U.S. patent application number 14/774719 was filed with the patent office on 2016-01-28 for long-lived polynucleotide molecules.
The applicant listed for this patent is MODERNA THERAPEUTICS, INC.. Invention is credited to Tirtha Chakraborty, Sayda M. Elbashir, Stephen G. Hoge, Eric Yi-Chun Huang.
Application Number | 20160024181 14/774719 |
Document ID | / |
Family ID | 50513463 |
Filed Date | 2016-01-28 |
United States Patent
Application |
20160024181 |
Kind Code |
A1 |
Hoge; Stephen G. ; et
al. |
January 28, 2016 |
LONG-LIVED POLYNUCLEOTIDE MOLECULES
Abstract
The invention relates to compositions and methods for the
preparation, manufacture and therapeutic use of long-lived
polynucleotides, primary transcripts and mmRNA molecules.
Inventors: |
Hoge; Stephen G.;
(Brookline, MA) ; Huang; Eric Yi-Chun; (Boston,
MA) ; Chakraborty; Tirtha; (Medford, MA) ;
Elbashir; Sayda M.; (Cambridge, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
MODERNA THERAPEUTICS, INC. |
Cambridge |
MA |
US |
|
|
Family ID: |
50513463 |
Appl. No.: |
14/774719 |
Filed: |
March 13, 2014 |
PCT Filed: |
March 13, 2014 |
PCT NO: |
PCT/US2014/025225 |
371 Date: |
September 11, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61778644 |
Mar 13, 2013 |
|
|
|
61828784 |
May 30, 2013 |
|
|
|
Current U.S.
Class: |
514/44R ;
435/455; 536/23.2; 536/23.4 |
Current CPC
Class: |
C07K 14/535 20130101;
A61K 48/00 20130101; C07K 14/605 20130101; C07K 14/76 20130101;
C07K 2319/00 20130101; C12N 15/67 20130101; C07K 14/50 20130101;
C07K 16/00 20130101; C07K 14/765 20130101; C07K 14/59 20130101;
C07K 14/61 20130101 |
International
Class: |
C07K 14/76 20060101
C07K014/76; C07K 14/535 20060101 C07K014/535; C07K 16/00 20060101
C07K016/00; C07K 14/765 20060101 C07K014/765; C07K 14/61 20060101
C07K014/61; C07K 14/605 20060101 C07K014/605; C07K 14/59 20060101
C07K014/59; C07K 14/50 20060101 C07K014/50 |
Claims
1. An isolated codon optimized mRNA, wherein said mRNA comprising a
nucleic acid sequence encoding (a) a polypeptide of interest; and
(b) a first longevity enhancing sequence.
2. The isolated codon optimized mRNA of claim 1 wherein the first
longevity enhancing sequence is selected from the group consisting
of carboxy-terminal peptide, albumin and IgG4.
3. The isolated codon optimized mRNA of claim 1 wherein at least
one isolated mRNA comprises at least a first modified
nucleoside.
4. The isolated codon optimized mRNA of claim 1 comprising a poly-A
tail and wherein the poly-A tail is at least 140 nucleotides in
length.
5. The isolated codon optimized mRNA of claim 1 comprising a 5' cap
structure and wherein the 5' cap structure is selected from the
group consisting of Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine,
2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine,
2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.
6. The isolated codon optimized mRNA of claim 1, wherein the first
longevity enhancing sequence is located at a position in the mRNA
selected from the group consisting of 5'UTR, coding region and
3'UTR.
7. The isolated codon optimized mRNA of claim 1, wherein the first
longevity enhancing sequence is a carboxy-terminal peptide and is
selected from the group consisting of SEQ ID NO: 1-3.
8. The isolated codon optimized mRNA of claim 7 encoding a second
longevity enhancing sequence.
9. The isolated codon optimized mRNA of claim 8, wherein the second
longevity enhancing sequence is a carboxy-terminal peptide and is
selected from the group consisting of SEQ ID NO: 1-3.
10. The isolated codon optimized mRNA of claim 8, wherein the first
longevity enhancing sequence and the second longevity enhancing
sequence are the same.
11. The isolated codon optimized mRNA of claim 8 encoding a third
longevity enhancing sequence.
12. The isolated codon optimized mRNA of claim 11, wherein the
third longevity enhancing sequence is a carboxy-terminal peptide
and is selected from the group consisting of SEQ ID NO: 1-3.
13. The isolated codon optimized mRNA of claim 11, wherein the
first longevity enhancing sequence, the second longevity enhancing
sequence and the third longevity enhancing sequence are the
same.
14. The isolated codon optimized mRNA of claim 11, wherein the
first longevity enhancing sequence is located in the 5'UTR of said
isolated codon optimized mRNA.
15. The isolated codon optimized mRNA of claim 14, wherein the
second longevity enhancing sequence and the third longevity
enhancing sequence are located in the 3'UTR of said isolated codon
optimized mRNA.
16. A method of increasing the half-life of a protein in a cell,
tissue and/or organism comprising contacting the cell, tissue
and/or organism with the isolated codon optimized mRNA of claim
1.
17. A pharmaceutical composition comprising the isolated codon
optimized mRNA of claim 1 and a pharmaceutically acceptable
excipient.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Patent
Application No. 61/778,644, filed Mar. 13, 2013, entitled
Long-Lived Polynucleotide Molecules and U.S. Provisional Patent
Application No. 61/828,784, filed May 30, 2013, entitled Long-Lived
Polynucleotide Molecules, the contents of each of which are herein
incorporated by reference in their entireties.
REFERENCE TO SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence listing file, entitled
M041PCTSEQLST.txt, was created on Mar. 11, 2014, and is 66,072
bytes in size. The information in electronic format of the Sequence
Listing is incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[0003] The invention relates to compositions, methods, processes,
kits and devices for the design, preparation, manufacture and/or
formulation of polynucleotides encoding at least one longevity
enhancing sequence such as, but not limited to, carboxy-terminal
peptide (CTP), albumin and/or IgG4 which may increase the length of
time a polynucleotide, primary construct and/or mmRNA remains in a
cell, tissue and/or organism. In one aspect, the invention relates
to modified RNA in therapeutics. The modified RNA of the invention
may encode peptides, polypeptides or multiple proteins. The
modified RNA of the invention may also be used to produce
polypeptides of interest which may include at least one longevity
enhancing sequence such as, but not limited to, carboxy-terminal
peptide (CTP), albumin and/or IgG4. The modified RNA molecules of
the invention may therefore be referred to as modified snRNA. The
polypeptides of interest may be used in therapeutics and/or
clinical and research settings.
BACKGROUND OF THE INVENTION
[0004] Polynucleotides are susceptible to denaturation or enzymatic
degradation in cells, tissues and/or organisms (e.g., in the blood,
liver or kidney). Accordingly, polynucleotides have short
circulatory half-lives such as, but not limited to, several hours.
Because of their low stability, the polynucleotides may need to be
administered repeatedly or continuously as to maintain a desired
concentration of the encoded polypeptide in the cell, tissue and/or
organism.
[0005] Thus, there is a need for technologies that will alter
(e.g., prolong and/or shorten) the half-lives of polynucleotides
while maintaining a pharmacological efficacy thereof. It would also
be desirable to have polynucleotides which may be therapeutics to
have enhanced serum stability, high activity and a low probability
of inducing an undesired immune response when administered or
delivered to a cell, tissue and/or organism.
[0006] Unfavorable pharmacokinetics of therapeutics, such as a
short serum half-life, can delay the development of many otherwise
promising polynucleotide therapeutics. Serum half-life is an
empirical characteristic of a molecule, and must be determined
experimentally for each new potential therapeutic. For example,
physiological clearance mechanism (e.g., renal filtration) can make
the maintenance of desired levels of a polynucleotide therapeutic
undesirable and/or unfeasible because of cost or frequency of the
required dosing regimen. Conversely, a long serum half-life may be
undesirable in some instances where a therapeutic or its
metabolites has toxic side effects.
[0007] The present invention addresses both the problem of
denaturation and/or degradation of polynucleotides by providing
nucleic acid based compounds or polynucleotides which encode a
polypeptide of interest (e.g., modified mRNA or mmRNA) and a
longevity enhancing sequence such as, but not limited to,
carboxy-terminal peptide (CTP), albumin and IgG4 and which may have
structural and/or chemical features that avoid one or more of the
problems in the art.
[0008] To this end, the inventors have shown that certain modified
mRNA sequences have the potential as therapeutics with benefits
beyond just evading, avoiding or diminishing the immune response.
Such studies are detailed in published co-pending applications
International Publication No WO2012019168 filed Aug. 5, 2011,
International Publication No WO2012045082 filed Oct. 3, 2011, and
International Publication No WO2012045075 filed Oct. 3, 2011, the
contents of which are incorporated herein by reference in their
entirety.
SUMMARY OF THE INVENTION
[0009] Described herein are compositions, methods, processes, kits
and devices for the design, preparation, manufacture and/or
formulation of polynucleotides encoding at least one longevity
enhancing sequence such as, but not limited to, carboxy-terminal
peptide (CTP), albumin and IgG4. Such polynucleotides may be
chemically modified mRNA (mmRNA) molecules.
[0010] In one aspect, provided herein is an isolated mRNA
polynucleotide. The isolated mRNA polynucleotide may encode a
polypeptide of interest and a first longevity enhancing sequence
such as, but not limited to, a carboxy-terminal peptide, an albumin
sequence and an IgG4 sequence. The isolated mRNA polynucleotide may
be codon optimized. Also provided herein is a composition
comprising at least one isolated mRNA polynucleotide.
[0011] The carboxy-terminal peptide may be located at a position
such as, but not limited to, a region that is located between the
5' terminus to coding region of a polypeptide of interest such as,
but not limited to, the 5'UTR, within coding region and a region
that is located between the coding region of the polypeptide of
interest to 3' terminus such as, but not limited to, the 3'UTR.
[0012] The poly-A tail of the isolated mRNA polynucleotide may be
approximately 140 to 160 nucleotides in length. The 5'cap structure
may be selected from, but is not limited to, Cap0, Cap1, ARCA,
inosine, N1-methyl-guanosine, 2'fluoro-guanosine,
7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine,
LNA-guanosine, and 2-azido-guanosine. The at least one isolated
polynucleotide may also be purified.
[0013] The isolated mRNA polynucleotide may also encode a second,
third or more carboxy-terminal peptides. The at least one isolated
mRNA polynucleotide may encode the same amino acid sequence for the
first and second, third or more carboxy-terminal peptides. The at
least one isolated mRNA polynucleotide may encode the same nucleic
acid sequence for the first and second, third or more
carboxy-terminal peptides. In one aspect, the at least one isolated
mRNA polynucleotide encodes a nucleic acid sequence for the first
carboxy-terminal peptide and the second carboxy-terminal peptide
has a nucleic acid sequence at least 85% homologous with the
nucleic acid sequence for the first carboxy-terminal peptide. The
carboxy-terminal peptides of the present invention may include, but
are not limited to, those recited in SEQ ID NOs: 1-3 and portion,
fragments and variants thereof.
[0014] In one aspect the first carboxy-terminal peptide, the second
carboxy-terminal peptide and the third carboxy-terminal peptide may
be each located at a position selected from a region that is
located between the 5' terminus to coding region of a polypeptide
of interest such as, but not limited to, the 5'UTR, the coding
region and a region that is located between the coding region of
the polypeptide of interest to 3' terminus such as, but not limited
to, the 3'UTR. As a non-limiting example, the first
carboxy-terminal peptide is located at the position of 5' terminus
to coding region of a polypeptide of interest. Further, the second
carboxy-terminal peptide and the third carboxy-terminal peptide may
be located at the position coding region of the polypeptide of
interest to 3' terminus. As another non-limiting example, the first
carboxy-terminal peptide is located in the 5'UTR. Further, the
second carboxy-terminal peptide and the third carboxy-terminal
peptide may be located in the 3'UTR.
[0015] The composition may comprise at least a first modified
nucleoside. In one aspect the at least one isolated mRNA
polynucleotide comprises at least two modifications. The at least
two modification may be located on one or more of a nucleoside
and/or a backbone linkage between nucleosides. The one or more
backbone linkages may be modified by replacement of one or more
oxygen atom and/or replacing at least one backbone linkage with a
phosphorothioate linkage. The one or more modifications may be
located on a sugar of one or more nucleosides.
[0016] In one aspect, the one or more modified nucleosides may
include, but are not limited to, pyridin-4-one ribonucleoside,
5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine,
4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine,
3-methyluridine, 5-carboxymethyl-uridine,
1-carboxymethyl-pseudouridine, 5-propynyl-uridine,
1-propynyl-pseudouridine, 5-taurinomethyluridine,
1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine,
1-taurinomethyl-4-thio-uridine, 5-methyl-uridine,
1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine,
2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine,
2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine,
dihydropseudouridine, 2-thio-dihydrouridine,
2-thio-dihydropseudouridine, 2-methoxyuridine,
2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine,
4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine,
3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine,
N4-methylcytidine, 5-hydroxymethylcytidine,
1-methyl-pseudoisocytidine, pyrrolo-cytidine,
pyrrolo-pseudoisocytidine, 2-thio-cytidine,
2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine,
4-thio-1-methyl-pseudoisocytidine,
4-thio-1-methyl-1-deaza-pseudoisocytidine,
1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine,
5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine,
2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine,
4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine,
2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine,
7-deaza-8-aza-adenine, 7-deaza-2-aminopurine,
7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine,
7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine,
N6-methyladenosine, N6-isopentenyladenosine,
N6-(cis-hydroxyisopentenyl)adenosine,
2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine,
N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine,
2-methylthio-N6-threonyl carbamoyladenosine,
N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine,
2-methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wybutosine,
7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine,
6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine,
7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine,
6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine,
N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine,
1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine and
N2,N2-dimethyl-6-thio-guanosine.
[0017] In one aspect, the at least one modification is located on
one or more nucleobases. The one or more nucleobases are selected
from the group consisting of cytosine, guanine, adenine, thymine
and uracil.
[0018] In one aspect of the present invention, provided is a method
of increasing the half-life of an mRNA polynucleotide in a cell,
tissue and/or organism comprising contacting the cell, tissue
and/or organism with the composition or isolated mRNA described
herein.
[0019] In one aspect of the present invention, provided is a method
of increasing the half-life of protein in a cell, tissue and/or
organism comprising contacting the cell, tissue and/or organism
with the isolated mRNA described herein. The isolated mRNA may be
codon optimized and may comprise a chemical modification.
[0020] In one aspect of the present invention, provided is a method
of increasing the level of protein in a cell, tissue and/or
organism comprising contacting the cell, tissue and/or organism
with the composition or isolated mRNA described herein. The
isolated mRNA may be codon optimized and may comprise a chemical
modification.
[0021] In one aspect of the present invention, provided is a
pharmaceutical composition comprising the isolated mRNA described
herein and a pharmaceutically acceptable excipient. The isolated
mRNA may be codon optimized and may comprise a chemical
modification.
[0022] The details of various embodiments of the invention are set
forth in the description below. Other features, objects, and
advantages of the invention will be apparent from the description
and the drawings, and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] The foregoing and other objects, features and advantages
will be apparent from the following description of particular
embodiments of the invention, as illustrated in the accompanying
drawings in which like reference characters refer to the same parts
throughout the different views. The drawings are not necessarily to
scale, emphasis instead being placed upon illustrating the
principles of various embodiments of the invention.
[0024] FIG. 1 is a schematic of a primary construct of the present
invention.
[0025] FIG. 2 is a schematic of a bicistronic primary construct of
the present invention.
[0026] FIG. 3 is a schematic of a primary construct of the present
invention with a longevity enhancing sequence.
[0027] FIG. 4 is a schematic of a primary construct of the present
invention with a longevity enhancing sequence.
[0028] FIG. 5 is a schematic of a primary construct of the present
invention with a longevity enhancing sequence.
[0029] FIG. 6 is a schematic of a primary construct of the present
invention with a longevity enhancing sequence.
[0030] FIG. 7 is clone map useful in the present invention.
DETAILED DESCRIPTION
[0031] It is of great interest in the fields of therapeutics,
diagnostics, reagents and for biological assays to be able to
deliver a nucleic acid, e.g., a ribonucleic acid (RNA) inside a
cell, whether in vitro, in vivo, in situ or ex vivo, such as to
cause intracellular translation of the nucleic acid and production
of an encoded polypeptide of interest. Of particular importance is
the delivery and function of a non-integrative polynucleotide.
[0032] Described herein are compositions (including pharmaceutical
compositions) and methods for the design, preparation, manufacture
and/or formulation of polynucleotides encoding one or more
polypeptides of interest and further encoding at least one
carboxy-terminal peptide (CTP). Also provided are systems,
processes, devices and kits for the selection, design and/or
utilization of the polynucleotides encoding the polypeptides of
interest further encoding at least one carboxy-terminal peptide
(CTP) described herein.
[0033] According to the present invention, these polynucleotides
are preferably modified as to avoid the deficiencies of other
polypeptide-encoding molecules of the art. Hence these
polynucleotides are referred to as modified mRNA or mmRNA.
[0034] Provided herein, in part, are polynucleotides, primary
constructs and/or mmRNA encoding polypeptides of interest which
have been designed to improve one or more of the stability and/or
clearance in tissues, receptor uptake and/or kinetics, cellular
access by the compositions, engagement with translational
machinery, mRNA half-life, translation efficiency, immune evasion,
protein production capacity, secretion efficiency (when
applicable), accessibility to circulation, protein half-life and/or
modulation of a cell's status, function and/or activity.
Specifically, the polynucleotides, primary constructs and/or mmRNA
of the present invention are useful in altering the longevity of
polynucleotides in a cell, tissue and/or organism.
I. COMPOSITIONS OF THE INVENTION
[0035] The present invention provides nucleic acid molecules,
specifically polynucleotides, primary constructs and/or mmRNA which
encode one or more polypeptides of interest and further encode at
least one longevity enhancing sequence such as, but not limited to,
a carboxy-terminal peptide, albumin and IgG4. As used herein,
"carboxy-terminal peptides" or "CTPs" are peptide moieties which,
when fused to or incorporated into other peptides or proteins
result in an increase in half-life of the resultant protein. These
long-acting peptides can, consequently result in therapeutic
benefit to the organism treated with such resultant peptides or
proteins or alternatively when treated with one or more
polynucleotides, primary constructs or mmRNA which encode such
proteins having CTPs. The polynucleotides, primary constructs
and/or mmRNA may encode at least one carboxy-terminal peptide. As a
non-limiting example, the polynucleotides, primary constructs
and/or mmRNA may encode a carboxy-terminal peptide attached at the
amino terminus of the encoded polypeptide of interest. In another
non-limiting example, the polynucleotides, primary constructs
and/or mmRNA may encode a carboxy-terminal peptide attached to the
amino and carboxy terminus of the encoded polypeptide of
interest.
[0036] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA encoded a polypeptide of interest and encode at least
one full-length carboxy-terminal peptide. In another embodiment,
the polynucleotides, primary constructs and/or mmRNA encoded a
polypeptide of interest and encode at least one truncated
carboxy-terminal peptide. In yet another embodiment, the
polynucleotides, primary constructs and/or mmRNA encoded a
polypeptide of interest and encode at least one full-length
carboxy-terminal peptide and at least one truncated
carboxy-terminal peptide.
[0037] In one embodiment, the half-life of a polynucleotide in a
cell, tissue and/or organism is increased by providing the cell,
tissue and/or organism with a polynucleotide, primary construct
and/or mmRNA comprising at least one nucleic acid sequence encoding
at least one carboxy-terminal peptide (CTP). In one embodiment, the
at least one carboxy-terminal peptide (CTP) may be attached to the
carboxy terminus of a polypeptide of interest. In another
embodiment, the at least one carboxy-terminal peptide (CTP) may be
attached to the amino terminus of the polypeptide of interest.
[0038] In one embodiment, the polynucleotide, primary construct
and/or mmRNA may comprise at least one nucleic acid sequence
encoding at least one carboxy-terminal peptide (CTP) located on the
5' end of the flanking region, after the 5' terminal cap, in the
5'UTR, before the first operational region, after the first
operational region, within the flanking region, after the first
operational region, prior to the signal sequence region, after the
signal sequence region, before the first region of linked
nucleosides, after the first region of linked nucleosides, within
the first region of linked nucleosides, before the second
operational region, after the second operational region, before the
stop codon, after the stop codon, before the second operational
region, after the second operational region, before the second
flanking region, after the second flanking region, within the
second flanking region, within the 3'UTR, before the 3' tailing
sequence, after the 3' tailing sequence, within the 3' tailing
sequence and combination thereof.
[0039] In one embodiment, the polynucleotide, primary construct
and/or mmRNA may comprise at least one nucleic acid sequence
encoding at least one carboxy-terminal peptide at the 5' end of the
polynucleotide, primary construct and/or mmRNA.
[0040] In one embodiment, the carboxy-terminal peptide may be
located after the signal peptide sequence.
[0041] In one embodiment, the polynucleotide, primary construct
and/or mmRNA may comprise at least two nucleic acid sequences
encoding at least one carboxy-terminal peptide at the 3' end of the
polynucleotide, primary construct and/or mmRNA. The
carboxy-terminal peptides located at the 3' end of the
polynucleotide, primary construct and/or mmRNA may be the same or
different. In another aspect, the nucleic acid sequence encoding
the carboxy-terminal peptides located at the 3' end of the
polynucleotide, primary construct and/or mmRNA may be different but
they encode the same carboxy-terminal peptide.
[0042] In one embodiment, the polynucleotide, primary construct
and/or mmRNA comprises at least one nucleic acid sequence encoding
at least one carboxy-terminal peptide at the 5' end of the
polynucleotide, primary construct and/or mmRNA and at least two
nucleic acid sequences encoding at least one carboxy-terminal
peptide at the 3' end of the polynucleotide, primary construct
and/or mmRNA. In one aspect, the carboxy-terminal peptide at the 5'
end may be the same as at least one of the at least two
carboxy-terminal peptides located at the 3' end. In another aspect,
the carboxy-terminal peptide at the 5' end may be a fragment of at
least one of the carboxy-terminal peptides located at the 3' end.
In one aspect, the nucleic acid sequence encoding the
carboxy-terminal peptides located at the 5' end of the
polynucleotide, primary construct and/or mmRNA may be the same or
different from the nucleic acid sequence encoding the
carboxy-terminal peptide located at the 3' end. As a non-limiting
example, the carboxy-terminal peptide at the 5'end is located after
the signal peptide before the sequence encoding the protein of
interest and the carboxy-terminal peptides at the 3' end is located
after the region encoding the protein of interest.
[0043] In one embodiment, the polynucleotide, primary construct
and/or mmRNA comprising at least one nucleic acid sequence encoding
at least one carboxy-terminal peptide (CTP) may include at least
one chemical modification described herein and/or known in the
art.
[0044] In one embodiment, the polynucleotide, primary construct
and/or mmRNA may comprise at least one nucleic acid sequence
encoding at least one carboxy-terminal peptide such as, but not
limited to, chorionic gonadotrophin carboxy-terminal peptide or
beta-gonadotrophin. In one embodiment, the encoded carboxy-terminal
peptide is a variant of the native carboxy-terminal peptide. In one
embodiment, the encoded carboxy-terminal peptide may differ from
the native carboxy-terminal peptide by 1, 2, 3, 4, 5 or more
conservative amino acid substitutions. As a non-limiting example,
the encoding carboxy-terminal peptide may be a variant of chorionic
gonadotrophin carboxy-terminal peptide by one to five conservative
amino acid substitutions as described in U.S. Pat. No. 5,712,122,
the contents of which are herein incorporated by reference in its
entirety. As another non-limiting example, Table 1 is a listing of
carboxy-terminal peptides which may be used in the present
invention.
TABLE-US-00001 TABLE 1 Carboxy-Terminal Peptides Identifier
Sequence SEQ ID NO CTP-001 SSSSKAPPPSLPSPSRLPGPSDTPI 1 LPQ CTP-002
SSSSKAPPPSLP 2 CTP-003 DPRFQDSSSSKAPPPSLPSPSRLPGP 3 SDTPILQ
[0045] In one embodiment, the encoded carboxy-terminal peptide may
differ from the native carboxy-terminal peptide by 1, 2, 3, 4, 5 or
more radical amino acid substitutions.
[0046] In one embodiment, the encoded carboxy-terminal peptide may
have 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to
the native carboxy-terminal peptide.
[0047] In one embodiment, a cell, tissue and/or organism may be
contacted with the polynucleotide, primary construct and/or mmRNA
comprising at least one nucleic acid sequence encoding at least one
carboxy-terminal peptide in order to produce a polypeptide of
interest the cell, tissue and/or organism. In another embodiment, a
cell, tissue and/or organism may be contacted with the
polynucleotide, primary construct or mmRNA in order to increase the
level of a polypeptide of interest in the cell, tissue and/or
organism.
[0048] In one embodiment, the carboxy-terminal peptide may be
glycosylated.
[0049] In another embodiment, the carboxy-terminal peptide may be
truncated.
[0050] In one embodiment, a polynucleotide, primary construct
and/or mmRNA may comprise carboxy-terminal peptide derived from
chorionic gonadotrophin. As a non-limiting example, the
polynucleotide, primary construct and/or mmRNA may encode a
polypeptide comprising at least one carboxy-terminal peptide of
chorionic gonadotrophin as described in US Patent Publication No.
US20130243747 or U.S. Pat. No. 8,476,234, the contents of each of
which are herein incorporated by reference in their entirety. As
another non-limiting example, the polynucleotide, primary construct
and/or mmRNA may encode a carboxy-terminal peptide having an amino
acid sequence such as SEQ ID NO: 1 and SEQ ID NO: 2 described in US
Patent Publication No. US20130243747, the contents of which are
herein incorporated by reference in its entirety. As another
non-limiting example, the polynucleotide, primary construct and/or
mmRNA may encode a carboxy-terminal peptide having an amino acid
sequence such as SEQ ID NO: 1 and SEQ ID NO: 2 described in U.S.
Pat. No. 8,476,234, the contents of which are herein incorporated
by reference in its entirety.
[0051] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA may encode a polypeptide comprising at least one
carboxy-terminal peptide of chorionic gonadotrophin as described in
US Patent Publication No. US20130243747, the contents of which are
herein incorporated by reference in its entirety, where the
carboxy-terminal peptide is attached to the carboxy terminus but
not to the amino terminus of a polypeptide. As another non-limiting
example, the polynucleotides, primary constructs and/or mmRNA
encoding a polypeptide comprising at least one carboxy-terminal
peptide of chorionic gonadotrophin may be made by the methods
described in US Patent Publication No. US20130243747 and U.S. Pat.
No. 8,476,234, the contents of each of which are herein
incorporated by reference in their entirety.
[0052] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA may encode a polypeptide comprising at least two
carboxy-terminal peptides (CTP) of chorionic gonadotrophin. As a
non-limiting example, the carboxy-terminal peptides of chorionic
gonadotrophin may be those described in US Patent Publication No.
US20130184207, the contents of which are herein incorporated by
reference in its entirety. As another non-limiting example, the
carboxy-terminal peptides of chorionic gonadotrophin may comprise
the amino acid sequence SEQ ID NO: 17 or the amino acid sequence
SEQ ID NO: 18 described in US Patent Publication No. US20130184207,
the contents of which are herein incorporated by reference in its
entirety.
[0053] In one embodiment, a polynucleotide, primary construct
and/or mmRNA may encode a binding domain which is capable of
binding to serum albumin which may increase the half-life of the
polypeptide. As a non-limiting example, the polynucleotides,
primary constructs and/or mmRNA may encode a polypeptide comprising
a binding domain which is capable of binding to serum albumin as
described in PCT Application No. WO2013128027, the contents of
which are herein incorporated by reference in its entirety. In
another non-limiting example, the polynucleotides, primary
constructs and/or mmRNA may encode a polypeptide comprising a
binding domain which is capable of binding to serum albumin. The
binding domain capable of binding to serum albumin may be attached
to the carboxy terminus but not to the amino terminus of a
polypeptide, such as the binding domain described in PCT
Application No. WO2013128027, the contents of which are herein
incorporated by reference in its entirety. As another non-limiting
example, the binding domain of serum albumin is derived from a
combinatorial library or an antibody binding domain, as described
in PCT Application WO2013128027, the contents of which are herein
incorporated by reference in its entirety.
[0054] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA may encode a polypeptide comprising a binding domain
which is capable of binding to serum albumin, wherein the binding
domain comprises between 10 and 25 amino acid residues as described
in PCT Application No. WO2013128027, the contents of which are
herein incorporated by reference in its entirety. In another
embodiment, the polynucleotides, primary constructs and/or mmRNA
may encode a polypeptide comprising a binding domain which is
capable of binding to serum albumin wherein the binding domain
capable of binding to serum albumin comprises the amino acid
sequence Asp-Xaa-Cys-Leu-Pro-Xaa-Trp-Gly-Cys-Leu-Trp, wherein Xaa
is any amino acid, as described in PCT Application No.
WO2013128027, the contents of which are herein incorporated by
reference in its entirety.
[0055] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA may encode a polypeptide comprising a binding domain
which is capable of binding to serum albumin, wherein the binding
domain capable of binding to serum albumin is derived from a CDR of
a single domain antibody, as described in PCT Application No.
WO2013128027, the contents of which are herein incorporated by
reference in its entirety. As a non limiting example, the
polynucleotides, primary constructs and/or mmRNA may encode a
polypeptide comprising a binding domain which is capable of binding
to serum albumin, wherein the binding domain is binding to serum
albumin with an affinity (KD) of <500 nM, as described in PCT
Application No. WO2013128027, the contents of which are herein
incorporated by reference in its entirety. As another non limiting
example, the polynucleotides, primary constructs and/or mmRNA may
encode a binding domain which is capable of binding to serum
albumin having an amino acid sequence such as in SEQ ID NOs: 51,
52, 54, 55, 57, 58, 60, 61, 75, 76, 81, 82, 85, 86, 90, 91, 85, 96,
100 or 101 described in PCT Application No. WO2013128027, the
contents of which are herein incorporated by reference in its
entirety.
[0056] In one embodiment, a polynucleotide, primary construct
and/or mmRNA may comprise a carboxy-terminal peptide derived from
albumin to stabilize the polypeptide. In one embodiment, the
polynucleotides, primary constructs and/or mmRNA may encode a
polypeptide comprising albumin, albumin fusion proteins or a
fragment or variant of albumin that is sufficient to stabilize
and/or prolong the activity of the polypeptide. As a non-limiting
example, the polynucleotides, primary constructs and/or mmRNA may
encode a polypeptide comprising albumin, albumin fusion proteins or
a fragment or variant of albumin as described in US Patent
Publication No. US20130266553, the contents of which are herein
incorporated by reference in its entirety. As another non-limiting
example, the polynucleotides, primary constructs and/or mmRNA may
encode a polypeptide derived from serum albumin comprising an amino
acid sequence which is at least 95% identical SEQ ID NO:18 or
comprising amino acids 1 to 585 of SEQ ID NO:18 or comprising and
amino acids 1 to 387 of SEQ ID NO:18 as described in US Patent
Publication No. US20130266553, the contents of which are herein
incorporated by reference in its entirety. As another non-limiting
example, the polynucleotides, primary constructs and/or mmRNA may
encode a polypeptide comprising serum albumin or a fragment or
variant of albumin which has been made by the methods described in
US Patent Publication No. US20130243747, the contents of which are
herein incorporated by reference in its entirety.
[0057] In one embodiment, polynucleotides, primary constructs
and/or mmRNA may encode a polypeptide comprising an Fc domain, a
CTP domain, Fc-CTP domain, or a combination thereof to increase
half-life of the polypeptide. As a non-limiting example, the
polynucleotides, primary constructs and/or mmRNA may encode a
polypeptide comprising at least one carboxy-terminal or N-terminal
peptide domain (e.g., Fc, CTP or Fc-CTP) as described in PCT Patent
Publication No. WO2013152351, the contents of which are herein
incorporated by reference in its entirety. As a non-limiting
examples, the polynucleotides, primary constructs and/or mmRNA may
encode a polypeptide comprising an Fc domain which is about 95%
identical to SEQ ID NO: 1, described in PCT Patent Publication No.
WO2013152351, the contents of which are herein incorporated by
reference in its entirety. As another non-limiting example, the
polynucleotides, primary constructs and/or mmRNA may encode a
polypeptide comprising a CTP domain which is about 95% identical to
SEQ ID NO: 3, described in PCT Patent Publication No. WO2013152351,
the contents of which are herein incorporated by reference in its
entirety. As another non-limiting example, the polynucleotides,
primary constructs and/or mmRNA may encode a polypeptide comprising
a Fc-CTP domain which is about 95% identical to SEQ ID NO: 1,
described in PCT Patent Publication No. WO2013152351, the contents
of which are herein incorporated by reference in its entirety.
[0058] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA may encode a polypeptide comprising a CTP domain, Fc
domain, Fc-CTP domain, or combination thereof fused to the
C-terminus or the N terminus or both the N and the C terminus of a
polypeptide such as the polypeptides described in PCT Patent
Publication No. WO2013152351, the contents of which are herein
incorporated by reference in its entirety.
[0059] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA encoded a polypeptide of interest and encode at least
one albumin sequence. In another embodiment, the polynucleotides,
primary constructs and/or mmRNA encoded a polypeptide of interest
and encode at least one IgG4 sequence.
[0060] In one embodiment, the half-life of a polynucleotide in a
cell, tissue and/or organism is increased by providing the cell,
tissue and/or organism with a polynucleotide, primary construct
and/or mmRNA comprising at least one nucleic acid sequence encoding
at least one albumin sequence and/or at least one IgG4 sequence. In
one embodiment, the at least one albumin sequence and/or at least
one IgG4 sequence may be attached to the carboxy terminus of a
polypeptide of interest. In another embodiment, the at least one
albumin sequence and/or at least one IgG4 sequence may be attached
to the amino terminus of the polypeptide of interest.
[0061] In one embodiment, the polynucleotide, primary construct
and/or mmRNA may comprise at least one nucleic acid sequence
encoding at least one albumin sequence and/or at least one IgG4
sequence located on the 5' end of the flanking region, after the 5'
terminal cap, in the 5'UTR, before the first operational region,
after the first operational region, within the flanking region,
after the first operational region, prior to the signal sequence
region, after the signal sequence region, before the first region
of linked nucleosides, after the first region of linked
nucleosides, within the first region of linked nucleosides, before
the second operational region, after the second operational region,
before the stop codon, after the stop codon, before the second
operational region, after the second operational region, before the
second flanking region, after the second flanking region, within
the second flanking region, within the 3'UTR, before the 3' tailing
sequence, after the 3' tailing sequence, within the 3' tailing
sequence and combination thereof. As a non-limiting example, the
albumin sequence is located in the 3'UTR. As another non-limiting
example, the IgG4 sequence is located in the 3'UTR.
[0062] In one embodiment, a cell, tissue and/or organism may be
contacted with the polynucleotide, primary construct and/or mmRNA
comprising at least one nucleic acid sequence encoding at least one
carboxy-terminal peptide in order to maintain the level of a
polypeptide of interest in the cell, tissue and/or organism.
[0063] In one embodiment, the present invention provides a method
for reducing the frequency of dosing of a cell, tissue and/or
organism in order to produce the polypeptide of interest. The
method may comprise contacting the cell, tissue and/or organism
with a polynucleotide, primary construct and/or mmRNA comprising at
least one nucleic acid sequence encoding at least one
carboxy-terminal peptide.
[0064] In one embodiment, the present invention provides a method
for protecting polynucleotides, primary constructs and/or mmRNA
against degradation. The method may comprise the addition of at
least one nucleic acid sequence encoding at least one
carboxy-terminal peptide in the polynucleotide, primary construct
and/or mmRNA.
[0065] In one embodiment, the present invention provides a method
for extending circulatory half-life of polynucleotides, primary
constructs and/or mmRNA. The method may comprise the addition of at
least one nucleic acid sequence encoding at least one
carboxy-terminal peptide in the polynucleotide, primary construct
and/or mmRNA.
[0066] In one embodiment, the present invention provides a method
for enhancing the potency of polynucleotides, primary constructs
and/or mmRNA. The method may comprise the addition of at least one
nucleic acid sequence encoding at least one carboxy-terminal
peptide in the polynucleotide, primary construct and/or mmRNA.
[0067] In one embodiment, the carboxy-terminal peptide encoded by
the nucleic acid sequence is a full-length carboxy-terminal
peptide. In another embodiment, the carboxy-terminal peptide
encoded by the nucleic acid sequence is a truncated
carboxy-terminal peptide.
[0068] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA comprise at least one nucleic acid sequence encoding
at least one carboxy-terminal peptide before the coding region of
the polypeptide of interest. In another embodiment, the
polynucleotides, primary constructs and/or mmRNA comprise at least
one nucleic acid sequence encoding at least one carboxy-terminal
peptide after the coding region of the polypeptide of interest.
[0069] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA comprise at least one nucleic acid sequence encoding
at least one carboxy-terminal peptide before the coding region of
the polypeptide of interest and at least one nucleic acid sequence
encoding at least one carboxy-terminal peptide after the coding
region of the polypeptide of interest. In another embodiment, the
polynucleotide, primary constructs and/or mmRNA comprise one
nucleic acid sequence encoding a carboxy-terminal peptide before
the coding region of the polypeptide of interest and two nucleic
acid sequences encoding at least one carboxy-terminal peptide after
the coding region of the polypeptide of interest.
[0070] In one embodiment, the nucleic acid sequences may encode the
same and/or different carboxy-terminal peptides. As a non-limiting
example, the nucleic acid sequence encoding the carboxy-terminal
peptide before the coding region of the polypeptide of interest may
encode the same carboxy-terminal peptide as one of the nucleic acid
sequences after the coding region of the polypeptide of
interest.
[0071] In another embodiment, the nucleic acid sequences may be
different and encode the same carboxy-terminal peptide. As a
non-limiting example, the nucleic acid sequence encoding the
carboxy-terminal peptide before the coding region of the
polypeptide of interest may encode the same carboxy-terminal
peptide as one of the nucleic acid sequences after the coding
region of the polypeptide of interest, but the two nucleic acid
sequences may have 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than
100% sequence identity.
[0072] In one embodiment, the polynucleotides, primary constructs
and mmRNA of the present invention have an altered property such
as, but not limited to, increased circulating half-life, increased
plasma residence time, decreased clearance and increased clinical
activity in a cell, tissue and/or organism.
[0073] In one embodiment, the polynucleotides, primary constructs
and mmRNA of the present invention have an altered property such
as, but not limited to, improved potency, improved stability,
elevated AUC levels and enhanced circulating half-life.
[0074] In one embodiment, the polynucleotides, primary constructs
and mmRNA may comprise at least one nucleic acid sequence encoding
a carboxy-terminal peptide which causes the polynucleotides,
primary constructs and mmRNA to be poorly vascularized. As a
non-limiting example, when a carboxy-terminal peptide is added to a
follicle stimulating hormone (FSH) the resulting ovarian follicles
appear to be poorly vascularized. If this effect is undesired a
polynucleotide, primary construct or mmRNA encoding a helper
molecule may be administered with the poorly vascularized
polynucleotides, primary constructs and mmRNA comprising at least
one nucleic acid sequence encoding a carboxy-terminal peptide. The
helper molecule may be, but is not limited to, vascular endothelial
growth factor (VEGF).
[0075] In one aspect, the helper molecule may be administered
concurrently with the poorly vascularized polynucleotide, primary
construct or mmRNA. The concurrent administration may be from, but
is not limited to, contacting a cell, tissue or organism with a
formulation comprising both the help molecule and the poorly
vascularized polynucleotide, primary construct or mmRNA or from
contacting a cell, tissue or organism with two separate
formulations of the helper molecule and the poorly vascularized
polynucleotides, primary constructs or mmRNA.
[0076] In another aspect, the helper molecule and the poorly
vascularized polynucleotide, primary construct or mmRNA may be
administered to a cell, tissue or organism on the same
polynucleotide, primary construct or mmRNA by using a bi-cistronic
or multi-cistronic polynucleotide, primary construct or mmRNA. As a
non-limiting example, the bi-cistronic polynucleotide, primary
construct or mmRNA may comprise a nucleic acid sequence encoding a
follicle stimulating hormone and a carboxy-terminal peptide and
also a nucleic acid sequence encoding VEGF. The two sequences may
be, for example, separated by an IRES sequence, a protein cleavage
site and/or a 2A peptide.
[0077] Carboxy-terminal peptides or C-terminal peptides useful in
the present invention include those disclosed in Japanese and/or
Chinese patents JP04699991B2, JP04763616B2, JP04871124B2,
JP04897814B2, JP04933439B2, JP03946638B2, JP04741086B2,
JP03868740B2, CN102656182A, JP04718459B2, CN102639144A,
JP03045539B2, JP04081137B2, JP04156024B2, JP04255618B2, and
JP04334615B2, each of which is herein incorporated by reference in
its entirety.
[0078] Proteins and or polypeptides having CTP moieties, and the
specific CTP moieties which may be encoded by the polynucleotides,
primary constructs or mmRNA of the present invention include those
disclosed in, for example, Canadian patent or patent applications:
CA2053864C, CA2118320A1, CA2120358C, CA2132868C, CA2160800A1,
CA2160800C, CA2173750A1, CA2173750C, CA2208420A1, CA2208420C,
CA2231348A1, CA2302647A1, CA2308571A1, CA2310713A1, CA2321677A1,
CA2347062A1, CA2361840A1, CA2372582A1, CA2394572C, CA2400908A1,
CA2400908C, CA2457067A1, CA2457849A1, CA2457851A1, CA2485365A1,
CA2517487A1, CA2518903A1, CA2526099A1, CA2544333A1, CA2579131A1,
CA2585507A1, CA2612613A1, CA2639115A1, CA2641342A1, CA2673222A1,
CA2685437A1, CA2700662A1, CA2707352A1, CA2713386A1, CA2725551A1,
CA2730996A1, CA2755927A1, CA2767503A1 and CA2781132A1; German
patent or patent applications: DE10235248A1, DE60117919T2,
DE69029799T2 and DE69328831T2; European patent or patent
applications: EP1012290A1, EP1032688A1, EP1032688B1, EP1054018A1,
EP1054018B1, EP1064382B1, EP1087985A1, EP1113814A1, EP1123315A1,
EP1263948A2, EP1276765A2, EP1276765B1, EP1285665A1, EP1316561A1,
EP1316561B1, EP1319712A2, EP1319712B1, EP1342730A1, EP1342730B1,
EP1425032A2, EP1425033A2, EP1425033B1, EP1434600A2, EP1434600B1,
EP1490386A2, EP1610822A1, EP1610822B1, EP1624893A2, EP1638595A1,
EP1673105A1, EP1673105B1, EP1697412A1, EP1697412B1, EP1802645A2,
EP1809663A1, EP1809663B1, EP1951395A1, EP1951395B1, EP1991578A2,
EP2001903A2, EP2016951A1, EP2016951B1, EP204566B1, EP2050762A2,
EP2067788A2, EP2099913A1, EP2099913B1, EP2134165A2, EP2134165B1,
EP2164508A2, EP2219607A1, EP2219607B1, EP2244717A1, EP224574A1,
EP2249869A1, EP2249869B1, EP2313431A2, EP2325194A1, EP2364162A2,
EP2412385A1, EP2414380A2, EP2451473A2, EP2471807A1, EP2504350A1,
EP2532674A1, EP2532675A1, EP329699A1, EP461200A1, EP461200B1,
EP607297A1, EP607297B1, EP636171A1, EP636171B1, EP644774A1,
EP692259A2, EP695307A1, EP695307B1, EP725795A1, EP725795B1,
EP793675A1, EP853945A1, EP853945B1 and EP882234A1; Korean patent or
patent applications: KR1105486B1, KR1160985B1, KR1173717B1,
KR2002046150A, KR2003044272A, KR2003045341A, KR2005110037A,
KR2006135656A, KR2007083618A, KR2008043301A, KR2008093148A,
KR2010088147A, KR2010123697A, KR2011049797A, KR2012013359A,
KR2012089445A, KR2012089755A, KR515855B1, KR515856B1, KR515857B1,
KR515858B1, KR515859B1 and KR558087B1; Mexican patent or patent
applications: MX2002008454A, MX2002PA008454A and MX2012000469A;
United States patent applications: US20010007757A1,
US20020102613A1, US20020160944A1, US20020162128A1, US20020169284A1,
US20020192706A1, US20030004102A1, US20030045462A1, US20030049633A1,
US20030049684A1, US20030050240A1, US20030050241A1, US20030054405A1,
US20030054986A1, US20030055216A1, US20030060406A1, US20030064407A1,
US20030068648A1, US20030069178A1, US20030072745A1, US20030073131A1,
US20030073624A1, US20030077700A1, US20030096744A1, US20030104536A1,
US20030104998A1, US20030113870A1, US20030113871A1, US20030124115A1,
US20030130181A1, US20030134785A1, US20030138439A1, US20030139328A1,
US20030143694A1, US20030144189A1, US20030147901A1, US20030148373A1,
US20030148376A1, US20030157615A1, US20030170254A1, US20030180310A1,
US20030180311A1, US20030180867A1, US20030185841A1, US20030186365A1,
US20030186368A1, US20030187241A1, US20030190321A1, US20030190701A1,
US20030190703A1, US20030194410A1, US20030194744A1, US20030194780A1,
US20030194781A1, US20030195148A1, US20030195333A1, US20030195344A1,
US20030195345A1, US20030198994A1, US20030199021A1, US20030199435A1,
US20030199436A1, US20030199437A1, US20030199674A1, US20030203402A1,
US20030203433A1, US20030203434A1, US20030203435A1, US20030203436A1,
US20030203441A1, US20030203442A1, US20030203443A1, US20030203444A1,
US20030203445A1, US20030203446A1, US20030204055A1, US20030206915A1,
US20030207803A1, US20030211091A1, US20030211092A1, US20030211580A1,
US20030215905A1, US20030215908A1, US20030216305A1, US20030216313A1,
US20030216560A1, US20030216561A1, US20040005312A1, US20040005657A1,
US20040006219A1, US20040009902A1, US20040029218A1, US20040048332A1,
US20040052820A1, US20040063921A1, US20040219640A1, US20040220088A1,
US20040223964A1, US20040235740A1, US20040259792A1, US20050014226A1,
US20050020489A1, US20050037463A1, US20050049199A1, US20050065069A1,
US20050079577A1, US20050084935A1, US20050124789A9, US20050227328A1,
US20050227342A1, US20050256035A1, US20060073571A1, US20060078964A1,
US20060147480A1, US20060229288A1, US20070031929A1, US20070037742A1,
US20070059252A1, US20070129295A1, US20070184530A1, US20070190610A1,
US20070190611A1, US20080070832A1, US20080095773A1, US20080108514A1,
US20080139466A1, US20080182275A1, US20080190179A1, US20080213889A1,
US20080234186A1, US20080299119A1, US20080312151A1, US20090012003A1,
US20090087411A1, US20090093411A1, US20090209453A1, US20090221037A1,
US20090264370A9, US20090270489A1, US20090275084A1, US20090286733A1,
US20090312254A1, US20100081614A1, US20100120677A1, US20100136012A1,
US20100196406A1, US20100203136A1, US20100227805A1, US20100261649A1,
US20100317585A1, US20100331251A1, US20110044945A1, US20110054410A1,
US20110070218A1, US20110151489A1, US20110189202A1, US20110286967A1,
US20110319327A1, US20120004286A1, US20120015437A1, US20120021984A1,
US20120035101A1, US20120135928A1, US20120208759A1 and
US20120252069A1; United States Patents: U.S. Pat. No. 4,780,312A,
U.S. Pat. No. 4,804,626A, U.S. Pat. No. 4,933,275A, U.S. Pat. No.
5,177,193A, U.S. Pat. No. 5,338,835A, U.S. Pat. No. 5,405,945A,
U.S. Pat. No. 5,585,345A, U.S. Pat. No. 5,705,478A, U.S. Pat. No.
5,712,122A, U.S. Pat. No. 5,733,735A, U.S. Pat. No. 5,759,818A,
U.S. Pat. No. 5,792,460A, U.S. Pat. No. 5,883,073A, U.S. Pat. No.
5,929,028A, U.S. Pat. No. 5,958,737A, U.S. Pat. No. 5,985,611A,
U.S. Pat. No. 6,028,177A, U.S. Pat. No. 6,103,501A, U.S. Pat. No.
6,225,449B1, U.S. Pat. No. 6,228,983B1, U.S. Pat. No. 6,238,890B1,
U.S. Pat. No. 6,242,580B1, U.S. Pat. No. 6,306,654B1, U.S. Pat. No.
6,455,283B1, U.S. Pat. No. 6,479,055B1, U.S. Pat. No. 6,518,013B1,
U.S. Pat. No. 6,620,784B1, U.S. Pat. No. 6,635,256B1, U.S. Pat. No.
6,689,365B1, U.S. Pat. No. 6,693,074B1, U.S. Pat. No. 6,737,515B2,
U.S. Pat. No. 6,824,783B1, U.S. Pat. No. 6,916,648B2, U.S. Pat. No.
6,951,717B1, U.S. Pat. No. 6,962,797B2, U.S. Pat. No. 6,972,325B2,
U.S. Pat. No. 6,974,696B2, U.S. Pat. No. 6,987,172B2, U.S. Pat. No.
7,019,115B2, U.S. Pat. No. 7,019,124B2, U.S. Pat. No. 7,029,874B2,
U.S. Pat. No. 7,037,710B2, U.S. Pat. No. 7,067,628B2, U.S. Pat. No.
7,067,636B2, U.S. Pat. No. 7,074,593B2, U.S. Pat. No. 7,081,446B2,
U.S. Pat. No. 7,081,521B2, U.S. Pat. No. 7,091,326B2, U.S. Pat. No.
7,098,318B2, U.S. Pat. No. 7,105,640B2, U.S. Pat. No. 7,112,657B2,
U.S. Pat. No. 7,122,190B2, U.S. Pat. No. 7,122,375B2, U.S. Pat. No.
7,125,969B1, U.S. Pat. No. 7,132,283B2, U.S. Pat. No. 7,153,824B2,
U.S. Pat. No. 7,166,700B2, U.S. Pat. No. 7,169,912B2, U.S. Pat. No.
7,173,113B2, U.S. Pat. No. 7,189,529B2, U.S. Pat. No. 7,193,050B2,
U.S. Pat. No. 7,195,760B2, U.S. Pat. No. 7,196,165B2, U.S. Pat. No.
7,196,176B2, U.S. Pat. No. 7,202,215B2, U.S. Pat. No. 7,202,338B2,
U.S. Pat. No. 7,208,575B2, U.S. Pat. No. 7,214,656B2, U.S. Pat. No.
7,220,835B2, U.S. Pat. No. 7,279,553B2, U.S. Pat. No. 7,285,623B2,
U.S. Pat. No. 7,294,700B2, U.S. Pat. No. 7,341,989B2, U.S. Pat. No.
7,371,377B2, U.S. Pat. No. 7,371,836B2, U.S. Pat. No. 7,402,558B2,
U.S. Pat. No. 7,405,197B2, U.S. Pat. No. 7,442,376B2, U.S. Pat. No.
7,442,684B2, U.S. Pat. No. 7,488,594B2, U.S. Pat. No. 7,488,795B2,
U.S. Pat. No. 7,494,977B2, U.S. Pat. No. 7,514,397B1, U.S. Pat. No.
7,553,940B2, U.S. Pat. No. 7,553,941B2, U.S. Pat. No. 7,563,612B2,
U.S. Pat. No. 7,575,879B2, U.S. Pat. No. 7,649,084B2, U.S. Pat. No.
7,723,488B2, U.S. Pat. No. 7,740,884B2, U.S. Pat. No. 7,741,268B2,
U.S. Pat. No. 7,741,455B2, U.S. Pat. No. 7,754,860B2, U.S. Pat. No.
7,807,620B2, U.S. Pat. No. 7,866,203B2, U.S. Pat. No. 8,008,454B2,
U.S. Pat. No. 8,048,848B2, U.S. Pat. No. 8,048,849B2, U.S. Pat. No.
8,097,435B2, U.S. Pat. No. 8,110,376B2, U.S. Pat. No. 8,114,836B2,
U.S. Pat. No. 8,211,852B2, U.S. Pat. No. 8,263,064B2, U.S. Pat. No.
8,304,386B2, U.S. Pat. No. 8,323,636B2 and U.S. Pat. No.
8,426,166B2; and International Patent Publications: WO1986007383A1,
WO1988003174A1, WO1990009800A1, WO1993006844A1, WO1993019167A1,
WO1993021947A1, WO1994024148A1, WO1996005224A1, WO1996019495A1,
WO1997047970A1, WO1998023782A2, WO1998043999A1, WO1999013081A1,
WO1999025375A2, WO1999025375A3, WO1999025375A8, WO1999025849A1,
WO1999046281A2, WO1999065929A1, WO2000015253A1, WO2000023473A1,
WO2000053756A2, WO2000070023A1, WO2001081406A2, WO2001084144A1,
WO2002048194A1, WO2003022301A2, WO2003022302A2, WO2003022303A2,
WO2003046013A1, WO2003048210A1, WO2003064619A2, WO2003064677A2,
WO2003094858A2, WO2004087211A2, WO2004087213A1, WO2004112826A1,
WO2005011726A1, WO2005047319A2, WO2005063811A1, WO2006036877A2,
WO2006051070A1, WO2006113452A2, WO2007031566A1, WO2007092252A2,
WO2007092252A3, WO2007094005A2, WO2007094985A2, WO2007094985A3,
WO2007131017A2, WO2008075363A1, WO2008096359A2, WO2008098169A2,
WO2008146272A2, WO2008149354A2, WO2009056569A1, WO2009056569A9,
WO2009073574A1, WO2009098318A1, WO2009144699A1, WO2009153783A1,
WO2010007622A2, WO2010035259A2, WO2010103517A1, WO2010115586A2,
WO2011004361A2, WO2011004361A3, WO2011063943A1, WO2011109784A1,
WO2011109787A1, WO2011122922A2, WO2011138785A2, WO2012117330A1,
WO2012131680A2, WO2012131680A9 and WO2013018098, each of which is
herein incorporated by reference in its entirety.
[0079] CTPs may range from 2-200 amino acids and may therefore be
encoded by polynucleotides, primary constructs or mmRNA ranging
from 6-600 nucleotides.
[0080] The term "nucleic acid," in its broadest sense, includes any
compound and/or substance that comprise a polymer of nucleotides.
These polymers are often referred to as polynucleotides. Exemplary
nucleic acids or polynucleotides of the invention include, but are
not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids
(DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs),
peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including
LNA having a .beta.-D-ribo configuration, .alpha.-LNA having an
.alpha.-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA
having a 2'-amino functionalization, and 2'-amino-.alpha.-LNA
having a 2'-amino functionalization) or hybrids thereof.
[0081] In preferred embodiments, the polynucleotide or nucleic acid
molecule is a messenger RNA (mRNA). As used herein, the term
"messenger RNA" (mRNA) refers to any polynucleotide which encodes a
polypeptide of interest and which is capable of being translated to
produce the encoded polypeptide of interest in vitro, in vivo, in
situ or ex vivo. Polynucleotides of the invention may be mRNA or
any nucleic acid molecule and may or may not be chemically
modified.
[0082] Traditionally, the basic components of an mRNA molecule
include at least a coding region, a 5'UTR, a 3'UTR, a 5' cap and a
poly-A tail. Building on this wild type modular structure, the
present invention expands the scope of functionality of traditional
mRNA molecules by providing polynucleotides or primary RNA
constructs which maintain a modular organization, but which
comprise one or more structural and/or chemical modifications or
alterations which impart useful properties to the polynucleotide
including, in some embodiments, the lack of a substantial induction
of the innate immune response of a cell into which the
polynucleotide is introduced. As such, modified mRNA molecules of
the present invention are termed "mmRNA." As used herein, a
"structural" feature or modification is one in which two or more
linked nucleotides are inserted, deleted, duplicated, inverted or
randomized in a polynucleotide, primary construct or mmRNA without
significant chemical modification to the nucleotides themselves.
Because chemical bonds will necessarily be broken and reformed to
effect a structural modification, structural modifications are of a
chemical nature and hence are chemical modifications. However,
structural modifications will result in a different sequence of
nucleotides. For example, the polynucleotide "ATCG" may be
chemically modified to "AT-5meC-G". The same polynucleotide may be
structurally modified from "ATCG" to "ATCCCG". Here, the
dinucleotide "CC" has been inserted, resulting in a structural
modification to the polynucleotide.
Polynucleotide, Primary Construct or mmRNA Architecture
[0083] The polynucleotides of the present invention are
distinguished from wild type mRNA in their functional and/or
structural design features which serve to, as evidenced herein,
overcome existing problems of effective polypeptide production
using nucleic acid-based therapeutics.
[0084] FIG. 1 shows a representative primary construct 100 of the
present invention. As used herein, the term "primary construct" or
"primary mRNA construct" refers to a polynucleotide transcript
which encodes one or more polypeptides of interest and which
retains sufficient structural and/or chemical features to allow the
polypeptide of interest encoded therein to be translated. Primary
constructs may be polynucleotides of the invention. When
structurally or chemically modified, the primary construct may be
referred to as a mmRNA.
[0085] Returning to FIG. 1, the primary construct 100 here contains
a first region of linked nucleotides 102 that is flanked by a first
flanking region 104 and a second flaking region 106. As used
herein, the "first region" may be referred to as a "coding region"
or "region encoding" or simply the "first region." This first
region may include, but is not limited to, the encoded polypeptide
of interest. The polypeptide of interest may comprise at its 5'
terminus one or more signal peptide sequences encoded by a signal
peptide sequence region 103. The flanking region 104 may comprise a
region of linked nucleotides comprising one or more complete or
incomplete 5' UTRs sequences. The flanking region 104 may also
comprise a 5' terminal cap 108. The second flanking region 106 may
comprise a region of linked nucleotides comprising one or more
complete or incomplete 3' UTRs. The flanking region 106 may also
comprise a 3' tailing sequence 110 and a 3'UTR 120.
[0086] Bridging the 5' terminus of the first region 102 and the
first flanking region 104 is a first operational region 105.
Traditionally this operational region comprises a start codon. The
operational region may alternatively comprise any translation
initiation sequence or signal including a start codon.
[0087] Bridging the 3' terminus of the first region 102 and the
second flanking region 106 is a second operational region 107.
Traditionally this operational region comprises a stop codon. The
operational region may alternatively comprise any translation
initiation sequence or signal including a stop codon. According to
the present invention, multiple serial stop codons may also be
used. In one embodiment, the operation region of the present
invention may comprise two stop codons. The first stop codon may be
"TGA" and the second stop codon may be selected from the group
consisting of "TAA," "TGA" and "TAG."
[0088] Turning to FIG. 2, the 3'UTR 120 of the second flanking
region 106 may comprise one or more sensor sequences 130. These
sensor sequences as discussed herein operate as pseudo-receptors
(or binding sites) for ligands of the local microenvironment of the
primary construct or polynucleotide. For example, microRNA binding
sites or miRNA seeds may be used as sensors such that they function
as pseudoreceptors for any microRNAs present in the environment of
the polynucleotide.
[0089] As shown in FIG. 3, FIG. 4, FIG. 5 and FIG. 6, the primary
construct 100 may comprise at least one longevity enhancing
sequence 140, such as, but not limited to, a carboxy-terminal
peptide sequence, an albumin sequence or an IgG4 sequence may be
located in the flanking region 104 such as, but not limited to, the
5'UTR as shown in FIG. 3, the 3'UTR 120 as shown in FIG. 4, the
first region of linked nucleosides 102, both the flanking region
104 and 3'UTR 120 as shown in FIG. 5, or in the flanking region
104, the first region of linked nucleosides 102 and the 3'UTR 120
as shown in FIG. 6. For example, the primary construct 100 may
include at least 1, at least 2, at least 3, at least 4, at least 5,
at least 6, at least 7, at least 8, at least 9, at least 10 or more
than 10 longevity enhancing sequences 140.
[0090] Generally, the shortest length of the first region of the
primary construct of the present invention can be the length of a
nucleic acid sequence that is sufficient to encode for a dipeptide,
a tripeptide, a tetrapeptide, a pentapeptide, a hexapeptide, a
heptapeptide, an octapeptide, a nonapeptide, or a decapeptide. In
another embodiment, the length may be sufficient to encode a
peptide of 2-30 amino acids, e.g. 5-30, 10-30, 2-25, 5-25, 10-25,
or 10-20 amino acids. The length may be sufficient to encode for a
peptide of at least 11, 12, 13, 14, 15, 17, 20, 25 or 30 amino
acids, or a peptide that is no longer than 40 amino acids, e.g. no
longer than 35, 30, 25, 20, 17, 15, 14, 13, 12, 11 or 10 amino
acids. Examples of dipeptides that the polynucleotide sequences can
encode or include, but are not limited to, carnosine and
anserine.
[0091] Generally, the length of the first region encoding the
polypeptide of interest of the present invention is greater than
about 30 nucleotides in length (e.g., at least or greater than
about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180,
200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000,
1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900,
2,000, 2,500, and 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000,
10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000,
90,000 or up to and including 100,000 nucleotides). As used herein,
the "first region" may be referred to as a "coding region" or
"region encoding" or simply the "first region."
[0092] In some embodiments, the polynucleotide, primary construct,
or mmRNA includes from about 30 to about 100,000 nucleotides (e.g.,
from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from
30 to 1,000, from 30 to 1,500, from 30 to 3,000, from 30 to 5,000,
from 30 to 7,000, from 30 to 10,000, from 30 to 25,000, from 30 to
50,000, from 30 to 70,000, from 100 to 250, from 100 to 500, from
100 to 1,000, from 100 to 1,500, from 100 to 3,000, from 100 to
5,000, from 100 to 7,000, from 100 to 10,000, from 100 to 25,000,
from 100 to 50,000, from 100 to 70,000, from 100 to 100,000, from
500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to
3,000, from 500 to 5,000, from 500 to 7,000, from 500 to 10,000,
from 500 to 25,000, from 500 to 50,000, from 500 to 70,000, from
500 to 100,000, from 1,000 to 1,500, from 1,000 to 2,000, from
1,000 to 3,000, from 1,000 to 5,000, from 1,000 to 7,000, from
1,000 to 10,000, from 1,000 to 25,000, from 1,000 to 50,000, from
1,000 to 70,000, from 1,000 to 100,000, from 1,500 to 3,000, from
1,500 to 5,000, from 1,500 to 7,000, from 1,500 to 10,000, from
1,500 to 25,000, from 1,500 to 50,000, from 1,500 to 70,000, from
1,500 to 100,000, from 2,000 to 3,000, from 2,000 to 5,000, from
2,000 to 7,000, from 2,000 to 10,000, from 2,000 to 25,000, from
2,000 to 50,000, from 2,000 to 70,000, and from 2,000 to
100,000).
[0093] According to the present invention, the first and second
flanking regions may range independently from 15-1,000 nucleotides
in length (e.g., greater than 30, 40, 45, 50, 55, 60, 70, 80, 90,
100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600,
700, 800, and 900 nucleotides or at least 30, 40, 45, 50, 55, 60,
70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450,
500, 600, 700, 800, 900, and 1,000 nucleotides).
[0094] According to the present invention, the tailing sequence may
range from absent to 500 nucleotides in length (e.g., at least 60,
70, 80, 90, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, or
500 nucleotides). Where the tailing region is a polyA tail, the
length may be determined in units of or as a function of polyA
binding protein binding. In this embodiment, the polyA tail is long
enough to bind at least 4 monomers of polyA binding protein. PolyA
binding protein monomers bind to stretches of approximately 38
nucleotides. As such, it has been observed that polyA tails of
about 80 nucleotides and 160 nucleotides are functional.
[0095] According to the present invention, the capping region may
comprise a single cap or a series of nucleotides forming the cap.
In this embodiment the capping region may be from 1 to 10, e.g.
2-9, 3-8, 4-7, 1-5, 5-10, or at least 2, or 10 or fewer nucleotides
in length. In some embodiments, the cap is absent.
[0096] According to the present invention, the first and second
operational regions may range from 3 to 40, e.g., 5-30, 10-20, 15,
or at least 4, or 30 or fewer nucleotides in length and may
comprise, in addition to a start and/or stop codon, one or more
signal and/or restriction sequences.
Cyclic Polynucleotides
[0097] According to the present invention, a primary construct or
mmRNA may be cyclized, or concatemerized, to generate a translation
competent molecule to assist interactions between poly-A binding
proteins and 5'-end binding proteins. The mechanism of cyclization
or concatemerization may occur through at least 3 different routes:
1) chemical, 2) enzymatic, and 3) ribozyme catalyzed. The newly
formed 5'-/3'-linkage may be intramolecular or intermolecular.
[0098] In the first route, the 5'-end and the 3'-end of the nucleic
acid may contain chemically reactive groups that, when close
together, form a new covalent linkage between the 5'-end and the
3'-end of the molecule. The 5'-end may contain an NHS-ester
reactive group and the 3'-end may contain a 3'-amino-terminated
nucleotide such that in an organic solvent the 3'-amino-terminated
nucleotide on the 3'-end of a synthetic mRNA molecule will undergo
a nucleophilic attack on the 5'-NHS-ester moiety forming a new
5'-/3'-amide bond.
[0099] In the second route, T4 RNA ligase may be used to
enzymatically link a 5'-phosphorylated nucleic acid molecule to the
3'-hydroxyl group of a nucleic acid forming a new phosphorodiester
linkage. In an example reaction, 1 .mu.g of a nucleic acid molecule
is incubated at 37.degree. C. for 1 hour with 1-10 units of T4 RNA
ligase (New England Biolabs, Ipswich, Mass.) according to the
manufacturer's protocol. The ligation reaction may occur in the
presence of a split oligonucleotide capable of base-pairing with
both the 5'- and 3'-region in juxtaposition to assist the enzymatic
ligation reaction.
[0100] In the third route, either the 5'- or 3'-end of the cDNA
template encodes a ligase ribozyme sequence such that during in
vitro transcription, the resultant nucleic acid molecule can
contain an active ribozyme sequence capable of ligating the 5'-end
of a nucleic acid molecule to the 3'-end of a nucleic acid
molecule. The ligase ribozyme may be derived from the Group I
Intron, Group I Intron, Hepatitis Delta Virus, Hairpin ribozyme or
may be selected by SELEX (systematic evolution of ligands by
exponential enrichment). The ribozyme ligase reaction may take 1 to
24 hours at temperatures between 0 and 37.degree. C.
mmRNA Multimers
[0101] According to the present invention, multiple distinct
polynucleotides, primary constructs or mmRNA may be linked together
through the 3'-end using nucleotides which are modified at the
3'-terminus. Chemical conjugation may be used to control the
stoichiometry of delivery into cells. For example, the glyoxylate
cycle enzymes, isocitrate lyase and malate synthase, may be
supplied into HepG2 cells at a 1:1 ratio to alter cellular fatty
acid metabolism. This ratio may be controlled by chemically linking
polynucleotides, primary constructs or mmRNA using a 3'-azido
terminated nucleotide on one polynucleotide, primary construct or
mmRNA species and a C5-ethynyl or alkynyl-containing nucleotide on
the opposite polynucleotide, primary construct or mmRNA species.
The modified nucleotide is added post-transcriptionally using
terminal transferase (New England Biolabs, Ipswich, Mass.)
according to the manufacturer's protocol. After the addition of the
3'-modified nucleotide, the two polynucleotide, primary construct
or mmRNA species may be combined in an aqueous solution, in the
presence or absence of copper, to form a new covalent linkage via a
click chemistry mechanism as described in the literature.
[0102] In another example, more than two polynucleotides may be
linked together using a functionalized linker molecule. For
example, a functionalized saccharide molecule may be chemically
modified to contain multiple chemical reactive groups (SH--,
NH.sub.2--, N.sub.3, etc. . . . ) to react with the cognate moiety
on a 3'-functionalized polynucleotide molecule (i.e., a
3'-maleimide ester, 3'-NHS-ester, alkynyl). The number of reactive
groups on the modified saccharide can be controlled in a
stoichiometric fashion to directly control the stoichiometric ratio
of conjugated polynucleotide, primary construct or mmRNA.
mmRNA Conjugates and Combinations
[0103] In order to further enhance protein production,
polynucleotide, primary constructs or mmRNA of the present
invention can be designed to be conjugated to other
polynucleotides, polypeptides, dyes, intercalating agents (e.g.
acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins
(TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons
(e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g.
EDTA), alkylating agents, phosphate, amino, mercapto, PEG (e.g.,
PEG-40K), MPEG, [MPEG].sub.2, polyamino, alkyl, substituted alkyl,
radiolabeled markers, enzymes, haptens (e.g. biotin),
transport/absorption facilitators (e.g., aspirin, vitamin E, folic
acid), synthetic ribonucleases, proteins, e.g., glycoproteins, or
peptides, e.g., molecules having a specific affinity for a
co-ligand, or antibodies e.g., an antibody, that binds to a
specified cell type such as a cancer cell, endothelial cell, or
bone cell, hormones and hormone receptors, non-peptidic species,
such as lipids, lectins, carbohydrates, vitamins, cofactors, or a
drug.
[0104] Conjugation may result in increased stability and/or
half-life and may be particularly useful in targeting the
polynucleotides, primary constructs or mmRNA to specific sites in
the cell, tissue or organism.
[0105] According to the present invention, the polynucleotide mmRNA
or primary constructs may be administered with, or further encode
one or more of RNAi agents, siRNAs, shRNAs, miRNAs, miRNA binding
sites, antisense RNAs, ribozymes, catalytic DNA, tRNA, RNAs that
induce triple helix formation, aptamers or vectors, and the
like.
Bifunctional mmRNA
[0106] In one embodiment of the invention are bifunctional
polynucleotides (e.g., bifunctional primary constructs or
bifunctional mmRNA). As the name implies, bifunctional
polynucleotides are those having or capable of at least two
functions. These molecules may also by convention be referred to as
multi-functional.
[0107] The multiple functionalities of bifunctional polynucleotides
may be encoded by the RNA (the function may not manifest until the
encoded product is translated) or may be a property of the
polynucleotide itself. It may be structural or chemical.
Bifunctional modified polynucleotides may comprise a function that
is covalently or electrostatically associated with the
polynucleotides. Further, the two functions may be provided in the
context of a complex of a polynucleotide and another molecule.
[0108] Bifunctional polynucleotides may encode peptides which are
anti-proliferative. These peptides may be linear, cyclic,
constrained or random coil. They may function as aptamers,
signaling molecules, ligands or mimics or mimetics thereof.
Anti-proliferative peptides may, as translated, be from 3 to 50
amino acids in length. They may be 5-40, 10-30, or approximately 15
amino acids long. They may be single chain, multichain or branched
and may form complexes, aggregates or any multi-unit structure once
translated.
Noncoding Polynucleotides
[0109] As described herein, provided are polynucleotides and
primary constructs having sequences that are partially or
substantially not translatable, e.g., having a noncoding region.
Such noncoding region may be the "first region" of the primary
construct. Alternatively, the noncoding region may be a region
other than the first region. Such molecules are generally not
translated, but can exert an effect on protein production by one or
more of binding to and sequestering one or more translational
machinery components such as a ribosomal protein or a transfer RNA
(tRNA), thereby effectively reducing protein expression in the cell
or modulating one or more pathways or cascades in a cell which in
turn alters protein levels. The polynucleotide and/or primary
construct may contain or encode one or more long noncoding RNA
(lncRNA, or lincRNA) or portion thereof, a small nucleolar RNA
(sno-RNA), micro RNA (miRNA), small interfering RNA (siRNA) or
Piwi-interacting RNA (piRNA).
Polypeptides of Interest
[0110] According to the present invention, the primary construct is
designed to encode one or more polypeptides of interest or
fragments thereof. A polypeptide of interest may include, but is
not limited to, whole polypeptides, a plurality of polypeptides or
fragments of polypeptides, which independently may be encoded by
one or more nucleic acids, a plurality of nucleic acids, fragments
of nucleic acids or variants of any of the aforementioned. As used
herein, the term "polypeptides of interest" refers to any
polypeptide which is selected to be encoded in the primary
construct of the present invention. As used herein, "polypeptide"
means a polymer of amino acid residues (natural or unnatural)
linked together most often by peptide bonds. The term, as used
herein, refers to proteins, polypeptides, and peptides of any size,
structure, or function. In some instances the polypeptide encoded
is smaller than about 50 amino acids and the polypeptide is then
termed a peptide. If the polypeptide is a peptide, it will be at
least about 2, 3, 4, or at least 5 amino acid residues long. Thus,
polypeptides include gene products, naturally occurring
polypeptides, synthetic polypeptides, homologs, orthologs,
paralogs, fragments and other equivalents, variants, and analogs of
the foregoing. A polypeptide may be a single molecule or may be a
multi-molecular complex such as a dimer, trimer or tetramer. They
may also comprise single chain or multichain polypeptides such as
antibodies or insulin and may be associated or linked. Most
commonly disulfide linkages are found in multichain polypeptides.
The term polypeptide may also apply to amino acid polymers in which
one or more amino acid residues are an artificial chemical analogue
of a corresponding naturally occurring amino acid.
[0111] The term "polypeptide variant" refers to molecules which
differ in their amino acid sequence from a native or reference
sequence. The amino acid sequence variants may possess
substitutions, deletions, and/or insertions at certain positions
within the amino acid sequence, as compared to a native or
reference sequence. Ordinarily, variants will possess at least
about 50% identity (homology) to a native or reference sequence,
and preferably, they will be at least about 80%, more preferably at
least about 90% identical (homologous) to a native or reference
sequence.
[0112] In some embodiments "variant mimics" are provided. As used
herein, the term "variant mimic" is one which contains one or more
amino acids which would mimic an activated sequence. For example,
glutamate may serve as a mimic for phosphoro-threonine and/or
phosphoro-serine. Alternatively, variant mimics may result in
deactivation or in an inactivated product containing the mimic,
e.g., phenylalanine may act as an inactivating substitution for
tyrosine; or alanine may act as an inactivating substitution for
serine.
[0113] "Homology" as it applies to amino acid sequences is defined
as the percentage of residues in the candidate amino acid sequence
that are identical with the residues in the amino acid sequence of
a second sequence after aligning the sequences and introducing
gaps, if necessary, to achieve the maximum percent homology.
Methods and computer programs for the alignment are well known in
the art. It is understood that homology depends on a calculation of
percent identity but may differ in value due to gaps and penalties
introduced in the calculation.
[0114] By "homologs" as it applies to polypeptide sequences means
the corresponding sequence of other species having substantial
identity to a second sequence of a second species.
[0115] "Analogs" is meant to include polypeptide variants which
differ by one or more amino acid alterations, e.g., substitutions,
additions or deletions of amino acid residues that still maintain
one or more of the properties of the parent or starting
polypeptide.
[0116] The present invention contemplates several types of
compositions which are polypeptide based including variants and
derivatives. These include substitutional, insertional, deletion
and covalent variants and derivatives. The term "derivative" is
used synonymously with the term "variant" but generally refers to a
molecule that has been modified and/or changed in any way relative
to a reference molecule or starting molecule.
[0117] As such, polynucleotides encoding polypeptides containing
substitutions, insertions and/or additions, deletions and covalent
modifications with respect to reference sequences, in particular
the polypeptide sequences disclosed herein, are included within the
scope of this invention. For example, sequence tags or amino acids,
such as one or more lysines, can be added to the peptide sequences
of the invention (e.g., at the N-terminal or C-terminal ends).
Sequence tags can be used for peptide purification or localization.
Lysines can be used to increase peptide solubility or to allow for
biotinylation. Alternatively, amino acid residues located at the
carboxy and amino terminal regions of the amino acid sequence of a
peptide or protein may optionally be deleted providing for
truncated sequences. Certain amino acids (e.g., C-terminal or
N-terminal residues) may alternatively be deleted depending on the
use of the sequence, as for example, expression of the sequence as
part of a larger sequence which is soluble, or linked to a solid
support.
[0118] "Substitutional variants" when referring to polypeptides are
those that have at least one amino acid residue in a native or
starting sequence removed and a different amino acid inserted in
its place at the same position. The substitutions may be single,
where only one amino acid in the molecule has been substituted, or
they may be multiple, where two or more amino acids have been
substituted in the same molecule.
[0119] As used herein the term "conservative amino acid
substitution" refers to the substitution of an amino acid that is
normally present in the sequence with a different amino acid of
similar size, charge, or polarity. Examples of conservative
substitutions include the substitution of a non-polar (hydrophobic)
residue such as isoleucine, valine and leucine for another
non-polar residue. Likewise, examples of conservative substitutions
include the substitution of one polar (hydrophilic) residue for
another such as between arginine and lysine, between glutamine and
asparagine, and between glycine and serine. Additionally, the
substitution of a basic residue such as lysine, arginine or
histidine for another, or the substitution of one acidic residue
such as aspartic acid or glutamic acid for another acidic residue
are additional examples of conservative substitutions. Examples of
non-conservative substitutions include the substitution of a
non-polar (hydrophobic) amino acid residue such as isoleucine,
valine, leucine, alanine, methionine for a polar (hydrophilic)
residue such as cysteine, glutamine, glutamic acid or lysine and/or
a polar residue for a non-polar residue.
[0120] "Insertional variants" when referring to polypeptides are
those with one or more amino acids inserted immediately adjacent to
an amino acid at a particular position in a native or starting
sequence. "Immediately adjacent" to an amino acid means connected
to either the alpha-carboxy or alpha-amino functional group of the
amino acid.
[0121] "Deletional variants" when referring to polypeptides are
those with one or more amino acids in the native or starting amino
acid sequence removed. Ordinarily, deletional variants will have
one or more amino acids deleted in a particular region of the
molecule.
