U.S. patent application number 14/875602 was filed with the patent office on 2016-01-28 for compositions and methods for enhanced sensitivity and specificity of nucleic acid synthesis.
The applicant listed for this patent is LIFE TECHNOLOGIES CORPORATION. Invention is credited to Mekbib ASTATKE, Deb Chatterjee, Gary Gerard.
Application Number | 20160024494 14/875602 |
Document ID | / |
Family ID | 33492655 |
Filed Date | 2016-01-28 |
United States Patent
Application |
20160024494 |
Kind Code |
A1 |
ASTATKE; Mekbib ; et
al. |
January 28, 2016 |
COMPOSITIONS AND METHODS FOR ENHANCED SENSITIVITY AND SPECIFICITY
OF NUCLEIC ACID SYNTHESIS
Abstract
The present invention relates to nucleic acid inhibitors,
compositions and method for enhancing synthesis of nucleic acid
molecules. In a preferred aspect, the invention relates to
inhibition or control of nucleic acid synthesis, sequencing or
amplification. Specifically, the present invention discloses
nucleic acids having affinity for polypeptides with polymerase
activity for use in such synthesis, amplification or sequencing
reactions. The nucleic acid inhibitors are capable of inhibiting
nonspecific nucleic acid synthesis under certain conditions (e.g.,
at ambient temperatures). Thus, in a preferred aspect, the
invention relates to "hot start" synthesis of nucleic acid
molecules. Accordingly, the invention prevents, reduces or
substantially reduces nonspecific nucleic acid synthesis. The
invention also relates to kits for synthesizing, amplifying,
reverse transcribing or sequencing nucleic acid molecules
comprising one or more of the nucleic acid inhibitors or
compositions of the invention. The invention also relates to using
the inhibitors of the invention to prevent viral replication or
treat viral infections in a subject. Thus, the invention relates to
therapeutic methods and pharmaceutical compositions using the
inhibitors of the invention. The invention thus may be used for in
vivo and in vitro inhibition of nucleic acid synthesis and/or
inhibition of polymerase activity.
Inventors: |
ASTATKE; Mekbib;
(Germantown, MD) ; Chatterjee; Deb; (North
Potomac, MD) ; Gerard; Gary; (Frederick, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
LIFE TECHNOLOGIES CORPORATION |
Carlsbad |
CA |
US |
|
|
Family ID: |
33492655 |
Appl. No.: |
14/875602 |
Filed: |
October 5, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12772961 |
May 3, 2010 |
|
|
|
14875602 |
|
|
|
|
12468036 |
May 18, 2009 |
8043816 |
|
|
12772961 |
|
|
|
|
11852156 |
Sep 7, 2007 |
|
|
|
12468036 |
|
|
|
|
11007184 |
Dec 9, 2004 |
|
|
|
11852156 |
|
|
|
|
09608066 |
Jun 30, 2000 |
6830902 |
|
|
11007184 |
|
|
|
|
60142072 |
Jul 2, 1999 |
|
|
|
Current U.S.
Class: |
514/44R ;
435/194; 435/236; 435/6.1; 435/91.2; 435/91.5; 435/91.51;
536/23.1 |
Current CPC
Class: |
A61K 31/7052 20130101;
C12N 2310/122 20130101; C12Q 1/6869 20130101; C12Y 207/07007
20130101; C12N 9/1276 20130101; C12N 9/1252 20130101; C12N 2310/315
20130101; C12Q 1/6844 20130101; C12N 15/11 20130101; C12P 19/34
20130101; A61P 31/12 20180101; C12Y 207/07049 20130101; C12Q 1/6844
20130101; C12Y 207/07006 20130101; C12N 9/1247 20130101; C12Q
2527/125 20130101 |
International
Class: |
C12N 15/11 20060101
C12N015/11; A61K 31/7052 20060101 A61K031/7052; C12N 9/12 20060101
C12N009/12; C12P 19/34 20060101 C12P019/34; C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A composition for inhibiting nucleic acid synthesis, comprising
a nucleic acid inhibitor that is capable of binding or has affinity
to an enzyme with polymerase activity.
2. The composition of claim 1, wherein said nucleic acid inhibitor
forms a hairpin or comprises a double stranded nucleic acid
molecule.
3. The composition of claim 1, wherein said binding or affinity of
said nucleic acid inhibitor to said enzyme is inhibited, reduced,
substantially reduced, or eliminated under conditions for nucleic
acid synthesis, amplification or sequencing.
4. The composition of claim 1, wherein said nucleic acid inhibitor
is capable of forming a complex with said enzyme.
5. The composition of claim 1, further comprising one or more
enzymes having polymerase activity.
6. The composition of claim 5, wherein said enzyme is
thermophilic.
7. The composition of claim 1, wherein said nucleic acid inhibitor
is denatured or has reduced capacity to inhibit under conditions
for nucleic acid synthesis, amplification or sequencing.
8. The composition of claim 5, wherein said enzyme having nucleic
acid polymerase activity is selected from the group consisting of a
DNA polymerase, an RNA polymerase and a reverse transcriptase.
9. The composition of claim 8, wherein said DNA polymerase is
selected from the group consisting of Taq, Tne, Tma, Pfu, VENT.TM.,
DEEPVENT.TM., KOD, Tfl, and Tth DNA polymerases, and mutants,
variants and derivatives thereof.
10. The composition of claim 8, wherein said reverse transcriptase
is selected from the group consisting of M-MLV reverse
transcriptase, RSV reverse transcriptase, AMV reverse
transcriptase, RAV reverse transcriptase, MAV reverse transcriptase
and HIV reverse transcriptase, and mutants, variants and
derivatives thereof.
11. The composition of claim 8, wherein said reverse transcriptase
is substantially reduced in RNase H activity.
12. A method for synthesizing a nucleic acid molecule comprising:
mixing at least one enzyme with polymerase activity with one or
more nucleic acid inhibitors of claim 1 and one or more templates;
and incubating said mixture under conditions sufficient to
synthesize one or more first nucleic acid molecules complementary
to all or a portion of said templates.
13. The method according to claim 12, wherein said mixing is
accomplished under conditions to prevent nucleic acid synthesis
and/or to allow binding of said nucleic acid inhibitor to said
enzyme with polymerase activity.
14. The method according to claim 12, wherein said synthesis of
said first nucleic acid molecule is accomplished under conditions
sufficient to reduce the inhibitory affect of said nucleic acid
inhibitor, and/or to inhibit, reduce, substantially reduce, or
eliminate binding of said nucleic acid inhibitor to said enzyme
with polymerase activity.
15. The method according to claim 12, wherein said synthesis is
accomplished in the presence of at least one component selected
from the group consisting of one or more nucleotides, and one or
more primers.
16. The method according to claim 12, wherein said template is
double stranded nucleic acid molecule.
17. The method of claim 12, further comprising incubating said one
or more first nucleic acid molecules under conditions sufficient to
make one or more second nucleic acid molecules complementary to all
or a portion of said first nucleic acid molecules.
18. A nucleic acid molecule made according to the method of claim
12.
19. A method for amplifying a nucleic acid molecule comprising:
mixing at least one nucleic acid inhibitor of claim 1 with one or
more enzymes with polymerase activity and one or more templates;
and incubating said mixture under conditions sufficient to amplify
one or more nucleic acid molecules complementary to all or a
portion of said templates.
20. The method according to claim 19, wherein said mixing is
accomplished under conditions sufficient to prevent nucleic acid
amplification and/or to allow binding of said nucleic acid
inhibitor to said enzyme with polymerase activity.
21. The method according to claim 19, wherein said amplifying is
accomplished under conditions sufficient to denature said nucleic
acid inhibitor or reduce the ability of the inhibitor to inhibit
amplification.
22. The method according to claim 19, wherein said amplifying is
accomplished in the presence of at least one component selected
from the group consisting of one or more nucleotides, and one or
more primers.
23. The method according to claim 19, wherein said template is a
double stranded nucleic acid molecule.
24. A nucleic acid molecule made according to the method of claim
19.
25. A method for sequencing a nucleic acid molecule, comprising:
mixing at least one nucleic acid molecule to be sequenced with one
or more nucleic acid inhibitors of claim 1, one or more enzymes
having polymerase activity, and one or more terminating agents;
incubating said mixture under conditions sufficient to synthesize a
population of molecules complementary to all or a portion of said
molecules to be sequenced; and separating said population to
determine the nucleotide sequence of all or a portion of said
molecule to be sequenced.
26. The method according to claim 25, wherein said mixing is
accomplished under conditions sufficient to prevent synthesis
and/or to allow binding of said nucleic acid inhibitor to said
enzyme with polymerase activity.
27. The method according to claim 25, wherein said synthesis is
accomplished under conditions sufficient to denature said nucleic
acid inhibitor and/or to reduce the inhibitory affect of said
nucleic acid inhibitor.
28. The method according to claim 25, wherein said synthesis is
accomplished in the presence of at least one component selected
from the group consisting of one or more nucleotides, and one or
more primers.
29. The method according to claim 25, wherein said molecule to be
sequenced is a double stranded nucleic acid molecule.
30. A kit for use in synthesis, amplification or sequencing of a
nucleic acid molecule, said kit comprising one or more of the
nucleic acid inhibitors of claim 1.
31. The kit of claim 30, further comprising one or more components
selected from the group consisting of one or more nucleotides, one
or more DNA polymerases, one of more reverse transcriptases, one or
more suitable buffers, one or more primers and one or more
terminating agents.
32. A method for amplifying a double stranded DNA molecule,
comprising: providing a first and second primer, wherein said first
primer is complementary to a sequence within or at or near the 3
`-termini of the first strand of said DNA molecule and said second
primer is complementary to a sequence within or at or near the
3`-termini of the second strand of said DNA molecule and one or
more nucleic acid inhibitors of claim 1, under conditions such that
said inhibitors prevent or inhibit nucleic acid synthesis;
hybridizing said first primer to said first strand and said second
primer to said second strand to form hybridized molecules;
incubating said hybridized molecules under conditions sufficient to
allow synthesis of a third DNA molecule complementary to all or a
portion of said first strand and a fourth DNA molecule
complementary to all or a portion of said second strand; denaturing
said first and third strand, and said second and fourth strands;
and repeating (a) to (c) or (d) one or more times.
33. A method of preparing cDNA from mRNA, comprising mixing one or
more mRNA templates, one or more reverse transcriptases, and with
one or more nucleic acid inhibitors of claim 1; and incubating said
mixture under conditions sufficient to synthesize one or more cDNA
molecules complementary to all or a portion of said templates.
34. The method of claim 33, wherein said mixing is accomplished
under conditions sufficient to prevent nucleic acid synthesis
and/or allow binding of said nucleic acid inhibitor to said reverse
transcriptase.
35. A method for inhibiting or preventing nucleic acid synthesis,
amplification or sequencing comprising: mixing one or more nucleic
acid inhibitors of claim 1 with one or more enzymes having
polymerase activity; and incubating said mixture under conditions
sufficient to inhibit or prevent nucleic acid synthesis,
amplification and/or sequencing.
36. An oligonucleotide comprising a 5'- and a 3'-portion, wherein
said 3'-portion comprises a series of contiguous
deoxyribonucleotides or derivatives thereof and said 5'-portion
comprises a series of contiguous ribonucleotides or derivatives
thereof and wherein all or a portion of said 3'-portion is capable
of base pairing to all or a portion of said 5'-portion.
37. The oligonucleotide according to claim 36, wherein said
5'-portion comprising ribonucleotides forms a 5'-overhang.
38. The oligonucleotide according to claim 36, wherein said the
3'-most nucleotide comprises one or more modifications so as to be
non-extendable.
39. The oligonucleotide according to claim 38, wherein said
modification is phosphorylation of the 3'-hydroxyl of the
nucleotide.
40. The oligonucleotide according to claim 36, wherein said,
comprising one or more modifications so as to be resistant to one
or more nucleases.
41. The oligonucleotide according to claim 40, wherein said
modification is a phosphorothioate.
42. The oligonucleotide according to claim 40, wherein said
modification is a methylation of a hydroxyl group.
43. A method of inhibiting a polymerase enzyme within a cell,
comprising: introducing into a cell an oligonucleotide, said
oligonucleotide comprising a 5'- and a 3'-portion, wherein said
3'-portion comprises a series of contiguous deoxyribonucleotides or
derivatives thereof and said 5'-portion comprises a series of
contiguous ribonucleotides or derivatives thereof and wherein all
or a portion of said 3'-portoin is capable of base pairing to all
or a portion of said 5'-portion; and causing the inhibition of the
polymerase with said oligonucleotide.
44. The method according to claim 43, wherein said 5'-portion of
said oligonucleotide comprising ribonucleotides forms a
5'-overhang.
45. The method according to claim 43, wherein said polymerase is a
reverse transcriptase.
46. The method according to claim 45, wherein said polymerase is
HIV reverse transcriptase.
47. A method of inhibiting replication of a virus, comprising:
providing a virus, said virus comprising a reverse transcriptase
and requiring activity of the reverse transcriptase for
replication; contacting said reverse transcriptase with an
oligonucleotide that inhibits activity of said reverse
transcriptase thereby inhibiting replication of said virus.
48. The method according to claim 47, wherein said oligonucleotide
comprises a 5'- and a 3'-portion, wherein said 3'-portion comprises
a series of contiguous deoxyribonucleotides or derivatives thereof
and said 5'-portion comprises a series of contiguous
ribonucleotides or derivatives thereof and wherein all or a portion
of said 3'-portion is capable of base pairing to all or a portion
of said 5'-portion.
49. The method according to claim 48, wherein said 5'-portion
comprising ribonucleotides forms a 5'-overhang.
50. The method according to claim 47, wherein said virus is a
HIV.
51. The method according to claim 47, wherein said contacting
comprises introducing said oligonucleotide into a cell.
52. A method of treating a viral infection in a
subject,'comprising: administering to said subject a composition
comprising an oligonucleotide comprising a 5'- and a 3'-portion,
wherein said 3'-portion comprises a series of contiguous
deoxyribonucleotides or derivatives thereof and said 5'-portion
comprises a series of contiguous ribonucleotides or derivatives
thereof and wherein all or a portion of said 3'-portion is capable
of base pairing to all or a portion of said 5'-portion.
53. An oligonucleotide which binds or has affinity for one or more
reverse transcriptases.
54. The oligonucleotide of claim 53, which comprises one or more
ribonucleotides or derivatives thereof and one or more
deoxyribonucleotides or derivatives thereof.
55. The oligonucleotide of claim 53, wherein said oligonucleotide
is resistant to degradation or digestion.
56. A method of inhibiting one or more reverse transcriptases
comprising: contacting a sample or a cell with one or more
oligonucleotides which binds or has affinity for one or more
reverse transcriptases causing said oligonucleotides to inhibit the
polymerase activity of said reverse transcriptases.
57. The method of claim 56, wherein said oligonucleotide comprises
one or more modifications to inhibit or prevent degradation or
digestion of said oligonucleotide.
58. A method of treating a viral infection in a subject comprising:
administering to said subject an effective amount of the
oligonucleotide of claim 53; and causing said oligonucleotide to
inhibit or prevent said viral infection in said subject.
