U.S. patent application number 14/818782 was filed with the patent office on 2016-02-04 for pathogen-inducible promoters and their use in enhancing the disease resistance of plants.
The applicant listed for this patent is Two Blades Foundation. Invention is credited to Jens Boch, Ulla Bonas, Thomas Lahaye, Patrick Romer, Sebastian Schornack.
Application Number | 20160032303 14/818782 |
Document ID | / |
Family ID | 41683263 |
Filed Date | 2016-02-04 |
United States Patent
Application |
20160032303 |
Kind Code |
A1 |
Lahaye; Thomas ; et
al. |
February 4, 2016 |
PATHOGEN-INDUCIBLE PROMOTERS AND THEIR USE IN ENHANCING THE DISEASE
RESISTANCE OF PLANTS
Abstract
Methods for producing pathogen-inducible promoters for the
expression of genes in plants are provided. The pathogen-inducible
promoters are inducible by one, two, three, or more plant
pathogens. Methods for producing R genes that are inducible in a
plant by more than one plant pathogen are further provided.
Additionally, provided are R genes and other nucleic acid molecules
comprising the pathogen-inducible promoters and that are made by
such methods as well as plants, plant parts, plant cells, seeds,
and non-human host cells comprising the R genes and other nucleic
acid molecules
Inventors: |
Lahaye; Thomas; (Moessingen,
DE) ; Romer; Patrick; (Riesdorf, DE) ;
Schornack; Sebastian; (Cambridge, GB) ; Boch;
Jens; (Halle (Saale), DE) ; Bonas; Ulla;
(Halle (Saale), DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Two Blades Foundation |
Evanston |
IL |
US |
|
|
Family ID: |
41683263 |
Appl. No.: |
14/818782 |
Filed: |
August 5, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12615506 |
Nov 10, 2009 |
9133467 |
|
|
14818782 |
|
|
|
|
61113206 |
Nov 10, 2008 |
|
|
|
Current U.S.
Class: |
800/279 ;
435/320.1; 435/91.53; 800/301 |
Current CPC
Class: |
C12N 15/8281 20130101;
C12Q 1/6897 20130101; C07K 14/415 20130101; C12N 15/1072 20130101;
C12N 15/8239 20130101; C12N 15/8279 20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82; C07K 14/415 20060101 C07K014/415 |
Claims
1-31. (canceled)
32. A method for making an R gene, said method comprising producing
a nucleic acid molecule comprising a promoter and an operably
linked coding sequence for an R gene product, wherein the promoter
comprises at least two different operably upa boxes and wherein the
promoter is capable of inducing expression in a plant of the
operably linked coding sequence in response to at least two
different TAL effectors.
33. The method of claim 32, wherein said promoter is capable of
driving pathogen-inducible expression of said coding sequence.
34. The method of claim 32, wherein said R gene is capable of
conferring upon a plant comprising said R gene increased resistance
to infection by at least one plant pathogen.
35. The method of claim 32, wherein said upa box occurs in the
native promoter of said R gene.
36. The method of claim 32, wherein said upa box does not occur in
the native promoter of said R gene.
37. The method of claim 32, wherein said R gene product is Bs3.
38. The method of claim of 37, wherein said coding sequence
comprising the nucleotide sequence set forth in SEQ ID NO: 1.
39. A nucleic acid molecule comprising an R gene produced by the
method of claim 32.
40. A transformed plant comprising an R gene produced by the method
of claim 32.
41. A seed of the transformed plant of claim 40, said seed
comprising said R gene.
42. A method for increasing the resistance of a plant to at least
one plant pathogen, said method comprising transforming a plant
cell with an R gene produced by the method of claim 32 and
regenerating a transformed plant from said transformed cell.
43-50. (canceled)
51. The method of claim 32, wherein said R gene is capable of
conferring upon a plant comprising said R gene increased resistance
to infection by at least two plant pathogens.
52. The method of claim 32, wherein at least one of the at least
two upa boxes is selected from the group consisting of
upa.sub.AvrBs3 (SEQ ID NO: 17), upa.sub.AvrBs3.DELTA.rep16 (SEQ ID
NO: 18), upa.sub.AvrXa27 (SEQ ID NO: 22), upa.sub.PthXo1 (SEQ ID
NO: 28 or 33), upa.sub.PthXo6 (SEQ ID NO: 29), uPa.sub.PthXo7 (SEQ
ID NO: 30), UPT.sub.AvrXa7 (SEQ ID NO: 32), UPT.sub.Apl1 (SEQ ID
NO: 35), UPT.sub.Apl2 (SEQ ID NO: 36), UPT.sub.Apl3 (SEQ ID NO:
37), UPT.sub.PthB (SEQ ID NO: 38), UPT.sub.PthA* (SEQ ID NO: 39),
UPT.sub.PthA*2 (SEQ ID NO: 40), UPT.sub.PthAw (SEQ ID NO: 41),
UPT.sub.PthA1 (SEQ ID NO: 42), UPT.sub.PthA2 (SEQ ID NO: 43),
UPT.sub.PthA3 (SEQ ID NO: 44), UPT.sub.pB3.7 (SEQ ID NO: 45),
UPT.sub.HssB3.0 (SEQ ID NO: 46), UPT.sub.PthA (SEQ ID NO: 47),
UPT.sub.PthC (SEQ ID NO: 48), upa.sub.AvrBs3.DELTA.rep16 (SEQ ID
NO: 18), upa.sub.AvrXa27 (SEQ ID NO: 22), upa.sub.PthXo1 (SEQ ID
NO: 28 or 33), upa.sub.PthXo6 (SEQ ID NO: 29), upa.sub.PthXo7 (SEQ
ID NO: 30), UPT.sub.AvrXa7 (SEQ ID NO: 32), UPT.sub.Apl1 (SEQ ID
NO: 35), UPT.sub.Apl2 (SEQ ID NO: 36), UPT.sub.Apl3 (SEQ ID NO:
37), UPT.sub.PthB (SEQ ID NO: 38), UPT.sub.PthA* (SEQ ID NO: 39),
UPT.sub.PthA*2 (SEQ ID NO: 40), UPT.sub.PthAw (SEQ ID NO: 41),
UPT.sub.PthA1 (SEQ ID NO: 42), UPT.sub.PthA2 (SEQ ID NO: 43),
UPTp.sub.PthA3 (SEQ ID NO: 44), UPT.sub.pB3.7 (SEQ ID NO: 45),
UPT.sub.HssB3.0 (SEQ ID NO: 46), and UPT.sub.PthA (SEQ ID NO: 47).
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is divisional of U.S. patent application
Ser. No. 12/615,506, filed Nov. 10, 2009 and issued on Sep. 15,
2015 as U.S. Pat. No. 9,133,467, which is hereby incorporated
herein in its entirety by reference, and claims the benefit of U.S.
Provisional Patent Application No. 61/113,206, filed Nov. 10,
2008.
BACKGROUND OF THE INVENTION
[0002] Plants are hosts to thousands of infectious diseases caused
by a vast array of phytopathogenic fungi, bacteria, viruses,
oomycetes and nematodes. Plants recognize and resist many invading
phytopathogens by inducing a rapid defense response. Recognition is
often due to the interaction between a dominant or semi-dominant
resistance (R) gene product in the plant and a corresponding
dominant avirulence (Avr) gene product expressed by the invading
phytopathogen. R-gene triggered resistance often results in a
programmed cell-death, which has been termed the hypersensitive
response (HR). The HR is believed to constrain spread of the
pathogen.
[0003] How R gene products mediate perception of the corresponding
Avr proteins is mostly unclear. It has been proposed that
phytopathogen Avr products function as ligands, and that plant R
gene products function as receptors. In this receptor-ligand model
binding of the Avr product to a corresponding R gene product in the
plant initiates the chain of events within the plant that produces
HR leads to disease resistance. In an alternate model the R protein
perceives the action rather than the structure of the Avr protein.
In this model the Avr protein is believed to modify a plant target
protein (pathogenicity target) in order to promote pathogen
virulence. The modification of the pathogenicity protein is
detected by the matching R protein and triggers a defense reponse.
Experimental evidence suggests that some R proteins act as Avr
receptors while others detect the activity of the Avr protein.
[0004] The production of transgenic plants carrying a heterologous
gene sequence is now routinely practiced by plant molecular
biologists. Methods for incorporating an isolated gene sequence
into an expression cassette, producing plant transformation
vectors, and transforming many types of plants are well known.
Examples of the production of transgenic plants having modified
characteristics as a result of the introduction of a heterologous
transgene include: U.S. Pat. No. 5,719,046 to Guerineau (production
of herbicide resistant plants by introduction of bacterial
dihydropteroate synthase gene); U.S. Pat. No. 5,231,020 to
Jorgensen (modification of flavenoids in plants); U.S. Pat. No.
5,583,021 to Dougherty (production of virus resistant plants); and
U.S. Pat. No. 5,767,372 to De Greve and U.S. Pat. No. 5,500,365 to
Fischoff (production of insect resistant plants by introducing
Bacillus thuringiensis genes).
[0005] In conjunction with such techniques, the isolation of plant
R genes has similarly permitted the production of plants having
enhanced resistance to certain pathogens. Since the cloning of the
first R gene, Pto from tomato, which confers resistance to
Pseudomonas syringae pv. tomato (Martin et al. (1993) Science 262:
1432-1436), a number of other R genes have been reported (Liu et
al. (2007) J. Genet. Genomics 34:765-776.). A number of these genes
have been used to introduce the encoded resistance characteristic
into plant lines that were previously susceptible to the
corresponding pathogen. For example, U.S. Pat. No. 5,571,706
describes the introduction of the N gene into tobacco lines that
are susceptible to Tobacco Mosaic Virus (TMV) in order to produce
TMV-resistant tobacco plants. WO 95/28423 describes the creation of
transgenic plants carrying the Rps2 gene from Arabidopsis thaliana,
as a means of creating resistance to bacterial pathogens including
Pseudomonas syringae, and WO 98/02545 describes the introduction of
the Prf gene into plants to obtain broad-spectrum pathogen
resistance.
[0006] Bacterial spot disease of tomato and pepper, caused by the
phytopathogenic bacterium Xanthomonas campestris pv. vesicatoria
(Xcv), can be devastating to commercial production of these crops
in areas of the world with high humidity and heavy rainfall. While
control ofXcv in commercial agriculture is based largely on the
application of pesticides, genetic resistance to bacterial spot
disease has been described in both tomato and pepper (Cook and
Stall (1963) Phytopathology 53: 1060-1062; Cook and Guevara (1984)
Plant Dis. 68: 329-330; Kim and Hartman (1985) Plant Dis. 69:
233-235; Jones and Scott (1986) Plant Dis. 70: 337-339). Of the two
hosts, genetic resistance in pepper has been better characterized.
Several single loci (Bs1, Bs2, and Bs3) that confer resistance in a
"gene-for-gene" manner have been identified (Hibberd et al. (1987)
Phytopathology 77: 1304-1307). Moreover, the corresponding
avirulence genes (avrBs1, avrBs2, and avrBs3) have been cloned from
Xcv (Swanson et al. (1988) Mol. Plant-Microbe Interact. 1:5-9;
Minsavage et al. (1990) Mol. Plant-Microbe Interact. 3: 41-47).
Genetic and molecular characterization of these avirulence genes
has provided a great deal of information concerning the interaction
between Xcv and pepper (Kearney et al. (1988) Nature 332: 541-543;
Kearney and Staskawicz (1990) Nature 346: 385-386; Herbers et al.
(1992) Nature 356: 172-174; Van der Ackerveken et al. (1992) Plant
J. 2: 359-366). More recently, the Bs3 gene of pepper has been
isolated and sequenced (U.S. Pat. No. 6,262,343)
[0007] Xcv employs a type III secretion (T3S) system to inject an
arsenal of about 20 effector proteins into the host cytoplasm that
collectively promote virulence (Thieme et al. (2005) J. Bacteriol.
187:7254). R protein mediated defense in response to Xcv effector
proteins is typically accompanied by a programmed cell death
response referred to as the HR. AvrBs3 is one Avr protein that R
proteins recognize and is a member of large family (>100
sequenced members) of highly related bacterial effector proteins
that are present in various Xanthomonas and Ralstonia solanacearum
strains (Schornack et al. (2006) J. Plant Physiol. 163:256). Due to
their structural relatedness to eukaryotic transcription factors
AvrBs3-like proteins are also referred to as TAL (transcription
activator like) effectors. The most characteristic feature of TAL
effectors is the central repeat domain that consists of a variable
number (1.5-28.5) of tandem-arranged, almost identical
34/35-(Xanthomonas/Ralstonia) repeat units. Analysis of AvrBs3 from
Xcv has shown that the repeat domain mediates specific binding to a
promoter element that has been termed "upa box" (Kay et al. (2007)
Science 318:648-651). The full length AvrBs3 protein not only binds
to promoters with a upa box but also transcriptionally activates
these promoters. In pepper genotypes that are susceptible to Xcv,
AvrBs3 binds to and activates the promoter of the upa20 gene, which
causes cell hypertrophy (Kay et al. (2007) Science 318:648-651). In
pepper plants that contain the Bs3 resistance gene, AvrBs3 triggers
a cell death response (i.e., HR) that restricts pathogen growth.
Molecular analysis revealed that the Bs3 promoter contains, like
the upa20 promoter, a upa box. AvrBs3 binds to and
transcriptionally activates the pepper Bs3 promoter thereby
triggering a defense reaction (Romer et al. (2007) Science
318:645-648). Thus the Bs3 promoter represents a DNA-based decoy
receptor. The AvrBs3-deletion derivative AvrBs3.DELTA.rep16 (lacks
repeat units 11-14) does not activate the Bs3 promoter but its
allelic variant Bs3-E (Romer et al. (2007) Science 318:645-648).
Intriguingly the Bs3 and Bs3-E promoter differ in their upa boxes
(herein referred to as "upa.sub.AvrBs3" and
"upa.sub.AvrBs3.DELTA.rep16" boxes, respectively). Thus recognition
specificity of TAL effectors is determined by a) the sum of the
repeat units of a given TAL effector and b) the upa box of a given
host promoter.
[0008] The TAL effector AvrXa27 from the bacterial rice pathogen
Xanthomonas oryzae pv. oryzae (Xoo) activates the promoter of the
matching rice R gene, Xa27 (Gu et al. (2005) Nature 435:1122-1125).
Thus, the R genes Bs3 and Xa27 are both transcriptionally activated
by their matching TAL effectors and thus are identical in their
mechanisms of activation. However, the predicted Bs3 and Xa27
proteins share neither sequence homology to each other nor to the
classical NB-LRR type R proteins. Nevertheless, it seems likely
that AvrXa27- and AvrBs3-mediated activation of host promoters are
mechanistically similar. To date, no report has yet appeared which
provides evidence demonstrating that AvrXa27 binds to the Xa27
promoter and that the Xa27 promoter contains a upa box to which
AvrXa27 binds.
BRIEF SUMMARY OF THE INVENTION
[0009] Methods are provided for making pathogen-inducible promoters
that find use in the expression of genes in plants following
attacks from plant pathogens. The methods of the invention involve
producing a pathogen-inducible promoter comprising one, two, three,
or more upa boxes. By using two or more upa boxes that bind to TAL
effectors from different plant pathogens, particularly bacterial
plant pathogens, the methods can be used to make promoters that are
inducible by two or more plant pathogens.
[0010] Methods are also provided for making an R gene, which finds
use in increasing the resistance of plants to plant pathogens. The
methods of the invention involve producing a nucleic acid construct
comprising a pathogen-inducible promoter operably linked to a
coding sequence of an R gene product. The pathogen-inducible
promoter is made by the methods disclosed herein and comprises one,
two, three, or more upa boxes. In one embodiment of the invention,
the methods are used to produce an R gene that is inducible by two
or more plant pathogens. Such an R gene of the present invention
comprises a promoter having two or more upa boxes, with each upa
box being inducible by a different plant pathogen, particularly a
bacterial plant pathogen that produces a TAL effector.
[0011] Methods are further provided for identifying a upa box in
the promoter of a gene from a plant. The methods involve exposing a
plant, plant part, or plant cell to a TAL effector and then
identifying two or more genes in the plant, plant part, or plant
cell, wherein the expression of these genes is directly induced
following exposure to said TAL effector. The methods further
involve comparing the promoters of the two or more genes to
identify one or more nucleotide sequences comprising a potential
upa box, assaying any such nucleotide sequence for upa-box
activity. Finally, the methods involve identifying a upa box as a
nucleotide sequence that comprises upa-box activity.
[0012] Additionally provided are isolated nucleic acid molecules,
expressions cassettes, nucleic acid or polynucleotide constructs,
plants, plant parts, plant cells, seeds, and non-human host cells
comprising the pathogen-inducible promoters, upa boxes, and R genes
of the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1A. Schematic representation of the constructs that
were used to study functionality of the upa box. Green and pink
boxes represent the Bs3/Bs3-E promoter and the Bs4 promoters
respectively. Small orange and blue boxes represent the
upa.sub.AvrBs3 and upa.sub.AvrBs3.DELTA.rep16 boxes, respectively.
Please note that the Bs3 and Bs3-E promoters differ only within
these boxes but are otherwise identical and are therefore displayed
in identical color. A white line within the upa.sub.AvrBs3 box
marks a mutation in this box. Numbers adjacent to the upa boxes
define their distance to the ATG start codon. Gray boxes represent
the coding region of the Bs3 gene.
[0014] FIG. 1B. Functional analysis of different Bs3 and Bs4
promoter derivatives. The depicted promoter derivatives were
delivered together with a 35S-driven avrBs3 gene into Nicotiana
benthamiana leaves via Agrobacterium tumefaciens (OD600=0.8).
Dashed lines mark the inoculated areas. Four days after
infiltration, the leaves were cleared to visualize the HR (dark
areas). Please note, that delivery of a 35S-driven avrBs3 does
trigger on its own a weak reaction (see `empty`). Thus, only dark
areas (marked with an asterisk [*]) represent functional
promoters.
[0015] FIG. 2A. Schematic representation of the constructs that
were used to study the promoter polymorphisms between the Xa27 and
xa27 promoters and the functional relevance of these polymorphisms.
Yellow, orange and pink boxes represent the xa27, Xa27, and Bs4
promoters, respectively. A black box represents the upa.sub.AvrXa27
box. Two nucleotide polymorphisms between the upa box of the xa27
promoter (not induced by AvrXa27) and the Xa27 promoter (induced by
AvrXa27) are represented by two white lines. The xa27 and Xa27
promoters show in total 15 polymorphisms in a region of about 1 kb
and are therefore displayed in different colors. The light gray and
dark gray boxes represent the coding regions of the pepper Bs3 and
tomato Bs4 genes.
[0016] FIG. 2B. Functional analysis of polymorphisms between the
Xa27 and xa27 promoter. The depicted promoter derivatives were
delivered together with a 35S-driven avrXa27 gene into Nicotiana
benthamiana leaves via Agrobacterium tumefaciens (OD600=0.8).
Dashed lines mark the inoculated areas. Four days after
infiltration, the leaves were cleared to visualize the HR (dark
areas). Dark areas (marked with an asterisk [*]) represent
functional promoters.
[0017] FIG. 3A. Schematic representation of the constructs that
were used to study the functionality of complex promoters combining
nucleotide sequence comprising the upa boxes of Bs3, Bs3-E, and
Xa27 promoters. Green, yellow, orange and pink boxes represent the
Bs3, xa27, Xa27, and the Bs4 promoter, respectively. Blue, brown
and black boxes represent the upa boxes from the Bs3, Bs3-E, and
the Xa27 promoter. Two nucleotide polymorphisms between the upa box
of the xa27 promoter (not induced by AvrXa27) and the Xa27 promoter
(induced by AvrXa27) are represented by two white lines within the
blue box. The xa27 and Xa27 promoter show in total 15 polymorphisms
in a region of about 1 kb and are therefore displayed in different
colors. The Bs3 and Bs3-E promoters differ only within their upa
boxes but are otherwise identical and are therefore displayed in
identical color. The black and gray boxes represent the coding
regions of the pepper Bs3 and tomato Bs4 genes.
[0018] FIG. 3B. Functional analysis of a complex promoter that
combines the recognition specificity of the Bs3, Bs3-E and Xa27
promoters. The depicted promoter derivatives were delivered
together with a 35S-driven avrBs3 gene (leaf on the left side), a
35-driven avrXa27 gene (leaf in the center) or a 35S-driven
avrBs3.DELTA.rep16 gene (leaf on the right side) into Nicotiana
benthamiana leaves via Agrobacterium tumefaciens (OD600=0.8).