[0122] "Covalent derivatives" when referring to polypeptides
include modifications of a native or starting protein with an
organic proteinaceous or non-proteinaceous derivatizing agent,
and/or post-translational modifications. Covalent modifications are
traditionally introduced by reacting targeted amino acid residues
of the protein with an organic derivatizing agent that is capable
of reacting with selected side-chains or terminal residues, or by
harnessing mechanisms of post-translational modifications that
function in selected recombinant host cells. The resultant covalent
derivatives are useful in programs directed at identifying residues
important for biological activity, for immunoassays, or for the
preparation of anti-protein antibodies for immunoaffinity
purification of the recombinant glycoprotein. Such modifications
are within the ordinary skill in the art and are performed without
undue experimentation.
[0123] Certain post-translational modifications are the result of
the action of recombinant host cells on the expressed polypeptide.
Glutaminyl and asparaginyl residues are frequently
post-translationally deamidated to the corresponding glutamyl and
aspartyl residues. Alternatively, these residues are deamidated
under mildly acidic conditions. Either form of these residues may
be present in the polypeptides produced in accordance with the
present invention.
[0124] Other post-translational modifications include hydroxylation
of proline and lysine, phosphorylation of hydroxyl groups of seryl
or threonyl residues, methylation of the alpha-amino groups of
lysine, arginine, and histidine side chains (T. E. Creighton,
Proteins: Structure and Molecular Properties, W.H. Freeman &
Co., San Francisco, pp. 79-86 (1983)).
[0125] "Features" when referring to polypeptides are defined as
distinct amino acid sequence-based components of a molecule.
Features of the polypeptides encoded by the mmRNA of the present
invention include surface manifestations, local conformational
shape, folds, loops, half-loops, domains, half-domains, sites,
termini or any combination thereof.
[0126] As used herein when referring to polypeptides the term
"surface manifestation" refers to a polypeptide based component of
a protein appearing on an outermost surface.
[0127] As used herein when referring to polypeptides the term
"local conformational shape" means a polypeptide based structural
manifestation of a protein which is located within a definable
space of the protein.
[0128] As used herein when referring to polypeptides the term
"fold" refers to the resultant conformation of an amino acid
sequence upon energy minimization. A fold may occur at the
secondary or tertiary level of the folding process. Examples of
secondary level folds include beta sheets and alpha helices.
Examples of tertiary folds include domains and regions formed due
to aggregation or separation of energetic forces. Regions formed in
this way include hydrophobic and hydrophilic pockets, and the
like.
[0129] As used herein the term "turn" as it relates to protein
conformation means a bend which alters the direction of the
backbone of a peptide or polypeptide and may involve one, two,
three or more amino acid residues.
[0130] As used herein when referring to polypeptides the term
"loop" refers to a structural feature of a polypeptide which may
serve to reverse the direction of the backbone of a peptide or
polypeptide. Where the loop is found in a polypeptide and only
alters the direction of the backbone, it may comprise four or more
amino acid residues. Oliva et al. have identified at least 5
classes of protein loops (J. Mol Biol 266 (4): 814-830; 1997).
Loops may be open or closed. Closed loops or "cyclic" loops may
comprise 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids between the
bridging moieties. Such bridging moieties may comprise a
cysteine-cysteine bridge (Cys-Cys) typical in polypeptides having
disulfide bridges or alternatively bridging moieties may be
non-protein based such as the dibromozylyl agents used herein.
[0131] As used herein when referring to polypeptides the term
"half-loop" refers to a portion of an identified loop having at
least half the number of amino acid resides as the loop from which
it is derived. It is understood that loops may not always contain
an even number of amino acid residues. Therefore, in those cases
where a loop contains or is identified to comprise an odd number of
amino acids, a half-loop of the odd-numbered loop will comprise the
whole number portion or next whole number portion of the loop
(number of amino acids of the loop/2+/-0.5 amino acids). For
example, a loop identified as a 7 amino acid loop could produce
half-loops of 3 amino acids or 4 amino acids (7/2=3.5+/-0.5 being 3
or 4).
[0132] As used herein when referring to polypeptides the term
"domain" refers to a motif of a polypeptide having one or more
identifiable structural or functional characteristics or properties
(e.g., binding capacity, serving as a site for protein-protein
interactions).
[0133] As used herein when referring to polypeptides the term
"half-domain" means a portion of an identified domain having at
least half the number of amino acid resides as the domain from
which it is derived. It is understood that domains may not always
contain an even number of amino acid residues. Therefore, in those
cases where a domain contains or is identified to comprise an odd
number of amino acids, a half-domain of the odd-numbered domain
will comprise the whole number portion or next whole number portion
of the domain (number of amino acids of the domain/2+/-0.5 amino
acids). For example, a domain identified as a 7 amino acid domain
could produce half-domains of 3 amino acids or 4 amino acids
(7/2=3.5+/-0.5 being 3 or 4). It is also understood that
sub-domains may be identified within domains or half-domains, these
subdomains possessing less than all of the structural or functional
properties identified in the domains or half domains from which
they were derived. It is also understood that the amino acids that
comprise any of the domain types herein need not be contiguous
along the backbone of the polypeptide (i.e., nonadjacent amino
acids may fold structurally to produce a domain, half-domain or
subdomain).
[0134] As used herein when referring to polypeptides the terms
"site" as it pertains to amino acid based embodiments is used
synonymously with "amino acid residue" and "amino acid side chain."
A site represents a position within a peptide or polypeptide that
may be modified, manipulated, altered, derivatized or varied within
the polypeptide based molecules of the present invention.
[0135] As used herein the terms "termini" or "terminus" when
referring to polypeptides refers to an extremity of a peptide or
polypeptide. Such extremity is not limited only to the first or
final site of the peptide or polypeptide but may include additional
amino acids in the terminal regions. The polypeptide based
molecules of the present invention may be characterized as having
both an N-terminus (terminated by an amino acid with a free amino
group (NH2)) and a C-terminus (terminated by an amino acid with a
free carboxyl group (COOH)). Proteins of the invention are in some
cases made up of multiple polypeptide chains brought together by
disulfide bonds or by non-covalent forces (multimers, oligomers).
These sorts of proteins will have multiple N- and C-termini.
Alternatively, the termini of the polypeptides may be modified such
that they begin or end, as the case may be, with a non-polypeptide
based moiety such as an organic conjugate.
[0136] Once any of the features have been identified or defined as
a desired component of a polypeptide to be encoded by the primary
construct or mmRNA of the invention, any of several manipulations
and/or modifications of these features may be performed by moving,
swapping, inverting, deleting, randomizing or duplicating.
Furthermore, it is understood that manipulation of features may
result in the same outcome as a modification to the molecules of
the invention. For example, a manipulation which involved deleting
a domain would result in the alteration of the length of a molecule
just as modification of a nucleic acid to encode less than a full
length molecule would.
[0137] Modifications and manipulations can be accomplished by
methods known in the art such as, but not limited to, site directed
mutagenesis. The resulting modified molecules may then be tested
for activity using in vitro or in vivo assays such as those
described herein or any other suitable screening assay known in the
art.
[0138] According to the present invention, the polypeptides may
comprise a consensus sequence which is discovered through rounds of
experimentation. As used herein a "consensus" sequence is a single
sequence which represents a collective population of sequences
allowing for variability at one or more sites.
[0139] As recognized by those skilled in the art, protein
fragments, functional protein domains, and homologous proteins are
also considered to be within the scope of polypeptides of interest
of this invention. For example, provided herein is any protein
fragment (meaning an polypeptide sequence at least one amino acid
residue shorter than a reference polypeptide sequence but otherwise
identical) of a reference protein 10, 20, 30, 40, 50, 60, 70, 80,
90, 100 or greater than 100 amino acids in length. In another
example, any protein that includes a stretch of about 20, about 30,
about 40, about 50, or about 100 amino acids which are about 40%,
about 50%, about 60%, about 70%, about 80%, about 90%, about 95%,
or about 100% identical to any of the sequences described herein
can be utilized in accordance with the invention. In certain
embodiments, a polypeptide to be utilized in accordance with the
invention includes 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mutations as
shown in any of the sequences provided or referenced herein.
Encoded Polypeptides
[0140] The primary constructs or mmRNA of the present invention may
be designed to encode polypeptides of interest such as peptides and
proteins.
[0141] In one embodiment primary constructs or mmRNA of the present
invention may encode variant polypeptides which have a certain
identity with a reference polypeptide sequence. As used herein, a
"reference polypeptide sequence" refers to a starting polypeptide
sequence. Reference sequences may be wild type sequences or any
sequence to which reference is made in the design of another
sequence. A "reference polypeptide sequence" may, e.g., be any one
of the protein sequences known in the art. Non-limiting examples of
protein sequences which may be a reference polypeptide sequence are
listed in Table 6 of co-pending U.S. Provisional Patent Application
No. 61/618,862, filed Apr. 2, 2012, entitled Modified
Polynucleotides for the Production of Biologics; U.S. Provisional
Patent Application No. 61/681,645, filed Aug. 10, 2012, entitled
Modified Polynucleotides for the Production of Biologics; U.S.
Provisional Patent Application No. 61/737,130, filed Dec. 14, 2012,
entitled Modified Polynucleotides for the Production of Biologics;
International Patent Application No. PCT/US2013/030062, filed Mar.
9, 2013, entitled Modified Polynucleotides for the Production of
Biologics and Proteins Associated with Human Disease; U.S.
Provisional Patent Application No. 61/618,866, filed Apr. 2, 2012,
entitled Modified Polynucleotides for the Production of Antibodies;
U.S. Provisional Patent Application No. 61/681,647, filed Aug. 10,
2012, entitled Modified Polynucleotides for the Production of
Antibodies; U.S. Provisional Patent Application No. 61/737,134,
filed Dec. 14, 2012, entitled Modified Polynucleotides for the
Production of Antibodies; U.S. Provisional Patent Application No.
61/618,868, filed Apr. 2, 2012, entitled Modified Polynucleotides
for the Production of Vaccines; U.S. Provisional Patent Application
No. 61/681,648, filed Aug. 10, 2012, entitled Modified
Polynucleotides for the Production of Vaccines; U.S. Provisional
Patent Application No. 61/737,135, filed Dec. 14, 2012, entitled
Modified Polynucleotides for the Production of Vaccines; U.S.
Provisional Patent Application No. 61/618,873, filed Apr. 2, 2012,
entitled Modified Polynucleotides for the Production of Secreted
Proteins; U.S. Provisional Patent Application No. 61/681,650, filed
Aug. 10, 2012, entitled Modified Polynucleotides for the Production
of Secreted Proteins; U.S. Provisional Patent Application No.
61/737,147, filed Dec. 14, 2012, entitled Modified Polynucleotides
for the Production of Secreted Proteins; International Patent
Application No. PCT/US2013/030064, filed Mar. 9, 2013, entitled
Modified Polynucleotides for the Production of Secreted Proteins;
U.S. Provisional Patent Application No. 61/618,878, filed Apr. 2,
2012, entitled Modified Polynucleotides for the Production of
Plasma Membrane Proteins; U.S. Provisional Patent Application No.
61/681,654, filed Aug. 10, 2012, entitled Modified Polynucleotides
for the Production of Plasma Membrane Proteins; U.S. Provisional
Patent Application No. 61/737,152, filed Dec. 14, 2012, entitled
Modified Polynucleotides for the Production of Plasma Membrane
Proteins; International Patent Application No. PCT/US2013/030059,
filed Mar. 9, 2013, entitled Modified Polynucleotides for the
Production of Membrane Proteins; U.S. Provisional Patent
Application No. 61/618,885, filed Apr. 2, 2012, entitled Modified
Polynucleotides for the Production of Cytoplasmic and Cytoskeletal
Proteins; U.S. Provisional Patent Application No. 61/681,658, filed
Aug. 10, 2012, entitled Modified Polynucleotides for the Production
of Cytoplasmic and Cytoskeletal Proteins; U.S. Provisional Patent
Application No. 61/737,155, filed Dec. 14, 2012, entitled Modified
Polynucleotides for the Production of Cytoplasmic and Cytoskeletal
Proteins; International Patent Application No. PCT/US2013/030066,
filed Mar. 9, 2013, entitled Modified Polynucleotides for the
Production of Cytoplasmic and Cytoskeletal Proteins; U.S.
Provisional Patent Application No. 61/618,896, filed Apr. 2, 2012,
entitled Modified Polynucleotides for the Production of
Intracellular Membrane Bound Proteins; U.S. Provisional Patent
Application No. 61/668,157, filed Jul. 5, 2012, entitled Modified
Polynucleotides for the Production of Intracellular Membrane Bound
Proteins; U.S. Provisional Patent Application No. 61/681,661, filed
Aug. 10, 2012, entitled Modified Polynucleotides for the Production
of Intracellular Membrane Bound Proteins; U.S. Provisional Patent
Application No. 61/737,160, filed Dec. 14, 2012, entitled Modified
Polynucleotides for the Production of Intracellular Membrane Bound
Proteins; U.S. Provisional Patent Application No. 61/618,911, filed
Apr. 2, 2012, entitled Modified Polynucleotides for the Production
of Nuclear Proteins; U.S. Provisional Patent Application No.
61/681,667, filed Aug. 10, 2012, entitled Modified Polynucleotides
for the Production of Nuclear Proteins; U.S. Provisional Patent
Application No. 61/737,168, filed Dec. 14, 2012, entitled Modified
Polynucleotides for the Production of Nuclear Proteins;
International Patent Application No. PCT/US2013/030067, filed Mar.
9, 2013, entitled Modified Polynucleotides for the Production of
Nuclear Proteins; U.S. Provisional Patent Application No.
61/618,922, filed Apr. 2, 2012, entitled Modified Polynucleotides
for the Production of Proteins; U.S. Provisional Patent Application
No. 61/681,675, filed Aug. 10, 2012, entitled Modified
Polynucleotides for the Production of Proteins; U.S. Provisional
Patent Application No. 61/737,174, filed Dec. 14, 2012, entitled
Modified Polynucleotides for the Production of Proteins;
International Patent Application No. PCT/US2013/030060, filed Mar.
9, 2013, entitled Modified Polynucleotides for the Production of
Proteins; U.S. Provisional Patent Application No. 61/618,935, filed
Apr. 2, 2012, entitled Modified Polynucleotides for the Production
of Proteins Associated with Human Disease; U.S. Provisional Patent
Application No. 61/681,687, filed Aug. 10, 2012, entitled Modified
Polynucleotides for the Production of Proteins Associated with
Human Disease; U.S. Provisional Patent Application No. 61/737,184,
filed Dec. 14, 2012, entitled Modified Polynucleotides for the
Production of Proteins Associated with Human Disease; International
Patent Application No. PCT/US2013/030061, filed Mar. 9, 2013,
entitled Modified Polynucleotides for the Production of Proteins
Associated with Human Disease; U.S. Provisional Patent Application
No. 61/618,945, filed Apr. 2, 2012, entitled Modified
Polynucleotides for the Production of Proteins Associated with
Human Disease; U.S. Provisional Patent Application No. 61/681,696,
filed Aug. 10, 2012, entitled Modified Polynucleotides for the
Production of Proteins Associated with Human Disease; U.S.
Provisional Patent Application No. 61/737,191, filed Dec. 14, 2012,
entitled Modified Polynucleotides for the Production of Proteins
Associated with Human Disease; U.S. Provisional Patent Application
No. 61/618,953, filed Apr. 2, 2012, entitled Modified
Polynucleotides for the Production of Proteins Associated with
Human Disease; U.S. Provisional Patent Application No. 61/681,704,
filed Aug. 10, 2012, entitled Modified Polynucleotides for the
Production of Proteins Associated with Human Disease; U.S.
Provisional Patent Application No. 61/737,203, filed Dec. 14, 2012,
entitled Modified Polynucleotides for the Production of Proteins
Associated with Human Disease; in Tables 6 and 7 of co-pending U.S.
Provisional Patent Application No. 61/681,720, filed Aug. 10, 2012,
entitled Modified Polynucleotides for the Production of Cosmetic
Proteins and Peptides; U.S. Provisional Patent Application No.
61/737,213, filed Dec. 14, 2012, entitled Modified Polynucleotides
for the Production of Cosmetic Proteins and Peptides; U.S.
Provisional Patent Application No. 61/681,742, filed Aug. 10, 2012,
entitled Modified Polynucleotides for the Production of
Oncology-Related Proteins and Peptides; International Application
No. PCT/US2013/030070, filed Mar. 9, 2013, entitled Modified
Polynucleotides for the Production of Oncology-Related Proteins and
Peptides; in Tables 6, 178 and 179 of co-pending International
Application No. PCT/US2013/030068, filed Mar. 9, 2013, entitled
Modified Polynucleotides for the Production of Cosmetic Proteins
and Peptides; in Tables 6, 28 and 29 of co-pending U.S. Provisional
Patent Application No. 61/618,870, filed Apr. 2, 2012, entitled
Modified Polynucleotides for the Production of Therapeutic Proteins
and Peptides; in Tables 6, 56 and 57 of co-pending U.S. Provisional
Patent Application No. 61/681,649, filed Aug. 10, 2012, entitled
Modified Polynucleotides for the Production of Therapeutic Proteins
and Peptides; in Tables 6, 186 and 187 of co-pending U.S.
Provisional Patent Application No. 61/737,139, filed Dec. 14, 2012,
Modified Polynucleotides for the Production of Therapeutic Proteins
and Peptides; in Tables 6, 185 and 186 of co-pending International
Application No PCT/US2013/030063, filed Mar. 9, 2013, entitled
Modified Polynucleotides; in Table 6 of co-pending International
Application No. PCT/US2013/031821, filed Mar. 15, 2013, entitled In
Vivo Production of Proteins, the contents of each of which are
herein incorporated by reference in their entireties.
[0142] In another embodiment, the polypeptide of interest is the
C-terminal fragment (amino acid 180-251) of Fibroblast Growth
Factor 23 (FGF23) (amino acid sequence of C-terminal fragment shown
in SEQ ID NO: 4). FGF23 is derived from osteocytes and it is
believed that FGF23 acts to regulate kidney function and
osteogenesis in a klotho dependent fashion (see e.g., Medici et al.
FGF-23-Klotho signaling stimulates proliferation and prevents
vitamin D-induced apoptosis. J. Cell Biol. 2008: 182(3) 459-465;
and Goetz et al. Isolated C-terminal tail of FGF23 alleviates
hypophosphatemia by inhibiting FGF23-FGFR-Klotho complex formation.
PNAS 2010: 107(1) 407-412; each of which is herein incorporated by
reference in its entirety). The C-terminal fragment of FGF23 could
be used as an inhibitor of renal phosphate reabsorption and the
C-terminal fragment could be used to stimulate mitogenic and cell
survival pathways to prevent atrophy of tissues caused by excessive
Vitamin D. Further, the C-terminal fragment of FGF23 can act as a
competitive inhibitor of full length FGF23 to promote renal
phosphate reabsorption and correct other diseases caused by the
hyperactivity of FGF23.
[0143] The term "identity" as known in the art, refers to a
relationship between the sequences of two or more peptides, as
determined by comparing the sequences. In the art, identity also
means the degree of sequence relatedness between peptides, as
determined by the number of matches between strings of two or more
amino acid residues. Identity measures the percent of identical
matches between the smaller of two or more sequences with gap
alignments (if any) addressed by a particular mathematical model or
computer program (i.e., "algorithms"). Identity of related peptides
can be readily calculated by known methods. Such methods include,
but are not limited to, those described in Computational Molecular
Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988;
Biocomputing: Informatics and Genome Projects, Smith, D. W., ed.,
Academic Press, New York, 1993; Computer Analysis of Sequence Data,
Part 1, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New
Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje,
G., Academic Press, 1987; Sequence Analysis Primer, Gribskov, M.
and Devereux, J., eds., M. Stockton Press, New York, 1991; and
Carillo et al., SIAM J. Applied Math. 48, 1073 (1988).
[0144] In some embodiments, the polypeptide variant may have the
same or a similar activity as the reference polypeptide.
Alternatively, the variant may have an altered activity (e.g.,
increased or decreased) relative to a reference polypeptide.
Generally, variants of a particular polynucleotide or polypeptide
of the invention will have at least about 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, 99% but less than 100% sequence identity to that particular
reference polynucleotide or polypeptide as determined by sequence
alignment programs and parameters described herein and known to
those skilled in the art. Such tools for alignment include those of
the BLAST suite (Stephen F. Altschul, Thomas L. Madden, Alejandro
A. Schiffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res.
25:3389-3402.) Other tools are described herein, specifically in
the definition of "identity."
[0145] Default parameters in the BLAST algorithm include, for
example, an expect threshold of 10, Word size of 28, Match/Mismatch
Scores 1, -2, Gap costs Linear. Any filter can be applied as well
as a selection for species specific repeats, e.g., Homo
sapiens.
Untranslated Regions (UTRs)
[0146] Untranslated regions (UTRs) of a gene are transcribed but
not translated. The 5'UTR starts at the transcription start site
and continues to the start codon but does not include the start
codon; whereas, the 3'UTR starts immediately following the stop
codon and continues until the transcriptional termination signal.
There is growing body of evidence about the regulatory roles played
by the UTRs in terms of stability of the nucleic acid molecule and
translation. The regulatory features of a UTR can be incorporated
into the polynucleotides, primary constructs and/or mmRNA of the
present invention to enhance the stability of the molecule. The
specific regulatory features can also be incorporated to ensure
controlled down-regulation of the transcript in case they are
misdirected to undesired organs sites. One or more carboxy-terminal
peptides, albumin or IgG4 sequences described herein may be located
before and/or after an untranslated region of the polynucleotides,
primary constructs and/or mmRNA described herein.
5' UTR and Translation Initiation
[0147] Natural 5'UTRs bear features which play roles in for
translation initiation. They harbor signatures like Kozak sequences
which are commonly known to be involved in the process by which the
ribosome initiates translation of many genes. Kozak sequences have
the consensus CCR(A/G)CCAUGG, where R is a purine (adenine or
guanine) three bases upstream of the start codon (AUG), which is
followed by another `G`. 5'UTR also have been known to form
secondary structures which are involved in elongation factor
binding.
[0148] By engineering the features typically found in abundantly
expressed genes of specific target organs, one can enhance the
stability and protein production of the polynucleotides, primary
constructs or mmRNA of the invention. For example, introduction of
5' UTR of liver-expressed mRNA, such as albumin, serum amyloid A,
Apolipoprotein A/B/E, transferrin, alpha fetoprotein,
erythropoietin, or Factor VIII, could be used to enhance expression
of a nucleic acid molecule, such as a mmRNA, in hepatic cell lines
or liver. Likewise, use of 5' UTR from other tissue-specific mRNA
to improve expression in that tissue is possible--for muscle (MyoD,
Myosin, Myoglobin, Myogenin, Herculin), for endothelial cells
(Tie-1, CD36), for myeloid cells (C/EBP, AML1, G-CSF, GM-CSF,
CD11b, MSR, Fr-1, i-NOS), for leukocytes (CD45, CD18), for adipose
tissue (CD36, GLUT4, ACRP30, adiponectin) and for lung epithelial
cells (SP-A/B/C/D).
[0149] Other non-UTR sequences may be incorporated into the 5' (or
3' UTR) UTRs. For example, introns or portions of introns sequences
may be incorporated into the flanking regions of the
polynucleotides, primary constructs or mmRNA of the invention.
Incorporation of intronic sequences may increase protein production
as well as mRNA levels.
3' UTR and the AU Rich Elements
[0150] 3'UTRs are known to have stretches of Adenosines and
Uridines embedded in them. These AU rich signatures are
particularly prevalent in genes with high rates of turnover. Based
on their sequence features and functional properties, the AU rich
elements (AREs) can be separated into three classes (Chen et al,
1995): Class I AREs contain several dispersed copies of an AUUUA
motif within U-rich regions. C-Myc and MyoD contain class I AREs.
Class II AREs possess two or more overlapping UUAUUUA(U/A)(U/A)
nonamers. Molecules containing this type of AREs include GM-CSF and
TNF-a. Class III ARES are less well defined. These U rich regions
do not contain an AUUUA motif c-Jun and Myogenin are two
well-studied examples of this class. Most proteins binding to the
AREs are known to destabilize the messenger, whereas members of the
ELAV family, most notably HuR, have been documented to increase the
stability of mRNA. HuR binds to AREs of all the three classes.
Engineering the HuR specific binding sites into the 3' UTR of
nucleic acid molecules will lead to HuR binding and thus,
stabilization of the message in vivo.
[0151] Introduction, removal or modification of 3' UTR AU rich
elements (AREs) can be used to modulate the stability of
polynucleotides, primary constructs or mmRNA of the invention. When
engineering specific polynucleotides, primary constructs or mmRNA,
one or more copies of an ARE can be introduced to make
polynucleotides, primary constructs or mmRNA of the invention less
stable and thereby curtail translation and decrease production of
the resultant protein. Likewise, AREs can be identified and removed
or mutated to increase the intracellular stability and thus
increase translation and production of the resultant protein.
Transfection experiments can be conducted in relevant cell lines,
using polynucleotides, primary constructs or mmRNA of the invention
and protein production can be assayed at various time points
post-transfection. For example, cells can be transfected with
different ARE-engineering molecules and by using an ELISA kit to
the relevant protein and assaying protein produced at 6 hr, 12 hr,
24 hr, 48 hr, and 7 days post-transfection.
Incorporating microRNA Binding Sites
[0152] microRNAs (or miRNA) are 19-25 nucleotide long noncoding
RNAs that bind to the 3'UTR of nucleic acid molecules and
down-regulate gene expression either by reducing nucleic acid
molecule stability or by inhibiting translation. The
polynucleotides, primary constructs or mmRNA of the invention may
comprise one or more microRNA target sequences, microRNA sequences,
microRNA binding sites, or microRNA seeds. Such sequences may
correspond to any known microRNA such as those taught in US
Publication US2005/0261218 and US Publication US2005/0059005, or
those listed in Table 7 of co-pending application U.S. Ser. No.
61/758,921 filed Jan. 31, 2013 (Attorney Docket Number 2030.1039),
the contents of which are incorporated herein by reference in their
entirety.
[0153] A microRNA sequence comprises a "seed" region, i.e., a
sequence in the region of positions 2-8 of the mature microRNA,
which sequence has perfect Watson-Crick complementarity to the
miRNA target sequence. A microRNA seed may comprise positions 2-8
or 2-7 of the mature microRNA. In some embodiments, a microRNA seed
may comprise 7 nucleotides (e.g., nucleotides 2-8 of the mature
microRNA), wherein the seed-complementary site in the corresponding
miRNA target is flanked by an adenine (A) opposed to microRNA
position 1. In some embodiments, a microRNA seed may comprise 6
nucleotides (e.g., nucleotides 2-7 of the mature microRNA), wherein
the seed-complementary site in the corresponding miRNA target is
flanked by an adenine (A) opposed to microRNA position 1. See for
example, Grimson A, Farh K K, Johnston W K, Garrett-Engele P, Lim L
P, Bartel D P; Mol Cell. 2007 Jul. 6; 27(1):91-105. The bases of
the microRNA seed have complete complementarity with the target
sequence. By engineering microRNA target sequences into the 3'UTR
of polynucleotides, primary constructs or mmRNA of the invention
one can target the molecule for degradation or reduced translation,
provided the microRNA in question is available. This process will
reduce the hazard of off target effects upon nucleic acid molecule
delivery. Identification of microRNA, microRNA target regions, and
their expression patterns and role in biology have been reported
(Bonauer et al., Curr Drug Targets 2010 11:943-949; Anand and
Cheresh Curr Opin Hematol 2011 18:171-176; Contreras and Rao
Leukemia 2012 26:404-413 (2011 Dec. 20. doi: 10.1038/leu.2011.356);
Bartel Cell 2009 136:215-233; Landgraf et al, Cell, 2007
129:1401-1414).
[0154] For example, if the nucleic acid molecule is an mRNA and is
not intended to be delivered to the liver but ends up there, then
miR-122, a microRNA abundant in liver, can inhibit the expression
of the gene of interest if one or multiple target sites of miR-122
are engineered into the 3'UTR of the polynucleotides, primary
constructs or mmRNA. Introduction of one or multiple binding sites
for different microRNA can be engineered to further decrease the
longevity, stability, and protein translation of a polynucleotides,
primary constructs or mmRNA.
[0155] As used herein, the term "microRNA site" refers to a
microRNA target site or a microRNA recognition site, or any
nucleotide sequence to which a microRNA binds or associates. It
should be understood that "binding" may follow traditional
Watson-Crick hybridization rules or may reflect any stable
association of the microRNA with the target sequence at or adjacent
to the microRNA site.
[0156] Conversely, for the purposes of the polynucleotides, primary
constructs or mmRNA of the present invention, microRNA binding
sites can be engineered out of (i.e. removed from) sequences in
which they naturally occur in order to increase protein expression
in specific tissues. For example, miR-122 binding sites may be
removed to improve protein expression in the liver. Regulation of
expression in multiple tissues can be accomplished through
introduction or removal or one or several microRNA binding
sites.
[0157] Examples of tissues where microRNA are known to regulate
mRNA, and thereby protein expression, include, but are not limited
to, liver (miR-122), muscle (miR-133, miR-206, miR-208),
endothelial cells (miR-17-92, miR-126), myeloid cells (miR-142-3p,
miR-142-5p, miR-16, miR-21, miR-223, miR-24, miR-27), adipose
tissue (let-7, miR-30c), heart (miR-id, miR-149), kidney (miR-192,
miR-194, miR-204), and lung epithelial cells (let-7, miR-133,
miR-126). MicroRNA can also regulate complex biological processes
such as angiogenesis (miR-132) (Anand and Cheresh Curr Opin Hematol
2011 18:171-176). In the polynucleotides, primary constructs or
mmRNA of the invention, binding sites for microRNAs that are
involved in such processes may be removed or introduced, in order
to tailor the expression of the polynucleotides, primary constructs
or mmRNA expression to biologically relevant cell types or to the
context of relevant biological processes.
[0158] Lastly, through an understanding of the expression patterns
of microRNA in different cell types, polynucleotides, primary
constructs or mmRNA can be engineered for more targeted expression
in specific cell types or only under specific biological
conditions. Through introduction of tissue-specific microRNA
binding sites, polynucleotides, primary constructs or mmRNA could
be designed that would be optimal for protein expression in a
tissue or in the context of a biological condition.
[0159] Transfection experiments can be conducted in relevant cell
lines, using engineered polynucleotides, primary constructs or
mmRNA and protein production can be assayed at various time points
post-transfection. For example, cells can be transfected with
different microRNA binding site-engineering polynucleotides,
primary constructs or mmRNA and by using an ELISA kit to the
relevant protein and assaying protein produced at 6 hr, 12 hr, 24
hr, 48 hr, 72 hr and 7 days post-transfection. In vivo experiments
can also be conducted using microRNA-binding site-engineered
molecules to examine changes in tissue-specific expression of
formulated polynucleotides, primary constructs or mmRNA.
5' Capping
[0160] The 5' cap structure of an mRNA is involved in nuclear
export, increasing mRNA stability and binds the mRNA Cap Binding
Protein (CBP), which is responsible for mRNA stability in the cell
and translation competency through the association of CBP with
poly(A) binding protein to form the mature cyclic mRNA species. The
cap further assists the removal of 5' proximal introns removal
during mRNA splicing.
[0161] Endogenous mRNA molecules may be 5'-end capped generating a
5'-ppp-5'-triphosphate linkage between a terminal guanosine cap
residue and the 5'-terminal transcribed sense nucleotide of the
mRNA molecule. This 5'-guanylate cap may then be methylated to
generate an N7-methyl-guanylate residue. The ribose sugars of the
terminal and/or anteterminal transcribed nucleotides of the 5' end
of the mRNA may optionally also be 2'-O-methylated. 5'-decapping
through hydrolysis and cleavage of the guanylate cap structure may
target a nucleic acid molecule, such as an mRNA molecule, for
degradation.
[0162] Modifications to the polynucleotides, primary constructs,
and mmRNA of the present invention may generate a non-hydrolyzable
cap structure preventing decapping and thus increasing mRNA
half-life. Because cap structure hydrolysis requires cleavage of
5'-ppp-5' phosphorodiester linkages, modified nucleotides may be
used during the capping reaction. For example, a Vaccinia Capping
Enzyme from New England Biolabs (Ipswich, Mass.) may be used with
.alpha.-thio-guanosine nucleotides according to the manufacturer's
instructions to create a phosphorothioate linkage in the 5'-ppp-5'
cap. Additional modified guanosine nucleotides may be used such as
.alpha.-methyl-phosphonate and seleno-phosphate nucleotides.
[0163] Additional modifications include, but are not limited to,
2'-O-methylation of the ribose sugars of 5'-terminal and/or
5'-anteterminal nucleotides of the mRNA (as mentioned above) on the
2'-hydroxyl group of the sugar ring. Multiple distinct 5'-cap
structures can be used to generate the 5'-cap of a nucleic acid
molecule, such as an mRNA molecule.
[0164] Cap analogs, which herein are also referred to as synthetic
cap analogs, chemical caps, chemical cap analogs, or structural or
functional cap analogs, differ from natural (i.e. endogenous,
wild-type or physiological) 5'-caps in their chemical structure,
while retaining cap function. Cap analogs may be chemically (i.e.
non-enzymatically) or enzymatically synthesized and/linked to a
nucleic acid molecule.
[0165] For example, the Anti-Reverse Cap Analog (ARCA) cap contains
two guanines linked by a 5'-5'-triphosphate group, wherein one
guanine contains an N7 methyl group as well as a 3'-O-methyl group
(i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine
(m.sup.7G-3'mppp-G; which may equivalently be designated 3'
O-Me-m7G(5')ppp(5')G). The 3'-O atom of the other, unmodified,
guanine becomes linked to the 5'-terminal nucleotide of the capped
nucleic acid molecule (e.g. an mRNA or mmRNA). The N7- and
3'-O-methylated guanine provides the terminal moiety of the capped
nucleic acid molecule (e.g. mRNA or mmRNA).
[0166] Another exemplary cap is mCAP, which is similar to ARCA but
has a 2'-O-methyl group on guanosine (i.e.,
N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine,
m.sup.7Gm-ppp-G).
[0167] While cap analogs allow for the concomitant capping of a
nucleic acid molecule in an in vitro transcription reaction, up to
20% of transcripts remain uncapped. This, as well as the structural
differences of a cap analog from an endogenous 5'-cap structures of
nucleic acids produced by the endogenous, cellular transcription
machinery, may lead to reduced translational competency and reduced
cellular stability.
[0168] Polynucleotides, primary constructs and mmRNA of the
invention may also be capped post-transcriptionally, using enzymes,
in order to generate more authentic 5'-cap structures. As used
herein, the phrase "more authentic" refers to a feature that
closely mirrors or mimics, either structurally or functionally, an
endogenous or wild type feature. That is, a "more authentic"
feature is better representative of an endogenous, wild-type,
natural or physiological cellular function and/or structure as
compared to synthetic features or analogs, etc., of the prior art,
or which outperforms the corresponding endogenous, wild-type,
natural or physiological feature in one or more respects.
Non-limiting examples of more authentic 5'cap structures of the
present invention are those which, among other things, have
enhanced binding of cap binding proteins, increased half-life,
reduced susceptibility to 5' endonucleases and/or reduced
5'decapping, as compared to synthetic 5'cap structures known in the
art (or to a wild-type, natural or physiological 5'cap structure).
For example, recombinant Vaccinia Virus Capping Enzyme and
recombinant 2'-O-methyltransferase enzyme can create a canonical
5'-5'-triphosphate linkage between the 5'-terminal nucleotide of an
mRNA and a guanine cap nucleotide wherein the cap guanine contains
an N7 methylation and the 5'-terminal nucleotide of the mRNA
contains a 2'-O-methyl. Such a structure is termed the Cap1
structure. This cap results in a higher translational-competency
and cellular stability and a reduced activation of cellular
pro-inflammatory cytokines, as compared, e.g., to other 5'cap
analog structures known in the art. Cap structures include
7mG(5')ppp(5')N,pN2p (cap 0), 7mG(5')ppp(5')N1mpNp (cap 1), and
7mG(5')-ppp(5')N1mpN2mp (cap 2).
[0169] Because the polynucleotides, primary constructs or mmRNA may
be capped post-transcriptionally, and because this process is more
efficient, nearly 100% of the polynucleotides, primary constructs
or mmRNA may be capped. This is in contrast to .about.80% when a
cap analog is linked to an mRNA in the course of an in vitro
transcription reaction.
[0170] According to the present invention, 5' terminal caps may
include endogenous caps or cap analogs. According to the present
invention, a 5' terminal cap may comprise a guanine analog. Useful
guanine analogs include inosine, N1-methyl-guanosine,
2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine,
2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.
Viral Sequences
[0171] Additional viral sequences such as, but not limited to, the
translation enhancer sequence of the barley yellow dwarf virus
(BYDV-PAV) can be engineered and inserted in the 3' UTR of the
polynucleotides, primary constructs or mmRNA of the invention and
can stimulate the translation of the construct in vitro and in
vivo. Transfection experiments can be conducted in relevant cell
lines at and protein production can be assayed by ELISA at 12 hr,
24 hr, 48 hr, 72 hr and day 7 post-transfection.
IRES Sequences
[0172] Further, provided are polynucleotides, primary constructs or
mmRNA which may contain an internal ribosome entry site (IRES).
First identified as a feature Picorna virus RNA, IRES plays an
important role in initiating protein synthesis in absence of the 5'
cap structure. An IRES may act as the sole ribosome binding site,
or may serve as one of multiple ribosome binding sites of an mRNA.
Polynucleotides, primary constructs or mmRNA containing more than
one functional ribosome binding site may encode several peptides or
polypeptides that are translated independently by the ribosomes
("multicistronic nucleic acid molecules"). When polynucleotides,
primary constructs or mmRNA are provided with an IRES, further
optionally provided is a second translatable region. Examples of
IRES sequences that can be used according to the invention include
without limitation, those from picornaviruses (e.g. FMDV), pest
viruses (CFFV), polio viruses (PV), encephalomyocarditis viruses
(ECMV), foot-and-mouth disease viruses (FMDV), hepatitis C viruses
(HCV), classical swine fever viruses (CSFV), murine leukemia virus
(MLV), simian immune deficiency viruses (SIV) or cricket paralysis
viruses (CrPV).
Poly-A Tails
[0173] During RNA processing, a long chain of adenine nucleotides
(poly-A tail) may be added to a polynucleotide such as an mRNA
molecule in order to increase stability. Immediately after
transcription, the 3' end of the transcript may be cleaved to free
a 3' hydroxyl. Then poly-A polymerase adds a chain of adenine
nucleotides to the RNA. The process, called polyadenylation, adds a
poly-A tail that can be between 100 and 250 residues long.
[0174] It has been discovered that unique poly-A tail lengths
provide certain advantages to the polynucleotides, primary
constructs or mmRNA of the present invention.
[0175] Generally, the length of a poly-A tail of the present
invention is greater than 30 nucleotides in length. In another
embodiment, the poly-A tail is greater than 35 nucleotides in
length (e.g., at least or greater than about 35, 40, 45, 50, 55,
60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400,
450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400,
1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000
nucleotides). In some embodiments, the polynucleotides, primary
construct, or mmRNA includes from about 30 to about 3,000
nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250,
from 30 to 500, from 30 to 750, from 30 to 1,000, from 30 to 1,500,
from 30 to 2,000, from 30 to 2,500, from 50 to 100, from 50 to 250,
from 50 to 500, from 50 to 750, from 50 to 1,000, from 50 to 1,500,
from 50 to 2,000, from 50 to 2,500, from 50 to 3,000, from 100 to
500, from 100 to 750, from 100 to 1,000, from 100 to 1,500, from
100 to 2,000, from 100 to 2,500, from 100 to 3,000, from 500 to
750, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from
500 to 2,500, from 500 to 3,000, from 1,000 to 1,500, from 1,000 to
2,000, from 1,000 to 2,500, from 1,000 to 3,000, from 1,500 to
2,000, from 1,500 to 2,500, from 1,500 to 3,000, from 2,000 to
3,000, from 2,000 to 2,500, and from 2,500 to 3,000).
[0176] In one embodiment, the poly-A tail is designed relative to
the length of the overall polynucleotides, primary constructs or
mmRNA. This design may be based on the length of the coding region,
the length of a particular feature or region (such as the first or
flanking regions), or based on the length of the ultimate product
expressed from the polynucleotides, primary constructs or
mmRNA.
[0177] In this context the poly-A tail may be 10, 20, 30, 40, 50,
60, 70, 80, 90, or 100% greater in length than the polynucleotides,
primary constructs or mmRNA or feature thereof. The poly-A tail may
also be designed as a fraction of polynucleotides, primary
constructs or mmRNA to which it belongs. In this context, the
poly-A tail may be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more
of the total length of the construct or the total length of the
construct minus the poly-A tail. Further, engineered binding sites
and conjugation of polynucleotides, primary constructs or mmRNA for
Poly-A binding protein may enhance expression.
[0178] Additionally, multiple distinct polynucleotides, primary
constructs or mmRNA may be linked together to the PABP (Poly-A
binding protein) through the 3'-end using modified nucleotides at
the 3'-terminus of the poly-A tail. Transfection experiments can be
conducted in relevant cell lines and protein production can be
assayed by ELISA at 12 hr, 24 hr, 48 hr, 72 hr and day 7
post-transfection.
[0179] In one embodiment, the polynucleotides and primary
constructs of the present invention are designed to include a
polyA-G Quartet. The G-quartet is a cyclic hydrogen bonded array of
four guanine nucleotides that can be formed by G-rich sequences in
both DNA and RNA. In this embodiment, the G-quartet is incorporated
at the end of the poly-A tail. The resultant mmRNA construct is
assayed for stability, protein production and other parameters
including half-life at various time points. It has been discovered
that the polyA-G quartet results in protein production equivalent
to at least 75% of that seen using a poly-A tail of 120 nucleotides
alone.
Quantification
[0180] In one embodiment, the polynucleotides, primary constructs
or mmRNA of the present invention may be quantified in exosomes
derived from one or more bodily fluid. As used herein "bodily
fluids" include peripheral blood, serum, plasma, ascites, urine,
cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial
fluid, aqueous humor, amniotic fluid, cerumen, breast milk,
broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's
fluid or pre-ejaculatory fluid, sweat, fecal matter, hair, tears,
cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph,
chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit,
vaginal secretions, mucosal secretion, stool water, pancreatic
juice, lavage fluids from sinus cavities, bronchopulmonary
aspirates, blastocyl cavity fluid, and umbilical cord blood.
Alternatively, exosomes may be retrieved from an organ selected
from the group consisting of lung, heart, pancreas, stomach,
intestine, bladder, kidney, ovary, testis, skin, colon, breast,
prostate, brain, esophagus, liver, and placenta.
[0181] In the quantification method, a sample of not more than 2 mL
is obtained from the subject and the exosomes isolated by size
exclusion chromatography, density gradient centrifugation,
differential centrifugation, nanomembrane ultrafiltration,
immunoabsorbent capture, affinity purification, microfluidic
separation, or combinations thereof. In the analysis, the level or
concentration of polynucleotides, primary construct or mmRNA may be
an expression level, presence, absence, truncation or alteration of
the administered construct. It is advantageous to correlate the
level with one or more clinical phenotypes or with an assay for a
human disease biomarker. The assay may be performed using construct
specific probes, cytometry, qRT-PCR, real-time PCR, PCR, flow
cytometry, electrophoresis, mass spectrometry, or combinations
thereof while the exosomes may be isolated using
immunohistochemical methods such as enzyme linked immunosorbent
assay (ELISA) methods. Exosomes may also be isolated by size
exclusion chromatography, density gradient centrifugation,
differential centrifugation, nanomembrane ultrafiltration,
immunoabsorbent capture, affinity purification, microfluidic
separation, or combinations thereof.
[0182] These methods afford the investigator the ability to
monitor, in real time, the level of polynucleotides, primary
constructs or mmRNA remaining or delivered. This is possible
because the polynucleotides, primary constructs or mmRNA of the
present invention differ from the endogenous forms due to the
structural and/or chemical modifications.
II. DESIGN AND SYNTHESIS OF POLYNUCLEOTIDES
[0183] Polynucleotides, primary constructs or mmRNA for use in
accordance with the invention may be prepared according to any
available technique including, but not limited to chemical
synthesis, enzymatic synthesis, which is generally termed in vitro
transcription (IVT) or enzymatic or chemical cleavage of a longer
precursor, etc. Methods of synthesizing RNAs are known in the art
(see, e.g., Gait, M. J. (ed.) Oligonucleotide synthesis: a
practical approach, Oxford [Oxfordshire], Washington, D.C.: IRL
Press, 1984; and Herdewijn, P. (ed.) Oligonucleotide synthesis:
methods and applications, Methods in Molecular Biology, v. 288
(Clifton, N.J.) Totowa, N.J.: Humana Press, 2005; both of which are
incorporated herein by reference).
[0184] The process of design and synthesis of the primary
constructs of the invention generally includes the steps of gene
construction, mRNA production (either with or without
modifications) and purification. In the enzymatic synthesis method,
a target polynucleotide sequence encoding the polypeptide of
interest is first selected for incorporation into a vector which
will be amplified to produce a cDNA template. Optionally, the
target polynucleotide sequence and/or any flanking sequences may be
codon optimized. The cDNA template is then used to produce mRNA
through in vitro transcription (IVT). After production, the mRNA
may undergo purification and clean-up processes. The steps of which
are provided in more detail below.
Gene Construction
[0185] The step of gene construction may include, but is not
limited to gene synthesis, vector amplification, plasmid
purification, plasmid linearization and clean-up, and cDNA template
synthesis and clean-up.
Gene Synthesis
[0186] Once a polypeptide of interest, or target, is selected for
production, a primary construct is designed. Within the primary
construct, a first region of linked nucleosides encoding the
polypeptide of interest may be constructed using an open reading
frame (ORF) of a selected nucleic acid (DNA or RNA) transcript. The
ORF may comprise the wild type ORF, an isoform, variant or a
fragment thereof. As used herein, an "open reading frame" or "ORF"
is meant to refer to a nucleic acid sequence (DNA or RNA) which is
capable of encoding a polypeptide of interest. ORFs often begin
with the start codon, ATG and end with a nonsense or termination
codon or signal.
[0187] Further, the nucleotide sequence of the first region may be
codon optimized. Codon optimization methods are known in the art
and may be useful in efforts to achieve one or more of several
goals. These goals include to match codon frequencies in target and
host organisms to ensure proper folding, bias GC content to
increase mRNA stability or reduce secondary structures, minimize
tandem repeat codons or base runs that may impair gene construction
or expression, customize transcriptional and translational control
regions, insert or remove protein trafficking sequences, remove/add
post translation modification sites in encoded protein (e.g.
glycosylation sites), add, remove or shuffle protein domains,
insert or delete restriction sites, modify ribosome binding sites
and mRNA degradation sites, to adjust translational rates to allow
the various domains of the protein to fold properly, or to reduce
or eliminate problem secondary structures within the mRNA. Codon
optimization tools, algorithms and services are known in the art,
non-limiting examples include services from GeneArt (Life
Technologies) and/or DNA2.0 (Menlo Park Calif.). In one embodiment,
the ORF sequence is optimized using optimization algorithms. Codon
options for each amino acid are given in Table 2.
TABLE-US-00002 TABLE 2 Codon Options Single Amino Letter Acid Code
Codon Options Isoleucine I ATT, ATC, ATA Leucine L CTT, CTC, CTA,
CTG, TTA, TTG Valine V GTT, GTC, GTA, GTG Phenylalanine F TTT, TTC
Methionine M ATG Cysteine C TGT, TGC Alanine A GCT, GCC, GCA, GCG
Glycine G GGT, GGC, GGA, GGG Proline P CCT, CCC, CCA, CCG Threonine
T ACT, ACC, ACA, ACG Serine S TCT, TCC, TCA, TCG, AGT, AGC Tyrosine
Y TAT, TAC Tryptophan W TGG Glutamine Q CAA, CAG Asparagine N AAT,
AAC Histidine H CAT, CAC Glutamic acid E GAA, GAG Aspartic acid D
GAT, GAC Lysine K AAA, AAG Arginine R CGT, CGC, CGA, CGG, AGA, AGG
Seleno- Sec UGA in mRNA in presence cysteine of Selenocystein
insertion element (SECIS) Stop codons Stop TAA, TAG, TGA
[0188] Features, which may be considered beneficial in some
embodiments of the present invention, may be encoded by the primary
construct and may flank the ORF as a first or second flanking
region. The flanking regions may be incorporated into the primary
construct before and/or after optimization of the ORF. It is not
required that a primary construct contain both a 5' and 3' flanking
region. Examples of such features include, but are not limited to,
untranslated regions (UTRs), Kozak sequences, an oligo(dT)
sequence, and detectable tags and may include multiple cloning
sites which may have XbaI recognition.
[0189] In some embodiments, a 5' UTR and/or a 3' UTR may be
provided as flanking regions. Multiple 5' or 3' UTRs may be
included in the flanking regions and may be the same or of
different sequences. Any portion of the flanking regions, including
none, may be codon optimized and any may independently contain one
or more different structural or chemical modifications, before
and/or after codon optimization. Combinations of features may be
included in the first and second flanking regions and may be
contained within other features. For example, the ORF may be
flanked by a 5' UTR which may contain a strong Kozak translational
initiation signal and/or a 3' UTR which may include an oligo(dT)
sequence for templated addition of a poly-A tail.
[0190] Tables 2 and 3 of co-pending International Application No.
PCT/US2013/030062, filed Mar. 9, 2013 the content of which are
herein incorporated by reference in its entirety, provide a listing
of exemplary UTRs which may be utilized in the primary construct of
the present invention as flanking regions. Variants of 5' UTRs may
be utilized wherein one or more nucleotides are added or removed to
the termini, including A, T, C or G.
[0191] It should be understood that those listed in the previous
tables are examples and that any UTR from any gene may be
incorporated into the respective first or second flanking region of
the primary construct. Furthermore, multiple wild-type UTRs of any
known gene may be utilized. It is also within the scope of the
present invention to provide artificial UTRs which are not variants
of wild type genes. These UTRs or portions thereof may be placed in
the same orientation as in the transcript from which they were
selected or may be altered in orientation or location. Hence a 5'
or 3' UTR may be inverted, shortened, lengthened, made chimeric
with one or more other 5' UTRs or 3' UTRs. As used herein, the term
"altered" as it relates to a UTR sequence, means that the UTR has
been changed in some way in relation to a reference sequence. For
example, a 3' or 5' UTR may be altered relative to a wild type or
native UTR by the change in orientation or location as taught above
or may be altered by the inclusion of additional nucleotides,
deletion of nucleotides, swapping or transposition of nucleotides.
Any of these changes producing an "altered" UTR (whether 3' or 5')
comprise a variant UTR.
[0192] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA of the present invention may have a heterologous UTR.
As used herein "heterologous UTRs" are those UTRs which are not
naturally found with the coding region encoded on the same or
instant polynucleotide, primary construct or mmRNA. As a
non-limiting example, the first flanking region may comprise a
heterologous UTR. As another non-limiting example, the second
flanking region may comprise a heterologous UTR. As yet another
non-limiting example, the first and second flanking regions may
each comprise a heterologous UTR. The heterologous UTR in the first
flanking region may be derived from the same species or a different
species than the heterologous UTR in the second flanking
region.
[0193] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA of the present invention may have a heterologous UTR
which is not derived from the beta-globin gene. As a non-limiting
example, the heterologous UTR may be a 5'UTR and is not derived
from the beta-globin gene. As another non-limiting example, the
heterologous UTR may be a 3'UTR and is not derived from the
beta-globin gene.
[0194] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA of the present invention comprise a heterologous 5'UTR
with the proviso that the heterologous 5'UTR is not derived from
the beta-globin gene.
[0195] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA of the present invention comprise a heterologous 3'UTR
with the proviso that the heterologous 3'UTR is not derived from
the beta-globin gene.
[0196] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA of the present invention may have a homologous UTRs.
As used herein "homologous UTRs" are those UTRs which are naturally
found associated with the coding region of the mRNA, such as the
wild type UTR. As a non-limiting example, the first flanking region
may comprise a homologous UTR. As another non-limiting example, the
second flanking region may comprise a homologous UTR. As yet
another non-limiting example, the first and second flanking regions
may each comprise a homologous UTR.
[0197] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA of the present invention may have a heterologous UTR
in the first flanking region and a homologous UTR in the second
flanking region.
[0198] In another embodiment, the polynucleotides, primary
constructs and/or mmRNA of the present invention may have a
homologous UTR in the first flanking region and a heterologous UTR
in the second flanking region.
[0199] In one embodiment, a double, triple or quadruple UTR such as
a 5' or 3' UTR may be used. As used herein, a "double" UTR is one
in which two copies of the same UTR are encoded either in series or
substantially in series. For example, a double beta-globin 3' UTR
may be used as described in US Patent publication 20100129877, the
contents of which are incorporated herein by reference in its
entirety.
[0200] It is also within the scope of the present invention to have
patterned UTRs. As used herein "patterned UTRs" are those UTRs
which reflect a repeating or alternating pattern, such as, but not
limited to, AB, ABA, ABAB, ABABA, ABABAB, AAB, AABB, AABBA, AABBAA,
AABBAAB, AABBAABB, AABBAABBA, ABB, ABBA, AABBAABBAABB, ABC, ABCA,
ABCAB, ABCABC, ABCABCA, ABCABCAB, ABCABCABC, ABCB, ABCBC, ABCBCA,
ABCC, ABCCB, ABCCBA, or variants thereof repeated once, twice, or
more than 3 times. In these patterns, each letter, A, B, or C
represent a different UTR at the nucleotide level. The different
UTRs represented in each pattern may be derived from the same
species or they may be derived from different species.
[0201] In one embodiment, the flanking regions may comprise
patterned UTRs. In one embodiment, the first flanking region and
the second flanking region may each comprise a patterned UTR. The
pattern for each UTR may be the same or different. As a
non-limiting example, the patterned UTR in first flanking region is
different than the patterned UTR in the second flanking region. As
another non-limiting example, the patterned UTR in the first
flanking region and the second flanking region may be the same.
[0202] In one embodiment, the flanking regions may comprise
patterned UTRs derived from the same species. As a non-limiting
example, the patterned UTR in the first flanking region may be
derived from the same species as the patterned UTR in the second
flanking region, but the patterned UTR in the first flanking region
is different from the patterned UTR in the second flanking
region.
[0203] In one embodiment, the first flanking region may comprise a
patterned UTR derived from a first species and the second flanking
region may comprise a patterned UTR derived from a second
species.
[0204] In another embodiment, the flanking regions may comprise
patterned UTRs derived from different species.
[0205] In one embodiment, the patterned UTR may comprise
heterologous and homologous UTRs. As a non-limiting example, the
first flanking region may comprise heterologous UTRs and the second
flanking region may comprise homologous UTRs.
[0206] In one embodiment, flanking regions are selected from a
family of transcripts whose proteins share a common function,
structure, feature of property. For example, polypeptides of
interest may belong to a family of proteins which are expressed in
a particular cell, tissue or at some time during development. The
UTRs from any of these genes may be swapped for any other UTR of
the same or different family of proteins to create a new chimeric
primary transcript. As used herein, a "family of proteins" is used
in the broadest sense to refer to a group of two or more
polypeptides of interest which share at least one function,
structure, feature, localization, origin, or expression
pattern.
[0207] After optimization (if desired), the primary construct
components are reconstituted and transformed into a vector such as,
but not limited to, plasmids, viruses, cosmids, and artificial
chromosomes. For example, the optimized construct may be
reconstituted and transformed into chemically competent E. coli,
yeast, neurospora, maize, drosophila, etc. where high copy
plasmid-like or chromosome structures occur by methods described
herein.
Stop Codons
[0208] In one embodiment, the primary constructs of the present
invention may include at least two stop codons before the 3'
untranslated region (UTR). The stop codon may be selected from TGA,
TAA and TAG. In one embodiment, the primary constructs of the
present invention include the stop codon TGA and one additional
stop codon. In a further embodiment the addition stop codon may be
TAA.
Vector Amplification
[0209] The vector containing the primary construct is then
amplified and the plasmid isolated and purified using methods known
in the art such as, but not limited to, a maxi prep using the
Invitrogen PURELINK.TM. HiPure Maxiprep Kit (Carlsbad, Calif.).
Plasmid Linearization
[0210] The plasmid may then be linearized using methods known in
the art such as, but not limited to, the use of restriction enzymes
and buffers. The linearization reaction may be purified using
methods including, for example Invitrogen's PURELINK.TM. PCR Micro
Kit (Carlsbad, Calif.), and HPLC based purification methods such
as, but not limited to, strong anion exchange HPLC, weak anion
exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic
interaction HPLC (HIC-HPLC) and Invitrogen's standard PURELINK.TM.
PCR Kit (Carlsbad, Calif.). The purification method may be modified
depending on the size of the linearization reaction which was
conducted. The linearized plasmid is then used to generate cDNA for
in vitro transcription (IVT) reactions.
cDNA Template Synthesis
[0211] A cDNA template may be synthesized by having a linearized
plasmid undergo polymerase chain reaction (PCR). Table 4 of
International Application No. PCT/US2013/030062, filed Mar. 9,
2013, the contents of which are herein incorporated by reference in
its entirety, provides a listing of primers and probes that may be
usefully in the PCR reactions of the present invention. is a
listing of primers and probes that may be useful in the PCR
reactions of the present invention. It should be understood that
the listing is not exhaustive and that primer-probe design for any
amplification is within the skill of those in the art. Probes may
also contain chemically modified bases to increase base-pairing
fidelity to the target molecule and base-pairing strength. Such
modifications may include 5-methyl-Cytidine, 2,6-di-amino-purine,
2'-fluoro, phosphoro-thioate, or locked nucleic acids.
[0212] In one embodiment, the cDNA may be submitted for sequencing
analysis before undergoing transcription.
mRNA Production
[0213] The process of polynucleotide production may include, but is
not limited to, in vitro transcription, cDNA template removal and
RNA clean-up, and capping and/or tailing reactions.
In Vitro Transcription
[0214] The cDNA produced in the previous step may be transcribed
using an in vitro transcription (IVT) system. The system typically
comprises a transcription buffer, nucleotide triphosphates (NTPs),
an RNase inhibitor and a polymerase. The NTPs may be manufactured
in house, may be selected from a supplier, or may be synthesized as
described herein. The NTPs may be selected from, but are not
limited to, those described herein including natural and unnatural
(modified) NTPs. The polymerase may be selected from, but is not
limited to, T7 RNA polymerase, T3 RNA polymerase and mutant
polymerases such as, but not limited to, polymerases able to be
incorporated into modified nucleic acids.
RNA Polymerases
[0215] Any number of RNA polymerases or variants may be used in the
design of the constructs of the present invention.
[0216] RNA polymerases may be modified by inserting or deleting
amino acids of the RNA polymerase sequence. As a non-limiting
example, the RNA polymerase may be modified to exhibit an increased
ability to incorporate a 2'-modified nucleotide triphosphate
compared to an unmodified RNA polymerase (see International
Publication WO2008078180 and U.S. Pat. No. 8,101,385; herein
incorporated by reference in their entireties).
[0217] Variants may be obtained by evolving an RNA polymerase,
optimizing the RNA polymerase amino acid and/or nucleic acid
sequence and/or by using other methods known in the art. As a
non-limiting example, T7 RNA polymerase variants may be evolved
using the continuous directed evolution system set out by Esvelt et
al. (Nature (2011) 472(7344):499-503; herein incorporated by
reference in its entirety) where clones of T7 RNA polymerase may
encode at least one mutation such as, but not limited to, lysine at
position 93 substituted for threonine (K93T), I4M, A7T, E63V, V64D,
A65E, D66Y, T76N, C125R, S128R, A136T, N165S, G175R, H176L, Y178H,
F182L, L196F, G198V, D208Y, E222K, S228A, Q239R, T243N, G259D,
M267I, G280C, H300R, D351A, A354S, E356D, L360P, A383V, Y385C,
D388Y, S397R, M401T, N410S, K450R, P451T, G452V, E484A, H523L,
H524N, G542V, E565K, K577E, K577M, N601S, S684Y, L699I, K713E,
N748D, Q754R, E775K, A827V, D851N or L864F. As another non-limiting
example, T7 RNA polymerase variants may encode at least mutation as
described in U.S. Pub. Nos. 20100120024 and 20070117112; herein
incorporated by reference in their entireties. Variants of RNA
polymerase may also include, but are not limited to, substitutional
variants, conservative amino acid substitution, insertional
variants, deletional variants and/or covalent derivatives.
[0218] In one embodiment, the primary construct may be designed to
be recognized by the wild type or variant RNA polymerases. In doing
so, the primary construct may be modified to contain sites or
regions of sequence changes from the wild type or parent primary
construct.
[0219] In one embodiment, the primary construct may be designed to
include at least one substitution and/or insertion upstream of an
RNA polymerase binding or recognition site, downstream of the RNA
polymerase binding or recognition site, upstream of the TATA box
sequence, downstream of the TATA box sequence of the primary
construct but upstream of the coding region of the primary
construct, within the 5'UTR, before the 5'UTR and/or after the
5'UTR.
[0220] In one embodiment, the 5'UTR of the primary construct may be
replaced by the insertion of at least one region and/or string of
nucleotides of the same base. The region and/or string of
nucleotides may include, but is not limited to, at least 3, at
least 4, at least 5, at least 6, at least 7 or at least 8
nucleotides and the nucleotides may be natural and/or unnatural. As
a non-limiting example, the group of nucleotides may include 5-8
adenine, cytosine, thymine, a string of any of the other
nucleotides disclosed herein and/or combinations thereof.
[0221] In one embodiment, the 5'UTR of the primary construct may be
replaced by the insertion of at least two regions and/or strings of
nucleotides of two different bases such as, but not limited to,
adenine, cytosine, thymine, any of the other nucleotides disclosed
herein and/or combinations thereof. For example, the 5'UTR may be
replaced by inserting 5-8 adenine bases followed by the insertion
of 5-8 cytosine bases. In another example, the 5'UTR may be
replaced by inserting 5-8 cytosine bases followed by the insertion
of 5-8 adenine bases.
[0222] In one embodiment, the primary construct may include at
least one substitution and/or insertion downstream of the
transcription start site which may be recognized by an RNA
polymerase. As a non-limiting example, at least one substitution
and/or insertion may occur downstream the transcription start site
by substituting at least one nucleic acid in the region just
downstream of the transcription start site (such as, but not
limited to, +1 to +6). Changes to region of nucleotides just
downstream of the transcription start site may affect initiation
rates, increase apparent nucleotide triphosphate (NTP) reaction
constant values, and increase the dissociation of short transcripts
from the transcription complex curing initial transcription (Brieba
et al, Biochemistry (2002) 41: 5144-5149; herein incorporated by
reference in its entirety). The modification, substitution and/or
insertion of at least one nucleic acid may cause a silent mutation
of the nucleic acid sequence or may cause a mutation in the amino
acid sequence.
[0223] In one embodiment, the primary construct may include the
substitution of at least 1, at least 2, at least 3, at least 4, at
least 5, at least 6, at least 7, at least 8, at least 9, at least
10, at least 11, at least 12 or at least 13 guanine bases
downstream of the transcription start site.
[0224] In one embodiment, the primary construct may include the
substitution of at least 1, at least 2, at least 3, at least 4, at
least 5 or at least 6 guanine bases in the region just downstream
of the transcription start site. As a non-limiting example, if the
nucleotides in the region are GGGAGA the guanine bases may be
substituted by at least 1, at least 2, at least 3 or at least 4
adenine nucleotides. In another non-limiting example, if the
nucleotides in the region are GGGAGA the guanine bases may be
substituted by at least 1, at least 2, at least 3 or at least 4
cytosine bases. In another non-limiting example, if the nucleotides
in the region are GGGAGA the guanine bases may be substituted by at
least 1, at least 2, at least 3 or at least 4 thymine, and/or any
of the nucleotides described herein.
[0225] In one embodiment, the primary construct may include at
least one substitution and/or insertion upstream of the start
codon. For the purpose of clarity, one of skill in the art would
appreciate that the start codon is the first codon of the protein
coding region whereas the transcription start site is the site
where transcription begins. The primary construct may include, but
is not limited to, at least 1, at least 2, at least 3, at least 4,
at least 5, at least 6, at least 7 or at least 8 substitutions
and/or insertions of nucleotide bases. The nucleotide bases may be
inserted or substituted at 1, at least 1, at least 2, at least 3,
at least 4 or at least 5 locations upstream of the start codon. The
nucleotides inserted and/or substituted may be the same base (e.g.,
all A or all C or all T or all G), two different bases (e.g., A and
C, A and T, or C and T), three different bases (e.g., A, C and T or
A, C and T) or at least four different bases. As a non-limiting
example, the guanine base upstream of the coding region in the
primary construct may be substituted with adenine, cytosine,
thymine, or any of the nucleotides described herein. In another
non-limiting example the substitution of guanine bases in the
primary construct may be designed so as to leave one guanine base
in the region downstream of the transcription start site and before
the start codon (see Esvelt et al. Nature (2011) 472(7344):499-503;
herein incorporated by reference in its entirety). As a
non-limiting example, at least 5 nucleotides may be inserted at 1
location downstream of the transcription start site but upstream of
the start codon and the at least 5 nucleotides may be the same base
type.
cDNA Template Removal and Clean-Up
[0226] The cDNA template may be removed using methods known in the
art such as, but not limited to, treatment with Deoxyribonuclease I
(DNase I). RNA clean-up may also include a purification method such
as, but not limited to, AGENCOURT.RTM. CLEANSEQ.RTM. system from
Beckman Coulter (Danvers, Mass.), HPLC based purification methods
such as, but not limited to, strong anion exchange HPLC, weak anion
exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic
interaction HPLC (HIC-HPLC).
Capping and/or Tailing Reactions
[0227] The primary construct or mmRNA may also undergo capping
and/or tailing reactions. A capping reaction may be performed by
methods known in the art to add a 5' cap to the 5' end of the
primary construct. Methods for capping include, but are not limited
to, using a Vaccinia Capping enzyme (New England Biolabs, Ipswich,
Mass.).
[0228] A poly-A tailing reaction may be performed by methods known
in the art, such as, but not limited to, 2' O-methyltransferase and
by methods as described herein. If the primary construct generated
from cDNA does not include a poly-T, it may be beneficial to
perform the poly-A-tailing reaction before the primary construct is
cleaned.
Purification
[0229] Primary construct or mmRNA purification may include, but is
not limited to, mRNA or mmRNA clean-up, quality assurance and
quality control. mRNA or mmRNA clean-up may be performed by methods
known in the arts such as, but not limited to, AGENCOURT.RTM. beads
(Beckman Coulter Genomics, Danvers, Mass.), poly-T beads, LNA.TM.
oligo-T capture probes (EXIQON.RTM. Inc, Vedbaek, Denmark) or HPLC
based purification methods such as, but not limited to, strong
anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC
(RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC). The term
"purified" when used in relation to a polynucleotide such as a
"purified mRNA or mmRNA" refers to one that is separated from at
least one contaminant. As used herein, a "contaminant" is any
substance which makes another unfit, impure or inferior. Thus, a
purified polynucleotide (e.g., DNA and RNA) is present in a form or
setting different from that in which it is found in nature, or a
form or setting different from that which existed prior to
subjecting it to a treatment or purification method.
[0230] A quality assurance and/or quality control check may be
conducted using methods such as, but not limited to, gel
electrophoresis, UV absorbance, or analytical HPLC.
[0231] In another embodiment, the mRNA or mmRNA may be sequenced by
methods including, but not limited to
reverse-transcriptase-PCR.
[0232] In one embodiment, the mRNA or mmRNA may be quantified using
methods such as, but not limited to, ultraviolet visible
spectroscopy (UV/Vis). A non-limiting example of a UV/Vis
spectrometer is a NANODROP.RTM. spectrometer (ThermoFisher,
Waltham, Mass.). The quantified mRNA or mmRNA may be analyzed in
order to determine if the mRNA or mmRNA may be of proper size,
check that no degradation of the mRNA or mmRNA has occurred.
Degradation of the mRNA and/or mmRNA may be checked by methods such
as, but not limited to, agarose gel electrophoresis, HPLC based
purification methods such as, but not limited to, strong anion
exchange HPLC, weak anion exchange HPLC, reverse phase HPLC
(RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid
chromatography-mass spectrometry (LCMS), capillary electrophoresis
(CE) and capillary gel electrophoresis (CGE).
Signal Peptides or Proteins
[0233] The primary constructs or mmRNA may also encode additional
features which facilitate trafficking of the polypeptides to
therapeutically relevant sites. One such feature which aids in
protein trafficking is the signal peptide sequence. As used herein,
a "signal sequence" or "signal peptide" is a polynucleotide or
polypeptide, respectively, which is from about 9 to 200 nucleotides
(3-60 amino acids) in length which is incorporated at the 5' (or
N-terminus) of the coding region or polypeptide encoded,
respectively. Addition of these sequences result in trafficking of
the encoded polypeptide to the endoplasmic reticulum through one or
more secretory pathways. Some signal peptides are cleaved from the
protein by signal peptidase after the proteins are transported.
[0234] Signal sequences may be selected from any of those listed in
Table 3 below and those listed in Table 5 of co-pending
International Application No. PCT/US2013/030062, filed Mar. 9,
2013, the contents of which are incorporated herein by
reference.
TABLE-US-00003 +0 TABLE 3 Signal Peptides SEQ ID Description
Sequence NO HSA/KEX2 Signal MKWVSFISLLFLFSSAYSGSLDKR 5 Peptide
FGF23 Signal MLGARLRLWVCALCSVCSMSVLRA 6 Peptide hGH Signal
MATGSRTSLLLAFGLLCLPWLQEG 7 Peptide SA GCSF Signal
MAGPATQSPMKLMALQLLLWHSAL 8 Peptide WTVQE
[0235] Protein signal sequences which may be incorporated for
encoding by the polynucleotides, primary constructs or mmRNA of the
invention include signal sequences from .alpha.-1-antitrypsin,
G-CSF, Factor IX, Prolactin, Albumin, HMMSP38, ornithine
carbamoyltransferase, Cytochrome C Oxidase subunit 8A, Type III,
bacterial, viral, secretion signals, Vrg-6, PhoA, OmpA, STI, STII,
Amylase, Alpha Factor, Endoglucanase V, Secretion signal, fungal
and fibronectin.
[0236] In the Table 5 of co-pending International Application No.
PCT/US2013/030062, SS is secretion signal and MLS is mitochondrial
leader signal. The primary constructs or mmRNA of the present
invention may be designed to encode any of the signal peptide
sequences or fragments or variants thereof. These sequences may be
included at the beginning of the polypeptide coding region, in the
middle or at the terminus or alternatively into a flanking
region.
[0237] Additional signal peptide sequences which may be utilized in
the present invention include those taught in, for example,
databases such as those found at http://www.signalpeptide.de/ or
http://proline.bic.nus.edu.sg/spdb/. Those described in U.S. Pat.
Nos. 8,124,379; 7,413,875 and 7,385,034 are also within the scope
of the invention and the contents of each are incorporated herein
by reference in their entirety.
Target Selection
[0238] According to the present invention, the primary constructs
comprise at least a first region of linked nucleosides encoding at
least one polypeptide of interest. The polypeptides of interest or
"targets" or proteins and peptides of the present invention are
listed in Table 6 of co-pending U.S. Provisional Patent Application
No. 61/618,862, filed Apr. 2, 2012, entitled Modified
Polynucleotides for the Production of Biologics; U.S. Provisional
Patent Application No. 61/681,645, filed Aug. 10, 2012, entitled
Modified Polynucleotides for the Production of Biologics; U.S.
Provisional Patent Application No. 61/737,130, filed Dec. 14, 2012,
entitled Modified Polynucleotides for the Production of Biologics;
International Patent Application No. PCT/US2013/030062, filed Mar.
9, 2013, entitled Modified Polynucleotides for the Production of
Biologics and Proteins Associated with Human Disease; U.S.
Provisional Patent Application No. 61/618,866, filed Apr. 2, 2012,
entitled Modified Polynucleotides for the Production of Antibodies;
U.S. Provisional Patent Application No. 61/681,647, filed Aug. 10,
2012, entitled Modified Polynucleotides for the Production of
Antibodies; U.S. Provisional Patent Application No. 61/737,134,
filed Dec. 14, 2012, entitled Modified Polynucleotides for the
Production of Antibodies; U.S. Provisional Patent Application No.
61/618,868, filed Apr. 2, 2012, entitled Modified Polynucleotides
for the Production of Vaccines; U.S. Provisional Patent Application
No. 61/681,648, filed Aug. 10, 2012, entitled Modified
Polynucleotides for the Production of Vaccines; U.S. Provisional
Patent Application No. 61/737,135, filed Dec. 14, 2012, entitled
Modified Polynucleotides for the Production of Vaccines; U.S.
Provisional Patent Application No. 61/618,873, filed Apr. 2, 2012,
entitled Modified Polynucleotides for the Production of Secreted
Proteins; U.S. Provisional Patent Application No. 61/681,650, filed
Aug. 10, 2012, entitled Modified Polynucleotides for the Production
of Secreted Proteins; U.S. Provisional Patent Application No.
61/737,147, filed Dec. 14, 2012, entitled Modified Polynucleotides
for the Production of Secreted Proteins; International Patent
Application No. PCT/US2013/030064, filed Mar. 9, 2013, entitled
Modified Polynucleotides for the Production of Secreted Proteins;
U.S. Provisional Patent Application No. 61/618,878, filed Apr. 2,
2012, entitled Modified Polynucleotides for the Production of
Plasma Membrane Proteins; U.S. Provisional Patent Application No.
61/681,654, filed Aug. 10, 2012, entitled Modified Polynucleotides
for the Production of Plasma Membrane Proteins; U.S. Provisional
Patent Application No. 61/737,152, filed Dec. 14, 2012, entitled
Modified Polynucleotides for the Production of Plasma Membrane
Proteins; International Patent Application No. PCT/US2013/030059,
filed Mar. 9, 2013, entitled Modified Polynucleotides for the
Production of Membrane Proteins; U.S. Provisional Patent
Application No. 61/618,885, filed Apr. 2, 2012, entitled Modified
Polynucleotides for the Production of Cytoplasmic and Cytoskeletal
Proteins; U.S. Provisional Patent Application No. 61/681,658, filed
Aug. 10, 2012, entitled Modified Polynucleotides for the Production
of Cytoplasmic and Cytoskeletal Proteins; U.S. Provisional Patent
Application No. 61/737,155, filed Dec. 14, 2012, entitled Modified
Polynucleotides for the Production of Cytoplasmic and Cytoskeletal
Proteins; International Patent Application No. PCT/US2013/030066,
filed Mar. 9, 2013, entitled Modified Polynucleotides for the
Production of Cytoplasmic and Cytoskeletal Proteins; U.S.
Provisional Patent Application No. 61/618,896, filed Apr. 2, 2012,
entitled Modified Polynucleotides for the Production of
Intracellular Membrane Bound Proteins; U.S. Provisional Patent
Application No. 61/668,157, filed Jul. 5, 2012, entitled Modified
Polynucleotides for the Production of Intracellular Membrane Bound
Proteins; U.S. Provisional Patent Application No. 61/681,661, filed
Aug. 10, 2012, entitled Modified Polynucleotides for the Production
of Intracellular Membrane Bound Proteins; U.S. Provisional Patent
Application No. 61/737,160, filed Dec. 14, 2012, entitled Modified
Polynucleotides for the Production of Intracellular Membrane Bound
Proteins; U.S. Provisional Patent Application No. 61/618,911, filed
Apr. 2, 2012, entitled Modified Polynucleotides for the Production
of Nuclear Proteins; U.S. Provisional Patent Application No.
61/681,667, filed Aug. 10, 2012, entitled Modified Polynucleotides
for the Production of Nuclear Proteins; U.S. Provisional Patent
Application No. 61/737,168, filed Dec. 14, 2012, entitled Modified
Polynucleotides for the Production of Nuclear Proteins;
International Patent Application No. PCT/US2013/030067, filed Mar.
9, 2013, entitled Modified Polynucleotides for the Production of
Nuclear Proteins; U.S. Provisional Patent Application No.
61/618,922, filed Apr. 2, 2012, entitled Modified Polynucleotides
for the Production of Proteins; U.S. Provisional Patent Application
No. 61/681,675, filed Aug. 10, 2012, entitled Modified
Polynucleotides for the Production of Proteins; U.S. Provisional
Patent Application No. 61/737,174, filed Dec. 14, 2012, entitled
Modified Polynucleotides for the Production of Proteins;
International Patent Application No. PCT/US2013/030060, filed Mar.
9, 2013, entitled Modified Polynucleotides for the Production of
Proteins; U.S. Provisional Patent Application No. 61/618,935, filed
Apr. 2, 2012, entitled Modified Polynucleotides for the Production
of Proteins Associated with Human Disease; U.S. Provisional Patent
Application No. 61/681,687, filed Aug. 10, 2012, entitled Modified
Polynucleotides for the Production of Proteins Associated with
Human Disease; U.S. Provisional Patent Application No. 61/737,184,
filed Dec. 14, 2012, entitled Modified Polynucleotides for the
Production of Proteins Associated with Human Disease; International
Patent Application No. PCT/US2013/030061, filed Mar. 9, 2013,
entitled Modified Polynucleotides for the Production of Proteins
Associated with Human Disease; U.S. Provisional Patent Application
No. 61/618,945, filed Apr. 2, 2012, entitled Modified
Polynucleotides for the Production of Proteins Associated with
Human Disease; U.S. Provisional Patent Application No. 61/681,696,
filed Aug. 10, 2012, entitled Modified Polynucleotides for the
Production of Proteins Associated with Human Disease; U.S.
Provisional Patent Application No. 61/737,191, filed Dec. 14, 2012,
entitled Modified Polynucleotides for the Production of Proteins
Associated with Human Disease; U.S. Provisional Patent Application
No. 61/618,953, filed Apr. 2, 2012, entitled Modified
Polynucleotides for the Production of Proteins Associated with
Human Disease; U.S. Provisional Patent Application No. 61/681,704,
filed Aug. 10, 2012, entitled Modified Polynucleotides for the
Production of Proteins Associated with Human Disease; U.S.
