U.S. patent application number 14/820445 was filed with the patent office on 2015-11-26 for array for detecting microbes.
The applicant listed for this patent is The Regents of the University of California. Invention is credited to Gary L. Andersen, Todd Z. DeSantis.
Application Number | 20150337363 14/820445 |
Document ID | / |
Family ID | 39876099 |
Filed Date | 2015-11-26 |
United States Patent
Application |
20150337363 |
Kind Code |
A1 |
Andersen; Gary L. ; et
al. |
November 26, 2015 |
ARRAY FOR DETECTING MICROBES
Abstract
The present embodiments relate to an array system for detecting
and identifying biomolecules and organisms. More specifically, the
present embodiments relate to an array system comprising a
microarray configured to simultaneously detect a plurality of
organisms in a sample at a high confidence level.
Inventors: |
Andersen; Gary L.;
(Berkeley, CA) ; DeSantis; Todd Z.; (Livermore,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Regents of the University of California |
Oakland |
CA |
US |
|
|
Family ID: |
39876099 |
Appl. No.: |
14/820445 |
Filed: |
August 6, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14298081 |
Jun 6, 2014 |
|
|
|
14820445 |
|
|
|
|
12474204 |
May 28, 2009 |
8771940 |
|
|
14298081 |
|
|
|
|
PCT/US2007/024720 |
Nov 29, 2007 |
|
|
|
12474204 |
|
|
|
|
60861834 |
Nov 30, 2006 |
|
|
|
Current U.S.
Class: |
506/16 ;
702/19 |
Current CPC
Class: |
C12Q 1/689 20130101;
C12Q 1/6837 20130101; G16B 25/00 20190201 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; G06F 19/20 20060101 G06F019/20 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED R&D
[0002] This invention was made with Government support under Grant
No. HSSCHQ04X00037 from the Department of Homeland Security and
Contract No. DE-AC02-05CH11231from the Department of Energy.
Claims
1. An array system comprising: (a) a microarray configured to
simultaneously detect a plurality of organisms in a sample, wherein
the microarray comprises a plurality of probes attached to a
surface comprising (i) a first probe set comprising a plurality of
different first nucleic acid probes, each of which is complementary
to an rRNA or rDNA sequence that is present in more than one
operational taxonomic unit (OTU) but collectively are present only
in a first OTU; and (ii) a second probe set consisting of different
second nucleic acid probes for detecting a second OTU that is
different from the first OTU, wherein the second nucleic acid
probes are complementary to rRNA or rDNA sequences collectively
present in the first OTU and the second OTU; and (b) a computer
system configured to determine the presence of the second OTU based
on hybridization signal intensities from the plurality of probes
according to computer-readable code, wherein the computer-readable
code provides instructions for (i) calculating a first
hybridization score for the first OTU based on signal intensities
of the first probe set; (ii) calculating a second hybridization
score for the second OTU based on signal intensities of the second
probe set; and (iii) determining the presence of the second OTU and
the absence of the first OTU when the second hybridization score is
above a threshold value and the first hybridization score is below
the threshold value.
2. The system of claim 1, wherein the OTUs comprise bacteria or
archaea.
3. The system of claim 1, wherein the plurality of probes comprise
probes for detecting 9000 OTUs.
4. The system of claim 1, wherein the rRNA or rDNA sequence is a
16S rRNA or rDNA sequence.
5. The system of claim 1, wherein the array further comprises a
mismatch probe for each of the nucleic acid probes complementary to
rRNA or rDNA sequences, wherein each mismatch probe differs from
the nucleic acid probe to which it corresponds at one or more
nucleotide bases.
6. The system of claim 1, wherein the array further comprises more
than one mismatch probe for each of the nucleic acid probes
complementary to rRNA or rDNA sequences, wherein each mismatch
probe differs from the nucleic acid probe to which it corresponds
at one or more nucleotide bases.
7. The system of claim 1, wherein detecting the presence of the
second OTU is made with a level of confidence higher than 95%.
8. The system of claim 1, wherein the microarray is configured to
simultaneously detect a plurality of organisms in an environmental
sample.
9. The system of claim 1, wherein the microarray is configured to
simultaneously detect a plurality of organisms in a clinical
sample.
10. The system of claim 9, wherein the clinical sample comprises at
least one of tissue, skin, bodily fluid, or blood.
11. The system of claim 9, wherein the clinical sample is a lung
sample, a gut sample, an ear sample, a nose sample, a throat
sample, or a digestive system sample.
12. The system of claim 11, wherein the clinical sample is a gut
sample.
13. The system of claim 1, wherein all demarcated bacterial and
archaeal orders are represented by the plurality of probes.
14. The system of claim 1, wherein the computer-readable code
further provides instructions for quantifying rRNA molecules
present in said sample based on the hybridization signal
intensities.
15. The system of claim 1, wherein the first probe set or the
second probe set comprises between 2 to 200 different nucleic acid
probes.
16. The system of claim 1, wherein the first probe set and the
second probe set each comprise 11 or more nucleic acid probes.
17. The system of claim 5, wherein the instructions for calculating
the first and second hybridization scores comprise instructions for
determining a positive fraction representing the fraction of probe
pairs assigned to an OTU that are positive, wherein (i) a probe
pair consists of a mismatch probe and the nucleic acid probe to
which it corresponds, and (ii) a probe pair is scored as positive
based on signal intensities of the probes in the probe pair and
signal noise of the array.
18. The system of claim 17, wherein the threshold value is a
positive fraction of 92%.
19. The system of claim 1, wherein each of the first and second
OTUs consists of sequences having up to 3% sequence divergence.
20. The system of claim 1, wherein each probe in the plurality of
probes is between 20 to 30 nucleotides in length.
21. An array system comprising: (a) a microarray having a plurality
of probes comprising; (i) a first probe set comprising a plurality
of different first nucleic acid probes present in a first
operational taxon unit (OTU), wherein each of the first nucleic
acid probes are complementary to a nucleic acid sequence that is
present in more than one operational taxon unit (OTU) but
collectively are present only in a first OTU; and (ii) a second
probe set for detecting a second OTU and consisting of second
nucleic acid probes that are complementary to nucleic acid
sequences present in the first OTU and the second OTU, wherein the
second OTU is different from the first OTU; and (b) a computer
system comprising instructions for determining the presence of the
second OTU based on hybridization signal intensities from the
plurality of probes by: (i) calculating a first hybridization score
for the first OTU based on signal intensities of the first probe
set; (ii) calculating a second hybridization score for the second
OTU based on signal intensities of the second probe set; and (iii)
determining the presence of the second OTU and the absence of the
first OTU when the second hybridization score is above a threshold
value and the first hybridization score is below the threshold
value.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/298081, filed Jun. 6, 2014, which is a
continatuion of U.S. patent application Ser. No. 12/474,204, filed
May 28, 2009, now issued as U.S. Pat. No. 8,771,940, which is in
turn a continuation of, and claims the benefit of priority to, PCT
Application No. PCT/US2007/024720, filed Nov. 29, 2007, which was
written in English, published in English as WO/2008/130394 and
designated the United States of America, which claims priority
under 35 U.S.C. .sctn.119(e) to U.S. Provisional Application No.
60/861,834 filed Nov.30, 2006, both of which are hereby
incorporated by reference in their entirety.
REFERENCE TO SEQUENCE LISTING
[0003] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled SEQLIST.TXT, which is 5.51 KB in size. The
information in the electronic format of the Sequence Listing is
incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
[0004] 1. Field of the Invention
[0005] The present embodiments relate to an array system for
detecting and identifying biomolecules and organisms. More
specifically, the present embodiments relate to an array system
comprising a microarray configured to simultaneously detect a
plurality of organisms in a sample at a high confidence level.
[0006] 2. Description of the Related Art
[0007] In the fields of molecular biology and biochemistry,
biopolymers such as nucleic acids and proteins from organisms are
identified and/or fractionated in order to search for useful genes,
diagnose diseases or identify organisms. A hybridization reaction
is frequently used as a pretreatment for such process, where a
target molecule in a sample is hybridized with a nucleic acid or a
protein having a known sequence. For this purpose, microarrays, or
DNA chips, are used on which probes such as DNAs, RNAs or proteins
with known sequences are immobilized at predetermined
positions.
[0008] A DNA microarray (also commonly known as gene or genome
chip, DNA chip, or gene array) is a collection of microscopic DNA
spots attached to a solid surface, such as glass, plastic or
silicon chip forming an array. The affixed DNA segments are known
as probes (although some sources will use different nomenclature),
thousands of which can be used in a single DNA microarray.
Measuring gene expression using microarrays is relevant to many
areas of biology and medicine, such as studying treatments,
disease, and developmental stages. For example, microarrays can be
used to identify disease genes by comparing gene expression in
diseased and normal cells.
[0009] Molecular approaches designed to describe organism diversity
routinely rely upon classifying heterogeneous nucleic acids
amplified by universal 16S RNA gene PCR (polymerase chain
reaction). The resulting mixed amplicons can be quickly, but
coarsely, typed into anonymous groups using T-/RFLP (Terminal
Restriction Fragment Length Polymorphism), SSCP (single-strand
conformation polymorphism) or T/DGGE (temperature/denaturing
gradient gel. electrophoresis). These groups may be classified
through sequencing, but this requires additional labor to
physically isolate each 16S RNA type, does not scale well for large
comparative studies such as environmental monitoring, and is only
suitable for low complexity environments. Also, the number of
clones that would be required to adequately catalogue the majority
of taxa in a sample is too large to be efficiently or economically
handled. As such, an improved array and method is needed to
efficiently analyze a plurality of organisms without the
disadvantages of the above technologies.
SUMMARY OF THE INVENTION
[0010] Some embodiments relate to an array system including a
microarray configured to simultaneously detect a plurality of
organisms in a sample, wherein the microarray comprises fragments
of 16s RNA unique to each organism and variants of said fragments
comprising at least 1 nucleotide mismatch, wherein the level of
confidence of species-specific detection derived from fragment
matches is about 90% or higher.
[0011] In one aspect, the plurality of organisms comprise bacteria
or archaea.
[0012] In another aspect, the fragments of 16s RNA are clustered
and aligned into groups of similar sequence such that detection of
an organism based on at least 11 fragment matches is possible.
[0013] In yet another aspect, the level of confidence of
species-specific detection derived from fragment matches is about
95% or higher.
[0014] In still another aspect, the level of confidence of
species-specific detection derived from fragment matches is about
98% or higher.
[0015] In some embodiments, the majority of fragments of 16s RNA
unique to each organism have a corresponding variant fragment
comprising at least 1 nucleotide mismatch.
[0016] In some aspects, every fragment of 16s RNA unique to each
organism has a corresponding variant fragment comprising at least 1
nucleotide mismatch.
[0017] In other aspects, the fragments are about 25 nucleotides
long.
[0018] In some aspects, the sample is an environmental sample.
[0019] In other aspects, the environmental sample comprises at
least one of soil, water or atmosphere.
[0020] In yet other aspects, the sample is a clinical sample.
[0021] In still other aspects, the clinical sample comprises at
least one of tissue, skin, bodily fluid or blood.
[0022] Some embodiments relate to a method of detecting an organism
including applying a sample comprising a plurality of organisms to
the array system which includes a microarray that comprises
fragments of 16s RNA unique to each organism and variants of said
fragments comprising at least 1 nucleotide mismatch, wherein the
level of confidence of species-specific detection derived from
fragment matches is about 90% or higher; and identifying organisms
in the sample.
[0023] In some aspects, the plurality of organisms comprise
bacteria or archaea.
[0024] In other aspects, the majority of fragments of 16s RNA
unique to each organism have a corresponding variant fragment
comprising at least 1 nucleotide mismatch.
[0025] In still other aspects, every fragment of 16s RNA unique to
each organism has a corresponding variant fragment comprising at
least 1 nucleotide mismatch.
[0026] In yet other aspects, the fragments are about 25 nucleotides
long.
[0027] In some aspects, the organism to be detected is the most
metabolically active organism in the sample.
[0028] Some embodiments relate to a method of fabricating an array
system including identifying 16s RNA sequences corresponding to a
plurality of organisms of interest; selecting fragments of 16s RNA
unique to each organism; creating variant RNA fragments
corresponding to the fragments of 16s RNA unique to each organism
which comprise at least 1 nucleotide mismatch; and fabricating said
array system.
[0029] In some aspects, the plurality of organisms comprise
bacteria or archaea.
[0030] In other aspects, the majority of fragments of 16s RNA
unique to each organism have a corresponding variant fragment
comprising at least 1 nucleotide mismatch.
[0031] In still other aspects, every fragment of 16s RNA unique to
each organism has a corresponding variant fragment comprising at
least 1 nucleotide mismatch.
[0032] In yet other aspects, the fragments are about 25 nucleotides
long.
BRIEF DESCRIPTION OF THE DRAWINGS
[0033] FIG. 1 is a bar graph showing rank-abundance curve of
phylotypes within the urban aerosol clone library obtained from San
Antonio calendar week 29. Phylotypes were determined by clustering
at 99% homology using nearest neighbor joining
[0034] FIG. 2 is a line graph showing that Chao1 and ACE richness
estimators are non-asymptotic, indicating an under-estimation of
predicted richness based on numbers of clones sequenced.
[0035] FIG. 3 is a graph showing a Latin square assessment of 16S
rRNA gene sequence quantitation by microarray.
[0036] FIG. 4 is a graph showing comparison of real-time PCR and
array monitoring of Pseudomonas oleovorans density in aerosol
samples from San Antonio. Corrected Array Hybridization Score is
the ln(intensity) normalized by internal spikes as described under
Normalization.
DETAILED DESCRIPTION
[0037] The present embodiments are related to an array system for
detecting and identifying biomolecules and organisms. More
specifically, the present embodiments relate to an array system
comprising a microarray configured to simultaneously detect a
plurality of organisms in a sample at a high confidence level.
[0038] In some embodiments, the array system uses multiple probes
for increasing confidence of identification of a particular
organism using a 16S rRNA gene targeted high density microarray.
The use of multiple probes can greatly increase the confidence
level of a match to a particular organism. Also, in some
embodiments, mismatch control probes corresponding to each perfect
match probe can be used to further increase confidence of
sequence-specific hybridization of a target to a probe. Probes with
one or more mismatch can be used to indicate non-specific binding
and a possible non-match. This has the advantage of reducing false
positive results due to non-specific hybridization, which is a
significant problem with many current microarrays.
[0039] Some embodiments of the invention relate to a method of
using an array to simultaneously identify multiple prokaryotic taxa
with a relatively high confidence. A taxa is an individual
microbial species or group of highly related species that share an
average of about 97% 16S rRNA gene sequence identity. The array
system of the current embodiments may use multiple confirmatory
probes, each with from about 1 to about 20 corresponding mismatch
control probes to target the most unique regions within a 16S rRNA
gene for about 9000 taxa. Preferably, each confirmatory probe has
from about 1 to about 10 corresponding mismatch probes. More
preferably, each confirmatory probe has from about 1 to about 5
corresponding mismatch probes. The aforementioned about 9000 taxa
represent a majority of the taxa that are currently known through
16S rRNA clone sequence libraries. In some embodiments, multiple
targets can be assayed through a high-density oligonucleotide
array. The sum of all target hybridizations is used to identify
specific prokaryotic taxa. The result is a much more efficient and
less time consuming way of identifying unknown organisms that in
addition to providing results that could not previously be
achieved, can also provide results in hours that other methods
would require days to achieve.
[0040] In some embodiments, the array system of the present
embodiments can be fabricated using 16s rRNA sequences as follows.