Dashed lines mark the inoculated areas. Four days after
infiltration, the leaves were cleared to visualize the HR (dark
areas). Dark areas (marked with an asterisk [*]) represent
functional promoters.
SEQUENCE LISTING
[0019] The nucleotide and amino acid sequences listed in the
accompanying sequence listing are shown using standard letter
abbreviations for nucleotide bases, and three-letter code for amino
acids. The nucleotide sequences follow the standard convention of
beginning at the 5' end of the sequence and proceeding forward
(i.e., from left to right in each line) to the 3' end. Only one
strand of each nucleic acid sequence is shown, but the
complementary strand is understood to be included by any reference
to the displayed strand. The amino acid sequences follow the
standard convention of beginning at the amino terminus of the
sequence and proceeding forward (i.e., from left to right in each
line) to the carboxy terminus.
[0020] SEQ ID NO: 1 sets forth a nucleotide sequence comprising the
coding sequence of the pepper Bs3 gene. The nucleotide sequence can
be found in Accession No. EU078684.
[0021] SEQ ID NO: 2 sets forth a nucleotide sequence comprising the
coding sequence of the tomato Bs4 gene. The nucleotide sequence can
be found in Accession No. AY438027.
[0022] SEQ ID NO: 3 sets forth a nucleotide sequence comprising the
promoter of the the Bs3 gene. The nucleotide sequence can be found
in Accession No. EU078684.
[0023] SEQ ID NO: 4 sets forth a nucleotide sequence comprising the
promoter of the Bs3-E allele of the Bs3 gene. The nucleotide
sequence can be found in Accession No. EU078683.
[0024] SEQ ID NO: 5 sets forth the nucleotide sequence of the Bs3
upa.sub.mut promoter.
[0025] SEQ ID NO: 6 sets forth the nucleotide sequence of the Bs3
upa.sub.294 promoter.
[0026] SEQ ID NO: 7 sets forth the nucleotide sequence of the Bs3
upa.sub.424 promoter.
[0027] SEQ ID NO: 8 sets forth a nucleotide sequence comprising the
promoter of the the Bs4 gene. The nucleotide sequence can be found
in Accession No. AY438027.
[0028] SEQ ID NO: 9 sets forth the nucleotide sequence of the Bs4
upa promoter.
[0029] SEQ ID NO: 10 sets forth the nucleotide sequence of the Bs4
upa.sub.mut promoter.
[0030] SEQ ID NO: 11 sets forth a nucleotide sequence comprising
the promoter of the the rice Xa27 gene. The nucleotide sequence can
be found in Accession No. AY986492.
[0031] SEQ ID NO: 12 sets forth a nucleotide sequence comprising
the promoter of the the rice xa27 gene. The nucleotide sequence can
be found in Accession No. AY986491.
[0032] SEQ ID NO: 13 sets forth the nucleotide sequence of the
Bs3+Bs3-E promoter.
[0033] SEQ ID NO: 14 sets forth the nucleotide sequence of the
Bs3+Xa27+Bs3-E promoter.
[0034] SEQ ID NO: 15 sets forth the nucleotide sequence of the
Bs3+Xa27 promoter.
[0035] SEQ ID NO: 16 sets forth the nucleotide sequence of the
Bs3+xa27+Bs3-E promoter.
[0036] SEQ ID NO: 17 sets forth the nucleotide sequence of the
upa.sub.AvrBs3 box.
[0037] SEQ ID NO: 18 sets forth the nucleotide sequence of the
upa.sub.AvrBs3.DELTA.rep16 box.
[0038] SEQ ID NO: 19 sets forth the nucleotide sequence of the Bs3
upa.sub.mut box.
[0039] SEQ ID NO: 20 sets forth a nucleotide sequence comprising
the upa.sub.AvrBs3 box.
[0040] SEQ ID NO: 21 sets forth a nucleotide sequence comprising a
mutated upa.sub.AvrBs3 box.
[0041] SEQ ID NO: 22 sets forth the nucleotide sequence of the
upa.sub.AvrXa27 box.
[0042] SEQ ID NO: 23 sets forth a nucleotide sequence comprising
the upa.sub.AvrXa27 box.
[0043] SEQ ID NO: 24 sets forth a nucleotide sequence comprising
the upa.sub.AvrBs3.DELTA.rep16 box.
[0044] SEQ ID NO: 25 sets forth the consensus nucleotide sequence
of the upa box, a conserved DNA element that was shown to be bound
by AvrBs3 by Kay et al. (2007) Science 318(5850): 648-651.
[0045] SEQ ID NO: 26 sets forth a nucleotide sequence comprising
the upa.sub.AvrBs3 box.
[0046] SEQ ID NO: 27 sets forth a nucleotide sequence comprising
the upa.sub.AvrBs3.DELTA.rep16 box.
[0047] SEQ ID NO: 28 sets forth the nucleotide sequence of the
upa.sub.PthXo1 box.
[0048] SEQ ID NO: 29 sets forth the nucleotide sequence of the
upa.sub.PthXo6 box.
[0049] SEQ ID NO: 30 sets forth the nucleotide sequence of the
upa.sub.PthXo7 box.
[0050] SEQ ID NO: 31 sets forth the nucleotide sequence of the
UPT.sub.Pthxo6 box of the rice OsTFX1 gene.
[0051] SEQ ID NO: 32 sets forth the nucleotide sequence of the
UPT.sub.AvrXa7 box of the rice Os11N3 gene.
[0052] SEQ ID NO: 33 sets forth the nucleotide sequence of the
UPT.sub.PthXo1 box of the rice OsXa13 gene.
[0053] SEQ ID NO: 34 sets forth the nucleotide sequence of the
complex promoter disclosed in Example 8.
[0054] SEQ ID NO: 35 sets forth the nucleotide sequence of the
UPT.sub.Apl1 box used in the complex promoter comprising the
nucleotide sequence set forth in SEQ ID NO: 34.
[0055] SEQ ID NO: 36 sets forth the nucleotide sequence of the
UPT.sub.Apl2 box used in the complex promoter comprising the
nucleotide sequence set forth in SEQ ID NO: 34.
[0056] SEQ ID NO: 37 sets forth the nucleotide sequence of the
UPT.sub.Apl3 box used in the complex promoter comprising the
nucleotide sequence set forth in SEQ ID NO: 34.
[0057] SEQ ID NO: 38 sets forth the nucleotide sequence of the
UPT.sub.PthB box used in the complex promoter comprising the
nucleotide sequence set forth in SEQ ID NO: 34.
[0058] SEQ ID NO: 39 sets forth the nucleotide sequence of the
UPT.sub.PthA* box used in the complex promoter comprising the
nucleotide sequence set forth in SEQ ID NO: 34.
[0059] SEQ ID NO: 40 sets forth the nucleotide sequence of the
UPT.sub.PthA*2 box used in the complex promoter comprising the
nucleotide sequence set forth in SEQ ID NO: 34.
[0060] SEQ ID NO: 41 sets forth the nucleotide sequence of the
UPT.sub.PthAw box used in the complex promoter comprising the
nucleotide sequence set forth in SEQ ID NO: 34.
[0061] SEQ ID NO: 42 sets forth the nucleotide sequence of the
UPT.sub.PthA1 box used in the complex promoter comprising the
nucleotide sequence set forth in SEQ ID NO: 34.
[0062] SEQ ID NO: 43 sets forth the nucleotide sequence of the
UPT.sub.PthA2 box used in the complex promoter comprising the
nucleotide sequence set forth in SEQ ID NO: 34.
[0063] SEQ ID NO: 44 sets forth the nucleotide sequence of the
UPT.sub.PthA3 box used in the complex promoter comprising the
nucleotide sequence set forth in SEQ ID NO: 34.
[0064] SEQ ID NO: 45 sets forth the nucleotide sequence of the
UPT.sub.pB3.7 box used in the complex promoter comprising the
nucleotide sequence set forth in SEQ ID NO: 34.
[0065] SEQ ID NO: 46 sets forth the nucleotide sequence of the
UPT.sub.HssB3.0 box used in the complex promoter comprising the
nucleotide sequence set forth in SEQ ID NO: 34.
[0066] SEQ ID NO: 47 sets forth the nucleotide sequence of the
UPT.sub.PthA box used in the complex promoter comprising the
nucleotide sequence set forth in SEQ ID NO: 34.
[0067] SEQ ID NO: 48 sets forth the nucleotide sequence of the
UPT.sub.PthC box used in the complex promoter comprising the
nucleotide sequence set forth in SEQ ID NO: 34.
DETAILED DESCRIPTION OF THE INVENTION
[0068] Recently, the pepper (Capsicum annuum) Bs3 resistance (R)
gene was isolated, sequenced, and characterized. See, Romer et al.
(2007) Science 318:645-648, U.S. Patent Application Publication No.
2009/0133158, and WO 2009/042753; all of which are hereby
incorporated in their entirety by reference. Molecular analysis
revealed that the Bs3 promoter contains an element known as a upa
box and that the bacterial effector protein AvrBs3 binds to the upa
box and activates the Bs3 promoter.
[0069] The present invention is based on several discoveries as
disclosed hereinbelow that were made during the further
characterization of the upa box of the Bs3 promoter (referred to
herein as upa.sub.AvrBs3) and the upa boxes of the pepper Bs3-E
promoter (referred to herein as upa.sub.AvrBs3.DELTA.rep16) and the
rice (Oryza sativa) Xa27 promoter (referred to herein as
upa.sub.AvrXa27). First, the function or biological activity of the
upa.sub.AvrBs3 box was found not to depend on its position within
the Bs3 promoter. Second, the function or biological activity of
the upa.sub.AvrBs3 box is not dependent on being within the Bs3
promoter. That is the upa.sub.AvrBs3 was discovered to function in
the same or similar manner when inserted into a promoter other than
the Bs3 promoter. Third, the combination of the TAL effector,
AvrXa27, and the promoter of the R gene Xa27 can functionally
replace AvrBs3 and the Bs3 promoter. This discovery is based on the
results of an experiment (see, Example 3 below) involving the
construction of a fusion gene comprising the Xa27 promoter operably
linked to a nucleotide sequence encoding Bs3. After this construct
was co-delivered to Nicotiana benthamiana leaves with a nucleotide
sequence comprising a constitutive promoter operably linked to an
avrXa27 coding sequence, a hypersensitive response was observed in
the leaves. Fourth, functionally relevant nucleotide polymorphisms
between the Xa27 and xa27 promoters are located adjacent to the
predicted TATA box of these promoters. This discovery reveals that
upa.sub.AvrXa27 is found near the vicinity for the TATA box in the
Xa27 promoter. Fifth, the upa boxes of the Bs3, Bs3-E and Xa27
promoters can be functionally combined in one complex promoter.
This discovery reveals that upa boxes from three or more different
R genes that are each specific for TAL effectors from different
plant pathogens can be combined into a single promoter that is
directly inducible by the TAL effectors of the different
pathogens.
[0070] The present invention provides methods for making a
pathogen-inducible promoter. The methods comprise producing a
nucleic acid molecule that comprise a nucleotide sequence having a
5' end nucleotide and a 3' end nucleotide, wherein the nucleotide
sequence comprises at least one upa box having a 5' end nucleotide
and a 3' end nucleotide, and wherein said 3' end nucleotide of said
upa box is not said 3' end nucleotide of said nucleotide sequence.
A pathogen-inducible promoter produced by the methods of the
invention is capable of driving pathogen-inducible expression of a
polynucleotide that is operably linked to the said 3' end of the
promoter sequence. Such promoters find use in driving the
pathogen-inducible expression of an operably linked polynucleotide
particularly a polynucleotide encoding an R gene product.
[0071] For the present invention, "upa box" is intended to mean a
promoter element that specifically binds with an AvrBs3-like
protein, also referred to as a TAL effector, and that a promoter
comprising such a upa box is capable, in the presence of its TAL
effector, of inducing or increasing the expression of an operably
linked nucleic acid molecule. Recently, such "upa boxes" have been
referred to as "UPT boxes," where "UPT" stands for "UPregulated by
TAL effectors" (Romer et al. (2009) Proc. Natl. Acad. Sci. USA, in
press). Unless stated otherwise or readily apparent from the
context, "upa box" and "UPT box" as used herein are equivalent
terms that can be used interchangeably and that do not differ in
meaning and/or scope.
[0072] The methods disclosed herein do not depend on the upa box
being in a particular position for the upa box to function within a
pathogen-inducible promoter of the present invention. However, the
position of the 3' end nucleotide of the upa box is at least about
one nucleotide from the 3' end nucleotide of the nucleotide
sequence of the promoter. In embodiments of the invention, at least
2, 5, 10, 25, 50, 100, 125, 150, 200, 300, 500, 750, 1000, or more
nucleotides separate the 3' end nucleotide of the upa box and the
3' end nucleotide of the promoter of the invention. In a preferred
embodiment of the invention, the 3' end nucleotide of the upa box
is at least about 50 nucleotides from the 3' end nucleotide of the
promoter or at least about 50 nucleotides upstream of the
transcriptional start site. In one embodiment, the 5' end
nucleotide of the upa box is the 5' end nucleotide of the promoter
nucleotide sequence. In other embodiments, the 5' end nucleotide of
the upa box is 1, 2, 5, 10, 25, 50, 100, 125, 150, 200, 300, 500,
750, 1000, or more nucleotides 3' of the 5' end of the promoter
nucleotide sequence.
[0073] By "producing a nucleic acid molecule" is intended the
making of a nucleic acid molecule by any known methods including,
but not limited to, chemical synthesis of the entire nucleic acid
molecule or parts or parts thereof, modification of a pre-existing
nucleic acid molecule, such as, for example, a DNA molecule
comprising the promoter of an Bs3 or other R gene, by molecular
biology methods such as, for example, restriction endonuclease
digestion and ligation, and the combination of chemical synthesis
and modification.
[0074] The methods of the present invention can be used to make
pathogen-inducible promoters comprising at least two upa boxes,
particularly pathogen-inducible promoters comprising 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more upa
boxes. In such methods, the first of the at least two upa boxes has
a 5' end nucleotide and a 3' end nucleotide and the second and any
additional two upa boxes each have a 5' end nucleotide and a 3' end
nucleotide. The first upa box is positioned within the promoter, 3'
of the second and any additional upa boxes. For any promoter of the
present invention comprising two or more upa boxes, any of the two
or more upa boxes can be identical to each other, but preferably,
each of the two or more upa boxes is different from the other upa
boxes and is capable of inducing expression in response to a
different TAL effector.
[0075] The methods of the present invention do not depend on the
two or more upa boxes being separated within the promoter
nucleotide sequence by a particular number of contiguous
nucleotides. Each of the upa boxes can be adjacent to each other or
separated in the promoter nucleotide sequence by 2, 5, 10, 25, 50,
100, 125, 150, 200, 300, 500, 750, 1000, or more nucleotides.
[0076] In the methods disclosed herein, a promoter of gene that
already comprises a upa box can be used. Such a gene, for example,
is the native promoter of the R gene, Bs3 gene. The promoter of Bs3
is set forth in SEQ ID NO: 3. By "native promoter of an R gene" is
intended to mean the promoter, or functional part thereof, of a
naturally occurring plant R gene. With such a native promoter, the
methods disclosed herein can be used to make pathogen-inducible
promoter comprising one or more additional upa boxes. Such upa
boxes can be inserted between the 5' end nucleotide and 3' end
nucleotide of the native promoter or other promoter comprising a
upa box, but preferably not within the upa box that is present in
the native promoter or other promoter comprising a upa box.
Alternatively or additionally, the additional upa boxes can be
attached, ligated, or otherwise covalently bound to either the 5'
and/or 3' ends of the native promoter or other promoter to produce
a pathogen-inducible promoter comprising a contiguous nucleotide
sequence. It is recognized that additional nucleotide sequences may
be added when one or more upa boxes are inserted into, or attached,
ligated, or covalently bound to a native promoter or other promoter
comprising a upa box.
[0077] In one embodiment, the present invention provides a method
for making a promoter that is inducible by two or more pathogens.
The method involves producing a promoter comprising two or more upa
boxes as described supra. Such a promoter comprises at least two
different upa boxes, each of which binds to a TAL effector from a
different plant pathogen. Promoters made by this method include,
for example: a promoter comprising a upa box from the Bs3 promoter
and a upa box from the Bs3-E promoter; a promoter comprising a upa
box from the Bs3 promoter, a upa box from the Bs3-E promoter; and a
upa box from the Xa27 promoter; and a promoter comprising a upa box
from the Bs3 promoter and a upa box from the Xa27 promoter.
Examples of these promoters have the nucleotide sequences set forth
in SEQ ID NOS: 13-16. In a preferred embodiment, the methods of the
invention are used to produce a pathogen-inducible promoter that is
inducible by two or more different bacterial pathogens that are
known to infect and cause economic damage to the same plant
species, particularly a crop plant, more particularly rice, pepper,
and a citrus species.
[0078] The methods of the present invention do not depend on the
use of any particular upa boxes. Any upa box can be used in the
methods disclosed herein. The methods for making a
pathogen-inducible promoter of the present invention further
comprise the use of upa boxes identified by additional methods of
present invention that are disclosed herein below. Upa boxes of the
present invention include but are not limited to upa.sub.AvrBs3,
upa.sub.AvrBs3.DELTA.rep16, upa.sub.AvrXa27, upa.sub.PthXo1,
upa.sub.PthXo6 and upa.sub.Pthxo7. Nucleotide sequences comprising
upa boxes include, but at not limited, to SEQ ID NOS: 17, 18, 20,
22, 24, 28-33, and 35-48.
[0079] The present invention provides methods for making an R gene,
said method comprising producing a nucleic acid molecule comprising
a promoter and an operably linked coding sequence for an R gene
product. An R gene produced by the methods disclosed herein is
capable of conferring upon a plant comprising said R gene increased
resistance to infection by at least one plant pathogen. In a
preferred embodiment, an R gene produced by the methods disclosed
herein is capable of conferring upon a plant comprising said R gene
increased resistance to infection by two or more plant pathogens,
particularly bacterial plant pathogens, more particularly bacterial
plant pathogens that produce at least one TAL effector. The methods
of the present invention find use in making new R genes for use in
producing crop plants and trees with enhanced resistance to one or
more plant pathogens, thereby allowing for increased agricultural
production while at the same time reducing the cost and negative
environmental impact associated with the application of pesticides
to crop plants and trees.
[0080] By "R gene product" is intended the gene product of a plant
resistant gene referred to an R gene. For the present invention,
such an R gene product is a protein that, when expressed in a
plant, particularly at the site of infection of a pathogen, is
capable of causing a hypersensitive response (HR) which is
characterized by a programmed cell death response in the immediate
vicinity of the pathogen. The methods of the present invention do
not depend on the use of particular coding sequence for an R gene
product. Any coding sequence of any R gene product can be employed
in the methods disclosed herein. A preferred coding sequence is any
nucleotide sequence comprising the coding sequence for the Bs3
protein or biologically active fragment or variant thereof. An
example of such a Bs3 coding sequence is set forth in SEQ ID NO: 1.
The nucleotide sequence of the Bs3 gene and coding sequence and the
amino acid sequence of the Bs3 protein are available at GenBank
(http://www.ncbi.nlm.nih.gov/) as Accession No. EU078684, which is
herein incorporated in its entirety by reference.
[0081] The methods of the present invention for making an R gene
involve producing a nucleic acid molecule comprising a promoter and
an operably linked coding sequence for an R gene product. Such a
promoter comprises one or more upa boxes and can be produced the
methods for making a pathogen-inducible promoter as disclosed
herein. Such a promoter is capable of driving pathogen-inducible
expression of the coding sequence for the R gene product. In one
embodiment of the invention, the promoter comprises a native
promoter of an R gene to which a upa box is added by the methods
disclosed herein. Preferably, such a native promoter comprises at
least one upa box that is different from the upa box that is added.
More preferably, the promoter comprises two or more upa boxes that
bind to different TAL effectors that from different plant pathogens
that infect the same plant species.
[0082] The R genes of present invention find further use in methods
for increasing the resistance of a plant to at least one plant
pathogen. These methods of the invention comprise transforming a
plant cell with an R gene produced by the methods of the present
invention and regenerating a transformed plant from said
transformed cell.
[0083] In one embodiment, the methods of the invention for making
an R gene can be used to make an R genes specific to a particular
bacterial pathogen when no naturally occurring R gene specific to
the pathogen is known to exist. For example, most citrus species
are susceptible to Xanthomonas citri, which is known to make at
least three AvrBs3-like proteins. However, no R gene against
Xanthomonas citri is known to exist in citrus species. Using the
methods of the present invention, one or more upa boxes can be
determined for a particular citrus plant species and a
pathogen-inducible promoter comprising the upa box can be produced.
