U.S. patent application number 14/793244 was filed with the patent office on 2016-01-07 for par1 modulation to alter myelination.
The applicant listed for this patent is Mayo Foundation for Medical Education and Research. Invention is credited to Kristen L. Drucker, Isobel A. Scarisbrick, Hye-Sook Yoon.
Application Number | 20160000791 14/793244 |
Document ID | / |
Family ID | 55016231 |
Filed Date | 2016-01-07 |
United States Patent
Application |
20160000791 |
Kind Code |
A1 |
Scarisbrick; Isobel A. ; et
al. |
January 7, 2016 |
PAR1 MODULATION TO ALTER MYELINATION
Abstract
Materials and methods for modulating protease activated receptor
1 (PAR1) activity to alter myelination are provided.
Inventors: |
Scarisbrick; Isobel A.;
(Rochester, MN) ; Yoon; Hye-Sook; (Rochester,
MN) ; Drucker; Kristen L.; (Oronoco, MN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Mayo Foundation for Medical Education and Research |
Rochester |
MN |
US |
|
|
Family ID: |
55016231 |
Appl. No.: |
14/793244 |
Filed: |
July 7, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62021566 |
Jul 7, 2014 |
|
|
|
Current U.S.
Class: |
424/172.1 ;
424/93.21; 514/267; 514/44A |
Current CPC
Class: |
A61K 31/519 20130101;
A61K 35/30 20130101; A61K 31/7105 20130101 |
International
Class: |
A61K 31/519 20060101
A61K031/519; A61K 35/30 20060101 A61K035/30 |
Goverment Interests
STATEMENT AS TO FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under
NS052741 awarded by the National Institutes of Health. the
government has certain rights in the invention.
Claims
1. A method for modulating myelination in a mammal, comprising; (a)
identifying the mammal as being in need of increased myelination;
and (b) administering to the mammal an agent that reduces the
activity of protease activated receptor 1 (PAR1).
2. The method of claim 1, wherein the agent is an siRNA, an
antisense nucleic acid molecule, an antibody against PAR1, or a
small molecule inhibitor of PAR1.
3. The method of claim 1, wherein the mammal is a human.
4. The method of claim 3, wherein the human is a preterm
infant.
5. The method of claim 3, wherein the human is an adult.
6. The method of claim 1, wherein the mammal is identified as
having a central nervous system (CNS) demyelinating disease, CNS
neuroinflammatory disease, or stroke.
7. The method of claim 1, wherein the mammal is identified as
having a CNS injury.
8. A method for treating a CNS demyelinating disorder in a mammal,
comprising administering to the mammal a composition comprising an
agent that reduces the activity of PAR1, wherein the composition is
administered in an amount effective to reduce or prevent
demyelination, or to enhance remyelination.
9. The method of claim 8, wherein the agent is an siRNA, an
antisense nucleic acid molecule, an antibody against PAR1, or a
small molecule inhibitor of PAR1.
10. The method of claim 8, wherein the mammal is a human.
11. The method of claim 10, wherein the human is a preterm
infant.
12. The method of claim 10, wherein the human is an adult.
13. The method of claim 8, wherein the CNS demyelinating disorder
is a CNS demyelinating disease, CNS neuroinflammatory disease, or
stroke.
14. The method of claim 8, wherein the CNS demyelinating disorder
is a CNS injury.
15. A method for modulating myelination in a subject, comprising
delivering to the subject a plurality of modified stem cells that
have reduced PAR expression as compared to corresponding wild type
stem cells.
16. The method of claim 15, wherein the subject is a human.
17. The method of claim 16, wherein the human is an adult with a
demyelinating disorder.
18. The method of claim 16, wherein the human is a preterm
infant.
19. The method of claim 15, wherein the stem cells are neural stem
cells.
20. The method of claim 19, wherein the neural stem cells comprise
a mutation in the PAR1 gene.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of priority from U.S.
Provisional Application No. 62/021,566, filed on Jul. 7, 2014.
TECHNICAL FIELD
[0003] This document relates to materials and methods for
modulating protease activated receptor 1 (PAR1) activity to alter
myelination.
BACKGROUND
[0004] Myelination in the central nervous system is achieved
through a delicate balance of extrinsic and intrinsic signaling
mechanisms. Myelin not only enhances axonal conduction velocity,
but also provides protection and trophic support (Wilkins et al.,
2003). Normal myelination requires a series of well-orchestrated
events, including the generation of oligodendrocyte progenitors
(OPCs), migration of the OPCs to specific regions of the brain or
spinal cord, and differentiation of the OCPs into oligodendrocytes
that elaborate multilamellar sheaths of plasma membrane to
myelinate axons in precise relation to their diameter. Aberrations
in this process during the perinatal period can result in white
matter injury and profound sensorimotor and cognitive disabilities.
Multiple factors can disrupt the key developmental mileposts,
including hemorrhagic-ischemic injuries (Mifsud et al., CNS
Neurosci Ther 20:603-612, 2014; Crawford et al., J Comp Pathol
149:242-254, 2013; and Volpe et al., Int J Devel Neurosci
29:423-440, 2011).
SUMMARY
[0005] This document is based in part on elucidation of the role of
PAR1 in regulating myelin gene expression, and the development of
methods for targeting PAR1 to improve myelination and locomotor
activity in vivo. As demonstrated by the data presented herein,
PAR1 is a therapeutic target for improving myelination in the
developing central nervous system. The methods disclosed herein can
be used to prevent perinatal white matter injuries, and provide
opportunities to improve both short and long term neurological
functional outcomes.
[0006] In one aspect, this document features a method for
modulating myelination in a mammal. The method can include (a)
identifying the mammal as being in need of increased myelination,
and (b) administering to the mammal an agent that reduces the
activity of protease activated receptor 1 (PAR1). The agent can be
an siRNA, an antisense nucleic acid molecule, an antibody against
PAR1, or a small molecule inhibitor of PAR1. The mammal can be a
human (e.g., a preterm infant, a child, an adolescent, or an
adult). The mammal can be identified as having a central nervous
system (CNS) demyelinating disease, CNS neuroinflammatory disease,
or stroke, or a CNS injury.
[0007] In another aspect, this document features a method for
treating a CNS demyelinating disorder in a mammal. The method can
include administering to the mammal a composition comprising an
agent that reduces the activity of PAR1, wherein the composition is
administered in an amount effective to reduce or prevent
demyelination, or to enhance remyelination. The agent can be an
siRNA, an antisense nucleic acid molecule, an antibody against
PAR1, or a small molecule inhibitor of PAR1. The mammal can be a
human (e.g., a preterm infant, a child, an adolescent, or an
adult). The CNS demyelinating disorder can be a CNS demyelinating
disease, CNS neuroinflammatory disease, or stroke, or a CNS
injury.
[0008] In another aspect, this document features a method for
modulating myelination in a subject. The method can include
delivering to the subject a plurality of modified stem cells that
have reduced PAR expression as compared to corresponding wild type
stem cells. The subject can be a human (e.g., an adult, adolescent,
or child with a demyelinating disorder), or a preterm infant. The
stem cells can be neural stem cells modified to have reduced PAR
expression as compared to corresponding wild type neural stem
cells. The modified neural stem cells can have a mutation in the
PAR1 gene.
[0009] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention pertains.
Although methods and materials similar or equivalent to those
described herein can be used to practice the invention, suitable
methods and materials are described below. All publications, patent
applications, patents, and other references mentioned herein are
incorporated by reference in their entirety. In case of conflict,
the present specification, including definitions, will control. In
addition, the materials, methods, and examples are illustrative
only and not intended to be limiting.
[0010] The details of one or more embodiments of the invention are
set forth in the accompanying drawings and the description below.
Other features, objects, and advantages of the invention will be
apparent from the description and drawings, and from the
claims.
DESCRIPTION OF DRAWINGS
[0011] FIG. 1 is a series of photomicrographs showing cellular
localization of Klk6, PAR1 and PAR2 in primary oligodendrocytes.
Immunocytochemical labeling for Klk6, PAR1 and PAR2 in 04.sup.+
mouse oligodendrocyte cultures isolated from PAR1.sup.+/+ postnatal
C57BL6/J mice (3 DIV). Abundant Klk6-immunoreactivity was observed
in the cell soma and in some O4.sup.+ processes. PAR1 was found in
the cell soma and throughout the oligodendrocyte process network.
By contrast, PAR2 was localized primarily to process nodules. Scale
bar=25 .mu.m.
[0012] FIG. 2A is a series of photomicrographs and FIGS. 2B and 2C
are graphs showing that PAR1 is necessary for Klk6-induced
oligodendrogliopathy in primary oligodendrocytes. O4.sup.+
oligodendrocyte cultures from PAR1.sup.+/+, PAR1.sup.-/-, or
PAR2.sup.-/- mice were treated with active recombinant Klk6 for 24
h. Klk6 (30 nM) promoted significant process retraction in
PAR1.sup.+/+ (SNK, P=9.0.times.10.sup.-4) or PAR2.sup.-/- (SNK,
P=0.002) oligodendrocytes, but not in the absence of PAR1 (FIGS. 2A
and 2B). Klk6 treatment had no effect on oligodendrocyte number in
cultures isolated from either PAR1.sup.+/+, PAR1.sup.-/-, or
PAR2.sup.-/- mice. Error bars indicate SEM. *P=<0.005,
**P=<0.001, SNK. Scale bar=100 .mu.m.
[0013] FIGS. 3A and 3B are a series of photomicrographs and FIGS.
3C to 3F are a series of graphs showing that Klk6 reduces the
maintenance of mature oligodendrocyte morphologies and exacerbates
ATP-mediated toxicity. The photomicrographs in FIG. 3A show four
morphological phenotypes that characterize the differentiation
state of primary oligodendroglia (FIGS. 3C and 3D). The
photomicrographs in FIG. 3B show loss of morphologic complexity
following ATP treatment (50 .mu.M), which was exacerbated by Klk6
(150 nM) (FIGS. 3D-3F) and to a lesser extent by Klk1 (150 nM)
(FIG. 3D). Treatment of 3 DIV oligodendrocyte cultures with Klk6
(150 nM) for 24 hours resulted in a significant increase in
immature phenotypes (simple, SNK, P=0.007 or incomplete, SNK,
P=4.7.times.10.sup.-4), while those with a mature phenotype
(complete, SNK, P=3.1.times.10.sup.-4 or membrane, SNK, P=0.038)
were significantly reduced (FIG. 3C). Correspondingly, Klk6
treatment resulted in fewer O4.sup.+ processes per cell (FIG. 3E).
Treatment with Klk1 alone did not significantly affect
oligodendrocyte morphology (FIG. 3C) or process number (FIG. 3E).
Treatment with ATP (50 .mu.M) also decreased the number of
oligodendroglia with complete morphologies (SNK, P=0.002),
increased the number with simple morphology (SNK, P=0.028) and
reduced the overall number of O4.sup.+ processes per cell (FIGS. 3D
and 3E, SNK, P=2.4.times.10.sup.-4). Co-application of Klk6 and ATP
further increased the loss of mature oligodendrocyte morphologies,
increasing the percentage of cells with an immature phenotype,
including simple (SNK, P=0.039) and incomplete (SNK, P=0.004),
while eliminating cells with mature complete (SNK,
P=2.0.times.10.sup.-4) and membrane morphologies (SNK, P=0.001)
(FIG. 3D). The effects of Klk6 and ATP were additive with regard to
loss of O4.sup.+ process (FIG. 3E). Klk1 also exacerbated the
effects of ATP, reducing the number of oligodendrocytes with a
membrane morphology (SNK, P=0.022). ATP promoted a significant loss
of O4.sup.+ cells (SNK, P=0.006), and this was exacerbated by the
addition of Klk6 (SNK, P=0.046), but not Klk1 (FIG. 3F).
*P<0.05, **P<0.005, ***P<0.001, SNK. (Scale bar=25 .mu.m
(FIG. 3A) or 100 .mu.m (FIG. 3B)).
[0014] FIG. 4A is a series of photomicrographs, and FIGS. 4B and 4C
are a pair of graphs, showing that Klk6, thrombin, and PAR1-AP
promote process retraction in Oli-neu oligodendrocytes. The
photomicrographs in FIG. 4A show retraction of Oli-neu
oligodendrocyte processes 24 hours after treatment with Klk6,
thrombin, or PAR1-AP, but not Klk1. FIG. 4B includes histograms
showing counts of Cy3-Phalloidin stained Oli-neu processes per cell
after 24 hours of treatment with Klk6 (30, 150, and 300 nM),
thrombin (270 nM), PAR1-AP (100 .mu.M), or Klk1 (300 nM). Klk6
caused a dose-dependent retraction of Oli-neu processes, relative
to control (SNK, P=1.5.times.10.sup.-4). Thrombin (SNK,
P=1.1.times.10.sup.-4) and PAR1-AP (SNK, P=2.7.times.10.sup.-4),
but not Klk1, also promoted significant process retraction. FIG. 4C
includes histograms showing counts of Oli-neu cells per field in
each treatment condition, presented as mean number of Phalloidin)
processes/DAPI.sup.- nuclei. 30 nM Klk6 and PAR1-AP treatment
resulted in a small but significant increase in Oli-neu cell number
(SNK, P=0.03 and P=0.003, respectively). Error bars indicate SEM.
*P<0.05; **P<0.001, SNK. Scale bar=100 .mu.m.
[0015] FIG. 5A is a series of photomicrographs, and FIGS. 5B-5D are
a series of graphs, showing that Klk6 impedes oligodendrocyte
progenitor process outgrowth in a PAR1-dependent fashion. Purified
O.sup.| oligodendrocyte progenitor cell (OPC) cultures from
PAR1.sup.+/+ mice were differentiated for 24 hours in the presence
of Klk6 (150 nM), thrombin (135 nM), or Klk1 (150 nM) (FIG. 5A).
Quantification of OPC process number per O4.sup.+ cell demonstrated
a significant inhibition of OPC process outgrowth in the case of
Klk6 and thrombin treatment, but not in response to Klk1 (SNK,
P=2.3.times.10.sup.-4, P=2.0.times.10.sup.-4) (FIG. 5B). Klk6
treated cells also developed significantly fewer processes than
thrombin treated cultures (SNK, P=2.3.times.10.sup.-4). Klk6 also
promoted a significant decrease in cell number (SNK, P=0.032) (FIG.
5C). Klk6-mediated inhibition of process outgrowth was diminished
in the presence of the PAR1 inhibitor, SCH79797 (50 nM) (SNK,
P=0.006, Klk6 vs. Klk6+SCH), albeit without returning process
outgrowth to control levels (SNK, P=2.4.times.10.sup.-4) (FIG. 5D).
