U.S. patent application number 14/621669 was filed with the patent office on 2015-11-05 for hepatitis c dsrna effector molecules, expression constructs, compositions, and methods of use.
The applicant listed for this patent is ALNYLAM PHARMACEUTICALS, INC.. Invention is credited to Daniel McCallus, Catherine Pachuk.
Application Number | 20150315593 14/621669 |
Document ID | / |
Family ID | 40186254 |
Filed Date | 2015-11-05 |
United States Patent
Application |
20150315593 |
Kind Code |
A1 |
McCallus; Daniel ; et
al. |
November 5, 2015 |
HEPATITIS C DSRNA EFFECTOR MOLECULES, EXPRESSION CONSTRUCTS,
COMPOSITIONS, AND METHODS OF USE
Abstract
The present invention provides agents, compositions, constructs
and methods for silencing HCV polynucleotides, as well as methods
and compositions for treating or preventing HCV infection in a
mammalian cell. In one aspect, the present invention provides an
agent or composition comprising at least one double-stranded RNA
effector molecule or complex. The double-stranded RNA effector
molecule or complex comprises: (1) a sequence of at least 19
nucleotides having at least 90% identity with a nucleotide sequence
within HCV Conserved Region 1 (SEQ ID NO: 2), HCV Conserved Region
2 (SEQ ID NO: 3), HCV Conserved Region 5 (SEQ ID NO: 4), (ATR)-1
(SEQ ID NO: 86), ATR-2 (SEQ ID NO: 87), ATR-3 (SEQ ID NO: 88),
ATR-4 (SEQ ID NO: 89); and (2) its complementary sequence. In
another aspect, the present invention provides a construct suitable
for replication in a host cell, and/or suitable for expression of
an RNA molecule or complex of the invention in vitro or in vivo. In
a third aspect, the present invention provides a method for
silencing HCV RNA in a mammalian cell, which comprises
administering to the mammalian cell an agent, composition, or
construct of the invention in a manner and amount effective to
silence HCV RNA in the cell. In a related aspect, the invention
provides a method for treating or preventing HCV infection in a
patient, comprising administering to the patient an effective
amount of an agent, composition, or construct of the invention as
described herein.
Inventors: |
McCallus; Daniel;
(Cambridge, MA) ; Pachuk; Catherine; (Cambridge,
MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ALNYLAM PHARMACEUTICALS, INC. |
Cambridge |
MA |
US |
|
|
Family ID: |
40186254 |
Appl. No.: |
14/621669 |
Filed: |
February 13, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14080342 |
Nov 14, 2013 |
8987227 |
|
|
14621669 |
|
|
|
|
12666057 |
Apr 8, 2010 |
8614198 |
|
|
PCT/US2008/067871 |
Jun 23, 2008 |
|
|
|
14080342 |
|
|
|
|
60929335 |
Jun 22, 2007 |
|
|
|
Current U.S.
Class: |
435/375 ;
435/320.1; 536/24.5 |
Current CPC
Class: |
C12N 2320/30 20130101;
C12N 15/1131 20130101; C12N 2310/53 20130101; C12N 2310/531
20130101; A61P 31/14 20180101; C12N 2310/111 20130101; C12N 2310/14
20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1. A method for silencing an hepatitis C virus (HCV) RNA in a
mammalian cell comprising administering to said cell at least one
double-stranded RNA effector molecule or complex, comprising: (1) a
sequence of at least 19 consecutive nucleotides having at least 90%
identity with a nucleotide sequence within Conserved Region 1 (SEQ
ID NO: 2), Conserved Region 2 (SEQ ID NO: 3), or Conserved Region 5
(SEQ ID NO: 4); active target region (ATR)-I (SEQ ID NO: 86), ATR-2
(SEQ ID NO: 87), ATR-3 (SEQ ID NO: 88), or ATR-4 (SEQ ID NO: 89);
and (2) its complementary sequence.
2. An agent for silencing hepatitis C Virus (HCV) RNA, comprising
at least four double-stranded RNA effector molecules or complexes
that comprise, or a construct that expresses: (a) (1) sequences of
at least 19 nucleotides having at least 90% identity with a
nucleotide sequence of SEQ ID NO: 19, SEQ ID NO: 32, SEQ ID NO: 22,
and SEQ ID NO: 33; and (2) their complementary sequences; or (b)
(1) sequences of at least 19 nucleotides having at least 90%
identity with a nucleotide sequence of SEQ ID NO: 19, SEQ ID NO:
11, SEQ ID NO: 22, and SEQ ID NO: 33; and (2) their complementary
sequences
3. The agent of claim 2, wherein the double-stranded RNA effector
molecules or complexes contain a double-stranded region of from 19
to 30 base pairs.
4. The agent of claim 3, wherein the sequence of at least 19
nucleotides and its complementary sequence are connected via a loop
sequence.
5. The agent of claim 1, wherein at least one double-stranded RNA
effector molecule has a sequence selected from SEQ ID NOs: 50, 58,
61, 71 and 72.
6. The agent of claim 5, wherein the expression construct contains
at least two expression cassettes, each expression cassette
directing the expression of at least one double-stranded RNA
effector molecule.
7. A construct for silencing a hepatitis C virus (HCV) RNA, the
construct encoding at least four double-stranded RNA effector
molecules or complexes wherein the construct comprises: (a) (1)
sequences of at least 19 nucleotides having at least 90% identity
with a nucleotide sequence of SEQ ID NO: 19, SEQ ID NO: 32, SEQ ID
NO: 22, and SEQ ID NO: 33; and (2) their complementary sequences;
or (b) (1) sequences of at least 19 nucleotides having at least 90%
identity with a nucleotide sequence of SEQ ID NO: 19, SEQ ID NO:
11, SEQ ID NO: 22, and SEQ ID NO: 33; and (2) their complementary
sequences.
8. The construct of claim 7, wherein the double-stranded RNA
effector molecules contain a double-stranded region of from 19 to
30 base pairs.
9. The construct of claim 8, wherein the sequence of at least 19
nucleotides and its complementary sequence are connected via a loop
sequence.
10. The construct of claim 7, wherein at least one double-stranded
RNA effector molecule has a sequence selected from SEQ ID NOs: 50,
58, 61, 71 and 72.
11. The construct of claim 7, wherein the expression construct
contains at least two expression cassettes, each expression
cassette directing the expression of at least one double-stranded
RNA effector molecule.
Description
PRIORITY
[0001] This application claims priority to U.S. Provisional
Application No. 60/929,335, filed Jun. 22, 2007, which is hereby
incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to nucleic acid-based
therapeutics for treating or preventing Hepatitis C Virus (HCV)
infection, and particularly RNAi-based therapeutics.
BACKGROUND OF THE INVENTION
[0003] Hepatitis C is an RNA virus containing a single-stranded
positive-sense RNA genome of about 9,600 nts. The genes for the
viral structural and non-structural proteins are flanked by 5' and
3' untranslated regions (UTRs), which are essential for genome
replication. For example, the 5' UTR contains an internal ribosome
entry site (IRES) which is indispensable for the initiation of HCV
polyprotein translation. HCV has been classified into six major
genotypes, each comprising further subgroups, which differ in their
sequence homology by more than 30%. The distribution of these
genotypes differs geographically. For example, genotypes 1a and 1b
are the most prevalent genotypes found within the U.S., while
genotypes 2 and 3 are more prevalent in other countries.
[0004] Because of the sequence variability of HCV, the development
of vaccines and therapeutic drugs, including RNAi-based
therapeutics, that would be active against the majority of viruses,
must take advantage of the rare conserved epitopes and sequences
found among the viral genotypes and quasispecies. In fact, the
mutability of HCV is such that even within an infected individual,
the HCV virus exists as a swarm of variants or "quasispecies" of a
predominant type rather than as a single entity.
[0005] Thus, to apply a gene-silencing-based strategy to the
treatment or prevention of HCV infection, it is necessary to
identify sufficiently conserved stretches of nucleotide sequence in
this highly mutable virus. That is, since RNA interference is a
sequence-specific effect, therapeutic or prophylactic RNAi
molecules must be specific for HCV target sequences, despite the
fact that hepatitis C viral genomes are highly variable. While HCV
target sequence conservation is an important consideration in the
design of sequence-specific anti-HCV prophylactic or therapeutic
modalities such as RNAi or antisense, e.g., some of the highly
conserved regions of the HCV genome such as the 5' UTR are known to
be highly structured, while some regions of the viral genome are
present in the infected cell in association with proteins which
make them largely inaccessible to antisense or RNAi. The lack of a
readily available HCV animal model and problems with various HCV
cell culture models, e.g., the absence or deficiencies in viral
infection or replication models, have hindered the development of
anti-HCV pharmaceuticals of all types.
[0006] Despite well over a decade of research efforts, there are no
vaccines available for HCV. As a consequence, the rate of new HCV
infections around the world is extremely high. The WHO estimates
that globally 170 million individuals carry chronic HCV infections
and that new infections are established at a rate of 3 to 4 million
annually.
[0007] Chronic HCV infection induces liver inflammation, causing
progressive liver disease that can lead to cirrhosis and
hepatocellular carcinoma (liver cancer). Chronic HCV infection
becomes established in 75%-85% of individuals experiencing an
initial infection, and HCV-related liver failure is the most common
indication cited for liver transplantation in the U.S. Chronic HCV
infection in its early stages may cause only mild non-specific
symptoms, such as fatigue, or be completely asymptomatic, leaving
many infected individuals unaware that they carry a dangerous
chronic infection.
[0008] Current therapies for HCV infection, which may include a 6
to 12 month regimen of pegylated interferon and ribavirin, can lead
to a cure in a minority of patients. Response rates vary by HCV
genotype, with genotype 2 and 3 patients exhibiting a 76% response
rate to the current standard therapy while patients infected with
genotype 1a and 1b having only a 46% response rate. Unfortunately,
genotype 1 accounts for 60% of global infections and is the
dominant strain in the U.S., Japan, and Western Europe.
Complicating genotype 1 resistance to ribavarin and interferon is
the fact that both drugs have side effect profiles that can require
dose reduction or discontinuance of therapy when patients
experience side effects. Further complicating patient outcomes is
the fact that patients who fail an initial treatment regimen rarely
respond favorably to a subsequent round of treatment with
interferon and ribavarin.
[0009] Clinicians who treat HCV patients are hopeful that current
and future research programs will yield options that improve the
response rate for genotype 1 patients, which is currently less than
50% using ribavarin and interferon. New treatment options that have
a more tolerable side effect profile would improve patient
compliance and enable more patients to complete a full course of
therapeutic intervention.
[0010] There remains a need for treatment options for HCV-exposed
or infected patients, including for highly conserved nucleic
acid-based molecules, including double-stranded RNAs and constructs
encoding dsRNAs, capable of inhibiting the replication of HCV in
mammalian cells. Such nucleic acid based anti-HCV therapeutic
agents have the potential to improve patient response rates to
therapy, improve adverse event profile, and eliminate or
significantly delay the development of drug resistant escape mutant
virus.
SUMMARY OF THE INVENTION
[0011] The present invention provides agents, compositions,
constructs, and methods for silencing HCV polynucleotides, as well
as methods and compositions capable of inhibiting HCV replication
and for treating or preventing HCV infection in a mammalian
cell.
[0012] In one aspect, the present invention provides an agent or
composition for silencing HCV RNA in a cell. In one aspect, the
agent or composition inhibits HCV viral replication and antigen
expression in a mammalian cell, preferably a human cell. In this
aspect, the agent or composition comprises at least one
double-stranded RNA effector molecule or complex. The
double-stranded RNA effector molecule or complex comprises: (1) a
sequence of at least 19, 20, or 21 consecutive nucleotides having
at least 90%, 95%, or 100% identity with a nucleotide sequence
within HCV Conserved Region 1 (SEQ ID NO: 2), HCV Conserved Region
2 (SEQ ID NO: 3), HCV Conserved Region 5 (SEQ ID NO: 4), active
target region (ATR)-1 (SEQ ID NO: 86), ATR-2 (SEQ ID NO: 87), ATR-3
(SEQ ID NO: 88), or ATR-4 (SEQ ID NO: 89); and (2) its
complementary sequence. Preferably the dsRNA effector molecule will
include (1) a sequence of 19 to 29, 19 to 25, 20 to 25, 21 to 25,
or 21 to 23 consecutive nucleotides within HCV Conserved Region 1
(SEQ ID NO: 2), HCV Conserved Region 2 (SEQ ID NO: 3), HCV
Conserved Region 5 (SEQ ID NO: 4), active target region (ATR)-1
(SEQ ID NO: 86), ATR-2 (SEQ ID NO: 87), ATR-3 (SEQ ID NO: 88), or
ATR-4 (SEQ ID NO: 89); and (2) its complementary sequence. The
effector molecule may optionally form a stem-loop structure, with
the sequence of at least 19 nucleotides and its complementary
sequence being connected via a loop sequence, thereby providing,
for example, short-hairpin RNAs (shRNAs) suitable for RNAi-based
HCV therapeutics. In one aspect, multiple different of such dsRNA
effector molecules of the invention, e.g., two, three, four, five
or more, are administered to or expressed concomitantly in a
mammalian cell, to eliminate or substantially delay the emergence
of drug resistant viral escape mutants.
[0013] In another aspect, the present invention provides a
construct suitable for replication in a host cell, and/or suitable
for expression of an RNA molecule of the invention in vitro or in
vivo. The construct of the invention encodes at least one RNA
effector molecule of the invention, which may be operably linked to
a promoter sequence, such as an RNA Polymerase I, RNA polymerase
II, or RNA polymerase III promoter sequence as described herein. In
one aspect, multiple such dsRNA effector molecules of the
invention, e.g., hairpin dsRNA molecules, are encoded by a single
expression construct under the control of one or more of such
promoters.
[0014] In a third aspect, the present invention provides a method
for silencing or inhibiting the replication of HCV, including
inhibition of HCV RNA and/or HCV antigen expression, in a mammalian
cell. In this aspect, the method of the invention comprises
administering to the mammalian cell an agent, composition, or
construct of the invention in a manner and amount effective to
inhibit HCV replication and/or HCV RNA or antigen expression in the
cell. In a related aspect, the present invention provides a method
for treating or preventing HCV infection in a patient, comprising
administering to the patient an effective amount and regimen of an
agent, composition, or construct of the invention as described
herein.
