U.S. patent application number 14/801172 was filed with the patent office on 2016-01-14 for fractionation of oil-bearing microbial biomass.
The applicant listed for this patent is Solazyme, Inc.. Invention is credited to Anthony G. Day, Harrison F. Dillon, Dan Elefant, Scott Franklin, Jon Wittenberg.
Application Number | 20160010025 14/801172 |
Document ID | / |
Family ID | 43223055 |
Filed Date | 2016-01-14 |
United States Patent
Application |
20160010025 |
Kind Code |
A1 |
Dillon; Harrison F. ; et
al. |
January 14, 2016 |
Fractionation of Oil-Bearing Microbial Biomass
Abstract
The invention generally relates to the production of hydrocarbon
compositions, such as a lipid, in microorganisms. In particular,
the invention provides methods for extracting, recovering,
isolating and obtaining a lipid from a microorganism and
compositions comprising the lipid. The invention also discloses
methods for producing hydrocarbon compositions for use as
biodiesel, renewable diesel, jet fuel, and other materials.
Inventors: |
Dillon; Harrison F.; (San
Mateo, CA) ; Elefant; Dan; (Pacifica, CA) ;
Day; Anthony G.; (San Francisco, CA) ; Franklin;
Scott; (Woodside, CA) ; Wittenberg; Jon; (San
Mateo, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Solazyme, Inc. |
South San Francisco |
CA |
US |
|
|
Family ID: |
43223055 |
Appl. No.: |
14/801172 |
Filed: |
July 16, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14055763 |
Oct 16, 2013 |
9115332 |
|
|
14801172 |
|
|
|
|
13322435 |
Feb 14, 2012 |
8580540 |
|
|
PCT/US2010/036238 |
May 26, 2010 |
|
|
|
14055763 |
|
|
|
|
61181252 |
May 26, 2009 |
|
|
|
Current U.S.
Class: |
435/173.7 ;
554/206 |
Current CPC
Class: |
C11C 3/04 20130101; Y02E
50/13 20130101; C12P 7/649 20130101; C12P 7/6463 20130101; Y02T
50/678 20130101; C11B 1/106 20130101; C11B 1/10 20130101; C11C
3/003 20130101; C10L 1/026 20130101; Y02E 50/10 20130101 |
International
Class: |
C11B 1/10 20060101
C11B001/10; C11C 3/04 20060101 C11C003/04 |
Claims
1. A method of extracting a lipid from a recombinant microalga, the
method comprising the steps of: (a) lysing recombinant microalgal
cells to produce a lysate, wherein the recombinant microalgal
cells: (i) have not been subjected to a drying step between
culturing and lysing; and (ii) contain a lipid; (b) treating the
lysate with an organic solvent for a period of time, wherein the
organic solvent is an alcohol selected from methanol, ethanol,
isopropanol or butanol; and (c) separating the treated lysate into
layers comprising a lipid layer and an aqueous layer and,
optionally, a lipid:aqueous emulsion layer, and/or a cell pellet;
and (d) removing the lipid from the other layer(s).
2-4. (canceled)
5. The method of claim 1, wherein the lysing is accomplished by
subjecting the recombinant microalgal cells to heating, sonication,
mechanical lysis, osmotic shock, expression of an autolysis gene,
exposure to pH above 8, exposure to an acidic pH, heating and
exposure to an acidic pH, or digestion with an enzyme.
6-10. (canceled)
11. The method of claim 1, wherein the recombinant microalga
produces a lipid with a lipid profile comprising at least 4%
C8-C14.
12-15. (canceled)
16. The method of claim 1, wherein step (d) comprises reducing the
temperature of the mixture to below 25.degree. C.
17. (canceled)
18. The method of claim 1, wherein the recombinant microalga is of
the genus Chlorella or Prototheca.
19-36. (canceled)
37. The method of claim 1, wherein the recombinant microalgal cells
comprise lipid that is at least 10% C14 triacylglycerols, at least
10% C12 triacylglycerols, or at least 10% C10 triacylglycerols.
38. The method of claim 1, wherein the lysing is accomplished by
subjecting the recombinant microalgal cells to sonication.
39. The method of claim 1, wherein the recombinant microalgal cells
comprise a polynucleotide encoding a sucrose invertase or a lipid
pathway enzyme.
40. The method of claim 39, wherein the polynucleotide encodes a
sucrose invertase.
41. The method of claim 39, wherein the polynucleotide encodes a
lipid pathway enzyme.
42. The method of claim 41, wherein the lipid pathway enzyme is a
fatty acyl-ACP thioesterase.
43. The method of claim 39, wherein the recombinant microalgal
cells comprise one or more polynucleotides encoding a sucrose
invertase and a lipid pathway enzyme.
44. The method of claim 43, wherein the lipid pathway enzyme is a
fatty acyl-ACP thioesterase.
45. The method of claim 18, wherein the recombinant microalga is of
the genus Chlorella.
46. The method of claim 45, wherein the recombinant microalga is
Chlorella protothecoides, Chlorella emersonii, Chlorella
sorokiniana or Chlorella minutissima.
47. The method of claim 46, wherein the recombinant microalga is
Chlorella protothecoides.
48. The method of claim 18, wherein the recombinant microalga is of
the genus Prototheca.
49. The method of claim 48, wherein the recombinant microalga is
Prototheca wickerhamii, Prototheca stagnora, Prototheca
portoricensis, Prototheca moriformis, or Prototheca zopfii.
50. The method of claim 49, wherein the recombinant microalga is
Prototheca moriformis.
51. The method of claim 39, wherein the polynucleotide is
codon-optimized for expression in the microalgal cells.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 14/055,763, filed Oct. 16, 2013, which is a continuation of
U.S. application Ser. No. 13/322,435, filed Feb. 14, 2012, now U.S.
Pat. No. 8,580,540, which is a US National Stage Application of
PCT/US2010/036238, filed May 26, 2010, which claims the benefit
under 35 U.S.C. 119(e) of U.S. Provisional Application No.
61/181,252, filed May 26, 2009, each of which is incorporated
herein by reference in its entirety for all purposes.
REFERENCE TO A SEQUENCE LISTING
[0002] This application includes an electronic sequence listing in
a file named "466557-Sequence.txt", created on Jul. 16, 2015 and
containing 170,526 bytes, which is hereby incorporated by reference
in its entirety for all purposes.
FIELD OF THE INVENTION
[0003] The invention generally relates to the production of oil
compositions, such as a lipid, in microorganisms. In particular,
the invention provides methods for extracting, recovering,
isolating and obtaining a lipid from a microorganism and
compositions comprising the lipid. The invention also discloses
methods for producing hydrocarbon or lipid compositions for
production of biodiesel, renewable diesel, jet fuel, and lipid
surfactants having various carbon chain lengths, including C8, C10,
C12 and C14.
BACKGROUND OF THE INVENTION
[0004] Fossil fuel is a general term for buried combustible
geologic deposits of organic materials, formed from decayed plants
and animals that have been converted to crude oil, coal, natural
gas, or heavy oils by exposure to heat and pressure in the earth's
crust over hundreds of millions of years.
[0005] Fossil fuels are a finite, non-renewable resource. With
global modernization in the 20th and 21st centuries, the thirst for
energy from fossil fuels, especially gasoline derived from oil, is
one of the causes of major regional and global conflicts. Increased
demand for energy by the global economy has also placed increasing
pressure on the cost of hydrocarbons. Aside from energy, many
industries, including plastics and chemical manufacturers, rely
heavily on the availability of hydrocarbons as a feedstock for
their manufacturing processes. Alternatives to current sources of
supply could help mitigate the upward pressure on these raw
material costs.
[0006] Lipids for use in biofuels can be produced in
microorganisms, such as algae, fungi, and bacteria. Typically,
manufacturing a lipid in a microorganism involves growing
microorganisms, such as algae, fungi, or bacteria, which are
capable of producing a desired lipid in a fermentor or bioreactor,
isolating the microbial biomass, drying it, and extracting the
intracellular lipids.
[0007] There is a need for a process for extracting lipids from
microorganism which solves the above problems of low efficiency and
high cost of lipid extraction from microorganism. The present
invention provides a solution to these prior art problems.
BRIEF SUMMARY OF THE INVENTION
[0008] In one aspect, the present invention is directed to a method
of extracting a lipid from a microorganism. In one embodiment, the
method comprises lysing a cultured microorganism that has not been
subjected to a drying step between culturing and lysing, and which
contains a lipid, to produce a lysate, treating the lysate with an
organic solvent for a period of time sufficient to allow the lipid
from the microorganism to become solubilized in the organic
solvent, and separating the lysate into layers comprising a
lipid:organic solvent layer and an aqueous layer, whereby the lipid
is extracted from the microorganism.
[0009] In another aspect, the present invention is directed to a
composition comprising a lipid isolated from a microorganism, and
an oil obtained from a source other than the microorganism. In some
cases, the ratio of the lipid to the oil is between 1 and 100. In
other cases, the ratio of the lipid to the oil is between 1 and 10.
In some embodiments, the lipid comprises at least 50% of a C18:1
lipid, or at least 10% of a C12 and C14 lipid combined.
[0010] In another aspect, the present invention is directed to a
method of producing biodiesel. In one embodiment, the method
comprises lysing a lipid-containing microorganism to produce a
lysate, treating the lysate with an organic solvent for a period of
time sufficient to allow the lipid from the microorganism to become
solubilized in the organic solvent, separating the lysate into a
lipid:organic solvent composition and an aqueous composition and,
optionally, an emulsified composition and/or cell pellet
composition, removing the lipid:organic solvent composition from
the aqueous composition, emulsion composition, or cell pellet
composition, and transesterifying the lipid:organic solvent
composition to produce biodiesel. In some cases, the biodiesel
meets or exceeds the ASTM D6751 biodiesel standard and/or the EN
14214 biodiesel standard. In one embodiment, the microorganism is
not subjected to a drying step.
[0011] In some embodiments of the biodiesel production method at
least 20% w/v of total lipid from the microorganism is C18:1. In
one embodiment, the layers further comprise a lipid:aqueous
emulsion layer and/or a cell pellet. Transesterification of the
lipid:organic solvent can be performed without substantially
separating the lipid from the organic solvent.
[0012] In still another aspect, the present invention is directed
to a method of producing renewable diesel. In one embodiment, the
method comprises lysing a lipid-containing microorganism to produce
a lysate, treating the lysate with an organic solvent for a period
of time sufficient to allow the lipid from the microorganism to
become solubilized in the organic solvent, separating the lysate
into a lipid:organic solvent composition and an aqueous composition
and, optionally, an emulsified composition and/or cell pellet
composition, removing the lipid:organic solvent composition from
the aqueous composition, emulsion composition, or cell pellet
composition, and treating the lipid:organic solvent composition to
produce a straight chain alkane renewable diesel product. In some
cases, the renewable diesel meets or exceeds the ASTM D 975
standard.
[0013] In various embodiments of the renewable diesel production
method, the microorganism has not been subjected to a drying step.
In some cases, treating the lipid:organic solvent composition is
performed without substantially separating the lipid from the
organic solvent. In some embodiments, treating the lipid:organic
solvent composition comprises hydrotreating, hydroprocessing, or
indirect liquefaction.
[0014] In another aspect, the present invention is directed to a
method of producing a jet fuel. In one embodiment, the method
comprises lysing a lipid-containing microorganism to produce a
lysate, treating the lysate with an organic solvent for a period of
time sufficient to allow the lipid from the microorganism to become
solubilized in the organic solvent, separating the lysate into a
lipid:organic solvent composition and an aqueous composition and,
optionally, an emulsified composition or cell pellet composition,
removing the lipid:organic solvent composition from the aqueous
composition, emulsion composition, or cell pellet composition,
treating the lipid:organic solvent composition to produce a
straight chain alkane, and cracking the straight chain alkane to
produce the jet fuel product.
[0015] In various embodiments of the jet fuel production method,
the microorganism has not been subjected to a drying step. In some
cases, treating the lipid:organic solvent composition is performed
without substantially separating the lipid from the organic
solvent. In some embodiments, treating the lipid:organic solvent
composition is performed by flowing the lipid:organic solvent
composition to a fluid catalytic cracking zone, and can further
comprise contacting the lipid:organic solvent composition with a
catalyst at cracking conditions. In one embodiment, treating the
lipid:organic solvent composition is performed by
hydrodeoxygenating the lipid:organic solvent composition. In some
cases, the method further comprises subjecting the
hydrodeoxygenated lipid:organic solvent composition to
isomerization.
[0016] In another aspect, the present invention is directed to a
method of extracting lipid from a microorganism by contacting a
microorganism containing a lipid with an acid to produce a lysate,
separating the lysate into layers comprising an aqueous layer and a
lipid:aqueous emulsion layer, and extracting lipid from the
emulsion layer.
[0017] In various embodiments of the method of extracting lipid
from a microorganism, the microorgansism is contacted with the acid
to produce an acid concentration of 5-200 mN, and contacting the
microorganism can be performed above 25.degree. C. In various
embodiments, an organic solvent is added to the microorganism or
lysate before, simultaneously with, or after contacting the
microorganism with the acid. In some cases, the microorganism is
contacted with an acid at a pH of no more than 4, at a pH of no
more than 3, or at a pH of no more than 2. In some embodiments, in
addition to contacting the microorganism with the acid, one or more
additional methods of lysing the microorganism is also utilized. In
some cases, contacting the microorganism with the acid is performed
at a temperature of 50-160.degree. C. In other cases, the step of
contacting the microorganism with the acid is performed at a
temperature of 20-65.degree. C. In one embodiment, the lipid is
extracted from the emulsion by contacting the emulsion with an
organic solvent, whereby the lipid partitions from the emulsion
into the organic solvent. In some cases, separation of the lysate
is performed by cooling the emulsion below 25.degree. C., below
10.degree. C., or to a temperature at or below 0.degree. C.,
whereby a lipid layer separates from the emulsion layer. In one
embodiment, the method further comprises centrifuging the emulsion
after the cooling to separate the lipid layer. In some embodiments,
the method further comprises separating the emulsion from the
aqueous layer before separating the lipid from the emulsion. In one
embodiment, the lipid is extracted from the lipid:aqueous emulsion
without use of an organic solvent.
[0018] In another aspect, the present invention is directed to a
method of extracting lipid from a microorganism by lysing a
microorganism containing a lipid to produce a lysate comprising a
lipid:aqueous emulsion, and cooling the emulsion below 25.degree.
C. to separate the lipid from the emulsion.
[0019] In another aspect, the present invention is directed to a
method of extracting lipid from microbial biomass generated by
culturing a microorganism that produces a lipid. Extraction
comprises lysing the microorganisms in the biomass to produce a
lysate comprising a lipid:aqueous emulsion. In some cases,
separation of a lipid layer from the emulsion comprises
destabilizing the emulsion with the addition of a surfactant to the
emulsion. In some cases, the lysate can be treated with an organic
solvent for a period of time sufficient to allow the lipid from the
microorganism to become solubilized in the organic solvent, and the
lysate can be separated into two or more layers, including a
lipid:organic solvent layer and at least one aqueous layer. In some
cases, the method can further include removing the lipid:organic
solvent composition from the other layer(s). Optionally, removing
the lipid:organic solvent composition from the other layer(s) can
be performed without substantially separating the lipid from the
organic solvent. In some cases, the method can further include
transesterifying the lipid:organic solvent composition to produce a
fatty acid alkyl ester, or treating the lipid:organic solvent
composition to produce a straight chain alkane. In the latter case,
the method can further include cracking the straight chain
alkane.
[0020] In another aspect, the present invention is directed to a
composition of fatty acid esters comprising esters derived from a
microorganism, and esters derived from a nonmicrobial oil. In some
embodiments, no more than 20%, no more than 10%, or no more than
6%, of the esters in the composition are derived from a
nonmicrobial oil. In some cases, the esters are selected from the
group consisting of methyl, ethyl and alkyl esters. In some
embodiments, the cultured microorganism has not been separated from
liquid medium used to culture the microorganism, and/or is present
at a ratio of less than 1:1 v/v of cultured microorganism to
extracellular liquid media.
[0021] In various embodiments of the method of extracting lipid
from a microorganism, the emulsion is cooled below 10.degree. C.,
or to a temperature at or below 0.degree. C. In one embodiment, the
method further comprises centrifuging the lysate to produce layers
comprising the emulsion and an aqueous layer. In some cases, the
method further comprises separating the emulsion from the aqueous
layer. In one embodiment, the lipid is extracted from the
lipid:aqueous emulsion without use of an organic solvent. In some
cases, the method further comprises treating the lysate with an
organic solvent for a period of time sufficient to allow the lipid
from the microorganism to become solubilized in the organic
solvent.
[0022] Microorganisms useful in accordance with the present
invention can be selected from the group of microorganisms
consisting of a bacterium, a cyanobacterium, a eukaryotic
microalgae, an oleaginous yeast, and a fungus. In some cases, the
microorganisms can be selected from Tables 1, 2 or 3. Such
microorganisms include microorganisms of the genus Chlorella. In
one embodiment, the microorganism is Chlorella protothecoides. In
some cases, the microorganisms of the present invention produce a
lipid that comprises at least 10% w/v of total cellular lipid as
C18 triacylglycerols, or at least 10% w/v of total cellular lipid
as C16 triacylglycerols. In some cases, the microorganisms produce
a lipid that comprises at least 10% w/v of total cellular lipid as
C14 triacylglycerols, at least 10% w/v of total cellular lipid as
C12 triacylglycerols, or at least 10% w/v of total cellular lipid
as C10 triacylglycerols. In some cases, the microorganisms of the
present invention have at least 85% 23S rRNA genomic sequence
identity to one or more sequences selected from the group
consisting of SEQ ID NOs:7-33.
[0023] In some cases, the microorganism is of the genus Prototheca.
In one embodiment, the microorganism is Prototheca moriformis. In
some cases, the microorganisms of the present invention have at
least 75% sequence identity to one or more sequences selected from
the group consisting of SEQ ID NOs: 33, 34, 35, 16, 36, 17, 37, 38,
39, and 32.
[0024] In various embodiments in accordance with the present
invention, lysing the cultured microorganisms is performed at an
acidic pH, at a pH of no more than 5, at a pH of no more than 4, at
a pH of no more than 3, or at a pH of no more than 2. In some
embodiments, lysing the cultured microorganisms is performed at a
pH of at least 9. In some cases, lysing the cultured microorganism
comprises one or more methods of lysing selected from the list
consisting of heating, sonication, mechanical lysis, osmotic shock,
pressure oscillation, expression of an autolysis gene, exposure to
pH above 8, exposure to pH below 6, and digestion with an enzyme.
In some cases, lysing the microorganism comprises acidic lysis and
heating. In one embodiment, the microorganism is lysed by digestion
with a polysaccharide-degrading enzyme, which can be a
polysaccharide-degrading enzyme from Chlorella or a Clorella virus.
In some cases, the microorganism is lysed by digestion with a
protease. In other cases, the microorganism is digested with a
combination of at least one protease and at least one
polysaccharide-degrading enzyme. In some cases, the protease is
alcalase and/or the polysaccharide-degrading enzyme is mannaway. In
some cases, other combinations of the foregoing are used, for
example, contacting the biomass with a protease and a
polysaccharide-degrading enzymes in combination with heating the
biomass to a temperature of at least 30 degrees Celsius.
[0025] In various embodiments in accordance with the present
invention, treating the lysate comprises treating with more than
about 5% v/v of an organic solvent to the lysate. In other cases,
the treating step comprises treating with more than about 6% v/v of
an organic solvent to the lysate, or with more than about 7% v/v of
an organic solvent to the lysate. In still other cases, the v/v of
the organic solvent to the lysate is between greater than about 5%
and greater than about 25%. In one embodiment, treatment of the
lysate can be facilitated by agitating the lysate.
[0026] In embodiments of the present invention the organic solvent
can comprise an oil. The oil can be selected from the group
consisting of oil from soy, rapeseed, canola, palm, palm kernel,
coconut, corn, waste vegetable, Chinese tallow, olive, sunflower,
cotton seed, chicken fat, beef tallow, porcine tallow, microalgae,
macroalgae, Cuphea, flax, peanut, choice white grease, lard,
Camelina sativa, mustard seed cashew nut, oats, lupine, kenaf,
calendula, hemp, coffee, linseed, hazelnut, euphorbia, pumpkin
seed, coriander, camellia, sesame, safflower, rice, tung oil tree,
cocoa, copra, pium poppy, castor beans, pecan, jojoba, jatropha,
macadamia, Brazil nuts, avocado, a fossil oil, or a distillate
fraction thereof. In some cases the oil is soy oil. In some cases
the oil is palm oil. In other cases the oil is coconut oil. In
still other cases the oil is canola oil. In yet other cases the oil
is jatropha oil. In one embodiment, the time sufficient to allow
the lipid from the microorganism to become solubilized in the
organic solvent is between 0.1 and 30 minutes.
[0027] In various embodiments in accordance with the present
invention, separating the lysate comprises centrifugation of the
treated lysate, whereby the lysate is separated into a light layer
comprising the lipid:organic solvent composition and a heavy layer
comprising the aqueous composition and, optionally, an emulsified
composition and/or cell pellet composition. In some cases,
separating the lysate comprises settling of the treated lysate,
whereby the lysate is separated into a light layer comprising the
lipid:organic solvent composition and a heavy layer comprising the
aqueous composition and, optionally, an emulsified composition
and/or cell pellet composition. Separation of the lysate can
include reducing the temperature of the mixture below 25.degree.
C., below 10.degree. C., or to a temperature at or below 0.degree.
C. In some aspects of the invention, the layers further comprise a
lipid:aqueous emulsion layer and/or a cell pellet.
[0028] In some cases, methods of the invention further comprise
removing the lipid:organic solvent composition from the other
layer(s). In one embodiment, removal is performed without
substantially separating the lipid from the organic solvent.
[0029] In some methods of the invention, the microorganism is
produced in a culturing process and then optionally stored for a
period of time between termination of the culturing process and
undertaking additional steps to lyse the microorganism. In some
cases, lysing the microorganisms in the biomass produces a lysate
comprising a lipid:aqueous emulsion. In some cases, the
microorganism is stored for at least one hour between termination
of the culturing process and undertaking additional steps to lyse
the cultured microorganism. In some cases, the microorganism is
stored for at least twenty-four hours between termination of the
culturing process and undertaking additional steps to lyse the
cultured microorganism. In some cases, the microorganism is stored
for at least forty-eight hours between termination of the culturing
process and undertaking additional steps to lyse the cultured
microorganism. In other cases, the fermentation broth is stored. In
some cases, the fermentation broth is concentrated, for example, by
centrifugation or filtration, and the cells are resuspended in an
aqueous media before storage. In some cases the aqueous media is
deionized or distilled water.
[0030] In some embodiments of the present invention, microorganisms
(biomass) prepared in a culture process are optionally stored at a
temperature below 15 degrees Celsius between termination of the
culturing process and undertaking additional steps to lyse the
cultured microorganism. In some cases, the biomass is stored at a
temperature below 5 degrees Celsius between termination of the
culturing process and undertaking additional steps to lyse the
cultured microorganisms. In some cases, the microorganism is stored
at a temperature above 30 degrees Celsius between termination of
the culturing process and undertaking additional steps to lyse the
cultured microorganism. In some cases, the microorganism is stored
at a temperature above 40 degrees Celsius between termination of
the culturing process and undertaking additional steps to lyse the
cultured microorganism. In some cases, the microorganism is
subjected to agitation during storage.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] FIG. 1 depicts two lipid profiles for pure oils prepared
according to the method of the present invention. Fatty acids
C10:1, C10, C12, C18:3, C14, C18:2, C166, C18:1, and C18:0 of pure
Chlorella oil (light-shaded bars) and coconut oil (dark-shaded
bars) are shown. The majority of pure Chlorella oil comprises C18:1
fatty acids (59%), while the majority of pure coconut oil comprises
C12 fatty acids (54%). Details are described in Example 6.
[0032] FIG. 2 depicts the ratio of C18:1 to C12 fatty acids and
C18:1 to C14 fatty acids in pure algal/coconut oil mixture. Details
are described in Example 6.
[0033] FIG. 3 depicts results of chemical/heat treatment of
Chlorella protothecoides. Details are described in Example 7.
[0034] FIG. 4 depicts an image of oil layer recovered from a
frozen, heat treated emulsion. Details are described in Example 7
(Enzyme Treatment #1).
[0035] FIG. 5 depicts a result of a thin layer chromatography (TLC)
analysis of control, basic, and acid generated oil samples. Lane 1,
Reference @ 100 .mu.g/each (FAME/TAG/FFA); Lane 2, No chemical
treatment; Lane 3, treatment with 120 mN H2SO4; Lane 4, treatment
with 160 mN KOH; Lane 5, no chemical treatment; Lane 6, treatment
with 120 mN H2SO4; Lane 7, treatment with 160 mN KOH. FAME, fatty
acid methyl ester; TAG, triacylglycerides; FFA, free fatty acid;
DAG, diacylglycerol (1,3-diolein); MAG, monoacylglycerol
(1-monoolein) Details are described in Example 7.
[0036] FIG. 6 depicts an image of layers recovered from enzyme
treated (left tube) versus untreated (right tube) cell culture
material. Details are described in Example 7 (Enzyme Treatment
#2).
[0037] FIG. 7 shows maps of the cassettes used in Prototheca
transformations, as described in Example 9.
[0038] FIG. 8 shows the results of Southern blot analysis on three
transformants of UTEX strain 1435, as described in Example 9.
[0039] FIG. 9 shows a schematic of the codon optimized and
non-codon optimized suc2 (yeast sucrose invertase (yInv)) transgene
construct. The relevant restriction cloning sites are indicated and
arrows indicate the direction of transcription.
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
[0040] Unless defined otherwise, all technical and scientific terms
used herein have the meaning commonly understood by a person
skilled in the art to which this invention belongs. The following
references provide one of skill with a general definition of many
of the terms used in this invention: Singleton et al., Dictionary
of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge
Dictionary of Science and Technology (Walker ed., 1988); The
Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer
Verlag (1991); and Hale & Marham, The Harper Collins Dictionary
of Biology (1991). As used herein, the following terms have the
meanings ascribed to them unless specified otherwise.
[0041] As used with reference to a nucleic acid, the phrase "active
in microalgae" refers to a nucleic acid that is functional in
microalgae. For example, a promoter that has been used to drive an
antibiotic resistance gene to impart antibiotic resistance to a
transgenic microalgae is active in microalgae. Examples of
promoters active in microalgae are promoters endogenous to certain
algae species and promoters found in plant viruses.
[0042] As used herein, an "acyl carrier protein" or "ACP" is a
protein which binds a growing acyl chain during fatty acid
synthesis as a thiol ester at the distal thiol of the
4'-phosphopantetheine moiety and comprises a component of the fatty
acid synthase complex.
[0043] An "acyl-CoA molecule" or "acyl-CoA" is a molecule
comprising an acyl moiety covalently attached to coenzyme A through
a thiol ester linkage at the distal thiol of the
4'-phosphopantetheine moiety of coenzyme A.
[0044] As used herein, the term "alkyl" refers to a straight or
branched chain hydrocarbon radical, and can include di- and
multivalent radicals, having the number of carbon atoms designated
(i.e. C1-C10 means one to ten carbons). Examples of saturated
hydrocarbon radicals include groups such as methyl, ethyl,
n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl,
homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl,
n-octyl, and the like.
[0045] As used herein, the term "alkenyl" refers to an unsaturated
alkyl group one having one or more double bonds. Examples of
alkenyl groups include vinyl, 2-propenyl, crotyl, 2-isopentenyl,
2-(butadienyl), 2,4-pentadienyl and 3-(1,4-pentadienyl), and the
higher homologs and isomers.
[0046] As used herein, the term "alkynyl" refers to an unsaturated
alkyl group one having one or more triple bonds. Examples of
alkynyl groups include ethynyl (acetylenyl), 1-propynyl, 1- and
2-butynyl, and the higher homologs and isomers.
[0047] As used herein, the phrase "aqueous or emulsified
composition" refers to microbial biomass that contains lipid.
[0048] As used herein, the phrase "area percent" refers to the area
of peaks observed using FAME GC/FID detection methods in which
every fatty acid in the sample is converted into a fatty acid
methyl ester (FAME) prior to detection. For examples, a separate
peak is observed for a fatty acid of 14 carbon atoms with no
unsaturation (C14:0) compared to any other fatty acid such as a
C14:1. The peak area for each class of FAME is directly
proportional to its percent composition in the mixture and is
calculated based on the sum of all peaks present in the sample
(i.e., [area under specific peak/total area of all measured
peaks].times.100). When referring to lipid profiles of oils and
cells of the invention, "at least 4% C8-C14," for example, means
that at least 4% of the total fatty acids in the cell or in the
extracted glycerolipid composition have a chain length that
includes 8, 10, 12, or 14 carbon atoms.
[0049] As used herein, the term "aryl" refers to a polyunsaturated,
aromatic, hydrocarbon substituent having 5-12 ring members, which
can be a single ring or multiple rings (up to three rings) which
are fused together or linked covalently. Non-limiting examples of
aryl groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, and
benzyl. Other aryl groups are also useful in the present
invention.
[0050] As used herein, the term "axenic" refers to a culture of an
organism that is free from contamination by other living
organisms.
[0051] As used herein, the term "base" refers to any compound whose
pKa is greater than that of water.
[0052] As used herein, the term "biodiesel" refers to a fatty acid
ester produced from transesterification of a lipid.
[0053] As used herein, the term "biomass" refers to material
produced by growth and/or propagation of cells. Biomass may contain
cells and/or intracellular contents as well as extracellular
material. Extracellular material includes, but is not limited to,
compounds secreted by a cell.
[0054] As used herein, the term "bioreactor" refers to an enclosure
or partial enclosure in which cells, e.g., microorganisms, are
cultured, optionally in suspension.
[0055] As used herein, the term "catalyst" refers to an agent, such
as a molecule or macromolecular complex, capable of facilitating or
promoting a chemical reaction of a reactant to a product without
becoming a part of the product. A catalyst thus increases the rate
of a reaction, after which, the catalyst may act on another
reactant to form the product. A catalyst generally lowers the
overall activation energy required for the reaction such that it
proceeds more quickly or at a lower temperature. Thus a reaction
equilibrium may be more quickly attained. Examples of catalysts
include enzymes, which are biological catalysts, and heat, which is
a non-biological catalyst.
[0056] As used herein, the term "cellulosic material" means the
products of digestion of cellulose, such as glucose, xylose,
arabinose, disaccharides, oligosaccharides, lignin, furfurals, and
other molecules.
[0057] As used herein, the term "co-culture" and variants thereof,
such as "co-cultivate," refer to the presence of two or more types
of cells in the same bioreactor. The two or more types of cells may
both be microorganisms, such as microalgae, or may be a microalgal
cell cultured with a different cell type. The culture conditions
may be those that foster growth and/or propagation of the two or
more cell types or those that facilitate growth and/or
proliferation of one, or a subset, of the two or more cells while
maintaining cellular growth for the remainder.
[0058] As used herein, the term "cofactor" refers to any molecule,
other than the substrate, that is required for an enzyme to carry
out its enzymatic activity.
[0059] A "constitutive" promoter is a promoter that is active under
most environmental and developmental conditions.
[0060] As used herein, the term "cultivated" and variants thereof,
refer to the intentional fostering of growth (increases in cell
size, cellular contents, and/or cellular activity) and/or
propagation (increases in cell numbers via mitosis) of one or more
cells by use of intended culture conditions. The combination of
both growth and propagation may be termed proliferation. The one or
more cells may be those of a microorganism, such as microalgae.
Examples of intended conditions include the use of a defined medium
(with known characteristics such as pH, ionic strength, and carbon
source), specified temperature, oxygen tension, carbon dioxide
levels, and growth in a bioreactor. The term does not refer to the
growth or propagation of microorganisms in nature or otherwise
without direct human intervention, such as natural growth of an
organism that ultimately becomes fossilized to produce geological
crude oil.
[0061] As used herein, the term "cycloalkyl" refers to a saturated
cyclic hydrocarbon having 3 to 15 carbons, and 1 to 3 rings that
can be fused or linked covalently. Cycloalkyl groups useful in the
present invention include, but are not limited to, cyclopentyl,
cyclohexyl, cycloheptyl and cyclooctyl. Bicycloalkyl groups useful
in the present invention include, but are not limited to,
[3.3.0]bicyclooctanyl, [2.2.2]bicyclooctanyl, [4.3.0]bicyclononane,
[4.4.0]bicyclodecane (decalin), spiro[3.4]octanyl,
spiro[2.5]octanyl, and so forth.
[0062] As used herein, the term "cycloalkenyl" refers to an
unsaturated cyclic hydrocarbon having 3 to 15 carbons, and 1 to 3
rings that can be fused or linked covalently. Cycloalkenyl groups
useful in the present invention include, but are not limited to,
cyclopentenyl, cyclohexenyl, cycloheptenyl and cyclooctenyl.
Bicycloalkenyl groups are also useful in the present invention.
[0063] As used herein, the term "cytolysis" refers to the lysis of
cells in a hypotonic environment. Cytolysis is caused by excessive
osmosis, or movement of water, towards the inside of a cell
(hyperhydration). The cell membrane cannot withstand the osmotic
pressure of the water inside, and so it explodes.
[0064] As used herein, the term "exogenous gene" refers to a
nucleic acid transformed into a cell. A transformed cell may be
referred to as a recombinant cell, into which additional exogenous
gene(s) may be introduced. The exogenous gene may be from a
different species (and so heterologous), or from the same species
(and so homologous) relative to the cell being transformed. In the
case of a homologous gene, it occupies a different location in the
genome of the cell relative to the endogenous copy of the gene. The
exogenous gene may be present in more than one copy in the cell.
The exogenous gene may be maintained in a cell as an insertion into
the genome or as an episomal molecule.
[0065] As used herein, the term "exogenously provided" in the
context of culturing a cell, refers to a molecule provided to a
culture media of a cell culture.
[0066] As used herein, the terms "expression vector" or "expression
construct" refer to a nucleic acid construct, generated
recombinantly or synthetically, with a series of specified nucleic
acid elements that permit transcription of a particular nucleic
acid in a host cell. The expression vector can be part of a
plasmid, virus, or nucleic acid fragment. Typically, the expression
vector includes a nucleic acid to be transcribed operably linked to
a promoter.
[0067] As used herein, a "fatty acyl-ACP thioesterase" is an enzyme
that catalyzes the cleavage of a fatty acid from an acyl carrier
protein (ACP) during lipid synthesis.
[0068] As used herein, a "fatty acyl-CoA/aldehyde reductase" is an
enzyme that catalyzes the reduction of an acyl-CoA molecule to a
primary alcohol.
[0069] As used herein, a "fatty acyl-CoA reductase" is an enzyme
that catalyzes the reduction of an acyl-CoA molecule to an
aldehyde.
[0070] As used herein, a "fatty aldehyde decarbonylase" is an
enzyme that catalyzes the conversion of a fatty aldehyde to an
alkane.
[0071] As used herein, a "fatty aldehyde reductase" is an enzyme
that catalyzes the reduction of an aldehyde to a primary
alcohol.
[0072] As used herein, the term "fixed carbon source" means
molecule(s) containing carbon, preferably organic, that are present
at ambient temperature and pressure in solid or liquid form.
[0073] As used herein, the term "fungus," means heterotrophic
organisms characterized by a chitinous cell wall from the kingdom
of fungi.
[0074] As used herein, the term "heteroaryl" refers to a
polyunsaturated, aromatic, hydrocarbon substituent having 5-12 ring
members, which can be a single ring or multiple rings (up to three
rings) which are fused together or linked covalently, and which has
at least one heteroatom in the ring, such as N, O, or S. A
heteroaryl group can be attached to the remainder of the molecule
through a heteroatom. Non-limiting examples of heteroaryl groups
include 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl,
2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl,
2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl,
5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl,
3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl,
2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl,
2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl,
2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, and 6-quinolyl.
Additional heteroaryl groups useful in the present invention
include pyridyl N-oxide, tetrazolyl, benzofuranyl, benzothienyl,
indazolyl, or any of the radicals substituted, especially mono- or
di-substituted.
[0075] As used herein, the term "heteroatom" means any atom that is
not carbon or hydrogen. Examples of heteroatoms include magnesium,
calcium, potassium, sodium, sulfur, phosphorus, iron and
copper.
[0076] As used herein, the term "heterocycloalkyl" refers to a
saturated cyclic hydrocarbon having 3 to 15 ring members, and 1 to
3 rings that can be fused or linked covalently, and which has at
least one heteroatom in the ring, such as N, O, or S. Additionally,
a heteroatom can occupy the position at which the heterocycle is
attached to the remainder of the molecule. Examples of
heterocycloalkyl include 1 (1,2,5,6-tetrahydropyridyl),
1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl,
3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl,
tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1-piperazinyl,
2-piperazinyl, and the like.
[0077] As used herein, in the context of biomass, the term
"homogenate" means biomass that has been physically disrupted.
[0078] As used herein, "hydrocarbon" refers to: (a) a molecule
containing only hydrogen and carbon atoms wherein the carbon atoms
are covalently linked to form a linear, branched, cyclic, or
partially cyclic backbone to which the hydrogen atoms are attached;
or (b) a molecule that only primarily contains hydrogen and carbon
atoms and that can be converted to contain only hydrogen and carbon
atoms by one to four chemical reactions. Nonlimiting examples of
the latter include hydrocarbons containing an oxygen atom between
one carbon and one hydrogen atom to form an alcohol molecule, as
well as aldehydes containing a single oxygen atom. Methods for the
reduction of alcohols to hydrocarbons containing only carbon and
hydrogen atoms are well known. Another example of a hydrocarbon is
an ester, in which an organic group replaces a hydrogen atom (or
more than one) in an oxygen acid. The molecular structure of
hydrocarbon compounds varies from the simplest, in the form of
methane (CH4), which is a constituent of natural gas, to the very
heavy and very complex, such as some molecules such as asphaltenes
found in crude oil, petroleum, and bitumens. Hydrocarbons may be in
gaseous, liquid, or solid form, or any combination of these forms,
and may have one or more double or triple bonds between adjacent
carbon atoms in the backbone. Accordingly, the term includes
linear, branched, cyclic, or partially cyclic alkanes, alkenes,
lipids, and paraffin. Examples include propane, butane, pentane,
hexane, octane, squalene and carotenoids.
[0079] As used herein, the term "hydrocarbon modification enzyme"
refers to an enzyme that alters the covalent structure of a
hydrocarbon. Examples of hydrocarbon modification enzymes include a
lipase, a fatty acyl-ACP thioesterase, a fatty acyl-CoA/aldehyde
reductase, a fatty acyl-CoA reductase, a fatty aldehyde reductase,
and a fatty aldehyde decarbonylase.
[0080] As used herein, the term "hydrogen:carbon ratio" refers to
the ratio of hydrogen atoms to carbon atoms in a molecule on an
atom-to-atom basis. The ratio may be used to refer to the number of
carbon and hydrogen atoms in a hydrocarbon molecule. For example,
the hydrocarbon with the highest ratio is methane CH.sub.4
(4:1).
[0081] As used herein, the term "hydrophobic fraction" refers to a
portion, or fraction, of a material that is more soluble in a
hydrophobic phase in comparison to an aqueous phase. A hydrophobic
fraction is substantially insoluble in water and usually
non-polar.
[0082] As used herein, the phrase "increase lipid yield" refers to
an increase in the productivity of a microbial culture by, for
example, increasing dry weight of cells per liter of culture,
increasing the percentage of cells that constitute lipid, or
increasing the overall amount of lipid per liter of culture volume
per unit time.
[0083] An "inducible promoter" is one that mediates transcription
of an operably linked gene in response to a particular
stimulus.
[0084] As used herein, the term "in situ" means "in place" or "in
its original position." For example, a culture may contain a first
microalgae secreting a catalyst and a second microorganism
secreting a substrate, wherein the first and second cell types
produce the components necessary for a particular chemical reaction
to occur in situ in the co-culture without requiring further
separation or processing of the materials.
[0085] As used herein, the term "isomers" refers to compounds of
the present invention that possess asymmetric carbon atoms (optical
centers) or double bonds. The racemates, diastereomers, geometric
isomers and individual isomers are all intended to be encompassed
within the scope of the present invention.
[0086] As used herein, the phrase "limiting concentration of a
nutrient" refers to a concentration in a culture that limits the
propagation of a cultured organism. A "non-limiting concentration
of a nutrient" is a concentration that supports maximal propagation
during a given culture period. Thus, the number of cells produced
during a given culture period is lower in the presence of a
limiting concentration of a nutrient than when the nutrient is
non-limiting. A nutrient is said to be "in excess" in a culture,
when the nutrient is present at a concentration greater than that
which supports maximal propagation.
[0087] As used herein, a "lipase" is an enzyme that catalyzes the
hydrolysis of ester bonds in water-insoluble, lipid substrates.
Lipases catalyze the hydrolysis of lipids into glycerols and fatty
acids.
[0088] "Lipids" are a class of molecules that are soluble in
nonpolar solvents (such as ether and chloroform) and are relatively
or completely insoluble in water. Lipid molecules have these
properties because they consist largely of long hydrocarbon tails
that are hydrophobic in nature. Examples of lipids include fatty
acids (saturated and unsaturated); glycerides or glycerolipids
(such as monoglycerides, diglycerides, triglyceries or neutral fats
and phosophoglycerides or glycerophospholipids); nonglycerides
(sphingolipids, sterol lipids including cholesterol and steroid
hormones, prenol lipids including terpenoids, fatty alcohols, waxes
and polyketides); and complex lipid derivatives (sugar-linked
lipids, or glycolipids, and protein-linked lipids). "Fats" are a
subgroup of lipids called "triacylglycerides".
[0089] As used herein, the phrase "lipid:organic solvent
composition" refers to a mixture of lipid and organic solvent.
[0090] As used herein, a "lipid pathway enzyme" is any enzyme that
plays a role in lipid metabolism, i.e., either lipid synthesis,
modification, or degradation. This term encompasses proteins that
chemically modify lipids, as well as carrier proteins.
[0091] As used herein, the term "lysate" refers to a solution
containing the contents of lysed cells.
[0092] As used herein, the term "lysis" refers to the breakage of
the plasma membrane and optionally the cell wall of a biological
organism sufficient to release at least some intracellular content,
often by mechanical, viral or osmotic mechanisms that compromise
its integrity.
[0093] As used herein, the term "lysing" refers to disrupting the
cellular membrane and optionally the cell wall of a biological
organism or cell sufficient to release at least some intracellular
content.
[0094] As used herein, the term "microalgae" means a microbial
organism that is either (a) eukaryotic and contains a chloroplast
or chloroplast remnant, or (b) is a cyanobacteria. Microalgae
include obligate photoautotrophs, which cannot metabolize a fixed
carbon source as energy, as well as heterotrophs, which can live
solely off of a fixed carbon source. Microalgae can refer to
unicellular organisms that separate from sister cells shortly after
cell division, such as Chlamydomonas, and can also refer to
microbes such as, for example, Volvox, which is a simple
multicellular photosynthetic microbe of two distinct cell types.
"Microalgae" can also refer to cells such as Chlorella and
Dunaliella. "Microalgae" also includes other microbial
photosynthetic organisms that exhibit cell-cell adhesion, such as
Agmenellum, Anabaena, and Pyrobotrys, as well as organisms that
contain chloroplast-like structures that are no longer capable of
performing photosynthesis, such as microalgae of the genus
Prototheca and some dinoflagellates. Microalgae" also includes
obligate heterotrophic micoorganisms that have lost the ability to
perform photosynthesis, such as certain dinoflagellate species.
[0095] The terms "microorganism" and "microbe" are used
interchangeably herein to refer to microscopic unicellular
organisms.
[0096] As used herein, the term "oil" means a hydrophobic,
lipophilic, nonpolar carbon-containing substance including but not
limited to geologically-derived crude oil, distillate fractions of
geologically-derived crude oil, vegetable oil, algal oil, and
microbial lipids.
[0097] As used herein, the term "oleaginous yeast," means yeast
that can accumulate more than 10% of its dry cell weight as lipid.
Oleaginous yeast includes organisms such as Yarrowia lipolytica, as
well as engineered strains of yeast such as Saccharomyces
cerevisiae that have been engineered to accumulate more than 10% of
the dry cell weight as lipid.
[0098] As used herein, the terms "operably linked," "in operable
linkage," or grammatical equivalents thereof refer to a functional
linkage between two sequences, such a control sequence (typically a
promoter) and the linked sequence. A promoter is in operable
linkage with an exogenous gene if it can mediate transcription of
the gene.
[0099] As used herein, the term "organic solvent" refers to a
carbon-containing material that dissolves a solid, liquid, or
gaseous solute, resulting in a solution.
[0100] As used herein, the term "osmotic shock" refers to the
rupture of bacterial, algal, or other cells in a solution following
a sudden reduction in osmotic pressure. Osmotic shock is sometimes
induced to release cellular components of such cells into a
solution.
[0101] As used herein, the term "photobioreactor" refers to a
container, at least part of which is at least partially transparent
or partially open, thereby allowing light to pass through, in
which, e.g., one or more microalgae cells are cultured.
Photobioreactors may be closed, as in the instance of a
polyethylene bag or Erlenmeyer flask, or may be open to the
environment, as in the instance of an outdoor pond.
[0102] As used herein, the term "polysaccharide" (also called
"glycan") refers to carbohydrate made up of monosaccharides joined
together by glycosidic linkages. Cellulose is an example of a
polysaccharide that makes up certain plant cell walls. Cellulose
can be depolymerized by enzymes to yield monosaccharides such as
xylose and glucose, as well as larger disaccharides and
oligosaccharides.
[0103] As used herein, the term "polysaccharide-degrading enzyme"
refers to any enzyme capable of catalyzing the hydrolysis, or
depolymerization, of any polysaccharide. For example, cellulase
catalyzes the hydrolysis of cellulose.
[0104] As used herein, the term "port," in the context of a
bioreactor, refers to an opening in the bioreactor that allows
influx or efflux of materials such as gases, liquids, and cells.
Ports are usually connected to tubing leading from the
photobioreactor.
[0105] A "promoter" is defined as an array of nucleic acid control
sequences that direct transcription of a nucleic acid. As used
herein, a promoter includes necessary nucleic acid sequences near
the start site of transcription, such as, in the case of a
polymerase II type promoter, a TATA element. A promoter also
optionally includes distal enhancer or repressor elements, which
can be located as much as several thousand base pairs from the
start site of transcription.
[0106] As used herein, the term "recombinant" when used with
reference, e.g., to a cell, or nucleic acid, protein, or vector,
indicates that the cell, nucleic acid, protein or vector, has been
modified by the introduction of a heterologous nucleic acid or
protein or the alteration of a native nucleic acid or protein, or
that the cell is derived from a cell so modified. Thus, e.g.,
recombinant cells express genes that are not found within the
native (non-recombinant) form of the cell or express native genes
that are otherwise abnormally expressed, under expressed or not
expressed at all. By the term "recombinant nucleic acid" herein is
meant nucleic acid, originally formed in vitro, in general, by the
manipulation of nucleic acid, e.g., using polymerases and
endonucleases, in a form not normally found in nature. In this
manner, operably linkage of different sequences is achieved. Thus
an isolated nucleic acid, in a linear form, or an expression vector
formed in vitro by ligating DNA molecules that are not normally
joined, are both considered recombinant for the purposes of this
invention. It is understood that once a recombinant nucleic acid is
made and reintroduced into a host cell or organism, it will
replicate non-recombinantly, i.e., using the in vivo cellular
machinery of the host cell rather than in vitro manipulations;
however, such nucleic acids, once produced recombinantly, although
subsequently replicated non-recombinantly, are still considered
recombinant for the purposes of the invention. Similarly, a
"recombinant protein" is a protein made using recombinant
techniques, i.e., through the expression of a recombinant nucleic
acid as depicted above.
[0107] As used herein, the term "renewable diesel" refers to a
mixture of alkanes (such as C10:0, C12:0, C14:0, C16:0 and C18:0)
produced through hydrogenation and deoxygenation of lipids.
Renewable diesel also includes diesel fuel derived from biomass as
defined in Section 45K(c)(3), using the process of thermal
depolymerization (EPAct 2005).
[0108] As used herein, the term "sonication" refers to a process of
disrupting biologic materials, such as a cell, by use of sound wave
energy.
[0109] As used herein, the term "wastewater" refers to a watery
waste which typically contains washing water, laundry waste,
faeces, urine, and other liquid or semi-liquid wastes. It includes
some forms of municipal waste as well as secondarily treated
sewage.
II. General
[0110] U.S. Patent application Nos: 60/941,581; 60/959,174;
60/968,291; and 61/024,069 are hereby incorporated by reference in
their entirety for all purposes.
[0111] The invention generally relates to the production of
hydrocarbon compositions, such as a lipid, in microorganisms. In
particular, the invention provides methods for extracting,
recovering, isolating and obtaining a lipid from a microorganism
and compositions comprising the lipid. The invention also discloses
methods for producing hydrocarbon compositions for use as
biodiesel, renewable diesel, jet fuel, and for producing a lipid
surfactant having a carbon chain length of C12 and C14.
[0112] The invention is premised in part on the insight that
certain microorganisms can be used to produce hydrocarbon
compositions economically and in large quantities for use in the
transportation fuel and petrochemical industry among other
applications. Suitable microorganisms include microalgae,
oleaginous yeast, and fungi. A preferred genus of microalgae for
use in the invention is the lipid-producing microalgae Chlorella.
Acidic transesterification of lipids yields long-chain fatty acid
esters useful as biodiesel. Other enzymatic processes can be
tailored to yield fatty acids, aldehydes, alcohols, and alkanes.
The present application describes methods for genetic modification
of multiple species and strains of microorganisms, including
Chlorella and similar microbes to provide organisms having
characteristics that facilitate the production of lipids suitable
for conversion into biodiesel or other hydrocarbon compounds. The
present application also describes methods of cultivating
microalgae for increased productivity and increased lipid
yield.
[0113] Microorganisms useful in the invention produce lipids or
hydrocarbons suitable for biodiesel production or as feedstock for
industrial applications. Suitable hydrocarbons for biodiesel
production include triacylglycerides (TAGs) containing long-chain
fatty acid molecules. Suitable hydrocarbons for industrial
applications, such as surfactant manufacturing, include fatty
acids, aldehydes, alcohols, and alkanes. In some embodiments,
suitable fatty acids, or the corresponding primary alcohols,
aldehydes, or alkanes, generated by the methods described herein,
contain at least 8, at least 9, at least 10, at least 11, at least
12, at least 13, at least 14, at least 15, at least 16, at least
17, at least 18, at least 19, at least 20, at least 21, at least
22, at least 23, at least 24, at least 25, at least 26, at least
27, at least 28, at least 29, at least 30, at least 31, at least
32, at least 33, at least 34, or at least 35 carbon atoms or more.
Preferred long-chain fatty acids for biodiesel generally contain at
least 14 carbon atoms or more.
[0114] Preferred fatty acids, or the corresponding primary
alcohols, aldehydes, and alkanes, for industrial applications
contain at least 8 carbon atoms or more. In certain embodiments,
the above fatty acids, as well as the other corresponding
hydrocarbon molecules, are saturated (with no carbon-carbon double
or triple bonds); mono unsaturated (single double bond); poly
unsaturated (two or more double bonds); are linear (not cyclic);
and/or have little or no branching in their structures.
[0115] Triacylglycerols containing carbon chain lengths in the C8
to C22 range are preferred. Preferred for surfactants are C10-C14.
Preferred for biodiesel or renewable diesel are C16 to C18.
Preferred for jet fuel are C8-C10. Preferred for nutrition are C22
polyunsaturated fatty acids (such as DHA) and carotenoids (such as
astaxanthin).
III. Microorganisms Useful for Producing Lipids
[0116] Any species of organism that produces suitable lipid or
hydrocarbon can be used, although microorganisms that naturally
produce high levels of suitable lipid or hydrocarbon are preferred.
Production of hydrocarbons by microorganisms is reviewed by Metzger
et al. Appl Microbiol Biotechnol (2005) 66: 486-496 and A Look Back
at the U.S. Department of Energy's Aquatic Species Program:
Biodiesel from Algae, NREL/TP-580-24190, John Sheehan, Terri
Dunahay, John Benemann and Paul Roessler (1998).
[0117] Considerations affecting the selection of a microorganism
for use in the invention include, in addition to production of
suitable hydrocarbons for biodiesel or for industrial applications:
(1) high lipid content as a percentage of cell weight; (2) ease of
growth; (3) ease of genetic engineering; and (3) ease of
processing. In particular embodiments, the wild-type or genetically
engineered microorganism yields cells that are at least: about 40%,
about 45%, about 50%, about 55%, about 60%, about 65%, or about 70%
or more lipid. Preferred organisms grow heterotrophically (on sugar
in the absence of light) or can be engineered to do so using, for
example, methods disclosed in commonly-owned U.S. Patent
Application Nos. 60/837,839 and 60/968,291, which are incorporated
herein by reference in their entireties. The ease of transformation
and availability of selectable markers and promoters, constitutive
and/or inducible, that are functional in the microorganism affect
the ease of genetic engineering. Processing considerations can
include, for example, the availability of effective means for
lysing the cells.
[0118] A. Algae
[0119] In a preferred embodiment of the present invention, a
microorganism producing a lipid or a microorganism from which a
lipid can be extracted, recovered, or obtained, is an algae.
[0120] Examples of algae that can be used to practice the present
invention include, but are not limited to the following algae
listed in Table 1.
TABLE-US-00001 TABLE 1 Examples of algae. Achnanthes orientalis,
Agmenellum, Amphiprora hyaline, Amphora coffeiformis, Amphora
coffeiformis linea, Amphora coffeiformis punctata, Amphora
coffeiformis taylori, Amphora coffeiformis tenuis, Amphora
delicatissima, Amphora delicatissima capitata, Amphora sp.,
Anabaena, Ankistrodesmus, Ankistrodesmus falcatus, Boekelovia
hooglandii, Borodinella sp., Botryococcus braunii, Botryococcus
sudeticus, Carteria, Chaetoceros gracilis, Chaetoceros muelleri,
Chaetoceros muelleri subsalsum, Chaetoceros sp., Chlorella
anitrata, Chlorella Antarctica, Chlorella aureoviridis, Chlorella
candida, Chlorella capsulate, Chlorella desiccate, Chlorella
ellipsoidea, Chlorella emersonii, Chlorella fusca, Chlorella fusca
var. vacuolata, Chlorella glucotropha, Chlorella infusionum,
Chlorella infusionum var. actophila, Chlorella infusionum var.
auxenophila, Chlorella kessleri, Chlorella lobophora (strain SAG
37.88), Chlorella luteoviridis, Chlorella luteoviridis var.
aureoviridis, Chlorella luteoviridis var. lutescens, Chlorella
miniata, Chlorella minutissima, Chlorella mutabilis, Chlorella
nocturna, Chlorella parva, Chlorella photophila, Chlorella
pringsheimii, Chlorella protothecoides (including any of UTEX
strains 1806, 411, 264, 256, 255, 250, 249, 31, 29, 25, and CCAP
strains 211/17 and 211/8d), Chlorella protothecoides var.
acidicola, Chlorella regularis, Chlorella regularis var. minima,
Chlorella regularis var. umbricata, Chlorella reisiglii, Chlorella
saccharophila, Chlorella saccharophila var. ellipsoidea, Chlorella
salina, Chlorella simplex, Chlorella sorokiniana, Chlorella sp.,
Chlorella sphaerica, Chlorella stigmatophora, Chlorella vanniellii,
Chlorella vulgaris, Chlorella vulgaris, Chlorella vulgaris f.
tertia, Chlorella vulgaris var. autotrophica, Chlorella vulgaris
var. viridis, Chlorella vulgaris var. vulgaris, Chlorella vulgaris
var. vulgaris f. tertia, Chlorella vulgaris var. vulgaris f.
viridis, Chlorella xanthella, Chlorella zofingiensis, Chlorella
trebouxioides, Chlorella vulgaris, Chlorococcum infusionum,
Chlorococcum sp., Chlorogonium, Chroomonas sp., Chrysosphaera sp.,
Cricosphaera sp., Cryptomonas sp., Cyclotella cryptica, Cyclotella
meneghiniana, Cyclotella sp., Dunaliella sp., Dunaliella bardawil,
Dunaliella bioculata, Dunaliella granulate, Dunaliella maritime,
Dunaliella minuta, Dunaliella parva, Dunaliella peircei, Dunaliella
primolecta, Dunaliella salina, Dunaliella terricola, Dunaliella
tertiolecta, Dunaliella viridis, Dunaliella tertiolecta,
Eremosphaera viridis, Eremosphaera sp., Ellipsoidon sp., Euglena,
Franceia sp., Fragilaria crotonensis, Fragilaria sp., Gleocapsa
sp., Gloeothamnion sp., Hymenomonas sp., Isochrysis aff. galbana,
Isochrysis galbana, Lepocinclis, Micractinium, Micractinium (UTEX
LB 2614), Monoraphidium minutum, Monoraphidium sp., Nannochloris
sp., Nannochloropsis salina, Nannochloropsis sp., Navicula
acceptata, Navicula biskanterae, Navicula pseudotenelloides,
Navicula pelliculosa, Navicula saprophila, Navicula sp.,
Nephrochloris sp., Nephroselmis sp., Nitschia communis, Nitzschia
alexandrina, Nitzschia communis, Nitzschia dissipata, Nitzschia
frustulum, Nitzschia hantzschiana, Nitzschia inconspicua, Nitzschia
intermedia, Nitzschia microcephala, Nitzschia pusilla, Nitzschia
pusilla elliptica, Nitzschia pusilla monoensis, Nitzschia
quadrangular, Nitzschia sp., Ochromonas sp., Oocystis parva,
Oocystis pusilla, Oocystis sp., Oscillatoria limnetica,
Oscillatoria sp., Oscillatoria subbrevis, Pascheria acidophila,
Pavlova sp., Phagus, Phormidium, Platymonas sp., Pleurochrysis
carterae, Pleurochrysis dentate, Pleurochrysis sp., Prototheca
wickerhamii, Prototheca stagnora, Prototheca portoricensis,
Prototheca moriformis, Prototheca zopfii, Pyramimonas sp.,
Pyrobotrys, Sarcinoid chrysophyte, Scenedesmus armatus, Spirogyra,
Spirulina platensis, Stichococcus sp., Synechococcus sp.,
Tetraedron, Tetraselmis sp., Tetraselmis suecica, Thalassiosira
weissflogii, and Viridiella fridericiana
[0121] 1. Chlorella and Prototheca
[0122] In a preferred embodiment of the present invention, the
microorganism producing a lipid or a microorganism from which a
lipid can be extracted, recovered, or obtained, is of the genus
Chlorella, preferably, Chlorella protothecoides.
[0123] Chlorella is a genus of single-celled green algae, belonging
to the phylum Chlorophyta. It is spherical in shape, about 2 to 10
.mu.m in diameter, and is without flagella. Some species of
Chlorella are naturally heterotrophic.
[0124] Chlorella, particularly Chlorella protothecoides, is a
preferred microorganism for use in the invention because of its
high composition (at least about 55% by weight) of lipid,
particularly long-chain lipid suitable for biodiesel. In addition,
this microalgae grows heterotrophically, can be genetically
engineered as demonstrated in the Examples herein, and can be lysed
by Chlorella virus.
[0125] In a preferred embodiment of the present invention, the
microorganism used for expression of a transgene is of the genus
Chlorella, preferably, Chlorella protothecoides. Examples of
expression of transgenes in, e.g., Chlorella, can be found in the
literature (see for example Current Microbiology Vol. 35 (1997),
pp. 356-362; Sheng Wu Gong Cheng Xue Bao. 2000 July; 16(4):443-6;
Current Microbiology Vol. 38 (1999), pp. 335-341; Appl Microbiol
Biotechnol (2006) 72: 197-205; Marine Biotechnology 4, 63-73, 2002;
Current Genetics 39:5, 365-370 (2001); Plant Cell Reports 18:9,
778-780, (1999); Biologia Plantarium 42(2): 209-216, (1999); Plant
Pathol. J 21(1): 13-20, (2005)). Also see Examples herein. Other
lipid-producing microbes can be engineered as well, including
prokaryotic microbes (see Kalscheuer et al., Applied Microbiology
and Biotechnology, volume 52, number 4/October, 1999).
[0126] In another preferred embodiment of the present invention,
the microorganism producing a lipid or a microorganism from which a
lipid can be extracted, recovered, or obtained, is of the genus
Prototheca, preferably, Prototheca moriformis. Species of the genus
Prototheca are suited for the production of lipid because they can
produce high levels of lipids, particularly lipids suitable for
fuel and chemical production. The lipid produced by Prototheca has
fatty acid chains of shorter chain length and a higher degree of
saturation than the lipid produced by most microalgae. Moreover,
Prototheca lipid is generally free of pigment (low to undetectable
levels of chlorophyll and certain carotenoids) and in any event
contains much less pigment than lipid from other microalgae.
Illustrative Prototheca strains for use in the methods of the
invention include Prototheca wickerhamii, Prototheca stagnora
(including UTEX 327), Prototheca portoricensis, Prototheca
moriformis (including UTEX strains 1441, 1435), and Prototheca
zopfii. Species of the genus Prototheca are obligate
heterotrophs.
[0127] 2. Identification of Microalgal Species
[0128] Species of microalgae, including Chlorella and Prototheca,
for use in the invention can be identified by amplification of
certain target regions of the genome. For example, identification
of a specific Chlorella species can be achieved through
amplification and sequencing of nuclear and/or chloroplast DNA
using primers and methodology described in Wu et al.,
Identification of Chlorella spp. isolates using any region of the
genome. Examples include ribosomal DNA sequences, Bot. Bull. Acad.
Sin. (2001) 42:115-121. Well established methods of phylogenetic
analysis, such as amplification and sequencing of ribosomal
internal transcribed spacer (ITS1 and ITS2 rDNA), 18S rRNA, and
other conserved genomic regions can be used by those skilled in the
art to identify species of not only Chlorella or Prototheca, but
other hydrocarbon and lipid producing organisms capable of using
the methods disclosed herein. For examples of methods of
identification and classification of algae also see for example
Genetics, 2005 August; 170(4):1601-10 and RNA, 2005 April;
11(4):361-4.
[0129] Genomic DNA comparison can be used to identify species of
microalgae to be used in the present invention. Regions of
conserved genomic DNA, such as but not limited to DNA encoding 23S
rRNA, can be amplified from microalgal species and compared to
consensus sequences in order to screen for microalgal species that
are taxonomically related to the preferred microalgae used in the
present invention. Examples of such DNA sequence comparison for
species within the Chlorella genus are shown below.
[0130] Genomic DNA comparison can also be useful to identify
microalgal species that have been misidentified in a strain
collection. Often a strain collection will identify species of
microalgae based on phenotypic and morphological characteristics.
The use of these characteristics may lead to miscategorization of
the species or the genus of a microalgae. The use of genomic DNA
comparison can be a better method of categorizing microalgae
species based on their phylogenetic relationship. Specific examples
of using genotyping data to establish phyogenetic relationships of
possibly misidentified microalgal strains are described below in
the Examples.
[0131] In some cases, microalgae that are preferred for use in the
present invention have genomic DNA sequences encoding for 23S rRNA
that have at least 99%, at least 98%, at least 97%, at least 96%,
at least 95%, at least 94%, at least 93%, at least 92%, at least
91%, at least 90%, at least 89%, at least 88%, at least 87%, or at
least 86% nucleotide identity to at least one of the sequences
listed in SEQ ID NOs: 7-31. In other cases, microalgae that are
preferred for use in the present invention have genomic DNA
sequences encoding for 23S rRNA that have at least 85%, at least
80%, at least 75% at least 70% at least 65% or at least 60%
nucleotide identity to at least one of the sequences listed in SEQ
ID NOs.7-31, 32, 33, 34, 35, 36, 37, 38, and 39.
[0132] B. Oleaginous Yeast
[0133] In a preferred embodiment of the present invention, a
microorganism producing a lipid or a microorganism from which a
lipid can be extracted, recovered, or obtained, is an oleaginous
yeast.
[0134] Examples of oleaginous yeast that can be used to practice
the present invention include, but are not limited to the following
oleaginous yeast listed in Table 2.
TABLE-US-00002 TABLE 2 Examples of oleaginous yeast. Candida
apicola, Candida sp., Cryptococcus curvatus, Cryptococcus
terricolus, Debaromyces hansenii, Endomycopsis vernalis, Geotrichum
carabidarum, Geotrichum cucujoidarum, Geotrichum histeridarum,
Geotrichum silvicola, Geotrichum vulgare, Hyphopichia burtonii,
Lipomyces lipofer, Lypomyces orentalis, Lipomyces starkeyi,
Lipomyces tetrasporous, Pichia mexicana, Rodosporidium
sphaerocarpum, Rhodosporidium toruloides Rhodotorula aurantiaca,
Rhodotorula dairenensis, Rhodotorula diffluens, Rhodotorula
glutinus, Rhodotorula glutinis var. glutinis, Rhodotorula gracilis,
Rhodotorula graminis Rhodotorula minuta, Rhodotorula mucilaginosa,
Rhodotorula mucilaginosa var. mucilaginosa, Rhodotorula
terpenoidalis, Rhodotorula toruloides, Sporobolomyces
alborubescens, Starmerella bombicola, Torulaspora delbruekii,
Torulaspora pretoriensis, Trichosporon behrend, Trichosporon
brassicae, Trichosporon domesticum, Trichosporon laibachii,
Trichosporon loubieri, Trichosporon loubieri var. loubieri,
Trichosporon montevideense, Trichosporon pullulans, Trichosporon
sp., Wickerhamomyces Canadensis, Yarrowia lipolytica, and Zygoascus
meyerae.
[0135] In a preferred embodiment of the present invention, the
microorganism used for expression of a transgene is an oleaginous
yeast. Examples of expression of transgenes in oleaginous yeast
(e.g., Yarrowia lipolytica) can be found in the literature (see,
for example, Bordes et al., J Microbiol Methods, Jun. 27
(2007)).
[0136] C. Other Fungi
[0137] In a preferred embodiment of the present invention, a
microorganism producing a lipid or a microorganism from which a
lipid can be extracted, recovered, or obtained, is a fungus.
[0138] Examples of fungi that can be used to practice the present
invention include, but are not limited to the following fungi
listed in Table 3.
TABLE-US-00003 TABLE 3 Examples of non-yeast fungi. Mortierella,
Mortierrla vinacea, Mortierella alpine, Pythium debaryanum, Mucor
circinelloides, Aspergillus ochraceus, Aspergillus terreus,
Pennicillium iilacinum, Hensenulo, Chaetomium, Cladosporium,
Malbranchea, Rhizopus, and Pythium
[0139] In a preferred embodiment of the present invention, the
microorganism used for expression of a transgene is a fungus.
Examples of expression of transgenes in fungi (e.g., Mortierella
alpine, Mucor circinelloides, and Aspergillus ochraceus) can also
be found in the literature (see, for example, Microbiology, July;
153 (Pt. 7):2013-25 (2007); Mol Genet Genomics, June;
271(5):595-602 (2004); Curr Genet, March; 21(3):215-23 (1992);
Current Microbiology, 30(2):83-86 (1995); Sakuradani, NISR Research
Grant, "Studies of Metabolic Engineering of Useful Lipid-producing
Microorganisms" (2004); and PCT/JP2004/012021).
