U.S. patent application number 14/830464 was filed with the patent office on 2015-12-03 for genetically modified major histocompatibility complex mice.
The applicant listed for this patent is Regeneron Pharmaceuticals, Inc.. Invention is credited to Cagan Gurer, Lynn Macdonald, Andrew J. Murphy, Vera Voronina, Yingze Xue.
Application Number | 20150342163 14/830464 |
Document ID | / |
Family ID | 54700278 |
Filed Date | 2015-12-03 |
United States Patent
Application |
20150342163 |
Kind Code |
A1 |
Voronina; Vera ; et
al. |
December 3, 2015 |
GENETICALLY MODIFIED MAJOR HISTOCOMPATIBILITY COMPLEX MICE
Abstract
The invention provides genetically modified non-human animals
that express chimeric human/non-human MHC I and MHC II polypeptides
and/or human or humanized .beta.2 microglobulin polypeptide, as
well as embryos, cells, and tissues comprising the same. Also
provided are constructs for making said genetically modified
animals and methods of making the same. Methods of using the
genetically modified animals to study various aspects of human
immune system are provided.
Inventors: |
Voronina; Vera; (Sleepy
Hollow, NY) ; Gurer; Cagan; (Valhalla, NY) ;
Murphy; Andrew J.; (Croton-on-Hudson, NY) ;
Macdonald; Lynn; (White Plains, NY) ; Xue;
Yingze; (Ardsley, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Regeneron Pharmaceuticals, Inc. |
Tarrytown |
NY |
US |
|
|
Family ID: |
54700278 |
Appl. No.: |
14/830464 |
Filed: |
August 19, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14185316 |
Feb 20, 2014 |
|
|
|
14830464 |
|
|
|
|
62039333 |
Aug 19, 2014 |
|
|
|
61767811 |
Feb 22, 2013 |
|
|
|
Current U.S.
Class: |
800/18 ;
800/14 |
Current CPC
Class: |
A01K 2217/072 20130101;
C12N 15/8509 20130101; A01K 67/0278 20130101; A01K 2227/105
20130101; A01K 67/0271 20130101; C07K 14/70514 20130101; C07K
14/70539 20130101; C07K 14/70517 20130101; A01K 2207/15 20130101;
A01K 2267/03 20130101 |
International
Class: |
A01K 67/027 20060101
A01K067/027 |
Claims
1. A non-human animal comprising at an endogenous MHC locus: a
first nucleotide sequence encoding a chimeric human/non-human
animal MHC I polypeptide, wherein a human portion of the chimeric
MHC I polypeptide comprises an extracellular domain of a human MHC
I polypeptide, a second nucleotide sequence encoding a chimeric
human/non-human animal MHC II .alpha. polypeptide, wherein a human
portion of the chimeric human/non-human MHC II .alpha. polypeptide
comprises an extracellular domain of a human MHC II .alpha.
polypeptide, and a third nucleotide sequence encoding a chimeric
human/non-human animal MHC II .beta. polypeptide, wherein a human
portion of the chimeric human/non-human MHC II .beta. polypeptide
comprises an extracellular domain of a human MHC II .beta.
polypeptide, wherein the non-human animal expresses chimeric
human/non-human MHC I and MHC II proteins from the endogenous MHC
locus, and wherein all genes encoding endogenous non-human animal
MHC I and MHC II proteins that are expressed on a cell surface are
functionally inactivated.
2. The non-human animal of claim 1, wherein the first nucleotide
sequence is located at an endogenous non-human animal MHC I locus,
the second nucleotide sequence is located at an endogenous
non-human animal MHC II .alpha. locus, and the third nucleotide
sequence is located at an endogenous non-human animal MHC II .beta.
locus.
3. The non-human animal of claim 1, wherein the first, second
and/or third nucleotide sequence(s) are operably linked to
endogenous non-human animal regulatory elements.
4. The non-human animal of claim 1, wherein the human portion of
the chimeric MHC I polypeptide comprises .alpha.1, .alpha.2, and
.alpha.3 domains of the human MHC I polypeptide.
5. The non-human animal of claim 1, wherein the non-human animal
portion of the chimeric MHC I polypeptide comprises transmembrane
and cytoplasmic domains of an endogenous non-human MHC I
polypeptide.
6. The non-human animal of claim 1, wherein the human MHC I
polypeptide is selected from the group consisting of HLA-A, HLA-B,
and HLA-C.
7. The non-human animal of claim 1, further comprising at an
endogenous non-human animal .beta.2 microglobulin locus a
nucleotide sequence encoding a human or humanized .beta.2
microglobulin polypeptide, wherein the non-human animal expresses
the human or humanized .beta.2 microglobulin polypeptide.
8. The non-human animal of claim 1, wherein the human MHC II
.alpha. extracellular domain comprises human MHC II .alpha.1 and
.alpha.2 domains.
9. The non-human animal of claim 1, wherein the human MHC II .beta.
extracellular domain comprises human MHC II .beta.1 and .beta.2
domains.
10. The non-human animal of claim 1, wherein the first nucleotide
sequence is operably linked to endogenous non-human animal MHC I
promoter and regulatory elements, the second nucleotide sequence is
operably linked to endogenous non-human animal MHC II .alpha.
promoter and regulatory elements, and the third nucleotide sequence
is operably linked to endogenous non-human animal MHC II .beta.
promoter and regulatory elements.
11. The non-human animal of claim 1, wherein the non-human animal
portion of the chimeric human/non-human animal MHC II .alpha.
polypeptide comprises transmembrane and cytoplasmic domains of an
endogenous non-human animal MHC II .alpha. polypeptide.
12. The r non-human animal of claim 1, wherein the non-human animal
portion of the chimeric human/non-human animal MHC II .beta.
polypeptide comprises transmembrane and cytoplasmic domains of an
endogenous non-human animal MHC II .beta. polypeptide.
13. The non-human animal of claim 1, wherein the human portions of
the chimeric human/non-human animal MHC II .alpha. and .beta.
polypeptides are derived from a human HLA class II protein selected
from the group consisting of HLA-DR, HLA-DQ, and HLA-DP.
14. The non-human animal of claim 13, wherein the human portions of
the chimeric human/non-human animal MHC II .alpha. and .beta.
polypeptides are derived from a human HLA-DR protein.
15. The non-human animal of claim 1, wherein the non-human animal
is a mouse, wherein the first nucleotide sequence encodes a
chimeric human/mouse MHC I polypeptide, and wherein a mouse portion
of the chimeric MHC I polypeptide is derived from H-2K, H-2D, or
H-2L.
16. The mouse of claim 15, wherein the mouse portion of the
chimeric MHC I polypeptide is derived from H-2K.
17. The non-human animal of claim 13, wherein the non-human animal
is a mouse, wherein the second nucleotide sequence encodes a
chimeric human/mouse MHC II .alpha. polypeptide, the third
nucleotide sequence encodes a chimeric human/mouse MHC II .beta.
polypeptide, and wherein mouse portions of the chimeric MHC II
.alpha. and .beta. polypeptides are derived from H-2E or H-2A.
18. The mouse of claim 17, wherein the mouse portions of the
chimeric MHC II polypeptides are derived from H-2E.
19. The mouse of claim 18, wherein the mouse endogenous gene
encoding a H-2A polypeptide is functionally inactivated.
20. The non-human animal of claim 1, wherein the non-human animal
is a mouse, wherein the first nucleotide sequence encodes a
chimeric HLA-A/H-2K polypeptide, the second nucleotide sequence
encodes an .alpha. chain of a chimeric HLA-DR/H-2E polypeptide, and
the third nucleotide sequence encodes a .beta. chain of a chimeric
HLA-DR/H-2E polypeptide, and wherein the mouse expresses HLA-A/H-2K
and HLA-DR/H-2E proteins.
21. The mouse of claim 20, wherein the first nucleotide sequence is
located at an endogenous mouse H-2K locus and wherein the mouse
lacks all or part of an endogenous H-2D gene and/or all or part of
an endogenous mouse H-2L gene.
22. The mouse of claim 20, wherein the second nucleotide sequence
is located at an endogenous H-2E .alpha. locus and the third
nucleotide sequence is located at an endogenous H-2E .beta. gene,
and wherein the mouse lacks all or part of an endogenous mouse H-2A
gene.
23. The mouse of claim 21, wherein the second nucleotide sequence
is located at an endogenous H-2E .alpha. locus and the third
nucleotide sequence is located at an endogenous H-2E .beta. locus,
and wherein the mouse lacks all or part of an endogenous mouse H-2A
gene.
24. The non-human animal of claim 1, wherein the non-human animal
is a rodent.
25. The non-human animal of claim 23, wherein the rodent is a mouse
or a rat.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit under 35 U.S.C. .sctn.119(e)
of U.S. provisional patent application Ser. No. 62/039,333, filed
Aug. 19, 2014 and is a continuation-in-part application of U.S.
application Ser. No. 14/185,316, filed Feb. 20, 2014, which claims
the benefit under 35 .sctn.119(e) of U.S. Provisional Patent
Application Ser. No. 61/767,811, filed Feb. 22, 2013, all of which
are hereby incorporated by reference in their entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to a genetically modified
non-human animal, e.g., a rodent (e.g., a mouse or a rat), that
expresses a human or humanized Major Histocompatibility Complex
(MHC) class I and a human or humanized MHC class II molecules. The
invention also relates to a genetically modified non-human animal,
e.g., a mouse or a rat, that expresses a human or humanized MHC I
protein (e.g., MHC I .alpha. chain) and a human or humanized MHC II
protein (e.g., MHC II .alpha. and MHC II .beta. chains), and
further expresses a human or humanized .beta.2 microglobulin; as
well as embryos, tissues, and cells expressing the same. The
invention further provides methods for making a genetically
modified non-human animal that expresses both human or humanized
MHC class I and class II proteins, and/or .beta.2 microglobulin.
Also provided are methods for identifying and evaluating peptides
in the context of a humanized cellular immune system in vitro or in
a genetically modified non-human animal, and methods of modifying
an MHC locus of a non-human animal, e.g., a mouse or a rat, to
express a human or humanized MHC I and a human or humanized MHC II
proteins.
BACKGROUND OF THE INVENTION
[0003] In the adaptive immune response, foreign antigens are
recognized by receptor molecules on B lymphocytes (e.g.,
immunoglobulins) and T lymphocytes (e.g., T cell receptor or TCR).
These foreign antigens are presented on the surface of cells as
peptide fragments by specialized proteins, generically referred to
as major histocompatibility complex (MHC) molecules. MHC molecules
are encoded by multiple loci that are found as a linked cluster of
genes that spans about 4 Mb. In mice, the MHC genes are found on
chromosome 17, and for historical reasons are referred to as the
histocompatibility 2 (H-2) genes. In humans, the genes are found on
chromosome 6 and are called human leukocyte antigen (HLA) genes.
The loci in mice and humans are polygenic; they include three
highly polymorphic classes of MHC genes (class I, II and III) that
exhibit similar organization in human and murine genomes (see FIG.
2 and FIG. 3, respectively).
[0004] MHC loci exhibit the highest polymorphism in the genome;
some genes are represented by >300 alleles (e.g., human
HLA-DR.beta. and human HLA-B). All class I and II MHC genes can
present peptide fragments, but each gene expresses a protein with
different binding characteristics, reflecting polymorphisms and
allelic variants. Any given individual has a unique range of
peptide fragments that can be presented on the cell surface to B
and T cells in the course of an immune response.
[0005] Both humans and mice have class I MHC genes (see FIG. 2 and
FIG. 3, respectively). In humans, the classical class I genes are
termed HLA-A, HLA-B and HLA-C, whereas in mice they are H-2K, H-2D
and H-2L. Class I molecules consist of two chains: a polymorphic
.alpha.-chain (sometimes referred to as heavy chain) and a smaller
chain called .beta.2-microglobulin (also known as light chain),
which is generally not polymorphic (FIG. 1, left). These two chains
form a non-covalent heterodimer on the cell surface. The
.alpha.-chain contains three domains (.alpha.1, .alpha.2 and
.alpha.3). Exon 1 of the .alpha.-chain gene encodes the leader
sequence, exons 2 and 3 encode the .alpha.1 and .alpha.2 domains,
exon 4 encodes the .alpha.3 domain, exon 5 encodes the
transmembrane domain, and exons 6 and 7 encode the cytoplasmic
tail. The .alpha.-chain forms a peptide-binding cleft involving the
.alpha.1 and .alpha.2 domains (which resemble Ig-like domains)
followed by the .alpha.3 domain, which is similar to
.beta.2-microglobulin.
[0006] .beta.2 microglobulin is a non-glycosylated 12 kDa protein;
one of its functions is to stabilize the MHC class I .alpha.-chain.
Unlike the .alpha.-chain, the .beta.2 microglobulin does not span
the membrane. The human .beta.2 microglobulin locus is on
chromosome 15, while the mouse locus is on chromosome 2. The
.beta.2 microglobulin gene consists of 4 exons and 3 introns.
Circulating forms of .beta.2 microglobulin are present in serum,
urine, and other body fluids; non-covalently MHC I-associated
.beta.2 microglobulin can be exchanged with circulating .beta.2
microglobulin under physiological conditions.
[0007] Class I MHC molecules are expressed on all nucleated cells,
including tumor cells. They are expressed specifically on T and B
lymphocytes, macrophages, dendritic cells and neutrophils, among
other cells, and function to display peptide fragments (typically
8-10 amino acids in length) on the surface to CD8+ cytotoxic T
lymphocytes (CTLs). CTLs are specialized to kill any cell that
bears an MHC I-bound peptide recognized by its own membrane-bound
TCR. When a cell displays peptides derived from cellular proteins
not normally present (e.g., of viral, tumor, or other non-self
origin), such peptides are recognized by CTLs, which become
activated and kill the cell displaying the peptide.
[0008] Both humans and mice also have class II MHC genes (see FIGS.
2 and 3, respectively). In humans, the classical MHC II genes are
termed HLA-DP, HLA-DQ, and HLA-DR, whereas in mice they are H-2A
and H-2E (often abbreviated as I-A and I-E, respectively).
Additional proteins encoded by genes in the MHC II locus, HLA-DM
and HLA-DO in humans, and H-2M and H-2O in mice, are not found on
the cell surface, but reside in the endocytic compartment and
ensure proper loading of MHC II molecules with peptides. Class II
molecules consist of two polypeptide chains: .alpha. chain and
.beta. chain. The extracellular portion of the .alpha. chain
contains two extracellular domains, .alpha.1 and .alpha.2; and the
extracellular portion of the .beta. chain also contains two
extracellular domains, .beta.1 and .beta.2 (see FIG. 1, right). The
.alpha. and the .beta. chains are non-covalently associated with
each other.