[0015] The present invention further provides methods for preparing
the dsRNA effector molecules, compositions, and constructs of the
invention.
DESCRIPTION OF THE DRAWINGS
[0016] FIG. 1 shows a number of highly active shRNAs which map to
four active target regions (ATR-1, ATR-2, ATR-3, and ATR-4) within
the HCV 5' UTR.
[0017] FIG. 2 is a plasmid diagram of the multi-cistronic plasmid
QJ, which expresses four different active shRNAs, HCV 5'-21-61, HCV
5'-21-94, HCV 5'-21-124, and HCV 5'-21-135.
[0018] FIG. 3 is a plasmid diagram of a mono-cistronic plasmid HCV
5' 21-61, which expresses the shRNA HCV 5' 21-61 from the 7SK 4A
promoter.
DETAILED DESCRIPTION OF THE INVENTION
[0019] To identify sequences that are most conserved among HCV
genomes worldwide, a bioinformatic analysis was conducted. There
are 93 complete genomes published in GenBank version 134.0 and
these were compared for the identification of sequences of 19 nts
or greater that are >95% conserved, and which could potentially
serve as target sites for small inhibitory RNAs (siRNAs) and
short-hairpin RNAs (shRNAs). The following sequences were
identified within the HCV 5'UTR, and are shown with respect to
GenBank Accession ID AB047639 (SEQ ID NO: 1).
TABLE-US-00001 HCV Conserved region 1: nts 35-102 of AB047639. (SEQ
ID NO: 2) 5'-atcactcccctgtgaggaactactgtcttcacgcagaaagcgcctag
ccatggcgttagtatgagtgt-3' HCV Conserved region 2: nts 119-176 of
AB047639. (SEQ ID NO: 3)
5'-ccccccctcccgggagagccatagtggtctgcggaaccggtgagtac accggaattgc-3'
HCV Conserved region 5: nts 270-338 of AB047639. (SEQ ID NO: 4)
5'-gcgaaaggccttgtggtactgcctgatagggcgcttgcgagtgcccc
gggaggtctcgtagaccgtgca-3'
[0020] Four highly conserved and highly active target regions
(ATR), preferred for some applications, were identified:
ATR-1: 5'-CCCTGTGAGGAACTACTGTCTTCACGCAGAA-3' (SEQ ID NO: 86),
mapping to nucleotide coordinates 42 to 76 of GenBank Accession No.
AB047639, found within Conserved Region 1 (SEQ ID NO: 2). ATR-2:
5'-TCCCGGGAGAGCCATAGTGGTCTGCGGAA-3' (SEQ ID NO: 87), mapping to
nucleotide coordinates 126 to 154 of GenBank Accession No.
AB047639, found within Conserved Region 2 (SEQ ID NO: 3). ATR-3:
5'-CGAAAGGCCTTGTGGTACTGC-3', (SEQ ID NO: 88) mapping to nucleotide
coordinates 271 to 297 of GenBank Accession No. AB047639, found
within Conserved Region 5 (SEQ ID NO: 4). ATR-4:
5'-TGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCA-3', (SEQ ID NO: 89) mapping
to nucleotide coordinates 305 to 338 of GenBank Accession No.
AB047639, found within Conserved Region 5 (SEQ ID NO: 4).
[0021] In this context, the present invention provides agents,
compositions, constructs and methods for silencing HCV
polynucleotides, as well as for treating or preventing HCV
infection in a mammalian cell.
[0022] Effector RNA Molecules and Complexes
[0023] In one aspect, the present invention provides an agent for
silencing HCV RNA in a cell. The agent comprises at least one
double-stranded RNA effector molecule or complex, which comprises:
(1) a sequence of at least 19, 20, or 21 consecutive nucleotides
having at least about 90% identity with a nucleotide sequence
within HCV Conserved Region 1 (SEQ ID NO: 2), HCV Conserved Region
2 (SEQ ID NO: 3), HCV Conserved Region 5 (SEQ ID NO: 4), ATR-1 (SEQ
ID NO: 86), ATR-2 (SEQ ID NO: 87), ATR-3 (SEQ ID NO: 88), or ATR-4
(SEQ ID NO: 89) and (2) its complementary sequence.
[0024] In this context, the nucleotide "t" in SEQ ID NOS: 1, 2, 3,
4, etc. is considered to be identical with "u," which would take
the place of "t" in the corresponding RNA sequence. Thus,
throughout this application it will be understood that where RNA
sequences are described for convenience with respect to encoding or
corresponding DNA sequences, "t" will be replaced by "u" in the RNA
sequence.
[0025] In certain embodiments, the at least 19 nucleotides of the
dsRNA effector molecule or complex has at least about 95% identity
with a nucleotide sequence within HCV Conserved Region 1 (SEQ ID
NO: 2), HCV Conserved Region 2 (SEQ ID NO: 3), HCV Conserved Region
5 (SEQ ID NO: 4), ATR-1 (SEQ ID NO: 86), ATR-2 (SEQ ID NO: 87),
ATR-3 (SEQ ID NO: 88), or ATR-4 (SEQ ID NO: 89), such as at least
about 96%, 97%, 98%, 99%, or about 100% identity. Identity between
two nucleotide sequences may be determined using any suitable
algorithm known in the art, such as Tatusova et al., Blast 2
sequences--a new tool for comparing protein and nucleotide
sequences, FEMS Microbiol Lett. 174:247-250 (1999).
[0026] In some embodiments, the at least 19 nucleotides of the
dsRNA effector molecule or complex has a sequence selected from
within nucleotides 42-76 (ATR-1), 126-154 (ATR-2), 271 to 297
(ATR-3), 305 to 338 (ATR-4) or 271-338 of SEQ ID NO: 1 (GenBank
Accession ID AB047639). For example, the dsRNA effector molecule or
complex may comprise at least 19 nucleotides selected from within
nucleotides 305-338 of SEQ ID NO: 1.
[0027] The dsRNA effector molecules and complexes may have
double-stranded regions that vary somewhat in length, so long as
the effector molecule or complex is effective for silencing the
target polynucleotide, that is, the length of the double-stranded
region is generally sufficient to trigger RNAi-mediated degradation
of the target sequence. For example, the agent or composition of
the invention may comprise at least one double-stranded RNA
effector molecule or complex containing a double-stranded region of
from 19 or 21 base pairs to about 30 or 40 base pairs, or from 21
base pairs to about 27 base pairs. In certain embodiments, the
double-stranded RNA effector molecule or complex contains a
double-stranded region of about 21 or about 27 base pairs.
[0028] In accordance with the invention, the double-stranded RNA
molecules and complexes of the invention may exist in a denatured
or substantially denatured form. Alternatively, the double-stranded
RNA molecules and complexes may exist in a double-stranded
conformation, or a substantially double-stranded conformation, or a
partially double-stranded conformation, at least with respect to
the regions of complementarity. Generally, the RNA molecules and
complexes of the invention are capable of forming double-stranded
structures under physiological conditions (e.g., intracellular
conditions), where these structures are sufficient to trigger
RNAi-mediated gene silencing.
[0029] In some embodiments, the double-stranded RNA effector
molecule or complex has a double-stranded region that comprises, or
consists essentially of (or consists of) in one strand, a sequence
selected from SEQ ID NOS: 5-42 as disclosed herein. Such sequences,
which correspond to HCV Conserved Regions 1, 2, and 5, are listed
in Table 3.
[0030] The double-stranded RNA effector molecules of the invention
comprise a region of self-complementarity such that nucleotides in
one segment of the molecule base pair with nucleotides in another
segment of the molecule (e.g., stem-loop or hairpin structure as
described herein). In contrast, the double-stranded RNA effector
duplexes or complexes of the invention include at least two
separate polynucleotide strands that have a region of
complementarity to each other. The double-stranded RNA complexes
(i.e., duplexes) may be fully complementary, that is, may contain
no single stranded regions, such as single stranded ends. In other
embodiments, the double-stranded RNA complex contains short
single-stranded ends, such as single-stranded 5' or 3' ends of from
about 1 to about 5 nucleotides (e.g., 1, 2, or 3 nucleotides).
[0031] In certain embodiments, the effector molecule is a short
hairpin dsRNA (shRNA) or a microRNA. A "shRNA" (short-hairpin RNA)
is an RNA molecule of less than approximately 200 or 100
nucleotides, such as about 70 nucleotides or less, in which at
least one stretch of nucleotides (e.g., at least about 19
nucleotides) is base paired with a complementary sequence located
on the same RNA molecule and separated from the complementary
sequence by an unpaired region. These single-stranded hairpin
regions form a single-stranded loop between the stem structure
created by the two regions of base complementarity. The length and
nucleotide sequence of the loop sequence is not narrowly critical,
and may range, for example, from about 4 to 5 to about 20
nucleotides in length, or from about 7 to about 10 nucleotides in
length. For example, the loop sequence may be about 9 nucleotides
in length. An exemplary loop sequence is 5'-agagaactt-3' (SEQ ID
NO: 43). The loop may vary considerably in length and sequence,
although loop sequences which assume significant secondary
structure are to be avoided, as are poly T (e.g., T.sub.4 to
T.sub.5 or more) sequences, which might trigger premature
termination of transcription for effector molecules expressed by
polymerase III promoters. In addition to a "stem" region which
comprises the identified homologous and complementary HCV
sequences, in certain embodiments the hairpin molecule and/or the
expression vector encoding the hairpin RNA will include additional
5' and/or 3' sequences, including in some embodiments 5' and/or 3'
flanking sequences as well as loop sequences derived from miRNAs.
See e.g., US 2004/0053411, the teaching of which is hereby
incorporated by reference.
[0032] Exemplary shRNAs in accordance with the invention have a
sequence selected from SEQ ID NOS: 44-81. The complementary strand
may also, optionally, have from one to five uracil nucleotides at
its 3'-end, which may correspond to transcribed transcription
termination sequences.
[0033] In addition to single shRNAs, the invention includes dual or
bi-finger and multi-finger hairpin dsRNAs, in which the RNA
molecule comprises two or more of such stem-loop structures, each
separated by a single-stranded spacer region. In some embodiments
such two or more stem-loop structures may be encoded by an
expression construct and operably linked to a single promoter.
Thus, the hairpin dsRNA may be a single hairpin dsRNA or a
bi-fingered, or multi-fingered dsRNA hairpin as described in
PCT/US03/033466 or WO 04/035766, or a partial or forced hairpin
structure as described in WO 2004/011624, the disclosures of which
are hereby incorporated by reference. In these embodiments, the
multi-finger hairpin RNA contains two, three, or four double
stranded regions, each corresponding to an HCV target sequence
independently selected from SEQ ID NOS: 5-42, such as SEQ ID NOS:
11, 19, 22, and 33. In these multi-finger hairpin RNAs the stem
loop sequences may be independently selected from SEQ ID NOS:
44-81.
[0034] HCV target sequences (as described above) may also be
combined into other RNA structures suitable for RNAi-based
therapeutics, including a single stem loop structure with multiple
double-stranded regions separated by mismatch region(s). Such RNA
structures are disclosed in U.S. application Ser. No. 10/531,349,
which was published as US 2006/0035344 on Feb. 16, 2006, which is
hereby incorporated by reference. In these embodiments, the
multi-target effector molecule may comprise two, three, or four
double-stranded regions each corresponding to an HCV target
sequence (as described herein) independently selected from SEQ ID
NOS: 5-42, such as SEQ ID NO: 11, 19, 22, and 33.
[0035] The RNA molecules and complexes of the invention may be
composed purely or predominately of ribonucleotides found naturally
in RNA (A, U, C, G), or may contain chemically modified
nucleotides. Exemplary chemically modified nucleotides include
phosphorothioate internucleotide linkages, 2'-deoxyribonucleotides,
2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides,
"universal base" nucleotides, "acyclic" nucleotides, 5-C-methyl
nucleotides, and terminal glyceryl and/or inverted deoxy abasic
residue incorporation. These, as well as other chemical
modifications, support RNAi-mediated gene silencing while having
superior serum stability.
[0036] RNA Compositions
[0037] The invention further provides compositions containing from
two to five double-stranded RNA effector molecules or complexes,
such as from two to five double-stranded RNA effector molecules or
complexes as described above. For example, the two to five
double-stranded RNA effector molecules (e.g., shRNAs) or complexes
may each comprise: (1) a sequence of at least 19 nucleotides having
at least 90% identity with a nucleotide sequence within Conserved
Region 1 (SEQ ID NO: 2), Conserved Region 2 (SEQ ID NO: 3),
Conserved Region 5 (SEQ ID NO: 4); ATR-1 (SEQ ID NO: 86), ATR-2
(SEQ ID NO: 87), ATR-3 (SEQ ID NO: 88), or ATR-4 (SEQ ID NO: 89),
and (2) its complementary sequence. Where the two to five
double-stranded RNAs are each shRNAs, the shRNAs each further
comprise a loop sequence as described above.
[0038] Thus, the composition of the invention may contain a
plurality of double-stranded RNA effector molecules, each having a
double-stranded region that comprises (or consists essentially of)
a sequence independently selected from SEQ ID NOS: 5-42, and its
complementary sequence. An exemplary composition may have: a first
dsRNA effector molecule comprising SEQ ID NO: 11 and its
complementary sequence; a second dsRNA effector molecule comprising
SEQ ID NO: 19 and its complementary sequence; a third dsRNA
effector molecule comprising SEQ ID NO: 22 and its complementary
sequence; and a fourth dsRNA effector molecule comprising SEQ ID
NO: 33 and its complementary sequence. One, two, three, or four of
these double stranded RNA effector molecules may be in the form of
short-hairpin RNAs, that is, the sense and anti-sense strands may
be connected by a short loop sequence as described herein. Thus, in
these embodiments, the composition of the invention may comprise
from two to five (e.g., four) double-stranded RNA effector
molecules independently selected from SEQ ID NOS: 44-81. For
example, the composition may comprise the four shRNAs represented
by the sequences: SEQ ID NO: 50, SEQ ID NO: 58, SEQ ID NO: 61, and
SEQ ID NO: 72. In some embodiments the plurality of anti-HCV RNA
effector molecules are expressed from a plasmid or viral vector
within a human cell.