59. A pharmaceutical composition comprising the oligonucleotide of
claim 53.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is related to U.S. provisional patent
application No. 60/142,072 filed Jul. 2, 1999, which is
specifically incorporated herein in its entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to a method for increasing
sensitivity and specificity of nucleic acid synthesis by reducing
nonspecific nucleic acid synthesis occurring at ambient
temperature. The invention also relates to novel nucleic acids
which have high affinity to polymerases. The methods and
compositions of the present invention can be used in DNA
sequencing, amplification reactions, nucleic acid synthesis and
cDNA synthesis.
[0003] The invention also relates to nucleic acids and compositions
which are capable of inhibiting or preventing nucleic acid
synthesis, sequencing, amplification and cDNA synthesis, for
example, by binding one or more polypeptides with polymerase
activity. In addition, the materials and methods of the present
invention may be used as therapeutics to inhibit the replication of
organisms that rely upon a reverse transcriptase activity for
completion of their life cycle, such as retroviruses. The invention
also relates to vectors and host cells comprising such nucleic acid
molecules. The invention also concerns kits comprising the
compositions or nucleic acids of the invention.
BACKGROUND OF THE INVENTION
[0004] DNA polymerases synthesize the formation of DNA molecules
which are complementary to a DNA template. Upon hybridization of a
primer to the single-stranded DNA template, polymerases synthesize
DNA in the 5' to 3' direction, successively adding nucleotides to
the 3'-hydroxyl group of the growing strand. Thus, in the presence
of deoxyribonucleoside triphosphates (dNTPs) and a primer, a new
DNA molecule, complementary to the single stranded DNA template,
can be synthesized.
[0005] Both mesophilic and thermophilic DNA polymerases are used to
synthesize nucleic acids. Using thermostable rather than mesophilic
polymerases is preferable since the higher annealing temperatures
used with thermostable polymerases result in less non-specific DNA
amplification from extension of mis-annealed primers. Even with
thermostable polymerases, however, some primer sequences and
certain experimental conditions can result in the synthesis of a
significant amount of non-specific DNA products. These non-specific
products can reduce the sensitivity of polymerase-based assays and
can require extensive optimization for each primer set. In
addition, this problem is intensified when polymerases having a
high level of activity at ambient temperature are employed (for
example, DNA polymerase from Thermotoga neapolitana).
[0006] In examining the structure and physiology of an organism,
tissue or cell, it is often desirable to determine its genetic
content. The genetic framework of an organism is encoded in the
double-stranded sequence of nucleotide bases in the
deoxyribonucleic acid (DNA) which is contained in the somatic and
germ cells of the organism. The genetic content of a particular
segment of DNA, or gene, is only manifested upon production of the
protein and RNA which the gene encodes. In order to produce a
protein, a complementary copy of one strand of the DNA double helix
(the "coding" strand) is produced by polymerase enzymes, resulting
in a specific sequence of ribonucleic acid (RNA). This particular
type of RNA, since it contains the genetic message from the DNA for
production of a protein, is called messenger RNA (mRNA).
[0007] Within a given cell, tissue or organism, there exist many
mRNA species, each encoding a separate and specific protein. This
fact provides a powerful tool to investigators interested in
studying genetic expression in a tissue or cell. mRNA molecules may
be isolated and further manipulated by various molecular biological
techniques, thereby allowing the elucidation of the full functional
genetic content of a cell, tissue or organism.
[0008] A common approach to the study of gene expression is the
production of complementary DNA (cDNA) clones. In this technique,
the mRNA molecules from an organism are isolated from an extract of
the cells or tissues of the organism. This isolation often employs
chromatography matrices, such as cellulose or agarose, to which
oligomers of thymidine (T) have been complexed. Since the 3'
termini on most eukaryotic mRNA molecules contain a string of
Adenosine (A) bases, and since A binds to T, the mRNA molecules can
be rapidly purified from other molecules and substances in the
tissue or cell extract. From these purified mRNA molecules, cDNA
copies may be made using the enzyme reverse transcriptase (RT) or
DNA polymerases having RT activity, which results in the production
of single-stranded cDNA molecules. The single-stranded cDNAs may
then be converted into a complete double-stranded DNA copy (i.e., a
double-stranded cDNA) of the original mRNA (and thus of the
original double-stranded DNA sequences, encoding this mRNA,
contained in the genome of the organism) by the action of a DNA
polymerase. The protein-specific double-stranded cDNAs can then be
inserted into a vector, which is then introduced into a host
bacterial, yeast, animal or plant cell, a process referred to as
transformation or transfection. The host cells are then grown in
culture media, resulting in a population of host cells containing
(or in many cases, expressing) the gene of interest or portions of
the gene of interest.
[0009] This entire process, from isolation of mRNA to insertion of
the cDNA into a vector (e.g., plasmid, viral vector, cosmid, etc.)
to growth of host cell populations containing the isolated gene or
gene portions, is termed "cDNA cloning." If cDNAs are prepared from
a number of different mRNAs, the resulting set of cDNAs is called a
"cDNA library," an appropriate term since the set of cDNAs
represents a "population" of genes or portions of genes comprising
the functional genetic information present in the source cell,
tissue or organism.
[0010] Synthesis of a cDNA molecule initiates at or near the 3'
termini of the mRNA molecules and proceeds in the 5'-to-3'
direction successively adding nucleotides to the growing strand.
Priming of the cDNA synthesis at the 3'-termini at the poly A tail
using an oligo (dT) primer ensures that the 3' message of the mRNAs
will be represented in the cDNA molecules produced. The ability to
increase sensitivity and specificity during cDNA synthesis provides
more representative cDNA libraries and may increase the likelihood
of the cDNA library having full-length cDNA molecules (e.g.,
full-length genes). Such advances would greatly improve the
probability of finding full-length genes of interest.
[0011] In addition to their importance for research purposes,
reverse transcriptase enzymes play a critical role in the life
cycle of many important pathogenic viruses, in particular, the
human immunodeficiency viruses (HIV). In order to complete its life
cycle, HIV and other similar viruses must use a reserve
transcriptase enzyme to convert the viral RNA genome into DNA for
integration into the host's genomic material. Since this step is
critical to the viral life cycle and host cells do not have any
similar requirement for reverse transcriptase activity, the reverse
transcriptase enzyme has been intensively studied as a
chemotherapeutic target. In general, the bulk of therapeutic
reagents directed at the reverse transcriptase enzyme have been
nucleotide analogues, for example AZT. Other therapeutic modalities
using oligonucleotide-based reagents, e.g., anti-sense
oligonucleotides and ribozymes, have been used to inhibit viral
replication, however, these reagents are not targeted specifically
against reverse transcriptase activity, instead of being targeted
against the nucleic acid of the viral genome. See, for example,
Goodchild, et al., "Inhibition of human immunodeficiency virus
replication by antisense oligodeoxynucleotides," Proc. Natl. Acad.
Sci. USA 85:5507-5511 (1988), Matsukara, et al., "Regulation of
viral expression of human immunodeficiency virus in vitro by an
antisense phosphorothioate oligodeoxynucleotide against rev
(art/trs) in chronically infected cells," Proc. Natl. Acad. Sci.
USA 86:4244-4248 (1989), Rossi, et al., "Ribozymes as Anti-HIV-1
Therapeutic Agents: Principles, Applications, and Problems," Aids
Research and Human Retroviruses 8:183:189 (1992), Goodchild,
"Enhancement of ribozyme catalytic activity by a contiguous
oligodeoxynucleotide (facilitator) and by 2'-O-methylation,"
Nucleic Acids Research 20:4607-4612 (1992) and Kinchington, et al.,
"A comparison of gag, pol and rev antisense oligodeoxynucleotides
as inhibitors of HIV-I," Antiviral Research 17:53-62 (1992) which
are specifically incorporated herein by reference. Oligonucleotides
that have been blocked at the 3'-end to prevent their elongation by
reverse transcriptase have also been considered as inhibitors (see,
for example, Austermann, et al., "Inhibition of human
immunodeficiency virus type 1 reverse transcriptase by 3'-blocked
oligonucleotides" Biochemical Pharmacology 43(12):2581-2589 (1992).
Each of the above cited references is specifically incorporated
herein in its entirety.
[0012] Oligonucleotides have been investigated for anti-HIV
activity. For example, Idriss, et al. (1994), Journal of Enzyme
Inhibition 8(2)97-112, disclose DNA oligonucleotides in a hairpin
structure as inhibitors of HIV RT activity while Kuwasaki, et al.,
(1996) Biochemical and Biophysical Research Communications
228:623-631 disclose anti-sense hairpin oligonucleotides containing
a mixture of deoxy and 2'-methoxy-nucleotides with anti-HIV
activity.
[0013] Notwithstanding these and other efforts to modulate the
activity of polymerases, there remains a need in the art for
materials and methods to prevent the undesirable activity of the
polymerases while permitting the synthesis of nucleic acids by the
polymerase when such synthesis is desired. These and other needs
are met by the present invention.
SUMMARY OF THE INVENTION
[0014] The present invention provides materials and methods for
inhibiting, reducing, substantially reducing or eliminating nucleic
acid synthesis under certain conditions (preferably at ambient
temperatures and/or within a cell) while permitting synthesis when
such synthesis is desired.
[0015] In a preferred aspect, the invention relates to methods for
the prevention or inhibition of nucleic acid synthesis during
reaction set up (e.g., in vitro) and preferably before optimum
reaction conditions for nucleic acid synthesis are achieved. Such
inhibition of synthesis at sub-optimum conditions or during
reaction set up prevents or reduces non-specific nucleic acid
synthesis. Once reaction set up is complete and the optimum
conditions are reached, nucleic acid synthesis can be
initiated.
[0016] In another aspect, the present invention relates to a method
of inhibiting a polymerase enzyme within a cell (e.g., in vivo) by
introducing into the cell an oligonucleotide or inhibitor of the
invention, preferably said oligonucleotide comprises a 5'-and a
3'-portion, wherein the said 3'-portion comprises one or more
deoxyribonucleotides or derivatives thereof and said 5'-portion
comprises one or more ribonucleotides or derivatives thereof and
wherein all or a portion of said 3'-portion is capable of base
pairing to all or a portion of said 5'-portion and incubating said
cell under conditions causing the inhibition of the polymerase. In
some embodiments, the 5'-portion of the oligonucleotide which
comprises ribonucleotides forms a 5'-overhang. In another aspect,
the oligonucleotide is in the form of a hairpin and preferably the
stem of the hairpin comprises a series of contiguous
ribonucleotides based paired or hybridized with a series of
continguous deoxyribonucleotides. In some embodiments the
polymerase is a reverse transcriptase and may preferably be an HIV
reverse transcriptase.
[0017] In another aspect, the present invention provides a method
of inhibiting replication of a virus, by providing a virus, said
virus comprising a reverse transcriptase and requiring activity of
the reverse transcriptase for replication and contacting said
reverse transcriptase with an oligonucleotide or inhibitor of the
invention that inhibits activity of said reverse transcriptase
thereby inhibiting replication of said virus. In some embodiments,
the oligonucleotide comprises a 5'- and a 3'-portion, wherein said
3'-portion comprises one or more deoxyribonucleotides or
derivatives thereof and said 5'-portion comprises one or more
ribonucleotides or derivatives thereof and wherein all or a portion
of said 3'-portion is capable of base pairing to all or a portion
of said 5'-portion. In some embodiments, the 5'-portion of the
oligonucleotide which comprises ribonucleotides forms a
5'-overhang. In another aspect, the oligonucleotide is in the form
of a hairpin and preferably the stem of the hairpin comprises a
series of contiguous ribonucleotides base paired or hybridized with
a series of contiguous deoxyribonucleotides. In some embodiments,
the virus is an HIV. In some embodiments, contacting comprises
introducing said oligonucleotide into a cell.
[0018] More specifically, the invention relates to controlling
nucleic acid synthesis by introducing an inhibitory nucleic acid or
oligonucleotide which binds to or interacts with the polypeptide
with polymerase activity (e.g., DNA polymerases, reverse
transcriptases, etc.). Accordingly, such inhibitory nucleic acids
or oligonucleotide can bind the polymerase and interfere with
nucleic acid synthesis by preventing binding or interaction of the
polymerase or reverse transcriptase with the primer/template.
Preferably, such inhibitory nucleic acid molecules are double
stranded molecules although any form of nucleic acid molecule may
be used as long as the molecule can bind or interact with the
polymerization enzyme of interest. Such molecules may be DNA, RNA,
DNA/RNA hybrids, double stranded DNA, double stranded RNA and
DNA/RNA double stranded molecules. Derivative nucleic acid
molecules may also be used such as Protein Nucleic Acids (PNAs),
linked nucleic acids (LNA, available form Proligo, Boulder Co.) and
nucleic acid molecules comprising modified nucleotides. Moreover,
the nucleic acid molecules may be in any form or topology such as
linear, circular, supercoiled, double stranded with one or more
single stranded portions, hairpin structure, or complexed with
other molecules such as peptides or proteins and the like. Such
inhibitory nucleic acids preferably include double-stranded nucleic
acid molecules (which may comprise one or more internal, 5' and/or
3' single stranded portions), or single stranded nucleic acid
molecules capable of folding into a double stranded form, i.e.
forming one or more hairpin-loops, such that at least one double
stranded portion of the nucleic acid molecule is capable of binding
to a polypeptide with polymerase activity. In one aspect, the
nucleic acid molecules used in the invention bind the polypeptide
having polymerase activity (e.g., DNA polymerase, reverse
transcriptase, etc.) with high affinity. Once the polymerase or
reverse transcriptase is complexed with the inhibitory nucleic
acid, it is unavailable for annealing to the primer/template
substrate, resulting in reduced, substantially reduced, or no
polymerase or reverse transcriptase activity. In some embodiments,
the oligonucleotides of the present invention may comprise a 5'-
and a 3'-portion, wherein said 3'-portion comprises one or more
deoxyribonucleotides or derivatives thereof and said 5'-portion
comprises one or more ribonucleotides or derivatives thereof and
wherein all or a portion of said 3'-portion is capable of base
pairing to all or a portion of said 5'-portion. In some
embodiments, the oligonucleotides of the invention may comprise a
5'-portion, wherein said 5'-portion comprising ribonucleotides
forms a 5'-overhang. In some embodiments, an oligonucleotide of the
invention may comprise one or more modifications so as to be
non-extendable. In some embodiments, this modification may be to
the 3'-most nucleotide. In some embodiments, the modification is
phosphorylation of the 3'-most nucleotide at the 3'-hydroxyl. An
oligonucleotide of the present invention may comprise one or more
modifications so as to be resistant to digestion or degradation by,
for example, one or more nucleases. In some embodiments, this
modification may be the incorporation of one or more
phophorothioate moieties. In some embodiments, the modification may
comprise alkylation of one or more hydroxl groups.
[0019] Thus, the inhibitory nucleic acid is preferably introduced
into the reaction mixture where it competitively binds to or
interacts with the polymerase, thereby inhibiting synthesis by the
polymerase under particular reaction conditions. Thus, interaction
or binding of the inhibitor and polymerase preferably results in
the formation of an inhibitor/polymerase complex.
[0020] The inhibition of polymerase activity or nucleic acid
synthesis by the nucleic acids of the invention is preferably
reduced, substantially reduced, inhibited, or eliminated so that
nucleic acid synthesis may proceed when reaction conditions are
changed, for example, when the temperature is raised.