Error bars indicate SEM. *P<0.05; **P<0.001, SNK. Scale
bar=100 .mu.m.
[0016] FIGS. 6A and 6B are a pair of graphs showing that Klk6 down
regulates myelin gene expression in a PAR1-dependent manner in
primary oligodendrocytes. Histograms show proteolipid protein (PLP)
(FIG. 6A) and myelin basic protein (MBP) (FIG. 6B) RNA expression
in PAR1.sup.+/+ or PAR1.sup.-/- primary mouse oligodendrocytes (3
DIV) following a 24 hour treatment with Klk6 (300 nM) or vehicle
alone. A significant Klk6-driven down regulation of PLP (Student's
t-test, P=5.9.times.10.sup.-4) and MBP (Student's t-test, P=0.029)
RNA was observed in PAR1.sup.+/+, but not PAR1.sup.-/-
oligodendrocytes. Expression data were normalized to GAPDH and
shown as percent of control. Error bars indicate SEM. *P<0.05,
**P<0.001, Student's t-test.
[0017] FIGS. 7A-7F are a series of graphs showing that Klk6-PAR1
signals through Erk1/2 to suppress myelin gene expression.
Quantitative PCR was used to determine the level of PLP (FIG. 7A)
or MBP (FIG. 7B) RNA in Oli-neu oligodendrocytes following 24 hours
of treatment with Klk6 (300 nM), thrombin (270 nM), PAR1-AP (100
.mu.M), or Klk1 (300 nM). A significant down regulation of PLP, but
not MBP, RNA was observed after treatment with Klk6 (SNK,
P=8.0.times.10.sup.-4), thrombin (SNK, P=0.003), or PAR1-AP (SNK,
P=7.4.times.10.sup.-4). Down regulation of PLP was observed
following 24 hours of treatment with as little as 30 nM Klk6 (SNK,
P=0.002) (FIG. 7C). Klk6-induced down regulation of PLP RNA was
abolished in the presence of the MEK1/2 inhibitor, U0126 (10 .mu.M)
(SNK, P=0.009, Klk6 vs. Klk6+U0126) (FIG. 7D). Western blotting
showed Erk1/2 phosphorylation in Oli-neu oligodendrocytes treated
with Klk6 or Klk1 for 10 min, with or without the PAR1 inhibitor,
SCH79797 (50 nM) (FIG. 7E). The histogram in FIG. 7F shows
densitometric quantification of bands, revealing a significant
increase in Erk1/2 phosphorylation in response to Klk6 (SNK,
P=0.012), which was abolished by SCH79797. Band optical density
measurements are expressed as percent of maximal response observed.
.beta.-actin levels were measured as a loading control. Error bars
indicate SEM. *P<0.05, **P<0.005, ***P.ltoreq.0.001, SNK.
[0018] FIGS. 8A-8C are a series of pictures, and FIGS. 8D-8G are a
series of graphs, showing that PAR1 plays a critical role in
Klk6-driven myelinopathy in vivo. The photomicrographs in FIGS. 8A
and 8B illustrate the extent of white matter pathology observed 72
hours after unilateral microinjection of 2 .mu.L of physiologic
saline, Klk6 (0.01 .mu.g/.mu.L), or PAR1-AP (0.1 .mu.g/.mu.L) into
the dorsal column of PAR1.sup.-/+ or PAR1.sup.-/- mice (FIG. 8A
shows H&E staining; FIG. 8B shows MBP). Dashed lines in H&E
stained sections demarcate the site of maximal lesion in each case.
As depicted in FIGS. 8C and 8G), microinjection of either Klk6 or
PAR1-AP resulted in a significant reduction in the number of
CC-1.sup.+ oligodendrocytes counted per 1.times.10.sup.5
.mu.m.sup.2 (the approximate size of the dorsal column in a given
section of spinal cord; Klk6, SNK, P=0.001; PAR1-AP, SNK, P=0.002),
in PAR.sup.|/| but not in PAR.sup.-/- mice. Microinjection of Klk6
or PAR1-AP resulted in enhanced rostrocaudal white matter injury
(FIG. 8D, Klk6, SNK, P=6.9.times.10.sup.-4; PAR1-AP, SNK, P=0.01),
rostrocaudal MBP loss (FIG. 8E; Klk6, SNK, P=4.1.times.10.sup.-4;
PAR1-AP, SNK, P=0.001), and maximal lesion area (FIG. 8F; Klk6,
SNK, P=3.3.times.10.sup.-4; PAR1-AP, SNK, P=3.2.times.10.sup.-4),
relative to saline alone, in PAR.sup.+/+ but not in PAR1.sup.-/-
mice. Error bars indicate SEM. *P<0.05, **P<0.005,
***P<0.001, SNK. (Scale bar=100 .mu.m, FIGS. 8A and 8B; 75
.mu.m, FIG. 8C.)
[0019] FIGS. 9A and 9B show that PAR1 expression in the spinal cord
is developmentally regulated and localized in part to
oligodendroglia. FIG. 9A is a graph plotting levels of PAR1 RNA
detected in the spinal cord of wild type mice, which were reduced
precipitously during the first postnatal week (*P<0.001, Newman
Keuls). FIG. 9B is a series of photomicrographs. A combination of
immunohistochemistry for PAR1 and immunofluorescence for CC-1 was
used to demonstrate co-localization of the receptor to spinal cord
white matter oligodendrocytes at all stages of development examined
(P7 shown). Arrows indicate a selection of PAR1/CC-1 co-labeled
oligodendroglia. Scale bar=20 .mu.m.
[0020] FIGS. 10A-10M include a picture of a Western blot and a
series of graphs showing that genetic deletion of PAR1
differentially increases PLP and MBP protein levels and is
associated with enhanced ERK1/2 signaling in developing and adult
spinal cord. The Western blots and associated histograms illustrate
that PAR1.sup.-/- genetic deletion results in significant changes
in the expression of oligodendrocyte-related proteins (FIGS. 10B to
10E), in addition to ERK1/2 (FIGS. 10H and 10K), in homogenates of
whole spinal cord. Genetic deletion of PAR1 resulted in higher
levels of PLP protein (FIG. 10B) at birth (P0) and P7, higher
levels of MBP protein (FIG. 10C) at P45, and higher levels of Olig2
protein (FIG. 10E) at P7 and P21 compared to levels detected in age
matched PAR1.sup.+/+ littermates. Levels of CNPase (FIG. 10D) were
reduced in PAR11.sup.-/- mice at P21, while no significant
differences in NFH (FIG. 10F) or NFL (FIG. 10G) were observed over
the same period. PAR1.sup.-/- genetic deletion was associated with
elevated levels of activated ERK1/2 at P21 (FIG. 10H) and elevated
levels of total ERK1/2 from P7 through adulthood (FIG. 10K). Levels
of activated AKT were also elevated over those seen at birth in
PAR1.sup.-/- by P7 (FIG. 10I). No significant differences were
observed in either total AKT (FIG. 10L) or in STAT3 (FIGS. 10J and
10M). ROD readings for Westerns were normalized to Actin to control
for loading. (*P<0.05, ** P.ltoreq.0.01, ***P.ltoreq.0.001
Newman Keuls; ND, not detected).
[0021] FIGS. 11A-11D include a pair of graphs and a series of
photomicrographs showing that PAR1 genetic deletion results in
increased numbers of spinal cord oligodendroglia. Counts of
Olig2-immunopositive cells within the dorsal columns of the spinal
cord revealed higher numbers at P0 (1.5-fold, P=0.04, Newman Keuls)
and P7 (1.3-fold, *P=0.05, Newman Keuls) in PAR1.sup.-/- (FIGS. 11A
and 11B), while the number of CC-1 immunopositive cells was
significantly elevated in PAR1.sup.-/- at P7 (1.6-fold, *P=0.03,
Newman Keuls) (FIGS. 11C and 11D). Scale bar=20 .mu.m.
[0022] FIGS. 12A-12F include graphs and a series of
photomicrographs showing that PAR1 genetic deletion increases the
expression of myelin-associated genes and PLP protein in vitro.
After a 72 hour period of differentiation, cultured OPCs
significantly down regulated the expression of PAR1 (*P=0.0005,
Students unpaired t-test) (FIG. 12A). Immediately after isolation
(0 h) by shaking from mixed glial cultures, PAR1.sup.-/+ and
PAR1.sup.-/- OPCs expressed similar levels of RNA encoding myelin
associated proteins (FIG. 12B). After a 72 hour period of
differentiation in vitro, PAR1.sup.-/- oligodendroglia expressed
higher levels of PLP, MBP and Olig2, but lower levels of NogoA
compared to wild type oligodendroglia cultured in parallel (FIG.
12C; ***P.ltoreq.0.001, Student's unpaired t-test). Treatment of
oligodendrocytes (24 hours in culture) with a small molecule
inhibitor of PAR1 (SCH79797, 70 nM) for 48 hours promoted a
significant increase in the expression of PLP and MBP RNA, and a
decrease in NogoA and Olig2 RNA (FIG. 12D). The photomicrographs of
FIG. 12E show PLP-immunostained PAR1.sup.+/+ and PAR1.sup.-/- OPCs
differentiated for 72 hours in vitro. PAR1-loss-of-function
(PAR1.sup.-/-) was associated with a significant increase in the
number of PLP-immunoreactive cells (1.3-fold more,
*P=0.03.times.10-5) as well as the amount of PLP-immunoreactivity
(ROD) per somal area (1.9-fold, *P=0.02.times.10.sup.-5) (FIG.
12F). Scale bar=20 .mu.m.
[0023] FIGS. 13A-13E include a series of photomicrographs, electron
micrographs, and plots showing that myelination occurs earlier and
the thickness of the myelin sheath attained is greater in the
spinal cord of PAR1.sup.-/- mice. The photomicrographs of FIG. 13A
show examples of paraphenylenediamine stained myelin sheaths in the
dorsal column of P0 and P45 mice. More myelinated axons were
counted in the spinal cord dorsal column white matter of
PAR1.sup.-/- relative to PAR.sup.+/+ mice on P0 (*P=0.02, Students
unpaired t-test) (FIG. 13B). At P45, parallel numbers of myelinated
axons were observed in PAR1.sup.+/+ and PAR1.sup.-/- mice, but the
number of myelinated fibers with a diameter of 10 .mu.m.sup.2
greater was significantly greater in mice lacking PAR1 (*P=0.02,
Students unpaired t-test). FIG. 13C is a series of electron
micrographs within the dorsal column white matter of spinal cords
from PAR1.sup.+/+ and PAR1.sup.-/- mice. At P0, the g-ratio of
axons 1-1.5 .mu.m was reduced in PAR1.sup.-/- mice reflecting
increased myelin thickness (*P=0.01, Students unpaired t-test)
(FIG. 13D). At P45, g-ratios were significantly lower across most
axon diameters examined, and increased myelin thickness was
observed across all axon diameters (*P.ltoreq.0.02, Students
unpaired t-test). FIG. 13E is a series of electron micrographs from
the spinal cord dorsal column of PAR1.sup.+/+ or PAR1.sup.-/-, mice
showing representative images demonstrating the relative thickness
of myelin wrapping 2, 1.3 or 0.5 .mu.m axons. Scale bar A=10 .mu.m;
C=2 .mu.m, E=0.2 .mu.m.
[0024] FIGS. 14A-14C are a series of graphs showing that PAR1
genetic-loss-of-function results in increased locomotor activity in
adulthood. A comprehensive laboratory animal monitoring system was
used to demonstrate that PAR1.sup.-/- mice have higher activity
under fed day (*P=0.04) or fasted night (*P=0.02) conditions (FIG.
14A), and higher ambulation (FIG. 14B; *P=0.02) and rearing (FIG.
14C; *P=0.04) under fasted night conditions (Students unpaired
t-test).
[0025] FIG. 15 is a diagram of a model by which PAR1 may suppress
oligodendrocyte precursor cell differentiation by limiting ERK1/2
signaling. The findings presented herein suggest that high levels
of OPC PAR1 expression limit the capacity of oligodendrocyte
precursor cells to differentiate towards a myelinating phenotype.
Genetic-loss-of PAR1 function is associated with elevated levels of
the ERK1/2 signaling intermediate, an established mediator of
myelination (Fyffe-Maricich et al., J Neurosci 31:843-850, 2011;
Ishii et al., J Neurosci 33:175-186, 2013). Taken together, the
data presented herein support a model in which PAR1 limits CNS
myelination by limiting ERK1/2 signaling.
[0026] FIG. 16 is a series of photomicrographs showing cerebellar
slices from postnatal day 8 mouse brain after they were grown in
cell culture for 7 days in the presence (bottom panels) or absence
(top panels) of SCH79797, a small molecule inhibitor of PAR1, and
then stained using immunofluorescence techniques for myelin
associated makers, including MBP, a marker of mature
oligodendrocytes (CC-1), and for a marker of oligodendrocyte
progenitor cells (NG2), as indicated. Photomicrographs show
staining for each individual antigen or for all of the antigens
collectively in a single slice (right panels).
[0027] FIG. 17 is a series of photomicrographs showing cerebellar
slices that were prepared from the brains of postnatal day 8 mice,
grown in culture for 72 hours, treated with a demyelinating agent
(Lysolecithin; LL) for 24 hours, cultured for 7 days, fixed, and
stained using immunofluorescence techniques for MBP to gauge myelin
regeneration.
[0028] FIGS. 18A and 18B are a pair of photomicrographs showing
axon remyelination in slices of dorsal column white matter from
adult male PAR1.sup.+/+ (FIG. 18A) or PAR1.sup.-/- (FIG. 18B) mice
that were microinjected with LL and then perfused with
paraformaldehyde 14 days later. Remyelinated axons (arrows) are
recognized by their thin appearance relative to axon diameter
compared to intact myelin sheaths. FIG. 18C is a graph plotting
counts of remyelinated axons in the slices from PAR1.sup.+/+ and
PAR1.sup.-/- mice (P=0.04, Students t-test, n=3 per group).
[0029] FIG. 19A is a graph plotting proliferation of neural
precursor cells (NPCs) isolated from the subventricular zone (SVZ)
of 8 week-old adult C57BL6/J mice and cultured in suspension. NPCs
from PAR1.sup.-/- and PAR1.sup.+/+ mice, determined based on
incorporation of bromodeoxyuridine (BrdU; *P=0.009). FIG. 19B is a
graph plotting the number of neurospheres formed in vitro by the
NPCs (**P=0.0007), while FIGS. 19C and 19D are photomicrographs
showing representative images of cultures of neurospheres derived
from PAR1.sup.+/+ (FIG. 19C) and PAR1.sup.-/- (FIG. 19D) mice.
