U.S. patent application number 14/694419 was filed with the patent office on 2016-01-21 for monitoring a dynamic system by liquid chromatography-mass spectrometry.
The applicant listed for this patent is Sutro Biopharma, Inc.. Invention is credited to Sunil Bajad, Evan Green, Henry Heinsohn, Sushmita Mimi Roy.
Application Number | 20160017397 14/694419 |
Document ID | / |
Family ID | 44799322 |
Filed Date | 2016-01-21 |
United States Patent
Application |
20160017397 |
Kind Code |
A1 |
Roy; Sushmita Mimi ; et
al. |
January 21, 2016 |
MONITORING A DYNAMIC SYSTEM BY LIQUID CHROMATOGRAPHY-MASS
SPECTROMETRY
Abstract
The present invention provides a method for monitoring of
profile changes of components in a dynamic system such as a
cell-free in vitro protein synthesis system by using liquid
chromatography (LC) combined with mass spectrometry (MS). In an
additional aspect, this invention provides a method for enhancing
the yield and/or reproducibility in a cell-free protein synthesis
system by modulating the level and/or activity of a protein
component that has regulatory effects on the system.
Inventors: |
Roy; Sushmita Mimi;
(Sunnyvale, CA) ; Bajad; Sunil; (Fremont, CA)
; Green; Evan; (Mountain View, CA) ; Heinsohn;
Henry; (Alamada, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Sutro Biopharma, Inc. |
South San Francisco |
CA |
US |
|
|
Family ID: |
44799322 |
Appl. No.: |
14/694419 |
Filed: |
April 23, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13087075 |
Apr 14, 2011 |
9040253 |
|
|
14694419 |
|
|
|
|
61324126 |
Apr 14, 2010 |
|
|
|
Current U.S.
Class: |
435/68.1 ;
435/252.8; 435/259 |
Current CPC
Class: |
C12N 1/20 20130101; C12P
21/06 20130101; C12Y 207/07006 20130101; C12N 1/06 20130101; C12N
9/1247 20130101; C07K 14/535 20130101; G01N 33/6848 20130101; C12P
21/02 20130101 |
International
Class: |
C12P 21/06 20060101
C12P021/06; C12N 9/12 20060101 C12N009/12; C07K 14/535 20060101
C07K014/535; C12N 1/20 20060101 C12N001/20; C12N 1/06 20060101
C12N001/06 |
Claims
1.-34. (canceled)
35. A modified prokaryotic cell lysate comprising a reduced amount
of CspE protein as compared to a lysate prepared from a wild-type
prokaryotic cell by the same method.
36. The modified prokaryotic cell lysate of claim 35 further
comprising a reduced amount of CspA protein as compared to a lysate
prepared from a wild-type prokaryotic cell by the same method.
37. The modified prokaryotic cell lysate of claim 35, wherein the
cell from which the lysate is prepared comprises a recombinant
genomic modification that abolishes CspE expression.
38. The modified prokaryotic cell lysate of claim 36, wherein the
cell from which the lysate is prepared comprises a recombinant
genomic modification that abolishes CspE expression and a
recombinant genomic modification that abolishes CspA
expression.
39. The modified prokaryotic cell lysate of claim 35 comprising
iodoacetamide modified protein.
40. The modified prokaryotic cell lysate of claim 35 comprising T7
RNA polymerase.
41. The modified prokaryotic cell lysate of claim 35 comprising an
exogenous nucleic acid template, wherein the exogenous nucleic acid
template encodes a recombinant protein.
42. The modified prokaryotic cell lysate of claim 41 comprising the
recombinant protein encoded by the exogenous nucleic acid
template.
43. A method of making a modified prokaryotic cell lysate, the
method comprising: (i) providing a modified prokaryotic cell
comprising a recombinant genomic modification that abolishes CspE
expression; and (ii) lysing the cell, thereby forming the modified
prokaryotic cell lysate.
44. The method of claim 43, wherein the modified prokaryotic cell
comprising a recombinant genomic modification that abolishes CspE
expression further comprises a recombinant genomic modification
that abolishes CspA expression.
45. The method of claim 43, wherein the method further comprises
activating the modified prokaryotic cell lysate by incubating the
modified prokaryotic cell lysate at a temperature of at least
25.degree. C.
46. The method of claim 43, wherein the method further comprises
contacting the modified prokaryotic cell lysate with
iodoacetamide.
47. The method of claim 46, wherein the method further comprises
contacting the modified prokaryotic cell lysate with glutamate,
pyruvate, AMP, GMP, UMP, CMP, and oxalate.
48. The method of claim 47, wherein the method further comprises
contacting the modified prokaryotic cell lysate with magnesium,
ammonium, potassium, phosphate, and sodium.
49. The method of claim 48, wherein the method further comprises
contacting the modified prokaryotic cell lysate with putrescine and
spermidine.
50. The method of claim 43, wherein the method further comprises
contacting the modified prokaryotic cell lysate with an exogenous
nucleic acid template, wherein the exogenous nucleic acid template
encodes a recombinant protein.
Description
RELATED APPLICATIONS
[0001] This application is a Continuation of U.S. patent
application Ser. No. 13/087,075, filed Apr. 14, 2011, (now U.S.
Pat. No. 9,040,253, issued May 26, 2015), which claims priority to
U.S. Provisional Patent Application No. 61/324,126, filed Apr. 14,
2010, the contents of which are hereby incorporated by reference in
the entirety for all purposes.
BACKGROUND OF THE INVENTION
[0002] Protein synthesis is a fundamental biological process that
underlies the development of polypeptide therapeutics, vaccines,
diagnostics, and industrial enzymes. With the advent of recombinant
DNA (rDNA) technology, it has become possible to harness the
catalytic machinery of the cell to produce a desired protein. This
can be achieved within the cellular environment or in vitro using
lysates derived from cells.
[0003] In vitro, or cell-free, protein synthesis offers several
advantages over conventional in vivo protein expression methods.
Cell-free systems can direct most, if not all, of the metabolic
resources of the cell towards the exclusive production of one
protein. Moreover, the lack of a cell wall and membrane components
in vitro is advantageous because it allows for control of the
synthesis environment. For example, tRNA levels can be changed to
reflect the codon usage of genes being expressed. The redox
potential, pH, or ionic strength can also be altered with greater
flexibility than with in vivo protein synthesis because concerns of
cell growth or viability do not exist. Furthermore, direct recovery
of purified, properly folded protein products can be easily
achieved.
[0004] This invention relates to in vitro polypeptide synthesis in
a system utilizing a suitable cell lysate. In particular, the
invention provides a method for monitoring changes in the profile
of various components (such as protein quantity and state of
modification) within a cell-free in vitro polypeptide synthesis
system, allowing the identification of components that correlate in
their level or amount to the cell lysate's capacity to produce
recombinant proteins in the system. The invention also provides a
method for improving protein yield from the in vitro polypeptide
synthesis reactions, by way of countering the changes in cell
lysate components responsible for reduced protein yield, for
example, by down-regulating proteins that have been identified to
suppress the in vitro polypeptide synthesis and/or up-regulating
proteins that have been identified to promote the in vitro
polypeptide synthesis in the cell-free system. Because of the
significant advantages of a cell-free in vitro polypeptide
synthesis system due to its relative simplicity, there exists the
need to improve the system's productivity and efficiency. The
present invention fulfills this and other related needs.
BRIEF SUMMARY OF THE INVENTION
[0005] In the first aspect, this invention relates to a method for
monitoring a cell-free protein synthesis system. The method
comprises these steps: (a) extracting a first sample from the
system at a first time point; (b) extracting a second sample from
the system at a second time point; (c) digesting proteins in the
first and second samples separately to produce peptides of about
6-15 amino acids in length; (d) separating the peptides according
to their size and polarity; (e) determining the molecular mass and
quantity of each of the peptides with greater than 10 ppm accuracy
in a mass spectrometer; (f) determining the amino acid sequence and
chemical composition of each peptide; and (g) comparing the
quantity and chemical composition of each peptide from the first
and the second samples, thereby determining the change in quantity
and chemical composition of the peptides. In some embodiments,
steps (a) to (f) are repeated after step (g) is completed. In other
embodiments, step (c) is performed by enzymatic digestion, such as
by papain, Endoproteinase Glu-C, Endoproteinase Lys-C, trypsin, or
chymotrypsin digestion. In some embodiments, step (d) is performed
by chromatography, such as liquid chromatography, including high
performance liquid chromatography (HPLC), nano- or micro-fluidic
liquid chromatography. In other embodiments, step (f) further
comprises aligning the amino acid sequence of at least one of the
peptides with the amino acid sequence of proteins known to be
present in the system, thereby identifying the protein from which
the peptide has originated. In some cases, the amino acid sequence
of a multiplicity of the peptides are aligned with the amino acid
sequence of proteins known to be present in the system, thereby
identifying a multiplicity of proteins from which the peptides have
originated. In other cases, step (g) further comprises determining
the change in quantity and chemical composition of the protein or
proteins. In some examples, the claimed method further comprises
the step of determining the ratio of the quantity of two peptides
originated from the same protein.
[0006] Using the monitoring method described above, the present
inventors are able to identify proteins that impact the efficiency
of the cell-free protein synthesis system. In the second aspect,
therefore, this invention relates to a method for enhancing
recombinant protein production in a cell-free protein synthesis
system comprising a cell lysate. This method comprises the step of
suppressing the level or amount of a cold shock protein in the
cell-free protein synthesis system when compared with a control
system where no step has been taken to regulate the cold shock
protein. Suppression of the cold shock protein may be achieved by
reducing the protein in total amount or in activity. In some
embodiments, at least a portion of the genomic sequence encoding
for the cold shock protein is deleted from the genome of the cells
from which the cell lysate is made; or at least one nucleotide in
the genomic sequence encoding for the cold shock protein is
substituted or deleted in the genome of the cells from which the
cell lysate is made; or the cold shock protein comprises a
multiplicity of His residues at its N- or C-terminus, such that the
protein may be readily removed from the cell lysate. To reduce the
activity of the cold shock protein, a neutralizing antibody for the
cold shock protein can be used, or an inhibitor of the cold shock
protein or its mRNA can be used. Some exemplary cold shock proteins
include CspA, CspE, H-NS, and HU-.beta.. Furthermore, additional
proteins have been shown to also negatively affect the efficiency
of the cell-free protein synthesis system, such as cell division
protein ftsZ (Swiss-Prot ID P0A9A6) and outer membrane protein A
(ompA, Swiss-Prot ID P0A910). These proteins can be removed or
suppressed in their quantity and/or activity using the same general
methodologies described in this application in order to enhance the
efficiency of recombinant protein production in the cell-free
system.
[0007] In the third aspect, this invention relates to a method for
enhancing recombinant protein production in a cell-free protein
synthesis system comprising a cell lysate, and the method comprises
the step of enhancing the level or activity of a protein that
stabilizes or enhances energy molecules in the cell-free protein
synthesis system, as compared to a control lysate where no such
step is taken. This protein may be, for example, adenylate kinase,
ATP synthase .alpha., or ATP synthase .beta..
[0008] In the fourth aspect, this invention relates to a method for
enhancing recombinant protein production in a cell-free protein
synthesis system comprising a cell lysate, and the method comprises
the step of increasing the level of ATP, ADP, AMP, GTP, GDP, or GMP
in the cell-free protein synthesis system, as compared to a control
lysate, where no such step is taken. This may be achieved by
suppressing the level or activity of a protein that
dephosphorylates ATP, ADP, AMP, GTP, GDP, or GMP.
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIG. 1: .sup.14C GMCSF profiles of three independently
produced extracts used for studying pre-incubation process using
proteomics and metabolomics. The arrows indicate sampling times.
Extracts hit high performance at 150 minutes of incubation.
[0010] FIG. 2: High throughput proteomic profiling shows that
proteins HNS, CspE, Adenylate kinase, and ATP synthase declined
over pre-incubation in three different extracts. Many other
proteins profiled remained the same.
[0011] FIG. 3: Plots of GFP production in a cell-free reaction with
and without cold-shock proteins CspE and H-NS. Addition of a crude
lysate from a cell-free reaction with no plasmid or with a GM-CSF
plasmid shows expression of GFP at high levels. Adding crude lysate
preparations of cold shock proteins CspE and H-NS show a marked
decrease in GFP production, indicating the inhibitory effect of
cold shock proteins HNS and CspE.
[0012] FIG. 4: Addition of CspE protein to the cell-free reaction
inhibits cell-free synthesis. This indicates that CspE is a major
inhibitory protein in the in vitro system and explains why warming
of the extract during pre-incubation results in decrease of CspE
leads to extract activation.
[0013] FIG. 5: Pre-incubation protein synthesis reaction profiles
of extracts prepared from E. coli strain KGK10. Extracts were
incubated at 42.degree. C. (.box-solid.), 37.degree. C.
