U.S. patent application number 14/553321 was filed with the patent office on 2015-11-05 for devices and methods for enrichment and alteration of circulating tumor cells and other particles.
The applicant listed for this patent is GPB Scientific, LLC. Invention is credited to Martin FUCHS, Yi-Shiuan HUANG, Neil X. KRUEGER, Ying-Xin WANG.
Application Number | 20150316555 14/553321 |
Document ID | / |
Family ID | 37694828 |
Filed Date | 2015-11-05 |
United States Patent
Application |
20150316555 |
Kind Code |
A1 |
FUCHS; Martin ; et
al. |
November 5, 2015 |
DEVICES AND METHODS FOR ENRICHMENT AND ALTERATION OF CIRCULATING
TUMOR CELLS AND OTHER PARTICLES
Abstract
The invention features devices and methods for detecting,
enriching, and analyzing circulating tumor cells and other
particles. The invention further features methods of diagnosing a
condition, e.g., cancer, in a subject by analyzing a cellular
sample from the subject.
Inventors: |
FUCHS; Martin; (Uxbridge,
MA) ; WANG; Ying-Xin; (Newtonville, MA) ;
HUANG; Yi-Shiuan; (Roslindale, MA) ; KRUEGER; Neil
X.; (Jamaica Plain, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
GPB Scientific, LLC |
Richmond |
VA |
US |
|
|
Family ID: |
37694828 |
Appl. No.: |
14/553321 |
Filed: |
November 25, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11322791 |
Dec 29, 2005 |
8921102 |
|
|
14553321 |
|
|
|
|
60703833 |
Jul 29, 2005 |
|
|
|
Current U.S.
Class: |
506/2 ; 506/18;
506/9 |
Current CPC
Class: |
B01L 2200/0668 20130101;
G01N 2800/52 20130101; B01L 3/502746 20130101; B01L 3/502761
20130101; B01L 2400/0406 20130101; G01N 33/57492 20130101; G01N
2333/70589 20130101; G01N 33/56966 20130101; B01L 2400/086
20130101; G01N 33/54366 20130101; B01L 2400/0487 20130101; B82Y
10/00 20130101; G01N 33/57484 20130101; B01L 2400/0415 20130101;
B01L 2400/0409 20130101; B01L 3/502707 20130101; G01N 2333/71
20130101; G01N 2333/705 20130101; B82Y 5/00 20130101 |
International
Class: |
G01N 33/574 20060101
G01N033/574 |
Claims
1. A device for cell enrichment comprising: a) a receptacle; b) a
lid detachably attached to said receptacle, said lid comprising a
functionalized lid surface, wherein said functionalized lid surface
comprises one or more capture moieties that selectively capture a
first cell from a cellular sample, and wherein said lid is
configured to fit within said receptacle; and c) a sample mobilizer
coupled to either said receptacle or said lid.
2. The device of claim 1, wherein said functionalized lid surface
has a cross section that is square, rectangular, or circular.
3. The device of claim 1, wherein said lid comprises glass,
silicon, or plastic.
4. The device of claim 1, wherein said receptacle comprises glass,
silicon, or plastic.
5. The device of claim 1, wherein said functionalized lid surface
comprises a microstructure.
6. The device of claim 5, wherein said microstructure comprises a
micro-obstacle, a micro-corrugation, a micro-groove, or a
micro-fin.
7. The device of claim 1, wherein said capture moieties comprise
one or more antibodies that specifically bind said first cell.
8. The device of claim 7, wherein said antibodies comprise an
array.
9. The device of claim 7, wherein said antibodies specifically bind
leukocytes or epithelial cells.
10. The device of claim 7, wherein said antibodies specifically
bind a cell surface cancer marker.
11. The device of claim 10, wherein said cell surface cancer marker
is selected from Table 1.
12. The device of claim 10, wherein said cell surface cancer marker
is selected from the group consisting of EpCAM, E-Cadherin,
Mucin-1, Cytokeratin 8, EGFR, and leukocyte associated receptor
(LAR).
13. The device of claim 1, wherein said receptacle comprises a
functionalized receptacle surface comprising one or more capture
moieties that selectively capture a second cell from said cellular
sample.
14. The device of claim 13, wherein said functionalized receptacle
surface comprises a microstructure.
15. The device of claim 14, wherein said microstructure comprises a
micro-obstacle, a micro-corrugation, a micro-groove, or a
micro-fin.
16. The device of claim 15, wherein said capture moieties that
selectively capture a second cell comprise one or more antibodies
that specifically bind said second cell.
17. The device of claim 16, wherein said antibodies specifically
bind leukocytes or epithelial cells.
18. The device of claim 16, wherein said antibodies specifically
bind a cell surface cancer marker of said second cell.
19. The device of claim 18, wherein said cell surface cancer marker
is selected from Table 1.
20. The device of claim 18, wherein said cell surface cancer marker
is selected from the group consisting of EpCAM, E-Cadherin,
Mucin-1, Cytokeratin 8, EGFR, and leukocyte associated receptor
(LAR).
21. The device of claim 1, wherein said lid fits in said receptacle
at a nonorthogonal angle with respect to a wall of said
receptacle.
22. The device of claim 1, wherein said sample mobilizer comprises
a mechanical rocker.
23. The device of claim 1, wherein said sample mobilizer is adapted
to provide centrifugal force to said receptacle and said lid.
24. The device of claim 23, wherein said centrifugal force drives
cell rolling along said lid surface.
25. The device of claim 23, wherein said sample mobilizer comprises
an axle that rotates said receptacle.
26. The device of claim 25, wherein said centrifugal force is
capable of driving said lid into a nonorthogonal angle with respect
to said axle.
27. The device of claim 1, wherein said sample mobilizer comprises
a first chamber fluidically coupled to a second chamber, wherein
each said chamber has a surface in contact with the internal space
of said receptacle, and wherein fluid movement between said
chambers results in a change in shape of each chamber.
28. The device of claim 1, wherein said receptacle can hold at
least 10 mL of fluid.
29. The device of claim 1, wherein said receptacle can hold at
least 50 mL of fluid.
30. A method for enriching one or more first cells from a cellular
sample, said method comprising the steps of: a) placing said
cellular sample in a device comprising: i) a receptacle; ii) a lid
detachably attached to said receptacle, said lid comprising at
least one functionalized lid surface, wherein said functionalized
lid surface comprises one or more capture moieties that selectively
capture said first cells from said cellular sample, and wherein
said lid is configured to fit within said receptacle; and iii) a
sample mobilizer coupled to either said receptacle or said lid; b)
covering said cellular sample with said lid; c) mobilizing said
sample using said sample mobilizer; and d) removing said lid from
said receptacle.
31. The method of claim 30, wherein said first cell is a cancer
cell or an epithelial cell.
32. The method of claim 30, wherein step c) comprises applying a
centrifugal force to said receptacle.
33. The method of claim 32, wherein said receptacle is subjected to
an average relative centrifugal field of between 1,000 g and 10,000
g.
34. The method of claim 30, wherein step c) comprises applying: i)
a4 first force; and ii) a second force opposite to said first
force.
35. The method of claim 34, wherein said first force and said
second force are applied repeatedly and in alternation.
36. The method of claim 35, further comprising waiting for an
interval of time between applications of said forces.
Description
CROSS-REFERENCE
[0001] This application is a continuation application of U.S.
application Ser. No. 11/322,791, filed Dec. 29, 2005, which claims
the benefit of U.S. Provisional Application No. 60/703,833, filed
Jul. 29, 2005. Each of the above listed applications is
incorporated by reference herein in its entirety.
REFERENCE TO A SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Jul. 16, 2015, is named 32061-724.301_SL.txt and is 12,879 bytes
in size
BACKGROUND OF THE INVENTION
[0003] The invention relates to the fields of medical diagnostics
and microfluidics.
[0004] Cancer is a disease marked by the uncontrolled proliferation
of abnormal cells. In normal tissue, cells divide and organize
within the tissue in response to signals from surrounding cells.
Cancer cells do not respond in the same way to these signals,
causing them to proliferate and, in many organs, form a tumor. As
the growth of a tumor continues, genetic alterations may
accumulate, manifesting as a more aggressive growth phenotype of
the cancer cells. If left untreated, metastasis, the spread of
cancer cells to distant areas of the body by way of the lymph
system or bloodstream, may ensue. Metastasis results in the
formation of secondary tumors at multiple sites, damaging healthy
tissue. Most cancer death is caused by such secondary tumors.
[0005] Despite decades of advances in cancer diagnosis and therapy,
many cancers continue to go undetected until late in their
development. As one example, most early-stage lung cancers are
asymptomatic and are not detected in time for curative treatment,
resulting in an overall five-year survival rate for patients with
lung cancer of less than 15%. However, in those instances in which
lung cancer is detected and treated at an early stage, the
prognosis is much more favorable.
[0006] Therefore, there exists a need to develop new methods for
detecting cancer at earlier stages in the development of the
disease.
SUMMARY OF THE INVENTION
[0007] The invention features a device for cell enrichment
including:
[0008] a) a receptacle;
[0009] b) a lid detachably attached to the receptacle, the lid
having a functionalized lid surface that includes one or more
capture moieties that selectively capture a first cell from a
cellular sample, and wherein the lid is configured to fit within
the receptacle; and
[0010] c) a sample mobilizer coupled to either the receptacle or
the lid.
[0011] The functionalized lid surface can have a cross section that
is square, rectangular, or circular, and both the lid and the
receptacle can be composed of glass, silicon, or plastic.
[0012] The functionalized lid surface can include a microstructure
which can include a micro-obstacle, a micro-corrugation, a
micro-groove, or a micro-fin.
[0013] The capture moieties can include one or more antibodies that
specifically bind the first cell. The antibodies can form an array
and can specifically bind leukocytes or epithelial cells, or a cell
surface cancer marker, e.g. a marker selected from Table 1, e.g.
EpCAM, E-Cadherin, Mucin-1, Cytokeratin 8, EGFR, and leukocyte
associated receptor (LAR).
[0014] The receptacle can include a functionalized receptacle
surface having one or more capture moieties that selectively
capture a second cell from the cellular sample. The functionalized
receptacle surface can include a microstructure that can include a
micro-obstacle, a micro-corrugation, a micro-groove, or a
micro-fin.
[0015] The capture moieties that selectively capture a second cell
can include one or more antibodies that specifically bind the
second cell, e.g., antibodies that specifically bind leukocytes or
epithelial cells, or that specifically bind a cell surface cancer
marker of the second cell. The cell surface cancer marker can be
one selected from Table 1, e.g., EpCAM, E-Cadherin, Mucin-1,
Cytokeratin 8, EGFR, or leukocyte associated receptor (LAR).
[0016] The lid can be configured to fit the receptacle at a
nonorthogonal angle with respect to a wall of the receptacle.
[0017] The sample mobilizer can include a mechanical rocker and can
be adapted to provide centrifugal force to the receptacle and the
lid; it can also include an axle that rotates the receptacle.
Centrifugal force can drive cells rolling along the lid surface.
Centrifugal force can also drive the lid into a nonorthogonal angle
with respect to the axle.
[0018] The sample mobilizer can include a first chamber fluidically
coupled to a second chamber, wherein each chamber has a surface in
contact with the internal space of the receptacle, and wherein
fluid movement between the chambers results in a change in shape of
each chamber.
[0019] The receptacle preferably can hold at least 10 mL, and more
preferably at least 50 mL of fluid.
[0020] The device is used for enriching one or more first cells
from a cellular sample by:
[0021] a) placing the cellular sample in the device;
[0022] b) covering the cellular sample with the lid;
[0023] c) mobilizing the sample using the sample mobilizer; and
[0024] d) removing the lid from the receptacle.
[0025] The first cell can be a cancer cell or an epithelial cell.
Step c) can include applying a centrifugal force to the receptacle;
the receptacle can be subjected to an average relative centrifugal
field of between 1,000 g and 10,000 g.
[0026] Alternatively, step c) involves applying:
[0027] i) a first force; and
[0028] ii) a second force opposite to the first force;
[0029] the first force and the second force can be applied
repeatedly and in alternation, and there can be a waiting period
between applications of said forces.
[0030] Any of the devices of the invention may be used together
with a set of instructions for the device.
[0031] By "approximately equal" in the context of length, size,
area, or other measurements is meant equal to within 10%, 5%, 4%,
3%, 2%, or even 1%.
[0032] By "biological particle" is meant any species of biological
origin that is insoluble in aqueous media. Examples include cells,
particulate cell components, viruses, and complexes including
proteins, lipids, nucleic acids, and carbohydrates.
[0033] By "biological sample" is meant any sample of biological
origin or containing, or potentially containing, biological
particles. Preferred biological samples are cellular samples.
[0034] By "blood component" is meant any component of whole blood,
including host red blood cells, white blood cells, platelets, or
epithelial cells, in particular, CTCs. Blood components also
include the components of plasma, e.g., proteins, lipids, nucleic
acids, and carbohydrates, and any other cells that may be present
in blood, e.g., because of current or past pregnancy, organ
transplant, infection, injury, or disease.
[0035] By "cellular sample" is meant a sample containing cells or
components thereof. Such samples include naturally occurring fluids
(e.g., blood, sweat, tears, ear flow, sputum, lymph, bone marrow
suspension, urine, saliva, semen, vaginal flow, cerebrospinal
fluid, cervical lavage, brain fluid, ascites, milk, secretions of
the respiratory, intestinal or genitourinary tract, amniotic fluid,
and water samples) and fluids into which cells have been introduced
(e.g., culture media and liquefied tissue samples). The term also
includes a lysate.
[0036] By "channel" is meant a gap through which fluid may flow. A
channel may be a capillary, a conduit, or a strip of hydrophilic
pattern on an otherwise hydrophobic surface wherein aqueous fluids
are confined.
[0037] By "circulating tumor cell" (CTC) is meant a cancer cell
that is exfoliated from a solid tumor of a subject and is found in
the subject's circulating blood.
[0038] By "component" of cell is meant any component of a cell that
may be at least partially isolated upon lysis of the cell. Cellular
components may be organelles (e.g., nuclei, perinuclear
compartments, nuclear membranes, mitochondria, chloroplasts, or
cell membranes), polymers or molecular complexes (e.g., lipids,
polysaccharides, proteins (membrane, trans-membrane, or cytosolic),
nucleic acids (native, therapeutic, or pathogenic), viral
particles, or ribosomes), or other molecules (e.g., hormones, ions,
cofactors, or drugs).
[0039] By "component" of a cellular sample is meant a subset of
cells, or components thereof, contained within the sample.
[0040] By "density" in reference to an array of obstacles is meant
the number of obstacles per unit of area, or alternatively the
percentage of volume occupied by such obstacles. Array density is
increased either by placing obstacles closer together or by
increasing the size of obstacles relative to the gaps between
obstacles.
[0041] By "enriched sample" is meant a sample containing components
that has been processed to increase the relative population of
components of interest relative to other components typically
present in a sample. For example, samples may be enriched by
increasing the relative population of cells of interest by at least
10%, 25%, 50%, 75%, 100% or by a factor of at least 1,000, 10,000,
100,000, 1,000,000, 10,000,000, or even 100,000,000.
[0042] By "exchange buffer" in the context of a cellular sample is
meant a medium distinct from the medium in which the cellular
sample is originally suspended, and into which one or more
components of the cellular sample are to be exchanged.
[0043] By "flow-extracting boundary" is meant a boundary designed
to remove fluid from an array.
[0044] By "flow-feeding boundary" is meant a boundary designed to
add fluid to an array.
[0045] By "gap" is meant an opening through which fluids or
particles may flow. For example, a gap may be a capillary, a space
between two obstacles wherein fluids may flow, or a hydrophilic
pattern on an otherwise hydrophobic surface wherein aqueous fluids
are confined. In a preferred embodiment of the invention, the
network of gaps is defined by an array of obstacles. In this
embodiment, the gaps are the spaces between adjacent obstacles. In
a preferred embodiment, the network of gaps is constructed with an
array of obstacles on the surface of a substrate.
[0046] By "hydrodynamic size" is meant the effective size of a
particle when interacting with a flow, obstacles, or other
particles. It is used as a general term for particle volume, shape,
and deformability in the flow.
[0047] By "hyperspectral" in reference to an imaging process or
method is meant the acquisition of an image at five or more
wavelengths or bands of wavelengths.
[0048] By "intracellular activation" is meant activation of second
messenger pathways leading to transcription factor activation, or
activation of kinases or other metabolic pathways. Intracellular
activation through modulation of external cell membrane antigens
may also lead to changes in receptor trafficking
[0049] By "labeling reagent" is meant a reagent that is capable of
binding to an analyte, being internalized or otherwise absorbed,
and being detected, e.g., through shape, morphology, color,
fluorescence, luminescence, phosphorescence, absorbance, magnetic
properties, or radioactive emission.
[0050] By "microfluidic" is meant having at least one dimension of
less than 1 mm.
[0051] By "microstructure" in reference to a surface is meant the
microscopic structure of a surface that includes one or more
individual features measuring less than 1 mm in at least one
dimension. Exemplary microfeatures are micro-obstacles,
micro-posts, micro-grooves, micro-fins, and micro-corrugation.
[0052] By "obstacle" is meant an impediment to flow in a channel,
e.g., a protrusion from one surface. For example, an obstacle may
refer to a post outstanding on a base substrate or a hydrophobic
barrier for aqueous fluids. In some embodiments, the obstacle may
be partially permeable. For example, an obstacle may be a post made
of porous material, wherein the pores allow penetration of an
aqueous component but are too small for the particles being
separated to enter.
[0053] By "shrinking reagent" is meant a reagent that decreases the
hydrodynamic size of a particle. Shrinking reagents may act by
decreasing the volume, increasing the deformability, or changing
the shape of a particle.
[0054] By "swelling reagent" is meant a reagent that increases the
hydrodynamic size of a particle. Swelling reagents may act by
increasing the volume, reducing the deformability, or changing the
shape of a particle.
[0055] Other features and advantages will be apparent from the
following description and the claims.
INCORPORATION BY REFERENCE
[0056] All publications, patents, and patent applications mentioned
in this specification are herein incorporated by reference to the
same extent as if each individual publication, patent, or patent
application was specifically and individually indicated to be
incorporated by reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0057] The patent or application file contains at least one drawing
executed in color. Copies of this patent or patent application
publication with color drawings will be provided by the Office upon
request and payment of the necessary fee.
[0058] FIGS. 1A-1E are schematic depictions of an array that
separates cells based on lateral displacement: (A) illustrates the
lateral displacement of subsequent rows; (B) illustrates how fluid
flowing through a gap is divided unequally around obstacles in
subsequent rows; (C) illustrates how a particle with a hydrodynamic
size above the critical size is displaced laterally in the device;
(D) illustrates an array of cylindrical obstacles; and (E)
illustrates an array of elliptical obstacles.
[0059] FIG. 2 is a schematic description illustrating the unequal
division of the flux through a gap around obstacles in subsequent
rows.
[0060] FIG. 3 is a schematic depiction of how the critical size
depends on the flow profile, which is parabolic in this
example.
[0061] FIG. 4 is an illustration of how shape affects the movement
of particles through a device.
[0062] FIG. 5 is an illustration of how deformability affects the
movement of particles through a device.
[0063] FIG. 6 is a schematic depiction of lateral displacement.
Particles having a hydrodynamic size above the critical size move
to the edge of the array, while particles having a hydrodynamic
size below the critical size pass through the device without
lateral displacement.
[0064] FIG. 7 is a schematic depiction of a three stage device.
[0065] FIG. 8 is a schematic depiction of the maximum size and
cut-off size for the device of FIG. 7.
[0066] FIG. 9 is a schematic depiction of a bypass channel.
[0067] FIG. 10 is a schematic depiction of a bypass channel.
[0068] FIG. 11 is a schematic depiction of a three stage device
having a common bypass channel.
[0069] FIG. 12 is a schematic depiction of a three stage, duplex
device having a common bypass channel.
[0070] FIG. 13 is a schematic depiction of a three stage device
having a common bypass channel, where the flow through the device
is substantially constant.
[0071] FIG. 14 is a schematic depiction of a three stage, duplex
device having a common bypass channel, where the flow through the
device is substantially constant.
[0072] FIG. 15 is a schematic depiction of a three stage device
having a common bypass channel, where the fluidic resistance in the
bypass channel and the adjacent stage are substantially
constant.
[0073] FIG. 16 is a schematic depiction of a three stage, duplex
device having a common bypass channel, where the fluidic resistance
in the bypass channel and the adjacent stage are substantially
constant.
[0074] FIG. 17 is a schematic depiction of a three stage device
having two, separate bypass channels.
[0075] FIG. 18 is a schematic depiction of a three stage device
having two, separate bypass channels, which are in arbitrary
configuration.
[0076] FIG. 19 is a schematic depiction of a three stage, duplex
device having three, separate bypass channels.
[0077] FIG. 20 is a schematic depiction of a three stage device
having two, separate bypass channels, wherein the flow through each
stage is substantially constant.
[0078] FIG. 21 is a schematic depiction of a three stage, duplex
device having three, separate bypass channels, wherein the flow
through each stage is substantially constant.
[0079] FIG. 22 is a schematic depiction of a flow-extracting
boundary.
[0080] FIG. 23 is a schematic depiction of a flow-feeding
boundary.
[0081] FIG. 24 is a schematic depiction of a flow-feeding boundary,
including a bypass channel.
[0082] FIG. 25 is a schematic depiction of two flow-feeding
boundaries flanking a central bypass channel.
[0083] FIG. 26 is a schematic depiction of a device having four
channels that act as on-chip flow resistors.
[0084] FIGS. 27 and 28 are schematic depictions of the effect of
on-chip resistors on the relative width of two fluids flowing in a
device.
