U.S. patent application number 14/691495 was filed with the patent office on 2016-01-21 for biosensors including metallic nanocavities.
The applicant listed for this patent is University of Utah Research Foundation. Invention is credited to Steven M. Blair, James N. Herron, Yongdong Liu, Farhad Mahdavi, Ajay Nahata.
Application Number | 20160018331 14/691495 |
Document ID | / |
Family ID | 38371932 |
Filed Date | 2016-01-21 |
United States Patent
Application |
20160018331 |
Kind Code |
A1 |
Blair; Steven M. ; et
al. |
January 21, 2016 |
BIOSENSORS INCLUDING METALLIC NANOCAVITIES
Abstract
A biomolecular assay includes a substrate with a metallic layer
on at least one surface thereof. The metallic film includes
nanocavities. The nanocavities are configured to enhance signals
that are representative of the presence or amount of one or more
analytes in a sample or sample solution, and may be configured to
enhance the signal by a factor of about two or more or by a factor
of about three or more. Such signal enhancement may be achieved
with nanocavities that are organized in an array, randomly
positioned nanocavities, or nanocavities that are surrounded by
increased surface area features, such as corrugation or patterning,
or nanocavities that have quadrilateral or triangular shapes with
tailored edge lengths, or with a plurality of nanoparticles.
Methods for fabricating biomolecular substrates and assay
techniques in which such bimolecular substrates are used are also
disclosed.
Inventors: |
Blair; Steven M.; (Salt Lake
City, UT) ; Mahdavi; Farhad; (Salt Lake City, UT)
; Liu; Yongdong; (Salt Lake City, UT) ; Herron;
James N.; (Salt Lake City, UT) ; Nahata; Ajay;
(Salt Lake City, UT) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
University of Utah Research Foundation |
Salt Lake City |
UT |
US |
|
|
Family ID: |
38371932 |
Appl. No.: |
14/691495 |
Filed: |
April 20, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11497581 |
Aug 2, 2006 |
9012207 |
|
|
14691495 |
|
|
|
|
60705216 |
Aug 2, 2005 |
|
|
|
60795110 |
Apr 26, 2006 |
|
|
|
Current U.S.
Class: |
506/9 ;
506/16 |
Current CPC
Class: |
G01N 2021/6439 20130101;
G01N 21/6428 20130101; G02B 2207/101 20130101; G01N 21/648
20130101; B82Y 15/00 20130101; G02B 5/008 20130101; G01N 33/54373
20130101; B82Y 20/00 20130101; G01N 21/7746 20130101; B82Y 30/00
20130101 |
International
Class: |
G01N 21/64 20060101
G01N021/64 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made in part with Government support
under Contract No. ECS-0134548 awarded by National Science
Foundation (NSF) and Contract No. 1R21EB000481-01 awarded by
National Institute of Health (NIH). The Government has certain
rights in this invention.
Claims
1. An apparatus for use in a biomolecular assay, comprising: a
substrate; and a metallic layer on at least one surface of the
substrate, the metallic layer including a plurality of
nanocavities, wherein the nanocavities create an exposed surface of
the substrate.
2. The apparatus of claim 1, wherein the substrate is substantially
planar.
3. The apparatus of claim 1, wherein the metallic layer comprises
gold.
4. The apparatus of claim 1, wherein the at least one nanocavity is
configured to enhance a signal representative of an amount of at
least one analyte present in a sample.
5. The apparatus of claim 1, further comprising capture molecules
immobilized within the plurality of nanocavities.
6. The apparatus of claim 5, wherein at least some of the capture
molecules are immobilized to surfaces of the metallic layer within
the plurality of nanocavities.
7. The apparatus of claim 1, wherein at least a portion of the
plurality of nanocavities are configured to enhance a signal
representative of an amount of at least one analyte present in a
sample.
8. The apparatus of claim 7, wherein the metallic layer is
configured to enhance a fluorescence signal that indicates binding
of at least one of an analyte and a competing molecule with a
capture molecule within a nanocavity of the metallic substrate.
9. The apparatus of claim 1, wherein the substrate comprises
quartz.
10. A biomolecular assay technique, comprising: introducing a
sample or sample solution into nanocavities of the apparatus of
claim 5; introducing electromagnetic radiation into the substrate,
wherein at least some of the electromagnetic radiation is
internally reflected within the substrate; detecting at least one
enhanced signal from the nanocavities representative of a presence
or amount of at least one type of analyte present in the sample.
Description
RELATED APPLICATIONS UNDER 35 U.S.C. .sctn.119(e)
[0001] This application claims the benefit of U.S. Provisional
Patent Application Ser. No. 60/705,216, filed Aug. 2, 2005, for
"BIOSENSORS INCLUDING METALLIC NANOCAVITIES," the entire contents
of which are hereby incorporated herein by this reference. This
application also claims the benefit of U.S. Provisional Patent
Application Ser. No. 60/795,110, filed Apr. 26, 2006, for "METALLIC
NANOCAVITIES CONFIGURED TO PROVIDE OPTIMAL RADIATIVE ENHANCEMENT,"
the entire contents of which are hereby incorporated herein by this
reference.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The invention relates generally to evanescent wave-type
biosensors, or biomolecular assays. More specifically, the
invention relates to biosensors including substrates with metallic
films on one or more surfaces thereof and, in particular, to
biosensors with metallic films that include nanocavities with
shapes that are configured to optimize the amplification of signals
indicative of the presence or amount of one or more analytes
present in a sample.
[0005] 2. Background of Related Art
[0006] Plasmonics is the study of phenomena related to the
interaction of electromagnetic radiation with an electron gas (or
plasma) at a metal surface (B. Schechter "Bright new world," New
Scientist 31-33 (2003)). Aside from the now-common surface plasmon
resonance (SPR)-based sensors (B. Liedberg, C. Nylander, and I.
Lundstrom, "Surface plasmon resonance for gas detection and
biosensing," Sen. Actuators, vol. 4, pp. 299-304, 1983; N. Bianchi,
C. Rustigliano, M. Tomassetti, G. Feriotto, F. Zorzato, and R.
Gambari, "Biosensor technology and surface plasmon resonance for
real-time detection of HIV-1 genomic sequences amplified by
polymerase chain reaction," Clin. Diagnostic Virology, vol. 8, pp.
199-208, 1997), plasmonics has been applied to molecular detection
applications by attaching metallic nanoparticles to molecules for
use as light scattering labels (J. Yguerabide and E. E. Yguerabide,
"Light-scattering submicroscopic particles as highly fluorescent
analogs and their use as tracer labels in clinical and biological
applications," Anal. Biochem., vol. 262, no. 2, pp. 157-176,
September 1998; T. A. Taton, C. A. Mirkin, and R. L. Letsinger,
"Scanometric DNA array detection with nanoparticle probes,"
Science, vol. 289, pp. 1757-1760, 2000; L. R. Hirsch, J. B.
Jackson, A. Lee, N. J. Halas, and J. L. West, "A whole blood
immunoassay using gold nanoshells," Anal. Chem., vol. 75, p. 2377,
2003) in biosensing. Nanostructured metallic surfaces have also
been studied extensively for surface-enhanced fluorescence (A.
Wokaun, H.-P. Lutz, A. P. King, U. P. Wild, and R. R. Ernst,
"Energy transfer in surface enhanced luminescence," J. Chem. Phys.,
vol. 79, no. 1, pp. 509-514, 1983; J. Malicka, I. Gryczynski, Z.
Gryczynski, and J. R. Lakowicz, "Effects of fluorophore-to-silver
distance on the emission of cyanine-dye-labeled oligonucleotides,"
Anal. Biochem., vol. 315, pp. 57-66, 2003) and Raman scattering
(SERS) (K. Kneipp, H. Kneipp, R. Manoharan, E. B. Hanlon, I.
Itzkan, R. R. Dasari, and M. S. Feld, "Extremely large enhancement
factors in surface-enhanced Raman scattering for molecules on
colloidal gold clusters," Appl. Spectros., vol. 52, pp. 1493-1497,
1998). One of the major drawbacks of these surface-enhanced
techniques is that the nanostructure is disordered (but sometimes
with fractal order) such that the fluorescence or Raman enhancement
factors are spatially-varying, as evidenced by "hot-spots" on the
surface (V. M. Shalaev, R. Botet, J. Mercer, and E. B. Stechel,
"Optical properties of self-affine thin films," Phys. Rev. B, vol.
54, pp. 8235-8242, 1996). The hot-spot effect may render these
techniques unsuitable for quantitative assays, especially in an
array format, as the average enhancement over a defined sensing
zone may not be very high, and the enhancement from zone to zone
may vary. As a result, there have been efforts in which molecules
are attached to lithographically defined arrays of metallic
nanoparticles (H. Ditlbacher, N. Felidj, J. R. Krenn, B.
Lambprecht, A. Leitner, and F. R. Aussenegg, "Electromagnetic
interaction of fluorophores with designed 2D silver nanoparticle
arrays," Appl. Phys. B, vol. 73, p. 373, 2001; N. Felidj, J.
Aubard, G. Levi, J. R. Krenn, A. Hohenau, G. Schider, A. Leitner,
and F. R. Aussenegg, "Optimized surface-enhanced Raman scattering
on gold nanoparticle arrays," Appl. Phys. Lett., vol. 82, no. 18,
pp. 3095-3097, 2003). With these architectures, uniformity in
nanoparticle size, shape, and spacing result in well-defined
enhancement in terms of magnitude and spatial location. However,
these techniques do not provide complete isolation from background
produced by unbound species, as uniform illumination can excite
fluorescence from molecules located between nanoparticles, which
produce background signals at the detector.
[0007] An important recent advance is the demonstration of
extraordinary light transmission through a periodic array of
subwavelength metallic apertures (T. W. Ebbeson, H. J. Lezec, H. F.
Ghaemi, T. Thio, and P. A. Wolff, "Extraordinary optical
transmission through sub-wavelength hole arrays," Nature, vol. 391,
pp. 667-669, 1998) or nanocavities, where, in the absence of the
nanocavities, no light passes through the metal film. Even though
this has been quite an active area of research, some disagreement
about the origin of the transmission enhancement still exists (H.
J. Lezec and T. Thio, "Diffracted evanescent wave model for
enhanced and suppressed optical transmission through subwavelength
hole arrays," Optics Express, vol. 12, no. 16, pp. 3629-3651,
2004). However, it is generally believed (I. Avrutsky, Y. Zhao, and
V. Kochergin, "Surface-plasmon-assisted resonant tunneling of light
through a periodically corrugated thin metal film," Opt. Lett.,
vol. 25, pp. 595-597, 2000; A. K. Sarychev, V. A. Podolsky, A. M.
Dykhne, and V. M. Shalaev, "Resonance transmittance through a metal
film with subwavelength holes," IEEE J. Quantum Electron., vol. 38,
pp. 956-963, 2002; L. Martin-Moreno and F. J. Garcia-Vidal, "Theory
of extraordinary optical transmission through subwavelength hole
arrays," Opt. Express, vol. 12, pp. 3619-3628, 2004.5) that the
periodic array of nanocavities acts as a two-dimensional
diffraction grating, which, at specific incidence angles, allows
light to couple from free space into surface plasmon polariton
(SPP) Bloch modes on either metal interface. These SPP modes can
constructively interfere within the nanocavities, resulting in
intensity enhancement (H. J. Lezec and T. Thio, "Diffracted
evanescent wave model for enhanced and suppressed optical
transmission through subwavelength hole arrays," Optics Express,
vol. 12, no. 16, pp. 3629-3651, 2004) and, therefore, greater
transmission. The inventors have demonstrated experimentally, using
fluorophores as local intensity probes, that light is indeed
localized within the nanocavities (Y. Liu and S. Blair,
"Fluorescence enhancement from an array of subwavelength metal
apertures," Opt. Lett., vol. 28, pp. 507-509, 2003) and that
enhanced fluorescence transduction can be performed (Y. Liu, J.
Bishop, L. Williams, S. Blair, and J. N. Herron, "Biosensing based
upon molecular confinement in metallic nanocavity arrays,"
Nanotechnology, vol. 15, pp. 1368-1374, 2004; Y. Liu and S. Blair,
"Fluorescence transmission through 1-D and 2-D periodic metal
films," Opt. Express, vol. 12, no. 16, pp. 3686-3693, 2004).
[0008] More recently, enhancement in single molecule fluorescence h
as been reported for round (H. Rigneault, J. Capoulade, J.
Ditinger, J. Wenger, N. Bonod, E. Popov, T. W. Ebbesen, and P.-F.
Lenne, "Enhancement of single-molecule fluorescence detection in
subwavelength apertures," Physical Review Letters 95, 117401
(2005)) and rectangular (J. Wenger, P.-F. Lenne, E. Popov, H.
Rigneault, J. Ditinger, and T. W. Ebbesen, "Single-molecule
fluorescence in rectangular nano-apertures," Optics Express 13,
7035-7044 (2005)) nanoapertures, and a computational model for
radiative enhancement has been developed (Y. Liu, F. Mandavi, and
S. Blair, "Enhanced fluorescence transduction properties of
metallic nanocavity arrays," IEEE Journal of Selected Topics in
Quantum Electronics 11, 778-784 (2005)).
[0009] Multi-analyte, or array, biosensing is an increasingly
important area of research and development for many clinical,
environmental, and industrial applications. In the clinical
application of genetic screening, for example, high sensitivity
hybridization arrays are needed for rapid identification of genetic
disorders in the presence of multiple genotypes or mutations (B. J.
Maron, J. H. Moller, C. E. Seidman, G. M. Vincent, H. C. Dietz, A.
J. Moss, H. M. Sondheimer, R. E. Pyeritz, G. McGee, and A. E.
Epstein, "Impact of laboratory molecular diagnosis on contemporary
diagnostic criteria for genetically transmitted cardiovascular
diseases: hypertrophic cardiomyopathy, long-QT syndrome, and Marfan
syndrome," Circulation 98, 1460-1471 (1998); J. G. Hacia
"Resequencing and mutational analysis using oligonucleotide
microarrays," Nature Genetics 21, 42-47 (1999)).
[0010] However, many challenges, such as improving sensitivity,
accuracy, precision and specificity of the assays, reducing assay
time, etc., remain in the field.
SUMMARY OF THE INVENTION
[0011] A biomolecular assay includes a substrate with a metallic
film, or layer, on at least one surface thereof. The metallic film
includes nanocavities. The nanocavities are configured to enhance
signals that are representative of the presence or amount of one or
more analytes (e.g., proteins or peptides, nucleic acids, small
molecule ligands, ions, etc.) in a sample or sample solution. Such
a biomolecular assay may be used for a variety of purposes,
including, without limitations, receptor-ligand binding, drug
screening, real-time nucleic acid hybridization, clinical
diagnostics, etc.
[0012] A biomolecular assay may be fabricated by forming a
substrate, or support, from a suitable material (e.g., glass,
quartz, another optically suitable (e.g., transparent) inorganic
material, an optical plastic, a combination of any of the foregoing
(as is the case in so-called "thin-film" waveguides, which include
multiple layers), etc.). A metallic film, or layer, is applied to
at least one surface of the substrate (e.g., by deposition
techniques, lamination processes, etc.). By way of nonlimiting
example, the metallic film may have a thickness of about 100
nm.
[0013] Nanocavities are formed in the metallic film by suitable
processes (e.g., mask and lift-off processes (such as those used in
semiconductor device fabrication), mask and etch processes (such as
those used in semiconductor device fabrication), with a laser,
etc.). The nanocavities may extend completely through the metallic
film, with the underlying substrate being exposed therethrough. A
lateral dimension (e.g., diameter) of each nanocavity may be about
the same as the thickness of the metallic layer, although lateral
nanocavity dimensions may differ from the thickness of the metallic
layer.
