U.S. patent application number 14/755002 was filed with the patent office on 2016-01-28 for scalable characterization of nucleic acids by parallel sequencing.
The applicant listed for this patent is Affymetrix, Inc.. Invention is credited to John D. Curry, Heather Koshinsky, Amanda Kay Lindholm-Perry, Richard Mark Thallman.
Application Number | 20160024571 14/755002 |
Document ID | / |
Family ID | 48781975 |
Filed Date | 2016-01-28 |
United States Patent
Application |
20160024571 |
Kind Code |
A1 |
Curry; John D. ; et
al. |
January 28, 2016 |
Scalable Characterization of Nucleic Acids by Parallel
Sequencing
Abstract
A method for detecting the presence or absence of a target
polynucleotide in a sample is described.
Inventors: |
Curry; John D.; (Concord,
CA) ; Koshinsky; Heather; (El Cerrito, CA) ;
Lindholm-Perry; Amanda Kay; (Clay Center, NE) ;
Thallman; Richard Mark; (Blue Hill, NE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Affymetrix, Inc. |
Santa Clara |
CA |
US |
|
|
Family ID: |
48781975 |
Appl. No.: |
14/755002 |
Filed: |
June 30, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13824348 |
Apr 2, 2014 |
|
|
|
PCT/US13/21379 |
Jan 14, 2013 |
|
|
|
14755002 |
|
|
|
|
61586635 |
Jan 13, 2012 |
|
|
|
Current U.S.
Class: |
506/4 |
Current CPC
Class: |
C12Q 1/6806 20130101;
C12Q 1/6869 20130101; C12Q 1/6827 20130101; C12Q 1/6874 20130101;
C12Q 1/6862 20130101; G01N 33/5308 20130101; C12Q 1/6869 20130101;
C12Q 1/6827 20130101; C12Q 2525/155 20130101; C12Q 2523/109
20130101; C12Q 2525/155 20130101; C12Q 2533/107 20130101; C12Q
2535/131 20130101; C12Q 1/6827 20130101; C12Q 2525/155 20130101;
C12Q 2531/137 20130101; C12Q 2533/107 20130101; C12Q 2535/131
20130101; C12Q 1/6827 20130101; C12Q 2525/155 20130101; C12Q
2533/107 20130101; C12Q 2535/131 20130101; C12Q 1/6827 20130101;
C12Q 1/6869 20130101; C12Q 2525/155 20130101; C12Q 2523/109
20130101; C12Q 2533/107 20130101; C12Q 2525/155 20130101; C12Q
2535/131 20130101; C12Q 1/6827 20130101; C12Q 2525/155 20130101;
C12Q 2531/137 20130101; C12Q 2535/131 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Goverment Interests
GOVERNMENT RIGHTS
[0002] This invention was made with government funding under CRADA
Number 58-3K95-1-1519-M provided by the United States Department of
Agriculture, Agricultural Research Service (USDA/ARS). The
government has certain rights in the invention.
Claims
1.-33. (canceled)
34. A method of determining the presence or absence of a plurality
of target polynucleotides in a sample, the method comprising the
steps of: a) combining i) a sample that may comprise one or more of
said plurality of target polynucleotides, each of said target
polynucleotides comprising a first target sequence and a second
target sequence; ii) a plurality of first complementary
polynucleotides, each first complementary polynucleotide comprising
a different first complementary sequence, wherein each first
complementary sequence is complementary to a first target sequence
of one of the plurality of target polynucleotides; and iii) a
plurality of second complementary polynucleotides, each comprising
a different second complementary sequence, wherein each second
complementary sequence is complementary to a second target sequence
of the target polynucleotide, wherein when a plurality of first and
second complementary sequences hybridize with a plurality of target
sequences they have a Tm within about 10.degree. C. of each other;
b) incubating the plurality of first and second complementary
polynucleotides with the plurality of target polynucleotides under
conditions that allow hybridization of complementary sequences,
wherein when a first complementary polynucleotide and a second
complementary polynucleotide are hybridized to the same target
polynucleotide, the first complementary polynucleotide is joined to
the second complementary polynucleotide to form one or more product
polynucleotides; and c) detecting the presence or absence of one or
more product polynucleotides to determine the presence or absence
of one or more of the plurality of target polynucleotides in the
sample.
35. The method of claim 34, wherein the first complementary
polynucleotide is covalently or non-covalently joined to the second
complementary polynucleotide when the first and second
complementary polynucleotides are hybridized to the same target
polynucleotide, wherein said joining occurs by chemical reaction,
enzymatic reaction or non-enzymatic reaction.
36. The method of claim 35, wherein the enzymatic reaction is
ligation.
37. The method of claim 34, further comprising an enriching step
before the detecting step, wherein each of the first and second
complementary sequences comprises a sequence complementary to one
or more amplification primers, and the enriching step comprises
amplification of the one or more product polynucleotides.
38. The method of claim 34, further comprising an enriching step
before the detecting step, wherein the enriching step comprises
selecting the one or more product polynucleotides or removal or
destruction of one or more non-product polynucleotides.
39. The method of claim 34, wherein: i) each of the first target
polynucleotides further comprises a polymorphic nucleotide or
nucleotide sequence positioned between the first and second target
sequence; ii) each of the first complementary polynucleotides
further comprises a first polymorphic nucleotide or nucleotide
sequence, wherein the polymorphic nucleotide is complementary to
the polymorphic nucleotide or nucleotide sequence of the first
target polynucleotide; and further comprising an enriching step
before the determining step, the enriching step comprising
increasing the concentration of at least one product polynucleotide
compared to a non-product polynucleotides.
40. The method of claim 34, wherein the first complementary
polynucleotide includes a polymorphism-specific tag or an
allele-specific tag.
41. The method of claim 40, wherein each of the first and/or second
complementary polynucleotides comprises a locus-specific tag
sequence, said locus-specific tag sequence corresponding to the
identity of the locus and/or each of the first and/or second target
sequences.
42. The method of claim 40, wherein each of the plurality of first
complementary polynucleotides comprises a polymorphism-specific
tag, an allele-specific tag, a nucleotide-specific tag, a
locus-specific tag, or combinations thereof.
43. The method of claim 37, wherein at least one of the sequences
complementary to an amplification primer comprises a
sample-specific tag sequence, wherein said sample-specific tag is
unique to the identity of the sample.
44. The method of claim 34, wherein the inosine is 2, 3, 4, 5, 6,
7, 8, 9, 10, or more bases from the terminus of the first and/or
second complementary polynucleotide.
45. The method of claim 34, wherein the determining step is
accomplished by sequencing all or part of one or more of the
product polynucleotides or a complement thereof, wherein said one
or more product polynucleotides are enriched prior to
sequencing.
46. The method of claim 45, further comprising comparing the
quantity of read events for the first polynucleotide from a
specific locus, and the quantity of read events for a second
polynucleotide from the same specific locus to determine the
presence or absence of heterozygosity or homozygosity.
47. The method of claim 37, wherein the amplifying step comprises
uracil incorporation.
48. The method of claim 34, wherein at least steps a-c are
conducted from, (i) 2 to 10 times on 2 to 10 samples or
individuals, (ii) 10 to 100 times on 10 to 100 samples or
individuals, (iii) 10 to 1000 times on 10 to 1000 samples or
individuals, or (iv) 10 to 10,000 times on 10 to 10,000 samples or
individuals.
49. The method of claim 34, wherein one or more first and/or second
complementary polynucleotides comprises inosine.
50. The method of claim 34, wherein a first complementary
polynucleotide and a second complementary polynucleotide are
hybridized to the same target polynucleotide immediately adjacent
one another.
51. The method of claim 40, wherein said allele-specific tag is
within the first complementary sequence.
Description
RELATED APPLICATION DATA
[0001] This application is a continuation application which claims
priority to U.S. patent application Ser. No. 13/824,348, filed on
Apr. 2, 2014, which is a National Stage Application under 35 U.S.C.
371 of co-pending PCT application PCT/US13/21379 designating the
United States and filed Jan. 14, 2013; which claims the benefit of
U.S. application 61/586,635 and filed Jan. 13, 2012 each of which
are hereby incorporated by reference in their entireties.
FIELD
[0003] The present disclosure is directed to the scalable
characterization of nucleic acids from multiple samples using
parallel sequencing.
BACKGROUND
[0004] Current large scale, commercial genotyping methods are
generally array based and are prohibitively expensive. This makes
them unusable for routine or en mass genotyping of a moderate
number of loci. Because genotyping for specific traits requires
testing of a moderate number of loci from large numbers of
subjects, commercial genotyping is rarely used.
[0005] Large scale genotyping can be performed using chip or bead
array technology. However, genotyping using array technology is
expensive on a per sample basis. While array technology can be
scaleable (i.e. allowing the gathering of genotype information from
tens of thousands of loci, or more, from a single sample), the per
sample cost prevents widespread adoption of this method for
genotyping large numbers of samples.
[0006] Described herein are methods and compositions for use in
determining the presence or absence of a target polynucleotide in a
sample.
SUMMARY
[0007] Disclosed herein is a method of detecting the presence or
absence of a target polynucleotide in a sample, the method
comprising the steps of: combining (i) a sample comprising a target
polynucleotide, the target polynucleotide comprising a first target
sequence and a second target sequence, (ii) a first complementary
polynucleotide comprising a first complementary sequence, wherein
the first complementary sequence is complementary to the first
target sequence of the target polynucleotide, and (iii) a second
complementary polynucleotide comprising a second complementary
sequence, wherein the second complementary sequence is
complementary to the second target sequence of the target
polynucleotide; incubating the first and second complementary
polynucleotides with the sample under conditions that allow
hybridization of the first and second complementary sequences of
the first and second polynucleotides with the first and second
target sequences of the target polynucleotide; if the first
complementary polynucleotide and the second complementary
polynucleotide are hybridized to the same target polynucleotide,
then joining the first complementary polynucleotide to the second
complementary polynucleotide, to form a first product
polynucleotide; and detecting the presence of the product
polynucleotide in the sample, or detecting the absence of the
product polynucleotide or nucleotide sequence in the sample. In
some aspects, the 3' end of the first complementary polynucleotide
is adjacent to the 5' end of the second complementary
polynucleotide. The 3' end is joined to the 5' end.
[0008] In some cases the presently disclosed method may further
include a polymerization step, digestion step, or repair step at
any point before the joining step. In some cases the polymerization
step can include elongation of the first and/or second
complementary polynucleotides. In some cases, the digestion step
can include digestion of the first and/or second complementary
polynucleotides. In some cases, the repair step may include repair
of the first and/or second complementary polynucleotides. In some
cases the polymerization and/or repair step can be performed where
the first and second complementary polynucleotides are hybridized
to the same target polynucleotide, and the 5' end of one
complementary polynucleotide is separated from the 3' end of the
other polynucleotide by one or more nucleotides.
[0009] In various embodiments, the joining step may comprise
covalent bonding or non-covalent bonding of the first and second
complementary polynucleotides as described herein.
[0010] In various embodiments, a third complementary polynucleotide
can hybridize to the target polynucleotide between the first and
second complementary polynucleotides. The third polynucleotide is
then joined to the first and second complementary polynucleotides
to make a product polynucleotide including the first, second, and
third complementary polynucleotide.
[0011] In some cases, the presently disclosed method may further
include an enriching step at any point before the detecting step.
The enriching step may increase the ratio of product
polynucleotides to non-product polynucleotides. In some cases, the
enriching step may comprise selecting the product polynucleotides
by size, affinity, charge, single strand vs. double strand, or
sequence. In some cases the enriching step may comprise
amplification of the product polynucleotide. In other cases the
enriching step may comprise removal of some or all of the
non-product polynucleotides, for example by selection, segregation,
or digestion. The enriching step can also be accomplished by
increasing the concentration of the target polynucleotide.
[0012] In some cases, the first and/or second complementary
polynucleotides can comprise one or more tag sequences. In various
cases, the one or more tag sequences may aid in identifying the
sample and/or target sequences. In various embodiments, the one or
more tag sequences may allow the sample and/or target sequences to
be detected without generating sequence data from the product
polynucleotide.
[0013] In some variations, the present method may be for
identifying the presence or absence of a plurality of different
target polynucleotides. In these embodiments, there may be a
plurality of sets of first and second complementary polynucleotides
for hybridizing to the plurality of different target
polynucleotides. For example, in variations of the method for
identifying the presence or absence of a first target
polynucleotide and a second target polynucleotide, there may be a
first set of first and second complementary polynucleotides and a
second set of first and second complementary polynucleotides. In
these cases the first set of first and second polynucleotides may
have complementary sequences that can hybridize to the first and
second target sequences of the first target polynucleotide, and the
second set of first and second complementary polynucleotides may
have a first and a second complementary sequence that can hybridize
to the first and second target sequence of the second target
polynucleotide.
[0014] In some variations, the method may further comprise a
pooling step at any point after the joining step, wherein product
polynucleotides from various samples are pooled to create a library
of product polynucleotides from different samples. In some cases,
the sequence of various product polynucleotides from various
samples may be determined at the same time. In some cases, such as
when product polynucleotides are sequenced, the various product
polynucleotides are sequenced in a single lane of a single flow
cell. In some cases, such as when product polynucleotides are
sequenced, the various product polynucleotides are sequenced in a
single physical substrate. In some cases, such as when product
polynucleotides are sequenced, the various product polynucleotides
are sequenced in a single masked portion of a single slide. In some
cases, such as when product polynucleotides are sequenced, the
various product polynucleotides are sequenced in a single sequence
data generation reaction. In some cases, such as when product
polynucleotides are sequenced, the various product polynucleotides
are sequenced in a single physical space of a single sequence data
generation reaction. In some cases, the various product
polynucleotides produced by pooling multiple samples may be
sequenced as a single sample. In these cases, the first and/or
second complementary sequences can comprise a sample-specific tag.
In some cases, the sample-specific tag may be added to a product
polynucleotide, for example by ligation of the sample specific tag
to the product polynucleotide, or during an enrichment step, such
as during amplification by PCR, wherein a PCR primer may have a
sample-specific tag sequence.
[0015] In some cases, for example where a sample may or may not
comprise a plurality of different target polynucleotides, such as
embodiments wherein the target polynucleotides comprise different
gene sequences and/or different genetic loci, the first and second
complementary polynucleotides may comprise locus-specific tags.
[0016] In some cases, for example where a sample contains two
target polynucleotides that may or may not be identical but for a
polymorphism, the first and second complementary polynucleotides
may comprise polymorphism-specific tags.
[0017] In some cases the method may be used to detect the presence
or absence of one or more nucleotides or nucleotide sequences, a
polymorphism, a translocation, deletion, insertion, modified
nucleotide, or a combination thereof. In various embodiments, a
polymorphism, translocation, deletion, insertion, modified
nucleotide, or combination thereof can include one or more
bases.
[0018] In one variation, the method can be used to detect the
presence or absence of a nucleotide polymorphism in a target
polynucleotide from a sample, the second complementary sequence can
further comprise a phosphorylated 5' nucleotide; the joining step
can further comprise ligating the 3' end of the first complementary
polynucleotide to the 5' end of the second complementary
polynucleotide. This method can further comprise an enriching step
comprising amplifying the product polypeptide by polymerase chain
reaction. In some of these cases amplification can further comprise
using a first PCR primer comprising a sequence that is
complementary to a portion of the second complementary
polynucleotide, and a second PCR primer comprising a sequence that
is identical to a portion of the first product polynucleotide to
create a first amplified product polynucleotide. In some cases, the
first and or second PCR primer may further comprise a
sample-specific tag sequence.
[0019] In some variations of the disclosed method, for use in
detecting a polymorphism on a target sequence, the polymorphism on
the target polynucleotide may comprise a single nucleotide or
multiple nucleotide substitutions. In some examples, the
polymorphism can be one, two, three, four, five, or six or more
nucleotides in length.
[0020] Some variations of the disclosed method for detecting a
polymorphism can include a plurality of first complementary
polynucleotides that differ in the identity of the 3' nucleotide or
3'-polynucleotide sequences. Some variations of the disclosed
method for detecting a polymorphism can include a plurality of
second complementary polynucleotides that differ in the identity of
the 5'-nucleotide or 5'-polynucleotide sequences. In some
variations of the method, wherein the each base of the polymorphism
can be one of four possible nucleotides, and thus four sets of
first and second complementary polynucleotides can be used. In
these methods, some sets of first and second complementary
polynucleotides may have the same second complementary
polynucleotides.
[0021] In some variations of the presently disclosed method, a
specific tag sequence can correspond to the identity of a
polynucleotide and can aid in identifying the 3'-nucleotide or
3'-nucleotide sequences of the first polynucleotide. In some
variations of the presently disclosed method, a specific tag
sequence can correspond to the identity of a polynucleotide and can
aid in identifying the 5'-nucleotide or 5'-nucleotide sequences of
the second polynucleotide.
[0022] In some variations, the method further includes a first
and/or second PCR primer comprising a sample-specific tag, wherein
the tag or tag combination correspond to and are unique for the
sample identity.
[0023] In some variations, the first complementary polynucleotide
of the disclosed method further comprises a universal base such as
inosine, positioned 2, 3, 4, 5, 6, 7, 8, 9, 10, or more bases from
the 3' nucleotide. Other universal bases include 3-nitropyrrole and
5-nitroindole. Any universal base (one that does not favor
particular base-pairing) can be used in these positions.
[0024] The presently disclosed method, in some variations, is used
to detect the presence or absence of a given polymorphism
positioned between the first and second target sequences. In some
cases, for example wherein the sample may comprise more than one
target polynucleotide having the same first and second target
sequence, and different polymorphic nucleotides positioned between
the target sequences, the method can be used to genotype a first
locus in the sample with the use of multiple first complementary
polynucleotides differing in their 3' nucleotide identities.
[0025] In some variations, the number of product polynucleotides
may correspond to the number of independent sequence reading
events. In some variations wherein target polynucleotides are
obtained from a diploid organism, the organism may be determined to
be homozygous or heterozygous based on the number of sequencing
reads for a given locus and the number of sequencing reads for one
or more polymorphisms. In some cases, a given locus can be
heterozygous wherein the number of sequencing reads for one target
sequence having one polymorphism comprises about 45-55% of the
number of sequencing reads for all target sequences at that locus.
In many cases, a given locus can be homozygous wherein the number
of sequencing reads for one target sequence having a polymorphism
comprises more than about 50%, 60%, 70%, 80%, 90%, 95%, or 99%
and/or less than about 50%, 40%, 30%, 20%, 10%, 5%, or 1% of the
number of sequencing reads for all target sequences at that locus.
It will be appreciated that different percentages of sequence reads
can show homozygous or heterozygous sequences for different
loci.
[0026] In some variations of the disclosed method, the amplifying
step may further comprise the nucleotide deoxyuridine triphosphate
(dUTP) and uracil DNA glycosylase (UNG), and may begin with a step
at or about 37.degree. C. to destroy (UNG destroys any dUTP
containing DNA) any contaminating amplification products (those
that contain dUTP), followed by a high temperature step to denature
or deactivate the uracil DNA glycosylase before synthesis of the
target. This can avoid potential amplification of the contaminating
amplification products.
[0027] In some disclosed variations, the method product
polynucleotides are sequenced by Illumina sequencing. In these
cases, the PCR primers and/or the first and second complementary
polynucleotides may include Illumina sequences to aid in capture on
an Illumina flow cell and bridge amplification on the flow
cell.
[0028] In some variations of the disclosed method, the polymorphism
may be a methylated or non-methylated nucleotide sequences. In
other variations, the polymorphism may be a deletion, insertion, or
translocation. In other variations, methylation-sensitive
restriction endonucleases may be used to aid in creating target
polynucleotides. In some variations, copy number of a given locus
may be determined.
BRIEF DESCRIPTION OF THE DRAWINGS
[0029] FIG. 1 A-1 D depicts method of analyzing the genotype of two
samples at two different polymorphic loci.
[0030] FIG. 2A-2E depicts a first target polynucleotide and a first
and second complementary polynucleotide used in one variation of
the presently described method.
[0031] FIG. 3 depicts a set of first and second complementary
polynucleotides for use in the method wherein sequencing is
performed on the Illumina sequencing devices.
[0032] FIG. 4 depicts the use of ligation dependent genotyping.
Step (a) shows a three polynucleotide set consisting of two first
complementary polynucleotides (one with a 3' G nucleotide and its
counterpart with a 3' T nucleotide) and one second complementary
polynucleotide that is 5' phosphorylated (P) added to denatured
target DNA. Step (b) shows the correctly hybridized first
complementary polynucleotide successfully joined via enzymatic
ligation to the second complementary polynucleotide. Step (c) shows
the first PCR step where an oligo nucleotide hybridizes to the
newly formed (LHS ligated to RHS) product polynucleotide and a full
length (step d) complementary strand arises.
[0033] FIG. 5 depicts PCR steps used to add sample-specific
sequence tags (GTCAGAC and CTGTATC) and the steps involved in
reading said tags on a sequencing device.
[0034] FIG. 6 depicts results from a ligation-dependent assay
performed with and without deoxyinosine at various positions 5' of
the 3' terminal nucleotide of the first complementary
polynucleotide.
[0035] FIG. 7 depicts a single ligation-dependent assay for eight
loci on a single target DNA sample, and resolved by gel
electrophoresis.
[0036] FIG. 8 depicts a bar graph of number of reads versus locus
(Allele-A, Allele-B) or (locus.times.allele) obtained by sequencing
the ligation products en masse.
[0037] FIG. 9 depicts a bar graph of number of reads versus locus
for a single library which contains a total of 24 genomic DNA
samples
[0038] FIG. 10 depicts results for a single sample repeated in
quadruplicate within a single MGST (mass genotyping by sequencing
technology) reaction. MGST is a type of multiplexed detection
sequence technology (MDST). A subset of 8 loci from the 24 loci
that were utilized are shown for clarity.
[0039] FIG. 11 depicts four dot plot graphs used for visual
analysis of MSGT data for four single loci.
[0040] FIG. 12 depicts a comparison of the number of reads per
locus obtained from the dNTP vs the dUTP prepared libraries for the
bulk sample.
[0041] FIG. 13 depicts specificity of genotyping by the presently
disclosed method from data resampling analysis.
[0042] FIG. 14 depicts a spectrum of cariogenic oral bacteria (*),
oral fungi (#), and other oral bacteria that may be present in the
human oral cavity. The spectrum of the oral bacteria present in the
saliva of two human subjects (LCS-11 and LCS-14) was determined by
the oral bacteria specific MDST. In various embodiments, MDST is
used to determining the presence or absence of a target
polynucleotide in a sample as described herein, in a multiplex
format. The mean counts are shown (bars) with standard deviations
(whiskers).
[0043] FIG. 15 depicts A PCR only based strategy for the detection
of target polynucleotides and or their polymorphisms in a multiplex
manner. Two different target polynucleotides (A and B) are shown in
single stranded forms (bottom strand 3' to 5'). In the Joining
Step, first complementary polynucleotide (A1) and second
complementary polynucleotide (A2) primers amplify the A target
polynucleotide while first complementary polynucleotide (B1) and
second complementary polynucleotide (B2) amplify the B target
polynucleotide. Each primer set is bounded by common sequences
(diagonal lines). In the Amplification Step, these common sequences
permit the Sample Tagging Primer 1 and Sample Tagging Primer 2
primers to amplify both product polynucleotides A and B
concurrently. The diagonal red bars are sample-specific barcodes
that tag the PCR products that comprise the product polynucleotide.
The final product polynucleotides are arranged as shown with
Illumina FC A and FC B on each end, these are the flow cell binding
sequences. Next are the sample tags (gray bars), then the location
for Illumina Sequencing Primer 1, the actual target polynucleotide
sequence, the location for Illumina Sequencing Primer 2, the next
sample tag (gray bars), and the final Illumina FC B flow cell
binding sequence.
[0044] FIG. 16 depicts examples of genotyping data where the data
fits the expected genotype frequency ratios, and examples where the
data is shifted off the expected genotype frequency ratios.
[0045] FIG. 17 depicts MGST combining multiple LD-PCR assays each
at different loci.
[0046] FIG. 18 depicts an exemplary sequence format of a sequencing
library.
[0047] FIG. 19 depicts exemplary NGS data.
[0048] FIG. 20 depicts an example of the reproducibility of NGS
data.
[0049] FIG. 21 depicts exemplary automated genotyping.
[0050] FIG. 22 depicts exemplary data resampling analysis.
[0051] FIG. 23 depicts the effect of deoxyinosine at various
positions
[0052] FIG. 24 shows the results from placing deoxyinosine at other
positions in a first complementary sequence.
[0053] FIG. 25 shows the results from placing deoxyinosine at other
positions in a second complementary sequence.
[0054] FIG. 26 shows results from the use of the presently
disclosed method in the detection of methylation and copy number
variation.
[0055] FIG. 27 shows the use of the presently disclosed method in
the Quantification in a heterogeneous sample,
[0056] FIG. 28 shows the use of the presently disclosed method in
detection of a microorganism in a sample.
[0057] FIG. 29 shows the use of the presently disclosed method in
quantification of different organisms in a sample
[0058] FIG. 30 shows the use of the presently disclosed method in
detection of a small dinucleotide repeat variant (INDEL) and of a
single nucleotide deletion.
[0059] FIG. 31 shows the use of the presently disclosed method for
the detection of insertion and deletion polymorphisms.
[0060] FIG. 32 shows the use of the presently disclosed method in
detection of three-allele single nucleotide polymorphisms.
[0061] FIG. 33 shows the use of the presently disclosed method in
detecting the genotype of a mock tetraploid genomic DNA sample.
[0062] FIG. 34 shows the use of the presently disclosed method in
detection of RNA as the starting sample.
[0063] FIG. 35 shows the use of the presently disclosed method
wherein samples are resolved on a MiSeq instrument from Illumina,
Inc.
[0064] FIG. 36 shows the use of the presently disclosed method
wherein samples are resolved on alon Torrent machine from Life
Technologies, Inc.
[0065] FIG. 37 is a diagram showing the joining occurring by
polymerase.
