U.S. patent application number 14/716141 was filed with the patent office on 2015-12-24 for antisense modulation of nuclear hormone receptors.
The applicant listed for this patent is Sarepta Therapeutics, Inc.. Invention is credited to Patrick L. Iversen.
Application Number | 20150368653 14/716141 |
Document ID | / |
Family ID | 44009904 |
Filed Date | 2015-12-24 |
United States Patent
Application |
20150368653 |
Kind Code |
A1 |
Iversen; Patrick L. |
December 24, 2015 |
ANTISENSE MODULATION OF NUCLEAR HORMONE RECEPTORS
Abstract
Provided are antisense oligonucleotides and other agents that
target and modulate nuclear hormone receptors (NHRs) such as the
glucocorticoid receptor (GR), compositions that comprise the same,
and methods of use thereof.
Inventors: |
Iversen; Patrick L.;
(Corvallis, OR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Sarepta Therapeutics, Inc. |
Corvallis |
OR |
US |
|
|
Family ID: |
44009904 |
Appl. No.: |
14/716141 |
Filed: |
May 19, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13046356 |
Mar 11, 2011 |
9068185 |
|
|
14716141 |
|
|
|
|
61313652 |
Mar 12, 2010 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/24.5 |
Current CPC
Class: |
A61P 29/00 20180101;
C12N 2310/3513 20130101; A61P 3/00 20180101; C12N 2310/3233
20130101; C12N 2310/314 20130101; C12N 15/1138 20130101; A61P 19/02
20180101; A61P 25/28 20180101; C12N 2310/11 20130101; A61P 1/00
20180101; A61P 11/06 20180101 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1.-50. (canceled)
51. An antisense morpholino oligomer of 20 to 30 bases comprising a
base sequence that is complementary to at least 15 contiguous bases
of SEQ ID NO:1, wherein the antisense morpholino oligomer alters
splicing of the human glucocorticoid receptor (GR) pre-mRNA
transcript and increases expression of a ligand independent form of
the GR; or a pharmaceutically acceptable salt thereof.
52. The antisense morpholino oligomer of claim 51, wherein the
antisense morpholino oligomer has 20 to 23 bases.
53. The antisense morpholino oligomer of claim 51, wherein the base
sequence is complementary to at least 17 contiguous bases of SEQ ID
NO:1.
54. The antisense morpholino oligomer of claim 51, wherein the base
sequence is complementary to at least 20 contiguous bases of SEQ ID
NO:1.
55. The antisense morpholino oligomer of claim 51, wherein the base
sequence is 100% complementary to contiguous bases of SEQ ID
NO:1.
56. The antisense morpholino oligomer of claim 51, wherein the
antisense morpholino oligomer contains about 10%-50% intersubunit
cationic linkages.
57. The antisense morpholino oligomer of claim 51, wherein the
antisense morpholino oligomer comprises an arginine-rich carrier
peptide.
58. The antisense morpholino oligomer of claim 57, wherein the
peptide is linked at its C-terminus to the 5' end of the antisense
morpholino oligomer through a one or two-amino acid linker.
59. The antisense morpholino oligomer of claim 57, wherein the
peptide is linked at its C-terminus to the 3' end of the antisense
morpholino oligomer through a one or two-amino acid linker.
60. The antisense morpholino oligomer of claim 59, wherein the
linker is Ahx.beta.Ala, wherein Ahx is 6-amino hexanoic acid and
.beta.Ala is .beta.-alanine.
61. The antisense morpholino oligomer of claim 51, wherein the
arginine-rich carrier peptide is selected from any one of SEQ ID
NOS: 18-26.
62. The antisense morpholino oligomer of claim 51, wherein the
antisense morpholino oligomer comprises phosphorus-containing
intersubunit linkages in accordance with the structure:
##STR00008## wherein Z.dbd.O, Y.sub.1.dbd.O, and
X.dbd.N(CH.sub.3).sub.2.
63. The antisense morpholino oligomer of claim 56, wherein the
antisense morpholino oligomer comprises phosphorus-containing
intersubunit linkages in accordance with the structure:
##STR00009## wherein Z is S or O, X.dbd.NR.sup.1R.sup.2 or
OR.sup.6, Y.sub.1.dbd.O or NR.sup.7, and each phosphorus-containing
linkage is independently selected from: (a) uncharged linkage (a),
wherein each of R.sup.1, R.sup.2, R.sup.6, and R.sup.7 is
independently selected from hydrogen and lower alkyl; (b1) cationic
linkage (b1), wherein X.dbd.NR.sup.1R.sup.2 and Y.sub.1.dbd.O,
wherein NR.sup.1R.sup.2 represents a group of the formula:
##STR00010## wherein each R is independently H or CH.sub.3, R.sup.4
is H, CH.sub.3 or an electron pair, and R.sup.3 is selected from H,
lower alkyl, C(.dbd.NH)NH.sub.2, Z-L-NHC(.dbd.NH)NH.sub.2, and
[C(O)CHR'NH].sub.mH, wherein Z is carbonyl (C(O)) or a direct bond,
L is an optional linker up to 18 atoms in length having bonds
selected from alkyl, alkoxy, and alkylamino, R' is a side chain of
a naturally occurring amino acid or a one- or two-carbon homolog
thereof, and m is 1 to 6; (b2) cationic linkage (b2), wherein
X.dbd.NR.sup.1R.sup.2 and Y.sub.1.dbd.O, wherein R.sup.1.dbd.H or
CH.sub.3, and R.sup.2=LNR.sup.3R.sup.4R.sup.5, wherein L, R.sup.3,
and R.sup.4 are defined as above, and R.sup.5 is H, lower alkyl, or
lower (alkoxy)alkyl; and (b3) cationic linkage (b3), wherein
Y.dbd.NR' and X.dbd.OR.sup.6, wherein
R.sup.7=LNR.sup.3R.sup.4R.sup.5, wherein L, R.sup.3, R.sup.4, and
R.sup.5 are defined as above, and R.sup.6 is H or lower alkyl;
wherein at least one phosphorus-containing intersubunit linkage is
selected from cationic linkages (b1), (b2), and (b3).
64. The antisense morpholino oligomer of claim 63, wherein each of
R.sup.1 and R.sup.2, in linkages of type (a), is methyl.
65. The antisense morpholino oligomer of claim 63, wherein at least
one phosphorus-containing intersubunit linkage is of type (b1),
where each R is H, R.sup.4 is H, CH.sub.3, or an electron pair, and
R.sup.3 is selected from H, CH.sub.3, C(.dbd.NH)NH.sub.2, and
C(O)-L-NHC(.dbd.NH)NH.sub.2.
66. The antisense morpholino oligomer of claim 63, wherein at least
one phosphorus-containing intersubunit linkage is of type (b1),
where each R is H, R.sup.4 is an electron pair, and R.sup.3 is
selected from C(.dbd.NH)NH.sub.2 and
C(O)-L-NHC(.dbd.NH)NH.sub.2.
67. The antisense morpholino oligomer of claim 66, wherein R.sup.3
is C(O)-L-NHC(NH)NH.sub.2, and L is a hydrocarbon having the
structure --(CH.sub.2).sub.n--, where n is 1 to 12.
68. The antisense morpholino oligomer of claim 63, wherein at least
one phosphorus-containing intersubunit linkage is of type (b1),
where each R is H, and each of R.sup.3 and R.sup.4 is independently
H or CH.sub.3.
69. The antisense morpholino oligomer of claim 51, wherein the base
sequence comprises any one of SEQ ID NOS:2-14.
70. The antisense morpholino oligomer of claim 51, wherein the base
sequence consists of any one of SEQ ID NOS:2-14.
71. A pharmaceutical composition comprising: (i) an antisense
morpholino oligomer of claim 51 or a pharmaceutically acceptable
salt thereof, and (ii) a pharmaceutically acceptable carrier.
72. An antisense morpholino oligomer of 20 to 30 bases comprising a
base sequence that is 100% complementary to contiguous bases of SEQ
ID NO:1, wherein the antisense morpholino oligomer comprises
phosphorodiamidate intersubunit linkages, and wherein the antisense
morpholino oligomer alters splicing of the human glucocorticoid
receptor (GR) pre-mRNA transcript and increases expression of a
ligand independent form of the GR; or a pharmaceutically acceptable
salt thereof.
73. A pharmaceutical composition comprising: (i) an antisense
morpholino oligomer of 20 to 30 bases comprising a base sequence
that is 100% complementary to contiguous bases of SEQ ID NO:1,
wherein the antisense morpholino oligomer comprises
phosphorodiamidate intersubunit linkages, and wherein the antisense
morpholino oligomer alters splicing of the human glucocorticoid
receptor (GR) pre-mRNA transcript and increases expression of a
ligand independent form of the GR; or a pharmaceutically acceptable
salt thereof, and (ii) a pharmaceutically acceptable carrier.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 13/046,356, filed Mar. 11, 2011 (allowed), which claims benefit
under 35 U.S.C. .sctn.119(e) of U.S. Provisional Application No.
61/313,652, filed Mar. 12, 2010, each of which is incorporated by
reference in its entirety.
STATEMENT REGARDING SEQUENCE LISTING
[0002] The Sequence Listing associated with this application is
provided in text format in lieu of a paper copy, and is hereby
incorporated by reference into the specification. The name of the
text file containing the Sequence Listing is
120178.sub.--485C1_SEQUENCE_LISTING.txt. The text file is 13 KB,
was created on May 19, 2015, and is being submitted electronically
via EFS-Web.
BACKGROUND OF THE INVENTION
[0003] 1. Technical Field
[0004] The present invention relates to antisense oligonucleotides
and other agents that target nuclear hormone receptors (NHRs) and
methods of use thereof.
[0005] 2. Description of the Related Art
[0006] The nuclear hormone receptor (NHR) family of transcription
factors bind low molecular weight ligands and either stimulate or
repress transcription. See, e.g., V. Laudet et al., The Nuclear
Receptor Facts Book, 345, (2002) and (Gronemeyer, Gustafsson et al.
2004)). NHRs stimulate transcription by binding to DNA and inducing
transcription of specific genes. NHRs may also stimulate
transcription by not binding to DNA but through the modulation of
the activity of other DNA binding proteins. This process of
stimulation of transcription is called transactivation. NHRs also
repress transcription by interacting with other transcription
factors or coactivators and inhibiting the ability of these other
transcription factors or coactivators from inducing transcription
of specific genes. This type of repression is called
transrepression (see V. Laudet et al (2002) and (Newton, Leigh et
al. 2010).
[0007] The glucocorticoid receptor (GR) is a member of the nuclear
hormone receptor family of transcription factors, and a member of
the steroid hormone family of transcription factors.
Glucocorticoids that interact with GR have been used for over 50
years to treat inflammatory diseases. Although glucocorticoids are
potent anti-inflammatory agents, their systemic use is limited by
numerous side effects. A compound that causes GR to retain the
anti-inflammatory efficacy of glucocorticoids while minimizing the
side effects such as diabetes, osteoporosis and glaucoma would be
of great benefit to a very large number of patients with
inflammatory diseases or other conditions. The art is therefore in
need of effective and relatively specific modulators of NHRs such
as GRs.
BRIEF DESCRIPTIONS OF THE DRAWINGS
[0008] FIG. 1A shows an exemplary morpholino oligomer structure
with a phosphorodiamidate linkage;
[0009] FIG. 1B shows a morpholino oligomer as in FIG. 1A, but where
the backbone linkages contain one positively charged group in the
form of a (piperazino) phosphorodiamidate linkage;
[0010] FIG. 1C shows a conjugate of an arginine-rich peptide and an
antisense oligomer, in accordance with one embodiment of the
invention;
[0011] FIGS. 1D-G show the repeating subunit segment of exemplary
morpholino oligonucleotides, designated D through G.
[0012] FIG. 2 shows the exon organization of the human and murine
GR gene and the human PR gene with the associated GenBank numbers.
The human GR schematic shows the exon locations for several of the
known alternatively spliced forms of the gene.
[0013] FIG. 3 shows the target location of the exemplary targeting
sequences for the human GR gene relative to the exon 5 and 6 splice
donor and acceptor sites.
[0014] FIG. 4 shows that antisense treatment induces precise
exon-skipping of exon 6 of the glucocorticoid receptor in rat
hepatocytes. The presence of the expected 504 bp band relative to
780 bp full-length band indicates removal of exon 6. This result
was confirmed by sequencing the 504 bp band.
[0015] FIG. 5 shows that intranasally administered antisense agents
induce precise exon-skipping of exon 7 of the glucocorticoid
receptor in an in vivo mouse model. This figure indicates the
presence of the expected alternative splice isoform lacking exon 7
(635 bp) compared to the band from the full length mRNA (780
bp).
[0016] FIGS. 6A-6D show that antisense-induced exon-skipping of
exon 6 of the glucocorticoid receptor reduces activation of
CD4.sup.+ and CD8.sup.+ T-cells. FIG. 6A shows that MuSA6 treatment
reduces the mean fluorescence intensity of cell-surface activation
marker CD25 on the surface of CD8.sup.+ T-cells. FIG. 6B shows that
MuSA6 treatment also reduces the percentage of dividing CD8.sup.+
T-cells relative to controls. FIGS. 6C and 6D show the same results
for CD4.sup.+ T-cells. The figure legends refer to MuSA6-PPMO (SEQ
ID NO:16 conjugated to the peptide of SEQ ID NO:19) and Peptide
only (SEQ ID NO: 19).
BRIEF SUMMARY OF THE INVENTION
[0017] The present invention relates generally to compositions and
methods for modulating expression of nuclear hormone receptors
(NHR) from the nuclear hormone receptor superfamily (NHRSF), mainly
by controlling or altering the splicing of pre-mRNA that codes for
the receptors. Examples of particular NHRs include glucocorticoid
receptors (GR). In certain embodiments, the antisense
oligonucleotides and agents described herein lead to increased
expression of ligand-independent or other selected forms of the
receptors, and decreased expression of their inactive forms.
[0018] Embodiments of the present invention include nucleic acids
and nucleic acid analogs that are complementary to selected exonic
or intronic sequences of an NHR, including the "ligand-binding
exons" and/or adjacent introns of a NHRSF pre-mRNA, among other
NHR-domains described herein. The term "ligand-binding exons"
refers to exon(s) that are present in the wild-type mRNA but are
removed from the primary transcript (the "pre-mRNA") to make a
ligand-independent form of the mRNA. In certain embodiments,
complementarity can be based on sequences in the sequence of
pre-mRNA that spans a splice site, which includes, but is not
limited to, complementarity based on sequences that span an
exon-intron junction. In other embodiments, complementarity can be
based solely on the sequence of the intron. In other embodiments,
complementarity can be based solely on the sequence of the
exon.
[0019] NHR modulators may be useful in treating NHR-associated
diseases, including diseases associated with the expression
products of genes whose transcription is stimulated or repressed by
NHRs. For instance, modulators of NHRs that inhibit AP-1 and/or
NF-.kappa.B can be useful in the treatment of inflammatory and
immune diseases and disorders such as osteoarthritis, rheumatoid
arthritis, multiple sclerosis, asthma, inflammatory bowel disease,
transplant rejection, and graft vs. host disease, among others
described herein and known in the art. Compounds that antagonize
transactivation can be useful in treating metabolic diseases
associated with increased levels of glucocorticoid, such as
diabetes, osteoporosis and glaucoma, among others. Also, compounds
that agonize transactivation can be useful in treating metabolic
diseases associated with a deficiency in glucocorticoid, such as
Addison's disease and others.
[0020] There are several alternative antisense or RNA interference
chemistries available and known to those skilled in the art. One
important feature of certain antisense chemistries is the ability
to hybridize to a target RNA without causing degradation of the
target by RNase H, as with 2'-deoxy oligonucleotides ("antisense
oligonucleotides" hereafter "ASON"). Such compounds may also be
referred to as splice-switching oligomers (SSOs). Those skilled in
the art will appreciate that SSOs include, but are not limited to,
2' O-modified oligonucleotides and ribonucleosidephosphorothioates
as well as peptide nucleic acids (PNA), morpholinos, locked nucleic
acids (LNA), and other polymers lacking ribofuranosyl-based
linkages.
[0021] Embodiments of the present invention include methods of
modulating nuclear hormone receptor (NHR) activity or expression in
a cell, comprising contacting the cell with an antisense oligomer
composed of morpholino subunits linked by phosphorus-containing
intersubunit linkages joining a morpholino nitrogen of one subunit
to a 5' exocyclic carbon of an adjacent subunit, wherein the
oligonucleotide contains between 10-40 bases and a targeting
sequence of at least 10 contiguous bases complementary to a target
sequence, wherein the target sequence is a pre-mRNA transcript of
the NHR, thereby modulating activity or expression of the NHR. In
certain embodiments, the NHR is selected from Table 1.
[0022] In certain embodiments, the oligomer alters splicing of the
pre-mRNA transcript and increases expression of a variant of the
NHR. In some embodiments, the oligomer induces full or partial
exon-skipping of one or more exons of the pre-mRNA transcript. In
certain embodiments, the one or more exons encode at least a
portion of a ligand-binding domain of the NHR, and the variant is a
ligand independent form of the NHR. In certain embodiments, the one
or more exons encode at least a portion of a transactivation domain
of the NHR, and the variant has reduced transcriptional activation
activity. In certain embodiments, the one or more exons encode at
least a portion of a DNA-binding domain of the NHR. In certain
embodiments, the one or more exons encode at least a portion of an
N-terminal activation domain of the NHR. In certain embodiments,
the one or more exons encode at least a portion of a
carboxy-terminal domain of the NHR. In specific embodiments, the
variant binds to NF-.kappa.B, AP-1, or both, and reduces
transcription of one or more of their pro-inflammatory target
genes.
[0023] In certain embodiments, the oligomer agonizes a
transactivation/transcriptional activity of the NHR. In other
embodiments, the oligomer antagonizes a
transactivation/transcriptional activity of the NHR. In certain
embodiments, the oligomer agonizes a transrepression activity of
the NHR. In other embodiments, the oligomer antagonizes a
transrepression activity of the NHR. In specific embodiments, the
oligomer antagonizes a transactivation/transcriptional activity of
the NHR and agonizes a transrepression activity of the NHR.
[0024] In certain embodiments, the NHR is a glucocorticoid receptor
(GR), a progesterone receptor (GR), or an androgen receptor (AR).
In specific embodiments, the NHR is the GR. In certain embodiments,
the target sequence is SEQ ID NO:1. In certain embodiments, the
targeting sequence is selected from SEQ ID NOS:2-17 or 34-41.
[0025] In some embodiments, the cell is in a subject. Certain
embodiments include reducing inflammation or an inflammatory
response in the subject. Other embodiments comprise increasing
inflammation or an inflammatory response in the subject.
[0026] Embodiments of the present invention also include
substantially uncharged antisense oligomers, composed of morpholino
subunits linked by phosphorus-containing intersubunit linkages
joining a morpholino nitrogen of one subunit to a 5' exocyclic
carbon of an adjacent subunit, wherein the oligonucleotide contains
between 10-40 bases and a targeting sequence of at least 10
contiguous bases complementary to a target sequence, wherein the
target sequence is a pre-mRNA transcript of a nuclear hormone
receptor (NHR). In certain embodiments, the oligomer contains about
10%-50% intersubunit cationic linkages. In some embodiments, the
oligomer comprises an arginine-rich carrier peptide. In certain
embodiments, the peptide is linked at its C-terminus to the 5' end
of the oligonucleotide through a one- or two-amino acid linker. In
other embodiments, the peptide is linked at its C-terminus to the
3' end of the oligonucleotide through a one- or two-amino acid
linker. In specific embodiments, the linker is Ahx.beta.Ala,
wherein Ahx is 6-amino hexanoic acid and .beta.Ala is
.beta.-alanine. In preferred embodiments, the peptide is selected
from SEQ ID NOS:18-26.
[0027] In some embodiments, the morpholino subunits in the
oligonucleotide are joined by phosphorodiamidate linkages, in
accordance with the structure:
##STR00001##
[0028] wherein Z is S or O,
[0029] X.dbd.NR.sup.1R.sup.2 or OR.sup.6,
[0030] Y.dbd.O or NR.sup.7,
[0031] and each said linkage is selected from:
[0032] (a) uncharged linkage (a), wherein each of R.sup.1, R.sup.2,
R.sup.6, and R.sup.7 is independently selected from hydrogen and
lower alkyl;
[0033] (b1) cationic linkage (b1), wherein X.dbd.NR.sup.1R.sup.2
and Y.dbd.O, and NR.sup.1R.sup.2 represents an optional substituted
piperazino group, such that R.sup.1R.sup.2=
[0034] --CHRCHRN(R.sup.3)(R.sup.4)CHRCHR--, wherein
[0035] each R.sup.4 is H, CH.sub.3 or null, and
[0036] R3 is selected from H, lower alkyl, C(.dbd.NH)NH.sub.2,
Z-L-NHC(.dbd.NH)NH.sub.2, and
[0037] [C(O)CHR'NH].sub.mH, wherein where Z is carbonyl (C(O)) or a
direct bond, L is an optional linker up to 18 atoms in length
having bonds selected from alkyl, alkoxy, and alkylamino, R' is a
side chain of a naturally occurring amino acid or a one- or
two-carbon homolog thereof, and m is 1 to 6;
[0038] (b2) cationic linkage (b2), wherein X.dbd.NR.sup.1R.sup.2
and Y.dbd.O, R.sup.1.dbd.H or CH.sub.3, and
R.sup.2=LNR.sup.3R.sup.4R.sup.5, wherein L, R.sup.3, and R.sup.4
are defined as above, and R.sup.5 is H, lower alkyl, or lower
(alkoxy)alkyl; and
[0039] (b3) cationic linkage (b3), wherein Y.dbd.NR' and
X.dbd.OR.sup.6, and R7=LNR.sup.3R.sup.4R.sup.5. wherein L, R.sup.3,
and R.sup.4 and R.sup.5 are defined as above, and R.sup.6 is H or
lower alkyl; and at least one said linkage is selected from
cationic linkages (b1), (b2), and (b3).
[0040] In certain embodiments, each of R.sup.1 and R.sup.2, in
linkages of type (a), is methyl.
[0041] In some embodiments, at least one linkage is of type (b1),
where each R is H, R.sup.4 is H, CH.sub.3, or an electron pair, and
R.sup.3 is selected from H, CH.sub.3, C(.dbd.NH)NH.sub.2, and
C(O)-L-NHC(.dbd.NH)NH.sub.2.
[0042] In specific embodiments, at least one linkage is of type
(b1), where each R is H, R.sup.4 is an electron pair, and R.sup.3
is selected from C(.dbd.NH)NH.sub.2 and
C(O)-L-NHC(.dbd.NH)NH.sub.2.
[0043] In certain embodiments, at least one linkage is of type
(b1), where each R is H, R.sup.4 is an electron pair, and R.sup.3
is selected from C(.dbd.NH)NH.sub.2 and
C(O)-L-NHC(.dbd.NH)NH.sub.2.
[0044] In certain embodiments, R.sup.3 is C(O)-L-NHC(NH)NH2, and L
is a hydrocarbon having the structure --(CH.sub.2).sub.n--, where n
is 1 to 12.
[0045] In certain embodiments, at least one linkage is of type
(b1), where each R is H, and each of R.sup.3 and R.sup.4 is
independently H or CH.sub.3.
[0046] Also included are methods of modulating inflammation in a
subject, comprising administering to the subject an antisense
oligomer composed of morpholino subunits linked by
phosphorus-containing intersubunit linkages joining a morpholino
nitrogen of one subunit to a 5' exocyclic carbon of an adjacent
subunit, wherein the oligonucleotide contains between 10-40 bases
and a targeting sequence of at least 10 contiguous bases
complementary to a target sequence, wherein the target sequence is
a pre-mRNA transcript of a nuclear hormone receptor (NHR), thereby
modulating inflammation in the subject.
[0047] Certain embodiments include reducing an acute inflammatory
response, reducing a chronic inflammatory response, or both. Other
embodiments include increasing an acute inflammatory response,
increasing a chronic inflammatory response, or both. Certain
embodiments comprise modulating the activation, inflammatory
molecule secretion, proliferation, activity, migration, or adhesion
of one or more immune cells or vascular cells.
[0048] Certain embodiments include modulating the levels or
activity of one or more inflammatory molecules. In some
embodiments, the one or more inflammatory molecules comprise
plasma-derived inflammatory molecules of any one or more of the
complement system, kinin system, coagulation system, or
fibrinolysis system. In certain embodiments, the one or more
inflammatory molecules comprise cell-derived inflammatory molecules
of any one or more of lysosome granules, vasoactive amines,
eicosanoids, cytokines, acute-phase proteins, or nitric oxide.
[0049] Certain embodiments relate to modulating an inflammatory
response or inflammatory condition associated with one or more
tissues, tissue systems, or organs selected from skin, hair
follicles, nervous system, auditory system or balance organs,
respiratory system, gastroesophogeal tissues, gastrointestinal
system, vascular system, liver, gallbladder, lymphatic/immune
system, uro-genital system, musculoskeletal system, adipose tissue,
mammaries, and endocrine system.
[0050] Some embodiments include treating inflammation associated
with hypersensitivity, an auto-inflammatory condition, cancer,
systemic inflammatory response syndrome (SIRS), or cytokine
storm.
[0051] Certain embodiments include treating inflammation associated
with any one or more of granulomatous inflammation, fibrinous
inflammation, purulent inflammation, serous inflammation, or
ulcerative inflammation. Certain embodiments treating inflammation
associated with one or more wounds. Certain embodiments treating
inflammation associated with chronic obstructive pulmonary disorder
(COPD). Certain embodiments comprising increasing the inflammatory
response to treat a primary or secondary immunodeficiency. Also
included are pharmaceutical composition, comprising an oligomer as
described herein an a pharmaceutically acceptable carrier.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0052] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by those
of ordinary skill in the art to which the invention belongs.
Although any methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present invention, preferred methods and materials are described.
For the purposes of the present invention, the following terms are
defined below.
[0053] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0054] By "about" is meant a quantity, level, value, number,
frequency, percentage, dimension, size, amount, weight or length
that varies by as much as 30, 25, 20, 25, 10, 9, 8, 7, 6, 5, 4, 3,
2 or 1% to a reference quantity, level, value, number, frequency,
percentage, dimension, size, amount, weight or length.
[0055] An "agonist" refers to an agent that intensifies or mimics a
selected biological activity of an NHR. Examples of such biological
activities include transactivation and transrepression. Included
are partial and full agonists.
[0056] The term "antagonist" refers to an agent that inhibits or
attenuates a selected biological activity of an NHR. Examples of
such biological activities include transactivation and
transrepression. Included are partial and full antagonists.
[0057] By "coding sequence" is meant any nucleic acid sequence that
contributes to the code for the polypeptide product of a gene. By
contrast, the term "non-coding sequence" refers to any nucleic acid
sequence that does not contribute to the code for the polypeptide
product of a gene.
[0058] Throughout this specification, unless the context requires
otherwise, the words "comprise," "comprises," and "comprising" will
be understood to imply the inclusion of a stated step or element or
group of steps or elements but not the exclusion of any other step
or element or group of steps or elements.
[0059] By "consisting of" is meant including, and limited to,
whatever follows the phrase "consisting of." Thus, the phrase
"consisting of" indicates that the listed elements are required or
mandatory, and that no other elements may be present. By
"consisting essentially of" is meant including any elements listed
after the phrase, and limited to other elements that do not
interfere with or contribute to the activity or action specified in
the disclosure for the listed elements. Thus, the phrase
"consisting essentially of" indicates that the listed elements are
required or mandatory, but that other elements are optional and may
or may not be present depending upon whether or not they materially
affect the activity or action of the listed elements.
[0060] The terms "complementary" and "complementarity" refer to
polynucleotides (i.e., a sequence of nucleotides) related by the
base-pairing rules. For example, the sequence "A-G-T," is
complementary to the sequence "T-C-A." Complementarity may be
"partial," in which only some of the nucleic acids' bases are
matched according to the base pairing rules. Or, there may be
"complete" or "total" complementarity between the nucleic acids.
The degree of complementarity between nucleic acid strands has
significant effects on the efficiency and strength of hybridization
between nucleic acid strands. While perfect complementarity is
often desired, some embodiments can include one or more but
preferably 6, 5, 4, 3, 2, or 1 mismatches with respect to the
target RNA. Variations at any location within the oligomer are
included. In certain embodiments, variations in sequence near the
termini of an oligomer are generally preferable to variations in
the interior, and if present are typically within about 6, 5, 4, 3,
2, or 1 nucleotides of the 5' and/or 3' terminus.
[0061] The terms "cell penetrating peptide" or "CPP" are used
interchangeably and refer to cationic cell penetrating peptides,
also called transport peptides, carrier peptides, or peptide
transduction domains. The peptides, as shown herein, have the
capability of inducing cell penetration within 30%, 40%, 50%, 60%,
70%, 80%, 90%, or 100% of cells of a given cell culture population,
including all integers in between, and allow macromolecular
translocation within multiple tissues in vivo upon systemic
administration.
[0062] The terms "antisense oligomer" or "antisense compound" or
"antisense oligonucleotide" or "oligonucleotide" are used
interchangeably and refer to a sequence of cyclic subunits, each
bearing a base-pairing moiety, linked by intersubunit linkages that
allow the base-pairing moieties to hybridize to a target sequence
in a nucleic acid (typically an RNA) by Watson-Crick base pairing,
to form a nucleic acid:oligomer heteroduplex within the target
sequence. The cyclic subunits may be based on ribose or another
pentose sugar or, in certain embodiments, a morpholino group (see
description of morpholino oligomers below). Also contemplated are
peptide nucleic acids (PNAs), locked nucleic acids (LNAs),
2'-O-Methyl oligonucleotides and RNA interference agents (siRNA
agents), and other antisense agents known in the art.
[0063] Such an antisense oligomer can be designed to block or
inhibit translation of mRNA or to inhibit natural pre-mRNA splice
processing, or induce degradation of targeted mRNAs, and may be
said to be "directed to" or "targeted against" a target sequence
with which it hybridizes. In certain embodiments, the target
sequence includes a region including an AUG start codon of an mRNA,
a 3' or 5' splice site of a pre-processed mRNA, a branch point. The
target sequence may be within an exon or within an intron. The
target sequence for a splice site may include an mRNA sequence
having its 5' end 1 to about 25 base pairs downstream of a normal
splice acceptor junction in a preprocessed mRNA. A preferred target
sequence for a splice is any region of a preprocessed mRNA that
includes a splice site or is contained entirely within an exon
coding sequence or spans a splice acceptor or donor site. An
oligomer is more generally said to be "targeted against" a
biologically relevant target, such as an NHR mRNA, when it is
targeted against the nucleic acid of the target in the manner
described above.
[0064] Included are antisense oligonucleotides that comprise,
consist essentially of, or consist of one or more of SEQ ID
NOS:2-17 or 34-41. Also included are variants of these antisense
oligomers, including variant oligomers having 80%, 85%, 90%, 95%,
97%, 98%, or 99% (including all integers in between) sequence
identity or sequence homology to any one of SEQ ID NOS:2-17 or
34-41, and/or variants that differ from these sequences by about 1,
2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, preferably those
variants that modulate NHR expression in a cell. Also included are
oligonucleotides of any one or more of SEQ ID NOS:2-17 or 34-41,
which comprise a suitable number of charged linkages, as described
herein, e.g., up to about 1 per every 2-5 uncharged linkages, such
as about 4-5 per every 10 uncharged linkages, and/or which comprise
an Arg-rich peptide attached thereto, as also described herein.
[0065] The terms "morpholino oligomer" or "PMO" (phosphoramidate-
or phosphorodiamidate morpholino oligomer) refer to an
oligonucleotide analog composed of morpholino subunit structures,
where (i) the structures are linked together by
phosphorus-containing linkages, one to three atoms long, preferably
two atoms long, and preferably uncharged or cationic, joining the
morpholino nitrogen of one subunit to a 5' exocyclic carbon of an
adjacent subunit, and (ii) each morpholino ring bears a purine or
pyrimidine or an equivalent base-pairing moiety effective to bind,
by base specific hydrogen bonding, to a base in a polynucleotide.
See, for example, the structure in FIG. 1A, which shows a preferred
phosphorodiamidate linkage type. Variations can be made to this
linkage as long as they do not interfere with binding or activity.
For example, the oxygen attached to phosphorus may be substituted
with sulfur (thiophosphorodiamidate). The 5' oxygen may be
substituted with amino or lower alkyl substituted amino. The
pendant nitrogen attached to phosphorus may be unsubstituted,
monosubstituted, or disubstituted with (optionally substituted)
lower alkyl. See also the discussion of cationic linkages below.
The purine or pyrimidine base pairing moiety is typically adenine,
cytosine, guanine, uracil, thymine or inosine. The synthesis,
structures, and binding characteristics of morpholino oligomers are
detailed in U.S. Pat. Nos. 5,698,685, 5,217,866, 5,142,047,
5,034,506, 5,166,315, 5,521,063, and 5,506,337, and PCT Appn. Nos.
PCT/US07/11435 (cationic linkages) and U.S. Ser. No. 08/012,804
(improved synthesis), all of which are incorporated herein by
reference.