[0039] Alternatively still, the composition of the invention may
contain a plurality of double-stranded RNA effector duplexes or
complexes, each having a double-stranded region that comprises (or
consists essentially of) a sequence independently selected from SEQ
ID NOS: 5-42, and its complementary sequence. For example: a first
RNA effector complex may comprise, in one RNA strand, the
nucleotide sequence of SEQ ID NO: 11; a second RNA effector complex
may comprise, in one strand, the nucleotide sequence of SEQ ID NO:
19; a third RNA effector complex may comprise, in one strand, the
nucleotide sequence of SEQ ID NO: 22; and a fourth RNA effector
complex may comprise, in one strand, the nucleotide sequence of SEQ
ID NO: 33. Such RNA molecules are base-paired in the complex with
(or are capable of base-pairing with) a complementary or partially
complementary RNA molecule in the complex, that is an RNA molecule
having a sequence complementary to SEQ ID NOS: 11, 19, 22, and 33,
respectively.
[0040] Constructs
[0041] In another aspect, the present invention provides a
construct encoding at least one RNA molecule or complex of the
invention. The construct may be, for example, a plasmid or viral
vector. Such constructs may be expression constructs suitable for
expression of the encoded RNA in vitro or in vivo, or may otherwise
be suitable for replication of the construct in a host cell, such
as a prokaryotic or eukaryotic host cell, including bacteria,
yeast, and mammalian including human host cells. The construct may
include an origin of replication, mechanism for selection (e.g.,
antibiotic resistance gene) as well as elements to facilitate
removal of the RNA-encoding sequence for sub-cloning into
additional constructs or vectors as may be desired, such as
conveniently placed restriction endonuclease cleavage sites (e.g.,
flanking the RNA-encoding sequence(s)).
[0042] In some embodiments, the construct is an expression
construct containing a DNA segment that encodes an RNA molecule of
the invention, with the DNA segment being operably linked to a
promoter to drive expression of the RNA molecule. An "expression
construct" is any double-stranded DNA or double-stranded RNA
designed to produce an RNA of interest. The invention includes
expression constructs in which one or more of the promoters is not
in fact operably, linked to a polynucleotide sequence to be
transcribed, but instead is designed for efficient insertion of an
operably-linked polynucleotide sequence to be transcribed by the
promoter, for instance by way of one or more restriction cloning
sites in operative association with the one or more promoters.
[0043] Transfection or transformation of the expression construct
into a recipient cell allows the cell to express an RNA effector
molecule encoded by the expression construct. An expression
construct may be a genetically engineered plasmid, virus,
recombinant virus, or an artificial chromosome derived from, for
example, a bacteriophage, adenovirus, adeno-associated virus,
retrovirus, lentivirus, poxvirus, or herpesvirus. Expression
vectors for use with the invention contain sequences from bacteria,
viruses or phages. Such vectors include chromosomal, episomal and
virus-derived vectors, e.g., vectors derived from bacterial
plasmids, bacteriophages, yeast episomes, yeast chromosomal
elements, and viruses; as well as vectors derived from combinations
thereof, such as those derived from plasmid and bacteriophage
genetic elements, cosmids and phagemids. Exemplary vectors are
double-stranded DNA phage vectors and double-stranded DNA viral
vectors.
[0044] In certain embodiments, the expression construct of the
invention is a plasmid, such as a plasmid suitable for delivery to
and/or for RNA expression in a mammalian cell.
[0045] The construct of the invention encodes at least one
double-stranded RNA effector molecule, which comprises: (1) a
sequence of at least 19 nucleotides having at least about 90%
identity with a nucleotide sequence within HCV Conserved Region 1
(SEQ ID NO: 2), HCV Conserved Region 2 (SEQ ID NO: 3), HCV
Conserved Region 5 (SEQ ID NO: 4); ATR-1 (SEQ ID NO: 86), ATR-2
(SEQ ID NO: 87), ATR-3 (SEQ ID NO: 88), or ATR-4 (SEQ ID NO: 89),
and (2) its complementary sequence.
[0046] In certain embodiments, the at least 19 nucleotides have at
least about 95% identity with a nucleotide sequence within HCV
Conserved Region 1 (SEQ ID NO: 2), HCV Conserved Region 2 (SEQ ID
NO: 3), HCV Conserved Region 5 (SEQ ID NO: 4), ATR-1 (SEQ ID NO:
86), ATR-2 (SEQ ID NO: 87), ATR-3 (SEQ ID NO: 88), or ATR-4 (SEQ ID
NO: 89), such as at least about 96%, 97%, 98%, 99%, or about 100%
identity. Identity between two nucleotide sequences may be
determined using any suitable algorithm known in the art, such as
Tatusova et al., Blast 2 sequences--a new tool for comparing
protein and nucleotide sequences, FEMS Microbiol Left. 174:247-250
(1999).
[0047] In some embodiments, the at least one RNA effector molecule
encoded by the construct or vector has a sequence selected from
within nucleotides 42-76, 126-154, or 271-338 of SEQ ID NO: 1
(GenBank Accession ID AB047639). For example, the construct may
encode an RNA effector molecule comprising at least 19 nucleotides
selected from within nucleotides 305-338 of SEQ ID NO: 1.
[0048] The expression construct of the invention may encode RNA
effector molecules having double-stranded regions that vary
somewhat in length, so long as the effector molecule is effective
for silencing the target polynucleotide. For example, the
expression construct may encode at least one double-stranded RNA
effector molecule containing a double-stranded region of from 19 or
21 base pairs to about 30 or 40 base pairs, or from 21 to about 27
base pairs. In certain embodiments, the double-stranded RNA
effector molecule contains a double-stranded region of about 21 or
about 27 base pairs.
[0049] In some embodiments, the construct (e.g., expression vector)
encodesone or more double-stranded RNA effector molecules, each
having a double-stranded region that comprises, or consists
essentially of (or consists of) in one strand, a sequence selected
from SEQ ID NOS: 5-42. Such sequences are listed in Table 3. In
some embodiments, the expression vector encodes at least one double
stranded RNA effector molecule that comprises: 1) a sequence
selected from SEQ ID NO: 9, 11, 19, 22, 26, 31, 32, and 33; 2) the
complement of said sequence, and optionally. 3) a sequence linking
1) and 2). In some embodiments, the expression vector will encode
at least two, three, four, or more of such dsRNA effector
molecules. In some embodiments the expression vector will encode at
least four different dsRNA effector molecules comprising, in double
stranded conformation, SEQ ID NOS: 11, 19, 22, and 33; SEQ ID NOS:
9, 11, 31, and 33; SEQ ID NOS: 11, 19, 31, and 33; SEQ ID NOS: 19,
22, 32, and 33; SEQ ID NOS: 11, 19, 22, and 33; or SEQ ID NOS: 26,
31, 32, and 33.
[0050] The encoded double stranded RNA effector molecule(s) may be
composed of two separate complementary, or partially complementary
RNA molecules (e.g., expressed from separate expression cassettes
on the same or different vectors), or may alternatively be in the
form of a single RNA molecule, such as a short-hairpin RNA. In the
latter embodiment, the sense and anti-sense polynucleotides are
connected via a loop sequence, which is generally single-stranded.
The length of the loop sequence is not narrowly critical, and may
range, for example, from 4 to 20 nucleotides in length, or from 7
to 10 nucleotides in length, or longer if desired, e.g., 30 nt, 40
nt, etc. For example, the loop sequence may be about 9 nucleotides
in length. An exemplary loop sequence is 5'-agagaactt-3' (SEQ ID
NO: 43). The loop sequence may also vary considerably, so long as
structure-forming complementarity is avoided, and, in the case of
RNA polymerase III promoter transcribed sequences, poly T
termination sequences are avoided.
[0051] In accordance with this aspect of the invention, exemplary
expression constructs encode double-stranded RNA effector
molecule(s) having a sequence selected from SEQ ID NOS: 44-81. The
complementary strand may also, optionally have from 1 to 5 uracil
nucleotides at its 3'-end, representing transcribed RNA pol III
termination signal nucleotides. The expressed dsRNA effector
molecule may also optionally include one to five or more additional
5' nucleotides, which may vary depending on the transcription start
site.
[0052] The expression construct may be engineered to encode
multiple, e.g., three, four, five or more RNA molecules, such as
the RNA molecules described herein, including short hairpin dsRNAs.
The expression construct may include a plurality of promoters,
e.g., RNA polymerase I, II or III promoters, mitochondrial
promoters, etc., operable in the host mammalian cell. Each promoter
may be operably linked to a sequence encoding one or more RNA
molecules of the invention, followed by an appropriate termination
sequence. In addition to targeting highly conserved HCV sequences,
the ability to co-deliver two, three, four, five or more different
RNA effector molecules radically reduces the ability of the virus
to develop escape mutants. While "cocktail" pharmaceutical
preparations including multiple active components can be
formulated, dsRNA expression constructs provide an attractive
delivery vehicle for accomplishing such co-delivery of a plurality
of different antiviral effector molecules by a single
pharmaceutical entity. The manufacturing and regulatory advantages
of such an approach are readily apparent.
[0053] In certain embodiments, the expression construct encodes two
or more RNAs of the invention, such as 2, 3, 4, 5, or more double
stranded RNA molecules, such as shRNAs. Thus, the expression
construct may encode double stranded RNAs, such as shRNA hairpins,
specific for one or more of HCV Conserved Regions 1, 2 or 5, or
ATR-1, ATR-2, ATR-3, or ATR-4.
[0054] In these embodiments, the invention provides one or more
expression constructs, which collectively encode from two to five
or more double-stranded RNA effector molecules, such as from two to
five or more double-stranded RNA effector molecules as described
herein. In certain embodiments, each expression construct encodes
two, three, or four double-stranded RNA effector molecules, and
preferably shRNAs. The encoding sequences, which may each be
operably linked to a promoter, may each encode: (1) a sequence of
at least 19 nucleotides having at least 90% identity with a
nucleotide sequence within HCV Conserved Region 1 (SEQ ID NO: 2),
HCV Conserved Region 2 (SEQ ID NO: 3), or HCV Conserved Region 5
(SEQ ID NO: 4), ATR-1 (SEQ ID NO: 86), ATR-2 (SEQ ID NO: 87), ATR-3
(SEQ ID NO: 88), or ATR-4 (SEQ ID NO: 89); (2) its complementary
sequence; and optionally (3) a loop sequence.
[0055] For example, the expression construct of the invention may
encode a plurality of double-stranded RNA effector molecules having
double-stranded regions comprising (or consisting essentially of) a
sequence independently selected from SEQ ID NOS: 5-42 and its
complementary sequence. In one embodiment, the construct encodes: a
first effector molecule comprising or consisting essentially of (or
consisting of) the nucleotide sequence of SEQ ID NO: 11, a second
effector molecule comprising or consisting essentially of (or
consisting of) the nucleotide sequence of SEQ ID NO: 19, a third
effector molecule comprising or consisting essentially of (or
consisting of) the nucleotide sequence of SEQ ID NO: 22, and a
fourth effector molecule comprising or consisting essentially of
(or consisting of) the nucleotide sequence of SEQ ID NO: 33. One,
two, three, or four of these double stranded RNA effector molecules
may be in the form of short-hairpin RNAs, that is, having sense and
anti-sense strands connected by a short loop sequence as described
herein. Thus, in these embodiments, the expression construct of the
invention may encode a plurality of dsRNA effector molecules
independently selected from SEQ ID NOS: 44-81. The construct may
encode two, three, or four double-stranded RNA effector molecules
represented by the sequences: SEQ ID NO: 50, SEQ ID NO: 58, SEQ ID
NO: 61, and SEQ ID NO: 72.
[0056] The expression construct may encode an RNA molecule of the
invention and its complementary stand separately, that is from
separate promoters (e.g., separate expression cassettes). In this
embodiment, the double-stranded molecule is produced
intracellularly upon expression of the RNAs and subsequent
hybridization. Typically, with expressed interfering RNA (eiRNA),
the dsRNA is expressed in the first transfected cell from an
expression vector. In such a vector, the sense strand and the
antisense strand of the dsRNA may be transcribed from the same
nucleic acid sequence using e.g., two convergent promoters at
either end of the nucleic acid sequence or separate promoters
transcribing either a sense or antisense sequence. Alternatively,
two plasmids can be cotransfected, with one of the plasmids
designed to transcribe one strand of the dsRNA while the other is
designed to transcribe the other strand.
[0057] In certain embodiments, the construct is an expression
construct suitable for expression (e.g., transcription) of the
encoded RNA in vitro or in vivo. In these embodiments, the
construct encodes an RNA molecule of the invention operably linked
to a promoter sequence. Suitable promoter sequences suitable for
run-off transcription in vitro are known, and include T3 and T7
promoters. In other embodiments, the expression construct encodes
an RNA molecule of the invention operably linked to a promoter
suitable for expression (e.g., transcription) of the RNA in a
mammalian cell. The mammalian cell may be in culture, or may be a
patient's cell, e.g., a patient afflicted with or at risk of
acquiring HCV. Promoters suitable for RNA expression in a mammalian
cell are known, and include those described in WO 2006/033756,
which is hereby incorporated by reference. For example, the
construct of the invention may contain a DNA sequence encoding an
RNA molecule of the invention operably linked to an RNA polymerase
III promoter, a 7SK promoter, an H1 promoter, or a U6 promoter.
Further, where the construct encodes a plurality of RNA molecules,
each independently controlled by its own promoter, the promoters
may be the same or different. In one aspect, an expression
construct may comprise two, three, four or more 7SK 4A promoters as
described in WO 2006/033756. Additional promoters may be selected
from an RNA polymerase I promoter, an RNA polymerase II promoter, a
T7 polymerase promoter, an SP6 polymerase promoter, a tRNA
promoter, and a mitochondrial promoter.
[0058] Generally, vector-directed expression of short RNA effector
molecules including short hairpin dsRNAs is most efficient when
under the control of a mammalian promoter that the host cell
naturally employs for expression of small RNA molecules. These
promoters comprise the family of RNA Polymerase III promoters,
including Type 1, Type 2, and Type 3 RNA Polymerase III promoters.
Prototypical examples of promoters in each class are found in genes
encoding 5s RNA (Type 1), various transfer RNAs (Type 2) and U6
small nuclear RNA (Type 3). Another promoter family (transcribed by
RNA Polymerase I) is also dedicated in the cell to transcription of
small structural RNAs; however, this family may be less diverse in
sequence than the RNA Polymerase III promoters. Finally, RNA
Polymerase II promoters are used in the transcription of the
protein-coding messenger RNA molecules, as distinguished from the
small structural and regulatory RNA mentioned above. The majority
of promoter systems known in the art utilize RNA Polymerase II
promoters, which may not be preferred for production of small RNAs.