[0009] MHC class II molecules are expressed on antigen-presenting
cells (APCs), e.g., B cells, macrophages, dendritic cells,
endothelial cells during a course of inflammation, etc. MHC II
molecules expressed on the surface of APCs typically present
antigens generated in intracellular vesicles to CD4+T cells. In
order to participate in CD4+T cell engagement, the MHC class II
complex with the antigen of interest must be sufficiently stable to
survive long enough to engage a CD4+T cell. When a CD4+T helper
cell is engaged by a foreign peptide/MHC II complex on the surface
of APC, the T cell is activated to release cytokines that assist in
immune response to the invader.
[0010] Not all antigens will provoke T cell activation due to
tolerance mechanisms. However, in some diseases (e.g., cancer,
autoimmune diseases) peptides derived from self-proteins become the
target of the cellular component of the immune system, which
results in destruction of cells presenting such peptides. There has
been significant advancement in recognizing antigens that are
clinically significant (e.g., antigens associated with various
types of cancer). However, in order to improve identification and
selection of peptides that will provoke a suitable response in a
human T cell, in particular for peptides of clinically significant
antigens, there remains a need for in vivo and in vitro systems
that mimic aspects of human immune system. Thus, there is a need
for biological systems (e.g., genetically modified non-human
animals and cells) that can display components of a human immune
system.
SUMMARY OF THE INVENTION
[0011] A biological system for generating or identifying peptides
that associate with human MHC class I proteins and chimeras thereof
and bind CD8+T cells, as well as peptides that associate with human
MHC class II proteins and chimeras thereof and bind to CD4+T cells,
is provided. Non-human animals comprising non-human cells that
express humanized molecules that function in the cellular immune
response are provided. Humanized rodent loci that encode humanized
MHC I and MHC II proteins are also provided. Humanized rodent cells
that express humanized MHC molecules are also provided. In vivo and
in vitro systems are provided that comprise humanized rodent cells,
wherein the rodent cells express one or more humanized immune
system molecules.
[0012] In various embodiments, provided herein is a non-human
animal comprising at an endogenous MHC locus a first nucleotide
sequence encoding a chimeric human/non-human MHC I polypeptide,
wherein a human portion of the chimeric MHC I polypeptide comprises
an extracellular domain of a human MHC I polypeptide; a second
nucleotide sequence encoding a chimeric human/non-human MHC II
.alpha. polypeptide, wherein a human portion of the chimeric
human/non-human MHC II .alpha. polypeptide comprises an
extracellular domain of a human MHC II .alpha. polypeptide; and a
third nucleotide sequence encoding a chimeric human/non-human MHC
II .beta. polypeptide, wherein a human portion of the chimeric
human/non-human MHC II .beta. polypeptide comprises an
extracellular domain of a human MHC II .beta. polypeptide, wherein
the non-human animal expresses functional chimeric human/non-human
MHC I and MHC II proteins from its endogenous non-human MHC loci.
In one embodiment, the animal does not express functional
endogenous MHC I, II .alpha., and/or II .beta. polypeptides from
the endogenous non-human MHC loci. In some embodiments, the animal
is not capable of expressing functional endogenous MHC I, II
.alpha., and/or II .beta. polypeptides, since for example, genes
encoding endogenous MHC I and MHC II proteins may be functionally
inactivated, e.g., are incapable of being transcribed and
translated into endogenous MHC I and MHC II proteins, respectively.
In various embodiments, all endogenous genes of the non-human
animal encoding MHC molecules that are expressed on the cell
surface (e.g., present antigen to and associate with T cell
receptor) are functionally inactivated such that the animal does
not express endogenous cell-surface MHC I, II .alpha., and/or II
.beta. polypeptides. In some embodiments, genes may be functionally
inactivated with a mutation (e.g., inversion), replacement of the
gene (in whole or in part) and/or deletion of the gene (in whole or
in part). In some embodiments, a non-human MHC class I gene may be
functionally inactivated by the replacement of an endogenous
sequence encoding .alpha.1, .alpha.2, and .alpha.3 domains of an
endogenous MHC class I polypeptide with a sequence encoding
.alpha.1, .alpha.2, and .alpha.3 domains of a human MHC class I
polypeptide; a non-human MHC class II .alpha. gene may be
inactivated by the replacement of an endogenous sequence encoding
.alpha.1 and .alpha.2 domains of an endogenous MHC class II .alpha.
polypeptide with a sequence encoding .alpha.1 and .alpha.2 domains
of a human MHC class II .alpha. polypeptide; or a non-human MHC
class II .beta. gene may be inactivated by the replacement of an
endogenous sequence encoding .beta.1 and .beta.2 domains of an
endogenous MHC class II .beta. polypeptide with a sequence encoding
.beta.1 and .beta.2 domains of a human MHC class II .beta.
polypeptide.
[0013] In one aspect, the first nucleotide sequence is located at
the endogenous non-human MHC I locus, the second nucleotide
sequence is located at the endogenous non-human MHC II .alpha.
locus, and the third nucleotide sequence is located at the
endogenous non-human MHC II .beta. locus. In one aspect, the first,
second and/or third nucleotide sequence(s) are operably linked to
endogenous non-human regulatory elements. In one aspect, the first
nucleotide sequence is operably linked to endogenous non-human MHC
I promoter and regulatory elements, the second nucleotide sequence
is operably linked to endogenous non-human MHC II .alpha. promoter
and regulatory elements, and the third nucleotide sequence is
operably linked to endogenous non-human MHC II .beta. promoter and
regulatory elements.
[0014] In one embodiment, the human portion of a chimeric MHC I
polypeptide comprises .alpha.1, .alpha.2, and .alpha.3 domains of
the human MHC I polypeptide. In one aspect, a non-human portion of
the chimeric MHC I polypeptide comprises transmembrane and
cytoplasmic domains of an endogenous non-human MHC I polypeptide.
The human MHC I polypeptide may be selected from the group
consisting of HLA-A, HLA-B, and HLA-C. In one embodiment, the human
MHC I polypeptide is HLA-A2. In another aspect, the human MHC I
polypeptide is HLA-A3, HLA-B7, HLA-B27, HLA-Cw6, or any other MHC I
molecule expressed in a human population. In an additional
embodiment, a non-human animal of the invention further comprises
at its endogenous non-human .beta.2 microglobulin locus a
nucleotide sequence encoding a human or humanized .beta.2
microglobulin polypeptide, wherein the animal expresses the human
or humanized .beta.2 microglobulin polypeptide.
[0015] In one embodiment, the human MHC II .alpha. extracellular
domain comprises human MHC II .alpha.1 and .alpha.2 domains. In
another embodiment, the human MHC II .beta. extracellular domain
comprises human MHC II .beta.1 and .beta.2 domains. In one aspect,
the non-human portion of a chimeric human/non-human MHC II .alpha.
polypeptide comprises transmembrane and cytoplasmic domains of an
endogenous non-human MHC II .alpha. polypeptide. In one aspect, the
non-human portion of a chimeric human/non-human MHC II .beta.
polypeptide comprises transmembrane and cytoplasmic domains of an
endogenous non-human MHC II .beta. polypeptide. In one embodiment,
the human portions of a chimeric human/mouse MHC II .alpha. and
.beta. polypeptides are derived from a human HLA class II protein
selected from the group consisting of HLA-DR, HLA-DQ, and HLA-DP.
In one specific embodiment, the human portions of chimeric
human/non-human MHC II .alpha. and .beta. polypeptides are derived
from a human HLA-DR2 protein. Alternatively, the human portions of
chimeric human/non-human MHC II .alpha. and .beta. polypeptides may
be derived from human MHC II protein selected from HLA-DR4,
HLA-DQ2.5, HLA-DQ8, or any other MHC II molecule expressed in a
human population.
[0016] In some aspects, a provided animal comprises two copies of
the MHC locus containing the first, the second, and the third
nucleotide sequences, while in other aspects, a provided animal
comprises one copy of the MHC locus containing the first, the
second, and the third nucleotide sequences. Thus, the animal may be
homozygous or heterozygous for the MHC locus containing nucleotide
sequences encoding chimeric human/non-human MHC I, MHC II .alpha.,
and MHC II .beta. polypeptides. In some embodiments of the
invention, the genetically modified MHC locus, comprising
nucleotide sequences encoding chimeric human/non-human MHC I, MHC
II .alpha., and MHC II .beta. polypeptides described herein, is in
the germline of the non-human animal.
[0017] Also provided herein is an MHC locus comprising a first
nucleotide sequence encoding a chimeric human/non-human MHC I
polypeptide, wherein a human portion of the chimeric MHC I
polypeptide comprises an extracellular domain of a human MHC I
polypeptide; a second nucleotide sequence encoding a chimeric
human/non-human MHC II .alpha. polypeptide, wherein a human portion
of the chimeric human/non-human MHC II .alpha. polypeptide
comprises an extracellular domain of a human MHC II .alpha.
polypeptide; and a third nucleotide sequence encoding a chimeric
human/non-human MHC II .beta. polypeptide, wherein a human portion
of the chimeric human/non-human MHC II .beta. polypeptide comprises
an extracellular domain of a human MHC II .beta. polypeptide. In
some aspects, non-human portions of the chimeric MHC I, II .alpha.,
and II .beta. polypeptides comprise transmembrane and cytoplasmic
domains of non-human MHC I, II .alpha., and II .beta.,
respectively.
[0018] In one embodiment, the genetically engineered non-human
animal is a rodent. In one embodiment, the rodent is a rat or a
mouse. In one embodiment, the rodent is a mouse. Thus, in one
aspect, the first nucleotide sequence encodes a chimeric
human/mouse MHC I polypeptide, and the mouse portion of the
chimeric MHC I polypeptide is derived from H-2K, H-2D, or H-2L. In
one specific embodiment, the mouse portion of the chimeric MHC I
polypeptide is derived from H-2K. In one aspect, the second
nucleotide sequence encodes a chimeric human/mouse MHC II .alpha.
polypeptide, the third nucleotide sequence encodes a chimeric
human/mouse MHC II .beta. polypeptide, and the mouse portions of
the chimeric MHC II .alpha. and .beta. polypeptides are derived
from H-2E or H-2A. In yet another embodiment, the mouse does not
express any functional endogenous MHC II .alpha. and MHC II .beta.
polypeptides on a cell surface, and the only MHC II .alpha. and MHC
II .beta. polypeptides expressed on a cell surface are chimeric
human/mouse MHC II .alpha. and MHC II .beta. polypeptides. In a
specific embodiment, the mouse portions of the chimeric MHC II
polypeptides are derived from H-2E. In some embodiments, the mouse
does not express functional endogenous MHC polypeptides from its
H-2D locus. In some embodiments, the mouse is engineered to lack
all or a portion of an endogenous H-2D locus. In some embodiments,
the mouse does not express any endogenous MHC I and II polypeptides
on a cell surface; in some embodiments, all endogenous mouse MHC I
and II polypeptides that are expressed on a cell surface are
functionally inactivated or fully or partially deleted.
[0019] Thus, also provided herein is a genetically engineered mouse
comprising at an endogenous MHC locus a first nucleotide sequence
encoding a chimeric human/mouse MHC I polypeptide, wherein the
human portion of the chimeric MHC I polypeptide comprises an
extracellular domain of a human MHC I polypeptide; a second
nucleotide sequence encoding a chimeric human/mouse MHC II .alpha.
polypeptide, wherein the human portion of the chimeric
human/non-human MHC II .alpha. polypeptide comprises an
extracellular domain of a human MHC II .alpha. polypeptide; and a
third nucleotide sequence encoding a chimeric human/mouse MHC II
.beta. polypeptide, wherein the human portion of the chimeric
human/non-human MHC II .beta. polypeptide comprises an
extracellular domain of a human MHC II .beta. polypeptide; wherein
the mouse expresses functional chimeric human/mouse MHC I and MHC
II proteins from its endogenous mouse MHC locus. In one specific
embodiment, the first nucleotide sequence encodes a chimeric
HLA-A2/H-2K polypeptide, the second nucleotide sequence encodes an
.alpha. chain of a chimeric HLA-DR/H-2E polypeptide (e.g.,
HLA-DR2/H-2E polypeptide), and the third nucleotide sequence
encodes a .beta. chain of a chimeric HLA-DR/H-2E polypeptide (e.g.,
HLA-DR2/H-2E polypeptide), and the mouse expresses functional
HLA-A2/H-2K and HLA-DR/H-2E (e.g., HLA-DR2/H-2E) proteins. In an
additional embodiment, the mouse further comprises at an endogenous
.beta.2 microglobulin locus a nucleotide sequence encoding a human
or humanized .beta.2 microglobulin polypeptide. In one embodiment,
the mouse does not express functional endogenous MHC polypeptides
from its endogenous MHC locus. In some embodiments, the mouse does
not express functional MHC I or II polypeptides on a cell surface;
in some embodiments, the only MHC I and MHC II polypeptides
expressed on a cell surface are chimeric human/mouse MHC I and II
polypeptides. In some embodiments, the mouse does not express
functional endogenous MHC polypeptides from its H-2D locus. In some
embodiments, the mouse is engineered to lack all or a portion of an
endogenous H-2D locus. In yet another embodiment, the endogenous
H-2D is deleted or functionally inactivated.
[0020] Also provided herein are methods for generating a
genetically modified non-human animal (e.g., rodent, e.g., mouse or
rat) described herein. Thus, in one aspect, the invention provides
a method of generating a genetically modified non-human animal
comprising replacing at an endogenous non-human MHC II locus a
nucleotide sequence encoding a non-human MHC II complex with a
nucleotide sequence encoding a chimeric human/non-human MHC II
complex to generate a first non-human animal; and replacing at an
endogenous non-human MHC I locus a nucleotide sequence encoding a
non-human MHC I polypeptide with a nucleotide sequence encoding a
chimeric human/non-human MHC I polypeptide to generate a second
non-human animal. In one aspect, the steps of replacing nucleotide
sequences comprise homologous recombination in non-human ES cells,
and the second non-human animal is generated by homologous
recombination in ES cells bearing nucleotide sequences encoding
chimeric human/non-human MHC II complex. The chimeric MHC II
complex comprises chimeric human/non-human MHC II .alpha. and
.beta. polypeptides. In some embodiments, ES cells are mouse ES
cells engineered to lack all or a portion of an endogenous H-2D
locus. In other embodiments, the ES cells are engineered to have a
functionally inactivated H-2D locus. In yet another embodiments,
the ES cells lack or are engineered to lack or have functional
inactivation of all or a portion of endogenous H-2A, H-2E, H-2K,
H-2D, and H-2L loci.
