U.S. patent application number 14/698561 was filed with the patent office on 2016-02-04 for multiplex gene editing.
The applicant listed for this patent is RECOMBINETICS, INC.. Invention is credited to Daniel F. Carlson, Scott C. Fahrenkrug.
Application Number | 20160029604 14/698561 |
Document ID | / |
Family ID | 53190022 |
Filed Date | 2016-02-04 |
United States Patent
Application |
20160029604 |
Kind Code |
A1 |
Fahrenkrug; Scott C. ; et
al. |
February 4, 2016 |
MULTIPLEX GENE EDITING
Abstract
Materials and methods for making multiplex gene edits in cells
or embryos are presented. Further methods include animals and
methods of making the same. Methods of making chimeric animals are
presented, as well as chimeric animals.
Inventors: |
Fahrenkrug; Scott C.;
(Minneapolis, MN) ; Carlson; Daniel F.; (Woodbury,
MN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
RECOMBINETICS, INC. |
SAINT PAUL |
MN |
US |
|
|
Family ID: |
53190022 |
Appl. No.: |
14/698561 |
Filed: |
April 28, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61985327 |
Apr 28, 2014 |
|
|
|
Current U.S.
Class: |
800/15 ; 435/463;
800/14; 800/16; 800/17; 800/19; 800/20; 800/21 |
Current CPC
Class: |
C12N 15/907 20130101;
A01K 67/0275 20130101; A01K 67/0276 20130101; A01K 2217/15
20130101; A01K 2227/101 20130101; A01K 2217/075 20130101; A01K
2227/108 20130101; A01K 2267/02 20130101; A01K 2217/07
20130101 |
International
Class: |
A01K 67/027 20060101
A01K067/027; C12N 15/90 20060101 C12N015/90 |
Claims
1. A large vertebrate animal comprising multiplex gene edits.
2. The animal of claim 1 comprising a number of knockout gene edits
from 2-25.
3. The animal of claim 1 having a number of allele replacements
from 2-25.
4. The animal of claim 3 having at least three allele replacements
wherein each of the three alleles are for three different
genes.
5. The animal of claim 3 comprising at least five exogenous
replacement alleles.
6. The animal of claim 1 comprising a plurality of homozygous
edits.
7. The animal of claim 1 being a chimera of host cells from a host
animal and donor cells from a donor animal, with the host cells
comprising the multiplex gene edits.
8. The animal of claim 7 wherein sexual reproduction of the animal
transmits gametes having a genotype of the donor cells to
progeny.
9. The animal of claim 1 being free of marker genes.
10. The animal of claim 1 being selected from the group consisting
of livestock, simian, dog, cat, avian, bird, fish, rabbit, pig,
cattle, buffalo, goat, sheep, and artiodactyl.
11. The animal of claim 1 being a first breed of cattle or a first
breed of pig that has at least three native alleles replaced with
corresponding exogenous alleles of a second breed or another
species, wherein the animal is free of exogenous marker genes.
12. The animal of claim 1 wherein the multiplex gene edits are made
in one or more of the following genes: IL2Rg, RAG2, DGAT, ABCG2,
ACAN, AMELY, BLG, BMP 1B (FecB), DAZL, DGAT, Eif4GI, GDF8,
Horn-poll locus, IGF2, CWC15, KissR/GRP54, OFD1Y, p65, PRLR,
Prmd14, PRNP, Rosa, Socs2, SRY, ZFY, .beta.-lactoglobulin, CLPG,
MODY 1 (HNF4.alpha.), MODY 2 (GCK), MODY 3 (HNF1.alpha.), MODY 4
(Pdxl), MODY 5 (HNF-1.beta.), MODY 6 (eurogenic differentiation 1),
MODY 7 (KLF11), MODY 8 (CEL), MODY 9 (PAX4), MODY 10 (INS), MODY 11
(BLK), APC, ApoE, DMD, GHRHR, HR, HSD11B2, LDLR, NF1, NPPA, NR3C2,
p53, PKD1, Rbm20, SCNN1G, tP53, FAH, HBB, IL2RG, PDX1, PITX3,
Runx1, GGTA, VASA, MIWI, PIWI, DCAF17, VDR, PNPLA1, HRAS,
Telomerase-vert, DSP, SNRPE, RPL21, LAMA3, UROD, EDAR, OFD1, PEX7,
COL3A1, ALOX12B, HLCS, NIPAL4, CERS3, ANTXR1, B3GALT6, DSG4, UBR1,
CTC1, MBTPS2, UROS, ABHD5, NOP10, ALMS1, LAMB3, EOGT, SAT1, RBPJ,
ARHGAP31, ACVR1, IKBKG, LPAR6, HR, ATR, HTRA1, AIRE, BCS1L, MCCC2,
DKC1, PORCN, EBP, SLITRK1, BTK, DOCK6, APCDD1, ZIP4, CASR, TERT,
EDARADD, ATP6VOA2, PVRL1, MGP, KRT85, RAG-1, ROR2, CLAUDIN1,
ABCAl2, SLA-DRA1, B4GALT7, COL7A1, NHP2, GNA11, WNT5A, USB1, LMNA,
EPS8L3, NSDHL, TRPV3, KRAS, TINF2, TGM1, DCLRE1C, PKP1, WRAP53,
KDM5C, ECM1, TP63, KRT14, RIPK4, PRKDC,BCL11a, BMI1, CCR5, CXCR4,
DKK1, ETV2, FLI1, FLK1, GATA2, GATA4, HHEX, KIT, LMX1A, MYF5,
MYOD1, MYOG, NKX2-5, NR4A2, PAX3, PDX1, PITX3, Runx1, RAG2, GGTA,
HR, HANDII, TBX5, ETV2, PDX1, TBX4 ,ID2 SOX2, TTF1/NKX2-1, MESP1,
GATA4, NKX2-5, FAH, PRKDC, RUNX1, FLI1, PITX3, LMX1A, DKK1,
NR4A2/NURR1, FLK1, HHEX1, BCL11A, RAG2, RAG1, IL2RG, c-KIT/SCFR,
BMI1, HANDII, TBX5, GATA2, OLIG1, OLIG2, heterozygotes thereof,
homozygotes therefore, and combinations thereof.
13. A method of making genetic edits in vitro in a vertebrate cell
or embryo at a plurality of target chromosomal DNA sites comprising
introducing into a vertebrate cell or embryo: a first targeted
endonuclease directed to a first target chromosomal DNA site and a
first homology directed repair (HDR) template homologous to the
first target site sequence; and a second targeted endonuclease
directed to a second target chromosomal DNA site and a second HDR
template homologous to the second target site sequence, with the
first HDR template sequence replacing the native chromosomal DNA
sequence at the first target site and the second HDR template
sequence replacing the native chromosomal DNA sequence at the
second target site sequence.
14. The method of claim 13 further comprising introducing into the
cell or embryo one or more of: a third, fourth, fifth, sixth, and
seventh targeted endonuclease directed to a third, fourth, fifth,
sixth, and seventh target chromosomal DNA site, respectively, and a
third, fourth, fifth, sixth, and seventh HDR template homologous to
the third, fourth, fifth, sixth, and seventh target chromosomal DNA
sites, respectively.
15. The method of claim 13 wherein the targeted endonuclease
comprises a TALENs, a zinc finger nuclease, RNA-guided
endonuclease, a Cas9, or a combination thereof.
16. The method of claim 13 wherein at least the first target
chromosomal DNA site is a locus for an allele.
17. The method of claim 16 wherein at least one of said HDR
templates encodes a knockout of the DNA target site allele that is
cognate to the template or at least one of said HDR templates
encodes an exogenous allele for replacement of an allele at the DNA
target site cognate to the template.
18. The method of claim 16 with the cell or embryo being a first
species or a first breed of livestock, and a plurality of the edits
comprise a replacement of a native allele with an exogenous allele
from a second species or a second breed of animal.
19. The method of claim 16 wherein the cell or embryo is homozygous
for a plurality of gene edits at the target DNA sites, said edits
being encoded by HDR templates cognate to said target DNA
sites.
20. The method of claim 16 with the cell or embryo being selected
from the group consisting of large vertebrate, livestock, simian,
dog, cat, avian, bird, fish, rabbit, pig, cattle, buffalo, goat,
sheep, and artiodactyl, or with th the cell being selected from the
group consisting of zygote, stem cell, adult stem cell, pluripotent
cell, progenitor cell, and primary cell, or with the embryo being
zygote, blastocyst, morula, or having a number of cells from
1-200.
21. The method of claim 16 wherein one or more of the target site
sequences are chosen from the following list: IL2Rg, RAG2, DGAT,
ABCG2, ACAN, AMELY, BLG, BMP 1B (FecB), DAZL, DGAT, Eif4GI, GDF8,
Horn-poll locus, IGF2, CWC15, KissR/GRP54, OFD1Y, p65, PRLR,
Prmd14, PRNP, Rosa, Socs2, SRY, ZFY, .beta.-lactoglobulin, CLPG,
MODY 1 (HNF4.alpha.), MODY 2 (GCK), MODY 3 (HNF1.alpha.), MODY 4
(Pdxl), MODY 5 (HNF-1.beta.), MODY 6 (eurogenic differentiation 1),
MODY 7 (KLF11), MODY 8 (CEL), MODY 9 (PAX4), MODY 10 (INS), MODY 11
(BLK), APC, ApoE, DMD, GHRHR, HR, HSD11B2, LDLR, NF1, NPPA, NR3C2,
p53, PKD1, Rbm20, SCNN1G, tP53, FAH, HBB, IL2RG, PDX1, PITX3,
Runx1, RAG2, GGTA, VASA, MIWI, PIWI, DCAF17, VDR, PNPLA1, HRAS,
Telomerase-vert, DSP, SNRPE, RPL21, LAMA3, UROD, EDAR, OFD1, PEX7,
COL3A1, ALOX12B, HLCS, NIPAL4, CERS3, ANTXR1, B3GALT6, DSG4, UBR1,
CTC1, MBTPS2 ,UROS, ABHD5, NOP10, ALMS1, LAMB3, EOGT, SAT1, RBPJ,
ARHGAP31, ACVR1, IKBKG, LPAR6, HR, ATR, HTRA1, AIRE, BCS1L, MCCC2,
DKC1, PORCN, EBP, SLITRK1, BTK, DOCK6, APCDD1, ZIP4, CASR, TERT,
EDARADD, ATP6V0A2, PVRL1, MGP, KRT85, RAG2, RAG-1, ROR2, CLAUDIN1,
ABCAl2, SLA-DRA1, B4GALT7, COL7A1, NHP2, GNA11, WNT5A, USB1, LMNA,
EPS8L3, NSDHL, TRPV3, KRAS, TINF2, TGM1, DCLRE1C, PKP1, WRAP53,
KDM5C, ECM1, TP63, KRT14, RIPK4, PRKDC, BCL11a, BMI1, CCR5, CXCR4,
DKK1, ETV2, FLI1, FLK1, GATA2, GATA4, HHEX, KIT, LMX1A, MYF5,
MYOD1, MYOG, NKX2-5, NR4A2, PAX3, PDX1, PITX3, Runx1, GGTA, HR,
HANDII, TBX5, ETV2, PDX1, TBX4, ID2 SOX2, TTF1/NKX2-1, MESP1,
GATA4, NKX2-5, FAH, PRKDC, RUNX1, FLI1, PITX3, LMX1A, DKK1,
NR4A2/NURR1, FLK1, HHEX1, BCL11A, RAG2, RAG1, IL2RG, c-KIT/SCFR,
BMI1, HANDII, TBX5, GATA2, OLIG1, OLIG2, heterozygotes thereof,
homozygotes therefore, and combinations thereof.
22. A method of making multiplex gene knockouts in a primary
vertebrate cell or embryo comprising introducing into the cell or
embryo a plurality of TALENs targeted to different target genes in
a presence of HDR templates with homology to said different target
genes.
23. A vertebrate embryo or vertebrate animal chimeric for host
cells and donor cells comprising a host embryo with a plurality of
host cell genetic edits at different chromosomal DNA sites, and a
donor cell integrated with the host cells to form the chimeric
embryo or chimeric animal.
24. A method of making a vertebrate embryo chimeric for host cells
and donor cells comprising: introducing into a host vertebrate
cell: a first targeted endonuclease directed to a first target
chromosomal DNA site and a first homology directed repair (HDR)
template homologous to the first target site sequence; and a second
targeted endonuclease directed to a second target chromosomal DNA
site and a second HDR template homologous to the second target site
sequence, with the first HDR template sequence replacing the native
chromosomal DNA sequence at the first target site and the second
HDR template sequence replacing the native chromosomal DNA sequence
at the second target site sequence, cloning the cell to develop a
host embryo, and placing a donor cell in the host embryo.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. provisional patent
application serial number 61/985,327 filed Apr. 28, 2014, which is
hereby incorporated by reference herein.
TECHNICAL FIELD
[0002] The technical field relates to gene editing at multiple
sites, multiple gene edits in vertebrate cells, and uses
thereof.
BACKGROUND
[0003] Genetic modifications to cells, and to animals made from
such cells, are useful for changing the expression of genes. The
field of genetic engineering is very active.
SUMMARY OF THE INVENTION
[0004] It would be very useful to make large vertebrate animals
that, in a single generation, have multiple changes to their
genetic code. As disclosed herein, it is possible to do so by
simultaneously editing multiple genes in a cell or embryo. Multiple
genes can be targeted for editing using targeted nucleases and
homology directed repair (HDR) templates in vertebrate cells or
embryos. These cells or embryos can be used for research or to make
whole animals. Multiple edits can be made in a single generation
that could not be made otherwise, for instance, by breeding or
genetic engineering changes made in seriatim
BRIEF DESCRIPTION OF THE DRAWINGS
[0005] FIG. 1A depicts a process for making animals homozygous for
two knockouts using single edits.
[0006] FIG. 1B depicts a hypothetical process of making animals
with multiple edits by making of a single edit at a time.
[0007] FIG. 2 depicts multiplex gene edits used to establish
founders at generation F0
[0008] FIG. 3 Multiplex gene editing of swine RAG2 and IL2R.gamma..
Panel a) Surveyor and RFLP analysis to determine the efficiency of
non-homologous end joining (NHEJ) and homology depended repair HDR
on cell populations 3 days post transfection. Panel b) RFLP
analysis for homology dependent repair on cell populations 11 days
post transfection. Panel c) Percentage of colonies positive for HDR
at IL2R.gamma., RAG2 or both. Cells were plated from the population
indicated by a "C" in panel a. Panel d) Colony analysis from cells
transfected with TALEN mRNA quantities of 2 and 1 .mu.g for
IL2R.gamma. and RAG2 and HDR template at 1 .mu.M for each.
Distribution of colony genotypes is shown below.
[0009] FIG. 4 Multiplex gene editing of swine APC and p53. Panel a)
Surveyor and RFLP analysis to determine the efficiency of
non-homologous end joining (NHEJ) and homology depended repair HDR
on cell populations 3 days post transfection. Panel b). RFLP
analysis for homology dependent repair on cell populations 11 days
post transfection. Panels c and d) Percentage of colonies positive
derived from the indicated cell population (indicated in panel a,
"C" and "D") for HDR at APC, p53 or both. Colonies with 3 or more
HDR alleles are listed below.
[0010] FIG. 5 Effect of Oligonucleotide HDR template concentration
on Five-gene multiplex HDR efficiency. Indicated amounts of TALEN
mRNA directed to swine RAG2, IL2Rg, p53, APC and LDLR were
co-transfected into pig fibroblasts along with 2 uM (panel a) or 1
uM (panel b) of each cognate HDR template. Percent NHEJ and HDR
were measured by Surveyor and RFLP assay.
[0011] FIG. 6 is a five-gene multiplex data set that shows plots of
experimental data for the effect of oligonucleotide HDR template
concentration on 5-gene multiplex HDR efficiency. Indicated amounts
of TALEN mRNA directed to swine RAG2, IL2Rg, p53, APC and LDLR were
co-transfected into pig fibroblasts along with 2 uM (panel a) or 1
uM (panel b) of each cognate HDR template. Percent NHEJ and HDR
were measured by Surveyor and RFLP assay. Colony genotypes from
5-gene multiplex HDR: Colony genotypes were evaluated by RFLP
analysis. Panel a) Each line represents the genotype of one colony
at each specified locus. Three genotypes could be identified; those
with the expected RFLP genotype of heterozygous or homozygous HDR
as well as those with an RFLP positive fragment, plus a second
allele that has a visible shift in size indicative of an insertion
or deletion (indel) allele. The percentage of colonies with an edit
at the specified locus is indicated below each column. Panel b) A
tally of the number of colonies edited at 0-5 loci.
[0012] FIG. 7 is another five-gene multiplex data set that shows
plots of experimental data for a second experiment involving the
effect of oligonucleotide HDR template concentration on Five-gene
multiplex HDR efficiency. Colony genotypes of a second 5-gene
multiplex trial. Panel a) Each line represents the genotype of one
colony at each specified locus. Three genotypes could be
identified; those with the expected RFLP genotype of heterozygous
or homozygous HDR as well as those with an RFLP positive fragment,
plus a second allele that has a visible shift in size indicative of
an insertion or deletion (indel) allele. The percentage of colonies
with an edit at the specified locus is indicated below each column.
Panel b) A tally of the number of colonies edited at 0-5 loci.
[0013] FIG. 8 is another five-gene multiplex trial data set that
shows colony genotypes. Panel a) Each line represents the genotype
of one colony at each specified locus. Three genotypes could be
identified; those with the expected RFLP genotype of heterozygous
or homozygous HDR as well as those with an RFLP positive fragment,
plus a second allele that has a visible shift in size indicative of
an insertion or deletion (indel) allele. The percentage of colonies
with an edit at the specified locus is indicated below each column.
Panel b) A tally of the number of colonies edited at 0-5 loci.
[0014] FIG. 9 depicts a process of making an F0 generation chimera
with targeted nucleases that produce a desired gene knockout or
choice of alleles.
[0015] FIG. 10 depicts establishment of an RF0 generation animal
with a normal phenotype and progeny with a failure to thrive (FTT)
phenotype and genotype.
[0016] FIG. 11 depicts a process for making chimeric animals with
gametes having the genetics of the donor embryo.
[0017] FIG. 12 depicts multiplex editing at three targeted loci of
NKX-2, GATA4, and MESP1. Panel a) is a schematic of the experiment,
panel b) shows the targeting of the genes, with the NKX2-5, GATA4,
and MESP1 listed as SEQ ID NOs: 1-3, respectively. Panel c) depicts
the results of an assay for the experiments. Oligo sequences for
each target gene. Novel nucleotides are represented by capital
letters. The PTC is represented by light color letters in boxes and
the novel HindIll RFLP site is underlined.
[0018] FIG. 13 depicts multiplex gene-editing using a combination
of TALENs and RGENs; assay of transfected cells evaluated by RFLP
revealed HDR at both sites.
DETAILED DESCRIPTION
[0019] Processes for multiplex gene edits are described. Multiple
genes can be modified in a cell or embryo that may be used for
research or to make whole animals. Other embodiments involve the
complementation of cell or organ loss by selective depopulation of
host niches. These inventions provide for rapid creation of animals
to serve as models, food, and as sources of cellular and acellular
products for industry and medicine.
[0020] FIG. 1A has a timeline that illustrates why it takes several
years using single edits to make livestock that have only two
edited alleles, with the time being about six years for cattle.
Edited, in this context, refers to choosing gene and altering it.
First, a gene of interest has to be edited, for instance knocked
out (KO), in cultured somatic cells that are cloned to create a
heterozygous calf with a targeted KO. The heterozygotes would be
raised to maturity for breeding, about 2 years old for cattle, to
generate first-generation (F1) male and female heterozygous calves,
which would be bred with each other to generate a homozygous
knockout calf (F2). Generating homozygotes with respect to multiple
targeted mutations using a conventional approach in cattle would be
impractical. The number of required years and the number of
required animals to make further edits increases in an
approximately exponential fashion, depending on the particular
scheme that is used, as illustrated in FIG. 1B. Among the
vertebrates, even those animals that have larger numbers of
offspring per generation and have shorter gestational times than
cattle nonetheless would require overly long times to achieve
multiple edits. Swine, for example, have a larger number of
offspring per mating and a gestational time that is roughly half
that of cattle but the time to make multiple edits can require many
years. Moreover, schemes that minimize time with aggressive
inbreeding may not be reasonably possible for multiple edits. Also,
serial cloning is undesirable from a process and an outcome
standpoint, especially if the animals are to be useful as livestock
or laboratory models.
[0021] An opportunity presented by the invention is illustrated in
FIG. 2, which shows multiple edits being made in a first-generation
animal (F0). Embryos are prepared directly or by cloning with two
or more edits independently chosen to be heterozygotes or
homozygotes and placed in surrogate females to gestate. The
resultant animals are F0 generation founders. A plurality of
embryos may be prepared and placed in one or more surrogates to
produce progeny of both genders, or well-known techniques of
embryo-splitting may be used to make a plurality of clonal embryos.
