completely complementary
to the target nucleic acid. The primers may be noncomplementary by
having additional sequences at their 5' end. These additional
sequences may be, for example, the sequence for a restriction
endonuclease recognition site or the sequence that is complementary
to a sequencing primer. The restriction endonuclease recognition
site may be useful for subsequent cleavage of the amplified
sequence. The use of restriction endonuclease that cleaves nucleic
acid outside the restriction endonuclease recognition site is also
contemplated. The sequence that is complementary for a sequencing
primer may allow rapid DNA sequencing of the amplified product
using commercially available primers or commercially available
sequencing apparatus.
[0194] Formation of nucleoprotein filaments can be performed by
incubation of the primer (oligonucleotides) with RecA protein or
its homologues in the presence of ATP, and auxiliary proteins such
as RecO, RecR and RecF, or uvsY in the case of T4 proteins. When
incubated at 37.degree. C. in RecA buffer (20 mM Tris-HCl pH 7.5,
10 mM MgCl.sub.2, 2 mM ATP, 2 mM DTT and 100 .mu.g/ml Bovine Serum
Albumin), RecA will form helical filaments on ssDNA with 6
protomers per turn. The DNA is located within the interior of the
protein helix. In the presence of dsDNA, the RecA/ssDNA
nucleoprotein filament can scan DNA at rates of at least 10.sup.7
bp per hour. The mode of scanning is unclear but it is at a speed
(>10.sup.3 bp per second) that it may involve only the initial
few base pairs that can be easily accessed along one face of the
major groove. Successful binding may result in a transition to a
triple-helical intermediate, which is then followed by strand
invasion and displacement to form a D-loop. Such joint molecules
can be formed under similar condition to those described above for
formation of helical filaments, and hence in the presence of ssDNA,
the homologous dsDNA, RecA, ATP, auxiliary proteins and suitable
buffer and temperature conditions, joint molecules will form
spontaneously. If ATP is used the assembly is reversible and will
reach equilibrium, but RecA/ssDNA filaments can be stabilized, even
in the presence of SSB, by the auxiliary proteins RecO and RecR.
Alternatively the T4 uvsX protein may be stabilized in the presence
of uvsY protein. In the case of thermostable proteins the
temperature of incubation can be higher. If a renewable supply of
ATP is required a standard ATP regeneration system can be included
in the reaction.
[0195] DNA polymerases can use the free 3'-hydroxyl of the invading
strand to catalyze DNA synthesis by incorporation of new
nucleotides. A number of polymerases can use the 3'-hydroxyl of the
invading strand to catalyze synthesis and simultaneously displace
the other strand as synthesis occurs. For example E. coli
polymerase II or III can be used to extend invaded D-loops (Morel
et al., 1997). In addition, E. coli polymerase V normally used in
SOS-lesion-targeted mutations in E. coli can be used (Pham et al.,
2001). All of these polymerases can be rendered highly processive
through their interactions and co-operation with the .beta.-dimer
clamp, as well as single stranded DNA binding protein (SSB) and
other components. Other polymerases from prokaryotes, viruses, and
eukaryotes can also be used to extend the invading strand.
[0196] In another embodiment of the invention, the primer may be
partially double stranded, partially single stranded and with at
least one single stranded 3' overhang. In this embodiment, the
primer may comprise a invading strand and a non-invading strand as
shown in FIG. 8A. In this case, after the invading strand is
hybridized to the target DNA and elongated, it serves as a target
nucleic acid for a second primer as shown in FIG. 8B. The
elongation of the second primer would displace the noninvading
strand as shown in FIG. 8C. In this embodiment, as the target
nucleic acid is amplified, the non-invading strand of primer 1 is
displaced. If both primer one and primer two are partly double
stranded primers, then the non-invading strands of both primer one
and primer two will accumulate in solution as the target nucleic
acid is amplified.
[0197] In one embodiment of the invention, at least two of the
primers in a RPA reaction are partially double stranded and
partially single stranded each generated by the hybridization of an
invading strand and a non-invading oligonucleotide strand, which
possess sequences of sufficiently complementary that they form a
double stranded region. Preferably, the two oligonucleotide strands
are sufficiently complementary over the relevant region that they
can form a double stranded structure in RPA reaction
conditions.
[0198] In an embodiment of the invention, the primers, including
single-stranded and partially double-stranded primers, are labeled
with a detectable label. It should be noted that a fluorescence
quencher is also considered a detectable label. For example, the
fluorescence quencher may be contacted to a fluorescent dye and the
amount of quenching is detected. The detectable label should be
such that it does not interfere with an elongation reaction. Where
the primer is partially double stranded with an invading strand and
a non-invading strand, the detectable label should be attached in
such a way so it would not interfere with the elongation reaction
of the invading strand. The non-invading strand of a partially
double stranded primer is not elongated so there are no limitations
on the labeling of the non-invading strand with the sole exception
being that the label on the non-invading strand should not
interfere with the elongation reaction of the invading strand.
Labeled primers offer the advantage of a more rapid detection of
amplified product. In addition, the detection of unincorporated
label, that is, labeled oligonucleotides that have not been
extended, will allow the monitoring of the status of the
reaction.
[0199] Monitoring a RPA reaction may involve, for example, removing
a fraction of an RPA reaction, isolating the unincorporated
fraction, and detecting the unincorporated primer. Since the size
of an unincorporated primer may be less than 50 bp, less than 40
bp, less than 30 bp or less than 25 bp, and the size of the
amplified product may be greater than 1 Kb, greater than 2 Kb,
greater than 5 Kb, or greater than 10 Kb, there is a great size
difference between the incorporated and unincorporated primer. The
isolation of the unincorporated primer may be performed rapidly
using size exclusion chromatography such as, for example, a spin
column. If a primer is labeled, a monitor procedure comprising a
spin column and a measurement (e.g., fluorescence or radioactivity)
can be performed in less than one minute. Another alternative for
separating elongated primers from unelongated primers involve the
use of PAGE. For example, the elongated primer may be separated
from the unelongated primer by gel electrophoresis in less than 5
minutes. Yet another alternative for separating elongated primers
involves the use of immobilized oligonucleotides. For example
oligonucleotides homologous to sequences found uniquely within the
amplified DNA sequence can be used to capture nucleic acids
produced by primer elongation specifically. These capturing
oligonucleotides can be immobilized on a chip, or other substrate.
Capture of the elongated oligonucleotides by the capturing
oligonucleotides can be performed by RecA protein mediated methods,
or by traditional solution hybridizations if necessary.
[0200] In another embodiment of the invention, a double stranded
primer may be labeled such that the separation of the two strands
of the primer may be detected. As discussed above, after multiple
rounds of elongation, the invading strand and the noninvading
strands of a partially double stranded primer is separated. After
this separation, the non-invading strand does not participate in
the RPA reaction. This characteristic may be used to detect and
monitor a RPA reaction in a number of ways.
[0201] In this application, the detectable label may be a
fluorescent label or an enzyme and the label quencher (also
referred to as the label inhibitor) may be a fluorescence quencher
or an enzyme inhibitor. In these cases, the label is detected by
fluorescence or enzyme inhibition. The delectability of the label
would be the fluorescence if a fluorescent label is used or enzyme
activity if an enzyme is used.
[0202] In the first method, the invading strand may be labeled with
a label and the non-invading strand may be labeled with a
detectable label quencher. The label, in the proximity of the label
quencher (label inhibitor) on the partially double stranded primer
would not be highly detectable. After RPA, the invading strand
would be separated from the noninvading strand and thus, the label
and the label quencher would be separated. The separation would
cause the label to be more detectable. Thus, measuring the
increases in the amount of detectable label may monitor RPA
reactions.
[0203] The second method is similar to the first method except that
the invading strand is modified with a label quencher while the
noninvading strand is modified with a label. Then RPA is allowed to
proceed with the result (same as method 1) of the label being
separated from the label quencher. Thus, the overall delectability
of the label would increase.
[0204] The third method involves labeling the noninvading strand of
one double stranded primer with a label. In addition, the
noninvading strand of a second double stranded primer is labeled
with a label quencher. The two non-invading stands are designed to
be complementary to each other. In this configuration, the RPA
reaction is initially fluorescent. As the RPA reaction progresses,
the two noninvading strands are displaced into solution and they
hybridize to each other because they are designed to be
complementary. As they hybridize, the label and the label quencher
are brought into proximity to each other and the fluorescence of
the reaction is decreased. The progress of the RPA reaction may be
measured by monitoring the decrease in label detectability.
[0205] In a fourth method, the noninvading strands of a first and
second double stranded primers are labeled with a first label and a
second label. The two noninvading strands are also designed to be
complementary to each other. As in the third method, after RPA, the
two noninvading strands are hybridized to each other and the
proximity of the two labels will be a reflection of the progress of
the RPA reaction. The proximity of the two labels may be
determined, for example, by direct observation or by isolation of
the non-invading strands. As discussed above, isolation of primers
and other small nucleic acids can be accomplished by size exclusion
columns (including spin columns) or by gel electrophoresis.
[0206] In another embodiment of the invention, the non-invading
strand of one or both of the primers is homologous to a second
region of nucleic acid such that the primer can hybridize to and
primer DNA synthesis at the second region of nucleic acid. Using
this method, a second RPA reaction using the noninvading stand from
the primer of a first RPA may be started. The product of the second
RPA may be monitored to determine the progress of the first
RPA.
[0207] In yet another embodiment of the invention, the non-invading
strand is detected by a biosensor specific for the sequence of the
non-invading strand. For example, the biosensor may be a surface
with a nucleic acid sequence complementary to the non-invading
strand. The biosensor may monitor a characteristic that results
from the binding of the non-invading strand. The characteristic may
be a detectable label.
[0208] Suitable detectable labels for any of the methods of the
invention include enzymes, enzyme substrates, coenzymes, enzyme
inhibitors, fluorescent markers, chromophores, luminescent markers,
radioisotopes (including radionucleotides), and one member of a
binding pair. More specific examples include fluorescein,
phycobiliprotein, tetraethyl rhodamine, and beta-gal. Bind pairs
may include biotin/avidin, biotin/strepavidin, antigen/antibody,
ligand/receptor, and analogs and mutants of the binding pairs.
[0209] The recombinase agent of the invention may be RecA, uvsX,
RadA, RadB, Rad 51 or a functional analog or homologues of these
proteins. If desired, the recombinase may be a
temperature-sensitive (referred to herein as "ts") recombinase
agent. If a ts recombinase is used, the RPA reaction may be started
at one temperature (the permissive temperature) and terminated at
another temperature (the non permissive temperature). Combinations
of permissive temperatures may be, for example 25.degree.
C./30.degree. C., 30.degree. C./37.degree. C., 37.degree.
C./42.degree. C. and the like. In a preferred embodiment, the ts
protein is reversible. A reversible ts protein's activity is
restored when it is shifted from the nonpermissive temperature to
the permissive temperature.
[0210] In a preferred embodiment, the RPA is performed in the
presences of ATP, an ATP analog, or another nucleoside
triphosphate. The ATP analog may be, for example, ATP.gamma.S,
dATP, ddATP, or another nucleoside triphosphate analog such as
UTP.
[0211] Other useful reagents that may be added to an RPA reaction
include nucleotide triphosphates (i.e., dNTPs such as dATP, dTTP,
dCTP, dGTP and derivatives and analogs thereof) and a DNA
polymerase. Other useful reagents useful for leading/lagging RPA
include NTPs (ATP, GTP, CTP, UTP and derivatives and analogs
thereof). One advantage of the RPA reaction is that there is no
limit on the type of polymerase used. For example, both eukaryotic
and prokaryotic polymerases can be used. Prokaryotic polymerase
include, at least, E. coli pol I, E. coli pol II, E. coli pol III,
E. coli pol IV and E. coli polV. Eukaryotic polymerases include,
for example, multiprotein polymerase complexes selected from the
group consisting of pol-.alpha., pol-.beta., pol-.delta., and
pol-.epsilon..
[0212] In another embodiment of the invention, the RPA process is
performed in the presence of an accessory component to improve
polymerase processivity or fidelity. Both eukaryotic and
prokaryotic accessory components may be used. Preferably, the
accessory component is an accessory protein is from E. coli. Useful
accessory proteins include single-strand binding protein, helicase,
topoisomerase, and resolvase. Other useful accessory proteins
include a sliding clamp selected from the group consisting of an E.
coli .beta.-dimer sliding clamp, a eukaryotic PCNA sliding clamp
and a T4 sliding clamp gp45. Other accessory components include a
DNA Polymerase III holoenzyme complex consisting of .beta.-Clamp,
DnaX Clamp Loader, and the Polymerase Core Complex. Still other
accessory components include RuvA, RuvB, RuvC, and RecG. The
properties endowed by the use of additional components will likely
enable the amplification of large DNAs not previously successfully
targeted by current methods such as PCR.
[0213] In another embodiment, the RPA is performed in the presence
of agents used to stabilize recombinase/ssDNA nucleoprotein
filaments. For example, the agent may be RecR, RecO, RecF, or a
combination of these proteins, or T4 uvsY protein if T4 components
are used. Molecular crowding agents may also be employed to
modulate biochemical interactions in a favourable manner. Other
useful agents include PriA, PriB, DnaT, DnaB, DnaC, and DnaG.
[0214] One benefit of the present invention is that the RPA
reaction may be performed at reduced temperatures compared to a PCR
reaction. For example, the RPA process may be performed between
20.degree. C. and 50.degree. C. Preferably, the RPA process is
performed at less than 45.degree. C. More preferably, the RPA
process may be performed at less than 40.degree. C. Even more
preferably, the RPA process may be performed at less than
35.degree. C. Most preferably, the RPA process may be performed at
less than 30.degree. C. One of the reasons that the RPA process can
be performed at these reduced temperatures is because RPA may be
performed without temperature induced melting of the template
nucleic acid. Further, unlike PCR, absolute temperature control is
not required and the temperature can fluctuate without adversely
affecting RPA. For example, the amount of fluctuation may be
anywhere within the temperatures specified above. The temperature
necessary for melting of double stranded DNA also contribute to
premature enzyme inactivation, a disadvantage absent in the methods
of this invention.
[0215] RPA may be performed to test for the presences or absences
of a genotype. The genotype tested may be associated with a disease
or a predisposition to a disease. Alternatively, the genotype may
be associated with a normal phenotype or a phenotype that confers
special resistance to a disease. The genotype as disclosed above
may be any standard genetic variant such as a point mutation, a
deletion, an insertion, an inversion, a frameshift mutation, a
crossover event, or the presence or absences of multiple copies of
a genetic sequence (e.g., the presences of minichromosomes).
[0216] One method of detecting a genotype is to detect the distance
between a primer pair in an RPA reaction. The distance between a
primer pair is reflected by the size of the amplified sequence. In
that method, the two primers are selected such that it spans a
target region such as, for example, a gene. Then RPA is performed
using the primer pair and the RPA product is analyzed. The analysis
may involve determining the size or sequence of the amplified
product. Methods of determining the size of a DNA sequence,
including at least techniques such as agarose gels, PAGE gels, mass
spectroscopy, pulsed field gels, gene chips, sucrose sedimentation
and the like are known. There are many DNA sequencing methods and
their variants, such as the Sanger sequencing using dideoxy
termination and denaturing gel electrophoresis (Sanger, F.,
Nichlen, S. & Coulson, A. R. Proc. Natl. Acad. Sci. U.S.A. 75,
5463-5467 (1977)), Maxam-Gilber sequencing using chemical cleavage
and denaturing gel electrophoresis (Maxam, A. M. & Gilbert, W.
Proc Natl Acad Sci USA 74, 560-564 (1977)), pyrosequencing
detection pyrophosphate (PPi) released during the DNA polymerase
reaction (Ronaghi, M., Uhlen, M. & Nyren, P. Science 281, 363,
365 (1998)), and sequencing by hybridization (SBH) using
oligonucleotides (Lysov, I., Florent'ev, V. L., Khorlin, A. A.,
Khrapko, K. R. & Shik, V. V. Dokl Akad Nauk SSSR 303, 1508-1511
(1988); Bains W. & Smith G. C. J. Theor. Biol 135,
303-307(1988); Drnanac, R., Labat, I., Brukner, I. &
Crkvenjakov, R. Genomics 4, 114-128 (1989); Khrapko, K. R., Lysov,
Y., Khorlyn, A. A., Shick, V. V., Florentiev, V. L. &
Mirzabekov, A. D. FEBS Lett 256. 118-122 (1989); Pevzner P. A. J
Biomol Struct Dyn 7, 63-73 (1989); Southern, E. M., Maskos, U.
& Elder, J. K. Genomics 13, 1008-1017 (1992)).
[0217] One method of detecting a genotype is to use primers that
are specific for a particular genotype. For example, a primer may
be designed to efficiently amplified one genotype but inefficiently
or not amplify another genotype at all. In an embodiment, the
primer may comprise a 3' sequence that is complementary to one
genotype (e.g., a genetic disease genotype) but not to another
genotype (e.g., a normal genotype).
[0218] The genotype to be determined may be indicative of a disease
such as, for example, the presence of an activated oncogene; the
presence of the gene for Huntington's disease or the absence of an
anti-oncogene.
[0219] The 3' bases of the primers are especially important in
determining the specificity and efficiency of an RPA reaction. A
primer may be designed so that the 3' base is complementary to one
genotype and not complementary to another genotype. This will allow
efficient RPA of one genotype and an inefficient RPA (if any) of
the second genotype. It is noted that the method is effective if
only one primer of the primer pair can differentiate between
different phenotypes (by having different efficiencies of
amplification). In a preferred embodiment, both primers in an RPA
reaction can differentiate between different genotypes. In this
above example, the primers are complementary to one genotype and
are not complementary to a second genotype by one base at its 3'
end. In a preferred embodiment, the primer is not complementary to
the second genotype by at least one base at its 3' end. Preferably,
the primer is not complementary to the second genotype by at least
2, 3, 4, 5, 6, 7, 8, 9, or 10 bases at its 3' end. Most preferably,
the primer is completely non-complementary or cannot hybridize to
the second genotype while it can hybridize to the first
genotype.
[0220] In some of the methods discussed, the presence or absence of
an amplified product provides the indication of the presence or
absence of a genotype. In these cases, the RPA reaction may be
monitored by the methods discussed throughout the
specification.
[0221] In a preferred embodiment, an RPA reaction for genotyping
will amplify a sequence regardless of the genotype of the patient.
However, the genotype of a patient will alter a characteristic of
the amplified sequence. For example, the amplified sequence may be
a different size, or sequence for one genotype than for another
genotype. In that way, the RPA reaction will contain an internal
control to indicate that the amplification reaction was performed
successfully. Naturally, a method of RPA, which includes one or
more additional pairs of primers as controls for the performance of
the RPA reaction, is also envisioned.
[0222] In another embodiment, an RPA reaction may be used to
determine the presence or absences of a nucleic acid molecule. The
nucleic acid molecule may be from any organism. For example, the
microbial composition of a sample may be determined by using a
battery of RPA reactions directed to the nucleic acid of different
microbes. RPA is especially useful for the detection of microbes.
In one embodiment, the pathogens are selected from viruses,
bacteria, parasites, and fungi. In further embodiments, the
pathogens are viruses selected from influenza, rubella,
varicella-zoster, hepatitis A, hepatitis B, other hepatitis
viruses, herpes simplex, polio, smallpox, human immunodeficiency
virus, vaccinia, rabies, Epstein Barr, retroviruses, and
rhinoviruses. In another embodiment, the pathogens are bacteria
selected from Escherichia coli, Mycobacterium tuberculosis,
Salmonella, Chlamydia and Streptococcus. In yet a further
embodiment, the pathogens are parasites selected from Plasmodium,
Trypanosoma, Toxoplasma gondii, and Onchocerca. However, it is not
intended that the present invention be limited to the specific
genera and/or species listed above.
[0223] Here we present data that help to define reaction conditions
that permit efficient amplification of DNA by RPA.
[0224] Single-Stranded DNA Binding Protein
[0225] Single-stranded DNA binding proteins are required for RPA
reactions. These proteins bind to single-stranded DNA, melt
secondary structure, facilitate outgoing strand displacement, and
suppress branch migration. In RPA their activity is required during
several distinct phases. We have investigated the activities of two
single-stranded DNA binding proteins, E. coli SSB and
bacteriophages T4 gp32. The T4 gp32 has proven to be most useful in
our hands. Furthermore we have generated a number of distinct forms
of this protein by including hexahistidine (His) peptide tags at
the N or C termini, as well as investigating several previously
described point mutations. Activities of gp32 variants are depicted
schematically in FIG. 21.
[0226] Variant Forms of Gp32
[0227] T4 gp32 protein possesses several features that are of
potential utility to RPA reactions. Foremost gp32 has a relatively
small DNA binding site (8-10 nucleotides), displays similar binding
properties under a wide range of salt concentrations, and displays
high (unlimited) cooperativity between monomers (Scheerhagen et
al., J Biomol Struct Dyn. 1986 April; 3(5):887-98; Kuil et al.,
Biophys Chem. 1988 December; 32(2-3):211-27). In contrast, E. coli
SSB protein has several distinct DNA binding modes that vary with
salt concentration all of which possess relatively large DNA
binding sites (32, 56 or 65 nucleotides) (Ferrari et al., J Mol
Biol. 1994 Feb. 11; 236(1):106-23) and there is complex
cooperativity behaviour (Lohman and Ferrari, Annu Rev Biochem.
1994; 63:527-70). Because the initial size of the outgoing strand
is small when synthetic oligonucleotides are employed, we reasoned
that the properties of the gp32 protein would be optimal for RPA.
We expressed and purified gp32 possessing an N-terminal His tag
(gp32(N)). In initial experiments we found gp32(N) to function at
least as well as the E. coli SSB protein, even when combined in a
heterologous system with the E. coli recA recombinase (FIG. 12).
This was surprising result as gp32 is reported to display extremely
high cooperativity between monomeric subunits and it seemed
unlikely that recA would be able to compete effectively for
oligonucleotide binding in its presence. When we compared the
behaviour of gp32(N) to untagged gp32, however, we discovered that
the two proteins did not behave equivalently. As the N-terminal His
tag is directly adjacent to the `B` domain of the gp32 protein,
which is required for cooperativity between monomers, we reasoned
that gp32(N) must have attenuated cooperativity. We therefore
generated a gp32 protein possessing a C-terminal His tag (gp32(C)),
as well as point mutant forms of gp32(C) in accordance with
previously published mutants having a lysine to alanine change at
position 3 (K3 to A), or an arginine either glutamine (R4 to Q) or
threonine at position 4 (R4 to T) (FIG. 21). These three point
mutant proteins exhibit progressively less cooperativity (FIG. 22)
(Villemain, et al. J Biol Chem. 2000 Oct. 6; 275(40):31496-504). We
tested the capacity of these proteins at two different
concentrations to support invasion/extension reactions on a
linearized template in combination with the bacteriophage T4 uvsX
protein and the Klenow fragment of E. coli DNA polymerase I (FIG.
22). Firstly we note that gp32(C) yields much less product than
other gp32 variants at either concentration (FIG. 22 compare with
gp32(N)) and that the products are almost exclusively full-length,
in contrast to gp32(N). When we compare these results to those
obtained with the point mutant allelic series we note that the
gp32(N) protein most closely resembles the profile obtained with
gp32(C) R4 to T, which has been reported to be significantly
attenuated in cooperativity. This suggests that the N terminal His
tag of gp32(N) interferes with the function of the B domain in a
manner similar to the point mutations.
[0228] There are several other relevant observations. Firstly, the
proteins believed to demonstrate the highest cooperativity, i.e.
gp32(C)>gp32(C)K3A seem to produce less product. Secondly, for
gp32(C) and gp32(C)K3A, more amplified product is generated when
less single-stranded binding protein is used, in contrast to
gp32(N) and gp32(C)R4T which generate more product in run-on assays
when more proteins is used. Taken together these observations
suggest an explanation. If the gp32 species is progressively more
cooperative then it will form progressively more stable filaments
on the oligonucleotides and make it progressively more difficult
for recombinase to load. Consequently when the most cooperative
gp32 species are employed there is a significant limitation on the
availability of recombinase-loaded filaments. If the concentration
of gp32 is raised, recombinase loading is further suppressed by
gp32 single-stranded DNA binding activity. Consistent with this, as
the cooperativity of the gp32 is progressively decreased the amount
of amplified product increases. This is consistent with a
substantial increase in recombinase-coated filament formation. As
relatively un-cooperative gp32 monomers are less likely to coat
oligonucleotides and permit the recombinase, uvsX, to seed instead.
We note that in the case of gp32(N) and gp32(C)R4T, more product is
generated with increased gp32(N) or gp32(C)R4T in DNA run-on
assays. This contrasts results using the more cooperative gp32
variants. One possibility is that during and following the strand
exchange reaction gp32 is required to stabilise the recombination
and synthesis intermediates. This may happen because gp32
cooperativity is so attenuated that it may no longer participate in
those aspects of the reaction, or because the recombinase
out-titrates gp32 and halts the reaction. The contrasting results
of amplification versus run-on assays suggest that the optimal
amount of cooperativity may be less than that possessed by the most
cooperative gp32 variants. Thus for RPA mutant gp32 variants, with
attenuated cooperativity, may be the most appropriate as these will
permit higher levels of recombinase loading. Attenuation of gp32
cooperativity must, however, be balanced against noise generated by
mispriming events as may be encountered in environments with less
gp32 activity.