[0021] In an alternative embodiment, the invention provides a
method of generating a genetically modified non-human animal
comprising replacing at an endogenous non-human MHC I locus a
nucleotide sequence encoding a non-human MHC I polypeptide with a
nucleotide sequence encoding a chimeric human/non-human MHC I
polypeptide to generate a first non-human animal; and replacing at
an endogenous non-human MHC II locus a nucleotide sequence encoding
a non-human MHC II complex with a nucleotide sequence encoding a
chimeric human/non-human MHC II complex to generate a second
non-human animal. In one aspect, the steps of replacing nucleotide
sequences comprise homologous recombination in non-human ES cells,
and the second non-human animal is generated by homologous
recombination in ES cells bearing a nucleotide sequence encoding
chimeric human/non-human MHC I polypeptide.
[0022] Also provided herein are cells, e.g., isolated
antigen-presenting cells, derived from the non-human animals (e.g.,
rodents, e.g., mice or rats) described herein. Tissues and embryos
derived from the non-human animals described herein are also
provided.
[0023] Any of the embodiments and aspects described herein can be
used in conjunction with one another, unless otherwise indicated or
apparent from the context. Other embodiments will become apparent
to those skilled in the art from a review of the ensuing detailed
description. The following detailed description includes exemplary
representations of various embodiments of the invention, which are
not restrictive of the invention as claimed. The accompanying
figures constitute a part of this specification and, together with
the description, serve only to illustrate embodiments and not to
limit the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] FIG. 1 is a schematic drawing of the MHC I (left panel) and
MHC II (right panel) class molecules expressed on the surface of a
cell. The gray circles represent peptides bound in the
peptide-binding clefts.
[0025] FIG. 2 is a schematic representation (not to scale) of the
relative genomic structure of the human HLA, showing class I, II
and III genes.
[0026] FIG. 3 is a schematic representation (not to scale) of the
relative genomic structure of the mouse MHC, showing class I, II
and III genes.
[0027] FIG. 4 depicts the strategy for generating a humanized MHC
locus comprising humanized MHC I and MHC II genes. In the
particular embodiment depicted, the MHC locus of the generated
mouse comprises chimeric HLA-A2/H-2K and HLA-DR2/H-2E sequences
(H2-K.sup.+/1666 MHC-II.sup.+/61 12) and lacks H2-D sequence
(H2-D.sup.+/delete) and H-2A sequence (the genetic engineering
scheme also results in a deletion of H-2A, see Example 1.2). Large
Targeting Vectors introduced into ES cells at each stage of
humanization are depicted to the right of the arrows.
[0028] FIG. 5 is a schematic diagram (not to scale) of the
targeting strategy used for making a chimeric H-2K locus that
expresses an extracellular region of a human HLA-A2 protein. Mouse
sequences are represented in black and human sequences are
represented in white. L=leader, UTR=untranslated region,
TM=transmembrane domain, CYT=cytoplasmic domain,
HYG=hygromycin.
[0029] FIG. 6 is a schematic diagram of an exemplary HLA-DR2/H-2E
large targeting vector.
[0030] FIG. 7 is a schematic representation of exemplary genotypes
of MHC loci (**) represents H-2L gene that is not present in all
mouse strains), where endogenous mouse H-2K and H-2E loci were
replaced by chimeric human/mouse loci, and H-2A and H-2D loci were
deleted.
[0031] FIG. 8 depicts contour plots of percentage of mouse CD3+T
cells and CD19+B cells in spleens from 3 wild-type (WT) control
mice and 3 chimeric A2 and DR2 mice. Cells were gated on live cells
discriminated based on FSC/SSC gating. HLA-A2/H-2K, HLA-DR2/H-2E,
H-2A-del, H-2D-del HET*=mice created in the genetic engineering
scheme depicted in FIG. 4, also referred to in this and remaining
figures as "chimeric A2 and DR2 mice."
[0032] FIG. 9 depicts histograms of mouse MHC class I (H2D), human
MHC class I (HLA-A2), and human MHC class II (HLA-DR) expression
levels on CD19+B cells from spleens of 3 wild-type (WT) control
mice and 3 chimeric A2 and DR2 mice.
[0033] FIG. 10 depicts histograms of mouse MHC class I (H2D), human
MHC class I (HLA-A2), and human MHC class II (HLA-DR) expression
levels on CD14+ monocytes from spleens of 3 wild-type (WT) control
mice and 3 chimeric A2 and DR2 mice.
[0034] FIG. 11 depicts histograms of mouse MHC class I (H2D), human
MHC class I (HLA-A2), and human MHC class II (HLA-DR) expression
levels on CD3+T cells from spleens of 3 wild-type (WT) control mice
and 3 chimeric A2 and DR2 mice.
DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION
Definitions
[0035] The present invention provides genetically modified
non-human animals (e.g., mice, rats, rabbits, etc.) that express
both human or humanized MHC I and MHC II proteins; embryos, cells,
and tissues comprising the same; methods of making the same; as
well as methods of using the same. Unless defined otherwise, all
terms and phrases used herein include the meanings that the terms
and phrases have attained in the art, unless the contrary is
clearly indicated or clearly apparent from the context in which the
term or phrase is used.
[0036] The term "conservative," when used to describe a
conservative amino acid substitution, includes substitution of an
amino acid residue by another amino acid residue having a side
chain R group with similar chemical properties (e.g., charge or
hydrophobicity). Conservative amino acid substitutions may be
achieved by modifying a nucleotide sequence so as to introduce a
nucleotide change that will encode the conservative substitution.
In general, a conservative amino acid substitution will not
substantially change the functional properties of interest of a
protein, for example, the ability of MHC I or MHC II to present a
peptide of interest. Examples of groups of amino acids that have
side chains with similar chemical properties include aliphatic side
chains such as glycine, alanine, valine, leucine, and isoleucine;
aliphatic-hydroxyl side chains such as serine and threonine;
amide-containing side chains such as asparagine and glutamine;
aromatic side chains such as phenylalanine, tyrosine, and
tryptophan; basic side chains such as lysine, arginine, and
histidine; acidic side chains such as aspartic acid and glutamic
acid; and, sulfur-containing side chains such as cysteine and
methionine. Conservative amino acids substitution groups include,
for example, valine/leucine/isoleucine, phenylalanine/tyrosine,
lysine/arginine, alanine/valine, glutamate/aspartate, and
asparagine/glutamine. In some embodiments, a conservative amino
acid substitution can be a substitution of any native residue in a
protein with alanine, as used in, for example, alanine scanning
mutagenesis. In some embodiments, a conservative substitution is
made that has a positive value in the PAM250 log-likelihood matrix
disclosed in Gonnet et al. ((1992) Exhaustive Matching of the
Entire Protein Sequence Database, Science 256:1443-45), hereby
incorporated by reference. In some embodiments, the substitution is
a moderately conservative substitution wherein the substitution has
a nonnegative value in the PAM250 log-likelihood matrix.
[0037] Thus, also encompassed by the invention is a genetically
modified non-human animal whose genome comprises a nucleotide
sequence encoding a human or humanized MHC I and II polypeptides,
wherein MHC I or MHC II the polypeptide comprises conservative
amino acid substitutions in the amino acid sequence described
herein.
[0038] One skilled in the art would understand that in addition to
the nucleic acid residues encoding a human or humanized MHC I or
MHC II polypeptide described herein, due to the degeneracy of the
genetic code, other nucleic acids may encode the polypeptide of the
invention. Therefore, in addition to a genetically modified
non-human animal that comprises in its genome a nucleotide sequence
encoding MHC I and MHC II polypeptides with conservative amino acid
substitutions, a non-human animal whose genome comprises a
nucleotide sequence that differs from that described herein due to
the degeneracy of the genetic code is also provided.
[0039] The term "identity" when used in connection with sequence
includes identity as determined by a number of different algorithms
known in the art that can be used to measure nucleotide and/or
amino acid sequence identity. In some embodiments described herein,
identities are determined using a ClustalW v. 1.83 (slow) alignment
employing an open gap penalty of 10.0, an extend gap penalty of
0.1, and using a Gonnet similarity matrix (MacVector.TM. 10.0.2,
MacVector Inc., 2008). The length of the sequences compared with
respect to identity of sequences will depend upon the particular
sequences. In various embodiments, identity is determined by
comparing the sequence of a mature protein from its N-terminal to
its C-terminal. In various embodiments when comparing a chimeric
human/non-human sequence to a human sequence, the human portion of
the chimeric human/non-human sequence (but not the non-human
portion) is used in making a comparison for the purpose of
ascertaining a level of identity between a human sequence and a
human portion of a chimeric human/non-human sequence (e.g.,
comparing a human ectodomain of a chimeric human/mouse protein to a
human ectodomain of a human protein).
[0040] The terms "homology" or "homologous" in reference to
sequences, e.g., nucleotide or amino acid sequences, means two
sequences which, upon optimal alignment and comparison, are
identical in at least about 75% of nucleotides or amino acids,
e.g., at least about 80% of nucleotides or amino acids, e.g., at
least about 90-95% nucleotides or amino acids, e.g., greater than
97% nucleotides or amino acids. One skilled in the art would
understand that, for optimal gene targeting, the targeting
construct should contain arms homologous to endogenous DNA
sequences (i.e., "homology arms"); thus, homologous recombination
can occur between the targeting construct and the targeted
endogenous sequence.
[0041] The term "operably linked" refers to a juxtaposition wherein
the components so described are in a relationship permitting them
to function in their intended manner. As such, a nucleic acid
sequence encoding a protein may be operably linked to regulatory
sequences (e.g., promoter, enhancer, silencer sequence, etc.) so as
to retain proper transcriptional regulation. In addition, various
portions of the chimeric or humanized protein of the invention may
be operably linked to retain proper folding, processing, targeting,
expression, and other functional properties of the protein in the
cell. Unless stated otherwise, various domains of the chimeric or
humanized protein of the invention are operably linked to each
other.
[0042] The term "MHC I complex" or the like, as used herein,
includes the complex between the MHC I .alpha. chain polypeptide
and the .beta.2-microglobulin polypeptide. The term "MHC I
polypeptide" or the like, as used herein, includes the MHC I
.alpha. chain polypeptide alone. The terms "MHC II complex," "MHC
II protein," or the like, as used herein, include the complex
between an MHC II .alpha. polypeptide and an MHC II .beta.
polypeptide. The term "MHC II .alpha. polypeptide" or "MHC II
.beta. polypeptide" (or the like), as used herein, includes the MHC
II .alpha. polypeptide alone or MHC II .beta. polypeptide alone,
respectively. Similarly, the terms "HLA-DR4 complex", "HLA-DR4
protein," "H-2E complex," "H-2E" protein," or the like, refer to
complex between .alpha. and .beta. polypeptides. Typically, the
terms "human MHC" and "HLA" are used interchangeably.
[0043] The term "replacement" in reference to gene replacement
refers to placing exogenous genetic material at an endogenous
genetic locus, thereby replacing all or a portion of the endogenous
gene with an orthologous or homologous nucleic acid sequence. As
demonstrated in the Examples below, nucleic acid sequence of
endogenous MHC locus was replaced by a nucleotide sequence
comprising sequences encoding a portion of human MHC I polypeptide,
specifically, encoding the extracellular portion of the MHC I
polypeptide; as well as portions of human MHC II .alpha. and .beta.
polypeptides, specifically, encoding the extracellular portions of
the MHC II .alpha. and .beta. polypeptides.
[0044] "Functional" as used herein, e.g., in reference to a
functional polypeptide, refers to a polypeptide that retains at
least one biological activity normally associated with the native
protein. For example, in some embodiments of the invention, a
replacement at an endogenous locus (e.g., replacement at an
endogenous non-human MHC locus) results in a locus that fails to
express a functional endogenous polypeptide, e.g., MHC I or MHC II
polypeptide. Likewise, the term "functional" as used herein in
reference to functional extracellular domain of a protein, refers
to an extracellular domain that retains its functionality, e.g., in
the case of MHC I or MHC II, ability to bind an antigen, ability to
bind a T cell co-receptor, etc. In reference to genes, an
endogenous gene may be functionally inactivated by various
techniques such that the whole gene or a portion of the gene that
encodes an endogenous protein is still present at its locus but the
gene is incapable of encoding an endogenous protein that is
biologically active. In some embodiments of the invention, a
replacement at the endogenous MHC locus results in a locus that
fails to express an extracellular domain (e.g., a functional
extracellular domain) of an endogenous MHC while expressing an
extracellular domain (e.g., a functional extracellular domain) of a
human MHC.
Genetically Modified MHC Animals
[0045] In various embodiments, the invention generally provides
genetically modified non-human animals that comprise in their
genome a nucleotide sequence encoding a human or humanized MHC I
and MHC II polypeptides; thus, the animals express a human or
humanized MHC I and MHC II polypeptides.
[0046] MHC genes are categorized into three classes: class I, class
II, and class III, all of which are encoded either on human
chromosome 6 or mouse chromosome 17. A schematic of the relative
organization of the human and mouse MHC classes is presented in
FIGS. 2 and 3, respectively. The MHC genes are among the most
polymorphic genes of the mouse and human genomes. MHC polymorphisms
are presumed to be important in providing evolutionary advantage;
changes in sequence can result in differences in peptide binding
that allow for better presentation of pathogens to cytotoxic T
cells.
[0047] MHC class I protein comprises an extracellular domain (which
comprises three domains: .alpha..sub.1, .alpha..sub.2, and
.alpha..sub.3), a transmembrane domain, and a cytoplasmic tail. The
.alpha..sub.1 and .alpha..sub.2 domains form the peptide-binding
cleft, while the .alpha..sub.3 interacts with
.beta.2-microglobulin.
[0048] In addition to its interaction with .beta.2-microglobulin,
the .alpha..sub.3 domain interacts with the TCR co-receptor CD8,
facilitating antigen-specific activation. Although binding of MHC
class I to CD8 is about 100-fold weaker than binding of TCR to MHC
class I, CD8 binding enhances the affinity of TCR binding.
Wooldridge et al. (2010) MHC Class I Molecules with Superenhanced
CD8 Binding Properties Bypass the Requirement for Cognate TCR
Recognition and Nonspecifically Activate CTLs, J. Immunol.
184:3357-3366. Interestingly, increasing MHC class I binding to CD8
abrogated antigen specificity in CTL activation. Id.
[0049] CD8 binding to MHC class I molecules is species-specific;
the mouse homolog of CD8, Lyt-2, was shown to bind H-2D.sup.d
molecules at the .alpha.3 domain, but it did not bind HLA-A
molecules. Connolly et al. (1988) The Lyt-2 Molecule Recognizes
Residues in the Class I .alpha.3 Domain in Allogeneic Cytotoxic T
Cell Responses, J. Exp. Med. 168:325-341. Differential binding was
presumably due to CDR-like determinants (CDR1- and CDR2-like) on
CD8 that was not conserved between humans and mice. Sanders et al.