[0021] In a preferred aspect, the changed conditions affect the
ability of the inhibitory nucleic acids to interact with the
polymerase causing release of the polymerase and/or denaturation or
inactivation of the inhibitory nucleic acids making the polymerase
available thus allowing nucleic acid synthesis to proceed. In one
aspect, the inhibitory nucleic acids and the primer/template
substrate competitively interact with the polymerase to prevent
synthesis. Under the changed conditions, the competitive
interaction is reduced such that nucleic acid synthesis occurs. In
another aspect, the changed conditions cause the double stranded
inhibitory nucleic acid molecule(s) (including hairpins) to
denature or melt such that single stranded molecules are formed
which do not substantially bind or interact with the polymerase. In
another aspect, a second change in conditions (i.e., temperature is
lowered to, for example, ambient temperatures) allows the inhibitor
nucleic acid molecules of the invention to reactivate or again
inhibit nucleic acid synthesis. That is, the inhibitors may again
interact or bind with the polymerase or reverse transcriptase under
the changed conditions. For example, the changed conditions may
allow the inhibitor to form double stranded molecules which
effectively enhances its binding or interacting capacity with the
polymerase or reverse transcriptases. Thus, in accordance with the
invention, the inhibitors may be reused or recycleable during
synthesis reactions (single or multiple) which may require multiple
adjustment or changes in reaction conditions (i.e., temperature
changes), without the need to add additional inhibitor.
[0022] The invention therefore relates to a method for synthesizing
one or more nucleic acid molecules, comprising (a) mixing one or
more nucleic acid templates (which may be a DNA molecule such as a
cDNA molecule, or an RNA molecule such as an mRNA molecule) with
one or more primers, and one or more inhibitory nucleic acids or
compositions of the present invention capable of binding or
interacting with an enzyme having polymerase activity, and (b)
incubating the mixture in the presence of one or more enzymes
having nucleic acid polymerase activity (e.g., DNA polymerases or
reverse transcriptases) under conditions sufficient to synthesize
one or more first nucleic acid molecules complementary to all or a
portion of the templates. Alternatively, the method may comprise
mixing one or more inhibitor nucleic acids with one or more
polymerases and incubating such mixtures under conditions
sufficient to synthesize one or more nucleic acid molecules. Such
conditions may involve the use of one or more nucleotides and one
or more nucleic acid synthesis buffers. Such methods of the
invention may optionally comprise one or more additional steps,
such as incubating the synthesized first nucleic acid molecule
under conditions sufficient to make a second nucleic acid molecule
complementary to all or a portion of the first nucleic acid
molecule. These additional steps may also comprise the use of the
inhibitory nucleic acid molecules of the invention. The invention
also relates to nucleic acid molecules synthesized by these
methods.
[0023] In a related aspect, the nucleic acid synthesis method may
comprise (a) mixing one or more polymerases with one or more of the
inhibitory nucleic acid molecules of the invention, and (b)
incubating such mixture under conditions sufficient to inactivate
or substantially inhibit or reduce polymerase activity of such
polymerases. In another aspect, such incubation is under conditions
sufficient to inhibit or prevent such nucleic acid synthesis.
[0024] The invention also relates to a method for amplifying one or
more nucleic acid molecules, comprising (a) mixing one or more
nucleic acid templates with one or more primers, and one or more
inhibitory nucleic acid molecules or compositions of the present
invention capable of binding or interacting with an enzyme having
polymerase activity and (b) incubating the mixture in the presence
of one or more enzymes having nucleic acid polymerase activity
(e.g., DNA polymerases) under conditions sufficient to amplify one
or more nucleic acid molecules complementary to all or a portion of
the templates. More specifically, the invention relates to a method
of amplifying a DNA molecule comprising: (a) providing a first and
second primer, wherein said first primer is complementary to a
sequence within or at or near the 3'-termini of the first strand of
said DNA molecule and said second primer is complementary to a
sequence within or at or near the 3'-termini of the second strand
of said DNA molecule, and one or more inhibitory nucleic acids or
compositions of the invention (e.g., a nucleic acid having affinity
for an enzyme with polymerase activity); (b) hybridizing said first
primer to said first strand and said second primer to said second
strand; (c) incubating the mixture under conditions such that a
third DNA molecule complementary to all or a portion of said first
strand and a fourth DNA molecule complementary to all or a portion
of said second strand are synthesized; (d) denaturing said first
and third strand, and said second and fourth strands; and (e)
repeating steps (a) to (c) or (d) one or more times. Such
conditions may include incubation in the presence of one or more
polymerases, one or more nucleotides and/or one or more buffering
salts. The invention also relates to nucleic acid molecules
amplified by these methods.
[0025] In a related aspect, the nucleic acid amplification method
may comprise (a) mixing one or more polymerases with one or more of
the inhibitory nucleic acid molecules of the invention, and (b)
incubating such mixture under conditions sufficient to inactivate
or substantially inhibit or reduce polymerase activity of such
polymerases. In another aspect, such incubation is under conditions
sufficient to inhibit or prevent such nucleic acid
amplification.
[0026] The invention also relates to methods for sequencing a
nucleic acid molecule comprising (a) mixing a nucleic acid molecule
to be sequenced with one or more primers, one or more of the
inhibitory nucleic acids or compositions of the invention, one or
more nucleotides and one or more terminating agents to form a
mixture; (b) incubating the mixture under conditions sufficient to
synthesize a population of molecules complementary to all or a
portion of the molecule to be sequenced; and (c) separating the
population to determine the nucleotide sequences of all or a
portion of the molecule to be sequenced. The invention more
specifically relates to a method of sequencing a nucleic acid
molecule, comprising: (a) providing an inhibitory nucleic acid or
composition of the present invention (to which an enzyme with
polymerase activity as affinity), one or more nucleotides, and one
or more terminating agents; (b) hybridizing a primer to a first
nucleic acid molecule; (c) incubating the mixture of step (b) under
conditions sufficient to synthesize a random population of nucleic
acid molecules complementary to said first nucleic acid molecule,
wherein said synthesized molecules are shorter in length than said
first molecule and wherein said synthesized molecules comprise a
terminator nucleotide at their 3' termini; and (d) separating said
synthesized molecules by size so that at least a part of the
nucleotide sequences of said first nucleic acid molecule can be
determined. Such terminator nucleotides include
dideoxyribonucleoside thiphophates such as ddNTP, ddATP, ddGTP,
ddITP or ddCTP. Such conditions may include incubation in the
presence of one or more polymerases and/or buffering salts.
[0027] In a related aspect, the nucleic acid sequencing method may
comprise (a) mixing one or more polymerases with one or more of the
inhibitory nucleic acid molecules of the invention, and (b)
incubating such mixture under conditions sufficient to inactivate
or substantially inhibit polymerase activity of such polymerases.
In another aspect, such incubation is under conditions sufficient
to inhibit or prevent such nucleic acid sequencing.
[0028] The invention also relates to the inhibitory nucleic acids
of the invention and to compositions comprising the inhibitory
nucleic acids of the invention, to vectors (which may be expression
vectors) comprising these nucleic acid molecules, and to host cells
comprising these nucleic acid molecules or vectors. Compositions of
the invention may also include those compositions made for carrying
out the methods of the invention or produced while carrying out
such methods. The invention also relates to pharmaceutical
compositions. Such compositions may comprise one or more of the
inhibitory nucleic acid molecules or oligonucleotides of the
invention and at least one other component selected from the group
consisting of one or more nucleotides, one or more polymerases
(e.g., thermophilic or mesophilic DNA polymerases and/or reverse
transcriptases), one or more suitable buffers or buffer salts, one
or more primers, one or more terminating agents, one or more
viruses, one or more cells, and one or more amplified or
synthesized nucleic acid molecules produced by the methods of the
invention. The invention also relates to methods of producing an
inhibitory nucleic acid comprising culturing the above-described
host cells under conditions favoring the production of the nucleic
acid by the host cells, and isolating the nucleic acid. The
invention also relates to nucleic acid produced by synthetic
methods. Such inhibitory nucleic acid molecules of the invention
may also be made by standard chemical synthesis techniques.
[0029] In a related aspect, the present invention provides
materials and methods for the in vivo inhibition of polymerase
activity. In some embodiments, the present invention provides for
the introduction of the inhibitory oligonucleotides of the present
invention into an organism thereby inhibiting a polymerase present
within the organism. In some embodiments, the polymerase may be a
reverse transcriptase, preferably a viral reverse transcriptase. In
some embodiments, the present invention provides a method for the
inhibition of a viral reverse transcriptase comprising contacting a
cell or virus expressing a viral reverse transcriptase with an
inhibitory oligonucleotide under conditions causing the
oligonucleotide to inhibit the reverse transcriptiase. Preferably,
the oligonucleotide is contacted with the cell under conditions
sufficient to have the oligonucleotide taken up by the cell by well
known techniques. In some embodiments, the present invention
provides a method of inhibiting the growth of a virus, comprising
contacting a cell infected with a virus that requires reverse
transcriptase activity to complete its life cycle with an
inhibitory oligonucleotide under conditions causing the
oligonucleotide to be taken up by the cell and causing the reverse
transcriptase to be inhibited thereby inhibiting the growth of the
virus. In some embodiments, the present invention provides a method
of treating an organism or subject infected with a virus that
requires reverse transcriptase activity to complete its life cycle
comprising contacting an infected cell of the organism or subject
with a composition comprising an inhibitory oligonucleotide under
conditions causing the oligonucleotide to be taken up by the cell
and causing the reverse transcriptase to be inhibited thereby
treating the organism.
[0030] The invention also relates to kits for use in synthesis,
sequencing and amplification of nucleic acid molecules, comprising
one or more containers containing one or more of the inhibitory
nucleic acids or compositions of the invention. These kits of the
invention may optionally comprise one or more additional components
selected from the group consisting of one or more nucleotides, one
or more polymerases (e.g., thermophilic or mesophilic DNA
polymerases and/or reverse transcriptases), one or more suitable
buffers, one or more primers and one or more terminating agents
(such as one or more dideoxynucleotides). The invention also
relates to kits for inhibiting viral replication or kits for
treating viral infections comprising the inhibitory nucleic acids
of the invention. Such kits may also comprise instructions or
protocols for carrying out the methods of the invention.
[0031] Other preferred embodiments of the present invention will be
apparent to one of ordinary skill in light of the following
drawings and description of the invention, and of the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0032] FIG. 1. The activity of Tne DNA polymerase was qualitatively
determined. Panel A: determination in the absence of inhibitor A,
Panel B: determination in the presence of inhibitor. The five
lanes, of each panel, from left to right are 15 sec, 30 sec, 1 min,
2 min and 5 min time points that have elapsed before the reactions
were quenced. P and C denote the primer position and control lane,
respectively. Inhibitor A did not contain dideoxynucleotide at its
termini.
[0033] FIG. 2. Amplification of a 2.7 Kb target DNA sequence
(pUC19) was performed at 5 different dilutions of the template. The
target was amplified by Tne DNA polymerase. Two different
concentration of Tne polymerse (85 nM and (e.g, 1 unit) and 42.5 nM
(e.g., 0.5 units)) and the respective inhibitor B Complexes (using
a 150-fold excess hairpin B over the polymerase concentration) were
used for each amplification condition. The concentration of the
target DNA in lanes 1, 2, 3, 4 & 5 is 100 .mu.g, 20 .mu.g, 2
.mu.g, 0.2 .mu.g and 0.02 .mu.g, respectively. Inhibitor B did not
contain dideoxynucleotide at its termini.
[0034] FIG. 3. A 1Kb, 3 Kb and 5Kb target DNA sequence (human
genomic source) were amplified by The (85 nM (e.g., I unit) and Taq
(e.g., 1 unit)) DNA polymerases as represented in panels A, B, and
C respectively. The four lanes of each panel repersented as a, b, c
and d are Tne (+125-fold excess inhibitor A), Tne (+50-fold excess
inhibitor A), Tne (no inhibitor) and Taq (no inhibitor),
respectively. Inhibitor A contained a 3'-terminal dideoxynucleotide
(i.e., ddT).
[0035] FIG. 4. The amplification of a 5 and 15 Kb target DNA
sequence (human genomic source) was performed with Tne DNA
polymerase (8.5 nM (e.g., 0.1 units)). The five panels A, B, C, D
and E represent reaction conditions: Tne (no inhibitor), Tne
(+50-fold excess inhibitor), Tne (+150-fold excess inhibitor), Tne
(+300-fold excess inhibitor), Tne (+750-fold excess inhibitor),
respectively. The two lanes (a and b) for each panel represent
amplification of a target size of 5 and 15 Kb. For this assay, the
inhibitor B was used which did not contain a terminal
dideoxynucleotide.
[0036] FIG. 5. The amplification of a 3 Kb target DNA sequence
(human genomic source) was performed with 1 unit Taq DNA
polymerase. The three panels A, B, and C represent reaction
conditions:for A and B the same primer sequences were used -1) the
PCR mix was incubated at 94.degree. C. for 1 min and was set on ice
to force mis-priming. All PCR reactionswere set for 30 min at
25.degree. C. so as to increase non-specific DNA synthesis. Each
condition has four lanes-lane a (Taq control), b (Taq+16 nM
inhibitor), c (Taq+32 nM inhibitor) and d (Taq+64 nM inhibitor).
Inhibitor B was used which did not contain a terminal
dideoxynucleotide.
[0037] FIG. 6A is a graph showing the results of polymerase
activity assays of Thermoscript.TM. I in the absence and presence
of nucleic acid inhibitors at ambient temperature (left bar),
37.degree. C. (center bar) and 55.degree. C. (right bar). TS
denotes polymerase reaction initiated by Thermoscript.TM.I TS-D
denotes polymerase reaction initiated by Thermoscript.TM. I in the
presence of nucleic acid inhibitor D, TS-E denotes polymerase
reaction initiated by Thermoscript.TM. in the presence of nucleic
acid inhibitor E, and TS-H denotes polymerase reaction initiated by
Thermoscript.TM. I in the presence of nucleic acid inhibitor H.
[0038] FIG. 6B is a graph showing the results of polymerase
activity assays of Thermoscript.TM. I in the absence and presence
of nucleic acid inhibitors at ambient temperature (left bar),
37.degree. C. (center bar) and 55.degree. C. (right bar). TS
denotes polymerase reaction initiated by Thermoscript.TM. I, TS-C
denotes polymerase reaction initiated by Thermoscript.TM. I in the
presence of nucleic acid inhibitor C, TS-H denotes polymerase
reaction initiated by Thermoscript.TM. I in the presence of nucleic
acid inhibitor H, TS-E denotes polymerase reaction initiated by
Thermoscript.TM. I in the presence of nucleic acid inhibitor E,
TS-F denotes polymerase reaction initiated by Thermoscript.TM. I in
the presence of nucleic acid inhibitor F, and TS-G denotes
polymerase reaction initiated by Thermoscript.TM. I in the presence
of nucleic acid inhibitor G.
[0039] FIG. 7 is a photograph of an agarose gel showing the results
of amplification reactions using a 1.6 kb (A), a 2 kb (B) and a 2.6
kb (C) fragment of the NF2 gene. In each panel, lane a is the
amplification using Taq polymerase alone, lane b is the
amplification reaction in the presence of inhibitor HPHH4Sspa3 at a
molar ratio of 1.2:1 inhibitor: polymerase and lane c is the
amplification using Platinum Taq.