[0014] Nanocavities of virtually any shape may be formed. Examples
of nanocavity shapes include, but are not limited to, round (e.g.,
circular, oval, elliptical, egg-shaped, etc.), quadrilateral (e.g.,
square, rectangular, parallelogram, trapezoidal, etc.), triangular,
and other polygonal shapes. The nanocavities that are formed in a
metallic film may all have substantially the same shapes and
dimensions, or a variety of shapes and/or dimensions of
nanocavities may be included in the metallic film of a biomolecular
assay that incorporates teachings of the invention.
[0015] The nanocavities may be arranged in such a way that
facilitates the coupling of incident light into surface modes, or
waves, on the metallic film, which surface modes can constructively
interfere within the nanocavities. For example, when incident light
is to be directed from the substrate, or back side of the
biomolecular assay, and fluorescence is to be detected at a
location adjacent to the opposite, top surface of the biomolecular
assay (i.e., the surface by which the metallic film is carried),
the metallic film prevents excitation of fluorophores in the bulk
solution, which is located over the metallic substrate. As another
example, when incident light is directed toward the biomolecular
assay from a location over the metallic film and detection occurs
at a location adjacent to the back side of the substrate, although
marker molecules that remain within solution may undergo a change
in state (e.g., fluorescence by fluorescent marker molecules), the
marker molecules that remain in solution over the metallic film
remain substantially undetected. This is because light emitted from
a location above the metallic film does not pass through the
metallic film and since the size of each nanocavity may be too
small for fluorescent light emitted from locations over the surface
of the metallic film to pass therethrough. Fluorescent light
generated within the nanocavities does exit the nanocavities,
however, and is enhanced by the materials from which the
nanocavities are formed, as well as by the configurations and
dimensions of the nanocavities.
[0016] In specific applications, however, fluorescence signals
originating from fluorescent species lying outside of the cavity
may be a concern. For example, these signals may increase
background or noise of an assay and thus compromise the sensitivity
and/or precision of the assay. Partial or complete isolation of
fluorescence signals originating from fluorescent species lying
outside of the cavity can be obtained by either narrowing the
fluorescence collection angle or by passivating the surfaces of the
metallic film.
[0017] The shapes of the nanocavities may be configured to optimize
signal amplification. It has been discovered that nanocavities of a
variety of shapes, including circular, square, and triangular,
provide a good degree of radiative, or signal, enhancement,
depending upon the dimensions (e.g., diameters of circular
nanocavities, edge lengths of square and triangular nanocavities,
etc.) of the nanocavities. Square nanocavities may provide better
signal enhancement than circular nanocavities, while triangular
nanocavities may provide even greater signal enhancement. Without
limiting the scope of the invention, circular nanocavities formed
in a gold film having a thickness of about 100 nm may enhance a
signal by up to about 1.8 times (for nanocavities having diameters
of about 160 nm), square nanocavities formed in a gold film having
a thickness of about 100 nm may enhance a signal by up to about 2.1
or 2.2 times (for nanocavities with edges of about 125 nm in length
and 20 nm radius corners), and equilateral triangular cavities
formed in a gold film having a thickness of about 100 nm may
enhance a signal by up to about 3 times (for nanocavities with
edges that are about 175 nm long an that have 20 nm radius
corners). It is believed that even greater radiative, or signal,
enhancements may be achieved by further tailoring the shapes or
dimensions of nanocavities.
[0018] Optionally, a biomolecular substrate according to the
invention may include one or more transparent films positioned
between the substrate and the metallic film or over the metallic
film for directing incident light to the nanocavities. Nanocavities
may extend into or through such transparent films.
[0019] Surfaces of the biomolecular substrate may be passivated to
prevent capture molecules (e.g., bait molecules) from adhering, or
being immobilized, to undesired locations thereof. The surfaces of
the metallic film may be passivated, for example, with polyethylene
glycol (PEG)-thiol, another metal (e.g., gold)-selective thiol
molecule, or any other material that prevents capture molecules
from being immobilized to the metallic film, or reduce
immobilization of capture molecules to the metallic film. Thus, the
capture molecules are instead immobilized to the surface of the
substrate exposed to and located within or adjacent to the
nanocavities. Alternatively, the exposed surfaces of the substrate
may be passivated (e.g., with PEG silane) to prevent capture
molecules from adhering to the substrate and, rather, causing the
capture molecules to be immobilized only to the metallic surfaces.
As another alternative, a major surface of the metallic film may be
covered with a coating film (e.g., another transparent film), and
the exposed surfaces of the coating film, as well as surfaces of
the substrate that are exposed through the coating film and the
metallic film, may be passivated, causing capture molecules to
adhere only to the unpassivated exposed edges of the metallic film,
which form part of the surface of each nanocavity.
[0020] The biomolecular substrate may be configured in such a way
that surface modes (e.g., surface plasmons, which generate an
evanescent field) may be generated at the surface of the metallic
film or at the portions of the surface of the substrate that are
exposed by the nanocavities. These surface modes may provide
enhanced excitation of marker molecules on analyte that has been
bound to capture molecules within the nanocavities, particularly
surface modes that constructively interfere with one another.
[0021] Capture molecules are introduced into the nanocavities and
immobilized to surfaces of the nanocavities, the substrate, or
both, as known in the art. The capture molecules are specific for
one or more analytes of interest.
[0022] Increased surface area structures, such as corrugated
patterning having a "bullseye" configuration, other patterns, or
the like may be formed around each nanocavity.
[0023] Nanocavities may be arranged in nanostructure architectures
such as a periodic array of nanocavities, a random array of
nanocavities, and "bullseye" structure of single nanocavity
surrounded by an annular, corrugated grating. Several embodiments
of nanostructure architectures are illustrated in FIG. 1 as
described herein.
[0024] A periodic array of metallic nanoparticles can also provide
enhanced signals, since, in essence, metallic nanoparticles merge
to form a periodic hole array. An example of a nanoparticle array
is illustrated in FIG. 1 (c) as described herein.
[0025] Such a biomolecular assay may include a sequential delivery
system, in which a sample flows into the nanocavities in sequence.
Sequential delivery systems are useful for detecting small
concentrations of analyte, as well as with samples having small
volumes. Of course, other types of delivery systems, including
delivery systems with sections through which portions of a sample
may flow in parallel, are also within the scope of the
invention.
[0026] Once a sample has traveled through the delivery system, it
may be recycled through the system one or more times. Recycling may
be effected in a loop, in which the sample travels through the
system in the same direction each time, or may be effected by
reversing the direction in which the sample flows through the
delivery system. Recycling may be useful for optimizing detection
of low analyte concentrations in a sample or for detecting analyte
in samples having small volumes.
[0027] Sample flow through a sequential or any other configuration
of delivery system may be effected by mechanisms that are
fabricated on or assembled with the biomolecular assay. Examples of
flow facilitators include, but are not limited to, peristaltic
pumps, positive pressure systems, and negative pressure
systems.
[0028] Mixing structures, such as those disclosed in U.S. patent
application Ser. No. 10/350,361, filed on Jan. 23, 2003, the
disclosure of which is hereby incorporated herein, in its entirety,
by this reference. Such mixing structures may also be included in a
sample delivery system of a biomolecular assay that incorporates or
may use the invention to advantage. In addition or as an
alternative to being located at reaction sites of the biomolecular
assay, mixing structures may be positioned along other locations of
the sample delivery system, including between reaction sites and at
ends of the system, where they may increase the homogeneity of a
sample prior to recirculating the sample through the delivery
system.
[0029] The use of a sequential delivery system, sample
recirculation, sample flow facilitation, sample mixing, or any
combination thereof may reduce the amount of reagent required for
detecting an analyte in a sample.
[0030] As a nonlimiting example, the biomolecular assay may be used
in an assay system or technique that employs fluorescence detection
techniques. Such a system also includes a source of electromagnetic
radiation and a detector. The source is configured to emit
electromagnetic radiation of one or more wavelengths, or "incident
light," that excites fluorescent dye molecules that are to be used
in the system, and oriented to direct the radiation onto the
nanocavities or into the substrate. The incident light may be in
the form of light transmitted from a source, an evanescent field
generated as light is directed into and internally reflected within
a substrate or transparent film that comprises a waveguide, or a
combination thereof. Radiation can penetrate the nanocavities
directly and, optionally, due to constructive interference that may
occur because of the arrangement of the nanocavities, thereby
exciting species within the nanocavities, or radiation may be
internally reflected within the substrate, generating an evanescent
field at one or more surfaces thereof. The incident light excites
fluorescent dye molecules that are immobilized (directly or
indirectly, depending upon the assay binding technique (e.g., a
sandwich-type assay, a binding competition assay, etc.) employed
relative to capture molecules within the nanocavities. Fluorescent
dye molecules within the nanocavities are excited and, thus, emit
electromagnetic radiation. The electromagnetic radiation is
enhanced by the nanocavities and the metallic substrate. It is then
detected by the detector. An aperture associated with the detector
may tailor the angle of a collection cone of radiation emitted by
the fluorescent dye molecules.
[0031] A biomolecular assay that incorporates teachings of the
invention may be used with known mass detection processes.
[0032] As an example, a reference analyte of known concentration
and analyte within a sample, which has an unknown concentration,
may be labeled with different marker molecules (e.g., fluorescent
molecules that emit different wavelengths, or colors, of light) and
their binding to capture molecules that have been immobilized
within the nanocavities compared to provide an indication of the
amount of analyte in the sample. The affinities of the reference
analyte and the sample analyte for the capture molecule, which may
be known, may be the same or different.
[0033] Of course, systems and techniques that employ
chemiluminescence, photoluminescence, electroluminescence, and
other types (i.e., no fluorescent) of marker molecules (e.g.,
metallic markers, such as the gold markers used in Raman scattering
techniques, etc.) are also within the scope of the invention.
[0034] Other features and advantages of the invention will become
apparent to those of ordinary skill in the art though consideration
of the ensuing description, the accompanying figures, and the
appended claims.
BRIEF DESCRIPTION OF DRAWINGS
[0035] FIG. 1 schematically depicts (in plan and cross section
views) examples of periodic metallic nanostructure architectures,
including: (a) a periodic array of nanocavities; (b) a "bullseye"
structure of a single nanocavity surrounded by an annular,
corrugated grating; and (c) a periodic array of nanoparticles.
[0036] FIG. 2 schematically depicts: (a) a plan view of a random
nanocavity array; (b) a plan view of a periodic nanocavity array;
and (c) a side view of the periodic nanocavity array of FIG.
2(b).
[0037] FIG. 3 illustrates a hybridization array, where each
hybridization zone includes an array of metallic nanocavities. Two
nanocavity embodiments are also illustrated: Type I, where the
probe molecules are selectively attached to the bottoms of the
nanocavities, and Type II, where the probe molecules are
selectively attached to the sidewalls of the nanocavities.
Passivation of the metal surfaces by depositing a thin layer of
SiO.sub.2 to cover the top metal surface is also illustrated for
Type II nanocavities. The illustrations are not to scale.
[0038] FIG. 4 depicts an example of microfluidic channels that may
be used in a real-time hybridization experiment.
[0039] FIG. 5 is a graph that illustrates real-time hybridization
between T3 in solution and anti-T3 immobilized within the
nanocavities.
[0040] FIG. 6 schematically depicts the geometry associated with a
two compartment model that simulates binding between capture
molecules and target molecules.
[0041] FIG. 7 is a model association/dissociation curve.
[0042] FIG. 8 illustrates the patterning of individual detection
zones of a 3.times.3 hybridization array for validation
studies.
[0043] FIG. 9 is a scanning electron microscopy (SEM) image of a
square lattice periodic nanoaperture array.
[0044] FIG. 10 is an SEM image of a metallic nano particle array
fabricated through e-beam lithography with a lift-off process.
DETAILED DESCRIPTION
[0045] The invention includes biosensors comprising metallic
nanocavities, thereby providing an apparatus, elements of an
apparatus and methods of fabrication and using such an apparatus.
In the following description, reference is made to the accompanying
drawings, which show, by way of illustration, several embodiments
of the invention.
[0046] FIGS. 2 (a) and (b) illustrate a randomly arranged array 20
and a periodic arranged array 30 of nanocavities, 22 and 32,
respectively. FIG. 2 (c) illustrates a cross section 28 of FIG.
2(b) shown formed on a metallic layer 34 (indicated by solid black
rectangles) on a surface 36 of a quartz substrate 38. FIG. 2 (c)
also shows optical paths 40, 41 and 42, and geometrical parameters
d and .LAMBDA. of the nanocavities, where d is the nanocavity
diameter and .LAMBDA. is the spacing of adjacent nanocavities. As
illustrated in FIG. 2 (c), when incident light 40 is directed
toward the nanocavities 32 from a location 48 over the metallic
layer 34, enhanced fluorescence output of fluorescent molecules
within the nanocavities 32 may be detected at a location 44
adjacent to a back side 46 of the substrate 38. For example,
fluorescence output of fluorescent molecules within nanocavities
may be read out using standard fluorescence scanners (i.e., normal
incidence excitation, normal incidence fluorescence collection)
from the backside 46 of the substrate. However, fluorescence output
may also be detected in a reflection mode rather than a
transmission mode as described herein.
[0047] Target or capture molecules of an assay may reside on the
sidewalls, the bottom surfaces, or both the sidewalls and the
bottom surfaces of the nanocavities. Two nanocavity embodiments are
illustrated in FIG. 3: Type I (as shown in FIG. 3 (c)), where
capture molecules 54 (e.g., probe oligonucleotides) are selectively
attached to the bottoms 58 of the nanocavities, and Type II (as
shown in FIG. 3 (d)), where the probes 54 are selectively attached
to the sidewalls 60 of the nanocavities. As shown in FIG. 3(a), a
hybridization array 130 comprises one or more sub-arrays or
periodic array 30 of metallic nanocavities within which capture, or
probe, oligonucleotides 54 are tethered directly to the
nanocavities 32. One molecular species 62 (i.e., the target
oligonucleotides or analyte, which is fluorescently labeled)
specifically bind to the capture oligonucleotides 54 through
hybridization. An optically-transduced, real-time signal in
proportion to the number of bound target oligonucleotides are
detected from the side of the sensor array opposite to the side on
which the sample solution is introduced, thereby providing
isolation from unbound species, which may represent a significant
fraction of the detected signal in a washless assay. In this
nanocavity array architecture, fluorescence from unbound species
98, as shown in FIG. 1 (a), do not penetrate the opaque metal
except at the nanocavities. By measuring the hybridization kinetics
in real-time, non-specific binding may be factored out as well.
Study of fluorescence enhancements using the two embodiments also
allows for independent and direct measurement of enhancement
factors for molecules located at the bottom surfaces (Type I) and
at the sidewalls (Type II).
[0048] However, fluorophores placed in close proximity to the
exposed metal surface of a periodic nanocavity structure may couple
to surface plasmons and emit from the back side of the substrate at
specific angles. Isolation from this fluorescence signal may be
obtained by either narrowing the collection angle to exclude this
contribution or by passivating the surfaces of the metallic
film.
[0049] To prevent capture molecules from binding to undesired
locations of the nanocavities, the surfaces of the metallic film or
the surface of the substrate may be passivated. For example, for
Type I nanocavities (FIG. 3 (c)), a surfaces 64 of the metallic
film 34 may be passivated with polyethylene glycol (PEG)-thiol.