[0085] FIG. 29 is a schematic depiction of a duplex device having a
common inlet for the two outer regions.
[0086] FIG. 30A is a schematic depiction of a multiple arrays on a
device. FIG. 30B is a schematic depiction of multiple arrays with
common inlets and product outlets on a device.
[0087] FIG. 31 is a schematic depiction of a multi-stage device
with a small footprint.
[0088] FIG. 32 is a schematic depiction of blood passing through a
device.
[0089] FIG. 33A is a graph of cell count versus hydrodynamic size
for a microfluidic separation of normal whole blood. FIG. 33B is a
graph of cell count versus hydrodynamic size for a microfluidic
separation of whole blood including a population of circulating
tumor cells (CTCs). FIG. 33C is the graph of FIG. 33B, additionally
showing a size cutoff that excludes most native blood cells. FIG.
33D is the graph of FIG. 33C, additionally showing a population of
cells larger than the size cutoff and indicative of a disease
state.
[0090] FIGS. 34A-34D are schematic depictions of moving a particle
from a sample to a buffer in a single stage (A), three stage (B),
duplex (C), or three stage duplex (D) device.
[0091] FIG. 35A is a schematic depiction of a two stage device
employed to move a particle from blood to a buffer to produce three
products. FIG. 35B is a schematic graph of the maximum size and cut
off size of the two stages. FIG. 35C is a schematic graph of the
composition of the three products.
[0092] FIG. 36 is a schematic depiction of a two stage device for
alteration, where each stage has a bypass channel.
[0093] FIG. 37 is a schematic depiction of the use of fluidic
channels to connect two stages in a device.
[0094] FIG. 38 is a schematic depiction of the use of fluidic
channels to connect two stages in a device, wherein the two stages
are configured as a small footprint array.
[0095] FIG. 39A is a schematic depiction of a two stage device
having a bypass channel that accepts output from both stages. FIG.
39B is a schematic graph of the size range of product achievable
with this device.
[0096] FIG. 40 is a schematic depiction of a two stage device for
alteration having bypass channels that flank each stage and empty
into the same outlet.
[0097] FIG. 41 is a schematic depiction of a device for the
sequential movement and alteration of particles.
[0098] FIG. 42A is a schematic depiction of a device of the
invention and its operation. FIG. 42B is an illustration of the
device of FIG. 42A and a further-schematized representation of this
device.
[0099] FIGS. 43A and 43B are schematic depictions of two distinct
configurations for joining two devices together. In FIG. 43A, a
cascade configuration is shown, in which outlet 1 of one device is
joined to a sample inlet of a second device. In FIG. 43B, a
bandpass configuration is shown, in which outlet 2 of one device is
joined to a sample inlet of a second device.
[0100] FIG. 44 is a schematic depiction of an enhanced method of
size separation in which target cells are labeled with
immunoaffinity beads.
[0101] FIG. 45 is a schematic depiction of a method for performing
size fractionation and for separating free labeling reagents, e.g.,
antibodies, from bound labeling reagents by using a device of the
invention.
[0102] FIG. 46 is a schematic depiction of a method shown in FIG.
45. In this case, non-target cells may copurify with target cells,
but these non-target cells do not interfere with quantification of
target cells.
[0103] FIG. 47 is a schematic depiction of a method for enriching
large cells from a mixture and producing a concentrated sample of
these cells.
[0104] FIG. 48 is a schematic depiction of a method for lysing
cells inside a device of the invention and separating whole cells
from organelles and other cellular components.
[0105] FIG. 49 is a schematic depiction of two devices arrayed in a
cascade configuration and used for performing size fractionation
and for separating free labeling reagent from bound labeling
reagent by using a device of the invention.
[0106] FIG. 50 is a schematic depiction of two devices arrayed in a
cascade configuration and used for performing size fractionation
and for separating free labeling reagent from bound labeling
reagent by using a device of the invention. In this figure, phage
is utilized for binding and detection rather than antibodies.
[0107] FIG. 51 is a schematic depiction of two devices arrayed in a
bandpass configuration.
[0108] FIG. 52 is a graph of cell count versus hydrodynamic size
for a microfluidic separation of normal whole blood.
[0109] FIG. 53 is a set of histograms from input, product, and
waste samples generated with a Coulter "AC-T diff" clinical blood
analyzer. The x-axis depicts cell volume in femtomoles.
[0110] FIG. 54 is a pair of representative micrographs from product
and waste streams of fetal blood processed with a cell enrichment
module, showing clear separation of nucleated cells and red blood
cells.
[0111] FIG. 55 is a pair of images showing cells fixed on a cell
enrichment module with paraformaldehyde and observed by
fluorescence microscopy. Target cells are bound to the obstacles
and floor of the capture module.
[0112] FIG. 56 is a schematic depiction of a method of the
invention. This method features isolating and counting large cells
within a cellular sample, wherein the count is indicative of a
patient's disease state, and subsequently further analyzing the
large cell subpopulation.
[0113] FIG. 57A is a design for a preferred embodiment of the
invention. FIG. 57B is a table of design parameters corresponding
to FIG. 57A. FIG. 57C is a mask design of a chip of the
invention.
[0114] FIG. 58 is a schematic depiction of a method of detecting
epidermal growth factor receptor (EGFR) mutations in CTCs in
blood.
[0115] FIG. 59 is a schematic depiction of a process for generating
EGFR sequencing templates. EGFR mRNA is reverse transcribed to make
cDNA; next, two PCR amplifications are performed sequentially.
[0116] FIG. 60 is a schematic depiction of an allele-specific
TaqMan 5' Nuclease Real Time PCR assay used to amplify EGFR
subregions specific to particular mutations of interest.
[0117] FIG. 61 is a set of sequencing charts showing the detection
of several EGFR mutations (shaded regions) above the background
level of fluorescence.
[0118] FIG. 62A is an image of an agarose gel showing that EpCAM
and EGFR are expressed in tumor cells but not in leukocytes. BCKDK
is expressed in both types of cells, while CD45 is expressed only
in leukocytes. FIG. 62B is a graph and table showing a Pharmagene
XpressWay.TM. profile of EGFR mRNA expression. Expression levels
are profiled in 72 tissues via quantitative RT-PCR, and >10,000
copies per cell are detected in almost every tissue profiled except
for blood. The table shows quantitation of mRNA for tissues #1-4
from the graph.
[0119] FIG. 63 is a pair of images of agarose gels showing the
results of a two sets of PCR assays. In the first set (left), PCR
is performed on EGFR input RNA at various concentrations. In the
second set of assays, samples from the first set of PCR reactions
are amplified with nested primers.
[0120] FIG. 64A is an image of an agarose gel showing the results
of a set of PCR assays in which NCI-H1975 RNA is mixed with various
quantities of peripheral blood mononuclear cell (PBMC) RNA and
reverse transcribed prior to PCR. Spurious amplification bands are
seen at the highest dilution. FIG. 64B is an image of an agarose
gel showing the results of a set of PCR assays in which the samples
shown in FIG. 64A are further amplified using nested primers. No
spurious amplification bands are produced, even at the highest
dilution.
[0121] FIG. 65 is an image of an agarose gel showing the results of
a set of PCR assays. In the associated experiment, whole blood
spiked with H1650 cells was run on two devices of the invention,
and cDNA was synthesized from the resulting enriched samples. PCR
using EGFR and CD45 primers was performed. Both wild type (138 bp)
and mutant (123 bp) EGFR bands are visible in the lanes showing
EGFR amplifications.
[0122] FIG. 66A is a schematic depiction of an array of the
invention containing staggered subarrays. FIG. 66B is a schematic
depiction contrasting a regular array with a staggered array. FIG.
66C is a schematic depiction showing the flow and capture of cells
in a staggered array. FIG. 66D is a schematic depiction showing a
device containing an outlet port surrounded by a region of narrowed
flow paths. FIG. 66E is a schematic depiction of a device that is
structured in the depth dimension to create narrowed flow paths.
FIG. 66F is a schematic depiction of the device of FIG. 66E,
showing captured cells. FIG. 66G is a set of microscope views
showing stained H1650 cells captured in the narrow flow regions of
a device of the invention.
[0123] FIG. 67A is a chart and inset showing the size distribution
of several cellular samples, including white blood cells and
various cancer cell lines, as measured by a Beckman Coulter Z2
counting device. The main chart uses a logarithmic scale for the
volume axis, while the inset uses a linear scale to better
represent the distribution of white blood cells. FIG. 67B is a
chart showing the size distribution of several cancer cell lines.
FIG. 67C is the chart of FIG. 67B, further showing three exemplary
size cutoffs.
[0124] FIG. 68A is a schematic depiction of a capture device of the
invention that features a functionalized microscope slide on the
bottom of a sample chamber. FIG. 68B is a schematic depiction of a
method of rocking cells in the capture device in order to keep the
cells tumbling and prevent sedimentation. FIG. 68C is a schematic
depiction of a method of rotating the capture device as an
alternative to rocking FIG. 68D is a schematic depiction of a
capture device that includes two additional fluid chambers, which
may be alternately filled and emptied in order to cause fluid
motion inside the main chamber of the device. FIG. 68E is a
schematic depiction of a microscope slide with multiple, spatially
patterned capture functionalities on the surface.
[0125] FIG. 69A is a schematic depiction of a centrifugation device
of the invention, shown both at rest and in operation. FIG. 69B is
a schematic depiction of a cell binding to a functionalized surface
in a gravitational field (top) and a centrifugal field (bottom).
FIG. 69C is a schematic depiction of the device of FIG. 69A in
which the chambers are inverted during the spin. FIG. 69D is a
schematic depiction of the device of FIG. 69C, further showing a
second functionalized surface for the capture of contaminating
cells. FIG. 69E is a schematic depiction of a centrifugal device in
which the functionalized slide is inclined at an angle during the
spin. FIG. 69F is a pair of charts showing spin speed versus
operating time, including periods that may be optimized: "spin up"
(1), "spin time" (2), "spin down" (3), and rest time (4). FIG. 69G
is a schematic depiction of a centrifugal device that includes a
functionalized microstructure surface.
[0126] FIG. 70A is an image of an enrichment device showing the
flow paths of a small cell (left) and a large cell (right). The
small cell may be seen to have very little interaction with the
obstacles and flows essentially in the average flow direction,
while the large cell contacts each obstacle along its path and is
directed laterally through the array. FIG. 70B is a schematic
depiction of a device of the invention containing a regular array
of obstacles. FIG. 70C is a schematic depiction of a device of the
invention that includes multiple arrays in which the direction of
deflection, the gap size, and/or the distance between obstacles is
varied throughout the device, while the critical size is kept
constant.
[0127] Figures are not necessarily to scale.
DETAILED DESCRIPTION OF THE INVENTION
[0128] The invention features devices and methods for detecting,
enriching, and analyzing circulating tumor cells (CTCs) and other
particles. The invention further features methods of diagnosing a
condition in a subject, e.g., cancer, by analyzing a cellular
sample from the subject. In some embodiments, devices of the
invention include arrays of obstacles that allow displacement of
CTCs or other fluid components.
[0129] While this application focuses primarily on the detection,
enrichment, and analysis of CTCs or epithelial cells, the devices
and methods of the invention are useful for processing a wide range
of other cells and particles, e.g., red blood cells, white blood
cells, fetal cells, stem cells (e.g., undifferentiated), bone
marrow cells, progenitor cells, foam cells, mesenchymal cells,
endothelial cells, endometrial cells, trophoblasts, cancer cells,
immune system cells (host or graft), connective tissue cells,
bacteria, fungi, cellular pathogens (e.g., bacterial or protozoa),
cellular organelles and other cellular components (e.g.,
mitochondria and nuclei), and viruses.
[0130] Exemplary devices and methods of the invention are described
in detail below.
Circulating Tumor Cells (CTCs)
[0131] Epithelial cells that are exfoliated from solid tumors have
been found in very low concentrations in the circulation of
patients with advanced cancers of the breast, colon, liver, ovary,
prostate, and lung, and the presence or relative number of these
cells in blood has been correlated with overall prognosis and
response to therapy. These CTCs may be an early indicator of tumor
expansion or metastasis before the appearance of clinical
symptoms.
[0132] CTCs typically have a short half-life of approximately one
day, and their presence generally indicates a recent influx from a
proliferating tumor. Therefore, CTCs represent a dynamic process
that may reflect the current clinical status of patient disease and
therapeutic response. Enumeration and characterization of CTCs,
using the devices and methods of the invention, is useful in
assessing cancer prognosis and in monitoring therapeutic efficacy
for early detection of treatment failure that may lead to disease
relapse. In addition, CTC analysis according to the invention
enables the detection of early relapse in presymptomatic patients
who have completed a course of therapy.
[0133] CTCs are generally larger than most blood cells (see, e.g.,
FIG. 33B). Therefore, one useful approach for analyzing CTCs in
blood is to enrich cells based on size, resulting in a cell
population enriched in CTCs. This cell population may then be
subjected to further processing or analysis. Other methods of
enrichment of CTCs are also possible using the invention. Devices
and methods for enriching, enumerating, and analyzing CTCs are
described below.
[0134] Device
[0135] In general, the devices include one or more arrays of
obstacles that allow lateral displacement of CTCs and other
components of fluids, thereby offering mechanisms of enriching or
otherwise processing such components. Prior art devices that differ
from those the present invention, but which, like those of the
invention, employ obstacles for this purpose, are described, e.g.,
in Huang et al. Science 304, 987-990 (2004) and U.S. Publication
No. 20040144651. The devices of the invention for separating
particles according to size typically employ an array of a network
of gaps, wherein a fluid passing through a gap is divided unequally
into subsequent gaps. The array includes a network of gaps arranged
such that fluid passing through a gap is divided unequally, even
though the gaps may be identical in dimensions. The method uses a
flow that carries cells to be separated through the array of gaps.
The flow is aligned at a small angle (flow angle) with respect to a
line-of-sight of the array. Cells having a hydrodynamic size larger
than a critical size migrate along the line-of-sight, i.e.,
laterally, through the array, whereas those having a hydrodynamic
size smaller than the critical size follow the average flow
direction. Flow in the device occurs under laminar flow conditions.
Devices of the invention are optionally configured as
continuous-flow devices.
[0136] The critical size is a function of several design
parameters. With reference to the obstacle array in FIGS. 1A-1C,
each row of obstacles is shifted horizontally with respect to the
previous row by .DELTA..lamda., where .lamda. is the
center-to-center distance between the obstacles (FIG. 1A). The
parameter .DELTA..lamda./.lamda. (the "bifurcation ratio,"
.epsilon.) determines the ratio of flow bifurcated to the left of
the next obstacle. In FIGS. 1A-1C, .epsilon. is 1/3, for the
convenience of illustration. In general, if the flux through a gap
between two obstacles is .phi., the minor flux is .epsilon..phi.,
and the major flux is (1-.epsilon. (FIG. 2). In this example, the
flux through a gap is divided essentially into thirds (FIG. 1B).
While each of the three fluxes through a gap weaves around the
array of obstacles, the average direction of each flux is in the
overall direction of flow. FIG. 1C illustrates the movement of
particles sized above the critical size through the array. Such
particles move with the major flux, being transferred sequentially
to the major flux passing through each gap.
[0137] Referring to FIG. 2, the critical size is approximately
2R.sub.critical, where R.sub.critical is the distance between the
stagnant flow line and the obstacle. If the center of mass of a
particle, e.g., a cell, falls within R.sub.critical, the particle
would follow the major flux and move laterally through the array.
R.sub.critical may be determined if the flow profile across the gap
is known (FIG. 3); it is the thickness of the layer of fluids that
would make up the minor flux. For a given gap size, d,
R.sub.critical may be tailored based on the bifurcation ratio,
.epsilon.. In general, the smaller .epsilon., the smaller
R.sub.critical.
[0138] In an array for lateral displacement, particles of different
shapes behave as if they have different sizes (FIG. 4). For
example, lymphocytes are spheres of .about.5 .mu.m diameter, and
erythrocytes are biconcave disks of .about.7 .mu.m diameter, and
.about.1.5 .mu.m thick. The long axis of erythrocytes (diameter) is
larger than that of the lymphocytes, but the short axis (thickness)
is smaller. If erythrocytes align their long axes to a flow when
driven through an array of obstacles by the flow, their
hydrodynamic size is effectively their thickness (.about.1.5
.mu.m), which is smaller than lymphocytes. When an erythrocyte is
driven through an array of obstacles by a hydrodynamic flow, it
tends to align its long axis to the flow and behave like a
.about.1.5 .mu.m-wide particle, which is effectively "smaller" than
lymphocytes. The method and device may therefore separate cells
according to their shapes, although the volumes of the cells could
be the same. In addition, particles having different deformability
behave as if they have different sizes (FIG. 5). For example, two
particles having the same undeformed shape may be separated by
lateral displacement, as the cell with the greater deformability
may deform when it comes into contact with an obstacle in the array
and change shape. Thus, separation in the device may be achieved
based on any parameter that affects hydrodynamic size including the
physical dimensions, the shape, and the deformability of the
particle.
[0139] Referring to FIG. 6, feeding a mixture of particles, e.g.,
cells, of different hydrodynamic sizes from the top of the array
and collecting the particles at the bottom, as shown schematically,
produces two outputs, the product containing cells larger than the
critical size, 2.sub.Rcritical, and waste containing cells smaller
than the critical size. Although labeled "waste" in FIG. 6,
particles below the critical size may be collected while the
particles above the critical size are discarded. Both types of
outputs may also be desirably collected, e.g., when fractionating a
sample into two or more sub-samples. Cells larger than the gap size
will get trapped inside the array. Therefore, an array has a
working size range. Cells have to be larger than a cut-off size
(2R.sub.critical) and smaller than a maximum pass-through size
(array gap size) to be directed into the major flux. The "size
range" of an array is defined as the ratio of maximum pass-through
size to cut-off size.
[0140] In some cases, the gaps between obstacles are more than 15
microns, more than 20 microns, or less than 60 microns in size. In
other cases, the gaps are between 20 and 100 microns in size.
[0141] In certain embodiments, a device of the invention may
contain obstacles that include binding moieties, e.g., monoclonal
anti-EpCAM antibodies or fragments thereof, that selectively bind
to particular cell types, e.g., cells of epithelial origin, e.g.,
tumor cells. All of the obstacles of the device may include these
binding moieties; alternatively, only a subset of the obstacles
include them. Devices may also include additional modules that are
fluidically coupled, e.g., a cell counting module or a detection
module. For example, the detection module may be configured to
visualize an output sample of the device. In addition, devices of
the invention may be configured to direct cells in a selected size
range in one direction, and other cells in a second direction. For
example, the device may be configured to enrich cells having a
hydrodynamic size greater than 12 microns, 14 microns, 16 microns,
18 microns, or even 20 microns from smaller cells in the sample.
Alternatively, the device may enrich cells having a hydrodynamic
size greater than or equal to 6 microns and less than or equal to
12 microns, e.g., cells having a hydrodynamic size greater than or
equal to 8 microns and less than or equal to 10 microns, from other
cells. The device may also enrich cells having a hydrodynamic size
greater than or equal to 5 microns and less than or equal to 10
microns from cells having a hydrodynamic size greater than 10
microns; alternatively, it may enrich cells having a hydrodynamic
size greater than or equal to 4 microns and less than or equal to 8
microns from cells having a hydrodynamic size greater than 8
microns. In general, the device may be configured to separate two
groups of cells, where the first group has a larger average
hydrodynamic size than the second group.
[0142] In some embodiments, devices of the invention may process
more than 20 mL of fluid per hour, or even 50 mL of fluid per
hour.
[0143] As described above, a device of the invention typically
contains an array of obstacles that form a network of gaps. For
example, such a device may include a staggered two-dimensional
array of obstacles, e.g., such that each successive row is offset
by less than half of the period of the previous row. The device may
also include a second staggered two-dimensional array of obstacles,
which is optionally oriented in a different direction than the
first array. In this case, the first array may be situated upstream
of the second array, and the second array may have a higher density
than the first array. Multiple arrays may be configured in this
manner, such that each additional array has an equal or higher
density than any array upstream of the additional array.
[0144] Devices of the invention may be adapted for implantation in
a subject. For example, such a device may be adapted for placement
in or near the circulatory system of a subject in order to be able
to process blood samples. Such devices may be part of an
implantable system of the invention that is fluidically coupled to
the circulatory system of a subject, e.g., through tubing or an
arteriovenous shunt. In some cases, systems of the invention that
include implantable devices, e.g., disposable systems, may remove
one or more analytes, components, or materials from the circulatory
system. These systems may be adapted for continuous blood flow
through the device.
Sample Mobilization Devices
[0145] The invention additionally encompasses devices for cell
enrichment, e.g., enrichment of CTCs, that employ sample
mobilization. A sample mobilization device gives rise to movement
of cells, or other components of a fluid sample, relative to
features, e.g., obstacles, of the device. For example, one device
of the invention includes a receptacle that may hold a cellular
sample, a detachably attached lid configured to fit within the
receptacle that includes a functionalized lid surface including one
or more capture moieties that selectively capture cells of
interest, and an sample mobilizer coupled to either the receptacle
or the lid. Optionally, the receptacle has a functionalized surface
including one or more capture moieties that selectively capture a
second cell type. The lid surface may have any shape, e.g., square,
rectangular, or circular. The device may be manufactured using any
materials known in the art, e.g., glass, silicon, or plastic. In
some cases, the lid surface or receptacle surface includes a
microstructure, e.g., a micro-obstacle, a micro-corrugation, a
micro-groove, or a micro-fin. The capture moieties may include one
or more antibodies that specifically bind to a particular cell
type, and these antibodies may be configured in an array. As with
other devices of the invention, the antibodies may specifically
bind to any of a wide variety of cells, e.g., leukocytes or
epithelial cells. Preferably, the antibodies are able to bind
specifically to CTCs. Furthermore, the antibodies may specifically
bind a cell surface cancer marker, e.g., EpCAM, E-Cadherin,
Mucin-1, Cytokeratin 8, epidermal growth factor receptor (EGFR),
and leukocyte associated receptor (LAR), or a marker selected from
Table 1. In some cases, the lid of a sample mobilization device may
be designed to fit into the receptacle at a nonorthogonal angle
with respect to a wall of the receptacle. The receptacle may be
designed to hold any desirable amount of sample, e.g., 10 mL or 50
mL.