[0140] D. Bacteria
[0141] In a preferred embodiment of the present invention, a
microorganism producing a lipid or a microorganism from which a
lipid can be extracted, recovered, or obtained, is a bacterium.
[0142] Examples of expression of exogenous genes in bacteria, such
as E. coli, are well known; see for example Molecular Cloning: A
Laboratory Manual, Sambrook et al. (3d edition, 2001, Cold Spring
Harbor Press).
IV. Microbe Engineering
[0143] In certain embodiments of the present invention, it is
desirous to genetically modify a microorganism. Thus, the present
application describes genetically engineering strains of
microalgae, oleaginous yeast, bacteria, or fungi with one or more
exogenous genes to produce various hydrocarbon compounds.
[0144] Promoters, cDNAs, and 3'UTRs, as well as other elements of
expression vectors, can be generated through cloning techniques
using fragments isolated from native sources (see for example
Molecular Cloning: A Laboratory Manual, Sambrook et al. (3d
edition, 2001, Cold Spring Harbor Press; and U.S. Pat. No.
4,683,202). Alternatively, elements can be generated synthetically
using known methods (see for example Gene, 1995 Oct. 16;
164(1):49-53).
[0145] A. Codon-Optimization for Expression
[0146] DNA encoding a polypeptide to be expressed in a
microorganism, e.g., a lipase and selectable marker are preferably
codon-optimized cDNA. Methods of recoding genes for expression in
microalgae are described in U.S. Pat. No. 7,135,290. Additional
information for codon optimization is available, e.g., at the codon
usage database of GenBank. As non-limiting examples, codon usage in
Prototheca species, Dunaliella salina, and Chlorella protothecoides
are shown in Tables 4, 5, and 6, respectively.
TABLE-US-00004 TABLE 4 Codon usage in Prototheca species Ala GCG
345 (0.36) GCA 66 (0.07) GCT 101 (0.11) GCC 442 (0.46) Cys TGT 12
(0.10) TGC 105 (0.90) Asp GAT 43 (0.12) GAC 316 (0.88) Glu GAG 377
(0.96) GAA 14 (0.04) Phe TTT 89 (0.29) TTC 216 (0.71) Gly GGG 92
(0.12) GGA 56 (0.07) GGT 76 (0.10) GGC 559 (0.71) His CAT 42 (0.21)
CAC 154 (0.79) Ile ATA 4 (0.01) ATT 30 (0.08) ATC 338 (0.91) Lys
AAG 284 (0.98) AAA 7 (0.02) Leu TTG 26 (0.04) TTA 3 (0.00) CTG 447
(0.61) CTA 20 (0.03) CTT 45 (0.06) CTC 190 (0.26) Met ATG 191
(1.00) Asn AAT 8 (0.04) AAC 201 (0.96) Pro CCG 161 (0.29) CCA 49
(0.09) CCT 71 (0.13) CCC 267 (0.49) Gln CAG 226 (0.82) CAA 48
(0.18) Arg AGG 33 (0.06) AGA 14 (0.02) CGG 102 (0.18) CGA 49 (0.08)
CGT 51 (0.09) CGC 331 (0.57) Ser AGT 16 (0.03) AGC 123 (0.22) TCG
152 (0.28) TCA 31 (0.06) TCT 55 (0.10) TCC 173 (0.31) Thr ACG 184
(0.38) ACA 24 (0.05) ACT 21 (0.05) ACC 249 (0.52) Val GTG 308
(0.50) GTA 9 (0.01) GTT 35 (0.06) GTC 262 (0.43) Trp TGG 107 (1.00)
Tyr TAT 10 (0.05) TAC 180 (0.95) Stop TGA/TAG/TAA
TABLE-US-00005 TABLE 5 Preferred codon usage in Dunaliella salina.
TTC (Phe) TAC (Tyr) TGC (Cys) TAA (Stop) TGG (Trp) CCC (Pro) CAC
(His) CGC (Arg) CTG (Leu) CAG (Gln) ATC (Ile) ACC (Thr) AAC (Asn)
AGC (Ser) ATG (Met) AAG (Lys) GCC (Ala) GAC (Asp) GGC (Gly) GTG
(Val) GAG (Glu)
TABLE-US-00006 TABLE 6 Preferred codon usage in Chlorella
protothecoides. TTC (Phe) TAC (Tyr) TGC (Cys) TGA (Stop) TGG (Trp)
CCC (Pro) CAC (His) CGC (Arg) CTG (Leu) CAG (Gln) ATC (Ile) ACC
(Thr) GAC (Asp) TCC (Ser) ATG (Met) AAG (Lys) GCC (Ala) AAC (Asn)
GGC (Gly) GTG (Val) GAG (Glu)
[0147] B. Promoters
[0148] Many promoters are active in microalgae, including promoters
that are endogenous to the algae being transformed, as well as
promoters that are not endogenous to the algae being transformed
(i.e., promoters from other algae, promoters from higher plants,
and promoters from plant viruses or algae viruses). Exogenous
and/or endogenous promoters that are active in microalgae, and
antibiotic resistance genes functional in microalgae are described
by e.g., Curr Microbiol. 1997 December; 35(6):356-62 (Chlorella
vulgaris); Mar Biotechnol (NY). 2002 January; 4(1):63-73 (Chlorella
ellipsoidea); Mol Gen Genet. 1996 Oct. 16; 252(5):572-9
(Phaeodactylum tricornutum); Plant Mol Biol. 1996 April; 31(1):1-12
(Volvox carteri); Proc Natl Acad Sci USA. 1994 Nov. 22;
91(24):11562-6 (Volvox carteri); Falciatore A, Casotti R, Leblanc
C, Abrescia C, Bowler C, PMID: 10383998, 1999 May; 1(3):239-251
(Laboratory of Molecular Plant Biology, Stazione Zoologica, Villa
Comunale, I-80121 Naples, Italy) (Phaeodactylum tricornutum and
Thalassiosira weissflogii); Plant Physiol. 2002 May; 129(1):7-12.
(Porphyridium sp.); Proc Natl Acad Sci USA. 2003 Jan 21;
100(2):438-42. (Chlamydomonas reinhardtii); Proc Natl Acad Sci USA.
1990 February; 87(3):1228-32. (Chlamydomonas reinhardtii); Nucleic
Acids Res. 1992 Jun. 25; 20(12):2959-65; Mar Biotechnol (NY). 2002
January; 4(1):63-73 (Chlorella); Biochem Mol Biol Int. 1995 August;
36(5):1025-35 (Chlamydomonas reinhardtii); J Microbiol. 2005
August; 43(4):361-5 (Dunaliella); Yi Chuan Xue Bao. 2005 April;
32(4):424-33 (Dunaliella); Mar Biotechnol (NY). 1999 May;
1(3):239-251. (Thalassiosira and Phaedactylum); Koksharova, Appl
Microbiol Biotechnol 2002 February; 58(2):123-37 (various species);
Mol Genet Genomics 2004 February; 271(1):50-9 (Thermosynechococcus
elongates); J. Bacteriol. (2000), 182, 211-215; FEMS Microbiol
Lett. 2003 Apr. 25; 221(2):155-9; Plant Physiol. 1994 June;
105(2):635-41; Plant Mol Biol. 1995 December; 29(5):897-907
(Synechococcus PCC 7942); Mar Pollut Bull. 2002; 45 (1-12):163-7
(Anabaena PCC 7120); Proc Natl Acad Sci USA. 1984 March;
81(5):1561-5 (Anabaena (various strains)); Proc Natl Acad Sci USA.
2001 Mar. 27; 98(7):4243-8 (Synechocystis); Wirth, Mol Gen Genet
1989 March; 216(1):175-7 (various species); Mol Microbiol, 2002
June; 44(6):1517-31; Plasmid, 1993 September; 30(2):90-105
(Fremyella diplosiphon); Hall et al. (1993) Gene 124: 75-81
(Chlamydomonas reinhardtii); Gruber et al. (1991). Current Micro.
22: 15-20; Jarvis et al. (1991) Current Genet. 19: 317-322
(Chlorella); for additional promoters see also Table 1 from U.S.
Pat. No. 6,027,900).
[0149] The promoter used to express an exogenous gene can be the
promoter naturally linked to that gene or can be a heterologous
gene. Some promoters are active in more than one species of
microalgae. Other promoters are species-specific. Preferred
promoters include promoters such as RBCS2 from Chlamydomonas
reinhardtii and viral promoters, such as cauliflower mosaic virus
(CMV) and chlorella virus, which have been shown to be active in
multiple species of microalgae (see for example Plant Cell Rep.
2005 March; 23 (10-11):727-35; J Microbiol. 2005 August;
43(4):361-5; Mar Biotechnol (NY). 2002 January; 4(1):63-73). In
other embodiments, the Botryococcus malate dehydrogenase promoter,
such a nucleic acid comprising any part of SEQ ID NO:3, or the
Chlamydomonas reinhardtii RBCS2 promoter (SEQ ID NO:4) can be used.
Optionally, at least 10, 20, 30, 40, 50, or 60 nucleotides or more
of these sequences containing a promoter are used. Preferred
promoters endogenous to species of the genus Chlorella are SEQ ID
NOs: 1 and 2.
[0150] Preferred promoters useful for expression of exogenous genes
in Chlorella are listed in the sequence listing of this
application, such as the promoter of the Chlorella HUP1 gene (SEQ
ID NO:1) and the Chlorella ellipsoidea nitrate reductase promoter
(SEQ ID NO:2). Chlorella virus promoters can also be used to
express genes in Chlorella, such as SEQ ID NOs: 1-7 of U.S. Pat.
No. 6,395,965. Additional promoters active in Chlorella can be
found, for example, in Biochem Biophys Res Commun, 1994 Oct. 14;
204(1):187-94; Plant Mol Biol, 1994 October; 26(1):85-93; Virology,
2004 Aug. 15; 326(1):150-9; and Virology, 2004 Jan 5;
318(1):214-23.
[0151] C. Selectable Markers
[0152] Any of a wide variety of selectable markers can be employed
in a transgene construct useful for transforming a microorganism,
e.g., Chlorella. Examples of suitable selectable markers include
the nitrate reductase gene, the hygromycin phosphotransferase gene
(HPT), the neomycin phosphotransferase gene, and the ble gene,
which confers resistance to phleomycin. Methods of determining
sensitivity of microalgae to antibiotics are well known. For
example, Mol Gen Genet, 1996 Oct. 16; 252(5):572-9.
[0153] More specifically, Dawson et al. (1997), Current
Microbiology 35:356-362 (incorporated by reference herein in its
entirety), described the use of the nitrate reductase (NR) gene
from Chlorella vulgaris as a selectable marker for NR-deficient
Chlorella sorokiniana mutants. Kim et al. (2002), Mar. Biotechnol.
4:63-73 (incorporated by reference herein in its entirety),
disclosed the use of the HPT gene as a selectable marker for
transforming Chorella ellipsoidea. Huang et al. (2007), Appl.
Microbiol. Biotechnol. 72: 197-205 (incorporated by reference
herein in its entirety), reported on the use of Sh ble as a
selectable marker for Chlorella sp. DT.
[0154] D. Inducible Expression
[0155] The present invention also provides for the use of an
inducible promoter to express a gene of interest. In particular,
the use of an inducible promoter to express a lipase gene permits
production of the lipase after growth of the microorganism when
conditions have been adjusted, if necessary, to enhance
transesterification, for example, after disruption of the cells,
reduction of the water content of the reaction mixture, and/or
addition sufficient alcohol to drive conversion of TAGs to fatty
acid esters.
[0156] Inducible promoters useful in the invention include those
that mediate transcription of an operably linked gene in response
to a stimulus, such as an exogenously provided small molecule (e.g,
glucose, as in SEQ ID NO:1), temperature (heat or cold), light,
etc. Suitable promoters can activate transcription of an
essentially silent gene or upregulate, preferably substantially,
transcription of an operably linked gene that is transcribed at a
low level. In the latter case, the level of transcription of the
gene of interest, e.g., the lipase gene, preferably does not
significantly interfere with the growth of the microorganism in
which it is expressed.
[0157] Expression of a transgene in Chlorella can be performed
under inducible conditions, e.g., using promoters such as the
promoter for the Chlorella hexose transporter gene (SEQ ID NO:1).
This promoter is strongly activated by the presence of glucose in
the culture media.
[0158] E. Expression of Two or More Exogenous Genes
[0159] Further, a genetically engineered microorganism, such as a
microalgae, may comprise and express two or more exogenous genes,
such as, for example, a lipase and a lytic gene, e.g., one encoding
a polysaccharide-degrading enzyme. One or both genes can be
expressed using an inducible promoter, which allows the relative
timing of expression of these genes to be controlled to enhance the
lipid yield and conversion to fatty acid esters. Expression of the
two or more exogenous genes may be under control of the same
inducible promoter or under control of a different inducible
promoters. In the latter situation, expression of a first exogenous
gene can be induced for a first period of time (during which
expression of a second exogenous gene may or may not be induced)
and expression of a second exogenous gene can be induced for a
second period of time (during which expression of a first exogenous
gene may or may not be induced). Provided herein are vectors and
methods for engineering lipid-producing microbes to metabolize
sucrose, which is an advantageous trait because it allows the
engineered cells to convert sugar cane feedstocks into lipids
appropriate for biodiesel production.
[0160] Also provided herein are genetically engineered strains of
microbes (e.g., microalgae, oleaginous yeast, bacteria, or fungi)
that express two or more exogenous genes, such as, for example, a
fatty acyl-ACP thioesterase and a fatty acyl-CoA/aldehyde
reductase, the combined action of which yields an alcohol product.
Further provided are other combinations of exogenous genes,
including without limitation, a fatty acyl-ACP thioesterase and a
fatty acyl-CoA reductase to generate aldehydes. In addition, this
application provides for the combination of a fatty acyl-ACP
thioesterase, a fatty acyl-CoA reductase, and a fatty aldehyde
decarbonylase to generate alkanes. One or more of the exogenous
genes can be expressed using an inducible promoter.
[0161] Examples of further modifications suitable for use in the
present invention are described in co-pending, commonly owned
Application No. 60/837,839, which is incorporated herein by
reference. This application discloses genetically engineering
strains of microalgae to express two or more exogenous genes, one
encoding a transporter of a fixed carbon source (such as sucrose)
and a second encoding a sucrose invertase enzyme. The resulting
fermentable organisms produce hydrocarbons at lower manufacturing
cost than what has been obtainable by previously known methods of
biological hydrocarbon production. This co-pending application also
teaches that the insertion of the two exogenous genes described
above can be combined with the disruption of polysaccharide
biosynthesis through directed and/or random mutagenesis, which
steers ever greater carbon flux into hydrocarbon production.
Individually and in combination, trophic conversion, engineering to
alter hydrocarbon production and treatment with exogenous enzymes
alter the hydrocarbon composition produced by a microorganism. The
alteration can be a change in the amount of hydrocarbons produced,
the amount of one or more hydrocarbon species produced relative to
other hydrocarbons, and/or the types of hydrocarbon species
produced in the microorganism. For example, microalgae can be
engineered to produce a higher amount and/or percentage of
TAGs.
[0162] F. Compartmentalized Expression
[0163] The present invention also provides for compartmentalized
expression a gene of interest. In particular, it can be
advantageous, in particular embodiments, to target expression of a
lipase gene, to one or more cellular compartments, where it is
sequestered from the majority of cellular lipids until initiation
of the transesterification reaction. Preferred organelles for
targeting are chloroplasts, mitochondria, and endoplasmic
reticulum.
[0164] 1. Expression in Chloroplasts
[0165] In a preferred embodiment of the present invention, the
expression of a polypeptide in a microorganism is targeted to
chloroplasts. Methods for targeting expression of a heterologous
gene to the chloroplast are known and can be employed in the
present invention. Methods for targeting foreign gene products into
chloroplasts are described in Shrier et al., EMBO J. (1985) 4:25
32. See also Tomai et al., Gen. Biol. Chem. (1988) 263:15104 15109
and U.S. Pat. No. 4,940,835 for the use of transit peptides for
translocating nuclear gene products into the chloroplast. Methods
for directing the transport of proteins to the chloroplast are also
reviewed in Kenauf TIBTECH (1987) 5:40 47. Chloroplast targeting
sequences endogenous to Chlorella are known, such as genes in the
Chlorella nuclear genome that encode proteins that are targeted to
the chloroplast; see for example GenBank Accession numbers AY646197
and AF499684.
[0166] Wageningen UR-Plant Research International sells an
IMPACTVECTOR1.4 vector, which uses the secretion signal of the
Chrysanthemum morifolium small subunit protein to deliver a
heterologous protein into the chloroplast stroma (cytoplasmic)
environment, shuttling across a double membrane system. The protein
is fused to the first 11 amino acids of the mature rubisco protein
in order to allow proper processing of the signal peptide (Wong et
al., Plant Molecular Biology 20: 81-93 (1992)). The signal peptide
contains a natural intron from the RbcS gene.
[0167] In another approach, the chloroplast genome is genetically
engineered to express the heterologous protein. Stable
transformation of chloroplasts of Chlamydomonas reinhardtii (a
green alga) using bombardment of recipient cells with high-velocity
tungsten microprojectiles coated with foreign DNA has been
described. See, for example, Boynton et al., Science (1988) 240:
1534 1538; Blowers et al. Plant Cell (1989) 1:123 132 and Debuchy
et al., EMBO J. (1989) 8: 2803 2809. The transformation technique,
using tungsten microprojectiles, is described by Klein et al.,
Nature (London) (1987) 7:70 73. Other methods of chloroplast
transformation for both plants and microalgae are known. See for
example U.S. Pat. Nos. 5,693,507; 6,680,426; Plant Physiol. 2002
May; 129(1):7-12; and Plant Biotechnol J. 2007 May;
5(3):402-12.
[0168] As described in U.S. Pat. No. 6,320,101 (issued Nov. 20,
2001 to Kaplan et al.; which is incorporated herein by reference),
cells can be chemically treated so as to reduce the number of
chloroplasts per cell to about one. Then, the heterologous nucleic
acid can be introduced into the cells via particle bombardment with
the aim of introducing at least one heterologous nucleic acid
molecule into the chloroplasts. The heterologous nucleic acid is
selected such that it is integratable into the chloroplast's genome
via homologous recombination which is readily effected by enzymes
inherent to the chloroplast. To this end, the heterologous nucleic
acid includes, in addition to a gene of interest, at least one
nucleic acid sequence that is derived from the chloroplast's
genome. In addition, the heterologous nucleic acid typically
includes a selectable marker. Further details relating to this
technique are found in U.S. Pat. Nos. 4,945,050 and 5,693,507,
which are incorporated herein by reference. A polypeptide can thus
be produced by the protein expression system of the
chloroplast.
[0169] U.S. Pat. No. 7,135,620 (issued Nov. 14, 2006 to Daniell et
al.; incorporated herein by reference) describes chloroplast
expression vectors and related methods. Expression cassettes are
DNA constructs including a coding sequence and appropriate control
sequences to provide for proper expression of the coding sequence
in the chloroplast. Typical expression cassettes include the
following components: the 5' untranslated region from a
microorganism gene or chloroplast gene such as psbA which will
provide for transcription and translation of a DNA sequence
encoding a polypeptide of interest in the chloroplast; a DNA
sequence encoding a polypeptide of interest; and a translational
and transcriptional termination region, such as a 3' inverted
repeat region of a chloroplast gene that can stabilize RNA of
introduced genes, thereby enhancing foreign gene expression. The
cassette can optionally include an antibiotic resistance gene.
[0170] Typically, the expression cassette is flanked by convenient
restriction sites for insertion into an appropriate genome. The
expression cassette can be flanked by DNA sequences from
chloroplast DNA to facilitate stable integration of the expression
cassette into the chloroplast genome, particularly by homologous
recombination. Alternatively, the expression cassette may remain
unintegrated, in which case, the expression cassette typically
includes a chloroplast origin of replication, which is capable of
providing for replication of the heterologous DNA in the
chloroplast.
[0171] The expression cassette generally includes a promoter region
from a gene capable of expression in the chloroplast. The promoter
region may include promoters obtainable from chloroplast genes,
such as the psbA gene from spinach or pea, or the rbcL and atpB
promoter region from maize and rRNA promoters. Examples of
promoters are described in Hanley-Bowdoin and Chua, TIBS (1987)
12:67 70; Mullet et al., Plant Molec Biol. (1985) 4: 39 54;
Hanley-Bowdoin (1986) PhD. Dissertation, the Rockefeller
University; Krebbers et al., Nucleic Acids Res. (1982) 10: 4985
5002; Zurawaki et al., Nucleic Acids Res. (1981) 9:3251 3270; and
Zurawski et al., Proc. Natl. Acad. Sci. U.S.A. (1982) 79: 7699
7703. Other promoters can be identified and the relative strength
of promoters so identified evaluated, by placing a promoter of
interest 5' to a promoterless marker gene and observing its
effectiveness relative to transcription obtained from, for example,
the promoter from the psbA gene, a relatively strong chloroplast
promoter. The efficiency of heterologous gene expression
additionally can be enhanced by any of a variety of techniques.
These include the use of multiple promoters inserted in tandem 5'
to the heterologous gene, for example a double psbA promoter, the
addition of enhancer sequences and the like.
[0172] Numerous promoters active in the Chlorella chloroplast can
be used for expression of exogenous genes in the Chlorella
chloroplast, such as those found in GenBank accession number
NC.sub.--001865 (Chlorella vulgaris chloroplast, complete
genome).
[0173] Where it is desired to provide for inducible expression of
the heterologous gene, an inducible promoter and/or a 5'
untranslated region containing sequences which provide for
regulation at the level of transcription and/or translation (at the
3' end) may be included in the expression cassette. For example,
the 5' untranslated region can be from a gene wherein expression is
regulatable by light. Similarly, 3' inverted repeat regions could
be used to stabilize RNA of heterologous genes. Inducible genes may
be identified by enhanced expression in response to a particular
stimulus of interest and low or absent expression in the absence of
the stimulus. For example, a light-inducible gene can be identified
where enhanced expression occurs during irradiation with light,
while substantially reduced expression or no expression occurs in
low or no light. Light regulated promoters from green microalgae
are known (see for example Mol Genet Genomics, 2005 December;
274(6):625-36).
[0174] The termination region which is employed will be primarily
one of convenience, since the termination region appears to be
relatively interchangeable among chloroplasts and bacteria. The
termination region may be native to the transcriptional initiation
region, may be native to the DNA sequence of interest, or may be
obtainable from another source. See, for example, Chen and Orozco,
Nucleic Acids Res. (1988) 16:8411.
[0175] The expression cassettes may be transformed into a plant
cell of interest by any of a number of methods. These methods
include, for example, biolistic methods (See, for example, Sanford,
Trends In Biotech. (1988) 6:299 302, U.S. Pat. No. 4,945,050;
electroporation (Fromm et al., Proc. Natl. Acad. Sci. (USA) (1985)
82:5824 5828); use of a laser beam, microinjection or any other
method capable of introducing DNA into a chloroplast.
[0176] Additional descriptions of chloroplast expression vectors
suitable for use in microorganisms such as microalgae are found in
U.S. Pat. No. 7,081,567 (issued Jul. 25, 2006 to Xue et al.); U.S.
Pat. No. 6,680,426 (issued Jan. 20, 2004 to Daniell et al.); and
U.S. Pat. No. 5,693,507 (issued Dec. 2, 1997 to Daniell et
al.).
[0177] Proteins expressed in the nuclear genome of Chlorella can be
targeted to the chloroplast using chloroplast targeting signals.
Chloroplast targeting sequences endogenous to Chlorella are known,
such as genes in the Chlorella nuclear genome that encode proteins
that are targeted to the chloroplast; see for example GenBank
Accession numbers AY646197 and AF499684. Proteins can also be
expressed in the Chlorella chloroplast by insertion of genes
directly into the chloroplast genome. Chloroplast transformation
typically occurs through homologous recombination, and can be
performed if chloroplast genome sequences are known for creation of
targeting vectors (see for example the complete genome sequence of
a Chlorella chloroplast; Genbank accession number NC.sub.--001865).
See previous sections herein for details of chloroplast
transformation.
[0178] 2. Expression in Mitochondria
[0179] In another preferred embodiment of the present invention,
the expression of a polypeptide in a microorganism is targeted to
mitochondria. Methods for targeting foreign gene products into
mitochondria (Boutry et al., Nature (London) (1987) 328:340 342)
have been described, including in green microalgae (see for example
Mol Gen Genet., 1993 January; 236 (2-3):235-44).
[0180] For example, an expression vector encoding a suitable
secretion signal can target a heterologous protein to the
mitochondria. An exemplary expression vector for mitochondria
targeting is the IMPACTVECTOR1.5 vector, from Wageningen UR-Plant
Research International, which uses the yeast CoxIV secretion
signal. This expression vector was shown to deliver proteins in the
mitochondrial matrix. The protein is fused to the first 4 amino
acids of the yeast CoxIV protein in order to allow proper
processing of the signal peptide (Kohler et al., Plant J. 11:
613-621 (1997)). Other mitochondrial targeting sequences are known,
including those functional in green microalgae. For example, see
FEBS Lett. 1990 Jan. 29; 260(2):165-8; and J. Biol. Chem. 2002 Feb.
22; 277(8):6051-8.
[0181] Proteins expressed in the nuclear genome of Chlorella can be
targeted to the mitochondria using mitochondrial targeting signals.
Details of mitochondrial protein targeting and transformation are
provided herein.
[0182] 3. Expression in Endoplasmic Reticulum
[0183] In another preferred embodiment of the present invention,
the expression of a polypeptide in a microorganism is targeted to
the endoplasmic reticulum (ER). The inclusion of an appropriate
retention or sorting signal in an expression vector ensure that
proteins are retained in the endoplasmic reticulum (ER) and do not
go downstream into Golgi. For example, the IMPACTVECTOR1.3 vector,
from Wageningen UR-Plant Research International, includes the well
known KDEL (SEQ ID NO:96) retention or sorting signal. With this
vector, ER retention has a practical advantage in that it has been
reported to improve expression levels 5-fold or more. The main
reason for this appears to be that the ER contains lower
concentrations and/or different proteases responsible for
post-translational degradation of expressed proteins than are
present in the cytoplasm. ER retention signals functional in green
microalgae are known. For example, see Proc. Nat.l Acad. Sci. USA.
2005 Apr. 26; 102(17):6225-30.
[0184] G. Transformation
[0185] Cells can be transformed by any suitable technique
including, e.g., biolistics, electroporation (see Maruyama et al.,
(2004) Biotechnology Techniques 8:821-826), glass bead
transformation and silicon carbide whisker transformation. Another
method that can be used involves forming protoplasts and using
CaCl.sub.2 and polyethylene glycol (PEG) to introduce recombinant
DNA into microalgal cells (see Kim et al., (2002), Mar. Biotechnol.
4:63-73, which reports the use of this method for the
transformation of Chlorella ellipsoidea). Co-transformation of
microalgae can be used to introduce two distinct vector molecules
into a cell simultaneously (see for example, Protist (2004)
December; 155(4):381-93).
[0186] Biolistic methods (see for example, Sanford, Trends in
Biotech. (1988) 6:299-302, U.S. Pat. No. 4,945,050; electroporation
(Fromm et al., PNAS (1985) 82:5824-5828), use of a laser beam,
microinjection, or any other method capable of introducing DNA into
a microalgae can also be used for transformation.
[0187] H. Lipid Pathway Engineering
[0188] In certain embodiments of the present invention, it is
preferred to further modify a microorganism, such as a microalgae,
for example, to provide desired growth characteristics and/or to
enhance the amount and/or quality of lipids produced. For example,
microalgae can be engineered to increase carbon flux into the lipid
pathway and/or modify the lipid pathway to beneficially alter the
proportions or properties of lipid produced by the cells. The
pathway is further, or alternatively, modified to alter the
properties and/or proportions of various hydrocarbon molecules
produced through enzymatic processing of lipids.
[0189] 1. Alteration of Properties or Portions of Lipids or
Hydrocarbons Produced
[0190] In some embodiments of the present invention, it can be
desirable to alter characteristics, such as lipid yield per unit
volume and/or per unit time, carbon chain length (e.g., for
biodiesel production or for industrial applications requiring
hydrocarbon feedstock), reducing the number of double or triple
bonds, optionally to zero, removing or eliminating rings and cyclic
structures, and increasing the hydrogen:carbon ratio of a
particular species of lipid or of a population of distinct lipid.
In addition, microalgae that produce appropriate hydrocarbons can
also be engineered to have even more desirable hydrocarbon outputs.
Examples of such microalgae include species of the genus
Chlorella.
[0191] a) Regulation of Enzymes Controlling Branch Points in Fatty
Acid Synthesis
[0192] In particular embodiments of the present invention, one or
more key enzymes that control branch points in metabolism to fatty
acid synthesis is up-regulated or down-regulated to improve lipid
production. Up-regulation is achieved, for example, by transforming
cells with expression constructs in which a gene encoding the
enzyme of interest is expressed, e.g., using a strong promoter
and/or enhancer elements that increase transcription. Such
expression constructs can include a selectable marker such that the
transformants can be subjected to selection, which can result in
amplification of the construct and an increase in the expression
level of the encoded enzyme. Examples of enzymes suitable for
up-regulation according to the methods of the invention include
pyruvate dehydrogenase, which plays a role in converting pyruvate
to acetyl-CoA (examples, some from microalgae, include GenBank
accession numbers NP.sub.--415392; AAA53047; Q1XDM1; and CAF05587).
Up-regulation of pyruvate dehydrogenase can increase production of
acetyl-CoA, and thereby increase fatty acid synthesis. Acetyl-CoA
carboxylase catalyzes the initial step in fatty acid synthesis.
Accordingly, in certain embodiments of the present invention, this
enzyme is up-regulated to increase production of fatty acids
(examples, some from microalgae, include GenBank accession numbers
BAA94752; AAA75528; AAA81471; YP.sub.--537052; YP.sub.--536879;
NP.sub.--045833; and BAA57908). In another embodiment, fatty acid
production is increased by up-regulation of acyl carrier protein
(ACP), which carries the growing acyl chains during fatty acid
synthesis (examples, some from microalgae, include GenBank
accession numbers A0T0F8; P51280; NP.sub.--849041;
YP.sub.--874433). Glycerol-3-phosphate acyltransferase catalyzes
the rate-limiting step of fatty acid synthesis. Up-regulation of
this enzyme is desired to increase fatty acid production (examples,
some from microalgae, include GenBank accession numbers AAA74319;
AAA33122; AAA37647; P44857; and ABO94442). In some embodiments, two
or more of these polypeptides (pyruvate dehydrogenase, Acetyl-CoA
carboxylase, acyl carrier protein (ACP), Glycerol-3-phosphate
acyltransferase) are up-regulated. In that case, the two or more
genes encoding the respective polypeptides may reside on a single
expression construct or, alternatively, on two or more expression
constructs. The preceding proteins are candidates for expression in
microalgae, including species of the genus Chlorella and/or
Prototheca.
[0193] Down-regulation of an enzyme of interest can achieved using,
e.g., antisense, catalytic RNA/DNA, RNA interference (RNAi),
"knock-out," "knock-down," or other mutagenesis techniques. Enzyme
expression/function can also be inhibited using intrabodies.
Examples of enzymes suitable for down-regulation according to the
methods of the invention include citrate synthase, which consumes
acetyl-CoA as part of the tricarboxylic acid (TCA) cycle.
Down-regulation of citrate synthase can force more acetyl-CoA into
the fatty acid synthetic pathway.
[0194] b) Modulation of Global Regulators of Fatty Acid Synthetic
Genes
[0195] Global regulators modulate the expression of the genes of
the fatty acid biosynthetic pathways. Accordingly, one or more
global regulators of fatty acid synthesis can be up- or
down-regulated, as appropriate, to inhibit or enhance,
respectively, the expression of a plurality of fatty acid synthetic
genes and, ultimately, to increase lipid production. Examples
include sterol regulatory element binding proteins (SREBPs), such
as SREBP-1a and SREBP-1c (for examples see GenBank accession
numbers NP.sub.--035610 and Q9WTN3). Global regulators can be up-
or down-regulated, for example, as described above with respect to
regulation of control point enzymes.
[0196] c) Regulation of Hydrocarbon Modification Enzymes
[0197] The present application describes genetically engineering
strains of microalgae, oleaginous yeast, bacteria, or fungi with
one or more exogenous genes to produce various hydrocarbon
compounds. Thus, in certain embodiments of the present invention,
the methods of the invention also comprise transforming cells with
one or more genes encoding hydrocarbon modification enzymes, such
as, for example, a fatty acyl-ACP thioesterase (see examples in
Table 7 with accession numbers), a fatty acyl-CoA/aldehyde
reductase (see examples in Table 8 with accession numbers), a fatty
acyl-CoA reductase (see examples in Table 9 with accession
numbers), a fatty aldehyde decarbonylase (see examples in Table 10
with accession numbers), a fatty aldehyde reductase, or a squalene
synthase gene (e.g., see GenBank Accession number AF205791).
Stearoyl-ACP desaturase, for example, catalyzes the conversion of
stearoyl-ACP to oleoyl-ACP. Up-regulation of this gene can increase
the proportion of monounsaturated fatty acids produced by a cell;
whereas down-regulation can reduce the proportion of
monounsaturates. Similarly, the expression of one or more
glycerolipid desaturases can be controlled to alter the ratio of
unsaturated to saturated fatty acids such as .omega.-6 fatty acid
desaturase, .omega.-3 fatty acid desaturase, or .omega.-6-oleate
desaturase.
[0198] For example, microalgae that would naturally, or through
genetic modification, produce high levels of lipids can be
engineered (or further engineered) to express an exogenous fatty
acyl-ACP thioesterase, which can facilitate the cleavage of fatty
acids from the acyl carrier protein (ACP) during lipid synthesis.
These fatty acids can be recovered or, through further enzymatic
processing within the cell, yield other hydrocarbon compounds.
Optionally, the fatty acyl-ACP thioesterase can be expressed from a
gene operably linked to an inducible promoter, and/or can be
expressed in an intracellular compartment.
[0199] Thus, in a preferred embodiment of the present invention,
the hydrocarbon modification enzyme suitable for use with the
microorganisms and methods of the invention is a fatty acyl-ACP
thioesterase. Fatty acyl-ACP thioesterases include, without
limitation, those listed in Table 7, each of which is hereby
incorporated by reference.
TABLE-US-00007 TABLE 7 Fatty acyl-ACP thioesterases and GenBank
accession numbers. Umbellularia californica fatty acyl-ACP
thioesterase (GenBank #AAC49001) Cinnamomum camphora fatty acyl-ACP
thioesterase (GenBank #Q39473) Umbellularia californica fatty
acyl-ACP thioesterase (GenBank #Q41635) Myristica fragrans fatty
acyl-ACP thioesterase (GenBank #AAB71729) Myristica fragrans fatty
acyl-ACP thioesterase (GenBank #AAB71730) Elaeis guineensis fatty
acyl-ACP thioesterase (GenBank #ABD83939) Elaeis guineensis fatty
acyl-ACP thioesterase (GenBank #AAD42220) Populus tomentosa fatty
acyl-ACP thioesterase (GenBank #ABC47311) Arabidopsis thaliana
fatty acyl-ACP thioesterase (GenBank #NP_172327) Arabidopsis
thaliana fatty acyl-ACP thioesterase (GenBank #CAA85387)
Arabidopsis thaliana fatty acyl-ACP thioesterase (GenBank
#CAA85388) Gossypium hirsutum fatty acyl-ACP thioesterase (GenBank
#Q9SQI3) Cuphea lanceolata fatty acyl-ACP thioesterase (GenBank
#CAA54060) Cuphea hookeriana fatty acyl-ACP thioesterase (GenBank
#AAC72882) Cuphea calophylla subsp. mesostemon fatty acyl-ACP
thioesterase (GenBank #ABB71581) Cuphea lanceolata fatty acyl-ACP
thioesterase (GenBank #CAC19933) Elaeis guineensis fatty acyl-ACP
thioesterase (GenBank #AAL15645) Cuphea hookeriana fatty acyl-ACP
thioesterase (GenBank #Q39513) Gossypium hirsutum fatty acyl-ACP
thioesterase (GenBank #AAD01982) Vitis vinifera fatty acyl-ACP
thioesterase (GenBank #CAN81819) Garcinia mangostana fatty acyl-ACP
thioesterase (GenBank #AAB51525) Brassica juncea fatty acyl-ACP
thioesterase (GenBank #ABI18986) Madhuca longifolia fatty acyl-ACP
thioesterase (GenBank #AAX51637) Brassica napus fatty acyl-ACP
thioesterase (GenBank #ABH11710) Oryza sativa (indica
cultivar-group) fatty acyl-ACP thioesterase (GenBank #EAY86877)
Oryza sativa (japonica cultivar-group) fatty acyl-ACP thioesterase
(GenBank #NP_001068400) Oryza sativa (indica cultivar-group) fatty
acyl-ACP thioesterase (GenBank #EAY99617) Cuphea hookeriana fatty
acyl-ACP thioesterase (GenBank #AAC49269)
[0200] A fatty acyl-ACP thioesterase can be chosen based on its
specificity for a growing (during fatty acid synthesis) fatty acid
having a particular carbon chain length. For example, the fatty
acyl-ACP thioesterase can have a specificity for a carbon chain
length ranging from 8 to 34 carbon atoms, preferably from 8 to 18
carbon atoms, and more preferably from 10 to 14 carbon atoms. A
specificity for a fatty acid with 12 carbon atoms is most
preferred. A specificity for a fatty acid with 14 carbon atoms is
also preferred.
[0201] In another preferred embodiment of the present invention,
the hydrocarbon modification enzyme suitable for use with the
microorganisms and methods of the invention is a fatty
acyl-CoA/aldehyde reductase. Fatty acyl-CoA/aldehyde reductases
include, without limitation, those listed in Table 8.
TABLE-US-00008 TABLE 8 Fatty acyl-CoA/aldehyde reductases listed by
GenBank accession numbers. AAC45217, YP_047869, BAB85476,
YP_001086217, YP_580344, YP_001280274, YP_264583, YP_436109,
YP_959769, ZP_01736962, ZP_01900335, ZP_01892096, ZP_01103974,
ZP_01915077, YP_924106, YP_130411, ZP_01222731, YP_550815,
YP_983712, YP_001019688, YP_524762, YP_856798, ZP_01115500,
YP_001141848, NP_336047, NP_216059, YP_882409, YP_706156,
YP_001136150, YP_952365, ZP_01221833, YP_130076, NP_567936,
AAR88762, ABK28586, NP_197634, CAD30694, NP_001063962, BAD46254,
NP_001030809, EAZ10132, EAZ43639, EAZ07989, NP_001062488, CAB88537,
NP_001052541, CAH66597, CAE02214, CAH66590, CAB88538, EAZ39844,
AAZ06658, CAA68190, CAA52019, and BAC84377
[0202] In another preferred embodiment of the present invention,
the hydrocarbon modification enzyme suitable for use with the
microorganisms and methods of the invention is a fatty acyl-CoA
reductase. Fatty acyl-CoA reductases include, without limitation,
those listed in Table 9.
TABLE-US-00009 TABLE 9 Fatty acyl-CoA reductases listed by GenBank
accession numbers. NP_187805, ABO14927, NP_001049083, CAN83375,
NP_191229, EAZ42242, EAZ06453, CAD30696, BAD31814, NP_190040,
AAD38039, CAD30692, CAN81280, NP_197642, NP_190041, AAL15288, and
NP_190042
[0203] In another preferred embodiment of the present invention,
the hydrocarbon modification enzyme suitable for use with the
microorganisms and methods of the invention is a fatty aldehyde
decarbonylase. Fatty aldehyde decarbonylases include, without
limitation, those listed in Table 10.
TABLE-US-00010 TABLE 10 Fatty aldehyde decarbonylases listed by
GenBank accession numbers. NP_850932, ABN07985, CAN60676, AAC23640,
CAA65199, AAC24373, CAE03390, ABD28319, NP_181306, EAZ31322,
CAN63491, EAY94825, EAY86731, CAL55686, XP_001420263, EAZ23849,
NP_200588, NP_001063227, CAN83072, AAR90847, and AAR97643
[0204] Additional examples of amino acid sequences for hydrocarbon
modification enzymes or nucleic acids encoding them are described
in U.S. Pat. Nos. 6,610,527, 6,451,576, 6,429,014, 6,342,380,
6,265,639, 6,194,185, 6,114,160, 6,083,731, 6,043,072, 5,994,114,
5,891,697, 5,871,988, and 6,265,639, and further described in
GenBank Accession numbers AAO18435, ZP.sub.--00513891, Q38710,
AAK60613, AAK60610, AAK60611, NP.sub.--113747, CAB75874, AAK60612,
AAF20201, BAA11024, AF205791, and CAA03710.
[0205] In particular embodiments, microorganisms of the present
invention are genetically engineered to express one or more
exogenous genes selected from a fatty acyl-ACP thioesterase, a
fatty acyl-CoA/aldehyde reductase, a fatty acyl-CoA reductase, a
fatty aldehyde reductase, or a fatty aldehyde decarbonylase.
Suitable expression methods are described above with respect to the
expression of a lipase gene, including, among other methods,
inducible expression and compartmentalized expression.
[0206] Other suitable enzymes for use with the microrganisms and
the methods of the invention include those that have at least 70%
amino acid identity with one of the proteins listed in Tables 7-10,
and that exhibit the corresponding desired enzymatic activity
(e.g., cleavage of a fatty acid from an acyl carrier protein,
reduction of an acyl-CoA to an aldehyde or an alcohol, or
conversion of an aldehyde to an alkane). In additional embodiments,
the enzymatic activity is present in a sequence that has at least
about 75%, at least about 80%, at least about 85%, at least about
90%, at least about 95%, or at least about 99% identity with one of
the above described sequences, all of which are hereby incorporated
by reference as if fully set forth.
[0207] The hydrocarbon modification enzymes described herein are
useful in the production of various hydrocarbons from a
microorganism (e.g., a microalgae, an oleaginous yeast, or a
fungus) or population of microorganisms, whereby a fatty acyl-ACP
thioesterase cleaves a fatty acid from an acyl carrier protein
(ACP) during lipid synthesis. Through further enzymatic processing,
the cleaved fatty acid is then combined with a coenzyme to yield an
acyl-CoA molecule. This acyl-CoA is the substrate for the enzymatic
activity of a fatty acyl-CoA reductase to yield an aldehyde, as
well as for a fatty acyl-CoA/aldehyde reductase to yield an
alcohol. The aldehyde produced by the action of the fatty acyl-CoA
reductase identified above is the substrate for further enzymatic
activity by either a fatty aldehyde reductase to yield an alcohol,
or a fatty aldehyde decarbonylase to yield an alkane.
[0208] The hydrocarbon modification enzymes have a specificity for
acting on a substrate which includes a specific number of carbon
atoms. For example, a fatty acyl-ACP thioesterase may have a
specificity for cleaving a fatty acid having 12 carbon atoms from
the ACP. Therefore, in various embodiments, the microorganism can
contain an exogenous gene that encodes a protein with specificity
for catalyzing an enzymatic activity (e.g., cleavage of a fatty
acid from an ACP, reduction of an acyl-CoA to an aldehyde or an
alcohol, or conversion of an aldehyde to an alkane) with regard to
the number of carbon atoms contained in the substrate. The
enzymatic specificity can, in various embodiments, be for a
substrate having from 8 to 34 carbon atoms, preferably from 8 to 18
carbon atoms, and more preferably from 10 to 14 carbon atoms. The
most preferred specificity is for a substrate having 12 carbon
atoms. In yet another embodiment, the preferred specificity is for
a substrate having 14 carbon atoms. In other embodiments the
specificity can be for 20 to 30 carbon atoms.
[0209] By selecting the desired combination of exogenous genes to
be expressed, one can tailor the product generated by the
microorganism, which may then be extracted from the aqueous
biomass. For example, in certain embodiments, the microorganism
contains: (i) an exogenous gene encoding a fatty acyl-ACP
thioesterase; and, optionally, (ii) an exogenous gene encoding a
fatty acyl-CoA/aldehyde reductase or a fatty acyl-CoA reductase;
and, optionally, (iii) an exogenous gene encoding a fatty aldehyde
reductase or a fatty aldehyde decarbonylase. The microorganism,
when cultured as described herein, synthesizes a fatty acid linked
to an ACP and the fatty acyl-ACP thioesterase catalyzes the
cleavage of the fatty acid from the ACP to yield, through further
enzymatic processing, a fatty acyl-CoA molecule. When present, the
fatty acyl-CoA/aldehyde reducatase catalyzes the reduction of the
acyl-CoA to an alcohol. Similarly, the fatty acyl-CoA reductase,
when present, catalyzes the reduction of the acyl CoA to an
aldehyde. In those embodiments in which an exogenous gene encoding
a fatty acyl-CoA reductase is present and expressed to yield an
aldehyde product, a fatty aldehyde reductase, encoded by the third
exogenous gene, catalyzes the reduction of the aldehyde to an
alcohol. Similarly, a fatty aldehyde decarbonylase catalyzes the
conversion of the aldehyde to an alkane, when present in the
microrganism.
[0210] Genes encoding such enzymes can be obtained from cells
already known to exhibit significant lipid production such as
Chlorella protothecoides. Genes already known to have a role in
lipid production, e.g., a gene encoding an enzyme that saturates
double bonds, can be transformed individually into recipient cells.
However, to practice the invention it is not necessary to make a
priori ansumptions as to which genes are required. A library of DNA
containing different genes, such as cDNAs from a good
lipid-production organism, can be transformed into recipient cells.
The cDNA is preferably in operable linkage with a promoter active
in microalgae. Different recipient microalgae cells transformed by
a library receive different genes from the library. Transformants
having improved lipid production are identified though screening
methods known in the art, such as, for example, HPLC, gas
chromatography, and mass spectrometry methods of hydrocarbon
analysis (for examples of such analysis, see Biomass and Bioenergy
Vol. 6. No. 4. pp. 269-274 (1994); Experientia 38; 47-49 (1982);
and Phytochemistry 65 (2004) 3159-3165). These transformants are
then subjected to further transformation with the original library
and/or optionally interbred to generate a further round of
organisms having improved lipid production. General procedures for
evolving whole organisms to acquire a desired property are
described in, e.g., U.S. Pat. No. 6,716,631. Such methods entail,
e.g., introducing a library of DNA fragments into a plurality of
cells, whereby at least one of the fragments undergoes
recombination with a segment in the genome or an episome of the
cells to produce modified cells. The modified cells are then
screened for modified cells that have evolved toward acquisition of
the desired function. Vectors and methods for transformation are
analogous to those discussed in connection with expression of
lipase genes.
[0211] Furthermore, subtractive libraries can be used to identify
genes whose transcription is induced under different conditions,
especially conditions employed in culturing microorganisms for
biodiesel production, or for the production of hydrocarbons useful
as a feedstock for industrial applications. Subtractive libraries
contain nucleotide sequences reflecting the differences between two
different samples. Such libraries are prepared by procedures that
include the steps of denaturing and hybridizing populations of
polynucleotides (e.g., mRNA, cDNA, amplified sequences) from each
sample. Sequences common to both samples hybridize and are removed,
leaving the sequences that differ between the samples. In this
manner, sequences that are induced under particular conditions can
be identified. This technique can be employed, for example, to
identify genes useful for increasing lipid (e.g., fatty acid)
production and, in particular, lipid production under any desired
culture conditions. The subtractive hybridization technique can
also be employed to identify promoters, e.g., inducible promoters,
useful in expression constructs according to the invention.
[0212] Thus, for example, subtractive libraries can be prepared
from microorganism cultures grown autotrophically (in the light
without a fixed carbon source) or heterotrophically (in the dark in
the presence of a fixed carbon source). In particular,
heterotrophic genes may be induced during dark growth in the
presence of a fixed carbon source and may therefore be present in a
library generated by subtracting sequences from autotrophic cells
from sequences from dark heterotrophic cells. Subtractive libraries
can also be prepared from cultures to which a particular carbon
substrate, such as glucose, has been added to identify genes that
play a role in metabolizing the substrate. Subtractive libraries
prepared from cultures grown in the presence of excess versus
limited nitrogen can be used to identify genes that control cell
division as opposed to hydrocarbon accumulation production. The
preparation of a subtractive library from a culture to which lipids
(e.g., fatty acids) have been added can help identify genes whose
overexpression increases fatty acid production. More specifically,
the addition of fatty acids to a culture of cells that can use the
added fatty acids will lead to the down-regulation of fatty acid
synthetic genes to down-regulate fatty acid production. The
overexpression of one or more such genes will have the opposite
effect.
[0213] 2. Increased Carbon Flux into Lipid Pathway
[0214] Some microalgae produce significant quantities of non-lipid
metabolites, such as, for example, polysaccharides. Because
polysaccharide biosynthesis can use a significant proportion of the
total metabolic energy available to cells, mutagenesis of
lipid-producing cells followed by screening for reduced or
eliminated polysaccharide production generates novel strains that
are capable of producing higher yields of lipids.
[0215] The phenol: sulfuric acid assay detects carbohydrates (see
Hellebust, Handbook of Phycological Methods, Cambridge University
Press, 1978; and Cuesta G., et al., J. Microbiol. Methods, 2003
January; 52(1):69-73). The 1,6 dimethylmethylene blue assay detects
anionic polysaccharides. (see for example Braz. J. Med. Biol. Res.
1999 May; 32(5):545-50; Clin. Chem. 1986 November;
32(11):2073-6).
[0216] Polysaccharides can also be analyzed through methods such as
HPLC, size exclusion chromatography, and anion exchange
chromatography (see for example Prosky L, Asp N, Schweizer T F,
DeVries J W & Furda I (1988) Determination of insoluble,
soluble and total dietary fiber in food and food products:
Interlaboratory study. Journal of the Association of Official
Analytical Chemists 71, 1017.+-.1023; Int J Biol Macromol. 2003
November; 33 (1-3):9-18). Polysaccharides can also be detected
using gel electrophoresis (see for example, Anal Biochem. 2003 Oct.
15; 321(2):174-82; Anal Biochem. 2002 Jan. 1; 300(1):53-68).
V. Methods of Culturing Microorganisms
[0217] A. Bioreactor
[0218] Microorganisms are cultured both for purposes of conducting
genetic manipulations and for subsequent production of hydrocarbons
(e.g., lipids, fatty acids, aldehydes, alcohols, and alkanes). The
former type of culture is conducted on a small scale and initially,
at least, under conditions in which the starting microorganism can
grow. For example, if the starting microorganism is a
photoautotroph the initial culture is conducted in the presence of
light. The culture conditions can be changed if the microorganism
is evolved or engineered to grow independently of light. Culture
for purposes of hydrocarbon production is preferentially conducted
on a large scale (e.g., 10,000 L, 40,000 L, 100,000 L or larger
bioreactors) in a bioreactor. Microorganisms (e.g., microalgae) of
the invention are typically cultured in the methods of the
invention in liquid media within a bioreactor, typically in the
absence of light (heterotrophic growth).
[0219] The bioreactor or fermentor is used to culture microalgal
cells through various phases of their physiological cycle.
Bioreactors offer many advantages for use in the heterotrophic
growth and propagation. To produce biomass for lipid production,
microalgae are preferably grown in large quantities in liquid, such
as in suspension cultures as an example. Bioreactors such as
stainless steel fermentors can accommodate very large culture
volumes (40,000 liter and greater capacity bioreactors are used in
various embodiments of the invention). Bioreactors also typically
allow for the control of culture conditions such as temperature,
pH, oxygen tension, and carbon dioxide levels. For example,
bioreactors are typically configurable, for example, using ports
attached to tubing, to allow gaseous components, like oxygen or
nitrogen, to be bubbled through a liquid culture. Other culture
parameters, such as pH of the culture media, the identity and
concentration of trace elements, and other media constituents can
also be more readily manipulated using a bioreactor.
[0220] Bioreactors can be configured to flow culture media through
the bioreactor throughout the time period during which the
microalgae reproduce and increase in number. In some embodiments,
for example, media can be infused into the bioreactor after
inoculation but before the cells reach a desired density. In other
instances, a bioreactor is filled with culture media at the
beginning of a culture, and no more culture media is infused after
the culture is inoculated. In other words, the microalgal biomass
is cultured in an aqueous medium for a period of time during which
the microalgae reproduce and increase in number; however,
quantities of aqueous culture medium are not flowed through the
bioreactor throughout the time period. Thus, in some embodiments,
aqueous culture medium is not flowed through the bioreactor after
inoculation.
[0221] Bioreactor ports can be used to introduce, or extract gases,
solids, semisolids, and liquids, into the bioreactor chamber
containing microalgae. While many bioreactors have more than one
port (for example, one for media entry, and another for sampling),
it is not necessary that only one substance enter or leave a port.
For example, a port can be used to flow culture media or additional
carbon source into the bioreactor and later be used for sampling,
gas entry, gas exit, or other purposes. Preferably, a sampling port
can be used repeatedly without altering or compromising the axenic
nature of the culture. A sampling port can be configured with a
valve or other device that allows the flow of sample to be stopped
or started or to provide a means of continuos sampling. Bioreactors
typically have at least one port that allows inoculation of a
culture, and such a port can also be used for other purposes such
as media or gas entry.
[0222] Bioreactors allow the gas content of the culture of
microorganism (e.g., microalgae) to be manipulated. To illustrate,
part of the volume of a bioreactor can be gas rather than liquid,
and the gas inlets of the bioreactor allow pumping of gases into
the bioreactor. Gases that can be beneficially pumped into a
bioreactor include air, air/CO.sub.2 mixtures, noble gases, such as
argon, and other gases. Bioreactors are typically equipped to
enable the user to control the rate of entry of a gas into the
bioreactor. As noted above, increasing gas flow into a bioreactor
can be used to increase mixing of the culture.
[0223] Increased gas flow affects the turbidity of the culture as
well. Turbulence can be achieved by placing a gas entry port below
the level of the aqueous culture media so that gas entering the
bioreactor bubbles to the surface of the culture. One or more gas
exit ports allow gas to escape, thereby preventing pressure buildup
in the bioreactor. Preferably a gas exit port leads to a "one-way"
valve that prevents contaminating microorganisms from entering the
bioreactor.
[0224] B. Media
[0225] Culture media for the cultivation of microorganisms,
including microalgae, typically contains components such as a fixed
nitrogen source, a fixed carbon source, trace elements, optionally
a buffer for pH maintenance, and phosphate (typically provided as a
phosphate salt). Other components can include salts such as sodium
chloride, particularly for seawater microalgae. Nitrogen sources
include organic and inorganic nitrogen sources, including, for
example, but without limitation, molecular nitrogen, nitrate,
nitrate salts, ammonia (pure or in salt form, such as
(NH.sub.4).sub.2SO.sub.4 and NH.sub.4OH), protein (and amino
acids), soybean meal, cornsteep liquor, and yeast extract. Examples
of trace elements include zinc, boron, cobalt, copper, manganese,
and molybdenum, in for example, the respective forms of ZnCl.sub.2,
H.sub.3BO.sub.3, CoCl.sub.2.6H.sub.2O, CuCl.sub.2.2H.sub.2O,
MnCl.sub.2.4H.sub.2O and
(NH.sub.4).sub.6MO.sub.7O.sub.24.4H.sub.2O.
[0226] Solid and liquid growth media are generally available from a
wide variety of sources, and instructions for the preparation of
particular media that is suitable for a wide variety of strains of
microorganisms can be found, for example, online at
http://www.utex.org/, a site maintained by the University of Texas
at Austin, 1 University Station A6700, Austin, Tex. 78712-0183, for
its culture collection of algae (UTEX). For example, various fresh
water and salt water media include those described in PCT Pub No.
2008/151149, incorporated herein by reference.
[0227] In a particular example, Proteose Medium is suitable for
axenic cultures, and a 1 liter volume of Proteose Medium (pH
.about.6.8) can be prepared by the addition of 1 g proteose peptone
to 1 liter of Bristol Medium. Bristol Medium comprises 2.94 mM
NaNO.sub.3, 0.17 mM CaCl.sub.2.2H.sub.2O, 0.3 mM
MgSO.sub.4.7H.sub.2O, 0.43 mM K.sub.2HPO.sub.4, 1.29 mM
KH.sub.2PO.sub.4 and 1.43 mM NaCl in an aqueous solution. The
solution is covered and autoclaved, and the stored at a
refrigerated temperature prior to use. Another example is the
Prototheca isolateion medium (PIM), which comprises 10 g/L
postassium hydrogen phthalate (KHP), 0.9 g/L sodium hydroxide, 0.1
g/L magnesium sulfate, 0.2 g/L potassium hydrogen phosphate, 0.3
g/L ammonium chloride, 10 g/L glucose, 0.001 g/L thiamine
hydrochloride, 20 g/L agar, 0.25 g/L 5-fluorocytosine, at a pH in
the range of 5.0 to 5.2 (see Pore (1973) App. Microbiology,
26:648-649). Other suitable media for use with the methods of the
invention can be readily identified by consulting the URL
identified above, or by consulting other organizations that
maintain cultures of microorganisms, such as SAG, CCAP or CCALA.
SAG refers to the Culture Collection of Algae at the University of
Gottingen (Gottingen, Germany), CCAP refers to the culture
collection of algae and protozoa managed by the Scottish
Association for Marine Science (Scotland, United Kingdom), and CCLA
refers to the culture collection of algal laboratory at the
Institute of Botany (T{hacek over (r)}ebo{hacek over (n)}, Czech
Republic). Additionally, U.S. Pat. No. 5,900,370 describes media
formulations and conditions suitable for heterotrophic fermentation
of Prototheca species.
[0228] For oil (lipid) production, selection of fixed carbon source
is important, as the cost of the fixed carbon source must be
sufficiently low to make oil production economical. Thus, while
suitable carbon sources include, for example, acetate, floidoside,
fructose, galactose, glucuronic acid, glucose, glycerol, lactose,
mannose, N-acetylglucosamine, rhamnose, sucrose, glucose, and/or
xylose, selection of feedstocks containing these compounds is an
important aspect of the methods of the invention. Some
microorganism (e.g., microalgae) species can grow by utilizing a
fixed carbon source such as glucose or acetate in the absence of
light. Such growth is known as heterotrophic growth. For Chlorella
protothecoides, for example, heterotrophic growth results in high
production of biomass and accumulation of high lipid content in
cells. Other suitable feedstocks include, for example, black
liquor, corn starch, depolymerized cellulosic material, milk whey,
molasses, thick cane juice, potato, sorghum, sucrose, sugar beet,
sugar cane, rice and wheat. Carbon sources can also be provided as
a mixture, such as a mixture of sucrose and depolymerized sugar
beet pulp. The one or more carbon source(s) can be supplied at a
concentration of at least about 50 .mu.M, at least about 100 .mu.M,
at least about 500 .mu.M, at least about 5 mM, at least about 50
mM, at least about 500 mM, of one or more exogenously provided
fixed carbon source(s). Carbon sources of particular interest for
purposes of the present invention include cellulose (in a
depolymerized form), glycerol, sucrose (in the form of cane juice
or molasses) and sorghum.
[0229] Some microorganisms naturally grow on or can be engineered
to grow on a fixed carbon source that is a heterogeneous source of
compounds such as municipal waste, secondarily treated sewage,
wastewater, and other sources of fixed carbon and other nutrients
such as sulfates, phosphates, and nitrates. The sewage component
serves as a nutrient source in the production of hydrocarbons, and
the culture provides an inexpensive source of hydrocarbons.
[0230] In some heterotrophic growth methods, microorganisms can be
cultured using cellulosic biomass as a feedstock. Cellulosic
biomass (e.g., stover, such as corn stover) is inexpensive and
readily available; however, attempts to use this material as a
feedstock for yeast have failed. In particular, such feedstock have
been found to be inhibitory to yeast growth, and yeast cannot use
the 5-carbon sugars produced from cellulosic materials (e.g.,
xylose from hemi-cellulose). By contrast, microalgae can grow on
processed cellulosic material. Accordingly, heterotrophic growth
methods include a method of culturing a microalgae in the presence
of a cellulosic material and/or a 5-carbon sugar. Cellulosic
materials generally include:
TABLE-US-00011 Component Percent Dry Weight Cellulose 40-60%
Hemicellulose 20-40% Lignin 10-30%
[0231] Suitable cellulosic materials include residues from
herbaceous and woody energy crops, as well as agricultural crops,
i.e., the plant parts, primarily stalks and leaves, not removed
from the fields with the primary food or fiber product. Examples
include corn stover (stalks, leaves, husks, and cobs), wheat straw,
and rice straw. Five-carbon sugars that are produced from such
materials include xylose.
[0232] Chlorella protothecoides, for example, has been shown to
exhibit higher levels of productivity when cultured on a
combination of glucose and xylose than when cultured on either
glucose or xylose alone. This synergistic effect provides a
significant advantage in that it allows cultivation of Chlorella on
combinations of xylose and glucose, such as cellulosic
material.
[0233] In another embodiment of the methods of the invention, the
carbon source is sucrose, including a complex feedstock containing
sucrose, such as thick cane juice from sugar cane processing or
molasses. In one embodiment, the culture medium further includes at
least one sucrose utilization enzyme. In some cases, the culture
medium includes a sucrose invertase. In one embodiment, the sucrose
invertase enzyme is a secretable sucrose invertase enzyme encoded
by an exogenous sucrose invertase gene expressed by the population
of microorganisms. Thus, in some cases, the microalgae has been
genetically engineered to express a sucrose utilization enzyme,
such as a sucrose transporter, a sucrose invertase, a hexokinase, a
glucokinase, or a fructokinase.
[0234] Complex feedstocks containing sucrose include waste molasses
from sugar cane processing; the use of this low-value product of
sugar cane processing can provide significant cost savings in the
production of lipids/oil. Another complex feedstock containing
sucrose that is useful in the methods of the invention is sorghum,
including sorghum syrup and pure sorghum. Sorghum syrup is produced
from the juice of sweet sorghum cane; its sugar profile consists of
mainly glucose (dextrose), fructose, and sucrose.
[0235] C. Increasing Yield of Lipids
[0236] For the production of lipids/oil in accordance with the
methods of the invention, it is preferable to culture cells in the
dark, as is the case, for example, when using extremely large
(40,000 liter or greater capacity) fermentors that do not allow
light to strike the culture. As an example, an inoculum of
lipid-producing microalgal cells are introduced into the medium;
there is a lag period (lag phase) before the cells begin to
propagate. Following the lag phase, the propagation rate increases
steadily and enters the log, or exponential phase. The exponential
phase is in turn followed by a slowing of propagation due to
decreases in nutrients such as nitrogen, increases in toxic
substances, and quorum sensing mechanisms. After this slowing,
propagation stops, and cells enter a stationary phase or steady
growth state, depending on the particular environment provided to
the cells. For obtaining lipid-rich biomass, the culture is
typically harvested well after the end of the exponential phase,
which may be terminated early by allowing nitrogen or another key
nutrient (other than carbon) to become depleted, forcing the cells
to convert the carbon sources, which are present in excess, to
lipid. Culture parameters can be manipulated to optimize total oil
production, the combination of lipid species produced, and/or
production of a specific oil.
[0237] Process conditions can be adjusted to increase the yield of
lipids suitable for use as biodiesel or other target molecules,
and/or to reduce production cost. For example, in certain
embodiments, a microbe (e.g., a microalgae) is cultured in the
presence of a limiting concentration of one or more nutrients, such
as, for example, nitrogen. This condition tends to increase
microbial lipid yield over microbial lipid yield in a culture in
which nitrogen is provided in excess. In particular embodiments,
the increase in lipid yield is at least about: 10%, 20%, 30%, 40%,
50%, 75%, 100%, 200%, 300%, 400%, or 500%. The microbe can be
cultured in the presence of a limiting amount of the nutrient for a
portion of the total culture period or for the entire period. In
particular embodiments, the nutrient concentration is cycled
between a limiting concentration and a non-limiting concentration
at least twice during the total culture period. In addition, as
described above, certain fixed carbon feedstocks, such as glycerol,
can be employed to increase the percentage of cell weight that is
lipid, in relation to comparable quantities of other fixed carbon
feedstocks.
[0238] To increase lipid yield, acetic acid can be employed in the
feedstock for a lipid-producing microbe (e.g., a microalgae).
Acetic acid feeds directly into the point of metabolism that
initiates fatty acid synthesis (i.e., acetyl-CoA); thus providing
acetic acid in the culture can increase fatty acid production.
Generally, the microbe is cultured in the presence of a sufficient
amount of acetic acid to increase microbial lipid yield, and/or
microbial fatty acid yield, specifically, over microbial lipid
(e.g., fatty acid) yield in the absence of acetic acid.
[0239] In another embodiment, lipid yield is increased by culturing
a lipid-producing microbe (e.g., microalgae) in the presence of one
or more cofactor(s) for a lipid pathway enzyme (e.g., a fatty acid
synthetic enzyme). Generally, the concentration of the cofactor(s)
is sufficient to increase microbial lipid (e.g., fatty acid) yield
over microbial lipid yield in the absence of the cofactor(s). In a
particular embodiment, the cofactor(s) are provided to the culture
by including in the culture a microbe (e.g., microalgae) containing
an exogenous gene encoding the cofactor(s). Alternatively,
cofactor(s) may be provided to a culture by including a microbe
(e.g., microalgae) containing an exogenous gene that encodes a
protein that participates in the synthesis of the cofactor. In
certain embodiments, suitable cofactors include any vitamin
required by a lipid pathway enzyme, such as, for example: biotin,
pantothenate. Genes encoding cofactors suitable for use in the
invention or that participate in the synthesis of such cofactors
are well known and can be introduced into microbes (e.g.,
microalgae), using constructs and techniques such as those
described above.
[0240] D. Microalgal Biomass with High Oil Content
[0241] Microalgal biomass with a high percentage of oil/lipid
accumulation by dry cell weight has been generated using different
methods of culture, which are known in the art. Microalgal biomass
with a higher percentage of accumulated oil/lipid is useful in
accordance with the present invention. Li et al. describe Chlorella
vulgaris cultures with up to 56.6% lipid by dry cell weight (DCW)
in stationary cultures grown under autotrophic conditions using
high iron concentrations (Li et al., Bioresource Technology
99(11):4717-22 (2008)). Rodolfi et al., describe Nanochloropsis sp.
and Chaetoceros calcitrans cultures with 60% lipid by DCW and 39.8%
lipid by DCW, respectively, grown in a photobioreactor under
nitrogen starvation conditions (Rodolfi et al., Biotechnology &
Bioengineering (2008) [June 18 Epub ahead of print]). Solovchenko
et al., describe Parietochloris incise cultures with approximately
30% lipid accumulation (by DCW) when grown phototrophically and
under low nitrogen conditions (Solovchenko et al., Journal of
Applied Phycology 20:245-251 (2008)). Chlorella protothecoides can
produce up to 55% lipid (DCW) grown under certain heterotrophic
conditions with nitrogen starvation (Miao and Wu, Bioresource
Technology 97:841-846 (2006)). Other Chlorella species including
Chlorella emersonii, Chlorella sorokiniana and Chlorella
minutissima have been described to have accumulated up to 63% oil
(DCW) when grown in stirred tank bioreactors under low-nitrogen
media conditions (Illman et al., Enzyme and Microbial Technology
27:631-635 (2000)). Still higher percent lipid accumulation by dry
cell weight has been reported, including 70% lipid (DCW)
accumulation in Dumaliella tertiolecta cultures grown in increased
NaCl conditions (Takagi et al., Journal of Bioscience and
Bioengineering 101(3): 223-226 (2006)) and 75% lipid accumulation
in Botryococcus braunii cultures (Banerjee et al., Critical Reviews
in Biotechnology 22(3): 245-279 (2002)).