Provisional Patent Application No. 61/737,203, filed Dec. 14, 2012,
entitled Modified Polynucleotides for the Production of Proteins
Associated with Human Disease; in Tables 6 and 7 of co-pending U.S.
Provisional Patent Application No. 61/681,720, filed Aug. 10, 2012,
entitled Modified Polynucleotides for the Production of Cosmetic
Proteins and Peptides; U.S. Provisional Patent Application No.
61/737,213, filed Dec. 14, 2012, entitled Modified Polynucleotides
for the Production of Cosmetic Proteins and Peptides; U.S.
Provisional Patent Application No. 61/681,742, filed Aug. 10, 2012,
entitled Modified Polynucleotides for the Production of
Oncology-Related Proteins and Peptides; International Application
No. PCT/US2013/030070, filed Mar. 9, 2013, entitled Modified
Polynucleotides for the Production of Oncology-Related Proteins and
Peptides; in Tables 6, 178 and 179 of co-pending International
Application No. PCT/US2013/030068, filed Mar. 9, 2013, entitled
Modified Polynucleotides for the Production of Cosmetic Proteins
and Peptides; in Tables 6, 28 and 29 of co-pending U.S. Provisional
Patent Application No. 61/618,870, filed Apr. 2, 2012, entitled
Modified Polynucleotides for the Production of Therapeutic Proteins
and Peptides; in Tables 6, 56 and 57 of co-pending U.S. Provisional
Patent Application No. 61/681,649, filed Aug. 10, 2012, entitled
Modified Polynucleotides for the Production of Therapeutic Proteins
and Peptides; in Tables 6, 186 and 187 of co-pending U.S.
Provisional Patent Application No. 61/737,139, filed Dec. 14, 2012,
Modified Polynucleotides for the Production of Therapeutic Proteins
and Peptides; in Tables 6, 185 and 186 of co-pending International
Application No PCT/US2013/030063, filed Mar. 9, 2013, entitled
Modified Polynucleotides; in Table 6 of co-pending International
Application No. PCT/US2013/031821, filed Mar. 15, 2013, entitled In
Vivo Production of Proteins, the contents of each of which are
herein incorporated by reference in their entireties.
Protein Cleavage Signals and Sites
[0239] In one embodiment, the polypeptides of the present invention
may include at least one protein cleavage signal containing at
least one protein cleavage site. The protein cleavage site may be
located at the N-terminus, the C-terminus, at any space between the
N- and the C-termini such as, but not limited to, half-way between
the N- and C-termini, between the N-terminus and the half way
point, between the half way point and the C-terminus, and
combinations thereof.
[0240] The polypeptides of the present invention may include, but
is not limited to, a proprotein convertase (or prohormone
convertase), thrombin or Factor Xa protein cleavage signal.
Proprotein convertases are a family of nine proteinases, comprising
seven basic amino acid-specific subtilisin-like serine proteinases
related to yeast kexin, known as prohormone convertase 1/3 (PC1/3),
PC2, furin, PC4, PC5/6, paired basic amino-acid cleaving enzyme 4
(PACE4) and PC7, and two other subtilases that cleave at non-basic
residues, called subtilisin kexin isozyme 1 (SKI-1) and proprotein
convertase subtilisin kexin 9 (PCSK9). In one embodiment, the
primary constructs and the mmRNA of the present invention may be
engineered such that the primary construct or mmRNA contains at
least one encoded protein cleavage signal. The encoded protein
cleavage signal may be located before the start codon, after the
start codon, before the coding region, within the coding region
such as, but not limited to, half way in the coding region, between
the start codon and the half way point, between the half way point
and the stop codon, after the coding region, before the stop codon,
between two stop codons, after the stop codon and combinations
thereof.
[0241] In one embodiment, the primary constructs or mmRNA of the
present invention may include at least one encoded protein cleavage
signal containing at least one protein cleavage site. The encoded
protein cleavage signal may include, but is not limited to, a
proprotein convertase (or prohormone convertase), thrombin and/or
Factor Xa protein cleavage signal. One of skill in the art may use
Table 2 above or other known methods to determine the appropriate
encoded protein cleavage signal to include in the primary
constructs or mmRNA of the present invention. In one embodiment,
the polypeptides of the present invention include at least one
protein cleavage signal and/or site.
[0242] As a non-limiting example, U.S. Pat. No. 7,374,930 and U.S.
Pub. No. 20090227660, herein incorporated by reference in their
entireties, use a furin cleavage site to cleave the N-terminal
methionine of GLP-1 in the expression product from the Golgi
apparatus of the cells. In one embodiment, the polypeptides of the
present invention include at least one protein cleavage signal
and/or site with the proviso that the polypeptide is not GLP-1.
[0243] In one embodiment, the primary constructs or mmRNA of the
present invention includes at least one encoded protein cleavage
signal and/or site.
[0244] In one embodiment, the primary constructs or mmRNA of the
present invention includes at least one encoded protein cleavage
signal and/or site with the proviso that the primary construct or
mmRNA does not encode GLP-1.
[0245] In one embodiment, the primary constructs or mmRNA of the
present invention may include more than one coding region. Where
multiple coding regions are present in the primary construct or
mmRNA of the present invention, the multiple coding regions may be
separated by encoded protein cleavage sites. As a non-limiting
example, the primary construct or mmRNA may be signed in an ordered
pattern. On such pattern follows AXBY form where A and B are coding
regions which may be the same or different coding regions and/or
may encode the same or different polypeptides, and X and Y are
encoded protein cleavage signals which may encode the same or
different protein cleavage signals. A second such pattern follows
the form AXYBZ where A and B are coding regions which may be the
same or different coding regions and/or may encode the same or
different polypeptides, and X, Y and Z are encoded protein cleavage
signals which may encode the same or different protein cleavage
signals. A third pattern follows the form ABXCY where A, B and C
are coding regions which may be the same or different coding
regions and/or may encode the same or different polypeptides, and X
and Y are encoded protein cleavage signals which may encode the
same or different protein cleavage signals.
[0246] In on embodiment, the polypeptides, primary constructs and
mmRNA can also contain sequences that encode protein cleavage sites
so that the polypeptides, primary constructs and mmRNA can be
released from a carrier region or a fusion partner by treatment
with a specific protease for said protein cleavage site.
III. MODIFICATIONS
[0247] Herein, in a polynucleotide (such as a primary construct or
a mRNA molecule), the terms "modification" or, as appropriate,
"modified" refer to modification with respect to A, G, U or C
ribonucleotides. Generally, herein, these terms are not intended to
refer to the ribonucleotide modifications in naturally occurring
5'-terminal mRNA cap moieties. In a polypeptide, the term
"modification" refers to a modification as compared to the
canonical set of 20 amino acids.
[0248] The modifications may be various distinct modifications. In
some embodiments, the coding region, the flanking regions and/or
the terminal regions may contain one, two, or more (optionally
different) nucleoside or nucleotide modifications. In some
embodiments, a modified polynucleotide, primary construct, or mmRNA
introduced to a cell may exhibit reduced degradation in the cell,
as compared to an unmodified polynucleotide, primary construct, or
mmRNA.
[0249] The polynucleotides, primary constructs, and mmRNA can
include any useful modification, such as to the sugar, the
nucleobase, or the internucleoside linkage (e.g. to a linking
phosphate/to a phosphodiester linkage/to the phosphodiester
backbone). One or more atoms of a pyrimidine nucleobase may be
replaced or substituted with optionally substituted amino,
optionally substituted thiol, optionally substituted alkyl (e.g.,
methyl or ethyl), or halo (e.g., chloro or fluoro). In certain
embodiments, modifications (e.g., one or more modifications) are
present in each of the sugar and the internucleoside linkage.
Modifications according to the present invention may be
modifications of ribonucleic acids (RNAs) to deoxyribonucleic acids
(DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs),
peptide nucleic acids (PNAs), locked nucleic acids (LNAs) or
hybrids thereof). Additional modifications are described
herein.
[0250] As described herein, in some embodiments, the
polynucleotides, primary constructs, and mmRNA of the invention do
not substantially induce an innate immune response of a cell into
which the mRNA is introduced. Features of an induced innate immune
response include 1) increased expression of pro-inflammatory
cytokines, 2) activation of intracellular PRRs (RIG-I, MDA5, etc,
and/or 3) termination or reduction in protein translation. In other
embodiments, an immune response is induced.
[0251] In certain embodiments, it may desirable to intracellularly
degrade a modified nucleic acid molecule introduced into the cell.
For example, degradation of a modified nucleic acid molecule may be
preferable if precise timing of protein production is desired.
Thus, in some embodiments, the invention provides a modified
nucleic acid molecule containing a degradation domain, which is
capable of being acted on in a directed manner within a cell.
[0252] In another aspect, the present disclosure provides
polynucleotides comprising a nucleoside or nucleotide that can
disrupt the binding of a major groove interacting, e.g. binding,
partner with the polynucleotide (e.g., where the modified
nucleotide has decreased binding affinity to major groove
interacting partner, as compared to an unmodified nucleotide).
[0253] The polynucleotides, primary constructs, and mmRNA can
optionally include other agents (e.g., RNAi-inducing agents, RNAi
agents, siRNAs, shRNAs, miRNAs, antisense RNAs, ribozymes,
catalytic DNA, tRNA, RNAs that induce triple helix formation,
aptamers, vectors, etc.). In some embodiments, the polynucleotides,
primary constructs, or mmRNA may include one or more messenger RNAs
(mRNAs) and one or more modified nucleoside or nucleotides (e.g.,
mmRNA molecules). Details for these polynucleotides, primary
constructs, and mmRNA follow.
Polynucleotides and Primary Constructs
[0254] The polynucleotides, primary constructs, and mmRNA of the
invention includes a first region of linked nucleosides encoding a
polypeptide of interest, a first flanking region located at the 5'
terminus of the first region, and a second flanking region located
at the 3' terminus of the first region.
[0255] In some embodiments, the polynucleotide, primary construct,
or mmRNA (e.g., the first region, first flanking region, or second
flanking region) includes n number of linked nucleosides having any
base, sugar, backbone, building block or other structure or
formula, including but not limited to those of Formulas I through
IX or any substructures thereof as described in International
Application No. PCT/US2012/58519, the contents of which are
incorporated herein by reference in their entirety. Such structures
include modifications to the sugar, nucleobase, internucleoside
linkage, or combinations thereof.
[0256] Combinations of chemical modifications include those taught
in including but not limited to those described in International
Application No. PCT/US2012/58519, the contents of which are
incorporated herein by reference in their entirety.
[0257] The synthesis of polynucleotides, primary constructs or
mmRNA of the present invention may be according to the methods
described in International Application No. PCT/US2012/58519, U.S.
Provisional Patent Application No. 61/618,862, filed Apr. 2, 2012,
entitled Modified Polynucleotides for the Production of Biologics;
U.S. Provisional Patent Application No. 61/681,645, filed Aug. 10,
2012, entitled Modified Polynucleotides for the Production of
Biologics; U.S. Provisional Patent Application No. 61/737,130,
filed Dec. 14, 2012, entitled Modified Polynucleotides for the
Production of Biologics; International Patent Application No.
PCT/US2013/030062, filed Mar. 9, 2013, entitled Modified
Polynucleotides for the Production of Biologics and Proteins
Associated with Human Disease; U.S. Provisional Patent Application
No. 61/618,866, filed Apr. 2, 2012, entitled Modified
Polynucleotides for the Production of Antibodies; U.S. Provisional
Patent Application No. 61/681,647, filed Aug. 10, 2012, entitled
Modified Polynucleotides for the Production of Antibodies; U.S.
Provisional Patent Application No. 61/737,134, filed Dec. 14, 2012,
entitled Modified Polynucleotides for the Production of Antibodies;
U.S. Provisional Patent Application No. 61/618,868, filed Apr. 2,
2012, entitled Modified Polynucleotides for the Production of
Vaccines; U.S. Provisional Patent Application No. 61/681,648, filed
Aug. 10, 2012, entitled Modified Polynucleotides for the Production
of Vaccines; U.S. Provisional Patent Application No. 61/737,135,
filed Dec. 14, 2012, entitled Modified Polynucleotides for the
Production of Vaccines; U.S. Provisional Patent Application No.
61/618,873, filed Apr. 2, 2012, entitled Modified Polynucleotides
for the Production of Secreted Proteins; U.S. Provisional Patent
Application No. 61/681,650, filed Aug. 10, 2012, entitled Modified
Polynucleotides for the Production of Secreted Proteins; U.S.
Provisional Patent Application No. 61/737,147, filed Dec. 14, 2012,
entitled Modified Polynucleotides for the Production of Secreted
Proteins; International Patent Application No. PCT/US2013/030064,
filed Mar. 9, 2013, entitled Modified Polynucleotides for the
Production of Secreted Proteins; U.S. Provisional Patent
Application No. 61/618,878, filed Apr. 2, 2012, entitled Modified
Polynucleotides for the Production of Plasma Membrane Proteins;
U.S. Provisional Patent Application No. 61/681,654, filed Aug. 10,
2012, entitled Modified Polynucleotides for the Production of
Plasma Membrane Proteins; U.S. Provisional Patent Application No.
61/737,152, filed Dec. 14, 2012, entitled Modified Polynucleotides
for the Production of Plasma Membrane Proteins; International
Patent Application No. PCT/US2013/030059, filed Mar. 9, 2013,
entitled Modified Polynucleotides for the Production of Membrane
Proteins; U.S. Provisional Patent Application No. 61/618,885, filed
Apr. 2, 2012, entitled Modified Polynucleotides for the Production
of Cytoplasmic and Cytoskeletal Proteins; U.S. Provisional Patent
Application No. 61/681,658, filed Aug. 10, 2012, entitled Modified
Polynucleotides for the Production of Cytoplasmic and Cytoskeletal
Proteins; U.S. Provisional Patent Application No. 61/737,155, filed
Dec. 14, 2012, entitled Modified Polynucleotides for the Production
of Cytoplasmic and Cytoskeletal Proteins; International Patent
Application No. PCT/US2013/030066, filed Mar. 9, 2013, entitled
Modified Polynucleotides for the Production of Cytoplasmic and
Cytoskeletal Proteins; U.S. Provisional Patent Application No.
61/618,896, filed Apr. 2, 2012, entitled Modified Polynucleotides
for the Production of Intracellular Membrane Bound Proteins; U.S.
Provisional Patent Application No. 61/668,157, filed Jul. 5, 2012,
entitled Modified Polynucleotides for the Production of
Intracellular Membrane Bound Proteins; U.S. Provisional Patent
Application No. 61/681,661, filed Aug. 10, 2012, entitled Modified
Polynucleotides for the Production of Intracellular Membrane Bound
Proteins; U.S. Provisional Patent Application No. 61/737,160, filed
Dec. 14, 2012, entitled Modified Polynucleotides for the Production
of Intracellular Membrane Bound Proteins; U.S. Provisional Patent
Application No. 61/618,911, filed Apr. 2, 2012, entitled Modified
Polynucleotides for the Production of Nuclear Proteins; U.S.
Provisional Patent Application No. 61/681,667, filed Aug. 10, 2012,
entitled Modified Polynucleotides for the Production of Nuclear
Proteins; U.S. Provisional Patent Application No. 61/737,168, filed
Dec. 14, 2012, entitled Modified Polynucleotides for the Production
of Nuclear Proteins; International Patent Application No.
PCT/US2013/030067, filed Mar. 9, 2013, entitled Modified
Polynucleotides for the Production of Nuclear Proteins; U.S.
Provisional Patent Application No. 61/618,922, filed Apr. 2, 2012,
entitled Modified Polynucleotides for the Production of Proteins;
U.S. Provisional Patent Application No. 61/681,675, filed Aug. 10,
2012, entitled Modified Polynucleotides for the Production of
Proteins; U.S. Provisional Patent Application No. 61/737,174, filed
Dec. 14, 2012, entitled Modified Polynucleotides for the Production
of Proteins; International Patent Application No.
PCT/US2013/030060, filed Mar. 9, 2013, entitled Modified
Polynucleotides for the Production of Proteins; U.S. Provisional
Patent Application No. 61/618,935, filed Apr. 2, 2012, entitled
Modified Polynucleotides for the Production of Proteins Associated
with Human Disease; U.S. Provisional Patent Application No.
61/681,687, filed Aug. 10, 2012, entitled Modified Polynucleotides
for the Production of Proteins Associated with Human Disease; U.S.
Provisional Patent Application No. 61/737,184, filed Dec. 14, 2012,
entitled Modified Polynucleotides for the Production of Proteins
Associated with Human Disease; International Patent Application No.
PCT/US2013/030061, filed Mar. 9, 2013, entitled Modified
Polynucleotides for the Production of Proteins Associated with
Human Disease; U.S. Provisional Patent Application No. 61/618,945,
filed Apr. 2, 2012, entitled Modified Polynucleotides for the
Production of Proteins Associated with Human Disease; U.S.
Provisional Patent Application No. 61/681,696, filed Aug. 10, 2012,
entitled Modified Polynucleotides for the Production of Proteins
Associated with Human Disease; U.S. Provisional Patent Application
No. 61/737,191, filed Dec. 14, 2012, entitled Modified
Polynucleotides for the Production of Proteins Associated with
Human Disease; U.S. Provisional Patent Application No. 61/618,953,
filed Apr. 2, 2012, entitled Modified Polynucleotides for the
Production of Proteins Associated with Human Disease; U.S.
Provisional Patent Application No. 61/681,704, filed Aug. 10, 2012,
entitled Modified Polynucleotides for the Production of Proteins
Associated with Human Disease; U.S. Provisional Patent Application
No. 61/737,203, filed Dec. 14, 2012, entitled Modified
Polynucleotides for the Production of Proteins Associated with
Human Disease; U.S. Provisional Patent Application No. 61/681,720,
filed Aug. 10, 2012, entitled Modified Polynucleotides for the
Production of Cosmetic Proteins and Peptides; U.S. Provisional
Patent Application No. 61/737,213, filed Dec. 14, 2012, entitled
Modified Polynucleotides for the Production of Cosmetic Proteins
and Peptides; U.S. Provisional Patent Application No. 61/681,742,
filed Aug. 10, 2012, entitled Modified Polynucleotides for the
Production of Oncology-Related Proteins and Peptides; International
Application No. PCT/US2013/030070, filed Mar. 9, 2013, entitled
Modified Polynucleotides for the Production of Oncology-Related
Proteins and Peptides; International Application No.
PCT/US2013/030068, filed Mar. 9, 2013, entitled Modified
Polynucleotides for the Production of Cosmetic Proteins and
Peptides; U.S. Provisional Patent Application No. 61/618,870, filed
Apr. 2, 2012, entitled Modified Polynucleotides for the Production
of Therapeutic Proteins and Peptides; U.S. Provisional Patent
Application No. 61/681,649, filed Aug. 10, 2012, entitled Modified
Polynucleotides for the Production of Therapeutic Proteins and
Peptides; U.S. Provisional Patent Application No. 61/737,139, filed
Dec. 14, 2012, Modified Polynucleotides for the Production of
Therapeutic Proteins and Peptides; International Application No
PCT/US2013/030063, filed Mar. 9, 2013, entitled Modified
Polynucleotides; International Application No. PCT/US2013/031821,
filed Mar. 15, 2013, entitled In Vivo Production of Proteins, the
contents of each of which are herein incorporated by reference in
their entireties, the contents of each of which are incorporated
herein by reference in their entirety.
[0258] In some embodiments, the nucleobase selected from the group
consisting of cytosine, guanine, adenine, and uracil.
[0259] In some embodiments, the modified nucleobase is a modified
uracil. Exemplary nucleobases and nucleosides having a modified
uracil include pseudouridine (.psi.), pyridin-4-one ribonucleoside,
5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine
(s.sup.2U), 4-thio-uridine (s.sup.4U), 4-thio-pseudouridine,
2-thio-pseudouridine, 5-hydroxy-uridine (ho.sup.5U),
5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or
5-bromo-uridine), 3-methyl-uridine (m.sup.3U), 5-methoxy-uridine
(mo.sup.5U), uridine 5-oxyacetic acid (cmo.sup.5U), uridine
5-oxyacetic acid methyl ester (mcmo.sup.5U),
5-carboxymethyl-uridine (cm.sup.5U), 1-carboxymethyl-pseudouridine,
5-carboxyhydroxymethyl-uridine (chm.sup.5U),
5-carboxyhydroxymethyl-uridine methyl ester (mchm.sup.5U),
5-methoxycarbonylmethyl-uridine (mcm.sup.5U),
5-methoxycarbonylmethyl-2-thio-uridine (mcm.sup.5s.sup.2U),
5-aminomethyl-2-thio-uridine (nm.sup.5s.sup.2U),
5-methylaminomethyl-uridine (mnm.sup.5U),
5-methylaminomethyl-2-thio-uridine (mnm.sup.5s.sup.2U),
5-methylaminomethyl-2-seleno-uridine (mnm.sup.5se.sup.2U),
5-carbamoylmethyl-uridine (ncm.sup.5U),
5-carboxymethylaminomethyl-uridine (cmnm.sup.5U),
5-carboxymethylaminomethyl-2-thio-uridine (cmnm.sup.5s.sup.2U),
5-propynyl-uridine, 1-propynyl-pseudouridine,
5-taurinomethyl-uridine (.tau.cm.sup.5U),
1-taurinomethyl-pseudouridine,
5-taurinomethyl-2-thio-uridine(.tau.m.sup.5s.sup.2U),
1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine (m.sup.5U,
i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine
(m.sup.1.psi.), 5-methyl-2-thio-uridine (m.sup.5s.sup.2U),
1-methyl-4-thio-pseudouridine (m.sup.1s.sup.4.psi.),
4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine
(m.sup.3.psi.), 2-thio-1-methyl-pseudouridine,
1-methyl-1-deaza-pseudouridine,
2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D),
dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine
(m.sup.5D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine,
2-methoxy-uridine, 2-methoxy-4-thio-uridine,
4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine,
N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine
(acp.sup.3U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine
(acp.sup.3 .psi.), 5-(isopentenylaminomethyl)uridine (inm.sup.5U),
5-(isopentenylaminomethyl)-2-thio-uridine (inm.sup.5s.sup.2U),
.alpha.-thio-uridine, 2'-O-methyl-uridine (Um),
5,2'-O-dimethyl-uridine (m.sup.5Um), 2'-O-methyl-pseudouridine
(.psi.m), 2-thio-2'-O-methyl-uridine (s.sup.2Um),
5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm.sup.5Um),
5-carbamoylmethyl-2'-O-methyl-uridine (ncm.sup.5Um),
5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm.sup.5Um),
3,2'-O-dimethyl-uridine (m.sup.3Um),
5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm.sup.5Um),
1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine,
2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, and
5-[3-(1-E-propenylamino)uridine.
[0260] In some embodiments, the modified nucleobase is a modified
cytosine.
[0261] Exemplary nucleobases and nucleosides having a modified
cytosine include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine,
3-methyl-cytidine (m.sup.3C), N4-acetylcytidine (ac.sup.4C),
5-formyl-cytidine (f.sup.5C), N4-methyl-cytidine (m.sup.4C),
5-methyl-cytidine (m.sup.5C), 5-halo-cytidine (e.g.,
5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm.sup.5C),
1-methyl-pseudoisocytidine, pyrrolo-cytidine,
pyrrolo-pseudoisocytidine, 2-thio-cytidine (s.sup.2C),
2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine,
4-thio-1-methyl-pseudoisocytidine,
4-thio-1-methyl-1-deaza-pseudoisocytidine,
1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine,
5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine,
2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine,
4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine,
lysidine (k.sub.2C), .alpha.-thio-cytidine, 2'-O-methyl-cytidine
(Cm), 5,2'-O-dimethyl-cytidine (m.sup.5Cm),
N4-acetyl-2'-O-methyl-cytidine (ac.sup.4Cm),
N4,2'-O-dimethyl-cytidine (m.sup.4Cm),
5-formyl-2'-O-methyl-cytidine (f.sup.5Cm),
N4,N4,2'-O-trimethyl-cytidine (m.sup.4.sub.2Cm), 1-thio-cytidine,
2'-F-ara-cytidine, 2'-F-cytidine, and 2'-OH-ara-cytidine.
[0262] In some embodiments, the modified nucleobase is a modified
adenine. Exemplary nucleobases and nucleosides having a modified
adenine include 2-amino-purine, 2,6-diaminopurine,
2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine),
6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine,
8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine,
7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine,
7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine,
1-methyl-adenosine (m.sup.1A), 2-methyl-adenine (m.sup.2A),
N6-methyl-adenosine (m.sup.6A), 2-methylthio-N6-methyl-adenosine
(ms.sup.2 m.sup.6A), N6-isopentenyl-adenosine (i.sup.6A),
2-methylthio-N6-isopentenyl-adenosine (ms.sup.2i.sup.6A),
N6-(cis-hydroxyisopentenyl)adenosine (io.sup.6A),
2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine
(ms.sup.2io.sup.6A), N6-glycinylcarbamoyl-adenosine (g.sup.6A),
N6-threonylcarbamoyl-adenosine (t.sup.6A),
N6-methyl-N6-threonylcarbamoyl-adenosine (m.sup.6t.sup.6A),
2-methylthio-N6-threonylcarbamoyl-adenosine (ms.sup.2g.sup.6A),
N6,N6-dimethyl-adenosine (m.sup.6.sub.2A),
N6-hydroxynorvalylcarbamoyl-adenosine (hn.sup.6A),
2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine
(ms.sup.2hn.sup.6A), N6-acetyl-adenosine (ac.sup.6A),
7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine,
.alpha.-thio-adenosine, 2'-O-methyl-adenosine (Am),
N6,2'-O-dimethyl-adenosine (m.sup.6Am),
N6,N6,2'-O-trimethyl-adenosine (m.sup.62Am),
1,2'-O-dimethyl-adenosine (m.sup.1Am), 2'-O-ribosyladenosine
(phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1-thio-adenosine,
8-azido-adenosine, 2'-F-ara-adenosine, 2'-F-adenosine,
2'-OH-ara-adenosine, and
N6-(19-amino-pentaoxanonadecyl)-adenosine.
[0263] In some embodiments, the modified nucleobase is a modified
guanine Exemplary nucleobases and nucleosides having a modified
guanine include inosine (I), 1-methyl-inosine (m.sup.1I), wyosine
(imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14),
isowyosine (imG2), wybutosine (yW), peroxywybutosine (o.sub.2yW),
hydroxywybutosine (OHyW), undermodified hydroxywybutosine (OHyW*),
7-deaza-guanosine, queuosine (Q), epoxyqueuosine (oQ),
galactosyl-queuosine (galQ), mannosyl-queuosine (manQ),
7-cyano-7-deaza-guanosine (preQ.sub.0),
7-aminomethyl-7-deaza-guanosine (preQ.sub.1), archaeosine
(G.sup.+), 7-deaza-8-aza-guanosine, 6-thio-guanosine,
6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine,
7-methyl-guanosine (m.sup.7G), 6-thio-7-methyl-guanosine,
7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine
(m.sup.1G), N2-methyl-guanosine (m.sup.2G),
N2,N2-dimethyl-guanosine (m.sup.2.sub.2G), N2,7-dimethyl-guanosine
(m.sup.2,7G), N2,N2,7-dimethyl-guanosine (m.sup.2,2,7G),
8-oxo-guanosine, 7-methyl-8-oxo-guanosine,
1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine,
N2,N2-dimethyl-6-thio-guanosine, .alpha.-thio-guanosine,
2'-O-methyl-guanosine (Gm), N2-methyl-2'-O-methyl-guanosine
(m.sup.2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine
(m.sup.2.sub.2Gm), 1-methyl-2'-O-methyl-guanosine (m.sup.1Gm),
N2,7-dimethyl-2'-O-methyl-guanosine (m.sup.2,7Gm),
2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m.sup.1Im), and
2'-O-ribosylguanosine (phosphate) (Gr(p)).
[0264] The nucleobase of the nucleotide can be independently
selected from a purine, a pyrimidine, a purine or pyrimidine
analog. For example, the nucleobase can each be independently
selected from adenine, cytosine, guanine, uracil, or hypoxanthine.
In another embodiment, the nucleobase can also include, for
example, naturally-occurring and synthetic derivatives of a base,
including pyrazolo[3,4-d]pyrimidines, 5-methylcytosine (5-me-C),
5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine,
6-methyl and other alkyl derivatives of adenine and guanine,
2-propyl and other alkyl derivatives of adenine and guanine,
2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl uracil
and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil
(pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine,
7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine,
3-deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]1,3,5
triazinones, 9-deazapurines, imidazo[4,5-d]pyrazines,
thiazolo[4,5-d]pyrimidines, pyrazin-2-ones, 1,2,4-triazine,
pyridazine; and 1,3,5 triazine. When the nucleotides are depicted
using the shorthand A, G, C, T or U, each letter refers to the
representative base and/or derivatives thereof, e.g., A includes
adenine or adenine analogs, e.g., 7-deaza adenine).
[0265] Modified nucleosides and nucleotides (e.g., building block
molecules) can be prepared according to the synthetic methods
described in Ogata et al., J. Org. Chem. 74:2585-2588 (2009);
Purmal et al., Nucl. Acids Res. 22(1): 72-78, (1994); Fukuhara et
al., Biochemistry, 1(4): 563-568 (1962); and Xu et al.,
Tetrahedron, 48(9): 1729-1740 (1992), each of which are
incorporated by reference in their entirety.
[0266] The polypeptides, primary constructs, and mmRNA of the
invention may or may not be uniformly modified along the entire
length of the molecule. For example, one or more or all types of
nucleotide (e.g., purine or pyrimidine, or any one or more or all
of A, G, U, C) may or may not be uniformly modified in a
polynucleotide of the invention, or in a given predetermined
sequence region thereof (e.g. one or more of the sequence regions
represented in FIG. 1). In some embodiments, all nucleotides X in a
polynucleotide of the invention (or in a given sequence region
thereof) are modified, wherein X may any one of nucleotides A, G,
U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C,
A+G+U, A+G+C, G+U+C or A+G+C.
[0267] Different sugar modifications, nucleotide modifications,
and/or internucleoside linkages (e.g., backbone structures) may
exist at various positions in the polynucleotide, primary
construct, or mmRNA. One of ordinary skill in the art will
appreciate that the nucleotide analogs or other modification(s) may
be located at any position(s) of a polynucleotide, primary
construct, or mmRNA such that the function of the polynucleotide,
primary construct, or mmRNA is not substantially decreased. A
modification may also be a 5' or 3' terminal modification. The
polynucleotide, primary construct, or mmRNA may contain from about
1% to about 100% modified nucleotides (either in relation to
overall nucleotide content, or in relation to one or more types of
nucleotide, i.e. any one or more of A, G, U or C) or any
intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from
1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1%
to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10%
to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10%
to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from
20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from
20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%,
from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%,
from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to
95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80%
to 100%, from 90% to 95%, from 90% to 100%, and from 95% to
100%).
[0268] In some embodiments, the polynucleotide, primary construct,
or mmRNA includes a modified pyrimidine (e.g., a modified
uracil/uridine/U or modified cytosine/cytidine/C). In some
embodiments, the uracil or uridine (generally: U) in the
polynucleotide, primary construct, or mmRNA molecule may be
replaced with from about 1% to about 100% of a modified uracil or
modified uridine (e.g., from 1% to 20%, from 1% to 25%, from 1% to
50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to
90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to
50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to
90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20%
to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20%
to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from
50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from
50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%,
from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to
100%, from 90% to 95%, from 90% to 100%, and from 95% to 100% of a
modified uracil or modified uridine). The modified uracil or
uridine can be replaced by a compound having a single unique
structure or by a plurality of compounds having different
structures (e.g., 2, 3, 4 or more unique structures, as described
herein).
[0269] In some embodiments, the cytosine or cytidine (generally: C)
in the polynucleotide, primary construct, or mmRNA molecule may be
replaced with from about 1% to about 100% of a modified cytosine or
modified cytidine (e.g., from 1% to 20%, from 1% to 25%, from 1% to
50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to
90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to
50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to
90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20%
to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20%
to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from
50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from
50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%,
from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to
100%, from 90% to 95%, from 90% to 100%, and from 95% to 100% of a
modified cytosine or modified cytidine). The modified cytosine or
cytidine can be replaced by a compound having a single unique
structure or by a plurality of compounds having different
structures (e.g., 2, 3, 4 or more unique structures, as described
herein).
[0270] In some embodiments, the polynucleotide, primary construct,
or mmRNA is translatable.
[0271] Other components of polynucleotides, primary constructs, and
mmRNA are optional, and are beneficial in some embodiments. For
example, a 5' untranslated region (UTR) and/or a 3'UTR are
provided, wherein either or both may independently contain one or
more different nucleotide modifications. In such embodiments,
nucleotide modifications may also be present in the translatable
region. Also provided are polynucleotides, primary constructs, and
mmRNA containing a Kozak sequence.
[0272] In some embodiments, at least 25% of the cytosines are
replaced by a compound of Formula (b10)-(b14) (e.g., at least about
30%, at least about 35%, at least about 40%, at least about 45%, at
least about 50%, at least about 55%, at least about 60%, at least
about 65%, at least about 70%, at least about 75%, at least about
80%, at least about 85%, at least about 90%, at least about 95%, or
about 100%).
[0273] In some embodiments, at least 25% of the uracils are
replaced by a compound of Formula (b1)-(b9) (e.g., at least about
30%, at least about 35%, at least about 40%, at least about 45%, at
least about 50%, at least about 55%, at least about 60%, at least
about 65%, at least about 70%, at least about 75%, at least about
80%, at least about 85%, at least about 90%, at least about 95%, or
about 100%).
[0274] In some embodiments, at least 25% of the cytosines are
replaced by a compound of Formula (b10)-(b14), and at least 25% of
the uracils are replaced by a compound of Formula (b1)-(b9) (e.g.,
at least about 30%, at least about 35%, at least about 40%, at
least about 45%, at least about 50%, at least about 55%, at least
about 60%, at least about 65%, at least about 70%, at least about
75%, at least about 80%, at least about 85%, at least about 90%, at
least about 95%, or about 100%).
IV. PHARMACEUTICAL COMPOSITIONS
Formulation, Administration, Delivery and Dosing
[0275] The present invention provides polynucleotides, primary
constructs and mmRNA compositions and complexes in combination with
one or more pharmaceutically acceptable excipients. Pharmaceutical
compositions may optionally comprise one or more additional active
substances, e.g. therapeutically and/or prophylactically active
substances. General considerations in the formulation and/or
manufacture of pharmaceutical agents may be found, for example, in
Remington: The Science and Practice of Pharmacy 21.sup.st ed.,
Lippincott Williams & Wilkins, 2005 (incorporated herein by
reference).
[0276] In some embodiments, compositions are administered to
humans, human patients or subjects. For the purposes of the present
disclosure, the phrase "active ingredient" generally refers to
polynucleotides, primary constructs and mmRNA to be delivered as
described herein.
[0277] Although the descriptions of pharmaceutical compositions
provided herein are principally directed to pharmaceutical
compositions which are suitable for administration to humans, it
will be understood by the skilled artisan that such compositions
are generally suitable for administration to any other animal,
e.g., to non-human animals, e.g. non-human mammals. Modification of
pharmaceutical compositions suitable for administration to humans
in order to render the compositions suitable for administration to
various animals is well understood, and the ordinarily skilled
veterinary pharmacologist can design and/or perform such
modification with merely ordinary, if any, experimentation.
Subjects to which administration of the pharmaceutical compositions
is contemplated include, but are not limited to, humans and/or
other primates; mammals, including commercially relevant mammals
such as cattle, pigs, horses, sheep, cats, dogs, mice, and/or rats;
and/or birds, including commercially relevant birds such as
poultry, chickens, ducks, geese, and/or turkeys.
[0278] Formulations of the pharmaceutical compositions described
herein may be prepared by any method known or hereafter developed
in the art of pharmacology. In general, such preparatory methods
include the step of bringing the active ingredient into association
with an excipient and/or one or more other accessory ingredients,
and then, if necessary and/or desirable, dividing, shaping and/or
packaging the product into a desired single- or multi-dose
unit.
[0279] A pharmaceutical composition in accordance with the
invention may be prepared, packaged, and/or sold in bulk, as a
single unit dose, and/or as a plurality of single unit doses. As
used herein, a "unit dose" is discrete amount of the pharmaceutical
composition comprising a predetermined amount of the active
ingredient. The amount of the active ingredient is generally equal
to the dosage of the active ingredient which would be administered
to a subject and/or a convenient fraction of such a dosage such as,
for example, one-half or one-third of such a dosage.
[0280] Relative amounts of the active ingredient, the
pharmaceutically acceptable excipient, and/or any additional
ingredients in a pharmaceutical composition in accordance with the
invention will vary, depending upon the identity, size, and/or
condition of the subject treated and further depending upon the
route by which the composition is to be administered. By way of
example, the composition may comprise between 0.1% and 100%, e.g.,
between 0.5 and 50%, between 1-30%, between 5-80%, at least 80%
(w/w) active ingredient.
Formulations
[0281] The polynucleotide, primary construct, and mmRNA of the
invention can be formulated using one or more excipients to: (1)
increase stability; (2) increase cell transfection; (3) permit the
sustained or delayed release (e.g., from a depot formulation of the
polynucleotide, primary construct, or mmRNA); (4) alter the
biodistribution (e.g., target the polynucleotide, primary
construct, or mmRNA to specific tissues or cell types); (5)
increase the translation of encoded protein in vivo; and/or (6)
alter the release profile of encoded protein in vivo. In addition
to traditional excipients such as any and all solvents, dispersion
media, diluents, or other liquid vehicles, dispersion or suspension
aids, surface active agents, isotonic agents, thickening or
emulsifying agents, preservatives, excipients of the present
invention can include, without limitation, lipidoids, liposomes,
lipid nanoparticles, polymers, lipoplexes, core-shell
nanoparticles, peptides, proteins, cells transfected with
polynucleotide, primary construct, or mmRNA (e.g., for
transplantation into a subject), hyaluronidase, nanoparticle mimics
and combinations thereof. Further, the polynucleotide, primary
construct, or mmRNA of the present invention may be formulated
using self-assembled nucleic acid nanoparticles.
[0282] Accordingly, the formulations of the invention can include
one or more excipients, each in an amount that together increases
the stability of the polynucleotide, primary construct, or mmRNA,
increases cell transfection by the polynucleotide, primary
construct, or mmRNA, increases the expression of polynucleotide,
primary construct, or mmRNA encoded protein, and/or alters the
release profile of polynucleotide, primary construct, or mmRNA
encoded proteins. Further, the primary construct and mmRNA of the
present invention may be formulated using self-assembled nucleic
acid nanoparticles.
[0283] Formulations of the pharmaceutical compositions described
herein may be prepared by any method known or hereafter developed
in the art of pharmacology. In general, such preparatory methods
include the step of associating the active ingredient with an
excipient and/or one or more other accessory ingredients.
[0284] A pharmaceutical composition in accordance with the present
disclosure may be prepared, packaged, and/or sold in bulk, as a
single unit dose, and/or as a plurality of single unit doses. As
used herein, a "unit dose" refers to a discrete amount of the
pharmaceutical composition comprising a predetermined amount of the
active ingredient. The amount of the active ingredient may
generally be equal to the dosage of the active ingredient which
would be administered to a subject and/or a convenient fraction of
such a dosage including, but not limited to, one-half or one-third
of such a dosage.
[0285] Relative amounts of the active ingredient, the
pharmaceutically acceptable excipient, and/or any additional
ingredients in a pharmaceutical composition in accordance with the
present disclosure may vary, depending upon the identity, size,
and/or condition of the subject being treated and further depending
upon the route by which the composition is to be administered. For
example, the composition may comprise between 0.1% and 99% (w/w) of
the active ingredient.
[0286] In some embodiments, the formulations described herein may
contain at least one mmRNA. As a non-limiting example, the
formulations may contain 1, 2, 3, 4 or 5 mmRNA. In one embodiment
the formulation may contain modified mRNA encoding proteins
selected from categories such as, proteins. In one embodiment, the
formulation contains at least three modified mRNA encoding
proteins. In one embodiment, the formulation contains at least five
modified mRNA encoding proteins.
[0287] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA described herein may be formulated as described in
International Application No PCT/US2012/069610, filed Dec. 14,
2012, entitled Modified Nucleoside, Nucleotide, and Nucleic Acid
Compositions, the contents of which are herein incorporated by
reference in its entirety. Non-limiting examples of formulations
include lipidoids, liposomes, lipoplexes, lipid nanoparticles,
peptides, proteins, cells, hyaluronidase, nanoparticle mimics,
nanotubes, conjugates, self-assembled nanoparticles, inorganic
nanoparticles, semi-conductive nanoparticles, metallic
nanoparticles, gels, hydrogels, molded nanoparticles,
microparticles, nanojackets and nanoliposomes. The formulation may
be administered by any of the methods described in International
Application No PCT/US2012/069610, filed Dec. 14, 2012, entitled
Modified Nucleoside, Nucleotide, and Nucleic Acid Compositions, the
contents of which are herein incorporated by reference in its
entirety. Non limiting examples of administration methods include
parenteral, injectable, rectal, vaginal, oral, topical,
transdermal, depot, pulmonary, intranasal, buccal and ophthalmic
administration.
[0288] Pharmaceutical formulations may additionally comprise a
pharmaceutically acceptable excipient, which, as used herein,
includes, but is not limited to, any and all solvents, dispersion
media, diluents, or other liquid vehicles, dispersion or suspension
aids, surface active agents, isotonic agents, thickening or
emulsifying agents, preservatives, and the like, as suited to the
particular dosage form desired. Various excipients for formulating
pharmaceutical compositions and techniques for preparing the
composition are known in the art (see Remington: The Science and
Practice of Pharmacy, 21.sup.st Edition, A. R. Gennaro, Lippincott,
Williams & Wilkins, Baltimore, Md., 2006; incorporated herein
by reference). The use of a conventional excipient medium may be
contemplated within the scope of the present disclosure, except
insofar as any conventional excipient medium may be incompatible
with a substance or its derivatives, such as by producing any
undesirable biological effect or otherwise interacting in a
deleterious manner with any other component(s) of the
pharmaceutical composition.
[0289] In some embodiments, the particle size of the lipid
nanoparticle may be increased and/or decreased. The change in
particle size may be able to help counter biological reaction such
as, but not limited to, inflammation or may increase the biological
effect of the modified mRNA delivered to mammals.
[0290] Pharmaceutically acceptable excipients used in the
manufacture of pharmaceutical compositions include, but are not
limited to, inert diluents, surface active agents and/or
emulsifiers, preservatives, buffering agents, lubricating agents,
and/or oils. Such excipients may optionally be included in the
pharmaceutical formulations of the invention.
Lipidoids
[0291] The synthesis of lipidoids has been extensively described
and formulations containing these compounds are particularly suited
for delivery of polynucleotides, primary constructs or mmRNA (see
Mahon et al., Bioconjug Chem. 2010 21:1448-1454; Schroeder et al.,
J Intern Med. 2010 267:9-21; Akinc et al., Nat Biotechnol. 2008
26:561-569; Love et al., Proc Natl Acad Sci USA. 2010
107:1864-1869; Siegwart et al., Proc Natl Acad Sci USA. 2011
108:12996-3001; all of which are incorporated herein in their
entireties).
[0292] While these lipidoids have been used to effectively deliver
double stranded small interfering RNA molecules in rodents and
non-human primates (see Akinc et al., Nat Biotechnol. 2008
26:561-569; Frank-Kamenetsky et al., Proc Natl Acad Sci USA. 2008
105:11915-11920; Akinc et al., Mol Ther. 2009 17:872-879; Love et
al., Proc Natl Acad Sci USA. 2010 107:1864-1869; Leuschner et al.,
Nat Biotechnol. 2011 29:1005-1010; all of which is incorporated
herein in their entirety), the present disclosure describes their
formulation and use in delivering single stranded polynucleotides,
primary constructs, or mmRNA. Complexes, micelles, liposomes or
particles can be prepared containing these lipidoids and therefore,
can result in an effective delivery of the polynucleotide, primary
construct, or mmRNA, as judged by the production of an encoded
protein, following the injection of a lipidoid formulation via
localized and/or systemic routes of administration. Lipidoid
complexes of polynucleotides, primary constructs, or mmRNA can be
administered by various means including, but not limited to,
intravenous, intramuscular, or subcutaneous routes.
[0293] In vivo delivery of nucleic acids may be affected by many
parameters, including, but not limited to, the formulation
composition, nature of particle PEGylation, degree of loading,
oligonucleotide to lipid ratio, and biophysical parameters such as
particle size (Akinc et al., Mol Ther. 2009 17:872-879; herein
incorporated by reference in its entirety). As an example, small
changes in the anchor chain length of poly(ethylene glycol) (PEG)
lipids may result in significant effects on in vivo efficacy.
Formulations with the different lipidoids, including, but not
limited to penta[3-(1-laurylaminopropionyl)]-triethylenetetramine
hydrochloride (TETA-SLAP; aka 98N12-5, see Murugaiah et al.,
Analytical Biochemistry, 401:61 (2010)), C12-200 (including
derivatives and variants), and MD1, can be tested for in vivo
activity.
[0294] The lipidoid referred to herein as "98N12-5" is disclosed by
Akinc et al., Mol Ther. 2009 17:872-879 and is incorporated by
reference in its entirety.
[0295] The lipidoid referred to herein as "C12-200" is disclosed by
Love et al., Proc Natl Acad Sci USA. 2010 107:1864-1869 and Liu and
Huang, Molecular Therapy. 2010 669-670; both of which are herein
incorporated by reference in their entirety. The lipidoid
formulations can include particles comprising either 3 or 4 or more
components in addition to polynucleotide, primary construct, or
mmRNA. As an example, formulations with certain lipidoids, include,
but are not limited to, 98N12-5 and may contain 42% lipidoid, 48%
cholesterol and 10% PEG (C14 alkyl chain length). As another
example, formulations with certain lipidoids, include, but are not
limited to, C12-200 and may contain 50% lipidoid, 10%
disteroylphosphatidyl choline, 38.5% cholesterol, and 1.5%
PEG-DMG.
[0296] Combinations of different lipidoids may be used to improve
the efficacy of polynucleotide, primary construct, or mmRNA
directed protein production as the lipidoids may be able to
increase cell transfection by the polynucleotide, primary
construct, or mmRNA; and/or increase the translation of encoded
protein (see Whitehead et al., Mol. Ther. 2011, 19:1688-1694,
herein incorporated by reference in its entirety).
[0297] In some embodiments, the particle size of the lipid
nanoparticle may be increased and/or decreased. The change in
particle size may be able to help counter biological reaction such
as, but not limited to, inflammation or may increase the biological
effect of, the polynucleotide, primary construct, or mmRNA
delivered to subjects.
Liposomes, Lipoplexes, and Lipid Nanoparticles
[0298] The polynucleotide, primary construct, and mmRNA of the
invention can be formulated using one or more liposomes,
lipoplexes, or lipid nanoparticles. In one embodiment,
pharmaceutical compositions of polynucleotide, primary construct,
or mmRNA include liposomes. Liposomes are artificially-prepared
vesicles which may primarily be composed of a lipid bilayer and may
be used as a delivery vehicle for the administration of nutrients
and pharmaceutical formulations. Liposomes can be of different
sizes such as, but not limited to, a multilamellar vesicle (MLV)
which may be hundreds of nanometers in diameter and may contain a
series of concentric bilayers separated by narrow aqueous
compartments, a small unicellular vesicle (SUV) which may be
smaller than 50 nm in diameter, and a large unilamellar vesicle
(LUV) which may be between 50 and 500 nm in diameter. Liposome
design may include, but is not limited to, opsonins or ligands in
order to improve the attachment of liposomes to unhealthy tissue or
to activate events such as, but not limited to, endocytosis.
Liposomes may contain a low or a high pH in order to improve the
delivery of the pharmaceutical formulations.
[0299] The formation of liposomes may depend on the physicochemical
characteristics such as, but not limited to, the pharmaceutical
formulation entrapped and the liposomal ingredients, the nature of
the medium in which the lipid vesicles are dispersed, the effective
concentration of the entrapped substance and its potential
toxicity, any additional processes involved during the application
and/or delivery of the vesicles, the optimization size,
polydispersity and the shelf-life of the vesicles for the intended
application, and the batch-to-batch reproducibility and possibility
of large-scale production of safe and efficient liposomal
products.
[0300] In one embodiment, pharmaceutical compositions described
herein may include, without limitation, liposomes such as those
formed from 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA)
liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.),
1,2-dilinoleyloxy-3-dimethylaminopropane (DLin-DMA),
2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane
(DLin-KC2-DMA), and MC3 (US20100324120; herein incorporated by
reference in its entirety) and liposomes which may deliver small
molecule drugs such as, but not limited to, DOXIL.RTM. from Janssen
Biotech, Inc. (Horsham, Pa.).
[0301] In one embodiment, pharmaceutical compositions described
herein may include, without limitation, liposomes such as those
formed from the synthesis of stabilized plasmid-lipid particles
(SPLP) or stabilized nucleic acid lipid particle (SNALP) that have
been previously described and shown to be suitable for
oligonucleotide delivery in vitro and in vivo (see Wheeler et al.
Gene Therapy. 1999 6:271-281; Zhang et al. Gene Therapy. 1999
6:1438-1447; Jeffs et al. Pharm Res. 2005 22:362-372; Morrissey et
al., Nat Biotechnol. 2005 2:1002-1007; Zimmermann et al., Nature.
2006 441:111-114; Heyes et al. J Contr Rel. 2005 107:276-287;
Semple et al. Nature Biotech. 2010 28:172-176; Judge et al. J Clin
Invest. 2009 119:661-673; deFougerolles Hum Gene Ther. 2008
19:125-132; all of which are incorporated herein in their
entireties.) The original manufacture method by Wheeler et al. was
a detergent dialysis method, which was later improved by Jeffs et
al. and is referred to as the spontaneous vesicle formation method.
The liposome formulations are composed of 3 to 4 lipid components
in addition to the polynucleotide, primary construct, or mmRNA. As
an example a liposome can contain, but is not limited to, 55%
cholesterol, 20% disteroylphosphatidyl choline (DSPC), 10%
PEG-S-DSG, and 15% 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA),
as described by Jeffs et al. As another example, certain liposome
formulations may contain, but are not limited to, 48% cholesterol,
20% DSPC, 2% PEG-c-DMA, and 30% cationic lipid, where the cationic
lipid can be 1,2-distearloxy-N,N-dimethylaminopropane (DSDMA),
DODMA, DLin-DMA, or 1,2-dilinolenyloxy-3-dimethylaminopropane
(DLenDMA), as described by Heyes et al.
[0302] In one embodiment, pharmaceutical compositions may include
liposomes which may be formed to deliver mmRNA which may encode at
least one immunogen. The mmRNA may be encapsulated by the liposome
and/or it may be contained in an aqueous core which may then be
encapsulated by the liposome (see International Pub. Nos.
WO2012031046, WO2012031043, WO201203091 and WO2012006378 herein
incorporated by reference in their entireties). In another
embodiment, the mmRNA which may encode an immunogen may be
formulated in a cationic oil-in-water emulsion where the emulsion
particle comprises an oil core and a cationic lipid which can
interact with the mmRNA anchoring the molecule to the emulsion
particle (see International Pub. No. WO2012006380). In yet another
embodiment, the lipid formulation may include at least cationic
lipid, a lipid which may enhance transfection and a least one lipid
which contains a hydrophilic head group linked to a lipid moiety
(International Pub. No. WO2011076807 and U.S. Pub. No. 20110200582;
herein incorporated by reference in their entireties). In another
embodiment, the polynucleotides, primary constructs and/or mmRNA
encoding an immunogen may be formulated in a lipid vesicle which
may have crosslinks between functionalized lipid bilayers (see U.S.
Pub. No. 20120177724, herein incorporated by reference in its
entirety).
[0303] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA may be formulated in a lipid vesicle which may have
crosslinks between functionalized lipid bilayers.
[0304] In one embodiment, the polynucleotides, primary constructs
and/or mmRNA may be formulated in a lipid-polycation complex. The
formation of the lipid-polycation complex may be accomplished by
methods known in the art and/or as described in U.S. Pub. No.
20120178702, herein incorporated by reference in its entirety. As a
non-limiting example, the polycation may include a cationic peptide
or a polypeptide such as, but not limited to, polylysine,
polyornithine and/or polyarginine. In another embodiment, the
polynucleotides, primary constructs and/or mmRNA may be formulated
in a lipid-polycation complex which may further include a neutral
lipid such as, but not limited to, cholesterol or dioleoyl
phosphatidylethanolamine (DOPE).
[0305] The liposome formulation may be influenced by, but not
limited to, the selection of the cationic lipid component, the
degree of cationic lipid saturation, the nature of the PEGylation,
ratio of all components and biophysical parameters such as size. In
one example by Semple et al. (Semple et al. Nature Biotech. 2010
28:172-176), the liposome formulation was composed of 57.1%
cationic lipid, 7.1% dipalmitoylphosphatidylcholine, 34.3%
cholesterol, and 1.4% PEG-c-DMA. As another example, changing the
composition of the cationic lipid could more effectively deliver
siRNA to various antigen presenting cells (Basha et al. Mol Ther.
2011 19:2186-2200; herein incorporated by reference in its
entirety).
[0306] In some embodiments, the ratio of PEG in the LNP
formulations may be increased or decreased and/or the carbon chain
length of the PEG lipid may be modified from C14 to C18 to alter
the pharmacokinetics and/or biodistribution of the LNP
formulations. As a non-limiting example, LNP formulations may
contain 1-5% of the lipid molar ratio of PEG-c-DOMG as compared to
the cationic lipid, DSPC and cholesterol. In another embodiment the
PEG-c-DOMG may be replaced with a PEG lipid such as, but not
limited to, PEG-DSG (1,2-Distearoyl-sn-glycerol,
methoxypolyethylene glycol) or PEG-DPG
(1,2-Dipalmitoyl-sn-glycerol, methoxypolyethylene glycol). The
cationic lipid may be selected from any lipid known in the art such
as, but not limited to, DLin-MC3-DMA, DLin-DMA, C12-200 and
DLin-KC2-DMA.
[0307] In one embodiment, the LNP formulations of the
polynucleotides, primary constructs and/or mmRNA may contain
PEG-c-DOMG 3% lipid molar ratio. In another embodiment, the LNP
formulations polynucleotides, primary constructs and/or mmRNA may
contain PEG-c-DOMG 1.5% lipid molar ratio.
[0308] In one embodiment, the pharmaceutical compositions of the
polynucleotides, primary constructs and/or mmRNA may include at
least one of the PEGylated lipids described in International
Publication No. 2012099755, herein incorporated by reference.
[0309] In one embodiment, the pharmaceutical compositions may be
formulated in liposomes such as, but not limited to, DiLa2
liposomes (Marina Biotech, Bothell, Wash.), SMARTICLES.RTM. (Marina
Biotech, Bothell, Wash.), neutral DOPC
(1,2-dioleoyl-sn-glycero-3-phosphocholine) based liposomes (e.g.,
siRNA delivery for ovarian cancer (Landen et al. Cancer Biology
& Therapy 2006 5(12)1708-1713)) and hyaluronan-coated liposomes
(Quiet Therapeutics, Israel).
[0310] Lipid nanoparticle formulations may be improved by replacing
the cationic lipid with a biodegradable cationic lipid which is
known as a rapidly eliminated lipid nanoparticle (reLNP). Ionizable
cationic lipids, such as, but not limited to, DLinDMA,
DLin-KC2-DMA, and DLin-MC3-DMA, have been shown to accumulate in
plasma and tissues over time and may be a potential source of
toxicity. The rapid metabolism of the rapidly eliminated lipids can
improve the tolerability and therapeutic index of the lipid
nanoparticles by an order of magnitude from a 1 mg/kg dose to a 10
mg/kg dose in rat. Inclusion of an enzymatically degraded ester
linkage can improve the degradation and metabolism profile of the
cationic component, while still maintaining the activity of the
reLNP formulation. The ester linkage can be internally located
within the lipid chain or it may be terminally located at the
terminal end of the lipid chain. The internal ester linkage may
replace any carbon in the lipid chain.
[0311] In one embodiment, the internal ester linkage may be located
on either side of the saturated carbon.
[0312] In one embodiment, an immune response may be elicited by
delivering a lipid nanoparticle which may include a nanospecies, a
polymer and an immunogen. (U.S. Publication No. 20120189700 and
International Publication No. WO2012099805; herein incorporated by
reference in their entireties). The polymer may encapsulate the
nanospecies or partially encapsulate the nanospecies. The immunogen
may be a recombinant protein, a modified RNA and/or a primary
construct described herein. In one embodiment, the lipid
nanoparticle may be formulated for use in a vaccine such as, but
not limited to, against a pathogen.
[0313] Lipid nanoparticles may be engineered to alter the surface
properties of particles so the lipid nanoparticles may penetrate
the mucosal barrier. Mucus is located on mucosal tissue such as,
but not limited to, oral (e.g., the buccal and esophageal membranes
and tonsil tissue), ophthalmic, gastrointestinal (e.g., stomach,
small intestine, large intestine, colon, rectum), nasal,
respiratory (e.g., nasal, pharyngeal, tracheal and bronchial
membranes), genital (e.g., vaginal, cervical and urethral
membranes). Nanoparticles larger than 10-200 nm which are preferred
for higher drug encapsulation efficiency and the ability to provide
the sustained delivery of a wide array of drugs have been thought
to be too large to rapidly diffuse through mucosal barriers. Mucus
is continuously secreted, shed, discarded or digested and recycled
so most of the trapped particles may be removed from the mucosla
tissue within seconds or within a few hours. Large polymeric
nanoparticles (200 nm-500 nm in diameter) which have been coated
densely with a low molecular weight polyethylene glycol (PEG)
diffused through mucus only 4 to 6-fold lower than the same
particles diffusing in water (Lai et al. PNAS 2007 104(5):1482-487;
Lai et al. Adv Drug Deliv Rev. 2009 61(2): 158-171; herein
incorporated by reference in their entirety). The transport of
nanoparticles may be determined using rates of permeation and/or
fluorescent microscopy techniques including, but not limited to,
fluorescence recovery after photobleaching (FRAP) and high
resolution multiple particle tracking (MPT).
[0314] The lipid nanoparticle engineered to penetrate mucus may
comprise a polymeric material (i.e. a polymeric core) and/or a
polymer-vitamin conjugate and/or a tri-block co-polymer. The
polymeric material may include, but is not limited to, polyamines,
polyethers, polyamides, polyesters, polycarbamates, polyureas,
polycarbonates, poly(styrenes), polyimides, polysulfones,
polyurethanes, polyacetylenes, polyethylenes, polyethyeneimines,
polyisocyanates, polyacrylates, polymethacrylates,
polyacrylonitriles, and polyarylates. The polymeric material may be
biodegradable and/or biocompatible. Non-limiting examples of
specific polymers include poly(caprolactone) (PCL), ethylene vinyl
acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid)
(PLLA), poly(glycolic acid) (PGA), poly(lactic acid-co-glycolic
acid) (PLGA), poly(L-lactic acid-co-glycolic acid) (PLLGA),
poly(D,L-lactide) (PDLA), poly(L-lactide) (PLLA),
poly(D,L-lactide-co-caprolactone),
poly(D,L-lactide-co-caprolactone-co-glycolide),
poly(D,L-lactide-co-PEO-co-D,L-lactide),
poly(D,L-lactide-co-PPO-co-D,L-lactide), polyalkyl cyanoacrylate,
polyurethane, poly-L-lysine (PLL), hydroxypropyl methacrylate
(HPMA), polyethyleneglycol, poly-L-glutamic acid, poly(hydroxy
acids), polyanhydrides, polyorthoesters, poly(ester amides),
polyamides, poly(ester ethers), polycarbonates, polyalkylenes such
as polyethylene and polypropylene, polyalkylene glycols such as
poly(ethylene glycol) (PEG), polyalkylene oxides (PEO),
polyalkylene terephthalates such as poly(ethylene terephthalate),
polyvinyl alcohols (PVA), polyvinyl ethers, polyvinyl esters such
as poly(vinyl acetate), polyvinyl halides such as poly(vinyl
chloride) (PVC), polyvinylpyrrolidone, polysiloxanes, polystyrene
(PS), polyurethanes, derivatized celluloses such as alkyl
celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose
esters, nitro celluloses, hydroxypropylcellulose,
carboxymethylcellulose, polymers of acrylic acids, such as
poly(methyl(meth)acrylate) (PMMA), poly(ethyl(meth)acrylate),
poly(butyl(meth)acrylate), poly(isobutyl(meth)acrylate),
poly(hexyl(meth)acrylate), poly(isodecyl(meth)acrylate),
poly(lauryl(meth)acrylate), poly(phenyl(meth)acrylate), poly(methyl
acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate),
poly(octadecyl acrylate) and copolymers and mixtures thereof,
polydioxanone and its copolymers, polyhydroxyalkanoates,
polypropylene fumarate, polyoxymethylene, poloxamers,
poly(ortho)esters, poly(butyric acid), poly(valeric acid),
poly(lactide-co-caprolactone), and trimethylene carbonate,
polyvinylpyrrolidone. The lipid nanoparticle may be coated or
associated with a co-polymer such as, but not limited to, a block
co-polymer, and (poly(ethylene glycol))-(poly(propylene
oxide))-(poly(ethylene glycol)) triblock copolymer (see US
Publication 20120121718 and US Publication 20100003337; herein
incorporated by reference in their entireties). The co-polymer may
be a polymer that is generally regarded as safe (GRAS) and the
formation of the lipid nanoparticle may be in such a way that no
new chemical entities are created. For example, the lipid
nanoparticle may comprise poloxamers coating PLGA nanoparticles
without forming new chemical entities which are still able to
rapidly penetrate human mucus (Yang et al. Angew. Chem. Int. Ed.
2011 50:2597-2600; herein incorporated by reference in its
entirety).
[0315] The vitamin of the polymer-vitamin conjugate may be vitamin
E. The vitamin portion of the conjugate may be substituted with
other suitable components such as, but not limited to, vitamin A,
vitamin E, other vitamins, cholesterol, a hydrophobic moiety, or a
hydrophobic component of other surfactants (e.g., sterol chains,
fatty acids, hydrocarbon chains and alkylene oxide chains).
[0316] The lipid nanoparticle engineered to penetrate mucus may
include surface altering agents such as, but not limited to, mmRNA,
anionic protein (e.g., bovine serum albumin), surfactants (e.g.,
cationic surfactants such as for example
dimethyldioctadecyl-ammonium bromide), sugars or sugar derivatives
(e.g., cyclodextrin), nucleic acids, polymers (e.g., heparin,
polyethylene glycol and poloxamer), mucolytic agents (e.g.,
N-acetylcysteine, mugwort, bromelain, papain, clerodendrum,
acetylcysteine, bromhexine, carbocisteine, eprazinone, mesna,
ambroxol, sobrerol, domiodol, letosteine, stepronin, tiopronin,
gelsolin, thymosin (34 dornase alfa, neltenexine, erdosteine) and
various DNases including rhDNase. The surface altering agent may be
embedded or enmeshed in the particle's surface or disposed (e.g.,
by coating, adsorption, covalent linkage, or other process) on the
surface of the lipid nanoparticle. (see US Publication 20100215580
and US Publication 20080166414; herein incorporated by reference in
their entireties).
[0317] The mucus penetrating lipid nanoparticles may comprise at
least one mmRNA described herein. The mmRNA may be encapsulated in
the lipid nanoparticle and/or disposed on the surface of the
particle. The mmRNA may be covalently coupled to the lipid
nanoparticle. Formulations of mucus penetrating lipid nanoparticles
may comprise a plurality of nanoparticles. Further, the
formulations may contain particles which may interact with the
mucus and alter the structural and/or adhesive properties of the
surrounding mucus to decrease mucoadhesion which may increase the
delivery of the mucus penetrating lipid nanoparticles to the
mucosal tissue.
[0318] Lipid nanoparticles may be engineered to alter the surface
properties of particles so the lipid nanoparticles may penetrate
the mucosal barrier. Mucus is located on mucosal tissue such as,
but not limited to, oral (e.g., the buccal and esophageal membranes
and tonsil tissue), ophthalmic, gastrointestinal (e.g., stomach,
small intestine, large intestine, colon, rectum), nasal,
respiratory (e.g., nasal, pharyngeal, tracheal and bronchial
membranes), genital (e.g., vaginal, cervical and urethral
membranes). Nanoparticles larger than 10-200 nm which are preferred
for higher drug encapsulation efficiency and the ability to provide
the sustained delivery of a wide array of drugs have been thought
to be too large to rapidly diffuse through mucosal barriers. Mucus
is continuously secreted, shed, discarded or digested and recycled
so most of the trapped particles may be removed from the mucosla
tissue within seconds or within a few hours. Large polymeric
nanoparticles (200 nm-500 nm in diameter) which have been coated
densely with a low molecular weight polyethylene glycol (PEG)
diffused through mucus only 4 to 6-fold lower than the same
particles diffusing in water (Lai et al. PNAS 2007 104(5):1482-487;
Lai et al. Adv Drug Deliv Rev. 2009 61(2): 158-171; herein
incorporated by reference in their entirety). The transport of
nanoparticles may be determined using rates of permeation and/or
fluorescent microscopy techniques including, but not limited to,
fluorescence recovery after photobleaching (FRAP) and high
resolution multiple particle tracking (MPT).
[0319] The lipid nanoparticle engineered to penetrate mucus may
comprise a polymeric material (i.e. a polymeric core) and/or a
polymer-vitamin conjugate and/or a tri-block co-polymer. The
polymeric material may including, but is not limited to,
polyamines, polyethers, polyamides, polyesters, polycarbamates,
polyureas, polycarbonates, poly(styrenes), polyimides,
polysulfones, polyurethanes, polyacetylenes, polyethylenes,
polyethyeneimines, polyisocyanates, polyacrylates,
polymethacrylates, polyacrylonitriles, and polyarylates. The
polymeric material may be biodegradable and/or biocompatible.
Non-limiting examples of specific polymers include
poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA),
poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic
acid) (PGA), poly(lactic acid-co-glycolic acid) (PLGA),
poly(L-lactic acid-co-glycolic acid) (PLLGA), poly(D,L-lactide)
(PDLA), poly(L-lactide) (PLLA), poly(D,L-lactide-co-caprolactone),
poly(D,L-lactide-co-caprolactone-co-glycolide),
poly(D,L-lactide-co-PEO-co-D,L-lactide),
poly(D,L-lactide-co-PPO-co-D,L-lactide), polyalkyl cyanoacrylate,
polyurethane, poly-L-lysine (PLL), hydroxypropyl methacrylate
(HPMA), polyethyleneglycol, poly-L-glutamic acid, poly(hydroxy
acids), polyanhydrides, polyorthoesters, poly(ester amides),
polyamides, poly(ester ethers), polycarbonates, polyalkylenes such
as polyethylene and polypropylene, polyalkylene glycols such as
poly(ethylene glycol) (PEG), polyalkylene oxides (PEO),
polyalkylene terephthalates such as poly(ethylene terephthalate),
polyvinyl alcohols (PVA), polyvinyl ethers, polyvinyl esters such
as poly(vinyl acetate), polyvinyl halides such as poly(vinyl
chloride) (PVC), polyvinylpyrrolidone, polysiloxanes, polystyrene
(PS), polyurethanes, derivatized celluloses such as alkyl
celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose
esters, nitro celluloses, hydroxypropylcellulose,
carboxymethylcellulose, polymers of acrylic acids, such as
poly(methyl(meth)acrylate) (PMMA), poly(ethyl(meth)acrylate),
poly(butyl(meth)acrylate), poly(isobutyl(meth)acrylate),
poly(hexyl(meth)acrylate), poly(isodecyl(meth)acrylate),
poly(lauryl(meth)acrylate), poly(phenyl(meth)acrylate), poly(methyl
acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate),
poly(octadecyl acrylate) and copolymers and mixtures thereof,
polydioxanone and its copolymers, polyhydroxyalkanoates,
polypropylene fumarate, polyoxymethylene, poloxamers,
poly(ortho)esters, poly(butyric acid), poly(valeric acid),
poly(lactide-co-caprolactone), and trimethylene carbonate,
polyvinylpyrrolidone. The lipid nanoparticle may be coated or
associated with a co-polymer such as, but not limited to, a block
co-polymer, and (poly(ethylene glycol))-(poly(propylene
oxide))-(poly(ethylene glycol)) triblock copolymer (see US
Publication 20120121718 and US Publication 20100003337; herein
incorporated by reference in their entireties).
[0320] The vitamin of the polymer-vitamin conjugate may be vitamin
E. The vitamin portion of the conjugate may be substituted with
other suitable components such as, but not limited to, vitamin A,
vitamin E, other vitamins, cholesterol, a hydrophobic moiety, or a
hydrophobic component of other surfactants (e.g., sterol chains,
fatty acids, hydrocarbon chains and alkylene oxide chains).
[0321] The lipid nanoparticle engineered to penetrate mucus may
include surface altering agents such as, but not limited to, mmRNA,
anionic protein (e.g., bovine serum albumin), surfactants (e.g.,
cationic surfactants such as for example
dimethyldioctadecyl-ammonium bromide), sugars or sugar derivatives
(e.g., cyclodextrin), nucleic acids, polymers (e.g., heparin,
polyethylene glycol and poloxamer), mucolytic agents (e.g.,
N-acetylcysteine, mugwort, bromelain, papain, clerodendrum,
acetylcysteine, bromhexine, carbocisteine, eprazinone, mesna,
ambroxol, sobrerol, domiodol, letosteine, stepronin, tiopronin,
gelsolin, thymosin .beta.4 dornase alfa, neltenexine, erdosteine)
and various DNases including rhDNase. The surface altering agent
may be embedded or enmeshed in the particle's surface or disposed
(e.g., by coating, adsorption, covalent linkage, or other process)
on the surface of the lipid nanoparticle. (see US Publication
20100215580 and US Publication 20080166414; herein incorporated by
reference in their entireties).
[0322] The mucus penetrating lipid nanoparticles may comprise at
least one polynucleotide, primary construct, or mmRNA described
herein. The polynucleotide, primary construct, or mmRNA may be
encapsulated in the lipid nanoparticle and/or disposed on the
surface of the particle. The polynucleotide, primary construct, or
mmRNA may be covalently coupled to the lipid nanoparticle.
Formulations of mucus penetrating lipid nanoparticles may comprise
a plurality of nanoparticles. Further, the formulations may contain
particles which may interact with the mucus and alter the
structural and/or adhesive properties of the surrounding mucus to
decrease mucoadhesion which may increase the delivery of the mucus
penetrating lipid nanoparticles to the mucosal tissue.
[0323] In one embodiment, the polynucleotide, primary construct, or
mmRNA is formulated as a lipoplex, such as, without limitation, the
ATUPLEX.TM. system, the DACC system, the DBTC system and other
siRNA-lipoplex technology from Silence Therapeutics (London, United
Kingdom), STEMFECT.TM. from STEMGENT.RTM. (Cambridge, Mass.), and
polyethylenimine (PEI) or protamine-based targeted and non-targeted
delivery of nucleic acids (Aleku et al. Cancer Res. 2008
68:9788-9798; Strumberg et al. Int J Clin Pharmacol Ther 2012
50:76-78; Santel et al., Gene Ther 2006 13:1222-1234; Santel et
al., Gene Ther 2006 13:1360-1370; Gutbier et al., Pulm Pharmacol.
Ther. 2010 23:334-344; Kaufmann et al. Microvasc Res 2010
80:286-293Weide et al. J Immunother. 2009 32:498-507; Weide et al.
J Immunother. 2008 31:180-188; Pascolo Expert Opin. Biol. Ther.
4:1285-1294; Fotin-Mleczek et al., 2011 J. Immunother. 34:1-15;
Song et al., Nature Biotechnol. 2005, 23:709-717; Peer et al., Proc
Natl Acad Sci USA. 2007 6; 104:4095-4100; deFougerolles Hum Gene
Ther. 2008 19:125-132; all of which are incorporated herein by
reference in its entirety).
[0324] In one embodiment such formulations may also be constructed
or compositions altered such that they passively or actively are
directed to different cell types in vivo, including but not limited
to hepatocytes, immune cells, tumor cells, endothelial cells,
antigen presenting cells, and leukocytes (Akinc et al. Mol Ther.
2010 18:1357-1364; Song et al., Nat Biotechnol. 2005 23:709-717;
Judge et al., J Clin Invest. 2009 119:661-673; Kaufmann et al.,
Microvasc Res 2010 80:286-293; Santel et al., Gene Ther 2006
13:1222-1234; Santel et al., Gene Ther 2006 13:1360-1370; Gutbier
et al., Pulm Pharmacol. Ther. 2010 23:334-344; Basha et al., Mol.
Ther. 2011 19:2186-2200; Fenske and Cullis, Expert Opin Drug Deliv.
2008 5:25-44; Peer et al., Science. 2008 319:627-630; Peer and
Lieberman, Gene Ther. 2011 18:1127-1133; all of which are
incorporated herein by reference in its entirety). One example of
passive targeting of formulations to liver cells includes the
DLin-DMA, DLin-KC2-DMA and MC3-based lipid nanoparticle
formulations which have been shown to bind to apolipoprotein E and
promote binding and uptake of these formulations into hepatocytes
in vivo (Akinc et al. Mol Ther. 2010 18:1357-1364; herein
incorporated by reference in its entirety). Formulations can also
be selectively targeted through expression of different ligands on
their surface as exemplified by, but not limited by, folate,
transferrin, N-acetylgalactosamine (GalNAc), and antibody targeted
approaches (Kolhatkar et al., Curr Drug Discov Technol. 2011
8:197-206; Musacchio and Torchilin, Front Biosci. 2011
16:1388-1412; Yu et al., Mol Membr Biol. 2010 27:286-298; Patil et
al., Crit Rev Ther Drug Carrier Syst. 2008 25:1-61; Benoit et al.,
Biomacromolecules. 2011 12:2708-2714Zhao et al., Expert Opin Drug
Deliv. 2008 5:309-319; Akinc et al., Mol Ther. 2010 18:1357-1364;
Srinivasan et al., Methods Mol Biol. 2012 820:105-116; Ben-Arie et
al., Methods Mol Biol. 2012 757:497-507; Peer 2010 J Control
Release. 20:63-68; Peer et al., Proc Natl Acad Sci USA. 2007
104:4095-4100; Kim et al., Methods Mol Biol. 2011 721:339-353;
Subramanya et al., Mol Ther. 2010 18:2028-2037; Song et al., Nat
Biotechnol. 2005 23:709-717; Peer et al., Science. 2008
319:627-630; Peer and Lieberman, Gene Ther. 2011 18:1127-1133; all
of which are incorporated herein by reference in its entirety).
[0325] In one embodiment, the polynucleotide, primary construct, or
mmRNA is formulated as a solid lipid nanoparticle. A solid lipid
nanoparticle (SLN) may be spherical with an average diameter
between 10 to 1000 nm. SLN possess a solid lipid core matrix that
can solubilize lipophilic molecules and may be stabilized with
surfactants and/or emulsifiers. In a further embodiment, the lipid
nanoparticle may be a self-assembly lipid-polymer nanoparticle (see
Zhang et al., ACS Nano, 2008, 2 (8), pp 1696-1702; herein
incorporated by reference in its entirety).
[0326] Liposomes, lipoplexes, or lipid nanoparticles may be used to
improve the efficacy of polynucleotide, primary construct, or mmRNA
directed protein production as these formulations may be able to
increase cell transfection by the polynucleotide, primary
construct, or mmRNA; and/or increase the translation of encoded
protein. One such example involves the use of lipid encapsulation
to enable the effective systemic delivery of polyplex plasmid DNA
(Heyes et al., Mol Ther. 2007 15:713-720; herein incorporated by
reference in its entirety). The liposomes, lipoplexes, or lipid
nanoparticles may also be used to increase the stability of the
polynucleotide, primary construct, or mmRNA.
[0327] Polymers, Biodegradable Nanoparticles, and Core-Shell
Nanoparticles
[0328] The polynucleotide, primary construct, and mmRNA of the
invention can be formulated using natural and/or synthetic
polymers. Non-limiting examples of polymers which may be used for
delivery include, but are not limited to, Dynamic POLYCONJUGATE.TM.
formulations from MIRUS.RTM. Bio (Madison, Wis.) and Roche Madison
(Madison, Wis.), PHASERX.TM. polymer formulations such as, without
limitation, SMARTT POLYMER TECHNOLOGY.TM. (Seattle, Wash.),
DMRI/DOPE, poloxamer, VAXFECTIN.RTM. adjuvant from Vical (San
Diego, Calif.), chitosan, cyclodextrin from Calando Pharmaceuticals
(Pasadena, Calif.), dendrimers and poly(lactic-co-glycolic acid)
(PLGA) polymers. RONDEL.TM. (RNAi/Oligonucleotide Nanoparticle
Delivery) polymers (Arrowhead Research Corporation, Pasadena,
Calif.) and pH responsive co-block polymers such as, but not
limited to, PHASERX.TM. (Seattle, Wash.).
[0329] A non-limiting example of PLGA formulations include, but are
not limited to, PLGA injectable depots (e.g., ELIGARD.RTM. which is
formed by dissolving PLGA in 66% N-methyl-2-pyrrolidone (NMP) and
the remainder being aqueous solvent and leuprolide. Once injected,
the PLGA and leuprolide peptide precipitates into the subcutaneous
space).