Such upa boxes include, but are limited to, UPT.sub.Apl1,
UPT.sub.Apl2, UPT.sub.Apl3, UPT.sub.pthB, UPT.sub.pthA*,
UPT.sub.pthA*2, UPT.sub.PthAw, UPT.sub.PthA1, UPT.sub.PthA2,
UPT.sub.PthA3, UPT.sub.pB3.7, UPT.sub.HssB3.0, UPT.sub.PthA, and
UPT.sub.PthC, and the UPT boxes comprising the nucleotide sequences
set forth in SEQ ID NOS: 35-48. A non-limiting example of a
pathogen-inducible promoter of the present invention that comprises
14 UPT boxes for citrus canker pathogen TAL effectors comprises the
nucleotide sequence set fort in SEQ ID NO: 34. The 14 UPT boxes in
this promoter are UPT.sub.Apl1, UPT.sub.Apl2, UPT.sub.Apl3,
UPT.sub.PthB, UPT.sub.PthA*, UPT.sub.PthA*2, UPT.sub.PthAw,
UPT.sub.PthA1, UPT.sub.PthA2, UPT.sub.PthA3, UPT.sub.pB3.7,
UPT.sub.HssB3.0, UPT.sub.PthA, and UPT.sub.Pthc and comprise the
nucleotide sequences set forth in SEQ ID NOS: 35-48,
respectively.
[0084] The methods of the present invention can be used to make a
pathogen-inducible promoter that is inducible in a citrus plant
species by one or more Xanthomonas citri strains and/or other
citrus canker-causing Xanthomonas strains and that can be fused to
a coding sequence for an R gene product. The coding sequence for
any R gene product that is capable of causing a HR in the citrus
plant species can be used. Such a coding sequence for any R gene
product can originate from a native R gene of the citrus species
wherein the R gene is specific to pathogen other than Xanthomonas
citri or other citrus canker-causing Xanthomonas strains.
Alternatively, the coding sequence for the R gene product can
originate from R gene that is from a different plant species.
[0085] The methods of the present invention provide
pathogen-inducible promoters and R genes comprising such
pathogen-inducible promoters. In preferred embodiments of the
invention, pathogen-inducible promoters and R genes comprising such
pathogen-inducible promoters are inducible by two or more different
plant pathogens, particularly bacterial plant pathogens. For the
purposes of present different plant pathogens or different
bacterial plant pathogens include different pathovars or strains
within in the same species. For example, the rice pathogens,
Xanthomonas oryzae pv. oryzae (Xoo) and Xanthomonas oryzae pv.
oryzicola (Xoc) are considered different plant pathogens or
different bacterial plant pathogens. Even different strains within
a particular pathovar are different plant pathogens or different
bacterial plant pathogens for the present invention, when such
strains differ in their complements of TAL effectors.
[0086] The present invention additionally provides methods for
identifying a upa box in the promoter of a gene from a plant. The
methods involve exposing a plant, plant part, or plant cell to a
TAL effector. The present invention does not depend a particular
method exposing a plant, a plant part, or a plant cell. The
exposing can comprise applying at least one bacterial cell to said
plant, plant part, or plant cell, wherein said bacterial cell
produces said TAL effector. Such a bacterial cell can be, for
example, a plant pathogenic bacterial cell that expresses the TAL
effector from its native genome. Alternatively, the TAL effector or
an expression cassette suitable for the expression of an
AvrBs3-like protein in a plant can presented or introduced on or
into a plant by any know method including, for example, injection,
addition to a cell culture medium, spraying, and infiltration. It
is further recognized an expression cassette suitable for the
expression of an AvrBs3-like protein in a plant can be part of a
T-DNA within an Agrobacterium and that that plant can be exposed to
the expression cassette by Agrobacterium-mediated delivery, which
can involve, but does not depend on, infiltration of the
Agrobacterium into a plant, a plant part, or a plant cell.
[0087] The methods for identifying a upa box in the promoter of a
gene from a plant further involve, after exposing the plant, the
plant part, or the plant cell to the TAL effector, identifying at
least two genes in the plant, plant part, or plant cell, wherein
the expression of the two or more genes are directly induced
following exposure to said TAL effector. Preferably, at least
three, four, five, or more genes are identified are directly
induced following exposure to said TAL effector. A gene that is
"directly induced" following the application of a TAL does not
require any protein synthesis to occur for the induction of the
gene, and protein synthesis can be blocked by the application of a
protein synthesis inhibitor such as, for example, cycloheximide,
and induction of the gene still occurs following exposure to the
TAL effector. Typically, the protein synthesis inhibitor is added a
few minutes before, but preferably at the same time as, the plant,
the plant part, or the plant cell is first exposed to the TAL
effector. It is recognized that the protein synthesis inhibitor can
be added shortly after (e.g., 1-5 minutes) the plant, the plant
part, or the plant cell is first exposed to the TAL effector to
block effectively the expression of genes that require protein
synthesis for their expression following exposure of the plant, the
plant part, or the plant cell to the TAL effector.
[0088] The methods of the present invention do not depend on a
particularly method identifying genes that display increased
expression in the plant, the plant part, or the plant cell
following exposure to the TAL. Any methods can be used including,
but not limited to, differential display (Liang & Pardee (1992)
Science 257:967-971; Sompayrac et al. (1995) Nuc. Acids Res.
23:4738-4739; Bartlett (2003) Methods Mol. Biol. 226:217-224),
serial analysis of gene expression (SAGE) (Velculescu et al. (1995)
Science 270:484-487; Tuteja & Tuteja (2004) Bioessays
26:916-922), and analysis of DNA microarrays (DeRisi et al. (1997)
Science 278:680-686; Schena et al. (1998) Trends Biotechnol. 1998;
16:217-218; Schulze & Downward (2001) Nature Cell Biol.
3:E190-E195). It is recognized that timing of when increased gene
expression is detectable will vary depending on number factors
including, for example, the particular host plant and TAL effector
combination, environmental conditions, and exposure method.
Typically for the methods of the present invention, the optimal
timing for harvesting plant tissue for use in gene expression
analysis is between 4 and 48 hours after exposure to the TAL
effector, preferably between 12 and 36 hours, more preferably
between about 18 and 30 hours, and most preferably at 24 hours
after exposure to the TAL effector. It is further recognized that
once genes are identified, the nucleotide sequences of the genes or
parts thereof (i.e., promoter regions) can be obtained by standard
methods such as, for example, cloning and sequencing. It is
recognized that one ore more genes may already be known that
display increased expression in the plant, the plant part, or the
plant cell following exposure to the TAL. In such a circumstance,
the identifying step does not require any experimentation. The
methods of the invention additionally involve obtaining the
nucleotide sequences of the two or more genes, particularly the
promoter regions or part thereof. Such nucleotide sequences can be
obtained by standard sequence methods or from nucleotide sequence
databases, if the gene sequence is already known.
[0089] The methods for identifying a upa box in the promoter of a
gene from a plant further involve comparing the nucleotide
sequences of the promoters of said at least two or more genes to
identify at least one nucleotide sequence subsequence comprising at
least one potential upa box. The methods additionally involve
assaying at least one nucleotide molecule comprising said
subsequence for upa-box activity and identifying a upa box when
said subsequence comprises upa-box activity.
[0090] For example, the methods of the present invention can be
used to identify upa boxes in any plant. Preferred plants include
plants of economic importance and that are known to suffer damage
from bacterial pathogens. Such preferred plants include, but are
not limited to crop plants, fruit trees, timber species, and
ornamental plants. In one embodiment of the invention, the methods
for identifying a upa box are used to identify a upa box in rice.
Several bacterial pathogens that infect rice plants are known to
produce AvrBs3-like proteins (also known as TAL effectors). For
example, strains of the rice pathogen Xanthomonas oryzae pv. oryzae
are known to produce up to 19 AvrBs3-like proteins. For three of
these AvrBs3-like proteins PthXo1, PthXo6, and PthXo7 (Yang et al.
(2006) Proc. Natl. Acad. Sci. USA 103:10503-10508; Sugio et al.
(2007) Proc. Natl. Acad. Sci. USA 104:10720-10725; Salzberg et al.
(2008) BMC Genomics 9:204), corresponding host genes have been
identified. Nucleotide and amino acid sequences for these three
AvrBs3-like proteins are set forth in Accession Nos. YP001912775,
AAS46025, ABB70183, YP001913452, ABB70129, and YP001911730; each of
which is herein incorporated in its entirety by reference. In
addition, rice genes that are induced by each of these AvrBs3-like
proteins are also known. For PthXo1, the rice gene is Os8N3 (also
know as Xa13) (Accession Nos. ABD78944 and ABD78943; each of which
is herein incorporated in its entirety by reference). For PthXo6,
the rice gene is OsTFX1 (Accession No. AK108319; herein
incorporated in its entirety by reference). For PthXo7, the rice
gene is OsTFIIA1.gamma. (Accession No. CB097192; herein
incorporated in its entirety by reference). Using the methods
disclosed herein, a upa box that binds to each of these three
AvrBs3-like proteins can be identified.
[0091] In the description herein of the present invention,
reference is made to a upa box binding to a TAL effector and to
"upa-box activity." Unless expressly stated otherwise or obvious
from the context, such binding refers to binding that occurs
between a upa box and a TAL effector, wherein such binding is
capable of causing the expression of a polynucleotide molecule that
is operably linked to a promoter comprising the upa box. Similarly,
a upa box displays "upa-box activity" when, in the presence of an
corresponding TAL effector, a nucleic acid molecule or promoter
comprising the upa box directs in a plant, plant part, or plant
cell the expression of a polynucleotide molecule that is operably
linked to the nucleic acid molecule or promoter comprising the upa
box. Such upa-box activity can be assayed, for example, by the
transient expression assay as described herein below. Such a
transient assay involves the co-delivery of both a gene encoding
the TAL effector and a polynucleotide construct comprising a
polynucleotide molecule operably linked to the nucleic acid
molecule comprising the upa box. Such an assay is also described in
U.S. Patent Application Publication No. 2009/0133158, and WO
2009/042753, and Romer et al. (2007) Science 318:645-648.
[0092] The present invention additionally provides isolated nucleic
acid molecules comprising at least one of the pathogen-inducible
promoters that are made by the methods disclosed herein, at least
one of the upa boxes of the present invention, and/or an R gene
that is produced by the methods disclosed herein. The nucleic acid
molecules of the invention include, but are not limited to, those
comprising the nucleotide sequences set forth in SEQ ID NOS: 6, 7,
9, 11, 13-18, 20, 22, 24, and 28-48 and fragments and variants
thereof that comprise upa-box activity. Such isolated nucleic acid
molecules find use in producing plants, particularly crop plants,
with enhanced resistance to one or more plant pathogens. The
invention further provides expression cassettes, plants, plant
parts, plant cells, seeds and non-human host cells comprising the
nucleic acid molecules of the present invention.
[0093] The methods for increasing the resistance of a plant to at
least one plant pathogen can involve one or R genes in addition to
an R gene produced by the methods of the present invention. The
additional R gene or genes can increase the resistance of a plant
to a single plant pathogen or increase plant resistant to different
plant pathogen. For example, a pepper plant comprising the Bs2
and/or Bs3 resistance genes can be transformed with an R gene of
the present invention. The nucleotide sequences of the Bs2 and Bs3
have been previously disclosed. See, U.S. Pat. Nos. 6,262,343 and
6,762,285 and Accession No. EU078684; each of which is herein
incorporated by reference.
[0094] Thus, the invention further provides methods for expressing
a gene of interest in a plant, plant part, or plant cell. The
methods involve operably linking a promoter of the present
invention to a gene of interest so as to produce a polynucleotide
construct. Such genes of interest will depend on the desired
outcome and can comprise nucleotide sequences that encode proteins
and/or RNAs of interest. The methods further involve transforming
at least one plant cell with the polynucleotide construct. The
methods can additionally involve regenerating the transformed plant
cell into a transformed plant. The gene of interest is expressed
when the promoter is induced after exposing the plant, plant part,
or plant cell to a corresponding TAL effector.
[0095] By "gene of interest" is intended any nucleotide sequence
that can be expressed when operable linked to a promoter. A gene of
interest of the present invention may, but need not, encode a
protein. Unless stated otherwise or readily apparent from the
context, when a gene of interest of the present invention is said
to be operably linked to a promoter of the invention, the gene of
interest does not by itself comprise a functional promoter.
[0096] The invention encompasses isolated or substantially purified
polynucleotide or protein compositions. An "isolated" or "purified"
polynucleotide or protein, or biologically active portion thereof,
is substantially or essentially free from components that normally
accompany or interact with the polynucleotide or protein as found
in its naturally occurring environment. Thus, an isolated or
purified polynucleotide or protein is substantially free of other
cellular material or culture medium when produced by recombinant
techniques, or substantially free of chemical precursors or other
chemicals when chemically synthesized. Optimally, an "isolated"
polynucleotide is free of sequences (optimally protein encoding
sequences) that naturally flank the polynucleotide (i.e., sequences
located at the 5' and 3' ends of the polynucleotide) in the genomic
DNA of the organism from which the polynucleotide is derived. For
example, in various embodiments, the isolated polynucleotide can
contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or
0.1 kb of nucleotide sequence that naturally flank the
polynucleotide in genomic DNA of the cell from which the
polynucleotide is derived. A protein that is substantially free of
cellular material includes preparations of protein having less than
about 30%, 20%, 10%, 5%, or 1% (by dry weight) of contaminating
protein. When the protein of the invention or biologically active
portion thereof is recombinantly produced, optimally culture medium
represents less than about 30%, 20%, 10%, 5%, or 1% (by dry weight)
of chemical precursors or non-protein-of-interest chemicals.
[0097] Fragments and variants of the disclosed polynucleotides and
proteins encoded thereby are also encompassed by the present
invention. By "fragment" is intended a portion of the
polynucleotide or a portion of the amino acid sequence and hence
protein encoded thereby. Fragments of polynucleotides comprising
coding sequences may encode protein fragments that retain
biological activity of the native protein. Fragments of
polynucleotide comprising promoter sequences retain biological
activity of the full-length promoter, particularly upa-box
activity. Alternatively, fragments of a polynucleotide that are
useful as hybridization probes generally do not encode proteins
that retain biological activity or do not retain promoter activity.
Thus, fragments of a nucleotide sequence may range from at least
about 20 nucleotides, about 50 nucleotides, about 100 nucleotides,
and up to the full-length polynucleotide of the invention.
[0098] A fragment of a polynucleotide of the invention may encode a
biologically active portion of a pathogen-inducible promoter, upa
box or R gene or it may be a fragment that can be used as a
hybridization probe or PCR primer using methods disclosed below. A
biologically active portion of a pathogen-inducible promoter, upa
box or the pathogen-inducible promoter of an R gene can be prepared
by isolating a portion of one of the polynucleotides of the
invention that comprises the promoter or upa-box and assessing
upa-box activity as described herein. Polynucleotides that are
fragments of a nucleotide sequence of the present invention
comprise at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 75, 100, 125, 150, 175,
200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900,
1000, 1100, 1200, 1300, 1400, 1500, 2000, 2500, or 3000 contiguous
nucleotides, or up to the number of nucleotides present in a
full-length polynucleotide disclosed herein (for example, 1059,
1059, 166, 1557, 1070, 1107, 1059, 1104, 19, 15, 35, 18, an 48
nucleotides for SEQ ID NOS: 6, 7, 9, 11, 13-18, 20, 22, and 24,
respectively).
[0099] "Variants" is intended to mean substantially similar
sequences. For polynucleotides, a variant comprises a
polynucleotide having deletions (i.e., truncations) at the 5'
and/or 3' end; deletion and/or addition of one or more nucleotides
at one or more internal sites in the native polynucleotide; and/or
substitution of one or more nucleotides at one or more sites in the
native polynucleotide. As used herein, a "native" polynucleotide or
polypeptide comprises a naturally occurring nucleotide sequence or
amino acid sequence, respectively. For polynucleotides that
comprise coding sequences, conservative variants include those
sequences that, because of the degeneracy of the genetic code,
encode the amino acid sequence of one of the polypeptides of the
invention. Naturally occurring allelic variants such as these can
be identified with the use of well-known molecular biology
techniques, as, for example, with polymerase chain reaction (PCR)
and hybridization techniques as outlined below. Variant
polynucleotides also include synthetically derived polynucleotides,
such as those generated, for example, by using site-directed
mutagenesis but which still comprise upa-box activity. Generally,
variants of a particular polynucleotide or nucleic acid molecule of
the invention will have at least about 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, 99% or more sequence identity to that particular
polynucleotide as determined by sequence alignment programs and
parameters as described elsewhere herein.
[0100] Variants of a particular polynucleotide of the invention
(i.e., the reference polynucleotide) can also be evaluated by
comparison of the percent sequence identity between the polypeptide
encoded by a variant polynucleotide and the polypeptide encoded by
the reference polynucleotide. Percent sequence identity between any
two polypeptides can be calculated using sequence alignment
programs and parameters described elsewhere herein. Where any given
pair of polynucleotides of the invention is evaluated by comparison
of the percent sequence identity shared by the two polypeptides
they encode, the percent sequence identity between the two encoded
polypeptides is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence
identity.
[0101] "Variant" protein is intended to mean a protein derived from
the native protein by deletion (so-called truncation) of one or
more amino acids at the N-terminal and/or C-terminal end of the
native protein; deletion and/or addition of one or more amino acids
at one or more internal sites in the native protein; or
substitution of one or more amino acids at one or more sites in the
native protein. Variant proteins encompassed by the present
invention are biologically active; that is they continue to possess
the desired biological activity of the native protein. Such
variants may result from, for example, genetic polymorphism or from
human manipulation. Biologically active variants of a protein of
the invention will have at least about 60%, 65%, 70%, 75%, 80%,
85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more
sequence identity to the amino acid sequence for the native protein
as determined by sequence alignment programs and parameters
described elsewhere herein. A biologically active variant of a
protein of the invention may differ from that protein by as few as
1-15 amino acid residues, as few as 1-10, such as 6-10, as few as
5, as few as 4, 3, 2, or even 1 amino acid residue.
[0102] The proteins of the invention may be altered in various ways
including amino acid substitutions, deletions, truncations, and
insertions. Methods for such manipulations are generally known in
the art. For example, amino acid sequence variants and fragments of
the proteins can be prepared by mutations in the DNA. Methods for
mutagenesis and polynucleotide alterations are well known in the
art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA
82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382;
U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques
in Molecular Biology (MacMillan Publishing Company, New York) and
the references cited therein. Guidance as to appropriate amino acid
substitutions that do not affect biological activity of the protein
of interest may be found in the model of Dayhoff et al. (1978)
Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found.,
Washington, D.C.), herein incorporated by reference. Conservative
substitutions, such as exchanging one amino acid with another
having similar properties, may be optimal.
[0103] Thus, the genes and polynucleotides of the invention include
both the naturally occurring sequences as well as mutant forms.
Likewise, the proteins of the invention encompass both naturally
occurring proteins as well as variations and modified forms
thereof. Such variants will continue to possess the desired
biological activity. Obviously, the mutations that will be made in
the DNA encoding the variant must not place the sequence out of
reading frame and optimally will not create complementary regions
that could produce secondary mRNA structure. See, EP Patent
Application Publication No. 75,444.
[0104] The deletions, insertions, and substitutions of the protein
sequences encompassed herein are not expected to produce radical
changes in the characteristics of the protein. However, when it is
difficult to predict the exact effect of the substitution,
deletion, or insertion in advance of doing so, one skilled in the
art will appreciate that the effect will be evaluated by routine
screening assays. That is, the activity can be evaluated by
flavin-dependent monooxygenase activity assays. See, for example,
Krueger et al. (2005). Pharmacol. Ther. 106, 357-387; herein
incorporated by reference.
[0105] Variant polynucleotides and proteins also encompass
sequences and proteins derived from a mutagenic and recombinogenic
procedure such as DNA shuffling. Strategies for such DNA shuffling
are known in the art. See, for example, Stemmer (1994) Proc. Natl.
Acad. Sci. USA 91:10747-10751; Stemmer (1994) Nature 370:389-391;
Crameri et al. (1997) Nature Biotech. 15:436-438; Moore et al.
(1997) J. Mol. Biol. 272:336-347; Zhang et al. (1997) Proc. Natl.