From about 1 to about 500 short probes can be designed for each
taxonomic group. In some embodiments, the probes can be proteins,
antibodies, tissue samples or oligonucleotide fragments. In certain
examples, oligonucleotide fragments are used as probes. In some
embodiments, from about 1 to about 500 short oligonucleotide
probes, preferably from about 2 to about 200 short oligonucleotide
probes, more preferably from about 5 to about 150 short
oligonucleotide probes, even more preferably from about 8 to about
100 short oligonucleotide probes can be designed for each taxonomic
grouping, allowing for the failure of one or more probes. In one
example, at least about 11 short oligonucleotide probes are used
for each taxonomic group. The oligonucleotide probes can each be
from about 5 by to about 100 bp, preferably from about 10 by to
about 50 bp, more preferably from about 15 by to about 35 bp, even
more preferably from about 20 by to about 30 bp. In some
embodiments, the probes may be 5-mers, 6-mers, 7-mers, 8-mers,
9-mers, 10-mers, 11-mers, 12-mers, 13-mers, 14-mers, 15-mers,
16-mers, 17-mers, 18-mers, 19-mers, 20-mers, 21-mers, 22-mers,
23-mers, 24-mers, 25-mers, 26-mers, 27-mers, 28-mers, 29-mers,
30-mers, 31-mers, 32-mers, 33-mers, 34-mers, 35-mers, 36-mers,
37-mers, 38-mers, 39-mers, 40-mers, 41-mers, 42-mers, 43-mers,
44-mers, 45-mers, 46-mers, 47-mers, 48-mers, 49-mers, 50-mers,
51-mers, 52-mers, 53-mers, 54-mers, 55-mers, 56-mers, 57-mers,
58-mers, 59-mers, 60-mers, 61-mers, 62-mers, 63-mers, 64-mers,
65-mers, 66-mers, 67-mers, 68-mers, 69-mers, 70-mers, 71-mers,
72-mers, 73-mers, 74-mers, 75-mers, 76-mers, 77-mers, 78-mers,
79-mers, 80-mers, 81-mers, 82-mers, 83-mers, 84-mers, 85-mers,
86-mers, 87-mers, 88-mers, 89-mers, 90-mers, 91-mers, 92-mers,
93-mers, 94-mers, 95-mers, 96-mers, 97-mers, 98-mers, 99-mers,
100-mers or combinations thereof.
[0041] Non-specific cross hybridization can be an issue when an
abundant 16S rRNA gene shares sufficient sequence similarity to
non-targeted probes, such that a weak but detectable signal is
obtained. The use of sets of perfect match and mismatch probes
(PM-MM) effectively minimizes the influence of cross-hybridization.
In certain embodiments, each perfect match probe (PM) has one
corresponding mismatch probe (MM) to form a pair that is useful for
analyzing a particular 16S rRNA sequence. In other embodiments,
each PM has more than one corresponding MM. Additionally, different
PMs can have different numbers of corresponding MM probes. In some
embodiments, each PM has from about 1 to about 20 MM, preferably,
each PM has from about 1 to about 10 MM and more preferably, each
PM has from about 1 to about 5 MM.
[0042] Any of the nucleotide bases can be replaced in the MM probe
to result in a probe having a mismatch. In one example, the central
nucleotide base sequence can be replaced with any of the three
non-matching bases. In other examples, more than one nucleotide
base in the MM is replaced with a non-matching base. In some
examples, 10 nucleotides are replaced in the MM, in other examples,
5 nucleotides are replaced in the MM, in yet other examples 3
nucleotides are replaced in the MM, and in still other examples, 2
nucleotides are replaced in the MM. This is done so that the
increased hybridization intensity signal of the PM over the one or
more MM indicates a sequence-specific, positive hybridization. By
requiring multiple PM-MM probes to have a confirmation interaction,
the chance that the hybridization signal is due to a predicted
target sequence is substantially increased.
[0043] In other embodiments, the 16S rRNA gene sequences can be
grouped into distinct taxa such that a set of the short
oligonucleotide probes that are specific to the taxon can be
chosen. In some examples, the 16s rRNA gene sequences grouped into
distinct taxa are from about 100 by to about 1000 bp, preferably
the gene sequences are from about 400 by to about 900 bp, more
preferably from about 500 by to about 800 bp. The resulting about
9000 taxa represented on the array, each containing from about 1%
to about 5% sequence divergence, preferably about 3% sequence
divergence, can represent substantially all demarcated bacterial
and archaeal orders.
[0044] In some embodiments, for a majority of the taxa represented
on the array, probes can be designed from regions of gene sequences
that have only been identified within a given taxon. In other
embodiments, some taxa have no probe-level sequence that can be
identified that is not shared with other groups of 16S rRNA gene
sequences. For these taxonomic groupings, a set of from about 1 to
about 500 short oligonucleotide probes, preferably from about 2 to
about 200 short oligonucleotide probes, more preferably from about
5 to about 150 short oligonucleotide probes, even more preferably
from about 8 to about 100 short oligonucleotide probes can be
designed to a combination of regions on the 16S rRNA gene that
taken together as a whole do not exist in any other taxa. For the
remaining taxa, a set of probes can be selected to minimize the
number of putative cross-reactive taxa. For all three probe set
groupings, the advantage of the hybridization approach is that
multiple taxa can be identified simultaneously by targeting unique
regions or combinations of sequence.
[0045] In some embodiments, oligonucleotide probes can then be
selected to obtain an effective set of probes capable of correctly
identifying the sample of interest. In certain embodiments, the
probes are chosen based on various taxonomic organizations useful
in the identification of particular sets of organisms.
[0046] In some embodiments, the chosen oligonucleotide probes can
then be synthesized by any available method in the art. Some
examples of suitable methods include printing with fine-pointed
pins onto glass slides, photolithography using pre-made masks,
photolithography using dynamic micromirror devices, ink jet
printing or electrochemistry. In one example, a photolithographic
method can be used to directly synthesize the chosen
oligonucleotide probes onto a surface. Suitable examples for the
surface include glass, plastic, silicon and any other surface
available in the art. In certain examples, the oligonucleotide
probes can be synthesized on a glass surface at an approximate
density of from about 1,000 probes per .mu.m.sup.2 to about 100,000
probes per .mu.m.sup.2, preferably from about 2000 probes per
.mu.m.sup.2 to about 50,000 probes per .mu.m.sup.2, more preferably
from about 5000 probes per .mu.m.sup.2 to about 20,000 probes per
.mu.m.sup.2. In one example, the density of the probes is about
10,000 probes per .mu.m.sup.2. The array can then be arranged in
any configuration, such as, for example, a square grid of rows and
columns. Some areas of the array can be oligonucleotide 16S rDNA PM
or MM probes, and others can be used for image orientation,
normalization controls or other analyses. In some embodiments,
materials for fabricating the array can be obtained from
Affymetrix, GE Healthcare (Little Chalfont, Buckinghamshire, United
Kingdom) or Agilent Technologies (Palo Alto, Calif.)
[0047] In some embodiments, the array system is configured to have
controls. Some examples of such controls include 1) probes that
target amplicons of prokaryotic metabolic genes spiked into the 16S
rDNA amplicon mix in defined quantities just prior to fragmentation
and 2) probes complimentary to a pre-labeled oligonucleotide added
into the hybridization mix. The first control collectively tests
the fragmentation, biotinylation, hybridization, staining and
scanning efficiency of the array system. It also allows the overall
fluorescent intensity to be normalized across all the arrays in an
experiment. The second control directly assays the hybridization,
staining and scanning of the array system. However, the array
system of the present embodiments is not limited to these
particular examples of possible controls.
[0048] The accuracy of the array of some embodiments has been
validated by comparing the results of some arrays with 16S rRNA
gene sequences from approximately 700 clones in each of 3 samples.
A specific taxa is identified as being present in a sample if a
majority (from about 70% to about 100%, preferably from about 80%
to about 100% and more preferably from about 90% to about 100%) of
the probes on the array have a hybridization signal about 100
times, 200 times, 300 times, 400 times or 500 times greater than
that of the background and the perfect match probe has a
significantly greater hybridization signal than its one or more
partner mismatch control probe or probes. This ensures a higher
probability of a sequence specific hybridization to the probe. In
some embodiments, the use of multiple probes, each independently
indicating that the target sequence of the taxonomic group being
identified is present, increases the probability of a correct
identification of the organism of interest.
[0049] Biomolecules, such proteins, DNA, RNA, DNA from amplified
products and native rRNA from the 16S rRNA gene, for example can be
probed by the array of the present embodiments. In some
embodiments, probes are designed to be antisense to the native rRNA
so that directly labeled rRNA from samples can be placed directly
on the array to identify a majority of the actively metabolizing
organisms in a sample with no bias from PCR amplification. Actively
metabolizing organisms have significantly higher numbers of
ribosomes used for the production of proteins, therefore, in some
embodiments, the capacity to make proteins at a particular point in
time of a certain organism can be measured. This is not possible in
systems where only the 16S rRNA gene DNA is measured which encodes
only the potential to make proteins and is the same whether an
organism is actively metabolizing or quiescent or dead. In this
way, the array system of the present embodiments can directly
identify the metabolizing organisms within diverse communities.
[0050] In some embodiments, the array system is able to measure the
microbial diversity of complex communities without PCR
amplification, and consequently, without all of the inherent biases
associated with PCR amplification. Actively metabolizing cells
typically have about 20,000 or more ribosomal copies within their
cell for protein assembly compared to quiescent or dead cells that
have few. In some embodiments, rRNA can be purified directly from
environmental samples and processed with no amplification step,
thereby avoiding any of the biases caused by the preferential
amplification of some sequences over others. Thus, in some
embodiments the signal from the array system can reflect the true
number of rRNA molecules that are present in the samples, which can
be expressed as the number of cells multiplied by the number of
rRNA copies within each cell. The number of cells in a sample can
then be inferred by several different methods, such as, for
example, quantitative real-time PCR, or FISH (fluorescence in situ
hybridization.) Then the average number of ribosomes within each
cell may be calculated.
[0051] In some embodiments, the samples used can be environmental
samples from any environmental source, for example, naturally
occurring or artificial atmosphere, water systems, soil or any
other sample of interest. In some embodiments, the environmental
samples may be obtained from, for example, atmospheric pathogen
collection systems, sub-surface sediments, groundwater, ancient
water deep within the ground, plant root-soil interface of
grassland, coastal water and sewage treatment plants. Because of
the ability of the array system to simultaneously test for such a
broad range of organisms based on almost all known 16s rRNA gene
sequences, the array system of the present embodiments can be used
in any environment, which also distinguishes it from other array
systems which generally must be targeted to specific
environments.
[0052] In other embodiments, the sample used with the array system
can be any kind of clinical or medical sample. For example, samples
from blood, the lungs or the gut of mammals may be assayed using
the array system. Also, the array system of the present embodiments
can be used to identify an infection in the blood of an animal. The
array system of the present embodiments can also be used to assay
medical samples that are directly or indirectly exposed to the
outside of the body, such as the lungs, ear, nose, throat, the
entirety of the digestive system or the skin of an animal.
Hospitals currently lack the resources to identify the complex
microbial communities that reside in these areas.
[0053] Another advantage of the present embodiments is that
simultaneous detection of a majority of currently known organisms
is possible with one sample. This allows for much more efficient
study and determination of particular organisms within a particular
sample. Current microarrays do not have this capability. Also, with
the array system of the present embodiments, simultaneous detection
of the top metabolizing organisms within a sample can be determined
without bias from PCR amplification, greatly increasing the
efficiency and accuracy of the detection process.
[0054] Some embodiments relate to methods of detecting an organism
in a sample using the described array system. These methods include
contacting a sample with one organism or a plurality of organisms
to the array system of the present embodiments and detecting the
organism or organisms. In some embodiments, the organism or
organisms to be detected are bacteria or archaea. In some
embodiments, the organism or organisms to be detected are the most
metabolically active organism or organisms in the sample.
[0055] Some embodiments relate to a method of fabricating an array
system including identifying 16s RNA sequences corresponding to a
plurality of organisms of interest, selecting fragments of 16s RNA
unique to each organism and creating variant RNA fragments
corresponding to the fragments of 16s RNA unique to each organism
which comprise at least 1 nucleotide mismatch and then fabricating
the array system.
[0056] The following examples are provided for illustrative
purposes only, and are in no way intended to limit the scope of the
present invention.
EXAMPLE 1
[0057] An array system was fabricated using 16s rRNA sequences
taken from a plurality of bacterial species. A minimum of 11
different, short oligonucleotide probes were designed for each
taxonomic grouping, allowing one or more probes to not bind, but
still give a positive signal in the assay. Non-specific cross
hybridization is an issue when an abundant 16S rRNA gene shares
sufficient sequence similarity to non-targeted probes, such that a
weak but detectable signal is obtained. The use of a perfect
match-mismatch (PM-MM) probe pair effectively minimized the
influence of cross-hybridization. In this technique, the central
nucleotide is replaced with any of the three non-matching bases so
that the increased hybridization intensity signal of the PM over
the paired MM indicates a sequence-specific, positive
hybridization. By requiring multiple PM-MM probe-pairs to have a
positive interaction, the chance that the hybridization signal is
due to a predicted target sequence is substantially increased.
[0058] The known 16S rRNA gene sequences larger than 600 by were
grouped into distinct taxa such that a set of at least 11 probes
that were specific to each taxon could be selected. The resulting
8,935 taxa (8,741 of which are represented on the array), each
containing approximately 3% sequence divergence, represented all
121 demarcated bacterial and archaeal orders. For a majority of the
taxa represented on the array (5,737, 65%), probes were designed
from regions of 16S rRNA gene sequences that have only been
identified within a given taxon. For 1,198 taxa (14%) no
probe-level sequence could be identified that was not shared with
other groups of 16S rRNA gene sequences, although the gene sequence
as a whole was distinctive. For these taxonomic groupings, a set of
at least 11 probes was designed to a combination of regions on the
16S rRNA gene that taken together as a whole did not exist in any
other taxa. For the remaining 1,806 taxa (21%), a set of probes
were selected to minimize the number of putative cross-reactive
taxa. Although more than half of the probes in this group have a
hybridization potential to one outside sequence, this sequence was
typically from a phylogenetically similar taxon. For all three
probe set groupings, the advantage of the hybridization approach is
that multiple taxa can be identified simultaneously by targeting
unique regions or combinations of sequence.
EXAMPLE 2
[0059] An array system was fabricated according to the following
protocol. 16S rDNA sequences (Escherichia coli base pair positions
47 to 1473) were obtained from over 30,000 16S rDNA sequences that
were at least 600 nucleotides in length in the 15 Mar. 2002 release
of the 16S rDNA database, "Greengenes." This region was selected
because it is bounded on both ends by universally conserved
segments that can be used as PCR priming sites to amplify bacterial
or archaeal genomic material using only 2 to 4 primers. Putative
chimeric sequences were filtered from the data set using computer
software preventing them from being misconstrued as novel
organisms. The filtered sequences are considered to be the set of
putative 16S rDNA amplicons. Sequences were clustered to enable
each sequence of a cluster to be complementary to a set of
perfectly matching (PM) probes. Putative amplicons were placed in
the same cluster as a result of common 17-mers found in the
sequence.
[0060] The resulting 8,988 clusters, each containing approximately
3% sequence divergence, were considered operational taxonomic units
(OTUs) representing all 121 demarcated prokaryotic orders. The
taxonomic family of each OTU was assigned according to the
placement of its member organisms in Bergey's Taxonomic Outline.
The taxonomic outline as maintained by Philip Hugenholtz was
consulted for phylogenetic classes containing uncultured
environmental organisms or unclassified families belonging to named
higher taxa. The OTUs comprising each family were clustered into
sub-families by transitive sequence identity. Altogether, 842
sub-families were found. The taxonomic position of each OTU as well
as the accompanying NCBI accession numbers of the sequences
composing each OTU are recorded and publicly available.
[0061] The objective of the probe selection strategy was to obtain
an effective set of probes capable of correctly categorizing mixed
amplicons into their proper OTU. For each OTU, a set of 11 or more
specific 25-mers (probes) were sought that were prevalent in
members of a given OTU but were dissimilar from sequences outside
the given OTU. In the first step of probe selection for a
particular OTU, each of the sequences in the OTU was separated into
overlapping 25-mers, the potential targets. Then each potential
target was matched to as many sequences of the OTU as possible.
