U.S. patent application number 14/283649 was filed with the patent office on 2015-11-26 for maintenance medium for primate pluripotent stem cells.
The applicant listed for this patent is Bourbon Corporation. Invention is credited to Akito MATSUSHIMA, Sakiko TAKIZAWA, Tadayuki YOKOYAMA.
Application Number | 20150335010 14/283649 |
Document ID | / |
Family ID | 54555088 |
Filed Date | 2015-11-26 |
United States Patent
Application |
20150335010 |
Kind Code |
A1 |
MATSUSHIMA; Akito ; et
al. |
November 26, 2015 |
MAINTENANCE MEDIUM FOR PRIMATE PLURIPOTENT STEM CELLS
Abstract
Provided are a maintenance medium for primate pluripotent stem
cells, and a method for preserving and a method for controlling
proliferation of primate pluripotent stem cells using the medium.
The maintenance medium for human pluripotent stem cells according
to the present invention includes xylose as a saccharide.
Inventors: |
MATSUSHIMA; Akito;
(Matsumoto-shi, JP) ; TAKIZAWA; Sakiko;
(Matsumoto-shi, JP) ; YOKOYAMA; Tadayuki;
(Matsumoto-shi, JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Bourbon Corporation |
Kashiwazaki-shi |
|
JP |
|
|
Family ID: |
54555088 |
Appl. No.: |
14/283649 |
Filed: |
May 21, 2014 |
Current U.S.
Class: |
435/366 ;
435/363; 435/374 |
Current CPC
Class: |
A01N 1/0221 20130101;
C12N 2501/00 20130101; C12N 5/0696 20130101; C12N 2500/34 20130101;
A01N 1/0226 20130101 |
International
Class: |
A01N 1/02 20060101
A01N001/02 |
Claims
1. A maintenance medium for pluripotent stem cells, comprising
xylose as a saccharide, which is substantially free of glucose.
2. The maintenance medium for pluripotent stem cells according to
claim 1, wherein the primate pluripotent stem cells are human
pluripotent stem cells.
3. The maintenance medium for pluripotent stem cells according to
claim 1, wherein the primate pluripotent stem cells are human iPS
cells.
4. The maintenance medium for pluripotent stem cells according to
claim 1, wherein the xylose concentration is 0.7 to 12.0 g/L at the
final concentration.
5. The maintenance medium for pluripotent stem cells according to
claim 1, wherein the maintenance medium is a culture medium for
human iPS cells containing xylose in place of glucose.
6. The maintenance medium for pluripotent stem cells according to
claim 5, wherein the basal medium of a culture medium for human iPS
cells is a DMEM/F12 medium.
7. A method for preserving primate pluripotent stem cells, which
comprises maintaining primate pluripotent stem cells using a medium
comprising xylose as a saccharide, which is substantially free of
glucose.
8. The method according to claim 7, wherein the primate pluripotent
stem cells are human pluripotent stem cells.
9. The method according to claim 7, wherein the primate pluripotent
stem cells are human iPS cells.
10. The method according to claim 7, wherein the xylose
concentration is 0.7 to 12.0 g/L at the final concentration.
11. The method according to claim 7, wherein the maintenance medium
is a culture medium for human iPS cells containing xylose in place
of glucose.
12. The method according to claim 11, wherein the basal medium of a
culture medium for human iPS cells is a DMEM/F12 medium.
13. A method for controlling proliferation of primate pluripotent
stem cells, which comprises inhibiting the proliferation of primate
pluripotent stem cells using a medium comprising xylose as a
saccharide, which is substantially free of glucose.
14. The method according to claim 13, which further comprises
promoting the proliferation of primate pluripotent stem cells using
a medium comprising glucose.
15. The method according to claim 13, wherein the primate
pluripotent stem cells are human pluripotent stem cells.
16. The method according to claim 13, wherein the primate
pluripotent stem cells are human iPS cells.
17. The method according to claim 13, wherein the xylose
concentration is 0.7 to 12.0 g/L at the final concentration.
18. The method according to claim 13, wherein the maintenance
medium is a culture medium for human iPS cells containing xylose in
place of glucose.
19. The method according to claim 18, wherein the basal medium of a
culture medium for human iPS cells is a DMEM/F12 medium.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] The present invention relates to a maintenance medium for
primate pluripotent stem cells, comprising xylose.
[0003] 2. Description of the Related Art
[0004] Pluripotent stem cells such as human ES cells (embryonic
stem cells) and iPS cells (induced pluripotent stem cells) have
been expected to be used and applied in various fields including
regenerative medicine and cell therapy because they have the
ability to be differentiated into various cells or tissues such as
nerve cells and cardiac muscle cells, i.e., pluripotency.
Pluripotent stem cells can be grown by culture after cell
establishment. However, in pluripotent stem cells of primates
including humans, it is not easy to grow the cells while
maintaining the cell-specific properties, i.e., undifferentiation
status and pluripotency (multipotency).
[0005] In order to grow human ES cells or human iPS cells while
maintaining the undifferentiation status and the pluripotency, it
is usually needed to culture these cells in coexistence with feeder
cells, or to add substances for maintaining undifferentiation
status, for example, ascorbic acid, basic fibroblast growth factor
(bFGF), and transforming growth factor .beta.-3 (TGF-.beta.3), to a
medium (refer to WO 2011/058558). However, the passage process in
culture in coexistence with feeder cells is complicated, and many
of substances for maintaining undifferentiation status are
expensive. In addition, for human iPS cells, since it is known that
the properties of the cells are changed when the passage number
exceeds a certain number, it is preferable to make the passage
number as small as possible.
[0006] Thus, cryopreservation is usually performed if the
properties are maintained consistently, i.e., cells are preserved,
for a medium and long term. However, primate, especially human, ES
cells and iPS cells are known to be sensitive to freezing and
thawing and to have a low viability after cryopreservation.
Therefore, frequent cryopreservation cannot be performed for
primate pluripotent stem cells.