Acad. Sci. USA 94:4504-4509; Crameri et al. (1998) Nature
391:288-291; and U.S. Pat. Nos. 5,605,793 and 5,837,458.
[0106] The polynucleotides of the invention can be used to isolate
corresponding sequences from other organisms, particularly other
plants. In this manner, methods such as PCR, hybridization, and the
like can be used to identify such sequences based on their sequence
homology to the sequences set forth herein. Sequences isolated
based on their sequence identity to the entire sequences set forth
herein or to variants and fragments thereof are encompassed by the
present invention. Such sequences include sequences that are
orthologs of the disclosed sequences. "Orthologs" is intended to
mean genes derived from a common ancestral gene and which are found
in different species as a result of speciation. Genes found in
different species are considered orthologs when their nucleotide
sequences and/or their encoded protein sequences share at least
60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, 99%, or greater sequence identity. Functions of orthologs are
often highly conserved among species. Thus, isolated
polynucleotides that have upa-box promoter activity and which
hybridize under stringent conditions to at least one of the
polynucleotides disclosed herein, or to variants or fragments
thereof, are encompassed by the present invention.
[0107] In a PCR approach, oligonucleotide primers can be designed
for use in PCR reactions to amplify corresponding DNA sequences
from cDNA or genomic DNA extracted from any plant of interest.
Methods for designing PCR primers and PCR cloning are generally
known in the art and are disclosed in Sambrook et al. (1989)
Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor
Laboratory Press, Plainview, N.Y.). See also Innis et al., eds.
(1990) PCR Protocols: A Guide to Methods and Applications (Academic
Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies
(Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR
Methods Manual (Academic Press, New York). Known methods of PCR
include, but are not limited to, methods using paired primers,
nested primers, single specific primers, degenerate primers,
gene-specific primers, vector-specific primers,
partially-mismatched primers, and the like.
[0108] In hybridization techniques, all or part of a known
polynucleotide is used as a probe that selectively hybridizes to
other corresponding polynucleotides present in a population of
cloned genomic DNA fragments or cDNA fragments (i.e., genomic or
cDNA libraries) from a chosen organism. The hybridization probes
may be genomic DNA fragments, cDNA fragments, RNA fragments, or
other oligonucleotides, and may be labeled with a detectable group
such as .sup.32P, or any other detectable marker. Thus, for
example, probes for hybridization can be made by labeling synthetic
oligonucleotides based on the polynucleotides of the invention.
Methods for preparation of probes for hybridization and for
construction of cDNA and genomic libraries are generally known in
the art and are disclosed in Sambrook et al. (1989) Molecular
Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory
Press, Plainview, N.Y.).
[0109] For example, an entire nucleic acid molecule of
polynucleotide disclosed herein, or one or more portions thereof,
may be used as a probe capable of specifically hybridizing to
corresponding polynucleotide and messenger RNAs. To achieve
specific hybridization under a variety of conditions, such probes
include sequences that are unique among one or more of the
polynucleotide sequences of the present invention and are optimally
at least about 10 nucleotides in length, and most optimally at
least about 20 nucleotides in length. Such probes may be used to
amplify corresponding polynucleotides from a chosen plant by PCR.
This technique may be used to isolate additional coding sequences
from a desired plant or as a diagnostic assay to determine the
presence of coding sequences in a plant. Hybridization techniques
include hybridization screening of plated DNA libraries (either
plaques or colonies; see, for example, Sambrook et al. (1989)
Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor
Laboratory Press, Plainview, N.Y.).
[0110] Hybridization of such sequences may be carried out under
stringent conditions. By "stringent conditions" or "stringent
hybridization conditions" is intended conditions under which a
probe will hybridize to its target sequence to a detectably greater
degree than to other sequences (e.g., at least 2-fold over
background). Stringent conditions are sequence-dependent and will
be different in different circumstances. By controlling the
stringency of the hybridization and/or washing conditions, target
sequences that are 100% complementary to the probe can be
identified (homologous probing). Alternatively, stringency
conditions can be adjusted to allow some mismatching in sequences
so that lower degrees of similarity are detected (heterologous
probing). Generally, a probe is less than about 1000 nucleotides in
length, optimally less than 500 nucleotides in length.
[0111] Typically, stringent conditions will be those in which the
salt concentration is less than about 1.5 M Na ion, typically about
0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to
8.3 and the temperature is at least about 30.degree. C. for short
probes (e.g., 10 to 50 nucleotides) and at least about 60.degree.
C. for long probes (e.g., greater than 50 nucleotides). Stringent
conditions may also be achieved with the addition of destabilizing
agents such as formamide. Exemplary low stringency conditions
include hybridization with a buffer solution of 30 to 35%
formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37.degree.
C., and a wash in 1.times. to 2.times.SSC (20.times.SSC=3.0 M
NaCl/0.3 M trisodium citrate) at 50 to 55.degree. C. Exemplary
moderate stringency conditions include hybridization in 40 to 45%
formamide, 1.0 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.5.times. to 1.times.SSC at 55 to 60.degree. C. Exemplary high
stringency conditions include hybridization in 50% formamide, 1 M
NaCl, 1% SDS at 37.degree. C., and a wash in 0.1.times.SSC at 60 to
65.degree. C. Optionally, wash buffers may comprise about 0.1% to
about 1% SDS. Duration of hybridization is generally less than
about 24 hours, usually about 4 to about 12 hours. The duration of
the wash time will be at least a length of time sufficient to reach
equilibrium.
[0112] Specificity is typically the function of post-hybridization
washes, the critical factors being the ionic strength and
temperature of the final wash solution. For DNA-DNA hybrids, the
T.sub.m can be approximated from the equation of Meinkoth and Wahl
(1984) Anal. Biochem. 138:267-284: T.sub.m=81.5.degree. C.+16.6
(log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of
monovalent cations, % GC is the percentage of guanosine and
cytosine nucleotides in the DNA, % form is the percentage of
formamide in the hybridization solution, and L is the length of the
hybrid in base pairs. The T.sub.m is the temperature (under defined
ionic strength and pH) at which 50% of a complementary target
sequence hybridizes to a perfectly matched probe. T.sub.m is
reduced by about 1.degree. C. for each 1% of mismatching; thus,
T.sub.m, hybridization, and/or wash conditions can be adjusted to
hybridize to sequences of the desired identity. For example, if
sequences with >90% identity are sought, the T.sub.m can be
decreased 10.degree. C. Generally, stringent conditions are
selected to be about 5.degree. C. lower than the thermal melting
point (T.sub.m) for the specific sequence and its complement at a
defined ionic strength and pH. However, severely stringent
conditions can utilize a hybridization and/or wash at 1, 2, 3, or
4.degree. C. lower than the thermal melting point (T.sub.m);
moderately stringent conditions can utilize a hybridization and/or
wash at 6, 7, 8, 9, or 10.degree. C. lower than the thermal melting
point (T.sub.m); low stringency conditions can utilize a
hybridization and/or wash at 11, 12, 13, 14, 15, or 20.degree. C.
lower than the thermal melting point (T.sub.m). Using the equation,
hybridization and wash compositions, and desired T.sub.m, those of
ordinary skill will understand that variations in the stringency of
hybridization and/or wash solutions are inherently described. If
the desired degree of mismatching results in a T.sub.m of less than
45.degree. C. (aqueous solution) or 32.degree. C. (formamide
solution), it is optimal to increase the SSC concentration so that
a higher temperature can be used. An extensive guide to the
hybridization of nucleic acids is found in Tijssen (1993)
Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes, Part I, Chapter 2
(Elsevier, New York); and Ausubel et al., eds. (1995) Current
Protocols in Molecular Biology, Chapter 2 (Greene Publishing and
Wiley-Interscience, New York). See Sambrook et al. (1989) Molecular
Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory
Press, Plainview, N.Y.).
[0113] It is recognized that the polynucleotide molecules of the
present invention encompass polynucleotide molecules comprising a
nucleotide sequence that is sufficiently identical to one of the
nucleotide sequences set forth in SEQ ID NOS: 6, 7, 9, 11, 13-18,
20, 22, or 24. The term "sufficiently identical" is used herein to
refer to a first amino acid or nucleotide sequence that contains a
sufficient or minimum number of identical or equivalent nucleotides
to a second nucleotide sequence such that the first and second
nucleotide sequences have a common structural domain and/or common
functional activity. For example, nucleotide sequences that contain
a common structural domain having at least about 45%, 55%, or 65%
identity, preferably 75% identity, more preferably 85%, 90%, 95%,
96%, 97%, 98% or 99% identity are defined herein as sufficiently
identical.
[0114] To determine the percent identity of two amino acid
sequences or of two nucleic acids, the sequences are aligned for
optimal comparison purposes. The percent identity between the two
sequences is a function of the number of identical positions shared
by the sequences (i.e., percent identity=number of identical
positions/total number of positions (e.g., overlapping
positions).times.100). In one embodiment, the two sequences are the
same length. The percent identity between two sequences can be
determined using techniques similar to those described below, with
or without allowing gaps. In calculating percent identity,
typically exact matches are counted.
[0115] The determination of percent identity between two sequences
can be accomplished using a mathematical algorithm. A preferred,
nonlimiting example of a mathematical algorithm utilized for the
comparison of two sequences is the algorithm of Karlin and Altschul
(1990) Proc. Natl. Acad. Sci. USA 87:2264, modified as in Karlin
and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such
an algorithm is incorporated into the NBLAST and XBLAST programs of
Altschul et al. (1990) J. Mol. Biol. 215:403. BLAST nucleotide
searches can be performed with the NBLAST program, score=100,
wordlength=12, to obtain nucleotide sequences homologous to the
polynucleotide molecules of the invention. BLAST protein searches
can be performed with the XBLAST program, score=50, wordlength=3,
to obtain amino acid sequences homologous to protein molecules of
the invention. To obtain gapped alignments for comparison purposes,
Gapped BLAST can be utilized as described in Altschul et al. (1997)
Nucleic Acids Res. 25:3389. Alternatively, PSI-Blast can be used to
perform an iterated search that detects distant relationships
between molecules. See Altschul et al. (1997) supra. When utilizing
BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters
of the respective programs (e.g., XBLAST and NBLAST) can be used.
See http://www.ncbi.nlm.nih.gov. Another preferred, non-limiting
example of a mathematical algorithm utilized for the comparison of
sequences is the algorithm of Myers and Miller (1988) CABIOS
4:11-17. Such an algorithm is incorporated into the ALIGN program
(version 2.0), which is part of the GCG sequence alignment software
package. When utilizing the ALIGN program for comparing amino acid
sequences, a PAM120 weight residue table, a gap length penalty of
12, and a gap penalty of 4 can be used. Alignment may also be
performed manually by inspection.
[0116] Unless otherwise stated, sequence identity/similarity values
provided herein refer to the value obtained using the full-length
sequences of the invention and using multiple alignment by mean of
the algorithm Clustal W (Nucleic Acid Research, 22(22):4673-4680,
1994) using the program AlignX included in the software package
Vector NTI Suite Version 7 (InforMax, Inc., Bethesda, Md., USA)
using the default parameters; or any equivalent program thereof. By
"equivalent program" is intended any sequence comparison program
that, for any two sequences in question, generates an alignment
having identical nucleotide or amino acid residue matches and an
identical percent sequence identity when compared to the
corresponding alignment generated by CLUSTALW (Version 1.83) using
default parameters (available at the European Bioinformatics
Institute website:
http://vvwvv.ebi.ac.uk/Tools/clustalw/index.html).
[0117] The use of the term "polynucleotide" is not intended to
limit the present invention to polynucleotides comprising DNA.
Those of ordinary skill in the art will recognize that
polynucleotides, can comprise ribonucleotides and combinations of
ribonucleotides and deoxyribonucleotides. Such deoxyribonucleotides
and ribonucleotides include both naturally occurring molecules and
synthetic analogues. The polynucleotides of the invention also
encompass all forms of sequences including, but not limited to,
single-stranded forms, double-stranded forms, hairpins,
stem-and-loop structures, and the like.
[0118] The pathogen-inducible promoters, upa boxes and R genes of
the present invention can be provided in expression cassettes for
expression in the plant or other organism or non-human host cell of
interest. The cassette will include 5' and 3' regulatory sequences
operably linked to polynucleotide to be expressed. "Operably
linked" is intended to mean a functional linkage between two or
more elements. For example, an operable linkage between a
polynucleotide or gene of interest and a regulatory sequence (i.e.,
a promoter) is functional link that allows for expression of the
polynucleotide of interest. Operably linked elements may be
contiguous or non-contiguous. When used to refer to the joining of
two protein coding regions, by operably linked is intended that the
coding regions are in the same reading frame. The cassette may
additionally contain at least one additional gene to be
cotransformed into the organism. Alternatively, the additional
gene(s) can be provided on multiple expression cassettes. Such an
expression cassette is provided with a plurality of restriction
sites and/or recombination sites for insertion of the
polynucleotide to be under the transcriptional regulation of the
regulatory regions. The expression cassette may additionally
contain selectable marker genes.
[0119] The expression cassette will include in the 5'-3' direction
of transcription, a transcriptional and translational initiation
region (i.e., a promoter), polynucleotide to be expressed, and a
transcriptional and translational termination region (i.e.,
termination region) functional in plants or other organism or
non-human host cell. The regulatory regions (i.e., promoters,
transcriptional regulatory regions, and translational termination
regions) and/or the polynucleotide to be expressed may be
native/analogous to the host cell or to each other. Alternatively,
any of the regulatory regions and/or the polynucleotide to be
expressed may be heterologous to the host cell or to each other. As
used herein, "heterologous" in reference to a sequence is a
sequence that originates from a foreign species, or, if from the
same species, is substantially modified from its native form in
composition and/or genomic locus by deliberate human intervention.
For example, a promoter operably linked to a heterologous
polynucleotide is from a species different from the species from
which the polynucleotide was derived, or, if from the
same/analogous species, one or both are substantially modified from
their original form and/or genomic locus, or the promoter is not
the native promoter for the operably linked polynucleotide. As used
herein, a chimeric gene comprises a coding sequence operably linked
to a transcription initiation region that is heterologous to the
coding sequence.
[0120] The termination region may be native with the
transcriptional initiation region, may be native with the operably
linked polynucleotide of interest, may be native with the plant
host, or may be derived from another source (i.e., foreign or
heterologous) to the promoter, the polynucleotide of interest, the
plant host, or any combination thereof. Convenient termination
regions are available from the Ti-plasmid of A. tumefaciens, such
as the octopine synthase and nopaline synthase termination regions.
See also Guerineau et al. (1991) Mol. Gen. Genet. 262:141-144;
Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev.
5:141-149; Mogen et al. (1990) Plant Cell 2:1261-1272; Munroe et
al. (1990) Gene 91:151-158; Ballas et al. (1989) Nucleic Acids Res.
17:7891-7903; and Joshi et al. (1987) Nucleic Acids Res.
15:9627-9639.
[0121] Unless stated otherwise or obvious from the context, a
promoter of the present invention comprises a nucleotide sequence
comprising at least one upa box and is capable of directing the
expression of an operably linked polynucleotide in a plant, a plant
part, and/or a plant cell. Preferably, a promoter of the present is
invention is pathogen-inducible. More preferably, the promoter is
inducible by a bacterial pathogen. Even more preferably, the
promoter is inducible by a bacterial pathogen that produces a TAL
effector. Most preferably, the promoter is inducible by a bacterial
pathogen that produces a TAL effector that specifically binds to
the upa box of the promoter.
[0122] Where appropriate, the polynucleotides may be optimized for
increased expression in the transformed plant. That is, the
polynucleotides can be synthesized using plant-preferred codons for
improved expression. See, for example, Campbell and Gowri (1990)
Plant Physiol. 92:1-11 for a discussion of host-preferred codon
usage. Methods are available in the art for synthesizing
plant-preferred genes. See, for example, U.S. Pat. Nos. 5,380,831,
and 5,436,391, and Murray et al. (1989) Nucleic Acids Res.
17:477-498, herein incorporated by reference.
[0123] Additional sequence modifications are known to enhance gene
expression in a cellular host. These include elimination of
sequences encoding spurious polyadenylation signals, exon-intron
splice site signals, transposon-like repeats, and other such
well-characterized sequences that may be deleterious to gene
expression. The G-C content of the sequence may be adjusted to
levels average for a given cellular host, as calculated by
reference to known genes expressed in the host cell. When possible,
the sequence is modified to avoid predicted hairpin secondary mRNA
structures.
[0124] The expression cassettes may additionally contain 5' leader
sequences. Such leader sequences can act to enhance translation.
Translation leaders are known in the art and include: picornavirus
leaders, for example, EMCV leader (Encephalomyocarditis 5'
noncoding region) (Elroy-Stein et al. (1989) Proc. Natl. Acad. Sci.
USA 86:6126-6130); potyvirus leaders, for example, TEV leader
(Tobacco Etch Virus) (Gallie et al. (1995) Gene 165(2):233-238),
MDMV leader (Maize Dwarf Mosaic Virus) (Virology 154:9-20), and
human immunoglobulin heavy-chain binding protein (BiP) (Macejak et
al. (1991) Nature 353:90-94); untranslated leader from the coat
protein mRNA of alfalfa mosaic virus (AMV RNA 4) (Jobling et al.
(1987) Nature 325:622-625); tobacco mosaic virus leader (TMV)
(Gallie et al. (1989) in Molecular Biology of RNA, ed. Cech (Liss,
New York), pp. 237-256); and maize chlorotic mottle virus leader
(MCMV) (Lommel et al. (1991) Virology 81:382-385). See also,
Della-Cioppa et al. (1987) Plant Physiol.
[0125] 84:965-968.
[0126] In preparing the expression cassette, the various DNA
fragments may be manipulated, so as to provide for the DNA
sequences in the proper orientation and, as appropriate, in the
proper reading frame. Toward this end, adapters or linkers may be
employed to join the DNA fragments or other manipulations may be
involved to provide for convenient restriction sites, removal of
superfluous DNA, removal of restriction sites, or the like. For
this purpose, in vitro mutagenesis, primer repair, restriction,
annealing, resubstitutions, e.g., transitions and transversions,
may be involved.
[0127] The expression cassette can also comprise a selectable
marker gene for the selection of transformed cells. Selectable
marker genes are utilized for the selection of transformed cells or
tissues. Marker genes include genes encoding antibiotic resistance,
such as those encoding neomycin phosphotransferase II (NEO) and
hygromycin phosphotransferase (HPT), as well as genes conferring
resistance to herbicidal compounds, such as glufosinate ammonium,
bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D).
Additional selectable markers include phenotypic markers such as
.beta.-galactosidase and fluorescent proteins such as green
fluorescent protein (GFP) (Su et al. (2004) Biotechnol Bioeng
85:610-9 and Fetter et al. (2004) Plant Cell 16:215-28), cyan
florescent protein (CYP) (Bolte et al. (2004) J. Cell Science
117:943-54 and Kato et al. (2002) Plant Physiol 129:913-42), and
yellow florescent protein (PhiYFP.TM. from Evrogen, see, Bolte et
al. (2004) J. Cell Science 117:943-54). For additional selectable
markers, see generally, Yarranton (1992) Curr. Opin. Biotech.
3:506-511; Christopherson et al. (1992) Proc. Natl. Acad. Sci. USA
89:6314-6318; Yao et al. (1992) Cell 71:63-72; Reznikoff (1992)
Mol. Microbiol. 6:2419-2422; Barkley et al. (1980) in The Operon,
pp. 177-220; Hu et al. (1987) Cell 48:555-566; Brown et al. (1987)
Cell 49:603-612; Figge et al. (1988) Cell 52:713-722; Deuschle et
al. (1989) Proc. Natl. Acad. USA 86:5400-5404; Fuerst et al. (1989)
Proc. Natl. Acad. Sci. USA 86:2549-2553; Deuschle et al. (1990)
Science 248:480-483; Gossen (1993) Ph.D. Thesis, University of
Heidelberg; Reines et al. (1993) Proc. Natl. Acad. Sci. USA
90:1917-1921; Labow et al. (1990) Mol. Cell. Biol. 10:3343-3356;
Zambretti et al. (1992) Proc. Natl. Acad. Sci. USA 89:3952-3956;
Baim et al. (1991) Proc. Natl. Acad. Sci. USA 88:5072-5076;
Wyborski et al. (1991) Nucleic Acids Res. 19:4647-4653;
Hillenand-Wissman (1989) Topics Mol. Struc. Biol. 10:143-162;
Degenkolb et al. (1991) Antimicrob. Agents Chemother. 35:1591-1595;
Kleinschnidt et al. (1988) Biochemistry 27:1094-1104; Bonin (1993)
Ph.D. Thesis, University of Heidelberg; Gossen et al. (1992) Proc.