[0066] FIG. 38 shows an example of a cluster plot where the number
of reads for Allele-A are highly skewed from the number of reads
obtained for Allele-B. The various symbols indicate the genotype
inferred (within a user defined statistical confidence) and whether
it is concordant with the genotype determined by an alternative
method. In some cases the probability of the genotype is known, but
the genotype is not inferred as it does not fall within the user
defined statistical criteria. Y-axis is the number of reads for
allele-B and X-axis is the number of reads for allele-A.
[0067] FIG. 39 shows another example of a cluster plots where the
number of reads for Allele-A are highly skewed from the number of
reads obtained for Allele-B.
[0068] FIG. 40 shows INDELs and short tandem repeat (STR) genotyped
using the disclosed method. In each example three complementary
polynucleotides are used for each target polynucleotide (two first
complementary polynucleotides, LHSs, and one second complementary
polynucleotide, RHS). Genotypes are BB (circles), AB (triangles)
and AA (small circles). The sequence nature of the alteration
detected in shown in text with allele-A/Allele-B. Repeat regions
are in bold.
[0069] FIG. 41 Genotype cluster plot for a single loci (rs17871214)
using an altered read state of the GAIIx sequencing instrument.
DETAILED DESCRIPTION
[0070] A method is described for detecting the presence or absence
of a target polynucleotide in a sample, the method comprising the
steps of: combining (i) a sample comprising a target
polynucleotide, the target polynucleotide comprising a first target
sequence and a second target sequence, (ii) a first complementary
polynucleotide comprising a first complementary sequence, wherein
the first complementary sequence is complementary to the first
target sequence of the target polynucleotide, and (iii) a second
complementary polynucleotide comprising a second complementary
sequence, wherein the second complementary sequence is
complementary to the second target sequence of the target
polynucleotide; incubating the first and second complementary
polynucleotides with the sample under conditions that allow
hybridization of the first and second complementary sequences of
the first and second complementary polynucleotides with the first
and second target sequences of the target polynucleotide (if
present); if the first complementary polynucleotide and the second
complementary polynucleotide are hybridized to the same target
polynucleotide, then joining the first complementary polynucleotide
to the second complementary polynucleotide, to form a first product
polynucleotide; and detecting the presence of the target
polynucleotide by generating sequence data that directly or
indirectly determines the sequence of the first product
polynucleotide, or detecting the absence of the target
polynucleotide in the sample by not determining the sequence of the
first product polynucleotide.
[0071] In various embodiments, the term LHS refers to an example of
a first complementary polynucleotide, and the term RHS refers to an
example of a second complementary polynucleotide. It will be
recognized that the first or second complementary polynucleotides
can be either LHS or RHS sequences, in that they can be
interchanged, and or hybridize to the opposing target DNA
strand.
[0072] In some cases the presently disclosed method may further
include a polymerization step, digestion step, or repair step
before or within the joining step. In some cases the polymerization
step can comprise elongating the first and/or second complementary
polynucleotides. In some cases, the digestion step can include
digestion of the first and/or second complementary polynucleotides.
In some cases, the repair step may include repair of the first
and/or second complementary polynucleotides. In some cases a
polymerization and/or repair step can be performed where the first
and second complementary polynucleotides are hybridized to the same
target polynucleotide, and the 5' end of one complementary
polynucleotide is separated from the 3' end of the other
polynucleotide by one or more nucleotides. In another embodiment,
the first and second complementary polynucleotides can be linked
via a third molecule. The third molecule can be DNA, RNA or a
nucleic acid analog such as PNA or LNA. The third molecule can
hybridize to the target polynucleotide sequence-specifically, or in
between the first and second complementary polynucleotides. The
third molecule can be joined to each of the first and second
complementary polynucleotides by any of the methods described for
joining the first and second complementary polynucleotides to form
a product polynucleotide.
[0073] Polynucleotides, including but not limited to complementary
polynucleotides or target polynucleotides, are polymeric form of
nucleotides or nucleotide analogs of any length, including
deoxyribonucleotides or ribonucleotides, or analogs thereof, or
mixtures thereof. Polynucleotides may contain modified bases,
including those that include, without limitation, a methylation,
deaniination, deamination, thiolation, and/or acetylation. A
polynucleotide may be further modified before or after
polymerization, such as by conjugation with a labeling component.
The polynucleotide may be an amplified region of a longer sequence
of nucleotides. A polynucleotide may be a peptide nucleic acid
(PNA), locked nucleic acid (LNA), Armored RNA, nucleic acids with
phosphoric background modifications (e.g. bridging chiral
phosphorothioates, non-bridging chiral phosphorothioates,
phosphorodithioate, chiral methyl phosphonate, chiral
phosphoramidate, chiral phosphate trimester, chiral
boranophosphate, and chiral phosphoroselenoate. Exemplary linkage
modifications include methylenemethylimino (MMI), 3'-amide, 3'
achiral phosphoramidate, 3' archiral methylene phosphonate,
thioformacetal, and thioethyl ether modifications. Exemplary sugar
modifications include 2'-fluoro, 2'-0-methyl, 2'-0-(3-amino)propyl,
2'-0-(2-methoxy)ethyl, 2'-0-2-(N,N-dimethylaminooxy)ethyl (DMAOE),
2'-0-2-[2-(N,N-dimethylamino)ethyloxy]ethyl (DMAEOE)3 and
2'-0-N,N-dimethylacetarnidyl. Classes of analog nucleotides having
sugar modifications include N-morpholinophosphordiamidate
(Morpholinos); hexose nucleic acid (HNA); threose nucleic acid
(TNA), such as those disclosed in Chaput et al., AMER. CHEM. SOC,
125:856-857 (2003); cyclohexene nucleic acid (CeNA); locked nucleic
acid (LNA), having methylene bridges between the 2'-0 and 4'-C on
the ribofuranose ring of some or all individual nucleotides of a
polynucleotide (which methylene bridges function to restrict the
flexibility of the polynucleotide and are associated with enhanced
stability and hybridization characteristics), such as those
disclosed in TRENDS IN BIOTECHNOLOGY 21:74-81 (2003); and
tricycle-deoxyribose nucleic acid (tcDNA) modifications. Base
modifications include 5-propynyluracil-1-yl, 5-methylcytosin-l-yl,
2-aminoadenin-9-yl, 7-deaza-7.about.iodoadnin-9-yl,
7-deaza-7-propynyl-2-aminoadenin-9-yl, phenoxazinyl,
phenoxazinyl-G-clamp, 2,6-diamino purine, and 2,6-diamino
thiouracil. A preferred connection modification is an o
deoxyribofuranosyl.
[0074] It will be understood that the polynucleotide includes
polynucleotides that are covalently or non-covalently linked to
another molecule. For example, polynucleotides can be bonded to a
protein, biotin, or avidin functionality.
[0075] A complementary polynucleotide is one in which a
single-stranded polynucleotide has the ability to bind a
polynucleotide in a base-specific manner. A polynucleotide that is
"complementary" may have one or more single base-pair mismatches,
additions, and/or deletions, but is still capable of hybridizing to
the target polynucleotide under the selected hybridization or
association conditions. An exactly complementary polynucleotide has
the ability to hybridize to a target nucleic acid sequence without
base mismatches. A polynucleotide is not exactly complementary to a
target polynucleotide if there is a single base-pair mismatch
between the polynucleotide and the target polynucleotide.
[0076] Hybridization of polynucleotides can be performed under
various conditions known in the art. For example, hybridization can
occur under various stringency conditions. Stringency refers to the
binding of two single stranded polynucleotide sequences via
complementary base pairing. Extensive guides to the hybridization
of nucleic acids can be found in: Tijssen, Laboratory Techniques in
Biochemistry and Molecular Biology--Hybridization with Nucleic Acid
Probes Part I, Ch. 2, Overview of principles of hybridization and
the strategy of nucleic acid probe assays" (1993), Elsevier, N.Y.;
and Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd
ed.) Vol. 1-3 (2001), Cold Spring Harbor Laboratory, Cold Spring
Harbor Press, N.Y.
[0077] Stringent conditions are hybridization conditions under
which a polynucleotide will hybridize preferentially to its target
subsequence, and optionally, to a lesser extent, or not at all, to
other sequences in a mixed population (e.g., a DNA preparation from
a tissue biopsy).
[0078] Generally, highly stringent hybridization and wash
conditions are selected to be about 5.degree. C. lower than the
thermal melting point (Tm) for a specific sequence at a defined
ionic strength and pH. The Tm is the temperature at which 50% of
the target sequence hybridizes to a perfectly matched probe. Very
stringent conditions are selected to be equal to the Tm for a
particular probe. Often, a high stringency wash is preceded by a
low stringency wash to remove background probe signal. An example
of stringent hybridization conditions for hybridization of
complementary nucleic acids which have more than 100 complementary
residues on an array is 42.degree. C. using standard hybridization
solutions, with the hybridization being carried out overnight. An
example of highly stringent wash conditions is a 0.15 M NaCl wash
at 72.degree. C. for 15 minutes. An example of stringent wash
conditions is a wash in 0.2.times. Standard Saline Citrate (SSC)
buffer at 65.degree. C. for 15 minutes. An example of a medium
stringency wash for a duplex of, for example, more than 100
nucleotides, is 1.times.SSC at 45.degree. C. for 15 minutes. An
example of a low stringency wash for a duplex of, for example, more
than 100 nucleotides, is 4.times. to 6.times.SSC at 40.degree. C.
for 15 minutes.
[0079] In some cases the joining step may comprise covalent bonding
or non-covalent bonding of the first and second complementary
polynucleotides.
[0080] Joining of the complementary polynucleotides covalently can
result in a covalently-bonded product polynucleotide. An example of
one way of covalent joining is ligating the first and second
complementary polynucleotides to form a product polynucleotide.
Without each terminal base hybridized to the target polynucleotide,
the complementary polynucleotides do not ligate to form a product
polynucleotide.
[0081] In one embodiment, a covalent product polynucleotide can be
created by template-directed chemical ligation of natural 5'
phosphorylated and 3' hydroxyl DNA polynucleotides catalyzed by
cyanogen bromide (BrCN). First and second complementary
polynucleotides can be hybridized onto the target polynucleotide.
The first and second complementary polynucleotides are joined by
the 5'-3' phosphate link. The product polynucleotide has full
biological functionality. An example of such a non-enzymatic
joining is described, for example, in Shabarova et al., Nucleic
Acids Res. 1991 Aug. 11; 19(15):4247-51. PMID:1870979.
[0082] In another embodiment, joining can be performed by
template-directed ligation. For example, a first complementary
polynucleotide is modified by a 5'-iodo group and a second
complementary polynucleotide is modified by a 3' phosphorothioate
group. The first and second complementary polynucleotides are
joined to form a product polynucleotide. In various embodiments,
the reaction requires no reagents other than the modified
polynucleotides and the target polynucleotide. The reaction can
show some mismatch discrimination at the ligation site, and even
higher mismatch discrimination if the mismatch is positioned 3-4
bases away from the ligation site. This joining by non-enzymatic
ligation results in a phosphorothioate-containing DNA, which is
resistant to nucleases but is a good template for DNA and RNA
polymerases. An example of such a reaction is disclosed by Xu Y,
Kool E T. Nucleic Acids Res. 1999 Feb. 1; 27(3):875-81.
PMID:9889286.
[0083] In one variation, the first complementary polynucleotide is
modified with a 5' dabsyl leaving group, and the second
complementary polynucleotide is modified with a 3'
phosphorothioate. The first and second complementary
polynucleotides are joined by non-enzymatic ligation that requires
no other reagents besides the modified first and second
complementary polynucleotide and the target polynucleotide.
Ligation is target polynucleotide-dependent, and can be performed
in E. coli cells or outside of cells. The product polynucleotide is
fluorescently de-quenched by the removal of the dabsyl such that
the product polynucleotide can be detected by a fluorescence
increase in vivo or in vitro. The product polynucleotide is natural
DNA and can be used by polymerases and DNases. An example reaction
is described in Sando S, Kool E T. Nucleic Acids Res Suppl. 2002;
(2):121-2. PMID:12903135.
[0084] In another embodiment, first and second complementary
polynucleotides are joined by template-directed ligation. The first
complementary polynucleotide has a modified 5' 5-vinyldeoxyuridine
and the second complementary polynucleotide has a 3'-terminal
pyrimidine (a T or C base). The first and second complementary
polynucleotides are photo-ligated by a [2+2] cyclobutane dimer
formation between the vinyl group on the 5' complementary
polynucleotide and the 5-6 C--C double bond on the pyrimidine on
the 3' complementary polynucleotide. The bond can resemble a
UV-induced DNA damage product. The product polynucleotide is
nuclease resistant. The reaction can be reversed upon irradiation
with 302 nm light. An example reaction described in Fujimoto K,
Matsuda S, Saito I. Nucleic Acids Symp Ser. 1999; (42):39-40.
PMID:10780368.
[0085] In another embodiment, the complementary polynucleotides are
joined by non-enzymatic click-chemistry-based ligation. The first
complementary polynucleotide is modified with a 5' alkyne group.
The second complementary polynucleotide is modified with a 3' azide
group. The joining step requires a Cu(I) catalyst or another
suitable catalyst. An example of such a reaction is described by
Kumar R, El-Sagheer A, Tumpane J, Lincoln P, Wilhelmsson L M, Brown
T. J Am Chem Soc. 2007 May 30; 129(21):6859-64. Epub 2007 May 9.
PMID:17488075.
[0086] In certain embodiments, a non-covalent method of joining to
produce a product polynucleotide is envisioned. In one non-limiting
example, first and second complementary polynucleotides can be
non-covalently joined by making a 3' biotin-labeled first
complementary polynucleotide, in which the biotin end is sterically
blocked by the formation of a 3' end hairpin, and a second
complementary polynucleotide that is modified with streptavidin at
the 5' end. The 3' biotin-labeled first complementary
polynucleotide is non-covalently joined to the 5' labeled
streptavidin second complementary target polynucleotide in the
presence of a target polynucleotide. The target polynucleotide can
serve to (i) unravel the biotin-blocking hairpin and/or (ii) bring
the biotin-labeled and streptavidin-labeled complementary
polynucleotides in close proximity such that they can be
non-covalently joined.
[0087] In various other embodiments, the biotin is on the second
complementary polynucleotide and the streptavidin is on the first
complementary polynucleotide. In further embodiments, the first and
second complementary polynucleotides have non-biotin and
non-streptavidin portions that are involved in the non-covalent
joining
[0088] In another embodiment, the first and second complementary
polynucleotides can be joined non-covalently by the use of a
specific antibody-antigen pair, where one of the complementary
polynucleotides is labeled at its 5' end with an antigen and the
other complementary polynucleotide is labeled at the 3' end with a
specific antibody for the antigen. Either the antibody binding site
or the antigen is blocked by a photo-cleavable moiety which
prevents the binding between antigen and antibody. Upon hybridizing
the two complementary polynucleotides to the target polynucleotide,
the un-bound complementary polynucleotides are removed (for example
by gel purification or other methods). The blocking moiety is
released by irradiation with the correct wavelength and the first
and second complementary polynucleotides are joined non-covalently
by the specific antigen-antibody interaction.
[0089] It will be appreciated that for purposes of detecting
polymorphism, the polymorphism need not occur at the terminal base
of the first complementary polynucleotide or second complementary
polynucleotide (at its first base) depending on the method of
joining. It will be appreciated by those of skill in the art that
the first and second complementary polynucleotides descriptions
herein can be in reverse order.
[0090] In some cases, the presently disclosed method may further
include an enriching step before the determining step. The
enriching step may increase the ratio of product polynucleotides to
non-product polynucleotides. In some cases, the enriching step may
comprise selecting the product polynucleotides by size, affinity,
charge, sequence, or a combination thereof In some cases the
enriching step may comprise amplification of the product
polynucleotide. In other cases the enriching step may comprise
removal of some or all of the non-product polynucleotides, for
example by size, sequence, selection, segregation, or digestion or
a combination thereof. In various cases, the enriching step may
combine selection of the product polynucleotide and removal of
non-product polynucleotides. In some variations, the joining and
enrichment steps can occur in a single reaction mixture. In other
variations, the joining and enrichment steps can occur in different
reaction mixtures.
[0091] In this variation, the first products are enriched by
labeling either or both the first and second complementary
polynucleotides with a 5' Biotin or 3' Biotin label, respectively.
After joining the first and second complementary polynucleotides,
streptavidin coated paramagnetic beads are added to bind the
biotin. The biotin containing polynucleotides/streptavidin beads
are washed to remove non-biotin containing elements. This enriches
the for the first product polynucleotide. A silica column based
purification may be included to size fractionate the non-joined
first and second complementary polynucleotides from those that did
join. In other variations, single stranded DNases could be added
and the first and second complementary polynucleotides removed by
digestion. Only those that are joined due to the hybridization with
the target polynucleotide are in a double stranded form and
protected. In other variations, the first and second complementary
polynucleotides each have a single end protected from exonuclease
digestion. When they are joined, both ends are protected. In this
manner the addition of an exonuclease removes the non-joined first
and second complementary polynucleotides.
[0092] In some cases, the first and/or second complementary
polynucleotides may comprise tag sequences. In various cases, the
tag sequences may aid in identifying the sample and/or target
sequences and/or variations (polymorphisms) in the target sequence.
In various embodiments, the tag sequences may allow the sample
and/or target sequences and/or variations (polymorphisms) to be
determined without generating sequence data on the target
sequences. The tag sequences can be positioned 5' of a LHS or 3' of
the RHS. In some variations various tag sequences can occur on or
be added to the first and/or second complementary polynucleotide.
In some variations portions of a tag sequence may occur on one, or
both, of the first and second complementary polynucleotide.
[0093] In some cases, a tag sequence may be more than about 1 nt, 2
nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt,
13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, or 21 nt,
or the tag sequence may be less than about 30 nt, 29 nt, 28 nt, 27
nt, 26 nt, 25 nt, 24 nt, 23 nt, 21 nt, 20 nt, 19 nt, 18 nt, 17 nt,
16 nt, 15 nt, 14 nt, 13 nt, 12 nt, 11 nt, 10 nt, or 9 nt.
[0094] In some variations of the present method, the method can be
used for identifying the presence or absence of a plurality of
different target polynucleotides. In these embodiments, there may
be a plurality of first and second complementary polynucleotides
for hybridizing to the plurality of different target
polynucleotides, wherein the plurality of first and second
complementary polynucleotides comprise sets of first and second
complementary polynucleotides. For example, in variations of the
method for identifying the presence or absence of a first target
polynucleotide and a second target polynucleotide, there may be a
first set of first and second complementary polynucleotides and a
second set of first and second polynucleotides. In these cases the
first set of first and second polynucleotides may have
complementary sequences that can hybridize to the first and second
target sequences of the first target polynucleotide, and the second
set of first and second polynucleotides may have a first and a
second complementary sequence that can hybridize to the first and
second target sequence of the second target polynucleotide. In some
variations, a sample may or may not comprise more than two target
polynucleotides. In these cases, the method may further comprise
more than one set of complementary polynucleotides.
[0095] In some variations, the method may further comprise a
pooling step after the joining step. In these cases, product
polynucleotides from various samples are combined to create a pool
or library of product polynucleotides, which can then be submitted
for sequencing. This can allow the determination of various product
polypeptide sequences from multiple samples at the same time. For
example, where sequence determination is performed by Illumina
sequencing, the various product polynucleotides are sequenced in a
single lane of a flow cell. In these cases, the first and/or second
complementary sequences can comprise a sample-specific tag. In some
cases, the sample-specific tag may be added to a product
polynucleotide, for example by ligation, or during an enrichment
step, such as during amplification.
[0096] In some cases, for example where a sample may or may not
comprise a plurality of different target polynucleotides, such as
embodiments wherein the target polynucleotides comprise different
gene sequences or different genetic loci, the first and second
complementary polynucleotides may comprise locus-specific tags. In
some cases, the method can be used to determine the presence or
absence of a signature polynucleotide sequence and as such
determine the presence or absence of a pathogen in a sample.
[0097] In some variations, the presently described method can be
used to identify polymorphisms such as, but not limited to, single
and multi-nucleotide polymorphisms, deletions, insertions,
translocations, covalent nucleotide modifications, etc. In various
cases, the target polynucleotide can be derived from samples of
animal, plant, microbial, viral, or synthetic DNA or RNA. In some
cases, the method can be used to genotype or fingerprint a
sample.
[0098] In variations for identifying target polynucleotides with
polymorphic nucleotides and nucleotide sequences, the method can
involve hybridizing two first complementary polynucleotides to a
target polynucleotide, wherein the target polynucleotide includes a
polymorphic nucleotide. In some of these cases, one of the two
complementary polynucleotides can comprise a nucleotide that is
complementary to one form of the polymorphic nucleotide on the
target polynucleotide. If the polymorphic nucleotide on the
complementary polynucleotide hybridizes to the polymorphic
nucleotide on the target polynucleotide, the two complementary
polynucleotides can be joined together to create a product
polynucleotide. If the polymorphic nucleotide on the complementary
polynucleotide does not hybridize to the polymorphic nucleotide on
the target polynucleotide, the two complementary polynucleotides,
in most cases, cannot be joined and cannot form a single product
polynucleotide. In most cases, the product polynucleotides are
sequenced to determine the presence or absence of the polymorphism,
and the identity of the target polynucleotide. In some variations,
the identity of the sample from which the target polynucleotide was
derived is also determined by sequencing.
[0099] In some variations of the presently described method, more
than one set of a first and a second complementary polynucleotide
may be used. In these cases, the method can be used to distinguish
or identify multiple polymorphisms at a given target sequence, for
example where a target represents a gene locus or allele. In some
variations multiple loci can be characterized from a single sample
to provide the identity of polymorphic nucleotides in various
target polynucleotides. In some variations of the present method,
multiple samples can be genotyped or fingerprinted.
[0100] Variations of the present method can be used to identify
alleles of a single nucleotide polymorphism (SNP) in a target
polynucleotide sequence. As shown in FIG. 1, a SNP is a single
nucleotide in a given sequence that may have several identities.
For example, a SNP at a given position may be a thymine in one
sample, while in another sample that same nucleotide position is a
cytosine. In some cases, for example where samples are derived from
genomic DNA, for example from a diploid mammal with two copies of a
given SNP, the SNP could be homozygous or heterozygous.
[0101] In variations of the present method for analysis of diploid
genomic DNA samples, multiple different complementary
polynucleotides, which differ in the identity of their polymorphic
nucleotide, may be used to interrogate a target polymorphism.
[0102] Exemplary FIG. 1 depicts a variation of the present method
to analyze target polynucleotides from two samples, Sample 1 and
Sample 2. The samples depicted in FIG. 1 are derived from a diploid
organism, and thus comprise two copies (or alleles) of each target
polynucleotide. Further, each sample includes two different target
polynucleotide sequences at each target polynucleotide. That is
there are two loci (Locus A and Locus B) and each locus has two
alleles, Allele A and Allele B. In this illustration, Locus A can
have either a thymine, "T," or guanine, "G," on one strand at the
polymorphic nucleotide. Locus B can have a cytosine, "C," at the
polymorphic nucleotide or a thymine, "T."
[0103] As depicted in FIG. 1 A, Locus A of Sample 1 is homozygous
for the T allele, A.sub.T/A.sub.T, while Locus A of Sample 2 is
heterozygous, A.sub.G/A.sub.T. Locus B of Sample 1 is heterozygous,
B.sub.C/B.sub.T, while Locus B of Sample 2 is homozygous for the T
allele, B.sub.T/B.sub.T.
[0104] While either strand of a polymorphic locus can be analyzed
for a given polymorphism, for ease of illustration, the bottom
strand in FIG. 1 A is analyzed. The analyzed target polynucleotide
is shown in FIG. 1 B without the top strand. The target
polynucleotide is shown 3'->5' (reading left to right).
[0105] FIG. 1 B shows target polynucleotides after denaturation of
the duplex DNA of FIG. 1 A. The target polynucleotides are
comprised of two target sequences: a first target sequence 3' of
the polymorphic nucleotide, and a second target sequence 5' of the
polymorphic nucleotide. After denaturation, the target
polynucleotides are mixed with a plurality of complementary
polynucleotides, and the target polynucleotide and complementary
polynucleotides allowed to hybridize.
[0106] Complementary polynucleotides are depicted in FIG. 1 C
hybridized to target polynucleotides. For each target
polynucleotide there are at least two complementary
polynucleotides, which hybridize to the first target sequence and
the second target sequence. The first complementary polynucleotide
is complementary to and can hybridize with the first target
sequence on the target polynucleotide. In some variations, the
first target sequence is on the left side of the polymorphic
nucleotide, and the first complementary polynucleotide can be
referred to as a left hybridization sequence ("LHS"). Likewise, the
second complementary polynucleotide, which can hybridize to the
second target sequence, can be referred to as a right hand sequence
("RHS").
[0107] Referring now to FIG. 2, the first complementary
polynucleotide comprises a first complementary sequence, or
hybridization sequence, which is complementary to the first target
sequence on the left (3') side of the polymorphic nucleotide
(polymorphism) of the target polynucleotide. The first
complementary polynucleotide further comprises a 3' terminal
nucleotide that can be complementary to the polymorphic nucleotide
on the target polynucleotide. The second complementary
polynucleotide comprises a second complementary sequence, or
hybridization sequence, which is complementary to the second target
sequence on the right (5' side) of the polymorphic nucleotide
(polymorphism) of the target polynucleotide. Alternatively, it will
be appreciated that the second complementary polynucleotide may
comprise a 5' terminal nucleotide that can be complementary to the
polymorphic nucleotide on the target polynucleotide. The first
complementary polynucleotide comprises a first complementary
sequence, or hybridization sequence, which is complementary to the
first target sequence on the left (3' side) of the polymorphic
nucleotide (polymorphism) of the target polynucleotide.