Livestock such as pigs that typically produce a litter with both
genders may be crossed and propagated.
[0022] Multiple alleles can be disrupted or otherwise edited as
described herein in a cell or embryo using targeted endonucleases
and homology directed repair (HDR). An embodiment is a method of
making genetic edits in a vertebrate cell or embryo at a plurality
of target chromosomal DNA sites comprising introducing into a
vertebrate cell or embryo: a first targeted endonuclease directed
to a first target chromosomal DNA site and a first homology
directed repair (HDR) template homologous to the first target site
sequence; and a second targeted endonuclease directed to a second
target chromosomal DNA site and a second HDR template homologous to
the second target site sequence, with the first HDR template
sequence replacing the native chromosomal DNA sequence at the first
target site and the second HDR template sequence replacing the
native chromosomal DNA sequence at the second target site
sequence.
[0023] It was an unexpected and surprising, and not predictable,
result to learn that multiple edits such as knockouts or
replacements could be obtained. One theorized mechanism is that
there are a minority of cells that are receptive to multiple edits
because they are at a particular stage in the cell cycle. When
exposed to endonucleases and HDR templates, they respond readily. A
related theory of operation is that the HDR templating process
lends itself to multiple substitutions because activation of
cellular repair machinery for one targeted site favors repair, or
HDR templating, at other sites as well. HDR has historically been a
low efficiency process so that multiple HDR edits were apparently
not attempted, observed, or recognized.
[0024] Results herein show that too much or too little endonuclease
and/or HDR template can have a negative effect, which may have
confounded prior research in this area. In fact, the inventors have
observed that targeted endonucleases can be designed and made
correctly but nonetheless fail because they are too efficient.
Further, the population of successfully modified cells often does
not improve over time. Artisans modifying cells normally look for
longevity of the cell and modification as an indicator of stability
and health for successful cloning or other uses. But that
expectation has often not been helpful in the multiplexing
processes herein. Moreover, the inventors have observed that
homologous recombination (HR) introgression efficiencies are
variable in the multiplex approach as compared to a single-locus
introgression. Some loci were very sensitive but others had large
drops in efficiency. There is apparently interference between the
endonucleases but the net effect cannot be explained simply, for
instance by positing that the endonucleases are competing for
common resource.
[0025] There are various well-known techniques to insert many genes
randomly or imprecisely into a plurality of locations in
chromosomal DNA, or to make many random edits that disrupt a
plurality of genes. As is evident, random or imprecise processes
are not going to assist the scientist that needs to edit a
plurality of specifically targeted genes to achieve an effect.
Accordingly, HDR processes taught herein may be readily
distinguished by the edits, and resultant organisms, being made
only at the intended target sites. One difference is that the
inventive HDR editing embodiments can be performed free of
insertion of extra gene copies and/or free of disruption of genes
other than those targeted by the endonucleases. And the specific
edits are made at one location because the HDR template sequence is
not copied into sites without appropriate homology. Embodiments
include organisms and processes wherein an exogenous allele is
copied into chromosomal DNA only at the site of its cognate
allele.
[0026] An advantage of HDR-based editing is that the edits can be
chosen. In contrast, other attempts, by non-homologous end joining
(NHEJ) processes, can make indels at multiple positions such that
the indels cancel each other out without making a frame shift. This
problem becomes significant when multiplexing is involved. But
successful use of HDR provides that the edits can be made to ensure
that, if desired, the target gene has an intended frame shift.
Moreover, allelic replacement requires HDR and cannot be
accomplished by NHEJ, vector-driven insertion of nucleic acids,
transposon insertions, and the like. Moreover, choosing organism
that are free of unwanted edits further increases the degree of
difficulty.
[0027] It is generally believed, however, that multiplex edits as
described herein have not been previously achieved at targeted
sites in cells or animals relevant to livestock or large
vertebrates. It is well known that cloning animals from
high-passage cells creates animals with so much genetic damage that
they are not useful as F0 founders of laboratory models or
livestock.
[0028] And gene editing is a stochastic process; as a result, the
field has traditionally emphasized various screening techniques to
identify the few percent of cells that have successfully been
edited. Since it is a stochastic process, the difficulty of making
a plurality of edits can be expected by the artisan to increase in
an exponential fashion as the number of intended edits
increases.
[0029] An embodiment of the invention provides processes for
creating multiple targeted gene knockouts or other edits in a
single cell or embryo, a process referred to herein as multiplex
gene knockouts or editing. The term targeted gene refers to a site
of chromosomal DNA that is selected for endonuclease attack by
design of the endonuclease system, e.g., a TALENs or CRISPR. The
term knockout, inactivated, and disrupted are used interchangeably
herein to mean that the targeted site is changed so that the gene
expression product is eliminated or greatly reduced so that the
gene's expression no longer has a significant impact on the animal
as a whole. These terms are sometimes used elsewhere to refer to
observably reducing the role of a gene without essentially
eliminating its role.
[0030] Gene editing, as that term is used herein, refers to
choosing a gene and altering it. Random insertions, gene trapping,
and the like are not gene editing. Examples of gene edits are, at
targeted sites, gene knockouts, adding nucleic acids, removing
nucleic acids, elimination of all function, introgression of an
allele, a hypermorphic alteration, a hypomorphic alteration, and a
replacement of one or more alleles.
[0031] A replacement of an allele refers to a non-meiotic process
of copying an exogenous allele over an endogenous allele. The term
replacement of an allele means the change is made from the native
allele to the exogenous allele without indels or other changes
except for, in some cases, degenerate substitutions. The term
degenerate substitution means that a base in a codon is changed to
another base without changing the amino acid that is coded. The
degenerate substitution may be chosen to be in an exon or in an
intron. One use for a degenerate substitution is to create a
restriction site for easy testing of a presence of the introgressed
sequence. The endogenous allele is also referred to herein as the
native allele. The term gene is broad and refers to chromosomal DNA
that is expressed to make a functional product. Genes have alleles.
Genotypes are homozygous if there are two identical alleles at a
particular locus and as heterozygous if the two alleles differ.
Alleles are alternative forms of a gene (one member of a pair) that
are located at a specific position on a specific chromosome.
Alleles determine distinct traits. Alleles have basepair (bp)
differences at specific positions in their DNA sequences
(distinguishing positions or bp) that give rise to the distinct
trait and distinguish them from each another, these distinguishing
positions serve as allelic markers. Alleles are commonly described,
and are described herein, as being identical if they have the same
bases at distinguishing positions; animals naturally have certain
variations at other by in other positions. Artisans routinely
accommodate natural variations when comparing alleles. The term
exactly identical is used herein to mean absolutely no by
differences or indels in a DNA alignment.
[0032] A similar test for allelic identity is to align the
chromosomal DNA in the altered organism with the chromosomal DNA of
the exogenous allele as it is recognized in nature. The exogenous
allele will have one or more allelic markers. The DNA alignment
upstream and downstream of the markers will be identical for a
certain distance. Depending on the desired test, this distance may
be from, e.g., 10 to 4000 bp. While an HDR template can be expected
to create a sequence that has exactly identical, the bases on
either side of the templated area will, of course, have some
natural variation. Artisans routinely distinguish alleles despite
the presence of natural variations. Artisans will immediately
appreciate that all ranges and values between the explicitly stated
bounds are contemplated, with any of the following distances being
available as an upper or lower limit: 15, 25, 50, 100, 200, 300,
400, 500, 600, 800, 1000, 1200, 1400, 1600, 1800, 2000, 4000.
[0033] Artisans are also able to distinguish gene edits to an
allele that are a result of gene editing as opposed to sexual
reproduction. It is trivial when the allele is from another species
that cannot sexually reproduce to mix alleles. And many edits are
simply not found in nature. Edits can be also be readily
distinguished when alleles are migrated from one breed to the next,
even when a replacement is made that exactly duplicates an allele
naturally found in another breed. Alleles are stably located on DNA
most of the time. But meiosis during gamete formation causes male
and female DNAs to occasionally swap alleles, an event called a
crossover. Crossover frequencies and genetic maps have been
extensively studied and developed. In the case of livestock, the
pedigree of an animal can be traced in great detail for many
generations. In genetics, a centimorgan (cM, also called a map unit
(m.u.)) is a unit that measures genetic linkage. It is defined as
the distance between chromosome positions (loci or markers of loci)
for which the expected average number of intervening chromosomal
crossovers in a single generation is 0.01. Genes that are close to
each other have a lower chance of crossing over compared to genes
that are distant from each other on the chromosome. Crossing over
is a very rare event when two genes are right next to each other on
the chromosome. Crossing over of a single allele relative to its
two neighboring alleles is so improbable that such an event must be
the product of genetic engineering. Even in the case where animals
of the same breeds are involved, natural versus engineered allele
replacement can be readily determined when the parents are known.
And parentage can be determined with a high degree of accuracy by
genotyping potential parents. Parent determination is routine in
herds and humans.
[0034] Embodiments include multiplex gene editing methods that are
simultaneous. The term simultaneous is in contrast to a
hypothetical process of treating cells multiple times to achieve
multiple edits, as in serial knockouts or serial cloning or
intervening cycles of animal breeding. Simultaneous means being
present at a useful concentration at the same time, for instance
multiple targeted endonucleases being present. The processes can be
applied to zygotes and embryos to make organisms wherein all cells
or essentially all cells have edited alleles or knockouts.
Essentially all cells, in the context of a knockout for instance,
refers to knocking the gene out of so many cells that the gene is,
for practical purposes, absent because its gene products are
ineffective for the organism's function. The processes modify
cells, and cells in embryos, over a minimal number cell divisions,
preferably about zero to about two divisions. Embodiments include a
quick process or a process that takes place over various times or
numbers of cell divisions is contemplated, for instance: from 0 to
20 replications (cell divisions). Artisans will immediately
appreciate that all values and ranges within the expressly stated
limits are contemplated, e.g., about 0 to about 2 replications,
about 0 to about 3 replications, no more than about 4 replications,
from about 0 to about 10 replications, 10-17; less than about 7
days, less than about 1, about 2, about 3, about 4, about 5, or
about 6 days, from about 0.5 to about 18 days, and the like. The
term low-passage refers to primary cells that have undergone no
more than about 20 replications.
[0035] Elsewhere, the inventors have shown that, in a single
embryo, maternal, paternal or both alleles can be edited in bovine
and porcine embryos, and that template editing of both alleles can
therefore occur using HDR in the embryo. These edits were made at
the same locus. Specifically introgression from sister chromatids
was detected. Carlson et al., PNAS 43(109):17382-17387, 2012.
[0036] Example 1, see FIG. 3, describes experiments that attempted,
successfully, to use HDR editing to knockout two genes at once and,
further, to be able to select cells that are homozygous for both
knockouts or heterozygous for each knockout. The term select is
used to refer to the ability to identify and isolate the cells for
further use; there were no expressible reporter genes anywhere in
the process, which is a highly significant advantage that
distinguishes this process from many other approaches. Cells were
treated to introduce a first and a second targeted endonuclease
(each being a TALENs pair) directed to, respectively, a first gene
(Recombination Activating Gene 2, RAG2) and a second gene target
(Interleukin Receptor 2, gamma, IL2Rg or ILR2.gamma.). The TALENs
had to be designed to target intended sites and made in adequate
amounts. The treatment of the cells took less than five minutes.
Electroporation was used but there are many other suitable protein
or DNA introducing-processes described herein. The cells were then
cultured so that they formed individual colonies of cells that each
descended from a single treated cell. Cells from the various
colonies were tested after 3 days or 11 days. The rate of knockout
of RAG2 was about six times higher than the rate of knockout of
IL2Rg; apparently some genes are more difficult to knockout than
others. The efficiency of knocking out both genes was high and
cells heterozygous or homozygous for both knockouts were
successfully identified. Significantly, dosage of TALEN mRNA and
HDR template had specific and non-specific effects. An increase in
TALEN mRNA for IL2Rg led to an increase in both NHEJ and HDR for
IL2Rg while NHEJ levels for RAG2 were unchanged. An increase in
IL2Rg HDR template reduced HDR at the RAG2 locus suggesting a
nonspecific inhibition of homology directed repair by escalation of
the concentration of oligonucleotide. This dose sensitivity,
particularly at these low doses, has possibly lead others away from
pursuit of multiplex processes. Cells from Example 1 have been
cloned and, at the time of filing, two animals are pregnant with
embryos derived from the same.
[0037] Example 2, see FIG. 4, describes experiments that had the
same goal of multiplex HDR editing but for different genes. The
first gene target was Adenomatous polyposis coli (APC). The second
gene target was p53 (the TP53 gene). Cells homozygous for both
knockouts and cells heterozygous for both knockouts were detected
and isolated.
[0038] Example 3, see FIGS. 5-8, describes multiplex HDR editing to
knockout 2-5 genes. There were three experiments, with the number
of cell colonies tested for genotype ranging from 72-192 for each
experiment. Cells were treated for multiplex knockout of various
combinations the genes APC, p53, RAG2, Low Density Lipoprotein
Receptor (LDLR), IL2Rg, Kisspeptin Receptor (KISSR or GPR54), and
Eukaryotic Translation Initiation Factor 4GI (EIF4GI). The gene
LDLR was consistently less amenable to modification than the other
genes. As is evident from the results, multiple alleles can be
disrupted simultaneously using the TALEN-specified, homology
directed repair (HDR). Five TALEN pairs that each resulted in more
than 20% HDR/site and their cognate HDR templates were
simultaneously co-transfected in three combinations (Table A). A
proportion of colonies from each replicate were positive for HDR
events in at least four genes and two colonies from replicate-A had
HDR events in all five genes. Although simultaneous indel formation
in five genes has been demonstrated by Cas9/CRISPR-stimulated NHEJ
in mouse ES cells, the precise modification of 5 genes (up to 7
alleles) by targeted nuclease-stimulated HDR is unexpected,
surprising, and unrivaled. When the TALENs of replicate were
replaced Cas9/CRISPRs (vectors were introduced into cells to
express), modification levels were below detection (data not
shown); however, other data points to RGEN multiplex, e.g., Example
9 below. Four genes were found to be edited in all experiments and
five genes in one experiment.
[0039] The speed and efficiency of this process lends itself to
scaling-up such that the multiplex knockout of more than 5 genes is
achievable without changing the nature of the process. Referring to
Table A, about 72 to 192 cells were tested; now that this process
has been established it is not unreasonable to increase the number
of tests to a very much larger number of cells such that multiplex
of larger numbers of genes/alles can be expected. A number of
multiplex genes or alleles may be from 2-25; artisans will
immediately appreciate that all ranges and values between the
explicitly stated bounds are contemplated, with any of the
following being available as an upper or lower limit in combination
with each other: 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 18, 20,
25.
TABLE-US-00001 TABLE A Multiplex HDR in pig fibroblasts Genes Rep A
Rep B Rep C edited # (percent) # (percent) # (percent) 5 2 (3) 0 0
4 0 5 (5) 4 (2) 3 3 (4) 7 (7) 14 (7) 2 12 (17) 23 (24) 41 (21) 1 24
(33) 29 (30) 47 (24) 1+ 41 (57) 63 (66) 106 (55) Genes targeted in
each replicate: A. APC, LDLR, RAG2, IL2Rg, p53. B. APC, LDLR, RAG2,
KISSR, EIF4G1 C. APC, LDLR, RAG2, KISSR, DMD
[0040] As is evident, cells and embryos with multiplex knockouts
are embodiments of the invention, as well as animals made
thereby.
[0041] Example 4 describes some detailed processes for making
various animals and refers to certain genes by way of example.
Example 5 describes examples of CRISPR/Cas9 design and
production.
[0042] Example 6 provides further examples of multiplex gene
editing with targeted nucleases driving HDR processes. GATA binding
protein 4 (GATA4); homeobox protein NKX2-5 (NKX2-5) and Mesoderm
Posterior Protein 1 (MESP1) were simultaneously targeted with
TALENs and HDR templates to direct frame-shift mutations and
premature stop-codons into each gene. The objective was to create
biallelic knockouts for each gene for use in complementation
studies. The process was about 0.5% efficient as 2 clones had the
intended biallelic HDR at each gene. The given genes knocked out
singly or in combination genes will cause a failure to thrive
genotype and early embryonic lethality without complementation.
Artisans will appreciate that knockout of these genes individually
and interbreeding of heterozygotes to obtain triple knockouts
(about 1/66 chance) for FTT and complementation studies is not
feasible in livestock.
[0043] Example 7 provides data that TALENs and Cas9/CRISPR can be
mixed to perform multiplex editing of genes. Some genes/alleles are
more readily targeted by a TALEN, or Cas9/CRISPR and that the
situation may arise that multiplexing must be done with a
combination of these tools. In this example, the Eukaryotic
Translation Initiation Factor 4GI (EIF4GI) was targeted by TALENs
and the p65 (RELA) gene was targeted by Cas9/CRISPR. The cells were
analyzeD by RFLP assay, indicative of HDR events, and HDR was
evident at both sites. Accordingly, TALENs and RGENs may be used
together or separately for multiplexing Combinations including, for
example, 1, 2, 3 4, 5, 6, 7, 8, 9 or 10 TALENs with 1, 2, 3 4, 5,
6, 7, 8, 9 or 10 RGEN reagents, in any combination.
Chimeras
[0044] Chimeras can be made by preparing a host blastocyst and
adding a donor cell from a donor animal. The resultant animal will
be a chimer that has cells that originate from both the host and
the donor. Some genes are required for the embryo to create certain
kinds of cells and cell lineages. When such a gene is knocked out
in the host cells, the introduction of a donor cell that has the
missing gene can result in those cells and cell lineages being
restored to the host embryo; the restored cells have the donor
genotype. Such a process is referred to as a complementation
process.
[0045] Matsunari et al., PNAS 110:4557-4562, 2013, described a
complementation process for making a donor-derived pig pancreas.
They made a host pig blastocyst that was altered to prevent
formation of a functional pancreas. They made the host blastocyst
by somatic cell cloning. The somatic cell had been modified to
overexpress Hes 1 under the promoter of Pdx 1 (pancreatic and
duodenal homeobox 1), which was known to inhibit pancreatic
development. The added donor cells to the host blastocyst that did
not have this modification; the donor cells supplied the cell
lineages needed to make the pancreas. They had already demonstrated
elsewhere that functional organs can be generated from pluripotent
stem cells (PSCs) in vivo by blastocyst complementation in
organogenesis-disabled mouse embryos. They proposed future research
using xenogenic pluripotent stem cells (PSCs), including human
induced PSCs. Indeed, xenotransplantation has been considered a
potential solution to the organ/tissue shortage for greater than 40
years. The fact that no genes were knocked out to disable the
formation of the pancreas is significant. Knocking out even one
gene in a large vertebrate is a significant investment of resources
using conventional processes. In contrast, overexpression of a gene
product in a cell is readily achieved using the present state of
the art, for instance, with a plasmid or a vector that places
multiple gene cassette copies into the genome. Adding expression of
a gene is easier than targeting a gene and knocking it out. The
ability to prevent organogenesis by overexpression of a gene
product is believed to be unusual at this time. In fact,
limitations in the ability to engineer large animal genomes can be
significant. Nonetheless, the pig is the preferred donor animal for
xenotransplantation due to its similarity in size and physiology to
humans as well as its high fecundity and growth rate.
[0046] FIG. 9 depicts a multiplex process used herein to make gene
knockouts or other gene edits as applied in the context of
chimeras. Low-passage primary somatic cells are made with gene
knockouts. Cells with exactly the desired distribution of
heterozygosity and homozygosity for the knockouts are isolated.
These cells are used in cloning to make an embryo that is allowed
to develop as a host blastocyst. The term blastocyst is used
broadly herein to refer to embryos from two cells to about three
weeks. The term embryo is used broadly to refer to animals from
zygote to live birth. A donor embryo is established and used as a
source of donor cells that provide genes to populate the niche
created by the knockouts. The donor cells are introduced into the
host blastocyst and reproduce with the host cells to form a chimera
having both host and donor cells. The embryo is transferred to a
surrogate female and gestated. The progeny of the chimera have host
genotypes when the host cells form the gametes. Chimeras have their
gender determined by their host blastocyst.
[0047] FIG. 10 illustrates a failure to thrive phenotype (FTT)
complementation process. FTT refers to animals that are not
expected to live to an age of sexual maturity. A host embryo is
provided with an FTT genotype and phenotype. Multiplex processes
are ideal because the FTTs available by knockout of just one gene
are limited and are not known for some organs and tissues. The
donor cells provide the genes missing in the FTT and provide the
missing cell types. The embryo can be a large vertebrate animal and
the knockouts can be multiplex, e.g., 2-25 genes. Moreover,
targeted endonucleases can be used to achieve a knockout. In an
immunodeficiency embodiment, an IL2Rg-/y RAG2-/- knockout is the
FTT because the host is essentially missing immune functions. But
the donor cells do not have those genes missing and the resultant
chimera has an essentially normal phenotype for purposes of being
able to raise and maintain the animal. But the progeny has the FTT
phenotype. The animals can thus be maintained and FTT animals
conveniently produced. The chimeras can be any combination of
heterozygous and homozygous for the knockouts. Processes for making
chimera are thus described that are F0 generation animals that
produce failure to thrive (FTT) phenotypes when other processes
require an additional generation, or more.