[0040] FIG. 8 is a bar graph showing the results of a dNTP
incorporation assay at the indicated temperatures. At each
temperature, the solid black rectangle reports the results obtained
with Taq polymerase alone, the striped rectangle report the results
obtained with inhibitor HPHH4Sspa3 at a molar ration of 2:1
inhibitor:polymerase, the white rectangle report the results
obtained with the same inhibitor at a molar ratio of 7.5:1
inhibitor:polymerase. FIG. 9 is a graph showing the dose dependent
inhibition of Taq polymerase by inhibitor present HPHH4Sspa3
present at the indicated molar ratios.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0041] In the description that follows, a number of terms used in
recombinant DNA technology are utilized extensively. In order to
provide a clearer and consistent understanding of the specification
and claims, including the scope to be given such terms, the
following definitions are provided.
[0042] Primer. As used herein, "primer" refers to a single-stranded
oligonucleotide that is extended by covalent bonding of nucleotide
monomers during amplification or polymerization of a DNA molecule.
Template. The term "template" as used herein refers to
double-stranded or single-stranded nucleic acid molecules which are
to be amplified, synthesized or sequenced. In the case of a
double-stranded molecule, denaturation of its strands to form a
first and second strand is preferably performed before these
molecules may be amplified, synthesized or sequenced, or the double
stranded molecule may be used directly as a template. For single
stranded templates, a primer, complementary to a portion of the
template is hybridized under appropriate conditions and one or more
polymerases may then synthesize a nucleic acid molecule
complementary to all or a portion of said template. Alternatively,
for double stranded templates, one or more promoters (e.g. SP6, T7
or T3 promoters) may be used in combination with one or more
polymerases to make nucleic acid molecules complementary to all or
a portion of the template. The newly synthesized molecules,
according to the invention, may be equal or shorter in length than
the original template.
[0043] Incorporating. The term "incorporating" as used herein means
becoming a part of a DNA and/or RNA molecule or primer.
[0044] Amplification. As used herein "amplification" refers to any
in vitro method for increasing the number of copies of a nucleotide
sequence with the use of a polymerase. Nucleic acid amplification
results in the incorporation of nucleotides into a DNA and/or RNA
molecule or primer thereby forming a new molecule complementary to
a template. The formed nucleic acid molecule and its template can
be used as templates to synthesize additional nucleic acid
molecules. As used herein, one amplification reaction may consist
of many rounds of replication. DNA amplification reactions include,
for example, polymerase chain reactions (PCR). One PCR reaction may
consist of 5 to 100 "cycles" of denaturation and synthesis of a DNA
molecule.
[0045] Nucleotide. As used herein "nucleotide" refers to a
base-sugar-phosphate combination. Nucleotides are monomeric units
of a nucleic acid sequence (DNA and RNA). Nucleotides may also
include mono-, di- and triphosphate forms of such nucleotides. The
term nucleotide includes ribonucleoside triphosphates ATP, UTP,
CTG, GTP and deoxyribonucleoside triphosphates such as dATP, dCTP,
dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such derivatives
include, for example, [aS]dATP, 7-deaza-dGTP and 7-deaza-dATP, and
nucleotide derivatives that confer nuclease resistance on the
nucleic acid molecule containing them. The term nucleotide as used
herein also refers to dideoxyribonucleoside triphosphates (ddNTPs)
and their derivatives. Illustrated examples of
dideoxyribonucleoside triphosphates include, but are not limited
to, ddATP, ddCTP, ddGTP, ddITP, and ddTTP. According to the present
invention, a "nucleotide" may be unlabeled or detectably labeled by
well known techniques. Detectable labels include, for example,
radioactive isotopes, fluorescent labels, chemiluminescent labels,
bioluminescent labels and enzyme labels.
[0046] Blocking Agent. "Blocking agent" refers to a nucleotide (or
derivatives thereof), modified oligonucleotides and/or one or more
other modifications which are incorporated into the nucleic acid
inhibitors of the invention to prevent or inhibit degradation or
digestion of such nucleic acid molecules by nuclease activity. One
or multiple blocking agents may be incorporated in the nucleic acid
inhibitors of the invention internally, at or near the 3' termini
and/or at or near the 5' termini of the nucleic acid inhibitors.
Preferably, such blocking agents are located, for linear inhibitor
nucleic acid molecules, at or near the 3' termini and/or at or near
the 5' termini and/or at the preferred cleavage position of the 5'
to 3' exonuclease of such molecules (Lyamichev, V., Brow, M. A. D.,
and Dahlberg, J. E., (1993) Science, 260, 778-783). Preferably,
such blocking agents prevent or inhibit degredation or digestion of
the inhibitor nucleic acid molecules by exonuclease activity
associated with the polymerase or reverse transcriptase used or
that may be present in the synthesis reaction. For example,
blocking agents for the invention prevent degredation or digestion
of inhibitor nucleic acid molecules by 3' exonuclease activity
and/or 5' exonuclease activity associated with a polymerase (e.g.,
a DNA polymerase). Preferred blocking agents in accordance with the
invention include dideoxynucleotides and their derivatives such as
ddATP, ddCTP, ddGTP, ddITP, and ddTTP. Other blocking agents for
use in accordance with the invention include, but are not limited
to, AZT, phosphamide backbones (e.g., PNAs), 3'-dNTPs (e.g.,
Condycepin) or any nucleotide containing a blocking group,
preferably at its 3'-position. Such blocking agents preferably act
to inhibit or prevent exonuclease activity (e.g., 3'-exonuclease
activity) from altering or digesting the inhibitory nucleic acids
of the invention. In some embodiments, the 5'-terminal of the
oligonucleotides of the present invention may be modified in order
to make them resistant to 5'-to-3' exonuclease activity. One such
modification may be to add an addition nucleotide to the 5'-end of
the oligonucleotide in a linkage (see, Koza. M. et al., Journal of
Organic Chemistry 56:3757). This results in at the 5'-end of the
oligonucleotide which results in the 5'-end having a 3'In another
aspect, such blocking agents preferably inhibit or prevent
polymerase activity of the polymerases from altering or changing
(e.g., incorporating nucleotides) to the inhibitory nucleic acids
of the invention.
[0047] Oligonucleotide. As used herein, "oligonucleotide" refers to
a synthetic or biologically produced molecule comprising a
covalently linked sequence of nucleotides which may be joined by a
phosphodiester bond between the 3' position of the pentose of one
nucleotide and the 5' position of the pentose of the adjacent
nucleotide. Oligonucleotide as used herein is seen to include
natural nucleic acid molecules (i. e., DNA and RNA) as well as
non-natural or derivative molecules such as peptide nucleic acids,
phophothioate containing nucleic acids, phosphonate containing
nucleic acids and the like. In addition, oligonucleotides of the
present invention may contain modified or non-naturally occurring
sugar residues (i. e., arabainose) and/or modified base residues.
Oligonucleotide is seen to encompass derivative molecules such as
nucleic acid molecules comprising various natural nucleotides,
derivative nucleotides, modified nucleotides or combinations
thereof. Thus any oligonucleotide or other molecule useful in the
methods of the invention are contemplated by this definition.
Oligonucleotides of the present invention may also comprise
blocking groups which prevent the interaction of the molecule with
particular proteins, enzymes or substrates.
[0048] Hairpin. As used herein, the term "hairpin" is used to
indicate the structure of an oligonucleotide in which one or more
portions of the oligonucleotide form base pairs with one or more
other portions of the oligonucleotide. When the two portions are
base paired to form a double stranded portion of the
oligonucleotide, the double stranded portion may be referred to as
a stem. Thus, depending on the number of complementary portions
used, a number of stems (preferably 1-10) may be formed.
Additionally, formation of the one or more stems preferably allows
formation of one or more loop structures in the hairpin molecule.
In one aspect, any one or more of the loop structures may be cut or
nicked at one or more sites within the loop or loops but preferably
at least one loop is not so cut or nicked. The sequence of the
oligonucleotide may be selected so as to vary the number of
nucleotides which base pair to form the stem from about 3
nucleotides to about 100 or more nucleotides, from about 3
nucleotides to about 50 nucleotides, from about 3 nucleotides to
about 25 nucleotides, and from about 3 to about 10 nucleotides. In
addition, the sequence of the oligonucleotide may be varied so as
to vary the number of nucleotides which do not form base pairs from
0 nucleotides to about 100 or more nucleotides, from 0 nucleotides
to about 50 nucleotides, from 0 nucleotides to about 25 nucleotides
or from 0 to about 10 nucleotides. The two portions of the
oligonucleotide which base pair may be located anywhere or at any
number of locations in the sequence of the oligonucleotide. In some
embodiments, one base-pairing-portion of the oligonucleotide may
include the 3'-terminal of the oligonucleotide. In some
embodiments, one base-pairing-portion may include the 5'-terminal
of the oligonucleotide. In some embodiments, one
base-pairing-portion of the oligonucleotide may include the
3'-terminal while the other base-pairing-portion may include the
5'-terminal and, when base paired, the stem of the oligonucleotide
is blunt ended. In other embodiments, the location of the base
pairing portions of the oligonucleotide may be selected so as to
form a 3'-overhang, a 5'-overhang and/or may be selected so that
neither the 3'-nor the 5'-most nucleotides are involved in base
pairing.
[0049] Hybridization. The terms "hybridization" and "hybridizing"
refer to base pairing of two complementary single-stranded nucleic
acid molecules (RNA and/or DNA and/or PNA) to give a
double-stranded molecule. As used herein, two nucleic acid
molecules may be hybridized although the base pairing is not
completely complementary. Accordingly, mismatched bases do not
prevent hybridization of two nucleic acid molecules provided that
appropriate conditions, well known in the art, are used. In a
preferred aspect, the double stranded inhibitory molecules are
denatured under certain conditions such that the complementary
single stranded molecules which are hybridized are allowed to
separate. Single stranded molecules formed do not interact or bind
polymerase or interact or bind polymerase with reduced efficiency
compared to the corresponding double-stranded molecule.
[0050] Unit. The term "unit" as used herein refers to the activity
of an enzyme. When referring, for example, to a DNA polymerase, one
unit of activity is the amount of enzyme that will incorporate 10
nanomoles of dNTPs into acid-insoluble material (i.e., DNA or RNA)
in 30 minutes under standard primed DNA synthesis conditions.
[0051] Viruses. As used herein, viruses that require a reverse
transcriptase activity to complete their lifecycle are seen to
include, but are not limited to, any member of the family
retroviridae including human immunodeficiency viruses, bovine
immunodeficiency virus, bovine leuukemia virus, human
T-lymphotrophic viruses, caprine arthritis-encephalitis virus,
equine infectious anemia virus, feline immunodeficiency virus,
feline sarcoma and leukemia viruses, maedi/visna virus of sheep,
mouse mammary tumor virus, simian immunodeficiency virus and other
retroviruses known to those skilled in the art.
[0052] Vector. The term "vector" as used herein refers to a
plasmid, phagemid, cosmid or phage nucleic acid or other nucleic
acid molecule which is able to replicable autonomously in a host
cell. Preferably a vector is characterized by one or a small number
of restriction endonuclease recognition sites at which such nucleic
acid sequences may be cut in a determinable fashion without loss of
an essential biological function of the vector, and into which
nucleic acid molecules may be spliced in order to bring about its
replication and cloning. The cloning vector may further contain one
or more markers suitable for use in the identification of cells
transformed with the cloning vector. Markers, for example, are
antibiotic resistance change genes, including, but not limited to
tetracycline resistance or ampicillin resistance.
[0053] Expression vector. The term "expression vector" as used
herein refers to avector similar to a cloning vector but which is
capable of enhancing the expression of a gene which has been cloned
into it, after transformation into a host. The cloned gene is
usually placed under the control of (i.e., operably linked to)
certain control sequences such as promoter sequences.
[0054] Recombinant host. The term "recombinant host" as used herein
refers to any prokaryotic or eukaryotic microorganism which
contains the desired cloned genes in an expression vector, cloning
vector or any other nucleic acid molecule. The term "recombinant
host" is also meant to include those host cells which have been
genetically engineered to contain the desired gene on a host
chromosome or in the host genome.
[0055] Host. The term "host" as used herein refers to any
prokaryotic or eukaryotic microorganism that is the recipient of a
replicable expression vector, cloning vector or any nucleic acid
molecule including the inhibitory nucleic acid molecules of the
invention. The nucleic acid molecule may contain, but is not
limited to, a structural gene, a promoter and/or an origin of
replication.
[0056] Promoter. The term "promoter" as used herein refers to a DNA
sequence generally described as the 5' region of a gene, located
proximal to start the codon. At the promoter region, transcription
of an adjacent gene(s) is initiated.
[0057] Gene. The term "gene" as used herein refers to a DNA
sequence that contains information necessary for expression of a
polypeptide or protein. It includes the promoter and the structural
gene as well as other sequences involved in expression of the
protein.
[0058] Structural gene. The term "structural gene" as used herein
refers to a DNA sequence that is transcribed into messenger RNA
that is then translated into a sequence of amino acids
characteristic of a specific polypeptide.
[0059] Operably linked. The term "operably linked" as used herein
means that the promoter is positioned to control the initiation of
expression of the polypeptide encoded by the structural gene.
[0060] Expression. The term "expression" has used herein refers to
the process by which a gene produces a polypeptide. It includes
transcription of the gene into messenger RNA (mRNA) and the
translation of such mRNA into polypeptide(s).
[0061] Substantially Pure. As used herein "substantially pure"
means that the desired purified molecule such as a protein or
nucleic acid molecule (including the inhibitory nucleic acid
molecule of the invention) is essentially free from contaminants
which are typically associated with the desired molecule.
Contaminating components may include, but are not limited to,
compounds or molecules which may interfere with the inhibitory or
synthesis reactions of the invention, and/or that degrade or digest
the inhibitory nucleic acid molecules of the invention (such as
nucleases including exonucleases and endonucleases) or that degrade
or digest the synthesized or amplified nucleic acid molecules
produced by the methods of the invention.
[0062] Thermostable. As used herein "thermostable" refers to a DNA
polymerase which is more resistant to inactivation by heat. DNA
polymerases synthesize the formation of a DNA molecule
complementary to a single-stranded DNA template by extending a
primer in the 5'-3'-direction. This activity for mesophilic DNA
polymerases may be inactivated by heat treatment. For example, T5
DNA polymerase activity is totally inactivated by exposing the
enzyme to a temperature of 90.degree. C. for 30 seconds. As used
herein, a thermostable DNA polymerase activity is more resistant to
heat inactivation than a mesophilic DNA polymerase. However, a
thermostable DNA polymerase does not mean to refer to an enzyme
which is totally resistant to heat inactivation and thus heat
treatment may reduce the DNA polymerase activity to some extent. A
thermostable DNA polymerase typically will also have a higher
optimum temperature than mesophilic DNA polymerases.
[0063] 3'-to-5' Exonuclease Activity. "3'-to-5' exonuclease
activity" is an enzymatic activity well known to the art. This
activity is often associated with DNA polymerases and is thought to
be involved in a DNA replication "editing" or correction
mechanism.