[0007] Meanwhile, for human ES cells and iPS cells, it is difficult
to prepare cells of different origin to a desired cell
concentration during the same period because the growth rate is
different by established cell line. For human ES cells and iPS
cells, it is recommended to change a medium every day due to their
fast metabolism, and the risk of contamination is high, placing a
burden on researchers.
[0008] Therefore, in culture of primate pluripotent stem cells such
as human ES cells and iPS cells, methods for simply maintaining and
preserving pluripotent stem cells without cell passage while
maintaining the properties of pluripotent stem cells other than
cryopreservation are required. In other words, methods for
temporarily controlling the proliferation of pluripotent stem cells
without changing the properties of the cells are required.
[0009] Xylose is one of the constituent sugars of sugar chains, and
plays an important role in vivo, such as in intercellular
communication. Xylose is also known to be abundantly contained in
woody biomass, and the expansion of its use as unused resources in
various fields has been required. However, in the field of culture
cells, xylose has not been used as a saccharide in a medium because
cells are considered not to be able to use xylose as energy.
[0010] The present inventors previously confirmed the effects of
various saccharides (e.g., glucose, xylose, galactose, and the
like) on mouse ES cells, and reported the possibility that xylose
maintains the undifferentiation status and its cell proliferation
effects in mouse ES cells (Tadayuki Yokoyama et al., Effects of
various sugars on cell proliferation and EB formation of mouse ES
cells, The 7th Congress of the Japanese Society for Regenerative
Medicine, Program and Abstract, Vol. 7, pp. 239, 2008; Tadayuki
Yokoyama et al., Xylose maintains the undifferentiation status of
mouse ES cells, The 8th Congress of the Japanese Society for
Regenerative Medicine, Program and Abstract, Vol. 8, pp. 221, 2009;
Sakiko Takizawa-Shirasawa et. al., The 6th International Niigata
Symposium on Diet and Health, pp. 152, 2012.)
[0011] However, these literatures have no description of primate
pluripotent stem cells, which is remarkably sensitive to changes in
culture environment compared with mouse ES cells. To the inventors'
knowledge, there are no reports on the use of xylose for cells
other than mouse ES cells.
[0012] The present inventors found this time that in human iPS
cells, when a medium in which glucose contained in a commercially
available common medium for human iPS cells is replaced by xylose
is used, the viability can be maintained and cell proliferation can
be inhibited while the undifferentiation status and the
pluripotency are maintained. In other words, human iPS cells were
successfully maintained and preserved without cryopreservation and
passage while the properties of human iPS cells are maintained.
Despite the fact that saccharides other than glucose had usually
been considered not to be able to be used as energy in cells, it
was surprising that the viability could be maintained and the cells
could be maintained at normal culture temperature for a long time
over 1 week while the undifferentiation status and the
pluripotency, which tend to be lost by culture environment
degradation, are maintained. The present invention is based on
these findings.
SUMMARY OF THE INVENTION
[0013] Thus, it is an object of the present invention to provide a
maintenance medium for primate pluripotent stem cells, and a method
for preserving and a method for controlling proliferation of
primate pluripotent stem cells using the medium.
[0014] A maintenance medium for primate pluripotent stem cells
according to the present invention includes xylose as a saccharide
and is substantially free of glucose.
[0015] According to one aspect of the present invention, in the
maintenance medium for primate pluripotent stem cells, primate
pluripotent stem cells are human pluripotent stem cells.
[0016] According to one aspect of the present invention, in the
maintenance medium for primate pluripotent stem cells, human
pluripotent stem cells are human iPS cells.
[0017] According to one preferred aspect of the present invention,
in the maintenance medium for primate pluripotent stem cells, a
xylose concentration is 0.7 to 12.0 g/L at the final
concentration.
[0018] According to one aspect of the present invention, in the
maintenance medium for primate pluripotent stem cells, the medium
is a culture medium for human iPS cells containing xylose in place
of glucose.
[0019] According to one preferred aspect of the present invention,
in the maintenance medium for primate pluripotent stem cells, the
basal medium of a culture medium for human iPS cells is a DMEM/F12
medium.
[0020] According to one aspect of the present invention, there is
provided a method for preserving primate pluripotent stem cells,
including the maintenance of primate pluripotent stem cells using a
medium including xylose as a saccharide, which is substantially
free of glucose.
[0021] According to one aspect of the present invention, a method
for controlling proliferation of primate pluripotent stem cells
which includes inhibiting the proliferation of primate pluripotent
stem cells using a medium including xylose as a saccharide, which
is substantially free of glucose, is provided.
[0022] According to one aspect of the present invention, the method
for controlling proliferation further includes the promotion of the
proliferation of primate pluripotent stem cells using a medium
containing glucose.
[0023] According to the maintenance medium for pluripotent stem
cells of the present invention, the undifferentiation status and
the pluripotency of pluripotent stem cells can be maintained
without the addition of undifferentiation-maintaining factors and
cell proliferation can be inhibited under normal culture
conditions. Therefore, a maintenance medium for pluripotent stem
cells according to the present invention is extremely useful in the
short-term preservation and the maintenance of pluripotent stem
cells that are sensitive to freezing.
[0024] Xylose used in the present invention is abundantly contained
in woody unused resources, and thus it is expected that the cost
can be reduced.
[0025] Furthermore, a method for preserving and a method for
controlling proliferation of pluripotent stem cells according to
the present invention involve only the change of a normal medium
with a maintenance medium for pluripotent stem cells of the present
invention. Thus, the culture protocol for pluripotent stem cells
need not be modified at all, and these methods do not require skill
and are very simple.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] FIGS. 1A-1D show the results of microscopy when human iPS
cell 253G1 lines of Example 1 were cultured in a glucose medium for
iPS cells or xylose media for iPS cells at various concentrations
(media of the present invention) (40 times magnification). The
xylose media for iPS cells of (A) and (B) contain dialysed KSR, and
the xylose media for iPS cells of (C) and (D) contain normal KSR
that is not dialysed.