[0048] Chimera normally pass on the genetics of the host cells.
Disclosed herein, however, are alternative chimeras that pass the
donor cell genetics to their progeny and not the host cell
genetics. It turns out that switching the genetic inheritance can
create some useful opportunities. Referring to FIG. 11, an embryo
labeled as G.sup.- host is depicted. The embryo has been prepared
with nonfunctional gametes. A donor blastocyst is prepared and used
as a source of donor cells. The donor cells provide the genes and
cell lineages that are needed to make donor gametes. The resultant
chimera has the gametes of the donor cells and creates progeny
having donor cell genetics. In the illustration, the host embryo is
a male Brahman bull. The donor cells are from a double-muscled
bull. The chimera has a Brahman bull phenotype but its progeny are
double muscled. The host and donors may be from the same or
different breeds or same or different species. The host has been
prepared to be sterile, meaning that it cannot sexually reproduce.
Some sterile animals may be used to make gametes that are
nonfunctional, e.g., immotile sperm, or not make gametes at all,
e.g., with early gametogenesis being disrupted. The donor cells may
be, for instance, wild-type cells, cells from animal breeds having
desirable traits, or genetically modified cells.
[0049] Embodiments of the invention include chimeric sterile
animals, such as chimeric livestock, that have a genetic
modification to a chromosome that prevents gametogenesis or
spermatogenesis. The chromosome may be an X chromosome, a Y
chromosome, or an autosome. The modification may include a
disruption of an existing gene. The disruption may be created by
altering an existing chromosomal gene so that it cannot be
expressed, or by genetically expressing factors that will inhibit
the transcription or translation of a gene. The term gametogenesis
means the production of haploid sex cells (ova and spermatozoa)
that each carry one-half the genetic compliment of the parents from
the germ cell line of each parent. The production of spermatozoa is
spermatogenesis. The fusion of spermatozoa and ova during
fertilization results in a zygote cell that has a diploid genome.
The term gametogenic cell refers to a progenitor to an ovum or
sperm, typically a germ cell or a spermatogonial cell. One
embodiment is a knockout of spermatogonial stem cells (SSC) in the
host. The animal may be made with donor cells that have desirable
genetics and supplies SSC cells that make gametes with the donor
genotype. Some genes are disrupted in combination to produce one or
more effects that cause infertility, for instance, combinations of:
Acr/H1.1/Smcp, Acr/Tnp2/Smcp, Tnp2/H1.1/Smcp, Acr/Hlt/Smcp,
Tnp2/H1t/Smcp (Nayernia K; Drabent B; Meinhardt A; Adham I M;
Schwandt I; Muller C; Sancken U; Kleene KC; Engel W Triple
knockouts reveal gene interactions affecting fertility of male
mice. Mol. Reprod. Dev 70(4):406-16, 2005). Embodiments include a
first line of animals with a knockout of a first gene or genes and
a second line of animals with a knockout of a second gene or genes
so that male progeny of the lines are infertile.
[0050] The use of genetic engineering to create genetically
modified large vertebrates will accelerate the creation of animals
with desirable traits. Traditional livestock breeding is an
expensive and time consuming process that involves careful
selection of genetic traits and lengthy waits for generational
reproduction. Even with careful trait selection, the variations of
sexual reproduction present a considerable challenge in cultivating
and passing on desirable trait combinations. But creation of
chimeras that pass on donor traits creates methods of animal
reproduction that allow for rapid dissemination of desirable
genetic traits, as well as for protection of the proprietary
control of the traits. Embodiments include the production of
genetically and genomically sterile animals that can serve as hosts
for donated genetic material. Sexual intercourse by the host will
lead to reproduction of the donor's genetic material. A group of
genetically sterile animals can be used to disseminate identical
genes from a single donor by sexual reproduction so that many donor
progeny may be rapidly generated. Embodiments include animals that
are modified to produce only one gender of animal so that users
receiving the animals will not be able to easily breed the animals
with the traits.
[0051] Embodiments include making a genetic modification to cells
or embryos to inactivate a gene or plurality of genes selective for
gametogenesis or spermatozoa activity. One process of genetic
modification involves introduction of a targeted nuclease, e.g., a
Cas9/CRISPR or mRNA for a TALEN pair that specifically binds to the
gene. An animal is cloned from the cells or the modified embryo is
directly raised in a surrogate mother. The animal may be a
livestock animal or other animal. Gametogenesis may be blocked at
an early stage. Or spermatozoa activity may be disrupted that is
essential for fertility but is not otherwise essential to the
animal. The animal is thus sterile because it cannot sexually
reproduce: however, ARTs may be used to create progeny from the
modified sperm. A donor animal that has desirable genetic traits
(as a result of breeding and/or genetic engineering) is
selected.
Rapid Establishment of F0 Generation Founder Animal Lines with Two
or more Knockouts
[0052] With multiplex, two, three, or more genes (2-25) may be
simultaneously knocked out to produce an F0 generation with the
desired combination of alleles. If homozygosity for all of the
knockouts creates an FTT, then one option is to make the founders
homozygous for all of the knockouts except for one--or whatever the
minimum heterozygosity should be for that situation. The one
heterozygote gene can allow for a non-FTT phenotype. Alternatively,
the multiplex knockouts can be used in combination with
complementation to make thriving chimera that have FTT progeny.
This process can eliminate generations in the creation of a
multiple knockout animal.
[0053] In either case, the advantages are large and move many
processes into the realm of actually being achievable. Producing
animals with knockouts of two loci by conventional breeding is cost
prohibitive as only .about.6% of offspring would have the desired
phenotype in the F2 generation (Table B). In contrast, the
multiplex approach enables production of the desired genotype in
the F0 generation, a large advantage over conventional knockouts
and breeding. It should be stressed that the saving of time and
animals is not theoretical: it is an advance that makes some kinds
of modifications possible because success is expected instead of
failure. Furthermore, to continue the example, breeding between one
or two chimeric RG-KO parents would significantly increase the
production rate of RG-KO offspring to 25 and 100 percent
respectively (Table B).
TABLE-US-00002 TABLE B Breeding advantage of chimeric pigs. Male
Female % RG-KO Chimera-IL2Rg.sup.y/-; X Chimera-IL2Rg.sup.-/-;
RAG2.sup.-/- 100% RAG2.sup.-/- Chimera-IL2Rg.sup.y/-; X
IL2Rg.sup.+/-; RAG2.sup.+/- 25% RAG2.sup.-/- IL2Rg.sup.y/+;
RAG2.sup.+/- X IL2Rg.sup.+/-; RAG2.sup.+/- 6.3%
Immunodeficient Animals
[0054] One group of embodiments relates to immunodeficient pigs or
other livestock and processes of making them. These embodiments are
examples of multiplex edits, e.g., knockouts that take advantage of
the opportunity to manage selection of homozygous and heterozygous
knockout genotypes. These demonstrate the power of multiplex to
rapidly establish founder lines. They also include further aspects
of the inventions that involve making chimeras.
[0055] The pig is the most relevant, non-primate animal model that
mimics the size and physiology of humans. Unfortunately, fully
immunodeficient pigs are not widely available because (1) multiple
gene knockouts (KOs) are required, (2) intercrossing to create
multi-locus null animals is extremely costly and depending on the
number of Kos may be possible, and (3) only small scale germ-free
facilities are available for pigs. Herein, embodiments include
large vertebrate animals with a knockout of both RAG2 and IL2Rg
(i.e., RG-KO). The term large vertebrate refers to simians,
livestock, dogs, and cats. The term livestock refers to animals
customarily raised for food, such as cattle, sheep, goats, avian
(chicken, turkey), pigs, buffalo, and fish. The genes can be
knocked out of somatic cells that are then used for cloning to
produce a whole animal. Alternatively, embryos can be treated to
knockout the genes, with the animals being derived directly from
the embryos. The multiplex gene-targeting platform can
simultaneously disrupt of T, B and NK cell development in the pig.
Accordingly, animals made without such cells can be made directly
with the methods herein, as F0 founders, but the phenotype is
FTT.
Agricultural Targets for Multiplex Edits
[0056] The editing of food animal genomes can be greatly
accelerated by editing numerous loci at the same time, saving
generations of animal breeding that would be required to bring
together alleles that are generated instead one at a time. In
addition, some agricultural traits are complex, meaning that they
are manifest as a result of the influence of alleles at more than
one gene (from 2 to hundreds). For example, polymorphisms at DGAT,
ABCG2, and a polymorphism on chromosome 18 together account for a
large portion of the variation in Net Dairy Merit in dairy cattle.
Livestock cells or embryos can be subjected to multiplex editing of
numerous genes, including various agricultural targets: one or more
of ACAN, AMELY, BLG, BMP 1B (FecB), DAZL, DGAT, Eif4GI, GDF8,
Horn-poll locus, IGF2, CWC15, KissR/GRP54, OFD 1Y, p65, PRLR,
Prmd14, PRNP, Rosa, Socs2, SRY, ZFY, .beta.-lactoglobulin,
CLPG.
Disease Modeling Targets For Multiplexing:
[0057] Some traits, like cancer, are caused on the basis of
mutations at multiple genes (see APC/p53). In addition numerous
disease traits are so-called Complex traits that manifest as a
result of the influence of alleles at more than one gene. For
example, diabetes, metabolism, heart disease, and neurological
diseases are considered complex traits. Embodiments include animal
models that are heterozygous and homozygous for individual alleles,
or in combination with alleles at other genes, in different
combinations. For example mature onset diabetes of the young (MODY)
loci cause diabetes individually and additively, including; MODY 1
(HNF4.alpha.), MODY 2 (GCK), MODY 3 (HNF1.alpha.), MODY 4 (Pdx1),
MODY 5 (HNF-1.beta.), MODY 6 (eurogenic differentiation 1), MODY 7
(KLF11), MODY 8 (CEL), MODY 9 (PAX4), MODY 10 (INS), MODY 11 (BLK).
Livestock cells or embryos can be subjected to multiplex editing of
numerous genes for animal modelling, including various disease
modeling targets: APC, ApoE, DMD, GHRHR, HR, HSD11B2, LDLR, NF1,
NPPA, NR3C2, p53, PKD1, Rbm20, SCNN1G, tP53, DAZL, FAH, HBB, IL2RG,
PDX1, PITX3, Runx1, RAG2, GGTA. Embodiments include cells, embryos,
and animals with one or more of the above targets being edited,
e.g., KO.
[0058] Genes in one species consistently have orthologs in other
species. Humans and mice genes consistently have orthologs in
livestock, particularly among cows, pigs, sheep, goats, chicken,
and rabbits. Genetic orthologs between these species and fish is
often consistent, depending upon the gene's function. Biologists
are familiar with processes for finding gene orthologs so genes may
be described herein in terms of one of the species without listing
orthologs of the other species. Embodiments describing the
disruption of a gene thus include disruption of orthologs that have
the same or different names in other species. There are general
genetic databases as well as databases that are specialized to
identification of genetic orthologs. Moreover, artisans are
familiar with the commonly used abbreviations for genes and using
the context to identify which gene is being referred to in case
there is more than one abbreviation for a gene or two genes are
referred to by the same abbreviation.
[0059] Spermatogonial stem cells offer a second method genetic
modification of livestock. Genetic modification or gene edits can
be executed in vitro in spermatogonial stem cells isolated from
donor testes. Modified cells are transplanted into germ
cell-depleted testes of a recipient. Implanted spermatogonial stem
cells produce sperm that carry the genetic modification(s) that can
be used for breeding via artificial insemination or in vitro
fertilization (IVF) to derive founder animals.
Complementation of Nullomorphic Cell or Organ Loss by Selective
Depopulation of Host Niches.
[0060] Multiplex editing can be used to purposefully ablate cells
or organs from a specific embryonic or animal niche, creating an
environment conducive to better donor cell integration,
proliferation, and differentiation, enhancing their contribution by
complementation orthologous cells, tissues or organs in the embryo,
fetus or animal. The animal with the empty niche is a deficiency
carrier because it has been created to have a deficiency that can
be filled by donor cells and genes. Specific examples include the
recipient-elimination, and donor-rescue of gametogenic cell
lineages (DAZL, VASA, MIWI, PIWI, and so forth.).
[0061] In another embodiment multiplex gene editing can be used to
induce congenital alopecia, providing opportunity for donor derived
cells to participate in hair folliculogenesis. The genes considered
for multiplex gene editing to cause alopecia include those
identified in OMIM and thr
[0062] Human Phenotype Ontology database; DCAF17, VDR, PNPLA1,
HRAS, Telomerase-vert, DSP, SNRPE, RPL21, LAMA3, UROD, EDAR, OFD1,
PEX7, COL3A1, ALOX12B, HLCS, NIPAL4, CERS3, ANTXR1, B3GALT6, DSG4,
UBR1, CTC1, MBTPS2 ,UROS, ABHD5, NOP10, ALMS1, LAMB3, EOGT, SAT1,
RBPJ, ARHGAP31, ACVR1, IKBKG, LPAR6, HR, ATR, HTRA1, AIRE, BCS1L,
MCCC2, DKC1, PORCN, EBP, SLITRK1, BTK, DOCK6, APCDD1, ZIP4, CASR,
TERT, EDARADD, ATP6V0A2, PVRL1, MGP, KRT85, RAG2, RAG-1, ROR2,
CLAUDIN1, ABCAl2, SLA-DRA1, B4GALT7, COL7A1, NHP2, GNA11, WNT5A,
USB1, LMNA, EPS8L3, NSDHL, TRPV3, KRAS, TINF2, TGM1, DCLRE1C, PKP1,
WRAP53, KDM5C, ECM1, TP63, KRT14, RIPK4. Chimerism with donor cells
that have folliculogenic potential may be used to grow human hair
follicles. The ablation of organs or tissues in pigs or other
vertebrates and growth of organs or tissues from human origins is
particularly useful as a source of medical organs or tissues.
[0063] Further complementation targets for multiplexing are: PRKDC,
BCL11a, BMI1, CCR5, CXCR4, DKK1, ETV2, FLI1, FLK1, GATA2, GATA4,
HHEX, KIT, LMX1A, MYF5, MYOD1, MYOG, NKX2-5, NR4A2, PAX3, PDX1,
PITX3, Runx1, RAG2, GGTA, HR, HANDII, TBX5.
[0064] Embodiments include targeting one, two, or more (2-25) of
the above targets in a multiplex approach or by other
approaches.
Edited Genes
[0065] The methods and inventions described herein with respect to
particular targets and targeted endonucleases are broadly
applicable. The inventors have prepared primary livestock cells
suitable for cloning with edits with all of the following genes.
.
TABLE-US-00003 TABLE C Primary livestock cells suitable for
cloning, produced in swine and/or bovine fibroblasts by targeted
endonucleases (TALENs) and HDR knockout. Species S: Swine Gene ID
Gene Name B: Bovine ETV2 Ets Variant 2 S PDX1 Pancreatic and
duodenal homeobox 1 S TBX4 T-box transcription factor TBX4 S ID2
DNA-binding protein inhibitor S SOX2 SRY (sex determining region
Y)-box 2 S TTF1/NKX2-1 thyroid transcription factor 1/NK2 S
homeobox 1 MESP1 mesoderm posterior 1 homolog S GATA4 GATA binding
protein 4 S NKX2-5 NK2 homeobox 5 S FAH Fumarylacetoacetate
Hydrolase S PRKDC protein kinase, DNA-activated, catalytic S
polypeptide RUNX1 Runt-related transcription factor 1 S FLI1 Friend
leukemia integration 1 transcription S factor PITX3 Pituitary
homeobox 3 S LMX1A LIM homeobox transcription factor 1, S alpha
DKK1 Dickkopf-related protein 1 S NR4A2/NURR1 Nuclear receptor
subfamily 4, group A, S member 2/Nuclear receptor related 1 protein
FLK1 Fetal Liver Kinase 1 S HHEX1 Hematopoietically-expressed
homeobox S protein BCL11A B-cell lymphoma/leukemia 11A S RAG2
Recombination activating gene 2 S RAG1 Recombination activating
gene 1 S IL2RG Interleukin 2 receptor, gamma S c-KIT/SCFR Mast/stem
cell growth factor receptor S BMI1 polycomb ring finger oncogene S
HANDII Heart- and neural crest derivatives- S expressed protein 2
TBX5 T-box transcription factor 5 S GATA2 GATA binding protein 2 S
DAZL Deleted in AZoospermia like S, B OLIG1 oligodendrocyte
transcription factor 1 S OLIG2 oligodendrocyte transcription factor
2 S
Genetically Modified Animals
[0066] Animals may be made that are mono-allelic or bi-allelic for
a chromosomal modification, using methods that either leave a
genetically expressible marker in place, allow for it to be bred
out of an animal, or by methods that do not place such a marker in
the animal. For instance, the inventors have used methods of
homologous dependent recombination (HDR) to make changes to, or
insertion of exogenous genes into, chromosomes of animals. Tools
such as TALENs and recombinase fusion proteins, as well as
conventional methods, are discussed elsewhere herein. Some of the
experimental data supporting genetic modifications disclosed herein
is summarized as follows. The inventors have previously
demonstrated exceptional cloning efficiency when cloning from
polygenic populations of modified cells, and advocated for this
approach to avoid variation in cloning efficiency by somatic cell
nuclear transfer (SCNT) for isolated colonies (Carlson et al.,
2011). Additionally, however, TALEN-mediated genome modification,
as well as modification by recombinase fusion molecules, provides
for a bi-allelic alteration to be accomplished in a single
generation. For example, an animal homozygous for a knocked-out
gene may be made by SCNT and without inbreeding to produce
homozygosity. Gestation length and maturation to reproduction age
for livestock such as pigs and cattle is a significant barrier to
research and to production. For example, generation of a homozygous
knockout from heterozygous mutant cells (both sexes) by cloning and
breeding would require 16 and 30 months for pigs and cattle
respectively. Some have allegedly reduced this burden with
sequential cycles of genetic modification and SCNT (Kuroiwa et al.,
2004) however, this is both technically challenging and cost
prohibitive, moreover, there are many reasons for avoiding serial
cloning for making F0 animals that are to be actually useful for
large vertebrate laboratory models or livestock. The ability to
routinely generate bi-allelic KO cells prior to SCNT is a
significant advancement in large animal genetic engineering.
Bi-allelic knockout has been achieved in immortal cells lines using
other processes such as ZFN and dilution cloning (Liu et al.,
2010). Another group recently demonstrated bi-allelic KO of porcine
GGTA1 using commercial ZFN reagents (Hauschild et al., 2011) where
bi-allelic null cells could be enriched by FACS for the absence of
a GGTA1-dependent surface epitope. While these studies demonstrate
certain useful concepts, they do not show that animals or livestock
could be modified because simple clonal dilution is generally not
feasible for primary fibroblast isolates (fibroblasts grow poorly
at low density) and biological enrichment for null cells is not
available for the majority of genes.
[0067] Targeted nuclease-induced homologous recombination can be
used so as to eliminate the need for linked selection markers.
TALENs may be used to precisely transfer specific alleles into a
livestock genome by homology dependent repair (HDR). In a pilot
study, a specific 1 lbp deletion (the Belgian Blue allele) (Grobet
et al., 1997; Kambadur et al., 1997) was introduced into the bovine
GDF8 locus (see U.S. 2012/0222143). When transfected alone, the
btGDF8.1 TALEN pair cleaved up to 16% of chromosomes at the target
locus. Co-transfection with a supercoiled homologous DNA repair
template harboring the 1 lbp deletion resulted in a gene conversion
frequency (HDR) of up to 5% at day 3 without selection for the
desired event. Gene conversion was identified in 1.4% of isolated
colonies that were screened. These results demonstrated that TALENs
can be used to effectively induce HDR without the aid of a linked
selection marker.
Homology Directed Repair (HDR)
[0068] Homology directed repair (HDR) is a mechanism in cells to
repair ssDNA and double stranded DNA (dsDNA) lesions. This repair
mechanism can be used by the cell when there is an HDR template
present that has a sequence with significant homology to the lesion
site. Specific binding, as that term is commonly used in the
biological arts, refers to a molecule that binds to a target with a
relatively high affinity compared to non-target tissues, and
generally involves a plurality of non-covalent interactions, such
as electrostatic interactions, van der Waals interactions, hydrogen
bonding, and the like. Specific hybridization is a form of specific
binding between nucleic acids that have complementary sequences.
Proteins can also specifically bind to DNA, for instance, in TALENs
or CRISPR/Cas9 systems or by Ga14 motifs. Introgression of an
allele refers to a process of copying an exogenous allele over an
endogenous allele with a template-guided process. The endogenous
allele might actually be excised and replaced by an exogenous
nucleic acid allele in some situations but present theory is that
the process is a copying mechanism. Since alleles are gene pairs,
there is significant homology between them. The allele might be a
gene that encodes a protein, or it could have other functions such
as encoding a bioactive RNA chain or providing a site for receiving
a regulatory protein or RNA.