TABLE-US-00001 TABLE 1 2AR A DISINTEGRIN ACTIVATOR OF THYROID AND
RETINOIC ACID RECEPTOR (ACTR) ADAM 11 ADIPOGENESIS INHIBITORY
FACTOR (ADIF) ALPHA 6 INTEGRIN SUBUNIT ALPHA V INTEGRIN SUBUNIT
ALPHA-CATENIN AMPLIFIED IN BREAST CANCER 1 (AIB1) AMPLIFIED IN
BREAST CANCER 3 (AIB3) AMPLIFIED IN BREAST CANCER 4 (AIB4) AMYLOID
PRECURSOR PROTEIN SECRETASE (APPS) AP-2 GAMMA APPS ATP-BINDING
CASSETTE TRANSPORTER (ABCT) PLACENTA-SPECIFIC (ABCP) ATP-BINDING
CASSETTE SUBFAMILY C MEMBER (ABCC1) BAG-1 BASIGIN (BSG) BCEI B-CELL
DIFFERENTIATION FACTOR (BCDF) B-CELL LEUKEMIA 2 (BCL-2) B-CELL
STIMULATORY FACTOR-2 (BSF-2) BCL-1 BCL-2-ASSOCIATED X PROTEIN (BAX)
BCRP BETA 1 INTEGRIN SUBUNIT BETA 3 INTEGRIN SUBUNIT BETA 5
INTEGRIN SUBUNIT BETA-2 INTERFERON BETA-CATENIN BETA-CATENIN BONE
SIALOPROTEIN (BSP) BREAST CANCER ESTROGEN-INDUCIBLE SEQUENCE (BCEI)
BREAST CANCER RESISTANCE PROTEIN (BCRP) BREAST CANCER TYPE 1
(BRCA1) BREAST CANCER TYPE 2 (BRCA2) BREAST CARCINOMA AMPLIFIED
SEQUENCE 2 (BCAS2) CADHERIN EPITHELIAL CADHERIN-11
CADHERIN-ASSOCIATED PROTEIN CALCITONIN RECEPTOR (CTR) CALCIUM
PLACENTAL PROTEIN (CAPL) CALCYCLIN CALLA CAM5 CAPL CARCINOEMBRYONIC
ANTIGEN (CEA) CATENIN ALPHA 1 CATHEPSIN B CATHEPSIN D CATHEPSIN K
CATHEPSIN L2 CATHEPSIN O CATHEPSIN O1 CATHEPSIN V CD10 CD146 CD147
CD24 CD29 CD44 CD51 CD54 CD61 CD66e CD82 CD87 CD9 CEA CELLULAR
RETINOL- BINDING PROTEIN 1 (CRBP1) c-ERBB-2 CK7 CK8 CK18 CK19 CK20
CLAUDIN-7 c-MET COLLAGENASE FIBROBLAST COLLAGENASE INTERSTITIAL
COLLAGENASE-3 COMMON ACUTE LYMPHOCYTIC LEUKEMIA ANTIGEN (CALLA)
CONNEXIN 26(Cx26) CONNEXIN 43(Cx43) CORTACTIN COX-2 CTLA-8 CTR CTSD
CYCLIN D1 CYCLOOXYGENASE-2 CYTOKERATIN 18 CYTOKERATIN 19
CYTOKERATIN 8 CYTOTOXIC T- LYMPHOCYTE- ASSOCIATED SERINE ESTERASE 8
(CTLA-8) DIFFERENTIATION- INHIBITING ACTIVITY (DIA) DNA AMPLIFIED
IN MAMMARY CARCINOMA 1 (DAM1) DNA TOPOISOMERASE II ALPHA DR-NM23
E-CADHERIN EMMPRIN EMS1 ENDOTHELIAL CELL GROWTH FACTOR (ECGR)
PLATELET-DERIVED (PD- ECGF) ENKEPHALINASE EPIDERMAL GROWTH FACTOR
RECEPTOR (EGFR) EPISIALIN EPITHELIAL MEMBRANE ANTIGEN (EMA)
ER-ALPHA ERBB2 ERBB4 ER-BETA ERF-1 ERYTHROID- POTENTIATING ACTIVITY
(EPA) ESR1 ESTROGEN RECEPTOR- ALPHA ESTROGEN RECEPTOR- BETA ETS-1
EXTRACELLULAR MATRIX METALLOPROTEINASE INDUCER (EMMPRIN)
FIBRONECTIN RECEPTOR BETA POLYPEPTIDE (FNRB) FIBRONECTIN RECEPTOR
BETA SUBUNIT (FNRB) FLK-1 GA15.3 GA733.2 GALECTIN-3 GAMMA-CATENIN
GAP JUNCTION PROTEIN (26 kDa) GAP JUNCTION PROTEIN (43 kDa) GAP
JUNCTION PROTEIN ALPHA-1 (GJA1) GAP JUNCTION PROTEIN BETA-2 (GJB2)
GCP1 GELATINASE A GELATINASE B GELATINASE (72 kDa) GELATINASE (92
kDa) GLIOSTATIN GLUCOCORTICOID RECEPTOR INTERACTING PROTEIN 1
(GRIP1) GLUTATHIONE S- TRANSFERASE p GM-CSF GRANULOCYTE CHEMOTACTIC
PROTEIN 1 (GCP1) GRANULOCYTE- MACROPHAGE-COLONY STIMULATING FACTOR
GROWTH FACTOR RECEPTOR BOUND-7 (GRB-7) GSTp HAP HEAT-SHOCK COGNATE
PROTEIN 70 (HSC70) HEAT-STABLE ANTIGEN HEPATOCYTE GROWTH FACTOR
(HGF) HEPATOCYTE GROWTH FACTOR RECEPTOR (HGFR) HEPATOCYTE-
STIMULATING FACTOR III (HSF III) HER-2 HER2/NEU HERMES ANTIGEN HET
HHM HUMORAL HYPERCALCEMIA OF MALIGNANCY (HHM) ICERE-1 INT-1
INTERCELLULAR ADHESION MOLECULE -1
(ICAM-1) INTERFERON-GAMMA- INDUCING FACTOR (IGIF) INTERLEUKIN-1
ALPHA (IL-1A) INTERLEUKIN-1 BETA (IL- 1B) INTERLEUKIN-11 (IL-11)
INTERLEUKIN-17 (IL-17) INTERLEUKIN-18 (IL-18) INTERLEUKIN-6 (IL-6)
INTERLEUKIN-8 (IL-8) INVERSELY CORRELATED WITH ESTROGEN RECEPTOR
EXPRESSION-1 (ICERE-1) KAI1 KDR KERATIN 8 KERATIN 18 KERATIN 19
KISS-1 LEUKEMIA INHIBITORY FACTOR (LIF) LIF LOST IN INFLAMMATORY
BREAST CANCER (LIBC) LOT ("LOST ON TRANSFORMATION") LYMPHOCYTE
HOMING RECEPTOR MACROPHAGE-COLONY STIMULATING FACTOR MAGE-3
MAMMAGLOBIN MASPIN MC56 M-CSF MDC MDNCF MDR MELANOMA CELL ADHESION
MOLECULE (MCAM) MEMBRANE METALLOENDOPEPTIDASE (MME)
MEMBRANE-ASSOCIATED NEUTRAL ENDOPEPTIDASE (NEP) CYSTEINE-RICH
PROTEIN (MDC) METASTASIN (MTS-1) MLN64 MMP1 MMP2 MMP3 MMP7 MMP9
MMP11 MMP13 MMP14 MMP15 MMP16 MMP17 MOESIN MONOCYTE ARGININE-
SERPIN MONOCYTE-DERIVED NEUTROPHIL CHEMOTACTIC FACTOR
MONOCYTE-DERIVED PLASMINOGEN ACTIVATOR INHIBITOR MTS-1 MUC-1 MUC18
MUCIN LIKE CANCER ASSOCIATED ANTIGEN (MCA) MUCIN MUC-1 MULTIDRUG
RESISTANCE PROTEIN 1 (MDR, MDR1) MULTIDRUG RESISTANCE RELATED
PROTEIN-1 (MRP, MRP-1) N-CADHERIN NEP NEU NEUTRAL ENDOPEPTIDASE
NEUTROPHIL- ACTIVATING PEPTIDE 1 (NAP1) NM23-H1 NM23-H2 NME1 NME2
NUCLEAR RECEPTOR COACTIVATOR-1 (NCoA-1) NUCLEAR RECEPTOR
COACTIVATOR-2 (NCoA-2) NUCLEAR RECEPTOR COACTIVATOR-3 (NCoA-3)
NUCLEOSIDE DIPHOSPHATE KINASE A (NDPKA) NUCLEOSIDE DIPHOSPHATE
KINASE B (NDPKB) ONCOSTATIN M (OSM) ORNITHINE DECARBOXYLASE (ODC)
OSTEOCLAST DIFFERENTIATION FACTOR (ODF) OSTEOCLAST DIFFERENTIATION
FACTOR RECEPTOR (ODFR) OSTEONECTIN (OSN, ON) OSTEOPONTIN (OPN)
OXYTOCIN RECEPTOR (OXTR) p27/kip1 p300/CBP COINTEGRATOR ASSOCIATE
PROTEIN (p/CIP) p53 p9Ka PAI-1 PAI-2 PARATHYROID ADENOMATOSIS 1
(PRAD1) PARATHYROID HORMONE-LIKE HORMONE (PTHLH) PARATHYROID
HORMONE-RELATED PEPTIDE (PTHrP) P-CADHERIN PD-ECGF
PDGF-.quadrature. PEANUT-REACTIVE URINARY MUCIN (PUM)
P-GLYCOPROTEIN (P-GP) PGP-1 PHGS-2 PHS-2 PIP PLAKOGLOBIN
PLASMINOGEN ACTIVATOR INHIBITOR (TYPE 1) PLASMINOGEN ACTIVATOR
INHIBITOR (TYPE 2) PLASMINOGEN ACTIVATOR (TISSUE- TYPE) PLASMINOGEN
ACTIVATOR (UROKINASE- TYPE) PLATELET GLYCOPROTEIN IIIa (GP3A) PLAU
PLEOMORPHIC ADENOMA GENE-LIKE 1 (PLAGL1) POLYMORPHIC EPITHELIAL
MUCIN (PEM) PRAD1 PROGESTERONE RECEPTOR (PgR) PROGESTERONE
RESISTANCE PROSTAGLANDIN ENDOPEROXIDE SYNTHASE-2 PROSTAGLANDIN G/H
SYNTHASE-2 PROSTAGLANDIN H SYNTHASE-2 pS2 PS6K PSORIASIN PTHLH
PTHrP RAD51 RAD52 RAD54 RAP46 RECEPTOR-ASSOCIATED COACTIVATOR 3
(RAC3) REPRESSOR OF ESTROGEN RECEPTOR ACTIVITY (REA) S100A4 S100A6
S100A7 S6K SART-1 SCAFFOLD ATTACHMENT FACTOR B (SAF-B) SCATTER
FACTOR (SF) SECRETED PHOSPHOPROTEIN-1 (SPP- 1) SECRETED PROTEIN
ACIDIC AND RICH IN CYSTEINE (SPARC) STANNICALCIN STEROID RECEPTOR
COACTIVATOR-1 (SRC-1) STEROID RECEPTOR COACTIVATOR-2 (SRC-2)
STEROID RECEPTOR COACTIVATOR-3 (SRC-3) STEROID RECEPTOR RNA
ACTIVATOR (SRA) STROMELYSIN-1 STROMELYSIN-3 TENASCIN-C (TN-C)
TESTES-SPECIFIC PROTEASE 50 THROMBOSPONDIN I THROMBOSPONDIN II
THYMIDINE PHOSPHORYLASE (TP) THYROID HORMONE RECEPTOR ACTIVATOR
MOLECULE 1 (TRAM-1) TIGHT JUNCTION PROTEIN 1 (TJP1) TIMP1 TIMP2
TIMP3 TIMP4 TISSUE-TYPE PLASMINOGEN ACTIVATOR TN-C TP53 tPA
TRANSCRIPTIONAL INTERMEDIARY FACTOR 2 (TIF2) TREFOIL FACTOR 1
(TFF1) TSG101
TSP-1 TSP1 TSP-2 TSP2 TSP50 TUMOR CELL COLLAGENASE STIMULATING
FACTOR (TCSF) TUMOR-ASSOCIATED EPITHELIAL MUCIN uPA uPAR UROKINASE
UROKINASE-TYPE PLASMINOGEN ACTIVATOR UROKINASE-TYPE PLASMINOGEN
ACTIVATOR RECEPTOR (uPAR) UVOMORULIN VASCULAR ENDOTHELIAL GROWTH
FACTOR VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR-2 (VEGFR2)
VASCULAR ENDOTHELIAL GROWTH FACTOR-A VASCULAR PERMEABILITY FACTOR
VEGFR2 VERY LATE T-CELL ANTIGEN BETA (VLA- BETA) VIMENTIN
VITRONECTIN RECEPTOR ALPHA POLYPEPTIDE (VNRA) VITRONECTIN RECEPTOR
VON WILLEBRAND FACTOR VPF VWF WNT-1 ZAC ZO-1 ZONULA OCCLUDENS-1
[0146] Any sample mobilization component may be used in the device.
For example, the sample mobilizer may include a mechanical rocker
or a sonicator. Alternatively, it may be adapted to provide
centrifugal force to the receptacle and lid. A centrifugal sample
mobilizer may be used to mobilize sample components, e.g., cells,
within a fluid sample, e.g., a fluid sample having a free surface.
A centrifugal sample mobilizer may also be used to drive cell
rolling along the lid surface. In one example, a centrifugal sample
mobilizer may include an axle that rotates the receptacle; in some
embodiments, the centrifugal force generated by operating the
device is capable of driving the lid into a nonorthogonal angle
with respect to the axle.
[0147] Another sample mobilization component that may be used in
the device utilizes two fluidically coupled chambers, each of which
has a surface in contact with the internal space of the receptacle.
In such a device, which utilizes pressure-driven flow, each chamber
is filled with a fluid, e.g., air, and when one chamber is
compressed, a portion of the fluid therein enters the other
chamber, increasing its volume. By placing these chambers in
contact with a cellular sample in the receptacle and altering their
volumes, e.g., squeezing the chambers in alternation, the sample is
mobilized.
Uses of Devices of the Invention
[0148] The invention features improved devices for the enrichment
of CTCs and other particles, including bacteria, viruses, fungi,
cells, cellular components, viruses, nucleic acids, proteins, and
protein complexes, according to size. The devices may be used to
effect various manipulations on particles in a sample. Such
manipulations include enrichment or concentration of a particle,
including size based fractionation, or alteration of the particle
itself or the fluid carrying the particle. Preferably, the devices
are employed to enrich CTCs or other rare particles from a
heterogeneous mixture or to alter a rare particle, e.g., by
exchanging the liquid in the suspension or by contacting a particle
with a reagent. Such devices allow for a high degree of enrichment
with limited stress on cells, e.g., reduced mechanical lysis or
intracellular activation of cells.
Array Design
[0149] Single-Stage Array.
[0150] In one embodiment, a single stage contains an array of
obstacles, e.g., cylindrical obstacles (FIG. 1D), forming a network
of gaps. In certain embodiments, the array has a maximum
pass-through size that is several times larger than the cut-off
size, e.g., when enriching CTCs from other cells in a blood sample.
This result may be achieved using a combination of a large gap size
d and a small bifurcation ratio E. In preferred embodiments, the
.epsilon. is at most 1/2, e.g., at most 1/3, 1/10, 1/30, 1/100,
1/300, or 1/1000. In such embodiments, the obstacle shape may
affect the flow profile in the gap, e.g., such that fluid flowing
through the gaps is unevenly distributed around the obstacles;
however, the obstacles may be compressed in the flow direction, in
order to make the array short (FIG. 1E). Single stage arrays may
include bypass channels as described herein.
[0151] Multiple-Stage Arrays.
[0152] In another embodiment, multiple stages are employed to
enrich particles over a wide size range. An exemplary device is
shown in FIG. 7. The device shown has three stages, but any number
of stages may be employed. Typically, the cut-off size in the first
stage is larger than the cut-off in the second stage, and the first
stage cut-off size is smaller than the maximum pass-through size of
the second stage (FIG. 8). The same is true for the following
stages. The first stage will deflect (and remove) particles, e.g.,
that would cause clogging in the second stage, before they reach
the second stage. Similarly, the second stage will deflect (and
remove) particles that would cause clogging in the third stage,
before they reach the third stage. In general, an array may have as
many stages as desired, connected either serially or in
parallel.
[0153] As described, in a multiple-stage array, large particles,
e.g., cells, that could cause clogging downstream are deflected
first, and these deflected particles need to bypass the downstream
stages to avoid clogging. Thus, devices of the invention may
include bypass channels that remove output from an array. Although
described here in terms of removing particles above the critical
size, bypass channels may also be employed to remove output from
any portion of the array.
[0154] Different designs for bypass channels are as follows.
[0155] Single bypass channels. In this design, all stages share one
bypass channel, or there is only one stage. The physical boundary
of the bypass channel may be defined by the array boundary on one
side and a sidewall on the other (FIGS. 9-11). Single bypass
channels may also be employed with duplex arrays (FIG. 12).
[0156] Single bypass channels may also be designed, in conjunction
with an array to maintain constant flux through a device (FIG. 13).
The bypass channel has varying width designed maintain constant
flux through all the stages, so that the flow in the channel does
not interfere with the flow in the arrays. Such a design may also
be employed with an array duplex (FIG. 14). Single bypass channels
may also be designed in conjunction with the array in order to
maintain substantially constant fluidic resistance through all
stages (FIG. 15). Such a design may also be employed with an array
duplex (FIG. 16.)
[0157] Multiple bypass channels. In this design (FIG. 17), each
stage has its own bypass channel, and the channels are separated
from each other by sidewalls. Large particles, e.g., cells are
deflected into the major flux to the lower right corner of the
first stage and then into in the bypass channel (bypass channel 1
in FIG. 17). Smaller cells that would not cause clogging in the
second stage proceed to the second stage, and cells above the
critical size of the second stage are deflected to the lower right
corner of the second stage and into in another bypass channel
(bypass channel 2 in FIG. 17). This design may be repeated for as
many stages as desired. In this embodiment, the bypass channels are
not fluidically connected, allowing for collection or other
manipulation of multiple fractions. The bypass channels do not need
to be straight or be physically parallel to each other (FIG. 18).
Multiple bypass channels may also be employed with duplex arrays
(FIG. 19).
[0158] Multiple bypass channels may be designed, in conjunction
with an array to maintain constant flux through a device (FIG. 20).
In this example, bypass channels are designed to remove an amount
of flow so the flow in the array is not perturbed, i.e.,
substantially constant. Such a design may also be employed with an
array duplex (FIG. 21). In this design, the center bypass channel
may be shared between the two arrays in the duplex.
[0159] Optimal Boundary Design.
[0160] If the array were infinitely large, the flow distribution
would be the same at every gap. The flux .phi.going through a gap
would be the same, and the minor flux would be .epsilon..phi. for
every gap. In practice, the boundaries of the array perturb this
infinite flow pattern. Portions of the boundaries of arrays may be
designed to generate the flow pattern of an infinite array.
Boundaries may be flow-feeding, i.e., the boundary injects fluid
into the array or flow-extracting, i.e., the boundary extracts
fluid from the array.
[0161] A preferred flow-extracting boundary widens gradually to
extract .epsilon..phi. (represented by arrows in FIG. 22) from each
gap at the boundary (d=24 .mu.m, .epsilon.=1/60). For example, the
distance between the array and the sidewall gradually increases to
allow for the addition of .epsilon..phi. from each gap to the
boundary. The flow pattern inside this array is not affected by the
bypass channel because of the boundary design.
[0162] A preferred flow-feeding boundary narrows gradually to feed
exactly .epsilon..phi. (represented by arrows in FIG. 23) into each
gap at the boundary (d=24 .mu.m, .epsilon.=1/60). For example, the
distance between the array and the sidewall gradually decreases to
allow for the removal of .epsilon..phi. to each gap from the
boundary. Again, the flow pattern inside this array is not affected
by the bypass channel because of the boundary design.
[0163] A flow-feeding boundary may also be as wide as or wider than
the gaps of an array (FIG. 24) (d=24 .mu.m, .epsilon.=1/60). A wide
boundary may be desired if the boundary serves as a bypass channel,
e.g., to allow for collection of particles. A boundary may be
employed that uses part of its entire flow to feed the array and
feeds .epsilon..phi. into each gap at the boundary (represented by
arrows in FIG. 24).
[0164] FIG. 25 shows a single bypass channel in a duplex array
(.epsilon.=1/10, d=8 .mu.m). The bypass channel includes two
flow-feeding boundaries. The flux across the dashed line 1 in the
bypass channel is .phi.bypass. A flow .phi. joins .phi.bypass from
a gap to the left of the dashed line. The shapes of the obstacles
at the boundaries are adjusted so that the flows going into the
arrays are .epsilon..phi. at each gap at the boundaries. The flux
at dashed line 2 is again .phi.bypass.