[0030] FIG. 20 is a graph plotting relative optical density of NPCs
that were isolated from the SVZ of 8 week-old adult C57BL6/J mice,
cultured in suspension, and treated with 70, 35, 10 or 1 nM
SCH79797 (SCH). Proliferation is indicated by the levels of BrdU
incorporation, measured as relative optical density.
[0031] FIGS. 21A-21C are a series of graphs plotting expression of
nestin (FIG. 21A; **P=0.0002), Olig2 (FIG. 21B; **P=0.0001), and
glial fibrillary acidic protein (GFAP; FIG. 21C; **P=0.009, t-test)
in NPCs that were isolated from the SVZ of 8 week-old adult
C57BL6/J PAR1.sup.-/- and PAR1.sup.+/+ mice and cultured in
suspension for 5 days.
[0032] FIGS. 22A and 22B are a pair of graphs plotting the number
of NPCs (isolated from the SVZ of 8 week-old adult C57BL6/J
PAR1.sup.-/- and PAR1.sup.+/+ mice) that were immunopositive for
NG2 (a marker for oligodendrocyte progenitor cells; FIG. 22A) and
Olig2 (a marker for OPCs and mature oligodendrocytes at early
stages of differentiation; FIG. 22B).
[0033] FIGS. 23A-23C are a series of graphs plotting the effects of
PAR1 gene deletion on locomotor activity in adult mice. A
comprehensive laboratory animal monitoring system was used to
demonstrate that PAR1.sup.-/- mice had higher total activity under
fed day (*P=0.04) or fasted night conditions (*P=0.02; (FIG. 23A),
and higher ambulation (*P=0.02; FIG. 23B) and rearing (*P=0.04;
FIG. 23C) under fasted night conditions (Student's unpaired
t-test).
DETAILED DESCRIPTION
[0034] Demyelinating disease in the central nervous system (CNS)
causes deterioration of the myelin sheaths that cover nerve cells
in the brain, spinal cord, and optic nerve, preventing the nerves
from properly transmitting impulses. Demyelination also can occur
in the peripheral nerves.
[0035] CNS demyelinating diseases include, for example, multiple
sclerosis (MS), which is the most common demyelinating disease of
the CNS. A number of demyelinating diseases, such as optic
neuritis, neuromyelitis optica, and Leber's hereditary optic
neuropathy, affect the optic nerve. Less common CNS demyelinating
diseases include Tay-Sachs disease, adrenoleukodystrophy,
adrenomyeloneuropathy, and transverse myelitis. Demyelination also
can be caused by autoimmune disease, infection, nutritional
deficiencies, and low oxygen levels.
[0036] The symptoms of CNS demyelinating diseases can affect any
part of the CNS, and may include seizures, headaches, delirium,
confusion, and/or slurred speech. In some cases, muscle weakness,
paralysis, trouble with balance, difficulty walking, tremors, pain,
numbness, tingling affect some with the disease, vision and hearing
problems, and/or bladder problems can occur. Demyelination
disorders tend to progress over time, and some forms of CNS
demyelination can lead to early death or disability. For example,
while people with MS often have a normal or near-normal life
expectancy, hereditary demyelination disorders such Tay-Sachs
disease can end in early death.
[0037] Demyelination also can occur as a result of injury to the
brain or spinal cord. Leakage of blood-derived serine proteases
such as thrombin into the CNS is a common component of hemorrhagic,
hypoxic, traumatic and infectious injuries (Gingrich and Traynelis,
Trends Neurosci 23:399-407, 2000). Thrombin can also be generated
by CNS endogenous cells, and its elevation has been reported in
spinal cord injury (Citron et al., J Neurotrauma 17:1191-1203,
2000; Yoon et al., J Neurochem 127:283-298, 2013), ischemia
(Riek-Burchardt et al., Neurosci Lett 329:181-184, 2002; Chen et
al., J Neurosci 32:7622-7631, 2012) and Alzheimer's disease (Arai
et al., J Neuropathol Exp Neurol 65:19-25, 2006). In addition to
its roles in thrombostasis, thrombin elevation can serve as a
powerful neurotoxic agent (Han et al., Mol Brain 4:32, 2011; Yoon
et al., supra).
[0038] Thrombin's cellular actions are conveyed by N-terminal
cleavage of an extracellular, seven transmembrane G-protein coupled
receptor, protease activated receptor 1 (PAR1), also referred to as
the thrombin receptor (Vu et al., Nature 353:674-677, 1991). PAR1
has highest affinity for thrombin, but also can be activated by
other secreted serine proteases, including plasmin, activated
protein C, granzyme A, MMP-1, and select kallikreins
(Oikonomopoulou et al., J Biol Chem 281:32095-32112, 2006;
Oikonomopoulou et al., Biol Chem 387:677-685, 2006; Vandell et al.,
J Neurochem 107:855-870, 2008; Adams et al., Pharmacol Ther
130:248-282, 2011; Burda et al., Glia 61:1456-1470, 2013; Yoon et
al., supra). PAR1 activation also plays a role in suppressing
myelin gene transcription, in limiting oligodendrocyte progenitor
(OPC) process elaboration, and in exacerbating the impact of
neurotoxic agents in vitro, and PAR1 can mediate protease-elicited
demyelination in vivo in the adult murine spinal cord (Burda et
al., supra). A common feature of pre-term birth is intraventricular
or intraparenchymal hemorrhage, which can excessively engage the
thrombin receptor and lead to a functional blockade of normal
myelination.
[0039] As described in the Examples herein, a murine genetic model
was used to functionally evaluate the role of PAR1 in the process
of murine spinal cord myelination at cellular, molecular, and
ultrastructural levels. The experimental results demonstrated that
PAR1 is a key suppressor of developmental myelination, and that its
absence results in elevations in extracellular-signal-regulated
kinase (ERK1/2) signaling and hypermyelination, including more
myelinated axons and higher levels of PLP at term, as well as the
attainment of higher levels of MBP, thicker myelin sheaths, and
enhanced motor activity in adults.
[0040] This document therefore provides materials and methods for
modulating myelination in a subject by delivering to the subject an
agent that reduces the activity of PAR1. The subject can be, for
example, a mammal, such as a mouse, rat, rabbit, dog, cat, monkey,
or human, including preterm infants as well as juveniles or adults
who are in need of increased myelination. Since PAR1 acts to
suppress myelination, reducing PAR1 activity can increase
myelination. In some embodiments, therefore, a subject identified
as having or as being at risk for having a CNS demyelinating
disorder can be given an agent that reduces the level of PAR1
activity. In some cases, an agent can inhibit the action of the
PAR1 protein, while in other cases an agent can inhibit expression
of the PAR1 gene.
[0041] Suitable agents include, for example, drugs, small
molecules, antibodies or antibody fragments, such as Fab'
fragments, F(ab').sub.2 fragments, or scFv fragments that bind
PAR1, antisense oligonucleotides, interfering RNA (RNAi, including
short interfering RNA (siRNA) and short hairpin RNA (shRNA)), or
combinations thereof. Methods for producing antibodies and antibody
fragments are known in the art. Chimeric antibodies and humanized
antibodies made from non-human (e.g., mouse, rat, gerbil, or
hamster) antibodies also can be useful. Chimeric and humanized
monoclonal antibodies can be produced by recombinant DNA techniques
known in the art, for example, using methods described in U.S. Pat.
Nos. 4,816,567; 5,482,856; 5,565,332; 6,054,297; and 6,808,901.
[0042] Antisense oligonucleotides as provided herein are at least 8
nucleotides in length and hybridize to a PAR1 transcript. For
example, a nucleic acid can be about 8, 9, 10 to 20 (e.g., 11, 12,
13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length), 15 to 20,
18 to 25, or 20 to 50 nucleotides in length. In some embodiments,
antisense molecules greater than 50 nucleotides in length can be
used, including the full-length sequence of a PAR1 mRNA. As used
herein, the term "oligonucleotide" refers to an oligomer or polymer
of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or analogs
thereof Nucleic acid analogs can be modified at the base moiety,
sugar moiety, or phosphate backbone to improve, for example,
stability, hybridization, or solubility of a nucleic acid.
Modifications at the base moiety include substitution of
deoxyuridine for deoxythymidine, and 5-methyl-2'-deoxycytidine and
5-bromo-2'-deoxycytidine for deoxycytidine. Other examples of
nucleobases that can be substituted for a natural base include
5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives
of adenine and guanine, 2-propyl and other alkyl derivatives of
adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and
cytosine, 6-azo uracil, cytosine and thymine, 5-uracil
(pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol,
8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and
guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other
5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and
7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Other useful
nucleobases include those disclosed, for example, in U.S. Pat. No.
3,687,808.
[0043] Modifications of the sugar moiety can include modification
of the 2' hydroxyl of the ribose sugar to form 2'-O-methyl or
2'-O-allyl sugars. The deoxyribose phosphate backbone can be
modified to produce morpholino nucleic acids, in which each base
moiety is linked to a six-membered, morpholino ring, or peptide
nucleic acids, in which the deoxyphosphate backbone is replaced by
a pseudopeptide backbone (e.g., an aminoethylglycine backbone) and
the four bases are retained. See, for example, Summerton and
Weller, Antisense Nucleic Acid Drug Dev. 7:187-195, 1997; and Hyrup
et al., Bioorgan. Med. Chem. 4:5-23, 1996. In addition, the
deoxyphosphate backbone can be replaced with, for example, a
phosphorothioate or phosphorodithioate backbone, a
phosphoroamidite, or an alkyl phosphotriester backbone. See, for
example, U.S. Pat. Nos. 4,469,863; 5,235,033; 5,750,666; and
5,596,086 for methods of preparing oligonucleotides with modified
backbones.
[0044] Antisense oligonucleotides also can be modified by chemical
linkage to one or more moieties or conjugates that enhance the
activity, cellular distribution or cellular uptake of the
oligonucleotide. Such moieties include but are not limited to lipid
moieties (e.g., a cholesterol moiety); cholic acid; a thioether
moiety (e.g., hexyl-S-tritylthiol); a thiocholesterol moiety; an
aliphatic chain (e.g., dodecandiol or undecyl residues); a
phospholipid moiety (e.g., di-hexadecyl-rac-glycerol or
triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate);
a polyamine or a polyethylene glycol chain; adamantane acetic acid;
a palmityl moiety; or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety. The preparation of such
oligonucleotide conjugates is disclosed in, for example, U.S. Pat.
Nos. 5,218,105 and 5,214,136.
[0045] Methods for synthesizing antisense oligonucleotides are
known, including solid phase synthesis techniques. Equipment for
such synthesis is commercially available from several vendors
including, for example, Applied Biosystems (Foster City, Calif.).
Alternatively, expression vectors that contain a regulatory element
that directs production of an antisense transcript can be used to
produce antisense molecules.
[0046] Antisense oligonucleotides can bind to a nucleic acid
encoding PAR1, including DNA encoding PAR1 RNA (including pre-mRNA
and mRNA) transcribed from such DNA, and also cDNA derived from
such RNA, under physiological conditions (i.e., physiological pH
and ionic strength).
[0047] It is understood in the art that the sequence of an
antisense oligonucleotide need not be 100% complementary to that of
its target nucleic acid to be hybridizable under physiological
conditions. Antisense oligonucleotides hybridize under
physiological conditions when binding of the oligonucleotide to the
PAR1 nucleic acid interferes with the normal function of the PAR1
nucleic acid, and non-specific binding to non-target sequences is
minimal.
[0048] Target sites for PAR1 antisense oligonucleotides can include
the regions encompassing the translation initiation or termination
codon of the open reading frame (ORF) of the gene. In addition, the
ORF can be targeted effectively in antisense technology, as have
the 5' and 3' untranslated regions. In some embodiments, antisense
oligonucleotides can be directed at intron regions and intron-exon
junction regions. Further criteria can be applied to the design of
antisense oligonucleotides. Such criteria are well known in the
art, and are widely used, for example, in the design of
oligonucleotide primers. These criteria include the lack of
predicted secondary structure of a potential antisense
oligonucleotide, an appropriate G and C nucleotide content (e.g.,
approximately 50%), and the absence of sequence motifs such as
single nucleotide repeats (e.g., GGGG runs). The effectiveness of
antisense oligonucleotides at modulating expression of a PAR1
nucleic acid can be evaluated by measuring levels of the PAR1 mRNA
or polypeptide (e.g., by Northern blotting, RT-PCR, Western
blotting, ELISA, or immunohistochemical staining)
[0049] Single and double-stranded interfering RNA (RNAi, such as
siRNA and shRNA) homologous to PAR1 DNA also can be used to reduce
expression of PAR1 and consequently, activity of PAR1. See, e.g.,
U.S. Pat. No. 6, 933,146; Fire et al., Nature 391:806-811, 1998;
Romano and Masino, Mol. Microbiol. 6:3343-3353, 1992; Cogoni et
al., EMBO J. 15:3153-3163, 1996; Cogoni and Masino, Nature
399:166-169, 1999; Misquitta and Paterson, Proc. Natl. Acad. Sci.
USA 96:1451-1456, 1999; and Kennerdell and Carthew, Cell
95:1017-1026, 1998.
[0050] The sense and anti-sense RNA strands of RNAi can be
individually constructed using chemical synthesis and enzymatic
ligation reactions using procedures known in the art. For example,
each strand can be chemically synthesized using naturally occurring
nucleotides or nucleic acid analogs. The sense or anti-sense strand
also can be produced biologically using an expression vector into
which a target PAR1 sequence (full-length or a fragment) has been
subcloned in a sense or anti-sense orientation. The sense and
anti-sense RNA strands can be annealed in vitro before delivery of
the dsRNA to cells. Alternatively, annealing can occur in vivo
after the sense and anti-sense strands are sequentially delivered
to the tumor vasculature or to tumor cells.
[0051] In some embodiments, a PAR1 agent can be incorporated into a
pharmaceutical composition. For example, an agent can be suspended
in a pharmaceutically-acceptable carrier (e.g., physiological
saline), and can be administered via any suitable route. For
example, an agent can be delivered orally or by intravenous
infusion, or injected subcutaneously, intramuscularly,
intrathecally, intraperitoneally, intrarectally, intravaginally,
intranasally, intragastrically, intratracheally, or
intrapulmonarily. The agent can, for example, be delivered directly
to the affected organ or tissue and/or vasculature of the organ, or
a site of an immune response such as a lymph node in the region of
an affected tissue or organ or spleen. For treating tissues in the
central nervous system, an agent can be administered by injection
or infusion into the cerebrospinal fluid, optionally with one or
more additional agents that are capable of promoting penetration of
the first agent across the blood-brain barrier.
