U.S. patent application number 14/795760 was filed with the patent office on 2015-12-03 for isolating biological modulators from biodiverse gene fragment libraries.
The applicant listed for this patent is Phylogica Limited. Invention is credited to Wayne Robert Thomas, Paul Michael Watt.
Application Number | 20150344875 14/795760 |
Document ID | / |
Family ID | 22455261 |
Filed Date | 2015-12-03 |
United States Patent
Application |
20150344875 |
Kind Code |
A1 |
Watt; Paul Michael ; et
al. |
December 3, 2015 |
Isolating Biological Modulators from Biodiverse Gene Fragment
Libraries
Abstract
The present invention provides a method for identifying a
modulator or mediator of a biological activity, which activity
includes antigenicity and or immunogenicity, said method comprising
the step of: (i) producing a gene fragment expression library
derived from defined nucleotide sequence fragments; and (ii)
assaying the expression library for at least an amino acid sequence
derived from step (i) for a biological activity wherein that
activity is different from any activity the amino acid sequence may
have in its native environment.
Inventors: |
Watt; Paul Michael; (Perth,
AU) ; Thomas; Wayne Robert; (Nedlands, AU) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Phylogica Limited |
Crawley |
|
AU |
|
|
Family ID: |
22455261 |
Appl. No.: |
14/795760 |
Filed: |
July 9, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13341788 |
Dec 30, 2011 |
|
|
|
14795760 |
|
|
|
|
12650351 |
Dec 30, 2009 |
|
|
|
13341788 |
|
|
|
|
11890714 |
Aug 6, 2007 |
|
|
|
12650351 |
|
|
|
|
11198436 |
Aug 4, 2005 |
|
|
|
11890714 |
|
|
|
|
09568229 |
May 5, 2000 |
6994982 |
|
|
11198436 |
|
|
|
|
60132711 |
May 5, 1999 |
|
|
|
Current U.S.
Class: |
506/17 ;
506/26 |
Current CPC
Class: |
C07K 7/08 20130101; C12N
15/10 20130101; C40B 40/10 20130101; C12N 15/1086 20130101; C12N
15/1034 20130101; G01N 33/569 20130101; G01N 33/6845 20130101; C07K
7/06 20130101; C40B 30/04 20130101; C07K 14/001 20130101; C12N
15/1027 20130101; Y02A 50/57 20180101; C12N 15/1058 20130101; C40B
40/08 20130101; G01N 33/574 20130101; Y02A 50/58 20180101; Y02A
50/30 20180101; C40B 50/06 20130101 |
International
Class: |
C12N 15/10 20060101
C12N015/10 |
Claims
1. A gene fragment expression library comprising a plurality of
different nucleotide sequences from a plurality of biodiverse
organisms each having a sequenced genome and wherein the organisms
are microorganisms and/or eukaryotes having compact genomes.
2. The library according to claim 1, wherein the sequence fragments
of the library are from organisms selected from the group
consisting of Fugu rubripes, Caenorhabditis elegans, Saccharomyces
cerevisiae, E. coli, Aquifex aelitcus, Methanococcus jannaschii,
Bacillus subtilis, Haemophilus influenzae, Helicobacter pylori,
Neisseria meningiditis, Synechocystis sp. Bordetella pertussis,
Pasteurella multocida, Pseudomonas aeruginosa, Borrelia
burgdorferi, Methanobacterium thermoautotrophicum, Mycoplasma
pneumoniae, Archaeoglobus fulgidis and Vibrio harveyi.
3. The gene fragment expression library according to claim 1
constructed using adapted fragments of pooled genomic DNA from an
evolutionarily diverse panel of compact genomes.
4. The expression library according to claim 1 comprising fragments
of DNA from a diverse panel of microorganisms.
5. The expression library according to claim 1 comprising adapted
fragments of pooled genomic DNA from an evolutionarily diverse set
of compact genomes.
6. The expression library according to claim 2 wherein the nucleic
acid fragments of the library comprise 90 base pairs to 120 base
pairs in length.
7. The expression library according to claim 2 wherein the nucleic
acid fragments of the library are of sufficient length to encode
peptides comprising about 30 amino acids in length.
8. A method of producing a gene fragment expression library
comprising a plurality of different nucleotide sequences from
different organisms said method comprising producing nucleotide
sequence fragments from a nucleotide sequence of known nucleotide
composition wherein said nucleotide sequence is from a sequenced
genome of a microorganism and/or a sequenced compact genome of an
eukaryotic species.
9. The method according to claim 8 comprising: (i) producing
defined fragments of DNA from a diverse panel of microorganisms;
(ii) pooling the fragments in direct proportion to the size and
complexity of the each genome; and (iii) inserting the combined
fragments into an expression vector.
10. The method of claim 9 wherein the nucleic acid fragments are 90
base pairs to 120 base pairs in length.
11. The method of claim 9 comprising digesting the pooled fragments
with one or more restriction endonucleases to produce nucleic acid
fragments of 90 base pairs to 120 base pairs in length.
12. The method according to claim 10 wherein the nucleic acid
fragments are of sufficient length to encode peptides comprising
about 30 amino acids in length.
13. The method according to claim 11 wherein the nucleic acid
fragments are of sufficient length to encode peptides comprising
about 30 amino acids in length.
14. The method according to claim 9 comprising: (i) producing
adapted fragments of pooled genomic DNA from an evolutionarily
diverse set of compact genomes wherein the relative concentration
of DNA in the pool from larger genomes is increased in proportion
to the total haploid genome size; and (ii) inserting the combined
fragments into an expression vector.
15. The method according to claim 14 comprising fragmenting the
pooled genomic DNA by mechanical shearing.
16. The method of claim 14 comprising producing the pooled genomic
DNA by polymerase extension of partially degenerate
oligonucleotides annealed to denatured genomic DNA and
amplification using polymerase chain reaction (PCR).
17. The method of claim 16 wherein PCR is mutagenic PCR.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 12/650,351, filed on Dec. 30, 2009, which is a
continuation of U.S. patent application Ser. No. 11/890,714, filed
on Aug. 6, 2007, which is a continuation of U.S. patent application
Ser. No. 11/198,436, filed on Aug. 4, 2005, which is a continuation
of U.S. patent application Ser. No. 09/568,229, filed on May 5,
2000, which claims the benefit under 35 U.S.C. .sctn.119(e) of U.S.
Provisional Application No. 60/132,711, filed May 5, 1999, the
contents of which are incorporated herein by reference in their
entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to the field of screening gene
libraries, and more particularly to the generation and screening of
natural domain libraries derived from organisms with known genomic
sequences. Methods for increasing the diversity of such biodiverse
gene fragment libraries further by mutagenesis procedures are
described. The present invention also provides the means by which a
wide range of peptide-based therapeutics, prophylactics and
diagnostic reagents may be developed.
General
[0003] Those skilled in the art will appreciate that the invention
described herein is susceptible to variations and modifications
other than those specifically described. It is to be understood
that the invention includes all such variation and modifications.
The invention also includes all of the steps, features,
compositions and compounds referred to or indicated in the
specification, individually or collectively, and any and all
combinations or any two or more of the steps or features.
[0004] The present invention is not to be limited in scope by the
specific embodiments described herein, which are intended for the
purpose of exemplification only. Functionally pa-1504571 equivalent
products, compositions and methods are clearly within the scope of
the invention as described herein.
[0005] Bibliographic details of the publications numerically
referred to in this specification are collected at the end of the
description. All references cited, including patents or patent
applications are hereby incorporated by reference. No admission is
made that any of the references constitute prior art.
[0006] As used herein the term "derived from" shall be taken to
indicate that a specific integer may be obtained from a particular
source albeit not necessarily directly from that source.
[0007] Throughout this specification and the claims which follow,
unless the context requires otherwise, the word "comprise", or
variations such as "comprises" or "comprising", will be understood
to imply the inclusion of a stated integer or group of integers but
not the exclusion of any other integer or group of integers.
BACKGROUND TO THE INVENTION
[0008] Biological interaction/activities, such as protein:protein
interactions, antigen:antibody interactions, protein:nucleic
interactions, protein:ligand interactions and nucleic acid:nucleic
acid interactions are involved in a wide variety of processes
occurring in living cells. For example, agonism and antagonism of
receptors by specific ligands, antibody-antigen interactions,
including drugs, hormones, second messenger molecules, etc. may
effect a variety of biological processes such as gene expression,
cellular differentiation and growth, enzyme activity, metabolite
flow and metabolite partitioning between cellular compartments,
amongst others. DNA:protein and RNA:protein interactions are well
known for their effects in regulating gene expression in both
prokaryotic and eukaryotic cells, in addition to being critical for
DNA replication and in the case of certain viruses, RNA
replication. In cases where the propagation of cells in deleterious
such as the replication of a pathogen or of a cancer cell, agents
which target biological interaction/activities or functional
structures, are suitable candidates for therapy. For example,
agents that block the function of membrane channels or disrupt
cytoplasmic membranes by other means, are attractive targets for
anti-microbial therapies against pathogens. Further, agents that
interact with antigen-specific or non-specific functions of the
immune systems may provide immunological modulators or vaccines for
allergy, autoimmunity, infectious disease, fertility and
invenomation. For example, agents that have the antigenicity of
microbial antigens, tumour antigens, allergens or autoantigens may
be used for vaccines or immunotherapy.
[0009] Undesirable or inappropriate gene expression and/or cellular
differentiation, cellular growth and metabolism may also be
attributable, at least in many cases, to biological
interaction/activities involving the binding and/or activity of
proteinaceous molecules, such as transcription factors, peptide
hormones, receptor molecules and enzymes, amongst others. In these
cases, therapies can be envisaged which block such inappropriate
interactions and/or which block the formation of inappropriate
cellular structures.
Production of Peptides by Recombinant DNA Techniques
[0010] Peptides that can mediate or interfere with a diverse range
of biological functions include natural peptides and peptides
synthesised to represent a portion or a modified portion of a
molecule known to mediate a target function. One source of such
peptides are random peptide libraries constructed with random (or
semi-random) oligonucleotides ligated into cloning sites of a
plasmid or phage vectors.
[0011] Vectors containing DNA encoding different peptides are
transfected or transformed into bacteria or other hosts and cloned
by standard plaque or colony purification procedures. Clones
producing peptides with a desired activity can be isolated by a
variety of screening or selection procedures which are
fundamentally the same as the screening procedures used to detect
polypeptides encoded by cDNA or cDNA fragments. These include the
production of peptides as fusions with the coat proteins of
bacteriophage or fusions with bacterial surface proteins so the
peptides can be used as tags for affinity purification procedures;
the production of peptides from hosts infected with phage or
transformed with plasmids to produce arrays of colonies or plaques
which can be screened for ligand-binding activity or biological
activity such as inhibiting the growth target bacteria or inducing
the activation of genes in target bacteria; and in positive
selection strategies such as two hybrid cloning systems, where the
peptide produced in the host microorganism binds to target proteins
to form complexes which activate the expression of the reporter
genes cloned into the same host. One of the significant advantages
of phage display technology is that it enables the construction of
libraries with very large complexities--ie. 10.sup.10 to 10.sup.11
individual clones.
[0012] Likewise, in `reverse two hybrid` or `spilt two hybrid`
systems, libraries of appropriately expressed peptides can be
screened for blockers of particular protein/protein interactions,
which in turn reduces the expression of counter selectable reporter
genes encoding toxic products.
Modification of Peptides for Utility and Optimisation
[0013] Once the active peptide or a ligand binding peptide has been
identified they can be modified by a variety of procedures to
optimise their utility. Modification may include: alterations in
the amino acid residues which engage the target to improve their
binding specificity and affinity; modifications which affect the
display of the peptide including the valency of binding and
constraint of particular conformations; and modifications to attach
further functional moieties such as markers, toxins and
co-activators.
[0014] Synthetic peptides can include residues other than the 20
amino acids found in nature and/or can be cyclised by means such as
oxidation of flanking cystein residues. In the case of peptides
mimicking antibody epitopes, carriers containing the T-cell
epitopes required to induce high affinity immune responses can be
added by genetic techniques.
Examples of Peptides that Modulate Biological Systems
[0015] Peptides can be applied as therapeutics or lead molecules
for designing therapeutics for disease including infection, cancer
and metabolic disorders as well as agents for vaccines and
immunotherapy, transplantation and diagnostics. The potential
usefulness of such peptides has been demonstrated by the following
examples:
Peptide Antimicrobial Agents
[0016] The antimicrobial effect demonstrated by natural peptides
produced by frogs and insects and artificially synthesised by
cationic peptides. A large variety of antibiotics are peptides or
polypeptides. The granules of mammalian neutrophils produce
families of antimicrobial polypeptides including azurocidin,
cathepsin G and Cationic Antimicrobial Peptides (CAP57 and CAP37).
In addition, neutrophils produce at least two families of
antimicrobial peptides, the defensins and the bactenecins.
Moreover, many natural antibiotics and antifungal drugs are
composed of peptides. For example, the magainin family of
antimicrobial .alpha.-helical peptides isolated from the skin of
the African clawed toad, Xenopus Laevis form lethal pores in the
cell membranes of certain microorganisms. Similarly, certain
.alpha.-helical peptides derived from a variety of insect genera
have antimicrobial activity. Recently, several rational design
approaches have been used to isolate novel peptide antibiotics. For
example, Tiozzo et al., used a "sequence template" approach in
which candidate peptide sequences were designed from alignments of
natural antimicrobial peptides [1]. The identification of virulence
determinants in several pathogens presents other attractive targets
for antimicrobial therapy. For example, Balaban and colleagues (2)
have recently identified an autoinducer of virulence in
Staphylococcus aureus that controls the production of bacterial
toxins involved in pathogenesis. The toxin genes are induced by a
regulatory RNA molecule, RNAIII that is induced by a threshold
concentration of an endogenous protein RNAIII Activating Protein
(RAP) [2]. Peptide inhibitors of RAP might be expected to act as
virulence determinants. Indeed, a natural peptide inhibitor of RAP
called RIP (RNAIII inhibiting peptide) is produced by a
non-pathogenic strain of Staphylococcus aureus and appears to
inhibit the RNAIII gene and to cause reduced virulence [2].
Peptide Modulators of Growth Regulation
[0017] The ability of peptides to affect key modulators of growth
regulation has been demonstrated by Brent and colleagues who used
two hybrid screening to identified constrained peptide `aptamers`
from combinatorial libraries which bind tightly to and inhibit the
function of cyclin dependent kinase 2. This demonstrates the
potential for treatment of neoplasms (3).
[0018] Peptides can exhibit exquisite specificity. For example,
peptide aptamers have been identified which can discriminate
between two closely related allelic variants of the Ras protein
(4). Moreover, a peptide aptamer against human cyclin dependent
kinase 2 inhibits kinase activity exclusively on certain particular
substrates.
[0019] Peptide specificity has also been demonstrated in vivo. In a
recent report, expression of aptamers that recognised cyclin
dependent kinases in transgenic flies was shown to cause
developmental abnormalities in a dominant negative fashion (5).
Importantly, the specificity the two aptamers for particular Cdks
(as determined by yeast two hybrid assays) was retained in the
Drosophila in vivo assay. Moreover co-expression of the specific
aptamer target Cdk suppressed the developmental phenotype observed
(5). This report of successful targeted inhibition of an enzyme in
vivo with aptamers, firmly establishes as practicable the principle
for developing new therapeutic strategies based on interfering
peptides.
Peptide-Based Inhibition: An Emerging Therapeutic Strategy
[0020] Much attention has recently focussed on peptides as
potential therapeutic agents because they can be highly specific
and readily synthesised. Phage display technologies are beginning
to prove useful for providing peptide leads in drug discovery
programs. Efficient delivery of peptide from outside the cell to
the nucleus of eukaryotic cells can now be achieved by attaching
sequences such as the targeting motif "penetratin" which is derived
from the Drosophila Antennapaedia protein. More recently a family
of such targeting peptides has been identified (6). For example,
conjugation of peptide sequences to the VP22 protein has been shown
to allow efficient export of the fusion protein to the nuclei of
cells adjacent to primary transfectants (7). Several recent
developments make it feasible to physically select conformationally
constrained peptide domains in order to identify peptides that bind
with very high affinity in vivo, favouring high potency. Mimetic
peptides have been reported to inhibit protein interactions and/or
enzyme function. Examples include a nonapeptide derived from the
ribonucleotide reductase of herpes simplex virus that was linked to
an enterotoxin subunit for delivery into cells via its receptor.