[0069] The HDR template is a nucleic acid that comprises the allele
that is being introgressed. The template may be a dsDNA or a
single-stranded DNA (ssDNA). ssDNA templates are preferably from
about 20 to about 5000 residues although other lengths can be used.
Artisans will immediately appreciate that all ranges and values
within the explicitly stated range are contemplated; e.g., from 500
to 1500 residues, from 20 to 100 residues, and so forth. The
template may further comprise flanking sequences that provide
homology to DNA adjacent to the endogenous allele or the DNA that
is to be replaced. The template may also comprise a sequence that
is bound to a targeted nuclease system, and is thus the cognate
binding site for the system's DNA-binding member. The term cognate
refers to two biomolecules that typically interact, for example, a
receptor and its ligand. In the context of HDR processes, one of
the biomolecules may be designed with a sequence to bind with an
intended, i.e., cognate, DNA site or protein site.
Targeted Endonuclease Systems
[0070] Genome editing tools such as transcription activator-like
effector nucleases (TALENs) and zinc finger nucleases (ZFNs) have
impacted the fields of biotechnology, gene therapy and functional
genomic studies in many organisms. More recently, RNA-guided
endonucleases (RGENs) are directed to their target sites by a
complementary RNA molecule. The Cas9/CRISPR system is a REGEN.
tracrRNA is another such tool. These are examples of targeted
nuclease systems: these system have a DNA-binding member that
localizes the nuclease to a target site. The site is then cut by
the nuclease. TALENs and ZFNs have the nuclease fused to the
DNA-binding member. Cas9/CRISPR are cognates that find each other
on the target DNA. The DNA-binding member has a cognate sequence in
the chromosomal DNA. The DNA-binding member is typically designed
in light of the intended cognate sequence so as to obtain a
nucleolytic action at nor near an intended site. Certain
embodiments are applicable to all such systems without limitation;
including, embodiments that minimize nuclease re-cleavage,
embodiments for making SNPs with precision at an intended residue,
and placement of the allele that is being introgressed at the
DNA-binding site.
TALENs
[0071] The term TALEN, as used herein, is broad and includes a
monomeric TALEN that can cleave double stranded DNA without
assistance from another TALEN. The term TALEN is also used to refer
to one or both members of a pair of TALENs that are engineered to
work together to cleave DNA at the same site. TALENs that work
together may be referred to as a left-TALEN and a right-TALEN,
which references the handedness of DNA or a TALEN-pair.
[0072] The cipher for TALs has been reported (PCT Publication WO
2011/072246) wherein each DNA binding repeat is responsible for
recognizing one base pair in the target DNA sequence. The residues
may be assembled to target a DNA sequence. In brief, a target site
for binding of a TALEN is determined and a fusion molecule
comprising a nuclease and a series of RVDs that recognize the
target site is created. Upon binding, the nuclease cleaves the DNA
so that cellular repair machinery can operate to make a genetic
modification at the cut ends. The term TALEN means a protein
comprising a Transcription Activator-like (TAL) effector binding
domain and a nuclease domain and includes monomeric TALENs that are
functional per se as well as others that require dimerization with
another monomeric TALEN. The dimerization can result in a
homodimeric TALEN when both monomeric TALEN are identical or can
result in a heterodimeric TALEN when monomeric TALEN are different.
TALENs have been shown to induce gene modification in immortalized
human cells by means of the two major eukaryotic DNA repair
pathways, non-homologous end joining (NHEJ) and homology directed
repair. TALENs are often used in pairs but monomeric TALENs are
known. Cells for treatment by TALENs (and other genetic tools)
include a cultured cell, an immortalized cell, a primary cell, a
primary somatic cell, a zygote, a germ cell, a primordial germ
cell, a blastocyst, or a stem cell. In some embodiments, a TAL
effector can be used to target other protein domains (e.g.,
non-nuclease protein domains) to specific nucleotide sequences. For
example, a TAL effector can be linked to a protein domain from,
without limitation, a DNA 20 interacting enzyme (e.g., a methylase,
a topoisomerase, an integrase, a transposase, or a ligase), a
transcription activators or repressor, or a protein that interacts
with or modifies other proteins such as histones. Applications of
such TAL effector fusions include, for example, creating or
modifying epigenetic regulatory elements, making site-specific
insertions, deletions, or repairs in DNA, controlling gene
expression, and modifying chromatin structure.
[0073] The term nuclease includes exonucleases and endonucleases.
The term endonuclease refers to any wild-type or variant enzyme
capable of catalyzing the hydrolysis (cleavage) of bonds between
nucleic acids within a DNA or RNA molecule, preferably a DNA
molecule. Non-limiting examples of endonucleases include type II
restriction endonucleases such as FokI, HhaL HindlIL Nod, BbvCl,
EcoRI, BOIL and AlwL Endonucleases comprise also rare- cutting
endonucleases when having typically a polynucleotide recognition
site of about 12-45 basepairs (bp) in length, more preferably of
14-45 bp. Rare-cutting endonucleases induce DNA double-strand
breaks (DSBs) at a defined locus. Rare-cutting endonucleases can
for example be a targeted endonuclease, a chimeric Zinc-Finger
nuclease (ZFN) resulting from the fusion of engineered zinc-finger
domains with the catalytic domain of a restriction enzyme such as
FokI or a chemical endonuclease. In chemical endonucleases, a
chemical or peptidic cleaver is conjugated either to a polymer of
nucleic acids or to another DNA recognizing a specific target
sequence, thereby targeting the cleavage activity to a specific
sequence. Chemical endonucleases also encompass synthetic nucleases
like conjugates of orthophenanthroline, a DNA cleaving molecule,
and triplex-forming oligonucleotides (TFOs), known to bind specific
DNA sequences. Such chemical endonucleases are comprised in the
term "endonuclease" according to the present invention. Examples of
such endonuclease include I-See I, I-Chu L I-Cre I, I-Csm I, PI-See
L PI-Tti L PI-Mtu I, I-Ceu I, I-See IL 1-See III, HO, PI-Civ I,
PI-Ctr L PI-Aae I, PI-Bsu I, PI-Dha I, PI-Dra L PI-May L PI-Meh I,
PI-Mfu L PI-Mfl I, PI-Mga L PI-Mgo I, PI-Min L PI-Mka L PI-Mle I,
PI-Mma I, PI- 30 Msh L PI-Msm I, PI-Mth I, PI-Mtu I, PI-Mxe I,
PI-Npu I, PI-Pfu L PI-Rma I, PI-Spb I, PI-Ssp L PI-Fae L PI-Mja I,
PI-Pho L PI-Tag L PI-Thy I, PI-Tko I, PI-Tsp I, I-MsoI.
[0074] A genetic modification made by TALENs or other tools may be,
for example, chosen from the list consisting of an insertion, a
deletion, insertion of an exogenous nucleic acid fragment, and a
substitution. The term insertion is used broadly to mean either
literal insertion into the chromosome or use of the exogenous
sequence as a template for repair. In general, a target DNA site is
identified and a TALEN-pair is created that will specifically bind
to the site. The TALEN is delivered to the cell or embryo, e.g., as
a protein, mRNA or by a vector that encodes the TALEN. The TALEN
cleaves the DNA to make a double-strand break that is then
repaired, often resulting in the creation of an indel, or
incorporating sequences or polymorphisms contained in an
accompanying exogenous nucleic acid that is either inserted into
the chromosome or serves as a template for repair of the break with
a modified sequence. This template-driven repair is a useful
process for changing a chromosome, and provides for effective
changes to cellular chromosomes.
[0075] The term exogenous nucleic acid means a nucleic acid that is
added to the cell or embryo, regardless of whether the nucleic acid
is the same or distinct from nucleic acid sequences naturally in
the cell. The term nucleic acid fragment is broad and includes a
chromosome, expression cassette, gene, DNA, RNA, mRNA, or portion
thereof. The cell or embryo may be, for instance, chosen from the
group consisting non-human vertebrates, non-human primates, cattle,
horse, swine, sheep, chicken, avian, rabbit, goats, dog, cat,
laboratory animal, and fish.
[0076] Some embodiments involve a composition or a method of making
a genetically modified livestock and/or artiodactyl comprising
introducing a TALEN-pair into livestock and/or an artiodactyl cell
or embryo that makes a genetic modification to DNA of the cell or
embryo at a site that is specifically bound by the TALEN-pair, and
producing the livestock animal/artiodactyl from the cell. Direct
injection may be used for the cell or embryo, e.g., into a zygote,
blastocyst, or embryo. Alternatively, the TALEN and/or other
factors may be introduced into a cell using any of many known
techniques for introduction of proteins, RNA, mRNA, DNA, or
vectors.
[0077] Genetically modified animals may be made from the embryos or
cells according to known processes, e.g., implantation of the
embryo into a gestational host, or various cloning methods. The
phrase "a genetic modification to DNA of the cell at a site that is
specifically bound by the TALEN", or the like, means that the
genetic modification is made at the site cut by the nuclease on the
TALEN when the TALEN is specifically bound to its target site. The
nuclease does not cut exactly where the TALEN-pair binds, but
rather at a defined site between the two binding sites.
[0078] Some embodiments involve a composition or a treatment of a
cell that is used for cloning the animal. The cell may be a
livestock and/or artiodactyl cell, a cultured cell, a primary cell,
a primary somatic cell, a zygote, a germ cell, a primordial germ
cell, or a stem cell. For example, an embodiment is a composition
or a method of creating a genetic modification comprising exposing
a plurality of primary cells in a culture to TALEN proteins or a
nucleic acid encoding a TALEN or TALENs. The TALENs may be
introduced as proteins or as nucleic acid fragments, e.g., encoded
by mRNA or a DNA sequence in a vector.
Zinc Finger Nucleases
[0079] Zinc-finger nucleases (ZFNs) are artificial restriction
enzymes generated by fusing a zinc finger DNA-binding domain to a
DNA-cleavage domain. Zinc finger domains can be engineered to
target desired DNA sequences and this enables zinc-finger nucleases
to target unique sequences within complex genomes. By taking
advantage of endogenous DNA repair machinery, these reagents can be
used to alter the genomes of higher organisms. ZFNs may be used in
method of inactivating genes.
[0080] A zinc finger DNA-binding domain has about 30 amino acids
and folds into a stable structure. Each finger primarily binds to a
triplet within the DNA substrate. Amino acid residues at key
positions contribute to most of the sequence-specific interactions
with the DNA site. These amino acids can be changed while
maintaining the remaining amino acids to preserve the necessary
structure. Binding to longer DNA sequences is achieved by linking
several domains in tandem. Other functionalities like non-specific
FokI cleavage domain (N), transcription activator domains (A),
transcription repressor domains (R) and methylases (M) can be fused
to a ZFPs to form ZFNs respectively, zinc finger transcription
activators (ZFA), zinc finger transcription repressors (ZFR, and
zinc finger methylases (ZFM). Materials and methods for using zinc
fingers and zinc finger nucleases for making genetically modified
animals are disclosed in, e.g., U.S. Pat. No. 8,106,255; U.S.
2012/0192298; U.S. 2011/0023159; and U.S. 2011/0281306.
Vectors and Nucleic Acids
[0081] A variety of nucleic acids may be introduced into cells, for
knockout purposes, for inactivation of a gene, to obtain expression
of a gene, or for other purposes. As used herein, the term nucleic
acid includes DNA, RNA, and nucleic acid analogs, and nucleic acids
that are double-stranded or single-stranded (i.e., a sense or an
antisense single strand). Nucleic acid analogs can be modified at
the base moiety, sugar moiety, or phosphate backbone to improve,
for example, stability, hybridization, or solubility of the nucleic
acid. The deoxyribose phosphate backbone can be modified to produce
morpholino nucleic acids, in which each base moiety is linked to a
six membered, morpholino ring, or peptide nucleic acids, in which
the deoxyphosphate backbone is replaced by a pseudopeptide backbone
and the four bases are retained.
[0082] The target nucleic acid sequence can be operably linked to a
regulatory region such as a promoter. Regulatory regions can be
porcine regulatory regions or can be from other species. As used
herein, operably linked refers to positioning of a regulatory
region relative to a nucleic acid sequence in such a way as to
permit or facilitate transcription of the target nucleic acid.
[0083] In general, type of promoter can be operably linked to a
target nucleic acid sequence. Examples of promoters include,
without limitation, tissue-specific promoters, constitutive
promoters, inducible promoters, and promoters responsive or
unresponsive to a particular stimulus. In some embodiments, a
promoter that facilitates the expression of a nucleic acid molecule
without significant tissue- or temporal-specificity can be used
(i.e., a constitutive promoter). For example, a beta-actin promoter
such as the chicken beta-actin gene promoter, ubiquitin promoter,
miniCAGs promoter, glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
promoter, or 3-phosphoglycerate kinase (PGK) promoter can be used,
as well as viral promoters such as the herpes simplex virus
thymidine kinase (HSV-TK) promoter, the SV40 promoter, or a
cytomegalovirus (CMV) promoter. In some embodiments, a fusion of
the chicken beta actin gene promoter and the CMV enhancer is used
as a promoter. See, for example, Xu et al., Hum. Gene Ther. 12:563,
2001; and Kiwaki et al., Hum. Gene Ther. 7:821, 1996.
[0084] Additional regulatory regions that may be useful in nucleic
acid constructs, include, but are not limited to, polyadenylation
sequences, translation control sequences (e.g., an internal
ribosome entry segment, IRES), enhancers, inducible elements, or
introns. Such regulatory regions may not be necessary, although
they may increase expression by affecting transcription, stability
of the mRNA, translational efficiency, or the like. Such regulatory
regions can be included in a nucleic acid construct as desired to
obtain optimal expression of the nucleic acids in the cell(s).
Sufficient expression, however, can sometimes be obtained without
such additional elements.
[0085] A nucleic acid construct may be used that encodes signal
peptides or selectable expressed markers. Signal peptides can be
used such that an encoded polypeptide is directed to a particular
cellular location (e.g., the cell surface). Non-limiting examples
of selectable markers include puromycin, ganciclovir, adenosine
deaminase (ADA), aminoglycoside phosphotransferase (neo,
[0086] G418, APH), dihydrofolate reductase (DHFR),
hygromycin-B-phosphtransferase, thymidine kinase (TK), and
xanthin-guanine phosphoribosyltransferase (XGPRT). Such markers are
useful for selecting stable transformants in culture. Other
selectable markers include fluorescent polypeptides, such as green
fluorescent protein or yellow fluorescent protein.
[0087] In some embodiments, a sequence encoding a selectable marker
can be flanked by recognition sequences for a recombinase such as,
e.g., Cre or Flp. For example, the selectable marker can be flanked
by loxP recognition sites (34-bp recognition sites recognized by
the Cre recombinase) or FRT recognition sites such that the
selectable marker can be excised from the construct. See, Orban et
al., Proc. Natl. Acad. Sci., 89:6861, 1992, for a review of Cre/lox
technology, and Brand and Dymecki, Dev. Cell, 6:7, 2004. A
transposon containing a Cre- or Flp-activatable transgene
interrupted by a selectable marker gene also can be used to obtain
transgenic animals with conditional expression of a transgene. For
example, a promoter driving expression of the marker/transgene can
be either ubiquitous or tissue-specific, which would result in the
ubiquitous or tissue-specific expression of the marker in F0
animals (e.g., pigs). Tissue specific activation of the transgene
can be accomplished, for example, by crossing a pig that
ubiquitously expresses a marker-interrupted transgene to a pig
expressing Cre or Flp in a tissue-specific manner, or by crossing a
pig that expresses a marker-interrupted transgene in a
tissue-specific manner to a pig that ubiquitously expresses Cre or
Flp recombinase. Controlled expression of the transgene or
controlled excision of the marker allows expression of the
transgene.
[0088] In some embodiments, the exogenous nucleic acid encodes a
polypeptide. A nucleic acid sequence encoding a polypeptide can
include a tag sequence that encodes a "tag" designed to facilitate
subsequent manipulation of the encoded polypeptide (e.g., to
facilitate localization or detection). Tag sequences can be
inserted in the nucleic acid sequence encoding the polypeptide such
that the encoded tag is located at either the carboxyl or amino
terminus of the polypeptide. Non-limiting examples of encoded tags
include glutathione S-transferase (GST) and FLAGTM tag (Kodak, New
Haven, CT).
[0089] Nucleic acid constructs can be introduced into embryonic,
fetal, or adult artiodactyl/livestock cells of any type, including,
for example, germ cells such as an oocyte or an egg, a progenitor
cell, an adult or embryonic stem cell, a primordial germ cell, a
kidney cell such as a PK-15 cell, an islet cell, a beta cell, a
liver cell, or a fibroblast such as a dermal fibroblast, using a
variety of techniques. Non-limiting examples of techniques include
the use of transposon systems, recombinant viruses that can infect
cells, or liposomes or other non-viral methods such as
electroporation, microinjection, or calcium phosphate
precipitation, that are capable of delivering nucleic acids to
cells.
[0090] In transposon systems, the transcriptional unit of a nucleic
acid construct, i.e., the regulatory region operably linked to an
exogenous nucleic acid sequence, is flanked by an inverted repeat
of a transposon. Several transposon systems, including, for
example, Sleeping Beauty (see, U.S. Pat. No. 6,613,752 and U.S.
2005/0003542); Frog Prince (Miskey et al., Nucleic Acids Res.
31:6873, 2003); To12 (Kawakami, Genome Biology 8(Suppl.1):57,
2007); Minos (Pavlopoulos et al., Genome Biology, 8(Suppl.1):52,
2007); Hsmarl (Miskey et al., Mol Cell Biol., 27:4589, 2007); and
Passport have been developed to introduce nucleic acids into cells,
including mice, human, and pig cells. The Sleeping Beauty
transposon is particularly useful. A transposase can be delivered
as a protein, encoded on the same nucleic acid construct as the
exogenous nucleic acid, can be introduced on a separate nucleic
acid construct, or provided as an mRNA (e.g., an in
vitro-transcribed and capped mRNA).
[0091] Nucleic acids can be incorporated into vectors. A vector is
a broad term that includes any specific DNA segment that is
designed to move from a carrier into a target DNA. A vector may be
referred to as an expression vector, or a vector system, which is a
set of components needed to bring about DNA insertion into a genome
or other targeted DNA sequence such as an episome, plasmid, or even
virus/phage DNA segment. Vector systems such as viral vectors
(e.g., retroviruses, adeno-associated virus and integrating phage
viruses), and non-viral vectors (e.g., transposons) used for gene
delivery in animals have two basic components: 1) a vector
comprised of DNA (or RNA that is reverse transcribed into a cDNA)
and 2) a transposase, recombinase, or other integrase enzyme that
recognizes both the vector and a DNA target sequence and inserts
the vector into the target DNA sequence. Vectors most often contain
one or more expression cassettes that comprise one or more
expression control sequences, wherein an expression control
sequence is a DNA sequence that controls and regulates the
transcription and/or translation of another DNA sequence or mRNA,
respectively.
[0092] Many different types of vectors are known. For example,
plasmids and viral vectors, e.g., retroviral vectors, are known.
Mammalian expression plasmids typically have an origin of
replication, a suitable promoter and optional enhancer, and also
any necessary ribosome binding sites, a polyadenylation site,
splice donor and acceptor sites, transcriptional termination
sequences, and 5' flanking non-transcribed sequences. Examples of
vectors include: plasmids (which may also be a carrier of another
type of vector), adenovirus, adeno-associated virus (AAV),
lentivirus (e.g., modified HIV-1, SIV or FIV), retrovirus (e.g.,
ASV, ALV or MoMLV), and transposons (e.g., Sleeping Beauty,
P-elements, Tol-2, Frog Prince, piggyBac).
[0093] As used herein, the term nucleic acid refers to both RNA and
DNA, including, for example, cDNA, genomic DNA, synthetic (e.g.,
chemically synthesized) DNA, as well as naturally occurring and
chemically modified nucleic acids, e.g., synthetic bases or
alternative backbones. A nucleic acid molecule can be
double-stranded or single-stranded (i.e., a sense or an antisense
single strand). The term transgenic is used broadly herein and
refers to a genetically modified organism or genetically engineered
organism whose genetic material has been altered using genetic
engineering techniques. A knockout artiodactyl is thus transgenic
regardless of whether or not exogenous genes or nucleic acids are
expressed in the animal or its progeny.