First, a text pattern was used for a search to match potential
targets and sequences, however, since partial gene sequences were
included in the reference set additional methods were performed.
Therefore, the multiple sequence alignment provided by Greengenes
was used to provide a discrete measurement of group size at each
potential probe site. For example, if an OTU containing seven
sequences possessed a probe site where one member was missing data,
then the site-specific OTU size was only six.
[0062] In ranking the possible targets, those having data for all
members of that OTU were preferred over those found only in a
fraction of the OTU members. In the second step, a subset of the
prevalent targets was selected and reverse complimented into probe
orientation, avoiding those capable of mis-hybridization to an
unintended amplicon. Probes presumed to have the capacity to
mis-hybridize were those 25-mers that contained a central 17-mer
matching sequences in more than one OTU. Thus, probes that were
unique to an OTU solely due to a distinctive base in one of the
outer four bases were avoided. Also, probes with mis-hybridization
potential to sequences having a common tree node near the root were
favored over those with a common node near the terminal branch.
[0063] Probes complementary to target sequences that were selected
for fabrication were termed perfectly matching (PM) probes. As each
PM probe was chosen, it was paired with a control 25-mer
(mismatching probe, MM), identical in all positions except the
thirteenth base. The MM probe did not contain a central 17-mer
complimentary to sequences in any OTU. The probe complementing the
target (PM) and MM probes constitute a probe pair analyzed
together.
[0064] The chosen oligonucleotides were synthesized by a
photolithographic method at Affymetrix Inc. (Santa Clara, Calif.,
USA) directly onto a 1.28 cm by 1.28 cm glass surface at an
approximate density of 10,000 probes per .mu.m.sup.2. Each unique
probe sequence on the array had a copy number of roughly
3.2.times.10.sup.6 (personal communication, Affymetrix). The entire
array of 506,944 features was arranged as a square grid of 712 rows
and columns. Of these features, 297,851 were oligonucleotide 16S
rDNA PM or MM probes, and the remaining were used for image
orientation, normalization controls or other unrelated analyses.
Each DNA chip had two kinds of controls on it: 1) probes that
target amplicons of prokaryotic metabolic genes spiked into the 16S
rDNA amplicon mix in defined quantities just prior to fragmentation
and 2) probes complimentary to a pre-labeled oligonucleotide added
into the hybridization mix. The first control collectively tested
the fragmentation, biotinylation, hybridization, staining and
scanning efficiency. It also allowed the overall fluorescent
intensity to be normalized across all the arrays in an experiment.
The second control directly assayed the hybridization, staining and
scanning.
EXAMPLE 3
[0065] A study was done on diverse and dynamic bacterial population
in urban aerosols utilizing an array system of certain embodiments.
Air samples were collected using an air filtration collection
system under vacuum located within six EPA air quality network
sites in both San Antonio and Austin, Texas. Approximately 10
liters of air per minute were collected in a polyethylene
terephthalate (Celanex), 1.0 .mu.m filter (Hoechst Calanese).
Samples were collected daily over a 24 h period. Sample filters
were washed in 10 mL buffer (0.1M Sodium Phosphate, 10 mM EDTA, pH
7.4, 0.01% Tween-20), and the suspension was stored frozen until
extracted. Samples were collected from 4 May to 29 Aug. 2003.
[0066] Sample dates were divided according to a 52-week calendar
year starting Jan. 1, 2003, with each Monday to Sunday cycle
constituting a full week. Samples from four randomly chosen days
within each sample week were extracted. Each date chosen for
extraction consisted of 0.6 mL filter wash from each of the six
sampling sites for that city (San Antonio or Austin) combined into
a "day pool" before extraction. In total, for each week, 24 filters
were sampled.
[0067] The "day pools" were centrifuged at 16,000.times.g for 25
min and the pellets were resuspended in 4004 sodium phosphate
buffer (100 mM, pH 8). The resuspended pellets were transferred
into 2 mL silica bead lysis tubes containing 0.9 g of
silica/zirconia lysis bead mix (0.3 g of 0.5 mm zirconia/silica
beads and 0.6 g of 0.1 mm zirconia/silica beads). For each lysis
tube, 300 .mu.L buffered sodium dodecyl sulfate (SDS) (100 mM
sodium chloride, 500 mM Tris pH 8, 10% [w/v] SDS), and 300 .mu.L
phenol:chloroform:isoamyl alcohol (25:24:1) were added. Lysis tubes
were inverted and flicked three times to mix buffers before bead
mill homogenization with a Bio101 Fast Prep 120 machine (Qbiogene,
Carlsbad, Calif.) at 6.5 m s.sup.-1 for 45 s. Following
centrifugation at 16,000.times.g for 5 min, the aqueous supernatant
was removed to a new 2 mL tube and kept at -20.degree. C. for 1
hour to overnight. An equal volume of chloroform was added to the
thawed supernatant prior to vortexing for 5 s and centrifugation at
16,000.times.g for 3 min. The supernatant was then combined with
two volumes of a binding buffer "Solution 3" (UltraClean Soil DNA
kit, MoBio Laboratories, Solana Beach, Calif.). Genomic DNA from
the mixture was isolated on a MoBio spin column, washed with
"Solution 4" and eluted in 60 .mu.L of 1.times. Tris-EDTA according
to the manufacturer's instructions. The DNA was further purified by
passage through a Sephacryl S-200 HR spin column (Amersham,
Piscataway, N.J., USA) and stored at 4.degree. C. prior to PCR
amplification. DNA was quantified using a PicoGreen fluorescence
assay according to the manufacturer's recommended protocol
(Invitrogen, Carlsbad, Calif.).
[0068] The 16S rRNA gene was amplified from the DNA extract using
universal primers 27F.1, (5' AGRGTTTGATCMTGGCTCAG) (SEQ ID NO: 1)
and 1492R, (5' GGTTACCTTGTTACGACTT) (SEQ ID NO: 2). Each PCR
reaction mix contained 1.times. Ex Taq buffer (Takara Bio Inc,
Japan), 0.8 mM dNTP mixture, 0.02U/.mu.L Ex Taq polymerase, 0.4
mg/mL bovine serum albumin (BSA), and 1.0 .mu.M each primer. PCR
conditions were 1 cycle of 3 min at 95.degree. C., followed by 35
cycles of 30 sec at 95.degree. C., 30 sec at 53.degree. C., and 1
min at 72.degree. C., and finishing with 7 min incubation at
72.degree. C. When the total mass of PCR product for a sample week
reached 2 .mu.g (by gel quantification), all PCR reactions for that
week were pooled and concentrated to a volume less than 40 .mu.L
with a Micron YM100 spin filter (Millipore, Billerica, Mass.) for
microarray analysis.
[0069] The pooled PCR product was spiked with known concentrations
of syntheticl6S rRNA gene fragments and non-16S rRNA gene fragments
according to Table S1. This mix was fragmented using DNAse I (0.02
U/.mu.g DNA, Invitrogen, Calif.) and One-Phor-All buffer (Amersham,
N.J.) per Affymetrix's protocol, with incubation at 25.degree. C.
for 10 min., followed by enzyme denaturation at 98.degree. C. for
10 min. Biotin labeling was performed using an Enzo.RTM.
BioArray.TM. Terminal Labeling Kit (Enzo Life Sciences Inc.,
Farmingdale, N.Y.) per the manufacturer's directions. The labeled
DNA was then denatured (99.degree. C. for 5 min) and hybridized to
the DNA microarray at 48.degree. C. overnight (>16 hr). The
microarrays were washed and stained per the Affymetrix
protocol.
[0070] The array was scanned using a GeneArray Scanner (Affymetrix,
Santa Clara, Calif., USA). The scan was recorded as a pixel image
and analyzed using standard Affymetrix software (Microarray
Analysis Suite, version 5.1) that reduced the data to an individual
signal value for each probe. Background probes were identified as
those producing intensities in the lowest 2% of all intensities.
The average intensity of the background probes was subtracted from
the fluorescence intensity of all probes. The noise value (N) was
the variation in pixel intensity signals observed by the scanner as
it read the array surface. The standard deviation of the pixel
intensities within each of the identified background cells was
divided by the square root of the number of pixels comprising that
cell. The average of the resulting quotients was used for N in the
calculations described below.
[0071] Probe pairs scored as positive were those that met two
criteria: (i) the intensity of fluorescence from the perfectly
matched probe (PM) was greater than 1.3 times the intensity from
the mismatched control (MM), and (ii) the difference in intensity,
PM minus MM, was at least 130 times greater than the squared noise
value (>130 N.sup.2). These two criteria were chosen empirically
to provide stringency while maintaining sensitivity to the
amplicons known to be present from sequencing results of cloning
the San Antonio week 29 sample. The positive fraction (PosFrac) was
calculated for each probe set as the number of positive probe pairs
divided by the total number of probe pairs in a probe set. A taxon
was considered present in the sample when over 92% of its assigned
probe pairs for its corresponding probe set were positive
(PosFrac>0.92). This was determined based on empirical data from
clone library analyses. Hybridization intensity (hereafter referred
to as intensity) was calculated in arbitrary units (a.u.) for each
probe set as the trimmed average (maximum and minimum values
removed before averaging) of the PM minus MM intensity differences
across the probe pairs in a given probe set. All intensities <1
were shifted to 1 to avoid errors in subsequent logarithmic
transformations. When summarizing chip results to the sub-family,
the probe set producing the highest intensity was used.
[0072] To compare the diversity of bacteria detected with
microarrays to a known standard, one sample week was chosen for
cloning and sequencing and for replicate microarray analysis. One
large pool of SSU amplicons (96 reactions, 50 .mu.L reaction) from
San Antonio week 29 was made. One milliliter of the pooled PCR
product was gel purified and 768 clones were sequenced at the DOE
Joint Genome Institute (Walnut Creek, Calif.) by standard methods.
An aliquot of this pooled PCR product was also hybridized to a
microarray (three replicate arrays performed). Sub-families
containing a taxon scored as present in all three array replicates
were recorded. Individual cloned rRNA genes were sequenced from
each terminus, assembled using Phred and Phrap (S9, S10, S11), and
were required to pass quality tests of Phred 20 (base call error
probability <10.sup.-2.0) to be included in the comparison.
[0073] Sequences that appeared chimeric were removed using
Bellerophon (S2) with two requirements; (1) the preference score
must be less than 1.3 and (2) the divergence ratio must be less
than 1.1. The divergence ratio is a new metric implemented to
weight the likelihood of a sequence being chimeric according to the
similarity of the parent sequences. The more distantly related the
parent sequences are to each other relative to their divergence
from the chimeric sequence, the greater the likelihood that the
inferred chimera is real. This metric uses the average sequence
identity between the two fragments of the candidate and their
corresponding parent sequences as the numerator, and the sequence
identity between the parent sequences as the denominator. All
calculations are made using a 300 base pair window on either side
of the most likely break point. A divergence ratio of 1.1 was
empirically determined to be the threshold for classifying
sequences as putatively chimeric.
[0074] Similarity of clones to array taxa was calculated with
DNADIST (S12) using the DNAML-F84 option assuming a
transition:transversion ratio of 2.0 and an A, C, G, T 16S rRNA
gene base frequency of 0.2537, 0.2317, 0.3167, 0.1979,
respectively. We calculated these parameters empirically from all
records of the `Greengenes` 16S rRNA multiple sequence alignment
over 1,250 nucleotides in length. The Lane mask (S13) was used to
restrict similarity observations to 1,287 conserved columns (lanes)
of aligned characters. Cloned sequences from this study were
rejected from further analysis when <1,000 characters could be
compared to a lane-masked reference sequence. Sequences were
assigned to a taxonomic node using a sliding scale of similarity
threshold (S14). Phylum, class, order, family, sub-family, or taxon
placement was accepted when a clone surpassed similarity thresholds
of 80%, 85%, 90%, 92%, 94%, or 97%, respectively. When similarity
to nearest database sequence was <94%, the clone was considered
to represent a novel sub-family. A full comparison between clone
and array analysis is presented in Table S2.
[0075] Primers targeting sequences within particular
taxa/sub-families were generated by ARB's probe design feature
(S15). Melting temperatures were constrained from 45.degree. C. to
65.degree. C. with G+C content between 40 and 70%. The probes were
chosen to contain 3' bases non-complementary to sequences outside
of the taxon/sub-family. Primers were matched using Primer3 (S16)
to create primer pairs (Table S3). Sequences were generated using
the Takara enzyme system as described above with the necessary
adjustments in annealing temperatures. Amplicons were purified
(PureLink PCR Purification Kit, Invitrogen) and sequenced directly
or, if there were multiple unresolved sequences, cloned using a
TOPO pCR2.1 cloning kit (Invitrogen, Calif.) according to the
manufacturer's instructions. The M13 primer pair was used for
clones to generate insert amplicons for sequencing at UC Berkeley's
sequencing facility.
[0076] To determine whether changes in 16S rRNA gene concentration
could be detected using the array, various quantities of distinct
rRNA gene types were hybridized to the array in rotating
combinations. We chose environmental organisms, organisms involved
in bioremediation, and a pathogen of biodefense relevance. 16S rRNA
genes were amplified from each of the organisms in Table S4. Then
each of these nine distinct 16S rRNA gene standards was tested once
in each concentration category spanning 5 orders of magnitude (0
molecules, 6.times.10.sup.7, 1.44.times.10.sup.8,
3.46.times.10.sup.8, 8.30.times.10.sup.8, 1.99.times.10.sup.9,
4.78.times.10.sup.9, 2.75.times.10.sup.10, 6.61.times.10.sup.10,
1.59.times.10.sup.11) with concentrations of individual 16S rRNA
gene types rotating between arrays such that each array contained
the same total of 16S rRNA gene molecules. This is similar to a
Latin Square design, although with a 9.times.11 format matrix.
[0077] A taxon (#9389) consisting only of two sequences of
Pseudomonas oleovorans that correlated well with environmental
variables was chosen for quantitative PCR confirmation of array
observed quantitative shifts. Primers for this taxon were designed
using the ARB (S 15) probe match function to determine unique
priming sites based upon regions detected by array probes. These
regions were then imputed into Primer3 (S16) in order to choose
optimal oligonucleotide primers for PCR. Primer quality was further
assessed using Beacon Designer v3.0 (Premier BioSoft, CA). Primers
9389F2 (CGACTACCTGGACTGACACT) (SEQ ID NO: 3) and 9389R2
(CACCGGCAGTCTCCTTAGAG) (SEQ ID NO: 4) were chosen to amplify a 436
by fragment.
[0078] To test the specificity of this primer pair, we used a
nested PCR approach. 16S rRNA genes were amplified using universal
primers (27F, 1492R) from pooled aerosol genomic DNA extracts from
both Austin and San Antonio, Tex. These products were purified and
used as template in PCR reactions using primer set 9389F2-9389R2.
Amplicons were then ligated to pCR2.1 and transformed into E.coli
TOP10 cells as recommended by the manufacturer (Invitrogen, CA).
Five clones were chosen at random for each of the two cities (10
clones total) and inserts were amplified using vector specific
primers M13 forward and reverse. Standard Sanger sequencing was
performed and sequences were tested for homology against existing
database entries (NCBI GenBank, RDPII and Greengenes).