Thus, the probe oligonucleotides (i.e., capture molecules) are
selectively attached to the bottoms of the nanocavities 32. On the
other hand, for Type II nanocavities (FIG. 3 (d)), the exposed
surface 66 of the substrate 38 may be passivated (e.g., with PEG
silane) to prevent capture molecules 54 from adhering to the
surface 66 of the substrate 38 and, rather, causing the capture
molecules 54 to be selectively attached to the sidewalls 60 of the
nanocavities. Alternatively, as shown in FIG. 3 (e), to facilitate
coupling of the capture molecules 54 to the sidewalls 60 of the
nanocavities, a thin (.about.20 nm) layer 68 of SiO.sub.2 is
deposited to cover the top metal surface 64. With this structure,
the only exposed substrate surface is the inside walls of the
nanocavities, to which selective derivatization of capture
molecules is performed. A layer (e.g., .about.5 nm) of Al or Cr,
which is not shown in FIG. 3 (e), may be used to promote adhesion
of the SiO.sub.2 layer.
[0050] Surfaces of nanocavity substrates may also be modified for
covalent or noncovalent immobilization of capture molecules. For
example, SiO.sub.2 and Si.sub.3N.sub.4 surfaces of nanocavity
substrates may be modified with a reactive species, e.g.,
epoxysilane. After surface modification with a reactive species,
coating of the capture molecules may be performed. For example,
amine-modified nucleic acid probes may be spotted on
epoxysilane-modified surfaces, and reactions of the amine groups
and the epoxy groups cause the amine-modified nucleic acid probes
covalently linked to the surface of the substrate.
[0051] Not wishing to be bound by theory, the surface plasmon modes
at each of the metal interfaces in general have different
propagation constants, such that usually only one of these modes
(the one at the metal-air interface) plays a role in enhanced
transmission. However, the modes at the two interfaces may be
coupled together. Fluorescence excitation enhancement may be
improved by surface plasmon cross-coupling. Surface plasmon
cross-coupling may be achieved by controlling the refractive index
at the substrate by depositing a thin film of silicon oxynitride
(SiON) between the metallic film and quartz substrate. FIG. 1 (a)
shows a SiON layer 96 deposited on the metallic surface 34. For
example, with SiON deposited by plasma-enhanced chemical vapor
deposition, one can have continuous control over refractive index
in the range 1.46 to 2.05 by adjusting the relative ratio of oxygen
and nitrogen atoms. For Type II nanocavities as shown in FIG. 3
(d), the effects of the finite thickness of SiO.sub.2 on the top
surface should also be taken into account in the propagation
constant of the surface plasmon wave at that interface.
[0052] Nanocavity geometry also has a strong influence on the
emission properties of the fluors within a nanocavity, most likely
based upon the nanocavity aspect ratio h/d, where h is the height
or depth of the nanocavity. Geometric properties, such as spacing A
and the incident angle of the incident light, may also be optimized
to maximize surface plasmon coupling.
[0053] A sample may be delivered to the array of hybridization
zones through a flow cell or a microfluidic channel. As shown in
FIG. 4, a nanocavity array 300 is placed within a microfluidic
channel 160. Sample flow is produced by a syringe pump with
suitable a flow rate, e.g., of 0.3 mL/min. In order to avoid
binding of target to the inside surface of the channels, the
interior surface area of the channels may be passivated, e.g., with
bovine serum albumin (BSA).
[0054] Sub-arrays of metallic nanostructures may provide highly
sensitive, real-time detection. Three periodic metallic
nanostructures are shown schematically in FIG. 1. FIG. 1 (a)
through (c) illustrate a periodic array 30 of nanocavities, a
so-called "bullseye" structure 180 and a modified periodic array
190 of nanoparticles. The structure 180 being of single nanocavity
100 surrounded by an annular, corrugated grating 102. Cross
sections corresponding to the respective nanostructures, showing
geometrical parameters and optical paths, are also respectively
shown in FIG. 1.
[0055] In the first two architectures (FIGS. 1 (a) and (b)), the
nanocavities 32 serve as the binding and detection sites of a
target entity, and in the third architecture (FIG. 1 (c)), the
nanoparticles 72 serve as the binding and detection sites. Enhanced
fluorescence transduction occurs through the optical excitation of
molecules preferentially bound within metallic nanocavities or
attached to metallic nanoparticles.
[0056] Not wishing to be bound by theory, enhanced fluorescence of
the three nanostructures of FIG. 1 occurs through two
mechanisms--increased fluor excitation through the coupling of
incident light with surface Plasmon modes (where the coupling
occurs through the diffraction grating produced by the periodic
patterning of the metal in the nanocavity architectures and by
direct excitation of the local plasmon resonance of the
nanoparticles) and interaction of the fluors with the metallic
nanostructure (either by confinement within a metallic nanocavity
or by proximity to a metallic nanoparticle) resulting in increased
fluorescence yield. These enhancement mechanisms may produce more
than an order of magnitude increase in fluorescence as compared to
direct excitation on a transparent substrate.
[0057] Individual nanocavities have localized surface plasmon
resonances that can undergo spectral shift upon change in the
dielectric properties of the enclosed environment (i.e., target
binding); when placed in specific spatial arrangements, collective
oscillations can produce a narrower resonance. A measurable change
in the position of the resonance peak can be obtained upon
molecular binding within nanocavities. The spectral position of the
resonance peak changes based upon the dielectric environment of the
nanocavities. This label-free microarray detection target molecules
may be achieved by using a conventional two-color scanner to
measure the resonance shift in reflection upon molecular
binding.
[0058] Nanocavity arrays significantly improve the signal to
background ratio. Accordingly, nanocavity arrays can find great
uses in many clinical, environmental, and industrial applications,
thus offer fast, sensitive, real-time detection of target
entities.
[0059] In typical real-time hybridization arrays (which are
generally based upon evanescent wave excitation at a planar
surface), excitation light covers the entire sensing zone area (as
well as the entire array of zones), across which the probe
molecules are spread uniformly. When bound target surface
concentration is low (as it can be well before the end point of the
hybridization kinetic reaction occurs or even at the end point for
low concentration species), much of the excitation light is wasted,
or, even worse, induces background signal from solvent or unbound
species lying within the evanescent field. Without wishing to be
bound by theory, real-time hybridization arrays, where the sensing
zones are based upon sub-arrays of metallic nanostructures, solve
this problem by two mechanisms: via selective surface chemistry,
target molecules only bind to the nanostructures, about which
excitation and emission enhancement of fluorescence occurs (by a
total factor M.sub.tot); and the fill fraction .eta. over which
these enhancements occur is less than 100%, thereby providing
isolation from sources of background fluorescence. These factors
are nearly identical to the advantages that confocal and near-field
techniques offer in single-molecule fluorescence microscopy (W. E.
Moerner and D. P. Fromm, "Methods of single-molecule fluorescence
spectroscopy and microscopy," Review of Scientific Instruments 74,
3597-3619 (2003)), except that the nanoscopic detection sites are
fixed (and arranged in sub-arrays within a detection zone) and the
molecules of interest diffuse to the detection sites where they
bind.
[0060] Arrays of metallic nanocavities may be used in clinical
diagnostics, where a particular area of need is to improve the
ability to rapidly determine the identity of pathogens responsible
for a given infection. With respect to identification, there are
clinical scenarios where similar signs and symptoms can result from
infection by any of a multitude of pathogens, including viruses,
bacteria and, in some instances, fungi. A common clinical example
is pneumonia, where it would be desirable to test for up to ten
different viruses and bacteria (e.g., Streptococcus pneumoniae,
Influenza, etc.).
[0061] Another clinical example where multiple organisms can be
causative is sepsis wherein a pathogen(s) is proliferating in the
bloodstream. Currently, the mainstay technology of pathogen
identification remains culture of the organism followed by
identification by biochemical means (for bacteria) or staining with
antibodies (for viruses or bacteria). Culture and identification of
bacteria typically requires two or more days and virus culture can
take one to several weeks. Significant advances with regard to
reducing identification times have been achieved by nucleic acid
amplification methods, notably the polymerase chain reaction (PCR).
For many viruses and some bacteria, identification times have been
reduced to less than one day. However, PCR methods in their current
format remain limited in terms of their ability to simultaneously
detect more than 6-8 pathogens. This limitation is due to the
technical challenges associated with multiplexing PCR and a limited
number of sufficiently spectrally distinct detection fluors that
can be bound to oligonucleotide probes. In this context, there is
substantial interest in and effort directed towards exploiting
array based technologies wherein amplification technologies, such
as PCR, are used to multiplex amplify various signature genetic
regions from suspected pathogens followed by hybridization of the
amplification products to an array containing complementary
sequences. While technically attractive, a current bottleneck
remains the length of hybridization time required to achieve
sufficient signal above background, with most arrays requiring
hybridization times on the order of hours to overnight (Y. Y.
Belosludtsev, D. Boweman, R. Weil, N. Marthandan, R. Balog, K.
Luebke, J. Lawson, S. A. Johnston, C. R. Lyons, K. O'Brien, H. R.
Garner, and T. F. Powdrill, "Organism identification using a genome
sequence independent universal microarray probe set," Biotechniques
37, 654-660 (2004)).
[0062] Ideally, with infectious disease, physicians would like the
result of pathogen identification within 2 hours of sample
collection. There are three steps in molecular diagnostics: 1)
sample preparation, 2) PCR, and 3) detection. Sample preparation
takes roughly 15-30 minutes, while PCR can be performed in 30-60
minutes. In the case of infectious disease, this leaves roughly
30-75 minutes for detection, which is clearly not possible with
current hybridization arrays. Nanocavity arrays as hybridization
zones may provide fast and sensitive detection of multiple
pathogens.
[0063] Another example of an application for nanocavity arrays is
gene expression analysis (H. P. Saluz, J. Iqbal, G. V. Limmon, A.
Ruryk, and W. Zhihao, "Fundamentals of DNA-chip/array technology
for comparative gene-expression analysis," Current Science 83,
829-833 (2002)). With their increased sensitivity (owing to
real-time analysis and greatly improved signal to background
ratio), nanostructure hybridization arrays can facilitate a new
scientific avenue in expression analysis through the detection of
less abundantly expressed genes, which currently cannot be studied
by using endpoint or other real-time methods. This new capability
could ultimately lead to better understanding of regulatory
pathways, drug intervention, and the biological behavior of tumor
cells, for example. Another avenue lies in the ability to analyze
RNA populations directly (where even linear amplification steps can
either be avoided entirely or minimized) where end-labeling of RNA
would occur after a digestion step to cleave the native RNA to 20
to 100 bases; cleaving is performed to enhance the hybridization
kinetics via increased diffusion.
[0064] Low-cost nanofabrication techniques can be applied such that
the cost of producing the array itself may be no greater than the
cost of producing a compact disc. For real time array analysis,
low-cost and disposable microfluidic flow cells may be attached to
the array in a hybridization unit, which can be compactly
integrated with external optical excitation and parallel readout
using imaging optics and a low-noise charge-coupled device camera
or other suitable device. The coupling of excitation light is
straightforward (comparable to the methods used in SPR biosensors),
as a broad beam of light covers the entire array and the coupling
is relatively insensitive to angle and wavelength (as opposed to
standard SPR).
[0065] The invention is further described in the following
non-limiting examples, which are offered by way of illustration and
are not intended to limit the invention in any manner.
Examples
1. Biosensing Based Upon Molecular Confinement in Metallic
Nanocavity Arrays
[0066] Liu et al. (Y. Liu, J. Bishop, L. Williams, S. Blair, and J.
N. Herron, "Biosensing based upon molecular confinement in metallic
nanocavity arrays," Nanotechnology, vol. 15, pp. 1368-1374, 2004)
describes the basis for an affinity biosensor platform in which
enhanced fluorescence transduction occurs through the optical
excitation of molecules located within metallic nanocavities. The
contents of Liu et al. are hereby incorporated herein, in their
entireties, by this reference. The nanocavities of Liu et al. are
about 200 nm in diameter, are arranged in periodic or random
two-dimensional arrays, and are fabricated in 70 nm thick gold
films by e-beam lithography using negative e-beam resist. It has
been shown that both periodic and randomly placed metallic
nanocavities can be used to enhance the fluorescence output of
molecules within the cavities by about a factor of ten. In
addition, the platform provides isolation from fluorescence
produced by unbound species, making it suitable for real-time
detection, for example, real-time detection of 20-base
oligonucleotides in solution.
2. Enhanced Fluorescence Transduction Properties of Metallic
Nanocavity Arrays
[0067] Liu et al. (Y. Liu, F. Mandavi, and S. Blair "Enhanced
fluorescence transduction properties of metallic nanocavity
arrays," IEEE Journal of Selected Topics in Quantum Electronics 11,
778-784 (2005)) describes fluorescence enhancement of molecular
species bound within metallic nanocavities. The contents of Liu et
al. are hereby incorporated herein, in their entireties, by this
reference. The nanocavity structures of Liu et al. possess a number
of desirable properties for real-time microarrays, such as
localization of excitation light within the nanocavities, strong
isolation from fluorescence produced by unbound species, and an
apparent increase in fluorescence yield for bound species.
Experimental measurements show nearly a factor of two increase in
excitation intensity within the nanocavities, and factor of six
increase in yield. An electromagnetic model of a dipole within a
nanocavity shows an increase in radiative output consistent with
estimated yield, and also verifies the strong fluorescence
isolation from species lying outside the nanocavity.
3. Biosensing Based Upon Molecular Confinement in an Array of
Metallic Nanocavities
[0068] The following study is designed to optimize and validate a
hybridization array platform based upon sub-arrays of metallic
nanocavities. These nanocavity arrays are conducive to real-time
measurement of hybridization kinetics, are scalable to large
hybridization array formats, and possess significantly improved
molecular sensitivities to enable rapid screenings in a clinical
setting.
[0069] To determine molecular sensitivity in a real-time assay,
derivatization of the nanocavities either occurs at the bottom
(quartz) surface or at the gold sidewall to avoid the binding of
species in solution to the top surface. Therefore, two nanocavity
array embodiments are studied for selective derivatization of
either the exposed quartz surface or the nanocavity sidewall. The
first embodiment (Type I) is shown schematically in FIG. 3 (c).
These samples are passivated with mPEG-thiol. The second embodiment
(Type II) is shown in FIG. 3 (d) and consists of a thin (.about.20
nm) overcoat of SiO.sub.2. A .about.5 nm layer of Al or Cr is used
to promote adhesion of the SiO.sub.2. With this structure, the only
exposed gold surface is the inside walls of the nanocavities, to
which selective derivatization is performed.
[0070] Previous studies identified two fluorescence enhancement
effects associated with nanocavity arrays--yield enhancement and
surface plasmon excitation enhancement. These enhancements are
studies in more detail using the two embodiments that allow for
independent and direct measurement of enhancement factors--an
embodiment with molecules located at the bottom (Type I) and an
embodiment with molecules located on the sidewall (Type II). The
enhancement factors--with additional denotation M.sup.bottom and
M.sup.side for the Type I and II embodiments--are calculated based
upon the respective surface areas--A.sup.bottom=.pi.d2/4 and
A.sup.side=2.pi.dh--where d and h are the nanocavity diameter and
height, respectively. When h>d/2, the surface area of the
sidewall is greater than the surface area of the bottom. The
enhancement factors associated with cavity-enhanced fluorescence in
random arrays, which result in increased fluorescence yield given
by M.sup.bottom.sub.cav and M.sup.side.sub.cav, are determined. The
surface plasmon excitation enhancement of fluorescence in periodic
arrays given by M.sup.bottom.sub.SP and M.sup.side.sub.SP are also
determined.
[0071] Individual detection zones, which are 75 .mu.m.times.75
.mu.m in size, are fabricated to characterize nanocavity
enhancement and optimize surface plasmon excitation enhancement.