[0066] The term "oligonucleotide analog" refers to an
oligonucleotide having (i) a modified backbone structure, e.g., a
backbone other than the standard phosphodiester linkage found in
natural oligo- and polynucleotides, and (ii) optionally, modified
sugar moieties, e.g., morpholino moieties rather than ribose or
deoxyribose moieties. Oligonucleotide analogs support bases capable
of hydrogen bonding by Watson-Crick base pairing to standard
polynucleotide bases, where the analog backbone presents the bases
in a manner to permit such hydrogen bonding in a sequence-specific
fashion between the oligonucleotide analog molecule and bases in a
standard polynucleotide (e.g., single-stranded RNA or
single-stranded DNA). Preferred analogs are those having a
substantially uncharged, phosphorus containing backbone.
[0067] A substantially uncharged, phosphorus containing backbone in
an oligonucleotide analog is one in which a majority of the subunit
linkages, e.g., between 50-100%, typically at least 60% to 100% or
75% or 80% of its linkages, are uncharged, and contain a single
phosphorous atom. Antisense oligonucleotides and oligonucleotide
analogs may contain between about 8 and 40 subunits, typically
about 8-25 subunits, and preferably about 12 to 25 subunits. In
certain embodiments, oligonucleotides may have exact sequence
complementarity to the target sequence or near complementarity, as
defined below.
[0068] A "subunit" of an oligonucleotide refers to one nucleotide
(or nucleotide analog) unit. The term may refer to the nucleotide
unit with or without the attached intersubunit linkage, although,
when referring to a "charged subunit", the charge typically resides
within the intersubunit linkage (e.g., a phosphate or
phosphorothioate linkage or a cationic linkage, as shown in FIG.
1B).
[0069] The purine or pyrimidine base pairing moiety is typically
adenine, cytosine, guanine, uracil, thymine or inosine. Also
included are bases such as pyridin-4-one, pyridin-2-one, phenyl,
pseudouracil, 2,4,6-trime115thoxy benzene, 3-methyl uracil,
dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g.,
5-methylcytidine), 5-alkyluridines (e.g., ribothymidine),
5-halouridine (e.g., 5-bromouridine) or 6-azapyrimidines or
6-alkylpyrimidines (e.g. 6-methyluridine), propyne, quesosine,
2-thiouridine, 4-thiouridine, wybutosine, wybutoxosine,
4-acetyltidine, 5-(carboxyhydroxymethyl)uridine,
5'-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluridine, .beta.-D-galactosylqueosine,
1-methyladenosine, 1-methylinosine, 2,2-dimethylguanosine,
3-methylcytidine, 2-methyladenosine, 2-methylguanosine,
N6-methyladenosine, 7-methylguanosine,
5-methoxyaminomethyl-2-thiouridine, 5-methylaminomethyluridine,
5-methylcarbonyhnethyluridine, 5-methyloxyuridine,
5-methyl-2-thiouridine, 2-methylthio-N6-isopentenyladenosine,
.beta.-D-mannosylqueosine, uridine-5-oxyacetic acid,
2-thiocytidine, threonine derivatives and others (Burgin et al.,
1996, Biochemistry, 35, 14090; Uhlman & Peyman, supra). By
"modified bases" in this aspect is meant nucleotide bases other
than adenine (A), guanine (G), cytosine (C), thymine (T), and
uracil (U), as illustrated above; such bases can be used at any
position in the antisense molecule. Persons skilled in the art will
appreciate that depending on the uses of the oligomers, Ts and Us
are interchangeable. For instance, with other antisense chemistries
such as 2'-O-methyl antisense oligonucleotides that are more
RNA-like, the T bases may be shown as U (see, e.g., Sequence
Listing).
[0070] An "amino acid subunit" or "amino acid residue" can refer to
an .alpha.-amino acid residue (--CO--CHR--NH--) or a .beta.- or
other amino acid residue (e.g., --CO--(CH.sub.2).sub.nCHR--NH--),
where R is a side chain (which may include hydrogen) and n is 1 to
7, preferably 1 to 4.
[0071] The term "naturally occurring amino acid" refers to an amino
acid present in proteins found in nature, such as the 20 (L)-amino
acids utilized during protein biosynthesis as well as others such
as 4-hydroxyproline, hydroxylysine, desmosine, isodesmosine,
homocysteine, citrulline and ornithine. The term "non-natural amino
acids" refers to those amino acids not present in proteins found in
nature, examples include beta-alanine (.beta.-Ala), 6-aminohexanoic
acid (Ahx) and 6-aminopentanoic acid. Additional examples of
"non-natural amino acids" include, without limitation, (D)-amino
acids, norleucine, norvaline, p-fluorophenylalanine, ethionine and
the like, which are known to a person skilled in the art.
[0072] By "isolated" is meant material that is substantially or
essentially free from components that normally accompany it in its
native state. For example, an "isolated polynucleotide" or
"isolated oligonucleotide," as used herein, may refer to a
polynucleotide that has been purified or removed from the sequences
that flank it in a naturally-occurring state, e.g., a DNA fragment
that has been removed from the sequences that are normally adjacent
to the fragment.
[0073] An "effective amount" or "therapeutically effective amount"
refers to an amount of therapeutic compound, such as an antisense
oligomer or RNA interference agent (e.g., siRNA), administered to a
mammalian subject, either as a single dose or as part of a series
of doses, which is effective to produce a desired therapeutic
effect. For an antisense oligomer, this effect is typically brought
about by inhibiting translation or natural splice-processing of a
selected target sequence. An "effective amount," targeted against
an NHR, also relates to an amount effective to modulate expression
of the NHR.
[0074] By "enhance" or "enhancing," or "increase" or "increasing,"
or "stimulate" or "stimulating," refers generally to the ability of
one or antisense or RNAi compounds or compositions to produce or
cause a greater physiological response (i.e., downstream effects)
in a cell or a subject, as compared to the response caused by
either no antisense compound or a control compound. An "increased"
or "enhanced" amount is typically a "statistically significant"
amount, and may include an increase that is 1.1, 1.2, 2, 3, 4, 5,
6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or more times (e.g., 500, 1000
times) (including all integers and decimal points in between and
above 1), e.g., 1.5, 1.6, 1.7, 1.8, etc.) the amount produced by no
antisense compound (the absence of an agent) or a control
compound.
[0075] The term "reduce" or "inhibit" may relate generally to the
ability of one or more antisense or RNAi compounds of the invention
to "decrease" a relevant physiological or cellular response, such
as a symptom of a disease or condition described herein, as
measured according to routine techniques in the diagnostic art.
Relevant physiological or cellular responses (in vivo or in vitro)
will be apparent to persons skilled in the art, and may include,
for example, reductions in inflammation. A "decrease" in a response
may be "statistically significant" as compared to the response
produced by no antisense compound or a control composition, and may
include a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%,
14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%,
55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% decrease,
including all integers in between.
[0076] The term "target sequence" refers to a portion of the target
RNA against which the oligonucleotide or antisense agent is
directed, that is, the sequence to which the oligonucleotide will
hybridize by Watson-Crick base pairing of a complementary sequence.
In certain embodiments, the target sequence may be a contiguous
region of a pre-mRNA that includes both intron and exon target
sequence. In certain other embodiments, the target sequence will
consist exclusively of either intron or exon sequences.
[0077] The term "targeting sequence" or "antisense targeting
sequence" refers to the sequence in an oligonucleotide or other
antisense agent that is complementary (meaning, in addition,
substantially complementary) to the target sequence in the RNA
genome. The entire sequence, or only a portion, of the antisense
compound may be complementary to the target sequence. For example,
in an oligonucleotide having 20-30 bases, about 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
or 29 may be targeting sequences that are complementary to the
target region. Typically, the targeting sequence is formed of
contiguous bases, but may alternatively be formed of non-contiguous
sequences that when placed together, e.g., from opposite ends of
the oligonucleotide, constitute sequence that spans the target
sequence.
[0078] The target and targeting sequences may be selected such that
binding of the antisense compound is to a region of a NHR pre-mRNA
that causes exon skipping of those exon or exons that encode the
NHR ligand-binding domain.
[0079] Target and targeting sequences are described as
"complementary" to one another when hybridization occurs in an
antiparallel configuration. A targeting sequence may have "near" or
"substantial" complementarity to the target sequence and still
function for the purpose of the present invention, that is, it may
still be functionally "complementary." In certain embodiments, an
oligonucleotide may have at most one mismatch with the target
sequence out of 10 nucleotides, and preferably at most one mismatch
out of 20. Alternatively, an oligonucleotide may have at least 90%
sequence homology, and preferably at least 95% sequence homology,
with the exemplary antisense targeting sequences described
herein.
[0080] An oligonucleotide "specifically hybridizes" to a target
polynucleotide if the oligomer hybridizes to the target under
physiological conditions, with a Tm substantially greater than
45.degree. C., preferably at least 50.degree. C., and typically
60.degree. C.-80.degree. C. or higher. Such hybridization
preferably corresponds to stringent hybridization conditions. At a
given ionic strength and pH, the Tm is the temperature at which 50%
of a target sequence hybridizes to a complementary polynucleotide.
Again, such hybridization may occur with "near" or "substantial"
complementarity of the antisense oligomer to the target sequence,
as well as with exact complementarity.
[0081] "Homology" refers to the percentage number of amino acids
that are identical or constitute conservative substitutions.
Homology may be determined using sequence comparison programs such
as GAP (Deveraux et al., 1984, Nucleic Acids Research 12, 387-395).
In this way sequences of a similar or substantially different
length to those cited herein could be compared by insertion of gaps
into the alignment, such gaps being determined, for example, by the
comparison algorithm used by GAP.
[0082] The recitations "sequence identity" or, for example,
comprising a "sequence 50% identical to," as used herein, refer to
the extent that sequences are identical on a
nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis
over a window of comparison. Thus, a "percentage of sequence
identity" may be calculated by comparing two optimally aligned
sequences over the window of comparison, determining the number of
positions at which the identical nucleic acid base (e.g., A, T, C,
G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser,
Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu,
Asn, Gln, Cys and Met) occurs in both sequences to yield the number
of matched positions, dividing the number of matched positions by
the total number of positions in the window of comparison (i.e.,
the window size), and multiplying the result by 100 to yield the
percentage of sequence identity.
[0083] Terms used to describe sequence relationships between two or
more polynucleotides or polypeptides include "reference sequence,"
"comparison window," "sequence identity," "percentage of sequence
identity," and "substantial identity". A "reference sequence" is at
least 8 or 10 but frequently 15 to 18 and often at least 25 monomer
units, inclusive of nucleotides and amino acid residues, in length.
Because two polynucleotides may each comprise (1) a sequence (i.e.,
only a portion of the complete polynucleotide sequence) that is
similar between the two polynucleotides, and (2) a sequence that is
divergent between the two polynucleotides, sequence comparisons
between two (or more) polynucleotides are typically performed by
comparing sequences of the two polynucleotides over a "comparison
window" to identify and compare local regions of sequence
similarity. A "comparison window" refers to a conceptual segment of
at least 6 contiguous positions, usually about 50 to about 100,
more usually about 100 to about 150 in which a sequence is compared
to a reference sequence of the same number of contiguous positions
after the two sequences are optimally aligned. The comparison
window may comprise additions or deletions (i.e., gaps) of about
20% or less as compared to the reference sequence (which does not
comprise additions or deletions) for optimal alignment of the two
sequences. Optimal alignment of sequences for aligning a comparison
window may be conducted by computerized implementations of
algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin
Genetics Software Package Release 7.0, Genetics Computer Group, 575
Science Drive Madison, Wis., USA) or by inspection and the best
alignment (i.e., resulting in the highest percentage homology over
the comparison window) generated by any of the various methods
selected. Reference also may be made to the BLAST family of
programs as for example disclosed by Altschul et al., 1997, Nucl.
Acids Res. 25:3389. A detailed discussion of sequence analysis can
be found in Unit 19.3 of Ausubel et al., "Current Protocols in
Molecular Biology," John Wiley & Sons Inc, 1994-1998, Chapter
15.
[0084] A "nuclease-resistant" oligomeric molecule (oligomer) refers
to one whose backbone is substantially resistant to nuclease
cleavage, in non-hybridized or hybridized form; by common
extracellular and intracellular nucleases in the body; that is, the
oligomer shows little or no nuclease cleavage under normal nuclease
conditions in the body to which the oligomer is exposed.
[0085] A "heteroduplex" refers to a duplex between an antisense
oligonucleotide and the complementary portion of a target RNA. A
"nuclease-resistant heteroduplex" refers to a heteroduplex formed
by the binding of an antisense oligomer to its complementary
target, such that the heteroduplex is substantially resistant to in
vivo degradation by intracellular and extracellular nucleases, such
as RNaseH, which are capable of cutting double-stranded RNA/RNA or
RNA/DNA complexes.
[0086] A "base-specific intracellular binding event involving a
target RNA" refers to the specific binding of an antisense
oligonucleotide to a target RNA sequence inside a cell. The base
specificity of such binding is sequence dependent. For example, a
single-stranded polynucleotide can specifically bind to a
single-stranded polynucleotide that is complementary in
sequence.
[0087] As used herein, the term "body fluid" encompasses a variety
of sample types obtained from a subject including, urine, saliva,
plasma, blood, spinal fluid, or other sample of biological origin,
such as skin cells or dermal debris, and may refer to cells or cell
fragments suspended therein, or the liquid medium and its
solutes.
[0088] The term "relative amount" is used where a comparison is
made between a test measurement and a control measurement. The
relative amount of a reagent forming a complex in a reaction is the
amount reacting with a test specimen, compared with the amount
reacting with a control specimen. The control specimen may be run
separately in the same assay, or it may be part of the same sample
(for example, normal tissue surrounding a malignant area in a
tissue section).
[0089] "Treatment" of an individual or a cell is any type of
intervention provided as a means to alter the natural course of a
disease or pathology in the individual or cell. Treatment includes,
but is not limited to, administration of, e.g., a pharmaceutical
composition, and may be performed either prophylactically, or
subsequent to the initiation of a pathologic event or contact with
an etiologic agent. Treatment includes any desirable effect on the
symptoms or pathology of a disease or condition associated with
inflammation, among others described herein.
[0090] Also included are "prophylactic" treatments, which can be
directed to reducing the rate of progression of the disease or
condition being treated, delaying the onset of that disease or
condition, or reducing the severity of its onset. "Treatment" or
"prophylaxis" does not necessarily indicate complete eradication,
cure, or prevention of the disease or condition, or associated
symptoms thereof.
[0091] An agent is "actively taken up by mammalian cells" when the
agent can enter the cell by a mechanism other than passive
diffusion across the cell membrane. The agent may be transported,
for example, by "active transport," referring to transport of
agents across a mammalian cell membrane by e.g., an ATP-dependent
transport mechanism, or by "facilitated transport," referring to
transport of antisense agents across the cell membrane by a
transport mechanism that requires binding of the agent to a
transport protein, which then facilitates passage of the bound
agent across the membrane. For both active and facilitated
transport, oligonucleotide analogs preferably have a substantially
uncharged backbone, as defined below.
[0092] Alternatively, the antisense compound may be formulated in a
complexed form, such as an agent having an anionic backbone
complexed with cationic lipids or liposomes, which can be taken
into cells by an endocytotic mechanism. The antisense
oligonucleotide may also be conjugated, e.g., at its 5' or 3' end,
to an arginine-rich peptide, such as a portion of the HIV TAT
protein, polyarginine, or to combinations of arginine and other
amino acids including the non-natural amino acids 6-aminohexanoic
acid (Ahx) and beta-alanine (.beta.-Ala). Exemplary arginine-rich
delivery peptides are listed as SEQ ID NOs:18-26. These exemplary
arginine-rich delivery peptides facilitate transport into the
target host cell as described (Moulton, Nelson et al. 2004).
[0093] Hence, included are methods of treating a subject in need
thereof, by administering one or more antisense oligomers of the
present invention (e.g., SEQ ID NOS:1-17 or 34-41, and variants
thereof), optionally as part of a pharmaceutical formulation or
dosage form, to a subject in need thereof. A "subject," as used
herein, may include any animal that exhibits a symptom, or is at
risk for exhibiting a symptom, which can be treated with an
antisense compound of the invention, such as a subject that has or
is at risk for having an inflammatory condition. Suitable subjects
(patients) include laboratory animals (such as mouse, rat, rabbit,
or guinea pig), farm animals, and domestic animals or pets (such as
a cat or dog). Non-human primates and, preferably, human patients,
are included.
[0094] Also contemplated are alternate methods of RNA interference
(RNAi), such as those involving double stranded RNA-molecules, or
dsRNA. The term "double-stranded" means two separate nucleic acid
strands comprising a region in which at least a portion of the
strands are sufficiently complementary to hydrogen bond and form a
duplex structure. The term "duplex" or "duplex structure" refers to
the region of a double stranded molecule wherein the two separate
strands are substantially complementary, and thus hybridize to each
other.
[0095] "dsRNA" refers to a ribonucleic acid molecule having a
duplex structure comprising two complementary and anti-parallel
nucleic acid strands (i.e., the sense and antisense strands). Not
all nucleotides of a dsRNA must exhibit Watson-Crick base pairs;
the two RNA strands may be substantially complementary. The RNA
strands may have the same or a different number of nucleotides. The
term "dsRNA" also includes "siRNA" or short interfering RNA.
[0096] It will be understood that the term "ribonucleotide" or
"nucleotide" can, in the case of a modified RNA or nucleotide
surrogate, also refer to a modified nucleotide, or surrogate
replacement moiety at one or more positions. Thus, the dsRNA is or
includes a region which is at least partially complementary to the
target RNA. In certain embodiments, the dsRNA is fully
complementary to the target RNA. It is not necessary that there be
perfect complementarity between the dsRNA and the target, but the
correspondence must be sufficient to enable the dsRNA, or a
cleavage product thereof, to direct sequence specific silencing,
such as by RNAi cleavage of the target RNA. Complementarity, or
degree of homology with the target strand, is most critical in the
antisense strand. While perfect complementarity, particularly in
the antisense strand, is often desired some embodiments can include
one or more but preferably 6, 5, 4, 3, 2, or fewer mismatches with
respect to the target RNA. The mismatches are most tolerated in the
terminal regions, and if present are preferably in a terminal
region or regions, e.g., within 6, 5, 4, or 3 nucleotides of the 5'
and/or 3' terminus. The sense strand need only be substantially
complementary with the antisense strand to maintain the overall
double-strand character of the molecule.
[0097] As used herein, "modified dsRNA" refers to a dsRNA molecule
that comprises at least one alteration that renders it more
resistant to nucleases (e.g., protein kinase) than an identical
dsRNA molecule that recognizes the same target RNA. Modified dsRNAs
may include a single-stranded nucleotide overhang and/or at least
one substituted nucleotide.
[0098] As used herein, a "nucleotide overhang" refers to the
unpaired nucleotide or nucleotides that protrude from the duplex
structure when a 3'-end of one RNA strand extends beyond the 5'-end
of the other complementary strand, or vice versa. "Blunt" or "blunt
end" means that there are no unpaired nucleotides at that end of
the dsRNA, i.e., no nucleotide overhang. A "blunt ended" dsRNA is a
dsRNA that is double stranded over its entire length, i.e., no
nucleotide overhang at either end of the molecule.
[0099] The term "terminal base pair," as used herein, refers to the
last nucleotide base pair on one end of the duplex region of a
double-stranded molecule. For example, if a dsRNA or other molecule
is blunt ended (i.e., has no nucleotide overhangs), the last
nucleotide base pairs at both ends of the molecule are terminal
base pairs. Where a dsRNA or other molecule has a nucleotide
overhang at one or both ends of the duplex structure, the last
nucleotide base pair(s) immediately adjacent the nucleotide
overhang(s) is the terminal base pair at that end(s) of the
molecule.
[0100] Also included are vector delivery systems that are capable
of expressing the oligomeric, NHR-targeted exon skipping sequences
of the present invention, such as vectors that express a
polynucleotide sequence comprising any one or more of SEQ ID
NOS:2-17 or 34-41, or variants thereof, as described herein, or
that express a polynucleotide sequence that is complementary to any
or more of the target sequences in Table 1 or set forth in SEQ ID
NO:1.
[0101] By "vector" or "nucleic acid construct" is meant a
polynucleotide molecule, preferably a DNA molecule derived, for
example, from a plasmid, bacteriophage, yeast or virus, into which
a polynucleotide can be inserted or cloned. A vector preferably
contains one or more unique restriction sites and can be capable of
autonomous replication in a defined host cell including a target
cell or tissue or a progenitor cell or tissue thereof, or be
integrable with the genome of the defined host such that the cloned
sequence is reproducible. Accordingly, the vector can be an
autonomously replicating vector, i.e., a vector that exists as an
extra-chromosomal entity, the replication of which is independent
of chromosomal replication, e.g., a linear or closed circular
plasmid, an extra-chromosomal element, a mini-chromosome, or an
artificial chromosome. The vector can contain any means for
assuring self-replication. Alternatively, the vector can be one
which, when introduced into the host cell, is integrated into the
genome and replicated together with the chromosome(s) into which it
has been integrated.
[0102] A vector or nucleic acid construct system can comprise a
single vector or plasmid, two or more vectors or plasmids, which
together contain the total DNA to be introduced into the genome of
the host cell, or a transposon. The choice of the vector will
typically depend on the compatibility of the vector with the host
cell into which the vector is to be introduced. In the present
case, the vector or nucleic acid construct is preferably one which
is operably functional in a mammalian cell, such as a muscle cell.
The vector can also include a selection marker such as an
antibiotic or drug resistance gene, or a reporter gene (i.e., green
fluorescent protein, luciferase), that can be used for selection or
identification of suitable transformants or transfectants.
Exemplary delivery systems may include viral vector systems (i.e.,
viral-mediated transduction) including, but not limited to,
retroviral (e.g., lentiviral) vectors, adenoviral vectors,
adeno-associated viral vectors, and herpes viral vectors, among
others known in the art.
[0103] The term "operably linked" as used herein means placing an
oligomer-encoding sequence under the regulatory control of a
promoter, which then controls the transcription of the
oligomer.
[0104] A wild-type gene or gene product is that which is most
frequently observed in a population and is thus arbitrarily
designed the "normal" or "wild-type" form of the gene.
[0105] "Alkyl" refers to a fully saturated monovalent radical
containing carbon and hydrogen, which may be branched, linear, or
cyclic (cycloalkyl). Examples of alkyl groups are methyl, ethyl,
n-butyl, t-butyl, n-heptyl, isopropyl, cyclopropyl, cyclopentyl,
ethylcyclopentyl, and cyclohexyl. Generally preferred are alkyl
groups having one to six carbon atoms, referred to as "lower
alkyl", and exemplified by methyl, ethyl, n-butyl, i-butyl,
t-butyl, isoamyl, n-pentyl, and isopentyl. In one embodiment, lower
alkyl refers to C.sub.1 to C.sub.4 alkyl.
[0106] "Alkenyl" refers to an unsaturated monovalent radical
containing carbon and hydrogen, which may be branched, linear, or
cyclic. The alkenyl group may be monounsaturated or
polyunsaturated. Generally preferred are alkenyl groups having one
to six carbon atoms, referred to as "lower alkenyl."
[0107] "Alkynyl" refers to an unsaturated straight or branched
chain hydrocarbon radical containing from 2 to 18 carbons
comprising at least one carbon to carbon triple bond. Examples
include without limitation ethynyl, propynyl, iso-propynyl,
butynyl, iso-butynyl, tert-butynyl, pentynyl and hexynyl. The term
"lower alkynyl" refers to an alkynyl group, as defined herein,
containing between 2 and 8 carbons.
[0108] "Cycloalkyl" refers to a mono- or poly-cyclic alkyl radical.
Examples include without limitation cyclobutyl, cycopentyl,
cyclohexyl, cycloheptyl and cyclooctyl.
[0109] "Aryl" refers to a substituted or unsubstituted monovalent
aromatic radical, generally having a single ring (e.g., phenyl) or
two condensed rings (e.g., naphthyl). This term includes heteroaryl
groups, which are aromatic ring groups having one or more nitrogen,
oxygen, or sulfur atoms in the ring, such as furyl, pyrrolyl,
pyridyl, and indolyl. By "substituted" is meant that one or more
ring hydrogens in the aryl group is replaced with a halide such as
fluorine, chlorine, or bromine; with a lower alkyl group containing
one or two carbon atoms; nitro, amino, methylamino, dimethylamino,
methoxy, halomethoxy, halomethyl, or haloethyl. Preferred
substituents include halogen, methyl, ethyl, and methoxy. Generally
preferred are aryl groups having a single ring.
[0110] "Aralkyl" refers to an alkyl, preferably lower
(C.sub.1-C.sub.4, more preferably C.sub.1-C.sub.2) alkyl,
substituent which is further substituted with an aryl group;
examples are benzyl (--CH.sub.2C.sub.6H.sub.5) and phenethyl
(--CH.sub.2CH.sub.2C.sub.6H.sub.5).
[0111] "Thioalkoxy" refers to a radical of the formula --SRc where
Rc is an alkyl radical as defined herein. The term "lower
thioalkoxy" refers to an alkoxy group, as defined herein,
containing between 1 and 8 carbons.
[0112] "Alkoxy" refers to a radical of the formula --ORda where Rd
is an alkyl radical as defined herein. The term "lower alkoxy"
refers to an alkoxy group, as defined herein, containing between 1
and 8 carbons. Examples of alkoxy groups include, without
limitation, methoxy and ethoxy.
[0113] "Alkoxyalkyl" refers to an alkyl group substituted with an
alkoxy group.
[0114] "Carbonyl" refers to the --C(.dbd.O)-- radical.
[0115] "Guanidynyl" refers to the H.sub.2N(C.dbd.NH.sub.2)--NH--
radical.
[0116] "Amidinyl" refers to the H.sub.2N(C.dbd.NH.sub.2)CH--
radical.
[0117] "Amino" refers to the --NH.sub.2 radical.
[0118] "Alkylamino" refers to a radical of the formula --NHRd or
--NRdRd where each Rd is, independently, an alkyl radical as
defined herein. The term "lower alkylamino" refers to an alkylamino
group, as defined herein, containing between 1 and 8 carbons.
[0119] "Heterocycle" means a 5- to 7-membered monocyclic, or 7- to
10-membered bicyclic, heterocyclic ring which is either saturated,
unsaturated, or aromatic, and which contains from 1 to 4
heteroatoms independently selected from nitrogen, oxygen and
sulfur, and wherein the nitrogen and sulfur heteroatoms may be
optionally oxidized, and the nitrogen heteroatom may be optionally
quaternized, including bicyclic rings in which any of the above
heterocycles are fused to a benzene ring. The heterocycle may be
attached via any heteroatom or carbon atom. Preferably, the ring
atoms include 3 to 6 carbon atoms. Such heterocycles include, for
example, pyrrolidine, piperidine, piperazine, and morpholine.
[0120] Heterocycles include heteroaryls as defined below. Thus, in
addition to the heteroaryls listed below, heterocycles also include
morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl,
piperizynyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl,
tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl,
tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydropyrimidinyl,
tetrahydrothiopyranyl, and the like.
[0121] "Heteroaryl" means an aromatic heterocycle ring of 5- to 10
members and having at least one heteroatom selected from nitrogen,
oxygen and sulfur, and containing at least 1 carbon atom, including
both mono- and bicyclic ring systems. Representative heteroaryls
are pyridyl, furyl, benzofuranyl, thiophenyl, benzothiophenyl,
quinolinyl, pyrrolyl, indolyl, oxazolyl, benzoxazolyl, imidazolyl,
benzimidazolyl, thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyl,
isothiazolyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl,
cinnolinyl, phthalazinyl, and quinazolinyl.
[0122] The term "substituted", with respect to an alkyl, alkenyl,
alkynyl, aryl, aralkyl, or alkaryl group, refers to replacement of
a hydrogen atom with a heteroatom-containing substituent, such as,
for example, halogen, hydroxy, alkoxy, thiol, alkylthio, amino,
alkylamino, imino, oxo (keto), nitro, cyano, or various acids or
esters such as carboxylic, sulfonic, or phosphonic.
[0123] The term "substituted", particularly with respect to an
alkyl, alkoxy, thioalkoxy, or alkylamino group, refers to
replacement of a hydrogen atom on carbon with a
heteroatom-containing substituent, such as, for example, halogen,
hydroxy, alkoxy, thiol, alkylthio, amino, alkylamino, imino, oxo
(keto), nitro, cyano, or various acids or esters such as
carboxylic, sulfonic, or phosphonic. It may also refer to
replacement of a hydrogen atom on a heteroatom (such as an amine
hydrogen) with an alkyl, carbonyl or other carbon containing
group.
[0124] In certain embodiments, the terms "optionally substituted
alkyl", "optionally substituted alkenyl", "optionally substituted
alkoxy", "optionally substituted thioalkoxy", "optionally
substituted alkyl amino", "optionally substituted lower alkyl",
"optionally substituted lower alkenyl", "optionally substituted
lower alkoxy", "optionally substituted lower thioalkoxy",
"optionally substituted lower alkyl amino" and "optionally
substituted heterocyclyl" mean that, when substituted, at least one
hydrogen atom is replaced with a substituent. In the case of an oxo
substituent (.dbd.O) two hydrogen atoms are replaced. In this
regard, substituents include: deuterium, optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted aryl, optionally substituted
heterocycle, optionally substituted cycloalkyl, oxo, halogen, --CN,
--ORx, NRxRy, NRxC(.dbd.O)Ry, NRxSO2Ry, --NRxC(.dbd.O)NRxRy,
C(.dbd.O)Rx, C(.dbd.O)ORx, C(.dbd.O)NRxRy, --SOmRx and --SOmNRxRy,
wherein m is 0, 1 or 2, Rx and Ry are the same or different and
independently hydrogen, optionally substituted alkyl, optionally
substituted alkenyl, optionally substituted alkynyl, optionally
substituted aryl, optionally substituted heterocycle or optionally
substituted cycloalkyl and each of said optionally substituted
alkyl, optionally substituted alkenyl, optionally substituted
alkynyl, optionally substituted aryl, optionally substituted
heterocycle and optionally substituted cycloalkyl substituents may
be further substituted with one or more of oxo, halogen, --CN,
--ORx, NRxRy, NRxC(.dbd.O)Ry, NRxSO2Ry, --NRxC(.dbd.O)NRxRy,
C(.dbd.O)Rx, C(.dbd.O)ORx, C(.dbd.O)NRxRy, --SOmRx and
--SOmNRxRy.
[0125] The selection of targeting sequences capable of inducing
exon skipping of those exons that encode all or part of an NHR
ligand-binding domain are discussed below.
Targeted NHR Genes
[0126] Embodiments of the present invention are based, in part, on
the discovery that antisense oligomer-induced exon skipping of
either of the two exons that encode the ligand-binding domain of
the glucocorticoid receptor (GR) result in the induction of an
activated, ligand-independent GR (liGR). It is fully contemplated
that similar exon skipping strategies can be employed to induce
ligand-independent steroid receptors other than GR and, more
generally, ligand-independent NHRs as a whole. A list of human
NHRSF targets and their known ligands that are considered targets
for the compositions and methods of this invention are shown below
in Table 1 (see Gronemeyer, Gustafsson et al. 2004). The sequences
of these NHRSF targets are known in the art.
TABLE-US-00001 TABLE 1 Nuclear Hormone Receptors Name Abbrev.
Nomenclature Ligand Thyroid hormone receptor TR.alpha. NR1A1
Thyroid hormone TR.beta. NR1A2 Retinoic acid receptor RAR.alpha.
NR1B1 Retinoic acid RAR.beta. NR1B2 RAR.gamma. NR1B3 Peroxisome
proliferator- activated PPAR.alpha. NR1C1 Fatty acids, leukotriene
B4, fibrates receptor PPAR.beta. NR1C2 Fatty acids Fatty acids,
PPAR.gamma. NR1C3 prostaglandin J2, Reverse erbA Rev-erb.alpha.
NR1D1 Orphan Rev-erb.beta. NR1D1 RAR-related orphan receptor
ROR.alpha. NR1F1 Cholesterol, cholesteryl sulphate ROR.beta. NR1F2
Retinoic acid ROR.gamma. NR1F3 Liver X receptor LXR.alpha. NR1H3
Oxysterols, T0901317, GW3965 LXR.beta. NR1H2 Oxysterols, T0901317,
GW3965 Farnesoid X receptor FXR.alpha. NR1H4 Bile acids, Fexaramine
Lanosterol FXR.beta. NR1H5 Vitamin D receptor VDR NR1I1
1,25-dihydroxy vitamin D3, litocholic acid Pregnane X receptor PXR
NR1I2 Xenobiotics, PCN Constitutive androstane receptor CAR NR1I3
Xenobiotics, phenobarbital Human nuclear factor 4 HNF4.alpha. NR2A1
Orphan HNF4.gamma. NR2A2 Retinoid X receptor RXR.alpha. NR2B1
Retinoic acid RXR.beta. NR2B2 RXR.gamma. NR2B3 Testis receptor TR2
NR2C1 Orphan TR4 NR2C2 Tailless TLL NR2E2 Orphan
Photoreceptor-specific nuclear PNR NR2E3 Orphan receptor Chicken
ovalbumin upstream COUP-TFI NR2F1 Orphan promoter-transcription
factor COUP-TFII NR2F2 ErbA2-related gene-2 EAR2 NR2F6 Orphan
Oestrogen receptor ER.alpha. NR3A1 Oestradiol-17.quadrature.,
tamoxifen, ER.beta. NR3A2 raloxifene Oestrogen receptor-related
ERR.alpha. NR3B1 Orphan DES, 4-OH tamoxifen DES, receptor ERR.beta.