[0079] To assay P. oleovorans 16S rRNA gene copies in genomic DNA
extracts, we performed real-time quantitative PCR (qPCR) using an
iCycler iQ real-time detection system (BioRad, CA) with the iQ
Sybr.RTM. Green Supermix (BioRad, CA) kit. Reaction mixtures (final
volume, 25 .mu.l) contained 1.times.iQ Sybr.RTM. Green Supermix,
7.5 pmol of each primer, 25 ug BSA, 0.5 .mu.l DNA extract and
DNase/RNase free water. Following enzyme activation (95.degree. C.,
3 min), up to 50 cycles of 95.degree. C., 30 s; 61.degree. C., 30
s; 85.degree. C., 10 s and 72.degree. C., 45 s were performed. The
specific data acquisition step (85.degree. C. for 10 s) was set
above the Tm of potential primer dimers and below the Tm of the
product to minimize any non-amplicon Sybr Green fluorescence. Copy
number of P. oleovorans 16S rRNA gene molecules was quantified by
comparing cycle thresholds to a standard curve (in the range of
7.6.times.10.degree. to 7.6.times.10.sup.5 copies .mu.l.sup.-1),
run in parallel, using cloned P. oleovorans 16S rRNA amplicons
generated by PCR using primers M13 forward and reverse. Regression
coefficients for the standard curves were typically greater than
0.99, and post amplification melt curve analyses displayed a single
peak at 87.5.degree. C., indicative of specific Pseudomonas
oleovorans 16S rRNA gene amplification (data not shown).
[0080] To account for scanning intensity variation from array to
array, internal standards were added to each experiment. The
internal standards were a set of thirteen amplicons generated from
yeast and bacterial metabolic genes and five synthetic 16S
rRNA-like genes spiked into each aerosol amplicon pool prior to
fragmentation. The known concentrations of the amplicons ranged
from 4 pM to 605 pM in the final hybridization mix. The intensities
resulting from the fifteen corresponding probe sets were natural
log transformed. Adjustment factors for each array were calculated
by fitting the linear model using the least-squares method. An
array's adjustment factor was subtracted from each probe set's
ln(intensity).
[0081] For each day of aerosol sampling, 15 factors including
humidity, wind, temperature, precipitation, pressure, particulate
matter, and week of year were recorded from the U.S. National
Climatic Data Center (http://www.ncdc.noaa.gov) or the Texas
Natural Resource Conservation Commission
(http://www.tceq.state.tx.us). The weekly mean, minimum, maximum,
and range of values were calculated for each factor from the
collected data. The changes in ln(intensity) for each taxon
considered present in the study was tested for correlation against
the environmental conditions. The resulting p-values were adjusted
using the step-up False Discovery Rate (FDR) controlling procedure
(S18).
[0082] Multivariate regression tree analysis (S19, S20) was carried
out using the package `mvpart` within the `R` statistical
programming environment. A Bray-Curtis-based distance matrix was
created using the function `gdist`. The Brady-Curtis measure of
dissimilarity is generally regarded as a good measure of ecological
distance when dealing with `species` abundance as it allows for
non-linear responses to environmental gradients (S19, S21).
[0083] Prior to rarefaction analysis a distance matrix (DNAML
homology) of clone sequences was created using an online tool at
http://greengenes.lbl.gov/cgi-bin/nph-distance_matrix.cgi following
alignment of the sequences using the NAST aligner
(http://greengenes.lbl.gov/NAST) (S22). DOTUR (S23) was used to
generate rarefaction curves, Chao1 and ACE richness predictions and
rank-abundance curves. Nearest neighbor joining was used with 1000
iterations for bootstrapping.
[0084] DNA yields in the pooled weekly filter washes ranged from
0.522 ng to 154 ng. As only an aliquot of the filter washes was
extracted we extrapolate the range of DNA extractable from each
daily filter to be between 150 ng and 4300 ng assuming 10%
extraction efficiency. Using previous estimates of bacterial to
fungal ratios in aerosols (49% bacterial, 44% fungal clones; S24)
this range is equivalent to 1.2.times.10.sup.7 to
3.5.times.10.sup.8 bacterial cells per filter assuming a mean DNA
content of a bacterial cell of 6 fg (S25).
TABLE-US-00001 TABLE S1 Spike in-controls of functional genes and
synthetic 16S rRNA-like genes used for internal array
normalization. Molecules applied Description Affymetrix control
spikes AFFX-BioB-5_at 5.83 .times. 10.sup.10 E. coli biotin
synthetase AFFX-BioB-M_at 5.43 .times. 10.sup.10 E. coli biotin
synthetase AFFX-BioC-5_at 2.26 .times. 10.sup.10 E. coli bioC
protein AFFX-BioC-3_at 1.26 .times. 10.sup.10 E. coli bioC protein
AFFX-BioDn-3_at 1.68 .times. 10.sup.10 E. coli dethiobiotin
synthetase AFFX-CreX-5_at 2.17 .times. 10.sup.9 Bacteriophage P1
cre recombinase protein AFFX-DapX-5_at 9.03 .times. 10.sup.8 B.
subtilis dapB, dihydrodipicolinate reductase AFFX-DapX-M_at 3.03
.times. 10.sup.10 B. subtilis dapB, dihydrodipicolinate reductase
YFL039C 5.02 .times. 10.sup.8 Saccharomyces, Gene for actin (Act1p)
protein YER022W 1.21 .times. 10.sup.9 Saccharomyces, RNA polymerase
II mediator complex subunit (SRB4p) YER148W 2.91 .times. 10.sup.9
Saccharomyces, TATA-binding protein, general transcription factor
(SPT15) YEL002C 7.00 .times. 10.sup.9 Saccharomyces, Beta subunit
of the oligosaccharyl transferase (OST) glycoprotein complex (WBP1)
YEL024W 7.29 .times. 10.sup.10 Saccharomyces,
Ubiquinol-cytochrome-c reductase (RIP1) Synthetic 16S rRNA control
spikes SYNM.neurolyt_st 6.74 .times. 10.sup.8 Synthetic derivative
of Mycoplasma neurolyticum 16S rRNA gene SYNLc.oenos_st 3.90
.times. 10.sup.9 Synthetic derivative of Leuconostoc oenos 16S rRNA
gene SYNCau.cres8_st 9.38 .times. 10.sup.9 Synthetic derivative of
Caulobacter crescentus 16S rRNA gene SYNFer.nodosm_st 4.05 .times.
10.sup.10 Synthetic derivative of Fervidobacterium nodosum 16S rRNA
gene SYNSap.grandi_st 1.62 .times. 10.sup.9 Synthetic derivative of
Saprospira grandis 16S rRNA gene
TABLE-US-00002 TABLE S2 Comparison between clone and array results.
Clone detection DNAML similarity Array number Comparison
detection.sup.1 of Array 3/3 clones Chimera checking.sup.4 Array
and Cloning replicates assigned maximum maximum only Cloning only
pass = 1, to sub- maximum preference divergence pass = 1, pass = 1,
pass = 1, Sub-families fail = 0 family.sup.2 similarity.sup.3
score.sup.5 ratio.sup.6 fail = 0 fail = 0 fail = 0 Bacteria; AD3;
Unclassified; Unclassified; 1 1 0 0 Unclassified; sf_1 Bacteria;
Acidobacteria; Acidobacteria-10; 1 1 0 0 Unclassified;
Unclassified; sf_1 Bacteria; Acidobacteria; Acidobacteria-4; 1 1 0
0 Ellin6075/11-25; Unclassified; sf_1 Bacteria; Acidobacteria;
Acidobacteria-6; 1 1 0 0 Unclassified; Unclassified; sf_1 Bacteria;
Acidobacteria; Acidobacteria; 1 3 0.973 1.16 1.06 0 1 0
Acidobacteriales; Acidobacteriaceae; sf_14 Bacteria; Acidobacteria;
Acidobacteria; 1 1 0 0 Acidobacteriales; Acidobacteriaceae; sf_16
Bacteria; Acidobacteria; Solibacteres; 1 2 0.960 0.00 0.00 0 1 0
Unclassified; Unclassified; sf_1 Bacteria; Actinobacteria;
Actinobacteria; 1 1 0 0 Acidimicrobiales; Acidimicrobiaceae; sf_1
Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Acidimicrobiales;
Microthrixineae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 0 1
0.947 0.00 0.00 0 0 1 Acidimicrobiales; Microthrixineae; sf_12
Bacteria; Actinobacteria; Actinobacteria; 1 1 0.961 1.28 1.06 0 1 0
Acidimicrobiales; Unclassified; sf_1 Bacteria; Actinobacteria;
Actinobacteria; 1 1 0.947 0.00 0.00 0 1 0 Actinomycetales;
Acidothermaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1
0 0 Actinomycetales; Actinomycetaceae; sf_1 Bacteria;
Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales;
Actinosynnemataceae; sf_1 Bacteria; Actinobacteria; Actinobacteria;
1 4 0.998 0.00 0.00 0 1 0 Actinomycetales; Brevibacteriaceae; sf_1
Bacteria; Actinobacteria; Actinobacteria; 1 2 0.981 1.20 1.08 0 1 0
Actinomycetales; Cellulomonadaceae; sf_1 Bacteria; Actinobacteria;
Actinobacteria; 1 1 0 0 Actinomycetales; Corynebacteriaceae; sf_1
Bacteria; Actinobacteria; Actinobacteria; 1 2 0.999 1.21 1.03 0 1 0
Actinomycetales; Dermabacteraceae; sf_1 Bacteria; Actinobacteria;
Actinobacteria; 1 1 0 0 Actinomycetales; Dermatophilaceae; sf_1
Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales;
Dietziaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0
Actinomycetales; Frankiaceae; sf_1 Bacteria; Actinobacteria;
Actinobacteria; 1 2 1.000 0.00 0.00 0 1 0 Actinomycetales;
Geodermatophilaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria;
1 1 0 0 Actinomycetales; Gordoniaceae; sf_1 Bacteria;
Actinobacteria; Actinobacteria; 1 10 0.999 1.20 1.18 0 1 0
Actinomycetales; Intrasporangiaceae; sf_1 Bacteria; Actinobacteria;
Actinobacteria; 1 1 0 0 Actinomycetales; Kineosporiaceae; sf_1
Bacteria; Actinobacteria; Actinobacteria; 1 4 0.999 0.00 0.00 0 1 0
Actinomycetales; Microbacteriaceae; sf_1 Bacteria; Actinobacteria;
Actinobacteria; 1 2 0.985 1.26 1.15 0 1 0 Actinomycetales;
Micrococcaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 3
1.000 1.27 1.20 0 1 0 Actinomycetales; Micromonosporaceae; sf_1
Bacteria; Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales;
Mycobacteriaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1
1 0.999 0.00 0.00 0 1 0 Actinomycetales; Nocardiaceae; sf_1
Bacteria; Actinobacteria; Actinobacteria; 1 4 0.994 1.16 1.07 0 1 0
Actinomycetales; Nocardioidaceae; sf_1 Bacteria; Actinobacteria;
Actinobacteria; 1 1 1.000 0.00 0.00 0 1 0 Actinomycetales;
Nocardiopsaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria; 1 1
0 0 Actinomycetales; Promicromonosporaceae; sf_1 Bacteria;
Actinobacteria; Actinobacteria; 1 3 0.982 1.20 1.05 0 1 0
Actinomycetales; Propionibacteriaceae; sf_1 Bacteria;
Actinobacteria; Actinobacteria; 1 3 0.999 1.14 1.11 0 1 0
Actinomycetales; Pseudonocardiaceae; sf_1 Bacteria; Actinobacteria;
Actinobacteria; 1 1 0 0 Actinomycetales; Sporichthyaceae; sf_1
Bacteria; Actinobacteria; Actinobacteria; 1 3 0.998 1.30 1.14 0 1 0
Actinomycetales; Streptomycetaceae; sf_1 Bacteria; Actinobacteria;
Actinobacteria; 1 2 0.996 0.00 0.00 0 1 0 Actinomycetales;
Streptomycetaceae; sf_3 Bacteria; Actinobacteria; Actinobacteria; 1
1 0 0 Actinomycetales; Streptosporangiaceae; sf_1 Bacteria;
Actinobacteria; Actinobacteria; 1 1 0 0 Actinomycetales;
Thermomonosporaceae; sf_1 Bacteria; Actinobacteria; Actinobacteria;
1 1 0 0 Actinomycetales; Unclassified; sf_3 Bacteria;
Actinobacteria; Actinobacteria; 0 1 0.987 1.18 1.12 0 0 1
Actinomycetales; Williamsiaceae; sf_1 Bacteria; Actinobacteria;
Actinobacteria; 1 1 0 0 Bifidobacteriales; Bifidobacteriaceae; sf_1
Bacteria; Actinobacteria; Actinobacteria; 1 13 0.990 1.56 1.05 0 1
0 Rubrobacterales; Rubrobacteraceae; sf_1 Bacteria; Actinobacteria;
Actinobacteria; 1 1 0 0 Unclassified; Unclassified; sf_1 Bacteria;
Aquificae; Aquificae; Aquificales; 1 1 0 0 Hydrogenothermaceae;
sf_1 Bacteria; BRC1; Unclassified; Unclassified; 1 1 0 0
Unclassified; sf_2 Bacteria; Bacteroidetes; Bacteroidetes; 1 1 0 0
Bacteroidales; Porphyromonadaceae; sf_1 Bacteria; Bacteroidetes;
Bacteroidetes; 1 1 0 0 Bacteroidales; Prevotellaceae; sf_1
Bacteria; Bacteroidetes; Bacteroidetes; 1 1 0 0 Bacteroidales;
Rikenellaceae; sf_5 Bacteria; Bacteroidetes; Bacteroidetes; 1 1 0 0
Bacteroidales; Unclassified; sf_15 Bacteria; Bacteroidetes;
Flavobacteria; 1 1 0.943 0.00 0.00 0 1 0 Flavobacteriales;
Blattabacteriaceae; sf_1 Bacteria; Bacteroidetes; Flavobacteria; 1
1 0 0 Flavobacteriales; Flavobacteriaceae; sf_1 Bacteria;
Bacteroidetes; Flavobacteria; 1 1 0 0 Flavobacteriales;
Unclassified; sf_3 Bacteria; Bacteroidetes; KSA 1; Unclassified; 1