(1991) Mutations in CD8 that Affect Interactions with HLA Class I
and Monoclonal Anti-CD8 Antibodies, J. Exp. Med. 174:371-379;
Vitiello et al. (1991) Analysis of the HLA-restricted
Influenza-specific Cytotoxic T Lymphocyte Response in Transgenic
Mice Carrying a Chimeric Human-Mouse Class I Major
Histocompatibility Complex, J. Exp. Med. 173:1007-1015; and, Gao et
al. (1997) Crystal structure of the complex between human
CD8.alpha..alpha. and HLA-A2, Nature 387:630-634. It has been
reported that CD8 binds HLA-A2 in a conserved region of the
.alpha.3 domain (at position 223-229). A single substitution
(V245A) in HLA-A reduced binding of CD8 to HLA-A, with a
concomitant large reduction in T cell-mediated lysis. Salter et al.
(1989), Polymorphism in the .alpha.3 domain of HLA-A molecules
affects binding to CD8, Nature 338:345-348. In general,
polymorphism in the .alpha.3 domain of HLA-A molecules also
affected binding to CD8. Id. In mice, amino acid substitution at
residue 227 in H-2D.sup.d affected the binding of mouse Lyt-2 to
H-2D.sup.d, and cells transfected with a mutant H-2D.sup.d were not
lysed by CD8+T cells. Potter et al. (1989) Substitution at residue
227 of H-2 class I molecules abrogates recognition by
CD8-dependent, but not CD8-independent, cytotoxic T lymphocytes,
Nature 337:73-75.
[0050] Therefore, due to species specificity of interaction between
the MHC class I .alpha.3 domain and CD8, an MHC I complex
comprising a replacement of an H-2K .alpha.3 domain with a human
HLA-A2 .alpha.3 domain was nonfunctional in a mouse (i.e., in vivo)
in the absence of a human CD8. In animals transgenic for HLA-A2,
substitution of human .alpha.3 domain for the mouse .alpha.3 domain
resulted in restoration of T cell response. Irwin et al. (1989)
Species-restricted interactions between CD8 and the .alpha.3 domain
of class I influence the magnitude of the xenogeneic response, J.
Exp. Med. 170:1091-1101; Vitiello et al. (1991), supra.
[0051] The transmembrane domain and cytoplasmic tail of mouse MHC
class I proteins also have important functions. One function of MHC
I transmembrane domain is to facilitate modulation by HLA-A2 of
homotypic cell adhesion (to enhance or inhibit adhesion),
presumably as the result of cross-linking (or ligation) of surface
MHC molecules. Wagner et al. (1994) Ligation of MHC Class I and
Class II Molecules Can Lead to Heterologous Desensitization of
Signal Transduction Pathways That Regulate Homotypic Adhesion in
Human Lymphocytes, J. Immunol. 152:5275-5287. Cell adhesion can be
affected by mAbs that bind at diverse epitopes of the HLA-A2
molecule, suggesting that there are multiple sites on HLA-A2
implicated in modulating homotypic cell adhesion; depending on the
epitope bound, the affect can be to enhance or to inhibit
HLA-A2-dependent adhesion. Id.
[0052] The cytoplasmic tail, encoded by exons 6 and 7 of the MHC I
gene, is reportedly necessary for proper expression on the cell
surface and for LIR1-mediated inhibition of NK cell cytotoxicity.
Gruda et al. (2007) Intracellular Cysteine Residues in the Tail of
MHC Class I Proteins Are Crucial for Extracellular Recognition by
Leukocyte Ig-Like Receptor 1, J. Immunol. 179:3655-3661. A
cytoplasmic tail is required for multimerizaton of at least some
MHC I molecules through formation of disulfide bonds on its
cysteine residues, and thus may play a role in clustering and in
recognition by NK cells. Lynch et al. (2009) Novel MHC Class I
Structures on Exosomes, J. Immunol. 183:1884-1891.
[0053] The cytoplasmic domain of HLA-A2 contains a constitutively
phosphorylated serine residue and a phosphorylatable tyrosine,
although--in Jurkat cells--mutant HLA-A2 molecules lacking a
cytoplasmic domain appear normal with respect to expression,
cytoskeletal association, aggregation, and endocytic
internalization. Gur et al. (1997) Structural Analysis of Class I
MHC Molecules: The Cytoplasmic Domain Is Not Required for
Cytoskeletal Association, Aggregation, and Internalization, Mol.
Immunol. 34(2):125-132. Truncated HLA-A2 molecules lacking the
cytoplasmic domain are apparently normally expressed and associate
with .beta.2 microglobulin. Id.
[0054] However, several studies have demonstrated that the
cytoplasmic tail is critical in intracellular trafficking,
dendritic cell (DC)-mediated antigen presentation, and CTL priming.
A tyrosine residue encoded by exon 6 was shown to be required for
MHC I trafficking through endosomal compartments, presentation of
exogenous antigens, and CTL priming; while deletion of exon 7
caused enhancement of anti-viral CTL responses. Lizee et al. (2003)
Control of Dendritic Cross-Presentation by the Major
Histocompatibility Complex Class I Cytoplasmic Domain, Nature
Immunol. 4:1065-73; Basha et al. (2008) MHC Class I Endosomal and
Lysosomal Trafficking Coincides with Exogenous Antigen Loading in
Dendritic Cells, PLoS ONE 3: e3247; and Rodriguez-Cruz et al.
(2011) Natural Splice Variant of MHC Class I Cytoplasmic Tail
Enhances Dendritic Cell-Induced CD8+T-Cell Responses and Boosts
Anti-Tumor Immunity, PLoS ONE 6:e22939.
[0055] MHC class II complex comprises two non-covalently associated
domains: an .alpha. chain and a .beta. chain, also referred herein
as an .alpha. polypeptide and a .beta. polypeptide (FIG. 1, right).
The protein spans the plasma membrane; thus it contains an
extracellular domain, a transmembrane domain, and a cytoplasmic
domain. The extracellular portion of the .alpha. chain includes
.alpha.1 and .alpha.2 domains, and the extracellular portion of the
.beta. chain includes .beta.1 and .beta.2 domains. The .alpha.1 and
.beta.1 domains form a peptide-binding cleft on the cell surface.
Due to the three-dimensional conformation of the peptide-binding
cleft of the MHC II complex, there is theoretically no upper limit
on the length of the bound antigen, but typically peptides
presented by MHC II are between 13 and 17 amino acids in
length.
[0056] In addition to its interaction with the antigenic peptides,
the peptide-binding cleft of the MHC II molecule interacts with
invariant chain (Ii) during the processes of MHC II complex
formation and peptide acquisition. The .alpha./.beta. MHC II dimers
assemble in the endoplasmic reticulum and associate with Ii chain,
which is responsible for control of peptide binding and targeting
of the MHC II into endocytic pathway. In the endosome, Ii undergoes
proteolysis, and a small fragment of Ii, Class II-associated
invariant chain peptide (CLIP), remains at the peptide-binding
cleft. In the endosome, under control of HLA-DM (in humans), CLIP
is exchanged for antigenic peptides.
[0057] MHC II interacts with T cell co-receptor CD4 at the
hydrophobic crevice at the junction between .alpha.2 and .beta.2
domains. Wang and Reinherz (2002) Structural Basis of T Cell
Recognition of Peptides Bound to MHC Molecules, Molecular
Immunology, 38:1039-49. When CD4 and T cell receptor bind the same
MHC II molecule complexed with a peptide, the sensitivity of a T
cell to antigen is increased, and it requires 100-fold less antigen
for activation. See, Janeway's Immunobiology, 7.sup.th Ed., Murphy
et al. eds., Garland Science, 2008, incorporated herein by
reference.
[0058] Numerous functions have been proposed for transmembrane and
cytoplasmic domains of MHC II. In the case of cytoplasmic domain,
it has been shown to be important for intracellular signaling,
trafficking to the plasma membrane, and ultimately, antigen
presentation. For example, it was shown that T cell hybridomas
respond poorly to antigen-presenting cells (APCs) transfected with
MHC II .beta. chains truncated at the cytoplasmic domain, and
induction of B cell differentiation is hampered. See, e.g., Smiley
et al. (1996) Truncation of the class II .beta.-chain cytoplasmic
domain influences the level of class II/invariant chain-derived
peptide complexes, Proc. Natl. Acad. Sci. USA, 93:241-44.
Truncation of Class II molecules seems to impair cAMP production.
It has been postulated that deletion of the cytoplasmic tail of MHC
II affects intracellular trafficking, thus preventing the complex
from coming across relevant antigens in the endocytic pathway.
Smiley et al. (supra) demonstrated that truncation of class II
molecules at the cytoplasmic domain reduces the number of
CLIP/class II complexes, postulating that this affects the ability
of CLIP to effectively regulate antigen presentation.
[0059] It has been hypothesized that, since MHC II clustering is
important for T cell receptor (TCR) triggering, if MHC II molecules
truncated at the cytoplasmic domain were prevented from binding
cytoskeleton and thus aggregating, antigen presentation to T cells
would be affected. Ostrand-Rosenberg et al. (1991) Abrogation of
Tumorigenicity by MHC Class II Antigen Expression Requires the
Cytoplasmic Domain of the Class II Molecule, J. Immunol.
147:2419-22. In fact, it was recently shown that HLA-DR truncated
at the cytoplasmic domain failed to associate with the cytoskeleton
following oligomerization. El Fakhy et al. (2004) Delineation of
the HLA-DR Region and the Residues Involved in the Association with
the Cytoskeleton, J. Biol. Chem. 279:18472-80. Importantly, actin
cytoskeleton is a site of localized signal transduction activity,
which can effect antigen presentation. In addition to association
with cytoskeleton, recent studies have also shown that up to 20% of
all HLA-DR molecules constitutively reside in the lipid rafts of
APCs, which are microdomains rich in cholesterol and
glycosphingolipids, and that such localization is important for
antigen presentation, immune synapse formation, and MHC II-mediated
signaling. See, e.g., Dolan et al. (2004) Invariant Chain and the
MHC II Cytoplasmic Domains Regulate Localization of MHC Class II
Molecules to Lipid Rafts in Tumor Cell-Based Vaccines, J. Immunol.
172:907-14. Dolan et al. suggested that truncation of cytoplasmic
domain of MHC II reduces constitutive localization of MHC II to
lipid rafts.
[0060] In addition, the cytoplasmic domain of MHC II, in particular
the .beta. chain, contains a leucine residue that is subject to
ubiquitination by ubiquitin ligase, membrane-associated RING-CH I
(MARCH I), which controls endocytic trafficking, internalization,
and degradation of MHC II; and it has been shown that
MARCH-mediated ubiquitination ceases upon dendritic cell maturation
resulting in increased levels of MHC II at the plasma membrane.
Shin et al. (2006) Surface expression of MHC class II in dendritic
cells is controlled by regulated ubiquitination, Nature 444:115-18;
De Gassart et al. (2008) MHC class II stabilization at the surface
of human dendritic cells is the result of maturation-dependent
MARCH I down-regulation, Proc. Natl. Acad. Sci. USA
105:3491-96.
[0061] Transmembrane domains of .alpha. and .beta. chains of MHC II
interact with each other and this interaction is important for
proper assembly of class II MHC complex. Cosson and Bonifacino
(1992) Role of Transmembrane Domain Interactions in the Assembly of
Class II MHC Molecules, Nature 258:659-62. In fact, MHC II
molecules in which the transmembrane domains of the .alpha. and
.beta. chains were replaced by the .alpha. chain of IL-2 receptor
were retained in the ER and were barely detectable at the cell
surface. Id. Through mutagenesis studies, conserved Gly residues at
the .alpha. and .beta. transmembrane domains were found to be
responsible for MHC II assembly at the cell surface. Id. Thus, both
transmembrane and cytoplasmic domains are crucial for the proper
function of the MHC II complex.
[0062] In various embodiments, provided herein is a genetically
modified non-human animal, e.g., rodent (e.g., mouse or rat)
comprising in its genome a nucleotide sequence encoding a human or
humanized MHC I polypeptide and a nucleotide sequence encoding
human or humanized MHC II protein. The MHC I nucleotide sequence
may encode an MHC I polypeptide that is partially human and
partially non-human, e.g., chimeric human/non-human MHC I
polypeptide, and the MHC II nucleotide sequence may encode an MHC
II protein that is partially human and partially non-human, e.g.,
chimeric human/non-human MHC II protein (e.g., comprising chimeric
human/non-human MHC II .alpha. and .beta. polypeptides). In some
aspects, the animal does not express endogenous MHC I and II
polypeptides, e.g., functional endogenous MHC I and II
polypeptides. In some embodiments, the only MHC I and MHC II
molecules expressed on a cell surface of the animal are chimeric
MHC I and II molecules.
[0063] A genetically modified non-human animal comprising in its
genome, e.g., at the endogenous locus, a nucleotide sequence
encoding a chimeric human/non-human MHC I polypeptide is disclosed
in U.S. Patent Application Publication Nos. 20130111617 and
20130185819, which applications are incorporated herein by
reference in their entireties. A genetically modified non-human
animal comprising in its genome, e.g., at the endogenous locus, a
nucleotide sequence encoding humanized, e.g., chimeric
human/non-human MHC II polypeptides is disclosed in U.S. Pat. Nos.
8,847,005 and 9,043,996, which applications are incorporated herein
by reference in their entireties. A genetically modified non-human
animal comprising in its genome, e.g., at the endogenous locus, a
nucleotide sequence encoding a chimeric human/non-human MHC I
polypeptide and comprising in its genome, e.g., at the endogenous
locus, a nucleotide sequence encoding humanized, e.g., chimeric
human/non-human MHC II polypeptides, is disclosed in U.S. Patent
Application Publication No. 20140245467, which application is
incorporated herein by reference in its entirety.
[0064] In various embodiments provided herein is a genetically
modified non-human animal comprising in its genome, e.g., at
endogenous MHC locus, a first nucleotide sequence encoding a
chimeric human/non-human MHC I polypeptide, wherein a human portion
of the chimeric MHC I polypeptide comprises an extracellular domain
of a human MHC I polypeptide; a second nucleotide sequence encoding
a chimeric human/non-human MHC II .alpha. polypeptide, wherein a
human portion of the chimeric MHC II .alpha. polypeptide comprises
an extracellular domain of a human MHC II .alpha. polypeptide; and
a third nucleotide sequence encoding a chimeric human/non-human MHC
II .beta. polypeptide, wherein a human portion of the chimeric MHC
II .beta. polypeptide comprises an extracellular domain of a human
MHC II .beta. polypeptide; wherein the non-human animal expresses
functional chimeric human/non-human MHC I and MHC II proteins from
its endogenous non-human MHC locus. In one embodiment, the first,
second, and/or third nucleotide sequences are located the
endogenous non-human MHC locus. In one embodiment, wherein the
non-human animal is a mouse, the first, second, and/or third
nucleotide sequences are located at the endogenous mouse MHC locus
on mouse chromosome 17. In one embodiment, the first nucleotide
sequence is located at the endogenous non-human MHC I locus. In one
embodiment, the second nucleotide sequence is located at the
endogenous non-human MHC II .alpha. locus. In one embodiment, the
third nucleotide sequence is located at the endogenous non-human
MHC II .beta. locus.