[0165] In some cases, arrays of the invention may include a
plurality of rows of obstacles, each successive row being offset by
less than half of the period of the previous row, such that at
least 50%, 60%, 70%, 80%, 90%, 95%, or even 99% of gaps between
obstacles each has a length approximately equal to a first length
parameter, and at most 50%, 40%, 30%, 20%, 10%, 5%, or even 1%,
respectively, of gaps between obstacles each has a length
approximately equal to a second length parameter shorter than the
first length parameter. Gaps having a length approximately equal to
the second length parameter may be distributed throughout the array
either uniformly or non-uniformly. The second length parameter may
be sized to capture a cell of interest larger than a predetermined
size from a cellular sample. The first length parameter is longer
than the second length parameter, e.g., by a factor of 1.1, 1.5, 2,
3, 5, 10, 20, 50, or even 100. Exemplary distances for the first
length parameter are in the range of 30 to 100 microns, and
exemplary distances for the second length parameter are in the
range of 10 to 50 microns.
[0166] Optionally, each obstacle of an array of the invention has
approximately the same size; alternatively, at least 50%, 60%, 70%,
80%, 90%, 95%, or even 99% of the obstacles have approximately the
same size. In some cases, at least 50%, 60%, 70%, 80%, 90%, 95%, or
even 99% of the gaps between obstacles in each row each has a
length approximately equal to a first length parameter, and up to
50%, 40%, 30%, 20%, 10%, 5%, or even 1%, respectively, of the gaps
between obstacles in each row each has a length approximately equal
to a second length parameter, which may be shorter than the first
length parameter.
[0167] In some arrays, a subset of the obstacles, e.g., 50%, 40%,
30%, 20%, 10%, 5%, or even 1%, are unaligned with the centers of
the remaining obstacles in their row. Unaligned obstacles may be
distributed throughout the array either uniformly or
non-uniformly.
[0168] Arrays of the invention may have obstacles with different
cross-sections; for example, 50%, 60%, 70%, 80%, 90%, 95%, or even
99% of the obstacles may each have a cross-sectional area
approximately equal to a first area parameter, and 50%, 40%, 30%,
20%, 10%, 5%, or even 1%, respectively, of the obstacles may each
have a cross-sectional area approximately equal to a second area
parameter. Optionally, the second area parameter is larger than the
first area parameter. In addition, at least one obstacle having a
cross-sectional area approximately equal to the first area
parameter or second area parameter may have an asymmetrical
cross-section.
[0169] Arrays of the invention may also include a first subarray of
obstacles and a second subarray of obstacles, such that each of the
subarrays includes a gap between two obstacles in that subarray,
and such that the array includes an interface between the first
subarray and the second subarray including a restricted gap that is
smaller than the gap between two obstacles in either subarray. The
subarrays may be arranged in a two-dimensional configuration;
furthermore, they may be staggered, either periodically or
uniformly. Each subarray may contain any number of obstacles, e.g.,
between 2 and 200, between 3 and 50, or between 6 and 20. Exemplary
diameters for subarray obstacles are, e.g., in the range of 25 to
200 microns. In general, the gap between two obstacles in an array
of the invention may be, e.g., at least 20, 40, 60, 80, or 100
microns; in the case of the restricted gap described above, this
gap may be, e.g., at most 100, 80, 60, 40, or 20 microns. Other gap
lengths are also possible.
[0170] Arrays of the invention may be coupled to a substrate, e.g.,
plastic, and may include a microfluidic gap. Arrays may
additionally be coupled to one or more binding moieties, e.g.,
binding moieties described herein, that selectively bind to cells
of interest. Arrays may also be inside a receptacle, e.g., a
receptacle coupled to a transparent cover.
[0171] In another embodiment, a two-dimensional array of obstacles
forms a network of gaps, such that the array of obstacles includes
a plurality of rows distributed on a surface to create fluid flow
paths through the device, wherein at least 50%, 60%, 70%, 80%, 90%,
95%, or even 99% of the flow paths each has a width approximately
equal to a first width parameter, and at most 50%, 40%, 30%, 20%,
10%, 5%, or even 1%, respectively, of the flow paths each has a
width approximately equal to a second, smaller width parameter.
Such an array may be used, e.g., to enrich an analyte from a fluid
sample. Flow paths each having a width approximately equal to the
second width parameter may be distributed throughout the device
either uniformly or non-uniformly, and the second width parameter
may be sized to capture the desired analyte within the flow paths
that are approximately of the second width parameter. Optionally,
the array includes an inlet and an outlet. Optionally, in arrays
that include outlets, a region of obstacles with flow path widths
equal to or smaller than the second width surrounds the outlet.
Such devices may, e.g., have three two-dimensional arrays fluidly
connected in series, such that the percentage of the flow paths of
the second width increases in the direction of flow of fluid
through the device.
[0172] Arrays may be coupled to other elements to form devices of
the invention. For example, an array may be fluidically coupled to
a sample reservoir, a detector, or other elements or modules
disclosed herein. Arrays may also function as devices without the
need for additional elements or modules. In addition, arrays of the
invention may be two-dimensional arrays, or they may adopt another
geometry.
[0173] Any of the arrays described herein may be used in
conjunction with any of the devices or methods of the
invention.
Device Design
On-Chip Flow Resistor for Defining and Stabilizing Flow
[0174] Devices of the invention may also employ fluidic resistors
to define and stabilize flows within an array and to also define
the flows collected from the array. FIG. 26 shows a schematic of
planar device; a sample, e.g., blood containing CTCs, inlet
channel, a buffer inlet channel, a waste outlet channel, and a
product outlet channel are each connected to an array. The inlets
and outlets act as flow resistors. FIG. 26 also shows the
corresponding fluidic resistances of these different device
components.
Flow Definition within the Array
[0175] FIGS. 27 and 28 show the currents and corresponding widths
of the sample and buffer flows within the array when the device has
a constant depth and is operated with a given pressure drop. The
flow is determined by the pressure drop divided by the resistance.
In this particular device, I.sub.blood and I.sub.buffer are
equivalent, and this determines equivalent widths of the blood and
buffer streams in the array.
Definition of Collection Fraction
[0176] By controlling the relative resistance of the product and
waste outlet channels, one may modulate the collection tolerance
for each fraction. For example, in this particular set of
schematics, when R.sub.product is greater than R.sub.waste, a more
concentrated product fraction will result at the expense of a
potentially increased loss to and dilution of waste fraction.
Conversely, when R.sub.product is less than R.sub.waste, a more
dilute and higher yield product fraction will be collected at the
expense of potential contamination from the waste stream.
Multiplexed Arrays
[0177] The invention features multiplexed arrays. Putting multiple
arrays on one device increases sample-processing throughput of CTCs
or other cells of interest and allows for parallel processing of
multiple samples or portions of the sample for different fractions
or manipulations. Multiplexing is further desirable for preparative
devices. The simplest multiplex device includes two devices
attached in series, i.e., a cascade. For example, the output from
the major flux of one device may be coupled to the input of a
second device. Alternatively, the output from the minor flux of one
device may be coupled to the input of the second device.
[0178] Duplexing.
[0179] Two arrays may be disposed side-by-side, e.g., as mirror
images (FIG. 29). In such an arrangement, the critical size of the
two arrays may be the same or different. Moreover, the arrays may
be arranged so that the major flux flows to the boundary of the two
arrays, to the edge of each array, or a combination thereof. Such a
multiplexed array may also contain a central region disposed
between the arrays, e.g., to collect particles above the critical
size or to alter the sample, e.g., through buffer exchange,
reaction, or labeling.
[0180] Multiplexing on a Device.
[0181] In addition to forming a duplex, two or more arrays that
have separated inputs may be disposed on the same device (FIG.
30A). Such an arrangement could be employed for multiple samples,
or the plurality of arrays may be connected to the same inlet for
parallel processing of the same sample. In parallel processing of
the same sample, the outlets may or may not be fluidically
connected. For example, when the plurality of arrays has the same
critical size, the outlets may be connected for high throughput
samples processing. In another example, the arrays may not all have
the same critical size or the particles in the arrays may not all
be treated in the same manner, and the outlets may not be
fluidically connected.
[0182] Multiplexing may also be achieved by placing a plurality of
duplex arrays on a single device (FIG. 30B). A plurality of arrays,
duplex or single, may be placed in any possible three-dimensional
relationship to one another.
[0183] Devices of the invention also feature a small footprint.
Reducing the footprint of an array may lower cost, and reduce the
number of collisions with obstacles to eliminate any potential
mechanical damage or other effects to particles. The length of a
multiple stage array may be reduced if the boundaries between
stages are not perpendicular to the direction of flow. The length
reduction becomes significant as the number of stages increases.
FIG. 31 shows a small-footprint three-stage array.
Additional Components
[0184] In addition to an array of gaps, devices of the invention
may include additional elements or modules, e.g., for isolation,
enrichment, collection, manipulation, or detection, e.g., of CTCs.
Such elements are known in the art. For example, devices may
include one or more inlets for sample or buffer input, and one or
more outlets for sample output. Arrays may also be employed on a
device having components for other types of enrichment or other
manipulation, including affinity, magnetic, electrophoretic,
centrifugal, and dielectrophoretic enrichment. Devices of the
invention may also be employed with a component for two-dimensional
imaging of the output from the device, e.g., an array of wells or a
planar surface. Preferably, arrays of gaps as described herein are
employed in conjunction with an affinity enrichment.
[0185] In one example, a detection module is fluidically coupled to
a separation or enrichment device of the invention. The detection
module may operate using any method of detection disclosed herein,
or other methods known in the art. For example, the detection
module includes a microscope, a cell counter, a magnet, a biocavity
laser (see, e.g., Gourley et al., J. Phys. D: Appl. Phys. 36:
R228-R239 (2003)), a mass spectrometer, a PCR device, an RT-PCR
device, a matrix, a microarray, or a hyperspectral imaging system
(see, e.g., Vo-Dinh et al., IEEE Eng. Med. Biol. Mag. 23:40-49
(2004)). In one embodiment, a computer terminal may be connected to
the detection module. For instance, the detection module may detect
a label that selectively binds to cells of interest.
[0186] In another example, a capture module is fluidically coupled
to a separation or enrichment device of the invention. For example,
a capture module includes one or more binding moieties that
selectively bind a particular cell type, e.g., a cancer cell or
other rare cell. In capture module embodiments that include an
array of obstacles, the obstacles may include such binding
moieties.
[0187] Additionally, a cell counting module, e.g., a Coulter
counter, may be fluidically coupled to a separation or enrichment
device of the invention. Other modules, e.g., a programmable
heating unit, may alternatively be fluidically coupled.
[0188] The methods of the invention may be employed in connection
with any enrichment or analytical device, either on the same device
or in different devices. Examples include affinity columns,
particle sorters, e.g., fluorescent activated cell sorters,
capillary electrophoresis, microscopes, spectrophotometers, sample
storage devices, and sample preparation devices. Microfluidic
devices are of particular interest in connection with the systems
described herein.
[0189] Exemplary analytical devices include devices useful for
size, shape, or deformability based enrichment of particles,
including filters, sieves, and enrichment or separation devices,
e.g., those described in International Publication Nos. 2004/029221
and 2004/113877, Huang et al. Science 304:987-990 (2004), U.S.
Publication No. 2004/0144651, U.S. Pat. Nos. 5,837,115 and
6,692,952, and U.S. Application Nos. 60/703,833, 60/704,067, and
11/227,904; devices useful for affinity capture, e.g., those
described in International Publication No. 2004/029221 and U.S.
application Ser. No. 11/071,679; devices useful for preferential
lysis of cells in a sample, e.g., those described in International
Publication No. 2004/029221, U.S. Pat. No. 5,641,628, and U.S.
Application No. 60/668,415; devices useful for arraying cells,
e.g., those described in International Publication No. 2004/029221,
U.S. Pat. No. 6,692,952, and U.S. application Ser. Nos. 10/778,831
and 11/146,581; and devices useful for fluid delivery, e.g., those
described in U.S. application Ser. Nos. 11/071,270 and 11/227,469.
Two or more devices may be combined in series, e.g., as described
in International Publication No. 2004/029221.
Methods of Fabrication
[0190] Devices of the invention may be fabricated using techniques
well known in the art. The choice of fabrication technique will
depend on the material used for the device and the size of the
array. Exemplary materials for fabricating the devices of the
invention include glass, silicon, steel, nickel, polymers, e.g.,
poly(methylmethacrylate) (PMMA), polycarbonate, polystyrene,
polyethylene, polyolefins, silicones (e.g.,
poly(dimethylsiloxane)), polypropylene, cis-polyisoprene (rubber),
poly(vinyl chloride) (PVC), poly(vinyl acetate) (PVAc),
polychloroprene (neoprene), polytetrafluoroethylene (Teflon),
poly(vinylidene chloride) (SaranA), and cyclic olefin polymer (COP)
and cyclic olefin copolymer (COC), and combinations thereof. Other
materials are known in the art. For example, deep Reactive Ion Etch
(DRIE) is used to fabricate silicon-based devices with small gaps,
small obstacles and large aspect ratios (ratio of obstacle height
to lateral dimension). Thermoforming (embossing, injection molding)
of plastic devices may also be used, e.g., when the smallest
lateral feature is >20 microns and the aspect ratio of these
features is <10. Additional methods include photolithography
(e.g., stereolithography or x-ray photolithography), molding,
embossing, silicon micromachining, wet or dry chemical etching,
milling, diamond cutting, Lithographie Galvanoformung and Abformung
(LIGA), and electroplating. For example, for glass, traditional
silicon fabrication techniques of photolithography followed by wet
(KOH) or dry etching (reactive ion etching with fluorine or other
reactive gas) may be employed. Techniques such as laser
micromachining may be adopted for plastic materials with high
photon absorption efficiency. This technique is suitable for lower
throughput fabrication because of the serial nature of the process.
For mass-produced plastic devices, thermoplastic injection molding,
and compression molding may be suitable. Conventional thermoplastic
injection molding used for mass-fabrication of compact discs (which
preserves fidelity of features in sub-microns) may also be employed
to fabricate the devices of the invention. For example, the device
features are replicated on a glass master by conventional
photolithography. The glass master is electroformed to yield a
tough, thermal shock resistant, thermally conductive, hard mold.
This mold serves as the master template for injection molding or
compression molding the features into a plastic device. Depending
on the plastic material used to fabricate the devices and the
requirements on optical quality and throughput of the finished
product, compression molding or injection molding may be chosen as
the method of manufacture. Compression molding (also called hot
embossing or relief imprinting) has the advantages of being
compatible with high molecular weight polymers, which are excellent
for small structures and may replicate high aspect ratio structures
but has longer cycle times. Injection molding works well for low
aspect ratio structures and is most suitable for low molecular
weight polymers.
[0191] A device may be fabricated in one or more pieces that are
then assembled. Layers of a device may be bonded together by
clamps, adhesives, heat, anodic bonding, or reactions between
surface groups (e.g., wafer bonding). Alternatively, a device with
channels in more than one plane may be fabricated as a single
piece, e.g., using stereolithography or other three-dimensional
fabrication techniques.
[0192] To reduce non-specific adsorption of cells or compounds
released by lysed cells onto the channel walls, one or more channel
walls may be chemically modified to be non-adherent or repulsive.
The walls may be coated with a thin film coating (e.g., a
monolayer) of commercial non-stick reagents, such as those used to
form hydrogels. Additional examples chemical species that may be
used to modify the channel walls include oligoethylene glycols,
fluorinated polymers, organosilanes, thiols, poly-ethylene glycol,
hyaluronic acid, bovine serum albumin, poly-vinyl alcohol, mucin,
poly-HEMA, methacrylated PEG, and agarose. Charged polymers may
also be employed to repel oppositely charged species. The type of
chemical species used for repulsion and the method of attachment to
the channel walls will depend on the nature of the species being
repelled and the nature of the walls and the species being
attached. Such surface modification techniques are well known in
the art. The walls may be functionalized before or after the device
is assembled. The channel walls may also be coated in order to
capture materials in the sample, e.g., membrane fragments or
proteins.
Methods of Operation
[0193] Devices of the invention may be employed in any application
where the production of a sample enriched in particles above or
below a critical size is desired. A preferred use of the device is
to produce samples enriched in CTCs or other rare cells. Once an
enriched sample is produced, it may be collected for analysis or
otherwise manipulated.
[0194] Devices of the invention may be employed in concentrated
samples, e.g., where particles are touching, hydrodynamically
interacting with each other, or exerting an effect on the flow
distribution around another particle. For example, the method may
enrich CTCs from other cells in whole blood from a human donor.
Human blood typically contains .about.45% of cells by volume. Cells
are in physical contact and/or coupled to each other
hydrodynamically when they flow through the array. FIG. 32 shows
schematically that cells are densely packed inside an array and
could physically interact with each other.
Enrichment
[0195] In one embodiment, devices of the invention are employed to
produce a sample enriched in particles of a desired hydrodynamic
size. Applications of such enrichment include concentrating CTCs or
other cells of interest, and size fractionization, e.g., size
filtering (selecting cells in a particular size range). Devices may
also be used to enrich components of cells, e.g., nuclei.
Desirably, the methods of the invention retain at least 50%, 75%,
80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, or even 99% of the desired particles
compared to the initial mixture, while potentially enriching the
desired particles by a factor of at least 100, 1,000, 10,000,
100,000, 1,000,000, 10,000,000, or even 100,000,000 relative to one
or more non-desired particles. Desirably, if a device produces any
output sample in addition to the enriched sample, this additional
output sample contains less than 50%, 25%, 20%, 19%, 18%, 17%, 16%,
15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or
even 1% of the desired particles compared to the initial mixture.
The enrichment may also result in a dilution of the enriched
particles compared to the original sample, although the
concentration of the enriched particles relative to other particles
in the sample has increased. Preferably, the dilution is at most
90%, e.g., at most 75%, 50%, 33%, 25%, 10%, or 1%.
[0196] In a preferred embodiment, the device produces a sample
enriched in a rare particles, e.g., cells. In general, a rare
particle is a particle that is present as less than 10% of a
sample. Rare particles include, depending on the sample, rare
cells, e.g., CTCs, epithelial cells, fetal cells, stem cells (e.g.,
undifferentiated), bone marrow cells, progenitor cells, foam cells,
mesenchymal cells, endothelial cells, endometrial cells,
trophoblasts, cancer cells, immune system cells (host or graft),
connective tissue cells, bacteria, fungi, and pathogens (e.g.,
bacterial or protozoa). Rare particles also include viruses, as
well as cellular components such as organelles (e.g., mitochondria
and nuclei). Rare particles may be isolated from samples including
bodily fluids, e.g., blood, or environmental sources, e.g.,
pathogens in water samples. Fetal red blood cells may be enriched
from maternal peripheral blood, e.g., for the purpose of
determining sex and identifying aneuploidies or genetic
characteristics, e.g., mutations, in the developing fetus. CTCs,
which are of epithelial type and origin, may also be enriched from
peripheral blood for the purpose of diagnosis and monitoring
therapeutic progress. Circulating endothelial cells may be
similarly enriched from peripheral blood. Bodily fluids or
environmental samples may also be screened for pathogens, e.g., for
coliform bacteria, blood borne illnesses such as sepsis, or
bacterial or viral meningitis. Rare cells also include cells from
one organism present in another organism, e.g., an in cells from a
transplanted organ.
[0197] In addition to enrichment of rare particles, devices of the
invention may be employed for preparative applications. An
exemplary preparative application includes generation of cell packs
from blood. Devices of the invention may be configured to produce
fractions enriched in platelets, red blood cells, and white cells.
By using multiplexed devices or multistage devices, all three
cellular fractions may be produced in parallel or in series from
the same sample. In other embodiments, the device may be employed
to separate nucleated from non-nucleated cells, e.g., from cord
blood sources.
[0198] Using the devices of the invention is advantageous in
situations where the particles being enriched are subject to damage
or other degradation. As described herein, devices of the invention
may be designed to enrich cells with a minimum number of collisions
between the cells and obstacles. This minimization reduces
mechanical damage to cells and also prevents intracellular
activation of cells caused by the collisions. This gentle handling
of the cells preserves the limited number of rare cells in a
sample, prevents rupture of cells leading to contamination or
degradation by intracellular components, and prevents maturation or
activation of cells, e.g., stem cells or platelets. In preferred
embodiments, cells are enriched such that fewer than 30%, 10%, 5%,
1%, 0.1%, or even 0.01% are activated or mechanically lysed.
[0199] FIG. 33A shows a typical size distribution of cells in human
peripheral blood. The white blood cells range from .about.4 .mu.m
to .about.12 .mu.m, whereas the red blood cells are .about.1.5-3
.mu.m (short axis). FIG. 33B shows that CTCs are generally
significantly larger than blood cells, with the majority of CTCs
ranging from .about.8 to .about.22 .mu.m. Thus, a size-based
enrichment using a device of the invention, in which the size
cutoff is chosen to be, e.g., 12 .mu.m (FIG. 33C), would be
effective in enriching CTCs from other blood cells. Any cell
population with a similar distribution to CTCs may be similarly
enriched from blood cells (FIG. 33D).
[0200] In an alternative embodiment, a cellular sample is added
through a sample inlet of the device, and buffer medium is added
through the fluid inlet (FIG. 42A). Cells below the critical size
move through the device undeflected, emerging from the edge outlets
in their original sample medium. Cells above the critical size,
e.g., epithelial cells, in particular, CTCs, are deflected and
emerge from the center outlet contained in the buffer medium added
through the fluid inlet. Operation of the device thus produces
samples enriched in cells above and below the critical size.