An exception may be shRNAs expressed by RNA polymerase II or III
promoters in a miRNA context as taught in e.g. U.S. Ser. No.
10/429,249 and PCT/US2007/81103, which is hereby incorporated by
reference. RNA polymerase III promoter-based vectors containing one
promoter have been described in the art (see, e.g., U.S. Pat. No.
5,624,803, Noonberg et al., "In vivo oligonucleotide generator, and
methods of testing the binding affinity of triplex forming
oligonucleotides derived therefrom"), and a description of U6-based
vector systems can be found in Lee et al., Nat. Biotechnol.
20:500-05 (2002). Yu et al., Proc. Natl. Acad. Sci. USA 99:6047-52
(2002), describe an expression system for short duplex siRNAs
comprising a T7 and U6 promoter. Miyagishi and Taira, Nat.
Biotechnol. 20:497-500 (2002), describe expression plasmids for
short duplex siRNAs comprising expression cassettes containing
tandem U6 promoters, each transcribing either the sense or the
antisense strand of an siRNA, which are then annealed to form
duplex siRNAs.
[0059] Where it is desired to deliver short dsRNAs, multiple RNA
polymerase III promoter expression constructs (as taught in WO
06/033756, which is hereby incorporated by reference), may be used
in accordance with the invention. The multiple RNA polymerase III
promoters may be utilized in conjunction with promoters of other
classes, including RNA polymerase I promoters, RNA polymerase II
promoters, etc. Preferred in some applications are the Type III RNA
pol III promoters including U6, H1, and 7SK, which exist in the 5'
flanking region, include TATA boxes, and lack internal promoter
sequences. A preferred 7SK promoter is the 7SK 4A promoter variant
taught in WO 06/033756, the nucleotide sequence of which is hereby
incorporated by reference. In such expression constructs each
promoter may be designed to control expression of an independent
RNA expression cassette, e.g., a shRNA expression cassette. Such
multiple RNA polymerase III promoter expression constructs are
suitable for expression of multiple, e.g., three, four, five, or
more anti-HCV shRNA effector molecules of the invention. Each dsRNA
effector molecule, e.g., hairpin dsRNA, may be transcribed from its
own promoter or one or more promoters may be engineered to each
transcribe a single RNA strand encoding a series or "gang" of two,
three or more shRNA molecules separated by single-stranded regions.
RNA Pol III promoters may be especially beneficial for expression
of small engineered RNA transcripts, because RNA Pol III
termination occurs efficiently and precisely at a short run of
thymine residues in the DNA coding strand, without other protein
factors. T.sub.4 and T.sub.5 are the shortest Pol III termination
signals in yeast and mammals, with oligo (dT) terminators longer
than T.sub.5 being rare in mammals. Accordingly, the multiple
polymerase III promoter expression constructs of the invention may
also include an appropriate oligo (dT) termination signal, i.e., a
sequence of 4, 5, 6 or more Ts, operably linked 3' to each RNA Pol
III promoter cassette in the DNA coding strand. That is, a DNA
sequence encoding one or more RNA effector molecules, e.g., a dsRNA
hairpin or RNA stem-loop structure to be transcribed, is inserted
between the Pol III promoter and the termination signal.
[0060] The invention provides means for delivering to a host cell
sustained amounts of 2, 3, 4, 5, or more different antiviral dsRNA
hairpin molecules (e.g., specific for 2, 3, 4, 5, or more different
viral sequences or elements), in a genetically stable mode, so as
to inhibit viral replication while preventing, decreasing, or
delaying generation of viral escape mutants, and without evoking a
dsRNA stress response. In accordance with this aspect, each dsRNA
hairpin may be expressed from an expression construct, and
controlled by e.g. an RNA polymerase III promoter. In some such
embodiments a single RNA polymerase promoter, e.g. a pol II or pol
III promoter, may express a plurality of dsRNA hairpins. In some
such embodiments the dsRNA hairpins will be present within 5' and
3' flanking miRNA sequences.
[0061] Thus, the expression constructs of the invention provide a
convenient means for delivering a multi-drug regimen comprising
several different RNAs of the invention to a cell or tissue of a
host vertebrate organism, thereby potentiating the anti-viral
activity, and reducing the likelihood that multiple independent
mutational events will produce resistant virus. This provides an
important advantage in countering viral variation both within human
and animal host populations and temporally within a host due to
mutation events.
[0062] In certain embodiments, the expression construct contains at
least two expression cassettes, each expression cassette directing
the expression of a shRNA independently selected from SEQ ID NOS:
44-81, such as SEQ ID NOS: 50, 58, 61, and 72. Each expression
cassette may independently comprise at least one promoter, e.g., an
RNA polymerase III promoter selected from a U6 promoter, a 7SK
promoter, an H1 promoter, and an MRP promoter. For example, each
expression cassette may comprise a 7SK promoter driving the
expression of at least one double-stranded RNA effector molecule,
and an RNA pol III termination signal.
[0063] Pharmaceutical Compositions
[0064] The RNAs and constructs of the invention may be formulated
as pharmaceutical compositions, comprising, in addition to
effective amounts of the RNA(s) or construct(s) necessary to
produce the desired biological effect, pharmaceutically acceptable
carriers. Such carriers may comprise, for example, agents for
facilitating the transfection of mammalian cells, which are well
known. Exemplary transfection agents and compositions, which may be
used in accordance with the present invention, are
Lipofectamine2000.TM. (Invitrogen, Carlsbad, Calif.), as well as
those reviewed and described in US 2006/0084617 published Apr. 20,
2006, which is hereby incorporated by reference in its entirety.
See also, the methods and compositions for delivery of nucleic
acids as taught in in WO 2006/033756, the teaching of which is
hereby incorporated herein in its entirety. Nucleic acids such as
shRNAs may also be delivered to distal organs such as the liver by
transfecting skeletal muscle cells (e.g., injection,
injection/electroporation, or hydrodynamic vessel delivery) with an
expression vector as taught in U.S. Ser. No. 11/935,925
(PCT/US2007/83805), the teaching of which is hereby incorporated by
reference in its entirely.
[0065] In various embodiments, the pharmaceutical composition
includes about 1 ng to about 20 mg of nucleic acid, e.g., RNA, DNA,
plasmids, viral vectors, recombinant viruses, or mixtures thereof
(as described above), which provide the desired amounts of the
nucleic acid molecules. In some embodiments, the composition
contains about 10 ng to about 10 mg of nucleic acid, about 0.1 mg
to about 500 mg, about 1 mg to about 350 mg, about 25 mg to about
250 mg, or about 100 mg of nucleic acid. Those of skill in the art
of clinical pharmacology can readily arrive at appropriate dosing
schedules with routine experimentation.
[0066] Other suitable carriers include, but are not limited to,
saline, buffered saline, dextrose, water, glycerol, ethanol, and
combinations thereof. The pharmaceutical composition generally
contains one or more pharmaceutically acceptable additives suitable
for the selected route and mode of administration. These
compositions may be administered by, without limitation, any
parenteral route including intravenous (IV) or intra-arterial (IA)
(including hydrodynamic delivery methods in which increasing
intravessel pressure increases transfection of the surrounding
cells), intramuscular (IM), intramuscular/electroporation,
subcutaneous (SC), intradermal, intraperitoneal, intrathecal, as
well as topically, orally, and by mucosal routes of delivery such
as intranasal, inhalation, rectal, vaginal, buccal, and sublingual.
Generally, the pharmaceutical compositions of the invention are
prepared for administration to mammalian subjects including
primates and humans, and are in the form of liquids, including
sterile, non-pyrogenic liquids for injection, emulsions, powders,
aerosols, tablets, capsules, enteric coated tablets, or
suppositories.
[0067] Methods for Inhibiting Expression of Target
Polynucleotides
[0068] The invention further provides a method for silencing an HCV
RNA in a mammalian cell. As used herein, the term silencing of an
HCV RNA refers to reducing the abundance of the target
polynucleotide in the cell, or in a patient treated with a
sequence-specific anti-HCV agent of the invention, whether via RNA
stability and/or via replication rate of the HCV polynucleotide,
including inhibitory effects on production, levels or persistence
of positive and/or negative strand HCV RNA, including various
qualitative and quantitative measures of HCV viral load, e.g.,
quantitative PCR, transcription-mediated amplification (TMA), and
branched DNA assay (bDNA). HCV RNA silencing also includes
inhibitory effects on viral protein expression. The target
polynucleotide (e.g., HCV RNA) may be reduced by about 1/2, 1/5,
1/10, 1/100 as compared to a positive control cell (e.g., a cell
infected with HCV). In some embodiments, the target polynucleotide
is undetectable in cells transfected or patients treated with an
agent, composition (including pharmaceutical composition), or
construct of the invention).
[0069] In this aspect, the invention comprises administering to a
mammalian cell, such as a primate or human cell infected with HCV,
at least one agent, composition, or construct of the invention, as
described previously herein, including small-hairpin RNAs and
including the encoding expression constructs. The cell in such
embodiments may be a cell culture, or may be an animal model or
patient. In these embodiments, the invention provides a method of
reducing levels of HCV RNA in a cell either in vitro or in vivo, as
well as methods for reducing an HCV titer in vitro or in vivo. In a
preferred aspect, the agent is capable of reducing HCV replication
in a human hepatocyte in an in vitro HCV infection/replication
model such as the recently developed infectious cell culture
systems, which more closely reflect actual human HCV infection. The
JFH-1 HCV clone, utilized in the Examples below, which is able to
replicate efficiently in Huh7 cells and can secrete infectious
viral particles, represents one such improved model. See e.g.,
Zhong et al., Robust hepatitis C virus infection in vitro, PNAS,
102, No. 26, pp 9294-9299, (2005). See also Yi M, Villanueva R A,
Thomas D L, Wakita T, Lemon S M. Production of infectious genotype
1a hepatitis C virus (Hutchinson strain) in cultured human hepatoma
cells. Proc Natl Acad Sci USA 2006; 103(7): 2310-2315. In
accordance with these embodiments, the double-stranded RNA effector
molecules may be introduced into the cell by transforming or
transfecting a cell with an expression construct of the invention,
or alternatively by directly introducing the double stranded
RNA.
[0070] The present invention further provides a method for
treating, ameliorating or preventing HCV infection in a patient
(e.g., a patient having, or at risk of acquiring an HCV infection),
comprising administering to said patient, including primates such
as humans, an effective amount of an agent, composition, or
construct of the invention, suitable for triggering RNAi-mediated
degradation of the patient. Thus, the method of the invention
reduces viral replication in infected cells, and in certain
embodiments, eliminated the infection. The presence of HCV RNA in
the blood is considered to be an indication that the virus is
actively replicating (reproducing and infecting new cells). In some
embodiments, HCV viral load is reduced (by 10%, 20%, 50%, 75%, 90%
or more) in an infected individual administered a sequence-specific
dsRNA of the invention. In some aspects, viral load will be reduced
from high to low levels (less than 2 million copies/mL), desirably
to undetectable levels. It is thought that individuals with viral
load below 400,000 IU/mL respond better to therapeutic agents that
those with higher levels of virus.
[0071] The present invention may, in certain embodiments, employ
the methods disclosed in U.S. Ser. No. 11/935,925
(PCT/US2007/83805), "In Vivo Delivery of Double Stranded RNA to a
Target Cell", which is hereby incorporated by reference in its
entirety. Specifically, delivery into skeletal muscle cells of
expression constructs encoding dsRNA(s) may result in targeted
inhibition of gene expression in other organs and tissues of the
body such as liver. The intramuscular delivery may be achieved in a
variety of ways, including needle or needleless IM injection, IM
injection/electroporation, and intravascular/hydrodynamic delivery.
Without being bound by any particular theory, delivery of dsRNA to
distal tissues such as liver cells, for example, may be mediated by
extracellular vesicles (exovesicles) containing expressed dsRNA or
injected siRNA or shRNA that bud from the surface of transfected
muscle cells.
[0072] The HCV treated by the method of the invention (e.g.,
targeted by the agents, compositions, and constructs described
herein) may be any genotype, subtype, or quasispecies, including
genotypes 1a, 1b, 2a, 2b, 3a, 4 and 5, and combinations thereof. In
certain embodiments, the HCV infection is non-responsive to
interferon-based therapy, and/or other nucleoside analogs such as
ribavirin, or other antivirals, making the methods of the invention
particularly desirable. In other embodiments, the agents,
compositions, and constructs are administered before, during, or
after interferon therapy, where necessary to control or eliminate
infection.
[0073] In certain embodiments, the agents, compositions, and
constructs of the invention are administered so as to inhibit viral
replication without evoking a dsRNA stress response. Further,
unlike traditional antiviral agents, the method of the present
invention may reduce the likelihood that multiple independent
mutational events will produce resistant virus, thereby providing
an important advantage in countering viral variation both within
human and animal host populations and temporally within a host due
to mutation events.
[0074] Some dsRNA sequences, possibly in certain cell types and
through certain delivery methods, may result in an interferon
response. The methods of the invention may be performed so as not
to trigger an interferon/PKR response, for instance by using
shorter dsRNA molecules between 20 to 25 base pairs, by expressing
dsRNA molecules intracellularly, or by using other methods known in
the art. See US Published Application 20040152117, which is herein
incorporated by reference. For instance, one of the components of
an interferon response is the induction of the interferon-induced
protein kinase PKR. To prevent an interferon response, interferon
and PKR responses may be silenced in the transfected and target
cells using a dsRNA species directed against the mRNAs that encode
proteins involved in the response. Alternatively, interferon
response promoters are silenced using dsRNA, or the expression of
proteins or transcription factors that bind interferon response
element (IRE) sequences is abolished using dsRNA or other known
techniques.
[0075] By "under conditions that inhibit or prevent an interferon
response or a dsRNA stress response" is meant conditions that
prevent or inhibit one or more interferon responses or cellular RNA
stress responses involving cell toxicity, cell death, an
anti-proliferative response, or a decreased ability of a dsRNA to
carry out a PTGS event. These responses include, but are not
limited to, interferon induction (both Type 1 and Type II),
induction of one or more interferon stimulated genes, PKR
activation, 2'5'-OAS activation, and any downstream cellular and/or
organismal sequelae that result from the activation/induction of
one or more of these responses. By "organismal sequelae" is meant
any effect(s) in a whole animal, organ, or more locally (e.g., at a
site of injection) caused by the stress response. Exemplary
manifestations include elevated cytokine production, local
inflammation, and necrosis. Desirably the conditions that inhibit
these responses are such that not more than 95%, 90%, 80%, 75%,
60%, 40%, or 25%, and most desirably not more than 10% of the cells
undergo cell toxicity, cell death, or a decreased ability to carry
out a PTGS event, compared to a cell not exposed to such interferon
response inhibiting conditions, all other conditions being equal
(e.g., same cell type, same transformation with the same
dsRNA).