NR3B2 4-OH tamoxifen ERR.gamma. NR3B3 Glucocorticoid receptor GR
NR3C1 Cortisol, dexamethasone, RU486 Mineralocorticoid receptor MR
NR3C2 Aldosterone, spirolactone Progesterone receptor PR NR3C3
Progesterone, medroxyprogesterone acetate, RU486 Androgen receptor
AR NR3C4 Testosterone, flutamide NGF-induced factor B NGFIB NR4A1
Orphan Nur related factor 1 NURR1 NR4A2 Orphan Neuron-derived
orphan receptor 1 NOR1 NR4A3 Orphan Steroidogenic factor 1 SF1
NR5A1 Orphan Liver receptor homologous LRH1 NR5A2 Orphan protein 1
Germ cell nuclear factor GCNF NR6A1 Orphan DSS-AHC critical region
on the DAX1 NR0B1 Orphan chromosome, gene 1 Short heterodimeric
partner SHP NR0B2 Orphan Aryl hydrocarbon receptor AHR Aromatic
hydrocarbons
[0127] Exemplary members of the steroid hormone receptor group of
NHRs and their ligand binding domains are described in more detail
below.
[0128] A. Glucocorticoid Receptor (GR)
[0129] The GR is a ligand-activated transcription factor belonging
to the NHRSF. It binds with high affinity to cortisol and other
glucocorticoids. GR is expressed in almost every cell in the body
and regulates genes controlling a wide variety of processes
including the development, metabolism, and immune response of the
organism. In the absence of hormone, GR is complexed with a variety
of heat shock proteins in the cytosol. The binding of the
glucocorticoids results in release of the heat shock proteins and
transforms it to its active state. One mechanism of action of GR is
by direct activation of gene transcription. The activated form of
GR forms dimers, translocates into the nucleus, and binds to
specific glucocorticoid responsive elements (GRE), activating gene
transcription.
[0130] The interaction of a glucocorticoid with GR can cause GR to
induce transcription of certain genes. This induction of
transcription is termed transactivation. Transactivation typically
requires dimerization of GR and binding to a glucocorticoid
response element (GRE).
[0131] GR can also function as a repressor of other gene
transcription activators, such as NF-.kappa.B and AF-1 by directly
binding to them, and blocking the expression of their activated
genes. It has been shown that glucocorticoids exert their
anti-inflammatory activity via the inhibition by GR of the
transcription factors NF-.kappa.B and AP-1. This inhibition is
termed transrepression. By this mechanism, GR is able to prevent
the transcription of pro-inflammatory genes, including interleukins
IL-1B, IL-4, IL-5, and IL-8, chemokines, cytokines, GM-CSF, and TNF
genes, among others.
[0132] It has also been shown that the primary mechanism for
inhibition of these transcription factors by GR is via a direct
physical interaction. This interaction alters the transcription
factor complex and inhibits the ability of NF-.kappa.B and AP-1 to
stimulate transcription. NF-.kappa.B and AP-1 (c-Fos/c-Jun) play
key roles in the initiation and perpetuation of inflammatory and
immunological disorders and are involved in regulating the
expression of a number of important inflammatory and
immunomodulatory genes including cytokines, chemokines, adhesion
molecules, inflammatory proteins and many others (e.g., TNF-alpha,
IL-1, IL-2, IL-5, adhesion molecules, Cox-2, and others
(Gronemeyer, Gustafsson et al. 2004; Newton, Leigh et al.
2010).
[0133] Like other members of the NHRSF of ligand-activated
transcription factors, GR has a central well conserved DNA binding
domain (DBD), a variable N-terminal domain, a flexible hinge and a
C-terminal ligand binding domain (LBD). The LBD also functions for
dimerization and chaperone protein association. Recent studies
using a transgenic GR dimerization defective mouse which cannot
bind DNA have shown that the transactivation (DNA binding)
activities of GR could be separated from the transrepressive
(non-DNA binding) effect of GR. These studies also indicate that
many of the side effects of glucocorticoid therapy are due to the
ability of GR to induce transcription of various genes involved in
metabolism, whereas, transrepression, which does not require DNA
binding leads to suppression of inflammation. See, e.g., Newton, et
al (Newton, Leigh et al. 2010).
[0134] Given the functional separation of GR transactivation and
transrepression, certain embodiments of the present invention
therefore relate to methods of modulating the splicing of GR to
produce an altered GR transcript that encodes a GR protein with
reduced transactivation activity, normal or increased
transrepression activity, or both. These and related embodiments
would reduce inflammation without the side effects of typical
glucocorticoid therapy.
[0135] B. Progesterone Receptor (Pr)
[0136] The PR is a member of the NHRSF of ligand dependent
transcription factors, mediating the biological actions of
progesterone. PR functions in a variety of biological processes
including development of the mammary gland, regulating cell cycle
progression, protein processing, and metabolism. When no binding
hormone is present the carboxyl terminal inhibits transcription.
Binding to a hormone induces a structural change that removes the
inhibitory action. After progesterone binds to the receptor, PR
forms a dimer and the complex enters the nucleus where it interacts
with the hormone response element (HRE) in the promoters of
progesterone responsive genes and alters their transcription. In
addition, rapid actions of PR that occur independent of
transcription, have also been observed in several tissues like
brain, liver, mammary gland and spermatozoa. There are two natural
PR isoforms called PR-A and PR-B. PR-B has an additional stretch of
164 amino acids at the N terminus. The extra domain in PR-B
performs activation functions by recruiting coactivators that could
not be recruited by PR-A. Like other members of the NHRSF of
ligand-activated transcription factors, PR has a central well
conserved DNA binding domain (DBD), a variable N-terminal domain, a
flexible hinge and a C-terminal ligand-binding domain (LBD). The
LBD is not only involved in binding to progesterone, but also
involved in coactivator binding and dimerization.
[0137] C. Androgen Receptor
[0138] The AR is activated by binding either of the androgenic
hormones, testosterone or dihydrotestosterone, which are
responsible for male primary sexual characteristics and for
secondary male characteristics, respectively. The primary mechanism
of action of ARs is by direct regulation of gene transcription. The
binding of an androgen results in a conformational change in AR
which causes its transport from the cytosol into the cell nucleus,
and dimerization. The receptor dimer binds to a hormone response
element of AR-regulated genes and modulates their expression.
Another mode of action is independent on interactions with DNA. The
receptors interact directly with signal transduction proteins in
the cytoplasm, causing rapid changes in cell function, such as ion
transport. Like other members of the NHRSF of ligand-activated
transcription factors, AR has a central well conserved DNA binding
domain (DBD), a variable N-terminal domain, a flexible hinge and a
C-terminal ligand binding domain (LBD). The LBD is not only
involved in binding to androgen, but also involved in binding of
coactivator proteins and dimerization. A ligand dependent nuclear
export signal is also present at the ligand binding domain.
NHR Target Selection
[0139] In certain embodiments, the exons encoding ligand binding
domains of the NHRs are the antisense or RNAi targets of the
present invention; however, other exons can also be targeted. For
NHRs generally, antisense agents can be targeted against, or be
complementary to, a variety of regions in a pre-processed mRNA. For
instance, certain antisense or RNAi agents may comprise a targeting
sequence that is complementary to a region that overlaps the splice
junction of a splice donor (SD) or splice acceptor (SA) site of
exon 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 of a NHR in Table 1,
and is complementary to a portion of an exonic region (e.g., 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, or 30 nucleotides) and a portion of an intronic region
(e.g., 8, 9, 10, 11, 12, 13, 14, 15, nucleotides) of the
pre-processed mRNA.
[0140] Certain exemplary antisense or RNAi agents may comprise a
targeting sequence that is complementary to an exonic region
defined by the first 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or
100 nucleotides (or ranges such as the first 10-30, 20-40, 30-50,
40-60, 50-70, 60-80, 80-100 nucleotides) immediately downstream of
the splice acceptor site of exon 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
or 12 of a NHR in Table 1, but either does not overlap with the
splice junction, or overlaps with the splice junction and is
complementary to about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides
of the proximal (upstream) intron. Some exemplary antisense or RNAi
agents may comprise a targeting sequence that is complementary to
an exonic region defined by the first 10, 15, 20, 25, 30, 40, 50,
60, 70, 80, 90, or 100 nucleotides (or ranges such as the first
10-30, 20-40, 30-50, 40-60, 50-70, 60-80, 80-100 nucleotides)
immediately upstream of the splice donor site of exon 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, or 12 of a selected NHR in Table 1, but
either does not overlap with the splice junction, or overlaps with
the splice junction and is complementary to about 1, 2, 3, 4, 5, 6,
7, 8, 9, or 10 nucleotides of the proximal (downstream) intron.
Certain antisense or RNAi agents are complementary to at least
about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30 or more contiguous or non-contiguous
nucleotides within these regions. These targeting strategies can be
applied to any of the NHR genes described herein (see, e.g., Table
1).
[0141] An exemplary gene that forms the basis of the experimental
evidence that supports this aspect of invention is the
glucocorticoid receptor (GR) gene. The exon structure of the murine
and human GR genes is shown in FIG. 2 along with the structure of
the human progesterone receptor gene. Human GR contains about 9
coding exons. The exons encoding the ligand binding domains of each
of the genes in FIG. 2 are indicated with arrows. Certain
experiments described herein were conducted in rats, using
antisense oligonucleotides targeted against either the murine GR
exons 6 or 7 (the murine and rat target sequences are identical)
(see, e.g., SEQ ID NOs: 16 and 13, respectively). The target
sequence for the muSA7 compound is identical in mice, rats and
humans. Exemplary sequences for targeting the human GR exons 5 and
6 are listed herein as SEQ ID NOs: 2-9 (exon 5) and SEQ ID NOs:
10-14 (exon 6). The location of these targeting sequences relative
to the human GR exon 5 and 6 splice acceptor (SA) or splice donor
sites is shown in FIG. 3. Hence, certain antisense or RNAi agents
comprise a targeting sequence that is complementary to a region of
exons 1, 2, 3, 4, 5, 6, 7, 8, or 9 of human GR, as described
herein. Certain preferred targets include exons 5, 6, or 7.
[0142] In certain embodiments, the exons in the carboxy-terminal
domain of the receptor gene are candidates for selection as targets
of the invention. The exemplary target exons shown in FIG. 2 for GR
and PR are instructive in the selection of target sequences and the
design of targeting oligomers for other NHR genes. The two or three
exons immediately upstream of the 3' terminal exon are preferred.
Listed as SEQ ID NO: 1 in the Sequence Listing is a region of human
GR pre-mRNA extending 70 bases upstream of exon 5 through intron 5
and exon 6 and extending 70 bases into intron 6. This sequence
illustrates a preferred target sequence or region for inducing exon
skipping of the two exons encoding the GR ligand-binding
domain.
[0143] Similar sequences for other NHR genes (see Table 1) can be
identified and used by skilled artisans in practicing the
invention. For instance, the human PR and AR genes have about 8
coding exons, and the TR gene as about 10 coding exons. Certain
antisense or RNAi agents may thus comprise a targeting sequence
that is complementary to a defined region of exons 1, 2, 3, 4, 5,
6, 7, or 8 of human PR or AR, or that is complementary to a defined
region of exons 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of human TR, as
described herein.
[0144] In certain embodiments, antisense targeting sequences are
designed to hybridize to a region of one or more of the target
sequences listed in Table 1, such as an exon, an intron, an
exon-intron junction, or a splice junction. The pre-mRNA sequences
of these target genes are known in the art. In certain embodiments,
the antisense sequences are designed to skip selected exons of a
NHR such as GR, and produce an altered (typically by deletion) but
functional protein. Exemplary targets for exon-skipping include
exons that encode at least a portion of an N-terminal activation or
regulatory domain, a DNA-binding domain, a ligand binding domain,
and/or a C-terminal domain. Also contemplated is the targeting of
any combination of such exons or domains.
[0145] In certain embodiments, a particular function of the NHR can
be modulated by such an approach. For instance, certain embodiments
include the targeting of selected exons of an NHR such as GR to
alter (e.g., delete) at least a portion of a domain associated with
its transactivation-related activities (i.e., transcriptional
activation), its transrepression-related activities, or both, and
thereby modulate one or both of these activities. Certain exemplary
embodiments increase or agonize the transactivation activities of
an NHR such as GR. Other embodiments decrease or antagonize the
transactivation activities of an NHR such as GR. Certain
embodiments increase or agonize the transrepression activities of
an NHR such as GR. Other embodiments decrease or antagonize the
transrepression activities of an NHR such as GR. Specific
embodiments agonize the transactivation activities of an NHR such
as GR, and also antagonize the transrepression activities of the
same NHR. Preferred embodiments antagonize the transactivation
activities of an NHR such as GR, and also agonize the
transrepression activities of the same NHR.
[0146] Selected antisense targeting sequences can be made shorter,
e.g., about 12 bases, or longer, e.g., about 40 bases, and include
a small number of mismatches, as long as the sequence is
sufficiently complementary to effect translation, splicing, and/or
other form of inhibition upon hybridization with the target, and
forms with the target RNA, a heteroduplex having a Tm of 45.degree.
C. or greater.
[0147] In certain embodiments, the degree of complementarity
between the target and antisense targeting sequence is sufficient
to form a stable duplex. The region of complementarity of the
antisense oligomers with the target RNA sequence may be as short as
8-11 bases, but is preferably 12-15 bases or more, e.g., 12-20
bases, 12-25, or 15-25 bases, including all integers in between
these ranges. An antisense oligomer of about 14-15 bases is
generally long enough to have a unique complementary sequence in
the target mRNA. In certain embodiments, a minimum length of
complementary bases may be required to achieve the requisite
binding Tm, as discussed below.
[0148] In certain embodiments, oligomers as long as 40 bases may be
suitable, where at least a minimum number of bases, e.g., 10-12
bases, are complementary to the target sequence. In general,
however, facilitated or active uptake in cells is optimized at
oligomer lengths less than about 30. For PMO oligomers, described
further below, an optimum balance of binding stability and uptake
generally occurs at lengths of 18-25 bases. Included are antisense
oligomers (e.g., PNAs, LNAs, 2'-OMe, MOE) and PMO oligomers that
consist of about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,
39, or 40 bases, in which at least about 6, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 contiguous or
non-contiguous bases are complementary to a target sequence of
Table 1 or set forth in SEQ ID NO:1, or variants thereof.
[0149] In certain embodiments, antisense oligomers may be 100%
complementary to the NHR nucleic acid target sequence, or they may
include mismatches, e.g., to accommodate variants, as long as a
heteroduplex formed between the oligomer and the target sequence is
sufficiently stable to withstand the action of cellular nucleases
and other modes of degradation which may occur in vivo. Oligomer
backbones which are less susceptible to cleavage by nucleases are
discussed below. Mismatches, if present, are less destabilizing
toward the end regions of the hybrid duplex than in the middle. The
number of mismatches allowed will depend on the length of the
oligomer, the percentage of G:C base pairs in the duplex, and the
position of the mismatch(es) in the duplex, according to well
understood principles of duplex stability. Although such an
antisense oligomer is not necessarily 100% complementary to the
target sequence, it is effective to stably and specifically bind to
the target sequence, such that a biological activity of the nucleic
acid target, e.g., expression of NHR protein(s), is modulated.
[0150] The stability of the duplex formed between an oligomer and a
target sequence is a function of the binding Tm and the
susceptibility of the duplex to cellular enzymatic cleavage. The Tm
of an antisense compound with respect to complementary-sequence RNA
may be measured by conventional methods, such as those described by
Hames et al., Nucleic Acid Hybridization, IRL Press, 1985, pp.
107-108 or as described in Miyada C. G. and Wallace R. B., 1987,
Oligonucleotide hybridization techniques, Methods Enzymol. Vol. 154
pp. 94-107. In certain embodiments, antisense oligomer may have a
binding Tm, with respect to a complementary-sequence RNA, of
greater than body temperature and preferably greater than
50.degree. C. Tm's in the range 60-80.degree. C. or greater are
preferred. According to well known principles, the Tm of an
oligomer compound, with respect to a complementary-based RNA
hybrid, can be increased by increasing the ratio of C:G paired
bases in the duplex, and/or by increasing the length (in base
pairs) of the heteroduplex. At the same time, for purposes of
optimizing cellular uptake, it may be advantageous to limit the
size of the oligomer. For this reason, compounds that show high Tm
(50.degree. C. or greater) at a length of 25 bases or less are
generally preferred over those requiring greater than 25 bases for
high Tm values.
[0151] In certain embodiments, such as PMO oligomers, the antisense
activity of an oligomer may be enhanced by using a mixture of
uncharged and cationic phosphorodiamidate linkages, as exemplified
in FIG. 1B. The total number of cationic linkages in the oligomer
can vary from 1 to 10 (including all integers in between), and be
interspersed throughout the oligomer. Preferably the number of
charged linkages is at least 2 and no more than half the total
backbone linkages, e.g., between 2, 3, 4, 5, 6, 7, or 8 positively
charged linkages, and preferably each charged linkages is separated
along the backbone by at least 1, 2, 3, 4, or 5 uncharged linkages.
The antisense activity of various oligomers can be measured in
vitro by fusing the oligomer target region to the 5' end a reporter
gene (e.g., firefly luciferase) and then measuring the inhibition
of translation of the fusion gene mRNA transcripts in cell free
translation assays. The inhibitory properties of oligomers
containing a mixture of uncharged and cationic linkages can be
enhanced between, approximately, five to 100 fold in cell free
translation assays.
[0152] Exemplary antisense sequences for inducing exon skipping of
either exon 5, 6, 7, or 8 of the human GR pre-mRNA are shown below
in Table 2.
TABLE-US-00002 TABLE 2 Exemplary Antisense Targeting Sequences SEQ
ID Sequence (5' to 3') NO: TTCGAGCTGTGGGTATTTAAAC 2
TGTTTTTCGAGCTGTGGGTATT 3 TTCTTTGTTTTTCGAGCTGTGG 4
ATTTTTTTCTTTGTTTTTCGAG 5 TTCCTTTTATTTTTTTCTTTGT 6
TCTTGTGAGACTCCTGTAGTGG 7 GCCTTTGCCCATTTCACTGCTG 8
CCTGGTATTGCCTTTGCCCATT 9 TCCTGAAACCTGAATTAAGAGA 10
TAAGTTCCTGAAACCTGAATTA 11 GGTCATCCAGGTGTAAGTTCCT 12
CATTTGGTCATCCAGGTGTAAG 13 AGGGTCATTTGGTCATCCAGGT 14
CACATCTGGTCTCATTCCAGGG 15 ATTTTTTTTCTTCGTTTTTCGAG 16
ATTTTTTTCTTCGTTTTTCGAG 17 GCAGGGTAGAGTCATTCTCTGC 34
GGTCGTACATGCAGGGTAGAGT 35 ACATTGGTCGTACATGCAGGGT 36
GAGAGAAGCAGTAAGGTTTTCA 37 CTCTTCAGACCGTCCTTAGGAA 38
GGCTCTTCAGACCGTCCTTAGG 39 AGGTCATTCTAATTTCATCAAA 40
CATGCATAGAATCCAAGAGTTT 41
Antisense Oligonucleotide Compounds
[0153] The antisense oligonucleotides of the present invention
typically (a) have the ability to be actively taken up by mammalian
cells, and (b) once taken up, form a duplex with the target RNA
with a Tm greater than about 45.degree. C. In certain embodiments,
the oligomer backbone may be substantially uncharged, and,
preferably, may be recognized as a substrate for active or
facilitated transport across the cell membrane. The ability of the
oligomer to form a stable duplex with the target RNA may also
relate to other features of the oligomer backbone, including the
length and degree of complementarity of the antisense oligomer with
respect to the target, the ratio of G:C to A:T base matches, and
the positions of any mismatched bases. The ability of the antisense
oligomer to resist cellular nucleases may promote survival and
ultimate delivery of the agent to the cell cytoplasm. Exemplary
antisense oligomer targeting sequences of the invention using the
PMO backbone chemistry are listed above in Table 2. In general, PNA
and LNA chemistries utilize shorter targeting oligomers due to
their relatively high target binding strength compared to PMO and
2'O-Me oligomers.
[0154] Peptide nucleic acids (PNAs) are analogs of DNA in which the
backbone is structurally homomorphous with a deoxyribose backbone,
consisting of N-(2-aminoethyl) glycine units to which pyrimidine or
purine bases are attached. PNAs containing natural pyrimidine and
purine bases hybridize to complementary oligonucleotides obeying
Watson-Crick base-pairing rules, and mimic DNA in terms of base
pair recognition (Egholm, Buchardt et al. 1993). The backbone of
PNAs is formed by peptide bonds rather than phosphodiester bonds,
making them well-suited for antisense applications (see structure
below). The backbone is uncharged, resulting in PNA/DNA or PNA/RNA
duplexes that exhibit greater than normal thermal stability. PNAs
are not recognized by nucleases or proteases.
[0155] PNAs are produced synthetically using any technique known in
the art. PNA is a DNA analog in which a polyamide backbone replaces
the traditional phosphate ribose ring of DNA as shown below.
##STR00002##
[0156] Despite a radical structural change to the natural
structure, PNA is capable of sequence-specific binding in a helix
form to DNA or RNA. Characteristics of PNA include a high binding
affinity to complementary DNA or RNA, a destabilizing effect caused
by single-base mismatch, resistance to nucleases and proteases,
hybridization with DNA or RNA independent of salt concentration and
triplex formation with homopurine DNA. Panagene.TM. has developed
its proprietary Bts PNA monomers (Bts; benzothiazole-2-sulfonyl
group) and proprietary oligomerisation process. The PNA
oligomerisation using Bts PNA monomers is composed of repetitive
cycles of deprotection, coupling and capping. Panagene's patents to
this technology include U.S. Pat. No. 6,969,766, U.S. Pat. No.
7,211,668, U.S. Pat. No. 7,022,851, U.S. Pat. No. 7,125,994, U.S.
Pat. No. 7,145,006 and U.S. Pat. No. 7,179,896. Representative
United States patents that teach the preparation of PNA compounds
include, but are not limited to, U.S. Pat. Nos. 5,539,082;
5,714,331; and 5,719,262, each of which is herein incorporated by
reference. Further teaching of PNA compounds can be found in
Nielsen et al., Science, 1991, 254, 1497.
[0157] Oligonucleotide compounds of the present invention may also
contain "locked nucleic acid" subunits (LNAs). The structures of
LNAs are known in the art: for example, Wengel, et al., Chemical
Communications (1998) 455; Tetrahedron (1998) 54, 3607, and
Accounts of Chem. Research (1999) 32, 301); Obika, et al.,
Tetrahedron Letters (1997) 38, 8735; (1998) 39, 5401, and
Bioorganic Medicinal Chemistry (2008)16, 9230. Exemplary,
non-limiting LNA structures are illustrated below:
##STR00003##
[0158] Compounds of the invention may incorporate one or more LNAs;
in some cases, the compounds may be entirely composed of LNAs.
Methods for the synthesis of individual LNA nucleoside subunits and
their incorporation into oligonucleotides are known in the art:
U.S. Pat. Nos. 7,572,582; 7,569,575; 7,084,125; 7,060,809;
7,053,207; 7,034,133; 6,794,499; and 6,670,461. Typical
intersubunit linkers include phosphodiester and phosphorothioate
moieties; alternatively, non-phosphorous containing linkers may be
employed. A preferred embodiment is an LNA containing compound
where each LNA subunit is separated by a DNA subunit (i.e., a
deoxyribose nucleotide). Further preferred compounds are composed
of alternating LNA and DNA subunits where the intersubunit linker
is phosphorothioate.
[0159] A preferred oligomer structure employs morpholino-based
subunits bearing base-pairing moieties, joined by uncharged
linkages, as described above. Especially preferred is a
substantially uncharged phosphorodiamidate-linked morpholino
oligomer. Morpholino oligonucleotides, including antisense
oligomers, are detailed, for example, in co-owned U.S. Pat. Nos.
5,698,685, 5,217,866, 5,142,047, 5,034,506, 5,166,315, 5,185, 444,
5,521,063, and 5,506,337, and in PCT application No. U.S. Ser. No.
08/088,339, all of which are expressly incorporated by reference
herein.
[0160] Certain properties of the morpholino-based subunits include:
the ability to be linked in a oligomeric form by stable, uncharged
backbone linkages; the ability to support a nucleotide base (e.g.,
adenine, cytosine, guanine or uracil) such that the polymer formed
can hybridize with a complementary-base target nucleic acid,
including target RNA, with high Tm, even with oligomers as short as
10-14 bases; the ability of the oligomer to be actively transported
into mammalian cells; and the ability of the oligomer:RNA
heteroduplex to resist RNase degradation.
[0161] Examples of morpholino oligonucleotides having
phosphorus-containing backbone linkages are illustrated in FIGS.
1A-1C. Especially preferred is a phosphorodiamidate-linked
morpholino oligonucleotide, as shown in FIG. 1B, which is modified,
in accordance with one aspect of the present invention, to contain
positively charged groups at preferably 10%-50% of its backbone
linkages. Morpholino oligonucleotides with uncharged backbone
linkages, including antisense oligonucleotides, are detailed, for
example, in (Summerton and Weller, 1997) and in co-owned U.S. Pat.
Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506, 5,166,315, 5,185,
444, 5,521,063, and 5,506,337, and in PCT application No. U.S. Ser.
No. 08/012,804, all of which are expressly incorporated by
reference herein.
[0162] Properties of the morpholino-based subunits include: 1) the
ability to be linked in a oligomeric form by stable, uncharged or
positively charged backbone linkages; 2) the ability to support a
nucleotide base (e.g., adenine, cytosine, guanine, thymidine,
uracil and hypoxanthine) such that the polymer formed can hybridize
with a complementary-base target nucleic acid, including target
RNA, Tm values above about 45.degree. C. in relatively short
oligonucleotides (e.g., 10-15 bases); 3) the ability of the
oligonucleotide to be actively or passively transported into
mammalian cells; and 4) the ability of the antisense
oligonucleotide:RNA heteroduplex to resist RNase and RNaseH
degradation, respectively.
[0163] Exemplary backbone structures for antisense oligonucleotides
of the claimed subject matter include the morpholino subunit types
shown in FIGS. 1D-1G, each linked by an uncharged or positively
charged, phosphorus-containing subunit linkage. FIG. 1D shows a
phosphorus-containing linkage which forms the five atom
repeating-unit backbone, where the morpholino rings are linked by a
1-atom phosphoamide linkage. FIG. 1E shows a linkage which produces
a 6-atom repeating-unit backbone. In this structure, the atom Y
linking the 5' morpholino carbon to the phosphorus group may be
sulfur, nitrogen, carbon or, preferably, oxygen. The X moiety
pendant from the phosphorus may be fluorine, an alkyl or
substituted alkyl, an alkoxy or substituted alkoxy, a thioalkoxy or
substituted thioalkoxy, or unsubstituted, monosubstituted, or
disubstituted nitrogen, including cyclic structures, such as
morpholines or piperidines. Alkyl, alkoxy and thioalkoxy preferably
include 1-6 carbon atoms. The Z moieties are sulfur or oxygen, and
are preferably oxygen.
[0164] The linkages shown in FIGS. 1F and 1G are designed for
7-atom unit-length backbones. In structure 1F, the X moiety is as
in Structure 1E, and the Y moiety may be methylene, sulfur, or,
preferably, oxygen. In Structure 1G, the X and Y moieties are as in
Structure 1E. Particularly preferred morpholino oligonucleotides
include those composed of morpholino subunit structures of the form
shown in FIG. 1E, where X.dbd.NH.sub.2, N(CH.sub.3).sub.2, or
1-piperazine or other charged group, Y.dbd.O, and Z.dbd.O.
[0165] As noted above, the substantially uncharged oligonucleotide
may be modified, in accordance with an aspect of the invention, to
include charged linkages, e.g., up to about 1 per every 2-5
uncharged linkages, such as about 4-5 per every 10 uncharged
linkages. In certain embodiments, optimal improvement in antisense
activity may be seen when about 25% of the backbone linkages are
cationic. In certain embodiments, enhancement may be seen with a
small number e.g., 10-20% cationic linkages, or where the number of
cationic linkages are in the range 50-80%, such as about 60%.
[0166] Additional experiments conducted in support of the present
invention indicate that the enhancement seen with added cationic
backbone charges may, in some cases, be further enhanced by
distributing the bulk of the charges close of the "center-region"
backbone linkages of the antisense oligonucleotide, e.g., in a
20-mer oligonucleotide with 8 cationic backbone linkages, having at
least 70% of these charged linkages localized in the 10 centermost
linkages.
[0167] In certain embodiments, the antisense compounds can be
prepared by stepwise solid-phase synthesis, employing methods
detailed in the references cited above, and below with respect to
the synthesis of oligonucleotides having a mixture or uncharged and
cationic backbone linkages. In some cases, it may be desirable to
add additional chemical moieties to the antisense compound, e.g.,
to enhance pharmacokinetics or to facilitate capture or detection
of the compound. Such a moiety may be covalently attached,
typically to a terminus of the oligomer, according to standard
synthetic methods. For example, addition of a polyethyleneglycol
moiety or other hydrophilic polymer, e.g., one having 10-100
monomeric subunits, may be useful in enhancing solubility. One or
more charged groups, e.g., anionic charged groups such as an
organic acid, may enhance cell uptake.
[0168] A reporter moiety, such as fluorescein or a radiolabeled
group, may be attached for purposes of detection. Alternatively,
the reporter label attached to the oligomer may be a ligand, such
as an antigen or biotin, capable of binding a labeled antibody or
streptavidin. In selecting a moiety for attachment or modification
of an antisense compound, it is generally of course desirable to
select chemical compounds of groups that are biocompatible and
likely to be tolerated by a subject without undesirable side
effects.
[0169] As noted above, certain of the antisense compounds can be
constructed to contain a selected number of cationic linkages
interspersed with uncharged linkages of the type described above.
The intersubunit linkages, both uncharged and cationic, preferably
are phosphorus-containing linkages, having the structure:
##STR00004##
where W is S or O, and is preferably O,
X.dbd.NR.sup.1R.sup.2 or OR.sup.6,
Y.dbd.O or NR.sup.7,
[0170] and each said linkage in the oligomer is selected from:
[0171] (a) uncharged linkage (a), where each of R.sup.1, R.sup.2,
R.sup.6 and R.sup.7 is independently selected from hydrogen and
lower alkyl;
[0172] (b1) cationic linkage (b1), where X.dbd.NR.sup.1R.sup.2 and
Y.dbd.O, and NR.sup.1R.sup.2 represents an optionally substituted
piperazino group, such that
R.sup.1R.sup.2.dbd.--CHRCHRN(R.sup.3)(R.sup.4)CHRCHR--, where
[0173] each R is independently H or CH.sub.3,
[0174] R.sup.4 is H, CH.sub.3, or an electron pair, and
[0175] R.sup.3 is selected from H, lower alkyl, e.g., CH.sub.3,
C(.dbd.NH)NH.sub.2, Z-L-NHC(.dbd.NH)NH.sub.2, and
[C(O)CHR'NH].sub.mH, where: Z is C(O) or a direct bond, L is an
optional linker up to 18 atoms in length, preferably up to 12
atoms, and more preferably up to 8 atoms in length, having bonds
selected from alkyl, alkoxy, and alkylamino, R' is a side chain of
a naturally occurring amino acid or a one- or two-carbon homolog
thereof, and m is 1 to 6, preferably 1 to 4;
[0176] (b2) cationic linkage (b2), where X.dbd.NR.sup.1R.sup.2 and
Y.dbd.O, R.sup.1.dbd.H or CH.sub.3, and
R.sup.2=LNR.sup.3R.sup.4R.sup.5, where L, R.sup.3, and R.sup.4 are
as defined above, and R.sup.5 is H, lower alkyl, or lower
(alkoxy)alkyl; and
[0177] (b3) cationic linkage (b3), where Y.dbd.NR.sup.7 and
X.dbd.OR.sup.6, and R.sup.7=LNR.sup.3R.sup.4R.sup.5, where L,
R.sup.3, R.sup.4 and R.sup.5 are as defined above, and R.sup.6 is H
or lower alkyl;
[0178] and at least one said linkage is selected from cationic
linkages (b1), (b2), and (b3).
[0179] In certain embodiments, an oligomer may include at least two
consecutive linkages of type (a) (i.e. uncharged linkages). In
further embodiments, at least 5% of the linkages in the oligomer
are cationic linkages (i.e. type (b1), (b2), or (b3)); for example,
10% to 60%, and preferably 20-50% linkages may be cationic
linkages.