[0242] Microalgal biomass generated by the culture methods
described herein and useful in accordance with the present
invention comprises at least 10% microalgal oil by dry weight. In
some embodiments, the microalgal biomass comprises at least 15%, at
least 25%, at least 35%, at least 45%, at least 55%, or at least
60% microalgal oil by dry weight. In some embodiments, the
microalgal biomass contains from 10-90% microalgal oil, from 25-75%
microalgal oil, form 40-75% microalgal oil, or from 50-70%
microalgal oil by dry weight.
[0243] E. Culturing Microorganisms Under Induced Conditions
[0244] As described herein, in certain embodiments of the present
invention, microorganisms are cultured under induced conditions,
i.e., by providing a stimulus. Generally, this is carried out as
follows: The microorganism is cultured for a first period of time
sufficient to increase the cell density. Then, the stimulus is
provided and the microorganisms are cultured for a second period of
time. During the second period of time the desired effect of the
stimulus takes place, e.g., induction of an exogenous gene or
increased lipid production. Culturing the microorganisms for the
second period of time can be in the continued presence of the
stimulus. Alternatively, the stimulus may not be provided or may
only partially provided (i.e., for a limited time) during the
culturing of the microorganism for the second period of time.
[0245] F. Storing Microorganisms Prior to Extraction of Lipid
[0246] In some cases it is desirable to store cultured
microorganisms for a period of time prior to subjecting them to the
extraction processes described below. In some methods of the
invention, the microorganisms, produced via a culturing process as
described herein are optionally stored for a period of time between
termination of the culturing process and lysing the microorganism.
In some cases, the microorganism is stored for at least one hour
between termination of the culturing process and lysing the
cultured microorganism. In other cases, the microorganism is stored
for at least two hours, at least three hours, at least four hours,
at least five hours, at least six hours, at least seven hours, at
least eight hours, at least nine hours, at least ten hours, at
least eleven hours, at least twelve hours, at least thirteen hours,
at least fourteen hours, at least fifteen hours, at least sixteen
hours, at least seventeen hours, at least eighteen hours, at least
nineteen hours, at least twenty hours, at least twenty-one hours,
at least twenty-two hours, at least twenty-three hours, or for at
least twenty-four hours between termination of the culturing
process and lysing the cultured microorganism. In some cases, the
microorganism is stored for at least thirty-six hours between
termination of the culturing process and lysing the cultured
microorganism. In some cases, the microorganism is stored for at
least forty-eight hours between termination of the culturing
process and lysing the cultured microorganism, or for longer
periods of time. In other cases, the microorganism is stored for at
least sixty or seventy-two hours, or longer, between termination of
the culturing process and lysing the cultured microorganism.
[0247] Microorganisms prepared in a culture process are optionally
stored at a temperature below 15 degrees Celsius between
termination of the culturing process and lysing the cultured
microorganism. In some cases the microorganisms are stored at a
temperature below 14.degree. C., below 13.degree. C., below
12.degree. C., below 11.degree. C., below 10.degree. C., below
9.degree. C., below 8.degree. C., below 7.degree. C., below
6.degree. C., below 5.degree. C., below 4.degree. C., below
3.degree. C., below 2.degree. C., or below 1.degree. C. between
termination of the culturing process and lysing the cultured
microorganism. In some cases, the microorganism is stored at a
temperature above 30 degrees Celsius between termination of the
culturing process and lysing the cultured microorganism. In some
cases, the microorganism is stored at a temperature above 40
degrees Celsius between termination of the culturing process and
lysing the cultured microorganism. In other cases, the
microorganism is stored at a temperature above 31.degree. C., above
32.degree. C., above 33.degree. C., above 34.degree. C., above
35.degree. C., above 36.degree. C., above 37.degree. C., above
38.degree. C., above 39.degree. C., above 41.degree. C., above
42.degree. C., above 43.degree. C., above 44.degree. C., above
45.degree. C., above 46.degree. C., above 47.degree. C., above
48.degree. C., above 49.degree. C., or above 50.degree. C. between
termination of the culturing process and lysing the cultured
microorganism.
[0248] In some cases, storage or ageing of the cultured
microorganisms is used to disrupt the cells to facilitate oil
extraction. With storage, the cell structure may weaken
sufficiently to cause the contents of the cells to begin leaking,
or to permit passage of reagents or other materials into the cells
to facilitate extraction of the lipid contents. Storage can be used
in this context in combination with other lysing methods described
below.
[0249] In some cases, the microorganism is subjected to agitation
during storage. Agitation can be in addition to any combination of
storage conditions set forth above. Agitation can be done on a
shaker, vortexer, or the like. Agitation can also result from the
shear forces present during high g force centrifugation.
Alternatively, the microorganism is not agitated during storage.
The microorganisms can be stored in a bioreactor or other culture
vessel, or optionally transferred to a separate storage
container.
VI. Methods of Extraction of Lipid from Microorganism
[0250] In one aspect, the present invention is directed to a
process for extracting, recovering, isolating or obtaining lipids
from microorganisms. The process of the present invention is
applicable to extracting a variety of lipids from a variety of
microorganisms.
[0251] A. Lysing Cells
[0252] Intracellular lipids produced in microorganisms are
extracted after lysing the cells of the microorganism. Once
extracted, the lipids can be further refined to produce a high
purity lipids.
[0253] After completion of culturing, the microorganisms can be
separated from the fermentation broth, preferably without a drying
step such as drum drying, spray drying, tray drying, vacuum drying
and other steps that remove substantially all of the extracellular
and intracellular water from the broth. Optionally, the separation
is effected by centrifugation to generate a concentrated paste.
Centrifugation does not remove significant amounts of intracellular
water from the microorganisms and is not a drying step. The biomass
can then be washed with a washing solution (e.g., DI water) to get
rid of the fermentation broth and debris. Optionally, the washed
microbial biomass may also be dried (oven dried, luyophilized,
etc.) prior to cell disruption. Alternatively, cells can be lysed
without separation from some or all of the fermentation broth when
the fermentation is complete. For example, the cells can be at a
ratio of less than 1:1 v:v cells to extracellular liquid when the
cells are lysed.
[0254] Microorganism containing a lipid can be lysed to produce a
lysate. As detailed herein, the step of lysing a microorganism
(also referred to as cell lysis) can be achieved by any convenient
means, including heat-induced lysis, adding a base, adding an acid,
using enzymes such as proteases and polysaccharide degradation
enzymes such as amylases, using ultrasound, mechanical lysis, using
osmotic shock, infection with a lytic virus, and/or expression of
one or more lytic genes. Lysis is performed to release
intracellular molecules which have been produced by the
microorganism. Each of these methods for lysing a microorganism can
be used as a single method or in combination.
[0255] The extent of cell disruption can be observed by microscopic
analysis. Using one or more of the methods described herein,
typically more than 70% cell breakage is observed. Preferably, cell
breakage is more than 80%, more preferably more than 90% and most
preferred about 100%.
[0256] In particular embodiments, the microorganism is lysed after
growth, for example to increase the exposure of cellular lipid to a
catalyst for transesterification such as a lipase or a chemical
catalyst, expressed as described above. The timing of lipase
expression (e.g., via an inducible promoter), cell lysis, and the
adjustment of transesterification reaction conditions (e.g.,
removal of water, addition of alcohol, etc.) can be adjusted to
optimize the yield of fatty acid esters from lipase-mediated
transesterification. Below are described a number of lysis
techniques. These techniques can be used individually or in
combination.
[0257] 1. Heat-Induced Lysis
[0258] In a preferred embodiment of the present invention, the step
of lysing a microorganism comprises heating of a cellular
suspension containing the microorganism. In this embodiment, the
fermentation broth containing the microorganisms (or a suspension
of microorganisms isolated from the fermentation broth) is heated
until the microorganisms, i.e., the cell walls and membranes of
microorganisms degrade or breakdown. Typically, temperatures
applied are at least 50.degree. C. Higher temperatures, such as, at
least 60.degree. C., at least 70.degree. C., at least 80.degree.
C., at least 90.degree. C., at least 100.degree. C., at least
110.degree. C., at least 120.degree. C., at least 130.degree. C. or
higher are used for more efficient cell lysis. Example 7 describes
an embodiment of lysis using heat treatment.
[0259] Lysing cells by heat treatment can be performed by boiling
the microorganism. Alternatively, heat treatment (without boiling)
can be performed in an autoclave (see Example 6). The heat treated
lysate may be cooled for further treatment.
[0260] Cell disruption can also be performed by steam treatment,
i.e., through addition of pressurized steam. Steam treatment of
microalgae for cell disruption is described, for example, in U.S.
Pat. No. 6,750,048.
[0261] 2. Lysis Using a Base
[0262] In another preferred embodiment of the present invention,
the step of lysing a microorganism comprises adding a base to a
cellular suspension containing the microorganism.
[0263] The base should be strong enough to hydrolyze at least a
portion of the proteinaceous compounds of the microorganisms used.
Bases which are useful for solubilizing proteins are known in the
art of chemistry. Exemplary bases which are useful in the methods
of the present invention include, but are not limited to,
hydroxides, carbonates and bicarbonates of lithium, sodium,
potassium, calcium, and mixtures thereof. A preferred base is KOH.
Examples 6 and 7 describe embodiments of cell lysis using KOH.
[0264] 3. Acidic Lysis
[0265] In another preferred embodiment of the present invention,
the step of lysing a microorganism comprises adding an acid to a
cellular suspension containing the microorganism. Acid lysis can be
effected using an acid at a concentration of 10-500 mN or
preferably 40-160 nM. Acid lysis is preferably performed at above
room temperature (e.g., at 40-160.degree., and preferably a
temperature of 50-130.degree.. For moderate temperatures (e.g.,
room temperature to 100.degree. C. and particularly room
temperature to 65.degree., acid treatment can usefully be combined
with sonication or other cell disruption methods. Example 7
describes embodiments of cell lysis using acidic lysis.
[0266] 4. Lysing Cells Using Enzymes
[0267] In another preferred embodiment of the present invention,
the step of lysing a microorganism comprises lysing the
microorganism by using an enzyme. Preferred enzymes for lysing a
microorganism are proteases and polysaccharide-degrading enzymes
such as hemicellulase (e.g., hemicellulase from Aspergillus niger;
Sigma Aldrich, St. Louis, Mo.; #H2125), pectinase (e.g., pectinase
from Rhizopus sp.; Sigma Aldrich, St. Louis, Mo.; #P2401), Mannaway
4.0 L (Novozymes), cellulase (e.g., cellulose from Trichoderma
viride; Sigma Aldrich, St. Louis, Mo.; #C9422), and driselase
(e.g., driselase from Basidiomycetes sp.; Sigma Aldrich, St. Louis,
Mo.; #D9515. Example 7 describes embodiments of cell lysis using
enzymes.
[0268] a) Cellulases
[0269] In a preferred embodiment of the present invention, a
cellulase for lysing a microorganism is a polysaccharide-degrading
enzyme, optionally from Chlorella or a Chlorella virus. Example 7
describes embodiments of cell lysis using a cellulase. Another
example of a polysaccharide-degrading enzyme that can be used is
mannaway, as described in the Examples.
[0270] b) Proteases
[0271] Proteases such as Streptomyces griseus protease,
chymotrypsin, proteinase K, proteases listed in Degradation of
Polylactide by Commercial Proteases, Oda Y et al., Journal of
Polymers and the Environment, Volume 8, Number 1, January 2000, pp.
29-32 (4), and other proteases can be used to lyse microorganisms.
Other proteases that can be used include Alcalase 2.4 FG
(Novozymes) and Flavourzyme 100 L (Novozymes), as described in the
Examples.
[0272] c) Combinations
[0273] Any combination of a protease and a polysaccharide-degrading
enzyme can also be used, including any combination of the preceding
proteases and polysaccharide-degrading enzymes.
[0274] 5. Lysis Cells Using Ultrasound
[0275] In another preferred embodiment of the present invention,
the step of lysing a microorganism is performed by using
ultrasound, i.e., sonication. Thus, cells can also by lysed with
high frequency sound. The sound can be produced electronically and
transported through a metallic tip to an appropriately concentrated
cellular suspension. This sonication (or ultrasonication) disrupts
cellular integrity based on the creation of cavities in cell
suspension. Example 6 describes a method for cell lysis using
ultrasound. Example 7 describes embodiments of cell lysis using
sonication.
[0276] 6. Mechanical Lysis
[0277] In another preferred embodiment of the present invention,
the step of lysing a microorganism is performed by mechanical
lysis. Cells can be lysed mechanically and optionally homogenized
to facilitate hydrocarbon (e.g., lipid) collection. For example, a
pressure disrupter can be used to pump a cell containing slurry
through a restricted orifice valve. High pressure (up to 1500 bar)
is applied, followed by an instant expansion through an exiting
nozzle. Cell disruption is accomplished by three different
mechanisms: impingement on the valve, high liquid shear in the
orifice, and sudden pressure drop upon discharge, causing an
explosion of the cell. The method releases intracellular
molecules.
[0278] Alternatively, a ball mill can be used. In a ball mill,
cells are agitated in suspension with small abrasive particles,
such as beads. Cells break because of shear forces, grinding
between beads, and collisions with beads. The beads disrupt the
cells to release cellular contents. Cells can also be disrupted by
shear forces, such as with the use of blending (such as with a high
speed or Waring blender as examples), the french press, or even
centrifugation in case of weak cell walls, to disrupt cells.
[0279] 7. Lysing Cells by Osmotic Shock (Cytolysis)
[0280] In another preferred embodiment of the present invention,
the step of lysing a microorganism is performed by applying an
osmotic shock. This can be achieved, for example, by centrifuging
fermentation broth and resuspending the cell paste in deionized
water.
[0281] 8. Infection with a Lytic Virus
[0282] In a preferred embodiment of the present invention, the step
of lysing a microorganism comprises infection of the microorganism
with a lytic virus. A wide variety of viruses are known to lyse
microorganisms suitable for use in the present invention, and the
selection and use of a particular lytic virus for a particular
microorganism is within the level of skill in the art.
[0283] For example, paramecium bursaria chlorella virus (PBCV-1) is
the prototype of a group (family Phycodnaviridae, genus
Chlorovirus) of large, icosahedral, plaque-forming, double-stranded
DNA viruses that replicate in, and lyse, certain unicellular,
eukaryotic chlorella-like green algae. Accordingly, any susceptible
microalgae, such as C. protothecoides, can be lysed by infecting
the culture with a suitable chlorella virus. Methods of infecting
species of Chlorella with a chlorella virus are known. See for
example Adv. Virus Res. 2006; 66:293-336; Virology, 1999 Apr. 25;
257(1):15-23; Virology, 2004 Jan. 5; 318(1):214-23; Nucleic Acids
Symp. Ser. 2000; (44):161-2; J. Virol. 2006 March; 80(5):2437-44;
and Annu. Rev. Microbiol. 1999; 53:447-94.
[0284] 9. Autolysis (Expression of a Lytic Gene)
[0285] In another preferred embodiment of the present invention,
the step of lysing a microorganism comprises autolysis. In this
embodiment, a microorganism according to the invention is
genetically engineered to produce a lytic gene that will lyse the
microorganism. This lytic gene can be expressed using an inducible
promoter, so that the cells can first be grown to a desirable
density in a fermentor and then harvested, followed by induction of
the promoter to express the lytic gene to lyse the cells. In one
embodiment, the lytic gene encodes a polysaccharide-degrading
enzyme.
[0286] In certain other embodiments, the lytic gene is a gene from
a lytic virus. Thus, for example, a lytic gene from a Chlorella
virus can be expressed in a Chlorella, such as C.
protothecoides.
[0287] Suitable expression methods are described herein with
respect to the expression of a lipase gene. Expression of lytic
genes is preferably done using an inducible promoter, such as a
promoter active in microalgae that is induced by a stimulus such as
the presence of a small molecule, light, heat, and other stimuli.
Lytic genes from chlorella viruses are known. For example, see
Virology 260, 308-315 (1999); FEMS Microbiology Letters 180 (1999)
45-53; Virology 263, 376-387 (1999); and Virology 230, 361-368
(1997).
[0288] 10. Pressure Oscillation
[0289] In another preferred embodiment of the present invention,
the step of lysing a microorganism comprises subjecting the
microorganism to rapid increases and decreases in pressure. Such
rapid increases and decreases are preferably performed across a
wide enough differential in pressure that the cells are not able to
self-regulate, and burst as a result.
[0290] 11. Additional Consideration
[0291] When lipids are not extracted immediately after isolating
the microorganism, the isolated microorganisms are typically dried.
Drying a microorganism can be done, e.g., on a drum dryer. Dried
microorganisms can be packaged in vacuum-sealed containers to
prevent degradation of lipids.
[0292] B. Treatment of Cell Lysate with Organic Solvent
[0293] A lipid produced by a microorganism is also referred herein
as a "first lipid." A first lipid may comprise one or more lipids
produced by the microorganism.
[0294] A lipid used to extract a first lipid from a microorganism
is referred to as a "second lipid." A preferred second lipid is an
oil. An organic solvent of the present invention comprises a second
lipid.
[0295] Some methods of the present invention comprise the step of
treating a lysate with an organic solvent. Typically, the organic
solvent is added directly to the lysate without prior separation of
the lysate components. After addition of the solvent, the lysate
separates either of its own accord or as a result of centrifugation
or the like into different layers. The layers can include in order
of decreasing density: a pellet of heavy solids, an aqueous phase,
an emulsion phase, and an oil phase. The emulsion phase is an
emulsion of lipids and aqueous phase. Depending on the percentage
of organic solvent added with respect to the lysate (w/w or v/v),
the force of centrifugation if any, volume of aqueous media and
other factors, either or both of the emulsion and oil phases can be
present.
[0296] Incubation or treatment of the cell lysate or the emulsion
phase with the organic solvent is performed for a time sufficient
to allow the lipid produced by the microorganism to become
solubilized in the organic solvent to form a heterogeneous
mixture.
[0297] 1. Oils
[0298] In a preferred embodiment of the present invention, an
organic solvent is an oil selected from the group consisting of oil
from soy, rapeseed, canola, palm, palm kernel, coconut, corn, waste
vegetable oil, Chinese tallow, olive, sunflower, cotton seed,
chicken fat, beef tallow, porcine tallow, microalgae, macroalgae,
Cuphea, flax, peanut, choice white grease (lard), Camelina sativa
mustard seedcashew nut, oats, lupine, kenaf, calendula, hemp,
coffee, linseed, hazelnut, euphorbia, pumpkin seed, coriander,
camellia, sesame, safflower, rice, tung oil tree, cocoa, copra,
pium poppy, castor beans, pecan, jojoba, jatropha, macadamia,
Brazil nuts, and avocado. Also included are fossil oils such as
crude oil or a distillate fraction of a fossil oil.
[0299] The amount of organic solvent added to the lysate is
typically greater than 5% (measured by v/v and/or w/w) of the
lysate with which the solvent is being combined. Thus, a preferred
v/v or w/w of the organic solvent is greater than 5%, at least 6%,
at least 7%, at least 10%, at least 20%, at least 25%, at least
30%. at least 40%, at least 50%, at least 60%, at least 70%, at
least 80%, at least 90%, and at least 95% of the cell lysate.
[0300] 2. Other Organic Solvents
[0301] Other non-limiting examples of organic solvents which can be
used to practice the methods of the present invention include
hexane, isohexane, methanol, dodecane, fossil-derived crude oil and
distillate fractions thereof, and supercritical carbon dioxide.
Methanol can be an advantageous organic solvent to use in biodiesel
manufacturing because it can be used in the transesterification
process as well as extraction of oil.
[0302] C. Solventless Extraction
[0303] Lipids can also be extracted from a lysate without
substantial or any use of organic solvents by cooling the lysate.
In such methods, the lysate is preferably produced by acid
treatment in combination with above room temperature. Sonication
can also be used, particularly if the temperature is between room
temperature and 65.degree. C. Such a lysate on centrifugation or
settling can be separated into layers, one of which is an
aqueous:lipid layer. Other layers can include a solid pellet, an
aqueous layer, and a lipid layer. Lipid can be extracted from the
emulsion layer by freeze thawing or otherwise cooling the emulsion
as described further below. In such methods, it is not necessary to
add any organic solvent. If any organic solvent is added, the
organic solvent can be below 5% v/v or w/w of the lysate.
[0304] D. Agitation or No Agitation of the Heterogeneous
Mixture
[0305] In a preferred embodiment of the present invention, after
producing a cell lysate and optionally adding the organic solvent
to the cell lysate or to the emulsion phase as described above, the
heterogeneous mixture is agitated. Agitation can be done on a
shaker, vortexer, or the like. Agitation can also result from the
shear forces present during high g force centrifugation.
Alternatively, the heterogeneous mixture is not agitated.
[0306] E. Separation of the Heterogeneous Mixture into a
Lipid:Organic Solvent Composition and an Aqueous Composition and,
Optionally an Emulsified Composition or Cell Pellet Composition
[0307] The cell lysate, optionally treated with an organic solvent,
produced by the above methods is a heterogeneous mixture including
lipids, aqueous solutions, cell debris and the organic solvent (if
added). The heterogeneous mixture can be separated into multiple
layers as described below. The multiple layers can include in order
of descending density, a pellet of cell debris, an aqueous layer, a
lipid:aqueous emulsion layer and a lipid layer. The presence and
relative proportions of the different layers depends on the lysis
technique, the separation technique including centrifugal force,
concentration of lipid in the microorganism and whether an organic
solvent is used. The desired lipid can occur both in a separate
lipid layer and in a lipid: aqueous layer. The use of an organic
solvent favors formation of a separate lipid layer. The higher the
concentration of the organic solvent relative to the lysis, the
more lipid is likely to be found in a separate lipid layer rather
than in an aqueous:lipid emulsion layer. The organic solvent, if
present, associates with the lipid either in the lipid layer or the
emulsion or both. The lipid can be obtained both from a separate
lipid layer and from an emulsion layer, as described below.
[0308] Cell lysates can be separated into different layers as
described above by techniques, such as, centrifugation and
settling, i.e., allowing the layers to form spontaneously with
time.
[0309] F. Separation of Lipid
[0310] The separation of lipid from other components present in the
lysate depends on which layers are formed as a result of the
separation. If a separate lipid layer is formed, this layer forms
on top of other layers and can be suctioned off, pipetted or
decanted or the like from the top of the vessel containing the
separated layers. This lipid layer can then be used in various
applications described below. Likewise solid and/or aqueous layers
can be drained off and discarded from the bottom of the vessel. If
an emulsion layer is formed, the emulsion can be subjected to
further extraction to separate lipids in the emulsion from aqueous
fluid. In such a circumstance, separate aqueous and/or pellet
layers, if present, can be drained off before separating the
emulsion. A separate lipid layer if present can also be decanted
off; however, such is not necessary, and the separate lipid layer
can facilitate separation of the emulsion into its components.
[0311] The emulsion can be separated into its components by washing
with a further volume of organic solvent to extract lipids from the
emulsion. Alternatively, the emulsion can be washed with an aqueous
solution to remove aqueous fluids from the emulsion. Alternatively,
the emulsion can be subject to cooling below room temperature.
Preferably, the emulsion is frozen and rethawed. Freezing is
preferably to a temperature of -5.degree. C. to -30.degree. C., and
is maintained for at least one hour.
[0312] After any of the above treatments, the emulsion is
re-separated into component layers by the same techniques as
previously described. The component layers can include a cell
pellet, aqueous layer, emulsion layer and lipid layer as previously
described. The component layers can be separated as previously
described. If an emulsion layer is present, the emulsion layer can
be subjected to a further round of extraction using the same
procedures described above.
[0313] After one or more rounds of separation, the lysate
eventually yields a lipid layer. The lipid layer can be used in
various applications as described below. When any of the rounds of
extraction is performed with an organic solvent, that organic
solvent remains associated with the lipid layer. Typically, it is
not necessary to separate the lipid layer from the organic solvent.
For example, when the organic solvent is an oil or lipid, the lipid
present in the microorganisms can be referred to as a first lipid
and the lipid or oil used for extraction can be referred to as a
second lipid. For example, the first lipid can be triacylglycerol
from a microalgae and the second lipid can be soy oil. After
separation of a lipid:organic solvent layer, (in this case
microalgal lipid:soy oil) the mixture can for example be
transesterified or hydrotreated to yield biodiesel or renewable
diesel, respectively.
[0314] One method of separation that can be used on a lysate,
including a lysate that contains an emulsion, is the application of
shear forces. Following cell lysis, oil may be present as an
oil-in-water emulsion with a small (<5 or <10 micron) droplet
size. The emulsion may be stabilized by any number of ampipathic
emulsifiers (e.g. oleosins, denatured proteins, phospholipids,
fatty acids etc.). All else being equal, the stability of an
emulsion is inversely related to the droplet size of the included
phase. There are a number of procedures provided herein that may be
applied to cause oil droplets to coalesce and increase in size,
thus rendering the emulsion more amenable to breakage (e.g. gentle
agitation in the presence of certain detergents, or acid or base).
Once an oil-in-water emulsion has been treated so as to weaken the
emulsion (by an increase in droplet size, as described above,
and/or by some chemical or physical treatment that decreases the
efficacy of the emulsifying agent(s)), the droplets need to be
physically forced together in order that they may coalesce and
phase separation may occur.
[0315] One method of forcing the included oil droplets together is
by centrifugation that causes physical crowding by forcing the
emulsion through a thin film and introducing concomitant shear that
may be required to break the emulsion. A device that can be used in
the methods provided herein to introduce g-force, thin film and
shear is a stacked disk centrifuge in which the light phase is
ejected as a thin film between rapidly rotating disks. The film is
preferably between 1 micrometer and 1000 micrometers. The film is
preferably less than or similar to the diameter of the included oil
droplets.
[0316] In one embodiment, microbial oil-bearing cells in
fermentation broth are centrifuged to reduce the water content of
the composition. Cells are ruptured by homegenization and/or
chemical/enzymatic treatment. Optionally, the oil droplets are
forced to coalesce by gentle agitation of the lysate. Phase
separation of the composition is then achieved by stacked disk
centrifugation.
[0317] Another method of separation that can be used alone or in
combination with other methods described herein is the use of one
or more surfactants to destabilize an emulsion. Destabilization
results in coalescence of oil globules into larger clusters and
eventually into a phase separated composition of a light layer of
oil, and a heavier aqueous phase. Preferred surfactants for
destabilizing emulsions of oil-bearing microbial biomass is
oleamide DEA (diethanolamine) (Stepan Chemical Co.) including but
not limited to NINOL 201, laurelamide DEA including but not limited
to NINOL 96L and NINOL 55L and cocoamide DEA including but not
limited to NINOL 4000. Methods of oil recovery from a lipid
emulsion using surfactants are provided in the Examples below.
[0318] The lipid composition obtained can be analyzed by a number
of methods, including HPLC as described in Example 6.
VII. Method of Producing Fuels Suitable for Use in Diesel Vehicles
and Jet Engines
[0319] Increasing interest is directed to the use of hydrocarbon
components of biological origin in fuels, such as biodiesel,
renewable diesel, and jet fuel, since renewable biological starting
materials that may replace fossil ones are available, and the use
thereof is desirable. There is an urgent need for methods for
producing hydrocarbon components from biological materials. The
present invention fulfills this need by providing methods for
production of biodiesel, renewable diesel, and jet fuel using the
lipid:organic solvent composition or the lipids described herein as
a biological material to produce biodiesel, renewable diesel, and
jet fuel.
[0320] After extraction, the present invention provides the
advantage that the microbial oil and the organic solvent
(preferably a plant oil) can together be subjected to chemical
treatment to manufacture a fuel for use in diesel vehicles and jet
engines. The ability to avoid separation of the organic solvent
used for extraction from the microbial oil provides a significant
advantage over traditional methods of oil extraction such as hexane
extraction in which hexane must be distilled away from the
microbial oil prior to any further processing steps.
[0321] Traditional diesel fuels are petroleum distillates rich in
paraffinic hydrocarbons. They have boiling ranges as broad as
370.degree. to 780.degree. F., which are suitable for combustion in
a compression ignition engine, such as a diesel engine vehicle. The
American Society of Testing and Materials (ASTM) establishes the
grade of diesel according to the boiling range, along with
allowable ranges of other fuel properties, such as cetane number,
cloud point, flash point, viscosity, aniline point, sulfur content,
water content, ash content, copper strip corrosion, and carbon
residue. Technically, any hydrocarbon distillate material derived
from biomass that meets the appropriate ASTM specification can be
defined as diesel, or as biodiesel.
[0322] Diesel fuel can be produced from biomass via several types
of technologies. Feedstocks for diesel fuels derived from biomass
include, but are not limited to, soybean, rape seed, canola, palm,
and waste cooking oils, along with animal fats. Starting oils can
also be of algal origin. The lipid:organic solvent layer produced
by the method of the present invention can serve as feedstock to
produce biodiesel and renewable diesel.
[0323] A. Biodiesel
[0324] Biodiesel is a liquid which varies in color--between golden
and dark brown--depending on the production feedstock. It is
practically immiscible with water, has a high boiling point and low
vapor pressure. Biodiesel refers to a diesel-equivalent processed
fuel for use in diesel-engine vehicles. Biodiesel is biodegradable
and non-toxic. An additional benefit of biodiesel over conventional
diesel fuel is lower engine wear.
[0325] Typically, biodiesel comprises short chain alkyl esters.
Various processes convert biomass or a lipid produced and isolated
as described herein to diesel fuels. A preferred method to produce
biodiesel is by transesterification of a lipid as described herein.
A preferred short chain alkyl ester for use as biodiesel is a
methyl ester or ethyl ester.
[0326] Biodiesel produced by a method described herein can be used
alone or blended with conventional diesel fuel at any concentration
in most modern diesel-engine vehicles. When blended with
conventional diesel fuel (petroleum diesel), biodiesel may be
present from about 0.1% to about 99.9%. Much of the world uses a
system known as the "B" factor to state the amount of biodiesel in
any fuel mix. For example, fuel containing 20% biodiesel is labeled
B20. Pure biodiesel is referred to as B100.
[0327] Biodiesel can also be used as a heating fuel in domestic and
commercial boilers. Existing oil boilers may contain rubber parts
and may require conversion to run on biodiesel. The conversion
process is usually relatively simple, involving the exchange of
rubber parts for synthetic parts due to biodiesel being a strong
solvent. Due to its strong solvent power, burning biodiesel will
increase the efficiency of boilers.
[0328] Biodiesel can be used as an additive in formulations of
diesel to increase the lubricity of pure Ulta-Low Sulfur Diesel
(ULSD) fuel, which is advantageous because it has virtually no
sulfur content.
[0329] Biodiesel is a better solvent than petrodiesel and can be
used to break down deposits of residues in the fuel lines of
vehicles that have previously been run on petrodiesel.
[0330] 1. Production of Biodiesel
[0331] Biodiesel can be produced by transesterification of
triglycerides contained in oil-rich biomass and animal fats. The
lipid:organic solvent layer or lipids produced by the method of the
present invention can serve as feedstock to produce biodiesel.
Thus, in another aspect of the present invention a method for
producing biodiesel is provided. In a preferred embodiment, the
method for producing biodiesel comprises the steps of (a) lysing a
lipid-containing microorganism to produce a lysate; (b) treating
the lysate with an organic solvent for a period of time sufficient
to allow the lipid from the microorganism to become solubilized in
the organic solvent, whereinby the organic solvent-treated lysate
forms a heterogeneous mixture; (c) separating the heterogeneous
mixture into layers comprising a lipid:organic solvent layer and an
aqueous layer; (d) removing the lipid:organic solvent composition
from the aqueous composition, emulsion composition, or cell pellet
composition; and (e) transesterifying the lipid:organic solvent
composition, whereby biodiesel is produced. The lipid:organic
solvent composition comprises the organic solvent and the microbial
lipids.
[0332] Methods for growth of a microorganism, lysing a
microorganism to produce a lysate, treating the lysate in a medium
comprising an organic solvent to form a heterogeneous mixture and
separating the treated lysate into a lipid:organic solvent
composition and an aqueous or emulsified composition have been
described above and can also be used in the method of producing
biodiesel.
[0333] Lipids and lipid:organic solvent composition, where the
organic solvent is a triacylglyceride selected as described above
can be subjected to transesterification to yield long-chain fatty
acid esters useful as biodiesel. Preferred transesterification
reactions are outlined below and include base catalyzed
transesterification and transesterification using recombinant
lipases.
[0334] In a base-catalyzed transesterification process, the
triacylglycerides are reacted with an alcohol, such as methanol or
ethanol, in the presence of an alkaline catalyst, typically
potassium hydroxide. This reaction forms methyl or ethyl esters and
glycerin (glycerol) as a byproduct.
[0335] a) General Chemical Process
[0336] Animal and plant oils are typically made of triglycerides
which are esters of free fatty acids with the trihydric alcohol,
glycerol. In transesterification, the glycerol in a
triacylglyceride (TAG) is replaced with a short-chain alcohol such
as methanol or ethanol. A typical reaction scheme is as
follows:
##STR00001##
[0337] In this scheme, the alcohol is deprotonated with a base to
make it a stronger nucleophile. Commonly, ethanol or methanol is
used in vast excess (up to 50-fold). Normally, this reaction will
proceed either exceedingly slowly or not at all. Heat, as well as
an acid or base can be used to help the reaction proceed more
quickly. The acid or base are not consumed by the
transesterification reaction, thus they are not reactants but
catalysts. Almost all biodiesel has been produced using the
base-catalyzed technique as it requires only low temperatures and
pressures and produces over 98% conversion yield (provided the
starting oil is low in moisture and free fatty acids).
[0338] Any free fatty acids in the base oil are either converted to
soap and removed from the process, or they are esterified (yielding
more biodiesel) using an acidic catalyst.
[0339] The most common form of transesterification uses methanol to
produce methyl esters as it is the cheapest alcohol available.
Ethanol is used to produce ethyl ester biodiesel. Higher alcohols,
such as isopropanol and butanol can also be used.
[0340] A byproduct of the transesterification process is the
production of glycerol. Approximately for every ton of biodiesel
produced, 100 kg of glycerol are produced. This glycerol may be
used as a chemical building block, and may also be used as a carbon
source to ferment microorganisms.
[0341] b) Using Recombinant Lipases
[0342] Transesterification has also been carried out using an
enzyme, such as a lipase instead of a base. Lipase-catalyzed
transesterification can be carried out, for example, at a
temperature between the room temperature and 80.degree. C., and a
mole ratio of the TAG to the lower alcohol of greater than 1:1,
preferably 2:1, more preferably 3:1, and most preferably about
3:1.
[0343] Lipases suitable for use in transesterification include, but
are not limited to, those listed in Table 11 below. Other examples
of lipases useful for transesterification are found in, e.g. U.S.
Pat. Nos. 4,798,793; 4,940,845 5,156,963; 5,342,768; 5,776,741 and
WO89/01032.
TABLE-US-00012 TABLE 11 Lipases suitable for use in
transesterification. Aspergillus niger lipase ABG73614, Candida
antarctica lipase B (novozym-435) CAA83122, Candida cylindracea
lipase AAR24090, Candida lipolytica lipase (Lipase L; Amano
Pharmaceutical Co., Ltd.), Candida rugosa lipase (e.g., Lipase-OF;
Meito Sangyo Co., Ltd.), Mucor miehei lipase (Lipozyme IM 20),
Pseudomonas fluorescens lipase AAA25882, Rhizopus japonicas lipase
(Lilipase A-10FG) Q7M4U7_1, Rhizomucor miehei lipase B34959,
Rhizopus oryzae lipase (Lipase F) AAF32408, Serratia marcescens
lipase (SM Enzyme) ABI13521, Thermomyces lanuginosa lipase
CAB58509, Lipase P (Nagase ChemteX Corporation), and Lipase QLM
(Meito Sangyo Co., Ltd., Nagoya, Japan)
[0344] One challenge to using a lipase for the production of fatty
acid esters suitable for biodiesel is that the price of lipase is
much higher than the price of sodium hydroxide (NaOH) used by the
strong base process. This challenge has been addressed by using an
immobilized lipase, which can be recycled. However, the activity of
the immobilized lipase must be maintained after being recycled for
a minimum number of cycles to allow a lipase-based process to
compete with the strong base process in terms of the production
cost. Immobilized lipases are subject to poisoning by the lower
alcohols typically used in transesterification. U.S. Pat. No.
6,398,707 (issued Jun. 4, 2002 to Wu et al.) describes methods for
enhancing the activity of immobilized lipases and regenerating
immobilized lipases having reduced activity.
[0345] 2. Standards
[0346] The common international standard for biodiesel is EN 14214.
ASTM D6751 is the most common biodiesel standard referenced in the
United States and Canada. Germany uses DIN EN 14214 and the UK
requires compliance with BS EN 14214.
[0347] Basic industrial tests to determine whether the products
conform to these standards typically include gas chromatography,
HPLC, and others. Biodiesel meeting the quality standards is very
non-toxic, with a toxicity rating (LD.sub.50) of greater than 50
mL/kg.
[0348] B. Renewable Diesel
[0349] Renewable diesel comprises a mixture of alkanes, such as
C10:0, C12:0, C14:0, C16:0 and C18:0 and thus, are distinguishable
from biodiesel. High quality renewable diesel conforms to the ASTM
D 975 standard.
[0350] The lipid:organic solvent layer or lipids produced by the
method of the present invention can serve as feedstock to produce
renewable diesel. Thus, in another aspect of the present invention,
a method for producing renewable diesel is provided. Renewable
diesel can be produced by at least three processes, hydrothermal
processing (hydrotreating), hydroprocessing, and indirect
liquefaction. These processes yield non-ester distillates. During
these processes, triacylglycerides produced and isolated as
described herein, are broken down to alkenes of C16 and C18.
[0351] Thus, in another aspect of the present invention a method
for producing renewable diesel is provided. In a preferred
embodiment, the method for producing renewable diesel comprises the
steps of A method of producing renewable diesel comprising the
steps of: (a) lysing a lipid-containing microorganism to produce a
lysate; (b) treating the lysate with an organic solvent for a
period of time sufficient to allow the lipid from the microorganism
to become solubilized in the organic solvent to form a
heterogeneous mixture; (c) separating the heterogeneous mixture
into a lipid:organic solvent composition and an aqueous composition
and, optionally, an emulsified composition or cell pellet
composition; (d) removing the lipid:organic solvent composition
from the aqueous composition, emulsion composition, or cell pellet
composition; and (e) treating the lipid:organic to produce a
straight chain alkane, whereby renewable diesel is produced. The
lipid:organic solvent composition comprises the organic solvent and
the cellular lipids.
[0352] 1. Hydrotreating
[0353] In a preferred embodiment of the method for producing
renewable diesel, treating the lipid:organic solvent composition or
the lipids produced and isolated to produce a straight chain
alkane, is performed by hydrotreating of the lipid:organic solvent
composition. In hydrothermal processing, typically, biomass is
reacted in water at an elevated temperature and pressure to form
oils and residual solids. Conversion temperatures are typically
570.degree. to 660.degree. F., with pressure sufficient to keep the
water primarily as a liquid, 100 to 170 standard atmosphere (atm).
Reaction times are on the order of 15 to 30 minutes. After the
reaction is completed, the organics are separated from the water.
Thereby a distillate suitable for diesel is produced.
[0354] 2. Hydroprocessing
[0355] A renewable diesel, referred to as "green diesel" can be
produced from fatty acids by traditional hydroprocessing
technology. The triglyceride-containing oils can be hydroprocessed
either as co-feed with petroleum or as a dedicated feed. The
product is a premium diesel fuel containing no sulfur and having a
cetane number of 90-100. Thus, in another preferred embodiment of
the method for producing renewable diesel, treating the
lipid:organic solvent composition or the lipids produced and
isolated to produce a straight chain alkane, is performed by
hydroprocessing of the lipid:organic solvent composition.
[0356] Petroleum refiners use hydroprocessing to remove impurities
by treating feeds with hydrogen. Hydroprocessing conversion
temperatures are typically 600.degree. to 700.degree. F. Pressures
are typically 40 to 100 atm. The reaction times are on the order of
10 to 60 minutes.
[0357] Solid catalysts are employed to increase certain reaction
rates, improve selectivity for certain products, and optimize
hydrogen consumption.
[0358] Hydrotreating and hydroprocessing can ultimately lead to a
reduction in the molecular weight of the feed. In the case of
triglyceride-containing oils, the triglyceride molecule is reduced
to four hydrocarbon molecules under hydroprocessing conditions: a
propane molecule and three hydrocarbon molecules, typically in the
C12 to C18 range. In some methods, the first step of treating a
triglyceride is hydroprocessing to saturate double bonds, followed
by deoxygenation at elevated temperature in the presence of
hydrogen and a catalyst. In some methods, hydrogenation and
deoxygenation occur in the same reaction. In other methods
deoxygenation occurs before hydrogenation. Isomerization is then
optionally performed, also in the presence of hydrogen and a
catalyst. Finally, gases and naphtha components can be removed if
desired. For example, see U.S. Pat. No. 5,475,160 (hydrogenation of
triglycerides); U.S. Pat. No. 5,091,116 (deoxygenation,
hydrogenation and gas removal); U.S. Pat. No. 6,391,815
(hydrogenation); and U.S. Pat. No. 5,888,947 (isomerization).
[0359] 3. Indirect Liquefaction
[0360] A traditional ultra-low sulfur diesel can be produced from
any form of biomass by a two-step process. First, the biomass is
converted to a syngas, a gaseous mixture rich in hydrogen and
carbon monoxide. Then, the syngas is catalytically converted to
liquids. Typically, the production of liquids is accomplished using
Fischer-Tropsch (FT) synthesis. This technology applies to coal,
natural gas, and heavy oils. Thus, in yet another preferred
embodiment of the method for producing renewable diesel, treating
the lipid:organic solvent composition or the lipids produced and
isolated to produce a straight chain alkane, is performed by
indirect liquefaction of the lipid:organic solvent composition.
[0361] C. Jet Fuel
[0362] The annual U.S. usage of jet fuel in 2006 was about 21
billion gallons (about 80 billion liters). Aeroplane fuel is clear
to straw colored. The most common fuel is an unleaded/paraffin
oil-based fuel classified as Aeroplane A-1, which is produced to an
internationally standardized set of specifications. Aeroplane fuel
is a mixture of a large number of different hydrocarbons, possibly
as many as a thousand or more. The range of their sizes (molecular
weighs or carbon numbers) is restricted by the requirements for the
product, for example, freezing point or smoke point. Kerosone-type
Aeroplane fuel (including Jet A and Jet A-1) has a carbon number
distribution between about 8 and 16 carbon numbers. Wide-cut or
naphta-type Aeroplane fuel (including Jet B) has a carbon number
distribution between about 5 and 15 carbon numbers.
[0363] Both Aeroplanes (Jet A and jet B) may contain a number of
additives. Useful additives include, but are not limited to,
antioxidants, antistatic agents, corrosion inhibitors, and fuel
system icing inhibitor (FSII) agents. Antioxidants prevent gumming
and usually, are based on alkylated phenols, for example, AO-30,
AO-31, or AO-37. Antistatic agents dissipate static electricity and
prevent sparking. Stadis 450 with dinonylnaphthylsulfonic acid
(DINNSA) as the active ingredient, is an example. Corrosion
inhibitors, e.g., DCI-4A is used for civilian and military fuels
and DCI-6A is used for military fuels. FSII agents, include, e.g.,
Di-EGME.
[0364] A solution is blending algae fuels with existing jet fuel.
The present invention provides such a solution. The lipid:organic
solvent layer or lipids produced by the method of the present
invention can serve as feedstock to produce jet fuel. Thus, in
another aspect of the present invention, a method for producing jet
fuel is provided. Herewith two methods for producing jet fuel from
the lipid:organic solvent layer or lipids produced by the method of
the present invention are provided, fluid catalytic cracking (FCC)
and hydrodeoxygenation (HDO).
[0365] 1. Fluid Catalytic Cracking
[0366] Fluid Catalytic Cracking (FCC) is one method which is used
to produce olefins, especially propylene from heavy crude
fractions. There are reports in the literature that vegetable oils
such as canola oil could be processed using FCC to give a
hydrocarbon stream useful as a gasoline fuel.
[0367] The lipid:organic solvent layer or lipids produced by the
method of the present invention can be converted to C.sub.2-C.sub.5
olefins. The process involves flowing the lipid:organic solvent
layer or lipids produced through an FCC zone and collecting a
product stream comprised of olefins, which is useful as a jet fuel.
The lipid:organic solvent layer or lipids produced are contacted
with a cracking catalyst at cracking conditions to provide a
product stream comprising C.sub.2-C.sub.5 olefins and hydrocarbons
useful as jet fuel.
[0368] Thus, in yet another aspect of the present invention a
method for producing jet fuel is provided. In a preferred
embodiment, the method for producing jet fuel comprises the steps
of (a) lysing a lipid-containing microorganism to produce a lysate;
(b) treating the lysate with anorganic solvent for a period of time
sufficient to allow the lipid from the microorganism to become
solubilized in the organic solvent to form a heterogeneous mixture;
(c) separating the heterogeneous mixture into a lipid:organic
solvent composition and an aqueous composition and, optionally, an
emulsified composition or cell pellet composition; (d) removing the
lipid:organic solvent composition from the aqueous composition,
emulsion composition, or cell pellet composition; and (e) treating
the lipid:organic solvent composition to produce a C.sub.2-C.sub.5
olefine, whereby jet fuel is produced. The lipid:organic solvent
composition comprises the organic solvent and cellular lipids.
[0369] In a preferred embodiment of the method for producing a jet
fuel, step (f) is performed by flowing the lipid:organic solvent
composition through a fluid catalytic cracking zone. Step (f) may
further comprise contacting the lipid:organic solvent composition
with a cracking catalyst at cracking conditions to provide a
product stream comprising C.sub.2-C.sub.5 olefins.
[0370] In certain embodiments of this method it may be desirable to
remove any contaminants that may be present in the lipid:organic
solvent composition. Thus, prior to step (f) flowing the
lipid:organic solvent composition through a fluid catalytic
cracking zone, the lipid:organic solvent composition is pretreated.
Pretreatment may involve contacting the lipid:organic solvent
composition with an ion-exchange resin. The ion exchange resin is
an acidic ion exchange resin, such as Amberlyst.TM.-15 and can be
used as a bed in a reactor through which the lipid:organic solvent
composition is flowed through, either upflow or downflow. Other
pretreatments may include mild acid washes by contacting the
lipid:organic solvent composition with an acid, such as sulfuric,
acetic, nitric, or hydrochloric acid. Contacting is done with a
dilute acid solution usually at ambient temperature and atmospheric
pressure.
[0371] The lipid:organic solvent composition, optionally
pretreated, is flowed to an FCC zone where the hydrocarbonaceous
components are cracked to olefins. Catalytic cracking is
accomplished by contacting the lipid:organic solvent composition in
a reaction zone with a catalyst composed of finely divided
particulate material. The reaction is catalytic cracking, as
opposed to hydrocracking, and is carried out in the absence of
added hydrogen or the consumption of hydrogen. As the cracking
reaction proceeds, substantial amounts of coke are deposited on the
catalyst. The catalyst is regenerated at high temperatures by
burning coke from the catalyst in a regeneration zone.
Coke-containing catalyst, referred to herein as "coked catalyst",
is continually transported from the reaction zone to the
regeneration zone to be regenerated and replaced by essentially
coke-free regenerated catalyst from the regeneration zone.
Fluidization of the catalyst particles by various gaseous streams
allows the transport of catalyst between the reaction zone and
regeneration zone. Methods for cracking hydrocarbons, such as those
of the lipid:organic solvent composition described herein, in a
fluidized stream of catalyst, transporting catalyst between
reaction and regeneration zones, and combusting coke in the
regenerator are well known by those skilled in the art of FCC
processes. Exemplary FCC applications and catalysts useful for
cracking the lipid:organic solvent composition to produce
C.sub.2-C.sub.5 olefins are described in U.S. Pat. Nos. 6,538,169,
7,288,685, which are incorporated in their entirety by
reference.
[0372] In one embodiment, cracking the lipid:organic solvent
composition of the present invention, takes place in the riser
section or, alternatively, the lift section, of the FCC zone. The
lipid:organic solvent composition is introduced into the riser by a
nozzle resulting in the rapid vaporization of the lipid:organic
solvent composition. Before contacting the catalyst, the
lipid:organic solvent composition will ordinarily have a
temperature of about 149.degree. C. to about 316.degree. C.
(300.degree. F. to 600.degree. F.). The catalyst is flowed from a
blending vessel to the riser where it contacts the lipid:organic
solvent composition for a time of abort 2 seconds or less.
[0373] The blended catalyst and reacted lipid:organic solvent
composition vapors are then discharged from the top of the riser
through an outlet and separated into a cracked product vapor stream
including olefins and a collection of catalyst particles covered
with substantial quantities of coke and generally referred to as
"coked catalyst." In an effort to minimize the contact time of the
lipid:organic solvent composition and the catalyst which may
promote further conversion of desired products to undesirable other
products, any arrangement of separators such as a swirl arm
arrangement can be used to remove coked catalyst from the product
stream quickly. The separator, e.g. swirl arm separator, is located
in an upper portion of a chamber with a stripping zone situated in
the lower portion of the chamber. Catalyst separated by the swirl
arm arrangement drops down into the stripping zone. The cracked
product vapor stream comprising cracked hydrocarbons including
light olefins and some catalyst exit the chamber via a conduit
which is in communication with cyclones. The cyclones remove
remaining catalyst particles from the product vapor stream to
reduce particle concentrations to very low levels. The product
vapor stream then exits the top of the separating vessel. Catalyst
separated by the cyclones is returned to the separating vessel and
then to the stripping zone. The stripping zone removes adsorbed
hydrocarbons from the surface of the catalyst by counter-current
contact with steam.
[0374] Low hydrocarbon partial pressure operates to favor the
production of light olefins. Accordingly, the riser pressure is set
at about 172 to 241 kPa (25 to 35 psia) with a hydrocarbon partial
pressure of about 35 to 172 kPa (5 to 25 psia), with a preferred
hydrocarbon partial pressure of about 69 to 138 kPa (10 to 20
psia). This relatively low partial pressure for hydrocarbon is
achieved by using steam as a diluent to the extent that the diluent
is 10 to 55 wt-% of lipid:organic solvent composition and
preferably about 15 wt-% of lipid:organic solvent composition.
Other diluents such as dry gas can be used to reach equivalent
hydrocarbon partial pressures.
[0375] The temperature of the cracked stream at the riser outlet
will be about 510.degree. C. to 621.degree. C. (950.degree. F. to
1150.degree. F.). However, riser outlet temperatures above
566.degree. C. (1050.degree. F.) make more dry gas and more
olefins. Whereas, riser outlet temperatures below 566.degree. C.
(1050.degree. F.) make less ethylene and propylene. Accordingly, it
is preferred to run the FCC process at a preferred temperature of
about 566.degree. C. to about 630.degree. C., preferred pressure of
about 138 kPa to about 240 kPa (20 to 35 psia). Another condition
for the process is the catalyst to lipid:organic solvent
composition ratio which can vary from about 5 to about 20 and
preferably from about 10 to about 15.
[0376] In one embodiment of the method for producing a jet fuel,
the lipid:organic solvent composition is introduced into the lift
section of an FCC reactor. The temperature in the lift section will
be very hot and range from about 700.degree. C. (1292.degree. F.)
to about 760.degree. C. (1400.degree. F.) with a catalyst to
lipid:organic solvent composition ratio of about 100 to about 150.
It is anticipated that introducing the lipid:organic solvent
composition into the lift section will produce considerable amounts
of propylene and ethylene.
[0377] Gas and liquid hydrocarbon products produced can be analyzed
by gas chromatography, HPLC, etc.
[0378] 2. Hydrodeoxygenation
[0379] In another embodiment of the method for producing a jet fuel
using the lipid:organic solvent composition or the lipids produced
as described herein, the structure of the lipid:organic solvent
composition or the lipids is broken by a process referred to as
hydrodeoxygenation (HDO). As such step (f) is performed by
hydrodeoxygenating the lipid:organic solvent composition.
[0380] HDO means removal of oxygen by means of hydrogen, that is,
oxygen is removed while breaking the structure of the material.
Olefinic double bonds are hydrogenated and any sulphur and nitrogen
compounds are removed. Sulphur removal is called
hydrodesulphurization (HDS). Pretreatment and purity of the raw
materials (lipid:organic solvent composition or the lipids)
contribute to the service life of the catalyst.
[0381] Generally in the HDO/HDS step, hydrogen is mixed with the
feed stock (lipid:organic solvent composition or the lipids) and
then the mixture is passed through a catalyst bed as a co-current
flow, either as a single phase or a two phase feed stock. After the
HDO/MDS step, the product fraction is separated and passed to a
separate isomerzation reactor. An isomerization reactor for
biological starting material is described in the literature (FI 100
248) as a co-current reactor.
[0382] The process for producing a fuel by hydrogenating a
hydrocarbon feed, e.g., the lipid:organic solvent composition or
the lipids herein, can also be performed by passing the
lipid:organic solvent composition or the lipids as a co-current
flow with hydrogen gas through a first hydrogenation zone, and
thereafter the hydrocarbon effluent is further hydrogenated in a
second hydrogenation zone by passing hydrogen gas to the second
hydrogenation zone as a counter-current flow relative to the
hydrocarbon effluent. Exemplary HDO applications and catalysts
useful for cracking the lipid:organic solvent composition to
produce C.sub.2-C.sub.5 olefins are described in U.S. Pat. No.
7,232,935 which is incorporated in its entirety by reference.
[0383] Typically, in the hydrodeoxygenation step, the structure of
the biological component, such as the lipid:organic solvent
composition or lipids herein, is decomposed, oxygen, nitrogen,
phosphorus and sulphur compounds, and light hydrocarbons as gas are
removed, and the olefinic bonds are hydrogenated. In the second
step of the process, i.e. in the so-called isomerization step,
isomerzation is carried out for branching the hydrocarbon chain and
improving the performance of the paraffin at low temperatures.
[0384] In the first step i.e. HDO step of the cracking process,
hydrogen gas and the lipid:organic solvent composition or lipids
herein which are to be hydrogenated are passed to a HDO catalyst
bed system either as co-current or counter-current flows, said
catalyst bed system comprising one or more catalyst bed(s),
preferably 1-3 catalyst beds. The HDO step is typically operated in
a co-current manner. In case of a HDO catalyst bed system
comprising two or more catalyst beds, one or more of the beds may
be operated using the counter-current flow principle.
[0385] In the HDO step, the pressure varies between 20 and 150 bar,
preferably between 50 and 100 bar, and the temperature varies
between 200 and 500.degree. C., preferably in the range of
300-400.degree. C.
[0386] In the HDO step, known hydrogenation catalysts containing
metals from Group VII and/or VIB of the Periodic System may be
used. Preferably, the hydrogenation catalysts are supported Pd, Pt,
Ni, NiMo or a CoMo catalysts, the support being alumina and/or
silica. Typically, NiMo/Al.sub.2O.sub.3 and CoMo/Al.sub.2O.sub.3
catalysts are used.
[0387] Prior to the HDO step, the lipid:organic solvent composition
or lipids herein may optionally be treated by prehydrogenation
under milder conditions thus avoiding side reactions of the double
bonds. Such prehydrogenation is carried out in the presence of a
prehydrogenation catalyst at temperatures of 50 400.degree. C. and
at hydrogen pressures of 1 200 bar, preferably at a temperature
between 150 and 250.degree. C. and at a hydrogen pressure between
10 and 100 bar. The catalyst may contain metals from Group VIII
and/or VIB of the Periodic System. Preferably, the prehydrogenation
catalyst is a supported Pd, Pt, Ni, NiMo or a CoMo catalyst, the
support being alumina and/or silica.
[0388] A gaseous stream from the HDO step containing hydrogen is
cooled and then carbon monoxide, carbon dioxide, nitrogen,
phosphorus and sulphur compounds, gaseous light hydrocarbons and
other impurities are removed therefrom. After compressing, the
purified hydrogen or recycled hydrogen is returned back to the
first catalyst bed and/or between the catalyst beds to make up for
the withdrawn gas stream. Water is removed from the condensed
liquid. The liquid is passed to the first catalyst bed or between
the catalyst beds.
[0389] After the HDO step, the product is subjected to an
isomerization step. It is substantial for the process that the
impurities are removed as completely as possible before the
hydrocarbons are contacted with the isomerization catalyst. The
isomerization step comprises an optional stripping step, wherein
the reaction product from the HDO step may be purified by stripping
with water vapour or a suitable gas such as light hydrocarbon,
nitrogen or hydrogen. The optional stripping step is carried out in
counter-current manner in a unit upstream of the isomerization
catalyst, wherein the gas and liquid are contacted with each other,
or before the actual isomerization reactor in a separate stripping
unit utilizing counter-current principle.
[0390] After the stripping step the hydrogen gas and the
hydrogenated lipid:organic solvent composition or lipids herein,
and optionally an n-paraffin mixture, are passed to a reactive
isomerization unit comprising one or several catalyst bed(s). The
catalyst beds of the isomerization step may operate either in
co-current or counter-current manner.
[0391] It is important for the process that the counter-current
flow principle is applied in the isomerization step. In the
isomerization step this is done by carrying out either the optional
stripping step or the isomerization reaction step or both in
counter-current manner.
[0392] The isomerization step and the HDO step may be carried out
in the same pressure vessel or in separate pressure vessels.
Optional prehydrogenation may be carried out in a separate pressure
vessel or in the same pressure vessel as the HDO and isomerization
steps.
[0393] In the isomerzation step, the pressure varies in the range
of 20 150 bar, preferably in the range of 20 100 bar, the
temperature being between 200 and 500.degree. C., preferably
between 300 and 400.degree. C.
[0394] In the isomerization step, isomerization catalysts known in
the art may be used. Suitable isomerization catalysts contain
molecular sieve and/or a metal from Group VII and/or a carrier.
Preferably, the isomerization catalyst contains SAPO-11 or SAPO41
or ZSM-22 or ZSM-23 or ferrierite and Pt, Pd or Ni and
Al.sub.2O.sub.3 or SiO.sub.2. Typical isomerization catalysts are,
for example, Pt/SAPO-11/Al.sub.2O.sub.3, Pt/ZSM-22/Al.sub.2O.sub.3,
Pt/ZSM-23/Al.sub.2O.sub.3 and Pt/SAPO-11/SiO.sub.2.
[0395] As the product, a high quality hydrocarbon component of
biological origin, useful as a diesel fuel or a component thereof,
is obtained, the density, cetane number and performance at low
temperate of said hydrocarbon component being excellent.
VIII. Compositions
[0396] Another object of the present invention is to provide
compositions comprising lipids isolated by using the methods
described herein. A preferred composition comprises (i) a first
lipid isolated from a microorganism and (ii) a second lipid,
wherein the second lipid is obtained from a source other than the
microorganism.
[0397] The first lipid can be isolated from any of the
microorganisms described herein.
[0398] A. First Lipids
[0399] Methods of the present invention are applicable to
extracting a variety of lipids from a variety of microorganisms.
Microorganisms described herein produce a variety of lipids, such
as phospholipids, free fatty acids, esters of fatty acids,
including triglycerides of fatty acids, sterols; pigments (e.g.,
carotenoids and oxycarotenoids) and other lipids, and lipid
associated compounds such as phytosterols, ergothionine, lipoic
acid and antioxidants including beta-carotene and tocopherol.
Exemplary first lipids include, but are not limited to, C8, C10,
C12, C14, C16 and C18 triacylglycerides, lipids containing omega-3
highly unsaturated fatty acids, such as docosahexaenoic acid (DHA),
eicosapentaenoic acid (EPA), and/or docosapentaenoic acid (DPA).
First lipids also include arachidonic acid, stearidonic acid,
cholesterol, desmesterol, astaxanthin, canthaxanthin, and n-6 and
n-3 highly unsaturated fatty acids such as eicosapentaenoic acid,
docosapentaenoic acid and docosahexaenoic acid. Other lipids and
microorganisms which may be suitable for use in the instant
invention will be readily apparent to those skilled in the art.
[0400] Preferred first lipids are lipids containing a relatively
large amount of C18 and C16 fatty acids.
[0401] 1. C18:1
[0402] In a preferred embodiment of the present invention, the
first lipid of a composition comprises at least 50% of a C18:1
lipid, preferably at least 60%, and more preferably at least
80%.
[0403] 2. C10, C12 and C14
[0404] In another preferred embodiment of the present invention,
the first lipid of a composition comprises at least 10% of a C10:0,
C12:0 and C14:0 lipid combined, preferably at least 15%, more
preferably at least 20%, and most preferably at least 30%.
[0405] B. Second Lipids
[0406] The second lipid can be any oil, optionally selected from
the group consisting of oil from soy, rapeseed, canola, palm,
coconut, corn, waste vegetable, Chinese tallow, olive, sunflower,
cotton seed. chicken fat, beef tallow, porcine tallow, microalgae,
macroalgae, Cuphea, flax, peanut, choice white grease, lard,
Camelina sativa, mustard seed, cashew nut, oats, lupine, kenaf,
calendula, hemp, coffee, linseed, hazelnuts, euphorbia, pumpkin
seed, coriander, camellia, sesame, safflower, rice, tung oil tree,
cocoa, copra, pium poppy, castor beans, pecan nuts, jojoba,
jatropha, macadamia nuts, Brazil nuts, and avocado. A preferred
second lipid is coconut oil. Another preferred second lipid is palm
oil or soy oil. A second lipid can also be a fossil oil such as
crude oil or a distillate fraction of crude oil.
[0407] C. Compositions Comprising a First Lipid and a Second
Lipid
[0408] The first lipid and the second lipid can be provided at
different ratios. In a preferred embodiment, the ratio of the first
lipid to the second lipid is between 1 and 100. In another
preferred embodiment, the ratio of the first lipid to the second
lipid is between 1 and 10. In another preferred embodiment, the
ratio of the first lipid to the second lipid is about 1. In another
embodiment, the ratio of the second lipid to the first lipid is
between 10 and 1.
[0409] Additional embodiments of the present invention include
optional functional components that would allow one of ordinary
skill in the art to perform any of the method variations described
herein.
[0410] Although the forgoing invention has been described in some
detail by way of illustration and example for clarity and
understanding, it will be readily apparent to one of ordinary skill
in the art in light of the teachings of this invention that certain
variations, changes, modifications and substitution of equivalents
may be made thereto without necessarily departing from the spirit
and scope of this invention. As a result, the embodiments described
herein are subject to various modifications, changes and the like,
with the scope of this invention being determined solely by
reference to the claims appended hereto. Those of skill in the art
will readily recognize a variety of non-critical parameters that
could be changed, altered or modified to yield essentially similar
results.
[0411] While each of the elements of the present invention is
described herein as containing multiple embodiments, it should be
understood that, unless indicated otherwise, each of the
embodiments of a given element of the present invention is capable
of being used with each of the embodiments of the other elements of
the present invention and each such use is intended to form a
distinct embodiment of the present invention.
[0412] The referenced patents, patent applications, and scientific
literature, including accession numbers to GenBank database
sequences, referred to herein are hereby incorporated by reference
in their entirety as if each individual publication, patent or
patent application were specifically and individually indicated to
be incorporated by reference. Any conflict between any reference
cited herein and the specific teachings of this specification shall
be resolved in favor of the latter. Likewise, any conflict between
an art-understood definition of a word or phrase and a definition
of the word or phrase as specifically taught in this specification
shall be resolved in favor of the latter. The publications
mentioned herein are cited for the purpose of describing and
disclosing reagents, methodologies and concepts that may be used in
connection with the present invention. Nothing herein is to be
construed as an admission that these references are prior art in
relation to the inventions described herein. In particular, the
following patent applications are hereby incorporated by reference
in their entireties for all purposes: U.S. Provisional Application
No. 61/028,493, filed Feb. 13, 2008, entitled "Extraction of Lipids
from Microorganisms"; U.S. Provisional Application No. 61/036,918,
filed Mar. 14, 2008, entitled "Oil Separation Methods"; U.S.
Provisional Application No. 61/043,318, filed Apr. 8, 2008,
entitled "Fractionation of Oil-Bearing Biomass"; PCT Patent
Application No. PCT/US2009/066142, filed Nov. 30, 2009, entitled
"Production of Tailored Oils in Heterotrophic Microorganisms"; and
PCT Patent Application No. PCT/US2009/066141, filed Nov. 30, 2009,
entitled "Manufacturing of Tailored Oils in Recombinant
Heterotrophic Microorganisms".
[0413] Although this invention has been described in connection
with specific embodiments thereof, it will be understood that it is
capable of further modifications. The present invention also has a
wide variety of applications. This application is intended to cover
any variations, uses or adaptations of the invention following, in
general, the principles of the invention and including such
departures from the present disclosure as come within known or
customary practice within the art to which the invention pertains
and as may be applied to the essential features hereinbefore set
forth.
IX. Examples
Example 1
Cultivation of Microalgae to Achieve High Oil Content
[0414] Microalgae strains were cultivated to achieve a high
percentage of oil by dry cell weight. Cryopreserved cells were
thawed at room temperature and 500 .mu.l of cells were added to 4.5
ml of medium (4.2 g/L K.sub.2HPO.sub.4, 3.1 g/L NaH.sub.2PO.sub.4,
0.2 g/L MgSO.sub.4.7H.sub.2O, 0.25 g/L citric acid monohydrate,
0.025 g/L CaCl.sub.2.2H.sub.2O, 2 g/L yeast extract) plus 2%
glucose and grown for 7 days at 28.degree. C. with agitation (200
rpm) in a 6-well plate. Dry cell weights were determined by
centrifuging 1 ml of culture at 14,000 rpm for 5 min in a
pre-weighed Eppendorf tube. The culture supernatant was discarded
and the resulting cell pellet washed with 1 ml of deionized water.
The culture was again centrifuged, the supernatant discarded, and
the cell pellets placed at -80.degree. C. until frozen. Samples
were then lyophilized for 24 hours and dry cell weights calculated.
For determination of total lipid in cultures, 3 ml of culture was
removed and subjected to analysis using an Ankom system (Ankom
Inc., Macedon, N.Y.) according to the manufacturer's protocol.
Samples were subjected to solvent extraction with an Ankom XT10
extractor according to manufacturer's protocol. Total lipid was
determined as the difference in mass between acid hydrolyzed dried
samples and solvent extracted, dried samples. Percent oil dry cell
weight measurements are shown in Table 12.
TABLE-US-00013 TABLE 12 Percent oil dry cell weight for microalgae.
Species Strain % Oil Strain # Chlorella kessleri UTEX 387 39.42 4
Chlorella kessleri UTEX 2229 54.07 5 Chlorella kessleri UTEX 398
41.67 6 Parachlorella kessleri SAG 11.80 37.78 7 Parachlorella
kessleri SAG 14.82 50.70 8 Parachlorella kessleri SAG 21.11 H9
37.92 9 Prototheca stagnora UTEX 327 13.14 10 Prototheca moriformis
UTEX 1441 18.02 11 Prototheca moriformis UTEX 1435 27.17 12
Chlorella minutissima UTEX 2341 31.39 13 Chlorella protothecoides
UTEX 250 34.24 1 Chlorella protothecoides UTEX 25 40.00 2 Chlorella
protothecoides CCAP 211/8D 47.56 3 Chlorella sp. UTEX 2068 45.32 14
Chlorella sp. CCAP 211/92 46.51 15 Chlorella sorokiniana SAG
211.40B 46.67 16 Parachlorella beijerinkii SAG 2046 30.98 17
Chlorella luteoviridis SAG 2203 37.88 18 Chlorella vulgaris CCAP
211/11K 35.85 19 Chlorella reisiglii CCAP 11/8 31.17 20 Chlorella
epllipsoidea CCAP 211/42 32.93 21 Chlorella saccharophila CCAP
211/31 34.84 22 Chlorella saccharophila CCAP 211/32 30.51 23
Example 2
Cultivation of Chlorella Protothecoides
[0415] Three fermentation processes were performed with three
different media formulations with the goal of generating algal
biomass with high oil content. The first formulation (Media 1) was
based on medium described in Wu et al. (1994 Science in China, vol.