[0229] Finally, there is a substantial difference in the quantity
of product generated in RPA using 7.5 .mu.g versus 15 .mu.g of
gp32(C)K3A. The 7.5 .mu.g level more closely resembles results with
more weakly cooperative mutants. Most likely in some cases during
the course of the reaction, which was held at 37.degree. C. for 2
hours, the amount of single-stranded run-on product increases to
the point that gp32 no longer effectively saturates single-stranded
DNA in the reaction. In such a situation two things would occur.
First there would be a rapid increase in the number of
homology-searching filaments leading to a significant rate increase
in invasion. Then the lack of gp32 to stabilise outgoing strands
would lead to many partial extensions by Klenow not being
stabilised, and possibly a greater rate of bubble migration
separating the new strand from the template. Hence many more
synthesised strands would not achieve full length.
[0230] A Model of Gp32 Function in Multiple Invasion/Extension
Reactions
[0231] We had earlier noted that in a heterologous system involving
recA and gp32(N), polyethylene glycol was required to permit more
than one cycle of invasion and extension from a given template.
Here we describe a model to rationalise these observations and
explain why targeting DNA ends multiple times requires specific
types of single-stranded DNA binding protein. It is clear gp32
activity is required to stabilise the outgoing strand during the
strand exchange process. If this does not occur then as the
recombinase disassembles the outgoing strand re-hybridises with its
complementary strand and displaces the invading oligonucleotide.
Following strand exchange the outgoing strand can exist in one of
two states, which likely place different demands on the
single-stranded DNA binding protein. These two states arise as a
consequence of the relationship between the single-stranded
searching DNA and the duplex target DNA. If the recombination event
can extend to an end of a linear duplex DNA, and it is possible for
the outgoing strand to be completely removed from its complement at
one end, then the outgoing strand is un-constrained at one end.
Under this un-constrained condition the new duplex involving the
incoming DNA strand and its complement is able to rewind to form B
form DNA. This is necessary because during the pairing reaction the
target DNAs are under wound by the activity of the invading
recombinase filament. Un-constrained outgoing strands can readily
bind single-stranded DNA binding proteins, which will prevent
branch migration from occurring and allowing the invading strand to
be removed.
[0232] Alternatively if the recombination event does not extend to
the end of the target duplex, as would occur if an embedded
sequence were targeted, then the outgoing strand is topologically
constrained because it is physically joined to the complementary
strand upstream and downstream of the recombining region. Such
intermediates are highly unstable because the newly formed duplex
cannot rewind without making the outgoing strand also wind around
it. And since the outgoing strand is constrained at both ends this
is energetically unstable, and the new hybrid is placed under
considerable strain. Consequently a far higher demand is placed on
the activity of single-stranded DNA binding proteins in this
context because there is substantial drive to eject the incoming
strand and rewind the original duplex (FIG. 6).
[0233] In our efforts to establish effective conditions for
repeated strand invasion and extension of linear DNA targets we
have noted that only oligonucleotides targeted to the ends of
linear sequences are readily extended to full template length, at
least when using a distributive polymerase such as the Klenow
fragment of E. Coli DNA polymerase I. We have found that under
certain conditions, for example when using recA with gp32(N) or E.
coli SSB, only one round of invasion and extension can readily
occur on each target template. These observations may be understood
by considering the outcome of invasion events occurring under
several different circumstances leading to either fully released
outgoing strands (plectonemic joints) or topologically constrained
intermediates (paranemic joints). Finally, we have identified
certain other conditions that are permissive for multiple rounds of
invasion and extension from a single template, a situation ideally
suited to the RPA reaction. We propose a model based on our own
data to consolidate these observations, and forms a framework
around which optimisation of the RPA reaction can be designed. This
model takes into account the behaviour of gp32 protein under
different reaction environments and justifies gp32 behaviours with
the effects of other reaction components (FIG. 29).
[0234] The model schematically describes the nature and outcome of
recombination events between the end of a target duplex and an
invading oligonucleotide that initially possesses a 5' overhang
relative to the target. This situation typifies the experimental
circumstance we have studied. Despite this starting situation all
but the initial cycle involves the invading oligonucleotides having
their 5' extreme flush to the 5' extreme of the target duplex DNA.
This is the case because the target DNA complementary strand
possesses a 3'-end that can be extended during the first round to
copy the overhang region of the invading primer, which we term
backfire synthesis. Experiments performed with gp32(N) protein (in
the absence of PEG), suggest that once the target is flush at the
5'-end to the oligonucleotide i.e. after the first round, then
subsequent invasion/extension cycles are very inefficient or do not
occur at all. Early experiments showed only a roughly equimolar
quantity of run-on product to start template. How does this
occur?
[0235] We believe that this block to re-invasion/extension arises
because invading oligonucleotides are rarely fully coated by
recombinase. Thus complete exchange to the 5' flush end of a target
will also occur very rarely and corresponding outgoing strands will
remain in a constrained state (FIG. 13). The exchange is initially
incomplete and the intermediate is unstable due to an inability to
allow the new duplex to relax into a B-DNA helix in the presence of
the topologically constrained outgoing strand. Such unstable
intermediates will have a tendency to rewind the original duplex
and eject the invading strand as the recombinase disassembles.
[0236] We found, however, that if a crowding agent such as
polyethylene glycol is included in the presence of gp32(N),
subsequent invasion/extension occurs. One possibility is that under
these conditions unstable intermediates are temporarily stabilised
by gp32(N), such that elongation can occur. It is possible that
polyethylene glycol acts to partly rescue the poor cooperativity of
the compromised gp32(N) allowing it to stabilise these otherwise
unstable intermediates. This conclusion is supported both by our
data showing that N-terminally his-tagged gp32 is cooperatively
attenuated, and the known capacity of crowding agents to enhance
the effectiveness of interactions between molecules, thus partly
making up for the poorer interaction between monomers. We initially
believed that this experiment might be best explained by suggesting
that recA filaments were more abundant in the presence of PEG, as
previously reported elsewhere (Lavery P E, Kowalczykowski S C. J
Biol Chem. 1992 May 5; 267(13):9307-14), however we feel that this
does not adequately account for the observed switch from a dead-end
only one round of invasion to productive multiple rounds of
invasion/extension.
[0237] The difference between PEG stimulation of full-length
multiple run-ons at end-directed targets versus the far poorer
activity at truly embedded targets (FIG. 15), suggests that the
temporary stabilisation of an intermediate, as suggested above, is
insufficient alone to generate substantial elongation. If this were
the case for run-on assays at embedded targets it should work as
well in reinvasion at end-directed targets, but this is not the
case (FIG. 15). Alternatively the difference between efficiencies
may be explained by supposing that gp32 temporarily stabilises an
intermediate in which the 5' extent of the incoming oligonucleotide
is not paired but free, and possibly even coated with gp32
dependent on the length. Provided that this unexchanged segment is
not coated with gp32, or that the gp32 can readily dissociate, as
would be the case without cooperativity, then the 5'-most portion
of the oligonucleotide could become paired via rapid branch
migration (FIG. 29, scenario 1). In fact there is a difference
between truly embedded sequences and re-invasion at DNA ends (FIG.
15). For embedded targets, secondary branch migration leading to
unconstrained release of the outgoing strand can never occur
because the ends are too distant.
[0238] We would therefore conclude that the small DNA binding size,
and high cooperativity between subunits permits gp32 proteins
permits multiple invasion and extension reactions by stabilising
the constrained paranemic joint structures for a sufficient time.
There are various possible outcomes (FIG. 29). Either the last
small section of oligonucleotide at the 5' end that was not
initially exchanged becomes hybridised through a branch migration
event, or disassembly of gp32 on the outgoing strand permits the
invading/extending oligonucleotide to be lost through branch
migration. Alternatively, loading of recombinase onto the outgoing
strand and re-invasion ejects the incoming strand (bubble
migration). If hybridisation via branch migration occurs then an
unconstrained structure arises that can be readily stabilised and
extended. If either gp32 disassembly or bubble migration occur then
there is a substantial risk that the new extending strand will be
lost before it is fully extended. If a single stranded DNA binding
protein with a large binding site, like E. coli SSB, or one with
poor cooperativity, like. gp32(N), is used in the absence of PEG,
then no temporary stabilisation occurs and the invading
oligonucleotide is ejected without being extended.
[0239] Consequently based on this model, and the earlier
conclusions about the frequency of recombinase-loaded filaments in
the presence of various g32 forms, we conclude that a balance
between the activities of recombinases and gp32 molecules must be
struck that best meets the various requirements of the
amplification reactions. We can summarise the needs and effects of
single-stranded DNA binding proteins in different phases of the RPA
reaction as follows.
[0240] Phase 1
[0241] Single-stranded DNA binding proteins help to prepare
single-stranded DNAs for recombinase loading by melting secondary
structure so that recombinase loading can occur consistently. Thus
the melting activity of single-stranded DNA binding proteins is
desirable and also plays a part in silencing non-specific annealing
of primers. Despite this, however, excessive levels of protein and
excessive cooperativity can significantly reduce number of
recombinase-loaded filaments available for invasion.
[0242] Phase 2
[0243] Single-stranded DNA binding proteins collect the outgoing
strand and prevent spontaneous ejection of the incoming
oligonucleotide as the recombinase disassembles. The instability of
paranemic joints means that invasions occurring on embedded
sequences, including the case that oligonucleotide ends are flush
to the duplex ends (as would occur during most cycles of an
amplification), means that significant cooperative activity may be
required for many situations. In general this phase of the reaction
will benefit from a surplus of highly cooperative single-stranded
DNA binding proteins.
[0244] Phase 3
[0245] Single-stranded DNA binding proteins bind to the displaced
strand that forms during DNA synthesis. As in phase 2 this
displaced strand may be unconstrained, or topologically
constrained, and these two circumstances place different demands on
the single-stranded DNA binding protein.
[0246] Phase 4
[0247] In certain configuration of the RPA reaction the displaced
single-stranded outgoing strand must hybridise to a partner
oligonucleotide to permit subsequent generation of a new duplex.
Many single-stranded DNA binding proteins prevent complementary
strands from annealing, however T4 gp32 protein aids re-annealing
of complementary DNA. Therefore bacteriophage T4 gp32 protein is an
ideal protein for this phase.
[0248] Oligonucleotide Length:
[0249] There is little published evidence to support how
effectively recA, or other recombinases, might be used with
relatively the short synthetic oligonucleotide primers used for
RPA. It is also unclear whether a stable reaction environment can
be generated in which such short DNA oligonucleotides remain
actively loaded with recombinase. Most studies performed with recA
utilise comparatively large substrates such as single-stranded and
double-stranded forms of the bacteriophage M13 genome (many
thousands of residues) as donor and acceptor DNAs. Experimental
assays for recombinase activity often consist of the formation of
intermediate, or completed, recombination events measured by
electrophoretic migration or electron microscopy (Harris L D,
Griffith J. J Biol Chem. 1987 Jul. 5; 262(19):9285-92). A few
experiments have been described using short oligonucleotides.
Sequences as short as 15 nucleotides have been shown to assemble
functional homology-searching complexes with recA in the presence
of the non-hydrolysable cofactor analogue ATP-.gamma.-S, but
investigations combining short oligonucleotides and ATP are
ambiguous (Hsieh P, Camerini-Otero C S, Camerini-Otero R D. Proc
Natl Acad Sci USA. 1992 Jul. 15; 89(14):6492-6). The
homology-searching function of recombinases is not necessarily
sufficient to complete strand exchange and to release from the
invasion complex to allow access by other DNA metabolising proteins
such as polymerases. Indeed, studies have shown that recA shows
transitions between low ATP hydrolysis rate (a useful indicator of
combined DNA binding activity and functional recombinase activity)
and high hydrolysis rate at oligonucleotide lengths substantially
longer than the 15 nucleotides required for searching. Furthermore
the type of nucleotide cofactor seems to influence on the length at
which such hydrolysis transitions occur (Katz F S, Bryant F R.
Biochemistry. 2001 Sep. 18; 40(37):11082-9). The bacteriophage T4
recombinase uvsX has also been shown to exhibit variable properties
on short oligonucleotides, and shows some sensitivity to the base
composition (Formosa T, Alberts B M. J Biol Chem. 1986 May 5;
261(13):6107-18). Despite this, both uvsX and recA are capable of
performing recombination events with single-stranded substrates of
roughly 30 base pairs or more in the presence of hydrolysable
nucleotides like ATP, suggesting that the use of such short
synthetic targeting oligonucleotides is reasonable (Salinas F,
Jiang H, Kodadek T. J Biol Chem. 1995 Mar. 10; 270(10):5181-6;
Formosa T, Alberts B M. J Biol Chem. 1986 May 5; 261(13):
6107-18).
[0250] An oligonucleotide bearing 33 residues of homology with the
end of a linearized DNA target can form a pairing intermediate
capable of elongation by the Klenow fragment of E. coli (FIG. 9).
This experiment and others demonstrate that homology lengths as
short as 33 nucleotides are sufficient to direct recombinase/ssDNA
filaments to appropriate targets in the presence of ATP and to
permit complete strand exchange. Similar results are found when
using the bacteriophage T4 uvsX protein.
[0251] In addition to a requirement for a minimal oligonucleotide
length there may be a progressive loss of invasion/extension
efficiency if the oligonucleotide is extended significantly beyond
the minimal length required for recombination, at least when
distributive polymerases are used. One possibility lies in the
nature of recombinase/ssDNA filaments. Filaments coated with
recombinases have varying 5' limits to their coating, as
recombinases seed randomly and then extend the filament in a 5'-3'
direction, there will be a distribution of 5' extents of coating.
If less than roughly 25-30 nucleotides are coated then little
recombination can occur because there is insufficient nucleoprotein
filament for strand exchange. If more than this is coated it is
potentially beneficial from the point of view of recombination, but
if greater than 10-20 residues is added beyond the minimal length
required for exchange there is a possibility that progressively
more active filaments will posses recombinase of a sufficient
length of DNA to permit exchange, but retain sufficient 5' uncoated
DNA for gp32 to bind, which through cooperative binding of the 5'
extreme could inhibit the branch migration phase and prevent the
outgoing strand from being un-constrained. Consistent with this
notion, we note that stimulation of multiple invasion events was
less apparent with the oligonucleotide the longer oligonucleotide
primer Tester1 bio compared to Tester3 bio (FIG. 15). The only
difference between these oligonucleotides is that the first has 25
additional overhanging nucleotides beyond the initial 33 residues
of homology, while the second has only 15 additional residues.
Regardless of the explanation this experimental observation argues
that an optimal maximal length may exist.
[0252] There are other reasons to suspect shorter oligonucleotides
will be best for efficient RPA. At the relatively low temperatures
used in RPA reactions there is a substantial increase in stable
secondary structures of oligonucleotides as well as a greater
probability of inappropriate hybridisation between primer pairs.
Despite an overall excess of single-stranded DNA binding proteins,
the dynamic nature of the reaction suggested by the instability of
nucleoprotein filaments formed with recombinases in the presence of
ATP means that there is likely to be a constant cycling of proteins
on and off oligonucleotides, and a steady-state concentration of
uncoated, unprotected, oligonucleotides. Consequently the use of
short oligonucleotides should reduce the likelihood of undesirable
intra- and intermolecular interactions.
[0253] Our data indicate that optimal length of oligonucleotide lay
between 30 nucleotides and 50 nucleotides, and that progressively
larger oligonucleotides can decrease the rate of
invasion/extension. It may, however, be desirable to extend the
length of the oligonucleotide to accommodate a duplex region in the
3' or 5' region of the searching oligonucleotide. Thus, in one
aspect of the invention, the preferred primer length is between
about 30 to about 50 bases. Examples of primers sizes that would
fit at least one of these criteria includes primers of between 30
to 45 bases, between 30 to 40 bases, between 30 to 35 bases,
between 35 to 40 bases, between 40 to 45 bases, and between 45 to
50 bases. It may be possible, however, to identify a recombinase
and/or single-stranded binding protein with an optimum primer
length of less than 30 bases.
[0254] Oligonucleotide Composition, Sequence and
Single-Stranded/Duplex Character:
[0255] 1) Composition and Sequence:
[0256] Software to design oligonucleotides for use in vitro DNA
synthesis reactions is well established, particularly for use in
PCR. The considerations for the RPA method are similar and include
the optimisation of the melting temperature of the oligonucleotide,
avoidance of hairpin formation within an oligonucleotide and
selection against complementarity with other oligonucleotides
present in a given reaction. As RPA is performed at relatively low
temperatures such considerations are potentially more important. We
have observed the accumulation of extended primer products in RPA
reactions, which are apparently template-independent and dependent
on the combination of primers used. The sizes of the aberrant
products generated suggest they are primer dimers, or the
consequence of self-priming of a single oligonucleotide. These
undesirable primer artifacts are well known for other methods such
as PCR. It is therefore important to design oligonucleotide primer
pairs to avoid undesirable side reactions. We have observed that
oligonucleotides capable of forming hairpins can erroneously
self-prime in an RPA reaction.
[0257] Besides optimising oligonucleotide sequence design there are
additional approaches to reduce or eliminate primer dimer
formation. We have observed that reaction noise can be
significantly reduced by utilising polymerases lacking 3'-5'
exonuclease activity. This suggests mispriming may result from
oligonucleotides that have been shortened by the 3'-5' exonuclease
activity of polymerases. Consequently 3'-5' exonuclease editing
activity, pyrophosphorylysis, or any other similar editing activity
can be a source of noise. In addition to using polymerases lacking
exonuclease activity and the removal of pyrophosphate with
pyrophosphatase, use of synthetic oligonucleotides with a
non-hydrolysable backbone at the ultimate and/or penultimate link
may be beneficial to reduce reaction noise. Alternative backbones
could be selected from the considerable range of chemistries
available such as phosphorothiorate, morpholino, locked nucleic
acid, or peptide nucleic acid.
[0258] 2) Single-Stranded/Duplex Character:
[0259] Deterring aberrant extension of oligonucleotide 3' ends may
also be achieved by designing, and including, short competitor
oligonucleotides that can efficiently compete for the formation of
hybrids with the 3' region of the targeting oligonucleotides. Such
an approach could be configured in various ways.
[0260] 1) A short independent oligonucleotide comprising a perfect
complement to the most 3' residues of the targeting oligonucleotide
could be employed. This oligonucleotide would be sufficiently long
that at the reaction temperature it would be likely to form a
hybrid with the targeting oligonucleotide moderately efficiently.
This might be between 6 and 15 residues in length. The short
oligonucleotide will be non-extendable by having a blocking group
at its 3' terminus, such as a dideoxy sugar, or other 3' blocking
group. This oligonucleotide also may require a non-phosphate
linkage at the ultimate and/or penultimate backbone link to deter
removal of bases in the 3'-5' direction by editing activities.
Although a large proportion of non protein-coated targeting
oligonucleotides may form duplexes with this short oligonucleotide
this should not significantly decrease the rate and efficiency of
the RPA reaction. Firstly, because at the low RPA reaction
temperature there is likely to be an equilibrium between hybridised
and unhybridised oligonucleotides there will always be a pool of
free melted targeting oligonucleotides available. As the
oligonucleotide is a better competitor than other random sequences
in the reaction, it will be favoured against other transient
interactions. Secondly, single-stranded DNA binding proteins such
as recA, uvsX, gp32, and E. coli SSB, tend to melt duplex DNA and
thus even if hybrids are relatively stable at the reaction
temperature when no proteins are bound, when they bind to the
single-stranded part of the oligonucleotide and extend
cooperatively to the region of duplex they are likely to enhance
its melting, thus the duplex state will tend only to exist on naked
oligonucleotides. Finally, recombinases have the capacity to extend
strand exchange initiated between a single-stranded DNA region and
duplex target into regions in which both DNAs are duplex. This
appears to be an ATP-dependant branch migration activity. Taken
together these considerations suggest that the short duplex region
should not significantly reduce the rate of the RPA reaction, but
instead act to suppress the formation of primer dimer or other
artifacts generated from non protein-coated oligonucleotides by
being a better competitor for binding to the 3' region of the
targeting primer than other oligonucleotide sequences available in
the reaction. If exonuclease deficient polymerases are used, it may
be optimal to design this oligonucleotide to have its 5' most base
pairing to the penultimate, rather than ultimate, 3' nucleotide as
many polymerases tend to add an additional base to a perfectly
blunt end.
[0261] 2) In a second approach, the targeting oligonucleotide
possesses a 5' overhang not present in the initial target DNA, and
this overhang is the precise reverse complement to the sequence to
the 3' end of the same targeting oligonucleotide, perhaps with the
most 3' base only unpaired (FIG. 35 part D). The length of this
complementary oligonucleotide should be relatively short, but long
enough to be a far better competitor than other oligonucleotide
sequences present in the reaction. For example between 6 and 10
nucleotides might be optimal. As described for the first approach
this arrangement is likely to lead to any uncoated oligonucleotides
forming hairpin structures to themselves far more efficiently than
to any other sequences. As the design will place the 3' base, or
penultimate 3' base, of the oligonucleotide in a perfect
base-pairing environment, but at the 5' end of the targeting
oligonucleotide, it cannot be extended, apart from the addition of
the single residue often catalysed by many polymerases if the end
is blunt. In this context it may be fine to leave the editing
activity of polymerases intact. Such hairpin forming
oligonucleotides may suppress erroneous activity of naked
oligonucleotides without deterring the activity of protein-loaded
filaments.
[0262] There are however some important considerations to taking
this approach. Firstly, if the recombinase loading is initiated
directly on the partly duplex naked oligonucleotide without initial
melting of the duplex section, recombinase may not extend as close
to the 5' end of the targeting oligonucleotide as might be optimal.
Secondly, as the amplification reaction continues beyond the first
round there will be active displacement of products generated from
previous rounds of synthesis and if a complete displacement occurs
then the very 3' end of a displaced strand, which is complementary
to immediately adjacent sequences, may be able to hairpin and
rapidly self-primer. Such a rapid self-priming event would result
in DNA synthesis and formation of a novel double-stranded DNA with
both strands joined by a hairpin at one end. This could be a
substrate for further rounds of invasion/synthesis and result in
formation of dimer-like products, and possibly more complex
products (see FIG. 35). We anticipate that this situation may be
perfectly acceptable for diagnostic tests. As the amplified
sequences are all dependant upon the presence of bona fide target
DNA, and will contain the unique inter-oligonucleotide sequences,
and because the self-priming event may be engineered to function
efficiently, then this may prove an ideal format for diagnostic
assays. We have already experienced the generation of greater than
unit length amplified DNA fragment apparently generated from
specific targets and suspect that this mechanism may operate in the
absence of specific oligonucleotide design. A similar activity has
been described although in this case the activity was initiated in
a totally different manner using a single very large
single-stranded DNA (Morrical S W, Wong M L, Alberts B M. J Biol
Chem. 1991 Jul. 25; 266(21):14031-8).
[0263] 3) In a final approach separate short oligonucleotides with
blocked 3'-ends would be employed as described in approach 1. In
this case however a linkage is engineered between the 5' end of the
targeting oligonucleotide and the 5' or 3' end of the short
competitor oligonucleotide (FIG. 35 parts B and C). This approach
is similar to approach 1, except that by tethering the competitor
oligonucleotide in the close vicinity of the targeting
oligonucleotide one ensures efficient competition of this
oligonucleotide with any other sequences in the reaction.
[0264] Polymerase Choice:
[0265] There are many DNA polymerases that might be used for RPA.
There are, however, a number of criteria that should be considered
when designing the optimal RPA format for a given application. We
have identified a number of different polymerases with activity in
RPA reactions, and deduced which properties confer specific
advantages for different circumstances. One exciting conclusion is
that polymerases from heterologous systems can be used effectively.
We discuss below the polymerase activities most relevant to
RPA.
[0266] Polymerase Processivity
[0267] Polymerase processivity is measured as the typical number of
incorporation events catalysed on each individual interaction with
a DNA template. Many of the polymerase enzymes used in molecular
biology applications are not highly processive, often because they
are functional analogues of the E. coli DNA polymerase I whose
primary role is DNA repair and Okazaki fragment processing.
Processivity is a more critical consideration for RPA than for PCR.
Because RPA uses a double-stranded template, distributive
polymerases will produce partially copied strands possessing a
joint, which could be ejected by branch migration. In addition, we
have evidence to suggest that bubble migration may occur in a
variety of RPA configurations. In bubble migration parent strands
of the template DNA re-hybridises shortly behind the replication
complex leading to ejection of the newly synthesised strand, which
is freed as a single-stranded DNA instead of the outgoing strand of
the original recombination event. This re-hybridisation has been
previously described in the T4 recombination/DNA synthesis system
and thought to involve coating of the outgoing strand with the uvsX
recombinase and subsequent re-invasion. Alternatively, in the
presence of uncooperative single-stranded DNA binding protein,
monomers may be lost progressively from one end of the outgoing
strand and may lead to progressive branch migration running in a
5'-3' direction, chasing the replication complex.