[0180] In one embodiment, at least one linkage is of type (b1),
where, preferably, each R is H, R.sup.4 is H, CH.sub.3, or an
electron pair, and R.sup.3 is selected from H, lower alkyl, e.g.,
CH.sub.3, C(.dbd.NH)NH.sub.2, and C(O)-L-NHC(.dbd.NH)NH.sub.2. The
latter two embodiments of R.sup.3 provide a guanidino moiety,
either attached directly to the piperazine ring, or pendant to a
linker group L, respectively. For ease of synthesis, the variable Z
in R.sup.3 is preferably C(O) (carbonyl), as shown.
[0181] The linker group L, as noted above, contains bonds in its
backbone selected from alkyl (e.g., --CH.sub.2--CH.sub.2--), alkoxy
(--C--O--), and alkylamino (e.g., --CH.sub.2--NH--), with the
proviso that the terminal atoms in L (e.g., those adjacent to
carbonyl or nitrogen) are carbon atoms. Although branched linkages
(e.g., --CH.sub.2--CHCH.sub.3--) are possible, the linker is
preferably unbranched. In one embodiment, the linker is a
hydrocarbon linker Such a linker may have the structure
--(CH.sub.2).sub.n--, where n is 1-12, preferably 2-8, and more
preferably 2-6.
[0182] The morpholino subunits have the structure:
##STR00005##
where Pi is a base-pairing moiety, and the linkages depicted above
connect the nitrogen atom of (i) to the 5' carbon of an adjacent
subunit. The base-pairing moieties Pi may be the same or different,
and are generally designed to provide a sequence which binds to a
target nucleic acid.
[0183] The use of embodiments of linkage types (b1), (b2) and (b3)
above to link morpholino subunits may be illustrated graphically as
follows:
##STR00006##
[0184] Preferably, all cationic linkages in the oligomer are of the
same type; i.e. all of type (b1), all of type (b2), or all of type
(b3).
[0185] In further embodiments, the cationic linkages are selected
from linkages (b1') and (b1'') as shown below, where (b1'') is
referred to herein as a "Pip" linkage and (b1'') is referred to
herein as a "GuX" linkage:
##STR00007##
[0186] In the structures above, W is S or O, and is preferably O;
each of R.sup.1 and R.sup.2 is independently selected from hydrogen
and lower alkyl, and is preferably methyl; and A represents
hydrogen or a non-interfering substituent on one or more carbon
atoms in (b1') and (b1''). Preferably, the ring carbons in the
piperazine ring are unsubstituted; however, they may include
non-interfering substituents, such as methyl or fluorine.
Preferably, at most one or two carbon atoms is so substituted. In
further embodiments, at least 10% of the linkages are of type (b1')
or (b1''); for example, 10%-60% and preferably 20% to 50%, of the
linkages may be of type (b1') or (b1'').
[0187] In certain embodiments, the oligomer contains no linkages of
the type (b1') above. Alternatively, the oligomer contains no
linkages of type (b1) where each R is H, R.sup.3 is H or CH.sub.3,
and R.sup.4 is H, CH.sub.3, or an electron pair.
[0188] The morpholino subunits may also be linked by
non-phosphorus-based intersubunit linkages, as described further
below, where at least one linkage is modified with a pendant
cationic group as described above.
[0189] Other oligonucleotide analog linkages which are uncharged in
their unmodified state but which could also bear a pendant amine
substituent could be used. For example, a 5'nitrogen atom on a
morpholino ring could be employed in a sulfamide linkage or a urea
linkage (where phosphorus is replaced with carbon or sulfur,
respectively) and modified in a manner analogous to the 5'-nitrogen
atom in structure (b3) above.
[0190] Oligomers having any number of cationic linkages are
provided, including fully cationic-linked oligomers. Preferably,
however, the oligomers are partially charged, having, for example,
10%-80%. In preferred embodiments, about 10% to 60%, and preferably
20% to 50% of the linkages are cationic.
[0191] In one embodiment, the cationic linkages are interspersed
along the backbone. The partially charged oligomers preferably
contain at least two consecutive uncharged linkages; that is, the
oligomer preferably does not have a strictly alternating pattern
along its entire length.
[0192] Also considered are oligomers having blocks of cationic
linkages and blocks of uncharged linkages; for example, a central
block of uncharged linkages may be flanked by blocks of cationic
linkages, or vice versa. In one embodiment, the oligomer has
approximately equal-length 5', 3' and center regions, and the
percentage of cationic linkages in the center region is greater
than about 50%, preferably greater than about 70%.
[0193] Oligomers for use in antisense applications generally range
in length from about 10 to about 40 subunits, more preferably about
10 to 30 subunits, and typically 15-25 bases. For example, an
oligomer of the invention having 19-20 subunits, a useful length
for an antisense compound, may ideally have two to ten, e.g., four
to eight, cationic linkages, and the remainder uncharged linkages.
An oligomer having 14-15 subunits may ideally have two to seven,
e.g., 3, 4, or 5, cationic linkages and the remainder uncharged
linkages.
[0194] Each morpholino ring structure supports a base pairing
moiety, to form a sequence of base pairing moieties which is
typically designed to hybridize to a selected antisense target in a
cell or in a subject being treated. The base pairing moiety may be
a purine or pyrimidine found in native DNA or RNA (e.g., A, G, C, T
or U) or an analog, such as hypoxanthine (the base component of the
nucleoside inosine) or 5-methyl cytosine.
Peptide Transporters
[0195] In certain embodiments, the antisense compounds of the
invention may include an oligonucleotide moiety conjugated to an
arginine-rich peptide transport moiety effective to enhance
transport of the compound into cells. The transport moiety may be
attached to a terminus of the oligomer, as shown, for example, in
FIG. 1C. The peptide transport moiety preferably comprises 6 to 16
subunits selected from X' subunits, Y' subunits, and Z' subunits,
where
[0196] (a) each X' subunit independently represents lysine,
arginine or an arginine analog, said analog being a cationic
.alpha.-amino acid comprising a side chain of the structure
R.sup.1N.dbd.C(NH.sub.2)R.sup.2, where R.sup.1 is H or R; R.sup.2
is R, NH.sub.2, NHR, or NR.sub.2, where R is lower alkyl or lower
alkenyl and may further include oxygen or nitrogen; R.sup.1 and
R.sup.2 may together form a ring; and the side chain is linked to
said amino acid via R.sup.1 or R.sup.2;
[0197] (b) each Y' subunit independently represents a neutral amino
acid --C(O)--(CHR).sub.n--NH--, where n is 2 to 7 and each R is
independently H or methyl; and
[0198] (c) each Z' subunit independently represents an
.alpha.-amino acid having a neutral aralkyl side chain;
[0199] wherein the peptide comprises a sequence represented by one
of (X'Y'X').sub.p, (X'Y').sub.m, and (X'Z'Z').sub.p, where p is 2
to 5 and m is 2 to 8. Certain embodiments include various
combinations selected independently from (X'Y'X').sub.p,
(X'Y').sub.m, and/or (X'Z'Z').sub.p, including, for example,
peptides having the sequence (X'Y'X')(X'Z'Z')(X'Y'X')(X'Z'Z') (SEQ
ID NO:31).
[0200] In selected embodiments, for each X', the side chain moiety
is guanidyl, as in the amino acid subunit arginine (Arg). In
further embodiments, each Y' is --CO--(CH.sub.2).sub.n--CHR--NH--,
where n is 2 to 7 and R is H. For example, when n is 5 and R is H,
Y' is a 6-aminohexanoic acid subunit, abbreviated herein as Ahx;
when n is 2 and R is H, Y' is a .beta.-alanine subunit, abbreviated
herein as B. Certain embodiments relate to carrier peptides having
a combination of different neutral amino acids, including, for
example, peptides comprising the sequence -RAhxRRBRRAhxRRBRAhxB-
(SEQ ID NO:26), which contains both .beta.-alanine and
6-aminohexanoic acid.
[0201] Preferred peptides of this type include those comprising
arginine dimers alternating with single Y' subunits, where Y' is
preferably Ahx. Examples include peptides having the formula
(RY'R).sub.p or the formula (RRY').sub.p, where Y' is preferably
Ahx. In one embodiment, Y' is a 6-aminohexanoic acid subunit, R is
arginine and p is 4.
[0202] Certain embodiments include various linear combinations of
at least two of (RY'R).sub.p and (RRY').sub.p, including, for
example, illustrative peptides having the sequence
(RY'R)(RRY')(RY'R)(RRY') (SEQ ID NO:32), or (RRY')(RY'R)(RRY') (SEQ
ID NO:33). Other combinations are contemplated. In a further
illustrative embodiment, each Z' is phenylalanine, and m is 3 or
4.
[0203] The conjugated peptide is preferably linked to a terminus of
the oligomer via a linker Ahx-B, where Ahx is a 6-aminohexanoic
acid subunit and B is a .beta.-alanine subunit, as shown, for
example, in FIG. 1C.
[0204] In selected embodiments, for each X', the side chain moiety
is independently selected from the group consisting of guanidyl
(HN.dbd.C(NH.sub.2)NH--), amidinyl (HN.dbd.C(NH.sub.2)C<),
2-aminodihydropyrimidyl, 2-aminotetrahydropyrimidyl,
2-aminopyridinyl, and 2-aminopyrimidonyl, and it is preferably
selected from guanidyl and amidinyl. In one embodiment, the side
chain moiety is guanidyl, as in the amino acid subunit arginine
(Arg).
[0205] In certain embodiments, the Y' subunits may be either
contiguous, in that no X' subunits intervene between Y' subunits,
or interspersed singly between X' subunits. In certain embodiments,
the linking subunit may be between Y' subunits. In one embodiment,
the Y' subunits are at a terminus of the transporter; in other
embodiments, they are flanked by X' subunits. In further preferred
embodiments, each Y' is --CO--(CH.sub.2).sub.n--CHR--NH--, where n
is 2 to 7 and R is H. For example, when n is 5 and R is H, Y' is a
6-aminohexanoic acid subunit, abbreviated herein as Ahx.
[0206] In selected embodiments of this group, each X' comprises a
guanidyl side chain moiety, as in an arginine subunit. Preferred
peptides of this type include those comprising arginine dimers
alternating with single Y' subunits, where Y' is preferably Ahx.
Examples include peptides having the formula (RY'R).sub.4 or the
formula (RRY').sub.4, where Y' is preferably Ahx. In the latter
case, the nucleic acid analog is preferably linked to a terminal Y'
subunit, preferably at the C-terminus, as shown, for example, in
FIG. 1C. The preferred linker is of the structure AhxB, where Ahx
is a 6-aminohexanoic acid subunit and B is a .beta.-alanine
subunit.
[0207] The transport moieties as described herein have been shown
to greatly enhance cell entry of attached oligomers, relative to
uptake of the oligomer in the absence of the attached transport
moiety, and relative to uptake by an attached transport moiety
lacking the hydrophobic subunits Y'. Such enhanced uptake is
preferably evidenced by at least a two-fold increase, and
preferably a four-fold increase, in the uptake of the compound into
mammalian cells relative to uptake of the agent by an attached
transport moiety lacking the hydrophobic subunits Y'. Uptake is
preferably enhanced at least twenty fold, and more preferably forty
fold, relative to the unconjugated compound.
[0208] A further benefit of the transport moiety is its expected
ability to stabilize a duplex between an antisense compound and its
target nucleic acid sequence, presumably by virtue of electrostatic
interaction between the positively charged transport moiety and the
negatively charged nucleic acid. The number of charged subunits in
the transporter is less than 14, as noted above, and preferably
between 8 and 11.
[0209] The use of arginine-rich peptide transporters (i.e.,
cell-penetrating peptides) are particularly useful in practicing
certain embodiments of the present invention. Certain peptide
transporters have been shown to be highly effective at delivery of
antisense compounds into primary cells including hematopoietic and
muscle cells (Marshall, Oda et al. 2007; Jearawiriyapaisarn,
Moulton et al. 2008; Wu, Moulton et al. 2008). Furthermore,
compared to other known peptide transporters such as Penetratin and
the Tat peptide, the peptide transporters described herein, when
conjugated to an antisense PMO, demonstrate an enhanced ability to
alter splicing of several gene transcripts (Marshall, Oda et al.
2007). Exemplary peptide transporters, including linkers (B or
AhxB) are shown in Table 3 below. Especially preferred are the
P007, CP04057, and CP06062 transport peptides (SEQ ID NOS:21, 25,
and 26, respectively).
TABLE-US-00003 TABLE 3 Exemplary Peptide Transporters SEQ Sequence
ID Peptide (N-terminal to C-terminal) NO: rTAT RRRQRRKKRC 18
R.sub.9F.sub.2 RRRRRRRRRFFC 19 (RRAhx).sub.4B RRAhxRRAhxRRAhxRRAhxB
20 (RAhxR).sub.4AhxB; RAhxRRAhxRRAhxRRAhxRAhxB 21 (P007)
(AhxRR).sub.4AhxB AhxRRAhxRRAhxRRAhxRRAhxB 22 (RAhx).sub.6B
RAhxRAhxRAhxRAhxRAhxRAhxB 23 (RAhx).sub.8B RAhxRAhxRAhxRAhxRAhxRAhx
24 RAhxRahxB (RAhxR).sub.5AhxB RAhxRRAhxRRAhxRRAhxRRAhx 25
(CP04057) RAhxB (RAhxRRBR).sub.2AhxB; RAhxRRBRRAhxRRBRAhxB 26
(CP06062)
RNA Interference Agents
[0210] The NHR target regions described herein may also be targeted
by a variety of RNA interference-based methods. RNA interference
(RNAi) is an evolutionarily conserved gene-silencing mechanism,
originally discovered in studies of the nematode Caenorhabditis
elegans (Lee et al, Cell 75:843, 1993; Reinhart et al., Nature
403:901, 2000). It may be triggered by introducing dsRNA into cells
expressing the appropriate molecular machinery, which then degrades
the corresponding endogenous mRNA. The mechanism involves
conversion of dsRNA into short RNAs that direct ribonucleases to
homologous mRNA targets (summarized, Ruvkun, Science 2294:797,
2001).
[0211] In certain embodiments, the methods provided herein may
utilize double-stranded ribonucleic acid (dsRNA) molecules as NHR
modulating agents. dsRNAs generally comprise two single strands.
One strand of the dsRNA comprises a nucleotide sequence that is
substantially identical to a portion of the target gene or target
region (the "sense" strand), and the other strand (the
"complementary" or "antisense" strand) comprises a sequence that is
substantially complementary to a portion of the target region. The
strands are sufficiently complementary to hybridize to form a
duplex structure. In certain embodiments, the complementary RNA
strand may be less than 30 nucleotides, less than 25 nucleotides in
length, or even 19 to 24 nucleotides in length. In certain aspects,
the complementary nucleotide sequence may be 20-23 nucleotides in
length, or 22 nucleotides in length.
[0212] In certain embodiments, at least one of the RNA strands
comprises a nucleotide overhang of 1 to 4 nucleotides in length. In
other embodiments, the dsRNA may further comprise at least one
chemically modified nucleotide. In certain aspects, a dsRNA
comprising a single-stranded overhang of 1 to 4 nucleotides may
comprise a molecule wherein the unpaired nucleotide of the
single-stranded overhang that is directly adjacent to the terminal
nucleotide pair contains a purine base. In other aspects, the last
complementary nucleotide pairs on both ends of a dsRNA are a G-C
pair, or, at least two of the last four terminal nucleotide pairs
are G-C pairs.
[0213] Certain embodiments of the present invention may comprise
microRNAs. Micro-RNAs represent a large group of small RNAs
produced naturally in organisms, some of which regulate the
expression of target genes. Micro-RNAs are formed from an
approximately 70 nucleotide single-stranded hairpin precursor
transcript by Dicer. (V. Ambros et al. Current Biology 13:807,
2003). Micro-RNAs are not translated into proteins, but instead
bind to specific messenger RNAs, thereby blocking translation. It
is thought that micro-RNAs base-pair imprecisely with their targets
to inhibit translation. Certain micro-RNAs may be transcribed as
hairpin RNA precursors, which are then processed to their mature
forms by Dicer enzyme.
[0214] In certain embodiments, the modulating agent, or RNAi
oligonucleotide, is single stranded. In other embodiments, the
modulating agent, or RNAi oligonucleotide, is double stranded.
Certain embodiments may also employ short-interfering RNAs (siRNA).
In certain embodiments, the first strand of the double-stranded
oligonucleotide contains two more nucleoside residues than the
second strand. In other embodiments, the first strand and the
second strand have the same number of nucleosides; however, the
first and second strands are offset such that the two terminal
nucleosides on the first and second strands are not paired with a
residue on the complimentary strand. In certain instances, the two
nucleosides that are not paired are thymidine resides.
[0215] In instances when the modulating agent comprises siRNA, the
agent should include a region of sufficient homology to the target
region, and be of sufficient length in terms of nucleotides, such
that the siRNA agent, or a fragment thereof, can mediate down
regulation of the target RNA. It will be understood that the term
"ribonucleotide" or "nucleotide" can, in the case of a modified RNA
or nucleotide surrogate, also refer to a modified nucleotide, or
surrogate replacement moiety at one or more positions. Thus, an
siRNA agent is or includes a region which is at least partially
complementary to the target RNA. It is not necessary that there be
perfect complementarity between the siRNA agent and the target, but
the correspondence must be sufficient to enable the siRNA agent, or
a cleavage product thereof, to direct sequence specific silencing,
such as by RNAi cleavage of the target RNA. Complementarity, or
degree of homology with the target strand, is most critical in the
antisense strand. While perfect complementarity, particularly in
the antisense strand, is often desired some embodiments include one
or more but preferably 10, 8, 6, 5, 4, 3, 2, or fewer mismatches
with respect to the target RNA. The mismatches are most tolerated
in the terminal regions, and if present are preferably in a
terminal region or regions, e.g., within 6, 5, 4, or 3 nucleotides
of the 5' and/or 3' terminus. The sense strand need only be
sufficiently complementary with the antisense strand to maintain
the over all double-strand character of the molecule.
[0216] In addition, an siRNA modulating agent may be modified or
include nucleoside surrogates. Single stranded regions of an siRNA
agent may be modified or include nucleoside surrogates, e.g., the
unpaired region or regions of a hairpin structure, e.g., a region
which links two complementary regions, can have modifications or
nucleoside surrogates. Modification to stabilize one or more 3'- or
5'-terminus of an siRNA agent, e.g., against exonucleases, or to
favor the antisense siRNA agent to enter into RISC are also useful.
Modifications can include C3 (or C6, C7, C12) amino linkers, thiol
linkers, carboxyl linkers, non-nucleotidic spacers (C3, C6, C9,
C12, abasic, triethylene glycol, hexaethylene glycol), special
biotin or fluorescein reagents that come as phosphoramidites and
that have another DMT-protected hydroxyl group, allowing multiple
couplings during RNA synthesis.
[0217] siRNA agents may include, for example, molecules that are
long enough to trigger the interferon response (which can be
cleaved by Dicer (Bernstein et al. 2001. Nature, 409:363-366) and
enter a RISC (RNAi-induced silencing complex)), in addition to
molecules which are sufficiently short that they do not trigger the
interferon response (which molecules can also be cleaved by Dicer
and/or enter a RISC), e.g., molecules which are of a size which
allows entry into a RISC, e.g., molecules which resemble
Dicer-cleavage products. Molecules that are short enough that they
do not trigger an interferon response are termed siRNA agents or
shorter RNAi agents herein. "siRNA agent or shorter RNAi agent" as
used refers to an siRNA agent that is sufficiently short that it
does not induce a deleterious interferon response in a human cell,
e.g., it has a duplexed region of less than 60 but preferably less
than 50, 40, or 30 nucleotide pairs. An siRNA modulating agent, or
a cleavage product thereof, can down regulate a target gene, e.g.,
by inducing RNAi with respect to a target RNA.
[0218] Each strand of an siRNA modulating agent can be equal to or
less than 35, 30, 25, 24, 23, 22, 21, or 20 nucleotides in length.
The strand is preferably at least 19 nucleotides in length. For
example, each strand can be between 21 and 25 nucleotides in
length. Preferred siRNA agents have a duplex region of 17, 18, 19,
29, 21, 22, 23, 24, or 25 nucleotide pairs, and one or more
overhangs, preferably one or two 3' overhangs, of 2-3
nucleotides.
[0219] In addition to homology to target RNA and the ability to
down regulate a target gene, an siRNA modulating agent may have one
or more of the following properties: it may, despite modifications,
even to a very large number, or all of the nucleosides, have an
antisense strand that can present bases (or modified bases) in the
proper three dimensional framework so as to be able to form correct
base pairing and form a duplex structure with a homologous target
RNA which is sufficient to allow down regulation of the target,
e.g., by cleavage of the target RNA; it may, despite modifications,
even to a very large number, or all of the nucleosides, still have
"RNA-like" properties, i.e., it may possess the overall structural,
chemical and physical properties of an RNA molecule, even though
not exclusively, or even partly, of ribonucleotide-based content.
For example, an siRNA agent can contain, e.g., a sense and/or an
antisense strand in which all of the nucleotide sugars contain
e.g., 2' fluoro in place of 2' hydroxyl. This
deoxyribonucleotide-containing agent can still be expected to
exhibit RNA-like properties. While not wishing to be bound by
theory, the electronegative fluorine prefers an axial orientation
when attached to the C2' position of ribose. This spatial
preference of fluorine can, in turn, force the sugars to adopt a
C.sub.3'-endo pucker. This is the same puckering mode as observed
in RNA molecules and gives rise to the RNA-characteristic
A-family-type helix. Further, since fluorine is a good hydrogen
bond acceptor, it can participate in the same hydrogen bonding
interactions with water molecules that are known to stabilize RNA
structures. Generally, it is preferred that a modified moiety at
the 2' sugar position will be able to enter into H-bonding which is
more characteristic of the OH moiety of a ribonucleotide than the H
moiety of a deoxyribonucleotide.
[0220] A "single strand RNAi agent" as used herein, is an RNAi
agent which is made up of a single molecule. It may include a
duplexed region, formed by intra-strand pairing, e.g., it may be,
or include, a hairpin or pan-handle structure. Single strand RNAi
modulating agents are preferably antisense with regard to the
target molecule. A single strand RNAi agent should be sufficiently
long that it can enter the RISC and participate in RISC mediated
cleavage of a target mRNA. A single strand RNAi agent is at least
14, and more preferably at least 15, 20, 25, 29, 35, 40, or 50
nucleotides in length. It is preferably less than 200, 100, or 60
nucleotides in length.
[0221] Hairpin RNAi modulating agents may have a duplex region
equal to or at least 17, 18, 19, 29, 21, 22, 23, 24, or 25
nucleotide pairs. The duplex region may preferably be equal to or
less than 200, 100, or 50, in length. Certain ranges for the duplex
region are 15-30, 17 to 23, 19 to 23, and 19 to 21 nucleotides
pairs in length. The hairpin may have a single strand overhang or
terminal unpaired region, preferably the 3', and preferably of the
antisense side of the hairpin. In certain embodiments, overhangs
are 2-3 nucleotides in length.
[0222] Certain modulating agents utilized according to the methods
provided herein may comprise RNAi oligonucleotides such as chimeric
oligonucleotides, or "chimeras," which contain two or more
chemically distinct regions, each made up of at least one monomer
unit, i.e., a nucleotide in the case of an oligonucleotide
compound. These oligonucleotides typically contain at least one
region wherein the oligonucleotide is modified so as to confer upon
the oligonucleotide increased resistance to nuclease degradation,
increased cellular uptake, and/or increased binding affinity for
the target nucleic acid. Consequently, comparable results can often
be obtained with shorter oligonucleotides when chimeric
oligonucleotides are used, compared to phosphorothioate
oligodeoxynucleotides. Chimeric oligonucleotides may be formed as
composite structures of two or more oligonucleotides, modified
oligonucleotides, oligonucleotides and/or oligonucleotide mimetics
as described above. Such oligonucleotides have also been referred
to in the art as hybrids or gapmers. Representative United States
patents that teach the preparation of such hybrid structures
include, but are not limited to, U.S. Pat. Nos. 5,013,830;
5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133;
5,565,350; 5,623,065; 5,652,355; 5,652,356; 5,700,922; and
5,955,589, each of which is herein incorporated by reference. In
certain embodiments, the chimeric oligonucleotide is RNA-DNA,
DNA-RNA, RNA-DNA-RNA, DNA-RNA-DNA, or RNA-DNA-RNA-DNA, wherein the
oligonucleotide is between 5 and 60 nucleotides in length.
[0223] In one aspect of the invention, modulating agents, such as
RNAi agents, relate to an oligonucleotide comprising at least one
ligand tethered to an altered or non-natural nucleobase. A large
number of compounds can function as the altered base. The structure
of the altered base is important to the extent that the altered
base should not substantially prevent binding of the
oligonucleotide to its target, e.g., mRNA. In certain embodiments,
the altered base is difluorotolyl, nitropyrrolyl, nitroimidazolyl,
nitroindolyl, napthalenyl, anthrancenyl, pyridinyl, quinolinyl,
pyrenyl, or the divalent radical of any one of the non-natural
nucleobases described herein. In certain embodiments, the
non-natural nucleobase is difluorotolyl, nitropyrrolyl, or
nitroimidazolyl. In certain embodiments, the non-natural nucleobase
is difluorotolyl. A wide variety of ligands are known in the art
and are amenable to the present invention. For example, the ligand
can be a steroid, bile acid, lipid, folic acid, pyridoxal, B12,
riboflavin, biotin, aromatic compound, polycyclic compound, crown
ether, intercalator, cleaver molecule, protein-binding agent, or
carbohydrate. In certain embodiments, the ligand is a steroid or
aromatic compound. In certain instances, the ligand is
cholesteryl.
[0224] In other embodiments, the RNAi agent is an oligonucleotide
tethered to a ligand for the purposes of improving cellular
targeting and uptake. For example, an RNAi agent may be tethered to
an antibody, or antigen binding fragment thereof. As an additional
example, an RNAi agent may be tethered to a specific ligand binding
molecule, such as a polypeptide or polypeptide fragment that
specifically binds a particular cell-surface receptor.
[0225] In other embodiments, the modulating agent comprises a
non-natural nucleobase. In certain embodiments, the non-natural
nucleobase is difluorotolyl, nitroimidazolyl, nitroindolyl, or
nitropyrrolyl. In certain embodiments, the modulating agents
provided herein relate to a double-stranded oligonucleotide
sequence, wherein only one of the two strands contains a
non-natural nucleobase. In certain embodiments, the modulating
agents as used herein relate to a double-stranded oligonucleotide
sequence, wherein both of the strands independently comprise at
least one non-natural nucleobase.
[0226] In certain instances, the ribose sugar moiety that naturally
occurs in nucleosides is replaced with a hexose sugar. In certain
aspects, the hexose sugar is an allose, altrose, glucose, mannose,
gulose, idose, galactose, talose, or a derivative thereof. In a
preferred embodiment, the hexose is a D-hexose. In certain
instances, the ribose sugar moiety that naturally occurs in
nucleosides is replaced with a polycyclic heteroalkyl ring or
cyclohexenyl group. In certain instances, the polycyclic
heteroalkyl group is a bicyclic ring containing one oxygen atom in
the ring. In certain instances, the polycyclic heteroalkyl group is
a bicyclo[2.2.1]heptane, a bicyclo[3.2.1]octane, or a
bicyclo[3.3.1]nonane. In certain embodiments, the backbone of the
oligonucleotide has been modified to improve the therapeutic or
diagnostic properties of the oligonucleotide compound. In certain
embodiments, at least one of the bases or at least one of the
sugars of the oligonucleotide has been modified to improve the
therapeutic or diagnostic properties of the oligonucleotide
compound. In instances when the oligonucleotide is double stranded,
the two strands are complementary, partially complementary, or
chimeric oligonucleotides.
[0227] Examples of modified RNAi agents envisioned for use in the
methods of the present invention include oligonucleotides
containing modified backbones or non-natural internucleoside
linkages. As defined here, oligonucleotides having modified
backbones or internucleoside linkages include those that retain a
phosphorus atom in the backbone and those that do not have a
phosphorus atom in the backbone. Modified oligonucleotides that do
not have a phosphorus atom in their intersugar backbone can also be
considered to be oligonucleotides. Specific oligonucleotide
chemical modifications are described below. It is not necessary for
all positions in a given compound to be uniformly modified, and in
fact more than one of the following modifications may be
incorporated in a single oligonucleotide compound or even in a
single nucleotide thereof
[0228] Examples of modified internucleoside linkages or backbones
include, for example, phosphorothioates, chiral phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonates and chiral phosphonates, phosphinates,
phosphoramidates including 3'-amino phosphoramidate and
aminoalkylphosphoramidates, thionophosphoramidates,
thionoalkylphosphonates, thionoalklyphosphotriesters, and
boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs
of these, and those having inverted polarity wherein the adjacent
pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to
5'-2'. Various salts, mixed salts and free-acid forms are also
included.
[0229] Representative United States patents that teach the
preparation of the above phosphorus atom-containing linkages
include, but are not limited to, U.S. Pat. Nos. 3,687,808;
4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423;
5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939;
5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821;
5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050;
and 5,697,248, each of which is herein incorporated by
reference.
[0230] Examples of modified internucleoside linkages or backbones
that do not include a phosphorus atom therein (i.e.,
oligonucleotides) have backbones that are formed by short chain
alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl
or cycloalkyl intersugar linkages, or one or more short chain
heteroatomic or heterocyclic intersugar linkages. These include
those having morpholino linkages (formed in part from the sugar
portion of a nucleoside); siloxane backbones; sulfide, sulfoxide
and sulfone backbones; formacetyl and thioformacetyl backbones;
methylene formacetyl and thioformacetyl backbones; alkene
containing backbones; sulfamate backbones; methyleneimino and
methylenehydrazino backbones; sulfonate and sulfonamide backbones;
amide backbones; and others having mixed N, O, S and CH.sub.2
component parts.
[0231] Representative United States patents that teach the
preparation of the above oligonucleotides include, but are not
limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and
5,677,439, each of which is herein incorporated by reference.
[0232] In other examples of oligonucleotide mimetics, both the
sugar and the internucleoside linkage, i.e., the backbone, of the
nucleoside units may be replaced with novel groups. The nucleobase
units are maintained for hybridization with an appropriate nucleic
acid target compound. One such oligonucleotide, an oligonucleotide
mimetic, that has been shown to have excellent hybridization
properties, is referred to as a peptide nucleic acid (PNA). In PNA
compounds, the sugar-backbone of an oligonucleotide is replaced
with an amide-containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to atoms of the amide portion of the
backbone. Representative United States patents that teach the
preparation of PNA compounds include, but are not limited to, U.S.
Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is
herein incorporated by reference. Further teaching of PNA compounds
can be found in Nielsen et al., Science, 1991, 254, 1497.
[0233] The present invention further encompasses oligonucleotides
employing ribozymes. Synthetic RNA molecules and derivatives
thereof that catalyze highly specific endoribonuclease activities
are known as ribozymes. (See, generally, U.S. Pat. No. 5,543,508 to
Haseloff et al., and U.S. Pat. No. 5,545,729 to Goodchild et al.)
The cleavage reactions are catalyzed by the RNA molecules
themselves. In naturally occurring RNA molecules, the sites of
self-catalyzed cleavage are located within highly conserved regions
of RNA secondary structure (Buzayan et al., Proc. Natl. Acad. Sci.
U.S.A., 1986, 83, 8859; Forster et al., Cell, 1987, 50, 9).
Naturally occurring autocatalytic RNA molecules have been modified
to generate ribozymes which can be targeted to a particular
cellular or pathogenic RNA molecule with a high degree of
specificity. Thus, ribozymes serve the same general purpose as
antisense oligonucleotides (i.e., modulation of expression of a
specific gene) and, like oligonucleotides, are nucleic acids
possessing significant portions of single-strandedness. That is,
ribozymes have substantial chemical and functional identity with
oligonucleotides and are thus considered to be equivalents for
purposes of the present invention.
[0234] In certain instances, the RNAi agents for use with the
methods provided herein may be modified by non-ligand group. A
number of non-ligand molecules have been conjugated to
oligonucleotides in order to enhance the activity, cellular
distribution, cellular targeting, or cellular uptake of the
oligonucleotide, and procedures for performing such conjugations
are available in the scientific literature. Such non-ligand
moieties have included lipid moieties, such as cholesterol
(Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553),
cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994,
4:1053), a thioether, e.g., hexyl-5-tritylthiol (Manoharan et al.,
Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med.
Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al.,
Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g.,
dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J.,
1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk
et al., Biochimie, 1993, 75:49), a phospholipid, e.g.,
di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res.,
1990, 18:3777), a polyamine or a polyethylene glycol chain
(Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or
adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995,
36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta,
1995, 1264:229), or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277:923). Representative United States
patents that teach the preparation of such oligonucleotide
conjugates have been listed above. Typical conjugation protocols
involve the synthesis of oligonucleotides bearing an aminolinker at
one or more positions of the sequence. The amino group is then
reacted with the molecule being conjugated using appropriate
coupling or activating reagents. The conjugation reaction may be
performed either with the oligonucleotide still bound to the solid
support or following cleavage of the oligonucleotide in solution
phase. Purification of the oligonucleotide conjugate by HPLC
typically affords the pure conjugate.
[0235] Additional examples of modulating agents, such as RNAi
oligonucleotides, may be found in U.S. Application Publication Nos.