Because epithelial cells are among the largest cells in the
bloodstream, the size and geometry of the gaps of the device may be
chosen so as to direct virtually all other cell types to the edge
outlets, while producing a sample from the center outlet that is
substantially enriched in epithelial cells after a single pass
through the device.
[0201] A device of the invention need not be duplexed as shown in
FIG. 42A in order to operate as described herein. The schematized
representation shown in FIG. 42B may represent either a duplexed
device or a single array.
[0202] Enrichment may be enhanced in numerous ways. For example,
target cells may be labeled with immunoaffinity beads, thereby
increasing their size (as depicted in FIG. 44). In the case of
epithelial cells, e.g., CTCs, this may further increase their size
and thus result in an even more efficient enrichment.
Alternatively, the size of smaller cells may be increased to the
extent that they become the largest objects in solution or occupy a
unique size range in comparison to the other components of the
cellular sample, or so that they copurify with other cells. The
hydrodynamic size of a labeled target cell may be at least 10%,
100%, or even 1,000% greater than the hydrodynamic size of such a
cell in the absence of label. Beads may be made of polystyrene,
magnetic material, or any other material that may be adhered to
cells. Desirably, such beads are neutrally buoyant so as not to
disrupt the flow of labeled cells through the device of the
invention.
[0203] Enrichment methods of the invention include devices that
include obstacles that are capable of selectively capturing cells
of interest, e.g., epithelial cells, e.g., CTCs.
[0204] The methods of the invention may also be used to deplete or
remove an analyte from a cellular sample, for example, by producing
a sample enriched in another analyte using the above-described
methods. For example, a cellular sample may be depleted of cells
having a hydrodynamic size less than or equal to 12 microns by
enriching for cells having a hydrodynamic size greater than 12
microns. Any method of depletion or removal may be used in
conjunction with the arrays and devices of the invention. In
methods of the invention featuring depletion of removal of an
analyte, sample processing may be continuous and may occur in vivo
or ex vivo. Furthermore, in some embodiments, if the analyte to be
depleted or removed is retained in a device of the invention, the
analyte may be released from the device by applying a hypertonic
solution to said device. The analyte may then be detected in the
effluent from the device.
Alteration
[0205] In other embodiments, in addition to enrichment, CTCs or
other cells of interest are contacted with an altering reagent that
may chemically or physically alter the particle or the fluid in the
suspension. Such applications include purification, buffer
exchange, labeling (e.g., immunohistochemical, magnetic, and
histochemical labeling, cell staining, and flow in-situ
fluorescence hybridization (FISH)), cell fixation, cell
stabilization, cell lysis, and cell activation.
[0206] Such methods allow for the transfer of particles, e.g.,
CTCs, from a sample into a different liquid. FIG. 34A shows this
effect schematically for a single stage device, FIG. 34B shows this
effect for a multistage device, FIG. 34C shows this effect for a
duplex array, and FIG. 34D shows this effect for a multistage
duplex array. By using such methods, blood cells may be separated
from plasma. Such transfers of particles from one liquid to another
may be also employed to effect a series of alterations, e.g.,
Wright staining blood on-chip. Such a series may include reacting a
particle with a first reagent and then transferring the particle to
a wash buffer, and then another reagent.
[0207] FIGS. 35A-35C illustrate a further example of alteration in
a two stage device having two bypass channels. In this example,
large blood particles are moved from blood to buffer and collected
in stage 1, medium blood particles are moved from blood to buffer
in stage 2, and small cells that are not moved from the blood in
stage are collected also collected. FIG. 35B illustrates the size
cut-off of the two stages, and FIG. 35C illustrates the size
distribution of the three fractions collected.
[0208] FIG. 36 illustrates an example of alteration in a two stage
device having bypass channels that are disposed between the lateral
edge of the array and the channel wall. FIG. 37 illustrates a
device similar to that in FIG. 36, except that the two stages are
connected by fluidic channels. FIG. 38 illustrates alteration in a
device having two stages with a small footprint. FIGS. 39A-39B
illustrate alteration in a device in which the output from the
first and second stages is captured in a single channel. FIG. 40
illustrates another device for use in the methods of the
invention.
[0209] FIG. 41 illustrates the use of a device to perform multiple,
sequential alterations on a particle. In this device a blood
particles is moved from blood into a regent that reacts with the
particle, and the reacted particle is then moved into a buffer,
thereby removing the unreacted reagent or reaction byproducts.
Additional steps may be added.
[0210] Enrichment and alteration may also be combined, e.g., where
desired cells are contacted with a lysing reagent and cellular
components, e.g., nuclei, are enriched based on size. In another
example, particles may be contacted with particulate labels, e.g.,
magnetic beads, which bind to the particles. Unbound particulate
labels may be removed based on size.
Separation of Free Labeling Reagent from Labeling Reagent Bound to
Cells
[0211] Devices of the invention may be employed in order to
separate free labeling reagent from labeling reagent bound to CTCs
or other cells. As shown in FIG. 45, a labeling reagent may be
pre-incubated with a cellular sample prior to introduction to the
device. Desirably, the labeling reagent specifically or
preferentially binds the cell population of interest, e.g.,
epithelial cells such as CTCs. Exemplary labeling reagents include
antibodies, quantum dots, phage, aptamers, fluorophore-containing
molecules, enzymes capable of carrying out a detectable chemical
reaction, or functionalized beads. Generally, the labeling reagent
is smaller than the cell of interest, or the cell of interest bound
to the bead; thus, when the cellular sample combined with the
labeling reagent is introduced to the device, free labeling reagent
moves through the device undeflected and emerges from the edge
outlets, while bound labeling reagent emerges from the center
outlet along with epithelial cells. Advantageously, this method
simultaneously achieves size separation and separation of free
labeling reagent from bound labeling reagent. Additionally, this
method of separation facilitates downstream sample analysis without
the need for a release step or destructive methods of analysis, as
described below.
[0212] FIG. 46 shows a more general case, in which the enriched
labeled sample contains a population of non-target cells that
co-separate with the target cells due to similar size. The
non-target cells do not interfere with downstream sample analysis
that relies on detection of the bound labeling reagent, because
this reagent binds selectively to the cells of interest.
Buffer Exchange
[0213] Devices of the invention may be employed for purposes of
buffer exchange. To achieve this result, a protocol similar to that
used for enrichment is followed: a cellular sample is added through
a sample inlet of the device, and the desired final buffer medium
is added through a fluid inlet. As described above, cells above the
critical size are deflected and enter the buffer.
Concentration
[0214] Devices of the invention may be employed in order to
concentrate a cellular sample of interest, e.g., a sample
containing CTCs. As shown in FIG. 47, a cellular sample is
introduced to the sample inlet of the device. By reducing the
volume of buffer introduced into the fluid inlet so that this
volume is significantly smaller than the volume of the cellular
sample, concentration of target cells in a smaller volume results.
This concentration step may improve the results of any downstream
analysis performed.
Cell Lysis
[0215] Devices of the invention may be employed for purposes of
cell lysis. To achieve this, a protocol similar to that used for
enrichment is followed: a cellular sample is added through a sample
inlet of the device (FIG. 48), and lysis buffer is added through
the fluid inlet. As described above, cells above the critical size
are deflected and enter the lysis buffer, leading to lysis of these
cells. As a result, the sample emerging from the center outlet
includes lysed cell components including organelles, while
undeflected whole cells emerge from the other outlet. Thus, the
device provides a method for selectively lysing target cells.
Multiple Stages
[0216] Devices of the invention may be joined together to provide
multiple stages of enrichment and reaction. For example, FIG. 43A
shows the "cascade" configuration, in which outlet 1 of one device
is joined to a sample inlet of a second device. This allows for an
initial enrichment step using the first device so that the sample
introduced to the second device is already enriched for cells of
interest. The two devices may have either identical or different
critical sizes, depending on the intended application.
[0217] In FIG. 49, an unlabeled cellular sample is introduced to
the first device in the cascade via a sample inlet, and a buffer
containing labeling reagent is introduced to the first device via
the fluid inlet. Epithelial cells, e.g., CTCs, are deflected and
emerge from the center outlet in the buffer containing labeling
reagent. This enriched labeled sample is then introduced to the
second device in the cascade via a sample inlet, while buffer is
added to the second device via the fluid inlet. Further enrichment
of target cells and separation of free labeling reagent is
achieved, and the enriched sample may be further analyzed.
Alternatively, labeling reagent may be added directly to the sample
emerging from the center outlet of the first device before
introduction to the second device. The use of a cascade
configuration may allow for the use of a smaller quantity or a
higher concentration of labeling reagent at less expense than the
single-device configuration of FIG. 55; in addition, any
nonspecific binding that may occur is significantly reduced by the
presence of an initial enrichment step using the first device.
[0218] An alternative configuration of two or more device stages is
the "bandpass" configuration. FIG. 43B shows this configuration, in
which outlet 2 of one device is joined to a sample inlet of a
second device. This allows for an initial enrichment step using the
first device so that the sample introduced to the second device
contains cells that remained undeflected within the first device.
This method may be useful when the cells of interest are not the
largest cells in the sample; in this instance, the first stage may
be used to reduce the number of large non-target cells by
deflecting them to the center outlet. As in the cascade
configuration, the two devices may have either identical or
different critical sizes, depending on the intended application.
For example, different critical sizes are appropriate for an
application requiring the enrichment of epithelial cells, e.g.,
CTCs, in comparison with an application requiring the enrichment of
smaller endothelial cells.
[0219] In FIG. 51, a cellular sample pre-incubated with labeling
reagent is introduced to a sample inlet of the first device of the
bandpass configuration, and a buffer is introduced to the first
device via the fluid inlet. The first device is disposed in such a
manner that large, non-target cells are deflected and emerge from
the center outlet, while a mixture of target cells, small
non-target cells, and labeling reagent emerge from outlet 2 of the
first device. This mixture is then introduced to the second device
via a sample inlet, while buffer is added to the second device via
the fluid inlet. Enrichment of target cells and separation of free
labeling reagent is achieved, and the enriched sample may be
further analyzed. Non-specific binding of labeling reagent to the
deflected cells in the first stage is acceptable in this method, as
the deflected cells and any bound labeling reagent are removed from
the system.
[0220] In any of the multiple device configurations described
above, the devices and the connections joining them may be
integrated into a single device. For example, a single cascade
device including two or more stages is possible, as is a single
bandpass device including two or more stages.
Downstream Analysis
[0221] A useful step for many diagnostic assays is the removal of
free labeling reagent from the sample to be analyzed. As described
above, devices of the invention are able to separate free labeling
reagent from labeling reagent bound to cells, e.g., CTCs. It is
then possible to perform a bulk measurement of the labeled sample
without significant levels of background interference from free
labeling reagent. For example, fluorescent antibodies selective for
a particular epithelial cell marker such as EpCAM may be used. The
fluorescent moiety may include Cy dyes, Alexa dyes, or other
fluorophore-containing molecules. The resulting labeled sample is
then analyzed by measuring the fluorescence of the resulting sample
of labeled enriched cells using a fluorometer. Alternatively, a
chromophore-containing label may be used in conjunction with a
spectrometer, e.g., a UV or visible spectrometer. The measurements
obtained may be used to quantify the number of target cells or all
cells in the sample. Alternatively, the ratio of two cells types in
the sample, e.g., the ratio of cancer cells to endothelial cells,
may be determined. This ratio may be a ratio of the number of each
type of cell, or alternatively it may be a ratio of any measured
characteristic of each type of cell.
[0222] Any method of identifying cells, e.g., cells that have a
cell surface marker associated with cancer, e.g., Ber-Ep4, CD34+,
EpCAM, E-Cadherin, Mucin-1, Cytokeratin 8, EGFR, and leukocyte
associated receptor (LAR), may be used. For example, an enriched
sample of CTCs may be contacted with a device that includes a
surface with one or more binding moieties that selectively bind one
or more cells of the enriched sample. The binding moieties may
include a polypeptide, e.g., an antibody or fragment thereof, e.g.,
monoclonal. For example, such a monoclonal antibody could be
specific for EpCAM, e.g., anti-human EpCAM/TROP1 (catalog #AF960,
R&D Systems).
[0223] Many other methods of measurement and labeling reagents are
useful in the methods of the invention. Any imaging technique,
e.g., hyperspectral imaging, may be used. Labeling antibodies,
e.g., antibodies selective for any cancer marker, e.g., those
listed in Table 1, may possess covalently bound enzymes that cleave
a substrate, altering its absorbance at a given wavelength; the
extent of cleavage is then quantified with a spectrometer.
Colorimetric or luminescent readouts are possible, depending on the
substrate used. Advantageously, the use of an enzyme label allows
for significant amplification of the measured signal, lowering the
threshold of detectability.
[0224] Quantum dots, e.g., Qdots.RTM. from QuantumDot Corp., may
also be utilized as a labeling reagent that is covalently bound to
a targeting antibody. Qdots are resistant to photobleaching and may
be used in conjunction with two-photon excitation measurements.
[0225] Other possible labeling reagents useful in the methods of
the invention are phage. Phage display is a technology in which
binding peptides are displayed by engineered phage strains having
strong binding affinities for a target protein, e.g., those found
on the surface of cells of interest. The peptide sequence
corresponding to a given phage is encoded in that phage's nucleic
acid, e.g., DNA or RNA. Thus, phage are useful labeling reagents in
that they are small relative to epithelial cells such as CTCs and
thus may be easily separated, and they additionally carry nucleic
acid that may be analyzed and quantified using PCR or similar
techniques, enabling a quantitative determination of the number of
cells present in an enriched bound sample.
[0226] FIG. 50 depicts the use of phage as a labeling reagent in
which two device stages are arrayed in a cascade configuration. The
method depicted in FIG. 50 fits the general description of FIG. 49,
with the exception of the labeling reagent employed.
[0227] Desirably, downstream analysis results in an accurate
determination of the number of target cells in the sample being
analyzed. In order to produce accurate quantitative results, the
surface antigen being targeted on the cells of interest typically
has known or predictable expression levels, and the binding of the
labeling reagent should also proceed in a predictable manner, free
from interfering substances. Thus, methods of the invention that
result in highly enriched cellular samples prior to introduction of
labeling reagent are particularly useful. In addition, labeling
reagents that allow for amplification of the signal produced are
preferred, because of the low incidence of target cells, such as
epithelial cells, e.g., CTCs, in the bloodstream. Reagents that
allow for signal amplification include enzymes and phage. Other
labeling reagents that do not allow for convenient amplification
but nevertheless produce a strong signal, such as quantum dots, are
also desirable.
[0228] It is not necessary to include a labeling reagent in the
methods of the invention. For example, one method includes the
steps of introducing a cellular sample, e.g., a sample of
peripheral blood, into a device of the invention. For example, the
device enriches cells having a hydrodynamic size greater than 12
microns, 14 microns, 16 microns, 18 microns, or even 20 microns
from smaller cells in the sample. Alternatively, the device may
enrich cells having a hydrodynamic size greater than or equal to 6
microns and less than or equal to 12 microns, e.g., cells having a
hydrodynamic size greater than or equal to 8 microns and less than
or equal to 10 microns, from other cells. The device may also
enrich cells having a hydrodynamic size greater than or equal to 5
microns and less than or equal to 10 microns from cells having a
hydrodynamic size greater than 10 microns; alternatively, it may
enrich cells having a hydrodynamic size greater than or equal to 4
microns and less than or equal to 8 microns from cells having a
hydrodynamic size greater than 8 microns. Each of these subsets of
cells may then be collected and analyzed, e.g., by detecting the
presence of a particular cell type, e.g., a rare cell, e.g., an
epithelial cell or progenitor endothelial cell, in one of the
samples thus collected. Because of the enrichment that this method
generally achieves, the concentration of rare cells may be higher
in a recovered sample than in the starting cellular sample,
allowing for rare cell detection by a variety of means. In one
embodiment, the cellular sample is applied to an inlet of the
device; a second reagent, e.g., a buffer, e.g., a buffer containing
BSA, a lysis reagent, a nucleic acid amplification reagent, an
osmolarity regulating reagent, a labeling reagent, a preservative,
or a fixing reagent, is optionally applied to a second inlet; and
two output samples flow out of two outlets of the device. For
example, application of a cellular sample containing cancer cells
to an inlet of the device could result in one output sample that is
enriched in such cells, while the other sample is depleted in these
cells or even completely devoid of them. Any of the second reagents
listed above may be employed in any of the devices and methods of
the invention, e.g., those in which the device contains a second
inlet.
[0229] In embodiments in which two cell types are directed in
different directions, the first cell type being the cell type of
interest, the second cell type may be any other cell type. For
example, the second cell type may include white blood cells or red
blood cells, e.g., enucleated red blood cells.
[0230] The methods of the invention need not employ either magnetic
particles or interaction with an antibody or fragment thereof in
order to enrich cells of interest, e.g., cancer cells, from a
cellular sample. Any method based on cell size, shape, or
deformability may be used in order to enrich cells of interest;
subsequently, cell detection or any other downstream applications,
e.g., those described herein, may be performed.
[0231] The methods of the invention allow for enrichment,
quantification, and molecular biology analysis of the same set of
cells. The gentle treatment of the cells in the devices of the
invention, coupled with the described methods of bulk measurement,
maintain the integrity of the cells so that further analysis may be
performed if desired. For example, techniques that destroy the
integrity of the cells may be performed subsequent to bulk
measurement; such techniques include DNA or RNA analysis, proteome
analysis, or metabolome analysis. For example, the total amount of
DNA or RNA in a sample may be determined; alternatively, the
presence of a particular sequence or mutation, e.g., a deletion, in
DNA or RNA may be detected, e.g., a mutation in a gene encoding a
polypeptide listed in Table 1. Furthermore, mitochondrial DNA,
telomerase, or nuclear matrix proteins in the sample may be
analyzed (for mitochondrial mutations in cancer, see, e.g.,
Parrella et al., Cancer Res. 61:7623-7626 (2001), Jones et al.,
Cancer Res. 61:1299-1304 (2001), and Fliss et al., Science
287:2017-2019 (2000); for telomerase, see, e.g., Soria et al.,
Clin. Cancer Res. 5:971-975 (1999)). For example, the sample may be
analyzed to determine whether any mitochondrial abnormalities (see,
e.g., Carew et al., Mol. Cancer 1:9 (2002), and Wallace, Science
283:1482-1488 (1999)) or perinuclear compartments are present. One
useful method for analyzing DNA is PCR, in which the cells are
lysed and levels of particular DNA sequences are amplified. Such
techniques are particularly useful when the number of target cells
isolated is very low. In-cell PCR may be employed; in addition,
gene expression analysis (see, e.g., Giordano et al., Am. J.
Pathol. 159:1231-1238 (2001), and Buckhaults et al., Cancer Res.
63:4144-4149 (2003)) or fluorescence in-situ hybridization may be
used, e.g., to determine the tissue or tissues of origin of the
cells being analyzed. A variety of cellular characteristics may be
measured using any of the above techniques, such as protein
phosphorylation, protein glycosylation, DNA methylation (see, e.g.,
Das et al., J. Clin. Oncol. 22:4632-4642 (2004)), microRNA levels
(see, e.g., He et al., Nature 435:828-833 (2005), Lu et al., Nature
435:834-838 (2005), O'Donnell et al., Nature 435:839-843 (2005),
and Calin et al., N. Engl. J. Med. 353:1793-1801 (2005)), cell
morphology or other structural characteristics, e.g.,
pleomorphisms, adhesion, migration, binding, division, level of
gene expression, and presence of a somatic mutation. This analysis
may be performed on any number of cells, including a single cell of
interest, e.g., a cancer cell. In addition, the size distribution
of cells may be analyzed.
[0232] Desirably, downstream analysis, e.g., detection, is
performed on more than one sample, preferably from the same
subject.
Quantification of Cells
[0233] Cells found in blood are of various types and span a range
of sizes. Using the methods of the invention, it is possible to
distinguish, size, and count blood cell populations, e.g., CTCs.
For example, a Coulter counter may be used. FIG. 33A shows a
typical size distribution for a normal blood sample. Under some
conditions, e.g., the presence of a tumor in the body that is
exfoliating tumor cells, cells that are not native to blood may
appear in the peripheral circulation. The ability to isolate and
count large cells, or other desired cells, that may appear in the
blood provides powerful opportunities for diagnosing disease
states.
[0234] Desirably, a Coulter counter, or other cell detector, is
fluidically coupled to an outlet of a device of the invention, and
a cellular sample is introduced to the device of the invention.
Cells flowing through the outlet fluidically coupled to the Coulter
counter then pass through the Coulter aperture, which includes two
electrodes separated by an opening through which the cells pass,
and which measures the volume displaced as each cell passes through
the opening. Preferably, the Coulter counter determines the number
of cells of cell volume greater than 500 fL in the enriched sample.
Alternatively, the Coulter counter preferably determines the number
of cells of diameter greater than 14 .mu.m in the enriched sample.
The Coulter counter, or other cell detector, may also be an
integral part of a device of the invention rather than constituting
a separate device. The counter may utilize any cellular
characteristic, e.g., impedance, light absorption, light
scattering, or capacitance.
[0235] In general, any means of generating a cell count is useful
in the methods of the invention. Such means include optical, such
as scattering, absorption, or fluorescence means. Alternatively,
non-aperture electrical means, such as determining capacitance, are
useful.
Combination with Other Enrichment Techniques
[0236] Enrichment and alteration methods employing devices of the
invention may be combined with other particulate sample
manipulation techniques. In particular, further enrichment or
purification of CTCs or other particles may be desirable. Further
enrichment may occur by any technique, including affinity
enrichment. Suitable affinity enrichment techniques include
contacting particles of interest with affinity agents bound to
channel walls or an array of obstacles. Such affinity agents may be
selective for any cell type, e.g., cancer cells. This includes
using a device of the invention in which antibodies specific for
target cells are immobilized within the device. This allows for
binding and enrichment of target cells within the device;
subsequently the target cells are eluted using a higher flow rate,
competing ligands, or another method.