1 0 0 Unclassified; sf_1 Bacteria; Bacteroidetes; Sphingobacteria;
1 6 0.973 1.22 1.07 0 1 0 Sphingobacteriales; Crenotrichaceae;
sf_11 Bacteria; Bacteroidetes; Sphingobacteria; 1 1 0 0
Sphingobacteriales; Flammeovirgaceae; sf_5 Bacteria; Bacteroidetes;
Sphingobacteria; 1 1 0 0 Sphingobacteriales; Flexibacteraceae;
sf_19 Bacteria; Bacteroidetes; Sphingobacteria; 1 1 0 0
Sphingobacteriales; Sphingobacteriaceae; sf_1 Bacteria;
Bacteroidetes; Sphingobacteria; 1 1 0 0 Sphingobacteriales;
Unclassified; sf_3 Bacteria; Bacteroidetes; Sphingobacteria; 1 1 0
0 Sphingobacteriales; Unclassified; sf_6 Bacteria; Bacteroidetes;
Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_4 Bacteria;
Caldithrix; Unclassified; Caldithrales; 1 1 0 0 Caldithraceae; sf_1
Bacteria; Caldithrix; Unclassified; Caldithrales; 1 1 0 0
Caldithraceae; sf_2 Bacteria; Chlamydiae; Chlamydiae; 1 1 0 0
Chlamydiales; Chlamydiaceae; sf_1 Bacteria; Chlorobi; Chlorobia;
Chlorobiales; 1 1 0 0 Chlorobiaceae; sf_1 Bacteria; Chlorobi;
Unclassified; Unclassified; 1 1 0 0 Unclassified; sf_1 Bacteria;
Chlorobi; Unclassified; Unclassified; 1 1 0 0 Unclassified; sf_6
Bacteria; Chlorobi; Unclassified; Unclassified; 1 1 0 0
Unclassified; sf_9 Bacteria; Chloroflexi; Anaerolineae; 1 1 0.992
0.00 0.00 0 1 0 Chloroflexi-1a; Unclassified; sf_1 Bacteria;
Chloroflexi; Anaerolineae; 1 1 0 0 Chloroflexi-1b; Unclassified;
sf_2 Bacteria; Chloroflexi; Anaerolineae; 1 1 0 0 Unclassified;
Unclassified; sf_9 Bacteria; Chloroflexi; Chloroflexi-3; 1 1 0 0
Roseiflexales; Unclassified; sf_5 Bacteria; Chloroflexi;
Dehalococcoidetes; 1 1 0 0 Unclassified; Unclassified; sf_1
Bacteria; Chloroflexi; Unclassified; 1 1 0 0 Unclassified;
Unclassified; sf_12 Bacteria; Coprothermobacteria; Unclassified; 1
1 0 0 Unclassified; Unclassified; sf_1 Bacteria; Cyanobacteria;
Cyanobacteria; 1 1 0 0 Chloroplasts; Chloroplasts; sf_11 Bacteria;
Cyanobacteria; Cyanobacteria; 1 3 0.995 0.00 0.00 0 1 0
Chloroplasts; Chloroplasts; sf_5 Bacteria; Cyanobacteria;
Cyanobacteria; 1 1 0 0 Chroococcales; Unclassified; sf_1 Bacteria;
Cyanobacteria; Cyanobacteria; 0 1 0.954 1.09 1.12 0 0 1
Chroococcidiopsis; Unclassified; sf_1 Bacteria; Cyanobacteria;
Cyanobacteria; 1 1 0 0 Leptolyngbya; Unclassified; sf_1 Bacteria;
Cyanobacteria; Cyanobacteria; 1 1 0 0 Nostocales; Unclassified;
sf_1 Bacteria; Cyanobacteria; Cyanobacteria; 1 1 0 0
Oscillatoriales; Unclassified; sf_1 Bacteria; Cyanobacteria;
Cyanobacteria; 1 1 0 0 Phormidium; Unclassified; sf_1 Bacteria;
Cyanobacteria; Cyanobacteria; 1 1 0 0 Plectonema; Unclassified;
sf_1 Bacteria; Cyanobacteria; Cyanobacteria; 1 1 0 0 Prochlorales;
Unclassified; sf_1 Bacteria; Cyanobacteria; Cyanobacteria; 1 1 0 0
Pseudanabaena; Unclassified; sf_1 Bacteria; Cyanobacteria;
Cyanobacteria; 1 1 0 0 Spirulina; Unclassified; sf_1 Bacteria;
Cyanobacteria; Unclassified; 1 1 0 0 Unclassified; Unclassified;
sf_5 Bacteria; Cyanobacteria; Unclassified; 1 1 0 0 Unclassified;
Unclassified; sf_8 Bacteria; Cyanobacteria; Unclassified; 1 1 0 0
Unclassified; Unclassified; sf_9 Bacteria; DSS1; Unclassified;
Unclassified; 1 1 0 0 Unclassified; sf_2 Bacteria;
Deinococcus-Thermus; Unclassified; 1 1 0 0 Unclassified;
Unclassified; sf_1 Bacteria; Deinococcus-Thermus; Unclassified; 0 1
0.993 1.19 1.05 0 0 1 Unclassified; Unclassified; sf_3 Bacteria;
Firmicutes; Bacilli; Bacillales; 1 2 0.963 1.14 1.15 0 1 0
Alicyclobacillaceae; sf_1 Bacteria; Firmicutes; Bacilli;
Bacillales; 1 151 1.000 1.37 1.23 0 1 0 Bacillaceae; sf_1 Bacteria;
Firmicutes; Bacilli; Bacillales; 1 6 0.997 1.15 1.07 0 1 0
Halobacillaceae; sf_1 Bacteria; Firmicutes; Bacilli; Bacillales; 1
14 0.999 1.19 1.07 0 1 0 Paenibacillaceae; sf_1 Bacteria;
Firmicutes; Bacilli; Bacillales; 1 2 0.999 1.12 1.04 0 1 0
Sporolactobacillaceae; sf_1 Bacteria; Firmicutes; Bacilli;
Bacillales; 1 6 0.999 1.30 1.06 0 1 0 Staphylococcaceae; sf_1
Bacteria; Firmicutes; Bacilli; Bacillales; 1 6 0.999 1.15 1.09 0 1
0 Thermoactinomycetaceae; sf_1 Bacteria; Firmicutes; Bacilli;
Exiguobacterium; 0 1 0.998 0.00 0.00 0 0 1 Unclassified; sf_1
Bacteria; Firmicutes; Bacilli; Lactobacillales; 1 6 0.998 1.23 1.26
0 1 0 Aerococcaceae; sf_1 Bacteria; Firmicutes; Bacilli;
Lactobacillales; 1 1 0 0 Carnobacteriaceae; sf_1 Bacteria;
Firmicutes; Bacilli; Lactobacillales; 1 3 0.999 1.32 1.08 0 1 0
Enterococcaceae; sf_1 Bacteria; Firmicutes; Bacilli;
Lactobacillales; 1 1 0 0 Lactobacillaceae; sf_1 Bacteria;
Firmicutes; Bacilli; Lactobacillales; 1 1 0 0 Leuconostocaceae;
sf_1 Bacteria; Firmicutes; Bacilli; Lactobacillales; 1 1 0 0
Streptococcaceae; sf_1 Bacteria; Firmicutes; Bacilli;
Lactobacillales; 1 1 0 0 Unclassified; sf_1 Bacteria; Firmicutes;
Catabacter; Unclassified; 1 1 0 0 Unclassified; sf_1 Bacteria;
Firmicutes; Catabacter; Unclassified; 1 1 0.954 0.00 0.00 0 1 0
Unclassified; sf_4 Bacteria; Firmicutes; Clostridia; Clostridiales;
1 14 0.998 1.45 1.15 0 1 0 Clostridiaceae; sf_12 Bacteria;
Firmicutes; Clostridia; Clostridiales; 1 1 0 0 Eubacteriaceae; sf_1
Bacteria; Firmicutes; Clostridia; Clostridiales; 1 2 0.990 1.12
1.12 0 1 0 Lachnospiraceae; sf_5 Bacteria; Firmicutes; Clostridia;
Clostridiales; 1 4 0.980 1.12 1.16 0 1 0 Peptococc/Acidaminococc;
sf_11 Bacteria; Firmicutes; Clostridia; Clostridiales; 1 1 0.976
1.21 1.04 0 1 0 Peptostreptococcaceae; sf_5
Bacteria; Firmicutes; Clostridia; Clostridiales; 1 1 0 0
Syntrophomonadaceae; sf_5 Bacteria; Firmicutes; Clostridia;
Clostridiales; 1 1 0 0 Unclassified; sf_17 Bacteria; Firmicutes;
Clostridia; Unclassified; 1 1 0 0 Unclassified; sf_3 Bacteria;
Firmicutes; Desulfotomaculum; 1 3 0.984 1.14 1.04 0 1 0
Unclassified; Unclassified; sf_1 Bacteria; Firmicutes; Mollicutes;
1 1 0 0 Acholeplasmatales; Acholeplasmataceae; sf_1 Bacteria;
Firmicutes; Symbiobacteria; 1 1 0 0 Symbiobacterales; Unclassified;
sf_1 Bacteria; Firmicutes; Unclassified; 1 1 0 0 Unclassified;
Unclassified; sf_8 Bacteria; Firmicutes; gut clone group; 1 1 0 0
Unclassified; Unclassified; sf_1 Bacteria; Gemmatimonadetes;
Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_5 Bacteria;
Natronoanaerobium; Unclassified; 1 1 0 0 Unclassified;
Unclassified; sf_1 Bacteria; Nitrospira; Nitrospira; Nitrospirales;
1 1 0 0 Nitrospiraceae; sf_1 Bacteria; OD1; OP11-5; Unclassified; 1
1 0 0 Unclassified; sf_1 Bacteria; OP8; Unclassified; Unclassified;
1 1 0 0 Unclassified; sf_3 Bacteria; Planctomycetes;
Planctomycetacia; 1 1 0 0 Planctomycetales; Anammoxales; sf_2
Bacteria; Planctomycetes; Planctomycetacia; 1 1 0 0
Planctomycetales; Anammoxales; sf_4 Bacteria; Planctomycetes;
Planctomycetacia; 1 1 0 0 Planctomycetales; Pirellulae; sf_3
Bacteria; Planctomycetes; Planctomycetacia; 1 1 0 0
Planctomycetales; Planctomycetaceae; sf_3 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 1 0.943 0.00 0.00 0 1 0 Acetobacterales;
Acetobacteraceae; sf_1 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 6 0.980 1.24 1.17 0 1 0 Acetobacterales;
Roseococcaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria;
1 1 0.947 1.12 1.10 0 1 0 Azospirillales; Azospirillaceae; sf_1
Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0
Azospirillales; Magnetospirillaceae; sf_1 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 1 0 0 Azospirillales; Unclassified; sf_1
Bacteria; Proteobacteria; Alphaproteobacteria; 1 2 0.951 1.13 1.08
0 1 0 Bradyrhizobiales; Beijerinck/Rhodoplan/Methylocyst; sf_3
Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0
Bradyrhizobiales; Bradyrhizobiaceae; sf_1 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 1 0 0 Bradyrhizobiales; Hyphomicrobiaceae;
sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 2 0.999 0.00
0.00 0 1 0 Bradyrhizobiales; Methylobacteriaceae; sf_1 Bacteria;
Proteobacteria; Alphaproteobacteria; 1 4 0.982 1.15 1.11 0 1 0
Bradyrhizobiales; Unclassified; sf_1 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 1 0 0 Bradyrhizobiales; Xanthobacteraceae;
sf_1 Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0.968 0.00
0.00 0 1 0 Caulobacterales; Caulobacteraceae; sf_1 Bacteria;
Proteobacteria; Alphaproteobacteria; 1 1 0.951 0.00 0.00 0 1 0
Consistiales; Caedibacteraceae; sf_3 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 1 0 0 Consistiales; Caedibacteraceae; sf_4
Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0
Consistiales; Caedibacteraceae; sf_5 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 1 0 0 Consistiales; Unclassified; sf_4
Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0.976 1.18 1.05
0 1 0 Devosia; Unclassified; sf_1 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 1 0 0 Ellin314/wr0007; Unclassified; sf_1
Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0
Ellin329/Riz1046; Unclassified; sf_1 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 1 0 0 Fulvimarina; Unclassified; sf_1
Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Rhizobiales;
Bartonellaceae; sf_1 Bacteria; Proteobacteria; Alphaproteobacteria;
1 1 0 0 Rhizobiales; Beijerinck/Rhodoplan/Methylocyst; sf_1
Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Rhizobiales;
Bradyrhizobiaceae; sf_1 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 1 0 0 Rhizobiales; Brucellaceae; sf_1
Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0 Rhizobiales;
Hyphomicrobiaceae; sf_1 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 1 0 0 Rhizobiales; Phyllobacteriaceae; sf_1
Bacteria; Proteobacteria; Alphaproteobacteria; 1 2 0.981 1.27 1.26
0 1 0 Rhizobiales; Rhizobiaceae; sf_1 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 1 0 0 Rhizobiales; Unclassified; sf_1
Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0
Rhodobacterales; Hyphomonadaceae; sf_1 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 6 0.985 1.13 1.11 0 1 0 Rhodobacterales;
Rhodobacteraceae; sf_1 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 1 0 0 Rickettsiales; Anaplasmataceae; sf_3
Bacteria; Proteobacteria; Alphaproteobacteria; 1 1 0 0
Rickettsiales; Rickettsiaceae; sf_1 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 1 0 0 Rickettsiales; Unclassified; sf_2
Bacteria; Proteobacteria; Alphaproteobacteria; 1 9 0.994 1.23 1.10
0 1 0 Sphingomonadales; Sphingomonadaceae; sf_1 Bacteria;
Proteobacteria; Alphaproteobacteria; 1 6 0.990 1.13 1.06 0 1 0
Sphingomonadales; Sphingomonadaceae; sf_15 Bacteria;
Proteobacteria; Alphaproteobacteria; 0 3 0.997 1.20 1.08 0 0 1
Sphingomonadales; Unclassified; sf_1 Bacteria; Proteobacteria;
Alphaproteobacteria; 1 1 0.954 0.00 0.00 0 1 0 Unclassified;
Unclassified; sf_6 Bacteria; Proteobacteria; Betaproteobacteria; 1
3 1.000 1.35 1.07 0 1 0 Burkholderiales; Alcaligenaceae; sf_1
Bacteria; Proteobacteria; Betaproteobacteria; 1 12 1.000 0.00 0.00
0 1 0 Burkholderiales; Burkholderiaceae; sf_1 Bacteria;
Proteobacteria; Betaproteobacteria; 1 1 0 0 Burkholderiales;
Comamonadaceae; sf_1 Bacteria; Proteobacteria; Betaproteobacteria;
1 2 0.996 0.00 0.00 0 1 0 Burkholderiales; Oxalobacteraceae; sf_1
Bacteria; Proteobacteria; Betaproteobacteria; 1 1 0 0
Burkholderiales; Ralstoniaceae; sf_1 Bacteria; Proteobacteria;
Betaproteobacteria; 1 1 0 0 MND1 clone group; Unclassified; sf_1
Bacteria; Proteobacteria; Betaproteobacteria; 1 1 0 0
Methylophilales; Methylophilaceae; sf_1 Bacteria; Proteobacteria;
Betaproteobacteria; 1 1 0 0 Neisseriales; Unclassified; sf_1
Bacteria; Proteobacteria; Betaproteobacteria; 1 1 0 0
Nitrosomonadales; Nitrosomonadaceae; sf_1 Bacteria; Proteobacteria;
Betaproteobacteria; 1 1 0 0 Rhodocyclales; Rhodocyclaceae; sf_1
Bacteria; Proteobacteria; Betaproteobacteria; 1 1 0 0 Unclassified;
Unclassified; sf_3 Bacteria; Proteobacteria; Deltaproteobacteria; 1
1 0 0 AMD clone group; Unclassified; sf_1 Bacteria; Proteobacteria;
Deltaproteobacteria; 1 1 0 0 Bdellovibrionales; Unclassified; sf_1
Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0
Desulfobacterales; Desulfobulbaceae; sf_1 Bacteria; Proteobacteria;
Deltaproteobacteria; 1 1 0 0 Desulfobacterales; Nitrospinaceae;
sf_2 Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0
Desulfobacterales; Unclassified; sf_4 Bacteria; Proteobacteria;
Deltaproteobacteria; 1 1 0 0 Desulfovibrionales;
Desulfohalobiaceae; sf_1 Bacteria; Proteobacteria;
Deltaproteobacteria; 1 1 0 0 Desulfovibrionales;
Desulfovibrionaceae; sf_1 Bacteria; Proteobacteria;
Deltaproteobacteria; 1 1 0 0 Desulfovibrionales; Unclassified; sf_1
Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0 EB1021
group; Unclassified; sf_4 Bacteria; Proteobacteria;
Deltaproteobacteria; 0 1 0.974 0.00 0.00 0 0 1 Myxococcales;
Myxococcaceae; sf_1 Bacteria; Proteobacteria; Deltaproteobacteria;
1 1 0 0 Myxococcales; Polyangiaceae; sf_3 Bacteria; Proteobacteria;
Deltaproteobacteria; 1 1 0 0 Myxococcales; Unclassified; sf_1
Bacteria; Proteobacteria; Deltaproteobacteria; 1 1 0 0
Syntrophobacterales; Syntrophobacteraceae; sf_1 Bacteria;
Proteobacteria; Deltaproteobacteria; 1 1 0 0 Unclassified;
Unclassified; sf_9 Bacteria; Proteobacteria; Deltaproteobacteria; 1
1 0 0 dechlorinating clone group; Unclassified; sf_1 Bacteria;
Proteobacteria; Epsilonproteobacteria; 1 1 0 0 Campylobacterales;
Campylobacteraceae; sf_3 Bacteria; Proteobacteria;
Epsilonproteobacteria; 1 1 0 0 Campylobacterales;
Helicobacteraceae; sf_3 Bacteria; Proteobacteria;
Epsilonproteobacteria; 1 1 0 0 Campylobacterales; Unclassified;
sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0
Aeromonadales; Aeromonadaceae; sf_1 Bacteria; Proteobacteria;
Gammaproteobacteria; 1 1 0 0 Alteromonadales; Alteromonadaceae;
sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0
Alteromonadales; Pseudoalteromonadaceae; sf_1 Bacteria;
Proteobacteria; Gammaproteobacteria; 1 1 0 0 Alteromonadales;
Unclassified; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1
1 0 0 Chromatiales; Chromatiaceae; sf_1 Bacteria; Proteobacteria;
Gammaproteobacteria; 1 1 0 0 Chromatiales; Ectothiorhodospiraceae;
sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0
Chromatiales; Unclassified; sf_1 Bacteria; Proteobacteria;
Gammaproteobacteria; 1 1 0 0 Ellin307/WD2124; Unclassified; sf_1
Bacteria; Proteobacteria; Gammaproteobacteria; 1 3 0.995 1.12 1.04
0 1 0 Enterobacteriales; Enterobacteriaceae; sf_1 Bacteria;
Proteobacteria; Gammaproteobacteria; 1 1 0 0 Enterobacteriales;
Enterobacteriaceae; sf_6 Bacteria; Proteobacteria;
Gammaproteobacteria; 1 1 0 0 GAO cluster; Unclassified; sf_1
Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0
Legionellales; Coxiellaceae; sf_3 Bacteria; Proteobacteria;
Gammaproteobacteria; 1 1 0 0 Legionellales; Unclassified; sf_1
Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0
Legionellales; Unclassified; sf_3 Bacteria; Proteobacteria;
Gammaproteobacteria; 1 1 0 0 Methylococcales; Methylococcaceae;
sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0
Oceanospirillales; Alcanivoraceae; sf_1 Bacteria; Proteobacteria;
Gammaproteobacteria; 1 1 0 0 Oceanospirillales; Halomonadaceae;
sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0
Oceanospirillales; Unclassified; sf_3 Bacteria; Proteobacteria;
Gammaproteobacteria; 1 1 0 0 Pasteurellales; Pasteurellaceae; sf_1
Bacteria; Proteobacteria; Gammaproteobacteria; 1 2 0.996 1.16 1.10
0 1 0 Pseudomonadales; Moraxellaceae; sf_3 Bacteria;
Proteobacteria; Gammaproteobacteria; 1 2 0.998 1.18 1.03 0 1 0
Pseudomonadales; Pseudomonadaceae; sf_1 Bacteria; Proteobacteria;
Gammaproteobacteria; 1 1 0 0 SUP05; Unclassified; sf_1 Bacteria;
Proteobacteria; Gammaproteobacteria; 1 1 0 0 Shewanella;
Unclassified; sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1
1 0 0 Symbionts; Unclassified; sf_1 Bacteria; Proteobacteria;
Gammaproteobacteria; 1 1 0 0 Thiotrichales; Francisellaceae; sf_1
Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0
Thiotrichales; Piscirickettsiaceae; sf_3 Bacteria; Proteobacteria;
Gammaproteobacteria; 1 1 0 0 Thiotrichales; Thiotrichaceae; sf_3
Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0
Unclassified; Unclassified; sf_3 Bacteria; Proteobacteria;
Gammaproteobacteria; 1 2 0.997 0.00 0.00 0 1 0 Xanthomonadales;
Xanthomonadaceae; sf_3 Bacteria; Proteobacteria;
Gammaproteobacteria; 1 1 0 0 aquatic clone group; Unclassified;
sf_1 Bacteria; Proteobacteria; Gammaproteobacteria; 1 1 0 0 uranium
waste clones; Unclassified; sf_1 Bacteria; Proteobacteria;
Unclassified; 1 1 0 0 Unclassified; Unclassified; sf_20 Bacteria;
Spirochaetes; Spirochaetes; 1 1 0 0 Spirochaetales; Leptospiraceae;
sf_3 Bacteria; Spirochaetes; Spirochaetes; 1 1 0 0 Spirochaetales;
Spirochaetaceae; sf_1 Bacteria; Spirochaetes; Spirochaetes; 1 1 0 0
Spirochaetales; Spirochaetaceae; sf_3 Bacteria; TM7; TM7-3;
Unclassified; 1 1 0 0 Unclassified; sf_1 Bacteria; TM7;
Unclassified; Unclassified; 1 1 0 0 Unclassified; sf_1 Bacteria;
Verrucomicrobia; Unclassified; 1 1 0 0 Unclassified; Unclassified;
sf_4 Bacteria; Verrucomicrobia; Unclassified; 1 1 0 0 Unclassified;
Unclassified; sf_5 Bacteria; Verrucomicrobia; Verrucomicrobiae; 1 1
0 0 Verrucomicrobiales; Unclassified; sf_3 Bacteria;
Verrucomicrobia; Verrucomicrobiae; 1 1 0 0
Verrucomicrobiales; Verrucomicrobia subdivision 5; sf_1 Bacteria;
Verrucomicrobia; Verrucomicrobiae; 1 1 0 0 Verrucomicrobiales;
Verrucomicrobiaceae; sf_6 Bacteria; Verrucomicrobia;
Verrucomicrobiae; 1 1 0 0 Verrucomicrobiales; Verrucomicrobiaceae;
sf_7 Bacteria; WS3; Unclassified; Unclassified; 1 1 0 0
Unclassified; sf_1 Bacteria; marine group A; mgA-1; Unclassified; 1
1 0 0 Unclassified; sf_1 Bacteria; marine group A; mgA-2;
Unclassified; 1 1 0 0 Unclassified; sf_1 Totals 238 67 178 60 7
Array Clone Array Array Clone sub- sub- only and only families
families sub- clone sub- families sub- families families .sup.1A
sub-family must have at least one taxon present above the positive
probe threshold of 0.92 (92%) in all three replicates to be
considered present. .sup.2For a clone to be assigned to a
sub-family its DNAML similarity must be above the 0.94 (94%)
threshold defined for sub-families. .sup.3This is the maximum DNAML
similarity measured. .sup.4Both maximum preference score and
maximum divergence ratio must pass the criteria below for a clone
to be considered non-chimeric. .sup.5Bellerophon preference score,
a ratio of 1.3 or greater has been empirically shown to demonstrate
a chimeric molecule. .sup.6Bellerophon divergence ratio. This is a
new metric devised to aid chimera detection, a score greater than
1.1 indicates a potential chimera.
TABLE-US-00003 TABLE S3 Confirmation of array sub-family detections
by taxon-specific PCR and sequencing. Genbank accession number of
Closest BLAST homolog SEQ retrieved Sub-family (sf) GenBank
accession number ID Tm Ta sequence verified (% identity) NO. Primer
Sequences (5' to 3') .degree. C. .degree. C. DQ236248
Actinobacteria, Actinokineospora diospyrosa, 5 For -
ACCAAGGCTACGACGGGTA 60.5 67.0 Actinosynnemataceae, AF114797 (94.3%)
6 Rev - ACACACCGCATGTCAAACC 60.4 sf_1 DQ515230 Actinobacteria,
Bifidobacterium adolescentis, 7 For - GGGTGGTAATGCCSGATG 60.0 62.0
Bifidobacteriaceae, AF275881 (99.6 %) 8 Rev - CCRCCGTTACACCGGGAA
64.0 sf_1 DQ236245 Actinobacteria, Actinomycetaceae SR 11, 9 For-
CAATGGACTCAAGCCTGATG 53.5 53.0 Kineosporiaceae, sf_1 X87617 (97.7%)
10 Rev- CTCTAGCCTGCCCGTTTC 53.9 DQ236250 Chloroflexi, penguin
droppings clone KD4-96, 11 For - GAGAGGATGATCAGCCAG 54.0 61.7
Anaerolineae, sf_9 AY218649 (90%) 12 Rev - 57.0
TACGGYTACCTTGTTACGACTT DQ236247 Cyanobacteria, Geitlerinema sp. PCC
7105, 13 For - 62.2 55.0 Geitlerinema, sf_1 AB039010 (89.3%)
TCCGTAGGTGGCTGTTCAAGTCTG 14 Rev - 61.7 GCTTTCGTCCCTCAGTGTCAGTTG
DQ236246 Cyanobacteria, Thermosynechococcus elongatus 15 For - 58.7
55.0 Thermosynechococcus, BP-1, TGTCGTGAGATGTTGGGTTAAGTC sf_1
BA000039 (96.0%) 16 Rev - 58.8 TGAGCCGTGGTTTAAGAGATTAGC DQ129654
Gammaproteobacteria, Pseudoalteromonas sp. S511-1, 17 For -
GCCTCACGCCATAAGATTAG 53.1 50.0 Pseudoaltermonadaceae, AB029824
(99.1%) 18 Rev - 53.0 sf_1 GTGCTTTCTTCTGTAAGTAACG DQ129656
Nitrospira Nitrospira moscoviensis, 19 For - TCGAAAAGCGTGGGG 57.6
47.0 Nitrospiraceae, sf_1 X82558 (98.5%) 20 Rev - CTTCCTCCCCCGTTC
54.4 DQ129666 Planctomycetes, Planctomyces brasiliensis, 21 For -
GAAACTGCCCAGACAC 50.0 60.0 Plantomycetaceae, AJ231190 (94%) 22 Rev
- AGTAACGTTCGCACAG 48.0 sf_3 DQ515231 Proteobacteria, Uncultured
Arcobacter sp. clone 23 For - GGATGACACTTTTCGGAG 54.0 48.0
Campylobacteraceae, DS017, sf_3 DQ234101 (98 %) 24 Rev -
AATTCCATCTGCCTCTCC 55.0 DQ129662 Spirochaetes, Leptospira
borgpetersenii, 25 For - GGCGGCGCGTTTTAAGC 57.0 58.7 Leptospiracea,
sf_3 X17547 (90.9%) DQ129661 Spirochaetes, Spirochaeta asiatica, 26
Rev - ACTCGGGTGGTGTGACG 57.0 Spirochaetaceae, sf_1 X93926 (90.0%)
DQ129660 Spirochaetes, Spirochaetaceae, Borrelia sf_3 hermsii
M72398 (91.0 %) DQ236249 TM7, TM7-3, sf_1 oral clone EW096, 27 For
- AYTGGGCGTAAAGAGTTGC 58.0 66.3 AY349415 (88.8%) 28 Rev - 57.0
TACGGYTACCTTGTTACGACTT Tm = Melting temperature; Ta = Optimal
annealing temperature used in PCR reaction.
TABLE-US-00004 TABLE S4 Bacteria and Archaea used for Latin square
hybridization assays. Organism Phylum/Sub-phylum ATCC Arthrobacter
oxydans Actinobacteria 14359.sup.a Bacillus anthracis AMES
Firmicutes -- .sup.b pX01- pX02- Caulobacter crescentus CB15
Alpha-proteobacteria 19089 Dechloromonas agitata CKB
Beta-proteobacteria 700666 .sup.c Dehalococcoides ethenogenes 195
Chloroflexi -- .sup.d Desulfovibrio vulgaris Delta-proteobacteria
29579.sup.e Hildenborough Francisella tularensis
Gamma-proteobacteria 6223 Geobacter metallireducens GS-15
Delta-proteobacteria 53774 .sup.c Geothrix fermentans H-5
Acidobacteria 700665 .sup.c Sulfolobus solfataricus Crenarchaeota
35092 .sup.aStain obtained from Hoi-Ying Holman, LBNL. .sup.b
Strain obtained from Arthur Friedlander USAMRID. .sup.c Strain
obtained from John Coates, UC Berkeley. .sup.d Strain obtained from
Lisa Alvarez-Cohen, UC Berkeley. .sup.eStrain obtained from Terry
Hazen, LBNL.
TABLE-US-00005 TABLE S5 Correlations between environmental/temporal
parameters. Sub- family- mean max min range mean mean max max range
level week TEMP MAXTEMP MINTEMP MINTEMP WDSP SLP VISIB PM2.5 PM2.5
richness Austin week 1.000 mean TEMP 0.703 1.000 max MAXTEMP 0.471
0.665 1.000 min MINTEMP 0.685 0.691 0.073 1.000 range MINTEMP
-0.267 -0.149 0.571 -0.777 1.000 mean WDSP -0.540 -0.053 -0.038
-0.195 0.136 1.000 mean SLP 0.607 0.145 0.162 0.352 -0.188 -0.380
1.000 max VISIB 0.486 0.311 0.400 0.230 0.063 -0.498 0.318 1.000
max PM2.5 -0.529 -0.219 -0.331 -0.162 -0.075 0.617 -0.409 -0.817
1.000 range PM2.5 -0.507 -0.219 -0.366 -0.117 -0.134 0.613 -0.407
-0.829 0.989 1.000 Sub-family-level -0.074 -0.104 0.098 -0.460
0.440 0.251 -0.182 -0.066 -0.058 -0.063 1.000 richness San Antonio
week 1.000 mean TEMP 0.452 1.000 max MAXTEMP 0.189 0.553 1.000 min
MINTEMP 0.570 0.622 0.044 1.000 range MINTEMP -0.318 -0.116 0.630
-0.749 1.000 mean WDSP -0.523 -0.014 -0.015 -0.014 0.001 1.000 mean
SLP 0.722 0.029 -0.088 0.300 -0.291 -0.495 1.000 max VISIB 0.420
0.169 0.298 -0.054 0.240 -0.234 0.501 1.000 max PM2.5 -0.508 -0.157
-0.197 -0.022 -0.114 0.189 -0.420 -0.830 1.000 range PM2.5 -0.515
-0.164 -0.201 0.000 -0.134 0.255 -0.455 -0.843 0.991 1.000
Sub-family-level 0.125 -0.016 -0.050 0.024 -0.051 -0.419 0.175
-0.054 -0.064 -0.102 1.000 richness Underlined font indicates a
significant positive correlation, while italic font indicates a
significant negative correlation at a 95% confidence interval.
TABLE-US-00006 TABLE S6 Sub-families detected in Austin or San
Antonio correlating significantly with environmental parameters.