The peptide conjugate was found to inhibit herpes simplex type 1
replication in quiescent Vero cells [8]. Using detailed knowledge
of the PCNA-interaction domain of p21WAF1 derived from two hybrid
screens, a peptide has been designed which effectively blocked the
interaction. This 20-mer bound with sufficient affinity to block
SV40 replication. A 20-mer peptide sequence derived from p16 has
been found to interact with Cdk4 and Cdk6 and inhibited pRB
phosphorylation and cell cycle progression [9]. The authors coupled
the specific inhibitor peptide to the 16 residue penetration
peptide for efficient nuclear delivery. Peptides have even been
shown to function as inhibitors in animal models. For example, a
tetrapeptide mimicking the substrate of farnesyl protein
transferase has also been shown to block the growth of
Ras-dependent tumours in nude mice.
Peptide Mimotopes
[0021] Peptides functionally resembling the epitopes (mimotopes)
bound by antibodies have been isolated and used as experimental
vaccine to induce antibodies which protect against infection as
shown for hepatitis B, respiratory syncytial virus, Japanese
encephalitis and Streptococcus pneumonia. High affinity antibodies
typically bind complex structures formed by the tertiary
conformation of an antigen. The peptide mimotopes essentially
convert a conformational epitope made from a complete protein into
a small peptide. It has advantages when only certain epitopes are
desired, eg to prevent immunopathology in RSV infection; or in the
production of recombinant epitopes where the complete polypeptide
may be difficult to fold; or where the entire antigen has
undesirable biological properties (Staphylococcal toxins in toxic
shock syndrome). In the case of carbohydrate antigens, polypeptides
that contain the mimotope can be constructed to convert a T-cell
independent antigen into a T-dependent antigen for the production
of high affinity antibodies and immunogenicity in young animals
including humans. Unlike the carbohydrates, peptide mimotopes can
be produced as DNA vaccines.
[0022] The possibility of using mimotopes as antigens for cancer
immunotherapy has been demonstrated for an adenocarcinoma
antigen.
[0023] Mimotopes can be used as antigens to diagnose infectious
disease by detecting antibody. The possibility has been
demonstrated with hepatitis C infection.
[0024] Mimotopes representing the antigens recognised by
autoantibodies against .beta.-islet tissue in diabetes have been
demonstrated and it has been proposed that these could be used to
monitor the development of disease (10). Similarly mimotopes have
been found for pollen allergens which could be used in the
diagnosis of allergic disease. In both these cases it is also
possible that the mimotopes could be used for therapy by modulating
the immune response or in prophylaxis.
[0025] Mimotopes representing transplantation antigens have been
demonstrated and thus may be used as tolerogens or blockers to
prevent transplantation rejection.
Ligand Interactions or Hormone Receptor Interactions
[0026] Peptide mimetics have been used as ligands to affinity
purify biologically useful molecules as shown for the purification
of the blood clotting protein, von Willebrand factor.
[0027] The modification of enzyme activity with peptides mimicking
substrates has also been demonstrated. Peptide mimetics can be used
as hormones as shown for erythropoietin and can be modified to
increase biological activity.
Recombinant Methods for Producing Biologically Active Peptides
[0028] The use of fragments from specific genes or cDNA to produce
peptides containing a biological activity of the polypeptide
encoded by the gene or an inhibitor of the activity can sometimes
be successful. In other instances the activity can be dependent on
the conformation of complete polypeptide and cannot be obtained by
these techniques. In many cases the use of random peptide libraries
in phage or plasmids to produce a peptide which mimics the
biological activity has been successful. This involves the
screening of large numbers of clones producing an essentially
random array of peptides for a peptide of the desired activity. The
activity is sometimes mediated by a peptide which shows an amino
acid sequence homology which could explain its biological activity
while in many cases the peptide acts as a mimetic for the
conformation of the polypeptide or its ligand and has no sequence
homology. Indeed the peptide may be a mimetic of a chemically
different molecule such as a carbohydrate. It is also possible to
use the combinatorial library approach to screen for inhibitors or
mediators of complex functions where there is no information on the
molecular interactions required.
[0029] The ability to isolate active peptides from random fragment
libraries can however be highly variable and problems with low
affinity interactions have been reported, particularly for peptides
required to represent complex conformations such as discontinuous
epitopes bound by many antibodies. There is unpredictability in
that, libraries that are a rich source of peptides for one ligand
may not contain peptides for others. While the ability to obtain
desired peptides should be increased with libraries containing
larger random peptides and more random peptides there are practical
difficulties in conducting high throughput screening or affinity
purification particularly since it has been shown that high-density
affinity purification is inefficient. There is also uncertainty
about the degree to which peptides isolated from the random peptide
libraries will retain their binding or biological activity when
produced as part of different delivery strategies such as fusions
with different polypeptides. There is thus an opportunity to
supplement or improve the existing technology with new
strategies.
Biodiverse Peptide Domain Libraries from Defined Genomic
Sources
[0030] Peptides present potential therapeutic and prophylactic
agents for many human and animal diseases, biochemical disorders
and adverse drug effects, because they can interact with other
molecules with high specificity and affinity. However, a major
problem to be overcome in the field of peptide therapeutics and
prophylactics is the identification of specific amino acid
sequences having a desired antagonist or agonist activity against a
particular biological activity in a particular cellular
environment. Such candidate peptide drugs may be particularly
difficult to identify from truly random peptide libraries that lack
any enrichment for sequences encoding molecular shapes suitable for
binding biological structures. In contrast, nature has already
assembled a rich source of such domains within the myriad of
peptides, polypeptides and proteins encoded by the diverse range of
genomes that make up the biosphere.
[0031] A wide range of different methods have been put forward to
facilitate the screening of biological libraries (such as cDNA
libraries) in an expedient manner to identify suitable protein or
polypeptide molecules. Libraries of thousands and in some cases
even millions of polypeptides or peptides have been prepared be
gene expression systems and displayed on chemical supports or in
biological systems suitable for testing biological activity.
Generally such libraries are made from either individual genomes of
organisms believed to be rich sources of new drugs (such as
`extremophile` bacterial species) or from a mixture of
uncharacterised genomes isolated directly from the environment.
[0032] While the screening the biodiverse libraries has proven
valuable, such libraries tend to be biased towards the frequency
with which a particular organism is found in the native environment
and may not necessarily represent the true population of the
biodiversity found in a particular biological sample. Moreover,
such screens are normally intended to isolate genes encoding
enzymes, hence attempts are often made to bias such libraries to
contain larger inserts which could be expected to encode
biologically active enzymes.
[0033] In U.S. Pat. No. 5,763,239 in the name of Short et al., a
procedure is described for normalising genomic DNA from an
environmental sample, in an attempt to address this problem of
bias. Because the libraries mentioned in that patent are generated
from environmental samples for which little would be known about
the genomic constitution of the library the procedure employs
complicated normalisation methods to normalise the genomic
constitution of the libraries. While that procedure permits some
normalisation of the genomes in an environmental sample, the
methods that it describes are complicated, there is a risk that
rare genomic DNA's will be lost when the methods are applied and/or
that new biases will be introduced by the procedure.
[0034] In addition to the above, current screening methods often
rely on the isolation of genomic nucleic acid sequences using PCR
amplification procedures for which little may be known about the
genomic sequences. In such cases biases can be introduced through
such factors as the presence of disproportional representation of
repeated sequences in certain genomes. Furthermore, because no
information is known about the genomic constitution of the
environment sample, only limited bioinformatic data can be derived
from a screen of the library. This problem is addressed to some
extent in U.S. Pat. No. 5,763,239, which seeks to increase the
probability that a genomic sequence of low copy number in an
environmental sample will have a chance of being represented in a
library.
[0035] There are, however, currently no available methods for
screening normalised biodiverse peptide domain libraries in vivo
wherein the entire composition and complexity of the library can be
accurately estimated and wherein the screening process provides
such comprehensive bioinformatic data useful for rational drug
design. Moreover, no methods have been described which
arespecifically designed for the construction of natural genomic
sequence libraries that have been optimised for the expression of
domains per se, rather than entire polypeptides. Accordingly, there
is a need to develop techniques that provides for the large-scale
screening of peptide libraries which are enriched for sequences
encoding bioactive domains useful in the determination of useful
peptide therapeutics, the basis of which is not necessarily related
to the natural role of particular peptide domains.
SUMMARY OF THE INVENTION
[0036] Proteins of different function show evidence of evolving by
shuffling of domains (eg. nerve growth factor and the low-density
lipoprotein receptors) or by minor modifications of different
residues within conserved domains (serine proteases). The present
invention seeks to mimic this evolution by using peptide libraries
encoded by known and defined nucleotide sequence fragments that are
a rich source of peptides containing amino acid sequences evolved
for diverse molecular interactions not necessarily closely related
to the function performed within the donor organism. Also described
are means of extending the diversity of biodiverse gene fragment
libraries further by mutagenesis--either in vitro using PCR
amplification under mutagenic conditions, or in vivo by replication
of the library in `mutator` bacterial strains which contain
mutations in genes involved in mismatch repair of DNA.
[0037] The present invention provides a method for identifying a
modulator or mediator of a biological activity, which activity
includes antigenicity and or immunogenicity, said method comprising
the step of: [0038] (i) producing a gene fragment expression
library derived from defined nucleotide sequence fragments; and
[0039] (ii) assaying the expression library for at least an amino
acid sequence derived from step (i) for a biological activity
wherein that activity is different from any activity the amino acid
sequence may have in its native environment.
[0040] It will be appreciated that the present invention has broad
reaching application for identifying amino acid sequences that have
a novel activity compared to that for which they may be recognised
as having in their ordinary natural environment. For example, the
present invention is particularly useful for screening genome
fragment expression libraries for amino acid sequences reactive
with particular antibodies by for example affinity chromatography
of a phage display library. Moreover, the present invention
provides a means for defining amino acids essential for modulating
a biological activity such as, for example, antibody binding. It
also provides a means for isolating amino acid sequence modulators
or mediators of a biological activity, which are capable of
functioning independently of the artificial constrains of the
screening system by which they were identified (e.g. gene fusions
etc.).
[0041] In particular the present invention is particularly useful
for identifying novel therapeutics such as vaccines or
immunotherapeutic antigens, antibiotics or inhibitory agents that
may serve as candidate agonists and antagonists of any biological
activity. For example, biodiverse gene fragment libraries may be
used to produce antigens that can be used for vaccines or for
immunotherapy of allergic disease or autoimmune disease. In the
case of the allergen immunotherapy it is especially desirable to
obtain a high affinity peptide (which is rare from random peptide
libraries) because it may be used as a monovalent antigen to avoid
crosslinking of IgE on mast cells.
[0042] This system may also be used in high through-put screening
for agents which target specific protein:DNA, peptide:DNA or
peptide:protein; protein:protein interactions or a structure such
as the cell wall or a membrane transport component.
[0043] A distinct advantage of the technology described herein is
that through having greater control over the composition of an
amino acid sequence expression library by knowing its defined
constitution, one can intentionally maximise the phylogenetic
distance between the constituent genomes of the library to ensure a
maximal degree of diversity which, could in principle rival the
sequence diversity of environmentally derived genome samples,
notwithstanding the fact that such samples may contain more species
diversity per se. This approach will become increasingly powerful
as the range of available nucleotide sequences increase
further.
[0044] In one embodiment there is provided a method for identifying
a modulator or mediator of a biological activity, which activity
includes antigenicity and or immunogenicity, said method comprising
the steps of: [0045] (i) producing a gene fragment expression
library derived from defined nucleotide sequence fragments, which
nucleotide sequence encodes at least a sequence of amino acids;
[0046] (ii) assaying the expression library for at least an amino
acid sequence derived from step (i) for a biological activity
wherein the library is adapted to display a range of amino acid
sequences each of which may vary by at least an amino acid; and
[0047] (iii) identifying those amino acids essential for modulating
the biological activity, which activity is different from the
activity which the sequence is not normally associated in its
native environment.
[0048] A sequence of amino acids that is particularly effective in
modulating or mediating a biological activity (e.g. antigenicity or
immunogenicity) can be selected by comparing the observed activity
from a series of different amino acid sequences of a similar
constitution. Using differences in the observed activity it is
possible to identify those amino acids essential for the activity
and those which are either desired for the activity or in the
alternate case those which are a hindrance to achieving effective
activity.
[0049] In a second embodiment the method may be employed to
identify novel antibacterial peptides that are conditionally
released from a fusion protein. According to this embodiment, there
is provided a method of identifying an antibacterial peptide,
comprising: [0050] (i) transforming or transfecting a first
bacterial population of cells with a peptide expression library
derived from defined nucleotide sequence fragments; [0051] (ii)
growing said first bacterial population for a time and under
conditions sufficient for expression of the amino acid sequences
encoded within said library to occur and for release of the amino
acid sequences from their cognate fusions; [0052] (iii) contacting
the expressed amino acid sequences with pathogenic bacteria; [0053]
(iv) identifying those sequence(s) that are capable of inhibiting
the growth of the pathogenic bacteria, or killing the pathogenic
bacteria; and [0054] (v) selecting those sequences from the
identification step in step (iv) that are not associated with the
inhibition of growth of the pathogenic bacteria, or killing the
pathogenic bacteria in their native environment.
[0055] In a third embodiment, there is provided a method for
identifying a modifier of a biological activity associated with a
host cell, said method comprising the steps of: [0056] (i)
Expressing a reporter molecule operably under the control of the
biological activity in the cell, wherein at least a molecule
associated with the biological activity comprises an amino acid
sequence encoded by a nucleotide sequence that is placed operably
in connection with a promoter; [0057] (ii) Incubating at least a
cell from step (i) in the presence of an amino acid sequence(s)
from a gene fragment expression library derived from a defined
genomic sequence, under conditions promoting interaction between
the amino acid sequence(s) and a nucleotide or amino acid sequence
involved with the biological activity; and [0058] (iii) Identifying
at least an amino acid sequence that in the presence of the cells
is capable of modifying expression of said reporter molecule, or
the biological activity; and [0059] (vi) Selecting those sequences
in step (iii) that are not generally recognised as being able to
modifying expression of said reporter molecule, or the biological
activity in their native environment.
[0060] Preferably the method described in this embodiment is
repeated as often as is necessary to ensure that a substantially
all of the amino acids encoded by the defined nucleotide sequence
are presented to the biological activity.
[0061] In a fourth embodiment there is provided a method of
identifying an antagonist of a biological activity, said method
comprising the steps of: [0062] (i) placing expression of a
reporter molecule operably under the control of a biological
activity in a cell, wherein at least one partner of said biological
activity comprises an amino acid sequence encoded by a nucleotide
sequence that is placed operably in connection with a
bacterial-expressible promoter in a suitable vector, wherein (a)
the nucleotide sequence is derived from a nucleotide sequence of
known and sequenced origin and (b) the biological activity is
different from any activity that the amino acid sequence may have
in its native environment; [0063] (ii) incubating the cell in the
presence of a candidate compound to be tested for the ability to
antagonise the biological activity; and [0064] (iii) selecting
cells wherein expression of said reporter molecule, or biological
activity, is modified.
[0065] Any nucleotide sequence of known nucleotide composition may
be used in the present invention. Preferably the nucleotide
sequence is derived from a substantially sequenced genome of a
microorganism and/or a compact eukaryotic species (ie a species
with a high proportion of sequence encoding polypeptide). Most
preferably, the nucleotide sequence is derived from a fully
sequenced genome from a microorganism and/or a compact genome of a
eukaryotic species that is a genome containing a high percentage of
DNA encoding polypeptides.
[0066] Desirably, the present invention employs a peptide
expression library made from defined genomic sequence present
either in isolation or in combination with other defined genomic
sequence to identify amino acid sequence(s) that may be suitable
candidates for rational drug design while at substantially the same
time providing comprehensive bioinformatic data about those
candidates. The bioinformatic data derived from the method may be
used to identify those amino acids important in modulating the
biological activity.
[0067] In a fifth embodiment there is provided a method for
identifying a modulator of a biological activity, said method
comprising the steps of: [0068] (i) producing an amino acid
expression library derived from a defined genomic sequence; [0069]
(ii) contacting an amino acid sequence derived from the expression
library with a reporter molecule that is operably under the control
of a biological activity associated with a host; and [0070] (iii)
identifying an amino acid sequence capable of modulating the
biological activity wherein that activity is different from any
activity the amino acid sequence may have in its native
environment.
[0071] In a sixth embodiment, there is provided a method for
identifying an amino acid sequence that is capable of modulating a
biological activity in a host cell, said method comprising the
steps of: [0072] (i) producing a library in a host wherein (a) the
transformed cells of said library contain at least a first
nucleotide sequence that comprises or encodes a reporter molecule
the expression of which is operably under control of said
biological activity and a second nucleotide sequence derived from a
known genomic sequence that is capable of encoding the amino acid
sequence when placed operably under the control of a suitable
promoter sequence and wherein (b) substantially all of the known
genomic sequence is present within the population of transformed
cells making up said library and the biological activity is
different from any activity the amino acid sequence may have in its
native environment; [0073] (ii) culturing said cellular host for a
time and/or under conditions sufficient for expression of said
second nucleotide sequence to occur; and [0074] (iii) selecting or
screening for cells wherein expression of said reporter molecule is
modified.