37, No. 3, pp. 326-335) and consisted of per liter:
KH.sub.2PO.sub.4, 0.7 g; K.sub.2HPO.sub.4, 0.3 g;
MgSO.sub.4-7H.sub.2O, 0.3 g; FeSO.sub.4-7H.sub.2O, 3 mg; thiamine
hydrochloride, 10 .mu.g; glucose, 20 g; glycine, 0.1 g;
H.sub.3BO.sub.3, 2.9 mg; MnCl.sub.2-4H.sub.2O, 1.8 mg;
ZnSO.sub.4-7H.sub.2O, 220 .mu.g; CuSO.sub.4-5H.sub.2O, 80 .mu.g;
and NaMoO.sub.4-2H.sub.2O, 22.9 mg. The second medium (Media 2) was
derived from the flask media described in Example 1 and consisted
of per liter: K.sub.2HPO.sub.4, 4.2 g; NaH.sub.2PO.sub.4, 3.1 g;
MgSO.sub.4-7H.sub.2O, 0.24 g; citric acid monohydrate, 0.25 g;
calcium chloride dehydrate, 25 mg; glucose, 20 g; yeast extract, 2
g. The third medium (Media 3) was a hybrid and consisted of per
liter: K.sub.2HPO.sub.4, 4.2 g; NaH.sub.2PO.sub.4, 3.1 g;
MgSO.sub.4-7H.sub.2O, 0.24 g; citric acid monohydrate, 0.25 g;
calcium chloride dehydrate, 25 mg; glucose, 20 g; yeast extract, 2
g; H.sub.3BO.sub.3, 2.9 mg; MnCl.sub.2-4H.sub.2O, 1.8 mg;
ZnSO.sub.4-7H.sub.2O, 220 .mu.g; CuSO.sub.4-5H.sub.2O, 80 .mu.g;
and NaMoO.sub.4-2H.sub.2O, 22.9 mg. All three media formulations
were prepared and autoclave sterilized in lab scale fermentor
vessels for 30 minutes at 121.degree. C. Sterile glucose was added
to each vessel following cool down post autoclave
sterilization.
[0416] Inoculum for each fermentor was Chlorella protothecoides
(UTEX 250), prepared in two flask stages using the medium and
temperature conditions of the fermentor inoculated. Each fermentor
was inoculated with 10% (v/v) mid-log culture. The three lab scale
fermentors were held at 28.degree. C. for the duration of the
experiment. The microalgal cell growth in Media 1 was also
evaluated at a temperature of 23.degree. C. For all fermentor
evaluations, pH was maintained at 6.6-6.8, agitations at 500 rpm,
and airflow at 1 vvm. Fermentation cultures were cultivated for 11
days. Biomass accumulation was measured by optical density at 750
nm and dry cell weight.
[0417] Lipid/oil concentration was determined using direct
transesterification with standard gas chromatography methods.
Briefly, samples of fermentation broth with biomass was blotted
onto blotting paper and transferred to centrifuge tubes and dried
in a vacuum oven at 65-70.degree. C. for 1 hour. When the samples
were dried, 2 mL of 5% H.sub.2SO.sub.4 in methanol was added to the
tubes. The tubes were then heated on a heat block at 65-70.degree.
C. for 3.5 hours, while being vortexed and sonicated
intermittently. 2 ml of heptane was then added and the tubes were
shaken vigorously. 2 Ml of 6% K.sub.2CO.sub.3 was added and the
tubes were shaken vigorously to mix and then centrifuged at 800 rpm
for 2 minutes. The supernatant was then transferred to GC vials
containing Na.sub.2SO.sub.4 drying agent and ran using standard gas
chromatography methods. Percent oil/lipid was based on a dry cell
weight basis. The dry cell weights for cells grown using: Media 1
at 23.degree. C. was 9.4 g/L; Media 1 at 28.degree. C. was 1.0 g/L,
Media 2 at 28.degree. C. was 21.2 g/L; and Media 3 at 28.degree. C.
was 21.5 g/L. The lipid/oil concentration for cells grown using:
Media 1 at 23.degree. C. was 3 g/L; Media 1 at 28.degree. C. was
0.4 g/L; Media 2 at 28.degree. C. was 18 g/L; and Media 3 at
28.degree. C. was 19 g/L. The percent oil based on dry cell weight
for cells grown using: Media 1 at 23.degree. C. was 32%; Media 1 at
28.degree. C. was 40%; Media 2 at 28.degree. C. was 85%; and Media
3 at 28.degree. C. was 88%. The lipid profiles (in area %, after
normalizing to the internal standard) for algal biomass generated
using the three different media formulations at 28.degree. C. are
summarized below in Table 13.
TABLE-US-00014 TABLE 13 Lipid profiles for Chlorella protothecoides
grown under different media conditions. Media 1 28.degree. C. Media
2 28.degree. C. Media 3 28.degree. C. (in Area %) (in Area %) (in
Area %) C14:0 1.40 0.85 0.72 C16:0 8.71 7.75 7.43 C16:1 -- 0.18
0.17 C17:0 -- 0.16 0.15 C17:1 -- 0.15 0.15 C18:0 3.77 3.66 4.25
C18:1 73.39 72.72 73.83 C18:2 11.23 12.82 11.41 C18:3 alpha 1.50
0.90 1.02 C20:0 -- 0.33 0.37 C20:1 -- 0.10 0.39 C20:1 -- 0.25 --
C22:0 -- 0.13 0.11
Example 3
Genotyping of Microalgae with High Oil Content
[0418] Microalgae samples from the 23 strains listed in Table 12
above were genotyped. Genomic DNA was isolated from algal biomass
as follows. Cells (approximately 200 mg) were centrifuged from
liquid cultures for 5 minutes at 14,000.times.g. Cells were then
resuspended in sterile distilled water, centrigured for 5 minutes
at 14,000.times.g and the supernatant discarded. A single glass
bead .about.2 mm in diameter was added to the biomass and tubes
were placed at -80.degree. C. for at least 15 minutes. Samples were
removed and 150 .mu.l of grinding buffer (1% Sarkosyl, 0.25 M
sucrose, 50 mM NaCl, 20 mM EDTA, 100 mM Tris-HCl, pH 8.0, RNase A
0.5 .mu.g/.mu.l) was added. Pellets were resuspended by vortexing
briefly, followed by the addition of 40 .mu.l of 5M NaCl. Samples
were vortexed briefly, followed by the addition of 66 .mu.l of 5%
CTAB (Cetyl trimethylammonium bromide) and a final brief vortex.
Samples were next incubated at 65.degree. C. for 10 minutes after
which they were centrifuged at 14,000.times.g for 10 minutes. The
supernatant was transferred to a fresh tube and extracted once with
300 .mu.l Phenol: Chloroform:Isoamyl alcohol 12:12:1, followed by
centrifugation for 5 minutes at 14,000.times.g. The resulting
aqueous phase was transferred to a fresh tube containing 0.7 vol of
isoproanol (.about.190 .mu.l), mixed by inversion and incubated at
room temperature for 30 minutes or overnight at 4.degree. C. DNA
was recovered via centrifugation at 14,000.times.g for 10 minutes.
The resulting pellet was then washed twice with 70% ethanol,
followed by a final wash with 100% ethanol. Pellets were air dried
for 20-30 minutes at room temperature followed by resuspension in
50 .mu.l of 10 mM TrisCl, 1 mM EDTA (pH 8.0).
[0419] Five .mu.l of total algal DNA, prepared as described above,
was diluted 1:50 in 10 mM Tris, pH 8.0. PCR reactions, final volume
20 .mu.l, were set up as follows. Ten .mu.l of 2.times. iProof HF
master mix (BIO-RAD) was added to 0.4 .mu.l primer SZ02613
(5'-TGTTGAAGAATGAGCCGGCGAC-3' (SEQ ID NO:5) at 10 mM stock
concentration). This primer sequence runs from position 567-588 in
Gen Bank accession no. L43357 and is highly conserved in higher
plants and algal plastid genomes. This was followed by the addition
of 0.4 .mu.l primer SZ02615 (5'-CAGTGAGCTATTACGCACTC-3' (SEQ ID
NO:6) at 10 mM stock concentration). This primer sequence is
complementary to position 1112-1093 in Gen Bank accession no.
L43357 and is highly conserved in higher plants and algal plastid
genomes. Next, 5 .mu.l of diluted total DNA and 3.2 .mu.l dH.sub.2O
were added. PCR reactions were run as follows: 98.degree. C., 45'';
98.degree. C., 8''; 53.degree. C., 12''; 72.degree. C., 20'' for 35
cycles followed by 72.degree. C. for 1 min and holding at
25.degree. C. For purification of PCR products, 20 .mu.l of 10 mM
Tris, pH 8.0, was added to each reaction, followed by extraction
with 40 .mu.l of Phenol:Chloroform:isoamyl alcohol 12:12:1,
vortexing and centrifuging at 14,000.times.g for 5 minutes. PCR
reactions were applied to S-400 columns (GE Healthcare) and
centrifuged for 2 minutes at 3,000.times.g. Purified PCR products
were subsequently TOPO cloned into PCR8/GW/TOPO and positive clones
selected for on LB/Spec plates. Purified plasmid DNA was sequenced
in both directions using M13 forward and reverse primers. Sequences
from strains 1-23 (designated in Example 1, Table 12) are listed as
SEQ ID NOs: 7-29 in the attached Sequence Listing.
Example 4
Genomic DNA Analysis of 23S rRNA from Chlorella protothecoides and
Prototheca
[0420] Genomic DNA from 8 strains of Chlorella protothecoides (UTEX
25, UTEX 249, UTEX 250, UTEX 256, UTEX 264, UTEX 411, CCAP 211/17
and CCAP 211/8d) was isolated and genomic DNA analysis of 23S rRNA
was performed according to the methods described above in Example
3. All strains of Chlorella protothecoides tested were identical in
sequence except for UTEX 25. Sequences for all eight strains are
listed as SEQ ID NOs: 30 and 31 in the attached Sequence
Listing.
[0421] The 23s rRNA genomic sequence for Prototheca moriformis UTEX
1436 (SEQ ID NO: 32) was also compared to other Prototheca species
(UTEX 1435, UTEX 1437, and UTEX 1439) and the above described
Chlorella protothecoides strains. The comparison showed that the
23s rRNA genomic sequence for Prototheca moriformis UTEX 1436 was
dissimilar to the other Prototheca genotypes (SEQ ID NO: 33).
Example 5
Diversity of Lipid Chains in Microalgal Species
[0422] Lipid samples from a subset of strains grown in Example 1,
Table 12 were analyzed for lipid profile using HPLC. Results are
shown below in Table 14.
TABLE-US-00015 TABLE 14 Diversity of lipid chains in microalgal
species. Strain # from Table 12 C:14:0 C:16:0 C:16:1 C:18:0 C:18:1
C:18:2 C:18:3 C:20:0 C:20:1 1 0.57 10.30 0 3.77 70.52 14.24 1.45
0.27 0 2 0.61 8.70 0.30 2.42 71.98 14.21 1.15 0.20 0.24 4 0.68 9.82
0 2.83 65.78 12.94 1.46 0 0 5 1.47 21.96 0 4.35 22.64 9.58 5.2 3.88
3.3 10 0 12.01 0 0 50.33 17.14 0 0 0 11 1.41 29.44 0.70 3.05 57.72
12.37 0.97 0.33 0 12 1.09 25.77 0 2.75 54.01 11.90 2.44 0 0
Example 6
Extraction of Lipids from Microalgae Using Coconut Oil
[0423] 1. Cell Production
[0424] An F-Tank batch of Chlorella protothecoides (about 1,200
gallons) was used to generate biomass for extraction processes. The
batch (#ZA07126) was allowed to run for 100 hours, while
controlling the glucose levels at 16 g/L, after which time the corn
syrup feed was terminated. Residual glucose levels dropped to <0
g/L two hours later. This resulted in a final age of 102 hours. The
final broth volume was 1,120 gallons. Both in-process contamination
checks and a thorough analysis of a final broth sample failed to
show any signs of contamination.
[0425] 2. Cell Disruption
[0426] Lyophilized Chlorella protothecoides cells were resuspended
to 200 g/L with DI water containing 20 g/L KOH. This cell
suspension was autoclaved at 130.degree. C. for 30 minutes and
cooled to room temperature. A 10 ml sample of this material was
sonicated using a Misonix 3000 sonicator equipped with a micro-tip
on level 7. The suspension was sonicated for 6 minutes on a 30 sec
on/off cycle for a total of 3 cycles. More than 70% breakage was
observed by microscope analysis. An aliquot of this suspension (1
ml sample) was centrifuged at 14 K rpm for 15 min Three layers were
observed: a pellet of heavy solids, an aqueous phase and an
emulsion phase. No oil layer was observed.
[0427] A second set of experiments were performed looking at cell
breakage efficiency at a variety of times of sonication to achieve
maximal cell breakage. 6 ml samples of Chlorella protothecoides
cells prepared as described above were sonicated using a Misonix
3000 sonicator equipped with a micro-tip on level 8 with interval
times of 20 seconds on and 20 seconds off. The sonication times
ranged from 10 minutes, 20 minutes and 30 minutes and were all
performed with the samples on ice. The samples were then
centrifuged at 4300 rpm for 30 minutes. Three layers were observed:
a pellet of heavy solids, an aqueous phase and an emulsion phase.
No oil layer was observed. Each time point sample was also analyzed
qualitatively for total cell breakage by looking for whole cells in
the lysate under 100.times. magnification. No whole cells were
observed in any of the time point samples, indicating that 10
minutes of sonication was sufficient to achieve maximal cell
breakage. Micrographs of the lysate under magnification showed oil
droplets and cell debris consisting of organelles and disrupted
cell membranes. To further inspection of the cell pellets from each
of the samples showed no whole cells were observed, only cell
debris.
[0428] 3. Algal Oil Purification for Control
[0429] Chlorella protothecoides oil was obtained from dried biomass
via hexane extraction using standard methods known in the art (see
for example U.S. Pat. Nos. 5,567,732; 6,255,505; and Yamada et al.,
Industrial applications of single cell oils, Eds. Kyle and
Ratledge, 118-138 (1992)).
[0430] 4. HPLC Analysis of Fatty Acid Profiles
[0431] The fatty acid concentrations and profiles of (i) Chlorella
cells, (ii) pure algal oil, (iii) pure coconut oil, and (iv) the
extracted oil samples were determined by HPLC.
[0432] A 50 .mu.l sample of the (200 g/L) washed Chlorella cell
suspension (before caustic and heat treatment; see above) was
hydrolyzed by incubation at 80.degree. C. in an isopropanol/KOH
saturated solution for 4 hours. The cells were then centrifuged at
14 K rpm for 10 min and the hydrolysate was loaded onto an HPLC
column. Samples were analyzed using an Aligent 1100 HPLC using the
following method. The samples were derivatized with bromophenacyl
bromide (60 mg/ml) and loaded onto a Luna 5u C8(2) 100 A
150.times.2 mm column (Phenomenex). The samples were eluted from
the column using a gradient of water to 100%
Acetonitrile:tetrahydrofuran (95:5). Signals were detected using
DAD array detector at a wavelength of 254 nm. The result of such an
analysis detailing the lipid profiles for pure oils (algal and
coconut oil), established separately (i.e., not mixed with each
other), is shown in FIG. 1. This result demonstrated that the lipid
profiles of pure algal oil and coconut oil are different. As such,
coconut oil can be used as an organic solvent to extract lipids
from microalgae and the percent of lipids extracted can be
determined (see below).
[0433] 5. Construction and Validation of Theoretical Curves
[0434] The fatty acids from mixtures of pure algal oil extracted
from Chlorella and coconut oil were measured as percentages of the
total lipid and are shown in Table 15.
TABLE-US-00016 TABLE 15 Fatty acid content as percentage of total
lipid. % Coconut % Algal Oil Oil C18:1 C12 C14 C18:1/C12 C18:1/C14
0 100 59 0.01 1.00 5,900 59.00 2 98 57.9 1.09 8.14 53.13 7.12 5 95
56.3 2.71 8.39 20.76 6.71 10 90 53.5 5.41 8.81 9.89 6.08 20 80 48.0
10.81 9.64 4.44 4.98 25 75 45.3 13.51 10.06 3.35 4.5 40 60 37.0
21.61 11.31 1.71 3.27 50 50 31.5 27.01 12.15 1.17 2.59 60 40 26.0
32.40 12.98 0.80 2.00 27 25 17.8 40.5 14.23 0.44 1.25 80 20 15.0
43.2 14.65 0.35 1.02 89.75 10.25 9.6 48.47 15.46 0.20 0.62 94.75
5.25 6.9 51.17 15.88 0.13 0.43 100 0 4 54 17.00 0.07 0.24
[0435] In pure algal oil, 59% of the total fatty acids are of the
C18:1 type, 0.01% are of the C12 type, and 1% are of the C14 type.
The remaining 39.99% of algal fatty acids are C10:1, C10, C18:3,
C18:2, C16 or C18 fatty acids, the majority being C18:2 fatty acids
(see FIG. 1). In pure coconut oil, 4% of the fatty acids are of the
C18:1 type, 54% are of the C12 type, and 17% are of the C14 type.
The remaining 25% are C10:1, C10, C18:3, C18:2, C16 or C18 fatty
acids (see FIG. 1). Upon mixing algal oil with coconut oil, the
ratio of the respective fatty acids changes. For example, in a 1:1
mixture of pure algal oil and pure coconut oil, 31.5% of the total
fatty acids are of the C18:1 type (where the majority is from algal
oil), 27.01% are of the C12 type (which are almost exclusively from
coconut oil), and 12.15% are of the C14 type (where the majority is
from coconut oil). This reference table is useful for determining
the percent of algal fatty acids and the percent of coconut fatty
acids upon HPLC analysis of a lipid:organic solvent composition
obtained from the lightest layer of a microalgal biomass lysate
that has been subjected to centrifugation.
[0436] A curve was constructed based on the expected total C18:1 vs
C12 or C14 in a mixture of the two pure oils, i.e., algal oil and
coconut oil. The theoretical measurements for both curves were
validated by HPLC analysis of a 1:1 mixture of pure algal to pure
coconut oil which should result in 50% of each ratio. The measured
value from the C18:1 to C12 and C14 was 51% and 65% respectively
when fitted to the corresponding curve (FIG. 2).
[0437] 6. Separating Microbial Oil from an Emulsion Using an
Organic Solvent (Coconut Oil Example)
[0438] In order to free the oil from the Chlorella lysate, coconut
oil was added to 1 ml of disrupted Chlorella cell material at
ratios of 3:1, 1:1, 1:3 and 1:10 (algal oil to coconut oil), mixed
well and heated for 15 min at 70.degree. C. and then centrifuged
for 15 min at 14 K rpm in a microcentrifuge. Upon centrifugation 4
layers were observed: a pellet of heavy solids, an aqueous phase,
an emulsion phase an oil phase. Then the oil phase was separated
from the other layers by pipetting. The oil phase included a
mixture of algal oil and coconut oil of which an aliquot as
subjected to HPLC analysis. The measurement of algal oil in the
suspension was based on oil content of cells. Controls included (i)
3 mg of pure algal oil, (ii) 3 mg of pure coconut oil; and (iii) a
1:1 mixture of pure algal oil and pure coconut oil. A 5 .mu.l
sample from each was analyzed by HPLC.
[0439] 7. Results
[0440] The oil content of the starting cell mass (CM) was
approximately 30% as determined by HPLC. Coconut oil was used to
extract lipids from a disrupted cell suspension of Chlorella (200
g/L was suspension) in mixtures of 3:1, 1:1, 1:3 and 1:10 (algal to
coconut oil). The samples in this experiment included: (1) 3 mg
pure algal oil (control); (2) 3 mg pure coconut oil (control); (3)
1:1 mix of 3 mg of each pure oil (control); (4) CM (1 ml)+coconut
oil (3:1); (5) CM (1 ml)+coconut oil (1:1); (6) CM (1 ml)+coconut
oil (1:3); (7) CM (1 ml)+coconut oil (1:10); and (8) CM (1 ml).
[0441] No oil layer was present in the sample without coconut oil
(8). The fatty acid composition (expressed as % fatty acid of total
lipid) of the pure oil controls and each of the extraction mixtures
(experiments (1)-(7)) is shown in Table 16.
TABLE-US-00017 TABLE 16 Fatty acid composition of pure oil controls
and extraction mixtures. 1:1 Mix of % Fatty Algal Coconut Algal Oil
and C.p./C.oil C.p./C.oil C.p./C.oil C.p./C.oil Acid of Oil Oil
Coconut Oil (3:1) (1:1) (1:3) (1:10) Total (1) (2) (3) (4) (5) (6)
(7) C10:1 0% 1% 0% 0% 0% 0% 0% C10 0% 10% 5% 9% 10% 9% 10% C12 0%
56% 27% 50% 53% 53% 54% C18:3 4% 0% 1% 0% 0% 0% 0% C14 1% 18% 9%
18% 17% 18% 18% C18:2 25% 1% 11% 1% 1% 1% 1% C16 11% 8% 9% 8% 8% 8%
8% C18:1 59% 4% 33% 11% 8% 8% 6% C18:0 0% 2% 4% 3% 3% 3% 2%
C.p., Chlorella protothecoides; C. Oil, Coconut Oil
[0442] The ratios of C18:1 to C12 and to C14 were calculated and
fitted into the theoretical graph (see above and FIG. 2). The
extraction efficiency of the coconut oil was determined by dividing
the calculated percent of algal oil (from theoretical curve) by the
expected percent (oil content in starting material). The extraction
efficiency ranged from 44% in the 1:10 (algal oil to coconut oil)
mixture (see experiment (7) above) to 16% in the 3:1 mixture (see
experiment (4) above) as determined from the C18:1 to C12 data
(Table 17). Thus, the higher the percent of coconut oil in the
extraction procedure, the higher the yield of extracting lipids
from Chorella.
TABLE-US-00018 TABLE 17 Extraction efficiency as a function of
coconut oil fraction. % Algal Oil in Measured % Extraction
Extraction C18:1 to C12 % Measured (C18:1/C12) 9 (7) 0.12 4.0 44%
25 (6) 0.14 6.0 24% 50 (5) 0.16 7.0 14% 75 (4) 0.22 12.0 16%
[0443] The range of the extraction efficiency was 33% (see
experiment (7) above) to 14% (see experiment (4) above) as
determined from the C18:1 to C14 data (Table 18). Thus, the higher
the percent of coconut oil in the extraction procedure, the higher
the yield of extracting lipids from Chorella.
TABLE-US-00019 TABLE 18 Extraction efficiency as a function of
coconut oil fraction. % Algal Oil in Measured % Extraction
Extraction C18:1 to C14 % Measured (C18:1/C14) 9 (7) 0.35 3.0 33%
25 (6) 0.43 5.3 21% 50 (5) 0.47 6.3 13% 75 (4) 0.62 10.3 14%
[0444] The above experiments demonstrated that an organic solvent
(in this case coconut oil) efficiently extracted lipids from an
algal cell mass to yield a lipid:organic solvent composition.
[0445] An additional set of experiments were performed to look at
the efficiency of extracting lipids from a disrupted cell
suspension of Chlorella protothecoides (sonication) using four
emulsion breaking surfactants. The surfactants that were used in
this study were: oleamide DEA (NINOL 201), laurelamide DEA (NINOL
55LL), laurelamide DEA (NINOL 96L) and cocoamide DEA (NINOL 4000).
Each surfactant was added in the concentrations of 0.2%, 0.5% and
1.0% to the cell lysate suspensions and were placed in a oven at
55.degree. C. for 15 hours. Each tube was then centrifuged at 4200
rpm for 20 minutes. In each sample, four phases could be seen: a
solid phase, an aqueous phase, and emulsion layer and an oil layer
on the top. Negative control samples with no added surfactant
produced no visible oil phase, but produced only the solid, aqueous
and emulsion layers. The oil layers from each of the surfactant
treated samples were carefully pipetted off and were weighed to
determine overall oil yields. The results are summarized below in
Table 19. These results show that an organic solvent, such as a
surfactant, efficiently extracted lipids from lipid-containing
algae biomass to yield a lipid:organic solvent composition.
TABLE-US-00020 TABLE 19 Use of surfactants to extract lipids from
algae biomass. Surfactant Name NINOL NINOL NINOL NINOL NINOL NINOL
NINOL 201 201 201 55LL 55LL 55LL 40C0 Surfactant Oleamide Oleamide
Oleamide Laurelamid Laurelamid Laurelamid Cocoamide DEA DEA DEA DEA
DEA DEA DEA Percent v/v 1.0% 0.5% 0.2% 1.0% 0.5% 0.2% 1.0% Oil in
Ferm g/L 62 62 62 62 62 62 62 (g) Oil in 5 mL 0.31 0.31 0.31 0.31
0.31 0.31 0.31 sample (theoretical) Temperature (C.) 55 55 55 55 55
55 55 Time (hrs) 15 15 15 15 15 15 15 TOTAL Oil in sample (g) 0.183
0.237 0.041 0.262 0.012 0.026 0.276 % of theoretical 59.07% 76.55%
13.11% 84.44% 4.03% 8.40% 89.01% Surfactant Name NINOL NINOL NINOL
NINOL NINOL 40C0 40C0 96SL 96SL 96SL Surfactant Cocoamide Cocoamide
Laurelamid Laurelamid Laurelamid DEA DEA DEA DEA DEA Percent v/v
0.5% 0.2% 1.0% 0.5% 0.2% Oil in Ferm g/L 62 62 62 62 62 (g) Oil in
5 mL 0.31 0.31 0.31 0.31 0.31 sample (theoretical) Temperature (C.)
55 55 55 55 55 Time (hrs) 15 15 15 15 15 TOTAL Oil in sample (g)
0.082 0.000 0.286 0.035 0.000 % of theoretical 26.45% 0.00% 92.30%
11.41% 0.00%
Example 7
Lysing of Chlorella Protothecoides
[0446] 1. Biomass Production
[0447] An F-Tank batch of Chlorella protothecoides (about 1,200
gallons) was used to generate biomass for extraction processes. The
batch (#ZA07126) was allowed to run for 100 hours, while
controlling the glucose levels at 16 g/L, after which time the corn
syrup feed was terminated. Residual glucose levels dropped to <0
g/L two hours later. This resulted in a final age of 102 hours. The
final broth volume was 1,120 gallons. Both in-process contamination
checks and a thorough analysis of a final broth sample failed to
show any signs of contamination.
[0448] 2. Heat and Chemical Treatment
[0449] Cells were resuspended in water to a biomass concentration
of 150 g/L and aliquoted into 27.times.5 mL tubes. Each tube was
conditioned per the matrix below in Table 20.
TABLE-US-00021 TABLE 20 Chemical/heat treatment matrix. Tube
Condition [KOH] mN [H.sub.2SO.sub.4] mN Temp, 30 min 1 Control 0 0
25.degree. C. 2 40 mN KOH 40 0 25.degree. C. 3 80 mN KOH 80 0
25.degree. C. 4 120 mN KOH 120 0 25.degree. C. 5 160 mN KOH 160 0
25.degree. C. 6 40 mN H.sub.2SO.sub.4 0 40 25.degree. C. 7 80 mN
H.sub.2SO.sub.4 0 80 25.degree. C. 8 120 mN H.sub.2SO.sub.4 0 120
25.degree. C. 9 160 mN H.sub.2SO.sub.4 0 160 25.degree. C. 10
Control 0 0 65.degree. C. 11 40 mN KOH 40 0 65.degree. C. 12 80 mN
KOH 80 0 65.degree. C. 13 120 mN KOH 120 0 65.degree. C. 14 160 mN
KOH 160 0 65.degree. C. 15 40 mN H.sub.2SO.sub.4 0 40 65.degree. C.
16 80 mN H.sub.2SO.sub.4 0 80 65.degree. C. 17 120 mN
H.sub.2SO.sub.4 0 120 65.degree. C. 18 160 mN H.sub.2SO.sub.4 0 160
65.degree. C. 19 Control 0 0 130.degree. C. 20 40 mN KOH 40 0
130.degree. C. 21 80 mN KOH 80 0 130.degree. C. 22 120 mN KOH 120 0
130.degree. C. 23 160 mN KOH 160 0 130.degree. C. 24 40 mN
H.sub.2SO.sub.4 0 40 130.degree. C. 25 80 mN H.sub.2SO.sub.4 0 80
130.degree. C. 26 120 mN H.sub.2SO.sub.4 0 120 130.degree. C. 27
160 mN H.sub.2SO.sub.4 0 160 130.degree. C.
[0450] After treatment, a 1.5 ml sample was centrifuged at 14 K rpm
for 15 min, and the size of each of the resulting layers was
measured.
[0451] 3. Emulsion Water Washing
[0452] A fresh set of samples were generated under conditions for
samples 21-27 using a total of 10 mL cell suspension, and aliquoted
into 3.times.3 mL samples. The resulting emulsions were isolated in
new 15 mL tubes, and subjected to the following water wash scheme
according to Table 21.
TABLE-US-00022 TABLE 21 Emulsion water washing matrix. Wash 1 Wash
2 Ratio of water wash Ratio of water wash Sample volume:emulsion
volume:emulsion 21 1 to 1 1 to 1 22 1 to 1 1 to 1 23 1 to 1 1 to 1
24 1 to 1 1 to 1 25 1 to 1 1 to 1 26 1 to 1 1 to 1 27 1 to 1 1 to 1
21 5 to 1 5 to 1 22 5 to 1 5 to 1 23 5 to 1 5 to 1 24 5 to 1 5 to 1
25 5 to 1 5 to 1 26 5 to 1 5 to 1 27 5 to 1 5 to 1 21 10 to 1 10 to
1 22 10 to 1 10 to 1 23 10 to 1 10 to 1 24 10 to 1 10 to 1 25 10 to
1 10 to 1 26 10 to 1 10 to 1 27 10 to 1 10 to 1
[0453] The water was added to the emulsion, vortexed, and
centrifuged at 4,400 rpm for 10 minutes. Following the 1st wash,
the aqueous phase was removed, and a 2nd water wash performed at
the same ratio, vortexed, and centrifuged at 4,400 rpm for 10
minutes. Following treatment, the emulsions were observed for the
appearance of a visible oil layer.
[0454] 4. Sonication
[0455] A sampling of conditions (samples #1, 9, 10, 14, 18, 19, 23,
27) from the chemical/heat treatment matrix were sonicated using a
Misonix 3000 sonicator equipped with a micro-tip on level 7. The
suspension was sonicated for 3 minutes on a 30 sec on/20 sec off
cycle. After treatment, a 1.5 ml sample was centrifuged at 14 K rpm
for 15 min and the size of each of the resulting layers was
measured.
[0456] 5. Emulsion Freezing
[0457] Samples which generated emulsions were subjected to freezing
at -20.degree. C. for >24 hours. Following freezing, the samples
were thawed at room temperature, vortexed, and centrifuged at 4,400
rpm for 10 minutes. The samples studied are listed in Table 22.
TABLE-US-00023 TABLE 22 Emulsions used in freezing cycle. Sample
Sonicated 160 mN HCl, 130.degree. C. for 30 min Yes, 30 min cycle
120 mN HCl, 130.degree. C. for 30 min No 160 mN KOH 130.degree. C.
for 30 min Yes, 30 min cycle No chemical, 130.degree. C. for 30 min
Yes, 30 min cycle No chemical, no heat Yes, 30 min cycle
[0458] Following treatment, the emulsions were observed for the
appearance of a visible oil layer.
[0459] 6. Enzyme Treatment Experiments #1
[0460] Several enzymes were evaluated as an alternative method of
cell breakage. These enzymes, all obtained from Sigma Aldrich, were
Hemicellulase (P/N H2125), Pectinase (P/N P2401), Cellulase
(C9422), and Driselase (D9515). 5 mL of cell material was prepared
to various biomass concentrations, and exchanged into buffer. The
enzyme concentrations were then prepared as described in Table
23.
TABLE-US-00024 TABLE 23 Enzyme treatment matrix. Enzyme conc.
Incubation Incubation [BM] Enzyme (%) temp, .degree. C. time, hrs
Incubation buffer g/L Hemicellulase 1% 25.degree. C. 12 100 mM
Acetate, pH 4.6 150 Pectinase 1% 25.degree. C. 12 100 mM Acetate,
pH 4.6 150 Cellulase 1% 25.degree. C. 12 100 mM Acetate, pH 4.6 150
Driselase 1% 25.degree. C. 12 100 mM Acetate, pH 4.6 150 Cocktail
of all 4 enzymes 1% of each 25.degree. C. 12 100 mM Acetate, pH 4.6
150 Hemicellulase 1% 37.degree. C. 1 100 mM Acetate, pH 4.6 150
Pectinase 1% 37.degree. C. 1 100 mM Acetate, pH 4.6 150 Cellulase
1% 37.degree. C. 1 100 mM Acetate, pH 4.6 150 Driselase 1%
37.degree. C. 1 100 mM Acetate, pH 4.6 150 Cocktail of all 4
enzymes 1% of each 37.degree. C. 1 100 mM Acetate, pH 4.6 150
Hemicellulase/Driselase 4%/2% 37.degree. C. 12 50 mM Citrate, pH
4.5 150 Hemicellulase/Driselase 4%/2% 50.degree. C. 12 50 mM
Citrate, pH 4.5 150 Hemicellulase/Driselase 4%/2% 37.degree. C. 12
50 mM Citrate, pH 4.5 100 Hemicellulase/Driselase 4%/2% 50.degree.
C. 12 50 mM Citrate, pH 4.5 100 Hemicellulase/Driselase 4%/2%
37.degree. C. 12 50 mM Citrate, pH 4.5 50 Hemicellulase/Driselase
4%/2% 50.degree. C. 12 50 mM Citrate, pH 4.5 50
Hemicellulase/Driselase 4%/2% 37.degree. C. 12 50 mM Citrate, pH
4.5 25 Hemicellulase/Driselase 4%/2% 50.degree. C. 12 50 mM
Citrate, pH 4.5 25
[0461] 7. Enzyme Treatment Experiments #2
[0462] Additional enzymes were evaluated alone, and in combination
with one another, and compared against disruption of cells by
storing and aging the cells with or without enzyme treatment. A
polysaccharide-degrading enzyme mannose and a protease were
evaluated for their ability to disrupt cells of Chlorella
protothecoides. Also, the effect of storing and aging a sample of
cultured cells on the weakening of the cell structure to facilitate
oil extraction was evaluated.
[0463] Three experiments were conducted. Chlorella protothecoides
cells were generated via heterotrophic growth using glucose as the
sole carbon source. In experiments in which dried cells were used,
fermentation broth was centrifuged and the cell paste was subjected
to drum drying. In experiments in which cells were stored for 7
days, storage was at 4.degree. C. A polysaccharide-degrading enzyme
(Mannaway 4.0L) and protease (Alcalase 2.4 FG) (both from
Novozymes) were used in the experiments, as indicated. Enzymes were
added at a concentration of 0.2% weight/volume.
[0464] In the first experiment, dried cells were reconstituted in
deionized water to a dry cell weight of 155 grams/liter in flasks,
and maintained at pH 7.5. Flasks were placed in an incubating
shaker for 22 hours at 50.degree. C. Enzymatic cell lysis for
sample 1 in Experiment 1 was very effective when combining enzymes,
as evidenced by 90.4% of total oil being found in the emulsion and
not in the pellet. Neither enzyme individually was as effective as
the combination of both, nor was the control without enzyme
treatment. The results are shown in Table 27 below.
[0465] In the second experiment, fresh fermentation broth was
separated into two aliquots for fresh and 7 day broth experiments.
The fresh cells were concentrated by centrifugation and
reconstituted in deionized water to 170 g/1 in flasks. Resuspended
cell samples were then subdivided into two sets of 4 flasks, half
of which were stored for 7 days at 4.degree. C. before further
treatment. For experimental treatment, 3 flasks contained
combinations of a protease and a polysaccharide-degrading mannase
while the 4.sup.th contained no enzymes (see Table 27 for
experimental conditions). Flasks were placed in an incubating
shaker for 22 hours at 50.degree. C. This second experiment
indicated extensive cell lysis with dual enzyme treatment at day 0
and day 7, as well as lysis in the absence of enzymes after 7 days.
The results are shown in Table 28 below.
[0466] In the third experiment, fermentation broth was collected
from fresh fermentations, concentrated by centrifugation and
re-suspended in deionized water at two different concentrations of
71 and 115 g/1 and agitated at 150 rpm in Applikon fermentors for
22 hours at 50.degree. C. pH was maintained at 7.5 by feedback
acid/base control. The results of this third experiment indicated
that cell disruption and/or emulsion formation is facilitated by
addition of enzymes and aging of the cells. The results are shown
in Table 29 below.
[0467] 8. Oil Analysis and Characterization
[0468] TLC was performed on aluminum backed silica TLC plates
(Sigma#60805). The developing solvent (mobile phase) was
hexane/diethyleter/acetic acid (80:20:1, by vol). Spots were
visualized by spraying with 10% sulfuric acid and charring on a
hotplate. Recovered oil samples from control, acidic, and basic
conditions were analyzed to determine if any significant product
degradation and/or modification occurred due to the processing
conditions.
[0469] 9. Results
[0470] (a) Heat and Chemical Treatment
[0471] The results from the chemical/heat treatment matrix are
reported in FIG. 3 and Table 24 below.
TABLE-US-00025 TABLE 24 Measurement of layers from chemical/heat
treatment matrix. [KOH] [H.sub.2SO.sub.4] Temp, Pellet, Aqueous,
Emulsion, Tube Condition mN mN 30 min mm mm mm 1 Control 0 0
25.degree. C. 15 15 0 2 40 mN KOH 40 0 25.degree. C. 15 15 0 3 80
mN KOH 80 0 25.degree. C. 15 15 0 4 120 mN KOH 120 0 25.degree. C.
15 15 0 5 160 mN KOH 160 0 25.degree. C. 15 15 0 6 40 mN
H.sub.2SO.sub.4 0 40 25.degree. C. 15 15 0 7 80 mN H.sub.2SO.sub.4
0 80 25.degree. C. 15 15 0 8 120 mN 0 120 25.degree. C. 15 15 0
H.sub.2SO.sub.4 9 160 mN 0 160 25.degree. C. 15 15 0
H.sub.2SO.sub.4 10 Control 0 0 65.degree. C. 10 19 1 11 40 mN KOH
40 0 65.degree. C. 10 19 1 12 80 mN KOH 80 0 65.degree. C. 10 19 1
13 120 mN KOH 120 0 65.degree. C. 9 19 2 14 160 mN KOH 160 0
65.degree. C. 8 19 3 15 40 mN H.sub.2SO.sub.4 0 40 65.degree. C. 10
19 1 16 80 mN H.sub.2SO.sub.4 0 80 65.degree. C. 10 19 1 17 120 mN
0 120 65.degree. C. 10 19 1 H.sub.2SO.sub.4 18 160 mN 0 160
65.degree. C. 10 19 1 H.sub.2SO.sub.4 19 Control 0 0 65.degree. C.
5 15 10 20 40 mN KOH 40 0 130.degree. C. 10 18 2 21 80 mN KOH 80 0
130.degree. C. 5 15 10 22 120 mN KOH 120 0 130.degree. C. 5 15 10
23 160 mN KOH 160 0 130.degree. C. 5 15 10 24 40 mN H.sub.2SO.sub.4
0 40 130.degree. C. 2 23 5 25 80 mN H.sub.2SO.sub.4 0 80
130.degree. C. 1 19 10 26 120 mN 0 120 130.degree. C. 1 19 10
H.sub.2SO.sub.4 27 160 mN 0 160 130.degree. C. 1 19 10
H.sub.2SO.sub.4
[0472] At 25.degree. C., no difference was observed between the
chemically treated samples and the control, and no emulsion
formed.
[0473] At 65.degree. C., an emulsion began to appear for the KOH
treated samples, increasing in size with higher concentrations of
caustic. The aqueous phase also became more turbid with increasing
concentrations of KOH. There appeared to be a proportional decrease
in the size of the pellet as the emulsion size increased. For the
acidic treated samples at 65.degree. C., a smaller emulsion formed
relative to the caustic treated samples, and no increase in the
size of the emulsion was observed with increasing level of acid,
and the aqueous phase was clear and uncolored.
[0474] Samples heated to 130.degree. C. all showed significantly
larger emulsions compared to 65.degree. C., and comprised roughly
1/3 of the total sample volume. The aqueous phase of the caustic
treated samples showed increasing dark color with increasing
concentration of KOH.
[0475] In the acidic treated samples, the aqueous phase remained
clear for all samples. In contrast to the base treated materials,
the pellet virtually disappeared for the acid treated preparations,
indicating that the cells and cell debris had partitioned to the
emulsion and aqueous phase. In none of the 27 conditions tested was
a visible oil layer observed.
[0476] (b) Emulsion Water Washing
[0477] The emulsion of the caustic treated samples was poorly
defined and difficult to separate from the aqueous phase to prepare
the emulsion for water washing. In contrast, the acidic emulsion
was firm and partitioned easily from the aqueous phase. Under all
washing conditions for the KOH treated samples, the emulsion became
thinner and thinner until it was nearly gone. No visible oil layer
was observed during either wash.
[0478] The acidic emulsions were easier to manipulate and separate
from the aqueous phase. The emulsion size remained essentially
unchanged during both washes. However, no visible oil layer was
observed during either wash.
[0479] (c) Sonication
[0480] The results of the sonication are recorded in Table 25
below.
TABLE-US-00026 TABLE 25 Impact of sonication compared to
corresponding pre-sonicated samples. [KOH] [H.sub.2SO.sub.4] Temp,
Pellet, Emulsion, Tube mN mN 30 min mm mm 1 0 0 25.degree. C. -5 +1
9 0 160 25.degree. C. -5 +1 10 0 0 65.degree. C. -5 +1 14 160 0
65.degree. C. -3 +2 18 0 160 65.degree. C. -5 +1 19 0 0 130.degree.
C. -2 -7 23 160 0 130.degree. C. -3 -7 27 0 160 130.degree. C. +1
-7
[0481] The 25.degree. C. and 65.degree. C. sample emulsions
increased in size while the pellet decreased relative to their
pre-sonicated counterparts. For the 130.degree. C. samples, the
emulsion decreased in size substantially, and the pellet of the
control and base treated samples decreased, while the pellet
increased for the acid treated preparation. There was some oil
layer formation for the sonicated samples, particularly at the
elevated temperatures.
[0482] (d) Temperature Reduction of Emulsion
[0483] The results of the emulsion freezing are recorded in Table
26 below.
TABLE-US-00027 TABLE 26 Results of emulsion freezing. Sample
Sonicated Visible oil layer 160 mN HCl, 130.degree. C. for 30 min
Yes, 30 min cycle Yes 120 mN HCl, 130.degree. C. for 30 min No No
160 mN KOH 130.degree. C. for 30 min Yes, 30 min cycle Yes No
chemical, 130.degree. C. for 30 min Yes, 30 min cycle Yes No
chemical, no heat Yes, 30 min cycle Yes
[0484] Reducing the temperature of the emulsion to -20.degree. C.
proved to be an effective emulsion breaker. In all samples where
the emulsion was sonicated, a large oil layer was observed. A
representative result is shown in FIG. 4. When compared to the
lipid content of the cell material by HPLC, the oil layer
constituted the majority of the oil from the emulsion.
[0485] (e) Enzymatic Treatment #1
[0486] Samples incubated at 25.degree. C. and 37.degree. C. at 1%
enzyme levels showed minimal emulsion formation. Considerably
larger emulsions formed at the higher enzyme concentrations of
4%/2% Hemicellulase/Driselase combination, with the 50.degree. C.
producing a larger emulsion compared to the 37.degree. C. sample.
No oil layer was observed with enzyme treatment alone.
Enzyme-generated emulsions subjected to sonication and then
-20.degree. C., generated an oil layer.
[0487] (f) Enzymatic Treatment #2
[0488] Enzyme treatment combining a polysaccharide-degrading
mannase and a protease was found effective to disrupt cells from
Chlorella protothecoides. Another technique found effective in
weakening cell structure enough to facilitate oil extraction was
storing/aging the cells. Tables 27, 28 and 29 show the results of
the three experiments described above, and FIG. 6 illustrates the
resulting layers from enzyme-treated (left tube) vs. untreated
(right tube) biomass. In the untreated tube, the cell pellet is
considerably larger in size because it comprises a large lipid
component. In neither case was lipid found in the aqueous
phase.
TABLE-US-00028 TABLE 27 Enzymatic treatment #2, experiment 1
results. Sample Number 1 2 3 4 ALCALASE 2.4 FG + + - - MANNAWAY 4.0
L + - + - % of oil in cell pellet 9.6% 30.7% 50.3% 97.8% % of oil
in emulsion 90.4% 69.3% 49.7% 2.2%
TABLE-US-00029 TABLE 28 Enzymatic treatment #2, experiment 2
results. Sample Number AGE 1 2 3 4 ALCALASE 2.4 FG + + - - MANNAWAY
4.0 L + - + - DCW G/L 170.0 170.0 170.0 170.0 DAYS W/W % W/W % W/W
% W/W % % of oil in cell pellet 0 28.8% 48.2% 67.8% 100.0% % of oil
in emulsion 0 71.2% 51.8% 32.2% 0% % of oil in cell pellet 7 47.8%
81.3% 80.7% 81.8% % of oil in emulsion 7 52.2% 18.7% 19.3%
18.2%
TABLE-US-00030 TABLE 29 Enzymatic treatment #2, experiment 3
results. Sample Number 1 2 3 4 5 ALCALASE 2.4 FG - - + - - MANNAWAY
4.0 L - - + - - DCW G/L 71.7 115.1 115.1 71.7 115.1 TEMPERATURE 50
50 50 50 50 PH 7.5 7.5 7.5 7.5 7.5 W/W % W/W % W/W % W/W % W/W % %
of oil in cell pellet 81.8% 63.0% 12.0% 49.1% 42.0% % of oil in
emulsion 18.2% 37.0% 88.0% 50.9% 58.0% age 0 0 0 7 7
[0489] (g) Oil Analysis and Characterization
[0490] An oil sample was isolated from each of the chemically
treated conditions and analyzed via TLC to determine if product
degradation was occurring at the extreme pHs compared the control
condition. TLC analysis is shown in FIG. 5. The pattern showed a
minor generation of free fatty acids (FFA's) under acidic
conditions compared to the base treated and control sample.
Example 8
Methods for Culturing Prototheca
[0491] Prototheca strains were cultivated to achieve a high
percentage of oil by dry cell weight. Cryopreserved cells were
thawed at room temperature and 500 ul of cells were added to 4.5 ml
of medium (4.2 g/L K.sub.2HPO.sub.4, 3.1 g/L NaH.sub.2PO.sub.4,
0.24 g/L MgSO.sub.4.7H.sub.2O, 0.25 g/L Citric Acid monohydrate,
0.025 g/L CaCl.sub.2 2H.sub.2O, 2 g/L yeast extract) plus 2%
glucose and grown for 7 days at 28.degree. C. with agitation (200
rpm) in a 6-well plate. Dry cell weights were determined by
centrifuging 1 ml of culture at 14,000 rpm for 5 min in a
pre-weighed Eppendorf tube. The culture supernatant was discarded
and the resulting cell pellet washed with 1 ml of deionized water.
The culture was again centrifuged, the supernatant discarded, and
the cell pellets placed at -80.degree. C. until frozen. Samples
were then lyophilized for 24 hrs and dry cell weights calculated.
For determination of total lipid in cultures, 3 ml of culture was
removed and subjected to analysis using an Ankom system (Ankom
Inc., Macedon, N.Y.) according to the manufacturer's protocol.
Samples were subjected to solvent extraction with an Amkom XT10
extractor according to the manufacturer's protocol. Total lipid was
determined as the difference in mass between acid hydrolyzed dried
samples and solvent extracted, dried samples. Percent oil dry cell
weight measurements are shown in Table 30.
TABLE-US-00031 TABLE 30 Percent oil by dry cell weight Species
Strain % Oil Prototheca stagnora UTEX 327 13.14 Prototheca
moriformis UTEX 1441 18.02 Prototheca moriformis UTEX 1435
27.17
[0492] Microalgae samples from the strains listed in Table 30,
above, were genotyped. Genomic DNA was isolated from algal biomass
as follows. Cells (approximately 200 mg) were centrifuged from
liquid cultures 5 minutes at 14,000.times.g. Cells were then
resuspended in sterile distilled water, centrifuged 5 minutes at
14,000.times.g and the supernatant discarded. A single glass bead
.about.2 mm in diameter was added to the biomass and tubes were
placed at -80.degree. C. for at least 15 minutes. Samples were
removed and 150 .mu.l of grinding buffer (1% Sarkosyl, 0.25 M
Sucrose, 50 mM NaCl, 20 mM EDTA, 100 mM Tris-HCl, pH 8.0, RNase A
0.5 ug/ul) was added. Pellets were resuspended by vortexing
briefly, followed by the addition of 40 ul of 5M NaCl. Samples were
vortexed briefly, followed by the addition of 66 .mu.l of 5% CTAB
(Cetyl trimethylammonium bromide) and a final brief vortex. Samples
were next incubated at 65.degree. C. for 10 minutes after which
they were centrifuged at 14,000.times.g for 10 minutes. The
supernatant was transferred to a fresh tube and extracted once with
300 .mu.l of Phenol: Chloroform:Isoamyl alcohol 12:12:1, followed
by centrifugation for 5 minutes at 14,000.times.g. The resulting
aqueous phase was transferred to a fresh tube containing 0.7 vol of
isopropanol (.about.190 .mu.l), mixed by inversion and incubated at
room temperature for 30 minutes or overnight at 4.degree. C. DNA
was recovered via centrifugation at 14,000.times.g for 10 minutes.
The resulting pellet was then washed twice with 70% ethanol,
followed by a final wash with 100% ethanol. Pellets were air dried
for 20-30 minutes at room temperature followed by resuspension in
50 .mu.l of 10 mM TrisCl, 1 mM EDTA (pH 8.0).
[0493] Five .mu.l of total algal DNA, prepared as described above,
was diluted 1:50 in 10 mM Tris, pH 8.0. PCR reactions, final volume
20 .mu.l, were set up as follows. Ten .mu.l of 2.times. iProof HF
master mix (BIO-RAD) was added to 0.4 .mu.l primer SZ02613
(5'-TGTTGAAGAATGAGCCGGCGAC-3' (SEQ ID NO:5) at 10 mM stock
concentration). This primer sequence runs from position 567-588 in
Gen Bank accession no. L43357 and is highly conserved in higher
plants and algal plastid genomes. This was followed by the addition
of 0.4 .mu.l primer SZ02615 (5'-CAGTGAGCTATTACGCACTC-3' (SEQ ID
NO:6) at 10 mM stock concentration). This primer sequence is
complementary to position 1112-1093 in Gen Bank accession no.
L43357 and is highly conserved in higher plants and algal plastid
genomes. Next, 5 .mu.l of diluted total DNA and 3.2 .mu.l dH.sub.2O
were added. PCR reactions were run as follows: 98.degree. C., 45'';
98.degree. C., 8''; 53.degree. C., 12''; 72.degree. C., 20'' for 35
cycles followed by 72.degree. C. for 1 min and holding at
25.degree. C. For purification of PCR products, 20 .mu.l of 10 mM
Tris, pH 8.0, was added to each reaction, followed by extraction
with 40 .mu.l of Phenol:Chloroform:isoamyl alcohol 12:12:1,
vortexing and centrifuging at 14,000.times.g for 5 minutes. PCR
reactions were applied to S-400 columns (GE Healthcare) and
centrifuged for 2 minutes at 3,000.times.g. Purified PCR products
were subsequently TOPO cloned into PCR8/GW/TOPO and positive clones
selected for on LB/Spec plates. Purified plasmid DNA was sequenced
in both directions using M13 forward and reverse primers. In total,
twelve Prototheca strains were selected to have their 23S rRNA DNA
sequenced and the sequences are listed in the Sequence Listing. A
summary of the strains and Sequence Listing Numbers is included
below in Table 31. The sequences were analyzed for overall
divergence from the UTEX 1435 (SEQ ID NO: 17) sequence. Two pairs
emerged (UTEX 329/UTEX 1533 and UTEX 329/UTEX 1440) as the most
divergent. In both cases, pairwise alignment resulted in 75.0%
pairwise sequence identity. The percent sequence identity to UTEX
1435 is also included below in Table 31.
TABLE-US-00032 TABLE 31 Genotyped Prototheca strains. % nt Species
Strain identity SEQ ID NO. Prototheca kruegani UTEX 329 75.2 SEQ ID
NO: 34 Prototheca wickerhamii UTEX 1440 99 SEQ ID NO: 35 Prototheca
stagnora UTEX 1442 75.7 SEQ ID NO: 16 Prototheca moriformis UTEX
288 75.4 SEQ ID NO: 36 Prototheca moriformis UTEX 1439; 100 SEQ ID
NO: 17 1441; 1435; 1437 Prototheca wikerhamii UTEX 1533 99.8 SEQ ID
NO: 37 Prototheca moriformis UTEX 1434 75.9 SEQ ID NO: 38
Prototheca zopfii UTEX 1438 75.7 SEQ ID NO: 39 Prototheca
moriformis UTEX 1436 88.9 SEQ ID NO: 32
[0494] Lipid samples from a subset of the above-listed strains were
analyzed for lipid profile using HPLC. Results are shown below in
Table 32.
TABLE-US-00033 TABLE 32 Diversity of lipid chains in Prototheca
species. Strain C14:0 C16:0 C16:1 C18:0 C18:1 C18:2 C18:3 C20:0
C20:1 UTEX 0 12.01 0 0 50.33 17.14 0 0 0 327 UTEX 1.41 29.44 0.70
3.05 57.72 12.37 0.97 0.33 0 1441 UTEX 1.09 25.77 0 2.75 54.01
11.90 2.44 0 0 1435
[0495] Algal plastid transit peptides were identified through the
analysis of UTEX 1435 (Prototheca moriformis) or UTEX 250
(Chlorella protothecoides) cDNA libraries. cDNAs encoding
potentially plastid targeted proteins based upon BLAST hit homology
to other known plastid targeted proteins were subjected to further
analysis by the software programs PSORT, ChloroP and TargetP.
Candidate plastid transit peptides identified through at least one
of these three programs were then PCR amplified from the
appropriate genomic DNA. Below, in Table 33, is a summary of the
algal plastid targeting amino acid sequences (PTS) that were
identified from this screen. Also included are the amino acid
sequences of plant fatty acyl-ACP thioesterases that are used in
the heterologous expression Examples below.
TABLE-US-00034 TABLE 33 Summary of algal plastic targeting amino
acid sequences. cDNA SEQ ID NO. P. moriformis isopentenyl
diphosphate synthase PTS SEQ ID NO: 40 P. moriformis delta 12 fatty
acid desaturase PTS SEQ ID NO: 41 P. moriformis stearoyl ACP
desaturase PTS SEQ ID NO: 42 C. protothecoides stearoyl ACP
desaturase PTS SEQ ID NO: 43 Cuphea hookeriana fatty acyl-ACP
thioesterase SEQ ID NO: 44 (C8-10) Umbellularia californica fatty
acyl-ACP thioesterase SEQ ID NO: 45 (C12) Cinnamomum camphora fatty
acyl-ACP thioesterase SEQ ID NO: 46 (C14)
Example 9
Methods for Transforming Prototheca
[0496] 1. General Method for Biolistic Transformation of
Prototheca
[0497] S550d gold carriers from Seashell Technology were prepared
according to the protocol from manufacturer. Linearized plasmid (20
.mu.g) was mixed with 50 .mu.l of binding buffer and 60 .mu.l (30
mg) of S550d gold carriers and incubated in ice for 1 min
Precipitation buffer (100 .mu.l) was added, and the mixture was
incubated in ice for another 1 min. After vortexing, DNA-coated
particles were pelleted by spinning at 10,000 rpm in an Eppendorf
5415C microfuge for 10 seconds. The gold pellet was washed once
with 500 .mu.l of cold 100% ethanol, pelleted by brief spinning in
the microfuge, and resuspended with 50 .mu.l of ice-cold ethanol.
After a brief (1-2 sec) sonication, 10 .mu.l of DNA-coated
particles were immediately transferred to the carrier membrane.
[0498] Prototheca strains were grown in proteose medium (2 g/L
yeast extract, 2.94 mM NaNO3, 0.17 mM CaCl2.2H2O, 0.3 mM
MgSO4.7H2O, 0.4 mM K2HPO4, 1.28 mM KH2PO4, 0.43 mM NaCl) on a
gyratory shaker until it reaches a cell density of 2.times.10.sup.6
cells/ml. The cells were harvested, washed once with sterile
distilled water, and resuspended in 50 .mu.l of medium.
1.times.10.sup.7 cells were spread in the center third of a
non-selective proteose media plate. The cells were bombarded with
the PDS-1000/He Biolistic Particle Delivery system (Bio-Rad).
Rupture disks (1100 and 1350 psi) were used, and the plates are
placed 9 and 12 cm below the screen/macrocarrier assembly. The
cells were allowed to recover at 25.degree. C. for 12-24 h. Upon
recovery, the cells were scraped from the plates with a rubber
spatula, mixed with 100 .mu.l of medium and spread on plates
containing the appropriate antibiotic selection. After 7-10 days of
incubation at 25.degree. C., colonies representing transformed
cells were visible on the plates from 1100 and 1350 psi rupture
discs and from 9 and 12 cm distances. Colonies were picked and
spotted on selective agar plates for a second round of
selection.
[0499] 2. Transformation of Prototheca with G418 Resistance
Gene
[0500] Prototheca moriformis and other Prototheca strains sensitive
to G418 can be transformed using the methods described below. G418
is an aminoglycoside antibiotic that inhibits the function of 80S
ribosomes and thereby inhibits protein synthesis. The corresponding
resistance gene functions through phosphorylation, resulting in
inactivation of G418. Prototheca strains UTEX 1435, UTEX 1439 and
UTEX 1437 were selected for transformation. All three Prototheca
strains were genotyped using the methods described above. All three
Prototheca strains had identical 23s rRNA genomic sequences (SEQ ID
NO:17).
[0501] All transformation cassettes were cloned as EcoRI-SacI
fragments into pUC19. Standard molecular biology techniques were
used in the construction of all vectors according to Sambrook and
Russell, 2001. The C. reinhardtii beta-tubulin promoter/5'UTR was
obtained from plasmid pHyg3 (Berthold et al., (2002) Protist: 153
(4), pp 401-412) by PCR as an EcoRI-AscI fragment. The Chlorella
vulgaris nitrate reductase 3'UTR was obtained from genomic DNA
isolated from UTEX strain 1803 via PCR using the following primer
pairs:
TABLE-US-00035 Forward: (SEQ ID NO: 47) 5'
TGACCTAGGTGATTAATTAACTCGAGGCAGCAGCAGCTCGGATAGTA TCG 3' Reverse:
(SEQ ID NO: 48) 5' CTACGAGCTCAAGCTTTCCATTTGTGTTC CCATCCCACTACT TCC
3'
[0502] The Chlorella sorokiniana glutamate dehydrogenase
promoter/UTR was obtained via PCR of genomic DNA isolated from UTEX
strain 1230 via PCR using the following primer pairs:
TABLE-US-00036 Forward: (SEQ ID NO: 94) 5'
GATCAGAATTCCGCCTGCAACGCAAGG GCAGC 3' Reverse: (SEQ ID NO: 95) 5'
GCATACTAGTGGCGGGACGGAGAGA GGGCG 3'
[0503] Codon optimization was based on the codons for Prototheca
moriformis. The sequence of the non-codon optimized neomycin
phosphotransferase (nptII) cassette was synthesized as an AscI-XhoI
fragment and was based on upon the sequence of Genbank Accession
No. YP.sub.--788126. The codon optimized nptII cassette was also
based on this Genbank Accession number.
[0504] The three Prototheca strains were transformed using
biolistic methods described above. Briefly, the Prototheca strains
were grown heterophically in liquid medium containing 2% glucose
until they reached the desired cell density (1.times.10.sup.7
cells/mL to 5.times.10.sup.7 cells/mL). The cells were harvested,
washed once with sterile distilled water and resuspended at
1.times.10.sup.8 cells/mL. 0.5 mL of cells were then spread out on
a non-selective solid media plate and allowed to dry in a sterile
hood. The cells were bombarded with the PDS-1000/He Biolistic
Particle Delivery System (BioRad). The cells were allowed to
recover at 25.degree. C. for 24 hours. Upon recovery, the cells
were removed by washing plates with 1 mL of sterile media and
transferring to fresh plates containing 100 .mu.g/mL G418. Cells
were allowed to dry in a sterile hood and colonies were allowed to
form on the plate at room temperature for up to three weeks.
Colonies of UTEX 1435, UTEX 1439 and UTEX 1437 were picked and
spotted on selective agar plates for a second round of
selection.
[0505] A subset of colonies that survived a second round of
selection described above, were cultured in small volume and
genomic DNA and RNA were extracted using standard molecular biology
methods. Southern blots were done on genomic DNA extracted from
untransformed (WT), the transformants and plasmid DNA. DNA from
each sample was run on 0.8% agarose gels after the following
treatments: undigested (U), digested with AvrII (A), digested with
NcoI (N), digested with SacI (S). DNA from these gels was blotted
on Nylon+ membranes (Amersham). These membranes were probed with a
fragment corresponding to the entire coding region of the nptII
gene (NeoR probe). FIG. 7 shows maps of the cassettes used in the
transformations. FIG. 8 shows the results of Southern blot analysis
on three transformants (all generated in UTEX strain 1435) (1, 2,
and 3) transformed with either the beta-tubulin::neo::nit (SEQ ID
NO: 49) (transformants 1 and 2) or glutamate dehydrogenase:neo:nit
(SEQ ID NO: 50) (transformant 3). The glutamate
dehydrogenase:neo:nit transforming plasmid was run as a control and
cut with both NcoI and SacI. AvrII does not cut in this plasmid.
Genomic DNA isolated from untransformed UTEX strain 1435 shows no
hybridization to the NeoR probe.
[0506] Additional transformants containing the codon-optimized
glutamate dehydrogenase:neo:nit (SEQ ID NO: 51) and codon-optimized
.beta.-tubulin::neo::nit (SEQ ID NO:52) constructs were picked and
analyzed by Southern blot analysis. As expected, only digests with
SacI show linearization of the transforming DNA. These
transformation events are consistent with integration events that
occur in the form of oligomers of the transforming plasmid. Only
upon digestion with restriction enzymes that cut within the
transforming plasmid DNA do these molecules collapse down the size
of the transforming plasmid.
[0507] Southern blot analysis was also performed on transformants
generated upon transformation of Prototheca strains UTEX 1437 and
UTEX 1439 with the glutamate dehydrogenase::neo::nit cassette. The
blot was probed with the NeoR probe and the results are similar to
the UTEX 1435 transformants. The results are indicative of
integration events characterized by oligomerization and integration
of the transforming plasmid. This type of integration event is
known to occur quite commonly in Dictyostelium discoideum (see, for
example, Kuspa, A. and Loomis, W. (1992) PNAS, 89:8803-8807 and
Morio et al., (1995) J. Plant Res. 108:111-114).
[0508] To further confirm expression of the transforming plasmid,
Northern blot analysis and RT-PCR analysis were performed on
selected transformants. RNA extraction was performed using Trizol
Reagent according to manufacturer's instructions. Northern blot
analysis were run according to methods published in Sambrook and
Russel, 2001. Total RNA (15 .mu.g) isolated from five UTEX 1435
transformants and untransformed UTEX 1435 (control lanes) was
separated on 1% agarose-formaldehyde gel and blotted on nylon
membrane. The blot was hybridized to the neo-non-optimized probe
specific for transgene sequences in transformants 1 and 3. The two
other transformants RNAs express the codon-optimized version of the
neo-transgene and, as expected, based on the sequence homology
between the optimized and non-optimized neo genes, showed
significantly lower hybridization signal.
[0509] RNA (1 .mu.g) was extracted from untransformed Prototheca
strain UTEX 1435 and two representative UTEX 1435 transformants and
reverse transcribed using an oligio dT primer or a gene specific
primer. Subsequently these cDNAs (in duplicate) were subjected to
qPCR analysis on ABI Veriti Thermocycler using SYBR-Green qPCR
chemistry using the following primers (nptII):
TABLE-US-00037 Forward: (SEQ ID NO: 53) 5' GCCGCGACTGGCTGCTGCTGG 3'
Reverse: (SEQ ID NO: 54) 5' AGGTCCTCGCCGTCGGGCATG 3'
[0510] Possible genomic DNA contamination was ruled out by a no
reverse transcriptase negative control sample. The results
indicated that the NeoR genes used to transform these strains is
actively transcribed in the transformants.
[0511] 3. Transformation of Prototheca with Secreted Heterologous
Sucrose Invertase
[0512] All of the following experiments were performed using liquid
medium/agar plates based on the basal medium described in Ueno et
al., (2002) J Bioscience and Bioengineering 94(2):160-65, with the
addition of trace minerals described in U.S. Pat. No. 5,900,370,
and 1.times.DAS Vitamin Cocktail (1000.times. solution): tricine: 9
g, thiamine HCL: 0.67 g, biotin: 0.01 g, cyannocobalamin (vitamin
B12): 0.008 g, calcium pantothenate: 0.02 g and p-aminobenzoic
acid: 0.04 g).
[0513] Two plasmid constructs were assembled using standard
recombinant DNA techniques. The yeast sucrose invertase genes (one
codon optimized and one non-codon optimized), suc2, were under the
control of the Chlorella reinhardtii beta-tubulin promoter/5'UTR
and had the Chlorella vulgaris nitrate reductase 3'UTR. The
sequences (including the 5'UTR and 3'UTR sequences) for the
non-codon optimized (Cr.beta.-tub::NCO-suc2::CvNitRed) construct,
SEQ ID NO: 55, and codon optimized
(Cr.beta.-tub::CO-suc2::CvNitRed) construct, SEQ ID NO: 56, are
listed in the Sequence Listing. Codon optimization was based on
Prototheca sp (see Table 4). FIG. 9 shows a schematic of the two
constructs with the relevant restriction cloning sites and arrows
indicating the direction of transcription. Selection was provided
by Neo R. Codon optimization was based on preferred codon usage in
Prototheca strains in Table 4.
[0514] Preparation of the DNA/gold microcarrier: DNA/gold
microcarriers were prepared immediately before use and stored on
ice until applied to macrocarriers. The plasmid DNA (in TE buffer)
was added to 50 .mu.l of binding buffer. Saturation of the gold
beads was achieved at 15 .mu.g plasmid DNA for 3 mg gold carrier.