[0330] Many of these polymer approaches have demonstrated efficacy
in delivering oligonucleotides in vivo into the cell cytoplasm
(reviewed in deFougerolles Hum Gene Ther. 2008 19:125-132; herein
incorporated by reference in its entirety). Two polymer approaches
that have yielded robust in vivo delivery of nucleic acids, in this
case with small interfering RNA (siRNA), are dynamic polyconjugates
and cyclodextrin-based nanoparticles. The first of these delivery
approaches uses dynamic polyconjugates and has been shown in vivo
in mice to effectively deliver siRNA and silence endogenous target
mRNA in hepatocytes (Rozema et al., Proc Natl Acad Sci USA. 2007
104:12982-12887). This particular approach is a multicomponent
polymer system whose key features include a membrane-active polymer
to which nucleic acid, in this case siRNA, is covalently coupled
via a disulfide bond and where both PEG (for charge masking) and
N-acetylgalactosamine (for hepatocyte targeting) groups are linked
via pH-sensitive bonds (Rozema et al., Proc Natl Acad Sci USA. 2007
104:12982-12887). On binding to the hepatocyte and entry into the
endosome, the polymer complex disassembles in the low-pH
environment, with the polymer exposing its positive charge, leading
to endosomal escape and cytoplasmic release of the siRNA from the
polymer. Through replacement of the N-acetylgalactosamine group
with a mannose group, it was shown one could alter targeting from
asialoglycoprotein receptor-expressing hepatocytes to sinusoidal
endothelium and Kupffer cells. Another polymer approach involves
using transferrin-targeted cyclodextrin-containing polycation
nanoparticles. These nanoparticles have demonstrated targeted
silencing of the EWS-FLI1 gene product in transferrin
receptor-expressing Ewing's sarcoma tumor cells (Hu-Lieskovan et
al., Cancer Res. 2005 65: 8984-8982) and siRNA formulated in these
nanoparticles was well tolerated in non-human primates (Heidel et
al., Proc Natl Acad Sci USA 2007 104:5715-21). Both of these
delivery strategies incorporate rational approaches using both
targeted delivery and endosomal escape mechanisms.
[0331] The polymer formulation can permit the sustained or delayed
release of polynucleotide, primary construct, or mmRNA (e.g.,
following intramuscular or subcutaneous injection). The altered
release profile for the polynucleotide, primary construct, or mmRNA
can result in, for example, translation of an encoded protein over
an extended period of time. The polymer formulation may also be
used to increase the stability of the polynucleotide, primary
construct, or mmRNA. Biodegradable polymers have been previously
used to protect nucleic acids other than mmRNA from degradation and
been shown to result in sustained release of payloads in vivo
(Rozema et al., Proc Natl Acad Sci USA. 2007 104:12982-12887;
Sullivan et al., Expert Opin Drug Deliv. 2010 7:1433-1446;
Convertine et al., Biomacromolecules. 2010 Oct. 1; Chu et al., Acc
Chem Res. 2012 Jan. 13; Manganiello et al., Biomaterials. 2012
33:2301-2309; Benoit et al., Biomacromolecules. 2011 12:2708-2714;
Singha et al., Nucleic Acid Ther. 2011 2:133-147; deFougerolles Hum
Gene Ther. 2008 19:125-132; Schaffert and Wagner, Gene Ther. 2008
16:1131-1138; Chaturvedi et al., Expert Opin Drug Deliv. 2011
8:1455-1468; Davis, Mol Pharm. 2009 6:659-668; Davis, Nature 2010
464:1067-1070; herein incorporated by reference in its
entirety).
[0332] In one embodiment, the pharmaceutical compositions may be
sustained release formulations. In a further embodiment, the
sustained release formulations may be for subcutaneous delivery.
Sustained release formulations may include, but are not limited to,
PLGA microspheres, ethylene vinyl acetate (EVAc), poloxamer,
GELSITE.RTM. (Nanotherapeutics, Inc. Alachua, Fla.), HYLENEX.RTM.
(Halozyme Therapeutics, San Diego Calif.), surgical sealants such
as fibrinogen polymers (Ethicon Inc. Cornelia, Ga.). TISSELL.RTM.
(Baxter International, Inc Deerfield, Ill.), PEG-based sealants,
and COSEAL.RTM. (Baxter International, Inc Deerfield, Ill.),
[0333] As a non-limiting example modified mRNA may be formulated in
PLGA microspheres by preparing the PLGA microspheres with tunable
release rates (e.g., days and weeks) and encapsulating the modified
mRNA in the PLGA microspheres while maintaining the integrity of
the modified mRNA during the encapsulation process. EVAc are
non-biodegradable, biocompatible polymers which are used
extensively in pre-clinical sustained release implant applications
(e.g., extended release products Ocusert a pilocarpine ophthalmic
insert for glaucoma or progestasert a sustained release
progesterone intrauterine device; transdermal delivery systems
Testoderm, Duragesic and Selegiline; catheters). Poloxamer F-407 NF
is a hydrophilic, non-ionic surfactant triblock copolymer of
polyoxyethylene-polyoxypropylene-polyoxyethylene having a low
viscosity at temperatures less than 5.degree. C. and forms a solid
gel at temperatures greater than 15.degree. C. PEG-based surgical
sealants comprise two synthetic PEG components mixed in a delivery
device which can be prepared in one minute, seals in 3 minutes and
is reabsorbed within 30 days. GELSITE.RTM. and natural polymers are
capable of in-situ gelation at the site of administration. They
have been shown to interact with protein and peptide therapeutic
candidates through ionic interaction to provide a stabilizing
effect.
[0334] Polymer formulations can also be selectively targeted
through expression of different ligands as exemplified by, but not
limited by, folate, transferrin, and N-acetylgalactosamine (GalNAc)
(Benoit et al., Biomacromolecules. 2011 12:2708-2714; Rozema et
al., Proc Natl Acad Sci USA. 2007 104:12982-12887; Davis, Mol
Pharm. 2009 6:659-668; Davis, Nature 2010 464:1067-1070; herein
incorporated by reference in its entirety).
[0335] The mmRNA of the invention may be formulated with or in a
polymeric compound. The polymer may include at least one polymer
such as, but not limited to, polyethylene glycol (PEG),
poly(l-lysine)(PLL), PEG grafted to PLL, cationic lipopolymer,
biodegradable cationic lipopolymer, polyethyleneimine (PEI),
cross-linked branched poly(alkylene imines), a polyamine
derivative, a modified poloxamer, a biodegradable polymer,
biodegradable block copolymer, biodegradable random copolymer,
biodegradable polyester copolymer, biodegradable polyester block
copolymer, biodegradable polyester block random copolymer, linear
biodegradable copolymer, poly[.alpha.-(4-aminobutyl)-L-glycolic
acid) (PAGA), biodegradable cross-linked cationic multi-block
copolymers or combinations thereof.
[0336] As a non-limiting example, the mmRNA of the invention may be
formulated with the polymeric compound of PEG grafted with PLL as
described in U.S. Pat. No. 6,177,274 herein incorporated by
reference in its entirety. The formulation may be used for
transfecting cells in vitro or for in vivo delivery of the mmRNA.
In another example, the mmRNA may be suspended in a solution or
medium with a cationic polymer, in a dry pharmaceutical composition
or in a solution that is capable of being dried as described in
U.S. Pub. Nos. 20090042829 and 20090042825 each of which are herein
incorporated by reference in their entireties.
[0337] A polyamine derivative may be used to deliver nucleic acids
or to treat and/or prevent a disease or to be included in an
implantable or injectable device (U.S. Pub. No. 20100260817 herein
incorporated by reference in its entirety). As a non-limiting
example, a pharmaceutical composition may include the mmRNA and the
polyamine derivative described in U.S. Pub. No. 20100260817 (the
contents of which are incorporated herein by reference in its
entirety.
[0338] For example, the mmRNA of the invention may be formulated in
a pharmaceutical compound including a poly(alkylene imine), a
biodegradable cationic lipopolymer, a biodegradable block
copolymer, a biodegradable polymer, or a biodegradable random
copolymer, a biodegradable polyester block copolymer, a
biodegradable polyester polymer, a biodegradable polyester random
copolymer, a linear biodegradable copolymer, PAGA, a biodegradable
cross-linked cationic multi-block copolymer or combinations
thereof. The biodegradable cationic lipopolymer may be made my
methods known in the art and/or described in U.S. Pat. No.
6,696,038, U.S. App. Nos. 20030073619 and 20040142474 which is
herein incorporated by reference in their entireties. The
poly(alkylene imine) may be made using methods known in the art
and/or as described in U.S. Pub. No. 20100004315, herein
incorporated by reference in its entirety. The biodegradable
polymer, biodegradable block copolymer, the biodegradable random
copolymer, biodegradable polyester block copolymer, biodegradable
polyester polymer, or biodegradable polyester random copolymer may
be made using methods known in the art and/or as described in U.S.
Pat. Nos. 6,517,869 and 6,267,987, the contents of which are each
incorporated herein by reference in its entirety. The linear
biodegradable copolymer may be made using methods known in the art
and/or as described in U.S. Pat. No. 6,652,886. The PAGA polymer
may be made using methods known in the art and/or as described in
U.S. Pat. No. 6,217,912 herein incorporated by reference in its
entirety. The PAGA polymer may be copolymerized to form a copolymer
or block copolymer with polymers such as but not limited to,
poly-L-lysine, polyargine, polyornithine, histones, avidin,
protamines, polylactides and poly(lactide-co-glycolides). The
biodegradable cross-linked cationic multi-block copolymers may be
made my methods known in the art and/or as described in U.S. Pat.
No. 8,057,821 or U.S. Pub. No. 2012009145 herein incorporated by
reference in their entireties. For example, the multi-block
copolymers may be synthesized using linear polyethyleneimine (LPEI)
blocks which have distinct patterns as compared to branched
polyethyleneimines. Further, the composition or pharmaceutical
composition may be made by the methods known in the art, described
herein, or as described in U.S. Pub. No. 20100004315 or U.S. Pat.
Nos. 6,267,987 and 6,217,912 herein incorporated by reference in
their entireties.
[0339] As described in U.S. Pub. No. 20100004313, herein
incorporated by reference in its entirety, a gene delivery
composition may include a nucleotide sequence and a poloxamer. For
example, the mmRNA of the present invention may be used in a gene
delivery composition with the poloxamer described in U.S. Pub. No.
20100004313.
[0340] In one embodiment, the polymer formulation of the present
invention may be stabilized by contacting the polymer formulation,
which may include a cationic carrier, with a cationic lipopolymer
which may be covalently linked to cholesterol and polyethylene
glycol groups. The polymer formulation may be contacted with a
cationic lipopolymer using the methods described in U.S. Pub. No.
20090042829 herein incorporated by reference in its entirety. The
cationic carrier may include, but is not limited to,
polyethylenimine, poly(trimethylenimine), poly(tetramethylenimine),
polypropylenimine, aminoglycoside-polyamine,
dideoxy-diamino-b-cyclodextrin, spermine, spermidine,
poly(2-dimethylamino)ethyl methacrylate, poly(lysine),
poly(histidine), poly(arginine), cationized gelatin, dendrimers,
chitosan, 1,2-Dioleoyl-3-Trimethylammonium-Propane (DOTAP),
N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride
(DOTMA),
1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium
chloride (DOTIM),
2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-pr-
opanaminium trifluoroacetate (DOSPA),
3B-[N--(N',N'-Dimethylaminoethane)-carbamoyl]Cholesterol
Hydrochloride (DC-Cholesterol HCl) diheptadecylamidoglycyl
spermidine (DOGS), N,N-distearyl-N,N-dimethylammonium bromide
(DDAB), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl
ammonium bromide (DMRIE), N,N-dioleyl-N,N-dimethylammonium chloride
DODAC) and combinations thereof.
[0341] The polynucleotide, primary construct, and mmRNA of the
invention can also be formulated as a nanoparticle using a
combination of polymers, lipids, and/or other biodegradable agents,
such as, but not limited to, calcium phosphate. Components may be
combined in a core-shell, hybrid, and/or layer-by-layer
architecture, to allow for fine-tuning of the nanoparticle so to
delivery of the polynucleotide, primary construct and mmRNA may be
enhanced (Wang et al., Nat Mater. 2006 5:791-796; Fuller et al.,
Biomaterials. 2008 29:1526-1532; DeKoker et al., Adv Drug Deliv
Rev. 2011 63:748-761; Endres et al., Biomaterials. 2011
32:7721-7731; Su et al., Mol Pharm. 2011 Jun. 6; 8(3):774-87;
herein incorporated by reference in its entirety).
[0342] Biodegradable calcium phosphate nanoparticles in combination
with lipids and/or polymers have been shown to deliver
polynucleotides, primary constructs and mmRNA in vivo. In one
embodiment, a lipid coated calcium phosphate nanoparticle, which
may also contain a targeting ligand such as anisamide, may be used
to deliver the polynucleotide, primary construct and mmRNA of the
present invention. For example, to effectively deliver siRNA in a
mouse metastatic lung model a lipid coated calcium phosphate
nanoparticle was used (Li et al., J Contr Rel. 2010 142: 416-421;
Li et al., J Contr Rel. 2012 158:108-114; Yang et al., Mol Ther.
2012 20:609-615). This delivery system combines both a targeted
nanoparticle and a component to enhance the endosomal escape,
calcium phosphate, in order to improve delivery of the siRNA.
[0343] In one embodiment, calcium phosphate with a PEG-polyanion
block copolymer may be used to deliver polynucleotides, primary
constructs and mmRNA (Kazikawa et al., J Contr Rel. 2004
97:345-356; Kazikawa et al., J Contr Rel. 2006 111:368-370).
[0344] In one embodiment, a PEG-charge-conversional polymer
(Pitella et al., Biomaterials. 2011 32:3106-3114) may be used to
form a nanoparticle to deliver the polynucleotides, primary
constructs and mmRNA of the present invention. The
PEG-charge-conversional polymer may improve upon the PEG-polyanion
block copolymers by being cleaved into a polycation at acidic pH,
thus enhancing endosomal escape.
[0345] The use of core-shell nanoparticles has additionally focused
on a high-throughput approach to synthesize cationic cross-linked
nanogel cores and various shells (Siegwart et al., Proc Natl Acad
Sci USA. 2011 108:12996-13001). The complexation, delivery, and
internalization of the polymeric nanoparticles can be precisely
controlled by altering the chemical composition in both the core
and shell components of the nanoparticle. For example, the
core-shell nanoparticles may efficiently deliver siRNA to mouse
hepatocytes after they covalently attach cholesterol to the
nanoparticle.
[0346] In one embodiment, a hollow lipid core comprising a middle
PLGA layer and an outer neutral lipid layer containing PEG may be
used to delivery of the polynucleotide, primary construct and mmRNA
of the present invention. As a non-limiting example, in mice
bearing a luciferase-expressing tumor, it was determined that the
lipid-polymer-lipid hybrid nanoparticle significantly suppressed
luciferase expression, as compared to a conventional lipoplex (Shi
et al, Angew Chem Int Ed. 2011 50:7027-7031).
Peptides and Proteins
[0347] The polynucleotide, primary construct, and mmRNA of the
invention can be formulated with peptides and/or proteins in order
to increase transfection of cells by the polynucleotide, primary
construct, or mmRNA. In one embodiment, peptides such as, but not
limited to, cell penetrating peptides and proteins and peptides
that enable intracellular delivery may be used to deliver
pharmaceutical formulations. A non-limiting example of a cell
penetrating peptide which may be used with the pharmaceutical
formulations of the present invention includes a cell-penetrating
peptide sequence attached to polycations that facilitates delivery
to the intracellular space, e.g., HIV-derived TAT peptide,
penetratins, transportans, or hCT derived cell-penetrating peptides
(see, e.g., Caron et al., Mol. Ther. 3(3):310-8 (2001); Langel,
Cell-Penetrating Peptides: Processes and Applications (CRC Press,
Boca Raton Fla., 2002); El-Andaloussi et al., Curr. Pharm. Des.
11(28):3597-611 (2003); and Deshayes et al., Cell. Mol. Life Sci.
62(16):1839-49 (2005), all of which are incorporated herein by
reference). The compositions can also be formulated to include a
cell penetrating agent, e.g., liposomes, which enhance delivery of
the compositions to the intracellular space. polynucleotides,
primary constructs, and mmRNA of the invention may be complexed to
peptides and/or proteins such as, but not limited to, peptides
and/or proteins from Aileron Therapeutics (Cambridge, Mass.) and
Permeon Biologics (Cambridge, Mass.) in order to enable
intracellular delivery (Cronican et al., ACS Chem. Biol. 2010
5:747-752; McNaughton et al., Proc. Natl. Acad. Sci. USA 2009
106:6111-6116; Sawyer, Chem Biol Drug Des. 2009 73:3-6; Verdine and
Hilinski, Methods Enzymol. 2012; 503:3-33; all of which are herein
incorporated by reference in its entirety).
[0348] In one embodiment, the cell-penetrating polypeptide may
comprise a first domain and a second domain. The first domain may
comprise a supercharged polypeptide. The second domain may comprise
a protein-binding partner. As used herein, "protein-binding
partner" includes, but are not limited to, antibodies and
functional fragments thereof, scaffold proteins, or peptides. The
cell-penetrating polypeptide may further comprise an intracellular
binding partner for the protein-binding partner. The
cell-penetrating polypeptide may be capable of being secreted from
a cell where the polynucleotide, primary construct, or mmRNA may be
introduced.
[0349] Formulations of the including peptides or proteins may be
used to increase cell transfection by the polynucleotide, primary
construct, or mmRNA, alter the biodistribution of the
polynucleotide, primary construct, or mmRNA (e.g., by targeting
specific tissues or cell types), and/or increase the translation of
encoded protein.
Cells
[0350] The polynucleotide, primary construct, and mmRNA of the
invention can be transfected ex vivo into cells, which are
subsequently transplanted into a subject. As non-limiting examples,
the pharmaceutical compositions may include red blood cells to
deliver modified RNA to liver and myeloid cells, virosomes to
deliver modified RNA in virus-like particles (VLPs), and
electroporated cells such as, but not limited to, from MAXCYTE.RTM.
(Gaithersburg, Md.) and from ERYTECH.RTM. (Lyon, France) to deliver
modified RNA. Examples of use of red blood cells, viral particles
and electroporated cells to deliver payloads other than mmRNA have
been documented (Godfrin et al., Expert Opin Biol Ther. 2012
12:127-133; Fang et al., Expert Opin Biol Ther. 2012 12:385-389; Hu
et al., Proc Natl Acad Sci USA. 2011 108:10980-10985; Lund et al.,
Pharm Res. 2010 27:400-420; Huckriede et al., J Liposome Res. 2007;
17:39-47; Cusi, Hum Vaccin. 2006 2:1-7; de Jonge et al., Gene Ther.
2006 13:400-411; all of which are herein incorporated by reference
in its entirety).
[0351] Cell-based formulations of the polynucleotide, primary
construct, and mmRNA of the invention may be used to ensure cell
transfection (e.g., in the cellular carrier), alter the
biodistribution of the polynucleotide, primary construct, or mmRNA
(e.g., by targeting the cell carrier to specific tissues or cell
types), and/or increase the translation of encoded protein.
[0352] A variety of methods are known in the art and suitable for
introduction of nucleic acid into a cell, including viral and
non-viral mediated techniques. Examples of typical non-viral
mediated techniques include, but are not limited to,
electroporation, calcium phosphate mediated transfer,
nucleofection, sonoporation, heat shock, magnetofection, liposome
mediated transfer, microinjection, microprojectile mediated
transfer (nanoparticles), cationic polymer mediated transfer
(DEAE-dextran, polyethylenimine, polyethylene glycol (PEG) and the
like) or cell fusion.
[0353] The technique of sonoporation, or cellular sonication, is
the use of sound (e.g., ultrasonic frequencies) for modifying the
permeability of the cell plasma membrane. Sonoporation methods are
known to those in the art and are used to deliver nucleic acids in
vivo (Yoon and Park, Expert Opin Drug Deliv. 2010 7:321-330;
Postema and Gilja, Curr Pharm Biotechnol. 2007 8:355-361; Newman
and Bettinger, Gene Ther. 2007 14:465-475; all herein incorporated
by reference in their entirety). Sonoporation methods are known in
the art and are also taught for example as it relates to bacteria
in US Patent Publication 20100196983 and as it relates to other
cell types in, for example, US Patent Publication 20100009424, each
of which are incorporated herein by reference in their
entirety.
[0354] Electroporation techniques are also well known in the art
and are used to deliver nucleic acids in vivo and clinically (Andre
et al., Curr Gene Ther. 2010 10:267-280; Chiarella et al., Curr
Gene Ther. 2010 10:281-286; Hojman, Curr Gene Ther. 2010
10:128-138; all herein incorporated by reference in their
entirety).
Hyaluronidase
[0355] The intramuscular or subcutaneous localized injection of
polynucleotide, primary construct, or mmRNA of the invention can
include hyaluronidase, which catalyzes the hydrolysis of
hyaluronan. By catalyzing the hydrolysis of hyaluronan, a
constituent of the interstitial barrier, hyaluronidase lowers the
viscosity of hyaluronan, thereby increasing tissue permeability
(Frost, Expert Opin. Drug Deliv. (2007) 4:427-440; herein
incorporated by reference in its entirety). It is useful to speed
their dispersion and systemic distribution of encoded proteins
produced by transfected cells. Alternatively, the hyaluronidase can
be used to increase the number of cells exposed to a
polynucleotide, primary construct, or mmRNA of the invention
administered intramuscularly or subcutaneously.
Nanoparticle Mimics
[0356] The polynucleotide, primary construct or mmRNA of the
invention may be encapsulated within and/or absorbed to a
nanoparticle mimic. A nanoparticle mimic can mimic the delivery
function organisms or particles such as, but not limited to,
pathogens, viruses, bacteria, fungus, parasites, prions and cells.
As a non-limiting example the polynucleotide, primary construct or
mmRNA of the invention may be encapsulated in a non-viron particle
which can mimic the delivery function of a virus (see International
Pub. No. WO2012006376 herein incorporated by reference in its
entirety).
Nanotubes
[0357] The polynucleotides, primary constructs or mmRNA of the
invention can be attached or otherwise bound to at least one
nanotube such as, but not limited to, rosette nanotubes, rosette
nanotubes having twin bases with a linker, carbon nanotubes and/or
single-walled carbon nanotubes, The polynucleotides, primary
constructs or mmRNA may be bound to the nanotubes through forces
such as, but not limited to, steric, ionic, covalent and/or other
forces.
[0358] In one embodiment, the nanotube can release one or more
polynucleotides, primary constructs or mmRNA into cells. The size
and/or the surface structure of at least one nanotube may be
altered so as to govern the interaction of the nanotubes within the
body and/or to attach or bind to the polynucleotides, primary
constructs or mmRNA disclosed herein. In one embodiment, the
building block and/or the functional groups attached to the
building block of the at least one nanotube may be altered to
adjust the dimensions and/or properties of the nanotube. As a
non-limiting example, the length of the nanotubes may be altered to
hinder the nanotubes from passing through the holes in the walls of
normal blood vessels but still small enough to pass through the
larger holes in the blood vessels of tumor tissue.
[0359] In one embodiment, at least one nanotube may also be coated
with delivery enhancing compounds including polymers, such as, but
not limited to, polyethylene glycol. In another embodiment, at
least one nanotube and/or the polynucleotides, primary constructs
or mmRNA may be mixed with pharmaceutically acceptable excipients
and/or delivery vehicles.
[0360] In one embodiment, the polynucleotides, primary constructs
or mmRNA are attached and/or otherwise bound to at least one
rosette nanotube. The rosette nanotubes may be formed by a process
known in the art and/or by the process described in International
Publication No. WO2012094304, herein incorporated by reference in
its entirety. At least one polynucleotide, primary construct and/or
mmRNA may be attached and/or otherwise bound to at least one
rosette nanotube by a process as described in International
Publication No. WO2012094304, herein incorporated by reference in
its entirety, where rosette nanotubes or modules forming rosette
nanotubes are mixed in aqueous media with at least one
polynucleotide, primary construct and/or mmRNA under conditions
which may cause at least one polynucleotide, primary construct or
mmRNA to attach or otherwise bind to the rosette nanotubes.
Conjugates
[0361] The polynucleotides, primary constructs, and mmRNA of the
invention include conjugates, such as a polynucleotide, primary
construct, or mmRNA covalently linked to a carrier or targeting
group, or including two encoding regions that together produce a
fusion protein (e.g., bearing a targeting group and therapeutic
protein or peptide).
[0362] The conjugates of the invention include a naturally
occurring substance, such as a protein (e.g., human serum albumin
(HSA), low-density lipoprotein (LDL), high-density lipoprotein
(HDL), or globulin); an carbohydrate (e.g., a dextran, pullulan,
chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a
lipid. The ligand may also be a recombinant or synthetic molecule,
such as a synthetic polymer, e.g., a synthetic polyamino acid, an
oligonucleotide (e.g. an aptamer). Examples of polyamino acids
include polyamino acid is a polylysine (PLL), poly L-aspartic acid,
poly L-glutamic acid, styrene-maleic acid anhydride copolymer,
poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic
anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer
(HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA),
polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide
polymers, or polyphosphazine. Example of polyamines include:
polyethylenimine, polylysine (PLL), spermine, spermidine,
polyamine, pseudopeptide-polyamine, peptidomimetic polyamine,
dendrimer polyamine, arginine, amidine, protamine, cationic lipid,
cationic porphyrin, quaternary salt of a polyamine, or an alpha
helical peptide.
[0363] Representative U.S. patents that teach the preparation of
polynucleotide conjugates, particularly to RNA, include, but are
not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603;
5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025;
4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582;
4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963;
5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250;
5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463;
5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142;
5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928
and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931;
6,900,297; 7,037,646; each of which is herein incorporated by
reference in their entirety.
[0364] In one embodiment, the conjugate of the present invention
may function as a carrier for the mmRNA of the present invention.
The conjugate may comprise a cationic polymer such as, but not
limited to, polyamine, polylysine, polyalkylenimine, and
polyethylenimine which may be grafted to with poly(ethylene
glycol). As a non-limiting example, the conjugate may be similar to
the polymeric conjugate and the method of synthesizing the
polymeric conjugate described in U.S. Pat. No. 6,586,524 herein
incorporated by reference in its entirety.
[0365] The conjugates can also include targeting groups, e.g., a
cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid
or protein, e.g., an antibody, that binds to a specified cell type
such as a kidney cell. A targeting group can be a thyrotropin,
melanotropin, lectin, glycoprotein, surfactant protein A, Mucin
carbohydrate, multivalent lactose, multivalent galactose,
N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose,
multivalent fucose, glycosylated polyaminoacids, multivalent
galactose, transferrin, bisphosphonate, polyglutamate,
polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate,
vitamin B12, biotin, an RGD peptide, an RGD peptide mimetic or an
aptamer.
[0366] Targeting groups can be proteins, e.g., glycoproteins, or
peptides, e.g., molecules having a specific affinity for a
co-ligand, or antibodies e.g., an antibody, that binds to a
specified cell type such as a cancer cell, endothelial cell, or
bone cell. Targeting groups may also include hormones and hormone
receptors. They can also include non-peptidic species, such as
lipids, lectins, carbohydrates, vitamins, cofactors, multivalent
lactose, multivalent galactose, N-acetyl-galactosamine,
N-acetyl-glucosamine multivalent mannose, multivalent fucose, or
aptamers. The ligand can be, for example, a lipopolysaccharide, or
an activator of p38 MAP kinase.
[0367] The targeting group can be any ligand that is capable of
targeting a specific receptor. Examples include, without
limitation, folate, GalNAc, galactose, mannose, mannose-6P,
aptamers, integrin receptor ligands, chemokine receptor ligands,
transferrin, biotin, serotonin receptor ligands, PSMA, endothelin,
GCPII, somatostatin, LDL, and HDL ligands. In particular
embodiments, the targeting group is an aptamer. The aptamer can be
unmodified or have any combination of modifications disclosed
herein.
[0368] In one embodiment, pharmaceutical compositions of the
present invention may include chemical modifications such as, but
not limited to, modifications similar to locked nucleic acids.
[0369] Representative U.S. Patents that teach the preparation of
locked nucleic acid (LNA) such as those from Santaris, include, but
are not limited to, the following: U.S. Pat. Nos. 6,268,490;
6,670,461; 6,794,499; 6,998,484; 7,053,207; 7,084,125; and
7,399,845, each of which is herein incorporated by reference in its
entirety.
[0370] Representative U.S. patents that teach the preparation of
PNA compounds include, but are not limited to, U.S. Pat. Nos.
5,539,082; 5,714,331; and 5,719,262, each of which is herein
incorporated by reference. Further teaching of PNA compounds can be
found, for example, in Nielsen et al., Science, 1991, 254,
1497-1500.
[0371] Some embodiments featured in the invention include
polynucleotides, primary constructs or mmRNA with phosphorothioate
backbones and oligonucleosides with other modified backbones, and
in particular --CH.sub.2--NH--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester backbone is represented as
--O--P(O).sub.2--O--CH.sub.2--] of the above-referenced U.S. Pat.
No. 5,489,677, and the amide backbones of the above-referenced U.S.
Pat. No. 5,602,240. In some embodiments, the polynucleotides
featured herein have morpholino backbone structures of the
above-referenced U.S. Pat. No. 5,034,506.
[0372] Modifications at the 2' position may also aid in delivery.
Preferably, modifications at the 2' position are not located in a
polypeptide-coding sequence, i.e., not in a translatable region.
Modifications at the 2' position may be located in a 5'UTR, a 3'UTR
and/or a tailing region. Modifications at the 2' position can
include one of the following at the 2' position: H (i.e.,
2'-deoxy); F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or
N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and
alkynyl may be substituted or unsubstituted C.sub.1 to C.sub.10
alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Exemplary
suitable modifications include O[(CH.sub.2).sub.nO].sub.mCH.sub.3,
O(CH.sub.2)..sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2,
O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m
are from 1 to about 10. In other embodiments, the polynucleotides,
primary constructs or mmRNA include one of the following at the 2'
position: C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl,
alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl,
Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3,
ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl,
heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted
silyl, an RNA cleaving group, a reporter group, an intercalator, a
group for improving the pharmacokinetic properties, or a group for
improving the pharmacodynamic properties, and other substituents
having similar properties. In some embodiments, the modification
includes a 2'-methoxyethoxy (2'-O--CH.sub.2CH.sub.2OCH.sub.3, also
known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv.
Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another
exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples herein below, and
2'-dimethylaminoethoxyethoxy (also known in the art as
2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2, also described in
examples herein below. Other modifications include 2'-methoxy
(2'-OCH.sub.3), 2'-aminopropoxy
(2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2'-fluoro (2'-F).
Similar modifications may also be made at other positions,
particularly the 3' position of the sugar on the 3' terminal
nucleotide or in 2'-5' linked dsRNAs and the 5' position of 5'
terminal nucleotide. polynucleotides of the invention may also have
sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative U.S. patents that teach the
preparation of such modified sugar structures include, but are not
limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080;
5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134;
5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053;
5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920 and each
of which is herein incorporated by reference.
[0373] In still other embodiments, the polynucleotide, primary
construct, or mmRNA is covalently conjugated to a cell penetrating
polypeptide. The cell-penetrating peptide may also include a signal
peptide sequence. The conjugates of the invention can be designed
to have increased stability; increased cell transfection; and/or
altered the biodistribution (e.g., targeted to specific tissues or
cell types).
Self-Assembled Nucleic Acid Nanoparticles
[0374] Self-assembled nanoparticles have a well-defined size which
may be precisely controlled as the nucleic acid strands may be
easily reprogrammable. For example, the optimal particle size for a
cancer-targeting nanodelivery carrier is 20-100 nm as a diameter
greater than 20 nm avoids renal clearance and enhances delivery to
certain tumors through enhanced permeability and retention effect.
Using self-assembled nucleic acid nanoparticles a single uniform
population in size and shape having a precisely controlled spatial
orientation and density of cancer-targeting ligands for enhanced
delivery. As a non-limiting example, oligonucleotide nanoparticles
were prepared using programmable self-assembly of short DNA
fragments and therapeutic siRNAs. These nanoparticles are
molecularly identical with controllable particle size and target
ligand location and density. The DNA fragments and siRNAs
self-assembled into a one-step reaction to generate DNA/siRNA
tetrahedral nanoparticles for targeted in vivo delivery. (Lee et
al., Nature Nanotechnology 2012 7:389-393).
Excipients
[0375] Pharmaceutical formulations may additionally comprise a
pharmaceutically acceptable excipient, which, as used herein,
includes any and all solvents, dispersion media, diluents, or other
liquid vehicles, dispersion or suspension aids, surface active
agents, isotonic agents, thickening or emulsifying agents,
preservatives, solid binders, lubricants and the like, as suited to
the particular dosage form desired. Remington's The Science and
Practice of Pharmacy, 21.sup.st Edition, A. R. Gennaro (Lippincott,
Williams & Wilkins, Baltimore, Md., 2006; incorporated herein
by reference) discloses various excipients used in formulating
pharmaceutical compositions and known techniques for the
preparation thereof. Except insofar as any conventional excipient
medium is incompatible with a substance or its derivatives, such as
by producing any undesirable biological effect or otherwise
interacting in a deleterious manner with any other component(s) of
the pharmaceutical composition, its use is contemplated to be
within the scope of this invention.
[0376] In some embodiments, a pharmaceutically acceptable excipient
is at least 95%, at least 96%, at least 97%, at least 98%, at least
99%, or 100% pure. In some embodiments, an excipient is approved
for use in humans and for veterinary use. In some embodiments, an
excipient is approved by United States Food and Drug
Administration. In some embodiments, an excipient is pharmaceutical
grade. In some embodiments, an excipient meets the standards of the
United States Pharmacopoeia (USP), the European Pharmacopoeia (EP),
the British Pharmacopoeia, and/or the International
Pharmacopoeia.
[0377] Pharmaceutically acceptable excipients used in the
manufacture of pharmaceutical compositions include, but are not
limited to, inert diluents, dispersing and/or granulating agents,
surface active agents and/or emulsifiers, disintegrating agents,
binding agents, preservatives, buffering agents, lubricating
agents, and/or oils. Such excipients may optionally be included in
pharmaceutical compositions.
[0378] Exemplary diluents include, but are not limited to, calcium
carbonate, sodium carbonate, calcium phosphate, dicalcium
phosphate, calcium sulfate, calcium hydrogen phosphate, sodium
phosphate lactose, sucrose, cellulose, microcrystalline cellulose,
kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch,
cornstarch, powdered sugar, etc., and/or combinations thereof.
[0379] Exemplary granulating and/or dispersing agents include, but
are not limited to, potato starch, corn starch, tapioca starch,
sodium starch glycolate, clays, alginic acid, guar gum, citrus
pulp, agar, bentonite, cellulose and wood products, natural sponge,
cation-exchange resins, calcium carbonate, silicates, sodium
carbonate, cross-linked poly(vinyl-pyrrolidone) (crospovidone),
sodium carboxymethyl starch (sodium starch glycolate),
carboxymethyl cellulose, cross-linked sodium carboxymethyl
cellulose (croscarmellose), methylcellulose, pregelatinized starch
(starch 1500), microcrystalline starch, water insoluble starch,
calcium carboxymethyl cellulose, magnesium aluminum silicate
(VEEGUM.RTM.), sodium lauryl sulfate, quaternary ammonium
compounds, etc., and/or combinations thereof.
[0380] Exemplary surface active agents and/or emulsifiers include,
but are not limited to, natural emulsifiers (e.g. acacia, agar,
alginic acid, sodium alginate, tragacanth, chondrux, cholesterol,
xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol,
wax, and lecithin), colloidal clays (e.g. bentonite [aluminum
silicate] and VEEGUM.RTM. [magnesium aluminum silicate]), long
chain amino acid derivatives, high molecular weight alcohols (e.g.
stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin
monostearate, ethylene glycol distearate, glyceryl monostearate,
and propylene glycol monostearate, polyvinyl alcohol), carbomers
(e.g. carboxy polymethylene, polyacrylic acid, acrylic acid
polymer, and carboxyvinyl polymer), carrageenan, cellulosic
derivatives (e.g. carboxymethylcellulose sodium, powdered
cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose,
hydroxypropyl methylcellulose, methylcellulose), sorbitan fatty
acid esters (e.g. polyoxyethylene sorbitan monolaurate
[TWEEN.RTM.20], polyoxyethylene sorbitan [TWEENn.RTM.60],
polyoxyethylene sorbitan monooleate [TWEEN.RTM.80], sorbitan
monopalmitate [SPAN.RTM.40], sorbitan monostearate [Span.RTM.60],
sorbitan tristearate [Span.RTM.65], glyceryl monooleate, sorbitan
monooleate [SPAN.RTM.80]), polyoxyethylene esters (e.g.
polyoxyethylene monostearate [MYRJ.RTM.45], polyoxyethylene
hydrogenated castor oil, polyethoxylated castor oil,
polyoxymethylene stearate, and SOLUTOL), sucrose fatty acid esters,
polyethylene glycol fatty acid esters (e.g. CREMOPHOR.RTM.),
polyoxyethylene ethers, (e.g. polyoxyethylene lauryl ether
[BRIJ.RTM. 30]), poly(vinyl-pyrrolidone), diethylene glycol
monolaurate, triethanolamine oleate, sodium oleate, potassium
oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl
sulfate, PLUORINC.RTM.F 68, POLOXAMER.RTM. 188, cetrimonium
bromide, cetylpyridinium chloride, benzalkonium chloride, docusate
sodium, etc. and/or combinations thereof.
[0381] Exemplary binding agents include, but are not limited to,
starch (e.g. cornstarch and starch paste); gelatin; sugars (e.g.
sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol,
mannitol,); natural and synthetic gums (e.g. acacia, sodium
alginate, extract of Irish moss, panwar gum, ghatti gum, mucilage
of isapol husks, carboxymethylcellulose, methylcellulose,
ethylcellulose, hydroxyethylcellulose, hydroxypropyl cellulose,
hydroxypropyl methylcellulose, microcrystalline cellulose,
cellulose acetate, poly(vinyl-pyrrolidone), magnesium aluminum
silicate (VEEGUM.RTM.), and larch arabogalactan); alginates;
polyethylene oxide; polyethylene glycol; inorganic calcium salts;
silicic acid; polymethacrylates; waxes; water; alcohol; etc.; and
combinations thereof.
[0382] Exemplary preservatives may include, but are not limited to,
antioxidants, chelating agents, antimicrobial preservatives,
antifungal preservatives, alcohol preservatives, acidic
preservatives, and/or other preservatives. Exemplary antioxidants
include, but are not limited to, alpha tocopherol, ascorbic acid,
acorbyl palmitate, butylated hydroxyanisole, butylated
hydroxytoluene, monothioglycerol, potassium metabisulfite,
propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite,
sodium metabisulfite, and/or sodium sulfite. Exemplary chelating
agents include ethylenediaminetetraacetic acid (EDTA), citric acid
monohydrate, disodium edetate, dipotassium edetate, edetic acid,
fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric
acid, and/or trisodium edetate. Exemplary antimicrobial
preservatives include, but are not limited to, benzalkonium
chloride, benzethonium chloride, benzyl alcohol, bronopol,
cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol,
chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin,
hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol,
phenylmercuric nitrate, propylene glycol, and/or thimerosal.
Exemplary antifungal preservatives include, but are not limited to,
butyl paraben, methyl paraben, ethyl paraben, propyl paraben,
benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium
sorbate, sodium benzoate, sodium propionate, and/or sorbic acid.
Exemplary alcohol preservatives include, but are not limited to,
ethanol, polyethylene glycol, phenol, phenolic compounds,
bisphenol, chlorobutanol, hydroxybenzoate, and/or phenylethyl
alcohol. Exemplary acidic preservatives include, but are not
limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric
acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid,
and/or phytic acid. Other preservatives include, but are not
limited to, tocopherol, tocopherol acetate, deteroxime mesylate,
cetrimide, butylated hydroxyanisol (BHA), butylated hydroxytoluened
(BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl
ether sulfate (SLES), sodium bisulfite, sodium metabisulfite,
potassium sulfite, potassium metabisulfite, GLYDANT PLUS.RTM.,
PHENONIP.RTM., methylparaben, GERMALL.RTM. 115, GERMABEN.RTM.II,
NEOLONE.TM., KATHON.TM., and/or EUXYL.RTM..
[0383] Exemplary buffering agents include, but are not limited to,
citrate buffer solutions, acetate buffer solutions, phosphate
buffer solutions, ammonium chloride, calcium carbonate, calcium
chloride, calcium citrate, calcium glubionate, calcium gluceptate,
calcium gluconate, D-gluconic acid, calcium glycerophosphate,
calcium lactate, propanoic acid, calcium levulinate, pentanoic
acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium
phosphate, calcium hydroxide phosphate, potassium acetate,
potassium chloride, potassium gluconate, potassium mixtures,
dibasic potassium phosphate, monobasic potassium phosphate,
potassium phosphate mixtures, sodium acetate, sodium bicarbonate,
sodium chloride, sodium citrate, sodium lactate, dibasic sodium
phosphate, monobasic sodium phosphate, sodium phosphate mixtures,
tromethamine, magnesium hydroxide, aluminum hydroxide, alginic
acid, pyrogen-free water, isotonic saline, Ringer's solution, ethyl
alcohol, etc., and/or combinations thereof.
[0384] Exemplary lubricating agents include, but are not limited
to, magnesium stearate, calcium stearate, stearic acid, silica,
talc, malt, glyceryl behanate, hydrogenated vegetable oils,
polyethylene glycol, sodium benzoate, sodium acetate, sodium
chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate,
etc., and combinations thereof.
[0385] Exemplary oils include, but are not limited to, almond,
apricot kernel, avocado, babassu, bergamot, black current seed,
borage, cade, camomile, canola, caraway, carnauba, castor,
cinnamon, cocoa butter, coconut, cod liver, coffee, corn, cotton
seed, emu, eucalyptus, evening primrose, fish, flaxseed, geraniol,
gourd, grape seed, hazel nut, hyssop, isopropyl myristate, jojoba,
kukui nut, lavandin, lavender, lemon, litsea cubeba, macademia nut,
mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange,
orange roughy, palm, palm kernel, peach kernel, peanut, poppy seed,
pumpkin seed, rapeseed, rice bran, rosemary, safflower, sandalwood,
sasquana, savoury, sea buckthorn, sesame, shea butter, silicone,
soybean, sunflower, tea tree, thistle, tsubaki, vetiver, walnut,
and wheat germ oils. Exemplary oils include, but are not limited
to, butyl stearate, caprylic triglyceride, capric triglyceride,
cyclomethicone, diethyl sebacate, dimethicone 360, isopropyl
myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone
oil, and/or combinations thereof.
[0386] Excipients such as cocoa butter and suppository waxes,
coloring agents, coating agents, sweetening, flavoring, and/or
perfuming agents can be present in the composition, according to
the judgment of the formulator.
Delivery
[0387] The present disclosure encompasses the delivery of
polynucleotides, primary constructs or mmRNA for any of
therapeutic, pharmaceutical, diagnostic or imaging by any
appropriate route taking into consideration likely advances in the
sciences of drug delivery. Delivery may be naked or formulated.
Naked Delivery
[0388] The polynucleotides, primary constructs or mmRNA of the
present invention may be delivered to a cell naked. As used herein
in, "naked" refers to delivering polynucleotides, primary
constructs or mmRNA free from agents which promote transfection.
For example, the polynucleotides, primary constructs or mmRNA
delivered to the cell may contain no modifications. The naked
polynucleotides, primary constructs or mmRNA may be delivered to
the cell using routes of administration known in the art and
described herein.
Formulated Delivery
[0389] The polynucleotides, primary constructs or mmRNA of the
present invention may be formulated, using the methods described
herein. The formulations may contain polynucleotides, primary
constructs or mmRNA which may be modified and/or unmodified. The
formulations may further include, but are not limited to, cell
penetration agents, a pharmaceutically acceptable carrier, a
delivery agent, a bioerodible or biocompatible polymer, a solvent,
and a sustained-release delivery depot. The formulated
polynucleotides, primary constructs or mmRNA may be delivered to
the cell using routes of administration known in the art and
described herein.
[0390] The compositions may also be formulated for direct delivery
to an organ or tissue in any of several ways in the art including,
but not limited to, direct soaking or bathing, via a catheter, by
gels, powder, ointments, creams, gels, lotions, and/or drops, by
using substrates such as fabric or biodegradable materials coated
or impregnated with the compositions, and the like.
Administration
[0391] The polynucleotides, primary constructs or mmRNA of the
present invention may be administered by any route which results in
a therapeutically effective outcome. These include, but are not
limited to enteral, gastroenteral, epidural, oral, transdermal,
epidural (peridural), intracerebral (into the cerebrum),
intracerebroventricular (into the cerebral ventricles),
epicutaneous (application onto the skin), intradermal, (into the
skin itself), subcutaneous (under the skin), nasal administration
(through the nose), intravenous (into a vein), intraarterial (into
an artery), intramuscular (into a muscle), intracardiac (into the
heart), intraosseous infusion (into the bone marrow), intrathecal
(into the spinal canal), intraperitoneal, (infusion or injection
into the peritoneum), intravesical infusion, intravitreal, (through
the eye), intracavernous injection, (into the base of the penis),
intravaginal administration, intrauterine, extra-amniotic
administration, transdermal (diffusion through the intact skin for
systemic distribution), transmucosal (diffusion through a mucous
membrane), insufflation (snorting), sublingual, sublabial, enema,
eye drops (onto the conjunctiva), or in ear drops. In specific
embodiments, compositions may be administered in a way which allows
them cross the blood-brain barrier, vascular barrier, or other
epithelial barrier. Non-limiting routes of administration for the
polynucleotides, primary constructs or mmRNA of the present
invention are described below.
Parenteral and Injectible Administration
[0392] Liquid dosage forms for oral and parenteral administration
include, but are not limited to, pharmaceutically acceptable
emulsions, microemulsions, solutions, suspensions, syrups, and/or
elixirs. In addition to active ingredients, liquid dosage forms may
comprise inert diluents commonly used in the art such as, for
example, water or other solvents, solubilizing agents and
emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl
carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate,
propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in
particular, cottonseed, groundnut, corn, germ, olive, castor, and
sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene
glycols and fatty acid esters of sorbitan, and mixtures thereof.
Besides inert diluents, oral compositions can include adjuvants
such as wetting agents, emulsifying and suspending agents,
sweetening, flavoring, and/or perfuming agents. In certain
embodiments for parenteral administration, compositions are mixed
with solubilizing agents such as CREMOPHOR.RTM., alcohols, oils,
modified oils, glycols, polysorbates, cyclodextrins, polymers,
and/or combinations thereof.
[0393] Injectable preparations, for example, sterile injectable
aqueous or oleaginous suspensions may be formulated according to
the known art using suitable dispersing agents, wetting agents,
and/or suspending agents. Sterile injectable preparations may be
sterile injectable solutions, suspensions, and/or emulsions in
nontoxic parenterally acceptable diluents and/or solvents, for
example, as a solution in 1,3-butanediol. Among the acceptable
vehicles and solvents that may be employed are water, Ringer's
solution, U.S.P., and isotonic sodium chloride solution. Sterile,
fixed oils are conventionally employed as a solvent or suspending
medium. For this purpose any bland fixed oil can be employed
including synthetic mono- or diglycerides. Fatty acids such as
oleic acid can be used in the preparation of injectables.
[0394] Injectable formulations can be sterilized, for example, by
filtration through a bacterial-retaining filter, and/or by
incorporating sterilizing agents in the form of sterile solid
compositions which can be dissolved or dispersed in sterile water
or other sterile injectable medium prior to use.
[0395] In order to prolong the effect of an active ingredient, it
is often desirable to slow the absorption of the active ingredient
from subcutaneous or intramuscular injection. This may be
accomplished by the use of a liquid suspension of crystalline or
amorphous material with poor water solubility. The rate of
absorption of the drug then depends upon its rate of dissolution
which, in turn, may depend upon crystal size and crystalline form.
Alternatively, delayed absorption of a parenterally administered
drug form is accomplished by dissolving or suspending the drug in
an oil vehicle. Injectable depot forms are made by forming
microencapsule matrices of the drug in biodegradable polymers such
as polylactide-polyglycolide. Depending upon the ratio of drug to
polymer and the nature of the particular polymer employed, the rate
of drug release can be controlled. Examples of other biodegradable
polymers include poly(orthoesters) and poly(anhydrides). Depot
injectable formulations are prepared by entrapping the drug in
liposomes or microemulsions which are compatible with body
tissues.
Rectal and Vaginal Administration
[0396] Compositions for rectal or vaginal administration are
typically suppositories which can be prepared by mixing
compositions with suitable non-irritating excipients such as cocoa
butter, polyethylene glycol or a suppository wax which are solid at
ambient temperature but liquid at body temperature and therefore
melt in the rectum or vaginal cavity and release the active
ingredient.
Oral Administration
[0397] Solid dosage forms for oral administration include capsules,
tablets, pills, powders, and granules. In such solid dosage forms,
an active ingredient is mixed with at least one inert,
pharmaceutically acceptable excipient such as sodium citrate or
dicalcium phosphate and/or fillers or extenders (e.g. starches,
lactose, sucrose, glucose, mannitol, and silicic acid), binders
(e.g. carboxymethylcellulose, alginates, gelatin,
polyvinylpyrrolidinone, sucrose, and acacia), humectants (e.g.
glycerol), disintegrating agents (e.g. agar, calcium carbonate,
potato or tapioca starch, alginic acid, certain silicates, and
sodium carbonate), solution retarding agents (e.g. paraffin),
absorption accelerators (e.g. quaternary ammonium compounds),
wetting agents (e.g. cetyl alcohol and glycerol monostearate),
absorbents (e.g. kaolin and bentonite clay), and lubricants (e.g.
talc, calcium stearate, magnesium stearate, solid polyethylene
glycols, sodium lauryl sulfate), and mixtures thereof. In the case
of capsules, tablets and pills, the dosage form may comprise
buffering agents.
Topical or Transdermal Administration
[0398] As described herein, compositions containing the
polynucleotides, primary constructs or mmRNA of the invention may
be formulated for administration topically. The skin may be an
ideal target site for delivery as it is readily accessible. Gene
expression may be restricted not only to the skin, potentially
avoiding nonspecific toxicity, but also to specific layers and cell
types within the skin.
[0399] The site of cutaneous expression of the delivered
compositions will depend on the route of nucleic acid delivery.
Three routes are commonly considered to deliver polynucleotides,
primary constructs or mmRNA to the skin: (i) topical application
(e.g. for local/regional treatment and/or applications); (ii)
intradermal injection (e.g. for local/regional treatment and/or
applications); and (iii) systemic delivery (e.g. for treatment of
dermatologic diseases that affect both cutaneous and extracutaneous
regions). polynucleotides, primary constructs or mmRNA can be
delivered to the skin by several different approaches known in the
art. Most topical delivery approaches have been shown to work for
delivery of DNA, such as but not limited to, topical application of
non-cationic liposome-DNA complex, cationic liposome-DNA complex,
particle-mediated (gene gun), puncture-mediated gene transfections,
and viral delivery approaches. After delivery of the nucleic acid,
gene products have been detected in a number of different skin cell
types, including, but not limited to, basal keratinocytes,
sebaceous gland cells, dermal fibroblasts and dermal
macrophages.
[0400] In one embodiment, the invention provides for a variety of
dressings (e.g., wound dressings) or bandages (e.g., adhesive
bandages) for conveniently and/or effectively carrying out methods
of the present invention. Typically dressing or bandages may
comprise sufficient amounts of pharmaceutical compositions and/or
polynucleotides, primary constructs or mmRNA described herein to
allow a user to perform multiple treatments of a subject(s).
[0401] In one embodiment, the invention provides for the
polynucleotides, primary constructs or mmRNA compositions to be
delivered in more than one injection.
[0402] In one embodiment, before topical and/or transdermal
administration at least one area of tissue, such as skin, may be
subjected to a device and/or solution which may increase
permeability. In one embodiment, the tissue may be subjected to an
abrasion device to increase the permeability of the skin (see U.S.
Patent Publication No. 20080275468, herein incorporated by
reference in its entirety). In another embodiment, the tissue may
be subjected to an ultrasound enhancement device. An ultrasound
enhancement device may include, but is not limited to, the devices
described in U.S. Publication No. 20040236268 and U.S. Pat. Nos.
6,491,657 and 6,234,990; herein incorporated by reference in their
entireties. Methods of enhancing the permeability of tissue are
described in U.S. Publication Nos. 20040171980 and 20040236268 and
U.S. Pat. No. 6,190,315; herein incorporated by reference in their
entireties.
[0403] In one embodiment, a device may be used to increase
permeability of tissue before delivering formulations of modified
mRNA described herein. The permeability of skin may be measured by
methods known in the art and/or described in U.S. Pat. No.
6,190,315, herein incorporated by reference in its entirety. As a
non-limiting example, a modified mRNA formulation may be delivered
by the drug delivery methods described in U.S. Pat. No. 6,190,315,
herein incorporated by reference in its entirety.
[0404] In another non-limiting example tissue may be treated with a
eutectic mixture of local anesthetics (EMLA) cream before, during
and/or after the tissue may be subjected to a device which may
increase permeability. Katz et al. (Anesth Analg (2004); 98:371-76;
herein incorporated by reference in its entirety) showed that using
the EMLA cream in combination with a low energy, an onset of
superficial cutaneous analgesia was seen as fast as 5 minutes after
a pretreatment with a low energy ultrasound.
[0405] In one embodiment, enhancers may be applied to the tissue
before, during, and/or after the tissue has been treated to
increase permeability. Enhancers include, but are not limited to,
transport enhancers, physical enhancers, and cavitation enhancers.
Non-limiting examples of enhancers are described in U.S. Pat. No.
6,190,315, herein incorporated by reference in its entirety.
[0406] In one embodiment, a device may be used to increase
permeability of tissue before delivering formulations of modified
mRNA described herein, which may further contain a substance that
invokes an immune response. In another non-limiting example, a
formulation containing a substance to invoke an immune response may
be delivered by the methods described in U.S. Publication Nos.
20040171980 and 20040236268; herein incorporated by reference in
their entireties.
[0407] Dosage forms for topical and/or transdermal administration
of a composition may include ointments, pastes, creams, lotions,
gels, foams, powders, solutions, sprays, inhalants and/or patches.
Generally, an active ingredient is admixed under sterile conditions
with a pharmaceutically acceptable excipient and/or any needed
preservatives and/or buffers as may be required. Additionally, the
present invention contemplates the use of transdermal patches,
which often have the added advantage of providing controlled
delivery of a compound to the body. Such dosage forms may be
prepared, for example, by dissolving and/or dispensing the compound
in the proper medium. Alternatively or additionally, rate may be
controlled by either providing a rate controlling membrane and/or
by dispersing the compound in a polymer matrix and/or gel.
[0408] Formulations suitable for topical administration include,
but are not limited to, liquid and/or semi liquid preparations such
as liniments, lotions, oil in water and/or water in oil emulsions
such as creams, ointments and/or pastes, and/or solutions and/or
suspensions.
[0409] Topically-administrable formulations may, for example,
comprise from about 0.1% to about 10% (w/w) active ingredient,
although the concentration of active ingredient may be as high as
the solubility limit of the active ingredient in the solvent.
Formulations for topical administration may further comprise one or
more of the additional ingredients described herein.
Penetration Enhancers
[0410] In one embodiment, the polynucleotides, primary construct
and mmRNA of present invention may use various penetration
enhancers to deliver the polynucleotides, primary construct and
mmRNA to at least one area associated with one or more
hyperproliferative diseases, disorders or conditions. Most drugs
are present in solution in both ionized and nonionized forms.
However, usually only lipid soluble or lipophilic drugs readily
cross cell membranes. It has been discovered that even
non-lipophilic drugs may cross cell membranes if the membrane to be
crossed is treated with a penetration enhancer. In addition to
aiding the diffusion of non-lipophilic drugs across cell membranes,
penetration enhancers also enhance the permeability of lipophilic
drugs.
[0411] Penetration enhancers may be classified as belonging to one
of five broad categories, i.e., surfactants, fatty acids, bile
salts, chelating agents, and non-chelating non-surfactants (Lee et
al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.
92). Each of the above mentioned classes of penetration enhancers
are described below in greater detail. Combinations of penetration
enhancer may also be encompassed by the scope of the present
invention, for example, fatty acids/salts in combination with bile
acids/salts. Other non-limiting examples of combinations of
penetration enhancers include the combination of sodium salt of
lauric acid, capric acid and UDCA.
[0412] Surfactants
[0413] In connection with the present invention, surfactants (or
"surface-active agents") are chemical entities which, when
dissolved in an aqueous solution, reduce the surface tension of the
solution or the interfacial tension between the aqueous solution
and another liquid, with the result that absorption of the
polynucleotides, primary constructs and mmRNA through the mucosa is
enhanced. In addition to bile salts and fatty acids, these
penetration enhancers include, for example, sodium lauryl sulfate,
polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether)
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, p. 92); and perfluorochemical emulsions, such as FC-43
(Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).
[0414] Fatty Acids
[0415] Various fatty acids and their derivatives which act as
penetration enhancers include, but are not limited to, oleic acid,
lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic
acid, stearic acid, linoleic acid, linolenic acid, dicaprate,
tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin,
caprylic acid, arachidonic acid, glycerol 1-monocaprate,
1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines,
C.sub.1-C.sub.10 alkyl esters thereof (e.g., methyl, isopropyl and
t-butyl), and mono- and di-glycerides thereof (i.e., oleate,
laurate, caprate, myristate, palmitate, stearate, linoleate, etc.)
(Lee et al., Critical Reviews in Therapeutic Drug Carryier Systems,
1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug
Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm.
Pharmacol., 1992, 44, 651-654).
[0416] Bile Salts
[0417] The physiological role of bile includes the facilitation of
dispersion and absorption of lipids and fat-soluble vitamins
(Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological
Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill,
New York, 1996, pp. 934-935). Various natural bile salts, and their
synthetic derivatives, act as penetration enhancers. Thus the term
"bile salts" includes any of the naturally occurring components of
bile as well as any of their synthetic derivatives. The bile salts
of the invention include, but are not limited to, cholic acid (or
its pharmaceutically acceptable sodium salt, sodium cholate),
dehydrocholic acid (sodium dehydrocholate), deoxycholic acid
(sodium deoxycholate), glucholic acid (sodium glucholate),
glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium
glycodeoxycholate), taurocholic acid (sodium taurocholate),
taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic
acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA),
sodium tauro-24,25-dihydro-fusidate (STDHF), sodium
glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee
et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991,
page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical
Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa.,
1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic
Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm.
Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990,
79, 579-583).
[0418] Chelating Agents
[0419] Chelating agents, as used in connection with the present
invention, can be defined as compounds that remove metallic ions
from solution by forming complexes therewith, with the result that
absorption of polynucleotides, primary construct and mmRNA through
the mucosa is enhanced. With regards to their use as penetration
enhancers in the present invention, chelating agents have the added
advantage of also serving as DNase inhibitors, as most
characterized DNA nucleases require a divalent metal ion for
catalysis and are thus inhibited by chelating agents (Jarrett, J.
Chromatogr., 1993, 618, 315-339). Chelating agents of the invention
include but are not limited to disodium ethylenediaminetetraacetate
(EDTA), citric acid, salicylates (e.g., sodium salicylate,
5-methoxysalicylate and homovanilate), N-acyl derivatives of
collagen, laureth-9 and N-amino acyl derivatives of beta-diketones
(enamines)(Lee et al., Critical Reviews in Therapeutic Drug Carrier
Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic
Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel.,
1990, 14, 43-51).
[0420] Non-Chelating Non-Surfactants
[0421] As used herein, non-chelating non-surfactant penetration
enhancing compounds can be defined as compounds that demonstrate
insignificant activity as chelating agents or as surfactants but
that nonetheless enhance absorption of polynucleotides, primary
construct and mmRNA through the alimentary mucosa (Muranishi,
Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7,
1-33). This class of penetration enhancers include, but are not
limited to, unsaturated cyclic ureas, 1-alkyl- and
1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical
Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and
non-steroidal anti-inflammatory agents such as diclofenac sodium,
indomethacin and phenylbutazone (Yamashita et al., J. Pharm.
Pharmacol., 1987, 39, 621-626).
[0422] Agents that enhance uptake of polynucleotides, primary
construct and mmRNA at the cellular level may also be added to the
pharmaceutical and other compositions of the present invention. For
example, cationic lipids, such as lipofectin (Junichi et al, U.S.
Pat. No. 5,705,188), cationic glycerol derivatives, and
polycationic molecules, such as polylysine (Lollo et al., PCT
Application WO 97/30731), are also known to enhance the cellular
uptake of polynucleotides, primary construct and mmRNA.
[0423] Other agents may be utilized to enhance the penetration of
the administered polynucleotides, primary construct and mmRNA,
including glycols such as ethylene glycol and propylene glycol,
pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and
menthone.
Depot Administration
[0424] As described herein, in some embodiments, the composition is
formulated in depots for extended release. Generally, a specific
organ or tissue (a "target tissue") is targeted for
administration.
[0425] In some aspects of the invention, the polynucleotides,
primary constructs or mmRNA are spatially retained within or
proximal to a target tissue. Provided are method of providing a
composition to a target tissue of a mammalian subject by contacting
the target tissue (which contains one or more target cells) with
the composition under conditions such that the composition, in
particular the nucleic acid component(s) of the composition, is
substantially retained in the target tissue, meaning that at least
10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9,
99.99 or greater than 99.99% of the composition is retained in the
target tissue. Advantageously, retention is determined by measuring
the amount of the nucleic acid present in the composition that
enters one or more target cells. For example, at least 1, 5, 10,
20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, 99.99
or greater than 99.99% of the nucleic acids administered to the
subject are present intracellularly at a period of time following
administration. For example, intramuscular injection to a mammalian
subject is performed using an aqueous composition containing a
ribonucleic acid and a transfection reagent, and retention of the
composition is determined by measuring the amount of the
ribonucleic acid present in the muscle cells.
[0426] Aspects of the invention are directed to methods of
providing a composition to a target tissue of a mammalian subject,
by contacting the target tissue (containing one or more target
cells) with the composition under conditions such that the
composition is substantially retained in the target tissue. The
composition contains an effective amount of a polynucleotides,
primary constructs or mmRNA such that the polypeptide of interest
is produced in at least one target cell. The compositions generally
contain a cell penetration agent, although "naked" nucleic acid
(such as nucleic acids without a cell penetration agent or other
agent) is also contemplated, and a pharmaceutically acceptable
carrier.
[0427] In some circumstances, the amount of a protein produced by
cells in a tissue is desirably increased. Preferably, this increase
in protein production is spatially restricted to cells within the
target tissue. Thus, provided are methods of increasing production
of a protein of interest in a tissue of a mammalian subject. A
composition is provided that contains polynucleotides, primary
constructs or mmRNA characterized in that a unit quantity of
composition has been determined to produce the polypeptide of
interest in a substantial percentage of cells contained within a
predetermined volume of the target tissue.
[0428] In some embodiments, the composition includes a plurality of
different polynucleotides, primary constructs or mmRNA, where one
or more than one of the polynucleotides, primary constructs or
mmRNA encodes a polypeptide of interest. Optionally, the
composition also contains a cell penetration agent to assist in the
intracellular delivery of the composition. A determination is made
of the dose of the composition required to produce the polypeptide
of interest in a substantial percentage of cells contained within
the predetermined volume of the target tissue (generally, without
inducing significant production of the polypeptide of interest in
tissue adjacent to the predetermined volume, or distally to the
target tissue). Subsequent to this determination, the determined
dose is introduced directly into the tissue of the mammalian
subject.
[0429] In one embodiment, the invention provides for the
polynucleotides, primary constructs or mmRNA to be delivered in
more than one injection or by split dose injections.
[0430] In one embodiment, the invention may be retained near target
tissue using a small disposable drug reservoir or patch pump.
Non-limiting examples of patch pumps include those manufactured
and/or sold by BD.RTM. (Franklin Lakes, N.J.), Insulet Corporation
(Bedford, Mass.), SteadyMed Therapeutics (San Francisco, Calif.),
Medtronic (Minneapolis, Minn.), UniLife (York, Pa.), Valeritas
(Bridgewater, N.J.), and SpringLeaf Therapeutics (Boston,
Mass.).
Pulmonary Administration
[0431] A pharmaceutical composition may be prepared, packaged,
and/or sold in a formulation suitable for pulmonary administration
via the buccal cavity. Such a formulation may comprise dry
particles which comprise the active ingredient and which have a
diameter in the range from about 0.5 nm to about 7 nm or from about
1 nm to about 6 nm. Such compositions are suitably in the form of
dry powders for administration using a device comprising a dry
powder reservoir to which a stream of propellant may be directed to
disperse the powder and/or using a self propelling solvent/powder
dispensing container such as a device comprising the active
ingredient dissolved and/or suspended in a low-boiling propellant
in a sealed container. Such powders comprise particles wherein at
least 98% of the particles by weight have a diameter greater than
0.5 nm and at least 95% of the particles by number have a diameter
less than 7 nm. Alternatively, at least 95% of the particles by
weight have a diameter greater than 1 nm and at least 90% of the
particles by number have a diameter less than 6 nm. Dry powder
compositions may include a solid fine powder diluent such as sugar
and are conveniently provided in a unit dose form.
[0432] Low boiling propellants generally include liquid propellants
having a boiling point of below 65.degree. F. at atmospheric
pressure. Generally the propellant may constitute 50% to 99.9%
(w/w) of the composition, and active ingredient may constitute 0.1%
to 20% (w/w) of the composition. A propellant may further comprise
additional ingredients such as a liquid non-ionic and/or solid
anionic surfactant and/or a solid diluent (which may have a
particle size of the same order as particles comprising the active
ingredient).
[0433] Pharmaceutical compositions formulated for pulmonary
delivery may provide an active ingredient in the form of droplets
of a solution and/or suspension. Such formulations may be prepared,
packaged, and/or sold as aqueous and/or dilute alcoholic solutions
and/or suspensions, optionally sterile, comprising active
ingredient, and may conveniently be administered using any
nebulization and/or atomization device. Such formulations may
further comprise one or more additional ingredients including, but
not limited to, a flavoring agent such as saccharin sodium, a
volatile oil, a buffering agent, a surface active agent, and/or a
preservative such as methylhydroxybenzoate. Droplets provided by
this route of administration may have an average diameter in the
range from about 0.1 nm to about 200 nm.
Intranasal, Nasal and Buccal Administration
[0434] Formulations described herein as being useful for pulmonary
delivery are useful for intranasal delivery of a pharmaceutical
composition. Another formulation suitable for intranasal
administration is a coarse powder comprising the active ingredient
and having an average particle from about 0.2 .mu.m to 500 .mu.m.
Such a formulation is administered in the manner in which snuff is
taken, i.e. by rapid inhalation through the nasal passage from a
container of the powder held close to the nose.
[0435] Formulations suitable for nasal administration may, for
example, comprise from about as little as 0.1% (w/w) and as much as
100% (w/w) of active ingredient, and may comprise one or more of
the additional ingredients described herein. A pharmaceutical
composition may be prepared, packaged, and/or sold in a formulation
suitable for buccal administration. Such formulations may, for
example, be in the form of tablets and/or lozenges made using
conventional methods, and may, for example, 0.1% to 20% (w/w)
active ingredient, the balance comprising an orally dissolvable
and/or degradable composition and, optionally, one or more of the
additional ingredients described herein. Alternately, formulations
suitable for buccal administration may comprise a powder and/or an
aerosolized and/or atomized solution and/or suspension comprising
active ingredient. Such powdered, aerosolized, and/or aerosolized
formulations, when dispersed, may have an average particle and/or
droplet size in the range from about 0.1 nm to about 200 nm, and
may further comprise one or more of any additional ingredients
described herein.
Ophthalmic Administration
[0436] A pharmaceutical composition may be prepared, packaged,
and/or sold in a formulation suitable for ophthalmic
administration. Such formulations may, for example, be in the form
of eye drops including, for example, a 0.1/1.0% (w/w) solution
and/or suspension of the active ingredient in an aqueous or oily
liquid excipient. Such drops may further comprise buffering agents,
salts, and/or one or more other of any additional ingredients
described herein. Other ophthalmically-administrable formulations
which are useful include those which comprise the active ingredient
in microcrystalline form and/or in a liposomal preparation. Ear
drops and/or eye drops are contemplated as being within the scope
of this invention.
Payload Administration: Detectable Agents and Therapeutic
Agents
[0437] The polynucleotides, primary constructs or mmRNA described
herein can be used in a number of different scenarios in which
delivery of a substance (the "payload") to a biological target is
desired, for example delivery of detectable substances for
detection of the target, or delivery of a therapeutic agent.
Detection methods can include, but are not limited to, both imaging
in vitro and in vivo imaging methods, e.g., immunohistochemistry,
bioluminescence imaging (BLI), Magnetic Resonance Imaging (MRI),
positron emission tomography (PET), electron microscopy, X-ray
computed tomography, Raman imaging, optical coherence tomography,
absorption imaging, thermal imaging, fluorescence reflectance
imaging, fluorescence microscopy, fluorescence molecular
tomographic imaging, nuclear magnetic resonance imaging, X-ray
imaging, ultrasound imaging, photoacoustic imaging, lab assays, or
in any situation where tagging/staining/imaging is required.
[0438] The polynucleotides, primary constructs or mmRNA can be
designed to include both a linker and a payload in any useful
orientation. For example, a linker having two ends is used to
attach one end to the payload and the other end to the nucleobase,
such as at the C-7 or C-8 positions of the deaza-adenosine or
deaza-guanosine or to the N-3 or C-5 positions of cytosine or
uracil. The polynucleotide of the invention can include more than
one payload (e.g., a label and a transcription inhibitor), as well
as a cleavable linker. In one embodiment, the modified nucleotide
is a modified 7-deaza-adenosine triphosphate, where one end of a
cleavable linker is attached to the C7 position of 7-deaza-adenine,
the other end of the linker is attached to an inhibitor (e.g., to
the C5 position of the nucleobase on a cytidine), and a label
(e.g., Cy5) is attached to the center of the linker (see, e.g.,
compound 1 of A*pCp C5 Parg Capless in FIG. 5 and columns 9 and 10
of U.S. Pat. No. 7,994,304, incorporated herein by reference). Upon
incorporation of the modified 7-deaza-adenosine triphosphate to an
encoding region, the resulting polynucleotide having a cleavable
linker attached to a label and an inhibitor (e.g., a polymerase
inhibitor). Upon cleavage of the linker (e.g., with reductive
conditions to reduce a linker having a cleavable disulfide moiety),
the label and inhibitor are released. Additional linkers and
payloads (e.g., therapeutic agents, detectable labels, and cell
penetrating payloads) are described herein.
[0439] For example, the polynucleotides, primary constructs or
mmRNA described herein can be used in reprogramming induced
pluripotent stem cells (iPS cells), which can directly track cells
that are transfected compared to total cells in the cluster. In
another example, a drug that may be attached to the
polynucleotides, primary constructs or mmRNA via a linker and may
be fluorescently labeled can be used to track the drug in vivo,
e.g. intracellularly. Other examples include, but are not limited
to, the use of polynucleotides, primary constructs or mmRNA in
reversible drug delivery into cells.
[0440] The polynucleotides, primary constructs or mmRNA described
herein can be used in intracellular targeting of a payload, e.g.,
detectable or therapeutic agent, to specific organelle. Exemplary
intracellular targets can include, but are not limited to, the
nuclear localization for advanced mRNA processing, or a nuclear
localization sequence (NLS) linked to the mRNA containing an
inhibitor.
[0441] In addition, the polynucleotides, primary constructs or
mmRNA described herein can be used to deliver therapeutic agents to
cells or tissues, e.g., in living animals. For example, the
polynucleotides, primary constructs or mmRNA described herein can
be used to deliver highly polar chemotherapeutics agents to kill
cancer cells. The polynucleotides, primary constructs or mmRNA
attached to the therapeutic agent through a linker can facilitate
member permeation allowing the therapeutic agent to travel into a
cell to reach an intracellular target.
[0442] In another example, the polynucleotides, primary constructs
or mmRNA can be attached to the polynucleotides, primary constructs
or mmRNA a viral inhibitory peptide (VIP) through a cleavable
linker. The cleavable linker can release the VIP and dye into the
cell. In another example, the polynucleotides, primary constructs
or mmRNA can be attached through the linker to an ADP-ribosylate,
which is responsible for the actions of some bacterial toxins, such
as cholera toxin, diphtheria toxin, and pertussis toxin. These
toxin proteins are ADP-ribosyltransferases that modify target
proteins in human cells. For example, cholera toxin ADP-ribosylates
G proteins modifies human cells by causing massive fluid secretion
from the lining of the small intestine, which results in
life-threatening diarrhea.
[0443] In some embodiments, the payload may be a therapeutic agent
such as a cytotoxin, radioactive ion, chemotherapeutic, or other
therapeutic agent. A cytotoxin or cytotoxic agent includes any
agent that may be detrimental to cells. Examples include, but are
not limited to, taxol, cytochalasin B, gramicidin D, ethidium
bromide, emetine, mitomycin, etoposide, teniposide, vincristine,
vinblastine, colchicine, doxorubicin, daunorubicin,
dihydroxyanthracinedione, mitoxantrone, mithramycin, actinomycin D,
1-dehydrotestosterone, glucocorticoids, procaine, tetracaine,
lidocaine, propranolol, puromycin, maytansinoids, e.g., maytansinol
(see U.S. Pat. No. 5,208,020 incorporated herein in its entirety),
rachelmycin (CC-1065, see U.S. Pat. Nos. 5,475,092, 5,585,499, and
5,846,545, all of which are incorporated herein by reference), and
analogs or homologs thereof. Radioactive ions include, but are not
limited to iodine (e.g., iodine 125 or iodine 131), strontium 89,
phosphorous, palladium, cesium, iridium, phosphate, cobalt, yttrium
90, samarium 153, and praseodymium. Other therapeutic agents
include, but are not limited to, antimetabolites (e.g.,
methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine,
5-fluorouracil decarbazine), alkylating agents (e.g.,
mechlorethamine, thiotepa chlorambucil, rachelmycin (CC-1065),
melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide,
busulfan, dibromomannitol, streptozotocin, mitomycin C, and
cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine, vinblastine, taxol and maytansinoids).
[0444] In some embodiments, the payload may be a detectable agent,
such as various organic small molecules, inorganic compounds,
nanoparticles, enzymes or enzyme substrates, fluorescent materials,
luminescent materials (e.g., luminol), bioluminescent materials
(e.g., luciferase, luciferin, and acquorin), chemiluminescent
materials, radioactive materials (e.g., .sup.18F, .sup.67Ga,
.sup.81mKr, .sup.82Rb, .sup.111In, .sup.123I, .sup.133Xe,
.sup.201Tl, .sup.125I, .sup.35S, .sup.14C, .sup.3H, or .sup.99mTc
(e.g., as pertechnetate (technetate(VII), TcO.sub.4.sup.-)), and
contrast agents (e.g., gold (e.g., gold nanoparticles), gadolinium
(e.g., chelated Gd), iron oxides (e.g., superparamagnetic iron
oxide (SPIO), monocrystalline iron oxide nanoparticles (MIONs), and
ultrasmall superparamagnetic iron oxide (USPIO)), manganese
chelates (e.g., Mn-DPDP), barium sulfate, iodinated contrast media
(iohexol), microbubbles, or perfluorocarbons). Such
optically-detectable labels include for example, without
limitation, 4-acetamido-4'-isothiocyanatostilbene-2,2'disulfonic
acid; acridine and derivatives (e.g., acridine and acridine
isothiocyanate); 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid
(EDANS); 4-amino-N-[3-vinylsulfonyl)phenyl]naphthalimide-3,5
disulfonate; N-(4-anilino-1-naphthyl)maleimide; anthranilamide;
BODIPY; Brilliant Yellow; coumarin and derivatives (e.g., coumarin,
7-amino-4-methylcoumarin (AMC, Coumarin 120), and
7-amino-4-trifluoromethylcoumarin (Coumarin 151)); cyanine dyes;
cyanosine; 4',6-diaminidino-2-phenylindole (DAPI);
5'5''-dibromopyrogallol-sulfonaphthalein (Bromopyrogallol Red);
7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin;
diethylenetriamine pentaacetate;
4,4'-diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid;
4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid;
5-[dimethylamino]-naphthalene-1-sulfonyl chloride (DNS,
dansylchloride); 4-dimethylaminophenylazophenyl-4'-isothiocyanate
(DABITC); eosin and derivatives (e.g., eosin and eosin
isothiocyanate); erythrosin and derivatives (e.g., erythrosin B and
erythrosin isothiocyanate); ethidium; fluorescein and derivatives
(e.g., 5-carboxyfluorescein (FAM),
5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF),
2',7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein, fluorescein,
fluorescein isothiocyanate, X-rhodamine-5-(and-6)-isothiocyanate
(QFITC or XRITC), and fluorescamine);
2-[2-[3-[[1,3-dihydro-1,1-dimethyl-3-(3-sulfopropyl)-2H-benz[e]indol-2-yl-
idene]ethylidene]-2-[4-(ethoxycarbonyl)-1-piperazinyl]-1-cyclopenten-1-yl]-
ethenyl]-1,1-dimethyl-3-(3-sulforpropyl)-1H-benz[e]indolium
hydroxide, inner salt, compound with n,n-diethylethanamine(1:1)
(IR144);
5-chloro-2-[2-[3-[(5-chloro-3-ethyl-2(3H)-benzothiazol-ylidene)ethylidene-
]-2-(diphenylamino)-1-cyclopenten-1-yl]ethenyl]-3-ethyl
benzothiazolium perchlorate (IR140); Malachite Green
isothiocyanate; 4-methylumbelliferone orthocresolphthalein;
nitrotyrosine; pararosaniline; Phenol Red; B-phycoerythrin;
o-phthaldialdehyde; pyrene and derivatives (e.g., pyrene, pyrene
butyrate, and succinimidyl 1-pyrene); butyrate quantum dots;
Reactive Red 4 (CIBACRON.TM. Brilliant Red 3B-A); rhodamine and
derivatives (e.g., 6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine
(R6G), lissamine rhodamine B sulfonyl chloride rhodamine (Rhod),
rhodamine B, rhodamine 123, rhodamine X isothiocyanate,
sulforhodamine B, sulforhodamine 101, sulfonyl chloride derivative
of sulforhodamine 101 (Texas Red),
N,N,N',N'tetramethyl-6-carboxyrhodamine (TAMRA) tetramethyl
rhodamine, and tetramethyl rhodamine isothiocyanate (TRITC));
riboflavin; rosolic acid; terbium chelate derivatives; Cyanine-3
(Cy3); Cyanine-5 (Cy5); cyanine-5.5 (Cy5.5), Cyanine-7 (Cy7); IRD
700; IRD 800; Alexa 647; La Jolta Blue; phthalo cyanine; and
naphthalo cyanine
[0445] In some embodiments, the detectable agent may be a
non-detectable precursor that becomes detectable upon activation
(e.g., fluorogenic tetrazine-fluorophore constructs (e.g.,
tetrazine-BODIPY FL, tetrazine-Oregon Green 488, or
tetrazine-BODIPY TMR-X) or enzyme activatable fluorogenic agents
(e.g., PROSENSE.RTM. (VisEn Medical))). In vitro assays in which
the enzyme labeled compositions can be used include, but are not
limited to, enzyme linked immunosorbent assays (ELISAs),
immunoprecipitation assays, immunofluorescence, enzyme immunoassays
(EIA), radioimmunoassays (RIA), and Western blot analysis.