[0075] Preferably, the method defined by the sixth embodiment also
includes the additional steps of: [0076] (iv) comparing the range
of amino acid sequences that can be derived from the known genomic
sequence against those sequences exhibited biological activity; and
[0077] (v) determining those amino acids which are essential for
modifying the reporter molecule activity.
[0078] In a particularly preferred form of the invention, a
plurality of defined genomic sequences derived from different
organisms may be expressed in the gene fragment expression library.
Where genomic sequences from more than one organism are used in the
method each of the sequences are preferably provided in equal molar
amounts to ensure that an equal proportion of the sequences are
included in the method.
[0079] The complexity of the gene fragment expression library may
also be augmented by subjecting the defined genomic sequence(s)
derived from those sequences to methods that mis-read or mutate the
sequence(s). Alternatively, or in addition, the complexity of the
library may also be augmented by expressing the defined genomic
sequence in each of its different reading frames. It may also be
expressed in its reverse reading frames. Thus, allowing for
expression of a gene sequence in each possible reading frame, for
any particular sequence there will be six different possible
combinations.
[0080] The present invention also contemplates amino acid sequences
identified by the method of the present invention as well as the
use of those molecules in a pharmaceutical composition. The
pharmaceutical composition comprising an amino acid sequence
capable of modulating or mediating a biological activity or the
function of a biological molecule and a pharmaceutical acceptable
carrier and/or diluent.
[0081] The present invention also provides a vector (or pool of up
to 3 vectors) capable of expressing a nucleotide sequence in each
of its possible reading frames and wherein each of the amino acid
sequences so produced are expressed as a fusion with a second amino
acid sequence in which they are conformationally constrained,
wherein said vector at least comprises: [0082] (i) a first
expression cassette, comprising: [0083] (a) a multiple cloning site
for insertion of nucleotide sequence encoding said amino acid
sequence, wherein said multiple cloning site may be adjacent to one
or more second nucleotide sequences encoding a polypeptide loop
such that a fusion polypeptide is capable of being produced between
said first and second amino acid sequences; [0084] (b) a terminator
sequence adjacent to the multiple cloning site and distal to said
promoter sequence and second nucleotide sequences; [0085] (ii) a
means for expressing the first nucleotide sequence in each of its
reading frames; [0086] (iii) a bacterial origin of replication
and/or a bacteriophage origin of replication; and [0087] (iv) a
second expression cassette encoding a bacterial selection marker
gene.
[0088] Another aspect of the present invention provides for
modification of the target microorganism whose growth or alternate
function may be inhibited. This microorganism may be modified for
screening purposes in a manner that facilitated screening such as
by: [0089] (i) The introduction of novel antibiotic resistance
markers by homologous recombination, by transformation of plasmids
or by random mutagenesis and selection; [0090] (ii) The
introduction (by homologous recombination or plasmid
transformation) of one or more reporter gene/s (eg. luciferase or
.beta.-galactosidase) under the control of an endogenous promoter
associated with pathology or virulence. For example, the promoters
for the RNAIII or RAP genes of Staphylococcus aureus could be used
to control expression of a reporter gene that could be easily
detected. Such methods are well known to those skilled in the
art--see international (PCT) patent WO 90/40979, for example.
[0091] The present invention also provides a means of exploiting
bioinformatic data concerning homologous sequences encoding
structural domains in sequenced genomes, to design defined
libraries by such techniques as degenerate PCR techniques or
chemical DNA synthesis that focus on a particular affinity domain.
The diversity of such a library may be further increased by
mutagenesis techniques known to those skilled on the art.
[0092] The present invention also provides a high through-put
screening technique for the identification of clones (from the
library) that produce amino acid sequences capable of inhibiting
growth or repressing virulence genes of the pathogenic target
organism.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0093] The screening methods described herein differ from existing
rational design approaches that attempt to model candidate
therapeutic peptides based in homologies in the databases to
natural inhibitory peptides. The existing approaches focus in amino
acid sequences that have previously been identified from their
natural source due to their inhibitory properties. In contrast, the
methods described herein, empirically determine amino acid
sequences, that may modulate a biological activity, from a wide
array of candidates encoded in a genomic expression library derived
from nucleotide sequences which have been completely determined
without regard for their original function of those sequences in
nature.
[0094] Natural biologically interactive peptide and polypeptide
domains are thought to have evolved by selection from a bank of
available domains in each organism in which they arose. Within any
organism there is a tremendous amount of diverse coding
information. To harness this diversity a genetic screen has been
devised which maximises the diversity of a pool of potential
biologically interactive domains. Moreover, since the information
used in the screen is derived from sequenced genetic information,
structural information that has already evolved in nature may be
exploited by comparing biologically interactive molecules against
similar sequences from a sequenced and test nucleotide sequence.
This information desirably permits the identification of particular
amino acids that are essential to the binding action of the
biological activity and/or possibly particular motifs that are
essential to or at least implicated in the binding reaction. Thus,
the present invention provides screening methods for identifying
potential amino acid sequence(s) that are capable of modulating or
mediating biological activities involving peptides, oligopeptides,
proteins and or nucleic acid sequences.
[0095] Therefore, the present invention resides in a method for
identifying a modulator or mediator of a biological activity, which
activity includes antigenicity and or immunogenicity, said method
comprising the step of: [0096] (i) producing a gene fragment
expression library derived from defined nucleotide sequence
fragments; and [0097] (ii) assaying the expression library for at
least an amino acid sequence derived from step (i) for a biological
activity wherein that activity is different from any activity the
amino acid sequence may have in its native environment.
[0098] As used herein, the term "biological activity" shall be
taken to include biological interactions leading to a physical
association between two or more molecules or "partners". Such
activity should be interpreted in its broadest context and include,
for example, interactions such as peptide:peptide, peptide:protein,
protein:protein, antigen:antibody, peptide:nucleic acid sequence,
protein:nucleic acid sequence, peptide:ligand and protein:ligand.
For example, the activity includes but is not limited to any
interaction that modulates or mediates antibody binding or antigen
binding or any other amino acid sequence based interaction
described in the background section of this specification.
Preferably, the physical association involves a cellular process or
alternatively, is required for a cellular event to occur and
wherein that activity is different from any activity the amino acid
sequence may have in its native environment. In addition, it shall
include activity that leads to the disruption of a biological
structure and/or activity. The "physical association" may involve
the formation of an induced magnetic field or paramagnetic field,
covalent bond formation such as a disulfide bridge formation
between polypeptide molecules, an ionic interaction such as occur
in an ionic lattice, a hydrogen bond or alternatively, a van der
Waals interaction such as a dipole-dipole interaction,
dipole-induced-dipole interaction, induced-dipole-induced-dipole
interaction or a repulsive interaction or any combination of the
above forces of attraction.
[0099] Fragments from any nucleotide sequence of a known nucleotide
composition may be used in the present invention. Those skilled in
the art will be aware of a variety of methods for producing
nucleotide sequence fragments including: mechanical shearing (eg by
sonication), Digestion with a nuclease (eg by Dnasel), digestion
with restriction enzyme/s, polymerase chain reaction using
degenerate primers. Preferably the nucleotide sequence is derived
from a substantially sequenced genome of a microorganism and/or a
compact eukaryotic species. More preferably, the nucleotide
sequence is derived from a fully sequenced genome from a
microorganism and/or a compact eukaryotic species. Most preferably
a plurality of different nucleotide sequences are expressed in the
gene fragment expression libraries which sequences are derived from
biodiverse organisms. Thus, biodiverse nucleotide sequences are
desirably employed in the method of the invention to prepare the
expression libraries. Where sequenced genomes or fragments thereof
from different organisms are used in the method each of the genomes
or fragments thereof should be provided in equal molar amounts to
ensure that an equal proportion of sequenced genomes or fragments
thereof are included in the method.
[0100] Those working in the field will appreciate that gene
fragment expression library may be prepared using any expression
vector known in the art. Preferably the vectors selected for use in
the library possess strong promoters therein enhancing amino acid
sequence expression. For example, in a bacterial system
bacterial-expressible promoters that may be used in the vector may
include, but would not be limited to, pT7-Select, pET, pZero,
pHook, pTYB or a derivative thereof. Other vectors that may be used
in the vector are discussed in more detail below.
[0101] The amino acid sequence(s) derived from the gene fragment
expression library may be expressed in a conformationally
constrained or conformationally unconstrained form. Amino acid
sequences that are expressed in a conformationally constrained form
may be expressed within a second polypeptide as a fusion protein
such that they are effectively "nested" in the secondary structure
of the second polypeptide. Alternatively, the amino acid
sequence(s) may be circularised by means of oxidising flanking
cysteine residues to limit conformational diversity. This may be
particularly beneficial where the amino acid sequence(s) are nested
within a surface-exposed or functional site of a protein, such that
they are accessible to the biological activity of interest. For
example, the amino acid sequence(s) may be expressed within a
thioredoxin (Trx) polypeptide loop. Whilst not being bound by any
theory or mode of action, expression of the amino acid sequence(s)
in a conformationally constrained form limits the degrees of
freedom and the entropic cost associated with its binding,
imparting a high degree of affinity and specificity to the
interaction.
[0102] Those working in the field will appreciate that the present
invention has broad reaching application. By way of exemplification
the present invention is particularly useful for screening gene
fragment expression libraries for amino acid sequence(s) reactive
with particular antibodies by for example affinity chromatography
of a phage display library. Alternatively, biodiverse gene fragment
libraries may be used to identify antigenic or immunogenic
sequences that may be used for vaccines or for immunotherapy of
allergic disease or autoimmune disease.
[0103] In one embodiment there is provided a method for identifying
a modulator or mediator of a biological activity, which activity
includes antigenicity and or immunogenicity, said method comprising
the steps of: [0104] (i) producing a gene fragment expression
library derived from defined nucleotide sequence fragments, which
nucleotide sequence encodes at least a sequence of amino acids;
[0105] (ii) assaying the expression library for at least an amino
acid sequence derived from step (i) for a biological activity
wherein the library is adapted to display a range of amino acid
sequences each of which may vary by at least an amino acid; and
[0106] (iii) identifying those amino acids essential for modulating
the biological activity, which activity is different from the
activity which the sequence is not normally associated in its
native environment.
[0107] A sequence of amino acids that is particularly affective in
modulating biological activity can be selected by comparing the
observed biological activity from a series of different amino acid
sequences of a similar constitution. Using differences in the
observed biological activity it is possible to identify those amino
acids essential for biological activity and those which are either
desired for the activity or in the alternate case those which are a
hindrance to achieving effective activity.
[0108] The present invention has broad reaching application for
identifying amino acid sequences that have a novel activity
compared to that for which they may be recognised as having in
their ordinary natural environment.
[0109] In a particularly preferred for of this embodiment there is
provided a method for identifying an amino acid sequence which has
either antigenic or immunogenic activity, said method comprising
the steps of: [0110] (i) producing a gene fragment expression
library derived from defined nucleotide sequence fragments, which
nucleotide sequence encodes at least a sequence of amino acids;
[0111] (ii) assaying the expression library for at least an amino
acid sequence derived from step (i) for a antigenic or immunogenic
activity wherein the library is adapted to display a range of amino
acid sequences each of which may vary but at least an amino acid;
[0112] (iii) identifying those amino acid sequences essential for
modulating or mediating the antigenic or immunogenic activity; and
[0113] (iv) selecting those sequences from the identification step
in step (iii) that are not associated the antigenic or immunogenic
activity in their native environment.
[0114] Preferably the gene fragment libraries employed in this
embodiment of the invention are used to identify or produce
antigens that can be used for vaccines or for immunotherapy of
allergic disease or autoimmune disease. In the case of the allergen
immunotherapy it is especially desirable that high affinity
peptides are identified (which are rare from random peptide
libraries) because they may be used as monovalent antigens to avoid
specific crosslinking immunological reactions such as crosslinking
of IgE on mast cells.
[0115] In a second embodiment the peptide libraries of the present
invention may be employed to identify novel antibacterial amino
acid sequences that are conditionally released from a fusion
protein. According to this embodiment, there is provided a method
of identifying a antibacterial amino acid sequence, comprising:
[0116] (i) transforming or transfecting a first bacterial
population of cells with a peptide expression library derived from
defined nucleotide sequence fragments; [0117] (ii) growing said
first bacterial population for a time and under conditions
sufficient for expression of the amino acid sequences encoded
within said library to occur and for release of the amino acid
sequences from their cognate fusions; [0118] (iii) contacting the
expressed amino acid sequences with pathogenic bacteria; [0119]
(iv) identifying those sequence(s) that are capable of inhibiting
the growth of the pathogenic bacteria, or killing the pathogenic
bacteria; and [0120] (v) selecting those sequences from the
identification step in step (iv) that are not associated with the
inhibition of growth of the pathogenic bacteria, or killing the
pathogenic bacteria in their native environment.
[0121] It should be appreciated that the method described in this
embodiment has broad reaching application for identifying novel
amino acid sequences that are capable of inhibiting the growth of
pathogenic bacteria, or killing pathogenic bacteria.
[0122] In a highly preferred form of this embodiment nucleotide
sequences encoding peptide(s) or peptide fusions are inserted
within the cloning site of a T7-Select phage vector (Invitrogen)
with or without the introduction of a conditional protein cleavage
site (such as the temperature sensitive protein splicing element
`intein` modified from the element found in the Saccharomyces
cerevisiae VMA1 gene (e.g. IMPACT T7 system, New England Biolabs))
cloned into the fusion junction of the vector. The first bacterial
population is then grown for a time and under conditions sufficient
for expression of the peptides encoded by said library to occur. In
cases where conditional cleavage of the peptide from its fusion
context is desired (e.g. the intein system), the bacterial/phage
population may be put under conditions where cleavage can occur
(e.g. low temperature in the case of the intein mutant cleavage)].
The individual clones or pools of clones in said library are then
separated into replica arrays. At least one of said replicated
arrays is then lysed to produce a lysate array. Note this is not
necessary in the case of lytic phage vectors such as T7-select. The
lysate array is then brought into physical relation with pathogenic
bacteria. Those lysates that are capable of inhibiting the growth
of the pathogenic bacteria, or killing the pathogenic bacteria can
then be identified by standard techniques.
[0123] For convenience, the pathogenic bacterium described in this
embodiment may be contained within a bacterial lawn on solid media,
however this is not essential to the performance of this
embodiment.
[0124] Preferably, the subject method further comprises the step of
keying the lysate back to the replicated array to localise the
bacterial cell that expresses the same antibacterial peptide as
that expressed in said lysate. More preferably, the genetic
sequence encoding the peptide is isolated for the purposes of
producing the antibacterial peptide encoded therefor.
[0125] In an exemplification of this embodiment, Escherichia coli
BL21 lysates containing protein expressed from pET peptide
libraries, are assayed for their ability to inhibit the growth of
pathogenic microorganisms or alternatively, for their ability to
kill pathogenic microorganisms, wherein individual clones derived
from a population of cells transformed or transfected with the
subject peptide library are either replica-plated onto
semi-permeable membranes, such as nitrocellulose or nylon
membranes, or alternatively, replica-picked, to master cultures and
cultures in which expression of the cloned peptide sequence is to
be induced, prior to lysis. Replica-plating and/or replica-picking
can be performed manually or with the assistance of robotics.
Samples comprising those colonies in which expression is to be
induced are lysed, for example by exposure to chloroform or by
infection with a bacteriophage such as T7 bacteriophage, and
overlayed on a freshly seeded lawn of pathogenic bacteria.
[0126] In the case of lytic phage libraries (such as those made in
the T7-select system), a double-faced petri-dish can be used. In
this case a phage overlay occupies one face of the dishes that is
separated from the other faces by a supported semi-permeable
membrane (made of a material such as nitrocellulose or nylon) on
which a seeded lawn of the pathogenic bacteria lies. Thus the
semi-permeable membrane separates the phage overlay from the
pathogenic bacteria that can be grown on different media
respectively (see example).
[0127] The ability of individual peptide-expressing clones to
inhibit growth or to kill the pathogenic bacterium in question is
assayed by detecting the presence of a `plaque-like` "clearing" or
"hole" in the lawn of pathogenic bacteria directly beneath the
position where the lysate containing the expressed antibacterial
peptide occurs.
[0128] Those skilled in the art will recognise that this method
provides an opportunity of isolating a phage or plasmid clone
expressing the activity that gave rise to the corresponding hole in
the lawn on the opposite.