[0052] Dosage required depends on the choice of the route of
administration, the nature of the formulation, the nature of the
patient's illness, the subject's size, weight, surface area, age,
and gender, other drugs being administered, and the judgment of the
attending physician. Suitable dosages typically are in the range of
0.0001-100.0 mg/kg, although wide variations in the needed dosage
are to be expected in view of the variety of compounds available
and the differing efficiencies of various routes of administration.
Variations in dosage levels can be adjusted using standard
empirical routines for optimization as is well understood in the
art. Encapsulation of an agent in a suitable delivery vehicle
(e.g., polymeric microparticles or an implantable device) may
increase the efficiency of delivery, particularly for oral
delivery.
[0053] In some embodiments, a nucleic acid (e.g., an expression
vector containing a regulatory sequence operably linked to a
nucleic acid encoding an antisense oligonucleotide, or an
expression vector from which sense and anti-sense RNAs can be
transcribed under the direction of separate promoters, or a single
RNA molecule containing both sense and anti-sense sequences can be
transcribed under the direction of a single promoter) can be
delivered to appropriate cells in a subject. Suitable expression
vectors include, for example, plasmids and viral vectors such as
herpes viruses, retroviruses, vaccinia viruses, attenuated vaccinia
viruses, canary pox viruses, adenoviruses and adeno-associated
viruses, among others.
[0054] Expression of a nucleic acid can be directed to any cell in
the body of the subject. However, it can be particularly useful to
direct expression to cells in, or close to, the CNS. Targeted
expression can be achieved by, for example, the use of polymeric,
biodegradable microparticle or microcapsule delivery devices known
in the art and/or tissue or cell-specific antibodies.
Alternatively, tissue specific targeting can be achieved by the use
of tissue-specific transcriptional regulatory sequences (i.e.,
tissue specific promoters) which are known in the art.
[0055] Nucleic acids also can be delivered to cells using
liposomes, which can be prepared by standard methods. Vectors can
be incorporated alone into these delivery vehicles, or can be
co-incorporated with tissue-specific antibodies. Alternatively, a
molecular conjugate composed of a plasmid or other vector attached
to poly-L-lysine by electrostatic or covalent forces can be
prepared. Poly-L-lysine binds to a ligand that can bind to a
receptor on target cells (Cristiano et al., J. Mol. Med. 73:479,
1995). Delivery of "naked DNA" (i.e., without a delivery vehicle)
to an intramuscular, intradermal, or subcutaneous site is another
means to achieve in vivo expression.
[0056] In some embodiments, an agent that reduces PAR1 activity can
be incorporated into a pharmaceutical composition, such as by
combination with a pharmaceutically acceptable carrier.
Pharmaceutically acceptable carriers are biologically compatible
vehicles that are suitable for administration to a mammal (e.g., a
human), and include, for example, water, physiological saline, and
liposomes. Pharmaceutically acceptable carriers can be selected
with the planned manner of administration in mind so as to provide
for the desired bulk, consistency, and other pertinent transport
and chemical properties, when combined with one or more of
components of a given pharmaceutical composition.
[0057] As discussed above, the dosage for any one patient depends
upon many factors, including the patient's size, body surface area,
age, the particular compound to be administered, sex, time and
route of administration, general health, and other drugs being
administered concurrently. Dosages will vary, but a preferred
dosage for administration of nucleic acid is from approximately
10.sup.6 to approximately 10.sup.12 copies of the nucleic acid.
This dose can be repeatedly administered, as needed. Routes of
administration can be any of those described above.
[0058] In addition, a method can be an ex vivo procedure that
involves providing a recombinant cell that is, or is a progeny of a
cell, obtained from a subject and has been transfected or
transformed ex vivo with one or more nucleic acids encoding one or
more agents that reduce PAR1 activity (e.g., an siRNA targeted to
PAR1), so that the cell expresses the agent(s); and administering
the cell to the subject. The cells can be cells obtained from the
subject to whom they are to be administered, or from another
subject. The donor and recipient of the cells can have identical
major histocompatibility complex (MHC; HLA in humans) haplotypes.
In some embodiments, the donor and recipient are homozygotic twins
or are the same individual (i.e., are autologous). The recombinant
cells can also be administered to recipients that have no, or only
one, two, three, or four MHC molecules in common with the
recombinant cells, e.g., in situations where the recipient is
severely immuno-compromised, where only mismatched cells are
available, and/or where only short term survival of the recombinant
cells is required or desirable.
[0059] The efficacy of an agent can be evaluated both in vitro and
in vivo. Briefly, an agent can be tested for its ability, for
example, to (a) reduce PAR1 activity, (b) increase myelination, or
(c) inhibit or slow the progression of demyelination. For in vivo
studies, the agent can, for example, be injected into an animal
(e.g., a mouse model of CNS demyelination), and its effects then
can be assessed. Suitable methods for evaluating the level or
progression of myelination/demyelination include, without
limitation, imaging, motor evoked potential, visual evoked
potentials, sensorimotor, and cognitive functional outcomes. Based
on the results, an appropriate dosage range and administration
route can be determined.
[0060] In some embodiments, the methods provided herein can include
identifying a subject as being in need of increased myelination. A
subject can be identified on the basis of, for example, having a
disorder characterized by demyelination (e.g., demyelination in the
CNS). In some cases, the subject can be identified as having a
neuroinflammatory disease or a stroke, or as having an injury to
the CNS.
[0061] In some embodiments of the methods provided herein, an agent
that reduces PAR1 activity, or a composition containing such an
agent, can be administered to a subject in an amount effective to
reduce or prevent demyelination, or to enhance remyelination. For
example, an effective amount of an agent or a composition
containing an agent can reduce the level or rate of demyelination
in a subject by at least 10 percent (e.g., at least 20, 30, 40, 50,
60, 70, 80, 90, 10 to 25, 25 to 50, 50 to 75, or 75 to 100 percent)
as compared to the level or rate of demyelination in the subject
prior to treatment, or as compared to the level or rate of
demyelination in an untreated subject. In some embodiments, an
effective amount of an agent or a composition containing an agent
can increase the level or rate of remyelination in a subject by at
least 10 percent (e.g., at least 20, 30, 40, 50, 60, 70, 80, 90, 10
to 25, 25 to 50, 50 to 75, or 75 to 100 percent) as compared to the
level or rate of remyelination in the subject prior to treatment,
or as compared to the level or rate of remyelination in an
untreated subject.
[0062] In some cases, a method as provided herein can include
delivering to a subject a population of stem cells that have been
modified to have reduced PAR expression as compared to
corresponding wild type neural stem cells. For example, the stem
cells can be modified in vitro to contain a mutation in the PAR1
gene, such that PAR1 expression is reduced or even knocked out.
Suitable types of stem cells include, without limitation, embryonic
stem cells, induced pluripotent stem cells, bone marrow derived
stem cells, mesenchymal stem cells, and neural stem cells. After
delivery to the subject (e.g., a preterm infant, or a juvenile or
adult having a CNS injury or demyelinating disorder), the stem
cells can differentiate into neuronal cells and, due to their
reduced level of PAR1 expression, can facilitate or enhance
myelination.
[0063] The invention will be further described in the following
examples, which do not limit the scope of the invention described
in the claims.
EXAMPLES
Example 1
Critical Role for PAR1 in Kallikrein 6-Mediated
Oligodendrogliopathy
Materials and Methods
[0064] Animal care and use: Eight- to ten-week-old C57BL6/J mice
were obtained from Jackson Laboratories. Mice deficient in PAR1
(PAR1.sup.-/-, B6.129S4-F2r.sup.tm1Ajc/J) or PAR2 (PAR2.sup.-/-,
B6.Cg-F2rl1(tm1Mslb)/J) were obtained from Jackson and backcrossed
to C57BL6/J for at least 20 generations, such that PAR1.sup.+/+
littermates served as controls.
[0065] Oligodendrocyte Cultures: Purified cortical oligodendrocyte
progenitor cells (OPCs) and differentiated oligodendrocytes were
isolated from mixed glial cultures derived from postnatal day 1
mice (McCarthy and de Vellis, J Cell Biol 85:890-902, 1980). Glial
cultures were grown in media containing DMEM, 2 mM Glutamax, 1 mM
sodium pyruvate, 20 mM HEPES, and 10% heat-inactivated fetal calf
serum (Atlanta Biologicals, Lawrenceville, Ga.). OPCs were isolated
from 10 days-in-vitro (DIV) mixed glial cultures by overnight
shaking and purified by differential adhesion. OPCs were seeded in
defined Neurobasal A media containing 1% N2, 50 U/mL
penicillin/streptomycin, 2 mM Glutamax, 1 mM sodium pyruvate, 0.45%
glucose, and 50 .mu.M .beta.-mercaptoethanol (Sigma Aldrich, USA).
OPCs were seeded at 3.times.10.sup.4/cm.sup.2 onto tissue culture
plastic or 12 mm glass cover slips coated with poly-L-lysine (PLL,
10 .mu.g/mL). After 24 h, cultures were 92-98% immunoreactive (IR)
for sulfatide (O4) and by 72 hours at least 80% were also
MBP-IR.
[0066] Oli-neu oligodendrocytes are derived from mouse primary
oligodendrocyte cultures retrovirally transduced to constitutively
express the t-neu oncogene (Jung et al., Eur J Neurosci
7:1245-1265, 1995). All morphology, signaling, and myelin gene
expression studies using Oli-neu oligodendrocytes were performed in
media containing DMEM, 1% N2, 2 mM Glutamax, 1 mM sodium pyruvate,
20 mM HEPES buffer, and 50 .mu.M .beta.-mercaptoethanol (Sigma
Aldrich. To evaluate PAR and Klk6 gene expression in Oli-neu (Table
2), cells were differentiated by treatment with 1 mM N.sup.6,
2'-O-dibutyryladenosine 3',5'-cyclic monophosphate disodium salt
(dbcAMP) for 72 hours prior to harvesting for RNA isolation. All
cells were maintained at 37.degree. C. in 95% air and 5% CO.sub.2.
Cell culture reagents were obtained from Life Technologies
(Carlsbad, Calif.) unless otherwise indicated. All cell culture
experiments were performed in triplicate and repeated at least
twice.
[0067] Recombinant kallikreins and PAR agonists: Recombinant murine
Klk6 and Klk1 were expressed using a baculovirus system and
purified as described previously (Blaber et al., Biochemistry
41:1165-1173, 2002; Scarisbrick et al., PLoS One 6:e18376, 2011;
and Scarisbrick et al., Biol Chem 393:355-367, 2012a).
Concentrations of Klk6 used in these studies (30-300 nM (1-10
.mu.g/mL; 15,000-159,000 U/mL)) were based on previous work
demonstrating those sufficient to elicit Ca.sup.2+ signaling and
Erk1/2 activation in neural cells (Vandell et al., supra). Klk1 was
used at comparable concentrations (300 nM (10 .mu.g/mL; 173,000
U/mL)). An equivalent concentration of Human .alpha.-thrombin (270
nM (10 .mu.g/mL; 161,000 U/mL, Enzyme Research Laboratories, South
Bend, Ind.)) was also examined. The specific activity of 1 ng of
Klk6, Klk1, or thrombin was measured by analysis of the rate of
hydrolysis against 100 .mu.M
t-Butyloxycarbonyl-Valine-Proline-Arginig-7-Amino-4-methylcoumarin
(Boc-VP-AMC) fluorogenic peptide substrate (R&D Systems,
Minneapolis, Minn.). PAR1-activating peptide (PAR1-AP)
(TFLLR-amide, Peptides International) that mimics the PAR1 tethered
ligand was used at 100 .mu.M (100 .mu.g/mL) (Vandell et al.,
supra).
[0068] Expression of oligodendrocyte PARs and
Klk6-immunocytochemistry for PARs and Klk6: Oligodendrocyte
cultures seeded on glass cover slips were immunostained with the
following primary antibodies: rabbit anti-Klk6 (Scarisbrick et al.,
Brain Pathol 22:709-722, 2012b), goat anti-PAR1 (C-18) or -PAR2
(C-17) (Santa Cruz, Santa Cruz, Calif.), and mouse anti-sulfatide
(O4) (Dr. Ben Barres, Stanford University). Immunostaining involved
fixation of cultures with 2% paraformaldehyde (PFA) prior to
incubation with primary antibody, with the exception of O4
immunostaining, which was accomplished using live cells at
4.degree. C. followed by fixation with 2% PFA. Cells were then
incubated with affinity-purified, species-appropriate
fluorochrome-conjugated secondary antibodies (Jackson
Immunoresearch Laboratories, Westgrove, Pa.) and mounted using
VECTASHIELD with 4',6-diamidino-2-phenylindole (DAPI) (Vector
Laboratories, Burlingame, Calif.).
[0069] Expression of oligodendrocyte PARs and Klk6-real-time
quantitative PCR: Total RNA was isolated from cultured cells using
RNA STAT-60 (Tel-Test, Friendswood, Tex.). Klk6, PAR1, or PAR2 RNA
expression was determined in 0.5 .mu.g of RNA with the iScript
one-step RT-PCR kit with SYBR.RTM. Green and the iCycler iQ5 system
(BioRad, Hercules, Calif.). Transcript copy number was determined
using a standard curve prepared by parallel amplification of cDNA
clones diluted to known copy number (Christophi et al., J Neurochem
91:1439-1449, 2004). Primers used for amplification are listed in
Table 1. Amplification of the housekeeping gene glyceraldehyde
phosphate 3-dehydrogenase (GAPDH) was used to control for loading.
The mean and standard error (SEM) of transcript copy number was
determined and data expressed as RNA copy number on a logarithmic
scale.
[0070] PAR agonist-induced changes in oligodendrocyte morphology:
To determine the effects of recombinant Klk6, Klk1, thrombin, or
PAR1-AP on oligodendroglia, 3 DIV PAR1.sup.+/+, PAR1.sup.-/-, and
PAR2.sup.-/- oligodendrocytes, PAR1.sup.+/+ OPCs immediately post
purification, or Oli-neu cells were grown on cover slips in the
presence of agonists for 24 h. For ATP toxicity assays,
oligodendrocytes were incubated with ATP (50 .mu.M, Sigma Aldrich)
in the presence of Klk6 or Klk1. Following each treatment,
oligodendrocyte and OPC cultures were immunolabeled for O4 to
visualize the cell body and processes. Oli-neu processes were
visualized by staining the actin cytoskeleton with Cy3-conjugated
Phalloidin.
[0071] To assess the effects of Klk6 and other PAR1 agonists on
oligodendrocyte morphology and process stability, 20.times. digital
micrographs were overlaid with a 780 .mu.m.sup.2 grid and ImageJ
software 1.45r (National Institutes of Health) used to record cell
number and the number of processes crossing horizontal grid lines
(Scarisbrick et al., Brain 125:1283-1296, 2002). Data are expressed
as the mean number of O4.sup.+ or Phalloidin.sup.+ processes per
DAPI.sup.+ cell (.+-.SEM).