2007/0275465, 2007/0054279, 2006/0287260, 2006/0035254,
2006/0008822, which are incorporated by reference.
Methods of Use
[0236] In another aspect, the present invention relates to methods
of using the NHR-targeted antisense or RNAi agents described herein
for treating a cell, tissue or subject, typically to modulate the
activity of an NHR in a therapeutically beneficial manner. The
cells or tissue that may be modulated by the present invention are
preferably mammalian cells, or more preferably human cells. Such
cells can be of a healthy state or of a diseased state.
[0237] In certain embodiments, for example, methods are provided
for modulating therapeutically relevant cellular activities
including, but not limited to, cellular metabolism, cell
differentiation, cell proliferation, cell death, cell mobilization,
cell migration, immune system function (e.g., inflammation,
auto-immunity), gene transcription, mRNA translation, cell
impedance, cytokine production, and the like, comprising contacting
a cell with an NHR-targeted antisense or RNAi agent as described
herein.
[0238] Specific embodiments relate to modulating the activity of
the glucocorticoid receptor (GR). For example, by antagonizing
transactivation, certain GR-targeted antisense or RNAi agents may
be employed to treat metabolic diseases associated with increased
levels of glucocorticoid, such as diabetes, osteoporosis and
glaucoma, among others. Preferred embodiments agonize
transrepression, and optionally antagonize transactivation. These
and related embodiments may be useful in the treatment of
inflammatory conditions.
[0239] As another example, by agonizing transactivation, certain
GR-targeted antisense or RNAi agents may be employed to treated
metabolic diseases associated with a deficiency in glucocorticoid,
such as Addison's disease and others. Such embodiments may also be
used as pro-inflammatory agents, to increase inflammatory responses
in a subject in need thereof, as exemplified herein.
[0240] As noted above, certain preferred embodiments relate to the
modulation of inflammation. Certain embodiments include methods of
decreasing inflammation, and depending on the needs of the subject
and the selection of the target sequence, other embodiments include
methods of increasing inflammation or inflammatory responses.
"Inflammation" refers generally to the biological response of
tissues to harmful stimuli, such as pathogens, damaged cells (e.g.,
wounds), and irritants. The term "inflammatory response" refers to
the specific mechanisms by which inflammation is achieved and
regulated, including, merely by way of illustration, immune cell
activation or migration, cytokine production, vasodilation,
including kinin release, fibrinolysis, and coagulation, among
others described herein and known in the art. Ideally, inflammation
is a protective attempt by the body to both remove the injurious
stimuli and initiate the healing process for the affected tissue or
tissues. In the absence of inflammation, wounds and infections
would never heal, creating a situation in which progressive
destruction of the tissue would threaten survival. On the other
hand, excessive or chronic inflammation may associate with a
variety of diseases, such as hay fever, atherosclerosis, and
rheumatoid arthritis, among others described herein and known in
the art.
[0241] The NHR-targeted antisense and RNAi agents of the invention
may modulate acute inflammation, chronic inflammation, or both.
Certain embodiments relate to increasing acute inflammation or
acute inflammatory responses, and certain embodiments relate to
increasing chronic inflammation or chronic inflammatory responses.
Depending on the needs of the subject, certain embodiments relate
to reducing acute inflammation or inflammatory responses, and
certain embodiments relate to reducing chronic inflammation or
chronic inflammatory responses.
[0242] Acute inflammation relates to the initial response of the
body to presumably harmful stimuli and involves increased movement
of plasma and leukocytes from the blood into the injured tissues.
It is a short-term process, typically beginning within minutes or
hours and ending upon the removal of the injurious stimulus. Acute
inflammation may be characterized by any one or more of redness,
increased heat, swelling, pain, and loss of function. Redness and
heat are due mainly to increased blood flow at body core
temperature to the inflamed site, swelling is caused by
accumulation of fluid, pain is typically due to release of
chemicals that stimulate nerve endings, and loss of function has
multiple causes.
[0243] Acute inflammatory responses are initiated mainly by local
immune cells, such as resident macrophages, dendritic cells,
histiocytes, Kuppfer cells and mastocytes. At the onset of an
infection, burn, or other injuries, these cells undergo activation
and release inflammatory mediators responsible for the clinical
signs of inflammation, such as vasoactive amines and eicosanoids.
Vasodilation and its resulting increased blood flow cause the
redness and increased heat. Increased permeability of the blood
vessels results in an exudation or leakage of plasma proteins and
fluid into the tissue, which creates swelling. Certain released
mediators such as bradykinin increase sensitivity to pain, and
alter the blood vessels to permit the migration or extravasation of
leukocytes, such as neutrophils, which typically migrate along a
chemotactic gradient created by the local immune cells.
[0244] Acute inflammatory responses also includes one or more
acellular biochemical cascade systems, consisting of preformed
plasma proteins modulate, which act in parallel to initiate and
propagate the inflammatory response. These systems include the
complement system, which is mainly activated by bacteria, and the
coagulation and fibrinolysis systems, which are mainly activated by
necrosis, such as the type of tissue damage that is caused by
certain infections, burns, or other trauma. Hence, antisense and
RNAi agents may be used to modulate acute inflammation, or any of
one or more of the individual acute inflammatory responses.
[0245] Chronic inflammation, a prolonged and delayed inflammatory
response, is characterized by a progressive shift in the type of
cells that are present at the site of inflammation, and often leads
to simultaneous or near simultaneous destruction and healing of the
tissue from the inflammatory process. At the cellular level,
chronic inflammatory responses involve a variety of immune cells
such as monocytes, macrophages, lymphocytes, plasma cells, and
fibroblasts, though in contrast to acute inflammation, which is
mediated mainly by granulocytes, chronic inflammation is mainly
mediated by mononuclear cells such as monocytes and lymphocytes.
Chronic inflammation also involves a variety of inflammatory
mediators, such as IFN-.gamma. and other cytokines, growth factors,
reactive oxygen species, and hydrolytic enzymes. Chronic
inflammation may last for many months or years, and may result in
undesired tissue destruction and fibrosis.
[0246] Clinical signs of chronic inflammation are dependent upon
duration of the illness, inflammatory lesions, cause and anatomical
area affected. (see, e.g., Kumar et al., Robbins Basic
Pathology-8.sup.th Ed., 2009 Elsevier, London; Miller, L M,
Pathology Lecture Notes, Atlantic Veterinary College,
Charlottetown, PEI, Canada). Chronic inflammation is associated
with a variety of pathological conditions or diseases, including,
for example, allergies, Alzheimer's disease, anemia, aortic valve
stenosis, arthritis such as rheumatoid arthritis and
osteoarthritis, cancer, congestive heart failure, fibromyalgia,
fibrosis, heart attack, kidney failure, lupus, pancreatitis,
stroke, surgical complications, inflammatory lung disease,
inflammatory bowel disease, atherosclerosis, and psoriasis, among
others described herein and known in the art. Hence, NHR-targeted
antisense and RNAi agents may be used to treat or manage chronic
inflammation, modulate any of one or more of the individual chronic
inflammatory responses, or treat any one or more diseases or
conditions associated with chronic inflammation.
[0247] Antisense and RNAi agents may also modulate proliferative
inflammation, an inflammatory process characterized by an increase
in the number of tissue cells. These can encompass skin conditions
such as psoriasis, seborrhea or eczema, or can also be thought of
in terms of cancers and abnormal growths especially in light of
accumulating evidence based on more efficient molecular methods to
document even low grade chronic inflammation.
[0248] In certain embodiments, antisense and RNAi agents may
modulate inflammatory responses at the cellular level, such as by
modulating the activation, inflammatory molecule secretion (e.g.,
cytokine or kinin secretion), proliferation, activity, migration,
or adhesion of various cells involved in inflammation. Examples of
such cells include immune cells and vascular cells. Immune cells
include, for example, granulocytes such as neutrophils, eosinophils
and basophils, macrophages/monocytes, lymphocytes such as B-cells,
killer T-cells (i.e., CD8+ T-cells), helper T-cells (i.e., CD4+
T-cells, including T.sub.h1 and T.sub.h2 cells), natural killer
cells, .gamma..delta. T-cells, dendritic cells, and mast cells.
Examples of vascular cells include smooth muscle cells, endothelial
cells, and fibroblasts. Also included are methods of modulating an
inflammatory condition associated with one or more immune cells or
vascular cells, including neutrophil-mediated, macrophage-mediated,
and lymphocyte-mediated inflammatory conditions.
[0249] In certain embodiments, antisense and RNAi agents may
modulate the levels or activity of inflammatory molecules,
including plasma-derived inflammatory molecules and cell-derived
inflammatory molecules (e.g., TNF-alpha, IL-1, IL-2, IL-5, adhesion
molecules, Cox-2, and others). Included are pro-inflammatory
molecules and anti-inflammatory molecules. Examples of
plasma-derived inflammatory molecules include, without limitation,
proteins or molecules of any one or more of the complement system,
kinin system, coagulation system, and the fibrinolysis system.
Examples of members of the complement system include C1, which
exists in blood serum as a molecular complex containing about 6
molecules of C1q, 2 molecules of C1r, and 2 molecules of C1s, C2 (a
and b), C3(a and B), C4 (a and b), C5, and the membrane attack
complex of C5a, C5b, C6, C7, C8, and C9. Examples of the kinin
system include bradykinin, kallidin, kallidreins,
carboxypeptidases, angiotensin-converting enzyme, and neutral
endopeptidase.
[0250] Examples of cell-derived inflammatory molecules include,
without limitation, enzymes contained within lysosome granules,
vasoactive amines, eicosanoids, cytokines, acute-phase proteins,
and soluble gases such as nitric oxide. Vasoactive amines contain
at least one amino group, and target blood vessels to alter their
permeability or cause vasodilation. Examples of vasoactive amines
include histamine and serotonin. Eicosanoids refer to signaling
molecules made by oxidation of twenty-carbon essential fatty acids,
and include prostaglandins, prostacyclins, thromboxanes, and
leukotrienes.
[0251] Cytokines refer to a variety of substances that are secreted
by immune cells, and include polypeptides and glycoproteins.
Typically, cytokines are categorized as either autocrine cytokines,
which act on the same type of cell from which the cytokine is
secreted, or paracrine cytokines, which are restricted to acting on
a different cell type from which the cytokine is secreted. Examples
of cytokines that can be modulated include GM-CSF, IL-1a, IL1b,
IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12,
IFN-.alpha., IFN-.beta., IFN-gamma, MIP-1.alpha., MIP-1.beta.,
TGF-.beta., TNF-.alpha., TNF-.beta., CXCL1-5, CXCL9-14, and CXCL16,
among others known in the art.
[0252] Each cytokine typically has a corresponding cytokine
receptor. Examples of classes of cytokine receptors include,
without limitation, receptors from the immunoglobulin (Ig)
superfamily, such as the IL-1 receptor types, which share
structural homology with immunoglobulins (antibodies), cell
adhesion molecules, and even some cytokines, and receptors from the
hematopoietic growth factor family, such as the IL-2 receptor
family and the receptors for GM-CSF, IL-3, and IL-5, receptors from
the interferon (type 2) family, including receptors for IFN .beta.
and .gamma.. Additional examples include receptors from the tumor
necrosis factors (TNF) (type 3) family, which share a cysteine-rich
common extracellular binding domain and interact with several other
non-cytokine ligands such as CD40, CD27 and CD30, receptors from
the seven transmembrane helix family, including G-protein coupled
receptors, and chemokine receptors such as CXCR4 and CCR5, as well
as receptors for IL-8, MIP-1 and RANTES. Hence, in certain
embodiments, NHR-targeted antisense or RNAi agents may modulate the
levels or activity of one or more selected cytokines, the levels or
activity of one or more selected cytokine receptors, the
interaction between cytokines and their receptors, or any
combination thereof.
[0253] NHR-targeted antisense and RNAi agents may also modulate
levels or activity of acute-phase proteins. Examples of acute-phase
proteins include C-reactive protein, serum amyloid A, serum amyloid
P, and vasopressin. In certain instances, expression of acute-phase
proteins can cause a range of undesired systemic effects including
amyloidosis, fever, increased blood pressure, decreased sweating,
malaise, loss of appetite, and somnolence. Accordingly,
NHR-targeted antisense and RNAi agents may modulate the levels or
activity of acute-phase proteins, their systemic effects, or
both.
[0254] In certain embodiments, antisense and RNAi agents may
modulate local inflammation, systemic inflammation, or both. In
certain embodiments, they may reduce or maintain (i.e., prevent
further increases) local inflammation or local inflammatory
responses. In certain embodiments, depending on the needs of the
subject, antisense and RNAi agents may increase local inflammation
or local inflammatory responses. In certain embodiments, they may
reduce or maintain (i.e., prevent further increases) systemic
inflammation or systemic inflammatory responses. In certain
embodiments, depending on the needs of the subject, antisense and
RNAi agents may increase systemic inflammation or systemic
inflammatory responses.
[0255] In certain embodiments, the modulation of inflammation or
inflammatory responses can be associated with one or more tissues
or organs. Non-limiting examples of such tissues or organs include
skin (e.g., dermis, epidermis, subcutaneous layer), hair follicles,
nervous system (e.g., brain, spinal cord, peripheral nerves),
auditory system or balance organs (e.g., inner ear, middle ear,
outer ear), respiratory system (e.g., nose, trachea, lungs),
gastroesophogeal tissues, the gastrointestinal system (e.g., mouth,
esophagus, stomach, small intestines, large intestines, rectum),
vascular system (e.g., heart, blood vessels and arteries), liver,
gallbladder, lymphatic/immune system (e.g., lymph nodes, lymphoid
follicles, spleen, thymus, bone marrow), uro-genital system (e.g.,
kidneys, ureter, bladder, urethra, cervix, Fallopian tubes,
ovaries, uterus, vulva, prostate, bulbourethral glands, epidiymis,
prostate, seminal vesicles, testicles), musculoskeletal system
(e.g., skeletal muscles, smooth muscles, bone, cartilage, tendons,
ligaments), adipose tissue, mammaries, and the endocrine system
(e.g., hypothalamus, pituitary, thyroid, pancreas, adrenal glands).
Accordingly, antisense and RNAi agents may be used to modulate
inflammation associated with any of these tissues or organs, such
as to treat conditions or diseases that are associated with the
inflammation of these tissues or organs.
[0256] As noted above, certain embodiments may employ the antisense
and RNAi agents described herein to reduce or manage (i.e., prevent
further increases) inflammation or inflammatory responses
associated with particular tissues or organs. Included are
inflammatory responses and conditions associated with the skin,
including inflammation, infections, and cancers associated with the
dermal, epidermal, and subcutaneous layers of the skin. Examples of
skin-associated inflammatory conditions include, without
limitation, dermatitis, such as psoriasis, irritant dermatitis,
seborrheic dermatitis, atopic dermatitis (eczema), allergic contact
dermatitis, thermal-induced dermatitis, drug-induced dermatitis,
dyshidrotic dermatitis, urticaria, autoimmune dermatitis, skin
cancer such as melanoma, and bullous dermatitis. Also included are
bacterial, viral and parasitic infections, erythema multiforme,
erythema nodosum, granuloma annulare, poison oak/poison ivy, and
toxic epidermal necrolysis.
[0257] Certain embodiments relate to reducing inflammatory
responses and conditions associated with the nervous system,
including inflammation, infections, and cancer associated with the
brain and spinal cord of the central nervous system, the peripheral
nervous system, and the meninges. Expression of inflammatory
mediators including complement, adhesion molecules, cyclooxygenase
enzymes and their products and cytokines is increased in
experimental and clinical neurodegenerative disease, and
intervention studies in experimental animals suggest that several
of these factors contribute directly to neuronal injury. For
instance, specific cytokines, such as interleukin-1 (IL-1), have
been implicated heavily in acute neurodegeneration, such as stroke
and head injury.
[0258] Examples of nervous system associated inflammatory
conditions include, without limitation, meningitis (i.e.,
inflammation of the protective membranes covering the brain and
spinal cord), myelitis, encaphaloymyelitis (e.g., myalgic
encephalomyelitis, acute disseminated encephalomyelitis,
encephalomyelitis disseminata or multiple sclerosis, autoimmune
encephalomyelitis), arachnoiditis (i.e., inflammation of the
arachnoid, one of the membranes that surround and protect the
nerves of the central nervous system), granuloma, drug-induced
inflammation or meningitis, neurodegenerative diseases such as
Alzheimer's disease, stroke, HIV-dementia, encephalitis such viral
encephalitis and bacterial encephalitis, parasitic infections,
inflammatory demyeleniating disorders, and auto-immune disorders
such as CD8+ T Cell-mediated autoimmune diseases of the CNS.
Additional examples include Parkinson's disease, myasthenia gravis,
motor neuropathy, Guillain-Barre syndrome, autoimmune neuropathy,
Lambert-Eaton myasthenic syndrome, paraneoplastic neurological
disease, paraneoplastic cerebellar atrophy, non-paraneoplastic
stiff man syndrome, progressive cerebellar atrophy, Rasmussen's
encephalitis, amyotrophic lateral sclerosis, Sydeham chorea, Gilles
de la Tourette syndrome, autoimmune polyendocrinopathy, dysimmune
neuropathy, acquired neuromyotonia, arthrogryposis multiplex, optic
neuritis, and stiff-man syndrome.
[0259] As noted above, also included is inflammation associated
with infections of the nervous system. Specific examples of
bacterial infections associated with inflammation of the nervous
system include, without limitation, streptococcal infection such as
group B streptococci (e.g., subtypes III) and Streptococcus
pneumoniae (e.g., serotypes 6, 9, 14, 18 and 23), Escherichia coli
(e.g., carrying K1 antigen), Listeria monocytogenes (e.g., serotype
IVb), neisserial infection such as Neisseria meningitidis
(meningococcus), staphylococcal infection, heamophilus infection
such as Haemophilus influenzae type B, Klebsiella, and
Mycobacterium tuberculosis. Also included are infections by
staphylococci and pseudomonas and other Gram-negative bacilli,
mainly with respect to trauma to the skull, which gives bacteria in
the nasal cavity the potential to enter the meningeal space, or in
persons with cerebral shunt or related device (e.g.,
extraventricular drain, Ommaya reservoir). Specific examples of
viral infections associated with inflammation of the nervous system
include, without limitation, enteroviruses, herpes simplex virus
type 1 and 2, human T-lymphotrophic virus, varicella zoster virus
(chickenpox and shingles), mumps virus, human immunodeficiency
virus (HIV), and lymphocytic choriomeningitis virus (LCMV).
Meningitis may also result from infection by spirochetes such as
Treponema pallidum (syphilis) and Borrelia burgdorferi (Lyme
disease), parasites such as malaria (e.g., cerebral malaria), fungi
such as Cryptococcus neoformans, and ameoba such as Naegleria
fowleri.
[0260] Meningitis or other forms of nervous system inflammation may
also associate with the spread of cancer to the meninges (malignant
meningitis), certain drugs such as non-steroidal anti-inflammatory
drugs, antibiotics and intravenous immunoglobulins, sarcoidosis (or
neurosarcoidosis), connective tissue disorders such as systemic
lupus erythematosus, and certain forms of vasculitis (inflammatory
conditions of the blood vessel wall) such as Behcet's disease.
Epidermoid cysts and dermoid cysts may cause meningitis by
releasing irritant matter into the subarachnoid space. Accordingly,
NHR-targeted antisense and RNAi agents may be used to treat or
manage any one or more of these conditions.
[0261] Certain embodiments relate to reducing inflammatory
responses and conditions associated with the auditory system or
balance organs, such as the inner ear, middle ear, and the outer
ear. Examples of auditory system or balance organ associated
inflammatory conditions include, without limitation, outer ear
inflammation (e.g., ear infections), middle ear inflammation, which
may lead to fluid build-up in the normally air-filled space and
associated conductive hearing loss, labyrinthitis, an inner ear
infection or inflammation causing both dizziness (vertigo) and
hearing loss, vestibular neuronitis, an infection of the vestibular
nerve, generally viral, causing vertigo, and cochlear neuronitis,
an infection of the cochlear nerve, generally viral, causing sudden
deafness but no vertigo. Recipients of cochlear implants for
hearing loss are at an increased risk of pneumococcal meningitis
and its associated inflammation.
[0262] Certain embodiments relate to reducing inflammatory
responses and conditions associated with the respiratory system,
including inflammation, infections, and cancer associated with the
nose, trachea, and lungs. Examples of respiratory system associated
inflammatory conditions include, without limitation, atopic asthma,
non-atopic asthma, allergic asthma, atopic bronchial IgE-mediated
asthma, bronchial asthma, essential asthma, true asthma, intrinsic
asthma caused by pathophysiologic disturbances, extrinsic asthma
caused by environmental factors, essential asthma of unknown or
inapparent cause, non-atopic asthma, bronchitic asthma,
emphysematous asthma, exercise-induced asthma, allergen induced
asthma, cold air induced asthma, occupational asthma, infective
asthma caused by bacterial, fungal, protozoal, or viral infection,
non-allergic asthma, incipient asthma, wheezy infant syndrome and
bronchiolytis, chronic or acute bronchoconstriction, chronic
bronchitis, small airways obstruction, and emphysema. Further
examples include obstructive or inflammatory airways diseases such
as chronic eosinophilic pneumonia, chronic obstructive pulmonary
disease (COPD), COPD that includes chronic bronchitis, pulmonary
emphysema or dyspnea associated or not associated with COPD, COPD
that is characterized by irreversible, progressive airways
obstruction, and adult respiratory distress syndrome (ARDS).
[0263] Further examples of conditions associated with pulmonary
inflammation include conditions related to exacerbation of airways
hyper-reactivity consequent to other drug therapy, airways disease
that is associated with pulmonary hypertension, bronchitis such as
acute bronchitis, acute laryngotracheal bronchitis, arachidic
bronchitis, catarrhal bronchitis, croupus bronchitis, dry
bronchitis, infectious asthmatic bronchitis, productive bronchitis,
staphylococcus or streptococcal bronchitis and vesicular
bronchitis, acute lung injury, and bronchiectasis such as cylindric
bronchiectasis, sacculated bronchiectasis, fusiform bronchiectasis,
capillary bronchiectasis, cystic bronchiectasis, dry bronchiectasis
and follicular bronchiectasis.
[0264] COPD in particular refers to a group of lung diseases that
block airflow and make it increasingly difficult for affected
individuals to breathe normally. Emphysema and chronic bronchitis
are the two main conditions within the group of COPD diseases, but
COPD can also refer to damage caused by chronic asthmatic
bronchitis, among other conditions known in the art. In most cases,
damage to the airways eventually interferes with the exchange of
oxygen and carbon dioxide in the lungs. Standard treatments focus
mainly on controlling symptoms and minimizing further damage.
[0265] Emphysema represents one aspect of COPD. Emphysema leads to
inflammation within the fragile walls of the alveoli, which may
destroy some of the walls and elastic fibers, allowing small
airways to collapse upon exhaling, and impairing airflow out of the
lungs. Signs and symptoms of emphysema include, for instance,
shortness of breath, especially during physical activities,
wheezing, and chest tightness.
[0266] Chronic bronchitis represents another aspect of COPD.
Chronic bronchitis is characterized by an ongoing cough, and leads
to inflammation and narrowing of the bronchial tubes. This
condition also causes increased mucus production, which can further
block the narrowed tubes. Chronic bronchitis occurs mainly in
smokers, and is typically defined as a cough that lasts for at
least three months a year for two consecutive years. Signs and
symptoms of chronic bronchitis include, for example, having to
clear the throat first thing in the morning, especially for
smokers, a chronic cough that produces yellowish sputum, shortness
of breath in the later stages, and frequent respiratory
infections.
[0267] As noted above, COPD refers primarily to obstruction in the
lungs resulting from the two above-noted chronic lung conditions.
However, many individuals with COPD have both of these
conditions.
[0268] Chronic asthmatic bronchitis represents another aspect of
COPD. Chronic asthmatic bronchitis is usually characterized as
chronic bronchitis combined with asthma (bronchospasm). Asthma may
occur when inflamed and infected secretions irritate the smooth
muscles in the airways. Symptoms are similar to those of chronic
bronchitis, but also include intermittent, or even daily, episodes
of wheezing.
[0269] In certain embodiments, COPD is ultimately caused by
cigarette smoke and other irritants. In the vast majority of cases,
the lung damage that leads to COPD is caused by long-term cigarette
smoking. However, other irritants may cause COPD, including cigar
smoke, secondhand smoke, pipe smoke, air pollution and certain
occupational fumes. Gastroesophageal reflux disease (GERD), which
occurs when stomach acids wash back up into the esophagus, can not
only aggravate COPD, but may even cause it in some individuals. In
rare cases, COPD results from a genetic disorder that causes low
levels of a protein called alpha-1-antitrypsin. Hence, risk factors
for COPD include exposure to tobacco smoke, occupational exposure
to dusts and chemicals (long-term exposure to chemical fumes,
vapors and dusts irritates and inflames the lungs),
gastroesophageal reflux disease (a severe form of acid reflux--the
backflow of acid and other stomach contents into the esophagus),
age (COPD develops slowly over years, so most people are at least
40 years old when symptoms begin), and genetics (a rare genetic
disorder known as alpha-1-antitrypsin deficiency is the source of a
few cases of COPD).
[0270] Complications or associated symptoms of COPD may include
increased risk of respiratory infections, high blood pressure,
heart problems (e.g., heart attacks, arrhythmias, cor pulmonale),
lung cancer (smokers with chronic bronchitis are at a higher risk
of developing lung cancer than are smokers who don't have chronic
bronchitis), pneumonia, pneumothorax, and depression, among others
known in the art. Further examples include cough that produces
mucus and may be streaked with blood, fatigue, frequent respiratory
infections, headaches, shortness of breath (dyspnea) that worsens
with mild activity, swelling of the ankles, feet, or legs, which
affects both sides of the body, and wheezing. NHR-targeted
antisense and RNAi agents may be used to reduce or manage the
complications or symptoms associated with COPD or other pulmonary
conditions related to inflammation.
[0271] Subjects with COPD may be identified according to routine
diagnostic techniques known in the art. For instance, pulmonary
function tests, such as spirometry, measure how much air the lungs
can hold and how fast an individual can blow the air out of their
lungs. Spirometry can detect COPD before the appearance of
symptoms, and can also be used to track disease progression and
monitor treatment. In addition, chest X-rays show emphysema, one of
the main causes of COPD, and may also rule out other lung problems
or heart failure. In addition, arterial blood gas analysis measures
how effectively the lungs bring oxygen into the blood and remove
carbon dioxide, providing an indication of COPD. Sputum
examination, i.e., the analysis of the cells in the sputum, can
identify the cause of certain lung problems and help rule out
certain lung cancers. Also, computerized tomography (CT) scan
produces highly-detailed images of the internal organs, which can
help detect emphysema, and, thus, COPD.
[0272] As elsewhere herein, the amount of NHR-targeted antisense or
RNAi agent administered to a subject with COPD (or at risk for
COPD) will depend on the characteristics of that subject, such as
general health, age, sex, body weight, and tolerance to drugs, as
well as the degree, severity, and type of reaction to the agent.
For instance, multiple administrations may be utilized (1, 2, 3, 4,
5, 6, 7, 8, 9, 10, etc), typically at a defined frequency (number
of administrations per day, per week, per month, etc).
[0273] Also included are combination therapies. For instance, one
or more NHR-targeted antisense and RNAi agents can be utilized in
combination with other treatments for pulmonary inflammation or
COPD. Examples of such treatments included, without limitation,
lifestyle changes, such as quitting or reducing smoking or other
exposure to lung irritants, lung rehabilitation, the use of
bronchodilators (e.g., ipratropium, tiotropium, salmeterol,
formoterol), steroids such as corticosteroids, antibiotics,
metered-dose inhalers (MDIs) and dry powder inhalers (DPIs),
nebulizers, replacement gene therapy for alpha-1-antitrypsin
deficiency, oxygen therapy, and surgery, including bullectomy, lung
volume reduction surgery, and lung transplant.
[0274] Certain embodiments relate to reducing inflammatory
responses and conditions associated the gastrointestinal system,
including inflammation, infections, and cancer associated with the
mouth, esophagus, stomach, small intestines, large intestines, and
rectum. "Gastrointestinal inflammation" as used herein refers to
inflammation of a mucosal layer of the gastrointestinal tract, and
encompasses acute and chronic inflammatory conditions. Acute
inflammation is generally characterized by a short time of onset
and infiltration or influx of neutrophils. Chronic inflammation is
generally characterized by a relatively longer period of onset and
infiltration or influx of mononuclear cells. Chronic inflammation
can also typically characterized by periods of spontaneous
remission and spontaneous occurrence. "Mucosal layer of the
gastrointestinal tract" is meant to include mucosa of the bowel
(including the small intestine and large intestine), rectum,
stomach (gastric) lining, oral cavity, and the like.
[0275] "Chronic gastrointestinal inflammation" refers to
inflammation of the mucosal of the gastrointestinal tract that is
characterized by a relatively longer period of onset, is
long-lasting (e.g., from several days, weeks, months, or years and
up to the life of the subject), and is often associated with
infiltration or influx of mononuclear cells, and can be further
associated with periods of spontaneous remission and spontaneous
occurrence. "Chronic gastrointestinal inflammatory conditions"
(also referred to as "chronic gastrointestinal inflammatory
diseases") having such chronic inflammation include, but are not
limited to, inflammatory bowel disease (IBD), colitis induced by
environmental insults (e.g., gastrointestinal inflammation
associated with a therapeutic regimen, such as chemotherapy,
radiation therapy, and the like), colitis in conditions such as
chronic granulomatous disease (see, e.g., Schappi et al., Arch Dis
Child. 84:147-151, 2001), celiac disease, celiac sprue (i.e., a
heritable disease in which the intestinal lining is inflamed in
response to the ingestion of a protein known as gluten), food
allergies, gastritis, infectious gastritis or enterocolitis (e.g.,
Helicobacter pylori-infected chronic active gastritis) and other
forms of gastrointestinal inflammation caused by an infectious
agent, and other like conditions.
[0276] As used herein, "inflammatory bowel disease" or "IBD" refers
to any of a variety of diseases characterized by inflammation of
all or part of the intestines. Examples of inflammatory bowel
disease include, but are not limited to, Crohn's disease and
ulcerative colitis. The term IBD includes pseudomembranous colitis,
hemorrhagic colitis, hemolytic-uremic syndrome colitis, collagenous
colitis, ischemic colitis, radiation colitis, drug and chemically
induced colitis, diversion colitis, ulcerative colitis, irritable
bowel syndrome, irritable colon syndrome and Crohn's disease; and
within Crohn's disease all the subtypes including active,
refractory, and fistulizing and Crohn's disease. Hence,
NHR-targeted antisense and RNAi agents may be employed to treat or
manage any one or more of these conditions.
[0277] Certain embodiments relate to reducing inflammatory
responses and conditions associated with the vascular system, or
vascular inflammation, such as inflammation associated with the
blood vessels and the heart. Examples of vascular system associated
inflammatory conditions include, without limitation, myocarditis,
pericarditis, occlusive disease, atherosclerosis, myocardial
infarction, thrombosis, Wegener's granulomatosis, Takayasu's
arteritis, Kawasaki syndrome, anti-factor VIII autoimmune disease,
necrotizing small vessel vasculitis, microscopic polyangiitis,
Churg and Strauss syndrome, pauci-immune focal necrotizing
glomerulonephritis, crescentic glomerulonephritis, antiphospholipid
syndrome, antibody induced heart failure, thrombocytopenic purpura,
autoimmune hemolytic anemia, cardiac autoimmunity in Chagas'
disease, and anti-helper T lymphocyte autoimmunity. Also included
are endocarditis, or infection of the heart valves with spread of
small clusters of bacteria through the bloodstream, phlebitis or
vasculitis, inflammation of one or more veins, and
thrombophlebitis, vein inflammation related to a thrombus.
Thrombophlebitis may occur repeatedly in different locations, and
is then referred to as thrombophlebitis migrans, or migrating
thrombophlebitis. Phlebitis may associate with a variety of causes,
such as bacterial infection, exposure to chemical agents, such as
irritating or vesicant solutions, physical trauma from skin
puncture such as movement of a cannula into the vein during
insertion, medications such as Celebrex, Olanzepine,
antidepressants, and others, and alcohol abuse. Certain embodiments
may relate to treating or managing heart inflammation caused by any
one or more of acute rheumatic fever, congenital toxoplasmosis,
enterovirus antenatal infection, lyme disease, and rheumatic
fever.