[0268] Thus if the polymerase dissociates prematurely from the
template, bubble migration or branch migration may result in the
newly synthesised strand being separated from the template as an
incomplete single strand. This could be catastrophic for RPA
reactions, because if such truncated products are too short to form
productive hybrids with similar products generated from the
opposing side, these undesired short products will accumulate
linearly. The T4 single-stranded DNA binding protein gp32 can
alleviate undesirable branch migration. Thus there is a need to
relatively processive polymerases, or polymerase complexes, to
efficiently amplify larger DNA fragments. Several now commonly used
simple polymerases such as Phi-29 DNA polymerase, Bst DNA
polymerase and T7 DNA polymerase in complex with thioredoxin are
known to be processive. We also surmise that related Pol I enzymes
from the Bacilli, such as Bacillus subtilis PolI (Bsu), will likely
demonstrate optimal characteristics by virtue of sharing with Bst
polymerase relative processivity and exonuclease minus status, but
retaining optimal solubility and activity profiles at temperatures
in the 30-37.degree. C. range. Additionally, multi-subunit
replication complexes incorporating sliding clamps may be used such
as that from bacteriophage T4, E. coli, and others. In all cases it
is assumed that the stable interaction between the polymerase and
the template will override bubble migration and branch migration
activities. We have found that Phi-29 polymerase and Bst polymerase
are capable of extending recombination intermediates generated in
our studies and that they show a different product length
distribution in comparison with those of the Klenow fragment of E.
coli DNA polymerase I. We have also purified the Polymerase I from
B. subtilis which is related to Bst polymerase. This polymerase is
readily overproduced and purified from E. coli with an N-terminal
hexhistidine tag, and appears to possess ideal biochemical
attributes for RPA.
[0269] Finally, there are some situations where a distributive
polymerase may be more appropriate for RPA. Because in many
configurations DNA synthesis is initiated from opposing ends and
replication complexes move toward one another, there is the
possibility of a collision between complexes resulting in a
stalemate in which neither progresses further. This requires either
that one polymerase temporarily dissociates from the template, or
that the polymerases used are able to pass one another effectively
without dissociation.
[0270] 3'-5' Exonuclease Activity Present Associated with the DNA
Polymerase:
[0271] Many DNA polymerases possess 3'-5' exonuclease activity, and
some also possess 5'-3' exonuclease activity, which is probably
undesirable in RPA as it results in digestion of one DNA strand
progressively as the polymerase moves forward, rather than
displacement. The 3'-5' exonuclease has potential advantages as
well as its obvious disadvantages. On the one hand 3'-5'
exonuclease activity increases the fidelity of the replication
reaction, and can also prevent stalling of polymerases at points of
misincorporation. High fidelity amplification is desirable for many
DNA applications. The 3'-5' exonuclease activity may also be
appropriate for amplification of larger DNA fragments where
stalling due to misincorporation could inhibit effective
amplification.
[0272] Despite these clear advantages of 3'-5' exonuclease activity
there are some disadvantages. We have observed that the free
oligonucleotides can be subject to end-dependant degradation when
polymerases possessing 3'-5' exonuclease are employed. This can be
suppressed to a large extent by using saturating amounts of
relatively cooperative gp32 protein with some polymerases such as
the Klenow fragment, but with enzymes possessing aggressive
exonucleases such as T4 DNA polymerase or Phi-29 DNA polymerase,
gp32 appears to be insufficient and the oligonucleotides appear to
be completely degraded. These data argue that it is advantageous to
at least limit to some extent the efficacy of an exonuclease
activity in the reaction.
[0273] We have found that 3'-5' exonuclease activity of some
polymerases may contribute substantially to noise in the reaction.
At the relatively low temperatures used in RPA reactions there is a
significant tendency for uncoated single-stranded DNA molecules to
form inappropriate hybrids, at low complementarity, with other DNAs
in the reaction. Such hybrids will prime DNA polymerases
elongation. For extension to occur the last base or two must be
paired correctly with its complement. While poorly complementing
segments within or between oligonucleotides can form weak hybrids
at low temperatures these will rarely be combined with a good
hybrid match at the very 3' end. Regardless, in the presence of a
3'-5' exonuclease activity the unpaired 3' most bases will be
excised until a correctly paired 3' end is formed, as happens
normally when an incorrect base is inserted by the polymerase. Our
data suggest that partly extended strands that have been displaced
by branch migration or bubble migration can fold back onto
themselves leaving an unpaired 3' end, which is trimmed thus
promoting inappropriate polymerase elongation. There are therefore
good reasons to limit or remove exonuclease activities from
polymerases used in RPA. There are other methods to inhibit
oligonucleotide degradation that may also be used.
[0274] Access to 3' Ends
[0275] The recombination intermediate formed after invasion must be
accessible to the DNA polymerase. The structure near the 3'-end of
the targeting oligonucleotide, is not equivalent to the 3'-end of
an oligonucleotide hybridised to otherwise single-stranded DNA,
which is the situation in PCR. Instead, the outgoing strand, which
is hybridised to the template strand immediately, or shortly,
downstream of the 3'-end of the invading oligonucleotide may block
polymerase loading. Moreover, whether of the outgoing strand is
constrained or unconstrained may affect the capacity of certain
polymerases to load successfully. Whether a particular polymerase
can function effectively in these situations must be addressed
experimentally. We find that the Klenow fragment of E. coli DNA
polymerase I, as well as the Bst DNA polymerase purified from
Bacillus stearothermophilus, can load onto and extend such
recombination intermediates. Helicases such as the T4 dda helicase
and T4 gp41 helicase may also function to process recombination
intermediates and separate the template and outgoing strands
downstream of the exchange event permitting other polymerases to be
used. Finally, it may be beneficial to use mixtures of polymerases,
acting synergistically in the RPA reaction, for example one
polymerase efficient at accessing the 3' ends of recombination
intermediates, and the other possessing processive,
strand-displacing synthetic activity.
[0276] Cooperative Interactions
[0277] We have demonstrated that enzymatic components from
heterologous systems can be combined together effectively in
various RPA formats. For example, both the Klenow fragment of E.
coli DNA polymerase I, the Bst DNA polymerase of Bacillus
stearothermophilus, and the large fragment of Bacillus subtilis
polymerase I, can extend recombination products generated with the
uvsX recombinase of bacteriophage T4 in the presence of the
bacteriophage T4 gp32 protein. Nevertheless, there are likely to be
additional synergistic effects when proteins from the same organism
are employed together. For example there are known to be physical
interactions between the bacteriophage T4 components such as uvsY
and uvsX, as well as gp32. T4 polymerase functionally interacts
with the gp41 helicase, and physically with gp32 (Formosa and
Alberts PNAS 80, 2442-2446, 1983). We suspect that using components
from the same organism will enhance RPA efficiency.
[0278] Resolution of Replication Complex Collisions
[0279] In some formats of RPA, such as when a large DNA product is
desired, a processive polymerase would be the optimal choice. Under
these conditions, however, there is significant likelihood that
replication complexes will converge with one another on the same
template. There is a danger that replication complexes will become
locked head-to head so that neither can pass. Most useful in this
situation are polymerases that are both processive and able to
resolve collisions as has been demonstrated for Phi29 DNA
polymerase (Elias-Arnanz M, Salas M. EMBO J. 1997 Sep. 15;
16(18):5775-83).
[0280] Recombinases
[0281] We have assayed both E. coli recA protein, and bacteriophage
T4 uvsX protein in RPA experiments. Both these proteins share some
limited protein sequence homology and are believed to have evolved
from a common progenitor. Crystallographic and electron microscope
studies of nucleoprotein filaments of these proteins, which show a
conserved filament structure, in terms of the pitch of the helices
formed in both ATP and ADP bound states, suggest a remarkable
similarity in their mechanism of action. Furthermore, all
prokaryotes possess proteins highly homologous to recA, which
suggests that the principle activities of recombinases have been
conserved throughout evolution. Hence, what is learned from one
recombinase may be applied to, or substituted by, another.
[0282] In addition to their similarities, however, there are
differences between recA and uvsX relevant to RPA and as additional
components of recombination/replication machinery are used in RPA
reactions organism-specific protein-protein interactions may have a
significant effect on reaction efficiency. The nucleotide
hydrolysis rate of uvsX is 10-20 times higher than that of recA,
suggesting that it might perform recombination reactions at an
accelerated rate (Formosa T, Alberts B M. J Biol Chem. 1986 May 5;
261(13):6107-18.). An increased hydrolysis rate could be beneficial
for RPA reactions in several ways.
[0283] 1) More dynamic turnover of uvsX on oligonucleotides could
increase the overall regeneration of nucleoprotein filaments
leading to near complete recombinase coverage to the most 5' end of
invading oligonucleotides.
[0284] 2) More rapid completion and disassembly of recombinase from
successful recombination events will permit more efficient
polymerase access
[0285] 3) A more active recombinase will produce a more flexible
nucleoprotein filament.
[0286] Another major difference between uvsX and recA is that uvsX
hydrolyses ATP to ADP plus phosphate, and to AMP plus pyrophosphate
whereas recA and other recombinases do not (Formosa T, Alberts B M.
J Biol Chem. 1986 May 5; 261(13):6107-18.). The biological
significance of this difference is not known but the activity might
affect RPA efficiency. For instance, the pitch of nucleoprotein
filaments formed with ATP and ADP is different and the hydrolysis
of ATP to ADP is associated with overall filament flexibility. It
may be that AMP-bound uvsX can adopt a different pitch and possess
a distinct flexibility.
[0287] The bacteriophage T4 recombinase uvsX stimulates a mode of
DNA displacement following synthesis known as bubble migration. In
bubble migration uvsX assembles onto the outgoing strand and
mediates a re-invasion of the outgoing strand thus displacing the
newly synthesised strand. This mode may have biological
significance because by displacing the newly synthesised strand,
the length of region with topological constraint is limited. This
process has not been described for recA, although it may occur.
Nevertheless several aspects of bubble migration suggest real
differences between uvsX and recA. For example, the bubble
migration model suggests that it is possible that uvsX bound DNA
extends to the end of the invading or partially extended DNA, but
that this structure is still accessible by polymerases for
elongation (Formosa T, Alberts B M. Cell. 1986 Dec. 5;
47(5):793-806). This has certainly not been observed for recA, and
if anything there is evidence that may be to the contrary (Xu L,
Marians K J. J Biol Chem. 2002 Apr. 19; 277(16):14321-8). It is
unclear how similar uvsX and recA filaments are in their respective
abilities to promote polymerase loading at 3' ends with or without
recombinase dissociation. We have found differences between uvsX(C)
and recA(C) consistent with the notion that their differences have
can affect RPA efficiency. Contrary to our findings with recA, uvsX
can mediate multiple invasions to an end structure target even when
N-terminally tagged gp32 is used in the absence of polyethylene
glycol (FIG. 23). Thus uvsX may be more optimal for use in RPA.
[0288] The bacteriophage T4 uvsX recombinase has a
well-characterised interaction with its partner loading protein
uvsY. Despite reports suggesting that E. coli recO and recR may be
functional analogues of uvsY we have not observed significant
improvement for RPA reactions. This may be due to problems with our
protein preparations, or due to the use of the heterologous gp32
rather than E. coli SSB.
[0289] Finally uvsX is likely to behave better with gp32, which we
find to be an optimal single-stranded DNA binding protein, because
they have evolved to function in concert and may have relevant
interactions. Indeed uvsX and other components of the bacteriophage
T4 recombination dependant replication machinery, such as the dda
helicase, have known protein-protein interactions that may useful
for establishing an optimal RPA reaction (Hacker K J, Alberts B M.
J Biol Chem. 1992 Oct. 15; 267(29):20674-81).
[0290] Despite the apparent advantages of uvsX for RPA, there are
features of E. coli recA that may be useful. It has been reported
that recA nucleoprotein filaments are more stable, which could be
of utility in some circumstances. The lower ATP hydrolysis rate
places less strain on establishing a durable ATP regeneration
system, and the lack of generation of AMP and pyrophosphate
obviates the need to regenerate and mop-up these side-products. It
may also be the case that other recA homologues possess activities
that are optimal or RPA.
[0291] Establishment of a Dynamic Recombination System:
[0292] To make RPA robust, it is critical to configure the reaction
to provide a sufficient number of active, coated,
homology-searching recombinase/DNA filaments. In addition,
following completion of homology-searching, filaments must
efficiently disassemble, or be otherwise processed, to permit
loading DNA polymerase and other components. It is also essential
that a sufficient quantity of single-stranded DNA binding protein
be present both to facilitate oligonucleotide melting and to
collect displaced outgoing strands. And finally, robust RPA
requires will require processive strand-displacing DNA synthesis.
Underlying these requirements is a competition between two the
recombinase and the single-stranded DNA binding protein.
[0293] It is widely known that of recombinase-loaded DNA filaments
are unstable in the presence of single-stranded DNA binding
proteins. Coupled to the finding that nucleotide cofactor
hydrolysis is not strictly required for homology searching, led to
the use of non-hydrolysable nucleotide analogues of nucleotides
such as ATP-.gamma.-S, to load recA onto filaments and produce
stable homology-searching complexes. A recA-mediated amplification
method using ATP-.gamma.-S has been described (Zarling, et al.),
however, has not been widely used. We previously identified a flaw
in the method, which we can now observe in our experimental
results. The Zarling, et al. method probably fails because
recombinase-loaded filaments needs to be dynamic and capable of
disassembly as well as other ATP-hydrolysis dependant events to
complete strand exchange and permit loading of DNA polymerase other
components to the 3' end of the invading oligonucleotide. The use
of ATP-.gamma.-S, as well as other modifications such as removing
acidic sequences from the C terminus of recombinases, leads to a
constant general high affinity for DNA that likely prevents strand
exchange and dissociation from the invasion complex. Thus
ATP-.gamma.-S-loaded recA filaments become effectively locked onto
the target site in the recombination event for an abnormally long
time. Consequently non-hydrolysable nucleotide analogues are not
generally permissive for recombinase-mediated replication and
amplification. Instead, ATP, or other hydrolysable nucleotides
capable of supporting recombinase loading, must be employed. In ATP
the recombinases are constantly associating with and dissociating
from oligonucleotide and are in competition with single-stranded
DNA binding proteins. We have addressed the problem this
competition poses in two general ways; first by including a
recombinase loading protein specific for uvsX, the uvsY protein,
and secondly by modulating the cooperative behaviour of gp32, and
the recombinases uvsX and recA, by mutation and/or inclusion of
crowding agents. It is possible however that limited quantities of
non-hydrolysable analogues such as ATP-.gamma.-S, or of
non-phosphorylatable analogues such as ADP-.beta.-S, may be
included to modulate the global loading/unloading activity of the
recombinase.
[0294] Additional Reaction Components
[0295] A number of specific reaction components have a significant
influence on RPA reaction efficacy.
[0296] Polyethylene Glycol
[0297] Polyethylene glycols (PEGs) have a profound effect on
recombination/DNA synthesis. Firstly, we find that PEGs influence
the number of multiple invasion/extension cycles that occur, for
example when recA is combined with gp32(N). We have also found that
PEGs stimulate amplification reactions configured in several
different ways (FIG. 15, Example 3). We also know that in some
configurations PEGs alter the length distribution of products
formed (FIG. 28). In summary polyethylene glycols, and presumably
other similar crowding agents may affect the cooperativity of gp32
and recombinases, affect polymerase processivity and affect the
hybridisation rate and behaviour of oligonucleotides in solution.
Furthermore the chain length of the polyethylene glycol appears to
be critical. We find PEGs of average molecular weight 1450 and
15-20,000 (PEG `compound`) produce the best results. The PEGs in
aiding gp32 function, particularly gp32 variants with attenuated
cooperativity, has been detailed above. PEG is also likely to
increase the stability of recombinase-loaded filaments and the
increased persistence may increase RPA efficacy.
[0298] ATP Regeneration System Components
[0299] An ATP regeneration system is crucial to permit persistent
recombination reactions as recombinases have an extremely high rate
of ATP hydrolysis when bound to nucleic acids. In particular, the
uvsX protein has a hydrolysis rate 10-20 times higher than recA and
can consume 200 molecules of ATP per minute per monomer. A number
of systems are available and we have routinely used the creatine
kinase/phosphocreatine system. When uvsX is employed the AMP that
is produced must be converted into ATP. We have used chicken
myokinase, which converts a molecule of AMP and one of ATP to two
molecules of ADP. ADP is then converted to ATP using the creatine
kinase/phosphocreatine system. Poor regeneration of ATP will reduce
the reaction rate and possibly stop the reaction.
[0300] Pyrophosphatase
[0301] Pyrophosphate (PPi) accumulates during DNA synthesis and
when uvsX is employed, as it hydryolyses ATP to AMP+PPi. PPi
accumulation in the reaction can have several detrimental
consequences. Significant pyrophosphate accumulation will permit an
unacceptable rate of pyrophosphorylsis, whereby the synthetic
reaction of a polymerase is driven into reverse and removes the
3'-most nucleotides from duplex templates. This could lead to
unacceptable levels of primer noise, or enhanced levels of
undesired self-priming of outgoing strands, because editing
activities of the polymerase tend to trim 3'-ends back until a
suitable duplex region is revealed to permit rapid elongation.
Additionally pyrophosphatase accumulation will lead to inhibition
of the recombinase, and to a slowing of the polymerase synthetic
reaction.
REFERENCES
[0302] Adams, D. E., Tsaneva, I. R. and West, S. C. (1994).
Dissociation of RecA filaments from duplex DNA by the RuvA and RuvB
DNA repair proteins. Proc Natl Acad Sci USA 91, 9901-5. [0303]
Alexseyev, A. A., Bakhlanova, I. V., Zaitsev, E. N. and Lanzov, V.
A. (1996). Genetic characteristics of new RecA mutants of
Escherichia coli K-12. J Bacteriol 178, 2018-24. [0304] Baumann,
P., Benson, F. E., Hajibagheri, N. and West, S. C. (1997).
Purification of human Rad51 protein by selective spermidine
precipitation. Mutat Res 384, 65-72. [0305] Benkovic, S. J.,
Valentine, A. M. and Salinas, F. (2001). Replisome-mediated DNA
replication. Annu Rev Biochem 70, 181-208. [0306] Bennett, R. L.
and Holloman, W. K. (2001). A RecA homologue in Ustilago maydis
that is distinct and evolutionarily distant from Rad51 actively
promotes DNA pairing reactions in the absence of auxiliary factors.
Biochemistry 40, 2942-53. [0307] Better, M. and Helinski, D. R.
(1983). Isolation and characterization of the RecA gene of
Rhizobium meliloti. J Bacteriol 155, 311-6. [0308] Bork, J. M.,
Cox, M. M. and Inman, R. B. (2001). The RecOR proteins modulate
RecA protein function at 5' ends of single-stranded DNA. EMBO J 20,
7313-22. [0309] Bork, Cox and Inman J Biol Chem. 2001 Dec. 7;
276(49):45740-3 [0310] Cox, M. M., Goodman, M. F., Kreuzer, K. N.,
Sherratt, D. J., Sandler, S. J. and Marians, K. J. (2000). The
importance of repairing stalled replication forks. Nature 404,
37-41. [0311] Cox, M. M., McEntee, K. and Lehman, I. R. (1981). A
simple and rapid procedure for the large scale purification of the
RecA protein of Escherichia coli. J Biol Chem 256, 4676-8. [0312]
Cromie, G. A. and Leach, D. R. (2000). Control of crossing over.
Mol Cell 6, 815-26. [0313] Dillingham, M. S. and Kowalczykowski, S.
C. (2001). A step backward in advancing DNA replication: rescue of
stalled replication forks by RecG. Mol Cell 8, 734-6. [0314]
Eggler, Lusetti and Cox, J Biol Chem. 2003 May 2; 278(18):16389-96
[0315] Eggleston, A. K. and West, S. C. (2000). Cleavage of holiday
junctions by the Escherichia coli RuvABC complex. J Biol Chem 275,
26467-76. [0316] Elias-Arnanz M, Salas M. EMBO J. 1997 Sep. 15;
16(18):5775-83 [0317] Ferrari et al., J Mol Biol. 1994 Feb. 11;
236(1):106-23 [0318] Formosa T, Alberts B M. J Biol Chem. 1986 May
5; 261(13):6107-18 [0319] Formosa T, Alberts B M. Cell. 1986 Dec.
5; 47(5):793-806. [0320] Glover, B. P. and McHenry, C. S. (2001).
The DNA polymerase III holoenzyme: an asymmetric dimeric
replicative complex with leading and lagging strand polymerases.
Cell 105, 925-34. [0321] Goodman, H. J., Parker, J. R., Southern,
J. A. and Woods, D. R. (1987). Cloning and expression in
Escherichia coli of a RecA-like gene from Bacteroides fragilis.
Gene 58, 265-71. [0322] Hacker K J, Alberts B M. J Biol Chem. 1992
Oct. 15; 267(29):20674-81 [0323] Harris L D, Griffith J. J Biol
Chem. 1987 Jul. 5; 262(19):9285-92 [0324] Heyer, W. D. and
Kolodner, R. D. (1989). Purification and characterization of a
protein from Saccharomyces cerevisiae that binds tightly to
single-stranded DNA and stimulates a cognate strand exchange
protein. Biochemistry 28, 2856-62. [0325] Hickson, I. D., Gordon,
R. L., Tomkinson, A. E. and Emmerson, P. T. (1981). A temperature
sensitive RecA protein of Escherichia coli. Mol Gen Genet 184,
68-72. [0326] Hsieh, P., Camerini-Otero, C. S. and Camerini-Otero,
R. D. (1992). The synapsis event in the homologous pairing of DNAs:
RecA recognizes and pairs less than one helical repeat of DNA. Proc
Natl Acad Sci USA 89, 6492-6. [0327] Hsieh P, Camerini-Otero C S,
Camerini-Otero R D. Proc Natl Acad Sci USA. 1992 Jul. 15;
89(14):6492-6 [0328] Kato, R. and Kuramitsu, S. (1993). RecA
protein from an extremely thermophilic bacterium, Thermus
thermophilus HB8. J Biochem (Tokyo) 114, 926-9. [0329] Katz F S,
Bryant F R. Biochemistry. 2001 Sep. 18; 40(37):11082-9 [0330]
Kelman, Z. and O'Donnell, M. (1995). DNA polymerase III holoenzyme:
structure and function of a chromosomal replicating machine. Annu
Rev Biochem 64, 171-200. [0331] Komori, K., Miyata, T., DiRuggiero,
J., Holley-Shanks, R., Hayashi, I., Cann, I. K., Mayanagi, K.,
Shinagawa, H. and Ishino, Y. (2000). Both RadA and RadB are
involved in homologous recombination in Pyrococcus furiosus. J Biol
Chem 275, 33782-90. [0332] Kornberg, A. and Baker, T. A. (1992).
DNA Replication. New York: W. H. Freeman and Company. [0333] Kuil
et al., Biophys Chem. 1988 December; 32(2-3):211-27 [0334]
Kuramitsu, S., Hamaguchi, K., Ogawa, T. and Ogawa, H. (1981). A
large-scale preparation and some physicochemical properties of RecA
protein. J Biochem (Tokyo) 90, 1033-45. [0335] Kurumizaka, H.,
Ikawa, S., Ikeya, T., Ogawa, T. and Shibata, T. (1994). A chimeric
RecA protein exhibits altered double-stranded DNA binding. J Biol
Chem 269, 3068-75. [0336] Lavery P E, Kowalczykowski S C. J Biol
Chem. 1992 May 5; 267(13):9307-14 [0337] Liu, J., Nurse, P. and
Marians, K. J. (1996). The ordered assembly of the phiX174-type
primosome. III. PriB facilitates complex formation between PriA and
DnaT. J Biol Chem 271, 15656-61. [0338] Lohman and Ferrari, Annu
Rev Biochem. 1994; 63:527-70 [0339] Lovett, C. M., Jr. and Roberts,
J. W. (1985). Purification of a RecA protein analogue from Bacillus
subtilis. J Biol Chem 260, 3305-13. [0340] Maeshima, K., Morimatsu,
K. and Horii, T. (1996). Purification and characterization of
XRad51.1 protein, Xenopus RAD51 homologue: recombinant XRad51.1
promotes strand exchange reaction. Genes Cells 1, 1057-68. [0341]
Marians, K. J. (1992). Prokaryotic DNA replication. Annu Rev
Biochem 61, 673-719. [0342] Marians, K. J. (1999). PriA: at the
crossroads of DNA replication and recombination. Prog Nucleic Acid
Res Mol Biol 63, 39-67. [0343] Mazin, A. V. and Kowalczykowski, S.
C. (1998). The function of the secondary DNA-binding site of RecA
protein during DNA strand exchange. EMBO J 17, 1161-8. [0344]
McGlynn, P. and Lloyd, R. G. (1999). RecG helicase activity at
three- and four-strand DNA structures. Nucleic Acids Res 27,
3049-56. [0345] McGlynn, P., Mandi, A. A. and Lloyd, R. G. (2000).
Characterisation of the catalytically active form of RecG helicase.
Nucleic Acids Res 28, 2324-32. [0346] Morel, P., Cherny, D.,
Ehrlich, S. D. and Cassuto, E. (1997). Recombination-dependent
repair of DNA double-strand breaks with purified proteins from
Escherichia coli. J Biol Chem 272, 17091-6. [0347] Monical S W,
Wong M L, Alberts B M. J Biol Chem. 1991 Jul. 25; 266(21):14031-8.
Amplification of snapback DNA synthesis reactions by the uvsX
recombinase of bacteriophage T4. [0348] Monical and Alberts J Biol
Chem. 1990 Sep. 5; 265(25):15096-103. [0349] Ng, J. Y. and Marians,
K. J. (1996a). The ordered assembly of the phiX174-type primosome.
I. Isolation and identification of intermediate protein-DNA
complexes. J Biol Chem 271, 15642-8. [0350] Ng, J. Y. and Marians,
K. J. (1996b). The ordered assembly of the phiX174-type primosome.
II. Preservation of primosome composition from assembly through
replication. J Biol Chem 271, 15649-55. [0351] Paulus, B. F. and
Bryant, F. R. (1997). Time-dependent inhibition of RecA
protein-catalyzed ATP hydrolysis by ATP-gammaS: evidence for a
rate-determining isomerization of the RecA-ssDNA complex.