(.tangle-solidup.), 30.degree. C. ( ), and 25.degree. C. () for the
indicated time, and aliquots were used for in-vitro synthesis of
rhGM-CSF for 5 hrs, Protein synthesis yields were monitored by
.sup.14C leucine incorporation. Data were fit to Y=A.sub.01
exp(-k.sub.1*t)+A.sub.02 exp(-k.sub.2*t) corresponding to a
biphasic process.
[0014] Pre-incubation is not required for removal of endogenous
message or activation of transcription. FIG. 6A) Comparison of
pre-incubation profile/ run-off reaction profile of extracts with
and without nuclease treatment. Extracts were treated with Staph.
aureus nuclease in the presence of CaCl.sub.2 for removal of
endogenous message followed by quenching of the nuclease activity
by EDTA. The extract activity was monitored by .sup.14C leucine
incorporation into rhGMCSF. FIG. 6B) rhGMCSF mRNA levels during
cell-free reactions of non-incubated and 2.5 incubated extracts.
mRNA levels were monitored by .sup.3H UTP incorporation. FIG. 6C)
Comparison of pre-incubation profile with added mRNA Vs plasmid.
FIG. 6D) PolyU directed .sup.14C phenylalanine incorporation in
non-incubated Vs 2.5 h pre-incubated extract.
[0015] Label-free proteomic profiling of pre-incubation process.
FIG. 7A) Reproducibility of label-free proteomic profiling method
for 7191 peptides. FIG. 7B) Pie-chart showing the functional
categories of proteins profiled. FIG. 7C) Intensity Vs time
profiles of peptides detected by LC/MS during pre-incubation
process. Profiling was carried out on samples collected at 0, 2.5
and 5 h at 30.degree. C. corresponding to the initial, maximal, and
late pre-incubation process. The gray-shaded lines show intensities
of all the peptides profiled during pre-incubation with darker gray
indicating higher intensity. Selected peptides showing decrease in
intensity over the pre-incubation time are highlighted in black
color for illustration purpose. FIG. 7D) Intensity Vs time plots of
selected peptides belonging to cold shock proteins CspC, CspE and
H-NS during the pre-incubation at 30.degree. C. Average intensities
of 2 peptides from each protein are plotted with error bars
indicating standard deviation over three independent extract
pre-incubation reactions. n=3.
[0016] FIG. 8A) Kinetics of CspE decay at 25 ( ), 30 (.box-solid.),
37 (.tangle-solidup.), and 42 (.diamond-solid.).degree. C.,
monitored by LC-MS during the pre-incubation reaction. Data were
fit to a single exponential decay Y=A.sub.0 exp(-k.sub.decay*t).
FIG. 8B) Relationship between the first-order rate constant for CSP
decay and the corresponding first-order rate constants for extract
activation, from FIG. 1, measured at several temperatures. The data
were fit to a linear free energy relationship
k.sub.decay=Ck.sub.activation.sup..beta., where .beta.=0.64.+-.0.06
for CSPC, .beta.=0.75.+-.0.14 for CspE, and .beta.=0.81.+-.0.05 for
HNS measures the sensitivity of CSP decay kinetics as a function of
the rate of extract activation.
[0017] Faster cooling process during cell harvesting produces
highly active extracts with predictable pre-incubation behavior.
FIG. 9A) Pre-incubation profiles of extracts from 3 independent
fermentor runs harvested with the fast cooling process. FIG. 9B)
Comparison of CSP levels (CspE) and protein synthesis yield
(rhGM-CSF) in extracts prepared from quenched, slow cooled and fast
cooled cells. The CspE levels are normalized to endogenous GAPDH. *
indicates p-value <0.001, compared to slow cooling process.
Protein synthesis data was obtained for quenched cells. FIG. 9C)
Proteomic profiling of pre-incubation process of extract prepared
with fast cooling process. Peptides belonging to cold shock
proteins CspE, CspA, CspC and H-NS are indicated with A symbol.
[0018] FIG. 10: Effect of purified CspA, CspE and H-NS on in-vitro
synthesis of rhGM-CSF. Purified proteins were added at the
beginning of the cell-free reactions and the rhGM-CSF synthesis was
monitored after 5 h by .sup.14C leucine incorporation as described
by Zawada et al. (Biotechnol. Bioeng. 2011, 108:n/a.
doi:10.1002/bit.23103).
[0019] FIG. 11: Effect of deletion of cold shock proteins on
pre-incubation profile of E. coli cell-free extract. Extracts
prepared from cold shock deletion mutants .DELTA.cspE,
.DELTA.cspE+.DELTA.cspA, .DELTA.cspE+.DELTA.cspA+.DELTA.cspC and
parent strain were pre-incubated. 30.degree. C. for the indicated
time, and aliquots were used for in-vitro synthesis of rhGM-CSF for
5 hrs. Protein synthesis yields were monitored by .sup.14C leucine
incorporation as described by Zawada et al., supra.
DEFINITIONS
[0020] It is to be understood that this invention is not limited to
the particular methodology, protocols, cell lines, animal species
or genera, and reagents described, as such may vary. It is also to
be understood that the terminology used herein is for the purpose
of describing particular embodiments only, and is not intended to
limit the scope of the present invention, which will be limited
only by the appended claims.
[0021] As used herein the singular forms "a," "and," and "the"
include plural referents unless the context clearly dictates
otherwise. Thus, for example, reference to "a cell" includes a
plurality of such cells and reference to "the protein" includes
reference to one or more proteins and equivalents thereof known to
those skilled in the art, and so forth. All technical and
scientific terms used herein have the same meaning as commonly
understood to one of ordinary skill in the art to which this
invention belongs unless clearly indicated otherwise.
[0022] The term "nucleic acid" or "polynucleotide" refers to
deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and
polymers thereof in either single- or double-stranded form. Unless
specifically limited, the term encompasses nucleic acids containing
known analogues of natural nucleotides that have similar binding
properties as the reference nucleic acid and are metabolized in a
manner similar to naturally occurring nucleotides. Unless otherwise
indicated, a particular nucleic acid sequence also implicitly
encompasses conservatively modified variants thereof (e.g.,
degenerate codon substitutions), alleles, orthologs, SNPs, and
complementary sequences as well as the sequence explicitly
indicated. Specifically, degenerate codon substitutions may be
achieved by generating sequences in which the third position of one
or more selected (or all) codons is substituted with mixed-base
and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res.
19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608
(1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).
The term nucleic acid is used interchangeably with gene, cDNA, and
mRNA encoded by a gene.
[0023] The term "gene" means the segment of DNA involved in
producing a polypeptide chain. It may include regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0024] The term "amino acid" refers to naturally occurring and
synthetic amino acids, as well as amino acid analogs and amino acid
mimetics that function in a manner similar to the naturally
occurring amino acids. Naturally occurring amino acids are those
encoded by the genetic code, as well as those amino acids that are
later modified, e.g., hydroxyproline, .gamma.-carboxyglutamate, and
O-phosphoserine. Amino acid analogs refers to compounds that have
the same basic chemical structure as a naturally occurring amino
acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl
group, an amino group, and an R group, e.g., homoserine,
norleucine, methionine sulfoxide, methionine methyl sulfonium. Such
analogs have modified R groups (e.g., norleucine) or modified
peptide backbones, but retain the same basic chemical structure as
a naturally occurring amino acid. "Amino acid mimetics" refers to
chemical compounds having a structure that is different from the
general chemical structure of an amino acid, but that functions in
a manner similar to a naturally occurring amino acid.
[0025] There are various known methods in the art that permit the
incorporation of an unnatural amino acid derivative or analog into
a polypeptide chain in a site-specific manner, see, e.g., WO
02/086075. Amino acids may be referred to herein by either the
commonly known three letter symbols or by the one-letter symbols
recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
Nucleotides, likewise, may be referred to by their commonly
accepted single-letter codes.
[0026] "Polypeptide," "peptide," and "protein" are used
interchangeably herein to refer to a polymer of amino acid
residues. All three terms apply to amino acid polymers in which one
or more amino acid residue is an artificial chemical mimetic of a
corresponding naturally occurring amino acid, as well as to
naturally occurring amino acid polymers and non-naturally occurring
amino acid polymers. As used herein, the terms encompass amino acid
chains of any length, including full-length proteins, wherein the
amino acid residues are linked by covalent peptide bonds.
[0027] "In vitro synthesis" or "cell-free synthesis" refers to
synthesis of polypeptides or other macromolecules in a reaction mix
comprising biological extracts and/or defined reagents. The
reaction mix will comprise a template for production of the
macromolecule, e.g., DNA, mRNA, etc.; monomers for the
macromolecule to be synthesized, e.g., amino acids, nucleotides,
etc.; and co-factors, enzymes and other reagents that are necessary
for the synthesis, e.g., ribosomes, uncharged tRNAs, tRNAs charged
with native or non-native amino acids, polymerases, transcriptional
factors, etc.
[0028] "Polypeptide," "peptide," and "protein" are used
interchangeably herein to refer to a polymer of amino acid
residues. The terms apply to amino acid polymers in which one or
more amino acid residue is an artificial chemical mimetic of a
corresponding naturally occurring amino acid, as well as to
naturally occurring amino acid polymers and non-naturally occurring
amino acid polymer.
[0029] "Polypeptide synthesis reaction lysate" or "synthesis
reaction lysate" or "reaction lysate" or "lysate" is any cell
derived preparation comprising the components required for the
synthesis of polypeptides. The synthesis reaction lysate will
contain protein synthesis machinery, wherein such cellular
components are capable of expressing a nucleic acid encoding a
desired protein where a majority of the biological components are
present following lysis of the cells rather than having been
reconstituted. A lysate may be further altered such that the lysate
is supplemented with additional cellular components, e.g., amino
acids, nucleic acids, enzymes, etc. The lysate may also be altered
such that additional cellular components are removed following
lysis.
[0030] An "expression cassette" is a nucleic acid construct,
generated recombinantly or synthetically, with a series of
specified nucleic acid elements that permit transcription of a
particular polynucleotide sequence in a host cell or in a cell-free
transcription/translation system. An expression cassette may be
part of a plasmid, viral genome, or nucleic acid fragment.
[0031] Typically, an expression cassette includes a polynucleotide
to be transcribed (e.g., a polynucleotide sequence encoding a
polypeptide of interest), operably linked to a promoter (e.g., a T7
promoter from the T7 bacteriophage), which means the promoter
sequence is connected to the coding sequence in such a manner
(e.g., typically upstream from the coding sequence) that the
promoter can function to direct the proper transcription of the
coding polynucleotide sequence. Optionally, the expression cassette
may include additional elements such as a transcription enhancer, a
polyadenylation sequence, and a selection marker (e.g., a gene
encoding a protein that confers a drug-resistance to the host
cell). If desired, an expression cassette may further comprise a
gene encoding a reporter gene (e.g., a luciferase or a green
fluorescence protein) under the transcriptional control of the
promoter sequence upstream from the coding sequence.
[0032] The term "chemical composition," as used herein, encompasses
all aspects of the chemical make-up of a molecule. For instance,
when the "chemical composition" of a peptide is concerned, this
term refers to the primary amino acid sequence as well as any
chemical modification of the amino acid residues, such as the
presence (or absence) of a chemical group such as --NH.sub.2, --OH,
--COOH, --PO.sub.4, etc.
[0033] The term "profile," as used in the context of a peptide
derived from a protein known to exist in a cell-free synthesis
system, refers to not only the amount of the peptide, the chemical
position of the peptide, but also the relative amount of the
peptide to other peptides derived from the same protein. Similarly,
the "profile" of a protein encompasses the amount of the protein as
well as any chemical modification occurred to the protein.
[0034] The term "modification," when used herein to describe the
state of a peptide, refers to any change in chemical composition of
the peptide. In other words, a peptide is deemed to have been
"modified" if the primary amino acid sequence is different from
that expected from a naturally occurring full length protein
following enzymatic digestion, such as having at least one amino
acid residue missing (shortened peptide sequence), altered in
identity, at least one amino acid residue added (lengthened peptide
sequence), or the presence of any additional group on any of the
amino acid residues, which may be indicative of cleavage
(enzymatically or otherwise) or blocked cleavage, or a chemical
reaction such as oxidation/reduction,
phosphorylation/dephosphorylation taken place on the protein from
which the peptide has originated.
[0035] "Inhibitors," "activators," and "modulators" of a protein
are used to refer to inhibitory, activating, or modulating
molecules, respectively, identified using in vitro and in vivo
assays for the protein's biological activity such as binding or
signaling, e.g., ligands, agonists, antagonists, and their homologs
and mimetics. The term "modulator" includes inhibitors and
activators. Inhibitors are agents that, e.g., partially or totally
block the activity of a target protein. In some cases, the
inhibitor directly or indirectly binds to the target protein
Inhibitors, as used herein, are synonymous with inactivators and
antagonists. Activators are agents that, e.g., stimulate, increase,
facilitate, enhance activation, sensitize or up regulate the
activity of the target protein. Modulators include, but are not
limited to, antibodies and antibody fragments, antagonists,
agonists, small molecules including carbohydrate-containing
molecules, siRNAs, RNA aptamers, and the like. Assays for
inhibitors or activators of a target protein include, e.g.,
applying putative inhibitor compounds to a cell expressing the
protein and then determining the functional effects on the
biological activity of the protein in, e.g., binding, cellular
signaling, etc. Assays for inhibitors or activators also include
cell-free systems, where the samples in which the protein is
exposed to a potential inhibitor are compared to control samples
without the inhibitor to examine the extent of inhibition or
activation. Control samples (not treated with the test compounds)
are assigned a relative activity value of 100%. Inhibition is
achieved when the protein's activity relative to the control is
about 80%, 70%, 50%, 20%, 10% or close to 0%. Similarly, activation
is achieved when a test compound causes an increase in the
protein's activity by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90% or higher such as 1- to 2-fold, 5-fold, or even
10-fold, as compared to a control.