Diagnosis
[0237] As described herein, epithelial cells exfoliated from solid
tumors have been found in the circulation of patients with cancers
of the breast, colon, liver, ovary, prostate, and lung. In general,
the presence of CTCs after therapy has been associated with tumor
progression and spread, poor response to therapy, relapse of
disease, and/or decreased survival over a period of several years.
Therefore, enumeration of CTCs offers a means to stratify patients
for baseline characteristics that predict initial risk and
subsequent risk based upon response to therapy.
[0238] The devices and methods of the invention may be used, e.g.,
to evaluate cancer patients and those at risk for cancer. In any of
the methods of diagnosis described herein, either the presence or
the absence of an indicator of cancer, e.g., a cancer cell, or of
any other disorder, may be used to generate a diagnosis. In one
example, a blood sample is drawn from the patient and introduced to
a device of the invention with a critical size chosen appropriately
to enrich epithelial cells, e.g., CTCs, from other blood cells.
Using a method of the invention, the number of epithelial cells in
the blood sample is determined. For example, the cells may be
labeled with an antibody that binds to EpCAM, and the antibody may
have a covalently bound fluorescent label. A bulk measurement may
then be made of the enriched sample produced by the device, and
from this measurement, the number of epithelial cells present in
the initial blood sample may be determined. Microscopic techniques
may be used to visually quantify the cells in order to correlate
the bulk measurement with the corresponding number of labeled cells
in the blood sample.
[0239] Besides epithelial tumor cells, there are other cell types
that are involved in metastatic tumor formation. Studies have
provided evidence for the involvement of hematopoietic bone marrow
progenitor cells and endothelial progenitor cells in metastasis
(see, e.g., Kaplan et al., Nature 438:820-827 (2005), and Brugger
et al., Blood 83:636-640 (1994)). The number of cells of a second
cell type, e.g., hematopoietic bone marrow progenitor cells, e.g.,
progenitor endothelial cells, may be determined, and the ratio of
epithelial tumor cells to the number of the second cell type may be
calculated. Such ratios are of diagnostic value in selecting the
appropriate therapy and in monitoring the efficacy of
treatment.
[0240] Cells involved in metastatic tumor formation may be detected
using any methods known in the art. For example, antibodies
specific for particular cell surface markers may be used. Useful
endothelial cell surface markers include CD105, CD106, CD144, and
CD146; useful tumor endothelial cell surface markers include TEM1,
TEM5, and TEM8 (see, e.g., Carson-Walter et al., Cancer Res.
61:6649-6655 (2001)); and useful mesenchymal cell surface markers
include CD133. Antibodies to these or other markers may be obtained
from, e.g., Chemicon, Abcam, and R&D Systems.
[0241] By making a series of measurements, optionally made at
regular intervals such as one day, two days, three days, one week,
two weeks, one month, two months, three months, six months, or one
year, one may track the level of epithelial cells present in a
patient's bloodstream as a function of time. In the case of
existing cancer patients, this provides a useful indication of the
progression of the disease and assists medical practitioners in
making appropriate therapeutic choices based on the increase,
decrease, or lack of change in epithelial cells, e.g., CTCs, in the
patient's bloodstream. For those at risk of cancer, a sudden
increase in the number of cells detected may provide an early
warning that the patient has developed a tumor. This early
diagnosis, coupled with subsequent therapeutic intervention, is
likely to result in an improved patient outcome in comparison to an
absence of diagnostic information.
[0242] Diagnostic methods include making bulk measurements of
labeled epithelial cells, e.g., CTCs, isolated from blood, as well
as techniques that destroy the integrity of the cells. For example,
PCR may be performed on a sample in which the number of target
cells isolated is very low; by using primers specific for
particular cancer markers, information may be gained about the type
of tumor from which the analyzed cells originated. Additionally,
RNA analysis, proteome analysis, or metabolome analysis may be
performed as a means of diagnosing the type or types of cancer
present in the patient.
[0243] One important diagnostic indicator for lung cancer and other
cancers is the presence or absence of certain mutations in EGFR
(see, e.g., International Publication WO 2005/094357). EGFR
consists of an extracellular ligand-binding domain, a transmembrane
portion, and an intracellular tyrosine kinase (TK) domain. The
normal physiologic role of EGFR is to bind ErbB ligands, including
epidermal growth factor (EGF), at the extracellular binding site to
trigger a cascade of downstream intracellular signals leading to
cell proliferation, survival, motility and other related
activities. Many non-small cell lung tumors with EGFR mutations
respond to small molecule EGFR inhibitors, such as gefitinib
(Iressa; AstraZeneca), but often eventually acquire secondary
mutations that make them drug resistant. Using the devices and
method of the invention, one may monitor patients taking such drugs
by taking frequent samples of blood and determining the number of
epithelial cells, e.g., CTCs, in each sample as a function of time.
This provides information as to the course of the disease. For
example, a decreasing number of circulating epithelial cells over
time suggests a decrease in the severity of the disease and the
size of the tumor or tumors. Immediately following quantification
of epithelial cells, these cells may be analyzed by PCR to
determine what mutations may be present in the EFGR gene expressed
in the epithelial cells. Certain mutations, such as those clustered
around the ATP-binding pocket of the EGFR TK domain, are known to
make the cancer cells susceptible to gefitinib inhibition. Thus,
the presence of these mutations supports a diagnosis of cancer that
is likely to respond to treatment using gefitinib. However, many
patients who respond to gefitinib eventually develop a second
mutation, often a methionine-to-threonine substitution at position
790 in exon 20 of the TK domain, which renders them resistant to
gefitinib. By using the devices and method of the invention, one
may test for this mutation as well, providing further diagnostic
information about the course of the disease and the likelihood that
it will respond to gefitinib or similar compounds. Since many EGFR
mutations, including all EGFR mutations in NSC lung cancer reported
to date that are known to confer sensitivity or resistance to
gefitinib, lie within the coding regions of exons 18 to 21, this
region of the EGFR gene may be emphasized in the development of
assays for the presence of mutations (see Examples 4-6).
[0244] The methods of the invention described above are not limited
to epithelial cells and cancer, but rather may be used to diagnose
any condition. Exemplary conditions that may be diagnosed using the
methods of the invention are hematological conditions, inflammatory
conditions, ischemic conditions, neoplastic conditions, infections,
traumas, endometriosis, and kidney failure (see, e.g., Takahashi et
al., Nature Med. 5:434-438 (1999), Healy et al., Hum. Reprod.
Update 4:736-740 (1998), and Gill et al., Circ. Res. 88:167-174
(2001)). Neoplastic conditions include acute lymphoblastic
leukemia, acute or chronic lymphocyctic or granulocytic tumor,
acute myeloid leukemia, acute promyelocytic leukemia,
adenocarcinoma, adenoma, adrenal cancer, basal cell carcinoma, bone
cancer, brain cancer, breast cancer, bronchi cancer, cervical
dysplasia, chronic myelogenous leukemia, colon cancer, epidermoid
carcinoma, Ewing's sarcoma, gallbladder cancer, gallstone tumor,
giant cell tumor, glioblastoma multiforma, hairy-cell tumor, head
cancer, hyperplasia, hyperplastic comeal nerve tumor, in situ
carcinoma, intestinal ganglioneuroma, islet cell tumor, Kaposi's
sarcoma, kidney cancer, larynx cancer, leiomyomater tumor, liver
cancer, lung cancer, lymphomas, malignant carcinoid, malignant
hypercalcemia, malignant melanomas, marfanoid habitus tumor,
medullary carcinoma, metastatic skin carcinoma, mucosal neuromas,
mycosis fungoide, myelodysplastic syndrome, myeloma, neck cancer,
neural tissue cancer, neuroblastoma, osteogenic sarcoma,
osteosarcoma, ovarian tumor, pancreas cancer, parathyroid cancer,
pheochromocytoma, polycythemia vera, primary brain tumor, prostate
cancer, rectum cancer, renal cell tumor, retinoblastoma,
rhabdomyosarcoma, seminoma, skin cancer, small-cell lung tumor,
soft tissue sarcoma, squamous cell carcinoma, stomach cancer,
thyroid cancer, topical skin lesion, veticulum cell sarcoma, and
Wilm's tumor. In one embodiment, neoplastic cells associated with
thyroid cancer are not detected. A cellular sample taken from a
patient, e.g., a sample of less than 50 mL, 40 mL, 30 mL, 20 mL, or
even 10 mL, may be processed through a device of the invention in
order to produce a sample enriched in any cell of interest, e.g., a
rare cell. Detection of this cell in the enriched sample may then
enable one skilled in the art to diagnose the presence or absence
of a particular condition in the patient. Furthermore,
determination of ratios of numbers of cells, e.g., cancer cells to
endothelial cells, in the sample may be used to generate a
diagnosis. Alternatively, detection of cancer biomarkers, e.g., any
of those listed in Table 1, or a nucleic acid associated with
cancer, e.g., a nucleic acid enoding any marker listed in Table 1,
may result in the diagnosis of a cancer or another condition. For
example, analysis of the expression level or pattern of such a
polypeptide or nucleic acid, e.g., cell surface markers, genomic
DNA, mRNA, or microRNA, may result in a diagnosis.
[0245] Cell detection may be combined with other information, e.g.,
imaging studies of the patient, in order to diagnose a patient. For
example, computed axial tomography, positron emission tomography,
or magnetic resonance imaging may be used.
[0246] A diagnosis may also be made using a cell pattern associated
with a particular condition. For example, by comparing the size
distribution of cells in an enriched sample, e.g., a sample
containing cells having a hydrodynamic size greater than 12
microns, with a size distribution associated with a condition,
e.g., cancer, a diagnosis may be made based on this comparison. A
cell pattern for comparison may be generated by any method. For
example, an association study may be performed in which cellular
samples from a plurality of control subjects (e.g., 50) and a
plurality of case subjects (e.g., 50) having a condition of
interest are processed, e.g., by enriching cells having a
hydrodynamic size greater than 12 microns, the results samples are
analyzed, and the results of the analysis are compared. To perform
such a study, it may be useful to analyze RNA levels, e.g., mRNA or
microRNA levels, in the enriched cells. Alternatively, it is useful
to count the number of cells enriched in each case, or to determine
a cellular size distribution, e.g., by using a microscope, a cell
counter, or a microarray device. The presence of particular cell
types, e.g., rare cells, may also be identified.
[0247] Once a drug treatment is administered to a patient, it is
possible to determine the efficacy of the drug treatment using the
methods of the invention. For example, a cellular sample taken from
the patient before the drug treatment, as well as one or more
cellular samples taken from the patient concurrently with or
subsequent to the drug treatment, may be processed using the
methods of the invention. By comparing the results of the analysis
of each processed sample, one may determine the efficacy of the
drug treatment. For example, an enrichment device may be used to
enrich cells having a hydrodynamic size greater than 12 microns, or
cells having a hydrodynamic size greater than or equal to 6 microns
and less than or equal to 12 microns, from other cells. Any other
detection or analysis described above may be performed, e.g.,
identification of the presence or quantity of specific cell
types.
Methods of Using Sample Mobilization Devices
[0248] A sample mobilization device of the invention may be used to
enrich CTCs or other cells from a sample. In one embodiment, a
cellular sample is placed in a sample mobilization device, e.g., a
device that includes a receptacle, a lid with a functionalized
surface, and a sample mobilizer. The receptacle containing the
sample is then covered with the lid, the sample mobilizer is
employed to mobilize the sample, and the lid is removed. Such a
device may be used to enrich a CTC or other cell of interest.
[0249] Any type of sample mobilization, e.g., centrifugation, may
be applied. Any centrifugal field that is known in the art may be
applied, e.g., a centrifugal field between 100 g and 100,000 g. For
example, the centrifugal field may be between 1,000 g and 10,000 g.
The application of this field results in a centrifugal force on the
sample. Additional forces may also be applied, e.g., a force
opposite to the centrifugal force; furthermore, forces may be
applied repeatedly and in alternation, with an optional time
interval between applications of each force.
[0250] General Considerations
[0251] Samples may be employed in the methods described herein with
or without purification, e.g., stabilization and removal of certain
components. Some sample may be diluted or concentrated prior to
introduction into the device.
[0252] In one embodiment, reagents are added to the sample, to
selectively or nonselectively increase the hydrodynamic size of the
particles within the sample. This modified sample is then pumped
through an obstacle array. Because the particles are swollen and
have an increased hydrodynamic size, it will be possible to use
obstacle arrays with larger and more easily manufactured gap sizes.
In a preferred embodiment, the steps of swelling and size-based
enrichment are performed in an integrated fashion on a device.
Suitable reagents include any hypotonic solution, e.g., deionized
water, 2% sugar solution, or neat non-aqueous solvents. Other
reagents include beads, e.g., magnetic or polymer, that bind
selectively (e.g., through antibodies or avidin-biotin) or
non-selectively.
[0253] In another embodiment, reagents are added to the sample to
selectively or nonselectively decrease the hydrodynamic size of the
particles within the sample. Nonuniform decrease in particles in a
sample will increase the difference in hydrodynamic size between
particles. For example, nucleated cells are separated from
enucleated cells by hypertonically shrinking the cells. The
enucleated cells may shrink to a very small particle, while the
nucleated cells cannot shrink below the size of the nucleus.
Exemplary shrinking reagents include hypertonic solutions.
[0254] In an alternative embodiment, affinity functionalized beads
and other appropriate beads are used to increase the volume of
particles of interest relative to the other particles present in a
sample, thereby allowing for the operation of a obstacle array with
a larger and more easily manufactured gap size.
[0255] Fluids may be driven through a device either actively or
passively. Fluids may be pumped using electric field, a centrifugal
field, pressure-driven fluid flow, an electro-osmotic flow, and
capillary action. In preferred embodiments, the average direction
of the field will be parallel to the walls of the channel that
contains the array.
Sample Preparation
[0256] Samples may be employed in the methods described herein with
or without manipulation, e.g., stabilization and removal of certain
components. In one embodiment, the sample is enriched in CTCs or
other cells of interest prior to introduction to a device of the
invention. Methods for enriching cell populations are known in the
art, e.g., affinity mechanisms, agglutination, and size, shape, and
deformability based enrichments. Exemplary methods for enriching a
sample in a cell of interest are found in U.S. Pat. Nos. 5,837,115
and 5,641,628, International Publications WO 2004/029221 and WO
2004/113877, and U.S. Application Publication 2004/0144651.
EXAMPLES
Example 1
[0257] Microfluidic devices of the invention were designed by
computer-aided design (CAD) and microfabricated by
photolithography. A two-step process was developed in which a blood
sample is first debulked to remove the large population of small
cells, and then the rare target epithelial cells target cells are
recovered by immunoaffinity capture. The devices were defined by
photolithography and etched into a silicon substrate based on the
CAD-generated design. The cell enrichment module, which is
approximately the size of a standard microscope slide, contains 14
parallel sample processing sections and associated sample handling
channels that connect to common sample and buffer inlets and
product and waste outlets. Each section contains an array of
microfabricated obstacles that is optimized to enrich the target
cell type by hydrodynamic size via displacement of the larger cells
into the product stream. In this example, the microchip was
designed to separate red blood cells (RBCs) and platelets from the
larger leukocytes and CTCs. Enriched populations of target cells
were recovered from whole blood passed through the device.
Performance of the cell enrichment microchip was evaluated by
separating RBCs and platelets from white blood cells (WBCs) in
normal whole blood (FIG. 52). In cancer patients, CTCs are found in
the larger WBC fraction. Blood was minimally diluted (30%), and a 6
ml sample was processed at a flow rate of up to 6 ml/hr. The
product and waste stream were evaluated in a Coulter Model "AC-T
diff"clinical blood analyzer, which automatically distinguishes,
sizes, and counts different blood cell populations. The enrichment
chip achieved separation of RBCs from WBCs, in which the WBC
fraction had >99% retention of nucleated cells, >99%
depletion of RBCs, and >97% depletion of platelets.
Representative histograms of these cell fractions are shown in FIG.
53. Routine cytology confirmed the high degree of enrichment of the
WBC and RBC fractions (FIG. 54).
[0258] Next, epithelial cells were recovered by affinity capture in
a microfluidic module that is functionalized with immobilized
antibody. A capture module with a single chamber containing a
regular array of antibody-coated microfabricated obstacles was
designed. These obstacles are disposed to maximize cell capture by
increasing the capture area approximately four-fold, and by slowing
the flow of cells under laminar flow adjacent to the obstacles to
increase the contact time between the cells and the immobilized
antibody. The capture modules may be operated under conditions of
relatively high flow rate but low shear to protect cells against
damage. The surface of the capture module was functionalized by
sequential treatment with 10% silane, 0.5% gluteraldehyde, and
avidin, followed by biotinylated anti-EpCAM. Active sites were
blocked with 3% bovine serum albumin in PBS, quenched with dilute
Tris HCl, and stabilized with dilute L-histidine. Modules were
washed in PBS after each stage and finally dried and stored at room
temperature. Capture performance was measured with the human
advanced lung cancer cell line NCI-H1650 (ATCC Number CRL-5883).
This cell line has a heterozygous 15 bp in-frame deletion in exon
19 of EGFR that renders it susceptible to gefitinib. Cells from
confluent cultures were harvested with trypsin, stained with the
vital dye Cell Tracker Orange (CMRA reagent, Molecular Probes,
Eugene, Oreg.), resuspended in fresh whole blood, and fractionated
in the microfluidic chip at various flow rates. In these initial
feasibility experiments, cell suspensions were processed directly
in the capture modules without prior fractionation in the cell
enrichment module to debulk the red blood cells; hence, the sample
stream contained normal blood red cells and leukocytes as well as
tumor cells. After the cells were processed in the capture module,
the device was washed with buffer at a higher flow rate (3 ml/hr)
to remove the nonspecifically bound cells. The adhesive top was
removed and the adherent cells were fixed on the chip with
paraformaldehyde and observed by fluorescence microscopy. Cell
recovery was calculated from hemacytometer counts; representative
capture results are shown in Table 2. Initial yields in
reconstitution studies with unfractionated blood were greater than
60% with less than 5% of non-specific binding.
TABLE-US-00002 TABLE 2 Run Avg. flow Length of No. cells No. cells
number rate run processed captured Yield 1 3.0 1 hr 150,000 38,012
25% 2 1.5 2 hr 150,000 30,000/ml 60% 3 1.08 2 hr 108,000 68,661 64%
4 1.21 2 hr 121,000 75,491 62%
[0259] Next, NCI-H1650 cells that were spiked into whole blood and
recovered by size fractionation and affinity capture as described
above were successfully analyzed in situ. In a trial run to
distinguish epithelial cells from leukocytes, 0.5 ml of a stock
solution of fluorescein-labeled CD45 pan-leukocyte monoclonal
antibody were passed into the capture module and incubated at room
temperature for 30 minutes. The module was washed with buffer to
remove unbound antibody, and the cells were fixed on the chip with
1% paraformaldehyde and observed by fluorescence microscopy. As
shown in FIG. 55, the epithelial cells were bound to the obstacles
and floor of the capture module. Background staining of the flow
passages with CD45 pan-leukocyte antibody is visible, as are
several stained leukocytes, apparently because of a low level of
non-specific capture.
Example 2
Device Embodiments
[0260] A design for preferred device embodiments of the invention
is shown in FIG. 57A, and parameters corresponding to three
preferred device embodiments associated with this design are shown
in FIG. 57B. These embodiments are particularly useful for enrich
epithelial cells from blood.
Example 3
Determining Counts for Non-Epithelial Cell Types
[0261] Using the methods of the invention, one may make a diagnosis
based on counting cell types other than CTCs or other epithelial
cells. A diagnosis of the absence, presence, or progression of
cancer may be based on the number of cells in a cellular sample
that are larger than a particular cutoff size. For example, cells
with a hydrodynamic size of 14 microns or larger may be selected.
This cutoff size would eliminate most leukocytes. The nature of
these cells may then be determined by downstream molecular or
cytological analysis.
[0262] Cell types other than epithelial cells that would be useful
to analyze include endothelial cells, endothelial progenitor cells,
endometrial cells, or trophoblasts indicative of a disease state.
Furthermore, determining separate counts for epithelial cells,
e.g., cancer cells, and other cell types, e.g., endothelial cells,
followed by a determination of the ratios between the number of
epithelial cells and the number of other cell types, may provide
useful diagnostic information.
[0263] A device of the invention may be configured to isolate
targeted subpopulations of cells such as those described above, as
shown in FIGS. 33A-D. A size cutoff may be selected such that most
native blood cells, including red blood cells, white blood cells,
and platelets, flow to waste, while non-native cells, which could
include endothelial cells, endothelial progenitor cells,
endometrial cells, or trophoblasts, are collected in an enriched
sample. This enriched sample may be further analyzed.
[0264] Using a device of the invention, therefore, it is possible
to isolate a subpopulation of cells from blood or other bodily
fluids based on size, which conveniently allows for the elimination
of a large proportion of native blood cells when large cell types
are targeted. As shown schematically in FIG. 56, a device of the
invention may include counting means to determine the number of
cells in the enriched sample, or the number of cells of a
particular type, e.g., cancer cells, within the enriched sample,
and further analysis of the cells in the enriched sample may
provide additional information that is useful for diagnostic or
other purposes.