These zones are arranged in a 3.times.3 array for the studies of
molecular sensitivity in a real-time assay. E-beam lithography
other suitable techniques may be used to fabricate individual
detection zones. Another fabrication technique that may be used is
nanoimprint lithography (S. Y. Chou, P. R. Krauss, and P. J.
Renstrom, "Nanoimprint lithography," Journal of Vacuum Science
& Technology B 14, 4129-4133 (2004)), in which arbitrary
patterns can be written using e-beam or focused ion beam
lithography on a master, then the master used to stamp out multiple
copies (in an analogy to the process used for CD's and DVD's, which
are basically a thin metal layer surrounded by dielectric
layers).
3.1 Characterization of Nanocavity Enhancement
[0072] In order to characterize the enhancement in fluorescence
yield produced by molecular confinement in a metallic nanocavity,
and verify that the majority of the cavity enhancement results from
an increase in fluorescence collection efficiency, detailed
characterizations of derivatized nanocavities are undertaken.
[0073] Development and Characterization of Nanocavity
Derivatization Procedures.
[0074] Two different passivation procedures are employed for
selective derivatization of the nanocavities, for which labeled
avidin monolayers are formed. The passivation of the gold surfaces
using mPEG-thiol follows the reference (K. L. Prime and G. M.
Whitesides, "Adsorption of proteins onto surfaces containing
end-attached oligo(ethylene oxide): a model system using
self-assembled monolayers," Journal of the American Chemical
Society 115, 10714-10721 (1993)) for the Type I embodiment, such
that monolayer formation occurs only on the bottom of the
nanocavities. A similar procedure is developed for the Type II
embodiment (i.e., with the SiO.sub.2 overcoat) to passivate the
dielectric surfaces, thus allowing monolayer formation only on the
exposed gold sidewalls. For Type II, dielectric surface passivation
is performed using mPEG-silane. Introduction of the labeled avidin
solution then allows monolayer formation on the exposed gold
surfaces. An alternate method of selectively derivatizing the
side-walls may also be employed, which follows a procedure
developed with biotinylated thiol (D. M. Disley, D. C. Cullen, H.
X. You, and C. R. Lowe, "Covalent coupling of immunoglobulin G to
self assembled monolayers as a method for immobilizing the
interfacial-recognition layer of a surface Plasmon resonance
immunosensor," Biosensors and Bioelectronics 13, 1213-1225 (1998)),
which binds strongly to gold surfaces. Cy-5 labeled neutravidin is
then be used for the monolayer, where the neutravidin does not
undergo a charge-charge interaction with the dielectric surfaces,
but interacts strongly with the biotin layer via two of its biotin
binding sites. This procedure is tested with two reference
surfaces, a quartz surface which, after derivatization, should
exhibit no measurable fluorescence, and a gold surface which should
exhibit strong fluorescence. During the initial avidin labeling
step, there is less than 1 Cy-5 molecule per labeled avidin, on
average. This avoids any effects of energy transfer among a group
of Cy-5 molecules clustered on a single avidin molecule, which
would complicate the interpretation of cavity enhancement of
fluorescence yield. The labeled avidin solution is then diluted
using pure 1 .mu.M avidin to the final concentration.
[0075] Previous studies suggest that the gold passivation procedure
performed on a quartz reference surface results in a reduction in
avidin surface concentration as compared to a quartz control
surface without the passivation step. The reference samples are
further characterized in terms of total fluorescence emission as
well as ellipsometry studies to compare extinction at 280 nm (650
nm), which is directly proportional to the avidin (Cy-5) surface
concentration. When the surface concentrations differ between
reference and control, it is likely that the reference surface
contains residual mPEG-thiol (on a quartz reference surface) or
mPEG-silane (on a gold reference surface), which can be detected
either with ellipsometry or XPS measurements. It may be that
reduced surface concentration on the desired surface is an
unavoidable consequence of the passivation process.
[0076] Because these passivation procedures require multiple steps
involving mass transport into and out of nanoscale volumes, it is
important that the final derivatized surfaces be fully
characterized. One motivating factor behind the characterization
studies is the determination of bound avidin surface concentration
within the nanocavities, which cannot be performed using the
standard XPS or ellipsometry techniques. Characterization is
performed with two methods, initially using low aspect ratio
h/d.about.0.1 such that capillary effects play a negligible role in
mass transport. After each successful characterization step, the
aspect ratio is increased, with the goal of successfully
derivatizing nanocavities with h/d>1. The first characterization
method employs radiolabeled avidin (with .sup.125I) for the
monolayer. The labeling procedure uses Enzymobeads (Bio-Rad Labs).
Before labeling, sodium azide is removed from the avidin solution
using Sephadex G-25 (Pharmacia) as sodium azide is a potent
inhibitor of lactoperoxidase. The following reagents is added to an
Enzymobead reaction vial: (1) 50 .mu.L of 0.2 M phosphate buffer
(pH 7.2); (2) 500 .mu.L avidin solution; (3) 1 mCi Na.sup.125I; (4)
25 .mu.L of 2% glucose. This mixture is allowed to react for 40 min
at room temperature. Unreacted Na.sup.125I is removed by gel
filtration (Sephadex G-25). Radiolabeling efficiency (RE) is
determined by precipitating the labeled protein with 20%
trichloroacetic acid (TCA) in presence of BSA as a carrier, and
calculated using the following equation
RE=(CPM.sub.solution-CPM.sub.super)/CPM.sub.solution (1)
[0077] where CPM.sub.solution is the number of counts in 5 .mu.L of
the labeled protein solution before TCA precipitation and
CPM.sub.super is the number of counts in 5 .mu.L supernatant.
Samples are counted using a Beckman Model 170M liquid scintillation
counter. The specific activity of the iodinated protein is then
calculated with the additional information of protein concentration
determined from a UV-visible spectrophotometer at 278 nm. The
radiolabeled avidin monolayer is formed using the same procedures
as described previously. Radioassay is then used to determine the
surface concentration of the immobilized avidin. Samples are
counted for 1 min and the surface concentration calculated from
.GAMMA.=(CPM/SA)/A.sub.surf (2)
[0078] where CPM is counts per minute, SA is the specific activity,
and A.sub.surf is the effective surface area, which is just the
total area of the nanocavities. The surface concentrations from
nanocavity array samples are compared to reference samples that
have undergone the same surface modification steps. The second
characterization method involves using avidin labeled with metallic
nanoparticles which are roughly 2 nm in size. Conjugation with
metallic nanoparticles provides contrast under scanning electron
microscope imaging, such that the location of the avidin monolayer
and uniformity within the nanocavities can be directly determined
and compared to the reference sample. Gold nanoparticle-avidin
conjugates are available commercially. A high-resolution (.about.2
nm) field-emission SEM is employed for these measurements.
[0079] In situations where the surface concentration within the
nanocavities is not as high as that for the reference samples
(which may occur as h/d.fwdarw.1), the parameters of the
derivatization procedures are adjusted. For example, one problem
that may occur is that the wash step after passivation may not
completely clear the volume of the nanocavities, which could cause
interference with avidin monolayer formation. Possible ways to
solve this would be to lengthen the duration of the wash step
and/or perform the wash step at elevated temperature. Another issue
that may arise is that of air bubbles becoming trapped within some
of the nanocavities, preventing surface modification. If this
occurs, the samples in buffer solution in a side-arm flask are
degassed to promote wetting of the nanocavities before
derivatization.
[0080] Study of Reproducibility.
[0081] A series of measurements are made to determine the
reproducibility of the enhancement factor across multiple samples.
Measurements are performed on 20 different samples of each
embodiment (Type I and Type II), five periodic array samples and
five random array samples fabricated using the etching procedure,
and five of each pattern fabricated using the lift-off procedure.
The nanocavity size is 150 nm diameter with 1 .mu.m spacing, and
the fluorescence outputs are measured relative to coated quartz
substrates. The standard deviations from these measurements
.sigma.ref reflect variations in pattern fabrication, monolayer
coating, and optical alignment and detection. When combined with
the standard deviations of subsequent measurements described below
(.sigma.meas), it can be determined whether or not a change in a
measured quantity such as the enhancement factor can be considered
statistically significant. Using the nanofabrication process based
upon metal etching, we obtained .sigma.ref.ltoreq.7% and 11% for
d=200 nm for periodic and random arrays, respectively. The
deviation is greater for d=150 nm, but with the new lift-off
process, it is expected to reduce .sigma.ref over the etching
process for the same d. For subsequent studies, a nanofabrication
process is chosen based upon the one that produces the smallest
variation.
[0082] Fluorescence Yield Enhancement by a Nanocavity.
[0083] The following procedures are designed for determining the
origin of the fluorescence yield enhancement by molecular
confinement within a metallic nanocavity by using random
arrangements of nanocavities where surface plasmon excitation
enhancement is suppressed. The net increase in fluorescence yield
is given by the factor M.sub.cav=M.sub.radM.sub.coll where
M.sub.cav is the fluorescence enhancement factor from the random
arrays, M.sub.rad is due to an increase in the radiative rate, and
M.sub.coll results from an increase in fluorescence collection
efficiency. Previous studies using random nanocavity arrangements
indicated that M.sub.cav ranged from about 10 for 120 nm diameter
cavities to about 7 for 200 nm diameter cavities, with a predicted
peak for 150 nm diameter. This observation suggests a strong
influence of the nanocavity geometry on the emission properties of
the fluors, most likely based upon the nanocavity aspect ratio h/d
where h is the height. This effect is studied experimentally by
using nanocavity diameters ranging from 50-250 nm in diameter and
comparing with results from simulation.
[0084] The total fluorescence enhancement factor due to the
nanocavity is calculated for both Type I and Type II embodiments by
measuring fluorescence output from random nanocavity arrangements
relative to reference samples to give M.sub.cav. These measurement
rely on direct excitation of fluors within the nanocavities by
incident light. Since the collection efficiency factor M.sub.coll
is difficult to measure directly, it is instead indirectly
determined from the measurements of M.sub.cav and M.sub.rad. In
order to estimate the fluorescence yield enhancement due to
modification of the radiative rate, direct fluorescence lifetime
measurements is performed with a time-correlated single photon
counting system, where instead of imaging a single nanocavity at a
time, a roughly 16 .mu.m spot size is excited and imaged. This
makes the experiments easier to perform and is one reason for using
the random nanocavity arrays. With this method the lifetime can be
measured for molecules on the bottom (Type I embodiment, giving
M.sup.bottom.sub.rad) and on the side-walls (Type II embodiment,
giving M.sup.side.sub.rad). For fluors on the sidewall, the fluor
to metal separation is the thickness of one avidin molecule
(approximately 5 nm), while for fluors on the bottom, the average
separation is d/6>15 nm. Experiments with nanoparticles (A.
Wokaun, H.-P. Lutz, A. P. King, U. P. Wild, and R. R. Ernst,
"Energy transfer in surface enhanced luminescence," Journal of
Chemical Physics 79, 509-514 (1983); J. Malicka, I. Gryczynski, Z.
Gryczynski, and J. R. Lakowicz "Effects of fluorophore-to-silver
distance on the emission of cyanine-dye-labeled oligonucleotides,"
Analytical Biochemistry 315, 57-66 (2003)) suggest maximum
fluorescence enhancement due to increase in radiative rate for
fluor to metal separation of about 9 nm. It is anticipated that the
net cavity enhancement is maximized for aspect ratio h/d
100/150=0.67, due mainly to increase in collection efficiency.
These measurements can identify the largest enhancement factor that
can be obtained given practical limitations in nanofabrication and
derivatization. For each embodiment, rigorous electromagnetic
simulation (using FEMLAB, a commercial finite element method
differential equation solver) of the radiative properties of a
molecular dipole (using all polarization orientations) is performed
at various positions within a metallic nanocavity in order to
verify the experimentally derived M.sub.coll. For example, for the
Type II embodiment, dipoles are placed along the sidewall of the
nanocavity, spaced 5 nm from the metal surface. The total radiative
output from the nanocavity is compared to the output produced by
the same dipole on a quartz surface to estimate M.sub.coll. An
average radiative enhancement is then be calculated based upon the
.sub.Mcoll values produced for the three orthogonal dipole
orientations, and dipole positions distributed along the bottom of
the nanocavity (Type I) or along the sidewall (Type II).
[0085] The importance of these measurements is threefold: 1) to
identify the spatial region of the nanocavity (i.e., Type I or Type
II embodiment) where the greatest increase in yield due to cavity
enhancement occurs, 2) to determine the contributions to net yield
by radiative rate enhancement and collection efficiency
enhancement, and 3) to determine the maximum net yield given the
practical limitations in nanocavity aspect ratio, where h/d=0.67 is
likely optimal with >10. The net cavity enhancement for a given
fluor is independent of excitation intensity, and determines the
photobleaching limited transduction sensitivity enhancement over
detection performed on a quartz substrate, as done for end-point
detection methods. This part of the study determines the nanocavity
geometry (in terms of the values of diameter d and height h) that
is applied for subsequent studies.
3.2 Optimization of Surface Plasmon Excitation Enhancement
[0086] The following procedures are designed to optimize the
fluorescence excitation enhancement by surface plasmon coupling
M.sub.SP in periodic arrays using Type I and Type II embodiments.
Previous studies suggest that the surface-plasmon enhancement
factor is nearly uniform for the two embodiments, i.e.,
M.sup.bottom.sub.SP.about.M.sup.side.sub.SP.
[0087] The total fluorescence enhancement factor M.sub.tot is
calculated by the ratio of normalized fluorescence output from the
periodic array to the reference surface, while the surface plasmon
excitation enhancement factor M.sub.SP is given by the ratio of
fluorescence between the periodic and random array of the same
nanocavity diameter d and average spacing .LAMBDA.. From these
quantities, an apparent increase in fluorescence yield can be
determined through the ratio M.sub.cav=M.sub.tot/M.sub.SP, as
described herein earlier.
[0088] Previous studies indicate that the intensity enhancement
factor due to surface plasmon coupling MSP is about a factor of
two, but it is expected that with optimization of the geometrical
parameters, this factor may increase to 7 or more (H. J. Lezec and
T. Thio, "Diffracted evanescent wave model for enhanced and
suppressed optical transmission through subwavelength hole arrays,"
Optics Express 12, 3629-3651 (2004)). The origin of the excitation
enhancement within the nanocavities results from the fact that
under the condition of enhanced transmission (Y. Liu and S. Blair,
"Fluorescence enhancement from an array of sub-wavelength metal
apertures," Optics Letters 28, 507-509 (2003)) energy is
concentrated within the nanocavities. The periodicity of the
nanocavities not only supports coupling incident light from free
space into surface plasmon modes, but also modifies the propagation
properties of the surface plasmon (I. I. Smolyaninov, W. Ada, and
C. C. Davis, "Near-field optical microscopy of two-dimensional
photonic and plasmonics crystals," Physical Review B 59, 2454-2460
(1999)) through coherent scattering off the walls of the
nanocavities, which results in constructive interference within the
nanocavities. In these studies, the immobilized fluors act as local
probes to the optical intensity buildup within the nanocavities.
Surface roughness of the metallic nanocavity side-walls may
manifest in the measurements of surface-plasmon excitation
enhancement as the nanoscale roughness can serve as concentration
points for light intensity buildup via the "lightning-rod" effect
(A. V. Ermushev, B. V. Mchedlishvili, V. A. Oleinikov, and A. V.
Petukhov, "Surface enhancement of local optical fields and the
lightning-rod effect," Quantum Electronics 23, 435-440 (1993)). Any
manifestation should average out across a nanocavity as the scale
of the surface roughness is less than the size of the nanocavity.