[0036] The term "cold shock protein" encompasses all naturally
occurring proteins that show an elevated level after 10 minutes at
15.degree. C. and have 95% homology to the amino acid sequences of
known cold shock proteins including cold shock-like protein CspE
(SwissProt ID P0A972), DNA-binding protein H-NS (SwissProt ID
P0ACF8), cold shock-like protein CspC (SwissProt ID P0A9Y6), and
HU-.beta. (SwissProt ID P0ACF4). The term "cold shock protein"
encompasses all homologs, orthologs, and variants of known cold
shock proteins, so long as they are specifically recognized by
polyclonal antibodies generated against any one of known cold shock
proteins such as those named above. Under designated immunoassay
conditions, the polyclonal antibodies specifically bind to a cold
shock protein at least two times the background and do not
substantially bind in a significant amount to other proteins
present in a test sample. For example, polyclonal antibodies raised
to the CspE protein can be selected to retain only those that
specifically immunoreactive with the CspE protein homologs,
orthologs, or allelic variants and not with other unrelated
proteins. This selection may be achieved by subtracting out
antibodies that cross-react with other proteins. A variety of
immunoassay formats may be used to select antibodies specifically
immunoreactive with a particular protein. For example, solid-phase
ELISA immunoassays are routinely used to select antibodies
specifically immunoreactive with a protein (see, e.g., Harlow &
Lane, Antibodies, A Laboratory Manual (1988), for a description of
immunoassay formats and conditions that can be used to determine
specific immunoreactivity). Typically, a specific or selective
reaction will provide at least twice background signal or noise,
and more typically more than 10 to 100 times over background.
[0037] As used herein, "a protein that stabilizes or enhances
energy molecules" is a protein that causes the increase in amount
and activity of energy molecules ATP, ADP, AMP, GTP, GDP, and GMP.
Examples of such proteins include adenylate kinase, ATP synthase
.alpha., and ATP synthase .beta.. Conversely, "a protein that
destabilizes or suppresses energy molecules" is a protein that
causes the reduction in amount and activity of energy molecules
ATP, ADP, AMP, GTP, GDP, and GMP. In particular, a protein that
dephosphorylates ATP, ADP, AMP, GTP, GDP, and GMP is such a
protein. Examples of such proteins include alkaline phosphatase,
adenylate cyclase, and acid phosphatase.
[0038] An "inactivating antibody" or "neutralizing antibody" is an
antibody or antibody fragment (e.g., an Fab fragment) that binds
specifically to a particular protein (such as a cold shock protein
described herein) and interferes with, reduces, or inhibits the
activity of this protein as compared to the sample without the
presence of such inactivating antibody. One example of such an
antibody is a neutralizing anti-fibroblast growth factor (FGF)
monoclonal antibody described by Shimada et al. (Clin. Cancer Res.
3897 2005;11(10) May 15, 2005).
DETAILED DESCRIPTION OF THE INVENTION
I. Introduction
[0039] The present invention provides methods useful for monitoring
the profile of components of in vitro polypeptide synthesis systems
and enhancing the production yield of such systems. The methods
involve the use of various means of protein analysis, such as
chromatography and mass spectrometry, to monitor changes in various
components (e.g., protein levels and/or modification, or
concentration of a metabolite etc.) within the cell-free synthesis
reaction. For example, profiles of various proteins are monitored
to indicate changes in their concentration as well as chemical
composition, such as changes in oxidation/reduction,
amination/deamination, phosphorylation/dephosphorylation, or
degradation. Also, other non-protein components of the cell-free
system, such as adenosine-5'-triphosphate (ATP), nicotinamide
adenine dinucleotide (NAD), nicotinamide adenine dinucleotide
phosphate (NADP), and coenzyme A (CoA), and acetyl CoA can be
monitored for changes in their concentration.
[0040] Such changes are then correlated with the recombinant
protein production capacity of the system to identify proteins that
potentially affect or regulate the productivity of the cell lysate,
as well as proteins that indirectly affect the cell lysate through
other components, protein or non-protein. For example, changes in
ATP during the course of recombinant protein synthesis may suggest
the depletion or suppressed activity of ATP-producing enzymes;
decreased phosphorylation of a protein may suggest heightened
activity of a phosphatase; and increased degradation of a protein
may suggest the increased activity of a protease. These "regulator"
proteins can subsequently be targeted to counter their negative
effects on the in vitro protein synthesis system, ultimately
augmenting the recombinant protein production by the system.
II. Reaction Lysate
[0041] The present invention is useful for in vitro production of
polypeptides by understanding limitations of the system in the
extent of activation of extract and also in the robustness of the
process by which it can be made reproducibly. Modifying the extract
production process will enhance the activity of the extract and
make it possible to make several batches of extract reproducibly
and reliably. The result is enhanced production of the polypeptide
desired to be produced by the in vitro reaction.
A. Lysate Preparation
[0042] The present invention involves a recombinant protein
production system based on a reaction lysate derived from a host
cell for in vitro translation of a target protein. Some embodiments
of the present invention are methods of monitoring in vitro
polypeptide synthesis that require the generation of a reaction
lysate in which the polypeptide will be recombinantly produced.
Other embodiments provide the reaction lysate as a composition as
described herein.
[0043] For convenience, the organism used as a source for the
lysate may be referred to as the source organism or host cell. Host
cells may be bacteria, yeast, mammalian or plant cells, or any
other type of cell capable of protein synthesis. A reaction lysate
comprises components that are capable of translating messenger
ribonucleic acid (mRNA) encoding a desired protein, and optionally
comprises components that are capable of transcribing DNA encoding
a desired protein. Such components include, for example,
DNA-directed RNA polymerase (RNA polymerase), any transcription
activators that are required for initiation of transcription of DNA
encoding the desired protein, transfer ribonucleic acids (tRNAs),
aminoacyl-tRNA synthetases, 70S ribosomes,
N.sup.10-formyltetrahydrofolate, formylmethionine-tRNAf.sup.Met
synthetase, peptidyl transferase, initiation factors such as IF-1,
IF-2, and IF-3, elongation factors such as EF-Tu, EF-Ts, and EF-G,
release factors such as RF-1, RF-2, and RF-3, and the like.
[0044] A bacterial lysate derived from any strain of bacteria can
be used in the methods of this invention. The bacterial lysate can
be obtained as follows. The bacteria of choice are grown up
overnight in any of a number of growth media and under growth
conditions that are well known in the art and easily optimized by a
practitioner for growth of the particular bacteria. For example, a
natural environment for synthesis utilizes cell lysates derived
from bacterial cells grown in medium containing glucose and
phosphate, where the glucose is present at a concentration of at
least about 0.25% (weight/volume), more usually at least about 1%;
and usually not more than about 4%, more usually not more than
about 2%. An example of such media is 2YTPG medium, however one of
skill in the art will appreciate that many culture media can be
adapted for this purpose, as there are many published media
suitable for the growth of bacteria such as E. coli, using both
defined and complex sources of nutrients. Cells that have been
harvested can be lysed by suspending the cell pellet in a suitable
cell suspension buffer, and disrupting the suspended cells by
sonication, breaking the suspended cells in a French press, or any
other method known in the art useful for efficient cell lysis. The
cell lysate is then centrifuged or filtered to remove large DNA
fragments.
[0045] Rabbit reticulocyte cells provide an example of a mammalian
cell type that may be used to generate a lysate. Reticulocyte
lysate is prepared following the injection of rabbits with
phenylhydrazine, which ensures reliable and consistent reticulocyte
production in each lot. The reticulocytes are purified to remove
contaminating cells, which could otherwise alter the translational
properties of final lysate. The cells can then be lysed by
suspending the cell pellet in a suitable cell suspension buffer,
and disrupting the suspended cells by sonication, breaking the
suspended cells in a French press, or any other method known in the
art useful for efficient cell lysis. After the reticulocytes are
lysed, the lysate is treated with micrococcal nuclease and
CaCl.sub.2 in order to destroy endogenous mRNA and thus reduce
background translation. EGTA is further added to chelate the
CaCl.sub.2 thereby inactivating the nuclease. Hemin may also be
added to the reticulocyte lysate because it is a suppressor of an
inhibitor of the initiation factor eIF2.alpha.. In the absence of
hemin, protein synthesis in reticulocyte lysates ceases after a
short period of incubation (Jackson, R. and Hunt, T. 1983 Meth. In
Enzymol. 96, 50). Potassium acetate and magnesium acetate are added
at a level recommended for the translation of most mRNA species.
For further detail on preparing rabbit reticulocyte lysate, one
skilled in the art can refer to, e.g., Sambrook et al., Molecular
Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. 1989).
[0046] Wheat germ provides a plant cell that may be used as a host
for which to generate a lysate that may be used by the methods of
the present invention. Generally, wheat germ lysate is prepared by
grinding wheat germ in an extraction buffer, followed by
centrifugation to remove cell debris. The supernatant is then
separated by chromatography from endogenous amino acids and plant
pigments that are inhibitory to translation. The lysate is also
treated with micrococcal nuclease to destroy endogenous mRNA, to
reduce background translation to a minimum. The lysate contains the
cellular components necessary for protein synthesis, such as tRNA,
rRNA and initiation, elongation, and termination factors. The
lysate is further optimized by the addition of an energy generating
system consisting of phosphocreatine kinase and phosphocreatine,
and magnesium acetate is added at a level recommended for the
translation of most mRNA species. For more detail on the
preparation of wheat germ lysate, see e.g., Roberts, B. E. and
Paterson, B. M. (1973), Proc. Natl. Acad. Sci. U.S.A. Vol. 70, No.
8, pp. 2330-2334), following the modifications described by
Anderson, C. W., et al., Meth. Enzymol. (Vol. 101, p. 635;
1983).
[0047] Lysates are also commercially available from manufacturers
such as Promega Corp., Madison, Wis.; Stratagene, La Jolla, Calif.;
Amersham, Arlington Heights, Ill.; and GIBCO, Grand Island,
N.Y.
B. Additional Components
[0048] The in vitro protein synthesis systems in the present
invention may include additional components to ensure the optimal
protein production. For instance, bacterial contamination of the
cell-free systems has many undesirable consequences and various
antibiotics may be added to the system to suppress or eliminate
bacterial proliferation. In some cases, one or more DNA gyrase
inhibitors belonging to the class of quinolones or aminocoumarins
can be used for this purpose. For more detailed description, see,
e.g., PCT Patent Application No. PCT/US2010/020727.
III. Monitoring Component Profile in an In Vitro Polypeptide
Synthesis System
[0049] In one aspect, the present invention relates to a method for
monitoring the profile of components within an in vitro polypeptide
synthesis system. The components being monitored may be proteins or
non-protein molecules known to be present in the cell-free
reaction.
A. Protein Digestion
[0050] If one or more proteins are to be monitored during the
course of in vitro protein synthesis, the first step is to digest
the protein(s) in order to generate small fragments of the
protein(s), typically peptides of 6-15 amino acids in length. A
number of proteases well known in the art and frequently used,
including trypsin, papain, Endoproteinase Glu-C, Endoproteinase
Lys-C, or chymotrypsin, that are suitable for the present
invention. These enzymes cleave a protein at known sites and
therefore generate fragments (peptides) of predictable amino acid
sequence and size.
[0051] In order to monitor changes in the profiles of one or more
proteins within the cell-free recombinant polypeptide synthesis
system, samples from the same system are taken at different time
points for analysis in an identical but parallel process. The
digestion of proteins is generally carried out according to methods
commonly practiced in the art.
B. Separating Peptides
[0052] Peptides in a sample can be separated using chromatography.
Typically, separation is based on differences in size, charge
(polarity), or hydrophobicity. With chromatography, the sample
components to be separated are distributed between two phases: a
stationary phase bed (column packing material) and a mobile phase
that percolates through the stationary phase. The various sample
components interact differently with the stationary phase, with
components that interact strongly being retained for a longer
periods on the column than components that do not interact or
interact weakly with the stationary phase. Thus, the components can
be separated and identified based on their respective elution time.
Many different chromatographic methods are available, including
size exclusion, ion exchange, and reverse phase, and can be used to
separate peptides generated after protein digestion.