Example 4
Method for Detection of EGFR Mutations
[0265] A blood sample from a cancer patient is processed and
analyzed using the devices and methods of the invention, e.g.,
those of Example 1, resulting in an enriched sample of epithelial
cells containing CTCs. This sample is then analyzed to identify
potential EGFR mutations. The method permits both identification of
known, clinically relevant EGFR mutations as well as discovery of
novel mutations. An overview of this process is shown in FIG.
58.
[0266] Below is an outline of the strategy for detection and
confirmation of EGFR mutations:
[0267] 1) Sequence CTC EGFR mRNA
[0268] Purify CTCs from blood sample;
[0269] Purify total RNA from CTCs;
[0270] Convert RNA to cDNA using reverse transcriptase;
[0271] Use resultant cDNA to perform first and second PCR reactions
for generating sequencing templates; and
[0272] Purify the nested PCR amplicon and use as a sequencing
template to sequence EGFR exons 18-21.
[0273] 2) Confirm RNA Sequence Using CTC Genomic DNA
[0274] Purify CTCs from blood sample;
[0275] Purify genomic DNA (gDNA) from CTCs;
[0276] Amplify exons 18, 19, 20, and/or 21 via PCR reactions;
and
[0277] Use the resulting PCR amplicon(s) in real-time quantitative
allele-specific PCR reactions in order to confirm the sequence of
mutations discovered via RNA sequencing.
[0278] Further details for each step outlined above are as
follows.
[0279] 1) Sequence CTC EGFR mRNA
[0280] a) Purify CTCs from Blood Sample.
[0281] CTCs are isolated using any of the size-based enrichment
and/or affinity purification devices of the invention.
[0282] b) Purify Total RNA from CTCs.
[0283] Total RNA is then purified from isolated CTC populations
using, e.g., the Qiagen Micro RNeasy kit, or a similar total RNA
purification protocol from another manufacturer; alternatively,
standard RNA purification protocols such as guanidium
isothiocyanate homogenization followed by phenol/chloroform
extraction and ethanol precipitation may be used. One such method
is described in "Molecular Cloning--A Laboratory Manual, Second
Edition" (1989) by J. Sambrook, E. F. Fritch and T. Maniatis, p.
7.24.
[0284] c) Convert RNA to cDNA Using Reverse Transcriptase.
[0285] cDNA reactions are carried out based on the protocols of the
supplier of reverse transcriptase. Typically, the amount of input
RNA into the cDNA reactions is in the range of 10 picograms (pg) to
2 micrograms (.mu.g) total RNA. First-strand DNA synthesis is
carried out by hybridizing random 7mer DNA primers, or oligo-dT
primers, or gene-specific primers, to RNA templates at 65.degree.
C. followed by snap-chilling on ice. cDNA synthesis is initiated by
the addition of iScript Reverse Transcriptase (BioRad) or
SuperScript Reverse Transcriptase (Invitrogen) or a reverse
transcriptase from another commercial vendor along with the
appropriate enzyme reaction buffer. For iScript, reverse
transcriptase reactions are carried out at 42.degree. C. for 30-45
minutes, followed by enzyme inactivation for 5 minutes at
85.degree. C. cDNA is stored at -20.degree. C. until use or used
immediately in PCR reactions. Typically, cDNA reactions are carried
out in a final volume of 20 .mu.l, and 10% (2 .mu.l) of the
resultant cDNA is used in subsequent PCR reactions.
[0286] d) Use Resultant cDNA to Perform First and Second PCR
Reactions for Generating Sequencing Templates.
[0287] cDNA from the reverse transcriptase reactions is mixed with
DNA primers specific for the region of interest (FIG. 59). See
Table 3 for sets of primers that may be used for amplification of
exons 18-21. In Table 3, primer set M13(+)/M12(-) is internal to
primer set M11(+)/M14(-). Thus primers M13(+) and M12(-) may be
used in the nested round of amplification, if primers Ml 1(+) and
M14(-) were used in the first round of expansion. Similarly, primer
set Ml 1(+)/M14(-) is internal to primer set M15(+)/M16(-), and
primer set M23(+)/M24(-) is internal to primer set M21(+)/M22(-).
Hot Start PCR reactions are performed using Qiagen Hot-Star Taq
Polymerase kit, or Applied Biosystems HotStart TaqMan polymerase,
or other Hot Start thermostable polymerase, or without a hot start
using Promega GoTaq Green Taq Polymerase master mix, TaqMan DNA
polymerase, or other thermostable DNA polymerase. Typically,
reaction volumes are 50 .mu.l, nucleotide triphosphates are present
at a final concentration of 200 .mu.M for each nucleotide, MgCl2 is
present at a final concentration of 1-4 mM, and oligo primers are
at a final concentration of 0.5 .mu.M. Hot start protocols begin
with a 10-15 minute incubation at 95.degree. C., followed by 40
cycles of 94.degree. C. for one minute (denaturation), 52.degree.
C. for one minute (annealing), and 72.degree. C. for one minute
(extension). A 10 minute terminal extension at 72.degree. C. is
performed before samples are stored at 4.degree. C. until they are
either used as template in the second (nested) round of PCRs, or
purified using QiaQuick Spin Columns (Qiagen) prior to sequencing.
If a hot-start protocol is not used, the initial incubation at
95.degree. C. is omitted. If a PCR product is to be used in a
second round of PCRs, 2 .mu.l (4%) of the initial PCR product is
used as template in the second round reactions, and the identical
reagent concentrations and cycling parameters are used.
TABLE-US-00003 TABLE 3 Primer Sets for expanding EGFR mRNA around
Exons 18-21 SEQ Amplicon cDNA Name ID NO Sequence (5' to 3')
Coordinates Size NXK-M11(+) 1 TTGCTGCTGGTGGTGGC (+) 1966-1982 813
NXK-M14(-) 2 CAGGGATTCCGTCATATGGC (-) 2778-2759 NXK-M13(+) 3
GATCGGCCTCTTCATGCG (+) 1989-2006 747 NXK M12(-) 4
GATCCAAAGGTCATCAACTCCC (-) 2735-2714 NXK-M15(+) 5
GCTGTCCAACGAATGGGC (+) 1904-1921 894 NXK-M16(-) 6
GGCGTTCTCCTTTCTCCAGG (-) 2797-2778 NXK-M21(+) 7 ATGCACTGGGCCAGGTCTT
(+) 1881-1899 944 NXK-M22(-) 8 CGATGGTACATATGGGTGGCT (-) 2824-2804
NXK-M23(+) 9 AGGCTGTCCAACGAATGGG (+) 1902-1920 904 NXK-M24(-) 10
CTGAGGGAGGCGTTCTCCT (-) 2805-2787
[0288] e) Purify the Nested PCR Amplicon and Use as a Sequencing
Template to Sequence EGFR Exons 18-21.
[0289] Sequencing is performed by ABI automated fluorescent
sequencing machines and fluorescence-labeled DNA sequencing ladders
generated via Sanger-style sequencing reactions using fluorescent
dideoxynucleotide mixtures. PCR products are purified using Qiagen
QuickSpin columns, the Agencourt AMPure PCR Purification System, or
PCR product purification kits obtained from other vendors. After
PCR products are purified, the nucleotide concentration and purity
is determined with a Nanodrop 7000 spectrophotometer, and the PCR
product concentration is brought to a concentration of 25 ng/.mu.l.
As a quality control measure, only PCR products that have a
UV-light absorbance ratio (A.sub.260/A.sub.280) greater than 1.8
are used for sequencing. Sequencing primers are brought to a
concentration of 3.2 pmol/.mu.l.
[0290] 2) Confirm RNA Sequence Using CTC Genomic DNA
[0291] a) Purify CTCs from Blood Sample.
[0292] As above, CTCs are isolated using any of the size-based
enrichment and/or affinity purification devices of the
invention.
[0293] b) Purify Genomic DNA (gDNA) from CTCs.
[0294] Genomic DNA is purified using the Qiagen DNeasy Mini kit,
the Invitrogen ChargeSwitch gDNA kit, or another commercial kit, or
via the following protocol:
[0295] 1. Cell pellets are either lysed fresh or stored at
-80.degree. C. and are thawed immediately before lysis.
[0296] 2. Add 500 .mu.l 50 mM Tris pH 7.9/100 mM EDTA/0.5% SDS (TES
buffer).
[0297] 3. Add 12.5 .mu.l Proteinase K (IBI5406, 20 mg/ml),
generating a final [ProtK]=0.5 mg/ml.
[0298] 4. Incubate at 55.degree. C. overnight in rotating
incubator.
[0299] 5. Add 20 .mu.l of RNase cocktail (500 U/ml RNase A+20,000
U/ml RNase T1, Ambion #2288) and incubate four hours at 37.degree.
C.
[0300] 6. Extract with Phenol (Kodak, Tris pH 8 equilibrated),
shake to mix, spin 5 min. in tabletop centrifuge.
[0301] 7. Transfer aqueous phase to fresh tube.
[0302] 8. Extract with Phenol/Chloroform/Isoamyl alcohol (EMD,
25:24:1 ratio, Tris pH 8 equilibrated), shake to mix, spin five
minutes in tabletop centrifuge.
[0303] 9. Add 50 .mu.l 3M NaOAc pH=6.
[0304] 10. Add 500 .mu.l EtOH.
[0305] 11. Shake to mix. Strings of precipitated DNA may be
visible. If anticipated DNA concentration is very low, add carrier
nucleotide (usually yeast tRNA).
[0306] 12. Spin one minute at max speed in tabletop centrifuge.
[0307] 13. Remove supernatant.
[0308] 14. Add 500 .mu.l 70% EtOH, Room Temperature (RT)
[0309] 15. Shake to mix.
[0310] 16. Spin one minute at max speed in tabletop centrifuge.
[0311] 17. Air dry 10-20 minutes before adding TE.
[0312] 18. Resuspend in 400 .mu.l TE. Incubate at 65.degree. C. for
10 minutes, then leave at RT overnight before quantitation on
Nanodrop.
[0313] c) Amplify Exons 18, 19, 20, and/or 21 Via PCR
Reactions.
[0314] Hot start nested PCR amplification is carried out as
described above in step 1d, except that there is no nested round of
amplification. The initial PCR step may be stopped during the log
phase in order to minimize possible loss of allele-specific
information during amplification. The primer sets used for
expansion of EGFR exons 18-21 are listed in Table 4 (see also Paez
et al., Science 304:1497-1500 (Supplementary Material) (2004)).
TABLE-US-00004 TABLE 4 Primer sets for expanding EGFR genomic DNA
SEQ ID Amplicon Name NO Sequence (5' to 3') Exon Size NXK-ex18.1(+)
11 TCAGAGCCTGTGTTTCTACCAA 18 534 NXK-ex18.2(-) 12
TGGTCTCACAGGACCACTGATT 18 NXK-ex18.3(+) 13 TCCAAATGAGCTGGCAAGTG 18
397 NXK-ex18.4(-) 14 TCCCAAACACTCAGTGAAACAAA 18 NXK-ex19.1(+) 15
AAATAATCAGTGTGATTCGTGGAG 19 495 NXK-ex19.2(-) 16
GAGGCCAGTGCTGTCTCTAAGG 19 NXK-ex19.3(+) 17 GTGCATCGCTGGTAACATCC 19
298 NXK-ex19.4(-) 18 TGTGGAGATGAGCAGGGTCT 19 NXK-ex20.1(+) 19
ACTTCACAGCCCTGCGTAAAC 20 555 NXK-ex20.2(-) 20 ATGGGACAGGCACTGATTTGT
20 NXK-ex20.3(+) 21 ATCGCATTCATGCGTCTTCA 20 379 NXK-ex20.4(-) 22
ATCCCCATGGCAAACTCTTG 20 NXK-ex21.1(+) 23 GCAGCGGGTTACATCTTCTTTC 21
526 NXK-ex21.2(-) 24 CAGCTCTGGCTCACACTACCAG 21 NXK-ex21.3(+) 25
GCAGCGGGTTACATCTTCTTTC 21 349 NXK-ex21.4(-) 26 CATCCTCCCCTGCATGTGT
21
[0315] d) Use the Resulting PCR Amplicon(s) in Real-Time
Quantitative Allele-Specific PCR Reactions in Order to Confirm the
Sequence of Mutations Discovered Via RNA Sequencing.
[0316] An aliquot of the PCR amplicons is used as template in a
multiplexed allele-specific quantitative PCR reaction using TaqMan
PCR 5' Nuclease assays with an Applied Biosystems model 7500 Real
Time PCR machine (FIG. 60). This round of PCR amplifies subregions
of the initial PCR product specific to each mutation of interest.
Given the very high sensitivity of Real Time PCR, it is possible to
obtain complete information on the mutation status of the EGFR gene
even if as few as 10 CTCs are isolated. Real Time PCR provides
quantification of allelic sequences over 8 logs of input DNA
concentrations; thus, even heterozygous mutations in impure
populations are easily detected using this method.
[0317] Probe and primer sets are designed for all known mutations
that affect gefitinib responsiveness in NSCLC patients, including
over 40 such somatic mutations, including point mutations,
deletions, and insertions, that have been reported in the medical
literature. For illustrative purposes, examples of primer and probe
sets for five of the point mutations are listed in Table 5. In
general, oligonucleotides may be designed using the primer
optimization software program Primer Express (Applied Biosystems),
with hybridization conditions optimized to distinguish the wild
type EGFR DNA sequence from mutant alleles. EGFR genomic DNA
amplified from lung cancer cell lines that are known to carry EGFR
mutations, such as H358 (wild type), H1650 (15-bp deletion,
.DELTA.2235-2249), and H1975 (two point mutations, 2369 C.fwdarw.T,
2573 T.fwdarw.G), is used to optimize the allele-specific Real Time
PCR reactions. Using the TaqMan 5' nuclease assay, allele-specific
labeled probes specific for wild type sequence or for known EGFR
mutations are developed. The oligonucleotides are designed to have
melting temperatures that easily distinguish a match from a
mismatch, and the Real Time PCR conditions are optimized to
distinguish wild type and mutant alleles. All Real Time PCR
reactions are carried out in triplicate.
[0318] Initially, labeled probes containing wild type sequence are
multiplexed in the same reaction with a single mutant probe.
Expressing the results as a ratio of one mutant allele sequence
versus wild type sequence may identify samples containing or
lacking a given mutation. After conditions are optimized for a
given probe set, it is then possible to multiplex probes for all of
the mutant alleles within a given exon within the same Real Time
PCR assay, increasing the ease of use of this analytical tool in
clinical settings.
[0319] A unique probe is designed for each wild type allele and
mutant allele sequence. Wild-type sequences are marked with the
fluorescent dye VIC at the 5' end, and mutant sequences with the
fluorophore FAM. A fluorescence quencher and Minor Groove Binding
moiety are attached to the 3' ends of the probes. ROX is used as a
passive reference dye for normalization purposes. A standard curve
is generated for wild type sequences and is used for relative
quantitation. Precise quantitation of mutant signal is not
required, as the input cell population is of unknown, and varying,
purity. The assay is set up as described by ABI product literature,
and the presence of a mutation is confirmed when the signal from a
mutant allele probe rises above the background level of
fluorescence (FIG. 61), and this threshold cycle gives the relative
frequency of the mutant allele in the input sample.
TABLE-US-00005 TABLE 5 Probes and Primers for Allele-Specific qPCR
SEQ Sequence (5' to 3', mutated cDNA Name ID NO position in bold)
Coordinates Description Mutation NXK-M01 27 CCGCAGCATGTCAAGATCAC
(+) 2542- (+) primer L858R 2561 NXK-M02 28
TCCTTCTGCATGGTATTCTTTCTCT (-) 2619- (-) primer 2595 Pwt-L858R 29
VIC-TTTGGGCTGGCCAA-MGB (+) 2566- WT allele 2579 probe Pmut-L858R 30
FAM-TTTTGGGCGGGCCA-MGB (+) 2566- Mutant 2579 allele probe NXK-M03
31 ATGGCCAGCGTGGACAA (+) 2296- (+) primer T790M 2312 NXK-M04 32
AGCAGGTACTGGGAGCCAATATT (-) 2444- (-) primer 2422 Pwt-T790M 33
VIC-ATGAGCTGCGTGATGA-MGB (-) 2378- WT allele 2363 probe Pmut- 34
FAM-ATGAGCTGCATGATGA-MGB (-) 2378- Mutant T790M 2363 allele probe
NXK-M05 35 GCCTCTTACACCCAGTGGAGAA (+) 2070- (+) primer G719S,C 2091
NXK-M06 36 TTCTGGGATCCAGAGTCCCTTA (-) 2202- (-) primer 2181 Pwt- 37
VIC-ACCGGAGCCCAGCA-MGB (-) 2163- WT allele G719SC 2150 probe
Pmut-G719S 38 FAM-ACCGGAGCTCAGCA-MGB (-) 2163- Mutant 2150 allele
probe Pmut- 39 FAM-ACCGGAGCACAGCA-MGB (-) 2163- Mutant G719C 2150
allele probe NXK-M09 40 TCGCAAAGGGCATGAACTACT (+) 2462- (+) primer
H835L 2482 NXK-M10 41 ATCTTGACATGCTGCGGTGTT (-) 2558- (-) primer
2538 Pwt-H835L 42 VIC-TTGGTGCACCGCGA-MGB (+) 2498- WT allele 2511
probe Pmut- 43 FAM-TGGTGCTCCGCGAC-MGB (+) 2498- Mutant H835L 2511
allele probe
Example 5
Absence of EGFR expression in leukocytes
[0320] The protocol of Example 4 would be most useful if EGFR were
expressed in target cancer cells but not in background leukocytes.
To test whether EGFR mRNA is present in leukocytes, several PCR
experiments were performed. Four sets of primers, shown in Table 6,
were designed to amplify four corresponding genes:
[0321] 1) BCKDK (branched-chain a-ketoacid dehydrogenase complex
kinase)--a "housekeeping" gene expressed in all types of cells, a
positive control for both leukocytes and tumor cells;
[0322] 2) CD45--specifically expressed in leukocytes, a positive
control for leukocytes and a negative control for tumor cells;
[0323] 3) EpCaM--specifically expressed in epithelial cells, a
negative control for leukocytes and a positive control for tumor
cells; and
[0324] 4) EGFR--the target mRNA to be examined.
TABLE-US-00006 TABLE 6 SEQ ID Amplicon Name NO Sequence (5' to 3')
Description Size BCKD_1 44 AGTCAGGACCCATGCACGG BCKDK (+) primer 273
BCKD-2 45 ACCCAAGATGCAGCAGTGTG BCKDK (-) primer CD_1 46
GATGTCCTCCTTGTTCTACTC CD45 (+) primer 263 CD_2 47
TACAGGGAATAATCGAGCATGC CD45 (-) primer EpCAM_1 48
GAAGGGAAATAGCAAATGGACA EpCAM (+) primer 222 EpCAM_2 49
CGATGGAGTCCAAGTTCTGG EpCAM (-) primer EGFR_1 50
AGCACTTACAGCTCTGGCCA EGFR (+) primer 371 EGFR_2 51
GACTGAACATAACTGTAGGCTG EGFR (-) primer
[0325] Total RNAs of approximately 9.times.10.sup.6 leukocytes
isolated using a cell enrichment device of the invention (cutoff
size 4 .mu.m) and 5.times.10.sup.6 H1650 cells were isolated by
using RNeasy mini kit (Qiagen). Two micrograms of total RNAs from
leukocytes and H1650 cells were reverse transcribed to obtain first
strand cDNAs using 100 pmol random hexamer (Roche) and 200 U
Superscript II (Invitrogen) in a 20 .mu.l reaction. The subsequent
PCR was carried out using 0.5 .mu.l of the first strand cDNA
reaction and 10 pmol of forward and reverse primers in total 25
.mu.l of mixture. The PCR was run for 40 cycles of 95.degree. C.
for 20 seconds, 56.degree. C. for 20 seconds, and 70.degree. C. for
30 seconds. The amplified products were separated on a 1% agarose
gel. As shown in FIG. 62A, BCKDK was found to be expressed in both
leukocytes and H1650 cells; CD45 was expressed only in leukocytes;
and both EpCAM and EGFR were expressed only in H1650 cells. These
results, which are fully consistent with the profile of EGFR
expression shown in FIG. 62B, confirmed that EGFR is a particularly
useful target for assaying mixtures of cells that include both
leukocytes and cancer cells, because only the cancer cells will be
expected to produce a signal.
Example 6
EGFR Assay with Low Quantities of Target RNA or High Quantities of
Background RNA
[0326] In order to determine the sensitivity of the assay described
in Example 4, various quantities of input NSCLC cell line total RNA
were tested, ranging from 100 pg to 50 ng. The results of the first
and second EGFR PCR reactions (step 1d, Example 4) are shown in
FIG. 63. The first PCR reaction was shown to be sufficiently
sensitive to detect 1 ng of input RNA, while the second round
increased the sensitivity to 100 pg or less of input RNA. This
corresponds to 7-10 cells, demonstrating that even extremely dilute
samples may generate detectable signals using this assay.
[0327] Next, samples containing 1 ng of NCI-H1975 RNA were mixed
with varying quantities of peripheral blood mononuclear cell (PBMC)
RNA ranging from 1 ng to 1 .mu.g and used in PCR reactions as
before. As shown in FIG. 64A, the first set of PCR reactions
demonstrated that, while amplification occurred in all cases,
spurious bands appeared at the highest contamination level.
However, as shown in FIG. 64B, after the second, nested set of PCR
reactions, the desired specific amplicon was produced without
spurious bands even at the highest contamination level. Therefore,
this example demonstrates that the EGFR PCR assays described herein
are effective even when the target RNA occupies a tiny fraction of
the total RNA in the sample being tested.