[0076] Apoptosis, interferon induction, 2'5'-OAS
activation/induction, PKR induction/activation, anti-proliferative
responses, and cytopathic effects are all indicators for the RNA
stress response pathway. Exemplary assays that can be used to
measure the induction of an RNA stress response as described herein
include a TUNEL assay to detect apoptotic cells, ELISA assays to
detect the induction of alpha, beta and gamma interferon, ribosomal
RNA fragmentation analysis to detect activation of 2'5'-OAS,
measurement of phosphorylated eIF2a as an indicator of PKR (protein
kinase RNA inducible) activation, proliferation assays to detect
changes in cellular proliferation, and microscopic analysis of
cells to identify cellular cytopathic effects. See, e.g., US
Published Application 20040152117, which is herein incorporated by
reference.
[0077] Methods for Making Agents and Compositions
[0078] The dsRNA molecules and constructs of the invention may be
made using conventional molecular biology techniques, including
standard gene cloning and in vitro RNA synthesis protocols. Such
methods are well known, and are described in Sambrook et al,
Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring
Harbor Laboratory Press (1989); and Ausubel et al., ed. Current
Protocols in Molecular Biology, John Wiley & Sons, Inc.
(1987)). See also the methods taught in U.S. Pat. No. 6,143,527,
"Chain reaction cloning using a bridging oligonucleotide and DNA
ligase".
[0079] The following examples are provided to describe and
illustrate the present invention. As such, they should not be
construed to limit the scope of the invention. Those in the art
will well appreciate that many other embodiments also fall within
the scope of the invention, as it is described hereinabove and in
the claims.
EXAMPLES
[0080] The following Examples are provided for illustration
only.
[0081] All possible 21-mer and 27-mer expressed shRNAs were
constructed based on HCV Conserved Regions 1 (SEQ ID NO: 2), 2 (SEQ
ID NO: 3) and 5 (SEQ ID NO: 4). Thus, for shRNAs targeting
Conserved Region 1, twenty-six 21-mers and sixteen 27-mers were
constructed; for Conserved Region 2, thirty-nine 21-mers and
thirty-three 27-mers were constructed; and for Conserved Region 5,
twenty-eight 21-mers and sixteen 27-mers were constructed.
Example 1
Silencing HCV Replication in a Viral Infection Cell Culture
Model
[0082] A human liver-derived cell line such as the Huh7 cell line
is transfected with an eiRNA plasmid expressing short-hairpin RNA
(shRNA) molecules that comprise sequences homologous and
complementary to the identified conserved sequences in the HCV
genome. Following internalization of the plasmid into hepatocytes
and nuclear localization, transcription of the eiRNA plasmid from
one or more RNA pol III promoters results in production of the
HCV-specific shRNAs.
[0083] The transfected cells are then infected with HCV JFH-1
virus. The JFH-1 clone is able to replicate efficiently in Huh7
cells and can secrete infectious viral particles. See e.g., Zhong
et al., Robust hepatitis C virus infection in vitro, PNAS, 102, No.
26, pp 9294-9299, (2005).
[0084] Using this model, cells were transfected with various eiRNA
constructs and then infected with HCV virus. The cells were then
monitored for loss of HCV replication as described below.
[0085] The following is an example of an experiment that was
performed using eiRNA vectors encoding HCV sequences derived from
GenBank accession number AB047639. HCV sequences in these described
eiRNA vectors were highly conserved sequences identified as
described elsewhere herein. The particular eiRNA backbone vector
used for this experiment contained a 7SK promoter to drive
expression of the encoded RNAs. Each vector encoded only one shRNA.
The shRNA coding sequence was followed by an RNA pol III
termination sequence. Sequences of the 7SK promoter, RNA pol III
termination signal, and encoded shRNAs are all shown at the end of
the example. Similar vectors containing U6 promoters (another RNA
pol III type 3 promoter) and RNA pol III termination signals are
commercially available such as the "siLentGene-2 Cloning Systems"
vector from Promega, Inc., Madison, Wis. One of ordinary skill in
the art can also create them according to the information provided
herein.
Experimental Procedure: Transfection.
[0086] Huh7 cells cultured in DMEM medium were seeded into 96-well
plates at a density of 4.times.10.sup.3 cells/well. All
transfections were performed the day after cell seeding using
Lipofectamine2000.TM. (Invitrogen, Carlsbad, Calif.) according to
the manufacturer's directions. In this experiment, cells were
transfected with 200 ng of the eiRNA plasmids and were infected 12
hours later with HCV infectious viral clone JFH-1 at a multiplicity
of infection (MOI) of 0.1 ffu/cell. DNA was held
constant/transfection at 200 ng. In experiments where less than 200
ng of the eiRNA plasmid was transfected, the remainder of the DNA
is made up by including an inert plasmid DNA, pGL2-Basic (Promega,
Madison Wis.) in amounts that brought the total DNA in the
transfection to 200 ng. Prior to transfection, medium was removed
from the cells and the cells washed with phosphate-buffered saline
(PBS), followed by addition of 100 uL of DMEM containing 10% Fetal
Bovine Serum (FBS). The DNA/Lipofectamine2000 transfection mix was
added to the cells and these were incubated at 37.degree. C. for 12
hours. The medium containing the transfection mix was then removed
and the cells were washed once with PBS. At this point, 100 uL of
DMEM containing 10% FBS was added to the cells. Infection with
JFH-1 then commenced with the addition of the virus at a MOI of 0.1
ffu/cell. All transfections were carried out in triplicate. Control
groups were pGL2-basic alone (200 ng of pGL2-basic), a green
fluorescent protein (GFP) plasmid instead of the eiRNA plasmid (200
ng pGFP), and a group that was untransfected but was infected with
JFH-1 at the same MOI.
Monitoring Cells for Loss of HCV Replication.
[0087] At 48 hours following transfection, cells were monitored for
the loss or reduction in HCV replication by measuring viral RNA by
quantitative reverse-transcription PCR (qRT-PCR). The cells were
lysed using Total RNA Lysis Buffer (Applied Biosystems. Foster
City, Calif.) and the RNA was harvested using an ABI Prism 6100
Nucleic Acid Prep Station (Applied Biosystems). HCV RNA was
quantified by qRT-PCR using a SYBR-green labeled probe. The PCR
primers used to amplify a 75 bp product corresponding the 5' UTR of
the genotype 2a HCV genome (GenBank AB047639) were
5'-TCTGCGGAACCGGTGAGTA-3' (sense) (SEQ ID NO: 82) and
5'-TCAGGCAGTACCACAAGGC-3' (antisense) (SEQ ID NO: 83). The PCR
primers used to amplify a 225 bp product of the human GAPDH coding
sequence (GenBank NM002046) were 5'-GAAGGTGAAGGTCGGAGTC-3' (sense)
(SEQ ID NO: 84) and 5'-GAAGATGGTGATGGGATTTC-3' (antisense) (SEQ ID
NO: 85). HCV and GAPDH transcript levels were determined relative
to a standard curve comprised of serial dilutions of plasmid
containing the HCV cDNA or the human GAPDH gene. HCV copies per ug
of total cellular RNA were normalized to GAPDH transcript levels
using a modified comparative threshold cycle method ddCt
(2''.sup.(ddCt)); where ddCt is the difference between the Average
GAPDH and the GAPDH of the individual sample. Fold reduction in HCV
copy numbers was calculated as: (average number of HCV copies per
ug total cellular RNA in control transfected samples)+(average
number of HCV copies per ug total cellular RNA in eiRNA transfected
samples).
Results:
[0088] A number of the shRNA plasmids transfected led to a decrease
in HCV replication as compared to negative controls. The results in
Table 1 are presented as the average of three plates and are shown
as both fold-inhibition and the equivalent percent reduction.
[0089] A total of 135 eiRNAs (plasmid expressed shRNAs) containing
21-mer double-stranded stem sequences and 118 eiRNAs containing
27-mer double-stranded stem sequences were tested in the assay. The
eiRNAs showing a 4-fold or greater inhibition are listed in Table 1
along with a representative selection of eiRNAs showing less than
4-fold inhibition. The eiRNA vectors encode the HCV sequences
listed in Table 2. The sequences of the shRNAs are shown as well as
the map coordinates of the sense sequence (found 3' to the
underlined 9 nt loop sequence) relative to the HCV JFH-1 clone, Gen
Bank accession number ABO47639 (SEQ ID NO: 1). The sequences of the
encoded shRNAs include an antisense HCV sequence followed by the
loop sequence (underlined in Table 1) followed by a second HCV
sequence, which is the complement to the first HCV sequence. (It
will be understood that either the antisense or sense sequence may
be located 5' to the loop sequence, i.e.,
5'-antisense-loop-sense-3' or 5'-sense-loop-antisense-3'.) The loop
structure does not need to be a fixed sequence or length, and
several loop sequences were used with no significant impact on the
functioning of the eiRNA construct. The second HCV sequence is
followed by a series of T residues, e.g., 1, 2, 3, or more Ts,
preferably at least 4 or 5 Ts, that function as the termination
signal for RNA pol Ill. These T nucleotides are not included in
Table 2.
TABLE-US-00002 TABLE 1 Fold Percent eiRNA inhibition reduction HCV
5' 21-2 1 0 HCV 5' 21-16 1 0 HCV 5' 21-50 1 0 HCV 5'-21-55 5 80 HCV
5'-21-56 5 80 HCV 5'-21-57 5 80 HCV 5'-21-61 7 85.7 HCV 5' 21-63 4
75 HCV 5' 21-70 1 0 HCV 5' 21-73 1 0 HCV 5' 21-88 5 80 HCV 5' 21-89
5 80 HCV 5' 21-90 4 75 HCV 5' 21-92 7 85.7 HCV 5' 21-94 9 88.9 HCV
5'-21-122 4 75 HCV 5'-21-123 4 75 HCV 5'-21-124 7 85.7 HCV
5'-21-125 5 80 HCV 5'-21-126 8 87.5 HCV 5'-21-127 7 85.7 HCV
5'-21-128 8 87.5 HCV 5'-21-129 4 75 HCV 5'-21-130 6 83.3 HCV
5'-21-131 3 67 HCV 5'-21-133 12 91.7 HCV 5'-21-134 9 88.9 HCV
5'-21-135 10 90 HCV 5' 27-1 1 0 HCV 5' 27-8 4 75 HCV 5' 27-9 4 75
HCV 5' 27-12 1 0 HCV 5'-27-16 8 87.5 HCV 5' 27-45 1 0 HCV 5'-27-53
4 75 HCV5'-27-73 1 0 HCV 5' 27-111 1 0
TABLE-US-00003 nucleotide coordinates sense sequence relative
Sequence (5' antisense-loop-sense 3') GenBank No. AB047639
TAGTTCCTCACAGGGGAGTGAagagaacttTCACTCCCCTGTGAGGAACTA 36-56
CCGGTTCCGCAGACCACTATGagagaacttCATAGTGGTCTGCGGAACCGG 50-70
TATGGCTCTCCCGGGAGGGGGagagaacttCCCCCTCCCGGGAGAGCCATA 121-141
ACCACTATGGCTCTCCCGGGAagagaacttTCCCGGGAGAGCCATAGTGGT 126-146
GACCACTATGGCTCTCCCGGGagagaacttCCCGGGAGAGCCATAGTGGTC 127-147
AGACCACTATGGCTCTCCCGGagagaacttCCGGGAGAGCCATAGTGGTCT 128-148
CCGCAGACCACTATGGCTCTCagagaacttGAGAGCCATAGTGGTCTGCGG 132-152
TTCCGCAGACCACTATGGCTCagagaacttGAGCCATAGTGGTCTGCGGAA 134-154
TCACCGGTTCCGCAGACCACTagagaacttAGTGGTCTGCGGAACCGGTGA 141-161
TACTCACCGGTTCCGCAGACCagagaacttGGTCTGCGGAACCGGTGAGTA 144-164
GCAGTACCACAAGGCCTTTCGagagaacttCGAAAGGCCTTGTGGTACTGC 271-291
GGCAGTACCACAAGGCCTTTCagagaacttGAAAGGCCTTGTGGTACTGCC 272-292
AGGCAGTACCACAAGGCCTTTagagaacttAAAGGCCTTGTGGTACTGCCT 274-294
TCAGGCAGTACCACAAGGCCTagagaacttAGGCCTTGTGGTACTGCCTGA 275-295
TATCAGGCAGTACCACAAGGCagagaacttGCCTTGTGGTACTGCCTGATA 277-297
AGACCTCCCGGGGCACTCGCAagagaacttTGCGAGTGCCCCGGGAGGTCT 305-325
GAGACCTCCCGGGGCACTCGCagagaacttGCGAGTGCCCCGGGAGGTCTC 306-326
CGAGACCTCCCGGGGCACTCGagagaacttCGAGTGCCCCGGGAGGTCTCG 307-327
ACGAGACCTCCCGGGGCACTCagagaacttGAGTGCCCCGGGAGGTCTCGT 308-328
TACGAGACCTCCCGGGGCACTagagaacttAGTGCCCCGGGAGGTCTCGTA 309-329
CTACGAGACCTCCCGGGGCACagagaacttGTGCCCCGGGAGGTCTCGTAG 310-330