[0065] In one embodiment, the non-human animal only expresses the
chimeric human/non-human MHC I, MHC II .alpha. and/or MHC .beta. II
polypeptides and does not express endogenous non-human MHC
polypeptides (e.g., functional endogenous MHC I, II .alpha. and/or
II .beta. polypeptides) from the endogenous non-human MHC locus. In
one embodiment, the animal described herein expresses a functional
chimeric MHC I and a functional chimeric MHC II on the surface of
its cells, e.g., antigen presenting cells, etc. In one embodiment,
the only MHC I and MHC II expressed by the animal on a cell surface
are chimeric MHC I and chimeric MHC II, and the animal does not
express any endogenous MHC I and MHC II on a cell surface.
[0066] In one embodiment, the chimeric human/non-human MHC I
polypeptide comprises in its human portion a peptide binding domain
of a human MHC I polypeptide. In one aspect, the human portion of
the chimeric polypeptide comprises an extracellular domain of a
human MHC I. In this embodiment, the human portion of the chimeric
polypeptide comprises an extracellular domain of an .alpha. chain
of a human MHC I. In one embodiment, the human portion of the
chimeric polypeptide comprises .alpha.1 and .alpha.2 domains of a
human MHC I. In another embodiment, the human portion of the
chimeric polypeptide comprises .alpha.1, .alpha.2, and .alpha.3
domains of a human MHC I.
[0067] In one aspect, a human portion of the chimeric MHC II
.alpha. polypeptide and/or a human portion of the chimeric MHC II
.beta. polypeptide comprises a peptide-binding domain of a human
MHC II .alpha. polypeptide and/or human MHC II .beta. polypeptide,
respectively. In one aspect, a human portion of the chimeric MHC II
.alpha. and/or .beta. polypeptide comprises an extracellular domain
of a human MHC II .alpha. and/or .beta. polypeptide, respectively.
In one embodiment, a human portion of the chimeric MHC II .alpha.
polypeptide comprises .alpha.1 domain of a human MHC II .alpha.
polypeptide; in another embodiment, a human portion of the chimeric
MHC II .alpha. polypeptide comprises .alpha.1 and .alpha.2 domains
of a human MHC II .alpha. polypeptide. In an additional embodiment,
a human portion of the chimeric MHC II .beta. polypeptide comprises
.beta.1 domain of a human MHC II .beta. polypeptide; in another
embodiment, a human portion of the chimeric MHC II .beta.
polypeptide comprises .beta.1 and .beta.2 domains of a human MHC II
.beta. polypeptide.
[0068] In some embodiments, the human or humanized MHC I
polypeptide may be derived from a functional human HLA molecule
encoded by any of HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, or HLA-G loci.
The human or humanized MHC II polypeptide may be derived from a
functional human HLA molecule encoded by an of HLA-DP, -DQ, and -DR
loci. A list of commonly used HLA antigens and alleles is described
in Shankarkumar et al. ((2004) The Human Leukocyte Antigen (HLA)
System, Int. J. Hum. Genet. 4(2):91-103), incorporated herein by
reference. Shankarkumar et al. also present a brief explanation of
HLA nomenclature used in the art. Additional information regarding
HLA nomenclature and various HLA alleles can be found in Holdsworth
et al. (2009) The HLA dictionary 2008: a summary of HLA-A, -B, -C,
-DRB1/3/4/5, and DQB1 alleles and their association with
serologically defined HLA-A, -B, -C, -DR, and -DQ antigens, Tissue
Antigens 73:95-170, and a recent update by Marsh et al. (2010)
Nomenclature for factors of the HLA system, 2010, Tissue Antigens
75:291-455, both incorporated herein by reference. In some
embodiments, the MHC I or MHC II polypeptides may be derived from
any functional human HLA-A, B, C, DR, or DQ molecules. Thus, the
human or humanized MHC I and/or II polypeptides may be derived from
any functional human HLA molecules described therein. In some
embodiments, all MHC I and MHC II polypeptides expressed on a cell
surface comprise a portion derived from human HLA molecules.
[0069] Of particular interest are human HLA molecules, specific
polymorphic HLA alleles, known to be associated with a number of
human diseases, e.g., human autoimmune diseases. In fact, specific
polymorphisms in HLA loci have been identified that correlate with
development of rheumatoid arthritis, type I diabetes, Hashimoto's
thyroiditis, multiple sclerosis, myasthenia gravis, Graves'
disease, systemic lupus erythematosus, celiac disease, Crohn's
disease, ulcerative colitis, and other autoimmune disorders. See,
e.g., Wong and Wen (2004) What can the HLA transgenic mouse tell us
about autoimmune diabetes?, Diabetologia 47:1476-87; Taneja and
David (1998) HLA Transgenic Mice as Humanized Mouse Models of
Disease and Immunity, J. Clin. Invest. 101:921-26; Bakker et al.
(2006), A high-resolution HLA and SNP haplotype map for disease
association studies in the extended human MHC, Nature Genetics
38:1166-72 and Supplementary Information; and International MHC and
Autoimmunity Genetics Network (2009) Mapping of multiple
susceptibility variants within the MHC region for 7 immune-mediated
diseases, Proc. Natl. Acad. Sci. USA 106:18680-85. Thus, the human
or humanized MHC I and/or II polypeptides may be derived from a
human HLA molecule known to be associated with a particular
disease, e.g., autoimmune disease.
[0070] In one specific aspect, the human or humanized MHC I
polypeptide is derived from human HLA-A. In a specific embodiment,
the HLA-A polypeptide is an HLA-A2 polypeptide (e.g., and HLA-A2.1
polypeptide). In one embodiment, the HLA-A polypeptide is a
polypeptide encoded by an HLA-A*0201 allele, e.g.,
HLA-A*02:01:01:01 allele. The HLA-A*0201 allele is commonly used
amongst the North American population. Although the present
Examples describe this particular HLA sequence, any suitable HLA-A
sequence is encompassed herein, e.g., polymorphic variants of
HLA-A2 exhibited in human population, sequences with one or more
conservative or non-conservative amino acid modifications, nucleic
acid sequences differing from the sequence described herein due to
the degeneracy of genetic code, etc.
[0071] In another specific aspect, the human portion of the
chimeric MHC I polypeptide is derived from human MHC I selected
from HLA-B and HLA-C. In one aspect, it is derived from HLA-B,
e.g., HLA-B27. In another aspect, it is derived from HLA-A3, -B7,
-Cw6, etc.
[0072] In one specific aspect, the human portions of the humanized
MHC II .alpha. and .beta. polypeptides described herein are derived
from human HLA-DR, e.g., HLA-DR2. Typically, HLA-DR .alpha. chains
are monomorphic, e.g., the .alpha. chain of HLA-DR complex is
encoded by HLA-DRA gene (e.g., HLA-DR.alpha.*01 gene). On the other
hand, the HLA-DR .beta. chain is polymorphic. Thus, HLA-DR2
comprises an a chain encoded by HLA-DRA gene and a .beta. chain
encoded by HLA-DR1.beta.*1501 gene. Although the present Examples
describe these particular HLA sequences, any suitable HLA-DR
sequences are encompassed herein, e.g., polymorphic variants
exhibited in human population, sequences with one or more
conservative or non-conservative amino acid modifications, nucleic
acid sequences differing from the sequences described herein due to
the degeneracy of genetic code, etc.
[0073] The human portions of the chimeric MHC II .alpha. and/or
.beta. polypeptide may be encoded by nucleotide sequences of HLA
alleles known to be associated with common human diseases. Such HLA
alleles include, but are not limited to, HLA-DRB1*0401, -DRB1*0301,
-DQA1*0501, -DQB1*0201, -DRB1*1501, -DRB1*1502, -DQB1*0602,
-DQA1*0102, -DQA1*0201, -DQB1*0202, -DQA1*0501, and combinations
thereof. For a summary of HLA allele/disease associations, see
Bakker et al. (2006), supra, incorporated herein by reference.
[0074] In one aspect, the non-human portion of a chimeric
human/non-human MHC I, MHC II .alpha. and/or MHC II .beta.
polypeptide(s) comprises transmembrane and/or cytoplasmic domains
of an endogenous non-human (e.g., rodent, e.g., mouse, rat, etc.)
MHC I, MHC II .alpha. and/or MHC II .beta. polypeptide(s),
respectively. Thus, the non-human portion of the chimeric
human/non-human MHC I polypeptide may comprise transmembrane and/or
cytoplasmic domains of an endogenous non-human MHC I polypeptide.
The non-human portion of a chimeric MHC II .alpha. polypeptide may
comprise transmembrane and/or cytoplasmic domains of an endogenous
non-human MHC II .alpha. polypeptide. The non-human portion of a
chimeric human/non-human MHC II .beta. polypeptide may comprise
transmembrane and/or cytoplasmic domains of an endogenous non-human
MHC II .beta. polypeptide. In one aspect, the non-human animal is
mouse, and a non-human portion of the chimeric MHC I polypeptide is
derived from a mouse H-2K protein. In one aspect, the animal is a
mouse, and non-human portions of the chimeric MHC II .alpha. and
.beta. polypeptides are derived from a mouse H-2E protein. Thus, a
non-human portion of the chimeric MHC I polypeptide may comprise
transmembrane and cytoplasmic domains derived from a mouse H-2K,
and non-human portions of the chimeric MHC II .alpha. and .beta.
polypeptides may comprise transmembrane and cytoplasmic domains
derived from a mouse H-2E protein. Although specific H-2K and H-2E
sequences are contemplated in the Examples, any suitable sequences,
e.g., polymorphic variants, conservative/non-conservative amino
acid substitutions, etc., are encompassed herein. In one aspect,
the non-human animal is a mouse, and the mouse does not express
functional endogenous MHC polypeptides from its H-2D locus. In some
embodiments, the mouse is engineered to lack all or a portion of an
endogenous H-2D locus. In other aspects, the mouse does not express
any functional endogenous mouse MHC I and MHC II on a cell
surface.
[0075] A chimeric human/non-human polypeptide may be such that it
comprises a human or a non-human leader (signal) sequence. In one
embodiment, the chimeric MHC I polypeptide comprises a non-human
leader sequence of an endogenous MHC I polypeptide. In one
embodiment, the chimeric MHC II .alpha. polypeptide comprises a
non-human leader sequence of an endogenous MHC II .alpha.
polypeptide. In one embodiment, the chimeric MHC II .beta.
polypeptide comprises a non-human leader sequence of an endogenous
MHC II .beta. polypeptide. In an alternative embodiment, the
chimeric MHC I, MHC II .alpha. and/or MHC II .beta. polypeptide(s)
comprises a non-human leader sequence of MHC I, MHC II .alpha.
and/or MHC II .beta. polypeptide(s), respectively, from another
non-human animal, e.g., another rodent or another mouse strain.
Thus, the nucleotide sequence encoding the chimeric MHC I, MHC II
.alpha. and/or MHC II .beta. polypeptide may be operably linked to
a nucleotide sequence encoding a non-human MHC I, MHC II .alpha.
and/or MHC II .beta. leader sequence, respectively. In yet another
embodiment, the chimeric MHC I, MHC II .alpha. and/or MHC II .beta.
polypeptide(s) comprises a human leader sequence of human MHC I,
human MHC II .alpha. and/or human MHC II .beta. polypeptide,
respectively (e.g., a leader sequence of human HLA-A2, human
HLA-DRA and/or human HLA-DR.beta.1*1501, respectively).
[0076] A chimeric human/non-human MHC I, MHC II .alpha. and/or MHC
II .beta. polypeptide may comprise in its human portion a complete
or substantially complete extracellular domain of a human MHC I,
human MHC II .alpha. and/or human MHC II .beta. polypeptide,
respectively. Thus, a human portion may comprise at least 80%,
preferably at least 85%, more preferably at least 90%, e.g., 95% or
more of the amino acids encoding an extracellular domain of a human
MHC I, human MHC II .alpha. and/or human MHC II .beta. polypeptide
(e.g., human HLA-A2, human HLA-DRA and/or human
HLA-DR.beta.1*1501). In one example, substantially complete
extracellular domain of the human MHC I, human MHC II .alpha.
and/or human MHC II .beta. polypeptide lacks a human leader
sequence. In another example, the chimeric human/non-human MHC I,
chimeric human/non-human MHC II .alpha. and/or the chimeric
human/non-human MHC II .beta. polypeptide comprises a human leader
sequence.
[0077] Moreover, the chimeric MHC I, MHC II .alpha. and/or MHC II
.beta. polypeptide may be operably linked to (e.g., be expressed
under the regulatory control of) endogenous non-human promoter and
regulatory elements, e.g., mouse MHC I, MHC II .alpha. and/or MHC
II .beta. regulatory elements, respectively. Such arrangement will
facilitate proper expression of the chimeric MHC I and/or MHC II
polypeptides in the non-human animal, e.g., during immune response
in the non-human animal.
[0078] The genetically modified non-human animal may be selected
from a group consisting of a mouse, rat, rabbit, pig, bovine (e.g.,
cow, bull, buffalo), deer, sheep, goat, chicken, cat, dog, ferret,
primate (e.g., marmoset, rhesus monkey). For the non-human animals
where suitable genetically modifiable ES cells are not readily
available, other methods are employed to make a non-human animal
comprising the genetic modification. Such methods include, e.g.,
modifying a non-ES cell genome (e.g., a fibroblast or an induced
pluripotent cell) and employing nuclear transfer to transfer the
modified genome to a suitable cell, e.g., an oocyte, and gestating
the modified cell (e.g., the modified oocyte) in a non-human animal
under suitable conditions to form an embryo.
[0079] In one aspect, the non-human animal is a mammal. In one
aspect, the non-human animal is a small mammal, e.g., of the
superfamily Dipodoidea or Muroidea. In one embodiment, the
genetically modified animal is a rodent. In one embodiment, the
rodent is selected from a mouse, a rat, and a hamster. In one
embodiment, the rodent is selected from the superfamily Muroidea.
In one embodiment, the genetically modified animal is from a family
selected from Calomyscidae (e.g., mouse-like hamsters), Cricetidae
(e.g., hamster, New World rats and mice, voles), Muridae (true mice
and rats, gerbils, spiny mice, crested rats), Nesomyidae (climbing
mice, rock mice, white-tailed rats, Malagasy rats and mice),
Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole
rates, bamboo rats, and zokors). In a specific embodiment, the
genetically modified rodent is selected from a true mouse or rat
(family Muridae), a gerbil, a spiny mouse, and a crested rat. In
one embodiment, the genetically modified mouse is from a member of
the family Muridae. In one embodiment, the animal is a rodent. In a
specific embodiment, the rodent is selected from a mouse and a rat.