[0053] Size exclusion chromatography (SEC) separates molecules
based on their size (hydrodynamic volume). When an aqueous solution
is used to transport the sample through the column, the technique
is known as gel filtration chromatography. Typically, the
stationary phase is a porous matrix. The smaller analytes can enter
the pores more easily and therefore spend more time in these pores,
increasing their retention time. Conversely, larger analytes spend
little if any time in the pores and are eluted quickly.
[0054] Ion exchange chromatography separates compounds according to
the nature and degree of their ionic charge. The column to be used
is selected according to its type and strength of charge. Anion
exchange resins have a positive charge and are used to retain and
separate negatively charged compounds, while cation exchange resins
have a negative charge and are used to separate positively charged
molecules.
[0055] Before the separation begins a buffer is pumped through the
column to equilibrate the opposing charged ions. Upon injection of
the sample, solute molecules (peptides, polypeptides or proteins)
will exchange with the buffer ions as each competes for the binding
sites on the resin. The length of retention for each solute depends
upon the strength of its charge. The most weakly charged compounds
will elute first, followed by those with successively stronger
charges. Temperature, pH, buffer type, and buffer concentration can
influence separation times.
[0056] Reverse phase chromatography is the name applied to the
chromatography technique where the stationary phase is relatively
more non-polar than mobile phase. Typically, the stationary phase
is made up of hydrophobic alkyl chains
(--CH.sub.2--CH.sub.2--CH.sub.2--CH.sub.3) that interact with the
analyte. Three chain lengths, C4, C8, and C18, are commonly used.
C4 is generally used for proteins with C8 and C18 used for peptides
and polypeptides. Small molecules are continuous partitioned
between the mobile phase and the hydrophobic stationary phase,
while polypeptides and proteins usually are too large to partition
into the hydrophobic phase and instead are adsorbed onto the
hydrophobic surface. Reverse phase chromatography systems usually
are run with a solvent gradient, so that as the mobile phase
becomes more non-polar, a critical concentration is reached that
causes desorption of the bound polypeptides and proteins. Once they
are desorbed, they elute down the column. Peptides may be thought
of as "sitting" on the stationary phase with most of the molecule
exposed to the mobile phase and only a part of the molecule--the
"hydrophobic foot"--in contact with the stationary phase surface.
Peptides can be separated based on subtle differences in the
"hydrophobic foot" of the polypeptides being separated. These
differences arise from differences in amino acid sequences and in
conformation.
[0057] High performance liquid chromatography (HPLC) or high
pressure liquid chromatography is a form of chromatography applying
high pressure to drive the solutes through the column faster. This
means that the diffusion is limited and the resolution is improved.
The three chromatography techniques described above can be run as
HPLC.
[0058] The peptides are typically detected as they elute from the
chromatography column using their absorbance at 280 nm. The various
chromatography techniques can also be coupled in-line with a mass
spectrometer.
C. Monitoring Changes in Profile
1. Detecting Changes
[0059] Once the peptides in a sample are separated, they may then
be analyzed using mass spectrometry (MS) to determine their
profile, which includes aspects such as their molecular mass,
chemical composition (amino acid sequence, the presence or absence
of additional chemical groups such as phosphate group in known
locations due to modification), and quantity. In some cases, a
marker molecule of known quantity may be added into a sample to
serve as a comparison basis to indicate the relative quantity of
one or more peptides. In label-free quantification, two or more
complex samples containing similar proteins in different amounts
can be compared by measuring the intensity of the same molecule in
two or more different samples. The same molecule is found in
multiple samples by following the accurate mass-to-charge ratio,
retention time and charge state of the molecule. The sample
processing and LC-MS analysis should be demonstrated to not induce
major changes in the intensity profiles of a control sample of
similar complexity. Systematic shifts in intensity or retention
time can be corrected by intensity normalization and retention time
alignment, if necessary. The ratio of the intensity of a given
molecule in one sample versus another then equals the relative
quantities of that molecule present in the two samples being
compared. Similarly, if the peptide being analyzed is modified, the
relative amounts of that modification can be also be determined. In
a similar fashion, non-protein components of a cell-free protein
synthesis system may be analyzed and monitored by mass
spectrometry, although for a small molecule (e.g., ATP) the
analysis will be substantially simpler in procedure than that for a
peptide.
[0060] Mass spectrometry is a technique used to identify molecules
based on their mass-to-charge ratios after these molecules are
ionized and accelerated in an electric field before being detected.
The mass spectrometer consists of 3 components--an ion source, a
mass analyzer and an ion detector. The sample to be analyzed is
introduced into the ion source where it is ionized. These ions are
then passed to the mass analyzer where they are separated according
to their mass-to-charge ratios and then go to the ion detector and
their presence is recorded and a mass spectrum is produced.
[0061] A number of different ionization methods are employed with
mass spectrometry. Typically, for biochemical analyses, the
ionization methods used are Electrospray Ionization (ESI) and
Matrix Assisted Laser Desorption Ionization (MALDI). Electrospray
ionization (ESI) and nanospray ionization, a low flow rate version
of ESI, are well-suited to the analysis of polar molecules ranging
from less than 100 Da to more than 1,000,000 Da in molecular
mass.
[0062] During electrospray ionization, the sample is dissolved in a
polar, volatile solvent and pumped through a narrow capillary. A
high voltage is applied to the tip of the capillary, which is
situated within the ionization source of the mass spectrometer, and
as a consequence of this strong electric field, the sample emerging
from the tip is dispersed as an aerosol of highly charged droplets.
This process is aided by nebulizing gas flowing around the outside
of the capillary that also helps to direct the aerosol towards the
mass spectrometer. The charged droplets diminish in size by solvent
evaporation. Eventually charged sample ions, free from solvent, are
released from the droplets, some of which pass through a sampling
cone into an intermediate vacuum region, and from there through a
small aperture into the analyser of the mass spectrometer, which is
held under high vacuum.
[0063] Matrix assisted laser desorption ionization (MALDI) works
well with thermolabile, non-volatile organic compounds especially
those of high molecular mass. It can be used for the analysis of
proteins, peptides, glycoproteins, oligosaccharides and
oligonucleotides. It is reasonably tolerant to buffers and other
additives and is capable of measuring masses to within 0.01% of the
molecular mass of the sample, at least up to ca. 40,000 Da. MALDI
is based on the bombardment of sample molecules with a laser light
to bring about sample ionization. The sample is pre-mixed with a
highly absorbing matrix compound for the most consistent and
reliable results, and a low concentration of sample to matrix works
best. The matrix transforms the laser energy into excitation energy
for the sample, which leads to sputtering of analyte and matrix
ions from the surface of the mixture. In this way energy transfer
is efficient and also the analyte molecules are spared excessive
direct energy that may otherwise cause decomposition. Most
commercially available MALDI mass spectrometers use a pulsed
nitrogen laser of wavelength 337 nm. MALDI is a "soft" ionization
method and so results predominantly in the generation of singly
charged molecular-related ions regardless of the molecular mass,
hence the spectra are relatively easy to interpret. Fragmentation
of the sample ions does not usually occur.
[0064] For peptide sequence analysis, tandem mass spectrometry
(MS-MS) is frequently used. In this method, typically, the mass
spectrometer has two analyzers separated by a collision cell. The
first analyzer is used to select user-specified sample ions arising
from a particular component; usually molecular-related (i.e.,
(M+H).sup.+ or (M-H).sup.-) ions. These chosen ions pass into the
collision cell where they are bombarded by molecules of an inert
gas (e.g., argon, xenon, nitrogen) that cause fragment ions to be
formed. These fragment ions are analyzed, i.e., separated according
to their mass to charge ratios, by the second analyzer. With MS-MS,
all the fragment ions arise directly from the precursor ions
specified in the experiment, and thus produce a fingerprint pattern
specific to the compound under investigation.
[0065] Peptide sequencing is possible by tandem mass spectrometry,
because peptides fragment in a reasonably well-documented manner
(P. Roepstorrf, J. Fohlmann, Biomed. Mass Spectrom., 1984, 11, 601;
R. S. Johnson, K. Biemann, Biomed. Environ. Mass Spectrom., 1989,
18, 945). There are three different types of bonds that can
fragment along the amino acid backbone: the NH--CH, CH--CO, and
CO--NH bonds. Each bond breakage gives rise to two species, one
neutral and the other one charged, and only the charged species is
monitored by the mass spectrometer. The charge can stay on either
of the two fragments depending on the chemistry and relative proton
affinity of the two species. Hence, there are six possible fragment
ions for each amino acid residue. The most common cleavage sites
are at the CO--NH bonds along the amino acid backbone that provide
sequence information. The extent of side-chain fragmentation
detected depends on the type of analyzers used in the mass
spectrometer.
[0066] Usually, peptides of approximately 2500 Da or less (i.e.,
less than 25 amino acids) produce the most useful data. Some
peptides can generate sufficient information for a full sequence to
be determined; others may generate a partial sequence of 4 or 5
amino acids, a sequence "tag" that is often sufficient to identify
the protein from a database. The accuracy of the technique is
sufficient to allow minor mass changes to be detected, e.g. the
substitution of one amino acid for another, a post-translational
modification or other chemical modification (such as glycosylation,
phosphorylation, oxidation, deletion of at least one amino acid,
etc.).
[0067] To ensure quality of the analysis, this step of the present
invention is typically practiced at a minimal accuracy level (for
example, at 10 ppm accuracy or greater) in a mass spectrometer.
2. Identifying a Source Protein
[0068] Upon determining the amino acid sequence of a peptide, it is
then possible to identify the "source protein," i.e., the full
length or parent protein from which the peptide has originated.
This identification process can be accomplished by aligning the
amino acid sequence of the peptide with a known protein sequence. A
100% match between the peptide sequence and a portion of the
protein sequence would then indicate the protein as the source
protein.
[0069] Methods of amino acid sequence alignment for comparison are
well-known in the art. Optimal alignment of sequences for
comparison can be conducted, e.g., by the local homology algorithm
of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the
homology alignment algorithm of Needleman & Wunsch, J. Mol.
Biol. 48:443 (1970), by the search for similarity method of Pearson
& Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by
computerized implementations of these algorithms (GAP, BESTFIT,
FASTA, and TFASTA in the Wisconsin Genetics Software Package,
Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by
manual alignment and visual inspection (see, e.g., Current
Protocols in Molecular Biology (Ausubel et al., eds. 1995
supplement)).
3. Interpretation of Changes
[0070] The change in amount of a peptide (and therefore its
corresponding protein, or the protein from which the peptide has
originated) in the cell-free system can be immediately determined
when the analysis as described above is completed with samples from
the same system at different time points. This change in protein
level, correlated with the state of production of the system,
provides valuable information as to the potential effects of this
protein on the system. Proteins that directly or indirectly
influence the production efficiency of the system can therefore be
identified.
[0071] In some cases, changes in peptide profile, such as increased
modification of a certain type (oxidation, phosphorylaion, cleavage
by protease), may provide indication that changes in the level
and/or activity of certain enzymes present in the cell-free system
are affecting the production rate of the system, which could then
suggest a means to counter the undesirable effects or to enhance
the desirable effects. As an example, the detection of a peptide
having an amino acid sequence shorter than the expected length
derived from digesting the source protein would indicate the
increased activity of a protease known to cleave the source protein
and generate the "clipped" fragment; whereas the detection of a
peptide longer than expected may suggest the presence of a molecule
bound to the source protein, therefore preventing the full
digestion of the source protein. In another example, when the ratio
of two peptides derived from the same source protein is seen to
deviate from an expected ratio (e.g., 1 to 1), the observation may
also indicate altered protease activity in the cell lysate or the
presence of a molecule bound to the source protein. In short,
changes observed in peptide profiles combined with knowledge of
other proteins, especially enzymes, present in the system will
allow one to identify the proteins relevant to the system's
production efficiency and therefore devise a means to maximize the
system's yield.
[0072] Changes in profile of other non-protein components of the
cell-free synthesis system will similarly provide indication of
relevance between certain proteins' level and activity and the
system's protein production rate, therefore allowing counter
measures to be taken to ensure the optimal yield of the in vitro
synthesis system.
IV. Modulating the Regulator Proteins
[0073] In another aspect, the present invention provides a means to
improve the production yield of an in vitro cell-free protein
synthesis system by modulating one or more of these so-called
regulator proteins, identified by the method described in the last
section as capable of directly or indirectly influencing the system
in its protein production rate. These proteins may include enzymes
that produce molecules of critical importance to the protein
production (e.g., ATP, CoA, acetyl CoA, NAD, NADP,
phosphatidylethanolamine), enzymes that modify (e.g.,
oxidize/reduce, aminate/deaminate, phosphorylate/dephosphorylate,
or degrade/cleave) key proteins in the system, proteins that
destabilize or decrease energy molecules (such as proteins that
dephosphorylate ATP, ADP, or AMP), or proteins that have a direct
or indirect effect on protein yield of the system (e.g., cold shock
protein CspA, CspE, DNA-binding protein HNS, cell division protein
ftsZ, or outer membrane protein ompA). Depending on their
particular effects on the system, these regulator proteins may be
referred to as "positive regulators" (whose level and/or activity
positively corresponds to the level of protein production) or
"negative regulators" (whose level and/or activity negatively
corresponds to the level of protein production). To maximize
protein production, steps may be taken to increase the positive
regulator protein(s) and/or to suppress the negative regulator
protein(s).