[0027] FIGS. 2A-2B show the results of microscopy when human iPS
cell 201B7 lines of Example 1 were cultured in a glucose medium for
iPS cells or xylose media for iPS cells at various concentrations
(media of the present invention) (40 times magnification). The
xylose media for iPS cells of (A) and (B) contain dialysed KSR.
[0028] FIG. 3 shows the results of microscopy when human iPS cell
253G1 lines of Example 1 were cultured for 120 hours in a glucose
medium for iPS cells or xylose media for iPS cells at
concentrations of 3 g/L or 15 g/L (media of the present invention)
(40 times magnification). The xylose media for iPS cells contain
normal KSR that is not dialysed.
[0029] FIG. 4 shows the results of microscopy when human iPS cell
253G1 lines of Example 1 were cultured in a glucose medium for iPS
cells or a D- or L-xylose medium for iPS cells (a medium of the
present invention) (40 times magnification). The D- or L-xylose
medium for iPS cells contains normal KSR that is not dialysed.
[0030] FIG. 5A-5D show the results of RT-qPCR when human iPS cell
253G1 lines and 201B7 lines of Example 1 were cultured in a glucose
medium for iPS cells or xylose media for iPS cells at various
concentrations (media of the present invention). The xylose media
for iPS cells contain normal KSR that is not dialysed.
[0031] FIG. 6 is a photograph showing each organ recovered at 4
weeks after transplantation of human iPS cell 253G1 lines that were
cultured for 24 hours in a glucose medium for iPS cells or a xylose
medium for iPS cells of Example 1 or feeder cells into the kidney
and the spleen of SCID mice. The xylose medium for iPS cells
contains normal KSR that is not dialysed.
[0032] FIG. 7 shows the results of microscopy of HE staining of a
paraffin section of each organ recovered at 4 weeks after
transplantation of human iPS cell 253G1 lines that were cultured
for 24 hours in a glucose medium for iPS cells or a xylose medium
for iPS cells of Example 1 or feeder cells into the kidney and the
spleen of SCID mice (200 times magnification). The xylose medium
for iPS cells contains normal KSR that is not dialysed.
[0033] FIG. 8 shows the results of microscopy when a colony of the
human iPS cell 253G1 lines of Example 1 was cultured by changing a
glucose medium for iPS cells with xylose media for iPS cells at
various concentrations, the media were changed with a glucose
medium for iPS cells again at 24 hours after culture, and the cells
were cultured in the glucose medium for iPS cells for 24 hours (40
times magnification). The xylose media for iPS cells contain normal
KSR that is not dialysed.
[0034] FIG. 9A-9B are graphs showing the cell viability evaluated
by a MTT assay when human iPS cells (disease iPS cells derived from
Ehlers-Danlos syndrome patients (P-iPS cells)) of Example 2 were
cultured in a glucose medium for iPS cells or a xylose medium for
iPS cells. The graph (A) shows the cell viability when the cells
were cultured in each medium for 8 days, and the graph (B) shows
the cell viability when the cells were cultured in each medium for
8 days, the medium was changed with a normal glucose medium, and
the cells were further cultured for 8 days.
DETAILED DESCRIPTION OF THE INVENTION
Maintenance Medium for Pluripotent Stem Cells
[0035] In the present specification, "primate pluripotent stem
cells" mean pluripotent stem cells that can be artificially
cultured ex vivo. Primates include humans, anthropoids such as
orangutans, chimpanzees, and gorillas, prosimians, and monkeys. In
the present specification, "pluripotent stem cells" mean cells
having self-renewal capacity that produce a cell the same as their
own, and having pluripotency, which means differentiation into
other types of cells constituting tissues and organs. Pluripotent
stem cells include, for example, embryonic stem cells (ES cells),
induced pluripotent stem cells (iPS cells), embryonic germ cells
(EG cells), embryonal carcinoma cells (EC cells), and adult
pluripotent stem cells (APS cells). Primate pluripotent stem cells
used in the present invention are preferably human pluripotent stem
cells, more preferably human ES cells or iPS cells, and still more
preferably human iPS cells. These pluripotent stem cells can be
obtained by methods well known to a person skilled in the art, or
commercially available pluripotent stem cells can be used.
[0036] "Pluripotency" means the ability to differentiate into all
differentiated cells belonging to ectoderm, mesoderm, or endoderm,
and the property of being able to differentiate into at least one
type of differentiated cells each belonging to ectoderm, mesoderm,
or endoderm, and can include the differentiation potency into germ
cells. Differentiated cells can differentiate into many types of
cells constituting body tissues and organs in the future. Whether
cells have pluripotency or not can be determined by, for example,
transplantation of pluripotent stem cells into SCID mice to form
teratoma and subsequent evaluation of whether triploblastic
(ectodermal, mesodermal, and endodermal) cells are differentiated
and formed from the morphology, or by in situ expression of various
differentiation markers.
[0037] "Undifferentiation status" means that cells are not
differentiated into a certain cell lineage yet, and stem cells
located relatively higher in the hierarchy have this property.
Whether cells have undifferentiation status or not can be
determined by measurement of undifferentiated cell markers and
differentiation markers. Specifically, if undifferentiated cell
markers are expressed and the expression of differentiation markers
is low, it can be considered that undifferentiation status is
maintained. In the case of human pluripotent stem cells,
undifferentiation markers used in the present invention include,
for example, Oct-4, Nanog, Nodal, Sox2, TDGF, DNMT3B, ZFP42, SSEA3,
SSEA4, and TRA1-60, and differentiation markers include, for
example, BCL6B, FOXN4, GATA6, Brachyury, and EOMES.
[0038] Xylose used as a saccharide in a maintenance medium for
pluripotent stem cells of the present invention abounds in woody
biomass, and a monosaccharide of pentose also called wood sugar.
Xylose used in the present invention may be D-xylose, which abounds
in nature, or may be L-xylose or DL-xylose prepared by synthesis.
Xylose used in the present invention is preferably D-xylose in
terms of low-cost preparation.