Natl. Acad. Sci. USA 89:5547-5551; Oliva et al. (1992) Antimicrob.
Agents Chemother. 36:913-919; Hlavka et al. (1985) Handbook of
Experimental Pharmacology, Vol. 78 (Springer-Verlag, Berlin); Gill
et al. (1988) Nature 334:721-724. Such disclosures are herein
incorporated by reference.
[0128] The above list of selectable marker genes is not meant to be
limiting. Any selectable marker gene can be used in the present
invention.
[0129] Numerous plant transformation vectors and methods for
transforming plants are available. See, for example, An, G. et al.
(1986) Plant Pysiol., 81:301-305; Fry, J., et al. (1987) Plant Cell
Rep. 6:321-325; Block, M. (1988) Theor. Appl Genet. 76:767-774;
Hinchee, et al. (1990) Stadler. Genet. Symp. 203212.203-212;
Cousins, et al. (1991) Aust. J. Plant Physiol. 18:481-494; Chee, P.
P. and Slightom, J. L. (1992) Gene. 118:255-260; Christou, et al.
(1992) Trends. Biotechnol. 10:239-246; D'Halluin, et al. (1992)
Bio/Technol. 10:309-314; Dhir, et al. (1992) Plant Physiol.
99:81-88; Casas et al. (1993) Proc. Nat. Acad Sci. USA
90:11212-11216; Christou, P. (1993) In Vitro Cell. Dev.
Biol.-Plant; 29P: 119-124; Davies, et al. (1993) Plant Cell Rep.
12:180-183; Dong, J. A. and Mchughen, A. (1993) Plant Sci.
91:139-148; Franklin, C. I. and Trieu, T. N. (1993) Plant. Physiol.
102:167; Golovkin, et al. (1993) Plant Sci. 90:41-52; Guo Chin Sci.
Bull. 38:2072-2078; Asano, et al. (1994) Plant Cell Rep. 13; Ayeres
N. M. and Park, W. D. (1994) Crit. Rev. Plant. Sci. 13:219-239;
Barcelo, et al. (1994) Plant. J. 5:583-592; Becker, et al. (1994)
Plant. J. 5:299-307; Borkowska et al. (1994) Acta. Physiol Plant.
16:225-230; Christou, P. (1994) Agro. Food. Ind. Hi Tech. 5: 17-27;
Eapen et al. (1994) Plant Cell Rep. 13:582-586; Hartman, et al.
(1994) Bio-Technology 12: 919923; Ritala, et al. (1994) Plant. Mol.
Biol. 24:317-325; and Wan, Y. C. and Lemaux, P. G. (1994) Plant
Physiol. 104:3748.
[0130] The methods of the invention involve introducing a
polynucleotide construct into a plant. By "introducing" is intended
presenting to the plant the polynucleotide construct in such a
manner that the construct gains access to the interior of a cell of
the plant. The methods of the invention do not depend on a
particular method for introducing a polynucleotide construct to a
plant, only that the polynucleotide construct gains access to the
interior of at least one cell of the plant. Methods for introducing
polynucleotide constructs into plants are known in the art
including, but not limited to, stable transformation methods,
transient transformation methods, and virus-mediated methods.
[0131] By "stable transformation" is intended that the
polynucleotide construct introduced into a plant integrates into
the genome of the plant and is capable of being inherited by
progeny thereof. By "transient transformation" is intended that a
polynucleotide construct introduced into a plant does not integrate
into the genome of the plant.
[0132] For the transformation of plants and plant cells, the
nucleotide sequences of the invention are inserted using standard
techniques into any vector known in the art that is suitable for
expression of the nucleotide sequences in a plant or plant cell.
The selection of the vector depends on the preferred transformation
technique and the target plant species to be transformed.
[0133] Methodologies for constructing plant expression cassettes
and introducing foreign nucleic acids into plants are generally
known in the art and have been previously described. For example,
foreign DNA can be introduced into plants, using tumor-inducing
(Ti) plasmid vectors. Other methods utilized for foreign DNA
delivery involve the use of PEG mediated protoplast transformation,
electroporation, microinjection whiskers, and biolistics or
microprojectile bombardment for direct DNA uptake. Such methods are
known in the art. (U.S. Pat. No. 5,405,765 to Vasil et al.; Bilang
et al. (1991) Gene 100: 247-250; Scheid et al., (1991) Mol. Gen.
Genet., 228: 104-112; Guerche et al., (1987) Plant Science 52:
111-116; Neuhause et al., (1987) Theor. Appl Genet. 75: 30-36;
Klein et al., (1987) Nature 327: 70-73; Howell et al., (1980)
Science 208:1265; Horsch et al., (1985) Science 227: 1229-1231;
DeBlock et al., (1989) Plant Physiology 91: 694-701; Methods for
Plant Molecular Biology (Weissbach and Weissbach, eds.) Academic
Press, Inc. (1988) and Methods in Plant Molecular Biology (Schuler
and Zielinski, eds.) Academic Press, Inc. (1989). The method of
transformation depends upon the plant cell to be transformed,
stability of vectors used, expression level of gene products and
other parameters.
[0134] Other suitable methods of introducing nucleotide sequences
into plant cells and subsequent insertion into the plant genome
include microinjection as Crossway et al. (1986) Biotechniques
4:320-334, electroporation as described by Riggs et al. (1986)
Proc. Natl. Acad. Sci. USA 83:5602-5606, Agrobacterium-mediated
transformation as described by Townsend et al., U.S. Pat. No.
5,563,055, Zhao et al., U.S. Pat. No. 5,981,840, direct gene
transfer as described by Paszkowski et al. (1984) EMBO J.
3:2717-2722, and ballistic particle acceleration as described in,
for example, Sanford et al., U.S. Pat. No. 4,945,050; Tomes et al.,
U.S. Pat. No. 5,879,918; Tomes et al., U.S. Pat. No. 5,886,244;
Bidney et al., U.S. Pat. No. 5,932,782; Tomes et al. (1995) "Direct
DNA Transfer into Intact Plant Cells via Microprojectile
Bombardment," in Plant Cell, Tissue, and Organ Culture: Fundamental
Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); McCabe
et al. (1988) Biotechnology 6:923-926); and Lecl transformation (WO
00/28058). Also see, Weissinger et al. (1988) Ann. Rev. Genet.
22:421-477; Sanford et al. (1987) Particulate Science and
Technology 5:27-37 (onion); Christou et al. (1988) Plant Physiol.
87:671-674 (soybean); McCabe et al. (1988) Bio/Technology 6:923-926
(soybean); Finer and McMullen (1991) In Vitro Cell Dev. Biol.
27P:175-182 (soybean); Singh et al. (1998) Theor. Appl. Genet.
96:319-324 (soybean); Datta et al. (1990) Biotechnology 8:736-740
(rice); Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85:4305-4309
(maize); Klein et al. (1988) Biotechnology 6:559-563 (maize);
Tomes, U.S. Pat. No. 5,240,855; Buising et al., U.S. Pat. Nos.
5,322,783 and 5,324,646; Tomes et al. (1995) "Direct DNA Transfer
into Intact Plant Cells via Microprojectile Bombardment," in Plant
Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg
(Springer-Verlag, Berlin) (maize); Klein et al. (1988) Plant
Physiol. 91:440-444 (maize); Fromm et al. (1990) Biotechnology
8:833-839 (maize); Hooykaas-Van Slogteren et al. (1984) Nature
(London) 311:763-764; Bowen et al., U.S. Pat. No. 5,736,369
(cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA
84:5345-5349 (Liliaceae); De Wet et al. (1985) in The Experimental
Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New
York), pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell
Reports 9:415-418 and Kaeppler et al. (1992) Theon. Appl. Genet.
84:560-566 (whisker-mediated transformation); D'Halluin et al.
(1992) Plant Cell 4:1495-1505 (electroporation); Li et al. (1993)
Plant Cell Reports 12:250-255 and Christou and Ford (1995) Annals
of Botany 75:407-413 (rice); Osjoda et al. (1996) Nature
Biotechnology 14:745-750 (maize via Agrobacterium tumefaciens); all
of which are herein incorporated by reference.
[0135] The polynucleotides of the invention may be introduced into
plants by contacting plants with a virus or viral nucleic acids.
Generally, such methods involve incorporating a polynucleotide
construct of the invention within a viral DNA or RNA molecule. It
is recognized that the a protein of the invention may be initially
synthesized as part of a viral polyprotein, which later may be
processed by proteolysis in vivo or in vitro to produce the desired
recombinant protein. Further, it is recognized that promoters of
the invention also encompass promoters utilized for transcription
by viral RNA polymerases. Methods for introducing polynucleotide
constructs into plants and expressing a protein encoded therein,
involving viral DNA or RNA molecules, are known in the art. See,
for example, U.S. Pat. Nos. 5,889,191, 5,889,190, 5,866,785,
5,589,367 and 5,316,931; herein incorporated by reference.
[0136] In specific embodiments, the nucleotide sequences of the
invention can be provided to a plant using a variety of transient
transformation methods. Such transient transformation methods
include, but are not limited to, the introduction of the a protein
or variants and fragments thereof directly into the plant or the
introduction of a a transcript into the plant. Such methods
include, for example, microinjection or particle bombardment. See,
for example, Crossway et al. (1986) Mol Gen. Genet. 202:179-185;
Nomura et al. (1986) Plant Sci. 44:53-58; Hepler et al. (1994)
Proc. Natl. Acad. Sci. 91: 2176-2180 and Hush et al. (1994) The
Journal of Cell Science 107:775-784, all of which are herein
incorporated by reference. Alternatively, the polynucleotide can be
transiently transformed into the plant using techniques known in
the art. Such techniques include viral vector system and
Agrobacterium tumefaciens-mediated transient expression as
described below.
[0137] The cells that have been transformed may be grown into
plants in accordance with conventional ways. See, for example,
McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants
may then be grown, and either pollinated with the same transformed
strain or different strains, and the resulting hybrid having
constitutive expression of the desired phenotypic characteristic
identified. Two or more generations may be grown to ensure that
expression of the desired phenotypic characteristic is stably
maintained and inherited and then seeds harvested to ensure
expression of the desired phenotypic characteristic has been
achieved. In this manner, the present invention provides
transformed seed (also referred to as "transgenic seed") having a
polynucleotide construct of the invention, for example, an
expression cassette of the invention, stably incorporated into
their genome.
[0138] The present invention may be used for transformation of any
plant species, including, but not limited to, monocots and dicots.
Examples of plant species of interest include, but are not limited
to, peppers (Capsicum spp; e.g., Capsicum annuum, C. baccatum, C.
chinense, C. frutescens, C. pubescens, and the like), tomatoes
(Lycopersicon esculentum), tobacco (Nicotiana tabacum), eggplant
(Solanum melongena), petunia (Petunia spp., e.g.,
Petunia.times.hybrida or Petunia hybrida), corn or maize (Zea
mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea),
particularly those Brassica species useful as sources of seed oil,
alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale
cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g.,
pearl millet (Pennisetum glaucum), proso millet (Panicum
miliaceum), foxtail millet (Setaria italica), finger millet
(Eleusine coracana)), sunflower (Helianthus annuus), safflower
(Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine
max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum),
peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium
hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot
esculenta), coffee (Coffea spp.), coconut (Cocos nucifera),
pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa
(Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.),
avocado (Persea americana), fig (Ficus casica), guava (Psidium
guajava), mango (Mangifera indica), olive (Olea europaea), papaya
(Carica papaya), cashew (Anacardium occidentale), macadamia
(Macadamia integrifolia), almond (Prunus amygdalus), sugar beets
(Beta vulgaris), sugarcane (Saccharum spp.), oats, barley,
vegetables, ornamentals, and conifers. Citrus spp. include, but are
not limited to, cultivated citrus species, such as, for example,
orange, lemon, meyer lemon, lime, key lime, Australian limes,
grapefruit, mandarin orange, clementine, tangelo, tangerine,
kumquat, pomelo, ugli, blood orange, and bitter orange.
[0139] As used herein, the term plant includes plant cells, plant
protoplasts, plant cell tissue cultures from which plants can be
regenerated, plant calli, plant clumps, and plant cells that are
intact in plants or parts of plants such as embryos, pollen,
ovules, seeds, leaves, flowers, branches, fruits, roots, root tips,
anthers, and the like. Progeny, variants, and mutants of the
regenerated plants are also included within the scope of the
invention, provided that these parts comprise the introduced
polynucleotides.
[0140] The invention is drawn to compositions and methods for
increasing resistance to plant disease. By "disease resistance" is
intended that the plants avoid the disease symptoms that are the
outcome of plant-pathogen interactions. That is, pathogens are
prevented from causing plant diseases and the associated disease
symptoms, or alternatively, the disease symptoms caused by the
pathogen is minimized or lessened.
[0141] Pathogens of the invention include, but are not limited to,
viruses or viroids, bacteria, insects, nematodes, fungi, and the
like. Viruses include any plant virus, for example, tobacco or
cucumber mosaic virus, ringspot virus, necrosis virus, maize dwarf
mosaic virus, etc. Fungal pathogens, include but are not limited
to, Colletotrichum graminocola, Diplodia maydis, Fusarium
graminearum, and Fusarium verticillioides. Specific pathogens for
the major crops include: Soybeans: Phytophthora megasperma fsp.
glycinea, Macrophomina phaseolina, Rhizoctonia solani, Sclerotinia
sclerotiorum, Fusarium oxysporum, Diaporthe phaseolorum var. sojae
(Phomopsis sojae), Diaporthe phaseolorum var. caulivora, Sclerotium
rolfsii, Cercospora kikuchii, Cercospora sojina, Peronospora
manshurica, Colletotrichum dematium (Colletotichum truncatum),
Corynespora cassiicola, Septoria glycines, Phyllosticta sojicola,
Alternaria alternata, Pseudomonas syringae p.v. glycinea,
Xanthomonas campestris p.v. phaseoli, Microsphaera diffusa,
Fusarium semitectum, Phialophora gregata, Soybean mosaic virus,
Glomerella glycines, Tobacco Ring spot virus, Tobacco Streak virus,
Phakopsora pachyrhizi, Pythium aphanidermatum, Pythium ultimum,
Pythium debaryanum, Tomato spotted wilt virus, Heterodera glycines
Fusarium solani; Canola: Albugo candida, Alternaria brassicae,
Leptosphaeria maculans, Rhizoctonia solani, Sclerotinia
sclerotiorum, Mycosphaerella brassicicola, Pythium ultimum,
Peronospora parasitica, Fusarium roseum, Alternaria alternata;
Alfalfa: Clavibacter michiganese subsp. insidiosum, Pythium
ultimum, Pythium irregulare, Pythium splendens, Pythium debaryanum,
Pythium aphanidermatum, Phytophthora megasperma, Peronospora
trifoliorum, Phoma medicaginis var. medicaginis, Cercospora
medicaginis, Pseudopeziza medicaginis, Leptotrochila medicaginis,
Fusarium oxysporum, Verticillium albo-atrum, Xanthomonas campestris
p.v. alfalfae, Aphanomyces euteiches, Stemphylium herbarum,
Stemphylium alfalfae, Colletotrichum trifolii, Leptosphaerulina
briosiana, Uromyces striatus, Sclerotinia trifoliorum, Stagonospora
meliloti, Stemphylium botryosum, Leptotrichila medicaginis; Wheat:
Pseudomonas syringae p.v. atrofaciens, Urocystis agropyri,
Xanthomonas campestris p.v. translucens, Pseudomonas syringae p.v.
syringae, Alternaria alternata, Cladosporium herbarum, Fusarium
graminearum, Fusarium avenaceum, Fusarium culmorum, Ustilago
tritici, Ascochyta tritici, Cephalosporium gramineum,
Collotetrichum graminicola, Erysiphe graminis f.sp. tritici,
Puccinia graminis f.sp. tritici, Puccinia recondite f.sp. tritici,
Puccinia striiformis, Pyrenophora tritici-repentis, Septoria
nodorum, Septoria tritici, Septoria avenae, Pseudocercosporella
herpotrichoides, Rhizoctonia solani, Rhizoctonia cerealis,
Gaeumannomyces graminis var. tritici, Pythium aphanidermatum,
Pythium arrhenomanes, Pythium ultimum, Bipolaris sorokiniana,
Barley Yellow Dwarf Virus, Brome Mosaic Virus, Soil Borne Wheat
Mosaic Virus, Wheat Streak Mosaic Virus, Wheat Spindle Streak
Virus, American Wheat Striate Virus, Claviceps purpurea, Tilletia
tritici, Tilletia laevis, Ustilago tritici, Tilletia indica,
Rhizoctonia solani, Pythium arrhenomannes, Pythium gramicola,
Pythium aphanidermatum, High Plains Virus, European wheat striate
virus; Sunflower: Plasmopora halstedii, Sclerotinia sclerotiorum,
Aster Yellows, Septoria helianthi, Phomopsis helianthi, Alternaria
helianthi, Alternaria zinniae, Botrytis cinerea, Phoma macdonaldii,
Macrophomina phaseolina, Erysiphe cichoracearum, Rhizopus oryzae,
Rhizopus arrhizus, Rhizopus stolonifer, Puccinia helianthi,
Verticillium dahliae, Erwinia carotovorum pv. carotovora,
Cephalosporium acremonium, Phytophthora cryptogea, Albugo
tragopogonis; Corn: Colletotrichum graminicola, Fusarium
moniliforme var. subglutinans, Erwinia stewartii, F.
verticillioides, Gibberella zeae (Fusarium graminearum),
Stenocarpella maydi (Diplodia maydis), Pythium irregulare, Pythium
debaryanum, Pythium graminicola, Pythium splendens, Pythium
ultimum, Pythium aphanidermatum, Aspergillus flavus, Bipolaris
maydis O, T (Cochliobolus heterostrophus), Helminthosporium
carbonum I, II & III (Cochliobolus carbonum), Exserohilum
turcicum I, II & III, Helminthosporium pedicellatum, Physoderma
maydis, Phyllosticta maydis, Kabatiella maydis, Cercospora sorghi,
Ustilago maydis, Puccinia sorghi, Puccinia polysora, Macrophomina
phaseolina, Penicillium oxalicum, Nigrospora oryzae, Cladosporium
herbarum, Curvularia lunata, Curvularia inaequalis, Curvularia
pallescens, Clavibacter michiganense subsp. nebraskense,
Trichoderma viride, Maize Dwarf Mosaic Virus A & B, Wheat
Streak Mosaic Virus, Maize Chlorotic Dwarf Virus, Claviceps sorghi,
Pseudonomas avenae, Erwinia chrysanthemi pv. zea, Erwinia
carotovora, Corn stunt spiroplasma, Diplodia macrospora,
Sclerophthora macrospora, Peronosclerospora sorghi,
Peronosclerospora philippinensis, Peronosclerospora maydis,
Peronosclerospora sacchari, Sphacelotheca reiliana, Physopella
zeae, Cephalosporium maydis, Cephalosporium acremonium, Maize
Chlorotic Mottle Virus, High Plains Virus, Maize Mosaic Virus,
Maize Rayado Fino Virus, Maize Streak Virus, Maize Stripe Virus,
Maize Rough Dwarf Virus; Sorghum: Exserohilum turcicum, C.
sublineolum, Cercospora sorghi, Gloeocercospora sorghi,
[0142] Ascochyta sorghina, Pseudomonas syringae p.v. syringae,
Xanthomonas campestris p.v. holcicola, Pseudomonas andropogonis,
Puccinia purpurea, Macrophomina phaseolina, Perconia circinate,
Fusarium moniliforme, Alternaria alternate, Bipolaris sorghicola,
Helminthosporium sorghicola, Curvularia lunata, Phoma insidiosa,
Pseudomonas avenae (Pseudomonas alboprecipitans), Ramulispora
sorghi, Ramulispora sorghicola, Phyllachara sacchari, Sporisorium
reilianum (Sphacelotheca reiliana), Sphacelotheca cruenta,
Sporisorium sorghi, Sugarcane mosaic H, Maize Dwarf Mosaic Virus A
& B, Claviceps sorghi, Rhizoctonia solani, Acremonium strictum,
Sclerophthona macrospora, Peronosclerospora sorghi,
Peronosclerospora philippinensis, Sclerospora graminicola, Fusarium
graminearum, Fusarium oxysporum, Pythium arrhenomanes, Pythium
graminicola, etc.