A. Increasing a Positive Regulator Protein
[0074] Once a protein is identified as a positive regulator by the
profile analysis as described above, efforts can be made to elevate
the presence, in amount and/or activity, of the protein in the
cell-free synthesis system. Several proteins have been recognized
as proteins that stabilize or increase the level and activity of
energy molecules (e.g., ATP, ADP, or AMP) and are therefore
considered positive regulator proteins. Examples include adenylate
kinase, ATP synthase .alpha., and ATP synthase .beta.. Various
means for achieving this goal include, but are not limited to,
introducing into the system an additional quantity of this protein
from an exogenous source; enhancing the expression of the protein
(e.g., introducing stronger promoters/enhancers, introducing
additional copies of the gene into cell genome); and augmenting the
protein's activity (e.g., by known activators or agonists).
[0075] The most straightforward method for increasing the presence
of a positive regulator in a cell-free system is to simply add more
of the protein into the system. The additional protein may be
isolated from a naturally occurring source or may be recombinantly
produced from another expression system.
[0076] In the alternative, a higher level of the positive regulator
protein may be achieved by promoting the protein's expression in
cultured cells before lysates are made from them or co-expressing
them in the cell-free system. Known compounds capable of
specifically boosting the gene expression may be used for this
purpose. Otherwise, genetic modifications can be made to produce
cells containing an elevated level of this protein and the cells
then used to produce lysate for in vitro protein synthesis. One
possible modification to cell genome is introducing a promoter
and/or enhancer that leads to increased transcription and
ultimately increased expression of the positive regulator protein.
The stronger promoter/enhancer may either replace the endogenous
promoter/enhancer, or may be introduced to act in addition to the
endogenous counterpart. Another possibility is to introduce
additional copy or copies of the gene encoding the positive
regulator protein, such that additional quantity of the protein
will be produced by the cells. Methods for genetic manipulation of
cellular genome and creating genetically modified cell lines are
well known in the art and also discussed in the sections below.
[0077] A further possibility of suppressing the effect of a
positive regulator protein on a cell-free protein synthesis system
is by adding known activators or agonists of the protein into the
cell lysate.
B. Suppressing a Negative Regulator Protein
[0078] Similarly, after a protein is identified as a negative
regulator by the profile analysis as described herein, efforts can
be made to eliminate or suppress the presence, in amount and/or
activity, of this protein in the cell-free synthesis system.
Proteins that destabilize or suppress the level or activity of
energy molecules, for example, proteins that dephosphorylate ATP,
ADP, or AMP, are such negative regulator proteins. Various means
for achieving this goal include, but are not limited to,
interference with the expression of the protein (e.g., by
disrupting its genomic sequence or transcription/translation
mechanism) and inhibition of the protein's activity (e.g., by known
inhibitors or antagonists such as neutralizing antibodies).
1. Inhibitory Nucleic Acids
[0079] Inhibiting the expression of a negative regulator protein
(e.g., a cold shock protein) in the cells that are used later for
making cell lysates for the in vitro protein synthesis system can
be achieved through the use of inhibitory nucleic acids. Inhibitory
nucleic acids can be single-stranded nucleic acids or
oligonucleotides that can specifically bind to a complementary
nucleic acid sequence. By binding to the appropriate target
sequence, an RNA-RNA, a DNA-DNA, or RNA-DNA duplex or triplex is
formed. These nucleic acids are often termed "antisense" because
they are usually complementary to the sense or coding strand of the
gene, although recently approaches for use of "sense" nucleic acids
have also been developed. The term "inhibitory nucleic acids" as
used herein, refers to both "sense" and "antisense" nucleic
acids.
[0080] In one embodiment, the inhibitory nucleic acid can
specifically bind to a target polynucleotide. Administration of
such inhibitory nucleic acids can minimize the negative effect of a
cold shock protein on a cell-free protein synthesis system by
reducing or eliminating the expression of the cold shock protein.
Nucleotide sequences encoding the cold shock proteins are known for
several species, including cold shock-like protein CspE (SwissProt
ID P0A972), DNA-binding protein H-NS (SwissProt ID P0ACF8), cold
shock-like protein CspC (SwissProt ID P0A9Y6), Adenylate kinase
(SwissProt ID P69441), HU-.beta. (SwissProt ID P9ACF4), and ATP
synthase. Other regulator proteins such as cell division protein
ftsZ (Swiss-Prot ID P0A9A6) and outer membrane protein A (ompA,
Swiss-Prot ID P0A910) are also known in their protein and encoding
polynucleotide sequences. One can derive a suitable inhibitory
nucleic acid from these particular cold shock proteins, their
species homologs, and variants of these sequences.
[0081] By binding to the target nucleic acid, the inhibitory
nucleic acid can inhibit the function of the target nucleic acid.
This could, for example, be a result of blocking DNA transcription,
processing or poly(A) addition to mRNA, DNA replication,
translation, or promoting inhibitory mechanisms of the cells, such
as promoting RNA degradation Inhibitory nucleic acid methods
therefore encompass a number of different approaches to altering
expression of specific genes that operate by different mechanisms.
These different types of inhibitory nucleic acid technology are
described in Helene and Toulme (1990) Biochim. Biophys. Acta.,
1049:99-125.
[0082] Inhibitory nucleic acid approaches can be classified into
those that target DNA sequences, those that target RNA sequences
(including pre-mRNA and mRNA), those that target proteins (sense
strand approaches), and those that cause cleavage or chemical
modification of the target nucleic acids.
[0083] Approaches targeting DNA fall into several categories.
Nucleic acids can be designed to bind to the major groove of the
duplex DNA to form a triple helical or "triplex" structure.
Alternatively, inhibitory nucleic acids are designed to bind to
regions of single stranded DNA resulting from the opening of the
duplex DNA during replication or transcription. See Helene and
Toulme, supra.
[0084] More commonly, inhibitory nucleic acids are designed to bind
to mRNA or mRNA precursors. Inhibitory nucleic acids are used to
prevent maturation of pre-mRNA. Inhibitory nucleic acids may be
designed to interfere with RNA processing, splicing or translation.
The inhibitory nucleic acids are often targeted to mRNA. In this
approach, the inhibitory nucleic acids are designed to specifically
block translation of the encoded protein. Using this approach, the
inhibitory nucleic acid can be used to selectively suppress
translation of mRNA encoding critical proteins. For example, an
inhibitory antisense nucleic acid complementary to regions of a
target mRNA inhibits protein expression (see, e.g., Wickstrom et
al. (1988) Proc. Nat'l. Acad. Sci. USA 85:1028-1032 and
Harel-Bellan et al. (1988) Exp. Med., 168:2309-2318). As described
in Helene and Toulme, supra, inhibitory nucleic acids targeting
mRNA have been shown to work by several different mechanisms in
order to inhibit translation of the encoded protein(s).
[0085] The inhibitory nucleic acids introduced into the cell can
also encompass the "sense" strand of the gene or mRNA to trap or
compete for the enzymes or binding proteins involved in mRNA
translation. See Helene and Toulme, supra.
[0086] The inhibitory nucleic acids can also be used to induce
chemical inactivation or cleavage of the target genes or mRNA.
Chemical inactivation can occur by the induction of crosslinks
between the inhibitory nucleic acid and the target nucleic acid
within the cell. Alternatively, irreversible photochemical
reactions can be induced in the target nucleic acid by means of a
photoactive group attached to the inhibitory nucleic acid. Other
chemical modifications of the target nucleic acids induced by
appropriately derivatized inhibitory nucleic acids may also be
used.
[0087] Cleavage, and therefore inactivation, of the target nucleic
acids can be effected by attaching to the inhibitory nucleic acid a
substituent that can be activated to induce cleavage reactions. The
substituent can be one that effects either chemical, photochemical
or enzymatic cleavage. For example, one can contact an
mRNA:antisense oligonucleotide hybrid with a nuclease which digests
mRNA:DNA hybrids. Alternatively cleavage can be induced by the use
of ribozymes or catalytic RNA. In this approach, the inhibitory
nucleic acids would comprise either naturally occurring RNA
(ribozymes) or synthetic nucleic acids with catalytic activity.
[0088] Inhibitory nucleic acids can also include RNA aptamers,
which are short, synthetic oligonucleotide sequences that bind to
proteins (see, e.g., Li et al. (2006) Nuc. Acids Res. 34: 6416-24).
They are notable for both high affinity and specificity for the
targeted molecule, and have the additional advantage of being
smaller than antibodies (usually less than 6 kD). RNA aptamers with
a desired specificity are generally selected from a combinatorial
library, and can be modified to reduce vulnerability to
ribonucleases, using methods known in the art.
2. Inactivating antibodies
[0089] Inhibition of the activity of a negative regulator protein
such as a cold shock protein can be achieved with an inactivating
antibody or neutralizing antibody. An inactivating antibody can
comprise an antibody or antibody fragment that specifically binds
to the target protein, thereby interfering with the normal activity
of the protein. Inactivating antibody fragments include, e.g., Fab
fragments, heavy or light chain variable regions, single
complementary determining regions (CDRs), or combinations of CRDs
with target protein-binding activity.
[0090] Any type of inactivating antibody may be used according to
the methods of the invention. The antibody can be derived from any
appropriate organism, e.g., mouse, rat, rabbit, gibbon, goat,
horse, sheep, etc.; or it can be a chimeric antibody derived from
two different species. The inactivating antibodies, which can be
polyclonal or monoclonal antibodies, are added into a cell-free
system to counter the undesirable effects of a negative regulator
protein. Polyclonal and monoclonal antibodies can be generated by
any method known in the art.
3. Modification of a Genomic Sequence
[0091] Inhibition of a negative regulator protein can also be
achieved by genetically modifying the genomic sequence encoding
this protein in the cells that are to be used for producing the
cell lysate, such that the protein expression is abolished or
reduced in amount, or the expressed protein has no or diminished
activity. Possible modifications include, but are not limited to,
deletions (partial or complete), substitutions (e.g., point
mutations), or insertions within the open reading frame (ORF) of
the gene, as well as similar manipulations within the non-coding
region, such as the upstream region from ORF, where elements
responsible for transcription (e.g., promotor and enhancer) are
located.
[0092] A variety of mutation-generating protocols are in the art,
and can be readily used to modify a polynucleotide sequence
encoding a regulator protein for the cell-free system. See, e.g.,
Zhang et al., Proc. Natl. Acad. Sci. USA, 94: 4504-4509 (1997); and
Stemmer, Nature, 370: 389-391 (1994). The procedures can be used
separately or in combination to produce variants of a set of
nucleic acids, and hence variants of encoded polypeptides. Kits for
mutagenesis, library construction, and other diversity-generating
methods are commercially available.
[0093] Methods for producing genetically modified cell lines are
described and frequently practiced in the art. For instance,
retroviral vectors or other integration vectors can be used to
introduce a polynucleotide sequence into a hose cell genome so that
the target genomic region is modified, e.g., replaced, deleted, or
otherwise disrupted. The design of retroviral vectors and other
integration vectors is well known to those of ordinary skill in the
art. Preparation of retroviral vectors and their uses are described
in many publications including, e.g., European Patent Application
EPA 0 178 220; U.S. Pat. No. 4,405,712; Gilboa, Biotechniques
4:504-512 (1986); Mann et al., Cell 33:153-159 (1983); Cone and
Mulligan, Proc. Natl. Acad. Sci. USA 81:6349-6353 (1984); Eglitis
et al., Biotechniques 6:608-614 (1988); Miller et al.,
Biotechniques 7:981-990 (1989); and WO 92/07943.
[0094] In some cases, the genetically modified cells will harbor a
selection marker introduced during the modification process, such
that the modified cells can be readily selected from their parent,
unmodified cells.
4. Removal of Negative Regulator Proteins
[0095] As a further alternative, negative regulator proteins can be
physically removed from the cell lysate to eliminate their
inhibitory effect on protein synthesis. For example, a negative
regulator protein may be removed from a cell lysate by passing the
lysate through a column on which an antibody that specifically
binds the negative regulator protein has been immobilized.
[0096] As another example, cells to be used for making lysate may
be genetically modified using methods mentioned in the previous
sections such that the genomic sequence encoding the negative
regulator protein now includes a "tag" or a partner in an
affinity-based binding pair, which permits quick and easy removal
of the negative regulator protein from the system. The tags are
typically placed at the protein's N- or C-terminus.
[0097] A frequently used affinity tag is a multi-Histidine tag
(e.g., 6x His), which has an affinity towards nickel or cobalt
ions. If one immobilizes nickel or cobalt ions on a solid carrier,
such as a resin column, the His-tagged negative regulator proteins
can be easily depleted from a cell lysate by running the lysate
through the column. Such techniques are well known in the art, and
His-tag vectors are commercially available from manufacturers such
as Qiagen (Valencia, Calif.), Roche Applied Science (Rotkreuz,
Switzerland), Biosciences Clontech (Palo Alto, Calif.), Promega
(San Luis Obispo, Calif.), and Thermo Scientific (Rockford,
Ill.).