[0108] FIG. 2A depicts a single stranded target sequence (bottom)
and two polynucleotides, a first complementary polynucleotide and a
second complementary polynucleotide (top), hybridized to the target
sequence. The target sequence includes a polymorphic nucleotide
depicted in bold. The target sequence, as in FIG. 1, is shown in a
3' to 5' orientation. The first complementary polynucleotide and
second complementary polynucleotide are shown above the target
sequence. Both the first complementary polynucleotide and the
second complementary polynucleotide comprise a target complementary
sequence, which are complementary to target sequence on the left
and right of a polymorphism in the target sequence. The first
complementary polynucleotide further comprises a 3' terminal
nucleotide (also bold) that is complementary to the target
polymorphism.
[0109] FIG. 2B depicts other possible first complementary
polynucleotides for use with other alleles of the target sequence
depicted in FIG. 2A. These first complementary polynucleotides are
labeled (i)-(iv).
[0110] Because FIG. 1 depicts a method for investigating two loci,
two different second complementary polynucleotides, designated RHS
A and RHS B, specific for the two loci, Locus A and Locus B, are
shown.
[0111] Because Locus A and Locus B each have two alleles, there are
two first complementary polynucleotides for Locus A, LHS-T (this is
equivalent to LHS A.sub.T) and LHS-G (this is equivalent to LHS
A.sub.G), and two first complementary polynucleotides for Locus B,
LHS-C (this is equivalent to LHS B.sub.C) and LHS-T (this is
equivalent to LHS B.sub.T).
[0112] FIG. 1 C shows that only the LHS-T first complementary
polynucleotide hybridizes to the target polynucleotide of Sample 1.
The LHS-G first complementary polynucleotide cannot be joined to
the second complementary polynucleotide, because the terminal base
of the LHS-G does not hybridize to the corresponding base of the
target polynucleotide in Sample 1. However both Locus B first
complementary polynucleotides, LHS-C and LHS-T, have terminal bases
that hybridize to the corresponding base in target polynucleotides
of Sample 1. Regarding Sample 2, both Locus A first complementary
LHS polynucleotides, LHS-T, and LHS-G, hybridize to the
corresponding base of the Sample 2 target polynucleotide, but only
the LHS-T terminal base of the first complementary polynucleotide
hybridizes to the corresponding base of the Sample 2 target
polynucleotides. In the embodiment of the ligase mediated joining,
this differential hybridization of the terminal base of the first
complementary polynucleotide allows the ligase to preferentially
join one of the first complementary polynucleotides.
[0113] In many variations of the presently described method, the
number of first complementary polynucleotides can correspond to the
number of possible polymorphisms, polymorphic nucleotides, or
alleles at a given locus. As described above, because the loci
depicted in FIG. 1 have two alleles each, there are two
corresponding first complementary polynucleotides for each locus in
this example (Locus A with LHS-T, and LHS-G, plus Locus B with
LHS-T, and LHS-G). In other variations there can be more than two
first complementary polynucleotides for a given locus. In
variations wherein a single base SNP is interrogated, there can be
as many as four first complementary polynucleotides for a given
locus, as depicted in FIG. 2B. Multi-nucleotide polymorphisms can
have more than four first complementary polynucleotides for a given
locus.
[0114] In many variations there is a single second complementary
polynucleotide for a given locus. Thus, FIG. 1 C shows two
complementary polynucleotides, one for locus A called RHS-A and
another for locus B called RHS-B. In some variations there can be
more than one second complementary polynucleotide for a given
locus. In many variations, the second complementary polynucleotide
includes a 5' phosphorylated nucleotide. This phosphate moiety can
aid in allowing ligation of the first and second complementary
polynucleotides.
[0115] FIG. 1 C depicts a locus LHS-G polynucleotide unhybridized
to Sample 1 target DNA, and a locus LHS-C polynucleotide
unhybridized in Sample 2. In some cases first complementary
polynucleotides with 3' nucleotide sequences that are not
complementary to a polymorphic sequence on a target polynucleotide
can hybridize to the target polynucleotide, but as discussed below,
in most cases these non-complementary first complementary
polynucleotides will not be joined to the second complementary
polynucleotide and/or result in a small portion of the product
polynucleotides produced. Non-complementary first complementary
polynucleotides that are joined to a second complementary
polynucleotide represent false positives.
[0116] As depicted in FIGS. 1 C and 2A, a first complementary
polynucleotide with a 3' nucleotide that is complementary to the
polymorphic nucleotide can hybridize to the target DNA sequence,
while first complementary polynucleotides with 3' nucleotides that
are not complementary to a polymorphic nucleotide sequence on a
target polynucleotide will usually not be joined.
[0117] In many variants of the presently disclosed method, the
length of the first and second complementary sequence of the first
and second complementary polynucleotide can be varied relative to
various criteria, for example the melting temperature of the
duplex, ionic strength of hybridization solution, complexity of the
target sequence (as discussed more below, mammalian genomic target
sequence can require longer target complementary sequences than
viral target DNA or synthetic target DNA, RNA, PNAs, LNAs),
etc.
[0118] After hybridization of the first complementary
polynucleotide and second complementary polynucleotide to the
target DNA sequences, the first and second complementary
polynucleotides are joined.
[0119] Where enzymatic ligation is used to join the first and the
second complementary polynucleotides, the first complementary
polynucleotide and second complementary polynucleotide for a given
locus can be ligated by connecting the 3' terminal hydroxyl (OH) of
the first complementary polynucleotide to the 5' phosphate
(PO.sub.4) of the second complementary polynucleotide. Successful
ligation creates a single product polynucleotide, depicted at FIG.
1D. Again, in some cases, a first complementary polynucleotide with
a 3' terminal nucleotide that is not complementary to a
polymorphism on the target polynucleotide can be ligated to a given
second complementary polynucleotide. This can represent a false
positive. In other methods of joining, such as non-enzymatic
chemical joining of iodo compounds, the polymorphic nucleotide or
nucleotides do not need to be at the terminal base or bases.
[0120] In some variations of the presently described method, the
product polynucleotides may be enriched. In these cases, enrichment
may be done by amplification. The product polynucleotide can be
amplified, for example, by PCR (polymerase chain reaction). The
product polynucleotides can also be sequenced, after, or in some
cases, before being amplified. In some variations, other
amplifications methods may be used, including but not limited to
loop-mediated isothermal amplification, transcription mediated
amplification, branched DNA and ligase chain reaction. It will be
understood that the product polynucleotide can be an enriched
polynucleotide, such as an amplification product.
[0121] In some variations wherein the method comprises an
enrichment step, and enrichment comprises amplification by PCR, PCR
primers can be used to amplify the product polynucleotides. The PCR
primers may comprise one or more and tag sequences, and a sequence
that is complementary, or identical, to a sequence on the product
polynucleotide. In many variations a first PCR primer may anneal to
the product polynucleotide at or near the 3' end of the product
polynucleotide. A polymerase can be used to elongate the first PCR
primer, resulting in a first amplification polynucleotide
comprising a first sequence of the first PCR primer and a second
sequence that is complementary to the product polynucleotide. A
second PCR primer may then anneal to the first amplification
polynucleotide at or near its 3' end. Elongation of the second PCR
primer results in a second amplification product comprising a first
sequence of the second PCR primer and a second sequence that is
complementary to the first amplification polynucleotide Annealing
the first PCR primer to the second amplification polynucleotide at
or near its 3' end, and elongating the first PCR primer can result
in a third amplification polynucleotide that is complementary to
the second amplification polynucleotide.
[0122] In some variations, the first and/or second PCR primers can
include tag sequences. The tag sequences can aid in identifying the
sample from which the amplification products were obtained, and can
add sequences necessary for subsequent sequencing. Tag sequences
for use in identifying the sample's origin may be referred to as a
sample-specific tag. For example, in one variation, the PCR primers
may add Illumina sequences for aid in capturing amplified
polynucleotides onto the Illumina flowcell for bridge
amplification. In other variations, the PCR primers may add
sequences for compatibility with other sequence data generation
methods.
[0123] In some variations the first complementary polynucleotide
and/or second complementary polynucleotide can further comprise tag
sequences. For example, identification of a locus, and/or
identification of the polymorphic nucleotide. In other variations,
the identity of the locus and/or polymorphic nucleotide may be
determined, directly, by sequencing through the product
polynucleotide. In various embodiments, linker or adaptor sequences
that can allow for annealing of PCR primers or processes involved
in sequence generation can be added. Tags can be used to determine
specific information, and linkers and adaptors can be used as a
component of physical, chemical, or enzymatic processes.
[0124] Tag sequences for use in annealing of PCR primers can be
referred to as amplification tag sequences, or PCR Tags (FIG. 2C).
PCR tags can allow PCR primers to anneal to the polynucleotide. In
other variations, PCR primers can anneal to target complementary
sequences in the first and second polynucleotides, and/or to other
sequences, for example a locus specific tag sequence, discussed
below.
[0125] In some variations of the presently disclosed method, the
complementary polynucleotides may further comprise a tag sequence
for identification of the locus. The first complementary
polynucleotide and/or second complementary polynucleotide can
comprise a locus-specific tag sequence 5' or 3', respectively, of
the target complementary sequence. FIG. 2D depicts the first
complementary polynucleotide and second complementary
polynucleotide of FIG. 2A with locus-specific tags. In most cases
wherein the first complementary polynucleotide has a locus-specific
tag, all first complementary polynucleotides that are specific for
a given locus will have an identical locus-specific tag. The
locus-specific tag can be any length, for example more than six,
seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or
fifteen nucleotides in length. As described herein, the identity of
the locus may also be directly determined by sequencing through one
or more of the tag sequences, product polynucleotide, complement of
the product polynucleotide, and/or amplification product of the
product polynucleotide.
[0126] In some variations the first complementary polynucleotide
can comprise a polymorphism-specific tag sequence 5' of the
complementary sequence. FIG. 2E depicts the first complementary
polynucleotides of FIG. 2B with polymorphism-specific tags (i, ii,
iii, iv). The polymorphism specific tags for each first
complementary polynucleotide at a given locus will differ in their
respective 3' nucleotides and their polymorphism-specific tags. In
some variations, the polymorphism specific tag can be one, two,
three, four, five, or more nucleotides. As described above, the
identity of the polymorphism can also be obtained, directly, by
sequencing through the complementary sequences of the first or
second complementary polynucleotide to the polymorphic nucleotide.
It will be appreciated that the second complementary polynucleotide
can contain the polymorphic nucleotide on its 5' side, which must
be 5' phosphorylated, and that such second complementary
polynucleotides would then contain polymorphism specific tags on
their 3' ends.
[0127] In some cases, PCR primers can be used to aid in
amplification of the product polynucleotides. In some variations,
one or both PCR primers for a given sample or individual can
further comprise a sample-specific (or individual-specific)
sequence tag. In cases where loci from multiple samples or
individuals can be sequenced together, each sample can first be
amplified separately, wherein a sample-specific tag sequence is
included in the first and/or second PCR primer, wherein the
sample-specific tag sequence and/or combination of sample-specific
tag sequences is a unique identifier of the origin sample. Each
product polynucleotide from a given sample can have a common
sample-specific tag or tags, as wherein both PCR primers include a
sample specific tag. In some cases, wherein both PCR primers
comprise a sample specific tag, the tag sequences may be the same
or they may differ. Sample-specific tags can be one, two, three,
four, five, six, seven, eight, nine, ten, or more nucleotides.
[0128] Tagging amplified products with sample-specific tags can
allow product polynucleotides from various samples to be combined,
and sequenced together. In these cases, the identity of the
individual or sample can be obtained by sequencing the
sample-specific sequence tag or tags of each product
polynucleotide.
[0129] FIG. 3 is a diagram of first complementary polynucleotide
and second complementary polynucleotide for use in one variation of
the present method to genotype based on SNP identification and
Illumina sequencing where the sample specific tags are part of the
complementary polynucleotides and no PCR enrichment is involved.
The Illumina FC A and FC B are Illumina fixed sequences and are
required in order to anneal to the Illumina flow cell. Sample
specific tags that were present in the first and second PCR primers
to aid in identifying the sample in the PCR based method are now
directly incorporated into the LHS and RHS probe sequences, and as
such no PCR is required. The Illumina PCR 1 and 2 are Illumina
fixed sequences were required for PCR amplification of the product
polynucleotides and are the locations of (and still used for), the
Illumina specific sequencing primers in the Illumina flow cell. The
polymorphism-specific tag is unfixed and can be any tag to spell
out any of the four nucleotide possibilities. The first
complementary polynucleotide and second complementary
polynucleotide vary according to the locus being interrogated.
[0130] In some variations sequencing is performed by next
generation sequencing. There are several common platforms currently
in use.
[0131] In some variations, the next generation sequencer is 454
technology developed by Roche. 454 technology uses microbeads to
which DNA fragments are captured and clonally amplified by emulsion
PCR (emPCR). In various permutations, each bead contains a large
number of identical copies of the parent DNA sequence. The beads
are deposited on a chip containing multiple wells, with each well
containing only one template bead. Each well is addressed by a
fiber optic for signal acquisition. 454 technology uses
pyrosequencing in which individual nucleotides are flown over the
beads containing the clonally amplified DNA fragments, and the
template-directed incorporation of a given nucleotide is detected
by an enzymatic cascade. The enzymatic cascade uses the
pyrophosphate (by-product of base incorporation) to generate a
light signal. The light signal intensity is proportional to the
number of bases incorporated, such that short homopolymers can be
reliably identified. After a wash, the process is repeated with
each of the remaining NTPs and the sequence of each DNA fragment is
determined from the pattern of light signals produced by each bead.
454 sequencing technology has a read length of 400-600 bases,
usually of unequal length. It has around 1 M reads per run, does
not perform paired reads, and requires approximately 10 hours.
[0132] 454 sequencers use natural NTPs, and are regarded to have
long read length, short run time, high accuracy. They also have
complicated sample preparation (e.g. emPCR); low number of reads,
and reads of unequal length.
[0133] Another example of next generation sequencing is SOLiD
(Sequencing by Oligonucleotide Ligation and Detection) (Applied
Biosystems). SOLiD uses microbeads to which DNA fragments are
captured and clonally amplified by emPCR. The beads are then
covalently bound on a glass slide and are microscopically imaged
during sequencing. SOLiD technology uses sequencing-by-ligation, in
which positions at increasing distance from the end of the molecule
are probed with fluorescently-labeled ligation probes. Each probe
has two discriminating bases at the end, and each position in the
template to be sequenced is probed twice (once at the first
position of a ligation probe, then again at the second position of
the next ligation probe).
[0134] SOLiD sequencing slides can be divided in 4 or 8 sections
and separate samples can be loaded on each section, increasing the
number of samples that can be run at once. Current SOLiD technology
can generate up to 100 Gb of sequence data per run, with a run time
of up to 16 days. SOLiD technology generates reads of equal
lengths, and it can produce paired end reads. Read length is
limited to 2.times.50 bases for paired end reads and to 60 bases
for single end reads. The system can perform up to 1.4 billion
reads with microbeads and up to 2.4 billion reads with nanobeads. A
run time can take 16 days for 50.times.50 reads. The system is
capable of high throughput, highest accuracy, the possibility of
obtaining of paired reads, and has a modular design of the
sequencing substrate (slides). The system has complicated sample
prep (e.g. emPCR), limited read length, long run time, and results
are provided in color space-instead of sequence-space.
[0135] Another exemplary next-generation sequencer is provided by
Illumina (also known as Solexa technology). Solexa relies on
capture primers covalently attached to the surface of glass flow
cells, which are used to capture and clonally amplify DNA fragments
for sequencing. The clonal amplification occurs on the surface by a
process called `bridge PCR` in which one parent molecule generates
a cluster of identical sequences. Illumina technology uses
`sequencing by synthesis` in which fluorescently-labeled,
chain-terminating nucleotides are incorporated one at a time in a
template-dependent order. After each cycle, the glass surface is
microscopically imaged and 4 color pictures are taken, and the base
that was incorporated into each cluster is determined; the dye and
chain terminator group are removed before the next cycle. The
location of each cluster is kept constant for all the cycles.
[0136] The Illumina method has a read length of 100 bases (HiSeq),
150 bases (GAIIx or MiSeq), 300 bases, 400 bases or more. It can
perform up to 600 Million reads/run (GAIIx) or 3 Billion reads/run
(HiSeq) or 5 Million reads/run (MiSeq), and is capable of
paired-end reads. The approximate run time is 14 days for
2.times.150 reads. The Illumina method has simple sample
preparation, relatively long reads, the possibility of obtaining
paired-end reads, and includes a modular design of sequencing
substrate (lanes on flow cell). The system also has a comparatively
long run time.
[0137] Other next generation sequencing platforms include Complete
Genomics, which uses DNA nanoball sequencing technology in
combination with proprietary software to determine the complete
genome of submitted samples. The technology is optimized for human
genome sequencing projects. The company offers DNA sequencing as a
service, and the sequencers are not commercially available.
[0138] Pacific Biosciences uses another NGS platform that uses
single molecule real time sequencing technology for gene
sequencing. The technology in its current form generates very long
reads (average 750 bp, longest reads up to 6 kb), but the number of
reads is limited (.about.20 k).
[0139] Ion Torrent is another exemplary NGS sequencing platform
that uses a technology similar to the 454 technology, with the
difference that the incorporated base is detected by a change in pH
as opposed to an enzymatic cascade. Ion Torrent technology
currently generates reads of about 100 bases, and up to 1 M reads
per run, with a run time of .about.2 h. Significant improvements of
both read length and throughput are expected for this
technology.
[0140] Helicos is another NGS sequencing platform that uses true
single molecule sequencing (tSMS) technology, in which the template
DNA strands are captured on a glass surface by covalently attached
capture primers, and are sequenced by the stepwise addition of
fluorescently labeled nucleotides, one at a time. The glass surface
is imaged after the addition of each base, and the location of each
newly incorporated base is recorded. The fluorescent group is then
cleaved and the next base is added. Helicos technology can generate
billions of reads per run, but the read length is currently limited
to about 25 bases.
Target Polynucleotides
[0141] The presently described method can be used for detecting the
presence or absence of a target polynucleotide. In some cases, the
target polynucleotide may be DNA and/or RNA. In some cases, the
method may be used to detect a nucleotide, or a nucleotide
sequence. In some cases the method may be used to identify a gene,
a locus, a polymorphism, a translocation, an insertion, a deletion,
a covalent or non-covalent modification, or a combination thereof.
In some cases the method may be used to identify transcribed
ribonucleic acids, for example, messenger RNA, transfer RNA,
interfering RNA, regulatory RNA, nuclear RNA, mitochondrial RNA,
etc.
[0142] The target polynucleotides may be of various lengths. For
example, the target polynucleotides may be longer than about 10 nt
and shorter than about 400 nt. In some cases, the target
polynucleotides may be of one length. In other cases, various
target polynucleotides may have different lengths. In various
cases, the target polynucleotide may be longer than about 20 nt, 30
nt, 40 nt, 50 nt, 60 nt, 70 nt, 80 nt, 90 nt, 100 nt, 110 nt, 120
nt, 130 nt, 140 nt, 150 nt, 160 nt, 170 nt, 180 nt, 190 nt, 200 nt,
210 nt, 220 nt, 230 nt, 240 nt, 250 nt, 260 nt, 270 nt, 280 nt, 290
nt, 300 nt, 310 nt, 320 nt, 330 nt, 340 nt, 350 nt, 360 nt, 370 nt,
380 nt, 390 nt, and shorter than about 400 nt, 390 nt, 380 nt, 370
nt, 360 nt, 350 nt, 340 nt, 330 nt, 320 nt, 310 nt, 300 nt, 290 nt,
280 nt, 270 nt, 260 nt, 250 nt, 240 nt, 230 nt, 220 nt, 210 nt, 200
nt, 190 nt, 180 nt, 170 nt, 160 nt, 150 nt, 140 nt, 130 nt, 120 nt,
110 nt, 100 nt, 90 nt, 80 nt, 70 nt, 60 nt, 50 nt, 40 nt, 30 nt, 20
nt.
[0143] The target sequences may be of various lengths. In some
cases the target sequence length may vary depending upon the
complexity and/or size of a sample. For example where the sample is
a genome. In other cases, the target sequence length may depend
upon the sequence of the target and the type and number of
nucleotides in the sequence. In other cases the target sequence
length may be varied depending on the melting temperature, Tm, of
the sequence, pH, salt concentration, or temperature of the
incubating step. In some cases the target sequence length will be
greater than about 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt,
11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20
nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt,
30 nt, 31 nt, 32 nt, 33 nt, or 34 nt and less than about 35 nt, 34
nt, 33 nt, 32 nt, 31 nt, 30 nt, 29 nt, 28 nt, 27 nt, 26 nt, 25 nt,
24 nt, 23 nt, 22 nt, 21 nt, 20 nt, 19 nt, 18 nt, 17 nt, 16 nt, 15
nt, 14 nt, 13 nt, 12 nt, 11 nt, 10 nt, 9 nt, 8 nt, 7 nt, 6 nt, or 5
nt. In many cases where a sample may or may not have multiple
target sequences and/or polynucleotides, the Tm's of the various
target sequences will be within about 1.degree. C., about 2.degree.
C., about 3.degree. C., about 4.degree. C., about 5.degree. C.,
about 6.degree. C., about 7.degree. C., about 8.degree. C., about
9.degree. C., and about 10.degree. C. of each other.
Detection of Nucleotide Polymorphism
[0144] In some variations the target polynucleotides can be
obtained from genomic DNA. Genomic DNA can be obtained from a
variety of organisms, for example animals, plants, microbes,
bacteria, viruses, etc. In some variations, genomic DNA is obtained
from domesticated mammals, fowl, fish, and wild or cultured plants.
In other variations, the target polynucleotides can be non-genomic
DNA, for example synthetic DNA or DNA fragments. In variations
wherein the target polynucleotides are obtained from an individual
(ie genomic DNA), loci can be associated with specific genes, and
polymorphisms can be associated with alleles of those genes. The
target polynucleotide can be any target polynucleotide described
herein.
[0145] Genes are sequences of DNA that code for proteins or for RNA
chains, and include other DNA sequences that affect how, when, and
how much of that protein and/or RNA sequence is made by the cell.
Many plants and animals carry two copies of each gene (diploid),
one copy inherited from each parent. These two copies can be
identical, similar, or they can be different. In some variations,
only no copies, one copy or more than two copies may be present. In
some variations the organism may be haploid, triploid, tetraploid
and higher. Within a large population of a species, many alleles of
a gene can exist, but a single diploid organism, in most cases,
will carry one or two alleles, or can include non-coding
polynucleotides (e.g. DNA or RNA).
[0146] Different alleles can be associated with distinctive
characteristics or traits that are passed-on from a parent to its
offspring. In some cases, genes, and their alleles can be
associated with dramatic and readily observable differences.
Observable differences include, for example, eye-color, hair color,
etc. Some genes, and alleles thereof can result in changes in
metabolism, biochemical pathways, behavior, and other traits that
are less readily observable. In some cases, a specific trait or
characteristic can be the result of a combination of multiple genes
and/or multiple alleles.
[0147] Alleles can be identified directly or indirectly. Direct
identification involves identifying the nucleotide change or
changes that give rise to the allelic difference, for example a
mutation that deletes, truncates, or mutates a protein or RNA,
makes a protein or RNA more or less active, or leads to over or
under-expression of a protein or RNA. Indirect identification
involves identifying changes in the DNA that are closely associated
with inheritance of that allele. In some cases, the DNA changes can
be within the gene itself, or in DNA sequences outside, or between
the genes of interest.
[0148] In some variations of the present disclosure, alleles can be
investigated through association with one or more nucleotide
polymorphisms. In some variations, the polymorphism can occur at a
single nucleotide position. In some variations one allele can be
associated with a first nucleotide, for example thymine, at a given
position and an alternative allele associated with a second
nucleotide, for example cytosine, at that position. In other
variations, the nucleotide polymorphism can include substitutions,
deletions, insertions, copy number variation, translocations,
nucleotide modification (such as methylation), and other changes in
DNA sequence. In some variations the polymorphism can include two,
three, four, or more contiguous nucleotides.
[0149] In some cases, many loci can be investigated in a single
individual. In some variations, this can be used to genotype or
DNA-fingerprint the individual. In some cases, by genotyping or
DNA-fingerprinting an individual, it can be possible to determine
the characteristics of that individual, for example specific traits
or relatedness to specific groups of individuals. Finger printing
can also be used to identify a specific individual from a pool of
related individuals.
[0150] With reference to FIG. 1, the polymorphic nucleotide at
Locus A can be either T or G. Thus individuals that are diploid for
Locus A can be one of three genotypes: T/T, T/G, or G/G. In some
instances, in a normally diploid species, an individual can have
more than two copies of a gene and/or allele (as in trisomy), in
other cases, an individual can have a single copy of a gene (as in
monosomy).
[0151] Variations of the presently disclosed method may be used to
analyze nucleotide polymorphisms, comprising a single nucleotide or
multiple nucleotides. In some cases a single nucleotide position
can be associated with two, three, or four different alleles. In
some cases, one allele can be associated with multiple nucleotide
polymorphisms.
[0152] FIG. 4 depicts one use of the present method to determine
the genotype of a single target polynucleotide using complementary
polynucleotides that further comprise a PCR tag sequence (diagonal
lines). Here, two complementary polynucleotides are used. Each
first complementary polynucleotide consists of a first
complementary sequence, or hybridization sequence, and a PCR
amplification sequence. The first complementary polynucleotide
sequence further includes a 3' nucleotide(s) sequence that is
complementary to the polymorphic nucleotide sequence on the target
polynucleotide (in this figure "A"). The second complementary
polynucleotide includes a second complementary sequence and a 5'
phosphate group. If the first complementary polynucleotide
sequence, including the 3' terminal nucleotide(s) base pairs with
the target polynucleotide, a ligase enzyme will be able to ligate
the first and second complementary polynucleotides to create a
single ligated product polynucleotide If however, the first
polynucleotide sequence 3' nucleotide(s) does not basepair with the
target polynucleotide's polymorphic nucleotide sequences, the
ligase may be unable to ligate the two polynucleotides. Thus, the
ligase is used to discriminate a base pair mismatch at the first
complementary polynucleotide sequence's 3' position.