[0129] In a third embodiment, there is provided a method for
identifying a modifier of a biological activity associated with a
host cell, said method comprising the steps of: [0130] (i)
Expressing a reporter molecule operably under the control of the
biological activity in the cell, wherein at least a molecule
associated with the biological activity comprises an amino acid
sequence encoded by a nucleotide sequence that is placed operably
in connection with a promoter; [0131] (ii) Incubating at least a
cell from step (i) in the presence of an amino acid sequence(s)
from a gene fragment expression library derived from a defined
genomic sequence, under conditions promoting interaction between
the amino acid sequence(s) and a nucleotide or amino acid sequence
involved with the biological activity; [0132] (iii) Identifying at
least an amino acid sequence that in the presence of the cells is
capable of modifying expression of said reporter molecule, or the
biological activity; and [0133] (iv) Selecting those sequences in
step (iii) that are not generally recognised as being able to
modifying expression of said reporter molecule, or the biological
activity in their native environment.
[0134] Preferably the method is repeated as often as is necessary
to ensure that a substantially all of the amino acids encoded by
the defined nucleotide sequence are presented to the biological
activity.
[0135] In a particularly preferred form of the third embodiment the
gene fragment expression library is prepared in a pET vector. Such
as those that are commercially available from Novagen. pET vectors
as described herein are particularly useful in such applications,
by virtue of the strong T7 promoter sequence contained therein
which facilitates bacterial expression in strains expressing T7
polymerase. Those skilled in the art will appreciate that other
bacterial expression vectors will be equally applicable.
[0136] In a highly preferred form of this embodiment, a nucleotide
sequence(s) derived from a defined genetic sequence is incorporated
into a pET vector such that the nucleotide sequence is operably
linked to an appropriate bacterial translation initiation sequence
as described supra. A second nucleotide sequence may further be
expressed in association with the first nucleotide sequence such
that the resultant peptide is constrained within the active site
loop of thioredoxin or within oxidised flanking cysteine residues.
As with other embodiments of the invention, the second nucleotide
sequence may be synthetic and/or derived from genomic sources.
[0137] Expression from the pET vector is achieved by infection of
bacteria which contain the library plasmid with bacteriophage T7 or
alternatively, by using publicly available strains such as E. coli
BL21, which contain the T7 polymerase gene under lac control,
because in such strains IPTG may be added to growth media to induce
expression of the T7 polymerase gene. Derivatives of the strain
BL21 (such as strain BL21trxB (DE3), which contain a mutation in
the thioredoxin reductase gene trxB, are particularly useful for
ensuring that disulphide bonds remain oxidised in the bacterial
cytoplasm.
[0138] This embodiment is particularly useful for identifying
antagonists of a biological activity. In such situations, the
undesirable biological activity is preferably functional in the
absence of the drug being screened and perturbation of that
interaction is assayed in the presence of a candidate drug
compound, wherein modified reporter gene expression is detected in
the manner described for other embodiments of the invention.
[0139] Preferably, where the reporter molecule is lethal to the
bacterial cell, expression thereof should not occur until the amino
acid sequence(s) candidate compound is provided to the cell for a
time and under conditions sufficient to antagonise the biological
activity leading to reporter expression. Accordingly in a preferred
form this embodiment provides a method of identifying an antagonist
of a biological activity in a bacterial cell, comprising the steps
of: [0140] (i) placing the expression of a cytostatic or cytotoxic
reporter molecule operably under the control of a biological
activity in said cell, wherein at least one binding partner in said
biological activity comprises an amino acid sequence encoded by a
nucleotide sequence that is placed operably in connection with a
bacterially-expressible promoter; [0141] (ii) incubating the cell
in the presence of at least an amino acid sequence candidate
compound to be tested for its ability to antagonise the biological
activity for a time and under conditions sufficient for antagonism
to occur, wherein the amino acid sequence candidate compound is
derived from a gene fragment expression library derived from a
defined genomic sequence; [0142] (iii) expressing the binding
partner under the control of the bacterially expressible promoter
for a time and under conditions sufficient to result in expression
of the reporter molecule in the absence of antagonism; and [0143]
(iv) selecting surviving or growing cells.
[0144] Preferably, the inducible bacterially-expressible promoter
is the T7 promoter. In such circumstances, the expression of the
reporter molecule may be induced by infecting cells with
bacteriophage T7, which supplies the T7 polymerase function.
Alternatively, the bacterial cell may be a cell that contains the
T7 polymerase under lac control (e.g. E. coli BL21 cells), in which
case the promoter may be induced by the addition of IPTG to growth
medium. The candidate compound may be any small molecule, drug,
antibiotic or other compound, the only requirement being that it is
capable of permeating or being actively taken up by the bacterial
cell or alternatively, is modified by the addition of a carrier
molecule to facilitate such uptake.
[0145] In a fourth embodiment there is provided a method of
identifying an antagonist of a biological activity, said method
comprising the steps of: [0146] (i) placing expression of a
reporter molecule operably under the control of a biological
activity in a cell, wherein at least one partner of said biological
activity comprises an amino acid sequence encoded by a nucleotide
sequence that is placed operably in connection with
bacterial-expressible promoter in a suitable vector, wherein (a)
the nucleotide sequence is derived from a nucleotide sequence of
known and sequenced origin and (b) the biological activity is
different from any activity that the amino acid sequence may have
in its native environment; [0147] (ii) incubating the cell in the
presence of a candidate compound to be tested for the ability to
antagonise the biological activity; and [0148] (iii) selecting
cells wherein expression of said reporter molecule, or biological
activity, is modified.
[0149] This method is particularly useful for identifying movel
drugs such as antibiotics or inhibitory agents that may serve as
candidate agonists and antagonists of any biological activity.
Moreover this system may be used in high through-put screening for
novel antibiotics or other inhibitory agents which target specific
amino acid sequence:nucleic acid sequence interactions or amino
acid sequence:amino acid sequence interactions.
[0150] Preferably, where the reporter molecule is lethal to the
bacterial cell, expression thereof should not be allowed until the
candidate compound is provided to the cell for a time and under
conditions sufficient to antagonise the biological activity leading
to reporter expression. Accordingly, a preferred aspect of this
embodiment provides a method of identifying an antagonist of a
biological activity in a bacterial cell, comprising: [0151] (i)
placing the expression of a cytostatic or cytotoxic reporter
molecule operably under the control of a biological activity in
said cell, wherein at least one binding partner is said biological
activity comprises an amino acid sequence encoded by a nucleotide
sequence that is placed operably in connection with a
bacterially-expressible promoter, wherein (a) the nucleotide
sequence is defined and is derived from a nucleotide sequence of
known origin and (b) the biological activity is different from any
activity the amino acid sequence may have in its native
environment; [0152] (ii) incubating the cell in the presence of a
candidate compound to be tested for its ability to antagonise the
biological activity for a time and under conditions sufficient for
antagonism to occur; [0153] (iii) expressing of the binding partner
under the control of the bacterially expressible promoter for a
time and under conditions sufficient to result in expression of the
reporter molecule in the absence of antagonism; and [0154] (iv)
selecting surviving or growing cells.
[0155] In a highly preferred example of this embodiment, the
inducible bacterially expressible promoter is the T7 promoter. A
person skilled the field will observe that any other bacterial
inducible promoter may be used in the invention. This embodiment is
only being exemplified in relation to the promoter for convenience.
In such circumstances, the expression of the reporter molecule may
be induced by infecting cells with bacteriophage T7, which supplies
the T7 polymerase function. Alternatively, the bacterial cell may
be a cell which contains the T7 polymerase under lac control (e.g.
E. coli BL21 cells), in which case the promoter may be induced by
the addition of IPTG to growth medium. The candidate compound may
be any small molecule, drug, antibiotic or other compound, the only
requirement being that it is capable of permeating or being
actively taken up by the bacterial cell or alternatively, is
modified by the addition of a carrier molecule to facilitate such
uptake.
[0156] Desirably, the present invention employs a gene fragment
expression library made from defined genomic sequence present
either in isolation or in combination with other defined genomic
sequence to identify amino acid sequence(s) that may be suitable
candidates for rational drug design while at substantially the same
time providing comprehensive bioinformatic data about those
candidates. The bioinformatic data derived from the method may be
used to identify those amino acids important in modulating the
biological activity.
[0157] Using knowledge of the phylogenetic relationship between
microorganisms, a mixture of particular genomes can be designed to
maximise the sequence diversity in the peptide expression library.
This approach has several distinct advantages over cloning and
expressing DNA purified directly from the environment. First, the
true diversity and bias of the library can be more easily
approximated. Hence measures can be implemented to maximise the
domain diversity and to minimise bias towards the genomes of
dominant species. Second, artificially pooling DNA derived from
distinct known organisms allows unique opportunities to survey
diverse genomes that may not occur together in nature. For example,
the genomes of certain archaebacteria could be simultaneously
screened with those of obligate parasites such as mycoplasmas
and/or diverse gram positive and/or gram negative organisms. Third,
the alignment of sequences derived from a screen can be used to
reveal consensus motifs. Moreover, other potential related motifs
can be excluded as potential drug candidates if they are not
identified from any of the genomes in which they theoretically
occur, despite exhaustive screening at a complexity that would be
predicted to cover all of the potential domains encoded by the
genome/s yet failed to exhibit the required activity. This
information can be used to design optimal peptides that mimic the
consensus motifs identified in the biological screen while lacking
alternative residues of structurally related peptides that were
presumably included in the exhaustive screen. Finally, using the
pooled genomes of sequenced organisms facilitates certain powerful
bioinformatic analyses that may be useful in the design of
therapeutic peptides.
[0158] In a fifth embodiment there is provided a method for
identifying a modulator of a biological activity, said method
comprising the steps of: [0159] (i) producing an gene fragment
expression library derived from a defined genomic sequence; [0160]
(ii) contacting an amino acid sequence derived from the expression
library with a reporter molecule that is operably under the control
of a biological activity associated with a host; and [0161] (iii)
identifying an amino acid sequence capable of modulating the
biological activity wherein that activity is different from any
activity the amino acid sequence may have in its native
environment.
[0162] Preferably, at least one of the partners in the biological
activity contemplated by this embodiment is a peptide, polypeptide,
protein or enzyme molecule or a derivative thereof. According to
this embodiment, the remaining partner(s) is (are) a molecule
selected from the list comprising nucleic acid such as
single-stranded or double-stranded RNA or DNA, a peptide,
polypeptide, protein, enzyme, carbohydrate, amino acid, nucleotide,
nucleoside, lipid, lipoprotein, vitamin, co-enzyme, receptor
molecule, hormone, chemical compound, cyclic AMP, metal ion or
second messenger molecule, amongst others. More preferably, the
biological activity is a protein:protein interaction or a
protein:peptide interaction or a protein:polypeptide
interaction.
[0163] In a particularly preferred form, the biological activity is
between a first partner comprising an amino acid sequence and a
second partner, comprising a nucleic acid molecule such as DNA or
RNA or alternatively, an amino acid sequence or a derivative or
analogue thereof.
[0164] According to a sixth embodiment, there is provided a method
for identifying an amino acid sequence that is capable of
modulating a biological activity in a host cell, said method
comprising the steps of: [0165] (i) producing a library in a host
wherein (a) the transformed cells of said library contain at least
a first nucleotide sequence that comprises or encodes a reporter
molecule the expression of which is operably under control of said
biological activity and a second nucleotide sequence derived from a
known genomic sequence that is capable of encoding the amino acid
sequence when placed operably under the control of a suitable
promoter sequence and wherein (b) substantially all of the known
genomic sequence is present within the population of transformed
cells making up said library and the biological activity is
different from any activity the amino acid sequence may have in its
native environment; [0166] (ii) culturing said cellular host for a
time and/or under conditions sufficient for expression of said
second nucleotide sequence to occur; and [0167] (iii) selecting or
screening for cells wherein expression of said reporter molecule is
modified.
[0168] The second nucleotide sequence used in the method may be
derived from any known genomic sequence. By using a sufficient
number of second nucleotide species to ensure that the entire
sequence of the known genomic sequence is assayed bioinformatic
data can be gathered from sequences which not only gave a positive
result in the test system but also those sequences which failed to
react. By comparing reactive amino acid sequences against similar
sequences in a genome that either caused a reaction or
alternatively failed to cause a reaction, sequence motifs as well
as individual amino acids can be identified that may be implicated
in a biological activity. In addition, if the screen is
sufficiently comprehensive to ensure adequate coverage, certain
alternative residues/motifs represented in the library can be shown
to be suboptimal if incorporated into the design of inhibitors of
the activity.
[0169] Thus, in a preferred form this embodiment provides a method
of identifying a amino acid sequence(s) that is capable of
modulating a biological activity in a host said method comprising
the steps of: [0170] (i) producing a peptide library in a host
wherein (a) the transformed cells of said library contain at least
a first nucleotide sequence which comprises or encodes a reporter
molecule the expression is which is operably under control of said
biological activity and a second nucleotide sequence derived from a
known genomic sequence which is capable of encoding said amino acid
sequence(s) when placed operably under the control of a suitable
promoter sequence and wherein (b) substantially all of the known
genomic sequence is present within the population of transformed
cells making up said library; [0171] (ii) culturing said cellular
host for a time and/or under conditions sufficient for expression
of said second nucleotide sequence to occur; [0172] (iii) selecting
or screening for cells wherein expression of said reporter molecule
is modified; [0173] (iv) comparing the range of amino acid
sequences that can be derived from the known genomic sequence
against those sequences which modulated biological activity; and
[0174] (v) determining those amino acids which are essential for
modifying the reporter molecule activity.
[0175] In another embodiment the present invention therefore
provides a vector capable of expressing a nucleotide sequence in
each of its possible reading frames and wherein each of the amino
acid sequences so produced are expressed as a fusion with a second
amino acid sequence in which they may be conformationally
constrained, wherein said vector at least comprises: [0176] (i) a
first expression cassette, comprising: [0177] (a) a multiple
cloning site for insertion of a first nucleotide sequence encoding
said first amino acid sequence, wherein said multiple cloning site
may be adjacent to one or more second nucleotide sequences encoding
a polypeptide loop such that a fusion polypeptide is capable of
being produced between said first and second amino acid sequences;
[0178] (b) a terminator sequence adjacent to the multiple cloning
site and distal to said promoter sequence and second nucleotide
sequences; [0179] (ii) a means for expressing the first nucleotide
sequence in each of its reading frames; [0180] (iii) a bacterial
origin of replication and/or a bacteriophage origin of replication;
and [0181] (iv) a second expression cassette encoding a bacterial
selection marker gene.
[0182] In an alternative embodiment, the expression vector of the
invention further comprises a second expression cassette comprising
a selectable marker gene operably linked to two or more promoter
sequences and placed upstream of a terminator sequence, wherein one
of said promoter sequences is a bacterially-expressible promoter
and wherein one of said promoter sequences is a yeast-expressible
promoter.
[0183] In another alternative embodiment, the subject vector is
further modified to provide for the inducible extracellular
expression by means of signal peptide fusions and/or conditional
lysis systems. Conditional lysis may be achieved by expression of
an inducible lytic gene in bacterial cells, by introducing such
sequences into an expression cassette between an inducible
bacterial promoter (such as the lac, tac or the more tightly
regulated araBAD promoters) and a transcriptional termination
sequence, in tandem array with the promoter and terminator
sequences already present in the subject expression cassettes.
[0184] In a still further embodiment, the conditional lysis of
bacteria expressing the said peptide/polypeptide, is brought about
by alternative means such as by infection with a suitable
bacteriophage or by exposure to appropriate chemical agents such as
chloroform and/or SDS. In a particularly preferred form of the
invention the vector also includes a third expression cassette
allowing conditional expression of a lytic gene (such as those
genes produced by bacteriophages).
[0185] The present invention also contemplates amino acid
sequence(s) identified by the method of the present invention as
well as use of those molecules in a pharmaceutical composition. The
pharmaceutical composition comprising an amino acid sequence(s)
capable of modulating a biological activity or the function of a
biological molecule and a pharmaceutically acceptable carrier
and/or diluent.
Biodiverse Nucleotide Sequence Fragments
[0186] Where sequenced genomes from different organisms are used in
the above embodiments each of the genomes should be provided in
equal molar amounts to ensure that an equal proportion of sequenced
genomes are included in the method. Because the genomes are of a
known size, standard normalisation methods can be applied to ensure
that the concentration of one organism's genome is not
proportionally greater than that of another organism's genome. Such
methods for equalising genomic concentrations are well known to
those skilled in the art and include, by way of example, the
contribution of proportionately more DNA to the pool from the
genomes which are larger, to compensate for the tendency for
fragments from such genomes to be under represented if an equal
mass of DNA from each genome is combined. In addition,
normalisation by other means known to those skilled in the art such
as disclosed in U.S. Pat. No. 5,763,239 is contemplated by the
present invention.