[0098] Similar to the His tag, other affinity tags can be fused to
a negative regulator protein, which allows rapid removal of the
protein by immunoaffinity based separation technique such as
immunoaffinity chromatography. Exemplary tags may include, but are
not limited to, Green Fluorescent Protein (GFP) tag,
Glutathione-S-transferase (GST) tag, and the FLAG-tag tag.
Immunoaffinity chromatography methods are well known in the art.
For more detail on either affinity or immunoaffinity
chromatography, see, e.g., Affinity Chromatography: Principles
& Methods (Pharmacia LKB Biotechnology 1988); and Doonan,
Protein Purification Protocols (The Humana Press 1996).
EXAMPLES
[0099] The following examples are provided by way of illustration
only and not by way of limitation. Those of skill in the art will
readily recognize a variety of non-critical parameters that could
be changed or modified to yield essentially the same or similar
results.
Example 1
Sampling and Analysis of Pre-incubation Time Points
[0100] FIG. 1 shows the protein yields for rhGM-CSF (Granulocyte
macrophage colony stimulating factor) obtained during a 5 hr
cell-free synthesis reaction from extracts prepared as a function
of different pre-incubation times for 3 different extracts. An
optimal pre-incubation time of ca. 2.5 hours is required to fully
activate the extract. Without pre-incubation the extract is
inactive (at time 0).
[0101] High throughput proteomic profiling of individual
preincubation time point samples was carried out as follows. A
96-well plate sample preparation method was developed for reducing,
alkylating, proteolysing and desalting the various time point
samples. Digested peptides were separated and analyzed on an HPLC
system interfaced to an electrospray ionization quadrupole-time of
flight (ESI-QTOF 6520 from Agilent Technologies, Santa Clara,
Calif.) mass spectrometer. Sixty LC-MS/MS experiments were
conducted to identify 2000 proteins in these extracts. Software
from Agilent Technologies was beta-tested for label-free
differential quantification of identified proteins. Global changes
in oxidation, deamidation, and proteolysis were monitored. The
effects of upstream processing variables on extract performance
were then correlated with the composition and dynamics of the
proteome.
Example 2
LC-MS Analysis of Extract Proteome to Identify Changing Protein
Levels
[0102] Five microliters of bacterial extract was sufficient to
profile .about.2000 proteins by 1DLC-MS without need for 2D
separation. Label-free differential profiling based quantification
was validated with spiked proteins. Related co-efficients of
variation for sample processing and LC-MS were within 15% for
majority of measurements. No retention time correction or intensity
normalization was required due to high retention time and signal
stability over multiple runs. Overall, a state-of-the-art sample
preparation as well as LC-MS and LC-MS/MS based relative
quantification platform was developed and validated for profiling
.about.2000 proteins in crude bacterial lysates using commercially
available hardware and software. Initially, about 400 proteins were
profiled in the extracts. The majority of the proteins such as
elongation factor Tu, elongation factor G, elongation factor Ts,
pyruvate dehydrogenase, tRNA synthetases, chaperonins, 50 s and 30
s ribosomal proteins don't change in concentration. Comparison of
several extracts including extract 3_13 and production runs 1, 2, 4
and 5 suggest that the translation machinery related proteins such
as ribosomal proteins, elongation factors and initiation factors
are at comparable levels in these samples.
[0103] Only few proteins were observed to change dramatically
during pre-incubation in a background of several hundred proteins
that did not change significantly in levels (FIG. 2). During the
pre-incubation step before cell-free transcription and translation,
the levels of these proteins decreased and corresponded to the
activation of translation.
[0104] The most dramatic change in levels was observed in 3
proteins from the cold shock family. These were CspC, CspE and DNA
binding HNS protein. An additional cold shock related protein HU
was also found to decrease.
[0105] Cold shock proteins are known to be involved in the
adaptation of cells at lower temperatures. These proteins bind to
DNA/ribosomes and inhibit transcription/translation (Gualerzi et
al., J. Mol. Biol (2003) 331, 527-539). Several experiments were
conducted to understand if these changes were just an unrelated
consequence of pre-incubation or whether these cold shock proteins
were playing a significant role in extract activation by
pre-incubation. The analysis of these proteins was pursued to
understand if these cold shock proteins were being produced in
cells during fermentation or whether they were induced by the
processing of extracts done at cold temperatures.
Example 3
Addition of Cold Shock Proteins Inhibits Cell-Free Protein
Synthesis
[0106] Cold shock proteins CspE and HNS were cloned and
overexpressed in the cell-free system. Crude preparations of CspE
and H-NS synthesized using cell-free reaction were added to a
cell-free reaction to produce green fluorescent protein (GFP). A
negative control was done using crude preparation of GM-CSF
synthesized during cell-free reaction and added to a GFP cell-free
reaction. The negative controls showed that the crude lysate
background did not have any inhibitory effect with the no plasmid
and the GMCSF lysates. However, the added crude lysates with
expressed cold shock proteins were found to inhibit the cell-free
reaction (FIG. 3). In the crude lysates experiment the maximum
amount of HNS and CspE present was limited by their expression
level, thus full inhibition was not observed. To see full
inhibition these proteins were expressed in larger scale and
purified. The pure protein was checked by LC-MS for correct intact
mass. Addition of pure CspE to the cell-free reaction inhibits
cell-free synthesis (FIG. 4).
Example 4
Introduction
[0107] E. coli cell-free protein synthesis (CFPS), which uses
extract prepared from cells, can direct most, if not all, of the
metabolic resources of the cell towards the exclusive production of
the desired protein. However, the prepared extracts are inactive
and require a pre-incubation step to activate
transcription/translation processes, commonly referred to as the
translation "run-off reaction" or "pre-incubation." It is believed
that this activation process involves freeing of ribosomes bound to
endogenous mRNAs. Contrary to this belief, in this disclosure the
present inventors show that the inactive extract contains free
ribosomes as evidenced by the synthesis of polyphenylalanine, and
that pre-incubation is required even after removal of endogenous
mRNAs. In the absence of hypotheses, using global label-free
proteomic profiling of the extract, the inventors have discovered
that activation results from the removal of cold shock proteins
(CSPs) CspE, CspC, CspA, and H-NS, well known inhibitors of protein
synthesis. Involvement of CSPs in the process was confirmed by the
observation that pure protein preparations inhibit in-vitro protein
synthesis and their deletion from the parent strain results in
faster activation and higher protein synthesis activity. It is
further shown that the cell harvesting and extract preparation
process, typically performed at temperatures below 15.degree. C.,
evokes a cold shock response and that the rapid chilling of cells
leads to a robust high-yield protein production. In summary,
experimental data presented herein provides new insight into the
cell-free extract pre-incubation process which involves removal of
the family of transcription/translation inhibitory factors, the
cold shock proteins. This is the first known instance where
in-depth unbiased proteomic profiling by LC-MS is successfully used
to help develop a robust, commercial-scale bioprocess.
[0108] Cell-free protein synthesis is a commonly used biochemical
tool in biological research and played a significant role in
deciphering the genetic code (Nirenberg 2004 Trends Biochem Sci
29:46-54). More recently, it has become a powerful alternative to
cell-based techniques for laboratory scale to commercial scale
synthesis of not only small proteins but functional antibodies
(Jermutus et al., 1998 Curr Opin Biotechnol 9: 534-48; Kanter et
al., 2007 Blood 109: 3393-9). In-vitro protein synthesis platform
offers several advantages over conventional methods, including
expression of toxic proteins (Orth et al., 2011 Toxicon 57:
199-207), incorporation of non-natural amino acids (Noren et al.,
1989 Science 244: 182-8; Kodama et al., 2010 J Biochem 148:
179-87), use of PCR fragment or mRNA as a template and
high-throughput screening of gene products (Sawasaki et al., 2002
FEBS Lett 514: 102-5). Since the description of an in-vitro system
in the early 1960s (Nirenberg 1963. Methods Enzymol 6: 17-23),
there have been several attempts to understand the factors that
influence the performance of the system (Calhoun and Swartz 2005
Biotechnol Prog 21: 1146-53; Jackson et al., 1983 FEBS Lett 163:
221-4). However, most of the effort has been devoted to improving
the protein yield by optimizing message or supply of reagents or
extending the applications of this technique. There has been no
systematic effort on mechanistic understanding of the requisite
pre-incubation process, commonly referred to as "the run-off
reaction" (Nirenbuerg 2004 supra; Liu et al., 2005. Biotechnol Prog
21: 460-5). This process takes 80-160 min to complete, depending on
the temperature, and is presumed to be required for the removal of
endogenous message from polysomes. However, this presumption seems
untenable considering that the inactive extract contains mostly
free 70S ribosomes and subunits with relatively small amount of
polysomes (Liu et al., supra; Chliamovitch and Anderson 1972. FEBS
Lett 23: 83-6). The current hypothesis is that the process possibly
involves removal of certain inhibitory factors, or activation of
factors required for transcription/translation. (Liu et al.,
supra). In this study, the inventors applied label-free
differential proteomic profiling to investigate the role of protein
factors in the activation process. Their study shows that the CSPs
are a significant inhibitory factor and their removal leads to
activation.
Methods
[0109] Cell free extract preparation--Cell-free extracts were
generated from high cell density cultures of E. coli strain KGK10,
as described by Zawada et al., supra. Briefly, rapidly growing
cells were harvested at mid-log phase by cooling recirculation
through a heat exchanger for over an hour until the temperature
reached below 10.degree. C. The cells were then pelleted in a
pre-cooled (4.degree. C.) centrifuge and washed with ice cold S30
buffer, followed by homogenization and clarification by
centrifugation to yield an inactive cell-free extract. A modified
"run-off procedure" (Liu et al., supra; Schindler et al., 2000
Electrophoresis 21: 2606-9) was used to activate the cell-free
extract. To investigate the role of endogenous message in run-off
reactions, extract was incubated with 150 U/ml of Staphylococcus
aureus nuclease (EMD chemicals, Gibbstown, N.J., USA) and 1 mM
calcium chloride for up to 60 min at 30.degree. C. (Pelham and
Jackson 1976. Eur J Biochem 67: 247-56).
[0110] Cell free protein synthesis--The inventors used cell-free
expression of rhGM-CSF, a 15 kD 4-helix bundle human cytokine, to
monitor the protein synthesis activity of the extract (Zawada et
al., supra). Reactions were run at 30.degree. C. containing 8 mM
magnesium glutamate, 10 mM ammonium glutamate, 130 mM potassium
glutamate, 35 mM sodium pyruvate, 1.2 mM AMP, 0.86 mM each of GMP,
UMP, & CMP, 2 mM amino acids (1 mM for tyrosine), 4 mM sodium
oxalate, 1 mM putrescine, 1.5 mM spermidine, 15 mM potassium
phosphate, 100 nM T7 RNA polymerase, 2-50 nM DNA template(s), 1-10
.mu.M E. coli DsbC, and 33% (v/v) IAM-treated cell-free extract
(Zawada et al., supra). Yields of soluble rhGM-CSF were monitored
by 14C leucine incorporation as described by Zawada et al.,
supra.
[0111] For polyphenylalanine synthesis, 0.4 mg/ml of polyuridylic
acid (Sigma, St. Louis, USA) was used as a template instead of
plasmid. For studying the effect of cold shock proteins on in-vitro
translation, highly purified cold shock proteins were added at the
beginning of the cell-free reaction at the indicated
concentrations.
[0112] Label free differential proteomic profiling--Extract samples
collected during the pre-incubation process were centrifuged and
denatured with 6 M guanidine hydrochloride followed by reduction
(10 mM DTT) and alkylation (25 mM iodoacetic acid). Digestion was
performed with modified porcine trypsin (Promega, Madison, USA) by
overnight incubation at 37.degree. C. Desalting was performed on
Sep-Pak tC18 96 well solid phase extraction plate (Waters, Milford,
USA). Samples were analyzed by liquid chromatography (Agilent 1200
Rapid Resolution) coupled to qTOF mass spectrometer (Agilent 6520).
Peptides were separated on reverse phase column (Zorbax SB 18,
50.times.3 mm) with 0.1% formic acid in water (solvent A) and 0.1%
formic acid in acetonitrile (solvent B) at flow rate of 0.5 ml/min.
Gradient was as follows: 0-2 min--2% B, 40 min--45% B, 40.01
min--90% B, 45 min--90% B, 45.01-55 min--2% B. The mass
spectrometer was operated in positive ionization mode with ESI
voltage 4000 V, source temperature 325.degree. C., nebulizer gas 35
psi and fragmentor voltage 160 V. For generating peptide library,
the mass spectrometer was operated in MS/MS mode with the 6 most
intense precursor ions selected for fragmentation. A total of 64
MS/MS runs with split mass ranges were performed with the peptides
identified in the previous MS/MS run/s excluded from the analysis
in the subsequent MS/MS runs. Peptide MS/MS data was searched
against E. coli K12 database (UnprotKB/Swiss-Prot) using Spectrum
Mill.RTM. software version A.03.03 (Agilent, Santa Clara, USA). For
creating an in-house peptide database containing chemical formula,
mass and RT, identified peptides were assigned a chemical formula
by using Software tool Molecular Weight Calculator V6.46 (website:
omics.pnl.gov/software/MWCalculator.php).