Genetically Modified Animals
[0094] Animals may be modified using TALENs or other genetic
engineering tools, including recombinase fusion proteins, or
various vectors that are known. A genetic modification made by such
tools may comprise disruption of a gene. The term disruption of a
gene refers to preventing the formation of a functional gene
product. A gene product is functional only if it fulfills its
normal (wild-type) functions. Disruption of the gene prevents
expression of a functional factor encoded by the gene and comprises
an insertion, deletion, or substitution of one or more bases in a
sequence encoded by the gene and/or a promoter and/or an operator
that is necessary for expression of the gene in the animal. The
disrupted gene may be disrupted by, e.g., removal of at least a
portion of the gene from a genome of the animal, alteration of the
gene to prevent expression of a functional factor encoded by the
gene, an interfering RNA, or expression of a dominant negative
factor by an exogenous gene. Materials and methods of genetically
modifying animals are further detailed in U.S. Pat. No. 8,518,701;
U.S. 2010/0251395; and U.S. 2012/0222143 which are hereby
incorporated herein by reference for all purposes; in case of
conflict, the instant specification is controlling. The term
trans-acting refers to processes acting on a target gene from a
different molecule (i.e., intermolecular). A trans-acting element
is usually a DNA sequence that contains a gene. This gene codes for
a protein (or microRNA or other diffusible molecule) that is used
in the regulation the target gene. The trans-acting gene may be on
the same chromosome as the target gene, but the activity is via the
intermediary protein or RNA that it encodes. Embodiments of
trans-acting gene are, e.g., genes that encode targeting
endonucleases. Inactivation of a gene using a dominant negative
generally involves a trans-acting element. The term cis-regulatory
or cis-acting means an action without coding for protein or RNA; in
the context of gene inactivation, this generally means inactivation
of the coding portion of a gene, or a promoter and/or operator that
is necessary for expression of the functional gene.
[0095] Various techniques known in the art can be used to
inactivate genes to make knock-out animals and/or to introduce
nucleic acid constructs into animals to produce founder animals and
to make animal lines, in which the knockout or nucleic acid
construct is integrated into the genome. Such techniques include,
without limitation, pronuclear microinjection (U.S. Pat. No.
4,873,191), retrovirus mediated gene transfer into germ lines (Van
der Putten et al., Proc. Natl. Acad. Sci. USA, 82:6148-6152, 1985),
gene targeting into embryonic stem cells (Thompson et al., Cell,
56:313-321, 1989), electroporation of embryos (Lo, Mol. Cell.
Biol., 3:1803-1814, 1983), sperm-mediated gene transfer (Lavitrano
et al., Proc. Natl. Acad. Sci. USA, 99:14230-14235, 2002; Lavitrano
et al., Reprod. Fert. Develop., 18:19-23, 2006), and in vitro
transformation of somatic cells, such as cumulus or mammary cells,
or adult, fetal, or embryonic stem cells, followed by nuclear
transplantation (Wilmut et al., Nature, 385:810-813, 1997; and
Wakayama et al., Nature, 394:369-374, 1998). Pronuclear
microinjection, sperm mediated gene transfer, and somatic cell
nuclear transfer are particularly useful techniques. An animal that
is genomically modified is an animal wherein all of its cells have
the genetic modification, including its germ line cells. When
methods are used that produce an animal that is mosaic in its
genetic modification, the animals may be inbred and progeny that
are genomically modified may be selected. Cloning, for instance,
may be used to make a mosaic animal if its cells are modified at
the blastocyst state, or genomic modification can take place when a
single-cell is modified. Animals that are modified so they do not
sexually mature can be homozygous or heterozygous for the
modification, depending on the specific approach that is used. If a
particular gene is inactivated by a knock out modification,
homozygousity would normally be required. If a particular gene is
inactivated by an RNA interference or dominant negative strategy,
then heterozygosity is often adequate.
[0096] Typically, in pronuclear microinjection, a nucleic acid
construct is introduced into a fertilized egg; 1 or 2 cell
fertilized eggs are used as the pronuclei containing the genetic
material from the sperm head and the egg are visible within the
protoplasm. Pronuclear staged fertilized eggs can be obtained in
vitro or in vivo (i.e., surgically recovered from the oviduct of
donor animals). In vitro fertilized eggs can be produced as
follows. For example, swine ovaries can be collected at an
abattoir, and maintained at 22-28.degree. C. during transport.
Ovaries can be washed and isolated for follicular aspiration, and
follicles ranging from 4-8 mm can be aspirated into 50 mL conical
centrifuge tubes using 18 gauge needles and under vacuum.
Follicular fluid and aspirated oocytes can be rinsed through
pre-filters with commercial TL-HEPES (Minitube, Verona, Wis.).
Oocytes surrounded by a compact cumulus mass can be selected and
placed into TCM-199 OOCYTE MATURATION MEDIUM (Minitube, Verona, WI)
supplemented with 0.1 mg/mL cysteine, 10 ng/mL epidermal growth
factor, 10% porcine follicular fluid, 50 .mu.M 2-mercaptoethanol,
0.5 mg/ml cAMP, 10 IU/mL each of pregnant mare serum gonadotropin
(PMSG) and human chorionic gonadotropin (hCG) for approximately 22
hours in humidified air at 38.7.degree. C. and 5% CO2.
Subsequently, the oocytes can be moved to fresh TCM-199 maturation
medium, which will not contain cAMP, PMSG or hCG and incubated for
an additional 22 hours. Matured oocytes can be stripped of their
cumulus cells by vortexing in 0.1% hyaluronidase for 1 minute.
[0097] For swine, mature oocytes can be fertilized in 500 .mu.l
Minitube PORCPRO IVF MEDIUM SYSTEM (Minitube, Verona, WI) in
Minitube 5-well fertilization dishes. In preparation for in vitro
fertilization (IVF), freshly-collected or frozen boar semen can be
washed and resuspended in PORCPRO IVF Medium to 4.times.10.sup.5
sperm. Sperm concentrations can be analyzed by computer assisted
semen analysis (SPERMVISION, Minitube, Verona, WI). Final in vitro
insemination can be performed in a 10 .mu.l volume at a final
concentration of approximately 40 motile sperm/oocyte, depending on
boar. Incubate all fertilizing oocytes at 38.7.degree. C. in 5.0%
CO.sub.2 atmosphere for 6 hours. Six hours post-insemination,
presumptive zygotes can be washed twice in NCSU-23 and moved to 0.5
mL of the same medium. This system can produce 20-30% blastocysts
routinely across most boars with a 10-30% polyspermic insemination
rate.
[0098] Linearized nucleic acid constructs can be injected into one
of the pronuclei. Then the injected eggs can be transferred to a
recipient female (e.g., into the oviducts of a recipient female)
and allowed to develop in the recipient female to produce the
transgenic animals. In particular, in vitro fertilized embryos can
be centrifuged at 15,000.times.g for 5 minutes to sediment lipids
allowing visualization of the pronucleus. The embryos can be
injected with using an Eppendorf FEMTOJET injector and can be
cultured until blastocyst formation. Rates of embryo cleavage and
blastocyst formation and quality can be recorded.
[0099] Embryos can be surgically transferred into uteri of
asynchronous recipients. Typically, 100-200 (e.g., 150-200) embryos
can be deposited into the ampulla-isthmus junction of the oviduct
using a 5.5-inch TOMCAT.RTM. catheter. After surgery, real-time
ultrasound examination of pregnancy can be performed.
[0100] In somatic cell nuclear transfer, a transgenic artiodactyl
cell (e.g., a transgenic pig cell or bovine cell) such as an
embryonic blastomere, fetal fibroblast, adult ear fibroblast, or
granulosa cell that includes a nucleic acid construct described
above, can be introduced into an enucleated oocyte to establish a
combined cell. Oocytes can be enucleated by partial zona dissection
near the polar body and then pressing out cytoplasm at the
dissection area. Typically, an injection pipette with a sharp
beveled tip is used to inject the transgenic cell into an
enucleated oocyte arrested at meiosis 2. In some conventions,
oocytes arrested at meiosis-2 are termed eggs. After producing a
porcine or bovine embryo (e.g., by fusing and activating the
oocyte), the embryo is transferred to the oviducts of a recipient
female, about 20 to 24 hours after activation. See, for example,
Cibelli et al., Science 280:1256-1258, 1998, and U.S. Pat. No.
6,548,741. For pigs, recipient females can be checked for pregnancy
approximately 20-21 days after transfer of the embryos.
[0101] Standard breeding techniques can be used to create animals
that are homozygous for the exogenous nucleic acid from the initial
heterozygous founder animals. Homozygosity may not be required,
however. Transgenic pigs described herein can be bred with other
pigs of interest.
[0102] In some embodiments, a nucleic acid of interest and a
selectable marker can be provided on separate transposons and
provided to either embryos or cells in unequal amount, where the
amount of transposon containing the selectable marker far exceeds
(5-10 fold excess) the transposon containing the nucleic acid of
interest. Transgenic cells or animals expressing the nucleic acid
of interest can be isolated based on presence and expression of the
selectable marker. Because the transposons will integrate into the
genome in a precise and unlinked way (independent transposition
events), the nucleic acid of interest and the selectable marker are
not genetically linked and can easily be separated by genetic
segregation through standard breeding. Thus, transgenic animals can
be produced that are not constrained to retain selectable markers
in subsequent generations, an issue of some concern from a public
safety perspective.
[0103] Once transgenic animal have been generated, expression of an
exogenous nucleic acid can be assessed using standard techniques.
Initial screening can be accomplished by Southern blot analysis to
determine whether or not integration of the construct has taken
place. For a description of Southern analysis, see sections
9.37-9.52 of Sambrook et al., Molecular Cloning, A Laboratory
Manual, second edition, Cold Spring Harbor Press, Plainview; N.Y.,
1989. Polymerase chain reaction (PCR) techniques also can be used
in the initial screening. PCR refers to a procedure or technique in
which target nucleic acids are amplified. Generally, sequence
information from the ends of the region of interest or beyond is
employed to design oligonucleotide primers that are identical or
similar in sequence to opposite strands of the template to be
amplified. PCR can be used to amplify specific sequences from DNA
as well as RNA, including sequences from total genomic DNA or total
cellular RNA. Primers typically are 14 to 40 nucleotides in length,
but can range from 10 nucleotides to hundreds of nucleotides in
length. PCR is described in, for example PCR Primer: A Laboratory
Manual, ed. Dieffenbach and Dveksler, Cold Spring Harbor Laboratory
Press, 1995. Nucleic acids also can be amplified by ligase chain
reaction, strand displacement amplification, self-sustained
sequence replication, or nucleic acid sequence-based amplified.
See, for example, Lewis, Genetic Engineering News 12:1, 1992;
Guatelli et al., Proc. Natl. Acad. Sci. USA, 87:1874, 1990; and
Weiss, Science 254:1292, 1991. At the blastocyst stage, embryos can
be individually processed for analysis by PCR, Southern
hybridization and splinkerette PCR (see, e.g., Dupuy et al. Proc
Natl Acad Sci USA, 99:4495, 2002).
[0104] Expression of a nucleic acid sequence encoding a polypeptide
in the tissues of transgenic pigs can be assessed using techniques
that include, for example, Northern blot analysis of tissue samples
obtained from the animal, in situ hybridization analysis, Western
analysis, immunoassays such as enzyme-linked immunosorbent assays,
and reverse-transcriptase PCR (RT-PCR).
Interfering RNAs
[0105] A variety of interfering RNA (RNAi) are known.
Double-stranded RNA (dsRNA) induces sequence-specific degradation
of homologous gene transcripts. RNA-induced silencing complex
(RISC) metabolizes dsRNA to small 21-23-nucleotide small
interfering RNAs (siRNAs). RISC contains a double stranded RNAse
(dsRNase, e.g., Dicer) and ssRNase (e.g., Argonaut 2 or Ago2). RISC
utilizes antisense strand as a guide to find a cleavable target.
Both siRNAs and microRNAs (miRNAs) are known. A method of
disrupting a gene in a genetically modified animal comprises
inducing RNA interference against a target gene and/or nucleic acid
such that expression of the target gene and/or nucleic acid is
reduced.
[0106] For example the exogenous nucleic acid sequence can induce
RNA interference against a nucleic acid encoding a polypeptide. For
example, double-stranded small interfering RNA (siRNA) or small
hairpin RNA (shRNA) homologous to a target DNA can be used to
reduce expression of that DNA. Constructs for siRNA can be produced
as described, for example, in Fire et al., Nature 391:806, 1998;
Romano and Masino, Mol. Microbiol. 6:3343, 1992; Cogoni et al.,
EMBO J. 15:3153, 1996; Cogoni and Masino, Nature, 399:166, 1999;
Misquitta and Paterson Proc. Natl. Acad. Sci. USA, 96:1451, 1999;
and Kennerdell and Carthew, Cell, 95:1017, 1998. Constructs for
shRNA can be produced as described by McIntyre and Fanning (2006)
BMC Biotechnology 6:1. In general, shRNAs are transcribed as a
single-stranded RNA molecule containing complementary regions,
which can anneal and form short hairpins.
[0107] The probability of finding a single, individual functional
siRNA or miRNA directed to a specific gene is high. The
predictability of a specific sequence of siRNA, for instance, is
about 50% but a number of interfering RNAs may be made with good
confidence that at least one of them will be effective.
[0108] Embodiments include an in vitro cell, an in vivo cell, and a
genetically modified animal such as a livestock animal that express
an RNAi directed against a gene, e.g., a gene selective for a
developmental stage. The RNAi may be, for instance, selected from
the group consisting of siRNA, shRNA, dsRNA, RISC and miRNA.
Inducible Systems
[0109] An inducible system may be used to control expression of a
gene. Various inducible systems are known that allow spatiotemporal
control of expression of a gene. Several have been proven to be
functional in vivo in transgenic animals. The term inducible system
includes traditional promoters and inducible gene expression
elements.
[0110] An example of an inducible system is the tetracycline
(tet)-on promoter system, which can be used to regulate
transcription of the nucleic acid. In this system, a mutated Tet
repressor (TetR) is fused to the activation domain of herpes
simplex virus VP16 trans-activator protein to create a
tetracycline-controlled transcriptional activator (tTA), which is
regulated by tet or doxycycline (dox). In the absence of
antibiotic, transcription is minimal, while in the presence of tet
or dox, transcription is induced. Alternative inducible systems
include the ecdysone or rapamycin systems. Ecdysone is an insect
molting hormone whose production is controlled by a heterodimer of
the ecdysone receptor and the product of the ultraspiracle gene
(USP). Expression is induced by treatment with ecdysone or an
analog of ecdysone such as muristerone A. The agent that is
administered to the animal to trigger the inducible system is
referred to as an induction agent.
[0111] The tetracycline-inducible system and the Cre/loxP
recombinase system (either constitutive or inducible) are among the
more commonly used inducible systems. The tetracycline-inducible
system involves a tetracycline-controlled transactivator
(tTA)/reverse tTA (rtTA). A method to use these systems in vivo
involves generating two lines of genetically modified animals. One
animal line expresses the activator (tTA, rtTA, or Cre recombinase)
under the control of a selected promoter. Another set of transgenic
animals express the acceptor, in which the expression of the gene
of interest (or the gene to be modified) is under the control of
the target sequence for the tTA/rtTA transactivators (or is flanked
by loxP sequences). Mating the two strains of mice provides control
of gene expression.
[0112] The tetracycline-dependent regulatory systems (tet systems)
rely on two components, i.e., a tetracycline-controlled
transactivator (tTA or rtTA) and a tTA/rtTA-dependent promoter that
controls expression of a downstream cDNA, in a
tetracycline-dependent manner. In the absence of tetracycline or
its derivatives (such as doxycycline), tTA binds to tetO sequences,
allowing transcriptional activation of the tTA-dependent promoter.
However, in the presence of doxycycline, tTA cannot interact with
its target and transcription does not occur. The tet system that
uses tTA is termed tet-OFF, because tetracycline or doxycycline
allows transcriptional down-regulation. Administration of
tetracycline or its derivatives allows temporal control of
transgene expression in vivo. rtTA is a variant of tTA that is not
functional in the absence of doxycycline but requires the presence
of the ligand for transactivation. This tet system is therefore
termed tet-ON. The tet systems have been used in vivo for the
inducible expression of several transgenes, encoding, e.g.,
reporter genes, oncogenes, or proteins involved in a signaling
cascade.
[0113] The Cre/lox system uses the Cre recombinase, which catalyzes
site-specific recombination by crossover between two distant Cre
recognition sequences, i.e., loxP sites. A DNA sequence introduced
between the two loxP sequences (termed floxed DNA) is excised by
Cre-mediated recombination. Control of Cre expression in a
transgenic animal, using either spatial control (with a tissue- or
cell-specific promoter) or temporal control (with an inducible
system), results in control of DNA excision between the two loxP
sites. One application is for conditional gene inactivation
(conditional knockout). Another approach is for protein
over-expression, wherein a floxed stop codon is inserted between
the promoter sequence and the DNA of interest. Genetically modified
animals do not express the transgene until Cre is expressed,
leading to excision of the floxed stop codon. This system has been
applied to tissue-specific oncogenesis and controlled antigene
receptor expression in B lymphocytes. Inducible Cre recombinases
have also been developed. The inducible Cre recombinase is
activated only by administration of an exogenous ligand. The
inducible Cre recombinases are fusion proteins containing the
original Cre recombinase and a specific ligand-binding domain. The
functional activity of the Cre recombinase is dependent on an
external ligand that is able to bind to this specific domain in the
fusion protein.
[0114] Embodiments include an in vitro cell, an in vivo cell, and a
genetically modified animal such as a livestock animal that
comprise a gene under control of an inducible system. The genetic
modification of an animal may be genomic or mosaic. The inducible
system may be, for instance, selected from the group consisting of
Tet-On, Tet-Off, Cre-lox, and Hifl alpha. An embodiment is a gene
set forth herein.
Dominant Negatives
[0115] Genes may thus be disrupted not only by removal or RNAi
suppression but also by creation/expression of a dominant negative
variant of a protein which has inhibitory effects on the normal
function of that gene product. The expression of a dominant
negative (DN) gene can result in an altered phenotype, exerted by
a) a titration effect; the DN PASSIVELY competes with an endogenous
gene product for either a cooperative factor or the normal target
of the endogenous gene without elaborating the same activity, b) a
poison pill (or monkey wrench) effect wherein the dominant negative
gene product ACTIVELY interferes with a process required for normal
gene function, c) a feedback effect, wherein the DN ACTIVELY
stimulates a negative regulator of the gene function.
Founder Animals, Animal lines, Traits, and Reproduction
[0116] Founder animals (F0 generation) may be produced by cloning
and other methods described herein. The founders can be homozygous
for a genetic modification, as in the case where a zygote or a
primary cell undergoes a homozygous modification. Similarly,
founders can also be made that are heterozygous. The founders may
be genomically modified, meaning that the cells in their genome
have undergone modification. Founders can be mosaic for a
modification, as may happen when vectors are introduced into one of
a plurality of cells in an embryo, typically at a blastocyst stage.
Progeny of mosaic animals may be tested to identify progeny that
are genomically modified. An animal line is established when a pool
of animals has been created that can be reproduced sexually or by
assisted reproductive techniques, with heterogeneous or homozygous
progeny consistently expressing the modification.
[0117] In livestock, many alleles are known to be linked to various
traits such as production traits, type traits, workability traits,
and other functional traits. Artisans are accustomed to monitoring
and quantifying these traits, e.g., Visscher et al., Livestock
Production Science, 40:123-137, 1994, U.S. Pat. No. 7,709,206, U.S.
2001/0016315, U.S. 2011/0023140, and U.S. 2005/0153317. An animal
line may include a trait chosen from a trait in the group
consisting of a production trait, a type trait, a workability
trait, a fertility trait, a mothering trait, and a disease
resistance trait. Further traits include expression of a
recombinant gene product.
Recombinases
[0118] Embodiments of the invention include administration of a
targeted nuclease system with a recombinase (e.g., a RecA protein,
a Rad51) or other DNA-binding protein associated with DNA
recombination. A recombinase forms a filament with a nucleic acid
fragment and, in effect, searches cellular DNA to find a DNA
sequence substantially homologous to the sequence. For instance a
recombinase may be combined with a nucleic acid sequence that
serves as a template for HDR. The recombinase is then combined with
the HDR template to form a filament and placed into the cell. The
recombinase and/or HDR template that combines with the recombinase
may be placed in the cell or embryo as a protein, an mRNA, or with
a vector that encodes the recombinase. The disclosure of U.S.
2011/0059160 (U.S. Patent Application No. 12/869,232) is hereby
incorporated herein by reference for all purposes; in case of
conflict, the specification is controlling. The term recombinase
refers to a genetic recombination enzyme that enzymatically
catalyzes, in a cell, the joining of relatively short pieces of DNA
between two relatively longer DNA strands. Recombinases include Cre
recombinase, Hin recombinase, RecA, RAD51, Cre, and FLP. Cre
recombinase is a Type I topoisomerase from P1 bacteriophage that
catalyzes site-specific recombination of DNA between loxP sites.
Hin recombinase is a 21 kD protein composed of 198 amino acids that
is found in the bacteria Salmonella. Hin belongs to the serine
recombinase family of DNA invertases in which it relies on the
active site serine to initiate DNA cleavage and recombination.
RAD51 is a human gene. The protein encoded by this gene is a member
of the RAD51 protein family which assists in repair of DNA double
strand breaks. RAD51 family members are homologous to the bacterial
RecA and yeast Rad51. Cre recombinase is an enzyme that is used in
experiments to delete specific sequences that are flanked by loxP
sites. FLP refers to Flippase recombination enzyme (FLP or Flp)
derived from the 2.mu. plasmid of the baker's yeast Saccharomyces
cerevisiae.