This effect can be quantified indirectly by estimating the surface
roughness within the nanocavities for the Type I embodiment (the
Type II embodiment should be similar) and incorporating these
estimates into numerical models of light propagation through
nanocavity arrays. Numerical modeling with FEMLAB can be used to
aid in optimizing the nanocavity array geometrical factors for
excitation enhancement and for characterizing the effects of
side-wall roughness on the measured enhancement factors. Surface
roughness is estimated experimentally by cross-section analysis of
nanocavities that are strongly elliptical, such that the minor axis
is in the 50-250 nm range, but the major axis is many .mu.m's in
length to make dicing and polishing more reliable. A
high-resolution SEM can be used for cross-section inspection with a
resolution of about 2 nm.
[0089] Excitation Enhancement by Surface Plasmon Coupling.
[0090] The following procedures are designed to measure the
fluorescence enhancement by fluors on the nanocavity sidewall
M.sup.side.sub.SP and by fluors at the bottom of the nanocavity
M.sup.bottom.sub.SP to determine the relative excitation
efficiencies. For each embodiment, the fluorescence enhancement
relative to the reference sample is determined for random and
periodic arrays for different values of average nanocavity spacing
.LAMBDA., ranging from about 600 nm to about 1 .mu.m. These
measurements are performed as a function of incidence angle, where
the peak fluorescence corresponds to angles of peak transmission of
the incident light owing to surface-plasmon coupling.
[0091] Incidence angle is changed only along the x-axis, so that
the intersections of the coupling curves with the horizontal axis
correspond to the angles of peak transmission (and peak
fluorescence). These measurements result in a two-dimensional data
set of M.sub.SP for each embodiment versus .LAMBDA. and incidence
angle .theta., from which values of peak fluorescence can be
extracted. It can be predicted where maximal values may occur. In
general, fluorescence enhancement should increase with decreasing
.LAMBDA.. In addition, there are discrete values of .LAMBDA. for
which increased fluorescence enhancement should occur due to the
overlapping of two or more coupling orders. For example, comparing
the situations where .LAMBDA.=1 .mu.m and 678 nm, it is expected to
obtain greater enhancement for .LAMBDA.=678 nm at 27.degree. than
for .LAMBDA.=1 .mu.m at 25.degree.. The reason for this is that at
the smaller spacing, coupling at 27.degree. corresponds (by design)
to two overlapping diffraction orders, so that two surface plasmon
waves are excited, thereby increasing the intensity within each
nanocavity on average.
[0092] Optimization of Surface Plasmon Enhancement Using
Cross-Coupling.
[0093] The surface plasmon modes at each of the metal interfaces in
general have different propagation constants, such that usually
only one of these modes (the one at the metal-air interface) plays
a role in enhanced transmission. However, the modes at the two
interfaces can be coupled together (or cross-coupled (R. W.
Gruhlke, W. R. Holland, and D. G. Hall, "Surface-plasmon cross
coupling in molecular fluorescence near a corrugated thin metal
film," Physical Review Letters 56, 2838-2841 (1986); R. W. Gruhlke,
W. R. Holland, and D. G. Hall, "Optical emission from coupled
surface plasmons," Optics Letters 12, 364-366 (1987))) when the
momentum of the periodic lattice matches the differences in momenta
of the two modes:
K=2.pi./.LAMBDA.=|k.sub.sp,1-k.sub.sp,2| (3)
Under this condition, both interfaces play a role in enhanced
transmission, and it is predicted that fluorescence excitation
enhancement can be improved. For a given excitation wavelength
(such as 633 nm), there is only one value of .LAMBDA. for which
cross-coupling occurs, which is approximately 1150 nm for the first
embodiment. However, as the difference in the refractive indices of
the dielectrics at the two interfaces increases, the necessary
value of .LAMBDA. decreases. For .LAMBDA.=678 nm, the necessary
refractive index on the substrate side is 1.513. Surface plasmon
cross-coupling can be achieved by controlling the refractive index
at the substrate by depositing a thin film of silicon oxynitride
(SiON) between the gold and quartz substrate. With SiON deposited
by plasma-enhanced chemical vapor deposition, one can have
continuous control over refractive index in the range 1.46 to 2.05
by adjusting the relative ratio of oxygen and nitrogen atoms.
Similar designs are tested for the second embodiment, where the
effects of the finite thickness of SiO.sub.2 on the top surface
must be taken into account in the propagation constant of the
surface plasmon wave at that interface.
[0094] The importance of these optimizations of excitation
enhancement (in conjunction with the characterization of nanocavity
enhancement) is twofold: 1) to determine the embodiment (Type I or
Type II) that has the greatest overall fluorescence enhancement
(i.e., M.sub.tot=M.sub.SPM.sub.cav, where 60 or more is expected),
and 2) to determine the geometrical and refractive index properties
that maximize M.sub.SP. The optimal embodiment and geometrical
parameters are carried-forward to the studies of molecular
sensitivity in real-time assays.
[0095] So far, these studies are directly comparable to the
sensitivities obtained by end-point readout by scanning or imaging,
where for the same incident power upon each hybridization zone, a
hybridization zone comprising a nanocavity array offers enhanced
fluorescence by a factor of M.sub.tot>12. This means that
.about.1/M.sub.tot fewer bound molecules per zone can be detected,
implying that hybridization can be performed in roughly 1/M.sub.tot
the time. However, this is only part of the story as significant
benefits can be gained by going towards a real-time detection
approach that enables direct measurement of hybridization kinetics.
These benefits include quantitative determination of target
concentration in solution (which is very difficult with end-point
analysis), discrimination against non-specific binding and
heteroduplex formation, and short time to result. In order to
perform real-time detection, there must be strong isolation from
fluorescence produced by unbound species. As will be shown as
follows, metallic nanocavity arrays provide greater isolation (by
more than a factor of 10) than other surface-selective techniques,
which, combined with the fluorescence enhancements already
described, make this technique highly suited for DNA-based clinical
diagnostics.
3.3 Determination of Molecular Sensitivity in Real-Time Assay
[0096] To determine molecular sensitivity in a real-time assay,
real-time nucleic acid hybridization measurements are performed
with a 3.times.3 array of hybridization zones, to verify that the
metallic nanocavity arrays provide strong fluorescence isolation
from unbound species in proportion to 1/.eta. (which is an
important consideration in any washless assay) and to determine
assay time as a function of target concentration, even in situation
where non-specific binding may be an issue. Validation studies
relevant to clinical diagnostics are performed using multiple
target species and controls. A second experimental setup is built
using a low-noise cooled CCD camera in order to simultaneously
image the 3.times.3 array. The nanocavity array embodiment (i.e.,
Type I or Type II) and geometrical parameters that produce the
greatest fluorescence enhancements are used, as determined from
studies described hereinbefore. The hybridization zones are spaced
far enough apart from each other (about 1 mm) that manual spotting
can be performed using a flexible Micromachined gasket with open
wells to isolate one zone from another. The T3 polymerase promotor
site is used as a model system; T3 5'-(AATTAACCCTCACTAAAGGG)-3' and
complementary anti-T3 are commercially available, and can be
fluorescently labeled with Cy-5. A synthetic 60-mers is also
employed in the validation studies. Sample solution containing
fluorescently labeled target and non-target species is introduced
to the surface using a flow cell (Y. Liu, J. Bishop, L. Williams,
S. Blair, and J. N. Herron, "Biosensing based upon molecular
confinement in metallic nanocavity arrays," Nanotechnology 15,
1368-1374 (2004)) (see FIG. 4), which resides on the top surface of
the nanocavity samples.
[0097] Nanocavity Derivatization with Anti-T3 Probe.
[0098] The following procedures are designed to characterize the
immobilization of capture oligonucleotides (anti-T3 for these
studies) within the nanocavities. Formation of the avidin monolayer
is followed by a solution of 0.15 .mu.M 5'-biotinylated anti-T3
which self-assembles on top of the avidin-coated surface (J. N.
Herron, S. zumBrunnen, J.-X. Wang, X.-L. Gao, H.-K. Wang, A. H.
Terry, and D. A. Christensen, "Planar waveguide biosensors for
nucleic acid hybridization reactions," Proceedings SPIE 3913,
177-184 (2000)). Derivatization procedures are characterized using
radio-labeled anti-T3 to determine probe surface concentration and
optimize the procedure. For reproducibility purposes, these
procedures are implemented identically in all 9 zones of the
3.times.3 array.
[0099] Radiolabeled oligonucleotides are prepared by end labeling
with (.sup.32P)phosphate. For determining the surface concentration
of immobilized capture oligo (i.e., anti-T3), 5'-biotinylated
oligos are labeled with (.alpha.-.sup.32P)ATP using terminal
transferase. This enzyme adds (.sup.32P)AMP to the 3' end of the
oligo. A commercial 3' end labeling kit (Perkin Elmer) is used to
perform the reaction. The extra adenosine group is not expected to
interfere with binding of the labeled oligo to the immobilized
avidin monolayer. Radiolabeling efficiency is determined using a
similar procedure as described before with equation (1). The oligo
concentration is determined using a UV-vis spectrophotometer at 260
nm. After self-assembly of the radiolabeled anti-T3 onto the avidin
monolayer, the probe surface concentration is determined according
to equation (2) using the radioisotope detector. The surface
concentration within the nanocavity array is compared to that
obtained for a planar reference sample. The derivatization
procedure for the nanocavities may need to be adjusted as a result
of this comparison; for example, if the nanocavity surface
concentration is lower, then it is necessary to increase the
concentration of anti-T3 in solution from 0.15 .mu.M before the
self-assembly step. Before the real-time hybridization experiments
are performed, a calibration between bound surface concentration
and fluorescence intensity is performed. Using radiolabeling one
can know the bound probe concentration. One can then perform the
same surface modification procedures with Cy-5 3' end-labeled
anti-T3 (with labeling ratio determined by UV-vis absorption) to
allow direct relation between measured fluorescence intensity and
bound concentration. This relationship can be used in conjunction
with the two-compartment model to determine the detection limits in
terms of the number of bound target molecules and to optimize the
probe concentration.
[0100] Determination of Signal to Background Ratio.
[0101] The following procedures are designed to verify fluorescence
isolation from unbound species and to determine the detection
sensitivity taking into account non-specific binding. Because
detectable fluorescence can only be produced from within a
nanocavity, random variation in fluorescence from non-target
molecules only occurs when those molecules randomly diffuse into
and out of the nanocavity (although some fraction may produce a
signal due to non-specific binding). The nanocavity surface area
represents a fraction .eta. of the total zone area
(.eta..about.2-10%), so that the background signal from unbound
species should be less by a factor of approximately 1/.eta.
(.about.10-50) than in other washless, surface selective
fluorescence sensors such as a planar waveguide or fluorescence-SPR
where the sensing surface represents 100% of the zone area. Again,
these studies are performed with the 3.times.3 array where all
zones are derivatized with anti-T3 probe.
[0102] Because the transduction area in the nanocavity
architectures is so small, diffusion of the target molecules into
the sensing regions is slightly slower than if the transduction
area were 100% of the sensing area. The first step is then to study
hybridization kinetics of the labeled target as a function of
target concentration in solution, as compared to a planar
waveguide. Target oligos (T3), labeled at the 5' end with Cy-5 dye
are prepared in solution with a concentration C.sub.n, where n is
the trial number. Typical Molar concentrations range from 10.sup.-8
to 10.sup.-12. When introduced into the flow cell, T3 hybridizes to
probe oligos on the capture monolayer and form duplex DNA. The
hybridization kinetic curve 74 is measured for each C.sub.n through
the time dependence of the fluorescence excited by light intensity
within each nanocavity (as shown in FIG. 5). By comparing the
kinetic curves between the two nanocavity architectures and the
waveguide, with greatly different fill fractions, the increase in
diffusion time can be estimated via the parameter k.sub.M, as
defined subsequently. In addition, optimization of immobilized
probe concentration is performed by maximizing binding rate.
[0103] One can analyze the kinetic curve using the two-compartment
model (D. G. Myszka, X. He, M. Dembo, T. A. Morton, and B.
Goldstein, "Extending the range of rate constants available from
BIACORE: interpreting mass transport-influenced binding data,"
Biophysical Journal 75,583-594 (1998)):
dC(t)/dt=1/h.sub.i{-k.sub.aC(t)(R.sub.T-B(t))+k.sub.dB(t)+k.sub.M(C.sub.-
T-C(t))} (4)
dB(t)/dt=k.sub.aC(t)(R.sub.T-B(t))-k.sub.dB(t) (5)
where h.sub.i is the height of the lower compartment where
significant target depletion can occur, k.sub.a is the association
rate, k.sub.d is the dissociation rate (which typically can be
ignored for specific binding at room temperature), k.sub.M accounts
for mass transport between the upper and lower compartments, C(t)
is the target concentration in the lower compartment, R.sub.T is
the probe concentration, and C.sub.T is the target concentration in
the upper compartment (which is assumed constant due to injection
from the flow cell). These parameters are illustrated in FIG. 6
showing nanocavities 432 having capture molecules 454 for
identifying species 462. The purpose for using the two-compartment
model is that, through the fitting constant k.sub.M, the effect of
mass transport to the sparse array of detection sites can be
determined and compared to a planar waveguide sensing modality in
which the fill fraction is 100%. In order to differentiate the
effects of non-specific binding, the two-compartment model is
modified to describe the binding of two species to the surface with
association constants k.sub.a1 and k.sub.a2. In this case, two
bound concentrations B.sub.1(t) and B.sub.2(t) are obtained, and
the density of available binding sites is given by
R.sub.T-B.sub.1(t)-B.sub.2(t). One may also have to incorporate the
effects of dissociation for the non-specific species. The ultimate
goal for clinical diagnostics is to use the two-compartment model
to analyze the kinetic curve at each hybridization zone to obtain
the unknown concentration C.sub.T of the desired target in
solution.
[0104] The next step is to perform kinetic measurements using a
second labeled sequence of the same length as T3/anti-T3 to
determine the kinetic coefficients in the two-compartment model for
non-specific binding (NSB). The sequences of these "background"
oligos are chosen so as not to specifically bind to either the
target or probe molecules. These background oligos diffuse into the
nanocavities and produce a random background signal, which could
mask the kinetic curve produced by bound species, and may also
non-specifically bind, which produces a signal that mimicks the
kinetics of the target species (but with a different rate and
equilibrium value (H. Dai, M. Meyer, S. Stepaniants, M. Ziman, and
R. Stooughton, "Use of hybridization kinetics for differentiating
specific from non-specific binding to oligonucleotide microarrays,"
Nucleic Acids Research 30, (2002))). NSB can occur under certain
experimental conditions (e.g., low ionic strength) between
non-target species and immobilized avidin which has a net positive
charge at neutral pH. These measurements are made as a function of
C.sub.n, where larger concentrations in the range 10.sup.-6 to
10.sup.-10 are used. Here, both association (i.e., binding) and
dissociation curves 76 and 78, respectively, are obtained, as
illustrated in FIG. 7. The dissociation curve 78 is generated by
flowing buffer solution through the flow cell, and allows
determination of k.sub.d for non-specific binding. From the
determination of the kinetic coefficients (k.sub.a and k.sub.d,
which should be relatively constant across concentration of
non-specific species), one can then use the modified dual-rate
two-compartment model to differentiate between specific and
non-specific binding, where the fitting parameters in the model is
C.sub.1 (initial target concentration) and C.sub.2 (initial
concentration of species that non-specifically bind). Herron et al.
(J. N. Herron, S. zumBrunnen, J.-X. Wang, X.-L. Gao, H.-K. Wang, A.