Combinations
[0446] The polynucleotides, primary constructs or mmRNA may be used
in combination with one or more other therapeutic, prophylactic,
diagnostic, or imaging agents. By "in combination with," it is not
intended to imply that the agents must be administered at the same
time and/or formulated for delivery together, although these
methods of delivery are within the scope of the present disclosure.
Compositions can be administered concurrently with, prior to, or
subsequent to, one or more other desired therapeutics or medical
procedures. In general, each agent will be administered at a dose
and/or on a time schedule determined for that agent. In some
embodiments, the present disclosure encompasses the delivery of
pharmaceutical, prophylactic, diagnostic, or imaging compositions
in combination with agents that may improve their bioavailability,
reduce and/or modify their metabolism, inhibit their excretion,
and/or modify their distribution within the body. As a non-limiting
example, the nucleic acids or mmRNA may be used in combination with
a pharmaceutical agent for the treatment of cancer or to control
hyperproliferative cells. In U.S. Pat. No. 7,964,571, herein
incorporated by reference in its entirety, a combination therapy
for the treatment of solid primary or metastasized tumor is
described using a pharmaceutical composition including a DNA
plasmid encoding for interleukin-12 with a lipopolymer and also
administering at least one anticancer agent or chemotherapeutic.
Further, the nucleic acids and mmRNA of the present invention that
encodes anti-proliferative molecules may be in a pharmaceutical
composition with a lipopolymer (see e.g., U.S. Pub. No.
20110218231, herein incorporated by reference in its entirety,
claiming a pharmaceutical composition comprising a DNA plasmid
encoding an anti-proliferative molecule and a lipopolymer) which
may be administered with at least one chemotherapeutic or
anticancer agent.
Dosing
[0447] The present invention provides methods comprising
administering modified mRNAs and their encoded proteins or
complexes in accordance with the invention to a subject in need
thereof. Nucleic acids, proteins or complexes, or pharmaceutical,
imaging, diagnostic, or prophylactic compositions thereof, may be
administered to a subject using any amount and any route of
administration effective for preventing, treating, diagnosing, or
imaging a disease, disorder, and/or condition (e.g., a disease,
disorder, and/or condition relating to working memory deficits).
The exact amount required will vary from subject to subject,
depending on the species, age, and general condition of the
subject, the severity of the disease, the particular composition,
its mode of administration, its mode of activity, and the like.
Compositions in accordance with the invention are typically
formulated in dosage unit form for ease of administration and
uniformity of dosage. It will be understood, however, that the
total daily usage of the compositions of the present invention may
be decided by the attending physician within the scope of sound
medical judgment. The specific therapeutically effective,
prophylactically effective, or appropriate imaging dose level for
any particular patient will depend upon a variety of factors
including the disorder being treated and the severity of the
disorder; the activity of the specific compound employed; the
specific composition employed; the age, body weight, general
health, sex and diet of the patient; the time of administration,
route of administration, and rate of excretion of the specific
compound employed; the duration of the treatment; drugs used in
combination or coincidental with the specific compound employed;
and like factors well known in the medical arts.
[0448] In certain embodiments, compositions in accordance with the
present invention may be administered at dosage levels sufficient
to deliver from about 0.0001 mg/kg to about 100 mg/kg, from about
0.001 mg/kg to about 0.05 mg/kg, from about 0.005 mg/kg to about
0.05 mg/kg, from about 0.001 mg/kg to about 0.005 mg/kg, from about
0.05 mg/kg to about 0.5 mg/kg, from about 0.01 mg/kg to about 50
mg/kg, from about 0.1 mg/kg to about 40 mg/kg, from about 0.5 mg/kg
to about 30 mg/kg, from about 0.01 mg/kg to about 10 mg/kg, from
about 0.1 mg/kg to about 10 mg/kg, or from about 1 mg/kg to about
25 mg/kg, of subject body weight per day, one or more times a day,
to obtain the desired therapeutic, diagnostic, prophylactic, or
imaging effect. The desired dosage may be delivered three times a
day, two times a day, once a day, every other day, every third day,
every week, every two weeks, every three weeks, or every four
weeks. In certain embodiments, the desired dosage may be delivered
using multiple administrations (e.g., two, three, four, five, six,
seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or
more administrations).
[0449] According to the present invention, it has been discovered
that administration of mmRNA in split-dose regimens produce higher
levels of proteins in mammalian subjects. As used herein, a "split
dose" is the division of single unit dose or total daily dose into
two or more doses, e.g, two or more administrations of the single
unit dose. As used herein, a "single unit dose" is a dose of any
therapeutic administered in one dose/at one time/single
route/single point of contact, i.e., single administration event.
As used herein, a "total daily dose" is an amount given or
prescribed in 24 hr period. It may be administered as a single unit
dose. In one embodiment, the mmRNA of the present invention are
administered to a subject in split doses. The mmRNA may be
formulated in buffer only or in a formulation described herein.
Dosage Forms
[0450] A pharmaceutical composition described herein can be
formulated into a dosage form described herein, such as a topical,
intranasal, intratracheal, or injectable (e.g., intravenous,
intraocular, intravitreal, intramuscular, intracardiac,
intraperitoneal, subcutaneous).
Liquid Dosage Forms
[0451] Liquid dosage forms for parenteral administration include,
but are not limited to, pharmaceutically acceptable emulsions,
microemulsions, solutions, suspensions, syrups, and/or elixirs. In
addition to active ingredients, liquid dosage forms may comprise
inert diluents commonly used in the art including, but not limited
to, water or other solvents, solubilizing agents and emulsifiers
such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl
acetate, benzyl alcohol, benzyl benzoate, propylene glycol,
1,3-butylene glycol, dimethylformamide, oils (in particular,
cottonseed, groundnut, corn, germ, olive, castor, and sesame oils),
glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and
fatty acid esters of sorbitan, and mixtures thereof. In certain
embodiments for parenteral administration, compositions may be
mixed with solubilizing agents such as CREMOPHOR.RTM., alcohols,
oils, modified oils, glycols, polysorbates, cyclodextrins,
polymers, and/or combinations thereof.
Injectable
[0452] Injectable preparations, for example, sterile injectable
aqueous or oleaginous suspensions may be formulated according to
the known art and may include suitable dispersing agents, wetting
agents, and/or suspending agents. Sterile injectable preparations
may be sterile injectable solutions, suspensions, and/or emulsions
in nontoxic parenterally acceptable diluents and/or solvents, for
example, a solution in 1,3-butanediol. Among the acceptable
vehicles and solvents that may be employed include, but are not
limited to, are water, Ringer's solution, U.S.P., and isotonic
sodium chloride solution. Sterile, fixed oils are conventionally
employed as a solvent or suspending medium. For this purpose any
bland fixed oil can be employed including synthetic mono- or
diglycerides. Fatty acids such as oleic acid can be used in the
preparation of injectables.
[0453] Injectable formulations can be sterilized, for example, by
filtration through a bacterial-retaining filter, and/or by
incorporating sterilizing agents in the form of sterile solid
compositions which can be dissolved or dispersed in sterile water
or other sterile injectable medium prior to use.
[0454] In order to prolong the effect of an active ingredient, it
may be desirable to slow the absorption of the active ingredient
from subcutaneous or intramuscular injection. This may be
accomplished by the use of a liquid suspension of crystalline or
amorphous material with poor water solubility. The rate of
absorption of the polynucleotide, primary construct or mmRNA then
depends upon its rate of dissolution which, in turn, may depend
upon crystal size and crystalline form. Alternatively, delayed
absorption of a parenterally administered polynucleotide, primary
construct or mmRNA may be accomplished by dissolving or suspending
the polynucleotide, primary construct or mmRNA in an oil vehicle.
Injectable depot forms are made by forming microencapsule matrices
of the polynucleotide, primary construct or mmRNA in biodegradable
polymers such as polylactide-polyglycolide. Depending upon the
ratio of polynucleotide, primary construct or mmRNA to polymer and
the nature of the particular polymer employed, the rate of
polynucleotide, primary construct or mmRNA release can be
controlled. Examples of other biodegradable polymers include, but
are not limited to, poly(orthoesters) and poly(anhydrides). Depot
injectable formulations may be prepared by entrapping the
polynucleotide, primary construct or mmRNA in liposomes or
microemulsions which are compatible with body tissues.
Pulmonary
[0455] Formulations described herein as being useful for pulmonary
delivery may also be use for intranasal delivery of a
pharmaceutical composition. Another formulation suitable for
intranasal administration may be a coarse powder comprising the
active ingredient and having an average particle from about 0.2
.mu.m to 500 .mu.m. Such a formulation may be administered in the
manner in which snuff is taken, i.e. by rapid inhalation through
the nasal passage from a container of the powder held close to the
nose.
[0456] Formulations suitable for nasal administration may, for
example, comprise from about as little as 0.1% (w/w) and as much as
100% (w/w) of active ingredient, and may comprise one or more of
the additional ingredients described herein. A pharmaceutical
composition may be prepared, packaged, and/or sold in a formulation
suitable for buccal administration. Such formulations may, for
example, be in the form of tablets and/or lozenges made using
conventional methods, and may, for example, contain about 0.1% to
20% (w/w) active ingredient, where the balance may comprise an
orally dissolvable and/or degradable composition and, optionally,
one or more of the additional ingredients described herein.
Alternately, formulations suitable for buccal administration may
comprise a powder and/or an aerosolized and/or atomized solution
and/or suspension comprising active ingredient. Such powdered,
aerosolized, and/or aerosolized formulations, when dispersed, may
have an average particle and/or droplet size in the range from
about 0.1 nm to about 200 nm, and may further comprise one or more
of any additional ingredients described herein.
[0457] General considerations in the formulation and/or manufacture
of pharmaceutical agents may be found, for example, in Remington:
The Science and Practice of Pharmacy 21.sup.st ed., Lippincott
Williams & Wilkins, 2005 (incorporated herein by
reference).
Coatings or Shells
[0458] Solid dosage forms of tablets, dragees, capsules, pills, and
granules can be prepared with coatings and shells such as enteric
coatings and other coatings well known in the pharmaceutical
formulating art. They may optionally comprise opacifying agents and
can be of a composition that they release the active ingredient(s)
only, or preferentially, in a certain part of the intestinal tract,
optionally, in a delayed manner. Examples of embedding compositions
which can be used include polymeric substances and waxes. Solid
compositions of a similar type may be employed as fillers in soft
and hard-filled gelatin capsules using such excipients as lactose
or milk sugar as well as high molecular weight polyethylene glycols
and the like.
Properties of Pharmaceutical Compositions
[0459] The pharmaceutical compositions described herein can be
characterized by one or more of bioavailability, therapeutic window
and/or volume of distribution.
Bioavailability
[0460] The polynucleotides, primary constructs or mmRNA, when
formulated into a composition with a delivery agent as described
herein, can exhibit an increase in bioavailability as compared to a
composition lacking a delivery agent as described herein. As used
herein, the term "bioavailability" refers to the systemic
availability of a given amount of polynucleotides, primary
constructs or mmRNA administered to a mammal. Bioavailability can
be assessed by measuring the area under the curve (AUC) or the
maximum serum or plasma concentration (C.sub.max) of the unchanged
form of a compound following administration of the compound to a
mammal. AUC is a determination of the area under the curve plotting
the serum or plasma concentration of a compound along the ordinate
(Y-axis) against time along the abscissa (X-axis). Generally, the
AUC for a particular compound can be calculated using methods known
to those of ordinary skill in the art and as described in G. S.
Banker, Modern Pharmaceutics, Drugs and the Pharmaceutical
Sciences, v. 72, Marcel Dekker, New York, Inc., 1996, herein
incorporated by reference.
[0461] The C.sub.max value is the maximum concentration of the
compound achieved in the serum or plasma of a mammal following
administration of the compound to the mammal. The C.sub.max value
of a particular compound can be measured using methods known to
those of ordinary skill in the art. The phrases "increasing
bioavailability" or "improving the pharmacokinetics," as used
herein mean that the systemic availability of a first
polynucleotide, primary construct or mmRNA, measured as AUC,
C.sub.max, or C.sub.min in a mammal is greater, when
co-administered with a delivery agent as described herein, than
when such co-administration does not take place. In some
embodiments, the bioavailability of the polynucleotide, primary
construct or mmRNA can increase by at least about 2%, at least
about 5%, at least about 10%, at least about 15%, at least about
20%, at least about 25%, at least about 30%, at least about 35%, at
least about 40%, at least about 45%, at least about 50%, at least
about 55%, at least about 60%, at least about 65%, at least about
70%, at least about 75%, at least about 80%, at least about 85%, at
least about 90%, at least about 95%, or about 100%.
Therapeutic Window
[0462] The polynucleotides, primary constructs or mmRNA, when
formulated into a composition with a delivery agent as described
herein, can exhibit an increase in the therapeutic window of the
administered polynucleotide, primary construct or mmRNA composition
as compared to the therapeutic window of the administered
polynucleotide, primary construct or mmRNA composition lacking a
delivery agent as described herein. As used herein "therapeutic
window" refers to the range of plasma concentrations, or the range
of levels of therapeutically active substance at the site of
action, with a high probability of eliciting a therapeutic effect.
In some embodiments, the therapeutic window of the polynucleotide,
primary construct or mmRNA when co-administered with a delivery
agent as described herein can increase by at least about 2%, at
least about 5%, at least about 10%, at least about 15%, at least
about 20%, at least about 25%, at least about 30%, at least about
35%, at least about 40%, at least about 45%, at least about 50%, at
least about 55%, at least about 60%, at least about 65%, at least
about 70%, at least about 75%, at least about 80%, at least about
85%, at least about 90%, at least about 95%, or about 100%.
Volume of Distribution
[0463] The polynucleotides, primary constructs or mmRNA, when
formulated into a composition with a delivery agent as described
herein, can exhibit an improved volume of distribution
(V.sub.dist), e.g., reduced or targeted, relative to a composition
lacking a delivery agent as described herein. The volume of
distribution (V.sub.dist) relates the amount of the drug in the
body to the concentration of the drug in the blood or plasma. As
used herein, the term "volume of distribution" refers to the fluid
volume that would be required to contain the total amount of the
drug in the body at the same concentration as in the blood or
plasma: V.sub.dist equals the amount of drug in the
body/concentration of drug in blood or plasma. For example, for a
10 mg dose and a plasma concentration of 10 mg/L, the volume of
distribution would be 1 liter. The volume of distribution reflects
the extent to which the drug is present in the extravascular
tissue. A large volume of distribution reflects the tendency of a
compound to bind to the tissue components compared with plasma
protein binding. In a clinical setting, V.sub.dist can be used to
determine a loading dose to achieve a steady state concentration.
In some embodiments, the volume of distribution of the
polynucleotide, primary construct or mmRNA when co-administered
with a delivery agent as described herein can decrease at least
about 2%, at least about 5%, at least about 10%, at least about
15%, at least about 20%, at least about 25%, at least about 30%, at
least about 35%, at least about 40%, at least about 45%, at least
about 50%, at least about 55%, at least about 60%, at least about
65%, at least about 70%.
Biological Effect
[0464] In one embodiment, the biological effect of the modified
mRNA delivered to the animals may be categorized by analyzing the
protein expression in the animals. The protein expression may be
determined from analyzing a biological sample collected from a
mammal administered the modified mRNA of the present invention. In
one embodiment, the expression protein encoded by the modified mRNA
administered to the mammal of at least 50 pg/ml may be preferred.
For example, a protein expression of 50-200 pg/ml for the protein
encoded by the modified mRNA delivered to the mammal may be seen as
a therapeutically effective amount of protein in the mammal.
Detection of Modified Nucleic Acids by Mass Spectrometry
[0465] Mass spectrometry (MS) is an analytical technique that can
provide structural and molecular mass/concentration information on
molecules after their conversion to ions. The molecules are first
ionized to acquire positive or negative charges and then they
travel through the mass analyzer to arrive at different areas of
the detector according to their mass/charge (m/z) ratio.
[0466] Mass spectrometry is performed using a mass spectrometer
which includes an ion source for ionizing the fractionated sample
and creating charged molecules for further analysis. For example
ionization of the sample may be performed by electrospray
ionization (ESI), atmospheric pressure chemical ionization (APCI),
photoionization, electron ionization, fast atom bombardment
(FAB)/liquid secondary ionization (LSIMS), matrix assisted laser
desorption/ionization (MALDI), field ionization, field desorption,
thermospray/plasmaspray ionization, and particle beam ionization.
The skilled artisan will understand that the choice of ionization
method can be determined based on the analyte to be measured, type
of sample, the type of detector, the choice of positive versus
negative mode, etc.
[0467] After the sample has been ionized, the positively charged or
negatively charged ions thereby created may be analyzed to
determine a mass-to-charge ratio (i.e., m/z). Suitable analyzers
for determining mass-to-charge ratios include quadropole analyzers,
ion traps analyzers, and time-of-flight analyzers. The ions may be
detected using several detection modes. For example, selected ions
may be detected (i.e., using a selective ion monitoring mode
(SIM)), or alternatively, ions may be detected using a scanning
mode, e.g., multiple reaction monitoring (MRM) or selected reaction
monitoring (SRM).
[0468] Liquid chromatography-multiple reaction monitoring
(LC-MS/MRM) coupled with stable isotope labeled dilution of peptide
standards has been shown to be an effective method for protein
verification (e.g., Keshishian et al., Mol Cell Proteomics 2009 8:
2339-2349; Kuhn et al., Clin Chem 2009 55:1108-1117; Lopez et al.,
Clin Chem 2010 56:281-290). Unlike untargeted mass spectrometry
frequently used in biomarker discovery studies, targeted MS methods
are peptide sequence-based modes of MS that focus the full
analytical capacity of the instrument on tens to hundreds of
selected peptides in a complex mixture. By restricting detection
and fragmentation to only those peptides derived from proteins of
interest, sensitivity and reproducibility are improved dramatically
compared to discovery-mode MS methods. This method of mass
spectrometry-based multiple reaction monitoring (MRM) quantitation
of proteins can dramatically impact the discovery and quantitation
of biomarkers via rapid, targeted, multiplexed protein expression
profiling of clinical samples.
[0469] In one embodiment, a biological sample which may contain at
least one protein encoded by at least one modified mRNA of the
present invention may be analyzed by the method of MRM-MS. The
quantification of the biological sample may further include, but is
not limited to, isotopically labeled peptides or proteins as
internal standards.
[0470] According to the present invention, the biological sample,
once obtained from the subject, may be subjected to enzyme
digestion. As used herein, the term "digest" means to break apart
into shorter peptides. As used herein, the phrase "treating a
sample to digest proteins" means manipulating a sample in such a
way as to break down proteins in a sample. These enzymes include,
but are not limited to, trypsin, endoproteinase Glu-C and
chymotrypsin. In one embodiment, a biological sample which may
contain at least one protein encoded by at least one modified mRNA
of the present invention may be digested using enzymes.
[0471] In one embodiment, a biological sample which may contain
protein encoded by modified mRNA of the present invention may be
analyzed for protein using electrospray ionization. Electrospray
ionization (ESI) mass spectrometry (ESIMS) uses electrical energy
to aid in the transfer of ions from the solution to the gaseous
phase before they are analyzed by mass spectrometry. Samples may be
analyzed using methods known in the art (e.g., Ho et al., Clin
Biochem Rev. 2003 24(1):3-12). The ionic species contained in
solution may be transferred into the gas phase by dispersing a fine
spray of charge droplets, evaporating the solvent and ejecting the
ions from the charged droplets to generate a mist of highly charged
droplets. The mist of highly charged droplets may be analyzed using
at least 1, at least 2, at least 3 or at least 4 mass analyzers
such as, but not limited to, a quadropole mass analyzer. Further,
the mass spectrometry method may include a purification step. As a
non-limiting example, the first quadrapole may be set to select a
single m/z ratio so it may filter out other molecular ions having a
different m/z ratio which may eliminate complicated and
time-consuming sample purification procedures prior to MS
analysis.
[0472] In one embodiment, a biological sample which may contain
protein encoded by modified mRNA of the present invention may be
analyzed for protein in a tandem ESIMS system (e.g., MS/MS). As
non-limiting examples, the droplets may be analyzed using a product
scan (or daughter scan) a precursor scan (parent scan) a neutral
loss or a multiple reaction monitoring.
[0473] In one embodiment, a biological sample which may contain
protein encoded by modified mRNA of the present invention may be
analyzed using matrix-assisted laser desorption/ionization (MALDI)
mass spectrometry (MALDIMS). MALDI provides for the nondestructive
vaporization and ionization of both large and small molecules, such
as proteins. In MALDI analysis, the analyte is first
co-crystallized with a large molar excess of a matrix compound,
which may also include, but is not limited to, an ultraviolet
absorbing weak organic acid. Non-limiting examples of matrices used
in MALDI are .alpha.-cyano-4-hydroxycinnamic acid,
3,5-dimethoxy-4-hydroxycinnamic acid and 2,5-dihydroxybenzoic acid.
Laser radiation of the analyte-matrix mixture may result in the
vaporization of the matrix and the analyte. The laser induced
desorption provides high ion yields of the intact analyte and
allows for measurement of compounds with high accuracy. Samples may
be analyzed using methods known in the art (e.g., Lewis, Wei and
Siuzdak, Encyclopedia of Analytical Chemistry 2000: 5880-5894). As
non-limiting examples, mass analyzers used in the MALDI analysis
may include a linear time-of-flight (TOF), a TOF reflection or a
Fourier transform mass analyzer.
[0474] In one embodiment, the analyte-matrix mixture may be formed
using the dried-droplet method. A biologic sample is mixed with a
matrix to create a saturated matrix solution where the
matrix-to-sample ratio is approximately 5000:1. An aliquot
(approximately 0.5-2.0 uL) of the saturated matrix solution is then
allowed to dry to form the analyte-matrix mixture.
[0475] In one embodiment, the analyte-matrix mixture may be formed
using the thin-layer method. A matrix homogeneous film is first
formed and then the sample is then applied and may be absorbed by
the matrix to form the analyte-matrix mixture.
[0476] In one embodiment, the analyte-matrix mixture may be formed
using the thick-layer method. A matrix homogeneous film is formed
with a nitro-cellulose matrix additive. Once the uniform
nitro-cellulose matrix layer is obtained the sample is applied and
absorbed into the matrix to form the analyte-matrix mixture.
[0477] In one embodiment, the analyte-matrix mixture may be formed
using the sandwich method. A thin layer of matrix crystals is
prepared as in the thin-layer method followed by the addition of
droplets of aqueous trifluoroacetic acid, the sample and matrix.
The sample is then absorbed into the matrix to form the
analyte-matrix mixture.
V. USES OF POLYNUCLEOTIDES, PRIMARY CONSTRUCTS AND MMRNA OF THE
INVENTION
[0478] The polynucleotides, primary constructs and mmRNA of the
present invention are designed, in preferred embodiments, to
provide for avoidance or evasion of deleterious bio-responses such
as the immune response and/or degradation pathways, overcoming the
threshold of expression and/or improving protein production
capacity, improved expression rates or translation efficiency,
improved drug or protein half-life and/or protein concentrations,
optimized protein localization, to improve one or more of the
stability and/or clearance in tissues, receptor uptake and/or
kinetics, cellular access by the compositions, engagement with
translational machinery, secretion efficiency (when applicable),
accessibility to circulation, and/or modulation of a cell's status,
function and/or activity.
Therapeutics
Therapeutic Agents
[0479] The polynucleotides, primary constructs or mmRNA of the
present invention, such as modified nucleic acids and modified
RNAs, and the proteins translated from them described herein can be
used as therapeutic or prophylactic agents. They are provided for
use in medicine. For example, polynucleotide, primary construct or
mmRNA described herein can be administered to a subject, wherein
the polynucleotide, primary construct or mmRNA is translated in
vivo to produce a therapeutic or prophylactic polypeptide in the
subject. Provided are compositions, methods, kits, and reagents for
diagnosis, treatment or prevention of a disease or condition in
humans and other mammals. The active therapeutic agents of the
invention include polynucleotides, primary constructs or mmRNA,
cells containing polynucleotides, primary constructs or mmRNA or
polypeptides translated from the polynucleotides, primary
constructs or mmRNA.
[0480] In certain embodiments, provided herein are combination
therapeutics containing one or more polynucleotide, primary
construct or mmRNA containing translatable regions that encode for
a protein or proteins that boost a mammalian subject's immunity
along with a protein that induces antibody-dependent cellular
toxicity.
[0481] Provided herein are methods of inducing translation of a
recombinant polypeptide in a cell population using the
polynucleotide, primary construct or mmRNA described herein. Such
translation can be in vivo, ex vivo, in culture, or in vitro. The
cell population is contacted with an effective amount of a
composition containing nucleic acid that has at least one
nucleoside modification, and a translatable region encoding the
recombinant polypeptide. The population is contacted under
conditions such that the nucleic acid is localized into one or more
cells of the cell population and the recombinant polypeptide is
translated in the cell from the nucleic acid.
[0482] An "effective amount" of the composition is provided based,
at least in part, on the target tissue, target cell type, means of
administration, physical characteristics of the nucleic acid (e.g.,
size, and extent of modified nucleosides), and other determinants.
In general, an effective amount of the composition provides
efficient protein production in the cell, preferably more efficient
than a composition containing a corresponding unmodified nucleic
acid. Increased efficiency may be demonstrated by increased cell
transfection (i.e., the percentage of cells transfected with the
nucleic acid), increased protein translation from the nucleic acid,
decreased nucleic acid degradation (as demonstrated, e.g., by
increased duration of protein translation from a modified nucleic
acid), or reduced innate immune response of the host cell.
[0483] Aspects of the invention are directed to methods of inducing
in vivo translation of a recombinant polypeptide in a mammalian
subject in need thereof. Therein, an effective amount of a
composition containing a nucleic acid that has at least one
structural or chemical modification and a translatable region
encoding the recombinant polypeptide is administered to the subject
using the delivery methods described herein. The nucleic acid is
provided in an amount and under other conditions such that the
nucleic acid is localized into a cell of the subject and the
recombinant polypeptide is translated in the cell from the nucleic
acid. The cell in which the nucleic acid is localized, or the
tissue in which the cell is present, may be targeted with one or
more than one rounds of nucleic acid administration.
[0484] In certain embodiments, the administered polynucleotide,
primary construct or mmRNA directs production of one or more
recombinant polypeptides that provide a functional activity which
is substantially absent in the cell, tissue or organism in which
the recombinant polypeptide is translated. For example, the missing
functional activity may be enzymatic, structural, or gene
regulatory in nature. In related embodiments, the administered
polynucleotide, primary construct or mmRNA directs production of
one or more recombinant polypeptides that increases (e.g.,
synergistically) a functional activity which is present but
substantially deficient in the cell in which the recombinant
polypeptide is translated.
[0485] In other embodiments, the administered polynucleotide,
primary construct or mmRNA directs production of one or more
recombinant polypeptides that replace a polypeptide (or multiple
polypeptides) that is substantially absent in the cell in which the
recombinant polypeptide is translated. Such absence may be due to
genetic mutation of the encoding gene or regulatory pathway
thereof. In some embodiments, the recombinant polypeptide increases
the level of an endogenous protein in the cell to a desirable
level; such an increase may bring the level of the endogenous
protein from a subnormal level to a normal level or from a normal
level to a super-normal level.
[0486] Alternatively, the recombinant polypeptide functions to
antagonize the activity of an endogenous protein present in, on the
surface of, or secreted from the cell. Usually, the activity of the
endogenous protein is deleterious to the subject; for example, due
to mutation of the endogenous protein resulting in altered activity
or localization. Additionally, the recombinant polypeptide
antagonizes, directly or indirectly, the activity of a biological
moiety present in, on the surface of, or secreted from the cell.
Examples of antagonized biological moieties include lipids (e.g.,
cholesterol), a lipoprotein (e.g., low density lipoprotein), a
nucleic acid, a carbohydrate, a protein toxin such as shiga and
tetanus toxins, or a small molecule toxin such as botulinum,
cholera, and diphtheria toxins. Additionally, the antagonized
biological molecule may be an endogenous protein that exhibits an
undesirable activity, such as a cytotoxic or cytostatic
activity.
[0487] The recombinant proteins described herein may be engineered
for localization within the cell, potentially within a specific
compartment such as the nucleus, or are engineered for secretion
from the cell or translocation to the plasma membrane of the
cell.
[0488] In some embodiments, modified mRNAs and their encoded
polypeptides in accordance with the present invention may be used
for treatment of any of a variety of diseases, disorders, and/or
conditions described herein.
VI. KITS AND DEVICES
Kits
[0489] The invention provides a variety of kits for conveniently
and/or effectively carrying out methods of the present invention.
Typically kits will comprise sufficient amounts and/or numbers of
components to allow a user to perform multiple treatments of a
subject(s) and/or to perform multiple experiments.
[0490] In one aspect, the present invention provides kits
comprising the molecules (polynucleotides, primary constructs or
mmRNA) of the invention. In one embodiment, the kit comprises one
or more functional antibodies or function fragments thereof.
[0491] Said kits can be for protein production, comprising a first
polynucleotide, primary construct or mmRNA comprising a
translatable region. The kit may further comprise packaging and
instructions and/or a delivery agent to form a formulation
composition. The delivery agent may comprise a saline, a buffered
solution, a lipidoid or any delivery agent disclosed herein.
[0492] In one embodiment, the buffer solution may include sodium
chloride, calcium chloride, phosphate and/or EDTA. In another
embodiment, the buffer solution may include, but is not limited to,
saline, saline with 2 mM calcium, 5% sucrose, 5% sucrose with 2 mM
calcium, 5% Mannitol, 5% Mannitol with 2 mM calcium, Ringer's
lactate, sodium chloride, sodium chloride with 2 mM calcium. In a
further embodiment, the buffer solutions may be precipitated or it
may be lyophilized. The amount of each component may be varied to
enable consistent, reproducible higher concentration saline or
simple buffer formulations. The components may also be varied in
order to increase the stability of modified RNA in the buffer
solution over a period of time and/or under a variety of
conditions. In one aspect, the present invention provides kits for
protein production, comprising: polynucleotide, primary construct
or mmRNA comprising a translatable region, provided in an amount
effective to produce a desired amount of a protein encoded by the
translatable region when introduced into a target cell; a second
polynucleotide comprising an inhibitory nucleic acid, provided in
an amount effective to substantially inhibit the innate immune
response of the cell; and packaging and instructions.
[0493] In one aspect, the present invention provides kits for
protein production, comprising polynucleotide, primary construct or
mmRNA comprising a translatable region, wherein the polynucleotide
exhibits reduced degradation by a cellular nuclease, and packaging
and instructions.
[0494] In one aspect, the present invention provides kits for
protein production, comprising polynucleotide, primary construct or
mmRNA comprising a translatable region, wherein the polynucleotide
exhibits reduced degradation by a cellular nuclease, and a
mammalian cell suitable for translation of the translatable region
of the first nucleic acid.
Devices
[0495] The present invention provides for devices which may
incorporate polynucleotides, primary constructs or mmRNA that
encode polypeptides of interest. These devices contain in a stable
formulation the reagents to synthesize a polynucleotide in a
formulation available to be immediately delivered to a subject in
need thereof, such as a human patient.
[0496] In some embodiments the device is self-contained, and is
optionally capable of wireless remote access to obtain instructions
for synthesis and/or analysis of the generated polynucleotide,
primary construct or mmRNA. The device is capable of mobile
synthesis of at least one polynucleotide, primary construct or
mmRNA and preferably an unlimited number of different
polynucleotides, primary constructs or mmRNA. In certain
embodiments, the device is capable of being transported by one or a
small number of individuals. In other embodiments, the device is
scaled to fit on a benchtop or desk. In other embodiments, the
device is scaled to fit into a suitcase, backpack or similarly
sized object. In another embodiment, the device may be a point of
care or handheld device. In further embodiments, the device is
scaled to fit into a vehicle, such as a car, truck or ambulance, or
a military vehicle such as a tank or personnel carrier. The
information necessary to generate a modified mRNA encoding
polypeptide of interest is present within a computer readable
medium present in the device.
[0497] In one embodiment, a device may be used to assess levels of
a protein which has been administered in the form of
polynucleotide, primary construct or mmRNA. The device may comprise
a blood, urine or other biofluidic test.
[0498] In some embodiments, the device is capable of communication
(e.g., wireless communication) with a database of nucleic acid and
polypeptide sequences which may be nucleic acid and polypeptide
sequences. The device contains at least one sample block for
insertion of one or more sample vessels. Such sample vessels are
capable of accepting in liquid or other form any number of
materials such as template DNA, nucleotides, enzymes, buffers, and
other reagents. The sample vessels are also capable of being heated
and cooled by contact with the sample block. The sample block is
generally in communication with a device base with one or more
electronic control units for the at least one sample block. The
sample block preferably contains a heating module, such heating
molecule capable of heating and/or cooling the sample vessels and
contents thereof to temperatures between about -20 C and above +100
C. The device base is in communication with a voltage supply such
as a battery or external voltage supply. The device also contains
means for storing and distributing the materials for RNA
synthesis.
[0499] Optionally, the sample block contains a module for
separating the synthesized nucleic acids. Alternatively, the device
contains a separation module operably linked to the sample block.
Preferably the device contains a means for analysis of the
synthesized nucleic acid. Such analysis includes sequence identity
(demonstrated such as by hybridization), absence of non-desired
sequences, measurement of integrity of synthesized mRNA (such has
by microfluidic viscometry combined with spectrophotometry), and
concentration and/or potency of modified RNA (such as by
spectrophotometry).
[0500] In certain embodiments, the device is combined with a means
for detection of pathogens present in a biological material
obtained from a subject, e.g., the IBIS PLEX-ID system (Abbott,
Abbott Park, Ill.) for microbial identification.
[0501] Suitable devices for use in delivering intradermal
pharmaceutical compositions described herein include short needle
devices such as those described in U.S. Pat. Nos. 4,886,499;
5,190,521; 5,328,483; 5,527,288; 4,270,537; 5,015,235; 5,141,496;
and 5,417,662. Intradermal compositions may be administered by
devices which limit the effective penetration length of a needle
into the skin, such as those described in PCT publication WO
99/34850 and functional equivalents thereof. Jet injection devices
which deliver liquid compositions to the dermis via a liquid jet
injector and/or via a needle which pierces the stratum corneum and
produces a jet which reaches the dermis are suitable. Jet injection
devices are described, for example, in U.S. Pat. Nos. 5,480,381;
5,599,302; 5,334,144; 5,993,412; 5,649,912; 5,569,189; 5,704,911;
5,383,851; 5,893,397; 5,466,220; 5,339,163; 5,312,335; 5,503,627;
5,064,413; 5,520,639; 4,596,556; 4,790,824; 4,941,880; 4,940,460;
and PCT publications WO 97/37705 and WO 97/13537. Ballistic
powder/particle delivery devices which use compressed gas to
accelerate vaccine in powder form through the outer layers of the
skin to the dermis are suitable. Alternatively or additionally,
conventional syringes may be used in the classical mantoux method
of intradermal administration.
[0502] In some embodiments, the device may be a pump or comprise a
catheter for administration of compounds or compositions of the
invention across the blood brain barrier. Such devices include but
are not limited to a pressurized olfactory delivery device,
iontophoresis devices, multi-layered microfluidic devices, and the
like. Such devices may be portable or stationary. They may be
implantable or externally tethered to the body or combinations
thereof.
[0503] Devices for administration may be employed to deliver the
polynucleotides, primary constructs or mmRNA of the present
invention according to single, multi- or split-dosing regimens
taught herein. Such devices are described below.
[0504] Method and devices known in the art for multi-administration
to cells, organs and tissues are contemplated for use in
conjunction with the methods and compositions disclosed herein as
embodiments of the present invention. These include, for example,
those methods and devices having multiple needles, hybrid devices
employing for example lumens or catheters as well as devices
utilizing heat, electric current or radiation driven
mechanisms.
[0505] According to the present invention, these
multi-administration devices may be utilized to deliver the single,
multi- or split doses contemplated herein.
[0506] A method for delivering therapeutic agents to a solid tissue
has been described by Bahrami et al. and is taught for example in
US Patent Publication 20110230839, the contents of which are
incorporated herein by reference in their entirety. According to
Bahrami, an array of needles is incorporated into a device which
delivers a substantially equal amount of fluid at any location in
said solid tissue along each needle's length.
[0507] A device for delivery of biological material across the
biological tissue has been described by Kodgule et al. and is
taught for example in US Patent Publication 20110172610, the
contents of which are incorporated herein by reference in their
entirety. According to Kodgule, multiple hollow micro-needles made
of one or more metals and having outer diameters from about 200
microns to about 350 microns and lengths of at least 100 microns
are incorporated into the device which delivers peptides, proteins,
carbohydrates, nucleic acid molecules, lipids and other
pharmaceutically active ingredients or combinations thereof.
[0508] A delivery probe for delivering a therapeutic agent to a
tissue has been described by Gunday et al. and is taught for
example in US Patent Publication 20110270184, the contents of which
are incorporated herein by reference in their entirety. According
to Gunday, multiple needles are incorporated into the device which
moves the attached capsules between an activated position and an
inactivated position to force the agent out of the capsules through
the needles.
[0509] A multiple-injection medical apparatus has been described by
Assaf and is taught for example in US Patent Publication
20110218497, the contents of which are incorporated herein by
reference in their entirety. According to Assaf, multiple needles
are incorporated into the device which has a chamber connected to
one or more of said needles and a means for continuously refilling
the chamber with the medical fluid after each injection.
[0510] In one embodiment, the polynucleotide, primary construct, or
mmRNA is administered subcutaneously or intramuscularly via at
least 3 needles to three different, optionally adjacent, sites
simultaneously, or within a 60 minutes period (e.g., administration
to 4, 5, 6, 7, 8, 9, or 10 sites simultaneously or within a 60
minute period). The split doses can be administered simultaneously
to adjacent tissue using the devices described in U.S. Patent
Publication Nos. 20110230839 and 20110218497, each of which is
incorporated herein by reference.
[0511] An at least partially implantable system for injecting a
substance into a patient's body, in particular a penis erection
stimulation system has been described by Forsell and is taught for
example in US Patent Publication 20110196198, the contents of which
are incorporated herein by reference in their entirety. According
to Forsell, multiple needles are incorporated into the device which
is implanted along with one or more housings adjacent the patient's
left and right corpora cavernosa. A reservoir and a pump are also
implanted to supply drugs through the needles.
[0512] A method for the transdermal delivery of a therapeutic
effective amount of iron has been described by Berenson and is
taught for example in US Patent Publication 20100130910, the
contents of which are incorporated herein by reference in their
entirety. According to Berenson, multiple needles may be used to
create multiple micro channels in stratum corneum to enhance
transdermal delivery of the ionic iron on an iontophoretic
patch.
[0513] A method for delivery of biological material across the
biological tissue has been described by Kodgule et al and is taught
for example in US Patent Publication 20110196308, the contents of
which are incorporated herein by reference in their entirety.
According to Kodgule, multiple biodegradable microneedles
containing a therapeutic active ingredient are incorporated in a
device which delivers proteins, carbohydrates, nucleic acid
molecules, lipids and other pharmaceutically active ingredients or
combinations thereof.
[0514] A transdermal patch comprising a botulinum toxin composition
has been described by Donovan and is taught for example in US
Patent Publication 20080220020, the contents of which are
incorporated herein by reference in their entirety. According to
Donovan, multiple needles are incorporated into the patch which
delivers botulinum toxin under stratum corneum through said needles
which project through the stratum corneum of the skin without
rupturing a blood vessel.
[0515] A small, disposable drug reservoir, or patch pump, which can
hold approximately 0.2 to 15 mL of liquid formulations can be
placed on the skin and deliver the formulation continuously
subcutaneously using a small bore needed (e.g., 26 to 34 gauge). As
non-limiting examples, the patch pump may be 50 mm by 76 mm by 20
mm spring loaded having a 30 to 34 gauge needle (BD.TM.
Microinfuser, Franklin Lakes N.J.), 41 mm by 62 mm by 17 mm with a
2 mL reservoir used for drug delivery such as insulin
(OMNIPOD.RTM., Insulet Corporation Bedford, Mass.), or 43-60 mm
diameter, 10 mm thick with a 0.5 to 10 mL reservoir
(PATCHPUMP.RTM., SteadyMed Therapeutics, San Francisco, Calif.).
Further, the patch pump may be battery powered and/or
rechargeable.
[0516] A cryoprobe for administration of an active agent to a
location of cryogenic treatment has been described by Toubia and is
taught for example in US Patent Publication 20080140061, the
contents of which are incorporated herein by reference in their
entirety. According to Toubia, multiple needles are incorporated
into the probe which receives the active agent into a chamber and
administers the agent to the tissue.
[0517] A method for treating or preventing inflammation or
promoting healthy joints has been described by Stock et al and is
taught for example in US Patent Publication 20090155186, the
contents of which are incorporated herein by reference in their
entirety. According to Stock, multiple needles are incorporated in
a device which administers compositions containing signal
transduction modulator compounds.
[0518] A multi-site injection system has been described by Kimmell
et al. and is taught for example in US Patent Publication
20100256594, the contents of which are incorporated herein by
reference in their entirety. According to Kimmell, multiple needles
are incorporated into a device which delivers a medication into a
stratum corneum through the needles.
[0519] A method for delivering interferons to the intradermal
compartment has been described by Dekker et al. and is taught for
example in US Patent Publication 20050181033, the contents of which
are incorporated herein by reference in their entirety. According
to Dekker, multiple needles having an outlet with an exposed height
between 0 and 1 mm are incorporated into a device which improves
pharmacokinetics and bioavailability by delivering the substance at
a depth between 0.3 mm and 2 mm.
[0520] A method for delivering genes, enzymes and biological agents
to tissue cells has described by Desai and is taught for example in
US Patent Publication 20030073908, the contents of which are
incorporated herein by reference in their entirety. According to
Desai, multiple needles are incorporated into a device which is
inserted into a body and delivers a medication fluid through said
needles.
[0521] A method for treating cardiac arrhythmias with fibroblast
cells has been described by Lee et al and is taught for example in
US Patent Publication 20040005295, the contents of which are
incorporated herein by reference in their entirety. According to
Lee, multiple needles are incorporated into the device which
delivers fibroblast cells into the local region of the tissue.
[0522] A method using a magnetically controlled pump for treating a
brain tumor has been described by Shachar et al. and is taught for
example in U.S. Pat. No. 7,799,012 (method) and U.S. Pat. No.
7,799,016 (device), the contents of which are incorporated herein
by reference in their entirety. According Shachar, multiple needles
were incorporated into the pump which pushes a medicating agent
through the needles at a controlled rate.
[0523] Methods of treating functional disorders of the bladder in
mammalian females have been described by Versi et al. and are
taught for example in U.S. Pat. No. 8,029,496, the contents of
which are incorporated herein by reference in their entirety.
According to Versi, an array of micro-needles is incorporated into
a device which delivers a therapeutic agent through the needles
directly into the trigone of the bladder.
[0524] A micro-needle transdermal transport device has been
described by Angel et al and is taught for example in U.S. Pat. No.
7,364,568, the contents of which are incorporated herein by
reference in their entirety. According to Angel, multiple needles
are incorporated into the device which transports a substance into
a body surface through the needles which are inserted into the
surface from different directions. The micro-needle transdermal
transport device may be a solid micro-needle system or a hollow
micro-needle system. As a non-limiting example, the solid
micro-needle system may have up to a 0.5 mg capacity, with 300-1500
solid micro-needles per cm.sup.2 about 150-700 .mu.m tall coated
with a drug. The micro-needles penetrate the stratum corneum and
remain in the skin for short duration (e.g., 20 seconds to 15
minutes). In another example, the hollow micro-needle system has up
to a 3 mL capacity to deliver liquid formulations using 15-20
microneedles per cm2 being approximately 950 .mu.m tall. The
micro-needles penetrate the skin to allow the liquid formulations
to flow from the device into the skin. The hollow micro-needle
system may be worn from 1 to 30 minutes depending on the
formulation volume and viscosity.
[0525] A device for subcutaneous infusion has been described by
Dalton et al and is taught for example in U.S. Pat. No. 7,150,726,
the contents of which are incorporated herein by reference in their
entirety. According to Dalton, multiple needles are incorporated
into the device which delivers fluid through the needles into a
subcutaneous tissue.
[0526] A device and a method for intradermal delivery of vaccines
and gene therapeutic agents through microcannula have been
described by Mikszta et al. and are taught for example in U.S. Pat.
No. 7,473,247, the contents of which are incorporated herein by
reference in their entirety. According to Mitszta, at least one
hollow micro-needle is incorporated into the device which delivers
the vaccines to the subject's skin to a depth of between 0.025 mm
and 2 mm.
[0527] A method of delivering insulin has been described by Pettis
et al and is taught for example in U.S. Pat. No. 7,722,595, the
contents of which are incorporated herein by reference in their
entirety. According to Pettis, two needles are incorporated into a
device wherein both needles insert essentially simultaneously into
the skin with the first at a depth of less than 2.5 mm to deliver
insulin to intradermal compartment and the second at a depth of
greater than 2.5 mm and less than 5.0 mm to deliver insulin to
subcutaneous compartment.
[0528] Cutaneous injection delivery under suction has been
described by Kochamba et al. and is taught for example in U.S. Pat.
No. 6,896,666, the contents of which are incorporated herein by
reference in their entirety. According to Kochamba, multiple
needles in relative adjacency with each other are incorporated into
a device which injects a fluid below the cutaneous layer.
[0529] A device for withdrawing or delivering a substance through
the skin has been described by Down et al and is taught for example
in U.S. Pat. No. 6,607,513, the contents of which are incorporated
herein by reference in their entirety. According to Down, multiple
skin penetrating members which are incorporated into the device
have lengths of about 100 microns to about 2000 microns and are
about 30 to 50 gauge.
[0530] A device for delivering a substance to the skin has been
described by Palmer et al and is taught for example in U.S. Pat.
No. 6,537,242, the contents of which are incorporated herein by
reference in their entirety. According to Palmer, an array of
micro-needles is incorporated into the device which uses a
stretching assembly to enhance the contact of the needles with the
skin and provides a more uniform delivery of the substance.
[0531] A perfusion device for localized drug delivery has been
described by Zamoyski and is taught for example in U.S. Pat. No.
6,468,247, the contents of which are incorporated herein by
reference in their entirety. According to Zamoyski, multiple
hypodermic needles are incorporated into the device which injects
the contents of the hypodermics into a tissue as said hypodermics
are being retracted.
[0532] A method for enhanced transport of drugs and biological
molecules across tissue by improving the interaction between
micro-needles and human skin has been described by Prausnitz et al.
and is taught for example in U.S. Pat. No. 6,743,211, the contents
of which are incorporated herein by reference in their entirety.
According to Prausnitz, multiple micro-needles are incorporated
into a device which is able to present a more rigid and less
deformable surface to which the micro-needles are applied.
[0533] A device for intraorgan administration of medicinal agents
has been described by Ting et al and is taught for example in U.S.
Pat. No. 6,077,251, the contents of which are incorporated herein
by reference in their entirety. According to Ting, multiple needles
having side openings for enhanced administration are incorporated
into a device which by extending and retracting said needles from
and into the needle chamber forces a medicinal agent from a
reservoir into said needles and injects said medicinal agent into a
target organ.
[0534] A multiple needle holder and a subcutaneous multiple channel
infusion port has been described by Brown and is taught for example
in U.S. Pat. No. 4,695,273, the contents of which are incorporated
herein by reference in their entirety. According to Brown, multiple
needles on the needle holder are inserted through the septum of the
infusion port and communicate with isolated chambers in said
infusion port.
[0535] A dual hypodermic syringe has been described by Horn and is
taught for example in U.S. Pat. No. 3,552,394, the contents of
which are incorporated herein by reference in their entirety.
According to Horn, two needles incorporated into the device are
spaced apart less than 68 mm and may be of different styles and
lengths, thus enabling injections to be made to different
depths.
[0536] A syringe with multiple needles and multiple fluid
compartments has been described by Hershberg and is taught for
example in U.S. Pat. No. 3,572,336, the contents of which are
incorporated herein by reference in their entirety. According to
Hershberg, multiple needles are incorporated into the syringe which
has multiple fluid compartments and is capable of simultaneously
administering incompatible drugs which are not able to be mixed for
one injection.
[0537] A surgical instrument for intradermal injection of fluids
has been described by Eliscu et al. and is taught for example in
U.S. Pat. No. 2,588,623, the contents of which are incorporated
herein by reference in their entirety. According to Eliscu,
multiple needles are incorporated into the instrument which injects
fluids intradermally with a wider disperse.
[0538] An apparatus for simultaneous delivery of a substance to
multiple breast milk ducts has been described by Hung and is taught
for example in EP 1818017, the contents of which are incorporated
herein by reference in their entirety. According to Hung, multiple
lumens are incorporated into the device which inserts though the
orifices of the ductal networks and delivers a fluid to the ductal
networks.
[0539] A catheter for introduction of medications to the tissue of
a heart or other organs has been described by Tkebuchava and is
taught for example in WO2006138109, the contents of which are
incorporated herein by reference in their entirety. According to
Tkebuchava, two curved needles are incorporated which enter the
organ wall in a flattened trajectory.
[0540] Devices for delivering medical agents have been described by
Mckay et al. and are taught for example in WO2006118804, the
content of which are incorporated herein by reference in their
entirety. According to Mckay, multiple needles with multiple
orifices on each needle are incorporated into the devices to
facilitate regional delivery to a tissue, such as the interior disc
space of a spinal disc.
[0541] A method for directly delivering an immunomodulatory
substance into an intradermal space within a mammalian skin has
been described by Pettis and is taught for example in WO2004020014,
the contents of which are incorporated herein by reference in their
entirety. According to Pettis, multiple needles are incorporated
into a device which delivers the substance through the needles to a
depth between 0.3 mm and 2 mm.
[0542] Methods and devices for administration of substances into at
least two compartments in skin for systemic absorption and improved
pharmacokinetics have been described by Pettis et al. and are
taught for example in WO2003094995, the contents of which are
incorporated herein by reference in their entirety. According to
Pettis, multiple needles having lengths between about 300 .mu.m and
about 5 mm are incorporated into a device which delivers to
intradermal and subcutaneous tissue compartments
simultaneously.
[0543] A drug delivery device with needles and a roller has been
described by Zimmerman et al. and is taught for example in
WO2012006259, the contents of which are incorporated herein by
reference in their entirety. According to Zimmerman, multiple
hollow needles positioned in a roller are incorporated into the
device which delivers the content in a reservoir through the
needles as the roller rotates.
Methods and Devices Utilizing Catheters and/or Lumens
[0544] Methods and devices using catheters and lumens may be
employed to administer the mmRNA of the present invention on a
single, multi- or split dosing schedule. Such methods and devices
are described below.
[0545] A catheter-based delivery of skeletal myoblasts to the
myocardium of damaged hearts has been described by Jacoby et al and
is taught for example in US Patent Publication 20060263338, the
contents of which are incorporated herein by reference in their
entirety. According to Jacoby, multiple needles are incorporated
into the device at least part of which is inserted into a blood
vessel and delivers the cell composition through the needles into
the localized region of the subject's heart.
[0546] An apparatus for treating asthma using neurotoxin has been
described by Deem et al and is taught for example in US Patent
Publication 20060225742, the contents of which are incorporated
herein by reference in their entirety. According to Deem, multiple
needles are incorporated into the device which delivers neurotoxin
through the needles into the bronchial tissue.
[0547] A method for administering multiple-component therapies has
been described by Nayak and is taught for example in U.S. Pat. No.
7,699,803, the contents of which are incorporated herein by
reference in their entirety. According to Nayak, multiple injection
cannulas may be incorporated into a device wherein depth slots may
be included for controlling the depth at which the therapeutic
substance is delivered within the tissue.
[0548] A surgical device for ablating a channel and delivering at
least one therapeutic agent into a desired region of the tissue has
been described by McIntyre et al and is taught for example in U.S.
Pat. No. 8,012,096, the contents of which are incorporated herein
by reference in their entirety. According to McIntyre, multiple
needles are incorporated into the device which dispenses a
therapeutic agent into a region of tissue surrounding the channel
and is particularly well suited for transmyocardial
revascularization operations.
[0549] Methods of treating functional disorders of the bladder in
mammalian females have been described by Versi et al and are taught
for example in U.S. Pat. No. 8,029,496, the contents of which are
incorporated herein by reference in their entirety. According to
Versi, an array of micro-needles is incorporated into a device
which delivers a therapeutic agent through the needles directly
into the trigone of the bladder.
[0550] A device and a method for delivering fluid into a flexible
biological barrier have been described by Yeshurun et al. and are
taught for example in U.S. Pat. No. 7,998,119 (device) and U.S.
Pat. No. 8,007,466 (method), the contents of which are incorporated
herein by reference in their entirety. According to Yeshurun, the
micro-needles on the device penetrate and extend into the flexible
biological barrier and fluid is injected through the bore of the
hollow micro-needles.
[0551] A method for epicardially injecting a substance into an area
of tissue of a heart having an epicardial surface and disposed
within a torso has been described by Bonner et al and is taught for
example in U.S. Pat. No. 7,628,780, the contents of which are
incorporated herein by reference in their entirety. According to
Bonner, the devices have elongate shafts and distal injection heads
for driving needles into tissue and injecting medical agents into
the tissue through the needles.
[0552] A device for sealing a puncture has been described by
Nielsen et al and is taught for example in U.S. Pat. No. 7,972,358,
the contents of which are incorporated herein by reference in their
entirety. According to Nielsen, multiple needles are incorporated
into the device which delivers a closure agent into the tissue
surrounding the puncture tract.
[0553] A method for myogenesis and angiogenesis has been described
by Chiu et al. and is taught for example in U.S. Pat. No.
6,551,338, the contents of which are incorporated herein by
reference in their entirety. According to Chiu, 5 to 15 needles
having a maximum diameter of at least 1.25 mm and a length
effective to provide a puncture depth of 6 to 20 mm are
incorporated into a device which inserts into proximity with a
myocardium and supplies an exogeneous angiogenic or myogenic factor
to said myocardium through the conduits which are in at least some
of said needles.
[0554] A method for the treatment of prostate tissue has been
described by Bolmsj et al. and is taught for example in U.S. Pat.
No. 6,524,270, the contents of which are incorporated herein by
reference in their entirety. According to Bolmsj, a device
comprising a catheter which is inserted through the urethra has at
least one hollow tip extendible into the surrounding prostate
tissue. An astringent and analgesic medicine is administered
through said tip into said prostate tissue.
[0555] A method for infusing fluids to an intraosseous site has
been described by Findlay et al. and is taught for example in U.S.
Pat. No. 6,761,726, the contents of which are incorporated herein
by reference in their entirety. According to Findlay, multiple
needles are incorporated into a device which is capable of
penetrating a hard shell of material covered by a layer of soft
material and delivers a fluid at a predetermined distance below
said hard shell of material.
[0556] A device for injecting medications into a vessel wall has
been described by Vigil et al. and is taught for example in U.S.
Pat. No. 5,713,863, the contents of which are incorporated herein
by reference in their entirety. According to Vigil, multiple
injectors are mounted on each of the flexible tubes in the device
which introduces a medication fluid through a multi-lumen catheter,
into said flexible tubes and out of said injectors for infusion
into the vessel wall.
[0557] A catheter for delivering therapeutic and/or diagnostic
agents to the tissue surrounding a bodily passageway has been
described by Faxon et al. and is taught for example in U.S. Pat.
No. 5,464,395, the contents of which are incorporated herein by
reference in their entirety. According to Faxon, at least one
needle cannula is incorporated into the catheter which delivers the
desired agents to the tissue through said needles which project
outboard of the catheter.
[0558] Balloon catheters for delivering therapeutic agents have
been described by Orr and are taught for example in WO2010024871,
the contents of which are incorporated herein by reference in their
entirety. According to Orr, multiple needles are incorporated into
the devices which deliver the therapeutic agents to different
depths within the tissue.
Methods and Devices Utilizing Electrical Current
[0559] Methods and devices utilizing electric current may be
employed to deliver the mmRNA of the present invention according to
the single, multi- or split dosing regimens taught herein. Such
methods and devices are described below.
[0560] An electro collagen induction therapy device has been
described by Marquez and is taught for example in US Patent
Publication 20090137945, the contents of which are incorporated
herein by reference in their entirety. According to Marquez,
multiple needles are incorporated into the device which repeatedly
pierce the skin and draw in the skin a portion of the substance
which is applied to the skin first.
[0561] An electrokinetic system has been described by Etheredge et
al. and is taught for example in US Patent Publication 20070185432,
the contents of which are incorporated herein by reference in their
entirety. According to Etheredge, micro-needles are incorporated
into a device which drives by an electrical current the medication
through the needles into the targeted treatment site.
[0562] An iontophoresis device has been described by Matsumura et
al. and is taught for example in U.S. Pat. No. 7,437,189, the
contents of which are incorporated herein by reference in their
entirety. According to Matsumura, multiple needles are incorporated
into the device which is capable of delivering ionizable drug into
a living body at higher speed or with higher efficiency.
[0563] Intradermal delivery of biologically active agents by
needle-free injection and electroporation has been described by
Hoffmann et al and is taught for example in U.S. Pat. No.
7,171,264, the contents of which are incorporated herein by
reference in their entirety. According to Hoffmann, one or more
needle-free injectors are incorporated into an electroporation
device and the combination of needle-free injection and
electroporation is sufficient to introduce the agent into cells in
skin, muscle or mucosa.
[0564] A method for electropermeabilization-mediated intracellular
delivery has been described by Lundkvist et al. and is taught for
example in U.S. Pat. No. 6,625,486, the contents of which are
incorporated herein by reference in their entirety. According to
Lundkvist, a pair of needle electrodes is incorporated into a
catheter. Said catheter is positioned into a body lumen followed by
extending said needle electrodes to penetrate into the tissue
surrounding said lumen. Then the device introduces an agent through
at least one of said needle electrodes and applies electric field
by said pair of needle electrodes to allow said agent pass through
the cell membranes into the cells at the treatment site.
[0565] A delivery system for transdermal immunization has been
described by Levin et al. and is taught for example in
WO2006003659, the contents of which are incorporated herein by
reference in their entirety. According to Levin, multiple
electrodes are incorporated into the device which applies
electrical energy between the electrodes to generate micro channels
in the skin to facilitate transdermal delivery.
[0566] A method for delivering RF energy into skin has been
described by Schomacker and is taught for example in WO2011163264,
the contents of which are incorporated herein by reference in their
entirety. According to Schomacker, multiple needles are
incorporated into a device which applies vacuum to draw skin into
contact with a plate so that needles insert into skin through the
holes on the plate and deliver RF energy.
VII. DEFINITIONS
[0567] At various places in the present specification, substituents
of compounds of the present disclosure are disclosed in groups or
in ranges. It is specifically intended that the present disclosure
include each and every individual subcombination of the members of
such groups and ranges. For example, the term "C.sub.1-6 alkyl" is
specifically intended to individually disclose methyl, ethyl,
C.sub.3 alkyl, C.sub.4 alkyl, C.sub.5 alkyl, and C.sub.6 alkyl.
[0568] About: As used herein, the term "about" means +/-10% of the
recited value.
[0569] Administered in combination: As used herein, the term
"administered in combination" or "combined administration" means
that two or more agents are administered to a subject at the same
time or within an interval such that there may be an overlap of an
effect of each agent on the patient. In some embodiments, they are
administered within about 60, 30, 15, 10, 5, or 1 minute of one
another. In some embodiments, the administrations of the agents are
spaced sufficiently closely together such that a combinatorial
(e.g., a synergistic) effect is achieved.
[0570] Animal: As used herein, the term "animal" refers to any
member of the animal kingdom. In some embodiments, "animal" refers
to humans at any stage of development. In some embodiments,
"animal" refers to non-human animals at any stage of development.
In certain embodiments, the non-human animal is a mammal (e.g., a
rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep,
cattle, a primate, or a pig). In some embodiments, animals include,
but are not limited to, mammals, birds, reptiles, amphibians, fish,
and worms. In some embodiments, the animal is a transgenic animal,
genetically-engineered animal, or a clone.
[0571] Antigens of interest or desired antigens: As used herein,
the terms "antigens of interest" or "desired antigens" include
those proteins and other biomolecules provided herein that are
immunospecifically bound by the antibodies and fragments, mutants,
variants, and alterations thereof described herein. Examples of
antigens of interest include, but are not limited to, insulin,
insulin-like growth factor, hGH, tPA, cytokines, such as
interleukins (IL), e.g., IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7,
IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17,
IL-18, interferon (IFN) alpha, IFN beta, IFN gamma, IFN omega or
IFN tau, tumor necrosis factor (TNF), such as TNF alpha and TNF
beta, TNF gamma, TRAIL; G-CSF, GM-CSF, M-CSF, MCP-1 and VEGF.
[0572] Approximately: As used herein, the term "approximately" or
"about," as applied to one or more values of interest, refers to a
value that is similar to a stated reference value. In certain
embodiments, the term "approximately" or "about" refers to a range
of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%,
13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in
either direction (greater than or less than) of the stated
reference value unless otherwise stated or otherwise evident from
the context (except where such number would exceed 100% of a
possible value).
[0573] Associated with: As used herein, the terms "associated
with," "conjugated," "linked," "attached," and "tethered," when
used with respect to two or more moieties, means that the moieties
are physically associated or connected with one another, either
directly or via one or more additional moieties that serves as a
linking agent, to form a structure that is sufficiently stable so
that the moieties remain physically associated under the conditions
in which the structure is used, e.g., physiological conditions. An
"association" need not be strictly through direct covalent chemical
bonding. It may also suggest ionic or hydrogen bonding or a
hybridization based connectivity sufficiently stable such that the
"associated" entities remain physically associated.
[0574] Bifunctional: As used herein, the term "bifunctional" refers
to any substance, molecule or moiety which is capable of or
maintains at least two functions. The functions may effect the same
outcome or a different outcome. The structure that produces the
function may be the same or different. For example, bifunctional
modified RNAs of the present invention may encode a cytotoxic
peptide (a first function) while those nucleosides which comprise
the encoding RNA are, in and of themselves, cytotoxic (second
function). In this example, delivery of the bifunctional modified
RNA to a cancer cell would produce not only a peptide or protein
molecule which may ameliorate or treat the cancer but would also
deliver a cytotoxic payload of nucleosides to the cell should
degradation, instead of translation of the modified RNA, occur.
[0575] Biocompatible: As used herein, the term "biocompatible"
means compatible with living cells, tissues, organs or systems
posing little to no risk of injury, toxicity or rejection by the
immune system.
[0576] Biodegradable: As used herein, the term "biodegradable"
means capable of being broken down into innocuous products by the
action of living things.
[0577] Biologically active: As used herein, the phrase
"biologically active" refers to a characteristic of any substance
that has activity in a biological system and/or organism. For
instance, a substance that, when administered to an organism, has a
biological effect on that organism, is considered to be
biologically active. In particular embodiments, polynucleotide,
primary construct or mmRNA of the present invention may be
considered biologically active if even a portion of the
polynucleotide, primary construct or mmRNA is biologically active
or mimics an activity considered biologically relevant.
[0578] Cancer: As used herein, the term "cancer" in a subject
refers to the presence of cells possessing characteristics, such as
uncontrolled proliferation, immortality, metastatic potential,
rapid growth and proliferation rate, and certain characteristic
morphological features. Often, cancer cells will be in the form of
a tumor, but such cells may exist alone within a subject, or may
circulate in the blood stream as independent cells, such as
leukemic cells.
[0579] Cell growth: As used herein, the term "cell growth" is
principally associated with growth in cell numbers, which occurs by
means of cell reproduction (i.e. proliferation) when the rate of
the latter is greater than the rate of cell death (e.g. by
apoptosis or necrosis).
[0580] Chemical terms: The following provides the definition of
various chemical terms from "acyl" to "thiol."
[0581] The term "acyl," as used herein, represents a hydrogen or an
alkyl group (e.g., a haloalkyl group), as defined herein, that is
attached to the parent molecular group through a carbonyl group, as
defined herein, and is exemplified by formyl (i.e., a
carboxyaldehyde group), acetyl, propionyl, butanoyl and the like.
Exemplary unsubstituted acyl groups include from 1 to 7, from 1 to
11, or from 1 to 21 carbons. In some embodiments, the alkyl group
is further substituted with 1, 2, 3, or 4 substituents as described
herein.
[0582] The term "acylamino," as used herein, represents an acyl
group, as defined herein, attached to the parent molecular group
though an amino group, as defined herein (i.e.,
--N(R.sup.N1)--C(O)--R, where R is H or an optionally substituted
C.sub.1-6, C.sub.1-10, or C.sub.1-20 alkyl group and R.sup.N1 is as
defined herein). Exemplary unsubstituted acylamino groups include
from 1 to 41 carbons (e.g., from 1 to 7, from 1 to 13, from 1 to
21, from 2 to 7, from 2 to 13, from 2 to 21, or from 2 to 41
carbons). In some embodiments, the alkyl group is further
substituted with 1, 2, 3, or 4 substituents as described herein,
and/or the amino group is --NH.sub.2 or --NHR.sup.N1, wherein
R.sup.N1 is, independently, OH, NO.sub.2, NH.sub.2,
NR.sup.N2.sub.2, SO.sub.2OR.sup.N2, SO.sub.2R.sup.N2, SOR.sup.N2,
alkyl, or aryl, and each R.sup.N2 can be H, alkyl, or aryl.
[0583] The term "acyloxy," as used herein, represents an acyl
group, as defined herein, attached to the parent molecular group
though an oxygen atom (i.e., --O--C(O)--R, where R is H or an
optionally substituted C.sub.1-6, C.sub.1-10, or C.sub.1-20 alkyl
group). Exemplary unsubstituted acyloxy groups include from 1 to 21
carbons (e.g., from 1 to 7 or from 1 to 11 carbons). In some
embodiments, the alkyl group is further substituted with 1, 2, 3,
or 4 substituents as described herein, and/or the amino group is
--NH.sub.2 or --NHR.sup.N1, wherein R.sup.N1 is, independently, OH,
NO.sub.2, NH.sub.2, NR.sup.N2.sub.2, SO.sub.2OR.sup.N2,
SO.sub.2R.sup.N2, SOR.sup.N2, alkyl, or aryl, and each R.sup.N2 can
be H, alkyl, or aryl.
[0584] The term "alkaryl," as used herein, represents an aryl
group, as defined herein, attached to the parent molecular group
through an alkylene group, as defined herein. Exemplary
unsubstituted alkaryl groups are from 7 to 30 carbons (e.g., from 7
to 16 or from 7 to 20 carbons, such as C.sub.1-6 alk-C.sub.6-10
aryl, C.sub.1-10 alk-C.sub.6-10 aryl, or C.sub.1-20 alk-C.sub.6-10
aryl). In some embodiments, the alkylene and the aryl each can be
further substituted with 1, 2, 3, or 4 substituent groups as
defined herein for the respective groups. Other groups preceded by
the prefix "alk-" are defined in the same manner, where "alk"
refers to a C.sub.1-6 alkylene, unless otherwise noted, and the
attached chemical structure is as defined herein.
[0585] The term "alkcycloalkyl" represents a cycloalkyl group, as
defined herein, attached to the parent molecular group through an
alkylene group, as defined herein (e.g., an alkylene group of from
1 to 4, from 1 to 6, from 1 to 10, or form 1 to 20 carbons). In
some embodiments, the alkylene and the cycloalkyl each can be
further substituted with 1, 2, 3, or 4 substituent groups as
defined herein for the respective group.
[0586] The term "alkenyl," as used herein, represents monovalent
straight or branched chain groups of, unless otherwise specified,
from 2 to 20 carbons (e.g., from 2 to 6 or from 2 to 10 carbons)
containing one or more carbon-carbon double bonds and is
exemplified by ethenyl, 1-propenyl, 2-propenyl,
2-methyl-1-propenyl, 1-butenyl, 2-butenyl, and the like. Alkenyls
include both cis and trans isomers. Alkenyl groups may be
optionally substituted with 1, 2, 3, or 4 substituent groups that
are selected, independently, from amino, aryl, cycloalkyl, or
heterocyclyl (e.g., heteroaryl), as defined herein, or any of the
exemplary alkyl substituent groups described herein.
[0587] The term "alkenyloxy" represents a chemical substituent of
formula --OR, where R is a C.sub.2-20 alkenyl group (e.g.,
C.sub.2-6 or C.sub.2-10 alkenyl), unless otherwise specified.
Exemplary alkenyloxy groups include ethenyloxy, propenyloxy, and
the like. In some embodiments, the alkenyl group can be further
substituted with 1, 2, 3, or 4 substituent groups as defined herein
(e.g., a hydroxy group).
[0588] The term "alkheteroaryl" refers to a heteroaryl group, as
defined herein, attached to the parent molecular group through an
alkylene group, as defined herein. Exemplary unsubstituted
alkheteroaryl groups are from 2 to 32 carbons (e.g., from 2 to 22,
from 2 to 18, from 2 to 17, from 2 to 16, from 3 to 15, from 2 to
14, from 2 to 13, or from 2 to 12 carbons, such as C.sub.1-6
alk-C.sub.1-12 heteroaryl, C.sub.1-10 alk-C.sub.1-12 heteroaryl, or
C.sub.1-20 alk-C.sub.1-12 heteroaryl). In some embodiments, the
alkylene and the heteroaryl each can be further substituted with 1,
2, 3, or 4 substituent groups as defined herein for the respective
group. Alkheteroaryl groups are a subset of alkheterocyclyl
groups.
[0589] The term "alkheterocyclyl" represents a heterocyclyl group,
as defined herein, attached to the parent molecular group through
an alkylene group, as defined herein. Exemplary unsubstituted
alkheterocyclyl groups are from 2 to 32 carbons (e.g., from 2 to
22, from 2 to 18, from 2 to 17, from 2 to 16, from 3 to 15, from 2
to 14, from 2 to 13, or from 2 to 12 carbons, such as C.sub.1-6
alk-C.sub.1-12 heterocyclyl, C.sub.1-10 alk-C.sub.1-12
heterocyclyl, or C.sub.1-20 alk-C.sub.1-12 heterocyclyl). In some
embodiments, the alkylene and the heterocyclyl each can be further
substituted with 1, 2, 3, or 4 substituent groups as defined herein
for the respective group.
[0590] The term "alkoxy" represents a chemical substituent of
formula --OR, where R is a C.sub.1-20 alkyl group (e.g., C.sub.1-6
or C.sub.1-10 alkyl), unless otherwise specified. Exemplary alkoxy
groups include methoxy, ethoxy, propoxy (e.g., n-propoxy and
isopropoxy), t-butoxy, and the like. In some embodiments, the alkyl
group can be further substituted with 1, 2, 3, or 4 substituent
groups as defined herein (e.g., hydroxy or alkoxy).
[0591] The term "alkoxyalkoxy" represents an alkoxy group that is
substituted with an alkoxy group. Exemplary unsubstituted
alkoxyalkoxy groups include between 2 to 40 carbons (e.g., from 2
to 12 or from 2 to 20 carbons, such as C.sub.1-6 alkoxy-C.sub.1-6
alkoxy, C.sub.1-10 alkoxy-C.sub.1-10 alkoxy, or C.sub.1-20
alkoxy-C.sub.1-20 alkoxy). In some embodiments, the each alkoxy
group can be further substituted with 1, 2, 3, or 4 substituent
groups as defined herein.
[0592] The term "alkoxyalkyl" represents an alkyl group that is
substituted with an alkoxy group. Exemplary unsubstituted
alkoxyalkyl groups include between 2 to 40 carbons (e.g., from 2 to
12 or from 2 to 20 carbons, such as C.sub.1-6 alkoxy-C.sub.1-6
alkyl, C.sub.1-10 alkoxy-C.sub.1-10 alkyl, or C.sub.1-20
alkoxy-C.sub.1-20 alkyl). In some embodiments, the alkyl and the
alkoxy each can be further substituted with 1, 2, 3, or 4
substituent groups as defined herein for the respective group.
[0593] The term "alkoxycarbonyl," as used herein, represents an
alkoxy, as defined herein, attached to the parent molecular group
through a carbonyl atom (e.g., --C(O)--OR, where R is H or an
optionally substituted C.sub.1-6, C.sub.1-10, or C.sub.1-20 alkyl
group). Exemplary unsubstituted alkoxycarbonyl include from 1 to 21
carbons (e.g., from 1 to 11 or from 1 to 7 carbons). In some
embodiments, the alkoxy group is further substituted with 1, 2, 3,
or 4 substituents as described herein.
[0594] The term "alkoxycarbonylalkoxy," as used herein, represents
an alkoxy group, as defined herein, that is substituted with an
alkoxycarbonyl group, as defined herein (e.g., --O-alkyl-C(O)--OR,
where R is an optionally substituted C.sub.1-6, C.sub.1-10, or
C.sub.1-20 alkyl group). Exemplary unsubstituted
alkoxycarbonylalkoxy include from 3 to 41 carbons (e.g., from 3 to
10, from 3 to 13, from 3 to 17, from 3 to 21, or from 3 to 31
carbons, such as C.sub.1-6 alkoxycarbonyl-C.sub.1-6 alkoxy,
C.sub.1-10 alkoxycarbonyl-C.sub.1-10 alkoxy, or C.sub.1-20
alkoxycarbonyl-C.sub.1-20 alkoxy). In some embodiments, each alkoxy
group is further independently substituted with 1, 2, 3, or 4
substituents, as described herein (e.g., a hydroxy group).
[0595] The term "alkoxycarbonylalkyl," as used herein, represents
an alkyl group, as defined herein, that is substituted with an
alkoxycarbonyl group, as defined herein (e.g., -alkyl-C(O)--OR,
where R is an optionally substituted C.sub.1-20, C.sub.1-10, or
C.sub.1-6 alkyl group). Exemplary unsubstituted alkoxycarbonylalkyl
include from 3 to 41 carbons (e.g., from 3 to 10, from 3 to 13,
from 3 to 17, from 3 to 21, or from 3 to 31 carbons, such as
C.sub.1-6 alkoxycarbonyl-C.sub.1-6 alkyl, C.sub.1-10
alkoxycarbonyl-C.sub.1-10 alkyl, or C.sub.1-20
alkoxycarbonyl-C.sub.1-20 alkyl). In some embodiments, each alkyl
and alkoxy group is further independently substituted with 1, 2, 3,
or 4 substituents as described herein (e.g., a hydroxy group).