[0278] Certain embodiments relate to reducing inflammatory
responses and conditions associated with the liver or gallbladder,
including acute and chronic liver inflammation, and acute and
chronic cholecystis. Examples of liver or gallbladder associated
inflammatory conditions include, without limitation, auto-immune
hepatitis, viral hepatitis (e.g., Hepatitis A virus, Hepatitis B
virus, Hepatitis C virus, Hepatitis D virus, Hepatitis E virus,
mononucleosis, rubella, Epstein-Barr virus, and cytomegalovirus),
other causes of hepatitis such as severe bacterial infection,
ameobic infections, medicines (e.g., agomelatine, allopurinol,
amitryptyline, amiodarone, asathioprine, paracetamol, halothane,
ibuprofen, indomethacin, isoniazid, rifampicin, pyrazinamide,
ketoconazole, loratadine, methotrexate, methyldopa, minocycline,
nifedipine, nitrofurantoin, phenytoin, valproic acid, troglitazone,
zidovudine), toxins (e.g., alcohol, fungal toxins), and metabolic
disorders (e.g., Wilson's disease, a disorder of the body's copper
metabolism, haemochromatosis, disorder of the body's iron
metabolism, non-alcoholic steatohepatitis, alpha 1-antitrypsin
deficiency). Additional examples include non-alcoholic fatty liver
disease, cirrhosis such as primary biliary cirrhosis, obstructive
jaundice, ischemic hepatitis, and gall bladder disease.
[0279] Certain embodiments relate to reducing inflammatory
responses and conditions associated with the lymphatic/immune
system. Examples of lymphatic/immune system associated inflammatory
conditions include, without limitation, auto-immune diseases, such
as Chagas disease, chronic obstructive pulmonary disorder (COPD),
Crohn's disease, dermatomyositis, diabetes mellitus type I,
endometriosis, Goodpasture's syndrome, Graves' disease,
Guillain-Barre syndrome, Hachimoto's disease, hidradenitis
suppurativa, Kawasaki disease, IgA nephropathy, idiopathic
thrombocytopenia purpura, interstitial cystitis, lupus
erythematosus, mixed connective tissue disease, morphea, myasthenia
gravis, narcolepsy, neuromyotonia, pemphigus vulgaris, pernicous
anemia, psoriasis, psoriatic arthritis, poliomyositis, primary
biliary cirrhosis, rheumatoid arthritis, schizophrenia,
scleroderma, Sjogren's syndrome, stiff person syndrome, temporal
arteritis, ulcerative colitis, vitiligo, and Wegener's
granulomatosis, in addition to autoimmune hemolytic anemia, and
various lymphadenopathies.
[0280] Also included are immune-related inflammatory conditions
associated with the transplantation of a graft, tissue, cell or
organ, such as graft rejection, chronic graft rejection, subacute
graft rejection, hyperacute graft rejection, acute graft rejection,
and graft versus host disease. In certain embodiments, NHR-targeted
antisense and RNAi agents can be administered to a transplant donor
before or during tissue removal. In certain embodiments,
NHR-targeted antisense and RNAi agents can be administered to a
transplant recipient before, during, and/or after transplant
therapy to reduce inflammation-related complications of transplant
therapy. Examples of transplant therapies include bone marrow, stem
cell, peripheral blood, liver, lung, heart, skin, and kidney, among
others known in the art. Additional examples include inflammatory
conditions associated with allergies, such as asthma, hives,
urticaria, pollen allergy, dust mite allergy, venom allergy,
cosmetics allergy, latex allergy, chemical allergy, drug allergy,
insect bite allergy, animal dander allergy, stinging plant allergy,
poison ivy allergy and food allergy.
[0281] Certain embodiments relate to reducing inflammatory
responses and conditions associated with the uro-genital system.
Examples of uro-genital system associated inflammatory conditions
include, without limitation, inflammations, infections or cancers
of the ureter, bladder, urethra, cervix, Fallopian tubes, ovaries,
uterus, womb, vulva, prostate, bulbourethral glands, epidiymis,
prostate, seminal vesicles, testicles, or kidneys. Also included
are auto-immune interstitial nephritis, renal abscess (intrarenal
or extrarenal), acute prostatitis, hematuria, urethritis (e.g.,
Chlamydia and other sexually transmitted diseases), pelvic
inflammatory disease (PID), and prostatic abscess. Also included is
nephritis associated with one or more of glomerulonephritis, lupus
nephritis, nephropathy, gout, poisons or chemicals (e.g., ether,
thallium sulfate), certain medications (e.g., piroxicam, candyl,
feldene gel, fensaid, pirox), Herrmann syndrome, yellow fever,
immune complex diseases, typhoid fever, urethral stricture, renal
tuberculosism, and post-streptococcal glomerulonephritis.
[0282] Certain embodiments relate to reducing inflammatory
responses and conditions associated with the musculoskeletal
system. Examples of musculoskeletal system associated inflammatory
conditions include, without limitation, arthritis such as
rheumatoid arthritis and psoriatic arthritis, ankylosing
spondylitis, auto-immune myositis, primary Sjogren's syndrome,
smooth muscle auto-immune disease, myositis, polymyositis,
tendinitis, ligament inflammation, cartilage inflammation, joint
inflammation, synovial inflammation, carpal tunnel syndrome,
chronic muscle inflammation, and bone inflammation, including bone
inflammation associated with osteoporosis and osteoarthritis. Also
included are Tietze's syndrome, a benign, painful, nonsuppurative
localized swelling of the costosternal, sternoclavicular, or
costochondral joints, costochondritis, sternalis syndrome,
xiphoidalgia, spontaneous sternoclavicular subluxation,
sternocostoclavicular hyperostosis, fibromyalgia, shoulder
tendinitis or bursitis, gouty arthritis, polymyalgia rheumatica,
lupus erythematosus, bone spurs, and fractures such as stress
fractures.
[0283] Certain embodiments relate to reducing inflammatory
responses and conditions associated with the endocrine system.
Examples of endocrine system associated inflammatory conditions
include, without limitation, inflammation, infection, or cancer
associated with the hypothalamus, pituitary, thyroid, pancreas, or
adrenal glands, glandular diseases such as pancreatic disease,
diabetes such as Type I diabetes, thyroid disease, Graves' disease,
thyroiditis, spontaneous autoimmune thyroiditis, Hashimoto's
thyroiditis, idiopathic myxedema, ovarian autoimmunity, autoimmune
anti-sperm infertility, autoimmune prostatitis and Type I
autoimmune polyglandular syndrome.
[0284] Certain embodiments relate to reducing inflammatory
responses and conditions associated with adipose tissues, an active
participant in regulating physiologic and pathologic processes,
including immunity and inflammation. Macrophages are components of
adipose tissue and actively participate in its activities.
Furthermore, cross-talk between lymphocytes and adipocytes can lead
to immune regulation. Adipose tissue produces and releases a
variety of pro-inflammatory and anti-inflammatory factors,
including the adipokines leptin, adiponectin, resistin, and
visfatin, as well as cytokines and chemokines, such as TNF-alpha,
IL-6, monocyte chemoattractant protein 1, and others.
Proinflammatory molecules produced by adipose tissue have been
implicated as active participants in the development of insulin
resistance and the increased risk of cardiovascular disease
associated with obesity. In contrast, reduced leptin levels may
predispose to increased susceptibility to infection caused by
reduced T-cell responses in malnourished individuals. Altered
adipokine levels have been observed in a variety of inflammatory
conditions (see, e.g., Fantuzzi, J Allergy Clin Immunol.
115:911-19, 2005; and Berg et al., Circulation Research. 96:939,
2005).
[0285] NHR-targeted antisense and RNAi agents may also be employed
to treat or manage inflammation associated with hypersensitivity.
Examples of such conditions include type I hypersensitivity, type
II hypersensitivity, type III hypersensitivity, type IV
hypersensitivity, immediate hypersensitivity, antibody mediated
hypersensitivity, immune complex mediated hypersensitivity,
T-lymphocyte mediated hypersensitivity, and delayed type
hypersensitivity.
[0286] NHR-targeted antisense and RNAi agents may also be employed
to treat or manage auto-inflammatory conditions. Examples of
auto-inflammatory conditions include familial Mediterranean fever,
TNF receptor associated periodic syndrome (TRAPS), Hyper-IgD
syndrome (HIDS), CIAS1-related diseases such as Muckle-Wells
syndrome, familial cold auto-inflammatory syndrome, and neonatal
onset multisystem inflammatory disease, PAPA syndrome (pyogenic
sterile arthritis, pyoderma gangrenosum, acne), and Blau
syndrome.
[0287] NHR-targeted antisense and RNAi agents may be employed to
treat or manage inflammation associated with a variety of cancers.
Examples of such cancers include, without limitation, prostate
cancer, breast cancer, colon cancer, rectal cancer, lung cancer,
ovarian cancer, testicular cancer, stomach cancer, bladder cancer,
pancreatic cancer, liver cancer, kidney cancer, brain cancer,
melanoma, non-melanoma skin cancer, bone cancer, lymphoma,
leukemia, thyroid cancer, endometrial cancer, multiple myeloma,
acute myeloid leukemia, neuroblastoma, glioblastoma, and
non-Hodgkin's lymphoma.
[0288] As noted above, certain embodiments may employ NHR-targeted
antisense and RNAi agents to modulate systemic inflammation, such
as to reduce or manage systemic inflammation. In certain
embodiments, systemic inflammation may by associated with systemic
inflammatory response syndrome (SIRS), a whole-body inflammatory
condition with a variety of potential causes. SIRS may be
characterized or identified according to routine diagnostic
techniques. As one non-limiting example, SIRS may be identified by
the presence of two or more of the following: (i) a body
temperature that is less than 36.degree. C. or greater than
38.degree. C., (ii) a heart rate that is greater than 90 beats per
minute, (iii) tachypnea (high respiratory rate), with greater than
20 breaths per minute; or, an arterial partial pressure of carbon
dioxide less than 4.3 kPa (32 mmHg), and (iv) white blood cell
count less than 4000 cells/mm.sup.3 (4.times.10.sup.9 cells/L) or
greater than 12,000 cells/mm.sup.3 (12.times.10.sup.9 cells/L); or
the presence of greater than 10% immature neutrophils (band
forms).
[0289] SIRS is broadly classified as either infectious or
non-infectious. Most generally, infectious SIRS is associated with
sepsis, a whole-body inflammatory state combined with a known or
suspected infection, which includes bacteremia, viremia,
parasitemia, and toxic shock syndrome. Sepsis may be associated
with a wide variety of infectious agents, including, without
limitation, bacteria such as Streptococcus agalactiae, Escherichia
coli, Haemophilus influenzae, Listeria monocytogenes,
Coagulase-negative Staphylococcus, Staphylococcus aureus,
Klebsiella species, Pseudomonas aeruginosa, Enterobacter species,
S. agalactiae, Serratia species, Acinetobacter species,
Streptococcus pneumoniae, Salmonella species, and Neisseria
meningitidis; viruses such as rubella, cytomegalovirus, herpes
simplex and the chickenpox virus; parasites such as in malarial
infection (e.g., Plasmodium falciparum), trypanosomiasis, and
filariasis; and fungi such as Candida species, Aspergillus species,
Histoplasma species, Cryptococcus neoformans, Coccidioides immitis,
Blastomyces dermatitidis, and Pneumocystis carinii. In certain
instances, infections in the lungs (e.g., pneumonia), bladder and
kidneys (e.g., urinary tract infections), skin (e.g., cellulitis),
abdomen (e.g., appendicitis), and other areas (e.g., meningitis)
can spread and lead to sepsis. NHR-targeted antisense and RNAi
agents may be used to modulate inflammation associated with any of
these infectious agents, whether sepsis is present or
otherwise.
[0290] Noninfectious SIRS may be associated with trauma, burns,
pancreatitis, ischemia, hemorrhage, surgical complications, adrenal
insufficiency, pulmonary embolism, aortic aneurysm, cardiac
tamponade, anaphylaxis, and drug overdose, among others. SIRS is
often complicated by the failure of one or more organs or organ
system, including those described herein. Specific examples include
acute lung injury, acute kidney injury, shock, and multiple organ
dysfunction syndrome, among others. Typically, SIRS is treated by
focusing on the underlying problem (e.g., adequate fluid
replacement for hypovolemia, IVF/NPO for pancreatitis,
epinephrine/steroids/benadryl for anaphylaxis). In certain
instances, selenium, glutamine, and eicosapentaenoic acid have
shown effectiveness in improving symptoms of SIRS, and antioxidants
such as vitamin E may also be helpful. Hence, NHR-targeted
antisense and RNAi agents may be used to treat or manage SIRS and
the complications of SIRS, alone or in combination with other
therapies.
[0291] Systemic inflammation may also be associated with "cytokine
storm," a dangerous immune reaction caused by a positive feedback
loop between cytokines and immune cells, resulting in highly
elevated levels of various cytokines. In certain instances,
cytokine storm (hypercytokinemia) includes the systemic release of
numerous known inflammatory mediators such as cytokines, oxygen
free radicals, and coagulation factors). Included are elevated
levels of pro-inflammatory cytokines such as TNF-alpha, IL-1, and
IL-6, and anti-inflammatory cytokines such as IL-10 and IL-1
receptor antagonist. Cytokine storms can occur in a number of
infectious and non-infectious diseases including graft versus host
disease (GVHD), acute respiratory distress syndrome (ARDS), sepsis,
avian influenza, smallpox, and SIRS. Cytokine storm may also be
induced by certain medications. Treatment includes OX40 IG, which
reduces T-cell responses, ACE inhibitors, Angiotensin II receptor
blockers, corticosteroids, gemfibrozil, free radical scavengers,
and TNF-.alpha. blockers. Accordingly, NHR-targeted antisense and
RNAi agents may be employed to treat or manage cytokine storm,
alone or in combination with other therapies.
[0292] Certain embodiments may employ NHR-targeted antisense and
RNAi agents to reduce any one or more of granulomatous
inflammation, fibrinous inflammation, purulent inflammation, serous
inflammation, or ulcerative inflammation. Granulomatous
inflammation is characterized by the formation of granulomas,
typically resulting from a response to infectious agents such as
tuberculosis, leprosy, and syphilis. Fibrinous inflammation results
from a large increase in vascular permeability, which allows fibrin
to pass through the blood vessels. If an appropriate
pro-coagulative stimulus is present, such as a cancer cell, a
fibrinous exudate is deposited. This process is commonly seen in
serous cavities, where the conversion of fibrinous exudate into a
scar can occur between serous membranes, limiting their function.
Purulent inflammation results from the formation of a large amount
of pus, which consists of neutrophils, dead cells, and fluid.
Infection by pyogenic bacteria such as staphylococci is
characteristic of this kind of inflammation. Large, localized
collections of pus enclosed by surrounding tissues are called
abscesses. Serous inflammation is characterized by the copious
effusion of non-viscous serous fluid, commonly produced by
mesothelial cells of serous membranes, but may also be derived from
blood plasma. Examples of this type of inflammation include skin
blisters. Ulcerative inflammation, which typically occurs near an
epithelium, results in the necrotic loss of tissue from the
surface, thereby exposing lower layers of tissue. The subsequent
excavation of the epithelium is known as an ulcer.
[0293] NHR-targeted antisense and RNAi agents may also be employed
in the treatment of physical injuries or wounds. Examples include
abrasions, bruises, cuts, puncture wounds, lacerations, impact
wounds, concussions, contusions, thermal burns, frostbite, chemical
burns, sunburns, gangrene, necrosis, desiccations, radiation burns,
radioactivity burns, smoke inhalation, torn muscles, pulled
muscles, torn tendons, pulled tendons, pulled ligaments, torn
ligaments, hyperextensions, torn cartilage, bone fractures, pinched
nerves, ulcers, and gunshot or other traumatic wounds.
[0294] NHR-targeted antisense and RNAi agents may also be employed
to treat or manage idiopathic inflammation or inflammation of
unknown etiology. Also included are combination therapies, in which
one or more NHR-targeted antisense and RNAi agents are administered
or utilized in combination with one or more other therapies for any
of the inflammatory diseases or conditions described herein,
including those therapies that are commonly available and known in
the art. Examples of combination therapies include the use of
standard anti-inflammatory agents such as non-steroidal
anti-inflammatory drugs (NSAIDs), immune selective
anti-inflammatory derivatives (ImSAIDs), and steroids (e.g.,
corticosteroids), anti-infectives such as antibiotics and
anti-viral agents, anti-oxidants, cytokines, chemotherapeutic
agents and other anti-cancer therapies, and immunosuppressive
therapies.
[0295] Criteria for assessing the signs and symptoms of
inflammatory and other conditions, including for purposes of making
differential diagnosis and also for monitoring treatments such as
determining whether a therapeutically effective dose has been
administered in the course of treatment, e.g., by determining
improvement according to accepted clinical criteria, will be
apparent to those skilled in the art and are exemplified by the
teachings of e.g., Berkow et al., eds., The Merck Manual, 16.sup.th
edition, Merck and Co., Rahway, N.J., 1992; Goodman et al., eds.,
Goodman and Gilman's The Pharmacological Basis of Therapeutics,
10.sup.th edition, Pergamon Press, Inc., Elmsford, N.Y., (2001);
Avery's Drug Treatment: Principles and Practice of Clinical
Pharmacology and Therapeutics, 3rd edition, ADIS Press, Ltd.,
Williams and Wilkins, Baltimore, Md. (1987); Ebadi, Pharmacology,
Little, Brown and Co., Boston, (1985); Osolci al., eds.,
Remington's Pharmaceutical Sciences, 18.sup.th edition, Mack
Publishing Co., Easton, Pa. (1990); Katzung, Basic and Clinical
Pharmacology, Appleton and Lange, Norwalk, Conn. (1992).
[0296] Certain embodiments may employ NHR-targeted antisense and
RNAi agents to increase inflammation. For instance, depending on
the needs of the subject, certain embodiments may increase acute
inflammation or increase acute inflammatory responses or both.
Certain embodiments may increase chronic inflammation or chronic
inflammatory responses or both. Certain embodiments may increase
both acute and chronic inflammation. Certain embodiments may
increase local or systemic inflammation or both.
[0297] In certain embodiments, NHR-targeted antisense and RNAi
agents may be used to treat or manage immunodeficiencies, including
primary immunodeficiencies and secondary immunodeficiencies, in
which the body may not mount an adequate inflammatory response.
Examples of primary immunodeficiencies include various autosomal
recessive and X-linked genetic conditions such as T-cell and B-cell
immunodeficiencies, including combined T-cell and B-cell
immunodeficiencies, antibody deficiencies, well-defined syndromes,
immune dysregulation diseases, phagocyte disorders, innate immunity
disorders, and complement deficiencies.
[0298] Examples of T-cell and B-cell immunodeficiencies include
T-/B+ deficiencies such as .gamma.c deficiency, JAK3 deficiency,
interleukin 7 receptor chain a deficiency, CD45 deficiency,
CD3.delta./CD3.epsilon. deficiency; and T-/B- deficiencies such as
RAG 1/2 deficiency, DCLRE1C deficiency, adenosine deaminase (ADA)
deficiency, reticular dysgenesis. Additional examples include Omenn
syndrome, DNA ligase type IV deficiency, CD40 ligand deficiency,
CD40 deficiency, purine nucleoside phosphorylase (PNP) deficiency,
MHC class II deficiency, CD3.gamma. deficiency, CD8 deficiency,
ZAP-70 deficiency, TAP-1/2 deficiency, and winged helix
deficiency.
[0299] Examples of antibody deficiencies include X-linked
agammaglobulinemia (btk deficiency, or Bruton's
agammaglobulinemia), .mu.-Heavy chain deficiency, 1-5 deficiency,
Ig.alpha. deficiency, BLNK deficiency, thymoma with
immunodeficiency, common variable immunodeficiency (CVID), ICOS
deficiency, CD19 deficiency, TACI (TNFRSF13B) deficiency, and BAFF
receptor deficiency. Additional examples include AID deficiency,
UNG deficiency, heavy chain deletions, kappa chain deficiency,
isolated IgG subclass deficiency, IgA with IgG subclass deficiency,
selective immunoglobulin A deficiency, and transient
hypogammaglobulinemia of infancy (THI).
[0300] Examples of "well-defined syndromes" include Wiskott-Aldrich
syndrome, ataxia telangiectasia, ataxia-like syndrome, Nijmegen
breakage syndrome, Bloom syndrome, DiGeorge syndrome,
immuno-osseous dysplasias such as cartilage-hair hypoplasia,
Schimke syndrome, Hermansky-Pudlak syndrome type 2, Hyper-IgE
syndrome, chronic mucocutaneous candidiasis.
[0301] Examples of immune dysregulation diseases include
immunodeficiency with hypopigmentation or albinism such as
Chediak-Higashi syndrome and Griscelli syndrome type 2, familial
hemophagocytic lymphohistiocytosis such as perforin deficiency,
MUNC13D deficiency, and syntaxin 11 deficiency, X-linked
lymphoproliferative syndrome, autoimmune lymphoproliferative
syndrome such as type 1a (CD95 defects), type 1b (Fas ligand
defects), type 2a (CASP10 defects), and type 2b (CASP8 defects),
autoimmune polyendocrinopathy with candidiasis and ectodermal
dystrophy, and immunodysregulation polyendocrinopathy enteropathy
X-linked syndrome. Additionally, diseases affecting the bone marrow
may result in abnormal or few leukocytes, such as leukopenia.
Leukopenia can be induced by certain infections and diseases,
including viral infection, Rickettsia infection, some protozoa,
tuberculosis, and certain cancers
[0302] Examples of phagocyte disorders include severe congenital
neutropenia such as ELA2 deficiency (e.g., with myelodysplasia),
GFI1 deficiency (with T/B lymphopenia) or G-CSFR deficiency
(G-CSF-unresponsive), Kostmann syndrome, cyclic neutropenia,
X-linked neutropenia/myelodysplasia, leukocyte adhesion deficiency
types 1, 2 and 3, RAC2 deficiency, 0-actin deficiency, localized
juvenile periodontitis, Papillon-Lefevre syndrome, specific granule
deficiency, Shwachman-Diamond syndrome, chronic granulomatous
disease, including X-linked and autosomal forms, neutrophil
glucose-6-phosphate dehydrogenase deficiency, IL-12 and IL-23
.beta.1 chain deficiency, IL-12p40 deficiency, interferon .gamma.
receptor 1 deficiency, interferon .gamma. receptor 2 deficiency,
and STAT1 deficiency.
[0303] Examples of innate immunity deficiencies include
hypohidrotic ectodermal dysplasia such as NEMO deficiency and IKBA
deficiency, IRAK-4 deficiency, WHIM syndrome (warts,
hypogammaglobulinaemia, infections, myleokathexis), and
epidermodysplasia verruciformis. Examples of complement
deficiencies and exemplary associated conditions include C1q
deficiency (e.g., lupus-like syndrome, rheumatoid disease,
infections), C1r deficiency, C4 deficiency, C2 deficiency (e.g.,
lupus-like syndrome, vasculitis, polymyositis, pyogenic
infections), C3 deficiency (e.g., recurrent pyogenic infections),
C5 deficiency (e.g., neisserial infections), C6 deficiency, C7
deficiency (e.g., vasculitis), C8a and C8b deficiency, C9
deficiency (e.g., neisserial infections), C1-inhibitor deficiency
(e.g., hereditary angioedema), Factor I deficiency (pyogenic
infections), Factor H deficiency (e.g., haemolytic-uraemic
syndrome, membranoproliferative glomerulonephritis), Factor D
deficiency (e.g., neisserial infections), Properdin deficiency
(e.g., neisserial infections), MBP deficiency (e.g., pyogenic
infections), and MASP2 deficiency.
[0304] Primary immune deficiencies can be diagnosed according to
routine techniques in the art. Exemplary diagnostic tests include,
without limitation, performing counts of the different types of
mononuclear cells in the blood (e.g., lymphocytes and monocytes,
including lymphocytes, different groups of B lymphocytes such as
CD19+, CD20+, and CD21+ lymphocytes, natural killer cells, and
monocytes positive for CD15+), measuring the presence of activation
markers (e.g., HLA-DR, CD25, CD80), performing tests for T cell
function such as skin tests for delayed-type hypersensitivity, cell
responses to mitogens and allogeneic cells, cytokine production by
cells, performing tests for B cell function such as by identifying
antibodies to routine immunizations and commonly acquired
infections and by quantifying IgG subclasses, and performing tests
or phagocyte function, such as by measuring the reduction of nitro
blue tetrazolium chloride, and performing assays of chemotaxis and
bactericidal activity. NHR-targeted antisense and RNAi agents may
therefore be used to stimulate or maintain acute inflammation or
acute inflammatory responses in subjects with a primary
immunodeficiency, as described herein and known in the art.
[0305] Examples of causes of secondary immunodeficiencies include
malnutrition, aging, and medications (e.g., chemotherapy,
disease-modifying anti-rheumatic drugs, immunosuppressive drugs
after organ transplants, glucocorticoids). Additional causes
include various cancers, including cancers of the bone marrow and
blood cells (e.g., leukemia, lymphoma, multiple myeloma), and
certain chronic infections, such as acquired immunodeficiency
syndrome (AIDS), caused by the human immunodeficiency virus (HIV).
NHR-targeted antisense and RNAi agents may be used to stimulate or
maintain acute inflammation or acute inflammatory responses in
subjects with an immunodeficiency, as described herein and known in
the art. NHR-targeted antisense and RNAi agents may also be used to
stimulate or maintain chronic inflammation or chronic inflammatory
responses in subjects with a secondary immunodeficiency, as
described herein and known in the art.
[0306] As noted above, certain embodiments include methods of
treating metabolic diseases, whether due to activity or
insufficient activity of a given NHR, such as GR. Examples of
conditions associated with excessive (e.g., chronic, acute) GR or
glucocorticoid activation include diabetes (e.g., insulin
resistance), hypertension, osteoporosis, reduced cognitive
function, and glaucoma. Examples of conditions associated with GR
or glucocorticoid deficiencies include Addison's disease, familial
glucocorticoid deficiency, chronic glucocorticoid deficiency, acute
glucocorticoid defiency, and their associated symptoms, such as
hypoglycemia, hyperpigmentation, muscle weakness, seizures, and
failure to thrive. Additional examples of metabolic diseases
include adrenoleukodystrophy, Krabbe's disease (globoid cell
leukodystrophy), metachromatic leukodystrophy, Alexander's disease,
Canavan's disease (spongiform leukodystrophy), Pelizaeus-Merzbacher
disease, Cockayne's syndrome, Hurler's disease, Lowe's syndrome,
Leigh's disease, Wilson's disease, Hallervorden-Spatz disease,
Tay-Sachs disease, etc. The utility of the NHR-targeted antisense
and RNAi agents of the invention in modulating metabolic processes
may be monitored using any of a variety of techniques known and
available in the art including, for example, assays which measure
adipocyte lipogenesis or adipocyte lipolysis.
[0307] Certain embodiments include modulation of NHRs such as GR
for the treatment of auto-immune conditions. Examples of
auto-immune conditions include but are not limited to, autoimmune
hemolytic anemia, autoimmune neonatal thrombocytopenia, idiopathic
thrombocytopenia purpura, autoimmunocytopenia, hemolytic anemia,
antiphospholipid syndrome, dermatitis, allergic encephalomyelitis,
myocarditis, relapsing polychondritis, rheumatic heart disease,
glomerulonephritis (for example, IgA nephropathy), multiple
sclerosis, neuritis, uveitis ophthalmia, polyendocrinopathies,
purpura (for example, Henloch-Scoenlein purpura), Reiter's disease,
stiff-man syndrome, autoimmune pulmonary inflammation,
Guillain-Barre Syndrome, insulin dependent diabetes mellitus, and
autoimmune inflammatory eye disease.
[0308] Additional autoimmune diseases, disorders or conditions
include, but are not limited to, autoimmune thyroiditis;
hypothyroidism, including Hashimoto's thyroiditis and thyroiditis
characterized, for example, by cell-mediated and humoral thyroid
cytotoxicity; SLE (which is often characterized, for example, by
circulating and locally generated immune complexes); Goodpasture's
syndrome (which is often characterized, for example, by
anti-basement membrane antibodies); pemphigus (which is often
characterized, for example, by epidermal acantholytic antibodies);
receptor autoimmunities such as, for example, Graves' disease
(which is often characterized, for example, by antibodies to a
thyroid stimulating hormone receptor; myasthenia gravis, which is
often characterized, for example, by acetylcholine receptor
antibodies); insulin resistance (which is often characterized, for
example, by insulin receptor antibodies); autoimmune hemolytic
anemia (which is often characterized, for example, by phagocytosis
of antibody-sensitized red blood cells); and autoimmune
thrombocytopenic purpura (which is often characterized, for
example, by phagocytosis of antibody-sensitized platelets).
[0309] Additional examples of conditions that can be treated by the
antisense or RNAi agents provided herein include non-alcoholic
steatohepatitis (e.g., targeting TR), diabetes (e.g., targeting
PPAR), conditions associated with calcium reabsorption and
mobilization (e.g., targeting VDR), cancer (e.g., targeting ER
and/or ERR), birth control/pregnancy related issues (e.g.,
targeting PR), and conditions associated with hormone regulation
such as low testosterone (e.g., targeting AR), among others.
[0310] An effective in vivo treatment regimen using the antisense
oligonucleotides or RNAi agents of the invention may vary according
to the duration, dose, frequency and route of administration, as
well as the condition of the subject under treatment (i.e.,
prophylactic administration versus administration in response to an
existing condition). Accordingly, such in vivo therapy will often
require monitoring by tests appropriate to the particular type of
viral infection under treatment, and corresponding adjustments in
the dose or treatment regimen, in order to achieve an optimal
therapeutic outcome. In certain embodiments, treatment may be
monitored, e.g., by general indicators of inflammation.
Pharmaceutical Formulations
[0311] In certain embodiments, the present invention provides
formulations or compositions suitable for the therapeutic delivery
of antisense oligomers or other agents such as RNAi agents, as
described herein. Hence, in certain embodiments, the present
invention provides pharmaceutically acceptable compositions that
comprise a therapeutically-effective amount of one or more of the
oligomers or agents described herein, formulated together with one
or more pharmaceutically acceptable carriers (additives) and/or
diluents. While it is possible for an oligomer of the present
invention to be administered alone, it is preferable to administer
the compound as a pharmaceutical formulation (composition).
[0312] Methods for the delivery of nucleic acid molecules are
described, for example, in Akhtar et al., 1992, Trends Cell Bio.,
2:139; and Delivery Strategies for Antisense Oligonucleotide
Therapeutics, ed. Akhtar; Sullivan et al., PCT WO 94/02595. These
and other protocols can be utilized for the delivery of virtually
any nucleic acid molecule, including the isolated oligomers of the
present invention.
[0313] As detailed below, the pharmaceutical compositions of the
present invention may be specially formulated for administration in
solid or liquid form, including those adapted for the following:
(1) oral administration, for example, drenches (aqueous or
non-aqueous solutions or suspensions), tablets, e.g., those
targeted for buccal, sublingual, and systemic absorption, boluses,
powders, granules, pastes for application to the tongue; (2)
parenteral administration, for example, by subcutaneous,
intramuscular, intravenous or epidural injection as, for example, a
sterile solution or suspension, or sustained-release formulation;
(3) topical application, for example, as a cream, ointment, or a
controlled-release patch or spray applied to the skin; (4)
intravaginally or intrarectally, for example, as a pessary, cream
or foam; (5) sublingually; (6) ocularly; (7) transdermally; or (8)
nasally.
[0314] The phrase "pharmaceutically acceptable" is employed herein
to refer to those compounds, materials, compositions, and/or dosage
forms which are, within the scope of sound medical judgment,
suitable for use in contact with the tissues of human beings and
animals without excessive toxicity, irritation, allergic response,
or other problem or complication, commensurate with a reasonable
benefit/risk ratio.
[0315] The phrase "pharmaceutically acceptable carrier" as used
herein means a pharmaceutically-acceptable material, composition or
vehicle, such as a liquid or solid filler, diluent, excipient,
manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc
stearate, or steric acid), or solvent encapsulating material,
involved in carrying or transporting the subject compound from one
organ, or portion of the body, to another organ, or portion of the
body. Each carrier must be "acceptable" in the sense of being
compatible with the other ingredients of the formulation and not
injurious to the patient.
[0316] Some examples of materials that can serve as
pharmaceutically-acceptable carriers include, without limitation:
(1) sugars, such as lactose, glucose and sucrose; (2) starches,
such as corn starch and potato starch; (3) cellulose, and its
derivatives, such as sodium carboxymethyl cellulose, ethyl
cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt;
(6) gelatin; (7) talc; (8) excipients, such as cocoa butter and
suppository waxes; (9) oils, such as peanut oil, cottonseed oil,
safflower oil, sesame oil, olive oil, corn oil and soybean oil;
(10) glycols, such as propylene glycol; (11) polyols, such as
glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters,
such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering
agents, such as magnesium hydroxide and aluminum hydroxide; (15)
alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18)
Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions;
(21) polyesters, polycarbonates and/or polyanhydrides; and (22)
other non-toxic compatible substances employed in pharmaceutical
formulations.
[0317] Additional non-limiting examples of agents suitable for
formulation with the antisense oligomers of the instant invention
include: PEG conjugated nucleic acids, phospholipid conjugated
nucleic acids, nucleic acids containing lipophilic moieties,
phosphorothioates, P-glycoprotein inhibitors (such as Pluronic P85)
which can enhance entry of drugs into various tissues;
biodegradable polymers, such as poly (DL-lactide-coglycolide)
microspheres for sustained release delivery after implantation
(Emerich, D F et al., 1999, Cell Transplant, 8, 47-58) Alkermes,
Inc. Cambridge, Mass.; and loaded nanoparticles, such as those made
of polybutylcyanoacrylate, which can deliver drugs across the blood
brain barrier and can alter neuronal uptake mechanisms (Prog
Neuropsychopharmacol Biol Psychiatry, 23, 941-949, 1999).