[0187] The present invention attempts to accelerate the
evolutionary process by artificially combining domains from
different genomes that would have been unlikely to co-evolve.
Preferably, the genomic expression libraries are prepared from
evolutionary diverse organisms. For example, the organisms could be
either derived from: compact eukaryotic genomes such as Fugu
rubripes, Caenorhabditis elegans, Saccharomyces cerevisiae; and or
from prokaryotic microorganisms that have been characterised
genetically such as, E. coli, Aquifex aelitcus, Methanococcus
jannaschii, Bacillus subtilis, Haemophilus influenzae, Helicobacter
pylori, Neisseria meningiditis, Synechocystis sp Bordetella
pertussis, Pasteurella multocida, Pseudomonas aeruginosa, Borrelia
burgdorferi, Methanobacterium thermoautotrophicum, Mycoplasma
pneumoniae, Archaeoglobus fulgidis and Vibrio harveyi). Those
skilled in the art are aware that the number of sequenced genomes
is increasing rapidly (compilations of sequenced genomes can be
readily obtained by reference to the World Wide Web (eg. see the
following URLs for details:
[0188] http://www.tigr.org/tdb/mdb/html
[0189] http://www.sanger.ac.uk
[0190] http://www.genome.ad.jp/kegg/java/org_proj.html
[0191]
http://www-fp.mcs.anl.gov/.about.gaasterland/genomes.html
[0192]
http://www.ncgr.org/http://www.cbs.dtu.dk/databases/DOGS/index.html
[0193] http://geta.life.uiuc.edu/.about.nikos/genomes.html
and that the methods described here are applicable to any subset of
the entire pool of sequenced genomes.
[0194] The defined nucleotide sequence from which the known
nucleotide sequence is derived is not limited only to those
sequences that encode amino acids in naturally derived proteins,
but also include non-coding nucleotide sequences. Thus, it should
be understood that the second nucleotide sequence may be derived
from a 5' UTR, an intron (where applicable), a 3' UTR, or
alternative reading frames/orientations of the cloned fragment.
[0195] Diversity within a pool of sequenced nucleotide sequences
may also be expanded by subjecting the sequences to methods that
mis-read or mutate those fragments. Thus, in an embodiment of the
invention the method may also include a step of artificially
mutating the domain libraries. Such methods are well known in the
art.
[0196] One ways to achieve this end would involve mutation of the
known genomic sequence prior to insertion into an expression
vector. Thus, in one preferred form, the method of the invention
might include the step of: subjecting the known nucleotide sequence
to mutagenesis prior to insertion into the expression vector. This
may be achieved for example by amplifying the sequenced genomes
using mutagenic PCR procedures such as those that include the step
of performing the PCR reaction in the presence of manganese. It has
been calculated with an error rate of 0.5 bases per 100 bp/cycle
that eight mutagenic cycles will produce base changes in 90% of the
PCR products and almost 50% will have 2 or 3 substitutions.
[0197] Another way in which the domain libraries might be mutated
would be through expression of nucleotide fragments in cells that
are modified to mutate sequence information. Such strains are
deficient in certain enzymes making their mutation rate
approximately 5,000 to 10,000 times higher than in the wild-type
parent. Thus, the method may include the step of: expressing the
biodiverse gene fragments in one or more cell lines that are
deficient in at least a DNA repair enzyme. For example, once
constructed, the plasmid library can be amplified in bacterial
strains deficient in mismatch repair (e.g. strains containing the
mutS, mutD and/or mutT mutation), resulting in the generation of
mutations. In one exemplification of this embodiment, peptide
libraries derived from the expression of genomic DNA are amplified
or propagated in bacterial strains which are defective in the
epsilon (c) subunit of DNA polymerase III (i.e. dnaQ and mutD
alleles) and/or are defective in mismatch repair. Escherichia coli
mutator strains possessing the mutY and/or mutM and/or mutD and/or
mutT and/or mutA and/or mutC and/or mutS alleles are particularly
useful for such applications. Bacterial strains carrying such
mutations are readily available to those skilled in the art.
[0198] Where fragments are mutated prior to generation of an
expression library both mutated and unmutated fragments should
preferably be combined in the same preparation and are preferably
expressed using vectors described herein. The mutated and unmutated
libraries will undergo the same selection procedures. The
specificity and biological activity of the peptides should then be
compared and examined.
[0199] To enhance diversity within the sequenced genomic peptide
library the fragmented sequenced genomes may also be expressed in
each of their different reading frames. Expression of such
sequences in this manner may be achieved by any method known in the
art including for example by ligating the fragments to adaptors
and/or linkers in the three different reading frames or by placing
the fragments under the control of internal ribosome entry site/s
(IRES) and/or sequences conferring transcriptional/translational
slippage. If adaptors are used, a single vector may contain each of
the different adaptors or each adaptor may be provided in a
different vector.
[0200] The fragments may also be expressed in the reverse reading
frames. Thus, allowing for expression of a gene sequence in each
possible reading frame, for any particular peptide sequence there
will be six different possible combinations.
[0201] The presence of clones in all reading frames allows the
simultaneous screening of random peptides expressed in reading
frames that do not occur in nature, together with a variety of
natural peptide domains cloned in the appropriate reading frame.
This allows a comparison of the relative success of isolation
inhibitors from natural peptide libraries as opposed to random
peptide libraries. The screening methods described herein are also
applicable to the screening of libraries of constrained or
unconstrained random peptides derived from artificial,
non-biological sources.
DEFINITIONS
[0202] As used here in the phrase "not normally associated in its
native environment" shall refer to an activity that the amino acid
sequence is not typically associated with. Further, as used herein
"native environment" shall be understood to refer to the biological
environment in with the amino acid sequence is typically found in
nature.
[0203] As used herein, the term `domain` shall be taken to mean a
functional unit of an amino acid sequence(s) possessing activity in
isolation or in an artificial context and does not necessarily
imply any structural features.
[0204] As used herein `amino acid sequence` shall include peptides,
oligopeptides and polypeptides including derivatives and analogues
thereof being comprised of a number of residues ranging from 1 to
500.
[0205] As used herein, the term `aptamer` shall be taken to include
the highly specific, normally conformationally constrained peptides
related to the class described by Brent and colleagues (3).
[0206] As used herein, the term `activity` shall be taken to
include any enzymatic activity, structural or conformational change
occurring outside or inside the cell.
[0207] As used herein, the term `gene fragment expression library`
shall be taken to include any expression libraries made using
inserts derived from genomic fragments or PCR products of a range
of distinct prokaryotic genomes and/or compact eukaryotic
genomes.
[0208] As used herein the term "derivative" shall be taken to refer
to mutants, parts or fragments of a complete polypeptide as defined
herein which are functionally equivalent. Derivatives include
modified peptides in which ligands are attached to one or more of
the amino acid residues contained therein, such as functional
groups, carbohydrates, enzymes, proteins, polypeptides or reporter
molecules such as radionuclides or fluorescent compounds.
Glycosylated, fluorescent, acylated or alkylated forms of the
subject peptides are also contemplated by the present invention.
Procedures for derivatizing proteins and peptides are well known in
the art.
[0209] "Analogues" of a peptide, protein, polypeptide or enzymes
are functionally equivalent molecules that comprise one or more
non-naturally occurring amino acid analogues known to those skilled
in the art.
[0210] The terms "host" and "cellular host" or similar term refer
to prokaryotic and eukaryotic cells capable of supporting the
expression of a reporter molecule under the control of a biological
activity, irrespective of whether or not the biological activity or
the reporter molecule is endogenous to the cell.
[0211] Those skilled in the art will be aware that a "transformed
cell" is a cell into which exogenous nucleic acid has been
introduced, wherein the exogenous nucleic acid is either integrated
into the host cell genome or alternatively, maintained therein as
an extra chromosomal genetic element such as a plasmid, episome or
artificial chromosome, amongst others.
[0212] The transformed cell of the present invention may be any
cell capable of supporting the expression of exogenous DNA, such as
a bacterial cell, insect cell, yeast cell, mammalian cell or plant
cell. In a particularly preferred embodiment of the invention, the
cell is a bacterial cell, mammalian cell or a yeast cell. In a
particularly preferred embodiment of the invention, the cell is a
yeast cell.
[0213] The term "expression" refers at least to the transcription
of a nucleotide sequence to produce an RNA molecule. The term
"expression may also refer to the combined transcription and
translation of a nucleotide sequence to produce a peptide,
polypeptide, protein or enzyme molecule or alternatively, to the
process of translation of mRNA to produce a peptide, polypeptide,
protein or enzyme molecule.
[0214] By "operably under control" is meant that a stated first
integer is regulated or controlled by a stated second integer.
[0215] In the present context, where the expression of the reporter
molecule is operably under control of a biological activity, said
expression is modified (i.e. enhanced, induced, activated,
decreased or repressed) when a peptide, oligopeptide or polypeptide
capable of enhancing, inducing, activating, decreasing or
repressing the formation of said biological activity is expressed.
Accordingly, it is not usually sufficient for only one partner in
the biological activity to be present for such modified expression
of the reporter molecule to occur however, there may be some
expression of the reporter molecule in the presence of only one
partner.
[0216] As used herein, the term "peptide library" is a set of
diverse nucleotide sequences encoding a set of amino acid
sequences, wherein said nucleotide sequences are preferably
contained within a suitable plasmid, cosmid, bacteriophage or virus
vector molecule which is suitable for maintenance and/or
replication in a cellular host. The term "peptide library" further
encompasses random amino acid sequences derived from a known
genomic sequence, wherein the amino acid sequences are encoded by a
second nucleotide sequence obtained for example by shearing or
partial digestion of genomic DNA using restriction endonucleases or
nucleases such as Dnasel, amongst other approaches.
[0217] Preferred peptide libraries according to this embodiment of
the invention are "representative libraries", comprising a set of
amino acid sequences or nucleotide sequences encoding same, which
includes virtually all possible combinations of amino acid or
nucleotide sequences for a previously defined and specified length
of peptide or nucleic acid molecule, respectively.
[0218] In a particularly preferred embodiment of the invention, the
peptide library comprises cells, virus particles or bacteriophage
particles comprising a diverse set of nucleotide sequences which
encode a diverse set of amino acid sequences, wherein the member of
said diverse set of nucleotide sequences are placed operably under
the control of a promoter sequence which is capable of directing
the expression of said nucleotide sequence in said cell, virus
particle or bacteriophage particle.
[0219] Accordingly, the amino acid sequence encoded by the second
nucleotide sequence may comprise any sequence of amino acids of at
least about 1 to 100 amino acids in length and preferably 1 to 60
amino acids in length and may be derived from the expression of
known nucleotide sequences which are prepared by any one of a
variety of methods such as, for example, random synthetic
generation. More preferably, the peptide unit is a 6 to 20 amino
acid peptide. The use of larger nucleotide fragments, particularly
employing randomly sheared nucleic acid derived from bacterial,
yeast or animal genomes, is not excluded.
[0220] Alternatively or in addition, the amino acid sequence may be
expressed as a fusion protein with a nuclear targeting motif
capable of facilitating targeting of said peptide to the nucleus of
said host cell where transcription occurs, in particular the SV40
nuclear localisation signal which is functional in yeast and
mammalian cells.
[0221] Alternatively, or in addition, the amino acid sequence may
be expressed as a fusion protein with a peptide sequence capable of
enhancing, increasing or assisting penetration or uptake of the
peptide by an isolated cell such as when the subject amino acid
sequence is synthesized ex vivo and added to isolated cells in
culture. In a particularly preferred embodiment, the peptide
sequence capable of enhancing, increasing or assisting penetration
or uptake is functional in higher eukaryotic cells; for example the
Drosophila penetratin targeting sequence. According to this
embodiment, the fusion protein at least comprises the amino acid
sequence:
CysArgGlnIleLysIleTrpPheGlnAsnArgArgMetLysTrpLysLys(Xaa).sub.nCys
[0222] or a homologue, derivative or analogue thereof, wherein Xaa
is any amino acid residue and n has a value grater than or equal to
1. Preferably, the value of n will be at least 5, more preferably
between about 5 and about 20, even more preferably between about 15
and about 35 and still even more preferably between about 30 and
about 50 and still more preferably between about 35 and about 55.
In a still more preferred embodiment, the value of n is between at
least about 40 and at least about 60.
[0223] Reference herein to a "promoter" is to be taken in its
broadest context and includes the transcriptional regulatory
sequences of a classical genomic gene, including the TATA box which
is required for accurate transcription initiation in eukaryotic
cells, with or without a CCAAT box sequence and additional
regulatory elements (i.e. upstream activating sequences, enhancers
and silencers). Promoters may also be lacking a TATA box motif,
however comprise one or more "initiator elements" or, as in the
case of yeast-derived promoter sequences, comprise one or more
"upstream activator sequences" or "UAS" elements. For expression in
prokaryotic cells such as bacteria, the promoter should at least
contain the -35 box and -10 box sequences.
[0224] A promoter is usually, positioned upstream or 5', of a
structural gene, the expression of which it regulates. Furthermore,
the regulatory elements comprising a promoter are usually
positioned within 2 kb of the start site of transcription of the
gene.
[0225] In the present context, the term "promoter" is also used to
describe a synthetic or fusion molecule, or derivative that
confers, activates or enhances expression of the subject reporter
molecule in a cell. Preferred promoters may contain additional
copies of one or more specific regulatory elements, to further
enhance expression of the gene and/or to alter the spatial
expression and/or temporal expression. For example, in yeast
regulatory elements that confer galactose, phosphate or copper
inducibility may be placed adjacent to a heterologous promoter
sequence driving expression of the reporter, thereby conferring
conditional inducibility on the expression of said gene by the
addition of the appropriate inducer to the growth medium.
[0226] Placing a gene operably under the control of a promoter
sequence means positioning the said gene such that its expression
is controlled by the promoter sequence. Promoters are generally
position 5' (upstream) to the genes that they control. In the
construction of heterologous promoter/structural gene combinations
it is generally preferred to position the promoter at a distance
from the gene transcription start site that is approximately the
same as the distance between that promoter and the gene it controls
in its natural setting, i.e., the gene from which the promoter is
derived. As is known in the art, some variation in this distance
can be accommodated without loss of promoter function. Similarly,
the preferred positioning of a regulatory sequence element with
respect to a heterologous gene to be placed under its control is
defined by the positioning of the element in its natural setting,
ie. the genes from which it is derived. Again, as is known in the
art, some variation in this distance can also occur.
[0227] Examples of promoters suitable for use in regulating the
expression of the reporter molecule and/or amino acid sequence
and/or the polypeptide binding partner in a cell include viral,
fungal, yeast, insect, animal and plant derived promoters.
Preferred promoters are capable of conferring expression in a
eukaryotic cell, especially a yeast or mammalian cell. The promoter
may regulate the expression of a gene constitutively, or
differentially with respect to the tissue in which expression
occurs or, with respect to the developmental stage at which
expression occurs, or in response to external stimuli such as
environmental stress, or hormones amongst others.
[0228] Particularly preferred promoters according to the present
invention include those naturally-occurring and synthetic promoters
which contain binding sites for transcription factors, more
preferably for helix-loop-helix (HLH) transcription factors, zinc
finger proteins, leucine zipper proteins and the like. Preferred
promoters may also be synthetic sequences comprising one or more
upstream operator sequences such as LexA operator sequences or
activating sequences derived from any of the promoters referred to
herein such as GAL4 DNA binding sites.
[0229] Those skilled in the art will recognise that the choice of
promoter will depend upon the nature of the cell being transformed
and the molecule to be expressed. Such persons will be readily
capable of determining functional combinations of minimum promoter
sequences and operators for cell types in which the inventive
method is performed.
[0230] In a particularly preferred embodiment, the promoter is a
yeast promoter, mammalian promoter, a bacterial or bacteriophage
promoter sequence selected from the list comprising GAL1, CUP1,
PGK1, ADH2, PHO5, PRB1, GUT1, SP013, ADH1, CMV, SV401 T7, SP6, lac
or tac promoter sequences.
[0231] Whilst the invention is preferably performed in yeast cells,
the inventors clearly contemplate modifications wherein the
invention is performed entirely in mammalian cells, utilising
promoters that are operable in mammalian cells to drive expression
of the various assay components, in combination with a counter
selective reporter gene operable in mammalian cells. Such
embodiments are within the ken of those skilled in the art.
[0232] For expression in mammalian cells, it is preferred that the
promoter is the CMV promoter sequence, more preferably the CMV-IE
promoter or alternatively, the SV40 promoter and, in particular,
the SV40 late promoter sequence. These and other promoter sequences
suitable for expression of genes in mammalian cells are well known
in the art.