[0596] The term "alkyl," as used herein, is inclusive of both
straight chain and branched chain saturated groups from 1 to 20
carbons (e.g., from 1 to 10 or from 1 to 6), unless otherwise
specified. Alkyl groups are exemplified by methyl, ethyl, n- and
iso-propyl, n-, sec-, iso- and tert-butyl, neopentyl, and the like,
and may be optionally substituted with one, two, three, or, in the
case of alkyl groups of two carbons or more, four substituents
independently selected from the group consisting of: (1) C.sub.1-6
alkoxy; (2) C.sub.1-6 alkylsulfinyl; (3) amino, as defined herein
(e.g., unsubstituted amino (i.e., --NH.sub.2) or a substituted
amino (i.e., --N(R.sup.N1).sub.2, where R.sup.N1 is as defined for
amino); (4) C.sub.6-10 aryl-C.sub.1-6 alkoxy; (5) azido; (6) halo;
(7) (C.sub.2-9 heterocyclyl)oxy; (8) hydroxy; (9) nitro; (10) oxo
(e.g., carboxyaldehyde or acyl); (11) C.sub.1-7 spirocyclyl; (12)
thioalkoxy; (13) thiol; (14) --CO.sub.2R.sup.A', where R.sup.A' is
selected from the group consisting of (a) C.sub.1-20 alkyl (e.g.,
C.sub.1-6 alkyl), (b) C.sub.2-20 alkenyl (e.g., C.sub.2-6 alkenyl),
(c) C.sub.6-10 aryl, (d) hydrogen, (e) C.sub.1-6 alk-C.sub.6-10
aryl, (f) amino-C.sub.1-20 alkyl, (g) polyethylene glycol of
--(CH.sub.2).sub.s2(OCH.sub.2CH.sub.2).sub.s1(CH.sub.2).sub.s3OR',
wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6 or from 1
to 4), each of s2 and s3, independently, is an integer from 0 to 10
(e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1 to 6, or from
1 to 10), and R' is H or C.sub.1-20 alkyl, and (h)
amino-polyethylene glycol of
--NR.sup.N1(CH.sub.2).sub.s2(CH.sub.2CH.sub.2O).sub.s1(CH.sub.2).sub.s3NR-
.sup.N1, wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6
or from 1 to 4), each of s2 and s3, independently, is an integer
from 0 to 10 (e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1
to 6, or from 1 to 10), and each R.sup.N1 is, independently,
hydrogen or optionally substituted C.sub.1-6 alkyl; (15)
--C(O)NR.sup.B'R.sup.C', where each of R.sup.B' and R.sup.C' is,
independently, selected from the group consisting of (a) hydrogen,
(b) C.sub.1-6 alkyl, (c) C.sub.6-10 aryl, and (d) C.sub.1-6
alk-C.sub.6-10 aryl; (16) --SO.sub.2R.sup.D', where R.sup.D' is
selected from the group consisting of (a) C.sub.1-6 alkyl, (b)
C.sub.6-10 aryl, (c) C.sub.1-6 alk-C.sub.6-10 aryl, and (d)
hydroxy; (17) --SO.sub.2NR.sup.E'R.sup.F', where each of R.sup.E'
and R.sup.F' is, independently, selected from the group consisting
of (a) hydrogen, (b) C.sub.1-6 alkyl, (c) C.sub.6-10 aryl and (d)
C.sub.1-6 alk-C.sub.6-10 aryl; (18) --C(O)R.sup.G', where R.sup.G'
is selected from the group consisting of (a) C.sub.1-20 alkyl
(e.g., C.sub.1-6 alkyl), (b) C.sub.2-20 alkenyl (e.g., C.sub.2-6
alkenyl), (c) C.sub.6-10 aryl, (d) hydrogen, (e) C.sub.1-6
alk-C.sub.6-10 aryl, (f) amino-C.sub.1-20 alkyl, (g) polyethylene
glycol of
--(CH.sub.2).sub.s2(OCH.sub.2CH.sub.2).sub.s1(CH.sub.2).sub.s3OR',
wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6 or from 1
to 4), each of s2 and s3, independently, is an integer from 0 to 10
(e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1 to 6, or from
1 to 10), and R' is H or C.sub.1-20 alkyl, and (h)
amino-polyethylene glycol of
--NR.sup.N1(CH.sub.2).sub.s2(CH.sub.2CH.sub.2O).sub.s1(CH.sub.2).sub.s3NR-
.sup.N1, wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6
or from 1 to 4), each of s2 and s3, independently, is an integer
from 0 to 10 (e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1
to 6, or from 1 to 10), and each R.sup.N1 is, independently,
hydrogen or optionally substituted C.sub.1-6 alkyl; (19)
--NR.sup.H'C(O)R.sup.I', wherein R.sup.H' is selected from the
group consisting of (a1) hydrogen and (b1) C.sub.1-6 alkyl, and
R.sup.I' is selected from the group consisting of (a2) C.sub.1-20
alkyl (e.g., C.sub.1-6 alkyl), (b2) C.sub.2-20 alkenyl (e.g.,
C.sub.2-6 alkenyl), (c2) C.sub.6-10 aryl, (d2) hydrogen, (e2)
C.sub.1-6 alk-C.sub.6-10 aryl, (f2) amino-C.sub.1-20 alkyl, (g2)
polyethylene glycol of
--(CH.sub.2).sub.s2(OCH.sub.2CH.sub.2).sub.s1(CH.sub.2).sub.s3OR',
wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6 or from 1
to 4), each of s2 and s3, independently, is an integer from 0 to 10
(e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1 to 6, or from
1 to 10), and R' is H or C.sub.1-20 alkyl, and (h2)
amino-polyethylene glycol of
--NR.sup.N1(CH.sub.2).sub.s2(CH.sub.2CH.sub.2O).sub.s1(CH.sub.2).sub.s3NR-
.sup.N1, wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6
or from 1 to 4), each of s2 and s3, independently, is an integer
from 0 to 10 (e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1
to 6, or from 1 to 10), and each R.sup.N1 is, independently,
hydrogen or optionally substituted C.sub.1-6 alkyl; (20)
--NR.sup.J'C(O)OR.sup.K', wherein R.sup.J' is selected from the
group consisting of (a1) hydrogen and (b1) C.sub.1-6 alkyl, and
R.sup.K' is selected from the group consisting of (a2) C.sub.1-20
alkyl (e.g., C.sub.1-6 alkyl), (b2) C.sub.2-20 alkenyl (e.g.,
C.sub.2-6 alkenyl), (c2) C.sub.6-10 aryl, (d2) hydrogen, (e2)
C.sub.1-6 alk-C.sub.6-10 aryl, (f2) amino-C.sub.1-20 alkyl, (g2)
polyethylene glycol of
--(CH.sub.2).sub.s2(OCH.sub.2CH.sub.2).sub.s1(CH.sub.2).sub.s3OR',
wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6 or from 1
to 4), each of s2 and s3, independently, is an integer from 0 to 10
(e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1 to 6, or from
1 to 10), and R' is H or C.sub.1-20 alkyl, and (h2)
amino-polyethylene glycol of
--NR.sup.N1(CH.sub.2).sub.s2(CH.sub.2CH.sub.2O).sub.s1(CH.sub.2).sub.s3NR-
.sup.N1, wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6
or from 1 to 4), each of s2 and s3, independently, is an integer
from 0 to 10 (e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1
to 6, or from 1 to 10), and each R.sup.N1 is, independently,
hydrogen or optionally substituted C.sub.1-6 alkyl; and (21)
amidine. In some embodiments, each of these groups can be further
substituted as described herein. For example, the alkylene group of
a C.sub.1-alkaryl can be further substituted with an oxo group to
afford the respective aryloyl substituent.
[0597] The term "alkylene" and the prefix "alk-," as used herein,
represent a saturated divalent hydrocarbon group derived from a
straight or branched chain saturated hydrocarbon by the removal of
two hydrogen atoms, and is exemplified by methylene, ethylene,
isopropylene, and the like. The term "C.sub.x-y alkylene" and the
prefix "C.sub.x-y alk-" represent alkylene groups having between x
and y carbons. Exemplary values for x are 1, 2, 3, 4, 5, and 6, and
exemplary values for y are 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16,
18, or 20 (e.g., C.sub.1-6, C.sub.1-10, C.sub.2-20, C.sub.2-6,
C.sub.2-10, or C.sub.2-20 alkylene). In some embodiments, the
alkylene can be further substituted with 1, 2, 3, or 4 substituent
groups as defined herein for an alkyl group.
[0598] The term "alkylsulfinyl," as used herein, represents an
alkyl group attached to the parent molecular group through an
--S(O)-- group. Exemplary unsubstituted alkylsulfinyl groups are
from 1 to 6, from 1 to 10, or from 1 to 20 carbons. In some
embodiments, the alkyl group can be further substituted with 1, 2,
3, or 4 substituent groups as defined herein.
[0599] The term "alkylsulfinylalkyl," as used herein, represents an
alkyl group, as defined herein, substituted by an alkylsulfinyl
group. Exemplary unsubstituted alkylsulfinylalkyl groups are from 2
to 12, from 2 to 20, or from 2 to 40 carbons. In some embodiments,
each alkyl group can be further substituted with 1, 2, 3, or 4
substituent groups as defined herein.
[0600] The term "alkynyl," as used herein, represents monovalent
straight or branched chain groups from 2 to 20 carbon atoms (e.g.,
from 2 to 4, from 2 to 6, or from 2 to 10 carbons) containing a
carbon-carbon triple bond and is exemplified by ethynyl,
1-propynyl, and the like. Alkynyl groups may be optionally
substituted with 1, 2, 3, or 4 substituent groups that are
selected, independently, from aryl, cycloalkyl, or heterocyclyl
(e.g., heteroaryl), as defined herein, or any of the exemplary
alkyl substituent groups described herein.
[0601] The term "alkynyloxy" represents a chemical substituent of
formula --OR, where R is a C.sub.2-20 alkynyl group (e.g.,
C.sub.2-6 or C.sub.2-10 alkynyl), unless otherwise specified.
Exemplary alkynyloxy groups include ethynyloxy, propynyloxy, and
the like. In some embodiments, the alkynyl group can be further
substituted with 1, 2, 3, or 4 substituent groups as defined herein
(e.g., a hydroxy group).
[0602] The term "amidine," as used herein, represents a
--C(.dbd.NH)NH.sub.2 group.
[0603] The term "amino," as used herein, represents
--N(R.sup.N1).sub.2, wherein each R.sup.N1 is, independently, H,
OH, NO.sub.2, N(R.sup.N2).sub.2, SO.sub.2OR.sup.N2,
SO.sub.2R.sup.N2, SOR.sup.N2, an N-protecting group, alkyl,
alkenyl, alkynyl, alkoxy, aryl, alkaryl, cycloalkyl, alkcycloalkyl,
carboxyalkyl, sulfoalkyl, heterocyclyl (e.g., heteroaryl), or
alkheterocyclyl (e.g., alkheteroaryl), wherein each of these
recited R.sup.N1 groups can be optionally substituted, as defined
herein for each group; or two R.sup.N1 combine to form a
heterocyclyl or an N-protecting group, and wherein each R.sup.N2
is, independently, H, alkyl, or aryl. The amino groups of the
invention can be an unsubstituted amino (i.e., --NH.sub.2) or a
substituted amino (i.e., --N(R.sup.N1).sub.2). In a preferred
embodiment, amino is --NH.sub.2 or --NHR.sup.N1, wherein R.sup.N1
is, independently, OH, NO.sub.2, NH.sub.2, NR.sup.N2.sub.2,
SO.sub.2OR.sup.N2, SO.sub.2R.sup.N2, SOR.sup.N2, alkyl,
carboxyalkyl, sulfoalkyl, or aryl, and each R.sup.N2 can be H,
C.sub.1-20 alkyl (e.g., C.sub.1-6 alkyl), or C.sub.6-10 aryl.
[0604] The term "amino acid," as described herein, refers to a
molecule having a side chain, an amino group, and an acid group
(e.g., a carboxy group of --CO.sub.2H or a sulfo group of
--SO.sub.3H), wherein the amino acid is attached to the parent
molecular group by the side chain, amino group, or acid group
(e.g., the side chain). In some embodiments, the amino acid is
attached to the parent molecular group by a carbonyl group, where
the side chain or amino group is attached to the carbonyl group.
Exemplary side chains include an optionally substituted alkyl,
aryl, heterocyclyl, alkaryl, alkheterocyclyl, aminoalkyl,
carbamoylalkyl, and carboxyalkyl. Exemplary amino acids include
alanine, arginine, asparagine, aspartic acid, cysteine, glutamic
acid, glutamine, glycine, histidine, hydroxynorvaline, isoleucine,
leucine, lysine, methionine, norvaline, ornithine, phenylalanine,
proline, pyrolysine, selenocysteine, serine, taurine, threonine,
tryptophan, tyrosine, and valine. Amino acid groups may be
optionally substituted with one, two, three, or, in the case of
amino acid groups of two carbons or more, four substituents
independently selected from the group consisting of: (1) C.sub.1-6
alkoxy; (2) C.sub.1-6 alkylsulfinyl; (3) amino, as defined herein
(e.g., unsubstituted amino (i.e., --NH.sub.2) or a substituted
amino (i.e., --N(R.sup.N1).sub.2, where R.sup.N1 is as defined for
amino); (4) C.sub.6-10 aryl-C.sub.1-6 alkoxy; (5) azido; (6) halo;
(7) (C.sub.2-9 heterocyclyl)oxy; (8) hydroxy; (9) nitro; (10) oxo
(e.g., carboxyaldehyde or acyl); (11) C.sub.1-7 spirocyclyl; (12)
thioalkoxy; (13) thiol; (14) --CO.sub.2R.sup.A', where R.sup.A' is
selected from the group consisting of (a) C.sub.1-20 alkyl (e.g.,
C.sub.1-6 alkyl), (b) C.sub.2-20 alkenyl (e.g., C.sub.2-6 alkenyl),
(c) C.sub.6-10 aryl, (d) hydrogen, (e) C.sub.1-6 alk-C.sub.6-10
aryl, (f) amino-C.sub.1-20 alkyl, (g) polyethylene glycol of
--(CH.sub.2).sub.s2(OCH.sub.2CH.sub.2).sub.s1(CH.sub.2).sub.s3OR',
wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6 or from 1
to 4), each of s2 and s3, independently, is an integer from 0 to 10
(e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1 to 6, or from
1 to 10), and R' is H or C.sub.1-20 alkyl, and (h)
amino-polyethylene glycol of
--NR.sup.N1(CH.sub.2).sub.s2(CH.sub.2CH.sub.2O).sub.s1(CH.sub.2).sub.s3NR-
.sup.N1, wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6
or from 1 to 4), each of s2 and s3, independently, is an integer
from 0 to 10 (e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1
to 6, or from 1 to 10), and each R.sup.N1 is, independently,
hydrogen or optionally substituted C.sub.1-6 alkyl; (15)
--C(O)NR.sup.B'R.sup.C', where each of R.sup.B' and R.sup.C' is,
independently, selected from the group consisting of (a) hydrogen,
(b) C.sub.1-6 alkyl, (c) C.sub.6-10 aryl, and (d) C.sub.1-6
alk-C.sub.6-10 aryl; (16) --SO.sub.2R.sup.D', where R.sup.D' is
selected from the group consisting of (a) C.sub.1-6 alkyl, (b)
C.sub.6-10 aryl, (c) C.sub.1-6 alk-C.sub.6-10 aryl, and (d)
hydroxy; (17) --SO.sub.2NR.sup.E'R.sup.F', where each of R.sup.E'
and R.sup.F' is, independently, selected from the group consisting
of (a) hydrogen, (b) C.sub.1-6 alkyl, (c) C.sub.6-10 aryl and (d)
C.sub.1-6 alk-C.sub.6-10 aryl; (18) --C(O)R.sup.G', where R.sup.G'
is selected from the group consisting of (a) C.sub.1-20 alkyl
(e.g., C.sub.1-6 alkyl), (b) C.sub.2-20 alkenyl (e.g., C.sub.2-6
alkenyl), (c) C.sub.6-10 aryl, (d) hydrogen, (e) C.sub.1-6
alk-C.sub.6-10 aryl, (f) amino-C.sub.1-20 alkyl, (g) polyethylene
glycol of
--(CH.sub.2).sub.s2(OCH.sub.2CH.sub.2).sub.s1(CH.sub.2).sub.s3OR',
wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6 or from 1
to 4), each of s2 and s3, independently, is an integer from 0 to 10
(e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1 to 6, or from
1 to 10), and R' is H or C.sub.1-20 alkyl, and (h)
amino-polyethylene glycol of
--NR.sup.N1(CH.sub.2).sub.s2(CH.sub.2CH.sub.2O).sub.s1(CH.sub.2).sub.s3NR-
.sup.N1, wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6
or from 1 to 4), each of s2 and s3, independently, is an integer
from 0 to 10 (e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1
to 6, or from 1 to 10), and each R.sup.N1 is, independently,
hydrogen or optionally substituted C.sub.1-6 alkyl; (19)
--NR.sup.H'C(O)R.sup.I', wherein R.sup.H' is selected from the
group consisting of (a1) hydrogen and (b1) C.sub.1-6 alkyl, and
R.sup.I' is selected from the group consisting of (a2) C.sub.1-20
alkyl (e.g., C.sub.1-6 alkyl), (b2) C.sub.2-20 alkenyl (e.g.,
C.sub.2-6 alkenyl), (c2) C.sub.6-10 aryl, (d2) hydrogen, (e2)
C.sub.1-6 alk-C.sub.6-10 aryl, (f2) amino-C.sub.1-20 alkyl, (g2)
polyethylene glycol of
--(CH.sub.2).sub.s2(OCH.sub.2CH.sub.2).sub.s1(CH.sub.2).sub.s3OR',
wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6 or from 1
to 4), each of s2 and s3, independently, is an integer from 0 to 10
(e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1 to 6, or from
1 to 10), and R' is H or C.sub.1-20 alkyl, and (h2)
amino-polyethylene glycol of
--NR.sup.N1(CH.sub.2).sub.s2(CH.sub.2CH.sub.2O).sub.s1(CH.sub.2).sub.s3NR-
.sup.N1, wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6
or from 1 to 4), each of s2 and s3, independently, is an integer
from 0 to 10 (e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1
to 6, or from 1 to 10), and each R.sup.N1 is, independently,
hydrogen or optionally substituted C.sub.1-6 alkyl; (20)
--NR.sup.J'C(O)OR.sup.K', wherein R.sup.J' is selected from the
group consisting of (a1) hydrogen and (b1) C.sub.1-6 alkyl, and
R.sup.K' is selected from the group consisting of (a2) C.sub.1-20
alkyl (e.g., C.sub.1-6 alkyl), (b2) C.sub.2-20 alkenyl (e.g.,
C.sub.2-6 alkenyl), (c2) C.sub.6-10 aryl, (d2) hydrogen, (e2)
C.sub.1-6 alk-C.sub.6-10 aryl, (f2) amino-C.sub.1-20 alkyl, (g2)
polyethylene glycol of
--(CH.sub.2).sub.s2(OCH.sub.2CH.sub.2).sub.s1(CH.sub.2).sub.s3OR',
wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6 or from 1
to 4), each of s2 and s3, independently, is an integer from 0 to 10
(e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1 to 6, or from
1 to 10), and R' is H or C.sub.1-20 alkyl, and (h2)
amino-polyethylene glycol of
--NR.sup.N1(CH.sub.2).sub.s2(CH.sub.2CH.sub.2O).sub.s1(CH.sub.2).sub.s3NR-
.sup.N1, wherein s1 is an integer from 1 to 10 (e.g., from 1 to 6
or from 1 to 4), each of s2 and s3, independently, is an integer
from 0 to 10 (e.g., from 0 to 4, from 0 to 6, from 1 to 4, from 1
to 6, or from 1 to 10), and each R.sup.N1 is, independently,
hydrogen or optionally substituted C.sub.1-6 alkyl; and (21)
amidine. In some embodiments, each of these groups can be further
substituted as described herein.
[0605] The term "aminoalkoxy," as used herein, represents an alkoxy
group, as defined herein, substituted by an amino group, as defined
herein. The alkyl and amino each can be further substituted with 1,
2, 3, or 4 substituent groups as described herein for the
respective group (e.g., CO.sub.2R.sup.A', where R.sup.A' is
selected from the group consisting of (a) C.sub.1-6 alkyl, (b)
C.sub.6-10 aryl, (c) hydrogen, and (d) C.sub.1-6 alk-C.sub.6-10
aryl, e.g., carboxy).
[0606] The term "aminoalkyl," as used herein, represents an alkyl
group, as defined herein, substituted by an amino group, as defined
herein. The alkyl and amino each can be further substituted with 1,
2, 3, or 4 substituent groups as described herein for the
respective group (e.g., CO.sub.2R.sup.A', where R.sup.A' is
selected from the group consisting of (a) C.sub.1-6 alkyl, (b)
C.sub.6-10 aryl, (c) hydrogen, and (d) C.sub.1-6 alk-C.sub.6-10
aryl, e.g., carboxy).
[0607] The term "aryl," as used herein, represents a mono-,
bicyclic, or multicyclic carbocyclic ring system having one or two
aromatic rings and is exemplified by phenyl, naphthyl,
1,2-dihydronaphthyl, 1,2,3,4-tetrahydronaphthyl, anthracenyl,
phenanthrenyl, fluorenyl, indanyl, indenyl, and the like, and may
be optionally substituted with 1, 2, 3, 4, or 5 substituents
independently selected from the group consisting of: (1) C.sub.1-7
acyl (e.g., carboxyaldehyde); (2) C.sub.1-20 alkyl (e.g., C.sub.1-6
alkyl, C.sub.1-6 alkoxy-C.sub.1-6 alkyl, C.sub.1-6
alkylsulfinyl-C.sub.1-6 alkyl, amino-C.sub.1-6 alkyl,
azido-C.sub.1-6 alkyl, (carboxyaldehyde)-C.sub.1-6 alkyl,
halo-C.sub.1-6 alkyl (e.g., perfluoroalkyl), hydroxy-C.sub.1-6
alkyl, nitro-C.sub.1-6 alkyl, or C.sub.1-6 thioalkoxy-C.sub.1-6
alkyl); (3) C.sub.1-20 alkoxy (e.g., C.sub.1-6 alkoxy, such as
perfluoroalkoxy); (4) C.sub.1-6 alkylsulfinyl; (5) C.sub.6-10 aryl;
(6) amino; (7) C.sub.1-6 alk-C.sub.6-10 aryl; (8) azido; (9)
C.sub.3-8 cycloalkyl; (10) C.sub.1-6 alk-C.sub.3-8 cycloalkyl; (11)
halo; (12) C.sub.1-12 heterocyclyl (e.g., C.sub.1-12 heteroaryl);
(13) (C.sub.1-12 heterocyclyl)oxy; (14) hydroxy; (15) nitro; (16)
C.sub.1-20 thioalkoxy (e.g., C.sub.1-6 thioalkoxy); (17)
--(CH.sub.2).sub.qCO.sub.2R.sup.A', where q is an integer from zero
to four, and R.sup.A' is selected from the group consisting of (a)
C.sub.1-6 alkyl, (b) C.sub.6-10 aryl, (c) hydrogen, and (d)
C.sub.1-6 alk-C.sub.6-10 aryl; (18)
--(CH.sub.2).sub.qCONR.sup.B'R.sup.C', where q is an integer from
zero to four and where R.sup.B' and R.sup.C' are independently
selected from the group consisting of (a) hydrogen, (b) C.sub.1-6
alkyl, (c) C.sub.6-10 aryl, and (d) C.sub.1-6 alk-C.sub.6-10 aryl;
(19) --(CH.sub.2).sub.qSO.sub.2R.sup.D', where q is an integer from
zero to four and where R.sup.D' is selected from the group
consisting of (a) alkyl, (b) C.sub.6-10 aryl, and (c)
alk-C.sub.6-10 aryl; (20)
--(CH.sub.2).sub.qSO.sub.2NR.sup.E'R.sup.F', where q is an integer
from zero to four and where each of R.sup.E' and R.sup.F' is,
independently, selected from the group consisting of (a) hydrogen,
(b) C.sub.1-6 alkyl, (c) C.sub.6-10 aryl, and (d) C.sub.1-6
alk-C.sub.6-10 aryl; (21) thiol; (22) C.sub.6-10 aryloxy; (23)
C.sub.3-8 cycloalkoxy; (24) C.sub.6-10 aryl-C.sub.1-6 alkoxy; (25)
C.sub.1-6 alk-C.sub.1-12 heterocyclyl (e.g., C.sub.1-6
alk-C.sub.1-12 heteroaryl); (26) C.sub.2-20 alkenyl; and (27)
C.sub.2-20 alkynyl. In some embodiments, each of these groups can
be further substituted as described herein. For example, the
alkylene group of a C.sub.1-alkaryl or a C.sub.1-alkheterocyclyl
can be further substituted with an oxo group to afford the
respective aryloyl and (heterocyclyl)oyl substituent group.
[0608] The term "arylalkoxy," as used herein, represents an alkaryl
group, as defined herein, attached to the parent molecular group
through an oxygen atom. Exemplary unsubstituted alkoxyalkyl groups
include from 7 to 30 carbons (e.g., from 7 to 16 or from 7 to 20
carbons, such as C.sub.6-10 aryl-C.sub.1-6 alkoxy, C.sub.6-10
aryl-C.sub.1-10 alkoxy, or C.sub.6-10 aryl-C.sub.1-20 alkoxy). In
some embodiments, the arylalkoxy group can be substituted with 1,
2, 3, or 4 substituents as defined herein
[0609] The term "aryloxy" represents a chemical substituent of
formula --OR', where R' is an aryl group of 6 to 18 carbons, unless
otherwise specified. In some embodiments, the aryl group can be
substituted with 1, 2, 3, or 4 substituents as defined herein.
[0610] The term "aryloyl," as used herein, represents an aryl
group, as defined herein, that is attached to the parent molecular
group through a carbonyl group. Exemplary unsubstituted aryloyl
groups are of 7 to 11 carbons. In some embodiments, the aryl group
can be substituted with 1, 2, 3, or 4 substituents as defined
herein.
[0611] The term "azido" represents an --N.sub.3 group, which can
also be represented as --N.dbd.N.dbd.N.
[0612] The term "bicyclic," as used herein, refer to a structure
having two rings, which may be aromatic or non-aromatic. Bicyclic
structures include spirocyclyl groups, as defined herein, and two
rings that share one or more bridges, where such bridges can
include one atom or a chain including two, three, or more atoms.
Exemplary bicyclic groups include a bicyclic carbocyclyl group,
where the first and second rings are carbocyclyl groups, as defined
herein; a bicyclic aryl groups, where the first and second rings
are aryl groups, as defined herein; bicyclic heterocyclyl groups,
where the first ring is a heterocyclyl group and the second ring is
a carbocyclyl (e.g., aryl) or heterocyclyl (e.g., heteroaryl)
group; and bicyclic heteroaryl groups, where the first ring is a
heteroaryl group and the second ring is a carbocyclyl (e.g., aryl)
or heterocyclyl (e.g., heteroaryl) group. In some embodiments, the
bicyclic group can be substituted with 1, 2, 3, or 4 substituents
as defined herein for cycloalkyl, heterocyclyl, and aryl
groups.
[0613] The terms "carbocyclic" and "carbocyclyl," as used herein,
refer to an optionally substituted C.sub.3-12 monocyclic, bicyclic,
or tricyclic structure in which the rings, which may be aromatic or
non-aromatic, are formed by carbon atoms. Carbocyclic structures
include cycloalkyl, cycloalkenyl, and aryl groups.
[0614] The term "carbamoyl," as used herein, represents
--C(O)--N(R.sup.N1).sub.2, where the meaning of each R.sup.N1 is
found in the definition of "amino" provided herein.
[0615] The term "carbamoylalkyl," as used herein, represents an
alkyl group, as defined herein, substituted by a carbamoyl group,
as defined herein. The alkyl group can be further substituted with
1, 2, 3, or 4 substituent groups as described herein.
[0616] The term "carbamyl," as used herein, refers to a carbamate
group having the structure --NR.sup.N1C(.dbd.O)OR or
--OC(.dbd.O)N(R.sup.N1).sub.2, where the meaning of each R.sup.N1
is found in the definition of "amino" provided herein, and R is
alkyl, cycloalkyl, alkcycloalkyl, aryl, alkaryl, heterocyclyl
(e.g., heteroaryl), or alkheterocyclyl (e.g., alkheteroaryl), as
defined herein.
[0617] The term "carbonyl," as used herein, represents a C(O)
group, which can also be represented as C.dbd.O.
[0618] The term "carboxyaldehyde" represents an acyl group having
the structure --CHO.
[0619] The term "carboxy," as used herein, means --CO.sub.2H.
[0620] The term "carboxyalkoxy," as used herein, represents an
alkoxy group, as defined herein, substituted by a carboxy group, as
defined herein. The alkoxy group can be further substituted with 1,
2, 3, or 4 substituent groups as described herein for the alkyl
group.
[0621] The term "carboxyalkyl," as used herein, represents an alkyl
group, as defined herein, substituted by a carboxy group, as
defined herein. The alkyl group can be further substituted with 1,
2, 3, or 4 substituent groups as described herein.
[0622] The term "cyano," as used herein, represents an --CN
group.
[0623] The term "cycloalkoxy" represents a chemical substituent of
formula --OR, where R is a C.sub.3-8 cycloalkyl group, as defined
herein, unless otherwise specified. The cycloalkyl group can be
further substituted with 1, 2, 3, or 4 substituent groups as
described herein. Exemplary unsubstituted cycloalkoxy groups are
from 3 to 8 carbons. In some embodiment, the cycloalkyl group can
be further substituted with 1, 2, 3, or 4 substituent groups as
described herein.
[0624] The term "cycloalkyl," as used herein represents a
monovalent saturated or unsaturated non-aromatic cyclic hydrocarbon
group from three to eight carbons, unless otherwise specified, and
is exemplified by cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl,
cycloheptyl, bicyclo[2.2.1.]heptyl, and the like. When the
cycloalkyl group includes one carbon-carbon double bond, the
cycloalkyl group can be referred to as a "cycloalkenyl" group.
Exemplary cycloalkenyl groups include cyclopentenyl, cyclohexenyl,
and the like. The cycloalkyl groups of this invention can be
optionally substituted with: (1) C.sub.1-7 acyl (e.g.,
carboxyaldehyde); (2) C.sub.1-20 alkyl (e.g., C.sub.1-6 alkyl,
C.sub.1-6 alkoxy-C.sub.1-6 alkyl, C.sub.1-6 alkylsulfinyl-C.sub.1-6
alkyl, amino-C.sub.1-6 alkyl, azido-C.sub.1-6 alkyl,
(carboxyaldehyde)-C.sub.1-6 alkyl, halo-C.sub.1-6 alkyl (e.g.,
perfluoroalkyl), hydroxy-C.sub.1-6 alkyl, nitro-C.sub.1-6 alkyl, or
C.sub.1-6 thioalkoxy-C.sub.1-6 alkyl); (3) C.sub.1-20 alkoxy (e.g.,
C.sub.1-6 alkoxy, such as perfluoroalkoxy); (4) C.sub.1-6
alkylsulfinyl; (5) C.sub.6-10 aryl; (6) amino; (7) C.sub.1-6
alk-C.sub.6-10 aryl; (8) azido; (9) C.sub.3-8 cycloalkyl; (10)
C.sub.1-6 alk-C.sub.3-8 cycloalkyl; (11) halo; (12) C.sub.1-12
heterocyclyl (e.g., C.sub.1-12 heteroaryl); (13) (C.sub.1-12
heterocyclyl)oxy; (14) hydroxy; (15) nitro; (16) C.sub.1-20
thioalkoxy (e.g., C.sub.1-6 thioalkoxy); (17)
--(CH.sub.2).sub.qCO.sub.2R.sup.A', where q is an integer from zero
to four, and R.sup.A' is selected from the group consisting of (a)
C.sub.1-6 alkyl, (b) C.sub.6-10 aryl, (c) hydrogen, and (d)
C.sub.1-6 alk-C.sub.6-10 aryl; (18)
--(CH.sub.2).sub.qCONR.sup.B'R.sup.C', where q is an integer from
zero to four and where R.sup.B' and R.sup.C' are independently
selected from the group consisting of (a) hydrogen, (b) C.sub.6-10
alkyl, (c) C.sub.6-10 aryl, and (d) C.sub.1-6 alk-C.sub.6-10 aryl;
(19) --(CH.sub.2).sub.qSO.sub.2R.sup.D', where q is an integer from
zero to four and where R.sup.D' is selected from the group
consisting of (a) C.sub.6-10 alkyl, (b) C.sub.6-10 aryl, and (c)
C.sub.1-6 alk-C.sub.6-10 aryl; (20)
--(CH.sub.2).sub.qSO.sub.2NR.sup.E'R.sup.F', where q is an integer
from zero to four and where each of R.sup.E' and R.sup.F' is,
independently, selected from the group consisting of (a) hydrogen,
(b) C.sub.6-10 alkyl, (c) C.sub.6-10 aryl, and (d) C.sub.1-6
alk-C.sub.6-10 aryl; (21) thiol; (22) C.sub.6-10 aryloxy; (23)
C.sub.3-8 cycloalkoxy; (24) C.sub.6-10 aryl-C.sub.1-6 alkoxy; (25)
C.sub.1-6 alk-C.sub.1-12 heterocyclyl (e.g., C.sub.1-6
alk-C.sub.1-12 heteroaryl); (26) oxo; (27) C.sub.2-20 alkenyl; and
(28) C.sub.2-20 alkynyl. In some embodiments, each of these groups
can be further substituted as described herein. For example, the
alkylene group of a C.sub.1-alkaryl or a C.sub.1-alkheterocyclyl
can be further substituted with an oxo group to afford the
respective aryloyl and (heterocyclyl)oyl substituent group.
[0625] The term "diastereomer," as used herein means stereoisomers
that are not mirror images of one another and are
non-superimposable on one another.
[0626] The term "effective amount" of an agent, as used herein, is
that amount sufficient to effect beneficial or desired results, for
example, clinical results, and, as such, an "effective amount"
depends upon the context in which it is being applied. For example,
in the context of administering an agent that treats cancer, an
effective amount of an agent is, for example, an amount sufficient
to achieve treatment, as defined herein, of cancer, as compared to
the response obtained without administration of the agent.
[0627] The term "enantiomer," as used herein, means each individual
optically active form of a compound of the invention, having an
optical purity or enantiomeric excess (as determined by methods
standard in the art) of at least 80% (i.e., at least 90% of one
enantiomer and at most 10% of the other enantiomer), preferably at
least 90% and more preferably at least 98%.
[0628] The term "halo," as used herein, represents a halogen
selected from bromine, chlorine, iodine, or fluorine.
[0629] The term "haloalkoxy," as used herein, represents an alkoxy
group, as defined herein, substituted by a halogen group (i.e., F,
Cl, Br, or I). A haloalkoxy may be substituted with one, two,
three, or, in the case of alkyl groups of two carbons or more, four
halogens. Haloalkoxy groups include perfluoroalkoxys (e.g.,
--OCF.sub.3), --OCHF.sub.2, --OCH.sub.2F, --OCCl.sub.3,
--OCH.sub.2CH.sub.2Br, --OCH.sub.2CH(CH.sub.2CH.sub.2Br)CH.sub.3,
and --OCHICH.sub.3. In some embodiments, the haloalkoxy group can
be further substituted with 1, 2, 3, or 4 substituent groups as
described herein for alkyl groups.
[0630] The term "haloalkyl," as used herein, represents an alkyl
group, as defined herein, substituted by a halogen group (i.e., F,
Cl, Br, or I). A haloalkyl may be substituted with one, two, three,
or, in the case of alkyl groups of two carbons or more, four
halogens. Haloalkyl groups include perfluoroalkyls (e.g.,
--CF.sub.3), --CHF.sub.2, --CH.sub.2F, --CCl.sub.3,
--CH.sub.2CH.sub.2Br, --CH.sub.2CH(CH.sub.2CH.sub.2Br)CH.sub.3, and
--CHICH.sub.3. In some embodiments, the haloalkyl group can be
further substituted with 1, 2, 3, or 4 substituent groups as
described herein for alkyl groups.
[0631] The term "heteroalkylene," as used herein, refers to an
alkylene group, as defined herein, in which one or two of the
constituent carbon atoms have each been replaced by nitrogen,
oxygen, or sulfur. In some embodiments, the heteroalkylene group
can be further substituted with 1, 2, 3, or 4 substituent groups as
described herein for alkylene groups.
[0632] The term "heteroaryl," as used herein, represents that
subset of heterocyclyls, as defined herein, which are aromatic:
i.e., they contain 4n+2 pi electrons within the mono- or
multicyclic ring system. Exemplary unsubstituted heteroaryl groups
are of 1 to 12 (e.g., 1 to 11, 1 to 10, 1 to 9, 2 to 12, 2 to 11, 2
to 10, or 2 to 9) carbons. In some embodiment, the heteroaryl is
substituted with 1, 2, 3, or 4 substituents groups as defined for a
heterocyclyl group.
[0633] The term "heterocyclyl," as used herein represents a 5-, 6-
or 7-membered ring, unless otherwise specified, containing one,
two, three, or four heteroatoms independently selected from the
group consisting of nitrogen, oxygen, and sulfur. The 5-membered
ring has zero to two double bonds, and the 6- and 7-membered rings
have zero to three double bonds. Exemplary unsubstituted
heterocyclyl groups are of 1 to 12 (e.g., 1 to 11, 1 to 10, 1 to 9,
2 to 12, 2 to 11, 2 to 10, or 2 to 9) carbons. The term
"heterocyclyl" also represents a heterocyclic compound having a
bridged multicyclic structure in which one or more carbons and/or
heteroatoms bridges two non-adjacent members of a monocyclic ring,
e.g., a quinuclidinyl group. The term "heterocyclyl" includes
bicyclic, tricyclic, and tetracyclic groups in which any of the
above heterocyclic rings is fused to one, two, or three carbocyclic
rings, e.g., an aryl ring, a cyclohexane ring, a cyclohexene ring,
a cyclopentane ring, a cyclopentene ring, or another monocyclic
heterocyclic ring, such as indolyl, quinolyl, isoquinolyl,
tetrahydroquinolyl, benzofuryl, benzothienyl and the like. Examples
of fused heterocyclyls include tropanes and
1,2,3,5,8,8a-hexahydroindolizine. Heterocyclics include pyrrolyl,
pyrrolinyl, pyrrolidinyl, pyrazolyl, pyrazolinyl, pyrazolidinyl,
imidazolyl, imidazolinyl, imidazolidinyl, pyridyl, piperidinyl,
homopiperidinyl, pyrazinyl, piperazinyl, pyrimidinyl, pyridazinyl,
oxazolyl, oxazolidinyl, isoxazolyl, isoxazolidiniyl, morpholinyl,
thiomorpholinyl, thiazolyl, thiazolidinyl, isothiazolyl,
isothiazolidinyl, indolyl, indazolyl, quinolyl, isoquinolyl,
quinoxalinyl, dihydroquinoxalinyl, quinazolinyl, cinnolinyl,
phthalazinyl, benzimidazolyl, benzothiazolyl, benzoxazolyl,
benzothiadiazolyl, furyl, thienyl, thiazolidinyl, isothiazolyl,
triazolyl, tetrazolyl, oxadiazolyl (e.g., 1,2,3-oxadiazolyl),
purinyl, thiadiazolyl (e.g., 1,2,3-thiadiazolyl),
tetrahydrofuranyl, dihydrofuranyl, tetrahydrothienyl,
dihydrothienyl, dihydroindolyl, dihydroquinolyl,
tetrahydroquinolyl, tetrahydroisoquinolyl, dihydroisoquinolyl,
pyranyl, dihydropyranyl, dithiazolyl, benzofuranyl,
isobenzofuranyl, benzothienyl, and the like, including dihydro and
tetrahydro forms thereof, where one or more double bonds are
reduced and replaced with hydrogens. Still other exemplary
heterocyclyls include: 2,3,4,5-tetrahydro-2-oxo-oxazolyl;
2,3-dihydro-2-oxo-1H-imidazolyl;
2,3,4,5-tetrahydro-5-oxo-1H-pyrazolyl (e.g.,
2,3,4,5-tetrahydro-2-phenyl-5-oxo-1H-pyrazolyl);
2,3,4,5-tetrahydro-2,4-dioxo-1H-imidazolyl (e.g.,
2,3,4,5-tetrahydro-2,4-dioxo-5-methyl-5-phenyl-1H-imidazolyl);
2,3-dihydro-2-thioxo-1,3,4-oxadiazolyl (e.g.,
2,3-dihydro-2-thioxo-5-phenyl-1,3,4-oxadiazolyl);
4,5-dihydro-5-oxo-1H-triazolyl (e.g., 4,5-dihydro-3-methyl-4-amino
5-oxo-1H-triazolyl); 1,2,3,4-tetrahydro-2,4-dioxopyridinyl (e.g.,
1,2,3,4-tetrahydro-2,4-dioxo-3,3-diethylpyridinyl);
2,6-dioxo-piperidinyl (e.g.,
2,6-dioxo-3-ethyl-3-phenylpiperidinyl);
1,6-dihydro-6-oxopyridiminyl; 1,6-dihydro-4-oxopyrimidinyl (e.g.,
2-(methylthio)-1,6-dihydro-4-oxo-5-methylpyrimidin-1-yl);
1,2,3,4-tetrahydro-2,4-dioxopyrimidinyl (e.g.,
1,2,3,4-tetrahydro-2,4-dioxo-3-ethylpyrimidinyl);
1,6-dihydro-6-oxo-pyridazinyl (e.g.,
1,6-dihydro-6-oxo-3-ethylpyridazinyl);
1,6-dihydro-6-oxo-1,2,4-triazinyl (e.g.,
1,6-dihydro-5-isopropyl-6-oxo-1,2,4-triazinyl);
2,3-dihydro-2-oxo-1H-indolyl (e.g.,
3,3-dimethyl-2,3-dihydro-2-oxo-1H-indolyl and
2,3-dihydro-2-oxo-3,3'-spiropropane-1H-indol-1-yl);
1,3-dihydro-1-oxo-2H-iso-indolyl;
1,3-dihydro-1,3-dioxo-2H-iso-indolyl; 1H-benzopyrazolyl (e.g.,
1-(ethoxycarbonyl)-1H-benzopyrazolyl);
2,3-dihydro-2-oxo-1H-benzimidazolyl (e.g.,
3-ethyl-2,3-dihydro-2-oxo-1H-benzimidazolyl);
2,3-dihydro-2-oxo-benzoxazolyl (e.g.,
5-chloro-2,3-dihydro-2-oxo-benzoxazolyl);
2,3-dihydro-2-oxo-benzoxazolyl; 2-oxo-2H-benzopyranyl;
1,4-benzodioxanyl; 1,3-benzodioxanyl;
2,3-dihydro-3-oxo,4H-1,3-benzothiazinyl;
3,4-dihydro-4-oxo-3H-quinazolinyl (e.g.,
2-methyl-3,4-dihydro-4-oxo-3H-quinazolinyl);
1,2,3,4-tetrahydro-2,4-dioxo-3H-quinazolyl (e.g.,
1-ethyl-1,2,3,4-tetrahydro-2,4-dioxo-3H-quinazolyl);
1,2,3,6-tetrahydro-2,6-dioxo-7H-purinyl (e.g.,
1,2,3,6-tetrahydro-1,3-dimethyl-2,6-dioxo-7H-purinyl);
1,2,3,6-tetrahydro-2,6-dioxo-1H-purinyl (e.g.,
1,2,3,6-tetrahydro-3,7-dimethyl-2,6-dioxo-1H-purinyl);
2-oxobenz[c,d]indolyl; 1,1-dioxo-2H-naphth[1,8-c,d]isothiazolyl;
and 1,8-naphthylenedicarboxamido. Additional heterocyclics include
3,3a,4,5,6,6a-hexahydro-pyrrolo[3,4-b]pyrrol-(2H)-yl, and
2,5-diazabicyclo[2.2.1]heptan-2-yl, homopiperazinyl (or
diazepanyl), tetrahydropyranyl, dithiazolyl, benzofuranyl,
benzothienyl, oxepanyl, thiepanyl, azocanyl, oxecanyl, and
thiocanyl. Heterocyclic groups also include groups of the
formula
##STR00001##
where
[0634] E' is selected from the group consisting of --N-- and
--CH--; F' is selected from the group consisting of --N.dbd.CH--,
--NH--CH.sub.2--, --NH--C(O)--, --NH--, --CH.dbd.N--,
--CH.sub.2--NH--, --C(O)--NH--, --CH.dbd.CH--, --CH.sub.2--,
--CH.sub.2CH.sub.2--, --CH.sub.2O--, --OCH.sub.2--, --O--, and
--S--; and G' is selected from the group consisting of --CH-- and
--N--. Any of the heterocyclyl groups mentioned herein may be
optionally substituted with one, two, three, four or five
substituents independently selected from the group consisting of:
(1) C.sub.1-7 acyl (e.g., carboxyaldehyde); (2) C.sub.1-20 alkyl
(e.g., C.sub.1-6 alkyl, C.sub.1-6 alkoxy-C.sub.1-6 alkyl, C.sub.1-6
alkylsulfinyl-C.sub.1-6 alkyl, amino-C.sub.1-6 alkyl,
azido-C.sub.1-6 alkyl, (carboxyaldehyde)-C.sub.1-6 alkyl,
halo-C.sub.1-6 alkyl (e.g., perfluoroalkyl), hydroxy-C.sub.1-6
alkyl, nitro-C.sub.1-6 alkyl, or C.sub.1-6 thioalkoxy-C.sub.1-6
alkyl); (3) C.sub.1-20 alkoxy (e.g., C.sub.1-6 alkoxy, such as
perfluoroalkoxy); (4) C.sub.1-6 alkylsulfinyl; (5) C.sub.6-10 aryl;
(6) amino; (7) C.sub.1-6 alk-C.sub.6-10 aryl; (8) azido; (9)
C.sub.3-8 cycloalkyl; (10) C.sub.1-6 alk-C.sub.3-8 cycloalkyl; (11)
halo; (12) C.sub.1-12 heterocyclyl (e.g., C.sub.2-12 heteroaryl);
(13) (C.sub.1-12 heterocyclyl)oxy; (14) hydroxy; (15) nitro; (16)
C.sub.1-20 thioalkoxy (e.g., C.sub.1-6 thioalkoxy); (17)
--(CH.sub.2).sub.qCO.sub.2R.sup.A', where q is an integer from zero
to four, and R.sup.A' is selected from the group consisting of (a)
C.sub.1-6 alkyl, (b) C.sub.6-10 aryl, (c) hydrogen, and (d)
C.sub.1-6 alk-C.sub.6-10 aryl; (18)
--(CH.sub.2).sub.qCONR.sup.B'R.sup.C', where q is an integer from
zero to four and where R.sup.B' and R.sup.C' are independently
selected from the group consisting of (a) hydrogen, (b) C.sub.1-6
alkyl, (c) C.sub.6-10 aryl, and (d) C.sub.1-6 alk-C.sub.6-10 aryl;
(19) --(CH.sub.2).sub.qSO.sub.2R.sup.D', where q is an integer from
zero to four and where R.sup.D' is selected from the group
consisting of (a) C.sub.1-6 alkyl, (b) C.sub.6-10 aryl, and (c)
C.sub.1-6 alk-C.sub.6-10 aryl; (20)
--(CH.sub.2).sub.qSO.sub.2NR.sup.E'R.sup.F', where q is an integer
from zero to four and where each of R.sup.E' and R.sup.F' is,
independently, selected from the group consisting of (a) hydrogen,
(b) C.sub.1-6 alkyl, (c) C.sub.6-10 aryl, and (d) C.sub.1-6
alk-C.sub.6-10 aryl; (21) thiol; (22) C.sub.6-10 aryloxy; (23)
C.sub.3-8 cycloalkoxy; (24) arylalkoxy; (25) C.sub.1-6
alk-C.sub.1-12 heterocyclyl (e.g., C.sub.1-6 alk-C.sub.1-12
heteroaryl); (26) oxo; (27) (C.sub.1-12 heterocyclyl)imino; (28)
C.sub.2-20 alkenyl; and (29) C.sub.2-20 alkynyl. In some
embodiments, each of these groups can be further substituted as
described herein. For example, the alkylene group of a
C.sub.1-alkaryl or a C.sub.1-alkheterocyclyl can be further
substituted with an oxo group to afford the respective aryloyl and
(heterocyclyl)oyl substituent group.
[0635] The term "(heterocyclyl)imino," as used herein, represents a
heterocyclyl group, as defined herein, attached to the parent
molecular group through an imino group. In some embodiments, the
heterocyclyl group can be substituted with 1, 2, 3, or 4
substituent groups as defined herein.
[0636] The term "(heterocyclyl)oxy," as used herein, represents a
heterocyclyl group, as defined herein, attached to the parent
molecular group through an oxygen atom. In some embodiments, the
heterocyclyl group can be substituted with 1, 2, 3, or 4
substituent groups as defined herein.
[0637] The term "(heterocyclyl)oyl," as used herein, represents a
heterocyclyl group, as defined herein, attached to the parent
molecular group through a carbonyl group. In some embodiments, the
heterocyclyl group can be substituted with 1, 2, 3, or 4
substituent groups as defined herein.
[0638] The term "hydrocarbon," as used herein, represents a group
consisting only of carbon and hydrogen atoms.
[0639] The term "hydroxy," as used herein, represents an --OH
group.
[0640] The term "hydroxyalkenyl," as used herein, represents an
alkenyl group, as defined herein, substituted by one to three
hydroxy groups, with the proviso that no more than one hydroxy
group may be attached to a single carbon atom of the alkyl group,
and is exemplified by dihydroxypropenyl, hydroxyisopentenyl, and
the like.
[0641] The term "hydroxyalkyl," as used herein, represents an alkyl
group, as defined herein, substituted by one to three hydroxy
groups, with the proviso that no more than one hydroxy group may be
attached to a single carbon atom of the alkyl group, and is
exemplified by hydroxymethyl, dihydroxypropyl, and the like.
[0642] The term "isomer," as used herein, means any tautomer,
stereoisomer, enantiomer, or diastereomer of any compound of the
invention. It is recognized that the compounds of the invention can
have one or more chiral centers and/or double bonds and, therefore,
exist as stereoisomers, such as double-bond isomers (i.e.,
geometric E/Z isomers) or diastereomers (e.g., enantiomers (i.e.,
(+) or (-)) or cis/trans isomers). According to the invention, the
chemical structures depicted herein, and therefore the compounds of
the invention, encompass all of the corresponding stereoisomers,
that is, both the stereomerically pure form (e.g., geometrically
pure, enantiomerically pure, or diastereomerically pure) and
enantiomeric and stereoisomeric mixtures, e.g., racemates.
Enantiomeric and stereoisomeric mixtures of compounds of the
invention can typically be resolved into their component
enantiomers or stereoisomers by well-known methods, such as
chiral-phase gas chromatography, chiral-phase high performance
liquid chromatography, crystallizing the compound as a chiral salt
complex, or crystallizing the compound in a chiral solvent.
Enantiomers and stereoisomers can also be obtained from
stereomerically or enantiomerically pure intermediates, reagents,
and catalysts by well-known asymmetric synthetic methods.
[0643] The term "N-protected amino," as used herein, refers to an
amino group, as defined herein, to which is attached one or two
N-protecting groups, as defined herein.
[0644] The term "N-protecting group," as used herein, represents
those groups intended to protect an amino group against undesirable
reactions during synthetic procedures. Commonly used N-protecting
groups are disclosed in Greene, "Protective Groups in Organic
Synthesis," 3.sup.rd Edition (John Wiley & Sons, New York,
1999), which is incorporated herein by reference. N-protecting
groups include acyl, aryloyl, or carbamyl groups such as formyl,
acetyl, propionyl, pivaloyl, t-butylacetyl, 2-chloroacetyl,
2-bromoacetyl, trifluoroacetyl, trichloroacetyl, phthalyl,
o-nitrophenoxyacetyl, .alpha.-chlorobutyryl, benzoyl,
4-chlorobenzoyl, 4-bromobenzoyl, 4-nitrobenzoyl, and chiral
auxiliaries such as protected or unprotected D, L or D, L-amino
acids such as alanine, leucine, phenylalanine, and the like;
sulfonyl-containing groups such as benzenesulfonyl,
p-toluenesulfonyl, and the like; carbamate forming groups such as
benzyloxycarbonyl, p-chlorobenzyloxycarbonyl,
p-methoxybenzyloxycarbonyl, p-nitrobenzyloxycarbonyl,
2-nitrobenzyloxycarbonyl, p-bromobenzyloxycarbonyl,
3,4-dimethoxybenzyloxycarbonyl, 3,5-dimethoxybenzyloxycarbonyl,
2,4-dimethoxybenzyloxycarbonyl, 4-methoxybenzyloxycarbonyl,
2-nitro-4,5-dimethoxybenzyloxycarbonyl,
3,4,5-trimethoxybenzyloxycarbonyl,
1-(p-biphenylyl)-1-methylethoxycarbonyl,
.alpha.,.alpha.-dimethyl-3,5-dimethoxybenzyloxycarbonyl,
benzhydryloxy carbonyl, t-butyloxycarbonyl,
diisopropylmethoxycarbonyl, isopropyloxycarbonyl, ethoxycarbonyl,
methoxycarbonyl, allyloxycarbonyl, 2,2,2,-trichloroethoxycarbonyl,
phenoxycarbonyl, 4-nitrophenoxy carbonyl,
fluorenyl-9-methoxycarbonyl, cyclopentyloxycarbonyl,
adamantyloxycarbonyl, cyclohexyloxycarbonyl, phenylthiocarbonyl,
and the like, alkaryl groups such as benzyl, triphenylmethyl,
benzyloxymethyl, and the like and silyl groups, such as
trimethylsilyl, and the like. Preferred N-protecting groups are
formyl, acetyl, benzoyl, pivaloyl, t-butylacetyl, alanyl,
phenylsulfonyl, benzyl, t-butyloxycarbonyl (Boc), and
benzyloxycarbonyl (Cbz).
[0645] The term "nitro," as used herein, represents an --NO.sub.2
group.
[0646] The term "oxo" as used herein, represents .dbd.O.
[0647] The term "perfluoroalkyl," as used herein, represents an
alkyl group, as defined herein, where each hydrogen radical bound
to the alkyl group has been replaced by a fluoride radical.
Perfluoroalkyl groups are exemplified by trifluoromethyl,
pentafluoroethyl, and the like.
[0648] The term "perfluoroalkoxy," as used herein, represents an
alkoxy group, as defined herein, where each hydrogen radical bound
to the alkoxy group has been replaced by a fluoride radical.
Perfluoroalkoxy groups are exemplified by trifluoromethoxy,
pentafluoroethoxy, and the like.
[0649] The term "spirocyclyl," as used herein, represents a
C.sub.2-7 alkylene diradical, both ends of which are bonded to the
same carbon atom of the parent group to form a spirocyclic group,
and also a C.sub.1-6 heteroalkylene diradical, both ends of which
are bonded to the same atom. The heteroalkylene radical forming the
spirocyclyl group can containing one, two, three, or four
heteroatoms independently selected from the group consisting of
nitrogen, oxygen, and sulfur. In some embodiments, the spirocyclyl
group includes one to seven carbons, excluding the carbon atom to
which the diradical is attached. The spirocyclyl groups of the
invention may be optionally substituted with 1, 2, 3, or 4
substituents provided herein as optional substituents for
cycloalkyl and/or heterocyclyl groups.
[0650] The term "stereoisomer," as used herein, refers to all
possible different isomeric as well as conformational forms which a
compound may possess (e.g., a compound of any formula described
herein), in particular all possible stereochemically and
conformationally isomeric forms, all diastereomers, enantiomers
and/or conformers of the basic molecular structure. Some compounds
of the present invention may exist in different tautomeric forms,
all of the latter being included within the scope of the present
invention.
[0651] The term "sulfoalkyl," as used herein, represents an alkyl
group, as defined herein, substituted by a sulfo group of
--SO.sub.3H. In some embodiments, the alkyl group can be further
substituted with 1, 2, 3, or 4 substituent groups as described
herein.
[0652] The term "sulfonyl," as used herein, represents an
--S(O).sub.2-- group.
[0653] The term "thioalkaryl," as used herein, represents a
chemical substituent of formula --SR, where R is an alkaryl group.
In some embodiments, the alkaryl group can be further substituted
with 1, 2, 3, or 4 substituent groups as described herein.
[0654] The term "thioalkheterocyclyl," as used herein, represents a
chemical substituent of formula --SR, where R is an alkheterocyclyl
group. In some embodiments, the alkheterocyclyl group can be
further substituted with 1, 2, 3, or 4 substituent groups as
described herein.
[0655] The term "thioalkoxy," as used herein, represents a chemical
substituent of formula --SR, where R is an alkyl group, as defined
herein. In some embodiments, the alkyl group can be further
substituted with 1, 2, 3, or 4 substituent groups as described
herein.
[0656] The term "thiol" represents an --SH group.
[0657] Compound: As used herein, the term "compound," is meant to
include all stereoisomers, geometric isomers, tautomers, and
isotopes of the structures depicted.
[0658] The compounds described herein can be asymmetric (e.g.,
having one or more stereocenters). All stereoisomers, such as
enantiomers and diastereomers, are intended unless otherwise
indicated. Compounds of the present disclosure that contain
asymmetrically substituted carbon atoms can be isolated in
optically active or racemic forms. Methods on how to prepare
optically active forms from optically active starting materials are
known in the art, such as by resolution of racemic mixtures or by
stereoselective synthesis. Many geometric isomers of olefins,
C.dbd.N double bonds, and the like can also be present in the
compounds described herein, and all such stable isomers are
contemplated in the present disclosure. Cis and trans geometric
isomers of the compounds of the present disclosure are described
and may be isolated as a mixture of isomers or as separated
isomeric forms.
[0659] Compounds of the present disclosure also include tautomeric
forms. Tautomeric forms result from the swapping of a single bond
with an adjacent double bond and the concomitant migration of a
proton. Tautomeric forms include prototropic tautomers which are
isomeric protonation states having the same empirical formula and
total charge. Examples prototropic tautomers include ketone-enol
pairs, amide-imidic acid pairs, lactam-lactim pairs, amide-imidic
acid pairs, enamine-imine pairs, and annular forms where a proton
can occupy two or more positions of a heterocyclic system, such as,
1H- and 3H-imidazole, 1H-, 2H- and 4H-1,2,4-triazole, 1H- and
2H-isoindole, and 1H- and 2H-pyrazole. Tautomeric forms can be in
equilibrium or sterically locked into one form by appropriate
substitution.
[0660] Compounds of the present disclosure also include all of the
isotopes of the atoms occurring in the intermediate or final
compounds. "Isotopes" refers to atoms having the same atomic number
but different mass numbers resulting from a different number of
neutrons in the nuclei. For example, isotopes of hydrogen include
tritium and deuterium.
[0661] The compounds and salts of the present disclosure can be
prepared in combination with solvent or water molecules to form
solvates and hydrates by routine methods.
[0662] Condition: As used herein, the term "condition" refers to a
disorder that presents with observable symptoms.
[0663] Conserved: As used herein, the term "conserved" refers to
nucleotides or amino acid residues of a polynucleotide sequence or
polypeptide sequence, respectively, that are those that occur
unaltered in the same position of two or more sequences being
compared. Nucleotides or amino acids that are relatively conserved
are those that are conserved amongst more related sequences than
nucleotides or amino acids appearing elsewhere in the
sequences.
[0664] In some embodiments, two or more sequences are said to be
"completely conserved" if they are 100% identical to one another.
In some embodiments, two or more sequences are said to be "highly
conserved" if they are at least 70% identical, at least 80%
identical, at least 90% identical, or at least 95% identical to one
another. In some embodiments, two or more sequences are said to be
"highly conserved" if they are about 70% identical, about 80%
identical, about 90% identical, about 95%, about 98%, or about 99%
identical to one another. In some embodiments, two or more
sequences are said to be "conserved" if they are at least 30%
identical, at least 40% identical, at least 50% identical, at least
60% identical, at least 70% identical, at least 80% identical, at
least 90% identical, or at least 95% identical to one another. In
some embodiments, two or more sequences are said to be "conserved"
if they are about 30% identical, about 40% identical, about 50%
identical, about 60% identical, about 70% identical, about 80%
identical, about 90% identical, about 95% identical, about 98%
identical, or about 99% identical to one another. Conservation of
sequence may apply to the entire length of an oligonucleotide or
polypeptide or may apply to a portion, region or feature
thereof.
[0665] Cyclic or Cyclized: As used herein, the term "cyclic" refers
to the presence of a continuous loop. Cyclic molecules need not be
circular, only joined to form an unbroken chain of subunits. Cyclic
molecules such as the engineered RNA or mRNA of the present
invention may be single units or multimers or comprise one or more
components of a complex or higher order structure.
[0666] Cytostatic: As used herein, "cytostatic" refers to
inhibiting, reducing, suppressing the growth, division, or
multiplication of a cell (e.g., a mammalian cell (e.g., a human
cell)), bacterium, virus, fungus, protozoan, parasite, prion, or a
combination thereof.
[0667] Cytotoxic: As used herein, "cytotoxic" refers to killing or
causing injurious, toxic, or deadly effect on a cell (e.g., a
mammalian cell (e.g., a human cell)), bacterium, virus, fungus,
protozoan, parasite, prion, or a combination thereof.
[0668] Delivery: As used herein, "delivery" refers to the act or
manner of delivering a compound, substance, entity, moiety, cargo
or payload.
[0669] Delivery Agent: As used herein, "delivery agent" refers to
any substance which facilitates, at least in part, the in vivo
delivery of polynucleotide, primary construct or mmRNA to targeted
cells.
[0670] Destabilized: As used herein, the term "destable,"
"destabilize," or "destabilizing region" means a region or molecule
that is less stable than a starting, wild-type or native form of
the same region or molecule.
[0671] Detectable label: As used herein, "detectable label" refers
to one or more markers, signals, or moieties which are attached,
incorporated or associated with another entity that is readily
detected by methods known in the art including radiography,
fluorescence, chemiluminescence, enzymatic activity, absorbance and
the like. Detectable labels include radioisotopes, fluorophores,
chromophores, enzymes, dyes, metal ions, ligands such as biotin,
avidin, streptavidin and haptens, quantum dots, and the like.
Detectable labels may be located at any position in the peptides or
proteins disclosed herein. They may be within the amino acids, the
peptides, or proteins, or located at the N- or C-termini.
[0672] Disease: As used herein, the term "disease" refers to an
abnormal condition affecting the body of an organism often showing
specific bodily symptoms.
[0673] Disorder: As used herein, the term "disorder," refers to a
disruption of or an interference with normal functions or
established systems of the body.
[0674] Digest: As used herein, the term "digest" means to break
apart into smaller pieces or components. When referring to
polypeptides or proteins, digestion results in the production of
peptides.
[0675] Distal: As used herein, the term "distal" means situated
away from the center or away from a point or region of
interest.
[0676] Dose splitting factor (DSF)-ratio of PUD of dose split
treatment divided by PUD of total daily dose or single unit dose.
The value is derived from comparison of dosing regimens groups.
[0677] Encoded protein cleavage signal: As used herein, "encoded
protein cleavage signal" refers to the nucleotide sequence which
encodes a protein cleavage signal.
[0678] Engineered: As used herein, embodiments of the invention are
"engineered" when they are designed to have a feature or property,
whether structural or chemical, that varies from a starting point,
wild type or native molecule.
[0679] Exosome: As used herein, "exosome" is a vesicle secreted by
mammalian cells or a complex involved in RNA degradation.
[0680] Expression: As used herein, "expression" of a nucleic acid
sequence refers to one or more of the following events: (1)
production of an RNA template from a DNA sequence (e.g., by
transcription); (2) processing of an RNA transcript (e.g., by
splicing, editing, 5' cap formation, and/or 3' end processing); (3)
translation of an RNA into a polypeptide or protein; and (4)
post-translational modification of a polypeptide or protein.
[0681] Feature: As used herein, a "feature" refers to a
characteristic, a property, or a distinctive element.
[0682] Formulation: As used herein, a "formulation" includes at
least a polynucleotide, primary construct or mmRNA and a delivery
agent.
[0683] Fragment: A "fragment," as used herein, refers to a portion.
For example, fragments of proteins may comprise polypeptides
obtained by digesting full-length protein isolated from cultured
cells.
[0684] Functional: As used herein, a "functional" biological
molecule is a biological molecule in a form in which it exhibits a
property and/or activity by which it is characterized.
[0685] Genotype: As used herein, "genotype" refers to the change in
the genotype, or genetic makeup, of a subject, cell, tissue, organ
and/or organism.
[0686] Homology: As used herein, the term "homology" refers to the
overall relatedness between polymeric molecules, e.g. between
nucleic acid molecules (e.g. DNA molecules and/or RNA molecules)
and/or between polypeptide molecules. In some embodiments,
polymeric molecules are considered to be "homologous" to one
another if their sequences are at least 25%, 30%, 35%, 40%, 45%,
50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical
or similar. The term "homologous" necessarily refers to a
comparison between at least two sequences (polynucleotide or
polypeptide sequences). In accordance with the invention, two
polynucleotide sequences are considered to be homologous if the
polypeptides they encode are at least about 50%, 60%, 70%, 80%,
90%, 95%, or even 99% for at least one stretch of at least about 20
amino acids. In some embodiments, homologous polynucleotide
sequences are characterized by the ability to encode a stretch of
at least 4-5 uniquely specified amino acids. For polynucleotide
sequences less than 60 nucleotides in length, homology is
determined by the ability to encode a stretch of at least 4-5
uniquely specified amino acids. In accordance with the invention,
two protein sequences are considered to be homologous if the
proteins are at least about 50%, 60%, 70%, 80%, or 90% identical
for at least one stretch of at least about 20 amino acids.
[0687] Identity: As used herein, the term "identity" refers to the
overall relatedness between polymeric molecules, e.g., between
oligonucleotide molecules (e.g. DNA molecules and/or RNA molecules)
and/or between polypeptide molecules.
[0688] Calculation of the percent identity of two polynucleotide
sequences, for example, can be performed by aligning the two
sequences for optimal comparison purposes (e.g., gaps can be
introduced in one or both of a first and a second nucleic acid
sequences for optimal alignment and non-identical sequences can be
disregarded for comparison purposes). In certain embodiments, the
length of a sequence aligned for comparison purposes is at least
30%, at least 40%, at least 50%, at least 60%, at least 70%, at
least 80%, at least 90%, at least 95%, or 100% of the length of the
reference sequence. The nucleotides at corresponding nucleotide
positions are then compared. When a position in the first sequence
is occupied by the same nucleotide as the corresponding position in
the second sequence, then the molecules are identical at that
position. The percent identity between the two sequences is a
function of the number of identical positions shared by the
sequences, taking into account the number of gaps, and the length
of each gap, which needs to be introduced for optimal alignment of
the two sequences. The comparison of sequences and determination of
percent identity between two sequences can be accomplished using a
mathematical algorithm. For example, the percent identity between
two nucleotide sequences can be determined using methods such as
those described in Computational Molecular Biology, Lesk, A. M.,
ed., Oxford University Press, New York, 1988; Biocomputing:
Informatics and Genome Projects, Smith, D. W., ed., Academic Press,
New York, 1993; Sequence Analysis in Molecular Biology, von Heinje,
G., Academic Press, 1987; Computer Analysis of Sequence Data, Part
I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New
Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and
Devereux, J., eds., M Stockton Press, New York, 1991; each of which
is incorporated herein by reference. For example, the percent
identity between two nucleotide sequences can be determined using
the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-17), which
has been incorporated into the ALIGN program (version 2.0) using a
PAM120 weight residue table, a gap length penalty of 12 and a gap
penalty of 4. The percent identity between two nucleotide sequences
can, alternatively, be determined using the GAP program in the GCG
software package using an NWSgapdna.CMP matrix. Methods commonly
employed to determine percent identity between sequences include,
but are not limited to those disclosed in Carillo, H., and Lipman,
D., SIAM J Applied Math., 48:1073 (1988); incorporated herein by
reference. Techniques for determining identity are codified in
publicly available computer programs. Exemplary computer software
to determine homology between two sequences include, but are not
limited to, GCG program package, Devereux, J., et al., Nucleic
Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN, and FASTA
Altschul, S. F. et al., J. Molec. Biol., 215, 403 (1990)).
[0689] Inhibit expression of a gene: As used herein, the phrase
"inhibit expression of a gene" means to cause a reduction in the
amount of an expression product of the gene. The expression product
can be an RNA transcribed from the gene (e.g., an mRNA) or a
polypeptide translated from an mRNA transcribed from the gene.
Typically a reduction in the level of an mRNA results in a
reduction in the level of a polypeptide translated therefrom. The
level of expression may be determined using standard techniques for
measuring mRNA or protein.
[0690] In vitro: As used herein, the term "in vitro" refers to
events that occur in an artificial environment, e.g., in a test
tube or reaction vessel, in cell culture, in a Petri dish, etc.,
rather than within an organism (e.g., animal, plant, or
microbe).
[0691] In vivo: As used herein, the term "in vivo" refers to events
that occur within an organism (e.g., animal, plant, or microbe or
cell or tissue thereof).
[0692] Isolated: As used herein, the term "isolated" refers to a
substance or entity that has been separated from at least some of
the components with which it was associated (whether in nature or
in an experimental setting). Isolated substances may have varying
levels of purity in reference to the substances from which they
have been associated. Isolated substances and/or entities may be
separated from at least about 10%, about 20%, about 30%, about 40%,
about 50%, about 60%, about 70%, about 80%, about 90%, or more of
the other components with which they were initially associated. In
some embodiments, isolated agents are more than about 80%, about
85%, about 90%, about 91%, about 92%, about 93%, about 94%, about
95%, about 96%, about 97%, about 98%, about 99%, or more than about
99% pure. As used herein, a substance is "pure" if it is
substantially free of other components. Substantially isolated: By
"substantially isolated" is meant that the compound is
substantially separated from the environment in which it was formed
or detected. Partial separation can include, for example, a
composition enriched in the compound of the present disclosure.
Substantial separation can include compositions containing at least
about 50%, at least about 60%, at least about 70%, at least about
80%, at least about 90%, at least about 95%, at least about 97%, or
at least about 99% by weight of the compound of the present
disclosure, or salt thereof. Methods for isolating compounds and
their salts are routine in the art.
[0693] Linker: As used herein, a linker refers to a group of atoms,
e.g., 10-1,000 atoms, and can be comprised of the atoms or groups
such as, but not limited to, carbon, amino, alkylamino, oxygen,
sulfur, sulfoxide, sulfonyl, carbonyl, and imine. The linker can be
attached to a modified nucleoside or nucleotide on the nucleobase
or sugar moiety at a first end, and to a payload, e.g., a
detectable or therapeutic agent, at a second end. The linker may be
of sufficient length as to not interfere with incorporation into a
nucleic acid sequence. The linker can be used for any useful
purpose, such as to form mmRNA multimers (e.g., through linkage of
two or more polynucleotides, primary constructs, or mmRNA
molecules) or mmRNA conjugates, as well as to administer a payload,
as described herein. Examples of chemical groups that can be
incorporated into the linker include, but are not limited to,
alkyl, alkenyl, alkynyl, amido, amino, ether, thioether, ester,
alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can
be optionally substituted, as described herein. Examples of linkers
include, but are not limited to, unsaturated alkanes, polyethylene
glycols (e.g., ethylene or propylene glycol monomeric units, e.g.,
diethylene glycol, dipropylene glycol, triethylene glycol,
tripropylene glycol, tetraethylene glycol, or tetraethylene
glycol), and dextran polymers, Other examples include, but are not
limited to, cleavable moieties within the linker, such as, for
example, a disulfide bond (--S--S--) or an azo bond (--N.dbd.N--),
which can be cleaved using a reducing agent or photolysis.
Non-limiting examples of a selectively cleavable bond include an
amido bond can be cleaved for example by the use of
tris(2-carboxyethyl)phosphine (TCEP), or other reducing agents,
and/or photolysis, as well as an ester bond can be cleaved for
example by acidic or basic hydrolysis.
[0694] Metastasis: As used herein, the term "metastasis" means the
process by which cancer spreads from the place at which it first
arose as a primary tumor to distant locations in the body.
[0695] Method of Treating: The phrase "a method of treating" or its
equivalent, when applied to, for example, cancer refers to a
procedure or course of action that is designed to reduce or
eliminate the number of cancer cells, prevent the increase in the
number of cancer cells, or to alleviate the symptoms of a cancer in
a subject. A method of treating cancer or another disorder does not
necessarily mean that the cancer cells or other disorder will, in
fact, be completely eliminated, that the number of cells or
disorder will, in fact, be reduced, or that the symptoms of a
cancer or other disorder will, in fact, be alleviated. Often, a
method of treating cancer will be performed even with a low
likelihood of success, but which, given the medical history and
estimated survival expectancy of a subject, is nevertheless deemed
an overall beneficial course of action.
[0696] MicroRNA (miRNA) binding site: As used herein, a microRNA
(miRNA) binding site represents a nucleotide location or region of
a nucleic acid transcript to which at least the "seed" region of a
miRNA binds.
[0697] Modified: As used herein "modified" refers to a changed
state or structure of a molecule of the invention. Molecules may be
modified in many ways including chemically, structurally, and
functionally. In one embodiment, the mRNA molecules of the present
invention are modified by the introduction of non-natural
nucleosides and/or nucleotides, e.g., as it relates to the natural
ribonucleotides A, U, G, and C. Noncanonical nucleotides such as
the cap structures are not considered "modified" although they
differ from the chemical structure of the A, C, G, U
ribonucleotides.
[0698] Mucus: As used herein, "mucus" refers to the natural
substance that is viscous and comprises mucin glycoproteins.
[0699] Naturally occurring: As used herein, "naturally occurring"
means existing in nature without artificial aid.
[0700] Non-human vertebrate: As used herein, a "non human
vertebrate" includes all vertebrates except Homo sapiens, including
wild and domesticated species. Examples of non-human vertebrates
include, but are not limited to, mammals, such as alpaca, banteng,
bison, camel, cat, cattle, deer, dog, donkey, gayal, goat, guinea
pig, horse, llama, mule, pig, rabbit, reindeer, sheep water
buffalo, and yak.
[0701] Off-target: As used herein, "off target" refers to any
unintended effect on any one or more target, gene, or cellular
transcript.
[0702] Open reading frame: As used herein, "open reading frame" or
"ORF" refers to a sequence which does not contain a stop codon in a
given reading frame.
[0703] Operably linked: As used herein, the phrase "operably
linked" refers to a functional connection between two or more
molecules, constructs, transcripts, entities, moieties or the
like.
[0704] Paratope: As used herein, a "paratope" refers to the
antigen-binding site of an antibody.
[0705] Patient: As used herein, "patient" refers to a subject who
may seek or be in need of treatment, requires treatment, is
receiving treatment, will receive treatment, or a subject who is
under care by a trained professional for a particular disease or
condition.
[0706] Optionally substituted: Herein a phrase of the form
"optionally substituted X" (e.g., optionally substituted alkyl) is
intended to be equivalent to "X, wherein X is optionally
substituted" (e.g., "alkyl, wherein said alkyl is optionally
substituted"). It is not intended to mean that the feature "X"
(e.g. alkyl) per se is optional.
[0707] Peptide: As used herein, "peptide" is less than or equal to
50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45,
or 50 amino acids long.
[0708] Pharmaceutical composition: The phrase "pharmaceutical
composition" refers to a composition that alters the etiology of a
disease, disorder and/or condition.
[0709] Pharmaceutically acceptable: The phrase "pharmaceutically
acceptable" is employed herein to refer to those compounds,
materials, compositions, and/or dosage forms which are, within the
scope of sound medical judgment, suitable for use in contact with
the tissues of human beings and animals without excessive toxicity,
irritation, allergic response, or other problem or complication,
commensurate with a reasonable benefit/risk ratio.
[0710] Pharmaceutically acceptable excipients: The phrase
"pharmaceutically acceptable excipient," as used herein, refers any
ingredient other than the compounds described herein (for example,
a vehicle capable of suspending or dissolving the active compound)
and having the properties of being substantially nontoxic and
non-inflammatory in a patient. Excipients may include, for example:
antiadherents, antioxidants, binders, coatings, compression aids,
disintegrants, dyes (colors), emollients, emulsifiers, fillers
(diluents), film formers or coatings, flavors, fragrances, glidants
(flow enhancers), lubricants, preservatives, printing inks,
sorbents, suspensing or dispersing agents, sweeteners, and waters
of hydration. Exemplary excipients include, but are not limited to:
butylated hydroxytoluene (BHT), calcium carbonate, calcium
phosphate (dibasic), calcium stearate, croscarmellose, crosslinked
polyvinyl pyrrolidone, citric acid, crospovidone, cysteine,
ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl
methylcellulose, lactose, magnesium stearate, maltitol, mannitol,
methionine, methylcellulose, methyl paraben, microcrystalline
cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone,
pregelatinized starch, propyl paraben, retinyl palmitate, shellac,
silicon dioxide, sodium carboxymethyl cellulose, sodium citrate,
sodium starch glycolate, sorbitol, starch (corn), stearic acid,
sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C,
and xylitol.
[0711] Pharmaceutically acceptable salts: The present disclosure
also includes pharmaceutically acceptable salts of the compounds
described herein. As used herein, "pharmaceutically acceptable
salts" refers to derivatives of the disclosed compounds wherein the
parent compound is modified by converting an existing acid or base
moiety to its salt form (e.g., by reacting the free base group with
a suitable organic acid). Examples of pharmaceutically acceptable
salts include, but are not limited to, mineral or organic acid
salts of basic residues such as amines; alkali or organic salts of
acidic residues such as carboxylic acids; and the like.
Representative acid addition salts include acetate, adipate,
alginate, ascorbate, aspartate, benzenesulfonate, benzoate,
bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate,
cyclopentanepropionate, digluconate, dodecylsulfate,
ethanesulfonate, fumarate, glucoheptonate, glycerophosphate,
hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride,
hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate,
laurate, lauryl sulfate, malate, maleate, malonate,
methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate,
oleate, oxalate, palmitate, pamoate, pectinate, persulfate,
3-phenylpropionate, phosphate, picrate, pivalate, propionate,
stearate, succinate, sulfate, tartrate, thiocyanate,
toluenesulfonate, undecanoate, valerate salts, and the like.
Representative alkali or alkaline earth metal salts include sodium,
lithium, potassium, calcium, magnesium, and the like, as well as
nontoxic ammonium, quaternary ammonium, and amine cations,
including, but not limited to ammonium, tetramethylammonium,
tetraethylammonium, methylamine, dimethylamine, trimethylamine,
triethylamine, ethylamine, and the like. The pharmaceutically
acceptable salts of the present disclosure include the conventional
non-toxic salts of the parent compound formed, for example, from
non-toxic inorganic or organic acids. The pharmaceutically
acceptable salts of the present disclosure can be synthesized from
the parent compound which contains a basic or acidic moiety by
conventional chemical methods. Generally, such salts can be
prepared by reacting the free acid or base forms of these compounds
with a stoichiometric amount of the appropriate base or acid in
water or in an organic solvent, or in a mixture of the two;
generally, nonaqueous media like ether, ethyl acetate, ethanol,
isopropanol, or acetonitrile are preferred. Lists of suitable salts
are found in Remington's Pharmaceutical Sciences, 17.sup.th ed.,
Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical
Salts: Properties, Selection, and Use, P. H. Stahl and C. G.
Wermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of
Pharmaceutical Science, 66, 1-19 (1977), each of which is
incorporated herein by reference in its entirety.