[0064] A "DNA polymerase substantially reduced in 3'-to-5'
exonuclease activity" is defined herein as either (1) a mutated DNA
polymerase that has about or less than 10%, or preferably about or
less than 1%, of the 3'-to-5' exonuclease activity of the
corresponding unmutated, wild-type enzyme, or (2) a DNA polymerase
having a 3'-to-5' exonuclease specific activity which is less than
about 1 unit/mg protein, or preferably about or less than 0.1
units/mg protein. A unit of activity of 3'-to-5' exonuclease is
defined as the amount of activity that solubilizes 10 nmoles of
substrate ends in 60 min. at 37.degree. C., assayed as described in
the "BRL 1989 Catalogue & Reference Guide", page 5, with HhaI
fragments of lambda DNA 3'-end labeled with [.sup.3H]dTTP by
terminal deoxynucleotidyl transferase (TdT). Protein is measured by
the method of Brandford, Anal. Biochem. 72:248 (1976). As a means
of comparison, natural, wild-type T5-DNA polymerase (DNAP) or
T5-DNAP encoded by pTTQ19-T5-2 has a specific activity of about 10
units/mg protein while the DNA polymerase encoded by
pTTQ19-T5-2(Exo-) (U.S. 5,270,179) has a specific activity of about
0.0001 units/mg protein, or 0.001% of the specific activity of the
unmodified enzyme, a 10.sup.5-fold reduction. Polymerases used in
accordance with the invention may lack or may be substantially
reduced in 3' exonuclease activity.
[0065] 5'-to-3' Exonuclease Activity. "5'-to-3' exonuclease
activity" is also enzymatic activity well known in the art. This
activity is often associated with DNA polymerases, such as E. coil
Poll and Tag DNA polymerase.
[0066] A "polymerase substantially reduced in 5'-to-3' exonuclease
activity" is defined herein as either (1) mutated or modified
polymerase that has about or less than 10%, or preferably about or
less than 1%, of the 5'-to-3' exonuclease activity of the
corresponding unmutated, wild-type enzyme, or (2) a polymerase
having 5'-to-3' exonuclease specific activity which is less than
about I unit/mg protein, or preferably about or less than 0.1
units/mg protein.
[0067] Both of the 3'-to-5' and 5'-to-3' exonuclease activities can
be observed on sequencing gels. Active 5'-to-3' exonuclease
activity will produce different size products in a sequencing gel
by removing mono-nucleotides and longer products from the 5'-end of
the growing primers. 3 `-to-5` exonuclease activity can be measured
by following the degradation of radiolabeled primers in a
sequencing gel. Thus, the relative amounts of these activities
(e.g., by comparing wild-type and mutant or modified polymerases)
can be determined with no more than routine experimentation.
[0068] Inhibitory nucleic acids. The nucleic acids of the present
invention include single stranded and double stranded nucleic acids
(although other strand multiples such as triple stranded (e.g.,
triple helix) molecules may be used) including nucleic acids
comprised of DNA, RNA, PNA, LNA or other derivative nucleic acid
molecules, or a combination thereof. The inhibitory nucleic acid
comprises a sequence which is capable of forming a site at one set
of conditions (preferably at ambient temperature) which competes
with the template/primer substrate used in synthesis or
amplification for binding an enzyme with polymerase activity and
competes less efficiently under a second set of conditions
(preferably elevated temperatures) for nucleic acid synthesis or
amplification. Preferably, the sequence of the inhibitory nucleic
acids is not complementary to the primer used in the synthesis,
amplification or sequencing reaction to be inhibited. As will be
recognized, other nucleic acids (natural, unnatural, modified etc.)
may be selected and used in accordance with the invention. Such
selection may be accomplished by binding studies and/or nucleic
acid synthesis inhibition assays. Design of nucleic acid sequences
for hairpin formation may be accomplished by those skilled in the
art. See, e.g., Antao, V.P. and Tinoco, I., Jr., 1992, Nucl. Acids
Res. 20: 819-824. Preferably, the nucleic acid inhibitor could be
made nuclease resistant (3'-to-5' exonuclease and 5'-to-3'
exonuclease) and/or inert to polymerization. Methods to render the
nucleic acid inert to exonucleases and polymerization are known in
the art and include, for example, using derivative nucleic acid
molecules which may include derivative nucleotides (for example,
using phosphamide and/or phosphorothioate backbone rather than
phosphate) and/or addition of one or more blocking agents to the
inhibitory nucleic acid molecules of the invention. The inhibitory
nucleic acid preferably form one or more hairpin-loop structures
with a double stranded stem. The double stranded stem can have
blunt ends and/or a single stranded overhang (for example, at the
5' and/or 3' terminus) designed so as to mimic the typical
primer/template substrate of a polymerase.
[0069] Inhibitory nucleic acids of the present invention are
preferably used in the present compositions and methods at a final
concentration in a synthesis, sequencing or amplification reaction
sufficient to prevent or inhibit such synthesis, sequencing or
amplification in the presence of a polymerase or reverse
transcriptase enzyme. The ratio of inhibitory nucleic acids of the
invention to polymerase or reverse transcriptase may vary depending
on the polymerase or reverse transcriptase used. The molar ratio of
inhibitory nucleic acids to polymerase/reverse transcriptase enzyme
for a synthesis, sequencing or amplification reaction may range
from about 0.001-100:1; 0.01-1000:1; 0.1-10,000:1; 1-100,000:1;
-1500,000:1; or 1-1,000,000:1. Of course, other suitable ratios of
such inhibitory nucleic acids to polymerase/reverse transcriptase
suitable for use in the invention will be apparent to one of
ordinary skill in the art or determined with no more than routine
experimentation.
[0070] Inhibitory nucleic acid molecules of the invention may be
synthesized by standard chemical oligonucleotide synthesis
techniques (for example, phosphoramidite and others know in the
art, see U.S. Pat. No. 5,529,756). Alternatively, recombinant DNA
techniques may be used to produce the inhibitory nucleic acids of
the invention by cloning the nucleic acid molecule of interest into
a vector, introducing the vector into the host cell, growing the
host cell and isolating the inhibitory nucleic acid molecule of
interest from the host cell. Inhibitory nucleic acid molecules of
the invention may also be obtained from commercial sources of
custom oligonucleotides such as Life Technologies, Inc. or may be
made enzymaticly, for example, by using polymerases in nucleic acid
synthesis or amplification reactions. In some embodiments, the
oligonucleotides of the present invention may be used for
therapeutic purposes. In a preferred embodiment, the
oligonucleotides of the present invention may be used to treat a
subject (for example, a human or an animal) infected with a virus
that requires reverse transcriptase activity to replicate. For
therapeutic treatment, oligonucleotides may be administered as a
pharmaceutically acceptable composition in which one or more
oligonucleotides of the present invention may be mixed with one or
more carriers, thickeners, diluents, buffers, preservatives,
surface active agents, excipients and the like. Pharmaceutical
compositions may also include one or more additional active
ingredients such as antimicrobial agents, antiinflammatory agents,
anesthetics, and the like in addition to oligonucleotides.
[0071] The pharmaceutical compositions of the present invention may
be administered by any route commonly used to administer
pharmaceutical compositions. For example, administration may be
done topically (including opthalmically, vaginally, rectally,
intranasally), orally, by inhalation, or parenterally, for example
by intravenous drip or subcutaneous, intraperitoneal or
intramuscular injection.
[0072] Pharmaceutical compositions formulated for topical
administration may include ointments, lotions, creams, gels, drops,
suppositories, sprays, liquids and powders. Any conventional
pharmaceutical excipient, such as carriers, aqueous, powder or oily
bases, thickeners and the like may be used.
[0073] Pharmaceutical compositions formulated for oral
administration may be in the form of one or more powders, granules,
suspensions or solutions in water or non-aqueous media, capsules,
sachets, or tablets. Pharmaceutical compositions formulated for
oral administration may additionally comprise thickeners,
flavorings, diluents, emulsifiers, dispersing aids, binders or the
like.
[0074] Pharmaceutical compositions formulated for parenteral
administration may include sterile aqueous solutions which may also
contain buffers, diluents and other suitable additives.
[0075] The pharmaceutical compositions of the present invention may
be administered in a therapeutically effective dose. A
therapeutically effective dose is one which inhibits the
replication of the virus within the host. It is not necessary that
replication of the virus be entirely eliminated in order for a
treatment to be therapeutically effective. Reduction of the rate of
replication of the virus may be a therapeutic effect. One or more
doses of the pharmaceutical compositions of the present invention
may be administered one or more times daily for a period of
treatment which may be a single administration or may be multiple
administrations per day for a period of several days to several
months or until a cure is effected or a diminution of disease state
is achieved. Persons of ordinary skill can easily determine optimum
dosages, dosing routes and the frequency at which doses should be
administered.
[0076] Polymerases. Enzymes with polymerase activity to which the
inhibitory nucleic acids of the present invention can bind or
interact include any enzyme used in nucleic acid synthesis,
amplification or sequencing reactions. Such polymerases include,
but are not limited to, polymerases (DNA and RNA polymerases), and
reverse transcriptases. DNA polymerases include, but are not
limited to, Thermus thermophilus (Tth) DNA polymerase, Thermus
aquaticus (Taq) DNA polymerase, Thermotoga neopolitana (Tne) DNA
polymerase, Thermotoga maritima (Tma) DNA polymerase, Thermococcus
litoralis (Tli or VENT-198 ) DNA polymerase, Pyrococcus furiosus
(Pfu) DNA polyermase, DEEPVENT.TM. DNA polymerase, Pyrococcus
woosii (Pwo) DNA polymerase, Pyrococcus sp KOD2 (KOD) DNA
polymerase, Bacillus sterothermophilus (Bst) DNA polymerase,
Bacillus caldophilus (Bca) DNA polymerase, Sulfolobus
acidocaldarius (Sac) DNA polyermase, Thermoplasma acidophilum (Tac)
DNA polymerase, Thermus flavus (Tfl/Tub) DNA polymerase, Thermus
ruber (Tru) DNA polymerase, Thermus brockianus (DYNAZYME.TM.) DNA
polymerase, Methanobacterium thermoautotrophicum (Mth) DNA
polymerase, mycobacterium DNA polymerase (Mtb, Mlep), E. coli pol I
DNA polymerase, T5 DNA polymerase, T7 DNA polymerase, and generally
pol I type DNA polymerases and mutants, variants and derivatives
thereof. RNA polymerases such as T3, T5 and SP 6 and mutants,
variants and derivatives thereof may also be used in accordance
with the invention.
[0077] The nucleic acid polymerases used in the present invention
may be mesophilic or thermophilic, and are preferably thermophilic.
Preferred mesophilic DNA polymerases include pol I family of DNA
polymerases (and their respective Klenow fragments) any of which
may be isolated from organism such as E. coli, H. influenzae, D.
radiodurans, H. pylori, C. aurantiacus, R. Prowazekii, T. pallidum,
Synechocysis sp., B. subtilis, L. lactis, S. pneumoniae, M.
tuberculosis, M. leprae, M. smegmatis, Bacteriophage L5, phi-C31,
T7, T3, T5, SP01, SP02, mitochondrial from S. cerevisiae MIP-1, and
eukaryotic C. elegans, and D. melanogaster (Astatke, M. et al.,
1998. J Mol. Biol. 278, 147-165), pol III type DNA polymerase
isolated from any sources, and mutants, derivatives or variants
thereof, and the like. Preferred thermostable DNA polymerases that
may be used in the methods and compositions of the invention
include Taq, Tne, Tma, Pfu, KOD, Tfl, Tth Stoffel fragment,
VENT.TM. and DEEPVENT.TM. DNA polymerases, and mutants, variants
and derivatives thereof (U.S. Pat. No. 5,436,149; U.S. Pat.
4,889,818; U.S. Pat. 4,965,188; U.S. Pat. 5,079,352; U.S. Pat.
5,614,365; U.S. Pat. No. 5,374,553; U.S. Pat. 5,270,179; U.S. Pat.
5,047,342; U.S. Pat. No. 5,512,462; WO 92/06188; WO 92/06200; WO
96/10640; WO 97/09451; Barnes, W. M. Gene 112:29-35 (1992); Lawyer,
F. C., et al, PCR Meth. Appl. 2:275-287 (1993); Flaman, J.-M, et
al., Nucl. Acids Res. 22(15):3259-3260 (1994)).
[0078] Reverse transcriptases for use in this invention include any
enzyme having reverse transcriptase activity. Such enzymes include,
but are not limited to, retroviral reverse transcriptase,
retrotransposon reverse transcriptase, hepatitis B reverse
transcriptase, cauliflower mosaic virus reverse transcriptase,
bacterial reverse transcriptase, Tth DNA polymerase, Taq DNA
polymerase (Saiki, R. K., et al, Science 239:487-491 (1988); U.S.
Pat. Nos. 4,889,818 and 4,965,188), Tne DNA polymerase (WO 96/10640
and WO 97/09451), Tma DNA polymerase (U.S. Pat. No. 5,374,553) and
mutants, variants or derivatives thereof (see, e.g., WO 97/09451
and WO 98/47912). Preferred enzymes for use in the invention
include those that have reduced, substantially reduced or
eliminated RNase H activity. By an enzyme "substantially reduced in
RNase H activity" is meant that the enzyme has less than about 20%,
more preferably less than about 15%, 10% or 5%, and most preferably
less than about 2%, of the RNase H activity of the corresponding
wildtype or RNase H+ enzyme such as wildtype Moloney Murine
Leukemia Virus (M-MLV), Avian Myeloblastosis Virus (AMV) or Rous
Sarcoma Virus (RSV) reverse transcriptases. The RNase H activity of
any enzyme may be determined by a variety of assays, such as those
described, for example, in U.S. Pat. No. 5,244,797, in Kotewicz, M.
L., et al, Nucl. Acids Res. 16:265 (1988) and in Gerard, G. F., et
al., FOCUS 14(5):91 (1992), the disclosures of all of which are
fully incorporated herein by reference. Particularly preferred
polypeptides for use in the invention include, but are not limited
to, M-MLV reverse transcriptase, RSV if reverse transcriptase, AMV
H.sup.- reverse transcriptase, RAV (rous-associated virus) H.sup.-
reverse transcriptase, MAV (myeloblastosis-associated virus) If
reverse transcriptase and HIV H.sup.- reverse transcriptase. (See
U.S. Pat. No. 5,244,797 and WO 98/47912). It will be understood by
one of ordinary skill, however, that any enzyme capable of
producing a DNA molecule from a ribonucleic acid molecule (i.e.,
having reverse transcriptase activity) may be equivalently used in
the compositions, methods and kits of the invention.
[0079] The enzymes having polymerase activity for use in the
invention may be obtained commercially, for example from Life
Technologies, Inc. (Rockville, Md.), Perkin-Elmer (Branchburg,
N.J.), New England BioLabs (Beverly, Mass.) or Boehringer Mannheim
Biochemicals (Indianapolis, Ind.). Enzymes having reverse
transcriptase activity for use in the invention may be obtained
commercially, for example, from Life Technologies, Inc. (Rockville,
Md.), Pharmacia (Piscataway, N.J.), Sigma (Saint Louis, Mo.) or
Boehringer Mannheim Biochemicals (Indianapolis, Ind.).