H. Terry, and D. A. Christensen, "Planar waveguide biosensors for
nucleic acid hybridization reactions," Proceedings SPIE 3913,
177-184 (2000)) showed that NSB can be virtually eliminated by
using a neutravidin monolayer instead of avidin. If it determines
that NSB is occurring to the point that NSB kinetics cannot be
discriminated from the target kinetics, then one should modify the
derivatization procedure to employ neutravidin on silanized
surfaces according to Herron et al. (for the Type I embodiment) or
biotinylated thiol (D. M. Disley, D. C. Cullen, H. X. You, and C.
R. Lowe, "Covalent coupling of immunoglobulin G to self assembled
monolayers as a method for immobilizing the interfacial-recognition
layer of a surface Plasmon resonance immunosensor," Biosensors and
Bioelectronics 13, 1213-1225 (1998)) (for the Type II embodiment),
followed by characterization procedures as described
previously.
[0105] Measurements are then performed using both the target and
background species. The background oligos diffuse into the
nanocavities and produce a random background signal. Three sets of
measurements are made to determine the detection sensitivity. The
first set is as a function of target concentration C.sub.n, where
the concentration of non-specific oligos is also C.sub.n. This
situation simulates the conditions for a two-zone sensor array. The
second set has target concentration C.sub.n, but non-specific
concentration 10 C.sub.n, thus simulating a 10-zone array. The
final set has non-specific concentration of 100 C.sub.n. From the
two-compartment model, one can then determine the minimum
detectable target concentration and the associated number of bound
target molecules. It is anticipated that the detection limit is a
factor of M.sub.tot/.eta. lower for the nanocavity architectures
than the waveguide (taking into account the normalization between
surface intensity of the evanescent field of the waveguide and the
intensity of direct excitation on the quartz reference surface from
which M.sub.tot was derived, where this normalization factor will
be of order 1). These measurements should demonstrate that the
nanocavity array has improved background isolation as compared to
the planar waveguide (as evidenced by greater ratio between the
hybridization signal and background noise). In addition, these
studies allow the determination of the hybridization time required
to obtain quantitative determination of target concentration, as a
function of that target concentration (i.e., lower C.sub.T will
require longer hybridization times). Because of the background
isolation and increased detection sensitivity, it is expected that
the necessary hybridization time is at least a factor 1/.eta.
shorter with the nanocavity array zones as compared to the
waveguide zones.
[0106] Validation Studies.
[0107] To validate the array system, the 3.times.3 array 200 (as
shown in FIG. 8) is used to screen across multiple synthetic
targets (five different 60-mer sequences with varying degrees of
overlap, with two sequences differing by only a single base) using
five hybridization zones 86, 88, 90, 92 and 94 that are derivatized
with complementary probes and the remaining four zones, 80, 80, 82,
and 84. The detection zones are placed far enough apart to enable
mutual isolation of the detection zones during immobilization of
probe molecules. The purpose of using 60-mers is that they are more
representative of the sequence length of PCR products in clinical
diagnostics setting. Because of the increased oligo length, the
hybridization kinetics is slower than in the previous studies due
to reduced diffusion. Two of four reference zones are derivatized
with Cy-5 labeled probes at different concentrations (to be used as
fluorescence intensity references) and the remaining two with
anti-T3 (where Cy-5 labeled T3 are introduced in high
concentrations in all experiments as a model source of background
and NSB), as illustrated in FIG. 8.
[0108] In these studies, the five target species in varying
concentrations (roughly 10 pM to 1 nM) with T3 at 100 nM
concentration are introduced as background. The goal is to study
discrimination across the five targets (in terms of obtaining CT
for each) in a complex environment where hybridization kinetics
varies strongly across hybridization zones due to differing target
concentration and where heteroduplex formation occurs. Again, in
addition to the quantitative determination of target
concentrations, important outcomes are the hybridization time
required to make that determination and comparison with a planar
waveguide.
[0109] These studies determine the ultimate performance of metallic
nanocavity arrays as detection zones of a real-time hybridization
array. Validation of this platform in situations relevant to
clinical diagnostics, in particular, to infectious disease where
assay time is critical, is performed. It is anticipated
quantitative determination of target concentrations can be made
with hybridization kinetics in less than 30 minutes, even in
complex environments where the effects of non-specific binding and
heteroduplex formation are important. It should also be noted that
further refinement of the techniques may be possible by using
electric-field enhanced hybridization (R. J. Heaton, A. W.
Peterson, and R. M. Georgiadis, "Electrostatic surface plasmon
resonance: direct electric field-induced hybridization and
denaturation in monolayer nucleic acid films and label-free
discrimination of base mismatches," Proceedings of the National
Academy of Sciences 98, 3701-3704 (2001); H.-J. Su, S. Surrey, S.
E. McKenzie, P. Fortina, and D. J. Graves, "Kinteics of
heterogeneous hybridization on indium tin oxide surfaces with and
without an applied potential," Electrophoresis 23, 1551-1557
(2002)) where it has been shown that hybridization kinetics can be
increased (through drift-induced oligo transport to the surface,
such that k.sub.M in the two-compartment model would increase in
value) in addition to improving binding specificity through field
reversal. The gold metallic layer upon which the nanocavity array
sensing zones are fabricated would lend itself naturally to such a
technique.
4. Quantitative Study and Comparison of Enhanced Molecular
Fluorescence by Periodic Metallic Nanostructure Architectures
[0110] The following study is designed to quantitatively compare
fluorescence enhancement mechanism and detection sensitivities in
complex environments for three periodic metallic nanostructure
architectures for real-time hybridization arrays. Each
nanostructure arrangement is conducive to real-time measurement of
hybridization kinetics, is scalable to a large array format, and
may possess sufficient molecular sensitivity to bypass the need for
molecular amplification steps required by other methodologies.
4.1 Fabrication of Metallic Nanostructure Arrays
[0111] To develop nanofabrication methods that are both expedient
and repeatable, fabrication of metallic nanostructure arrays are
based upon the technique of lift-off, which bypasses the need for a
hard mask and metal dry-etching. Dry etching of metals requires
very tight process control to produce repeatable results. Lift-off
therefore results in significantly increased device yield.
[0112] Even though expensive from a manufacturing standpoint,
e-beam lithography is the most stable, cost-effective, and flexible
nanolithography tool available in an academic environment. Other
techniques to fabricate metallic nanostructure arrays include
interference lithography (S. C. Lee and S. R. Brueck, "Nanoscale
two-dimensional patterning on Si(001) by large-area interferometric
lithography and anisotropic wet etching," Journal of Vacuum Science
& Technology B 22, 1949-1952 (2004)), which exposes patterns in
photoresist based upon the interference of two or more optical
plane waves; nanosphere lithography (W. A. Murray, S. Astilean, and
W. L. Barnes, "Transition from localized surface plasmon resonance
to extended surface plasmon-polariton as metallic nanoparticles
merge to form a periodic hole array," Physical Review B 69, 165407
(2004)), in which a self-assembled monolayer of small dielectric
spheres is used as a mask for deposition/etching steps; and
nanoimprint lithography (S. Y. Chou, P. R. Krauss, and P. J.
Renstrom "Nanoimprint lithography," Journal of Vacuum Science &
Technology B 14, 4129-4133 (2004)), in which arbitrary patterns can
be written using e-beam or focused ion beam lithography on a
master, then the master used to stamp out multiple copies (in an
analogy to the process used for CD's and DVD's, which are basically
a thin metal layer surrounded by dielectric layers).
[0113] Three array architecture, including Nanocavity array
architecture, Bullseye architecture, Nanoparticle array
architecture, are fabricated. For each architecture, individual
detection zones which are 75 .mu.m.times.75 .mu.m in size are
fabricated.
[0114] Nanocavity Array Architecture.
[0115] Nanocavity arrays are produced in 60 nm thick gold films
using electron beam lithography followed by a reactive ion etching
(RIE) step. The gold layer is deposited on clean quartz substrates
by RF-magnetron sputtering followed by a 300 nm silicon-nitride
film deposited by plasma enhanced chemical vapor deposition
(PECVD). Then a layer of PMMA is spun on for 45 seconds at 4000 rpm
and baked to remove the solvent. An identical second coating is
applied with an additional baking step thereafter to produce a PMMA
layer of total thickness 350 nm. The nanocavity array patterns are
drawn on this positive resist using e-beam and the exposed PMMA
developed in a solution of MIBK:IPA 1:3 for 70 seconds. The pattern
from PMMA is transferred to silicon-nitride using RIE with etching
gases of CF.sub.4 and O.sub.2, then continue to transfer the
pattern to gold with etching gases Cl.sub.2 and Ar.sub.2. FIG. 9
shows an SEM image 500 of one nanocavity array 30. The array 30 has
.LAMBDA.=1 .mu.m and d=150 nm. In addition, a .about.20 nm layer of
SiON (preceded by a thin adhesion layer) is deposited on top of the
.about.100 nm gold layer before lift-off. After lift-off, the only
exposed gold surfaces are the interior walls of the nanocavities.
This modified structure has two advantages. First, because the top
and bottom metal interfaces are more nearly symmetric in terms of
the effective propagation constants of the SPP modes at each
interface 3, there is stronger coupling between these SPP modes,
resulting in greater light transmission (L. Martin-Moreno, F. J.
Garcia-Vidal, H. J. Lezec, K. M. Pellerin, T. Thio, J. B. Pendry,
and T. W. Ebbesen, "Theory of extraordinary optical transmission
through subwavelength hole arrays," Physical Review Letters 86,
1114-1117 (2001)) and therefore, greater intensity enhancement
within the nanocavities. In this symmetric situation, the maximum
intensity enhancement is estimated to be a factor of 7 (H. J. Lezec
and T. Thio, "Diffracted evanescent wave model for enhanced and
suppressed optical transmission through subwavelength hole arrays,"
Optics Express 12, 3629-3651 (2004)) The second advantage is that
the same surface modification chemistry can be shared between the
nanocavity and nanoparticle architectures, where selective
derivatization of the exposed gold surfaces is performed.
[0116] It is well-known (H. J. Lezec and T. Thio, "Diffracted
evanescent wave model for enhanced and suppressed optical
transmission through subwavelength hole arrays," Optics Express 12,
3629-3651 (2004)) that the transmission enhancement is maximum for
nanocavity spacings .LAMBDA. slightly less than the excitation
wavelength .lamda., and for nanocavity diameters d.about..lamda./3.
However, because of nanocavity effects, this may not be optimal for
fluorescence emission. Therefore, nanocavity diameters ranging from
100 to 250 nm are fabricated. This optimal spacing is designed for
normally incident light. In order to minimize transmitted
excitation light from producing background signal at the detector
(i.e., leakage through the spectral filter), spacings in the
750-850 nm range are used, as this allows collection of
fluorescence emission normal to the surface over a .+-.10.degree.
cone half-angle without the collection of transmitted excitation
light, which exits at 12-17.degree.. After sample fabrication,
linear transmission measurements versus wavelength at normal
incidence and versus angle of incidence at a fixed wavelength (633
nm) are performed. These measurements allow for parameter
optimizations to maximize transmission and to determine
sample-to-sample repeatability.
[0117] Bullseye Architecture.
[0118] Nanofabrication of this architecture is quite a bit more
involved than the nanocavity sub-arrays. A new process for
fabricating this architecture can be based upon e-beam lithography.
This process requires accurate alignment (better than about 60 nm)
of one e-beam lithography step to another. The first step is to
place alignment marks on the substrate using optical lithography.
These alignment marks are made using small gold crosses and are
oriented at the corners of an 80 .mu.m by 80 .mu.m square, which is
approximately the field of view of the e-beam system. The next step
is to pattern the 3.times.3 sub-array of circular corrugations into
the quartz substrate with S=25 .mu.m center-to-center spacing. This
process occurs via e-beam lithography with positive resist. Before
exposure, the e-beam is switched to imaging mode to locate the
calibration marks. Once located, a grid can be created on the
controlling computer with the alignment marks at the corners. The
bullseye sub-array pattern is then exposed using coordinates on
this grid with a periodicity 580 nm, which is nearly optimal for an
excitation wavelength of 633 nm (T. Thio, K. M. Pellerin, R. A.
Linke, H. J. Lezec, and T. W. Ebbeson, "Enhanced light transmission
through a single subwavelength aperture," Optic Letters 26,
1972-1974 (2001)). About 10 annular rings are sufficient to achieve
the maximum enhancement. After exposure and development, the quartz
substrate is dry etched to a depth of about 40-50 nm, which again
is nearly optimal (too deep of an etch renders these annular
regions of the gold nearly transparent). From here, the process
follows the procedure of fabricating the nanocavity arrays, with
the exception of the additional alignment step needed during e-beam
lithography to place a nanocavity in the center of each circular
corrugation. Lift-off leaves a nanocavity in the center of the
bullseye, while the corrugation is automatically produced (or
cloned) onto the metal by deposition onto the corrugated substrate.
After fabrication, these samples are imaged with SEM to determine
the placement of the nanocavity with respect to the center of the
bullseye corrugation. Then, linear transmission spectra are taken
to determine the transmission enhancement factor and the effect of
placement accuracy on the enhancement. Since the effective
wavelength of the top-surface SPP mode is roughly .lamda.=633 nm,
about 0.1.lamda. accuracy is required. The placement accuracy is
verified using rigorous electromagnetic simulation in FEMLAB. After
the determination of necessary alignment accuracy, bullseye
nanocavity patterns that have acceptable placement are used in
specific applications. In the event that the device yield is too
low (i.e., less than 25%), the nanocavities of this structure can
be milled precisely using dbFIB.
[0119] Nanoparticle Array Architecture.
[0120] This architecture is the most straightforward to fabricate.
A positive e-beam resist (PMMA for example) is spun onto the quartz
substrate and baked. The resist is then exposed with the desired
nanoparticle array pattern. Developing removes the exposed areas.
After deposition of the chromium adhesion and gold layers, the
resist is removed during a lift-off process, leaving behind the
metallic nanoparticle array. An example nanoparticle array pattern
190 is shown in FIG. 10. The pattern 190 includes particles 192,
where the particles are elliptical in shape with 113 nm major axis
and 60 nm minor axis, and the thickness is 30 nm.
[0121] As opposed to the nanocavity architectures, optical testing
is performed on nanoparticle arrays in reflection mode as coupling
into the local surface plasmon modes of the nanoparticles occurs
via total internal reflection (TIR) from a prism, as illustrated in
FIG. 1. The nanoparticles are arranged in a periodic square lattice
with .LAMBDA..about.150-250 nm, which prevents any
particle-particle interaction that would shift and dampen the
individual nanoparticle resonance (W. A. Murray, S. Astilean, and
W. L. Barnes, "Transition from localized surface plasmon resonance
to extended surface plasmon-polariton as metallic nanoparticles
merge to form a periodic hole array," Physical Review B 69, 165407
(2004)), while at the same time eliminates any diffraction orders
from the incident excitation light as .LAMBDA.<.lamda./2. In
reflection, the localized surface plasmon resonance of each
nanoparticle is indicated by dips (as opposed to peaks in
transmission for the nanocavities). Nanoparticle shapes and
thicknesses are designed to maximize absorption at 633 nm under TIR
illumination, roughly elliptical with 110 nm major axis and 100 nm
minor axis and 30 nm thickness.
[0122] Improving Geometry Control.
[0123] One of the issues that arises during long exposures in
electron beam lithography is the stability of the writing beam.
Thermal drift of the electron beam may result in slight variation
in the positions of nanocavities in an array. This problem worsens
with increasing pattern complexity. The effect of nonuniform
spacing of nanocavities (i.e., inhomogeneous broadening), for
example, is a reduction of the excitation efficiency of surface
plasmons, thereby reducing the achievable intensity enhancement
factor within the nanocavities. Geometry nonuniformity can be
significantly reduced when using "faster" e-beam resists. Fast
resists require reduced exposure dosage, and hence the same pattern
can be written in less time, but these resists do tend to have
reduced resolution. Many different positive and negative resists
can be investigated to find a faster resist that retains enough
resolution for the patterns.