TCTACGAGACCTCCCGGGGCAagagaacttTGCCCCGGGAGGTCTCGTAGA 311-331
GTCTACGAGACCTCCCGGGGCagagaacttGCCCCGGGAGGTCTCGTAGAC 312-332
GGTCTACGAGACCTCCCGGGGagagaacttCCCCGGGAGGTCTCGTAGACC 313-333
CGGTCTACGAGACCTCCCGGGagagaacttCCCGGGAGGTCTCGTAGACCG 314-334
ACGGTCTACGAGACCTCCCGGagagaacttCCGGGAGGTCTCGTAGACCGT 315-335
CACGGTCTACGAGACCTCCCGagagaacttCGGGAGGTCTCGTAGACCGTG 316-336
GCACGGTCTACGAGACCTCCCagagaacttGGGAGGTCTCGTAGACCGTGC 317-337
TGCACGGTCTACGAGACCTCCagagaacttGGAGGTCTCGTAGACCGTGCA 318-338
GACAGTAGTTCCTCACAGGGGAGTGATagagaacttATCACTCCCCTGTGAGGAACTACTGTC
35-61
GCGTGAAGACAGTAGTTCCTCACAGGGagagaacttCCCTGTGAGGAACTACTGTCTTCACGC
42-68
TGCGTGAAGACAGTAGTTCCTCACAGGagagaacttCCTGTGAGGAACTACTGTCTTCACGCA
43-69
TTCTGCGTGAAGACAGTAGTTCCTCACagagaacttGTGAGGAACTACTGTCTTCACGCAGAA
46-72
CGCTTTCTGCGTGAAGACAGTAGTTCCagagaacttGGAACTACTGTCTTCACGCAGAAAGCG
50-76
GACCACTATGGCTCTCCCGGGAGGGGGagagaacttCCCCCTCCCGGGAGAGCCATAGTGGTC
122-148
GTTCCGCAGACCACTATGGCTCTCCCGagagaacttCGGGAGAGCCATAGTGGTCTGCGGAAC
129-155
CAATTCCGGTGTACTCACCGGTTCCGCagagaacttGCGGAACCGGTGAGTACACCGGAATTG
149-175
TCTACGAGACCTCCCGGGGCACTCGCAagagaacttTGCGAGTGCCCCGGGAGGTCTGGTAGA
305-331
TABLE-US-00004 TABLE 3 eiRNA Sense sequence HCV5'-21-2
tcactcccctgtgaggaacta (SEQ ID NO: 5) HCV5'-21-16
ggaactactgtcttcacgcag (SEQ ID NO: 6) HCV5'-21-50
ccccctcccgggagagccata (SEQ ID NO: 7) HCV5'-21-55
tcccgggagagccatagtggt (SEQ ID NO: 8) HCV5'-21-56
cccgggagagccatagtggtc (SEQ ID NO: 9) HCV5'-21-57
ccgggagagccatagtggtct (SEQ ID NO: 10) HCV5.-21-61
gagagccatagtggtctgcgg (SEQ ID NO: 11) HCV5'-21-63
gagccatagtggtctgcggaa (SEQ ID NO: 12) HCV5'-21-70
agtggtctgcggaaccggtga (SEQ ID NO: 13) HCV5'-21-73
ggtctgcggaaccggtgagta (SEQ ID NO: 14) HCV5'-21-88
cgaaaggccttgtggtactgc (SEQ ID NO: 15) HCV5'-21-89
gaaaggccttgtggtactgcc (SEQ ID NO: 16) HCV5'-21-90
aaaggccttgtggtactgcct (SEQ ID NO: 17) HCV5'-21-92
aggccttgtggtactgcctga (SEQ ID NO: 18) HCV5'-21-94
gccttgtggtactgcctgata (SEQ ID NO: 19) HCV5'-21-122
tgcgactgccccgggaggtct (SEQ ID NO: 20) HCV5'-21-123
gcgagtgccccgggaggtctc (SEQ ID NO: 21) HCV5'-21-124
cgagtgccccgggaggtctcg (SEQ ID NO: 22) HCV5'-21-125
gagtgccccgggaggtctcgt (SEQ ID NO: 23) HCV5'-21-126
agtgccccgggaggtctcgta (SEQ ID NO: 24) HCV5'-21-127
gtgccccgggaggtctcgtag (SEQ ID NO: 25) HCV5'-21-128
tgccccgggaggtctcgtaga (SEQ ID NO: 26) HCV5'-21-129
gccccgggaggtctcgtagac (SEQ ID NO: 27) HCV5'-21-130
ccccgggaggtctcgtagacc (SEQ ID NO: 28) HCV5'-21-131
cccgggaggtctcgtagaccg (SEQ ID NO: 29) HCV5'-21-132
ccgggaggtctcgtagaccgt (SEQ ID NO: 30) HCV5'-21-133
cgggaggtctcgtagaccgtg (SEQ ID NO: 31) HCV5'-21-134
gggaggtctcgtagaccgtgc (SEQ ID NO: 32) HCV5'-21-135
ggaggtctcgtagaccgtgca (SEQ ID NO: 33) HCV5'-27-1
atcactcccctgtgaggaactactgtc SEQ ID NO: 34) HCV5'-27-8
ccctgtgaggaactactgtcttcacgc (SEQ ID NO 35) HCV5'-27-9
cctgtgaggaactactgtcttcacgca (SEQ ID NO: 36) HCV5'-27-12
gtgaggaactactgtcttcacgcagaa (SEQ ID NO: 37) HCV5'-27-16
ggaactactgtcttcacgcagaaagcg (SEQ ID NO: 38) HCV5'-27-45
ccccctcccgggagagccatagtggtc (SEQ ID NO: 39) HCV5'-27-53
cgggagagccatagtggtctgcggaac (SEQ ID NO: 40) HCV5'-27-73
gcggaaccggtgagtacaccggaattg (SEQ ID NO: 41) HCV5'-27-111
tgcgagtgccccgggaggtctcgtaga (SEQ ID NO: 42)
[0090] Preferred for use in anti-HCV dsRNA effector molecules of
the invention are the following conserved and actively inhibitory
HCV sequences:
HCV-5-21-56, SEQ ID NO: 9, and its complement, which may be
utilized as a duplex dsRNA, or as an shRNA, such as that of SEQ.
ID. NO: 48; HCV-5-21-61, SEQ. ID NO: 11, and its complement, which
may be utilized as a duplex dsRNA, or as an shRNA, such as that of
SEQ. ID NO: 50; HCV-5-21-90, SEQ. ID NO: 17, and its complement,
which may be utilized as a duplex dsRNA, or as an shRNA, such as
that of SEQ. ID NO: 56; HCV-5-21-94, SEQ. ID NO: 19, and its
complement, which may be utilized as a duplex dsRNA, or as an
shRNA, such as that of SEQ. ID NO: 58; HCV-5-21-124, SEQ. ID NO:22,
and its complement, which may be utilized as a duplex dsRNA, or as
an shRNA, such as that of SEQ. ID NO: 61; HCV-5-21-128, SEQ. ID NO:
26, and its complement, which may be utilized as a duplex dsRNA, or
as an shRNA, such as that of SEQ. ID NO: 65; HCV-5-21-133, SEQ. ID
NO:31, and its complement, which may be utilized as a duplex dsRNA,
or as an shRNA, such as that of SEQ. ID NO:70; HCV-5-21-134, SEQ.
ID NO: 32, and its complement, which may be utilized as a duplex
dsRNA, or as an shRNA, such as that of SEQ. ID NO:71; HCV-5-21-135,
SEQ. ID NO:33, and its complement, which may be utilized as a
duplex dsRNA, or as an shRNA, such as that of SEQ. ID NO:72;
[0091] In preferred embodiments, two, three, four, five or more of
the above-identified anti-HCV dsRNA effector molecules are
administered concomitantly to a human cell infected with HCV. In
some aspects, an expression construct or constructs encoding such a
plurality of dsRNA effector molecules is/are administered
concomitantly to a human cell infected with HCV. In some aspects
said two or more dsRNA effector molecules will comprise in
double-stranded conformation two or more sequences selected from
SEQ ID NOS: 9, 11, 17, 19, 22, 26, 31, 32, and 33. In some aspects
said two or more dsRNA effector molecules will comprise two or more
sequences selected from SEQ ID NOS: 48, 50, 56, 58, 61, 65, 70, 71,
and 72.
[0092] The actively inhibitory HCV sequences map to four conserved
and highly active target regions (ATR) (see FIG. 1):
ATR-1: 5'-CCCTGTGAGGAACTACTGTCTTCACGCAGAA-3' (SEQ ID NO: 86),
mapping to nucleotide coordinates 42 to 76 of GenBank Accession No.
AB047639, found within Conserved Region 1 (SEQ ID NO: 2). ATR-2:
5'-TCCCGGGAGAGCCATAGTGGTCTGCGGAA-3' (SEQ ID NO: 87), mapping to
nucleotide coordinates 126 to 154 of GenBank Accession No.
AB047639, found within Conserved Region 2 (SEQ ID NO: 3). ATR-3:
5'-CGAAAGGCCTTGTGGTACTGC-3' (SEQ ID NO: 88), mapping to nucleotide
coordinates 271 to 297 of GenBank Accession No. AB047639, found
within Conserved Region 5 (SEQ ID NO: 4). ATR-4:
5'-TGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCA3' (SEQ ID NO: 89), mapping to
nucleotide coordinates 305 to 338 of GenBank Accession No.
AB047639, found within Conserved Region 5 (SEQ ID NO: 4).
Example 2
Silencing HCV Replication Using a Plasmid Expressing Multiple eiRNA
Molecules
[0093] Plasmids expressing multiple eiRNAs (shRNAs) (known as
multi-cistronic plasmids) can be used to inhibit HCV replication in
a cell culture model (as described in Example 1). In this example,
sequences encoding four different shRNA molecules were sequentially
cloned into a single plasmid expression vector, each operably
linked to an individual RNA polymerase III promoter and terminator.
Each shRNA contained a different sequence homologous and
complementary to the HCV genome that was previously shown to
inhibit HCV replication. By expressing several different dsRNA
molecules within an HCV infected cell or a human cell capable of
HCV infection, the eiRNA expression vector represents a multi-drug
regimen having an enhanced ability to inhibit HCV replication and
to prevent the development during therapy of HCV escape
mutants.
[0094] We cloned the genes for four HCV-suppressive shRNAs into a
single plasmid, each operably linked to a different RNA polymerase
III promoter and terminator. The four shRNAs were 1) shRNA SEQ ID
NO: 50, which includes HCV 5'-21-61 (SEQ ID NO: 11) and its
complement; 2) shRNA SEQ ID NO: 58, which includes HCV-5'-21-94
(SEQ. ID NO: 19) and its complement; 3) shRNA SEQ. ID NO: 61, which
includes HCV 5'-21-124 (SEQ. ID NO: 22) and its complement; and 4)
shRNA SEQ. ID NO: 72, which includes HCV 5'21-135 (SEQ. ID NO: 33)
and its complement. (See HCV multi-cistronic plasmid HCV-QJ, FIG.
2), Each shRNA sequence was expressed from a different copy of the
RNA pol III promoter 7SK 4A, although one or more other RNA pol III
type 3 promoters such as 7SK, H1 and/or U6 could also be used. It
may be desirable in some circumstances to select two, three, four
or more different promoters to express two, three, four or more
different dsRNAs of the invention. The quad-cistron plasmid was
constructed essentially as described in WO 2006/0033756 and the 7SK
4A promoter utilized is also described therein. The eiRNAs were
transcribed following intracellular uptake of the plasmid.
[0095] In the same manner as HCV-QJ (described above), other
multi-cistronic plasmids (e.g., including quad-cistron plasmids
HVC-QF, HCV-QG, HCV-QH, and HCV-QK), were constructed using
different combinations of eiRNAs (anti-HCV shRNAs described herein)
that had each been shown to be suppressive of HCV replication in
their original mono-cistronic forms (see Table 4 below).
[0096] Such a mono-cistronic HCV eiRNA expression plasmid (HCV 5'
21-61 eiRNA plasmid, which expresses shRNA SEQ ID NO: 50, which
includes HCV 5'-21-61 (SEQ ID NO: 11) and its complement) is
illustrated in FIG. 3.
[0097] Note that any number of combinations, e.g., two, three,
four, five or more different suppressive eiRNAs, can constitute the
multi-cistronic eiRNA plasmids of the invention. While a
combination of two, three, four or more of such different dsRNA
effector molecules (e.g., duplex and/or hairpin dsRNAs) may be
administered concomitantly to a mammalian cell as a "cocktail" of
exogenously generated RNAs, it is desirable in some aspects to
express them within a target mammalian cell from a multi-cistronic
plasmid as described herein.
TABLE-US-00005 TABLE 4 Multi- cistronic plasmid shRNA sequence and
corresponding HCV sequence HCV-QF HCV 5' 21-56 (SED. ID. NO: 9) and
its complement, expressed as shRNA SEQ ID NO: 48 HCV 5' 21-135
(SEQ. ID NO: 33) and its complement, expressed as shRNA SEQ. ID NO:
72 HCV 5' 21-133 (SEQ. ID NO: 31) and its complement, expressed as
shRNA SEQ. ID NO: 70 HCV 5' 21-61 (SEQ. ID NO: 11) and its
complement, expressed as shRNA SEQ. ID NO: 50 HCV-QG HCV-5-21-94
(SEQ. ID NO: 19) and its complement, expressed as shRNA SEQ. ID NO:
58 HCV 5' 21-135 (SEQ. ID NO: 33) and its complement, expressed as
shRNA SEQ. ID NO: 72 HCV 5' 21-133 (SEQ. ID NO: 31) and its
complement, expressed as shRNA SEQ. ID NO: 70 HCV 5' 21-61 (SEQ. ID
NO: 11) and its complement, expressed as shRNA SEQ. ID NO: 50
HCV-QH HCV-5-21-94 (SEQ. ID NO: 19) and its complement, expressed
as shRNA SEQ. ID NO: 58 HCV-5-21-134 (SEQ. ID NO: 32) and its
complement, expressed as shRNA SEQ. ID NO: 71 HCV-5-21-124 (SEQ. ID
NO: 22) and its complement, expressed as shRNA, SEQ. ID NO: 61 HCV
5' 21-135 (SEQ. ID NO: 33) and its complement, expressed as shRNA
SEQ. ID NO: 72 HCV-QJ HCV-5-21-94 (SEQ. ID NO: 19) and its
complement, expressed as shRNA SEQ. ID NO: 58 HCV 5' 21-61 (SEQ. ID
NO: 11) and its complement, expressed as shRNA SEQ. ID NO: 50
HCV-5-21-124 (SEQ. ID NO: 22)and its complement, expressed as
shRNA, SEQ. ID NO: 61 HCV 5' 21-135 (SEQ. ID NO: 33) and its
complement, expressed as shRNA SEQ. ID NO: 72 HCV-QK HCV-5-21-128
(SEQ. ID NO: 26) and itscomplement, expressed as shRNA SEQ. ID NO:
65 HCV-5-21-134 (SEQ. ID NO: 32) and itscomplement, expressed as
shRNA SEQ. ID NO: 71 HCV 5' 21-133 (SEQ. ID NO: 31) and
itscomplement, expressed as shRNA SEQ. ID NO: 70 HCV 5' 21-135
(SEQ. ID NO: 33) and itscomplement, expressed as shRNA SEQ. ID NO:
72
[0098] The methods that were utilized for transfection of the
multi-cistronic plasmids into Huh7 cells, the subsequent infection
of these cells with HCV and the quantification of HCV mRNA (as a
measure of the suppression of HCV replication) were carried out as
described in Example 1 above.