Alternatively, polymerases or reverse transcriptases having
polymerase activity may be isolated from their natural viral or
bacterial sources according to standard procedures for isolating
and purifying natural proteins that are well-known to one of
ordinary skill in the art (see, e.g., Houts, G. E., et al., J.
Virol. 29:517 (1979)). In addition, such polymerases/reverse
transcriptases may be prepared by recombinant DNA techniques that
are familiar to one of ordinary skill in the art (see, e.g.,
Kotewicz, M. L., et al., Nucl. Acids Res. 16:265 (1988); U.S. Pat.
No. 5,244,797; WO 98/47912; Soltis, D. A., and Skalka, A. M., Proc.
Natl. Acad. Sci USA 85:3372-3376 (1988)). Examples of enzymes
having polymerase activity and reverse transcriptase activity may
include any of those described in the present application.
Methods of Nucleic Acid Synthesis, Amplification and Sequencing
[0080] The inhibitory nucleic acids and compositions of the
invention may be used in methods for the synthesis of nucleic
acids. In particular, it has been discovered that the present
inhibitory nucleic acids and compositions reduce nonspecific
nucleic acid synthesis, particularly in amplification reactions
such as the polymerase chain reaction (PCR). The present inhibitory
nucleic acids and compositions may therefore be used in any method
requiring the synthesis of nucleic acid molecules, such as DNA
(including cDNA) and RNA molecules. Methods in which the inhibitory
nucleic acids or compositions of the invention may advantageously
be used include, but are not limited to, nucleic acid synthesis
methods and nucleic acid amplification methods (including
"hot-start" synthesis or amplification) where the reaction is set
up at a temperature where the inhibitory nucleic acid can
competitively inhibit DNA synthesis or amplification and the
synthesis or amplification reaction is initiated by increasing the
temperature to reduce the competitive inhibition by the inhibitor
of the polymerases thus allowing nucleic acid synthesis or
amplification to take place.
[0081] Nucleic acid synthesis methods according to this aspect of
the invention may comprise one or more steps. For example, the
invention provides a method for synthesizing anucleic acid molecule
comprising (a) mixing a nucleic acid template with one or more
primers and one or more inhibitory nucleic acids of the present
invention (which may be the same or different) and one or more
enzymes having polymerase or reverse transcriptase activity to form
a mixture; (b) incubating the mixture under conditions sufficient
to inhibit or prevent nucleic acid synthesis; and (c) incubating
the mixture under conditions sufficient to make a first nucleic
acid molecule complementary to all or a portion of the template.
According to this aspect of the invention, the nucleic acid
template may be a DNA molecule such as a cDNA molecule or library,
or an RNA molecule such as a mRNA molecule or population of
molecules. Conditions sufficient to allow synthesis such as pH,
temperature, ironic strength, and incubation times may be optimized
according to routine methods known to those skilled in the art.
[0082] In accordance with the invention, the input or template
nucleic acid molecules or libraries may be prepared from
populations of nucleic acid molecules obtained from natural
sources, such as a variety of cells, tissues, organs or organisms.
Cells that may be used as sources of nucleic acid molecules may be
prokaryotic (bacterial cells, including those of species of the
genera Escherichia, Bacillus, Serratia, Salmonella, Staphylococcus,
Streptococcus, Clostridium, Chlamydia, Neisseria, Treponema,
Mycoplasma, Borrelia, Legionella, Pseudomonas, Mycobacterium,
Helicobacter, Erwinia, Agrobacterium, Rhizobium, and Streptomyces)
or eukaryotic (including fungi (especially yeasts), plants,
protozoans and other parasites, and animals including insects
(particularly Drosophilia spp. cells), nematodes (particularly
Caenorhabditis elegans cells), and mammals (particulary human
cells)). Once the starting cells, tissues, organs or other samples
are obtained, nucleic acid molecules (such as DNA, RNA (e.g., mRNA
or poly A+ RNA) molecules) may be isolated, or cDNA molecules or
libraries prepared therefrom, by methods that are well-known in the
art (See, e.g. Maniatis, T., et al., Cell 15:687-701 (1978);
Okayama, H., and Berg, P., Mol. Cell. Biol. 2:161-170 (1982);
Gubler, U., and Hoffman, B. J., Gene 25:263-269 (1983)).
[0083] In the practice of a preferred aspect of the invention, a
first nucleic acid molecule may be synthesized by mixing an nucleic
acid template obtained as described above, which is preferably a
DNA molecule or an RNA molecule such as an mRNA molecule or a
polyA+RNA molecule, with one or more of the above-described enzymes
with polymerase activity to which has been added the inhibitory
nucleic acids or compositions of the invention to form a mixture.
Synthesis of a first nucleic acid molecule complementary to all or
a portion of the nucleic acid template is preferably accomplished
after raising the temperature of the reaction and thus reducing the
competitive inhibition of the inhibitory nucleic acid of the
present invention thereby favoring the reverse transcription (in
the case of an RNA template) and/or polymerization of the input or
template nucleic acid molecule. Such synthesis is preferably
accomplished in the presence of nucleotides (e.g.,
deoxyribonucleoside triphosphates (dNTPs), dideoxyribonucleoside
triphosphate (ddNTPs) or derivatives thereof).
[0084] Of course, other techniques of nucleic acid synthesis in
which the inhibitory nucleic acids, compositions and methods of the
invention may be advantageously used will be readily apparent to
one of ordinary skill in the art.
[0085] In other aspects of the invention, the inhibitory nucleic
acids and compositions of the invention may be used in methods for
amplifying or sequencing nucleic acid molecules. Nucleic acid
amplification methods according to this aspect of the invention may
additionally comprise use of one or more polypeptides having
reverse transcriptase activity, in methods generally known in the
art as one-step (e.g., one-step RT-PCR) or two-step (e.g., two-step
RT-PCR) reverse transcriptase-amplification reactions. For
amplification of long nucleic acid molecules (e.g., greater than
about 3-5 Kb in length), a combination of DNA polymerases may be
used, as described in WO 98/06736 and WO 95/16028.
[0086] Amplification methods according to this aspect of the
invention may comprise one or more steps. For example, the
invention provides a method for amplifying a nucleic acid molecule
comprising (a) mixing one or more enzymes with polymerase activity
with the inhibitory nucleic acids or compositions of the invention
and one or more nucleic acid templates; (b) incubating the mixture
under conditions sufficient to inhibit or prevent nucleic acid
amplification; and (c) incubating the mixture under conditions
sufficient to allow the enzyme with polymerase activity to amplify
one or more nucleic acid molecules complementary to all or a
portion of the templates. The invention also provides nucleic acid
molecules amplified by such methods.
[0087] General methods for the amplification and analysis of
nucleic acid molecules or fragments are well-known to one of
ordinary skill in the art (see e.g., U.S. Pat. Nos. 4,683,195;
4,683,202; and 4,800,159; Innis, M. A., et al., eds., PCR
Protocols: A Guide to Methods and Applications, San Diego, Calif.:
Academic Press, Inc. (1990); Griffin, H. G., and Griffin, A. M.,
eds., PCR Technology: Current Innovations, Boca Raton, Florida: CRC
Press (1994)). For example, amplification methods which may be used
in accordance with the present invention include PCR (U.S. Pat.
Nos. 4,683,195 and 4,683,202), Strand Displacement Amplification
(SDA; U.S. Pat. No. 5,455,166; EP 0 684 315), Nucleic Acid
Sequenced-Based Amplification (NASBA; U.S. Pat. No. 5,409,818; EP 0
329 822).
[0088] Typically, these amplification methods comprise: (a) mixing
one or more enzymes with polymerase activity with one or more
inhibitory nucleic acids of the present invention to form a complex
(protein-nucleic acid); (b) mixing the nucleic acid sample with the
complex of (a) in the presence of one or more primer sequences; and
(c) amplifying the nucleic acid sample to generate a collection of
amplified nucleic acid fragments, preferably by PCR or equivalent
automated amplification technique. Following amplification or
synthesis by the methods of the present invention, the amplified or
synthesized nucleic acid fragments may be isolated for further use
or characterization. This step is usually accomplished by
separation of the amplified or synthesized nucleic acid fragments
by size or by any physical or biochemical means including gel
electrophoresis, capillary electrophoresis, chromatography
(including sizing, affinity and immunochromatography), density
gradient centrifugation and immunoadsorption. Separation of nucleic
acid fragments by gel electrophoresis is particularly preferred, as
it provides a rapid and highly reproducible means of sensitive
separation of a multitude of nucleic acid fragments, and permits
direct, simultaneous comparison of the fragments in several samples
of nucleic acids. One can extend this approach, in another
preferred embodiment, to isolate and characterize these fragments
or any nucleic acid fragment amplified or synthesized by the
methods of the invention. Thus, the invention is also directed to
isolated nucleic acid molecules produced by the amplification or
synthesis methods of the invention.
[0089] In this embodiment, one or more of the amplified or
synthesized nucleic acid fragments are removed from the gel which
was used for identification (see above), according to standard
techniques such as electroelution or physical excision. The
isolated unique nucleic acid fragments may then be inserted into
standard vectors, including expression vectors, suitable for
transfection or transformation of a variety of prokaryotic
(bacterial) or eukaryotic (yeast, plant or animal including human
and other mammalian) cells. Alternatively, nucleic acid molecules
produced by the methods of the invention may be further
characterized, for example by sequencing (e.g., determining the
nucleotide sequence of the nucleic acid fragments), by methods
described below and others that are standard in the art (see, e.g.,
U.S. Pat. Nos. 4,962,022 and 5,498,523, which are directed to
methods of DNA sequencing).
[0090] Nucleic acid sequencing methods according to the invention
may comprise one or more steps. For example, the invention provides
a method for sequencing a nucleic acid molecule comprising (a)
mixing an enzyme with polymerase activity with one or more
inhibitory nucleic acids of the present invention, a nucleic acid
molecule to be sequenced, one or more primers, one or more
nucleotides, and one or more terminating agents (such as a
dideoxynucleotide) to form a mixture; (b) incubating the mixture
under conditions sufficient to inhibit or prevent nucleic acid
sequencing or synthesis; (c) incubating the mixture under
conditions sufficient to synthesize a population of molecules
complementary to all or a portion of the molecule to be sequenced;
and (d) separating the population to determine the nucleotide
sequence of all or a portion of the molecule to be sequenced.
[0091] Nucleic acid sequencing techniques which may employ the
present inhibitory molecules or compositions include dideoxy
sequencing methods such as those disclosed in U.S. Pat. Nos.
4,962,022 and 5,498,523.
Vectors and Host Cells
[0092] The present invention also relates to vectors which comprise
an inhibitory nucleic acid molecule of the present invention.
Further, the invention relates to host cells which contain the
inhibitory nucleic acids of the invention and preferably to host
cells comprising recombinant vectors containing such nucleic acids,
and to methods for the production of the nucleic acids of the
invention using these vectors and host cells. Nucleic acid
synthesis and amplification products produced by the methods of the
invention may also be cloned into vectors and host cells in
accordance with the invention to facilitate production of such
nucleic acid molecules or proteins encoded by such nucleic acid
molecules.
[0093] The vectors will preferably include at least one selectable
marker. Such markers include, but are not limited to, antibiotic
resistance genes such as tetracycline or ampicillin resistance
genes for culturing in E. coli and other bacteria.
[0094] Representative examples of appropriate host cells include,
but are not limited to, bacterial cells such as E. coli,
Streptomyces spp., Erwinia spp., Klebsiella spp and Salmonella
typhimurium. Preferred as a host cell is E. coli, and particularly
preferred are E. coli strains DH10B and Stb12, which are available
commercially (Life Technologies, Inc., Rockville, Md.).
Nucleic Acid Production
[0095] As noted above, the methods of the present invention are
suitable for production of any nucleic acid or any protein encoded
by such nucleic acid molecule, via insertion of the above-described
nucleic acid molecules or vectors into a host cell and isolation of
the nucleic acid molecule from the host cell or isolation of the
protein from the host cell expressing the nucleic acid molecule.
Introduction of the nucleic acid molecules or vectors into a hot
cell to produce a transformed host cell can be effected by calcium
phosphate transfection, calcium chloride transformation,
DEAE-dextran mediated transfection, cationic lipid-mediated
transfection, electroporation, transduction, infection or other
methods. Such methods are described in many standard laboratory
manuals, such as Davis, et al., Basic Methods in Molecular Biology
(1986). Preferably, chemically competent or electrocompetent cells
are used for such transformation reactions. Once transformed host
cells have been obtained, the cells may be cultivated under any
physiologically compatible conditions of pH and temperature, in any
suitable nutrient medium containing assimilable sources of carbon,
nitrogen and essential minerals that support host cell growth. For
example, certain expression vectors comprise regulatory regions
which require cell growth at certain temperatures, or addition of
certain chemicals or inducing agents to the cell growth.
Appropriate culture media and conditions for the above-described
host cells and vectors are well-known in the art. Following its
production in the host cells, the nucleic acid or protein of
interest may be isolated by several techniques. To liberate the
nucleic acid or protein of interest from the host cells, the cells
are preferably lysed or ruptured. This lysis may be accomplished by
contacting the cells with a hypotonic solution, by treatment with a
cell wall-disrupting enzyme such as lysozyme, by sonication, by
treatment with high pressure, or by a combination of the above
methods. Other methods of bacterial cell disruption and lysis that
are known to one of ordinary skill may also be used.
[0096] Following disruption, the nucleic acid or proteins may be
separated from the cellular debris by any technique suitable for
separation of particles in complex mixtures. The nucleic acids or
proteins may then be purified by well known isolation techniques.
Suitable techniques for purification include, but are not limited
to, ammonium sulfate or ethanol precipitation, acid extraction,
electrophoresis, immunoadsorption, CsCl centrifugation, anion or
cation exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
immunoaffinity chromatography, size exclusion chromatography,
liquid chromatography (LC), high performance LC (HPLC), fast
performance LC (FPLC), hybroxylapatite chromatography and lectin
chromatography.
Kits
[0097] The present invention also provides kits for use in the
synthesis, amplification or sequencing of nucleic acid molecules.
Kits according to this aspect of the invention may comprise one or
more containers, such as vials, tubes, ampules, bottles and the
like, which may comprise one or more of the inhibitory nucleic
acids and/or compositions of the invention.
[0098] The kits of the invention may comprise one or more of the
following components: (i) one or more nucleic acids or compositions
of the invention; (ii) one or more polymerases and/or reverse
transcriptases, (iii) one or more suitable buffers or buffering
salts; (iv) one or more nucleotides; and (v) one or more
primers.
[0099] It will be readily apparent to one of ordinary skill in the
relevant arts that other suitable modifications and adaptations to
the methods and applications described herein are obvious and may
be made without departing from the scope of the invention or any
embodiment thereof. Having now described the present invention in
detail, the same will be more clearly understood by reference to
the following examples, which are included herewith for purposes of
illustration only and are not intended to be limiting of the
invention.
EXAMPLE I
Nucleic Acid Inhibitors
[0100] Nucleic acid inhibitors were synthesized by Life
Technologies, Inc. and were HPLC or PAGE purified.