4.2 Selective Derivatization of Nanostructures
[0124] The following studies are designed are to develop and
characterize selective surface modification procedures for the
nanostructure architectures.
[0125] Surface Modification for Measurement of Fluorescent
Enhancement.
[0126] A passivation procedure for the metal surface has been
developed so that the fluorescing monolayer only covers the bottom,
quartz, surface of the nanocavities. The passivation procedure
follows Prime et al. (K. L. Prime and G. M. Whitesides, "Adsorption
of proteins onto surfaces containing end-attached oligo(ethylene
oxide): a model system using self-assembled monolayers," Journal of
the American Chemical Society 115, 10714-10721 (1993)): dissolve
mPEG-thiol (in powdered form) to a concentration of 1 .mu.mol/L in
ethanol; apply solution to gold surfaces for 24 hours in a N.sub.2
filled glove box at room temperature and atmospheric pressure, then
rinse in ethanol and dry in N.sub.2; apply labeled avidin solution
to form the monolayer. Reference surfaces for this procedure
consisted of a smooth gold surface, which after passivation and
monolayer coating, did not produce a measurable fluorescence signal
in a fluorescence microscope, and a quartz substrate, which after
passivation and monolayer coating, produced a fluorescence signal
roughly 85% of a coated quartz surface without passivation, which
is likely the result of a slight reduction of bound surface
concentration.
[0127] A similar procedure can be developed for the nanostructure
array architectures, where the dielectric surfaces are passivated,
thus allowing monolayer formation only on the exposed gold
sidewalls of the nanocavities or gold surfaces of the
nanoparticles. Dielectric surface passivation is performed using
mPEG-silane. Introduction of Cy-5 labeled avidin solution then
allows monolayer formation on the exposed gold surfaces.
Alternatively, selectively derivatizing the side-walls may also be
employed, which follows a procedure developed with biotinylated
thiol (D. M. Disley, D. C. Cullen, H. X. You, and C. R. Lowe,
"Covalent coupling of immunoglobulin G to self-assembled monolayers
as a method for immobilizing the interfacial-recognition layer of a
surface plasmon resonance immunosensor," Biosensors and
Bioelectronics 13, 1213-1225 (1998)), which binds strongly to gold
surfaces. Cy-5 labeled neutravidin is then be used for the
monolayer, where the neutravidin does not undergo a charge-charge
interaction with the dielectric surfaces, but interacts strongly
with the biotin layer via two of its biotin binding sites. A third
alternative is to passivate with mPEG-silane and derivatize the
exposed gold surfaces with thiol-conjugated oligos (J. Malicka, I.
Gryczynski, and J. R. Lakowicz, "DNA hybridization assays using
metal-enhanced fluorescence," Biochemical and Biophysical Research
Communications 306, 213-218 (2003)). These procedures are tested
with two reference surfaces, a quartz surface which, after
derivatization, should exhibit no measurable fluorescence, and a
gold surface which should exhibit strong fluorescence, as measured
with a scanning confocal fluorescence microscope.
[0128] The new procedures are tested first on the nanoparticle
array architecture, as direct imaging by the fluorescence
microscope in reflection mode can be used to determine selective
derivatization of the nanoparticles with Cy-5/avidin. The other two
nanocavity array architectures can be tested next. By using
reflection mode, the absence of fluorescence from the top surface
can be verified; fluorescence from within the nanocavities can be
detected. As further verification, transmission mode can be used to
verify that the only detectable fluorescence comes from the
nanocavities.
[0129] Because these surface modification procedures require
multiple steps involving mass transport into and out of nanoscale
volumes, it is important that the final derivatized surfaces be
fully characterized. One motivating factor behind the
characterization studies is the determination of bound avidin
surface concentration within the nanocavities or upon the
nanoparticles. The characterization methods are described herein in
Example 4.
[0130] Surface Modification for Nucleic Acid Hybridization.
[0131] The T3 polymerase promotor site is used as a model system
for nucleic acid hybridization to determine background isolation
and molecular sensitivity across the three architectures. T3
5'-(AATTAACCCTCACTAAAGGG)-3' and complementary anti-T3 are
commercially available, and can be fluorescently labeled with Cy-5.
Capture oligonucleotides (anti-T3 for these studies) are
immobilized onto the nanostructures. Formation of the avidin
monolayer is followed by a solution of 0.1-10.0 .mu.M
5'-biotinylated anti-T3 which self-assembles on top of the
avidin-coated surface (J. N. Herron, S. zumBrunnen, J.-X. Wang,
X.-L. Gao, H.-K. Wang, A. H. Terry, and D. A. Christensen, "Planar
waveguide biosensors for nucleic acid hybridization reactions,"
Proceedings SPIE 3913, 177-184 (2000)). Radiolabeled
oligonucleotides (anti-T3 for this part of the study) are prepared
by end labeling with (.sup.32P)phosphate. For determining the
surface concentration of immobilized capture oligo (i.e., anti-T3),
5'-biotinylated oligos are labeled with (.alpha.-.sup.32P)ATP using
terminal transferase. This enzyme adds (.sup.32P)AMP to the 3' end
of the oligo. A commercial 3' end labeling kit (Perkin Elmer) is
used to perform the reaction. The extra adenosine group is not
expected to interfere with binding of the labeled oligo to the
immobilized avidin monolayer. Radiolabeling efficiency is
determined using a similar procedure as described before with
equation (1). The specific activity is determined using a UV-vis
spectrophotometer at 260 nm. After self-assembly of the
radiolabeled anti-T3 onto the avidin monolayer, the probe surface
concentration is determined according to equation (2) using the
radioisotope detector. The surface concentration of the respective
nanostructure is compared to that obtained for a reference sample.
The derivatization procedure for the nanocavities may need to be
adjusted as a result of this comparison, either by adjusting
concentration of anti-T3 in solution or by changing the adsorption
time.
4.3 Comparison of Fluorescence Enhancement
[0132] Detailed, comparative studies of the total fluorescence
enhancement by each of the three architectures are performed.
Measurements by Lakowicz' group (J. Malicka, I. Gryczynski, Z.
Gryczynski, and J. R. Lakowicz, "Effects of fluorophore-to-silver
distance on the emission of cyanine-dye-labeled oligonucleotides,"
Analytical Biochemistry 315, 57-66 (2003)) showed that the
fluorescence lifetime of Cy-5 can be reduced from about 1.3 ns to
less than 100 ps on nanostructured metallic surfaces, which is one
reason why it is necessary to build a system with such small time
resolution. In a simplified phenomenological model, the total
fluorescence enhancement for all three architectures is given by
the product of three
factors--M.sub.tot=M.sub.SPM.sub.radM.sub.rate, where M.sub.SP is
the enhancement factor of the incident intensity due to surface
plasmon coupling, M.sub.rad is the enhancement in fluorescence due
to interaction of the molecular radiative dipole with the metallic
nanostructure (L. A. Blanco and F. J. G. do Abajo, "Spontaneous
light emission in complex nanostructures," Physical Review B 69,
205414 (2004); Y. Liu and S. Blair, "Enhanced fluorescence
transduction properties of metallic nanocavity arrays," submitted
to IEEE Journal of Selected Topics in Quantum Electronics (2005)),
and M.sub.rate is the enhancement factor associated with increase
in the radiative transition rate (J. Malicka, I. Gryczynski, Z.
Gryczynski, and J. R. Lakowicz, "Effects of fluorophore-to-silver
distance on the emission of cyanine-dye-labeled oligonucleotides,"
Analytical Biochemistry 315, 57-66 (2003); L. A. Blanco and F. J.
G. do Abajo, "Spontaneous light emission in complex
nanostructures," Physical Review B 69, 205414 (2004)). The product
M.sub.yield=M.sub.radM.sub.rate results in an apparent increase in
fluorescence yield, even though the actual quantum efficiency may
not be greatly increased. The fluorescence quantum efficiency of a
fluor is given by
QE=k.sub.r/(k.sub.r+k.sub.nr)
where k.sub.r is the radiative rate and k.sub.nr is the
nonradiative rate of de-excitation. In the case where the radiative
rate is modified to a new value k'.sub.r, the fluorescence
enhancement is given by the factor M.sub.rate=QE'/QE, where
QE'=k'.sub.r/(k'.sub.r+k.sub.nr). The amount of enhancement
therefore depends strongly on the native QE of the fluor. For Cy-5,
QE.about.28%; therefore, QE can be increased by a maximum of 3.6
times. However, proximity of a fluor to a metal surface can
introduce new non-radiative pathways, such as energy transfer to
phonons or surface electromagnetic waves. This can also result in a
reduction in fluorescence lifetime with comparable reduction in Q,
leaving yield unchanged.
[0133] Three types of measurements are performed to determine these
factors and to compare the three architectures. Measurements of
total fluorescence output and photobleaching times are performed as
compared to reference surfaces. These measurements allow for
estimates of M.sub.SP and M.sub.yield. Fluorescence lifetime
measurements are performed, from which the relative contributions
of M.sub.rad and M.sub.rate can be estimated. Initial measurements
are performed using Cy-5 labeled avidin, for which the
fluor-to-metal separation is about 5 nm. Because the three
enhancement factors may have strong dependence on this separation
(as shown in related work for Cy-5 on nanostructured silver
surfaces, for which the maximum enhancement occurred at 9 nm
separation (J. Malicka, I. Gryczynski, Z. Gryczynski, and J. R.
Lakowicz, "Effects of fluorophore-to-silver distance on the
emission of cyanine-dye-labeled oligonucleotides," Analytical
Biochemistry 315, 57-66 (2003))), a simple technique is employed to
experimentally study this distance dependence using alternating
layers of avidin and biotinylated BSA (BBSA). The monolayer
sequence starts with avidin:Cy-5; the next step in the sequence is
avidin:BBSA:avidin:Cy-5; and so on. At each step, layer thickness
is measured by ellipsometry and surface concentration measured by
radiolabeling.
[0134] For each architecture, a rigorous electromagnetic simulation
(using FEMLAB) of the radiative properties of a dipole (using all
orientations) is performed, either within a metallic nanocavity or
adjacent to a metallic nanoparticle. In order to mimic experimental
conditions, the dipole-metal distance is varied from about 5 nm to
about 25 nm. Combined with the experimental results, the results of
these simulations can provide further insight into the
photophysical processes occurring as the result of proximity to the
metallic nanostructures. These studies also determine the maximum
oligo lengths that can be employed while retaining the benefits of
enhanced fluorescence; preliminary studies suggest that 60-base
oligo's still maintain significant enhancement (Y. Liu and S.
Blair, "Enhanced fluorescence transduction properties of metallic
nanocavity arrays," submitted to IEEE Journal of Selected Topics in
Quantum Electronics (2005)) (i.e., greater than half the maximum)
within a nanocavity.
[0135] Nanocavity Array Architecture.
[0136] Previous studies indicate that the intensity enhancement
factor due to surface plasmon coupling M.sub.SP is about a factor
of 2, but with the new symmetric structure described herein, this
factor may increase to nearly 7 (H. J. Lezec and T. Thio,
"Diffracted evanescent wave model for enhanced and suppressed
optical transmission through subwavelength hole arrays," Optics
Express 12, 3629-3651 (2004)). The origin of the excitation
enhancement within the nanocavities results from the fact that
under the condition of enhanced transmission (Y. Liu and S. Blair,
"Fluorescence enhancement from an array of sub-wavelength metal
apertures," Optics Letters 28, 507-509 (2003)), energy is
concentrated within the nanocavities. The periodicity of the
nanocavities not only supports coupling incident light from free
space into surface plasmon modes, but also modifies the propagation
properties of the surface plasmon (I. I. Smolyaninov, W. Atia, and
C. C. Davis, "Near-field optical microscopy of two-dimensional
photonic and plasmonic crystals," Physical Review B 59, 2454-2460
(1999)) through coherent scattering off the walls of the
nanocavities, which results in constructive interference within the
nanocavities. Previous studies using random nanocavity arrangements
also indicated that the net enhancement of fluorescence yield
ranged from about 9 for 150 nm diameter cavities to about 7 for 200
nm diameter cavities. This observation suggests a strong influence
of the nanocavity geometry on the emission properties of the
fluors, most likely based upon the nanocavity aspect ratio h/d,
where h is the height. This effect can be studied experimentally by
using nanocavity diameters ranging from 100-250 nm in diameter and
comparing with results from simulation. As a result of the
geometric dependence, the experimental finding may differ from that
of Lakowicz (J. Malicka, I. Gryczynski, Z. Gryczynski, and J. R.
Lakowicz, "Effects of fluorophore-to-silver distance on the
emission of cyanine-dye-labeled oligonucleotides," Analytical
Biochemistry 315, 57-66 (2003)), for example, where the enhancement
effects occurred at a nanostructured planar surface, which is known
to result in an increase in radiative rate (A. Wokaun, H.-P. Lutz,
A. P. King, U. P. Wild, and R. R. Ernst, "Energy transfer in
surface enhanced luminescence," Journal of Chemical Physics 79,
509-514 (1983)).
[0137] In these measurements, fluorescence output from periodic and
random nanocavity arrays are compared to the output from a
reference surface that consists of a quartz surface with the same
surface concentration (as determined by radiolabeling). The output
from the nanocavity arrays is normalized to the fill-fraction of
the fluors, given by .eta..sub.f=.pi.dh/.LAMBDA.2 (which is
different than the nanocavity fill fraction
.eta.=.pi.(d/2).sup.2/.about..LAMBDA..sup.2) since the fluors cover
only the inner walls of the nanocavities. The total fluorescence
enhancement factor M.sub.tot is given by the ratio of normalized
fluorescence output from the periodic array to the reference
surface, while the surface plasmon excitation enhancement factor
M.sub.SP is given by the ratio of fluorescence between the periodic
and random array. From these quantities, an apparent increase in
fluorescence yield can be determined by the ratio
M.sub.yield=M.sub.tot/M.sub.SP, but further measurements can be
compared to compare photobleaching times and fluorescence lifetimes
across the periodic and random nanocavity array geometries and the
reference in order to obtain a better understanding of the
influence of the nanocavity geometry on the photophysical
processes.
[0138] All measurements using three different samples are performed
for each geometry. Multiple samples can be fabricated on each
substrate to greatly improve the efficiency. The standard
deviations from these measurements reflect variations in pattern
fabrication, monolayer coating, and optical alignment and
detection. With our previous methods, we achieved a standard
deviation of less than 10% of the mean. The new fabrication methods
and surface modification procedures are expected to reduce the
deviation to less than 5%.
[0139] Bullseye Nanocavity Architecture.
[0140] The main reason why the surface plasmon enhancement factor
for the nanocavity arrays is small is due to the fact that the
periodicity of the nanocavities themselves is used to couple
incident light into surface plasmon modes. The fill fraction of the
nanocavities is small (resulting in a weak diffraction grating) in
order to keep .LAMBDA.>.lamda. and to improve background
isolation. The bullseye nanocavity geometry breaks these
constraints by using a separate, more efficient, structure for
grating coupling into surface plasmon modes--corrugated annular
rings--which redistributes a much larger fraction of incident light
into the nanocavity in the center. Measurements of second-harmonic
generation through the bullseye nanocavity compared to a single,
bare nanocavity (A. Nahata, R. A. Linke, T. Ishi, and K. Ohashi,
"Enhanced nonlinear optical conversion using periodically
nanostructured metal films," Optics Letters 28, 423-425 (2003))
indicate that the surface plasmon intensity enhancement within the
bullseye nanocavity M.sub.SP.about.100. The main disadvantage of
the bullseye architecture is that the annular ring structure is
significantly larger than the nanocavity, reducing the density of
detection sites within a zone.