The binding buffer and DNA were mixed well via vortexing. The DNA
and binding buffer should be pre-mix prior to gold addition to
ensure uniformed plasmid binding to gold carrier particles. 60
.mu.l of S550d (Seashell Technologies, San Diego, Calif.) gold
carrier was added to the DNA/binding buffer mixture. For a gold
stock at 50 mg/ml, addition of 60 .mu.l results in an optimal ratio
of 15 .mu.g DNA/3 mg gold carrier. The gold carrier/DNA mixture was
allowed to incubate on ice for 1 minute and then 100 .mu.l of
precipitation buffer was added. The mixture was allowed to incubate
again on ice for 1 minute and then briefly vortexed and centrifuged
at 10,000 rpm at room temperature for 10 seconds to pellet the gold
carrier. The supernatant was carefully removed with a pipette and
the pellet was washed with 500 .mu.l of ice cold 100% ethanol. The
gold particles were re-pelleted by centrifuging again at 10,000 rpm
for 10 seconds. The ethanol was removed and 50 .mu.l of ice cold
ethanol was added to the gold mixture. Immediately prior to
applying the gold to macrocarriers, the gold/ethanol was
resuspended with a brief 1-2 second pulse at level 2 on a MISONIX
sonicator using the micro tip. Immediately after resuspension, 10
.mu.l of the dispersed gold particles was transferred to the
macrocarrier and allowed to dry in a sterile hood.
[0515] The two Prototheca moriformis strains (UTEX 1435 and 1441)
were grown heterotrophically in liquid medium containing 2% glucose
from cryopreserved vials. Each strain was grown to a density of
10.sup.7 cells/ml. This seed culture was then diluted with fresh
media to a density of 10.sup.5 cells/ml and allowed to grow for
12-15 hours to achieve a final cell density of approximately
10.sup.6 cells/ml. The microalgae were aliquoted into 50 ml conical
tubes and centrifuged for 10 minutes at 3500 rpm. The cells were
washed with fresh medium and centrifuged again for 10 minutes at
3500 rpm. The cells were then resuspended at a density of
1.25.times.10.sup.8 cells/ml in fresh medium.
[0516] In a sterile hood, 0.4 ml of the above-prepared cells were
removed and placed directly in the center of an agar plate (without
selection agent). The plate was gently swirled with a level
circular motion to evenly distribute the cells to a diameter of no
more than 3 cm. The cells were allowed to dry onto the plates in
the sterile hood for approximately 30-40 minutes and then were
bombarded at a rupture disk pressure of 1350 psi and a plate to
macrocarrier distance of 6 cm. The plates were then covered and
wrapped with parafilm and allowed to incubate under low light for
24 hours.
[0517] After the 24 hour recovery, 1 ml of sterile medium (with no
glucose) was added to the lawn of cells. The cells were resuspended
using a sterile loop, applied in a circular motion to the lawn of
cells and the resuspended cells were collected using a sterile
pipette. The cells were then plated onto a fresh agar plate with 2%
glucose and 100 .mu.g/ml G418. The appearance of colonies occurred
7-12 days after plating. Individual colonies were picked and grown
in selective medium with 2% glucose and 100 .mu.g/ml G418. The
wildtype (untransformed) and transgenic cells were then analyzed
for successful introduction, integration and expression of the
transgene.
[0518] Genomic DNA from transformed Prototheca moriformis UTEX 1435
and 1441 and their wildtype (untransformed) counterparts were
isolated using standard methods. Briefly, the cells were
centrifuged for 5 minutes at 14,000 rpm in a standard table top
Eppendorf centrifuge (model 5418) and flash frozen prior to DNA
extraction. Cell pellets were lysed by adding 200 uL of Lysis
buffer (100 mM Tris HCl, pH 8.0, 1% Lauryl Sarcosine, 50 mM NaCl,
20 mM EDTA, 0.25 M sucrose, 0.5 mg/ml RNase A) for every 100-200 mg
of cells (wet weight) and vortexing for 30-60 seconds. Cetyl
trimethyammonium bromide (CTAB) and NaCl were brought to 1% and 1
M, respectively, and cell extracts were incubated at 60-65.degree.
C. for 10 minutes. Subsequently, extracts were clarified via
centrifugation at 14,000 rpm for 10 minutes and the resulting
supernatant was extracted with an equal volume of
phenol/chloroform/isoamyl alcohol (25:24:1). Samples were then
centrifuged for 5 minutes at 14,000 rpm and the aqueous phase
removed. DNA was precipitated with 0.7 volumes of isopropanol. DNA
was pelleted via centrifugation at 14,000 rpm for 10 minutes and
washed twice with 80% ethanol, and once with ethanol. After drying,
DNA was resuspended in 10 mM Tris HCl, pH 8.0 and DNA
concentrations were determined by using PicoGreen fluorescence
quantification assay (Molecular Probes).
[0519] RNA from transformed Prototheca moriformis UTEX 1435 and
1441 and their wildtype (untransformed) counterparts were isolated
using standard methods. Briefly, the cells were centrifuged for 5
minutes at 14,000 rpm in a standard table top Eppendorf centrifuge
(model 5418) and flash frozen before RNA extraction. Cell pellets
were lysed by addition of 1 mL of Trizol reagent (Sigma) for every
100 mg of cells (wet weight) and by vortexing for 1-2 minutes.
Samples were incubated at room temperature for 5 minutes and
subsequently adjusted with 200 uL of chloroform per 1 mL of Trizol
reagent. After extensive shaking, cells were incubated at room
temperature for 15 minutes and then subjected to centrifugation at
14000 rpm for 15 minutes in a refrigerated table top
microcentrifuge. RNA partitioning to the upper aqueous phase was
removed and precipitated by addition of isopropanol (500 uL per 1
ml of Trizol reagent). RNA was collected by centrifugation for 10
minutes and the resulting pellet washed twice with 1 mL of 80%
ethanol, dried, and resuspended in RNAse free water. RNA
concentration was estimated by RiboGreen fluorescence
quantification assay (Molecular Probes).
[0520] Expression of neomycin phophotransferase gene conferring
G418 antibotic resistance and yeast invertase was assayed in
non-transformed Prototheca moriformis UTEX 1435 and 1441 and
transformants T98 (UTEX 1435 transformant) and T97 (UTEX 1441
transformant) using reverse transcription quantitative PCR analysis
(RT-qPCR). 20 ng total RNA (isolated as described above) was
subjected to one step RT-qPCR analysis using iScript SYBR Green
RT-PCR kit (BioRad Laboratories) and primer pairs targeting the
neomycin resistance gene (forward primer 5' CCGCCGTGCTGGACGTGGTG 3'
and reverse primer 5' GGTGGCGGGGTCCAGGGTGT 3'; SEQ ID NOs: 57 and
58, respectively) and suc2 invertase transcripts (forward primer 5'
CGGCCGGCGGCTCCTTCAAC 3' and reverse primer 5' GGCGCTCCCGTAGGTCGGGT
3'; SEQ ID NO: 59 and 60, respectively). Endogenous beta-tubulin
transcripts served as an internal positive control for PCR
amplification and as a normalization reference to estimate relative
transcript levels.
[0521] Both codon optimized and non-codon optimized constructs were
transformed into UTEX 1435 and 1441 Prototheca moriformis cells as
described above. Initially, transformants were obtained with both
constructs and the presence of the transgene was verified by
Southern blot analysis followed by RTPCR to confirm the presence of
the DNA and mRNA from the transgene. For the Southern blot
analysis, genomic DNA isolated as described above was
electrophoresed on 0.7% agarose gels in 1.times.TAE buffer. Gells
were processed as described in Sambrook et al. (Molecular Cloning;
A Laboratory Manual, 2.sup.nd Edition. Cold Spring Harbor
Laboratory Press, 1989). Probes were prepared by random priming and
hybridizations carried out as described in Sambrook et al.
Transformants from both the codon optimized and the non-codon
optimized constructs showed the presence of the invertase cassette,
while the non-transformed control was negative. Invertase mRNA was
also detected in transformants with both the codon optimized and
non-codon optimized constructs.
[0522] To confirm that the transformants were expressing an active
invertase protein, the transformants were plated on sucrose plates.
The transformants containing the non-codon optimized cassette
failed to grow on the sucrose containing plates, indicating that,
while the gene and the mRNA encoding the SUC2 protein were present,
the protein was either (1) not being translated, or (2) being
translated, but not accumulating to levels sufficient to allow for
growth on sucrose as the sole carbon source. The transformants with
the codon optimized cassette grew on the sucrose containing plates.
To assess the levels of invertase being expressed by these
transformants, two clones (T98 and T97) were subjected to an
invertase assay of whole cells scraped from solid medium and direct
sampling and quantitation of sugars in the culture supernatants
after 48 hours of growth in liquid medium containing 2% sucrose as
the sole carbon source.
[0523] For the invertase assay, the cells (T98 and T97) were grown
on plates containing 2% sucrose, scraped off and assayed for
invertase activity. 10 .mu.l of the scraped cells was mixed with 40
.mu.l of 50 mM NaOAc pH 5.1. 12.5 .mu.l of 0.5M sucrose was added
to the cell mixture and incubated at 37.degree. C. for 10-30
minutes. To stop the reaction, 75 .mu.l of 0.2M K.sub.2HPO.sub.4
was added. To assay for glucose liberated, 500 .mu.l of
reconstituted reagent (glucose oxidase/peroxidase+o-Dianisidine)
from Sigma (GAGO-20 assay kit) was added to each tube and incubated
at 37.degree. C. for 30 minutes. A glucose standard curve was also
created at this time (range: 25 .mu.g to 0.3 .mu.g glucose). After
incubation, 500 .mu.l of 6N HCl was added to stop the reaction and
to develop the color. The samples were read at 540 nm. The amount
of glucose liberated was calculated from the glucose standard curve
using the formula y=mx+c, where y is the 540 nm reading, and x is
.mu.g of glucose. Weight of glucose was converted to moles of
glucose, and given the equimolar relationship between moles of
sucrose hydrolyzed to moles of glucose generated, the data was
expressed as nmoles of sucrose hydrolyzed per unit time. The assay
showed that both T98 and T97 clones were able to hydrolyze sucrose,
indicating that a functional sucrose invertase was being produced
and secreted by the cells.
[0524] For the sugar analysis on liquid culture media after 48
hours of algal growth, T97 and T98 cells were grown in 2% sucrose
containing medium for 48 hours and the culture media were processed
for sugar analysis. Culture broths from each transformant (and
negative non-transformed cell control) were centrifuged at 14,000
rpm for 5 minutes. The resulting supernatant was removed and
subjected to HPLC/ELSD (evaporative light scattering detection).
The amount of sugar in each sample was determined using external
standards and liner regression analysis. The sucrose levels in the
culture media of the transformants were very low (less than 1.2
g/L, and in most cases 0 g/L). In the negative controls, the
sucrose levels remained high, at approximately 19 g/L after 48
hours of growth.
[0525] These results were consistant with the invertase activity
results, and taken together, indicated that the codon optimized
transformants, T97 and T98, secreted an active sucrose invertase
that allowed the microalgae to utilize sucrose as the sole carbon
source in contrast to (1) the non-codon optimized transformants and
(2) the non-transformed wildtype microalgae, both of which could
not utilize sucrose as the sole carbon source in the culture
medium.
[0526] Prototheca moriformis strains, T98 and T97, expressing a
functional, secreted sucrose invertase (SUC2) transgene were
assayed for growth and lipid production using sucrose as the sole
carbon source.
[0527] Wild type (untransformed), T98 and T97 strains were grown in
growth media (as described above) containing either 4% glucose or
4% sucrose as the sole carbon source under heterotrophic conditions
for approximately 6 days. Growth, as determined by A750 optical
density readings were taken of all four samples every 24 hours and
the dry cell weight of the cultures and lipid profiles were
determined after the 6 days of growth. The optical density readings
of the transgenic strains grown in both the glucose and sucrose
conditions were comparable to the wildtype strains grown in the
glucose conditions. These results indicate that the transgenic
strains were able to grow on either glucose or sucrose as the sole
carbon source at a rate equal to wildtype strains in glucose
conditions. The non-transformed, wildtype strains did not grow in
the sucrose-only condition.
[0528] The biomass for the wildtype strain grown on glucose and T98
strain grown on sucrose was analyzed for lipid profile. Lipid
samples were prepared from dried biomass (lyophilized) using an
Acid Hydrolysis System (Ankom Technology, NY) according to
manufacturer's instructions. Lipid profile determinations were
carried as described in Example 6. The lipid profile for the
non-transformed Prototheca moriformis UTEX 1435 strain, grown on
glucose as the sole carbon source and two colonal T98 strains (UTEX
1435 transformed with a sucrose invertase transgene), grown on
sucrose as the sole carbon source, are disclosed in Table 34
(wildtype UTEX 1435 and T98 clone 8 and clone 11 below. C:19:0
lipid was used as an internal calibration control.
TABLE-US-00038 TABLE 34 Lipid profile of wildtype UTEX 1435 and
UTEX 1435 clones with suc2 transgene. wildtype T98 clone 11 T98
clone 8 Name (Area % - ISTD) (Area % - ISTD) (Area % - ISTD) C 12:0
0.05 0.05 0.05 C 14:0 1.66 1.51 1.48 C 14:1 0.04 nd nd C 15:0 0.05
0.05 0.04 C 16:0 27.27 26.39 26.50 C 16:1 0.86 0.80 0.84 C 17:0
0.15 0.18 0.14 C 17:1 0.05 0.07 0.05 C 18:0 3.35 4.37 4.50 C 18:1
53.05 54.48 54.50 C 18:2 11.79 10.33 10.24 C 19:0 (ISTD) -- -- -- C
18:3 alpha 0.90 0.84 0.81 C 20:0 0.32 0.40 0.38 C 20:1 0.10 0.13
0.12 C 20:1 0.04 0.05 0.04 C 22:0 0.12 0.16 0.12 C 20:3 0.07 0.08
0.07 C 24:0 0.12 0.11 0.10 nd--denotes none detected
[0529] Oil extracted from wildtype Prototheca moriformis UTEX 1435
(via solvent extraction or using an expeller press) was analyzed
for carotenoids, chlorophyll, tocopherols, other sterols and
tocotrienols. The results are summarized below in Table 35.
TABLE-US-00039 TABLE 35 Carotenoid, chlorophyll, tocopherol/sterols
and tocotrienol analysis in oil extracted from Prototheca
moriformis (UTEX 1435). Pressed oil Solvent extracted oil (mcg/ml)
(mcg/ml) cis-Lutein 0.041 0.042 trans-Lutein 0.140 0.112
trans-Zeaxanthin 0.045 0.039 cis-Zeaxanthin 0.007 0.013
t-alpha-Crytoxanthin 0.007 0.010 t-beta-Crytoxanthin 0.009 0.010
t-alpha-Carotene 0.003 0.001 c-alpha-Carotene none detected none
detected t-beta-Carotene 0.010 0.009 9-cis-beta-Carotene 0.004
0.002 Lycopene none detected none detected Total Carotenoids 0.267
0.238 Chlorophyll <0.01 mg/kg <0.01 mg/kg Tocopherols and
Sterols Pressed oil Solvent extracted oil (mg/100 g) (mg/100 g)
gamma Tocopherol 0.49 0.49 Campesterol 6.09 6.05 Stigmasterol 47.6
47.8 Beta-sitosterol 11.6 11.5 Other sterols 445 446 Tocotrienols
Pressed oil Solvent extracted oil (mg/g) (mg/g) alpha Tocotrienol
0.26 0.26 beta Tocotrienol <0.01 <0.01 gamma Tocotrienol 0.10
0.10 detal Tocotrienol <0.01 <0.01 Total Tocotrienols 0.36
0.36
[0530] The ability of using sucrose as the sole carbon source as
the selection factor for clones containing the suc2 transgene
construct instead of G418 (or another antibiotic) was assessed
using the positive suc2 gene transformants. A subset of the
positive transformants was grown on plates containing sucrose as
the sole carbon source and without antibiotic selection for 24
doublings. The clones were then challenged with plates containing
glucose as the sole carbon source and G418. There was a subset of
clones that did not grow on the glucose+G418 condition, indicating
a loss of expression of the transgene. An additional experiment was
performed using a plate containing sucrose as the sole carbon
source and no G418 and streaking out a suc2 transgene expressing
clone on one half of the plate and wild-type Prototheca moriformis
on the other half of the plate. Growth was seen with both the
wild-type and transgene-containing Prototheca moriformis cells.
Wild-type Prototheca moriformis has not demonstrated the ability to
grow on sucrose, therefore, this result shows that unlike
antibiotic resistance, the use of sucrose/invertase selection is
not cell-autonomous. It is very likely that the transformants were
secreting enough sucrose invertase into the plate/media to support
wildtype growth as the sucrose was hydrolyzed into fructose and
glucose.
Example 10
Recombinant Prototheca with Exogenous TE Gene
[0531] As described above, Prototheca strains can be transformed
with exogenous genes. Prototheca moriformis (UTEX 1435) was
transformed, using methods described above, with either
Umbellularia californica C12 thioesterase gene or Cinnamomum
camphora C14 thiotesterase gene (both codon optimized according to
Table 4). Each of the transformation constructs contained a
Chlorella sorokiniana glutamate dehydrogenase promoter/5'UTR region
(SEQ ID NO: 61) to drive expression of the thioesterase transgene.
The thioesterase transgenes coding regions of Umbellularia
californica C12 thioesterase (SEQ ID NO: 62) or Cinnamomum camphora
C14 thioesterase (SEQ ID NO: 63), each with the native putative
plastid targeting sequence Immediately following the thioesterase
coding sequence is the coding sequence for a c-terminal
3.times.-FLAG tag (SEQ ID NO: 64), followed by the Chlorella
vulgaris nitrate reductase 3'UTR (SEQ ID NO: 65).
[0532] Preparation of the DNA, gold microcarrier and Prototheca
moriformis (UTEX 1435) cells were performed using the methods
described above in Example 9. The microalgae were bombarded using
the gold microcarrier--DNA mixture and plated on selection plates
containing 2% glucose and 100 .mu.g/ml G418. The colonies were
allowed to develop for 7 to 12 days and colonies were picked from
each transformation plate and screened for DNA construct
incorporation using Southern blots assays and expression of the
thioesterase constructs were screened using RT-PCR.
[0533] Positive clones were picked from both the C12 and C14
thioesterase transformation plates and screened for construct
incorporation using Southern blot assays. Southern blot assays were
carried out using standard methods (and described above in Example
9) using an optimized c probes, based on the sequence in SEQ ID NO:
62 and SEQ ID NO: 63. Transforming plasmid DNA was run as a
positive control. Out of the clones that were positive for
construct incorporation, a subset was selected for reverse
transcription quantitative PCR (RT-qPCR) analysis for C12
thioesterase and C14 thioesterase expression.
[0534] RNA isolation was performed using methods described in
Example 9 above and RT-qPCR of the positive clones were performed
using 20 ng of total RNA from each clone using the below-described
primer pair and iScript SYBR Green RT-PCR kit (Bio-Rad
Laboratories) according to manufacturer's protocol. Wildtype
(non-transformed) Prototheca moriformis total RNA was included as a
negative control. mRNA expression was expressed as relative fold
expression (RFE) as compared to negative control. The primers that
were used in the C12 thioesterase transformation RT-qPCR screening
were: U. californica C12 thioesterase PCR primers:
TABLE-US-00040 Forward: (SEQ ID NO: 66) 5' CTGGGCGACGGCTTCGGCAC 3'
Reverse: (SEQ ID NO: 67) 5' AAGTCGCGGCGCATGCCGTT 3'
[0535] The primers that were used in the C14 thioesterase
transformation RT-qPCR screening were:
Cinnamomum camphora C14 Thioesterase PCR Primers:
TABLE-US-00041 Forward: (SEQ ID NO: 68) 5' TACCCCGCCTGGGGCGACAC 3'
Reverse: (SEQ ID NO: 69) 5' CTTGCTCAGGCGGCGGGTGC 3'
[0536] RT-qPCR results for C12 thioesterase expression in the
positive clones showed an increased RFE of about 40 fold to over
2000 fold increased expression as compared to negative control.
Similar results were seen with C14 thioesterase expression in the
positive clones with an increase RFE of about 60-fold to over 1200
fold increased expression as compared to negative control.
[0537] A subset of the positive clones from each transformation (as
screened by Southern blotting and RT-qPCR assays) were selected and
grown under nitrogen-replete conditions and analyzed for total
lipid production and profile. Lipid samples were prepared from
dried biomass from each clone. 20-40 mg of dried biomass from each
transgenic clone was resuspended in 2 mL of 3% H.sub.2SO.sub.4 in
MeOH, and 200 ul of toluene containing an appropriate amount of a
suitable internal standard (C19:0) was added. The mixture was
sonicated briefly to disperse the biomass, then heated at
65-70.degree. C. for two hours. 2 mL of heptane was added to
extract the fatty acid methyl esters, followed by addition of 2 mL
of 6% K.sub.2CO.sub.3 (aq) to neutralize the acid. The mixture was
agitated vigorously, and a portion of the upper layer was
transferred to a vial containing Na.sub.2SO.sub.4 (anhydrous) for
gas chromatography analysis using standard FAME GC/FID (fatty acid
methyl ester gas chromatography flame ionization detection)
methods. Lipid profile (expressed as Area %) of the positive clones
as compared to wildtype negative control are summarized in Tables
36 and 37 below. As shown in Table 36, the fold increase of C12
production in the C12 transformants ranged from about a 5-fold
increase (clone C12-5) to over 11-fold increase (clone C12-1). Fold
increase of C14 production in the C14 transformants ranged from
about a 1.5 fold increase to about a 2.5 fold increase.
TABLE-US-00042 TABLE 36 Summary of total lipid profile of the
Prototheca moriformis C12 thioesterase transformants. Wildtype
C12-1 C12-2 C12-3 C12-4 C12-5 C12-6 C12-7 C12-8 C6:0 0.03 nd nd nd
nd nd nd nd nd C8:0 0.11 0.09 nd 0.11 nd nd nd nd nd C10:0 nd nd nd
0.01 0.01 nd nd 0.01 nd C12:0 0.09 1.04 0.27 0.72 0.71 0.50 0.67
0.61 0.92 C14:0 2.77 2.68 2.84 2.68 2.65 2.79 2.73 2.56 2.69 C14:1
0.01 nd nd 0.02 nd nd nd 0.01 nd C15:0 0.30 0.09 0.10 0.54 0.19
0.09 0.13 0.97 0.09 C15:1 0.05 nd nd 0.02 nd nd nd nd nd C16:0
24.13 23.12 24.06 22.91 22.85 23.61 23.14 21.90 23.18 C16:1 0.57
0.62 0.10 0.52 0.69 0.63 0.69 0.49 0.63 C17:0 0.47 0.24 0.27 1.02
0.36 0.17 0.26 2.21 0.19 C17:1 0.08 nd 0.09 0.27 0.10 0.05 0.09
0.80 0.05 C18:0 nd nd 2.14 1.75 2.23 2.16 2.38 1.62 2.47 C18:1
22.10 23.15 24.61 21.90 23.52 19.30 22.95 20.22 22.85 C18:1 nd 0.33
0.24 nd nd 0.09 0.09 nd 0.11 C18:2 37.16 34.71 35.29 35.44 35.24
36.29 35.54 36.01 35.31 C18:3 11.68 11.29 9.26 11.62 10.76 13.61
10.64 11.97 10.81 alpha C20:0 0.15 0.16 0.19 0.16 0.16 0.14 0.18
0.14 0.18 C20:1 0.22 0.17 0.19 0.20 0.21 0.19 0.21 0.20 0.21 C20:2
0.05 nd 0.04 0.05 0.05 0.05 0.04 0.05 0.04 C22:0 nd nd nd 0.01 nd
nd nd 0.02 nd C22:1 nd nd nd nd nd 0.01 nd 0.01 nd C20:3 0.05 nd
0.07 0.06 0.06 0.10 0.07 0.05 0.06 C20:4 nd nd nd nd nd 0.02 nd nd
nd C24:0 nd nd 0.24 0.01 0.20 0.19 0.19 0.14 0.20
TABLE-US-00043 TABLE 37 Summary of total lipid profile of the
Prototheca moriformis C14 thioesterase transformants. Wildtype
C14-1 C14-2 C14-3 C14-4 C14-5 C14-6 C14-7 C6:0 0.03 nd nd nd nd nd
nd nd C8:0 0.11 nd nd nd nd nd nd nd C10:0 nd 0.01 nd 0.01 nd 0.01
nd nd C12:0 0.09 0.20 0.16 0.25 0.21 0.19 0.40 0.17 C14:0 2.77 4.31
4.76 4.94 4.66 4.30 6.75 4.02 C14:1 0.01 nd 0.01 nd nd 0.01 nd nd
C15:0 0.30 0.43 0.45 0.12 0.09 0.67 0.10 0.33 C15:1 0.05 nd nd nd
nd nd nd nd C16:0 24.13 22.85 23.20 23.83 23.84 23.48 24.04 23.34
C16:1 0.57 0.65 0.61 0.60 0.60 0.47 0.56 0.67 C17:0 0.47 0.77 0.76
0.21 0.19 1.11 0.18 0.54 C17:1 0.08 0.23 0.15 0.06 0.05 0.24 0.05
0.12 C18:0 nd 1.96 1.46 2.48 2.34 1.84 2.50 2.06 C18:1 22.10 22.25
19.92 22.36 20.57 19.50 20.63 22.03 C18:1 nd nd nd nd nd nd 0.10 nd
C18:2 37.16 34.97 36.11 34.35 35.70 35.49 34.03 35.60 C18:3 11.68
10.71 12.00 10.15 11.03 12.08 9.98 10.47 alpha C20:0 0.15 0.16 0.19
0.17 0.17 0.14 0.18 0.16 C20:1 0.22 0.20 0.12 .019 0.19 0.19 0.17
0.20 C20:2 0.05 0.04 0.02 0.03 0.04 0.05 0.03 0.04 C22:0 nd nd nd
nd 0.02 0.01 nd nd C22:1 nd 0.01 nd nd nd nd nd 0.01 C20:3 0.05
0.08 0.03 0.06 0.09 0.05 0.05 0.07 C20:4 nd 0.01 nd nd nd nd 0.02
nd C24:0 nd 0.17 0.14 0.19 0.20 0.16 0.22 0.17
[0538] The above-described experiments indicate the successful
transformation of Prototheca moriformis (UTEX 1435) with transgene
constructs of two different thioesterases (C12 and C14), which
involved not only the successful expression of the transgene, but
also the correct targeting of the expressed protein to the plastid
and a functional effect (the expected change in lipid profile) as a
result of the transformation. The same transformation experiment
was performed using an expression construct containing a
codon-optimized (according to Table 4) Cuphea hookeriana C8-10
thioesterase coding region with the native plastid targeting
sequence (SEQ ID NO: 70) yielded no change in lipid profile. While
the introduction of the Cuphea hookeriana C8-10 transgene into
Prototheca moriformis (UTEX 1435) was successful and confirmed by
Southern blot analysis, no change in C8 or C10 fatty acid
production was detected in the transformants compared to the
wildtype strain.
Example 11
Generation of Prototheca moriformis Strain with Exogenous Plant TE
with Algal Plastid Targeting Sequence
[0539] In order to investigate whether the use of algal
chloroplast/plastid targeting sequences would improve medium chain
(C8-C14) thioesterase expression and subsequent medium chain lipid
production in Prototheca moriformis (UTEX 1435), several putative
algal plastid targeting sequences were cloned from Chlorella
protothecoides and Prototheca moriformis. Thioesterase constructs
based on Cuphea hookeriana C8-10 thioesterase, Umbellularia
californica C12 thioesterase, and Cinnamomum camphora C14
thioesterase were made using made with a Chlorella sorokiniana
glutamate dehydrogenase promoter/5'UTR and a Chlorella vulgaris
nitrate reductase 3'UTR. The thioesterase coding sequences were
modified by removing the native plastid targeting sequences and
replacing them with plastid targeting sequences from the Chlorella
protothecoides and the Prototheca moriformis genomes. The
thioesterase expression constructs and their corresponding sequence
identification numbers are listed below. Each transformation
plasmid also contained a Neo resistance construct that was
identical to the ones described in Example 9 above. Additionally,
another algal-derived promoter, the Chlamydomonas reinhardtii
.beta.-tubulin promoter, was also tested in conjunction with the
thioesterase constructs. "Native" plastid targeting sequence refers
to the higher plant thioesterase plastid targeting sequence. A
summary of the constructs used in these experiments is provided
below:
TABLE-US-00044 Construct Promoter/ Plastid Name 5'UTR targeting seq
Gene 3'UTR SEQ ID NO. Construct 1 C. sorokiniana C. protothecoides
Cuphea C. vulgaris SEQ ID NO: 71 glutamate stearoyl ACP hookeriana
nitrate dehydrogenase desaturase C8-10 TE reductase Construct 2 C.
sorokiniana P. moriformis Cuphea C. vulgaris SEQ ID NO: 72
glutamate delta 12 fatty hookeriana nitrate dehydrogenase acid
desaturase C8-10 TE reductase Construct 3 C. sorokiniana P.
moriformis Cuphea C. vulgaris SEQ ID NO: 73 glutamate isopentenyl
hookeriana nitrate dehydrogenase diphosphate C8-10 TE reductase
synthase Construct 4 C. sorokiniana P. moriformis Umbellularia C.
vulgaris SEQ ID NO: 74 glutamate isopentenyl californica nitrate
dehydrogenase diphosphate C12 TE reductase synthase Construct 5 C.
sorokiniana P. moriformis Umbellularia C. vulgaris SEQ ID NO: 75
glutamate stearoyl ACP californica nitrate dehydrogenase desaturase
C12 TE reductase Construct 6 C. sorokiniana C. protothecoides
Umbellularia C. vulgaris SEQ ID NO: 76 glutamate stearoyl ACP
californica nitrate dehydrogenase desaturase C12 TE reductase
Construct 7 C. sorokiniana P. moriformis Umbellularia C. vulgaris
SEQ ID NO: 77 glutamate delta 12 fatty californica nitrate
dehydrogenase acid desaturase C12 TE reductase Construct 8 C.
sorokiniana C. protothecoides Cinnamomum C. vulgaris SEQ ID NO: 78
glutamate stearoyl ACP camphora nitrate dehydrogenase desaturase
C14 TE reductase Construct 9 Chlamydomonas Native Cuphea C.
vulgaris SEQ ID NO: 79 reinhardtii hookeriana nitrate
.beta.-tubulin C8-10 TE reductase Construct 10 Chlamydomonas P.
moriformis Cuphea C. vulgaris SEQ ID NO: 80 reinhardtii isopentenyl
hookeriana nitrate .beta.-tubulin diphosphate C8-10 TE reductase
synthase Construct 11 Chlamydomonas P. moriformis Cuphea C.
vulgaris SEQ ID NO: 81 reinhardtii delta 12 fatty hookeriana
nitrate .beta.-tubulin acid desaturase C8-10 TE reductase Construct
12 Chlamydomonas C. protothecoides Cuphea C. vulgaris SEQ ID NO: 82
reinhardtii stearoyl ACP hookeriana nitrate .beta.-tubulin
desaturase C8-10 TE reductase Construct 13 Chlamydomonas P.
moriformis Cuphea C. vulgaris SEQ ID NO: 83 reinhardtii stearoyl
ACP hookeriana nitrate .beta.-tubulin desaturase C8-10 TE reductase
Construct 14 Chlamydomonas Native Umbellularia C. vulgaris SEQ ID
NO: 84 reinhardtii californica nitrate .beta.-tubulin C12 TE
reductase Construct 15 Chlamydomonas P. moriformis Umbellularia C.
vulgaris SEQ ID NO: 85 reinhardtii isopentenyl californica nitrate
.beta.-tubulin diphosphate C12 TE reductase Construct 16
Chlamydomonas P. moriformis Umbellularia C. vulgaris SEQ ID NO: 86
reinhardtii delta 12 fatty californica nitrate .beta.-tubulin acid
desaturase C12 TE reductase Construct 17 Chlamydomonas C.
protothecoides Umbellularia C. vulgaris SEQ ID NO: 87 reinhardtii
stearoyl ACP californica nitrate .beta.-tubulin desaturase C12 TE
reductase Construct 18 Chlamydomonas P. moriformis Umbellularia C.
vulgaris SEQ ID NO: 88 reinhardtii stearoyl ACP californica nitrate
.beta.-tubulin desaturase C12 TE reductase Construct 19
Chlamydomonas Native Cinnamomum C. vulgaris SEQ ID NO: 89
reinhardtii camphora nitrate .beta.-tubulin C14 TE reductase
Construct 20 Chlamydomonas P. moriformis Cinnamomum C. vulgaris SEQ
ID NO: 90 reinhardtii isopentenyl camphora nitrate .beta.-tubulin
diphosphate C14 TE reductase synthase Construct 21 Chlamydomonas P.
moriformis Cinnamomum C. vulgaris SEQ ID NO: 91 reinhardtii delta
12 fatty camphora nitrate .beta.-tubulin acid desaturase C14 TE
reductase Construct 22 Chlamydomonas C. protothecoides Cinnamomum
C. vulgaris SEQ ID NO: 92 reinhardtii stearoyl ACP camphora nitrate
.beta.-tubulin desaturase C14 TE reductase Construct 23
Chlamydomonas P. moriformis Cinnamomum C. vulgaris SEQ ID NO: 93
reinhardtii stearoyl ACP camphora nitrate .beta.-tubulin desaturase
C14 TE reductase
[0540] Each construct was transformed into Prototheca moriformis
(UTEX 1435) and selection was performed using G418 using the
methods described in Example 9 above. Several positive clones from
each transformation were picked and screened for the presence
thioesterase transgene using Southern blotting analysis. Expression
of the thioesterase transgene was confirmed using RT-PCR. A subset
of the positive clones (as confirmed by Southern blotting analysis
and RT-PCR) from each transformation was selected and grown for
lipid profile analysis. Lipid samples were prepared from dried
biomass samples of each clone and lipid profile analysis was
performed using acid hydrolysis methods described in Example 9.
Changes in area percent of the fatty acid corresponding to the
thioesterase transgene were compared to wildtype levels, and clones
transformed with a thioesterase with the native plastid targeting
sequence.
[0541] The clones transformed with Cuphea hookeriana C8-10
thioesterase constructs with the native plastid targeting sequence
had the same level of C8 and C10 fatty acids as wildtype. The
clones transformed with Cuphea hookeriana C8-10 thioesterase
constructs (Constructs 1-3) with algal plastid targeting sequences
had over a 10-fold increase in C10 fatty acids for Construct 3 and
over 40-fold increase in C10 fatty acids for Constructs 1 and 2 (as
compared to wildtype). The clones transformed with Umbellularia
californica C12 thioesterase constructs with the native plastid
targeting sequence had a modest 6-8 fold increase in C12 fatty acid
levels as compared to wildtype. The clones transformed with the
Umbellularia californica C12 thioesterase constructs with the algal
plasid targeting constructs (Constructs 4-7) had over an 80-fold
increase in C12 fatty acid level for Construct 4, about an 20-fold
increase in C12 fatty acid level for Construct 6, about a 10-fold
increase in C12 fatty acid level for Construct 7 and about a 3-fold
increase in C12 fatty acid level for Construct 5 (all compared to
wildtype). The clones transformed with Cinnamomum camphora C14
thioesterase with either the native plastid targeting sequence or
the construct 8 (with the Chlorella protothecoides stearoyl ACP
desaturase plastid targeting sequence) had about a 2-3 fold
increase in C14 fatty acid levels as compared to wildtype. In
general clones transformed with an algal plastid targeting sequence
thioesterase constructs had a higher fold increase in the
corresponding chain-length fatty acid levels than when using the
native higher plant targeting sequence.
[0542] 1. Clamydomonas reinhartii .beta.-Tubulin Promoter
[0543] Additional heterologous thioesterase expression constructs
were prepared using the Chlamydomonas reinhardtii .beta.-tubulin
promoter instead of the C. sorokinana glutamate dehydrogenase
promoter. The construct elements and sequence of the expression
constructs are listed above. Each construct was transformed into
Prototheca moriformis UTEX 1435 host cells using the methods
described above. Lipid profiles were generated from a subset of
positive clones for each construct in order to assess the success
and productivity of each construct. The lipid profiles compare the
fatty acid levels (expressed in area %) to wildtype host cells. The
"Mean" column represents the numerical average of the subset of
positive clones. The "Sample" column represents the best positive
clone that was screened (best being defined as the sample that
produced the greatest change in area % of the corresponding
chain-length fatty acid production). The "low-high" column
represents the lowest area % and the highest area % of the fatty
acid from the clones that were screened. The lipid profile results
of Constructs 9-12 and 14-23 are summarized below.
TABLE-US-00045 Fatty Acid wildtype Mean Sample low/high Construct
9. Cuphea hookeriana C8-10 TE C 8:0 0 0.05 0.30 0-0.29 C 10:0 0.01
0.63 2.19 0-2.19 C 12:0 0.03 0.06 0.10 0-0.10 C 14:0 1.40 1.50 1.41
1.36-3.59 C 16:0 24.01 24.96 24.20 C 16:1 0.67 0.80 0.85 C 17:0 0
0.16 0.16 C 17:1 0 0.91 0 C 18:0 4.15 17.52 3.19 C 18:1 55.83 44.81
57.54 C 18:2 10.14 7.58 8.83 C 18:3.alpha. 0.93 0.68 0.76 C 20:0
0.33 0.21 0.29 C 24:0 0 0.05 0.11 Construct 10. Cuphea hookeriana
C8-10 TE C 8:0 0 0.01 0.02 0-0.03 C 10:0 0 0.16 0.35 0-0.35 C 12:0
0.04 0.05 0.07 0-0.07 C 14:0 1.13 1.62 1.81 0-0.05 C 14:1 0 0.04
0.04 C 15:0 0.06 0.05 0.05 C 16:0 19.94 26.42 28.08 C 16:1 0.84
0.96 0.96 C 17:0 0.19 0.14 0.13 C 17:1 0.10 0.06 0.05 C 18:0 2.68
3.62 3.43 C 18:1 63.96 54.90 53.91 C 18:2 9.62 9.83 9.11 C 18:3
.gamma. 0 0.01 0 C 18:3.alpha. 0.63 0.79 0.73 C 20:0 0.26 0.35 0.33
C 20:1 0.06 0.08 0.09 C 20:1 0.08 0.06 0.07 C 22:0 0 0.08 0.09 C
24:0 0.13 0.13 0.11 Construct 11. Cuphea hookeriana C8-10 TE C 8:0
0 0.82 1.57 0-1.87 C 10:0 0 3.86 6.76 0-6.76 C 12:0 0.04 0.13 0.20
0.03-0.20 C 14:0 1.13 1.80 1.98 1.64-2.05 C 14:1 0 0.04 0.04 C 15:0
0.06 0.06 0.06 C 16:0 19.94 25.60 25.44 C 16:1 0.84 1.01 1.02 C
17:0 0.19 0.13 0.11 C 17:1 0.10 0.06 0.05 C 18:0 2.68 2.98 2.38 C
18:1 63.96 51.59 48.85 C 18:2 9.62 9.85 9.62 C 18:3 .gamma. 0 0.01
0 C 18:3.alpha. 0.63 0.91 0.92 C 20:0 0.26 0.29 0.26 C 20:1 0.06
0.06 0 C 20:1 0.08 0.06 0.03 C 22:0 0 0.08 0.08 C 24:0 0.13 0.06 0
Construct 12. Cuphea hookeriana C8-10 TE C 8:0 0 0.31 0.85 0-0.85 C
10:0 0 2.16 4.35 0.20-4.35 C 12:0 0.04 0.10 0.15 0-0.18 C 14:0 1.13
1.96 1.82 1.66-2.97 C 14:1 0 0.03 0.04 C 15:0 0.06 0.07 0.07 C 16:0
19.94 26.08 25.00 C 16:1 0.84 1.04 0.88 C 17:0 0.19 0.16 0.16 C
17:1 0.10 0.05 0.07 C 18:0 2.68 3.02 3.19 C 18:1 63.96 51.08 52.15
C 18:2 9.62 11.44 9.47 C 18:3 .gamma. 0 0.01 0 C 18:3.alpha. 0.63
0.98 0.90 C 20:0 0.26 0.30 0.28 C 20:1 0.06 0.06 0.05 C 20:1 0.08
0.04 0 C 22:0 0 0.07 0 C 24:0 0.13 0.05 0 Construct 14.
Umbellularia californica C12 TE C 10:0 0.01 0.02 0.03 0.02-0.03 C
12:0 0.03 2.62 3.91 0.04-3.91 C 14:0 1.40 1.99 2.11 1.83-2.19 C
16:0 24.01 27.64 27.01 C 16:1 0.67 0.92 0.92 C 18:0 4.15 2.99 2.87
C 18:1 55.83 53.22 52.89 C 18:2 10.14 8.68 8.41 C 18:3.alpha. 0.93
0.78 0.74 C 20:0 0.33 0.29 0.27 Construct 15. Umbellularia
californica C12 TE C 10:0 0 0.05 0.08 0-0.08 C 12:0 0.04 8.12 12.80
4.35-12.80 C 13:0 0 0.02 0.03 0-0.03 C 14:0 1.13 2.67 3.02
2.18-3.37 C 14:1 0 0.04 0.03 0.03-0.10 C 15:0 0.06 0.07 0.06 C 16:0
19.94 25.26 23.15 C 16:1 0.84 0.99 0.86 C 17:0 0.19 0.14 0.14 C
17:1 0.10 0.05 0.05 C 18:0 2.68 2.59 2.84 C 18:1 63.96 46.91 44.93
C 18:2 9.62 10.59 10.01 C 18:3.alpha. 0.63 0.92 0.83 C 20:0 0.26
0.27 0.24 C 20:1 0.06 0.06 0.06 C 20:1 0.08 0.05 0.04 C 22:0 0 0.07
0.09 C 24:0 0.13 0.13 0.12 Construct 16. Umbellularia californica
C12 TE C 10:0 0 0.03 0.04 0.02-0.04 C 12:0 0.04 2.43 5.32 0.98-5.32
C 13:0 0 0.01 0.02 0-0.02 C 14:0 1.13 1.77 1.93 1.62-1.93 C 14:1 0
0.03 0.02 0.02-0.04 C 15:0 0.06 0.06 0.05 C 16:0 19.94 24.89 22.29
C 16:1 0.84 0.91 0.82 C 17:0 0.19 0.16 0.15 C 17:1 0.10 0.06 0.06 C
18:0 2.68 3.81 3.67 C 18:1 63.96 53.19 52.82 C 18:2 9.62 10.38
10.57 C 18:3.alpha. 0.63 0.80 0.77 C 20:0 0.26 0.35 0.32 C 20:1
0.06 0.06 0.07 C 20:1 0.08 0.07 0.08 C 22:0 0 0.08 0.07 C 24:0 0.13
0.15 0.14 Construct 17. Umbellularia californica C12 TE C 10:0 0
0.04 0.07 0.03-0.08 C 12:0 0.04 7.02 14.11 4.32-14.11 C 13:0 0 0.03
0.04 0.01-0.04 C 14:0 1.13 2.25 3.01 1.95-3.01 C 14:1 0 0.03 0.03
0.02-0.03 C 15:0 0.06 0.06 0.06 C 16:0 19.94 23.20 21.46 C 16:1
0.84 0.82 0.77 C 17:0 0.19 0.15 0.14 C 17:1 0.10 0.06 0.06 C 18:0
2.68 3.47 2.93 C 18:1 63.96 50.30 45.17 C 18:2 9.62 10.33 9.98 C
18:3 .gamma. 0 0.01 0 C 18:3.alpha. 0.63 0.84 0.86 C 20:0 0.26 0.32
0.27 C 20:1 0.06 0.07 0.06 C 20:1 0.08 0.06 0.06 C 22:0 0 0.08 0.09
C 24:0 0.13 0.14 0.13 Construct 18. Umbellularia californica C12 TE
C 10:0 0 0.03 0.05 0.01-0.05 C 12:0 0.04 5.06 7.77 0.37-7.77 C 13:0
0 0.02 0 0-0.03 C 14:0 1.13 2.11 2.39 1.82-2.39 C 14:1 0 0.03 0.03
0.02-0.05 C 15:0 0.06 0.06 0.06 C 16:0 19.94 24.60 23.95 C 16:1
0.84 0.86 0.83 C 17:0 0.19 0.15 0.14 C 17:1 0.10 0.06 0.05 C 18:0
2.68 3.31 2.96 C 18:1 63.96 51.26 49.70 C 18:2 9.62 10.18 10.02 C
18:3 .gamma. 0 0.01 0.02 C 18:3.alpha. 0.63 0.86 0.86 C 20:0 0.26
0.32 0.29 C 20:1 0.06 0.05 0.05 C 20:1 0.08 0.07 0.04 C 22:0 0 0.08
0.08 C 24:0 0.13 0.13 0.13 Construct 19. Cinnamomum camphora C14 TE
C 10:0 0.02 0.01 0.01 0.01-0.02 C 12:0 0.05 0.27 0.40 0.08-0.41 C
14:0 1.52 4.47 5.81 2.10-5.81 C 16:0 25.16 28.14 28.55 C 16:1 0.72
0.84 0.82 C 18:0 3.70 3.17 2.87 C 18:1 54.28 51.89 51.01 C 18:2
12.24 9.36 8.62 C 18:3.alpha. 0.87 0.74 0.75 C 20:0 0.33 0.33 0.31
Construct 20. Cinnamomum camphora C14 TE C 10:0 0.01 0.01 0.02
0.01-0.02 C 12:0 0.03 0.39 0.65 0.08-0.65 C 13:0 0 0.01 0.01
0.01-0.02 C 14:0 1.40 5.61 8.4 2.1-8.4 C 14:1 0 0.03 0.03 0.02-0.03
C 15:0 0 0.06 0.07 C 16:0 24.01 25.93 25.57 C 16:1 0.67 0.75 0.71 C
17:0 0 0.13 0.12 C 17:1 0 0.05 0.05 C 18:0 4.15 3.30 3.23 C 18:1
55.83 51.00 48.48 C 18:2 10.14 10.38 10.35 C 18:3.alpha. 0.93 0.91
0.88 C 20:0 0.33 0.35 0.32 C 20:1 0 0.08 0.08 C 20:1 0 0.07 0.07 C
22:0 0 0.08 0.08 C 24:0 0 0.14 0.13 Construct 21. Cinnamomum
camphora C14 TE C 10:0 0.01 0.01 0.01 0-0.01 C 12:0 0.03 0.10 0.27
0.04-0.27 C 14:0 1.40 2.28 4.40 1.47-4.40 C 16:0 24.01 26.10 26.38
C 16:1 0.67 0.79 0.73 C 17:0 0 0.15 0.16 C 17:1 0 0.06 0.06 C 18:0
4.15 3.59 3.51 C 18:1 55.83 53.53 50.86 C 18:2 10.14 10.83 11.11 C
18:3.alpha. 0.93 0.97 0.87 C 20:0 0.33 0.36 0.37 C 20:1 0 0.09 0.08
C 20:1 0 0.07 0.07 C 22:0 0 0.09 0.09 Construct 22. Cinnamomum
camphora C14 TE C 10:0 0.01 0.02 0.02 0.02-0.02 C 12:0 0.03 1.22
1.83 0.59-1.83 C 13:0 0 0.02 0.03 0.01-0.03 C 14:0 1.40 12.77 17.33
7.97-17.33 C 14:1 0 0.02 0.02 0.02-0.04 C 15:0 0 0.07 0.08 C 16:0
24.01 24.79 24.22 C 16:1 0.67 0.64 0.58 C 17:0 0 0.11 0.10 C 17:1 0
0.04 0.04 C 18:0 4.15 2.85 2.75 C 18:1 55.83 45.16 41.23 C 18:2
10.14 9.96 9.65 C 18:3.alpha. 0.93 0.91 0.85 C 20:0 0.33 0.30 0.30
C 20:1 0 0.07 0.06 C 20:1 0 0.06 0.05 C 22:0 0 0.08 0.08 Construct
23. Cinnamomum camphora C14 TE C 10:0 0.01 0.01 0.02 0-0.02 C 12:0
0.05 0.57 1.08 0.16-1.08 C 13:0 0 0.02 0.02 0-0.02 C 14:0 1.45 7.18
11.24 2.96-11.24 C 14:1 0.02 0.03 0.03 0.02-0.03 C 15:0 0.06 0.07
0.07 C 16:0 24.13 25.78 25.21 C 16:1 0.77 0.72 0.66
C 17:0 0.19 0.13 0.11 C 17:1 0.08 0.05 0.04 C 18:0 3.53 3.35 3.12 C
18:1 56.15 49.65 46.35 C 18:2 11.26 10.17 9.72 C 18:3.alpha. 0.84
0.95 0.83 C 20:0 0.32 0.34 0.32 C 20:1 0.09 0.08 0.09 C 20:1 0.07
0.05 0.06 C 22:0 0.07 0.08 0.08 C 24:0 0.13 0.13 0.12
[0544] Constructs 9-12 were expression vectors containing the
Cuphea hookeriana C8-10 thioesterase construct. As can be seen in
the data summaries above, the best results were seen with Construct
11, with the Sample C8 fatty acid being 1.57 Area % (as compared to
0 in wildtype) and C10 fatty acid being 6.76 Area % (as compared to
0 in wildtype). There was also a modest increase in C12 fatty acids
(approximately 2-5 fold increase). While the native plastid
targeting sequence produced no change when under the control of the
C. sorokinana glutamate dehydrogenase promoter, the same expression
construct driven by the C. reinhardtii .beta.-tubulin promoter
produced significant changes in C8-10 fatty acids in the host cell.
This is further evidence of the idiosyncrasies of heterologous
expression of thioesterases in Prototheca species. All of the
clones containing the C. reinhardtii .beta.-tubulin promoter C8-10
thioesterase construct had greater increases in C8-10 fatty acids
than the clones containing the C. sorokinana glutamate
dehydrogenase promoter C8-10 thioesterase construct. Lipid profile
data for Construct 13 was not obtained and therefore, not included
above.
[0545] Constructs 14-18 were expression vectors containing the
Umbellularia californica C12 thioesterase construct. As can be seen
in the data summaries above, the best results were seen with
Constructs 15 (P. moriformis isopentenyl diphosphate synthase
plastid targeting sequence) and 17 (C. protothecoides stearoyl ACP
desaturase plastid targeting sequence). The greatest change in C12
fatty acid production was seen with Construct 17, with C12 fatty
acids levels of up to 14.11 area %, as compared to 0.04 area % in
wildtype. Modest changes (about 2-fold) were also seen with C14
fatty acid levels. When compared to the same constructs with the C.
sorokinana glutamate dehydrogenase promoter, the same trends were
true with the C. reinhardtii .beta.-tubulin promoter--the C.
protothecoides stearoyl ACP desaturase and P. moriformis
isopentenyl diphosphate synthase plastid targeting sequences
produced the greatest change in C12 fatty acid levels with both
promoters.
[0546] Constructs 19-23 were expression vectors containing the
Cinnamomum camphora C14 thioesterase construct. As can be seen in
the data summaries above, the best results were seen with
Constructs 22 and Construct 23. The greatest change in C14 fatty
acid production was seen with Construct 22, with C14 fatty acid
levels of up to 17.35 area % (when the values for C140 and C141 are
combined), as compared to 1.40% in wildtype. Changes in C12 fatty
acids were also seen (5-60 fold). When compared to the same
constructs with the C. sorokinana glutamate dehydrogenase promoter,
the same trends were true with the C. reinhardtii .beta.-tubulin
promoter--the C. protothecoides stearoyl ACP desaturase and P.
moriformis stearoyl ACP desaturase plastid targeting sequences
produced the greatest change in C14 fatty acid levels with both
promoters. Consistently with all thioesterase expression
constructs, the C. reinhardtii .beta.-tubulin promoter constructs
produced greater changes in C8-14 fatty acid levels than the C.
sorokiniana glutamate dehydrogenase
[0547] Two positive clones from the Construct 22 were selected and
grown under high selective pressure (50 mg/L G418). After 6 days in
culture, the clones were harvested and their lipid profile was
determined using the methods described above. The lipid profile
data is summarized below and is expressed in area %.
TABLE-US-00046 Construct 22 clones + 50 mg/L G418 Fatty Acid
Construct 22 A Construct 22 B C 12:0 3.21 3.37 C 14:0 27.55 26.99 C
16:0 25.68 24.37 C 16:1 0.99 0.92 C 18:0 1.37 1.23 C 18:1 28.35
31.07 C 18:2 11.73 11.05 C 18:3.alpha. 0.92 0.81 C 20:0 0.16
0.17
[0548] Both clones, when grown under constant, high selective
pressure, produced an increased amount of C14 and C12 fatty acids,
about double the levels seen with Construct 22 above. These clones
yielded over 30 area % of C12-14 fatty acids, as compared to 1.5
area % of C12-14 fatty acids seen in wildtype cells.