[0113] For profiling studies, the mass spectrometer was operated in
MS mode with scanning range of 300-1700 amu and data was searched
against the described in-house peptide library for peak finding,
extraction and integration using MassHunter.RTM. software Version
B.03.01 (Agilent, Santa Clara, Calif.). The processed data was
further analyzed and visualized by Mass Profiler Professional.RTM.
version 2.0 (Agilent, Santa Clara, Calif., USA).
[0114] Deletion of cold shock proteins--The .DELTA.cspE,
.DELTA.cspE+.DELTA.cspA, .DELTA.cspE+.DELTA.cspA+.DELTA.cspC, and
.DELTA.cspE+.DELTA.cspA+.DELTA.hns mutant strains were constructed
by P1 phage transduction of the gene deletion mutants from the Keio
collection of E. coli K-12 mutants with in-frame, single-gene
knock-outs (16) obtained from The Coli Genetic Stock Centre (CGSC)
at Yale University. The single-gene mutant strains .DELTA.cspA,
.DELTA.cspC, .DELTA.cspE and .DELTA.hns are CGSC# 10603, 9515,
11860 and 9111, the respective genes of which were replaced by
kanamycin resistant genes. P1 phage lysate from these single-gene
knock-out mutants was transduced into the target strains in this
study. Kanamycin resistant recombinant strains were isolated and
gene deletion in the mutant strain was confirmed by colony PCR
using a pair of primers which are designed according to the
sequences upstream and downstream of the deleted gene. Then
kanamycin resistant gene was eliminated by using a FLP recombinase
encoding plasmid, 706-FLP (Gene Bridges, Heidelberg, Germany).
After elimination of the antibiotic resistant gene, the next gene
deletion can be introduced into the mutant strain and selected by
the same method.
[0115] Cold shock protein expression and purification--The genes
encoding CspA, CspE and H-NS were amplified using E. coli strain
A19 genomic DNA as templates. A hexa-His tag encoding sequence and
a SGG short linker encoding sequence were ligated to the 5'-end of
the cold shock protein genes by PCR primer extension. The primer
sequences used to amplify the cold shock protein genes include
5'-ATATATCATATGCATCACCATCACCATCACAGCGGTGGCTCCGGTAAAATGACTGGT
ATCGTAAAATGGTTCAACG-3' and
5'-ATATATGTCGACTTACAGGCTGGTTACGTTACCAGCTGCCG-3' for CspA
5'-ATATATCATATGCATCACCATCACCATCACAGCGGTGGCTCTAAGATTAAAGGTAAC
GTTAAGTGGTTTAATGAGTCCA-3' and
5'-ATATATGTCGACTTACAGAGCGATTACGTTTGCAGCAGAAGGGC-3' for CspE,
5'-ATATATCATATGCATCACCATCACCATCACAGCGGTGGCAGCGAAGCACTTAAAATT
CTGAACAACATCCGTACTC-3' and
5'-ATATATGTCGACTTATTGCTTGATCAGGAAATCGTCGAGGGATTTACC-3' for H-NS.
After PCR amplification, the DNA was purified using QIAGEN PCR
purification spin column and digested by restriction enzymes, NdeI
and SalI. The restriction digested DNA was ligated into our
expression vector pYD317, which is a high-copy number plasmid with
a T7 RNA polymerase controlled expression cassette. The cspC gene
was synthesized (DNA 2.0, Menlo Park, Calif., USA) and subcloned
into pYD317.
[0116] CSPs were expressed using cell-free reactions (100 ml) and
purified by FPLC (Akta Explorer 100) by IMAC (Ni Sepharose 6 FF, GE
Healthcare Bio-Sciences Corp, Piscataway, USA) with a linear
gradient of 20 mM imidazole to 350 mM imidazole in 50 mM Tris-HCl
buffer (pH 7.9) containing 350 mM NaCl. The pooled fractions
containing protein were further purified by anion exchange
chromatography (Q Sepharose FF, GE Healthcare Bio-Sciences Corp,
Piscataway, USA) using a linear gradient of 0 M NaCl to 1 M NaCl in
S30 buffer. Fractions containing proteins were pooled and
concentrated using centricon.RTM. centrifugal filters (3 kDa MW
cut-off). The purity of the concentrated proteins was checked by
sodium dodecyl sulphate-polyacrylamide gel electrophoresis and
exact mass was determined by reverse phase liquid
chromatography-mass spectrometry (LC-qTOF, Agilent, San Jose,
USA).
[0117] Analysis of nucleotides by HPLC--Samples (30 .mu.L) were
acidified with 20 .mu.L of 150 mM H.sub.2SO.sub.4 and mixed,
followed by centrifugation at 20,800 g for 10 minutes at 4.degree.
C. Supernatant was collected and analyzed by HPLC using a hybrid
anion exchange/reversed phase column (Vydac 302IC 4.6.times.250 mm,
10 .mu.m, with the guard column of the same material). Mobile Phase
A: 10 mM sodium phosphate (1:1 Na.sub.2HPO.sub.4:NaH.sub.2PO.sub.4)
adjusted to pH 2.8 with glacial acetic acid. Mobile Phase B: 125 mM
sodium phosphate (1:1 Na.sub.2HPO.sub.4:NaH.sub.2PO.sub.4) adjusted
to pH 2.9 with glacial acetic acid. Separation was performed using
following gradient, 0-2 min--0% B, 10 min--20% B, 22 min--100% B,
28 min--100% B. Flow rate was 2 ml/min and the UV absorbance was
measured at 260 nm. Absolute concentration was determined using
standard curves.
Results
[0118] Activation of cell-free extracts for in-vitro protein
synthesis--Cell-free extracts were prepared from E. coli strain
KGK10 (Zawada et al., supra). These extracts require pre-incubation
prior to in-vitro protein synthesis. The yield of a model protein,
rhGM-CSF producted at 5 hrs of cell-free reaction, was measured,
where the reaction is linear with time (Zawada et al., supra), as a
function of the time and temperature of the pre-incubation step, as
shown in FIG. 5. The activation process is temperature dependent
with full activation in as much as 10 min at 42.degree. C. compared
to 150 min at 30.degree. C. Even though the rate of activation
varies at different temperatures, the maximal yield is not
significantly different. The activity decreases after full
activation with highest decrease at 42.degree. C., possibly due to
non-specific protein precipitation or inactivation of critical
factors, and is not the focus of this study. The available time
window for harvesting fully activated extract during incubation is
smaller at higher temperature. Moreover, a small change in the
extract preparation method could change the profile significantly
making it a hard to control process. This is particularly important
for large-scale production. Therefore, the inventors typically
activate their extracts at 30.degree. C. for 150 min.
[0119] The pre-incubation process is thought to be required for the
completion of run-off to free-up the ribosomes from endogenous
message (Nirenberg 1963 supra) which in turn would lead to
dissociation of polysomes into 70 S ribosomes and subunits.
However, according to a recent report, the extract mainly contains
70S ribosomes and subunits with a relatively small amount of
polysomes and the change in ribosome profile does not correlate
with activity (Liu et al., supra). The authors of the same report
also observed that the run-off reaction is complete within 20 min
but full activation requires longer time suggesting that the
freeing of ribosomes in not the only mechanism of activation.
Moreover, background protein synthesis should occur if the run-off
reaction is ongoing. The inventors did not detect background
protein synthesis in their extract during the activation
process.
[0120] Some researchers have tried nuclease treatment to remove
endogenous message (Hofbauer et al., Eur J Biochem 122: 199-203;
Ehrenfeld and Brown 1981. J Biol Chem 256: 2656-61). For the
extract in this invention, however, removal of endogenous message
by nuclease (Staphylococcus aureus) treatment did not change the
activation profile relative to control (FIG. 6A). Thus, it appears
that the pre-incubation process involves factors other than just
the disassociation of polysomes by run-off of endogenous mRNAs.
[0121] One possible factor is the inactivation of transcription
during extract preparation which requires heat to reactivate. If
this were the case, the non-incubated extract would be unable to
transcribe from a DNA template. To determine this, the inventors
measured mRNA synthesis in incubated extract and non-incubated
extract. Synthesis of mRNA was detected in non-incubated extract,
though at a lower level than fully activated extract, suggesting
that pre-incubation is not required for transcription per se (FIG.
6B). It appears that the transcription process is active. Moreover,
when the cell-free protein synthesis reactions were carried out
using purified mRNA of rhGM-CSF instead of plasmid, the
non-incubated extract did not synthesize protein. Thus it is
translation that requires pre-incubation for activation (FIG.
6C).
[0122] Following this, the inventors decided to probe the status of
translation in the non-incubated extract. When polyuridylic acid
(UUUn) was used, which lacks a start codon and can be translated by
ribosomes without initiation, interestingly, non-incubated extract
was able to synthesize polyphenylalanine (FIG. 6D). This suggests
that the ribosomes are capable of elongation of new message and may
not be engaged with the endogenous message. Also, the incubation
process appears to negatively affect the elongation process as
judged by decreasing yields. Translation of polyuridylic acid is
not affected by the factors that affect initiation or if the
translation is blocked at the initiation step (Clark 1980. Proc
Natl Acad Sci U S A 77: 1181-4; Agafonov et al., 2001. EMBO Rep 2:
399-402). Thus, these data suggest that the initiation step of
protein synthesis is blocked and it is this particular step of
translation that requires pre-incubation.
[0123] It has been hypothesized that the activation process
probably involves activation or deactivation of certain factors
that are involved in protein synthesis. For example, transcription
regulator AraC has previously been reported to degrade during the
run-off reaction (Zubay 1973. Annu Rev Genet 7: 267-87). However,
this hypothesis and in general, the process of activation has not
been tested systematically.
[0124] With the advent of modern systems biology approaches to
analysis of biological samples and processes, the inventors have
undertaken a global analytical approach to understand the complex
nature of in vitro transcription and translation. In this report, a
unique proteomic profiling approach was used to investigate the
changes that occur during the run-off reaction. Global metabolite
profiling was also conducted.
[0125] Proteomic analysis of pre-incubation process--Proteomics can
be used to characterize a very complex system and obtain
information about the composition and dynamics of the proteome.
There are several methods for doing proteomic analysis and
selecting the one that best suits the problem at hand is important.
The inventors have developed a unique approach of performing
label-free proteomic profiling, which involves generation of an
in-depth peptide library containing accurate mass and retention
time data obtained from MS/MS analysis. The experimental samples
are then analyzed in MS mode and searched against the generated
library, thereby, yielding a reliable intensity value for almost
all of the peptides queried in every sample run on LC-MS. This
relative quantification method offers reliable detection of changes
in the levels of more than 1500 proteins represented by 7200 unique
peptides with median coefficient of variation (CV) of 8.4%, the
smallest CV ever reported in a proteome-wide study (FIG. 7A).
[0126] The different functional categories of proteins detected are
shown in FIG. 7B. Using this method, the extract proteome was
profiled during pre-incubation process at 0, 2.5 and 5 h at
30.degree. C. corresponding to the initial, maximal, and late
pre-incubation process shown in FIG. 5. An ANOVA analysis was
conducted to see the consistent trends in 3 independent extracts.
Among all the profiled proteins, only cold shock protein E (CspE),
cold shock protein C (CspC), DNA binding protein H-NS (H-NS),
adenylate kinase, ATP synthase, outer membrane protein A (ompA),
and cell division protein FtsZ were found to decrease significantly
and consistently (FIG. 7C and FIG. 7D). Cold shock proteins CspE
and H-NS showed strongest decline at 2.5 h, which corresponds to
the full activation time. Interestingly, proteins CspE, CspC and
H-NS all belong to cold shock family of proteins, which are known
to interact and inhibit cellular transcription and translation
machinery (Hofweber et al., 2005 FEBS J272: 4691-702), thus for the
first time pointing to this phenomenon as an important player in
extract activation process.
[0127] The decrease in the levels of cold shock proteins could be
correlated with the activation profiles at different temperatures
(FIG. 8). For H-NS, peptides close to C-terminus decreased while
other peptides remained stable during the incubation. H-NS is a
known substrate of OmpT protease with a cleavage site (K87-R90)
near the C-terminus. The fact that the extract of this invention
contains this protease and that the inventors observed clipping of
exogenous H-NS at the OmpT cleavage site suggests that H-NS is
subjected to proteolysis during pre-incubation. Similarly, the
protein sequences of adenylate kinase (ADK) and ATP synthase have
OmpT protease sites (KR, RR, RK, RA, KA) and the decrease in the
levels of these proteins shown in e FIG. 7C could also be due to
OmpT proteolysis. However, the protein sequences of CspE and CspC
do not have OmpT cleavage sites.