TABLE-US-00001 Nucleic Acid Inhibitor A (34-mer) (SEQ ID NO: 1)
.sup.5'CCCAATATGGACCGGTCGAAAGACCGGTCCATAT.sup.3' Nucleic Acid
Inhibitor B (55-mer) (SEQ ID NO: 2)
.sup.5'CCATGCAGGTAGCCGATGAACTGGTCGAAAGACCAGTTCATCGGC
TACCTGCATG.sup.3'
At ambient temperature the above sequences form a hairpin-like
structure (Antao an dTinoco, 1992, supra), see structures
below.
[0101] In some embodiments, the 3'-terminus of Inhibitor A may be
capped at the 3'terminus with a dideoxythymine triphosphate using a
Klenow fragment mutatn (F762Y) of DNA polymerase I (Escherichia
coli) or T7 DNA polymerase (Tabor, S. and Richardson, C. C., 1995,
Proc. Natl. Acad. Sci. USA 92, 6339-6343). The 3'-OH terminus of
the oligonucleotide was extended with ddTTP by the polymerase at 20
.mu.M ddTTP in the presence of 2 mM Mg2.sup.+ in 50 mM Tris pH 7.5
buffer, at 37.degree. C. for 30 min. Following extension, the
sample was placed in a 100.degree. C. water bath for 3 min to
denature the protein. Following heating the oligonucleotide sample
was cooled slowly to ambient temperature (2-3 hrs) to allow
formation of the hairpin structure.
[0102] Nucleic Acid Inhibitor A as Hairpin Structure:
TABLE-US-00002 (SEQ ID NO: 1) A A G A C C G G T C C A T A T A C T G
G C C A G G T A T A A C C C.sup.5' G
[0103] Nucleic Acid Inhibitor B as Hairpin Structure
TABLE-US-00003 (SEQ ID NO: 2) A A G A C C A G T T C A T C G G C T A
C C T G A C T G G T C A A G T A G C C G A T G G A C G C A T G G T A
C C.sup.5'
In some embodiments, the nucleic acid inhibitor B may be capped at
the 3' terminus by ddGTP as described above.
[0104] This invention was tested using Tne DNA polymerase--a
thermostable DNA polymerase that is significantly efficient at low
temperature in incorporating deoxynucleotides into the growing
strand, about 50-fold more efficient than Taq DNA polymerase at
37.degree. C. The Tne used was wild type except that it was
rendered substantially reduced in 5' to 3' exonuclease activity by
virtue of D137A mutation (See WO 98/09451).
EXAMPLE 2
Inhibition of Polymerase with Inhibitor
[0105] The time course of the activity of Tne DNA polymerase was
qualitatively determined using a 34/60-mer primer/template
substrate at 3 different temperatures. FIG. 1 represents results
from these experiments. For each temperature, polymerase activity
was measured in the absence (Panel A) and presence (Panel B) of
inhibitor A. Aliquots of the reaction mixture were taken at various
time points and separated on an agarose gel. The five lanes, of
each panel, from left ro right at 15 sec, 30 sec, 1 min, 2 min and
5 min, time points that have elapsed before the reactions were
quenched. P and C denote the primer position and control lane,
respectively.
[0106] As can be seen in FIG. 1, the potency of the inhibition of
the polymerase reaction catalyzed by Tne is significantly reduced
as the temperature is increased.
EXAMPLE 3
Amplification of a Target DNA Sequence from Plasmid DNA Source
[0107] A 2.7 Kb target DNA sequence delivered from pUC19 plasmid
was amplified using 5 different dilutions of the template. The
target was amplified by Tne DNA polymerases. Two different
concentration of Tne polymerase (85 nM (e.g., 1 unit) and 42.5 nM
(i.e., 0.5 units) and the Tne complexed to the inhibitor nucleic
acid (using a 150-fold excess inhibitor B over polymerase) were
used at each amplification condition. The results are shown in FIG.
2. The concentration of the target DNA in lanes 1, 2, 3, 4 and 5
denote 100 pg, 20 pg 2 pg, 0.2 pg and 0.02 pg, respectively.
[0108] Results indicate that the sensitivity of Tne was greatly
improved by the addition of the inhibitor, and relative purity of
the target molecule was immensely enhanced.
EXAMPLE 4
[0109] Amplification of a Target DNA Sequence from Genomic DNA
Source
[0110] A 1 Kb, 3 Kb and 5 Kb target DNA sequences were amplified by
Tne (85 nM (e.g., 1 unit) and Taq (1 unit) DNA polymerases as
represented in panels A, B and C of FIG. 3, respectively. The four
lanes of each panel represented as a, b, c and d are Tne (+125-fold
excess inhibitor A (ddT capped)), Tne (+50-fold excess inhibitor A
(ddT capped)), Tne (no inhibitor) and Taq (no inhibitor),
respectively.
[0111] Results indicate that the sensitivity of Tne was greatly
improved by the addition of the inhibitor and relative purity of
the target molecule was immensely improved for each target
condition.
EXAMPLE 5
Amplification of a 5 and 15 Kb Target DNA Sequence by Tne DNA
Polymerase
[0112] The five panels A, B, C, D and E of FIG. 4 represent
reaction conditions: control Tne (no inhibitor), Tne (+50-fold
excess inhibitor B), Tne (+150-fold excess inhibitor B), Tne
(+300-fold excess inhibitor B), Tne (+750-fold excess inhibitor B),
respectively. The two lanes in each panel represented as A and B
are for amplification of target size of 5 and 15 Kb. The final
concentration of the Tne DNA polymerase in each reaction was 8.5 nM
(e.g., 0.1 unit).
[0113] As can be seen in FIG. 4, the sensitivity of Tne was greatly
improved by the addition of this inhibitor, and relative purity of
the target molecule was immensely improved as the concentration of
the inhibitor was optimized. As shown in panels D and E, 15 Kb
product can only be amplified by Tne DNA polymerase, under Taq PCR
conditions (Perkin-Elmer), in the presence of the inhibitor nucleic
acid.
EXAMPLE 6
Amplification of a 3 Kb Target DNA Sequence (Human Genomic Source)
by I Unit Taq
[0114] DNA Polymerase
[0115] The three panels A, B, and C of FIG. 5 represent reaction
conditions.
[0116] For A and B, the same primer sequences were used. In A, the
PCR mix was incubated at 94.degree. C. for 1 min and was set on ice
to force mis-priming. All PCR reaction were set for 30 min at
25.degree. C. so as to increase non-specific DNA synthesis. Each
condition: lane A (Taq control), B (Taq+126 nM inhibitor), C
(Taq+32 nM inhibitor) and D (Taq+64 nM inhibitor).
[0117] Results show that the specificity of Taq was greatly
improved by the addition of the inhibitor in each case producing
significant reduction in the non-specific DNA synthesis and
enhanced amount of the target sequence product.
EXAMPLE 7
Inhibition of RT Using the Oligonucleotides of the Present
Invention
[0118] The DNA polymerase activity of ThermoScript.TM. I RNase
deficient mutant reverse transcriptase (RT) (available from Life
Technologies, Inc.) was determined at ambient temperature,
37.degree. C. and 55.degree. C. in the presence and absence of the
oligonucleotide inhibitor molecules. The sequences and secondary
structures of the oligonucleotide inhibitors are shown below. The
polymerase activity of the RT was determined under steady state
kinetic conditions using olig(dG).sub.15/polyrC as the
primer/template substrate. This assay has been described by Polesky
et al. (1990), and was used with minor modification.
Oligonucleotide Inhibitors
[0119] All nucleic acid inhibitors used in our assays were HPLC
purified, and were capped synthetically with phosphate (PO.sub.4.)
at the 3' terminus. The mis-matches on the double stranded portion
of the molecules were introduced in order to reduce the melting
temperature of the double stranded without affecting the length of
the nucleic acid inhibitors. Nucleic acid inhibitor H is a control
oligonucleic acid that does not form double stranded structure
under our experimental condition and is used to determine the level
of inhibition by the RNA sequence.
[0120] Nucleic Acid Inhibitor C (synthesized by Synthetic
Genetics)
[0121] A 17/27 mer DNA/DNA double stranded nucleic acid
inhibitor.
TABLE-US-00004 (SEQ ID NO: 3) .sup.5'G G T A T A G T A A T A A T A
T A.sup.3' .sup.3'C C A T A T C A T T A T T A T A T A T G T A A T T
A A.sup.5'
[0122] Nucleic Acid Inhibitor D (synthesized by Life Technologies,
Inc.)
[0123] A 50 mer Dna/RNA hybrid nucleic acid, RNA bases are
underlined.
TABLE-US-00005 (SEQ ID NO: 4)
.sup.5'AAUUAAUGUAUAUAUUAUUACUAUACCGAAGGGTATAG
TAATAATATATA.sup.3'
[0124] Hairpin structure of Nucleic Acid Inhibitor D
TABLE-US-00006 (SEQ ID NO: 4) G A G G T A T A G T A A T A A T A T A
T A.sup.-3' A C C A U A U C A U U A U U A U A U A U G U G A A U U A
A.sup.-5'
[0125] Nucleic Acid Inhibitor E (synthesized by Life Technologies,
Inc.)
[0126] A 50 mer DNA/RNA hybrid nucleic acid, RNA bases are single
underline and the two mis-match positions are double underlined on
the DNA portion of the corresponding hairpin structure.
TABLE-US-00007 (SEQ ID NO: 5)
.sup.5'AAUUAAUGUAUAUAUUAUUACUAUACCGAAGGGTATAAT
AATAGTATATA.sup.3'
[0127] Hairpin Structure of Nucleic Acid Inhibitor E
TABLE-US-00008 (SEQ ID NO: 5) G A G G T A T A A T A A T A G T A T A
T A.sup.-3' A C C A U A U C A U U A U U A U A U A U G U A G A U U A
A.sup.-5'
[0128] Nucleic Acid Inhibitor F (synthesized by Life Technologies,
Inc.) A 50 mer DNA/RNA hybrid nucleic acid, RNA bases are single
underlined and the three mis-match positions are double underlined
on the DNA portion of the corresponding hairpin structure.
TABLE-US-00009 (SEQ ID NO: 6)
.sup.5'AAUUAAUGUAUAUAUUAUUACUAUACCGAAGGGTATAATGAGA
GTATATA.sup.3'
[0129] Hairpin Structure of Nucleic Acid Inhibitor F
TABLE-US-00010 (SEQ ID NO: 6) G A G G T A T A A T G A G A G T A T A
T A.sup.-3' A C C A U A U C A U U A U U A U A U A U G U A G A U U A
A.sup.-5'
[0130] Nucleic Acid Inhibitor G (synthesized by Life Technologies,
Inc.
[0131] A 50 mer DNA/RNA hybrid nucleic acid, RNA bases are
underlined and the four mis-match positions are double underlined
on the DNA portion of the corresponding hairpin structure.
TABLE-US-00011 (SEQ ID NO: 7)
.sup.5'AAUUAAUGUAUAUAUUAUUACUAUACCGAAGGGTATAATGAGA
GTATATA.sup.3'
[0132] Hairpin Structure of Nucleic Acid Inhibitor G
TABLE-US-00012 (SEQ ID NO: 7) G A G G T A T A A T G A G A G T A T A
T A.sup.-3' A C C A U A U C A U U A U U A U A U A U G U A G A U U A
A.sup.-5'
[0133] Nucleic Acid Inhibitor H (synthesized by Life Technologies,
Inc.)
[0134] A 50 mer DNA/RNA hybrid nucleic acid, RNA bases are
underlined.
TABLE-US-00013 (SEQ ID NO: 8)
.sup.5'AAUUAAUGUAUAUAUUAUUACUAUACCGAAAATATATAATGATG
ATATAG.sup.3'
[0135] The relative polymerase activities of ThermoScript.TM. in
the absence and presence of nucleic acid inhibitors at ambient
temperature (.about.22.degree. C.), 37.degree. C. and 55.degree. C.
was determined. The polymerization reaction was initiated by the
addition of RT or RT/inhibitor (5 .mu.L) to a solution of the
primer/template in the presence of dGTP (spiked with dGVP) and
MgCl.sub.2, final reaction volume of 50 .mu.L. The mixture was
incubated at the reaction temperature, and samples (5 .mu.L) were
removed at 1 mM (22.degree. C.) and 15 sec (37.degree. C. and
55.degree. C.) intervals and were added into 50 .mu.l, of 25 mM
EDTA. A portion of the quenched solution was applied to DE-81
filters. Following washes to remove unincorporated dGTP, the
filters were counted in scintillation vials containing EconoFluor-2
(Packard). The apparent rate of the reaction was derived from the
rate plot (com plotted against time interval). The reaction
concentration of the oligo(dG).sub.15/polyrC was 800 nM in primer,
dGTP was 100 .mu.M and MgCl.sub.2 and KCI were 10 mM and 50 mM,
respectively. For each reaction condition the concentration of the
reverse transcriptase was maintained at 12 nM whereas the
concentration of each of the oligonucleotide inhibitor was 540
nM.
[0136] The relative activity of the polymerization reaction
catalyzed by ThermoScript.TM. at ambient temperature, 37.degree. C.
and 55.degree. C. in the presence and absence of the inhibitors are
shown in FIGS. 6A and 6B. The activities in the absence of the
oligonucleotide inhibitors (free ThermoScript.TM. I) was normalized
to 1 for measurements at each temperature. The RT activity in the
presence of an inhibitor was correlated to the activity of
ThermoScript.TM. at each temperature and the relative normalized
activities are presented as a bar graph and are shown in FIGS. 6A
and 6B. For each set of reaction condition, the three bars from
left to right denote reactions performed at ambient temperature,
37.degree. C. and 55.degree. C., respectively. TS, TS-D, TS-E, and
TS-H in FIG. 6A denote polymerase reaction initiated by
ThermoScript.TM. I, ThermoScript.TM. I-nucleic acid inhibitor D
complex, ThermoScript.TM. I-nucleic acid inhibitor E complex and
ThermoScript.TM. I-nucleic acid inhibitor H complex, respectively.
The efficiency of inhibition of the RT activity is dependent to the
temperature which indicates that the level of inhibition of RT by
the nucleic acid inhibitors is dependent to the melting temperature
of the nucleic acid.
Nucleic Acid Inhibitor D
[0137] Under experimental conditions described above, complexing
ThermoScript.TM. I with about 50-fold excess of this nucleic acid
prior to initiating the polymerization reaction inhibited the RT
activity by about 85-90% at each of the reaction temperatures. The
relative similarity of the level of inhibition is indicative of the
stability of the hairpin structure of this nucleic acid inhibitor
in the temperature range that was assayed for RT activity.
Nucleic Acid Inhibitor E
[0138] Under the experimental conditions, complexing
ThermoScript.TM. I with about 50-fold excess of this nucleic acid
prior to initiating the polymerization reaction inhibited the RT
activity by about 90% at ambient temperature and 37.degree. C. but
the level of inhibition was 45% at 55.degree. C. The significant
reduction in the level of inhibition at 55.degree. C. suggests that
the hairpin structure was destabilized by the introduction of the
two mis-matches. This result suggests that "hot-start" of the
polymerase reaction catalyzed by reverse transcriptases can be
enhanced by using a nucleic acid inhibitor that forms double
stranded at ambient temperature but denatures at the desired
polymerization temperature.