All of the below are in the Domain of Bacteria BH Sub- taxon and
representative Environ. Correl. p adjusted Phylum Class Order
Family family organism name factor Coeff. value p.value .sup.a
Actino- Actino- Actinomycetales Unclassified sf_3 1114 clone
PENDANT- max 0.64 4.05E-05 2.49E-02 bacteria bacteria 38 TEMP
Actino- Actino- Actinomycetales Unclassified sf_3 1114 clone
PENDANT- mean 0.66 2.16E-05 2.01E-02 bacteria bacteria 38 TEMP
Actino- Actino Actinomycetales Unclassified sf_3 1114 clone
PENDANT- week 0.63 6.73E-05 3.18E-02 bacteria bacteria 38 Actino-
Actino- Actinomycetales Gordoniaceae sf_1 1116 Gordona terrae week
0.61 1.18E-04 3.68E-02 bacteria bacteria Actino- Actino-
Actinomycetales Actinosynnemataceae sf_1 1125 Actinokineospora max
0.6 1.53E-04 4.30E-02 bacteria bacteria diospyrosa str. TEMP NRRL
B-24047T Actino- Actino- Actinomycetales Actinosynnemataceae sf_1
1125 Actinokineospora week 0.63 7.42E-05 3.38E-02 bacteria bacteria
diospyrosa str. NRRL B-24047T Actino- Actino- Actinomycetales
Streptomycetaceae sf_1 1128 Streptomyces sp. week 0.7 3.75E-06
1.18E-02 bacteria bacteria str. YIM 80305 Actino- Actino-
Actinomycetales Sporichthyaceae sf_1 1223 Sporichthya mean 0.61
1.42E-04 4.21E-02 bacteria bacteria polymorpha TEMP Actino- Actino-
Actinomycetales Sporichthyaceae sf_1 1223 Sporichthya min 0.61
1.50E-04 4.27E-02 bacteria bacteria polymorpha MINTEMP Actino-
Actino- Actinomycetales Sporichthyaceae sf_1 1223 Sporichthya week
0.7 4.39E-06 1.18E-02 bacteria bacteria polymorpha Actino- Actino-
Actinomycetales Microbacteriaceae sf_1 1264 Waste-gas biofilter
mean 0.61 1.47E-04 4.25E-02 bacteria bacteria clone BIhi33 TEMP
Actino- Actino- Actinomycetales Microbacteriaceae sf_1 1264
Waste-gas biofilter week 0.69 7.62E-06 1.18E-02 bacteria bacteria
clone BIhi33 Actino- Actino- Actinomycetales Streptomycetaceae sf_1
1344 Streptomyces max 0.64 5.42E-05 2.84E-02 bacteria bacteria
species TEMP Actino- Actino- Actinomycetales Streptomycetaceae sf_1
1344 Streptomyces mean 0.62 9.56E-05 3.63E-02 bacteria bacteria
species TEMP Actino- Actino- Actinomycetales Thermomonosporaceae
sf_1 1406 Actinomadura week 0.65 2.91E-05 2.29E-02 bacteria
bacteria kijaniata Actino- Actino- Actinomycetales Kineosporiaceae
sf_1 1424 Actinomycetaceae max 0.6 1.70E-04 4.59E-02 bacteria
bacteria SR 139 VISIB Actino- Actino- Actinomycetales
Kineosporiaceae sf_1 1424 Actinomycetaceae week 0.62 8.03E-05
3.50E-02 bacteria bacteria SR 139 Actino- Actino- Actinomycetales
Intrasporangiaceae sf_1 1445 Ornithinimicrobium week 0.62 9.46E-05
3.63E-02 bacteria bacteria humiphilum str. DSM 12362 HKI 124
Actino- Actino- Actinomycetales Unclassified sf_3 1514 uncultured
human week 0.69 7.08E-06 1.18E-02 bacteria bacteria oral bacterium
A11 Actino- Actino- Actinomycetales Pseudonocardiaceae sf_1 1530
Pseudonocardia max 0.64 5.10E-05 2.79E-02 bacteria bacteria
thermophila str. TEMP IMSNU 20112T Actino- Actino- Actinomycetales
Pseudonocardiaceae sf_1 1530 Pseudonocardia mean 0.66 1.99E-05
1.97E-02 bacteria bacteria thermophila str. TEMP IMSNU 20112T
Actino- Actino- Actinomycetales Pseudonocardiaceae sf_1 1530
Pseudonocardia min 0.61 1.10E-04 3.63E-02 bacteria bacteria
thermophila str. MINTEMP IMSNU 20112T Actino- Actino-
Actinomycetales Pseudonocardiaceae sf_1 1530 Pseudonocardia min 0.6
1.82E-04 4.73E-02 bacteria bacteria thermophila str. TEMP IMSNU
20112T Actino- Actino- Actinomycetales Pseudonocardiaceae sf_1 1530
Pseudonocardia week 0.73 1.15E-06 5.92E-03 bacteria bacteria
thermophila str. IMSNU 20112T Actino- Actino- Actinomycetales
Cellulomonadaceae sf_1 1592 Lake Bogoria week 0.61 1.15E-04
3.63E-02 bacteria bacteria isolate 69B4 Actino- Actino-
Actinomycetales Corynebacteriaceae sf_1 1642 Corynebacterium max
0.62 8.87E-05 3.63E-02 bacteria bacteria otitidis TEMP Actino-
Actino- Actinomycetales Corynebacteriaceae sf_1 1642
Corynebacterium mean 0.64 4.12E-05 2.49E-02 bacteria bacteria
otitidis TEMP Actino- Actino- Actinomycetales Corynebacteriaceae
sf_1 1642 Corynebacterium min 0.62 1.07E-04 3.63E-02 bacteria
bacteria otitidis MINTEMP Actino- Actino- Actinomycetales
Corynebacteriaceae sf_1 1642 Corynebacterium week 0.63 5.53E-05
2.84E-02 bacteria bacteria otitidis Actino- Actino- Actinomycetales
Dermabacteraceae sf_1 1736 Brachybacterium max 0.63 6.17E-05
3.09E-02 bacteria bacteria rhamnosum TEMP LMG 19848T Actino-
Actino- Actinomycetales Dermabacteraceae sf_1 1736 Brachybacterium
mean 0.6 1.91E-04 4.90E-02 bacteria bacteria rhamnosum TEMP LMG
19848T Actino- Actino- Actinomycetales Dermabacteraceae sf_1 1736
Brachybacterium week 0.64 4.47E-05 2.62E-02 bacteria bacteria
rhamnosum LMG 19848T Actino- Actino- Actinomycetales
Streptomycetaceae sf_3 1743 Streptomyces week 0.6 1.60E-04 4.38E-02
bacteria bacteria scabiei str. DNK-G01 Actino- Actino-
Actinomycetales Nocardiaceae sf_1 1746 Nocardia week 0.66 2.48E-05
2.21E-02 bacteria bacteria corynebacteroides Actino- Actino-
Actinomycetales Unclassified sf_3 1806 French Polynesia: max 0.65
3.37E-05 2.29E-02 bacteria bacteria Tahiti clone 23 TEMP Actino-
Actino- Actinomycetales Unclassified sf_3 1806 French Polynesia:
mean 0.66 1.97E-05 1.97E-02 bacteria bacteria Tahiti clone 23 TEMP
Actino- Actino- Actinomycetales Micromonosporaceae sf_1 1821
Catellatospora max 0.61 1.10E-04 3.63E-02 bacteria bacteria subsp.
citrea str. TEMP IMSNU 22008T Actino- Actino- Actinomycetales
Micromonosporaceae sf_1 1821 Catellatospora mean 0.61 1.22E-04
3.72E-02 bacteria bacteria subsp. citrea str. MINTEMP IMSNU 22008T
Actino- Actino- Actinomycetales Micromonosporaceae sf_1 1821
Catellatospora mean 0.67 1.76E-05 1.97E-02 bacteria bacteria subsp.
citrea str. TEMP IMSNU 22008T Actino- Actino- Actinomycetales
Micromonosporaceae sf_1 1821 Catellatospora min 0.7 4.92E-06
1.18E-02 bacteria bacteria subsp. citrea str. MINTEMP IMSNU 22008T
Actino- Actino- Actinomycetales Micromonosporaceae sf_1 1821
Catellatospora min 0.65 2.68E-05 2.29E-02 bacteria bacteria subsp.
citrea str. TEMP IMSNU 22008T Actino- Actino- Actinomycetales
Micromonosporaceae sf_1 1821 Catellatospora week 0.62 8.24E-05
3.52E-02 bacteria bacteria subsp. citrea str. IMSNU 22008T Actino-
Actino- Rubrobacterales Rubrobacteraceae sf_1 1892 Start arid zone
soil min 0.62 8.51E-05 3.56E-02 bacteria bacteria clone 0319-7H2
MINTEMP Actino- Actino- Rubrobacterales Rubrobacteraceae sf_1 1892
Start arid-zone soil week 0.68 9.19E-06 1.18E-02 bacteria bacteria
clone 0319-7H2 Actino- Actino- Actinomycetales Actinosynnemataceae
sf_1 1984 Saccharothrix max 0.68 8.01E-06 1.18E-02 bacteria
bacteria tangerinus TEMP str. MK27-91F2 Actino- Actino-
Actinomycetales Actinosynnemataceae sf_1 1984 Saccharothrix mean
0.67 1.64E-05 1.97E-02 bacteria bacteria tangerinus TEMP str.
MK27-91F2 Actino- Actino- Actinomycetales Actinosynnemataceae sf_1
1984 Saccharothrix week 0.7 3.54E-06 1.18E-02 bacteria bacteria
tangerinus str. MK27-91F2 Actino- Actino- Actinomycetales
Nocardiaceae sf_1 1999 Rhodococcus max 0.61 1.14E-04 3.63E-02
bacteria bacteria fascians TEMP str. DFA7 Actino- Actino-
Actinomycetales Propionibacteriaceae sf_1 2023 Propionibacterium
week 0.62 9.19E-05 3.63E-02 bacteria bacteria propionicum str. DSM
43307T Actino- Actino- Actinomycetales Streptosporangiaceae sf_1
2037 Nonomuraea week 0.61 1.13E-04 3.63E-02 bacteria bacteria
terrinata str. DSM 44505 Firmicutes Bacilli Bacillales
Thermoactino- sf_1 3619 Thermoactinomyces range 0.65 3.41E-05
2.29E-02 mycetaceae intermedius str. MINTEMP ATCC 33205T Cyano-
Cyano- Symploca Unclassified sf_1 5165 Symploca atlantica week 0.63
6.84E-05 3.18E-02 bacteria bacteria str. PCC 8002 Bacte- Sphingo-
Sphingobacteriales Crenotrichaceae sf_11 5491 Austria: Lake mean
0.61 1.15E-04 3.63E-02 roidetes bacteria Gossenkoellesee TEMP clone
GKS2-106 Bacte- Sphingo- Sphingobacteriales Crenotrichaceae sf_11
5491 Austria: Lake week 0.63 6.62E-05 3.18E-02 roidetes bacteria
Gossenkoellesee clone GKS2-106 Bacte- Sphingo- Sphingobacteriales
Flexibacteraceae sf_19 5866 Taxeobacter week 0.62 1.08E-04 3.63E-02
roidetes bacteria ocellatus str. Myx2105 Bacte- Bacte-
Bacteroidales Prevotellaceae sf_1 6047 deep marine week 0.62
9.52E-05 3.63E-02 roidetes roidetes sediment clone MB-A2-107 Bacte-
Sphingo- Sphingobacteriales Crenotrichaceae sf_11 6171 Bifissio
spartinae max -0.62 9.95E-05 3.63E-02 roidetes bacteria str.
AS1.1762 PM2.5 Bacte- Sphingo- Sphingobacteriales Crenotrichaceae
sf_11 6171 Bifissio spartinae max 0.62 1.09E-04 3.63E-02 roidetes
bacteria str. AS1.1762 VISIB Bacte- Sphingo- Sphingobacteriales
Crenotrichaceae sf_11 6171 Bifissio spartinae range -0.65 2.86E-05
2.29E-02 roidetes bacteria str. AS1.1762 PM2.5 Bacte- Sphingo-
Sphingobacteriales Crenotrichaceae sf_11 6171 Bifissio spartinae
week 0.61 1.25E-04 3.76E-02 roidetes bacteria str. AS1.1762 Proteo-
Alpha- Sphingomonadales Sphingomonadaceae sf_1 6808 PCB-polluted
soil mean 0.63 7.73E-05 3.45E-02 bacteria proteo- clone WD267 TEMP
bacteria Proteo- Alpha- Sphingomonadales Sphingomonadaceae sf_1
6808 PCB-polluted soil week 0.69 5.54E-06 1.18E-02 bacteria proteo-
clone WD267 bacteria Proteo- Alpha- Sphingomonadales
Sphingomonadaceae sf_1 7132 Sphingomonas sp. min 0.64 5.16E-05
2.79E-02 bacteria proteo- K101 SLP bacteria Proteo- Alpha-
Sphingomonadales Sphingomonadaceae sf_1 7132 Sphingomonas sp. week
0.75 2.74E-07 2.81E-03 bacteria proteo- K101 bacteria Proteo-
Alpha- Bradyrhizobiales Unclassified sf_1 7255 Pleomorphomonas max
0.65 3.57E-05 2.29E-02 bacteria proteo- oryzae str. B-32 TEMP
bacteria Proteo- Alpha- Bradyrhizobiales Unclassified sf_1 7255
Pleomorphomonas mean 0.64 4.62E-05 2.63E-02 bacteria proteo- oryzae
str. B-32 TEMP bacteria Proteo- Alpha- Sphingomonadales
Sphingomonadaceae sf_1 7344 rhizosphere soil week 0.68 8.96E-06
1.18E-02 bacteria proteo- RSI-21 bacteria Proteo- Alpha-
Sphingomonadales Sphingomonadaceae sf_1 7411 Sphingomonas min 0.66
2.01E-05 1.97E-02
bacteria proteo- adhaesiva SLP bacteria Proteo- Alpha-
Sphingomonadales Sphingomonadaceae sf_1 7411 Sphingomonas week 0.74
6.42E-07 4.39E-03 bacteria proteo- adhaesiva bacteria Proteo-
Alpha- Rhodobacterales Rhodobacteraceae sf_1 7527 clone CTD56B mean
0.61 1.44E-04 4.23E-02 bacteria proteo- TEMP bacteria Proteo-
Alpha- Sphingomonadales Sphingomonadaceae sf_1 7555 derived
microbial week 0.6 1.60E-04 4.38E-02 bacteria proteo-
`pearl`-community bacteria clone sipK48 Proteo- Alpha-
Bradyrhizobiales Methylobacteriaceae sf_1 7593 Methylobacterium max
0.65 3.53E-05 2.29E-02 bacteria proteo- organophilum TEMP bacteria
Proteo- Alpha- Bradyrhizobiales Methylobacteriaceae sf_1 7593
Methylobacterium mean 0.62 9.87E-05 3.63E-02 bacteria proteo-
organophilum TEMP bacteria Proteo- Alpha- Bradyrhizobiales
Methylobacteriaceae sf_1 7593 Methylobacterium week 0.68 8.06E-06
1.18E-02 bacteria proteo- organophilum bacteria Proteo- Alpha-
Devosia Unclassified sf_1 7626 Devosia neptuniae week 0.6 1.80E-04
4.73E-02 bacteria proteo- str. J1 bacteria Proteo- Beta-
Burkholderiales Comamonadaceae sf_1 7786 unidentified alpha mean
0.65 3.45E-05 2.29E-02 bacteria proteo- proteobacterium TEMP
bacteria Proteo- Beta- Burkholderiales Burkholderiaceae sf_1 7899
Burkholderia week 0.65 3.43E-05 2.29E-02 bacteria proteo-
andropogonis bacteria Proteo- Gamma- Unclassified Unclassified sf_3
8759 Agricultural soil max 0.6 1.74E-04 4.63E-02 bacteria proteo-
SC-I-87 TEMP bacteria Proteo- Gamma- Pseudomonadales
Pseudomonadaceae sf_1 9389 Pseudomonas min 0.68 8.57E-06 1.18E-02
bacteria proteo- oleovorans SLP bacteria Proteo- Gamma-
Pseudomonadales Pseudomonadaceae sf_1 9389 Pseudomonas week 0.83
1.03E-09 2.11E-05 bacteria proteo- oleovorans bacteria .sup.a
P-value is adjusted for multiple comparisons using false discovery
rate controlling procedure (S18).