[0233] Examples of mammalian cells contemplated herein to be
suitable for expression include COS, VERO, HeLa, mouse C127,
Chinese hamster ovary (CHO), WI-38, baby hamster kidney (BHK) or
MDCK cell lines, amongst others. A wide variety of cell lines such
as these are readily available to those skilled in the art.
[0234] The prerequisite for producing intact polypeptides in
bacterial cells and, in particular, in Escherichia coli cells, is
the use of a strong promoter with an effective ribosome binding
site, such as a Shine-Dalgarno sequence, which may be incorporated
into expression vectors carrying the first and second nucleotide
sequences, or other genetic constructs used in performing the
various alternative embodiments of the invention. Typical promoters
suitable for expression in bacterial cells such as E. coli include,
but are not limited to, the lacZ promoter, temperature-sensitive
.lamda..sub.L or .lamda..sub.K promoters, SP6, T3 or T7 promoter or
composite promoters such as the IPTG-inducible tac promoter. A
number of other vector systems for expressing the nucleic acid
molecule of the invention in E. coli are well known in the art and
are described for example in Ausubel et al (1987) and/or Sambrook
et al (1989). Numerous sources of genetic sequences suitable for
expression in bacteria are also publicly available in various
plasmid constructs, such as for]example, pkC30 (.lamda..sub.L),
PKK173-3 (tac), pET-3 (T7) or the pQE series of expression vectors,
amongst others.
[0235] Suitable prokaryotic cells for expression include
Staphylococcus, Corynebacterium, Salmonella, Escherichia coli,
Bacillus sp. and Pseudomonas sp, amongst others. Bacterial strains
that are suitable for the present purpose are well known in the
relevant art.
[0236] Where the promoter is intended to regulate expression of the
reporter molecule, it is particularly preferred that said promoter
include one or more recognition sequences for the binding of a DNA
binding domain derived from a transcription factor, for example a
GAL4 binding site or LexA operator sequence.
[0237] As used herein, the term "reporter molecule" shall be taken
to refer to any molecule that is capable of producing an
identifiable or detectable result.
[0238] In one embodiment of the invention, the reporter molecule is
an enzyme, peptide, oligopeptide or polypeptide that comprises a
visible product or at least, when incubated in the presence of a
substrate molecule can convert said substrate to a visible product,
such that cells expressing the reporter molecule may be readily
detected. For example, the expression of reporter genes that encode
polypeptides, which themselves fluoresce, or cause fluorescence of
a second molecule, can be operably connected to the biological
activity being assay, to facilitate the detection of cells wherein
expression of the reporter molecule is present or absent. Such
applications are particularly useful in high throughput drug
screening approaches, wherein it is desirable to rapidly screen a
large number of drug candidates for their agonist/antagonist
properties with respect to the biological activity in question.
Preferred reporter molecules according to this embodiment include,
but are not limited to, the Escherichia coli .beta.-galactosidase
enzyme, the firefly luciferase protein and the green fluorescent
protein or mutants thereof which possess red-shifted or
blue-shifted emission spectra or enhanced output. Persons skilled
in the art will be aware of how to utilise genetic sequences
encoding such reporter molecules in performing the invention
described herein, without undue experimentation. For example, the
coding sequence of the gene encoding such a reporter molecule may
be modified for use in the cell line of interest (eg. human cells,
yeast cells) in accordance with known codon usage preferences.
Additionally, the translational efficiency of mRNA derived from
non-eukaryotic sources may be improved by mutating the
corresponding gene sequence or otherwise introducing to said gene
sequence a Kozak consensus translation initiation site.
[0239] Preferably, the reporter molecule allows colorometric
identification of its expression either by direct fluorescence (eg.
Green Fluorescent Protein) or by a change in colour in the presence
of an appropriate substrate (eg. the production of a blue colour
with .beta.-galactosidase in the presence of the substrate
5-bromo-4-chloro-3-indoyl-.beta.-D-galacotside (ie. X-GAL).
[0240] Particularly preferred reporter molecules according to the
present invention are those which produce altered cell growth or
viability, including the ability to induce cell death. In the
present context, the reporter molecule either comprises the first
nucleic acid molecule or is encoded by said first nucleic acid
molecule. Accordingly, those skilled in the art will be aware that
the reporter molecule of such an embodiment is preferably a
peptide, polypeptide, enzyme, abzyme or other protein molecule or
alternatively, an isolated nucleic acid molecule.
[0241] Preferably, the reporter molecule of the invention is
capable of directly or indirectly inhibiting, enhancing or
otherwise modulating the growth and/or viability of the host cell.
Direct modulation of cell growth and/or viability is where
expression of the reporter molecule has a direct consequence on
cell growth and/or viability. Indirect modulation of cell growth
and/or viability is where expression of the reporter molecule has
no direct consequence on cell growth and/or viability, however,
said expression may modulate cell growth and/or viability when
cells are cultured in the presence of a suitable co-factor or
substrate molecule, amongst others.
[0242] Where the reporter molecule is a peptide, polypeptide,
enzyme, abzyme or other protein molecule which comprises a
cytostatic compound, anti-mitotic compound, toxin, mitogen or
growth regulatory substance such as a hormone or protein which is
essential to cell growth or viability, it may have a direct effect
on cell growth or viability when expressed therein. Similarly, a
reporter molecule which comprises a nucleic acid molecule may have
a direct effect on cell growth and/or viability, for example
wherein the reporter molecule is a ribozyme, antisense molecule,
minizyme, or co-suppression molecule which is targeted to the
expression of a gene which is capable of modifying cell growth
and/or viability.
[0243] Wherein it is desirable for the reporter molecule to have an
indirect effect on cell growth and/or viability, this may be
achieved, for example by coupling expression of the reporter
molecule to the production of a cytostatic compound, anti-mitotic
compound, toxin or negative growth regulatory molecule.
[0244] In one embodiment, the reporter molecule is an enzyme which,
when expressed in the host cell, catalyses the conversion of a
substrate molecule which is not capable of altering or affecting
cell growth and/or viability, to produce a product which comprises
a toxin, cytostatic compound or anti-mitotic compound. According to
this embodiment, the expression of the reporter molecule in the
presence of said substrate leads to production of a sufficiently
high concentration of the toxin, cytostatic compound or
anti-mitotic compound to reduce cell growth or result in cell
death.
[0245] In a further embodiment, the reporter molecule is an enzyme
which, when expressed in the host cell, catalyses the conversion of
a cytostatic or anti-mitotic substrate molecule to produce a
product which is incapable of modifying cell growth and/or
viability. According to this embodiment, cells incubated in the
presence of the substrate molecule do not grow or divide as rapidly
as cells that are not incubated therewith. Wherein cells incubated
in the presence of the cytostatic or anti-mitotic substrate
molecule express the reporter molecule, cell division and/or cell
growth is resumed when the concentration of said substrate in said
cell is reduced.
[0246] In an alternative embodiment, the reporter molecule directly
or indirectly enhances cell growth and/or viability, for example by
coupling expression of the reporter molecule to the production of a
mitogen or positive growth regulatory molecule.
[0247] In a further embodiment, the reporter molecule is an enzyme
which, when expressed in the host cell, catalyses the conversion of
a first compound which is inactive in modulating cell growth and/or
viability to produce a mitogen or positive growth regulatory
molecule product. According to this embodiment, cells incubated in
the presence of the substrate molecule grow or divide at a normal
rate compared to other cells. Expression of the enzyme reporter
molecule in the presence of the substrate molecule leads to
enhanced cell growth and/or cell division as the concentration of
the mitogen or positive growth regulatory molecule is increased in
the cell. As a consequence, cells in which the reporter molecule is
enhanced as a result of the biological activity grow and/or divide
more rapidly than the surrounding cells in the library,
facilitating their detection.
[0248] In the context of the present invention, the amino acid
sequence identified using the above method is capable of modulating
the expression of the reporter molecule. Accordingly, the amino
acid sequence may be an agonist or an antagonist of the biological
activity under which expression of the reporter molecule is
operably placed. Wherein the amino acid sequence is an agonist
molecule, reporter molecule expression will be increased or
enhanced or activated and, depending upon whether or not the
reporter molecule directly or indirectly increases or reduces cell
growth and/or viability, cell growth will be increased or reduced,
respectively. In such embodiments of the invention however, it is
clearly undesirable for the reporter molecule to result in cell
death, because it would not be possible to recover the cells
expressing the desired peptide. Wherein the amino acid sequence is
an antagonist of the biological activity, reporter molecule
expression will be decreased or repressed or inactivated and,
depending upon whether or not the reporter molecule directly or
indirectly increases or reduces cell growth and/or viability, cell
growth will be reduced or increased, respectively. Wherein the
reporter molecule leads directly or indirectly to cell death,
antagonism of the biological activity by the antagonist amino acid
sequence facilitates survival of the cell compared to cells which
do not express the antagonist but express the reporter
molecule.
[0249] Examples of suitable yeast positive selectible reporter
genes (suitable for isolation of peptide agonists) include but are
not limited to HISS and LEU2 the protein products of which allow
cells expressing these reporter genes to survive on appropriate
cell culture medium. Conversely, several yeast counterselectable
reporter genes (suitable for isolation of peptide antagonists)
exist, including the URA3 gene, wherein URA3 expression is toxic to
a cell expressing this gene, in the presence of the drug
5-fluoro-orotic acid (5FOA). Other counter-selectable reporter
genes include CYH1 and LYS2, which confer lethality in the presence
of the drugs cycloheximide and alpha aminoadipate (aAA),
respectively. For counter selection in bacteria corresponding
reporter genes encoding toxic products are available, including:
SacB, CcdB and the mammalian GATA-1 gene, the expression of which
is toxic in E. coli.
[0250] Standard methods are used to introduce the first and second
nucleotide sequences into the cellular host. In the case of yeast
cells, this may be achieved by mass mating or transformation.
[0251] In one embodiment, the first and second nucleotide sequences
are each contained within a separate genetic construct, further
comprising a selectable marker gene to facilitate detection of
transformed cells, for example an antibiotic resistance selectable
marker gene. Preferably, the selectable marker genes for each
genetic construct are different, such that the presence of one or
both genetic constructs in a single cell may be facilitated. The
first and second nucleotide sequences may thus be introduced into
the cellular host by shotgun cotransformation and selection on an
appropriate media to select for the presence of both selectable
marker genes.
[0252] Alternatively, the first and second nucleic acid sequences
may be introduced by sequential transformation, accompanied by
selection for the appropriate marker genes after each
transformation event.
[0253] Alternatively, the first and second nucleotide sequences may
be introduced into separate populations of host cells which are
subsequently mated and those cell populations containing both
nucleotide sequences are selected on media permitting growth of
host cells successfully transformed with both first and second
nucleic acid molecules.
[0254] Alternatively, the first and second nucleotide sequences may
be contained on a single genetic construct and introduced into the
host cell population in a single step. In such an embodiment of the
invention, the random peptide library is usually produced using a
vector which at least comprises the first nucleotide sequence
placed operably under control of a suitable promoter with or
without operator sequence, and a selectable marker gene, the
insertion site for the second nucleotide sequence being selected
such that the inserted second nucleotide sequence is capable of
being expressed.
[0255] These embodiments are in addition to the steps to be
performed in relation to the introduction of one or more further
nucleic acid molecules that encode one or more polypeptide binding
partners of the biological activity, variations of which are
described supra.
[0256] The selected host cells can be screened on media comprising
the components required to utilise the counter-selectable reporter
molecule. Hosts cells expressing a peptide that inhibits the
biological activity are unable to adequately transcribe the
counter-selectable reporter gene thereby permitting the host cell
to live in the selection medium. Those host cells expressing amino
acid sequences that are unable to inhibit the biological activity
transcribe the reporter gene thereby resulting in the formation of
a product that is toxic to the host cell in the presence of the
selection medium.
[0257] The genetic construct may be in the form of an autonomously
replicating vector or may comprise genetic sequences to facilitate
integration into a host cell genome.
[0258] Alternatively, the first nucleotide sequence encoding the
reporter molecule can be integrated into the chromosome of the host
cell by homologous recombination of the products of polymerase
chain reaction (PCR), or of sequences on another DNA molecule that
is incapable of replicating autonomously in yeast cells.
[0259] According to the nature of the biological activity of
interest, the first nucleotide sequence may be placed operably in
connection with any promoter sequence, the only requirement being
that the promoter is capable of regulating gene expression in the
host cell selected. Usually, the host cell will be varied to suit
the promoter sequence. The present invention clearly extends to the
isolation of peptides capable of modulating any biological
activity.
[0260] In fact, the present invention will facilitate the
identification and isolation of a amino acid sequences that
modulates or mediate expression of a reporter molecule by agonising
or antagonising any regulatory step which is required for
expression to occur, not merely steps later in the signal
transduction pathway, such as DNA-protein interactions or
interactions between transcription factors. Wherein it is desired
to isolate a specific amino acid sequence which is capable of
modulating a particular biological activity, it is necessary only
to operably connect expression of the first nucleotide sequence to
the biological activity of interest. This is done by placing the
first nucleotide sequence operably in connection with a promoter
sequence which is regulated by the biological activity or
alternatively, genetically manipulating a promoter sequence which
is operably connected to the first nucleic acid molecule thereby
placing the promoter under operable control of the biological
activity.
[0261] In the case of amino acid sequences that modulate or mediate
a protein:DNA interaction which is required for gene expression or
the modulation of gene expression, for example to isolate a peptide
molecule which interacts directly with a cis-acting enhancer or
silencer element or a protein to which said element binds, this
objective may be achieved by introducing the cis-acting element
into a promoter sequence to which the first nucleotide sequence is
operably connected. By this means, expression of the reporter
molecule is placed operably under the control of the cis-acting
element and modulation of gene expression will occur when the
appropriate protein molecule either binds to the cis-acting DNA
element or to the protein that recognises said element.
[0262] In the case of a protein:protein interaction controlling
gene expression, the promoter controlling the expression of the
first nucleic acid molecule is selected such that it contains the
necessary cis-acting elements to which at least one of the proteins
involved in the interaction binds. Where there is not complete
knowledge of the cis-acting sequences or trans-acting factors
involved in regulating gene expression, but the promoter sequence
and cell-type in which expression occurs are known, the first
nucleotide sequence may be placed operably in connection with that
promoter sequence and the resulting nucleic acid molecule
introduced into that cell type. Such a relationship forms the basis
of "two-hybrid" screening approaches. Wherein the peptide of
interest antagonises or agonises any step required for expression
or the activation, repression or enhancement of gene expression,
the effect will be identified by recording altered expression of
the reporter molecule.
[0263] The present invention further contemplates the detection of
amino acid sequences that modulate a biological activity, in a
mammalian cell, wherein expression of the counter-selectable
reporter gene is placed operably under the control of a
mammalian-expressible promoter sequence, which is aberrantly active
in the pathogenic situation, for example an oncogene promoter such
as MYC. Activity of such a promoter would be blocked directly in
cells express an amino acid sequence capable of inhibiting the
oncogene promoter in a mammalian cell.
[0264] In a preferred aspect of the sixth embodiment there is
provided a method for identifying a amino acid sequence which is
capable of antagonising a protein:protein interaction in a host
cell said method comprising the steps of: [0265] (i) producing a
peptide library in a cellular host wherein the transformed cells of
said library contain at least a first nucleotide sequence which
comprises or encodes a reporter molecule capable of reducing the
growth and/or viability of said host cell, the expression of which
is operably under control of said protein:protein interaction and a
second nucleotide sequence derived from a defined genomic sequence
which is capable of encoding said amino acid sequence when placed
operably under the control of a suitable promoter sequence and
wherein (b) substantially all of the defined genomic sequence is
present within the population of transformed cells making up said
library; [0266] (ii) culturing said cellular host for a time and
under conditions sufficient for expression of said second
nucleotide sequence to occur; and [0267] (iii) selecting cells
wherein expression of said reporter molecule is antagonised,
repressed or reduced.
[0268] Preferably, the subject method includes the additional first
step or later step of introducing into the cellular host one or
more further nucleic acid molecules which encode one or more
polypeptide binding partners which are involved in the biological
activity, operably under the control of one or more promoter
sequences. Such embodiments are described in detail supra.
[0269] According to this embodiments, it is preferred that the
reporter molecule comprise a peptide, polypeptide, enzyme, or other
protein molecule which is capable of converting an innocuous
substrate molecule into a cytostatic compound, anti-mitotic
compound or a toxin, such that antagonised expression of the
reporter molecule by the subject peptide prevents cell death or at
least prevents a reduction in cell growth and/or viability in the
presence of the substrate. More preferably, in the yeast system,
the reporter gene is URA3 and/or CYH2, amongst other such as LYS2.