Biochemistry 36, 7832-8. [0352] Pham, P., Bertram, J. G.,
O'Donnell, M., Woodgate, R. and Goodman, M. F. (2001). A model for
SOS-lesion-targeted mutations in Escherichia coli. Nature 409,
366-70. [0353] Pierre, A. and Paoletti, C. (1983). Purification and
characterization of RecA protein from salmonella typhimurium. J
Biol Chem 258, 2870-4. [0354] Rashid, N., Morikawa, M., Kanaya, S.,
Atomi, H. and Imanaka, T. (2001). RecA/Rad51 homolog from
Thermococcus kodakaraensis KODI. Methods Enzymol 334, 261-70.
[0355] Reddy, Weitzel and Von Hippel, Proc Natl Acad Sci USA. 1993
Apr. 15; 90(8):3211-5 [0356] Rosselli, W. and Stasiak, A. (1990).
Energetics of RecA-mediated recombination reactions. Without ATP
hydrolysis RecA can mediate polar strand exchange but is unable to
recycle. J Mol Biol 216, 335-52. [0357] Salinas F, Jiang H, Kodadek
T. J Biol Chem. 1995 Mar. 10; 270(10):5181-6. [0358] Scheerhagen et
al., J Biomol Struct Dyn. 1986 April; 3(5):887-98 [0359] Shan, Q.,
Bork, J. M., Webb, B. L., Inman, R. B. and Cox, M. M. (1997). RecA
protein filaments: end-dependent dissociation from ssDNA and
stabilization by RecO and RecR proteins. J Mol Biol 265, 519-40.
[0360] Singleton, M. R., Scaife, S. and Wigley, D. B. (2001).
Structural analysis of DNA replication fork reversal by RecG. Cell
107, 79-89. [0361] Spies, M., Kil, Y., Masui, R., Kato, R., Kujo,
C., Ohshima, T., Kuramitsu, S. and Lanzov, V. (2000). The RadA
protein from a hyperthermophilic archaeon Pyrobaculum islandicum is
a DNA-dependent ATPase that exhibits two disparate catalytic modes,
with a transition temperature at 75 degrees C. Eur J Biochem 267,
1125-37. [0362] Steffen, S. E. and Bryant, F. R. (2000).
Purification and characterization of the RecA protein from
Streptococcus pneumoniae. Arch Biochem Biophys 382, 303-9. [0363]
Tang, M., Pham, P., Shen, X., Taylor, J. S., O'Donnell, M.,
Woodgate, R. and Goodman, M. F. (2000). Roles of E. coli DNA
polymerases IV and V in lesion-targeted and untargeted SOS
mutagenesis. Nature 404, 1014-8. [0364] Tissier, A. F., Lopez, M.
F. and Signer, E. R. (1995). Purification and characterization of a
DNA strand transferase from broccoli. Plant Physiol 108, 379-86.
[0365] Villemain, et al. J Biol Chem. 2000 Oct. 6;
275(40):31496-504 [0366] Webb, B. L., Cox, M. M. and Inman, R. B.
(1995). An interaction between the Escherichia coli RecF and RecR
proteins dependent on ATP and double-stranded DNA. J Biol Chem 270,
31397-404. [0367] Webb, B. L., Cox, M. M. and Inman, R. B. (1997).
Recombinational DNA repair: the RecF and RecR proteins limit the
extension of RecA filaments beyond single-strand DNA gaps. Cell 91,
347-56. [0368] Webb, B. L., Cox, M. M. and Inman, R. B. (1999). ATP
hydrolysis and DNA binding by the Escherichia coli RecF protein. J
Biol Chem 274, 15367-74. [0369] West, S. C., Countryman, J. K. and
Howard-Flanders, P. (1983). Purification and properties of the RecA
protein of Proteus mirabilis. Comparison with Escherichia coli RecA
protein; specificity of interaction with single strand binding
protein. J Biol Chem 258, 4648-54. [0370] Wetmur, J. G., Wong, D.
M., Ortiz, B., Tong, J., Reichert, F. and Gelfand, D. H. (1994).
Cloning, sequencing, and expression of RecA proteins from three
distantly related thermophilic eubacteria. J Biol Chem 269,
25928-35. [0371] Xu L, Marians K J. J Biol Chem. 2002 Apr. 19;
277(16):14321-8.
EXAMPLES
[0372] As shown herein, we have developed an in vitro DNA
amplification system that couples recombinase-driven sequence
targeting with strand-displacement synthesis. This permits DNA
amplification without global thermal, chemical, or enzymatic
template melting. Reactions are sensitive, specific and operate at
37.degree. C. with no pre-treatment of sample DNA. As much as
10.sup.12-fold amplification is observed within 1-11/2 hours. Less
than 10 copies of a given target DNA can be detected in a complex
sample with a simple single-step reaction. This method is an ideal
alternative to PCR for a variety of applications and will enable
highly portable DNA diagnostic systems.
[0373] The examples are presented in order to more fully illustrate
the preferred embodiments of the invention. These examples should
in no way be construed as limiting the scope of the invention, as
encompassed by the appended claims.
Example 1
An Example of a Leading Strand Recombinase-Polymerase Amplification
(lsRPA)
[0374] DNA sequences can be amplified using leading strand
synthesis according to the Recombinase-Polymerase amplification
(RPA) method depicted in FIG. 1. FIG. 1 shows RecA/primer loading.
Prior to the addition of template DNA and/or Polymerase, RecA and
SSB will compete for binding to single-stranded oligonucleotide
primers. In the presence of a RecR and RecO, RecA is selectively
stabilized onto the single-stranded primers forming RecA
nucleoprotein filaments in a complex with RecO and RecR. This
complex is competent to invade double-stranded DNA to form a D-loop
at sites homologous to the oligonucleotide primers. Alternatively,
RecA, RecO and RecR can be pre-loaded onto oligonucleotide primers
prior to the introduction of SSB to the reaction mixture.
[0375] The following details the likely composition of an RPA
reaction assembled with E. coli recA and E. coli recO and recR
stabilizing agents:
[0376] D-Loop Formation/Resolution Components:
TABLE-US-00001 Component Concentration RecA 20 .mu.M
Single-stranded oligonucleotide 0.25 .mu.M primers ATP 3 mM RecF
0.1 .mu.M RecO 0.13 .mu.M RecR 0.5 .mu.M Single-stranded Binding
protein 1 to 10 .mu.M (SSB) DNA polymerase V 5 units
[0377] Polymerase/Helicase/Resolvase Mix:
TABLE-US-00002 Component Concentration DNA Polymerase 5 units RuvA
0.5 .mu.M RuvB 0.5 .mu.M RuvC 0.5 .mu.M RecG 10 nM
[0378] Reaction Buffer:
TABLE-US-00003 Component Concentration MgCl2 2 to 10 mM TrisHCl pH
7.2 50 mM DTT 0 to 10 mM KCl 0 to 50 mM Deoxyribonucleotide 0.2 mM
triphosphates Bovine serum albumin (BSA) 0 to 10 .mu.g per ml
[0379] The reaction is assembled so that the final concentration
satisfies the D-Loop Formation/Resolution Components,
Polymerase/Helicase/Resolvase Mix, and Reaction Buffer with the DNA
polymerase and/or template added last if necessary. For example, a
2.times. concentrated solution of D-Loop Formation/Resolution
Components and of the Polymerase/Helicase/Resolvase Mix may be made
in 1.times. reaction buffer. The reaction may be initiated by
mixing an equal volume of each of the two components (each in
1.times. reaction buffer). Optionally, and as stated above, the DNA
polymerase or template (target DNA) may be added last. The reaction
is incubated for a sufficient time of until the reactants are
exhausted. Typical incubation times would range from 1 hour, 2
hours, 3 hours, 5 hours, 10 hours or overnight (about 16 hours).
Unlike PCR, which requires small volumes for rapid temperature
change, there is no limit to the reaction volume of RPA. Reaction
volumes of 25 .mu.l, 50 .mu.l, 100 .mu.l, 1 ml, 10 ml and 100 ml or
larger may be performed in one vessel. Incubation temperature may
be a typical laboratory temperature such as 25.degree. C.,
30.degree. C., or 37.degree. C.
[0380] Prior to the addition of template DNA and/or Polymerase,
recombinase and SSB will compete for binding to single-stranded
oligonucleotide primers. In the presence of a RecR and RecO, RecA
is selectively stabilized onto the single-stranded primers forming
RecA nucleoprotein filaments in a complex with RecO and RecR. This
complex is competent to invade double-stranded DNA to form a D-loop
at sites homologous to the oligonucleotide primers. Alternatively,
RecA, RecO, and RecR can be pre-loaded onto oligonucleotide primers
prior to the introduction of SSB to the reaction mixture (FIG.
1).
[0381] The invading strands will be extended by the polymerase in a
5' to 3' direction. As D-loops are formed and synthesis proceeds,
displaced single stranded DNA becomes coated with SSB. RecA release
from double-stranded DNA can occur via ATP hydrolysis in a 5' to 3'
direction or as a result of helicase/resolvase or polymerase
activity (FIG. 2A, B). New rounds of invasion/synthesis will
continuously occur. The third round of strand-invasion/synthesis
will release discrete products released whose ends correspond to
the two facing primer sites. These fragments will soon become the
dominant reaction product and will accumulate to high levels. As
each synthetic complex processes to the end of the template RecA
protein is displaced either by polymerase activity or by the
activity of helicases, such as RuvAB or resolvases, such as RuvC.
Once primers, ATP, deoxynucleoside triphosphates, or any other
limiting component is exhausted, the reaction will stop.
[0382] The inclusion of temperature-sensitive recombinase mutants
will allow the controlled initiation of DNA synthesis. In such a
situation, the initiation reaction is performed at 25 to 37.degree.
C. permitting the formation of D-loops. Elongation reactions are
performed at 42.degree. C., which is non-permissive for RecA
mediated double-strand invasion. The number of cycles will
determine the amount of reaction product. Extended elongation
phases will permit the amplification of extremely long DNAs without
interference of re-invasion.
Example 2
Nested RPA
[0383] The RPA reaction is performed as described in Example 1. A
fraction of one tenth ( 1/10) and one hundredth ( 1/100) of the
reaction is removed and used in place of the DNA template in a
second round of RPA. LsRPA, leading/lagging RPA, and combinations
thereof may be used for nested RPA.
Example 3
Simultaneous Leading and Lagging Strand Recombinase-Polymerase
Amplification
[0384] DNA sequences can be amplified using simultaneous leading
and lagging strand synthesis according to the
Recombinase-Polymerase amplification (RPA) method depicted in FIG.
2. This figure specifically illustrates lsRPA. FIG. 2A shows that
RecA/primer nucleoprotein filaments invade double stranded template
DNA preferentially associating with homologous target sites. As
D-loops are formed and synthesis proceeds, displaced single
stranded DNA becomes coated with SSB (FIG. 2A). RecA release from
double-stranded DNA can occur via ATP hydrolysis in a 5'-3'
direction or as a result of helicase/resolvase or polymerase
activity (FIG. 2A). As synthesis continues (FIG. 2B), polymerases
encounter SSB bound, displaced single-stranded template.
Double-stranded target sites are re-invaded by RecA/primer
nucleoprotein filaments. Subsequent rounds of lsRPA proceed from
re-invaded sites (FIG. 2B).
[0385] The following details likely components of a
replisome-mediated amplification utilizing components from E. coli.
A reaction is assembled with the following composition:
[0386] D-Loop Formation/Resolution Components
TABLE-US-00004 Component Concentration RecA 20 .mu.M
Single-stranded oligonucleotide 0.25 .mu.M primers ATP 3 mM RecF
0.1 .mu.M RecO 0.13 .mu.M RecR 0.5 .mu.M Single-stranded Binding
protein 1 to 10 .mu.M (SSB) DNA polymerase V 5 units
[0387] Helicase/Resolvase Mix
TABLE-US-00005 Component Concentration RuvA 0.5 .mu.M RuvB 0.5
.mu.M RuvC 0.5 .mu.M RecG 10 nM
[0388] Primosome Complex
TABLE-US-00006 Component Concentration PriA 20 nM PriB 20 nM DnaT
100 nM DnaB 100 nM DnaC 200 nM DnaG 200 nM
[0389] DNA Polymerase III Holoenzyme Complex
TABLE-US-00007 Component Concentration .beta.-Clamp 2 .mu.M DnaX
Clamp Loader 500 nM Polymerase Core Complex 500 nM
[0390] Lagging Strand Mix
TABLE-US-00008 Component Concentration DNA polymerase I 5 units DNA
ligase 2 units
[0391] Reaction Buffer
TABLE-US-00009 Component Concentration MgCl.sub.2 2 to 10 mM
TrisHCl pH 7.2 10 to 60 mM DTT 0 to 10 mM KCl 0 to 50 mM
Deoxyribonucleotide 0.2 to 0.4 mM triphosphates Bovine serum
albumin (BSA) 0 to 10 .mu.g per ml
[0392] The reaction is assembled so that the final concentration of
all the reagents is as listed above. Thus, for example, a 5 fold
concentrated solution of each of the components (D-loop
Formation/Resolution Components, Helicase/Resolvase Mix, Primosome
Complex, DNA Polymerase III holoenzyme Complex, Lagging Strand Mix)
is made in 1.times. reaction buffer. Then, the five solutions are
mixed together in equal volumes to initiate the reaction. The
reaction is incubated for a sufficient time of until the reactants
are exhausted. Typical incubation times would range from 1 hour, 2
hours, 3 hours, 5 hours, 10 hours or overnight (about 16 hours). As
stated above, there is no limit to the reaction volume of RPA.
Reaction volumes of 25 .mu.l, 50 .mu.l, 100 .mu.l, 1 ml, 10 ml and
100 ml or larger may be performed in one vessel. Incubation
temperature may be a typical laboratory temperature such as
25.degree. C., 30.degree. C., or 37.degree. C.
[0393] FIG. 3 shows initiation (FIG. 3A), synthesis (FIG. 3B), and
polymerase amplification (FIG. 3C-3D). First, the primosome loads
onto the D-loop formed by RecA nucleoprotein filament invasion
(FIG. 3A). The primosome synthesizes a stretch of RNA primer.
Finally, the primosome recruits the clamp loader, which recruits
both the sliding clamp dimer and the asymmetric DNA polymerase core
(FIG. 3A). Synthesis occurs simultaneously in both the leading and
lagging directions. Eventually lagging strand synthesis stops and
the lagging strand clamp is unloaded (FIG. 3B). Synthesis of the
leading strand continues until a new site of lagging stand
synthesis is formed (FIG. 3B). While leading strand synthesis
continues, a new site of lagging stand synthesis is formed. Lagging
strand synthesis continues back to the previous Okazaki fragment
where the lagging strand clamp is unloaded (FIG. 3C). DNA
Polymerase I removes the RNA primer, and fills in the gap while DNA
ligase connects the two Okazaki fragments forming a continuous
lagging strand (FIG. 3D).
Example 4
Establishment of an Amplification Environment Using the Assembly of
Heterologous Components E. coli recA(C) and T4 gp32(N)
[0394] FIG. 18 shows the results of an experiment in which recA(C)
has been combined with gp32(N) in the presence of pairs of
oligonucleotides, Tester3bio (possessing a 5' biotin label) and
Sizer1, Sizer2, Sizer3, Sizer4 or Tester2. These latter
unbiotinylated oligonucleotides were positioned progressively
further away from the common Tester3bio oligonucleotide. The
template was a linear DNA fragment, approximately 300 bp, released
from a plasmid. Tester3bio was designed to be complementary to one
end of this fragment and included a 5' overhang relative to this
sequence.
[0395] The reaction buffer included Magnesium acetate at 10 mM,
required to support recA binding to DNA, and 3 mM ATP. Also
included was an ATP regeneration system, comprising phosphocreatine
and creatine kinase, as well as dNTPS at 200 .mu.M, and the Klenow
fragment of E. coli DNA polymerase I. PEG compound was employed as
shown. Double stranded template DNA (0.5 fmoles), derived from a
plasmid carrying the E. coli ruvB gene, was used as a starting
target. The Sizer1, Sizer2, Sizer3, and Sizer4 oligonucleotides did
not recognise the other end of the template. Instead, these
oligonucleotides were positioned to face Tester3bio with increasing
distance between their relative 3' ends.
[0396] After an incubation of 2 hours at 37.degree. C., there was a
substantial amplification of specific fragments of the correct size
when Tester2, 3, and 4 were used. In the best conditions (with
Sizer2), we estimated that the amplification product were 10.sup.4
fold greater than the starting template.
Example 5
The Nature of Amplification Products and the Sensitivity of the
Reaction Using a Heterologous Assembly of E. coli recA(C) and
Bacteriophage T4 gp32(N)
[0397] FIG. 19 shows the results of an experiment in which recA(C)
has been combined with gp32(N) in the presence of the pair of
oligonucleotides, Tester3bio (possessing a 5' biotin label) and
Sizer2, under conditions similar to those used in Example 1. PEG
compound or PEG 1450 were employed as shown and 0.5 fmoles of
template was used as a starting template amount. In this example,
progressive dilution of the template was investigated.
Alternatively we explored the use of linearised starting template
possessing no end that overlaps the primer (by using a ClaI digest
of the E. coli ruvB gene carrying plasmid), and dilution of the
Klenow fragment. Amplification of correctly sized fragments
occurred in all lanes and was strongest in the case of 0.5
fmoles-starting template in the presence of PEG compound.
[0398] When the products of these optimal reactions were
electrophoresed on agarose gels and stained with ethidium bromide,
a clean band of double-stranded DNA of the correct size was
observed. When this sample was treated with BbvC1 restriction
enzyme prior to electrophoresis the expected increase in gel
mobility occurs consistent with a single cut as expected.
Amplification of a product of the correct size was observed with
starting template dilutions of 100-fold, or greater, although the
product was less abundant and includes a ladder of shorter products
below the main band. A similar pattern was observed when uncut
template is employed or when no template is employed. We reasoned
that the proteins used in these studies were significantly
contaminated with E. coli genomic DNA (naturally carrying the ruvB
gene) as they were purified in single column purifications without
the use of nucleases. Consequently we believe this test system
generates false positives when the sensitivity is high enough.
Example 6
Establishment of an Amplification Environment Using an Assembly of
Gp32(N) and uvsX(C)
[0399] FIG. 24 shows results of an experiment in which uvsX(C) has
been combined with gp32(N) in the presence of the oligonucleotides
Tester3bio and Sizer2. The template DNA in this experiment was an
EcoRV digestion of the E. coli ruvB gene carrying plasmid used in
Examples 1 and 2. Tester3bio recognised one end of an approximately
300 base pair fragment and included a 5' overhang relative to the
end of the target sequence. Sizer2 recognised the other strand of
this template. This oligonucleotide was directed toward embedded
sequences such that its 3' end was about three and a half helical
turns from the end of Tester3bio.
[0400] In the presence of PEG1450, we observed the amplification of
the expected fragment within the 2 hours of the reaction. In the
cases where amplification has occurred, almost the entire of
population of oligonucleotides was consumed indicating an
amplification of 3-5.times.10.sup.4. The reaction components are
indicated on FIG. 24. Included in some samples were additional
components. We found that 200 .mu.M ADP-.beta.-S included in this
reaction slightly increased the amount of product formed under
these conditions. Conversely, under the conditions used here,
inclusion of E. coli toposiomerase I was inhibitory to DNA
amplification. Under the conditions used, we detected no
amplification with uvsX(C)delta protein. However, no PEG1450 was
included in these samples and uvsX(C) also failed to amplify under
these conditions without PEG1450.
Example 7
Amplification of a Target from Human Genomic DNA Using T4
Recombination Proteins
[0401] FIG. 30 shows the results of an experiment in which several
pairs of primers were employed to amplify a specific DNA fragment
from human genomic DNA. The reaction included bacteriophage T4
gp32(C)K3A, uvsX(C) and uvsY(N) proteins, as well as exonuclease
deficient Klenow fragment, and proteins comprising the ATP
regeneration system to convert ADP and AMP. To detect the specific
DNA fragment, we transferred the electrophoretically separated
reaction products to nylon membrane, then hybridised a biotinylated
probe, which recognised a unique non-primer internal sequence.
[0402] Three primer pairs were employed, and in each case a
comparison was made between no input genomic DNA, 10,000 copies of
uncut human genomic DNA, and 10,000 copies of HpaII cut genomic DNA
(which generates at least one end for the primer pairs). In all
cases, specific amplification of the desired DNA sequence occurred,
while the efficiency showed variation between primer pairs, and
between uncut and cut DNAs. In all cases, prior HpaII digestion of
the DNA sample was not absolutely required, but improved the
efficiency of amplification. In all cases, input genomic DNA was
important. In the best amplification (shown in lane 4), we
estimated at least 10.sup.11 molecules, indicating an amplification
of the approximate order 10.sup.7.
Example 8
Sensitivity of lsRPA when Targeting a Complex DNA--Human Genomic
DNA
[0403] FIG. 31 shows the results of an experiment in which several
pairs of primer were employed to amplify a specific DNA fragment
from human genomic DNA. The reaction included bacteriophage T4
gp32(C)K3A, uvsX(C) and uvsY(N) proteins, as well as an exonuclease
deficient Klenow fragment, and comprising the ATP regeneration
system to convert ADP and AMP. To detect the specific DNA fragment,
we transferred the electrophoretically separated reaction products
to nylon membrane. Then we hybridised a biotinylated probe, which
recognises a unique non-primer internal sequence.
[0404] Three primer pairs were employed and in each case a
comparison is made between no starting template and approximately
10, 100, 1000, 3000, and 10,000 copies of the genomic target. In
all cases, clear amplification was detected when at least 1000
copies of the genomic target were used (a weak signal is seen with
the best primer pair at 100 copies). We concluded that during that
lsRPA reactions configured in this way were capable of amplifying
DNA from very complex targets with a sensitivity of at least 1000
copies, and potentially higher.
Example 9
Competition Between the Accumulation of Bona Fide Product and
Primer (Template-Independent) Artifacts During Reactions
[0405] FIG. 32 shows the results of an experiment in which a pair
of primers was employed to amplify a specific DNA fragment from
human genomic DNA. Employed in the reaction were bacteriophage T4
gp32(C), uvsX(C) and uvsY(N) proteins, as well as an exonuclease
deficient Klenow fragment, and proteins comprising the ATP
regeneration system to convert ADP and AMP. PEG 1450 was included
at 10% w/v. One of the oligonucleotides included a 5'-biotin so
that all reaction products could be observed at the end of the
amplification. Samples were taken at 1, 2 and 3 hours to observe
how the reaction progressed. In one sample, when a minimal amount
of uvsY(N) was employed (50 ng/.mu.l), amplification of the correct
fragment was observed (see arrow in lane 4). This fragment was
cleaved by BstXI to the expected size fragment, indicating it was
principally double-stranded. However the fragment was less abundant
than apparently template-independent bands that also accumulated
during the reaction. The size and template-independent nature of
these bands suggested that they were primer artifacts, e.g., primer
dimers and/or snapback synthesis products. The absence of
amplification of the specific fragment suggested that, at uvsY(N)
concentrations greater than 50 ng/.mu.l, the reaction occurred
suboptimally. This was borne out by later experiments.
Example 10
Optimisation of Reaction Composition to Severely Limit or Eliminate
Primer Artifacts and Enable Sensitive Noise-Free Amplification from
Complex Templates
[0406] FIG. 36 shows the results of an experiment in which a pair
of primers was employed to amplify a specific DNA fragment from
human genomic DNA. Employed in the reaction were bacteriophage T4
gp32(C), uvsX(C) and uvsY(N) proteins, as well as an exonuclease
deficient Klenow fragment, or Bst polymerase, and proteins
comprising the ATP regeneration system to convert ADP and AMP. One
of the oligonucleotides included a 5'-biotin so that all reaction
products could be observed at the end of the amplification.
Amplified fragments were visualised following separation of
fragments by size by running a small sample of the reaction on an
acrylamide gel. In this experiment, uncut human genomic DNA was
titrated from zero copies, 45 copies, and then doublings in target
copy number up to 2880. Slightly different conditions were employed
in this experiment for each of the two polymerase species with
regard to both buffer and temperature. The reaction with the Klenow
fragment was performed at 37.degree. C., while that with Bst
polymerase was performed at 42.degree. C. The details of the buffer
composition are given in the figure description.
[0407] Of note, and important to the efficiency of reactions under
these optimised conditions, PEG compound was included at 5% final
weight to volume in both cases. Both polymerases have effectively
amplified the correct fragment, and in some cases, utilised most of
the available primers. Under the conditions used for the Klenow
fragment, the sensitivity was so great that a weak signal was
observed even in the zero copies lane presumably reflecting
contamination with a quantity of human DNA representing less than
the 45 copies present in the lane immediately adjacent. At the
level of sensitivity that is demonstrated here, it was difficult to
eliminate trace levels of contamination from the equipment that was
used leading to signals in the negative controls. Routine
employment of conditions similar to those utilised in the
Klenow-mediated amplification proved effective for noise-free
amplification of numerous primer pairs in later experiments. This
suggested that these conditions were close to one optimum for
reactions involving this set of protein components.