TABLE-US-00007 TABLE S7 Bacterial sub-families detected (92% or
greater of probes in probe set positive) most frequently over 17
week study. Most frequently detected 16S rRNA gene sequences AU SA
Bacteria; Acidobacteria; Acidobacteria; Acidobacteriales;
Acidobacteriaceae; sf_14 17 17 Bacteria; Acidobacteria;
Acidobacteria-6; Unclassified; Unclassified; sf_1 16 17 Bacteria;
Acidobacteria; Solibacteres; Unclassified; Unclassified; sf_1 17 17
Bacteria; Actinobacteria; Actinobacteria; Actinomycetales;
Cellulomonadaceae; sf_1 17 17 Bacteria; Actinobacteria;
Actinobacteria; Actinomycetales; Corynebacteriaceae; sf_1 16 17
Bacteria; Actinobacteria; Actinobacteria; Actinomycetales;
Gordoniaceae; sf_1 17 17 Bacteria; Actinobacteria; Actinobacteria;
Actinomycetales; Kineosporiaceae; sf_1 17 17 Bacteria;
Actinobacteria; Actinobacteria; Actinomycetales; Microbacteriaceae;
sf_1 16 17 Bacteria; Actinobacteria; Actinobacteria;
Actinomycetales; Micrococcaceae; sf_1 17 17 Bacteria;
Actinobacteria; Actinobacteria; Actinomycetales;
Micromonosporaceae; sf_1 17 17 Bacteria; Actinobacteria;
Actinobacteria; Actinomycetales; Mycobacteriaceae; sf_1 17 17
Bacteria; Actinobacteria; Actinobacteria; Actinomycetales;
Nocardiaceae; sf_1 17 17 Bacteria; Actinobacteria; Actinobacteria;
Actinomycetales; Promicromonosporaceae; sf_1 17 17 Bacteria;
Actinobacteria; Actinobacteria; Actinomycetales;
Pseudonocardiaceae; sf_1 16 17 Bacteria; Actinobacteria;
Actinobacteria; Actinomycetales; Streptomycetaceae; sf_1 17 17
Bacteria; Actinobacteria; Actinobacteria; Actinomycetales;
Thermomonosporaceae; sf_1 16 17 Bacteria; Actinobacteria;
Actinobacteria; Actinomycetales; Unclassified; sf_3 17 17 Bacteria;
Actinobacteria; Actinobacteria; Rubrobacterales; Rubrobacteraceae;
sf_1 16 17 Bacteria; Actinobacteria; Actinobacteria; Unclassified;
Unclassified; sf_1 16 17 Bacteria; Actinobacteria; BD2-10 group;
Unclassified; Unclassified; sf_2 17 16 Bacteria; Bacteroidetes;
Sphingobacteria; Sphingobacteriales; Unclassified; sf_3 16 17
Bacteria; Chloroflexi; Anaerolineae; Chloroflexi-la; Unclassified;
sf_1 16 17 Bacteria; Chloroflexi; Anaerolineae; Unclassified;
Unclassified; sf_9 16 17 Bacteria; Chloroflexi; Dehalococcoidetes;
Unclassified; Unclassified; sf_1 16 17 Bacteria; Cyanobacteria;
Cyanobacteria; Chloroplasts; Chloroplasts; sf_5 17 17 Bacteria;
Cyanobacteria; Cyanobacteria; Plectonema; Unclassified; sf_1 16 17
Bacteria; Cyanobacteria; Unclassified; Unclassified; Unclassified;
sf_5 16 17 Bacteria; Firmicutes; Bacilli; Bacillales; Bacillaceae;
sf_1 17 17 Bacteria; Firmicutes; Bacilli; Bacillales;
Halobacillaceae; sf_1 17 17 Bacteria; Firmicutes; Bacilli;
Bacillales; Paenibacillaceae; sf_1 16 17 Bacteria; Firmicutes;
Bacilli; Lactobacillales; Enterococcaceae; sf_1 17 17 Bacteria;
Firmicutes; Bacilli; Lactobacillales; Streptococcaceae; sf_1 16 17
Bacteria; Firmicutes; Catabacter; Unclassified; Unclassified; sf_1
16 17 Bacteria; Firmicutes; Clostridia; Clostridiales;
Clostridiaceae; sf_12 17 17 Bacteria; Firmicutes; Clostridia;
Clostridiales; Lachnospiraceae; sf_5 17 17 Bacteria; Firmicutes;
Clostridia; Clostridiales; Peptococc/Acidaminococc; sf_11 17 17
Bacteria; Firmicutes; Clostridia; Clostridiales;
Peptostreptococcaceae; sf_5 17 17 Bacteria; Firmicutes; Clostridia;
Clostridiales; Unclassified; sf_17 16 17 Bacteria; Firmicutes;
Unclassified; Unclassified; Unclassified; sf_8 16 17 Bacteria;
Nitrospira; Nitrospira; Nitrospirales; Nitrospiraceae; sf_1 17 16
Bacteria; OP3; Unclassified; Unclassified; Unclassified; sf_4 16 17
Bacteria; Proteobacteria; Alphaproteobacteria; Acetobacterales;
Acetobacteraceae; sf_1 17 16 Bacteria; Proteobacteria;
Alphaproteobacteria; Azospirillales; Unclassified; sf_1 16 17
Bacteria; Proteobacteria; Alphaproteobacteria; Bradyrhizobiales;
Beijerinck/Rhodoplan/Methylocyst; sf_3 17 17 Bacteria;
Proteobacteria; Alphaproteobacteria; Bradyrhizobiales;
Bradyrhizobiaceae; sf_1 17 17 Bacteria; Proteobacteria;
Alphaproteobacteria; Bradyrhizobiales; Hyphomicrobiaceae; sf_1 17
17 Bacteria; Proteobacteria; Alphaproteobacteria; Bradyrhizobiales;
Methylobacteriaceae; sf_1 16 17 Bacteria; Proteobacteria;
Alphaproteobacteria; Ellin314/wr0007; Unclassified; sf_1 16 17
Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales;
Bradyrhizobiaceae; sf_1 16 17 Bacteria; Proteobacteria;
Alphaproteobacteria; Rhizobiales; Phyllobacteriaceae; sf_1 17 17
Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales;
Unclassified; sf_1 16 17 Bacteria; Proteobacteria;
Alphaproteobacteria; Rhodobacterales; Rhodobacteraceae; sf_1 17 17
Bacteria; Proteobacteria; Alphaproteobacteria; Rickettsiales;
Unclassified; sf_1 17 17 Bacteria; Proteobacteria;
Alphaproteobacteria; Sphingomonadales; Sphingomonadaceae; sf_1 17
17 Bacteria; Proteobacteria; Alphaproteobacteria; Sphingomonadales;
Sphingomonadaceae; sf_15 17 17 Bacteria; Proteobacteria;
Alphaproteobacteria; Unclassified; Unclassified; sf_6 17 17
Bacteria; Proteobacteria; Betaproteobacteria; Burkholderiales;
Alcaligenaceae; sf_1 16 17 Bacteria; Proteobacteria;
Betaproteobacteria; Burkholderiales; Burkholderiaceae; sf_1 16 17
Bacteria; Proteobacteria; Betaproteobacteria; Burkholderiales;
Comamonadaceae; sf_1 16 17 Bacteria; Proteobacteria;
Betaproteobacteria; Burkholderiales; Oxalobacteraceae; sf_1 17 17
Bacteria; Proteobacteria; Betaproteobacteria; Burkholderiales;
Ralstoniaceae; sf_1 16 17 Bacteria; Proteobacteria;
Betaproteobacteria; Methylophilales; Methylophilaceae; sf_1 16 17
Bacteria; Proteobacteria; Betaproteobacteria; Rhodocyclales;
Rhodocyclaceae; sf_1 16 17 Bacteria; Proteobacteria;
Betaproteobacteria; Unclassified; Unclassified; sf_3 17 17
Bacteria; Proteobacteria; Deltaproteobacteria; Syntrophobacterales;
Syntrophobacteraceae; sf_1 16 17 Bacteria; Proteobacteria;
Epsilonproteobacteria; Campylobacterales; Campylobacteraceae; sf_3
17 17 Bacteria; Proteobacteria; Epsilonproteobacteria;
Campylobacterales; Helicobacteraceae; sf_3 17 17 Bacteria;
Proteobacteria; Epsilonproteobacteria; Campylobacterales;
Unclassified; sf_1 17 17 Bacteria; Proteobacteria;
Gammaproteobacteria; Alteromonadales; Alteromonadaceae; sf_1 16 17
Bacteria; Proteobacteria; Gammaproteobacteria; Chromatiales;
Chromatiaceae; sf_1 16 17 Bacteria; Proteobacteria;
Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; sf_1 16
17 Bacteria; Proteobacteria; Gammaproteobacteria;
Enterobacteriales; Enterobacteriaceae; sf_6 17 17 Bacteria;
Proteobacteria; Gammaproteobacteria; Legionellales; Unclassified;
sf_1 17 17 Bacteria; Proteobacteria; Gammaproteobacteria;
Legionellales; Unclassified; sf_3 16 17 Bacteria; Proteobacteria;
Gammaproteobacteria; Pseudomonadales; Moraxellaceae; sf_3 16 17
Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales;
Pseudomonadaceae; sf_1 16 17 Bacteria; Proteobacteria;
Gammaproteobacteria; Unclassified; Unclassified; sf_3 17 17
Bacteria; Proteobacteria; Gammaproteobacteria; Xanthomonadales;
Xanthomonadaceae; sf_3 17 17 Bacteria; TM7; TM7-3; Unclassified;
Unclassified; sf_1 16 17 Bacteria; Unclassified; Unclassified;
Unclassified; Unclassified; sf_148 16 17 Bacteria; Unclassified;
Unclassified; Unclassified; Unclassified; sf_160 17 17 Bacteria;
Verrucomicrobia; Verrucomicrobiae; Verrucomicrobiales;
Verrucomicrobiaceae; sf_7 17 17 Number of sub-families detected in
all samples over 17 week period 43 80 Italic text indicates
sub-families not found in all 17 weeks. AU = Austin, SA = San
Antonio.
TABLE-US-00008 TABLE S8 Bacterial sub-families containing pathogens
of public health and bioterrorism significance and their relatives
that were detected in aerosols over the 17 week monitoring period.
Austin San Antonio Weeks % of Weeks % of Pathogens and relatives
taxon # detected weeks detected weeks Bacillus anthracis Bacillus
cohnii, B. psychrosaccharolyticus, 3439 17 100.0 17 100.0 B.
benzoevorans Bacillus megaterium 3550 11 64.7 12 70.6 Bacillus
horikoshii 3904 9 52.9 14 82.4 Bacillus litoralis, B. macroides, B.
3337 5 29.4 8 47.1 psychrosaccharolyticus Staphylococcus
saprophyticus, S. xylosus, S. 3659 7 41.2 15 88.2 cohnii Bacillus
anthracis, cereus, thuringiensis, 3262 0 0.0 1 5.9 mycoides +
others Rickettsia prowazekii - rickettsii Rickettsia australis, R.
eschlimannii, R. typhi, 7556 2 11.8 5 29.4 R. tarasevichiae +
others Rickettsia prowazekii 7114 0 0.0 0 0.0 Rickettsia
rickettsii, R. japonica, R. honei + 6809 4 23.5 10 58.8 others
Burkholderia mallei - pseudomallei Burkholderia pseudomallei, B.
thailandensis 7870 10 58.8 14 82.4 Burkholderia mallei 7747 10 58.8
8 47.1 Burkholderia pseudomallei, Burkholderia 8097 13 76.5 15 88.2
cepacia, B. tropica, B. gladioli, B. stabilis, B. plantarii +
others Clostridum botulinum - perfringens Clostridium butyricum, C.
baratii, C. 4598 3 17.6 10 58.8 sardiniense + others Clostridium
botulinum type C 4587 2 11.8 4 23.5 Clostridium perfringens 4576 1
5.9 1 5.9 Clostridium botulinum type G 4575 3 17.6 7 41.2
Clostridium botulinum types B and E 4353 0 0.0 0 0.0 Francisella
tularensis Tilapia parasite 9554 1 5.9 2 11.8 Francisella
tularensis 9180 0 0.0 0 0.0
TABLE-US-00009 TABLE S9 Distribution of array taxa among Bacterial
and Archaeal phyla. Numbers of taxa in phylum Phyla represented on
array Archaea Crenarchaeota 79 Euryarchaeota 224 Korarchaeota 3
YNPFFA 1 Archaeal taxa subtotal 307 Bacteria 1959 group 1
Acidobacteria 98 Actinobacteria 810 AD3 1 Aquificae 19
Bacteroidetes 880 BRC1 3 Caldithrix 2 Chlamydiae 27 Chlorobi 21
Chloroflexi 117 Chrysiogenetes 1 Coprothermobacteria 3
Cyanobacteria 202 Deferribacteres 5 Deinococcus-Thermus 18
Dictyoglomi 5 DSS1 2 EM3 2 Fibrobacteres 4 Firmicutes 2012
Fusobacteria 29 Gemmatimonadetes 15 LD1PA group 1 Lentisphaerae 8
marine group A 5 Natronoanaerobium 7 NC10 4 Nitrospira 29 NKB19 2
OD1 4 OD2 6 OP1 5 OP10 12 OP11 20 OP3 5 OP5 3 OP8 8 OP9/JS1 12 OS-K
2 OS-L 1 Planctomycetes 182 Proteobacteria 3170 SPAM 2 Spirochaetes
150 SR1 4 Synergistes 19 Termite group 1 6 Thermodesulfobacteria 4
Thermotogae 15 TM6 5 TM7 45 Unclassified 329 Verrucomicrobia 78 WS1
2 WS3 7 WS5 1 WS6 4 Bacterial taxa subtotal 8434 Total taxa
8741
EQUIVALENTS
[0085] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the present
embodiments. The foregoing description and Examples detail certain
preferred embodiments and describes the best mode contemplated by
the inventors. It will be appreciated, however, that no matter how
detailed the foregoing may appear in text, the present embodiments
may be practiced in many ways and the present embodiments should be
construed in accordance with the appended claims and any
equivalents thereof.
[0086] The term "comprising" is intended herein to be open-ended,
including not only the recited elements, but further encompassing
any additional elements.
Sequence CWU 1
1
28120DNAArtificial SequenceArtificially Synthesized Primer
1agrgtttgat cmtggctcag 20219DNAArtificial SequenceArtificially
Synthesized Primer 2ggttaccttg ttacgactt 19320DNAArtificial
SequenceArtificially Synthesized Primer 3cgactacctg gactgacact
20420DNAArtificial SequenceArtificially Synthesized Primer
4caccggcagt ctccttagag 20519DNAArtificial SequenceArtificially
Synthesized Primer 5accaaggcta cgacgggta 19619DNAArtificial
SequenceArtificially Synthesized Primer 6acacaccgca tgtcaaacc
19718DNAArtificial SequenceArtificially Synthesized Primer
7gggtggtaat gccsgatg 18818DNAArtificial SequenceArtificially
Synthesized Primer 8ccrccgttac accgggaa 18920DNAArtificial
SequenceArtificially Synthesized Primer 9caatggactc aagcctgatg
201018DNAArtificial SequenceArtificially Synthesized Primer
10ctctagcctg cccgtttc 181118DNAArtificial SequenceArtificially
Synthesized Primer 11gagaggatga tcagccag 181222DNAArtificial
SequenceArtificially Synthesized Primer 12tacggytacc ttgttacgac tt
221324DNAArtificial SequenceArtificially Synthesized Primer
13tccgtaggtg gctgttcaag tctg 241424DNAArtificial
SequenceArtificially Synthesized Primer 14gctttcgtcc ctcagtgtca
gttg 241524DNAArtificial SequenceArtificially Synthesized Primer
15tgtcgtgaga tgttgggtta agtc 241624DNAArtificial
SequenceArtificially Synthesized Primer 16tgagccgtgg tttaagagat
tagc 241720DNAArtificial SequenceArtificially Synthesized Primer
17gcctcacgcc ataagattag 201822DNAArtificial SequenceArtificially
Synthesized Primer 18gtgctttctt ctgtaagtaa cg 221915DNAArtificial
SequenceArtificially Synthesized Primer 19tcgaaaagcg tgggg
152015DNAArtificial SequenceArtificially Synthesized Primer
20cttcctcccc cgttc 152116DNAArtificial SequenceArtificially
Synthesized Primer 21gaaactgccc agacac 162216DNAArtificial
SequenceArtificially Synthesized Primer 22agtaacgttc gcacag
162318DNAArtificial SequenceArtificially Synthesized Primer
23ggatgacact tttcggag 182418DNAArtificial SequenceArtificially
Synthesized Primer 24aattccatct gcctctcc 182517DNAArtificial
SequenceArtificially Synthesized Primer 25ggcggcgcgt tttaagc
172617DNAArtificial SequenceArtificially Synthesized Primer
26actcgggtgg tgtgacg 172719DNAArtificial SequenceArtificially
Synthesized Primer 27aytgggcgta aagagttgc 192822DNAArtificial
SequenceArtificially Synthesized Primer 28tacggytacc ttgttacgac tt
22
* * * * *
References