Sequence CWU 1
1
9611187DNAChlorella sp. 1gatcagacgg gcctgacctg cgagataatc
aagtgctcgt aggcaaccaa ctcagcagct 60gcttggtgtt gggtctgcag gatagtgttg
cagggcccca aggacagcag gggaacttac 120accttgtccc cgacccagtt
ttatggagtg cattgcctca agagcctagc cggagcgcta 180ggctacatac
ttgccgcacc ggtatgaggg gatatagtac tcgcactgcg ctgtctagtg
240agatgggcag tgctgcccat aaacaactgg ctgctcagcc atttgttggc
ggaccattct 300gggggggcca gcaatgcctg actttcgggt agggtgaaaa
ctgaacaaag actaccaaaa 360cagaatttct tcctccttgg aggtaagcgc
aggccggccc gcctgcgccc acatggcgct 420ccgaacacct ccatagctgt
aagggcgcaa acatggccgg actgttgtca gcactctttc 480atggccatac
aaggtcatgt cgagattagt gctgagtaag acactatcac cccatgttcg
540attgaagccg tgacttcatg ccaacctgcc cctgggcgta gcagacgtat
gccatcatga 600ccactagccg acatgcgctg tcttttgcca ccaaaacaac
tggtacaccg ctcgaagtcg 660tgccgcacac ctccgggagt gagtccggcg
actcctcccc ggcgggccgc ggccctacct 720gggtagggtc gccatacgcc
cacgaccaaa cgacgcagga ggggattggg gtagggaatc 780ccaaccagcc
taaccaagac ggcacctata ataataggtg gggggactaa cagccctata
840tcgcaagctt tgggtgccta tcttgagaag cacgagttgg agtggctgtg
tacggtcgac 900cctaaggtgg gtgtgccgca gcctgaaaca aagcgtctag
cagctgcttc tataatgtgt 960cagccgttgt gtttcagtta tattgtatgc
tattgtttgt tcgtgctagg gtggcgcagg 1020cccacctact gtggcgggcc
attggttggt gcttgaattg cctcaccatc taaggtctga 1080acgctcactc
aaacgccttt gtacaactgc agaactttcc ttggcgctgc aactacagtg
1140tgcaaaccag cacatagcac tcccttacat cacccagcag tacaaca
118721414DNAChlorella ellipsoidea 2cgctgcgcac cagggccgcc agctcgctga
tgtcgctcca aatgcggtcc cccgattttt 60tgttcttcat cttctccacc ttggtggcct
tcttggccag ggccttcagc tgcatgcgca 120cagaccgttg agctcctgat
cagcatcctc aggaggccct ttgacaagca agcccctgtg 180caagcccatt
cacggggtac cagtggtgct gaggtagatg ggtttgaaaa ggattgctcg
240gtcgattgct gctcatggaa ttggcatgtg catgcatgtt cacaatatgc
caccaggctt 300tggagcaaga gagcatgaat gccttcaggc aggttgaaag
ttcctggggg tgaagaggca 360gggccgagga ttggaggagg aaagcatcaa
gtcgtcgctc atgctcatgt tttcagtcag 420agtttgccaa gctcacagga
gcagagacaa gactggctgc tcaggtgttg catcgtgtgt 480gtggtggggg
ggggggggtt aatacggtac gaaatgcact tggaattccc acctcatgcc
540agcggaccca catgcttgaa ttcgaggcct gtggggtgag aaatgctcac
tctgccctcg 600ttgctgaggt acttcaggcc gctgagctca aagtcgatgc
cctgctcgtc tatcagggcc 660tgcacctctg ggctgaccgg ctcagcctcc
ttcgcgggca tggagtaggc gccggcagcg 720ttcatgtccg ggcccagggc
agcggtggtg ccataaatgt cggtgatggt ggggaggggg 780gccgtcgcca
caccattgcc gttgctggct gacgcatgca catgtggcct ggctggcacc
840ggcagcactg gtctccagcc agccagcaag tggctgttca ggaaagcggc
catgttgttg 900gtccctgcgc atgtaattcc ccagatcaaa ggagggaaca
gcttggattt gatgtagtgc 960ccaaccggac tgaatgtgcg atggcaggtc
cctttgagtc tcccgaatta ctagcagggc 1020actgtgacct aacgcagcat
gccaaccgca aaaaaatgat tgacagaaaa tgaagcggtg 1080tgtcaatatt
tgctgtattt attcgtttta atcagcaacc aagttcgaaa cgcaactatc
1140gtggtgatca agtgaacctc atcagactta cctcgttcgg caaggaaacg
gaggcaccaa 1200attccaattt gatattatcg cttgccaagc tagagctgat
ctttgggaaa ccaactgcca 1260gacagtggac tgtgatggag tgccccgagt
ggtggagcct cttcgattcg gttagtcatt 1320actaacgtga accctcagtg
aagggaccat cagaccagaa agaccagatc tcctcctcga 1380caccgagaga
gtgttgcggc agtaggacga caag 141431113DNABotryococcus braunii
3aattggaaac cccgcgcaag accgggttgt ttggccgcct gaccggaaag ggggggcctg
60tcccgaaggg ggtctatctc ttgggggatg tcgggcgcgg aaagtcgatg ttgatggacc
120tcttcttcga ccatgtcggg gtcgaggcca agagccgcgt ccatttcgcc
gagttcatga 180tggaggtgaa tgaccgcatc gccaccgaac gcgccaagaa
gcgggcgacc gatcgccccc 240gtcgctgcag cccttgccga ggaagtccgg
ctgctggcgt tcgacgagat gatggtgacg 300aacagcccgg acgcgatgat
cctgtcgcgg ctgttcaccg cgctgatcga ggcgggggtg 360acgatcgtca
ccacctccaa ccggccgccc agggatctct ataagaacgg gctcaaccgc
420gagcatttcc tgcccttcat cgcgctgatc gaggcgcggc tggacgtgct
ggcgctgaac 480ggcccgaccg actatcggcg cgaccggctg gggcggctgg
acacgtggtt ggtgcccaat 540ggccccaagg cgacgattac cttgtcggcg
gcgttcttcc gcctgaccga ctatccggtc 600gaggatgccg cgcatgtgcc
ctctgaggac ctgaaggtgg gcgggcgcgt gctgaatgtc 660cccaaggcgc
tgaagggcgt cgcggtcttc tcgttcaagc ggttgtgcgg cgaagcgcgg
720ggggcggcgg actatctggc ggtcgcgcgg ggcttccaca ccgtcatcct
ggtcggaatc 780cccaagctgg gggcggagaa ccgcaacgag gcggggcgct
tcgtccagct gatcgacgcg 840ctctacgaac ataaggtcaa gctgctcgcc
gcagccgatg ccagcccgcc gaactctatg 900aaaccggcga cggccggttc
gagtttgagc gcagatcagc cggttggaag agatgcgctc 960cgaggattat
ctggcccaag gccatggctc ggaggggcct tgatcaggcc ttaatgcact
1020tcgcaaccat tatcgtttaa aatcttaaac tctgtggaat aacggttccc
cgacgccgca 1080atacacgtac gtccactacg gagtaggatt gga
11134253DNAChlamydomonas reinhardtii 4cgcttagaag atttcgataa
ggcgccagaa ggagcgcagc caaaccagga tgatgtttga 60tggggtattt gagcacttgc
aacccttatc cggaagcccc ctggcccaca aaggctaggc 120gccaatgcaa
gcagttcgca tgcagcccct ggagcggtgc cctcctgata aaccggccag
180ggggcctatg ttctttactt ttttacaaga gaagtcactc aacatcttaa
acggtcttaa 240gaagtctatc cgg 253522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5tgttgaagaa tgagccggcg ac 22620DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 6cagtgagcta ttacgcactc
207565DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 7tgttgaagaa tgagccggcg acttagaaaa
agtggcgtgg ttaaggaaaa attccgaagc 60cttagcgaaa gcgagtctga atagggcgat
caaatatttt aatatttaca atttagtcat 120tttttctaga cccgaacccg
ggtgatctaa ccatgaccag gatgaaactt gggtgatacc 180aagtgaaggt
ccgaaccgac cgatgttgaa aaatcggcgg atgagttgtg gttagcggtg
240aaataccagt cgaacccgga gctagctggt tctccccgaa atgcgttgag
gcgcagcagt 300acatctagtc tatctagggg taaagcactg tttcggtgcg
ggctgtgaaa acggtaccaa 360atcgtggcaa actctgaata ctagaaatga
cggtgtagta gtgagactgt gggggataag 420ctccattgtc aagagggaaa
cagcccagac caccagctaa ggccccaaaa tggtaatgta 480gtgacaaagg
aggtgaaaat gcaaacacaa ccaggaggtt ggcttagaag cagccatcct
540ttaaagagtg cgtaatagct cactg 5658546DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
8tgttgaagaa tgagccggcg acttagaaaa cgtggcaagg ttaaggaaac gtatccggag
60ccgaagcgaa agcaagtctg aacagggcga ttaagtcatt ttttctagac ccgaacccgg
120gtgatctaac catgaccagg atgaagcttg ggtgacacca agtgaaggtc
cgaaccgacc 180gatgttgaaa aatcggcgga tgagttgtgg ttagcggtga
aataccagtc gaactcggag 240ctagctggtt ctccccgaaa tgcgttgagg
cgcagcggtt cataaggctg tctaggggta 300aagcactgtt tcggtgcggg
ctgcgaaagc ggtaccaaat cgtggcaaac tctgaatact 360agatatgcta
tttatgggcc agtgagacgg tgggggataa gcttcatcgt cgagagggaa
420acagcccaga tcactagcta aggccccaaa atgatcgtta agtgacaaag
gaggtgagaa 480tgcagaaaca accaggaggt ttgcttagaa gcagccaccc
tttaaagagt gcgtaatagc 540tcactg 5469565DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
9tgttgaagaa tgagccggcg acttagaaaa agtggcgtgg ttaaggaaaa attccgaagc
60cttagcgaaa gcgagtctga atagggcgat caaatatttt aatatttaca atttagtcat
120tttttctaga cccgaacccg ggtgatctaa ccatgaccag gatgaaactt
gggtgatacc 180aagtgaaggt ccgaaccgac cgatgttgaa aaatcggcgg
atgagttgtg gttagcggtg 240aaataccagt cgaacccgga gctagctggt
tctccccgaa atgcgttgag gcgcagcagt 300acatctagtc tatctagggg
taaagcactg tttcggtgcg ggctgtgaaa acggtaccaa 360atcgtggcaa
actctgaata ctagaaatga cggtgtagta gtgagactgt gggggataag
420ctccattgtc aagagggaaa cagcccagac caccagctaa ggccccaaaa
tggtaatgta 480gtgacaaagg aggtgaaaat gcaaacacaa ccaggaggtt
ggcttagaag cagccatcct 540ttaaagagtg cgtaatagct cactg
56510565DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 10tgttgaagaa tgagccggcg acttagaaaa
agtggcgtgg ttaaggaaaa attccgaagc 60cttagcgaaa gcgagtctga atagggcgat
caaatatttt aatatttaca atttagtcat 120tttttctaga cccgaacccg
ggtgatctaa ccatgaccag gatgaaactt gggtgatacc 180aagtgaaggt
ccgaaccgac cgatgttgaa aaatcggcgg atgagttgtg gttagcggtg
240aaataccagt cgaacccgga gctagctggt tctccccgaa atgcgttgag
gcgcagcagt 300acatctagtc tatctagggg taaagcactg tttcggtgcg
ggctgtgaaa acggtaccaa 360atcgtggcaa actctgaata ctagaaatga
cggtgtagta gtgagactgt gggggataag 420ctccattgtc aagagggaaa
cagcccagac caccagctaa ggccccaaaa tggtaatgta 480gtgacaaagg
aggtgaaaat gcaaacacaa ccaggaggtt ggcttagaag cagccatcct
540ttaaagagtg cgtaatagct cactg 56511548DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
11tgttgaagaa tgagccggcg acttagaaga agtggcttgg ttaaggataa ctatccggag
60ccagagcgaa agcaagtctg aatagggcgc ttaaaggtca ctttttctag acccgaaccc
120gggtgatcta accatgacca ggatgaagct tgggtaacac cacgtgaagg
tccgaaccga 180ccgatgttga aaaatcggcg gatgagttgt ggttagcggt
gaaataccaa tcgaactcgg 240agctagctgg ttctccccga aatgcgttga
ggcgcagcgg tttatgaggc tgtctagggg 300taaagcactg tttcggtgcg
ggctgcgaaa gcggtaccaa atcgtggcaa actctgaata 360ctagatatgc
tattcatgag ccagtgagac ggtgggggat aagcttcatc gtcaagaggg
420aaacagccca gatcaccagc taaggcccca aaatggtcgt taagtggcaa
aggaggtgag 480aatgctgaaa caaccaggag gtttgcttag aagcagccac
cctttaaaga gtgcgtaata 540gctcactg 54812548DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
12tgttgaagaa tgagccggcg acttagaaga agtggcttgg ttaaggataa ctatccggag
60ccagagcgaa agcaagtctg aatagggcgc ttaaaggtca ctttttctag acccgaaccc
120gggtgatcta accatgacca ggatgaagct tgggtaacac cacgtgaagg
tccgaaccga 180ccgatgttga aaaatcggcg gatgagttgt ggttagcggt
gaaataccaa tcgaactcgg 240agctagctgg ttctccccga aatgcgttga
ggcgcagcgg tttatgaggc tgtctagggg 300taaagcactg tttcggtgcg
ggctgcgaaa gcggtaccaa atcgtggcaa actctgaata 360ctagatatgc
tattcatgag ccagtgagac ggtgggggat aagcttcatc gtcaagaggg
420aaacagccca gatcaccagc taaggcccca aaatggtcgt taagtggcaa
aggaggtgag 480aatgctgaaa caaccaggag gtttgcttag aagcagccac
cctttaaaga gtgcgtaata 540gctcactg 54813548DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
13tgttgaagaa tgagccggcg acttagaaga agtggcttgg ttaaggataa ctatccggag
60ccagagcgaa agcaagtctg aatagggcgc ttaaaggtca ctttttctag acccgaaccc
120gggtgatcta accatgacca ggatgaagct tgggtaacac cacgtgaagg
tccgaaccga 180ccgatgttga aaaatcggcg gatgagttgt ggttagcggt
gaaataccaa tcgaactcgg 240agctagctgg ttctccccga aatgcgttga
ggcgcagcgg tttatgaggc tgtctagggg 300taaagcactg tttcggtgcg
ggctgcgaaa gcggtaccaa atcgtggcaa actctgaata 360ctagatatgc
tattcatgag ccagtgagac ggtgggggat aagcttcatc gtcaagaggg
420aaacagccca gatcaccagc taaggcccca aaatggtcgt taagtggcaa
aggaggtgag 480aatgctgaaa caaccaggag gtttgcttag aagcagccac
cctttaaaga gtgcgtaata 540gctcactg 54814548DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
14tgttgaagaa tgagccggcg acttagaaga agtggcttgg ttaaggataa ctatccggag
60ccagagcgaa agcaagtctg aatagggcgc ttaaaggtca ctttttctag acccgaaccc
120gggtgatcta accatgacca ggatgaagct tgggtaacac cacgtgaagg
tccgaaccga 180ccgatgttga aaaatcggcg gatgagttgt ggttagcggt
gaaataccaa tcgaactcgg 240agctagctgg ttctccccga aatgcgttga
ggcgcagcgg tttatgaggc tgtctagggg 300taaagcactg tttcggtgcg
ggctgcgaaa gcggtaccaa atcgtggcaa actctgaata 360ctagatatgc
tattcatgag ccagtgagac ggtgggggat aagcttcatc gtcaagaggg
420aaacagccca gatcaccagc taaggcccca aaatggtcgt taagtggcaa
aggaggtgag 480aatgctgaaa caaccaggag gtttgcttag aagcagccac
cctttaaaga gtgcgtaata 540gctcactg 54815565DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
15tgttgaagaa tgagccggcg acttagaaaa agtggcgtgg ttaaggaaaa attccgaagc
60cttagcgaaa gcgagtctga atagggcgat caaatatttt aatatttaca atttagtcat
120tttttctaga cccgaacccg ggtgatctaa ccatgaccag gatgaaactt
gggtgatacc 180aagtgaaggt ccgaaccgac cgatgttgaa aaatcggcgg
atgagttgtg gttagcggtg 240aaataccagt cgaacccgga gctagctggt
tctccccgaa atgcgttgag gcgcagcagt 300acatctagtc tatctagggg
taaagcactg tttcggtgcg ggctgtgaaa acggtaccaa 360atcgtggcaa
actctgaata ctagaaatga cggtgtagta gtgagactgt gggggataag
420ctccattgtc aagagggaaa cagcccagac caccagctaa ggccccaaaa
tggtaatgta 480gtgacaaagg aggtgaaaat gcaaacacaa ccaggaggtt
ggcttagaag cagccatcct 540ttaaagagtg cgtaatagct cactg
56516541DNAPrototheca stagnora 16tgttgaagaa tgagccggcg agttaaaaaa
aatggcatgg ttaaagatat ttctctgaag 60ccatagcgaa agcaagtttt acaagctata
gtcatttttt ttagacccga aaccgagtga 120tctacccatg atcagggtga
agtgttggtc aaataacatg gaggcccgaa ccgactaatg 180gtgaaaaatt
agcggatgaa ttgtgggtag gggcgaaaaa ccaatcgaac tcggagttag
240ctggttctcc ccgaaatgcg tttaggcgca gcagtagcaa cacaaataga
ggggtaaagc 300actgtttctt ttgtgggctt cgaaagttgt acctcaaagt
ggcaaactct gaatactcta 360tttagatatc tactagtgag accttggggg
ataagctcct tggtcaaaag ggaaacagcc 420cagatcacca gttaaggccc
caaaatgaaa atgatagtga ctaaggacgt gagtatgtca 480aaacctccag
caggttagct tagaagcagc aatcctttca agagtgcgta atagctcact 540g
54117573DNAPrototheca moriformis 17tgttgaagaa tgagccggcg acttaaaata
aatggcaggc taagagaatt aataactcga 60aacctaagcg aaagcaagtc ttaatagggc
gctaatttaa caaaacatta aataaaatct 120aaagtcattt attttagacc
cgaacctgag tgatctaacc atggtcagga tgaaacttgg 180gtgacaccaa
gtggaagtcc gaaccgaccg atgttgaaaa atcggcggat gaactgtggt
240tagtggtgaa ataccagtcg aactcagagc tagctggttc tccccgaaat
gcgttgaggc 300gcagcaatat atctcgtcta tctaggggta aagcactgtt
tcggtgcggg ctatgaaaat 360ggtaccaaat cgtggcaaac tctgaatact
agaaatgacg atatattagt gagactatgg 420gggataagct ccatagtcga
gagggaaaca gcccagacca ccagttaagg ccccaaaatg 480ataatgaagt
ggtaaaggag gtgaaaatgc aaatacaacc aggaggttgg cttagaagca
540gccatccttt aaagagtgcg taatagctca ctg 57318573DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
18tgttgaagaa tgagccggcg acttaaaata aatggcaggc taagagaatt aataactcga
60aacctaagcg aaagcaagtc ttaatagggc gctaatttaa caaaacatta aataaaatct
120aaagtcattt attttagacc cgaacctgag tgatctaacc atggtcagga
tgaaacttgg 180gtgacaccaa gtggaagtcc gaaccgaccg atgttgaaaa
atcggcggat gaactgtggt 240tagtggtgaa ataccagtcg aactcagagc
tagctggttc tccccgaaat gcgttgaggc 300gcagcaatat atctcgtcta
tctaggggta aagcactgtt tcggtgcggg ctatgaaaat 360ggtaccaaat
cgtggcaaac tctgaatact agaaatgacg atatattagt gagactatgg
420gggataagct ccatagtcga gagggaaaca gcccagacca ccagttaagg
ccccaaaatg 480ataatgaagt ggtaaaggag gtgaaaatgc aaatacaacc
aggaggttgg cttagaagca 540gccatccttt aaagagtgcg taatagctca ctg
57319565DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 19tgttgaagaa tgagccggcg acttagaaaa
agtggcgtgg ttaaggaaaa attccgaagc 60cttagcgaaa gcgagtctga atagggcgat
caaatatttt aatatttaca atttagtcat 120tttttctaga cccgaacccg
ggtgatctaa ccatgaccag gatgaaactt gggtgatacc 180aagtgaaggt
ccgaaccgac cgatgttgaa aaatcggcgg atgagttgtg gttagcggtg
240aaataccagt cgaacccgga gctagctggt tctccccgaa atgcgttgag
gcgcagcagt 300acatctagtc tatctagggg taaagcactg tttcggtgcg
ggctgtgaaa acggtaccaa 360atcgtggcaa actctgaata ctagaaatga
cggtgtagta gtgagactgt gggggataag 420ctccattgtc aagagggaaa
cagcccagac caccagctaa ggccccaaaa tggtaatgta 480gtgacaaagg
aggtgaaaat gcaaacacaa ccaggaggtt ggcttagaag cagccatcct
540ttaaagagtg cgtaatagct cactg 56520565DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
20tgttgaagaa tgagccggcg acttagaaaa agtggcgtgg ttaaggaaaa attccgaagc
60cttagcgaaa gcgagtctga atagggcgat caaatatttt aatatttaca atttagtcat
120tttttctaga cccgaacccg ggtgatctaa ccatgaccag gatgaaactt
gggtgatacc 180aagtgaaggt ccgaaccgac cgatgttgaa aaatcggcgg
atgagttgtg gttagcggtg 240aaataccagt cgaacccgga gctagctggt
tctccccgaa atgcgttgag gcgcagcagt 300acatctagtc tatctagggg
taaagcactg tttcggtgcg ggctgtgaaa acggtaccaa 360atcgtggcaa
actctgaata ctagaaatga cggtgtagta gtgagactgt gggggataag
420ctccattgtc aagagggaaa cagcccagac caccagctaa ggccccaaaa
tggtaatgta 480gtgacaaagg aggtgaaaat gcaaacacaa ccaggaggtt
ggcttagaag cagccatcct 540ttaaagagtg cgtaatagct cactg
56521546DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 21tgttgaagaa tgagccggcg acttagaaaa
cgtggcaagg ttaaggacat gtatccggag 60ccgaagcgaa agcaagtctg aatagggcgc
ctaagtcatt ttttctagac ccgaacccgg 120gtgatctaac catgaccagg
atgaagcttg ggtgacacca agtgaaggtc cgaaccgacc 180gatgttgaaa
aatcggcgga tgagttgtgg ttagcggtga aataccagtc gaactcggag
240ctagctggtt ctccccgaaa tgcgttgagg cgcagcggtt cataaggctg
tctaggggta 300aagcactgtt tcggtgcggg ctgcgaaagc ggtaccaaat
cgtggcaaac tctgaatact 360agatatgcta tttatgagcc agtgagacgg
tgggggataa gcttcatcgt cgagagggaa 420acagcccaga tcactagcta
aggcccctaa atgatcgtta agtgacaaag gaggtgagaa 480tgcagaaaca
accaggaggt ttgcttagaa gcagccaccc tttaaagagt gcgtaatagc 540tcactg
54622550DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 22tgttgaagaa tgagccggcg acttatagga
agtggcaggg ttaaggaaga atctccggag 60cccaagcgaa agcgagtctg aaaagggcga
tttggtcact tcttatggac ccgaacctgg 120atgatctaat catggccaag
ttgaagcatg ggtaacacta tgtcgaggac tgaacccacc 180gatgttgaaa
aatcggggga tgagctgtga ttagcggtga aattccaatc gaattcagag
240ctagctggat ctccccgaaa tgcgttgagg cgcagcggcg acgatgtcct
gtctaagggt 300agagcgactg tttcggtgcg ggctgcgaaa
gcggtaccaa gtcgtggcaa actccgaata 360ttaggcaaag gattccgtga
gccagtgaga ctgtggggga taagcttcat agtcaagagg 420gaaacagccc
agaccatcag ctaaggcccc taaatggctg ctaagtggaa aaggatgtga
480gaatgctgaa acaaccagga ggttcgctta gaagcagcta ttccttgaaa
gagtgcgtaa 540tagctcactg 55023548DNAArtificial SequenceDescription
of Artificial Sequence Synthetic polynucleotide 23tgttgaagaa
tgagccggcg acttagaaga agtggcttgg ttaaggataa ctatccggag 60ccagagcgaa
agcaagtctg aatagggcgc ttaaaggtca ctttttctag acccgaaccc
120gggtgatcta accatgacca ggatgaagct tgggtaacac cacgtgaagg
tccgaaccga 180ccgatgttga aaaatcggcg gatgagttgt ggttagcggt
gaaataccaa tcgaactcgg 240agctagctgg ttctccccga aatgcgttga
ggcgcagcgg tttatgaggc tgtctagggg 300taaagcactg tttcggtgcg
ggctgcgaaa gcggtaccaa atcgtggcaa actctgaata 360ctagatatgc
tattcatgag ccagtgagac ggtgggggat aagcttcatc gtcaagaggg
420aaacagccca gatcaccagc taaggcccca aaatggtcgt taagtggcaa
aggaggtgag 480aatgctgaaa caaccaggag gtttgcttag aagcagccac
cctttaaaga gtgcgtaata 540gctcactg 54824556DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
24tgttgaagaa tgagccggcg acttataggg ggtggcgtgg ttaaggaagt aatccgaagc
60caaagcgaaa gcaagttttc aatagagcga ttttgtcacc ccttatggac ccgaacccgg
120gtgatctaac cttgaccagg atgaagcttg ggtaacacca agtgaaggtc
cgaactcatc 180gatcttgaaa aatcgtggga tgagttgggg ttagttggtt
aaatgctaat cgaactcgga 240gctagctggt tctccccgaa atgtgttgag
gcgcagcgat taacgaaata ttttgtacgg 300tttaggggta aagcactgtt
tcggtgcggg ctgcgaaagc ggtaccaaat cgtggcaaac 360tctgaatact
aagcctgtat accgttagtc agtgagagta taggggataa gctctatact
420caagagggaa acagcccaga tcaccagcta aggccccaaa atgacagcta
agtggcaaag 480gaggtgaaag tgcagaaaca accaggaggt tcgcttagaa
gcagcaaccc tttaaagagt 540gcgtaatagc tcactg 55625548DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
25tgttgaagaa tgagccggcg acttagaaga agtggcttgg ttaaggataa ctatccggag
60ccagagcgaa agcaagtctg aatagggcgc ttaaaggtca ctttttctag acccgaaccc
120gggtgatcta accatgacca ggatgaagct tgggtaacac cacgtgaagg
tccgaaccga 180ccgatgttga aaaatcggcg gatgagttgt ggttagcggt
gaaataccaa tcgaactcgg 240agctagctgg ttctccccga aatgcgttga
ggcgcagcgg tttatgaggc tgtctagggg 300taaagcactg tttcggtgcg
ggctgcgaaa gcggtaccaa atcgtggcaa actctgaata 360ctagatatgc
tattcatgag ccagtgagac ggtgggggat aagcttcatc gtcaagaggg
420aaacagccca gatcaccagc taaggcccca aaatggtcgt taagtggcaa
aggaggtgag 480aatgctgaaa caaccaggag gtttgcttag aagcagccac
cctttaaaga gtgcgtaata 540gctcactg 54826565DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
26tgttgaagaa tgagccggcg acttagaaaa agtggcgtgg ttaaggaaaa attccgaagc
60cttagcgaaa gcgagtctga atagggcgat caaatatttt aatatttaca atttagtcat
120tttttctaga cccgaacccg ggtgatctaa ccatgaccag gatgaaactt
gggtgatacc 180aagtgaaggt ccgaaccgac cgatgttgaa aaatcggcgg
atgagttgtg gttagcggtg 240aaataccagt cgaacccgga gctagctggt
tctccccgaa atgcgttgag gcgcagcagt 300acatctagtc tatctagggg
taaagcactg tttcggtgcg ggctgtgaaa acggtaccaa 360atcgtggcaa
actctgaata ctagaaatga cggtgtagta gtgagactgt gggggataag
420ctccattgtc aagagggaaa cagcccagac caccagctaa ggccccaaaa
tggtaatgta 480gtgacaaagg aggtgaaaat gcaaacacaa ccaggaggtt
ggcttagaag cagccatcct 540ttaaagagtg cgtaatagct cactg
56527573DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 27tgttgaagaa tgagccggcg acttataggg
ggtggcttgg ttaaggacta caatccgaag 60cccaagcgaa agcaagtttg aagtgtacac
acattgtgtg tctagagcga ttttgtcact 120ccttatggac ccgaacccgg
gtgatctatt catggccagg atgaagcttg ggtaacacca 180agtgaaggtc
cgaactcatc gatgttgaaa aatcgtggga tgagttgtga ataggggtga
240aatgccaatc gaactcggag ctagctggtt ctccccgaaa tgtgttgagg
cgcagcgatt 300cacgatctaa agtacggttt aggggtaaag cactgtttcg
gtgcgggctg ttaacgcggt 360accaaatcgt ggcaaactaa gaatactaaa
cttgtatgcc gtgaatcagt gagactaaga 420gggataagct tcttagtcaa
gagggaaaca gcccagatca ccagctaagg ccccaaaatg 480acagctaagt
ggcaaaggag gtgagagtgc agaaacaacc aggaggtttg cttagaagca
540gccatccttt aaagagtgcg taatagctca ctg 57328573DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
28tgttgaagaa tgagccggcg acttataggg ggtggcttgg ttaaggacta caatccgaag
60cccaagcgaa agcaagtttg aagtgtacac acgttgtgtg tctagagcga ttttgtcact
120ccttatggac ccgaacccgg gtgatctatt catggccagg atgaagcttg
ggtaacacca 180agtgaaggtc cgaactcatc gatgttgaaa aatcgtggga
tgagttgtga ataggggtga 240aatgccaatc gaactcggag ctagctggtt
ctccccgaaa tgtgttgagg cgcagcgatt 300cacgatctaa agtacggttt
aggggtaaag cactgtttcg gtgcgggctg ttaacgcggt 360accaaatcgt
ggcaaactaa gaatactaaa cttgtatgcc gtgaatcagt gagactaaga
420gggataagct tcttagtcaa gagggaaaca gcccagatca ccagctaagg
ccccaaaatg 480acagctaagt ggcaaaggag gtgagagtgc agaaacaacc
aggaggtttg cttagaagca 540gccatccttt aaagagtgcg taatagctca ctg
57329573DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 29tgttgaagaa tgagccggcg acttataggg
ggtggcttgg ttaaggacta caatccgaag 60cccaagcgaa agcaagtttg aagtgtacac
acattgtgtg tctagagcga ttttgtcact 120ccttatggac ccgaacccgg
gtgatctatt catggccagg atgaagcttg ggtaacacca 180agtgaaggtc
cgaactcatc gatgttgaaa aatcgtggga tgagttgtga ataggggtga
240aatgccaatc gaactcggag ctagctggtt ctccccgaaa tgtgttgagg
cgcagcgatt 300cacgatctaa agtacggttt aggggtaaag cactgtttcg
gtgcgggctg ttaacgcggt 360accaaatcgt ggcaaactaa gaatactaaa
cttgtatgcc gtgaatcagt gagactaaga 420gggataagct tcttagtcaa
gagggaaaca gcccagatca ccagctaagg ccccaaaatg 480acagctaagt
ggcaaaggag gtgagagtgc agaaacaacc aggaggtttg cttagaagca
540gccatccttt aaagagtgcg taatagctca ctg 57330546DNAChlorella
protothecoides 30tgttgaagaa tgagccggcg acttagaaaa cgtggcaagg
ttaaggaaac gtatccggag 60ccgaagcgaa agcaagtctg aacagggcga ttaagtcatt
ttttctagac ccgaacccgg 120gtgatctaac catgaccagg atgaagcttg
ggtgacacca agtgaaggtc cgaaccgacc 180gatgttgaaa aatcggcgga
tgagttgtgg ttagcggtga aataccagtc gaactcggag 240ctagctggtt
ctccccgaaa tgcgttgagg cgcagcggtt cataaggctg tctaggggta
300aagcactgtt tcggtgcggg ctgcgaaagc ggtaccaaat cgtggcaaac
tctgaatact 360agatatgcta tttatgggcc agtgagacgg tgggggataa
gcttcatcgt cgagagggaa 420acagcccaga tcactagcta aggccccaaa
atgatcgtta agtgacaaag gaggtgagaa 480tgcagaaaca accaggaggt
ttgcttagaa gcagccaccc tttaaagagt gcgtaatagc 540tcactg
54631565DNAChlorella protothecoides 31tgttgaagaa tgagccggcg
acttagaaaa agtggcgtgg ttaaggaaaa attccgaagc 60cttagcgaaa gcgagtctga
atagggcgat caaatatttt aatatttaca atttagtcat 120tttttctaga
cccgaacccg ggtgatctaa ccatgaccag gatgaaactt gggtgatacc
180aagtgaaggt ccgaaccgac cgatgttgaa aaatcggcgg atgagttgtg
gttagcggtg 240aaataccagt cgaacccgga gctagctggt tctccccgaa
atgcgttgag gcgcagcagt 300acatctagtc tatctagggg taaagcactg
tttcggtgcg ggctgtgaaa acggtaccaa 360atcgtggcaa actctgaata
ctagaaatga cggtgtagta gtgagactgt gggggataag 420ctccattgtc
aagagggaaa cagcccagac caccagctaa ggccccaaaa tggtaatgta
480gtgacaaagg aggtgaaaat gcaaacacaa ccaggaggtt ggcttagaag
cagccatcct 540ttaaagagtg cgtaatagct cactg 56532565DNAPrototheca
moriformis 32tgttgaagaa tgagccggcg acttagaaaa ggtggcatgg ttaaggaaat
attccgaagc 60cgtagcaaaa gcgagtctga atagggcgat aaaatatatt aatatttaga
atctagtcat 120tttttctaga cccgaacccg ggtgatctaa ccatgaccag
gatgaagctt gggtgatacc 180aagtgaaggt ccgaaccgac cgatgttgaa
aaatcggcgg atgagttgtg gttagcggtg 240aaataccagt cgaacccgga
gctagctggt tctccccgaa atgcgttgag gcgcagcagt 300acatctagtc
tatctagggg taaagcactg tttcggtgcg ggctgtgaga acggtaccaa
360atcgtggcaa actctgaata ctagaaatga cgatgtagta gtgagactgt
gggggataag 420ctccattgtc aagagggaaa cagcccagac caccagctaa
ggccccaaaa tggtaatgta 480gtgacaaagg aggtgaaaat gcaaatacaa
ccaggaggtt ggcttagaag cagccatcct 540ttaaagagtg cgtaatagct cactg
56533573DNAPrototheca moriformis 33tgttgaagaa tgagccggcg acttaaaata
aatggcaggc taagagaatt aataactcga 60aacctaagcg aaagcaagtc ttaatagggc
gctaatttaa caaaacatta aataaaatct 120aaagtcattt attttagacc
cgaacctgag tgatctaacc atggtcagga tgaaacttgg 180gtgacaccaa
gtggaagtcc gaaccgaccg atgttgaaaa atcggcggat gaactgtggt
240tagtggtgaa ataccagtcg aactcagagc tagctggttc tccccgaaat
gcgttgaggc 300gcagcaatat atctcgtcta tctaggggta aagcactgtt
tcggtgcggg ctatgaaaat 360ggtaccaaat cgtggcaaac tctgaatact
agaaatgacg atatattagt gagactatgg 420gggataagct ccatagtcga
gagggaaaca gcccagacca ccagttaagg ccccaaaatg 480ataatgaagt
ggtaaaggag gtgaaaatgc aaatacaacc aggaggttgg cttagaagca
540gccatccttt aaagagtgcg taatagctca ctg 57334541DNAPrototheca
kruegani 34tgttgaagaa tgagccggcg agttaaaaag agtggcatgg ttaaagaaaa
tactctggag 60ccatagcgaa agcaagttta gtaagcttag gtcattcttt ttagacccga
aaccgagtga 120tctacccatg atcagggtga agtgttagta aaataacatg
gaggcccgaa ccgactaatg 180ttgaaaaatt agcggatgaa ttgtgggtag
gggcgaaaaa ccaatcgaac tcggagttag 240ctggttctcc ccgaaatgcg
tttaggcgca gcagtagcag tacaaataga ggggtaaagc 300actgtttctt
ttgtgggctt cgaaagttgt acctcaaagt ggcaaactct gaatactcta
360tttagatatc tactagtgag accttggggg ataagctcct tggtcaaaag
ggaaacagcc 420cagatcacca gttaaggccc caaaatgaaa atgatagtga
ctaaggatgt gggtatgtca 480aaacctccag caggttagct tagaagcagc
aatcctttca agagtgcgta atagctcact 540g 54135573DNAPrototheca
wickerhamii 35tgttgaagaa tgagccggcg acttaaaata aatggcaggc
taagagattt aataactcga 60aacctaagcg aaagcaagtc ttaatagggc gtcaatttaa
caaaacttta aataaattat 120aaagtcattt attttagacc cgaacctgag
tgatctaacc atggtcagga tgaaacttgg 180gtgacaccaa gtggaagtcc
gaaccgaccg atgttgaaaa atcggcggat gaactgtggt 240tagtggtgaa
ataccagtcg aactcagagc tagctggttc tccccgaaat gcgttgaggc
300gcagcaatat atctcgtcta tctaggggta aagcactgtt tcggtgcggg
ctatgaaaat 360ggtaccaaat cgtggcaaac tctgaatact agaaatgacg
atatattagt gagactatgg 420gggataagct ccatagtcga gagggaaaca
gcccagacca ccagttaagg ccccaaaatg 480ataatgaagt ggtaaaggag
gtgaaaatgc aaatacaacc aggaggttgg cttagaagca 540gccatccttt
aaagagtgcg taatagctca ctg 57336541DNAPrototheca moriformis
36tgttgaagaa tgagccggcg agttaaaaag agtggcatgg ttaaagataa ttctctggag
60ccatagcgaa agcaagttta acaagctaaa gtcacccttt ttagacccga aaccgagtga
120tctacccatg atcagggtga agtgttggta aaataacatg gaggcccgaa
ccgactaatg 180gtgaaaaatt agcggatgaa ttgtgggtag gggcgaaaaa
ccaatcgaac tcggagttag 240ctggttctcc ccgaaatgcg tttaggcgca
gcagtagcaa cacaaataga ggggtaaagc 300actgtttctt ttgtgggctt
cgaaagttgt acctcaaagt ggcaaactct gaatactcta 360tttagatatc
tactagtgag accttggggg ataagctcct tggtcaaaag ggaaacagcc
420cagatcacca gttaaggccc caaaatgaaa atgatagtga ctaaggatgt
gggtatgtta 480aaacctccag caggttagct tagaagcagc aatcctttca
agagtgcgta atagctcact 540g 54137573DNAPrototheca wickerhamii
37tgttgaagaa tgagccgtcg acttaaaata aatggcaggc taagagaatt aataactcga
60aacctaagcg aaagcaagtc ttaatagggc gctaatttaa caaaacatta aataaaatct
120aaagtcattt attttagacc cgaacctgag tgatctaacc atggtcagga
tgaaacttgg 180gtgacaccaa gtggaagtcc gaaccgaccg atgttgaaaa
atcggcggat gaactgtggt 240tagtggtgaa ataccagtcg aactcagagc
tagctggttc tccccgaaat gcgttgaggc 300gcagcaatat atctcgtcta
tctaggggta aagcactgtt tcggtgcggg ctatgaaaat 360ggtaccaaat
cgtggcaaac tctgaatact agaaatgacg atatattagt gagactatgg
420gggataagct ccatagtcga gagggaaaca gcccagacca ccagttaagg
ccccaaaatg 480ataatgaagt ggtaaaggag gtgaaaatgc aaatacaacc
aggaggttgg cttagaagca 540gccatccttt aaagagtgcg taatagctca ctg
57338541DNAPrototheca moriformis 38tgttgaagaa tgagccggcg agttaaaaag
agtggcgtgg ttaaagaaaa ttctctggaa 60ccatagcgaa agcaagttta acaagcttaa
gtcacttttt ttagacccga aaccgagtga 120tctacccatg atcagggtga
agtgttggta aaataacatg gaggcccgaa ccgactaatg 180gtgaaaaatt
agcggatgaa ttgtgggtag gggcgaaaaa ccaatcgaac tcggagttag
240ctggttctcc ccgaaatgcg tttaggcgca gcagtagcaa cacaaataga
ggggtaaagc 300actgtttctt ttgtgggctc cgaaagttgt acctcaaagt
ggcaaactct gaatactcta 360tttagatatc tactagtgag accttggggg
ataagctcct tggtcgaaag ggaaacagcc 420cagatcacca gttaaggccc
caaaatgaaa atgatagtga ctaaggatgt gagtatgtca 480aaacctccag
caggttagct tagaagcagc aatcctttca agagtgcgta atagctcact 540g
54139541DNAPrototheca zopfii 39tgttgaagaa tgagccggcg agttaaaaag
agtggcatgg ttaaagaaaa ttctctggag 60ccatagcgaa agcaagttta acaagcttaa
gtcacttttt ttagacccga aaccgagtga 120tctacccatg atcagggtga
agtgttggta aaataacatg gaggcccgaa ccgactaatg 180gtgaaaaatt
agcggatgaa ttgtgggtag gggcgaaaaa ccaatcgaac tcggagttag
240ctggttctcc ccgaaatgcg tttaggcgca gcagtagcaa cacaaataga
ggggtaaagc 300actgtttctt tcgtgggctt cgaaagttgt acctcaaagt
ggcaaactct gaatactcta 360tttagatatc tactagtgag accttggggg
ataagctcct tggtcaaaag ggaaacagcc 420cagatcacca gttaaggccc
caaaatgaaa atgatagtga ctaaggatgt gagtatgtca 480aaacctccag
caggttagct tagaagcagc aatcctttca agagtgcgta atagctcact 540g
5414039PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 40Met Thr Phe Gly Val Ala Leu Pro Ala Met Gly
Arg Gly Val Ser Leu 1 5 10 15 Pro Arg Pro Arg Val Ala Val Arg Ala
Gln Ser Ala Ser Gln Val Leu 20 25 30 Glu Ser Gly Arg Ala Gln Leu 35
4140PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 41Met Ala Ile Lys Thr Asn Arg Gln Pro Val Glu
Lys Pro Pro Phe Thr 1 5 10 15 Ile Gly Thr Leu Arg Lys Ala Ile Pro
Ala His Cys Phe Glu Arg Ser 20 25 30 Ala Leu Arg Gly Arg Ala Gln
Leu 35 40 4236PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 42Met Ala Ser Ala Ala Phe Thr Met
Ser Ala Cys Pro Ala Met Thr Gly 1 5 10 15 Arg Ala Pro Gly Ala Arg
Arg Ser Gly Arg Pro Val Ala Thr Arg Leu 20 25 30 Arg Gly Arg Ala 35
4340PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 43Met Ala Thr Ala Ser Thr Phe Ser Ala Phe Asn
Ala Arg Cys Gly Asp 1 5 10 15 Leu Arg Arg Ser Ala Gly Ser Gly Pro
Arg Arg Pro Ala Arg Pro Leu 20 25 30 Pro Val Arg Gly Arg Ala Gln
Leu 35 40 4487PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 44Met Val Ala Ala Ala Ala Ser Ser
Ala Phe Phe Pro Val Pro Ala Pro 1 5 10 15 Gly Ala Ser Pro Lys Pro
Gly Lys Phe Gly Asn Trp Pro Ser Ser Leu 20 25 30 Ser Pro Ser Phe
Lys Pro Lys Ser Ile Pro Asn Gly Gly Phe Gln Val 35 40 45 Lys Ala
Asn Asp Ser Ala His Pro Lys Ala Asn Gly Ser Ala Val Ser 50 55 60
Leu Lys Ser Gly Ser Leu Asn Thr Gln Glu Asp Thr Ser Ser Ser Pro 65
70 75 80 Pro Pro Arg Thr Phe Leu His 85 4560PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
45Met Ala Thr Thr Ser Leu Ala Ser Ala Phe Cys Ser Met Lys Ala Val 1
5 10 15 Met Leu Ala Arg Asp Gly Arg Gly Met Lys Pro Arg Ser Ser Asp
Leu 20 25 30 Gln Leu Arg Ala Gly Asn Ala Pro Thr Ser Leu Lys Met
Ile Asn Gly 35 40 45 Thr Lys Phe Ser Tyr Thr Glu Ser Leu Lys Arg
Leu 50 55 60 4660PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 46Met Ala Thr Thr Ser Leu Ala Ser
Ala Phe Cys Ser Met Lys Ala Val 1 5 10 15 Met Leu Ala Arg Asp Gly
Arg Gly Met Lys Pro Arg Ser Ser Asp Leu 20 25 30 Gln Leu Arg Ala
Gly Asn Ala Gln Thr Ser Leu Lys Met Ile Asn Gly 35 40 45 Thr Lys
Phe Ser Tyr Thr Glu Ser Leu Lys Lys Leu 50 55 60 4750DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
47tgacctaggt gattaattaa ctcgaggcag cagcagctcg gatagtatcg
504845DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 48ctacgagctc aagctttcca tttgtgttcc catcccacta
cttcc 45491568DNAArtificial SequenceDescription of Artificial
Sequence Synthetic polynucleotide 49gaattccttt cttgcgctat
gacacttcca gcaaaaggta gggcgggctg cgagacggct 60tcccggcgct gcatgcaaca
ccgatgatgc ttcgaccccc cgaagctcct tcggggctgc 120atgggcgctc
cgatgccgct ccagggcgag cgctgtttaa atagccaggc ccccgattgc
180aaagacatta tagcgagcta ccaaagccat attcaaacac ctagatcact
accacttcta 240cacaggccac tcgagcttgt gatcgcactc cgctaagggg
gcgcctcttc ctcttcgttt 300cagtcacaac ccgcaaacgg cgcgccatat
caatgattga acaagatgga ttgcacgcag 360gttctccggc cgcttgggtg
gagaggctat tcggctatga ctgggcacaa cagacaatcg 420gctgctctga
tgccgccgtg ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca
480agaccgacct gtccggtgcc ctgaatgaac tgcaggacga ggcagcgcgg
ctatcgtggc 540tggccacgac gggcgttcct tgcgcagctg tgctcgacgt
tgtcactgaa gcgggaaggg 600actggctgct attgggcgaa gtgccggggc
aggatctcct gtcatctcac cttgctcctg 660ccgagaaagt atccatcatg
gctgatgcaa tgcggcggct gcatacgctt gatccggcta 720cctgcccatt
cgaccaccaa gcgaaacatc gcatcgagcg agcacgtact cggatggaag
780ccggtcttgt cgatcaggat gatctggacg aagagcatca ggggctcgcg
ccagccgaac 840tgttcgccag gctcaaggcg cgcatgcccg acggcgagga
tctcgtcgtg acccatggcg 900atgcctgctt gccgaatatc atggtggaaa
atggccgctt ttctggattc atcgactgtg 960gccggctggg tgtggcggac
cgctatcagg acatagcgtt ggctacccgt gatattgctg 1020aagagcttgg
cggcgaatgg gctgaccgct tcctcgtgct ttacggtatc gccgctcccg
1080attcgcagcg catcgccttc tatcgccttc ttgacgagtt cttctaagat
ctgtcgatcg 1140acaagtgact cgaggcagca gcagctcgga tagtatcgac
acactctgga cgctggtcgt 1200gtgatggact gttgccgcca cacttgctgc
cttgacctgt gaatatccct gccgctttta 1260tcaaacagcc tcagtgtgtt
tgatcttgtg tgtacgcgct tttgcgagtt gctagctgct 1320tgtgctattt
gcgaatacca cccccagcat ccccttccct cgtttcatat cgcttgcatc
1380ccaaccgcaa cttatctacg ctgtcctgct atccctcagc gctgctcctg
ctcctgctca 1440ctgcccctcg cacagccttg gtttgggctc cgcctgtatt
ctcctggtac tgcaacctgt 1500aaaccagcac tgcaatgctg atgcacggga
agtagtggga tgggaacaca aatggaaagc 1560ttgagctc
1568502571DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 50gaattccgcc tgcaacgcaa gggcagccac
agccgctccc acccgccgct gaaccgacac 60gtgcttgggc gcctgccgcc tgcctgccgc
atgcttgtgc tggtgaggct gggcagtgct 120gccatgctga ttgaggcttg
gttcatcggg tggaagctta tgtgtgtgct gggcttgcat 180gccgggcaat
gcgcatggtg gcaagagggc ggcagcactt gctggacgtg ccgcggtgcc
240tccaggtggt tcaatcgcgg cagccagagg gatttcagat gatcgcgcgt
acaggttgag 300cagcagtgtc agcaaaggta gcagtttgcc agaatgatcg
gttcagctgt taatcaatgc 360cagcaagaga aggggtcaag tgcaaacacg
ggcatgccac agcacgggca ccggggagtg 420gaatggcacc accaagtgtg
tgcgagccag catcgccgcc tggctgtttc agctacaacg 480gcaggagtca
tccaactaac catagctgat caacactgca atcatcggcg gctgatgcaa
540gcatcctgca agacacatgc tgtgcgatgc tgcgctgctg cctgctgcgc
acgccgttga 600gttggcagca gctcagccat gcactggatc aggctgggct
gccactgcaa tgtggtggat 660aggatgcaag tggagcgaat accaaaccct
ctggctgctt gctgggttgc atggcatcgc 720accatcagca ggagcgcatg
cgaagggact ggccccatgc acgccatgcc aaaccggagc 780gcaccgagtg
tccacactgt caccaggccc gcaagctttg cagaaccatg ctcatggacg
840catgtagcgc tgacgtccct tgacggcgct cctctcgggt gtgggaaacg
caatgcagca 900caggcagcag aggcggcggc agcagagcgg cggcagcagc
ggcgggggcc acccttcttg 960cggggtcgcg ccccagccag cggtgatgcg
ctgatcnnnc caaacgagtt cacattcatt 1020tgcagcctgg agaagcgagg
ctggggcctt tgggctggtg cagcccgcaa tggaatgcgg 1080gaccgccagg
ctagcagcaa aggcgcctcc cctactccgc atcgatgttc catagtgcat
1140tggactgcat ttgggtgggg cggccggctg tttctttcgt gttgcaaaac
gcgccacgtc 1200agcaacctgt cccgtgggtc ccccgtgccg atgaaatcgt
gtgcacgccg atcagctgat 1260tgcccggctc gcgaagtagg cgccctcttt
ctgctcgccc tctctccgtc ccgccactag 1320tggcgcgcca tatcaatgat
tgaacaagat ggattgcacg caggttctcc ggccgcttgg 1380gtggagaggc
tattcggcta tgactgggca caacagacaa tcggctgctc tgatgccgcc
1440gtgttccggc tgtcagcgca ggggcgcccg gttctttttg tcaagaccga
cctgtccggt 1500gccctgaatg aactgcagga cgaggcagcg cggctatcgt
ggctggccac gacgggcgtt 1560ccttgcgcag ctgtgctcga cgttgtcact
gaagcgggaa gggactggct gctattgggc 1620gaagtgccgg ggcaggatct
cctgtcatct caccttgctc ctgccgagaa agtatccatc 1680atggctgatg
caatgcggcg gctgcatacg cttgatccgg ctacctgccc attcgaccac
1740caagcgaaac atcgcatcga gcgagcacgt actcggatgg aagccggtct
tgtcgatcag 1800gatgatctgg acgaagagca tcaggggctc gcgccagccg
aactgttcgc caggctcaag 1860gcgcgcatgc ccgacggcga ggatctcgtc
gtgacccatg gcgatgcctg cttgccgaat 1920atcatggtgg aaaatggccg
cttttctgga ttcatcgact gtggccggct gggtgtggcg 1980gaccgctatc
aggacatagc gttggctacc cgtgatattg ctgaagagct tggcggcgaa
2040tgggctgacc gcttcctcgt gctttacggt atcgccgctc ccgattcgca
gcgcatcgcc 2100ttctatcgcc ttcttgacga gttcttctaa gatctgtcga
tcgacaagtg actcgaggca 2160gcagcagctc ggatagtatc gacacactct
ggacgctggt cgtgtgatgg actgttgccg 2220ccacacttgc tgccttgacc
tgtgaatatc cctgccgctt ttatcaaaca gcctcagtgt 2280gtttgatctt
gtgtgtacgc gcttttgcga gttgctagct gcttgtgcta tttgcgaata
2340ccacccccag catccccttc cctcgtttca tatcgcttgc atcccaaccg
caacttatct 2400acgctgtcct gctatccctc agcgctgctc ctgctcctgc
tcactgcccc tcgcacagcc 2460ttggtttggg ctccgcctgt attctcctgg
tactgcaacc tgtaaaccag cactgcaatg 2520ctgatgcacg ggaagtagtg
ggatgggaac acaaatggaa agcttgagct c 2571512550DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
51gaattccgcc tgcaacgcaa gggcagccac agccgctccc acccgccgct gaaccgacac
60gtgcttgggc gcctgccgcc tgcctgccgc atgcttgtgc tggtgaggct gggcagtgct
120gccatgctga ttgaggcttg gttcatcggg tggaagctta tgtgtgtgct
gggcttgcat 180gccgggcaat gcgcatggtg gcaagagggc ggcagcactt
gctggacgtg ccgcggtgcc 240tccaggtggt tcaatcgcgg cagccagagg
gatttcagat gatcgcgcgt acaggttgag 300cagcagtgtc agcaaaggta
gcagtttgcc agaatgatcg gttcagctgt taatcaatgc 360cagcaagaga
aggggtcaag tgcaaacacg ggcatgccac agcacgggca ccggggagtg
420gaatggcacc accaagtgtg tgcgagccag catcgccgcc tggctgtttc
agctacaacg 480gcaggagtca tccaactaac catagctgat caacactgca
atcatcggcg gctgatgcaa 540gcatcctgca agacacatgc tgtgcgatgc
tgcgctgctg cctgctgcgc acgccgttga 600gttggcagca gctcagccat
gcactggatc aggctgggct gccactgcaa tgtggtggat 660aggatgcaag
tggagcgaat accaaaccct ctggctgctt gctgggttgc atggcatcgc
720accatcagca ggagcgcatg cgaagggact ggccccatgc acgccatgcc
aaaccggagc 780gcaccgagtg tccacactgt caccaggccc gcaagctttg
cagaaccatg ctcatggacg 840catgtagcgc tgacgtccct tgacggcgct
cctctcgggt gtgggaaacg caatgcagca 900caggcagcag aggcggcggc
agcagagcgg cggcagcagc ggcgggggcc acccttcttg 960cggggtcgcg
ccccagccag cggtgatgcg ctgatcnnnc caaacgagtt cacattcatt
1020tgcagcctgg agaagcgagg ctggggcctt tgggctggtg cagcccgcaa
tggaatgcgg 1080gaccgccagg ctagcagcaa aggcgcctcc cctactccgc
atcgatgttc catagtgcat 1140tggactgcat ttgggtgggg cggccggctg
tttctttcgt gttgcaaaac gcgccacgtc 1200agcaacctgt cccgtgggtc
ccccgtgccg atgaaatcgt gtgcacgccg atcagctgat 1260tgcccggctc
gcgaagtagg cgccctcttt ctgctcgccc tctctccgtc ccgccactag
1320tggcgcgcca tatcaatgat cgagcaggac ggcctccacg ccggctcccc
cgccgcctgg 1380gtggagcgcc tgttcggcta cgactgggcc cagcagacca
tcggctgctc cgacgccgcc 1440gtgttccgcc tgtccgccca gggccgcccc
gtgctgttcg tgaagaccga cctgtccggc 1500gccctgaacg agctgcagga
cgaggccgcc cgcctgtcct ggctggccac caccggcgtg 1560ccctgcgccg
ccgtgctgga cgtggtgacc gaggccggcc gcgactggct gctgctgggc
1620gaggtgcccg gccaggacct gctgtcctcc cacctggccc ccgccgagaa
ggtgtccatc 1680atggccgacg ccatgcgccg cctgcacacc ctggaccccg
ccacctgccc cttcgaccac 1740caggccaagc accgcatcga gcgcgcccgc
acccgcatgg aggccggcct ggtggaccag 1800gacgacctgg acgaggagca
ccagggcctg gcccccgccg agctgttcgc ccgcctgaag 1860gcccgcatgc
ccgacggcga ggacctggtg gtgacccacg gcgacgcctg cctgcccaac
1920atcatggtgg agaacggccg cttctccggc ttcatcgact gcggccgcct
gggcgtggcc 1980gaccgctacc aggacatcgc cctggccacc cgcgacatcg
ccgaggagct gggcggcgag 2040tgggccgacc gcttcctggt gctgtacggc
atcgccgccc ccgactccca gcgcatcgcc 2100ttctaccgcc tgctggacga
gttcttctga ctcgaggcag cagcagctcg gatagtatcg 2160acacactctg
gacgctggtc gtgtgatgga ctgttgccgc cacacttgct gccttgacct
2220gtgaatatcc ctgccgcttt tatcaaacag cctcagtgtg tttgatcttg
tgtgtacgcg 2280cttttgcgag ttgctagctg cttgtgctat ttgcgaatac
cacccccagc atccccttcc 2340ctcgtttcat atcgcttgca tcccaaccgc
aacttatcta cgctgtcctg ctatccctca 2400gcgctgctcc tgctcctgct
cactgcccct cgcacagcct tggtttgggc tccgcctgta 2460ttctcctggt
actgcaacct gtaaaccagc actgcaatgc tgatgcacgg gaagtagtgg
2520gatgggaaca caaatggaaa gcttgagctc 2550521547DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
52gaattccttt cttgcgctat gacacttcca gcaaaaggta gggcgggctg cgagacggct
60tcccggcgct gcatgcaaca ccgatgatgc ttcgaccccc cgaagctcct tcggggctgc
120atgggcgctc cgatgccgct ccagggcgag cgctgtttaa atagccaggc
ccccgattgc 180aaagacatta tagcgagcta ccaaagccat attcaaacac
ctagatcact accacttcta 240cacaggccac tcgagcttgt gatcgcactc
cgctaagggg gcgcctcttc ctcttcgttt 300cagtcacaac ccgcaaacgg
cgcgccatat caatgatcga gcaggacggc ctccacgccg 360gctcccccgc
cgcctgggtg gagcgcctgt tcggctacga ctgggcccag cagaccatcg
420gctgctccga cgccgccgtg ttccgcctgt ccgcccaggg ccgccccgtg
ctgttcgtga 480agaccgacct gtccggcgcc ctgaacgagc tgcaggacga
ggccgcccgc ctgtcctggc 540tggccaccac cggcgtgccc tgcgccgccg
tgctggacgt ggtgaccgag gccggccgcg 600actggctgct gctgggcgag
gtgcccggcc aggacctgct gtcctcccac ctggcccccg 660ccgagaaggt
gtccatcatg gccgacgcca tgcgccgcct gcacaccctg gaccccgcca
720cctgcccctt cgaccaccag gccaagcacc gcatcgagcg cgcccgcacc
cgcatggagg 780ccggcctggt ggaccaggac gacctggacg aggagcacca
gggcctggcc cccgccgagc 840tgttcgcccg cctgaaggcc cgcatgcccg
acggcgagga cctggtggtg acccacggcg 900acgcctgcct gcccaacatc
atggtggaga acggccgctt ctccggcttc atcgactgcg 960gccgcctggg
cgtggccgac cgctaccagg acatcgccct ggccacccgc gacatcgccg
1020aggagctggg cggcgagtgg gccgaccgct tcctggtgct gtacggcatc
gccgcccccg 1080actcccagcg catcgccttc taccgcctgc tggacgagtt
cttctgactc gaggcagcag 1140cagctcggat agtatcgaca cactctggac
gctggtcgtg tgatggactg ttgccgccac 1200acttgctgcc ttgacctgtg
aatatccctg ccgcttttat caaacagcct cagtgtgttt 1260gatcttgtgt
gtacgcgctt ttgcgagttg ctagctgctt gtgctatttg cgaataccac
1320ccccagcatc cccttccctc gtttcatatc gcttgcatcc caaccgcaac
ttatctacgc 1380tgtcctgcta tccctcagcg ctgctcctgc tcctgctcac
tgcccctcgc acagccttgg 1440tttgggctcc gcctgtattc tcctggtact
gcaacctgta aaccagcact gcaatgctga 1500tgcacgggaa gtagtgggat
gggaacacaa atggaaagct tgagctc 15475321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
53gccgcgactg gctgctgctg g 215421DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 54aggtcctcgc cgtcgggcat g
21552357DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 55ctttcttgcg ctatgacact tccagcaaaa
ggtagggcgg gctgcgagac ggcttcccgg 60cgctgcatgc aacaccgatg atgcttcgac
cccccgaagc tccttcgggg ctgcatgggc 120gctccgatgc cgctccaggg
cgagcgctgt ttaaatagcc aggcccccga ttgcaaagac 180attatagcga
gctaccaaag ccatattcaa acacctagat cactaccact tctacacagg
240ccactcgagc ttgtgatcgc actccgctaa gggggcgcct cttcctcttc
gtttcagtca 300caacccgcaa acggcgcgcc atatcaatgc ttcttcaggc
ctttcttttt cttcttgctg 360gttttgctgc caagatcagc gcctctatga
cgaacgaaac ctcggataga ccacttgtgc 420actttacacc aaacaagggc
tggatgaatg accccaatgg actgtggtac gacgaaaaag 480atgccaagtg
gcatctgtac tttcaataca acccgaacga tactgtctgg gggacgccat
540tgttttgggg ccacgccacg tccgacgacc tgaccaattg ggaggaccaa
ccaatagcta 600tcgctccgaa gaggaacgac tccggagcat tctcgggttc
catggtggtt gactacaaca 660atacttccgg ctttttcaac gataccattg
acccgagaca acgctgcgtg gccatatgga 720cttacaacac accggagtcc
gaggagcagt acatctcgta tagcctggac ggtggataca 780cttttacaga
gtatcagaag aaccctgtgc ttgctgcaaa ttcgactcag ttccgagatc
840cgaaggtctt ttggtacgag ccctcgcaga agtggatcat gacagcggca
aagtcacagg 900actacaagat cgaaatttac tcgtctgacg accttaaatc
ctggaagctc gaatccgcgt 960tcgcaaacga gggctttctc ggctaccaat
acgaatgccc aggcctgata gaggtcccaa 1020cagagcaaga tcccagcaag
tcctactggg tgatgtttat ttccattaat ccaggagcac 1080cggcaggagg
ttcttttaat cagtacttcg tcggaagctt taacggaact catttcgagg
1140catttgataa ccaatcaaga gtagttgatt ttggaaagga ctactatgcc
ctgcagactt 1200tcttcaatac tgacccgacc tatgggagcg ctcttggcat
tgcgtgggct tctaactggg 1260agtattccgc attcgttcct acaaaccctt
ggaggtcctc catgtcgctc gtgaggaaat 1320tctctctcaa cactgagtac
caggccaacc cggaaaccga actcataaac ctgaaagccg 1380aaccgatcct
gaacattagc aacgctggcc cctggagccg gtttgcaacc aacaccacgt
1440tgacgaaagc caacagctac aacgtcgatc tttcgaatag caccggtaca
cttgaatttg 1500aactggtgta tgccgtcaat accacccaaa cgatctcgaa
gtcggtgttc gcggacctct 1560ccctctggtt taaaggcctg gaagaccccg
aggagtacct cagaatgggt ttcgaggttt 1620ctgcgtcctc cttcttcctt
gatcgcggga acagcaaagt aaaatttgtt aaggagaacc 1680catattttac
caacaggatg agcgttaaca accaaccatt caagagcgaa aacgacctgt
1740cgtactacaa agtgtatggt ttgcttgatc aaaatatcct ggaactctac
ttcaacgatg 1800gtgatgtcgt gtccaccaac acatacttca tgacaaccgg
gaacgcactg ggctccgtga 1860acatgacgac gggtgtggat aacctgttct
acatcgacaa attccaggtg agggaagtca 1920agtgagatct gtcgatcgac
aagctcgagg cagcagcagc tcggatagta tcgacacact 1980ctggacgctg
gtcgtgtgat ggactgttgc cgccacactt gctgccttga cctgtgaata
2040tccctgccgc ttttatcaaa cagcctcagt gtgtttgatc ttgtgtgtac
gcgcttttgc 2100gagttgctag ctgcttgtgc tatttgcgaa taccaccccc
agcatcccct tccctcgttt 2160catatcgctt gcatcccaac cgcaacttat
ctacgctgtc ctgctatccc tcagcgctgc 2220tcctgctcct gctcactgcc
cctcgcacag ccttggtttg ggctccgcct gtattctcct 2280ggtactgcaa
cctgtaaacc agcactgcaa tgctgatgca cgggaagtag tgggatggga
2340acacaaatgg aaagctt 2357562335DNAArtificial SequenceDescription
of Artificial Sequence Synthetic polynucleotide 56ctttcttgcg
ctatgacact tccagcaaaa ggtagggcgg gctgcgagac ggcttcccgg 60cgctgcatgc
aacaccgatg atgcttcgac cccccgaagc tccttcgggg ctgcatgggc
120gctccgatgc cgctccaggg cgagcgctgt ttaaatagcc aggcccccga
ttgcaaagac 180attatagcga gctaccaaag ccatattcaa acacctagat
cactaccact tctacacagg 240ccactcgagc ttgtgatcgc actccgctaa
gggggcgcct cttcctcttc gtttcagtca 300caacccgcaa acggcgcgcc
atgctgctgc aggccttcct gttcctgctg gccggcttcg 360ccgccaagat
cagcgcctcc atgacgaacg agacgtccga ccgccccctg gtgcacttca
420cccccaacaa gggctggatg aacgacccca acggcctgtg gtacgacgag
aaggacgcca 480agtggcacct gtacttccag tacaacccga acgacaccgt
ctgggggacg cccttgttct 540ggggccacgc cacgtccgac gacctgacca
actgggagga ccagcccatc gccatcgccc 600cgaagcgcaa cgactccggc
gccttctccg gctccatggt ggtggactac aacaacacct 660ccggcttctt
caacgacacc atcgacccgc gccagcgctg cgtggccatc tggacctaca
720acaccccgga gtccgaggag cagtacatct cctacagcct ggacggcggc
tacaccttca 780ccgagtacca gaagaacccc gtgctggccg ccaactccac
ccagttccgc gacccgaagg 840tcttctggta cgagccctcc cagaagtgga
tcatgaccgc ggccaagtcc caggactaca 900agatcgagat ctactcctcc
gacgacctga agtcctggaa gctggagtcc gcgttcgcca 960acgagggctt
cctcggctac cagtacgagt gccccggcct gatcgaggtc cccaccgagc
1020aggaccccag caagtcctac tgggtgatgt tcatctccat caaccccggc
gccccggccg 1080gcggctcctt caaccagtac ttcgtcggca gcttcaacgg
cacccacttc gaggccttcg 1140acaaccagtc ccgcgtggtg gacttcggca
aggactacta cgccctgcag accttcttca 1200acaccgaccc gacctacggg
agcgccctgg gcatcgcgtg ggcctccaac tgggagtact 1260ccgccttcgt
gcccaccaac ccctggcgct cctccatgtc cctcgtgcgc aagttctccc
1320tcaacaccga gtaccaggcc aacccggaga cggagctgat caacctgaag
gccgagccga 1380tcctgaacat cagcaacgcc ggcccctgga gccggttcgc
caccaacacc acgttgacga 1440aggccaacag ctacaacgtc gacctgtcca
acagcaccgg caccctggag ttcgagctgg 1500tgtacgccgt caacaccacc
cagacgatct ccaagtccgt gttcgcggac ctctccctct 1560ggttcaaggg
cctggaggac cccgaggagt acctccgcat gggcttcgag gtgtccgcgt
1620cctccttctt cctggaccgc gggaacagca aggtgaagtt cgtgaaggag
aacccctact 1680tcaccaaccg catgagcgtg aacaaccagc ccttcaagag
cgagaacgac ctgtcctact 1740acaaggtgta cggcttgctg gaccagaaca
tcctggagct gtacttcaac gacggcgacg 1800tcgtgtccac caacacctac
ttcatgacca ccgggaacgc cctgggctcc gtgaacatga 1860cgacgggggt
ggacaacctg ttctacatcg acaagttcca ggtgcgcgag gtcaagtgat
1920taattaactc gaggcagcag cagctcggat agtatcgaca cactctggac
gctggtcgtg 1980tgatggactg ttgccgccac acttgctgcc ttgacctgtg
aatatccctg ccgcttttat 2040caaacagcct cagtgtgttt gatcttgtgt
gtacgcgctt ttgcgagttg ctagctgctt 2100gtgctatttg cgaataccac
ccccagcatc cccttccctc gtttcatatc gcttgcatcc 2160caaccgcaac
ttatctacgc tgtcctgcta tccctcagcg ctgctcctgc tcctgctcac
2220tgcccctcgc acagccttgg tttgggctcc gcctgtattc tcctggtact
gcaacctgta 2280aaccagcact gcaatgctga tgcacgggaa gtagtgggat
gggaacacaa atgga 23355720DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 57ccgccgtgct ggacgtggtg
205820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 58ggtggcgggg tccagggtgt 205920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
59cggccggcgg ctccttcaac 206020DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 60ggcgctcccg taggtcgggt
20611335DNAChlorella sorokiniana 61cgcctgcaac gcaagggcag ccacagccgc
tcccacccgc cgctgaaccg acacgtgctt 60gggcgcctgc cgcctgcctg ccgcatgctt
gtgctggtga ggctgggcag tgctgccatg 120ctgattgagg cttggttcat
cgggtggaag cttatgtgtg tgctgggctt gcatgccggg 180caatgcgcat
ggtggcaaga gggcggcagc acttgctgga gctgccgcgg tgcctccagg
240tggttcaatc gcggcagcca gagggatttc agatgatcgc gcgtacaggt
tgagcagcag 300tgtcagcaaa ggtagcagtt tgccagaatg atcggttcag
ctgttaatca atgccagcaa 360gagaaggggt caagtgcaaa cacgggcatg
ccacagcacg ggcaccgggg agtggaatgg 420caccaccaag tgtgtgcgag
ccagcatcgc cgcctggctg tttcagctac aacggcagga 480gtcatccaac
gtaaccatga gctgatcaac actgcaatca tcgggcgggc gtgatgcaag
540catgcctggc gaagacacat ggtgtgcgga tgctgccggc tgctgcctgc
tgcgcacgcc 600gttgagttgg cagcaggctc agccatgcac tggatggcag