[0153] As shown in steps (c) and (d) of FIG. 4, the next step in
the presently disclosed method involves amplification of product
polypeptides. For this step, the PCR amplification sequences on the
first complementary polynucleotide and second complementary
polynucleotide can be used to aid in creating highly multiplexed
reaction. The enriched product polynucleotides can then be
submitted for sequence data generation.
[0154] Step (a) of FIG. 4 shows the target polynucleotide with an
adenine, "A," polymorphic nucleotide, two first complementary
polynucleotides (LHS; one with a 3' G nucleotide [LHS-G] and its
counterpart with a 3' T nucleotide [LHS-T]) and one second
complementary polynucleotide (designated RHS) that is 5'
phosphorylated (P) is added to target polynucleotide. Step (b)
shows the period after hybridization, wherein a ligase is added and
the successfully hybridized LHS-T is ligated to the adjacent RHS
polynucleotide. Step (c) depicts the ligation polynucleotide
serving as a template for PCR amplification. Step (d) shows a first
PCR primer (diagonal arrow) directing amplification (second PCR
primer not shown).
[0155] The locus shown in FIG. 4 can be A or C. Thus the LHS
polynucleotides are either LHS-T or LHS-G, with T or G, at their 3'
terminal nucleotides, respectively. In an genome that is homozygous
for the A allele at this particular locus, (A/A), only a first
complementary polynucleotide with a 3' T nucleotide, LHS-T, would
basepair with the target polynucleotide, allow ligation between the
first and second complementary polynucleotides, and form a
subsequent product polynucleotide in the amplification step. The
LHS-G polynucleotide, shown with a thick dark line in the middle,
does not hybridize with an A/A homozygous sample having two target
polynucleotides with A at the polymorphic nucleotide. An A/C
heterozygous genome would produce two product polynucleotides:
LHS-T joined to RHS and LHS-G joined to RHS. A C/C homozygous
genome would produce the LHS-G joined to RHS product
polynucleotide.
[0156] In some variations, during the PCR amplification step, a
sample-specific tag sequence can be added to the first and/or
second PCR primers and incorporated into the product
polynucleotides. In some variations, two different sample-specific
tags (one on each PCR primer) can aid in increasing the number of
individuals that can be analyzed in a single genotyping experiment.
In some variations, where fewer samples, or individuals are
analyzed in a single experiment, only one PCR primer can include a
sample-specific tag sequence. In some variations, the sample
specific tag is on the LHS and/or the RHS and is not introduced in
this PCR enrichment step.
[0157] In variations wherein the product polynucleotides are
sequenced by next generation sequencing, the PCR primers can also
contain sequences for use with a specific sequencing technique. For
example, in some variations, Illumina sequencing can be used and
the PCR primers can include sequences for permitting the product
polynucleotides to anneal to the surface-bound DNA oligonucleotides
within an Illumina NGS flow cell. In some variations, the sequences
required for Illumina based sequence data generation are on the LHS
and or the RHS and are not introduced in this PCR enrichment
step.
[0158] In some variations, two sequence data generation reads can
be performed in order to identify the sample, locus, and allele
identities of each product polynucleotide. In other variations,
three sequence data generation reads can be used to determine the
individual, locus, and allele identities of each product
polynucleotide. In some variations, one sequence data generation
read can be performed in order to identify the sample, locus, and
allele identities of each product polynucleotide. In some
variations, four sequence data generation reads can be performed in
order to identify the sample, locus, and allele identities of each
product polynucleotide.
[0159] In some variations the various first complementary
polynucleotide, specific for a given locus, can include short
polymorphism-specific or allele-specific tags (FIG. 5). The
polymorphism-specific tag can allow identification of the specific
polymorphic nucleotide (or allele) without having to sequence
through the complementary/target sequences. Identification of the
polymorphism in this way, can shorten read lengths and minimize
sequencing reagent use and data acquisition time.
Polymorphism-specific tags can be designed to allow up to 1, 2, 3,
4 or more sequencing errors while still allowing identification of
the specific allele. In some variations, polymorphism-specific tags
can be designed to allow up to 1, 2, 3, 4 or more sequencing errors
while still allowing identification of the specific allele. In some
variations, sample-specific tags can be designed to allow up to 1,
2, 3, 4 or more sequencing errors while still allowing
identification of the specific sample. In some variations,
locus-specific tags can be designed to allow up to 1, 2, 3, 4 or
more sequencing errors while still allowing identification of the
specific locus. Specific loci can also be identified by sequencing
through the complementary/target sequences. In some variations,
less than 15 nucleotides or more can be used to identify the
individual polynucleotides and thus the specific locus.
[0160] FIG. 5 depicts the PCR steps used to add sample-specific
sequence tags and the steps involved in reading said tags. In Step
(a), after ligation of the first complementary polynucleotide (the
3' A nucleotide is shown) (LHS) and second complementary
polynucleotide (RHS), a PCR primer containing a sample-specific
sequence tag (GACATAG) directs PCR amplification of a first PCR
product. In Step (b), a second PCR primer anneals to the first PCR
product. The second PCR primer includes a second sample-specific
sequence tag (CAGTCTG). In this figure, the reverse complement of
the final product polynucleotide is shown and the 5' end that is
bound to a sequencing flow cell is noted (5'). In Step (c), a first
sequencing primer (sequencing primer 1; open arrow) is used to
generate sequence data on the 7-base sample-specific sequence tag.
In Step (d), a second sequencing primer (sequencing primer 2) is
used to generate sequence data on the 5-base polymorphism-specific
sequence tag and the first 10 bases of the first complementary
polynucleotide (locus-specific sequence tag). In Step (e), a third
sequencing primer (sequencing primer 3) is used to generate
sequence data on a second sample-specific sequence tag. Sequencing
reads from Steps (c) and (d) can be combined such that one long
read starting with the outer Illumina primer (open arrow under
GTCAGAC), generates the sequence data on the left sample-specific
sequence tag, then a common PCR primer region (left thick bar), the
polymorphism-specific sequence tag, and then the first
complementary polynucleotide sequence containing the locus-specific
sequence tag.
[0161] If the Illumina tags on either end of the LHS and RHS are
exchanged, then the sequence read strategy can begin from the right
side. In some embodiments, the read lengths would need to increase
as the allele information exists in the LHS and not the RHS probe
sequences. In other embodiments the allele tag may be placed on the
RHS probe. Alternatively, the Illumina tags on either end of the
LHS and RHS are swapped for one another and the allele (or other
variation) information is on the RHS probe sequence. In other
embodiments, sample and or locus tags may be placed in the RHS. In
further embodiments the tags may be placed in either or both LHS
and RHS probes. In further embodiments the tags may be in the LHS
and or RHS probes or they may be added to the product
polynucleotide after it is formed.
[0162] In many variations, the presently disclosed method can use
low molecular weight target polynucleotides when only short regions
of the polynucleotide are required for hybridization.
[0163] FIG. 15 depicts a non-ligation-based strategy comprising PCR
in the joining step of the method.
[0164] With reference to FIG. 15, two different target
polynucleotide (A and B) are shown in single stranded forms (bottom
strand 3' to 5'). In the first amplification reaction, first
complementary polynucleotide (A1) and second complementary
polynucleotide (A2) amplify target polynucleotide A, while first
complementary polynucleotide (B1) and second complementary
polynucleotide (B2) amplify target polynucleotide B. In some
variations, including this one, the second complementary sequence
can be identical to the second target sequence, instead of
complementary to it. In the amplification step, PCR tag sequences
of first complementary polynucleotide (A1) and first complementary
polynucleotide (B1), and second complementary polynucleotide (A2)
and second complementary polynucleotide (B2), permit Sample Tagging
Primer 1 and Sample Tagging Primer 2 to amplify both target
polynucleotide A and target polynucleotide B concurrently. In
various embodiments, it will be understood that any of, or any
combination of, Primers A1, A2, B1, and B2 can include
sample-specific tags, and further that the sample-specific tags can
be included in either the joining or enrichment steps. The joining
and enrichment steps can be performed in a single reaction or in
multiple, discrete successive reactions.
[0165] Various tags can be included in any of the amplification
steps. These tags can be specific for a sample, an allele or set of
alleles, a target, and/or a locus or set of loci.
[0166] In one variation, the product polynucleotides can include
one or more Illumina or other NGS-specific sequence. In this
variation, the sequences in the product polynucleotide are arranged
as shown with Illumina FC A and FC B on each end. These are the
flow cell binding sequences. Next are the Sample Tagging Primer 1
tag sequence, then the first complementary polynucleotide (A1) or
first complementary polynucleotide (B1) sequence, then
polymorphism-containing target sequence, then the second
complementary polynucleotide (A2) or second complementary
polynucleotide (B2) sequence, the next Sample Tagging Primer 2 tag,
and the final Illumina FC B flow cell binding sequence. It will be
understood that the sequences can exist without NGS sequences (e.g.
Illumina FC A and FC B).
[0167] This disclosure makes possible the high-throughput, lost
cost genotyping of large numbers of samples for targeted
polymorphism detection, including single-nucleotide polymorphism
(SNP) detection, through next generation sequencing (NGS). By
applying sample tags to the product polynucleotides, the sample
from which each sequence read can be determined based on sample tag
sequence in a specified location within the sequence of each read.
Many samples can be pooled prior to obtaining a library for
sequencing.
[0168] In various embodiments, any amplification reaction can be
used. For example, the polymerase chain reaction (PCR) can be used
to add tags to polynucleotides, making it feasible to pool
thousands or tens of thousands of samples within one NGS lane. Two
independent tags can be combined at different locations within the
polynucleotide to allow labeling many samples using relatively few
primers (e.g., 96.times.384=36,864 samples identified by 96+384=480
primers). In contrast with other applications of tagging samples
for NGS, the method produces sequencing reads only of specifically
tagged targets, such as SNPs. Therefore sequencing reads are not
wasted on uninformative loci and the number of samples
(individuals) that can be evaluated in one NGS lane is much greater
(tens of thousands).
[0169] In various embodiments, the test can be used in agricultural
industries. A large number of animals can be tested in a single
run. The accuracy of testing could be improved greatly by
genotyping several hundred of the most significant SNPs from
research populations in 10-30,000 animals, including beef cattle,
dairy cattle, swine and sheep. Outside agriculture, the method can
be used to identify sequences in human genetics, food safety
testing, environmental sampling, research animal genotyping, and
human and livestock diagnostics.
[0170] The following example was performed: In the original
proof-of-concept application (developed by ARS), the target SNP
fragments were selected by highly multiplexed (96-fold) PCR. The
method (and others described) uses the plateau effect of PCR to
normalize the number of sequence reads with respect to both
individuals and SNP loci.
[0171] In some variations, the joining step further comprises a PCR
reaction in which the first and second complementary
polynucleotides are PCR primers, the second complementary
polynucleotide is identical to the second target sequence, and the
second complementary polynucleotide is oriented 3' to 5' from left
to right.
[0172] In some variations, the joining and enrichment steps are
combined in one reaction step.
Genotyping
[0173] One variation of the presently described method combines
identification of allele-associated nucleotide polymorphisms, and
high throughput parallel sequencing technology, in order to
simultaneously genotype or fingerprint very large numbers of
individuals at a moderately large number of loci.
Sample
[0174] The sample can be anything that includes the target
polynucleotide. For example, a sample can be obtained from a
biological sample. Optionally, the sample can be modified by adding
or removing non-nucleic acid components. The polynucleotide in the
sample can be modified. Samples need not be homogenous. The sample
may or may not contain a mixture of polynucleotides from many
organisms. The sample may or may not contain a mixture of
polynucleotides from individuals of the same species. The sample
may or may not have been processed so that the analyte is a
non-nucleic acid molecule. The sample can contain polynucleotides
that have been processed, such as by amplification, purification,
digestion, chemical modification, enrichment, selection, etc. The
sample may or may not contain one or more non-target
polynucleotides.
[0175] Sample DNA, target polynucleotides, can be obtained from a
variety of sources. For example, the presently disclosed method can
be used to genotype domesticated animals, non-domesticated animals,
cultivated plants, non-cultivated plants, micro-organisms, viruses,
and humans. In these variations, genomic DNA can be obtained. In
some variations individuals can be mammals, for example, humans,
cows, sheep, hogs, pigs. In other variations the individuals can be
fish, for example, trout, salmon, or fowl, for example chicken,
turkey, etc. In other variations, target polynucleotides other than
genomic DNA can be used. For example, target polynucleotides can
also be mitochondrial DNA, chloroplast DNA, extra-chromosomal DNA,
plasmid DNA, artificial DNA, transposable elements, etc. Sources of
target DNA can include air, water, soil, food, tissue, skin, hair
follicles, feces, waste, semen, saliva, blood, and other bodily
fluids. In some variations, samples can be obtained from a crime
scene.
[0176] In many variations, the amount of DNA obtained can be less
than about 100 .mu.g, about 10 .mu.g, about 1 .mu.g, about 100 ng,
about 10 ng, about 1 ng, about 100 pg, about 10 pg, about 1 pg, or
about 100 fg. In some variations, the target polynucleotides can be
isolated from samples using a variety of methods, for example
mechanical isolation (such as glass-bead technology), chemical
extraction methods, column based methods, or combinations thereof.
DNA extraction methods are well-known to one of skill in the art,
for example in Molecular Cloning: A Laboratory Manual, Third
Edition, Joe Sambrook and David Russell, Jan. 15, 2001 (3rd
edition), ISBN-10: 0879695773.
[0177] In some variations of the presently disclosed method, the
target polynucleotides can have an average length of between 10 kbp
and 100 kbp. In other variations, the target polynucleotides can
have an average length of less than 10 kbp, or greater than 100
kbp. In other variations, the target polynucleotides can have an
average length of less than 1 kb. In other variations, the target
polynucleotides can have an average length of less than 750 bases.
In other variations, the target polynucleotides can have an average
length of less than 500 bases. In other variations, the target
polynucleotides can have an average length of less than 250 bases.
In other variations, the target polynucleotides can have an average
length of less than 100 bases. In other variations, the target
polynucleotides can have an average length of less than 50 bases.
In many variations, the purified and isolated target
polynucleotides can comprise little or no salt, for example the
salt concentration can be less than 60 mM, 10 mM, 1 mM, 100 .mu.M,
10 .mu.M, 1 .mu.M, 100 nM, 10 nM, or 1 nM.
[0178] First and Second Complementary Polynucleotides
[0179] In many variations, the length of the complementary sequence
of the second and first complementary polynucleotide can be
determined based upon the length, sequence, and Tm of a given
complementary/target sequence, as well as the complexity of the
sample DNA. For example, in some variations wherein the target
polynucleotides are obtained from genomic DNA, the length of the
complementary sequence can vary with the size of the organism's
genome, for example a complementary sequence for a mammal can be
required to be longer than the complementary sequence of a virus or
a bacterium.
[0180] As described above, in some variations, the size of a given
complementary sequence can correspond to the complexity of the
target DNA. For example, a viral genome can comprise between 1 kb
and 1 Mb. For a 1 kb viral genome, a specific 5 nt polynucleotide
should occur only once (4.sup.5=1,024), while 10+ nt polynucleotide
would theoretically be required to interrogate a 1 Mb genome
(4.sup.10=1.049M), and a 16+ nt polynucleotide would theoretically
be required to interrogate a 1 Bp genome (4.sup.16=4.3B). Thus, in
some variations, it can be possible to make a set of first and
second complementary polynucleotides that are specific for
pathogenic viruses.
[0181] For example, a polynucleotide sequence specific for the
human pathogen E. coli 0157 can be detected from a 40 to 90 base
region specific for this bacteria strain (or any pathogen DNA
sequence or antibiotic resistance DNA sequence). In other
variations, a 30 base region can be detected. In other variations,
a 20 base region can be detected. In other variations, a 10 base
region can be detected. Other polynucleotides would be made for
other bacteria, or even viruses, or other organism or other
sequences whose detection is desired. The polynucleotide panel
would be run with a gDNA sample obtained from patient, saliva, gut
lavage, stool sample, blood sample, food sample, animal sample,
processing facility sample, air sample, plant sample, water sample,
swab, swipe, etc. The sequencing library would be made, tagged for
the number of samples in the library and sequence data generated.
The results would show the relative intensity of the E. coli gDNA
in the sample. Thus indicating the presence of that bacteria, or
bacterial strain, or virus or organism, or presence of an
antibiotic resistance DNA sequence, etc. As copy number variation
can be detected, the test could also be made semi-quantitative.
[0182] In another variation, the first and second complementary
sequences are complementary to a target polynucleotide in the
organism to be detected. In one variation, human saliva is
processed into genomic DNA, which contains a mixture of human and
bacterial genomic DNA. The DNA is mixed with a panel of first and
second complementary polynucleotides that have sequences
characteristic of cariogenic bacteria, a common fungal agent, and
commensal bacteria, and target sequences that are common in most
bacterial species. After hybridization of the panel of first and
second complementary polynucleotides to the target polynucleotides,
adjacent first and second complementary polynucleotide are joined,
for example by the Taq DNA ligase enzyme to produce a panel of
product polynucleotides. Optionally, sample specific tags, and/or
sequences required for the Illumina sequencing reaction, are added
by PCR. Sample tags are sequenced and compiled by sample and
microbial target based on the microbial target locus tag. An
example of the resulting data is depicted in FIG. 14. The sequence
reads derived from the first complementary polynucleotide provide
the tag for the locus information. Reading, or generating sequence
data from, 6 to 15 bases of the first complementary polynucleotide
can be sufficient to distinguish it from any of the first
complementary polynucleotides in the panel.
[0183] A panel of probes (Terefework et al. 2008) with target
polynucleotide sequences specific for cariogenic oral bacteria as
well common oral bacterial and tagged with Illumina specific
sequences were generated. Human saliva samples were processed to
obtain purified genomic DNA. This genomic DNA was analyzed by the
methods described herein. Samples were separately tagged. The first
and second complementary polynucleotides were designed based on the
target sequence described in Terefework, Z., C. L. Pham, et al.
(2008). "MLPA diagnostics of complex microbial communities:
relative quantification of bacterial species in oral biofilms." J
Microbiol Methods 75(3): 558-565.
[0184] The first and second complementary polynucleotides may be of
various lengths. For example, the first and second complementary
polynucleotides may be longer than about 10 nt and/or shorter than
about 400 nt. In some cases, the first and second complementary
polynucleotides are of the same length, In other cases, the first
and second complementary polynucleotides are of different lengths.
In some cases one set of first and second complementary
polynucleotides may have the same lengths as another set of first
and second complementary polynucleotides. In various cases, the
first and second complementary polynucleotides may be longer than
about 20 nt, 30 nt, 40 nt, 50 nt, 60 nt, 70 nt, 80 nt, 90 nt, 100
nt, 110 nt, 120 nt, 130 nt, 140 nt, 150 nt, 160 nt, 170 nt, 180 nt,
190 nt, 200 nt, 210 nt, 220 nt, 230 nt, 240 nt, 250 nt, 260 nt, 270
nt, 280 nt, 290 nt, 300 nt, 310 nt, 320 nt, 330 nt, 340 nt, 350 nt,
360 nt, 370 nt, 380 nt, 390 nt, and shorter than about 400 nt, 390
nt, 380 nt, 370 nt, 360 nt, 350 nt, 340 nt, 330 nt, 320 nt, 310 nt,
300 nt, 290 nt, 280 nt, 270 nt, 260 nt, 250 nt, 240 nt, 230 nt, 220
nt, 210 nt, 200 nt, 190 nt, 180 nt, 170 nt, 160 nt, 150 nt, 140 nt,
130 nt, 120 nt, 110 nt, 100 nt, 90 nt, 80 nt, 70 nt, 60 nt, 50 nt,
40 nt, 30 nt, 20 nt.
[0185] In some cases, the first and second complementary
polynucleotides may comprise complementary sequences and other
nucleotides, nucleotide sequences, or tags. In some cases, the
first and/or second complementary polynucleotide may comprise a
polymorphism-, allele-, or nucleotide-specific tag, locus-specific
tag, sample-specific tag, or combinations thereof. In some cases,
the first and/or second complementary polynucleotides may comprise
an amplification-specific tag, or a sequencing-specific tag.
Amplification-specific tags may be used in cases wherein the method
includes an amplification-based enriching step. Sequencing-specific
tags may be specific for various types of sequencing protocols.
[0186] The complementary sequences may be of various lengths. In
some cases the complementary sequence length may vary depending
upon the complexity and/or size of a sample, for example where the
sample is a small genome of a sample from a complex environment. In
other cases, the complementary sequence length may depend upon the
target sequence and the type and number of nucleotides in that
sequence. In other cases the complementary sequence length may be
varied depending on the melting temperature, Tm, of the sequence,
pH, salt concentration, or temperature of the incubating step. In
some cases the complementary sequence length will be greater than
about 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12
nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt,
22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, 30 nt, 31
nt, 32 nt, 33 nt, or 34 nt and less than about 35 nt, 34 nt, 33 nt,
32 nt, 31 nt, 30 nt, 29 nt, 28 nt, 27 nt, 26 nt, 25 nt, 24 nt, 23
nt, 22 nt, 21 nt, 20 nt, 19 nt, 18 nt, 17 nt, 16 nt, 15 nt, 14 nt,
13 nt, 12 nt, 11 nt, 10 nt, 9 nt, 8 nt, 7 nt, 6 nt, or 5 nt. In
many cases where a sample may or may not have multiple
complementary sequences and/or polynucleotides, the Tm's of the
various complementary sequences will be within about 1.degree. C.,
about 2.degree. C., about 3.degree. C., about 4.degree. C., about
5.degree. C., about 6.degree. C., about 7.degree. C., about
8.degree. C., about 9.degree. C., and about 10.degree. C. of each
other.
[0187] In some variations the thermodynamic equation for Tm is
based on nearest-neighbor interactions;
Tm=((.DELTA.H.degree.1000)/(A+AS.degree.+R
ln(C.sub.t/4)))-273.15+16.6 log [Na.sup.+].
Where .DELTA.H (Kcal/mol) is the sum of the nearest neighbor
enthalpy changes for hybrids, A is a small, but important constant
containing corrections for helix initiation, .DELTA.S (eu) is the
sum of the nearest neighbor entropy changes, R is the Gas Constant
(1.987 cal deg mol.sup.-1) and C.sub.t is the total molar
concentration of strands. If the strand is self-complementary,
C.sub.t/4 is replaced by C.sub.t. .DELTA.H, .DELTA.S, .DELTA.G
values for nearest neighbor interactions of DNA 1 M NaCl are:
TABLE-US-00001 Nearest-neighbor sequence .DELTA.H.degree.
AS.degree. AG.degree..sub.37 (5'-3'/3'-5') kJ/mol J/(mol K) kJ/mol
AA/TT -33.1 -92.9 -4.26 AT/TA -30.1 -85.4 -3.67 TA/AT -30.1 -89.1
-2.50 CA/GT -35.6 -95.0 -6.12 GT/CA -35.1 -93.7 -6.09 CT/GA -32.6
-87.9 -5.40 GA/CT -34.3 -92.9 -5.51 CG/GC -44.4 -113.8 -9.07 GC/CG
-41.0 -102.1 -9.36 GG/CC -33.5 -83.3 -7.66 Terminal A-T base pair
9.6 17.2 4.31 Terminal G-C base pair 0.4 -11.7 4.05
[0188] In some cases, Tm can be determined by methods well known to
one of skill in the art, for example by using an algorithm such as
that found in the oligo designing program Go-Oli-Go. For example,
Tm is determined by standard/common algorithms such as the nearest
neighbor as taught, for example, in Breslauer et al., (1986) Proc.
Nat. Acad. Sci. 83:3746-50. A first complementary polynucleotide
and second complementary polynucleotide can be greater than 17 nt,
18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27
nt, 28 nt, 29 nt, 30 nt, 31 nt, 32 nt, 33 nt, 34 nt, and less than
35 nt, 34 nt, 33 nt, 32 nt, 31 nt, 30 nt, 29 nt, 28 nt, 27 nt, 26
nt, 25 nt, 24 nt, 23 nt, 22 nt, 21 nt, 20 nt, 19 nt. In many
variations the length of a complementary sequence of a specific
first complementary polynucleotide or second complementary
polynucleotide, can depend on the specific sequence of nucleotides.
In most variations the annealing temperature, or melting
temperature, Tm, of a specific sequence will be great than about
69.degree. C., about 74.degree. C., about 79.degree. C., about
84.degree. C., about 89.degree. C., or about 94.degree. C. and less
than about 95.degree. C., about 90.degree. C., about 85.degree. C.,
about 80.degree. C., about 75.degree. C., or about 70.degree. C. In
some variations the hybridization sequences can have Tm within
about 1.degree. C., about 2.degree. C., about 3.degree. C., about
4.degree. C., about 5.degree. C., about 6.degree. C., about
7.degree. C., about 8.degree. C., about 9.degree. C., and about
10.degree. C. of each other.
[0189] In some variations, a first complementary polynucleotide
sequence, in addition to the 3' polymorphic nucleotide and the
complementary sequence, can further comprise a polymorphism-tag
sequence. In some variations, the polymorphism-tag sequence is not
complementary to target sequence at the given locus. In some
variations the polymorphism-tag sequence can code for the identity
of the 3' polymorphic nucleotide on a specific first complementary
polynucleotide, and thus the specific polymorphic nucleotide in the
target polynucleotide. In some variations, the polymorphism-tag
sequences of the various first complementary polynucleotide,
specific for a given locus, will not be the same. In some
variations the polymorphism-tag sequence can be more that about 1
nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, or 10 nt, or
less than about 15 nt, 14 nt, 13 nt, 12 nt, 11 nt, 10 nt, 9 nt, 8
nt, 7 nt, 6 nt, 5 nt, 4 nt, 3 nt, or 2 nt.