[0128] An alternative mechanism for loss of CSPs lacking OmpT
cleavage sites during the pre-incubation could be due to
precipitation as has been observed previously (Liu et al., supra).
It was suggested that the removal of protein synthesis inhibitory
factors by precipitation could possibly be one of the mechanisms of
extract activation. During the pre-incubation process,
precipitation of some material was observed and the amount of
precipitate increased with time. The precipitate was collected by
centrifugation and subjected to proteomic analysis. The CSPs were
found to be present in the precipitate and the amount present in
precipitate increased with the pre-incubation time. It is unclear
as to why these proteins precipitate when present in extract as
precipitation of purified proteins in solution is not observed. It
is hypothesized that CSPs co-precipitate with RNA/DNA and/or
membrane vesicles during incubation.
[0129] These data drew the inventors' attention to established
extract production processes and the possibility of cold shock
induction during cell harvesting. For the extracts analyzed by
proteomics, the cell harvesting process involved recirculation of
cells through the heat exchanger for over an hour until the
temperature reached below 10.degree. C. The cells were then
centrifuged in a pre-cooled (4.degree. C.) centrifuge and washed
with ice cold S30 buffer followed by homogenization. Extracts
produced using this process showed variable pre-incubation profiles
and at times gave low yields. The entire process which takes
several hours could elicit cold stress response resulting in
variable induction of transcription/translation inhibitory
CSPs.
[0130] In order to investigate the role of cold stress during
harvesting on the extract activity, the cells were rapidly
harvested and cooled down to 4.degree. C. (within 10 min) also
using a heat exchanger but without slow recirculation. The extracts
produced using the fast cooling process showed highly consistent
pre-incubation profiles (FIG. 9A). Interestingly, the extract
activity showed an inverse relationship to CSP levels (FIG. 9B)
with the extract prepared from fast cooled cells showing
significantly lower CSP levels (p-value <0.001) and high protein
synthesis activity compared to the extract prepared from slow
cooled cells. The CSP levels in the extract prepared from fast
cooled cells were higher than extract prepared from the quenched
cells (5 ml broth quenched in 20 ml of methanol:water, 80:20 v/v,
pre-cooled to -80.degree. C.), suggesting that even fast cooled
cells experience some cold stress. Unfortunately, due to the volume
limitations (minimum 30 ml) of the industrial scale homogenizer,
extract from the quenched cells (5 ml volume) could not be
prepared.
[0131] Comparison of global proteomic analysis of non-incubated and
2.5 h incubated extract prepared with the fast cooling process is
shown in FIG. 9C. Again the cold shock proteins CspE/C and H-NS
were found to decrease the most. In these extracts, CspA, a
transiently induced major cold inducible protein, seems to be
absent or possibly below the detection limits as evidenced by the
absence of the unique peptides from this protein that had
previously been detected in extracts prepared by slow cooling.
[0132] Inhibition of cell-free protein synthesis by purified cold
shock proteins--Purified CSPs have been previously shown to inhibit
in-vitro coupled transcription-translation of cold shock and
non-cold shock proteins (Hofweber et al., 2005. FEBS J272:
4691-702; Bae et al., 1999. Mol Microbiol 31: 1429-41). In order to
confirm that the CSPs exhibit similar activity in the extracts of
this invention, rhGM-CSF synthesis was performed in the presence of
various concentrations of purified CSPs (FIG. 10). At lower
concentrations, H-NS and CspA showed increased protein synthesis
with H-NS showing as much as 45% stimulation at 3.6 .mu.M
level.
[0133] At higher concentrations, inhibition of protein synthesis
was observed for all the proteins studied. At 114 .mu.M
concentration, 87%, inhibition was observed for H-NS while CspA and
CspE showed 87% and 93% inhibition at 237 .mu.M and 324 .mu.M
concentration. H-NS showed the strongest biphasic response of
stimulation and inhibition. For CspA, the results of this study are
in line with a previous report (Hofweber et al., supra), which
showed 50% inhibition of chloramphenicol acetyltransferase
expression in E. coli cell-free system by T. maritime CspA at 140
.mu.M concentration. For CspE, 50% inhibition of rGM-CSF expression
was observed at approximately 160 .mu.M concentration, which is
higher than earlier report of 37% and 72% inhibition of CspA
expression at 12 and 24 .mu.M concentration, respectively. The
difference in the inhibition concentration could be product
dependent, with inhibition of CSP expression by other CSPs being
the strongest as csps are known to repress the expression of other
csps in cells (Bae et al., supra). While the concentration of CspE
and H-NS in the cold-shocked E. coli cells in not known, CspA has
been estimated to be present at approximately 100 .mu.M
concentration during cold shock (Jiang et al., 1997. J Biol Chem
272: 196-202). Hence, the concentrations that showed in-vitro
inhibition of protein synthesis in this study are in the
physiological range.
[0134] Deletion of cold shock proteins CspE, CspC, CspA and
H-NS--Single, double and triple deletion mutant strains were
created by deleting CspE (.DELTA.cspE), both CspE and CspA
(.DELTA.cspE+.DELTA.cspA), the three proteins CspE, CspA and CspC
(.DELTA.cspE+.DELTA.cspA+.DELTA.cspC) and another combination of
three proteins, CspE, CspA and H-NS
(.DELTA.cspE+.DELTA.cspA+.DELTA.hns). Pre-incubation profiles of
extracts prepared from these mutants, except for
.DELTA.cspE+.DELTA.cspA+.DELTA.hns strain which showed no activity,
are shown in FIG. 11. Parent strain extract was fully activated by
2.5 h which is typical for these extracts. However, mutants
exhibited changes in the activation profile with mutants
.DELTA.cspE and .DELTA.cspE+.DELTA.cspA yielding higher activity
while mutants .DELTA.cspE+.DELTA.cspA+.DELTA.cspC and
.DELTA.cspE+.DELTA.cspA+.DELTA.hns performing poorly.
Interestingly, .DELTA.cspE+.DELTA.cspA mutant was fully activated
by 1 h with almost double the activity compared to the parent
strain. This confirms the hypothesis that the CSPs are inhibitory
and their removal leads to decreased inhibition and faster
activation. This is the first report of a significant and
reproducible change in the extract activation profile caused by
deletion of a protein, a possible inhibitory factor.
[0135] Pre-incubation is not required for activation of nucleotide
triphosphate synthesis--Energy required for cell-free protein
synthesis can be supplied using nucleotide monophosphates owing to
their fast and efficient conversion into nucleotide triphosphates
(Calhoun and Swartz, supra). Since nucleotide monophosphates were
used as the energy source in the system of this study, nucleotide
analysis was performed to see if non-incubated extracts are
incapable of synthesizing nucleotide triphosphates and if
incubation is required to activate their synthesis. During the
cell-free reaction of both non-incubated and incubated extract, ATP
and other nucleotides are rapidly generated from the supplied
nucleotide monophosphates. This suggests that the pre-incubation
process is not required for the activation of synthesis of ATP and
other nucleotides required for transcription and translation.
Deletion of CSPs did not cause any change in the time-concentration
profiles of these nucleotides. Therefore, earlier activation of
.DELTA.cspEA extract cannot be correlated to faster energy
generation.
Discussion
[0136] In this report, the present inventors applied a systems
approach, differential proteomic profiling, to discover cold shock
proteins as primary inhibitors of in-vitro protein synthesis in E.
coli. Considering the complexity of the transcription and
translation process, and the absence of hypothesis, a global
approach was appropriate. The unique label-free proteomic profiling
method developed utilized an accurate mass and retention time
database of more than 7,000 peptides representing over 1500
proteins built by untargeted MS/MS. The list of identified peptides
was then queried in the raw MS data for ion intensities. The
analysis was still "untargeted" in nature, as the peptide library
was built in an unbiased fashion. This analysis allowed for
proteome-wide differential profiling with raw ion intensities,
giving more representative ion statistics as opposed to methods
such as spectral counting. At the same time, it obviated the need
for special software for label-free quantification. Overall, this
method offers a highly robust and simple path for all laboratories
with mass spectrometry capabilities with limited software resources
to conduct differential proteome profiling of hundreds to thousands
of proteins.
[0137] The finding of the involvement of cold shock proteins in
extract activation using such a systems approach is significant in
that it challenges a well-accepted but inadequately supported
hypothesis that the inactivity of prepared E. coli extracts is due
to engagement of ribosomes with endogenous message. It also
corroborates the power of a systems approach when no reliable
hypothesis exists or the hypothesis that exists seems untenable.
The important impact of chilling proved to be one of the critical
factors in the successful development of a robust process for
commercial scale in-vitro synthesis of a wide spectrum of
proteins/peptides which are difficult/impossible to synthesize
using cell-based methods. This study serves as a unique application
of systems biology analysis for industrial-scale process
development.
[0138] In-vitro protein synthesis was demonstrated in early 1960's
(Nirenberg 1963, supra). Since then, the technique, particularly
for the E. coli system, has evolved tremendously as a biochemical
tool as well as an alternative to conventional cell-based
techniques for commercial protein production. E. coli cell-free
extract preparation involves fermentation, cell harvesting, lysis
and clarification. The cell collection and downstream processing
steps are typically carried out at lower temperature
(.about.10.degree. C.) to preserve cellular machinery and
ribosomes. Interestingly, the extract produced is unable to
synthesize proteins and warming is required. It has been proposed
that the ribosomes are engaged with the endogenous message and that
they need to be dissociated from it for accepting exogenous
message. However, the possible effect of cold stress, which is
well-known to block protein synthesis, on extract activity has been
completely ignored in the context of extract production.
[0139] The present inventors provide experimental evidence that the
cold shock proteins are induced during this process and
pre-incubation activates protein synthesis. Their study is the
first to shows that the cold shock proteins are selectively
removed, possibly by precipitation/proteolysis, during this warming
up step and their removal correlates with the activation of protein
synthesis.
[0140] It is well established that cold shock proteins are induced
when E. coli cells are subjected to a temperature of 15.degree. C.
or below which is commonly referred to as "cold shock" (Phadtare
2004. Curr Issues Mol Biol 6: 125-36). During the cold stress, the
expression of these proteins inversely correlates with the global
protein synthesis rate (Horn et al., 2007. Cell Mol Life Sci 64:
1457-70). Synthesis of non-cold shock proteins is almost completely
blocked during the peak induction of CSPs and protein synthesis
resumes when the CSPs drop to near pre-cold shock levels. This is
not surprising considering that these proteins are known to inhibit
both transcription and translation processes (Hofweber, supra). The
CSPs appear to be induced due to the cold stress they are
inadvertently subjected to during cell harvesting and extract
preparation processes, causing the inhibition of in-vitro protein
synthesis.
[0141] One way to reduce the cold stress and induction of CSPs
would be to harvest the cells as fast as possible. In our hands,
faster harvesting at even lower temperatures in 15-20 min led to
improved extract activity, with no change in activation profile.
However, even with a fast harvesting, CSPs are still induced,
albeit to a lower level and are still removed during the
pre-incubation. The deletion of genes encoding several CSPs was
attempted to decrease the need for activation and not surprisingly,
resulted in both faster activation and significantly higher protein
synthesis activity compared to the extract made with the wild-type
strain.
[0142] The findings presented here on cold shock proteins as
primary inhibitors of in-vitro protein synthesis are supported by
published reports. At cold temperatures, translation initiation is
known to be blocked while the elongation of already initiated
protein continues for 25 min, followed by accumulation of 70S
monosomes and subunits (Friedman et al., 1971. J Mol Biol 61:
105-21; Broeze et al., 1978. J Bacteriol 134: 861-74). Therefore,
in the absence of new protein synthesis, the elongation of already
initiated message should be completed during the extract
preparation process, which takes more than 2 hrs. This in turn
should result in dissociation of polysomes. Indeed, the prepared
extract does contain free ribosomes (Liu et al., supra). This is
further supported by the fact that our non-incubated extract can
synthesize polyphenylalanine. Moreover, no background protein
synthesis was detected using non-incubated extract and even after
nuclease treatment, which should remove endogenous message, the
extract could not be activated.
[0143] It was concluded that the endogenous message is not an
interfering factor that needs to be removed by pre-incubation. It
was proposed then that the term "run-off" reaction be replaced by
"pre-incubation" or "activation step" when describing cell-free
protein synthesis extract activation.
[0144] The fact that the non-preincubated extract is able to
synthesize mRNA and is also able to elongate polyphenylalanine
suggests that the initiation step of translation is blocked, which
interestingly is proposed to be involved in translation inhibition
by cold shock proteins.
[0145] In summary, CSPs are induced during harvesting and extract
preparation processes carried out at cold temperatures and they
block in-vitro coupled transcription/translation. These inhibitory
factors are removed during the so called "run-off reaction" and
their removal not only corresponds to the activation of
translation, but is directly responsible for activating the
extract.
[0146] All patents, patent applications, and other publications,
including GenBank Accession Numbers, cited in this application are
incorporated by reference in the entirety for all purposes.
* * * * *