Example 11
Experimental Methods for Production of Clones and Proteins
[0408] All clones have been constructed by cloning PCR amplified
products from E. coli, T4 phage, B. subtilis, or Phi-29 phage. All
stock organisms used for amplification were obtained from a public
source at the DSMZ. Cloned DNA's used for protein expression have
in general been cloned into pET vectors (e.g., pET-21) with the
insertion of a hexahistidine peptide tag at either the N or C
terminus during the PCR amplification of the fragment, or into pQE
vectors (e.g., pQE31) in the case of Pol I from B. subtilis (Bsu
polymerase). In this disclosure all proteins containing an N
terminal tag are referred to as the protein name followed by (N),
e.g. gp32(N), or if containing the tag at the C terminus the name
is followed by (C), e.g. gp32(C). Additionally we have constructed
several clones to produce otherwise modified proteins. These
include a recA(C) with a deletion of the last 17 amino acid
residues of the native protein, referred to as recA(C)delta17. A
similar form of the T4 UvsX(C) protein has been generated and is
referred to as UvsX(C)delta 21. We have also constructed mutant
forms of gp32, which modify either lysine 3 or arginine4.
[0409] All proteins were overexpressed in E. coli and purified
using conventional protocols. Proteins have generally been purified
by standard procedures on Nickel resin in 1 M NaCl and phosphate
buffer. Proteins were eluted with 250 mM imidazole and dialysed
into appropriate buffers. Proteins produced from clones generated
in-house include: E. coli recA(C), E. coli SSB(N), E. coli PriA(N),
E. coli PriB, E. coli PriC, E. coli DnaB, E. coli DnaC, E. coli
DnaC810, E. coli DnaT, E. coli RuvA, E. coli RuvB, T4 phage
UvsX(C), T4 phage UvsX(N), T4 gp32(N), T4 gp32(C), T4 gp32(C)K3A,
T4 phage gp32(C)R4Q, T4 phage gp32(C)R4T, T4 phage gp32, T4 phage
gp32 K3A, T4 phage gp32R4Q, T4 phage gp32R4T, T4 phage UvsY(N), T4
phage UvsY(C), T4 phage gp43, T4 phage gp43(exo-), E. coli Klenow
fragment, E. coli Klenow exo-. Untagged gp32 proteins were purified
by a 2-column procedure involving DEAE sepharose anionic exchange
followed by binding to single-stranded DNA cellulose matrix.
[0410] DNAs Used in RPA Reactions.
[0411] We have employed several different target DNAs in this
study, and a number of oligonucleotides. The sequence of the
relevant section of the templates, and the sequence of the
oligonucleotides is given below.
[0412] The E. coli RuvB Gene Target
[0413] The sequence of the EcoRV fragment of the RuvB gene is given
below.
TABLE-US-00010 (SEQ ID NO: 1)
ATCATGATTGGTGAAGGTCCGGCGGCACGCTCCATTAAAATTGATTTGCC
GCCGTTTACCCTGATTGGTGCAACCACGCGCGCAGGTTCGCTGACATCAC
CGTTGCGCGACCGTTTTGGTATTGTGCAACGTCTGGAGTTTTATCAGGTG
CCGGATCTGCAATATATCGTCAGTCGCAGCGCACGCTTTATGGGGCTTGA
GATGAGTGATGACGGCGCGCTGGAAGTTGCTCGTCGCGCTCGCGGTACGC
CGCGCATTGCCAACCGTCTGCTGCGTCGAGTGCGTGATTTCGCCGAAGTG
AAGCACGATGGCACCATCTCGGCAGAT
[0414] The sequence of oligonucleotides targeting this template
mentioned in this study are given below:
TABLE-US-00011 Tester2 (SEQ ID NO: 2)
CTAGCGATGGTGCCATCGTACAGAATTCCCTCAGCATCTGCCGA Tester3 (SEQ ID NO: 3)
CTCACTATACCTCAGCATCATGATTGGTGAAGGTCCGGCGGCAC Tester1bio (SEQ ID NO:
4) 5'-biotin-GCTAATACGACTCACTATACCTCAGCATCATGAT
TGGTGAAGGTCCGGCGGCAC Tester3bio (SEQ ID NO: 5)
5'-biotin-CTCACTATACCTCAGCATCATGATTGGTGAAGGT CCGGCGGCAC Sizer1 (SEQ
ID: 6) CTATGCGAATTCAGCGAACCTGCGCGCGTGGTTGCACCAATCAGGG Sizer2 (SEQ
ID NO: 7) CTATGCGAATTCGGTGATGTCAGCGAACCTGCGCGCGTGGTTGCA Sizer3 (SEQ
ID NO: 8) CTATGCGAATTCTCCAGACGTTGCACAATACCAAAACGGTCGCGC Sizer4 (SEQ
ID NO: 9) CTATGCGAATTCCGTGCGCTGCGACTGACGATATATTGCAGATCC Gen2bio
(SEQ ID NO: 10) 5'-biotin-ATCTGCCGAGATGGTGCC
[0415] The sequence of part of the human angiotensin converting
enzyme targeted in this study is shown below:
TABLE-US-00012 (SEQ ID NO: 11)
AACCAACTCCGCCCCGGGCCACGGCCTCGCTCTGCTCCAGGTACTTTGTC
AGCTTCATCATCCAGTTCCAGTTCCACGAGGCACTGTGCCAGGCAGCTGG
CCACACGGGCCCCCTGCACAAGTGTGACATCTACCAGTCCAAGGAGGCCG GGCAGCGC
[0416] Underlined are HpaII restriction sites that have been
targeted with HpaII in the preparation of some DNAs in some
experiments.
[0417] The sequence of oligonucleotides used to target part of the
human ACE gene are shown below:
TABLE-US-00013 Up3 (SEQ ID NO: 12)
ATTCGTCAGCCTCGCTCTGCTCCAGGTACTTTGTCAGCTTCATC Down1 (SEQ ID NO: 13)
GCCTCCTTGGACTGGTAGATGTCACACTTGTGC Down2 (SEQ ID NO: 14)
GCGCTGCCCGGCCTCCTTGGACTGGTAGATGTCACACTTGTGC Down3 (SEQ ID NO: 15)
TATGCGAATTGCCTCCTTGGACTGGTAGATGTCACACTTGTGC Angio1bio (SEQ ID NO:
16) 5'-biotin-GCCTCCTTGGACTGGTAGATGTCACACTTGTG Angio3 (SEQ ID NO:
17) GGCCACGGCCTCGCTCTGCTCCAGGTACTTTGTCAGCTTCATC
Example 12
Experimental Results and Analysis
[0418] FIG. 9 shows the results from investigations into the nature
of double-stranded DNA targets and targeting oligonucleotides.
Experiments using either supercoiled templates or linearised DNAs
suggested that recA catalyses the formation of intermediates
capable of supporting polymerase elongation most readily on
supercoiled DNA, or the ends of linearised DNA. Shown are the
results of an experiment in which the biotinylated oligonucleotide,
Tester3bio, has been incubated with either supercoiled target DNA,
or a target template linearized with EcoRV, or ClaI. This generated
an end that overlapped with the oligonucleotide or embedded
sequences respectively. The reaction solution included 20 mM
Tris-acetate pH 7.9, 10 mM Mg-acetate, 13 .mu.g rec A, 1 .mu.g E.
coli SSB, 27 mM phosphocreatine, 1 U creatine kinase, 0.2 .mu.M
Tester3bio, 3 mM ATP, 200 .mu.M dG, dC, and dT; 1 mM dA, 50 U
Klenow, 0.5 pmoles template, 120 ng recO, 120 ng recR, 0.5 .mu.M
dnaB, and 0.5 .mu.M dnaC810. E. coli recO and recR proteins, as
well as dnaB and dnaC810 proteins, were included in this experiment
although they did not significantly affect the results. After 2
hours of reaction at 37.degree. C., the reaction was precipitated
and run on a 6% denaturing gel, transferred to nylon membrane, and
incubated with streptavidin-HRP prior to performing ECL to detect
reactive material. In each reaction, 0.5 pmoles of template was
used. Included on the gel as a control for size and amount was 0.5
pmoles of biotinylated PCR fragment (labeled CON). Other reaction
components and conditions are indicated on the figure.
[0419] FIG. 10 shows backfire synthesis. Backfire synthesis occurs
when a recombinase-coated targeting oligonucleotide possessing a 5'
overhang invades a duplex DNA end in the presence of a suitable
polymerase and dNTPs. This new duplex region is stable to
subsequent branch migration and can be utilised as a platform for
other applications. Forward fire is the elongation of the invading
oligonucleotide, which also occurs in these reactions. Shown are
the results of experiments to detect the activity of polymerases on
intermediates formed when the oligonucleotide Tester3, possessing a
5' overhang relative to the end of a linearized target DNA, is
incubated with various templates.
[0420] In part A, the template used is a double-stranded PCR
product generated such that the product has a biotin label at the
5' end of the strand complementary to the targeting
oligonucleotide. This fragment is otherwise similar to the EcoRV
fragment released from a plasmid carrying the E. coli RuvB gene
used elsewhere in this study, and which is a target for the
Tester3bio oligonucleotide. The reaction solution included 10 mM
Mg-acetate, 7.5 .mu.g recA, 1 .mu.g SSB, 27 mM phosphocreatine, 1 U
creatine kinase, 0.3 .mu.M Tester3bio, 3 mM ATP, 200 .mu.M dNTPs,
50 U Klenow, 0.5 pmoles biotinylated template. Optionally, we
included 0.5 .mu.M ruvA and 0.5 .mu.M ruvB; or 1 .mu.M ruvA and 1
.mu.M ruvB; or 1.5 .mu.M ruvA and 1.5 .mu.M ruvB. The final volume
was 30 .mu.l. Incubation was carried out for 1 hour at 37.degree.
C. In the presence of recA, the biotinylated strand of the target
was extended by 16 bases, as would be expected if a recombination
intermediate were accessible by a polymerase to copy the overhang
region of the invading oligonucleotide.
[0421] In part B, the reaction is configured in a similar manner
except that the template is not biotinylated, and the invading
oligonucleotide is biotinylated. Several polymerases were
investigated in this experiment, and only unmodified Klenow
fragment gave a significant production of product. In this
experiment, we also investigated including a small oligonucleotide
designed to recognise the target directly downstream of the Tester3
targeting site. The reaction solution included 10 mM Mg-acetate, 10
.mu.g recA, 1 .mu.g SSB, 27 mM phosphocreatine, 1 U creatine
kinase, 0.3 .mu.M Tester3bio, 3 mM ATP, 200 .mu.M dNTPs, 50 U
Klenow, 0.5 pmoles unbiotinylated template. Optionally, we included
5 .mu.l preloaded stable ATP.gamma.S oligonucleotide. The final
volume was 30 .mu.l. Incubation was carried out for 1 hour at
37.degree. C. We pre-incubated with recA in the presence of
ATP-.gamma.-S in an effort to load recombinase stably onto it.
Pre-load solution included 10 mM Mg-acetate, 2.5 .mu.g recA, 50
.mu.M ATP.gamma.S, and 0.15 .mu.M oligonucleotide. The pre-load
solution was added into the Tester3bio invasion/extension mixture.
In all cases, the yield of product was decreased by inclusion of
this premixed material. Based on our data, we believe that the
presence of ATP-.gamma.-S (final concentration .about.8 .mu.M) in
the reaction was mildly inhibitory. The purpose of this experiment
was to address whether the presence of a stable 3-stranded hybrid
formed immediately downstream of the Tester3 targeting site would
stabilise these invasions to branch migration.
[0422] FIG. 11 shows uses of backfire synthesis. Backfire synthesis
can be useful because it generates a branch migration resistant
platform that can be employed in applications other than
straightforward forward fire. Some examples are shown here,
including introduction of a nicking enzyme target site,
introduction of an RNA polymerase promoter, and the linear
generation of short dsDNA fragments through successive
invasion/synthesis/cleavage events. If a restriction enzyme site is
included in the additional overhang sequence such that after
targeting a suitable linearized fragment, backfire synthesis will
generate the duplex target for the restriction enzyme. The enzyme
can then cut the sequence releasing a short double-stranded DNA,
and a longer double-stranded DNA, which is a target for further
invasion events.
[0423] In FIG. 11B, the 5' overhang of a targeting oligonucleotide
is designed such that should backfire synthesis occur, a target for
a nicking endonuclease is generated. In the presence of the nicking
endonuclease, for example BbvC1a or b, a suitable polymerase, for
example the Klenow fragment, can extend from the nick and displace
a DNA strand. Multiple strands may be run-off by successive nicking
and elongation from a single template. In FIG. 11C, the 5' overhand
that is converted to duplex by backfire synthesis contains the
sequence of an RNA polymerase promoter, such as the phage T7 RNA
polymerase gene. In the presence of the necessary polymerase and
suitable nucleoside triphosphates, transcription can initiate
downstream of the promoter to generate an RNA as shown. The
presence of a break in the non-template strand is not predicted to
prevent successful elongation. RNA products might be used in some
form of amplification reaction, or for other purposes.
[0424] FIG. 12 shows that single stranded binding proteins
facilitate recombinase invasion and primer extension. Both E. coli
SSB and bacteriophage T4 gp32 with an N-terminal His tag (gp32(N))
are able to stimulate recA-mediated invasion/elongation on a linear
DNA template. The results of an experiment are shown in which 0.5
pmoles of target template (the EcoRV fragment released from a
plasmid carrying the E. coli ruvB gene) was incubated with the
Tester3bio oligonucleotide that overlaps one end of the template.
Either the E. coli SSB protein, or the T4 gp32(N) protein was
included to stimulate the reaction. The reaction solution included
10 mM Mg-acetate, 6 .mu.g rec A, 8.8 .mu.g gp32 or 1 .mu.g SSB, 27
mM phosphocreatine, 1 U creatine kinase, 0.3 mM Tester3bio, 3 mM
ATP, 200 .mu.M dNTPs, 50 U Klenow, 0.5 pmoles template. Optionally,
we included 120 ng recO and 120 ng recR. The final volume was 304
Incubation was carried out for 1 hour at 37.degree. C. Other
reaction components and conditions are indicated in the figure. The
figure also shows the general relationship of the primer and target
DNA. In the reactions where E. coli recO and recR proteins were
included, little effect was seen from their addition under these
conditions. Invasion and elongation appeared to have proceeded in
all cases, and the gp32(N) appeared to have stimulated synthesis
even better than E. coli SSB, although it was used at higher
concentration in this experiment.
[0425] FIG. 13 shows the requirement for a minimal oligonucleotide
length or overhang for invasion and elongation during end targeting
of linear templates. The results of an experiment are shown in
which 0.5 pmoles of target template (the EcoRV fragment released
from a plasmid carrying the E. coli ruvB gene) was incubated with
the either the Tester3bio oligonucleotide. This oligonucleotide
overlaps one end of the template, or the Gen2bio oligonucleotide,
which is flush to the other end of the template and is only 18
residues long. The reaction solution included 10 mM Mg-acetate, 27
mM phosphocreatine, 1 U creatine kinase, 0.2 .mu.M Tester3bio or
Gen2bio, 10 mM dATP, 3 mM ATP, 200 .mu.M dNTP mixture, 50 U Klenow
or Phi29 polymerase, 13 .mu.g recA(C), 1 .mu.g E. coli SSB, and 0.5
pmoles template. The final volume was 304 Incubation was carried
out for 2 hours at 37.degree. C., and 2 .mu.l or the reaction was
loaded in each lane of the gel. Other reaction components,
conditions, and the general relationship of the primers and target
DNA are indicated on the figure. Invasion and elongation appeared
to have proceeded efficiently in the presence of the Klenow
fragment, less efficiently with the Phi29 polymerase, and less well
with the Gen2bio primer and the Klenow fragment. We concluded that
a minimal primer length and/or an overhand relative to the template
was required to stimulate efficient invasion and elongation.
[0426] FIG. 14 shows paranemic (A-E) and pletonemic (F-H) joints.
For paranemic joints, the interaction of the recombinase filament
with DNA stimulates unwinding (FIG. 14A). The unwound region moves
with the homology search (FIG. 14B). The homology is found (FIG.
14C). The recombinase dissociates and a new duplex attempts to
rewind (FIG. 14D). Because it topologically restrained, the
`outgoing` strand is forced to rewind around the new duplex (FIG.
14E). This state is highly unfavorable and unstable, and cannot
always be managed by SSBs (FIG. 14E). For plectonemic joints, the
interaction of the recombinase filament with DNA stimulates
unwinding (FIG. 14F). If strand exchange overlaps with a DNA end,
the `outgoing` strand is freed and can relax as the incoming oligo
and its complement rewind as the recombinase dissociates (FIG.
14G). This forms a deconstrained product, and a single-strand DNA
binding protein inhibits branch migration (FIG. 14H).
[0427] This figure compares the likely events that occur when a
nucleoprotein filament initiates strand exchange with a homologous
sequence located at the end of a linearized duplex (right side of
figure), or within a duplex which lacks homology on either side
(left side of figure). Starting with the left side, once the
nucleoprotein filament has located the correct sequence it will
pair the searching DNA to its complement, and one strand of the
original duplex becomes unpaired. In fact, the exchange complex
consists of 3 strands, which are relatively under-wound and
stabilised by the recombinase. As the recombinase begins to
disassemble in a 5' to 3' direction, the under-wound 3-stranded
intermediate becomes unstable. For the new duplex to regain the
normal conformation of relaxed DNA, it must rotate. However, in
doing so, it must co-rotate the outgoing strand, as it is linked
upstream and downstream to its original partner. This results in
over-winding the outgoing strand, as it has to make the same number
of turns but take a longer path around the new duplex, and is
energetically unfavourable. Consequently there is a requirement for
single-stranded binding proteins with very stable DNA interactions
to permit such structures to exist for any significant time.
Alternatively the right side of the diagram indicates that should
the exchange include an end of the duplex then exchange can cause
the complete release of the outgoing strand at one end and thus
permit it to rotate freely unconstrained by the other strands
involved in recombination. This leads to a stable situation in
which the new duplex is free to rewind after recombinase
disassembly, and single-stranded DNA binding proteins need only
deter spontaneous branch migration.
[0428] FIG. 15 shows the effect of crowding agents. In the presence
of polyethylene glycols, gp32(N) and recA recombinase can mediate
multiple invasion events on single templates without a requirement
for regeneration of the template ends that would permit 5'
overhangs in the targeting oligonucleotide. FIG. 15A shows the
results of an experiment in which either the Tester1bio, or
Tester3bio oligonucleotides (which differ in the length of 5'
overhang relative to the template) were incubated with the EcoRV
fragment released from a plasmid carrying the E. coli ruvB gene, or
the ClaI digest of the plasmid, in the presence or absence of 10%
PEG 8000. The reaction solution included 10 mM Mg-acetate, 10.6
.mu.g recA, 8.8 .mu.g gp32, 27 mM phosphocreatine, 1 U creatine
kinase, 0.3 mM Tester3bio or Tester1bio, 3 mM ATP, 200 .mu.M dNTP
mixture, 50 U Klenow, and 0.5 pmoles template (species indicated in
figure). Optionally, we included 120 ng recO and 120 ng recR.
PEG8000 was included as shown. The final volume was 30 .mu.l.
Incubation was carried out for 1 hour at 37.degree. C.
[0429] The diagram shown represents the relationship of the
oligonucleotides to the two possible templates. In particular, both
oligonucleotides recognised an embedded sequence within the ClaI
fragment. In each case, 0.5 pmoles of template was used, other
conditions were carried out as indicated. Both primers stimulated
invasion/elongation on the EcoRV template. Based on signal
intensity, approximately one elongation occurred per target
template. However, in the presence of 10% PEG 8000, the intensity
of the fully elongated fragment was significantly greater than in
its absence and stronger than the 0.5 pmoles of control
biotinylated PCR product. The strongest signal was seen with the
Tester3bio oligonucleotide. In that case, we estimated at least 10
invasion/run-ons occurred per template.
[0430] In FIG. 15B, we compared the stimulation of
invasion/elongation in 10% w/v of various commercially available
polyethylene glycols. The reaction solution included 10 mM
Mg-acetate, 10.6 .mu.g recA, 8.8 .mu.g gp32, 27 mM phosphocreatine,
1 U creatine kinase, 0.3 mM Tester3bio or Tester1bio, 3 mM ATP, 200
.mu.M dNTPs, 50 U Klenow, and 0.5 pmoles RV template. PEG species
were included as shown. There was significant variation observed in
the degree of stimulation. PEG compound (MW=15,000 to 20,000)
appeared to be the most effective, followed by PEG1450.
[0431] FIG. 16 shows the effect of end targeted amplification using
leading strand RPA. Amplification comprising several rounds of
invasion and extension was demonstrated, achieving at least a 10
fold amplification from 0.05 pmoles of template. In this
experiment, we have employed pairs of oligonucleotide primers to
establish an amplification reaction. Shown schematically is the
relationship of the oligonucleotides used to the EcoRV fragment
from a plasmid carrying the E. coli ruvB gene, which was used as
template. The reaction solution included 10 mM Mg-acetate, 6 .mu.g
recA, 8.8 .mu.g gp32(N), 27 mM phosphocreatine, 1 U creatine
kinase, 0.3 mM Tester3bio, 0.3 mM variable oligonucleotide, 3 mM
ATP, 200 .mu.M dNTPs, 10% PEG compound, 50 U Klenow, and 0.5 pmoles
template. Additional proteins were used as indicated.
[0432] Tester3bio included a 16-nucleotide overhang relative to the
starting template, while Tester2 included a 21-nucleotide overhang
and was targeted to the other end of the template. Phosphol was
used as an oligonucleotide with a phosphorothiorate backbone. This
oligonucleotide was 15 residues long, and was flush to the target
end. Phospho-1 was predicted not to interact with recombinase or
single-stranded DNA binding protein as it lacked a phosphate
backbone. However, it was predicted to function in straightforward
solution hybridisation. A control fragment of biotinylated PCR
product was employed to demonstrate the signal intensity of 0.5
pmoles of DNA, and was also the precise size of the starting
template. The reaction products were run on a 6% denaturing gel,
transferred to nylon, and bound with streptavidin-HRP prior to
performing enhanced chemiluminescence to reveal the biotinylated
products of the reactions.
[0433] In all cases, successful invasion and elongation with the
biotinylated Tester3bio has occurred as seen by presence of fully
elongated products. The products were slightly slower mobility that
the control, due to the presence of overhangs on the
oligonucleotides. Furthermore, there was evidence for several
rounds of invasion/run-ons as the signal intensity was at least as
great as the 0.5 pmoles control (we initiated the reaction with
only 0.05 pmoles). There was a significant accumulation of a
product roughly 37 nucleotides larger than the control. This was
predicted to arise from Tester3bio elongating on a strand
previously copied from, and including the overhang from, the
opposing primer. Two exposures of the same gel are shown.
[0434] The inclusion of various different proteins, which are
normally involved in DNA metabolism, had varying effects. DNA
gyrase, and toposiomerase I (human) decreased the yield of
amplification product, and the topoisomerase profoundly reduced the
generation of shorter elongation products. Inclusion of E. coli
ruvA and ruvB also lead to a general reduction in product
formation. E. coli priA increased the amount of product formed, and
significantly increased the number of shorter products formed.
Inclusion of E. coli dnaB and dnaC810 protein slightly increased
the amount of product formed. Note that a significantly stronger
signal detected in reactions containing Phospho-1 oligonucleotide
in comparison to Tester3bio alone. This suggested that Phospho-1
was able to hybridise with displaced strands and lead to formation
of duplex DNA.
[0435] FIG. 17 shows leading strand RPA and Klenow processivity. In
this experiment, we have employed pairs of oligonucleotide primers
in an effort to establish an amplification reaction in a manner
similar to that shown in FIG. 16, except using a further 100-fold
dilution of the start template. The reaction solution included 10
mM Mg-acetate, 6 or 12 .mu.g recA, 8.8 or 14.3 .mu.g gp32, 27 mM
phosphocreatine, 1 U creatine kinase, 0.3 or 0.9 .mu.M Tester3bio,
0.3 or 0.9 .mu.M Tester2, 3 mM ATP, 200 .mu.M dNTPs, 10% PEG
compound, 50 U Klenow, and 0.5 pmoles template. The final volume
was 30 .mu.l. Incubation was carried out for 2 hours at 37.degree.
C. Shown schematically is the relationship of the oligonucleotides
used to an EcoRV fragment from a plasmid carrying the E. coli ruvB
gene, which is used as target template. Tester3bio included a
16-nucleotide overhang relative to the starting template, while
Tester2 included a 21-nucleotide overhang, is targeted to the other
end of the template, and encodes an EcoRI site within the overhang.
A control fragment of biotinylated PCR product was employed to
demonstrate the signal intensity of 0.5 pmoles of DNA, and was also
the precise size of the starting template. The reaction products
were run on a 6% denaturing gel, transferred to nylon, and bound
with streptavidin-HRP prior to performing enhanced
chemiluminescence to reveal the biotinylated products of the
reactions.