[0072] The extent of oligodendrocyte morphological differentiation
was determined by scoring O4.sup.+/DAPI.sup.+ oligodendrocyte
morphology as simple (only primary processes, no secondary
branching), incomplete (one or more primary process without
secondary branching), complete (all primary processes with
secondary branching), or membrane (complete secondary branching
with membrane sheets) (Huang et al., Nat Neurosci 14:45-53, 2011).
The mean number of cells in each morphology class was determined
across treatments and expressed as percent of total
O4.sup.+/DAPI.sup.+ cells.
[0073] Changes in OPC or oligodendrocyte morphology were quantified
from five microscopic fields per cover slip with the mean and SEM
calculated across three cover slips per experiment. Each experiment
was repeated at least twice using independent cultures. Analysis of
oligodendrocyte morphology was performed without knowledge of
treatment groups.
[0074] Regulation of oligodendrocyte myelin gene expression by PAR1
agonists: Primary murine oligodendrocytes (3 DIV) or Oli-neu
oligodendrocytes were seeded at 3.5.times.10.sup.5 cells/well in
six-well tissue culture plates. Cells were then treated with Klk6
(30-300 nM), Klk1 (300 nM), thrombin (270 nM), or PAR1-AP (100
.mu.M) for 24 hours prior to RNA isolation. Expression of
myelin-associated genes, PLP, and MBP was examined by real-time
quantitative RT-PCR. Expression levels of target genes were
normalized to GAPDH and expressed as percent control.
[0075] Klk6-PAR signaling assays: To examine the ability of Klk6 to
mediate PAR-dependent signaling in oligodendrocytes, Oli-neu
oligodendroglia (3.5.times.10.sup.5 cells/well in six-well plates)
were treated with Klk6 (150 nM) for 10 min, followed by protein
harvest. Cell lysates were analyzed for phosphorylated or
nonphosphorylated Erk1/2 by Western blot. In experiments to
determine the role of PARs in Klk6 signaling, Ol-neu were
preincubated with the PAR1 antagonist, SCH79797 dihydrochloride (50
nM, Tocris Biosciences, Minneapolis, Minn.) for 30 minutes prior to
Klk6 application.
[0076] Western blot: Oli-neu lysates were obtained using a buffer
containing 1% NP40, 0.5% deoxycholate, 10% glycerol, and 20 mM Tris
base and separated on SDS-polyacrylamide gels prior to transfer.
Membranes were blocked with 5% milk in TBS-T and incubated
overnight with primary antibodies including rabbit
anti-phospho-Erk1/2 (1:1,000, Cell Signaling Technology, Danvers,
Mass.), followed with a species-appropriate horseradish
peroxidase-conjugated secondary antibody (1:20,000 GE Healthcare
Unlimited, UK). Signal was detected using Chemiluminescence
Supersignal Pico (Pierce, Rockford, Ill.). Western blots were
repeated three times from independent cultures, scanned, and
quantified by densitometry (BioRad Quantity One 1-D Analysis
Software, BioRad, Hercules, Calif.). Erk1/2 signal was normalized
to its nonphosphorylated form. Equal loading was verified by
reprobing blots for .beta.-Actin (Novus Biologicals, Littleton,
Colo.).
[0077] In vivo effects of excess Klk6 or PAR1-AP in spinal cord
white matter: All mice were administered Buprenorphine
preoperatively (Buprenex, 0.03 mg/kg, intraperitoneal (i.p.),
Reckitt Benckise, Slough, UK) and every 12 hours for the first 48
hours following surgery. Surgical anesthesia was induced in
age-matched male C57BL6/J or PAR12/2 mice using Ketamine (Ketaset,
80 mg/kg, Fort Dodge Animal Health, Fort Dodge, Iowa) and Xylazine
i.p. (Anased, 10 mg/kg, Lloyd Laboratories, Shenendoah, Iowa). A
thoracic (T11-T12) laminectomy was performed and a 30-40 .mu.m
glass capillary needle inserted into a 10 .mu.L gas-tight Hamilton
Syringe (Hamilton Company, Reno, Nev.) used to deliver 2 .mu.L of
Klk6 (0.01 .mu.g/.mu.L (300 nM)), PAR1-AP (0.01 .mu.g/.mu.L (100
.mu.M)), or vehicle (physiologic saline) alone (n=3 for each
treatment group) using a stereotaxic injection system (Stoelting,
Wood Dale, Ill.). Under micromanipulator control (MyNeurolab,
Richmond, Ill.), the needle was inserted 350 .mu.m into the dorsal
column, infusion carried out over 5 minutes and the needle left in
place for 3 minutes to avoid backflow. All mice received 0.5 mL of
sterile saline and Baytril (2.5 mg/kg, Bayer Healthcare, Shawnee
Mission, Kans.) i.p. postoperatively.
[0078] Seventy-two hours after microinjection of PAR1 agonists,
mice were deeply anesthetized with Nembutal (50 mg/kg, i.p.,
Lundbeck, Deerfield, Ill.) and perfused transcardially with 4% PFA.
Two millimeter transverse spinal cord segments encompassing the
microinjection epicenter as well as 2 mm rostral and caudal were
embedded in paraffin. Six micrometer sections were cut and slide
mounted serially. Every sixth slide was stained with hematoxylin
and eosin (H&E). Adjacent sections were immunostained for
oligodendroglia using an antibody specific for CC-1/APC (ab16794,
AbCam, Cambridge, Mass.), myelin using an antibody recognizing MBP
(MAB386, Millipore, Bedford, Mass.), and standard avidin-biotin
immunoperoxidase techniques (Scarisbrick et al., J Comp Neurol
431:347-361, 2001; and Scarisbrick et al. 2012b, supra). Stained
sections were cover slipped with Permount (Fisher Scientific,
Pittsburgh, Pa.) containing 2 mg/mL bisbenzamide to visualize
nuclei (Sigma Aldrich).
[0079] Measurements of white matter lesion area were based on signs
of pathology (vacuolation, tissue destruction, hemorrhage) in
20.times. digital images of H&E stained sections. The largest
lesion area in each animal was used to determine mean maximal
lesion area and expressed in .mu.m.sup.2. The integrity of MBP
immunoreactivity was assessed in sections for 2,000 .mu.m
rostrocaudal to the microinjection site. The number of dorsal
column CC-1.sup.+/DAPI.sup.+ cells was quantified in sections
across 300 mm of spinal cord extending rostrocaudal to the
epicenter. The mean area of dorsal column white matter in the
intact spinal cord was approximately 1.5.times.10.sup.5 mm.sup.2.
To put the number of CC-1.sup.+ oligodendrocytes into context, the
mean number CC-1.sup.+ cells per mm.sup.2 was evaluated as the mean
number per 1.5.times.10.sup.5 mm.sup.2. Sections stained for CC-1
were also stained for GFAP (Sigma Aldrich), allowing for the
exclusion of CC-1.sup.| astrocytes; however, no examples of double
labeled cells were observed.
[0080] Statistical analysis: Student's t-test was used to determine
the significance of differences between two treatment groups and
the Mann-Whitney U test was used when data were not normally
distributed. For comparisons between multiple groups, one-way
analysis of variance (ANOVA) and the Student-Newman-Keuls (SNK)
post-hoc test, or the Kruskal-Wallis ANOVA on Ranks with Dunn's
method for pairwise comparisons were applied in the case of
normally or not normally distributed data, respectively.
Statistical significance was set at P<0.05.
Results
[0081] Expression of Klk6, PAR1, and PAR2 in oligodendrocytes and
OPCs: Kallikrein 6 is known to be highly expressed by
oligodendroglia of the rodent spinal cord, in vivo and in vitro
(Scarisbrick et al., J Neurosci 17:8156-8168, 1997; and Scarisbrick
et al., Glia 30:219-230, 2000). Here, Klk6 was shown to be densely
expressed throughout the cytoplasm and processes of purified,
O4.sup.+ murine primary oligodendrocytes (3 DIV) (FIG. 1). O4.sup.+
oligodendrocytes were also immunoreactive for PAR1 and PAR2.
PAR1-immunorectivity was observed throughout the cell body and
process network. PAR2-immunoreactivity was also dense in the cell
body, but showed more limited staining in processes being most
dense at nodule branch points (FIG. 1). A parallel pattern of Klk6,
PAR1, and PAR2 immunoreactivity was observed in the Oli-neu
oligodendrocytes (data not shown).
[0082] Quantitative real-time PCR was used to determine RNA
expression levels of Klk6, PAR1, and PAR2 in primary cultures of
OPCs and differentiated oligodendrocytes (3 DIV) (Table 2).
Equivalent levels of Klk6 RNA were observed at both stages of
oligodendrocyte differentiation. High levels of PAR1 RNA were
detected in both OPC and oligodendrocyte cultures, though
expression significantly declined with differentiation (Student's
t-test, P=0.030). PAR2 RNA levels were nearly 4-log values lower
than PAR1 and expressed by OPCs and oligodendrocytes at equivalent
levels. Klk6, PAR1, and PAR2 RNA levels were also determined for
the Oli-neu cell line, under resting and dbcAMP-differentiated
conditions (Table 2). Levels of Klk6 RNA were similar for resting
and differentiated Oli-neu oligodendrocytes. PAR1 RNA expression
was approximately 3-log values greater than PAR2 in Oli-neu
oligodendrocytes, and each was expressed at equivalent levels in
resting and differentiated culture conditions.
[0083] Klk6-mediated injury to mature oligodendroglial processes is
PAR1-dependent: In human cerebrospinal fluid (CSF), the
concentration of KLK6 is approximately 40 nM, which is likely
representative of that in the CNS (Zarghooni et al., Clin Biochem
35:225-231, 2002). Klk6 levels are substantially elevated at sites
of CNS injury (Scarisbrick et al. 2002, supra; Scarisbrick et al.,
Eur J Neurosci 24:1457-1469, 2006; and Scarisbrick et al. 2012a,
supra). Treatment of rat primary oligodendrocytes with 30 or 300 nM
recombinant Klk6 for 24 hours resulted in significant process
retraction without oligodendrocyte degeneration (Scarisbrick et al.
2002, supra). As described herein, this phenotype is confirmed in
PAR1.sup.|/| murine oligodendrocyte cultures (3 DIV) (FIGS. 2A-2C).
Treatment of oligodendrocytes with either 30 (FIGS. 2A and 2B; SNK,
P=9.0.times.10.sup.-4) or 300 nM Klk6 (SNK, P=4.7.times.10.sup.-4)
each produced significant and statistically equivalent
oligodendrocyte process retraction compared with controls. To
determine the involvement of PARs in Klk6-oligodendrogliopathy,
results were compared between primary PAR1.sup.+/+ oligodendrocyte
cultures and those derived from PAR1.sup.-/- or PAR2.sup.-/- mice.
PAR1.sup.-/- oligodendrocytes did not exhibit statistically
significant process retraction in response to 30 (FIGS. 2A and 2B)
or 300 nM Klk6. By contrast, treatment of PAR2.sup.-/-
oligodendrocytes with Klk6 resulted in process retraction
comparable to that seen in PAR1.sup.+/+ cultures (FIG. 2B; 30 nM
Klk6, SNK, P=0.002; 300 nM Klk6, SNK, P=1.2.times.10.sup.-4 vs.
Control). No significant differences in the number O4.sup.+
PAR1.sup.+/+, PAR1.sup.-/-, or PAR2.sup.-/- cells were observed in
response to Klk6 treatment (FIG. 2C).
[0084] To further evaluate the effects of excess Klk6 on
oligodendroglial processes, primary oligodendrocyte cultures (3
DIV) were treated with recombinant Klk6 (150 nM) for 24 hours and
quantified with respect to morphological maturity, albeit simple,
incomplete, complete, or membrane morphologies (Huang et al.,
supra) (FIG. 3A). Klk6 promoted a two-fold increase in the number
of simple (SNK, P=0.007) and a greater than four-fold increase in
the number of incomplete (SNK, P=4.7.times.10.sup.-4)
oligodendrocyte morphologies. Additionally, Klk6 promoted a nearly
eleven-fold decrease in oligodendrocytes with complete morphology
(FIG. 3C; SNK, P=3.1.times.10.sup.-4) and the elimination of
oligodendroglia with the most mature membrane morphology (SNK,
P=0.038). Klk6 treatment also resulted in two-fold fewer processes
per cell (FIG. 3E; SNK, P=2.8.times.10.sup.-4), but there was no
significant effect on oligodendrocyte number (FIG. 3F). By
contrast, recombinant Klk1 (300 nM) did not significantly impact
oligodendrocyte morphology (FIG. 3C), process (FIG. 3E), or cell
number under the conditions of this study (FIG. 3F).
[0085] Elevated Klk6 exacerbates ATP toxicity in oligodendrocytes:
Aberrant ATP signaling causes oligodendrocyte excitotoxicity and
high levels of ATP have been associated with pathophysiology in
both SCI and MS (Matute et al., J Neurosci 27:9525-9533, 2007; Wang
et al., Nat Med 10:821-827, 2004). Experiments were conducted to
investigate whether elevated levels of Klk6 augment ATP-induced
excitotoxicity in oligodendroglia, using loss of morphological
differentiation and cell number as measures of pathogenicity.
Twenty-four hour treatment of primary oligodendrocyte cultures (3
DIV) with ATP (50 .mu.M) resulted in a significant increase in the
percentage of cells with simple morphology (FIG. 3B; SNK, P=0.028).
Treatment with ATP alone also resulted in a significant decrease in
cells with complete morphology (SNK, P=0.002) and a small, but
significant increase in cells with membrane morphology (SNK,
P=0.011). Klk6 (150 nM) amplified the gliopathic effects of ATP,
further increasing the percentage of oligodendrocytes with "simple"
morphology relative to ATP alone (FIG. 3D; SNK, P=0.039). The
coapplication of Klk6 and ATP also resulted in greater than 40%
increase in the population of oligodendrocytes with incomplete
morphologies compared with vehicle (SNK, P=0.003) or ATP alone
(SNK, P=0.004). The addition of Klk6 and ATP also exacerbated the
reduction in mature cells seen with ATP alone and resulted in the
complete loss of oligodendroglia with the mature complete (FIG. 3D;
SNK, P=2.0.times.10.sup.-4, ATP vs. ATP+Klk6; SNK,
P=2.3.times.10.sup.-4, vehicle vs. ATP+Klk6) or membrane
morphologies (SNK, P=0.001, ATP vs. ATP+Klk6; SNK, P=0.033, vehicle
vs. ATP+Klk6). Moreover, treatment with ATP resulted in a two-fold
reduction in the number of processes per oligodendrocyte (FIG. 3E;
SNK, P=2.3.times.10.sup.-4) and this increased to a five-fold
reduction with the co-application of Klk6 (FIG. 3E; SNK,
P=2.5.times.10.sup.-4). The co-application of Klk1 and ATP (FIG.