In one embodiment, the non-human animal is a mouse.
[0080] In one embodiment, the non-human animal is a rodent that is
a mouse of a C57BL strain selected from C57BL/A, C57BL/An,
C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ,
C57BL/10, C57BL/10ScSn, C57BL/10Cr, and C57BL/Ola. In another
embodiment, the mouse is a 129 strain selected from the group
consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1
(e.g., 129S1/SV, 12951/Svlm), 129S2, 129S4, 129S5, 129S9/SvEvH,
129S6 (129/SvEvTac), 129S7, 129S8, 129T1, 129T2 (see, e.g., Festing
et al. (1999) Revised nomenclature for strain 129 mice, Mammalian
Genome 10:836, see also, Auerbach et al (2000) Establishment and
Chimera Analysis of 129/SvEv- and C57BL/6-Derived Mouse Embryonic
Stem Cell Lines). In one embodiment, the genetically modified mouse
is a mix of an aforementioned 129 strain and an aforementioned
C57BL/6 strain. In another embodiment, the mouse is a mix of
aforementioned 129 strains, or a mix of aforementioned BL/6
strains. In one embodiment, the 129 strain of the mix is a 129S6
(129/SvEvTac) strain. In another embodiment, the mouse is a BALB
strain, e.g., BALB/c strain. In yet another embodiment, the mouse
is a mix of a BALB strain and another aforementioned strain. In
some embodiments, the mouse strain is such that a genetically
wild-type mouse of that strain only expresses MHC I polypeptides
derived from H-2K and H-2D on a cell surface and lacks endogenous
H-2L gene.
[0081] In one embodiment, the non-human animal is a rat. In one
embodiment, the rat is selected from a Wistar rat, an LEA strain, a
Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti.
In one embodiment, the rat strain is a mix of two or more strains
selected from the group consisting of Wistar, LEA, Sprague Dawley,
Fischer, F344, F6, and Dark Agouti.
[0082] Thus, in one embodiment, the invention relates to a
genetically modified mouse that comprises in its genome a first
nucleotide sequence encoding a chimeric human/mouse MHC I, a second
nucleotide sequence encoding a chimeric human/mouse MHC II .alpha.,
and a third nucleotide sequence encoding a chimeric human/mouse MHC
II .beta. polypeptides. A human portion of the chimeric MHC I, MHC
II .alpha., and MHC II .beta. may comprise an extracellular domain
of a human MHC I, MHC II .alpha., and MHC II .beta., respectively.
In one embodiment, the mouse expresses functional chimeric
human/mouse MHC I, MHC II .alpha., and MHC II .beta. polypeptides
from its endogenous mouse MHC locus. In one embodiment, the mouse
does not express functional mouse MHC polypeptides, e.g.,
functional mouse MHC I, MHC II .alpha., and MHC II .beta.
polypeptides, from its endogenous mouse MHC locus. In one
embodiment, the mouse does not express functional endogenous MHC
polypeptides from its H-2D locus. In some embodiments, the mouse is
engineered to lack all or a portion of an endogenous H-2D locus. In
other embodiments, the only MHC I and MHC II expressed by the mouse
on a cell surface are chimeric MHC I and II.
[0083] In one embodiment, a human portion of the chimeric
human/mouse MHC I polypeptide comprises a peptide binding domain or
an extracellular domain of a human MHC I (e.g., human HLA-A, e.g.,
human HLA-A2, e.g., human HLA-A2.1). In some embodiments, the mouse
does not express a peptide binding or an extracellular domain of an
endogenous mouse MHC I polypeptide from its endogenous mouse MHC I
locus. The peptide binding domain of the chimeric human/mouse MHC I
may comprise human .alpha.1 and .alpha.2 domains. Alternatively,
the peptide binding domain of the chimeric human/mouse MHC I may
comprise human .alpha.1, .alpha.2, and .alpha.3 domains. In one
aspect, the extracellular domain of the chimeric human/mouse MHC I
comprises an extracellular domain of a human MHC I .alpha. chain.
In one embodiment, the endogenous mouse MHC I locus is an H-2K
(e.g., H-2Kb) locus, and the mouse portion of the chimeric MHC I
polypeptide comprises transmembrane and cytoplasmic domains of a
mouse H-2K (e.g., H-2Kb) polypeptide. Thus, in one embodiment, the
mouse of the invention comprises at its endogenous mouse MHC I
locus a nucleotide sequence encoding a chimeric human/mouse MHC I,
wherein a human portion of the chimeric polypeptide comprises an
extracellular domain of a human HLA-A2 (e.g., HLA-A2.1) polypeptide
and a mouse portion comprises transmembrane and cytoplasmic domains
of a mouse H-2K (e.g., H-2Kb) polypeptide, and a mouse expresses a
chimeric human/mouse HLA-A2/H-2K protein. In other embodiment, the
mouse portion of the chimeric MHC I polypeptide may be derived from
other mouse MHC I, e.g., H-2D, H-2L, etc.; and the human portion of
the chimeric MHC I polypeptide may be derived from other human MHC
I, e.g., HLA-B, HLA-C, etc. In one aspect, the mouse does not
express a functional endogenous H-2K polypeptide from its
endogenous mouse H-2K locus. In one embodiment, the mouse does not
express functional endogenous MHC polypeptides from its H-2D locus.
In some embodiments, the mouse is engineered to lack all or a
portion of an endogenous H-2D locus. In other embodiments, the only
MHC I polypeptides expressed by the mouse on a cell surface are
chimeric human/mouse MHC I polypeptides.
[0084] In one embodiment, a human portion of the chimeric
human/mouse MHC II .alpha. polypeptide comprises a human MHC II
.alpha. peptide binding or extracellular domain and a human portion
of the chimeric human/mouse MHC II .beta. polypeptide comprises a
human MHC II .beta. peptide binding or extracellular domain. In
some embodiments, the mouse does not express a peptide binding or
an extracellular domain of endogenous mouse .alpha. and/or .beta.
polypeptide from an endogenous mouse locus (e.g., H-2A and/or H-2E
locus). In some embodiments, the mouse comprises a genome that
lacks a gene that encodes a functional MHC class II molecule
comprising an H-2Ab1, H-2Aa, H-2Eb1, H-2Eb2, H-2Ea, and a
combination thereof. In some embodiments, the only MHC II
polypeptides expressed by the mouse on a cell surface are chimeric
human/mouse MHC II polypeptides. The peptide-binding domain of the
chimeric human/mouse MHC II .alpha. polypeptide may comprise human
.alpha.1 domain and the peptide-binding domain of the chimeric
human/mouse MHC II .beta. polypeptide may comprise a human .beta.1
domain; thus, the peptide-binding domain of the chimeric MHC II
complex may comprise human .alpha.1 and .beta.1 domains. The
extracellular domain of the chimeric human/mouse MHC II .alpha.
polypeptide may comprise human .alpha.1 and .alpha.2 domains and
the extracellular domain of the chimeric human/mouse MHC II .beta.
polypeptide may comprise human .beta.1 and .beta.2 domains; thus,
the extracellular domain of the chimeric MHC II complex may
comprise human .alpha.1, .alpha.2, .beta.1 and .beta.2 domains. In
one embodiment, the mouse portion of the chimeric MHC II complex
comprises transmembrane and cytosolic domains of mouse MHC II, e.g.
mouse H-2E (e.g., transmembrane and cytosolic domains of mouse H-2E
.alpha. and .beta. chains). Thus, in one embodiment, the mouse of
the invention comprises at its endogenous mouse MHC II locus a
nucleotide sequence encoding a chimeric human/mouse MHC II .alpha.,
wherein a human portion of the chimeric MHC II .alpha. polypeptide
comprises an extracellular domain derived from an .alpha. chain of
a human MHC II (e.g., .alpha. chain of HLA-DR2) and a mouse portion
comprises transmembrane and cytoplasmic domains derived from an
.alpha. chain of a mouse MHC II (e.g., H-2E); and a mouse comprises
at its endogenous mouse MHC II locus a nucleotide sequence encoding
a chimeric human/mouse MHC II .beta., wherein a human portion of
the chimeric MHC II .beta. polypeptide comprises an extracellular
domain derived from a .beta. chain of a human MHC II (e.g., .beta.
chain of HLA-DR2) and a mouse portion comprises transmembrane and
cytoplasmic domains derived from a .beta. chain of a mouse MHC II
(e.g., H-2E); wherein the mouse expresses a chimeric human/mouse
HLA-DR2/H-2E protein. In other embodiment, the mouse portion of the
chimeric MHC II protein may be derived from other mouse MHC II,
e.g., H-2A, etc.; and the human portion of the chimeric MHC II
protein may be derived from other human MHC II, e.g., HLA-DQ, etc.
In one aspect, the mouse does not express functional endogenous
H-2A and H-2E polypeptides from their endogenous mouse loci (e.g.,
the mouse does not express H-2Ab1, H-2Aa, H-2Eb1, H-2Eb2, and H-2Ea
polypeptides). In one aspect, the mouse does not express functional
endogenous MHC polypeptides from its H-2D locus. In some
embodiments, the mouse is engineered to lack all or a portion of an
endogenous H-2D locus. In some embodiments, the mouse lacks
expression of any endogenous MHC I or MHC II molecule on a cell
surface.
[0085] In a further embodiment, a non-human animal of the
invention, e.g., a rodent, e.g., a mouse, comprises at an
endogenous .beta.2 microglobulin locus a nucleotide sequence
encoding a human or humanized .beta.2 microglobulin. .beta.2
microglobulin or the light chain of the MHC class I complex (also
abbreviated ".beta.2M") is a small (12 kDa) non-glycosylated
protein, that functions primarily to stabilize the MHC I .alpha.
chain. Generation of human or humanized microglobulin animals is
described in detail in U.S. Patent Publication No. 20130111617, and
is incorporated herein by reference. A mouse comprising a humanized
MHC locus as described in the present disclosure, and a human or
humanized .beta.2 microglobulin locus as described in U.S. Patent
Publication No. 2013011, may be generated by any methods known in
the art, e.g., breeding, or alternatively, using homologous
recombination in ES cells.
[0086] Various other embodiments of a genetically modified
non-human animal, e.g. rodent, e.g., rat or mouse, would be evident
to one skilled in the art from the present disclosure and from the
disclosure of U.S. Patent Publication No. 20130111617 and U.S. Pat.
No. 8,847,005 incorporated herein by reference.
[0087] In various aspects of the invention, the sequence(s)
encoding a chimeric human/non-human MHC I and MHC II polypeptides
are located at an endogenous non-human MHC locus (e.g., mouse H-2K
and/or H-2E locus). In one embodiment, this results in a
replacement of an endogenous MHC gene(s) or a portion thereof with
a nucleotide sequence(s) encoding a human or humanized MHC I or MHC
II polypeptides. Since the nucleotide sequences encoding MHC I, MHC
II .alpha. and MHC II .beta. polypeptides are located in proximity
to one another on the chromosome, in order to achieve the greatest
success in humanization of both MHC I and MHC II in one animal, the
MHC I and MHC II loci should be targeted sequentially. Thus, also
provided herein are methods of generating a genetically modified
non-human animal comprising nucleotide sequences encoding chimeric
human/non-human MHC I, MHC II .alpha. and MHC II .beta.
polypeptides as described herein.
[0088] In some embodiments, the method utilizes a targeting
construct made using VELOCIGENE.RTM. technology, introducing the
construct into ES cells, and introducing targeted ES cell clones
into a mouse embryo using VELOCIMOUSE.RTM. technology, as described
in the Examples.
[0089] The nucleotide constructs used for generating non-human
animals described herein are also provided. In one aspect, the
nucleotide construct comprises: 5' and 3' non-human homology arms,
a human DNA fragment comprising human MHC gene sequences (e.g.,
human HLA-A2 or human HLA-DR4 gene sequences), and a selection
cassette flanked by recombination sites. In one embodiment, the
human DNA fragment is a genomic fragment that comprises both
introns and exons of a human MHC gene (e.g., human HLA-A2 or
HLA-DR2 gene). In one embodiment, the non-human homology arms are
homologous to a non-human MHC locus (e.g., MHC I or MHC II
locus).
[0090] A selection cassette is a nucleotide sequence inserted into
a targeting construct to facilitate selection of cells (e.g., ES
cells) that have integrated the construct of interest. A number of
suitable selection cassettes are known in the art. Commonly, a
selection cassette enables positive selection in the presence of a
particular antibiotic (e.g., Neo, Hyg, Pur, CM, Spec, etc.). In
addition, a selection cassette may be flanked by recombination
sites, which allow deletion of the selection cassette upon
treatment with recombinase enzymes. Commonly used recombination
sites are loxP* and Frt, recognized by Cre and Flp enzymes,
respectively, but others are known in the art. In one embodiment,
the selection cassette is located at the 5' end the human DNA
fragment. In another embodiment, the selection cassette is located
at the 3' end of the human DNA fragment. In another embodiment, the
selection cassette is located within the human DNA fragment. In
another embodiment, the selection cassette is located within an
intron of the human DNA fragment.
[0091] In one embodiment, the 5' and 3' non-human homology arms
comprise genomic sequence at 5' and 3' locations, respectively, of
an endogenous non-human (e.g., murine) MHC class I or class II gene
locus (e.g., 5' of the first leader sequence and 3' of the .alpha.3
exon of the mouse MHC I gene, or upstream of mouse H-2Ab1 gene and
downstream of mouse H-2Ea gene). In one embodiment, the endogenous
MHC class I locus is selected from mouse H-2K, H-2D and H-2L. In a
specific embodiment, the endogenous MHC class I locus is mouse
H-2K. In one embodiment, the endogenous MHC II locus is selected
from mouse H-2E and H-2A. In one embodiment, the engineered MHC II
construct allows replacement of both mouse H-2E and H-2A genes. In
one embodiment, the mouse does not express functional endogenous
MHC polypeptides from its H-2D locus. In some embodiments, the
mouse is engineered to lack all or a portion of an endogenous H-2D
locus. In another embodiment, the mouse does not express any
functional endogenous MHC I and MHC II polypeptides on a cell
surface. In one embodiment, the only MHC I and MHC II expressed by
the mouse on a cell surface are chimeric human/mouse MHC I and MHC
II.
[0092] Thus, in one embodiment, provided herein is a method of
generating a genetically engineered non-human animal (e.g., rodent,
e.g., rat or mouse) capable of expressing humanized MHC I and II
proteins comprising replacing at an endogenous non-human MHC II
locus a nucleotide sequence encoding a non-human MHC II complex
with a nucleotide sequence encoding a chimeric human/non-human MHC
II complex to generate a first non-human animal; and replacing at
an endogenous non-human MHC I locus a nucleotide sequence encoding
a non-human MHC I polypeptide with a nucleotide sequence encoding a
chimeric human/non-human MHC I polypeptide to generate a second
non-human animal. In one embodiment, the steps of replacing
nucleotide sequences comprise homologous recombination in ES cells.