[0190] In some variations, the polymorphism-tag sequence can code
for a specific nucleotide: adenine, thymine, cytosine, or guanine
In variations wherein the polymorphism-tag sequence codes for a
specific nucleotide identity, first complementary polynucleotide
from different loci can have similar or the same polymorphism-tag
sequences. For example, in one variation of the polymorphism-tag
sequence GTCTC can code for a thymine, T, nucleotide; GCACT for C;
GGAGT for G; and GACAC for A. In other variations, T, C, G, and A
can be coded for by different sequences.
[0191] In some variations the first complementary polynucleotide
can further comprise a locus-specific tag sequence. In some
variations the locus-specific tag sequence cannot be complementary
to target sequence at a given locus. In some variations the
locus-specific tag sequence can code for the identity of a given
locus. In some variations, the locus specific tag sequence can be
greater than 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11
nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, or 20
nt, and less than about 29 nt, 28 nt, 27 nt, 26 nt, 25 nt, 24 nt,
23 nt, 22 nt, 21 nt, 20 nt, 19 nt, 18 nt, 17 nt, 16 nt, 15 nt, 14
nt, 13 nt, 12 nt, 11 nt, 10 nt, 9 nt, 8 nt, 7 nt, 6 nt, or 5
nt.
[0192] In some variations, the first complementary polynucleotide
and second complementary polynucleotide can include sequences used
in amplification (e.g. PCR). In some variations, the amplification
sequences can be complementary to, or completely complementary to,
sequences of polymerase chain reaction (PCR) amplification primers.
In some variations, the amplification sequences can have lengths
greater than 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11
nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, or 20
nt, and less than about 29 nt, 28 nt, 27 nt, 26 nt, 25 nt, 24 nt,
23 nt, 22 nt, 21 nt, 20 nt, 19 nt, 18 nt, 17 nt, 16 nt, 15 nt, 14
nt, 13 nt, 12 nt, 11 nt, 10 nt, 9 nt, 8 nt, 7 nt, 6 nt, or 5
nt.
[0193] In some variations the first complementary polynucleotide
and second complementary polynucleotide of a given locus can
further comprise sequencing tags. In some variations, the
sequencing tag sequence can be greater than 3 nt, 4 nt, 5 nt, 6 nt,
7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt,
17 nt, 18 nt, 19 nt, or 20 nt, and less than about 29 nt, 28 nt, 27
nt, 26 nt, 25 nt, 24 nt, 23 nt, 22 nt, 21 nt, 20 nt, 19 nt, 18 nt,
17 nt, 16 nt, 15 nt, 14 nt, 13 nt, 12 nt, 11 nt, 10 nt, 9 nt, 8 nt,
7 nt, 6 nt, or 5 nt. In some variations the sequencing tags and/or
PCR tags can comprise sequences that correspond to part or all of
an Illumina sequencing adapter. In one variation, the two Illumina
tags can be (A)=5'-AG-ACGTGTGCTCTTCCGATCT on the second
complementary polynucleotide, and (B)=5'
A-CACTCTTTCCCTACACGACGCTCTTCCGATCT on the first complementary
polynucleotide. These sequences can be reversed as required. For
example the Illumina A tag can replace the Illumina B tag so long
as the Illumina B tag is replaced with the Illumina A tag.
[0194] In some variations, the second complementary polynucleotide
can further comprise a 5' terminal phosphate group.
Incubating
[0195] The target polynucleotides can be made single stranded by
denaturation. The samples may be denatured before or after
combining with the first and second complementary polynucleotides.
In some cases, samples comprising target polynucleotides can be
denatured in a solution. The solution can be any solution known in
the art. For example, a water solution without buffer can be used.
Alternatively, a solution of Tris-HCl and EDTA can be used. After
raising the temperature of the solution to about 98.degree. C. for
about five minutes, double stranded polynucleotides are denatured.
In these cases, after denaturation of the target polynucleotides,
first complementary polynucleotides, second complementary
polynucleotides, and a hybridization solution can be added to
create an incubation mix, to aid in creating duplex DNA. In other
cases, the sample, and first and second complementary
polynucleotides may be combined and then the sample may be
denatured. In some cases, the sample may be single stranded and may
not need to be denatured.
[0196] The temperature of the hybridization solution can then be
raised to about 98.degree. C. for about 1 min to about 10 min. In
other variations, the incubation mix can be raised to greater than
about 95.degree. C., about 96.degree. C., about 97.degree. C.,
about 98.degree. C., about 99.degree. C., or about 100.degree. C.,
and the temperature held constant for about 1 min, about 2 min,
about 3 min, about 4 min, about 5 min, about 6 min, about 7 min,
about 8 min, about 9 min, about 10 min, about 11 min, about 12 min,
about 13 min, about 14 min, about 15 min, about 16 min, about 17
min, about 18 min, about 19 min, about 20 min, or greater than 20
min.
[0197] The incubation mix can then be allowed to cool to 60.degree.
C., room temperature, or other temperature and held at this
temperature for a period of time. In other variations, the
incubation mix can be allowed to cool to about below 25.degree. C.,
about 30.degree. C., about 35.degree. C., about 40.degree. C.,
about 45.degree. C., about 50.degree. C., 55.degree. C., about
56.degree. C., about 57.degree. C., about 58.degree. C., about
59.degree. C., about 60.degree. C., about 61.degree. C., about
62.degree. C., about 63.degree. C., about 64.degree. C., about
65.degree. C. about 70.degree. C., about 75.degree. C., or about
80.degree.. The temperature held constant for a period of time,
such as greater than about 1 minute, greater than about 3 minutes,
greater than about 5 minutes, greater than about 15 minutes,
greater than about 30 minutes, greater than about 45 minutes,
greater than about 1 hr, greater than about 1.5 hrs, greater than
about 2 hrs, greater than 2 about 0.5 hrs, greater than about 3 hr,
greater than about 3.5 hr, greater than about 4 hr, greater than
about 4.5 hr, greater than about 5 hr, greater than about 5.5 hr,
greater than about 6 hr, greater than about 6.5 hr, or greater than
about 7 hr.
Joining
[0198] In some cases, after the target polynucleotide, and the
first and second complementary polynucleotides have been incubated
under conditions that allow hybridization of complementary
polynucleotides, the first and second complementary polynucleotides
may be joined. Joining can be accomplished in a variety of ways. In
some cases the first and second complementary polynucleotides may
be joined non-covalently as described herein. In other cases, the
first and second complementary polynucleotides may be joined
covalently. In some cases, the covalent joining may be accomplished
by use of a ligase, for example ligase from T. aquaticus.
[0199] A DNA ligase and ligation buffer solution can be added to
create a ligation mix for aiding in ligating adjacent first
complementary polynucleotide and second complementary
polynucleotide molecules. In some variations, the ligation solution
can contain DNA Ligase from T. aquaticus or Ligase-65. The
temperature of the ligation mix then can be held constant for about
1 min, about 2 min, about 5 min, about 10 min, about 11 min, about
12 min, about 13 min, about 14 min, about 15 min, about 16 min,
about 17 min, about 18 min, about 19 min, about 20 min, or greater
than 20 min. This can aid in completing the ligation of the first
complementary polynucleotide and second complementary
polynucleotide molecules.
[0200] The temperature of the ligation mix can then be increased to
about 94.degree. C. for about 1 min to aid in inactivating the DNA
ligase and denaturing the product polynucleotides. In other
variations the temperature can be increased to about 90.degree. C.,
about 91.degree. C., about 92.degree. C., about 93.degree. C.,
about 94.degree. C., about 95.degree. C., about 96.degree. C.,
about 97.degree. C., about 98.degree. C., or about 99.degree. C.
for about 1 min, about 1 min, about 2 min, about 3 min, about 4
min, or about 5 min. The ligation mix can then be rapidly cooled to
room temperature, about 4.degree. C., or about 0.degree. C.
[0201] In some variations involving ligase mediated joining, the
first complementary polynucleotide and second complementary
polynucleotide can join if the 3' nucleotide(s) of the first
complementary polynucleotide is complementary to the target
polymorphic nucleotide or nucleotides. In other variations the
first complementary polynucleotide and second complementary
polynucleotide can join if the 3' nucleotide(s) of the first
complementary polynucleotide is not completely complementary to the
target polymorphic nucleotide or nucleotides, provided that the
terminal ends of the first and second complementary polynucleotides
are hybridized to the target polynucleotide.
Universal Base
[0202] In some variations the use of a "universal base," for
example, inosine or 5-Nitroindole, can aid in preventing joining of
molecules wherein the first complementary polynucleotide is not
complementary to the target polymorphic nucleotide or nucleotides.
In these variations, a universal base can be substituted at the
2.sup.nd, 3.sup.rd, 4.sup.th, 5.sup.th, 6.sup.th, 7.sup.th,
8.sup.th, 9.sup.th, or 10.sup.th 3' nucleotide to aid in preventing
or reducing joining of first complementary polynucleotide molecules
that do not have a 3' nucleotide or nucleotides complementary to
the target polymorphic nucleotide. Alternatively, or in addition to
the above, a universal base can be substituted at the 2.sup.nd,
3.sup.rd, 4.sup.th, 5.sup.th, 6.sup.th, 7.sup.th, 8.sup.th,
9.sup.th, or 10.sup.th 5'-nucleotide if the second complementary
polynucleotide to aid in preventing or reducing joining of the
second complementary polynucleotide molecules that do not have a
5'-nucleotide or nucleotides complementary to the target
polymorphic nucleotide.
Enriching
[0203] In some variations of the present method, there can be an
enriching step. The enriching step may increase the ratio of
product polynucleotide to non-product polynucleotide. In some
variations that include an enriching step, the product
polynucleotide may be selected by size, affinity, charge, or
sequence. In other cases the enriching step may comprise removal of
some or all of the non-product polynucleotides, for example by
selection, segregation, or digestion.
[0204] In some variations the enriching step may include size
selection of the product polynucleotide, wherein the results of the
joining step are separated on a gel or sizing column. In some
embodiments, the product polypeptide may be selected based on the
presence of a specific sequence, a tag, or the complementary
sequence. In some cases, the product polynucleotide may be enriched
by selecting for a sequence at one end of the product
polynucleotide, and then selected again for a sequence at the other
end of the product polynucleotide. This double selection may aid in
removing sample sequence, target sequence, and the first and second
complementary polynucleotides that have not been joined. In some
cases, the product polynucleotide may comprise a sequence tag that
is designed to be selected during an enrichment step.
[0205] In some cases the enriching step may comprise amplification
of the product polynucleotide. In some of these cases, the
enriching step can comprise amplification of the product
polypeptides to create an amplified product. In these cases, the
product polypeptides can be used as templates for DNA
amplification, for example by PCR. In these variations, PCR primers
can be combined with the product polynucleotide.
[0206] In some variations the PCR primers can comprise an annealing
sequence that is complementary to a portion of the product
polynucleotide or the target polynucleotide. For example, where a
first and a second PCR primer are used to direct PCR amplification
of a product polynucleotide, the first PCR primer may comprise an
annealing sequence that is complementary to a sequence on the
product polynucleotide, and the second PCR primer may have an
annealing sequence that is homologous to a sequence on the product
polypeptide. This can allow the second PCR primer to anneal to the
polynucleotide created by polymerizing from the first PCR
primer.
[0207] In some cases, the PCR primers may further comprise other
sequences, for example, sample-specific tags and/or sequencing
tags.
Sample Specific Sequence/Tag
[0208] As described above, in some variations of the present
method, an enrichment step is added. In these variations, such as
wherein the enrichment step comprises an amplification step and
amplification primers, the amplification primers can further
include sequences that can be used to identify the sample being
amplified (sample tags). In some of these variations, the
amplification primers can further include sequences that can aid in
the sequencing of amplified products with a variety of sequencing
methods. In some variations the sequencing method can be
Illumina-based, and the amplification primers can include Illumina
sequencing sequences. In some variations a portion of the sample
tag may be added to one end of the product polynucleotide and a
portion of the sample tag may be added to the other end of the
product polynucleotide. In other variations the entire sample tag
may be added to one or the other end of the product polynucleotide
or to both ends of the product polynucleotide.
[0209] In some variations of the presently disclosed method, first
and or second complementary polynucleotide design can obviate the
need for sequencing the complementary or target sequences. In these
variations, sample, locus, and allele (or other variation) identity
are all encoded by sequence tags on the various polynucleotides and
primers.
Determining the Presence or Absence of a Nucleotide or Nucleotide
Sequence
[0210] In some variations of the method, the presence or absence of
a nucleotide or nucleotide sequence may be determined by
determining the product polynucleotide's sequence. Sequencing of
the product polynucleotide may be accomplished by a variety of
methods including chain termination, sequencing by synthesis, next
generation sequencing, and other sequencing methods disclosed
herein.
[0211] In some cases, such as wherein Illumina sequencing is used
to determine the sequence of the product polynucleotide, the
product polynucleotide can comprise sequences that allow the
product polynucleotide to be captured by a flow cell and/or
amplified on the flow cell.
[0212] The presence or absence of the target polynucleotide can be
determined indirectly by detecting the sequence of at least a part
of a tag sequence. In various embodiments, the tag sequence is a
polymorphism-specific tag that corresponds to the sequence of a
complementary polynucleotide. By way of illustration as described
in FIG. 2E, the first complementary polynucleotide can comprise a
polymorphism-specific tag sequence 5' of the complementary
sequence. The polymorphism is detected by detecting at least part
of the tag sequence. The present of the target polynucleotide is
then detected.
[0213] It will be appreciated that a polymorphism-specific tag can
be attached to a first or second complementary sequence.
Quantitation.
[0214] In some variations of the method, target polynucleotide copy
number may be determined. For example, sequences can vary by
number, from one to 1000s of copies. CNV (copy number variation) is
implicated in gene control and human disease. To analyze CNV by the
presently disclosed method, it can be possible to design first and
second complementary polynucleotides for each potential CNV gene
and one or more single gene copies. These polynucleotides can be
tagged as described above. The relative read counts of the CNV gene
(target polynucleotide) and single copy target polynucleotide(s)
can be used to estimate copy number of the CNV gene (target
polynucleotide). Alternatively, differential expression of RNA can
be detected by measuring the relative change in quantity of tagged
RNA. Alternatively, quantitation of the amount of a target
polynucleotide in a sample containing nucleic acids from more than
one individual of the same species can be determined. An example is
the detection of the presence of genetically modified (GMO) soybean
seeds in a mixture of GMO and non-GMO seeds. Alternatively,
quantitation of the amount of target polynucleotide in a sample of
nucleic acids obtained from more than one individual of different
species can be determined. An example is the detection of a
pathogen in a clinical sample or in a food sample.
[0215] CNV is determined solely by comparing samples with differing
or known CNV to the unknown samples. For example a sample may have
one copy of a locus, while another sample may have two or more
copies; the first sample will yield a signal of X, while the second
sample would have a greater signal of 2.times. or more. If required
samples with constructed CNV can be used for the generation of
standard curves. These would be synthetic DNA sequences doped into
similar DNA samples. The doping would be in genome equivalents and
greater, and the doped samples would output differing signals,
forming a standard curve by which the unknown samples could be
compared and the copy number (and its variation) determined.
[0216] Data analysis can reveal the sequence copy number and
distinguish the fold differences from a normalized sample or gene
(target polynucleotide). In some variations this is applied to the
determination of copy number variation. For a sample with two
copies of the target polynucleotide, the total number of sequence
reads would, relative to the normalized sample, show that there are
two copies of the target polynucleotide. But a sample with a 4-fold
gene variation would yield 4 times the number of sequence reads. A
sample with a deletion, would yield no sequence reads at all. Thus
the assay reads CNV and even gene deletion.
Restriction Endonuclease/Methylation-Based Identification
[0217] Restriction endonucleases target specific DNA sequences for
cutting. Again for illustration, if a restriction endonuclease with
a target recognition sequence GTACGC is used on the DNA sequences
depicted in FIG. 2A, only one target polynucleotide will be
cut--the sequence depicted in FIGS. 2A, and 2B (i).
[0218] A sample that may or may not contain a target polynucleotide
is combined with the first and second complementary polynucleotides
and set to hybridize, then joined to produce product
polynucleotides. The product polynucleotides are split into two
different reactions. One reaction is seeded with a methylation
sensitive restriction enzyme that has a recognition sequence within
the probe binding area. The other reaction does not have an added
restriction enzyme. The two reaction products can then be
amplified. Sites that are methylated will not be digested and will
present signal. This is compared to the non-digested sample. Sites
that are non-methylated will be digested and will not amplify and
will not present signal, and again these are compared to the
non-digested sample signal. In another variation, the second
non-digested sample is not required. In another variation the
enzyme is not methylation dependent. In yet another variation the
sample is treated with a restriction enzyme (methylation dependent
or not) and then treated so that the cut ends cannot join. The
first and second complementary polynucleotides are added to the
treated sample and set to hybridize and then joined and sequence
data is generated. The presence of the restriction site in or near
the target sequence in the sample, allows the restriction enzyme to
destroy the ability of the first and second complementary
polynucleotides to be positioned in a manner that allows the
joining When joining is prevented, the product polynucleotide is
not generated and direct or indirect sequencing of the product
polynucleotide does not occur, or alternatively rarely occurs. In
contrast, samples in which the restriction site is modified or
missing between the first and second complementary polynucleotides
will generate sequence reads. In an alternative approach the two
reactions are seeded with a methylations sensitive and a
methylation insensitive restriction endonuclease that recognize the
same polynucleotide sequence. An example of this type of
endonuclease pair is Ascl (GG/CGCGCC).
[0219] In some variations, restriction endonucleases that are
methylation-dependent can be used to digest sample DNA and thus
target polynucleotides prior to hybridization, joining and
sequencing. Digested target DNA will not allow joining of the first
and second complementary polynucleotides. It will be appreciated
that the presence or absence of other methylation sensitive
restriction sites can be similarly interrogated. It will be
appreciated that the presence or absence of other non-methylation
sensitive restriction sites can be similarly interrogated.
[0220] In this variation of the presently disclosed method, first
and second complementary polynucleotides can be made for a gene
regulated by DNA methylation and present at a site/loci that
contains a methylated restriction site (example Hhal). Sample DNA
is then digested with the Hhal restriction enzyme [restriction site
is GCGC] which does not cut at the methylated site. Alternatively,
other methylation-sensitive restriction enzymes may be used that
recognize sequences within the target polynucleotide. An uncut
target DNA sample is also analyzed. Multiple polynucleotides for
different potentially methylated sites can be made up with
locus-specific tags. Multiple samples can be differentiated by
using sample-specific tags. The joining and enrichment is performed
and the library then sequenced. Analysis of the sequence data can
then be used to determine either (A) or (B). In (A) for site 1 cut
sample--no signal AND for site 1 uncut sample--a full signal. This
indicates that site 1 is methylated. Alternatively, the data
analysis can show (B) for site 1 cut sample--a full signal, AND for
site 1 uncut sample--an equal signal. This indicates that site 1 is
non-methylated. Hundreds of sites for hundreds of samples can be
analyzed.
Scoring
[0221] The sequences of the product polynucleotides are determined
either by direct sequencing of the complementary sequences or by
sequencing of the tag sequences. In variations of the method for
determining genotype of various samples, the sequencing data can be
analyzed to determine whether specific loci are heterogeneous or
homogeneous. In some variations, as described above, the copy
number of specific target sequences may be determined. For example,
specific loci can have only one copy (ie be monozygous), or have
more than two copies (eg where the individual is trisomic at that
locus). In many variations, number of loci as well as polymorphisms
within those loci can be determined by a mathematical
algorithm.
[0222] Wherein the method of genotyping combines ligation-dependent
analysis and multiplexed sequencing, genotypes can be determined by
examining allele frequencies. Allele frequency can be determined
for a given two-allele locus by dividing the number of reads for a
given allele by the total number of reads at that locus. For
example, where a locus has two alleles, Allele A and Allele B, the
frequency of Allele A can be determined by dividing the number of
Allele A reads by the sum of Allele A and Allele B reads.
[0223] Wherein the method of genotyping combines ligation-dependent
analysis and multiplexed sequencing, genotypes can be determined by
examining allele read counts. For a two allele locus, the genotype
can be determined by computing the ratio R.sub.A/(RA+RB), where RA
is the number of reads confirming allele A and the RB is the number
of reads confirming allele B at this locus. In this manner, when
the ratio is near zero, the homozygote BB genotype can be inferred.
Likewise, when the ratio is near one, the homozygote AA genotype
can be inferred. Finally, ratio values around 0.5, correspond to
the heterozygote AB genotype.
[0224] The processes by which reads confirming allele A and B are
obtained are not always equally efficient. This means that for some
loci and probe combinations a typical ratio of 0 for BB, 0.5 for AB
and 1 for AA will not be appropriate. For example, a particular
locus or probe may exhibit a ratio of 0.2 for BB, 0.7 for AB, and
0.9 for AA genotypes. To account for this, behavior of probes for a
given locus (expected ratio values for genotypes) can be determined
by running training experiments to establish mean ratio (using
samples with known genotypes) and variance estimates.
Alternatively, clustering techniques can be used to identify
expected mean ratios, provided the number of distinct genotypes for
a given locus is known (1, 2, or 3).
[0225] One such clustering technique is k-means clustering (though
other clustering approaches may be used). Under this approach,
ratios R.sub.A/(F+RB) from multiple, different samples (animals) at
a particular locus can be partitioned into k clusters, such that
each observation assigned to a cluster is closer to this cluster's
mean than to the mean of any other cluster. The number of clusters
must be specified prior to start of clustering to avoid significant
misclassification issues. This can be achieved by manually
specifying the number of clusters (expert opinion); quality-of-fit
selections strategies whereby partitioning with varying number of
clusters is attempted for the data (in this case the choices are 1,
2, or 3) and the best fit (whether by minimizing cluster variance,
cluster separation, or by other means) is chosen; or by other
established k-means clustering techniques. Other clustering
approaches include, but are not limited to (i) machine learning
approaches, such as neural networks or Support vector machines,
(ii) statistical approaches, such as non-parametric density
clustering and k-means clustering with expectation maximization,
and (iii) parametric modeling based on counts of reads for allele A
and B. If there are more than two alleles the clustering approach
may include the above (and other frequency space methods) and may
be expanded to include three dimensional count space.
[0226] Once the observations for a given locus have been
partitioned into one, two, or three clusters (depending on the
observed ratios), the genotype call -AA, AB, or BB can be assigned
to each cluster. One approach that can be used for this genotype
assignment involves computing the distance between the cluster
center points and expected frequencies for each genotype at a given
locus and selecting the genotype call with the minimum distance to
the cluster center. Expected frequencies can be the default ratios
of 0 for BB, 0.5 for AB and 1 for AA, expert specified ratios, or
mean ratio from previous training set experiments.
[0227] Alternatively, clustering can be performed on the counts of
reads for allele A and Allele B, rather than in the frequency
space. To do this, rather than projecting the counts onto the
frequency line by computing the ratio of R.sub.A/(RA+RB), the read
counts R.sub.A and R.sub.B are used directly. For example, R.sub.A
can be displayed on the x-axis, while R.sub.B can be displayed on
the y-axis. The k-means clustering approach outlined above can
still be applied in two-dimensional space without any significant
modifications. Similarly, for loci with 3 possible alleles (A, B,
or C), a three dimensional approach can be used, where x axis is
number reads for allele A, y-axis is the number of reads for allele
B, and z axis is the number of read for allele C. The same
clustering approaches (for example k-means), will also work
here.
[0228] The sample tag sequence can be used to identify the sample a
given read on the lane of the flowcell belongs to. Currently, this
tag is placed in the index portion of the Illumina GAIIx read. In
this fashion the sample assignment can be handled by simple
demultiplexing of a lane. The location of the tag is not exclusive
to the index portion the read however--the sample tag can be
incorporated into the read itself (added to the beginning of each
sequenced read, in the middle, or in the end), without affecting
the rest of the genotyping effort.
[0229] There are currently two different variants for the placement
of the allele tag (to call A or B allele), with locus tag placement
being common across both variants. Under the first variant, the
allele tag is 5 bases (the first 5 bases of the read), while the
locus is the next 15 bases of the read. The allele tag used for
this variant are: "GTCTC", "GCACT", "GGAGT", and "GACAC" (although
other allele tag may be designed in the future, if warranted), with
the fourth base of the tag specifying the allele nucleotide A, C,
T, or G. Multiple mismatches are allowed when identifying the
allele tag (by default at most 2). Under the second variant, the
allele tag is 3 bases (the first three bases of the read), while
the locus is the next 15 bases. The third base of the allele tag
specifies the allele nucleotide (A, C, T, or G), with no mismatched
tolerated during its identification. Immediate following the allele
tag in both variants is the locus tag of 15 bases. The 15 bases of
the locus tag are specific to each of the locus being examined and
are known a priori. Multiple mismatches are tolerated when
identifying the locus tag (up to 3 by default).
[0230] Each lane undergoes a binning process, whereby each read on
a lane is assigned appropriate sample (based on sample tag), locus
(based on locus tag), and allele (based on allele tag and variant
type). For each locus, only the reads corresponding to the two
expected nucleotides (for allele A and B) are kept. Reads that
cannot be binned to the proper sample-locus-allele are discarded
from further analysis.
[0231] In some cases, a heterozygous, diploid sample can produce a
similar number of reads for each allele at a given locus. In these
variations the ratio of reads will be approximately 1:1. In these
variations, the read frequencies for each allele can be around 0.5
of the total number of reads at that specific locus. In many
variations the allele frequency for one polymorphism or allele of a
heterozygous locus can be greater than about 0.01, 0.05, 0.10,
0.15, 0.20, 0.25, 0.30, 0.35, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44,
0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.51, 0.52, 0.53, 0.54, 0.55,
0.56, 0.57, 0.58, 0.59, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90,
or 0.95. In many variations the allele frequency for one
polymorphism or allele of a heterozygous locus can be less than
about 0.99, 0.95, 0.90, 0.85, 0.80, 0.75, 0.70, 0.65, 0.61, 0.60,
0.59, 0.58, 0.57, 0.56, 0.55, 0.54, 0.53, 0.52, 0.51, 0.50, 0.49,
0.48, 0.47, 0.46, 0.45, 0.44, 0.43, 0.42, 0.41, 0.40, 0.35, 0.30,
0.25, 0.20, 0.10, or 0.05. In many variations the allele frequency
for one allele of a heterozygous locus will be between about 0.44
and 0.56. The allele frequency can be allele dependent and can
vary.