3D) did cause a significant decrease in the population of
oligodendrocytes with membrane morphology (SNK, P=0.022) but did
not impact process loss per cell relative to treatment with ATP
alone (FIG. 3E).
[0086] Treatment of murine oligodendrocytes (3 DIV) with ATP caused
a significant decrease in oligodendrocyte number relative to
control (FIG. 3F; SNK, P=0.006). Treatment with Klk6 in addition to
ATP caused a significant exacerbation of ATP-induced cell loss
compared with ATP (FIG. 3F; SNK, P=0.046) or with vehicle alone
(SNK, P=9.3.times.10.sup.-4). Klk1 did not increase ATP-mediated
oligodendrocyte loss (FIG. 3F).
[0087] PAR1 agonists mediate process loss in oli-neu
oligodendrocytes: To determine the range of PAR1 agonists able to
regulate oligodendrocyte process integrity, Oli-neu
oligodendrocytes were treated with recombinant Klk6 (30, 150, and
300 nM), thrombin (270 nM), or PAR1-AP (100 .mu.M) for 24 hours. A
significant and dose-dependent (FIGS. 4A and 4B; SNK, P=0.018, Klk6
30 vs. 150 nM; SNK, P=0.041, Klk6 30 vs. 300 nM) decrease in the
number of processes per cell was observed in response to Klk6 (SNK,
P=1.5.times.10.sup.-4, Klk6 30-150 nM vs. control). A significant
decrease in Oli-neu process number was also observed following
treatment with thrombin (FIGS. 4A and 4B; SNK,
P=1.1.times.10.sup.-4) or PAR1-AP (SNK, P=2.7.times.10.sup.-4). A
small but significant increase in Oli-neu cell number was also
observed following treatment with the lowest concentration of Klk6
examined (FIG. 4C; 30 nM, SNK, P=0.03). A similar increase in cell
number was observed in the case of treatment with PAR1-AP (SNK,
P=0.003). Klk1 (300 nM) had no effect on Oli-neu process stability
(FIGS. 4A and 4B) or cell number.
[0088] Klk6 blockade of OPC differentiation is PAR1-dependent: To
determine whether elevated levels of Klk6 inhibit process outgrowth
from OPCs, purified OPCs were treated with Klk6 (150 nM) just after
plating for 24 h. Progenitor cells treated with Klk6 exhibited
stunted morphological differentiation, having .about.60% fewer
processes per cell compared with controls (FIGS. 5A and 5B; SNK,
P=2.3.times.10.sup.-4). Thrombin also inhibited OPC process
extension (FIGS. 5A and 5B; SNK, P=2.0.times.10.sup.-4). OPCs
treated with Klk1 developed processes comparable to controls (FIGS.
5A and 5B). In the case of progenitors, Klk6 treatment also
significantly reduced the number of OPCs (FIG. 5C; SNK, P=0.032),
while treatment with thrombin or Klk1 had no effect. To determine
the role of PAR1 in mediating these effects, primary OPCs were
differentiated in the presence of a selective PAR1 inhibitor,
SCH79797 (50 nM), for 3 hours prior to the addition of Klk6.
SCH79797 attenuated the ability of Klk6 to reduce OPC process
outgrowth by .about.34% (FIG. 5D; SNK, P=0.006), while treatment
with the SCH79797 alone had no significant effect relative to
vehicle controls.
[0089] Klk6 suppresses myelin gene expression in a PAR1-dependent
fashion: To determine the impact of elevated Klk6 on other key
aspects of oligodendrocyte biology, the effects of treatment with
Klk6 for 24 hours on the expression of PLP and MBP and the
involvement of PAR1 were evaluated. Treatment of PAR1.sup.+/+ but
not PAR.sup.-/- oligodendrocyte cultures with recombinant Klk6 (300
nM) for 24 hours resulted in a significant suppression of PLP (FIG.
6A; 636%, Student's t-test, P=5.9.times.10.sup.-4) and MBP RNA
expression (FIG. 6B; 633%, Student's t-test, P=0.029). Treatment of
either PAR1.sup.+/+ or PAR1.sup.-/- cells with Klk6 did not
significantly alter GAPDH RNA expression (PAR1.sup.+/+-control,
1.5.times.10.sup.6.+-.6.9.times.10.sup.4 vs. PAR1.sup.+/+-Klk6,
1.4.times.10.sup.6.+-.4.4.times.10.sup.4 copies/0.5 .mu.g RNA;
PAR1.sup.-/--control, 1.4.times.10.sup.6.+-.1.3.times.10.sup.4 vs.
PAR1.sup.-/- Klk6, 1.4.times.10.sup.6.+-.6.5.times.10.sup.3
copies/0.5 .mu.g RNA).
[0090] Parallel to the effects of Klk6 observed in primary
oligodendrocytes, treatment of Oli-neu oligodendroglia with Klk6
for 24 hours also significantly diminished PLP expression (FIGS. 7A
and 7B; SNK, P=8.0.times.10.sup.-4), although no significant
suppression of MBP RNA was observed at this time point. Notably,
Klk6 caused significant and equivalent PLP RNA down regulation at
30, 150, and 300 nM (FIG. 7C; SNK, P=0.002). PLP expression was
also significantly decreased by treatment with either thrombin
(FIG. 7A; 270 nM; SNK, P=0.003, vs. Control) or PAR1-AP (100 .mu.M;
SNK, P=7.4.times.10.sup.-4), but not recombinant Klk1 (300 nM) at
the time point examined.
[0091] Role of Erk1/2 in Klk6 regulation of myelin gene expression:
Based on previous data demonstrating the Klk6-mediated MAPK
signaling in neurons and astrocytes (Vandell et al., supra),
experiments were conducted to examine whether Klk6 triggers similar
signaling in Oli-neu oligodendrocytes and the possible role of this
signaling in the regulation of myelin gene expression. Treatment of
Oli-neu oligodendrocytes with Klk6 for 10 minutes elicited a nearly
four-fold increase in Erk1/2 phosphorylation (FIGS. 7E and 7F; SNK,
P=0.012). The ability of Klk6 to induce MAPK signaling was blocked
by the PAR1 inhibitor, SCH79797 (50 nM) (FIGS. 7E and 7F). No
significant changes in Erk1/2 signaling were observed following
treatment with SCH79797 alone or Klk1. Linking Klk6-PAR1-mediated
down regulation of PLP to Erk1/2 signaling, co-treatment of Oli-neu
with Klk6 and a selective MEK1/2 inhibitor (U0126, 10 .mu.M) for 24
h, significantly diminished the ability of Klk6 to suppress PLP RNA
expression (FIG. 7D; SNK, P=0.009, Klk6 vs. Klk6+U0126), although
suppression was not completely blocked (SNK, P=0.034, Klk6+U0126
vs. Control). No significant change in PLP RNA expression was
observed following treatment with U0126 alone.
[0092] Klk6 promotes white matter pathology in a PAR1-dependent
fashion: To determine whether elevated Klk6 or deregulated
PAR1-agonism alone mediate white matter pathology in vivo, and the
role of PAR1 in mediating these effects, recombinant Klk6 or
PAR1-AP were microinjected unilaterally into the dorsal funiculus
of PAR1.sup.+/+ or PAR1.sup.-/- murine spinal cord. Seventy-two
hours after microinjection of Klk6 (0.02 .mu.g total) into
PAR1.sup.+/+, over 1,200 .mu.m of white matter surrounding the
injection site presented with vacuolating myelinopathy, tissue
destruction and hemorrhage in H&E stained sections, effects
that were largely absent in PAR1.sup.-/- mice (FIG. 8A).
Rostrocaudal white matter pathology mediated by Klk6 was two-fold
greater than that induced by saline alone (FIG. 8D; saline
control=570.0.+-.39.3 .mu.m vs. Klk6=1,242.0.+-.95.3 .mu.m; SNK,
P=6.9.times.10.sup.-4). Microinjection of PAR1-AP (0.02 .mu.g) also
induced significantly greater rostrocaudal white matter pathology
relative to saline (FIGS. 8A and 8D; PAR1-AP=1,026.0.+-.105.3
.mu.m, SNK, P=0.01) and these effects were also absent in
PAR1.sup.-/- mice. In addition, Klk6 and PAR1-AP each caused
significant and largely equivalent loss of MBP-immunoreactivity
across multiple sections rostrocaudally (.about.45% loss relative
to saline alone) (FIGS. 8B and 8E; SNK, P=4.1.times.10.sup.-4 and
P=0.001, respectively) in PAR.sup.+/+ but not in PAR.sup.-/- mice,
and enhanced the maximal lesion area (FIG. 8F; Klk6, SNK,
P=3.3.times.10.sup.-4; PAR1-AP, SNK, P=3.2.times.10.sup.-4),
relative to saline alone, in PAR.sup.+/+ but not in PAR1.sup.-/-
mice.
[0093] To determine the effect of PAR1 agonists on white matter
oligodendroglia, sections were stained for CC-1. Counts of
CC-1.sup.-/DAPI.sup.+ cells in the dorsal columns in tissue
sections encompassing the injection epicenter and for 300 .mu.m
rostrocaudally (FIGS. 8C and 8G) indicated that Klk6 and PAR1-AP
each promoted a significant loss of CC-1.sup.+ cells throughout the
dorsal column white matter (.about.15% reduction, SNK, P=0.001 and
P=0.002, respectively) in PAR1.sup.+/+ but not in PAR1.sup.-/-
mice. In PAR1.sup.+/+ spinal cord injected with saline alone,
approximately 92.4.+-.2.0 CC-1.sup.+ oligodendroglia were counted
per 1.5.times.10.sup.5, the approximate size of the dorsal column
in a given tissue section. The number of CC-1.sup.+ oligodendroglia
after saline microinjection in PAR1.sup.-/- was nearly identical
(93.4.+-.1.8).
TABLE-US-00001 TABLE 1 Primers used for quantitative PCR of murine
PAR, Klk6, and myelin genes Gene Entrez accession Primer sequences
SEQ ID NO: GAPDH NM_008084.2 Forward: ACCACCATGGAGAAGGC 1 Reverse:
GGCATGGACTGTGGTCATGA 2 Klk6 NM_011177.2 Forward:
CCTACCCTGGCAAGATCAC 3 Reverse: GGATCCATCTGATATGAGTGC 4 PAR1
NM_010169.3 Forward: CTTGCTGATCGTCGCCC 5 Reverse:
TTCACCGTAGCATCTGTCCT 6 PAR2 NM_007974.4 Forward: CCGGACCGAGAACCTTG
7 Reverse: CGGAAGAAAGACAGTGGTCAG 8 MBP NM_001025251 Forward:
CCAGTAGTCCATTTCTTCAAGAACAT 9 Reverse: GCCGATTTATAGTCGGAAGCTC 10 PLP
NM_011123.2 Forward: TCTTTGGCGACTACAAGACCAC 11 Reverse:
CACAAACTTGTCGGGATGTCCTA 12 GAPDH, Glyceraldehyde phosphate
3-dehydrogenase; Klk6, kallikrein-related peptidase 6; PAR1,
protease-activated receptor 1; PAR2, protease-activated receptor 2;
MBP, myelin basic protein; PLP, proteolipid protein.
TABLE-US-00002 TABLE 2 Quantitative PCR Analysis Demonstrates
Robust Expression of Klk6, PAR1, and PAR2 by Murine Primary and
Oli-neu Oligodendroglia RNA copy number Primary oligodendrocyte
Primary differentiated Gene progenitor cell oligodendrocyte Oli-neu
Oli-neu1dbcAMP Klk6 6.0E+03 (.+-.2.2E+02) 5.6E+03 (68.7E+01)
6.4E+04(.+-.2.2E+04) 2.0E+04 (.+-.4.0E+03) PAR1 1.1E+06
(.+-.5.7E+04) 8.6E+05 (63.6E+04) 1.5E+06(.+-.2.2E+05) 1.3E+06
(.+-.3.3E+05) PAR2 2.5E+02 (.+-.2.3E+01) 2.9E+02 (.+-.2.1E+01)
3.1E+03(.+-.1.6E+02) 3.5E+03 (.+-.2.3E+01) GAPDH 6.0E+06
(.+-.1.3E+05) 6.5E+06 (.+-.2.9E+05) 2.4E+07(.+-.6.7E+05) 1.8E+07
(.+-.2.9E+05) The mean number of RNA copies encoding for Klk6,
PAR1, and PAR2 RNA in 0.5 .mu.g of total RNA isolated from
immediately post purification OPCs, mature oligodendrocytes (3DIV),
undifferentiated (Oli-neu), or differentiated Oli-neu (Oli-neu +
dbcAMP) oligodendrocytes is provided (.+-.SEM). Amplification of
GAPDH was carried out to verify equal loading.
Example 2
The Thrombin Receptor is a Critical Extracellular Switch
Controlling Myelination
Materials and Methods
[0094] Animal care and use: Mice genetically deficient in PAR1
(PAR1.sup.-/-, B6.129S4-F2r.sup.tm1Ajc/J) were obtained from
Jackson (Bar Harbor, Me.) and backcrossed to C57BL6/J for more than
30 generations (Burda et al., supra; Yoon et al., supra).
PAR1.sup.+/+ liittermates served as controls.
[0095] Quantification of myelin protein expression using Western
blot: Western blots were used to quantify myelin and signaling
proteins. Whole spinal cords were harvested. from three individual
PAR1.sup.30 /+ or PAR1.sup.-/- mice on postnatal day (P) 0, 7, 21
or 45 (adulthood). Spinal cords at each time point were
collectively homogenized in radio-immunoprecipitation assay buffer
and 25 .mu.g of protein resolved on sodium dodecyl
sulfate-polyacrylamide gets (Bio-Rad Laboratories, Hercules,
Calif.). Multiple electroblotted membranes were used to
sequentially probe for antigens of interest, including myelin
proteins PLP (Ab28486, Abeam, Cambridge, Mass.), MBP (MAB386,
Chemicon, Billerica, Mass.), and CNPase (MAB326, Millipore,
Billerica, Mass.); oligodendrocyte proteins, Olig2 (Ab9610,
Millipore); neuron specific proteins, Neurofilarnent H or L (N4142,
N5139, Sigma, St. Louis, Mo.); or the phosphorylated or total
protein forms of select signaling proteins, ERK1/2 (9101S, 9102S,
Cell signaling, Boston, Mass.), protein kinase B (AKT, 4058L,
9272S, Cell signaling) or signal transducer and activator of
transcription 3 (STA7173, sc-8059, sc-8019, Santa Cruz, Santa Cruz,
Calif.). Membranes were re-probed for .beta.-actin (NB600-501,
Novus Biological, Littleton, Colo., USA) and the relative optical
density (ROD) of each protein of interest normalized to that of
Actin. The mean and standard error (s.e.) of ROD readings across at
least 3 independent Westerns was used for statistical comparisons
(Yoon et al., supra).