In a particularly preferred embodiment, the reporter molecule is
the product of the URA3 gene which, when expressed converts
5-fluoroorotic acid (5-FOA) to a toxic product.
[0270] One exemplification of this embodiment takes advantage of
the fact that most active eukaryotic transcription activators are
modular and comprise a DNA binding domain and a DNA activation
domain, wherein the DNA binding domain and the DNA activation
domain may be contained on the same protein molecule or
alternatively, on separate molecules which interact to regulate
gene expression. According to this embodiment, the expression of
the reporter molecule is placed operably under the control of a
protein:protein interaction, for example between the oncogenic
proteins SCL and LMO2 which bind to form an active artificial
transcription factor. The transcription of the reporter gene can
therefore be used as an indicator of two proteins interacting where
one of said proteins of interest comprises at least a DNA binding
domain and binds to an operator promoter element upstream of the
reporter gene and said other protein of interest comprises at least
a DNA activation domain. Binding of the DNA binding protein to the
operator, in the presence of a function activation domain,
initiates transcription of the reporter gene. The URA3 reporter
thereby acts as a counter selectable marker.
[0271] This embodiment of the invention may be adapted to the
identification of amino acid sequences which modulate other
protein:protein interactions, by functionally replacing the DNA
binding domain of a transcription factor with a different DNA
binding domain which is specific for a different cis-acting element
in the promoter regulating expression of the reporter molecule.
Methods for the productions of such fusion proteins are well known
to those skilled in the art. In such cases, the selection of an
appropriate DNA binding domain will depend on the nature of the DNA
binding site located upstream of the reporter gene.
[0272] For example, fusion proteins may be constructed between an
oncoprotein and a DNA binding domain and/or a DNA activation
domain. For example, a sequence of nucleotides encoding or
complementary to a sequence of nucleotides encoding residues 176 to
331 of SCL may be fused to the LexA DNA binding domain and a
nucleotide sequence encoding LMO2 may be fused to a DNA activation
domain (or vice-versa).
[0273] The present invention is also particularly useful for
identifying amino acid sequences that inhibit protein:protein
interactions which normally produce deleterious effects (apart from
the deleterious effect of certain reporter molecules), for example
interactions involving oncogene products. Specific examples of
oncogenes, the products of which form transcription factors
contributing to tumorigenesis, include SCL and any one or more of
DRG, E47 and/or LMO2.
[0274] In a further aspect of the sixth embodiment there is
provided a method for identifying a amino acid sequence that is
capable of modifying a protein:protein interaction in a host cell,
said method comprising the steps of: [0275] (i) producing a peptide
library in a host wherein (a) the transformed cells of said library
contain: (1) at least a first nucleotide sequence which comprises
or encodes a reporter molecule wherein said nucleotide sequence is
operably connected to an operator sequence or transcription factor
binding site; (2) a second nucleotide sequence derived from a
defined genomic sequence which encodes said amino acid sequence
when placed operably under the control of a suitable promoter
sequence; and (3) one or more further third nucleotide sequences
which encode one or more polypeptides, proteins or fusion proteins
wherein at least one of said polypeptides, proteins or fusion
proteins includes at least one DNA binding domain capable of
binding to said operator sequence or transcription factor binding
site and at least one of said polypeptides, proteins or fusion
proteins includes at least one DNA activation domain or derivative
thereof capable of activating the expression of said first
nucleotide sequence when targeted to the promoter/operator by
interaction with another protein bearing the cognate DNA binding
domain; and (b) substantially all of the defined genomic sequence
is present within the population of transformed cells making up
said library; [0276] (ii) culturing said host cell for a time and
under conditions sufficient to permit expression of said second and
further nucleotide sequences to occur; and [0277] (iii) selecting
cells wherein expression of said reporter molecule is activated,
inhibited or otherwise modified.
[0278] The proteins involved in the biological activity of
interest, which are encoded by the second nucleic acid molecule,
are synthesised in the host cell, either encoded by one or more
foreign nucleotide sequences transformed into the host cell or
integrated into the genome of said cell. However, the present
invention clearly extends to situations in which these sequences
are also encoded by endogenous host cell genes.
[0279] According to this embodiment, the DNA binding domain binds
to the operator sequence and, in the presence of the DNA activating
region, expression of the reporter molecule occurs. Wherein the
second nucleotide sequence encodes a peptide that antagonises or
inhibits DNA binding and/or DNA activation, expression of the
reporter molecule is repressed, reduced or otherwise inhibited.
Alternatively, wherein the second nucleotide sequence encodes an
amino acid sequence that agonises or enhances DNA binding and/or
DNA activation, expression of the reporter molecule is activated,
enhanced or otherwise increased.
[0280] Those skilled in the art will recognise that the DNA binding
domain and the DNA activation domain may be contained on a single
amino acid molecule or alternatively, they may be contained in
separate amino acid molecules that interact with each other to
regulate reporter gene expression.
[0281] Similarly, the first and/or second and/or further nucleotide
sequences may be contained in a single nucleic acid molecule, for
example in one genetic construct or alternatively, one, two, three
or more of said sequences may be contained on separate nucleic acid
molecules. Wherein one or more of the nucleotide sequences are
contained on separate nucleic acid molecules, then each such
nucleotide sequence is further preferably operably connected to its
own promoter sequence. Alternatively, where any two or more of the
nucleotide sequences are contained on the same nucleic acid
molecules, the nucleotide sequences may be expressed under the
control of a single promoter or alternatively, under the control of
separate promoter sequences.
[0282] Those skilled in the art will recognise that the
alternatives described supra are equally applicable to this
embodiment of the invention.
[0283] In a further preferred aspect of the sixth embodiment, the
subject method further comprises the step of isolating the second
nucleotide sequence from the host cell and sequencing the nucleic
acid molecule and deriving the amino acid sequence encoded
therefor. Once the sequence has been identified it can then be
compared to like sequences in within the known nucleotide sequence
to identify those amino acids which are essential for modulation of
biological activity. Synthetic peptides may then be produced, based
upon the derived amino acid sequence thus obtained. Those skilled
in the art are well versed in such techniques.
[0284] The present invention also contemplates amino acid sequences
identified by the method of the present invention.
[0285] Preferably the amino acid sequences are agonists or
antagonists of protein:protein or protein:DNA interactions. More
preferably, the peptides, oligopeptides and polypeptides of the
present invention are antagonists of protein:protein interactions
or protein:DNA interactions and even more preferably, antagonists
of protein:protein interactions.
[0286] In a particularly preferred embodiment, the peptides of the
invention antagonise or inhibit interactions that produce
deleterious effects in eukaryotic cells, in particular human or
animal cells. More preferably, the amino acid sequences of the
invention antagonise or inhibit interactions which involve one or
more oncoproteins.
[0287] The present invention clearly contemplates the use of said
amino acid sequences or fragments or derivatives thereof in the
prophylactic or therapeutic treatment of human or animal. Methods
of treatment include their use in antibiotic peptide therapy
regimens such as in the treatment protocols for said patients with
bacterial, fungal or viral infections. Their use in treatment
protocols for said patients includes their administration as a
means of inhibiting the growth of the infecting microorganism
and/or inhibiting its virulence. The use of such peptides in
potentiating the effects of other antimicrobial agents is also
envisaged (eg. See international PCT application: WO 96/24684).
[0288] Accordingly, another aspect of the present invention
contemplates a pharmaceutical composition comprising a peptide,
oligopeptide and polypeptide that is capable of modulating a
biological activity and one or more pharmaceutically acceptable
carriers and/or diluents.
[0289] A preferred embodiment contemplates a pharmaceutical
composition wherein said peptide, oligopeptide and polypeptide
antagonises the growth and/or virulence of a pathogen, and one or
more pharmaceutically acceptable carriers and/or diluents. These
components are referred to as the active ingredients.
[0290] The pharmaceutical forms suitable for injectable use include
sterile aqueous solutions (where water-soluble) or dispersions and
sterile powders for the extemporaneous preparation of sterile
injectable solutions or dispersion or may be in the form of a cream
or other form suitable for topical application. Alternatively,
injectable solutions may be delivered encapsulated in liposomes to
assist their transport across cell membrane. Alternatively or in
addition such preparations may contain constituents of
self-assembling pore structures to facilitate transport across the
cellular membrane. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating/destructive action of environmental microorganisms
such as bacteria and fungi. The carrier can be a solvent or
dispersion medium containing, for example, water, ethanol, polyol
(for example, glycerol, propylene glycol and liquid polyethylene
glycol, and the like), suitable mixtures thereof, and vegetable
oils. The proper fluidity can be maintained, for example, by the
use of a coating such as licithin, by the maintenance of the
required particle size in the case of dispersion and by the use of
superfactants. Prevention of the action of microorganisms can be
brought about by various antibacterial and antifungal agents, for
example, parabens, chlorobutanol, phenol, sorbic acid, thirmerosal
and the like. In many cases, it will be preferable to include
isotonic agents, for example, sugars or sodium chloride. Prolonged
absorption of the injectable compositions can be brought about by
the use in the compositions of agents delaying absorption, for
example, aluminum monostearate and gelatin.
[0291] Sterile injectable solutions are prepared by incorporating
the active compounds in the required amount in the appropriate
solvent with various of the other ingredients enumerated above, as
required, followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the various sterilized
active ingredient into a sterile vehicle which contains the basic
dispersion medium and the required other ingredients from those
enumerated above. In the case of sterile powders for the
preparation of sterile injectable solutions, the preferred methods
of preparation are vacuum drying and the freeze-drying technique
which yield a powder of the active ingredient plus any additional
desired ingredient from previously sterile-filtered solution
thereof.
[0292] When the active ingredients are suitably protected they may
be orally administered, for example, with an inert diluent or with
an assimilable edible carrier, or it may be enclosed in hard or
soft shell gelatin capsule, or it may be compressed into tablets,
or it may be incorporated directly with the food of the diet. For
oral therapeutic administration, the active compound may be
incorporated with excipients and used in the form of ingestible
tablets, buccal tablets, troches, capsules, elixirs, suspensions,
syrups, wafers, and the like. Such compositions and preparations
should contain at least 1% by weight of active compound. The
percentage of the compositions and preparations may, of course, be
varied and may conveniently be between about 5 to about 80% of the
weight of the unit. The amount of active compound in such
therapeutically useful compositions in such that a suitable dosage
will be obtained. Preferred compositions or preparations according
to the present invention are prepared so that a dosage unit form
contains between about 0.1 .mu.g and 20 g of active compound.
[0293] The tablets, troches, pills, capsules and the like may also
contain the components as listed hereafter: A binder such as gum,
acacia, corn starch or gelatin; excipients such as dicalcium
phosphate; a disintegrating agent such as corn starch, potato
starch, alginic acid and the like; a lubricant such as magnesium
stearate; and a sweetening agent such as sucrose, lactose or
saccharin may be added or a flavouring agent such as peppermint,
oil of wintergreen, or cherry flavouring. When the dosage unit form
is a capsule, it may contain, in addition to materials of the above
type, a liquid carrier. Various other materials may be present as
coatings or to otherwise modify the physical form of the dosage
unit. For instance, tablets, pills, or capsules may be coated with
shellac, sugar or both. A syrup or elixir may contain the active
compound, sucrose as a sweetening agent, methyl and propylparabens
as preservatives, a dye and flavouring such as cherry or orange
flavour. Of course, any material used in preparing any dosage unit
form should be pharmaceutically pure and substantially non-toxic in
the amounts employed. In addition, the active compound(s) may be
incorporated into sustained-release preparations and
formulations.
[0294] The present invention also extends to forms suitable for
topical application such as creams, lotions and gels.
[0295] Pharmaceutically acceptable carriers and/or diluents include
any and all solvents, dispersion media, coatings, antibacterial and
antifungal agents, isotonic and absorption delaying agents and the
like. The use of such media and agents for pharmaceutical active
substances is well known in the art. Except insofar as any
conventional media or agent is incompatible with the active
ingredient, use thereof in the therapeutic compositions is
contemplated. Supplementary active ingredients can also be
incorporated into the compositions.
[0296] It is especially advantageous to formulate parenteral
compositions in dosage unit form for ease of administration and
uniformity of dosage. Dosage unit form as used herein refers to
physically discrete units suited as unitary dosages for the
mammalian subjects to be treated; each unit containing a
predetermined quantity of active material calculated to produce the
desired therapeutic effect in association with the required
pharmaceutical carrier. The specification for the novel dosage unit
forms of the invention are dictated by and directly dependent on
(a) the unique characteristics of the active material and the
particular therapeutic effect to be achieved, and (b) the
limitations inherent in the art of compounding such an active
material for the treatment of disease in living subjects having a
diseased condition in which bodily health is impaired as herein
disclosed in detail.
[0297] The principal active ingredient is compounded for convenient
and effective administration in effective amounts with a suitable
pharmaceutically acceptable carrier in dosage unit form. A unit
dosage form can, for example, contain the principal active compound
in amounts ranging from 0.5 .mu.g to about 2000 mg. Expressed in
proportions, the active compound is generally present in from about
0.5 .mu.g to about 2000 mg/ml of carrier. In the case of
compositions containing supplementary active ingredients, the
dosages are determined by reference to the usual dose and manner of
administration of the said ingredients.
[0298] The pharmaceutical composition may also comprise genetic
molecules such as a vector capable of transfecting target cells
where the vector carries a nucleic acid molecule capable of
inhibiting such deleterious biological interaction/activities. The
vector may, for example, be a viral vector.
EXAMPLES
[0299] Further features of the present invention are more fully
described in the following non-limiting Examples. It is to be
understood, however, that this detailed description is included
solely for the purposes of exemplifying the present invention. It
should not be understood in any way as a restriction on the broad
description of the invention as set out above.
[0300] Methods of molecular cloning, immunology and protein
chemistry that are not explicitly described in the following
examples are reported in the literature and are known by those
skilled in the art. General texts that described conventional
molecular biology, microbiology, and recombinant DNA techniques
within the skill of the art, included, for example: Sambrook et
al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989);
Glover ed., DNA Cloning: A Practical Approach, Volumes I and II,
MRL Press, Ltd., Oxford, U.K. (1985); and Ausubel, F., Brent, R.,
Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A.,
Struhl, K. Current protocols in molecular biology, Greene
Publishing Associates/Wiley Intersciences, New York.
Example 1
The Construction of Biodiverse Gene Fragment Libraries
[0301] The genomic DNA of a diverse panel of microorganisms, chosen
to maximise the genetic diversity across the panel, were reduced to
fragments suitable for expressing peptides. Techniques suitable for
achieving this outcome include: mechanical shearing, partial
DNA-asel digestion and the use of combinations of restriction
endonuclease.
[0302] Each genome was then added to the pool in direct proportion
to its size and complexity. More DNA of large genomes was added
than small genomes to ensure adequate representation.
[0303] A peptide library was then constructed by digesting aliquots
of the pooled DNA with all 6 combinations of 2 restriction enzymes
from a set containing Alu I, Bst U I, Hae III and Rsa I. These
enzymes are blunt-cutting restriction endonucleases, which have
distinct 4 base pair recognition sequences and thus each
combination will produce fragments with sizes in the 90-120 bp
range predominating. These are suitable for cloning and the length
of DNA is sufficient to encode peptides of about 30 amino acid
residues that are in the range of the sizes of sequences reported
in structurally conserved regions of proteins. In instances where
linkers rather than adaptors are to be ligated to the genomic
fragments, the genomic digest pool may be protected from subsequent
digestion by treatment with an appropriate methylase (in this
example EcoR1 methylase).
[0304] The digest fragments were purified by native acrylamide gel
electrophoresis followed by gel filtration chromatography.
[0305] Linkers were then ligated onto the DNA fragments by standard
methods. 3 reading frames of linkers were used. Where the fragments
are to be cloned into an EcoR1 site, equimolar amounts of the
following 3 self-annealing linkers may be used:
TABLE-US-00001 d(pGGAATTCC), d(pCGGAATTCCG) and
d(pCCGGAATTCCGG)
[0306] Where the cloning was intended to be directional, an
equimolar amount of another linker corresponding to the second 3'
restriction site was added--eg for cloning into EcoR1 and HindIII
sites of a vector (eg., an equal number of moles (to be combined
EcoR1 linkers) of the following linker was added to the ligation:
d(pCCAAGCTTGG).
[0307] Linkers were then digested with the restriction
endonuclease/s corresponding to their recognition sequences and
appropriately sized digest fragments were purified by standard
techniques including; agarose gel electrophoresis, sucrose or
potassium acetate gradients, or size exclusion chromatography.
[0308] The genomic fragments which contain flanking linkers or
adaptors (see example 4 below) were then cloned into a pT7-Select
expression vector by standard methodology for library
construction.