[0712] Pharmaceutically acceptable solvate: The term
"pharmaceutically acceptable solvate," as used herein, means a
compound of the invention wherein molecules of a suitable solvent
are incorporated in the crystal lattice. A suitable solvent is
physiologically tolerable at the dosage administered. For example,
solvates may be prepared by crystallization, recrystallization, or
precipitation from a solution that includes organic solvents,
water, or a mixture thereof. Examples of suitable solvents are
ethanol, water (for example, mono-, di-, and tri-hydrates),
N-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO),
N,N'-dimethylformamide (DMF), N,N'-dimethylacetamide (DMAC),
1,3-dimethyl-2-imidazolidinone (DMEU),
1,3-dimethyl-3,4,5,6-tetrahydro-2-(1H)-pyrimidinone (DMPU),
acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl
alcohol, 2-pyrrolidone, benzyl benzoate, and the like. When water
is the solvent, the solvate is referred to as a "hydrate."
[0713] Pharmacokinetic: As used herein, "pharmacokinetic" refers to
any one or more properties of a molecule or compound as it relates
to the determination of the fate of substances administered to a
living organism. Pharmacokinetics is divided into several areas
including the extent and rate of absorption, distribution,
metabolism and excretion. This is commonly referred to as ADME
where: (A) Absorption is the process of a substance entering the
blood circulation; (D) Distribution is the dispersion or
dissemination of substances throughout the fluids and tissues of
the body; (M) Metabolism (or Biotransformation) is the irreversible
transformation of parent compounds into daughter metabolites; and
(E) Excretion (or Elimination) refers to the elimination of the
substances from the body. In rare cases, some drugs irreversibly
accumulate in body tissue.
[0714] Phenotype: As used herein, "phenotype" refers to the set of
observable characteristics of a subject, cell, tissue, organ and/or
organism.
[0715] Physicochemical: As used herein, "physicochemical" means of
or relating to a physical and/or chemical property.
[0716] Preventing: As used herein, the term "preventing" refers to
partially or completely delaying onset of an infection, disease,
disorder and/or condition; partially or completely delaying onset
of one or more symptoms, features, or clinical manifestations of a
particular infection, disease, disorder, and/or condition;
partially or completely delaying onset of one or more symptoms,
features, or manifestations of a particular infection, disease,
disorder, and/or condition; partially or completely delaying
progression from an infection, a particular disease, disorder
and/or condition; and/or decreasing the risk of developing
pathology associated with the infection, the disease, disorder,
and/or condition.
[0717] Prodrug: The present disclosure also includes prodrugs of
the compounds described herein. As used herein, "prodrugs" refer to
any substance, molecule or entity which is in a form predicate for
that substance, molecule or entity to act as a therapeutic upon
chemical or physical alteration. Prodrugs may by covalently bonded
or sequestered in some way and which release or are converted into
the active drug moiety prior to, upon or after administered to a
mammalian subject. Prodrugs can be prepared by modifying functional
groups present in the compounds in such a way that the
modifications are cleaved, either in routine manipulation or in
vivo, to the parent compounds. Prodrugs include compounds wherein
hydroxyl, amino, sulfhydryl, or carboxyl groups are bonded to any
group that, when administered to a mammalian subject, cleaves to
form a free hydroxyl, amino, sulfhydryl, or carboxyl group
respectively. Preparation and use of prodrugs is discussed in T.
Higuchi and V. Stella, "Pro-drugs as Novel Delivery Systems," Vol.
14 of the A.C.S. Symposium Series, and in Bioreversible Carriers in
Drug Design, ed. Edward B. Roche, American Pharmaceutical
Association and Pergamon Press, 1987, both of which are hereby
incorporated by reference in their entirety.
[0718] Proliferate: As used herein, the term "proliferate" means to
grow, expand or increase or cause to grow, expand or increase
rapidly. "Proliferative" means having the ability to proliferate.
"Anti-proliferative" means having properties counter to or
inapposite to proliferative properties.
[0719] Protein cleavage site: As used herein, "protein cleavage
site" refers to a site where controlled cleavage of the amino acid
chain can be accomplished by chemical, enzymatic or photochemical
means.
[0720] Protein cleavage signal: As used herein "protein cleavage
signal" refers to at least one amino acid that flags or marks a
polypeptide for cleavage.
[0721] Progression: As used herein, the term "progression" (e.g.,
cancer progression) means the advancement or worsening of or toward
a disease or condition.
[0722] Protein of interest: As used herein, the terms "proteins of
interest" or "desired proteins" include those provided herein and
fragments, mutants, variants, and alterations thereof.
[0723] Proximal: As used herein, the term "proximal" means situated
nearer to the center or to a point or region of interest.
[0724] Purified: As used herein, "purify," "purified,"
"purification" means to make substantially pure or clear from
unwanted components, material defilement, admixture or
imperfection.
[0725] Regression: As used herein, the term "regression" or "degree
of regression" refers to the reversal, either phenotypically or
genotypically, of a cancer progression. Slowing or stopping cancer
progression may be considered regression.
[0726] Reducing the effect: As used herein, the phrase "reducing
the effect" when referring to symptoms, means reducing, eliminating
or alleviating the symptom in the subject. It does not necessarily
mean that the symptom will, in fact, be completely eliminated,
reduced or alleviated.
[0727] Sample: As used herein, the term "sample" or "biological
sample" refers to a subset of its tissues, cells or component parts
(e.g. body fluids, including but not limited to blood, mucus,
lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva,
amniotic fluid, amniotic cord blood, urine, vaginal fluid and
semen). A sample further may include a homogenate, lysate or
extract prepared from a whole organism or a subset of its tissues,
cells or component parts, or a fraction or portion thereof,
including but not limited to, for example, plasma, serum, spinal
fluid, lymph fluid, the external sections of the skin, respiratory,
intestinal, and genitourinary tracts, tears, saliva, milk, blood
cells, tumors, organs. A sample further refers to a medium, such as
a nutrient broth or gel, which may contain cellular components,
such as proteins or nucleic acid molecule.
[0728] Side effect: As used herein, the phrase "side effect" refers
to a secondary effect of treatment.
[0729] Signal Peptide Sequences: As used herein, the phrase "signal
peptide sequences" refers to a sequence which can direct the
transport or localization of a protein.
[0730] Single unit dose: As used herein, a "single unit dose" is a
dose of any therapeutic administered in one dose/at one time/single
route/single point of contact, i.e., single administration
event.
[0731] Similarity: As used herein, the term "similarity" refers to
the overall relatedness between polymeric molecules, e.g. between
polynucleotide molecules (e.g. DNA molecules and/or RNA molecules)
and/or between polypeptide molecules. Calculation of percent
similarity of polymeric molecules to one another can be performed
in the same manner as a calculation of percent identity, except
that calculation of percent similarity takes into account
conservative substitutions as is understood in the art.
[0732] Skin: The term "skin" is the thin layer of tissue forming
the natural outer covering of the body of a subject and includes
the epidermis and the dermis. The dermis is the thick layer of
living tissue below the epidermis which is the surface epithelium
of the skin.
[0733] Split dose: As used herein, a "split dose" is the division
of single unit dose or total daily dose into two or more doses.
[0734] Stable: As used herein "stable" refers to a compound that is
sufficiently robust to survive isolation to a useful degree of
purity from a reaction mixture, and preferably capable of
formulation into an efficacious therapeutic agent.
[0735] Stabilized: As used herein, the term "stabilize",
"stabilized," "stabilized region" means to make or become
stable.
[0736] Subject: As used herein, the term "subject" or "patient"
refers to any organism to which a composition in accordance with
the invention may be administered, e.g., for experimental,
diagnostic, prophylactic, and/or therapeutic purposes. Typical
subjects include animals (e.g., mammals such as mice, rats,
rabbits, non-human primates, and humans) and/or plants.
[0737] Substantially: As used herein, the term "substantially"
refers to the qualitative condition of exhibiting total or
near-total extent or degree of a characteristic or property of
interest. One of ordinary skill in the biological arts will
understand that biological and chemical phenomena rarely, if ever,
go to completion and/or proceed to completeness or achieve or avoid
an absolute result. The term "substantially" is therefore used
herein to capture the potential lack of completeness inherent in
many biological and chemical phenomena.
[0738] Substantially equal: As used herein as it relates to time
differences between doses, the term means plus/minus 2%.
[0739] Substantially simultaneously: As used herein and as it
relates to plurality of doses, the term means within 2 seconds.
[0740] Suffering from: An individual who is "suffering from" a
disease, disorder, and/or condition has been diagnosed with or
displays one or more symptoms of a disease, disorder, and/or
condition.
[0741] Susceptible to: An individual who is "susceptible to" a
disease, disorder, and/or condition has not been diagnosed with
and/or may not exhibit symptoms of the disease, disorder, and/or
condition but harbors a propensity to develop a disease or its
symptoms. In some embodiments, an individual who is susceptible to
a disease, disorder, and/or condition (for example, cancer) may be
characterized by one or more of the following: (1) a genetic
mutation associated with development of the disease, disorder,
and/or condition; (2) a genetic polymorphism associated with
development of the disease, disorder, and/or condition; (3)
increased and/or decreased expression and/or activity of a protein
and/or nucleic acid associated with the disease, disorder, and/or
condition; (4) habits and/or lifestyles associated with development
of the disease, disorder, and/or condition; (5) a family history of
the disease, disorder, and/or condition; and (6) exposure to and/or
infection with a microbe associated with development of the
disease, disorder, and/or condition. In some embodiments, an
individual who is susceptible to a disease, disorder, and/or
condition will develop the disease, disorder, and/or condition. In
some embodiments, an individual who is susceptible to a disease,
disorder, and/or condition will not develop the disease, disorder,
and/or condition.
[0742] Symptom: As used herein, the term "symptom" is a signal of a
disease, disorder and/or condition. For example, symptoms may be
felt or noticed by the subject who has them but may not be easily
accessed by looking at a subject's outward appearance or behaviors.
Examples of symptoms include, but are not limited to, weakness,
aches and pains, fever, fatigue, weight loss, blood clots,
increased blood calcium levels, low white blood cell count, short
of breath, dizziness, headaches, hyperpigmentation, jaundice,
erthema, pruritis, excessive hair growth, change in bowel habits,
change in bladder function, long-lasting sores, white patches
inside the mouth, white spots on the tongue, unusual bleeding or
discharge, thickening or lump on parts of the body, indigestion,
trouble swallowing, changes in warts or moles, change in new skin
and nagging cough or hoarseness.
[0743] Synthetic: The term "synthetic" means produced, prepared,
and/or manufactured by the hand of man. Synthesis of
polynucleotides or polypeptides or other molecules of the present
invention may be chemical or enzymatic.
[0744] Targeted Cells: As used herein, "targeted cells" refers to
any one or more cells of interest. The cells may be found in vitro,
in vivo, in situ or in the tissue or organ of an organism. The
organism may be an animal, preferably a mammal, more preferably a
human and most preferably a patient.
[0745] Therapeutic Agent: The term "therapeutic agent" refers to
any agent that, when administered to a subject, has a therapeutic,
diagnostic, and/or prophylactic effect and/or elicits a desired
biological and/or pharmacological effect.
[0746] Therapeutically effective amount: As used herein, the term
"therapeutically effective amount" means an amount of an agent to
be delivered (e.g., nucleic acid, drug, therapeutic agent,
diagnostic agent, prophylactic agent, etc.) that is sufficient,
when administered to a subject suffering from or susceptible to an
infection, disease, disorder, and/or condition, to treat, improve
symptoms of, diagnose, prevent, and/or delay the onset of the
infection, disease, disorder, and/or condition.
[0747] Therapeutically effective outcome: As used herein, the term
"therapeutically effective outcome" means an outcome that is
sufficient in a subject suffering from or susceptible to an
infection, disease, disorder, and/or condition, to treat, improve
symptoms of, diagnose, prevent, and/or delay the onset of the
infection, disease, disorder, and/or condition.
[0748] Total daily dose: As used herein, a "total daily dose" is an
amount given or prescribed in 24 hr period. It may be administered
as a single unit dose.
[0749] Transcription factor: As used herein, the term
"transcription factor" refers to a DNA-binding protein that
regulates transcription of DNA into RNA, for example, by activation
or repression of transcription. Some transcription factors effect
regulation of transcription alone, while others act in concert with
other proteins. Some transcription factor can both activate and
repress transcription under certain conditions. In general,
transcription factors bind a specific target sequence or sequences
highly similar to a specific consensus sequence in a regulatory
region of a target gene. Transcription factors may regulate
transcription of a target gene alone or in a complex with other
molecules.
[0750] Treating: As used herein, the term "treating" refers to
partially or completely alleviating, ameliorating, improving,
relieving, delaying onset of, inhibiting progression of, reducing
severity of, and/or reducing incidence of one or more symptoms or
features of a particular infection, disease, disorder, and/or
condition. For example, "treating" cancer may refer to inhibiting
survival, growth, and/or spread of a tumor. Treatment may be
administered to a subject who does not exhibit signs of a disease,
disorder, and/or condition and/or to a subject who exhibits only
early signs of a disease, disorder, and/or condition for the
purpose of decreasing the risk of developing pathology associated
with the disease, disorder, and/or condition.
[0751] Tumor: As used herein, a "tumor" is an abnormal growth of
tissue, whether benign or malignant.
[0752] Tumor growth: As used herein, the term "tumor growth" or
"tumor metastases" means an increased mass or volume of the tumor
or expansion of the tumor distribution.
[0753] Unmodified: As used herein, "unmodified" refers to any
substance, compound or molecule prior to being changed in any way.
Unmodified may, but does not always, refer to the wild type or
native form of a biomolecule. Molecules may undergo a series of
modifications whereby each modified molecule may serve as the
"unmodified" starting molecule for a subsequent modification.
EQUIVALENTS AND SCOPE
[0754] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments in accordance with the
invention described herein. The scope of the present invention is
not intended to be limited to the above Description, but rather is
as set forth in the appended claims.
[0755] In the claims, articles such as "a," "an," and "the" may
mean one or more than one unless indicated to the contrary or
otherwise evident from the context. Claims or descriptions that
include "or" between one or more members of a group are considered
satisfied if one, more than one, or all of the group members are
present in, employed in, or otherwise relevant to a given product
or process unless indicated to the contrary or otherwise evident
from the context. The invention includes embodiments in which
exactly one member of the group is present in, employed in, or
otherwise relevant to a given product or process. The invention
includes embodiments in which more than one, or all of the group
members are present in, employed in, or otherwise relevant to a
given product or process.
[0756] It is also noted that the term "comprising" is intended to
be open and permits but does not require the inclusion of
additional elements or steps. When the term "comprising" is used
herein, the term "consisting of" is thus also encompassed and
disclosed.
[0757] Where ranges are given, endpoints are included. Furthermore,
it is to be understood that unless otherwise indicated or otherwise
evident from the context and understanding of one of ordinary skill
in the art, values that are expressed as ranges can assume any
specific value or subrange within the stated ranges in different
embodiments of the invention, to the tenth of the unit of the lower
limit of the range, unless the context clearly dictates
otherwise.
[0758] In addition, it is to be understood that any particular
embodiment of the present invention that falls within the prior art
may be explicitly excluded from any one or more of the claims.
Since such embodiments are deemed to be known to one of ordinary
skill in the art, they may be excluded even if the exclusion is not
set forth explicitly herein. Any particular embodiment of the
compositions of the invention (e.g., any nucleic acid or protein
encoded thereby; any method of production; any method of use; etc.)
can be excluded from any one or more claims, for any reason,
whether or not related to the existence of prior art.
[0759] All cited sources, for example, references, publications,
databases, database entries, and art cited herein, are incorporated
into this application by reference, even if not expressly stated in
the citation. In case of conflicting statements of a cited source
and the instant application, the statement in the instant
application shall control.
[0760] Section and table headings are not intended to be
limiting.
EXAMPLES
Example 1
Polynucleotide Production
[0761] Modified mrnas (mmRNA) according to the invention may be
made using standard laboratory methods and materials.
[0762] The open reading frame with various upstream or downstream
regions (.beta.-globin, tags, etc.) is ordered from DNA2.0 (Menlo
Park, Calif.) and typically contains a multiple cloning site with
XbaI recognition. Upon receipt of the construct, it is
reconstituted and transformed into chemically competent E. coli.
For the present invention, NEB DH5-alpha Competent E. coli are
used. A typical clone map is shown in FIG. 7. Transformations are
performed according to NEB instructions using 100 ng of plasmid.
The protocol is as follows: [0763] 1. Thaw a tube of NEB 5-alpha
Competent E. coli cells on ice for 10 minutes. [0764] 2. Add 1-5
.mu.l containing 1 pg-100 ng of plasmid DNA to the cell mixture.
Carefully flick the tube 4-5 times to mix cells and DNA. Do not
vortex. [0765] 3. Place the mixture on ice for 30 minutes. Do not
mix. [0766] 4. Heat shock at 42.degree. C. for exactly 30 seconds.
Do not mix. [0767] 5. Place on ice for 5 minutes. Do not mix.
[0768] 6. Pipette 950 .mu.l of room temperature SOC into the
mixture. [0769] 7. Place at 37.degree. C. for 60 minutes. Shake
vigorously (250 rpm) or rotate. [0770] 8. Warm selection plates to
37.degree. C. [0771] 9. Mix the cells thoroughly by flicking the
tube and inverting.
[0772] Spread 50-100 .mu.l of each dilution onto a selection plate
and incubate overnight at 37.degree. C. Alternatively, incubate at
30.degree. C. for 24-36 hours or 25.degree. C. for 48 hours.
[0773] A single colony is then used to inoculate 5 ml of LB growth
media using the appropriate antibiotic and then allowed to grow
(250 RPM, 37.degree. C.) for 5 hours. This is then used to
inoculate a 200 ml culture medium and allowed to grow overnight
under the same conditions.
[0774] To isolate the plasmid (up to 850 .mu.g), a maxi prep is
performed using the Invitrogen PURELINK.TM. HiPure Maxiprep Kit
(Carlsbad, Calif.), following the manufacturer's instructions.
[0775] In order to generate cDNA for In Vitro Transcription (IVT),
the plasmid is first linearized using a restriction enzyme such as
XbaI. A typical restriction digest with XbaI will comprise the
following: Plasmid 1.0 .mu.g; 10.times. Buffer 1.0 .mu.l; XbaI 1.5
.mu.l; dH.sub.20 up to 10 .mu.l; incubated at 37.degree. C. for 1
hr. If performing at lab scale (<5 .mu.g), the reaction is
cleaned up using Invitrogen's PURELINK.TM. PCR Micro Kit (Carlsbad,
Calif.) per manufacturer's instructions. Larger scale purifications
may need to be done with a product that has a larger load capacity
such as Invitrogen's standard PURELINK.TM. PCR Kit (Carlsbad,
Calif.). Following the cleanup, the linearized vector is quantified
using the NanoDrop and analyzed to confirm linearization using
agarose gel electrophoresis.
[0776] As a non-limiting example, G-CSF may represent the
polypeptide of interest. Sequences used in the steps outlined in
Examples 1-5 are shown in Table 4. It should be noted that the
start codon (ATG) has been underlined in each sequence of Table
4.
TABLE-US-00004 TABLE 4 G-CSF Sequences SEQ ID NO Description 9
cDNAsequence: ATGGCTGGACCTGCCACCCAGAGCCCCATGAAGCTGATGGCCCT
GCAGCTGCTGCTGTGGCACAGTGCACTCTGGACAGTGCAGGAAG
CCACCCCCCTGGGCCCTGCCAGCTCCCTGCCCCAGAGCTTCCTG
CTCAAGTGCTTAGAGCAAGTGAGGAAGATCCAGGGCGATGGCGC
AGCGCTCCAGGAGAAGCTGTGTGCCACCTACAAGCTGTGCCACC
CCGAGGAGCTGGTGCTGCTCGGACACTCTCTGGGCATCCCCTGG
GCTCCCCTGAGCAGCTGCCCCAGCCAGGCCCTGCAGCTGGCAGG
CTGCTTGAGCCAACTCCATAGCGGCCTTTTCCTCTACCAGGGGC
TCCTGCAGGCCCTGGAAGGGATCTCCCCCGAGTTGGGTCCCACC
TTGGACACACTGCAGCTGGACGTCGCCGACTTTGCCACCACCAT
CTGGCAGCAGATGGAAGAACTGGGAATGGCCCCTGCCCTGCAGC
CCACCCAGGGTGCCATGCCGGCCTTCGCCTCTGCTTTCCAGCGC
CGGGCAGGAGGGGTCCTGGTTGCCTCCCATCTGCAGAGCTTCCT
GGAGGTGTCGTACCGCGTTCTACGCCACCTTGCCCAGCCCTGA 10 cDNA having T7
polymerase site, AfeI and Xba restriction site: TAATACGACTCACTATA
GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCC
ACCATGGCTGGACCTGCCACCCAGAGCCCCATGAAGCTGATGGC
CCTGCAGCTGCTGCTGTGGCACAGTGCACTCTGGACAGTGCAGG
AAGCCACCCCCCTGGGCCCTGCCAGCTCCCTGCCCCAGAGCTTC
CTGCTCAAGTGCTTAGAGCAAGTGAGGAAGATCCAGGGCGATGG
CCGCAGCGCTCCAGGAGAAGTGTGTGCCACCTACAAGCTGTGCC
ACCCCGAGGAGCTGGTGCTGCTCGGACACTCTCTGGGCATCCCC
TGGGCTCCCCTGAGCAGCTGCCCCAGCCAGGCCCTGCAGCTGGC
GAGCTGCTTGAGCCAACTCCATAGCGGCCTTTTCCTCTACCAGG
GGCTCCTGCAGGCCCTGGAAGGGATCTCCCCCGAGTTGGGTCCC
ACCTTGGACACACTGCAGCTGGACGTCGCCGACTTTGCCACCAC
CATCTGGCAGCAGATGGAAGAACTGGGAATGGCCCCTGCCCTGC
AGCCCACCCAGGGTGCCATGCCGGCCTTCGCCTCTGCTTTCCAG
CGCCGGGCAGGAGGGGTCCTGGTTGCCTCCCATCTGCAGAGCTT
CCTGGAGGTGTCGTACCGCGTTCTACGCCACCTTGCCCAGCCCT
GAAGCGCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTC
TTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCT
GAGTAGGAAGGCGGCCGCTCGAGCATGCATCTAGA 11 Optimized sequence;
containing T7 polymerase site, AfeI and Xba restriction site
TAATACGACTCACTATA GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCC
ACCATGGCCGGTCCCGCGACCCAAAGCCCCATGAAACTTATGGC
CCTGCAGTTGCTGCTTTGGCACTCGGCCCTCTGGACAGTCCAAG
AAGCGACTCCTCTCGGACCTGCCTCATCGTTGCCGCAGTCATTC
CTTTTGAAGTGTCTGGAGCAGGTGCGAAAGATTCAGGGCGATGG
AGCCGCACTCCAAGAGAAGCTCTGCGCGACATACAAACTTTGCC
ATCCCGAGGAGCTCGTACTGCTCGGGCACAGCTTGGGGATTCCC
TGGGCTCCTCTCTCGTCCTGTCCGTCGCAGGCTTTGCAGTTGGC
AGGGTGCCTTTCCCAGCTCCACTCCGGTTTGTTCTTGTATCAGG
GACTGCTGCAAGCCCTTGAGGGAATCTCGCCAGAATTGGGCCCG
ACGCTGGACACGTTGCAGCTCGACGTGGCGGATTTCGCAACAAC
CATCTGGCAGCAGATGGAGGAACTGGGGATGGCACCCGCGCTGC
AGCCCACGCAGGGGGCAATGCCGGCCTTTGCGTCCGCGTTTCAG
GCGCAGGGCGGTGGAGTCCTCGTAGCGAGCCACCTTCAATCATT
TTTGGAAGTCTCGTACCGGGTGCTGAGACATCTTGCGCAGCCGT
GAAGCGCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTC
TTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCT
GAGTAGGAAGGCGGCCGCTCGAGCATGCATCTAGA 12 mRNA sequence (transcribed)
GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCC ACC
AUGGCCGGUCCCGCGACCCAAAGCCCCAUGAAACUUAUGGCCCU
GCAGUUGCUGCUUUGGCACUCGGCCCUCUGGACAGUCCAAGAAG
CGACUCCUCUCGGACCUGCCUCAUCGUUGCCGCAGUCAUUCCUU
UUGAAGUGUCUGGAGCAGGUGCGAAAGAUUCAGGGCGAUGGAGC
CGCACUCCAAGAGAAGCUCUGCGCGACAUACAAACUUUGCCAUC
CCGAGGAGCUCGUACUGCUCGGGCACAGCUUGGGGAUUCCCUGG
GCUCCUCUCUCGUCCUGUCCGUCGCAGGCUUUGCAGUUGGCAGG
CGUGCCUUUCCCAGCUCCACUCGGUUUGUUCUUGUAUCAGGGAC
UGCUGCAAGCCCUUGAGGGAAUCUCGCCAGAAUUGGGCCCGACG
CUGGACACGUUGCAGCUCGACGUGGCGGAUUUCGCAACAACCAU
CUGGCAGCAGAUGGAGGAACUGGGGAUGGCACCCGCGCUGCAGC
CCACGCAGGGGGCAAUGCCGGCCUUUGCGUCCGCGUUUCAGCGC
AGGGCGGGUGGAGUCCUCGUAGCGAGCCACCUUCAAUCAUUUUU
GGAAGUCUCGUACCGGGUGCUGAGACAUCUUGCGCAGCCGUGA
AGCGCUGCCUUCUGCGGGGCUUGCCUUCUGGCCAUGCCCUUCUU
CUCUCCCUUGCACCUGUACCUCUUGGUCUUUGAAUAAAGCCUGA GUAGGAAG
Example 2
PCR for cDNA Production
[0777] PCR procedures for the preparation of cDNA are performed
using 2.times.KAPA HIFI.TM. HotStart ReadyMix by Kapa Biosystems
(Woburn, Mass.). This system includes 2.times.KAPA ReadyMix12.5
.mu.l; Forward Primer (10 uM) 0.75 .mu.l; Reverse Primer (10 uM)
0.75 .mu.l; Template cDNA 100 ng; and dH.sub.20 diluted to 25.0
.mu.l. The reaction conditions are at 95.degree. C. for 5 min. and
25 cycles of 98.degree. C. for 20 sec, then 58.degree. C. for 15
sec, then 72.degree. C. for 45 sec, then 72.degree. C. for 5 min.
then 4.degree. C. to termination.
[0778] The reverse primer of the instant invention incorporates a
poly-T.sub.120 for a poly-A.sub.120 in the mRNA. Other reverse
primers with longer or shorter poly(T) tracts can be used to adjust
the length of the poly(A) tail in the mRNA.
[0779] The reaction is cleaned up using Invitrogen's PURELINK.TM.
PCR Micro Kit (Carlsbad, Calif.) per manufacturer's instructions
(up to 5 .mu.g). Larger reactions will require a cleanup using a
product with a larger capacity. Following the cleanup, the cDNA is
quantified using the NanoDrop and analyzed by agarose gel
electrophoresis to confirm the cDNA is the expected size. The cDNA
is then submitted for sequencing analysis before proceeding to the
in vitro transcription reaction.
Example 3
In Vitro Transcription (IVT)
[0780] The in vitro transcription reaction generates mRNA
containing modified nucleotides or modified RNA. The input
nucleotide triphosphate (NTP) mix is made in-house using natural
and un-natural NTPs.
[0781] A typical in vitro transcription reaction includes the
following: [0782] 1. Template cDNA 1.0 .mu.g [0783] 2. 10.times.
transcription buffer (400 mM Tris-HCl pH 8.0, 190 mM MgCl.sub.2, 50
mM DTT, 10 mM Spermidine) 2.0 .mu.l [0784] 3. Custom NTPs (25 mM
each) 7.2 .mu.l [0785] 4. RNase Inhibitor 20 U [0786] 5. T7 RNA
polymerase 3000 U [0787] 6. dH.sub.20 Up to 20.0 .mu.l. and [0788]
7. Incubation at 37.degree. C. for 3 hr-5 hrs.
[0789] The crude IVT mix may be stored at 4.degree. C. overnight
for cleanup the next day. 1 U of RNase-free DNase is then used to
digest the original template. After 15 minutes of incubation at
37.degree. C., the mRNA is purified using Ambion's MEGACLEAR.TM.
Kit (Austin, Tex.) following the manufacturer's instructions. This
kit can purify up to 500 .mu.g of RNA. Following the cleanup, the
RNA is quantified using the NanoDrop and analyzed by agarose gel
electrophoresis to confirm the RNA is the proper size and that no
degradation of the RNA has occurred.
Example 4
Enzymatic Capping of mRNA
[0790] Capping of the mRNA is performed as follows where the
mixture includes: IVT RNA 60 .mu.g-180 .mu.g and dH.sub.20 up to 72
.mu.l. The mixture is incubated at 65.degree. C. for 5 minutes to
denature RNA, and then is transferred immediately to ice.
[0791] The protocol then involves the mixing of 10.times. Capping
Buffer (0.5 M Tris-HCl (pH 8.0), 60 mM KCl, 12.5 mM MgCl.sub.2)
(10.0 .mu.l); 20 mM GTP (5.0 .mu.l); 20 mM S-Adenosyl Methionine
(2.5 .mu.l); RNase Inhibitor (100 U); 2'-O-Methyltransferase
(400U); Vaccinia capping enzyme (Guanylyl transferase) (40 U);
dH.sub.20 (Up to 28 .mu.l); and incubation at 37.degree. C. for 30
minutes for 60 .mu.g RNA or up to 2 hours for 180 .mu.g of RNA.
[0792] The mRNA is then purified using Ambion's MEGACLEAR.TM. Kit
(Austin, Tex.) following the manufacturer's instructions. Following
the cleanup, the RNA is quantified using the NANODROP.TM.
(ThermoFisher, Waltham, Mass.) and analyzed by agarose gel
electrophoresis to confirm the RNA is the proper size and that no
degradation of the RNA has occurred. The RNA product may also be
sequenced by running a reverse-transcription-PCR to generate the
cDNA for sequencing.
Example 5
PolyA Tailing Reaction
[0793] Without a poly-T in the cDNA, a poly-A tailing reaction must
be performed before cleaning the final product. This is done by
mixing Capped IVT RNA (100 .mu.l); RNase Inhibitor (20 U);
10.times. Tailing Buffer (0.5 M Tris-HCl (pH 8.0), 2.5 M NaCl, 100
mM MgCl.sub.2)(12.0 .mu.l); 20 mM ATP (6.0 .mu.l); Poly-A
Polymerase (20 U); dH.sub.20 up to 123.5 .mu.l and incubation at
37.degree. C. for 30 min. If the poly-A tail is already in the
transcript, then the tailing reaction may be skipped and proceed
directly to cleanup with Ambion's MEGACLEAR.TM. kit (Austin, Tex.)
(up to 500 .mu.g). Poly-A Polymerase is preferably a recombinant
enzyme expressed in yeast.
[0794] For studies performed and described herein, the poly-A tail
is encoded in the IVT template to comprise 160 nucleotides in
length. However, it should be understood that the processivity or
integrity of the polyA tailing reaction may not always result in
exactly 160 nucleotides. Hence polyA tails of approximately 160
nucleotides, e.g, about 150-165, 155, 156, 157, 158, 159, 160, 161,
162, 163, 164 or 165 are within the scope of the invention.
Example 6
Natural 5' Caps and 5' Cap Analogues
[0795] 5'-capping of modified RNA may be completed concomitantly
during the in vitro-transcription reaction using the following
chemical RNA cap analogs to generate the 5'-guanosine cap structure
according to manufacturer protocols: 3'-O-Me-m7G(5')ppp(5') G [the
ARCA cap];G(5')ppp(5')A; G(5')ppp(5')G; m7G(5')ppp(5')A;
m7G(5')ppp(5')G (New England BioLabs, Ipswich, Mass.). 5'-capping
of modified RNA may be completed post-transcriptionally using a
Vaccinia Virus Capping Enzyme to generate the "Cap 0" structure:
m7G(5')ppp(5')G (New England BioLabs, Ipswich, Mass.). Cap 1
structure may be generated using both Vaccinia Virus Capping Enzyme
and a 2'-O methyl-transferase to generate:
m7G(5')ppp(5')G-2'-O-methyl. Cap 2 structure may be generated from
the Cap 1 structure followed by the 2'-O-methylation of the
5'-antepenultimate nucleotide using a 2'-O methyl-transferase. Cap
3 structure may be generated from the Cap 2 structure followed by
the 2'-O-methylation of the 5'-preantepenultimate nucleotide using
a 2'-O methyl-transferase. Enzymes are preferably derived from a
recombinant source.
[0796] When transfected into mammalian cells, the modified mRNAs
have a stability of between 12-18 hours or more than 18 hours,
e.g., 24, 36, 48, 60, 72 or greater than 72 hours.
Example 7
Capping
[0797] A. Protein Expression Assay
[0798] Synthetic mRNAs encoding human G-CSF (cDNA shown in SEQ ID
NO: 9; mRNA sequence fully modified with 5-methylcytosine at each
cytosine and pseudouridine replacement at each uridine site shown
in SEQ ID NO: 12 with a polyA tail approximately 160 nucleotides in
length not shown in sequence) containing the ARCA (3'
O-Me-m7G(5')ppp(5')G) cap analog or the Cap1 structure can be
transfected into human primary keratinocytes at equal
concentrations. 6, 12, 24 and 36 hours post-transfection the amount
of G-CSF secreted into the culture medium can be assayed by ELISA.
Synthetic mRNAs that secrete higher levels of G-CSF into the medium
would correspond to a synthetic mRNA with a higher
translationally-competent Cap structure.
[0799] B. Purity Analysis Synthesis
[0800] Synthetic mRNAs encoding human G-CSF (cDNA shown in SEQ ID
NO: 9; mRNA sequence fully modified with 5-methylcytosine at each
cytosine and pseudouridine replacement at each uridine site shown
in SEQ ID NO: 12 with a polyA tail approximately 160 nucleotides in
length not shown in sequence) containing the ARCA cap analog or the
Cap1 structure crude synthesis products can be compared for purity
using denaturing Agarose-Urea gel electrophoresis or HPLC analysis.
Synthetic mRNAs with a single, consolidated band by electrophoresis
correspond to the higher purity product compared to a synthetic
mRNA with multiple bands or streaking bands. Synthetic mRNAs with a
single HPLC peak would also correspond to a higher purity product.
The capping reaction with a higher efficiency would provide a more
pure mRNA population.
[0801] C. Cytokine Analysis
[0802] Synthetic mRNAs encoding human G-CSF (cDNA shown in SEQ ID
NO: 9; mRNA sequence fully modified with 5-methylcytosine at each
cytosine and pseudouridine replacement at each uridine site shown
in SEQ ID NO: 12 with a polyA tail approximately 160 nucleotides in
length not shown in sequence) containing the ARCA cap analog or the
Cap1 structure can be transfected into human primary keratinocytes
at multiple concentrations. 6, 12, 24 and 36 hours
post-transfection the amount of pro-inflammatory cytokines such as
TNF-alpha and IFN-beta secreted into the culture medium can be
assayed by ELISA. Synthetic mRNAs that secrete higher levels of
pro-inflammatory cytokines into the medium would correspond to a
synthetic mRNA containing an immune-activating cap structure.
[0803] D. Capping Reaction Efficiency
[0804] Synthetic mRNAs encoding human G-CSF (cDNA shown in SEQ ID
NO: 9; mRNA sequence fully modified with 5-methylcytosine at each
cytosine and pseudouridine replacement at each uridine site shown
in SEQ ID NO: 12 with a polyA tail approximately 160 nucleotides in
length not shown in sequence) containing the ARCA cap analog or the
Cap1 structure can be analyzed for capping reaction efficiency by
LC-MS after capped mRNA nuclease treatment. Nuclease treatment of
capped mRNAs would yield a mixture of free nucleotides and the
capped 5'-5-triphosphate cap structure detectable by LC-MS. The
amount of capped product on the LC-MS spectra can be expressed as a
percent of total mRNA from the reaction and would correspond to
capping reaction efficiency. The cap structure with higher capping
reaction efficiency would have a higher amount of capped product by
LC-MS.
Example 8
Agarose Gel Electrophoresis of Modified RNA or RT PCR Products
[0805] Individual modified RNAs (200-400 ng in a 20 .mu.l volume)
or reverse transcribed PCR products (200-400 ng) are loaded into a
well on a non-denaturing 1.2% Agarose E-Gel (Invitrogen, Carlsbad,
Calif.) and run for 12-15 minutes according to the manufacturer
protocol.
Example 9
Nanodrop Modified RNA Quantification and UV Spectral Data
[0806] Modified RNAs in TE buffer (1 .mu.l) are used for Nanodrop
UV absorbance readings to quantitate the yield of each modified RNA
from an in vitro transcription reaction.
Example 10
Formulation of Polynucleotides
[0807] Polynucleotides may be formulated for in vitro and in vivo
experiments according to the methods taught in International
Application No. PCT/US12/069610 filed Dec. 14, 2012, the contents
of which are incorporated herein by reference in their
entirety.
Example 11
Assays and Methods of Detection or Analysis of Polynucleotides
[0808] Polynucleotides may be investigated using the methods
described in International Application No. PCT/US2012/58519 filed
Oct. 3, 2012 and in International Application No. PCT/US12/069610
filed Dec. 14, 2012, the contents of which are incorporated herein
by reference in their entirety.
Example 12
Carboxy-Terminal Peptide Constructs
[0809] The polynucleotide, primary construct and/or mmRNA of the
present invention can have at least one nucleic acid sequence
encoding at least one carboxy-terminal peptide (CTP). The
carboxy-terminal peptides can increase the half-life of the
polynucleotides, primary constructs and/or mmRNA of the present
invention and can increase the half-life of the proteins encoded by
the polynucleotides, primary constructs and/or mmRNA. The
polynucleotides, primary constructs and/or mmRNA of the present
invention may include at least one chemical modification and/or at
least one terminal modification (e.g., miR binding sites). Examples
of carboxy-terminal peptide constructs are shown in Table 5. In
Table 5, the carboxy-terminal peptides are underlined in the amino
acid sequences, "CTP" stands for carboxy-terminal peptide, "FGF23"
stands for fibroblast growth factor 23, "HGH" stands for human
growth hormone, "G-CSF" stands for granulocyte colony stimulating
growth factor and "GLP" stands for glucagon-like peptide.
TABLE-US-00005 TABLE 5 Carboxy-terminal peptide constructs SEQ SEQ
Protein ID ID Description Sequence NO mRNA Sequence NO Albiglutide
MKWVSFISLLF 13 (without LFSSAYSGSLD albumin) KRHGEGTFTSD with 2
CTPs VSSYLEGQAAK EFIAWLVKGRS SSSKAPPPSLPS PSRLPGPSDTPI LPQSSSSKAPPP
SLPSPSRLPGPS DTPILPQ Albiglutide GGGAAAUAAGAGAGAAAAGAAG 30 (without
AGUAAGAAGAAAUAUAAGAGCC albumin) ACCAUGAAGUGGGUGUCGUUCA with 2 CTPs
UCUCACUGUUGUUCCUUUUCAG CUCGGCGUACUCGGGGUCACUCG
ACAAACGCCACGGAGAGGGCACC UUUACUUCCGAUGUCAGCUCCU
ACCUCGAAGGCCAGGCGGCAAA GGAAUUCAUCGCCUGGCUGGUG
AAGGGAAGAAGCUCAUCGAGCA AGGCCCCUCCACCGUCCCUCCCU
UCGCCGUCCCGGCUGCCGGGACC AAGCGACACUCCGAUCCUGCCAC
AAUCGUCAUCCUCCAAAGCUCCU CCACCCUCGCUGCCAUCCCCGUC
AAGGCUGCCCGGUCCGAGCGAU ACCCCGAUUCUCCCGCAGUCAUC
CUCGAGCAAGGCCCCUCCGCCCU CACUGCCAUCGCCAAGCCGCCUG
CCGGGACCUUCCGACACCCCGAU CCUCCCGCAGUCAUCCUCGAGCA
AGGCCCCUCCGCCCUCACUGCCA UCGCCAAGCCGCCUGCCGGGACC
UUCCGACACCCCGAUCCUCCCGC AGUGAUAAUAGGCUGGAGCCUC
GGUGGCCAUGCUUCUUGCCCCUU GGGCCUCCCCCCAGCCCCUCCUC
CCCUUCCUGCACCCGUACCCCCG UGGUCUUUGAAUAAAGUCUGAG UGGGCGGC Albiglutide
MKWVSFISLLF 14 GLP-1 with LFSSAYSGSLD 2 CTPs KRHGEGTFTSD
VSSYLEGQAAK EFIAWLVKGRS SSSKAPPPSLPS PSRLPGPSDTPI LPQSSSSKAPPP
SLPSPSRLPGPS DTPILPQ Dulaglutide MKWVSFISLLF 15 GLP-1 with
LFSSAYSGSLD 2 CTPs KRHGEGTFTSD VSSYLEEQAAK EFIAWLVKGGG GGGGSGGGGS
GGGGSSSSKAP PPSLPSPSRLPG PSDTPILPQSSS SKAPPPSLPSPS RLPGPSDTPILP Q
FGF23 MLGARLRLWV 16 GGGAAAUAAGAGAGAAAAGAAG 31 fragment CALCSVCSMSV
AGUAAGAAGAAAUAUAAGAGCC (180-251) LRASAEDDSER ACCAUGCUGGGUGCAAGACUUC
with 1 CTP DPLNVLKPRAR GCCUUUGGGUGUGCGCACUUUG MTPAPASCSQE
CAGCGUGUGUUCAAUGAGCGUG LPSAEDNSPMA CUGAGAGCAUCCGCCGAGGACG
SDPLGVVRGGR ACUCCGAACGUGACCCCUUGAAC VNTHAGGTGP
GUGCUGAAGCCUAGGGCUAGAA EGCRPFAKFISS UGACGCCAGCCCCUGCGUCAUGC
SSKAPPPSLPSP UCGCAAGAACUCCCGUCGGCGGA SRLPGPSDTPIL
GGAUAACUCCCCUAUGGCAUCCG PQ AUCCUCUGGGAGUGGUGCGAGG
UGGUCGUGUUAACACCCACGCG GGUGGCACUGGACCCGAAGGGU
GUAGACCUUUCGCAAAGUUUAU CUCAUCCUCGAGCAAGGCCCCUC
CGCCCUCACUGCCAUCGCCAAGC CGCCUGCCGGGACCUUCCGACAC
CCCGAUCCUCCCGCAGGCUGGAG CCUCGGUGGCCAUGCUUCUUGCC
CCUUGGGCCUCCCCCCAGCCCCU CCUCCCCUUCCUGCACCCGUACC
CCCGUGGUCUUUGAAUAAAGUC UGAGUGGGCGGC FGF23 MKWVSFISLLF 17 fragment
LFSSAYSGSLD (180-251) KRSAEDDSERD with 2 CTPs PLNVLKPRAR
MTPAPASCSQE LPSAEDNSPMA SDPLGVVRGGR VNTHAGGTGP EGCRPFAKFISS
SSKAPPPSLPSP SRLPGPSDTPIL PQSSSSKAPPPS LPSPSRLPGPSD TPILPQ FGF23
MLGARLRLWV 18 fragment CALCSVCSMSV (180-251) LRASAEDDSER with 1 CTP
DPLNVLKPRAR MTPAPASCSQE LPSAEDNSPMA SDPLGVVRGGR VNTHAGGTGP
EGCRPFAKFISS SSKAPPPSLPSP SRLPGPSDTPIL PQ G-CSF with MAGPATQSPM 19
GGGAAAUAAGAGAGAAAAGAAG 32 3 CTPs KLMALQLLLW AGUAAGAAGAAAUAUAAGAGCC
HSALWTVQESS ACCAUGGCCGGUCCCGCGACCCA SSKAPPPSLPSP
AAGCCCCAUGAAACUUAUGGCCC SRLPGPSDTPIL UGCAGUUGCUGCUUUGGCACUC
PQATPLGPASS GGCCCUCUGGACAGUCCAAGAA LPQSFLLKCLE
UCAUCCUCGAGCAAGGCCCCUCC QVRKIQGDGA GCCCUCACUGCCAUCGCCAAGCC
ALQEKLCATY GCCUGCCGGGACCUUCCGACACC KLCHPEELVLL
CCGAUCCUCCCGCAGGCGACUCC GHSLGIPWAPL UCUCGGACCUGCCUCAUCGUUGC
SSCPSQALQLA CGCAGUCAUUCCUUUUGAAGUG GCLSQLHSGLF
UCUGGAGCAGGUGCGAAAGAUU LYQGLLQALEG CAGGGCGAUGGAGCCGCACUCCA
ISPELGPTLDTL AGAGAAGCUCUGCGCGACAUAC QLDVADFATTI
AAACUUUGCCAUCCCGAGGAGC WQQMEELGM UCGUACUGCUCGGGCACAGCUU APALQPTQGA
GGGGAUUCCCUGGGCUCCUCUCU MPAFASAFQRR CGUCCUGUCCGUCGCAGGCUUUG
AGGVLVASHL CAGUUGGCAGGGUGCCUUUCCC QSFLEVSYRVL
AGCUCCACUCCGGUUUGUUCUU RHLAQPSSSSK GUAUCAGGGACUGCUGCAAGCC
APPPSLPSPSRL CUUGAGGGAAUCUCGCCAGAAU PGPSDTPILPQS
UGGGCCCGACGCUGGACACGUU SSSKAPPPSLPS GCAGCUCGACGUGGCGGAUUUC
PSRLPGPSDTPI GCAACAACCAUCUGGCAGCAGA LPQ UGGAGGAACUGGGGAUGGCACC
CGCGCUGCAGCCCACGCAGGGGG CAAUGCCGGCCUUUGCGUCCGCG
UUUCAGCGCAGGGCGGGUGGAG UCCUCGUAGCGAGCCACCUUCAA
UCAUUUUUGGAAGUCUCGUACC GGGUGCUGAGACAUCUUGCGCA
GCCGUCAUCCUCGAGCAAGGCCC CUCCGCCCUCACUGCCAUCGCCA
AGCCGCCUGCCGGGACCUUCCGA CACCCCGAUCCUCCCGCAGUCAU
CCUCGAGCAAGGCCCCUCCGCCC UCACUGCCAUCGCCAAGCCGCCU
GCCGGGACCUUCCGACACCCCGA UCCUCCCGCAGGCUGGAGCCUCG
GUGGCCAUGCUUCUUGCCCCUUG GGCCUCCCCCCAGCCCCUCCUCC
CCUUCCUGCACCCGUACCCCCGU GGUCUUUGAAUAAAGUCUGAGU GGGCGGC G-CSF with
MATGSRTSLLL 20 GGGAAAUAAGAGAGAAAAGAAG 33 3 CTPs AFGLLCLPWLQ
AGUAAGAAGAAAUAUAAGAGCC EGSASSSSKAPP ACCAUGGCCACUGGGUCGAGGA
PSLPSPSRLPGP CCAGCCUGUUGUUGGCCUUUGG SDTPILPQATPL
GCUGCUUUGUCUGCCAUGGCUCC GPASSLPQSFLL AAGAGGGAUCCGCAUCAUCCUC
KCLEQVRKIQG GAGCAAGGCCCCUCCGCCCUCAC DGAALQEKLC
UGCCAUCGCCAAGCCGCCUGCCG ATYKLCHPEEL GGACCUUCCGACACCCCGAUCCU
VLLGHSLGIPW CCCGCAGGCGACUCCUCUCGGAC APLSSCPSQAL
CUGCCUCAUCGUUGCCGCAGUCA QLAGCLSQLHS UUCCUUUUGAAGUGUCUGGAGC
GLFLYQGLLQA AGGUGCGAAAGAUUCAGGGCGA LEGISPELGPTL
UGGAGCCGCACUCCAAGAGAAG DTLQLDVADF CUCUGCGCGACAUACAAACUUU
ATTIWQQMEEL GCCAUCCCGAGGAGCUCGUACUG GMAPALQPTQ
CUCGGGCACAGCUUGGGGAUUC GAMPAFASAF CCUGGGCUCCUCUCUCGUCCUGU
QRRAGGVLVA CCGUCGCAGGCUUUGCAGUUGG SHLQSFLEVSY
CAGGGUGCCUUUCCCAGCUCCAC RVLRHLAQPSS UCCGGUUUGUUCUUGUAUCAGG
SSKAPPPSLPSP GACUGCUGCAAGCCCUUGAGGG SRLPGPSDTPIL
AAUCUCGCCAGAAUUGGGCCCG PQSSSSKAPPPS ACGCUGGACACGUUGCAGCUCG
LPSPSRLPGPSD ACGUGGCGGAUUUCGCAACAAC TPILPQ CAUCUGGCAGCAGAUGGAGGAA
CUGGGGAUGGCACCCGCGCUGCA GCCCACGCAGGGGGCAAUGCCGG
CCUUUGCGUCCGCGUUUCAGCGC AGGGCGGGUGGAGUCCUCGUAG
CGAGCCACCUUCAAUCAUUUUU GGAAGUCUCGUACCGGGUGCUG
AGACAUCUUGCGCAGCCGUCAUC CUCGAGCAAGGCCCCUCCGCCCU
CACUGCCAUCGCCAAGCCGCCUG CCGGGACCUUCCGACACCCCGAU
CCUCCCGCAGUCAUCCUCGAGCA AGGCCCCUCCGCCCUCACUGCCA
UCGCCAAGCCGCCUGCCGGGACC UUCCGACACCCCGAUCCUCCCGC
AGGCUGGAGCCUCGGUGGCCAU GCUUCUUGCCCCUUGGGCCUCCC
CCCAGCCCCUCCUCCCCUUCCUG CACCCGUACCCCCGUGGUCUUUG
AAUAAAGUCUGAGUGGGCGGC G-CSF with MAGPATQSPM 21
GGGAAAUAAGAGAGAAAAGAAG 34 1 CTP KLMALQLLLW AGUAAGAAGAAAUAUAAGAGCC
HSALWTVQESS ACCAUGGCCGGUCCCGCGACCCA SSKAPPPSLPSP
AAGCCCCAUGAAACUUAUGGCCC SRLPGPSDTPIL UGCAGUUGCUGCUUUGGCACUC
PQATPLGPASS GGCCCUCUGGACAGUCCAAGAA LPQSFLLKCLE
UCAUCCUCGAGCAAGGCCCCUCC QVRKIQGDGA GCCCUCACUGCCAUCGCCAAGCC
ALQEKLCATY GCCUGCCGGGACCUUCCGACACC KLCHPEELVLL
CCGAUCCUCCCGCAGGCGACUCC GHSLGIPWAPL UCUCGGACCUGCCUCAUCGUUGC
SSCPSQALQLA CGCAGUCAUUCCUUUUGAAGUG GCLSQLHSGLF
UCUGGAGCAGGUGCGAAAGAUU LYQGLLQALEG CAGGGCGAUGGAGCCGCACUCCA
ISPELGPTLDTL AGAGAAGCUCUGCGCGACAUAC QLDVADFATTI
AAACUUUGCCAUCCCGAGGAGC WQQMEELGM UCGUACUGCUCGGGCACAGCUU APALQPTQGA
GGGGAUUCCCUGGGCUCCUCUCU MPAFASAFQRR CGUCCUGUCCGUCGCAGGCUUUG
AGGVLVASHL CAGUUGGCAGGGUGCCUUUCCC QSFLEVSYRVL
AGCUCCACUCCGGUUUGUUCUU RHLAQP GUAUCAGGGACUGCUGCAAGCC
CUUGAGGGAAUCUCGCCAGAAU UGGGCCCGACGCUGGACACGUU
GCAGCUCGACGUGGCGGAUUUC GCAACAACCAUCUGGCAGCAGA
UGGAGGAACUGGGGAUGGCACC CGCGCUGCAGCCCACGCAGGGGG
CAAUGCCGGCCUUUGCGUCCGCG UUUCAGCGCAGGGCGGGUGGAG
UCCUCGUAGCGAGCCACCUUCAA
UCAUUUUUGGAAGUCUCGUACC GGGUGCUGAGACAUCUUGCGCA
GCCGGCUGGAGCCUCGGUGGCCA UGCUUCUUGCCCCUUGGGCCUCC
CCCCAGCCCCUCCUCCCCUUCCU GCACCCGUACCCCCGUGGUCUUU
GAAUAAAGUCUGAGUGGGCGGC G-CSF with MAGPATQSPM 22
GGGAAAUAAGAGAGAAAAGAAG 35 2 CTPs KLMALQLLLW AGUAAGAAGAAAUAUAAGAGCC
HSALWTVQEA ACCAUGGCCGGUCCCGCGACCCA TPLGPASSLPQS
AAGCCCCAUGAAACUUAUGGCCC FLLKCLEQVRK UGCAGUUGCUGCUUUGGCACUC
IQGDGAALQEK GGCCCUCUGGACAGUCCAAGAA LCATYKLCHPE
GCGACUCCUCUCGGACCUGCCUC ELVLLGHSLGIP AUCGUUGCCGCAGUCAUUCCUU
WAPLSSCPSQA UUGAAGUGUCUGGAGCAGGUGC LQLAGCLSQLH
GAAAGAUUCAGGGCGAUGGAGC SGLFLYQGLLQ CGCACUCCAAGAGAAGCUCUGCG
ALEGISPELGPT CGACAUACAAACUUUGCCAUCCC LDTLQLDVADF
GAGGAGCUCGUACUGCUCGGGC ATTIWQQMEEL ACAGCUUGGGGAUUCCCUGGGC
GMAPALQPTQ UCCUCUCUCGUCCUGUCCGUCGC GAMPAFASAF
AGGCUUUGCAGUUGGCAGGGUG QRRAGGVLVA CCUUUCCCAGCUCCACUCCGGUU
SHLQSFLEVSY UGUUCUUGUAUCAGGGACUGCU RVLRHLAQPSS
GCAAGCCCUUGAGGGAAUCUCG SSKAPPPSLPSP CCAGAAUUGGGCCCGACGCUGG
SRLPGPSDTPIL ACACGUUGCAGCUCGACGUGGC PQSSSSKAPPPS
GGAUUUCGCAACAACCAUCUGG LPSPSRLPGPSD CAGCAGAUGGAGGAACUGGGGA TPILIQ
UGGCACCCGCGCUGCAGCCCACG CAGGGGGCAAUGCCGGCCUUUG
CGUCCGCGUUUCAGCGCAGGGCG GGUGGAGUCCUCGUAGCGAGCC
ACCUUCAAUCAUUUUUGGAAGU CUCGUACCGGGUGCUGAGACAU
CUUGCGCAGCCGUCAUCCUCGAG CAAGGCCCCUCCGCCCUCACUGC
CAUCGCCAAGCCGCCUGCCGGGA CCUUCCGACACCCCGAUCCUCCC
CCAGUCAUCCUCGAGCAAGGCCC CUCCGCCCUCACUGCCAUCGCCA
AGCCGCCUGCCGGGACCUUCCGA CACCCCGAUCCUCCCGCAGGCUG
GAGCCUCGGUGGCCAUGCUUCU UGCCCCUUGGGCCUCCCCCCAGC
CCCUCCUCCCCUUCCUGCACCCG UACCCCCGUGGUCUUUGAAUAA AGUCUGAGUGGGCGGC HGH
with 3 MATGSRTSLLL 23 GGGAAAUAAGAGAGAAAAGAAG 36 CTPs AFGLLCLPWLQ
AGUAAGAAGAAAUAUAAGAGCC EGSASSSSKAPP ACCAUGGCCACUGGGUCGAGGA
PSLPSPSRLPGP CCAGCCUGUUGUUGGCCUUUGG SDTPILPQFPTIP
GCUGCUUUGUCUGCCAUGGCUCC LSRLFDNAMLR AAGAGGGAUCCGCAUCAUCCUC
AHRLHQLAFDT GAGCAAGGCCCCUCCGCCCUCAC YQEFEEAYIPK
UGCCAUCGCCAAGCCGCCUGCCG EQKYSFLQNPQ GGACCUUCCGACACCCCGAUCCU
TSLCFSESIPTPS CCCGCAGUUCCCGACAAUUCCCC NREETQQKSNL
UCUCAAGACUGUUUGAUAACGC ELLRISLLLIQS UAUGCUCCGAGCCCACCGGCUGC
WLEPVQFLRSV ACCAGCUGGCGUUCGAUACAUA FANSLVYGASD
CCAAGAAUUCGAGGAAGCAUAC SNVYDLLKDLE AUCCCCAAAGAGCAGAAGUAUU
EGIQTLMGRLE CGUUCCUUCAAAAUCCUCAGACA DGSPRTGQIFK
UCGCUUUGUUUCUCGGAGUCAA QTYSKFDTNSH UUCCGACGCCCAGCAAUAGGGA
NDDALLKNYG AGAAACGCAGCAGAAGUCGAAC LLYCFRKDMD CUUGAGUUGUUGCGGAUUAGCU
KVETFLRIVQC UGCUCCUGAUCCAGUCAUGGCUC RSVEGSCGFSS
GAACCGGUGCAGUUCUUGCGCU SSKAPPPSLPSP CGGUGUUUGCGAACUCCCUGGU
SRLPGPSDTPIL AUAUGGUGCGUCCGAUUCAAAU PQSSSSKAPPPS
GUCUACGACUUGCUCAAGGAUC LPSPSRLPGPSD UUGAAGAGGGGAUCCAAACUCU TPILPQ
CAUGGGUAGGCUUGAGGACGGC UCGCCUCGCACGGGACAGAUCUU
UAAGCAGACGUAUUCGAAAUUU GACACCAAUUCACAUAACGACG
ACGCGUUGCUCAAAAACUAUGG AUUGCUCUACUGCUUUCGGAAG
GACAUGGAUAAAGUGGAGACAU UCUUGAGAAUCGUCCAGUGCAG
AUCCGUAGAGGGAUCAUGCGGU UUUUCAUCCUCGAGCAAGGCCCC
UCCGCCCUCACUGCCAUCGCCAA GCCGCCUGCCGGGACCUUCCGAC
ACCCCGAUCCUCCCGCAGUCAUC CUCGAGCAAGGCCCCUCCGCCCU
CACUGCCAUCGCCAAGCCGCCUG CCGGGACCUUCCGACACCCCGAU
CCUCCCGCAGGCUGGAGCCUCGG UGGCCAUGCUUCUUGCCCCUUGG
GCCUCCCCCCAGCCCCUCCUCCC CUUCCUGCACCCGUACCCCCGUG
GUCUUUGAAUAAAGUCUGAGUG GGCGGC HGH with 3 MATGSRTSLLL 24 CTPs
AFGLLCLPWLQ EGSASSSSKAPP PSLPFPTIPLSRL FDNAMLRAHR LHQLAFDTYQE
FEEAYIPKEQK YSFLQNPQTSL CFSESIPTPSNR EETQQKSNLEL LRISLLLIQSWL
EPVQFLRSVFA NSLVYGASDSN VYDLLKDLEEG IQTLMGRLEDG SPRTGQIFKQT
YSKFDTNSHND DALLKNYGLL YCFRKDMDKV ETFLRIVQCRS VEGSCGFSSSS
KAPPPSLPSPSR LPGPSDTPILPQ SSSSKAPPPSLP SPSRLPGPSDTP ILPQ HGH with 3
MKWVSFISLLF 25 CTPs LFSSAYSGSLD KRSSSSKAPPPS LPSPSRLPGPSD
TPILPQFPTIPLS RLFDNAMLRA HRLHQLAFDTY QEFEEAYIPKE QKYSFLQNPQT
SLCFSESIPTPS NREETQQKSNL ELLRISLLLIQS WLEPVQFLRSV FANSLVYGASD
SNVYDLLKDLE EGIQTLMGRLE DGSPRTGQIFK QTYSKFDTNSH NDDALLKNYG
LLYCFRKDMD KVETFLRIVQC RSVEGSCGFSS SSKAPPPSLPSP SRLPGPSDTPIL
PQSSSSKAPPPS LPSPSRLPGPSD TPILPQ GLP-1 with MKWVSFISLLF 26 2 CTP
LFSSAYSGSLD KRHAEGTFTSD VSSYLEGQAAK EFIAWLVKGRS SSSKAPPPSLPS
PSRLPGPSDTPI LPQSSSSKAPPP SLPSPSRLPGPS DTPILPQ GLP-2 MKWVSFISLLF 27
Teduglutide LFSSAYSGSLD with 2 CTPs KRHGDGSFSDE MNTILDNLAAR
DFINWLIQTKIT DSSSSKAPPPSL PSPSRLPGPSDT PILPQSSSSKAP PPSLPSPSRLPG
PSDTPILPQ 2 GLP-2 MKWVSFISLLF 28 Teduglutide LFSSAYSGSLD with 2
CTPs KRHGDGSFSDE MNTILDNLAAR DFINWLIQTKIT DHGDGSFSDE MNTILDNLAAR
DFINWLIQTKIT DSSSSKAPPPSL PSPSRLPGPSDT PILPQSSSSKAP PPSLPSPSRLPG
PSDTPILPQ GLP-2 MATGSRTSLLL 29 Teduglutide AFGLLCLPWLQ with 3 CTPs
EGSASSSSKAPP PSLPSPSRLPGP SDTPILPQHGD GSFSDEMNTIL DNLAARDFIN
WLIQTKITDSSS SKAPPPSLPSPS RLPGPSDTPILP QSSSSKAPPPSL PSPSRLPGPSDT
PILPQ
Example 13
Evaluation of Carboxy-Terminal Peptide Constructs In Vitro
[0810] mRNAs, such as those described in Table 5 which further
comprise a polyA tail of at least 140 nucleotides and a 5'cap of
Cap1, encoding a protein of interest and at least one
carboxy-terminal peptide are formulated in saline, a buffer, a
lipid, a lipid nanoparticle, or lipofectamine 2000 for analysis in
vitro. The mRNA contains chemical modifications such as, but not
limited to, fully modified with 5-methylcytosine and pseudouridine,
fully modified with 5-methylcytosine and 1-methylpseudouridine,
fully modified with 1-methylpseudouridine, fully modified with
pseudouridine or where 25% of the uridine residues are modified
with 2-thiouridine and 25% of the cytosine residues are modified
with 5-methylcytosine. Varying concentrations (e.g., 0.5 mg/kg,
0.05 mg/kg or 0.005 mg/kg) of the mRNA in the formulations are
transfected by methods described herein and known in the art.
Measurements are taken at predetermined intervals (e.g., 2 hours, 8
hours, 12 hours, 18 hours 24 hours and 48 hours) to determine the
levels of protein and/or mRNA in the sample.
Example 14
Evaluation of Carboxy-Terminal Peptide Constructs in Mammals
[0811] mRNAs, such as those described in Table 5 which further
comprise a polyA tail of at least 140 nucleotides and a 5'cap of
Cap1, encoding a protein of interest and at least one
carboxy-terminal peptide are formulated in saline, a buffer, a
lipid, a lipid nanoparticle, or surgical sealants for delivery
intramuscularly, intravenously and/or subcutaneously to mammals.
The mRNA contains chemical modifications such as, but not limited
to, fully modified with 5-methylcytosine and pseudouridine, fully
modified with 5-methylcytosine and 1-methylpseudouridine, fully
modified with 1-methylpseudouridine, fully modified with
pseudouridine or where 25% of the uridine residues are modified
with 2-thiouridine and 25% of the cytosine residues are modified
with 5-methylcytosine. Varying concentrations (e.g., 0.5 mg/kg,
0.05 mg/kg or 0.005 mg/kg) of the mRNA in the formulations are
administered to the mammals by methods described herein and/or
known in the art. Measurements are taken at predetermined intervals
(e.g., 2 hours, 8 hours, 12 hours, 18 hours 24 hours and 48 hours)
to determine the levels of protein and/or mRNA in the sample.
Example 15
Evaluation of FGF23 In Vitro
[0812] mRNA encoding the full length of the wild type FGF23
sequence, mRNA encoding the C-terminal fragment (amino acid
180-251) of the wild-type FGF23 with a native signal peptide, mRNA
encoding the C-terminal fragment (amino acid 180-251) of the
wild-type FGF23 with a non-native signal peptide (such as the
HSA/KEX2 signal peptide), mRNA encoding the C-terminal fragment
(amino acid 180-251) of the wild-type FGF23 with a native signal
peptide and a C-terminal CTP and/or mRNA encoding the C-terminal
fragment (amino acid 180-251) of the wild-type FGF23 with a native
signal peptide and a N-terminal CTP is evaluated in renal proximal
tubule epithelial cells by the methods described herein and/or are
known in the art (see e.g., Medici et al. FGF-23-Klotho signaling
stimulates proliferation and prevents vitamin D-induced apoptosis.
J. Cell Biol. 2008: 182(3) 459-465; and Goetz et al. Isolated
C-terminal tail of FGF23 alleviates hypophosphatemia by inhibiting
FGF23-FGFR-Klotho complex formation. PNAS 2010: 107(1) 407-412;
each of which is herein incorporated by reference in its entirety).
The supernatant from the transfections is assessed by ELISA for
FGF23 bioactivity for protein phosphorylation and cell
proliferation.
Example 16
Evaluation of FGF23 In Vivo
[0813] mRNA encoding the full length of the wild type FGF23
sequence (amino acid sequence shown in SEQ ID NO: 37), mRNA
encoding the C-terminal fragment (amino acid 180-251) of the
wild-type FGF23 with a native signal peptide, mRNA encoding the
C-terminal fragment (amino acid 180-251) of the wild-type FGF23
with a non-native signal peptide (such as the HSA/KEX2 signal
peptide), mRNA encoding the C-terminal fragment (amino acid
180-251) of the wild-type FGF23 with a native signal peptide and a
C-terminal CTP and/or mRNA encoding the C-terminal fragment (amino
acid 180-251) of the wild-type FGF23 with a native signal peptide
and a N-terminal CTP is formulated in a lipid nanoparticle. The
formulated mRNA is administered via a single intravenous injection
to mammals at a predetermined dose (e.g., 0.005 mg/kg, 0.05 mg/kg
or 0.5 mg/kg). The levels of FGF23 in the serum are measured by
ELISA. The serum inorganic phosphate (Pi) is measured pre-dose and
1 hour, 3 hours and 6 hours after administration. The
pharmacokinetics of each mRNA will be evaluated by methods known in
the art and/or described herein.
Example 17
Human Growth Hormone Carboxy-Terminal Peptide Studies
[0814] Carboxy-Terminal Peptides (CTPs) were evaluated as a
potential approach for prolonging the half-life of therapeutic
protein molecules. mRNAs encoding human growth hormone (hGH) were
prepared using the in vitro transcription method for these
studies.
A. In Vitro Study
[0815] Human cervical carcinoma (HeLa) or hepatocellular carcinoma
epithelial (HepG2) cells were seeded at density of 200,000 on
24-well plates in cell culture medium with 10% fetal calf serum
(FCS) overnight and next day the growth media was replaced with a
fresh one with no serum and no phenol red.
[0816] The cells were transfected with 384 ng of mRNA encoding the
wild type sequence of hGH (mRNA sequence shown in SEQ ID NO: 38;
polyA tail of approximately 140 nucleotides not shown in sequence;
5'Cap, Cap1; fully modified with 5-methylcytosine and
1-methylpseudouridine) (wild type hGH) lipoplexed with 1.5 LF2000
per well or 500 ng of mRNA encoding the hGH sequence with one CTP
(C-terminal peptide of the beta chain of human Chorionic
Gonadotropin) at N terminus and two CTP (C-terminal peptide of the
beta chain of human Chorionic Gonadotropin) at the C terminus (mRNA
sequence shown in SEQ ID NO: 39; polyA tail of approximately 140
nucleotides not shown in sequence; 5'Cap, Cap1; fully modified with
5-methylcytosine and 1-methylpseudouridine) (CTP modified hGH). A
positive control of mRNA encoding hGH (amino acid sequence shown in
SEQ ID NO: 40; mRNA sequence shown in SEQ ID NO: 41; polyA tail of
approximately 140 nucleotides not shown in sequence; 5'Cap, Cap1;
fully modified with 5-methylcytosine and 1-methylpseudouridine) was
used and PBS was used as a negative control.
[0817] Two sets of aliquots culture media supernatants were
collected 7 hours post transfection. One set of samples were used
to perform hGH ELISA to determine the hGH protein level in the
supernatants. As shown in Table 6, the hGH ELISA detected high
level of protein from the supernatants from both the wild type hGH
and the CTP modified hGH and also from the positive control. The
negative control (PBS) showed no signal.
TABLE-US-00006 TABLE 6 In Vitro hGH protein expression Protein
Molecular Protein Expression (ng/ul) Mass (kDa) HeLa Cells HepG2
Cells Wild type hGH 22 967.3 318.5 CTP modified hGH 47.5 311.8 65.8
Positive control 22 662.6 348.1 Negative control -- 0 0
[0818] The second set of samples were used to perform a bioactivity
test (Bioassay lab-Germany). The bioactivity assay was a cell based
proliferation assay using the NB2-11 cell line (rat lymphoma cells)
to determine the bioactivity of hGH. The cells were incubated 48
hours and cell proliferation was stimulated in a 96-well plate by
linking hGH to a prolactin-receptor. There were 9 titration steps
with one standard versus one sample on one plate. Proliferation
dependent staining by water soluble tetrazolium (WST) was conducted
and bioactivity response was measured by the photometric absorbance
of formazan signal (OD) in the proliferation assay. The results are
shown in Tables 7, 8 and 9.
TABLE-US-00007 TABLE 7 Bioactivity of HeLa cell vehicle vs.
Standard (NIBSC WHO 98/574) Dose Vehicle from HeLa Cell Standard
(NIBSC WHO 98/574) Response (OD) (OD) 1 287 2118.3 0.667 288.3
1933.3 0.444 293.7 1699.3 0.296 299 1422.7 0.198 295.7 1183.7 0.132
295 968 0.088 297 786 0.059 298.7 620.3 0.039 300 573.3
TABLE-US-00008 TABLE 8 Bioactivity of Wild type hGH (HeLa) vs.
Standard (NIBSC WHO 98/574) Dose Wild type hGH (HeLa) Standard
(NIBSC WHO 98/574) Response (OD) (OD) 1 2152.7 2108.3 0.667 2123
1939.7 0.444 1927 1647.3 0.296 1697.7 1462 0.198 1463.7 1184.3
0.132 1212 959 0.088 968.7 777 0.059 792.3 646 0.039 663 551
TABLE-US-00009 TABLE 9 Bioactivity of CTP modified hGH (HeLa) vs.
Standard (NIBSC WHO 98/574) Dose CTP modified hGH (HeLa) Standard
(NIBSC WHO 98/574) Response (OD) (OD) 1 2107 2088.3 0.667 1970.3
1932.7 0.444 1804.7 1655.3 0.296 1572 1425.7 0.198 1286.7 1180.7
0.132 1048.3 966.3 0.088 858.3 800.3 0.059 683.7 647.3 0.039 592.7
571.3
[0819] The results which summarized in Tables 7-9 above showed that
mRNAs encoding wild type hGH and CTP modified hGH expressed
proteins have positive bioactivity response compare to the WHO hGH
standard (NIBSC WHO 98/574). The NB-2-II rat lymphoma cells showed
strong proliferation 48 hours after the addition of the
supernatants from HeLa cells containing wild type hGH or CTP
modified hGH proteins and no proliferation was observed from the
vehicle supernatants.
B. In Vivo Study
[0820] Mice (n=4; C57BL/6; approximate weight: 0.025 kg/mouse) were
administered intravenously mRNA encoding the wild type sequence of
hGH (mRNA sequence shown in SEQ ID NO: 38; polyA tail of
approximately 140 nucleotides not shown in sequence; 5'Cap, Cap1;
fully modified with 5-methylcytosine and 1-methylpseudouridine)
(wild type hGH) formulated in an LNP described in Table 10
(characterization in Table 11), mRNA encoding the hGH sequence with
one CTP (C-terminal peptide of the beta chain of human Chorionic
Gonadotropin) at N terminus and two CTP (C-terminal peptide of the
beta chain of human Chorionic Gonadotropin) at the C terminus (mRNA
sequence shown in SEQ ID NO: 41; polyA tail of approximately 140
nucleotides not shown in sequence; 5'Cap, Cap1; fully modified with
5-methylcytosine and 1-methylpseudouridine) (CTP modified hGH)
formulated in an LNP described in Table 10 or a negative control of
PBS (vehicle only) as outlined in Table 12. The dose of CTP
modified hGH was corrected due to the size difference in mRNA of
wild type hGH in order to make the doses equimolar.
TABLE-US-00010 TABLE 10 LNP Formulation Characterization
DLin-KC2-DMA DSPC Cholesterol PEG-DMG Mole Percent 50.0 10.0 38.5
1.5 (mol %)
TABLE-US-00011 TABLE 11 LNP Formulation Characterization Drug Zeta
at Encapsu- Concen- Lipid:mRNA Mean size pH 7.4 lation (%) tration
mRNA Ratio (nm) (mV) (Ribogreen) (mg/mL) Wild type 20:1 91.5 0.9 80
0.15 hGH PDI: 0.09 CTP 20:1 82.6 0.9 81 0.14 modified PDI: 0.06
hGH
TABLE-US-00012 TABLE 12 Dosing Regimen Injection Cationic Dose
volume Lipid Cohorts (mg/kg) (mL) Wild type hGH KC2 7 0.05 0.1 CTP
modified hGH KC2 7 0.065 0.1 PBS none 2 none 0.1
[0821] The cohorts of mice administered the LNP formulated mRNA
were bled terminally at 1 hours, 6 hours, 12 hours, 18 hours, 24
hours, 30 hours and 48 hours after administration and the PBS
administered mice were bled terminally at 1 hour and 30 hours after
administration to determine the Human growth hormone (hGH) protein
expression by ELISA. As shown in Table 13, hGH protein expression
was detectable at least out to 24 hours for the mice that received
a dose of 0.065 mg/kg of CTP modified hGH mice and at least out to
12 hours for the wild types hGH mice. No protein was detected in
the negative PBS control. In Table 13, "NT" means not tested.
TABLE-US-00013 TABLE 13 Serum Protein Expression in Mice Wild type
hGH CTP modified hGH PBS (pg/ml) (pg/ml) (pg/ml) .sup. 1 hour 0 0 0
6 hours 322.5 342 NT 12 hours 109.4 133.6 NT 18 hours 0 77 NT 24
hours 0 0 NT 30 hours 0 0 0 48 hours 0 0 NT
[0822] The mice serum hGH protein concentration (pg/ml) in the time
course curve show that the mice administered the CTP modified hGH
mRNA demonstrated prolonged half-life as compared to the mice
administered wild type hGH mRNA.
Example 18
Human Granulocyte Colony-Stimulating Factor Carboxy-Terminal
Peptide Study
[0823] Carboxy-Terminal Peptides (CTPs) were evaluated as a
potential approach for prolonging the half-life of therapeutic
protein molecules. mRNAs encoding human granulocyte
colony-stimulating factor (hGCSF) were prepared using the in vitro
transcription method for these studies.
[0824] Mice (n=4; C57BL/6; approximate weight: 0.025 kg/mouse) were
administered intravenously mRNA encoding the wild type sequence of
hGCSF (mRNA sequence shown in SEQ ID NO: 42; polyA tail of
approximately 140 nucleotides not shown in sequence; 5'Cap, Cap1;
fully modified with 5-methylcytosine and 1-methylpseudouridine)
(wild type hGCSF) formulated in an LNP described in Table 14
(characterization in Table 15), mRNA encoding the hGCSF sequence
with one CTP (C-terminal peptide of the beta chain of human
Chorionic Gonadotropin) at N terminus (mRNA sequence shown in SEQ
ID NO: 43; polyA tail of approximately 140 nucleotides not shown in
sequence; 5'Cap, Cap1; fully modified with 5-methylcytosine and
1-methylpseudouridine) (1.times.CTP modified hGCSF) formulated in
an LNP described in Table 14 (characterization in Table 15), mRNA
encoding the hGCSF sequence two CTP (C-terminal peptide of the beta
chain of human Chorionic Gonadotropin) at the C terminus
(C-terminal peptide of the beta chain of human Chorionic
Gonadotropin) (mRNA sequence shown in SEQ ID NO: 44; polyA tail of
approximately 140 nucleotides not shown in sequence; 5'Cap, Cap1;
fully modified with 5-methylcytosine and 1-methylpseudouridine)
(2.times.CTP modified hGCSF) formulated in an LNP described in
Table 14 (characterization in Table 15) or a negative control of
PBS as outlined in Table 16. The dose of 1.times.CTP modified hGCSF
and 2.times.CTP modified hGCSF was corrected due to the size
differences in mRNA in order to make the doses equimolar.
TABLE-US-00014 TABLE 14 LNP Formulation Characterization
DLin-KC2-DMA DSPC Cholesterol PEG-DMG Mole Percent 50.0 10.0 38.5
1.5 (mol %)
TABLE-US-00015 TABLE 15 LNP Formulation Characterization Drug Zeta
at Encapsu- Concen- Lipid:mRNA Mean size pH 7.4 lation (%) tration
mRNA Ratio (nm) (mV) (Ribogreen) (mg/mL) Wild type 20:1 82.3 0.7 77
0.14 hGCSF PDI: 0.04 1xCTP 20:1 82.7 0.9 92 0.16 modified PDI: 0.06
hGCSF 2xCTP 20:1 86.4 2.0 98 0.17 modified PDI: 0.07 hGCSF
TABLE-US-00016 TABLE 16 Dosing Regimen Injection Cationic Dose
volume Lipid Cohorts (mg/kg) (mL) Wild type hGCSF KC2 7 0.05 0.1
1xCTP modified hGCSF KC2 7 0.055 0.1 2xCTP modified hGCSF KC2 7
0.060 0.1 PBS none 2 none 0.1
[0825] The cohorts of mice administered the LNP formulated mRNA
were bled terminally at 1 hours, 6 hours, 12 hours, 18 hours, 24
hours, 30 hours and 48 hours after administration and the PBS
administered mice were bled terminally at 1 hour and 30 hours after
administration to determine the human granulocyte
colony-stimulating factor (hGCSF) protein expression in serum by
ELISA. Blood was collected from the cohorts of mice at 24 hours and
48 hours after administration to measure CBC (neutrophil level) as
a pharmacological readout.