[0436] The concentration of the oligonucleotides, gp32(N) and the
recA(C) were varied, and we have also investigated whether the
inclusion of EcoRI restriction enzyme, which can cleave part of the
additional sequence incorporated by the Tester2 overhang, has any
effect on the reaction. In most cases, there was evidence of some
limited degree of amplification of the expected size of fragment,
but there was principally generation of shorter DNA fragments. We
deduced that the relatively poor accumulation of bona fide full
length product may occur at these more dilute template
concentrations because the poor processivity of the E. coli DNA
polymerase I Klenow fragment (10-50 nucleotides) results in most
interactions generating short fragments, which is more significant
at low target template concentrations.
[0437] FIG. 18 shows spacing dependence of RPA primers. As a
consequence of earlier results, we attempted to establish whether
decreasing the distance between primer pairs would result in an
increase in amplification efficiency. To test this, we employed a
series of oligonucleotides, Sizer1, 2, 3, and 4, which were
positioned at increasing distances away from the 3' end of the
Tester3bio oligonucleotide. All Sizer oligonucleotides included the
EcoRI overhang indicated in the bottom right side of the figure.
The sequence of the target DNA, an EcoRV fragment from a plasmid
carrying the E. coli ruvB gene, and the position of the
oligonucleotides used are shown. The reaction solution included 10
mM Mg-acetate, 6 .mu.g recA, 8.8 .mu.g gp32, 27 mM phosphocreatine,
1 U creatine kinase, 0.3 .mu.M Tester3bio, 0.3 .mu.M variable
oligonucleotide, 3 mM ATP, 200 .mu.M dNTPs, 10% PEG compound, 50 U
Klenow, 5 U EcoRI, and 0.5 pmoles template. The final volume was 30
.mu.l. The reaction solution was incubated for 2 hours at
37.degree. C. Other reactions conditions are indicated on the
figure.
[0438] A control fragment of biotinylated PCR product was employed
to demonstrate the signal intensity of 0.5 pmoles of DNA, and was
also the precise size of the starting template. The reaction
products were run on a 6% denaturing gel, transferred to nylon, and
bound with streptavidin-HRP prior to performing enhanced
chemiluminescence to reveal the biotinylated products of the
reactions. Specific fragments of the expected lengths were
efficiently amplified from 0.5 fmoles of starting template when
Sizer2, 3, and 4 were employed. The yield of product decreased
somewhat however as the length of the product increased. Little or
no product of the expected size is produced when Sizer1 was used.
Lane 4 was estimated to contain .about.4.times.10.sup.4 fold
amplification. This primer included the shortest
inter-oligonucleotide distance of only 25 nucleotides. This
suggested there is a minimal required distance to separate the ends
of the oligonucleotides, although other explanations such as poor
primer behaviour could also explain the result. Included in the
experiment were several samples containing no template DNA. In the
case of Sizer2, a faint band of approximately the expected size is
observed even in the absence of exogenous DNA. Based on a variety
of data we believe that this arises from contamination of our
protein preparations with significant quantities of E. coli genomic
DNA.
[0439] FIG. 19 shows that RPA products are largely double stranded.
RPA reaction can generate double-stranded DNA products as evidenced
by agarose gel electrophoresis and restriction enzyme cleavage.
However, under the conditions used here, there were significant
decreases in reaction efficiency if the starting template dropped
significantly below 0.5 fmoles. Furthermore, signals observed in
the water-only control suggested significant genomic contamination
of E. coli DNA. In this experiment we have incubated 0.5 fmoles, or
more dilute quantities, of the fragment detailed in FIG. 10 with
Tester3bio and Sizer2 under the conditions indicated. The reaction
solution included 10 mM Mg-acetate, 6 .mu.g recA, 8.8 .mu.g gp32,
27 mM phosphocreatine, 1 U creatine kinase, 0.3 .mu.M Tester3bio,
0.3 .mu.M Sizer2, 3 mM ATP, 200 .mu.M dNTPs, 10% PEG compound, 50 U
Klenow, and 0.5 pmoles template or dilution indicated in figure.
The final volume was 30 .mu.l.
[0440] We have included a no DNA control, progressive dilution of
the template, and investigated initiating the reaction on embedded
template (the ClaI fragment detailed on FIGS. 1 and 7), of using
PEG 1450, and diluting the Klenow fragment. A fraction ( 1/10) of
the reaction products were run on a 6% denaturing gel, transferred
to nylon, and bound with streptavidin-HRP prior to performing
enhanced chemiluminescence to reveal the biotinylated products of
the reactions (FIG. 19A). A further fraction ( 3/10) was phenol
extracted, precipitated, and run on a 2% agarose gel and stained
with ethidium bromide (FIG. 19B). A final fraction ( 3/10) was cut
with BbvC1 and electrophoresed on a 2% agarose gel alongside
equivalent uncut DNA (FIG. 19C).
[0441] Lane 2 (FIG. 19A) was estimated to contain 5.times.10.sup.4
fold amplification, which corresponded to 10.sup.13 molecules of
final product. In the presence of 0.5 fmoles of starting template,
an extremely robust amplification of the expected size fragment was
seen as evidenced by denaturing gel electrophoresis. Furthermore,
when part of the sample was electrophoresed on agarose a strong
clean band of precisely the correct size for a double-stranded DNA
product was observed. This product could be cut by BbvC1 to yield a
slightly smaller fragment of the expected size. Dilution of the
template by 100-fold or more resulted in a significantly less
intense band, and a much larger quantity of fragments shorter than
the expected length. This was determined by denaturing gel
electrophoresis and by agarose gel electrophoresis. A similar
pattern was observed when ClaI cut DNA was used, or if no DNA was
used. We believe that when less than a threshold quantity of DNA is
used under these conditions, there is a suboptimal amplification
reaction, which leads to heterogeneous products, and furthermore
that our samples are highly contaminated with E. coli genomic DNA
from the single-step purification procedures used in generating our
recombinant proteins used here.
[0442] FIG. 20 shows activity of a recA C-terminal truncation
mutant. RecA proteins with a deletion of the C-terminal acidic
peptide (recA(C)A) are active in promoting strand exchange and
extension in a linear template run-on assay. However, there was
some suggestion that the optimal protein concentration was lower
than that with the recA(C) protein. This experiment addresses
whether a C terminal truncated form of the E. coli recA protein,
described elsewhere, could be used successfully in
invasion/extension reactions. Shown is the result of a single-sided
run-on assay using either the E. coli recA(C) protein or the E.
coli recAA17(C) protein, which lacks the 17 C-terminal acidic
residues. The relationship between primers and template and other
experimental conditions are indicated. The reaction solution
included 10 mM Mg-acetate, 27 mM phosphocreatine, 1 U creatine
kinase, 0.3 .mu.M Tester3bio, 3 mM ATP, 200 .mu.M dNTPs, 50 U
Klenow, 0.5 pmoles RV template, and recA species and amount as
indicated in figure. PEG was included as shown. The final volume
was 30 .mu.l. The solution was incubated for 2 hours at 37.degree.
C. Reactions were performed with or without 10% PEG1450, and with
the indicated quantities of the respective recombinase. Both
recombinases successfully supported invasion/extension, although
under the conditions used here there appears to be a different
optimum for the amount of protein required.
[0443] FIG. 21 shows Modified gp32 proteins. Shown is a schematic
representation of T4 gp32 proteins used in this study and the
position of various modification and mutations.
[0444] FIG. 22 shows activity of gp32 proteins. Significant
variations confirm that gp32 cooperativity has a substantial effect
on the rate of invasion/extension reactions, and further confirms
that gp32(N) displays a significant decrease in cooperativity
consistent with interference with the function of the N-terminal B
domain. Shown are the results of an experiment in which linear
run-ons were generated using as template the EcoRV fragment of a
plasmid carrying the E. coli RuvB gene and the Tester3bio
oligonucleotide. The reaction solution included 10 mM Mg-acetate,
27 mM phosphocreatine, 100 ng/.mu.l creatine kinase, 400 nM
Tester3bio, 3 mM ATP, 200 .mu.M dNTPs, 10 U chicken myokinase, 8
.mu.g C-tag uvsX, 7.5 or 15 .mu.g gp32 (each species), 50 U Klenow,
and 0.5 pmoles template; no PEG was included. The final volume was
30 .mu.l. The solution was incubated for 2 hours at 37.degree. C.
Reactions contained uvsX(C) and various gp32 forms as indicated.
Two concentrations of each gp32 form were used in this experiment.
To analyze the reaction products, 2 .mu.l of the total volume (30
.mu.l) was loaded onto the gel.
[0445] In all cases, elongated products of the oligonucleotide were
generated that extend up to a length consistent with full length
run-ons. We note that in this experiment there was a gel artifact
which we occasionally observed. We observed a slower mobility
shadow of the bands. This was seen in the PCR control fragment
lane, also. The smallest quantity of product was formed when using
the gp32(C) protein, which was consistent with it permitting only a
low level of recombinase-loaded filaments to be present in the
reaction. A smaller quantity of product was formed with 15 .mu.g
compared with 7.5 .mu.g, consistent with the notion that higher
concentrations decreased the efficiency of recombinase loading.
[0446] The gp32(C)K3A protein was predicted to be the next most
cooperative form. Consistent with this, it produced a limited
number of full-length products when 15 .mu.g of protein is used.
However, the number of run-ons was greater than that observed with
either quantity of gp32(C), indicating that there were more
recombinase-loaded filaments in the reaction and a higher rate of
invasion/elongation. When 7.5 mg of gp32(C)K3A was used, there was
a dramatic change in the quantity of product formed. One
explanation is that an increased rate of invasion/elongation in
this reaction could lead to the out-titration of the gp32(C)K3A by
single-stranded DNA run-offs. Under these conditions, most of the
oligonucleotide would become coated with uvsX(C), leading to a high
invasion rate and to an inability to stabilise the outgoing strand
and coat it with gp32. This would result in shorter truncated
products, some of which would be folded back on themselves,
self-primed, and formed into a variety of other such products. This
suggested that the rate of invasion/elongation of gp32(C)K3A was
notably higher for this protein than gp32(C).
[0447] By comparing the intensities of the products produced when
using 15 .mu.g of each protein, we estimated that reactions
containing gp32(C)K3A have an invasion/elongation rate of
approximately 10 times that of gp32(C). All of the other gp32
proteins tested in this experiment produced a pattern similar to
that seen when gp32(C)K3A was employed and large amounts of
product. This was the case even when 15 .mu.g of the relevant
protein was employed, suggesting that they all exhibited lower
cooperativity than either gp32(C) or gp32(C)K3A. Notably, however,
both gp32(N) and gp32(C)R4T produced significantly less product
when only 7.5 .mu.g of protein was used when compared with 15
.mu.g. This contrasted to the situation with the other proteins. On
this basis, we suggest that gp32(N) and gp32(C)R4T possess a
similar degree of cooperativity. An earlier study has suggested
that gp32K3A and gp32R4Q are of similar cooperativity. However, our
data would suggest that gp32(C)R4Q lies somewhere between
gp32(C)K3A and gp32(C)R4T with regard to its behaviour in
supporting invasion/synthesis.
[0448] FIG. 23 shows invasion and extension using uvsX. This
experiment addresses whether a C terminal truncated form of the
bacteriophage T4 uvsX protein could be used successfully in
invasion/extension reactions. Shown are the results of single-sided
run-on assays using either the uvsX(C) protein or the
uvsX.DELTA.21(C) protein which lacks the 21 C-terminal acidic
residues. The reaction solution included 10 mM Mg-acetate, 27 mM
phosphocreatine, 1 U creatine kinase, 0.4 .mu.M Tester3bio, 3 mM
ATP, 200 .mu.M dNTPs, 50 U Klenow, 1 U chicken myokinase, uvsX(C)
or uvsX.DELTA.21(C), 8.8 .mu.g gp32(N), and 0.5 pmoles RV template.
The final volume was 30 .mu.l. The solution was incubated for 2
hours at 37.degree. C., and 2 .mu.l or reaction mixture was loaded
onto each lane of the gel. The relationship of the template and
oligonucleotides and other experimental conditions are indicated in
the figure. Reactions were performed with the indicated quantities
of the respective recombinase.
[0449] Both recombinases successfully supported invasion/extension.
However, under the conditions used here, there appears to be a
different optimum for the amount of protein required. In the case
of uvsX(C), the rate of invasion/extension increased progressively
with the concentration of protein within the range tested. However
for the uvsX.DELTA.21(C) protein, the rate was inhibited at higher
concentration and the overall level of product production was lower
under these conditions. In contrast to recA-mediated
invasion/extension in similar reactions, uvsX(C), appeared to
stimulate multiple invasion/extension events without the need for
the addition of polyethylene glycol.
[0450] FIG. 24 shows RPA using uvsX(C). In this experiment, uvsX(C)
has been combined with gp32(N) in the presence of the
oligonucleotides Tester3bio and Sizer2. The template DNA in this
experiment was the EcoRV digested plasmid carrying the E. coli ruvB
gene used in Example 1. The reaction solution included 10 mM
Mg-acetate, 27 mM phosphocreatine, 100 ng/.mu.l creatine kinase,
400 nM Tester3bio, 400 nM Sizer2, 3 mM ATP, 200 .mu.M dNTPs, 50 U
Klenow fragment, 10 U chicken myokinase, 10 .mu.g (1.times.) or 20
.mu.g (2.times.)C-tag uvsX, 8.8 .mu.g gp32(N). Optionally, we
included 0.2 mM ADP.beta.S, 10 .mu.g E. coli topoisomerase I, 10%
PEG 1450, and 10 .mu.g uvsX.DELTA.21(C). Tester3bio recognised one
end of an approximately 300 base pair fragment and included a 5'
overhang relative to the end of the target. Sizer2 recognised the
other strand of this template and was directed toward an embedded
sequence such that its 3' end is about three and a half helical
turns from the end of Tester3bio.
[0451] In the presence of PEG1450, we observed the amplification of
the expected fragment within 2 hours. In the cases where
amplification occurred, almost the entire of population of
oligonucleotides was consumed indicating an amplification of
3-5.times.10.sup.4. The reaction components are indicated. Included
in some samples are additional components. We found that 200 .mu.M
ADP-.beta.-S slightly increased the amount of product generated
under these conditions. Conversely under the conditions used here,
addition of E. coli toposiomerase I inhibited amplification. Under
the conditions used, we detected no amplification with
uvsX.DELTA.21(C) protein. However, no PEG1450 was included in these
samples, and uvsX(C) did not amplify either under these conditions
without PEG1450.
[0452] FIG. 25 shows wild-type versus modified gp32. The variant
uvsX(C) protein was determined to be qualitatively different to
native untagged gp32. The reaction solution included 10 mM
Mg-acetate, 27 mM phosphocreatine, 100 ng/.mu.l creatine kinase,
300 nM Tester3bio, 300 nM Sizer2, 3 mM ATP, 200 .mu.M dNTPs, 50 U
Klenow fragment, 10 U chicken myokinase, 300 ng/.mu.l uvsX(C), 300
ng/ml gp32 (untagged) or 100, 200, 300, 400, 500, or 600 ng/ml
gp32(C), and PEG as indicated. The reaction was incubated for 2
hours at 37.degree. C. A comparison is shown between amplification
reactions performed in the presence of untagged gp32 and a
titration of gp32(C), either in the presence or absence of PEG1450.
We observed that PEG was required in the reaction for gp32(C) to
function, while this is not the case for untagged gp32. However,
PEG significantly increased the quantity of product formed during
the reaction period in either case. Even in the presence of PEG,
untagged gp32 consistently appeared to generate slightly more
product than gp32(C) at each point on the titration curve.
[0453] FIG. 26 shows titration of gp32 and effect of uvsY.
Titration of gp32 revealed a requirement for a minimal quantity of
gp32, and a requirement for uvsY(N) protein when untagged gp32 was
employed. In FIG. 26A, the results of an experiment are shown
demonstrating that when untagged gp32 was used, uvsY(N) protein was
required for amplification. The reaction solution included 10 mM
Mg-acetate, 27 mM phosphocreatine, 100 ng/.mu.l creatine kinase,
300 nM Tester3bio, 300 nM Sizer2, 3 mM ATP, 200 .mu.M dNTPs, 10%
PEG1450, 50 U Klenow fragment, 10 U chicken myokinase, 300 ng/.mu.l
uvsX(C), 300 ng/.mu.l gp32 (untagged), and uvsY(N) as indicated in
the figure. The solution was incubated for 2 hours at 37.degree. C.
The uvs(Y) protein operated over a range of concentrations shown
here (50 to 300 ng/.mu.l). Other experiments demonstrated that
higher quantities inhibited the reaction. Thus, an optimum must be
established for any given reaction (probably between 5 and 50
ng/.mu.l).
[0454] FIG. 26B shows the results of titrating the untagged gp32
protein in the presence or absence of uvsY(N). The reaction
solution included 10 mM Mg-acetate, 27 mM phosphocreatine, 100
ng/.mu.l creatine kinase, 300 nM Tester3bio, 300 nM Sizer2, 3 mM
ATP, 200 .mu.M dNTPs, 10% PEG1450, 10 U chicken myokinase, 750
ng/.mu.l uvsX(C), 300 ng/.mu.l gp32 (untagged), and 300 ng/.mu.l
uvsY(N). The solution was incubated for 2 hours at 37.degree. C.
Once again, there is a requirement for uvsY(N) to achieve
amplification. Additionally, this experiment demonstrates a need
for a minimal amount of gp32. In this experiment, varying the gp32
concentrations between 80 and 160 ng/.mu.l gp32 resulted in a sharp
transition from no amplification to efficient amplification. A
simple analysis of known binding site size for gp32, the length of
the oligonucleotides, and their concentration, suggested that this
rise in concentration would represent a transition from
substoichiometric levels of gp32 for the primer, to saturating
levels. Consequently, the simplest interpretation is that gp32
saturates the oligonucleotides in order to have excess gp32 in the
reaction to collect and stabilise the outgoing strand.
[0455] FIG. 27 shows factors affecting reaction rate and noise.
High gp32 cooperativity inhibits recombinase filament formation
(FIG. 27A). In addition, uvsY acts to increase recombinase loading
in an unfavorable gp32 environment (FIG. 27B). PEG aids the
function of cooperatively-disabled gp32 (FIG. 27C). The reaction
rate is influenced by both recombinase activity and effectiveness
of gp32 (FIG. 27D). Post-invasion phases are enhanced in the
presence of cooperative gp32 (FIG. 27E). Cooperative gp32 is more
effective at silencing reaction noise (FIG. 27F).
[0456] The predicted effects and interactions of gp32, uvsX, uvsY,
and PEG were suggested, with the conclusion that an optimal balance
between reaction rate and noise must be reached. The degree of
cooperativity of gp32 is indicated across the top of the figure.
High cooperativity favoured efficient binding to single-stranded
DNA, which prevented significant reaction noise by inhibiting
undesirable priming behaviour. High cooperativity also favoured
stabilisation of the outgoing strand during recombination and DNA
synthesis. Conversely highly cooperative gp32 reduced the abundance
of recombinase-loaded searching filaments, and can affect reaction
rate considerably.
[0457] This behaviour could be partly overcome by including uvsY in
the reaction. However, whether this could achieve as high a loading
rate as desired is yet to be determined One could employ modified
gp32 proteins that are less cooperative. Also, the cooperativity of
gp32 proteins and uvsX proteins can be affected by the inclusion of
PEGs. PEG may also have beneficial, or sometimes detrimental,
consequences on other components of the reaction such as DNA
hybridisation behaviour and polymerase processivity. Optimal rate
may be acquired at some position away from either extreme, as
indicated, as a balance between recombinase loading and gp32
function may need to be reached.
[0458] FIG. 28 shows the effects of PEG. PEG was able to reduce the
average length of linear invasion/run-on products in uvsX-mediated
linear run-on experiment in the presence of gp32(C). Shown are the
results of a linear run-on experiment utilising the Tester3bio
oligonucleotide targeted to the end of the approximately 300 base
pair EcoRV fragment of E. coli RuvB. This fragment was used
throughout the disclosed experiments and is depicted schematically
on the right of the figure. Reaction were reconstituted with 8 mg
of UvsX(C) in a final reaction volume of 30 ml, in the presence of
gp32(C), and in some cases, varying amounts of UvsY(N) or UvsY(C).
The reaction solution included 10 mM Mg-acetate, 27 mM
phosphocreatine, 1 U creatine kinase, 0.4 .mu.M Tester3bio, 3 mM
ATP, 200 .mu.M dNTPs, 50 U Klenow fragment, 1 U chicken myokinase,
8 .mu.g uvsX(C), 7.5 .mu.g gp32(C) or 8.8 .mu.g gp32(N), and 0.5
pmoles template. The final volume was 30 .mu.l. The solution was
incubated for 2 hours at 37.degree. C., and 2 .mu.l of the solution
was loaded in each lane.
[0459] In the absence of PEG, multiple invasion/run-on cycles
appear to have occurred on each template, and there was generation
of a significant amount full-length product. However, an even
greater amount of slightly shorter fragment was produced, which we
believe constitute slightly shorter run-ons which may have folded
back on themselves and synthesised a short hairpin. We interpreted
all bands not full-length as resulting from some form of bona fide
invasion/extension reaction that has not achieved full extension.
Both UvsY(N) and UvsY(C) stimulate the quantity of product formed
to some extent. In the case of no PEG, UvsY(C) seems to be more
effective than UvsY(C). This is in contrast to other geometric
amplification data we generated, suggesting that only UvsY(N)
supported efficient geometric amplification.
[0460] Most notably, the inclusion of PEG, in contradiction to
findings with E. coli recA, seemed to decrease the overall amount
of product on this gel. It also decreased the average length
distribution of products. In order to explain this, we suggest that
under these conditions the cooperativity of gp32(C), perhaps
already at a maximum, cannot be increased by PEG whilst that of
UvsX can be. Thus, relatively hyperactive UvsX behaviour results in
rapid loading onto the outgoing stand, reinvasion, and efficient
`bubble migration` which chases the newly synthesised strand and
displaces it more readily. Consequently, the average product length
is significantly reduced.
[0461] FIG. 29 shows DNA end directed invasion. The first round of
invasion/synthesis using end-targeting and oligonucleotide overhang
is illustrated (FIG. 29A). Additional .about.10 to 15 residues (5'
end) and .about.30 residues (3' end) approximate the minimal
requirement for strand exchange (FIG. 29B). Invasion occurs,
followed by release of the deconstrained outgoing strand, and
backfire synthesis (FIG. 29C). Most nucleoprotein filaments that
are coated enough to complete strand exchange will catalyze
complete and deconstrained release of the outgoing strand (FIG.
29D). Subsequent rounds of invasion/synthesis occur (FIG. 29E). Few
or no nucleoprotein filaments can exchange to the end of the target
(FIG. 29F). One or no gp32 molecules are provided (FIG. 29G).
Following this is recombinase loading (FIG. 29H) and branch
migration (FIG. 29I).
[0462] This figure describes how targeting oligonucleotides
initially possessing an overhang relative to a linear target
template might behave during the first and then subsequent attempts
to carry out strand exchange. The purpose of this model is to
rationalise data suggesting that when such a situation in
reconstituted experimentally, there is a significant difference
between the first and subsequent invasions. The top of the figure
depicts recombinase loaded oligonucleotide filaments, displaying
different 5' extents of coverage. The 5 to 3' directional assembly
means that most should have coating to the very 3' end. As depicted
in the figure, the oligonucleotides all possess a 5' overhang
relative to the initial target.
[0463] The first invasion event is likely to result in complete
release of the outgoing strand as there is a significant likelihood
that recombinase will coat the searching oligonucleotide to a
further 5' extent than the sequence that will be involved in the
strand exchange. Once the outgoing strand is freed, it is
topologically unconstrained and can be easily stabilised by
single-stranded DNA binding proteins, presumably even those with
relatively poor cooperativity. Furthermore, stability is also
generated by polymerases extending the 3' end of the duplex DNA to
generate the complement to the very 5' end of the targeting
oligonucleotide. We refer to this synthesis as backfire synthesis.
As a consequence of backfire synthesis any subsequent invasion will
be flush with the extended template.
[0464] Under these circumstances, most oligonucleotides are not
completely coated with recombinase to their very 5' ends. In some
cases, there may be one or more gp32 molecules coating the 5' part
of the oligonucleotide. When these oligonucleotides perform strand
exchange on the now extended target, the outgoing strand is
unlikely to be immediately freed. As a consequence, the event
initially resembles the topologically constrained event already
depicted in FIG. 6. The model suggests that only if, the
cooperativity of the single-stranded DNA binding protein is
sufficient will these strained unstable intermediates be able to
exist for some limited period. In the bottom part of the figure, we
explore what might occur to these unstable intermediates.
[0465] In scenario 1, the unexchanged 5' extent of the
oligonucleotide undergoes branch migration with the equivalent
duplex portion of the target. This could easily lead to complete
dissociation of this part of the outgoing strand which would then
rapidly rotate to release any stress and be stabilised by
single-stranded DNA binding proteins as occurred in the first
invasion. These now stable substrates will be ideal and relatively
stable assemblies for polymerase elongation. Alternatively, in
scenario 2, the single-stranded DNA binding protein disassembles
from the outgoing strand and branch migration proceeds in the
opposite direction to that in scenario 1, so that the invading DNA
is ejected. In scenario 3, the outgoing strand becomes coated with
recombinase and re-invades leading to ejection of the
oligonucleotide. This process resembles a process described
elsewhere as bubble migration. If recombinase loads onto the freed
outgoing strand in scenario 1 then bubble migration could also
occur. We have experimental data that is most easily reconciled by
considering the existence of bubble migration as shown in FIG.
28.