In one embodiment, the second non-human animal is generated by
homologous recombination in ES cells bearing nucleotide sequences
encoding chimeric human/non-human MHC II complex. In one
embodiment, the non-human animal is a mouse, and the first or
second mouse does not express functional endogenous MHC
polypeptides from its H-2D locus. In some embodiments, the first or
second mouse is engineered to lack all or a portion of an
endogenous H-2D locus. Alternatively, also provided herein is a
method of generating a genetically engineered non-human animal
(e.g., rodent, e.g., rat or mouse) capable of expressing humanized
MHC I and II proteins comprising replacing at an endogenous
non-human MHC I locus a nucleotide sequence encoding a non-human
MHC I polypeptide with a nucleotide sequence encoding a chimeric
human/non-human MHC I polypeptide to generate a first non-human
animal; and replacing at an endogenous non-human MHC II locus a
nucleotide sequence encoding a non-human MHC II complex with a
nucleotide sequence encoding a chimeric human/non-human MHC II
complex to generate a second non-human animal. In such embodiment,
the second non-human animal is generated by homologous
recombination in ES cells bearing a nucleotide sequence encoding
chimeric human/non-human MHC I polypeptide.
[0093] Upon completion of gene targeting, ES cells or genetically
modified non-human animals are screened to confirm successful
incorporation of exogenous nucleotide sequence of interest or
expression of exogenous polypeptide. Numerous techniques are known
to those skilled in the art, and include (but are not limited to)
Southern blotting, long PCR, quantitative PCT (e.g., real-time PCR
using TAQMAN.RTM.), fluorescence in situ hybridization, Northern
blotting, flow cytometry, Western analysis, immunocytochemistry,
immunohistochemistry, etc. In one example, non-human animals (e.g.,
mice) bearing the genetic modification of interest can be
identified by screening for loss of mouse allele and/or gain of
human allele using a modification of allele assay described in
Valenzuela et al. (2003) High-throughput engineering of the mouse
genome coupled with high-resolution expression analysis, Nature
Biotech. 21(6):652-659. Other assays that identify a specific
nucleotide or amino acid sequence in the genetically modified
animals are known to those skilled in the art.
[0094] In one aspect, a cell that expresses a chimeric
human/non-human MHC I and MHC II proteins (e.g., HLA-A2/H-2K and
HLA-DR2/H-2E proteins) is provided. In one aspect, the cell is a
mouse cell that does not express functional endogenous MHC
polypeptides from its H-2D locus. In some embodiments, the cell is
a mouse cell is engineered to lack all or a portion of an
endogenous H-2D locus. In some embodiments, the cell is a mouse
cell that does not express any endogenous MHC I and MHC II
polypeptide on its surface. In one embodiment, the cell comprises
an expression vector comprising a chimeric MHC class I sequence and
chimeric MHC class II sequence as described herein. In one
embodiment, the cell is selected from CHO, COS, 293, HeLa, and a
retinal cell expressing a viral nucleic acid sequence (e.g., a
PERC.6.TM. cell).
[0095] A chimeric MHC II complex comprising an extracellular domain
of HLA-DR2 described herein may be detected by anti-HLA-DR
antibodies. Thus, a cell displaying chimeric human/non-human MHC II
polypeptide may be detected and/or selected using anti-HLA-DR
antibody. The chimeric MHC I complex comprising an extracellular
domain of HLA-A2 described herein may be detected using anti-HLA-A,
e.g., anti-HLA-A2 antibodies. Thus, a cell displaying a chimeric
human/non-human MHC I polypeptide may be detected and/or selected
using anti-HLA-A antibody. Antibodies that recognize other HLA
alleles are commercially available or can be generated, and may be
used for detection/selection.
[0096] Although the Examples that follow describe a genetically
engineered animal whose genome comprises a replacement of a
nucleotide sequence encoding mouse H-2K, and H-2A and H-2E proteins
with a nucleotide sequence encoding a chimeric human/mouse
HLA-A2/H-2K and HLA-DR2/H-2E protein, respectively, one skilled in
the art would understand that a similar strategy may be used to
introduce chimeras comprising other human MHC I and II genes (other
HLA-A, HLA-B, and HLA-C; and other HLA-DR, HLA-DP and HLA-DQ
genes). Such animals comprising multiple chimeric human/non-human
(e.g., human/rodent, e.g., human/mouse) MHC I and MHC II genes at
endogenous MHC loci are also provided.
[0097] In various embodiments of the invention, the mouse that
comprises chimeric human/mouse MHC I and MHC II loci and expresses
only chimeric human/mouse MHC I and MHC II on a cell surface (and
lacks cell surface expression of any endogenous MHC I and MHC II)
displays essentially normal B to T cell ratio, e.g., B to T cell
ratio in the spleen. In some embodiments of the invention, the
mouse described herein displays normal T and B cell development,
expression levels, and expression patterns. In some embodiments of
the invention, the mouse described herein expresses chimeric
human/mouse MHC II only on antigen presenting cells of the mouse.
In some embodiments, a mouse described herein elicits an immune
response, e.g., a cellular immune response, to one or more human
antigens. In some embodiments, a mouse described herein elicits a T
cell response to one or more human antigens.
[0098] In various embodiments, the genetically modified non-human
animals described herein make cells, e.g., APCs, with human or
humanized MHC I and II on the cell surface and, as a result,
present peptides as epitopes for T cells in a human-like manner,
because substantially all of the components of the complex are
human or humanized. The genetically modified non-human animals of
the invention can be used to study the function of a human immune
system in the humanized animal; for identification of antigens and
antigen epitopes that elicit immune response (e.g., T cell
epitopes, e.g., unique human cancer epitopes), e.g., for use in
vaccine development; for evaluation of vaccine candidates and other
vaccine strategies; for studying human autoimmunity; for studying
human infectious diseases; and otherwise for devising better
therapeutic strategies based on human MHC expression.
EXAMPLES
[0099] The invention will be further illustrated by the following
nonlimiting examples. These Examples are set forth to aid in the
understanding of the invention but are not intended to, and should
not be construed to, limit its scope in any way. The Examples do
not include detailed descriptions of conventional methods that
would be well known to those of ordinary skill in the art
(molecular cloning techniques, etc.). Unless indicated otherwise,
parts are parts by weight, molecular weight is average molecular
weight, temperature is indicated in Celsius, and pressure is at or
near atmospheric.
Example 1
Engineering a Mouse Comprising Humanized MHC I and MHC II Loci
[0100] The various steps involved in engineering a mouse comprising
humanized MHC I and MHC II loci, with corresponding and additional
endogenous MHC I and MHC II loci deletions (HLA-A2/H-2K,
HLA-DR2/H-2E, H-2A-del, H-2D-del) are depicted in FIG. 4. Detailed
description of the steps appears below.
Example 1.1
Engineering Mouse ES Cells Comprising Humanized MHC I Gene
[0101] The mouse H-2K gene was humanized in a single step by
construction of a unique targeting vector from human and mouse
bacterial artificial chromosome (BAC) DNA using VELOCIGENE.RTM.
technology (see, e.g., U.S. Pat. No. 6,586,251 and Valenzuela et
al. (2003) High-throughput engineering of the mouse genome coupled
with high-resolution expression analysis. Nat. Biotech. 21(6):
652-659). DNA from mouse BAC clone RP23-173k21 (Invitrogen) was
modified by homologous recombination to replace the genomic DNA
encoding the .alpha.1, .alpha.2 and .alpha.3 domains of the mouse
H-2K gene with human genomic DNA encoding the .alpha.1, .alpha.2
and .alpha.3 subunits of the human HLA-A2 gene (FIG. 5). Detailed
steps for construction of BAC DNA can be found in U.S. Patent
Application Publication No. 2013-0111617, incorporated herein by
reference. The targeted BAC DNA was used to electroporate mouse
F1H4 ES cells to create modified ES cells for generating mice that
express a chimeric MHC class I protein on the surface of nucleated
cells (e.g., T and B lymphocytes, macrophages, neutrophils). ES
cells containing an insertion of human HLA sequences were
identified by a the quantitative PCR assay using TAQMAN.TM. (Lie
and Petropoulos (1998) Curr. Opin. Biotechnology 9:43-48). Detailed
steps for construction of mouse ES cells comprising humanized MHC I
gene as well as screening can be also found in the same U.S. Patent
Application Publication No. 2013-0111617.
[0102] ES cells comprising the chimeric HLA-A2/H-2K were utilized
in further genetic engineering steps detailed below and in FIG.
4.
Example 1.2
Engineering Mouse ES Cells Comprising Deletion of MHC II Loci
[0103] The targeting vector for introducing a deletion of the
endogenous MHC class II H-2Ab1, H-2Aa, H-2Eb1, H-2Eb2, and H-2Ea
genes was made using VELOCIGENE.RTM. genetic engineering technology
(see, e.g., U.S. Pat. No. 6,586,251 and Valenzuela et al., supra).
Bacterial Artificial Chromosome (BAC) RP23-458i22 (Invitrogen) DNA
was modified to delete the endogenous MHC class II genes H-2Ab1,
H-2Aa, H-2Eb1, H-2Eb2, and H-2Ea.
[0104] Briefly, upstream and downstream homology arms were derived
by PCR of mouse BAC DNA from locations 5' of the H-2Ab1 gene and 3'
of the H-2Ea gene, respectively. These homology arms were used to
make a cassette that deleted .about.79 kb of RP23-458i22 comprising
genes H-2Ab1, H-2Aa, H-2Eb1, H-2Eb2, and H-2Ea of the MHC class II
locus by bacterial homologous recombination (BHR). This region was
replaced with a neomycin cassette flanked by lox2372 sites. The
final targeting vector included from 5' to 3' a 26 kb homology arm
comprising mouse genomic sequence 5' to the H-2Ab1 gene of the
endogenous MHC class II locus, a 5' lox2372 site, a neomycin
cassette, a 3' lox2372 site and a 63 kb homology arm comprising
mouse genomic sequence 3' to the H-2Ea gene of the endogenous MHC
class II locus (MAID 5092).
[0105] The BAC DNA targeting vector (described above) was used to
electroporate mouse ES cells comprising humanized MHC I locus (from
Example 1.1 above) to create modified ES cells comprising a
deletion of the endogenous MHC class II locus (both H-2A and H-2E
were deleted). Positive ES cells containing a deleted endogenous
MHC class II locus were identified by the quantitative PCR assay
using TAQMAN.TM. probes (Lie and Petropoulos (1998) Curr. Opin.
Biotechnology 9:43-48). The upstream region of the deleted locus
was confirmed by PCR using primers 5111U F (CAGAACGCCAGGCTGTAAC;
SEQ ID NO:1) and 5111U R (GGAGAGCAGGGTCAGTCAAC; SEQ ID NO:2) and
probe 5111U P (CACCGCCACTCACAGCTCCTTACA; SEQ ID NO:3), whereas the
downstream region of the deleted locus was confirmed using primers
5111D F (GTGGGCACCATCTTCATCATTC; SEQ ID NO:4) and 5111D R
(CTTCCTTTCCAGGGTGTGACTC; SEQ ID NO:5) and probe 5111D P
(AGGCCTGCGATCAGGTGGCACCT; SEQ ID NO:6). The presence of the
neomycin cassette from the targeting vector was confirmed using
primers NEOF (GGTGGAGAGGCTATTCGGC; SEQ ID NO:7) and NEOR
(GAACACGGCGGCATCAG; SEQ ID NO:8) and probe NEOP
(TGGGCACAACAGACAATCGGCTG; SEQ ID NO:9). The nucleotide sequence
across the upstream deletion point (SEQ ID NO:10) included the
following, which indicates endogenous mouse sequence upstream of
the deletion point (contained within the parentheses below) linked
contiguously to cassette sequence present at the deletion point:
(TTTGTAAACA AAGTCTACCC AGAGACAGAT GACAGACTTC AGCTCCAATG CTGATTGGTT
CCTCACTTGG GACCAACCCT) ACCGGTATAA CTTCGTATAA GGTATCCTAT ACGAAGTTAT
ATGCATGGCC TCCGCGCCGG. The nucleotide sequence across the
downstream deletion point (SEQ ID NO:11) included the following,
which indicates cassette sequence contiguous with endogenous mouse
sequence downstream of the deletion point (contained within the
parentheses below): CGACCTGCAG CCGGCGCGCC ATAACTTCGT ATAAGGTATC
CTATACGAAG TTATCTCGAG (CACAGGCATT TGGGTGGGCA GGGATGGACG GTGACTGGGA
CAATCGGGAT GGAAGAGCAT AGAATGGGAG TTAGGGAAGA).
[0106] Subsequently to generation of the ES cells comprising both
the MHC I humanization and endogenous MHC II deletion described
above, the loxed neomycin cassette was removed using CRE.
Specifically, a plasmid encoding Cre recombinase was electroporated
into ES cells to remove the neomycin cassette.
Example 1.3
Generation of Mouse ES Cells Comprising H2-D Locus Deletion
[0107] To delete mouse H-2D locus, BHR was used to modify mouse BAC
clone bMQ-218H21 (Sanger Institute), replacing 3756 bp of the H2-D
gene (from the ATG start codon to 3 bp downstream of the TGA stop
codon, exons 1-8 of mouse H-2D) with a 6,085 bp cassette containing
from 5' to 3': a LacZ gene in frame with a 5' loxp site, UbC
promoter, Neomycin gene, and 3' loxp site.
[0108] The BAC DNA targeting vector (described above) was used to
electroporate mouse ES cells comprising humanized MHC I locus and a
deletion of mouse MHC II, described in Example 1.2 above. Positive
ES cells containing a deleted endogenous H-2D locus were identified
by the quantitative PCR assay, as described above. Table 1 contains
primers and probes used for the quantitative PCR assay.
TABLE-US-00001 TABLE 1 TAQMAN .TM. Loss of Allele Assay Primers and
Probes Name Forward Reverse (location) Primer Primer Probe 5152 mTU
CGAGGAGCC AAGCGCACGA CTCTGTCGG (upstream) CCGGTACA ACTCCTTGTT
CTATGTGG (SEQ ID (SEQ ID (SEQ ID NO: 12) NO: 13) NO: 14) 5152 mTD
GGACTCCCAGA GAGTCATGAACCA TGGTGGGT (downstream) ATCTCCTGAGA
TCACTGTGAAGA TGCTGGAA (SEQ ID (SEQ ID (SEQ ID NO: 15) NO: 16) NO:
17)
Example 1.4
Generation of Mouse ES Cells Comprising Humanized MHC II Locus
[0109] To generate a vector comprising humanized HLA-DR2/H-2E,
first, mouse H-2Ea gene was modified in accordance with the
description in US Patent Application Publication No. US
2013-0111616, incorporated herein by reference, to generate a
vector comprising sequence encoding a chimeric H-2Ea/HLA-DRA1*01
protein.