[0099] Results.
[0100] The suppressive activities that were observed for each of
the multi-cistronic plasmids are shown in Table 5. Not only did the
use of multiple different dsRNA effector molecules produce a very
high level of inhibition of HCV replication, we expect that use of
such combinations of different sequence-specific inhibitors will
have enhanced ability to prevent the development of HCV escape
mutants during therapy.
TABLE-US-00006 TABLE 5 Multi-cistronic Fold- Percent plasmid
inhibition reduction HCV-QF 12 91.7 HCV-QG 11 90.9 HCV-QH 20 95
HCV-QJ 28 96.4 HCV-QK 25 96
[0101] All publications, patents and patent applications discussed
herein are incorporated herein by reference. While in the foregoing
specification this invention has been described in relation to
certain preferred embodiments thereof, and many details have been
set forth for purposes of illustration, it will be apparent to
those skilled in the art that the invention is susceptible to
additional embodiments and that certain of the details described
herein may be varied considerably without departing from the basic
principles of the invention.
Sequence CWU 1
1
8919678DNAHepatitis C virus 1acctgcccct aataggggcg acactccgcc
atgaatcact cccctgtgag gaactactgt 60cttcacgcag aaagcgccta gccatggcgt
tagtatgagt gtcgtacagc ctccaggccc 120ccccctcccg ggagagccat
agtggtctgc ggaaccggtg agtacaccgg aattgccggg 180aagactgggt
cctttcttgg ataaacccac tctatgcccg gccatttggg cgtgcccccg
240caagactgct agccgagtag cgttgggttg cgaaaggcct tgtggtactg
cctgataggg 300cgcttgcgag tgccccggga ggtctcgtag accgtgcacc
atgagcacaa atcctaaacc 360tcaaagaaaa accaaaagaa acaccaaccg
tcgcccagaa gacgttaagt tcccgggcgg 420cggccagatc gttggcggag
tatacttgtt gccgcgcagg ggccccaggt tgggtgtgcg 480cacgacaagg
aaaacttcgg agcggtccca gccacgtggg agacgccagc ccatccccaa
540agatcggcgc tccactggca aggcctgggg aaaaccaggt cgcccctggc
ccctatatgg 600gaatgaggga ctcggctggg caggatggct cctgtccccc
cgaggctctc gcccctcctg 660gggccccact gacccccggc ataggtcgcg
caacgtgggt aaagtcatcg acaccctaac 720gtgtggcttt gccgacctca
tggggtacat ccccgtcgta ggcgccccgc ttagtggcgc 780cgccagagct
gtcgcgcacg gcgtgagagt cctggaggac ggggttaatt atgcaacagg
840gaacctaccc ggtttcccct tttctatctt cttgctggcc ctgttgtcct
gcatcaccgt 900tccggtctct gctgcccagg tgaagaatac cagtagcagc
tacatggtga ccaatgactg 960ctccaatgac agcatcactt ggcagctcga
ggctgcggtt ctccacgtcc ccgggtgcgt 1020cccgtgcgag agagtgggga
atacgtcacg gtgttgggtg ccagtctcgc caaacatggc 1080tgtgcggcag
cccggtgccc tcacgcaggg tctgcggacg cacatcgata tggttgtgat
1140gtccgccacc ttctgctctg ctctctacgt gggggacctc tgtggcgggg
tgatgctcgc 1200ggcccaggtg ttcatcgtct cgccgcagta ccactggttt
gtgcaagaat gcaattgctc 1260catctaccct ggcaccatca ctggacaccg
catggcatgg gacatgatga tgaactggtc 1320gcccacggcc accatgatcc
tggcgtacgt gatgcgcgtc cccgaggtca tcatagacat 1380cgttagcggg
gctcactggg gcgtcatgtt cggcttggcc tacttctcta tgcagggagc
1440gtgggcgaag gtcattgtca tccttctgct ggccgctggg gtggacgcgg
gcaccaccac 1500cgttggaggc gctgttgcac gttccaccaa cgtgattgcc
ggcgtgttca gccatggccc 1560tcagcagaac attcagctca ttaacaccaa
cggcagttgg cacatcaacc gtactgcctt 1620gaattgcaat gactccttga
acaccggctt tctcgcggcc ttgttctaca ccaaccgctt 1680taactcgtca
gggtgtccag ggcgcctgtc cgcctgccgc aacatcgagg ctttccggat
1740agggtggggc accctacagt acgaggataa tgtcaccaat ccagaggata
tgaggccgta 1800ctgctggcac taccccccaa agccgtgtgg cgtagtcccc
gcgaggtctg tgtgtggccc 1860agtgtactgt ttcaccccca gcccggtagt
agtgggcacg accgacagac gtggagtgcc 1920cacctacaca tggggagaga
atgagacaga tgtcttccta ctgaacagca cccgaccgcc 1980gcagggctca
tggttcggct gcacgtggat gaactccact ggtttcacca agacttgtgg
2040cgcgccacct tgccgcacca gagctgactt caacgccagc acggacttgt
tgtgccctac 2100ggattgtttt aggaagcatc ctgatgccac ttatattaag
tgtggttctg ggccctggct 2160cacaccaaag tgcctggtcc actaccctta
cagactctgg cattacccct gcacagtcaa 2220ttttaccatc ttcaagataa
gaatgtatgt agggggggtt gagcacaggc tcacggccgc 2280atgcaacttc
actcgtgggg atcgctgcga cttggaggac agggacagga gtcagctgtc
2340tcctctgttg cactctacca cggaatgggc catcctgccc tgcacctact
cagacttacc 2400cgctttgtca actggtcttc tccaccttca ccagaacatc
gtggacgtac aatacatgta 2460tggcctctca cctgctatca caaaatacgt
cgttcgatgg gagtgggtgg tactcttatt 2520cctgctctta gcggacgcca
gagtctgcgc ctgcttgtgg atgctcatct tgttgggcca 2580ggccgaagca
gcattggaga agttggtcgt cttgcacgct gcgagtgcgg ctaactgcca
2640tggcctccta tattttgcca tcttcttcgt ggcagcttgg cacatcaggg
gtcgggtggt 2700ccccttgacc acctattgcc tcactggcct atggcccttc
tgcctactgc tcatggcact 2760gccccggcag gcttatgcct atgacgcacc
tgtgcacgga cagataggcg tgggtttgtt 2820gatattgatc accctcttca
cactcacccc ggggtataag accctcctcg gccagtgtct 2880gtggtggttg
tgctatctcc tgaccctggg ggaagccatg attcaggagt gggtaccacc
2940catgcaggtg cgcggcggcc gcgatggcat cgcgtgggcc gtcactatat
tctgcccggg 3000tgtggtgttt gacattacca aatggctttt ggcgttgctt
gggcctgctt acctcttaag 3060ggccgctttg acacatgtgc cgtacttcgt
cagagctcac gctctgataa gggtatgcgc 3120tttggtgaag cagctcgcgg
ggggtaggta tgttcaggtg gcgctattgg cccttggcag 3180gtggactggc
acctacatct atgaccacct cacacctatg tcggactggg ccgctagcgg
3240cctgcgcgac ttagcggtcg ccgtggaacc catcatcttc agtccgatgg
agaagaaggt 3300catcgtctgg ggagcggaga cggctgcatg tggggacatt
ctacatggac ttcccgtgtc 3360cgcccgactc ggccaggaga tcctcctcgg
cccagctgat ggctacacct ccaaggggtg 3420gaagctcctt gctcccatca
ctgcttatgc ccagcaaaca cgaggcctcc tgggcgccat 3480agtggtgagt
atgacggggc gtgacaggac agaacaggcc ggggaagtcc aaatcctgtc
3540cacagtctct cagtccttcc tcggaacaac catctcgggg gttttgtgga
ctgtttacca 3600cggagctggc aacaagactc tagccggctt acggggtccg
gtcacgcaga tgtactcgag 3660tgctgagggg gacttggtag gctggcccag
cccccctggg accaagtctt tggagccgtg 3720caagtgtgga gccgtcgacc
tatatctggt cacgcggaac gctgatgtca tcccggctcg 3780gagacgcggg
gacaagcggg gagcattgct ctccccgaga cccatttcga ccttgaaggg
3840gtcctcgggg gggccggtgc tctgccctag gggccacgtc gttgggctct
tccgagcagc 3900tgtgtgctct cggggcgtgg ccaaatccat cgatttcatc
cccgttgaga cactcgacgt 3960tgttacaagg tctcccactt tcagtgacaa
cagcacgcca ccggctgtgc cccagaccta 4020tcaggtcggg tacttgcatg
ctccaactgg cagtggaaag agcaccaagg tccctgtcgc 4080gtatgccgcc
caggggtaca aagtactagt gcttaacccc tcggtagctg ccaccctggg
4140gtttggggcg tacctatcca aggcacatgg catcaatccc aacattagga
ctggagtcag 4200gaccgtgatg accggggagg ccatcacgta ctccacatat
ggcaaatttc tcgccgatgg 4260gggctgcgct agcggcgcct atgacatcat
catatgcgat gaatgccacg ctgtggatgc 4320tacctccatt ctcggcatcg
gaacggtcct tgatcaagca gagacagccg gggtcagact 4380aactgtgctg
gctacggcca caccccccgg gtcagtgaca accccccatc ccgatataga
4440agaggtaggc ctcgggcggg agggtgagat ccccttctat gggagggcga
ttcccctatc 4500ctgcatcaag ggagggagac acctgatttt ctgccactca
aagaaaaagt gtgacgagct 4560cgcggcggcc cttcggggca tgggcttgaa
tgccgtggca tactatagag ggttggacgt 4620ctccataata ccagctcagg
gagatgtggt ggtcgtcgcc accgacgccc tcatgacggg 4680gtacactgga
gactttgact ccgtgatcga ctgcaatgta gcggtcaccc aagctgtcga
4740cttcagcctg gaccccacct tcactataac cacacagact gtcccacaag
acgctgtctc 4800acgcagtcag cgccgcgggc gcacaggtag aggaagacag
ggcacttata ggtatgtttc 4860cactggtgaa cgagcctcag gaatgtttga
cagtgtagtg ctttgtgagt gctacgacgc 4920aggggctgcg tggtacgatc
tcacaccagc ggagaccacc gtcaggctta gagcgtattt 4980caacacgccc
ggcctacccg tgtgtcaaga ccatcttgaa ttttgggagg cagttttcac
5040cggcctcaca cacatagacg cccacttcct ctcccaaaca aagcaagcgg
gggagaactt 5100cgcgtaccta gtagcctacc aagctacggt gtgcgccaga
gccaaggccc ctcccccgtc 5160ctgggacgcc atgtggaagt gcctggcccg
actcaagcct acgcttgcgg gccccacacc 5220tctcctgtac cgtttgggcc
ctattaccaa tgaggtcacc ctcacacacc ctgggacgaa 5280gtacatcgcc
acatgcatgc aagctgacct tgaggtcatg accagcacgt gggtcctagc
5340tggaggagtc ctggcagccg tcgccgcata ttgcctggcg actggatgcg
tttccatcat 5400cggccgcttg cacgtcaacc agcgagtcgt cgttgcgccg
gataaggagg tcctgtatga 5460ggcttttgat gagatggagg aatgcgcctc
tagggcggct ctcatcgaag aggggcagcg 5520gatagccgag atgttgaagt
ccaagatcca aggcttgctg cagcaggcct ctaagcaggc 5580ccaggacata
caacccgcta tgcaggcttc atggcccaaa gtggaacaat tttgggccag
5640acacatgtgg aacttcatta gcggcatcca atacctcgca ggattgtcaa
cactgccagg 5700gaaccccgcg gtggcttcca tgatggcatt cagtgccgcc
ctcaccagtc cgttgtcgac 5760cagtaccacc atccttctca acatcatggg
aggctggtta gcgtcccaga tcgcaccacc 5820cgcgggggcc accggctttg
tcgtcagtgg cctggtgggg gctgccgtgg gcagcatagg 5880cctgggtaag
gtgctggtgg acatcctggc aggatatggt gcgggcattt cgggggccct
5940cgtcgcattc aagatcatgt ctggcgagaa gccctctatg gaagatgtca
tcaatctact 6000gcctgggatc ctgtctccgg gagccctggt ggtgggggtc
atctgcgcgg ccattctgcg 6060ccgccacgtg ggaccggggg agggcgcggt
ccaatggatg aacaggctta ttgcctttgc 6120ttccagagga aaccacgtcg
cccctactca ctacgtgacg gagtcggatg cgtcgcagcg 6180tgtgacccaa
ctacttggct ctcttactat aaccagccta ctcagaagac tccacaattg
6240gataactgag gactgcccca tcccatgctc cggatcctgg ctccgcgacg
tgtgggactg 6300ggtttgcacc atcttgacag acttcaaaaa ttggctgacc
tctaaattgt tccccaagct 6360gcccggcctc cccttcatct cttgtcaaaa
ggggtacaag ggtgtgtggg ccggcactgg 6420catcatgacc acgcgctgcc
cttgcggcgc caacatctct ggcaatgtcc gcctgggctc 6480tatgaggatc
acagggccta aaacctgcat gaacacctgg caggggacct ttcctatcaa
6540ttgctacacg gagggccagt gcgcgccgaa accccccacg aactacaaga
ccgccatctg 6600gagggtggcg gcctcggagt acgcggaggt gacgcagcat
gggtcgtact cctatgtaac 6660aggactgacc actgacaatc tgaaaattcc
ttgccaacta ccttctccag agtttttctc 6720ctgggtggac ggtgtgcaga
tccataggtt tgcacccaca ccaaagccgt ttttccggga 6780tgaggtctcg
ttctgcgttg ggcttaattc ctatgctgtc gggtcccagc ttccctgtga
6840acctgagccc gacgcagacg tattgaggtc catgctaaca gatccgcccc
acatcacggc 6900ggagactgcg gcgcggcgct tggcacgggg atcacctcca
tctgaggcga gctcctcagt 6960gagccagcta tcagcaccgt cgctgcgggc
cacctgcacc acccacagca acacctatga 7020cgtggacatg gtcgatgcca
acctgctcat ggagggcggt gtggctcaga cagagcctga 7080gtccagggtg