Example 2
BGF Library Construction
[0309] Biodiverse gene fragment libraries can be constructed using
adapted fragments of pooled genomic DNA from an evolutionarily
diverse set of compact genomes. To maximise the diversity of the
pool, the relative concentration of DNA in the pool from larger
genomes can be increased in proportion to the total haploid genome
size. The genomic inserts can be fragmented using mechanical
shearing (e.g. sonication) followed by repair and ligation of
linker oligonucleotides or adaptors. Alternatively, they can be
made by polymerase extension of partially degenerate
oligonucleotides anealed to the denatured genomic DNA, followed by
amplification using the polymerase chain reaction (PCR).
[0310] In this example the oligonucleotides used in the primary
extension with the Klenow fragment of DNA polymerase-I (at 15-25
degrees celcius), had the sequence:
(Using * to represent a universal base such as 5-nitro-indole)
TABLE-US-00002 Forward primer: GACTACAAGGACGACGACGACAAGNNNNNNNN*
Reverse primer: ATTCCCGGGAAGCTTATCAATCAATCANNNNNNNN*
[0311] N corresponded to degenerate nucleotides (e.g. either dATP,
dCTP, dGTP or dTTP). Moreover, either of the universal bases:
deoxyinosine, or 5-Nitroindole (or functionally equivalent
analogue) can be substituted at any or all of the `N` positions of
the primer, especially at the 3' terminal position. Thus the length
of the `N` series can varied from 6 to 8 nucleotides.
[0312] According to this example, the primers for the nested PCR
amplification of the product of the Klenow extension reaction
were:
TABLE-US-00003 Forward primer: GAGAGGAATTCAGACTACAAGGACGACGACGACAAG
Reverse primer: GAGAGAATTCCCGGGAAGCTTATCAATCAATCA
[0313] The PCR amplification was performed using a `Touchdown`
protocol with `hot-start` enzyme to maximise specificity.
[0314] The initial extension and PCR amplification was performed
entirely with Klenow polymerase adding more polymerase each cycle
as in the initial report of PCR. This allows the entire cycling to
be performed between the denaturation temperature (90-100 degrees
celcius) and a low, annealing temperature (15-25 degrees celcius),
minimising the potential annealing bias against amplification of
A/T rich sequences. For this approach the primers had the form:
TABLE-US-00004 Forward primer: GAGAATTCANNNNNNNN* Reverse primer:
GAGAATTCNNNNNNNN*
[0315] Methylated nucleotides can be included in the PCR reaction
(but not incorporated into the primers) to protect the products
from internal cleavage with restriction enzymes during cloning.
[0316] In a preferred form of the example, mutagenic PCR using
alternative nucleotides and/or the use of a manganese buffer can
also be employed to increase the sequence diversity of inserts.
[0317] The resultant PCR products were digested with EcoR1 alone or
EcoR1 and Xma1 (where the reverse primer contains an Xma1 site
prior to cloning into vectors of the pBLOCK series.
[0318] Libraries were constructed according to standard methodology
using the highest efficiency commercially available competent cells
viz. XL10-Gold (Stratagene) to ensure complexities greater than
10.sup.7 independent clones.
Example 3
Mimotope Libraries Using Biodiverse Gene Fragments
[0319] This example illustrates the detection of mimotopes from the
major house dust mite allergen Der p 1.
[0320] DNA in the 90-120 bp range of each of the double digests was
isolated and pooled, ligated to linkers in all reading frames and
cloned into phage display vector T7 Section 1.1 or the vector T7
Section 415. Some DNA fragments were outside the range of 90-120 bp
range and were not cloned, but the redundancy in the digestion
procedures should allow a representation of most sequences. The use
of a pool of 3 reading frames of linkers and/or a translational
slippage signal in the construction of the library ensured that all
6 reading frames of the inserts were represented. The total genome
size of a biodiverse panel of microorganisms was approximately 35
Mb. This procedure generated about 12.times.10.sup.6 different
fragments allowing for cloning in all reading frames and
orientations. Allowing for the latter about 1/6.sup.th of the
sequences encoded natural peptides. The T7Select is a molecular
cloning system with high packaging efficiency and is designed to
display the peptides encoded by the cloned DNA as C-terminal
fusions on a phage coat protein which is accessible for affinity
purification procedures. A minority of the unnatural peptides were
smaller than the estimated size range because they will be
truncated by stop codons. The T7 Select 1.1 or the vector T7 Select
415 display the peptide in low and high copy number so high and low
affinity interactions can be used for affinity purification.
[0321] Further diversity was generated by PCR mutagenesis which
conducts the amplification under conditions which favour high error
rates. It has been calculated with an error rate of 0.5 bases per
100 bp/cycle (which can be achieved) that eight mutagenic cycles
produces base changes in 90% of the PCR products and almost 50%
will have 2 or 3 substitutions. Linkers were added to provide the
primer sequences for the PCR and a final high fidelity PCR was
performed with linkers extended to provide cloning sites. The
mutated fragments had a 10.times. diversification of the sequences
in an amount of DNA which was readily packaged.
[0322] Phage from the libraries constructed above which display
peptides which bind to human and murine IgG and IgE anti-Der p 1
were isolated using methods based on those described for pollen
allergens [11] and other antigens. They are essentially standard
protocols for affinity purifying phage displaying antigens. Such
methods have been described for filamentous phage display systems
and the T7Select cloning system.
[0323] Antibody was affinity purified from Der p 1-coupled
Sepharose.TM. and used to coat ELISA wells to immunoselect phage by
a panning procedure. Several cycles of selection and phage
amplification were performed as recommended. Several types of
affinity purification methods have been used for selecting phage so
there is scope to use a variety of procedures. Human IgE antibodies
were isolated from the serum of allergic subjects and IgG from the
serum of allergic and nonallergic subjects. Monoclonal mouse IgG
antibodies which are known to recognizes a different epitope were
used to isolate peptides which mimic different epitopes.
[0324] Following selection and amplification of the phage
displaying the peptides further purification may be obtained using
plaque immunoassays performed with anti Der p 1 antibodies [11;
12]. Such a procedure enables the isolation of individual clones
reacting with the antibodies. Crossover immunoassays were performed
with different human and mouse antibody preparations to estimate
the frequency of, and to isolate shared peptide mimotopes. Phage
were then selected for further study based on the sequence of the
peptide, the serological reactivity and intended use. The
specificity of the antibody mimotope interaction was tested by
inhibition assays against other purified mite allergens and by
Western blotting of antiserum against complex protein sources,
allergen and microbial extracts.
[0325] The antibody binding activity of mimotopes can often be
improved by fine adjustments of the amino acid sequence. Clones
encoding peptides reacting with anti Der p 1 were optimized for
antibody binding by random mutagenesis using PCR enhanced for
mismatching by Mn.sup.++ and high nucleotide concentrations. The
sequences flanking cloning site will be used for the primers. A
final high fidelity PCR using the primers extended to contain the
restriction enzyme sequences for recloning into display vector was
performed for cloning. The phage containing the mutated inserts
were then used to transform E. coli and produce plaques for
immunoscreening. Clones showing the highest antibody binding
activity were picked.
[0326] The peptides identified by the described purification
procedure were tested for their ability to not only mimic the an
epitope of the Der p 1 allergen but to be a mimotope which can
immunise animals or humans to induce anti Der p 1 antibodies. This
was performed in the following ways: with a synthetic peptide
chemically coupled to an immunogenic carrier, with peptide
genetically fused to a carrier by molecular cloning techniques and
by using the phage displaying the peptide as immunogens.
[0327] The ability of the peptides to bind to IgE against the Der p
1 allergen can be used for diagnostic techniques which not only
detect the presence of antibody but which can also show the
diversity of the immune response and pattern of epitope
recognition. The ability to act as a mimotope and induce
anti-allergen IgG antibody can be used in several immunotherapeutic
strategies. Importantly constructs can be produced to enable the
peptide to be used as a monovalent immunogen and thus prevent
allergens reaction cause by cross-linking IgE molecules in allergic
patients.
Example 4
Screening Peptide Libraries Encoding Biodiverse Gene Fragments for
Antimicrobial Agents
[0328] To isolate novel peptides with antibiotic activity against a
multi-resistant Staphylococcus aureus strain, the following
approach was used.
[0329] A biodiverse gene fragment library was first made by the
procedures described in example 1 in a T7-phage vector. Examples of
T7-phage vectors that can be used in this part of the method
include: T7Select 415-1b, T7Select1-1b, T7Select1-2a, T7Select1-2b
and/or, T7Select1-2c (Novagen), having a complexity greater
1,000,000 individual clones.
[0330] The library was plated out at a multiplicity of at least one
on a lawn of either E. coli BL21 (in the case of T7Select415-1b) or
either of the complementing hosts E. coli BLT5403 or E. coli
BLT5615 (for the other vectors), to allow a plaque density of below
semi-confluence.
[0331] The plates used were double-sided, being made in a fashion
resembling dual culture plates joined together by the underside.
Such plates therefore had two lids on opposite faces. The adjoining
face of the two sides of the plates was made of nitrocellulose or
nylon membrane, supported by a grid made of a rigid material such
as plastic. The opposite side of the plate to the side containing
the BL21-derived T7 plaque overlay contained media suitable for the
growth of Staphylococcus aureus. Following the plating of the
library, the Staphylococcus aureus was on the face of the plate
containing the appropriate media at the minimum density required to
obtain a lawn.
[0332] The plates were then incubated at 37 degrees Celsius until
the T7 phage plaques appear and the Staphylococcus aureus lawn
appears. Any discontinuities in the lawn of Staphylococcus aureus
can reflect the diffusion of an inhibitory drug produced by a phage
plaque at a corresponding position on the opposite side of the
plate. The plaques were then purified to clonality and tested for
inhibitory properties in subsequent secondary, tertiary and/or
quarternary screens.
[0333] The inserts from pure plaques were then amplified using PCR
and sequenced using vector primers. The inserts of the clones were
then subcloned and purified by standard bacterial expression
methodology using vectors such as PET14b, pMAL-c2 or pTYB1, and
tested for minimal inhibitory concentration (MIC) by methods known
to those skilled in the art.
[0334] The sequence of inhibitory peptides can then be used to
design synthetic peptide-based candidate drugs which would be
tested for animicrobial activity against Staphylococcus aureus.
Example 5
Selecting Blockers of Protein/Protein Interactions from Biodiverse
Gene Fragment Libraries in Yeast
[0335] Reverse two hybrid libraries were constructed and screened
using the vector pBLOCK-1 as described in our earlier specification
(see PCT/AU99/00018) using genomic inserts prepared as described
supra in example 1, with the addition of EcoR1 linkers and cloned
into the EcoR1 site of the vector.
[0336] Obvious variations of this method will be known to those
skilled in the art such as the possibility of using adaptors
instead of linkers, of using alternative cloning sites and of
including addition sequences into the linkers. For example a pool
of the following annealed adaptors could be used in place of the
linkers: (Each strand of the adaptor sequence is shown reading 5'
to 3').
TABLE-US-00005 Adaptor 1
AATTCAATCAATCACACACAGGAGGCCACCATGGATGCATGTGTGCACGT
GCACACATGCATCCATGGTGGCCTCCTGTGTGTGATTGATTG Adaptor 2
AATTCAATCAATCACACACAGGAGGCCACCATGGATGCATGTGTGCATGC
ACACATGCATCCATGGTGGCCTCCTGTGTGTGATTGATTG Adaptor 3
AATTCAATCAATCACACACAGGAGGCCACCATGGATGCATGTGTGCGCAC
ACATGCATCCATGGTGGCCTCCTGTGTGTGATTGATTG
[0337] Adaptors such as those shown here can encode motifs useful
for expression or conformational constraint (eg. in this case; dual
Shine-Dalgarno and Kozak sequences, flanking cysteine residues and
stop codons).
[0338] The library was transformed or mated into a yeast strain
containing the two proteins whose interaction which one intends to
block and containing counter selectable reporter genes whose
expression is dependent on that interaction. Detailed methodology
for reverse two hybrid screening is described in our specification
PCT/AU99/00018.
REFERENCES
[0339] 1. Tiozzo, E., Rocco, G., Tossi, A. & Romeo, D. (1998).
Biochemical and Biophysical Research Communications, 249, 202-206.
[0340] 2. Balaban, N., Goldkorn, T., Nhan, R., Dang, L., Scott, R
M, R., Rasooly, A., Wright, S., Larrick, J., Rasooly, R. &
Carlson, J. (1998). Science, 280, 438-440. [0341] 3. Colas, P.,
Cohen, B., Jessen, T., Grishina, I., McCoy, J., Brent, R. (1996).
Nature, 380, 548-550. [0342] 4. Xu, C., Mendelsohn, A. & Brent,
R. (1997). Proc. Natl. Acad. Sci. USA, 94, 12473-12478. [0343] 5.
Kolonin, M. & Finley, R. (1998). Proc. Natl. Acad. Sci. USA,
95, 14266-14271. [0344] 6. Derossi, D., Joliot, A. H., Chassaing,
G., Prochiantz, A. (1994). Journal of Biological Chemistry, 269,
10444-10450. [0345] 7. Phelan, A. (1998). Nature Biotechnology, 16,
440-443. [0346] 8. Marcello, A., Loregion, A., Cross, A., Marsden,
H., Hirst, T., Palu, G. (1994). Proc. Natl. Acad. Sci. USA, 91,
8994-8998. [0347] 9. Fahraeus, E., Paramio, J. M., Ball, K. L.,
Lain, S., Lane, D. P. (1996). Current Biology, 6, 84-91. [0348] 10.
Mennuni, C., Santini, C., Lazzaro, D., Dott, F., Farilla, L.,
Fierabracci, A., Bottazzo, G. F., Di Mario, U., Cortese, R. &
Luzzago, A. (1997). Journal of Molecular Biology, 268, 599-606.
[0349] 11. Leitner, A., Vogel, M., Radauer, C., Breiteneder, H.,
Stadler, B. M., Scheiner, O., Kraft, D. & Jensen-Jarolim, E.
(1998). European Journal of Immunology, 28, 2921-7. [0350] 12.
Pincus, S. H., Smith, M. J., Jennings, H. J., Burritt, J. B. &
Glee, P. M. (1998). Journal of Immunology, 160, 293-8.
Sequence CWU 1
1
141118PRTDrosophila sp.misc_feature(18)..(117)Xaa can be any
naturally occurring amino acid 1Cys Arg Gln Ile Lys Ile Trp Phe Gln
Asn Arg Arg Met Lys Trp Lys 1 5 10 15 Lys Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 20 25 30 Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 35 40 45 Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 50 55 60 Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 65 70
75 80 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa 85 90 95 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa 100 105 110 Xaa Xaa Xaa Xaa Xaa Cys 115 28DNAArtificial
SequenceDescription of Artificial sequence Synthetic linker
2ggaattcc 8310DNAArtificial SequenceDescription of Artificial
sequence Synthetic linker 3cggaattccg 10412DNAArtificial
SequenceDescription of Artificial sequence Synthetic linker
4ccggaattcc gg 12510DNAArtificial SequenceDescription of Artificial
sequence Synthetic linker 5ccaagcttgg 10632DNAArtificial
SequenceDescription of Artificial sequence Synthetic primer
6gactacaagg acgacgacga caagnnnnnn nn 32735DNAArtificial
SequenceDescription of Artificial sequence Synthetic primer
7attcccggga agcttatcaa tcaatcannn nnnnn 35836DNAArtificial
SequenceDescription of Artificial sequence Synthetic primer
8gagaggaatt cagactacaa ggacgacgac gacaag 36933DNAArtificial
SequenceDescription of Artificial sequence Synthetic primer
9gagagaattc ccgggaagct tatcaatcaa tca 331017DNAArtificial
SequenceDescription of Artificial sequence Synthetic primer
10gagaattcan nnnnnnn 171116DNAArtificial SequenceDescription of
Artificial sequence Synthetic primer 11gagaattcnn nnnnnn
161292DNAArtificial SequenceDescription of Artificial sequence
Synthetic adaptor 12aattcaatca atcacacaca ggaggccacc atggatgcat
gtgtgcacgt gcacacatgc 60atccatggtg gcctcctgtg tgtgattgat tg
921390DNAArtificial SequenceDescription of Artificial sequence
Synthetic adaptor 13aattcaatca atcacacaca ggaggccacc atggatgcat
gtgtgcatgc acacatgcat 60ccatggtggc ctcctgtgtg tgattgattg
901488DNAArtificial SequenceDescription of Artificial sequence
Synthetic adaptor 14aattcaatca atcacacaca ggaggccacc atggatgcat
gtgtgcgcac acatgcatcc 60atggtggcct cctgtgtgtg attgattg 88
* * * * *
References