[0039] In the present specification, "maintenance medium for
pluripotent stem cells" means a medium suitable for maintenance of
pluripotent stem cells or its composition, and a medium that
enables the survival of a certain number of the cells for a certain
period without significant damage affecting the viability of the
cells while maintaining the undifferentiation status and the
pluripotency of pluripotent stem cells. Specifically, use of
maintenance medium for pluripotent stem cells of the present
invention can inhibit the proliferation of pluripotent stem cells
while maintaining the properties, i.e., undifferentiation status
and pluripotency, of pluripotent stem cells.
[0040] A maintenance medium for pluripotent stem cells of the
present invention can maintain the undifferentiation status and the
pluripotency of pluripotent stem cells if the maintenance medium
for pluripotent stem cells contains xylose as a saccharide even
when the medium does not substantially contain
undifferentiation-maintaining factors. In other words, xylose
contained in the maintenance medium for pluripotent stem cells of
the present invention has undifferentiation-maintaining effects on
pluripotent stem cells.
[0041] "Saccharide" means an energy source to be metabolized by
cells immersed in a medium for their survival. A saccharide
contained in a medium of the present invention is xylose, and
glucose is not substantially included. A saccharide contained in a
medium of the present invention includes xylose, and may further
include saccharides other than glucose, and preferably includes
only xylose.
[0042] The term "not substantially contain glucose" or
"substantially free of glucose" means that glucose is not contained
in a medium, or even if glucose is contained, the amount of glucose
contained is such that cells cannot use it as a saccharide, i.e.,
an energy source. Specifically, the amount of glucose for the total
amount of saccharides (100% by weight) contained in a medium is
desirably less than 20% by weight, preferably less than 15% by
weight, more preferably less than 10% by weight, still more
preferably less than 7% by weight, yet more preferably less than 5%
by weight, further preferably less than 4% by weight, further
preferably less than 3% by weight, further preferably less than 2%
by weight, further preferably less than 1% by weight, further
preferably less than 0.5% by weight, and particularly preferably
less than 0.1% by weight.
[0043] Metabolism of xylose by cells enables the cell proliferation
inhibitory effects, which are objects of the present invention.
"Cell proliferation inhibitory effects" mean maintenance of the
viability of cells and inhibition of cell proliferation. Inhibition
of cell proliferation enables the maintenance and preservation of
cells at a constant condition.
[0044] When converted into the amount of saccharides, the
metabolism of xylose by cells is less than the metabolism of
glucose (refer to Example 3(1) mentioned below). Therefore, use of
a maintenance medium for pluripotent stem cells of the present
invention can inhibit cell proliferation, and due to a low
metabolism of saccharides by cells, does not require daily medium
change, which is needed in normal culture, and can reduce the
burden on researchers.
[0045] Whether xylose is metabolized as a saccharide or not can be
determined by measurement of phosphoribosyl pyrophosphate (PRPP).
The present inventors found that PRPP is a metabolite specific to
xylose metabolism, and a substance that is not produced by glucose
metabolism or shows an extremely high value (refer to Example 3(2)
mentioned below). Therefore, the measurement of PRPP as a xylose
metabolism marker can confirm the metabolism of xylose.
Specifically, PRPP in cells or culture supernatants can be measured
with CE-TOFMS, HPLC, or LC-MSMS. Other than PRPP, NADP.sup.+,
NAD.sup.+, IMP, nicotinamide, or xanthine, which shows a higher
value than glucose metabolism, can be used as a xylose metabolism
marker. These substances can be measured with the same methods as
for PRPP.
[0046] Whether glucose is metabolized as a saccharide or not can be
determined by measurement of glucose 6-phosphate, fructose
1,6-diphosphate, glyceraldehyde 3-phosphate, pyruvic acid, or
kynurenine. These substances can be measured with the same methods
as for PRPP.
[0047] The content of xylose in a maintenance medium for
pluripotent stem cells of the present invention is 0.7 g/L or more,
preferably 0.7 to 12.0 g/L, more preferably 2.3 to 12.0 g/L, still
more preferably 2.3 to 9.0 g/L, and yet more preferably 2.3 to 4.7
g/L at the final concentration for human pluripotent stem cells.
The content of xylose for the basal medium before preparation of a
maintenance medium for pluripotent stem cells of the present
invention is 1.0 g/L or more, preferably 1.0 to 15.0 g/L, more
preferably 3.0 to 15.0 g/L, still more preferably 3.0 to 9.0 g/L,
and yet more preferably 3.0 to 6.0 g/L. Since xylose has no
toxicity and is well water soluble, addition of a large amount of
xylose usually causes no substantial problems, but the amount is
desirably up to 24 g/L for a basal medium in terms of osmotic
pressure and cost.
[0048] A maintenance medium for pluripotent stem cells of the
present invention can be obtained by containing xylose in place of
glucose in a conventional medium used for pluripotent stem cell
culture, i.e., a normal culture medium for pluripotent stem cells
for proliferation. Specifically, a maintenance medium for
pluripotent stem cells of the present invention can be obtained by,
as needed, adding serum or serum substitutes or other components to
a basal medium in which glucose is replacement with xylose in the
medium. The proportion of replacement of glucose by xylose is
desirably more than 80%, preferably more than 90%, more preferably
more than 93%, still more preferably more than 95%, yet more
preferably more than 96%, further preferably more than 97%, further
e preferably more than 98%, further preferably more than 99%,
further preferably more than 99.5%, further preferably more than
99.9%, and particularly preferably 100%.
[0049] A basal medium include, for example, Dulbecco's modified
Eagle's medium (DMEM), Eagle's minimal essential medium (MEM),
Ham's F12 medium, DMEM/F12 medium, MCDB medium, Fisher's medium,
RPMI-1640 medium, and feeder-free medium (Essential 8.TM. medium
(Life Technologies Corporation)).
[0050] All serum or serum substitutes can be used if publicly
known. For example, serum includes FBS and FCS, and serum
substitutes include KSR, and the like.
[0051] Other components include non-essential amino acids, pH
adjustment agents, and the like.
[0052] If glucose in contained in serum or serum substitutes or
other components added to a basal medium, it is preferable to
remove glucose by membrane treatment. Membrane treatment can be
performed by, for example, using a dialysis membrane 36/32
(manufactured by EIDIA Co., Ltd.). Since KSR does not substantially
contain glucose, dialysis may not be performed.