[0466] FIG. 30 shows RPA in a complex sample. In this experiment we
have examined the sensitivity of RPA, and need for a DNA-end, in an
RPA reaction on a complex DNA target. A schematic representation is
given of the DNA sequence, which corresponds to part of the human
angiotensin converting enzyme (ACE) gene. Three different
combinations of primers were used. The experiment used a mixture of
uvsX(C), uvsY(N), and gp32(C)K3A. The reaction solution included 10
mM Mg-acetate, 27 mM phosphocreatine, 100 ng/.mu.l creatine kinase;
300 nM Up3 primer; 300 nM Down1, 2, or 3 primer; 3 mM ATP, 200
.mu.M dNTPs, 10% PEG1450, 50 U Klenow fragment, 10 U chicken
myokinase, 300 ng/.mu.l uvsX(C), 300 ng/.mu.l gp32(C)K3A, and 50
ng/.mu.l uvsY(N). The final volume was 30 .mu.l. The solution was
incubated for 5 hours at 37.degree. C. Reaction products were
electrophoretically separated on an acrylamide gel, transferred to
a nylon membrane, and probed with a biotinylated oligonucleotide
recognising a unique internal sequence.
[0467] For the RPA reaction, uncut template (genomic DNA) and cut
template were compared, and primer pairs were compared. A fragment
of the expected size was detected. In all cases, there was no
specific product when no genomic DNA is added to the reaction, but
a specific product was generated when DNA (equivalent to roughly
10,000 copies of any sequence) was added. Digestion of the DNA
prior to RPA with HpaII resulted in the generation of at least one
end overlapping with one of the oligonucleotides, and an increase
in signal strength. However, there was not an absolute requirement
for HpaII digestion for RPA to occur.
[0468] FIG. 31 shows RPA sensitivity. In this experiment, we have
examined the sensitivity in an RPA reaction on a complex DNA
target. A schematic representation is given of the DNA sequence,
which corresponds to part of the human angiotensin converting
enzyme (ACE) gene. Three different combinations of primers were
used. The experiment used a mixture of uvsX(C), uvsY(N), and
gp32(C)K3A. The reaction solution included 10 mM Mg-acetate, 27 mM
phosphocreatine, 100 ng/.mu.l creatine kinase; 300 nM Up3 primer;
300 nM Down1, 2, or 3 primer; 3 mM ATP, 200 .mu.M dNTPs, 10%
PEG1450, 50 U Klenow fragment, 10 U chicken myokinase, 300 ng/.mu.l
uvsX(C), 300 ng/.mu.l gp32(C)K3A, and 50 ng/.mu.l uvsY(N). The
final volume was 30 .mu.l. The solution was incubated for 5 hours
at 37.degree. C., and probe ACE-hyb was used. Reaction products
were electrophoretically separated on an acrylamide gel,
transferred to a nylon membrane, and probed with a biotinylated
oligonucleotide recognising a unique internal sequence. A fragment
of the expected size was detected. In all cases, there was no
specific product when no genomic DNA is added to the reaction, but
a specific product was generated when sufficient DNA was added. In
all cases, 1000 copies were sufficient to generate a significant
signal, and in one case we could detect a very faint signal at 100
copies.
[0469] FIG. 32 shows RPA sensitivity and template independent
artifacts. The results of an experiment are shown in which we have
investigated the sensitivity in an RPA reaction on a complex DNA
target. A schematic representation is given of the DNA sequence,
which corresponds to part of the human angiotensin converting
enzyme (ACE) gene. A time course of the amplification was performed
taking reaction samples at 1, 2 and 3 hours. Reaction products were
detected by virtue of the presence of a biotin residues attached to
the 5' end of one of the oligonucleotides used in the
amplification. In this way, it was possible to visualise all the
reaction products involving this oligonucleotide, including any
artifacts that might arise. We tested several different
concentrations of the uvsY(N) protein. The reaction solution
included 10 mM Mg-acetate, 27 mM phosphocreatine, 100 ng/.mu.l
creatine kinase; 300 nM Up3 primer; 300 nM Down1 primer; 3 mM ATP,
200 .mu.M dNTPs, 10% PEG1450, 50 U Klenow fragment, 10 U chicken
myokinase, 300 ng/.mu.l uvsX(C), 300 ng/.mu.l gp32(C), and 50
ng/.mu.l uvsY(N). The final volume was 30 .mu.l. The solution was
incubated for 5 hours at 37.degree. C. At an uvsY(N) concentration
of 50 ng/.mu.l, we detected the correct product directly, albeit
faintly, after 3 hours of incubation. During this period there was
an accumulation of strong bands of roughly twice the length of the
oligonucleotide, which accumulated similarly in the template minus
sample. These were most likely to be primer artifacts.
[0470] FIG. 33 shows how primer artifacts may arise. Primer
artifacts likely initiate by erroneous self-priming events as
depicted here. Primers may form hairpins, as occurs in FIG. 33A, or
hybridise to a second primer, as occurs in FIG. 33B. If a
polymerase can extend such a hairpin a significant stretch of
double-stranded DNA may be formed, as seen in A* and B*. These
structures might become targets for other recombinase-loaded
filaments, titrate active filaments from bona fide targets, and
possibly enter into geometric forms of amplification
themselves.
[0471] FIG. 34 shows primer artifact suppression. Depicted
schematically are several strategies to suppress primer artifact
noise. In FIG. 34A, a second short, 3'-blocked oligonucleotide
complementary to the 3' sequences of the targeting oligonucleotide
is included in the reaction to compete for the formation of
secondary structure formation that might result in erroneous
priming. In FIGS. 34B and 34C, a similar short blocked
oligonucleotide is employed as in (A), but in this case a covalent
bridge is engineered between the 5' end of the targeting
oligonucleotide and the 5', or 3', end of the competing short
primer. In this way, the blocked nucleotide is tethered at its
5'end to the 5' end of the targeting oligonucleotide (FIG. 34A-B)
In FIG. 34D, a short sequence complementary to the 3' region of the
targeting oligonucleotide is added to the 5' region of the
targeting oligonucleotide. It competes efficiently with secondary
structure formation.
[0472] FIG. 35 shows use of hairpin oligonucleotides to stimulate
self-priming of displaced strands. Depicted is a scheme showing how
oligonucleotides whose design includes a 5' section with perfect
complementarity to the 3' section might be used to stimulate
amplification through self-priming At the top of the diagram is
shown a target DNA, designated A, which has distinct ends which are
targets for one of the two targeting oligonucleotides shown in the
upper left and right of the figure. Both of these oligonucleotides
possess complementarity between their 5' and 3' regions as
indicated by short arrows. The target, A, would likely have been
generated by earlier invasion/elongation events involving these
oligonucleotides and an initial target lacking the 5'-most regions
of these oligonucleotides. On the left or right side of the figure
we follow the outcome of invasion/elongation events initiated by
targeting by the left or right primers respectively. The outcome is
similar in both cases, albeit the final products are arranged
slightly differently.
[0473] Focusing on the left side of the figure we observe that when
target A is subject to invasion and elongation with the left primer
the result is formation of a new duplex identical to A and a
single-stranded DNA equivalent to the top strand of the initial
target, designated B. Due to the presence of the complementarity
between the very 3' region and adjacent sequences, B is capable of
forming a hairpin which will prime DNA synthesis to generate a
largely double-stranded product C. The product C can readily be
targeted once again by the left oligonucleotide. However, in this
case, no single-stranded displaced strand is formed. Instead,
product D is formed with a length that is roughly twice that of the
original target. This product is an inverted repeat and contains
two sequences that are targets for the left oligonucleotide, and
one for the right oligonucleotide located in the middle.
[0474] Subsequent invasion/elongation events, and the possible
occurrence of hybridisation events between displaced strands, could
easily lead to such `dimeric` species becoming further enlarged,
and the formation generally of more complex products. A similar
course of events is shown on the right side of the figure, this
time initiated by invasion/elongation by the right primer. The
final dimeric product, D', is not equivalent to D as the two end
sequences are targets for the right primer, and the central region
is a target for the left primer. Processes similar or identical to
those shown here are likely to occur with some frequency under some
conditions even in the absence of the deliberate design of
oligonucleotides to promote it, as there is often some limited
capacity for self-priming of single-stranded DNAs.
[0475] FIG. 36 shows conditions that support the amplification of
DNA with little or no primer artifacts. The results of an
experiment are shown in which we have investigated the sensitivity
of an RPA reaction on a complex DNA target. A schematic
representation is given of the DNA sequence, which corresponds to
part of the human angiotensin converting enzyme (ACE) gene.
Oligonucleotides used are the biotinylated Angio1bio primer and the
unbiotinylated Angio3 primer whose sequence is given in the
experimental methods. These primers amplified a 132 bp
double-stranded DNA fragment. Uncut human genomic DNA was titrated
from 45 copies up to 2880 copies. Reaction products were detected
by virtue of the presence of a biotin residue attached to the 5'
end of one of the oligonucleotides used in the amplification. In
this way, it was possible to visualise all the reaction products
involving this oligonucleotide, including any artifacts that might
arise.
[0476] The reaction was incubated for 2 hours at 37.degree. C. in
the case of the Klenow exo-, and 2 hours at 42.degree. C. in the
case of the Bst polymerase. The reaction included the following: 50
ng/.mu.l uvsY(N), 300 ng/.mu.l gp32(C), 100 ng/.mu.l uvsX(C), 20 mM
phosphocreatine, 3 mM ATP, 25 milliunits/.mu.l myokinase, 100
ng/.mu.l creatine kinase, 200 .mu.M dNTPs, 5% w/v PEG compound, 300
nM Angio1bio primer, 300 nM Angio3 primer, 800 ng/.mu.l Klenow exo-
or 1.2 units/.mu.l Bst polymerase. The Klenow-mediated
amplification was performed in U2 buffer comprising a final
composition of 20 mM Tris acetate pH 7.9, 8 mM magnesium acetate,
120 mM potassium acetate. The Bst polymerase-mediated amplification
was performed in U1 buffer comprising a final composition of 20 mM
Tris acetate pH 7.5, 6 mM magnesium acetate, 100 mM potassium
acetate.
Example 13
DNA Amplification for Point-of-Use Applications
[0477] Clones and proteins were produced as described in Example
11, above.
[0478] DNAs Used in RPA Reactions
[0479] We have employed several different target DNAs in this
study, and a number of oligonucleotides. The sequence of the
oligonucleotides is given below, and the template target in the
experiment shown in FIG. 39B. The E. coli RuvB gene target was used
for linear run-on assay (FIG. 39B). Identical quantities of plasmid
template containing this fragment were cut either with EcoRV,
releasing a roughly 300 bp fragment, or with ClaI which linearises
the DNA. Equal molar quantities of template were used in the run-on
experiments (20 nM each template). The sequence of a KpnI/ClaI
fragment of this template is given below. The EcoRV fragment is
embedded within this sequence, and the sites are highlighted.
TABLE-US-00014 (SEQ ID NO: 18)
GGTACCACTTTGCCGGAAGATGTAGCAGATCGCGCCATTCGCCCCAAATT
ACTGGAAGAGTATGTTGGTCAGCCGAGGTTCGTTCACAGATGGAGATTTT
CATCAAAGCAGCGAAACTGCGCGGCGATGCCCTCGATCATTTGTTGATTT
TTGGTCCTCCGGGGTTGGGTAAAACTACGCTTGCCAACATTGTCGCCAAT
GAAATGGGCGTTAATTTACGCACGACTTCTGGTCCGGTGCTGGAAAAGGC
GGGCGATTTGGCTGCGATGCTCACTAACCTTGAACCGCATGACGTGCTGT
TTATTGATGAGATCCACCGTCTATCGCCAGTTGTTGAAGAAGTGCTGTAC
CCGGCAATGGAAGACTACCAACTGGATATCATGATTGGTGAAGGTCCGGC
GGCACGCTCCATTAAAATTGATTTGCCGCCGTTTACCCTGATTGGTGCAA
CCACGCGCGCAGGTTCGCTGACATCACCGTTGCGCGACCGTTTTGGTATT
GTGCAACGTCTGGAGTTTTATCAGGTGCCGGATCTGCAATATATCGTCAG
TCGCAGCGCACGCTTTATGGGGCTTGAGATGAGTGATGACGGCGCGCTGG
AAGTTGCTCGTCGCGCTCGCGGTACGCCGCGCATTGCCAACCGTCTGCTG
CGTCGAGTGCGTGATTTCGCCGAAGTGAAGCACGATGGCACCATCTCGGC
AGATATCGCTGCTCAGGCGCTGGATATGTTGAATGTCGATGCTGAAGGTT
TCGATTATATGGACCGCAAATTGTTGCTGGCGGTAATCGAT
[0480] Oligonucleotide Tester3bio sequence. Bases homologous to the
target are in bold.
TABLE-US-00015 (SEQ ID NO: 19)
5'biotin-CTCACTATACCTCAGCATCATGATTGGTGAAGGTCCGGCGG CAC.
[0481] Human DNAs
[0482] We have used human genomic DNAs from several sources. A
mixed population male genomic DNA from Promega was utilised. Also,
DNA from individual male samples was studied in FIG. 38A.
Individual 1 and 2 were father and son. Individual 2 DNA was used
in the experiment in FIG. 39E, while DNA for the experiment in FIG.
39F was another male individual. Sequences of oligonucleotides used
for amplifying human and B. subtilis sequences are as follows:
[0483] Corresponding to the Human ApolipoproteinB Locus:
TABLE-US-00016 ApoB4 (SEQ ID NO: 20) 5'
CAGTGTATCTGGAAAGCCTACAGGACACCAAAA 3' Apo300 (SEQ ID NO: 21) 5'
TGCTTTCATACGTTTAGCCCAATCTTGGATAG 3' Apo700 (SEQ ID NO: 22) 5'
TGGTAAACGGAAGTCTGGCAGGGTGATTCTCG 3' Apo800 (SEQ ID NO: 23) 5'
CAATTGTGTGTGAGATGTGGGGAAGCTGGAAT 3' Apo900 (SEQ ID NO: 24) 5'
GAGGTGGTTCCATTCCCTATGTCAGCATTTGC 3' Apo1000 (SEQ ID NO: 25) 5'
GGGTTTGAGAGTTGTGCATTTGCTTGAAAATC 3' Apo1500 (SEQ ID NO: 26) 5'
TTGAATTTCAAGTTTAGAAAAGTTGAGGGAGCCAG 3'
[0484] Corresponding to the Human SRY Locus:
TABLE-US-00017 SRY3 (SEQ ID NO: 27) 5'
AAAGCTGTAACTCTAAGTATCAGTGTGAAAC 3' SRY4 (SEQ ID NO: 28) 5'
GTTGTCCAGTTGCACTTCGCTGCAGAGTACC 3'
[0485] Corresponding to B. subtilis Genomic DNA:
TABLE-US-00018 BSA1 (SEQ ID NO: 29) 5'
TTGGGCACTTGGATATGATGGAACTGGCAC 3' BSA3 (SEQ ID NO: 30) 5'
ACAGAAAGCTATTAAAGCAACTGACGGTGTGG 3' BSB3 (SEQ ID NO: 31) 5'
CCATCTTCAGAGAACGCTTTAACAGCAATCC 3'
[0486] Human STR Marker Primers:
TABLE-US-00019 CSF1PO (SEQ ID NO: 32) 5'
GTTGCTAACCACCCTGTGTCTCAGTTTTCCTAC CSF1PO (SEQ ID NO: 33) 3'
AGACTCTTCCACACACCACTGGCCATCTTCAGC D7S820 (SEQ ID NO: 34) 5'
GAACACTTGTCATAGTTTAGAACGAACTAACG D7S820 (SEQ ID NO: 35) 3'
GAATTATAACGATTCCACATTTATCCTCATTGAC D13S317 (SEQ ID NO: 36) 5'
TTGCTGGACATGGTATCACAGAAGTCTGGGATG D13S317 (SEQ ID NO: 37) 3'
CCATAGGCAGCCCAAAAAGACAGACAGAAAGA D16S539 (SEQ ID NO: 38) 5'
AAACAAAGGCAGATCCCAAGCTCTTCCTCTTCC D16S539 (SEQ ID NO: 39) 5'
ATACCATTTACGTTTGTGTGTGCATCTGTAAGC D18S51 (SEQ ID NO: 40) 5'
GGTGGACATGTTGGCTTCTCTCTGTTCTTAAC D18S51 (SEQ ID NO: 41) 3'
GGTGGCACGTGCCTGTAGTCTCAGCTACTTGC THO1 (SEQ ID NO: 42) 5'
TACACAGGGCTTCCGGTGCAGGTCACAGGGA THO1 (SEQ ID NO: 43) 3'
CCTTCCCAGGCTCTAGCAGCAGCTCATGGTGG TPOX (SEQ ID NO: 44) 5'
ACTGGCACAGAACAGGCACTTAGGGAACCC TPOX (SEQ ID NO: 45) 3'
GGAGGAACTGGGAACCACACAGGTTAATTA
[0487] Timecourse Experiment:
TABLE-US-00020 APOB600 (SEQ ID NO: 46)
GCTCACTGTTCTGCATCTGGTCAATGGTTCTG APOB300REV (SEQ ID NO: 47)
CTATCCAAGATTGGGCTAAACGTATGAAAGCA
[0488] Shorter Oligonucleotide Experiment:
TABLE-US-00021 APOB500 (SEQ ID NO: 48)
ATGGTAAATTCTGGTGTGGAAAACCTGGATGG APO500-28 (SEQ ID NO: 49)
TAAATTCTGGTGTGGAAAACCTGGATGG APO500-25 (SEQ ID NO: 50)
ATTCTGGTGTGGAAAACCTGGATGG APOB300REV (SEQ ID NO: 51)
CTATCCAAGATTGGGCTAAACGTATGAAAGCA APOB300REV-28 (SEQ ID NO: 52)
CCAAGATTGGGCTAAACGTATGAAAGCA APOB300REV-25 (SEQ ID NO: 53)
AGATTGGGCTAAACGTATGAAAGCA D18S51 (SEQ ID NO: 54) 5'
GGTGGACATGTTGGCTTCTCTCTGTTCTTAAC D18S51 (SEQ ID NO: 55) 5'-28
GACATGTTGGCTTCTCTCTGTTCTTAAC D18S51 (SEQ ID NO: 56) 5'-25
ATGTTGGCTTCTCTCTGTTCTTAAC D18S51 (SEQ ID NO: 57) 3'
GGTGGCACGTGCCTGTAGTCTCAGCTACTTGC D18S51 (SEQ ID NO: 58) 3'-28
GCACGTGCCTGTAGTCTCAGCTACTTGC D18S51 (SEQ ID NO: 59) 3'-25
CGTGCCTGTAGTCTCAGCTACTTGC SRY3 (SEQ ID NO: 60)
AAAGCTGTAACTCTAAGTATCAGTGTGAAAC SRY3-28 (SEQ ID NO: 61)
GCTGTAACTCTAAGTATCAGTGTGAAAC SRY3-25 (SEQ ID NO: 62)
GTAACTCTAAGTATCAGTGTGAAAC SRY4 (SEQ ID NO: 63)
GTTGTCCAGTTGCACTTCGCTGCAGAGTACC SRY4-28 (SEQ ID NO: 64)
GTCCAGTTGCACTTCGCTGCAGAGTACC SRY4-25 (SEQ ID NO: 65)
CAGTTGCACTTCGCTGCAGAGTACC
[0489] Conditions of standard RPA reactions included: 50 mM Tris pH
8.4, 80 mM Potassium acetate, 10 mM Magnesium acetate, 1 mM DTT, 5%
PEG compound (Carbowax-20 M), 3 mM ATP, 20 mM Phosphocreatine, 100
ng/.mu.l Creatine kinase, 600 ng/.mu.l gp32; 109 ng/.mu.l, or 125
ng/.mu.l, or 200 ng/.mu.l uvsX; 16 ng/.mu.l, or 25 ng/.mu.l, or 40
ng/.mu.l, or 60 ng/.mu.l uvsY; 20 ng/.mu.l Bsu polymerase, 200
.mu.M dNTPs, and 300 nM each oligonucleotide. Reaction conditions
C1-C4 are as above with: C1=109 ng/.mu.l uvsX, 16 ng/.mu.l usvY;
C2=125 ng/.mu.l uvsX, 25 ng/.mu.l uvsY; C3=200 ng/.mu.l uvsX, 40
ng/.mu.l uvsY; C4=200 ng/.mu.l uvsX, 60 ng/.mu.l uvsY.
[0490] Experimental Results
[0491] FIG. 37 shows a schematic representation of RPA method. In
FIG. 37A(i), Recombinase protein uvsX binds cooperatively to
single-stranded oligonucleotides in the presence of ATP.
Nucleoprotein filaments actively hydrolyse ATP to ADP. Spontaneous
disassembly can lead to competitive binding of single stranded
binding protein gp32, this being deterred and reloading aided by
uvsY protein and polyethylene glycol. In FIG. 37A(ii), recombinase
filaments catalyse strand exchange if homologous DNA is detected.
In FIG. 37A(iii), strand exchange matches the searching strand with
its complement and displaces a strand then bound by gp32.
Recombinase disassembles. In FIG. 37A(iv), polymerases access the
structure and extend the oligonucleotide, displacing more of the
original strand. In FIG. 37B(i), two opposing targeting
nucleoprotein complexes recombine with their respective targets and
DNA synthesis is initiated. In FIG. 37B(ii), polymerase complexes
encounter one another and one of the polymerases dissociates. In
FIG. 37B(iii), the remaining polymerase continues synthesis freeing
the two parent strands, a polymerase re-binds to the free 3'-end
thus replication of both strands occurs. In FIG. 37B(iv), new
targeting events occur. In the second round one targeting primer
will displace a free end. In FIG. 37C, comparison of the products
of strand exchange at a DNA end or at an embedded DNA sequence.
[0492] FIG. 38A shows the results of amplification of STR markers
from two individuals (1 and 2, father and son) using primer pairs
for seven independent markers. RPA conditions C4 were employed (see
above). FIG. 38B shows titration of reaction components to
determine concentrations that support in vitro amplification.
Reactions included the primers SRY3 and SRY4 at 0.3 .mu.M
(targeting the SRY gene), 80 mM potassium acetate, 50 mM TrisCl pH
8.4, 2 mM DTT, 5% Carbowax-20M, 200 ng/.mu.l uvsX, 60 ng/.mu.l
uvsY, 600 ng/.mu.l gp32, 20 ng/.mu.l Bsu polymerase, and 50
copies/.mu.l Y chromosomal DNA, except when a given component was
that under investigation. Optimal quantities of gp32, ATP, uvsX,
uvsY, PEG, and Bsu polymerase for effective amplification of this
particular product were determined. ATP-.gamma.-S and ADP-.beta.-S
inhibited the reactions.
[0493] FIG. 39A shows the size limits of RPA reactions. Primer
ApoB4 was combined with opposing primers capable of generating
amplified products of the indicated sizes. Conditions of 125
ng/.mu.l uvsX and 25 ng/.mu.l uvsY (C2) were employed except C1
where 109 ng/.mu.l uvsX and 16 ng/.mu.l uvsY were used; 15
copies/.mu.l human DNA were used (30 .mu.l reactions). Under
conditions C2, some hairpin-mediated product duplication occurred
converting some of the 300 bp amplicon to 2.times..times. and
3.times..times. unit length (*) (L. D. Harris, J. D. Griffith, J
Mol Biol 206, 19-27 (Mar. 5, 1989)).
[0494] FIG. 39B shows elongation efficiencies from embedded or end
sequences. A biotinylated primer was incubated with linearized
plasmid DNA. Equal quantities (20 nM final) of templates linearized
with either ClaI (lane 3) or EcoRV (lanes 1 and 2) were used, the
primer either overlapping the cut end, or the target site being
embedded (lane 3). Incubation with recombinase targeting components
with (lanes 2 and 3) or without (lane 1) Klenow reveals limited
elongation from the embedded site (product 1*), and abundant
elongation from the end site (product 2*). Electrophoresed products
were transferred to nylon and biotin detected by chemiluminescence.
The weak common band (.about.300 bp, lanes 1 and 3) was an artifact
arising from this particular protocol.
[0495] FIG. 39C shows the sensitivity of RPA reactions. The
indicated copy number of B. subtilis genomes was amplified with
oligonucleotides BsA1 and BsB3, which amplify a 200 bp fragment.
Conditions C1 were employed. FIG. 39D shows human DNA of the
indicated copy number amplified with primers ApoB4 and Apo300 to
generate a 300 bp fragment. Conditions C2 were employed. FIG. 39E,
F show results from human DNA from single individuals. The DNA was
diluted and samples theoretically containing the indicated copy
number were amplified with primers D18S51 5' and 3' which amplify
an STR of size .about.300-360 bp. At predicted copy numbers of 2 or
3, a number of samples amplified single alleles (*). Conditions
employed were C2 in (E), and C4 in (F).
[0496] FIG. 40 shows specificity of RPA reactions. Primers BsA3 and
BsB3, which amplify a 380 bp fragment from B. subtilis genomic DNA
were incubated with 1 .mu.g of human DNA, with (+) or without (-)
addition of 100 copies of B. subtilis DNA (FIG. 40A). An asterisk
indicates the position of the expected reaction product, and an
arrow indicated the position of the genomic DNA. Conditions C3 were
employed. To investigate how long it takes RPA to generate
detectable reaction products a series of amplification reactions
were established with oligonucleotides Apo600bio and Apo300rev
generating a 345 bp fragment. A copy number of 60 copies/.mu.l
(FIG. 40B) or 6 copies/.mu.l (FIG. 40C) were used. Individual
reactions were stopped at the indicated number of minutes and
analysed on a gel. Conditions C4 were employed (FIG. 40D).