[0826] As shown in Table 17, hGCSF protein expression was
detectable in serum at least out to 30 hours for the group treated
with wild type hGCSF mRNA, 1.times.CTP modified hGCSF mRNA and
2.times.CTP modified hGCSF mRNA. High overall performance was seen
with the 1.times.CTP modified hGCSF mRNA as compared to the wild
type hGCSF mRNA group and the 2.times.CTP modified hGCSF mRNA
group. No protein was detected in the negative PBS control. In
Table 17, "NT" means not tested.
TABLE-US-00017 TABLE 17 Serum Protein Expression in Mice Wild type
1xCTP modified 2xCTP modified hGCSF hGCSF hGCSF PBS (pg/ml) (pg/ml)
(pg/ml) (pg/ml) .sup. 1 hour 0 0 0 0 6 hours 29743.2 56847.6 35343
NT 12 hours 29891.8 36333.2 34517.3 NT 18 hours 9046.7 22124.4
7375.8 NT 24 hours 12401.1 16149.1 8922.4 NT 30 hours 8936 5407.8
2646.8 0 48 hours 0 0 0 NT
[0827] Wild type hGCSF mRNA, 1.times.CTP modified hGCSF mRNA and
2.times.CTP modified hGCSF mRNA groups expressed a good amount of
protein through the time points. The overall hGCSF protein
concentration (pg/ml) in mice serum through the time course curve
demonstrated a superior profile of 1.times.CTP modified hGCSF as
compared to wild type hGCSF post a single IV administration of LNP
formulated mRNA.
[0828] As shown in Table 18, CBC (Neutrophil level) was measured as
a pharmacological readout. To demonstrate the specificity of the
action CBC (Neutrophil Level) blood was collected and evaluated
from mice injected with 0.065 mg/kg unrelated mRNA (mRNA encoding
the hGH sequence with one CTP (C-terminal peptide of the beta chain
of human Chorionic Gonadotropin) at N terminus and two CTP
(C-terminal peptide of the beta chain of human Chorionic
Gonadotropin) at the C terminus (mRNA sequence shown in SEQ ID NO:
39; polyA tail of approximately 140 nucleotides not shown in
sequence; 5'Cap, Cap1; fully modified with 5-methylcytosine and
1-methylpseudouridine) (CTP modified hGH)) formulated in a LNP
described in Table 18 (characterization in Table 19).
TABLE-US-00018 TABLE 18 LNP Formulation Characterization
DLin-KC2-DMA DSPC Cholesterol PEG-DMG Mole Percent 50.0 10.0 38.5
1.5 (mol %)
TABLE-US-00019 TABLE 19 LNP Formulation Characterization Drug Zeta
at Encapsu- Concen- Lipid:mRNA Mean size pH 7.4 lation (%) tration
mRNA Ratio (nm) (mV) (Ribogreen) (mg/mL) CTP 20:1 82.6 0.9 81 0.14
modified PDI: 0.06 hGH
[0829] Results of the neutrophil count are shown in Table 20 and
neutrophil percent are shown in Table 21.
TABLE-US-00020 TABLE 20 Neutrophil Count Neutrophil Neutrophil
Count (K/ul) Count (K/ul) 24 Hours 48 Hours Wild type hGCSF 1.29
1.24 1xCTP modified hGCSF 2.26 1.26 2xCTP modified hGCSF 1.80 0.67
CTP modified hGH 0.72 0.33 PBS 0.35 0.47
TABLE-US-00021 TABLE 21 Absolute Neutrophil Percent Neutrophil
Percent (%) Neutrophil Percent (%) 24 Hours 48 Hours Wild type
hGCSF 25.5 15.2 1xCTP modified hGCSF 30.1 13.2 2xCTP modified hGCSF
30.7 11.2 CTP modified hGH 12.1 9.7 PBS 10.4 12.8
[0830] Wild type hGCSF showed significant induction of neutrophil
in mice at 24 hours, around 3.7 fold compared to the vehicle (PBS).
The 1.times.CTP modified hGCSF and 2.times.CTP modified hGCSF
showed higher induction 6.5 and 5.1 fold respectively at 24 hours
as compared to the vehicle (PBS). The neutrophil percent is also
higher in the groups injected with the 1.times.CTP modified hGCSF
mRNA and 2.times.CTP modified hGCSF mRNA as compared to the wild
type hGCSF and around three fold compared to the PBS. The induction
of the neutrophil counts and the neutrophil percent decreased at 48
hours. The results from untreated group showed closely similar to
the PBS.
Example 19
Human GLP-1 Carboxy-Terminal Peptide Study
[0831] Carboxy-Terminal Peptides (CTPs) were evaluated as a
potential approach for prolonging the half-life of therapeutic
protein molecules. mRNAs encoding human GLP-1 were prepared using
the in vitro transcription method for these studies.
[0832] Rats (n=6; Sprague Dawley rats with fitted jugular vein
catheter (JVC-Harlan); approximate weight: 300-330 gm/rat) were
administered intravenously mRNA encoding the wild type sequence of
human GLP1 (mRNA sequence shown in SEQ ID NO: 45; polyA tail of
approximately 140 nucleotides not shown in sequence; 5'Cap, Cap1;
fully modified with 5-methylcytosine and 1-methylpseudouridine)
(wild type hGLP1) formulated in an LNP described in Table 22
(characterization in Table 23), mRNA encoding the human GLP1
sequence with one CTP (C-terminal peptide of the beta chain of
human Chorionic Gonadotropin) at C terminus (amino acid sequence
shown in SEQ ID NO: 46; mRNA sequence shown in SEQ ID NO: 47; polyA
tail of approximately 140 nucleotides not shown in sequence; 5'Cap,
Cap1; fully modified with 5-methylcytosine and
1-methylpseudouridine) (1.times.CTP modified hGLP1) formulated in
an LNP described in Table 22 (characterization in Table 23) or a
negative control of PBS (vehicle only) as outlined in Table 24. The
dose of 1.times.CTP modified hGLP1 was corrected due to the size
differences in mRNA in order to make the doses equimolar.
TABLE-US-00022 TABLE 22 LNP Formulation Characterization
DLin-KC2-DMA DSPC Cholesterol PEG-DMG Mole Percent 50.0 10.0 38.5
1.5 (mol %)
TABLE-US-00023 TABLE 23 LNP Formulation Characterization Drug Zeta
at Encapsu- Concen- Lipid:mRNA Mean size pH 7.4 lation (%) tration
mRNA Ratio (nm) (mV) (Ribogreen) (mg/mL) Wild type 20:1 86.3 2.6 99
0.15 hGLP1 PDI: 0.08 1xCTP 20:1 86.1 1.3 89 0.19 modified PDI: 0.04
hGLP1
TABLE-US-00024 TABLE 24 Dosing Regimen Injection Cationic Dose Size
Ratios volume Lipid (mg/kg) to wt type (mL) Wild type hGLP1 KC2
0.05 1 0.2 1xCTP modified hGLP1 KC2 0.07 1.4 0.2 PBS None None --
0.2
[0833] The rats were bled at 2 hours, 8 hours and terminally at 24
hours after administration to determine the human GLP1 protein
expression in serum by ELISA. The serum levels of human GLP-1
protein expression in rat sera at different time points were
measured by specific human GLP-1 ELISA and the final conversion of
pM to pg/ml calculated according to the conversion factor of the MW
of engineered protein (conversion factor of 3.3 for wild type GLP1,
8.85 for 1.times.CTP modified hGLP1 and 1 for PBS).
[0834] As shown in Table 25, human GLP1 protein expression was
detectable in serum at least out to 24 hours with the group treated
with 1.times.CTP modified hGLP1 mRNA having the greatest
performance.
TABLE-US-00025 TABLE 25 Serum Protein Expression in Rats 1xCTP
1xCTP Wild type Wild type modified modified PBS hGLP1 hGLP1 hGLP1
hGLP1 (pg/ml) (pg/ml) (pM) (pg/ml) (pM) and (pM) 1 hour 98.9 30 763
86.2 22.7 .sup. 6 hours 165.7 50.2 1234.8 139.5 32.8 12 hours.sup.
188.0 57 382.9 43.3 31.7
Example 20
Human GLP-1 Albumin and IgG4 Study
[0835] Albumin and IgG4 were evaluated as a potential approach for
prolonging the half-life of therapeutic protein molecules. mRNAs
encoding human GLP-1 were prepared using the in vitro transcription
method for these studies.
[0836] Rats (n=6; Sprague Dawley rats with fitted jugular vein
catheter (JVC-Harlan); approximate weight: 300-330 gm/rat) were
administered intravenously mRNA encoding the wild type sequence of
human GLP1 (mRNA sequence shown in SEQ ID NO: 45; polyA tail of
approximately 140 nucleotides not shown in sequence; 5'Cap, Cap1;
fully modified with 5-methylcytosine and 1-methylpseudouridine)
(wild type hGLP1) formulated in an LNP described in Table 26
(characterization in Table 27), mRNA encoding the human GLP1
sequence with albumin at C terminus (mRNA sequence shown in SEQ ID
NO: 48; polyA tail of approximately 140 nucleotides not shown in
sequence; 5'Cap, Cap1; fully modified with 5-methylcytosine and
1-methylpseudouridine) (albumin modified hGLP1) formulated in an
LNP described in Table 26 (characterization in Table 27), mRNA
encoding the human GLP1 sequence with IgG4 at C terminus (mRNA
sequence shown in SEQ ID NO: 49; polyA tail of approximately 140
nucleotides not shown in sequence; 5'Cap, Cap1; fully modified with
5-methylcytosine and 1-methylpseudouridine) (IgG4 modified hGLP1)
formulated in an LNP described in Table 26 (characterization in
Table 27) or a negative control of PBS (vehicle only) as outlined
in Table 28. The dose of albumin modified hGLP1 and IgG4 modified
hGLP1 was corrected due to the size differences in mRNA in order to
make the doses equimolar.
TABLE-US-00026 TABLE 26 LNP Formulation Characterization
DLin-KC2-DMA DSPC Cholesterol PEG-DMG Mole Percent 50.0 10.0 38.5
1.5 (mol %)
TABLE-US-00027 TABLE 27 LNP Formulation Characterization Drug Zeta
at Encapsu- Concen- Lipid:mRNA Mean size pH 7.4 lation (%) tration
mRNA Ratio (nm) (mV) (Ribogreen) (mg/mL) Wild type 20:1 86.3 2.6 99
0.15 hGLP1 PDI: 0.08 Albumin 20:1 77.2 1.2 90 0.12 modified PDI:
0.05 hGLP1 IgG4 20:1 87.0 2.4 98 0.14 modified PDI: 0.08 hGLP1
TABLE-US-00028 TABLE 28 Dosing Regimen Injec- Size tion Cationic
Co- Ratio to Dose volume Lipid hort wt type (mg/kg) (mL) Wild type
hGLP1 KC2 1 1 0.05 0.2 Albumin modified hGLP1 KC2 2 4.98 0.25 0.2
IgG4 modified hGLP1 KC2 2 2.6 0.13 0.2 PBS none 1 -- -- 0.2
[0837] The rats administered wild type hGLP1 or PBS were bled at 2
hours, 8 hours and terminally at 24 hours after administration, the
rats administered albumin modified hGLP1 and IgG4 modified hGLP1
were bled at 2 hours, 8 hours, 24 hours, 48 hours and 72 hours to
determine the human GLP1 protein expression in serum by GLP1 ELISA.
The serum levels of human GLP-1 protein expression in rat sera at
different time points were measured by specific human GLP-1 ELISA
and the final conversion of pM to pg/ml calculated according to the
conversion factor of the MW of engineered protein (conversion
factor of 3.3 for wild type GLP1, 36.5 for albumin modified hGLP1,
30 for IgG4 modified hGLP1 and 1 for PBS).
[0838] As shown in Table 29, wild type hGLP1, albumin modified
hGLP1 and IgG4 modified hGLP1 expressed good amount of protein with
the peak at 8 hours. Albumin modified hGLP1 mRNA expressed very
high protein level through the time course curve until 72 hours
mRNA and IgG4 modified hGLP1-IgG demonstrated a great superiority
with half-life more than 72 hours in rats. In Table 29, "NT" means
not tested.
TABLE-US-00029 TABLE 29 Serum Protein Expression in Rats Albumin
Albumin IgG4 IgG4 Wild type Wild type modified modified modified
modified PBS hGLP1 hGLP1 hGLP1 hGLP1 hGLP1 hGLP1 (pg/ml) (pg/ml)
(pM) (pg/ml) (pM) (pg/ml) (pM) and (pM) 2 hours 99 30 5938.6 162.7
4635 154.5 22.7 8 hours 165.7 50.2 41095.4 1125.9 41232 1374.4 32.8
24 hours 188.1 57 27287.4 747.6 28497 949.9 31.7 48 hours NT NT
20889 572.3 29892 996.4 NT 72 hours NT NT 5055.3 138.5 19080 636
NT
Other Embodiments
[0839] It is to be understood that the words which have been used
are words of description rather than limitation, and that changes
may be made within the purview of the appended claims without
departing from the true scope and spirit of the invention in its
broader aspects.
[0840] While the present invention has been described at some
length and with some particularity with respect to the several
described embodiments, it is not intended that it should be limited
to any such particulars or embodiments or any particular
embodiment, but it is to be construed with references to the
appended claims so as to provide the broadest possible
interpretation of such claims in view of the prior art and,
therefore, to effectively encompass the intended scope of the
invention.
[0841] All publications, patent applications, patents, and other
references mentioned herein are incorporated by reference in their
entirety. In case of conflict, the present specification, including
definitions, will control. In addition, section headings, the
materials, methods, and examples are illustrative only and not
intended to be limiting.
Sequence CWU 1
1
49128PRTHomo sapiens 1Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu
Pro Ser Pro Ser Arg 1 5 10 15 Leu Pro Gly Pro Ser Asp Thr Pro Ile
Leu Pro Gln 20 25 212PRTHomo sapiens 2Ser Ser Ser Ser Lys Ala Pro
Pro Pro Ser Leu Pro 1 5 10 333PRTHomo sapiens 3Asp Pro Arg Phe Gln
Asp Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser 1 5 10 15 Leu Pro Ser
Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu 20 25 30 Gln
472PRTHomo sapiens 4Ser Ala Glu Asp Asp Ser Glu Arg Asp Pro Leu Asn
Val Leu Lys Pro 1 5 10 15 Arg Ala Arg Met Thr Pro Ala Pro Ala Ser
Cys Ser Gln Glu Leu Pro 20 25 30 Ser Ala Glu Asp Asn Ser Pro Met
Ala Ser Asp Pro Leu Gly Val Val 35 40 45 Arg Gly Gly Arg Val Asn
Thr His Ala Gly Gly Thr Gly Pro Glu Gly 50 55 60 Cys Arg Pro Phe
Ala Lys Phe Ile 65 70 524PRTHomo sapiens 5Met Lys Trp Val Ser Phe
Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala 1 5 10 15 Tyr Ser Gly Ser
Leu Asp Lys Arg 20 624PRTHomo sapiens 6Met Leu Gly Ala Arg Leu Arg
Leu Trp Val Cys Ala Leu Cys Ser Val 1 5 10 15 Cys Ser Met Ser Val
Leu Arg Ala 20 726PRTHomo sapiens 7Met Ala Thr Gly Ser Arg Thr Ser
Leu Leu Leu Ala Phe Gly Leu Leu 1 5 10 15 Cys Leu Pro Trp Leu Gln
Glu Gly Ser Ala 20 25 829PRTHomo sapiens 8Met Ala Gly Pro Ala Thr
Gln Ser Pro Met Lys Leu Met Ala Leu Gln 1 5 10 15 Leu Leu Leu Trp
His Ser Ala Leu Trp Thr Val Gln Glu 20 25 9615DNAHomo sapiens
9atggctggac ctgccaccca gagccccatg aagctgatgg ccctgcagct gctgctgtgg
60cacagtgcac tctggacagt gcaggaagcc acccccctgg gccctgccag ctccctgccc
120cagagcttcc tgctcaagtg cttagagcaa gtgaggaaga tccagggcga
tggcgcagcg 180ctccaggaga agctgtgtgc cacctacaag ctgtgccacc
ccgaggagct ggtgctgctc 240ggacactctc tgggcatccc ctgggctccc
ctgagcagct gccccagcca ggccctgcag 300ctggcaggct gcttgagcca
actccatagc ggccttttcc tctaccaggg gctcctgcag 360gccctggaag
ggatctcccc cgagttgggt cccaccttgg acacactgca gctggacgtc
420gccgactttg ccaccaccat ctggcagcag atggaagaac tgggaatggc
ccctgccctg 480cagcccaccc agggtgccat gccggccttc gcctctgctt
tccagcgccg ggcaggaggg 540gtcctggttg cctcccatct gcagagcttc
ctggaggtgt cgtaccgcgt tctacgccac 600cttgcccagc cctga
61510800DNAHomo sapiens 10taatacgact cactataggg aaataagaga
gaaaagaaga gtaagaagaa atataagagc 60caccatggct ggacctgcca cccagagccc
catgaagctg atggccctgc agctgctgct 120gtggcacagt gcactctgga
cagtgcagga agccaccccc ctgggccctg ccagctccct 180gccccagagc
ttcctgctca agtgcttaga gcaagtgagg aagatccagg gcgatggcgc
240agcgctccag gagaagctgt gtgccaccta caagctgtgc caccccgagg
agctggtgct 300gctcggacac tctctgggca tcccctgggc tcccctgagc
agctgcccca gccaggccct 360gcagctggca ggctgcttga gccaactcca
tagcggcctt ttcctctacc aggggctcct 420gcaggccctg gaagggatct
cccccgagtt gggtcccacc ttggacacac tgcagctgga 480cgtcgccgac
tttgccacca ccatctggca gcagatggaa gaactgggaa tggcccctgc
540cctgcagccc acccagggtg ccatgccggc cttcgcctct gctttccagc
gccgggcagg 600aggggtcctg gttgcctccc atctgcagag cttcctggag
gtgtcgtacc gcgttctacg 660ccaccttgcc cagccctgaa gcgctgcctt
ctgcggggct tgccttctgg ccatgccctt 720cttctctccc ttgcacctgt
acctcttggt ctttgaataa agcctgagta ggaaggcggc 780cgctcgagca
tgcatctaga 80011800DNAArtificial SequenceDescription of artificial
sequence synthetic transcript sequence 11taatacgact cactataggg
aaataagaga gaaaagaaga gtaagaagaa atataagagc 60caccatggcc ggtcccgcga
cccaaagccc catgaaactt atggccctgc agttgctgct 120ttggcactcg
gccctctgga cagtccaaga agcgactcct ctcggacctg cctcatcgtt
180gccgcagtca ttccttttga agtgtctgga gcaggtgcga aagattcagg
gcgatggagc 240cgcactccaa gagaagctct gcgcgacata caaactttgc
catcccgagg agctcgtact 300gctcgggcac agcttgggga ttccctgggc
tcctctctcg tcctgtccgt cgcaggcttt 360gcagttggca gggtgccttt
cccagctcca ctccggtttg ttcttgtatc agggactgct 420gcaagccctt
gagggaatct cgccagaatt gggcccgacg ctggacacgt tgcagctcga
480cgtggcggat ttcgcaacaa ccatctggca gcagatggag gaactgggga
tggcacccgc 540gctgcagccc acgcaggggg caatgccggc ctttgcgtcc
gcgtttcagc gcagggcggg 600tggagtcctc gtagcgagcc accttcaatc
atttttggaa gtctcgtacc gggtgctgag 660acatcttgcg cagccgtgaa
gcgctgcctt ctgcggggct tgccttctgg ccatgccctt 720cttctctccc
ttgcacctgt acctcttggt ctttgaataa agcctgagta ggaaggcggc
780cgctcgagca tgcatctaga 80012758RNAArtificial SequenceDescription
of artificial sequence synthetic transcript sequence 12gggaaauaag
agagaaaaga agaguaagaa gaaauauaag agccaccaug gccggucccg 60cgacccaaag
ccccaugaaa cuuauggccc ugcaguugcu gcuuuggcac ucggcccucu
120ggacagucca agaagcgacu ccucucggac cugccucauc guugccgcag
ucauuccuuu 180ugaagugucu ggagcaggug cgaaagauuc agggcgaugg
agccgcacuc caagagaagc 240ucugcgcgac auacaaacuu ugccaucccg
aggagcucgu acugcucggg cacagcuugg 300ggauucccug ggcuccucuc
ucguccuguc cgucgcaggc uuugcaguug gcagggugcc 360uuucccagcu
ccacuccggu uuguucuugu aucagggacu gcugcaagcc cuugagggaa
420ucucgccaga auugggcccg acgcuggaca cguugcagcu cgacguggcg
gauuucgcaa 480caaccaucug gcagcagaug gaggaacugg ggauggcacc
cgcgcugcag cccacgcagg 540gggcaaugcc ggccuuugcg uccgcguuuc
agcgcagggc ggguggaguc cucguagcga 600gccaccuuca aucauuuuug
gaagucucgu accgggugcu gagacaucuu gcgcagccgu 660gaagcgcugc
cuucugcggg gcuugccuuc uggccaugcc cuucuucucu cccuugcacc
720uguaccucuu ggucuuugaa uaaagccuga guaggaag 75813110PRTArtificial
SequenceDescription of artificial sequence synthetic protein
sequence 13Met Lys Trp Val Ser Phe Ile Ser Leu Leu Phe Leu Phe Ser
Ser Ala 1 5 10 15 Tyr Ser Gly Ser Leu Asp Lys Arg His Gly Glu Gly
Thr Phe Thr Ser 20 25 30 Asp Val Ser Ser Tyr Leu Glu Gly Gln Ala
Ala Lys Glu Phe Ile Ala 35 40 45 Trp Leu Val Lys Gly Arg Ser Ser
Ser Ser Lys Ala Pro Pro Pro Ser 50 55 60 Leu Pro Ser Pro Ser Arg
Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu 65 70 75 80 Pro Gln Ser Ser
Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser Pro 85 90 95 Ser Arg
Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln 100 105 110
14110PRTArtificial SequenceDescription of artificial sequence
synthetic protein sequence 14Met Lys Trp Val Ser Phe Ile Ser Leu
Leu Phe Leu Phe Ser Ser Ala 1 5 10 15 Tyr Ser Gly Ser Leu Asp Lys
Arg His Gly Glu Gly Thr Phe Thr Ser 20 25 30 Asp Val Ser Ser Tyr
Leu Glu Gly Gln Ala Ala Lys Glu Phe Ile Ala 35 40 45 Trp Leu Val
Lys Gly Arg Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser 50 55 60 Leu
Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu 65 70
75 80 Pro Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser
Pro 85 90 95 Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro
Gln 100 105 110 15125PRTArtificial SequenceDescription of
artificial sequence synthetic protein sequence 15Met Lys Trp Val
Ser Phe Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala 1 5 10 15 Tyr Ser
Gly Ser Leu Asp Lys Arg His Gly Glu Gly Thr Phe Thr Ser 20 25 30
Asp Val Ser Ser Tyr Leu Glu Glu Gln Ala Ala Lys Glu Phe Ile Ala 35
40 45 Trp Leu Val Lys Gly Gly Gly Gly Gly Gly Gly Ser Gly Gly Gly
Gly 50 55 60 Ser Gly Gly Gly Gly Ser Ser Ser Ser Lys Ala Pro Pro
Pro Ser Leu 65 70 75 80 Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser Asp
Thr Pro Ile Leu Pro 85 90 95 Gln Ser Ser Ser Ser Lys Ala Pro Pro
Pro Ser Leu Pro Ser Pro Ser 100 105 110 Arg Leu Pro Gly Pro Ser Asp
Thr Pro Ile Leu Pro Gln 115 120 125 16124PRTArtificial
SequenceDescription of artificial sequence synthetic protein
sequence 16Met Leu Gly Ala Arg Leu Arg Leu Trp Val Cys Ala Leu Cys
Ser Val 1 5 10 15 Cys Ser Met Ser Val Leu Arg Ala Ser Ala Glu Asp
Asp Ser Glu Arg 20 25 30 Asp Pro Leu Asn Val Leu Lys Pro Arg Ala
Arg Met Thr Pro Ala Pro 35 40 45 Ala Ser Cys Ser Gln Glu Leu Pro
Ser Ala Glu Asp Asn Ser Pro Met 50 55 60 Ala Ser Asp Pro Leu Gly
Val Val Arg Gly Gly Arg Val Asn Thr His 65 70 75 80 Ala Gly Gly Thr
Gly Pro Glu Gly Cys Arg Pro Phe Ala Lys Phe Ile 85 90 95 Ser Ser
Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser Pro Ser Arg 100 105 110
Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln 115 120
17152PRTArtificial SequenceDescription of artificial sequence
synthetic protein sequence 17Met Lys Trp Val Ser Phe Ile Ser Leu
Leu Phe Leu Phe Ser Ser Ala 1 5 10 15 Tyr Ser Gly Ser Leu Asp Lys
Arg Ser Ala Glu Asp Asp Ser Glu Arg 20 25 30 Asp Pro Leu Asn Val
Leu Lys Pro Arg Ala Arg Met Thr Pro Ala Pro 35 40 45 Ala Ser Cys
Ser Gln Glu Leu Pro Ser Ala Glu Asp Asn Ser Pro Met 50 55 60 Ala
Ser Asp Pro Leu Gly Val Val Arg Gly Gly Arg Val Asn Thr His 65 70
75 80 Ala Gly Gly Thr Gly Pro Glu Gly Cys Arg Pro Phe Ala Lys Phe
Ile 85 90 95 Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser
Pro Ser Arg 100 105 110 Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro
Gln Ser Ser Ser Ser 115 120 125 Lys Ala Pro Pro Pro Ser Leu Pro Ser
Pro Ser Arg Leu Pro Gly Pro 130 135 140 Ser Asp Thr Pro Ile Leu Pro
Gln 145 150 18124PRTArtificial SequenceDescription of artificial
sequence synthetic protein sequence 18Met Leu Gly Ala Arg Leu Arg
Leu Trp Val Cys Ala Leu Cys Ser Val 1 5 10 15 Cys Ser Met Ser Val
Leu Arg Ala Ser Ala Glu Asp Asp Ser Glu Arg 20 25 30 Asp Pro Leu
Asn Val Leu Lys Pro Arg Ala Arg Met Thr Pro Ala Pro 35 40 45 Ala
Ser Cys Ser Gln Glu Leu Pro Ser Ala Glu Asp Asn Ser Pro Met 50 55
60 Ala Ser Asp Pro Leu Gly Val Val Arg Gly Gly Arg Val Asn Thr His
65 70 75 80 Ala Gly Gly Thr Gly Pro Glu Gly Cys Arg Pro Phe Ala Lys
Phe Ile 85 90 95 Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro
Ser Pro Ser Arg 100 105 110 Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu
Pro Gln 115 120 19288PRTArtificial SequenceDescription of
artificial sequence synthetic protein sequence 19Met Ala Gly Pro
Ala Thr Gln Ser Pro Met Lys Leu Met Ala Leu Gln 1 5 10 15 Leu Leu
Leu Trp His Ser Ala Leu Trp Thr Val Gln Glu Ser Ser Ser 20 25 30
Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser Pro Ser Arg Leu Pro Gly 35
40 45 Pro Ser Asp Thr Pro Ile Leu Pro Gln Ala Thr Pro Leu Gly Pro
Ala 50 55 60 Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys Cys Leu Glu
Gln Val Arg 65 70 75 80 Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu
Lys Leu Cys Ala Thr 85 90 95 Tyr Lys Leu Cys His Pro Glu Glu Leu
Val Leu Leu Gly His Ser Leu 100 105 110 Gly Ile Pro Trp Ala Pro Leu
Ser Ser Cys Pro Ser Gln Ala Leu Gln 115 120 125 Leu Ala Gly Cys Leu
Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln 130 135 140 Gly Leu Leu
Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr 145 150 155 160
Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp 165
170 175 Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr
Gln 180 185 190 Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg
Ala Gly Gly 195 200 205 Val Leu Val Ala Ser His Leu Gln Ser Phe Leu
Glu Val Ser Tyr Arg 210 215 220 Val Leu Arg His Leu Ala Gln Pro Ser
Ser Ser Ser Lys Ala Pro Pro 225 230 235 240 Pro Ser Leu Pro Ser Pro
Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro 245 250 255 Ile Leu Pro Gln
Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro 260 265 270 Ser Pro
Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln 275 280 285
20285PRTArtificial SequenceDescription of artificial sequence
synthetic protein sequence 20Met Ala Thr Gly Ser Arg Thr Ser Leu
Leu Leu Ala Phe Gly Leu Leu 1 5 10 15 Cys Leu Pro Trp Leu Gln Glu
Gly Ser Ala Ser Ser Ser Ser Lys Ala 20 25 30 Pro Pro Pro Ser Leu
Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser Asp 35 40 45 Thr Pro Ile
Leu Pro Gln Ala Thr Pro Leu Gly Pro Ala Ser Ser Leu 50 55 60 Pro
Gln Ser Phe Leu Leu Lys Cys Leu Glu Gln Val Arg Lys Ile Gln 65 70
75 80 Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys
Leu 85 90 95 Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu
Gly Ile Pro 100 105 110 Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala
Leu Gln Leu Ala Gly 115 120 125 Cys Leu Ser Gln Leu His Ser Gly Leu
Phe Leu Tyr Gln Gly Leu Leu 130 135 140 Gln Ala Leu Glu Gly Ile Ser
Pro Glu Leu Gly Pro Thr Leu Asp Thr 145 150 155 160 Leu Gln Leu Asp
Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met 165 170 175 Glu Glu
Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met 180 185 190
Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val 195
200 205 Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu
Arg 210 215 220 His Leu Ala Gln Pro Ser Ser Ser Ser Lys Ala Pro Pro
Pro Ser Leu 225 230 235 240 Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser
Asp Thr Pro Ile Leu Pro 245 250 255 Gln Ser Ser Ser Ser Lys Ala Pro
Pro Pro Ser Leu Pro Ser Pro Ser 260 265 270 Arg Leu Pro Gly Pro Ser
Asp Thr Pro Ile Leu Pro Gln 275 280 285 21232PRTArtificial
SequenceDescription of artificial sequence synthetic protein
sequence 21Met Ala Gly Pro Ala Thr Gln Ser Pro Met Lys Leu Met Ala
Leu Gln 1 5 10 15 Leu Leu Leu Trp His Ser Ala Leu Trp Thr Val Gln
Glu Ser Ser Ser 20 25 30 Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser
Pro Ser Arg Leu Pro Gly 35 40 45 Pro Ser Asp Thr Pro Ile Leu Pro
Gln Ala Thr Pro Leu Gly Pro Ala 50 55 60 Ser Ser Leu Pro Gln Ser
Phe Leu Leu Lys Cys Leu Glu Gln Val Arg 65 70 75 80 Lys Ile Gln Gly
Asp Gly Ala Ala Leu Gln Glu
Lys Leu Cys Ala Thr 85 90 95 Tyr Lys Leu Cys His Pro Glu Glu Leu
Val Leu Leu Gly His Ser Leu 100 105 110 Gly Ile Pro Trp Ala Pro Leu
Ser Ser Cys Pro Ser Gln Ala Leu Gln 115 120 125 Leu Ala Gly Cys Leu
Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln 130 135 140 Gly Leu Leu
Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr 145 150 155 160
Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp 165
170 175 Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr
Gln 180 185 190 Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg
Ala Gly Gly 195 200 205 Val Leu Val Ala Ser His Leu Gln Ser Phe Leu
Glu Val Ser Tyr Arg 210 215 220 Val Leu Arg His Leu Ala Gln Pro 225
230 22260PRTArtificial SequenceDescription of artificial sequence
synthetic protein sequence 22Met Ala Gly Pro Ala Thr Gln Ser Pro
Met Lys Leu Met Ala Leu Gln 1 5 10 15 Leu Leu Leu Trp His Ser Ala
Leu Trp Thr Val Gln Glu Ala Thr Pro 20 25 30 Leu Gly Pro Ala Ser
Ser Leu Pro Gln Ser Phe Leu Leu Lys Cys Leu 35 40 45 Glu Gln Val
Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys 50 55 60 Leu
Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu 65 70
75 80 Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro
Ser 85 90 95 Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His
Ser Gly Leu 100 105 110 Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu
Gly Ile Ser Pro Glu 115 120 125 Leu Gly Pro Thr Leu Asp Thr Leu Gln
Leu Asp Val Ala Asp Phe Ala 130 135 140 Thr Thr Ile Trp Gln Gln Met
Glu Glu Leu Gly Met Ala Pro Ala Leu 145 150 155 160 Gln Pro Thr Gln
Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg 165 170 175 Arg Ala
Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu 180 185 190
Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro Ser Ser Ser Ser 195
200 205 Lys Ala Pro Pro Pro Ser Leu Pro Ser Pro Ser Arg Leu Pro Gly
Pro 210 215 220 Ser Asp Thr Pro Ile Leu Pro Gln Ser Ser Ser Ser Lys
Ala Pro Pro 225 230 235 240 Pro Ser Leu Pro Ser Pro Ser Arg Leu Pro
Gly Pro Ser Asp Thr Pro 245 250 255 Ile Leu Pro Gln 260
23301PRTArtificial SequenceDescription of artificial sequence
synthetic protein sequence 23Met Ala Thr Gly Ser Arg Thr Ser Leu
Leu Leu Ala Phe Gly Leu Leu 1 5 10 15 Cys Leu Pro Trp Leu Gln Glu
Gly Ser Ala Ser Ser Ser Ser Lys Ala 20 25 30 Pro Pro Pro Ser Leu
Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser Asp 35 40 45 Thr Pro Ile
Leu Pro Gln Phe Pro Thr Ile Pro Leu Ser Arg Leu Phe 50 55 60 Asp
Asn Ala Met Leu Arg Ala His Arg Leu His Gln Leu Ala Phe Asp 65 70
75 80 Thr Tyr Gln Glu Phe Glu Glu Ala Tyr Ile Pro Lys Glu Gln Lys
Tyr 85 90 95 Ser Phe Leu Gln Asn Pro Gln Thr Ser Leu Cys Phe Ser
Glu Ser Ile 100 105 110 Pro Thr Pro Ser Asn Arg Glu Glu Thr Gln Gln
Lys Ser Asn Leu Glu 115 120 125 Leu Leu Arg Ile Ser Leu Leu Leu Ile
Gln Ser Trp Leu Glu Pro Val 130 135 140 Gln Phe Leu Arg Ser Val Phe
Ala Asn Ser Leu Val Tyr Gly Ala Ser 145 150 155 160 Asp Ser Asn Val
Tyr Asp Leu Leu Lys Asp Leu Glu Glu Gly Ile Gln 165 170 175 Thr Leu
Met Gly Arg Leu Glu Asp Gly Ser Pro Arg Thr Gly Gln Ile 180 185 190
Phe Lys Gln Thr Tyr Ser Lys Phe Asp Thr Asn Ser His Asn Asp Asp 195
200 205 Ala Leu Leu Lys Asn Tyr Gly Leu Leu Tyr Cys Phe Arg Lys Asp
Met 210 215 220 Asp Lys Val Glu Thr Phe Leu Arg Ile Val Gln Cys Arg
Ser Val Glu 225 230 235 240 Gly Ser Cys Gly Phe Ser Ser Ser Ser Lys
Ala Pro Pro Pro Ser Leu 245 250 255 Pro Ser Pro Ser Arg Leu Pro Gly
Pro Ser Asp Thr Pro Ile Leu Pro 260 265 270 Gln Ser Ser Ser Ser Lys
Ala Pro Pro Pro Ser Leu Pro Ser Pro Ser 275 280 285 Arg Leu Pro Gly
Pro Ser Asp Thr Pro Ile Leu Pro Gln 290 295 300 24285PRTArtificial
SequenceDescription of artificial sequence synthetic protein
sequence 24Met Ala Thr Gly Ser Arg Thr Ser Leu Leu Leu Ala Phe Gly
Leu Leu 1 5 10 15 Cys Leu Pro Trp Leu Gln Glu Gly Ser Ala Ser Ser
Ser Ser Lys Ala 20 25 30 Pro Pro Pro Ser Leu Pro Phe Pro Thr Ile
Pro Leu Ser Arg Leu Phe 35 40 45 Asp Asn Ala Met Leu Arg Ala His
Arg Leu His Gln Leu Ala Phe Asp 50 55 60 Thr Tyr Gln Glu Phe Glu
Glu Ala Tyr Ile Pro Lys Glu Gln Lys Tyr 65 70 75 80 Ser Phe Leu Gln
Asn Pro Gln Thr Ser Leu Cys Phe Ser Glu Ser Ile 85 90 95 Pro Thr
Pro Ser Asn Arg Glu Glu Thr Gln Gln Lys Ser Asn Leu Glu 100 105 110
Leu Leu Arg Ile Ser Leu Leu Leu Ile Gln Ser Trp Leu Glu Pro Val 115
120 125 Gln Phe Leu Arg Ser Val Phe Ala Asn Ser Leu Val Tyr Gly Ala
Ser 130 135 140 Asp Ser Asn Val Tyr Asp Leu Leu Lys Asp Leu Glu Glu
Gly Ile Gln 145 150 155 160 Thr Leu Met Gly Arg Leu Glu Asp Gly Ser
Pro Arg Thr Gly Gln Ile 165 170 175 Phe Lys Gln Thr Tyr Ser Lys Phe
Asp Thr Asn Ser His Asn Asp Asp 180 185 190 Ala Leu Leu Lys Asn Tyr
Gly Leu Leu Tyr Cys Phe Arg Lys Asp Met 195 200 205 Asp Lys Val Glu
Thr Phe Leu Arg Ile Val Gln Cys Arg Ser Val Glu 210 215 220 Gly Ser
Cys Gly Phe Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu 225 230 235
240 Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro
245 250 255 Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser
Pro Ser 260 265 270 Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro
Gln 275 280 285 25299PRTArtificial SequenceDescription of
artificial sequence synthetic protein sequence 25Met Lys Trp Val
Ser Phe Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala 1 5 10 15 Tyr Ser
Gly Ser Leu Asp Lys Arg Ser Ser Ser Ser Lys Ala Pro Pro 20 25 30
Pro Ser Leu Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro 35
40 45 Ile Leu Pro Gln Phe Pro Thr Ile Pro Leu Ser Arg Leu Phe Asp
Asn 50 55 60 Ala Met Leu Arg Ala His Arg Leu His Gln Leu Ala Phe
Asp Thr Tyr 65 70 75 80 Gln Glu Phe Glu Glu Ala Tyr Ile Pro Lys Glu
Gln Lys Tyr Ser Phe 85 90 95 Leu Gln Asn Pro Gln Thr Ser Leu Cys
Phe Ser Glu Ser Ile Pro Thr 100 105 110 Pro Ser Asn Arg Glu Glu Thr
Gln Gln Lys Ser Asn Leu Glu Leu Leu 115 120 125 Arg Ile Ser Leu Leu
Leu Ile Gln Ser Trp Leu Glu Pro Val Gln Phe 130 135 140 Leu Arg Ser
Val Phe Ala Asn Ser Leu Val Tyr Gly Ala Ser Asp Ser 145 150 155 160
Asn Val Tyr Asp Leu Leu Lys Asp Leu Glu Glu Gly Ile Gln Thr Leu 165
170 175 Met Gly Arg Leu Glu Asp Gly Ser Pro Arg Thr Gly Gln Ile Phe
Lys 180 185 190 Gln Thr Tyr Ser Lys Phe Asp Thr Asn Ser His Asn Asp
Asp Ala Leu 195 200 205 Leu Lys Asn Tyr Gly Leu Leu Tyr Cys Phe Arg
Lys Asp Met Asp Lys 210 215 220 Val Glu Thr Phe Leu Arg Ile Val Gln
Cys Arg Ser Val Glu Gly Ser 225 230 235 240 Cys Gly Phe Ser Ser Ser
Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser 245 250 255 Pro Ser Arg Leu
Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln Ser 260 265 270 Ser Ser
Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser Pro Ser Arg Leu 275 280 285
Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln 290 295
26110PRTArtificial SequenceDescription of artificial sequence
synthetic protein sequence 26Met Lys Trp Val Ser Phe Ile Ser Leu
Leu Phe Leu Phe Ser Ser Ala 1 5 10 15 Tyr Ser Gly Ser Leu Asp Lys
Arg His Ala Glu Gly Thr Phe Thr Ser 20 25 30 Asp Val Ser Ser Tyr
Leu Glu Gly Gln Ala Ala Lys Glu Phe Ile Ala 35 40 45 Trp Leu Val
Lys Gly Arg Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser 50 55 60 Leu
Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu 65 70
75 80 Pro Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser
Pro 85 90 95 Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro
Gln 100 105 110 27113PRTArtificial SequenceDescription of
artificial sequence synthetic protein sequence 27Met Lys Trp Val
Ser Phe Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala 1 5 10 15 Tyr Ser
Gly Ser Leu Asp Lys Arg His Gly Asp Gly Ser Phe Ser Asp 20 25 30
Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile Asn 35
40 45 Trp Leu Ile Gln Thr Lys Ile Thr Asp Ser Ser Ser Ser Lys Ala
Pro 50 55 60 Pro Pro Ser Leu Pro Ser Pro Ser Arg Leu Pro Gly Pro
Ser Asp Thr 65 70 75 80 Pro Ile Leu Pro Gln Ser Ser Ser Ser Lys Ala
Pro Pro Pro Ser Leu 85 90 95 Pro Ser Pro Ser Arg Leu Pro Gly Pro
Ser Asp Thr Pro Ile Leu Pro 100 105 110 Gln 28146PRTArtificial
SequenceDescription of artificial sequence synthetic protein
sequence 28Met Lys Trp Val Ser Phe Ile Ser Leu Leu Phe Leu Phe Ser
Ser Ala 1 5 10 15 Tyr Ser Gly Ser Leu Asp Lys Arg His Gly Asp Gly
Ser Phe Ser Asp 20 25 30 Glu Met Asn Thr Ile Leu Asp Asn Leu Ala
Ala Arg Asp Phe Ile Asn 35 40 45 Trp Leu Ile Gln Thr Lys Ile Thr
Asp His Gly Asp Gly Ser Phe Ser 50 55 60 Asp Glu Met Asn Thr Ile
Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile 65 70 75 80 Asn Trp Leu Ile
Gln Thr Lys Ile Thr Asp Ser Ser Ser Ser Lys Ala 85 90 95 Pro Pro
Pro Ser Leu Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser Asp 100 105 110
Thr Pro Ile Leu Pro Gln Ser Ser Ser Ser Lys Ala Pro Pro Pro Ser 115
120 125 Leu Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser Asp Thr Pro Ile
Leu 130 135 140 Pro Gln 145 29143PRTArtificial SequenceDescription
of artificial sequence synthetic protein sequence 29Met Ala Thr Gly
Ser Arg Thr Ser Leu Leu Leu Ala Phe Gly Leu Leu 1 5 10 15 Cys Leu
Pro Trp Leu Gln Glu Gly Ser Ala Ser Ser Ser Ser Lys Ala 20 25 30
Pro Pro Pro Ser Leu Pro Ser Pro Ser Arg Leu Pro Gly Pro Ser Asp 35
40 45 Thr Pro Ile Leu Pro Gln His Gly Asp Gly Ser Phe Ser Asp Glu
Met 50 55 60 Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp Phe Ile
Asn Trp Leu 65 70 75 80 Ile Gln Thr Lys Ile Thr Asp Ser Ser Ser Ser
Lys Ala Pro Pro Pro 85 90 95 Ser Leu Pro Ser Pro Ser Arg Leu Pro
Gly Pro Ser Asp Thr Pro Ile 100 105 110 Leu Pro Gln Ser Ser Ser Ser
Lys Ala Pro Pro Pro Ser Leu Pro Ser 115 120 125 Pro Ser Arg Leu Pro
Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln 130 135 140
30664RNAArtificial SequenceDescription of artificial sequence
synthetic transcript sequence 30gggaaauaag agagaaaaga agaguaagaa
gaaauauaag agccaccaug aagugggugu 60cguucaucuc acuguuguuc cuuuucagcu
cggcguacuc ggggucacuc gacaaacgcc 120acggagaggg caccuuuacu
uccgauguca gcuccuaccu cgaaggccag gcggcaaagg 180aauucaucgc
cuggcuggug aagggaagaa gcucaucgag caaggccccu ccaccguccc
240ucccuucgcc gucccggcug ccgggaccaa gcgacacucc gauccugcca
caaucgucau 300ccuccaaagc uccuccaccc ucgcugccau ccccgucaag
gcugcccggu ccgagcgaua 360ccccgauucu cccgcaguca uccucgagca
aggccccucc gcccucacug ccaucgccaa 420gccgccugcc gggaccuucc
gacaccccga uccucccgca gucauccucg agcaaggccc 480cuccgcccuc
acugccaucg ccaagccgcc ugccgggacc uuccgacacc ccgauccucc
540cgcagugaua auaggcugga gccucggugg ccaugcuucu ugccccuugg
gccucccccc 600agccccuccu ccccuuccug cacccguacc cccguggucu
uugaauaaag ucugaguggg 660cggc 66431529RNAArtificial
SequenceDescription of artificial sequence synthetic transcript
sequence 31gggaaauaag agagaaaaga agaguaagaa gaaauauaag agccaccaug
cugggugcaa 60gacuucgccu uugggugugc gcacuuugca gcguguguuc aaugagcgug
cugagagcau 120ccgccgagga cgacuccgaa cgugaccccu ugaacgugcu
gaagccuagg gcuagaauga 180cgccagcccc ugcgucaugc ucgcaagaac
ucccgucggc ggaggauaac uccccuaugg 240cauccgaucc ucugggagug
gugcgaggug gucguguuaa cacccacgcg gguggcacug 300gacccgaagg
guguagaccu uucgcaaagu uuaucucauc cucgagcaag gccccuccgc
360ccucacugcc aucgccaagc cgccugccgg gaccuuccga caccccgauc
cucccgcagg 420cuggagccuc gguggccaug cuucuugccc cuugggccuc
cccccagccc cuccuccccu 480uccugcaccc guacccccgu ggucuuugaa
uaaagucuga gugggcggc 529321021RNAArtificial SequenceDescription of
artificial sequence synthetic transcript sequence 32gggaaauaag
agagaaaaga agaguaagaa gaaauauaag agccaccaug gccggucccg 60cgacccaaag
ccccaugaaa cuuauggccc ugcaguugcu gcuuuggcac ucggcccucu
120ggacagucca agaaucaucc ucgagcaagg ccccuccgcc cucacugcca
ucgccaagcc 180gccugccggg accuuccgac accccgaucc ucccgcaggc
gacuccucuc ggaccugccu 240caucguugcc gcagucauuc cuuuugaagu
gucuggagca ggugcgaaag auucagggcg 300auggagccgc acuccaagag
aagcucugcg cgacauacaa acuuugccau cccgaggagc 360ucguacugcu
cgggcacagc uuggggauuc ccugggcucc ucucucgucc uguccgucgc
420aggcuuugca guuggcaggg ugccuuuccc agcuccacuc cgguuuguuc
uuguaucagg 480gacugcugca agcccuugag ggaaucucgc cagaauuggg
cccgacgcug gacacguugc 540agcucgacgu ggcggauuuc gcaacaacca
ucuggcagca gauggaggaa cuggggaugg 600cacccgcgcu gcagcccacg
cagggggcaa ugccggccuu ugcguccgcg uuucagcgca 660gggcgggugg
aguccucgua gcgagccacc uucaaucauu uuuggaaguc ucguaccggg
720ugcugagaca ucuugcgcag ccgucauccu cgagcaaggc cccuccgccc
ucacugccau 780cgccaagccg ccugccggga ccuuccgaca ccccgauccu
cccgcaguca uccucgagca 840aggccccucc gcccucacug ccaucgccaa
gccgccugcc gggaccuucc gacaccccga 900uccucccgca ggcuggagcc
ucgguggcca ugcuucuugc cccuugggcc uccccccagc 960cccuccuccc
cuuccugcac ccguaccccc guggucuuug aauaaagucu gagugggcgg 1020c
1021331012RNAArtificial SequenceDescription of artificial sequence
synthetic transcript sequence 33gggaaauaag agagaaaaga agaguaagaa
gaaauauaag agccaccaug gccacugggu 60cgaggaccag ccuguuguug gccuuugggc
ugcuuugucu gccauggcuc caagagggau 120ccgcaucauc cucgagcaag
gccccuccgc ccucacugcc aucgccaagc cgccugccgg 180gaccuuccga
caccccgauc cucccgcagg cgacuccucu cggaccugcc ucaucguugc
240cgcagucauu ccuuuugaag ugucuggagc aggugcgaaa gauucagggc
gauggagccg 300cacuccaaga gaagcucugc gcgacauaca aacuuugcca
ucccgaggag cucguacugc 360ucgggcacag cuuggggauu cccugggcuc
cucucucguc cuguccgucg caggcuuugc 420aguuggcagg gugccuuucc
cagcuccacu ccgguuuguu cuuguaucag ggacugcugc 480aagcccuuga
gggaaucucg ccagaauugg gcccgacgcu ggacacguug cagcucgacg
540uggcggauuu cgcaacaacc aucuggcagc agauggagga acuggggaug
gcacccgcgc 600ugcagcccac gcagggggca augccggccu uugcguccgc
guuucagcgc agggcgggug 660gaguccucgu agcgagccac cuucaaucau
uuuuggaagu cucguaccgg gugcugagac 720aucuugcgca gccgucaucc
ucgagcaagg ccccuccgcc cucacugcca ucgccaagcc 780gccugccggg
accuuccgac accccgaucc ucccgcaguc auccucgagc aaggccccuc
840cgcccucacu gccaucgcca agccgccugc cgggaccuuc cgacaccccg
auccucccgc 900aggcuggagc cucgguggcc augcuucuug ccccuugggc
cuccccccag ccccuccucc 960ccuuccugca cccguacccc cguggucuuu
gaauaaaguc ugagugggcg gc 101234853RNAArtificial SequenceDescription
of artificial sequence synthetic transcript sequence 34gggaaauaag
agagaaaaga agaguaagaa gaaauauaag agccaccaug gccggucccg 60cgacccaaag
ccccaugaaa cuuauggccc ugcaguugcu gcuuuggcac ucggcccucu
120ggacagucca agaaucaucc ucgagcaagg ccccuccgcc cucacugcca
ucgccaagcc 180gccugccggg accuuccgac accccgaucc ucccgcaggc
gacuccucuc ggaccugccu 240caucguugcc gcagucauuc cuuuugaagu
gucuggagca ggugcgaaag auucagggcg 300auggagccgc acuccaagag
aagcucugcg cgacauacaa acuuugccau cccgaggagc 360ucguacugcu
cgggcacagc uuggggauuc ccugggcucc ucucucgucc uguccgucgc
420aggcuuugca guuggcaggg ugccuuuccc agcuccacuc cgguuuguuc
uuguaucagg 480gacugcugca agcccuugag ggaaucucgc cagaauuggg
cccgacgcug gacacguugc 540agcucgacgu ggcggauuuc gcaacaacca
ucuggcagca gauggaggaa cuggggaugg 600cacccgcgcu gcagcccacg
cagggggcaa ugccggccuu ugcguccgcg uuucagcgca 660gggcgggugg
aguccucgua gcgagccacc uucaaucauu uuuggaaguc ucguaccggg
720ugcugagaca ucuugcgcag ccggcuggag ccucgguggc caugcuucuu
gccccuuggg 780ccucccccca gccccuccuc cccuuccugc acccguaccc
ccguggucuu ugaauaaagu 840cugagugggc ggc 85335937RNAArtificial
SequenceDescription of artificial sequence synthetic transcript
sequence 35gggaaauaag agagaaaaga agaguaagaa gaaauauaag agccaccaug
gccggucccg 60cgacccaaag ccccaugaaa cuuauggccc ugcaguugcu gcuuuggcac
ucggcccucu 120ggacagucca agaagcgacu ccucucggac cugccucauc
guugccgcag ucauuccuuu 180ugaagugucu ggagcaggug cgaaagauuc
agggcgaugg agccgcacuc caagagaagc 240ucugcgcgac auacaaacuu
ugccaucccg aggagcucgu acugcucggg cacagcuugg 300ggauucccug
ggcuccucuc ucguccuguc cgucgcaggc uuugcaguug gcagggugcc
360uuucccagcu ccacuccggu uuguucuugu aucagggacu gcugcaagcc
cuugagggaa 420ucucgccaga auugggcccg acgcuggaca cguugcagcu
cgacguggcg gauuucgcaa 480caaccaucug gcagcagaug gaggaacugg
ggauggcacc cgcgcugcag cccacgcagg 540gggcaaugcc ggccuuugcg
uccgcguuuc agcgcagggc ggguggaguc cucguagcga 600gccaccuuca
aucauuuuug gaagucucgu accgggugcu gagacaucuu gcgcagccgu
660cauccucgag caaggccccu ccgcccucac ugccaucgcc aagccgccug
ccgggaccuu 720ccgacacccc gauccucccg cagucauccu cgagcaaggc
cccuccgccc ucacugccau 780cgccaagccg ccugccggga ccuuccgaca
ccccgauccu cccgcaggcu ggagccucgg 840uggccaugcu ucuugccccu
ugggccuccc cccagccccu ccuccccuuc cugcacccgu 900acccccgugg
ucuuugaaua aagucugagu gggcggc 937361060RNAArtificial
SequenceDescription of artificial sequence synthetic transcript
sequence 36gggaaauaag agagaaaaga agaguaagaa gaaauauaag agccaccaug
gccacugggu 60cgaggaccag ccuguuguug gccuuugggc ugcuuugucu gccauggcuc
caagagggau 120ccgcaucauc cucgagcaag gccccuccgc ccucacugcc
aucgccaagc cgccugccgg 180gaccuuccga caccccgauc cucccgcagu
ucccgacaau uccccucuca agacuguuug 240auaacgcuau gcuccgagcc
caccggcugc accagcuggc guucgauaca uaccaagaau 300ucgaggaagc
auacaucccc aaagagcaga aguauucguu ccuucaaaau ccucagacau
360cgcuuuguuu cucggaguca auuccgacgc ccagcaauag ggaagaaacg
cagcagaagu 420cgaaccuuga guuguugcgg auuagcuugc uccugaucca
gucauggcuc gaaccggugc 480aguucuugcg cucgguguuu gcgaacuccc
ugguauaugg ugcguccgau ucaaaugucu 540acgacuugcu caaggaucuu
gaagagggga uccaaacucu cauggguagg cuugaggacg 600gcucgccucg
cacgggacag aucuuuaagc agacguauuc gaaauuugac accaauucac
660auaacgacga cgcguugcuc aaaaacuaug gauugcucua cugcuuucgg
aaggacaugg 720auaaagugga gacauucuug agaaucgucc agugcagauc
cguagaggga ucaugcgguu 780uuucauccuc gagcaaggcc ccuccgcccu
cacugccauc gccaagccgc cugccgggac 840cuuccgacac cccgauccuc
ccgcagucau ccucgagcaa ggccccuccg cccucacugc 900caucgccaag
ccgccugccg ggaccuuccg acaccccgau ccucccgcag gcuggagccu
960cgguggccau gcuucuugcc ccuugggccu ccccccagcc ccuccucccc
uuccugcacc 1020cguacccccg uggucuuuga auaaagucug agugggcggc
106037251PRTHomo sapiens 37Met Leu Gly Ala Arg Leu Arg Leu Trp Val
Cys Ala Leu Cys Ser Val 1 5 10 15 Cys Ser Met Ser Val Leu Arg Ala
Tyr Pro Asn Ala Ser Pro Leu Leu 20 25 30 Gly Ser Ser Trp Gly Gly
Leu Ile His Leu Tyr Thr Ala Thr Ala Arg 35 40 45 Asn Ser Tyr His
Leu Gln Ile His Lys Asn Gly His Val Asp Gly Ala 50 55 60 Pro His
Gln Thr Ile Tyr Ser Ala Leu Met Ile Arg Ser Glu Asp Ala 65 70 75 80
Gly Phe Val Val Ile Thr Gly Val Met Ser Arg Arg Tyr Leu Cys Met 85
90 95 Asp Phe Arg Gly Asn Ile Phe Gly Ser His Tyr Phe Asp Pro Glu
Asn 100 105 110 Cys Arg Phe Gln His Gln Thr Leu Glu Asn Gly Tyr Asp
Val Tyr His 115 120 125 Ser Pro Gln Tyr His Phe Leu Val Ser Leu Gly
Arg Ala Lys Arg Ala 130 135 140 Phe Leu Pro Gly Met Asn Pro Pro Pro
Tyr Ser Gln Phe Leu Ser Arg 145 150 155 160 Arg Asn Glu Ile Pro Leu
Ile His Phe Asn Thr Pro Ile Pro Arg Arg 165 170 175 His Thr Arg Ser
Ala Glu Asp Asp Ser Glu Arg Asp Pro Leu Asn Val 180 185 190 Leu Lys
Pro Arg Ala Arg Met Thr Pro Ala Pro Ala Ser Cys Ser Gln 195 200 205
Glu Leu Pro Ser Ala Glu Asp Asn Ser Pro Met Ala Ser Asp Pro Leu 210
215 220 Gly Val Val Arg Gly Gly Arg Val Asn Thr His Ala Gly Gly Thr
Gly 225 230 235 240 Pro Glu Gly Cys Arg Pro Phe Ala Lys Phe Ile 245
250 38817RNAArtificial SequenceDescription of artificial sequence
synthetic transcript sequence 38gggaaauaag agagaaaaga agaguaagaa
gaaauauaag agccaccaug gccacugggu 60cgaggaccag ccuguuguug gccuuugggc
ugcuuugucu gccauggcuc caagagggau 120ccgcauuccc gacaauuccc
cucucaagac uguuugauaa cgcuaugcuc cgagcccacc 180ggcugcacca
gcuggcguuc gauacauacc aagaauucga ggaagcauac auccccaaag
240agcagaagua uucguuccuu caaaauccuc agacaucgcu uuguuucucg
gagucaauuc 300cgacgcccag caauagggaa gaaacgcagc agaagucgaa
ccuugaguug uugcggauua 360gcuugcuccu gauccaguca uggcucgaac
cggugcaguu cuugcgcucg guguuugcga 420acucccuggu auauggugcg
uccgauucaa augucuacga cuugcucaag gaucuugaag 480aggggaucca
aacucucaug gguaggcuug aggacggcuc gccucgcacg ggacagaucu
540uuaagcagac guauucgaaa uuugacacca auucacauaa cgacgacgcg
uugcucaaaa 600acuauggauu gcucuacugc uuucggaagg acauggauaa
aguggagaca uucuugagaa 660ucguccagug cagauccgua gagggaucau
gcgguuuuug auaauaggcu ggagccucgg 720uggccaugcu ucuugccccu
ugggccuccc cccagccccu ccuccccuuc cugcacccgu 780acccccgugg
ucuuugaaua aagucugagu gggcggc 817391069RNAArtificial
SequenceDescription of artificial sequence synthetic transcript
sequence 39gggaaauaag agagaaaaga agaguaagaa gaaauauaag agccaccaug
gccacugggu 60cgaggaccag ccuguuguug gccuuugggc ugcuuugucu gccauggcuc
caagagggau 120ccgcaucauc cucgagcaag gccccuccgc ccucacugcc
aucgccaagc cgccugccgg 180gaccuuccga caccccgauc cucccgcagu
ucccgacaau uccccucuca agacuguuug 240auaacgcuau gcuccgagcc
caccggcugc accagcuggc guucgauaca uaccaagaau 300ucgaggaagc
auacaucccc aaagagcaga aguauucguu ccuucaaaau ccucagacau
360cgcuuuguuu cucggaguca auuccgacgc ccagcaauag ggaagaaacg
cagcagaagu 420cgaaccuuga guuguugcgg auuagcuugc uccugaucca
gucauggcuc gaaccggugc 480aguucuugcg cucgguguuu gcgaacuccc
ugguauaugg ugcguccgau ucaaaugucu 540acgacuugcu caaggaucuu
gaagagggga uccaaacucu cauggguagg cuugaggacg 600gcucgccucg
cacgggacag aucuuuaagc agacguauuc gaaauuugac accaauucac
660auaacgacga cgcguugcuc aaaaacuaug gauugcucua cugcuuucgg
aaggacaugg 720auaaagugga gacauucuug agaaucgucc agugcagauc
cguagaggga ucaugcgguu 780uuucauccuc gagcaaggcc ccuccgcccu
cacugccauc gccaagccgc cugccgggac 840cuuccgacac cccgauccuc
ccgcagucau ccucgagcaa ggccccuccg cccucacugc 900caucgccaag
ccgccugccg ggaccuuccg acaccccgau ccucccgcag ugauaauagg
960cuggagccuc gguggccaug cuucuugccc cuugggccuc cccccagccc
cuccuccccu 1020uccugcaccc guacccccgu ggucuuugaa uaaagucuga
gugggcggc 106940217PRTHomo sapiens 40Met Ala Thr Gly Ser Arg Thr
Ser Leu Leu Leu Ala Phe Gly Leu Leu 1 5 10 15 Cys Leu Pro Trp Leu
Gln Glu Gly Ser Ala Phe Pro Thr Ile Pro Leu 20 25 30 Ser Arg Leu
Phe Asp Asn Ala Met Leu Arg Ala His Arg Leu His Gln 35 40 45 Leu
Ala Phe Asp Thr Tyr Gln Glu Phe Glu Glu Ala Tyr Ile Pro Lys 50 55
60 Glu Gln Lys Tyr Ser Phe Leu Gln Asn Pro Gln Thr Ser Leu Cys Phe
65 70 75 80 Ser Glu Ser Ile Pro Thr Pro Ser Asn Arg Glu Glu Thr Gln
Gln Lys 85 90 95 Ser Asn Leu Glu Leu Leu Arg Ile Ser Leu Leu Leu
Ile Gln Ser Trp 100 105 110 Leu Glu Pro Val Gln Phe Leu Arg Ser Val
Phe Ala Asn Ser Leu Val 115 120 125 Tyr Gly Ala Ser Asp Ser Asn Val
Tyr Asp Leu Leu Lys Asp Leu Glu 130 135 140 Glu Gly Ile Gln Thr Leu
Met Gly Arg Leu Glu Asp Gly Ser Pro Arg 145 150 155 160 Thr Gly Gln
Ile Phe Lys Gln Thr Tyr Ser Lys Phe Asp Thr Asn Ser 165 170 175 His
Asn Asp Asp Ala Leu Leu Lys Asn Tyr Gly Leu Leu Tyr Cys Phe 180 185
190 Arg Lys Asp Met Asp Lys Val Glu Thr Phe Leu Arg Ile Val Gln Cys
195 200 205 Arg Ser Val Glu Gly Ser Cys Gly Phe 210 215
41797RNAArtificial SequenceDescription of artificial sequence
synthetic transcript sequence 41gggaaauaag agagaaaaga agaguaagaa
gaaauauaag agccaccaug gccacugggu 60cgaggaccag ccuguuguug gccuuugggc
ugcuuugucu gccauggcuc caagagggau 120ccgcauuccc gacaauuccc
cucucaagac uguuugauaa cgcuaugcuc cgagcccacc 180ggcugcacca
gcuggcguuc gauacauacc aagaauucga ggaagcauac auccccaaag
240agcagaagua uucguuccuu caaaauccuc agacaucgcu uuguuucucg
gagucaauuc 300cgacgcccag caauagggaa gaaacgcagc agaagucgaa
ccuugaguug uugcggauua 360gcuugcuccu gauccaguca uggcucgaac
cggugcaguu cuugcgcucg guguuugcga 420acucccuggu auauggugcg
uccgauucaa augucuacga cuugcucaag gaucuugaag 480aggggaucca
aacucucaug gguaggcuug aggacggcuc gccucgcacg ggacagaucu
540uuaagcagac guauucgaaa uuugacacca auucacauaa cgacgacgcg
uugcucaaaa 600acuauggauu gcucuacugc uuucggaagg acauggauaa
aguggagaca uucuugagaa 660ucguccagug cagauccgua gagggaucau
gcgguuuuug auaagcugcc uucugcgggg 720cuugccuucu ggccaugccc
uucuucucuc ccuugcaccu guaccucuug gucuuugaau 780aaagccugag uaggaag
79742778RNAArtificial SequenceDescription of artificial sequence
synthetic transcript sequence 42gggaaauaag agagaaaaga agaguaagaa
gaaauauaag agccaccaug gccggucccg 60cgacccaaag ccccaugaaa cuuauggccc
ugcaguugcu gcuuuggcac ucggcccucu 120ggacagucca agaagcgacu
ccucucggac cugccucauc guugccgcag ucauuccuuu 180ugaagugucu
ggagcaggug cgaaagauuc agggcgaugg agccgcacuc caagagaagc
240ucugcgcgac auacaaacuu ugccaucccg aggagcucgu acugcucggg
cacagcuugg 300ggauucccug ggcuccucuc ucguccuguc cgucgcaggc
uuugcaguug gcagggugcc 360uuucccagcu ccacuccggu uuguucuugu
aucagggacu gcugcaagcc cuugagggaa 420ucucgccaga auugggcccg
acgcuggaca cguugcagcu cgacguggcg gauuucgcaa 480caaccaucug
gcagcagaug gaggaacugg ggauggcacc cgcgcugcag cccacgcagg
540gggcaaugcc ggccuuugcg uccgcguuuc agcgcagggc ggguggaguc
cucguagcga 600gccaccuuca aucauuuuug gaagucucgu accgggugcu
gagacaucuu gcgcagccgu 660gauaauaggc uggagccucg guggccaugc
uucuugcccc uugggccucc ccccagcccc 720uccuccccuu ccugcacccg
uacccccgug gucuuugaau aaagucugag ugggcggc 77843862RNAArtificial
SequenceDescription of artificial sequence synthetic transcript
sequence 43gggaaauaag agagaaaaga agaguaagaa gaaauauaag agccaccaug
gccggucccg 60cgacccaaag ccccaugaaa cuuauggccc ugcaguugcu gcuuuggcac
ucggcccucu 120ggacagucca agaaucaucc ucgagcaagg ccccuccgcc
cucacugcca ucgccaagcc 180gccugccggg accuuccgac accccgaucc
ucccgcaggc gacuccucuc ggaccugccu 240caucguugcc gcagucauuc
cuuuugaagu gucuggagca ggugcgaaag auucagggcg 300auggagccgc
acuccaagag aagcucugcg cgacauacaa acuuugccau cccgaggagc
360ucguacugcu cgggcacagc uuggggauuc ccugggcucc ucucucgucc
uguccgucgc 420aggcuuugca guuggcaggg ugccuuuccc agcuccacuc
cgguuuguuc uuguaucagg 480gacugcugca agcccuugag ggaaucucgc
cagaauuggg cccgacgcug gacacguugc 540agcucgacgu ggcggauuuc
gcaacaacca ucuggcagca gauggaggaa cuggggaugg 600cacccgcgcu
gcagcccacg cagggggcaa ugccggccuu ugcguccgcg uuucagcgca
660gggcgggugg aguccucgua gcgagccacc uucaaucauu uuuggaaguc
ucguaccggg 720ugcugagaca ucuugcgcag ccgugauaau aggcuggagc
cucgguggcc augcuucuug 780ccccuugggc cuccccccag ccccuccucc
ccuuccugca cccguacccc cguggucuuu 840gaauaaaguc ugagugggcg gc
86244946RNAArtificial SequenceDescription of artificial sequence
synthetic transcript sequence 44gggaaauaag agagaaaaga agaguaagaa
gaaauauaag agccaccaug gccggucccg 60cgacccaaag ccccaugaaa cuuauggccc
ugcaguugcu gcuuuggcac ucggcccucu 120ggacagucca agaagcgacu
ccucucggac cugccucauc guugccgcag ucauuccuuu 180ugaagugucu
ggagcaggug cgaaagauuc agggcgaugg agccgcacuc caagagaagc
240ucugcgcgac auacaaacuu ugccaucccg aggagcucgu acugcucggg
cacagcuugg 300ggauucccug ggcuccucuc ucguccuguc cgucgcaggc
uuugcaguug gcagggugcc 360uuucccagcu ccacuccggu uuguucuugu
aucagggacu gcugcaagcc cuugagggaa 420ucucgccaga auugggcccg
acgcuggaca cguugcagcu cgacguggcg gauuucgcaa 480caaccaucug
gcagcagaug gaggaacugg ggauggcacc cgcgcugcag cccacgcagg
540gggcaaugcc ggccuuugcg uccgcguuuc agcgcagggc ggguggaguc
cucguagcga 600gccaccuuca aucauuuuug gaagucucgu accgggugcu
gagacaucuu gcgcagccgu 660cauccucgag caaggccccu ccgcccucac
ugccaucgcc aagccgccug ccgggaccuu 720ccgacacccc gauccucccg
cagucauccu cgagcaaggc cccuccgccc ucacugccau 780cgccaagccg
ccugccggga ccuuccgaca ccccgauccu cccgcaguga uaauaggcug
840gagccucggu ggccaugcuu cuugccccuu gggccucccc ccagccccuc
cuccccuucc 900ugcacccgua cccccguggu cuuugaauaa agucugagug ggcggc
94645333RNAArtificial SequenceDescription of artificial sequence
synthetic transcript sequence 45gggaaauaag agagaaaaga agaguaagaa
gaaauauaag agccaccaug aagugggugu 60cuuucauuuc acugcucuuc cuguucucau
cugccuacuc cgguagccuc gauaagcgcc 120augcagaagg aacuuucacc
agcgacgugu ccucauaucu ugagggccag gcugccaaag 180aguuuaucgc
uuggcugguc aagggacggg ggugauaaua ggcugccuuc ugcggggcuu
240gccuucuggc caugcccuuc uucucucccu ugcaccugua ccucuugguc
uuugaauaaa 300gccugaguag gaaggcggcc gcucgagcau gca 33346110PRTHomo
sapiens 46Met Lys Trp Val Ser Phe Ile Ser Leu Leu Phe Leu Phe Ser
Ser Ala 1 5 10 15 Tyr Ser Gly Ser Leu Asp Lys Arg His Gly Glu Gly
Thr Phe Thr Ser 20 25 30 Asp Val Ser Ser Tyr Leu Glu Gly Gln Ala
Ala Lys Glu Phe Ile Ala 35 40 45 Trp Leu Val Lys Gly Arg Ser Ser
Ser Ser Lys Ala Pro Pro Pro Ser 50 55 60 Leu Pro Ser Pro Ser Arg
Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu 65 70 75 80 Pro Gln Ser Ser
Ser Ser Lys Ala Pro Pro Pro Ser Leu Pro Ser Pro 85 90 95 Ser Arg
Leu Pro Gly Pro Ser Asp Thr Pro Ile Leu Pro Gln 100 105 110
47496RNAArtificial SequenceDescription of artificial sequence
synthetic transcript sequence 47gggaaauaag agagaaaaga agaguaagaa
gaaauauaag agccaccaug aagugggugu 60cguucaucuc acuguuguuc cuuuucagcu
cggcguacuc ggggucacuc gacaaacgcc 120acggagaggg caccuuuacu
uccgauguca gcuccuaccu cgaaggccag gcggcaaagg 180aauucaucgc
cuggcuggug aagggaagaa gcucaucgag caaggccccu ccaccguccc
240ucccuucgcc gucccggcug ccgggaccaa gcgacacucc gauccugcca
caaucgucau 300ccuccaaagc uccuccaccc ucgcugccau ccccgucaag
gcugcccggu ccgagcgaua 360ccccgauucu cccgcaguga uaauaggcug
gagccucggu
ggccaugcuu cuugccccuu 420gggccucccc ccagccccuc cuccccuucc
ugcacccgua cccccguggu cuuugaauaa 480agucugagug ggcggc
496482175RNAArtificial SequenceDescription of artificial sequence
synthetic transcript sequence 48gggaaauaag agagaaaaga agaguaagaa
gaaauauaag agccaccaug aagugggugu 60ccuucaucuc acuucuuuuc cucuuuucuu
cugcauacag cggaucacuc gauaagcgcc 120acggugaggg gacuuucacc
ucagaugugu ccagcuaucu cgaagggcag gccgcuaaag 180aguucaucgc
cuggcugguc aaggguagac acggagaggg aaccuucacu agcgacguga
240gcucauaccu cgaaggccaa gcagccaagg aauucaucgc uuggcucgug
aaaggaaggg 300acgcccauaa gucugagguc gcccaucggu uuaaggaccu
cggagaagaa aacuucaaag 360cccugguccu cauugccuuu gcccaguauc
ugcagcagug ccccuucgag gaccacguga 420agcuggucaa cgaagugacc
gaguucgcaa agacuugcgu ggccgaugaa ucagccgaga 480auugcgauaa
gucacuucau acccuguuug gagacaagcu guguaccguc gccacccugc
540gcgaaacuua cggagagaug gcugacugcu gugccaagca ggagccugag
cgcaacgagu 600guuuucucca gcacaaagau gacaacccaa accugccucg
gcuggugcgc ccugaagucg 660acgugaugug cacugccuuc caugacaaug
aggagacuuu ccuuaagaag uaccucuacg 720agaucgcuag acggcaccca
uauuucuacg ccccugagcu ucuguucuuu gcuaaacggu 780auaaagccgc
uuucacugag ugcugccaag ccgccgacaa ggccgccugu cugcugccca
840agcucgacga acugcgcgac gaagggaaag cuucuucagc caaacagaga
cugaagugcg 900ccucacuuca gaaguuuggg gaaagagcau ucaaagcaug
ggcaguggcu agacuuagcc 960aacgguuucc aaaggcagaa uucgccgaag
ugucuaagcu ggugaccgac cugaccaagg 1020ugcauaccga augcugccau
ggggaccugc uugagugugc ugacgaucgg gccgaccucg 1080ccaaauacau
uugugaaaac caagacucca uuucuagcaa gcugaaggag ugcugugaaa
1140agccucuccu ugagaagagc cacugcauug cugaggucga gaaugacgag
augccugcug 1200aucuuccauc ucuggcagcu gacuucgugg aguccaagga
ugucuguaag aauuacgccg 1260aagccaaaga cguguuccuc ggaauguucc
uuuacgaaua cgcaagaagg cauccggacu 1320acuccguggu gcugcuucuu
cgccuggcaa agacuuauga gacuacccuc gaaaagugcu 1380gugcugcugc
ugacccccac gagugcuacg ccaagguguu ugacgaguuu aagccucucg
1440ucgaggagcc gcaaaaccug aucaagcaga auugugagcu uuucgaacag
cugggcgagu 1500acaaguucca aaacgcacug cuggugagau acaccaagaa
ggucccccaa gugucaaccc 1560cgacccuugu ggaagucucu cgcaaucuug
guaaaguggg aagcaagugc ugcaaacauc 1620ccgaagcaaa gagaaugcca
ugugccgagg acuaucuuag cgucgugcuc aaucagcucu 1680gcgugcuuca
cgaaaagacc ccugugucag aucgggucac caaguguugc accgagucac
1740uggugaaccg caggcccugc uucagcgcac ucgaggugga cgaaaccuac
gugccaaagg 1800aguucaacgc ugagacuuuu accuuccaug cugauaucug
cacucugagc gagaaggaac 1860gccagaucaa gaagcagacc gcccuggucg
aacuggucaa gcauaagccg aaagccacca 1920aggagcagcu gaaggcugug
auggaugacu ucgcagccuu cguggaaaag uguuguaaag 1980ccgaugacaa
agaaaccugc uucgcugagg aagggaagaa gcucgucgcu gccucucaag
2040ccgcccuggg ucugugauaa uaggcugccu ucugcggggc uugccuucug
gccaugcccu 2100ucuucucucc cuugcaccug uaccucuugg ucuuugaaua
aagccugagu aggaaggcgg 2160ccgcucgagc augca 2175491065RNAArtificial
SequenceDescription of artificial sequence synthetic transcript
sequence 49gggaaauaag agagaaaaga agaguaagaa gaaauauaag agccaccaug
aagugggugu 60cauucaucuc ucugcuuuuc cuguucucuu ccgccuacag cgggagccuc
gacaagcgcc 120acggagaggg cacuuucacc agcgacgugu caagcuaccu
ugaagagcaa gcugcuaagg 180aauucaucgc cuggcuugug aagggcggug
gcgguggugg gggcucuggg ggugguggaa 240gcgguggggg uggcucugcc
gagucaaaau acggaccacc gugcccaccc uguccugccc 300cugaagccgc
ugguggaccc ucugucuuuc ucuucccacc caagccgaaa gacacccuga
360ugauuucacg gaccccugag gugacuugcg ucgucgucga cgugagccag
gaagauccgg 420aagugcaguu caacugguau guggauggag ucgaggugca
uaaugcuaag accaagccua 480gagaagagca guuuaacagc acuuaucgcg
ucguguccgu ccucaccgug cugcaucagg 540acuggcuuaa cggaaaggag
uacaagugca aggugucuaa caaggggcuc ccuucaagca 600ucgaaaagac
caucagcaaa gcaaagggac agcccaggga accccaagug uauacccugc
660cacccucaca agaggagaug accaagaauc aagugucacu gaccugucug
gucaaaggau 720ucuacccuuc agacauugca guggaguggg agucaaaugg
ccagcccgag aauaacuaca 780agacuacucc accggugcuc gauuccgaug
gaucauucuu ccuuuacucu cgccugaccg 840uggacaaguc ucgguggcag
gaaggaaacg uguuuucuug cuccgucaug cacgaagcuc 900ugcauaauca
cuacacccag aaaucacuga gccugucccu uggaugauaa uaggcugccu
960ucugcggggc uugccuucug gccaugcccu ucuucucucc cuugcaccug
uaccucuugg 1020ucuuugaaua aagccugagu aggaaggcgg ccgcucgagc augca
1065
* * * * *
References