[0096] PAR1 expression by oligodendrocytes and quantification of
oligodendrocyte number in the developing mouse spinal cord: To
evaluate whether the PAR1-regulated changes in myelin proteins and
myelin gene expression reflect changes in the number of OPCs or
mature oligodendroglia, Olig2 (Ab9610, Millipore) or CC-1/APC 1
(adenomatous polyposis coli, Ab16794, Abcam, Cambridge, Mass.)
immunopositive cells were enumerated in 5 .mu.m paraffin sections
through the dorsal columns of P0, 7, 21 or 45 spinal cords. Olig2
is a basic helix-loop-helix transcription factor expressed by OPCs
and mature oligodendroglia, whereas CC-1 is associated only with
the mature phenotype (Ligon et al., Glia 54:1-10, 2006;
Funfschilling et al., Nature 485:517-521, 2012; Burda et al.,
supra). Immunoperoxidase stained sections were cover slipped with
Hardset containing DAPI (Vector, Burlingame, Calif.) and digitally
imaged (Olympus BX51 microscope, Olympus, Center Valley, Pa.).
Counts were made of either Olig2 or CC1+ cells with a DAPI stained
nucleus within the entire dorsal column of at least 3 mice at each
time point without knowledge of genotype. The association of PAR1
with spinal cord oligodendrocytes was evaluated by
co-immunolabeling for PAR1 (sc-5606, clone H-111. Santa Cruz) and
CC-1.
[0097] Myelin RNA and protein expression by OPCs and
oligodendroglia in vitro: To determine whether the absence of PAR1
directly impacts myelin expression, real time reverse transcription
PCR was used to determine the level of oligodendrocyte associated
gene transcripts in OPCs freshly shaken from or PAR1.sup.+/+ or
PAR.sup.-/- mixed glial cultures or after a 72 hour period of
differentiation in vitro. Mixed glial cultures were prepared from
the cortices of P1 mice according to a modified McCarthy and de
Vellis protocol (Burda et al., supra). Zero hour OPC RNA was
obtained from cells immediately after shaking from 10 day-in-vitro
mixed glial cultures. Alternatively, OPCs were differentiated for
72 hours prior to RNA isolation by plating at
3.times.10.sup.4/cm.sup.2 cells per well on poly-L-lysine (PLL, 10
.mu.g/mL) coated 6-well plates in Neurohasal A media containing 1%
N2, 50 U/mL penicillin/streptomycin, 2 mM Glutamax, 1 mM sodium
pyruvate and 0.45% glucose. The level of RNA encoding PAR1, MBP,
PLP, CNPase, MAG, MOG, NogoA or Olig2 was determined in 0.10 .mu.g
of RNA in triplicate using an iCycler iQ5 system (BioRad) with
primers described in Table 3 (Burda et al., supra). Results were
repeated twice from independent cell preparations with parallel
results. The relative amount of RNA at each time point was
normalized to the constitutively expressed gene Rn18S. Mean
expression levels in cells derived from PAR1.sup.-/- mice were
expressed as a percent of the level observed in cells derived from
wild type mice.
[0098] The impact of PAR1 genetic deletion on the expression of PLP
protein in vitro was determined by comparing PLP-immunoreactivity
(Ab28486, Abeam) in 72 hour differentiated PAR1.sup.+/+ or
PAR1.sup.-/- oligodendrocytes plated at 7.times.10.sup.4/cm.sup.2
on PLL coated 12 mm glass cover slips. Five 20.times. fields
encompassing the poles and center of each coverslip were captured
digitally and Image J software was used to determine the ROD of
somal PLP staining as well as somal area. The mean number of
PLP.sup.+ cells was also enumerated and expressed as a ratio of the
number of DAPI cells present in each field.
[0099] Analysis of the number of myelinated nerve fibers and myelin
thickness: The number of myelinated nerve fibers and the thickness
of myelin sheaths were determined by structural and ultrastructural
analysis of the spinal cord dorsal column white matter at P0 and
P45. Mice were perfused with Trump's fixative (4% formaldehyde with
1% glutaraldehyde, pH 7.4) and a 1 mm segment of the cervical
spinal cord was osmicated and embedded in araldite. The number of
myelinated nerve fibers was counted in 1 .mu.m semi-thin sections
stained with 4% p-phenylenediamine to visualize the myelin sheaths.
Digital images capturing the entire dorsal-ventral and
lateral-medial axis of the spinal cord dorsal columns were captured
at 60.times.. The number of myelinated nerve fibers and their
diameter was automatically quantified from digital images using a
batch algorithm generated in Matlab (The Mathworks, Narrick, Mass.)
(Denic et al., Ann Neurol 66:559-564, 2009). For P45 spinal cords,
the number of myelinated nerve fibers that were <4 .mu.m.sup.2,
4-10 .mu.m.sup.2 or>10 .mu.m.sup.2 was also examined. All
myelinated nerve fiber counts for each genotype were averaged
across at least 3 independent animals per time point.
[0100] Myelin sheath thickness in the dorsal column of the cervical
spinal cord at P0 and P45 was quantified in ultrathin (0.1 .mu.m)
sections taken from araldite blocks using a JEM-1400 Transmission
Electron Microscope (JEOL USA, Inc., Peabody, Mass.). Images were
captured at 8000.times. without knowledge of genotype and included
5 fields across the dorsal-ventral axis of the dorsal column at P0
and 6 fields at P45. G-ratios were calculated from all myelinated
axons in each image. Across 3 animals per time point this resulted
in measurement of roughly 60 myelinated fibers at P0 and 2200 at
P45 for each genotype. Measurements of axon diameter (d) and myelin
fiber diameter (D) were made using Image J software and presented
as mean g-ratio (d/D) or myelin thickness.+-.s.e. across axon
diameters.
[0101] Evaluation of locomotor activity: Potential differences in
locomotor activity between PAR1.sup.+/+ and PAR1.sup.-/- mice were
evaluated using a Comprehensive Laboratory Animal Monitoring System
(Columbus Instruments, Columbus Ohio). Animals were housed in the
system and total activity, ambulatory activity, and rearing data
collected for a period of 72 hours that included a 24 hour period
of acclimation followed by 24 hour fed and 24 hour fasted periods.
The mean activity across genotypes in each case (PAR.sup.+/+, n=11
or PAR1.sup.-/-, n=12) was analyzed for light and dark periods
under both fed and fasted conditions.
[0102] Statistical comparisons: All data were expressed as
mean.+-.s.e. Comparisons between multiple groups were made using a
One-Way Analysis of Variance (ANOVA) and the Newman Keuls post-hoc
test. When multiple comparison data was found to be not normally
distributed, the Kruskal-Wallis ANOVA on Ranks was applied with
Dunn's method. For pairwise comparisons between two groups the
Students unpaired t-test was used. Statistical significance was set
at P<0.05.
Results
[0103] PAR1 is expressed by oligodendroglia and levels are
inversely correlated with the onset of spinal cord myelination: To
determine the significance of PAR1 to myelination of the spinal
cord, the expression of PAR1 RNA was evaluated using quantitative
real time PCR. Two-fold reductions in PAR1 RNA were observed in the
spinal cord by P7 and this lower level persisted through adulthood
(FIG. 9A, P<0.001, Newman Keuls). Perinatal reductions in PAR1
RNA, when the levels of many myelin proteins begin to surge (FIGS.
10A-10G), supports an emerging model in which high levels of PAR1
signaling at birth engage a negative signaling cascade that
suppresses myelination (FIG. 15).
[0104] PAR1 immunoreactivity was co-localized to CC-1 positive
oligodendroglia in the spinal cord white matter at all post-term
intervals examined (FIG. 9B). PAR1 has also been functionally
linked to neurons (Hamill et al., Exp Neurol 217:136-146, 2009;
Yoon et al., supra) and astroglia (Nicole et al., J Neurosci
25:4319-4329, 2005; Vandell et al., supra; Scarisbrick et al.
2012a, supra) and non-CC-1-immunostained cells were also
immunoreactive for PAR1 in the perinatal and adult spinal cord.
[0105] Knockout of PAR1 results in accelerated PLP expression in
the perinatal period and higher levels of MBP in adults: To
critically evaluate the role of PAR1 in myelin development in vivo,
the onset, magnitude, and duration of myelin protein expression,
including the two major myelin structural proteins, PLP and MBP,
were directly compared in the spinal cord of PAR1.sup.+/+ and
PAR1.sup.-/- mice at P0 through P45 (adulthood) (FIGS. 10A-10C).
Consistent with a regulatory role for PAR1 in the onset of myelin
protein expression, spinal cord PLP levels were 2.4-fold higher at
P0 in PAR1.sup.-/- mice relative to PAR1.sup.+/+ mice (P=0.003,
Neuman Keuls). Also, peak PLP levels were achieved by P7 in the
absence of PAR1, 2 weeks ahead of the P21 peak observed in the wild
type spinal cord (P=0.03, Newman Keuls). Supporting a unique role
for PAR1 in regulating the onset of PLP production, despite the
earlier commencement of spinal cord PLP protein expression in
PAR1.sup.-/- mice, by P21, and at P45, levels were identical across
genotypes. These data highlight a key role for PAR1 in regulating
the early stages of PLP protein production.
[0106] The developmental onset of MBP protein detectable by Western
blot occurred well after that of PLP, being first observed in
spinal cord samples by P21, when levels were comparable between
PAR.sup.+/+ and PAR1.sup.-/- mice (FIGS. 10A and 10C). By
adulthood, however, MBP protein levels were 1.7-fold higher in
PAR1.sup.-/- mice (P=0.02, Newman Keuls). The manifestation of
higher MBP protein levels in adult PAR1.sup.-/- mice is consistent
with the model that blocking PAR1 signaling creates a
microenvironment that enhances myelin production (FIG. 15) (Burda
et al., supra). By contrast to the elevated levels of PLP and MBP
protein seen in the spinal cord in the absence of PAR1, levels of
2',3'-cyclic-nucleotide 3'-phosphodiesterase (CNPase), were reduced
by 1.4-fold on P21 (FIGS. 10A and 10D; P=0.03, Newman Keuls). No
impact of PAR1 deletion was seen on the heavy or light chains of
neurofilament protein (NF.sub.H or NF.sub.L) at any age examined
(FIGS. 10A, 10F, and 10G).
[0107] PAR1 is a negative regulator of ERK1/2 signaling in the
spinal cord across the lifespan: To determine the likely
intracellular signaling cascade(s) impacted by PAR1,
extracellular-signal-related kinase (ERK1/2) and AKT (protein
kinase B) were evaluated, since each of these signaling
intermediates participate in myelin development (Czopka et al., J
Neuroscience 30:12310-12322, 2010; Harrington et al., Ann Neurol
68:703-716, 2010; Guardiola-Diaz et al., Glia 60:476-486, 2012;
Ishii et al., J Neurosci 32:8855-8864, 2012; Fyffe-Maricich et al.,
J Neurosci 33:18402-18408, 2013; and Ishii et al. 2013, supra).
Levels of the transcription factor signal transducer and activator
of transcription 3 (STAT3) which has been both indirectly (see
Nobuta et al., Ann Neurol 72:750-765, 2012) and directly
(Dell'Albani et al., J Neurosci Res 54:191-205, 1998) linked to
oligodendrocyte differentiation was also examined in parallel.
Consistent with prior studies demonstrating that elevations in
ERK1/2 promote hypermyelination, substantial elevations in ERK1/2
were found in the spinal cords of PAR1.sup.-/- mice from P7 through
the adult period (FIGS. 10A and 10K; P=0.03, Newman Keuls). Peak
elevations in ERK1/2 in PAR1.sup.-/- spinal cords were seen at P7
and P21 when levels were 1.7-fold higher than those observed in
wild type mice. Elevated levels of activated ERK1/2 (1.3-fold) were
also detected in PAR1.sup.-/- spinal cords on P21 (FIGS. 10A and
10H; P=0.008, Newman Keuls). Levels of activated AKT were also
elevated in the PAR1.sup.-/- spinal cord on P7 relative to the
level detected at birth (FIGS. 10A and 10I), an elevation not seen
in WT mice. A significant difference in total AKT levels was not
observed (FIG. 10L). PAR1-loss-of-function also had little impact
on STAT3 signaling pathway (FIGS. 10A, 10J, and 10M).
[0108] Knockout of PAR1 increases oligodendrocyte number in the
early postnatal period: To determine whether increases in PLP and
MBP protein in the spinal cord of PAR1.sup.-/- mice reflect
increases in myelin protein expression per cell, or alternatively,
more myelin producing oligodendroglia, protein levels of
oligodendrocyte transcription factor 2 (Olig2) were quantified from
P0 through adulthood (FIGS. 10A and 10E). Findings regarding
overall levels of Olig2 in the spinal cord were complemented by
counts of Olig2-or adenomatous polyposis coli (CC-1)-immunoreactive
oligodendrocytes in the dorsal column of parallel sets of mice
(FIGS. 11A and 11B). Olig2 protein levels detected by Western blot
were higher in spinal cords of PAR1.sup.-/- compared to
PAR1.sup.+/+ mice at P7 (2.6 fold, P=0.04) and P21 (1.6-fold,
P=0.02) (FIG. 10E, Newman Keuls), but not in adults. In parallel,
counts of Olig2.sup.+ cells revealed significantly greater numbers
in PAR1.sup.-/- at P0 (1.5-fold, P=0.04) and P7 (1.3-fold, P=0.05),
but identical numbers thereafter (FIGS. 11A and 11B, Newman Keuls).
Also, counts of CC-1-immunoreactive oligodendrocytes indicated
increased numbers in the dorsal columns of PAR1.sup.-/- mice on P7
(1.6-fold, P=0.03) (FIGS. 11C and 11D, Newman Keuls).
[0109] PAR1-loss-of-function enhances myelin expression in purified
OPCs and differentiated oligodendroglia in vitro: To determine
whether reductions in PAR1 at the level of the oligodendrocyte
directly impact myelin expression, the appearance of RNA encoding
myelin proteins were evaluated in freshly isolated PAR1.sup.-/+ or
PAR1.sup.-/- OPCs, or after a 72 hour period of differentiation in
vitro (FIGS. 12B and 12C). Consistent with a suppressive role of
PAR1 in the process of myelination (FIG. 15), CNPase (1.2-fold,
P=0.002) and MOG (2.4-fold, P=0.04) RNA transcripts were
significantly elevated in OPCs lacking PAR1 (Newman Keuls).