[0318] The invention also features the use of the composition
comprising surface-modified liposomes containing poly (ethylene
glycol) lipids (PEG-modified, branched and unbranched or
combinations thereof, or long-circulating liposomes or stealth
liposomes). Oligomers of the invention can also comprise covalently
attached PEG molecules of various molecular weights. These
formulations offer a method for increasing the accumulation of
drugs in target tissues. This class of drug carriers resists
opsonization and elimination by the mononuclear phagocytic system
(MPS or RES), thereby enabling longer blood circulation times and
enhanced tissue exposure for the encapsulated drug (Lasic et al.
Chem. Rev. 1995, 95, 2601-2627; Ishiwata et al., Chem. Pharm. Bull.
1995, 43, 1005-1011). Such liposomes have been shown to accumulate
selectively in tumors, presumably by extravasation and capture in
the neovascularized target tissues (Lasic et al., Science 1995,
267, 1275-1276; Oku et al., 1995, Biochim. Biophys. Acta, 1238,
86-90). The long-circulating liposomes enhance the pharmacokinetics
and pharmacodynamics of DNA and RNA, particularly compared to
conventional cationic liposomes which are known to accumulate in
tissues of the MPS (Liu et al., J. Biol. Chem. 1995, 42,
24864-24870; Choi et al., International PCT Publication No. WO
96/10391; Ansell et al., International PCT Publication No. WO
96/10390; Holland et al., International PCT Publication No. WO
96/10392). Long-circulating liposomes are also likely to protect
drugs from nuclease degradation to a greater extent compared to
cationic liposomes, based on their ability to avoid accumulation in
metabolically aggressive MPS tissues such as the liver and
spleen.
[0319] In a further embodiment, the present invention includes
oligomer compositions prepared for delivery as described in U.S.
Pat. Nos. 6,692,911, 7,163,695 and 7,070,807. In this regard, in
one embodiment, the present invention provides an oligomer of the
present invention in a composition comprising copolymers of lysine
and histidine (HK) as described in U.S. Pat. Nos. 7,163,695,
7,070,807, and 6,692,911 either alone or in combination with PEG
(e.g., branched or unbranched PEG or a mixture of both), in
combination with PEG and a targeting moiety or any of the foregoing
in combination with a crosslinking agent. In certain embodiments,
the present invention provides antisense oligomers in compositions
comprising gluconic-acid-modified polyhistidine or
gluconylated-polyhistidine/transferrin-polylysine. One skilled in
the art will also recognize that amino acids with properties
similar to His and Lys may be substituted within the
composition.
[0320] Certain embodiments of the oligomers described herein may
contain a basic functional group, such as amino or alkylamino, and
are, thus, capable of forming pharmaceutically-acceptable salts
with pharmaceutically-acceptable acids. The term
"pharmaceutically-acceptable salts" in this respect, refers to the
relatively non-toxic, inorganic and organic acid addition salts of
compounds of the present invention. These salts can be prepared in
situ in the administration vehicle or the dosage form manufacturing
process, or by separately reacting a purified compound of the
invention in its free base form with a suitable organic or
inorganic acid, and isolating the salt thus formed during
subsequent purification. Representative salts include the
hydrobromide, hydrochloride, sulfate, bisulfate, phosphate,
nitrate, acetate, valerate, oleate, palmitate, stearate, laurate,
benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate,
succinate, tartrate, napthylate, mesylate, glucoheptonate,
lactobionate, and laurylsulphonate salts and the like. (See, e.g.,
Berge et al. (1977) "Pharmaceutical Salts", J. Pharm. Sci.
66:1-19).
[0321] The pharmaceutically acceptable salts of the subject
oligomers include the conventional nontoxic salts or quaternary
ammonium salts of the compounds, e.g., from non-toxic organic or
inorganic acids. For example, such conventional nontoxic salts
include those derived from inorganic acids such as hydrochloride,
hydrobromic, sulfuric, sulfamic, phosphoric, nitric, and the like;
and the salts prepared from organic acids such as acetic,
propionic, succinic, glycolic, stearic, lactic, malic, tartaric,
citric, ascorbic, palmitic, maleic, hydroxymaleic, phenylacetic,
glutamic, benzoic, salicyclic, sulfanilic, 2-acetoxybenzoic,
fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic,
oxalic, isothionic, and the like.
[0322] In certain embodiments, the oligomers of the present
invention may contain one or more acidic functional groups and,
thus, are capable of forming pharmaceutically acceptable salts with
pharmaceutically acceptable bases. The term "pharmaceutically
acceptable salts" in these instances refers to the relatively
non-toxic, inorganic and organic base addition salts of compounds
of the present invention. These salts can likewise be prepared in
situ in the administration vehicle or the dosage form manufacturing
process, or by separately reacting the purified compound in its
free acid form with a suitable base, such as the hydroxide,
carbonate or bicarbonate of a pharmaceutically-acceptable metal
cation, with ammonia, or with a pharmaceutically-acceptable organic
primary, secondary or tertiary amine. Representative alkali or
alkaline earth salts include the lithium, sodium, potassium,
calcium, magnesium, and aluminum salts and the like. Representative
organic amines useful for the formation of base addition salts
include ethylamine, diethylamine, ethylenediamine, ethanolamine,
diethanolamine, piperazine and the like. (See, e.g., Berge et al.,
supra).
[0323] Wetting agents, emulsifiers and lubricants, such as sodium
lauryl sulfate and magnesium stearate, as well as coloring agents,
release agents, coating agents, sweetening, flavoring and perfuming
agents, preservatives and antioxidants can also be present in the
compositions.
[0324] Examples of pharmaceutically-acceptable antioxidants
include: (1) water soluble antioxidants, such as ascorbic acid,
cysteine hydrochloride, sodium bisulfate, sodium metabisulfite,
sodium sulfite and the like; (2) oil-soluble antioxidants, such as
ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated
hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol,
and the like; and (3) metal chelating agents, such as citric acid,
ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid,
phosphoric acid, and the like.
[0325] Formulations of the present invention include those suitable
for oral, nasal, topical (including buccal and sublingual), rectal,
vaginal and/or parenteral administration. The formulations may
conveniently be presented in unit dosage form and may be prepared
by any methods well known in the art of pharmacy. The amount of
active ingredient that can be combined with a carrier material to
produce a single dosage form will vary depending upon the host
being treated, the particular mode of administration. The amount of
active ingredient which can be combined with a carrier material to
produce a single dosage form will generally be that amount of the
compound which produces a therapeutic effect. Generally, out of one
hundred percent, this amount will range from about 0.1 percent to
about ninety-nine percent of active ingredient, preferably from
about 5 percent to about 70 percent, most preferably from about 10
percent to about 30 percent.
[0326] In certain embodiments, a formulation of the present
invention comprises an excipient selected from cyclodextrins,
celluloses, liposomes, micelle forming agents, e.g., bile acids,
and polymeric carriers, e.g., polyesters and polyanhydrides; and an
oligomer of the present invention. In certain embodiments, an
aforementioned formulation renders orally bioavailable an oligomer
of the present invention.
[0327] Methods of preparing these formulations or compositions
include the step of bringing into association an oligomer of the
present invention with the carrier and, optionally, one or more
accessory ingredients. In general, the formulations are prepared by
uniformly and intimately bringing into association a compound of
the present invention with liquid carriers, or finely divided solid
carriers, or both, and then, if necessary, shaping the product.
[0328] Formulations of the invention suitable for oral
administration may be in the form of capsules, cachets, pills,
tablets, lozenges (using a flavored basis, usually sucrose and
acacia or tragacanth), powders, granules, or as a solution or a
suspension in an aqueous or non-aqueous liquid, or as an
oil-in-water or water-in-oil liquid emulsion, or as an elixir or
syrup, or as pastilles (using an inert base, such as gelatin and
glycerin, or sucrose and acacia) and/or as mouth washes and the
like, each containing a predetermined amount of a compound of the
present invention as an active ingredient. An oligomer of the
present invention may also be administered as a bolus, electuary or
paste.
[0329] In solid dosage forms of the invention for oral
administration (capsules, tablets, pills, dragees, powders,
granules, trouches and the like), the active ingredient may be
mixed with one or more pharmaceutically-acceptable carriers, such
as sodium citrate or dicalcium phosphate, and/or any of the
following: (1) fillers or extenders, such as starches, lactose,
sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such
as, for example, carboxymethylcellulose, alginates, gelatin,
polyvinyl pyrrolidone, sucrose and/or acacia; (3) humectants, such
as glycerol; (4) disintegrating agents, such as agar-agar, calcium
carbonate, potato or tapioca starch, alginic acid, certain
silicates, and sodium carbonate; (5) solution retarding agents,
such as paraffin; (6) absorption accelerators, such as quaternary
ammonium compounds and surfactants, such as poloxamer and sodium
lauryl sulfate; (7) wetting agents, such as, for example, cetyl
alcohol, glycerol monostearate, and non-ionic surfactants; (8)
absorbents, such as kaolin and bentonite clay; (9) lubricants, such
as talc, calcium stearate, magnesium stearate, solid polyethylene
glycols, sodium lauryl sulfate, zinc stearate, sodium stearate,
stearic acid, and mixtures thereof; (10) coloring agents; and (11)
controlled release agents such as crospovidone or ethyl cellulose.
In the case of capsules, tablets and pills, the pharmaceutical
compositions may also comprise buffering agents. Solid compositions
of a similar type may also be employed as fillers in soft and
hard-shelled gelatin capsules using such excipients as lactose or
milk sugars, as well as high molecular weight polyethylene glycols
and the like.
[0330] A tablet may be made by compression or molding, optionally
with one or more accessory ingredients. Compressed tablets may be
prepared using binder (e.g., gelatin or hydroxypropylmethyl
cellulose), lubricant, inert diluent, preservative, disintegrant
(for example, sodium starch glycolate or cross-linked sodium
carboxymethyl cellulose), surface-active or dispersing agent.
Molded tablets may be made by molding in a suitable machine a
mixture of the powdered compound moistened with an inert liquid
diluent.
[0331] The tablets, and other solid dosage forms of the
pharmaceutical compositions of the present invention, such as
dragees, capsules, pills and granules, may optionally be scored or
prepared with coatings and shells, such as enteric coatings and
other coatings well known in the pharmaceutical-formulating art.
They may also be formulated so as to provide slow or controlled
release of the active ingredient therein using, for example,
hydroxypropylmethyl cellulose in varying proportions to provide the
desired release profile, other polymer matrices, liposomes and/or
microspheres. They may be formulated for rapid release, e.g.,
freeze-dried. They may be sterilized by, for example, filtration
through a bacteria-retaining filter, or by incorporating
sterilizing agents in the form of sterile solid compositions which
can be dissolved in sterile water, or some other sterile injectable
medium immediately before use. These compositions may also
optionally contain opacifying agents and may be of a composition
that they release the active ingredient(s) only, or preferentially,
in a certain portion of the gastrointestinal tract, optionally, in
a delayed manner. Examples of embedding compositions which can be
used include polymeric substances and waxes. The active ingredient
can also be in micro-encapsulated form, if appropriate, with one or
more of the above-described excipients.
[0332] Liquid dosage forms for oral administration of the compounds
of the invention include pharmaceutically acceptable emulsions,
microemulsions, solutions, suspensions, syrups and elixirs. In
addition to the active ingredient, the liquid dosage forms may
contain inert diluents commonly used in the art, such as, for
example, water or other solvents, solubilizing agents and
emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl
carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate,
propylene glycol, 1,3-butylene glycol, oils (in particular,
cottonseed, groundnut, corn, germ, olive, castor and sesame oils),
glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty
acid esters of sorbitan, and mixtures thereof.
[0333] Besides inert diluents, the oral compositions can also
include adjuvants such as wetting agents, emulsifying and
suspending agents, sweetening, flavoring, coloring, perfuming and
preservative agents.
[0334] Suspensions, in addition to the active compounds, may
contain suspending agents as, for example, ethoxylated isostearyl
alcohols, polyoxyethylene sorbitol and sorbitan esters,
microcrystalline cellulose, aluminum metahydroxide, bentonite,
agar-agar and tragacanth, and mixtures thereof.
[0335] Formulations for rectal or vaginal administration may be
presented as a suppository, which may be prepared by mixing one or
more compounds of the invention with one or more suitable
nonirritating excipients or carriers comprising, for example, cocoa
butter, polyethylene glycol, a suppository wax or a salicylate, and
which is solid at room temperature, but liquid at body temperature
and, therefore, will melt in the rectum or vaginal cavity and
release the active compound.
[0336] Formulations or dosage forms for the topical or transdermal
administration of an oligomer as provided herein include powders,
sprays, ointments, pastes, creams, lotions, gels, solutions,
patches and inhalants. The active oligomers may be mixed under
sterile conditions with a pharmaceutically-acceptable carrier, and
with any preservatives, buffers, or propellants which may be
required. The ointments, pastes, creams and gels may contain, in
addition to an active compound of this invention, excipients, such
as animal and vegetable fats, oils, waxes, paraffins, starch,
tragacanth, cellulose derivatives, polyethylene glycols, silicones,
bentonites, silicic acid, talc and zinc oxide, or mixtures
thereof.
[0337] Powders and sprays can contain, in addition to an oligomer
of the present invention, excipients such as lactose, talc, silicic
acid, aluminum hydroxide, calcium silicates and polyamide powder,
or mixtures of these substances. Sprays can additionally contain
customary propellants, such as chlorofluorohydrocarbons and
volatile unsubstituted hydrocarbons, such as butane and
propane.
[0338] Transdermal patches have the added advantage of providing
controlled delivery of an oligomer of the present invention to the
body. Such dosage forms can be made by dissolving or dispersing the
oligomer in the proper medium. Absorption enhancers can also be
used to increase the flux of the agent across the skin. The rate of
such flux can be controlled by either providing a rate controlling
membrane or dispersing the agent in a polymer matrix or gel, among
other methods known in the art.
[0339] Pharmaceutical compositions suitable for parenteral
administration may comprise one or more oligomers of the invention
in combination with one or more pharmaceutically-acceptable sterile
isotonic aqueous or nonaqueous solutions, dispersions, suspensions
or emulsions, or sterile powders which may be reconstituted into
sterile injectable solutions or dispersions just prior to use,
which may contain sugars, alcohols, antioxidants, buffers,
bacteriostats, solutes which render the formulation isotonic with
the blood of the intended recipient or suspending or thickening
agents. Examples of suitable aqueous and nonaqueous carriers which
may be employed in the pharmaceutical compositions of the invention
include water, ethanol, polyols (such as glycerol, propylene
glycol, polyethylene glycol, and the like), and suitable mixtures
thereof, vegetable oils, such as olive oil, and injectable organic
esters, such as ethyl oleate. Proper fluidity can be maintained,
for example, by the use of coating materials, such as lecithin, by
the maintenance of the required particle size in the case of
dispersions, and by the use of surfactants.
[0340] These compositions may also contain adjuvants such as
preservatives, wetting agents, emulsifying agents and dispersing
agents. Prevention of the action of microorganisms upon the subject
oligomers may be ensured by the inclusion of various antibacterial
and antifungal agents, for example, paraben, chlorobutanol, phenol
sorbic acid, and the like. It may also be desirable to include
isotonic agents, such as sugars, sodium chloride, and the like into
the compositions. In addition, prolonged absorption of the
injectable pharmaceutical form may be brought about by the
inclusion of agents which delay absorption such as aluminum
monostearate and gelatin.
[0341] In some cases, in order to prolong the effect of a drug, it
is desirable to slow the absorption of the drug from subcutaneous
or intramuscular injection. This may be accomplished by the use of
a liquid suspension of crystalline or amorphous material having
poor water solubility, among other methods known in the art. The
rate of absorption of the drug then depends upon its rate of
dissolution which, in turn, may depend upon crystal size and
crystalline form. Alternatively, delayed absorption of a
parenterally-administered drug form is accomplished by dissolving
or suspending the drug in an oil vehicle.
[0342] Injectable depot forms may be made by forming microencapsule
matrices of the subject oligomers in biodegradable polymers such as
polylactide-polyglycolide. Depending on the ratio of oligomer to
polymer, and the nature of the particular polymer employed, the
rate of oligomer release can be controlled. Examples of other
biodegradable polymers include poly(orthoesters) and
poly(anhydrides). Depot injectable formulations may also prepared
by entrapping the drug in liposomes or microemulsions that are
compatible with body tissues.
[0343] When the oligomers of the present invention are administered
as pharmaceuticals, to humans and animals, they can be given per se
or as a pharmaceutical composition containing, for example, 0.1 to
99% (more preferably, 10 to 30%) of active ingredient in
combination with a pharmaceutically acceptable carrier.
[0344] As noted above, the formulations or preparations of the
present invention may be given orally, parenterally, topically, or
rectally. They are typically given in forms suitable for each
administration route. For example, they are administered in tablets
or capsule form, by injection, inhalation, eye lotion, ointment,
suppository, etc. administration by injection, infusion or
inhalation; topical by lotion or ointment; and rectal by
suppositories.
[0345] The phrases "parenteral administration" and "administered
parenterally" as used herein means modes of administration other
than enteral and topical administration, usually by injection, and
includes, without limitation, intravenous, intramuscular,
intraarterial, intrathecal, intracapsular, intraorbital,
intracardiac, intradermal, intraperitoneal, transtracheal,
subcutaneous, subcuticular, intraarticulare, subcapsular,
subarachnoid, intraspinal and intrasternal injection and
infusion.
[0346] The phrases "systemic administration," "administered
systemically," "peripheral administration" and "administered
peripherally" as used herein mean the administration of a compound,
drug or other material other than directly into the central nervous
system, such that it enters the patient's system and, thus, is
subject to metabolism and other like processes, for example,
subcutaneous administration.
[0347] Regardless of the route of administration selected, the
oligomers of the present invention, which may be used in a suitable
hydrated form, and/or the pharmaceutical compositions of the
present invention, may be formulated into
pharmaceutically-acceptable dosage forms by conventional methods
known to those of skill in the art. Actual dosage levels of the
active ingredients in the pharmaceutical compositions of this
invention may be varied so as to obtain an amount of the active
ingredient which is effective to achieve the desired therapeutic
response for a particular patient, composition, and mode of
administration, without being unacceptably toxic to the
patient.
[0348] The selected dosage level will depend upon a variety of
factors including the activity of the particular oligomer of the
present invention employed, or the ester, salt or amide thereof,
the route of administration, the time of administration, the rate
of excretion or metabolism of the particular oligomer being
employed, the rate and extent of absorption, the duration of the
treatment, other drugs, compounds and/or materials used in
combination with the particular oligomer employed, the age, sex,
weight, condition, general health and prior medical history of the
patient being treated, and like factors well known in the medical
arts.
[0349] A physician or veterinarian having ordinary skill in the art
can readily determine and prescribe the effective amount of the
pharmaceutical composition required. For example, the physician or
veterinarian could start doses of the compounds of the invention
employed in the pharmaceutical composition at levels lower than
that required in order to achieve the desired therapeutic effect
and gradually increase the dosage until the desired effect is
achieved. In general, a suitable daily dose of a compound of the
invention will be that amount of the compound which is the lowest
dose effective to produce a therapeutic effect. Such an effective
dose will generally depend upon the factors described above.
Generally, oral, intravenous, intracerebroventricular and
subcutaneous doses of the compounds of this invention for a
patient, when used for the indicated effects, will range from about
0.0001 to about 100 mg per kilogram of body weight per day.
[0350] If desired, the effective daily dose of the active compound
may be administered as two, three, four, five, six or more
sub-doses administered separately at appropriate intervals
throughout the day, optionally, in unit dosage forms. In certain
situations, dosing is one administration per day. In certain
embodiments, dosing is one or more administration per every 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days, or every 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12 weeks, or every 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12 months, as needed, to treat the desired condition.
[0351] Nucleic acid molecules can be administered to cells by a
variety of methods known to those familiar to the art, including,
but not restricted to, encapsulation in liposomes, by
iontophoresis, or by incorporation into other vehicles, such as
hydrogels, cyclodextrins, biodegradable nanocapsules, and
bioadhesive microspheres, as described herein and known in the art.
In certain embodiments, microemulsification technology may be
utilized to improve bioavailability of lipophilic (water insoluble)
pharmaceutical agents. Examples include Trimetrine (Dordunoo, S.
K., et al., Drug Development and Industrial Pharmacy, 17(12),
1685-1713, 1991 and REV 5901 (Sheen, P. C., et al., J Pharm Sci
80(7), 712-714, 1991). Among other benefits, microemulsification
provides enhanced bioavailability by preferentially directing
absorption to the lymphatic system instead of the circulatory
system, which thereby bypasses the liver, and prevents destruction
of the compounds in the hepatobiliary circulation.
[0352] In one aspect of invention, the formulations contain
micelles formed from an oligomer as provided herein and at least
one amphiphilic carrier, in which the micelles have an average
diameter of less than about 100 nm. More preferred embodiments
provide micelles having an average diameter less than about 50 nm,
and even more preferred embodiments provide micelles having an
average diameter less than about 30 nm, or even less than about 20
nm.
[0353] While all suitable amphiphilic carriers are contemplated,
the presently preferred carriers are generally those that have
Generally-Recognized-as-Safe (GRAS) status, and that can both
solubilize the compound of the present invention and microemulsify
it at a later stage when the solution comes into a contact with a
complex water phase (such as one found in human gastro-intestinal
tract). Usually, amphiphilic ingredients that satisfy these
requirements have HLB (hydrophilic to lipophilic balance) values of
2-20, and their structures contain straight chain aliphatic
radicals in the range of C-6 to C-20. Examples are
polyethylene-glycolized fatty glycerides and polyethylene
glycols.
[0354] Examples of amphiphilic carriers include saturated and
monounsaturated polyethyleneglycolyzed fatty acid glycerides, such
as those obtained from fully or partially hydrogenated various
vegetable oils. Such oils may advantageously consist of tri-, di-,
and mono-fatty acid glycerides and di- and mono-polyethyleneglycol
esters of the corresponding fatty acids, with a particularly
preferred fatty acid composition including capric acid 4-10, capric
acid 3-9, lauric acid 40-50, myristic acid 14-24, palmitic acid
4-14 and stearic acid 5-15%. Another useful class of amphiphilic
carriers includes partially esterified sorbitan and/or sorbitol,
with saturated or mono-unsaturated fatty acids (SPAN-series) or
corresponding ethoxylated analogs (TWEEN-series).
[0355] Commercially available amphiphilic carriers may be
particularly useful, including Gelucire-series, Labrafil, Labrasol,
or Lauroglycol (all manufactured and distributed by Gattefosse
Corporation, Saint Priest, France), PEG-mono-oleate, PEG-di-oleate,
PEG-mono-laurate and di-laurate, Lecithin, Polysorbate 80, etc
(produced and distributed by a number of companies in USA and
worldwide).
[0356] In certain embodiments, the delivery may occur by use of
liposomes, nanocapsules, microparticles, microspheres, lipid
particles, vesicles, and the like, for the introduction of the
compositions of the present invention into suitable host cells. In
particular, the compositions of the present invention may be
formulated for delivery either encapsulated in a lipid particle, a
liposome, a vesicle, a nanosphere, a nanoparticle or the like. The
formulation and use of such delivery vehicles can be carried out
using known and conventional techniques.
[0357] Hydrophilic polymers suitable for use in the present
invention are those which are readily water-soluble, can be
covalently attached to a vesicle-forming lipid, and which are
tolerated in vivo without toxic effects (i.e., are biocompatible).
Suitable polymers include polyethylene glycol (PEG), polylactic
(also termed polylactide), polyglycolic acid (also termed
polyglycolide), a polylactic-polyglycolic acid copolymer, and
polyvinyl alcohol. In certain embodiments, polymers have a
molecular weight of from about 100 or 120 daltons up to about 5,000
or 10,000 daltons, or from about 300 daltons to about 5,000
daltons. In other embodiments, the polymer is polyethyleneglycol
having a molecular weight of from about 100 to about 5,000 daltons,
or having a molecular weight of from about 300 to about 5,000
daltons. In certain embodiments, the polymer is polyethyleneglycol
of 750 daltons (PEG(750)). Polymers may also be defined by the
number of monomers therein; a preferred embodiment of the present
invention utilizes polymers of at least about three monomers, such
PEG polymers consisting of three monomers (approximately 150
daltons).
[0358] Other hydrophilic polymers which may be suitable for use in
the present invention include polyvinylpyrrolidone,
polymethoxazoline, polyethyloxazoline, polyhydroxypropyl
methacrylamide, polymethacrylamide, polydimethylacrylamide, and
derivatized celluloses such as hydroxymethylcellulose or
hydroxyethylcellulose.
[0359] In certain embodiments, a formulation of the present
invention comprises a biocompatible polymer selected from the group
consisting of polyamides, polycarbonates, polyalkylenes, polymers
of acrylic and methacrylic esters, polyvinyl polymers,
polyglycolides, polysiloxanes, polyurethanes and co-polymers
thereof, celluloses, polypropylene, polyethylenes, polystyrene,
polymers of lactic acid and glycolic acid, polyanhydrides,
poly(ortho)esters, poly(butic acid), poly(valeric acid),
poly(lactide-co-caprolactone), polysaccharides, proteins,
polyhyaluronic acids, polycyanoacrylates, and blends, mixtures, or
copolymers thereof.
[0360] Cyclodextrins are cyclic oligosaccharides, consisting of 6,
7 or 8 glucose units, designated by the Greek letter .alpha.,
.beta.. or .gamma., respectively. The glucose units are linked by
.alpha.-1,4-glucosidic bonds. As a consequence of the chair
conformation of the sugar units, all secondary hydroxyl groups (at
C-2, C-3) are located on one side of the ring, while all the
primary hydroxyl groups at C-6 are situated on the other side. As a
result, the external faces are hydrophilic, making the
cyclodextrins water-soluble. In contrast, the cavities of the
cyclodextrins are hydrophobic, since they are lined by the hydrogen
of atoms C-3 and C-5, and by ether-like oxygens. These matrices
allow complexation with a variety of relatively hydrophobic
compounds, including, for instance, steroid compounds such as
17.alpha.-estradiol (see, e.g., van Uden et al. Plant Cell Tiss.
Org. Cult. 38:1-3-113 (1994)). The complexation takes place by Van
der Waals interactions and by hydrogen bond formation. For a
general review of the chemistry of cyclodextrins, see, Wenz, Agnew.
Chem. Int. Ed. Engl., 33:803-822 (1994).
[0361] The physico-chemical properties of the cyclodextrin
derivatives depend strongly on the kind and the degree of
substitution. For example, their solubility in water ranges from
insoluble (e.g., triacetyl-beta-cyclodextrin) to 147% soluble (w/v)
(G-2-beta-cyclodextrin). In addition, they are soluble in many
organic solvents. The properties of the cyclodextrins enable the
control over solubility of various formulation components by
increasing or decreasing their solubility.
[0362] Numerous cyclodextrins and methods for their preparation
have been described. For example, Parmeter (I), et al. (U.S. Pat.
No. 3,453,259) and Gramera, et al. (U.S. Pat. No. 3,459,731)
described electroneutral cyclodextrins. Other derivatives include
cyclodextrins with cationic properties [Parmeter (II), U.S. Pat.
No. 3,453,257], insoluble crosslinked cyclodextrins (Solms, U.S.
Pat. No. 3,420,788), and cyclodextrins with anionic properties
[Parmeter (III), U.S. Pat. No. 3,426,011]. Among the cyclodextrin
derivatives with anionic properties, carboxylic acids, phosphorous
acids, phosphinous acids, phosphonic acids, phosphoric acids,
thiophosphonic acids, thiosulphinic acids, and sulfonic acids have
been appended to the parent cyclodextrin [see, Parmeter (III),
supra]. Furthermore, sulfoalkyl ether cyclodextrin derivatives have
been described by Stella, et al. (U.S. Pat. No. 5,134,127).
[0363] Liposomes consist of at least one lipid bilayer membrane
enclosing an aqueous internal compartment. Liposomes may be
characterized by membrane type and by size. Small unilamellar
vesicles (SUVs) have a single membrane and typically range between
0.02 and 0.05 .mu.m in diameter; large unilamellar vesicles (LUVS)
are typically larger than 0.05 .mu.m. Oligolamellar large vesicles
and multilamellar vesicles have multiple, usually concentric,
membrane layers and are typically larger than 0.1 .mu.m. Liposomes
with several nonconcentric membranes, i.e., several smaller
vesicles contained within a larger vesicle, are termed
multivesicular vesicles.
[0364] One aspect of the present invention relates to formulations
comprising liposomes containing an oligomer of the present
invention, where the liposome membrane is formulated to provide a
liposome with increased carrying capacity. Alternatively or in
addition, the compound of the present invention may be contained
within, or adsorbed onto, the liposome bilayer of the liposome. An
oligomer of the present invention may be aggregated with a lipid
surfactant and carried within the liposome's internal space; in
these cases, the liposome membrane is formulated to resist the
disruptive effects of the active agent-surfactant aggregate.
[0365] According to one embodiment of the present invention, the
lipid bilayer of a liposome contains lipids derivatized with
polyethylene glycol (PEG), such that the PEG chains extend from the
inner surface of the lipid bilayer into the interior space
encapsulated by the liposome, and extend from the exterior of the
lipid bilayer into the surrounding environment.
[0366] Active agents contained within liposomes of the present
invention are in solubilized form. Aggregates of surfactant and
active agent (such as emulsions or micelles containing the active
agent of interest) may be entrapped within the interior space of
liposomes according to the present invention. A surfactant acts to
disperse and solubilize the active agent, and may be selected from
any suitable aliphatic, cycloaliphatic or aromatic surfactant,
including but not limited to biocompatible lysophosphatidylcholines
(LPCs) of varying chain lengths (for example, from about C14 to
about C20). Polymer-derivatized lipids such as PEG-lipids may also
be utilized for micelle formation as they will act to inhibit
micelle/membrane fusion, and as the addition of a polymer to
surfactant molecules decreases the CMC of the surfactant and aids
in micelle formation. Preferred are surfactants with CMCs in the
micromolar range; higher CMC surfactants may be utilized to prepare
micelles entrapped within liposomes of the present invention.
[0367] Liposomes according to the present invention may be prepared
by any of a variety of techniques that are known in the art. See,
e.g., U.S. Pat. No. 4,235,871; Published PCT applications WO
96/14057; New RRC, Liposomes: A practical approach, IRL Press,
Oxford (1990), pages 33-104; Lasic D D, Liposomes from physics to
applications, Elsevier Science Publishers BV, Amsterdam, 1993. For
example, liposomes of the present invention may be prepared by
diffusing a lipid derivatized with a hydrophilic polymer into
preformed liposomes, such as by exposing preformed liposomes to
micelles composed of lipid-grafted polymers, at lipid
concentrations corresponding to the final mole percent of
derivatized lipid which is desired in the liposome. Liposomes
containing a hydrophilic polymer can also be formed by
homogenization, lipid-field hydration, or extrusion techniques, as
are known in the art.
[0368] In another exemplary formulation procedure, the active agent
is first dispersed by sonication in a lysophosphatidylcholine or
other low CMC surfactant (including polymer grafted lipids) that
readily solubilizes hydrophobic molecules. The resulting micellar
suspension of active agent is then used to rehydrate a dried lipid
sample that contains a suitable mole percent of polymer-grafted
lipid, or cholesterol. The lipid and active agent suspension is
then formed into liposomes using extrusion techniques as are known
in the art, and the resulting liposomes separated from the
unencapsulated solution by standard column separation.
[0369] In one aspect of the present invention, the liposomes are
prepared to have substantially homogeneous sizes in a selected size
range. One effective sizing method involves extruding an aqueous
suspension of the liposomes through a series of polycarbonate
membranes having a selected uniform pore size; the pore size of the
membrane will correspond roughly with the largest sizes of
liposomes produced by extrusion through that membrane. See e.g.,
U.S. Pat. No. 4,737,323 (Apr. 12, 1988). In certain embodiments,
reagents such as DharmaFECT.RTM. and Lipofectamine.RTM. may be
utilized to introduce polynucleotides or proteins into cells.
[0370] The release characteristics of a formulation of the present
invention depend on the encapsulating material, the concentration
of encapsulated drug, and the presence of release modifiers. For
example, release can be manipulated to be pH dependent, for
example, using a pH sensitive coating that releases only at a low
pH, as in the stomach, or a higher pH, as in the intestine. An
enteric coating can be used to prevent release from occurring until
after passage through the stomach. Multiple coatings or mixtures of
cyanamide encapsulated in different materials can be used to obtain
an initial release in the stomach, followed by later release in the
intestine. Release can also be manipulated by inclusion of salts or
pore forming agents, which can increase water uptake or release of
drug by diffusion from the capsule. Excipients which modify the
solubility of the drug can also be used to control the release
rate. Agents which enhance degradation of the matrix or release
from the matrix can also be incorporated. They can be added to the
drug, added as a separate phase (i.e., as particulates), or can be
co-dissolved in the polymer phase depending on the compound. In
most cases the amount should be between 0.1 and thirty percent (w/w
polymer). Types of degradation enhancers include inorganic salts
such as ammonium sulfate and ammonium chloride, organic acids such
as citric acid, benzoic acid, and ascorbic acid, inorganic bases
such as sodium carbonate, potassium carbonate, calcium carbonate,
zinc carbonate, and zinc hydroxide, and organic bases such as
protamine sulfate, spermine, choline, ethanolamine, diethanolamine,
and triethanolamine and surfactants such as Tween.RTM. and
Pluronic.RTM.. Pore forming agents which add microstructure to the
matrices (i.e., water soluble compounds such as inorganic salts and
sugars) are added as particulates. The range is typically between
one and thirty percent (w/w polymer).