[0143] Nematodes include parasitic nematodes such as root-knot,
cyst, and lesion nematodes, including Heterodera spp., Meloidogyne
spp., and Globodera spp.; particularly members of the cyst
nematodes, including, but not limited to, Heterodera glycines
(soybean cyst nematode); Heterodera schachtii (beet cyst nematode);
Heterodera avenae (cereal cyst nematode); and Globodera
rostochiensis and Globodera pailida (potato cyst nematodes). Lesion
nematodes include Pratylenchus spp.
[0144] Various changes in phenotype are of interest including
modifying the fatty acid composition in a plant, altering the amino
acid content of a plant, altering a plant's pathogen defense
mechanism, and the like. These results can be achieved by providing
expression of heterologous products or increased expression of
endogenous products in plants.
[0145] Genes of interest are reflective of the commercial markets
and interests of those involved in the development of the crop.
Crops and markets of interest change, and as developing nations
open up world markets, new crops and technologies will emerge also.
In addition, as our understanding of agronomic traits and
characteristics such as yield and heterosis increase, the choice of
genes for transformation will change accordingly. General
categories of genes of interest include, for example, those genes
involved in information, such as zinc fingers, those involved in
communication, such as kinases, and those involved in housekeeping,
such as heat shock proteins. More specific categories of
transgenes, for example, include genes encoding important traits
for agronomics, insect resistance, disease resistance, herbicide
resistance, sterility, grain characteristics, and commercial
products. Genes of interest include, generally, those involved in
oil, starch, carbohydrate, or nutrient metabolism as well as those.
In addition, genes of interest include genes encoding enzymes and
other proteins from plants and other sources including prokaryotes
and other eukaryotes.
[0146] The following examples are offered by way of illustration
and not by way of limitation.
Example 1
The Functionality of the upa.sub.AvrBs3 Box Does Not Depend on Its
Position But Depends on Its Orientation
[0147] In order to test the functionality of the Bs3 promoter
derivatives, a HR-based reporter assay was used. This assay, which
is referred to herein as the "argo-infiltration assay," is based on
the fact that Agrobacterium-mediated delivery of a T-DNA construct
("agroinfiltration") containing the Bs3 gene (Bs3 promoter+Bs3
coding sequence) triggers an HR in Nicotiana benthamiana if a T-DNA
with a 35S Cauliflower mosaic virus-driven avrBs3 gene is
co-delivered. In this assay, AvrBs3 will be expressed and activates
the Bs3 promoter or derivatives thereof if they are compatible. In
planta expression of the Bs3 protein triggers cell death. Thus, in
the above described assay, the AvrBs3-inducibility of Bs3 promoter
derivatives can be determined based on the presence or absence of
an HR.
[0148] We first introduced point mutations into a sequence
comprising the upa.sub.AvrBs3 box (SEQ ID NO: 26:
GCCTGACCAATTTTATTATATAAACCTAACCATCCTC; located 102 bp 5' of the Bs3
ATG) of the Bs3 promoter and showed by the HR reporter assay, that
some of these Bs3 promoter mutants did no longer trigger an HR when
being agro-infiltrated together with a constitutively expressed
avrBs3 gene. We now used one Bs3 promoter mutant derivative
(referred to a "Bs3 upa.sub.mut") that no longer triggers an
AvrBs3-inducible HR (FIG. 1) for further studies (Bs3 upa.sub.mut
sequence, SEQ ID NO: 27: GCCTGACCAATTTTATAATATAAACCTAACCATCCTC;
mutated residue is underlined). The upaAvrBs3 box was inserted 294
and 424 bp upstream (5') of the ATG inserted in the non-functional
Bs3 upa.sub.mut promoter. Both promoter constructs (Bs3 upa.sub.294
and Bs3 upa.sub.424) were tested via the agro-infiltration assay
described and were found to functional like the Bs3 wild-type
promoter (FIG. 1). Thus, these results demonstrate that the
upa.sub.AvrBs3 box can be moved to other locations within the Bs3
promoter without losing its biological activity (i.e., upa box
activity).
[0149] The upa.sub.AvrBs3 box was also inserted in inverse
orientation into the non-functional Bs3 upa.sub.mut promoter.
However, this construct did not result in HR in the
agro-infiltration assay. This result indicates that the orientation
of the upa.sub.AvrBs3 box is not flexible (data not shown).
Example 2
Functionality of the upa.sub.AvrBs3 Box is Not Restricted to the
Bs3 Promoter
[0150] The promoter of the tomato R gene Bs4 is expressed
constitutively, but at very low levels (Schornack et al. (2005)
Mol. Plant Microbe Interact. 18:1215-1225). When the Bs3 coding
region was placed under the transcriptional control of the Bs4
promoter, this construct did not give HR in the agro-infiltration
assay described in Example 1, irrespective of whether this
construct is expressed with or without AvrBs3 (FIG. 1). The
upa.sub.AvrBs3 box and a mutated upa.sub.AvrBs3 box (from the Bs3
upa.sub.mut promoter, see FIG. 1) were inserted 35 bp 5' of the
predicted TATA-Box of the Bs4 promoter. The construct comprising
the Bs4 promoter with the upaAvrBs3 Box (Bs4 upa; SEQ ID NO: 9)
showed an HR after being agro-infiltrated with a constitutively
expressed avrBs3 gene (FIG. 1). By contrast a construct comprising
a Bs4 promoter with a mutated upa.sub.AvrBs3 box (Bs4 upa.sub.mut;
SEQ ID NO: 10) did not trigger an AvrBs3-dependent HR (FIG. 1).
Thus, the upa.sub.AvrBs3 box not only displays its biological
activity (i.e., upa box activity) in the context of the pepper Bs3
promoter but also displays its biological activity in the context
of the tomato Bs4 promoter. Thus, the function or biological
activity of the upa.sub.AvrBs3 box seems is not dependent on being
located within one particular promoter.
Example 3
AvrXa27 and the Xa27 Promoter Can Functionally Replace AvrBs3 and
the Bs3 Promoter
[0151] Constructs were made to test whether the combination of
AvrXa27 from Xanthomonas oryzae pv. oryzae (Xoo) and the rice Xa27
promoter could functionally replace the Xanthomonas campestris pv.
vesicatoria (Xcv) AvrBs3 protein and the matching pepper Bs3
promoter. The rice Xa27 promoter (Xa27.sub.PRoM, AvrXa27-inducible;
SEQ ID NO: 11) and the allelic xa27 promoter (xa27.sub.PRoM, not
AvrXa27 inducible; SEQ ID NO: 12) in front of the Bs3 coding region
(Bs3.sub.CDS; SEQ ID NO: 1) yielding two promoter constructs
referred to Xa27.sub.PROM-Bs3.sub.cDs and
xa27.sub.PROM-Bs3.sub.CDS, respectively. Upon
Agrobacterium-mediated delivery in the agro-infiltration assay,
only Xa27.sub.PROMBs3.sub.CDS but not the xa27.sub.PROM-Bs3.sub.CDS
construct triggered an AvrXa27-dependent HR in Nicotiana
benthamiana leaves (FIG. 2). Importantly, AvrBs3 did not trigger HR
in combination with Xa27.sub.PROM-Bs3.sub.CDS (data not shown). In
summary, these results indicate that the combination of AvrXa27 and
the Xa27 promoter functionally replaces the combination of AvrBs3
and the Bs3 promoter.
Example 4
[0152] Functionally Relevant Nucleotide Polymorphisms Between the
Xa27 and xa27 Promoters Are Located Adjacent to the Predicted TATA
Box
[0153] A comparison of the rice Xa27 and xa27 promoters revealed 15
polymorphisms in a genomic region of about 1000 bp upstream of the
transcriptional start site (Gu et al. (2005) Nature 435:1122-1125).
It remained unclear, however, which nucleotide polymorphisms
between the Xa27 and the xa27 promoters are functionally relevant.
By contrast the promoters of the functionally different pepper Bs3
and Bs3-E promoters differ only in a region that is located
adjacent to the TATA box. This TATA box motif in the Bs3 and Bs3-E
promoters is also part of the upa.sub.AvrBs3 box and
upa.sub.AvrBs3.DELTA.rep16 box. Thus, the nucleotide polymorphisms
between the Xa27 and xa27 promoters that are located adjacent to
the TATA box might be the functionally relevant polymorphisms and
possibly part of a upa.sub.AvrXa27 box. To test this hypothesis,
the xa27 promoter was modified by site-directed mutagenesis to
change the polymorphic residues adjacent to the TATA box in such a
way that they are identical to corresponding residues in the Xa27
promoter sequence. Functional analysis showed that this mutated
xa27 promoter was functionally identical to the Xa27 promoter (FIG.
2). Furthermore, these results provide evidence that the
upa.sub.AvrXa27 box is located in the immediate vicinity of the
TATA box in the Xa27 promoter.
Example 5
The upa Boxes of the Bs3, Bs3-E and Xa27 Promoters Can Be
Functionally Combined in One Complex Promoter
[0154] The results described in Examples 1-4 resulted in the
hypothesis that one can combine different upa boxes (e.g.,
upa.sub.AvrXa27, upa.sub.AvrBs3 and upa.sub.AvrBs3.DELTA.rep16
boxes) into one promoter that than would be transcriptionally
activated by two or more different TAL effectors. For this purpose,
the upa.sub.AvrXa27 box and the upa.sub.AvrBs3.DELTA.rep16 box were
introduced into the Bs3 promoter. The analysis of the different
combinations of upa boxes that as depicted in FIG. 3A showed that
one could functionally combine two or three upa boxes into one
complex promoter (FIG. 3B). Taken together, these results
demonstrate that upa boxes corresponding to different TAL effectors
can be functionally combined into one complex promoter, resulting
in a promoter that can be transcriptionally activated by two or
more different TAL. Such a promoter finds use in the development of
new strategies for increasing the resistance of a plant to multiple
bacterial pathogens by introducing into the plant an R gene coding
sequence that is under the control of a complex promoter as
described herein.
Example 6
Insertion of the UPT Boxes of the Rice OsTFX1, Os11N3 and Xa13 into
the Pepper Bs3 Promoter
[0155] The UPT.sub.PthXo6, UPT.sub.AvrXa7 and UPT.sub.PthXo1 boxes
(SEQ ID NOS: 31-33, respectively) of the rice OsTFX1, Os11N3 and
Xal3 promoters, respectively, were each inserted separately into
the pepper Bs3 promoter 5' of the upa.sub.AvrBs3 box. The resulting
promoter constructs were cloned in front of an uidA reporter gene.
The Bs3 promoter-embedded UPT boxes were agro-infiltrated into N.
benthamiana leaves in combination with the 35S promoter-driven TALe
genes pthXo1, pthXo6, avrXa7 and avrBs3, respectively. GUS assays
demonstrated that a Bs3 promoter derivative containing a given UPT
box is transcriptionally activated only by the matching Xoo TAL
effector (data not shown). For example, insertion of the
UPT.sub.PthXo6 box from the rice OsTFX1 into the pepper Bs3
promoter made this promoter construct inducible by the TAL effector
PthXo6 but not PthXo1. By contrast, the Bs3 wildtype promoter (Bs3)
that lacks the UPT.sub.PthXo6 box was only inducible by AvrBs3 but
not PthXo6. Similarly insertion of the UPT.sub.AvrXa7 and
UPT.sub.PthXo1 boxes separately into the Bs3 promoter resulted in
promoter constructs that were AvrXa7 and PthXo1 inducible,
respectively (data not shown). All Bs3 promoter constructs contain
the UPT.sub.AvrBs3 box and thus, were also AvrBs3 inducible,
irrespective of whether a Xoo UPT box was present or not (data not
shown). In summary, these results demonstrate that insertion of the
UPT.sub.PthXo6, UPT.sub.AvrXa7 and UPT.sub.PthXo1 separately into
the pepper Bs3 promoter confers upon the Bs3 promoter inducibility
by the TAL effectors, PthXo6, PthXo6, and AvrXa7, respectively.
Example 7
The Citrus UPT.sub.PthAW Box is Functional When Inserted into the
Pepper Bs3 Promoter
[0156] The production of citrus has become imperiled by the
unabated spread of the bacterial disease citrus canker. The United
States is the third largest citrus producer in the world, with the
greatest citrus production occurring in Florida, valued at more
than $9 billion (Boriss (2006) Commodity profile: Citrus
Agriculture Marketing Resource Center, University of California;
Hodges et al. (2006) Economic impacts of the Florida citrus
industry in 2003-04, University of Florida, Institute for Food and
Agriculture Sciences, EDIS document FE633). Severe economic
consequences from citrus canker have occurred from the loss of
marketability of fruit, reduction in fruit production and tree
vigor, extra control measures, and the substantial cost incurred by
eradication efforts. Various strains of Xanthomonas are known to
cause citrus canker (Table 1). Unsuccessful attempts to eliminate
the disease between 1996 and 2006 by eradication resulted in a cost
of $1.2 billion and the destruction of 7 million commercial and 5
million nursery and residential trees (Bausher et al. (2006) BMC
Plant Biol. 6:21), the largest plant-pest eradication effort ever
carried out in the U.S. No new solutions have yet been deployed,
and the recommended alternative management strategies are to plant
windbreaks, minimize the establishment of disease with copper
sprays, and control populations of leafminer, which contribute to
disease spread (Graham et al. (2007) 2008 Florida citrus pest
management guide for citrus canker, University of Florida,
Institute for Food and Agriculture Sciences, EDIS document PP-182).
These methods do limit the extent of disease; however they are
inadequate to provide effective control, and they incur additional
costs, have chemical safety issues and may not be durable (Canteros
(2002) Phytopathol. 92:S116). The use of other chemical control
measures, such as induced systemic resistance compounds, has also
been ineffective (Graham et al., 2004). The preferred control
method for citrus canker, as indeed with all plant diseases, is
genetic resistance, because it is generally more effective and
environmentally benign. Therefore, new strategies for genetic
resistance in citrus species are needed to combat the epidemic of
citrus canker in Florida and other afflicted, citrus-growing
regions of the world.
[0157] Toward this aim, the UPT.sub.PthAw box (SEQ ID NO: 41) for
the TAL effector PthAw of the citrus pathogen, Xanthomonas citri
subsp. citri, was inserted into the pepper Bs3 promoter 5' of the
upa.sub.AvrBs3 box. The resulting promoter construct was then
cloned in front of an uidA reporter gene. This promoter construct
was agro-infiltrated into N. benthamiana leaves in combination with
the 35S promoter-driven pthAw. GUS assays demonstrated that this
Bs3 promoter construct comprising a UPT.sub.PthAW box was
transcriptionally activated when PthAw was co-expressed in the N.
benthamiana leaves (data not shown). This result demonstrates that
insertion of a citrus UPT box into the pepper Bs3 promoter confers
upon the Bs3 promoter inducibility by a TAL effector from a
bacterial pathogen of citrus. Such a promoter finds use in genetic
resistance strategies for combating citrus canker as described
hereinabove.
TABLE-US-00001 TABLE 1 Xanthomonas Strains Causing Canker on Citrus
Strain Pathovar Designation name(s) Geography Species effected A,
Asiatic Xanthomonas Argentina, Bolivia, Wide range, high citri
subsp. citri Brazil, China, Florida, pathogenicity on sweet Also
known as: Hong Kong, India, orange, grapefruit, Key X. campestris
pv Japan. Malaysia, Lime. Mandarin is citri Strain A Mauritius,
Pakistan, more resistant. X. axonopodis Paraguay, Philippines, pv
citri Reunion Is, Rodrigues X. smithii subsp Is, Taiwan, Thailand,
citri Uruguay, Vietnam Aw Same as A Florida Key Lime, other citrus
are immune. A* Same as A India, Iran, Saudi Key Lime, other citrus
Arabia are immune. B, Cancrosis B X. fuscans subsp. Argentina,
Uruguay Key Lime, lemons. aurantifolii C, Cancrosis C X. fuscans
subsp. Brazil Key Lime aurantifolii
Example 8
Construction of a Complex Promoter for Genetic Resistance to Citrus
Canker
[0158] A complex promoter with 14 UPT boxes from Xanthomonas
strains that are known to cause canker on citrus was produced by
inserting the 14 UPT boxes into the Bs3 promoter. To synthesize
this complex promoter, restriction enzyme recognition sites for
AgeI and XhoI were first introduced into the Bs3 promoter using
site-directed mutagenesis. The 14 UPT boxes were inserted into this
modified Bs3 promoter between the AgeI and XhoI sites. This
nucleotide sequence of the complex promoter is set forth in SEQ ID
NO: 34. The complex promoter retains the upa.sub.AvrBs3 box of the
wild-type Bs3 promoter and thus, is expected to be inducible by
AvrBs3. The 14 UPT boxes and their TAL effectors are set forth in
Table 2. This construct will be tested for inducibility by each of
the 17 TAL effectors listed in Table 1. Two of the UPT boxes,
UPT.sub.Apl1 and UPT.sub.PthA3, are expected to bind multiple TAL
effectors. UPT.sub.Apl1 is expected to bind Apl1, PthA4, and
PthA-KC21. UPT.sub.PthA3 is expected to bind PthA3 and PB3.1.
TABLE-US-00002 TABLE 2 UPT boxes and Citrus Canker TAL effectors
Accession UPT Box TAL effector Species Strain number UPT.sub.Apl1
(SEQ ID NO: 35) Apl1 Xanthomonas citri A, Asiatic NA-1
TATAAACCTCTTTTACCTT subsp. citri PthA4 Xanthomonas citri A, Asiatic
306 subsp. citri PthA-KC21 Xanthomonas citri A, Asiatic KC21 subsp.
citri UPT.sub.Apl2 (SEQ ID NO: 36) Apl2 Xanthomonas citri A,
Asiatic NA-1 TATACACCTCTTTTACT subsp. citri UPT.sub.Apl3 (SEQ ID
NO: 37) Apl3 Xanthomonas citri A, Asiatic NA-1
TACACACCTCCACCACCTCTACTT subsp. citri UPT.sub.PthB (SEQ ID NO: 38)
PthB X. Fuscans B, Cancrosis B69 TCTCTATCTCAACCCCTTT subsp.
aurantifoli B UPT.sub.PthA* (SEQ ID NO: 39) PthA* Xanthomonas citri
A* Xc270 TATACACCTCTTTACATTT subsp. citri UPT.sub.PthA*2 (SEQ ID
NO: 40) PthA*2 Xanthomonas citri A* Xc270 TATATACCTACACCCT subsp.
citri UPT.sub.PthAw (SEQ ID NO: 41) PthAw Xanthomonas citri Aw
X0053 TATTTACCACTCTTACCTT subsp. citri UPT.sub.PthA1 (SEQ ID NO:
42) PthA1 Xanthomonas citri A, Asiatic 306 TATATACCTACACTACCT
subsp. citri UPT.sub.PthA2 (SEQ ID NO: 43) PthA2 Xanthomonas citri
A, Asiatic 306 TACACACCTCTTTTAAT subsp. citri UPT.sub.PthA3 (SEQ ID
NO: 44) PthA3 Xanthomonas citri A, Asiatic 306 TACACATCTTTAAAACT
subsp. citri pB3.1 Xanthomonas citri A, Asiatic KC21 subsp. citri
UPT.sub.pB3.7 (SEQ ID NO: 45) pB3.7 Xanthomonas citri A, Asiatic
KC21 TATATACCTACACTACACTACCT subsp. citri UPT.sub.HssB3.0 (SEQ ID
NO: 46) HssB3.0 Xanthomonas citri A, Asiatic KC21 TACACATTATACCACT
subsp. citri UPT.sub.PthA (SEQ ID NO: 47) PthA Xanthomonas citri A,
Asiatic 3213 TATAAATCTCTTTTACCTT subsp. citri UPT.sub.PthC (SEQ ID
NO: 48) PthC X. fuscans C, Cancrosis C340 TCTCTATATAACTCCCTTT
subsp. aurantifoli C
[0159] The article "a" and "an" are used herein to refer to one or
more than one (i.e., to at least one) of the grammatical object of
the article. By way of example, "an element" means one or more
element.
[0160] Throughout the specification the word "comprising," or
variations such as "comprises" or "comprising," will be understood
to imply the inclusion of a stated element, integer or step, or
group of elements, integers or steps, but not the exclusion of any
other element, integer or step, or group of elements, integers or
steps.
[0161] All publications and patent applications mentioned in the
specification are indicative of the level of those skilled in the
art to which this invention pertains. All publications and patent
applications are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
[0162] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
claims.