cccgttctgg actttctcga gccaatggcc gaggaagaga gcgaccttga
7140gccctcaata ccatcggagt gcatgctccc caggagcggg tttccacggg
ccttaccggc 7200ttgggcacgg cctgactaca acccgccgct cgtggaatcg
tggaggaggc cagattacca 7260accgcccacc gttgctggtt gtgctctccc
cccccccaag aaggccccga cgcctccccc 7320aaggagacgc cggacagtgg
gtctgagcga gagcaccata tcagaagccc tccagcaact 7380ggccatcaag
acctttggcc agcccccctc gagcggtgat gcaggctcgt ccacgggggc
7440gggcgccgcc gaatccggcg gtccgacgtc ccctggtgag ccggccccct
cagagacagg 7500ttccgcctcc tctatgcccc ccctcgaggg ggagcctgga
gatccggacc tggagtctga 7560tcaggtagag cttcaacctc ccccccaggg
ggggggggta gctcccggtt cgggctcggg 7620gtcttggtct acttgctccg
aggaggacga taccaccgtg tgctgctcca tgtcatactc 7680ctggaccggg
gctctaataa ctccctgtag ccccgaagag gaaaagttgc caatcaaccc
7740tttgagtaac tcgctgttgc gataccataa caaggtgtac tgtacaacat
caaagagcgc 7800ctcacagagg gctaaaaagg taacttttga caggacgcaa
gtgctcgacg cccattatga 7860ctcagtctta aaggacatca agctagcggc
ttccaaggtc agcgcaaggc tcctcacctt 7920ggaggaggcg tgccagttga
ctccacccca ttctgcaaga tccaagtatg gattcggggc 7980caaggaggtc
cgcagcttgt ccgggagggc cgttaaccac atcaagtccg tgtggaagga
8040cctcctggaa gacccacaaa caccaattcc cacaaccatc atggccaaaa
atgaggtgtt 8100ctgcgtggac cccgccaagg ggggtaagaa accagctcgc
ctcatcgttt accctgacct 8160cggcgtccgg gtctgcgaga aaatggccct
ctatgacatt acacaaaagc ttcctcaggc 8220ggtaatggga gcttcctatg
gcttccagta ctcccctgcc caacgggtgg agtatctctt 8280gaaagcatgg
gcggaaaaga aggaccccat gggtttttcg tatgataccc gatgcttcga
8340ctcaaccgtc actgagagag acatcaggac cgaggagtcc atataccagg
cctgctccct 8400gcccgaggag gcccgcactg ccatacactc gctgactgag
agactttacg taggagggcc 8460catgttcaac agcaagggtc aaacctgcgg
ttacagacgt tgccgcgcca gcggggtgct 8520aaccactagc atgggtaaca
ccatcacatg ctatgtgaaa gccctagcgg cctgcaaggc 8580tgcggggata
gttgcgccca caatgctggt atgcggcgat gacctagtag tcatctcaga
8640aagccagggg actgaggagg acgagcggaa cctgagagcc ttcacggagg
ccatgaccag 8700gtactctgcc cctcctggtg atccccccag accggaatat
gacctggagc taataacatc 8760ctgttcctca aatgtgtctg tggcgttggg
cccgcggggc cgccgcagat actacctgac 8820cagagaccca accactccac
tcgcccgggc tgcctgggaa acagttagac actcccctat 8880caattcatgg
ctgggaaaca tcatccagta tgctccaacc atatgggttc gcatggtcct
8940aatgacacac ttcttctcca ttctcatggt ccaagacacc ctggaccaga
acctcaactt 9000tgagatgtat ggatcagtat actccgtgaa tcctttggac
cttccagcca taattgagag 9060gttacacggg cttgacgcct tttctatgca
cacatactct caccacgaac tgacgcgggt 9120ggcttcagcc ctcagaaaac
ttggggcgcc acccctcagg gtgtggaaga gtcgggctcg 9180cgcagtcagg
gcgtccctca tctcccgtgg agggaaagcg gccgtttgcg gccgatatct
9240cttcaattgg gcggtgaaga ccaagctcaa actcactcca ttgccggagg
cgcgcctact 9300ggacttatcc agttggttca ccgtcggcgc cggcgggggc
gacatttttc acagcgtgtc 9360gcgcgcccga ccccgctcat tactcttcgg
cctactccta cttttcgtag gggtaggcct 9420cttcctactc cccgctcggt
agagcggcac acactaggta cactccatag ctaactgttc 9480cttttttttt
tttttttttt tttttttttt tttttttttt ttttcttttt tttttttttc
9540cctctttctt cccttctcat cttattctac tttctttctt ggtggctcca
tcttagccct 9600agtcacggct agctgtgaaa ggtccgtgag ccgcatgact
gcagagagtg ccgtaactgg 9660tctctctgca gatcatgt 9678268DNAHepatitis C
virus 2atcactcccc tgtgaggaac tactgtcttc acgcagaaag cgcctagcca
tggcgttagt 60atgagtgt 68358DNAHepatitis C virus 3ccccccctcc
cgggagagcc atagtggtct gcggaaccgg tgagtacacc ggaattgc
58469DNAHepatitis C virus 4gcgaaaggcc ttgtggtact gcctgatagg
gcgcttgcga gtgccccggg aggtctcgta 60gaccgtgca 69521DNAHepatitis C
virus 5tcactcccct gtgaggaact a 21621DNAHepatitis C virus
6ggaactactg tcttcacgca g 21721DNAHepatitis C virus 7ccccctcccg
ggagagccat a 21821DNAHepatitis C virus 8tcccgggaga gccatagtgg t
21921DNAHepatitis C virus 9cccgggagag ccatagtggt c
211021DNAHepatitis C virus 10ccgggagagc catagtggtc t
211121DNAHepatitis C virus 11gagagccata gtggtctgcg g
211221DNAHepatitis C virus 12gagccatagt ggtctgcgga a
211321DNAHepatitis C virus 13agtggtctgc ggaaccggtg a
211421DNAHepatitis C virus 14ggtctgcgga accggtgagt a
211521DNAHepatitis C virus 15cgaaaggcct tgtggtactg c
211621DNAHepatitis C virus 16gaaaggcctt gtggtactgc c
211721DNAHepatitis C virus 17aaaggccttg tggtactgcc t
211821DNAHepatitis C virus 18aggccttgtg gtactgcctg a
211921DNAHepatitis C virus 19gccttgtggt actgcctgat a
212021DNAHepatitis C virus 20tgcgagtgcc ccgggaggtc t
212121DNAHepatitis C virus 21gcgagtgccc cgggaggtct c
212221DNAHepatitis C virus 22cgagtgcccc gggaggtctc g
212321DNAHepatitis C virus 23gagtgccccg ggaggtctcg t
212421DNAHepatitis C virus 24agtgccccgg gaggtctcgt a
212521DNAHepatitis C virus 25gtgccccggg aggtctcgta g
212621DNAHepatitis C virus 26tgccccggga ggtctcgtag a
212721DNAHepatitis C virus 27gccccgggag gtctcgtaga c
212821DNAHepatitis C virus 28ccccgggagg tctcgtagac c
212921DNAHepatitis C virus 29cccgggaggt ctcgtagacc g
213021DNAHepatitis C virus 30ccgggaggtc tcgtagaccg t
213121DNAHepatitis C virus 31cgggaggtct cgtagaccgt g
213221DNAHepatitis C virus 32gggaggtctc gtagaccgtg c
213321DNAHepatitis C virus 33ggaggtctcg tagaccgtgc a
213427DNAHepatitis C virus 34atcactcccc tgtgaggaac tactgtc
273527DNAHepatitis C virus 35ccctgtgagg aactactgtc ttcacgc
273627DNAHepatitis C virus 36cctgtgagga actactgtct tcacgca
273727DNAHepatitis C virus 37gtgaggaact actgtcttca cgcagaa
273827DNAHepatitis C virus 38ggaactactg tcttcacgca gaaagcg
273927DNAHepatitis C virus 39ccccctcccg ggagagccat agtggtc
274027DNAHepatitis C virus 40cgggagagcc atagtggtct gcggaac
274127DNAHepatitis C virus 41gcggaaccgg tgagtacacc ggaattg
274227DNAHepatitis C virus 42tgcgagtgcc ccgggaggtc tcgtaga
27439DNAUnknownDescription of Unknown Exemplary loop sequence
43agagaactt 94451DNAHepatitis C virus 44tagttcctca caggggagtg
aagagaactt tcactcccct gtgaggaact a 514551DNAHepatitis C virus
45ccggttccgc agaccactat gagagaactt catagtggtc tgcggaaccg g
514651DNAHepatitis C virus 46tatggctctc ccgggagggg gagagaactt
ccccctcccg ggagagccat a 514751DNAHepatitis C virus 47accactatgg
ctctcccggg aagagaactt tcccgggaga gccatagtgg t 514851DNAHepatitis C
virus 48gaccactatg gctctcccgg gagagaactt cccgggagag ccatagtggt c
514951DNAHepatitis C virus 49agaccactat ggctctcccg gagagaactt
ccgggagagc catagtggtc t 515051DNAHepatitis C virus 50ccgcagacca
ctatggctct cagagaactt gagagccata gtggtctgcg g 515151DNAHepatitis C
virus 51ttccgcagac cactatggct cagagaactt gagccatagt ggtctgcgga a
515251DNAHepatitis C virus 52tcaccggttc cgcagaccac tagagaactt
agtggtctgc ggaaccggtg a 515351DNAHepatitis C virus 53tactcaccgg
ttccgcagac cagagaactt ggtctgcgga accggtgagt a 515451DNAHepatitis C
virus 54gcagtaccac aaggcctttc gagagaactt cgaaaggcct tgtggtactg c
515551DNAHepatitis C virus 55ggcagtacca caaggccttt cagagaactt
gaaaggcctt gtggtactgc c 515651DNAHepatitis C virus 56aggcagtacc
acaaggcctt tagagaactt aaaggccttg tggtactgcc t 515751DNAHepatitis C
virus 57tcaggcagta ccacaaggcc tagagaactt aggccttgtg gtactgcctg a
515851DNAHepatitis C virus 58tatcaggcag taccacaagg cagagaactt
gccttgtggt actgcctgat a 515951DNAHepatitis C virus 59agacctcccg
gggcactcgc aagagaactt tgcgagtgcc ccgggaggtc t 516051DNAHepatitis C
virus 60gagacctccc ggggcactcg cagagaactt gcgagtgccc
cgggaggtct c 516151DNAHepatitis C virus 61cgagacctcc cggggcactc
gagagaactt cgagtgcccc gggaggtctc g 516251DNAHepatitis C virus
62acgagacctc ccggggcact cagagaactt gagtgccccg ggaggtctcg t
516351DNAHepatitis C virus 63tacgagacct cccggggcac tagagaactt
agtgccccgg gaggtctcgt a 516451DNAHepatitis C virus 64ctacgagacc
tcccggggca cagagaactt gtgccccggg aggtctcgta g 516551DNAHepatitis C
virus 65tctacgagac ctcccggggc aagagaactt tgccccggga ggtctcgtag a
516651DNAHepatitis C virus 66gtctacgaga cctcccgggg cagagaactt
gccccgggag gtctcgtaga c 516751DNAHepatitis C virus 67ggtctacgag
acctcccggg gagagaactt ccccgggagg tctcgtagac c 516851DNAHepatitis C
virus 68cggtctacga gacctcccgg gagagaactt cccgggaggt ctcgtagacc g
516951DNAHepatitis C virus 69acggtctacg agacctcccg gagagaactt
ccgggaggtc tcgtagaccg t 517051DNAHepatitis C virus 70cacggtctac
gagacctccc gagagaactt cgggaggtct cgtagaccgt g 517151DNAHepatitis C
virus 71gcacggtcta cgagacctcc cagagaactt gggaggtctc gtagaccgtg c
517251DNAHepatitis C virus 72tgcacggtct acgagacctc cagagaactt
ggaggtctcg tagaccgtgc a 517363DNAHepatitis C virus 73gacagtagtt
cctcacaggg gagtgataga gaacttatca ctcccctgtg aggaactact 60gtc
637463DNAHepatitis C virus 74gcgtgaagac agtagttcct cacagggaga
gaacttccct gtgaggaact actgtcttca 60cgc 637563DNAHepatitis C virus
75tgcgtgaaga cagtagttcc tcacaggaga gaacttcctg tgaggaacta ctgtcttcac
60gca 637663DNAHepatitis C virus 76ttctgcgtga agacagtagt tcctcacaga
gaacttgtga ggaactactg tcttcacgca 60gaa 637763DNAHepatitis C virus
77cgctttctgc gtgaagacag tagttccaga gaacttggaa ctactgtctt cacgcagaaa
60gcg 637863DNAHepatitis C virus 78gaccactatg gctctcccgg gagggggaga
gaacttcccc ctcccgggag agccatagtg 60gtc 637963DNAHepatitis C virus
79gttccgcaga ccactatggc tctcccgaga gaacttcggg agagccatag tggtctgcgg
60aac 638063DNAHepatitis C virus 80caattccggt gtactcaccg gttccgcaga
gaacttgcgg aaccggtgag tacaccggaa 60ttg 638163DNAHepatitis C virus
81tctacgagac ctcccggggc actcgcaaga gaactttgcg agtgccccgg gaggtctcgt
60aga 638219DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 82tctgcggaac cggtgagta
198319DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 83tcaggcagta ccacaaggc 198419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
84gaaggtgaag gtcggagtc 198520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 85gaagatggtg atgggatttc
208631DNAHepatitis C virus 86ccctgtgagg aactactgtc ttcacgcaga a
318729DNAHepatitis C virus 87tcccgggaga gccatagtgg tctgcggaa
298821DNAHepatitis C virus 88cgaaaggcct tgtggtactg c
218934DNAHepatitis C virus 89tgcgagtgcc ccgggaggtc tcgtagaccg tgca
34
* * * * *