[0232] In some variations, a diploid sample can be said to be
homozygous if one polymorphism or allele at a given locus is
greater than about 0.49, 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56,
0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67,
0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78,
0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89,
0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, or 0.99, or
less than about 0.45, 0.44, 0.43, 0.42, 0.41, 0.40, 0.39, 0.38,
0.37, 0.36, 0.35, 0.34, 0.33, 0.32, 0.31, 0.30, 0.29, 0.28, 0.27,
0.26, 0.25, 0.24, 0.23, 0.22, 0.21, 0.20, 0.19, 0.18, 0.17, 0.16,
0.15, 0.14, 0.13, 0.12, 0.11, 0.10, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4,
0.3, 0.2, or 0.1. In some cases, one polymorphism or allele
frequency can be about 0.70 or greater, while the other
polymorphism or allele can have a frequency of about 0.30 or
lower.
[0233] It will be understood that more than two alleles can be
measured.
[0234] FIG. 16 depicts examples of genotyping data where the data
fits the expected genotype frequency ratios, and examples where the
data is shifted off the expected genotype frequency ratios. Locus
443 demonstrates data distribution for samples containing either AA
or BB homozygote genotypes that are clustered along the X and Y
axis, respectively. Samples containing the AB heterozygous genotype
in locus 443 are evenly split between the A and B axis such that
the counts for Allele-A are nearly equal the counts for the
Allele-B. Locus 436 shows a significant skewing in the sample
containing the AB heterozygous genotype toward the Y-axis. Locus
439 shows reads for samples containing the AA homozygous genotype
close to the X-axis contains some non-allele A information. Locus
446 shows the same effect but for samples containing the homozygous
BB genotype contain some non-allele B information.
[0235] For many loci, the data fits the genotype frequency ratio
where the homozygotes AA has a ratio at or near 1.0 while samples
containing the homozygous BB genotype have a ratio at or near zero.
Samples with the heterozygotes AB genotype have intermediate
frequencies at or near 0.5.
[0236] In some variations, for example, if where a specific locus
generates about 1,000 reads, the locus can be scored as
heterozygous if one allele generates about 440-560 reads,
alternatively the locus can be scored as homozygous if one allele
generates from about 700 to about 1000 reads, or the other allele
generates from about 0 to 300 reads. In alternative variations, the
locus can generate about 10 reads per sample.
[0237] In some variations, genotype probabilities can be computed
for each locus and each sample. The probability of the most likely
genotype for each call (locus by sample) can be used as a call
quality score. A threshold can be applied to this call quality
score, resulting in "no call" results in situations in which
insufficient information is available (likely due at least in part
to a random, unusually low number of reads). Genotype probabilities
can be computed using Bayes Rule by multiplying the likelihood of
having observed the data conditional on each of the three possible
genotypes (for example A/A, B/B, and A/B) by the prior probability
of each of those three genotypes and then scaling the three
products to sum to one. In some variations, the Bayesian prior
probabilities are simply the population estimate of genotype
frequencies. Under the common assumptions of random mating and
other conditions of a population in Hardy-Weinberg equilibrium, the
prior probabilities of genotypes A/A, A/B, and BB can be computed
as p.sup.2, 2pq, and q.sup.2, respectively, where p and q are the
population frequencies of alleles A and B, respectively and p+q=1.
In variations in which a pedigreed population is being genotyped,
fewer reads can be required by computing genotypes by iterative
allelic peeling (Thallman et al., 2001; Thallman, R. M., Bennett,
G. L, Keele, J. W., and Kappes, S. M. Efficient computation of
genotype probabilities for loci with many alleles. II. Iterative
method for large, complex pedigrees. J. Anim. Sci. 79:34-44. 2001).
Briefly, the Bayesian approach described is used, but the prior
probability is made more informative by conditioning it on the
allele counts of the parents and their relatives and mates.
Furthermore, the likelihood is made more informative by multiplying
the likelihood of the individual (based on the allele counts of the
individual) by a likelihood conditional on the allele counts of the
progeny and their relatives and mates. The net effect is that, for
a given average number of reads, the call rate will typically be
higher if pedigree can be considered.
[0238] In some cases, such as where the method is used to determine
the presence or absence of a polymorphism at a specific target
sequence, two sets of first and second complementary
polynucleotides can be used. In these variations, two sets of first
and second complementary polynucleotides may be used, wherein the
two sets may have the same second complementary polynucleotide, and
different first complementary polynucleotides. In some variations,
the total concentration of the first complementary polynucleotide
in each set is 2.times. that of the second complementary
polynucleotide. In some variations, one or both of the first
complementary polynucleotides at a specific locus can be unable to
discriminate one or both of the target polynucleotides. In some
variations, one or both of the first complementary polynucleotides
can have different efficiencies of hybridizations and of ligation.
In these variations, where the read data may be graphically
presented, the read data can be compressed along one axis and the
read frequency thresholds adjusted. In some variations a sequencing
system can be maximally multiplexed. In these cases, a priori and
loci specific modifications will likely be required.
EXAMPLES
[0239] The following examples are intended to illustrate aspects of
the disclosure, and are not intended to limit the scope of any
description or claims.
Example One
Illumina Sequencing of Product Polynucleotides
[0240] Genomic bovine DNA was obtained from either whole blood or
bull semen. The target DNA was extracted using either a salt
extraction method (whole blood) or proteinase K/organic solvent
treatment (semen). DNA isolated from bull semen kindly provided by
Dr. Mark Thallman, USMARC, USDA.
[0241] Illumina genotyping has previously been used to genotype
these specific individuals, using the Illumina BovineSNP50
BeadChip. Those results were made available by Dr. Thallman.
[0242] First, a single bovine DNA sample was analyzed for eight
single nucleotide polymorphisms (SNPs). These specific SNPs were
previously characterized in a "weaning weight" study, and were
provided by Dr. Thallman. Separate reactions were performed for
each target polynucleotide at a given locus. Each first
complementary polynucleotide for a given locus was ligated to the
second complementary polynucleotide in a separate reaction. Seven
of the eight first complementary polynucleotides were able to form
G:T mismatches with their target polynucleotides. As discussed
below, substitution of deoxyinosine at the third 3' position of the
first complementary polynucleotide can aid in preventing potential
mismatches resulting in visible product polynucleotides (FIG. 6).
Differences in band intensity observed between the different loci
sets (for example, loci 192 vs 193) indicate that the
polynucleotide sets can require balancing (discussed below).
[0243] The second complementary polynucleotides were
5'-phosphorylated and contained an Illumina-specific sequence tag
immediately 3' of the second complementary sequence, Illumina
sequences can permit the addition of sample-specific sequence tags
to the product polynucleotide, as well as a final Illumina sequence
required for binding to the sequencing flow cell. Polynucleotides
were obtained from IDT, Integrated DNA Technologies (Coralville,
Iowa). Polynucleotides were diluted to 1 uM in a 1 mM Tris-HCl
(pH=8.3) 0.1 mM EDTA buffer (TE). A final dilution of the
polynucleotide was 4 nM in TE.
[0244] FIG. 7 depicts a single ligation-dependent assay on eight
loci (numbers 192-249) on target polynucleotides from a single
diploid sample. For each locus, two pairs of polynucleotides were
used (LHS-A, and LHS-B with an RHS common for the given locus).
LHS-A and LHS-B are specific for different polymorphic nucleotides
representing different alleles at each locus. Ligated
polynucleotides, LHS+RHS, were PCR amplified and resolved on an
ethidium bromide stained agarose gel and imaged. The previously
established allele identities are noted above and the allele
identities based on this experiment are noted below. The first
complementary polynucleotides contained deoxyinosine when there was
potential for a G:T mismatch (loci 193 to 249). All product
polynucleotides were not of identical length as it was necessary to
vary the length of individual first and second complementary
polynucleotides in order to maintain similar annealing
temperatures.
[0245] After initial characterization described above, DNA samples
were collected from 21 individual bovine. Sample DNA was assayed at
24 different loci. The 24 loci were previously identified as part
of a "weaning weight" panel. These individual loci are coded 192 to
249.
[0246] A 3' nucleotide polymorphism-specific tag was incorporated
into the first complementary polynucleotides. In this variation,
specific sequence tags were added only to one PCR primer, the
right-side primer. In total, 21 individuals were genotyped. One DNA
sample was tested in quadruplicate.
[0247] DNA solutions were prepared with 200 ng of target DNA in a 5
.mu.l volume of TE. The target DNA solutions were initially heated
to 98.degree. C. for 5 minutes and then cooled to room
temperature.
[0248] Hybridization solutions were then prepared by adding 1.5
.mu.l of hybridization buffer (1.5M KCl, 0.3M Tris-HCl pH=8.5, 1 mM
EDTA) and 1.5 .mu.l of each polynucleotide, two LHS and one RHS
polynucleotides (4 nM each), to the target DNA solution. These
hybridization solutions were then heated to 98.degree. C. for 1
minute and incubated at 60.degree. C. After about 4+ hours of
incubation the hybridization solution was cooled to 54.degree.
C.
[0249] A ligation solution was prepared by adding 32 .mu.l of a
1.times. ligation mix (0.2 U of Tag DNA ligase and the supplied
1.times. ligation buffer (NEB)) to the hybridization solution. The
ligation solution was held at 54.degree. C. for 15 minutes, then
heated to 94.degree. C. for 1 minute, followed by rapid cooling to
4.degree. C.
[0250] In some cases, a PCR amplification solution was created by
adding 4 .mu.l volume of the completed ligation reaction to 21
.mu.l volume of PCR mixture (0.5 Units of Promega GoTaq.RTM.
Hotstart, with supplied 1.times. buffer and 0.2 mM each dNTP) along
with forward and reverse DNA oligonucleotides (400 nM each). The
PCR amplification solution was thermo-cycled (94.degree. C. for 5
minutes, then 30 cycles of 94.degree. C. for 10 sec and 65.degree.
C. for 15 sec, followed by a final extension at 72.degree. C. for 1
minute and chilled to 4.degree. C.). PCR reactions destined for
agarose gel analysis completed an additional 6 cycles.
[0251] Some PCR amplification solutions were resolved by agarose
gel electrophoresis. These solutions comprised two different
samples, one containing the Allele-A LHS and the RHS polynucleotide
and the second sample containing the Allele-B LHS and the same RHS
polynucleotide. Separating the two samples permitted the
similarly-sized product polynucleotides to be resolved on agarose
gels in adjacent lanes and genotypes resolved for the locus.
[0252] Some PCR amplification solutions were resolved with sequence
data from an Illumina sequencing platform. These solutions
contained 4 nM of each the LHS-Allele-A, LHS-Allele-B, and the
adjacent RHS polynucleotides for each of the 24 loci in the weaning
weight SNP panel.
[0253] Sample-specific tagging of individual ligated products was
accomplished by adding left and right sample-specific sequence tag
primers to the PCR amplification solution. The first PCR primers
contained 96 different 7 nucleotide sequence tags. The second PCR
primers contained up to 96 different 7 nucleotide tag sequences
and, in this example, were matched to those used in the first PCR
primers for each locus. When less than 96 sample-specific sequence
tags were needed, only the right tag set was used. If more than 96
sample-specific sequence tags were needed, then two or more left
sample-specific sequence tags could be used to effectively multiply
the sample-specific sequence tags as needed.
[0254] Sample-specific tagged and completed PCR reactions (one for
each ligation reaction) were combined into a single volume. A
portion of the combined volume was run out on an agarose gel to
visually inspect the average product polynucleotide size which for
this polynucleotide set should be around 190 bp (167 to 210 bp),
and to estimate the DNA concentration. A suitable portion of the
library volume was then cleaned up on a silica based PCR clean up
column (Zymo Research, Hayward, Calif.) and eluted into 20 ul TE. A
portion of the eluate was examined on a 2100 Bioanalyzer DNA 1000
chip to determine the concentration of the library and to ensure
that it was essentially free of PCR primers and their dimers.
[0255] A portion of the eluate was denatured, and 5.5 pM was pumped
through the assigned lane of the Illumina flowcell and allowed to
hybridize to the flowcell's surfaces. Cluster formation and
amplification on the cluster station was performed using supplied
reagents from a TruSeq Paired End Cluster Kit (Illumina, Hayward,
Calif.). The flowcell with the amplified clusters and hybridized
sequencing primer was subsequently loaded onto an Illumina Genome
Analyzer IIx (GAIIx) where appropriate cycles of multiplexed
sequencing data were generated.
[0256] A 36-cycle, indexed sequence data set was generated. After
data quality filtration (4.7.times.10.sup.6 failed the filter),
25.29.times.10.sup.6 sequence reads were obtained and 120,992 had a
sample-specific sequence tag that could not be assigned to a
specific individual. The remaining sequence reads were sorted by
the sample-specific sequence tag. Each individual had
1.199.times.10.sup.6 reads.+-.SD 0.194.times.10.sup.6. The data
(number of reads) was then plotted by the locus and SNP tags for
one sample (FIG. 8).
[0257] The library of product polynucleotides, in which each sample
member was differentially tagged by sequences during the PCR, was
introduced into one GAIIx flow cell and clusters produced and
36-cycle, indexed sequence data was generated. The remaining
sequence reads were sorted by the sample-specific sequence tags.
After data quality filtration (4.7.times.10.sup.6 failed the
filter), 25.29.times.10.sup.6 sequence reads were obtained and
120,992 had sample ID tags that were unreadable. This is often
because the camera cannot resolve overlapping flow cell clusters.
Each individual had 1.199.times.10.sup.6 reads .+-.SD
0.194.times.10.sup.6. Table I. The data (number of reads) was then
plotted by the locus and polymorphism/polymorphism-specific
sequence tag (FIG. 5).
TABLE-US-00002 TABLE 1 Sequencing read counts for dNTP and dUTP
prepared Libraries. dNTP Library dUTP Library Total Reads 25.29
.times. 10.sup.6 25.17 .times. 10.sup.6 Reads per Sample 1.199 .+-.
0.194 .times. 10.sup.6 1.094 .+-. 0.171 .times. 10.sup.6
[0258] FIG. 8 depicts the analysis of data produced by the
presently disclosed method for a single animal. Product
polynucleotides from twenty animals with sample-specific sequence
tags were sequenced in a single lane of an Illumina GAIIx flow cell
using an indexed 36 cycle single end run. The data was de-indexed
and sorted into sample specific sets. A sample's specific reads
were then sorted by locus (n=24) and polymorphism call (A, C, G, or
T), then the number of reads per polymorphism per locus was
plotted. In this example of the presently disclosed method, the
polynucleotide sets were not normalized.
[0259] FIG. 9 shows the average number of Allele-A and Allele-B
(summed) reads per locus. Data for 21 genotyped samples is shown.
The number of reads for Allele-A plus Allele-B at each locus (for
21 samples) were averaged (bars) with the standard deviations
(whiskers), then ranked lowest to highest for clarity. The mean
number of reads per locus is 50,639 (horizontal line with
left-pointing arrow) with a +2-fold (100K) and -2-fold (25K) lines
shown above and below, respectively. This represents our
normalization goal where we will attempt to bring the average
number of reads per locus into by adjusting the ligation
polynucleotide concentrations.
[0260] As evidenced by the small relative error bars,
polymorphism-specific product polynucleotides were consistent
between animals. For example at locus 193, where all animals were
of the AA genotype, the recovered A allele tag had a mean count of
24,484.+-.SD 5079.
[0261] Two additional issues were identified. First, in some cases
the number of reads varies by approximately two orders of magnitude
between different polynucleotide sets (FIG. 5: 7,371 to 108,000
reads from expected alleles only). While first and second
complementary polynucleotide concentrations were all 4 nM, raising
and/or lowering this concentration can aid in providing a more
consistent read number. In some cases, changing the first base
after the common PCR primer sequence from G to A can lower the
output of a particular polynucleotide set. A more consistent read
number can aid in analysis of copy number variations.
[0262] FIG. 10 depicts results for the quadruplicate assay of the
commercial sample. In this case, each replicate was given a
different sample-specific sequence tag such that each replicate
could be distinguished in the sequencing data. The tight standard
error bars show the high reproducibility of the assay for this DNA
sample.
[0263] In FIG. 10 the mean number of sequence reads with each first
complementary polynucleotide is shown (bars) with standard errors.
The iT and iG refers to the use of the 3rd 3' deoxyinosine base
(discussed in more detail below) in the first complementary
polynucleotide to reduce the amount of signal occurring due to
product polynucleotides produced from ligated polynucleotides with
G:T mismatches between the first complementary polynucleotide 3' T
or G and the target polynucleotide G or T base, respectively, for
the locus indicated.
[0264] In some cases, unknown polymorphisms can occur within the
first and second complementary polynucleotides. Unknown
polymorphisms can hinder polynucleotide binding and reduce the
efficiency of proper ligation, with the result of reducing the
number of product polynucleotide sequence reads. In the case of
known polymorphisms within the polynucleotide hybridization
sequences, a universal deoxyinosine can be used and/or the length
of the polynucleotide can be increased increase annealing/melting
temperature.
[0265] Normalization of product polynucleotide output from
different polynucleotide sets can aid in reducing the cost of this
technique, by allowing more samples to be included into each
library. For example, where the polynucleotide sets are not
normalized, under-represented alleles can be lost where
over-represented product polynucleotides consume flow cell surface
area.
[0266] In some variations, the presently disclosed method run on a
single lane of the GAIIx can be used to assay 10,000 animals for
100 loci. Each lane of the GAIIx can be used to produce 25 to 40
million reads. Newer HiSeq-2000 sequencers from Illumina can have
increased capacity and reduced cost. Such increased efficiency can
permit even more loci (up to 200 or more) and/or more samples to be
analyzed in a single lane.
[0267] In some variations, sequence data can be generated for
alleles that are not present in the DNA, i.e. false positives are
generated. For example in FIG. 8, sequence data collected at locus
192 showed evidence of an A allele (average of 1426 reads). The DNA
of the individual used in developing the data in FIG. 8 has a T/T
genotype (62821 reads) at locus 194. At loci with the potential for
G:T mismatches, sequence reads are being generated from the
incorrect LHS polynucleotide ligations even though the animals are
homozygous. In most variations, false positives do not prevent
accurate estimation/determination of allele frequencies.
Example Two
Determination of Allele Frequency
[0268] In some variations, the allele frequency can be estimated by
dividing the number of sequence reads of one polymorphism (for
example Polymorphism A) by the total number of sequence reads for
that locus (which, for example can include a Polymorphism A and
Polymorphism B) Freq of Polymorphism A=(Number of Polymorphism A
sequence reads)/[(Number of Polymorphism A sequence reads)+(Number
of Polymorphism B sequence reads)].
[0269] In most cases, samples from individuals that are
heterozygous at a given locus can produce a similar number of
sequencing reads for each polymorphism or allele at that locus. In
these cases, the frequencies for both polymorphisms can be about
0.5. For example, heterozygous loci 218, 219, 220, and 249 had read
frequencies for one polymorphism of 0.45, 0.48, 0.44 and 0.52,
respectively (FIG. 10).
[0270] For some samples from individuals that are homozygous at a
given locus, the frequency of one polymorphism or allele can be
0.70 or greater, and the frequency of the other non-present allele
can be 0.30 or lower.
[0271] In some cases, read frequencies of about 0.5/0.5 and
<0.31>0.7 can be used to determine the genotype of a given
locus (here, heterozygous and homozygous, respectively.
[0272] Frequency cutoffs can be used when examining the data. For
example, read frequency can be used to determine zygosity of a
given locus from a given sample, where the zygosity has not yet
been determined. For example, for a given locus with two possible
polymorphisms or alleles, a read frequency for one of the possible
polymorphisms of >0.7 and/or <0.3 can indicate homozygosity,
and a frequency of between about 0.44 and 0.52 indicate
heterozygosity.
[0273] In some cases, genotype probabilities can be computed by
multiplying the likelihood of having observed the data conditional
on each of the three possible genotypes by the prior probability of
each of those three genotypes and then scaling the three products
to sum to one. In the event, we consider each individual
independently, the prior probabilities are simply computed
(p.sup.2, 2pq, and q.sup.2) from estimates of the population allele
frequencies (p and q=1-p). We can gain power (or require fewer
reads) in cases where we can take into account genotype
probabilities of relatives to compute a prior probability that is
more informative before multiplying by the likelihood.
[0274] FIG. 11 depicts analysis of loci SNP-220 (polymorphisms C
and T; FIG. 11 A), and SNP-215 (polymorphisms A and G; FIG. 11 B)
loci. 19 samples were plotted as dots, with each sample represented
by a dot. The horizontal axis is the number of T and A sequence
reads for the 220 and 215 loci, respectively. The vertical axis is
the number of C or G sequence reads for the 220 and 215 loci,
respectively. For locus 220, the plotted data points fall into
three groups: homozygous samples (CC or TT) cluster along the
vertical and horizontal axes, respectively; and heterozygous
samples (CT) cluster diagonally. FIG. 11 B depicts a failed
polynucleotide set, locus 215. All sequence reads for locus 215
cluster along the horizontal axis, polymorphism G. Although 7
animals were previously determined (via Illumina Bovine SNP50
BeadChip) to be heterozygous for locus 215, the first complementary
polynucleotide LHS-G failed and does not produce product
polynucleotides with equal efficiency to the LHS-A
polynucleotide.
[0275] In the case of the data depicted in FIG. 11 A, the read
frequency cut-offs of <0.3 and >0.7 can be used to determine
the genotype of the sample. FIG. 11 B depicts data plot for an
assay that did not properly discriminate alleles, wherein data
points compressed along one axis. In this case, it may be necessary
to adjust read frequency cut-offs.
[0276] FIG. 11C-F depict several single loci. SNP-192 (with
polymorphisms T and A), is shown in FIG. 11C. The number of
sequence reads with the T and A first complementary polynucleotides
were plotted for 19 samples as in FIGS. 11 A and 11 B. These data,
like locus 220, cluster into three genotype groups; homozygous
sample (TT or AA) along the two axes, and heterozygous samples (TA)
on a diagonal, down the middle. For locus 193 at FIG. 11 D,
(polymorphisms G and A) all samples were homozygous for
polymorphism A, and the data are clustered along the x-axis. For
locus 195, depicted at FIG. 11 E, the number of sequencing reads
for the first complementary polynucleotide, with polymorphism T,
were approximately three-fold lower than the number of sequence
reads obtained for the first complementary polynucleotide with the
C polymorphism. For locus 215, FIG. 11 F (with polymorphisms G and
A) the data is clustered along the X-axis, this can signify that
the first complementary polynucleotide with polymorphism G has
failed.
Example Three
Universal Base to Decrease False Positives
[0277] In some cases, genotyping can misidentify G and A OR C and T
polymorphisms.
[0278] This can be caused by partial hydrogen bonding between the
two nucleotides of a basepair. In some variations, G:T and T:G
basepairs between the 3' nucleotide of the first complementary
polynucleotide and the polymorphism in the target polynucleotide
can permit ligation, despite the mismatch. In these variations,
despite a mismatched basepair, the first complementary
polynucleotide and second complementary polynucleotides can be
ligated and subsequently amplified. In some variations, production
of a product polynucleotide resulting from G:T mismatches can be
minimized by adding a universal base, for example, deoxyinosine, to
the first complementary polynucleotide. The universal base can be
added proximal to the 3' nucleotide of the first complementary
polynucleotide. In these variations, the first complementary
polynucleotide comprising a universal base can be destabilized such
that basepair mismatch between the polymorphic nucleotide of the
target polynucleotide and the 3' nucleotide of the first
complementary polynucleotide will aid in reducing ligation of a
first complementary polynucleotide, with a mismatched 3'
nucleotide, and a second complementary polynucleotide.
[0279] As mentioned above, FIG. 6 depicts use of a universal base
to reduce the occurrence of product polynucleotides resulting from
a first complementary polynucleotide with a 3' nucleotide mismatch
to the polymorphic nucleotide on the target polynucleotide. As
shown in FIG. 6, positioning inosine 5' of the 3' nucleotide can
aid in reducing occurrence of a ligation event in these cases.
Positioning inosine at the 3 position may reduce these mismatched
ligation events more than positioning inosine at the 2nd position.
The product polynucleotides of FIG. 6 were resolved on an ethidium
bromide stained agarose gel and imaged.
Example Four
Uracil Incorporation
[0280] In some variations, laboratory space can be contaminated
with previously produced product polynucleotides. In these cases,
previous product polynucleotides can contaminate subsequent
experiments and their analysis. In some variations, dUTP
(2'-Deoxyuridine, 5'-Triphosphate) can be partially or fully
substituted for dTTP in the amplification reaction.
[0281] In some variations, Uracil-DNA glycosylase (UNG) can be
added to the amplification step. In some variations the presence of
the UNG enzyme can digest polynucleotides containing uracil
nucleotides. In these variations, the UNG enzyme can be denatured
by incubating the enzyme at high temperature. In some variations,
the first step of an amplification can denature and de-activate the
enzyme. In most cases, after de-activation the UNG enzyme cannot
digest polynucleotides containing uracil. In these variations the
amplification step can include a 15 minute incubation at 37.degree.
C., which can permit the UNG enzyme to digest dUTP-containing
product polynucleotides. In these variations, a subsequent
94.degree. C., 5 minute incubation can be used to de-activate the
UNG enzyme.