Sequence CWU 1
1
4812244DNACapsicum annuumgene(0)...(0)Bs3 1atgatgaatc agaattgctt
taattcttgt tcacctctaa ctgttgatgc acttgaacca 60aaaaaatcct cttgtgctgc
taaatgcata caagtaaatg gtcctcttat tgttggagct 120ggcccttcag
gcctggctac tgctgccgtc cttaagcaat acagtgttcc gtatgtaatc
180attgaacgcg cggactgcat tgcttctctg tggcaacaca agacctacga
tcggcttagg 240cttaacgtgc cacgacaata ctgcgaattg cctggcttgc
catttccacc agactttcca 300gagtatccaa ccaaaaacca attcatcagc
tacctcgtat cttatgcaaa gcatttcgag 360atcaaaccac aactcaacga
gtcagtaaac ttagctggat atgatgagac atgtggttta 420tggaaggtga
aaacagtttc tgaaatcaat ggttcaacct ctgaatacat gtgtaagtgg
480cttattgtgg ccacaggaga gaatgctgag atgatagtgc ccgaattcga
aggattgcaa 540gattttggtg gccaggttat tcatgcttgt gagtacaaga
ctggggaata ctatactgga 600gaaaatgtgc tggcggttgg ctgtggcaat
tccgggatcg atatctcact tgatctttcc 660caacataatg caaatccatt
catggtagtt cgaagctcgg taagttttat attcaataag 720tattattttt
caagtaacac tagaaagtga tcttgtatct ttcatttgct cgcatgaata
780tattatattc acacatgaat gatatcatct agttttgtta atctttcagg
tacagggtcg 840taatttccct gaggaaataa acatagttcc agcaatcaag
aaatttactc aaggaaaagt 900agaatttgtt aatggacaaa ttctagagat
cgactctgtt atcttggcaa ctggttatac 960cagcaatgta acttcttggt
taatggtaag gaaatacaca agttttattt ctatgcctaa 1020ttaaattggt
gtttaatcat aaattatata tagtactaag tatgataaaa gctccttcaa
1080ctataaagga tgatttagtc aaatgaactc ttaatgaatg tagtaattat
ttatggattc 1140ttgttacatt catgtaagtt ggtatctcat tatcctgtgg
attctttcct ttgagttatt 1200aattagttag aattcactat aaccgtcttt
tttcttttac cctttcctca tacctttttg 1260ttcttttgat aactcgaact
cacaatctta agattgggaa taaggggctc tttaccatct 1320gagcaacttt
ctctcgttct ataatagccc ccttcgaaat ttggtctaat gagaatttta
1380ctgatacagg agagtgaatt gttttcaagg gagggatgtc caaaaagccc
attcccaaat 1440ggttggaagg gggaggatgg tctctatgca gttggattta
caggaatagg actgtttggt 1500gcttctatag atgccactaa tgttgcacaa
gatattgcca aaatttggaa agaacaaatg 1560tagcacaaga atcataatca
atctgttgga tgcatgccat ggagaagaag caagttactt 1620ttctcatgtc
aagaaaataa gatttttttt tttcttcctg taatattact gggattggat
1680attctcccag ttgccttttg tttgatttgt gtcatgtgtg aaaataataa
tttaatggtt 1740tgtaagttat tcttctattt gatgttttaa gtcacttgtt
ttatattttt cctgtgatgg 1800atttatatta tgaattttta tataaattat
ttttttttcc tttttcaagg ttgcatttca 1860ataccagtca tattaaccat
tttcgaactc tacttctttt tatgacatag attttgaagc 1920atttttctgt
gaccccactc acaattagga ttcatttggt acaaacaact agcccgtggc
1980gagtcaacta tgagggcata tatatatata tttttttttc catttagact
tgaactatcc 2040tactttatgg tattaatcga gccatgtttc aacttagaat
tttcattcat attattagag 2100gctttctaga ttgaatttgt taaattttat
gggtctaatt ccacacttta ttatgactag 2160gcttatgagg atatgctagg
ggtcttcttg accttcattg gtctgagatg tccgttacgg 2220tcaggacctg
cactcagatc atga 224424499DNALycopersicon esculentumgene(0)...(0)Bs4
2atggcatctt cttcttcttc ttctgcaagt aattcaaagt attatcctcg atggaagtac
60gttgtttttc taagtttcag aggtgaagac actcgaaaaa catttacagg tcacttatac
120gaaggtttga gaaatagagg aataaacaca tttcaagatg ataaaagact
agagcatgga 180gattcaattc caaaagaact cttgagagct atagaagatt
ctcaagttgc acttatcatt 240ttctcaaaga attatgctac atctaggtgg
tgcttgaatg aactagtgaa gatcatggaa 300tgcaaagagg aagaaaatgg
acaaacagtc ataccgatct tttataatgt ggatccatca 360catgttcgat
accaaactga aagctttgga gcagcatttg ccaaacacga atcaaagtat
420aaggatgatg ttgaggggat gcagaaggtg caaagatgga gaactgccct
aactgctgcc 480gcaaatctaa aaggatatga tatccgtaac gggttagttg
aatacacata attactttta 540atgtttttac tgttaaaaag gcatagtcca
atcaatttaa ttagagaaga tacataaaag 600tccaaaaaac tattcaagtt
ttgcaacttc catacttgaa aactatagag tattgttatt 660acctgaacta
ttctatttcc tatttaatac cctgctgatt attaacaata tatatagagt
720atatgaaata cttgttggta tttgactttc ttacattgtc cacaatcaat
tttcttcttt 780atgtaggatt gaatcagaga atattcagca gatcgtagat
tgcatctctt ccaaattttg 840tacgaatgct tattctttat cttttttgca
agatattgtg ggaataaatg ctcacttaga 900gaaactaaaa tcgaaacttc
aaatagaaat caatgatgtt cggattttag ggatctgggg 960aataggcgga
gtcggtaaaa caagaatagc aaaagccatt tttgatactc tatcttatca
1020atttgaagct tcttgttttc ttgctgatgt taaagaattt gcaaaaaaga
ataaactgca 1080ttctttacaa aatattcttc tctctgaact gttaaggaaa
aaaaatgatt acgtctacaa 1140caagtatgat ggaaagtgta tgattccaaa
cagactttgt tctttgaagg ttctaattgt 1200gcttgatgat atagatcatg
gtgatcagat ggagtattta gcaggtgata tttgttggtt 1260tggtaatggc
agcagagtta ttgtaacaac tagaaacaaa catttgatag agaaagatga
1320tgcgatatac gaagtgtcta cactgcctga tcatgaagct atgcaattat
tcaatatgca 1380tgcttttaaa aaagaagttc caaatgagga ttttaaggag
ttggcgttag agatagtaaa 1440tcacgctaaa ggcctccctt tagccctcaa
ggtgtggggc tgtttattgc ataaaaaaaa 1500tctctcttta tggaaaataa
cagtagagca aataaagaaa gactctaatt cagaaattgt 1560tgaacaactc
aaaataagtt atgatgggtt ggagtccgaa gagcaggaaa tatttttaga
1620tatagcatgt ttcttccgcg gagagaaaag aaaagaggtc atgcaaattc
ttaagagttg 1680tgactttgga gctgaatacg gattggatgt tctgattaat
aaatctcttg tgttcatatc 1740tgaaaatgac aggattgaaa tgcatgattt
gattagagat atgggtagat atgtggtgaa 1800aatgcaaaag cttcagaaaa
aacgtagcag aatatgggat gttgaagatt tcaaagaagt 1860gatgatagac
tatacggtaa gtaagcttaa caatgcaatg atatttaatt tctaattttt
1920atattccaag gaacttatag gctaatcaat acagtttatg aataattgac
tcattgatct 1980ttataccagg ggaccatgac agtggaagca atctggttta
gttgctttga agaagtacgt 2040tttaataagg aggcaatgaa aaaaatgaaa
aggcttagga tattacacat atttgatggt 2100tttgtcaaat tcttctcttc
gcctccctct tccaattcca atgattcaga agaagaagat 2160gattcctacg
acttagtcgt agatcaccat gatgactcta ttgagtacct gtccaataac
2220ttgcgttggt tagtctggaa tcactattct tggaagtcat tgccagaaaa
ttttaaacca 2280gaaaagcttg ttcatcttga actccgttgg agttcgcttc
attatttatg gaagaaaaca 2340gaggtaacat tattatttac tttacttacc
ctcctccagg agcttcaacc ccttttgctc 2400tcttatttac tcgaacccac
aaccttttgg gttggaagtg agggtgctca actccctctt 2460gtcatttttg
gtctgacaca aagatcatta ttctttctct attttgaata acagcatttg
2520ccgtctctac gaaagctaga tctcagctta tctaaaagtc tggtgcaaac
accagatttc 2580acggggatgc caaatttgga gtatttgaat ctggagtact
gtagtaagct tgaagaggtt 2640cactattccc tagcatattg cgaaaaactc
attgagttaa atttgagttg gtgtacaaag 2700cttaggagat ttccatatat
taacatggaa tctcttgaat ctctggatct acaatattgc 2760tatggtataa
tggtgtttcc agaaatcatc ggaacgatga agccggagtt aatgattctc
2820tcagcaaaca ctatgataac tgaactacca tcatctcttc agtacccaac
tcatctcaca 2880gagctagatt tgagtggcat ggaaaacctt gaagctcttc
caagcagcat tgtcaagttg 2940aaagatttgg tgaagctaaa tgtgtcgtac
tgcttaacgc ttaaaagctt gcctgaagag 3000attggtgatt tagaaaactt
ggaggaactt gatgcttcgc gtactctaat ttcacagcct 3060ccatcttcca
ttgtccgctt gaacaagctt aaatccttga agttaatgaa acgaaacaca
3120ttaacagatg atgtgtgctt tgtgtttcct cctgtgaata acgggttact
ctcattggaa 3180attctggagc tcggttcctc caatttcgaa gatggaagaa
ttccggaaga tattggatgt 3240ttatcctctt tgaaagagtt acgtctcgag
ggagataatt tcaatcattt gcctcaaagc 3300atagcccaac ttggtgcact
tcgattctta tacataaaag attgcaggag tcttacaagt 3360ctgccagaat
ttccaccgca attagataca atatttgcag attggagcaa tgatttgatc
3420tgtaagtcac tgtttctaaa tatctcatca ttccaacata acatctctgc
ttcagattcg 3480ttgtcgttaa gagtgtttac gagtttgggg agtagtatcc
caatctggtt ccaccatcag 3540ggaacagata caagtgtttc agtcaatttg
cctgaaaact ggtatgtatc agataacttc 3600ttgggattcg ctgtatgtta
ctatggcaat ttaactgaga acacagctga attgattatg 3660agttctgcag
ggatgccatg tatcacctgg aaacttttgt tatcgaatca ttcagaatgt
3720acatatatta ggattcattt tttcttggta ccttttgctg gcttatggga
tacatctaac 3780gccaatggta aaacaccaaa tgactataag cacattatgt
tatcttttcc tcaagaattg 3840aaggagtgtg gagttcgttt gttctatgaa
gatgaatctg tgcttgagac caccaatgat 3900gaacttacca ttggggtaag
gaggatcaga tacgacgacg acgatagtga acattatgag 3960gaggctggtt
gttcctcttc taagaaacaa agatcataat ataggtatat aaacttgtga
4020tcacttgctg tttgttatta ataattcatt tcgatgctct atgtggttgt
taaatatctc 4080tcatgttatg acagggagca gaggcggagc cagaattttc
aataagaggg ctcaaaatct 4140gtagaaatag atagctgaag gggtttgaca
tcttactata tatatacata taaacttatt 4200ttaaccatgt ataaataata
taatttttcg tcgaatgggg tttggatgaa ccccttctat 4260gaaggtacaa
tgaagcatca atcaaagtgt gagacagtgg aggaacgttc acatatagca
4320aacataaaaa tcatatttgt atgttatagt tatagttagc atcattgtaa
attttgtaca 4380aatgtttcag ttctttatta attcattttg tacattgtaa
atttgtataa taacatctgt 4440atttgtataa ttataagtgt atatgatgaa
tatatatgta tatatatact tttctctcg 449931024DNACapsicum
annuumgene(0)...(0)Bs3 3ctacggaata gcagcattaa ggcacatcag agattttttg
ggtgttaagt ttgtcatgaa 60acctgatgcc tccacaggaa ctgtcaatct catgtgtctt
ggctctggtt ttcagaattt 120atccagaaaa gtatcatgat aaattaatgg
tgtctgtgtt tggtggctta gagtgacggc 180tagatcaaca tctttgggat
gccttgtgga gtgaaatcaa gcatacttta tcataggcga 240aattttttgt
tgtggtttgc tgcttgtaat gagagagtga tataggaagc aaatgtggag
300atcacatttg ctcatctcct tgttgcgttg aaacttttgg tgtcaagagt
tctaattcac 360atgtatttga agattcctca tatgctgctt ttgtttctaa
ttattttttc tagtaagaaa 420acatttgttc ctgagtttcc aactagaaaa
aaatatcaag taaaatagaa ttcaatcatt 480tcccttacca acgcttggta
ctgccaaccg caacaaagaa ttaatgcaaa acaacagtct 540attaatatca
acctagacta aactccttag ttttactttg aaatgcgaat gatacatgac
600acattagatt gtacttgctt tttaccacag atacaacgat acatttgtat
atcttttccc 660ttatagcaaa ctctaatata tcatagtcaa gctaacgaaa
cttatgcaag ggaaatatga 720aattagtatg caagtaaact caaagaacta
atcattgaac tgaaagatca atatatcaaa 780aaaaaaaaaa aaacaataaa
accgtttaac cgatagatta accatttctg gttcagttta 840tgggttaaac
cacaatttgc acaccctggt taaacaatga acacgtttgc ctgaccaatt
900ttattatata aacctaacca tcctcacaac ttcaagttat catccccttt
ctcttttctc 960ctcttgttct tgtcacccgc taaatctatc aaaacacaag
tagtcctagt tgcacatata 1020tttc 102441037DNACapisucum
annuumgene(0)...(0)Bs3-E 4ctacggaata gcagcattaa ggcacatcag
agattttttg ggtgttaagt ttgtcatgaa 60acctgatgcc tccacaggaa ctgtcaatct
catgtgtctt ggctctggtt ttcagaattt 120atccagaaaa gtatcatgat
aaattaatgg tgtctgtgtt tggtggctta gagtgacggc 180tagatcaaca
tctttgggat gccttgtgga gtgaaatcaa gcatacttta tcataggcga
240aattttttgt tgtggtttgc tgcttgtaat gagagagtga tataggaagc
aaatgtggag 300atcacatttg ctcatctcct tgttgcgttg aaacttttgg
tgtcaagagt tctaattcac 360atgtatttga agattcctca tatgctgctt
ttgtttctaa ttattttttc tagtaagaaa 420acatttgttc ctgagtttcc
aactagaaaa aaatatcaag taaaatagaa ttcaatcatt 480tcccttacca
acgcttggta ctgccaaccg caacaaagaa ttaatgcaaa acaacagtct
540attaatatca acctagacta aactccttag ttttactttg aaatgcgaat
gatacatgac 600acattagatt gtacttgctt tttaccacag atacaacgat
acatttgtat atcttttccc 660ttatagcaaa ctctaatata tcatagtcaa
gctaacgaaa cttatgcaag ggaaatatga 720aattagtatg caagtaaact
caaagaacta atcattgaac tgaaagatca atatatcaaa 780aaaaaaaaaa
aaacaataaa accgtttaac cgatagatta accatttctg gttcagttta
840tgggttaaac cacaatttgc acaccctggt taaacaatga acacgtttgc
ctgaccaatt 900ttattatata aacctctcta ttccactaaa ccatcctcac
aacttcaagt tatcatcccc 960tttctctttt ctcctcttgt tcttgtcacc
cgctaaatct atcaaaacac aagtagtcct 1020agttgcacat atatttc
103751024DNACapsicum annuumgene(0)...(0)Bs3 upa-mut 5ctacggaata
gcagcattaa ggcacatcag agattttttg ggtgttaagt ttgtcatgaa 60acctgatgcc
tccacaggaa ctgtcaatct catgtgtctt ggctctggtt ttcagaattt
120atccagaaaa gtatcatgat aaattaatgg tgtctgtgtt tggtggctta
gagtgacggc 180tagatcaaca tctttgggat gccttgtgga gtgaaatcaa
gcatacttta tcataggcga 240aattttttgt tgtggtttgc tgcttgtaat
gagagagtga tataggaagc aaatgtggag 300atcacatttg ctcatctcct
tgttgcgttg aaacttttgg tgtcaagagt tctaattcac 360atgtatttga
agattcctca tatgctgctt ttgtttctaa ttattttttc tagtaagaaa
420acatttgttc ctgagtttcc aactagaaaa aaatatcaag taaaatagaa
ttcaatcatt 480tcccttacca acgcttggta ctgccaaccg caacaaagaa
ttaatgcaaa acaacagtct 540attaatatca acctagacta aactccttag
ttttactttg aaatgcgaat gatacatgac 600acattagatt gtacttgctt
tttaccacag atacaacgat acatttgtat atcttttccc 660ttatagcaaa
ctctaatata tcatagtcaa gctaacgaaa cttatgcaag ggaaatatga
720aattagtatg caagtaaact caaagaacta atcattgaac tgaaagatca
atatatcaaa 780aaaaaaaaaa aaacaataaa accgtttaac cgatagatta
accatttctg gttcagttta 840tgggttaaac cacaatttgc acaccctggt
taaacaatga acacgtttgc ctgaccaatt 900ttataatata aacctaacca
tcctcacaac ttcaagttat catccccttt ctcttttctc 960ctcttgttct
tgtcacccgc taaatctatc aaaacacaag tagtcctagt tgcacatata 1020tttc
102461059DNAArtificial Sequencegene(0)...(0)Bs3 upa294 6ctacggaata
gcagcattaa ggcacatcag agattttttg ggtgttaagt ttgtcatgaa 60acctgatgcc
tccacaggaa ctgtcaatct catgtgtctt ggctctggtt ttcagaattt
120atccagaaaa gtatcatgat aaattaatgg tgtctgtgtt tggtggctta
gagtgacggc 180tagatcaaca tctttgggat gccttgtgga gtgaaatcaa
gcatacttta tcataggcga 240aattttttgt tgtggtttgc tgcttgtaat
gagagagtga tataggaagc aaatgtggag 300atcacatttg ctcatctcct
tgttgcgttg aaacttttgg tgtcaagagt tctaattcac 360atgtatttga
agattcctca tatgctgctt ttgtttctaa ttattttttc tagtaagaaa
420acatttgttc ctgagtttcc aactagaaaa aaatatcaag taaaatagaa
ttcaatcatt 480tcccttacca acgcttggta ctgccaaccg caacaaagaa
ttaatgcaaa acaacagtct 540attaatatca acctagacta aactccttag
ttttactttg aaatgcgaat gatacatgac 600acattagatt gtacttgctt
tttaccacag atacaacgat acatttgtat atcttttccc 660ttatagcaaa
ctctaatata tcatagtcaa gctaacgaaa cttatgcaag ggaaatatga
720aattagtatg caattttatt atataaacct aaccatcctc acaaccaagt
aaactcaaag 780aactaatcat tgaactgaaa gatcaatata tcaaaaaaaa
aaaaaaaaca ataaaaccgt 840ttaaccgata gattaaccat ttctggttca
gtttatgggt taaaccacaa tttgcacacc 900ctggttaaac aatgaacacg
tttgcctgac caattttata atataaacct aaccatcctc 960acaacttcaa
gttatcatcc cctttctctt ttctcctctt gttcttgtca cccgctaaat
1020ctatcaaaac acaagtagtc ctagttgcac atatatttc
105971059DNAArtificial SequenceSynthetic promoter 7ctacggaata
gcagcattaa ggcacatcag agattttttg ggtgttaagt ttgtcatgaa 60acctgatgcc
tccacaggaa ctgtcaatct catgtgtctt ggctctggtt ttcagaattt
120atccagaaaa gtatcatgat aaattaatgg tgtctgtgtt tggtggctta
gagtgacggc 180tagatcaaca tctttgggat gccttgtgga gtgaaatcaa
gcatacttta tcataggcga 240aattttttgt tgtggtttgc tgcttgtaat
gagagagtga tataggaagc aaatgtggag 300atcacatttg ctcatctcct
tgttgcgttg aaacttttgg tgtcaagagt tctaattcac 360atgtatttga
agattcctca tatgctgctt ttgtttctaa ttattttttc tagtaagaaa
420acatttgttc ctgagtttcc aactagaaaa aaatatcaag taaaatagaa
ttcaatcatt 480tcccttacca acgcttggta ctgccaaccg caacaaagaa
ttaatgcaaa acaacagtct 540attaatatca acctagacta aactccttag
ttttactttg aaatgcgaat gatacatgac 600aattttatta tataaaccta