[0053] According to one aspect of the present invention, there is
provided a method for preserving primate pluripotent stem cells,
which includes maintaining primate pluripotent stem cells using a
medium including xylose as a saccharide, which does not
substantially contain glucose.
[0054] The term "maintaining primate pluripotent stem cells" means
a procedure in which primate pluripotent stem cells are immersed in
a maintenance medium for pluripotent stem cells of the present
invention and placed under normal culture conditions. The
maintenance can inhibit cell proliferation and preserve cells for a
short period while the undifferentiation status and the
pluripotency of pluripotent stem cells are maintained. In a method
for preserving of the present invention, during preservation, an
only certain number of pluripotent stem cells need to survive and
pluripotent stem cells may proliferate. The proportion of
proliferation only needs to be lower than that when a normal
culture medium containing glucose is used.
[0055] According to the method for preserving of the present
invention, daily medium change need not be performed. Thus, risk of
contamination due to daily medium change can be avoided, and the
burden on researchers can be reduced.
[0056] As long as the undifferentiation status and the pluripotency
are maintained, the preservation period can be changed as
appropriate depending on the type of cells cultured, culture
objective, the type of a basal medium, or culture temperature. If
daily medium change is not performed, the period is preferably 4
days, and more preferably 2 days. If daily medium change is
performed, the period is preferably 6 days, and more preferably 3
days.
[0057] According to one aspect of the present invention, there is
provided a method for controlling proliferation of primate
pluripotent stem cells, which includes inhibiting the proliferation
of primate pluripotent stem cells using a medium including xylose
as a saccharide, which does not substantially contain glucose.
[0058] The term "cell proliferation control" means a procedure in
which cell proliferative capacity is stopped at a desired time, the
cell concentration is maintained without significant damage
affecting the viability of cells to the cells, and subsequently
cell proliferation is restarted at a desired time. In other words,
in a method for controlling cell proliferation of the present
invention, the proliferation of primate pluripotent stem cells can
be inhibited with a maintenance medium for pluripotent stem cells
of the present invention, and after a desired period elapsed, the
proliferation of primate pluripotent stem cells can be promoted
with a culture medium containing glucose. In a method for
controlling cell proliferation of the present invention, the growth
rate and the morphology of pluripotent stem cells following the
procedure in which the proliferation is inhibited with a
maintenance medium for pluripotent stem cells of the present
invention, and after an inhibition period passed, the proliferation
is restarted by change the medium with a normal culture medium for
pluripotent stem cells containing glucose are almost same as those
when pluripotent stem cells are cultured only in a normal culture
medium for pluripotent stem cells. Thus, in a method for
controlling cell proliferation of the present invention, cell
proliferation control can be performed without affecting the
proliferative capacity of pluripotent stem cells. Furthermore, the
method for controlling cell of the present invention can only be
performed by replacement a maintenance medium for pluripotent stem
cells of the present invention by a normal culture medium for
pluripotent stem cells containing glucose.
[0059] When plural types of primate pluripotent stem cells are
prepared and subjected to an experiment, since the growth rate
differs by type of pluripotent stem cells, even if a desired cell
concentration is obtained and the experiment is prepared for
certain pluripotent stem cells, the experiment for other
pluripotent stem cells with a slow growth rate may not be prepared.
In such cases, when a method for controlling proliferation of
primate pluripotent stem cells of the present invention is used,
the conditions for all cells subjected to an experiment can easily
be arranged by replacing the medium for prepared primate
pluripotent stem cells by a maintenance medium for pluripotent stem
cells of the present invention and by preserving the cells until
other pluripotent stem cells are prepared.
[0060] Cell proliferation control may be performed at normal cell
culture temperature and under normal cell culture environment
conditions.
[0061] As long as the undifferentiation status and the pluripotency
are maintained, the cell proliferation inhibition period can be
changed as appropriate depending on the type of cells cultured,
culture objective, the type of a basal medium, or culture
temperature. If daily medium change is not performed, cell
proliferation can be inhibited for at least 5 days, and more
preferably at least 2 days. If daily medium change is performed,
the period is preferably 10 days, and more preferably 5 days.
EXAMPLES
[0062] Examples of the present invention will be described in
detail below. However, the present invention is not limited by
these Examples.
Example 1
Culture of Human iPS Cells (253G1 Lines and 201B7 Lines) in a
Xylose Medium
(1) Preparation of Medium
[0063] A medium for human iPS cells (induced pluripotent stem
cells) was prepared each so that the composition was as
follows.
Control Medium (Glucose Medium for iPS Cells):
[0064] DMEM/F12 (Gibco BRL, Rockville, Md.), 20 volume % KSR
(Invitrogen), 2 mM L-glutamine (Gibco), 1.times.MEM non-essential
amino acid solution (Wako), 100 .mu.M .beta.-mercaptoethanol
(Sigma, St. Louis, Mo.), 50 U/mL penicillin and 50 .mu.g/mL
streptomycin (Gibco BRL), and 4 ng/mL basic FGF (Invitrogen).
Medium According to Present Invention (Xylose Medium for iPS
Cells):
[0065] Modified DMEM/F12 containing D-xylose at various
concentrations in place of glucose contained in a normal DMEM/F12
(M-DMEM, available from Nissui Pharmaceutical Co., Ltd.), 20 volume
% KSR (Invitrogen) or 20 volume % dialysed KSR (available from
Nissui Pharmaceutical Co., Ltd.) in which sugars (saccharides) are
removed by a dialysis membrane (dialysis membrane 36/32,
manufactured by EIDIA Co., Ltd.), 2 mM L-glutamine (Gibco),
1.times.MEM non-essential amino acid solution (Wako), 100 .mu.M
.beta.-mercaptoethanol (Sigma, St. Louis, Mo.), 50 U/mL penicillin
and 50 .mu.g/mL streptomycin (Gibco BRL), and 4 ng/mL basic FGF
(Invitrogen).