[0282] dUTP containing polynucleotides were prepared as described
in Example One. Amplified polynucleotides were prepared from the
ligation reactions. A portion (20%) of the completed amplification
reactions were separated by electrophoresis on a 2% agarose gel to
confirm the expected product polynucleotides. One sample did not
produce the expected 200 bp band. All the remaining amplification
reaction volumes for the dTTP library or for the dUTP library were
then combined, cleaned-up and quantitated for use as a sequence
data generation library. In this reaction the dNTP mix was replaced
by a mix containing dUTP rather than dTTP. The purpose of the dUTP
library was to demonstrate that dUTP libraries could be used in the
presently disclosed method. This would permit a UNG step to be
incorporated into the PCR reaction so that potential LD-PCR product
polynucleotides contamination could be minimized.
[0283] The dUTP library required a non-hotstart Taq polymerase mix
rather than the proof-reading Phusion mix prescribed by the
manufacturer. The dUTP library had 25.17.times.10.sup.6 sequence
reads with each sample having 1.094.times.10.sup.6 reads .+-.SD
0.171.times.10.sup.6.
[0284] PCR amplification can then be used to create novel dUTP
containing product polynucleotides from newly ligated LHS and RHS
polynucleotides.
[0285] FIG. 12 demonstrates that the effect of dUTP use in
amplification are minimal as the number of reads can be only
slightly less than when dNTP was utilized. Failed loci were
excluded from analysis, and the presently disclosed method repeated
with a dUTP containing library. Amplification reactions comprising
dUTP and dTTP were in agreement with each other and the previously
obtained genotyping data (418/418). This indicates that dUTP
libraries are suitable for use in the presently disclosed method
and will be an effective method to prevent product polynucleotide
contamination in the library. FIG. 12 compares the number of reads
obtained from the dNTP vs the dUTP prepared library for the bulk
sample. For each allele the average number of dNTP vs dUTP reads
obtained from the four replicates were plotted and a line of best
fit determined (y=0.3683.times.1.058, R.sup.2=0.088).
Example Five
Relationship of Reads/Locus and Specificity/Stability
[0286] Three sets of computational experiments were performed. Data
was obtained by performing the presently disclosed method as
described above. Data was re-sampled 1000 times. Re-sampling
resulted in 10, 20, or 30 reads obtained for each locus/individual
combination (n=418). After application of genotype calculation and
its cutoffs (0.70><0.30), genotypes were determined for each
data set (418.times.1000.times.3). For each sample, locus and read
number (10, 20, or 30 reads), the specificity of the genotyping
approach was determined by computing the proportion of experiments
(out of 1000) where the observed and expected genotypes were in
concordance.
[0287] FIG. 13 depicts specificity of genotyping by the presently
disclosed method from data resampling analysis. The mean
specificities (bar) are shown with standard deviations (line).
[0288] Variability (or stability) of the presently disclosed method
was determined by observing variation in computed specificity
proportions across all loci+animal+read number combinations. As
depicted in FIG. 13, Increasing the number of reads per
locus/individual combination improved the specificity and reduced
variability. The rate of improvement as a function of number of
reads can diminish as the number of reads increases. Locus-specific
rules and a priori genotype frequency information will be required
to improve the specificity and stability with low read numbers. For
example, with 30 independent sequencing reads, the accuracy reaches
approximately 98%.
Example 6
[0289] Routine genotyping of cattle is currently prohibitively
expensive. Many fields in agriculture need an inexpensive high
throughput method to provide flexible low-density genotyping. We
demonstrate the feasibility of inexpensively genotyping cattle,
using a novel combination of highly multiplexed ligation-dependent
PCR (LD-PCR) combined with high throughput next generation
sequencing (NGS) technology. We call this a mass genotyping by
sequencing technology (MGST). The MGST has the potential to be
highly multiplexed in terms of the number of SNP positions to be
typed as well as the total number of animals that can be combined
in a single assay run. MGST has the potential to be fully automated
and could be offered as a very inexpensive service. Most of the
cost is actually the DNA extraction process. Our results suggest
that MGST has the capacity to accommodate at least 100 SNPs and
upwards of 10,000 animals per assay run (single lane) of the
Illumina NGS devices. We have designed two genotyping panels that
interrogate 24 and 113 publically available SNPs in cattle. We
would also explore other genotype panels, such as genetic defects
and qualitative traits, which would be of great use for the
agriculture industry.
[0290] With reference to FIG. 17, an example is shown of MGST
combines multiple LD-PCR assays, each at different loci, permitting
multiple animal samples to be genotyped within a single sequencing
library. We have two SNP panels consisting of 24 SNPs from the
Illumina BovineSNP50 BeadChip and another 113 SNPs for parentage
and tenderness associated polymorphisms. For any given loci there
are two types of probes, the left hybridization sequences (LHS) and
the right hybridization sequences (RHS). For the LHS, there are two
genotyping probes that differ in the last 3' nucleotide which is
complementary to the SNP to be interrogated. The LHS probes also
contain a short "Allele Barcode" that further differentiates one
LHS from its partner. This also permits the allele information to
be determined from short sequencing reads. (Barcodes as used herein
are also referred to as tags.) The RHS probes are immediately
adjacent the LHS and are 5' phosphorylated (P') so that a DNA
ligase can ligate the LHS to the RHS. Only successfully ligated LHS
and RHS probes can be amplified by the common PCR primers by means
of common sequences that tail the LHS and RHS probes (diagonal
lines on the LHS and RHS). Each animal's gDNA sample (25 to 200 ng)
is processed in a single reaction tube for the probe hybridization
and ligation steps while a subsequent PCR step adds an animal
specific sample ID barcode to the ligation products. After the
sample specific PCR, the reaction products are combined forming a
single sequencing library. The libraries (6 pmol) are introduced
into a lane of the Illumina GAIIx flow cell. After clustering on
the flow cell, a single end with 36 reads is performed plus an
additional barcode read. The first 5 bases read, determine the
allele from the allele barcode engineered into the LHS probes. The
subsequent bases determine which locus is being read while the
animal ID is determined in
a separate barcode read. The raw data is passed through the
Illumina quality control filter and then binned according to the
animal ID barcode. Each animal's data is then binned according the
locus barcode. Each locus is then binned according to one of the
two allele types (Allele A or B). For each locus the read counts
can then be used to determine the observed frequency according the
formula Freq=Counts A/(Counts A+Counts B). Animals with near 1.0
frequencies are of the AA genotypes while animals with near 0.0
frequencies are of the BB genotypes. AB heterozygote animals have
intermediate allele frequencies of -0.5. Data can be plotted by
these frequencies and clusters of AA, AB, and BB animals observed
and compared to the expected genotypes as determined by the
Illumina BovineSNP50 chip results. We have an automated pipeline
that can call the genotypes based on a k-means clustering
system.
[0291] With reference to FIG. 18, members of an exemplary MGST
sequencing library have a sequence format. The original LHS and RHS
probe sequences that were joined by ligation are bounded by
Illumina specific sequences that permit `Flow Cell Binding`. Each
LHS has an addition short allele barcode (thick grey bars G/C) that
encodes the allele information. By placing the allele barcode
information in this location, the "Read 1" does not need to extend
into the site where the actual SNP is positioned (the junction of
LHS and RHS). Read 1 begins with the sequencing of the allele
barcode and then picks up the LHS sequence which is in essence the
locus barcode. A short index read (7 to 8 bases) determines the
sample specific animal ID barcode.
[0292] With reference to FIG. 19, exemplary NGS data is shown. For
Run 115, the read count data for Allele-A vs Allele-B was plotted
for a single marker (rs17870274). Three discrete groupings are
apparent, reflecting the AA, AB, and BB genotypes for this locus.
The genotypes established by the Illumina BovineSNP50 BeadChip are
shown. For some animals the total number of reads for the Allele-A
plus Allele-B were significantly below the mean number of reads
obtained (3700). In this particular experiment several reaction
wells had evaporated during hybridization resulting in the loss of
those samples and the below mean read counts.
[0293] Table 1 depicts MGST Runs Performed. SNP Panels, panel-24
(P24), Parentage & Tenderness panel (PPTP). Failed loci are
those where the groupings for the genotypes cannot be resolved. Two
lanes in run 106 were performed with either dNTP or a dUTP
nucleotide mix. The use of dUTP during library construction permits
a uracil-n-gylcosylase based anti-contamination system to be used.
*Sequence based non-calls have not been excluded.
[0294] With respect to FIG. 20, an example of the reproducibility
of NGS data is shown. For Run 106/dNTP, one animal was included as
four replicates in the library. The mean number of reads (bars)
with standard deviations (whiskers) are shown for a subset of the
24 loci that were assayed. The homozygous (196, 197, 204, 207, 215,
217) and heterozygous (219, 220) genotypes are apparent.
[0295] With respect to FIG. 21, exemplary automated genotyping is
depicted. Our automated pipeline uses a k-means clustering approach
to partition the number of observed sample points into its
appropriate genotype category based on the observed frequency
[Freq=(reads Allele-A/(reads Allele-A+reads Allele-B)] for each
`sample.times.locus` combination. A simple input file with the
established genotypes (from Illumina BovineSNP50 BeadChip data)
(homozygous AA, BB or heterozygous AB) is provided to a pipeline as
validation data. The pipeline then runs k-means clustering on this
dataset and analyzes the clusters for accuracy and quality of
clustering. The pipeline's genotype calls are compared to the
validation genotypes calls and the concordance determined. If the
validation data contains non-called datapoints (expNC) they are
excluded from concordance analysis. The pipeline currently produces
genotype calls for all animal x SNP combinations for which
BovineSNP50 genotypes exist. Some discordances are therefore due to
low numbers of reads or other conditions which will more
appropriately be classified as no-calls in future versions of the
pipeline. The results can be viewed graphically in the form of
plots or textual format (data from run 118 is shown).
[0296] With respect to exemplary FIG. 22, exemplary data resampling
analysis is depicted. In order for the MGST technology to be viable
when 10,000 animals across 100 loci are used in a single assay, the
genotype assignment method needs to be both sensitive and specific
when the number of reads per animal per locus is very constrained.
The validation assay presented here has orders of magnitude higher
coverage per animal per locus than what is expected for the actual
production-grade agricultural assay services. In order to explore
the feasibility of accurate genotype identification under low read
conditions, we have performed extensive re-sampling
simulations.
[0297] The simulation was set up in the following manner. An
implementation of Marsenne twister pseudorandom number generator
was used to resample the reads from each animal and each locus
until a desired sample size was obtained. A total of 10,000 random
re-sampling experiments were performed with sample sizes of 10, 20,
30, 40, 50, 60, 70, 80, 90, and 100 reads per animal per locus.
Each re-sampled animal-locus combination was assigned a genotype of
AA, AB, or BB based on the frequency thresholds defined from the
full data set (typically 0 to 0.33 for BB genotype, 0.33 to 0.66
for AB genotype, and 0.66 to 1 for AA genotype).
[0298] Sensitivity, specificity, and ROC curves were computed
separately for each genotype (AA, AB, and BB). The average
sensitivity and specificity (across all 10,000 simulations) is
shown in the table above. At the lowest sample size of 10 reads per
animal-locus, the sensitivity of the MGST is less than 75% for
heterozygote but greater than 95% for both homozygous and the
specificity is greater than 95% for all three genotypes.
Computational simulations show that both sensitivity and
specificity improve as the number of reads per animal-locus
increases. These computational results provide good evidence of the
feasibility of the MGST approach at low read counts.
[0299] Using the Illumina sequencing platform to genotype multiple
loci for multiple animals is feasible and economically practical.
In addition, MGST can be easily applied to other sequencing
platforms.
[0300] Reaction sizes have been scaled down successfully by 20
fold; (Ligation reactions reduced from 40 all to just LA). A simple
one tube system has been successfully used where hybridization,
ligation and the final sample indexing PCR all take place. In such
a single tube system, 384 well plates have been utilized but we
envision using 1536 well plates. At such sample densities we have
explored the use of an acoustic based liquid handling device (Echo
555, from Labcyte, Sunnyvale, Calif.) which can move droplets of
DNA and probe mixtures as low as 2.5 nL into such high sample plate
geometries.
[0301] Using small reaction sizes in a single tube/sample format
requires less than 10 ng of genomic DNA for the genotyping analysis
of multiple of loci.
[0302] It will be understood that larger probe panels can include
137 different loci. It will also be understood that even larger
probe panels can include 250, 500, 1000, 2000 and 5000 or more
loci. It also will be understood that the disclosure can be
performed using a robotics platform to handle the library
preparations A dual sample ID barcode system can be performed where
left and right index barcodes are added by a PCR reaction. This
permits multiplying the number of sample ID barcodes
(left.times.right) and obtain 10,000's of unique sample ID barcodes
from a limited set of left and right PCR primers.
[0303] Sample probe panels can be designed for the detection
(presence/absence) of microbial species in human and food
samples.
[0304] Probe panels that permit gene methylation status to be
determined have been designed.
[0305] Probe panels can be designed for the semi-quantitative
analysis such as copy number variations as well as estimation of
strain mixtures.
FIGS. 23, 24, and 25
Deoxyinosine
[0306] Taq DNA ligase poorly discriminates G or T mis-paired with T
or G, respectively, due to partial hydrogen bonds that can occur
between the mis-paired nucleotides. In general this mis-pairing
with generate a 25% signal as compared to the properly paired G to
C or T to A base pairing. This can confuse the genotyping
assay.
[0307] The G:T mismatch effect can be alleviated by placing a
non-pairing nucleotide such as the universal base deoxyinosine (dl)
within the probe sequences (complementary polynucleotides) adjacent
to the SNP interrogating nucleotide, a polymorphic nucleotide or
nucleotide sequence in the complementary polynucleotide.
[0308] FIG. 23 is a CC animal with a first complementary
polynucleotide comprising a 3' T (LHS-T). This figure demonstrates
that the LHS-T probe produces a strong signal from the mis-pairing
effect. However if a single deoxyinosine is placed at the 2nd (iT2)
to 7th (iT7) 3' position of the LHS-T probe, the mismatch effect is
removed. In this example, placement of the deoxyinosine at
positions 8 (iT8) to 10 (iT10) have little effect and the
mispairing produces a signal at nearly 25% of the properly paired
sequences (FIG. 23, CC panel). The placement of the deoxyinosine in
the LHS-T has no affect on the properly paired T:A match and its
ligations by the Taq DNA ligase.
[0309] The CC panel of FIG. 23 shows the reads counts obtained from
reactions programmed with genomic DNA from a homozygous CC animal
at locus rs17870274 and probes that contained either no
deoxyinosine (none) or deoxyinosine at the second (iT2) to tenth
(iT10) 3' positions. A probe mix to examine the other allele-C is
shown (C). A no probe control (NPC) is shown as well. The TT panel,
at right, shows the reads counts obtained from reactions programmed
with genomic DNA from a homozygous TT animal at the same locus
rs17870274.
[0310] Continued examples of data obtained from LHS and RHS probes
that have deoxyinosine at positions in the LHS and the RHS (FIGS.
24 and 25).
[0311] SNPs adjacent to the target SNPs have the potential to
interfere with the hybridization of the first and second
complementary polynucleotide and the target sequence, by altering
the melting temperatures of the probes (the first and second
complementary polynucleotides). To alleviate this issue we placed
the universal base deoxyinosine at positions in the first
complementary polynucleotide (LHS) and second complementary
polynucleotide (RHS) that are affected by the adjacent SNPs.
Deoxyinosine has no strong preference for complementarity and can
be extended by Taq polymerase. FIGS. 24 and 25 show that placing
the dl in the first complementary polynucleotide (LHS) or second
complementary polynucleotide (RHS) does not affect the ability of
the genotyping probes to operate and that the three expected
genotypes (AA, AB, BB) are still presented as cluster spaces.
[0312] FIG. 24 shows the results from placing deoxyinosine at other
positions in a first complementary polynucleotide. The first
complementary polynucleotide, LHS402 [rs17871214] probes contain a
single deoxyinosine at the ninth 3' position in order to alleviate
the potential for a second single nucleotide polymorphism SNP 5' of
that location (rs#17871215) to interfere with the binding the LHS
probes. Closed circles represent the BB genotype, close triangles
represent the AB genotype, closed little circles represent the AA
genotypes, while the X marks are animals that had unknown
genotypes.
[0313] FIG. 25 shows results of placing deoxyinosine at other
positions in a second complementary sequence. The second
complimentary sequence, RHS480 [rs29021607] probe contain a single
deoxyinosine at the fifth 5' position in order to alleviate the
potential for a SNP 3' of that location (rs29021606) to interfere
with the binding the second complementary sequence, RHS probe.
Closed circles represent the BB genotype, close triangles represent
the AB genotype, closed squares represent the AA genotypes, while
the X marks are animals that had unknown genotypes. The LHS402
[rs17871214] probes contain a single deoxyinosine at the ninth 3'
position in order to alleviate the potential for a SNP 5' of that
location (rs#17871215) to interfere with the binding the LHS
probes. Closed circles represent the BB genotype, close triangles
represent the AB genotype, closed little circles represent the AA
genotypes, while the X marks are animals that had unknown
genotypes.
Example Seven
FIG. 26
Methylation and Copy Number Variation
[0314] FIG. 26 shows methylation and copy number variation status
of the SNRPN gene in normal (n=3) and Angelman syndrome affected
individuals (n=3). The mean relative methylation status is shown
for the SNRPN gene. SNRPN was tiled with seven sets of
complementary polynucleotides (1-7) of which SNRPN1 and SNRPN2 are
not methylation sensitive sites and serve as controls, while the
remaining five SNRPN3-7 are methylation sensitive. Only those sets
of complementary polynucleotide for genes after (horizontal arrow)
the NRXN1 gene are methylation sensitive. An approximately half
fold reduction in methylation status for SNRPN3 indicates that only
one maternal allele is methylated in the normal individuals, while
both alleles are unmethylated in the AS individuals.
[0315] Methylation sensitive complementary polynucleotide sets in
genes that are to be interrogated for methylation status are placed
at Hhal sites within those genes. The Hhal site will only be cut by
that methylation sensitive restriction enzyme if that site is not
methylated. Sample genomic DNA to be tested is combined with the
sets of complementary polynucleotide, hybridized, then ligated. The
completed reactions are then split in half and one half treated
with the Hhal enzyme and the other with mock enzyme mix. The split
mixtures undergo PCR with different barcodes, and the library
prepared for sequencing. For any particular gene the number of
sequencing reads of the Hhal cut reaction are compared against the
reads for the mock cut reaction. When the reads are equal, the gene
is methylated, as the Hhal treatment does not destroy the ligated
complementary polynucleotide. When the reads are disequal and the
Hhal reads are reduced, this indicates that the Hhal sites were
unmethylated and subjected to Hhal degradation. Angelman syndrome
is a neurogenetic disorder resulting from aberrant expression of
genes located in an imprinting region on chromosome 15q11-q13. The
SNRPN gene is located in that area and seven sets of complementary
polynucleotides in that gene can monitor the imprinting
(methylation), two of the seven are unaffected by methylation and
serve as controls. FIG. 26 shows that the imprinting is lost in the
SNRPN gene in AS affected individuals as compared to normal
individuals. Genomic DNA was obtained from established
lymphoblastoid cell lines, which maintain the original imprinting
of the donor. The SNRPN3 and SNRPN5 complementary polynucleotide
positions shows an approximately 1/2 fold reduction in copy number,
as only the maternal copy of the imprinting region is
methylated.
Example Eight
FIG. 27
Quantification of Heterogeneous Samples
[0316] Human genomic sample DNA was mixed with Bos taurus genomic
sample DNA at 6 increasing amounts. The mixtures were then mixed
with a human first and second complementary polynucleotide sequence
probe panel containing 41 different target gene detection probes
(first and second complementary polynucleotide sequences), after
hybridization, ligation, and barcoding PCR (addition of tag
sequences), the library was sequenced. The read results for a
single probe set (IL-4) are shown. In this example, between 0% and
100% the relationship between the % human DNA and the number of
reads is roughly 15 reads per 1% of human DNA.
Example Nine
FIG. 28
Detection of a Microorganism in a Sample
[0317] Target DNA sequence of several cariogenic bacteria species
were detected in a sample DNA preparation extracted from human
saliva. A single human specific first and second complementary
probe set was used to detected the human DNA target sequence
expected in the saliva DNA sample, as well as first and second
complementary polynucleotide probe sets for two commensal bacteria
species (Streptococci, Lactobacilli), as well as a Universal-2
marker for bacterial DNAs'. A panel of seven first and second
complementary polynucleotide probe sets for cariogenic bacteria
probes sets, identified three species DNA in the subjects' saliva
sample. In this example the probe sets have a single left
hybridization sequence and a single right hybridization
sequence.
Example Ten
FIG. 29
Quantification of MO (Microorganisms) in a Sample
[0318] Quantification of human genomic DNA and bacterial DNA in a
sample of DNA extracted from human saliva. A single cariogenic
bacterial species was quantified between six different individuals'
saliva DNA samples. Complementary polynucleotide probe sets to
human, common commensal bacteria, and a cariogenic bacterium were
used to quantify differing levels of their presence in DNA samples
obtained from the saliva of healthy human donors. Saliva contains a
mixture of sluffed human epithelial cells as well as a plethora of
commensal bacteria that populated the human oral cavity. Tooth
decay causing bacteria can be detected within this complex mix and
quantified. After normalizing to the number of reads produced with
the complementary nucleotide sets directed to the human sample, the
relative (or absolute) amounts of the organism detected with the
other probes can be determined (based on the number of reads). Such
an exercise can be facilitated with standard curves.
Example Eleven
FIG. 30
Detection of a Small Dinucleotide Repeat Variant (INDEL) and of a
Single Nucleotide Deletion
[0319] The presently disclosed method, MGST, can detect other
sequence changes such as the insertions and deletions.
[0320] The second complementary polynucleotide (RHS) is placed at
the right most common sequence between the wild-type first target
sequence and the polymorphic or variant sequence. The first
complementary polynucleotide (LHS-wild-type probe) is placed such
that its 3' sequences reflect the wild-type target sequences
immediately 5' of the common second complementary polynucleotide
(RHS) sequences. The variant second complementary polynucleotide
(LHS) reflects the variant target sequence that is immediately 5'
of the common second complementary polynucleotide (RHS) sequences.
This LHS-wt/LHS-var/RHS probe (complementary polynucleotide) set
can then detected homozygous or heterozygous individuals for that
particular sequence alteration or wild type condition. Right Panel.
A small CT dinucleotide insertion is detected (A>ACT). Left
Panel. A single nucleotide deletion is detected (C AAAAAA>C
AAAAA). Points along the Y axis are homozygous variants while those
along the X axis are homozygous wild-type. Intermediate points are
heterozygous and have a single copy of both the variant and the
wildtype alleles.
Example Twelve
FIG. 31
Single Allele SNP, the Presence or Absence of a Single Target
Polynucleotide
[0321] The presently disclosed method, MGST, can be used to detect
specific target sequences, essentially a presence or absence test.
In this case a set of two complementary polynucleotides (i.e. one
first complementary polynucleotide and one second complementary
polynucleotide, a probe doublet) instead of a set of three
complementary polynucleotides (i.e. two first complementary
polynucleotide and one second complementary polynucleotide, a probe
triplet) is used. FIG. 31 shows results for a detection of a
specific high GC rich target sequence within chromosome 19 of the
bovine genomic DNA sample. Six of the seven samples have the
sequence and 1 of the seven samples does not.
Example Thirteen
FIG. 32
Three Allele SNP Detection
[0322] The presently disclosed method, MGST, is able to genotype
poly-allelic SNPs' by the simple addition of complementary
polynucleotide sets comprising three or more first complementary
polynucleotides (LHS; which differ in their 3' nucleotide(s))
specific for the additional allele/s in the target sequence. In the
example shown in FIG. 32, there were three nearly identical first
complementary polynucleotides (LHS), each first complementary
polynucleotide with a different 3' terminal nucleotide
complementary to a polymorphism (for example a SNP) in the genomic
target sequence sample DNA. The allele-specific tag (allele
barcode) was also altered to match the three possible SNPs. No
other changes to the protocol were required, other than to bin the
third allele type from the sequence data.
Example Fourteen
FIG. 33
Genotype of a Mock Tetraploid Genomic DNA Sample
[0323] The presently described method, MGST, can genotype
tetraploid organisms. For example, in tetraploidy, four copies of
an allele can exist, one on each of four chromosomes. To mimic a
tetraploid organism, two different bovine DNA samples were mixed
together. This produced a sample with four copies of any given
allele. A probe panel (mixture of multiple sets of first and second
complementary polynucleotides) that queries 113 loci was used. Loci
DQ404153, which comprises a polymorphic C/T site, was examined by
the presently described method, MGST.
[0324] FIG. 33 plots reads for the Allele-C against reads for the
Allele-T. Mock tetraploid DNA representing TTTT (solid circle) or
CCCC (solid square) genotypes plot along the Y or X axis,
respectively. Mock tetraploid DNA representing heterozygous
genotypes are shown as open squares (CTTT), closed triangle (CCTT),
and open diamonds (CCCT).
[0325] The sequence results demonstrate that the presently
disclosed method is capable of identifying the expected five
different genotypes (CCCC, CCCT, CCTT, CTTT, and TTTT) possible in
a tetraploid organism.
Example Fifteen
FIG. 34
Detection with RNA as the Start
[0326] The presently disclosed method, MDST, can be used with RNA
as the starting sample and can be used for RNA expression analysis.
Human RNA samples were obtained from a variety of healthy and
diseased tissues. The RNA was mixed with a panel of 41 primer
sequences which permitted those sequences to be copied into cDNA
form. The cDNA mixture was then hybridized to the sets of first and
second complementary polynucleotide, i.e. LHS and RHS probes,
mixtures, ligated, indexed by PCR and then the library sequenced.
The top panel of FIG. 34 shows the results for a common
housekeeping gene (beta-2-microglobulin) used for signal
normalization. The number of reads produced with the oncogene
(c-myc) which is known to be highly expressed in HELA and some
cancers are elevated in the HELA sample and in the prostate cancer
sample compared to the other samples (including prostate
non-cancer).