[0371] Uptake can also be manipulated by altering residence time of
the particles in the gut. This can be achieved, for example, by
coating the particle with, or selecting as the encapsulating
material, a mucosal adhesive polymer. Examples include most
polymers with free carboxyl groups, such as chitosan, celluloses,
and especially polyacrylates (as used herein, polyacrylates refers
to polymers including acrylate groups and modified acrylate groups
such as cyanoacrylates and methacrylates).
[0372] An oligomer may be formulated to be contained within, or,
adapted to release by a surgical or medical device or implant. In
certain aspects, an implant may be coated or otherwise treated with
an oligomer. For example, hydrogels, or other polymers, such as
biocompatible and/or biodegradable polymers, may be used to coat an
implant with the compositions of the present invention (i.e., the
composition may be adapted for use with a medical device by using a
hydrogel or other polymer). Polymers and copolymers for coating
medical devices with an agent are well-known in the art. Examples
of implants include, but are not limited to, stents, drug-eluting
stents, sutures, prosthesis, vascular catheters, dialysis
catheters, vascular grafts, prosthetic heart valves, cardiac
pacemakers, implantable cardioverter defibrillators, IV needles,
devices for bone setting and formation, such as pins, screws,
plates, and other devices, and artificial tissue matrices for wound
healing.
[0373] In addition to the methods provided herein, the oligomers
for use according to the invention may be formulated for
administration in any convenient way for use in human or veterinary
medicine, by analogy with other pharmaceuticals. The antisense
oligomers and their corresponding formulations may be administered
alone or in combination with other therapeutic strategies in the
treatment of inflammation.
[0374] In accordance with the invention, routes of antisense
oligomer delivery include, but are not limited to, various systemic
routes, including oral and parenteral routes, e.g., intravenous,
subcutaneous, intraperitoneal, and intramuscular, as well as
inhalation, transdermal, pulmonary and topical delivery. The
appropriate route may be determined by one of skill in the art, as
appropriate to the condition of the subject under treatment. For
example, an appropriate route for delivery of an antisense oligomer
in the treatment of a condition of the skin may include topical
delivery, while delivery of a antisense oligomer for the treatment
of a respiratory condition (e.g., COPD) may include inhalation,
intranasal or pulmonary delivery. The oligomer may also be
delivered directly to the site of inflammation infection, or to the
bloodstream.
[0375] The antisense oligomer may be administered in any convenient
vehicle which is physiologically acceptable. Such a composition may
include any of a variety of standard pharmaceutically acceptable
carriers employed by those of ordinary skill in the art. Examples
include, but are not limited to, saline, phosphate buffered saline
(PBS), water, aqueous ethanol, emulsions, such as oil/water
emulsions or triglyceride emulsions, tablets and capsules. The
choice of suitable physiologically acceptable carrier will vary
dependent upon the chosen mode of administration.
[0376] In some instances, as noted above, liposomes may be employed
to facilitate uptake of the antisense oligonucleotide into cells.
(See, e.g., Williams, S. A., Leukemia 10(12):1980-1989, 1996;
Lappalainen et al., Antiviral Res. 23:119, 1994; Uhlmann et al.,
antisense oligonucleotides: a new therapeutic principle, Chemical
Reviews, Volume 90, No. 4, pages 544-584, 1990; Gregoriadis, G.,
Chapter 14, Liposomes, Drug Carriers in Biology and Medicine, pp.
287-341, Academic Press, 1979). Hydrogels may also be used as
vehicles for antisense oligomer administration, for example, as
described in WO 93/01286 or PCT Application No US1992/005305.
Alternatively, the oligonucleotides may be administered in
microspheres or microparticles. (See, e.g., Wu, G. Y. and Wu, C.
H., J. Biol. Chem. 262:4429-4432, 1987). Alternatively, the use of
gas-filled microbubbles complexed with the antisense oligomers can
enhance delivery to target tissues, as described in U.S. Pat. No.
6,245,747.
[0377] Sustained release compositions may also be used. These may
include semipermeable polymeric matrices in the form of shaped
articles such as films or microcapsules.
[0378] In one aspect of the method, the subject is a human subject,
e.g., a patient diagnosed as having a localized or systemic
inflammatory condition. The condition of a patient may also dictate
prophylactic administration of an antisense oligomer of the
invention, e.g., in the case of a patient who (1) is
immunocompromised; (2) is a burn victim; (3) has an indwelling
catheter; or (4) is about to undergo or has recently undergone
surgery. In one preferred embodiment, the oligomer is a
phosphorodiamidate morpholino oligomer, contained in a
pharmaceutically acceptable carrier, and is delivered orally. In
another preferred embodiment, the oligomer is a phosphorodiamidate
morpholino oligomer, contained in a pharmaceutically acceptable
carrier, and is delivered intravenously (i.v.).
[0379] In certain embodiments, the antisense compounds may be
administered in an amount and manner effective to result in a peak
blood concentration of at least 200-400 nM antisense oligomer.
Typically, one or more doses of antisense oligomer are
administered, generally at regular intervals, for a period of about
one to two weeks. Preferred doses for oral administration are from
about 1-100 mg oligomer per 70 kg. In some cases, doses of greater
than 100 mg oligomer/patient may be necessary. For i.v.
administration, preferred doses are from about 1 mg to 500 mg
oligomer per 70 kg. The antisense oligomer may be administered at
regular intervals for a short time period, e.g., daily for two
weeks or less. However, in some cases the oligomer is administered
intermittently over a longer period of time. Administration may be
followed by, or concurrent with, administration of an antibiotic or
other therapeutic treatment. The treatment regimen may be adjusted
(dose, frequency, route, etc.) as indicated, based on the results
of immunoassays, other biochemical tests and physiological
examination of the subject under treatment.
[0380] All publications and patent applications cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference.
[0381] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be readily apparent to one of ordinary
skill in the art in light of the teachings of this invention that
certain changes and modifications may be made thereto without
departing from the spirit or scope of the appended claims. The
following examples are provided by way of illustration only and not
by way of limitation. Those of skill in the art will readily
recognize a variety of noncritical parameters that could be changed
or modified to yield essentially similar results.
EXAMPLES
Materials and Methods
[0382] All peptides were custom synthesized by Global Peptide
Services (Ft. Collins, Colo.) or at AVI BioPharma (Corvallis,
Oreg.) and purified to >90% purity. Phosphorodiamidate
morpholino oligomers (PMO) were synthesized at AVI BioPharma in
accordance with known methods, as described, for example, in
((Summerton and Weller 1997) and U.S. Pat. No. 5,185,444 and
further described in PCT application No. U.S. Ser. No. 08/012,804.
Exemplary structures of the PMO are as shown in FIGS. 1A-C.
[0383] Some of the PMO oligomers were conjugated at the 3' end with
an arginine-rich peptide ((RXRRBR).sub.2XB; SEQ ID NO:26) to form
peptide-conjugated PMOs (PPMOs) to enhance cellular uptake as
described (U.S. Pat. No. 7,468,418, PCT application No. US08/008168
and (Marshall, Oda et al. 2007; Abes, Moulton et al. 2008)).
[0384] A synthetic pathway that can be used to make morpholino
subunits containing a (1-piperazino) phosphinylideneoxy linkage is
described in PCT application No. U.S. Ser. No. 07/011,435 and
further experimental detail for a representative synthesis is
provided below. Reaction of piperazine and trityl chloride gave
trityl piperazine, which was isolated as the succinate salt.
Reaction with ethyl trifluoroacetate in the presence of a weak base
(such as diisopropylethylamine or DIEA) provided
1-trifluoroacetyl-4-trityl piperazine, which was immediately
reacted with HCl to provide the salt in good yield. Introduction of
the dichlorophosphoryl moiety was performed with phosphorus
oxychloride in toluene.
[0385] The acid chloride is reacted with morpholino subunits (moN),
which may be prepared as described in U.S. Pat. No. 5,185,444 or in
Summerton and Weller, 1997 (cited above) and further described in
PCT application No. U.S. Ser. No. 08/012,804, to provide the
activated subunits. Suitable protecting groups are used for the
nucleoside bases, where necessary; for example, benzoyl for adenine
and cytosine, phenylacetyl for guanine, and pivaloylmethyl for
inosine. The subunits containing the (1-piperazino)
phosphinylideneoxy linkage can be incorporated into the existing
PMO synthesis protocol, as described, for example in Summerton and
Weller (1997), without modification.
Example 1
Activation of Glucocorticoid Receptor in an In Vivo Model
System
[0386] Male Sprague Dawley rats were treated with vehicle (n=3) or
glucocorticoid receptor antisense PMO targeting either GR exon 6 or
exon 7 (SEQ ID NOs: 13 or 16, respectively) for three days at the
dose of 30 mg/kg/day administered subcutaneously. The animals were
subsequently challenged with dexamethasone and tyrosine
aminotransferase (TAT) activity was measured in liver extracts six
hours later. The target sequence for these two antisense oligomers
between mouse and rats are conserved. The same two antisense
oligomers were used to treat primary rat hepatocytes followed by
measurement of TAT activity. The following table shows the level of
TAT activity in the treated animals and primary hepatocytes
relative to vehicle controls.
TABLE-US-00004 TABLE A Tyrosine aminotransferase (TAT) activity
Name SEQ ID NO TAT activity (% control) Observations in vitro muSA6
16 +22.8 muSA7 13 +13.4 Observations in vivo muSA6 16 +81.2 muSA7
13 +50.2
[0387] The above results indicate an induction of TAT activity when
antisense PMO targeting either exons 6 or 7 are used in treatments.
The loss of the GR ligand binding domain, through the selective
removal of either exon 6 or 7, results in a ligand-independent
glucocorticoid receptor or liGR by deleting the H3 domain (exon 6)
or the H5 domain (exon 7) (see point mutation studied by Zhang et
al (Zhang, Simisky et al. 2005)).
Example 2
Antisense Induced Alternative Splicing of Glucocorticoid Receptor
Pre-mRNA in Rat Hepatocytes
[0388] To determine a molecular basis for the increased TAT
activity described in Example 1, primary rat hepatocytes were
treated with either dexamethasone at 100 nM, a MuSA6
peptide-conjugated PPMO at 5 .mu.M (SEQ ID NO: 16 conjugated at the
3' end to SEQ ID NO: 19) or a combination treatment with 100 nM
dexamethasone and 5 .mu.M MuSA6 PPMO. Total RNA was extracted and
purified from Sprague Dawley primary rat hepatocytes using the
QuickGene RNA cultured cell HC kit from Autogen. The resulting
total RNA was reverse transcribed and PCR amplified using the
SuperScript III 1-Step RTPCR kit from Life Technologies and the
following primer pairs using standard conditions. The forward
primer was directed to exon 4 (FWD: 5' GTG CTG GAA GAA ACG ATT GC
3') (SEQ ID NO:27) and the reverse primer was directed to exon 8
(REV: 5' CAG TTG GTA AAA CCG TTG CC 3') (SEQ ID NO:28). PCR
amplification products using these primers are able to detect mRNA
isoforms lacking exons 5 and/or 6. The expected PCR amplification
products for the rat glucocorticoid mRNA isoform lacking exon 6 is
504 bp compared to 780 bp obtained from the full length mRNA
isoform.
[0389] FIG. 4 indicates the presence of the expected 504 bp band
only in MuSA6-treated hepatocytes. DNA sequence analysis was then
performed on both the upper and lower bands from the RT-PCR
reaction, and the precise removal of exon 6 was observed in the
sequence from the lower 504 bp band. Antisense agents are thus
capable of inducing precise exon-skipping of exon 6 of the
glucocorticoid receptor.
Example 3
Pulmonary Administration of Antisense Agents Induces Alternative
Splice Forms of the Glucocorticoid Receptor mRNA in an In Vivo
Mouse Model
[0390] C57BL/6 mice were treated intranasally with 100 .mu.g of
peptide-conjugated MuSA7 PPMO (SEQ ID NO: 13 conjugated at the 3'
end to SEQ ID NO: 19) in 40 .mu.l of PBS at -48 hr, -24 hr and -4
h. LPS was then administered intranasally at 0 hr (50 ug/mouse in
50 .mu.l PBS) to induce an inflammatory response in the lungs. The
mice were sacrificed at 0 min, 40 min, 90 min, 6 hr, and 22 hr
post-LPS treatment. Lung tissue was used for both extraction of
mRNA and subsequent RT-PCR for glucocorticoid receptor mRNA splice
variants. RNA was extracted as described in Example 2, but a
murine-specific pair of PCR primers was used ((FWD: 5'-GTG CTG GAA
GAA ATG ATT GC-3') (SEQ ID NO:29) and (REV: 5'-GTT GAT AAA ACC GCT
GCC-3') (SEQ ID NO:30)), directed to the same locations in exons 5
and 8 as described for the primers in Example 2.
[0391] FIG. 5 shows the presence of the expected alternative splice
isoform lacking exon 7 (635 bp) compared to the band from the full
length mRNA (780 bp). The upper and lower bands from the RT-PCR
reactions were sequenced and the expected sequence indicating the
precise removal of exon 7 was determined to be present in the lower
635 bp band. Antisense agents are thus capable of inducing precise
in vivo exon-skipping of exon 7 of the glucocorticoid receptor.
Example 4
Antisense Agents Reduce T-Cell Activation in Stimulated
Splenocytes
[0392] Carboxyfluorescein succinimidyl ester (CFSE)-labeled mouse
splenocytes were stimulated at 0.5.times.10.sup.6 cells/well in a
96 well plate on plate bound anti-CD3 at 10 .mu.g/ml. A MuSA6 PPMO
(SEQ ID NO:16 conjugated at the 3' end to SEQ ID NO:19) was added
at 10 .mu.M, 5 .mu.M, and 2.5 .mu.M with or without
10.times.10.sup.-12 M dexamethasone. Soluble anti-CD28 was added at
10 .mu.g/ml and cells were incubated at 37.degree. C. for 72 hours.
CD4.sup.+ and CD8.sup.+ T-cells were analyzed for CFSE dilution and
CD25 by flow cytometry.
[0393] FIG. 6A shows that MuSA6 treatment reduces the mean
fluorescence intensity of cell-surface activation marker CD25 on
the surface of CD8.sup.+ T-cells. FIG. 6B shows that MuSA6
treatment also reduces the percentage of dividing CD8.sup.+ T-cells
relative to controls. Parallel observations were made for CD4.sup.+
T-cells (FIGS. 6C and 6D). The legends in FIGS. 6A-6D refer to
MuSA6 (the peptide-conjugated PMO described above) and Peptide only
(SEQ ID NO: 19). Antisense-induced exon-skipping of exon 6 of the
glucocorticoid receptor thus reduces activation of CD4.sup.+ and
CD8.sup.+ T-cells.
TABLE-US-00005 SEQUENCE LISTING Seq ID Sequence (5' to 3') No
TTCTTGAATAAACTGTGTAGCGCAGACCTTCCCATTACAGTTCATTTCTATGTATTTGTTTAAATACCCACA
1
G/CTCGAAAAACAAAGAAAAAAATAAAAGGAATTCAGCAGGCCACTACAGGAGTCTCACAAGAAACCTCTGA
AAATCCTGGTAACAAAACAATAGTTCCTGCAACGTTACCACAACTCACCCCTACCCTGGTGTCACTGTTGGA
GGTTATTGAACCTGAAGTGTTATATGCAGGATATGATAGCTCTGTTCCAGACTCAACTTGGAGGATCATGAC
TACGCTCAACATGTTAGGAGGGCGGCAAGTGATTGCAGCAGTGAAATGGGCAAAGGCAATACCAG/GTAAGA
TGCAAAACATAAAAGAGCAACTATATAAACCTTTGTGTTTTCTTCAGCAAAAACACTTTGGCTTTTATATCA
TCGTGAGCCCATGGCTTATCTTGTTTCTCTTAGTTCTGGGGACTATGAAGGGGAGAGTCAGGTGAATACAGG
TGATAGGGAGTTTATAATAAAACATTTACATTACTCCCTGCTTTTCAAATCATTATGCACAGGATGGTAATT
TCACATAGGATGATGTAATATCAGAATTCAAGTTACAAGACTCACTCAAAACTCCTTTTACACTGAAGTTTG
GGGAAAGAAAATGTTTTTAGTTAATTCCATTTGTTTTCCTTCATTGTGCCACTTTTAAAAATCAGGTTGTTT
GTAAGATTGGTAAACATCAAGTATGTTGATTGTCAAAATTTGTACTAAAGTAGAATGATTTTAACCCTTCAC
TAAATGAAATGCTACACATTGAATGTAATTTTAAAGATAATTTTAAATAAAAGTTACCCTATTGGAATTTGG
TGTGGAATGGCAGAGGTCAATGTTAGTGTCAGCTCTGACTTTAAAGACAGGGAATTGACAAGCCTGTGTTCA
CGCAAATAGTTAGGGAGAGAGCAAGAAAGTAACCTGACCTCCTGTCATCCTTGTTTTATTAAGGGGGAAAGA
GGTGTGAATAGCAGGGCAAATGTTTTGCTTAACTCATTGATTAATACCTCAAGCCAAGATTCTTTTCTGTTT
TTTAAAATCAATACATAATAGTTGTACATATTTACTGTACATATTTATATTTAGGGGGTACATGTAATAATT
TAATAAAAGCATACAACGTGTAAGGATCAAATCAGAGTAACTGGGATATCCATCACCTCAAACATTTGTTTG
GGGAACATTCCAAATCTTCTCTTTTAGCTATTTTGAAATATAAAGTAAATTATTGTTAACTATAGTCATCCT
GTTGTGCTACTGAACACTAAAACTTATTTCTTCTAACTGTATTTTTGCACCCGTCAACCATTCCCGCTTCAT
CCCCATCACCACTATCTTTCCCGGTCACTGGTAACCGCCAAGCCAAGAATTTTGGCTATTTTACTATTTAGT
TCATGTTTACTTAAGCAGACAGAGGTGACAAAACTGGCTTTTTTTTTTTTTTTTTACATTAAAAGCTATTAA
AAAGCACCTAGGGGGCTGGGTGCGATGGCTCACGCCTGTAATCCCAGCACTTTGGGAAGCCCAGGTGGGTGG
ATCAGTTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAGCATAGCAAAACCCCATCTCTACTAAAATTACAAA
AATTAGCCGGGCATGGTGGTATGAATCTGTATTCCTAGCTACTTGGGAGGCTGGCACTGAGAATCACTTGAA
CCCGGGAGGCGGAGGTTGCAGTGAGCCGAGATGGCACCATTGCACTCCAGCCTGGGTGACAGAGCAAGACTT
TGTCTCAATTAAAAAAAAAAAAAAAAAAAAAAACACAAGAGGGTTTGTGAGTCTTAAAGTGTCAGATGACAG
AAGAAAACTGTGTCTACCTAGTATTTAATTTCCATTTTCTGTTAGGGGTGCCCTTGTTTTGACAGGGCTAAT
TGATCTCATTGCTCCTTGGCAATTCCCACAGAGATGATCTTCTGAAGAGTGTTGCCTCATACCTTTATTTCT
CTTAATTCAG/GTTTCAGGAACTTACACCTGGATGACCAAATGACCCTACTGCAGTACTCCTGGATGTTTCT
TATGGCATTTGCTCTGGGGTGGAGATCATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCT
GATTATTAATGA/GTAAGTTGTATGTGTGTCATTTTCCCTGTATTCATAGGGTATCTTTAACCAGCTGATGT
TTTCCTGATTGACT TTCGAGCTGTGGGTATTTAAAC 2 TGTTTTTCGAGCTGTGGGTATT 3
TTCTTTGTTTTTCGAGCTGTGG 4 ATTTTTTTCTTTGTTTTTCGAG 5
TTCCTTTTATTTTTTTCTTTGT 6 TCTTGTGAGACTCCTGTAGTGG 7
GCCTTTGCCCATTTCACTGCTG 8 CCTGGTATTGCCTTTGCCCATT 9
TCCTGAAACCTGAATTAAGAGA 10 TAAGTTCCTGAAACCTGAATTA 11
GGTCATCCAGGTGTAAGTTCCT 12 CATTTGGTCATCCAGGTGTAAG 13
AGGGTCATTTGGTCATCCAGGT 14 CACATCTGGTCTCATTCCAGGG 15
ATTTTTTTTCTTCGTTTTTCGAG 16 ATTTTTTTCTTCGTTTTTCGAG 17 RRRQRRKKRC 18
RRRRRRRRRFFC 19 RRAhxRRAhxRRAhxRRAhxB 20 RAhxRRAhxRRAhxRRAhxRAhxB
21 AhxRRAhxRRAhxRRAhxRRAhxB 22 RAhxRAhxRAhxRAhxRAhxRAhxB 23
RAhxRAhxRAhxRAhxRAhxRAhxRAhxRAhxB 24 RAhxRRAhxRRAhxRRAhxRRAhxRAhxB
25 RAhxRRBRRAhxRRBRAhxB 26 Primer GTG CTG GAA GAA ACG ATT GC 27
Primer CAG TTG GTA AAA CCG TTG CC 28 Primer GTG CTG GAA GAA ATG ATT
GC 29 Primer GTT GAT AAA ACC GCT GCC 30 (X'Y'X') (X'Z'Z') (X'Y'X')
(X'Z'Z') 31 (RY'R) (RRY') (RY'R) (RRY') 32 (RRY') (RY'R) (RRY') 33
GCAGGGTAGAGTCATTCTCTGC 34 GGTCGTACATGCAGGGTAGAGT 35
ACATTGGTCGTACATGCAGGGT 36 GAGAGAAGCAGTAAGGTTTTCA 37
CTCTTCAGACCGTCCTTAGGAA 38 GGCTCTTCAGACCGTCCTTAGG 39
AGGTCATTCTAATTTCATCAAA 40 CATGCATAGAATCCAAGAGTTT 41
REFERENCES
[0394] Abes, R., H. M. Moulton, et al. (2008). "Delivery of steric
block morpholino oligomers by (R-X-R)4 peptides: structure-activity
studies." Nucleic Acids Res. [0395] Graziewicz, M. A., T. K.
Tarrant, et al. (2008). "An endogenous TNF-alpha antagonist induced
by splice-switching oligonucleotides reduces inflammation in
hepatitis and arthritis mouse models." Mol Ther 16(7): 1316-22.
[0396] Gronemeyer, H., J. A. Gustafsson, et al. (2004). "Principles
for modulation of the nuclear receptor superfamily." Nat Rev Drug
Discov 3(11): 950-64. [0397] Marshall, N. B., S. K. Oda, et al.
(2007). "Arginine-rich cell-penetrating peptides facilitate
delivery of antisense oligomers into murine leukocytes and alter
pre-mRNA splicing." Journal of Immunological Methods 325(1-2):
114-126. [0398] Moulton, H. M., M. H. Nelson, et al. (2004).
"Cellular uptake of antisense morpholino oligomers conjugated to
arginine-rich peptides." Bioconjug Chem 15(2): 290-9. [0399]
Newton, R., R. Leigh, et al. (2010). "Pharmacological strategies
for improving the efficacy and therapeutic ratio of glucocorticoids
in inflammatory lung diseases." Pharmacol Ther 125(2): 286-327.
[0400] Overington, J. P., B. Al-Lazikani, et al. (2006). "How many
drug targets are there?" Nat Rev Drug Discov 5(12): 993-6. [0401]
Sazani, P., R. Kole, et al. (2007). Splice switching oligomers for
the TNF superfamily receptors and their use in treatment of
disease. PCT WO2007058894. [0402] Summerton, J. and D. Weller
(1997). "Morpholino antisense oligomers: design, preparation, and
properties." Antisense Nucleic Acid Drug Dev 7(3): 187-95. [0403]
Zhang, J., J. Simisky, et al. (2005). "A critical role of helix
3-helix 5 interaction in steroid hormone receptor function." Proc
Natl Acad Sci USA 102(8): 2707-12.
Sequence CWU 1
1
4112242DNAHomo sapiens 1ttcttgaata aactgtgtag cgcagacctt cccattacag
ttcatttcta tgtatttgtt 60taaataccca cagctcgaaa aacaaagaaa aaaataaaag
gaattcagca ggccactaca 120ggagtctcac aagaaacctc tgaaaatcct
ggtaacaaaa caatagttcc tgcaacgtta 180ccacaactca cccctaccct
ggtgtcactg ttggaggtta ttgaacctga agtgttatat 240gcaggatatg
atagctctgt tccagactca acttggagga tcatgactac gctcaacatg
300ttaggagggc ggcaagtgat tgcagcagtg aaatgggcaa aggcaatacc
aggtaagatg 360caaaacataa aagagcaact atataaacct ttgtgttttc
ttcagcaaaa acactttggc 420ttttatatca tcgtgagccc atggcttatc
ttgtttctct tagttctggg gactatgaag 480gggagagtca ggtgaataca
ggtgataggg agtttataat aaaacattta cattactccc 540tgcttttcaa
atcattatgc acaggatggt aatttcacat aggatgatgt aatatcagaa
600ttcaagttac aagactcact caaaactcct tttacactga agtttgggga
aagaaaatgt 660ttttagttaa ttccatttgt tttccttcat tgtgccactt
ttaaaaatca ggttgtttgt 720aagattggta aacatcaagt atgttgattg
tcaaaatttg tactaaagta gaatgatttt 780aacccttcac taaatgaaat
gctacacatt gaatgtaatt ttaaagataa ttttaaataa 840aagttaccct
attggaattt ggtgtggaat ggcagaggtc aatgttagtg tcagctctga
900ctttaaagac agggaattga caagcctgtg ttcacgcaaa tagttaggga
gagagcaaga 960aagtaacctg acctcctgtc atccttgttt tattaagggg
gaaagaggtg tgaatagcag 1020ggcaaatgtt ttgcttaact cattgattaa
tacctcaagc caagattctt ttctgttttt 1080taaaatcaat acataatagt
tgtacatatt tactgtacat atttatattt agggggtaca 1140tgtaataatt
taataaaagc atacaacgtg taaggatcaa atcagagtaa ctgggatatc
1200catcacctca aacatttgtt tggggaacat tccaaatctt ctcttttagc
tattttgaaa 1260tataaagtaa attattgtta actatagtca tcctgttgtg
ctactgaaca ctaaaactta 1320tttcttctaa ctgtattttt gcacccgtca
accattcccg cttcatcccc atcaccacta 1380tctttcccgg tcactggtaa
ccgccaagcc aagaattttg gctattttac tatttagttc 1440atgtttactt
aagcagacag aggtgacaaa actggctttt tttttttttt tttacattaa
1500aagctattaa aaagcaccta gggggctggg tgcgatggct cacgcctgta
atcccagcac 1560tttgggaagc ccaggtgggt ggatcagttg aggtcaggag
ttcgagacca gcctggccag 1620catagcaaaa ccccatctct actaaaatta
caaaaattag ccgggcatgg tggtatgaat 1680ctgtattcct agctacttgg
gaggctggca ctgagaatca cttgaacccg ggaggcggag 1740gttgcagtga
gccgagatgg caccattgca ctccagcctg ggtgacagag caagactttg
1800tctcaattaa aaaaaaaaaa aaaaaaaaaa acacaagagg gtttgtgagt
cttaaagtgt 1860cagatgacag aagaaaactg tgtctaccta gtatttaatt
tccattttct gttaggggtg 1920cccttgtttt gacagggcta attgatctca
ttgctccttg gcaattccca cagagatgat 1980cttctgaaga gtgttgcctc
atacctttat ttctcttaat tcaggtttca ggaacttaca 2040cctggatgac
caaatgaccc tactgcagta ctcctggatg tttcttatgg catttgctct
2100ggggtggaga tcatatagac aatcaagtgc aaacctgctg tgttttgctc
ctgatctgat 2160tattaatgag taagttgtat gtgtgtcatt ttccctgtat
tcatagggta tctttaacca 2220gctgatgttt tcctgattga ct
2242222DNAArtificial SequenceAntisense oligonucleotide 2ttcgagctgt
gggtatttaa ac 22322DNAArtificial SequenceAntisense oligonucleotide
3tgtttttcga gctgtgggta tt 22422DNAArtificial SequenceAntisense
oligonucleotide 4ttctttgttt ttcgagctgt gg 22522DNAArtificial
SequenceAntisense oligonucleotide 5atttttttct ttgtttttcg ag
22622DNAArtificial SequenceAntisense oligonucleotide 6ttccttttat
ttttttcttt gt 22722DNAArtificial SequenceAntisense oligonucleotide
7tcttgtgaga ctcctgtagt gg 22822DNAArtificial SequenceAntisense
oligonucleotide 8gcctttgccc atttcactgc tg 22922DNAArtificial
SequenceAntisense oligonucleotide 9cctggtattg cctttgccca tt
221022DNAArtificial SequenceAntisense oligonucleotide 10tcctgaaacc
tgaattaaga ga 221122DNAArtificial SequenceAntisense oligonucleotide
11taagttcctg aaacctgaat ta 221222DNAArtificial SequenceAntisense
oligonucleotide 12ggtcatccag gtgtaagttc ct 221322DNAArtificial
SequenceAntisense oligonucleotide 13catttggtca tccaggtgta ag
221422DNAArtificial SequenceAntisense oligonucleotide 14agggtcattt
ggtcatccag gt 221522DNAArtificial SequenceAntisense oligonucleotide
15cacatctggt ctcattccag gg 221623DNAArtificial SequenceAntisense
oligonucleotide 16attttttttc ttcgtttttc gag 231722DNAArtificial
SequenceAntisense oligonucleotide 17atttttttct tcgtttttcg ag
221810PRTArtificial SequenceArginine-rich cell penetrating peptide
18Arg Arg Arg Gln Arg Arg Lys Lys Arg Cys1 5 10 1912PRTArtificial
SequenceArginine-rich cell penetrating peptide 19Arg Arg Arg Arg
Arg Arg Arg Arg Arg Phe Phe Cys1 5 10 2013PRTArtificial
SequenceArginine-rich cell penetrating peptide 20Arg Arg Xaa Arg
Arg Xaa Arg Arg Xaa Arg Arg Xaa Xaa1 5 10 2114PRTArtificial
SequenceArginine-rich cell penetrating peptide 21Arg Xaa Arg Arg
Xaa Arg Arg Xaa Arg Arg Xaa Arg Xaa Xaa1 5 10 2214PRTArtificial
SequenceArginine-rich cell penetrating peptide 22Xaa Arg Arg Xaa
Arg Arg Xaa Arg Arg Xaa Arg Arg Xaa Xaa1 5 10 2313PRTArtificial
SequenceArginine-rich cell penetrating peptide 23Arg Xaa Arg Xaa
Arg Xaa Arg Xaa Arg Xaa Arg Xaa Xaa1 5 10 2417PRTArtificial
SequenceArginine-rich cell penetrating peptide 24Arg Xaa Arg Xaa
Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa1 5 10 15
Xaa2517PRTArtificial SequenceArginine-rich cell penetrating peptide
25Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Xaa1
5 10 15 Xaa2614PRTArtificial SequenceArginine-rich cell penetrating
peptide 26Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Xaa Xaa1
5 10 2720DNAArtificial SequencePrimer 27gtgctggaag aaacgattgc
202820DNAArtificial SequencePrimer 28cagttggtaa aaccgttgcc
202920DNAArtificial SequencePrimer 29gtgctggaag aaatgattgc
203018DNAArtificial SequencePrimer 30gttgataaaa ccgctgcc
183112PRTArtificial SequenceCell penetrating peptide motif 31Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa1 5 10 3212PRTArtificial
SequenceCell penetrating peptide motif 32Arg Xaa Arg Arg Arg Xaa
Arg Xaa Arg Arg Arg Xaa1 5 10 339PRTArtificial SequenceCell
penetrating peptide motif 33Arg Arg Xaa Arg Xaa Arg Arg Arg Xaa1 5
3422DNAArtificial SequenceAntisense oligonucleotide 34gcagggtaga
gtcattctct gc 223522DNAArtificial SequenceAntisense oligonucleotide
35ggtcgtacat gcagggtaga gt 223622DNAArtificial SequenceAntisense
oligonucleotide 36acattggtcg tacatgcagg gt 223722DNAArtificial
SequenceAntisense oligonucleotide 37gagagaagca gtaaggtttt ca
223822DNAArtificial SequenceAntisense oligonucleotide 38ctcttcagac
cgtccttagg aa 223922DNAArtificial SequenceAntisense oligonucleotide
39ggctcttcag accgtcctta gg 224022DNAArtificial SequenceAntisense
oligonucleotide 40aggtcattct aatttcatca aa 224122DNAArtificial
SequenceAntisense oligonucleotide 41catgcataga atccaagagt tt 22
* * * * *