[0066] Xylose concentrations in a modified DMEM/F12 were prepared
so that the xylose concentrations contained in a basal medium
before medium preparation, a DMEM/F12, were 0, 1, 2, 3, 4, 5, 6, 9,
12, 15, 18, 21, and 24 g/L. In this example, unless mentioned as a
final concentration, the concentration of xylose or glucose
represents a concentration for a basal medium before medium
preparation. The final concentration of xylose in a medium after
preparation can be calculated from the xylose concentration in a
basal medium before medium preparation.times.77.5%. Since addition
of xylose is associated with variation of osmotic pressure,
adjustment was performed by adding sodium chloride in order to the
osmotic pressure was same as that in a normal DMEM/F12, i.e., a
glucose medium for iPS cells (glucose concentration: 3.15 g/L)
(specifically, value: 290 to 350 mOsm). In terms of osmotic
pressure, the critical concentration of xylose concentration was 24
g/L.
(2) Preparation of Human iPS Cells
[0067] As human iPS cells, 253G1 lines and 20167 lines (both were
available from iPS Academia Japan, Inc.) were used. The 253G1 lines
were human iPS (induced pluripotent stem) cell lines established by
introducing 3 factors (Oct3/4, Sox2, and Klf4) with retroviral
vectors, and the 201B7 lines were human iPS cell lines established
by introducing 4 factors (Oct3/4, Sox2, Klf4, and c-Myc) were
introduced into retroviral vectors.
[0068] Each of the human iPS cells (253G1 lines and 201B7 lines)
was cultured on a layer of MEF feeder cells (available from
Oriental Yeast Co., Ltd.) inactivated with mitomycin C (Sigma) in a
cell culture dish (6-well plate, available from Sanplatec
Corporation) coated with 0.1% by weight gelatin (Sigma) at
37.degree. C. in the presence of 5% CO.sub.2. The above mentioned
glucose medium for iPS cells was used, and medium change was
performed daily.
(3) Property Study of Human iPS Cells
[0069] After iPS cells were cultured on MEF feeder cells, only a
colony of the iPS cells was recovered using a dissociation solution
(1.times.trypsin (Gibco), 1 mg/mL collagenase type IV (Gibco), 20%
KSR (Gibco), 10 mM CaCl.sub.2 (Wako), and 1.times.PBS (Wako)), and
then the iPS cells were seeded on a 60 mm dish (available from AGC
Techno Glass Co., Ltd.) on which inactivated MEF feeder cells were
seeded with the number of cells of 0.6 to 1.8.times.10.sup.5, and
were cultured with the above mentioned glucose medium for iPS cells
at 37.degree. C. in the presence of 5% CO.sub.2 for 24 hours to
form a colony again.
[0070] After colony formation, the colony was cultured by changing
the glucose medium for iPS cells with xylose media for iPS cells
containing xylose at various concentrations (defined as "0 hour
after medium change (M.C.)"). The colony was cultured also in a
control medium (glucose medium for iPS cells). During culture
period, medium change was performed daily.
[0071] For each iPS cell colony, observation of the morphology,
confirmation of differentiation tendency by gene expression
analysis (RT-qPCR), and pluripotency study were performed.
[0072] Observation of Colony Morphology
[0073] The morphology of iPS cell colonies at 0, 24, 48, and 72
hours after medium change was observed with a light microscope
(IX70, manufactured by Olympus Corporation). The results of 253G1
lines are shown in FIGS. 1A and B (dialysed KSR) and Figs. C and D
(KSR), and the results of 201B7 lines are shown in FIGS. 2A and B
(dialysed KSR).
[0074] As shown in the results, in a xylose medium for iPS cells
containing xylose, no changes in colony morphology were observed
compared with a control medium, and the size of a colony was small.
In other words, the inhibition of cell proliferation can be
confirmed. In a control medium, many floating dead cells were also
observed, and it is considered that after 72 hours of medium
change, a xylose medium for iPS cells is more suitable as a culture
condition. Furthermore, when the xylose concentration was 5 g/L or
more, there were no differences in effects of concentration on the
morphology, i.e., the inhibition of proliferation and the
maintenance of undifferentiation status were observed. When the
concentration was 2 g/L or less, the collapse of a colony was
observed. At about 24 g/L, which is the critical concentration, the
compactness of a colony was slightly decreased and a colony showing
a differentiation tendency was observed. In 253G1 lines and 201B7
lines, there were no differences between iPS cell lines. There were
also no differences between KSR and dialysed KSR. Both KSR and
dialysed KSR did not contain glucose (analysis by HPLC-RI).
[0075] For a xylose medium for iPS cells in which xylose
concentrations were 3 g/L and 15 g/L, the morphology of iPS cell
colonies at 96 and 120 hours after culture was also observed with a
light microscope (IX70, manufactured by Olympus Corporation). The
results are shown in FIG. 3 (253G1 lines, KSR).
[0076] As shown in the results, in a control medium, when a
long-term culture was performed, a colony became excessively
larger, the colony morphology became difficult to be maintained,
and many floating dead cells were observed. On the other hand, in a
xylose medium for iPS cells, cell proliferation was inhibited, the
colony morphology was good while performing a long-term culture,
and the number of floating dead cells was small.
[0077] In addition, for a xylose medium for iPS cells in which
xylose concentration was 3 g/L, a medium containing L-xylose
(L-substance) in place of D-xylose (D-substance) was prepared, and
the morphology of iPS cell colonies at 0, 24, 48, and 72 hours
after culture was observed with a light microscope (IX70,
manufactured by Olympus Corporation). The results are shown in FIG.
4 (253G1 lines, KSR).
[0078] As shown in the results, there were no differences in colony
morphology and proliferation inhibitory effects between D-xylose
and L-xylose.