ctgggctgcc actgcaatgt 660ggtggatagg atgcaagtgg agcgaatacc
aaaccctctg gctgcttgct gggttgcatg 720gcatcgcacc atcagcagga
gcgcatgcga agggactggc cccatgcacg ccatgccaaa 780ccggagcgca
ccgagtgtcc acactgtcac caggcccgca agctttgcag aaccatgctc
840atggacgcat gtagcgctga cgtcccttga cggcgctcct ctcgggtgtg
ggaaacgcaa 900tgcagcacag gcagcagagg cggcggcagc agagcggcgg
cagcagcggc gggggccacc 960cttcttgcgg ggtcgcgccc cagccagcgg
tgatgcgctg atcccaaacg agttcacatt 1020catttgcatg cctggagaag
cgaggctggg gcctttgggc tggtgcagcc cgcaatggaa 1080tgcgggaccg
ccaggctagc agcaaaggcg
cctcccctac tccgcatcga tgttccatag 1140tgcattggac tgcatttggg
tggggcggcc ggctgtttct ttcgtgttgc aaaacgcgcc 1200agctcagcaa
cctgtcccgt gggtcccccg tgccgatgaa atcgtgtgca cgccgatcag
1260ctgattgccc ggctcgcgaa gtaggcgccc tcctttctgc tcgccctctc
tccgtcccgc 1320cactagtggc gcgcc 1335621146DNAUmbellularia
californica 62atggccacca ccagcctggc ctccgccttc tgctccatga
aggccgtgat gctggcccgc 60gacggccgcg gcatgaagcc ccgcagctcc gacctgcagc
tgcgcgccgg caacgccccc 120acctccctga agatgatcaa cggcaccaag
ttcagctaca ccgagagcct gaagcgcctg 180cccgactggt ccatgctgtt
cgccgtgatc accaccatct tcagcgccgc cgagaagcag 240tggaccaacc
tggagtggaa gcccaagccc aagctgcccc agctgctgga cgaccacttc
300ggcctgcacg gcctggtgtt ccgccgcacc ttcgccatcc gctcctacga
ggtgggcccc 360gaccgcagca cctccatcct ggccgtgatg aaccacatgc
aggaggccac cctgaaccac 420gccaagagcg tgggcatcct gggcgacggc
ttcggcacca ccctggagat gtccaagcgc 480gacctgatgt gggtggtgcg
ccgcacccac gtggccgtgg agcgctaccc cacctggggc 540gacaccgtgg
aggtggagtg ctggatcggc gccagcggca acaacggcat gcgccgcgac
600ttcctggtgc gcgactgcaa gaccggcgag atcctgaccc gctgcacctc
cctgagcgtg 660ctgatgaaca cccgcacccg ccgcctgagc accatccccg
acgaggtgcg cggcgagatc 720ggccccgcct tcatcgacaa cgtggccgtg
aaggacgacg agatcaagaa gctgcagaag 780ctgaacgact ccaccgccga
ctacatccag ggcggcctga ccccccgctg gaacgacctg 840gacgtgaacc
agcacgtgaa caacctgaag tacgtggcct gggtgttcga gaccgtgccc
900gacagcatct tcgagtccca ccacatcagc tccttcaccc tggagtaccg
ccgcgagtgc 960acccgcgact ccgtgctgcg cagcctgacc accgtgagcg
gcggcagctc cgaggccggc 1020ctggtgtgcg accacctgct gcagctggag
ggcggcagcg aggtgctgcg cgcccgcacc 1080gagtggcgcc ccaagctgac
cgactccttc cgcggcatca gcgtgatccc cgccgagccc 1140cgcgtg
1146631146DNACinnamomum camphora 63atggccacca cctccctggc ctccgccttc
tgcagcatga aggccgtgat gctggcccgc 60gacggccgcg gcatgaagcc ccgctccagc
gacctgcagc tgcgcgccgg caacgcccag 120acctccctga agatgatcaa
cggcaccaag ttctcctaca ccgagagcct gaagaagctg 180cccgactggt
ccatgctgtt cgccgtgatc accaccatct tctccgccgc cgagaagcag
240tggaccaacc tggagtggaa gcccaagccc aacccccccc agctgctgga
cgaccacttc 300ggcccccacg gcctggtgtt ccgccgcacc ttcgccatcc
gcagctacga ggtgggcccc 360gaccgctcca ccagcatcgt ggccgtgatg
aaccacctgc aggaggccgc cctgaaccac 420gccaagtccg tgggcatcct
gggcgacggc ttcggcacca ccctggagat gtccaagcgc 480gacctgatct
gggtggtgaa gcgcacccac gtggccgtgg agcgctaccc cgcctggggc
540gacaccgtgg aggtggagtg ctgggtgggc gcctccggca acaacggccg
ccgccacgac 600ttcctggtgc gcgactgcaa gaccggcgag atcctgaccc
gctgcacctc cctgagcgtg 660atgatgaaca cccgcacccg ccgcctgagc
aagatccccg aggaggtgcg cggcgagatc 720ggccccgcct tcatcgacaa
cgtggccgtg aaggacgagg agatcaagaa gccccagaag 780ctgaacgact
ccaccgccga ctacatccag ggcggcctga ccccccgctg gaacgacctg
840gacatcaacc agcacgtgaa caacatcaag tacgtggact ggatcctgga
gaccgtgccc 900gacagcatct tcgagagcca ccacatctcc tccttcacca
tcgagtaccg ccgcgagtgc 960accatggaca gcgtgctgca gtccctgacc
accgtgagcg gcggctcctc cgaggccggc 1020ctggtgtgcg agcacctgct
gcagctggag ggcggcagcg aggtgctgcg cgccaagacc 1080gagtggcgcc
ccaagctgac cgactccttc cgcggcatca gcgtgatccc cgccgagtcc 1140agcgtg
11466472DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 64atggactaca aggaccacga cggcgactac
aaggaccacg acatcgacta caaggacgac 60gacgacaagt ga
7265408DNAChlorella vulgaris 65ctcgaggcag cagcagctcg gatagtatcg
acacactctg gacgctggtc gtgtgatgga 60ctgttgccgc cacacttgct gccttgacct
gtgaatatcc ctgccgcttt tatcaaacag 120cctcagtgtg tttgatcttg
tgtgtacgcg cttttgcgag ttgctagctg cttgtgctat 180ttgcgaatac
cacccccagc atccccttcc ctcgtttcat atcgcttgca tcccaaccgc
240aacttatcta cgctgtcctg ctatccctca gcgctgctcc tgctcctgct
cactgcccct 300cgcacagcct tggtttgggc tccgcctgta ttctcctggt
actgcaacct gtaaaccagc 360actgcaatgc tgatgcacgg gaagtagtgg
gatgggaaca caaatgga 4086620DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 66ctgggcgacg gcttcggcac
206720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 67aagtcgcggc gcatgccgtt 206820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
68taccccgcct ggggcgacac 206920DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 69cttgctcagg cggcgggtgc
20701317DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 70atggtggccg ccgccgcctc cagcgccttc
ttccccgtgc ccgcccccgg cgcctccccc 60aagcccggca agttcggcaa ctggccctcc
agcctgagcc cctccttcaa gcccaagtcc 120atccccaacg gcggcttcca
ggtgaaggcc aacgacagcg cccaccccaa ggccaacggc 180tccgccgtga
gcctgaagag cggcagcctg aacacccagg aggacacctc ctccagcccc
240cccccccgca ccttcctgca ccagctgccc gactggagcc gcctgctgac
cgccatcacc 300accgtgttcg tgaagtccaa gcgccccgac atgcacgacc
gcaagtccaa gcgccccgac 360atgctggtgg acagcttcgg cctggagtcc
accgtgcagg acggcctggt gttccgccag 420tccttctcca tccgctccta
cgagatcggc accgaccgca ccgccagcat cgagaccctg 480atgaaccacc
tgcaggagac ctccctgaac cactgcaaga gcaccggcat cctgctggac
540ggcttcggcc gcaccctgga gatgtgcaag cgcgacctga tctgggtggt
gatcaagatg 600cagatcaagg tgaaccgcta ccccgcctgg ggcgacaccg
tggagatcaa cacccgcttc 660agccgcctgg gcaagatcgg catgggccgc
gactggctga tctccgactg caacaccggc 720gagatcctgg tgcgcgccac
cagcgcctac gccatgatga accagaagac ccgccgcctg 780tccaagctgc
cctacgaggt gcaccaggag atcgtgcccc tgttcgtgga cagccccgtg
840atcgaggact ccgacctgaa ggtgcacaag ttcaaggtga agaccggcga
cagcatccag 900aagggcctga cccccggctg gaacgacctg gacgtgaacc
agcacgtgtc caacgtgaag 960tacatcggct ggatcctgga gagcatgccc
accgaggtgc tggagaccca ggagctgtgc 1020tccctggccc tggagtaccg
ccgcgagtgc ggccgcgact ccgtgctgga gagcgtgacc 1080gccatggacc
ccagcaaggt gggcgtgcgc tcccagtacc agcacctgct gcgcctggag
1140gacggcaccg ccatcgtgaa cggcgccacc gagtggcgcc ccaagaacgc
cggcgccaac 1200ggcgccatct ccaccggcaa gaccagcaac ggcaactccg
tgtccatgga ctacaaggac 1260cacgacggcg actacaagga ccacgacatc
gactacaagg acgacgacga caagtga 1317711170DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
71atggccaccg catccacttt ctcggcgttc aatgcccgct gcggcgacct gcgtcgctcg
60gcgggctccg ggccccggcg cccagcgagg cccctccccg tgcgcgggcg cgcccagctg
120cccgactgga gccgcctgct gaccgccatc accaccgtgt tcgtgaagtc
caagcgcccc 180gacatgcacg accgcaagtc caagcgcccc gacatgctgg
tggacagctt cggcctggag 240tccaccgtgc aggacggcct ggtgttccgc
cagtccttct ccatccgctc ctacgagatc 300ggcaccgacc gcaccgccag
catcgagacc ctgatgaacc acctgcagga gacctccctg 360aaccactgca
agagcaccgg catcctgctg gacggcttcg gccgcaccct ggagatgtgc
420aagcgcgacc tgatctgggt ggtgatcaag atgcagatca aggtgaaccg
ctaccccgcc 480tggggcgaca ccgtggagat caacacccgc ttcagccgcc
tgggcaagat cggcatgggc 540cgcgactggc tgatctccga ctgcaacacc
ggcgagatcc tggtgcgcgc caccagcgcc 600tacgccatga tgaaccagaa
gacccgccgc ctgtccaagc tgccctacga ggtgcaccag 660gagatcgtgc
ccctgttcgt ggacagcccc gtgatcgagg actccgacct gaaggtgcac
720aagttcaagg tgaagaccgg cgacagcatc cagaagggcc tgacccccgg
ctggaacgac 780ctggacgtga accagcacgt gtccaacgtg aagtacatcg
gctggatcct ggagagcatg 840cccaccgagg tgctggagac ccaggagctg
tgctccctgg ccctggagta ccgccgcgag 900tgcggccgcg actccgtgct
ggagagcgtg accgccatgg accccagcaa ggtgggcgtg 960cgctcccagt
accagcacct gctgcgcctg gaggacggca ccgccatcgt gaacggcgcc
1020accgagtggc gccccaagaa cgccggcgcc aacggcgcca tctccaccgg
caagaccagc 1080aacggcaact ccgtgtccat ggactacaag gaccacgacg
gcgactacaa ggaccacgac 1140atcgactaca aggacgacga cgacaagtga
1170721170DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 72atggctatca agacgaacag gcagcctgtg
gagaagcctc cgttcacgat cgggacgctg 60cgcaaggcca tccccgcgca ctgtttcgag
cgctcggcgc ttcgtgggcg cgcccagctg 120cccgactgga gccgcctgct
gaccgccatc accaccgtgt tcgtgaagtc caagcgcccc 180gacatgcacg
accgcaagtc caagcgcccc gacatgctgg tggacagctt cggcctggag
240tccaccgtgc aggacggcct ggtgttccgc cagtccttct ccatccgctc
ctacgagatc 300ggcaccgacc gcaccgccag catcgagacc ctgatgaacc
acctgcagga gacctccctg 360aaccactgca agagcaccgg catcctgctg
gacggcttcg gccgcaccct ggagatgtgc 420aagcgcgacc tgatctgggt
ggtgatcaag atgcagatca aggtgaaccg ctaccccgcc 480tggggcgaca
ccgtggagat caacacccgc ttcagccgcc tgggcaagat cggcatgggc
540cgcgactggc tgatctccga ctgcaacacc ggcgagatcc tggtgcgcgc
caccagcgcc 600tacgccatga tgaaccagaa gacccgccgc ctgtccaagc
tgccctacga ggtgcaccag 660gagatcgtgc ccctgttcgt ggacagcccc
gtgatcgagg actccgacct gaaggtgcac 720aagttcaagg tgaagaccgg
cgacagcatc cagaagggcc tgacccccgg ctggaacgac 780ctggacgtga
accagcacgt gtccaacgtg aagtacatcg gctggatcct ggagagcatg
840cccaccgagg tgctggagac ccaggagctg tgctccctgg ccctggagta
ccgccgcgag 900tgcggccgcg actccgtgct ggagagcgtg accgccatgg
accccagcaa ggtgggcgtg 960cgctcccagt accagcacct gctgcgcctg
gaggacggca ccgccatcgt gaacggcgcc 1020accgagtggc gccccaagaa
cgccggcgcc aacggcgcca tctccaccgg caagaccagc 1080aacggcaact
ccgtgtccat ggactacaag gaccacgacg gcgactacaa ggaccacgac
1140atcgactaca aggacgacga cgacaagtga 1170731167DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
73atgacgttcg gggtcgccct cccggccatg ggccgcggtg tctcccttcc ccggcccagg
60gtcgcggtgc gcgcccagtc ggcgagtcag gttttggaga gcgggcgcgc ccagctgccc
120gactggagcc gcctgctgac cgccatcacc accgtgttcg tgaagtccaa
gcgccccgac 180atgcacgacc gcaagtccaa gcgccccgac atgctggtgg
acagcttcgg cctggagtcc 240accgtgcagg acggcctggt gttccgccag
tccttctcca tccgctccta cgagatcggc 300accgaccgca ccgccagcat
cgagaccctg atgaaccacc tgcaggagac ctccctgaac 360cactgcaaga
gcaccggcat cctgctggac ggcttcggcc gcaccctgga gatgtgcaag
420cgcgacctga tctgggtggt gatcaagatg cagatcaagg tgaaccgcta
ccccgcctgg 480ggcgacaccg tggagatcaa cacccgcttc agccgcctgg
gcaagatcgg catgggccgc 540gactggctga tctccgactg caacaccggc
gagatcctgg tgcgcgccac cagcgcctac 600gccatgatga accagaagac
ccgccgcctg tccaagctgc cctacgaggt gcaccaggag 660atcgtgcccc
tgttcgtgga cagccccgtg atcgaggact ccgacctgaa ggtgcacaag
720ttcaaggtga agaccggcga cagcatccag aagggcctga cccccggctg
gaacgacctg 780gacgtgaacc agcacgtgtc caacgtgaag tacatcggct
ggatcctgga gagcatgccc 840accgaggtgc tggagaccca ggagctgtgc
tccctggccc tggagtaccg ccgcgagtgc 900ggccgcgact ccgtgctgga
gagcgtgacc gccatggacc ccagcaaggt gggcgtgcgc 960tcccagtacc
agcacctgct gcgcctggag gacggcaccg ccatcgtgaa cggcgccacc
1020gagtggcgcc ccaagaacgc cggcgccaac ggcgccatct ccaccggcaa
gaccagcaac 1080ggcaactccg tgtccatgga ctacaaggac cacgacggcg
actacaagga ccacgacatc 1140gactacaagg acgacgacga caagtga
1167741149DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 74atgacgttcg gggtcgccct cccggccatg
ggccgcggtg tctcccttcc ccggcccagg 60gtcgcggtgc gcgcccagtc ggcgagtcag
gttttggaga gcgggcgcgc ccccgactgg 120tccatgctgt tcgccgtgat
caccaccatc ttcagcgccg ccgagaagca gtggaccaac 180ctggagtgga
agcccaagcc caagctgccc cagctgctgg acgaccactt cggcctgcac
240ggcctggtgt tccgccgcac cttcgccatc cgctcctacg aggtgggccc
cgaccgcagc 300acctccatcc tggccgtgat gaaccacatg caggaggcca
ccctgaacca cgccaagagc 360gtgggcatcc tgggcgacgg cttcggcacc
accctggaga tgtccaagcg cgacctgatg 420tgggtggtgc gccgcaccca
cgtggccgtg gagcgctacc ccacctgggg cgacaccgtg 480gaggtggagt
gctggatcgg cgccagcggc aacaacggca tgcgccgcga cttcctggtg
540cgcgactgca agaccggcga gatcctgacc cgctgcacct ccctgagcgt
gctgatgaac 600acccgcaccc gccgcctgag caccatcccc gacgaggtgc
gcggcgagat cggccccgcc 660ttcatcgaca acgtggccgt gaaggacgac
gagatcaaga agctgcagaa gctgaacgac 720tccaccgccg actacatcca
gggcggcctg accccccgct ggaacgacct ggacgtgaac 780cagcacgtga
acaacctgaa gtacgtggcc tgggtgttcg agaccgtgcc cgacagcatc
840ttcgagtccc accacatcag ctccttcacc ctggagtacc gccgcgagtg
cacccgcgac 900tccgtgctgc gcagcctgac caccgtgagc ggcggcagct
ccgaggccgg cctggtgtgc 960gaccacctgc tgcagctgga gggcggcagc
gaggtgctgc gcgcccgcac cgagtggcgc 1020cccaagctga ccgactcctt
ccgcggcatc agcgtgatcc ccgccgagcc ccgcgtgatg 1080gactacaagg
accacgacgg cgactacaag gaccacgaca tcgactacaa ggacgacgac
1140gacaagtga 1149751146DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 75atggcttccg
cggcattcac catgtcggcg tgccccgcga tgactggcag ggcccctggg 60gcacgtcgct
ccggacggcc agtcgccacc cgcctgaggg ggcgcgcccc cgactggtcc
120atgctgttcg ccgtgatcac caccatcttc agcgccgccg agaagcagtg
gaccaacctg 180gagtggaagc ccaagcccaa gctgccccag ctgctggacg
accacttcgg cctgcacggc 240ctggtgttcc gccgcacctt cgccatccgc
tcctacgagg tgggccccga ccgcagcacc 300tccatcctgg ccgtgatgaa
ccacatgcag gaggccaccc tgaaccacgc caagagcgtg 360ggcatcctgg
gcgacggctt cggcaccacc ctggagatgt ccaagcgcga cctgatgtgg
420gtggtgcgcc gcacccacgt ggccgtggag cgctacccca cctggggcga
caccgtggag 480gtggagtgct ggatcggcgc cagcggcaac aacggcatgc
gccgcgactt cctggtgcgc 540gactgcaaga ccggcgagat cctgacccgc
tgcacctccc tgagcgtgct gatgaacacc 600cgcacccgcc gcctgagcac
catccccgac gaggtgcgcg gcgagatcgg ccccgccttc 660atcgacaacg
tggccgtgaa ggacgacgag atcaagaagc tgcagaagct gaacgactcc
720accgccgact acatccaggg cggcctgacc ccccgctgga acgacctgga
cgtgaaccag 780cacgtgaaca acctgaagta cgtggcctgg gtgttcgaga
ccgtgcccga cagcatcttc 840gagtcccacc acatcagctc cttcaccctg
gagtaccgcc gcgagtgcac ccgcgactcc 900gtgctgcgca gcctgaccac
cgtgagcggc ggcagctccg aggccggcct ggtgtgcgac 960cacctgctgc
agctggaggg cggcagcgag gtgctgcgcg cccgcaccga gtggcgcccc
1020aagctgaccg actccttccg cggcatcagc gtgatccccg ccgagccccg
cgtgatggac 1080tacaaggacc acgacggcga ctacaaggac cacgacatcg
actacaagga cgacgacgac 1140aagtga 1146761155DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
76atggccaccg catccacttt ctcggcgttc aatgcccgct gcggcgacct gcgtcgctcg
60gcgggctccg ggccccggcg cccagcgagg cccctccccg tgcgcgggcg cgcccccgac
120tggtccatgc tgttcgccgt gatcaccacc atcttcagcg ccgccgagaa
gcagtggacc 180aacctggagt ggaagcccaa gcccaagctg ccccagctgc
tggacgacca cttcggcctg 240cacggcctgg tgttccgccg caccttcgcc
atccgctcct acgaggtggg ccccgaccgc 300agcacctcca tcctggccgt
gatgaaccac atgcaggagg ccaccctgaa ccacgccaag 360agcgtgggca
tcctgggcga cggcttcggc accaccctgg agatgtccaa gcgcgacctg
420atgtgggtgg tgcgccgcac ccacgtggcc gtggagcgct accccacctg
gggcgacacc 480gtggaggtgg agtgctggat cggcgccagc ggcaacaacg
gcatgcgccg cgacttcctg 540gtgcgcgact gcaagaccgg cgagatcctg
acccgctgca cctccctgag cgtgctgatg 600aacacccgca cccgccgcct
gagcaccatc cccgacgagg tgcgcggcga gatcggcccc 660gccttcatcg
acaacgtggc cgtgaaggac gacgagatca agaagctgca gaagctgaac
720gactccaccg ccgactacat ccagggcggc ctgacccccc gctggaacga
cctggacgtg 780aaccagcacg tgaacaacct gaagtacgtg gcctgggtgt
tcgagaccgt gcccgacagc 840atcttcgagt cccaccacat cagctccttc
accctggagt accgccgcga gtgcacccgc 900gactccgtgc tgcgcagcct
gaccaccgtg agcggcggca gctccgaggc cggcctggtg 960tgcgaccacc
tgctgcagct ggagggcggc agcgaggtgc tgcgcgcccg caccgagtgg
1020cgccccaagc tgaccgactc cttccgcggc atcagcgtga tccccgccga
gccccgcgtg 1080atggactaca aggaccacga cggcgactac aaggaccacg
acatcgacta caaggacgac 1140gacgacaagt gatga 1155771152DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
77atggctatca agacgaacag gcagcctgtg gagaagcctc cgttcacgat cgggacgctg
60cgcaaggcca tccccgcgca ctgtttcgag cgctcggcgc ttcgtgggcg cgcccccgac
120tggtccatgc tgttcgccgt gatcaccacc atcttcagcg ccgccgagaa
gcagtggacc 180aacctggagt ggaagcccaa gcccaagctg ccccagctgc
tggacgacca cttcggcctg 240cacggcctgg tgttccgccg caccttcgcc
atccgctcct acgaggtggg ccccgaccgc 300agcacctcca tcctggccgt
gatgaaccac atgcaggagg ccaccctgaa ccacgccaag 360agcgtgggca
tcctgggcga cggcttcggc accaccctgg agatgtccaa gcgcgacctg
420atgtgggtgg tgcgccgcac ccacgtggcc gtggagcgct accccacctg
gggcgacacc 480gtggaggtgg agtgctggat cggcgccagc ggcaacaacg
gcatgcgccg cgacttcctg 540gtgcgcgact gcaagaccgg cgagatcctg
acccgctgca cctccctgag cgtgctgatg 600aacacccgca cccgccgcct
gagcaccatc cccgacgagg tgcgcggcga gatcggcccc 660gccttcatcg
acaacgtggc cgtgaaggac gacgagatca agaagctgca gaagctgaac
720gactccaccg ccgactacat ccagggcggc ctgacccccc gctggaacga
cctggacgtg 780aaccagcacg tgaacaacct gaagtacgtg gcctgggtgt
tcgagaccgt gcccgacagc 840atcttcgagt cccaccacat cagctccttc
accctggagt accgccgcga gtgcacccgc 900gactccgtgc tgcgcagcct
gaccaccgtg agcggcggca gctccgaggc cggcctggtg 960tgcgaccacc
tgctgcagct ggagggcggc agcgaggtgc tgcgcgcccg caccgagtgg
1020cgccccaagc tgaccgactc cttccgcggc atcagcgtga tccccgccga
gccccgcgtg 1080atggactaca aggaccacga cggcgactac aaggaccacg
acatcgacta caaggacgac 1140gacgacaagt ga 1152781155DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
78atggccaccg catccacttt ctcggcgttc aatgcccgct gcggcgacct gcgtcgctcg
60gcgggctccg ggccccggcg cccagcgagg cccctccccg tgcgcgggcg cgcccccgac
120tggtccatgc tgttcgccgt gatcaccacc atcttctccg ccgccgagaa
gcagtggacc 180aacctggagt ggaagcccaa gcccaacccc ccccagctgc
tggacgacca cttcggcccc 240cacggcctgg tgttccgccg caccttcgcc
atccgcagct acgaggtggg ccccgaccgc 300tccaccagca tcgtggccgt
gatgaaccac ctgcaggagg ccgccctgaa ccacgccaag 360tccgtgggca
tcctgggcga cggcttcggc accaccctgg agatgtccaa gcgcgacctg
420atctgggtgg tgaagcgcac ccacgtggcc gtggagcgct accccgcctg
gggcgacacc 480gtggaggtgg agtgctgggt gggcgcctcc ggcaacaacg
gccgccgcca cgacttcctg 540gtgcgcgact gcaagaccgg cgagatcctg
acccgctgca cctccctgag cgtgatgatg 600aacacccgca cccgccgcct
gagcaagatc
cccgaggagg tgcgcggcga gatcggcccc 660gccttcatcg acaacgtggc
cgtgaaggac gaggagatca agaagcccca gaagctgaac 720gactccaccg
ccgactacat ccagggcggc ctgacccccc gctggaacga cctggacatc
780aaccagcacg tgaacaacat caagtacgtg gactggatcc tggagaccgt
gcccgacagc 840atcttcgaga gccaccacat ctcctccttc accatcgagt
accgccgcga gtgcaccatg 900gacagcgtgc tgcagtccct gaccaccgtg
agcggcggct cctccgaggc cggcctggtg 960tgcgagcacc tgctgcagct
ggagggcggc agcgaggtgc tgcgcgccaa gaccgagtgg 1020cgccccaagc
tgaccgactc cttccgcggc atcagcgtga tccccgccga gtccagcgtg
1080atggactaca aggaccacga cggcgactac aaggaccacg acatcgacta
caaggacgac 1140gacgacaagt gatga 1155794817DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
79ggtacccgcc tgcaacgcaa gggcagccac agccgctccc acccgccgct gaaccgacac
60gtgcttgggc gcctgccgcc tgcctgccgc atgcttgtgc tggtgaggct gggcagtgct
120gccatgctga ttgaggcttg gttcatcggg tggaagctta tgtgtgtgct
gggcttgcat 180gccgggcaat gcgcatggtg gcaagagggc ggcagcactt
gctggagctg ccgcggtgcc 240tccaggtggt tcaatcgcgg cagccagagg
gatttcagat gatcgcgcgt acaggttgag 300cagcagtgtc agcaaaggta
gcagtttgcc agaatgatcg gttcagctgt taatcaatgc 360cagcaagaga
aggggtcaag tgcaaacacg ggcatgccac agcacgggca ccggggagtg
420gaatggcacc accaagtgtg tgcgagccag catcgccgcc tggctgtttc
agctacaacg 480gcaggagtca tccaacgtaa ccatgagctg atcaacactg
caatcatcgg gcgggcgtga 540tgcaagcatg cctggcgaag acacatggtg
tgcggatgct gccggctgct gcctgctgcg 600cacgccgttg agttggcagc
aggctcagcc atgcactgga tggcagctgg gctgccactg 660caatgtggtg
gataggatgc aagtggagcg aataccaaac cctctggctg cttgctgggt
720tgcatggcat cgcaccatca gcaggagcgc atgcgaaggg actggcccca
tgcacgccat 780gccaaaccgg agcgcaccga gtgtccacac tgtcaccagg
cccgcaagct ttgcagaacc 840atgctcatgg acgcatgtag cgctgacgtc
ccttgacggc gctcctctcg ggtgtgggaa 900acgcaatgca gcacaggcag
cagaggcggc ggcagcagag cggcggcagc agcggcgggg 960gccacccttc
ttgcggggtc gcgccccagc cagcggtgat gcgctgatcc caaacgagtt
1020cacattcatt tgcatgcctg gagaagcgag gctggggcct ttgggctggt
gcagcccgca 1080atggaatgcg ggaccgccag gctagcagca aaggcgcctc
ccctactccg catcgatgtt 1140ccatagtgca ttggactgca tttgggtggg
gcggccggct gtttctttcg tgttgcaaaa 1200cgcgccagct cagcaacctg
tcccgtgggt cccccgtgcc gatgaaatcg tgtgcacgcc 1260gatcagctga
ttgcccggct cgcgaagtag gcgccctcct ttctgctcgc cctctctccg
1320tcccgcctct agaatatcaa tgatcgagca ggacggcctc cacgccggct
cccccgccgc 1380ctgggtggag cgcctgttcg gctacgactg ggcccagcag
accatcggct gctccgacgc 1440cgccgtgttc cgcctgtccg cccagggccg
ccccgtgctg ttcgtgaaga ccgacctgtc 1500cggcgccctg aacgagctgc
aggacgaggc cgcccgcctg tcctggctgg ccaccaccgg 1560cgtgccctgc
gccgccgtgc tggacgtggt gaccgaggcc ggccgcgact ggctgctgct
1620gggcgaggtg cccggccagg acctgctgtc ctcccacctg gcccccgccg
agaaggtgtc 1680catcatggcc gacgccatgc gccgcctgca caccctggac
cccgccacct gccccttcga 1740ccaccaggcc aagcaccgca tcgagcgcgc
ccgcacccgc atggaggccg gcctggtgga 1800ccaggacgac ctggacgagg
agcaccaggg cctggccccc gccgagctgt tcgcccgcct 1860gaaggcccgc
atgcccgacg gcgaggacct ggtggtgacc cacggcgacg cctgcctgcc
1920caacatcatg gtggagaacg gccgcttctc cggcttcatc gactgcggcc
gcctgggcgt 1980ggccgaccgc taccaggaca tcgccctggc cacccgcgac
atcgccgagg agctgggcgg 2040cgagtgggcc gaccgcttcc tggtgctgta
cggcatcgcc gcccccgact cccagcgcat 2100cgccttctac cgcctgctgg
acgagttctt ctgacaattg gcagcagcag ctcggatagt 2160atcgacacac
tctggacgct ggtcgtgtga tggactgttg ccgccacact tgctgccttg
2220acctgtgaat atccctgccg cttttatcaa acagcctcag tgtgtttgat
cttgtgtgta 2280cgcgcttttg cgagttgcta gctgcttgtg ctatttgcga
ataccacccc cagcatcccc 2340ttccctcgtt tcatatcgct tgcatcccaa
ccgcaactta tctacgctgt cctgctatcc 2400ctcagcgctg ctcctgctcc
tgctcactgc ccctcgcaca gccttggttt gggctccgcc 2460tgtattctcc
tggtactgca acctgtaaac cagcactgca atgctgatgc acgggaagta
2520gtgggatggg aacacaaatg gaggatcccg cgtctcgaac agagcgcgca
gaggaacgct 2580gaaggtctcg cctctgtcgc acctcagcgc ggcatacacc
acaataacca cctgacgaat 2640gcgcttggtt cttcgtccat tagcgaagcg
tccggttcac acacgtgcca cgttggcgag 2700gtggcaggtg acaatgatcg
gtggagctga tggtcgaaac gttcacagcc tagggatatc 2760gaattccttt
cttgcgctat gacacttcca gcaaaaggta gggcgggctg cgagacggct
2820tcccggcgct gcatgcaaca ccgatgatgc ttcgaccccc cgaagctcct
tcggggctgc 2880atgggcgctc cgatgccgct ccagggcgag cgctgtttaa
atagccaggc ccccgattgc 2940aaagacatta tagcgagcta ccaaagccat
attcaaacac ctagatcact accacttcta 3000cacaggccac tcgagcttgt
gatcgcactc cgctaagggg gcgcctcttc ctcttcgttt 3060cagtcacaac
ccgcaaacgg cgcgccatgg tggccgccgc cgcctccagc gccttcttcc
3120ccgtgcccgc ccccggcgcc tcccccaagc ccggcaagtt cggcaactgg
ccctccagcc 3180tgagcccctc cttcaagccc aagtccatcc ccaacggcgg
cttccaggtg aaggccaacg 3240acagcgccca ccccaaggcc aacggctccg
ccgtgagcct gaagagcggc agcctgaaca 3300cccaggagga cacctcctcc
agcccccccc cccgcacctt cctgcaccag ctgcccgact 3360ggagccgcct
gctgaccgcc atcaccaccg tgttcgtgaa gtccaagcgc cccgacatgc
3420acgaccgcaa gtccaagcgc cccgacatgc tggtggacag cttcggcctg
gagtccaccg 3480tgcaggacgg cctggtgttc cgccagtcct tctccatccg
ctcctacgag atcggcaccg 3540accgcaccgc cagcatcgag accctgatga
accacctgca ggagacctcc ctgaaccact 3600gcaagagcac cggcatcctg
ctggacggct tcggccgcac cctggagatg tgcaagcgcg 3660acctgatctg
ggtggtgatc aagatgcaga tcaaggtgaa ccgctacccc gcctggggcg
3720acaccgtgga gatcaacacc cgcttcagcc gcctgggcaa gatcggcatg
ggccgcgact 3780ggctgatctc cgactgcaac accggcgaga tcctggtgcg
cgccaccagc gcctacgcca 3840tgatgaacca gaagacccgc cgcctgtcca
agctgcccta cgaggtgcac caggagatcg 3900tgcccctgtt cgtggacagc
cccgtgatcg aggactccga cctgaaggtg cacaagttca 3960aggtgaagac
cggcgacagc atccagaagg gcctgacccc cggctggaac gacctggacg
4020tgaaccagca cgtgtccaac gtgaagtaca tcggctggat cctggagagc
atgcccaccg 4080aggtgctgga gacccaggag ctgtgctccc tggccctgga
gtaccgccgc gagtgcggcc 4140gcgactccgt gctggagagc gtgaccgcca
tggaccccag caaggtgggc gtgcgctccc 4200agtaccagca cctgctgcgc
ctggaggacg gcaccgccat cgtgaacggc gccaccgagt 4260ggcgccccaa
gaacgccggc gccaacggcg ccatctccac cggcaagacc agcaacggca
4320actccgtgtc catggactac aaggaccacg acggcgacta caaggaccac
gacatcgact 4380acaaggacga cgacgacaag tgactcgagg cagcagcagc
tcggatagta tcgacacact 4440ctggacgctg gtcgtgtgat ggactgttgc
cgccacactt gctgccttga cctgtgaata 4500tccctgccgc ttttatcaaa
cagcctcagt gtgtttgatc ttgtgtgtac gcgcttttgc 4560gagttgctag
ctgcttgtgc tatttgcgaa taccaccccc agcatcccct tccctcgttt
4620catatcgctt gcatcccaac cgcaacttat ctacgctgtc ctgctatccc
tcagcgctgc 4680tcctgctcct gctcactgcc cctcgcacag ccttggtttg
ggctccgcct gtattctcct 4740ggtactgcaa cctgtaaacc agcactgcaa
tgctgatgca cgggaagtag tgggatggga 4800acacaaatgg aaagctt
4817804665DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 80ggtacccgcc tgcaacgcaa gggcagccac
agccgctccc acccgccgct gaaccgacac 60gtgcttgggc gcctgccgcc tgcctgccgc
atgcttgtgc tggtgaggct gggcagtgct 120gccatgctga ttgaggcttg
gttcatcggg tggaagctta tgtgtgtgct gggcttgcat 180gccgggcaat
gcgcatggtg gcaagagggc ggcagcactt gctggagctg ccgcggtgcc
240tccaggtggt tcaatcgcgg cagccagagg gatttcagat gatcgcgcgt
acaggttgag 300cagcagtgtc agcaaaggta gcagtttgcc agaatgatcg
gttcagctgt taatcaatgc 360cagcaagaga aggggtcaag tgcaaacacg
ggcatgccac agcacgggca ccggggagtg 420gaatggcacc accaagtgtg
tgcgagccag catcgccgcc tggctgtttc agctacaacg 480gcaggagtca
tccaacgtaa ccatgagctg atcaacactg caatcatcgg gcgggcgtga
540tgcaagcatg cctggcgaag acacatggtg tgcggatgct gccggctgct
gcctgctgcg 600cacgccgttg agttggcagc aggctcagcc atgcactgga
tggcagctgg gctgccactg 660caatgtggtg gataggatgc aagtggagcg
aataccaaac cctctggctg cttgctgggt 720tgcatggcat cgcaccatca
gcaggagcgc atgcgaaggg actggcccca tgcacgccat 780gccaaaccgg
agcgcaccga gtgtccacac tgtcaccagg cccgcaagct ttgcagaacc
840atgctcatgg acgcatgtag cgctgacgtc ccttgacggc gctcctctcg
ggtgtgggaa 900acgcaatgca gcacaggcag cagaggcggc ggcagcagag
cggcggcagc agcggcgggg 960gccacccttc ttgcggggtc gcgccccagc
cagcggtgat gcgctgatcc caaacgagtt 1020cacattcatt tgcatgcctg
gagaagcgag gctggggcct ttgggctggt gcagcccgca 1080atggaatgcg
ggaccgccag gctagcagca aaggcgcctc ccctactccg catcgatgtt
1140ccatagtgca ttggactgca tttgggtggg gcggccggct gtttctttcg
tgttgcaaaa 1200cgcgccagct cagcaacctg tcccgtgggt cccccgtgcc
gatgaaatcg tgtgcacgcc 1260gatcagctga ttgcccggct cgcgaagtag
gcgccctcct ttctgctcgc cctctctccg 1320tcccgcctct agaatatcaa
tgatcgagca ggacggcctc cacgccggct cccccgccgc 1380ctgggtggag
cgcctgttcg gctacgactg ggcccagcag accatcggct gctccgacgc
1440cgccgtgttc cgcctgtccg cccagggccg ccccgtgctg ttcgtgaaga
ccgacctgtc 1500cggcgccctg aacgagctgc aggacgaggc cgcccgcctg
tcctggctgg ccaccaccgg 1560cgtgccctgc gccgccgtgc tggacgtggt
gaccgaggcc ggccgcgact ggctgctgct 1620gggcgaggtg cccggccagg
acctgctgtc ctcccacctg gcccccgccg agaaggtgtc 1680catcatggcc
gacgccatgc gccgcctgca caccctggac cccgccacct gccccttcga
1740ccaccaggcc aagcaccgca tcgagcgcgc ccgcacccgc atggaggccg
gcctggtgga 1800ccaggacgac ctggacgagg agcaccaggg cctggccccc
gccgagctgt tcgcccgcct 1860gaaggcccgc atgcccgacg gcgaggacct
ggtggtgacc cacggcgacg cctgcctgcc 1920caacatcatg gtggagaacg
gccgcttctc cggcttcatc gactgcggcc gcctgggcgt 1980ggccgaccgc
taccaggaca tcgccctggc cacccgcgac atcgccgagg agctgggcgg
2040cgagtgggcc gaccgcttcc tggtgctgta cggcatcgcc gcccccgact
cccagcgcat 2100cgccttctac cgcctgctgg acgagttctt ctgacaattg
gcagcagcag ctcggatagt 2160atcgacacac tctggacgct ggtcgtgtga
tggactgttg ccgccacact tgctgccttg 2220acctgtgaat atccctgccg
cttttatcaa acagcctcag tgtgtttgat cttgtgtgta 2280cgcgcttttg
cgagttgcta gctgcttgtg ctatttgcga ataccacccc cagcatcccc
2340ttccctcgtt tcatatcgct tgcatcccaa ccgcaactta tctacgctgt
cctgctatcc 2400ctcagcgctg ctcctgctcc tgctcactgc ccctcgcaca
gccttggttt gggctccgcc 2460tgtattctcc tggtactgca acctgtaaac
cagcactgca atgctgatgc acgggaagta 2520gtgggatggg aacacaaatg
gaggatcccg cgtctcgaac agagcgcgca gaggaacgct 2580gaaggtctcg
cctctgtcgc acctcagcgc ggcatacacc acaataacca cctgacgaat
2640gcgcttggtt cttcgtccat tagcgaagcg tccggttcac acacgtgcca
cgttggcgag 2700gtggcaggtg acaatgatcg gtggagctga tggtcgaaac
gttcacagcc tagggatatc 2760gaattccttt cttgcgctat gacacttcca
gcaaaaggta gggcgggctg cgagacggct 2820tcccggcgct gcatgcaaca
ccgatgatgc ttcgaccccc cgaagctcct tcggggctgc 2880atgggcgctc
cgatgccgct ccagggcgag cgctgtttaa atagccaggc ccccgattgc
2940aaagacatta tagcgagcta ccaaagccat attcaaacac ctagatcact
accacttcta 3000cacaggccac tcgagcttgt gatcgcactc cgctaagggg
gcgcctcttc ctcttcgttt 3060cagtcacaac ccgcaaacac tagtatgacg
ttcggggtcg ccctcccggc catgggccgc 3120ggtgtctccc ttccccggcc
cagggtcgcg gtgcgcgccc agtcggcgag tcaggttttg 3180gagagcgggc
gcgcccagct gcccgactgg agccgcctgc tgaccgccat caccaccgtg
3240ttcgtgaagt ccaagcgccc cgacatgcac gaccgcaagt ccaagcgccc
cgacatgctg 3300gtggacagct tcggcctgga gtccaccgtg caggacggcc
tggtgttccg ccagtccttc 3360tccatccgct cctacgagat cggcaccgac
cgcaccgcca gcatcgagac cctgatgaac 3420cacctgcagg agacctccct
gaaccactgc aagagcaccg gcatcctgct ggacggcttc 3480ggccgcaccc
tggagatgtg caagcgcgac ctgatctggg tggtgatcaa gatgcagatc
3540aaggtgaacc gctaccccgc ctggggcgac accgtggaga tcaacacccg
cttcagccgc 3600ctgggcaaga tcggcatggg ccgcgactgg ctgatctccg
actgcaacac cggcgagatc 3660ctggtgcgcg ccaccagcgc ctacgccatg
atgaaccaga agacccgccg cctgtccaag 3720ctgccctacg aggtgcacca
ggagatcgtg cccctgttcg tggacagccc cgtgatcgag 3780gactccgacc
tgaaggtgca caagttcaag gtgaagaccg gcgacagcat ccagaagggc
3840ctgacccccg gctggaacga cctggacgtg aaccagcacg tgtccaacgt
gaagtacatc 3900ggctggatcc tggagagcat gcccaccgag gtgctggaga
cccaggagct gtgctccctg 3960gccctggagt accgccgcga gtgcggccgc
gactccgtgc tggagagcgt gaccgccatg 4020gaccccagca aggtgggcgt
gcgctcccag taccagcacc tgctgcgcct ggaggacggc 4080accgccatcg
tgaacggcgc caccgagtgg cgccccaaga acgccggcgc caacggcgcc
4140atctccaccg gcaagaccag caacggcaac tccgtgtcca tggactacaa
ggaccacgac 4200ggcgactaca aggaccacga catcgactac aaggacgacg
acgacaagtg actcgaggca 4260gcagcagctc ggatagtatc gacacactct
ggacgctggt cgtgtgatgg actgttgccg 4320ccacacttgc tgccttgacc
tgtgaatatc cctgccgctt ttatcaaaca gcctcagtgt 4380gtttgatctt
gtgtgtacgc gcttttgcga gttgctagct gcttgtgcta tttgcgaata
4440ccacccccag catccccttc cctcgtttca tatcgcttgc atcccaaccg
caacttatct 4500acgctgtcct gctatccctc agcgctgctc ctgctcctgc
tcactgcccc tcgcacagcc 4560ttggtttggg ctccgcctgt attctcctgg
tactgcaacc tgtaaaccag cactgcaatg 4620ctgatgcacg ggaagtagtg
ggatgggaac acaaatggaa agctt 4665814668DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
81ggtacccgcc tgcaacgcaa gggcagccac agccgctccc acccgccgct gaaccgacac
60gtgcttgggc gcctgccgcc tgcctgccgc atgcttgtgc tggtgaggct gggcagtgct
120gccatgctga ttgaggcttg gttcatcggg tggaagctta tgtgtgtgct
gggcttgcat 180gccgggcaat gcgcatggtg gcaagagggc ggcagcactt
gctggagctg ccgcggtgcc 240tccaggtggt tcaatcgcgg cagccagagg
gatttcagat gatcgcgcgt acaggttgag 300cagcagtgtc agcaaaggta
gcagtttgcc agaatgatcg gttcagctgt taatcaatgc 360cagcaagaga
aggggtcaag tgcaaacacg ggcatgccac agcacgggca ccggggagtg
420gaatggcacc accaagtgtg tgcgagccag catcgccgcc tggctgtttc
agctacaacg 480gcaggagtca tccaacgtaa ccatgagctg atcaacactg
caatcatcgg gcgggcgtga 540tgcaagcatg cctggcgaag acacatggtg
tgcggatgct gccggctgct gcctgctgcg 600cacgccgttg agttggcagc
aggctcagcc atgcactgga tggcagctgg gctgccactg 660caatgtggtg
gataggatgc aagtggagcg aataccaaac cctctggctg cttgctgggt
720tgcatggcat cgcaccatca gcaggagcgc atgcgaaggg actggcccca
tgcacgccat 780gccaaaccgg agcgcaccga gtgtccacac tgtcaccagg
cccgcaagct ttgcagaacc 840atgctcatgg acgcatgtag cgctgacgtc
ccttgacggc gctcctctcg ggtgtgggaa 900acgcaatgca gcacaggcag
cagaggcggc ggcagcagag cggcggcagc agcggcgggg 960gccacccttc
ttgcggggtc gcgccccagc cagcggtgat gcgctgatcc caaacgagtt
1020cacattcatt tgcatgcctg gagaagcgag gctggggcct ttgggctggt
gcagcccgca 1080atggaatgcg ggaccgccag gctagcagca aaggcgcctc
ccctactccg catcgatgtt 1140ccatagtgca ttggactgca tttgggtggg
gcggccggct gtttctttcg tgttgcaaaa 1200cgcgccagct cagcaacctg
tcccgtgggt cccccgtgcc gatgaaatcg tgtgcacgcc 1260gatcagctga
ttgcccggct cgcgaagtag gcgccctcct ttctgctcgc cctctctccg
1320tcccgcctct agaatatcaa tgatcgagca ggacggcctc cacgccggct
cccccgccgc 1380ctgggtggag cgcctgttcg gctacgactg ggcccagcag
accatcggct gctccgacgc 1440cgccgtgttc cgcctgtccg cccagggccg
ccccgtgctg ttcgtgaaga ccgacctgtc 1500cggcgccctg aacgagctgc
aggacgaggc cgcccgcctg tcctggctgg ccaccaccgg 1560cgtgccctgc
gccgccgtgc tggacgtggt gaccgaggcc ggccgcgact ggctgctgct
1620gggcgaggtg cccggccagg acctgctgtc ctcccacctg gcccccgccg
agaaggtgtc 1680catcatggcc gacgccatgc gccgcctgca caccctggac
cccgccacct gccccttcga 1740ccaccaggcc aagcaccgca tcgagcgcgc
ccgcacccgc atggaggccg gcctggtgga 1800ccaggacgac ctggacgagg
agcaccaggg cctggccccc gccgagctgt tcgcccgcct 1860gaaggcccgc
atgcccgacg gcgaggacct ggtggtgacc cacggcgacg cctgcctgcc
1920caacatcatg gtggagaacg gccgcttctc cggcttcatc gactgcggcc
gcctgggcgt 1980ggccgaccgc taccaggaca tcgccctggc cacccgcgac
atcgccgagg agctgggcgg 2040cgagtgggcc gaccgcttcc tggtgctgta
cggcatcgcc gcccccgact cccagcgcat 2100cgccttctac cgcctgctgg
acgagttctt ctgacaattg gcagcagcag ctcggatagt 2160atcgacacac
tctggacgct ggtcgtgtga tggactgttg ccgccacact tgctgccttg
2220acctgtgaat atccctgccg cttttatcaa acagcctcag tgtgtttgat
cttgtgtgta 2280cgcgcttttg cgagttgcta gctgcttgtg ctatttgcga
ataccacccc cagcatcccc 2340ttccctcgtt tcatatcgct tgcatcccaa
ccgcaactta tctacgctgt cctgctatcc 2400ctcagcgctg ctcctgctcc
tgctcactgc ccctcgcaca gccttggttt gggctccgcc 2460tgtattctcc
tggtactgca acctgtaaac cagcactgca atgctgatgc acgggaagta
2520gtgggatggg aacacaaatg gaggatcccg cgtctcgaac agagcgcgca
gaggaacgct 2580gaaggtctcg cctctgtcgc acctcagcgc ggcatacacc
acaataacca cctgacgaat 2640gcgcttggtt cttcgtccat tagcgaagcg
tccggttcac acacgtgcca cgttggcgag 2700gtggcaggtg acaatgatcg
gtggagctga tggtcgaaac gttcacagcc tagggatatc 2760gaattccttt
cttgcgctat gacacttcca gcaaaaggta gggcgggctg cgagacggct
2820tcccggcgct gcatgcaaca ccgatgatgc ttcgaccccc cgaagctcct
tcggggctgc 2880atgggcgctc cgatgccgct ccagggcgag cgctgtttaa
atagccaggc ccccgattgc 2940aaagacatta tagcgagcta ccaaagccat
attcaaacac ctagatcact accacttcta 3000cacaggccac tcgagcttgt
gatcgcactc cgctaagggg gcgcctcttc ctcttcgttt 3060cagtcacaac
ccgcaaacac tagtatggct atcaagacga acaggcagcc tgtggagaag
3120cctccgttca cgatcgggac gctgcgcaag gccatccccg cgcactgttt
cgagcgctcg 3180gcgcttcgtg ggcgcgccca gctgcccgac tggagccgcc
tgctgaccgc catcaccacc 3240gtgttcgtga agtccaagcg ccccgacatg
cacgaccgca agtccaagcg ccccgacatg 3300ctggtggaca gcttcggcct
ggagtccacc gtgcaggacg gcctggtgtt ccgccagtcc 3360ttctccatcc
gctcctacga gatcggcacc gaccgcaccg ccagcatcga gaccctgatg
3420aaccacctgc aggagacctc cctgaaccac tgcaagagca ccggcatcct
gctggacggc 3480ttcggccgca ccctggagat gtgcaagcgc gacctgatct
gggtggtgat caagatgcag 3540atcaaggtga accgctaccc cgcctggggc
gacaccgtgg agatcaacac ccgcttcagc 3600cgcctgggca agatcggcat
gggccgcgac tggctgatct ccgactgcaa caccggcgag 3660atcctggtgc
gcgccaccag cgcctacgcc atgatgaacc agaagacccg ccgcctgtcc
3720aagctgccct acgaggtgca ccaggagatc gtgcccctgt tcgtggacag
ccccgtgatc 3780gaggactccg acctgaaggt gcacaagttc aaggtgaaga
ccggcgacag catccagaag 3840ggcctgaccc ccggctggaa cgacctggac
gtgaaccagc acgtgtccaa cgtgaagtac 3900atcggctgga tcctggagag
catgcccacc gaggtgctgg agacccagga gctgtgctcc 3960ctggccctgg
agtaccgccg cgagtgcggc cgcgactccg tgctggagag cgtgaccgcc
4020atggacccca gcaaggtggg cgtgcgctcc cagtaccagc acctgctgcg
cctggaggac 4080ggcaccgcca tcgtgaacgg cgccaccgag tggcgcccca
agaacgccgg cgccaacggc 4140gccatctcca ccggcaagac cagcaacggc
aactccgtgt ccatggacta caaggaccac 4200gacggcgact acaaggacca
cgacatcgac tacaaggacg acgacgacaa gtgactcgag 4260gcagcagcag
ctcggatagt atcgacacac tctggacgct ggtcgtgtga tggactgttg
4320ccgccacact tgctgccttg acctgtgaat atccctgccg cttttatcaa
acagcctcag 4380tgtgtttgat cttgtgtgta cgcgcttttg cgagttgcta
gctgcttgtg ctatttgcga 4440ataccacccc cagcatcccc ttccctcgtt
tcatatcgct tgcatcccaa ccgcaactta 4500tctacgctgt cctgctatcc
ctcagcgctg ctcctgctcc tgctcactgc ccctcgcaca 4560gccttggttt
gggctccgcc tgtattctcc tggtactgca acctgtaaac cagcactgca
4620atgctgatgc acgggaagta gtgggatggg aacacaaatg gaaagctt
4668824668DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 82ggtacccgcc tgcaacgcaa gggcagccac
agccgctccc acccgccgct gaaccgacac 60gtgcttgggc gcctgccgcc tgcctgccgc
atgcttgtgc tggtgaggct gggcagtgct 120gccatgctga ttgaggcttg
gttcatcggg tggaagctta tgtgtgtgct gggcttgcat 180gccgggcaat
gcgcatggtg gcaagagggc ggcagcactt gctggagctg ccgcggtgcc
240tccaggtggt tcaatcgcgg cagccagagg gatttcagat gatcgcgcgt
acaggttgag 300cagcagtgtc agcaaaggta gcagtttgcc agaatgatcg
gttcagctgt taatcaatgc 360cagcaagaga aggggtcaag tgcaaacacg
ggcatgccac agcacgggca ccggggagtg 420gaatggcacc accaagtgtg
tgcgagccag catcgccgcc tggctgtttc agctacaacg 480gcaggagtca
tccaacgtaa ccatgagctg atcaacactg caatcatcgg gcgggcgtga
540tgcaagcatg cctggcgaag acacatggtg tgcggatgct gccggctgct
gcctgctgcg 600cacgccgttg agttggcagc aggctcagcc atgcactgga
tggcagctgg gctgccactg 660caatgtggtg gataggatgc aagtggagcg
aataccaaac cctctggctg cttgctgggt 720tgcatggcat cgcaccatca
gcaggagcgc atgcgaaggg actggcccca tgcacgccat 780gccaaaccgg
agcgcaccga gtgtccacac tgtcaccagg cccgcaagct ttgcagaacc
840atgctcatgg acgcatgtag cgctgacgtc ccttgacggc gctcctctcg
ggtgtgggaa 900acgcaatgca gcacaggcag cagaggcggc ggcagcagag
cggcggcagc agcggcgggg 960gccacccttc ttgcggggtc gcgccccagc
cagcggtgat gcgctgatcc caaacgagtt 1020cacattcatt tgcatgcctg
gagaagcgag gctggggcct ttgggctggt gcagcccgca 1080atggaatgcg
ggaccgccag gctagcagca aaggcgcctc ccctactccg catcgatgtt
1140ccatagtgca ttggactgca tttgggtggg gcggccggct gtttctttcg
tgttgcaaaa 1200cgcgccagct cagcaacctg tcccgtgggt cccccgtgcc
gatgaaatcg tgtgcacgcc 1260gatcagctga ttgcccggct cgcgaagtag
gcgccctcct ttctgctcgc cctctctccg 1320tcccgcctct agaatatcaa
tgatcgagca ggacggcctc cacgccggct cccccgccgc 1380ctgggtggag
cgcctgttcg gctacgactg ggcccagcag accatcggct gctccgacgc
1440cgccgtgttc cgcctgtccg cccagggccg ccccgtgctg ttcgtgaaga
ccgacctgtc 1500cggcgccctg aacgagctgc aggacgaggc cgcccgcctg
tcctggctgg ccaccaccgg 1560cgtgccctgc gccgccgtgc tggacgtggt
gaccgaggcc ggccgcgact ggctgctgct 1620gggcgaggtg cccggccagg
acctgctgtc ctcccacctg gcccccgccg agaaggtgtc 1680catcatggcc
gacgccatgc gccgcctgca caccctggac cccgccacct gccccttcga
1740ccaccaggcc aagcaccgca tcgagcgcgc ccgcacccgc atggaggccg
gcctggtgga 1800ccaggacgac ctggacgagg agcaccaggg cctggccccc
gccgagctgt tcgcccgcct 1860gaaggcccgc atgcccgacg gcgaggacct
ggtggtgacc cacggcgacg cctgcctgcc 1920caacatcatg gtggagaacg
gccgcttctc cggcttcatc gactgcggcc gcctgggcgt 1980ggccgaccgc
taccaggaca tcgccctggc cacccgcgac atcgccgagg agctgggcgg
2040cgagtgggcc gaccgcttcc tggtgctgta cggcatcgcc gcccccgact
cccagcgcat 2100cgccttctac cgcctgctgg acgagttctt ctgacaattg
gcagcagcag ctcggatagt 2160atcgacacac tctggacgct ggtcgtgtga
tggactgttg ccgccacact tgctgccttg 2220acctgtgaat atccctgccg
cttttatcaa acagcctcag tgtgtttgat cttgtgtgta 2280cgcgcttttg
cgagttgcta gctgcttgtg ctatttgcga ataccacccc cagcatcccc
2340ttccctcgtt tcatatcgct tgcatcccaa ccgcaactta tctacgctgt
cctgctatcc 2400ctcagcgctg ctcctgctcc tgctcactgc ccctcgcaca
gccttggttt gggctccgcc 2460tgtattctcc tggtactgca acctgtaaac
cagcactgca atgctgatgc acgggaagta 2520gtgggatggg aacacaaatg
gaggatcccg cgtctcgaac agagcgcgca gaggaacgct 2580gaaggtctcg
cctctgtcgc acctcagcgc ggcatacacc acaataacca cctgacgaat
2640gcgcttggtt cttcgtccat tagcgaagcg tccggttcac acacgtgcca
cgttggcgag 2700gtggcaggtg acaatgatcg gtggagctga tggtcgaaac
gttcacagcc tagggatatc 2760gaattccttt cttgcgctat gacacttcca
gcaaaaggta gggcgggctg cgagacggct 2820tcccggcgct gcatgcaaca
ccgatgatgc ttcgaccccc cgaagctcct tcggggctgc 2880atgggcgctc
cgatgccgct ccagggcgag cgctgtttaa atagccaggc ccccgattgc
2940aaagacatta tagcgagcta ccaaagccat attcaaacac ctagatcact
accacttcta 3000cacaggccac tcgagcttgt gatcgcactc cgctaagggg
gcgcctcttc ctcttcgttt 3060cagtcacaac ccgcaaacac tagtatggcc
accgcatcca ctttctcggc gttcaatgcc 3120cgctgcggcg acctgcgtcg
ctcggcgggc tccgggcccc ggcgcccagc gaggcccctc 3180cccgtgcgcg
ggcgcgccca gctgcccgac tggagccgcc tgctgaccgc catcaccacc
3240gtgttcgtga agtccaagcg ccccgacatg cacgaccgca agtccaagcg
ccccgacatg 3300ctggtggaca gcttcggcct ggagtccacc gtgcaggacg
gcctggtgtt ccgccagtcc 3360ttctccatcc gctcctacga gatcggcacc
gaccgcaccg ccagcatcga gaccctgatg 3420aaccacctgc aggagacctc
cctgaaccac tgcaagagca ccggcatcct gctggacggc 3480ttcggccgca
ccctggagat gtgcaagcgc gacctgatct gggtggtgat caagatgcag
3540atcaaggtga accgctaccc cgcctggggc gacaccgtgg agatcaacac
ccgcttcagc 3600cgcctgggca agatcggcat gggccgcgac tggctgatct
ccgactgcaa caccggcgag 3660atcctggtgc gcgccaccag cgcctacgcc
atgatgaacc agaagacccg ccgcctgtcc 3720aagctgccct acgaggtgca
ccaggagatc gtgcccctgt tcgtggacag ccccgtgatc 3780gaggactccg
acctgaaggt gcacaagttc aaggtgaaga ccggcgacag catccagaag
3840ggcctgaccc ccggctggaa cgacctggac gtgaaccagc acgtgtccaa
cgtgaagtac 3900atcggctgga tcctggagag catgcccacc gaggtgctgg
agacccagga gctgtgctcc 3960ctggccctgg agtaccgccg cgagtgcggc
cgcgactccg tgctggagag cgtgaccgcc 4020atggacccca gcaaggtggg
cgtgcgctcc cagtaccagc acctgctgcg cctggaggac 4080ggcaccgcca
tcgtgaacgg cgccaccgag tggcgcccca agaacgccgg cgccaacggc
4140gccatctcca ccggcaagac cagcaacggc aactccgtgt ccatggacta
caaggaccac 4200gacggcgact acaaggacca cgacatcgac tacaaggacg
acgacgacaa gtgactcgag 4260gcagcagcag ctcggatagt atcgacacac
tctggacgct ggtcgtgtga tggactgttg 4320ccgccacact tgctgccttg
acctgtgaat atccctgccg cttttatcaa acagcctcag 4380tgtgtttgat
cttgtgtgta cgcgcttttg cgagttgcta gctgcttgtg ctatttgcga
4440ataccacccc cagcatcccc ttccctcgtt tcatatcgct tgcatcccaa
ccgcaactta 4500tctacgctgt cctgctatcc ctcagcgctg ctcctgctcc
tgctcactgc ccctcgcaca 4560gccttggttt gggctccgcc tgtattctcc
tggtactgca acctgtaaac cagcactgca 4620atgctgatgc acgggaagta
gtgggatggg aacacaaatg gaaagctt 4668834656DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
83ggtacccgcc tgcaacgcaa gggcagccac agccgctccc acccgccgct gaaccgacac
60gtgcttgggc gcctgccgcc tgcctgccgc atgcttgtgc tggtgaggct gggcagtgct
120gccatgctga ttgaggcttg gttcatcggg tggaagctta tgtgtgtgct
gggcttgcat 180gccgggcaat gcgcatggtg gcaagagggc ggcagcactt
gctggagctg ccgcggtgcc 240tccaggtggt tcaatcgcgg cagccagagg
gatttcagat gatcgcgcgt acaggttgag 300cagcagtgtc agcaaaggta
gcagtttgcc agaatgatcg gttcagctgt taatcaatgc 360cagcaagaga
aggggtcaag tgcaaacacg ggcatgccac agcacgggca ccggggagtg
420gaatggcacc accaagtgtg tgcgagccag catcgccgcc tggctgtttc
agctacaacg 480gcaggagtca tccaacgtaa ccatgagctg atcaacactg
caatcatcgg gcgggcgtga 540tgcaagcatg cctggcgaag acacatggtg
tgcggatgct gccggctgct gcctgctgcg 600cacgccgttg agttggcagc
aggctcagcc atgcactgga tggcagctgg gctgccactg 660caatgtggtg
gataggatgc aagtggagcg aataccaaac cctctggctg cttgctgggt
720tgcatggcat cgcaccatca gcaggagcgc atgcgaaggg actggcccca
tgcacgccat 780gccaaaccgg agcgcaccga gtgtccacac tgtcaccagg
cccgcaagct ttgcagaacc 840atgctcatgg acgcatgtag cgctgacgtc
ccttgacggc gctcctctcg ggtgtgggaa 900acgcaatgca gcacaggcag
cagaggcggc ggcagcagag cggcggcagc agcggcgggg 960gccacccttc
ttgcggggtc gcgccccagc cagcggtgat gcgctgatcc caaacgagtt
1020cacattcatt tgcatgcctg gagaagcgag gctggggcct ttgggctggt
gcagcccgca 1080atggaatgcg ggaccgccag gctagcagca aaggcgcctc
ccctactccg catcgatgtt 1140ccatagtgca ttggactgca tttgggtggg
gcggccggct gtttctttcg tgttgcaaaa 1200cgcgccagct cagcaacctg
tcccgtgggt cccccgtgcc gatgaaatcg tgtgcacgcc 1260gatcagctga
ttgcccggct cgcgaagtag gcgccctcct ttctgctcgc cctctctccg
1320tcccgcctct agaatatcaa tgatcgagca ggacggcctc cacgccggct
cccccgccgc 1380ctgggtggag cgcctgttcg gctacgactg ggcccagcag
accatcggct gctccgacgc 1440cgccgtgttc cgcctgtccg cccagggccg
ccccgtgctg ttcgtgaaga ccgacctgtc 1500cggcgccctg aacgagctgc
aggacgaggc cgcccgcctg tcctggctgg ccaccaccgg 1560cgtgccctgc
gccgccgtgc tggacgtggt gaccgaggcc ggccgcgact ggctgctgct
1620gggcgaggtg cccggccagg acctgctgtc ctcccacctg gcccccgccg
agaaggtgtc 1680catcatggcc gacgccatgc gccgcctgca caccctggac
cccgccacct gccccttcga 1740ccaccaggcc aagcaccgca tcgagcgcgc
ccgcacccgc atggaggccg gcctggtgga 1800ccaggacgac ctggacgagg
agcaccaggg cctggccccc gccgagctgt tcgcccgcct 1860gaaggcccgc
atgcccgacg gcgaggacct ggtggtgacc cacggcgacg cctgcctgcc
1920caacatcatg gtggagaacg gccgcttctc cggcttcatc gactgcggcc
gcctgggcgt 1980ggccgaccgc taccaggaca tcgccctggc cacccgcgac
atcgccgagg agctgggcgg 2040cgagtgggcc gaccgcttcc tggtgctgta
cggcatcgcc gcccccgact cccagcgcat 2100cgccttctac cgcctgctgg
acgagttctt ctgacaattg gcagcagcag ctcggatagt 2160atcgacacac
tctggacgct ggtcgtgtga tggactgttg ccgccacact tgctgccttg
2220acctgtgaat atccctgccg cttttatcaa acagcctcag tgtgtttgat
cttgtgtgta 2280cgcgcttttg cgagttgcta gctgcttgtg ctatttgcga
ataccacccc cagcatcccc 2340ttccctcgtt tcatatcgct tgcatcccaa
ccgcaactta tctacgctgt cctgctatcc 2400ctcagcgctg ctcctgctcc
tgctcactgc ccctcgcaca gccttggttt gggctccgcc 2460tgtattctcc
tggtactgca acctgtaaac cagcactgca atgctgatgc acgggaagta
2520gtgggatggg aacacaaatg gaggatcccg cgtctcgaac agagcgcgca
gaggaacgct 2580gaaggtctcg cctctgtcgc acctcagcgc ggcatacacc
acaataacca cctgacgaat 2640gcgcttggtt cttcgtccat tagcgaagcg
tccggttcac acacgtgcca cgttggcgag 2700gtggcaggtg acaatgatcg
gtggagctga tggtcgaaac gttcacagcc tagggatatc 2760gaattccttt
cttgcgctat gacacttcca gcaaaaggta gggcgggctg cgagacggct
2820tcccggcgct gcatgcaaca ccgatgatgc ttcgaccccc cgaagctcct
tcggggctgc 2880atgggcgctc cgatgccgct ccagggcgag cgctgtttaa
atagccaggc ccccgattgc 2940aaagacatta tagcgagcta ccaaagccat
attcaaacac ctagatcact accacttcta 3000cacaggccac tcgagcttgt
gatcgcactc cgctaagggg gcgcctcttc ctcttcgttt 3060cagtcacaac
ccgcaaacac tagtatggct tccgcggcat tcaccatgtc ggcgtgcccc
3120gcgatgactg gcagggcccc tggggcacgt cgctccggac ggccagtcgc
cacccgcctg 3180agggggcgcg cccccgactg gagccgcctg ctgaccgcca
tcaccaccgt gttcgtgaag 3240tccaagcgcc ccgacatgca cgaccgcaag
tccaagcgcc ccgacatgct ggtggacagc 3300ttcggcctgg agtccaccgt
gcaggacggc ctggtgttcc gccagtcctt ctccatccgc 3360tcctacgaga
tcggcaccga ccgcaccgcc agcatcgaga ccctgatgaa ccacctgcag
3420gagacctccc tgaaccactg caagagcacc ggcatcctgc tggacggctt
cggccgcacc 3480ctggagatgt gcaagcgcga cctgatctgg gtggtgatca
agatgcagat caaggtgaac 3540cgctaccccg cctggggcga caccgtggag
atcaacaccc gcttcagccg cctgggcaag 3600atcggcatgg gccgcgactg
gctgatctcc gactgcaaca ccggcgagat cctggtgcgc 3660gccaccagcg
cctacgccat gatgaaccag aagacccgcc gcctgtccaa gctgccctac
3720gaggtgcacc aggagatcgt gcccctgttc gtggacagcc ccgtgatcga
ggactccgac 3780ctgaaggtgc acaagttcaa ggtgaagacc ggcgacagca
tccagaaggg cctgaccccc 3840ggctggaacg acctggacgt gaaccagcac
gtgtccaacg tgaagtacat cggctggatc 3900ctggagagca tgcccaccga
ggtgctggag acccaggagc tgtgctccct ggccctggag 3960taccgccgcg
agtgcggccg cgactccgtg ctggagagcg tgaccgccat ggaccccagc
4020aaggtgggcg tgcgctccca gtaccagcac ctgctgcgcc tggaggacgg
caccgccatc 4080gtgaacggcg ccaccgagtg gcgccccaag aacgccggcg
ccaacggcgc catctccacc 4140ggcaagacca gcaacggcaa ctccgtgtcc
atggactaca aggaccacga cggcgactac 4200aaggaccacg acatcgacta
caaggacgac gacgacaagt gactcgaggc agcagcagct 4260cggatagtat
cgacacactc tggacgctgg tcgtgtgatg gactgttgcc gccacacttg
4320ctgccttgac ctgtgaatat ccctgccgct tttatcaaac agcctcagtg
tgtttgatct 4380tgtgtgtacg cgcttttgcg agttgctagc tgcttgtgct
atttgcgaat accaccccca 4440gcatcccctt ccctcgtttc atatcgcttg
catcccaacc gcaacttatc tacgctgtcc 4500tgctatccct cagcgctgct
cctgctcctg ctcactgccc ctcgcacagc cttggtttgg 4560gctccgcctg
tattctcctg gtactgcaac ctgtaaacca gcactgcaat gctgatgcac
4620gggaagtagt gggatgggaa cacaaatgga aagctt 4656844721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
84ggtacccgcc tgcaacgcaa gggcagccac agccgctccc acccgccgct gaaccgacac
60gtgcttgggc gcctgccgcc tgcctgccgc atgcttgtgc tggtgaggct gggcagtgct
120gccatgctga ttgaggcttg gttcatcggg tggaagctta tgtgtgtgct
gggcttgcat 180gccgggcaat gcgcatggtg gcaagagggc ggcagcactt
gctggagctg ccgcggtgcc 240tccaggtggt tcaatcgcgg cagccagagg
gatttcagat gatcgcgcgt acaggttgag 300cagcagtgtc agcaaaggta
gcagtttgcc agaatgatcg gttcagctgt taatcaatgc 360cagcaagaga
aggggtcaag tgcaaacacg ggcatgccac agcacgggca ccggggagtg
420gaatggcacc accaagtgtg tgcgagccag catcgccgcc tggctgtttc
agctacaacg 480gcaggagtca tccaacgtaa ccatgagctg atcaacactg
caatcatcgg gcgggcgtga 540tgcaagcatg cctggcgaag acacatggtg
tgcggatgct gccggctgct gcctgctgcg 600cacgccgttg agttggcagc
aggctcagcc atgcactgga tggcagctgg gctgccactg 660caatgtggtg
gataggatgc aagtggagcg aataccaaac cctctggctg cttgctgggt
720tgcatggcat cgcaccatca gcaggagcgc atgcgaaggg actggcccca
tgcacgccat 780gccaaaccgg agcgcaccga gtgtccacac tgtcaccagg
cccgcaagct ttgcagaacc 840atgctcatgg acgcatgtag cgctgacgtc
ccttgacggc gctcctctcg ggtgtgggaa 900acgcaatgca gcacaggcag
cagaggcggc ggcagcagag cggcggcagc agcggcgggg 960gccacccttc
ttgcggggtc gcgccccagc cagcggtgat gcgctgatcc caaacgagtt
1020cacattcatt tgcatgcctg gagaagcgag gctggggcct ttgggctggt
gcagcccgca 1080atggaatgcg ggaccgccag gctagcagca aaggcgcctc
ccctactccg catcgatgtt 1140ccatagtgca ttggactgca tttgggtggg
gcggccggct gtttctttcg tgttgcaaaa 1200cgcgccagct cagcaacctg
tcccgtgggt cccccgtgcc gatgaaatcg tgtgcacgcc 1260gatcagctga
ttgcccggct cgcgaagtag gcgccctcct ttctgctcgc cctctctccg
1320tcccgcctct agaatatcaa tgatcgagca ggacggcctc cacgccggct
cccccgccgc 1380ctgggtggag cgcctgttcg gctacgactg ggcccagcag
accatcggct gctccgacgc 1440cgccgtgttc cgcctgtccg cccagggccg
ccccgtgctg ttcgtgaaga ccgacctgtc 1500cggcgccctg aacgagctgc
aggacgaggc cgcccgcctg tcctggctgg ccaccaccgg 1560cgtgccctgc
gccgccgtgc tggacgtggt gaccgaggcc ggccgcgact ggctgctgct