Nucleic Acid Inhibitor H
[0139] Under the experimental conditions, complexing ThermoScript"'
I with about 50-fold excess of this nucleic acid prior to
initiating the polymerization reaction inhibition the RT activity
by about 50% at ambient temperature. The level of inhibition at
37.degree. C. and 55.degree. C. was negligible, within our
experimental error. This result suggests that there is a background
level of inhibition at ambient temperature that is not derived from
the primer/template substrate competition. Whereas the level of
inhibition by the addition of inhibitor H was minimal at 37.degree.
C. and 55.degree. C., under our experimental condition.
[0140] The relative polymerase activities of Thermoscript.TM. I in
the absence and presence of the remaining nucleic acid inhibitors
described above are shown in FIG. 6B. For each set of reaction
conditions, the three bars from left to right denote reactions
performed at ambient temperature, 37.degree. C. and 55.degree. C.,
respectively. TS, TS-C, TS-H, TS-E, TS-F and TS-G denote polymerase
reaction initiated by ThermoScript.TM. I, ThermoScript.sup.."'
I-nucleic acid inhibitor C complex, ThermoScript.sup.1M I-nucleic
acid inhibitor H complex, ThermoScript.TM. I-nucleic acid inhibitor
E complex, ThermoScripfm I-nucleic acid inhibitor F complex, and
ThermoScript.TM. I-nucleic acid inhibitor G complex,
respectively.
Nucleic Acid Inhibitor C
[0141] Under the experimental conditions, complexing
ThermoScript.TM. I with about 50-fold excess of this nucleic acid
(DNA/DNA) prior to initiating the polymerase inhibited the RT
activity by about 70% at each of the reaction temperature. The
relative similarity of the level of inhibition is indicative of the
stability of the double stranded structure of this nucleic acid
sequence in the temperature range in which the RT activity was
assayed.
Nucleic Acid Inhibitor H
[0142] Under the experimental conditions, complexing
ThermoScript.TM. I with about 50-fold excess of this nucleic acid
prior to initiating the polymerization reaction inhibited the RT
activity by about 40% at ambient temperature. The level of
inhibition at 37.degree. C. and 55.degree. C. was negligible,
within our experimental error.
Nucleic Acid Inhibitor E
[0143] Under the experimental conditions, complexing
ThermoScript.TM. I with about 50-fold excess of this nucleic acid
prior to initiating the polymerization reaction inhibited the RT
activity by more than 90% at ambient temperature and 37.degree. C.
but the level of inhibition was 60% at 55.degree. C.
Nucleic Acid Inhibitor F
[0144] Under the experimental conditions, complexing
ThermoScript.TM. I with about 50-fold excess of this nucleic acid
prior to initiating the polymerization reaction inhibited the RT
activity by about 80% at ambient temperature, 65% at 37.degree. C.
and 40% at 55.degree. C. The decrease in the level of inhibition in
correlation to the increase of the reaction temperature is
indicative of the destabilization of the hairpin structure due to
the three mis-matches.
Nucleic Acid Inhibitor G
[0145] Under the experimental conditions, complexing ThermoScripfm
I with about 50-fold excess of this nucleic acid prior to
initiating the polymerization reaction inhibited the RT activity by
about 80% at ambient temperature, 55% at 37.degree. C. and 30% at
55.degree. C. The decrease in the level of inhibition in
correlation to the increase of the reaction temperature is
indicative of the destabilization of the hairpin structure due to
the three mis-matches.
EXAMPLE 8
Inhibition of Reverse Transcriptase Activity Within a Cell
[0146] The oligonucleotides of the present invention may be used to
inhibit the activity of a revere transcriptase enzyme with a cell.
Oligonucleotides for use inside a cell may optionally be modified
to render them resistant to one or more nuclease enzymes that may
be present in a cell. For example, a derivative of the nucleic acid
inhibitor may be synthesized with one or more of the following
modifications: 1) one or more of the ribose groups on the RNA
portion of the oligonucleotide may be alkylated, for example,
methylated, preferably at the 2'-OH to produce a 2'-O methyl; 2)
one or more of the internucleotide linkages of the oligonucleotide,
for example, in the DNA portion of the nucleic acid, may contain a
modified linkage, for example, a phosphorothioate linkage; 3) the
3' terminus of the oligonucleotide may be capped so as to be
non-extendable, for example, with a phosphate, phoshorothioate or a
dideoxynucleotide or other modification of the 3'-hydroxyl so as to
make it not extendable. Other modification that increase the level
of resistance to cellular RNase activity and/or reduce the
efficiency of DNA degradation by other cellular factors are known
to those skilled in the art and may be incorporated into the design
of the oligonucleotides of the present invention. In addition to
rendering the oligonucleotides resistant to one or more cellular
degradation factors, phosphorothioate reduces the possibility of
homologous recombination into the host chromosome should a given
inhibitor contain a region homologous to one on the host
chromosome.
[0147] Oligonucleotides may be assayed to determine if they have an
inhibitory effect on reverse transcriptase activity in a cell.
Cells to be treated with the oligonucleotides of the invention, for
example NIH3T3 cells may be transfected with the nucleic acid (Life
Technologies, Inc.) using any method known to those skilled in the
art. In some preferred embodiments, the oligonucleotides of the
invention may be introduced into the cells using lipid mediated
transfection (see, for example, U.S. Pat. Nos. 5,334,761;
5,674,908; 5,627,159; 5,736,392; 5,279,833 and published
international application WO 94/27345 all of which are specifically
incorporated herein by reference).
[0148] Following transfection of the cells, a virus expressing a
reverse transcriptase (for example, Moloney Murine Leukemia V,
M-MLV) may be added so as to efficiently infect cells with the
virus and provide a source of reverse transcriptase activity.
(Jolicoeur, P. and Rassart, E., 1980). An aliquot of the cells will
be centrifuged and lysed at time intervals in order to assay for
reverse transcriptase activity. Comparing the level of RT activity
derived from cells that are transfected with a nucleic acid
inhibitor and those that are not transfected, the efficacy of
inhibition of viral proliferation in the cell can be
determined.
EXAMPLE 9
Inhibition of Taq polymerase Using Phosphorothioate Substituted
Oligonucleotides
[0149] In some preferred embodiments, one or more phosphorothioate
residues may be incorporated into the oligonucleotides of the
present invention. Those skilled in the art will appreciate that
oligonucleotides incorporating such internucleotide linkages may be
more resistant to nuclease activities that may be present in a
reaction mixture within a cell Accordingly, such modifications may
be made in oligonucleotides intended for in vivo or in vitro use.
In some preferred embodiments, all of the internucleotide linkages
may be phosphorotioate linkages.
[0150] In some embodiments, the 3'-terminus of an oligonucleotide
of the invention may be modified to render the oligonucleotide more
resistant to any 3'-to 5'-exonuclease activity present in a
reaction mixture or within a cell. In some embodiments, the
3'-hydroxyl of the oligonucleotide may be modified , for example,
by coupling a spacer modifier to the hydroxyl group. Such spacer
modifiers are commercially available (Glen Research) and may
comprise a chain of carbon atoms which may be substituted with one
or more groups containing heteroatoms. In some preferred
embodiments, the 3'-hydroxyl of the oligonucleotides of the
invention may be modified with a 3 carbon spacer which terminates
in a group containing a heteroatom such as, for example, an amine
group or a hydroxyl group. The incorporation of such spacer
modifiers into an oligonucleotide may be accomplished using
chemistries well known to those skilled in the art for example, by
the incorporation of a suitably blocked phophoramidite version of
the spacer.
[0151] To examine the effectiveness of phosphorothioate modified
oligonucleotides to inhibit Taq polymerase oligonucleotides were
constructed in which all phosphate internucleotide linkages were
change to phophorothioate internucleotide linkages. Four such
oligonucleotides were constructed and their sequences are given
below. HPHH1 is a phosphorothioate hairpin oligonucleotide with a 3
nucleotide loop, a melting temperature of the duplex region of
59.degree. C. and a .DELTA.G=-15.70 kcal/mol of formation of the
duplex.
TABLE-US-00014 (SEQ ID NO: 9) 5' CGGATGTATTAACTATCAATA .fwdarw.
||||||||||||||| C 3' CAGAATTGATAGTTAA .rarw.
HPHH2 is a phosphorothioate hairpin oligonucleotide with a 3
nucleotide loop, a melting temperature of the duplex region of
67.degree. C. and a .DELTA.G=-18.10 kcal/mol of formation of the
duplex.
TABLE-US-00015 (SEQ ID NO: 10) 5' CGGATGGATTAACTATCAATA .fwdarw.
||||||||||||||| C 3' CCTAATTGATAGTTAA .rarw.
HPHH3 is a phosphorothioate hairpin oligonucleotide with a 5
nucleotide loop and a melting temperature of the duplex region of
70.degree. C. and a .DELTA.G=-18.90 kcal/mol of formation of the
duplex.
TABLE-US-00016 (SEQ ID NO: 11) 5' CGGATGGATTAACTATCAATTA .fwdarw.
||||||||||||||| C 3' CCTAATTGATAGTTAGA .rarw.
HPHH4 is a phosphorothioate oligonucleotide with a 4 nucleotide
loop and a melting temperature of 65.degree. C. of the duplex and a
.DELTA.G=-13.5 kcal/mol of formation of the duplex.
TABLE-US-00017 (SEQ ID NO: 12) 5' ACATGTATTGATAGATCGA .fwdarw.
||||||||||||| C 3' CATAACTATCTAGAA .rarw.
The bases involved in formation of the stem structure are indicated
by a vertical line. When the oligonucleotide was modified at the
3'-terminal with a 3 carbon spacer group ending in a hydroxyl, the
designation Sspa3 was added to the name of oligonucleotide.
[0152] With reference to FIG. 7, amplification reactions to produce
a 1.6 kb (A), a 2 kb (B) and a 2.6 kb (C) fragment of the NF2 gene.
In each panel, lane a is the amplification using Taq polymerase
alone, lane b is the amplification reaction in the presence of
inhibitor HPHH4Sspa3 at a molar ratio of 1.2:1 inhibitor:
polymerase and lane c is the amplification using Platinum Taq. The
template was 200 ng of genomic DNA. A comparison of lane b to lanes
a and c in each panel shows that the presence of the inhibitor
improves the amount of full length product and reduces the amount
of shorter products under these reaction conditions.
[0153] As shown in FIG. 8, the activity of Taq polymerase in a
nucleotide incorporation assay was determined at three temperatures
(25.degree. C., 55.degree. C. and 72.degree. C.) in the presence of
two different concentrations of inhibitor HPHH4Sspa3 (molar ratios
of 2:1 and 7.5:1 inhibitor:polymerase). At each temperature, the
solid black bar is the Taq polymerase alone, the striped bar is Taq
polymerase plus inhibitor at a 2:1 ratio of inhibitor to polymerase
and the solid white bar is Taq plus inhibitor at a 7.5:1 ratio of
inhibitor:polymerase. The incorporation was assayed in a PCR
reaction mixture incubated at the indicated temperature in the
presence of alpha-[.sup.32P]-dCTP. After 30 minutes, the reactions
were stopped by the addition of EDTA and an aliquot of each
reaction was spotted onto GF/C filters. The filters were washed
with TCA and counted. The activity was normalized to the amount of
activity of the Taq polymerase at the same temperature.
[0154] At 25.degree. C. and a 2:1 ratio, Taq activity was reduced
to approximately 60% of the un-inhibited polymerase while a 7.5:1
ratio reduced activity by approximately 90%. At 55.degree. C. (a
typical annealing temperature) inhibition was still observed,
approximately a 20% and 60% reduction in activity at 2:1 and 7.5:1
respectively. At 72.degree. C. (a typical extension temperature)
inhibition was nearly eliminated at a 2.5:1 ratio and was
approximately 50% at a 7.5:1 ratio. These data indicate that the
inhibition is temperature dependent with more inhibition observed
at lower temperatures (i. e., when the oligonucleotide is in a
hairpin structure) and less at a higher temperature.
[0155] The concentration dependence of the inhibition of Taq
polymerase by inhibitor HPHHSspa3 was studied at 37.degree. C. and
the results are shown in FIG. 9. The incorporation assay described
above was used. These results indicate that the inhibition is dose
dependent with a slight (20%) inhibition seen at a molar ration of
0.5:1 inhibitor: polymerase up to a nearly complete inhibition
(96%) seen at 7.5:1. By way of comparison, a Taq polymerase
inhibited by antibody (Platinum Taq) was tested under the same
conditions. At a molar ratio of 7.5:1, the inhibitors of the
present invention provide a comparable amount of inhibition of Taq
activity as the antibody.
[0156] Having now fully described the present invention in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious to one of ordinary skill in
the art that the same can be performed by modifying or changing the
invention within a wide and equivalent range of conditions,
formulations and other parameters without affecting the scope of
the invention or any specific embodiment thereof, and that such
modifications or changes are intended to be encompassed within the
scope of the appended claims.
[0157] All publications, patents and patent applications mentioned
in this specification are indicative of the level of skill of those
skilled in the art to which this invention pertains, and are herein
incorporated by reference to the same extent as if each individual
publication, patent or patent application was specifically and
individually indicated to be incorporated by reference.
Sequence CWU 1
1
12134DNAArtificial SequenceDescription of Artificial Sequence
nucleic acid inhibitor 1cccaatatgg accggtcgaa agaccggtcc atat
34255DNAArtificial SequenceDescription of Artificial Sequence
nucleic acid inhibitor 2ccatgcaggt agccgatgaa ctggtcgaaa gaccagttca
tcggctacct gcatg 55344DNAArtificial SequenceDescription of
Artificial Sequence nucleic acid inhibitor 3aattaatgta tatattatta
ctataccggt atagtaataa tata 44450DNAArtificial SequenceDescription
of Combined DNA/RNA Molecule RNA bases from 1-25 and DNA bases from
26-50 4aauuaaugua uauauuauua cuauaccgaa gggtatagta ataatatata
50550DNAArtificial SequenceDescription of Combined DNA/RNA Molecule
RNA bases from 1 to 25 and DNA bases from 25-48 5aauuaaugua
uauauuauua cuauaccgaa gggtataata atagtatata 50650DNAArtificial
SequenceDescription of Combined DNA/RNA Molecule RNA bases from
1-25 and DNA bases from 26-50 6aauuaaugua uauauuauua cuauaccgaa
gggtataatg agagtatata 50750DNAArtificial SequenceDescription of
Combined DNA/RNA Molecule RNA bases from 1-25 and DNA bases from
26-50 7aauuaaugua uauauuauua cuauaccgaa gggtataatg agagtatata
50850DNAArtificial SequenceDescription of Combined DNA/RNA Molecule
RNA bases from 1-25 and DNA bases from 26-50 8aauuaaugua uauauuauua
cuauaccgaa aatatataat gatgatatag 50938DNAArtificial
SequenceDescription of Artificial Sequence synthetic
oligonucleotides 9cggatgtatt aactatcaat acaattgata gttaagac
381038DNAArtificial SequenceDescription of Artificial Sequence
synthetic oligonucleotides 10cggatggatt aactatcaat acaattgata
gttaatcc 381140DNAArtificial SequenceDescription of Artificial
Sequence synthetic oligonucleotides 11cggatggatt aactatcaat
tacagattga tagttaatcc 401235DNAArtificial SequenceDescription of
Artificial Sequence synthetic oligonucleotides 12acatgtattg
atagatcgac aagatctatc aatac 35
* * * * *