Gene Expression Analysis (RT-qPCR)
[0079] All RNAs of a colony of iPS cells (253G1 lines and 201B7
lines) at 48 or 72 hours after they were cultured in xylose media
for iPS cells at various concentrations were extracted with a
TRIzol reagent (Invitrogen, Carlsbad, Calif.). From the extracted
RNAs, cDNAs were prepared with Super Script II (Invitrogen). cDNA
samples were amplified with hOct-4, hNanog, hNodal, and hSox2 as an
undifferentiation marker and h-BCL6B and h-FOXN4 as a
differentiation marker of the primers in the following Table 1
(Thermal Cycler Dice, manufactured by Takara Bio Inc.).
TABLE-US-00001 TABLE 1 Primer Name Type Sequence hOct-4
Undifferentia- Forward: tion marker TCTATTTGGGAAGGTATTCAGC Reverse:
ATTGTTGTCAGCTTCCTCCA hNanog Undifferentia- Forward: tion marker
AGCTACAAACAGGTGAAGAC Reverse: GGTGGTAGGAAGAGTAAAGG hNodaI
Undifferentia- Forward: tion marker AGACATCATCCGCGACCTA Reverse:
CAAAAGCAAACGTCCAGTTCT hSox2 Undifferentia- Forward: tion marker
GGGGGAATGGACCTTGTATAG Reverse: GCAAAGCTCCTACCGTACCA h-BCL6B
Differentia- Forward: tion marker GAACGGGCTCGTCCACTAC Reverse:
CCCCAGGAACCAAGGAGT h-FOXN4 Differentia- Forward: tion marker
CCCAAGCCCATCTACTCGT Reverse: GTAGGGGAAGTGCTCCTTCAT .beta.-actin
Control Forward: marker CATCCGTAAAGACCFCTATGCCAAC Reverse:
ATGGAGCCACCGATCCACA Amplification 95.degree. C., 3 min. .fwdarw.
condition (95.degree. C., 3 min. .fwdarw. annealing temperature of
each primer, 30 sec., 72.degree. C., 30 sec.) .times. 35 cycles
[0080] The results are shown in FIGS. 5A to D. As is clear from the
results, in the iPS cells cultured in a xylose medium for iPS
cells, the expression of an undifferentiation marker equivalent to
that in a glucose medium for iPS cells was observed at 48 and 72
hours after medium change. In the iPS cells cultured in a xylose
medium for iPS cells, almost no expression of a differentiation
marker was observed compared with that in a glucose medium for iPS
cells, and almost no expression of a differentiation marker was
observed even at 96 and 120 hours after medium change (refer to
FIG. 5D). In other words, it was revealed that in iPS cells
cultured in a xylose medium for iPS cells, the undifferentiation
function was maintained and the differentiation was inhibited. In
253G1 lines and 20187 lines, there were no differences between iPS
cell lines.
Pluripotency Test
[0081] Human iPS cells (253G1 lines) cultured in xylose media for
iPS cells at concentrations of 3, 6, 9, and 15 g/L and in a glucose
medium for iPS cells and MEF feeder cells were recovered at 24
hours after culture, and 1 to 4.times.10.sup.6 cells were
transplanted into the kidney and the spleen of SCID mice (available
from CLEA Japan, Inc.). At 4 weeks after transplantation, the
kidney and the spleen were recovered from each mouse. The presence
or absence of tumor (teratoma) formation in the organs was
evaluated. The results are shown in FIG. 6.
[0082] Paraffin blocks were prepared from each organ obtained in
accordance with conventional methods, and HE staining was performed
to evaluate differentiation into triploblastic cells. The results
are shown in FIG. 7.
[0083] As shown in the results, although no tumors were observed in
the organs into which MEF feeder cells were transplanted, tumor
formation was observed in the organs into which iPS cells were
transplanted. In other words, since tumors could be formed by
transplanting iPS cells cultured in a xylose medium for iPS cells,
it could be confirmed that infinite proliferation, an important
function of iPS cells, was maintained regardless of xylose
concentration. Triploblastic cell-forming ability was confirmed in
all iPS cells; in other words, it could be confirmed that
pluripotency is maintained even when cells are cultured in a xylose
medium for iPS cells.
(4) Cell Proliferation Control
[0084] A colony was formed in accordance with the methods mentioned
in the above (3), and the glucose medium for iPS cells was replaced
by xylose media for iPS cells at concentrations of 3, 6, 9, and 15
g/L, and a colony of iPS cells (253G1 lines) were cultured in the
xylose media. At 24 hours after culture, the media were changed
again with a glucose medium for iPS cells. At 24 hours after
change, the morphology of iPS cells was observed. The results are
shown in FIG. 8.
[0085] As shown in the results, when a xylose medium for iPS cells
was changed with a glucose medium for iPS cells, any effects on the
morphology were not observed, and proliferation was restarted. In
other words, it was revealed that only by changing a xylose medium
for iPS cells of the present invention with a glucose medium for
iPS cells, proliferation of human iPS cells can be simply
controlled.
Example 2
Cell Proliferation Control of Human iPS Cells
[0086] (Disease iPS Cells Derived from Ehlers-Danlos Syndrome
Patients (P-iPS Cells))
(1) Preparation of Medium
[0087] A medium for human iPS cells (induced pluripotent stem
cells) was prepared each so that the composition was as
follows.
Control Medium (Glucose Medium for iPS Cells):
[0088] DMEM/F12 (Gibco BRL, Rockville, Md.), 20 volume % KSR
(Invitrogen), 2 mM L-glutamine (Gibco), 1.times.MEM non-essential
amino acid solution (Wako), 100 .mu.M .beta.-mercaptoethanol
(Sigma, St. Louis, Mo.), 50 U/mL penicillin and 50 .mu.g/mL
streptomycin (Gibco BRL), and 4 ng/mL basic FGF (Invitrogen).
Medium According to Present Invention (Xylose Medium for iPS
Cells):
[0089] Modified DMEM/F12 in which glucose contained in a normal
DMEM/F12 is changed with D-xylose (M-DMEM, available from Nissui
Pharmaceutical Co., Ltd.) (D-xylose concentration: 3.15 g/L), 20
volume % dialysed KSR (available from Nissui Pharmaceutical Co.,
Ltd.) in which sugars are removed by a dialysis membrane (dialysis
membrane 36/32, manufactured by EIDIA Co., Ltd.), 2 mM L-glutamine
(Gibco), 1.times.MEM non-essential amino acid solution (Wako), 100
.mu.M .beta.-mercaptoethanol (Sigma, St. Louis, Mo.), 50 U/mL
penicillin and 50 .mu.g/mL streptomycin (Gibco BRL), and 4 ng/mL
basic FGF (Invitrogen).