[0119] Herein, "RecA" or "RecA protein" refers to a family of
RecA-like recombination proteins having essentially all or most of
the same functions, particularly: (i) the ability to position
properly oligonucleotides or polynucleotides on their homologous
targets for subsequent extension by DNA polymerases; (ii) the
ability topologically to prepare duplex nucleic acid for DNA
synthesis; and, (iii) the ability of RecA/oligonucleotide or
RecA/polynucleotide complexes efficiently to find and bind to
complementary sequences. The best characterized RecA protein is
from E. coli; in addition to the original allelic form of the
protein a number of mutant RecA-like proteins have been identified,
for example, RecA803. Further, many organisms have RecA-like
strand-transfer proteins including, for example, yeast, Drosophila,
mammals including humans, and plants. These proteins include, for
example, Recl, Rec2, Rad51, Rad51B, Rad51C, Rad51D, Rad51E, XRCC2
and DMC1. An embodiment of the recombination protein is the RecA
protein of E. coli. Alternatively, the RecA protein can be the
mutant RecA-803 protein of E. coli, a RecA protein from another
bacterial source or a homologous recombination protein from another
organism.
Compositions and Kits
[0120] The present invention also provides compositions and kits
containing, for example, nucleic acid molecules encoding
site-specific endonucleases, CRISPR, Cas9, ZNFs, TALENs, RecA-gal4
fusions, polypeptides of the same, compositions containing such
nucleic acid molecules or polypeptides, or engineered cell lines.
An HDR may also be provided that is effective for introgression of
an indicated allele. Such items can be used, for example, as
research tools, or therapeutically.
EXAMPLES
[0121] Methods are as follows unless otherwise noted.
Tissue Culture and Transfection.
[0122] Pig were maintained at 37 at 5% CO2 in DMEM supplemented
with 10% fetal bovine serum, 100 I.U./ml penicillin and
streptomycin, and 2mM L-Glutamine. For transfection, all TALENs and
HDR templates were delivered through transfection using the NEON
Transfection system (Life Technologies). Briefly, low passage
Ossabaw, Landrace reaching 100% confluence were split 1:2 and
harvested the next day at 70-80% confluence. Each transfection was
comprised of 500,000-600,000 cells resuspended in buffer "R" mixed
with TALEN mRNA and oligos and electroporated using the 100 .mu.l
tips that provide a 100 .mu.l working volume by the following
parameters: input Voltage; 1800V; Pulse Width; 20 ms; and Pulse
Number; 1. Typically, 1-2 .mu.g of TALEN mRNA and 1-4 .mu.M of HDR
templates (single stranded oligonucleotides) specific for the gene
of interest were included in each transfection. Deviation from
those amounts is indicated in the figures and legends. After
transfection, cells were plated in a well of a 6-well dish for
three days and cultured at either 30.degree. C. After three days,
cell populations were plated for colony analysis and/or expanded
and at 37.degree. C. until at least day 10 to assess stability of
edits.
Surveyor Mutation Detection and RFLP Analysis.
[0123] PCR flanking the intended sites was conducted using PLATINUM
Taq DNA polymerase HiFi (Life Technologies) with 1 .mu.l of the
cell lysate according to the manufacturer's recommendations. The
frequency of mutation in a population was analysed with the
SURVEYOR Mutation Detection Kit (Transgenomic) according to the
manufacturer's recommendations using 10 .mu.l of the PCR product as
described above. RFLP analysis was performed on 10 .mu.l of the
above PCR reaction using the indicated restriction enzyme. Surveyor
and RFLP reactions were resolved on a 10% TBE polyacrylamide gels
and visualized by ethidium bromide staining. Densitometry
measurements of the bands were performed using IMAGEJ; and mutation
rate of Surveyor reactions was calculated as described in Guschin
et al., 2010(1). Percent homology directed repair (HDR) was
calculated by dividing the sum intensity of RFLP fragments by the
sum intensity of the parental band+RFLP fragments. RFLP analysis of
colonies was treated similarly except that the PCR products were
amplified by 1X MYTAQ RED MIX (Bioline) and resolved on 2.5%
agarose gels.
Dilution Cloning:
[0124] Three days post transfection, 50 to 250 cells were seeded
onto 10 cm dishes and cultured until individual colonies reached
circa 5mm in diameter. At this point, 6 ml of TRYPLE (Life
Technologies) 1:5 (vol/vol) diluted in PBS was added and colonies
were aspirated, transferred into wells of a 24-well dish well and
cultured under the same conditions. Colonies reaching confluence
were collected and divided for cryopreservation and genotyping.
Sample Preparation:
[0125] Transfected cells populations at day 3 and 10 were collected
from a well of a 6-well dish and 10-30% were resuspended in 50
.mu.l of 1.times. PCR compatible lysis buffer: 10 mM Tris-Cl pH
8.0, 2 mM EDTA, 0.45% TRYTON X-100(vol/vol), 0.45%
TWEEN-20(vol/vol) freshly supplemented with 200 .mu.g/ml Proteinase
K. The lysates were processed in a thermal cycler using the
following program: 55.degree. C. for 60 minutes, 95.degree. C. for
15 minutes. Colony samples from dilution cloning were treated as
above using 20-30 .mu.l of lysis buffer.
TABLE-US-00004 TABLE D Listing of Endonuclease binding sequences
and HDR templates. Gene Example Endonuclease HDR Template Example
L: repeat-variable ssDNA oligo sequence, diresidue (RVD) code 5' to
3' for left TALEN monomer R: RVD code for right TALEN monomer OR
Cas9/CRISPR, sgRNA: gRNA sequence, 5' to 3' IL2R.gamma. 1, 3 L: HD
HD HD NI NI NI NN TTCCACTCTACCCCCCCCAAAGG NN NG NG HD NI NN NG NN
TTCAGTGTTTTGTGTAAGCTTCAA NG NG NG (SEQ ID NO: 4)
TGTTGAGTACATGAATTGCACTT R: HD HD NI NI NN NG NN
GGGACAGCAGCTCTGAGCTC HD NI NI NG NG HD NI NG (SEQ ID NO: 27) NN NG
NI HD NG (SEQ ID NO: 5) RAG2 1, 3 L: NI HD HD NG NG HD HD
CTCTAAGGATTCCTGCCACCTTCC NG HD HD NG HD NG HD
TCCTCTCCGCTACCCAGACTAAG HD NN HD NG CTTTGCACATTCAAAAGCAGCTT (SEQ ID
NO: 6) AGGGTCTGAAAAACATCAGT R: HD NG NI NI NN HD NG (SEQ ID NO: 28)
NN HD NG NG NG NG NN NI NI NG (SEQ ID NO: 7) APC 2, 3 L: NN NN NI
NI NN NI NI NN CCAGATCGCCAAAGTCACGGAAG NG NI NG HD NI NN HD HD
AAGTATCAGCCATTCATCCCTCC NI NG (SEQ ID NO: 8)
CAGTGAAGCTTACAGAAATTCTG R: NN NI HD HD HD NI NN NI
GGTCGACCACGGAGTTGCACT NI NG NG NG HD NG NN NG (SEQ ID NO: 29) (SEQ
ID NO: 9) P53 2, 3 L: NN NN HD NI HD HD HD AGCTCGCCACCCCCGCCGGGCAC
NN NG NN NG HD HD NN CCGTGTCCGCGCCATGGCCATCT HD NN HD (SEQ ID NO:
10) AAGCTTAAAGAAGTCAGAGTACA R: HD NI NG NN NG NI HD
TGCCCGAGGTGGTGAGGCGCT NG HD NG NN NI HD NG (SEQ ID NO: 30) NG(SEQ
ID NO: 11) KISSR 3 L: NN HD NG HD NG NI HD GTGCTGCGTGCCCTTTACTGCTCT
NG HD NG NI HD HD HD HD ACTCTACCCCCTACCAGCCTAAG (SEQ ID NO: 12)
CTTGTGCTGGGCGACTTCATGTG R: NN HD NI HD NI NG NN NI
CAAGTTCCTCAACTACATCC NI NN NG HD NN HD HD HD (SEQ ID NO: 31) NI
(SEQ ID NO: 13) EIF4GI 3, 7 L: HD HD NN NG HD HD NG
CCCAGACTTCACTCCGTCCTTTGC NG NG NN HD HD NI NI HD
CGACTTCGGCCGACCAGCCCTTA HD NG NG (SEQ ID NO: 14)
GCAACCGTGGGCCCCCAAGGGGT R: NG NN NN NN NN NN HD
GGGCCAGGTGGGGAGCTGCC HD HD NI HD NN NN NG NG (SEQ ID NO: 32) NN HD
NG (SEQ ID NO: 15) LDLR 3 L: HD NG HD HD NG NI HD
CCGAGACGGGAAATGCACCTCCT NI NI NN NG NN NN NI NG
ACAAGTGGATTTGTGATGGATCC NG NG (SEQ ID NO: 16)
GAACACCGAGTGCAAGGACGGG R: HD NN NN NI HD HD HD
TCCGCTGAGTCCCTGGAGACGT NN NG HD HD NG NG NN HD (SEQ ID NO: 33) NI
HD NG (SEQ ID NO: 17) DMD 3 L: NN NN NI HD NG NN NI
AAAGTGGCCTGGCCCAACCCCTG HD HD NI HD NG NI NG NG
GACTGACCACTCGAGTATTGAAG (SEQ ID NO: 18) CACGTAAGTATGCTGGACCACAT R:
NI NN NI NN NI NI NG NN TCTCTATGGCTGTAGACATTC NG NN NN NG HD HD NI
NN (SEQ ID NO: 34) HD (SEQ ID NO: 19) NKX2-5 6 L: HD NN HD NI NN NN
HD CTCTTTTCGCAGGCACAGGTCTA NI HD NI NN NN NG HD NG
CGAGCTGGAGCGACGCTTCTAAG NI HD (SEQ ID NO: 20)
CTTGCAGCAGCGGTACCTGTCGG R: NI HD HD NN HD NG NN
CTCCCGAGCGTGACCAGTTGG HD NG NN HD NG NG NN NI (SEQ ID NO: 35) (SEQ
ID NO: 21) MESP1 6 L: NN HD NN NN NG NG NN TGCGGTTGCTCCCCCGCCTCGTCC
HD NG HD HD HD HD HD NN CCGTAAGCTTGACTCCTGGTGCA HD HD (SEQ ID NO:
22) GCGCCCCGGCCAG R: NN NN HD HD NN NN NN (SEQ ID NO: 36) NN HD NN
HD NG NN HD NI HD HD (SEQ ID NO: 23) GATA4 6 L: NI NG NN NG NG NG
NN AACCCTGTGTCGTTTCCCACCCA NI NG NN NI HD NG NG HD
GTAGATATGTTTGATGACTAAGC (SEQ ID NO: 24) TTCTCGGAAGGCAGAGAGTGTGT R:
NN NN HD HD HD HD NN CAACTGCGGGGCCATGTCCAC HD NI NN NG NG NN NI HD
(SEQ ID NO: 37) NI HD (SEQ ID NO: 25) P65 7 Cas9/CRISPR, sgRNA:
GCTCCCACTCCCCTGGGGGCCTC CGTCACCAACGGTCTCCTC TGGGCTCACCAACGGTCTCCTCC
TCGG (SEQ ID NO: 26) CGGGGGACGAAGACTTCTCCTCC ATTGCGGACATGGACTTCTCA
(SEQ ID NO: 38)
Example 1
Multiplex Gene Editing
[0126] Six conditions of TALEN mRNA and HDR templates directed to
pig RAG2 and IL2R.gamma. were co-transfected into pig fibroblasts.
A fixed quantity of RAG2 mRNA and template were used for each
transfection whereas the quantity of IL2Rg TALEN mRNA and HDR
template is altered for each condition as indicated. The dosage of
TALEN mRNA and HDR template has both on and off target effects. An
increase in TALEN mRNA for IL2R yled to an increase in both NHEJ
and HDR for IL2R.gamma. while NHEJ levels for RAG2 were unchanged.
An increase in IL2R.gamma. HDR template reduced HDR at the RAG2
locus suggesting a nonspecific inhibition of homology directed
repair by escalation of the concentration of oligonucleotide.
Colonies with bi-allelic HDR at RAG2 and IL2R.gamma. were obtained
at four and two percent from two conditions (FIG. 3 panel, c, panel
d) which is at and above the expected frequency of two percent. The
expected frequency is calculated by multiplication of day 3 HDR
levels which treats each HDR allele as an independent event.
Referring to FIG. 3, Multiplex gene editing of swine RAG2 and
IL2Rya) SURVEYOR and RFLP analysis to determine the efficiency of
non-homologous end joining (NHEJ) and homology depended repair HDR
on cell populations 3 days post transfection. b) RFLP analysis for
homology dependent repair on cell populations 11 days post
transfection. c) Percentage of colonies positive for HDR at
IL2R.gamma. RAG2 or both. Cells were plated from the population
indicated by a "C" in panel a. Distribution of colony genotypes is
shown below. d) Colony analysis from cells transfected with TALEN
mRNA quantities of 2 and 1 .mu.g for IL2R rand RAG2 and HDR
template at 1 .mu.M for each. Distribution of colony genotypes is
shown below.
Example 2
Multiplex Gene Editing
[0127] Four conditions of TALEN mRNA and HDR templates directed to
pig APC and p53 were co-transfected into pig fibroblasts. The
quantity of APC mRNA was sequentially reduced from left to right
(FIG. 4 panel b); the remaining of the quantities remained constant
as indicated. Percent HDR reduced in a linear manor with reduction
of APC mRNA. There was little effect on p53 HDR with altered dosage
of APC TALENs. Genotyping of colonies revealed a higher than
expected union of clones with HDR allele in both APC and p53
relative to the day 11 values; 18 and 20 percent versus 13.7 and
7.1 percent for FIG. 4 panel c and FIG. 4 panel d, respectively.
Referring to FIG. 4 Multiplex gene editing of swine APC and p53.
Panel a) Surveyor and RFLP analysis to determine the efficiency of
non-homologous end joining (NHEJ) and homology depended repair HDR
on cell populations 3 days post transfection. Panel b) RFLP
analysis for homology dependent repair on cell populations 11 days
post transfection. Panels c) and d). Percentage of colonies
positive derived from the indicated cell population (indicated in
panel a, "C" and "D") for HDR at APC, p53 or both. Colonies with 3
or more HDR alleles are listed below.
Example 3
Multiplex with at Least Three Genes
[0128] In Example 1, a non-specific reduction in HDR was observed
at high concentration of HDR oligo, thus it was unknown whether
2+HDR oligos could be effective without non-specific inhibition of
HDR. Two concentrations were tested, 1 uM and 2 uM for each target
site. While TALEN activity was not significantly altered between
the two conditions, HDR was blunted significantly at 2 uM
concentration for each template. Clones derived from the 1 uM
condition had a variety of genotypes, some of those with edits in
each gene and up to 7 alleles (FIG. 6). If treated as independent
events, the expected frequency of the genotype denoted by an "a",
with 7 alleles edited, is 0.001 percent. Binomial distribution
predicts the likelihood of identifying 2+colonies of such a
genotype in a sample size of 72, as was done here, is less than
0.000026 percent.
[0129] This high rate of success could not be predicted and is
unexpected and surprising. This result was replicated with two
addition combinations of TALENs/HDR template (FIGS. 7 and 8). As
with the results the first trial, colonies were obtained with HDR
edits in up to seven alleles and up to four genes (Table A).
Several genotypes were recovered at a frequency far greater than
anticipated by chance. Although a concern regarding simultaneous
double strand break at several loci is induction of unintended
chromosomal rearrangements, 50 of 50 karyotypes tested from trial 3
cells were normal (data not shown).
[0130] Referring to FIG. 5: Effect of Oligonucleotide HDR template
concentration on 5-gene multiplex HDR efficiency. Indicated amounts
of TALEN mRNA directed to swine RAG2, IL2Rg, p53, APC and LDLR were
co-transfected into pig fibroblasts along with 2 uM (panel a) or 1
uM (panel b) of each cognate HDR template. Percent NHEJ and HDR
were measured by Surveyor and RFLP assay. Referring to FIG. 6:
Colony genotypes from 5-gene multiplex HDR. Colony genotypes were
evaluated by RFLP analysis. Panel a) Each line represents the
genotype of one colony at each specified locus. Three genotypes
could be identified; those with the expected RFLP genotype of
heterozygous or homozygous HDR as well as those with an RFLP
positive fragment, plus a second allele that has a visible shift in
size indicative of an insertion or deletion (indel) allele. The
percentage of colonies with an edit at the specified locus is
indicated below each column. Panel b) A tally of the number of
colonies edited at 0-5 loci. Referring to FIG. 7: Colony genotypes
of a second 5-gene multiplex trial. Panel a) Each line represents
the genotype of one colony at each specified locus. Three genotypes
could be identified; those with the expected RFLP genotype of
heterozygous or homozygous HDR as well as those with an RFLP
positive fragment, plus a second allele that has a visible shift in
size indicative of an insertion or deletion (indel) allele. The
percentage of colonies with an edit at the specified locus is
indicated below each column. Panel b) A tally of the number of
colonies edited at 0-5 loci. Referring to FIG. 8: Colony genotypes
a third 5-gene multiplex trial. Panel a) Each line represents the
genotype of one colony at each specified locus. Three genotypes
could be identified; those with the expected RFLP genotype of
heterozygous or homozygous HDR as well as those with an RFLP
positive fragment, plus a second allele that has a visible shift in
size indicative of an insertion or deletion (indel) allele. The
percentage of colonies with an edit at the specified locus is
indicated below each column. Panel b) A tally of the number of
colonies edited at 0-5 loci.
Examples 4A-4DD
[0131] Example 4A: Develop RAG2/IL2Rg null (RG-KO) pig fibroblasts
by multiplex gene editing.
[0132] Male pig fetal fibroblasts will be transfected with TALENs
and oligonucleotide templates for disruption of RAG2 and IL2Rg
using the inventors' previously defined methods (Tan, W., et al.,
Efficient nonmeiotic allele introgression in livestock using custom
endonucleases. PNAS, 110(41):16526-16531, 2013.) RG-KO candidates
will be identified by, e.g., restriction length polymorphism (RFLP)
as confirmed by sequencing. At least about 5 validated RG-KO
colonies will be pooled as a resource for cloning and chimera
production.
Example 4B
Production of Chimeric Embryos using RG-KO Host Blastocysts.
[0133] Host RG-KO embryos and female EGFP-labeled donor cells will
be produced using chromatin transfer technology followed by in
vitro culture to the blastocyst stage. RG-KO cells from Example 1
may be used. Day-7 inter cell mass clumps from EGFP blastocysts
will be injected into day-6 RG-KO embryos prior to embryo transfer
to a synchronized sow. Using this approach, Nagashima and
colleagues observed chimerism in >50 percent of liveborn
piglets
[0134] (Nagashima H. et al., Sex differentiation and germ cell
production in chimeric pigs produced by inner cell mass injection
into blastocysts. Biol Reprod, 70(3):702-707, 2004). The male
phenotype is dominant in injection chimeras for both mice and pigs.
Therefore, XY RG-KO hosts injected with female donor cells will
exclusively transmit male host genetics. Pregnancy checks will be
conducted at appropriate times, e.g., days 25, 50, and 100.
Pregnant sows at about 100 days of gestation will be monitored 4
times daily prior to C-section derivation of piglets by about day
114.
Example 4C
Determine if Non-Chimeric Offspring are Deficient for T, B and NK
Cells
[0135] Non-chimeric offspring will be tested to determine if they
deficient for T, B and NK cells. The following process is one
technique for the same. C-section derivation will be conducted on
each sow carrying presumptive chimeras and one bred sow carrying
wild-type piglets. Umbilical cord blood will be isolated from each
piglet immediately after C-section derivation. Cord blood
leukocytes will be evaluated by fluorescence-activated cell sorting
(FACS) for T, B and NK cell populations as well as donor derived
EGFP expression. In addition, chimerism will be evaluated by PCR
from cord blood, ear and tail biopsy. This initial analysis will be
completed within 6 hours of birth, such that non-chimeric piglets
can be monitored closely and humanely euthanized with signs of
infection. A portion of non-chimeric animals, or those lacking
immune cells, will be euthanized for necropsy.
Example 4D
Identify Chimeric Pigs and Determine Origin of T, B and NK
Cells
[0136] Chimeric pigs will be tested to determine origin of T, B and
NK cells. The following process is one technique for the same.
Chimeric piglets will be identified using the methods above. Weekly
evaluation of circulating lymphocytes and serum immunoglobulin will
be compared between chimeric, non-chimeric and wild-type piglets
over a 2 month period. Populations of sorted T, B and NK cells will
be evaluated for EGFP expression and microsatellite analysis to
confirm donor origin. The maintenance of samples and semen
collections from chimeric pigs will be supported by RCI until Phase
II funding is available.
Sample Procedures for Examples A-D:
Cord and Peripheral Blood FACS.