[0497] For long-term storage of reaction components we lyophilised
RPA reactions. Mixtures of reaction components were assembled in
the absence of the indicated components, PEG and buffer. The
material was freeze-dried, and then reconstituted with PEG and
buffer plus the additional omitted components. Primers used are
indicated. All components apart from PEG and buffer could be
lyophilised and successfully reconstituted in a functional
reaction. Target DNA was human male genomic DNA at 150 copies/.mu.l
(FIG. 40E). Oligonucleotides targeting three independent loci in
human genomic DNA were incubated with overlapping primer pairs of
25, 28, or 32 bases as indicated. Only the primers of 32 bases in
length successfully amplified targets. Other experiments show that
primers of 30 residues are also effective at amplifying target
DNAs.
DISCUSSION
[0498] There is a long-standing need for in vitro methods to
amplify specific DNA sequences. Since the late 1980's the
polymerase chain reaction (PCR) method has principally met this
need (R. K. Saiki et al., Science 239, 487-91 (Jan. 29, 1988)). The
requirement for thermal cycling equipment, however, poses a
significant barrier to the use of PCR outside of a laboratory
setting. As described herein, we have developed a method called
RPA, which obviates the need for thermal melting of template DNAs.
RPA combines components of the bacteriophage T4
recombination/replication system in vitro under critical defined
conditions to mediate the hybridisation of oligonucleotide primers
to template DNAs. Specifically, the bacteriophage T4 recombinase
uvsX, single-stranded DNA binding (SSB) protein gp32, and
recombinase loading factor uvsY together with molecular crowding
agents, allow high fidelity in vitro recombinase-mediated DNA
targeting. When this targeting system is combined with strand
displacement DNA synthesis mediated by enzymes of the E. coli or B.
subtilis Pol I class, efficient exponential DNA amplification is
achieved.
[0499] Any oligonucleotide sequence may be coated by recombinase to
form homology searching filaments (FIG. 37) giving RPA a broad
utility allowing amplification of virtually any DNA sequence. This
feature has been one of the major advantages of PCR over other in
vitro DNA amplification methods (G. T. Walker, M. C. Little, J. G.
Nadeau, D. D. Shank, Proc Natl Acad Sci USA 89, 392-6 (Jan. 1,
1992); D. Y. Zhang, M. Brandwein, T. Hsuih, H. B. Li, Mol Diagn 6,
141-50 (June, 2001); M. Vincent, Y. Xu, H. Kong, EMBO Rep 5,
795-800 (August, 2004); J. Compton, Nature 350, 91-2 (Mar. 7,
1991)). Resembling their in vivo role, homology-searching filaments
scan duplex DNA for sequences complementary to that of the
oligonucleotide (T. Yonesaki, Y. Ryo, T. Minagawa, H. Takahashi,
Eur J Biochem 148, 127-34 (Apr. 1, 1985); T. Shibata, C. DasGupta,
R. P. Cunningham, C. M. Radding, Proc Natl Acad Sci USA 76, 1638-42
(April, 1979)). On finding a match, the recombinase catalyses
several reactions: the primer is paired with its complement, the
similar `outgoing` strand is displaced, and the recombinase
dissociates. This establishes a `D-loop` structure accessible to
other reaction components. Exchange events occurring away from a
free DNA end generate topologically strained joints, as the
outgoing strand is attached on both sides of the exchanged region
(FIG. 37C).
[0500] Embedded sequences generate topologically constrained
intermediates that are unstable. Joints formed at DNA ends permit
free rotation of the displaced strand (P. W. Riddles, I. R. Lehman,
J Biol Chem 260, 165-9 (Jan. 10, 1985)). Because these two
structures have different stabilities elongation of initial strand
invasion events are less efficient than subsequent ones (FIG. 39B).
The free 3' end of the oligonucleotide primes synthesis by a
strand-displacing DNA polymerase such as the Klenow fragment of E.
coli, or the Bacillus subtilis DNA polymerase I (Bsu). The
synthetic and strand-displacing activities of the polymerase result
in the production of a double-stranded DNA and a displaced single
strand. This displaced strand is replicated either by direct
hybridisation and elongation of the second oligonucleotide, or by
strand displacement synthesis if an invasion event had already
occurred from the opposite end. The generation of two complete
daughter duplexes completes one round of RPA. Invasions continue to
act on products of previous synthesis reactions with the
endtargeted products eventually dominating the reaction.
[0501] In developing the method of the invention, we have found
that several important conditions are important for optimal RPA to
occur. First, there needs to be saturating quantities of nucleic
acid melting proteins present in the reaction especially a SSB such
as gp32. Second, there needs to be a sufficient quantity of
recombinase-loaded primer to achieve an acceptable
invasion/strand-exchange rate. Finally, the
recombinase/single-stranded DNA primer filaments need to be dynamic
and capable of disassembly. There are competing biochemical
activities of the reaction components. For example, in a typical in
vitro situation recombinases are usually out-competed by saturating
amounts of SSBs such as gp32.
[0502] To overcome this problem, others have used nonhydrolysable
ATP analogues such as ATP-.gamma.-S, which stabilises the
recombinase/single-stranded primer DNA interaction (S. C.
Kowalczykowski, J. Clow, R. Somani, A. Varghese, J Mol Biol 193,
81-95 (Jan. 5, 1987); A. L. Eggler, S. L. Lusetti, M. M. Cox, J
Biol Chem 278, 16389-96 (May 2, 2003); T. Shibata, C. DasGupta, R.
P. Cunningham, C. M. Radding, Proc Natl Acad Sci USA 77, 2606-10
(May, 1980)). Non-hydrolysable ATP analogues are, however,
incompatible with the dynamic activity of
recombinase/single-stranded DNA primer filaments needed to complete
strand-exchange reactions and allow polymerases access to the
D-loops (L. Xu, K. J. Marians, J Biol Chem 277, 14321-8 (Apr. 19,
2002); P. W. Riddles, I. R. Lehman, J Biol Chem 260, 170-3 (Jan.
10, 1985); N. Armes, D. Stemple, in patent application PCT WO
03/072805 (ASM Scientific, Inc., USA, 2003)) (FIG. 38).
[0503] There are other ways the recombinase/single-stranded primer
DNA interaction could be stabilised. For example, another
bacteriophage T4 protein called uvsY is known to aid loading of
uvsX onto gp32-coated DNA (L. D. Harris, J. D. Griffith, J Mol Biol
206, 19-27 (Mar. 5, 1989)). In addition, molecular crowding agents
are also known to facilitate loading and stabilisation of the E.
coli recA recombinase protein (P. E. Lavery, S. C. Kowalczykowski,
J Biol Chem 267, 9307-14 (May 5, 1992)). We therefore tested
whether uvsY and molecular crowding agents might alleviate the
unfavourable competition between uvsX and gp32 in a dynamic,
ATP-dependent system.
[0504] Titration of reaction components reveals that defined
quantities of T4 gp32, T4 uvsX, T4 uvsY, ATP, and PEG are required
for DNA amplification (FIG. 38). Indeed the T4 uvsY recombinase
mediator protein and PEG-compound (Carbowax 20M) are required to
achieve detectable amplification. At reduced concentrations of
gp32, amplification efficiency is impaired generating smearing and
laddering of reaction products. The recombinase uvsX protein is
important for RPA and the reaction rate is accelerated at higher
concentrations, although this can also increase artifacts (FIG.
39A). ATP is important for the reaction, and we have found that an
ATP regeneration system is needed to reach detectable levels of
product for most reactions. Conversely, ATP-.gamma.-S is a powerful
inhibitor of amplification.
[0505] To be a useful tool for routine DNA amplification
applications such as diagnostic testing, RPA should be sensitive
and specific, applicable to diverse sequence targets and be capable
of amplifying fragments of sufficient size. We first investigated
the size of products that could be generated. Amplified products up
to 1000 base pairs in size could be amplified using standard
reaction conditions (FIG. 38A). Larger amplified products may also
be generated using RPA.
[0506] We tested the sensitivity of RPA under the most stringent
conditions, using a single-step RPA reaction, without nesting, and
detecting products by conventional ethidium bromide staining of
agarose gels. With several independent primer/target sets we
routinely detected less than 10 copies of starting duplex template.
We observed variability between experiments at lowest detectable
copy number but all attempts were successful at detecting less than
10 copies. With proper sample handling, RPA may be used to amplify
from single molecules to detectable levels in a single reaction. To
explore this possibility, we amplified a polymorphic simple tandem
repeat (STR) marker from human DNA diluted until only a few copies
should remain. We generated a number of amplified products
corresponding to both possible separate alleles present in the
sample DNA (FIG. 39E,F). This allele separation effect suggests
that RPA has single molecule sensitivity and thus surpasses the
sensitivity of many other DNA amplification methods.
[0507] Analysis of the amount of amplified product shows that RPA
will routinely amplify DNA samples by 10.sup.11-12-fold from small
quantities of starting template. Final product levels are typically
in the range of 10-250 nM, generating more than sufficient
quantities of DNA for even the least sensitive detection protocols.
To assess specificity of amplification reactions we have analysed
many primer pairs, most directed to human DNA sequences. For every
primer/template set, we have tested the predicted product sizes,
restriction enzyme digestion patterns, or product DNA sequence to
show that amplification is specific. We have not observed
amplification of non-target sequences from sample DNA to the best
interpretation of our data. Artifacts we have observed are product
or primer related (FIG. 39A).
[0508] Often in diagnostic settings, specificity problems arise
from the large amounts of nontarget DNA present in a sample. For
example, in pathogen detection, human DNA from blood samples can
interfere with detection of pathogen DNA. We therefore sought to
detect trace quantities of target DNA in a large mass of unrelated
DNA. We found that RPA was able to amplify a target to detectable
levels from 100 copies of Bacillus subtilis DNA in the presence of
1 .mu.g of human DNA (i.e., 10.sup.8-fold less B. subtilis DNA than
human DNA by mass). With such a large mass of sample DNA we found
we had to increase levels of uvsX and uvsY compared to equivalent
reactions without excess competitor DNA to achieve an acceptable
reaction rate. This is perhaps due to out-titration of the
homology-searching components.
[0509] In time-course experiments with several different
primer/template sets, we found that amplification rate was
partially dependent on product length. For fragments in the range
150-400 base pairs, however, fairly similar rates were observed,
allowing amplification from hundreds to thousands of starting
copies to gel detectable levels (10.sup.12 copies) in as little as
20 minutes). We estimate that we have been able to reduce average
`cycle` times to as little as 30 seconds on average for such
fragments. Using optimally short target sequences and sensitive
detection method, we expect that a diagnostic
amplification/detection assay could be performed well within an
hour. Our studies show that for a large number of arbitrary DNA
targets in complex samples high-quality primer pairs can be easily
designed. We have addressed minimal oligonucleotide length and
found that while oligonucleotides of less than 30 nucleotides do
not amplify DNA effectively, those of 30-35 nucleotides in length
are excellent primers and are short enough for easy synthesis (FIG.
40).
[0510] As demonstrated herein, RPA is an excellent general method
to amplify specific DNA sequences. Initial experiments indicate
that it is easy to lyophilise the components of the RPA reaction
for convenient storage and reconstitution (FIG. 40). This method,
which operates robustly at constant low temperature, can be
lyophilised for easy storage and requires no thermal cycling or
melting for high sensitivity, nor other complex handling. It offers
a significant breakthrough in the development of DNA diagnostic,
forensic and other point-of-use applications. Once integrated with
portable sample DNA extraction and product detection systems, RPA
should enable easy-to-use clinical or domestic testing kits for a
variety of pathogens (e.g., Clamydia or MRSA) as well as field kits
for other applications.
[0511] The details of one or more embodiments of the invention have
been set forth in the accompanying description above. Although any
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, the preferred methods and materials are now described.
Other features, objects, and advantages of the invention will be
apparent from the description and from the claims.
[0512] In the specification and the appended claims, the singular
forms include plural referents unless the context clearly dictates
otherwise. Unless defined otherwise, all technical and scientific
terms used herein have the same meaning as commonly understood by
one of ordinary skill in the art to which this invention belongs.
Unless expressly stated otherwise, the techniques employed or
contemplated herein are standard methodologies well known to one of
ordinary skill in the art. All patents and publications cited in
this specification are hereby incorporated by reference herein,
including the previous disclosure provided by U.S. application
60/553,999 filed Mar. 16, 2004, U.S. application Ser. No.
10/371,641 filed Feb. 21, 2003, and U.S. Application 60/358,563
filed Feb. 21, 2002.
Sequence CWU 1
1
771327DNAEscherichia coli 1atcatgattg gtgaaggtcc ggcggcacgc
tccattaaaa ttgatttgcc gccgtttacc 60ctgattggtg caaccacgcg cgcaggttcg
ctgacatcac cgttgcgcga ccgttttggt 120attgtgcaac gtctggagtt
ttatcaggtg ccggatctgc aatatatcgt cagtcgcagc 180gcacgcttta
tggggcttga gatgagtgat gacggcgcgc tggaagttgc tcgtcgcgct
240cgcggtacgc cgcgcattgc caaccgtctg ctgcgtcgag tgcgtgattt
cgccgaagtg 300aagcacgatg gcaccatctc ggcagat 327244DNAArtificial
SequenceSynthetic oligonucleotide 2ctagcgatgg tgccatcgta cagaattccc
tcagcatctg ccga 44344DNAArtificial SequenceSynthetic
oligonucleotide 3ctcactatac ctcagcatca tgattggtga aggtccggcg gcac
44454DNAArtificial SequenceSynthetic oligonucleotide 4gctaatacga
ctcactatac ctcagcatca tgattggtga aggtccggcg gcac 54544DNAArtificial
SequenceSynthetic oligonucleotide 5ctcactatac ctcagcatca tgattggtga
aggtccggcg gcac 44646DNAArtificial SequenceSynthetic
oligonucleotide 6ctatgcgaat tcagcgaacc tgcgcgcgtg gttgcaccaa tcaggg
46745DNAArtificial SequenceSynthetic oligonucleotide 7ctatgcgaat
tcggtgatgt cagcgaacct gcgcgcgtgg ttgca 45845DNAArtificial
SequenceSynthetic oligonucleotide 8ctatgcgaat tctccagacg ttgcacaata
ccaaaacggt cgcgc 45945DNAArtificial SequenceSynthetic
oligonucleotide 9ctatgcgaat tccgtgcgct gcgactgacg atatattgca gatcc
451018DNAArtificial SequenceSynthetic oligonucleotide 10atctgccgag
atggtgcc 1811158DNAHomo sapiens 11aaccaactcc gccccgggcc acggcctcgc
tctgctccag gtactttgtc agcttcatca 60tccagttcca gttccacgag gcactgtgcc
aggcagctgg ccacacgggc cccctgcaca 120agtgtgacat ctaccagtcc
aaggaggccg ggcagcgc 1581244DNAArtificial SequenceSynthetic
oligonucleotide 12attcgtcagc ctcgctctgc tccaggtact ttgtcagctt catc
441333DNAArtificial SequenceSynthetic oligonucleotide 13gcctccttgg
actggtagat gtcacacttg tgc 331443DNAArtificial SequenceSynthetic
oligonucleotide 14gcgctgcccg gcctccttgg actggtagat gtcacacttg tgc
431543DNAArtificial SequenceSynthetic oligonucleotide 15tatgcgaatt
gcctccttgg actggtagat gtcacacttg tgc 431632DNAArtificial
SequenceSynthetic oligonucleotide 16gcctccttgg actggtagat
gtcacacttg tg 321743DNAArtificial SequenceSynthetic oligonucleotide
17ggccacggcc tcgctctgct ccaggtactt tgtcagcttc atc
4318791DNAEscherichia coli 18ggtaccactt tgccggaaga tgtagcagat
cgcgccattc gccccaaatt actggaagag 60tatgttggtc agccgaggtt cgttcacaga
tggagatttt catcaaagca gcgaaactgc 120gcggcgatgc cctcgatcat
ttgttgattt ttggtcctcc ggggttgggt aaaactacgc 180ttgccaacat
tgtcgccaat gaaatgggcg ttaatttacg cacgacttct ggtccggtgc
240tggaaaaggc gggcgatttg gctgcgatgc tcactaacct tgaaccgcat
gacgtgctgt 300ttattgatga gatccaccgt ctatcgccag ttgttgaaga
agtgctgtac ccggcaatgg 360aagactacca actggatatc atgattggtg
aaggtccggc ggcacgctcc attaaaattg 420atttgccgcc gtttaccctg
attggtgcaa ccacgcgcgc aggttcgctg acatcaccgt 480tgcgcgaccg
ttttggtatt gtgcaacgtc tggagtttta tcaggtgccg gatctgcaat
540atatcgtcag tcgcagcgca cgctttatgg ggcttgagat gagtgatgac
ggcgcgctgg 600aagttgctcg tcgcgctcgc ggtacgccgc gcattgccaa
ccgtctgctg cgtcgagtgc 660gtgatttcgc cgaagtgaag cacgatggca
ccatctcggc agatatcgct gctcaggcgc 720tggatatgtt gaatgtcgat
gctgaaggtt tcgattatat ggaccgcaaa ttgttgctgg 780cggtaatcga t
7911944DNAArtificial SequenceSynthetic oligonucleotide 19ctcactatac
ctcagcatca tgattggtga aggtccggcg gcac 442033DNAArtificial
SequenceSynthetic oligonucleotide 20cagtgtatct ggaaagccta
caggacacca aaa 332132DNAArtificial SequenceSynthetic
oligonucleotide 21tgctttcata cgtttagccc aatcttggat ag
322232DNAArtificial SequenceSynthetic oligonucleotide 22tggtaaacgg
aagtctggca gggtgattct cg 322332DNAArtificial SequenceSynthetic
oligonucleotide 23caattgtgtg tgagatgtgg ggaagctgga at
322432DNAArtificial SequenceSynthetic oligonucleotide 24gaggtggttc
cattccctat gtcagcattt gc 322532DNAArtificial SequenceSynthetic
oligonucleotide 25gggtttgaga gttgtgcatt tgcttgaaaa tc
322635DNAArtificial SequenceSynthetic oligonucleotide 26ttgaatttca
agtttagaaa agttgaggga gccag 352731DNAArtificial SequenceSynthetic
oligonucleotide 27aaagctgtaa ctctaagtat cagtgtgaaa c
312831DNAArtificial SequenceSynthetic oligonucleotide 28gttgtccagt
tgcacttcgc tgcagagtac c 312930DNAArtificial SequenceSynthetic
oligonucleotide 29ttgggcactt ggatatgatg gaactggcac
303032DNAArtificial SequenceSynthetic oligonucleotide 30acagaaagct
attaaagcaa ctgacggtgt gg 323131DNAArtificial SequenceSynthetic
oligonucleotide 31ccatcttcag agaacgcttt aacagcaatc c
313233DNAArtificial SequenceSynthetic oligonucleotide 32gttgctaacc
accctgtgtc tcagttttcc tac 333333DNAArtificial SequenceSynthetic
oligonucleotide 33cgacttctac cggtcaccac acaccttctc aga
333432DNAArtificial SequenceSynthetic oligonucleotide 34gaacacttgt
catagtttag aacgaactaa cg 323534DNAArtificial SequenceSynthetic
oligonucleotide 35cagttactcc tatttacacc ttagcaatat taag
343633DNAArtificial SequenceSynthetic oligonucleotide 36ttgctggaca
tggtatcaca gaagtctggg atg 333732DNAArtificial SequenceSynthetic
oligonucleotide 37agaaagacag acagaaaaac ccgacggata cc
323833DNAArtificial SequenceSynthetic oligonucleotide 38aaacaaaggc
agatcccaag ctcttcctct tcc 333933DNAArtificial SequenceSynthetic
oligonucleotide 39ataccattta cgtttgtgtg tgcatctgta agc
334032DNAArtificial SequenceSynthetic oligonucleotide 40ggtggacatg
ttggcttctc tctgttctta ac 324132DNAArtificial SequenceSynthetic
oligonucleotide 41cgttcatcga ctctgatgtc cgtgcacggt gg
324231DNAArtificial SequenceSynthetic oligonucleotide 42tacacagggc
ttccggtgca ggtcacaggg a 314332DNAArtificial SequenceSynthetic
oligonucleotide 43ggtggtactc gacgacgatc tcggaccctt cc
324430DNAArtificial SequenceSynthetic oligonucleotide 44actggcacag
aacaggcact tagggaaccc 304530DNAArtificial SequenceSynthetic
oligonucleotide 45attaattgga cacaccaagg gtcaaggagg
304632DNAArtificial SequenceSynthetic oligonucleotide 46gctcactgtt
ctgcatctgg tcaatggttc tg 324732DNAArtificial SequenceSynthetic
oligonucleotide 47ctatccaaga ttgggctaaa cgtatgaaag ca
324832DNAArtificial SequenceSynthetic oligonucleotide 48atggtaaatt
ctggtgtgga aaacctggat gg 324928DNAArtificial SequenceSynthetic
oligonucleotide 49taaattctgg tgtggaaaac ctggatgg
285025DNAArtificial SequenceSynthetic oligonucleotide 50attctggtgt
ggaaaacctg gatgg 255132DNAArtificial SequenceSynthetic
oligonucleotide 51ctatccaaga ttgggctaaa cgtatgaaag ca
325228DNAArtificial SequenceSynthetic oligonucleotide 52ccaagattgg
gctaaacgta tgaaagca 285325DNAArtificial SequenceSynthetic
oligonucleotide 53agattgggct aaacgtatga aagca 255432DNAArtificial
SequenceSynthetic oligonucleotide 54ggtggacatg ttggcttctc
tctgttctta ac 325528DNAArtificial SequenceSynthetic oligonucleotide
55gacatgttgg cttctctctg ttcttaac 285625DNAArtificial
SequenceSynthetic oligonucleotide 56atgttggctt ctctctgttc ttaac
255732DNAArtificial SequenceSynthetic oligonucleotide 57cgttcatcga
ctctgatgtc cgtgcacggt gg 325828DNAArtificial SequenceSynthetic
oligonucleotide 58cgttcatcga ctctgatgtc cgtgcacg
285925DNAArtificial SequenceSynthetic oligonucleotide 59cgttcatcga
ctctgatgtc cgtgc 256031DNAArtificial SequenceSynthetic
oligonucleotide 60aaagctgtaa ctctaagtat cagtgtgaaa c
316128DNAArtificial SequenceSynthetic oligonucleotide 61gctgtaactc
taagtatcag tgtgaaac 286225DNAArtificial SequenceSynthetic
oligonucleotide 62gtaactctaa gtatcagtgt gaaac 256331DNAArtificial
SequenceSynthetic oligonucleotide 63gttgtccagt tgcacttcgc
tgcagagtac c 316428DNAArtificial SequenceSynthetic oligonucleotide
64gtccagttgc acttcgctgc agagtacc 286525DNAArtificial
SequenceSynthetic oligonucleotide 65cagttgcact tcgctgcaga gtacc
256649DNAArtificial SequenceSynthetic oligonucleotide 66ctcactatac
ctcagcatca tgattggtga aggtccggcg gcacgctcc 4967327DNAEscherichia
coli 67atcatgattg gtgaaggtcc ggcggcacgc tccattaaaa ttgatttgcc
gccgtttacc 60ctgattggtg caaccacgcg cgcaggttcg ctgacatcac cgttgcgcga
ccgttttggt 120attgtgcaac gtctggagtt ttatcaggtg ccggatctgc
aatatatcgt cagtcgcagc 180gcacgcttta tggggcttga gatgagtgat
gacggcgcgc tggaagttgc tcgtcgcgct 240cgcggtacgc cgcgcattgc
caaccgtctg ctgcgtcgag tgcgtgattt cgccgaagtg 300aagcacgatg
gcaccatctc ggcagat 3276812DNAArtificial SequenceSynthetic
oligonucleotide 68ctatgcgaat tc 12696PRTArtificial
SequenceSynthetic 6x His tag 69His His His His His His 1 5
7010PRTArtificial SequenceSynthetic peptide 70Glu Gln Lys Leu Ile
Ser Glu Glu Asp Leu 1 5 10 718PRTArtificial SequenceSynthetic
peptide 71Asp Tyr Lys Asp Asp Asp Asp Lys 1 5 7212PRTArtificial
SequenceSynthetic peptide 72Glu Asp Gln Val Asp Pro Arg Leu Ile Asp
Gly Lys 1 5 10 7312PRTArtificial SequenceSynthetic peptide 73Glu
Glu Thr Ala Arg Phe Gln Pro Gly Tyr Arg Ser 1 5 10
7414PRTArtificial SequenceSynthetic peptide 74Gly Lys Pro Ile Pro
Asn Pro Leu Leu Gly Leu Asp Ser Thr 1 5 10 7511PRTArtificial
SequenceSynthetic peptide 75Tyr Thr Asp Ile Glu Met Asn Arg Leu Gly
Lys 1 5 10 768PRTArtificial SequenceSynthetic peptide 76Asp Leu Tyr
Asp Asp Asp Asp Lys 1 5 779PRTArtificial SequenceSynthetic peptide
77Tyr Pro Tyr Asp Val Pro Asp Tyr Ala 1 5
* * * * *