(2) Preparation of Human iPS Cells
[0090] As human iPS cells, disease iPS cells derived from the nerve
cells of Ehlers-Danlos syndrome patients (available from Shinshu
University) (hereinafter referred to as "P-iPS") were used. The
P-iPS cells were cultured on a layer of MEF feeder cells (available
from Oriental Yeast Co., Ltd.) inactivated with mitomycin C (Sigma)
in a cell culture dish (6-well plate, available from Sanplatec
Corporation) coated with 0.1% by weight gelatin (Sigma) at
37.degree. C. in the presence of 5% CO.sub.2. The above mentioned
glucose medium for iPS cells was used, and medium change was
performed daily.
(3) Proliferation Inhibitory Effects of Human iPS Cells
[0091] After P-iPS cells were cultured on MEF feeder cells, only a
colony of the P-iPS cells was recovered using 0.25% by weight
trypsin and 0.1 mg/mL collagenase IV (Invitrogen); then, the P-iPS
cells were seeded on a 96-well plate (available from AGC Techno
Glass Co., Ltd.) on which inactivated MEF feeder cells were seeded,
and were cultured with the above mentioned glucose medium for iPS
cells at 37.degree. C. in the presence of 5% CO.sub.2 for 4 days to
form a colony again.
[0092] After colony formation, the colony was cultured by changing
one medium with a xylose medium for iPS cells (defined as "0 days
after culture").
[0093] At 8 days after culture, P-iPS cells cultured in a xylose
medium for iPS cells were further cultured for 8 days by changing
the medium with a glucose medium for iPS cells again. During
culture period, medium change was performed daily.
[0094] At 0, 1, 4, and 8 days after culture and at 1, 4, and 8 days
after the medium was changed with a glucose medium again (9, 12,
and 16 days after culture), cell viability was measured by MTT
assay. MTT assay was performed for 6 wells each time.
MTT Assay
[0095] Measurement was performed in accordance with the product
manual with MTT Cell Growth Assay Kit (Chemicon). Specifically, 100
.mu.L of the medium of cells cultured in a 96-well plate was
replaced by a fresh medium, 10 .mu.L of a MTT reagent was added to
this medium, and the cells were incubated for 4 hours. Then, the
formazan dye (blue) produced by living cells was dissolved by
adding a lysate (0.04N HCl/isopropanol) and pipetting several
times, and measurement was performed with absorption wavelength of
570 nm and reference wavelength of 630 nm using a plate reader. For
the viability, mean.+-.SD of each was calculated by defining the
value on 0 days after culture as 100%.
[0096] The results are shown in FIGS. 9A and B.
Example 3
Metabolites of Human iPS Cells in Xylose Medium
(1) Saccharide Consumption in Each Medium
[0097] iPS cells (253G1 lines) were cultured for 24 hours with a
xylose medium for iPS cells or a glucose medium for iPS cells, the
consumption of each saccharide (sugar) contained in the supernatant
after culture was calculated. Measurement of each saccharide was
performed with HPLC (manufactured by Shimadzu Corporation). When
the amount at 0 hours after culture was defined as 100.0, the sugar
amount was 79.0 for a glucose medium for iPS cells and 88.2 for a
xylose medium for iPS cells, and when converted into sugar
consumption (%), it was 21.1% and 11.8%, respectively.
(2) Confirmation of Metabolites
[0098] For metabolites in cell samples when iPS cells (253G1 lines)
were cultured in a xylose medium for iPS cells, metabolome analysis
were performed. Specifically, cell samples and culture supernatants
were deproteinized by ultrafiltration, and the relative area of
detected substances among metabolites registered in the HTM
metabolite library was calculated with CE-TOFMS (manufactured by
Agilent Technologies, Inc.). As a control, those in a glucose
medium for iPS cells or a xylose stable isotope medium containing
the stable isotope (.sup.13C) of xylose (available from Omicron
Biochemicals, Inc.) were also analyzed. From the analysis results,
metabolites specific to each medium were identified as a metabolism
marker of each medium. The results are shown in Tables 2 and 3.
TABLE-US-00002 TABLE 2 Metabolism Markers of Xylose Glucose Xylose
Medium Xylose Stable Metabolite Medium for for iPS Isotope Medium
Name iPS Cells Cells (.sup.12C) (.sup.13C) PRPP N.D. 3.5E-03 N.D.
NADP.sup.+ 3.4E-03 4.7E-03 1.7E-03 NAD.sup.+ 1.2E-01 1.6E-01
3.2E-02 IMP 1.1E-03 1.6E-03 N.D. Nicotinamide 7.8E-05 1.0E-04 N.D.
Xanthine N.D. 1.6E-05 3.1E-05 N.D.: Not Detected
TABLE-US-00003 TABLE 3 Metabolism Markers of Glucose Glucose Xylose
Medium Xylose Stable Medium for for iPS Isotope Medium Metabolite
Name iPS Cells Cells (.sup.12C) (.sup.13C) Glucose 4.8E-02 3.0E-03
N.D. 6-phosphate Fructose 2.7E-01 N.D. N.D. 1,6-diphosphate
Glyceraldehyde 9.5E-03 N.D. N.D. 3-phosphate Pyruvic acid 1.0E-03
N.D. N.D. Kynurenine 7.7E-05 N.D. N.D. N.D.: Not Detected
[0099] As shown in the results, it was revealed that PRPP was
specifically contained as a metabolite in iPS cells cultured in a
xylose medium for iPS cells or their culture supernatants. This
PRPP was not contained when cells were cultured in a glucose medium
for iPS cells, i.e., was found to be a specific metabolite in a
xylose medium.
* * * * *