[0137] Evaluation of blood lymphocytes and EGFP chimerism will be
performed as previously described (2) with adaptations for porcine
specimens. Cord blood will be collected from each piglet
immediately after C-section delivery. A portion of the cord blood
will be processed and cryopreserved for potential allograft
treatments while the remainder will be used for FACS analysis of
lymphocytes. Peripheral blood samples will be collected at 2, 4, 6
and 8 weeks of age by standard methods. RBCs will be removed and
approximately 1-2E+5 cells will be distributed into tubes. Aliquots
will be labeled with anti-pig antibodies for identification of T
cells (CD4 and CD8), B cells (CD45RA ad CD3), NK cells (CD16 and
CD3) and myeloid cells (CD3). Antigen expression will be quantified
on the LS RII Flow Cytometer (BD Biosciences). Fluorophores will be
carefully selected to enable multiplex evaluation of donor derived
EGFP cells along with surface antigens. Single cell suspensions
from the spleen will be analyzed by the same methods.
Examinations
[0138] All major organs and tissues will be grossly examined for
appropriate anatomic development and appropriate samples from all
major organs and tissues including pancreas, liver, heart, kidneys,
lungs, gastrointestinal, immune system (peripheral and mucosal
lymph nodes and spleen), and CNS will be collected for DNA
isolation. Single cell suspensions will be prepared from the spleen
for FACS analysis. Tissues will be prepared for histological
examination to further assess chimerism and for any alterations
that may be associated with the chimeric state and for the presence
of any underlying illness.
Assessment of Chimerism.
[0139] Quantitative PCR will be conducted on cord blood, ear, and
tail biopsy using primers specific to the EGFP transgene and
compared to a standard curve with known ratios of EGFP to wild
type-cells. Specimens will also be evaluated for RG-KO alleles via
the RFLP assay previously described. Engraftment of EGFP+cells will
be evaluated macroscopically on whole animals and organs during
necropsy. Tissues from the major organs will be sectioned for EGFP
immunohistochemistry and counterstained with DAPI (4',
6-diamidino-2-phenylindole) to determine the ratio of donor to host
cells.
Microsatellite Analysis.
[0140] Animals will be screened for informative microsatellites for
host and donor genetics from those routinely used in our lab.
Samples from tissues and blood (sorted lymphocytes or myeloid
lineages, EGFP positive and negative) will be evaluated. Relative
quantities of donor versus host cells will be evaluated by
multiplexed amplicon sequencing on the MISEQ instrument
(Illumina).
Animals
[0141] Non-chimeric pigs will be made having an absence of T, B and
NK cells in cord and peripheral blood. Chimeric pigs will have
levels substantially similar to nearly wild-type levels. Moreover,
T, B and NK cell positive chimeras will have substantially normal
immune functions and remain healthy when reared in standard
conditions.
Example 5
CRISPR/Cas9 Design and Production
[0142] Gene specific gRNA sequences were cloned into the Church lab
gRNA vector (Addgene ID: 41824) according their methods. The Cas9
nuclease was provided either by co-transfection of the hCas9
plasmid (Addgene ID: 41815) or mRNA synthesized from
RCIScript-hCas9. This RCIScript-hCas9 was constructed by
sub-cloning the XbaI-AgeI fragment from the hCas9 plasmid
(encompassing the hCas9 cDNA) into the RCIScript plasmid. Synthesis
of mRNA was conducted as above except that linearization was
performed using KpnI.
Example 6
Multiplex Gene Editing with Targeted Endonucleases and HDR
[0143] Panel (a) is a schematic of each gene in the multiplex
experiment (depicted as a cDNA-exons denoted by alternating shades)
and the site targeted by TALENS is indicated. The sequence coding
the DNA binding domain for each gene is indicated below. Swine
fibroblasts were co-transfected with 1 ug of each TALEN mRNA and
0.1 nMol of each HDR oligo (FIG. 12 panel b), targeting each gene,
designed to insert a premature termination codon as well as a novel
HindIII RFLP site for genotyping. A total of 384 colonies were
isolated for genotyping. The GATA4 and Nkx2-5 RFLP assays were
performed (FIG. 12 panel c) and MESP1 was evaluated by sequencing
(not shown). Two colonies (2/384, 0.52%) were homozygous HDR
knockouts for all three genes. The triple knockouts are labeled
with asterisks (FIG. 12 panel c). Additional genotypes can be
observed in panel c, example colony 49 with no HDR edits; colony 52
and 63 with heterozygous edits to NKX2-5; colony 59 with
heterozygous edits to both NKX2-5 and GATA4 and so on.
Example 7
Multiplex Gene-Editing using a Combination of TALENs and RGENs
[0144] See FIG. 13. Swine fibroblasts were co-transfected with
TALENS (1 ug EIF4G 14.1 mRNA)+Cas9/CRISPR components (2 ug Cas9
mRNA+2 ug p65 G1s guide RNA) and 02 nMol of HDR oligo for each
gene. Transfected cells were evaluated by RFLP assay revealing HDR
at both sites. Cells from this population will be plated for colony
isolation and isolates with edits in both genes are identified.
FURTHER DISCLOSURE
[0145] Patents, patent applications, publications, and articles
mentioned herein are hereby incorporated by reference; in the case
of conflict, the instant specification is controlling. The
embodiments have various features; these features may be mixed and
matched as guided by the need to make a functional embodiment. The
headings and subheadings are provided for convenience but are not
substantive and do not limit the scope of what is described. The
following numbered statements present embodiments of the invention:
[0146] 1A. A method of making genetic edits in a vertebrate cell or
embryo at a plurality of target chromosomal DNA sites comprising
introducing into a vertebrate cell or embryo:
[0147] a first targeted endonuclease directed to a first target
chromosomal DNA site and a [0148] first homology directed repair
(HDR) template homologous to the first target site sequence; and a
second targeted endonuclease directed to a second target
chromosomal DNA site [0149] and a second HDR template homologous to
the second target site sequence, [0150] with the first HDR template
sequence replacing the native chromosomal DNA sequence at the first
target site and the second HDR template sequence replacing the
native chromosomal DNA sequence at the second target site sequence.
[0151] 1B. A method of editing a plurality of alleles of an animal,
comprising
[0152] introducing, into a primary livestock cell or livestock
embryo, a plurality of targeted nucleases that each target a
different allele locus and a homology directed repair template for
each targeted allele locus,
[0153] with the targeted endonucleases making double stranded
breaks in the allele loci cognate to each of the plurality of
targeted endonucleases and with the cell copying the homology
directed repair (HDR) template nucleic acid sequence into the loci
cognate to each HDR template to thereby edit the allele. [0154] 2.
The method of any of 1 further comprising
[0155] introducing into the cell or embryo one or more of:
[0156] a third, fourth, fifth, sixth, and seventh targeted
endonuclease directed to a third, fourth, fifth, sixth, and seventh
target chromosomal DNA site, respectively, and
[0157] a third, fourth, fifth, sixth, and seventh HDR template
homologous to the third, fourth, fifth, sixth, and seventh target
chromosomal DNA sites, respectively. [0158] 3. The method of any of
1-2 wherein the targeted endonuclease comprises a TALENs. [0159] 4.
The method of any of 1-3 wherein the targeted endonuclease
comprises a zinc finger nuclease or a Cas9. [0160] 5. The method of
any of 1-4 wherein at least the first target chromosomal DNA site
is a locus for an allele. [0161] 6. The method of 5 wherein at
least one of said HDR templates encodes a knockout of the DNA
target site cognate to the template. [0162] 7. The method of 5
wherein at least one of said HDR templates encodes an exogenous
allele for replacement of an allele at the DNA target site cognate
to the template. [0163] 8. The method of 1 with the cell or embryo
being a first species or a first breed of livestock, and a
plurality of the edits comprise a replacement of a native allele
with an exogenous allele from a second species or a second breed of
animal. [0164] 9. The method of 1 with the animal being a first
breed of animal that has at least three native alleles replaced
with corresponding exogenous alleles of a second breed or another
species, said exogenous alleles being a replacement of the
corresponding native allele without meiotic recombination, wherein
the animal is free of exogenous marker genes. [0165] 10. The method
of 2 wherein at least three, four, five, six, or seven target
chromosomal DNA sites are each a locus for a different allele.
[0166] 11. The method of 10 wherein one or more of the HDR
templates encodes a knockout of the DNA target site cognate to the
template. [0167] 12. The method of 10 wherein at least one of said
HDR templates encodes an exogenous allele for replacement of an
allele at the DNA target site cognate to the template. [0168] 13.
The method of any of 1-12 wherein the cell or embryo is homozygous
for a plurality of gene edits at the target DNA sites, said edits
being encoded by HDR templates cognate to said target DNA sites.
[0169] 14. The method of any of 1-12 wherein the cell or embryo is
heterozygous for a plurality of gene edits at the target DNA sites
said edits being encoded by HDR templates cognate to said target
DNA sites. [0170] 15. The method of any of 11-14 wherein the gene
edits comprise a knockout or an introgression of an allele from
another breed of animal or another species of animal. [0171] 16.
The method of any of 11-14 with the cell or embryo being a first
species or a first breed of livestock, and a plurality of the edits
comprise a replacement of a native allele with an exogenous allele
from a second species or a second breed of animal. [0172] 17. The
method of 16, with DNA sequences of the exogenous allele and the
native allele differing at one or more positions, wherein
replacement of the native allele with the exogenous allele makes a
chromosomal DNA sequence of the cell or embryo identical to the
second breed of animal or second species for a distance of at least
200 basepairs (bp) on each side of any of said positions, as
measured by an alignment across said positions. [0173] 18. The
method of 17 with the distance being a number between 200 and 2000
bp. [0174] 19. The method of any of 1-17 wherein the cell or embryo
is homozygous for a plurality of gene edits at the target DNA
sites, said edits being encoded by HDR templates cognate to said
target DNA sites. [0175] 20. The method of any of 1-17 wherein the
cell or embryo is heterozygous for a plurality of gene edits at the
target DNA sites said edits being encoded by HDR templates cognate
to said target DNA sites. [0176] 21. The method of any of 1-20 with
the cell or embryo being selected from the group consisting of
large vertebrate, livestock, simian, dog, cat, avian, bird, fish,
rabbit, pig, cattle, buffalo, goat, sheep, and artiodactyl. [0177]
22. The method of any of 1-21 with the cell being selected from the
group consisting of zygote, stem cell, adult stem cell, pluripotent
cell, progenitor cell, and primary cell. [0178] 23. The method of
any of 1-21 with the embryo being zygote, blastocyst, morula, or
having a number of cells from 1-200. [0179] 24. The method of any
of 1-23 comprising introducing mRNAs that encode one or more of the
endonucleases and/or one or more of the HDR templates. [0180] 25.
The method of any of 1-24 wherein one or more of the endonucleases
are introduced into the cell or embryo as a protein. [0181] 26. The
method of any of 1-25 wherein
[0182] of one or more (e.g., each of) of the endonucleases are
provided as mRNAs and are introduced into the cell or embryo from a
solution having a concentration from 0.1 ng/ml to 100 ng/ml;
artisans will immediately appreciate that all values and ranges
within the expressly stated limits are contemplated, e.g., about
20, from about 1 to about 20, from about 0.5 to about 50, and so
forth; and/or
[0183] of one or more (e.g., each of) of the HDR templates are
provided as mRNAs and are introduced into the cell or embryo from a
solution having a concentration from about 0.2 .mu.M to about 20
.mu.M. [0184] 27. The method of any of 1-26 comprising
electroporation for introduction of an endonuclease and/or HDR
template. [0185] 28. The method of any of 1-27 wherein the
endonuclease and/or HDR are introduced by a process selected from
the group consisting of chemical-based methods, non-chemical
methods, particle-based methods, and viral methods. [0186] 29. The
method of any of 13-28 comprising introducing one or more vectors
into the cell or embryo to express the endonucleases and/or the HDR
templates. [0187] 30. The method of any of 1-29 wherein the
targeted endonucleases are TALENs, or CRISPR, or a combination of
TALENs and CRISPR. [0188] 31. The method of 30 wherein the edits
are gene knockouts. [0189] 32. The method of any of 1-31 wherein
one or more of the target site sequences are chosen from the
following list, or wherein one or more of the exogenous alleles or
the native alleles are chosen from the following list: IL2Rgy/-,
RAG2-/-, IL2Rg.sup.-/-; RAG2.sup.-/-, IL2Rgy/-, RAG2-/-, IL2Rg+/-,
RAG2+/-, IL2Rg.sup.y/+, RAG2.sup.+/-, IL2R.sup.+/-; RAG2.sup.+/-,
DGAT (diglyceride acyltransferase), ABCG2 (ATP-binding cassette
sub-family G member 2), ACAN (aggrecan), AMELY (amelogenin,
y-linked), BLG (progestagen-associated endometrial protein), BMP 1B
(FecB) (bone morphogenetic protein receptor, type 1B), DAZL
(deleted in azoospermia like), Eif4GI (eukaryotic translation
initiation factor 4 gamma, 1), GDF8 (growth/differentiation factor
8), Horn-poll locus, IGF2 (insulin-like growth factor 2), CWC15
(CWC15 spliceosome associated protein), KissR/GRP54 (kisspeptin),
OFD1Y (Y-linked oral-facial-digital syndrome 1 pseudogene), p65
(v-rel reticuloendotheliosis viral oncogene homolog A), PRLR
(prolactin receptor), Prmd14 (PR domain containtin 14), PRNP (prion
protein), Rosa, Socs2 (suppressor of cytokine signaling 2), SRY
(sex determining region of Chr Y), ZFY (zinc finger protein,
y-linked), .beta.-lactoglobulin, callipyg (CLPG), MODY 1
(HNF4.alpha.) (hepatocyte nuclear factor 4, alpha), MODY 2 (GCK)
(glucokinase), MODY 3 (HNF1.alpha.) (hepatocyte nuclear factor 4,
alpha), MODY 4 (Pdxl) (pancreatic and duodenal homeobox 1), MODY 5
(HNF-1.beta.) (HNF1 homeobox B), MODY 6 (eurogenic differentiation
1), MODY 7 (KLF11) (Kruppel-like factor 11), MODY 8 (CEL) (carboxyl
ester lipase), MODY 9 (PAX4) (paired box 4), MODY 10 (INS)
(insulin), MODY 11 (BLK) (BLK proto-oncogene, Src family tyrosine
kinase), APC (adenomatosis polyposis coli), ApoE (apolipoprotein
E), DMD (dystrophin muscular dystrophy), GHRHR (growth hormone
releasing hormone receptor), HR (hair growth associated), HSD11B2
(hydroxysteroid (11-beta) dehydrogenase 2), LDLR (low density
lipoprotein receptor), NF1 (neurofibromin 1), NPPA (natriuretic
peptide A), NR3C2 (nuclear receptor subfamily 3, group C, member
2), p53 (cellular tumor antigen p53-like), PKD1 (polycystic kidney
disase 1), Rbm20 (RNA binding motif protein 20), SCNN1G (sodium
channel, non-voltage gated 1 gamma subunit), tP53 (tumor protein
p53), FAH (fumarylacetoacetate hydrolase), HBB (hemoglobin beta),
IL2RG (interleukin 2 receptor, gamma chain), PDX1 (pancreatic and
duodenal homeobox 1), PITX3 (paired-like homeodomain transcription
factor 3), Runx1 (runt-related transcription factor 1), GGTA
(bifunctional cephalosporin acylase/gamma-glutamyltranspetidase),
VASA (vasa protein), MIWI (piwi-like RNA-mediated gene silencing
1), PIWI (CG6122 gene product from transcript CG6122-RA), DCAF17
(DDB1 and CUL4 associated factor 17), VDR (vitamin D receptor),
PNPLA1 (patatin-like phospholipase domain containing 1), HRAS
(Harvey rat sarcoma viral oncogene homolog), Telomerase-vert, DSP
(desmoplakin), SNRPE (small nuclear ribonucleoprotein polypeptide
E), RPL21 (ribosomal protein), LAMA3 (laminin, alpha 3), UROD
(uroporphyrinogen decarboxylase), EDAR (ectodysplasin-A receptor),
OFD1 (oral-facial-digital syndrome 1), PEX7 (peroxisomal biogenesis
factor 7), COL3A1 (collagen, type III, alpha 1), ALOX12B
(arachidonate 1201ipoxygenase 12R type), HLCS (holocarboxylase
synthetase (biotin-(proprionyl-CoA-carboxylase)ATP-hydrolysing))
ligase)), NIPAL4 (NIPA-like domain containing 4), CERS3 (ceramide
synthase 3), ANTXR1 (anthrax toxin receptor 1), B3GALT6
(UDP-Gal:betaGA1 beta 1,3 galactosyltransferase polypeptide 6),
DSG4 (desmoglein 4), UBR1 (ubiquitin protein ligase E3 component
n-recognin 1), CTC1 (CTS telomere maintenance complex component 1),
MBTPS2 (membrane-bound transcription factor peptidase, site 2),
UROS (uroporphyrinogen III synthase), ABHD5 (abhydrolase domain
containing 5), NOP10 (NOP10 ribonucleoprotein), ALMS1 (Alstrom
syndrome protein 1), LAMB3 (laminin, beta 3), EOGT (EGF
domain-specific 0-linked N-acetylglucosamine (G1cNAc)), SAT1
(spermindine/spermine N1-acetyltransferase 1), RBPJ (recombination
signal binding protein for immunoglobulin kappa J region), ARHGAP31
(Rho GTPase activating protein 31), ACVR1 (activin A receptor, type
I), IKBKG (inhibitor of kappa light polypeptide gene enhancer in
B-cells, kinase gamma), LPAR6 (lysophosphatidic acid receptor 6),
HR (hair growth associated), ATR (ATR serine/threonine kinase),
HTRA1 (HtrA serine peptidase 1), AIRE (autoimmune regulator), BCS1L
(BC1 (ubiquinol-cytochrome c reductase) synthesis-like), MCCC2
(methylcrotonoyl-CoA carboxylase 2 (beta)), DKC1 (dyskeratosis
congenital 1, dyskerin), PORCN (porcupine homolog), EBP (emopamil
binding protein (sterol isomerase)), SLITRK1 (SLIT and NTRK-like
family, member 1), BTK (Bruton agammaglobulinemia tyrosine kinase),
DOCK6 (dedicator of cytokinesis 6), APCDD1 (adenomatosis polyposis
coli down-regulated 1), ZIP4 (zinc transporter 4 precursor), CASR
(calcium-sensing receptor), TERT (telomerase reverse
transcriptase), EDARADD (EDAR (ectodysplasin-A receptor)-associated
death domain), ATP6V0A2 (ATPase, H+transporting, lysosomal VO
subunit a2), PVRL1 (poliovirus receptor-related 1 (herpesvirus
entry mediator C)), MGP (matrix Gla protein), KRT85 (keratin 85,
type II), RAG2 (recombination activating gene 2), RAG-1
(recombination activating gene 1), ROR2 (receptor tyrosine
kinase-like orphan receptor 2), CLAUDIN1 (claudin 7), ABCAl2
(ATP-binding cassette, subfamily A (ABC1), member 12), SLA-DRA1
(MHC class II DR-alpha), B4GALT7 (xylosylprotein beta
1,4-galactosyltransferase, polypeptide 7), COL7A1 (collagen type
VII, alpha 1), NHP2 (NHP2 ribonucleoprotein), GNA1 1 (guanine
nucleotide binding protein (g protein), alpha 11 (Gq class)), WNT5A
(wingless-typ MMTV integration site family member 5A), USB1 (U6
snRNA biogenesis 1), LMNA (lamin A/C), EPS8L3 (EPS8-like 3), NSDHL
(NAD(P) dependent steroid dehydrogenase-like), TRPV3 (transient
receptor potential cation channel subfamily V, member 3), KRAS
(Kirsten rat sarcoma viral oncogene homolog), TINF2
(TERF1-interacting nuclear factor 2), TGM1 (tranglutaminase 1),
DCLRE1C (DNA cross-link repair 1C), PKP1 (plakophilin 1), WRAP53
(WD repeat containing antisense to TP53), KDM5C (lysine (k)
specific demethylase 5C), ECM1 (extracellular matrix protein 1),
TP63 (tumor protein p63), KRT14 (keratin 14), RIPK4
(receptor-interacting serine-threonine kinase 4), PRKDC (protein
kinase, DNA activated, catalytic polypeptide), BCL11a (B-cell
CLL/lymphoma 11A (zinc finger protein)), BMI1 (BMI1 proto-oncogene,
polycomb ring finger), CCR5 (chemokine (C-C motif) receptor 5
(gene/pseudogene)), CXCR4 (chemokine (C-X-C motif) receptor 4),
DKK1 (dickkopf WNT signaling pathway inhibitor 1), ETV2 (ets
variant 2), FLI1 (Fli-1 proto-oncogene, ETS transcription factor),
FLK1 (kinase insert domain receptor), GATA2 (GATA binding protein
2), GATA4 (GATA binding protein 4), HHEX (hematopoietically
expressed homeobox), KIT (kit oncogene), LMX1A (LIM homeobox
transcription factor 1 alpha), MYF5 (myogenic factor 5), MYOD1
(myogenic differentiation 1), MYOG (myogenin), NKX2-5 (NK2 homeobox
5), NR4A2 (nuclear receptor subfamily 4, group A, member 2), PAX3
(paired box 3), PDX1 (pancreatic and duodenal homeobox 1), PITX3
(paired-like homeodomain transcription factor 3), Runx1
(runt-related transcription factor 1), RAG2 (recombination
activating gene 2), GGTA (bifunctional cephalosporin
acylase/gamma-glutamyhtranspeptidase), HANDII (heart-and neural
crest derivative expressed protein 2), TBX5 (T-box 5), ETV2 (ets
variant 2), PDX1 (pancreatic and duodenal homeobox 1), TBX4 (T-box
4), ID2 (inhibitor of DNA binding 2), SOX2 (SRY (sex determining
region Y)-box 2), TTF1/NKX2-1 (NK2 homeobox 1), MESP1 (mesoderm
posterior 1), NKX2-5 (HK2 homeobox 5), FAH (fumarylacetoacetate
hydrolase), PRKDC (protein kinase, DNA activated, catalytic
polypeptide), RUNX1 (runt related transcription factor 1), FLI1
(fli-1 proto-oncogene, ETS transcription factor), PITX3
(paired-like homeodomain transcription factor 3), LMX1A (LIM
homeobox transcription factor 1 alpha), DKK1 (dickkopf WNT
signaling pathway inhibitor 1), NR4A2/NURR1 (nuclear receptor
subfamily 4, group A, member 2), FLK1 (kinase insert domain
receptor), HHEX1 (hematopoietically-expressed homeobox protein
HHEX), BCL11A (B-cell CLL/lymphoma 11A (zinc finger protein), RAG2
(recombination activating gene 2), RAG1 (recombination activating
gene 1), IL2RG (interleukin 2 receptor, gamma chain), c-KIT/SCFR
(v-kit hardy-Zuckerman 4 feline sarcoma viral oncogene homolog),
BMI1 (BMI1 proto-oncogene polycomb ring finger), TBX5 (T-box 5),
OLIG1 (oligodendrocyte transcription factor 1), OLIG2
(oligodendrocyte transcription factor 2), heterozygotes thereof,
homozygotes therefore, and combinations thereof. [0190] 33. A
method of making multiplex gene knockouts in a primary vertebrate
cell or embryo comprising introducing into the cell or embryo a
plurality of TALENs targeted to different target genes in a
presence of HDR templates with homology to said different target
genes. [0191] 34. A method of making an animal comprising of any of
1-33 and further comprising cloning the cell or placing the embryo
into a gestational mother. [0192] 35. An animal made by a method of
any of 1-34. [0193] 36. A chimeric embryo or animal made by the
method of any of 1-34 wherein the cell is edited and further
comprising cloning the cell, making a host embryo from the cell,
and adding a donor cell to the host embryo to form the chimeric
embryo. [0194] 37. A vertebrate embryo chimeric for host cells and
donor cells comprising
[0195] a host embryo with a plurality of host cell genetic edits at
different chromosomal DNA sites, and
[0196] a donor cell integrated with the host cells to form the
chimeric embryo. [0197] 38. A vertebrate deficiency carrier
comprising an embryo with a plurality of multiplex genetic edits at
different chromosomal DNA gene sites, the edits providing a genetic
niche for complementation by donor cells. [0198] 39. The embryo or
carrier of any of 37-38 wherein the donor cells are embryonic stem
cells, pluripotent stem cells, blastomeres, and the like from
primates, rodents, or artiodactyl. [0199] 40. The embryo of any of
37-39 wherein the host or carrier cell genetic edits comprise a
knockout of a gene or a replacement of a native allele with an
exogenous allele of another breed of vertebrate or another species
of animal. [0200] 41. The embryo of any of 37-41 wherein a number
of the host cell genetic edits is, or is at least, 2, 3, 4, 5, 6,
or 7. [0201] 42. The embryo of any of 37-41 wherein a number of
replacements of a native allele with an exogenous allele of another
breed of vertebrate or another species of animal is, or is at
least, 2, 3, 4, 5, 6, or 7. [0202] 43. The embryo of any of 37-42
wherein the embryo is free of expressible reporter genes and/or
synthetic genes and/or exogenous fluorescent proteins. [0203] 44.