1620gggcgaggtg cccggccagg acctgctgtc ctcccacctg gcccccgccg
agaaggtgtc 1680catcatggcc gacgccatgc gccgcctgca caccctggac
cccgccacct gccccttcga 1740ccaccaggcc aagcaccgca tcgagcgcgc
ccgcacccgc atggaggccg gcctggtgga 1800ccaggacgac ctggacgagg
agcaccaggg cctggccccc gccgagctgt tcgcccgcct 1860gaaggcccgc
atgcccgacg gcgaggacct ggtggtgacc cacggcgacg cctgcctgcc
1920caacatcatg gtggagaacg gccgcttctc cggcttcatc gactgcggcc
gcctgggcgt 1980ggccgaccgc taccaggaca tcgccctggc cacccgcgac
atcgccgagg agctgggcgg 2040cgagtgggcc gaccgcttcc tggtgctgta
cggcatcgcc gcccccgact cccagcgcat 2100cgccttctac cgcctgctgg
acgagttctt ctgacaattg gcagcagcag ctcggatagt 2160atcgacacac
tctggacgct ggtcgtgtga tggactgttg ccgccacact tgctgccttg
2220acctgtgaat atccctgccg cttttatcaa acagcctcag tgtgtttgat
cttgtgtgta 2280cgcgcttttg cgagttgcta gctgcttgtg ctatttgcga
ataccacccc cagcatcccc 2340ttccctcgtt tcatatcgct tgcatcccaa
ccgcaactta tctacgctgt cctgctatcc 2400ctcagcgctg ctcctgctcc
tgctcactgc ccctcgcaca gccttggttt gggctccgcc 2460tgtattctcc
tggtactgca acctgtaaac cagcactgca atgctgatgc acgggaagta
2520gtgggatggg aacacaaatg gaggatcccg cgtctcgaac agagcgcgca
gaggaacgct 2580gaaggtctcg cctctgtcgc acctcagcgc ggcatacacc
acaataacca cctgacgaat 2640gcgcttggtt cttcgtccat tagcgaagcg
tccggttcac acacgtgcca cgttggcgag 2700gtggcaggtg acaatgatcg
gtggagctga tggtcgaaac gttcacagcc tagggatatc 2760gaattccttt
cttgcgctat gacacttcca gcaaaaggta gggcgggctg cgagacggct
2820tcccggcgct gcatgcaaca ccgatgatgc ttcgaccccc cgaagctcct
tcggggctgc 2880atgggcgctc cgatgccgct ccagggcgag cgctgtttaa
atagccaggc ccccgattgc 2940aaagacatta tagcgagcta ccaaagccat
attcaaacac ctagatcact accacttcta 3000cacaggccac tcgagcttgt
gatcgcactc cgctaagggg gcgcctcttc ctcttcgttt 3060cagtcacaac
ccgcaaacgg cgcgccatgg ccaccaccag cctggcctcc gccttctgct
3120ccatgaaggc cgtgatgctg gcccgcgacg gccgcggcat gaagccccgc
agctccgacc 3180tgcagctgcg cgccggcaac gcccccacct ccctgaagat
gatcaacggc accaagttca 3240gctacaccga gagcctgaag cgcctgcccg
actggtccat gctgttcgcc gtgatcacca 3300ccatcttcag cgccgccgag
aagcagtgga ccaacctgga gtggaagccc aagcccaagc 3360tgccccagct
gctggacgac cacttcggcc tgcacggcct ggtgttccgc cgcaccttcg
3420ccatccgctc ctacgaggtg ggccccgacc gcagcacctc catcctggcc
gtgatgaacc 3480acatgcagga ggccaccctg aaccacgcca agagcgtggg
catcctgggc gacggcttcg 3540gcaccaccct ggagatgtcc aagcgcgacc
tgatgtgggt ggtgcgccgc acccacgtgg 3600ccgtggagcg ctaccccacc
tggggcgaca ccgtggaggt ggagtgctgg atcggcgcca 3660gcggcaacaa
cggcatgcgc cgcgacttcc tggtgcgcga ctgcaagacc ggcgagatcc
3720tgacccgctg cacctccctg agcgtgctga tgaacacccg cacccgccgc
ctgagcacca 3780tccccgacga ggtgcgcggc gagatcggcc ccgccttcat
cgacaacgtg gccgtgaagg 3840acgacgagat caagaagctg cagaagctga
acgactccac cgccgactac atccagggcg 3900gcctgacccc ccgctggaac
gacctggacg tgaaccagca cgtgaacaac ctgaagtacg 3960tggcctgggt
gttcgagacc gtgcccgaca gcatcttcga gtcccaccac atcagctcct
4020tcaccctgga gtaccgccgc gagtgcaccc gcgactccgt gctgcgcagc
ctgaccaccg 4080tgagcggcgg cagctccgag gccggcctgg tgtgcgacca
cctgctgcag ctggagggcg 4140gcagcgaggt gctgcgcgcc cgcaccgagt
ggcgccccaa gctgaccgac tccttccgcg 4200gcatcagcgt gatccccgcc
gagccccgcg tgatggacta caaggaccac gacggcgact 4260acaaggacca
cgacatcgac tacaaggacg acgacgacaa gtgatgactc gaggcagcag
4320cagctcggat agtatcgaca cactctggac gctggtcgtg tgatggactg
ttgccgccac 4380acttgctgcc ttgacctgtg aatatccctg ccgcttttat
caaacagcct cagtgtgttt 4440gatcttgtgt gtacgcgctt ttgcgagttg
ctagctgctt gtgctatttg cgaataccac 4500ccccagcatc cccttccctc
gtttcatatc gcttgcatcc caaccgcaac ttatctacgc 4560tgtcctgcta
tccctcagcg ctgctcctgc tcctgctcac tgcccctcgc acagccttgg
4620tttgggctcc gcctgtattc tcctggtact gcaacctgta aaccagcact
gcaatgctga 4680tgcacgggaa gtagtgggat gggaacacaa atggaaagct t
4721854650DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 85ggtacccgcc tgcaacgcaa gggcagccac
agccgctccc acccgccgct gaaccgacac 60gtgcttgggc gcctgccgcc tgcctgccgc
atgcttgtgc tggtgaggct gggcagtgct 120gccatgctga ttgaggcttg
gttcatcggg tggaagctta tgtgtgtgct gggcttgcat 180gccgggcaat
gcgcatggtg gcaagagggc ggcagcactt gctggagctg ccgcggtgcc
240tccaggtggt tcaatcgcgg cagccagagg gatttcagat gatcgcgcgt
acaggttgag 300cagcagtgtc agcaaaggta gcagtttgcc agaatgatcg
gttcagctgt taatcaatgc 360cagcaagaga aggggtcaag tgcaaacacg
ggcatgccac agcacgggca ccggggagtg 420gaatggcacc accaagtgtg
tgcgagccag catcgccgcc tggctgtttc agctacaacg 480gcaggagtca
tccaacgtaa ccatgagctg atcaacactg caatcatcgg gcgggcgtga
540tgcaagcatg cctggcgaag acacatggtg tgcggatgct gccggctgct
gcctgctgcg
600cacgccgttg agttggcagc aggctcagcc atgcactgga tggcagctgg
gctgccactg 660caatgtggtg gataggatgc aagtggagcg aataccaaac
cctctggctg cttgctgggt 720tgcatggcat cgcaccatca gcaggagcgc
atgcgaaggg actggcccca tgcacgccat 780gccaaaccgg agcgcaccga
gtgtccacac tgtcaccagg cccgcaagct ttgcagaacc 840atgctcatgg
acgcatgtag cgctgacgtc ccttgacggc gctcctctcg ggtgtgggaa
900acgcaatgca gcacaggcag cagaggcggc ggcagcagag cggcggcagc
agcggcgggg 960gccacccttc ttgcggggtc gcgccccagc cagcggtgat
gcgctgatcc caaacgagtt 1020cacattcatt tgcatgcctg gagaagcgag
gctggggcct ttgggctggt gcagcccgca 1080atggaatgcg ggaccgccag
gctagcagca aaggcgcctc ccctactccg catcgatgtt 1140ccatagtgca
ttggactgca tttgggtggg gcggccggct gtttctttcg tgttgcaaaa
1200cgcgccagct cagcaacctg tcccgtgggt cccccgtgcc gatgaaatcg
tgtgcacgcc 1260gatcagctga ttgcccggct cgcgaagtag gcgccctcct
ttctgctcgc cctctctccg 1320tcccgcctct agaatatcaa tgatcgagca
ggacggcctc cacgccggct cccccgccgc 1380ctgggtggag cgcctgttcg
gctacgactg ggcccagcag accatcggct gctccgacgc 1440cgccgtgttc
cgcctgtccg cccagggccg ccccgtgctg ttcgtgaaga ccgacctgtc
1500cggcgccctg aacgagctgc aggacgaggc cgcccgcctg tcctggctgg
ccaccaccgg 1560cgtgccctgc gccgccgtgc tggacgtggt gaccgaggcc
ggccgcgact ggctgctgct 1620gggcgaggtg cccggccagg acctgctgtc
ctcccacctg gcccccgccg agaaggtgtc 1680catcatggcc gacgccatgc
gccgcctgca caccctggac cccgccacct gccccttcga 1740ccaccaggcc
aagcaccgca tcgagcgcgc ccgcacccgc atggaggccg gcctggtgga
1800ccaggacgac ctggacgagg agcaccaggg cctggccccc gccgagctgt
tcgcccgcct 1860gaaggcccgc atgcccgacg gcgaggacct ggtggtgacc
cacggcgacg cctgcctgcc 1920caacatcatg gtggagaacg gccgcttctc
cggcttcatc gactgcggcc gcctgggcgt 1980ggccgaccgc taccaggaca
tcgccctggc cacccgcgac atcgccgagg agctgggcgg 2040cgagtgggcc
gaccgcttcc tggtgctgta cggcatcgcc gcccccgact cccagcgcat
2100cgccttctac cgcctgctgg acgagttctt ctgacaattg gcagcagcag
ctcggatagt 2160atcgacacac tctggacgct ggtcgtgtga tggactgttg
ccgccacact tgctgccttg 2220acctgtgaat atccctgccg cttttatcaa
acagcctcag tgtgtttgat cttgtgtgta 2280cgcgcttttg cgagttgcta
gctgcttgtg ctatttgcga ataccacccc cagcatcccc 2340ttccctcgtt
tcatatcgct tgcatcccaa ccgcaactta tctacgctgt cctgctatcc
2400ctcagcgctg ctcctgctcc tgctcactgc ccctcgcaca gccttggttt
gggctccgcc 2460tgtattctcc tggtactgca acctgtaaac cagcactgca
atgctgatgc acgggaagta 2520gtgggatggg aacacaaatg gaggatcccg
cgtctcgaac agagcgcgca gaggaacgct 2580gaaggtctcg cctctgtcgc
acctcagcgc ggcatacacc acaataacca cctgacgaat 2640gcgcttggtt
cttcgtccat tagcgaagcg tccggttcac acacgtgcca cgttggcgag
2700gtggcaggtg acaatgatcg gtggagctga tggtcgaaac gttcacagcc
tagggatatc 2760gaattccttt cttgcgctat gacacttcca gcaaaaggta
gggcgggctg cgagacggct 2820tcccggcgct gcatgcaaca ccgatgatgc
ttcgaccccc cgaagctcct tcggggctgc 2880atgggcgctc cgatgccgct
ccagggcgag cgctgtttaa atagccaggc ccccgattgc 2940aaagacatta
tagcgagcta ccaaagccat attcaaacac ctagatcact accacttcta
3000cacaggccac tcgagcttgt gatcgcactc cgctaagggg gcgcctcttc
ctcttcgttt 3060cagtcacaac ccgcaaacac tagtatgacg ttcggggtcg
ccctcccggc catgggccgc 3120ggtgtctccc ttccccggcc cagggtcgcg
gtgcgcgccc agtcggcgag tcaggttttg 3180gagagcgggc gcgcccccga
ctggtccatg ctgttcgccg tgatcaccac catcttcagc 3240gccgccgaga
agcagtggac caacctggag tggaagccca agcccaagct gccccagctg
3300ctggacgacc acttcggcct gcacggcctg gtgttccgcc gcaccttcgc
catccgctcc 3360tacgaggtgg gccccgaccg cagcacctcc atcctggccg
tgatgaacca catgcaggag 3420gccaccctga accacgccaa gagcgtgggc
atcctgggcg acggcttcgg caccaccctg 3480gagatgtcca agcgcgacct
gatgtgggtg gtgcgccgca cccacgtggc cgtggagcgc 3540taccccacct
ggggcgacac cgtggaggtg gagtgctgga tcggcgccag cggcaacaac
3600ggcatgcgcc gcgacttcct ggtgcgcgac tgcaagaccg gcgagatcct
gacccgctgc 3660acctccctga gcgtgctgat gaacacccgc acccgccgcc
tgagcaccat ccccgacgag 3720gtgcgcggcg agatcggccc cgccttcatc
gacaacgtgg ccgtgaagga cgacgagatc 3780aagaagctgc agaagctgaa
cgactccacc gccgactaca tccagggcgg cctgaccccc 3840cgctggaacg
acctggacgt gaaccagcac gtgaacaacc tgaagtacgt ggcctgggtg
3900ttcgagaccg tgcccgacag catcttcgag tcccaccaca tcagctcctt
caccctggag 3960taccgccgcg agtgcacccg cgactccgtg ctgcgcagcc
tgaccaccgt gagcggcggc 4020agctccgagg ccggcctggt gtgcgaccac
ctgctgcagc tggagggcgg cagcgaggtg 4080ctgcgcgccc gcaccgagtg
gcgccccaag ctgaccgact ccttccgcgg catcagcgtg 4140atccccgccg
agccccgcgt gatggactac aaggaccacg acggcgacta caaggaccac
4200gacatcgact acaaggacga cgacgacaag tgatgactcg aggcagcagc
agctcggata 4260gtatcgacac actctggacg ctggtcgtgt gatggactgt
tgccgccaca cttgctgcct 4320tgacctgtga atatccctgc cgcttttatc
aaacagcctc agtgtgtttg atcttgtgtg 4380tacgcgcttt tgcgagttgc
tagctgcttg tgctatttgc gaataccacc cccagcatcc 4440ccttccctcg
tttcatatcg cttgcatccc aaccgcaact tatctacgct gtcctgctat
4500ccctcagcgc tgctcctgct cctgctcact gcccctcgca cagccttggt
ttgggctccg 4560cctgtattct cctggtactg caacctgtaa accagcactg
caatgctgat gcacgggaag 4620tagtgggatg ggaacacaaa tggaaagctt
4650864653DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 86ggtacccgcc tgcaacgcaa gggcagccac
agccgctccc acccgccgct gaaccgacac 60gtgcttgggc gcctgccgcc tgcctgccgc
atgcttgtgc tggtgaggct gggcagtgct 120gccatgctga ttgaggcttg
gttcatcggg tggaagctta tgtgtgtgct gggcttgcat 180gccgggcaat
gcgcatggtg gcaagagggc ggcagcactt gctggagctg ccgcggtgcc
240tccaggtggt tcaatcgcgg cagccagagg gatttcagat gatcgcgcgt
acaggttgag 300cagcagtgtc agcaaaggta gcagtttgcc agaatgatcg
gttcagctgt taatcaatgc 360cagcaagaga aggggtcaag tgcaaacacg
ggcatgccac agcacgggca ccggggagtg 420gaatggcacc accaagtgtg
tgcgagccag catcgccgcc tggctgtttc agctacaacg 480gcaggagtca
tccaacgtaa ccatgagctg atcaacactg caatcatcgg gcgggcgtga
540tgcaagcatg cctggcgaag acacatggtg tgcggatgct gccggctgct
gcctgctgcg 600cacgccgttg agttggcagc aggctcagcc atgcactgga
tggcagctgg gctgccactg 660caatgtggtg gataggatgc aagtggagcg
aataccaaac cctctggctg cttgctgggt 720tgcatggcat cgcaccatca
gcaggagcgc atgcgaaggg actggcccca tgcacgccat 780gccaaaccgg
agcgcaccga gtgtccacac tgtcaccagg cccgcaagct ttgcagaacc
840atgctcatgg acgcatgtag cgctgacgtc ccttgacggc gctcctctcg
ggtgtgggaa 900acgcaatgca gcacaggcag cagaggcggc ggcagcagag
cggcggcagc agcggcgggg 960gccacccttc ttgcggggtc gcgccccagc
cagcggtgat gcgctgatcc caaacgagtt 1020cacattcatt tgcatgcctg
gagaagcgag gctggggcct ttgggctggt gcagcccgca 1080atggaatgcg
ggaccgccag gctagcagca aaggcgcctc ccctactccg catcgatgtt
1140ccatagtgca ttggactgca tttgggtggg gcggccggct gtttctttcg
tgttgcaaaa 1200cgcgccagct cagcaacctg tcccgtgggt cccccgtgcc
gatgaaatcg tgtgcacgcc 1260gatcagctga ttgcccggct cgcgaagtag
gcgccctcct ttctgctcgc cctctctccg 1320tcccgcctct agaatatcaa
tgatcgagca ggacggcctc cacgccggct cccccgccgc 1380ctgggtggag
cgcctgttcg gctacgactg ggcccagcag accatcggct gctccgacgc
1440cgccgtgttc cgcctgtccg cccagggccg ccccgtgctg ttcgtgaaga
ccgacctgtc 1500cggcgccctg aacgagctgc aggacgaggc cgcccgcctg
tcctggctgg ccaccaccgg 1560cgtgccctgc gccgccgtgc tggacgtggt
gaccgaggcc ggccgcgact ggctgctgct 1620gggcgaggtg cccggccagg
acctgctgtc ctcccacctg gcccccgccg agaaggtgtc 1680catcatggcc
gacgccatgc gccgcctgca caccctggac cccgccacct gccccttcga
1740ccaccaggcc aagcaccgca tcgagcgcgc ccgcacccgc atggaggccg
gcctggtgga 1800ccaggacgac ctggacgagg agcaccaggg cctggccccc
gccgagctgt tcgcccgcct 1860gaaggcccgc atgcccgacg gcgaggacct
ggtggtgacc cacggcgacg cctgcctgcc 1920caacatcatg gtggagaacg
gccgcttctc cggcttcatc gactgcggcc gcctgggcgt 1980ggccgaccgc
taccaggaca tcgccctggc cacccgcgac atcgccgagg agctgggcgg
2040cgagtgggcc gaccgcttcc tggtgctgta cggcatcgcc gcccccgact
cccagcgcat 2100cgccttctac cgcctgctgg acgagttctt ctgacaattg
gcagcagcag ctcggatagt 2160atcgacacac tctggacgct ggtcgtgtga
tggactgttg ccgccacact tgctgccttg 2220acctgtgaat atccctgccg
cttttatcaa acagcctcag tgtgtttgat cttgtgtgta 2280cgcgcttttg
cgagttgcta gctgcttgtg ctatttgcga ataccacccc cagcatcccc
2340ttccctcgtt tcatatcgct tgcatcccaa ccgcaactta tctacgctgt
cctgctatcc 2400ctcagcgctg ctcctgctcc tgctcactgc ccctcgcaca
gccttggttt gggctccgcc 2460tgtattctcc tggtactgca acctgtaaac
cagcactgca atgctgatgc acgggaagta 2520gtgggatggg aacacaaatg
gaggatcccg cgtctcgaac agagcgcgca gaggaacgct 2580gaaggtctcg
cctctgtcgc acctcagcgc ggcatacacc acaataacca cctgacgaat
2640gcgcttggtt cttcgtccat tagcgaagcg tccggttcac acacgtgcca
cgttggcgag 2700gtggcaggtg acaatgatcg gtggagctga tggtcgaaac
gttcacagcc tagggatatc 2760gaattccttt cttgcgctat gacacttcca
gcaaaaggta gggcgggctg cgagacggct 2820tcccggcgct gcatgcaaca
ccgatgatgc ttcgaccccc cgaagctcct tcggggctgc 2880atgggcgctc
cgatgccgct ccagggcgag cgctgtttaa atagccaggc ccccgattgc
2940aaagacatta tagcgagcta ccaaagccat attcaaacac ctagatcact
accacttcta 3000cacaggccac tcgagcttgt gatcgcactc cgctaagggg
gcgcctcttc ctcttcgttt 3060cagtcacaac ccgcaaacac tagtatggct
atcaagacga acaggcagcc tgtggagaag 3120cctccgttca cgatcgggac
gctgcgcaag gccatccccg cgcactgttt cgagcgctcg 3180gcgcttcgtg
ggcgcgcccc cgactggtcc atgctgttcg ccgtgatcac caccatcttc
3240agcgccgccg agaagcagtg gaccaacctg gagtggaagc ccaagcccaa
gctgccccag 3300ctgctggacg accacttcgg cctgcacggc ctggtgttcc
gccgcacctt cgccatccgc 3360tcctacgagg tgggccccga ccgcagcacc
tccatcctgg ccgtgatgaa ccacatgcag 3420gaggccaccc tgaaccacgc
caagagcgtg ggcatcctgg gcgacggctt cggcaccacc 3480ctggagatgt
ccaagcgcga cctgatgtgg gtggtgcgcc gcacccacgt ggccgtggag
3540cgctacccca cctggggcga caccgtggag gtggagtgct ggatcggcgc
cagcggcaac 3600aacggcatgc gccgcgactt cctggtgcgc gactgcaaga
ccggcgagat cctgacccgc 3660tgcacctccc tgagcgtgct gatgaacacc
cgcacccgcc gcctgagcac catccccgac 3720gaggtgcgcg gcgagatcgg
ccccgccttc atcgacaacg tggccgtgaa ggacgacgag 3780atcaagaagc
tgcagaagct gaacgactcc accgccgact acatccaggg cggcctgacc
3840ccccgctgga acgacctgga cgtgaaccag cacgtgaaca acctgaagta
cgtggcctgg 3900gtgttcgaga ccgtgcccga cagcatcttc gagtcccacc
acatcagctc cttcaccctg 3960gagtaccgcc gcgagtgcac ccgcgactcc
gtgctgcgca gcctgaccac cgtgagcggc 4020ggcagctccg aggccggcct
ggtgtgcgac cacctgctgc agctggaggg cggcagcgag 4080gtgctgcgcg
cccgcaccga gtggcgcccc aagctgaccg actccttccg cggcatcagc
4140gtgatccccg ccgagccccg cgtgatggac tacaaggacc acgacggcga
ctacaaggac 4200cacgacatcg actacaagga cgacgacgac aagtgatgac
tcgaggcagc agcagctcgg 4260atagtatcga cacactctgg acgctggtcg
tgtgatggac tgttgccgcc acacttgctg 4320ccttgacctg tgaatatccc
tgccgctttt atcaaacagc ctcagtgtgt ttgatcttgt 4380gtgtacgcgc
ttttgcgagt tgctagctgc ttgtgctatt tgcgaatacc acccccagca
4440tccccttccc tcgtttcata tcgcttgcat cccaaccgca acttatctac
gctgtcctgc 4500tatccctcag cgctgctcct gctcctgctc actgcccctc
gcacagcctt ggtttgggct 4560ccgcctgtat tctcctggta ctgcaacctg
taaaccagca ctgcaatgct gatgcacggg 4620aagtagtggg atgggaacac
aaatggaaag ctt 4653874653DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 87ggtacccgcc
tgcaacgcaa gggcagccac agccgctccc acccgccgct gaaccgacac 60gtgcttgggc
gcctgccgcc tgcctgccgc atgcttgtgc tggtgaggct gggcagtgct
120gccatgctga ttgaggcttg gttcatcggg tggaagctta tgtgtgtgct
gggcttgcat 180gccgggcaat gcgcatggtg gcaagagggc ggcagcactt
gctggagctg ccgcggtgcc 240tccaggtggt tcaatcgcgg cagccagagg
gatttcagat gatcgcgcgt acaggttgag 300cagcagtgtc agcaaaggta
gcagtttgcc agaatgatcg gttcagctgt taatcaatgc 360cagcaagaga
aggggtcaag tgcaaacacg ggcatgccac agcacgggca ccggggagtg
420gaatggcacc accaagtgtg tgcgagccag catcgccgcc tggctgtttc
agctacaacg 480gcaggagtca tccaacgtaa ccatgagctg atcaacactg
caatcatcgg gcgggcgtga 540tgcaagcatg cctggcgaag acacatggtg
tgcggatgct gccggctgct gcctgctgcg 600cacgccgttg agttggcagc
aggctcagcc atgcactgga tggcagctgg gctgccactg 660caatgtggtg
gataggatgc aagtggagcg aataccaaac cctctggctg cttgctgggt
720tgcatggcat cgcaccatca gcaggagcgc atgcgaaggg actggcccca
tgcacgccat 780gccaaaccgg agcgcaccga gtgtccacac tgtcaccagg
cccgcaagct ttgcagaacc 840atgctcatgg acgcatgtag cgctgacgtc
ccttgacggc gctcctctcg ggtgtgggaa 900acgcaatgca gcacaggcag
cagaggcggc ggcagcagag cggcggcagc agcggcgggg 960gccacccttc
ttgcggggtc gcgccccagc cagcggtgat gcgctgatcc caaacgagtt
1020cacattcatt tgcatgcctg gagaagcgag gctggggcct ttgggctggt
gcagcccgca 1080atggaatgcg ggaccgccag gctagcagca aaggcgcctc
ccctactccg catcgatgtt 1140ccatagtgca ttggactgca tttgggtggg
gcggccggct gtttctttcg tgttgcaaaa 1200cgcgccagct cagcaacctg
tcccgtgggt cccccgtgcc gatgaaatcg tgtgcacgcc 1260gatcagctga
ttgcccggct cgcgaagtag gcgccctcct ttctgctcgc cctctctccg
1320tcccgcctct agaatatcaa tgatcgagca ggacggcctc cacgccggct
cccccgccgc 1380ctgggtggag cgcctgttcg gctacgactg ggcccagcag
accatcggct gctccgacgc 1440cgccgtgttc cgcctgtccg cccagggccg
ccccgtgctg ttcgtgaaga ccgacctgtc 1500cggcgccctg aacgagctgc
aggacgaggc cgcccgcctg tcctggctgg ccaccaccgg 1560cgtgccctgc
gccgccgtgc tggacgtggt gaccgaggcc ggccgcgact ggctgctgct
1620gggcgaggtg cccggccagg acctgctgtc ctcccacctg gcccccgccg
agaaggtgtc 1680catcatggcc gacgccatgc gccgcctgca caccctggac
cccgccacct gccccttcga 1740ccaccaggcc aagcaccgca tcgagcgcgc
ccgcacccgc atggaggccg gcctggtgga 1800ccaggacgac ctggacgagg
agcaccaggg cctggccccc gccgagctgt tcgcccgcct 1860gaaggcccgc
atgcccgacg gcgaggacct ggtggtgacc cacggcgacg cctgcctgcc
1920caacatcatg gtggagaacg gccgcttctc cggcttcatc gactgcggcc
gcctgggcgt 1980ggccgaccgc taccaggaca tcgccctggc cacccgcgac
atcgccgagg agctgggcgg 2040cgagtgggcc gaccgcttcc tggtgctgta
cggcatcgcc gcccccgact cccagcgcat 2100cgccttctac cgcctgctgg
acgagttctt ctgacaattg gcagcagcag ctcggatagt 2160atcgacacac
tctggacgct ggtcgtgtga tggactgttg ccgccacact tgctgccttg
2220acctgtgaat atccctgccg cttttatcaa acagcctcag tgtgtttgat
cttgtgtgta 2280cgcgcttttg cgagttgcta gctgcttgtg ctatttgcga
ataccacccc cagcatcccc 2340ttccctcgtt tcatatcgct tgcatcccaa
ccgcaactta tctacgctgt cctgctatcc 2400ctcagcgctg ctcctgctcc
tgctcactgc ccctcgcaca gccttggttt gggctccgcc 2460tgtattctcc
tggtactgca acctgtaaac cagcactgca atgctgatgc acgggaagta
2520gtgggatggg aacacaaatg gaggatcccg cgtctcgaac agagcgcgca
gaggaacgct 2580gaaggtctcg cctctgtcgc acctcagcgc ggcatacacc
acaataacca cctgacgaat 2640gcgcttggtt cttcgtccat tagcgaagcg
tccggttcac acacgtgcca cgttggcgag 2700gtggcaggtg acaatgatcg
gtggagctga tggtcgaaac gttcacagcc tagggatatc 2760gaattccttt
cttgcgctat gacacttcca gcaaaaggta gggcgggctg cgagacggct
2820tcccggcgct gcatgcaaca ccgatgatgc ttcgaccccc cgaagctcct
tcggggctgc 2880atgggcgctc cgatgccgct ccagggcgag cgctgtttaa
atagccaggc ccccgattgc 2940aaagacatta tagcgagcta ccaaagccat
attcaaacac ctagatcact accacttcta 3000cacaggccac tcgagcttgt
gatcgcactc cgctaagggg gcgcctcttc ctcttcgttt 3060cagtcacaac
ccgcaaacac tagtatggcc accgcatcca ctttctcggc gttcaatgcc
3120cgctgcggcg acctgcgtcg ctcggcgggc tccgggcccc ggcgcccagc
gaggcccctc 3180cccgtgcgcg ggcgcgcccc cgactggtcc atgctgttcg
ccgtgatcac caccatcttc 3240agcgccgccg agaagcagtg gaccaacctg
gagtggaagc ccaagcccaa gctgccccag 3300ctgctggacg accacttcgg
cctgcacggc ctggtgttcc gccgcacctt cgccatccgc 3360tcctacgagg
tgggccccga ccgcagcacc tccatcctgg ccgtgatgaa ccacatgcag
3420gaggccaccc tgaaccacgc caagagcgtg ggcatcctgg gcgacggctt
cggcaccacc 3480ctggagatgt ccaagcgcga cctgatgtgg gtggtgcgcc
gcacccacgt ggccgtggag 3540cgctacccca cctggggcga caccgtggag
gtggagtgct ggatcggcgc cagcggcaac 3600aacggcatgc gccgcgactt
cctggtgcgc gactgcaaga ccggcgagat cctgacccgc 3660tgcacctccc
tgagcgtgct gatgaacacc cgcacccgcc gcctgagcac catccccgac
3720gaggtgcgcg gcgagatcgg ccccgccttc atcgacaacg tggccgtgaa
ggacgacgag 3780atcaagaagc tgcagaagct gaacgactcc accgccgact
acatccaggg cggcctgacc 3840ccccgctgga acgacctgga cgtgaaccag
cacgtgaaca acctgaagta cgtggcctgg 3900gtgttcgaga ccgtgcccga
cagcatcttc gagtcccacc acatcagctc cttcaccctg 3960gagtaccgcc
gcgagtgcac ccgcgactcc gtgctgcgca gcctgaccac cgtgagcggc
4020ggcagctccg aggccggcct ggtgtgcgac cacctgctgc agctggaggg
cggcagcgag 4080gtgctgcgcg cccgcaccga gtggcgcccc aagctgaccg
actccttccg cggcatcagc 4140gtgatccccg ccgagccccg cgtgatggac
tacaaggacc acgacggcga ctacaaggac 4200cacgacatcg actacaagga
cgacgacgac aagtgatgac tcgaggcagc agcagctcgg 4260atagtatcga
cacactctgg acgctggtcg tgtgatggac tgttgccgcc acacttgctg
4320ccttgacctg tgaatatccc tgccgctttt atcaaacagc ctcagtgtgt
ttgatcttgt 4380gtgtacgcgc ttttgcgagt tgctagctgc ttgtgctatt
tgcgaatacc acccccagca 4440tccccttccc tcgtttcata tcgcttgcat
cccaaccgca acttatctac gctgtcctgc 4500tatccctcag cgctgctcct
gctcctgctc actgcccctc gcacagcctt ggtttgggct 4560ccgcctgtat
tctcctggta ctgcaacctg taaaccagca ctgcaatgct gatgcacggg
4620aagtagtggg atgggaacac aaatggaaag ctt 4653884647DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
88ggtacccgcc tgcaacgcaa gggcagccac agccgctccc acccgccgct gaaccgacac
60gtgcttgggc gcctgccgcc tgcctgccgc atgcttgtgc tggtgaggct gggcagtgct
120gccatgctga ttgaggcttg gttcatcggg tggaagctta tgtgtgtgct
gggcttgcat 180gccgggcaat gcgcatggtg gcaagagggc ggcagcactt
gctggagctg ccgcggtgcc 240tccaggtggt tcaatcgcgg cagccagagg
gatttcagat gatcgcgcgt acaggttgag 300cagcagtgtc agcaaaggta
gcagtttgcc agaatgatcg gttcagctgt taatcaatgc 360cagcaagaga
aggggtcaag tgcaaacacg ggcatgccac agcacgggca ccggggagtg
420gaatggcacc accaagtgtg tgcgagccag catcgccgcc tggctgtttc
agctacaacg 480gcaggagtca tccaacgtaa ccatgagctg atcaacactg
caatcatcgg gcgggcgtga 540tgcaagcatg cctggcgaag acacatggtg
tgcggatgct gccggctgct gcctgctgcg 600cacgccgttg agttggcagc
aggctcagcc atgcactgga tggcagctgg gctgccactg 660caatgtggtg
gataggatgc aagtggagcg aataccaaac cctctggctg cttgctgggt
720tgcatggcat cgcaccatca gcaggagcgc atgcgaaggg actggcccca
tgcacgccat 780gccaaaccgg agcgcaccga gtgtccacac tgtcaccagg
cccgcaagct ttgcagaacc 840atgctcatgg acgcatgtag cgctgacgtc
ccttgacggc gctcctctcg ggtgtgggaa 900acgcaatgca gcacaggcag
cagaggcggc ggcagcagag cggcggcagc agcggcgggg 960gccacccttc
ttgcggggtc gcgccccagc cagcggtgat gcgctgatcc caaacgagtt
1020cacattcatt tgcatgcctg gagaagcgag gctggggcct ttgggctggt
gcagcccgca 1080atggaatgcg ggaccgccag gctagcagca aaggcgcctc
ccctactccg catcgatgtt 1140ccatagtgca ttggactgca tttgggtggg
gcggccggct gtttctttcg tgttgcaaaa 1200cgcgccagct cagcaacctg
tcccgtgggt cccccgtgcc gatgaaatcg tgtgcacgcc 1260gatcagctga
ttgcccggct cgcgaagtag gcgccctcct ttctgctcgc cctctctccg
1320tcccgcctct agaatatcaa tgatcgagca
ggacggcctc cacgccggct cccccgccgc 1380ctgggtggag cgcctgttcg
gctacgactg ggcccagcag accatcggct gctccgacgc 1440cgccgtgttc
cgcctgtccg cccagggccg ccccgtgctg ttcgtgaaga ccgacctgtc
1500cggcgccctg aacgagctgc aggacgaggc cgcccgcctg tcctggctgg
ccaccaccgg 1560cgtgccctgc gccgccgtgc tggacgtggt gaccgaggcc
ggccgcgact ggctgctgct 1620gggcgaggtg cccggccagg acctgctgtc
ctcccacctg gcccccgccg agaaggtgtc 1680catcatggcc gacgccatgc
gccgcctgca caccctggac cccgccacct gccccttcga 1740ccaccaggcc
aagcaccgca tcgagcgcgc ccgcacccgc atggaggccg gcctggtgga
1800ccaggacgac ctggacgagg agcaccaggg cctggccccc gccgagctgt
tcgcccgcct 1860gaaggcccgc atgcccgacg gcgaggacct ggtggtgacc
cacggcgacg cctgcctgcc 1920caacatcatg gtggagaacg gccgcttctc
cggcttcatc gactgcggcc gcctgggcgt 1980ggccgaccgc taccaggaca
tcgccctggc cacccgcgac atcgccgagg agctgggcgg 2040cgagtgggcc
gaccgcttcc tggtgctgta cggcatcgcc gcccccgact cccagcgcat
2100cgccttctac cgcctgctgg acgagttctt ctgacaattg gcagcagcag
ctcggatagt 2160atcgacacac tctggacgct ggtcgtgtga tggactgttg
ccgccacact tgctgccttg 2220acctgtgaat atccctgccg cttttatcaa
acagcctcag tgtgtttgat cttgtgtgta 2280cgcgcttttg cgagttgcta
gctgcttgtg ctatttgcga ataccacccc cagcatcccc 2340ttccctcgtt
tcatatcgct tgcatcccaa ccgcaactta tctacgctgt cctgctatcc
2400ctcagcgctg ctcctgctcc tgctcactgc ccctcgcaca gccttggttt
gggctccgcc 2460tgtattctcc tggtactgca acctgtaaac cagcactgca
atgctgatgc acgggaagta 2520gtgggatggg aacacaaatg gaggatcccg
cgtctcgaac agagcgcgca gaggaacgct 2580gaaggtctcg cctctgtcgc
acctcagcgc ggcatacacc acaataacca cctgacgaat 2640gcgcttggtt
cttcgtccat tagcgaagcg tccggttcac acacgtgcca cgttggcgag
2700gtggcaggtg acaatgatcg gtggagctga tggtcgaaac gttcacagcc
tagggatatc 2760gaattccttt cttgcgctat gacacttcca gcaaaaggta
gggcgggctg cgagacggct 2820tcccggcgct gcatgcaaca ccgatgatgc
ttcgaccccc cgaagctcct tcggggctgc 2880atgggcgctc cgatgccgct
ccagggcgag cgctgtttaa atagccaggc ccccgattgc 2940aaagacatta
tagcgagcta ccaaagccat attcaaacac ctagatcact accacttcta
3000cacaggccac tcgagcttgt gatcgcactc cgctaagggg gcgcctcttc
ctcttcgttt 3060cagtcacaac ccgcaaacac tagtatggct tccgcggcat
tcaccatgtc ggcgtgcccc 3120gcgatgactg gcagggcccc tggggcacgt
cgctccggac ggccagtcgc cacccgcctg 3180agggggcgcg cccccgactg
gtccatgctg ttcgccgtga tcaccaccat cttcagcgcc 3240gccgagaagc
agtggaccaa cctggagtgg aagcccaagc ccaagctgcc ccagctgctg
3300gacgaccact tcggcctgca cggcctggtg ttccgccgca ccttcgccat
ccgctcctac 3360gaggtgggcc ccgaccgcag cacctccatc ctggccgtga
tgaaccacat gcaggaggcc 3420accctgaacc acgccaagag cgtgggcatc
ctgggcgacg gcttcggcac caccctggag 3480atgtccaagc gcgacctgat
gtgggtggtg cgccgcaccc acgtggccgt ggagcgctac 3540cccacctggg
gcgacaccgt ggaggtggag tgctggatcg gcgccagcgg caacaacggc
3600atgcgccgcg acttcctggt gcgcgactgc aagaccggcg agatcctgac
ccgctgcacc 3660tccctgagcg tgctgatgaa cacccgcacc cgccgcctga
gcaccatccc cgacgaggtg 3720cgcggcgaga tcggccccgc cttcatcgac
aacgtggccg tgaaggacga cgagatcaag 3780aagctgcaga agctgaacga
ctccaccgcc gactacatcc agggcggcct gaccccccgc 3840tggaacgacc
tggacgtgaa ccagcacgtg aacaacctga agtacgtggc ctgggtgttc
3900gagaccgtgc ccgacagcat cttcgagtcc caccacatca gctccttcac
cctggagtac 3960cgccgcgagt gcacccgcga ctccgtgctg cgcagcctga
ccaccgtgag cggcggcagc 4020tccgaggccg gcctggtgtg cgaccacctg
ctgcagctgg agggcggcag cgaggtgctg 4080cgcgcccgca ccgagtggcg
ccccaagctg accgactcct tccgcggcat cagcgtgatc 4140cccgccgagc
cccgcgtgat ggactacaag gaccacgacg gcgactacaa ggaccacgac
4200atcgactaca aggacgacga cgacaagtga tgactcgagg cagcagcagc
tcggatagta 4260tcgacacact ctggacgctg gtcgtgtgat ggactgttgc
cgccacactt gctgccttga 4320cctgtgaata tccctgccgc ttttatcaaa
cagcctcagt gtgtttgatc ttgtgtgtac 4380gcgcttttgc gagttgctag
ctgcttgtgc tatttgcgaa taccaccccc agcatcccct 4440tccctcgttt
catatcgctt gcatcccaac cgcaacttat ctacgctgtc ctgctatccc
4500tcagcgctgc tcctgctcct gctcactgcc cctcgcacag ccttggtttg
ggctccgcct 4560gtattctcct ggtactgcaa cctgtaaacc agcactgcaa
tgctgatgca cgggaagtag 4620tgggatggga acacaaatgg aaagctt
4647894721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 89ggtacccgcc tgcaacgcaa gggcagccac
agccgctccc acccgccgct gaaccgacac 60gtgcttgggc gcctgccgcc tgcctgccgc
atgcttgtgc tggtgaggct gggcagtgct 120gccatgctga ttgaggcttg
gttcatcggg tggaagctta tgtgtgtgct gggcttgcat 180gccgggcaat
gcgcatggtg gcaagagggc ggcagcactt gctggagctg ccgcggtgcc
240tccaggtggt tcaatcgcgg cagccagagg gatttcagat gatcgcgcgt
acaggttgag 300cagcagtgtc agcaaaggta gcagtttgcc agaatgatcg
gttcagctgt taatcaatgc 360cagcaagaga aggggtcaag tgcaaacacg
ggcatgccac agcacgggca ccggggagtg 420gaatggcacc accaagtgtg
tgcgagccag catcgccgcc tggctgtttc agctacaacg 480gcaggagtca
tccaacgtaa ccatgagctg atcaacactg caatcatcgg gcgggcgtga
540tgcaagcatg cctggcgaag acacatggtg tgcggatgct gccggctgct
gcctgctgcg 600cacgccgttg agttggcagc aggctcagcc atgcactgga
tggcagctgg gctgccactg 660caatgtggtg gataggatgc aagtggagcg
aataccaaac cctctggctg cttgctgggt 720tgcatggcat cgcaccatca
gcaggagcgc atgcgaaggg actggcccca tgcacgccat 780gccaaaccgg
agcgcaccga gtgtccacac tgtcaccagg cccgcaagct ttgcagaacc
840atgctcatgg acgcatgtag cgctgacgtc ccttgacggc gctcctctcg
ggtgtgggaa 900acgcaatgca gcacaggcag cagaggcggc ggcagcagag
cggcggcagc agcggcgggg 960gccacccttc ttgcggggtc gcgccccagc
cagcggtgat gcgctgatcc caaacgagtt 1020cacattcatt tgcatgcctg
gagaagcgag gctggggcct ttgggctggt gcagcccgca 1080atggaatgcg
ggaccgccag gctagcagca aaggcgcctc ccctactccg catcgatgtt
1140ccatagtgca ttggactgca tttgggtggg gcggccggct gtttctttcg
tgttgcaaaa 1200cgcgccagct cagcaacctg tcccgtgggt cccccgtgcc
gatgaaatcg tgtgcacgcc 1260gatcagctga ttgcccggct cgcgaagtag
gcgccctcct ttctgctcgc cctctctccg 1320tcccgcctct agaatatcaa
tgatcgagca ggacggcctc cacgccggct cccccgccgc 1380ctgggtggag
cgcctgttcg gctacgactg ggcccagcag accatcggct gctccgacgc
1440cgccgtgttc cgcctgtccg cccagggccg ccccgtgctg ttcgtgaaga
ccgacctgtc 1500cggcgccctg aacgagctgc aggacgaggc cgcccgcctg
tcctggctgg ccaccaccgg 1560cgtgccctgc gccgccgtgc tggacgtggt
gaccgaggcc ggccgcgact ggctgctgct 1620gggcgaggtg cccggccagg
acctgctgtc ctcccacctg gcccccgccg agaaggtgtc 1680catcatggcc
gacgccatgc gccgcctgca caccctggac cccgccacct gccccttcga
1740ccaccaggcc aagcaccgca tcgagcgcgc ccgcacccgc atggaggccg
gcctggtgga 1800ccaggacgac ctggacgagg agcaccaggg cctggccccc
gccgagctgt tcgcccgcct 1860gaaggcccgc atgcccgacg gcgaggacct
ggtggtgacc cacggcgacg cctgcctgcc 1920caacatcatg gtggagaacg
gccgcttctc cggcttcatc gactgcggcc gcctgggcgt 1980ggccgaccgc
taccaggaca tcgccctggc cacccgcgac atcgccgagg agctgggcgg
2040cgagtgggcc gaccgcttcc tggtgctgta cggcatcgcc gcccccgact
cccagcgcat 2100cgccttctac cgcctgctgg acgagttctt ctgacaattg
gcagcagcag ctcggatagt 2160atcgacacac tctggacgct ggtcgtgtga
tggactgttg ccgccacact tgctgccttg 2220acctgtgaat atccctgccg
cttttatcaa acagcctcag tgtgtttgat cttgtgtgta 2280cgcgcttttg
cgagttgcta gctgcttgtg ctatttgcga ataccacccc cagcatcccc
2340ttccctcgtt tcatatcgct tgcatcccaa ccgcaactta tctacgctgt
cctgctatcc 2400ctcagcgctg ctcctgctcc tgctcactgc ccctcgcaca
gccttggttt gggctccgcc 2460tgtattctcc tggtactgca acctgtaaac
cagcactgca atgctgatgc acgggaagta 2520gtgggatggg aacacaaatg
gaggatcccg cgtctcgaac agagcgcgca gaggaacgct 2580gaaggtctcg
cctctgtcgc acctcagcgc ggcatacacc acaataacca cctgacgaat
2640gcgcttggtt cttcgtccat tagcgaagcg tccggttcac acacgtgcca
cgttggcgag 2700gtggcaggtg acaatgatcg gtggagctga tggtcgaaac
gttcacagcc tagggatatc 2760gaattccttt cttgcgctat gacacttcca
gcaaaaggta gggcgggctg cgagacggct 2820tcccggcgct gcatgcaaca
ccgatgatgc ttcgaccccc cgaagctcct tcggggctgc 2880atgggcgctc
cgatgccgct ccagggcgag cgctgtttaa atagccaggc ccccgattgc
2940aaagacatta tagcgagcta ccaaagccat attcaaacac ctagatcact
accacttcta 3000cacaggccac tcgagcttgt gatcgcactc cgctaagggg
gcgcctcttc ctcttcgttt 3060cagtcacaac ccgcaaacgg cgcgccatgg
ccaccacctc cctggcctcc gccttctgca 3120gcatgaaggc cgtgatgctg
gcccgcgacg gccgcggcat gaagccccgc tccagcgacc 3180tgcagctgcg
cgccggcaac gcccagacct ccctgaagat gatcaacggc accaagttct
3240cctacaccga gagcctgaag aagctgcccg actggtccat gctgttcgcc
gtgatcacca 3300ccatcttctc cgccgccgag aagcagtgga ccaacctgga
gtggaagccc aagcccaacc 3360ccccccagct gctggacgac cacttcggcc
cccacggcct ggtgttccgc cgcaccttcg 3420ccatccgcag ctacgaggtg
ggccccgacc gctccaccag catcgtggcc gtgatgaacc 3480acctgcagga
ggccgccctg aaccacgcca agtccgtggg catcctgggc gacggcttcg
3540gcaccaccct ggagatgtcc aagcgcgacc tgatctgggt ggtgaagcgc
acccacgtgg 3600ccgtggagcg ctaccccgcc tggggcgaca ccgtggaggt
ggagtgctgg gtgggcgcct 3660ccggcaacaa cggccgccgc cacgacttcc
tggtgcgcga ctgcaagacc ggcgagatcc 3720tgacccgctg cacctccctg
agcgtgatga tgaacacccg cacccgccgc ctgagcaaga 3780tccccgagga
ggtgcgcggc gagatcggcc ccgccttcat cgacaacgtg gccgtgaagg
3840acgaggagat caagaagccc cagaagctga acgactccac cgccgactac
atccagggcg 3900gcctgacccc ccgctggaac gacctggaca tcaaccagca
cgtgaacaac atcaagtacg 3960tggactggat cctggagacc gtgcccgaca
gcatcttcga gagccaccac atctcctcct 4020tcaccatcga gtaccgccgc
gagtgcacca tggacagcgt gctgcagtcc ctgaccaccg 4080tgagcggcgg
ctcctccgag gccggcctgg tgtgcgagca cctgctgcag ctggagggcg
4140gcagcgaggt gctgcgcgcc aagaccgagt ggcgccccaa gctgaccgac
tccttccgcg 4200gcatcagcgt gatccccgcc gagtccagcg tgatggacta
caaggaccac gacggcgact 4260acaaggacca cgacatcgac tacaaggacg
acgacgacaa gtgatgactc gaggcagcag 4320cagctcggat agtatcgaca
cactctggac gctggtcgtg tgatggactg ttgccgccac 4380acttgctgcc
ttgacctgtg aatatccctg ccgcttttat caaacagcct cagtgtgttt
4440gatcttgtgt gtacgcgctt ttgcgagttg ctagctgctt gtgctatttg
cgaataccac 4500ccccagcatc cccttccctc gtttcatatc gcttgcatcc
caaccgcaac ttatctacgc 4560tgtcctgcta tccctcagcg ctgctcctgc
tcctgctcac tgcccctcgc acagccttgg 4620tttgggctcc gcctgtattc
tcctggtact gcaacctgta aaccagcact gcaatgctga 4680tgcacgggaa
gtagtgggat gggaacacaa atggaaagct t 4721904650DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
90ggtacccgcc tgcaacgcaa gggcagccac agccgctccc acccgccgct gaaccgacac
60gtgcttgggc gcctgccgcc tgcctgccgc atgcttgtgc tggtgaggct gggcagtgct
120gccatgctga ttgaggcttg gttcatcggg tggaagctta tgtgtgtgct
gggcttgcat 180gccgggcaat gcgcatggtg gcaagagggc ggcagcactt
gctggagctg ccgcggtgcc 240tccaggtggt tcaatcgcgg cagccagagg
gatttcagat gatcgcgcgt acaggttgag 300cagcagtgtc agcaaaggta
gcagtttgcc agaatgatcg gttcagctgt taatcaatgc 360cagcaagaga
aggggtcaag tgcaaacacg ggcatgccac agcacgggca ccggggagtg
420gaatggcacc accaagtgtg tgcgagccag catcgccgcc tggctgtttc
agctacaacg 480gcaggagtca tccaacgtaa ccatgagctg atcaacactg
caatcatcgg gcgggcgtga 540tgcaagcatg cctggcgaag acacatggtg
tgcggatgct gccggctgct gcctgctgcg 600cacgccgttg agttggcagc
aggctcagcc atgcactgga tggcagctgg gctgccactg 660caatgtggtg
gataggatgc aagtggagcg aataccaaac cctctggctg cttgctgggt
720tgcatggcat cgcaccatca gcaggagcgc atgcgaaggg actggcccca
tgcacgccat 780gccaaaccgg agcgcaccga gtgtccacac tgtcaccagg
cccgcaagct ttgcagaacc 840atgctcatgg acgcatgtag cgctgacgtc
ccttgacggc gctcctctcg ggtgtgggaa 900acgcaatgca gcacaggcag
cagaggcggc ggcagcagag cggcggcagc agcggcgggg 960gccacccttc
ttgcggggtc gcgccccagc cagcggtgat gcgctgatcc caaacgagtt
1020cacattcatt tgcatgcctg gagaagcgag gctggggcct ttgggctggt
gcagcccgca 1080atggaatgcg ggaccgccag gctagcagca aaggcgcctc
ccctactccg catcgatgtt 1140ccatagtgca ttggactgca tttgggtggg
gcggccggct gtttctttcg tgttgcaaaa 1200cgcgccagct cagcaacctg
tcccgtgggt cccccgtgcc gatgaaatcg tgtgcacgcc 1260gatcagctga
ttgcccggct cgcgaagtag gcgccctcct ttctgctcgc cctctctccg
1320tcccgcctct agaatatcaa tgatcgagca ggacggcctc cacgccggct
cccccgccgc 1380ctgggtggag cgcctgttcg gctacgactg ggcccagcag
accatcggct gctccgacgc 1440cgccgtgttc cgcctgtccg cccagggccg
ccccgtgctg ttcgtgaaga ccgacctgtc 1500cggcgccctg aacgagctgc
aggacgaggc cgcccgcctg tcctggctgg ccaccaccgg 1560cgtgccctgc
gccgccgtgc tggacgtggt gaccgaggcc ggccgcgact ggctgctgct
1620gggcgaggtg cccggccagg acctgctgtc ctcccacctg gcccccgccg
agaaggtgtc 1680catcatggcc gacgccatgc gccgcctgca caccctggac
cccgccacct gccccttcga 1740ccaccaggcc aagcaccgca tcgagcgcgc
ccgcacccgc atggaggccg gcctggtgga 1800ccaggacgac ctggacgagg
agcaccaggg cctggccccc gccgagctgt tcgcccgcct 1860gaaggcccgc
atgcccgacg gcgaggacct ggtggtgacc cacggcgacg cctgcctgcc
1920caacatcatg gtggagaacg gccgcttctc cggcttcatc gactgcggcc
gcctgggcgt 1980ggccgaccgc taccaggaca tcgccctggc cacccgcgac
atcgccgagg agctgggcgg 2040cgagtgggcc gaccgcttcc tggtgctgta
cggcatcgcc gcccccgact cccagcgcat 2100cgccttctac cgcctgctgg
acgagttctt ctgacaattg gcagcagcag ctcggatagt 2160atcgacacac
tctggacgct ggtcgtgtga tggactgttg ccgccacact tgctgccttg
2220acctgtgaat atccctgccg cttttatcaa acagcctcag tgtgtttgat
cttgtgtgta 2280cgcgcttttg cgagttgcta gctgcttgtg ctatttgcga
ataccacccc cagcatcccc 2340ttccctcgtt tcatatcgct tgcatcccaa
ccgcaactta tctacgctgt cctgctatcc 2400ctcagcgctg ctcctgctcc
tgctcactgc ccctcgcaca gccttggttt gggctccgcc 2460tgtattctcc
tggtactgca acctgtaaac cagcactgca atgctgatgc acgggaagta
2520gtgggatggg aacacaaatg gaggatcccg cgtctcgaac agagcgcgca
gaggaacgct 2580gaaggtctcg cctctgtcgc acctcagcgc ggcatacacc
acaataacca cctgacgaat 2640gcgcttggtt cttcgtccat tagcgaagcg
tccggttcac acacgtgcca cgttggcgag 2700gtggcaggtg acaatgatcg
gtggagctga tggtcgaaac gttcacagcc tagggatatc 2760gaattccttt
cttgcgctat gacacttcca gcaaaaggta gggcgggctg cgagacggct
2820tcccggcgct gcatgcaaca ccgatgatgc ttcgaccccc cgaagctcct
tcggggctgc 2880atgggcgctc cgatgccgct ccagggcgag cgctgtttaa
atagccaggc ccccgattgc 2940aaagacatta tagcgagcta ccaaagccat
attcaaacac ctagatcact accacttcta 3000cacaggccac tcgagcttgt
gatcgcactc cgctaagggg gcgcctcttc ctcttcgttt 3060cagtcacaac
ccgcaaacac tagtatgacg ttcggggtcg ccctcccggc catgggccgc
3120ggtgtctccc ttccccggcc cagggtcgcg gtgcgcgccc agtcggcgag
tcaggttttg 3180gagagcgggc gcgcccccga ctggtccatg ctgttcgccg
tgatcaccac catcttctcc 3240gccgccgaga agcagtggac caacctggag
tggaagccca agcccaaccc cccccagctg 3300ctggacgacc acttcggccc
ccacggcctg gtgttccgcc gcaccttcgc catccgcagc 3360tacgaggtgg
gccccgaccg ctccaccagc atcgtggccg tgatgaacca cctgcaggag
3420gccgccctga accacgccaa gtccgtgggc atcctgggcg acggcttcgg
caccaccctg 3480gagatgtcca agcgcgacct gatctgggtg gtgaagcgca
cccacgtggc cgtggagcgc 3540taccccgcct ggggcgacac cgtggaggtg
gagtgctggg tgggcgcctc cggcaacaac 3600ggccgccgcc acgacttcct
ggtgcgcgac tgcaagaccg gcgagatcct gacccgctgc 3660acctccctga
gcgtgatgat gaacacccgc acccgccgcc tgagcaagat ccccgaggag
3720gtgcgcggcg agatcggccc cgccttcatc gacaacgtgg ccgtgaagga
cgaggagatc 3780aagaagcccc agaagctgaa cgactccacc gccgactaca
tccagggcgg cctgaccccc 3840cgctggaacg acctggacat caaccagcac
gtgaacaaca tcaagtacgt ggactggatc 3900ctggagaccg tgcccgacag
catcttcgag agccaccaca tctcctcctt caccatcgag 3960taccgccgcg
agtgcaccat ggacagcgtg ctgcagtccc tgaccaccgt gagcggcggc
4020tcctccgagg ccggcctggt gtgcgagcac ctgctgcagc tggagggcgg
cagcgaggtg 4080ctgcgcgcca agaccgagtg gcgccccaag ctgaccgact
ccttccgcgg catcagcgtg 4140atccccgccg agtccagcgt gatggactac
aaggaccacg acggcgacta caaggaccac 4200gacatcgact acaaggacga
cgacgacaag tgatgactcg aggcagcagc agctcggata 4260gtatcgacac
actctggacg ctggtcgtgt gatggactgt tgccgccaca cttgctgcct
4320tgacctgtga atatccctgc cgcttttatc aaacagcctc agtgtgtttg
atcttgtgtg 4380tacgcgcttt tgcgagttgc tagctgcttg tgctatttgc
gaataccacc cccagcatcc 4440ccttccctcg tttcatatcg cttgcatccc
aaccgcaact tatctacgct gtcctgctat 4500ccctcagcgc tgctcctgct
cctgctcact gcccctcgca cagccttggt ttgggctccg 4560cctgtattct
cctggtactg caacctgtaa accagcactg caatgctgat gcacgggaag
4620tagtgggatg ggaacacaaa tggaaagctt 4650914653DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
91ggtacccgcc tgcaacgcaa gggcagccac agccgctccc acccgccgct gaaccgacac
60gtgcttgggc gcctgccgcc tgcctgccgc atgcttgtgc tggtgaggct gggcagtgct
120gccatgctga ttgaggcttg gttcatcggg tggaagctta tgtgtgtgct
gggcttgcat 180gccgggcaat gcgcatggtg gcaagagggc ggcagcactt
gctggagctg ccgcggtgcc 240tccaggtggt tcaatcgcgg cagccagagg
gatttcagat gatcgcgcgt acaggttgag 300cagcagtgtc agcaaaggta
gcagtttgcc agaatgatcg gttcagctgt taatcaatgc 360cagcaagaga
aggggtcaag tgcaaacacg ggcatgccac agcacgggca ccggggagtg
420gaatggcacc accaagtgtg tgcgagccag catcgccgcc tggctgtttc
agctacaacg 480gcaggagtca tccaacgtaa ccatgagctg atcaacactg
caatcatcgg gcgggcgtga 540tgcaagcatg cctggcgaag acacatggtg
tgcggatgct gccggctgct gcctgctgcg 600cacgccgttg agttggcagc
aggctcagcc atgcactgga tggcagctgg gctgccactg 660caatgtggtg
gataggatgc aagtggagcg aataccaaac cctctggctg cttgctgggt
720tgcatggcat cgcaccatca gcaggagcgc atgcgaaggg actggcccca
tgcacgccat 780gccaaaccgg agcgcaccga gtgtccacac tgtcaccagg
cccgcaagct ttgcagaacc 840atgctcatgg acgcatgtag cgctgacgtc
ccttgacggc gctcctctcg ggtgtgggaa 900acgcaatgca gcacaggcag
cagaggcggc ggcagcagag cggcggcagc agcggcgggg 960gccacccttc
ttgcggggtc gcgccccagc cagcggtgat gcgctgatcc caaacgagtt
1020cacattcatt tgcatgcctg gagaagcgag gctggggcct ttgggctggt
gcagcccgca 1080atggaatgcg ggaccgccag gctagcagca aaggcgcctc
ccctactccg catcgatgtt 1140ccatagtgca ttggactgca tttgggtggg
gcggccggct gtttctttcg tgttgcaaaa 1200cgcgccagct cagcaacctg
tcccgtgggt cccccgtgcc gatgaaatcg tgtgcacgcc 1260gatcagctga
ttgcccggct cgcgaagtag gcgccctcct ttctgctcgc cctctctccg
1320tcccgcctct agaatatcaa tgatcgagca ggacggcctc cacgccggct
cccccgccgc 1380ctgggtggag cgcctgttcg gctacgactg ggcccagcag
accatcggct gctccgacgc 1440cgccgtgttc cgcctgtccg cccagggccg
ccccgtgctg ttcgtgaaga ccgacctgtc 1500cggcgccctg aacgagctgc
aggacgaggc cgcccgcctg tcctggctgg ccaccaccgg 1560cgtgccctgc
gccgccgtgc tggacgtggt gaccgaggcc ggccgcgact ggctgctgct
1620gggcgaggtg cccggccagg acctgctgtc ctcccacctg gcccccgccg
agaaggtgtc 1680catcatggcc gacgccatgc gccgcctgca caccctggac
cccgccacct gccccttcga 1740ccaccaggcc aagcaccgca tcgagcgcgc
ccgcacccgc atggaggccg gcctggtgga 1800ccaggacgac ctggacgagg
agcaccaggg cctggccccc gccgagctgt tcgcccgcct 1860gaaggcccgc
atgcccgacg gcgaggacct ggtggtgacc cacggcgacg cctgcctgcc
1920caacatcatg gtggagaacg gccgcttctc cggcttcatc gactgcggcc
gcctgggcgt 1980ggccgaccgc taccaggaca tcgccctggc cacccgcgac
atcgccgagg agctgggcgg
2040cgagtgggcc gaccgcttcc tggtgctgta cggcatcgcc gcccccgact
cccagcgcat 2100cgccttctac cgcctgctgg acgagttctt ctgacaattg
gcagcagcag ctcggatagt 2160atcgacacac tctggacgct ggtcgtgtga
tggactgttg ccgccacact tgctgccttg 2220acctgtgaat atccctgccg
cttttatcaa acagcctcag tgtgtttgat cttgtgtgta 2280cgcgcttttg
cgagttgcta gctgcttgtg ctatttgcga ataccacccc cagcatcccc
2340ttccctcgtt tcatatcgct tgcatcccaa ccgcaactta tctacgctgt
cctgctatcc 2400ctcagcgctg ctcctgctcc tgctcactgc ccctcgcaca
gccttggttt gggctccgcc 2460tgtattctcc tggtactgca acctgtaaac
cagcactgca atgctgatgc acgggaagta 2520gtgggatggg aacacaaatg
gaggatcccg cgtctcgaac agagcgcgca gaggaacgct 2580gaaggtctcg
cctctgtcgc acctcagcgc ggcatacacc acaataacca cctgacgaat
2640gcgcttggtt cttcgtccat tagcgaagcg tccggttcac acacgtgcca
cgttggcgag 2700gtggcaggtg acaatgatcg gtggagctga tggtcgaaac
gttcacagcc tagggatatc 2760gaattccttt cttgcgctat gacacttcca
gcaaaaggta gggcgggctg cgagacggct 2820tcccggcgct gcatgcaaca
ccgatgatgc ttcgaccccc cgaagctcct tcggggctgc 2880atgggcgctc
cgatgccgct ccagggcgag cgctgtttaa atagccaggc ccccgattgc
2940aaagacatta tagcgagcta ccaaagccat attcaaacac ctagatcact
accacttcta 3000cacaggccac tcgagcttgt gatcgcactc cgctaagggg
gcgcctcttc ctcttcgttt 3060cagtcacaac ccgcaaacac tagtatggct
atcaagacga acaggcagcc tgtggagaag 3120cctccgttca cgatcgggac
gctgcgcaag gccatccccg cgcactgttt cgagcgctcg 3180gcgcttcgtg
ggcgcgcccc cgactggtcc atgctgttcg ccgtgatcac caccatcttc
3240tccgccgccg agaagcagtg gaccaacctg gagtggaagc ccaagcccaa
ccccccccag 3300ctgctggacg accacttcgg cccccacggc ctggtgttcc
gccgcacctt cgccatccgc 3360agctacgagg tgggccccga ccgctccacc
agcatcgtgg ccgtgatgaa ccacctgcag 3420gaggccgccc tgaaccacgc
caagtccgtg ggcatcctgg gcgacggctt cggcaccacc 3480ctggagatgt
ccaagcgcga cctgatctgg gtggtgaagc gcacccacgt ggccgtggag
3540cgctaccccg cctggggcga caccgtggag gtggagtgct gggtgggcgc
ctccggcaac 3600aacggccgcc gccacgactt cctggtgcgc gactgcaaga
ccggcgagat cctgacccgc 3660tgcacctccc tgagcgtgat gatgaacacc
cgcacccgcc gcctgagcaa gatccccgag 3720gaggtgcgcg gcgagatcgg
ccccgccttc atcgacaacg tggccgtgaa ggacgaggag 3780atcaagaagc
cccagaagct gaacgactcc accgccgact acatccaggg cggcctgacc
3840ccccgctgga acgacctgga catcaaccag cacgtgaaca acatcaagta
cgtggactgg 3900atcctggaga ccgtgcccga cagcatcttc gagagccacc
acatctcctc cttcaccatc 3960gagtaccgcc gcgagtgcac catggacagc
gtgctgcagt ccctgaccac cgtgagcggc 4020ggctcctccg aggccggcct
ggtgtgcgag cacctgctgc agctggaggg cggcagcgag 4080gtgctgcgcg
ccaagaccga gtggcgcccc aagctgaccg actccttccg cggcatcagc
4140gtgatccccg ccgagtccag cgtgatggac tacaaggacc acgacggcga
ctacaaggac 4200cacgacatcg actacaagga cgacgacgac aagtgatgac
tcgaggcagc agcagctcgg 4260atagtatcga cacactctgg acgctggtcg
tgtgatggac tgttgccgcc acacttgctg 4320ccttgacctg tgaatatccc
tgccgctttt atcaaacagc ctcagtgtgt ttgatcttgt 4380gtgtacgcgc
ttttgcgagt tgctagctgc ttgtgctatt tgcgaatacc acccccagca
4440tccccttccc tcgtttcata tcgcttgcat cccaaccgca acttatctac
gctgtcctgc 4500tatccctcag cgctgctcct gctcctgctc actgcccctc
gcacagcctt ggtttgggct 4560ccgcctgtat tctcctggta ctgcaacctg
taaaccagca ctgcaatgct gatgcacggg 4620aagtagtggg atgggaacac
aaatggaaag ctt 4653921893DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 92gaattccttt
cttgcgctat gacacttcca gcaaaaggta gggcgggctg cgagacggct 60tcccggcgct
gcatgcaaca ccgatgatgc ttcgaccccc cgaagctcct tcggggctgc
120atgggcgctc cgatgccgct ccagggcgag cgctgtttaa atagccaggc
ccccgattgc 180aaagacatta tagcgagcta ccaaagccat attcaaacac
ctagatcact accacttcta 240cacaggccac tcgagcttgt gatcgcactc
cgctaagggg gcgcctcttc ctcttcgttt 300cagtcacaac ccgcaaacac
tagtatggcc accgcatcca ctttctcggc gttcaatgcc 360cgctgcggcg
acctgcgtcg ctcggcgggc tccgggcccc ggcgcccagc gaggcccctc
420cccgtgcgcg ggcgcgcccc cgactggtcc atgctgttcg ccgtgatcac
caccatcttc 480tccgccgccg agaagcagtg gaccaacctg gagtggaagc
ccaagcccaa ccccccccag 540ctgctggacg accacttcgg cccccacggc
ctggtgttcc gccgcacctt cgccatccgc 600agctacgagg tgggccccga
ccgctccacc agcatcgtgg ccgtgatgaa ccacctgcag 660gaggccgccc
tgaaccacgc caagtccgtg ggcatcctgg gcgacggctt cggcaccacc
720ctggagatgt ccaagcgcga cctgatctgg gtggtgaagc gcacccacgt
ggccgtggag 780cgctaccccg cctggggcga caccgtggag gtggagtgct
gggtgggcgc ctccggcaac 840aacggccgcc gccacgactt cctggtgcgc
gactgcaaga ccggcgagat cctgacccgc 900tgcacctccc tgagcgtgat
gatgaacacc cgcacccgcc gcctgagcaa gatccccgag 960gaggtgcgcg
gcgagatcgg ccccgccttc atcgacaacg tggccgtgaa ggacgaggag
1020atcaagaagc cccagaagct gaacgactcc accgccgact acatccaggg
cggcctgacc 1080ccccgctgga acgacctgga catcaaccag cacgtgaaca
acatcaagta cgtggactgg 1140atcctggaga ccgtgcccga cagcatcttc
gagagccacc acatctcctc cttcaccatc 1200gagtaccgcc gcgagtgcac
catggacagc gtgctgcagt ccctgaccac cgtgagcggc 1260ggctcctccg
aggccggcct ggtgtgcgag cacctgctgc agctggaggg cggcagcgag
1320gtgctgcgcg ccaagaccga gtggcgcccc aagctgaccg actccttccg
cggcatcagc 1380gtgatccccg ccgagtccag cgtgatggac tacaaggacc
acgacggcga ctacaaggac 1440cacgacatcg actacaagga cgacgacgac
aagtgatgac tcgaggcagc agcagctcgg 1500atagtatcga cacactctgg
acgctggtcg tgtgatggac tgttgccgcc acacttgctg 1560ccttgacctg
tgaatatccc tgccgctttt atcaaacagc ctcagtgtgt ttgatcttgt
1620gtgtacgcgc ttttgcgagt tgctagctgc ttgtgctatt tgcgaatacc
acccccagca 1680tccccttccc tcgtttcata tcgcttgcat cccaaccgca
acttatctac gctgtcctgc 1740tatccctcag cgctgctcct gctcctgctc
actgcccctc gcacagcctt ggtttgggct 1800ccgcctgtat tctcctggta
ctgcaacctg taaaccagca ctgcaatgct gatgcacggg 1860aagtagtggg
atgggaacac aaatggaaag ctt 1893931887DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
93gaattccttt cttgcgctat gacacttcca gcaaaaggta gggcgggctg cgagacggct
60tcccggcgct gcatgcaaca ccgatgatgc ttcgaccccc cgaagctcct tcggggctgc
120atgggcgctc cgatgccgct ccagggcgag cgctgtttaa atagccaggc
ccccgattgc 180aaagacatta tagcgagcta ccaaagccat attcaaacac
ctagatcact accacttcta 240cacaggccac tcgagcttgt gatcgcactc
cgctaagggg gcgcctcttc ctcttcgttt 300cagtcacaac ccgcaaacac
tagtatggct tccgcggcat tcaccatgtc ggcgtgcccc 360gcgatgactg
gcagggcccc tggggcacgt cgctccggac ggccagtcgc cacccgcctg
420agggggcgcg cccccgactg gtccatgctg ttcgccgtga tcaccaccat
cttctccgcc 480gccgagaagc agtggaccaa cctggagtgg aagcccaagc
ccaacccccc ccagctgctg 540gacgaccact tcggccccca cggcctggtg
ttccgccgca ccttcgccat ccgcagctac 600gaggtgggcc ccgaccgctc
caccagcatc gtggccgtga tgaaccacct gcaggaggcc 660gccctgaacc
acgccaagtc cgtgggcatc ctgggcgacg gcttcggcac caccctggag
720atgtccaagc gcgacctgat ctgggtggtg aagcgcaccc acgtggccgt
ggagcgctac 780cccgcctggg gcgacaccgt ggaggtggag tgctgggtgg
gcgcctccgg caacaacggc 840cgccgccacg acttcctggt gcgcgactgc
aagaccggcg agatcctgac ccgctgcacc 900tccctgagcg tgatgatgaa
cacccgcacc cgccgcctga gcaagatccc cgaggaggtg 960cgcggcgaga
tcggccccgc cttcatcgac aacgtggccg tgaaggacga ggagatcaag
1020aagccccaga agctgaacga ctccaccgcc gactacatcc agggcggcct
gaccccccgc 1080tggaacgacc tggacatcaa ccagcacgtg aacaacatca
agtacgtgga ctggatcctg 1140gagaccgtgc ccgacagcat cttcgagagc
caccacatct cctccttcac catcgagtac 1200cgccgcgagt gcaccatgga
cagcgtgctg cagtccctga ccaccgtgag cggcggctcc 1260tccgaggccg
gcctggtgtg cgagcacctg ctgcagctgg agggcggcag cgaggtgctg
1320cgcgccaaga ccgagtggcg ccccaagctg accgactcct tccgcggcat
cagcgtgatc 1380cccgccgagt ccagcgtgat ggactacaag gaccacgacg
gcgactacaa ggaccacgac 1440atcgactaca aggacgacga cgacaagtga
tgactcgagg cagcagcagc tcggatagta 1500tcgacacact ctggacgctg
gtcgtgtgat ggactgttgc cgccacactt gctgccttga 1560cctgtgaata
tccctgccgc ttttatcaaa cagcctcagt gtgtttgatc ttgtgtgtac
1620gcgcttttgc gagttgctag ctgcttgtgc tatttgcgaa taccaccccc
agcatcccct 1680tccctcgttt catatcgctt gcatcccaac cgcaacttat
ctacgctgtc ctgctatccc 1740tcagcgctgc tcctgctcct gctcactgcc
cctcgcacag ccttggtttg ggctccgcct 1800gtattctcct ggtactgcaa
cctgtaaacc agcactgcaa tgctgatgca cgggaagtag 1860tgggatggga
acacaaatgg aaagctt 18879432DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 94gatcagaatt ccgcctgcaa
cgcaagggca gc 329530DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 95gcatactagt ggcgggacgg agagagggcg
30964PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 96Lys Asp Glu Leu1
* * * * *
References