[0110] For mouse H-2Eb gene, synthesized human HLA-DR2 .beta. chain
(DRB1*1501) was used to generate a vector comprising
DR.beta.1*02(1501) exons and introns, and swapped using bacterial
homologous recombination into the vector comprising chimeric
H-2Ea/HLA-DRA1*01 protein. H-2Eb gene was modified essentially as
described in U.S. Patent Application Publication Nos. US
2013-0111616 and US 2013-0185820, incorporated herein by reference.
A hygromycin selection cassette was used.
[0111] The resulting HLA-DR2/H-2E LTVEC is depicted in FIG. 6. The
various nucleotide sequence junctions of the resulting LTVECs
(e.g., mouse/human sequence junctions, human/mouse sequence
junctions, or junctions of mouse or human sequence with selection
cassettes) are summarized below in Table 2 and listed in the
Sequence Listing; their locations are indicated in the schematic
diagram of FIG. 6. In Table 2 below, with the exception of
sequences marked with asterisks (*, see Table legend) the mouse
sequences are in regular font; the human sequences are in
parentheses; the Lox sequences are italicized; and the restriction
sites introduced during cloning steps and other vector-based
sequences (e.g., multiple cloning sites, etc.) are bolded.
TABLE-US-00002 TABLE 2 Nucleotide Sequence Junctions SEQ ID NO:
Nucleotide Sequence 18 CTGTTTCTTC CCTAACTCCC ATTCTATGCT CTTCCATC CC
GA CCGCGG (CCCA ATCTCTCTCC ACTACTTCCT GCCTACATGT ATGTAGGT) 19
(CAAGGTTTCC TCCTATGATG CTTGTGTGAA ACTCGG) GGCC GGCC AGCATTTAAC
AGTACAGGGA TGGGAGCACA GCTCAC 20* (GAAAGCAGTC TTCCCAGCCT TCACACTCAG
AGGTAC AAAT) CCCCATTTTC ATATTAGCGA TTTTAATTTA TTCTAGCCTC 21*
TCTTCCCTAA CTCCCATTCT ATGCTCTTCC ATCCCGA CCG CGG (CCCAATC
TCTCTCCACT ACTTCCTGCC TACATGTATG) 22
GAGTTCCTCCATCACTTCACTGGGTAGCACAGCTGTAACTG
TCCAGCCTG(TCCTGGGCTGCAGGTGGTGGGCGTTGCGGGT GGGGCCGGTTAAGGTTCCA) 23
(TCCCACATCCTATTTTAATTTGCTCCATGTTCTCATCTCC ATCAGCACAG)CTCGAG
ATAACTTCGTATAATGTATGCTA TACGAAGTTAT ATGCATGGCC 24 ATACGAAGTTAT
GCTAGTAACTATAACGGTCCTAAGGTAG CGAGTGGCTT
ACAGGTAGGTGCGTGAAGCTTCTACAAGCA CAGTTGCCCCCTGGGAAGCA *Sequences
marked with asterisk are C57BL/6-BALB/c junction sequences where
C57BL/6 sequences are in parentheses. During cloning of the
chimeric H-2Ea gene, exon 1 and the remainder of intron 1 of the
C57BL/6 allele of H-2Ea was replaced with the equivalent 2616 bp
region from the BALB/c allele of H-2Ea. This was done because exon
1 of the C57BL/6 allele of H-2Ea contains a deletion which renders
the gene nonfunctional, while exon 1 of BALB/c allele of H-2Ea is
functional. For a more detailed description, see U.S. Patent
Application Publication No. US 2013-0111616, incorporated herein by
reference.
[0112] The targeted BAC DNA described above was used to
electroporate mouse ES cells comprising humanized MHC I (HLA-A2),
as well as MHC II and H-2D deletion to create modified ES cells for
generating mice that express chimeric MHC I and MHC II genes and
lack functional endogenous mouse H-2E, H-2A, H-2K, and H-2D loci.
ES cells containing an insertion of human HLA sequences were
identified by a quantitative PCR (TAQMAN.TM.) assay, using primers
and probes in Table 3 and the procedure described above.
TABLE-US-00003 TABLE 3 TAQMAN .TM. Primer and Probe Sequences Name
Forward Reverse (location) Primer Primer Probe Hyg cassette
TGCGGCCGATC TTGACCGATTCCT ACGAGCGGGTT TTAGCC (SEQ TGCGG (SEQ
CGGCCCATTC ID NO: 25) ID NO: 26) (SEQ ID NO: 27) 7092 hTUP1
CCCCACAGCAC CGTCCCATTGAAG TGGCAGCCTAA (Exon 2 of GTTTCCT AAATGACACT
GAGG (SEQ DRB1*1501) (SEQ ID NO: (SEQ ID NO: ID NO: 30) 28) 29)
7092 hTUP2 CCCCACAGCAC ACCCGCTCCGTCC AGCCTAAGAGG (Exon 2 of GTTTCCT
CATT GAGTGTC DRB1*1501) (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: 31) 32)
33) 7092 hTDP1 AGACCCTGGTG CGCTTGGGTGCTC TCGAAGTGGAG (Exon 3 of
ATGCTGGAA CACTT AGGTTTA DRB1*1501) (SEQ ID NO: (SEQ ID NO: (SEQ ID
NO: 34) 35) 36) 7092 hTDP2 TGGAATGGAGT GCACGGTCCCCTT TGACTTCCTAA
(exon 3 of GAGCAGCTTT CTTAGTG ATTTCTC DRB1*1501) (SEQ ID NO: (SEQ
ID NO: (SEQ ID NO: 37) 38) 39) hDRAIU CTGGCGGCTTG CATGATTTCCAGG
CGATTTGCCAG (exon 2 of AAGAATTTGG TTGGCTTTGTC CTTTGAGGCTC DRA) (SEQ
ID NO: (SEQ ID NO: AAGG (SEQ 40) 41) ID NO: 42) 1751jxn2.sup.1
CCTCACTTGGG TTGTCCCAGTCAC TGCATCTCGAG (loss-of- ACCAACCCTA CGTCCAT
CACAGGCATTT allele assay, (SEQ ID NO: (SEQ ID NO: GG (SEQ sequence
43) 44) ID NO: 45) present in H- 2A and H-2E delete only) .sup.1All
sequences except this one are used in the gain-of-allele assay.
[0113] The selection cassette may be removed by methods known by
the skilled artisan. For example, ES cells bearing the chimeric
human/mouse MHC class I locus may be transfected with a construct
that expresses Cre in order to remove the "loxed" selection
cassette introduced by the insertion of the targeting construct.
The selection cassette may optionally be removed by breeding to
mice that express Cre recombinase. Optionally, the selection
cassette is retained in the mice.
[0114] Targeted ES cells containing all of the modifications
described in Examples 1.1-1.4 (H2-K.sup.+/1666 MHC-II.sup.+/6112
H2-D.sup.+/delete of FIG. 4) were verified using a quantitative
TAQMAN.RTM. assay described above using the primer/probe sets
described herein for individual modifications. An additional
primer/probe set was used to determine that during
cassette-deletion step, no inverted clone was created due to lox
sites present in opposing orientation.
[0115] Targeted ES cells described above were used as donor ES
cells and introduced into an 8-cell stage mouse embryo by the
VELOCIMOUSE.RTM. method (see, e.g., U.S. Pat. No. 7,294,754 and
Poueymirou et al. (2007) F0 generation mice that are essentially
fully derived from the donor gene-targeted ES cells allowing
immediate phenotypic analyses Nature Biotech. 25(1):91-99).
VELOCIMICE.RTM. (F0 mice fully derived from the donor ES cell)
independently bearing a chimeric MHC class I and MHC II genes were
identified by genotyping using a modification of allele assay
(Valenzuela et al., supra) that detects the presence of the unique
human gene sequences. A schematic representation of the genotype of
MHC loci in the resulting mice is depicted in FIG. 7 (** represents
H-2L gene which is not present in all mouse strains).
Example 1.5
Characterization of Mice Comprising Chimeric MHC I and II Genes
[0116] Spleens from WT or heterozygous humanized
HLA-A2/HLA-DR2/H-2D-del mice (see mice generated on the bottom of
FIG. 4 ("HLA-A2/H-2K, HLA-DR2/H-2E, H-2A-del, H-2D-del HET" or
"H-2K.sup.+/1666 MHC-II.sup.+/6112 H2-D.sup.+/delete" or "chimeric
A2 and DR2") were harvested, and single cell suspensions were
prepared. Cell surface expression of mouse MHC class I (H2D), human
MHC class I (HLA-A2), and human MHC class II (HLA-DR) on CD3+T
cells, CD19+B cells, and CD14+ monocytes were analyzed by FACS. As
shown in FIG. 8, there was no significant disruption in T to B cell
ratio or no significant effect on T and B cell development.
Expression of human HLA-A2 and HLA-DR were detectable on the
surface of CD19+B cells and monocytes (FIGS. 9 and 10). Expression
of human HLA-A2, but not HLA-DR, was detectable on the surface of
CD3+T cells (FIG. 11), as MHC II is only expressed on
antigen-presenting cells.
EQUIVALENTS
[0117] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents of the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
[0118] Entire contents of all non-patent documents, patent
applications and patents cited throughout this application are
incorporated by reference herein in their entirety.
Sequence CWU 1
1
45119DNAArtificial Sequencesynthetic 1cagaacgcca ggctgtaac
19220DNAArtificial Sequencesynthetic 2ggagagcagg gtcagtcaac
20324DNAArtificial Sequencesynthetic 3caccgccact cacagctcct taca
24422DNAArtificial Sequencesynthetic 4gtgggcacca tcttcatcat tc
22522DNAArtificial Sequencesynthetic 5cttcctttcc agggtgtgac tc
22623DNAArtificial Sequencesynthetic 6aggcctgcga tcaggtggca cct
23719DNAArtificial Sequencesynthetic 7ggtggagagg ctattcggc
19817DNAArtificial Sequencesynthetic 8gaacacggcg gcatcag
17923DNAArtificial Sequencesynthetic 9tgggcacaac agacaatcgg ctg
2310140DNAArtificial Sequencesynthetic 10tttgtaaaca aagtctaccc
agagacagat gacagacttc agctccaatg ctgattggtt 60cctcacttgg gaccaaccct
accggtataa cttcgtataa ggtatcctat acgaagttat 120atgcatggcc
tccgcgccgg 14011140DNAArtificial Sequencesynthetic 11cgacctgcag
ccggcgcgcc ataacttcgt ataaggtatc ctatacgaag ttatctcgag 60cacaggcatt
tgggtgggca gggatggacg gtgactggga caatcgggat ggaagagcat
120agaatgggag ttagggaaga 1401217DNAArtificial Sequencesynthetic
12cgaggagccc cggtaca 171320DNAArtificial Sequencesynthetic
13aagcgcacga actccttgtt 201417DNAArtificial Sequencesynthetic
14ctctgtcggc tatgtgg 171522DNAArtificial Sequencesynthetic
15ggactcccag aatctcctga ga 221625DNAArtificial Sequencesynthetic
16gagtcatgaa ccatcactgt gaaga 251716DNAArtificial Sequencesynthetic
17tggtgggttg ctggaa 161890DNAArtificial Sequencesynthetic
18ctgtttcttc cctaactccc attctatgct cttccatccc gaccgcggcc caatctctct
60ccactacttc ctgcctacat gtatgtaggt 901980DNAArtificial
Sequencesynthetic 19caaggtttcc tcctatgatg cttgtgtgaa actcggggcc
ggccagcatt taacagtaca 60gggatgggag cacagctcac 802080DNAArtificial
Sequencesynthetic 20gaaagcagtc ttcccagcct tcacactcag aggtacaaat
ccccattttc atattagcga 60ttttaattta ttctagcctc 802180DNAArtificial
Sequencesynthetic 21tcttccctaa ctcccattct atgctcttcc atcccgaccg
cggcccaatc tctctccact 60acttcctgcc tacatgtatg 8022100DNAArtificial
Sequencesynthetic 22gagttcctcc atcacttcac tgggtagcac agctgtaact
gtccagcctg tcctgggctg 60caggtggtgg gcgttgcggg tggggccggt taaggttcca
10023100DNAArtificial Sequencesynthetic 23tcccacatcc tattttaatt
tgctccatgt tctcatctcc atcagcacag ctcgagataa 60cttcgtataa tgtatgctat
acgaagttat atgcatggcc 10024100DNAArtificial Sequencesynthetic
24atacgaagtt atgctagtaa ctataacggt cctaaggtag cgagtggctt acaggtaggt
60gcgtgaagct tctacaagca cagttgcccc ctgggaagca 1002517DNAArtificial
Sequencesynthetic 25tgcggccgat cttagcc 172618DNAArtificial
Sequencesynthetic 26ttgaccgatt ccttgcgg 182721DNAArtificial
Sequencesynthetic 27acgagcgggt tcggcccatt c 212818DNAArtificial
Sequencesynthetic 28ccccacagca cgtttcct 182923DNAArtificial
Sequencesynthetic 29cgtcccattg aagaaatgac act 233015DNAArtificial
Sequencesynthetic 30tggcagccta agagg 153118DNAArtificial
Sequencesynthetic 31ccccacagca cgtttcct 183217DNAArtificial
Sequencesynthetic 32acccgctccg tcccatt 173318DNAArtificial
Sequencesynthetic 33agcctaagag ggagtgtc 183420DNAArtificial
Sequencesynthetic 34agaccctggt gatgctggaa 203518DNAArtificial
Sequencesynthetic 35cgcttgggtg ctccactt 183618DNAArtificial
Sequencesynthetic 36tcgaagtgga gaggttta 183721DNAArtificial
Sequencesynthetic 37tggaatggag tgagcagctt t 213820DNAArtificial
Sequencesynthetic 38gcacggtccc cttcttagtg 203918DNAArtificial
Sequencesynthetic 39tgacttccta aatttctc 184021DNAArtificial
Sequencesynthetic 40ctggcggctt gaagaatttg g 214124DNAArtificial
Sequencesynthetic 41catgatttcc aggttggctt tgtc 244226DNAArtificial
Sequencesynthetic 42cgatttgcca gctttgaggc tcaagg
264321DNAArtificial Sequencesynthetic 43cctcacttgg gaccaaccct a
214420DNAArtificial Sequencesynthetic 44ttgtcccagt caccgtccat
204524DNAArtificial Sequencesynthetic 45tgcatctcga gcacaggcat ttgg
24
* * * * *