The embryo of any of 37-43 wherein all of the gene edits are
bi-allelic, at least 2, 3, 4, or 5 of the edits are bi-allelic,
wherein at least 2, 3, 4, or 5 of the gene edits are mono-allelic,
or any combination thereof. [0204] 45. The embryo of any of 37-44
with the donor cell being a complement to the host cells. [0205]
46. The embryo of any of 37-45 wherein the host embryo is destined
for a failure to thrive (FTT) phenotype. [0206] 47. The embryo of
46 wherein the donor cell rescues the embryo from the FTT
phenotype. [0207] 48. The embryo of any of 37-47 wherein the donor
cell comprises one or more genetic edits. [0208] 49. The embryo of
any of 37-47 being selected from the group consisting of large
vertebrate, livestock, simian, dog, cat, avian, bird, fish, rabbit,
pig, cattle, buffalo, goat, sheep, and artiodactyl. [0209] 50. A
vertebrate animal chimeric for host cells and donor cells
comprising a plurality of host cell genetic edits at different
chromosomal DNA sites, and a donor cell integrated with the host
cells to form the chimeric animal. [0210] 51. The animal of 50
being selected from the group consisting of large vertebrate,
livestock, simian, dog, cat, avian, bird, fish, rabbit, pig,
cattle, buffalo, goat, sheep, and artiodactyl. [0211] 52. A method
of making a vertebrate embryo chimeric for host cells and donor
cells comprising:
[0212] introducing into a host vertebrate cell: [0213] a first
targeted endonuclease directed to a first target chromosomal DNA
site and a first homology directed repair (HDR) template homologous
to the first target site sequence; and [0214] a second targeted
endonuclease directed to a second target chromosomal DNA site and a
second HDR template homologous to the second target site sequence,
[0215] with the first HDR template sequence replacing the native
chromosomal DNA sequence at the first target site and the second
HDR template sequence replacing the native chromosomal DNA sequence
at the second target site sequence, [0216] cloning the cell to
develop a host embryo, and [0217] placing a donor cell in the host
embryo. [0218] 53. The method of 52 wherein the cell is a primary
cell. [0219] 54. The method of any of 52-53 being selected from the
group consisting of large vertebrate, livestock, simian, dog, cat,
avian, bird, fish, rabbit, pig, cattle, buffalo, goat, sheep, and
artiodactyl. [0220] 55. The method, cell, embryo, or animal of any
of 1-54 being free of expressible reporter genes and/or synthetic
genes and/or exogenous fluorescent proteins. [0221] 56. A chimeric
large vertebrate animal comprising host cells and donor cells, with
the host cells comprising at least one non-meiotic gene edit to a
gametogenic or spermatogenic gene that is complemented by a gene of
the donor cells, with the animal comprising gametes with a genotype
of the donor cells. [0222] 57. The animal of 56 being free of
functional gametes with a genotype of the host cells. [0223] 58. A
chimeric large vertebrate animal comprising host cells and donor
cells, with the host cells comprising at least one non-meiotic gene
edit to establish a failure to thrive (FTT) host cell genotype ,
with the FTT genotype being complemented by the donor cells. [0224]
59. The animal of 58 wherein the host cells comprise a plurality of
non-meiotic gene edits that establish a failure to thrive (FTT)
host cell genotype. [0225] 60. The animal of any of 58 or 59
wherein the FTT phenotype is immunodeficiency. [0226] 61. A large
vertebrate animal comprising multiplex gene edits (non-meiotic).
[0227] 62. The animal of 61 being a first breed of pig or a first
breed of cattle that has at least three native alleles replaced
with corresponding exogenous alleles of a second breed or another
species, said exogenous alleles being a replacement of the
corresponding native allele without meiotic recombination, wherein
the animal is free of exogenous marker genes. [0228] 63. The animal
of 61 or 62 comprising at least three, four, five, six, or seven of
said exogenous replacement alleles, each without meiotic
recombination. [0229] 64. The animal of any of 61-63 being selected
from the group consisting of livestock, simian, dog, cat, avian,
bird, fish, rabbit, pig, cattle, buffalo, goat, sheep, and
artiodactyl. [0230] 65. The animal any of 61-64 having a number of
edits from 3 to 25. [0231] 66. The animal of any of 61-65 being an
F0 generation with respect to the multiplex edits. [0232] 67. The
animal of any of 61-66 having a number of allele replacements from
2-25. [0233] 68. The animal of any of 61-67 having a number of KO
gene edits from 2-25. [0234] 69. The animal of 61 being a first
breed of pig or a first breed of cattle that has at least three
native alleles replaced with corresponding exogenous alleles of a
second breed or another species, said exogenous alleles being a
replacement of the corresponding native allele without meiotic
recombination, wherein the animal is free of exogenous marker
genes. [0235] 70. The animal of 69 comprising at least three, four,
five, six, or seven of said exogenous replacement alleles, each
without meiotic recombination.
Sequence CWU 1
1
38190DNAArtificial SequenceSynthetic Homology Directed Repair
Template 1ctcttttcgc aggcacaggt ctacgagctg gagcgacgct tctaagcttg
cagcagcggt 60acctgtcggc tcccgagcgt gaccagttgg 90290DNAArtificial
SequenceSynthetic Homology Directed Repair Template 2aaccctgtgt
cgtttcccac ccagtagata tgtttgatga ctaagcttct cggaaggcag 60agagtgtgtc
aactgcgggg ccatgtccac 90360DNAArtificial SequenceSynthetic Homology
Directed Repair Template 3tgcggttgct cccccgcctc gtccccgtaa
gcttgactcc tggtgcagcg ccccggccag 60436PRTArtificial
SequenceSynthetic Repeat-Variable Diresidue (RVD) Code 4His Asp His
Asp His Asp Asn Ile Asn Ile Asn Ile Asn Asn Asn Asn 1 5 10 15 Asn
Gly Asn Gly His Asp Asn Ile Asn Asn Asn Gly Asn Asn Asn Gly 20 25
30 Asn Gly Asn Gly 35 540PRTArtificial SequenceSynthetic
Repeat-Variable Diresidue (RVD) Code 5His Asp His Asp Asn Ile Asn
Ile Asn Asn Asn Gly Asn Asn His Asp 1 5 10 15 Asn Ile Asn Ile Asn
Gly Asn Gly His Asp Asn Ile Asn Gly Asn Asn 20 25 30 Asn Gly Asn
Ile His Asp Asn Gly 35 40 636PRTArtificial SequenceSynthetic
Repeat-Variable Diresidue (RVD) Code 6Asn Ile His Asp His Asp Asn
Gly Asn Gly His Asp His Asp Asn Gly 1 5 10 15 His Asp His Asp Asn
Gly His Asp Asn Gly His Asp His Asp Asn Asn 20 25 30 His Asp Asn
Gly 35 734PRTArtificial SequenceSynthetic Repeat-Variable Diresidue
(RVD) Code 7His Asp Asn Gly Asn Ile Asn Ile Asn Asn His Asp Asn Gly
Asn Asn 1 5 10 15 His Asp Asn Gly Asn Gly Asn Gly Asn Gly Asn Asn
Asn Ile Asn Ile 20 25 30 Asn Gly 836PRTArtificial SequenceSynthetic
Repeat-Variable Diresidue (RVD) Code 8Asn Asn Asn Asn Asn Ile Asn
Ile Asn Asn Asn Ile Asn Ile Asn Asn 1 5 10 15 Asn Gly Asn Ile Asn
Gly His Asp Asn Ile Asn Asn His Asp His Asp 20 25 30 Asn Ile Asn
Gly 35 932PRTArtificial SequenceSynthetic Repeat-Variable Diresidue
(RVD) Code 9Asn Asn Asn Ile His Asp His Asp His Asp Asn Ile Asn Asn
Asn Ile 1 5 10 15 Asn Ile Asn Gly Asn Gly Asn Gly His Asp Asn Gly
Asn Asn Asn Gly 20 25 30 1034PRTArtificial SequenceSynthetic
Repeat-Variable Diresidue (RVD) Code 10Asn Asn Asn Asn His Asp Asn
Ile His Asp His Asp His Asp Asn Asn 1 5 10 15 Asn Gly Asn Asn Asn
Gly His Asp His Asp Asn Asn His Asp Asn Asn 20 25 30 His Asp
1130PRTArtificial SequenceSynthetic Repeat-Variable Diresidue (RVD)
Code 11His Asp Asn Ile Asn Gly Asn Asn Asn Gly Asn Ile His Asp Asn
Gly 1 5 10 15 His Asp Asn Gly Asn Asn Asn Ile His Asp Asn Gly Asn
Gly 20 25 30 1230PRTArtificial SequenceSynthetic Repeat-Variable
Diresidue (RVD) Code 12Asn Asn His Asp Asn Gly His Asp Asn Gly Asn
Ile His Asp Asn Gly 1 5 10 15 His Asp Asn Gly Asn Ile His Asp His
Asp His Asp His Asp 20 25 30 1334PRTArtificial SequenceSynthetic
Repeat-Variable Diresidue (RVD) Code 13Asn Asn His Asp Asn Ile His
Asp Asn Ile Asn Gly Asn Asn Asn Ile 1 5 10 15 Asn Ile Asn Asn Asn
Gly His Asp Asn Asn His Asp His Asp His Asp 20 25 30 Asn Ile
1436PRTArtificial SequenceSynthetic Repeat-Variable Diresidue (RVD)
Code 14His Asp His Asp Asn Asn Asn Gly His Asp His Asp Asn Gly Asn
Gly 1 5 10 15 Asn Gly Asn Asn His Asp His Asp Asn Ile Asn Ile His
Asp His Asp 20 25 30 Asn Gly Asn Gly 35 1536PRTArtificial
SequenceSynthetic Repeat-Variable Diresidue (RVD) Code 15Asn Gly
Asn Asn Asn Asn Asn Asn Asn Asn Asn Asn His Asp His Asp 1 5 10 15
His Asp Asn Ile His Asp Asn Asn Asn Asn Asn Gly Asn Gly Asn Asn 20
25 30 His Asp Asn Gly 35 1634PRTArtificial SequenceSynthetic
Repeat-Variable Diresidue (RVD) Code 16His Asp Asn Gly His Asp His
Asp Asn Gly Asn Ile His Asp Asn Ile 1 5 10 15 Asn Ile Asn Asn Asn
Gly Asn Asn Asn Asn Asn Ile Asn Gly Asn Gly 20 25 30 Asn Gly
1736PRTArtificial SequenceSynthetic Repeat-Variable Diresidue (RVD)
Code 17His Asp Asn Asn Asn Asn Asn Ile His Asp His Asp His Asp Asn
Asn 1 5 10 15 Asn Gly His Asp His Asp Asn Gly Asn Gly Asn Asn His
Asp Asn Ile 20 25 30 His Asp Asn Gly 35 1830PRTArtificial
SequenceSynthetic Repeat-Variable Diresidue (RVD) Code 18Asn Asn
Asn Asn Asn Ile His Asp Asn Gly Asn Asn Asn Ile His Asp 1 5 10 15
His Asp Asn Ile His Asp Asn Gly Asn Ile Asn Gly Asn Gly 20 25 30
1934PRTArtificial SequenceSynthetic Repeat-Variable Diresidue (RVD)
Code 19Asn Ile Asn Asn Asn Ile Asn Asn Asn Ile Asn Ile Asn Gly Asn
Asn 1 5 10 15 Asn Gly Asn Asn Asn Asn Asn Gly His Asp His Asp Asn
Ile Asn Asn 20 25 30 His Asp 2034PRTArtificial SequenceSynthetic
Repeat-Variable Diresidue (RVD) Code 20His Asp Asn Asn His Asp Asn
Ile Asn Asn Asn Asn His Asp Asn Ile 1 5 10 15 His Asp Asn Ile Asn
Asn Asn Asn Asn Gly His Asp Asn Gly Asn Ile 20 25 30 His Asp
2130PRTArtificial SequenceSynthetic Repeat-Variable Diresidue (RVD)
Code 21Asn Ile His Asp His Asp Asn Asn His Asp Asn Gly Asn Asn His
Asp 1 5 10 15 Asn Gly Asn Asn His Asp Asn Gly Asn Gly Asn Asn Asn
Ile 20 25 30 2234PRTArtificial SequenceSynthetic Repeat-Variable
Diresidue (RVD) Code 22Asn Asn His Asp Asn Asn Asn Asn Asn Gly Asn
Gly Asn Asn His Asp 1 5 10 15 Asn Gly His Asp His Asp His Asp His
Asp His Asp Asn Asn His Asp 20 25 30 His Asp 2334PRTArtificial
SequenceSynthetic Repeat-Variable Diresidue (RVD) Code 23Asn Asn
Asn Asn His Asp His Asp Asn Asn Asn Asn Asn Asn Asn Asn 1 5 10 15
His Asp Asn Asn His Asp Asn Gly Asn Asn His Asp Asn Ile His Asp 20
25 30 His Asp 2430PRTArtificial SequenceSynthetic Repeat-Variable
Diresidue (RVD) Code 24Asn Ile Asn Gly Asn Asn Asn Gly Asn Gly Asn
Gly Asn Asn Asn Ile 1 5 10 15 Asn Gly Asn Asn Asn Ile His Asp Asn
Gly Asn Gly His Asp 20 25 30 2534PRTArtificial SequenceSynthetic
Repeat-Variable Diresidue (RVD) Code 25Asn Asn Asn Asn His Asp His
Asp His Asp His Asp Asn Asn His Asp 1 5 10 15 Asn Ile Asn Asn Asn
Gly Asn Gly Asn Asn Asn Ile His Asp Asn Ile 20 25 30 His Asp
2623PRTArtificial SequenceSynthetic Repeat-Variable Diresidue (RVD)
Code 26Cys Gly Thr Cys Ala Cys Cys Ala Ala Cys Gly Gly Thr Cys Thr
Cys 1 5 10 15 Cys Thr Cys Thr Cys Gly Gly 20 2790DNAArtificial
SequenceSynthetic Homology Directed Repair Template 27ttccactcta
ccccccccaa aggttcagtg ttttgtgtaa gcttcaatgt tgagtacatg 60aattgcactt
gggacagcag ctctgagctc 902890DNAArtificial SequenceSynthetic
Homology Directed Repair Template 28ctctaaggat tcctgccacc
ttcctcctct ccgctaccca gactaagctt tgcacattca 60aaagcagctt agggtctgaa
aaacatcagt 902990DNAArtificial SequenceSynthetic Homology Directed
Repair Template 29ccagatcgcc aaagtcacgg aagaagtatc agccattcat
ccctcccagt gaagcttaca 60gaaattctgg gtcgaccacg gagttgcact
903090DNAArtificial SequenceSynthetic Homology Directed Repair
Template 30agctcgccac ccccgccggg cacccgtgtc cgcgccatgg ccatctaagc
ttaaagaagt 60cagagtacat gcccgaggtg gtgaggcgct 903190DNAArtificial
SequenceSynthetic Homology Directed Repair Template 31gtgctgcgtg
ccctttactg ctctactcta ccccctacca gcctaagctt gtgctgggcg 60acttcatgtg
caagttcctc aactacatcc 903290DNAArtificial SequenceSynthetic
Homology Directed Repair Template 32cccagacttc actccgtcct
ttgccgactt cggccgacca gcccttagca accgtgggcc 60cccaaggggt gggccaggtg
gggagctgcc 903390DNAArtificial SequenceSynthetic Homology Directed
Repair Template 33ccgagacggg aaatgcacct cctacaagtg gatttgtgat
ggatccgaac accgagtgca 60aggacgggtc cgctgagtcc ctggagacgt
903490DNAArtificial SequenceSynthetic Homology Directed Repair
Template 34aaagtggcct ggcccaaccc ctggactgac cactcgagta ttgaagcacg
taagtatgct 60ggaccacatt ctctatggct gtagacattc 903590DNAArtificial
SequenceSynthetic Homology Directed Repair Template 35ctcttttcgc
aggcacaggt ctacgagctg gagcgacgct tctaagcttg cagcagcggt 60acctgtcggc
tcccgagcgt gaccagttgg 903660DNAArtificial SequenceSynthetic
Homology Directed Repair Template 36tgcggttgct cccccgcctc
gtccccgtaa gcttgactcc tggtgcagcg ccccggccag 603790DNAArtificial
SequenceSynthetic Homology Directed Repair Template 37aaccctgtgt
cgtttcccac ccagtagata tgtttgatga ctaagcttct cggaaggcag 60agagtgtgtc
aactgcgggg ccatgtccac 903890DNAArtificial SequenceSynthetic
Homology Directed Repair Template 38gctcccactc ccctgggggc
ctctgggctc accaacggtc tcctcccggg ggacgaagac 60ttctcctcca ttgcggacat
ggacttctca 90
* * * * *