Example Sixteen
FIG. 35
MGST as Resolved on a Illumina MySeq Instrument
[0327] MGST libraries can be resolved on other Illumina sequencing
devices such as the MySeq device. The genotype for the bovine locus
rs29001956) resolved by MGST on a MySeq next generation sequencing
platform. The allele-A reads (x-axis) are plotted against the
allele-B reads (y-axis) for 96 bovine samples. The animals with
homozygous BB genotypes cluster along the Y-axis (close circles)
while those with homozygous AA genotypes cluster along the X-axis
(small point), with those heterozygous animals cluster between the
axis (closed triangles).
Example Seventeen
FIG. 36
Ion Torrent Detection
[0328] The basic assay can be modified to work on sequence data
generation instruments other than Illumina.
[0329] The presently described method, MGST, as resolved on a Life
Ion Torrent instrument (PGM). This requires that the sequences
required for sequence data generation on the Ion Torrent be added
to the joined product. As described in FIG. 36, the form of the
sequence data generation is specific. This similar form may or may
not be used with other sequence data generation platforms. A bovine
SNP (rs29009668) resolved by MGST on an lonTorrent next generation
sequencing platform. The allele-A reads (x-axis) are plotted
against the allele-B reads (y-axis) for 96 bovine samples. The
animals with homozygous BB genotypes cluster along the Y-axis
(close circles) while those with homozygous AA genotypes cluster
along the X-axis (small point), with those heterozygous animals
cluster between the axis (closed triangles). Animals with unknown
genotypes are shown (X).
Example Seventeen
FIG. 37
Diagram of Illumina Sequencing of Product Polynucleotides Produced
by PCR
[0330] Genomic bovine DNA was obtained from either whole blood,
buffy coat samples, or bull semen. The sample DNA was extracted
using either a salt extraction method (whole blood), commercial DNA
isolation kit (whole blood/buffy coats) or proteinaseK/organic
solvent treatment (semen).
[0331] Illumina genotyping has previously been used to genotype
these specific individuals, using the Illumina BovineSNP50
BeadChip. Oligonucleotide primer pairs were designed to amplify 98
target sequences that included polymorphic nucleotides (for
example, SNPs). The target sequences were between 47 and 97 bps of
genomic DNA sequence. PCR primers were designed such that the 3'
base of the reverse primer was no further than 14 bases from the
polymorphic nucleotide(s) (for example an SNP). Each primer pair
comprised a reverse primer and a forward primer. Each reverse PCR
primer also contained the 3' 33 bp of the reverse Illumina
sequencing primer sequence (Seq2;
5'-CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3') at the 5' end of the
primer. The 33 by Illumina sequencing primer sequence will serve as
the amplification initiation site for the entire Illumina
Sequencing primer sequence added in by PCR in a future step. The
forward SNP primer had a 20 bp linker sequence, either called A4
(5'-GGTGGGTTGGTGGAGTTGAG-3') or A7 (5'-ACACGACGGTCTTCCGACTC-3')
appended to its 5' end.
[0332] Samples included a tag sequence (barcode). The tag sequences
were added with two additional oligonucleotide primers, termed
bar-coding primers. The first set of barcoding primers (Barcode1)
contained from 5' to 3': 20 bp sequence for linker C7
(5'-TCCGCCTCTCCCACGCCGTC-3'), 8 bp of barcoded tag sequence,
followed by the sequence for either linker A4 or A7. The second set
of 24 bar-coding primers (Barcode2) consisted of the following
sequences 5' to 3': 33 bp of Illumina sequencing primer sequence
(Seq1; 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'), 8 bp of barcoded
tag sequence and the linker C7 sequence.
[0333] The 192 oligonucleotide primer sets for 96 of the 98 loci
were combined to a final concentration of 100 uM. PCR was performed
with 5-1 Ong genomic DNA samples that were dried in wells of
384-well plates (1 DNA sample per well). PCR reactions were
performed using the following methods: 0.625 ul 10.times. Buffer,
0.325 ul 25 mM MgCl2, 0.4 ul 25 mM dNTP mix (dATP, dCTP, dGTP,
dTTP), 0.25 ul HotStar Taq, 4 uM forward and reverse SNP primer
mix, 4 uM C7-Barcode1-A7 primer, 4 uM Seq1-Barcode2-C7 primer
5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-barcode-TCCGCCTCTCCCACGCCGTC--
3', 4 uM Illumina Seq2 primer
5'-CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3', adjusted to a 5 uL volume
with water. Thermal Cycler conditions were as follows: 95.degree.
C. for 15 min; 3 cycles of 94.degree. C. for 30 s, 56.degree. C.
for 1 min, 72.degree. C. for 1 min; 5 (or 12) cycles of 94.degree.
C. for 30 s, 58.degree. C. for 1 min, 72.degree. C. for 1 min;
followed by a final extension of 72.degree. C. for 3 min and
holding temperature of 50.degree. C.
[0334] Sample-specific tagged and completed PCR reactions were
combined into a single volume. A portion of the combined volume was
electrophoresed on a Pippen System to select PCR products of
appropriate size to use for the sequencing library. PCR products
were between 157 base pairs to 226 base pairs. To create a
sequencing library, the pooled sample was diluted 1:100 with water
and 1 uL of this was amplified with the full length Illumina
sequencing primers
(5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGA TCT-3')
and (5'-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTC CGA
TCT-3') set using the following reaction conditions: 6.25 uL of 4
uM full length forward Sequencing primer, 6.25 uL of 4 uM reverse
sequencing primer, 5 uL 10.times. Buffer, 1 uL 10 mM each dNTP, 2
uL HotStar Taq, and adjusted to a final volume of 50 uL with water.
Thermal cycling conditions were: one cycle at 95.degree. C. for 15
min, 12 cycles of 95.degree. C. for 20 s, 65.degree. C. for 30 s,
and 72.degree. C. for 30 s, followed by one cycle of 72.degree. C.
for 5 min and final temperature of 4.degree. C.
[0335] A portion of the library volume was then cleaned up with a
PCR clean up column (Qiagen) and eluted into 20 ul TE. A portion of
the eluate was examined on an eGene System to determine the
concentration of the library and to ensure that PCR primers and
primer dimers had been removed.
[0336] In some instances (i.e. experiments with small numbers of
samples), dual barcoding may not be required and a single barcode
method may be employed. Oligonucleotide primers for single barcode
experiments were designed in the following manner from 5' to 3': 33
bp of Illumina sequencing primer sequence Seq1
(5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'), 8 bp of barcoded tag
sequence, followed by the sequence for either linker A4 or A7. PCR
was performed as described above with the exception of the
substitution of the barcoding primers.
[0337] Sequence data was generated. The sequence reads can be
placed in bins based on the sample barcode(s). Analysis of the SNPs
contained in the sequence data in the bins allows the number of
reads associated with the target polynucleotide(s) to be
determined.
[0338] The general approach is diagramed in FIG. 37.
Example Eighteen
FIGS. 38 and 39
Illumina Sequencing of Product Polynucleotides Produced by PCR
[0339] The presently disclosed method, MGST (LDMA), can produce
cluster plots where the reads for the two different alleles are
highly skewed (one in several fold excess of the other). Even in
this situation the presence or absence of the target polynucleotide
can be determined.
Example Nineteen
[0340] FIG. 40: IINDELS and STR genotyping: INDELs and short tandem
repeat (STR) can be genotyped using the disclosed method.
[0341] The disclosed method can detect small insertions and
deletions (INDELS) as well as short tandem repeats. The same probe
design principals can also be used for large deletion events where
fixed breakpoints are known. STR probe design can determine STR
length though the use of multiple probes that span the length
distribution of the STR. In each example three probes are used for
each target polynucleotide (two LHS and one RHS). Genotypes are BB
(circles), AB (triangles) and AA (small circles). The sequence
nature of the alteration detected in shown in text with
allele-A/Allele-B. Repeat regions are in bold.
Examples 20-24
Protocols for Use with the Presently Disclosed Method
Examples 20 and 21
96-Well Plate+96-Well Plate, and 96-Well Plate+384-Well Plate, Both
at 40 ul
[0342] The presently described method was performed with liquid
mixtures of complementary polynucleotides (probes). This is
referred to as the "Two Plate Method" and required a 40 ul
"standard" "full sized reaction."
[0343] The disclosed method was performed using a sample prepared
from genomic DNA. The sample was added directly to a 96-well plate
and heated at 98.degree. C. for five minutes. A mixture of
complementary polynucleotides probe and hybridization buffer was
added to each well of a 96-well plate, sealed and hybridized
overnight. A ligation mixture was added and the first and second
complementary polynucleotides were ligated. In some cases, four
96-well plates were PCR on a single 384-well plate.
[0344] The sample was cooked. The amount of genomic sample DNA was
adjusted to 40 ng/ul (5 ul to 10 ul) as required with TE 8.3 and
was plated into Hybridization 96-well plate. The plate was heated
at 98.degree. C. for 5 minutes, then cooled to room temperature
(RT).
[0345] 3.0 ul of water, 3.0 ul of Hybridization Buffer contained
1.5M KCl, 300 mM Tris-HCl pH=8.5, 1 mM EDTA and 3.0 ul of 100 pM
complementary polynucleotide (probe) mixture (100 pM of each set of
complementary polynucleotide in TE pH=8.0) was added and the plate
was heated to 98.degree. C. for 1 minute, and 60.degree. C.
overnight.
[0346] The ligation mixture comprising 27.8 ul H20, 4.0 ul
10.times. Ligase Buffer and 0.2 ul Taq DNA Ligase was added to each
well, and the plate is heated to 54 C for 15 min.
[0347] An aliquote from each well is mixed with a unique
combination of left index and right index PCR primers. The mixture
comprises 3.0125 ul H20, 0.0375 UL Left Index 100 uM, 2.0 ul Right
Index 1.875 uM and 1.2 ul Ligase Reaction. These reactions can be
set up in 96 well plates OR in 384 well plates OR in other plate
and reaction vessel configurations.
[0348] PCR conditions are 94.degree. C. --5 min, (94.degree. C.
--10 sec, 65.degree. C. --15 sec).times.32 cycles, 72.degree. C.
--1 min, 8.degree. C. --hold.
[0349] After PCR, compatible 96 well or 384-well PCR plates were
consolidated into single library. Two volumes of Zymo Binding
buffer were added using a 10 ml pipette and completely mixed. The
All the liquid was passed through a Zymo-100 column (2.5K for
>min). The column was rinsed twice with 5 mis of wash buffer,
and spin, and flow through discarded. The column was washed twice
with 600 ul of wash buffer, and spin, and flow through discarded.
The column was placed into a clean receiving tube and spun at full
speed for 5 minutes. This was repeated and then the column was then
placed into a clean receiving tube 1.5 ml with cap and 150 ul of TE
pH8.0 added, let sit for one minute, and the tube was spun at 2 k
for 1 minute. The spin through is the library.
[0350] The library was then quantified by using the agarose gel to
approximate the concentration based on the 100 bp ladder and on a
Bioanalyzer 2100 DNA100 chip.
[0351] The library concentration is adjusted as per sequencing
platform recommendations and sequence data is generated (as per
sequencing platform manufactures' protocols).
Example 22
384-Well Plate with 2 ul DNA, and Dried Probe Mixture
[0352] The presently described method was performed with
complementary polynucleotides that were dried onto a plate. These
are a further variation of the examples 20 and 21. For these
experiments, a mixture of probe, hybridization buffer and water
were dried into a 384-well plate. Heated genomic DNA was then added
directly to the plate, sealed and hybridized overnight. The
hybridization plate was then used as the PCR plate, in this one
plate method.
[0353] The dried complementary polynucleotides (probes) were
prepared using 150 ul of Hybridization Buffer (1.5M KCl, 300 mM
Tris-HCl pH=8.5, 1 mM EDTA), 150 ul of 100 pM Probe mixture. (100
pM of each probe set in TE pH=8.0), 700 ul of water. 2.0 ul was
added to each well, but the plate was not covered. The plate was
spun down, and incubated at 50.degree. C. until dry.
[0354] Input DNA was adjusted to 20 ng/ul (3 to 5 ul) as required
with TE.sub.--8.3. 5 ul was heated to 98.degree. C. for 5 minutes,
cooled to RT, and then spun down.
[0355] 2.0 ul of cooked (heated) sample DNA was added to the dried
Probe/Buffer plate, the plate sealed and spun down. The temperature
was held at RT for 10 to 20 minutes. The plate was then vortexed
and spun down and sealed. Hybridization was then begun at
98.degree. C. for 1 minute, and 60.degree. C. overnight (at least
16 hours)
[0356] The ligation mixture containing 5.56 ul H20, 0.8 10.times.
Ligase Buffer (fully re-suspended and fresh), and 0.04 ul of Ligase
was created. The plate was held between 54 and 60.degree. C. and
6.4 ul ligation mixture was added. The plate was sealed, vortexed,
reheated, spun down, and incubated at 15 min 54.degree. C. and 1
min at 98.degree. C., and hold at 8.degree. C., ice or freeze.
[0357] The PCR index mixture contained 12.5 ul 2.times. PCR Master
Mix, 0.4625 H20, 0.0375 ul Left Index 200 uM and is kept on
ice.
[0358] The PCR reactions were mixed at room temperature. 13.0 ul of
PCR cocktail was dispensed (first three components) directly into
the Hybridization/Ligation 384-well PCR plate. The plate was spun
down in plate spinner briefly. 4.0 ul of the Right Index 1.875 uM
384-well plate was mapped onto the PCR plate. The plate was spun
down in plate spinner briefly. The plate was sealed with a heated
foil seal, and spun down at 3K for 1 minute. The plate was then
moved to the PCR machine and thermocycle for 32.times.. [94.degree.
C. --5 min, (94.degree. C. --10 sec, 65.degree. C. --15
sec).times.32 cycles, 72.degree. C. --1 min, 8.degree.
C.-hold).
[0359] After PCR, compatible 384-well PCR plates were consolidated
into single library. Two volumes of Zymo Binding buffer were added
using a 10 ml pipette and completely mixed. The All the liquid was
passed through a Zymo-100 column (2.5K for >min). The column was
rinsed twice with 5 mis of wash buffer, and spin, and flow through
discarded. The column was washed twice with 600 ul of wash buffer,
and spin, and flow through discarded. The column was placed into a
clean receiving tube and spun at full speed for 5 minutes. This was
repeated and then the column was then placed into a clean receiving
tube 1.5 ml with cap and 150 ul of TE pH8.0 added, let sit for one
minute, and the tube was spun at 2 k for 1 minute. The spin through
is the library.
[0360] The library was then quantified by using the agarose gel to
approximate the concentration based on the 100 bp ladder and on a
Bioanalyzer 2100 DNA100 chip.
[0361] The library concentration is adjusted as per sequencing
platform recommendations and sequence data is generated (as per
sequencing platform manufactures protocols).
Example 23
384-Well Plate+384-Well Plate with 2 ul
[0362] Sample DNA was added directly to the 384-plate and heated at
98.degree. C. for five minutes. A mixture of complementary
polynucleotides, hybridization buffer and water were added to each
well of a 384-well plate, sealed and hybridized overnight. The
ligation mixture was added and the probes were ligated. Then an
aliquote is moved to a second 384 well plate and the PCR reaction
to add the sample index(es) are performed. In all examples other
reaction configurations and vessels can be used.
[0363] The sample DNA was adjusted to 20 ng/ul (5 ul to 10 ul) as
required with TE.sub.--8.3. DNA could vary 20 to 200 ng/ul. 2 ul
was plated into a Hybridization 384 well plate. The plate sealed
with temporary tape seal, spun down 4 k 1 min, then heated at
98.degree. C. for 5 minutes, cooled to RT, and then spun down 4 k
for 1 min.
[0364] A mix of complementary polynucleotide (probe) and buffer mix
was prepared. The mixtures contained 0.6 ul of Hybridization Buffer
[1.5M KCl, 300 mM Tris-HCl pH=8.5, 1 mM EDTA], 0.6 ul of 100 pM
Probe mixture. [100 pM of each probe set in TE pH=8.0], 0.5 ul of
water
[0365] The sample DNA was then hybridized with the complementary
polynucleotides (probes), at 98.degree. C. for 1 minute, and
60.degree. C. overnight (for at least 20 hrs. but not >24 hrs)
in a thermal cycler.
[0366] The annealed first and second complementary polynucleotides
were ligated by preparing a ligation mixture. The mixture contained
11.12 ul H20, 1.6 ul 10.times. Ligase Buffer, and 0.04 ul Taq DNA
Ligase. The 60.degree. C. incubation was shifted to 54.degree. C.
12.8 ul of the ligase mix was dispensed and mixed into each well.
The plate was sealed and incubated 54.degree. C. for 15 minutes,
98.degree. C. for 1 min, 8.degree. C. forever. After 1 minute, the
plate was removed, and drops shaken down, by hand. The plate was
then placed into a rack and vortexed 10 seconds, returned to heat
block for 30 seconds, vortexed (adapter was used to avoid rubber
bits on the plate and getting into PCR block), and the plate
quickly centrifuged in the plate spinner and returned to heat block
until program finished. The plate was then spun down at 4K for 1
min.
[0367] Left Indexes were selected, one for each 384-well plate. A
PCR mixture was prepared for the needed reactions. The mixture
contained 6.25 ul 2.times.PCR Master Mix, 3.0125 H20, 0.0375 ul
Left Index 200 uM, 2.0 ul Right Index 1.875 uM, and 1.2 ul Ligase
Reaction, and the mixture kept on ice.
[0368] The PCR reactions were mixed at room temperature. 9.3 ul of
PCR cocktail was dispensed (first three components) directly into a
384-well PCR plate and the plate was spun down. 2.0 ul of the
unique Right Index 1.875 uM 384-well plate was put in each well of
the PCR plate. (1 to 1 Mapping). The plate was spun down. 1.0 ul
from each well of the hybridization/ligation 384-well plate was
mapped onto the PCR plate. (1 to 1 Mapping). The plate sealed, and
spun down The plate was then moved to the PCR machine and
thermocycle for 32.times.. [94.degree. C. --5 min, (94.degree. C.
--10 sec, 65.degree. C. --15 sec).times.32 cycles, 72.degree. C.
--1 min, 8.degree. C. --hold).
[0369] After PCR, compatible 384-well PCR plates (one with
differing left indexing primers) were consolidated into single
library. Two volumes of Zymo Binding buffer were added using a 10
ml pipette and completely mixed. The All the liquid was passed
through a Zymo-100 column (2.5K for >min). The column was rinsed
twice with 5 mis of wash buffer, and spin, and flow through
discarded. The column was washed twice with 600 ul of wash buffer,
and spin, and flow through discarded. The column was placed into a
clean receiving tube and spun at full speed for 5 minutes. This was
repeated and then the column was then placed into a clean receiving
tube 1.5 ml with cap and 150 ul of TE pH8.0 added, let sit for one
minute, and the tube was spun at 2 k for 1 minute. The spin through
is the library.
[0370] The library was then quantified by using the agarose gel to
approximate the concentration based on the 100 bp ladder and on a
Bioanalyzer 2100 DNA100 chip.
[0371] The library concentration is adjusted as per sequencing
platform recommendations and sequence data is generated (as per
sequencing platform manufactures protocols).
Example 24
384-Well Plate with 2 ul Dried Probe/Buffer+2.sup.nd 384-Well PCR
Plate
[0372] The presently described method was performed with
complementary polynucleotides that were dried onto a plate. For
these experiments, a mixture of probe, hybridization buffer and
water were dried into a 384-well plate. The pre-cooked sample DNA
was then added directly to the plate, sealed and hybridized
overnight, and then ligated. A second PCR 384-well plate was then
used and is seeded by the first hybridization/ligation 384-well
plate.
[0373] The complementary polynucleotides (probes) were prepared
using 150 ul of Hybridization Buffer (1.5M KCl, 300 mM Tris-HCl
pH=8.5, 1 mM EDTA), 150 ul of 100 pM Probe mixture. (100 pM of each
probe set in TE pH=8.0), 700 ul of water. 2.0 ul was added to each
well, but the plate was not covered. The plate was spun down, and
incubated at 50.degree. C. until dry.
[0374] The sample DNA was adjusted to 20 ng/ul (3 to 5 ul) as
required with TE.sub.--8.3. 5 ul was heated to 98.degree. C. for 5
minutes, cooled to RT, and then spun down.
[0375] 2.0 ul of heated sample DNA was added to the dried
Probe/Buffer plate, the plate sealed and spun down. The temperature
was held at RT for 10 to 20 minutes. The plate was then vortexed
and spun down. Hybridization was then begun at 98.degree. C. for 1
minute, and 60.degree. C. overnight (at least 16 hrs.)
[0376] The ligation mixture contained 5.56 ul H20, 0.8 10.times.
Ligase Buffer (fully resuspended and fresh), and 0.04 ul of Ligase.
The mixture was then mixed by inversion well and spun down. The
thermal program was advanced to 54.degree. C. and PAUSEd. 6.4 ul
ligation mixture was added to each well. The plate was sealed with
tape seal, vortexed, spun down, and incubated at 15 min 54.degree.
C. and 1 min at 98.degree. C., and hold at 8.degree. C., ice or
freeze.
[0377] The Right Index Plate was thawed at RT or 37.degree. C.,
spun down, and kept on ice. A single Left Index was selected. The
PCR reaction is 6.25 ul 2.times.PCR Master Mix, 3.0125 H20, 0.0375
ul Left Index 100 uM, 2.0 ul Right Index 1.875 uM (1' to 384'), and
1.2 ul Ligase Reaction from the first hybridization/ligation
384-well plate.
[0378] The PCR reactions were mixed at room temperature. 9.3 ul of
PCR cocktail was dispensed (first three components) into a 384-well
PCR plate. The plate was spun down. 2.0 ul of the Right Index 1.875
uM 384-well plate was mapped onto the PCR plate. (1 to 1 Mapping).
The plate was spun down. 1.0 ul of the Hybridization/Ligation
384-well plate was mapped onto the PCR plate. (1 to 1 Mapping). The
plate was sealed, spun down and thermocycled for 32.times..
[94.degree. C. --5 min, (94.degree. C. --10 sec, 65.degree. C. --15
sec).times.32 cycles, 72.degree. C. --1 min, 8.degree. C.
--hold).
[0379] After PCR, compatible 384-well PCR plates were consolidated
into single library. Two volumes of Zymo Binding buffer were added
using a 10 ml pipette and completely mixed. The All the liquid was
passed through a Zymo-100 column (2.5K for >min). The column was
rinsed twice with 5 mis of wash buffer, and spin, and flow through
discarded. The column was washed twice with 600 ul of wash buffer,
and spin, and flow through discarded. The column was placed into a
clean receiving tube and spun at full speed for 5 minutes. This was
repeated and then the column was then placed into a clean receiving
tube 1.5 ml with cap and 150 ul of TE pH8.0 added, let sit for one
minute, and the tube was spun at 2 k for 1 minute. The spin through
is the library.
[0380] The library was then quantified by using the agarose gel to
approximate the concentration based on the 100 bp ladder and on a
Bioanalyzer 2100 DNA100 chip.
[0381] The library concentration is adjusted as per sequencing
platform recommendations and sequence data is generated (as per
sequencing platform manufactures protocols).
Example 25
[0382] The Ion Torrent data in example 16 (FIG. 26) also provides
an example of how altered read configurations can be used to
generate the sequence data. For example, currently for sequence
data generation on the PGM a long read is required. The sequence
read contains the left sample ID barcode, some universal sequence
(this could be eliminated), the allele bar code and the loci.
[0383] The altered read characteristics can also be demonstrated on
an Illumina instrument. The read characteristics of the sequencing
instrument can be altered and genotyping information retrieved. To
demonstrate this, we extended the read one sequencing primer by one
single G base. This shorter read could be accommodated as the
molecules to be sequenced all contained a G at that position. This
altered read state did not affect the genotyping results (FIG. 41)
and the three expected genotype clusters were still present.
Sequence CWU 1
1
28121DNAArtificialPrimer 1agacgtgtgc tcttccgatc t
21233DNAArtificialPrimer 2acactctttc cctacacgac gctcttccga tct
33333DNAArtificialPrimer 3ctcggcattc ctgctgaacc gctcttccga tct
33420DNAArtificialPrimer 4ggtgggttgg tggagttgag
20520DNAArtificialPrimer 5acacgacggt cttccgactc
20620DNAArtificialPrimer 6tccgcctctc ccacgccgtc
20733DNAArtificialPrimer 7acactctttc cctacacgac gctcttccga tct
33833DNAArtificialPrimer 8acactctttc cctacacgac gctcttccga tct
33920DNAArtificialPrimer 9tccgcctctc ccacgccgtc
201033DNAArtificialPrimer 10ctcggcattc ctgctgaacc gctcttccga tct
331158DNAArtificialPrimer 11aatgatacgg cgaccaccga gatctacact
ctttccctac acgacgctct tccgatct 581261DNAArtificialPrimer
12caagcagaag acggcatacg agatcggtct cggcattcct gctgaaccgc tcttccgatc
60t 611333DNAArtificialPrimer 13acactctttc cctacacgac gctcttccga
tct 331412DNAArtificialFirst Complimentary Polynucleotide
14cgtacgtacg ta 121510DNAArtificialSecond Complimentary
Polynucleotide 15cgcatagcga 101640DNAArtificialTarget
Polynucleotide 16atgcatgcat gcatgcatgc atgcgtatgg ctatgcatgc
401712DNAArtificialPrimer 17dgtacgtacg ta 121812DNAArtificialPrimer
18cgtacgtacg tt 121912DNAArtificialPrimer 19cgtacgtacg tc
122033DNAArtificialPrimer 20acactctttc cctacacgac gctcttccga tct
332112DNAArtificialPrimer 21cgtacgtacg ta 122210DNAArtificialPrimer
22ggcatagcga 102312DNAArtificialPrimer 23cgtacgtacg ta
122410DNAArtificialPrimer 24cgcatagcga 102512DNAArtificialPrimer
25cgtacgtacg ta 122612DNAArtificialPrimer 26cgtacgtacg tt
122712DNAArtificialPrimer 27cgtacgtacg tc 122812DNAArtificialPrimer
28cgtacgtacg tg 12
* * * * *