[0328] Table 7 lists the RNA yield in a variety of cells and shows
that the yield per cell is widely variable, depending on the cell
type. This information is useful in order to estimate the amount of
target and background RNA in a sample based on cell counts. For
example, 1 ng of NCL-H1975 RNA corresponds to approximately 100
cells, while 1 .mu.g of PBMC RNA corresponds to approximately 106
cells. Thus, the highest contamination level in the above-described
experiment, 1,000:1 of PBMC RNA to NCL-H1975 RNA, actually
corresponds to a 10,000:1 ratio of PBMCs to NCL-H1975 cells. Thus,
these data indicate that EGFR may be sequenced from as few as 100
CTCs contaminated by as many as 106 leukocytes.
TABLE-US-00007 TABLE 7 RNA Yield versus Cell Type Cells Count RNA
Yield [RNA]/Cell NCI-H1975 2 .times. 10.sup.6 26.9 .mu.g 13.5 pg
NCI-H1650 2 .times. 10.sup.6 26.1 .mu.g 13.0 pg H358 2 .times.
10.sup.6 26.0 .mu.g 13.0 pg HT29 2 .times. 10.sup.6 21.4 .mu.g 10.7
pg MCF7 2 .times. 10.sup.6 25.4 .mu.g 12.7 pg PBMC #1 19 .times.
10.sup.6 10.2 .mu.g 0.5 pg PBMC #2 16.5 .times. 10.sup.6 18.4 .mu.g
1.1 pg
[0329] Next, whole blood spiked with 1,000 cells/ml of Cell Tracker
(Invitrogen)-labeled H1650 cells was run through the capture module
chip of FIG. 57C. To avoid inefficiency in RNA extraction from
fixed samples, the captured H1650 cells were immediately counted
after running and subsequently lysed for RNA extraction without
formaldehyde fixation. Approximately 800 captured H1650 cells and
>10,000 contaminated leukocytes were lysed on the chip with 0.5
ml of 4M guanidine thiocyanate solution. The lysate was extracted
with 0.5 ml of phenol/chloroform and precipitated with 1 ml of
ethanol in the presence of 10 .mu.g of yeast tRNA as carrier. The
precipitated RNAs were DNase I-treated for 30 minutes and then
extracted with phenol/chloroform and precipitated with ethanol
prior to first strand cDNA synthesis and subsequent PCR
amplification. These steps were repeated with a second blood sample
and a second chip. The cDNA synthesized from chip1 and chip2 RNAs
along with H1650 and leukocyte cDNAs were PCR amplified using two
sets of primers, CD45.sub.--1 and CD45.sub.--2 (Table 6) as well as
EGFR.sub.--5 (forward primer, 5'-GTTCGGCACGGTGTATAAGG-3') (SEQ ID
NO: 52) and EGFR.sub.--6 (reverse primer,
5'-CTGGCCATCACGTAGGCTTC-3') (SEQ ID NO: 53). EGFR.sub.--5 and
EGFR.sub.--6 produce a 138 bp wild type amplified fragment and a
123 bp mutant amplified fragment in H1650 cells. The PCR products
were separated on a 2.5% agarose gel. As shown in FIG. 65, EGFR
wild type and mutant amplified fragments were readily detected,
despite the high leukocyte background, demonstrating that the EGFR
assay is robust and does not require a highly purified sample.
Example 7
Protocol for Processing a Blood Sample Through an Enrichment Module
Coupled to a Capture Module
[0330] Using a sample of healthy blood spiked with tumor cells, a
device of the invention containing an enrichment module coupled to
a capture module was tested for the ability to enrich and capture
tumor cells from blood.
[0331] To prepare the blood sample, a human non-small-cell lung
cancer line, NCI-H1650 from ATCC) was stained with cell tracker
orange (CMRA from Molecular Probes) and then spiked into fresh
blood from a healthy patient (Research Blood Component). The spike
level was 1,000 cells/ml. The spiked blood was diluted to a ratio
of 2:1 (blood to buffer, 1% BSA in PBS). Both leukocytes and tumor
cells were labeled with nuclear staining dye, Hoechst 33342;
labeling the tumor cells with an additional stain, cell tracker
orange, helped to distinguish tumor cells from leukocytes.
[0332] Next, the enrichment module manifold, chip, and tubing were
set up, and the enrichment module chip was primed with degassed
buffer. The spiked blood sample was run through the enrichment
module at a pressure of 2.4 psi, and the flow rate of product was
6.91 ml/hr.
[0333] Prior to running the product through the capture module, the
product was characterized. Taking into account the dilution factor
in the product, the number of leukocytes per ml of equivalent whole
blood was 7.02.times.10.sup.5. The removal efficiency of leukocytes
was 90%. The yield of tumor cells was 89.5%, and the purity of the
tumor cells was 0.14%.
[0334] The product from the enrichment module was then run through
the capture module, which contained anti-EpCAM-coated obstacles.
The tumor cells expressing epithelial cell adhesion molecule were
captured on the obstacles. The flow rate was 2.12 ml/hr, and the
running time was one hour. The device was then washed with buffer
at a higher flow rate, 3 ml/hr, to remove the nonspecifically-bound
cells. The yield was 74%. The purity was not determined.
[0335] The results of these experiments are summarized in Table
8.
TABLE-US-00008 TABLE 8 Yield of Number of Tumor Yield of Number of
Tumor enrichment leukocytes/ml cell capture leukocytes/ml cell
module of whole purity module of whole purity Combined (%) blood
(%) (%) blood (%) yield (%) Enrichment 89 7.02.quadrature.105 0.14
74 (2.12 ml/hr) Not measured N/A 66 module (V1) - capture
module
Example 8
Cell Capture Using Staggered Arrays
[0336] In one embodiment of the invention, CTCs or other cells
larger than a chosen cutoff size may be captured using a device
that includes obstacles arranged in an array of subarrays. The
subarrays are arrayed over the field with a slight stagger, or
uneven spacing, initially designed in order to introduce variation
in the flow lines and encourage the interaction of cells with the
obstacles. One effect of this arrangement is that each subarray
gives rise to a region in which the flow path is narrowed, as shown
in FIG. 66A. In the array shown in the figure, the regular gap
between obstacles is 46 .mu.m, while the narrowed gap is 17 .mu.m.
The array and subarrays may be varied in order to result in any
desirable gap sizes, as well as any desired density of narrowed
gaps in relation to regular gaps.
[0337] Such a staggered array is particularly useful for
preferential capture of CTCs in a blood sample, since CTCs tend to
be larger than most other blood cells. CTCs or other large cells
may be captured within the array without the need for a
functionalized surface containing antibodies or other binding
moieties, since cell capture is based on array geometry.
Fabrication of such a device is therefore simplified.
[0338] A staggered array of the invention is shown in FIG. 66B.
Narrowed flow paths are dispersed regularly throughout the device,
and these paths may be sized to capture cells of a given
hydrodynamic size or larger, while allowing cells smaller than this
cutoff size to flow through the array without being retained. If a
large cell is lodged in a narrow flow path, thereby blocking it,
smaller cells are still able to flow around via the unblocked
larger flow paths, as shown in FIG. 66C. This design avoids the
problem of clogging that may occur in a uniform array.
[0339] Desirably, the device is configured such that CTCs or other
cells of interest are statistically likely to encounter and be
trapped in the areas of narrowed gaps. Devices may be optimized for
particular applications by varying the density of the restricted
flow paths to alter the probability of capture of target cells.
[0340] In one configuration, a larger percentage of flow paths near
the device outlet may be designed to be narrow (FIG. 66D), thereby
allowing for capture of any large cells that were not captured
elsewhere in the array. Unless all available narrow gaps are
occupied by target cells, clogging is still avoided in this
configuration.
[0341] Some devices of the invention have a relatively large depth
dimension in order to accommodate high throughput of sample,
whereas in other embodiments, the depth dimension is much smaller,
with the result that captured cells are largely found in one focal
plane and are easier to view under a microscope. In the device
shown in FIG. 66E, the depth dimension is structured to create
narrowed flow paths, resulting in capture of cells in a single
focal plane (FIG. 66F). The captured cells are directly below the
transparent window for simplified viewing. Fabrication of such
devices may be achieved readily by a variety of means, e.g.,
injection molding or hot embossing of polymer substrates.
[0342] Once captured, cells may be released, e.g., by treatment
with a hypotonic solution that causes the cells to shrink and be
released from the device. Upon release and collection, cells may be
returned to their original osmolarity and subjected to further
analysis, e.g, molecular analysis. Alternatively, analysis may be
conducted within the device without releasing the cells.
Example 9
Cell Capture of H1650 Cells Using Staggered Arrays
[0343] A capture module chip (FIG. 57C) was used to process a
sample of H1650 lung cancer cells. Parameters of the capture module
are as follows: the chip dimensions are 66.0.times.24.9 mm; the
obstacle field dimensions are 51.3.times.18.9 mm; the obstacle
diameter is 104 .mu.m; the port dimensions are 2.83.times.2.83 mm
on the front side and 1.66.times.1.66 mm on the back side; the
substrate is silicon; and the etch depth is 100 .mu.m. The H1650
lung cancer cells were spiked at 10,000 cells/ml into buffy coat
and run at 1.6 ml/hour (FIG. 66G). An estimated 12,700 H1650 cells
passed through the device. The device contained approximately 7,230
capture locations in the active area. The yield of H1650 cells
following the experiment was 16%, indicating that a substantial
portion of available capture locations was occupied by H1650
cells.
Example 10
Size Distribution of Cancer Cells
[0344] In order to determine the size distribution of cancer cells,
several cancer cell lines were passed through a Beckman Coulter
Model Z2 counting device (FIG. 67A). Cell lines that were tested in
this experiment included H358, H1650, H1975, HT29, and MCF7 cells,
which include colon, lung, and breast cancer cells. As FIG. 67A
shows, each of these cell lines consists of cells that are larger
than most white blood cells. The size distributions of each cancer
cell line are similar to each other and are well-separated from the
distribution of white blood cells shown. A closeup of the size
distribution of the cancer cells (FIG. 67B) reveals a generally
Gaussian distribution of cells in each case, with only a small
minority of cells below 8, 10, or even 12 .mu.m in size (FIG. 67C).
These data offer strong support for the principle of enrichment of
CTCs from other blood cells based on size.
Example 11
Capture Device Using a Microscope Slide
[0345] The invention encompasses a variety of cell capture devices
and methods. In one embodiment, a capture device of the invention
utilizes a functionalized surface, e.g., a glass microscope slide,
as shown in FIG. 68A. The slide may be functionalized with an
antibody or other capture moiety specific for the cell type of
interest, e.g., CTCs, using standard chemistries. The device
includes a sample fluid chamber, which may have, for example, a
capacity of 10 ml or greater, with the functionalized slide on the
bottom of the chamber. Any fluid, e.g., blood or a blood fraction,
may be placed within the chamber for processing.
[0346] Cells within the fluid sample sediment to the bottom of the
chamber via gravity, or optionally centrifugation (see Example 12),
or application of other forces, and are bound by the functionalized
surface. In order to keep the remaining cells tumbling, the chamber
may be rocked (FIG. 68B) or rotated (FIG. 68C). Subsequently, the
chamber may be washed and removed, and the slide is then available
for staining, visualization, and/or other subsequent analysis.
[0347] Several advantages of such a device and method are evident.
For example, the flat capture surface allows for easy visualization
of captured cells. Furthermore, the uniform cell capture on the
flat surface simplifies cell quantification. In addition, the
residence time for cells contacting the surface is long in
comparison to other methods, improving capture efficiency and
allowing for the total duration of the experiment to be shortened.
This duration may also be shortened in view of the fact that there
is no limiting flow rate. Because the cells are not flowing through
a device, they are also not subjected to flow-induced shear.
[0348] Other advantages include the fact that, in the configuration
described here, surface area is generally not a limiting factor in
the capture of rare cells. Furthermore, it is particularly
straightforward to analyze captured cells using a light microscope
or other visualization techniques, allowing for the analysis of
morphology, organelle characteristics, or other cellular
characteristics.
[0349] The capture device may be coupled to other devices for
processing cellular samples or other fluid samples, and it is
compatible with microcapture technologies.
[0350] In one variation, shown in FIG. 68D, two additional fluid
chambers are present in the device. The fluid chambers, which may
be filled with air, are alternately filled and emptied in order to
cause fluid motion inside the main chamber of the device. The air
chambers have a flexible wall separating them, and may be filled
and emptied using any mechanism. The device mobilizes the cellular
sample or other fluid sample, keeping sedimented cells tumbling and
preventing the blockage of capture sites on the functionalized
surface.
[0351] The capture surface of any of the above devices may be
microstructured, e.g., with low relief, including micro-posts,
micro-fins, and/or micro-corrugation. The functionalized surface
may be, e.g., a microfabricated silicon chip surface or a plastic
surface. This approach provides, for example, multiple, spatially
patterned capture functionalities on the surface for differential
capture, quantification, and/or targeting of multiple cell
populations (FIG. 68E).
Example 12
Centrifugal Capture Device Using a Microscope Slide
[0352] Prior to using a capture device of the invention, it is
advantageous to perform microfluidics-based cell enrichment with a
cell enrichment device of the invention. For example, by applying a
first enrichment step to a blood sample, most erythrocytes,
leukocytes, and platelets are removed. In one set of experiments,
when blood samples were processed using cell enrichment devices of
the invention having a cutoff of 8 .mu.m, 10 .mu.m, and 12 .mu.m,
erythrocytes and platelets were removed completely in each case,
and the leukocyte concentration was reduced to 1.25.quadrature.105
cells/ml, 2,900 cells/ml, and 111 cells/ml, respectively. Thus, a
large portion of the contaminating cells in a blood sample or other
cellular sample may be removed prior to a capture step, helping to
avoid nonspecific sedimentation on a functionalized surface.
However, the resulting enriched sample may be highly diluted,
thereby increasing the processing time necessary to capture cells
of interest, e.g., CTCs.
[0353] To decrease the time required to process a sample, the
device described in Example 11 may be used in combination with a
centrifuge (FIG. 69A). In this method, cells of interest, e.g.,
CTCs, are flattened against the functionalized slide (FIG. 69B)
when the sample is exposed to a high centrifugal field of
N.times.g, where, for example, N is a large number, e.g., 1,000 or
greater. This centrifugal method substantially increases the
contact location and area between CTCs and binding moieties, e.g.,
antibodies.
[0354] Cell sedimentation velocity may be estimated by the
equation:
u = ad cell 2 ( .rho. cell - .rho. plasma ) 18 .mu. plasma
##EQU00001##
where u represents velocity, d represents cell diameter, d
represents density, .rho. represents viscosity, and a represents
acceleration, i.e., gravitational or centrifugal field. The
parameter a may be expressed as N.times.g, where N equals 1 in the
case of gravity, and N generally equals a large number, e.g., 1,000
or greater, in the case of centrifugation. When N equals 1, i.e.,
in the presence of gravity alone, it takes approximately one hour
for a 14 .mu.m diameter cell to settle in a 2 cm high liquid level
chamber; however, with a centrifugal field of N.times.g,
sedimentation time is reduced by a factor of N, thereby
significantly reducing the time required to perform the
experiment.
[0355] Following capture of CTCs, leukocytes or other contaminating
cells that are bound nonspecifically to the functionalized surface
may be removed by inverting the chamber and subjecting it once
again to a high centrifugal force (FIG. 69C). This step greatly
reduces the number of contaminating cells that remain attached to
the functionalized surface. In one embodiment, antibodies specific
for contaminating cells such as leukocytes may be coupled to a
functionalized surface opposite the surface that is used to capture
the cells of interest (FIG. 69D), thereby capturing the
contaminating cells and further minimizing contamination of the
captured cells of interest. In another variation, the
functionalized surface used to capture cells of interest may be
inclined at an angle, resulting in a centrifugal force component
that drives cell rolling along the planar surface, in addition to
the perpendicular component of the centrifugal force (FIG. 69E).
The component of the centrifugal force that drives cell rolling
helps to spread clusters of cells and increases the efficiency of
cell capture.
[0356] The applied centrifugal field may be optimized in a number
of ways (FIG. 69F). For example, each period of centrifugation may
be modified, including the "spin up" phase (period between starting
centrifugation and attaining the desired rotational speed), "spin
time" (period of centrifugation at desired rotational speed), "spin
down" (period between beginning to slow centrifugation and coming
to a stop), and "rest time" (period between spins). In each case,
the duration, rotational speed, and/or rotational acceleration may
be optimized to suit the application. This includes spinning the
chamber in both the forward and reverse directions, as described
above.
[0357] To improve capture efficiency, the functionalized surface
may be micro-structured (FIG. 69G), as in Example 11.
Example 13
Capture Device
[0358] In the enrichment devices of the invention that include
obstacles (FIG. 70A, and described above), large cells generally
have numerous interactions with the obstacles, while small cells
are able to flow through the device with minimal contact with the
obstacles. A capture device that includes antibodies or other
binding moieties attached to the surfaces of arrayed obstacles may
be designed using similar principles, and combines both size and
affinity selectivity.
[0359] In a regular array of obstacles, the critical diameter
depends on a number of parameters, including the gap size and the
distance between obstacles (obstacle offset), as shown in FIG. 70B.
As described above, cells that are larger than the critical
diameter are deflected, while cells that are smaller than this
parameter move in the average flow direction. Thus, based on the
size of the cell type of interest, e.g., a particular type of CTC,
the critical diameter may be optimized. This may be achieved, for
example, by selecting an appropriate gap size and offset. The
optimized device may provide efficient capture with very low
contamination.
[0360] In one instance, the obstacle density may be varied
throughout the device. For example, obstacles may be arrayed at a
lower density near the sample inlet of the device, or order to
prevent clogging, while the density may be increased near the
device outlet, in order to maximize capture.
[0361] It is possible to vary the arrangement of obstacles while
keeping the critical size constant. Thus, devices of the invention
may include variable obstacle arrays in which the direction of
deflection, the gap size, and/or the distance between obstacles is
varied throughout the device, in order to increase flow rate,
decrease clogging, or achieve other design goals (FIG. 70C).
[0362] In some devices, both target cells, e.g., CTCs, and
contaminating cells, e.g., leukocytes, bind to the floor of the
device. For example, this may occur in devices that include a
functionalized silicon substrate containing obstacles, as all
exposed surfaces of the silicon substrate are typically
functionalized with antibody or other binding moiety. Thus, capture
devices may be operated in an inverted orientation, such that any
cells that sediment come into contact with a non-functionalized
surface and do not bind. This may result in reduced clogging and
may generally improve device performance.
[0363] The capture device described in this example, or other
capture devices of the invention, may also include
nonfunctionalized areas that may be used for enrichment or other
purposes.
Other Embodiments
[0364] All publications, patents, and patent applications mentioned
in the above specification are hereby incorporated by reference.
Various modifications and variations of the described method and
system of the invention will be apparent to those skilled in the
art without departing from the scope and spirit of the invention.
Although the invention has been described in connection with
specific embodiments, it should be understood that the invention as
claimed should not be unduly limited to such specific embodiments.
Indeed, various modifications of the described modes for carrying
out the invention that are obvious to those skilled in the art are
intended to be within the scope of the invention.
[0365] Other embodiments are in the claims.
Sequence CWU 1
1
53117DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1ttgctgctgg tggtggc 17220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 2cagggattcc gtcatatggc 20318DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 3gatcggcctc ttcatgcg 18422DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 4gatccaaagg tcatcaactc cc 22518DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 5gctgtccaac gaatgggc 18620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 6ggcgttctcc tttctccagg 20719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 7atgcactggg ccaggtctt 19821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 8cgatggtaca tatgggtggc t 21919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 9aggctgtcca acgaatggg 191019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 10ctgagggagg cgttctcct 191122DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 11tcagagcctg tgtttctacc aa 221222DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 12tggtctcaca ggaccactga tt 221320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 13tccaaatgag ctggcaagtg 201423DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 14tcccaaacac tcagtgaaac aaa 231524DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 15aaataatcag tgtgattcgt ggag 241622DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 16gaggccagtg ctgtctctaa gg 221720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 17gtgcatcgct ggtaacatcc 201820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 18tgtggagatg agcagggtct 201921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 19acttcacagc cctgcgtaaa c 212021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 20atgggacagg cactgatttg t 212120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 21atcgcattca tgcgtcttca 202220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 22atccccatgg caaactcttg 202322DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 23gcagcgggtt acatcttctt tc 222422DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 24cagctctggc tcacactacc ag 222522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 25gcagcgggtt acatcttctt tc 222619DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 26catcctcccc tgcatgtgt 192720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 27ccgcagcatg tcaagatcac 202825DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 28tccttctgca tggtattctt tctct 252914DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 29tttgggctgg ccaa 143014DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 30ttttgggcgg gcca 143117DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 31atggccagcg tggacaa 173223DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 32agcaggtact gggagccaat att 233316DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 33atgagctgcg tgatga 163416DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 34atgagctgca tgatga 163522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 35gcctcttaca cccagtggag aa 223622DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 36ttctgggatc cagagtccct ta 223714DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 37accggagccc agca 143814DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 38accggagctc agca 143914DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 39accggagcac agca 144021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 40tcgcaaaggg catgaactac t 214121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 41atcttgacat gctgcggtgt t 214214DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 42ttggtgcacc gcga 144314DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 43tggtgctccg cgac 144419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 44agtcaggacc catgcacgg 194520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 45acccaagatg cagcagtgtg 204621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 46gatgtcctcc ttgttctact c 214722DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 47tacagggaat aatcgagcat gc 224822DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 48gaagggaaat agcaaatgga ca 224920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 49cgatggagtc caagttctgg 205020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 50agcacttaca gctctggcca 205122DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 51gactgaacat aactgtaggc tg 225220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 52gttcggcacg gtgtataagg 205320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 53ctggccatca cgtaggcttc 20
* * * * *