accatcctca caaccacatt agattgtact tgctttttac 660cacagataca
acgatacatt tgtatatctt ttcccttata gcaaactcta atatatcata
720gtcaagctaa cgaaacttat gcaagggaaa tatgaaatta gtatgcaagt
aaactcaaag 780aactaatcat tgaactgaaa gatcaatata tcaaaaaaaa
aaaaaaaaca ataaaaccgt 840ttaaccgata gattaaccat ttctggttca
gtttatgggt taaaccacaa tttgcacacc 900ctggttaaac aatgaacacg
tttgcctgac caattttata atataaacct aaccatcctc 960acaacttcaa
gttatcatcc cctttctctt ttctcctctt gttcttgtca cccgctaaat
1020ctatcaaaac acaagtagtc ctagttgcac atatatttc
10598131DNALycopersicon esculentumgene(0)...(0)Bs4 8gatcaaagcg
aatgttaata caagctttca cgtttcaagt ggtacttgtt taattcttct 60ttcttgtata
taactttgtc caaaatatca tcaattgatc tcatccatac aatttatttt
120taatcgaatc t 1319166DNAArtificial SequenceSynthetic promoter
9gatcaaagcg aatgttaata caagctttca ccaattttat tatataaacc taaccatcct
60cacaacgttt caagtggtac ttgtttaatt cttctttctt gtatataact ttgtccaaaa
120tatcatcaat tgatctcatc catacaattt atttttaatc gaatct
16610166DNAArtificial SequenceSynthetic promoter 10gatcaaagcg
aatgttaata caagctttca ccaattttat tatataaagg taaggatcct 60cacaacgttt
caagtggtac ttgtttaatt cttctttctt gtatataact ttgtccaaaa
120tatcatcaat tgatctcatc catacaattt atttttaatc gaatct
166111557DNAOryza sativagene(0)...(0)Xa27 11ctgcagctga accaaacagt
tttagctcca tcgaagaaag gagttatact gattggaatg 60ctctcacagt aaaaaaaaca
aggaagtaga gctggatttt agacagttct acaagaagtt 120agaactctac
caaaattgga attttggatg atggtctttt aaaaactcga ttgcaggaat
180aaaattttac ggcttgaaac ttacaaaatg attagaaaag ataacatgcc
tcagcgattt 240gtaaaaaagt gaacaaataa aaatctacaa taccactaaa
ctattgcttt attttgggga 300cattgcttac cattgaaaaa acaactaacc
gtaaatacga acacccatat caaatatact 360atcactgata aaataatcaa
ttgtaaattc aagcacacat attagtatag tactttaact 420cgattggata
gaagaaacct aactaattta agctatgcct cacaacaaaa aggtataaat
480tttttaaggc ttcttttttt ttcttgcgtt tgctagttta tgcttttaag
atgtttatac 540cttttactcc cctcattcac tgtttaaata caatgggaat
tagtgaaatc aatgagagtt 600caaacttcga aacactgaat acatgttatt
ttggattgaa atcaaatcga atcagtcaaa 660ttcaaatagg aggaggaaca
taggcattct tcctttcttc agcgggcacc attgaattca 720gatactgctt
cgcctagtct ctgtccaaga ctccacattt tctgatggtg atggggaact
780ctgaaactat aggaggaaga ataaaatgaa gaatgcagaa atgaatagta
atttgtgttt 840tttaattctt cttcaattcc accttaggat ccaacttcag
tccaaatcca aagtaatgca 900actgccacta gatcaggcta gagcttcaaa
ttcaactcca aaaacctccg taaagtggca 960cacacagagg aaaaatcctg
gattcgtcac tgcccatcaa catctgcttt cgcctcccaa 1020ttcctgcttt
ctgaaatctg ctttcgccga attcatgcct tcttgaatta tgctttctta
1080gaccctcttt agatgggact aaaactttta ctctctatca catcggatgt
ttggacacta 1140attataaata ttaaacgtag actattaata aaacccatct
ataatcttgt attaattcgc 1200gagacgaatc tattgagcct aattaatcca
tgattagcct atgtgatgct ataataaaca 1260ttctctaatt ataaattaat
tgggcttaaa aaatttgtct cgcgtattag ctttcattta 1320tataattagt
tttataaata gtctatattt aatactctaa attagtgtct aaatacaggg
1380actaaagtta agtcactgga tccaaacacc acctaaggtt ttcttgtgta
cttgtgaatt 1440gtggttgact acgactacta gtgctataaa tagaagaaga
gacccataga gagcatcaga 1500gcaaagtact cctaaaagac agccacacac
actgagacac ccaagaagct gcctcca 1557121589DNAOryza
sativagene(0)...(0)xa27 12ctgcagctga accaaacagt tttagctcca
tcgaagaaag gagttatact gattggaatg 60ctcacagtta aaaaaaacaa ggaagtagag
ctggatttta gacagttcta taagaagtta 120gaactctacc aaacggatag
ttaattggaa ttttggatga tggtctttta aaaactcgat 180tgcaggaata
aaattttacg gcttgaaact tacaaaatga ttagaaaaga taacatgcct
240cagcgatttg taaaaaagtg aacaaataaa aatctacaat
accactaaac tattgcttta 300ttttggggac attgcttacc attgaaaaaa
caactaaccg taaatacgaa cacccatgtc 360aaatatacta tcactgataa
aataatcaat tgtaaattca agcacacata ttagtatagt 420actttaactc
gattggatag aagaaaccta actaatttaa gctatgcctc acaacaaaaa
480ggtataaatt ttttaaggct tctttttttt ttcttgcgtt tgctagttta
tgcttttaag 540atgtttatac tttttactcc cctcattcac tgtttaaata
caatgggaat tagtgaaatc 600aatgagagtt caaacttcga aacactgaat
acatgttatt ttggattgaa atcaaatcga 660atcagtcaaa ttcaaatagg
aggaggaaca taggcattct tcctttcttc agcgggcacc 720attgaattca
gatactgctt cgcctagtct ctgtccaaga ctccacattt tctgatggtg
780atggggaact ctgaaactat aggaggaaga ataaaatgaa gaatgcagaa
atgaatagta 840atttgtgttt tttaattctt cttcaattcc accttaggat
ccaacttcag tccaaatcca 900aagtaatgca actgccacta gatcaggcta
gagcttcaaa ttcaactcca aaaacctccg 960taaagtggca cacacagagg
aaaaatcctg gattcgtcac tgcccatcaa catctgcttt 1020cgcctcccaa
ttcctgcttt ctgaaatctg ctttcgccga attcatgcct tcttgaatta
1080tgctttctta gaccctcttt agatgagact aaaactttta ctctctatca
catcggatgt 1140ttggacacta attataaata ttaaacgtag actattaata
aaacccatct ataatcttgt 1200attaattcgc gtgacgaatc tattgagcct
aattaatcca tgattagcct atgtgatgct 1260ataataaaca ttctctaatt
ataaattaat tgggcttaaa aaatttgtct cgcgtattag 1320ctttcattta
tgtaattagt tttataaata gtctatattt aatactctaa attagtgtct
1380aaatacaggg actaaagtta agtccctgga tccaaacgcc acctaaggtt
ttcttgtgta 1440cttgtgaatt gtggtttctt gtgtacttgt gaattgtggt
tgactacgac tacgagtgct 1500ataaatagaa gagaccaata gagagcatca
gagcaaagta ctcctaaaag acagccacac 1560acactgagac acccaagaag
ctgcctcca 1589131070DNAArtificial SequenceSynthetic promoter
13ctacggaata gcagcattaa ggcacatcag agattttttg ggtgttaagt ttgtcatgaa
60acctgatgcc tccacaggaa ctgtcaatct catgtgtctt ggctctggtt ttcagaattt
120atccagaaaa gtatcatgat aaattaatgg tgtctgtgtt tggtggctta
gagtgacggc 180tagatcaaca tctttgggat gccttgtgga gtgaaatcaa
gcatacttta tcataggcga 240aattttttgt tgtggtttgc tgcttgtaat
gagagagtga tataggaagc aaatgtggag 300atcacatttg ctcatctcct
tgttgcgttg aaacttttgg tgtcaagagt tctaattcac 360atgtatttga
agattcctca tatgctgctt ttgtttctaa ttattttttc tagtaagaaa
420acatttgttc ctgagtttcc aactagaaaa aaatatcaag taaaatagaa
ttcaatcatt 480tcccttacca acgcttggta ctgccaaccg caacaaagaa
ttaatgcaaa acaacagtct 540attaatatca acctagacta aactccttag
ttttactttg aaatgcgaat gatacatgac 600acattagatt gtacttgctt
tttaccacag atacaacgat acatttgtat atcttttccc 660ttatagcaaa
ctctaatata tcatagtcaa gctaacgaaa cttatgcaag ggaaatatga
720aattagtatg caattttatt atataaacct ctctattcca ctaaaccatc
ctcacaacca 780agtaaactca aagaactaat cattgaactg aaagatcaat
atatcaaaaa aaaaaaaaaa 840caataaaacc gtttaaccga tagattaacc
atttctggtt cagtttatgg gttaaaccac 900aatttgcaca ccctggttaa
acaatgaaca cgtttgcctg accaatttta ttatataaac 960ctaaccatcc
tcacaacttc aagttatcat cccctttctc ttttctcctc ttgttcttgt
1020cacccgctaa atctatcaaa acacaagtag tcctagttgc acatatattt
1070141107DNAArtificial SequenceSynthetic Promoter 14ctacggaata
gcagcattaa ggcacatcag agattttttg ggtgttaagt ttgtcatgaa 60acctgatgcc
tccacaggaa ctgtcaatct catgtgtctt ggctctggtt ttcagaattt
120atccagaaaa gtatcatgat aaattaatgg tgtctgtgtt tggtggctta
gagtgacggc 180tagatcaaca tctttgggat gccttgtgga gtgaaatcaa
gcatacttta tcataggcga 240aattttttgt tgtggtttgc tgcttgtaat
gagagagtga tataggaagc aaatgtggag 300atcacatttg ctcatctcct
tgttgcgttg aaacttttgg tgtcaagagt tctaattcac 360atgtatttga
agattcctca tatgctgctt ttgtttctaa ttattttttc tagtaagaaa
420acatttgttc ctgagtttcc aactagaaaa aaatatcaag taaaatagaa
ttcaatcatt 480tcccttacca acgcttggta ctgccaaccg caacaaagaa
ttaatgcaaa acaacagtct 540attaatatca acctagacta aactccttag
ttttactttg aaatgcgaat gatacatgac 600acattagatt gtacttgctt
tttaccacag atacaacgat acatttgtat atcttttccc 660ttatagcaaa
ctctaatata tcatagtcaa gctaacgaaa cttatgcaag ggaaatatga
720aattagtatg caattttatt atataaacct ctctattcca ctaaaccatc
ctcacaacca 780agtaaactca aagaactaat cattgaactg aaagatcaat
atatcaaaaa aaaaaaaaaa 840caataaaacc gtttaaccga tagattaacc
atttctggtt cagtttatgg gttaaaccac 900aatttgcaca ccgtgctata
aatagaagaa gagacccata gagagcatcc tggttaaaca 960atgaacacgt
ttgcctgacc aattttatta tataaaccta accatcctca caacttcaag
1020ttatcatccc ctttctcttt tctcctcttg ttcttgtcac ccgctaaatc
tatcaaaaca 1080caagtagtcc tagttgcaca tatattt
1107151059DNAArtificial SequenceSynthetic Promoter 15ctacggaata
gcagcattaa ggcacatcag agattttttg ggtgttaagt ttgtcatgaa 60acctgatgcc
tccacaggaa ctgtcaatct catgtgtctt ggctctggtt ttcagaattt
120atccagaaaa gtatcatgat aaattaatgg tgtctgtgtt tggtggctta
gagtgacggc 180tagatcaaca tctttgggat gccttgtgga gtgaaatcaa
gcatacttta tcataggcga 240aattttttgt tgtggtttgc tgcttgtaat
gagagagtga tataggaagc aaatgtggag 300atcacatttg ctcatctcct
tgttgcgttg aaacttttgg tgtcaagagt tctaattcac 360atgtatttga
agattcctca tatgctgctt ttgtttctaa ttattttttc tagtaagaaa
420acatttgttc ctgagtttcc aactagaaaa aaatatcaag taaaatagaa
ttcaatcatt 480tcccttacca acgcttggta ctgccaaccg caacaaagaa
ttaatgcaaa acaacagtct 540attaatatca acctagacta aactccttag
ttttactttg aaatgcgaat gatacatgac 600acattagatt gtacttgctt
tttaccacag atacaacgat acatttgtat atcttttccc 660ttatagcaaa
ctctaatata tcatagtcaa gctaacgaaa cttatgcaag ggaaatatga
720aattagtatg caagtaaact caaagaacta atcattgaac tgaaagatca
atatatcaaa 780aaaaaaaaaa aacaataaaa ccgtttaacc gatagattaa
ccatttctgg ttcagtttat 840gggttaaacc acaatttgca caccgtgcta
taaatagaag aagagaccca tagagagcat 900cctggttaaa caatgaacac
gtttgcctga ccaattttat tatataaacc taaccatcct 960cacaacttca
agttatcatc ccctttctct tttctcctct tgttcttgtc acccgctaaa
1020tctatcaaaa cacaagtagt cctagttgca catatattt
1059161104DNAArtificial SequenceSynthetic Promoter 16ctacggaata
gcagcattaa ggcacatcag agattttttg ggtgttaagt ttgtcatgaa 60acctgatgcc
tccacaggaa ctgtcaatct catgtgtctt ggctctggtt ttcagaattt
120atccagaaaa gtatcatgat aaattaatgg tgtctgtgtt tggtggctta
gagtgacggc 180tagatcaaca tctttgggat gccttgtgga gtgaaatcaa
gcatacttta tcataggcga 240aattttttgt tgtggtttgc tgcttgtaat
gagagagtga tataggaagc aaatgtggag 300atcacatttg ctcatctcct
tgttgcgttg aaacttttgg tgtcaagagt tctaattcac 360atgtatttga
agattcctca tatgctgctt ttgtttctaa ttattttttc tagtaagaaa
420acatttgttc ctgagtttcc aactagaaaa aaatatcaag taaaatagaa
ttcaatcatt 480tcccttacca acgcttggta ctgccaaccg caacaaagaa
ttaatgcaaa acaacagtct 540attaatatca acctagacta aactccttag
ttttactttg aaatgcgaat gatacatgac 600acattagatt gtacttgctt
tttaccacag atacaacgat acatttgtat atcttttccc 660ttatagcaaa
ctctaatata tcatagtcaa gctaacgaaa cttatgcaag ggaaatatga
720aattagtatg caattttatt atataaacct ctctattcca ctaaaccatc
ctcacaacca 780agtaaactca aagaactaat cattgaactg aaagatcaat
atatcaaaaa aaaaaaaaaa 840caataaaacc gtttaaccga tagattaacc
atttctggtt cagtttatgg gttaaaccac 900aatttgcaca ccgtgctata
aatagaagag accaatagag agcatcctgg ttaaacaatg 960aacacgtttg
cctgaccaat tttattatat aaacctaacc atcctcacaa cttcaagtta
1020tcatcccctt tctcttttct cctcttgttc ttgtcacccg ctaaatctat
caaaacacaa 1080gtagtcctag ttgcacatat attt 11041719DNACapsicum
annuumgene(0)...(0)Bs3 17tatataaacc taaccatcc 191815DNACapsicum
annuumgene(0)...(0)Bs3-E 18tatataaacc tctct 151919DNACapsicum
annuumgene(0)...(0)Bs3 upa-mut 19aatataaacc taaccatcc
192035DNACapsicum annuumgene(0)...(0)Bs3 20caattttatt atataaacct
aaccatcctc acaac 352135DNAArtificial Sequencemutated Bs3 UPA Box
21caattttatt atataaaggt aaggatcctc acaac 352218DNAOryza
sativagene(0)...(0)Xa27 22tagaagaaga gacccata 182334DNAOrzya
sativagene(0)...(0)xa27 23gtgctataaa tagaagagac caatagagag catc
342448DNACapsicum annuumgene(0)...(0)Bs3-E 24ttttattata taaacctctc
tattccacta aaccatcctc acaaccaa 482513DNAArtificial Sequenceupa box
consensus sequence 25tatataaacc ncc 132637DNACapsicum
annuumgene(0)...(0)Bs3 26gcctgaccaa ttttattata taaacctaac catcctc
372737DNAArtificial SequenceSynthetic promoter element 27gcctgaccaa
ttttataata taaacctaac catcctc 372825DNAOryza
sativagene(0)...(0)Os8N3 28tgcatctccc cctactgtac accac
252924DNAOryza sativagene(0)...(0)OstFX1 29tataaaaggc cctcaccaac
ccat 243023DNAOryza sativagene(0)...(0)OsTFIIAgamma 30tataatcccc
aaatcccctc ctc 233124DNAOryza sativagene(0)...(0)OsTFX1
31tataaaaggc cctcaccaac ccat 243227DNAOryza
sativagene(0)...(0)Os11N3 32tatataaacc ccctccaacc aggtgct
273324DNAOryza sativagene(0)...(0)OsXa13 33gcatctcccc ctactgtaca
ccac 2434963DNAArtificial Sequencesynthetic pathogen-inducible
promoter 34ttagttttac tttgaaatgc gaatgataca tgacacatta gattgtactt
gctttttacc 60acagatacaa cgatacattt gtatatcttt tcccttatag caaactctaa
tatatcatag 120tcaagctaac gaaacttatg caagggaaat atgaaattag
tatgcaagta aactcaaaga 180actaatcatt gaactgaaag atcaatatat
caaaaaaaaa aaaaaacaat aaaaccgttt 240aaccgataga ttaaccattt
ctggttcagt ttatgggtta aaccacaatt tgcacaccct 300gaccggttta
gttttacttt gaaatgctat aaacctcttt taccttgaat gatacatgac
360atatacacct cttttactca ttagattgta ctttacacac ctcctaccac
ctctacttgc 420tttttaccac agatctctat ctcaacccct tttacaacga
tacatttgta tacacctctt 480tacattttat atcttttccc tttatatacc
tacaccctat agcaaactct aattatttac 540cactcttacc ttatatcata
gtcaagctat atacctacac taccttaacg aaacttatgc 600tacacacctc
ttttaataag ggaaatatga aatacacatc tttaaaactt tagtatgcaa
660gtaatatata cctacactac actacctact caaagaacta attacacatt
ataccactca 720ttgaactgaa agatataaat ctcttttacc tttcaatata
tcaaaaatct ctatataact 780ccctttaaaa aaaaacaata actcgaggtt
aaacaatgaa cacgtttgcc tgaccaattt 840tattatataa acctaaccat
cctcacaact tcaagttatc atcccctttc tcttttctcc 900tcttgttctt
gtcacccgct aaatctatca aaacacaagt agtcctagtt gcacatatat 960ttc
9633519DNAArtificial Sequencepredicted UPT-Apl1 box 35tataaacctc
ttttacctt 193617DNAArtificial Sequencepredicted UPT-Apl2 box
36tatacacctc ttttact 173725DNAArtificial Sequencepredicted UPT-Apl3
box 37tacacacctc ctaccacctc tactt 253819DNAArtificial
Sequencepredicted UPT-PthB box 38tctctatctc aaccccttt
193919DNAArtificial Sequencepredicted UPT-PthAasterisk box
39tatacacctc tttacattt 194016DNAArtificial Sequencepredicted
UPT-PthAasterisk2 box 40tatataccta caccct 164119DNAArtificial
Sequencepredicted UPT-PthAw box 41tatttaccac tcttacctt
194218DNAArtificial Sequencepredicted UPT-PthA1 box 42tatataccta
cactacct 184317DNAArtificial Sequencepredicted UPT-PthA2 box
43tacacacctc ttttaat 174417DNAArtificial Sequencepredicted
UPT-PthA3 box 44tacacatctt taaaact 174523DNAArtificial
Sequencepredicted UPT-pB3.7 box 45tatataccta cactacacta cct
234616DNAArtificial Sequencepredicted UPT-HssB3.0 box 46tacacattat
accact 164719DNAArtificial Sequencepredicted UPT-PthA box
47tataaatctc ttttacctt 194819DNAArtificial Sequencepredicted
UPT-PthC box 48tctctatata actcccttt 19
* * * * *
References