Moreover, PLP (2.7 fold, P=0.00001), MBP (3.7-fold, P=0.0001),
CNPase (1.4-fold, P=0.009), myelin oligodendrocyte glycoprotein
(MOG) (4.4-fold, P=0.003), myelin associated glycoprotein (MAG)
(1.5-fold, P=0.004) and Olig2 (1.5-fold, P=0.00002) RNA transcripts
were all elevated in PAR1.sup.-/- oligodendroglia after 72 hours in
culture (Newman Keuls). By contrast, transcripts encoding NogoA
were reduced in PAR1.sup.-/- oligodendroglia after differentiation
(1.5-fold, P=0.0007, Newman Keuls). These findings were
complemented by examination of PLP-immunoreactivity in parallel 72
hours differentiated cultures which showed that
PLP-immunoreactivity occurred at a higher level (1.9-fold,
P=0.02.times.10.sup.-5) and in more oligodendrocytes (1.3-fold
more, P=0.03.times.10.sup.-5) in cultures derived from PAR1.sup.-/-
relative to PAR1.sup.+/+ mice (Newman Keuls). Supporting a model in
which reductions in PAR1 promote oligodendrocyte differentiation,
PAR1 RNA levels were 2.2-fold higher in freshly shaken OPCs
compared to those differentiated for 72 hours in vitro (P=0.0005,
Students unpaired t-test, FIG. 12A).
[0110] Treatment of oligodendrocytes (24 hours in culture) with 70
nM SCH79797 (a small molecule inhibitor of PAR1) for 48 hours
promoted a significant increase in the expression of PLP and MBP
RNA, and a decrease in NogoA and Olig2 RNA (FIG. 12D).
Immunostaining of PAR1.sup.+/+ and PAR1.sup.-/- OPCs differentiated
for 72 hours in vitro revealed that PAR1-loss-of-function
(PAR1.sup.-/-) was associated with a significant increase in the
number of PLP-immunoreactive cells (1.3-fold more,
*P=0.03.times.10.sup.-5) as well as the amount of
PLP-immunoreactivity (ROD) per somal area (1.9-fold,
*P=0.02.times.10.sup.-5) (FIGS. 12E and 12F). Scale bar=20
.mu.m.
[0111] PAR1 regulates the onset of axon ensheathment and myelin
thickness in adults: To determine whether the increases observed in
PLP and MBP proteins in the spinal cord of PAR1.sup.-/- mice were
reflected in changes in myelin structure, the impact of
PAR1-loss-of-function on the onset of axon ensheathment and myelin
thickness in the dorsal funiculi was systematically evaluated
(FIGS. 13A-13D). The number of myelinated nerve fibers and their
size were determined at P0 and P45 in paraphenylenediamine stained
semithin (1 .mu.m) spinal cord sections. There were nearly two-fold
more thinly myelinated nerve fibers in the dorsal funiculi of
PAR1.sup.-/- mice at P0 (252.+-.65) relative to wild type
littermates (100.+-.19) (FIGS. 13A and 13B; mean.+-.s.e., P=0.02,
Students unpaired t-test). By P45, the number of myelinated nerve
fibers was no longer different, however, PAR1.sup.-/- mice had
significantly more myelinated nerve fibers that were>10
.mu.m.sup.2 (P=0.02, Students unpaired t-test). To delineate
whether this shift in the size distribution of myelinated nerve
fibers reflected an increase in myelin thickness or a shift in the
size distribution of axons, the g-ratio of dorsal funiculi
myelinated fibers at P0 and P45 in ultrathin (0.1 .mu.m) sections
was assessed by electron microscopy. At P0, the g-ratio of axons
1-1.5 .mu.m was reduced in PAR1.sup.-/- mice, reflecting increased
myelin thickness (FIGS. 13C and 13D; P=0.01, Students unpaired
t-test). At P45, the g-ratios of dorsal column axons in
PAR1.sup.-/- mice were also significantly lower across the majority
of axon diameters and absolute increases in myelin thickness
occurred across all axon diameters (FIGS. 13C and 13E;
P.ltoreq.0.02, Students unpaired t-test). Thus, not only does axon
ensheathment and myelination occur earlier in the spinal cord of
mice lacking the thrombin receptor, but the thickness of the myelin
sheath ultimately achieved in adults is also enhanced.
[0112] Motor Activity in PAR1.sup.-/- mice: To link changes in
spinal cord myelination observed in PAR1.sup.-/- mice to function,
overall motor activity, ambulation and rearing were evaluated
during diurnal and nocturnal cycles under both fed and fasted
conditions (FIG. 14). Overall activity of mice lacking the thrombin
receptor was increased during the day under fed conditions (P=0.04)
and at night when fasted (P=0.02) (Students unpaired t-test, FIG.
14A). Also, both ambulation (P=0.02) and rearing responses (P=0.04)
were increased in thrombin receptor-deficient mice under fasting
conditions at night (Students unpaired t-test, FIGS. 14B and
14C).
TABLE-US-00003 TABLE 3 Primers used for quantitative real-time PCR
Gene Accession number Primer Sequence Forward/Reverse SEQ ID NO:
CNPase NM_001146318.1 Forward: CAAATTCTGTGACTACGGG 13 Reverse:
GGCCTTGCCATACGA 14 MAG NM_010758.2 Applied Biosystems, Assay ID:
Mm00487538_m1 MBP NM_001025251 Forward: CCAGTAGTCCATTTCTTCAAGAACAT
15 Reverse: GCCGATTTATAGTCGGAAGCTC 16 MOG NM_010814.2 Applied
Biosystems, Assay ID: Mm00447824_m1 NogoA NM_024226.4 Applied
Biosystems, Assay ID: Mm00445861_m1 Olig2 NM_016967 Assay ID:
Mm.PT.56a.42319010 PAR1 NM_010169.3 Forward: CTTGCTGATCGTCGCCC 17
Reverse: TTCACCGTAGCATCTGTCCT 18 PLP NM_011123.2 Forward:
TCTTTGGCGACTACAAGACCAC 19 Reverse: CACAAACTTGTCGGGATGTCCTA 20 Rn18S
NR_003278.3 Applied Biosystems, Assay ID: Mm03928990_gl All primers
were obtained from Integrated DNA Technologies (IDT) unless
otherwise indicated.
[0113] Pharmacologic inhibition of PAR1 in an organotypic
cerebellar slice culture system: Cerebellar slices (350.mu.m) from
postnatal day 8 mouse brain were grown in cell culture for 7 days
in the presence or absence of 70 nM SCH79797, a small molecule
inhibitor of PAR1. Cerebellar slices were then fixed with 2%
paraformaldehyde and stained using immunofluorescence techniques
for myelin associated makers, including MBP, a marker of mature
oligodendrocytes (CC-1), and for a marker of oligodendrocyte
progenitor cells (NG2). The photomicrographs in FIG. 16 show
staining for each individual antigen, or for all of the antigens
collectively in a single slice, as indicated. Relative to control
cerebellar slices (top panels), slices treated with SCH79797
(bottom panels) showed significant increases in the abundance of
MBP, in the number of mature oligodendrocytes (CC-1), and the
number of progenitor cells positive for the NG2 antigen. These
findings suggested that inhibition of PAR1 promotes myelination in
an organotypic cerebellar slice culture system.
[0114] Myelin regeneration after demyelinating injury in vitro:
Cerebellar slices (350 .mu.m) were prepared from the brains of
postnatal day 8 mice and grown in culture for 72 hours. Slices were
then treated with a demyelinating agent (Lysolecithin; LL) for 24
hours, followed by an additional seven day culture period to
visualize the process of myelin regeneration. All cerebellar slices
were fixed with 2% paraformaldehyde and stained using
immunofluorescence techniques for MBP to gauge myelin abundance.
Cerebellar slices cultured from PAR1 gene deficient mice were
associated with significantly more myelin repair
(immunofluorescence for MBP; FIG. 17, bottom panels) relative to
PAR1.sup.+/+ slices (FIG. 17, top panels) seven days after a
demyelinating lesion. These results suggested that blocking PAR1
can improve myelin regeneration in the central nervous system.
[0115] Remyelination in PAR1.sup.-/- mice: A demyelinating agent
(Lysolecithin, 2 .mu.l of a 1% solution) was microinjected into the
dorsal column white matter of adult male PAR1.sup.+/+ or
PAR1.sup.-/- mice. Mice were perfused with 4% paraformaldehyde 14
days later to examine the extent of axon remyelination in semithin
1 .mu.m paraphenylenediamine stained plastic sections. Remyelinated
axons (arrows in FIGS. 18A and 18B) were evident by their thin
appearance relative to axon diameter, as compared to intact myelin
sheaths. Counts of remyelinated axons demonstrated significantly
higher numbers in PAR1 gene deficient (PAR1.sup.-/-) mice relative
to their PAR1.sup.+/- wild type counterparts (FIG. 18C). Thus,
remyelination was enhanced in the PAR1.sup.-/- mice.
[0116] Effects of PAR1 gene deletion on neural precursor cell
proliferation in vitro: Neural precursor cells (NPCs) were isolated
from the subventricular zone (SVZ) of 8 week-old adult C57BL6/J
mice and cultured in suspension. NPCs from PAR1.sup.-/- mice
incorporated greater levels of bromodeoxyuridine (BrdU, an
indicator of proliferation) (FIG. 19A, *P=0.009) and formed more
neurospheres in vitro (FIGS. 19B-19D, **P=0.0007). The
photomicrographs in FIGS. 19C and 19D are representative images of
cultures of neurospheres derived from PAR1.sup.+/+ or PAR1.sup.-/-
mice, with those lacking the PAR1 gene demonstrating a significant
increase in the number of neurospheres. These results suggested
that deletion of the PAR1 receptor results in improved
proliferation and expansion of NPCs derived from the adult
forebrain.
[0117] Effects of pharmacologic inhibition of PAR1 on NPC
proliferation in vitro: NPCs were isolated from the SVZ of 8
week-old adult C57BL6/J mice, cultured in suspension, and treated
with 70, 35, 10, or 1 nM of SCH79797, a small molecule inhibitor of
PAR1. Cells treated with SCH79797 incorporated greater levels of
BrdU (FIG. 20), indicating that PAR1 can be targeted
pharmacologically to promote expansion of NPCs.
[0118] Effects of PAR1 gene deletion on differentiation of NPCs:
NPCs were isolated from the SVZ of 8 week-old adult C57BL6/J
PAR1.sup.-/- and PAR1.sup.+/+ mice and cultured in suspension, and
levels of differentiation markers were measured. PAR1 gene deletion
enhanced NPC differentiation, as suggested by reduced levels of
Nestin RNA in PAR1.sup.-/- NPCs after 5 days of cell culture in
differentiation media (FIG. 21A; **P=0.0002). The PAR1.sup.-/- NPCs
also showed increased RNA levels for the oligodendrocyte marker
Olig2 (FIG. 21B; **P=0.0001) and reduced levels of RNA for a marker
of astrocyte differentiation (glial fibrillary acidic protein
(GFAP); FIG. 21C; **P=0.009, t-test).
[0119] In further experiments, NPCs isolated from the SVZ of 8
week-old adult C57BL6/J PAR1.sup.-/- and PAR1.sup.-/+ mice and
cultured in suspension, and immunostained for NG2, a marker for
oligodendrocyte progenitor cells, and Olig2, a marker for OPCs and
mature oligodendrocytes at early stages of differentiation. These
studies showed that the PAR1.sup.-/- cells exhibited an increase in
the number of NPCs immunopositive for both NG2 (FIG. 22A) and Olig2
(FIG. 22B), suggesting that loss of PAR1 enhances early
differentiation of NPCs toward an oligodendrocyte lineage.
[0120] Motor activity in PAR1.sup.-/- mice: To link changes in
spinal cord myelination observed in PAR1.sup.-/- mice to functional
outcomes, overall motor activity, ambulation, and rearing during
diurnal and nocturnal cycles under both fed and fasted conditions
were evaluated. The overall activity of mice lacking the thrombin
receptor was increased during the day under fed conditions
(P=0.04), and also at night when fasted (P=0.02) (Student's
unpaired t-test, FIG. 23A). In addition, both ambulation (P=0.02)
and rearing responses (P=0.04) were increased in the PAR1-deficient
mice under fasting conditions at night (Student's unpaired t-test,
FIGS. 23B and 23C).
Other Embodiments
[0121] It is to be understood that while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
Sequence CWU 1
1
20117DNAArtificial Sequencesynthetically generated oligonucleotide
1accaccatgg agaaggc 17220DNAArtificial Sequencesynthetically
generated oligonucleotide 2ggcatggact gtggtcatga 20319DNAArtificial
Sequencesynthetically generated oligonucleotide 3cctaccctgg
caagatcac 19421DNAArtificial Sequencesynthetically generated
oligonucleotide 4ggatccatct gatatgagtg c 21517DNAArtificial
Sequencesynthetically generated oligonucleotide 5cttgctgatc gtcgccc
17620DNAArtificial Sequencesynthetically generated oligonucleotide
6ttcaccgtag catctgtcct 20717DNAArtificial Sequencesynthetically
generated oligonucleotide 7ccggaccgag aaccttg 17821DNAArtificial
Sequencesynthetically generated oligonucleotide 8cggaagaaag
acagtggtca g 21926DNAArtificial Sequencesynthetically generated
oligonucleotide 9ccagtagtcc atttcttcaa gaacat 261022DNAArtificial
Sequencesynthetically generated oligonucleotide 10gccgatttat
agtcggaagc tc 221122DNAArtificial Sequencesynthetically generated
oligonucleotide 11tctttggcga ctacaagacc ac 221223DNAArtificial
Sequencesynthetically generated oligonucleotide 12cacaaacttg
tcgggatgtc cta 231319DNAArtificial Sequencesynthetically generated
oligonucleotide 13caaattctgt gactacggg 191415DNAArtificial
Sequencesynthetically generated oligonucleotide 14ggccttgcca tacga
151526DNAArtificial Sequencesynthetically generated oligonucleotide
15ccagtagtcc atttcttcaa gaacat 261622DNAArtificial
Sequencesynthetically generated oligonucleotide 16gccgatttat
agtcggaagc tc 221717DNAArtificial Sequencesynthetically generated
oligonucleotide 17cttgctgatc gtcgccc 171820DNAArtificial
Sequencesynthetically generated oligonucleotide 18ttcaccgtag
catctgtcct 201922DNAArtificial Sequencesynthetically generated
oligonucleotide 19tctttggcga ctacaagacc ac 222023DNAArtificial
Sequencesynthetically generated oligonucleotide 20cacaaacttg
tcgggatgtc cta 23
* * * * *