[0141] As before with the nanocavity array architecture,
measurements across three samples--a 3.times.3 bullseye array, and
3.times.3 nanocavity array with .LAMBDA.=S=25 .mu.m, and the quartz
surface, are compared. The purpose of the 3.times.3 nanocavity
array is to maintain the same fluor fill fraction
.eta..sub.f=.pi.dh/S.sup.2 while isolating surface plasmon
excitation enhancement from nanocavity related effects. At 25 .mu.m
spacing, which is greater than the surface plasmon attenuation
length, these nanocavities do not coherently interact and therefore
act as independent cavities. From these measurements, significantly
larger excitation enhancement factors M.sub.SP is expected with
very similar yield enhancements M.sub.yield. Because of the annular
corrugation surrounding each nanocavity in the bullseye structure,
the radiative properties of the fluor could be modified from that
of the bare nanocavity, which would affect the radiative efficiency
M.sub.rad. This can be verified with electromagnetic simulation.
Even with the possible modification of M.sub.rad, it is anticipated
that it is not necessary to repeat the exhaustive studies comparing
enhancement effects versus nanocavity diameter d and
fluor-to-sidewall separation, thus requiring far fewer bullseye
patterns be fabricated.
[0142] Nanoparticle Architecture.
[0143] Large surface enhancement effects by metallic nanoparticles
have been known for over 20 years (M. Fleischmann, P. J. Hendra,
and A. J. McQuillan, "Raman spectra of pyridine adsorbed at a
silver electrode," Chemical Physics Letters 26, 163-166 (1974); H.
G. Craighead and A. M. Glass "Optical absorption of small metal
particles with adsorbed dye coats," Optics Letters 6, 248-250
(1981)) owing to the large absorption cross-section associated with
the local plasmon resonance of the nanoparticle. The wavelength of
the peak absorption due to the local plasmon resonance is
determined by the geometry of the nanoparticle. The nanoparticles
are elliptical in shape with major axis about 110 nm, minor axis
about 100 nm, and thickness about 30 nm, which places the peak of
the local plasmon absorption near 633 nm in one linear polarization
state (the state of polarization of the excitation light) and a
peak in the local plasmon resonance near 670 nm (the peak
fluorescence wavelength for Cy-5) for the orthogonal state of
polarization. The use of an elliptical nanoparticle can produce a
double resonance effect (H. Ditlbacher, N. Felidj, J. R. Krenn, B.
Lambprecht, A. Leitner, and F. R. Aussenegg, "Electromagnetic
intereaction of fluorophores with designed 2D silver nanoparticle
arrays," Applied Physics B 73, 373 (2001)) to maximize fluorescence
output. With the nanoparticle array, since the nanoparticles are
non-interacting, there is no way to directly isolate the excitation
enhancement factor M.sub.SP from M.sub.yield; therefore, the
comparisons are based upon the quartz reference surface. The
measured fluorescence from the nanoparticle array is normalized to
the fill fraction of the nanoparticles
.eta.=.pi.(d/2).sup.2/.LAMBDA..sup.2 and compared to the reference
sample to obtain the total fluorescence enhancement factor. This
fill fraction is significantly greater than for the nanocavity
array as .LAMBDA. is much shorter.
[0144] For the nanoparticle array, M.sub.SP can be estimated from
the ratios of photobleaching times and fluorescence lifetimes
between the nanoparticle array and reference surface. As with the
nanocavity array, these measurements are performed as a function of
fluor-particle spacing, but expect to obtain results qualitatively
similar to Lakowicz (J. Malicka, I. Gryczynski, Z. Gryczynski, and
J. R. Lakowicz, "Effects of fluorophore-to-silver distance on the
emission of cyanine-dye-labeled oligonucleotides," Analytical
Biochemistry 315, 57-66 (2003)). Overall, total enhancement factors
M.sub.tot>10 is anticipated (H. Ditlbacher, N. Felidj, J. R.
Krenn, B. Lambprecht, A. Leitner, and F. R. Aussenegg,
"Electromagnetic intereaction of fluorophores with designed 2D
silver nanoparticle arrays," Applied Physics B 73, 373 (2001); J.
Malicka, I. Gryczynski, and J. R. Lakowicz, "DNA hybridization
assays using metal-enhanced fluorescence," Biochemical and
Biophysical Research Communications 306, 213-218 (2003); J.
Malicka, I. Gryczynski, Z. Gryczynski, and J. R. Lakowicz "Effects
of fluorophore-to-silver distance on the emission of
cyanine-dye-labeled oligonucleotides," Analytical Biochemistry 315,
57-66 (2003)), with the majority of the enhancement due to
M.sub.SP. The total fluorescence enhancement is anticipated to be
more sensitive to separation for the nanoparticles than for the
nanocavity architectures.
[0145] The surface plasmon enhancement factor M.sub.SP represents
an additional enhancement over the yield enhancement given by
M.sub.yield=M.sub.radM.sub.rate. This additional factor is
important in situations where fluorescence transduction is not
photobleaching limited. One situation is in the use of quantum dot
fluorescence labels (M. B. Jr., M. Moronne, P. Gin, S. Weiss, and
A. P. Alivisatos, "Semiconductor nanocrystals as fluorescent
biological labels," Science 281, 2013-2016 (1998); W. C. W. Chan
and S. Nie "Quantum dot bioconjugates for ultrasensitive
nonisotropic detection," Science 281, 2016-2018 (1998).), which do
not significantly photobleach. With metallic nanostructure arrays
comprising a single zone, we obtain the practical advantages of an
additional fluorescence signal increase by the factor
M.sub.SPM.sub.yield for the same number of fluorescing molecules,
or a reduction in the number of molecules by the factor
M.sub.SPM.sub.yield with the same fluorescence level, as compared
to direct excitation on a quartz substrate with the same zone area.
The other situation is that of simultaneous transduction of
multi-zone sensing arrays, in which the incidence light is divided
equally among all zones. The practical advantage, then, even in the
case of fluors that photobleach, is that spreading the light across
MSP zones will result in M.sub.yield times more output from each
zone with the same bleaching time, as compared to a single zone on
a quartz substrate with the same number of molecules per zone. One
could also excite M.sub.SPM.sub.yield zones with the same
fluorescence output from each zone as the quartz substrate, but
with a much longer time to photobleach. These factors do not take
into account the other significant advantage of the nanostructure
array architectures, that of background isolation, which further
improves these scalings by at least another order of magnitude.
4.4 Comparison of Sensitivity in Real-Time Hybridization
[0146] The performance advantages of the nanostructure
architectures are quantified through the study of real-time
hybridization kinetics on a single zone using fluorescence
transduction in the presence of varying concentrations of
background species. Instead of using RNA as the target species (as
would be the case in direct expression analysis), end-labeled
single-stranded DNA (i.e., an oligonucleotide of 20-base length) is
used. The reason for this is that DNA is significantly more robust
and requires fewer precautions in sample handling and storage,
therefore simplifying experimental procedures. These results are
highly relevant to the direct analysis of expressed RNA, which can
also be performed using the structures as described herein. The T3
polymerase promotor site is used as a model system; T3 and
complementary anti-T3 are commercially available, and can be
fluorescently labeled with Cy-5. Capture oligonucleotides (anti-T3
for these studies) are selectively immobilized as described
previously. Sample solution containing fluorescently labeled target
and non-target species are introduced to the surface using a flow
cell (see FIG. 4), which resides on the top surface of the
nanostructure samples. A kinetic curve is analyzed using the
two-compartment model as described previously. These parameters are
illustrated in FIG. 6. The purpose for using the two-compartment
model is that, through the fitting constant k.sub.M, the effect of
mass transport to the sparse array of detection sites can be
determined and compared to a planar waveguide sensing modality in
which the fill fraction is 100%. In order to differentiate the
effects of non-specific binding, the two-compartment model is
modified to describe the binding of two species to the surface with
association constants k.sub.a1 and k.sub.a2. In this case, two
bound concentrations B1(t) and B2(t) are obtained, and the density
of available binding sites are given by RT-B1(t)-B2(t). The effects
of dissociation for the non-specific species may also be
incorporated. It is not be noted that the ultimate goal for
expression arrays is to use the two-compartment model to analyze
the kinetic curve at each hybridization zone to obtain the unknown
concentration C.sub.T of the desired target in solution.
[0147] Before the real-time hybridization experiments are
performed, a calibration between bound surface concentration and
fluorescence intensity is performed. Using radiolabeling as
described previously, the bound probe concentration can be
obtained. The same surface modification procedures with Cy-5
end-labeled anti-T3 (with labeling ratio determined by UV-vis
absorption) can be performed to allow direct relation between
measured fluorescence intensity and bound concentration. This
relationship can then be used in conjunction with the
two-compartment model to determine the detection limits in terms of
the number of bound target molecules.
[0148] Determination of Detection Sensitivity--Nanocavity
Architectures.
[0149] In this section, fluorescence isolation from unbound species
is verified, and the detection sensitivity is determined taking
into account non-specific binding for the periodic nanocavity array
and 3.times.3 bullseye array. Because detectable fluorescence can
only be produced from within a nanocavity, random variation in
fluorescence from non-target molecules only occurs when those
molecules randomly diffuse into and out of the nanocavity (although
some fraction may non-specifically bind). The nanocavity surface
area represents a fraction .eta. of the total zone area
(.eta..about.1-4% for the nanocavity arrays and .eta..about.0.01%
for the bullseye arrays), so that the background signal from
unbound species should be less by a factor of approximately 1/.eta.
than in other washless, surface selective fluorescence sensors such
as a planar waveguide or fluorescence-SPR where the sensing surface
represents 100% of the zone area.
[0150] Because the transduction area in the nanocavity
architectures is so small, diffusion of the target molecules into
the sensing regions may be slower than if the transduction area
were 100% of the sensing area. The first step is to study
hybridization kinetics of the labeled target as a function of
target concentration in solution, as compared to a planar
waveguide. Target oligos (T3), labeled at the 5' end with Cy-5 dye
are prepared in solution with a concentration C.sub.n, where n is
the trial number. Typical Molar concentrations range from 10.sup.-8
to 10.sup.-12. When introduced into the flow cell, T3 specifically
binds to probe oligos on the capture monolayer and form hybridized
DNA. The hybridization kinetic curve 74 is measured for each
C.sub.n through the time dependence of the fluorescence excited by
light intensity within each nanocavity (as in FIG. 5). Both
association 76 (i.e., binding) and dissociation 78 curves are
obtained, as illustrated in FIG. 7. The dissociation curve 78 are
generated by flowing buffer solution through the flow cell, and
allows determination of k.sub.d (which will essentially be zero for
specific binding, but non-zero for non-specific binding, as
described in the next paragraph). By comparing the kinetic curves
between the two nanocavity architectures and the waveguide, with
greatly different fill fractions, the increase in diffusion time
can be determined via the parameter k.sub.M.
[0151] The next step is to perform the same measurements using a
second labeled sequence of the same length as T3/anti-T3 to
determine the kinetic coefficients in the two-compartment model for
non-specific binding. The sequence of these "background" oligos is
chosen so as not to specifically bind to either the target or probe
molecules. These background oligos diffuse into the nanocavities
and produce a random background signal, which could mask the
kinetic curve produced by bound species, and may also
non-specifically bind, which produces a signal that mimicks the
kinetics of the target species (but with a different rate and
equilibrium value (H. Dai, M. Meyer, S. Stepaniants, M. Ziman, and
R. Stooughton, "Use of hybridization kinetics for differentiating
specific from non-specific binding to oligonucleotide microarrays,"
Nucleic Acids Research 30, (2002))). As before, these measurements
are made as a function of C.sub.n, where larger concentrations in
the range 10.sup.-6 to 10.sup.-10 are used. From the determination
of the kinetic coefficients (k.sub.a2 and k.sub.d2, which should be
relatively constant across concentration of non-specific species),
the modified dual-rate two-compartment model can then be used to
differentiate between specific and non-specific binding, where the
fitting parameters in the model are C.sub.1 and C.sub.2.
[0152] Three sets of measurements are made to determine the
detection sensitivity. The first set is as a function of target
concentration C.sub.n, where the concentration of non-specific
oligos is also C.sub.n. This situation simulates the conditions for
a two-zone sensor array. The second set has target concentration
C.sub.n, but non-specific concentration 10 C.sub.n, thus simulating
a 10-zone array. The final set has a non-specific concentration of
100 C.sub.n. From the two-compartment model, the minimum detectable
target concentration and the associated number of bound target
molecules can be determined. It is anticipated that the detection
limit will be a factor of M.sub.tot/.eta. lower for the nanocavity
architectures than the waveguide (taking into account the
normalization between surface intensity of the evanescent field of
the waveguide and the intensity of direct excitation on the quartz
reference surface from which M.sub.tot was derived, where this
normalization factor will be of order 1).
[0153] Determination of Detection Sensitivity--Nanoparticle
Architecture.
[0154] Estimation of the expected signal to background ratio in the
nanoparticle architecture is more involved as fluorescence
contribution from non-target species can occur either near the
nanoparticle surface or between the nanoparticles. The excitation
geometry that minimizes contribution from species residing between
nanoparticles is shown in FIG. 1, in which the local plasmon
resonance of the nanoparticles is excited via the evanescent wave
of a prism. These mean that only unbound species that randomly
diffuse to within about 100 nm of the surface produce a
contribution. The signal to background ratio of the nanoparticle
arrays is given by M.sub.tot/(.eta.M.sub.tot+(1-.eta.)); therefore,
for very large total fluorescence enhancement factors
M.sub.tot>>(1-.eta.)/.eta., the background isolation scales
the same as the nanocavity architectures. The same experimental
procedures used for the nanocavity architectures are repeated for
the nanoparticle architecture.
[0155] The detection sensitivities are critically compared across
the three architectures. As discussed previously, the nanocavity
architectures are expected to have the greatest background
isolation, with the bullseye having the greatest signal to
background ratio due to its large surface plasmon enhancement and
very low fill fraction. These bullseye structures are the most
promising architecture for the implementation of very high
sensitivity detection that can operate with unbiased real
populations, as the large surface plasmon intensity enhancement
allows efficient scaling to large arrays, where each zone retains
the benefit of yield enhancement given by M.sub.yield.about.10.
[0156] Two additional sets of studies can also be performed: 1)
single base-pair mismatch discrimination, which is performed in the
same manner as the non-specific binding studies, except that the
temperature of the nanostructure array is elevated to near the
heteroduplex melting temperature, and 2) binding studies using
target and non-target species of 60-base length (where the bottom
20 bases of the target are complementary to anti-T3) in order to
provide additional relevant results to situations encountered in
expression analysis.
[0157] Although the description included herewith contains many
specifics, these should not be construed as limiting the scope of
the invention, but merely as providing illustrations of some of the
presently preferred embodiments. Similarly, other embodiments of
the invention may be devised which do not depart from the spirit or
scope of the invention. Features from different embodiments may be
employed in combination. The scope of the invention is, therefore,
indicated and limited only by the appended claims and their legal
equivalents, rather than by the foregoing description. All
additions, deletions and modifications to the invention as
disclosed herein which fall within the meaning and scope of the
claims are to be embraced thereby.
[0158] All references, including publications, patents, and patent
applications, cited herein are hereby incorporated by reference to
the same extent as if each reference were individually and
specifically indicated to be incorporated by reference and were set
forth in its entirety herein. The references discussed herein are
provided solely for their disclosure prior to the filing date of
the present application. Nothing herein is to be construed as an
admission that the inventors are not entitled to antedate such
disclosure by virtue of prior invention.
* * * * *